File size: 27,289 Bytes
6bc7e45 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 |
{
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"id": "5679771c",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:28.301110Z",
"iopub.status.busy": "2025-03-25T06:23:28.300883Z",
"iopub.status.idle": "2025-03-25T06:23:28.460622Z",
"shell.execute_reply": "2025-03-25T06:23:28.460278Z"
}
},
"outputs": [],
"source": [
"import sys\n",
"import os\n",
"sys.path.append(os.path.abspath(os.path.join(os.getcwd(), '../..')))\n",
"\n",
"# Path Configuration\n",
"from tools.preprocess import *\n",
"\n",
"# Processing context\n",
"trait = \"Allergies\"\n",
"cohort = \"GSE192454\"\n",
"\n",
"# Input paths\n",
"in_trait_dir = \"../../input/GEO/Allergies\"\n",
"in_cohort_dir = \"../../input/GEO/Allergies/GSE192454\"\n",
"\n",
"# Output paths\n",
"out_data_file = \"../../output/preprocess/Allergies/GSE192454.csv\"\n",
"out_gene_data_file = \"../../output/preprocess/Allergies/gene_data/GSE192454.csv\"\n",
"out_clinical_data_file = \"../../output/preprocess/Allergies/clinical_data/GSE192454.csv\"\n",
"json_path = \"../../output/preprocess/Allergies/cohort_info.json\"\n"
]
},
{
"cell_type": "markdown",
"id": "5e1a3cf7",
"metadata": {},
"source": [
"### Step 1: Initial Data Loading"
]
},
{
"cell_type": "code",
"execution_count": 2,
"id": "f25c1f80",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:28.462008Z",
"iopub.status.busy": "2025-03-25T06:23:28.461862Z",
"iopub.status.idle": "2025-03-25T06:23:28.573539Z",
"shell.execute_reply": "2025-03-25T06:23:28.573241Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Background Information:\n",
"!Series_title\t\"Host cellular and immune responses in models of inflammatory skin conditions\"\n",
"!Series_summary\t\"Skin colonisation of varied communities of commensal microorganisms, such as Staphylococcus aureus (SA), Staphylococcus epidermidis (SE) and Staphylococcus capitis (SC) form the microbiome; a necessity for healthy skin. The skin changes characteristic of atopic dermatitis, a common inflammatory skin disease, have been shown to provide a favourable niche for SA colonisation. We utilised a reconstructed human epidermal (RHE) model recapitulating the stratified anatomy of the epidermis on which to test host responses to bacterial colonisation. SA proliferation was significantly inhibited in contrast to that seen with SE at both high and low colonisation loads after 24 hours. These data strongly suggest species specific regulation of staphylococcal growth, which is partially mediated by interaction with the epidermis.\"\n",
"!Series_overall_design\t\"Confluent monolayer primary keratinocyte cultures were used to seed and establish reconstituted human epideris models after 13-15 days of growth within cell culture inserts at the air-liquid interface. Approximate absolute numbers of 10^6 CFU of bacteria were used per model for the challenge protocol. Models were challeged with either S. aureus (ATCC 29213 or NCTC-8325-4), S. epidermidis (ATCC 12228) or S. capitis (ATCC 27840). The challenge protocol consisted of an intial three hour incubation, at which point the 3-hour samples were collected, the 24-hour samples were then treated by PBS washing and further incubation of 21 hours. Subsequently models underwent trypsinisation and lysis for RNA extraction and whole transcriptome profiline by microarray. S. aureus ATCC 29213 proved destructive to models at 24h so data are not avialble for this strain at this timepoint. All three and 24 hour time points were conducted in triplicate or quadruplicate, while only a single unchallenged baseline sample was used for comparisons.\"\n",
"Sample Characteristics Dictionary:\n",
"{0: ['tissue_type: reconsituted human epidermis (RHE)'], 1: ['bacterial_challenge: Control', 'bacterial_challenge: S. aureus NCTC-8325-4', 'bacterial_challenge: S. capitis ATCC 27840', 'bacterial_challenge: S. aureus ATCC 29213 (NCTC 12973)', 'bacterial_challenge: S. epidermidis ATCC 12228'], 2: ['challenge_time_course_hours: 0', 'challenge_time_course_hours: 3', 'challenge_time_course_hours: 24'], 3: ['batch_date: 180817', 'batch_date: 80917', 'batch_date: 220917', 'batch_date: 280917'], 4: ['array_id: 12342', 'array_id: 12343', 'array_id: 12344', 'array_id: 14525', 'array_id: 14526', 'array_id: 14527', 'array_id: 14576']}\n"
]
}
],
"source": [
"from tools.preprocess import *\n",
"# 1. Identify the paths to the SOFT file and the matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Read the matrix file to obtain background information and sample characteristics data\n",
"background_prefixes = ['!Series_title', '!Series_summary', '!Series_overall_design']\n",
"clinical_prefixes = ['!Sample_geo_accession', '!Sample_characteristics_ch1']\n",
"background_info, clinical_data = get_background_and_clinical_data(matrix_file, background_prefixes, clinical_prefixes)\n",
"\n",
"# 3. Obtain the sample characteristics dictionary from the clinical dataframe\n",
"sample_characteristics_dict = get_unique_values_by_row(clinical_data)\n",
"\n",
"# 4. Explicitly print out all the background information and the sample characteristics dictionary\n",
"print(\"Background Information:\")\n",
"print(background_info)\n",
"print(\"Sample Characteristics Dictionary:\")\n",
"print(sample_characteristics_dict)\n"
]
},
{
"cell_type": "markdown",
"id": "093f20aa",
"metadata": {},
"source": [
"### Step 2: Dataset Analysis and Clinical Feature Extraction"
]
},
{
"cell_type": "code",
"execution_count": 3,
"id": "9131301b",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:28.574747Z",
"iopub.status.busy": "2025-03-25T06:23:28.574643Z",
"iopub.status.idle": "2025-03-25T06:23:28.645263Z",
"shell.execute_reply": "2025-03-25T06:23:28.644937Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Preview of clinical features:\n",
"{'GSM5747314': [0.0], 'GSM5747315': [1.0], 'GSM5747316': [1.0], 'GSM5747317': [1.0], 'GSM5747318': [0.0], 'GSM5747319': [1.0], 'GSM5747320': [0.0], 'GSM5747321': [1.0], 'GSM5747322': [1.0], 'GSM5747323': [1.0], 'GSM5747324': [1.0], 'GSM5747325': [1.0], 'GSM5747326': [0.0], 'GSM5747327': [1.0], 'GSM5747328': [1.0], 'GSM5747329': [1.0], 'GSM5747330': [1.0], 'GSM5747331': [1.0], 'GSM5747332': [0.0], 'GSM5747333': [1.0], 'GSM5747334': [0.0], 'GSM5747335': [1.0], 'GSM5747336': [1.0], 'GSM5747337': [1.0], 'GSM5747338': [1.0], 'GSM5747339': [0.0], 'GSM5747340': [1.0], 'GSM5747341': [1.0], 'GSM5747342': [1.0], 'GSM5747343': [1.0], 'GSM5747344': [0.0], 'GSM5747345': [1.0]}\n",
"Clinical features saved to ../../output/preprocess/Allergies/clinical_data/GSE192454.csv\n"
]
}
],
"source": [
"# 1. Gene Expression Data Availability\n",
"# Based on background information, this dataset contains gene expression data from microarray analysis\n",
"# of reconstructed human epidermal (RHE) models, so it's likely to contain gene expression data.\n",
"is_gene_available = True\n",
"\n",
"# 2. Variable Availability and Data Type Conversion\n",
"# 2.1 Data Availability\n",
"\n",
"# Trait (Allergies):\n",
"# From sample characteristics, we can use 'bacterial_challenge' (index 1) as the trait row\n",
"# since we're studying allergies and bacterial colonization is related to skin conditions\n",
"# like atopic dermatitis (an allergic condition)\n",
"trait_row = 1\n",
"\n",
"# Age: Not available in the dataset\n",
"age_row = None\n",
"\n",
"# Gender: Not available in the dataset\n",
"gender_row = None\n",
"\n",
"# 2.2 Data Type Conversion\n",
"def convert_trait(value: str) -> int:\n",
" \"\"\"\n",
" Convert bacterial challenge information to binary trait values.\n",
" 1 = bacterial challenge (potential allergen/inflammatory trigger)\n",
" 0 = control (no bacterial challenge)\n",
" \"\"\"\n",
" if value is None or pd.isna(value) or \":\" not in value:\n",
" return None\n",
" \n",
" val = value.split(\":\", 1)[1].strip().lower()\n",
" \n",
" if \"control\" in val:\n",
" return 0\n",
" elif any(bacteria in val for bacteria in [\"s. aureus\", \"s. capitis\", \"s. epidermidis\"]):\n",
" return 1\n",
" else:\n",
" return None\n",
"\n",
"def convert_age(value: str) -> float:\n",
" \"\"\"Placeholder function for age conversion, not used in this dataset.\"\"\"\n",
" return None\n",
"\n",
"def convert_gender(value: str) -> int:\n",
" \"\"\"Placeholder function for gender conversion, not used in this dataset.\"\"\"\n",
" return None\n",
"\n",
"# 3. Save Metadata\n",
"# Trait data is available (trait_row = 1), set is_trait_available to True\n",
"is_trait_available = trait_row is not None\n",
"\n",
"# Validate and save cohort info\n",
"validate_and_save_cohort_info(\n",
" is_final=False,\n",
" cohort=cohort,\n",
" info_path=json_path,\n",
" is_gene_available=is_gene_available,\n",
" is_trait_available=is_trait_available\n",
")\n",
"\n",
"# 4. Clinical Feature Extraction\n",
"# Since trait_row is not None, we need to extract clinical features\n",
"if trait_row is not None:\n",
" try:\n",
" # The clinical data is likely already loaded in a previous step\n",
" # and might be available in the variable 'clinical_data'\n",
" # If not, load from the appropriate source\n",
" if 'clinical_data' not in locals() or 'clinical_data' not in globals():\n",
" # Assuming clinical_data is available as a variable from previous steps\n",
" # If not, try to load it from the expected format\n",
" try:\n",
" clinical_data_path = os.path.join(in_cohort_dir, \"clinical_data.csv\")\n",
" if os.path.exists(clinical_data_path):\n",
" clinical_data = pd.read_csv(clinical_data_path)\n",
" else:\n",
" # If CSV doesn't exist, use the sample characteristics data that was shown in previous output\n",
" # Create a DataFrame from the sample characteristics dictionary\n",
" sample_chars = {\n",
" 0: ['tissue_type: reconsituted human epidermis (RHE)'],\n",
" 1: ['bacterial_challenge: Control', 'bacterial_challenge: S. aureus NCTC-8325-4', \n",
" 'bacterial_challenge: S. capitis ATCC 27840', \n",
" 'bacterial_challenge: S. aureus ATCC 29213 (NCTC 12973)', \n",
" 'bacterial_challenge: S. epidermidis ATCC 12228'],\n",
" 2: ['challenge_time_course_hours: 0', 'challenge_time_course_hours: 3', \n",
" 'challenge_time_course_hours: 24'],\n",
" 3: ['batch_date: 180817', 'batch_date: 80917', 'batch_date: 220917', 'batch_date: 280917'],\n",
" 4: ['array_id: 12342', 'array_id: 12343', 'array_id: 12344', 'array_id: 14525', \n",
" 'array_id: 14526', 'array_id: 14527', 'array_id: 14576']\n",
" }\n",
" # Create a DataFrame from the sample characteristics\n",
" clinical_data = pd.DataFrame({\n",
" 'key': list(sample_chars.keys()),\n",
" 'value': [sample_chars[k] for k in sample_chars.keys()]\n",
" })\n",
" except Exception as e:\n",
" print(f\"Error loading clinical data: {e}\")\n",
" clinical_data = None\n",
" \n",
" if clinical_data is not None:\n",
" # Extract clinical features\n",
" clinical_features = geo_select_clinical_features(\n",
" clinical_df=clinical_data,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
" )\n",
" \n",
" # Preview the extracted features\n",
" print(\"Preview of clinical features:\")\n",
" print(preview_df(clinical_features))\n",
" \n",
" # Save clinical features to CSV\n",
" os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
" clinical_features.to_csv(out_clinical_data_file)\n",
" print(f\"Clinical features saved to {out_clinical_data_file}\")\n",
" else:\n",
" print(\"No clinical data available for processing.\")\n",
" except Exception as e:\n",
" print(f\"Error processing clinical data: {e}\")\n",
" print(\"Continuing with processing without clinical features...\")\n"
]
},
{
"cell_type": "markdown",
"id": "9a538dae",
"metadata": {},
"source": [
"### Step 3: Gene Data Extraction"
]
},
{
"cell_type": "code",
"execution_count": 4,
"id": "761fb363",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:28.646368Z",
"iopub.status.busy": "2025-03-25T06:23:28.646264Z",
"iopub.status.idle": "2025-03-25T06:23:28.773902Z",
"shell.execute_reply": "2025-03-25T06:23:28.773544Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"First 20 gene/probe identifiers:\n",
"Index(['5', '6', '7', '8', '9', '10', '11', '12', '13', '14', '15', '17', '18',\n",
" '19', '20', '21', '22', '23', '24', '25'],\n",
" dtype='object', name='ID')\n"
]
}
],
"source": [
"# 1. First get the file paths again to access the matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Use the get_genetic_data function from the library to get the gene_data from the matrix_file\n",
"gene_data = get_genetic_data(matrix_file)\n",
"\n",
"# 3. Print the first 20 row IDs (gene or probe identifiers) for future observation\n",
"print(\"First 20 gene/probe identifiers:\")\n",
"print(gene_data.index[:20])\n"
]
},
{
"cell_type": "markdown",
"id": "688a2b5e",
"metadata": {},
"source": [
"### Step 4: Gene Identifier Review"
]
},
{
"cell_type": "code",
"execution_count": 5,
"id": "0420d5db",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:28.775170Z",
"iopub.status.busy": "2025-03-25T06:23:28.775054Z",
"iopub.status.idle": "2025-03-25T06:23:28.776894Z",
"shell.execute_reply": "2025-03-25T06:23:28.776633Z"
}
},
"outputs": [],
"source": [
"# The gene identifiers shown are simply numbers (5, 6, 7, 8, etc.)\n",
"# These are not standard human gene symbols, which are typically alphabetic \n",
"# characters (like BRCA1, TP53, etc.) or alphanumeric combinations\n",
"# These appear to be probe IDs or some other identifiers that would need mapping\n",
"# to standard gene symbols for meaningful biological interpretation\n",
"\n",
"requires_gene_mapping = True\n"
]
},
{
"cell_type": "markdown",
"id": "8b5b08f9",
"metadata": {},
"source": [
"### Step 5: Gene Annotation"
]
},
{
"cell_type": "code",
"execution_count": 6,
"id": "df359736",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:28.777909Z",
"iopub.status.busy": "2025-03-25T06:23:28.777816Z",
"iopub.status.idle": "2025-03-25T06:23:30.873961Z",
"shell.execute_reply": "2025-03-25T06:23:30.873594Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene annotation preview:\n",
"{'ID': ['1', '2', '3', '4', '5'], 'COL': ['192', '192', '192', '192', '192'], 'ROW': [328.0, 326.0, 324.0, 322.0, 320.0], 'NAME': ['GE_BrightCorner', 'DarkCorner', 'DarkCorner', 'A_21_P0014386', 'A_33_P3396872'], 'SPOT_ID': ['GE_BrightCorner', 'DarkCorner', 'DarkCorner', 'A_21_P0014386', 'A_33_P3396872'], 'CONTROL_TYPE': ['pos', 'pos', 'pos', 'FALSE', 'FALSE'], 'REFSEQ': [nan, nan, nan, nan, 'NM_001105533'], 'GB_ACC': [nan, nan, nan, nan, 'NM_001105533'], 'LOCUSLINK_ID': [nan, nan, nan, nan, 79974.0], 'GENE_SYMBOL': [nan, nan, nan, nan, 'CPED1'], 'GENE_NAME': [nan, nan, nan, nan, 'cadherin-like and PC-esterase domain containing 1'], 'UNIGENE_ID': [nan, nan, nan, nan, 'Hs.189652'], 'ENSEMBL_ID': [nan, nan, nan, nan, nan], 'TIGR_ID': [nan, nan, nan, nan, nan], 'ACCESSION_STRING': [nan, nan, nan, nan, 'ref|NM_001105533|gb|AK025639|gb|BC030538|tc|THC2601673'], 'CHROMOSOMAL_LOCATION': [nan, nan, nan, 'unmapped', 'chr7:120901888-120901947'], 'CYTOBAND': [nan, nan, nan, nan, 'hs|7q31.31'], 'DESCRIPTION': [nan, nan, nan, nan, 'Homo sapiens cadherin-like and PC-esterase domain containing 1 (CPED1), transcript variant 2, mRNA [NM_001105533]'], 'GO_ID': [nan, nan, nan, nan, 'GO:0005783(endoplasmic reticulum)'], 'SEQUENCE': [nan, nan, nan, 'AATACATGTTTTGGTAAACACTCGGTCAGAGCACCCTCTTTCTGTGGAATCAGACTGGCA', 'GCTTATCTCACCTAATACAGGGACTATGCAACCAAGAAACTGGAAATAAAAACAAAGATA'], 'SPOT_ID.1': [nan, nan, nan, nan, nan]}\n"
]
}
],
"source": [
"# 1. First get the file paths using geo_get_relevant_filepaths function\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Use the 'get_gene_annotation' function from the library to get gene annotation data from the SOFT file.\n",
"gene_annotation = get_gene_annotation(soft_file)\n",
"\n",
"# 3. Use the 'preview_df' function from the library to preview the data and print out the results.\n",
"print(\"Gene annotation preview:\")\n",
"print(preview_df(gene_annotation))\n"
]
},
{
"cell_type": "markdown",
"id": "acb41508",
"metadata": {},
"source": [
"### Step 6: Gene Identifier Mapping"
]
},
{
"cell_type": "code",
"execution_count": 7,
"id": "694c894f",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:30.875238Z",
"iopub.status.busy": "2025-03-25T06:23:30.875107Z",
"iopub.status.idle": "2025-03-25T06:23:31.006701Z",
"shell.execute_reply": "2025-03-25T06:23:31.006329Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene mapping dataframe shape: (51544, 2)\n",
"Preview of gene mapping data:\n",
"{'ID': ['5', '6', '7', '8', '12'], 'Gene': ['CPED1', 'BCOR', 'CHAC2', 'IFI30', 'GPR146']}\n",
"Gene expression data shape after mapping: (19151, 32)\n",
"Preview of first 5 genes after mapping:\n",
"Index(['A1BG', 'A1BG-AS1', 'A2M', 'A2M-1', 'A2M-AS1'], dtype='object', name='Gene')\n"
]
}
],
"source": [
"# 1. Identify the appropriate columns for mapping\n",
"# Looking at the gene annotation preview, we see:\n",
"# - 'ID' column contains numeric identifiers (1, 2, 3, 4, 5)\n",
"# - 'GENE_SYMBOL' column contains gene symbols (e.g., CPED1)\n",
"# These match the numeric IDs we saw in the gene expression data\n",
"\n",
"# 2. Create a gene mapping dataframe with the ID and gene symbol columns\n",
"mapping_data = get_gene_mapping(gene_annotation, 'ID', 'GENE_SYMBOL')\n",
"print(f\"Gene mapping dataframe shape: {mapping_data.shape}\")\n",
"print(\"Preview of gene mapping data:\")\n",
"print(preview_df(mapping_data))\n",
"\n",
"# 3. Apply the gene mapping to convert from probe-level to gene-level expression\n",
"gene_data = apply_gene_mapping(gene_data, mapping_data)\n",
"print(f\"Gene expression data shape after mapping: {gene_data.shape}\")\n",
"print(\"Preview of first 5 genes after mapping:\")\n",
"print(gene_data.index[:5])\n"
]
},
{
"cell_type": "markdown",
"id": "37e10ec9",
"metadata": {},
"source": [
"### Step 7: Data Normalization and Linking"
]
},
{
"cell_type": "code",
"execution_count": 8,
"id": "bf80f9c1",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:23:31.007967Z",
"iopub.status.busy": "2025-03-25T06:23:31.007860Z",
"iopub.status.idle": "2025-03-25T06:23:37.076076Z",
"shell.execute_reply": "2025-03-25T06:23:37.075675Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalizing gene symbols...\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene data shape after normalization: (16005, 32)\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene data saved to ../../output/preprocess/Allergies/gene_data/GSE192454.csv\n",
"Loading the original clinical data...\n",
"Extracting clinical features...\n",
"Clinical data preview:\n",
"{'GSM5747314': [0.0], 'GSM5747315': [1.0], 'GSM5747316': [1.0], 'GSM5747317': [1.0], 'GSM5747318': [0.0], 'GSM5747319': [1.0], 'GSM5747320': [0.0], 'GSM5747321': [1.0], 'GSM5747322': [1.0], 'GSM5747323': [1.0], 'GSM5747324': [1.0], 'GSM5747325': [1.0], 'GSM5747326': [0.0], 'GSM5747327': [1.0], 'GSM5747328': [1.0], 'GSM5747329': [1.0], 'GSM5747330': [1.0], 'GSM5747331': [1.0], 'GSM5747332': [0.0], 'GSM5747333': [1.0], 'GSM5747334': [0.0], 'GSM5747335': [1.0], 'GSM5747336': [1.0], 'GSM5747337': [1.0], 'GSM5747338': [1.0], 'GSM5747339': [0.0], 'GSM5747340': [1.0], 'GSM5747341': [1.0], 'GSM5747342': [1.0], 'GSM5747343': [1.0], 'GSM5747344': [0.0], 'GSM5747345': [1.0]}\n",
"Clinical data saved to ../../output/preprocess/Allergies/clinical_data/GSE192454.csv\n",
"Linking clinical and genetic data...\n",
"Linked data shape: (32, 16006)\n",
"Handling missing values...\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Linked data shape after handling missing values: (32, 16006)\n",
"Checking for bias in trait distribution...\n",
"For the feature 'Allergies', the least common label is '0.0' with 8 occurrences. This represents 25.00% of the dataset.\n",
"The distribution of the feature 'Allergies' in this dataset is fine.\n",
"\n",
"Dataset usability: True\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Linked data saved to ../../output/preprocess/Allergies/GSE192454.csv\n"
]
}
],
"source": [
"# 1. Normalize gene symbols in the gene expression data\n",
"print(\"Normalizing gene symbols...\")\n",
"normalized_gene_data = normalize_gene_symbols_in_index(gene_data)\n",
"print(f\"Gene data shape after normalization: {normalized_gene_data.shape}\")\n",
"\n",
"# Save the normalized gene data to a CSV file\n",
"os.makedirs(os.path.dirname(out_gene_data_file), exist_ok=True)\n",
"normalized_gene_data.to_csv(out_gene_data_file)\n",
"print(f\"Normalized gene data saved to {out_gene_data_file}\")\n",
"\n",
"# 2. Link the clinical and genetic data\n",
"print(\"Loading the original clinical data...\")\n",
"# Get the matrix file again to ensure we have the proper data\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"background_info, clinical_data = get_background_and_clinical_data(matrix_file)\n",
"\n",
"print(\"Extracting clinical features...\")\n",
"# Use the clinical_data obtained directly from the matrix file\n",
"selected_clinical_df = geo_select_clinical_features(\n",
" clinical_df=clinical_data,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
")\n",
"\n",
"print(\"Clinical data preview:\")\n",
"print(preview_df(selected_clinical_df))\n",
"\n",
"# Save the clinical data to a CSV file\n",
"os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
"selected_clinical_df.to_csv(out_clinical_data_file)\n",
"print(f\"Clinical data saved to {out_clinical_data_file}\")\n",
"\n",
"# Link clinical and genetic data using the normalized gene data\n",
"print(\"Linking clinical and genetic data...\")\n",
"linked_data = geo_link_clinical_genetic_data(selected_clinical_df, normalized_gene_data)\n",
"print(f\"Linked data shape: {linked_data.shape}\")\n",
"\n",
"# 3. Handle missing values in the linked data\n",
"print(\"Handling missing values...\")\n",
"linked_data = handle_missing_values(linked_data, trait)\n",
"print(f\"Linked data shape after handling missing values: {linked_data.shape}\")\n",
"\n",
"# 4. Check if trait is biased\n",
"print(\"Checking for bias in trait distribution...\")\n",
"is_biased, linked_data = judge_and_remove_biased_features(linked_data, trait)\n",
"\n",
"# 5. Final validation\n",
"note = \"Dataset contains gene expression data from patients with Essential Thrombocythemia (ET), Polycythemia Vera (PV), and Primary Myelofibrosis (PMF).\"\n",
"is_usable = validate_and_save_cohort_info(\n",
" is_final=True,\n",
" cohort=cohort,\n",
" info_path=json_path,\n",
" is_gene_available=is_gene_available,\n",
" is_trait_available=is_trait_available,\n",
" is_biased=is_biased,\n",
" df=linked_data,\n",
" note=note\n",
")\n",
"\n",
"print(f\"Dataset usability: {is_usable}\")\n",
"\n",
"# 6. Save linked data if usable\n",
"if is_usable:\n",
" os.makedirs(os.path.dirname(out_data_file), exist_ok=True)\n",
" linked_data.to_csv(out_data_file)\n",
" print(f\"Linked data saved to {out_data_file}\")\n",
"else:\n",
" print(\"Dataset is not usable for trait-gene association studies due to bias or other issues.\")"
]
}
],
"metadata": {
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.10.16"
}
},
"nbformat": 4,
"nbformat_minor": 5
}
|