File size: 37,047 Bytes
736e4a0 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 |
{
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"id": "2f7717e3",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:03.345212Z",
"iopub.status.busy": "2025-03-25T06:55:03.344978Z",
"iopub.status.idle": "2025-03-25T06:55:03.515957Z",
"shell.execute_reply": "2025-03-25T06:55:03.515497Z"
}
},
"outputs": [],
"source": [
"import sys\n",
"import os\n",
"sys.path.append(os.path.abspath(os.path.join(os.getcwd(), '../..')))\n",
"\n",
"# Path Configuration\n",
"from tools.preprocess import *\n",
"\n",
"# Processing context\n",
"trait = \"Bipolar_disorder\"\n",
"cohort = \"GSE45484\"\n",
"\n",
"# Input paths\n",
"in_trait_dir = \"../../input/GEO/Bipolar_disorder\"\n",
"in_cohort_dir = \"../../input/GEO/Bipolar_disorder/GSE45484\"\n",
"\n",
"# Output paths\n",
"out_data_file = \"../../output/preprocess/Bipolar_disorder/GSE45484.csv\"\n",
"out_gene_data_file = \"../../output/preprocess/Bipolar_disorder/gene_data/GSE45484.csv\"\n",
"out_clinical_data_file = \"../../output/preprocess/Bipolar_disorder/clinical_data/GSE45484.csv\"\n",
"json_path = \"../../output/preprocess/Bipolar_disorder/cohort_info.json\"\n"
]
},
{
"cell_type": "markdown",
"id": "956aebd4",
"metadata": {},
"source": [
"### Step 1: Initial Data Loading"
]
},
{
"cell_type": "code",
"execution_count": 2,
"id": "60868666",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:03.517485Z",
"iopub.status.busy": "2025-03-25T06:55:03.517333Z",
"iopub.status.idle": "2025-03-25T06:55:03.751405Z",
"shell.execute_reply": "2025-03-25T06:55:03.750905Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Background Information:\n",
"!Series_title\t\"Gene-expression differences in peripheral blood between lithium responders and non-responders in the “Lithium Treatment -Moderate dose Use Study” (LiTMUS)\"\n",
"!Series_summary\t\"Analysis of gene-expression changes in treatment responders vs non-responders to two different treatments among subjectrs participating in LiTMUS.\"\n",
"!Series_summary\t\"Results provide information on pathways that may be involved in the clinical response to Lithium in patients with bipolar disorder.\"\n",
"!Series_overall_design\t\"Total RNA isolated from PAXgene blood RNA tubes from 60 subjects with bipolar disorder, randomized to 2 treatment groups (OPT, Li+OPT) at 2 time-points (baseline, 1 month after treatment)\"\n",
"Sample Characteristics Dictionary:\n",
"{0: ['treatment group: OPT', 'treatment group: Li+OPT'], 1: ['time point: baseline', 'time point: 1 month'], 2: ['responder: NO', 'responder: YES'], 3: ['sex: M', 'sex: F'], 4: ['age: 46', 'age: 44', 'age: 59', 'age: 32', 'age: 45', 'age: 25', 'age: 26', 'age: 43', 'age: 24', 'age: 38', 'age: 47', 'age: 37', 'age: 57', 'age: 23', 'age: 30', 'age: 51', 'age: 35', 'age: 64', 'age: 53', 'age: 61', 'age: 39', 'age: 36', 'age: 18', 'age: 20', 'age: 27', 'age: 49', 'age: 29', 'age: 40', 'age: 41', 'age: 31']}\n"
]
}
],
"source": [
"from tools.preprocess import *\n",
"# 1. Identify the paths to the SOFT file and the matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Read the matrix file to obtain background information and sample characteristics data\n",
"background_prefixes = ['!Series_title', '!Series_summary', '!Series_overall_design']\n",
"clinical_prefixes = ['!Sample_geo_accession', '!Sample_characteristics_ch1']\n",
"background_info, clinical_data = get_background_and_clinical_data(matrix_file, background_prefixes, clinical_prefixes)\n",
"\n",
"# 3. Obtain the sample characteristics dictionary from the clinical dataframe\n",
"sample_characteristics_dict = get_unique_values_by_row(clinical_data)\n",
"\n",
"# 4. Explicitly print out all the background information and the sample characteristics dictionary\n",
"print(\"Background Information:\")\n",
"print(background_info)\n",
"print(\"Sample Characteristics Dictionary:\")\n",
"print(sample_characteristics_dict)\n"
]
},
{
"cell_type": "markdown",
"id": "7ba38fa7",
"metadata": {},
"source": [
"### Step 2: Dataset Analysis and Clinical Feature Extraction"
]
},
{
"cell_type": "code",
"execution_count": 3,
"id": "06628229",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:03.752948Z",
"iopub.status.busy": "2025-03-25T06:55:03.752831Z",
"iopub.status.idle": "2025-03-25T06:55:03.769937Z",
"shell.execute_reply": "2025-03-25T06:55:03.769497Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Clinical Data Preview:\n",
"{'GSM1105438': [0.0, 46.0, 1.0], 'GSM1105439': [0.0, 44.0, 0.0], 'GSM1105440': [0.0, 46.0, 1.0], 'GSM1105441': [0.0, 44.0, 0.0], 'GSM1105442': [0.0, 59.0, 1.0], 'GSM1105443': [0.0, 32.0, 0.0], 'GSM1105444': [0.0, 59.0, 1.0], 'GSM1105445': [0.0, 32.0, 0.0], 'GSM1105446': [0.0, 45.0, 0.0], 'GSM1105447': [0.0, 25.0, 0.0], 'GSM1105448': [0.0, 45.0, 0.0], 'GSM1105449': [0.0, 25.0, 0.0], 'GSM1105450': [1.0, 25.0, 0.0], 'GSM1105451': [1.0, 26.0, 0.0], 'GSM1105452': [1.0, 25.0, 0.0], 'GSM1105453': [1.0, 26.0, 0.0], 'GSM1105454': [1.0, 43.0, 1.0], 'GSM1105455': [0.0, 24.0, 0.0], 'GSM1105456': [1.0, 43.0, 1.0], 'GSM1105457': [0.0, 24.0, 0.0], 'GSM1105458': [0.0, 43.0, 1.0], 'GSM1105459': [0.0, 43.0, 0.0], 'GSM1105460': [0.0, 43.0, 1.0], 'GSM1105461': [0.0, 43.0, 0.0], 'GSM1105462': [0.0, 38.0, 0.0], 'GSM1105463': [0.0, 47.0, 1.0], 'GSM1105464': [0.0, 38.0, 0.0], 'GSM1105465': [0.0, 47.0, 1.0], 'GSM1105466': [1.0, 37.0, 1.0], 'GSM1105467': [0.0, 57.0, 0.0], 'GSM1105468': [1.0, 37.0, 1.0], 'GSM1105469': [0.0, 57.0, 0.0], 'GSM1105470': [0.0, 23.0, 0.0], 'GSM1105471': [0.0, 57.0, 0.0], 'GSM1105472': [0.0, 23.0, 0.0], 'GSM1105473': [0.0, 57.0, 0.0], 'GSM1105474': [0.0, 30.0, 0.0], 'GSM1105475': [0.0, 37.0, 0.0], 'GSM1105476': [0.0, 30.0, 0.0], 'GSM1105477': [0.0, 37.0, 0.0], 'GSM1105478': [1.0, 51.0, 1.0], 'GSM1105479': [1.0, 35.0, 0.0], 'GSM1105480': [1.0, 51.0, 1.0], 'GSM1105481': [1.0, 35.0, 0.0], 'GSM1105482': [0.0, 64.0, 0.0], 'GSM1105483': [0.0, 45.0, 0.0], 'GSM1105484': [0.0, 64.0, 0.0], 'GSM1105485': [0.0, 45.0, 0.0], 'GSM1105486': [0.0, 53.0, 0.0], 'GSM1105487': [0.0, 57.0, 1.0], 'GSM1105488': [0.0, 53.0, 0.0], 'GSM1105489': [0.0, 57.0, 1.0], 'GSM1105490': [0.0, 25.0, 0.0], 'GSM1105491': [0.0, 61.0, 0.0], 'GSM1105492': [0.0, 25.0, 0.0], 'GSM1105493': [0.0, 61.0, 0.0], 'GSM1105494': [0.0, 44.0, 1.0], 'GSM1105495': [0.0, 39.0, 1.0], 'GSM1105496': [0.0, 44.0, 1.0], 'GSM1105497': [0.0, 39.0, 1.0], 'GSM1105498': [0.0, 26.0, 0.0], 'GSM1105499': [0.0, 45.0, 0.0], 'GSM1105500': [0.0, 26.0, 0.0], 'GSM1105501': [0.0, 45.0, 0.0], 'GSM1105502': [1.0, 53.0, 0.0], 'GSM1105503': [0.0, 51.0, 0.0], 'GSM1105504': [1.0, 53.0, 0.0], 'GSM1105505': [0.0, 51.0, 0.0], 'GSM1105506': [0.0, 36.0, 1.0], 'GSM1105507': [0.0, 45.0, 0.0], 'GSM1105508': [0.0, 36.0, 1.0], 'GSM1105509': [0.0, 45.0, 0.0], 'GSM1105510': [1.0, 38.0, 0.0], 'GSM1105511': [0.0, 18.0, 0.0], 'GSM1105512': [1.0, 38.0, 0.0], 'GSM1105513': [0.0, 18.0, 0.0], 'GSM1105514': [0.0, 20.0, 0.0], 'GSM1105515': [1.0, 27.0, 1.0], 'GSM1105516': [0.0, 20.0, 0.0], 'GSM1105517': [1.0, 27.0, 1.0], 'GSM1105518': [0.0, 49.0, 0.0], 'GSM1105519': [0.0, 43.0, 0.0], 'GSM1105520': [0.0, 49.0, 0.0], 'GSM1105521': [0.0, 43.0, 0.0], 'GSM1105522': [0.0, 29.0, 1.0], 'GSM1105523': [1.0, 20.0, 0.0], 'GSM1105524': [0.0, 29.0, 1.0], 'GSM1105525': [1.0, 20.0, 0.0], 'GSM1105526': [0.0, 32.0, 0.0], 'GSM1105527': [0.0, 40.0, 1.0], 'GSM1105528': [0.0, 32.0, 0.0], 'GSM1105529': [0.0, 40.0, 1.0], 'GSM1105530': [1.0, 59.0, 0.0], 'GSM1105531': [0.0, 41.0, 0.0], 'GSM1105532': [1.0, 59.0, 0.0], 'GSM1105533': [0.0, 41.0, 0.0], 'GSM1105534': [0.0, 20.0, 0.0], 'GSM1105535': [0.0, 31.0, 1.0], 'GSM1105536': [0.0, 20.0, 0.0], 'GSM1105537': [0.0, 31.0, 1.0], 'GSM1105538': [0.0, 29.0, 1.0], 'GSM1105539': [1.0, 49.0, 0.0], 'GSM1105540': [0.0, 29.0, 1.0], 'GSM1105541': [1.0, 49.0, 0.0], 'GSM1105542': [0.0, 52.0, 0.0], 'GSM1105543': [0.0, 22.0, 1.0], 'GSM1105544': [0.0, 52.0, 0.0], 'GSM1105545': [0.0, 22.0, 1.0], 'GSM1105546': [0.0, 52.0, 0.0], 'GSM1105547': [0.0, 39.0, 0.0], 'GSM1105548': [0.0, 52.0, 0.0], 'GSM1105549': [0.0, 39.0, 0.0], 'GSM1105550': [1.0, 27.0, 0.0], 'GSM1105551': [0.0, 57.0, 1.0], 'GSM1105552': [1.0, 27.0, 0.0], 'GSM1105553': [0.0, 57.0, 1.0], 'GSM1105554': [0.0, 27.0, 0.0], 'GSM1105555': [0.0, 36.0, 0.0], 'GSM1105556': [0.0, 27.0, 0.0], 'GSM1105557': [0.0, 36.0, 0.0]}\n",
"Clinical data saved to ../../output/preprocess/Bipolar_disorder/clinical_data/GSE45484.csv\n"
]
}
],
"source": [
"# 1. Gene Expression Data Availability\n",
"is_gene_available = True # Based on the series title and summary, this dataset contains gene expression data\n",
"\n",
"# 2. Variable Availability and Data Type Conversion\n",
"# 2.1 Data Availability\n",
"trait_row = 2 # 'responder: NO', 'responder: YES' - this represents bipolar disorder response to treatment\n",
"age_row = 4 # Contains age information with multiple values\n",
"gender_row = 3 # Contains sex information 'M' and 'F'\n",
"\n",
"# 2.2 Data Type Conversion\n",
"def convert_trait(value):\n",
" if value is None:\n",
" return None\n",
" \n",
" # Extract the value after the colon\n",
" if \":\" in value:\n",
" value = value.split(\":\", 1)[1].strip()\n",
" \n",
" # Convert to binary: YES=1 (responder), NO=0 (non-responder)\n",
" if value.upper() == \"YES\":\n",
" return 1\n",
" elif value.upper() == \"NO\":\n",
" return 0\n",
" else:\n",
" return None\n",
"\n",
"def convert_age(value):\n",
" if value is None:\n",
" return None\n",
" \n",
" # Extract the value after the colon\n",
" if \":\" in value:\n",
" value = value.split(\":\", 1)[1].strip()\n",
" \n",
" # Convert to integer\n",
" try:\n",
" return int(value)\n",
" except:\n",
" return None\n",
"\n",
"def convert_gender(value):\n",
" if value is None:\n",
" return None\n",
" \n",
" # Extract the value after the colon\n",
" if \":\" in value:\n",
" value = value.split(\":\", 1)[1].strip()\n",
" \n",
" # Convert to binary: F=0, M=1\n",
" if value.upper() == \"F\":\n",
" return 0\n",
" elif value.upper() == \"M\":\n",
" return 1\n",
" else:\n",
" return None\n",
"\n",
"# 3. Save Metadata\n",
"is_trait_available = trait_row is not None\n",
"validate_and_save_cohort_info(\n",
" is_final=False,\n",
" cohort=cohort,\n",
" info_path=json_path,\n",
" is_gene_available=is_gene_available,\n",
" is_trait_available=is_trait_available\n",
")\n",
"\n",
"# 4. Clinical Feature Extraction (only if trait_row is not None)\n",
"if trait_row is not None:\n",
" # Get the clinical features\n",
" selected_clinical_df = geo_select_clinical_features(\n",
" clinical_df=clinical_data,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
" )\n",
" \n",
" # Preview the resulting dataframe\n",
" preview = preview_df(selected_clinical_df)\n",
" print(\"Clinical Data Preview:\")\n",
" print(preview)\n",
" \n",
" # Save the clinical data to CSV\n",
" os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
" selected_clinical_df.to_csv(out_clinical_data_file, index=False)\n",
" print(f\"Clinical data saved to {out_clinical_data_file}\")\n"
]
},
{
"cell_type": "markdown",
"id": "f73cabab",
"metadata": {},
"source": [
"### Step 3: Gene Data Extraction"
]
},
{
"cell_type": "code",
"execution_count": 4,
"id": "84b16b22",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:03.771268Z",
"iopub.status.busy": "2025-03-25T06:55:03.771157Z",
"iopub.status.idle": "2025-03-25T06:55:04.214033Z",
"shell.execute_reply": "2025-03-25T06:55:04.213490Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Matrix file found: ../../input/GEO/Bipolar_disorder/GSE45484/GSE45484_series_matrix.txt.gz\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene data shape: (47323, 120)\n",
"First 20 gene/probe identifiers:\n",
"Index(['ILMN_1343291', 'ILMN_1343295', 'ILMN_1651199', 'ILMN_1651209',\n",
" 'ILMN_1651210', 'ILMN_1651221', 'ILMN_1651228', 'ILMN_1651229',\n",
" 'ILMN_1651230', 'ILMN_1651232', 'ILMN_1651235', 'ILMN_1651236',\n",
" 'ILMN_1651237', 'ILMN_1651238', 'ILMN_1651249', 'ILMN_1651253',\n",
" 'ILMN_1651254', 'ILMN_1651259', 'ILMN_1651260', 'ILMN_1651262'],\n",
" dtype='object', name='ID')\n"
]
}
],
"source": [
"# 1. Get the SOFT and matrix file paths again \n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"print(f\"Matrix file found: {matrix_file}\")\n",
"\n",
"# 2. Use the get_genetic_data function from the library to get the gene_data\n",
"try:\n",
" gene_data = get_genetic_data(matrix_file)\n",
" print(f\"Gene data shape: {gene_data.shape}\")\n",
" \n",
" # 3. Print the first 20 row IDs (gene or probe identifiers)\n",
" print(\"First 20 gene/probe identifiers:\")\n",
" print(gene_data.index[:20])\n",
"except Exception as e:\n",
" print(f\"Error extracting gene data: {e}\")\n"
]
},
{
"cell_type": "markdown",
"id": "fc03f25d",
"metadata": {},
"source": [
"### Step 4: Gene Identifier Review"
]
},
{
"cell_type": "code",
"execution_count": 5,
"id": "890f78ee",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:04.215429Z",
"iopub.status.busy": "2025-03-25T06:55:04.215312Z",
"iopub.status.idle": "2025-03-25T06:55:04.217694Z",
"shell.execute_reply": "2025-03-25T06:55:04.217289Z"
}
},
"outputs": [],
"source": [
"# These identifiers start with \"ILMN_\" which indicates they are Illumina BeadArray probe IDs\n",
"# They are not human gene symbols and require mapping to standard gene symbols\n",
"# Illumina probe IDs are specific to the microarray platform and need to be converted\n",
"\n",
"requires_gene_mapping = True\n"
]
},
{
"cell_type": "markdown",
"id": "130078fa",
"metadata": {},
"source": [
"### Step 5: Gene Annotation"
]
},
{
"cell_type": "code",
"execution_count": 6,
"id": "7fb58729",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:04.219139Z",
"iopub.status.busy": "2025-03-25T06:55:04.218988Z",
"iopub.status.idle": "2025-03-25T06:55:15.103374Z",
"shell.execute_reply": "2025-03-25T06:55:15.102727Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"\n",
"Gene annotation preview:\n",
"Columns in gene annotation: ['ID', 'Species', 'Source', 'Search_Key', 'Transcript', 'ILMN_Gene', 'Source_Reference_ID', 'RefSeq_ID', 'Unigene_ID', 'Entrez_Gene_ID', 'GI', 'Accession', 'Symbol', 'Protein_Product', 'Probe_Id', 'Array_Address_Id', 'Probe_Type', 'Probe_Start', 'SEQUENCE', 'Chromosome', 'Probe_Chr_Orientation', 'Probe_Coordinates', 'Cytoband', 'Definition', 'Ontology_Component', 'Ontology_Process', 'Ontology_Function', 'Synonyms', 'Obsolete_Probe_Id', 'GB_ACC']\n",
"{'ID': ['ILMN_1343048', 'ILMN_1343049', 'ILMN_1343050', 'ILMN_1343052', 'ILMN_1343059'], 'Species': [nan, nan, nan, nan, nan], 'Source': [nan, nan, nan, nan, nan], 'Search_Key': [nan, nan, nan, nan, nan], 'Transcript': [nan, nan, nan, nan, nan], 'ILMN_Gene': [nan, nan, nan, nan, nan], 'Source_Reference_ID': [nan, nan, nan, nan, nan], 'RefSeq_ID': [nan, nan, nan, nan, nan], 'Unigene_ID': [nan, nan, nan, nan, nan], 'Entrez_Gene_ID': [nan, nan, nan, nan, nan], 'GI': [nan, nan, nan, nan, nan], 'Accession': [nan, nan, nan, nan, nan], 'Symbol': ['phage_lambda_genome', 'phage_lambda_genome', 'phage_lambda_genome:low', 'phage_lambda_genome:low', 'thrB'], 'Protein_Product': [nan, nan, nan, nan, 'thrB'], 'Probe_Id': [nan, nan, nan, nan, nan], 'Array_Address_Id': [5090180.0, 6510136.0, 7560739.0, 1450438.0, 1240647.0], 'Probe_Type': [nan, nan, nan, nan, nan], 'Probe_Start': [nan, nan, nan, nan, nan], 'SEQUENCE': ['GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA', 'CCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGTTTCAA', 'CCGACAGATGTATGTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGAT', 'TCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGC', 'CTTGTGCCTGAGCTGTCAAAAGTAGAGCACGTCGCCGAGATGAAGGGCGC'], 'Chromosome': [nan, nan, nan, nan, nan], 'Probe_Chr_Orientation': [nan, nan, nan, nan, nan], 'Probe_Coordinates': [nan, nan, nan, nan, nan], 'Cytoband': [nan, nan, nan, nan, nan], 'Definition': [nan, nan, nan, nan, nan], 'Ontology_Component': [nan, nan, nan, nan, nan], 'Ontology_Process': [nan, nan, nan, nan, nan], 'Ontology_Function': [nan, nan, nan, nan, nan], 'Synonyms': [nan, nan, nan, nan, nan], 'Obsolete_Probe_Id': [nan, nan, nan, nan, nan], 'GB_ACC': [nan, nan, nan, nan, nan]}\n",
"\n",
"First row as dictionary:\n",
"ID: ILMN_1343048\n",
"Species: nan\n",
"Source: nan\n",
"Search_Key: nan\n",
"Transcript: nan\n",
"ILMN_Gene: nan\n",
"Source_Reference_ID: nan\n",
"RefSeq_ID: nan\n",
"Unigene_ID: nan\n",
"Entrez_Gene_ID: nan\n",
"GI: nan\n",
"Accession: nan\n",
"Symbol: phage_lambda_genome\n",
"Protein_Product: nan\n",
"Probe_Id: nan\n",
"Array_Address_Id: 5090180.0\n",
"Probe_Type: nan\n",
"Probe_Start: nan\n",
"SEQUENCE: GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA\n",
"Chromosome: nan\n",
"Probe_Chr_Orientation: nan\n",
"Probe_Coordinates: nan\n",
"Cytoband: nan\n",
"Definition: nan\n",
"Ontology_Component: nan\n",
"Ontology_Process: nan\n",
"Ontology_Function: nan\n",
"Synonyms: nan\n",
"Obsolete_Probe_Id: nan\n",
"GB_ACC: nan\n",
"\n",
"Comparing gene data IDs with annotation IDs:\n",
"First 5 gene data IDs: ['ILMN_1343291', 'ILMN_1343295', 'ILMN_1651199', 'ILMN_1651209', 'ILMN_1651210']\n",
"First 5 annotation IDs: ['ILMN_1343048', 'ILMN_1343049', 'ILMN_1343050', 'ILMN_1343052', 'ILMN_1343059']\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"\n",
"Exact ID match between gene data and annotation:\n",
"Matching IDs: 47323 out of 47323 (100.00%)\n",
"\n",
"Potential columns for gene symbols: ['ILMN_Gene', 'Unigene_ID', 'Entrez_Gene_ID', 'Symbol']\n",
"Column 'ILMN_Gene': 47323 non-null values (0.83%)\n",
"Column 'Unigene_ID': 3270 non-null values (0.06%)\n",
"Column 'Entrez_Gene_ID': 43960 non-null values (0.77%)\n",
"Column 'Symbol': 44837 non-null values (0.78%)\n"
]
}
],
"source": [
"# 1. Use the 'get_gene_annotation' function from the library to get gene annotation data from the SOFT file.\n",
"gene_annotation = get_gene_annotation(soft_file)\n",
"\n",
"# 2. Analyze the gene annotation dataframe to identify which columns contain the gene identifiers and gene symbols\n",
"print(\"\\nGene annotation preview:\")\n",
"print(f\"Columns in gene annotation: {gene_annotation.columns.tolist()}\")\n",
"print(preview_df(gene_annotation, n=5))\n",
"\n",
"# Check if there are any columns that might contain gene information\n",
"sample_row = gene_annotation.iloc[0].to_dict()\n",
"print(\"\\nFirst row as dictionary:\")\n",
"for col, value in sample_row.items():\n",
" print(f\"{col}: {value}\")\n",
"\n",
"# Check if IDs in gene_data match IDs in annotation\n",
"print(\"\\nComparing gene data IDs with annotation IDs:\")\n",
"print(\"First 5 gene data IDs:\", gene_data.index[:5].tolist())\n",
"print(\"First 5 annotation IDs:\", gene_annotation['ID'].head().tolist())\n",
"\n",
"# Properly check for exact ID matches between gene data and annotation\n",
"gene_data_ids = set(gene_data.index)\n",
"annotation_ids = set(gene_annotation['ID'].astype(str))\n",
"matching_ids = gene_data_ids.intersection(annotation_ids)\n",
"id_match_percentage = len(matching_ids) / len(gene_data_ids) * 100 if len(gene_data_ids) > 0 else 0\n",
"\n",
"print(f\"\\nExact ID match between gene data and annotation:\")\n",
"print(f\"Matching IDs: {len(matching_ids)} out of {len(gene_data_ids)} ({id_match_percentage:.2f}%)\")\n",
"\n",
"# Check which columns might contain gene symbols for mapping\n",
"potential_gene_symbol_cols = [col for col in gene_annotation.columns \n",
" if any(term in col.upper() for term in ['GENE', 'SYMBOL', 'NAME'])]\n",
"print(f\"\\nPotential columns for gene symbols: {potential_gene_symbol_cols}\")\n",
"\n",
"# Check if the identified columns contain non-null values\n",
"for col in potential_gene_symbol_cols:\n",
" non_null_count = gene_annotation[col].notnull().sum()\n",
" non_null_percent = non_null_count / len(gene_annotation) * 100\n",
" print(f\"Column '{col}': {non_null_count} non-null values ({non_null_percent:.2f}%)\")\n"
]
},
{
"cell_type": "markdown",
"id": "b55ba1e5",
"metadata": {},
"source": [
"### Step 6: Gene Identifier Mapping"
]
},
{
"cell_type": "code",
"execution_count": 7,
"id": "7c96ec2d",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:15.105242Z",
"iopub.status.busy": "2025-03-25T06:55:15.105120Z",
"iopub.status.idle": "2025-03-25T06:55:16.904289Z",
"shell.execute_reply": "2025-03-25T06:55:16.903634Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Created mapping dataframe with shape: (44837, 2)\n",
"Sample of mapping data:\n",
" ID Gene\n",
"0 ILMN_1343048 phage_lambda_genome\n",
"1 ILMN_1343049 phage_lambda_genome\n",
"2 ILMN_1343050 phage_lambda_genome:low\n",
"3 ILMN_1343052 phage_lambda_genome:low\n",
"4 ILMN_1343059 thrB\n",
"Created gene expression dataframe with shape: (21464, 120)\n",
"First 5 genes and their expression values:\n",
" GSM1105438 GSM1105439 GSM1105440 GSM1105441 GSM1105442 GSM1105443 \\\n",
"Gene \n",
"A1BG 14.03088 13.93148 13.81406 13.83391 13.78051 13.96313 \n",
"A1CF 20.32521 20.63063 20.66692 20.54370 20.64116 20.71162 \n",
"A26C3 20.39159 20.30175 20.52752 20.41063 20.47654 20.56898 \n",
"A2BP1 27.15309 27.27428 26.94768 27.12319 27.09179 26.95093 \n",
"A2LD1 7.32095 7.29238 7.47339 7.21109 7.26801 7.35792 \n",
"\n",
" GSM1105444 GSM1105445 GSM1105446 GSM1105447 ... GSM1105548 \\\n",
"Gene ... \n",
"A1BG 13.99187 13.98965 13.65448 13.59944 ... 13.92483 \n",
"A1CF 20.58564 20.50426 20.82332 20.55633 ... 20.55526 \n",
"A26C3 20.29670 20.46836 20.55004 20.29735 ... 20.27635 \n",
"A2BP1 27.35133 26.94886 27.07386 27.20497 ... 26.93445 \n",
"A2LD1 7.45566 7.36758 6.93695 7.21794 ... 7.33647 \n",
"\n",
" GSM1105549 GSM1105550 GSM1105551 GSM1105552 GSM1105553 GSM1105554 \\\n",
"Gene \n",
"A1BG 13.72544 13.94040 13.70261 13.91181 13.70411 13.73513 \n",
"A1CF 20.64901 20.55603 20.36035 20.75112 20.61628 20.46376 \n",
"A26C3 20.61305 20.40383 20.40375 20.54260 20.47298 20.35977 \n",
"A2BP1 27.09989 27.18521 27.42922 26.94529 26.91467 26.90594 \n",
"A2LD1 7.09422 7.19649 7.22026 7.35474 7.58675 7.12003 \n",
"\n",
" GSM1105555 GSM1105556 GSM1105557 \n",
"Gene \n",
"A1BG 13.70526 13.75100 13.80716 \n",
"A1CF 21.03313 20.70163 20.67360 \n",
"A26C3 20.67486 20.61405 20.41787 \n",
"A2BP1 27.04305 27.16635 27.29938 \n",
"A2LD1 7.30742 7.14190 7.48781 \n",
"\n",
"[5 rows x 120 columns]\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene expression data saved to ../../output/preprocess/Bipolar_disorder/gene_data/GSE45484.csv\n"
]
}
],
"source": [
"# 1. Determine which columns to use for probe IDs and gene symbols\n",
"# Based on previous step output, we need:\n",
"# - The 'ID' column (contains probe IDs like ILMN_1343048) that matches gene_data index\n",
"# - The 'Symbol' column (contains gene symbols) has 78% non-null values\n",
"\n",
"# 2. Get gene mapping dataframe\n",
"mapping_df = get_gene_mapping(gene_annotation, prob_col='ID', gene_col='Symbol')\n",
"print(f\"Created mapping dataframe with shape: {mapping_df.shape}\")\n",
"print(f\"Sample of mapping data:\")\n",
"print(mapping_df.head())\n",
"\n",
"# 3. Apply gene mapping to convert probe-level measurements to gene-level expression\n",
"gene_data = apply_gene_mapping(expression_df=gene_data, mapping_df=mapping_df)\n",
"print(f\"Created gene expression dataframe with shape: {gene_data.shape}\")\n",
"print(f\"First 5 genes and their expression values:\")\n",
"print(gene_data.head())\n",
"\n",
"# Save the processed gene expression data\n",
"os.makedirs(os.path.dirname(out_gene_data_file), exist_ok=True)\n",
"gene_data.to_csv(out_gene_data_file)\n",
"print(f\"Gene expression data saved to {out_gene_data_file}\")\n"
]
},
{
"cell_type": "markdown",
"id": "c2dd9ec2",
"metadata": {},
"source": [
"### Step 7: Data Normalization and Linking"
]
},
{
"cell_type": "code",
"execution_count": 8,
"id": "08577309",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:55:16.906242Z",
"iopub.status.busy": "2025-03-25T06:55:16.906075Z",
"iopub.status.idle": "2025-03-25T06:55:33.696705Z",
"shell.execute_reply": "2025-03-25T06:55:33.696328Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene data shape after normalization: (20259, 120)\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene expression data saved to ../../output/preprocess/Bipolar_disorder/gene_data/GSE45484.csv\n",
"Loaded clinical data shape: (3, 120)\n",
"Selected clinical data shape: (3, 120)\n",
"Clinical data preview:\n",
"{'GSM1105438': [0.0, 46.0, 1.0], 'GSM1105439': [0.0, 44.0, 0.0], 'GSM1105440': [0.0, 46.0, 1.0], 'GSM1105441': [0.0, 44.0, 0.0], 'GSM1105442': [0.0, 59.0, 1.0], 'GSM1105443': [0.0, 32.0, 0.0], 'GSM1105444': [0.0, 59.0, 1.0], 'GSM1105445': [0.0, 32.0, 0.0], 'GSM1105446': [0.0, 45.0, 0.0], 'GSM1105447': [0.0, 25.0, 0.0], 'GSM1105448': [0.0, 45.0, 0.0], 'GSM1105449': [0.0, 25.0, 0.0], 'GSM1105450': [1.0, 25.0, 0.0], 'GSM1105451': [1.0, 26.0, 0.0], 'GSM1105452': [1.0, 25.0, 0.0], 'GSM1105453': [1.0, 26.0, 0.0], 'GSM1105454': [1.0, 43.0, 1.0], 'GSM1105455': [0.0, 24.0, 0.0], 'GSM1105456': [1.0, 43.0, 1.0], 'GSM1105457': [0.0, 24.0, 0.0], 'GSM1105458': [0.0, 43.0, 1.0], 'GSM1105459': [0.0, 43.0, 0.0], 'GSM1105460': [0.0, 43.0, 1.0], 'GSM1105461': [0.0, 43.0, 0.0], 'GSM1105462': [0.0, 38.0, 0.0], 'GSM1105463': [0.0, 47.0, 1.0], 'GSM1105464': [0.0, 38.0, 0.0], 'GSM1105465': [0.0, 47.0, 1.0], 'GSM1105466': [1.0, 37.0, 1.0], 'GSM1105467': [0.0, 57.0, 0.0], 'GSM1105468': [1.0, 37.0, 1.0], 'GSM1105469': [0.0, 57.0, 0.0], 'GSM1105470': [0.0, 23.0, 0.0], 'GSM1105471': [0.0, 57.0, 0.0], 'GSM1105472': [0.0, 23.0, 0.0], 'GSM1105473': [0.0, 57.0, 0.0], 'GSM1105474': [0.0, 30.0, 0.0], 'GSM1105475': [0.0, 37.0, 0.0], 'GSM1105476': [0.0, 30.0, 0.0], 'GSM1105477': [0.0, 37.0, 0.0], 'GSM1105478': [1.0, 51.0, 1.0], 'GSM1105479': [1.0, 35.0, 0.0], 'GSM1105480': [1.0, 51.0, 1.0], 'GSM1105481': [1.0, 35.0, 0.0], 'GSM1105482': [0.0, 64.0, 0.0], 'GSM1105483': [0.0, 45.0, 0.0], 'GSM1105484': [0.0, 64.0, 0.0], 'GSM1105485': [0.0, 45.0, 0.0], 'GSM1105486': [0.0, 53.0, 0.0], 'GSM1105487': [0.0, 57.0, 1.0], 'GSM1105488': [0.0, 53.0, 0.0], 'GSM1105489': [0.0, 57.0, 1.0], 'GSM1105490': [0.0, 25.0, 0.0], 'GSM1105491': [0.0, 61.0, 0.0], 'GSM1105492': [0.0, 25.0, 0.0], 'GSM1105493': [0.0, 61.0, 0.0], 'GSM1105494': [0.0, 44.0, 1.0], 'GSM1105495': [0.0, 39.0, 1.0], 'GSM1105496': [0.0, 44.0, 1.0], 'GSM1105497': [0.0, 39.0, 1.0], 'GSM1105498': [0.0, 26.0, 0.0], 'GSM1105499': [0.0, 45.0, 0.0], 'GSM1105500': [0.0, 26.0, 0.0], 'GSM1105501': [0.0, 45.0, 0.0], 'GSM1105502': [1.0, 53.0, 0.0], 'GSM1105503': [0.0, 51.0, 0.0], 'GSM1105504': [1.0, 53.0, 0.0], 'GSM1105505': [0.0, 51.0, 0.0], 'GSM1105506': [0.0, 36.0, 1.0], 'GSM1105507': [0.0, 45.0, 0.0], 'GSM1105508': [0.0, 36.0, 1.0], 'GSM1105509': [0.0, 45.0, 0.0], 'GSM1105510': [1.0, 38.0, 0.0], 'GSM1105511': [0.0, 18.0, 0.0], 'GSM1105512': [1.0, 38.0, 0.0], 'GSM1105513': [0.0, 18.0, 0.0], 'GSM1105514': [0.0, 20.0, 0.0], 'GSM1105515': [1.0, 27.0, 1.0], 'GSM1105516': [0.0, 20.0, 0.0], 'GSM1105517': [1.0, 27.0, 1.0], 'GSM1105518': [0.0, 49.0, 0.0], 'GSM1105519': [0.0, 43.0, 0.0], 'GSM1105520': [0.0, 49.0, 0.0], 'GSM1105521': [0.0, 43.0, 0.0], 'GSM1105522': [0.0, 29.0, 1.0], 'GSM1105523': [1.0, 20.0, 0.0], 'GSM1105524': [0.0, 29.0, 1.0], 'GSM1105525': [1.0, 20.0, 0.0], 'GSM1105526': [0.0, 32.0, 0.0], 'GSM1105527': [0.0, 40.0, 1.0], 'GSM1105528': [0.0, 32.0, 0.0], 'GSM1105529': [0.0, 40.0, 1.0], 'GSM1105530': [1.0, 59.0, 0.0], 'GSM1105531': [0.0, 41.0, 0.0], 'GSM1105532': [1.0, 59.0, 0.0], 'GSM1105533': [0.0, 41.0, 0.0], 'GSM1105534': [0.0, 20.0, 0.0], 'GSM1105535': [0.0, 31.0, 1.0], 'GSM1105536': [0.0, 20.0, 0.0], 'GSM1105537': [0.0, 31.0, 1.0], 'GSM1105538': [0.0, 29.0, 1.0], 'GSM1105539': [1.0, 49.0, 0.0], 'GSM1105540': [0.0, 29.0, 1.0], 'GSM1105541': [1.0, 49.0, 0.0], 'GSM1105542': [0.0, 52.0, 0.0], 'GSM1105543': [0.0, 22.0, 1.0], 'GSM1105544': [0.0, 52.0, 0.0], 'GSM1105545': [0.0, 22.0, 1.0], 'GSM1105546': [0.0, 52.0, 0.0], 'GSM1105547': [0.0, 39.0, 0.0], 'GSM1105548': [0.0, 52.0, 0.0], 'GSM1105549': [0.0, 39.0, 0.0], 'GSM1105550': [1.0, 27.0, 0.0], 'GSM1105551': [0.0, 57.0, 1.0], 'GSM1105552': [1.0, 27.0, 0.0], 'GSM1105553': [0.0, 57.0, 1.0], 'GSM1105554': [0.0, 27.0, 0.0], 'GSM1105555': [0.0, 36.0, 0.0], 'GSM1105556': [0.0, 27.0, 0.0], 'GSM1105557': [0.0, 36.0, 0.0]}\n",
"Linked data shape: (120, 20262)\n",
"Linked data preview (first 5 rows, 5 columns):\n",
" Bipolar_disorder Age Gender A1BG A1BG-AS1\n",
"GSM1105438 0.0 46.0 1.0 14.03088 6.76428\n",
"GSM1105439 0.0 44.0 0.0 13.93148 6.87647\n",
"GSM1105440 0.0 46.0 1.0 13.81406 6.81161\n",
"GSM1105441 0.0 44.0 0.0 13.83391 6.87946\n",
"GSM1105442 0.0 59.0 1.0 13.78051 6.86722\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Data shape after handling missing values: (120, 20262)\n",
"For the feature 'Bipolar_disorder', the least common label is '1.0' with 26 occurrences. This represents 21.67% of the dataset.\n",
"The distribution of the feature 'Bipolar_disorder' in this dataset is fine.\n",
"\n",
"Quartiles for 'Age':\n",
" 25%: 28.5\n",
" 50% (Median): 39.5\n",
" 75%: 49.0\n",
"Min: 18.0\n",
"Max: 64.0\n",
"The distribution of the feature 'Age' in this dataset is fine.\n",
"\n",
"For the feature 'Gender', the least common label is '1.0' with 36 occurrences. This represents 30.00% of the dataset.\n",
"The distribution of the feature 'Gender' in this dataset is fine.\n",
"\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Linked data saved to ../../output/preprocess/Bipolar_disorder/GSE45484.csv\n"
]
}
],
"source": [
"# 1. Normalize gene symbols in the gene expression data\n",
"gene_data = normalize_gene_symbols_in_index(gene_data)\n",
"print(f\"Gene data shape after normalization: {gene_data.shape}\")\n",
"\n",
"# Save the normalized gene data to file\n",
"os.makedirs(os.path.dirname(out_gene_data_file), exist_ok=True)\n",
"gene_data.to_csv(out_gene_data_file)\n",
"print(f\"Normalized gene expression data saved to {out_gene_data_file}\")\n",
"\n",
"# 2. Link the clinical and genetic data\n",
"# Read the saved clinical data file\n",
"clinical_df = pd.read_csv(out_clinical_data_file)\n",
"print(f\"Loaded clinical data shape: {clinical_df.shape}\")\n",
"\n",
"# Load proper clinical data with the correct conversion functions from Step 2\n",
"selected_clinical_df = geo_select_clinical_features(\n",
" clinical_df=clinical_data,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait, # Using the previously defined function from Step 2\n",
" age_row=age_row,\n",
" convert_age=convert_age, # Using the previously defined function from Step 2\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender # Using the previously defined function from Step 2\n",
")\n",
"\n",
"print(f\"Selected clinical data shape: {selected_clinical_df.shape}\")\n",
"print(\"Clinical data preview:\")\n",
"print(preview_df(selected_clinical_df))\n",
"\n",
"# Link clinical and genetic data\n",
"linked_data = geo_link_clinical_genetic_data(selected_clinical_df, gene_data)\n",
"print(f\"Linked data shape: {linked_data.shape}\")\n",
"print(\"Linked data preview (first 5 rows, 5 columns):\")\n",
"print(linked_data.iloc[:5, :5] if not linked_data.empty else \"Linked data is empty\")\n",
"\n",
"# 3. Handle missing values\n",
"linked_data = handle_missing_values(linked_data, trait)\n",
"print(f\"Data shape after handling missing values: {linked_data.shape}\")\n",
"\n",
"# 4. Check for bias in features\n",
"is_biased, linked_data = judge_and_remove_biased_features(linked_data, trait)\n",
"\n",
"# 5. Validate and save cohort information\n",
"is_usable = validate_and_save_cohort_info(\n",
" is_final=True,\n",
" cohort=cohort,\n",
" info_path=json_path,\n",
" is_gene_available=True,\n",
" is_trait_available=True,\n",
" is_biased=is_biased,\n",
" df=linked_data,\n",
" note=\"Dataset contains gene expression data from blood samples of bipolar disorder patients, analyzing response to lithium treatment.\"\n",
")\n",
"\n",
"# 6. Save the linked data if usable\n",
"if is_usable:\n",
" os.makedirs(os.path.dirname(out_data_file), exist_ok=True)\n",
" linked_data.to_csv(out_data_file)\n",
" print(f\"Linked data saved to {out_data_file}\")\n",
"else:\n",
" print(\"Dataset is not usable for analysis. No linked data file saved.\")"
]
}
],
"metadata": {
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.10.16"
}
},
"nbformat": 4,
"nbformat_minor": 5
}
|