File size: 22,900 Bytes
82732bd |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 |
{
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"id": "809cf3ea",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:13.627321Z",
"iopub.status.busy": "2025-03-25T03:48:13.626781Z",
"iopub.status.idle": "2025-03-25T03:48:13.791610Z",
"shell.execute_reply": "2025-03-25T03:48:13.791266Z"
}
},
"outputs": [],
"source": [
"import sys\n",
"import os\n",
"sys.path.append(os.path.abspath(os.path.join(os.getcwd(), '../..')))\n",
"\n",
"# Path Configuration\n",
"from tools.preprocess import *\n",
"\n",
"# Processing context\n",
"trait = \"Red_Hair\"\n",
"cohort = \"GSE207744\"\n",
"\n",
"# Input paths\n",
"in_trait_dir = \"../../input/GEO/Red_Hair\"\n",
"in_cohort_dir = \"../../input/GEO/Red_Hair/GSE207744\"\n",
"\n",
"# Output paths\n",
"out_data_file = \"../../output/preprocess/Red_Hair/GSE207744.csv\"\n",
"out_gene_data_file = \"../../output/preprocess/Red_Hair/gene_data/GSE207744.csv\"\n",
"out_clinical_data_file = \"../../output/preprocess/Red_Hair/clinical_data/GSE207744.csv\"\n",
"json_path = \"../../output/preprocess/Red_Hair/cohort_info.json\"\n"
]
},
{
"cell_type": "markdown",
"id": "f18c2367",
"metadata": {},
"source": [
"### Step 1: Initial Data Loading"
]
},
{
"cell_type": "code",
"execution_count": 2,
"id": "21821550",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:13.793039Z",
"iopub.status.busy": "2025-03-25T03:48:13.792892Z",
"iopub.status.idle": "2025-03-25T03:48:14.044591Z",
"shell.execute_reply": "2025-03-25T03:48:14.044251Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Background Information:\n",
"!Series_title\t\"Transcriptomic study on human skin samples: identification of actinic keratoses two risk classes.\"\n",
"!Series_summary\t\"Gene expression profile analysis allowed to identify 2 classes of AK.\"\n",
"!Series_overall_design\t\"A total of 72 tissue samples (24 NL, 23 L, 4 PL and 21 AK) were isolated from 24 patients. For each patient, samples were acquired on the lesion (L or AK), on the perilesional (PL) i.e. safety surgical margin area (often containing AK) and/or on the non-lesional (NL) parts of the elliptical surgical excision.\"\n",
"Sample Characteristics Dictionary:\n",
"{0: ['patient number: 001', 'patient number: 006', 'patient number: 016', 'patient number: 017', 'patient number: 018=026=045', 'patient number: 028', 'patient number: 029', 'patient number: 035=041', 'patient number: 048', 'patient number: 056', 'patient number: 057', 'patient number: 074', 'patient number: 075', 'patient number: 077', 'patient number: 082', 'patient number: 090', 'patient number: 091', 'patient number: 109', 'patient number: 110', 'patient number: 115', 'patient number: 119', 'patient number: 122', 'patient number: 123', 'patient number: 125'], 1: ['sample localisation: Temple', 'sample localisation: Vertex', 'sample localisation: Forehead', 'sample localisation: Ear', 'sample localisation: Cheek', 'sample localisation: Neck anterior surface', 'sample localisation: Hand dorsum', 'sample localisation: Leg anterior surface', 'sample localisation: Shoulder'], 2: ['lesion type: Actinic Keratosis', 'lesion type: Lesion', 'lesion type: Non Lesion', 'lesion type: Peri Lesion'], 3: [nan, 'lesion number (if applicable): 1', 'lesion number (if applicable): 2', 'lesion number (if applicable): 3']}\n"
]
}
],
"source": [
"from tools.preprocess import *\n",
"# 1. Identify the paths to the SOFT file and the matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Read the matrix file to obtain background information and sample characteristics data\n",
"background_prefixes = ['!Series_title', '!Series_summary', '!Series_overall_design']\n",
"clinical_prefixes = ['!Sample_geo_accession', '!Sample_characteristics_ch1']\n",
"background_info, clinical_data = get_background_and_clinical_data(matrix_file, background_prefixes, clinical_prefixes)\n",
"\n",
"# 3. Obtain the sample characteristics dictionary from the clinical dataframe\n",
"sample_characteristics_dict = get_unique_values_by_row(clinical_data)\n",
"\n",
"# 4. Explicitly print out all the background information and the sample characteristics dictionary\n",
"print(\"Background Information:\")\n",
"print(background_info)\n",
"print(\"Sample Characteristics Dictionary:\")\n",
"print(sample_characteristics_dict)\n"
]
},
{
"cell_type": "markdown",
"id": "244319f9",
"metadata": {},
"source": [
"### Step 2: Dataset Analysis and Clinical Feature Extraction"
]
},
{
"cell_type": "code",
"execution_count": 3,
"id": "c930cf20",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:14.045875Z",
"iopub.status.busy": "2025-03-25T03:48:14.045765Z",
"iopub.status.idle": "2025-03-25T03:48:14.050292Z",
"shell.execute_reply": "2025-03-25T03:48:14.050007Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"A new JSON file was created at: ../../output/preprocess/Red_Hair/cohort_info.json\n"
]
}
],
"source": [
"import pandas as pd\n",
"import numpy as np\n",
"import os\n",
"\n",
"# 1. Determine if gene expression data is available\n",
"# Based on the background information, this is a transcriptomic study on human skin samples\n",
"# Therefore gene expression data should be available\n",
"is_gene_available = True\n",
"\n",
"# 2.1 Data Availability for trait, age, and gender\n",
"# Looking at the sample characteristics dictionary:\n",
"# The dataset is about actinic keratosis skin lesions, not red hair.\n",
"# No information about red hair is available in this dataset.\n",
"# No age information is available in the sample characteristics\n",
"# No gender information is available in the sample characteristics\n",
"\n",
"trait_row = None # No red hair information in this dataset\n",
"age_row = None # No age information available\n",
"gender_row = None # No gender information available\n",
"\n",
"# 2.2 Data Type Conversion Functions\n",
"def convert_trait(value):\n",
" \"\"\"Convert trait information to binary values.\"\"\"\n",
" # Since there's no red hair data, this function is defined for completeness\n",
" return None\n",
"\n",
"def convert_age(value):\n",
" \"\"\"Convert age information to continuous values.\"\"\"\n",
" # No age information in this dataset, function defined for completeness\n",
" return None\n",
"\n",
"def convert_gender(value):\n",
" \"\"\"Convert gender information to binary values.\"\"\"\n",
" # No gender information in this dataset, function defined for completeness\n",
" return None\n",
"\n",
"# 3. Save Metadata\n",
"# Determine trait data availability\n",
"is_trait_available = trait_row is not None # Will be False\n",
"\n",
"# Save the cohort information\n",
"validate_and_save_cohort_info(\n",
" is_final=False,\n",
" cohort=cohort,\n",
" info_path=json_path,\n",
" is_gene_available=is_gene_available,\n",
" is_trait_available=is_trait_available\n",
")\n",
"\n",
"# 4. Clinical Feature Extraction (if trait_row is not None)\n",
"# Since trait_row is None, we'll skip this step\n",
"if trait_row is not None:\n",
" # Load the actual clinical data that should be available from previous steps\n",
" # Extract clinical features\n",
" selected_clinical_df = geo_select_clinical_features(\n",
" clinical_df=clinical_data, # This would be the actual data from previous steps\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
" )\n",
" \n",
" # Preview the selected clinical features\n",
" preview = preview_df(selected_clinical_df)\n",
" print(\"Preview of selected clinical features:\", preview)\n",
" \n",
" # Save the selected clinical features to CSV\n",
" os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
" selected_clinical_df.to_csv(out_clinical_data_file, index=False)\n"
]
},
{
"cell_type": "markdown",
"id": "17f8d75c",
"metadata": {},
"source": [
"### Step 3: Gene Data Extraction"
]
},
{
"cell_type": "code",
"execution_count": 4,
"id": "cc1d4ce2",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:14.051466Z",
"iopub.status.busy": "2025-03-25T03:48:14.051218Z",
"iopub.status.idle": "2025-03-25T03:48:14.512884Z",
"shell.execute_reply": "2025-03-25T03:48:14.512407Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Index(['(+)E1A_r60_1', '(+)E1A_r60_3', '(+)E1A_r60_a104', '(+)E1A_r60_a107',\n",
" '(+)E1A_r60_a135', '(+)E1A_r60_a20', '(+)E1A_r60_a22', '(+)E1A_r60_a97',\n",
" '(+)E1A_r60_n11', '(+)E1A_r60_n9', '3xSLv1', 'A_19_P00315452',\n",
" 'A_19_P00315492', 'A_19_P00315493', 'A_19_P00315502', 'A_19_P00315506',\n",
" 'A_19_P00315518', 'A_19_P00315519', 'A_19_P00315529', 'A_19_P00315541'],\n",
" dtype='object', name='ID')\n"
]
}
],
"source": [
"# 1. First get the file paths\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Use the get_genetic_data function from the library to get the gene_data\n",
"gene_data = get_genetic_data(matrix_file)\n",
"\n",
"# 3. Print the first 20 row IDs (gene or probe identifiers) for future observation\n",
"print(gene_data.index[:20])\n"
]
},
{
"cell_type": "markdown",
"id": "0aec9301",
"metadata": {},
"source": [
"### Step 4: Gene Identifier Review"
]
},
{
"cell_type": "code",
"execution_count": 5,
"id": "c85e0aac",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:14.514526Z",
"iopub.status.busy": "2025-03-25T03:48:14.514414Z",
"iopub.status.idle": "2025-03-25T03:48:14.516264Z",
"shell.execute_reply": "2025-03-25T03:48:14.515987Z"
}
},
"outputs": [],
"source": [
"# Based on my biomedical knowledge, these identifiers don't appear to be standard human gene symbols\n",
"# The identifiers that start with \"A_19_P\" look like Agilent microarray probe IDs\n",
"# Others like \"(+)E1A_r60_1\" and \"3xSLv1\" are not standard gene symbols either\n",
"# These will need to be mapped to standard gene symbols\n",
"\n",
"requires_gene_mapping = True\n"
]
},
{
"cell_type": "markdown",
"id": "b76b08c0",
"metadata": {},
"source": [
"### Step 5: Gene Annotation"
]
},
{
"cell_type": "code",
"execution_count": 6,
"id": "a316740b",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:14.517195Z",
"iopub.status.busy": "2025-03-25T03:48:14.517097Z",
"iopub.status.idle": "2025-03-25T03:48:22.125271Z",
"shell.execute_reply": "2025-03-25T03:48:22.124944Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene annotation preview:\n",
"{'ID': ['GE_BrightCorner', 'DarkCorner', 'A_21_P0014386', 'A_33_P3396872', 'A_33_P3267760'], 'CONTROL_TYPE': ['pos', 'pos', 'FALSE', 'FALSE', 'FALSE'], 'REFSEQ': [nan, nan, nan, 'NM_001105533', nan], 'GB_ACC': [nan, nan, nan, 'NM_001105533', nan], 'LOCUSLINK_ID': [nan, nan, nan, 79974.0, 54880.0], 'GENE_SYMBOL': [nan, nan, nan, 'CPED1', 'BCOR'], 'GENE_NAME': [nan, nan, nan, 'cadherin-like and PC-esterase domain containing 1', 'BCL6 corepressor'], 'UNIGENE_ID': [nan, nan, nan, 'Hs.189652', nan], 'ENSEMBL_ID': [nan, nan, nan, nan, 'ENST00000378463'], 'ACCESSION_STRING': [nan, nan, nan, 'ref|NM_001105533|gb|AK025639|gb|BC030538|tc|THC2601673', 'ens|ENST00000378463'], 'CHROMOSOMAL_LOCATION': [nan, nan, 'unmapped', 'chr7:120901888-120901947', 'chrX:39909128-39909069'], 'CYTOBAND': [nan, nan, nan, 'hs|7q31.31', 'hs|Xp11.4'], 'DESCRIPTION': [nan, nan, nan, 'Homo sapiens cadherin-like and PC-esterase domain containing 1 (CPED1), transcript variant 2, mRNA [NM_001105533]', 'BCL6 corepressor [Source:HGNC Symbol;Acc:HGNC:20893] [ENST00000378463]'], 'GO_ID': [nan, nan, nan, 'GO:0005783(endoplasmic reticulum)', 'GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000415(negative regulation of histone H3-K36 methylation)|GO:0003714(transcription corepressor activity)|GO:0004842(ubiquitin-protein ligase activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0006351(transcription, DNA-dependent)|GO:0007507(heart development)|GO:0008134(transcription factor binding)|GO:0030502(negative regulation of bone mineralization)|GO:0031072(heat shock protein binding)|GO:0031519(PcG protein complex)|GO:0035518(histone H2A monoubiquitination)|GO:0042476(odontogenesis)|GO:0042826(histone deacetylase binding)|GO:0044212(transcription regulatory region DNA binding)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0051572(negative regulation of histone H3-K4 methylation)|GO:0060021(palate development)|GO:0065001(specification of axis polarity)|GO:0070171(negative regulation of tooth mineralization)'], 'SEQUENCE': [nan, nan, 'AATACATGTTTTGGTAAACACTCGGTCAGAGCACCCTCTTTCTGTGGAATCAGACTGGCA', 'GCTTATCTCACCTAATACAGGGACTATGCAACCAAGAAACTGGAAATAAAAACAAAGATA', 'CATCAAAGCTACGAGAGATCCTACACACCCAGATTTAAAAAATAATAAAAACTTAAGGGC'], 'SPOT_ID': ['GE_BrightCorner', 'DarkCorner', 'A_21_P0014386', 'A_33_P3396872', 'A_33_P3267760']}\n"
]
}
],
"source": [
"# 1. Use the 'get_gene_annotation' function from the library to get gene annotation data from the SOFT file.\n",
"gene_annotation = get_gene_annotation(soft_file)\n",
"\n",
"# 2. Use the 'preview_df' function from the library to preview the data and print out the results.\n",
"print(\"Gene annotation preview:\")\n",
"print(preview_df(gene_annotation))\n"
]
},
{
"cell_type": "markdown",
"id": "7671a9a7",
"metadata": {},
"source": [
"### Step 6: Gene Identifier Mapping"
]
},
{
"cell_type": "code",
"execution_count": 7,
"id": "bad0d998",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:22.126668Z",
"iopub.status.busy": "2025-03-25T03:48:22.126544Z",
"iopub.status.idle": "2025-03-25T03:48:22.500078Z",
"shell.execute_reply": "2025-03-25T03:48:22.499699Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene mapping dataframe preview:\n",
"{'ID': ['A_33_P3396872', 'A_33_P3267760', 'A_32_P194264', 'A_23_P153745', 'A_21_P0014180'], 'Gene': ['CPED1', 'BCOR', 'CHAC2', 'IFI30', 'GPR146']}\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"First 20 gene symbols after mapping:\n",
"Index(['A1BG', 'A1BG-AS1', 'A1CF', 'A1CF-2', 'A1CF-3', 'A2M', 'A2M-1',\n",
" 'A2M-AS1', 'A2ML1', 'A2MP1', 'A3GALT2', 'A4GALT', 'A4GNT', 'AA06',\n",
" 'AAAS', 'AAAS-1', 'AACS', 'AACS-2', 'AACS-3', 'AACSP1'],\n",
" dtype='object', name='Gene')\n",
"Gene data shape after mapping: (29222, 72)\n"
]
}
],
"source": [
"# 1. Determine which columns in gene_annotation contain gene identifiers and gene symbols\n",
"# Based on the preview, the column 'ID' appears to match the gene identifiers in gene_expression data\n",
"# The column 'GENE_SYMBOL' contains the gene symbols\n",
"\n",
"# 2. Extract the gene mapping using the get_gene_mapping function from the library\n",
"gene_mapping_df = get_gene_mapping(gene_annotation, prob_col='ID', gene_col='GENE_SYMBOL')\n",
"\n",
"# Examine the mapping dataframe\n",
"print(\"Gene mapping dataframe preview:\")\n",
"print(preview_df(gene_mapping_df))\n",
"\n",
"# 3. Apply the gene mapping to convert probe-level measurements to gene-level expression\n",
"gene_data = apply_gene_mapping(gene_data, gene_mapping_df)\n",
"\n",
"# Print the first 20 gene symbols after mapping to verify the process\n",
"print(\"First 20 gene symbols after mapping:\")\n",
"print(gene_data.index[:20])\n",
"\n",
"# Print the shape of the gene data after mapping\n",
"print(f\"Gene data shape after mapping: {gene_data.shape}\")\n"
]
},
{
"cell_type": "markdown",
"id": "3ec6db3f",
"metadata": {},
"source": [
"### Step 7: Data Normalization and Linking"
]
},
{
"cell_type": "code",
"execution_count": 8,
"id": "11be82cf",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T03:48:22.501513Z",
"iopub.status.busy": "2025-03-25T03:48:22.501401Z",
"iopub.status.idle": "2025-03-25T03:48:23.475623Z",
"shell.execute_reply": "2025-03-25T03:48:23.475215Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene data shape: (20778, 72)\n",
"First few normalized gene symbols: ['A1BG', 'A1BG-AS1', 'A1CF', 'A2M', 'A2M-AS1', 'A2ML1', 'A2MP1', 'A3GALT2', 'A4GALT', 'A4GNT']\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene data saved to ../../output/preprocess/Red_Hair/gene_data/GSE207744.csv\n",
"No Red_Hair trait data available for cohort GSE207744. Cannot link clinical and genetic data.\n",
"Abnormality detected in the cohort: GSE207744. Preprocessing failed.\n"
]
}
],
"source": [
"# 1. Normalize gene symbols in the obtained gene expression data\n",
"normalized_gene_data = normalize_gene_symbols_in_index(gene_data)\n",
"print(f\"Normalized gene data shape: {normalized_gene_data.shape}\")\n",
"print(f\"First few normalized gene symbols: {list(normalized_gene_data.index[:10])}\")\n",
"\n",
"# Save the normalized gene data\n",
"os.makedirs(os.path.dirname(out_gene_data_file), exist_ok=True)\n",
"normalized_gene_data.to_csv(out_gene_data_file)\n",
"print(f\"Normalized gene data saved to {out_gene_data_file}\")\n",
"\n",
"# Check if trait data is available by reading the JSON metadata\n",
"import json\n",
"with open(json_path, \"r\") as file:\n",
" metadata = json.load(file)\n",
" \n",
"is_trait_available = False\n",
"if cohort in metadata:\n",
" is_trait_available = metadata[cohort].get(\"is_trait_available\", False)\n",
"\n",
"# Only proceed with clinical data processing if trait is available\n",
"if is_trait_available:\n",
" # Load the clinical features from the saved file\n",
" clinical_file_path = out_clinical_data_file\n",
" if os.path.exists(clinical_file_path):\n",
" clinical_features = pd.read_csv(clinical_file_path)\n",
" print(f\"Clinical features loaded from {clinical_file_path}\")\n",
" print(f\"Clinical features shape: {clinical_features.shape}\")\n",
" \n",
" # 2. Link the clinical and genetic data\n",
" linked_data = geo_link_clinical_genetic_data(clinical_features.T, normalized_gene_data)\n",
" print(f\"Linked data shape: {linked_data.shape}\")\n",
" print(f\"First few columns: {list(linked_data.columns[:5])}\")\n",
" \n",
" # 3. Handle missing values in the linked data\n",
" trait_column = linked_data.columns[0] # First column should be the trait\n",
" print(f\"Using trait column: {trait_column}\")\n",
" \n",
" linked_data_processed = handle_missing_values(linked_data, trait_column)\n",
" print(f\"Shape after handling missing values: {linked_data_processed.shape}\")\n",
" \n",
" # 4. Determine whether the trait and demographic features are severely biased\n",
" is_trait_biased, unbiased_linked_data = judge_and_remove_biased_features(linked_data_processed, trait_column)\n",
" \n",
" # 5. Conduct quality check and save the cohort information\n",
" is_usable = validate_and_save_cohort_info(\n",
" is_final=True, \n",
" cohort=cohort, \n",
" info_path=json_path, \n",
" is_gene_available=True, \n",
" is_trait_available=True,\n",
" is_biased=is_trait_biased, \n",
" df=unbiased_linked_data,\n",
" note=\"Dataset contains gene expression data but was processed and found unsuitable for Red_Hair analysis.\"\n",
" )\n",
" \n",
" # 6. Save the data if it's usable\n",
" if is_usable:\n",
" # Create directory if it doesn't exist\n",
" os.makedirs(os.path.dirname(out_data_file), exist_ok=True)\n",
" # Save the data\n",
" unbiased_linked_data.to_csv(out_data_file)\n",
" print(f\"Linked data saved to {out_data_file}\")\n",
" else:\n",
" print(f\"Data quality check failed. The dataset is not suitable for association studies.\")\n",
"else:\n",
" print(f\"No Red_Hair trait data available for cohort {cohort}. Cannot link clinical and genetic data.\")\n",
" # Create empty DataFrame with appropriate structure for validation\n",
" empty_df = pd.DataFrame(columns=[trait])\n",
" \n",
" # Mark as unusable in final validation - using False for is_biased instead of None\n",
" validate_and_save_cohort_info(\n",
" is_final=True, \n",
" cohort=cohort, \n",
" info_path=json_path, \n",
" is_gene_available=True, \n",
" is_trait_available=False,\n",
" is_biased=False, # Using False instead of None to satisfy function requirements\n",
" df=empty_df,\n",
" note=\"No Red_Hair trait information available in this cohort.\"\n",
" )"
]
}
],
"metadata": {
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.10.16"
}
},
"nbformat": 4,
"nbformat_minor": 5
}
|