--- license: apache-2.0 base_model: - zhihan1996/DNABERT-2-117M tags: - biology - medical --- #### Citation If you find the model useful in your research, we ask that you cite the relevant paper: - Nakamae *et al*. Risk Prediction of RNA Off-Targets of CRISPR Base Editors in Tissue-Specific Transcriptomes Using Language Models. *International Journal of Molecular Sciences* **2025**, 26(4), 1723.; [DOI: 10.3390/ijms26041723](https://doi.org/10.3390/ijms26041723) --- This is one of the fine-tuned models, named RNAOffScan v2 (previously named as SNL model), from [zhihan1996/DNABERT-2-117M ](https://huggingface.co/zhihan1996/DNABERT-2-117M). The RNAOffScan v2 can predict the RNA offtarget induced by cytosine base editors (CBEs). Here is an example of using the model for RNA-off-target prediction. **pred_rna_offtarget.py:** ```python import sys import numpy as np import torch from transformers import AutoTokenizer, AutoModelForSequenceClassification __authors__ = ["Kazuki Nakamae"] __version__ = "1.0.0" def pred_rna_offtarget(dna, model_dir): try: device = torch.device("cuda" if torch.cuda.is_available() else "cpu") tokenizer = AutoTokenizer.from_pretrained(model_dir, trust_remote_code=True) model = AutoModelForSequenceClassification.from_pretrained(model_dir, trust_remote_code=True).to(device) except Exception as e: print(f"Error loading model from {model_dir}: {e}") sys.exit(1) inputs = tokenizer(dna, return_tensors='pt') model.eval() with torch.no_grad(): outputs = model( inputs["input_ids"].to(device), inputs["attention_mask"].to(device), ) print("[Negative, Positive]") print(outputs.logits) y_preds = np.argmax(outputs.logits.to('cpu').detach().numpy().copy(), axis=1) def id2label(x): return model.config.id2label[x] y_dash = [id2label(x) for x in y_preds] print("Result:") print(y_dash) # LABEL_0: Not RNA-offtarget / LABEL_1: RNA-offtarget return (dna, y_dash) def print_usage(): print(f"Usage: {sys.argv[0]} ") print("Options:") print(" -h, --help Show this help message and exit") print(" -v, --version Show version information and exit") def print_version(): print(f"{sys.argv[0]} version {__version__}") print("Authors:", ", ".join(__authors__)) if __name__ == "__main__": if len(sys.argv) != 3: if len(sys.argv) == 2 and sys.argv[1] in ("-h", "--help"): print_usage() sys.exit(0) elif len(sys.argv) == 2 and sys.argv[1] in ("-v", "--version"): print_version() sys.exit(0) else: print_usage() sys.exit(1) dna = sys.argv[1] model_dir = sys.argv[2] pred_rna_offtarget(dna, model_dir) ``` ```bash $ python pred_rna_offtarget.py GGCAGGGCTGGGGAAGCTTACTGTGTCCAAGAGCCTGCTG KazukiNakamae/SNLmodel; [Negative, Positive] tensor([[-0.7521, 0.4817]]) Result: ['LABEL_1'] $ python pred_rna_offtarget.py GTCATCTAACAAAAATATTCCGTTGCAGGAAAAGCAAGCT KazukiNakamae/SNLmodel; [Negative, Positive] tensor([[ 0.9211, -0.8157]]) Result: ['LABEL_0'] ``` #### Developers of the fine-tuned model - [Takayuki Suzuki](https://github.com/szktkyk) - [Kazuki Nakamae](https://github.com/KazukiNakamae)