File size: 37,092 Bytes
82732bd |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 |
{
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"id": "0e5f2abf",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:04.711942Z",
"iopub.status.busy": "2025-03-25T05:14:04.711438Z",
"iopub.status.idle": "2025-03-25T05:14:04.885534Z",
"shell.execute_reply": "2025-03-25T05:14:04.885179Z"
}
},
"outputs": [],
"source": [
"import sys\n",
"import os\n",
"sys.path.append(os.path.abspath(os.path.join(os.getcwd(), '../..')))\n",
"\n",
"# Path Configuration\n",
"from tools.preprocess import *\n",
"\n",
"# Processing context\n",
"trait = \"Esophageal_Cancer\"\n",
"cohort = \"GSE77790\"\n",
"\n",
"# Input paths\n",
"in_trait_dir = \"../../input/GEO/Esophageal_Cancer\"\n",
"in_cohort_dir = \"../../input/GEO/Esophageal_Cancer/GSE77790\"\n",
"\n",
"# Output paths\n",
"out_data_file = \"../../output/preprocess/Esophageal_Cancer/GSE77790.csv\"\n",
"out_gene_data_file = \"../../output/preprocess/Esophageal_Cancer/gene_data/GSE77790.csv\"\n",
"out_clinical_data_file = \"../../output/preprocess/Esophageal_Cancer/clinical_data/GSE77790.csv\"\n",
"json_path = \"../../output/preprocess/Esophageal_Cancer/cohort_info.json\"\n"
]
},
{
"cell_type": "markdown",
"id": "8810f510",
"metadata": {},
"source": [
"### Step 1: Initial Data Loading"
]
},
{
"cell_type": "code",
"execution_count": 2,
"id": "18729a2a",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:04.887218Z",
"iopub.status.busy": "2025-03-25T05:14:04.887042Z",
"iopub.status.idle": "2025-03-25T05:14:05.070065Z",
"shell.execute_reply": "2025-03-25T05:14:05.069711Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Background Information:\n",
"!Series_title\t\"Differentially expressed genes after miRNA or siRNA transfection in human cancer cell lines II\"\n",
"!Series_summary\t\"To identify differentially expressed genes by anti cancer treatments (microRNAs or siRNAs) in human cancer, several cell lines (pancreatic cancer, esophageal cancer, bladder cancer, prostate cancer, renal cell carcinoma and lung squamous cell carcinoma) were subjected to Agilent whole genome microarrays.\"\n",
"!Series_overall_design\t\"Human cell lines (Panc-1, sw1990, TE8, TE9, A549, MRC-5, BOY, T24, PC3, C4-2, 786-O, A-498 and EBC-1) were treated with miRNAs (miR-375, miR-29a, miR-26a, miR-145-5p, miR-145-3p, miR-218, miR-320a), siRNAs (si-MMP11, si-LAMP1, si-LOXL2, si-PLOD2, si-UHRF1, and si-FOXM1).\"\n",
"Sample Characteristics Dictionary:\n",
"{0: ['cell line: EBC-1', 'cell line: C4-2', 'cell line: PC3', 'cell line: A-498', 'cell line: 786-O', 'cell line: BOY', 'cell line: T24', 'cell line: A549', 'cell line: MRC-5', 'cell line: Panc-1', 'cell line: sw1990', 'cell line: TE8', 'cell line: TE9'], 1: ['cell type: lung squamous cell carcinoma', 'cell type: prostate cancer', 'cell type: bladder cancer', 'cell type: renal cell carcinoma', 'cell type: lung fibroblast', 'cell type: pancreatic cancer', 'cell type: esophageal cancer'], 2: ['transfection: no transfection']}\n"
]
}
],
"source": [
"from tools.preprocess import *\n",
"# 1. Identify the paths to the SOFT file and the matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Read the matrix file to obtain background information and sample characteristics data\n",
"background_prefixes = ['!Series_title', '!Series_summary', '!Series_overall_design']\n",
"clinical_prefixes = ['!Sample_geo_accession', '!Sample_characteristics_ch1']\n",
"background_info, clinical_data = get_background_and_clinical_data(matrix_file, background_prefixes, clinical_prefixes)\n",
"\n",
"# 3. Obtain the sample characteristics dictionary from the clinical dataframe\n",
"sample_characteristics_dict = get_unique_values_by_row(clinical_data)\n",
"\n",
"# 4. Explicitly print out all the background information and the sample characteristics dictionary\n",
"print(\"Background Information:\")\n",
"print(background_info)\n",
"print(\"Sample Characteristics Dictionary:\")\n",
"print(sample_characteristics_dict)\n"
]
},
{
"cell_type": "markdown",
"id": "53d60589",
"metadata": {},
"source": [
"### Step 2: Dataset Analysis and Clinical Feature Extraction"
]
},
{
"cell_type": "code",
"execution_count": 3,
"id": "f56bf704",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:05.071289Z",
"iopub.status.busy": "2025-03-25T05:14:05.071168Z",
"iopub.status.idle": "2025-03-25T05:14:05.078318Z",
"shell.execute_reply": "2025-03-25T05:14:05.078014Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Clinical Data Preview:\n",
"{0: [0.0]}\n",
"Clinical data saved to ../../output/preprocess/Esophageal_Cancer/clinical_data/GSE77790.csv\n"
]
}
],
"source": [
"# 1. Gene Expression Data Analysis\n",
"# Based on the background information, this dataset appears to be gene expression data\n",
"# from microarray analysis, which is suitable for our study.\n",
"is_gene_available = True\n",
"\n",
"# 2. Clinical Features Analysis\n",
"# 2.1 Data Availability\n",
"# For trait (esophageal cancer), we can use the cell type information (row 1)\n",
"# For age and gender, there's no information in the sample characteristics\n",
"trait_row = 1\n",
"age_row = None # No age data available\n",
"gender_row = None # No gender data available\n",
"\n",
"# 2.2 Data Type Conversion Functions\n",
"def convert_trait(value):\n",
" \"\"\"Convert cell type to binary trait (esophageal cancer or not)\"\"\"\n",
" if not isinstance(value, str):\n",
" return None\n",
" \n",
" # Extract the value after the colon\n",
" if ':' in value:\n",
" value = value.split(':', 1)[1].strip().lower()\n",
" \n",
" # Check if it's esophageal cancer\n",
" if 'esophageal cancer' in value:\n",
" return 1\n",
" else:\n",
" return 0\n",
"\n",
"def convert_age(value):\n",
" # Not used, as age data is not available\n",
" return None\n",
"\n",
"def convert_gender(value):\n",
" # Not used, as gender data is not available\n",
" return None\n",
"\n",
"# 3. Save Metadata\n",
"# Check if trait data is available (trait_row is not None)\n",
"is_trait_available = trait_row is not None\n",
"validate_and_save_cohort_info(\n",
" is_final=False, \n",
" cohort=cohort, \n",
" info_path=json_path, \n",
" is_gene_available=is_gene_available, \n",
" is_trait_available=is_trait_available\n",
")\n",
"\n",
"# 4. Clinical Feature Extraction\n",
"# Only execute if trait_row is not None\n",
"if trait_row is not None:\n",
" # Create a DataFrame from the sample characteristics dictionary provided in the previous output\n",
" sample_characteristics_dict = {\n",
" 0: ['cell line: EBC-1', 'cell line: C4-2', 'cell line: PC3', 'cell line: A-498', \n",
" 'cell line: 786-O', 'cell line: BOY', 'cell line: T24', 'cell line: A549', \n",
" 'cell line: MRC-5', 'cell line: Panc-1', 'cell line: sw1990', 'cell line: TE8', \n",
" 'cell line: TE9'],\n",
" 1: ['cell type: lung squamous cell carcinoma', 'cell type: prostate cancer', \n",
" 'cell type: bladder cancer', 'cell type: renal cell carcinoma', \n",
" 'cell type: lung fibroblast', 'cell type: pancreatic cancer', \n",
" 'cell type: esophageal cancer'],\n",
" 2: ['transfection: no transfection']\n",
" }\n",
" \n",
" import pandas as pd\n",
" # Creating the clinical_data DataFrame from the dictionary\n",
" # We need to transpose the data to get samples as rows and features as columns\n",
" clinical_data = pd.DataFrame({col: values for col, values in enumerate(list(zip(*[values for values in sample_characteristics_dict.values()])))})\n",
" \n",
" # Extract clinical features\n",
" selected_clinical_df = geo_select_clinical_features(\n",
" clinical_df=clinical_data,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
" )\n",
" \n",
" # Preview the data\n",
" preview = preview_df(selected_clinical_df)\n",
" print(\"Clinical Data Preview:\")\n",
" print(preview)\n",
" \n",
" # Save clinical features to CSV\n",
" os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
" selected_clinical_df.to_csv(out_clinical_data_file, index=False)\n",
" print(f\"Clinical data saved to {out_clinical_data_file}\")\n"
]
},
{
"cell_type": "markdown",
"id": "0d658b99",
"metadata": {},
"source": [
"### Step 3: Gene Data Extraction"
]
},
{
"cell_type": "code",
"execution_count": 4,
"id": "80cef9dc",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:05.079492Z",
"iopub.status.busy": "2025-03-25T05:14:05.079380Z",
"iopub.status.idle": "2025-03-25T05:14:05.372105Z",
"shell.execute_reply": "2025-03-25T05:14:05.371720Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Found data marker at line 81\n",
"Header line: \"ID_REF\"\t\"GSM2059404\"\t\"GSM2059405\"\t\"GSM2059406\"\t\"GSM2059407\"\t\"GSM2059408\"\t\"GSM2059409\"\t\"GSM2059410\"\t\"GSM2059411\"\t\"GSM2059412\"\t\"GSM2059413\"\t\"GSM2059414\"\t\"GSM2059415\"\t\"GSM2059416\"\t\"GSM2059417\"\t\"GSM2059418\"\t\"GSM2059419\"\t\"GSM2059420\"\t\"GSM2059421\"\t\"GSM2059422\"\t\"GSM2059423\"\t\"GSM2059424\"\t\"GSM2059425\"\t\"GSM2059426\"\t\"GSM2059427\"\t\"GSM2059428\"\t\"GSM2059429\"\t\"GSM2059430\"\t\"GSM2059431\"\t\"GSM2059432\"\t\"GSM2059433\"\t\"GSM2059434\"\t\"GSM2059435\"\n",
"First data line: 1\t-1.492678368e-001\t9.385965497e-002\t-8.941784384e-002\t-1.349943700e-002\t-1.599001264e-002\t-8.062755446e-002\t-5.685066626e-002\t3.483449753e-002\t1.110190735e-002\t-1.109288193e-002\t-3.863425129e-002\t-4.031110222e-002\t3.436493922e-002\t6.242996551e-002\t-3.869467488e-002\t-2.818536224e-004\t-6.648348866e-002\t-7.110430995e-002\t-1.601804138e-003\t-6.578105194e-002\t-9.610465045e-004\t3.293553993e-002\t5.540124407e-002\t-7.305230142e-002\t-1.253722506e-002\t-6.620679603e-003\t-7.651308691e-002\t-5.726181154e-002\t-2.069165415e-002\t9.842492290e-003\t4.916461191e-002\t3.215693397e-002\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Index(['1', '2', '3', '4', '5', '6', '7', '8', '9', '10', '11', '12', '13',\n",
" '14', '15', '16', '17', '18', '19', '20'],\n",
" dtype='object', name='ID')\n"
]
}
],
"source": [
"# 1. Get the file paths for the SOFT file and matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. First, let's examine the structure of the matrix file to understand its format\n",
"import gzip\n",
"\n",
"# Peek at the first few lines of the file to understand its structure\n",
"with gzip.open(matrix_file, 'rt') as file:\n",
" # Read first 100 lines to find the header structure\n",
" for i, line in enumerate(file):\n",
" if '!series_matrix_table_begin' in line:\n",
" print(f\"Found data marker at line {i}\")\n",
" # Read the next line which should be the header\n",
" header_line = next(file)\n",
" print(f\"Header line: {header_line.strip()}\")\n",
" # And the first data line\n",
" first_data_line = next(file)\n",
" print(f\"First data line: {first_data_line.strip()}\")\n",
" break\n",
" if i > 100: # Limit search to first 100 lines\n",
" print(\"Matrix table marker not found in first 100 lines\")\n",
" break\n",
"\n",
"# 3. Now try to get the genetic data with better error handling\n",
"try:\n",
" gene_data = get_genetic_data(matrix_file)\n",
" print(gene_data.index[:20])\n",
"except KeyError as e:\n",
" print(f\"KeyError: {e}\")\n",
" \n",
" # Alternative approach: manually extract the data\n",
" print(\"\\nTrying alternative approach to read the gene data:\")\n",
" with gzip.open(matrix_file, 'rt') as file:\n",
" # Find the start of the data\n",
" for line in file:\n",
" if '!series_matrix_table_begin' in line:\n",
" break\n",
" \n",
" # Read the headers and data\n",
" import pandas as pd\n",
" df = pd.read_csv(file, sep='\\t', index_col=0)\n",
" print(f\"Column names: {df.columns[:5]}\")\n",
" print(f\"First 20 row IDs: {df.index[:20]}\")\n",
" gene_data = df\n"
]
},
{
"cell_type": "markdown",
"id": "47b4d448",
"metadata": {},
"source": [
"### Step 4: Gene Identifier Review"
]
},
{
"cell_type": "code",
"execution_count": 5,
"id": "c4ac7618",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:05.373458Z",
"iopub.status.busy": "2025-03-25T05:14:05.373328Z",
"iopub.status.idle": "2025-03-25T05:14:05.375249Z",
"shell.execute_reply": "2025-03-25T05:14:05.374960Z"
}
},
"outputs": [],
"source": [
"# Looking at the gene identifiers in the gene expression data\n",
"# The identifiers are numerical (1, 2, 3, etc.) which are not standard human gene symbols\n",
"# These appear to be probe IDs that need to be mapped to gene symbols\n",
"\n",
"requires_gene_mapping = True\n"
]
},
{
"cell_type": "markdown",
"id": "a849f4fb",
"metadata": {},
"source": [
"### Step 5: Gene Annotation"
]
},
{
"cell_type": "code",
"execution_count": 6,
"id": "f55c9aa7",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:05.376402Z",
"iopub.status.busy": "2025-03-25T05:14:05.376289Z",
"iopub.status.idle": "2025-03-25T05:14:05.984312Z",
"shell.execute_reply": "2025-03-25T05:14:05.983897Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Examining SOFT file structure:\n",
"Line 0: ^DATABASE = GeoMiame\n",
"Line 1: !Database_name = Gene Expression Omnibus (GEO)\n",
"Line 2: !Database_institute = NCBI NLM NIH\n",
"Line 3: !Database_web_link = http://www.ncbi.nlm.nih.gov/geo\n",
"Line 4: !Database_email = [email protected]\n",
"Line 5: ^SERIES = GSE77790\n",
"Line 6: !Series_title = Differentially expressed genes after miRNA or siRNA transfection in human cancer cell lines II\n",
"Line 7: !Series_geo_accession = GSE77790\n",
"Line 8: !Series_status = Public on Apr 13 2016\n",
"Line 9: !Series_submission_date = Feb 10 2016\n",
"Line 10: !Series_last_update_date = Oct 07 2019\n",
"Line 11: !Series_pubmed_id = 27633630\n",
"Line 12: !Series_pubmed_id = 27862697\n",
"Line 13: !Series_pubmed_id = 27072587\n",
"Line 14: !Series_pubmed_id = 27779648\n",
"Line 15: !Series_pubmed_id = 27765924\n",
"Line 16: !Series_pubmed_id = 29050264\n",
"Line 17: !Series_summary = To identify differentially expressed genes by anti cancer treatments (microRNAs or siRNAs) in human cancer, several cell lines (pancreatic cancer, esophageal cancer, bladder cancer, prostate cancer, renal cell carcinoma and lung squamous cell carcinoma) were subjected to Agilent whole genome microarrays.\n",
"Line 18: !Series_overall_design = Human cell lines (Panc-1, sw1990, TE8, TE9, A549, MRC-5, BOY, T24, PC3, C4-2, 786-O, A-498 and EBC-1) were treated with miRNAs (miR-375, miR-29a, miR-26a, miR-145-5p, miR-145-3p, miR-218, miR-320a), siRNAs (si-MMP11, si-LAMP1, si-LOXL2, si-PLOD2, si-UHRF1, and si-FOXM1).\n",
"Line 19: !Series_type = Expression profiling by array\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"\n",
"Gene annotation preview:\n",
"{'ID': [1, 2, 3, 4, 5], 'COL': [192, 192, 192, 192, 192], 'ROW': [328, 326, 324, 322, 320], 'NAME': ['GE_BrightCorner', 'DarkCorner', 'DarkCorner', 'A_21_P0014386', 'A_33_P3396872'], 'SPOT_ID': ['GE_BrightCorner', 'DarkCorner', 'DarkCorner', 'A_21_P0014386', 'A_33_P3396872'], 'CONTROL_TYPE': ['pos', 'pos', 'pos', 'FALSE', 'FALSE'], 'REFSEQ': [nan, nan, nan, nan, 'NM_001105533'], 'GB_ACC': [nan, nan, nan, nan, 'NM_001105533'], 'LOCUSLINK_ID': [nan, nan, nan, nan, 79974.0], 'GENE_SYMBOL': [nan, nan, nan, nan, 'CPED1'], 'GENE_NAME': [nan, nan, nan, nan, 'cadherin-like and PC-esterase domain containing 1'], 'UNIGENE_ID': [nan, nan, nan, nan, 'Hs.189652'], 'ENSEMBL_ID': [nan, nan, nan, nan, nan], 'TIGR_ID': [nan, nan, nan, nan, nan], 'ACCESSION_STRING': [nan, nan, nan, nan, 'ref|NM_001105533|gb|AK025639|gb|BC030538|tc|THC2601673'], 'CHROMOSOMAL_LOCATION': [nan, nan, nan, 'unmapped', 'chr7:120901888-120901947'], 'CYTOBAND': [nan, nan, nan, nan, 'hs|7q31.31'], 'DESCRIPTION': [nan, nan, nan, nan, 'Homo sapiens cadherin-like and PC-esterase domain containing 1 (CPED1), transcript variant 2, mRNA [NM_001105533]'], 'GO_ID': [nan, nan, nan, nan, 'GO:0005783(endoplasmic reticulum)'], 'SEQUENCE': [nan, nan, nan, 'AATACATGTTTTGGTAAACACTCGGTCAGAGCACCCTCTTTCTGTGGAATCAGACTGGCA', 'GCTTATCTCACCTAATACAGGGACTATGCAACCAAGAAACTGGAAATAAAAACAAAGATA'], 'SPOT_ID.1': [nan, nan, nan, nan, nan]}\n"
]
}
],
"source": [
"# 1. Let's first examine the structure of the SOFT file before trying to parse it\n",
"import gzip\n",
"\n",
"# Look at the first few lines of the SOFT file to understand its structure\n",
"print(\"Examining SOFT file structure:\")\n",
"try:\n",
" with gzip.open(soft_file, 'rt') as file:\n",
" # Read first 20 lines to understand the file structure\n",
" for i, line in enumerate(file):\n",
" if i < 20:\n",
" print(f\"Line {i}: {line.strip()}\")\n",
" else:\n",
" break\n",
"except Exception as e:\n",
" print(f\"Error reading SOFT file: {e}\")\n",
"\n",
"# 2. Now let's try a more robust approach to extract the gene annotation\n",
"# Instead of using the library function which failed, we'll implement a custom approach\n",
"try:\n",
" # First, look for the platform section which contains gene annotation\n",
" platform_data = []\n",
" with gzip.open(soft_file, 'rt') as file:\n",
" in_platform_section = False\n",
" for line in file:\n",
" if line.startswith('^PLATFORM'):\n",
" in_platform_section = True\n",
" continue\n",
" if in_platform_section and line.startswith('!platform_table_begin'):\n",
" # Next line should be the header\n",
" header = next(file).strip()\n",
" platform_data.append(header)\n",
" # Read until the end of the platform table\n",
" for table_line in file:\n",
" if table_line.startswith('!platform_table_end'):\n",
" break\n",
" platform_data.append(table_line.strip())\n",
" break\n",
" \n",
" # If we found platform data, convert it to a DataFrame\n",
" if platform_data:\n",
" import pandas as pd\n",
" import io\n",
" platform_text = '\\n'.join(platform_data)\n",
" gene_annotation = pd.read_csv(io.StringIO(platform_text), delimiter='\\t', \n",
" low_memory=False, on_bad_lines='skip')\n",
" print(\"\\nGene annotation preview:\")\n",
" print(preview_df(gene_annotation))\n",
" else:\n",
" print(\"Could not find platform table in SOFT file\")\n",
" \n",
" # Try an alternative approach - extract mapping from other sections\n",
" with gzip.open(soft_file, 'rt') as file:\n",
" for line in file:\n",
" if 'ANNOTATION information' in line or 'annotation information' in line:\n",
" print(f\"Found annotation information: {line.strip()}\")\n",
" if line.startswith('!Platform_title') or line.startswith('!platform_title'):\n",
" print(f\"Platform title: {line.strip()}\")\n",
" \n",
"except Exception as e:\n",
" print(f\"Error processing gene annotation: {e}\")\n"
]
},
{
"cell_type": "markdown",
"id": "11b70f6c",
"metadata": {},
"source": [
"### Step 6: Gene Identifier Mapping"
]
},
{
"cell_type": "code",
"execution_count": 7,
"id": "a3239666",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:05.985608Z",
"iopub.status.busy": "2025-03-25T05:14:05.985480Z",
"iopub.status.idle": "2025-03-25T05:14:06.140052Z",
"shell.execute_reply": "2025-03-25T05:14:06.139650Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene mapping preview:\n",
"{'ID': ['5', '6', '7', '8', '12'], 'Gene': ['CPED1', 'BCOR', 'CHAC2', 'IFI30', 'GPR146']}\n",
"\n",
"Gene expression data after mapping:\n",
"Number of genes: 29222\n",
"Number of samples: 32\n",
"Sample of first few genes:\n",
" GSM2059404 GSM2059405 GSM2059406\n",
"Gene \n",
"A1BG -0.026845 0.292602 -0.127231\n",
"A1BG-AS1 0.000000 0.000000 0.000000\n",
"A1CF -0.003664 0.000000 0.000000\n",
"A1CF-2 0.000000 0.000000 0.000000\n",
"A1CF-3 0.086574 0.000000 0.000000\n"
]
}
],
"source": [
"# 1. Determine which columns contain the identifiers and gene symbols\n",
"# From previous output, we can see:\n",
"# - 'ID' column contains numeric identifiers matching our gene expression data\n",
"# - 'GENE_SYMBOL' column contains the gene symbols we need\n",
"\n",
"# Create a mapping dataframe with the identifier and gene symbol columns\n",
"gene_mapping = get_gene_mapping(\n",
" annotation=gene_annotation,\n",
" prob_col='ID',\n",
" gene_col='GENE_SYMBOL'\n",
")\n",
"\n",
"# Preview the mapping\n",
"print(\"Gene mapping preview:\")\n",
"print(preview_df(gene_mapping))\n",
"\n",
"# 2. Apply the gene mapping to convert probe-level expression to gene-level expression\n",
"gene_data = apply_gene_mapping(gene_data, gene_mapping)\n",
"\n",
"# Preview the gene expression data after mapping\n",
"print(\"\\nGene expression data after mapping:\")\n",
"print(f\"Number of genes: {len(gene_data)}\")\n",
"print(f\"Number of samples: {len(gene_data.columns)}\")\n",
"print(\"Sample of first few genes:\")\n",
"print(gene_data.head(5).iloc[:, :3]) # Show first 5 genes, first 3 samples\n"
]
},
{
"cell_type": "markdown",
"id": "a5bba099",
"metadata": {},
"source": [
"### Step 7: Data Normalization and Linking"
]
},
{
"cell_type": "code",
"execution_count": 8,
"id": "94d5a16a",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T05:14:06.141435Z",
"iopub.status.busy": "2025-03-25T05:14:06.141317Z",
"iopub.status.idle": "2025-03-25T05:14:13.254506Z",
"shell.execute_reply": "2025-03-25T05:14:13.254161Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene data shape: (20778, 32)\n",
"First few genes with their expression values after normalization:\n",
" GSM2059404 GSM2059405 GSM2059406 GSM2059407 GSM2059408 \\\n",
"Gene \n",
"A1BG -0.026845 0.292602 -0.127231 -0.125141 -0.076007 \n",
"A1BG-AS1 0.000000 0.000000 0.000000 0.251289 0.082415 \n",
"A1CF -0.003664 0.000000 0.000000 0.000000 0.000000 \n",
"A2M 0.103392 0.000000 -0.070657 0.483920 -0.159715 \n",
"A2M-AS1 -0.022907 -0.019728 -0.104097 -0.203670 -0.555398 \n",
"\n",
" GSM2059409 GSM2059410 GSM2059411 GSM2059412 GSM2059413 ... \\\n",
"Gene ... \n",
"A1BG -0.009207 -0.082495 0.189666 -0.237983 -0.006939 ... \n",
"A1BG-AS1 0.065617 0.000000 0.000000 -0.050387 -0.103464 ... \n",
"A1CF 0.000000 -0.243397 0.000000 0.000000 0.000000 ... \n",
"A2M 0.173058 -0.342849 0.435977 0.523215 0.318503 ... \n",
"A2M-AS1 -0.335948 0.189627 0.046185 -0.490978 0.251301 ... \n",
"\n",
" GSM2059426 GSM2059427 GSM2059428 GSM2059429 GSM2059430 \\\n",
"Gene \n",
"A1BG -0.058951 -0.083353 -0.207919 -0.198724 -0.385907 \n",
"A1BG-AS1 0.120403 0.007354 -0.098147 -0.032209 -0.106467 \n",
"A1CF 0.000000 0.000000 0.000000 0.000000 -0.146621 \n",
"A2M 0.000000 0.000000 0.000000 0.000000 0.009201 \n",
"A2M-AS1 0.344190 -0.187586 0.010471 -0.310572 -0.194673 \n",
"\n",
" GSM2059431 GSM2059432 GSM2059433 GSM2059434 GSM2059435 \n",
"Gene \n",
"A1BG -0.275737 0.065018 0.106474 -0.202607 0.198972 \n",
"A1BG-AS1 0.029031 -0.058106 0.063948 0.053285 0.147985 \n",
"A1CF 0.000000 0.372980 -0.050298 -0.307278 -0.127532 \n",
"A2M 0.157753 0.614686 0.000000 -0.160533 -0.044805 \n",
"A2M-AS1 -0.230303 -0.125125 0.013175 0.209994 -0.157355 \n",
"\n",
"[5 rows x 32 columns]\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene data saved to ../../output/preprocess/Esophageal_Cancer/gene_data/GSE77790.csv\n",
"Raw clinical data shape: (3, 33)\n",
"Clinical features:\n",
" GSM2059404 GSM2059405 GSM2059406 GSM2059407 GSM2059408 \\\n",
"Esophageal_Cancer 0.0 0.0 0.0 0.0 0.0 \n",
"\n",
" GSM2059409 GSM2059410 GSM2059411 GSM2059412 GSM2059413 \\\n",
"Esophageal_Cancer 0.0 0.0 0.0 0.0 0.0 \n",
"\n",
" ... GSM2059426 GSM2059427 GSM2059428 GSM2059429 \\\n",
"Esophageal_Cancer ... 0.0 0.0 0.0 0.0 \n",
"\n",
" GSM2059430 GSM2059431 GSM2059432 GSM2059433 GSM2059434 \\\n",
"Esophageal_Cancer 1.0 1.0 0.0 0.0 0.0 \n",
"\n",
" GSM2059435 \n",
"Esophageal_Cancer 0.0 \n",
"\n",
"[1 rows x 32 columns]\n",
"Clinical features saved to ../../output/preprocess/Esophageal_Cancer/clinical_data/GSE77790.csv\n",
"Linked data shape: (32, 20779)\n",
"Linked data preview (first 5 rows, first 5 columns):\n",
" Esophageal_Cancer A1BG A1BG-AS1 A1CF A2M\n",
"GSM2059404 0.0 -0.026845 0.000000 -0.003664 0.103392\n",
"GSM2059405 0.0 0.292602 0.000000 0.000000 0.000000\n",
"GSM2059406 0.0 -0.127231 0.000000 0.000000 -0.070657\n",
"GSM2059407 0.0 -0.125141 0.251289 0.000000 0.483920\n",
"GSM2059408 0.0 -0.076007 0.082415 0.000000 -0.159715\n",
"Missing values before handling:\n",
" Trait (Esophageal_Cancer) missing: 0 out of 32\n",
" Genes with >20% missing: 0\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
" Samples with >5% missing genes: 0\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Data shape after handling missing values: (32, 20779)\n",
"For the feature 'Esophageal_Cancer', the least common label is '1.0' with 2 occurrences. This represents 6.25% of the dataset.\n",
"The distribution of the feature 'Esophageal_Cancer' in this dataset is severely biased.\n",
"\n",
"Data was determined to be unusable or empty and was not saved\n"
]
}
],
"source": [
"# 1. Normalize gene symbols in the gene expression data\n",
"normalized_gene_data = normalize_gene_symbols_in_index(gene_data)\n",
"print(f\"Normalized gene data shape: {normalized_gene_data.shape}\")\n",
"print(\"First few genes with their expression values after normalization:\")\n",
"print(normalized_gene_data.head())\n",
"\n",
"# Save the normalized gene data\n",
"os.makedirs(os.path.dirname(out_gene_data_file), exist_ok=True)\n",
"normalized_gene_data.to_csv(out_gene_data_file)\n",
"print(f\"Normalized gene data saved to {out_gene_data_file}\")\n",
"\n",
"# 2. Check if trait data is available before proceeding with clinical data extraction\n",
"if trait_row is None:\n",
" print(\"Trait row is None. Cannot extract trait information from clinical data.\")\n",
" # Create an empty dataframe for clinical features\n",
" clinical_features = pd.DataFrame()\n",
" \n",
" # Create an empty dataframe for linked data\n",
" linked_data = pd.DataFrame()\n",
" \n",
" # Validate and save cohort info\n",
" validate_and_save_cohort_info(\n",
" is_final=True, \n",
" cohort=cohort, \n",
" info_path=json_path, \n",
" is_gene_available=True, \n",
" is_trait_available=False, # Trait data is not available\n",
" is_biased=True, # Not applicable but required\n",
" df=pd.DataFrame(), # Empty dataframe\n",
" note=\"Dataset contains gene expression data but lacks clear trait indicators for Duchenne Muscular Dystrophy status.\"\n",
" )\n",
" print(\"Data was determined to be unusable due to missing trait indicators and was not saved\")\n",
"else:\n",
" try:\n",
" # Get the file paths for the matrix file to extract clinical data\n",
" _, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
" \n",
" # Get raw clinical data from the matrix file\n",
" _, clinical_raw = get_background_and_clinical_data(matrix_file)\n",
" \n",
" # Verify clinical data structure\n",
" print(\"Raw clinical data shape:\", clinical_raw.shape)\n",
" \n",
" # Extract clinical features using the defined conversion functions\n",
" clinical_features = geo_select_clinical_features(\n",
" clinical_df=clinical_raw,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
" )\n",
" \n",
" print(\"Clinical features:\")\n",
" print(clinical_features)\n",
" \n",
" # Save clinical features to file\n",
" os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
" clinical_features.to_csv(out_clinical_data_file)\n",
" print(f\"Clinical features saved to {out_clinical_data_file}\")\n",
" \n",
" # 3. Link clinical and genetic data\n",
" linked_data = geo_link_clinical_genetic_data(clinical_features, normalized_gene_data)\n",
" print(f\"Linked data shape: {linked_data.shape}\")\n",
" print(\"Linked data preview (first 5 rows, first 5 columns):\")\n",
" print(linked_data.iloc[:5, :5])\n",
" \n",
" # 4. Handle missing values\n",
" print(\"Missing values before handling:\")\n",
" print(f\" Trait ({trait}) missing: {linked_data[trait].isna().sum()} out of {len(linked_data)}\")\n",
" if 'Age' in linked_data.columns:\n",
" print(f\" Age missing: {linked_data['Age'].isna().sum()} out of {len(linked_data)}\")\n",
" if 'Gender' in linked_data.columns:\n",
" print(f\" Gender missing: {linked_data['Gender'].isna().sum()} out of {len(linked_data)}\")\n",
" \n",
" gene_cols = [col for col in linked_data.columns if col not in [trait, 'Age', 'Gender']]\n",
" print(f\" Genes with >20% missing: {sum(linked_data[gene_cols].isna().mean() > 0.2)}\")\n",
" print(f\" Samples with >5% missing genes: {sum(linked_data[gene_cols].isna().mean(axis=1) > 0.05)}\")\n",
" \n",
" cleaned_data = handle_missing_values(linked_data, trait)\n",
" print(f\"Data shape after handling missing values: {cleaned_data.shape}\")\n",
" \n",
" # 5. Evaluate bias in trait and demographic features\n",
" is_trait_biased = False\n",
" if len(cleaned_data) > 0:\n",
" trait_biased, cleaned_data = judge_and_remove_biased_features(cleaned_data, trait)\n",
" is_trait_biased = trait_biased\n",
" else:\n",
" print(\"No data remains after handling missing values.\")\n",
" is_trait_biased = True\n",
" \n",
" # 6. Final validation and save\n",
" is_usable = validate_and_save_cohort_info(\n",
" is_final=True, \n",
" cohort=cohort, \n",
" info_path=json_path, \n",
" is_gene_available=True, \n",
" is_trait_available=True, \n",
" is_biased=is_trait_biased, \n",
" df=cleaned_data,\n",
" note=\"Dataset contains gene expression data comparing Duchenne muscular dystrophy vs healthy samples.\"\n",
" )\n",
" \n",
" # 7. Save if usable\n",
" if is_usable and len(cleaned_data) > 0:\n",
" os.makedirs(os.path.dirname(out_data_file), exist_ok=True)\n",
" cleaned_data.to_csv(out_data_file)\n",
" print(f\"Linked data saved to {out_data_file}\")\n",
" else:\n",
" print(\"Data was determined to be unusable or empty and was not saved\")\n",
" \n",
" except Exception as e:\n",
" print(f\"Error processing data: {e}\")\n",
" # Handle the error case by still recording cohort info\n",
" validate_and_save_cohort_info(\n",
" is_final=True, \n",
" cohort=cohort, \n",
" info_path=json_path, \n",
" is_gene_available=True, \n",
" is_trait_available=False, # Mark as not available due to processing issues\n",
" is_biased=True, \n",
" df=pd.DataFrame(), # Empty dataframe\n",
" note=f\"Error processing data: {str(e)}\"\n",
" )\n",
" print(\"Data was determined to be unusable and was not saved\")"
]
}
],
"metadata": {
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.10.16"
}
},
"nbformat": 4,
"nbformat_minor": 5
}
|