id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,284 | https://bio-protocol.org/exchange/protocoldetail?id=1284&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of the Number of Peroxisomes
MS Michitaro Shibata
Kazusato Oikawa
SM Shoji Mano
Mikio Nishimura
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1284 Views: 9811
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
This is the detailed protocol for the measurement of the number of peroxisomes described by Shibata et al. (2013). It is difficult to count the number of organelles in a cell because of the thickness of plant leaves. To overcome this challenge, protoplasts were isolated from leaves, and the number of peroxisomes per protoplast was counted. This method can be applied to other organelles such as mitochondria that are labeled with GFP or its derivatives.
Keywords: Peroxisome Peroxisome-targeted GFP Protoplast Number of organelles
Materials and Reagents
Arabidopsis plant expressing peroxisome-targeted GFP (Mano et al., 2002)
Cellulase Onozuka R-10 (Yakult Honsha)
Macerozyme R-10 (Yakult Honsha)
MES
Mannitol
Enzyme solution (see Recipes)
Wash solution (see Recipes)
Equipment
Time tape (Time Med)
Mending tape (3M)
Aluminum foil
20 ml beaker
Shaker
Pasteur pipette
Test tube
Swing-out rotor centrifuge machine
Confocal laser scanning microscope (Zeiss, model: LSM510 META )
MAS-coated glass slide (super frost) (Matsunami Glass, catalog number: S9441 )
Cover slip (24 x 60 No.1, 0.12-0.17 mm) (Matsunami Glass, catalog number: C024601 )
Software
NIH ImageJ software 1.46 for Windows (http://imagej.nih.gov/ij)
Note: ImageJ is also available on Mac OS X and Linux.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shibata, M., Oikawa, K., Mano, S. and Nishimura, M. (2014). Measurement of the Number of Peroxisomes. Bio-protocol 4(21): e1284. DOI: 10.21769/BioProtoc.1284.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell structure
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,285 | https://bio-protocol.org/exchange/protocoldetail?id=1285&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assay of the Glycosyltransferase Activity of a Heterologously Expressed Plant Protein
CA Carsten P Ade
FB Felix Bemm
JD James M J Dickson
CW Christian Walter
PH Philip J Harris
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1285 Views: 11153
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Glycosyltransferases are carbohydrate active enzymes containing catalytic modules involved in catalysing the biosynthesis of glycosidic bonds in oligo- and polysaccharides and glycoconjugates. One of the most comprehensive collections of Carbohydrate Active enZYmes is the CAZy database (http://www.cazy.org) comprising 120,000 glycosyltransferases allocated to 96 families based mainly on sequence homologies of their conserved and catalytically active domains (Cantarel et al., 2009). Interestingly, the glycosyltransferase activities of only about 1.6% of these proteins have been experimentally characterized (Lombard et al., 2014). In recent years, membrane-bound glycosyltransferases of a number of families have been shown to play a key role in the biosynthesis of plant cell-wall polysaccharides (Doblin et al., 2010; Scheller and Ulvskov, 2010; Driouich et al., 2012). They catalyze the transfer of glycosyl residues from donor nucleotide sugars to acceptors, forming the glycosidic bonds between adjacent glycosyl residues. Family 34 contains glycosyltransferases that have been shown to be involved in the biosynthesis of xyloglucans and transfer xylosyl residues to (1→4)-β-glucan chains (Keegstra and Cavalier, 2011). Our previous work suggests that Pinus radiata protein PrGT34B is a xyloglucan (1→6)-α-xylosyltransferase (Ade et al., 2014). Here, we describe a procedure for determining the xylosyltransferase activity of PrGT34B in vitro. We measured the transfer of xylose from the donor substrate UDP-xylose to different cello-oligosaccharide acceptor substrates under controlled reaction conditions. The assays include quantification of radioactively labeled reaction products and their identification by mass spectrometry. We also describe the purification, identification and quantification of the heterologously expressed recombinant protein PrGT34B in preparation for its use in the assays. This procedure may be applied to a wide range of glycosyltransferases in many different plant species.
Materials and Reagents
Spodoptera frugiperda cells (Sf9) (Life Technologies, InvitrogenTM, catalog number: 11496-015 )
Vector pFastBacHTaTM (Life Technologies, InvitrogenTM, catalog number: 10584-027 )
Escherichia coli (E. coli) strains DH10Bac (Life Technologies, InvitrogenTM, catalog number: 10359-016 )
20% ethanol
SDS
β-mercaptoethanol
Glycerol
Bromophenol blue
HEPES-NaOH (pH 7.0)
MgCl2
MnCl2
Triton X-100
Benzonase® nuclease (Novagen, catalog number: 70746 )
Protease inhibitors (complete EDTA free, protease inhibitor cocktail tablet) (Roche Diagnostics, catalog number: 0 4693159001 )
Imidazole
Cellotetraose, cellopentaose and cellohexaose (Associates of Cape Cod, Northstar BioProducts®, catalog numbers: 400402-1 , 400404-1 , 400406-1 )
Cellobiose (Sigma-Aldrich, catalog number: C7252 )
UDP-D-xylose (CarboSource Services, Complex Carbohydrate Research Center, product code: UDP-Xylose )
UDP-[14C-U]xylose (151.8 mCi/mmol) (PerkinElmer, catalog number: NEC543005UC )
TALON metal affinity resin (Takara Bio Company, Clontech, catalog number: 635501 )
BenchMark His-tagged protein standard (Life Technologies, InvitrogenTM, catalog number: LC5606 )
Precision Plus protein unstained standard (Bio-Rad Laboratories, catalog number: 161-0363 )
Mouse anti-His6 monoclonal antibody (GE Healthcare, product code: 27-4710-01 )
Horseradish peroxidase (HRP) conjugated secondary sheep anti-mouse antibody (GE Healthcare, product code: NA931-100UL )
SYPRO® Ruby protein gel stain (Life Technologies, Molecular Probes®, catalog number: S-21900 )
Ion exchange resin Dowex 1x8-200 (chloride form) (Sigma-Aldrich, catalog number: 217425 )
2,5-Dihydroxybenzoic acid (Sigma-Aldrich, catalog number: 85707 )
Starscint high flash-point LSC-cocktail (PerkinElmer)
PAGE loading dye (see Recipes)
Hypotonic lysis buffer (see Recipes)
Equilibration/wash buffer for IMAC (see Recipes)
Sample preparation buffer for IMAC (see Recipes)
IMAC elution buffer (see Recipes)
Reaction buffer for enzymatic assays (with radioactively labeled UDP-xylose) (see Recipes)
Reaction buffer for enzymatic assays (without radioactively labeled UDP-xylose) (see Recipes)
Equipment
Empty gravity-flow chromatography columns (20 ml volume) (Bio-Rad Laboratories, catalog number: 732-1010 )
Micro Bio-Spin chromatography columns (Bio-Rad Laboratories, catalog number: 732-6204 )
Amersham ECL detection system (GE Healthcare, product code: RPN2105 )
PVDF transfer membrane (Amersham Hybond-P) (GE Healthcare, product code: 10600023 )
NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific)
LAS-3000 Lite imager with software LAS-3000 Image Reader (Fujifilm Corporation)
FLA 2000 phosphorimager with software FLA 2000G (Fujifilm Corporation)
Rackbeta LKB Wallac (PerkinElmer, model: 1209 )
Voyager DETM PRO MALDI-TOF Workstation (Life Technologies, Applied Biosystems®)
Note: We believe that the reproducibility of the experiments does not depend on the precise equipment stated above but can be achieved using any other equivalent instrumentation.
Software
Software Multi Gauge v2.2 (Fujifilm Corporation)
Data Explorer (version 4.0.0.0) (Life Technologies, Applied Biosystems®)
Software FLA 2000G (Fujifilm Corporation)
Software LAS-3000 Image Reader (Fujifilm Corporation)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ade, C. P., Bemm, F., Dickson, J. M. J., Walter, C. and Harris, P. J. (2014). In vitro Assay of the Glycosyltransferase Activity of a Heterologously Expressed Plant Protein. Bio-protocol 4(21): e1285. DOI: 10.21769/BioProtoc.1285.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Plant Science > Plant biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,286 | https://bio-protocol.org/exchange/protocoldetail?id=1286&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stable Transformation of Cyanobacterium Synechocystis sp.
Reinhard K Proels
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1286 Views: 13286
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Cyanobacteria are prokaryotes, which perform oxygenic photosynthesis. Among them, the unicellular cyanobacterium Synechocystis sp. PCC 6803 (hereafter Synechocystis) is a well characterized model system for studies on oxygenic photosynthesis, light signal transduction etc. Moreover, Synechocystis is applied in biotechnological applications (Desai and Atsumi, 2013). Stable transformation of Synechocytis is achieved via the uptake of DNA and incorporation into the host genome by homologous double recombination. This allows for the generation of gene knock-outs (KO) by replacing the coding sequence of the gene of interest by a KO-cassette (comprising of a selection marker flaked by sequences of the gene of interest) or stable overexpression of certain genes of interest after insertion of a corresponding overexpression cassette at a neutral insertion site on the host genome. Stable transformation of Synechocystis was reported by Grigorieva and Shestakov (1982). Since then, variants of the initial protocol have been applied successfully to transform Synechocystis sp. Here we describe a lab-protocol that was applied successfully for stable transformation of Synechocystis (Schwarzkopf et al., 2014).
Keywords: Transformation Cyanobacteria Synechocystis sp.
Materials and Reagents
Synechocystis sp. PCC 6803 wild-type (WT) strain [see Schwarzkopf et al. (2014) for details]
Antibiotics
Chloramphenicol (Merck KGaA, catalog number: 2366 )
Kanamycin sulfat (Carl Roth, catalog number: T832.1 )
Spectinomycin (Duchefa Biochemie, catalog number: S 0188.0025 )
Phyto agar (Duchefa Biochemie, catalog number: P1003.1000 )
NaNO3 (Carl Roth, catalog number: 8601.2 )
K2HPO4 (Carl Roth, catalog number: P749.2 )
MgSO4.7 H2O (Carl Roth, catalog number: P027.2 )
CaCl2.2 H2O (Sigma-Aldrich, catalog number: 223506 )
Citric acid (Carl Roth, catalog number: 1818.1 )
Ferric ammonium citrate (III+) (Carl Roth, catalog number: CN77.1 )
EDTA Na2 (Carl Roth, catalog number: 8043.2 )
Na2CO3 (Sigma-Aldrich, catalog number: S-1641 )
H3BO3 (Carl Roth, catalog number: 6943.3 )
MnCl2.4 H2O (Sigma-Aldrich, catalog number: M3634 )
ZnSO4.7 H2O (Merck KGaA, catalog number: 0 143532 )
Na MoO4.5 H2O (Carl Roth, catalog number: 0274.3 )
CuSO4.5 H2O (Carl Roth, catalog number: P025.1 )
Co(NO3)2.6 H2O (Merck KGaA, catalog number: A834336548 )
Na2S2O3.5 H2O (Merck KGaA, catalog number: K5023616 )
BG11 medium (see Recipes)
BG11 agar plates (see Recipes)
Common antibiotics used (see Recipes)
Equipment
Petri dishes (Greiner Bio-one, catalog number: 632180 )
2 ml-reaction tubes (Eppendorf)
Tape (Gotha-VLIES, 10 m x 1.25 cm) (Gothaplast, catalog number: PZN-7105417 )
Centrifuge (Eppendorf, model: 5810R )
Shaking incubator with illumination (Sartorius, model: Certomat® BS-T )
Light shelves provided with light bulbs (NARVA LT 36W/760-010 daylight) (Brand-Erbisdorf)
Photometer (Pharmacia LKB-Ultrospec III)
Flow cabinet (Heraeus, HERAsafe, model: HS12 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Proels, R. K. (2014). Stable Transformation of Cyanobacterium Synechocystis sp.. Bio-protocol 4(21): e1286. DOI: 10.21769/BioProtoc.1286.
Schwarzkopf, M., Yoo, Y. C., Huckelhoven, R., Park, Y. M. and Proels, R. K. (2014). Cyanobacterial phytochrome2 regulates the heterotrophic metabolism and has a function in the heat and high-light stress response. Plant Physiol 164(4): 2157-2166.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Transformation
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,287 | https://bio-protocol.org/exchange/protocoldetail?id=1287&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fractionation by Ultracentrifugation of Gram Negative Cytoplasmic and Membrane Proteins
SS Sara M Sandrini
RH Richard Haigh
PF Primrose P. E. Freestone
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1287 Views: 19522
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Protein fractionation is a useful separation process which divides membrane proteins (including those located in the outer and inner membrane) and cytoplasmic proteins into discrete fractions. Fractionation of proteins can simplify analysis of the numbers of proteins present, and therefore make easier to characterize any environmentally or mutation induced changes in expression profiles, or changes in protein strucutre resulting from post-translational modification. This protocol is derived from Haigh et al. (2013) and it is specific to Gram negative bacteria.
Materials and Reagents
Bacterial culture media (subject to the needs of the bacterium being studied; for Escherichia coli, Luria Broth or DMEM are suitable)
Tris base (Thermo Fisher Scientific)
Triton X-100 (Sigma-Aldrich) (optional)
Tris-Triton (TT)
HCl (Hydrochloric acid)
TT (see Recipes)
Equipment
Bench top ultracentrifuge (e.g. Beckman Coulter, model: TL-100 ) capable of up to 50,000 rpm for culture volumes of 25 ml or less, and a larger mainframe ultracentrifuge for larger culture volume preparations
Bench top centrifuge capable of up to 12,225 x g
Sonicator
Spectrophotometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sandrini, S. M., Haigh, R. and Freestone, P. P. E. (2014). Fractionation by Ultracentrifugation of Gram Negative Cytoplasmic and Membrane Proteins. Bio-protocol 4(21): e1287. DOI: 10.21769/BioProtoc.1287.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial cell biology > Organelle isolation
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,288 | https://bio-protocol.org/exchange/protocoldetail?id=1288&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pain Assessment Using the Rat and Mouse Formalin Tests
Nian Gong
Qian Huang
Yuan Chen
Meng Xu
Shuai Ma
Yong-Xiang Wang
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1288 Views: 26434
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The formalin test was originally developed by Dubuisson and Dennis (1977), and has since been extensively used to assess pain-related responses. Rats and mice are the most frequently used animal models, though other species including cats, rabbits, guinea pigs, Octodon degus, domestic fowls, crocodiles, tortoises, toads and primates have also been employed. The injection of formalin into the skin of rodent hindpaws to cause spontaneous pain-related flinch behaviors is the most commonly used procedure. The resulting nociceptive response can be divided into two phases differing in timing, duration and underlying mechanisms, and is responsive to many classes of analgesic drugs (Coderre et al., 1990; Hunskaar and Hole, 1987; Rosland et al., 1990; Taylor et al., 1995). The behavioral and electrophysiological responses to formalin consist of an acute phase (Phase I) of a short-lasting response, which is believed to reflect the activity of C-fiber afferent nociceptors. After a short quiescent period, the acute phase is followed by a continuous prolonged response (Phase II), which is believed to be due to central sensitization of the spinal dorsal horn neurons as a result of the initial barrage of input from C-fiber nociceptive afferents during the early phase (Coderre et al., 1993; Dickenson and Sullivan, 1987; Raboisson et al., 1995; Shibata et al., 1989). In this respect, the formalin test has been regarded as a more satisfactory model of pain than tests producing phasic pain like the hot-plate and tail-flick tests (Abbott et al., 1981). Here, we describe the procedures for generating an efficient and reproducible formalin test in rats and mice.
Keywords: Formalin test Pain Rat Mice Spinal cord
Materials and Reagents
Eight-week-old Wistar (or other strain) rats (body weight 200-250 g)
Eight-week-old Swiss mice or a variety of transgenic/knockout mice (body weight 20-25 g)
Sterile normal saline (0.9% NaCl solution) (Thermo Fisher Scientific, catalog number: BR0053G ) or other vehicles for the test articles
Formaldehyde solution (37 wt.% in H2O) (Sigma-Aldrich, catalog number: 252549 )
5% formalin in saline (see Recipes)
Equipment
Body weight scales for rats (range 0.01-2,000 g) (Shenzhen Amput Electronic Technology Co., catalog number: APTP452) and mice (range 0.01-300 g) (Shenzhen Amput Electronic Technology Co., catalog number: APTP457B)
Permanent black marker (Thermo Fisher Scientific, catalog number: S02727)
Individual transparent polycarbonate observation chambers with hinged lids (the formalin test chamber: 30 x 20 x 15 cm for rats and 15 x 15 x 15 cm for mice)
Mirrors (two or more mirrors are recommended to cover the experimental area)
Thick cotton bag with an open end
0.5-ml syringes with 28-G needles (Thermo Fisher Scientific, catalog number: 22-004-271) or 50-μl Hamilton syringes with 30-G needles (Hamilton Company, catalog number: 80508)
Hand-held counters
Timers (two timers are recommended)
Figure 1. Example preparation for the rat formalin test
Software
Prism software (version 5.01, GraphPad Software Inc.)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Gong, N., Huang, Q., Chen, Y., Xu, M., Ma, S. and Wang, Y. (2014). Pain Assessment Using the Rat and Mouse Formalin Tests. Bio-protocol 4(21): e1288. DOI: 10.21769/BioProtoc.1288.
Gong, N., Xiao, Q., Zhu, B., Zhang, C. Y., Wang, Y. C., Fan, H., Ma, A. N. and Wang, Y. X. (2014b). Activation of spinal glucagon-like peptide-1 receptors specifically suppresses pain hypersensitivity. J Neurosci 34(15): 5322-5334.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems
Neuroscience > Behavioral neuroscience > Cognition
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,289 | https://bio-protocol.org/exchange/protocoldetail?id=1289&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Intestinal Permeability in Mice
Jalaj Gupta
AN Angel R. Nebreda
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1289 Views: 45646
Reviewed by: Kate HannanIsabel Cristiane da Silva
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The intestinal epithelial layer serves as a barrier against pathogens and ingested toxins, which are present in the lumen of the intestine. The importance of the intestinal epithelial barrier is emphasized by the alterations in paracellular permeability and tight junction functions observed in inflammatory bowel disease (IBD) and colon cancer.
Keywords: epithelial barrier inflammation tumor FITC-dextran
Materials and Reagents
8-10-week old mice (in-house bred mice mostly C57BL/6 background; both male and female)
Fluorescein isothiocyanate conjugated dextran (FITC-dextran) (Sigma-Aldrich, catalog number: FD4 )
Sterile 1x phosphate-buffered saline (PBS) (pH 7.4)
Anesthesia (isoflurane) (ESTEVE, catalog number: 103287025 )
Equipment
BD Microtainer SST tubes (BD Biosciences, catalog number: 365968 )
1 ml syringes (ENFA, catalog number: JS1 )
Autoclaved oral gavage needles (22 Gauge /25 mm long) (Fine Science Tools, catalog number: 18061-22 )
Spectrophotofluorometer (BioTek Instruments, catalog number: FLx800 )
96-well microplates (flat bottom) (Corning, catalog number: 3650 )
Dissection equipment (forceps, tweezers, scissors)
Balance
Table top anesthesia machine (Parkland Scientific, catalog number: V3000PK )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gupta, J. and Nebreda, A. R. (2014). Analysis of Intestinal Permeability in Mice. Bio-protocol 4(22): e1289. DOI: 10.21769/BioProtoc.1289.
Download Citation in RIS Format
Category
Cell Biology > Tissue analysis > Tissue staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
129 | https://bio-protocol.org/exchange/protocoldetail?id=129&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expansion of Worms for Microarray, IP, ChIP and Similar Experiments
Peichuan Zhang
Published: Sep 5, 2011
DOI: 10.21769/BioProtoc.129 Views: 11601
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes the basic work-flow of expanding nematode culture under lab conditions, which serves for the subsequent preparation of RNA (microarray), protein (IP), and DNA/protein (ChIP).
Materials and Reagents
Plates and culture materials:
High growth (HG) plates
Normal growth (NG) plates
OP50 or RNAi bacteria culture
LB medium (autoclaved)
Note: Prepare enough plates (with extra ones to replace contaminated plates).
Other materials:
Antibiotics (carbenicillin, tetracycline)
IPTG
Cholesterol
CaCl2
MgSO4
KPO4
KOH
Sodium hypochlorite
M9 buffer
NP40 buffer
O/N culture
Triton X-100 (Sigma-Aldrich, catalog number: 9002-93-1 )
Sodium hypochlorite (Thermo Fisher Scientific, catalog number: SS290-1 )
2x bleach solution (see Recipes)
Equipment
Beckman centrifuge and rotor (Beckman Coulter)
Low-temperature incubator (Thermo Fisher Scientific)
15-ml conical tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > Microarray
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,290 | https://bio-protocol.org/exchange/protocoldetail?id=1290&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Induction of Colitis and Colitis-associated Colorectal Cancer (CAC)
Jalaj Gupta
AN Angel R. Nebreda
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1290 Views: 15620
Reviewed by: Kate HannanIsabel Cristiane da Silva
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Inflammatory bowel disease (IBD) including Crohn’s disease and ulcerative colitis are characterized by chronic, progressive and relapsing inflammatory disorders. Existing evidence indicate that IBD is associated with a higher risk of developing CAC, which is directly related to the duration and extent of colitis. Thus, animal models have been developed to understand the biology of colitis and CAC. The most commonly used model of colitis is to treat with dextran sodium sulfate (DSS). DSS given in the drinking water is toxic to the colonic epithelial lining and induces bloody diarrhea, ulceration and inflammation, similar to colitis in IBD patients. To study CAC, DSS treatment is combined with a single intraperitoneal injection of the DNA alkylation reagent Azoxymethane (AOM).
Keywords: inflammation tumor intestine mouse carcinogen
Materials and Reagents
8-10 weeks old mice (in-house bred mice mostly C57BL/6 background, both male and female; we also used mice with mixed C57BL/6-129v background to induce colon tumors)
Azoxymethane (AOM) (Sigma-Aldrich, catalog number: A5486 )
DSS salt (molecular weight 36,000-50,000 Da) (MP Biomedicals, catalog number: 0126011090-500 g)
Sterile 1x phosphate-buffered saline (PBS)
10% formalin solution (Sigma-Aldrich, catalog number: HT-501128)
Autoclaved drinking water
Equipment
1 ml and 5 ml syringes (ENFA, catalog numbers: JS1 and JS3)
10 cm Petri dish, tissue culture grade (BD Biosciences, Falcon®, catalog number: 353006)
Needles (25 G for AOM injection and 21 G to wash the colon)
Digital caliper (Sylvac, catalog number: S_Cal WORK 910.0502.10)
Dissection equipment (forceps, tweezers, scissors)
Balance
Tissue processor (Sakura, catalog number: VIP6-E2)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Inflammation > Animal models
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,291 | https://bio-protocol.org/exchange/protocoldetail?id=1291&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Golgi Membranes from Rat Liver
CV Carmen Valente
GT Gabriele Turacchio
SS Stefania Spanò
AL Alberto Luini
DC Daniela Corda
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1291 Views: 8636
Edited by: Lin Fang
Reviewed by: Kate Hannan
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
This protocol details the isolation of enriched Golgi membranes from rat liver, using discontinuous density gradient centrifugation. This high-yield extraction method is useful for several applications, including immunoprecipitation of solubilised Golgi membrane proteins (preparation included) and electron microscopy. Protocol adapted from Leelavathi et al. (1970).
Keywords: Golgi membranes Density gradient centrifugation Solubilised Golgi membrane proteins Rat liver Tissue isolation
Materials and Reagents
Fresh rat liver tissue (30 mg)
HEPES (Sigma-Aldrich, catalog number: H4034 )
KCl (Baker, catalog number: 0 208 )
Triton X-100 (ACROS, catalog number: 215680010 )
EDTA (Baker, catalog number: 1073 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
β-Glycerophosphate (Sigma-Aldrich, catalog number: G9422 )
NaF (Sigma-Aldrich, catalog number: S7920 )
Protease inhibitor cocktail (complete Mini EDTA-free) (Roche Diagnostics; or equivalent) (Roche Diagnostics, catalog number: 0 5056489001 )
Protein assay kit (Bio-Rad Laboratories, catalog number: 500-0006 )
MgCl2 (Sigma-Aldrich, catalog number: 16104 )
Sucrose (Sigma-Aldrich, catalog number: 16104; extra pure grade) (see Recipes)
Phosphatase inhibitor cocktail (Roche Diagnostics, catalog number: 04906837001 ) (see Recipes)
Equipment
Ultraturrax homogeniser (T 25 digital ULTRA-TURRAX® IKA® Werke Staufen/Germany)
Centrifuge (Ultracentrifuge, Beckman Coulter, model: Optima XE-100; ultra clear centrifuge tubes, catalog number: 344058 )
SW28 (or equivalent) swing-out rotor [swinging bucket rotor, catalog number: 2352 ; Beckman SW 28 (Beckman Coulter, catalog numbers: 342207 , 342204 ), with titanium buckets 6 x 38.5 ml, 25 x 89 mm, 28,000 rpm, 141,000 x g]
Bausch and Lomb refractometer (Lab Logistics Group GmbH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Organelle isolation > Golgi
Cell Biology > Organelle isolation > Membrane
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,292 | https://bio-protocol.org/exchange/protocoldetail?id=1292&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of FAP Cells from Mouse Dystrophic Skeletal Muscle Using Fluorescence Activated Cell Sorting
Nicoletta Cordani
VP Viviana Pisa
LP Laura Pozzi
Clara Sciorati
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1292 Views: 14265
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
A population of muscle resident CD45-, CD31- cells expressing the mesenchymal PDGF receptor alpha (PDGFRα) as well as Sca-1 was first isolated in healthy mouse muscles in Uezumi et al. (2010). In the same year, Joe et al. (2010) identified and purified fibro-adipogenic precursors (FAPs), cells located into the interstitial space between myofibers close to vessels, negative for CD45, CD31,α7-Integrin, but expressing CD34, Sca-1.
Both groups demonstrated that these cells are not myogenic in vitro or in vivo, but they are capable of differentiating in vitro towards both fibrogenic and adipogenic lineage (Uezumi et al., 2011). Further marker analysis indicates that the two groups identified independently the same cell population (Natarajan et al., 2010).
FAPs are an important source of fibrosis and adipogenesis in dystrophic skeletal muscle (Natarajan et al., 2010; Cordani et al., 2014). We have recently demonstrated that Nitric Oxide regulates FAP fate inhibiting in vitro their differentiation into adipocytes. In mdx mice, an animal model of DMD, fed with a diet containing the nitric oxide donating drug, Molsidomine, the number of PDGFRα+ cells was reduced as well as the deposition of both skeletal muscle fat and connective tissues (Cordani et al., 2014). Here we described a method to isolate in both wild type and in mdx dystrophic muscle pure population of FAPs by double selection for SCA-1 and PDGFRα positivity in absence of the satellite cell markers SM/C2.6 and α7integrin as well of the pan-lymphocytes marker CD45 or endothelial marker CD31.
Keywords: Fibroadypose precursors Skeletal muscle Fluorescence cell sorting Mouse dystrophy model Satellite cells
Materials and Reagents
8-10 weeks old mice C57BL/6J wild-type mice (Charles River Laboratories International, http://www.criver.com) and mdx-4cv mice (B6Ros.Cg-Dmdmdx-4cv/J, crossed on C57/BL/6 background; Jackson ImmunoResearch Laboratories)
Note: Animals were treated in accordance with European Community guidelines and with the approval of the Institutional Ethical Committee.
Collagenase II (Worthington Biochemical, catalog number: CLSS2 )
Dulbecco's modified high glucose Eagle's medium (DMEM high glucose) (EuroClone, catalog number: ECB7501L )
100 U/ml penicillin and 100 μg/ml streptomycin (EuroClone)
L-glutammine (EuroClone)
Recombinant human basic fibroblast growth factor (b-FGF) (Pepro Tech, catalog number: 100-18B )
Growth factor reduced BD MatrigelTM Matrix (BD Biosciences, catalog number: 356230 )
Foetal Bovine Serum (FBS) (EuroClone)
Sterile phosphate buffered saline (PBS) w/o Ca++Mg++ (EuroClone)
Antibodies
Anti-CD31-phycoerythrin/Cy7 (anti-CD31-PE/Cy7, clone 390) (eBioscience, catalog number: 25-0311 )
Anti-CD45-PECy7 (clone 30-F11) (eBioscience, catalog number: 15-0451 )
Anti-SM/C2.6-Biotin (kindly provided by Dr. Fukada) (Fukada et al., 2004)
Streptavidin-PE (BioLegend)
Anti-α7-Integrin-PE (clone R2F2) (AbLab Laboratorio di Istologia e Citologia Patologica Veterinaria, catalog number: AB10RS24MW215 )
Anti-PDGFRα-allophycocyanin (APC, CD140a, clone APA5) (BioLegend, catalog number: 135907 )
Anti-LY-6A/E SCA-1-allophycocyanin/Cy7 (APC/Cy7, clone B7) (BD Biosciences, catalog number: 560654 )
7-aminoactinomycin D (7-AAD) (Life Technologies, catalog number: A1310 )
Growth medium (GM) (see Recipes)
Wash buffer (WB) (see Recipes)
Collagenase II solution (see Recipes)
Erythrocytes lysis buffer (see Recipes)
Note: Use 1 ml of this solution for approximately 1 g of muscle.
Sorting buffer (see Recipes)
Matrigel solution (see Recipes)
b-FGF solution (see Recipes)
Equipment
Scissors and tweezers
Cell culture plastic dishes (Corning, Costar®)
Six multiwells (Corning, Costar®)
Centrifuge
50 and 15 ml plastic tubes
18G-10 ml syringes
70 μm and 40 μm cell strainer caps (BD Biosciences)
Beckam Coulter Cell Sorter MoFloTM XDP (Beckman Coulter, catalog number: ML99030 )
Cell culture incubator at 37 °C and 5% CO2
Microscope or cell counter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Muscle stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,293 | https://bio-protocol.org/exchange/protocoldetail?id=1293&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification and Sequencing of DNA Guides from Prokaryotic Argonaute
Daan C. Swarts
EW Edze R. Westra
Stan J. J. Brouns
John van der Oost
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1293 Views: 13929
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Some proteins utilize nucleic acids to guide them to complementary nucleic acid targets. One example is prokaryotic Argonaute protein, which, binds small single stranded DNA molecules as guides (Swarts et al., 2014). This protocol describes a method to purify DNA guides from these proteins. It also describes a PCR-based method to enrich the guides by PCR amplification. This methods relies on addition of a poly-A tail at the 3’-end of the ssDNA molecules by Terminal Deoxynucleotidyl Transferase (TdT), followed by ligation of a oligonucleotide to the 5’-end of the ssDNA molecule using T4 RNA ligase, and amplification by PCR. The generated dsDNA products are suitable for traditional cloning and sequencing and high-throughput sequencing. Importantly, the information which strand matches the ssDNA molecule is not lost during this process.
Materials and Reagents
Purifying nucleic acids from proteins
Purified protein and co-purified nucleic acids in purification buffer (e.g. TtAgo with siDNA guides)
Note: Please refer to the protocol “Expression and Purification of the Thermus thermophilus Argonaute Protein” (Swarts et al., 2014b).
Proteinase K solution (20 mg/ml) (Life Technologies, Ambion®, catalog number: AM2548 )
CaCl2 solution (50 μM)
Roti phenol/chloroform/isoamyl alcohol (pH 7.5-8.0) (Carl Roth, catalog number: A156 )
99% ethanol
70% ethanol (pre-cooled to -20 °C)
Linear acrylamide (5 mg/ml) (Life Technologies, Ambion®, catalog number: AM9520 )
Note: Alternatively, a house-made Linear Acrylamide can be used (http://www.uvm.edu/~tpdelane/lab/protocols/LinearPolyAcryl.htm).
RNase free MQ water
Additional materials and reagents required for analysis of purified nucleic acids (optional)
T4 polynucleotide kinase (PNK) (New England Biolabs, catalog number M0201 )
T4 polynucleotide kinase reaction buffer (New England Biolabs, catalog number M0201)
Enriching and preparing ssDNA molecules for sequencing
Purified single stranded DNA nucleotides in MQ water (e.g. see Procedure part A "purifying nucleic acids from proteins")
RNase A (DNase and protease-free) (10 mg/ml) (Thermo Fisher Scientific, catalog number: EN0531 )
Terminal Deoxynucleotidyl transferase (TdT) (recombinant) (Life Technologies, InvitrogenTM, catalog number: 10533-073 )
Terminal Deoxynucleotidyl transferase (TdT) buffer (Life Technologies, InvitrogenTM, catalog number: 16314-015 )
dATP (100 mM) (Thermo Fisher Scientific, catalog number: R0141 )
QIAquick nucleotide removal kit (QIAGEN, catalog number: 28304 )
Primer A (5’-GAGAGAGGATCCCGAATTGTGCAGCTGTCAATCAACC-3’) (5 μM)
T4 RNA ligase 1 (New England BioLabs, catalog number: M0204 )
T4 RNA ligase reaction buffer (10x, supplied with T4 RNA ligase 1)
ATP (10 mM) (supplied with T4 RNA ligase 1)
PEG8000 (supplied with T4 RNA ligase 1)
Primer B (5’-GAGAGAGGATCCTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3’) (5 μM)
Pfu DNA polymerase (or equivalent)
10x Pfu DNA polymerase buffer (or equivalent, supplied with MgCl2 or MgSO4)
dNTPs (5 μM)
2% agarose gel
Generuler low range DNA ladder (Thermo Fisher Scientific)
GeneJET gel extraction kit (Thermo Fisher Scientific, Fermentas, catalog number: K0691 )
Note: Additional materials and reagents required only if ssDNA is not 5’-end phosphorylated: T4 polynucleotide kinase (PNK, New England Biolabs, catalog number: M0201) and T4 polynucleotide kinase reaction buffer (New England Biolabs, catalog number: M0201).
Equipment
Purifying nucleic acids from proteins
Heat block
PCR machine
Cooled table top Eppendorf centrifuge
Freezer (-20 °C)
Enriching and preparing ssDNA molecules for sequencing
Heat block
PCR machine
Table top centrifuge
Agarose gel electrophoresis equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA extraction
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,294 | https://bio-protocol.org/exchange/protocoldetail?id=1294&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of Tumor-Associated Macrophages (TAM) and Tumor-Associated Dendritic Cells (TADC)
DL Damya Laoui
EO Eva Van Overmeire
JK Jiri Keirsse
KM Kiavash Movahedi
JG Jo A Van Ginderachter
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1294 Views: 27203
Edited by: HongLok Lung
Reviewed by: Hsin-Yi Chang
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Tumors are heterogeneous microenvironments where complex interactions take place between neoplastic cells and infiltrating inflammatory cells, such as tumor-associated macrophages (TAM) and tumor-associated dendritic cells (TADC). The relevance of tumor-infiltrating mononuclear myeloid cells is underscored by clinical studies showing a correlation between their abundance and poor prognosis (Laoui et al., 2011). These cells are able to promote tumor progression via several mechanisms, including induction of angiogenesis, remodeling of the extracellular matrix, stimulation of cancer cell proliferation and metastasis and the inhibition of adaptive immunity (Laoui et al., 2011). Moreover, mononuclear myeloid cells are characterized by plasticity and versatility in response to microenvironmental signals, resulting in different activation states, as illustrated by the presence of distinct functional TAM subsets in tumors (Movahedi et al., 2010; Laoui et al., 2014). Here, we describe a valuable isolation technique for TAM and TADC permitting their molecular and functional characterization.
Keywords: Tumor-associated macrophages Tumor-associated dendritic cells Tumor single cell suspension Macrophage purification Dendritic cell purification
Materials and Reagents
Mouse
RPMI-1640 medium (RPMI) (Life Technologies, catalog number: 52400-041 )
Collagenase I (Worthington Biochemical, catalog number: LS004214 )
Collagenase IV (Worthington Biochemical, catalog number: LS004209 )
DNase I (Worthington Biochemical, catalog number: LS002060 )
Hank’s buffered salt solution (HBSS) (Life Technologies, Gibco®)
NH4Cl (Merck KGaA)
KHCO3 (Merck KGaA)
EDTA (Duchefa Biochemie)
Fetal calf serum (FCS) (Life Technologies, Gibco®)
Lymphoprep (Axis-shield, catalog number: 1114547 )
LS colums (Miltenyi Biotec, catalog number: 130-042-401 )
Anti-CD11b microbeads (Miltenyi Biotec, catalog number: 130-049-601 )
Anti-CD11c microbeads (Miltenyi Biotec, catalog number: 130-052-001 )
Purified CD16/CD32 (FcBlock) (clone 2.4G2) (BD Biosciences, catalog number: 553142 )
PE-Cy7-conjugated anti-CD11b antibody (clone M1/70) (BD Biosciences, catalog number: 552850 )
AF647-conjugated anti-Ly6C antibody (clone ER-MP20) (Bio-Rad Laboratories, AbD Serotec®, catalog number: MCA2389A647 )
PerCP-Cy5.5-conjugated anti-I-A/I-E (MHC-II) antibody (clone M5/114.15.2) (BioLegend, catalog number: 107626 )
FITC-conjugated anti-Ly6G antibody (clone 1A8) (BD Biosciences, catalog number: 551460 )
PE-conjugated anti-SiglecF antibody (clone E50-2440) (BD Biosciences, catalog number: 552126 )
PE-conjugated anti-CD11c antibody (clone HL3) (BD Biosciences, catalog number: 553802 )
Tumor digestion medium (see Recipes)
Erythrocyte lysis buffer (see Recipes)
MACS buffer (see Recipes)
Sorting buffer (see Recipes)
Complete medium (see Recipes)
Equipment
Polyester filters cut in 10 x 10 cm squares (thread diameter 70 μm) (Spectrum® Laboratories, catalog number: 146490 )
6-well plates (Greiner Bio-One GmbH, catalog number: 657185 )
10 ml syringes (Omnifix, catalog number: 473203 )
BD Falcon 50 ml polypropylene tubes (BD Biosciences, catalog number: 2070 )
BD Falcon 15 ml polypropylene tubes (BD Biosciences, catalog number: 2096 )
BD Falcon 5 ml polypropylene round-bottom tube (BD Biosciences, catalog number: 352063 )
Sterile culture hood
Surgical scissors and forceps
37 °C, 5% CO2 cell culture incubator
Pipettes
Centrifuges
Shaker
Microscope
MidiMACSTM Separator and MultiStand (Miltenyi Biotec, catalog number: 130-042-301 )
Multicolour FACS sorter (BD Biosciences, Aria flow cytometer)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Laoui, D., Overmeire, E. V., Keirsse, J., Movahedi, K. and Ginderachter, J. A. V. (2014). Purification of Tumor-Associated Macrophages (TAM) and Tumor-Associated Dendritic Cells (TADC). Bio-protocol 4(22): e1294. DOI: 10.21769/BioProtoc.1294.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Animal models
Immunology > Immune cell isolation > Macrophage
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,295 | https://bio-protocol.org/exchange/protocoldetail?id=1295&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infectious Focus Assays and Multiplicity of Infection (MOI) Calculations for Alpha-herpesviruses
Anna Sloutskin
RG Ronald S. Goldstein
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1295 Views: 43015
Reviewed by: Valeria Lulla
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Titration of viral stocks is a critical process before any experimental use of the virus. Here we describe an infectious focus assay for several alphaherpesviruses, a titration method for fluorescently labeled viruses, based on the original plaque assay. In addition, the calculation of multiplicity of infection (MOI) is presented.
Keywords: Multiplicity of infection Viral infection Herpesvirus
Materials and Reagents
Standard cell line [e.g. MeWo (ATCC® HTB-65 TM); ARPE19 (ATCC® CRL-2302TM); Vero (ATCC® CCL-81 TM)]
Fluorescently labeled virus stock (genetically engineered VZV-66GFP, HSV1-gC-GFP and PRV-IE180-GFP were kindly provided by Prof. Paul R. Kinchington, University of Pittsburgh, Pittsburgh PA)
Growth medium for the cells listed above (e.g. item #6, Fibroblast medium)
Note: However, it can be any other medium for other pairs of virus and cells.
4% paraformaldehyde (EMS 15710) in phosphate buffered saline with divalent cations (e.g. Biological Industries, catalog number: 020201A )
High glucose DMEM (Biological Industries, catalog number: 010551A )
Fetal calf serum (Biological Industries, catalog number: 041271A )
Glutamine (Biological Industries, catalog number: 030201 )
Penicillin-streptomycin (Biological Industries, catalog number: 030311 )
Agarose low EEO (Hispanagar, catalog number: D1500 )
Fibroblast medium (see Recipes)
Overlaying media for free virus (see Recipes)
Crystal violet (Sigma-Aldrich, catalog number: C0775 ) (see Recipes)
Equipment
24-well tissue culture plates
Incubator 37 °C, 5% CO2
Epifluorescent inverted microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial cell biology > Cell imaging
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,296 | https://bio-protocol.org/exchange/protocoldetail?id=1296&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Detection of S-acylation on Recombinant Proteins via the Biotin-Switch Technique
DQ Dong Qi
Roger W. Innes
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1296 Views: 9270
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Protein palmitoylation is the post-translational modification of proteins via the attachment of palmitate through acyl linkages. The nucleophile sulfhydryl group of cysteines is the common palmitoylation site. Covalent attachment of palmitate occurs on numerous proteins and is usually associated with directing protein localization to the endomembrane system. Detection of protein palmitoylation by in vivo labeling with tritium-labeled palmitic acid typically requires an autoradiographic exposure time of several months, and, thus is not suitable for rapid analyses. Here, we described an easy protocol for quick in vitro detection of protein S-acylation using the Arabidopsis protein kinase, PBS1, as an example. To determine whether PBS1 is modified through thioester linkage to acyl groups, we employed a “biotin switch” assay (Hemsley et al., 2008). This work was first published in Qi et al. (2014), but we expand on the method here. PBS1 functions within the basal immune system of plants, and is a target of the bacterial cysteine protease, AvrPphB (Shao et al., 2002; Zhang et al., 2010). It contains a predicted N-terminal S-acylation motif (MGCFSCFDS), with both Cys-3 and Cys-6 residues predicted to be palmitoylated by CSS-Palm 3.0 (http://csspalm.biocuckoo.org/; Ren et al., 2008). Our method utilizes hydroxylamine-induced cleavage of thioester bonds, which results in free sulfhydryl groups that can then be conjugated to a biotin derivative, 1-biotinamido-4-[4′-(maleimidomethyl) cyclohexanecarboxamido]-butane (Biotin-BMCC). The conjugates are detectable by Western blot with streptavidin-horseradish peroxidase. The whole process of in vitro labelling and detection took less than 3 days, allowing the fast detection of protein modifications via thioester bonds such as palmitoylation.
Materials and Reagents
Nicotiana benthamiana (N. benthamiana) plants
Agrobacterium tumefaciens strain GV3101 (pMP90)
Bacto yeast extract (BD Biosciences, catalog number: 288620 )
Bacto tryptone (BD Biosciences, catalog number: 211699 )
Magnesium chloride hexahydrate (EMD Millipore, catalog number: 442611 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406-5G )
Dexamethasone (Sigma-Aldrich, D4902-1G )
Trizma Tris base (Sigma-Aldrich, catalog number: 93362 )
Sodium chloride (EMD Millipore, catalog number: 567442 )
Nonidet P-40(Sigma-Aldrich, catalog number: 21-3277 )
Plant proteinase inhibitor cocktail (Sigma-Aldrich, catalog number: P9599-5M )
SDS (Sigma-Aldrich, catalog number: L3771-100G )
Glycerol (EMD Millipore, catalog number: 356350 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148-25ML )
EDTA (Sigma-Aldrich, catalog number: E6758-100G )
BSA (Sigma-Aldrich, catalog number: A4503-100G )
Bromphenol blue (EMD Millipore, catalog number: BX1410 )
Anti-HA monoclonal antibody matrix (Roche Diagnostics, catalog number: 11867423001 )
Tris-HEPES-SDS polyacrylamide gels (Thermo Fisher Scientific, catalog number: 25204 )
Anti-HA peroxidase (Sigma-Aldrich, catalog number: H6533-1VL )
High Sensitivity Streptavidin-HRP Conjugate (Thermo Fisher Scientific, catalog number: 21130 )
ImmunoStar HRP Substrate Kit (Bio-Rad Laboratories, catalog number: 170-5070 )
N-ethylmaleimide (Sigma-Aldrich, catalog number: E3876-5G )
Hydroxylamine (Sigma-Aldrich, catalog number: 467804-10ML )
1-biotinamido-4-[4′(maleimidomethyl)-cyclohexane-carboxamido]-butane (EZ-link BMCC-Biotin) (Thermo Fisher Scientific, catalog number: 21900 )
Nitrocellulose Membrane (Thermo Fisher Scientific, catalog number: WP4HY00010 )
Metro-Mix 360 (Sun Gro Horticulture Canada)
LB liquid medium (see Recipes)
Lysis buffer (see Recipes)
4x SDS loading buffer (see Recipes)
5x nonreducing protein sample buffer (see Recipes)
Equipment
Confocal microscope system (Leica Microsystem, model: TCS SP5 )
Mini-Protean Electrophoresis and Blotting system (Bio-Rad Laboratories)
Benchtop Centrifuge 5424 (Eppendorf)
Lab tube rotator (Thermo Fisher Scientific)
Gene Pulser (Bio-Rad Laboratories, catalog number: 1652076 )
1 ml syringe (BD Biosciences, catalog number: 305945 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Qi, D. and Innes, R. W. (2014). In vitro Detection of S-acylation on Recombinant Proteins via the Biotin-Switch Technique. Bio-protocol 4(22): e1296. DOI: 10.21769/BioProtoc.1296.
Qi, D., Dubiella, U., Kim, S. H., Sloss, D. I., Dowen, R. H., Dixon, J. E. and Innes, R. W. (2014). Recognition of the protein kinase AVRPPHB SUSCEPTIBLE1 by the disease resistance protein RESISTANCE TO PSEUDOMONAS SYRINGAE5 is dependent on S-acylation and an exposed loop in AVRPPHB SUSCEPTIBLE1. Plant Physiol 164(1): 340-351.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,297 | https://bio-protocol.org/exchange/protocoldetail?id=1297&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Semi-denaturing Detergent Agarose Gel Electrophoresis (SDD-AGE)
Laura Molina-García
Fátima Gasset-Rosa
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1297 Views: 22686
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Pathological proteins in neurodegenerative diseases suffer a conformational change to a misfolded amyloid state. Such pathological event leads to the aggregation of these proteins that indefinitely propagates as an altered form of itself, and harbor prion-like properties (Wickner, 1994; Prusiner, 2012). In addition to diseases, prions can also have beneficial adaptive roles in lower eukaryotes (in fungi and yeast) (Eaglestone et al., 1999; True et al., 2004; Coustou et al., 1999). Besides separating polymers from their precursor soluble monomers, another particular difficulty of the study of amyloid proteins is to resolve the heterogeneity of the aggregates, since these usually exhibit a variable degree of polymorphism. Semi-denaturating detergent agarose gel electrophoresis (SDD-AGE) is a technique that takes advantage of both the property of prions and prion-like polymers to be highly resistant to solubilization by SDS detergent, and the large pores sizes of agarose, that allow the resolution of high molecular weight complexes. In this method, we describe in detail how this technique can be used to characterize heterogeneous aggregation in bacteria and yeast (Gasset-Rosa et al., 2014; Molina-García and Giraldo, 2014), and further be applied to study the aggregation pattern of proteins that become prone to aggregation through genetic manipulation.
Materials and Reagents
Bacteria: Gram negative Escherichia coli (E. coli) or yeast Saccharomyces cerevisiae (S. cerevisiae)
Notes:
Amyloids exist in E. coli and S. cerevisiae. In both organism amyloids can be functional. In E. coli the most well know example is the curli protein which is assembled in the extracellular medium and allow the attechemnet of the bacteria to the surface and sustain the formation of biofilms (Chiti and Dobson, 2006; Chapman et al., 2002).
In S. cerevisiae, amyloids confer to cells selctive advantage under certain physiological conditions and they aren’t harmful (Chien et al., 2004; Shorter and Lindquist, 2005; Wickner et al., 2007), a few examples are Sup35p y Ure2p, Rnq1p. The conversion of Sup35 from soluble to the amyloid state drives the reduction of translation termination activity (Wickner et al., 1995).
Protease inhibitor cocktail (Roche Diagnostics, catalog number: 04 693 159 001 )
Silica beads (1 mm lysing matrix C) (MP Biomedicals, catalog number: 6912-050 )
Pure agarose D2 (Pronadisa, catalog number: 8034 )
Detergents: SDS (Bio-Rad Laboratories, catalog number: 161-0301 ) and Sarkosyl 97% N-lauroylsarcosine (Sigma-Aldrich, catalog number: L-9150 )
PVDF membrane (Bio-Rad Laboratories)
Antibodies
Notes:
Depends on the protein you work, the antibody may be against the protein that you are studying for aggregation. A recommended strategy if the user is going to generate a recombinant protein is to include a tag in the amino or carboxyl terminal of the protein and use a specific antibody against the tag. One example is the Histidine-tag, the corresponding antibody would be a Monoclonal anti-polyhistidine (Sigma-Aldrich, catalog number: H1029 ).
Antibodies that recognize monomer state may still be able to identify the protein in polymers even is the protein conformation has changed. Usually monomer antibodies have a broad range recognition epitopes. In our hands the antibodies used were:
For E. coli, house-made polyclonal antibodies against RepA (generated in rabbit immunized with soluble RepA), (Gasset-Rosa et al., 2014); and monoclonal anti poly-histidine against His-RepA (WH1) (Sigma-Aldrich, catalog number: H1029) (Molina-García and Giraldo, 2014). Both of them work.
For S. cerevisiae, anti-HA antibody (Roche Diagnostics, catalog number: 12CA5 ) against the HA (Human influenza hemagglutinin) tag of Sup35 protein (unpublished).
Cell culture medium
Luria Bertani (LB) medium (see Recipes)
Yeast extract peptone dextrose (YPD) (see Recipes)
Lysis buffer (see Recipes)
Running buffer (see Recipes)
Loading buffer (see Recipes)
Transference buffer (see Recipes)
Equipment
Fast Prep-MilliPore/MP FastPrep-24 homogenizer (catalog number: 6004-500 )
Horizontal agarose electrophoresis system (Electrophoresis power supply EPS601 General Electrics)
Wet/Tank transfer blotting system (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Molina-García, L. and Gasset-Rosa, F. (2014). Semi-denaturing Detergent Agarose Gel Electrophoresis (SDD-AGE). Bio-protocol 4(22): e1297. DOI: 10.21769/BioProtoc.1297.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,298 | https://bio-protocol.org/exchange/protocoldetail?id=1298&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Competitive ELISA for Protein-lipopolysaccharide (LPS) Binding
Victoria Martínez-Sernández
Florencio M. Ubeira
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1298 Views: 14251
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Lipopolysaccharide is the major constituent of the outer membrane of gram-negative bacteria and, once released from the bacterial surface into the bloodstream, is a potent activator of the host immune system, which can lead to septic shock. LPS has a hydrophilic region consisting of a repeating oligosaccharide that is strain-specific (O-antigen) and a core polysaccharide, which is covalently linked to a hydrophobic lipid moiety (lipid A). Lipid A is the most conserved part and is responsible for the toxicity of LPS. Therefore, finding molecules able to bind to this region and neutralize LPS toxicity is of relevant interest as it may provide new therapies to prevent septic shock (Chen et al., 2006). Several proteins and peptides were reported to bind LPS and alter its toxicity towards reduction and even enhancement (Brandenburg et al., 1998), such as serum albumin (Ohno and Morrison, 1989), lipopolysaccharide binding protein (LBP) (de Haas et al., 1999), casein (López-Expósito et al., 2008), lysozyme, the antibiotic polymyxin B and antimicrobial peptides (Chen et al., 2006). Although some of these proteins are neutral and even anionic/acidic (pI<7) (Jang et al., 2009), due to the amphipathic structure of LPS and the presence of negatively charged phosphate groups on the lipid A, the most important factors that are considered for optimal binding to LPS are a cationic/basic (pI>7) and amphipathic nature (Chen et al., 2006).
Here we describe a competitive ELISA that can be used to identify proteins or peptides that bind LPS, as a first approach before analyzing the possible activity in vitro and in vivo. In this ELISA, serial dilutions of the protein or peptide to be tested are preincubated with a fixed concentration of fluorescein isothiocyanate (FITC)-labeled LPS from Escherichia coli serotype O111:B4 and then added to wells of a microtitre plate which are blocked with a casein hydrolysate that binds LPS (Martínez-Sernández et al., 2014). Binding of the protein to LPS displaces LPS from binding to the casein, which is revealed using a horseradish peroxidase (HRP)-labeled anti-FITC polyclonal conjugate. This method allows simultaneous analysis of several proteins or peptides in a short period of time and no recognizing molecules (e.g., antibodies) to a specific protein or peptide are needed.
Keywords: LPS Lipopolysaccharide ELISA Casein LPS-binding
Materials and Reagents
Casein (Hammarsten grade) (BDH Prolabo, VWR International, catalog number: 440203H )
Lipopolysaccharides from Escherichia coli O111: B4-FITC conjugate (Sigma-Aldrich, catalog number: F3665 )
Polymyxin B sulfate salt (Sigma-Aldrich, catalog number: P4119 )
Proteins that were used for the example below (see Representative data) but which are not necessary for the assay:
LBP human recombinant (Sigma-Aldrich, catalog number: SRP6033 )
Bovine serum albumin (Sigma-Aldrich, catalog number: A7906 )
Myoglobin from equine skeletal muscle (Sigma-Aldrich, catalog number: M0630 )
Salts
Na2HPO4 anhydrous (Merck KGaA, Merck Millipore, catalog number: 106586 )
NaH2PO4.H2O (Merck KGaA, Merck Millipore, catalog number: 106346 )
NaCl (Merck KGaA, Merck Millipore, catalog number: 106404 )
EDTA disodium salt 2-hydrate (AppliChem GmbH, PanReac AppliChem, catalog number: 131669 )
Sheep anti-FITC: HRP (Bio-Rad Laboratories, AbD Serotec, catalog number: 640005 )
SIGMAFASTTM OPD (Sigma-Aldrich, catalog number: P9187 )
Tween® 20 (Merck KGaA, Merck Millipore, catalog number: 822184 )
0.3 M NaOH (prepared from 50% w/w NaOH solution) (18.94 M) (Sigma-Aldrich, catalog number: 415413 )
7.4% HCl (37% commercial solution diluted 1/5 with distilled water) (Merck KGaA, Merck Millipore, catalog number: 100317 )
Phosphate buffered saline (PBS) containing 0.05% Tween® 20 (PBS-T)
3 N H2SO4 (1.5 M)
Casein hydrolysate solution (see Recipes)
Concentrated PB (see Recipes)
PBS (see Recipes)
PBS-EDTA (see Recipes)
Equipment
96-well microplate (polystyrene with clear flat bottom wells) (Greiner Bio-One GmbH, catalog number: 762071 )
Automatic (mono- and multichannel) pipettes and pipette tips
Calibrated beakers, graduated cylinders and conical flasks
Magnetic stir bars and magnetic stirrer
Manual or automatic microplate washer (e.g., DAS plate washer)
Microcentrifuge tubes (e.g., Eppendorf; Kartell, catalog numbers: 297, for 1.5 ml , and 1298 , for 0.5 ml tubes)
Microplate adhesive sealing films (e.g., AlumaSeal® II film; Sigma-Aldrich, catalog number: A2350 )
Microplate reader (equipped for measuring absorbance at 492 nm) (e.g., Beckman Coulter, model: Biomek® plate reader )
Microtitre plate shaker with a small orbit diameter (preferably 1.5 mm) set to 750 rpm (e.g., Stuart, model: SSM5 )
pH meter
Reagent reservoir for multichannel pipettes
Scales
Shaking incubator set to 37 °C and 150 rpm (e.g., Panasonic Corporation, SANYO Electric, model: Orbi-Safe TM)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Martínez-Sernández, V. and Ubeira, F. M. (2014). Competitive ELISA for Protein-lipopolysaccharide (LPS) Binding. Bio-protocol 4(22): e1298. DOI: 10.21769/BioProtoc.1298.
Ohno, N. and Morrison, D. C. (1989). Lipopolysaccharide interaction with lysozyme. Binding of lipopolysaccharide to lysozyme and inhibition of lysozyme enzymatic activity. J Biol Chem 264(8): 4434-4441.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Immunodetection
Biochemistry > Lipid > Lipid-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,299 | https://bio-protocol.org/exchange/protocoldetail?id=1299&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Separation of the Inner and Outer Mitochondrial Membrane in HeLa Cells
NN Naotaka Nishimura
MY Masato Yano
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1299 Views: 27819
Edited by: Arsalan Daudi
Reviewed by: Varpu MarjomakiJyotiska Chaudhuri
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Mitochondria are organelles that have important functions in oxidative phosphorylation, fatty acid oxidation and apoptosis signaling. They have two distinct membranes, outer membrane (OM) and inner membrane (IM). IM contains respiratory chain complexes that produce ATP. IM is rich in cardiolipin, a specific phospholipid reportedly having a critical role for organizing super-complex formation of respiratory chain complexes. IM abundant in cardiolipin exhibits resistance to extraction by digitonin (a non-ionic detergent), whereas the detergent easily lyses OM. Therefore, digitonin is useful to separate mitoplast (IM plus matrix) and OM from mitochondria. Here, we describe a method to isolate mitochondria from HeLa cells, and a method to isolate mitochondrial outer membrane proteins and inner membrane proteins by using digitonin. This method is applicable also to other types of cultured cells such as COS-7.
Keywords: Mitochondria Membrane Isolation Inner Outer
Materials and Reagents
HeLa cells (80-100% confluent) pre-cultured in 8 to 12 pieces of dishes (diameter 10-cm)
PBS (-) (without Ca2+ and Mg2+)
EDTA
Mannitol
Sucrose
HEPES
EGTA
Complete Mini EDTA-free (Roche Diagnostics, catalog number: 11 836 170 001 )
Digitonin (Wako Pure Chemical Industries, catalog number: 040-02123 )
Trichloroacetic acid (optional)
Mitochondria isolation buffer (MTiso-buffer) (see Recipes)
Digitonin stock solution (see Recipes)
Digitonin buffer (see Recipes)
Equipment
Culture dishes
Aspirator
Cell scraper (e.g. Rubber policeman)
Dounce homogenizer (Glass 7 ml Dounce Tissue Grinder) (WHEATON, catalog number: 357542 )
50 ml-tube
Phase-contrast microscope (upright-type, x100 ~ x400) (for confirming disruption efficiency of the cells)
Centrifuges [for centrifugation at 500 x g (swing rotor) and 10,000 x g (angle rotor)]
Micro tube mixer (e.g. TOMY MT-400 , Digital Biology, catalog number: MT-400) or vortex mixer
Ultracentrifuge (e.g. Hitachi, catalog number: CS100 ) (for centrifugation at 100,000 x g (angle rotor)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nishimura, N. and Yano, M. (2014). Separation of the Inner and Outer Mitochondrial Membrane in HeLa Cells. Bio-protocol 4(22): e1299. DOI: 10.21769/BioProtoc.1299.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Mitochondria
Cell Biology > Cell signaling > Development
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
how to perform the same experiment from drosophila and how to separate outer membrane proteins and its transient cytoplasmic interactors ?
0 Answer
4 Views
Jul 3, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
13 | https://bio-protocol.org/exchange/protocoldetail?id=13&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Metabolic Labeling of Yeast Proteins
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.13 Views: 13424
Download PDF
Ask a question
Favorite
Cited by
Abstract
Proteins of Saccharomyces cerevisiae can be metabolically labeled with (35) methionine. After labeling, a protocol is described for the mechanical disruption of yeast cells or conversion to spheroplasts, with subsequent lysis before immunoprecipitation of the proteins.
Materials and Reagents
TRAN35S-label (MP Biomedicals)
Methionine
FLAG peptides
Immunoprecipitation buffer
Digitonin (EMD Chemicals)
1x SDS
Medium minus methionine (SD-Met)
Equipment
Bench-top centrifuges
Charcoal filter paper
50 ml conical tube
125 ml Erlenmeyer flask with vented cap (Nalgene)
O-ring cap tube
Geiger counter
Labeled radioactive beaker
Kimwipes
1.5 ml Eppendorf tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Labeling
Microbiology > Microbial biochemistry > Protein
Cell Biology > Cell viability > Cell lysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
130 | https://bio-protocol.org/exchange/protocoldetail?id=130&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Stable Caco-2 Cell Line Construction
Lin Fang
Published: Vol 2, Iss 6, Mar 20, 2012
DOI: 10.21769/BioProtoc.130 Views: 21294
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes the construction of Caco-2 stable cell lines using the Lipofectamine transfection method.
Materials and Reagents
Caco-2 cell
Lipofectamine TM transfection reagent. (Life Technologies, Invitrogen™, catalog number: 18324-020 )
Dulbecco’s Modification of Eagles Medium (DMEM) (Life Technologies, Invitrogen™)
Trypsin-EDTA (Life Technologies, Invitrogen™/Gibco®)
Opti-MEM (Life Technologies, Invitrogen™/Gibco®)
2x FBS (Life Technologies, Invitrogen™/Gibco®)
G418 (Life Technologies, Invitrogen™)
Trypsin (Life Technologies, Invitrogen™/Gibco®)
Cloning ring, vacuum grease (all autoclaved)
Trypsin
Equipment
Tissue culture hood
Culture dish (VWRI)
10 cm dish
Tissue culture incubator
24-well culture dishes
Forceps (autoclaved)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,300 | https://bio-protocol.org/exchange/protocoldetail?id=1300&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Characterisation of Dendritic Cells from Peripheral Blood
MR Matthew Reeves
JS John Sinclair
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1300 Views: 16738
Reviewed by: Jia Li
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
Latency and reactivation of human cytomegalovirus (HCMV) is intimately associated with the myeloid lineage. Multiple studies have used in vitro protocols to generate dendritic cells (DCs) from myeloid precursors. Here we describe the direct isolation of DCs from peripheral blood to study HCMV latency directly in this cell type.
Keywords: Dendritic cell Cell purification Cytomegalovirus
Materials and Reagents
100 ml peripheral blood obtained via subcutaneous venepuncture
Heparin - to prevent clotting of blood
Histopaque-1077 (Sigma-Aldrich, catalog number: 10771 ) or any equivalent ficoll solution (density 1.077 g/ml)
Fetal calf serum (FCS)
PBS (chilled)
DC isolation kit (Miltenyi Biotec, catalog number: 130-094-487 )
Antibodies (BD biosciences unless stated otherwise)
Anti-TCRa/b-FITC (catalog number: 347773 ) - isotype with mouse IgG1-FITC
Anti-CD19-FITC (catalog number: 553785 ) - isotype with IgG2a-FITC
Anti-CD14-FITC (catalog number: 561712 ) - isotype with IgG2a-FITC
Anti-HLA-DR-PE (catalog number: 556644 ) - isotype with IgG2a-PE
MACS buffer (see Recipes)
Equipment
Magnetic-activated cell sorting (MACS) magnet
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Centrifuge (50 ml tube capacity)
50 ml polypropylene conical tubes (FalconTM)
14 ml snap-cap polypropylene tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Virus
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,301 | https://bio-protocol.org/exchange/protocoldetail?id=1301&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay of Ornithine Decarboxylase and Spermidine/Spermine N1-acetyltransferase Activities
Mervi T. Hyvönen
TK Tuomo Keinänen
Leena Alhonen
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1301 Views: 9598
Reviewed by: Manuel D. GaheteRenate Weizbauer
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The polyamines, spermidine (Spd) and spermine, and their diamine precursor putrescine, are important regulators of various cellular functions, such as proliferation and differentiation. Polyamine homeostasis is tightly regulated on the level of uptake, excretion, biosynthesis, interconversion and terminal catabolism. The rate-controlling enzymes of polyamine biosynthesis and interconversion are ornithine decarboxylase (ODC) and spermidine/spermine N1-acetyltransferase (SSAT), respectively. Here, we describe a protocol to assay ODC (Jänne and Williams-Ashman, 1971) and SSAT (Libby, 1978) activities from cell or tissue samples.
Keywords: 14C-L-ornithine 14C-Acetylcoenzyme A Polyamine biosynthesis Polyamine acetylation
Materials and Reagents
EDTA (Sigma-Aldrich, catalog number: E9884 )
Tris-HCl (Sigma-Aldrich, catalog number: T5941 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
DL-dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43815 )
Protease inhibitor cocktail, such as Complete EDTA-free protease inhibitor tablets (Roche Diagnostics, catalog number: 11873580001 )
L-ornithine monohydrochloride (Sigma-Aldrich, catalog number: O2375 )
Acid-treated [14C]-L-ornithine (100 µCi/ml, 40-60 mCi/mmol) (PerkinElmer, catalog number: NEC710050UC )
Pyridoxal 5’phosphate monohydrate (PLP) (Sigma-Aldrich, catalog number: 82870 )
Citric acid (Sigma-Aldrich, catalog number: C0759 )
SOLVABLE (PerkinElmer, catalog number: 6NE9100 )
[Acetyl-1-14C]-Acetyl Coenzyme A (AcCoA) (20 µCi/ml, 40-60 mCi/mmol) (PerkinElmer, catalog number: NEC313050UC ) (Note 1)
Spermidine trihydrochloride (Sigma-Aldrich, catalog number: S2501 )
Hydroxylamine hydrochloride (Sigma-Aldrich, catalog number: 159417 )
ddH2O
96% ethanol such as ETAX A (Altia Oyj, catalog number: 12210143 )
Liquid scintillation cocktail, such as OptiPhase HiSafe 2 (PerkinElmer, catalog number: 1200-436 )
Buffer A (see Recipes)
1 M Tris-HCl (see Recipes)
200 mM EDTA (pH 8.0) (see Recipes)
100 mM DTT (see Recipes)
Acid-treated [14C]-L-ornithine (see Recipes)
10 mM or 25 mM L-ornithine (see Recipes)
20 mM PLP (see Recipes)
2 M citric acid (see Recipes)
100 mM Spd (see Recipes)
1 M hydroxylamine (see Recipes)
Equipment
10-ml glass tubes with rubber caps (Note 2)
Tube rack for glass tubes
WhatmanTM 3MM Chr chromatography paper (Thermo Fisher Scientific, catalog number: 05-713-336 )
Note: Cut into 3 cm x 2 cm size and folded 4 times (Figure 1A).
Long 18-21G needle
10-ml syringe
Forceps
Tissue homogenizer, such as 3-ml Potter-Elvehjem glass tube and pestle (Sigma-Aldrich, catalog number: P7734 ) and a drill to operate the pestle
0.5-ml microcentrifuge tubes
Microcentrifuge
Thermal cycler with block fitted for 0.5 ml tubes
WhatmanTM Grade P81 Ion Exchange Cellulose Chromatography Paper (Thermo Fisher Scientific, catalog number: 05-171-2A ) (cut into 1.5 x 1.5 cm size)
ParafilmTM (Sigma-Aldrich, catalog number: P7793 )
Horizontal shaker
A sheet of filter paper
Wallac 4-ml plastic scintillation vials and caps (PerkinElmer, catalog number: 1200-421 )
Liquid scintillation counter and plates fitted for 4-ml vials
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hyvönen, M. T., Keinänen, T. and Alhonen, L. (2014). Assay of Ornithine Decarboxylase and Spermidine/Spermine N1-acetyltransferase Activities. Bio-protocol 4(22): e1301. DOI: 10.21769/BioProtoc.1301.
Download Citation in RIS Format
Category
Cell Biology > Cell metabolism > Other compound
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,302 | https://bio-protocol.org/exchange/protocoldetail?id=1302&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Secretion Assay in Shigella flexneri
JR Jonathan Reinhardt
MK Michael Kolbe
Published: Vol 4, Iss 22, Nov 20, 2014
DOI: 10.21769/BioProtoc.1302 Views: 10800
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Shigella flexneri (S. flexneri) is a Gram-negative bacterium that causes gastroenteritis and shigellosis in humans. In order to establish and maintain an infection, S. flexneri utilises a type three secretion system (T3SS) to deliver virulence factors called effector proteins into the cytoplasm of host cells, facilitating e.g. uptake into the host cell and escape from the endosome. Secretion through the T3SS is tightly regulated and is usually triggered by host-cell contact, but can also be artificially stimulated in vitro. In this assay, the dye Congo red is used to induce T3SS-dependent secretion of S. flexneri (Parsot et al., 1995) and secreted proteins are concentrated from the culture supernatant by precipitation with trichloroacetic acid. The assay presented here can easily be adapted to the secretion analysis of other bacteria utilising a T3SS, such as Salmonella typhimurium, which constitutively secrete when grown at 37 °C (Collazo et al., 1995; Pegues et al., 1995), or pathogenic species of Yersinia, where secretion can be induced by calcium deprivation (Heesemann et al., 1986; Forsberg et al., 1987).
Keywords: Shigella flexneri Type 3 Secretion System Infection Bacteria Microbe-Host Interaction
Materials and Reagents
Tryptone soy agar (TSA) (Carl Roth, catalog number: CP70.1 )
Shigella flexneri (strain M90T) on a Congo red tryptone soy agar plate
99% Trichloroacetic acid (TCA) (Carl Roth, catalog number: 8789 )
Acetone (Merck KGaA, catalog number: 1000142511 )
TRIZMA base (Sigma-Aldrich, catalog number: T1503 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Bromophenol blue (Sigma-Aldrich, catalog number: B5525 )
Glycerol (Sigma-Aldrich, catalog number: G7757 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
LB medium (Carl Roth, catalog number: X968.2 ) (see Recipes)
Tryptone soy agar plates (see Recipes)
Sample buffer (see Recipes)
Congo red stock solution (Sigma-Aldrich, catalog number: C6767 ) (see Recipes)
Note: Used as 5 mg/ml stock solution.
Equipment
5 ml syringes (Henke-Sass, Wolf, catalog number: 5050.000V0 )
0.2 µm syringe filters (GE Healthcare, catalog number: 10462200 )
Culture tubes
50 ml Erlenmeyer flasks
1.5 ml microtubes
Microfuge
37 °C shaking incubator
Laminar flow hood
Spectrophotometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Reinhardt, J. and Kolbe, M. (2014). Secretion Assay in Shigella flexneri. Bio-protocol 4(22): e1302. DOI: 10.21769/BioProtoc.1302.
Dohlich, K., Zumsteg, A. B., Goosmann, C. and Kolbe, M. (2014). A substrate-fusion protein is trapped inside the Type III Secretion System channel in Shigella flexneri. PLoS Pathog 10(1): e1003881.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial biochemistry > Protein
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,303 | https://bio-protocol.org/exchange/protocoldetail?id=1303&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of ALT Associated Promyelocytic Leukemia Nuclear Bodies (APBs) by Immunofluorescence-FISH (IF-FISH)
Siamak A. Kamranvar
Maria G. Masucci
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1303 Views: 13147
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
The activation of functions that counteract the physiological shortening of telomeres in rapidly proliferating cell is prerequisite for the progression of cancer cells to full malignancy (Collado et al., 2007). In most human cancers, the length of telomere is maintained through up-regulation of telomerase whereas a telomerase-independent pathway, termed Alternative Lengthening of Telomeres (ALT) is active in about 10-15% of cancers (Johnson and Broccoli, 2007; Heaphy et al., 2011). One characteristic feature of ALT is the formation of ALT-associated Promyelocytic Leukemia nuclear bodies (APBs) (Lang et al., 2010; Yeager et al., 1999). APBs contain Promyelocytic Leukemia nuclear bodies (PML-NB) components such as PML, SP100 and SUMO, telomeric DNA and telomere associated proteins including the shelterin components TRF1, TRF2, POT1, TIN2, TPP1 and Rap1 (Yeager et al., 1999). In addition, APBs contain proteins involved in DNA repair. In particular, the presence of components of the homologous recombination machinery suggests that APBs may promote telomere elongation by facilitating the homologous recombination of telomeric templates (Nabetani et al., 2004; Stavropoulos et al., 2002). This is also supported by the requirement of the homologous recombination-associated MRN complex for APB formation (Wu et al., 2000). Furthermore, APBs are suggested to be active sites of ATM and ATR dependent DNA repair (Nabetani et al., 2004). Finally, the number of APBs increases in G2 phase of the cell cycle when recombination is mainly active (Grobelny et al., 2000). We have shown that infection of normal and malignant B lymphocytes with the human oncogenic herpesvirus Epstein-Barr virus (EBV) is associated with the induction of APBs and with numerous signs of chromosomal and genomic instability (Kamranvar et al., 2007; Kamranvar and Masucci, 2011; Kamranvar et al., 2013).
Here we describe a method for detection of APBs in human B-lymphocytes. The method can be applied with minor modifications to different cell types including adherent, suspension and primary cells.
Keywords: ALT APB Telomere PML
Materials and Reagents
Cells (suspension cells)
Formaldehyde (Merck KGaA, catalog number: K43634203 228 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
BSA (Sigma-Aldrich, catalog number: A7906 )
Blocking reagent (Roche Diagnostics, catalog number: 11096176001 )
Maleic acid (Sigma-Aldrich, catalog number: M0375 )
Deionized formamide (Merck KGaA, catalog number: K25761484 902 )
Tris-HCl
Green-fluorescent Alexa Fluor® 488 (Life Technologies, InvitrogenTM, catalog number: A-11034 ) or Red-fluorescent Alexa Fluor® 594 (Life Technologies, InvitrogenTM, catalog number: A-11005 )
Ethanol (Kemetyl, catalog number: 200-578-6 )
Cy3-TelG (PANAGENE, catalog number: F1006 )
FITC-TelC (PANAGENE, catalog number: F1009 )
DAPI (Vector Laboratories)
Fixation buffer (see Recipes)
Permeabilization buffer (see Recipes)
IF blocking buffer (see Recipes)
FISH blocking solution (see Recipes)
Maleic acid buffer (see Recipes)
PNA probes (see Recipes)
Hybridizing solution (see Recipes)
Washing solution (see Recipes)
PML antibody (see Recipes)
Secondary antibody (see Recipes)
Dehydration solution (see Recipes)
Mounting medium (see Recipes)
Equipment
Microscope glass slide (76 x 26 mm)
Coverslip (preferably circular 19 mm diameter)
Cytospin or slide centrifuge (Cytospin3 SHANDON)
Cytospin funnel with white filter card
Metal holder
Hydrophobic barrier pen (ImmEdge Pen, model: H-4000 )
Hot plate preheated to a temperature 80 °C
Coplin jar
Moist chamber
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kamranvar, S. A. and Masucci, M. G. (2014). Detection of ALT Associated Promyelocytic Leukemia Nuclear Bodies (APBs) by Immunofluorescence-FISH (IF-FISH). Bio-protocol 4(23): e1303. DOI: 10.21769/BioProtoc.1303.
Download Citation in RIS Format
Category
Cancer Biology > Proliferative signaling > Biochemical assays
Cancer Biology > Replicative immortality > Biochemical assays
Cell Biology > Cell staining > Nucleic acid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,304 | https://bio-protocol.org/exchange/protocoldetail?id=1304&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescent Measurement of Synaptic Activity Using SynaptopHluorin in Isolated Hippocampal Neurons
HL Hongmei Li
HP Han-A Park
Elizabeth A. Jonas
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1304 Views: 11159
Reviewed by: Geoff Lau
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
This protocol comprises the entire process of fluorescent measurement of vesicle recycling using the probe SynaptopHluorin, a pH-dependent GFP variant whose fluorescence increases at the synapse upon vesicle release due to fluorescence quenching in acidic vesicles. This technique provides a genetic tool to monitor synaptic vesicle recycling in real time in cultured hippocampal neurons.
Materials and Reagents
Embryonic hippocampal neurons (E18)
SynaptopHluorin
Note: pHluorin-based fusion-proteins in which ecliptic pHluorin was fused to an intraluminal loop of synaptotagmin (Fernandez-Alfonso and Ryan, 2006; Wienisch and Klingauf, 2006).
0.03% trypsin (-20 °C) (Sigma-Aldrich)
0.1% (w/v) poly-L-lysine (-20 °C) (Peptides International)
Neurobasal medium (2-8 °C) (Life Technologies, Gibco®)
B-27 (-20 °C) (Life Technologies, Gibco®)
Glutamine (final concentration: 0.5 mM, -20 °C) (Life Technologies, Gibco®)
Glutamate (final concentration: 0.025 mM) (Sigma-Aldrich)
Fetal bovine serum (FBS) (-20 °C) (Life Technologies, Gibco®)
Fluo-4 AM calcium indicator (-20 °C) (Life Technologies, Molecular Probes®, catalog number: F14201 )
DL-2-Amino-5-phosphonopentanoic acid (APV) (final concentration: 50 µM, solution in 4 °C) (Sigma-Aldrich, catalog number: A5282 )
6-cyano-7-nitroquinoxaline-2,3-dione (CNQX) (final concentration: 10 µM , -20 °C) (Sigma-Aldrich, catalog number: C127 )
Bafilomycin A1 (final concentration: 5 µM, 20 °C) (Calbiochem®, catalog number: 196000 )
Vacuum grease (Dow-Corning, for mounting the coverslip)
HEPES-buffered saline (HBS) extracellular solution (4 °C) (see Recipes)
2x HeBS (see Recipes)
Equipment
Pasteur pipette
No. 1, 12-mm diameter glass coverslips (Warner Instruments)
Note: No.1 glass coverslips are washed with HCl and ethanol, then autoclaved. Autoclaved glass coverslips are treated in 0.1% (w/v) poly-L-lysine for overnight. poly-L-lysine is aspirated on the next day, and glass coverslips are washed with sterile water three times.
Inverted microscope (63x oil immersion lens, Mercury arc lamp, filters for EGFP) (ZEISS)
Computer with time-lapse imaging system
Electric field stimulation chamber (two parallel platinum wire bath electrodes) (Warner Instruments)
Perfusion pump (Ismatec® REGLO Digital 2-Ch Var-Speed Pump; 0.005 to 59 ml/min) (Cole-Parmer, catalog number: WU-78016-40 )
Software
Axiovision LE software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Neuroanatomy and circuitry > Live-cell imaging
Neuroscience > Cellular mechanisms > Synaptic physiology
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,305 | https://bio-protocol.org/exchange/protocoldetail?id=1305&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Visualization of Cell Complexity in the Filamentous Cyanobacterium Mastigocladus laminosus by Transmission Electron Microscopy (TEM)
Dennis J. Nürnberg
GM Giulia Mastroianni
CM Conrad W. Mullineaux
GM Graham D. McPhail
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1305 Views: 10097
Edited by: Fanglian He
Reviewed by: Claudia Catalanotti
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
The cyanobacterium Mastigocladus laminosus (M. laminosus) is one of the most morphologically complex prokaryotes. It forms long chains of cells that are connected via septal junction complexes; such complexes allow diffusion of metabolites and regulators between neighboring cells. Cellular division occurs in multiple planes, resulting in the formation of true branches, and cell differentiation leads to the formation of specialized cell types for nitrogen fixation (heterocysts) and culture dispersal (hormogonia and necridia). Here, we describe a detailed protocol for the preparation of M. laminosus for TEM in order to visualize the ultrastructural properties of the organism. The presented preparation method is based on adding potassium permanganate as fixative which has been shown to increases the contrast of membranes (Luft, 1956), making it suitable for studies in cyanobacteria where the visualization of the photosynthetic membranes is important.
Keywords: Ultrastructure Fischerella Heterocyst Hormogonia Branching cyanobacteria
Materials and Reagents
Liquid culture of Mastigocladus laminosus
Potassium phosphate monobasic (KH2PO4) (Thermo Fisher Scientific, catalog number: BP362 )
Sodium phosphate dibasic (Na2HPO4) (Thermo Fisher Scientific, Acros Organics, catalog number: 204855000 )
Glutaraldehyde (25%, EM grade) (Agar Scientific, catalog number: R1020 )
Low gelling temperature agarose (Sigma-Aldrich, catalog number: A9414 )
Potassium permanganate (KMnO4) (VWR International, BDH, catalog number: 296444N )
100% ethanol
Propylene oxide (Agar Scientific, catalog number: R1080 )
Araldite CY212 (Agar Scientific, catalog number: R1042 )
Methyl nadic anhydride (MNA) (Agar Scientific, catalog number: R1083 )
Dodecenylsuccinic anhydride (DDSA) (Agar Scientific, catalog number: R1052 )
Benzyldimethylamine (BDMA) (Agar Scientific, catalog number: R1061 )
Sodium tetraborate (borax) (Sigma-Aldrich, catalog number: 221732 )
Toluidine blue (Sigma-Aldrich, catalog number: 89640 )
Uranyl acetate [UO2(CH3COO)2]*2 H2O] (SPI Supplies, catalog number: 02624-AB )
Lead (II) nitrate [Pb(NO3)2] (Sigma-Aldrich, catalog number: 228621 )
Tri-sodium citrate (TAAB, catalog number: S011 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: 221465 )
0.125 M Sørensen's phosphate buffer (PB) (see Recipes)
4% (v/v) glutaraldehyde in PB (see Recipes)
2% (w/v) low gelling temperature agarose (see Recipes)
2% (w/v) potassium permanganate (see Recipes)
Araldite (see Recipes)
1% (w/v) toluidine blue (see Recipes)
Uranyl acetate (see Recipes)
Reynold's lead citrate stain (see Recipes)
Equipment
Centrifuge
Copper grids (300 mesh) (Agar Scientific, catalog number: G2740C )
Dental wax
Disposable plastic Pasteur pipettes
Disposable polyethylene beaker
Eppendorf tubes (1.5 ml)
Glass or diamond knife
Hotplate
Light microscope
Oven (60 °C)
Razor blades
Rotator
Rubber embedding mould
Sealable glass vials (7 ml)
Shaker
Spatula
Sterilization filters (pore size: 0.22 µm)
Syringe
TEM (JOEL, model: JEM-1230 )
Tweezers
Ultramicrotome (Reichert Ultracut E)
Vortexer
SPI Slide-A-GridTM storage box (SPI Slide-A-GridTM, catalog number: 02450-AB )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nürnberg, D. J., Mastroianni, G., Mullineaux, C. W. and McPhail, G. D. (2014). Visualization of Cell Complexity in the Filamentous Cyanobacterium Mastigocladus laminosus by Transmission Electron Microscopy (TEM). Bio-protocol 4(23): e1305. DOI: 10.21769/BioProtoc.1305.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell imaging
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,306 | https://bio-protocol.org/exchange/protocoldetail?id=1306&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In situ Digestion of Wheat Cell-wall Polysaccharides
DV Dušan Veličković
HR Hélène Rogniaux
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1306 Views: 11239
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Cell walls of the wheat endosperm are mostly composed of arabinoxylans (AX) and mixed (1→3), (1→4)-β-glucans (BG) (Saulnier et al., 2012). Here, we present an optimized protocol to degrade enzymatically these cell-wall polysaccharides into oligosaccharides, directly from wheat grain cross sections. The main difficulty is to provide a sufficient amount of humidity for the enzyme to be active, while the amount of liquid at the surface of the tissue should stay low to prevent any delocalization of the released products. With this protocol, enzymatic degradation was shown to be efficient and delocalization of released oligosaccharides was estimated below 50 µm (Veličković et al., 2014).
Although it can be employed for other purposes, this in situ enzymatic digestion was primarily developed to obtain molecular images of the cross-sections of wheat endosperm by matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (Veličković et al., 2014). The cell wall polysaccharides are heterogeneous in structure, exhibit high masses and are entangled into complex networks. Thus, they are not amenable to direct analysis by mass spectrometry and they need to be degraded into smaller compounds as a first step. In this protocol, additional steps corresponding to the deposition of the MALDI matrix are also described.
Keywords: Enzyme application Arabinoxylans Beta glucans MALDI MSI Wheat section prepartaion
Materials and Reagents
Milli-Q quality water (dH2O)
Ethanol (Sigma-Aldrich, catalog number: 02854 )
Acetonitrile (Sigma-Aldrich, catalog number: 271004 )
K2SO4 (Merck KGaA, catalog number: 5153 )
NaCl (Merck KGaA, catalog number: 106404.1 )
CaCl2.2H2O (CARLO ERBA Reagents, catalog number: 433381 )
NaN3 (Merck KGaA, catalog number: 822335 )
NaOH (Sigma-Aldrich, catalog number: 221465 )
H3PO4 (Sigma-Aldrich, catalog number: P6560 )
Enzymes
α-Amylase from porcine pancreas (Sigma-Aldrich, catalog number: A3176 )
Xylanase M1 from Trichoderma viride (Megazyme International, catalog number: E-XYTRI )
Lichenase [endo-1,3(4)-β-D-glucanase] from Bacillus sp. (Megazyme International, catalog number: E-LICHN )
MALDI matrix preparation
2,5-dihydroxybenzoic acid (DHB) (Sigma-Aldrich, catalog number: 85707 )
N,N-dimethylaniline (DMA) (analytical reagent grade) (Thermo Fisher Scientific, catalog number: 121-69-7 )
Buffers and media
70% ethanol (see Recipes)
0.1 M NaOH (see Recipes)
25 mM CaCl2 (see Recipes)
Buffer for α-Amylase (see Recipes)
1 mg/ml α-Amylase (see Recipes)
460 U/ml Xylanase M1 (see Recipes)
4.6 U/ml Xylanase M1 (see Recipes)
200 U/ml Lichenase (see Recipes)
2 U/ml Lichenase (see Recipes)
Saturated K2SO4 at 40 °C (see Recipes)
50% acetonitrile (see Recipes)
MALDI matrix preparation (see Recipes)
Equipment
Vibratome (MICROM, model: HM 650 V )
In-house designed spraying robot
Note: Robot was built by adapting an electro-spray probe dismounted from a LCQ Advantage mass spectrometer (Thermo Fisher Scientific) to an X, Y, Z robotic arm (FISNAR, F4300N) (see Figure 1) (see Note 2).
Figure 1. In-house designed spraying robot for enzyme application. The right hand panel represents the enlarged view of the dashed rectangle zone depicted on the left picture.
Syringe pump infusion 0.2 µl/h to 500 ml/h (Thermo Fischer Scientific, catalog number: 12486350 )
500 µl glass syringe (Hamilton, model: Gastight 1750 )
Thermo-shaker (Eppendorf, Thermomixer compact)
Incubator (THERMOSI, model: SR 300 )
Home-designed chamber for incubation
Note: This consists of a rubber gasket sealed glass container (the jar with lid, KORKEN, IKEA of Sweden. Diameter 11 cm; high 10.5 cm, volume 0.5 L) in which is placed a 50 ml glass beaker and a set of weights (e.g. pieces of stones) (see Figure 2). Set of weights are required to keep the glass beaker from floating.
Figure 2. Schematic representation of home-designed chamber for incubation
pH meter (pHenomenal®, model: pH 1000 L , equipped with a pHenomenal® 221 electrode)
Other equipment
Glue (Loctite Super Glue Ultra Gel)
Adhesive carbon tape (8 mm x 20 m) (Agar Scientific, catalog number: AGG3939 )
Indium tin oxide (ITO) glass slides (Bruker, catalog number: 237001 ) (see Note 3)
Art paint brush (approximate diameter of the brush: 3-4 mm)
Razor blade (Gillette, Bleue extra)
Petri dish (90 mm x 14.2 mm) (Thermo Fischer Scientific, catalog number: 5184E )
Whatman filter paper (90 mm diameter)
1.5 ml Eppendorf tube (Eppendorf Safe-Lock quality)
2 ml plastic Pasteur pipette (Thermo Fischer Scientific, catalog number: 13984 )
Kimwipes paper (Kimberly-Clark)
Additional, required for MALDI imaging experiments
ImagePrep nebulizing robot (Bruker Daltonics) (see Figure 3)
Figure 3. ImagePrep nebulizing robot
MTP Slide adapter II (Bruker Daltonics, catalog number: 235380 ) (see Note 4)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Veličković, D. and Rogniaux, H. (2014). In situ Digestion of Wheat Cell-wall Polysaccharides. Bio-protocol 4(23): e1306. DOI: 10.21769/BioProtoc.1306.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Plant Science > Plant physiology > Tissue analysis
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,307 | https://bio-protocol.org/exchange/protocoldetail?id=1307&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Induction of Tigecycline Resistance in Acinetobacter baumannii
Ming-Feng Lin
YL Yun-You Lin
Chung-Yu Lan
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1307 Views: 8285
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Multidrug resistance Acinetobacter baumannii (A. baumannii) (MDRAB) has emerged as a serious threat in hospitals in recent years. Currently, there are few antibiotics, including tigecycline, available to treat infections caused by MDRAB effectively. Both tigecycline-resistant and tigecycline-susceptible isogenic strains of MDRAB are valuable in understanding the mechanisms underlying tigecycline resistance. To get the isogenic strains in the laboratory, we describe a protocol for induction of tigecycline resistance in A. buamannii by serial passage to plates with tigecycline of different concentrations. The minimal inhibitory concentration of A. baumannii by tigecycline was determined according to the protocol “Minimal Inhibitory Concentration (MIC) Assay for Acinetobacter baumannii” (Lin et al., 2014b).
Keywords: Acinetobacter baumannii Tigecycline Drug resistance Serial passages
Materials and Reagents
A. baumannii (ATCC, catalog number: 17978 )
Tigecycline (Wyeth, catalog number. 0220620-09-7 )
Tryptone (Pronadisa, catalog number: 1612 )
Yeast extract (Pronadisa, catalog number: 1702 )
NaCl (MDBio, catalog number: 101-1647-14-5 )
99% glycerol (Honeywell International, Riedel-deHaen, catalog number: 5523 )
Lysogeny broth (LB) (see Recipes)
20% glycerol (see Recipes)
Equipment
50 ml polystyrene culture tubes (sterile)
37 °C shaking and static incubators
Multichannel pipette (volume ranges 10 μl-1,000 μl)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lin, M., Lin, Y. and Lan, C. (2014). Induction of Tigecycline Resistance in Acinetobacter baumannii. Bio-protocol 4(23): e1307. DOI: 10.21769/BioProtoc.1307.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antibacterial assay
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,308 | https://bio-protocol.org/exchange/protocoldetail?id=1308&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Minimal Inhibitory Concentration (MIC) Assay for Acinetobacter baumannii
Ming-Feng Lin
YL Yun-You Lin
Chung-Yu Lan
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1308 Views: 47394
Edited by: Arsalan Daudi
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Minimal inhibition concentration (MIC) is the lowest concentration of an antimicrobial agent that can inhibit the visible growth of a microorganism after overnight incubation. MIC determination is used as not only a diagnostic tool in treating bacterial infections for clinicians but also a research method in evaluating the efficacy of an antimicrobial. Multidrug resistance Acinetobacter baumannii (A. baumannii) has emerged in recent years. Accurate determination of resistance by MIC assay is important in coping with this superbug. Here we described a protocol for determining MIC for A. baumannii in hope of assisting researchers and physicians in confirming resistance of clinical isolates correctly.
Keywords: Acinetobacter baumannii Minimal Inhibitory concentration Drug resistance
Materials and Reagents
A. baumannii (ATCC, catalog number: 17978 )
Escherichia coli (E. coli) (ATCC, catalog number: 25922 )
Mueller Hinton broth (Sigma-Aldrich, catalog number: 70192 )
Tigecycline (Wyeth, catalog number. 0220620-09-7 )
NaCl (MDBio, catalog number: 101-1647-14-5 )
KCl (Sigma-Aldrich, catalog number: P1147 )
Na2HPO4 (J.T.Baker®, catalog number: 3828-01 )
KH2PO4 (J.T.Baker®, catalog number: 4921-07 )
HCl (J.T.Baker®, catalog number: 9535-03 )
Tryptone (Pronadisa, catalog number: 1612 )
Yeast extract (Pronadisa, catalog number: 1702 )
Cation-adjusted Mueller-Hinton broth (CAMHB) (see Recipes)
PBS (1 L) (see Recipes)
Lysogeny broth (LB) (see Recipes)
Equipment
50 ml polystyrene culture tubes (sterile)
Spectrophotometer to measure absorbance of cell culture (OD600)
37 °C shaking and static incubators
Multichannel pipette (volume ranges 10 μl-1,000 μl)
1.5 ml Eppendorf tube
A centrifuge machine
1 ml cuvette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Antimicrobial assay > Antibacterial assay
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,309 | https://bio-protocol.org/exchange/protocoldetail?id=1309&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Vanillin Assay of Arabidopsis Seeds for Proanthocyanidins
LX Lijie Xuan
ZW Zhong Wang
Lixi Jiang
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1309 Views: 11557
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Proanthocyanidins (PAs) are colorless flavonoid polymers and deposit in Arabidopsis seed coat specifically. Oxidation of PAs gives rise to brown color of mature seeds. PA accumulation can be affected by a number of growth conditions, such as temperature and sun light. PAs, which are converted from anthocyanidins, can protect seeds from outer environment and have a positive effect in seed longevity (Debeaujon, 2003). Vanillin turns red upon binding to leucoanthoanthocyanidins, catechins and monomers and terminal subunits of PAs (Butler et al., 1982; Deshpande et al., 1986). Based on this principle, PA deposition in Arabidopsis seed coat can be visualized.
Keywords: Seed coat color Vanillin assay Arabidopsis Proanthocyanidins
Materials and Reagents
Arabidopsis seeds (Col-0 and tt mutants)
6 M HCl
Sterile distilled water
Dye solution (for coloration and reaction with PAs) containing 1% w/v vanillin (Sangon Biotech, catalog number: VT0974- 100g) and 6 M HCl stored in brown bottle
Note: The dye solution should be used after preparation as soon as possible (not longer than half an hour).
Vanillin reagent (see Recipes)
Equipment
Brown bottle (or glass bottle covered with aluminum foil)
1.5 ml microcentrifuge tubes
Glass slides (25.4 mm x 76.2 mm) and coverslips (20 mm x 20 mm)
Dissecting needle and tweezer
An SZ61-zoom stereomicroscope (OLYMPUS, model: SZ61)
A compound light microscope (OLYMPUS, model: BX61 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xuan, L., Wang, Z. and Jiang, L. (2014). Vanillin Assay of Arabidopsis Seeds for Proanthocyanidins. Bio-protocol 4(23): e1309. DOI: 10.21769/BioProtoc.1309.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
131 | https://bio-protocol.org/exchange/protocoldetail?id=131&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chloroform-ethanol Isolation Genomic DNA from Mouse Tail
Lin Fang
Published: Sep 20, 2011
DOI: 10.21769/BioProtoc.131 Views: 11809
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes a simple and fast method to purify genomic DNA from mouse tails using chloroform.
Materials and Reagents
Proteinase K (20 mg/ml) (Life Technologies, Invitrogen™)
KAcO (Sigma-Aldrich)
Chloroform (Mallinckrodt)
Ethanol (Pharmco-Aaper)
Tris
NaCl
EDTA
SDS
Lysis buffer (see Recipes)
Equipment
Centrifuges
Incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > DNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,310 | https://bio-protocol.org/exchange/protocoldetail?id=1310&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
CytoTrap Two-Hybrid Screening Assay
LZ Lei Zhang
LD Liqun Du
B. W. Poovaiah
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1310 Views: 12430
Edited by: Tie Liu
Reviewed by: Saminathan Thangasamy
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
CytoTrap two-hybrid system provides an alternate strategy to detect protein-protein interactions in yeast. In this system, bait protein is fused with human son of sevenless (hSos) protein (Li et al., 1993), and a cDNA library or prey protein is expressed by fusion with myristoylation signal which anchors the prey fusion protein to yeast cell membrane. Protein interaction between bait and prey proteins recruits the hSos protein to the cell membrane, where hSos activates the Ras signaling pathway, leading to the survival of temperature-sensitive Saccharomyces cerevisiae (S. cerevisiae) strain cdc25H at 36 °C. In the CytoTrap two-hybrid system, detection of protein interaction occurs in the cytoplasm near cell membrane and is not dependent on transcription activation of reporter genes. Hence, the system is particularly useful for identifying interaction partners of transcription factors and proteins that need post-translational modification in the cytoplasm, which could not be used as bait proteins in conventional transactivation-based yeast two-hybrid systems. Here we describe the construction of a cDNA library from the model plant Arabidopsis and a procedure for screening interaction proteins of AtSR1/CAMTA3, a Ca2+/CaM-regulated transcription factor from this library. This procedure could be adapted to identify interacting partners of interested proteins from other organisms.
Keywords: Cytotrap system Yeast two-hybrid screen Protein interaction
Materials and Reagents
XL10-Gold Kanr Ultracompetent cells (Agilent, catalog number: 200317 )
RNeasy plant mini kit (QIAGEN, catalog number: 74904 )
Oligotex mRNA mini kit (QIAGEN, catalog number: 70022 )
CytoTrap two-hybrid system (Agilent, catalog number: 200444 )
YeastmakerTM yeast transformation system 2 (Takara Bio Company, Clontech, catalog number: 630439 )
AccuScript (Agilent, catalog number: 200820 )
RNase H (New England Biolabs, catalog number: M0297S )
DNA polymerase I (New England Biolabs, catalog number: M0209S )
UltraPureTM phenol: chloroform: isoamyl alcohol (25:24:1, v/v) (Life Technologies, catalog number: 15593-031 )
T4 ligase (New England Biolabs, catalog number: M0202S )
T4 polynucleotide kinase (New England Biolabs, catalog number: M0201S )
Xho I (New England Biolabs, catalog number: R0146M )
Acid-washed glass beads (Sigma-Aldrich, catalog number: G8772 )
TritonTM X-100 (Thermo Fisher Scientific, catalog number: BP151-100 )
Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: BP166-100 )
Sodium chloride (NaCl) (J.T.Baker®, catalog nuber: JT3628-1 )
Tris (J.T.Baker®, catalog number: JT4109-1 )
EDTA (J.T.Baker®, catalog number: JT8993-1 )
Yeast extract (Thermo Fisher Scientific, catalog number: BP9727-500 )
Peptone (Thermo Fisher Scientific, catalog number: BP9725-500 )
Dextrose (J.T.Baker®, catalog number: JT1919-1 )
Adenine sulfate (Sigma-Aldrich, catalog number: A2545 )
Yeast nitrogen base without amino acids (BD, catalog number: 291940 )
DO supplement -His/-Leu/-Trp/-Ura (Takara Bio Company, Clontech, catalog number: 630425 )
Histidine (Sigma-Aldrich, catalog number: H6034 )
Tryptophan (Sigma-Aldrich, catalog number: T0254 )
Galactose (Sigma-Aldrich, catalog number: G0750 )
Raffinose (Sigma-Aldrich, catalog number: R0250 )
Yeast lysis solution (see Recipes)
YPDA/YPAD (see Recipes)
SC/-LU (glucose) (see Recipes)
SC/-LU (galactose) (see Recipes)
10x STE buffer (see Recipes)
Equipment
Replica plating mold (Sunrise Science Products, catalog number: 3005-002 )
RNase-free microcentrifuge tube (BioExpress, catalog numer: C-3262-2 )
Microcentrifuge (Eppendorf, catalog number: 5424 )
Shaker (New Brunswick Scientific, catalog number: M1299-0092 )
Incubator (VWR International, catalog number: 414005-128 )
150-mm plate (VWR International, catalog number: 25384-326 )
PCR thermocycler (Eppendorf, catalog number: 6321 000.515 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, L., Du, L. and Poovaiah, B. W. (2014). CytoTrap Two-Hybrid Screening Assay. Bio-protocol 4(23): e1310. DOI: 10.21769/BioProtoc.1310.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Microbiology > Microbial genetics > DNA
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,311 | https://bio-protocol.org/exchange/protocoldetail?id=1311&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infection Assays of Tomato and Apple Fruit by the Fungal Pathogen Botrytis cinerea
ZZ Zhanquan Zhang
GQ Guozheng Qin
BL Boqiang Li
Shiping Tian
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1311 Views: 12700
Edited by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Botrytis cinerea (B. cinerea) is an aggressive fungal pathogen that infects more than 200 plant species. Furthermore, the pathogen can attack fruits of some plants, such as tomato and apple. B. cinerea has become one of the model systems in molecular phytopathology because of its economic importance and sophisticated genetic operation methods. Virulence assays are very important in the study of fungal pathogenesis. This protocol details the artificial inoculation procedure of B. cinerea on tomato and apple fruits. It also can be used to analyse the virulence of postharvest fungal pathogens on other fruits, such as pear, peach, jujube and so on.
Materials and Reagents
Freshly harvested tomatoes and apples (fully ripe)
Botrytis cinerea (B05.10): Supplied by Prof. Paul Tudzynski Westfaelische Wilhelms-Universitaet Muenster, Germany
KH2PO4 (Beijing Chemical Works, catalog number: HG/T 1274-1993 )
Glucose (Beijing Chemical Works, catalog number: HG/T 3475-1999 )
2% sodium hypochlorite (Xilong Chemical, catalog number: 7681-52-9 )
Potato
Dextrose
PDA medium (see Recipes)
2% sodium hypochlorite (see Recipes)
KH2PO4-glucose solution (see Recipes)
Equipment
Glass stick
Hemacytometer (QIUJING, model: XB-K-25 )
Cheesecloth
Vortexer (Select BioProducts, model: SBS100-2 )
Optical microscope (Chongqing Optec Instrument, model: B203LED )
Clean bench (Donglian Electronic & Technology Development, model: SCB-1520 )
Pipette
Plastic basket
Sterile nail (approximately 3 mm in diameter)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbe-host interactions > Fungus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,312 | https://bio-protocol.org/exchange/protocoldetail?id=1312&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enzymatic Activity Assays in Yeast Cell Extracts
Melike Çağlayan
SW Samuel H. Wilson
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1312 Views: 10962
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Saccharomyces cerevisiae (S. cerevisiae) (commonly known as baker’s yeast) is a model organism that has a similar upstream base excision repair (BER) pathway for the repair of methylated bases as that in mammalian cells, and it is very easy to maintain in the laboratory environment. Here, we described a method to prepare cell extracts from yeast to investigate their enzymatic activities. This protocol is a quick and efficient way to make yeast cell extracts without using commercial kits.
Keywords: DNA damage DNA polymerase DNA repair Base excision repair Ligation failure
Materials and Reagents
EDTA-free protease inhibitor cocktail tablet (Roche Diagnostics, catalog number: 11836170001 )
Bio-Rad protein assay dye reagent concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
Dextrose (Sigma-Aldrich, catalog number: D9434 )
Bacto-peptone (Sigma-Aldrich, catalog number: P5905 )
Bacto-yeast extract (Sigma-Aldrich, catalog number: Y1625 )
Adenine sulfate (Sigma-Aldrich, catalog number: A3159 )
Trizma base (Sigma-Aldrich, catalog number: T1503 )
EDTA (Sigma-Aldrich, catalog number: 93283 )
NaCl (Sigma-Aldrich, catalog number: S7653 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: B0126 )
Formamide (Sigma-Aldrich, catalog number: F9037 )
Bromophenol blue (Sigma-Aldrich, catalog number: B0126)
Xylene cyanol (Sigma-Aldrich, catalog number: X4126 )
Dithiothreitol-DTT (Sigma-Aldrich, catalog number: D0632 )
Sodium borohydride-NaBH4 (Sigma-Aldrich, catalog number: 247677 )
Sterile water
Yeast peptone dextrose adenine (YPDA) medium (see Recipes)
Potassium phosphate buffer (see Recipes)
Lysis buffer (see Recipes)
10x reaction buffer (see Recipes)
Gel loading buffer (see Recipes)
Equipment
0.5 mm diameter glass beads (Bio Spec Products, catalog number: 11079105 )
Eppendorf tubes
Table-top centrifuge
Table-top heat block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,313 | https://bio-protocol.org/exchange/protocoldetail?id=1313&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
TGFβ Stimulation Assay
Emanuel Rognoni
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1313 Views: 14792
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
TGFβ is part of a growth factor superfamily which modulates cell growth, differentiation, adhesion, migration, ECM synthesis and apoptosis (Massague, 1998; Siegel and Massague, 2003). Free TGFβ binds to its high affinity TGFβ receptor, a receptor serine/threonine kinase, inducing phosphorylation of Smad2/3 which subsequently forms a complex with Smad4 to translocate to the nucleus where it interacts with multiple co-activators and repressors generating distinct transcriptional responses.
Indeed, TGFβ signaling shows a remarkable cellular context dependency and apparent multifunctionality: e.g. TGFβ is able to inhibit cell proliferation in many epithelial cells but can also enhance proliferation in fibroblasts and cell growth in endothelial cells (Guasch et al., 2007; Xiao et al., 2012); it enhances stem cell pluripotency, but promotes differentiation in other cells (Park, 2011); in cancer development it suppresses pre-malignant cell proliferation, but at the same time promotes conversion to a metastatic phenotype (Chaudhury and Howe, 2009).
The TGFβ stimulation assay monitors the responsiveness of cells to TGFβ. Upon TGFβ stimulation short-term effects such as Smad2 phosphorylation and long-term effects such as cell proliferation can be analyzed. The assay will be described for murine keratinocytes, where TGFβ strongly inhibits cell proliferation, but both assays are applicable for other cell types as well.
Materials and Reagents
Cell line(s) of interest [here primary murine keratinocytes isolated as described in Montanez et al. (2007)]
Antibodies
pSmad2 (Merck KGaA, catalog number: AB3849 )
Total Smad2/3 (Santa Cruz, catalog number: sc11769 )
Goat anti–rabbit conjugated with horseradish peroxidase (HRP) (Bio-Rad Laboratories, catalog number: 172-1011 )
Bovine serum albumin (BSA) fraction V (Carl Roth, catalog number: 8076 )
Calcium chloride (CaCl2) (Carl Roth, catalog number: A119.1 )
Chelex 100 resin (Bio-Rad Laboratories, catalog number: 143-2832 )
Collagen I (PureCol, Advanced BioMatrix, catalog number: 5005-B )
Fibronectin (Life Technologies, Gibco®, catalog number: 33016-015 )
Protein standard (e.g. precision plus protein kaleidoscope standards) (Bio-Rad Laboratories, catalog number: 161-0375 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10270-106 )
Minimum essential medium (MEM) (Sigma-Aldrich, catalog number: M8167 )
Insulin (Sigma-Aldrich, catalog number: I5500 )
Epidermal growth factor (EGF) (Sigma-Aldrich, catalog number: E4127 )
Transferin (Sigma-Aldrich, catalog number: T8158 )
Phosphoethanolamine (Sigma-Aldrich, catalog number: P0503 )
Ethanolamine (Sigma-Aldrich, catalog number: E0135 )
Hydrocortisone (Calbiochem, catalog number: 386698 )
Trypsin powder (Life Technologies, Gibco®, catalog number: 27250-018 )
L-Glutamine (Life Technologies, InvitrogenTM, catalog number: 25030-081 )
Penicillin-streptomycin (pen-strep) (Life Technologies, InvitrogenTM, catalog number: 15070-063 )
Click-iT® EdU Alexa Fluor® 488 Imaging Kit (Life Technologies, InvitrogenTM, catalog number: C10420 )
Nonfat dried milk powder (AppliChem, catalog number: A0830 )
PVDF membrane (e.g. Immobilon-P) (Merck KGaA, catalog number: IPVH00010 )
Recombinant TGFβ1 (PeproTech, catalog number: 100-21 )
Tween20 (Sigma-Aldrich, catalog number: P9416 )
Sodium dodecyl sulfate (SDS) (Carl Roth, catalog number: 0183.1 )
β-Mercaptoethanol (Carl Roth, catalog number: 4227.3 )
Bromophenol blue (Carl Roth, cataog number: A512.1 )
Sodium chloride (NaCl) (Carl Roth, catalog number: P029 )
Sodium hydrogen carbonate (NHCO3) (Carl Roth, catalog number: 6885 )
Sodium carbonate (Na2CO3) (Carl Roth, catalog number: A135 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: D6750 )
di-Sodium hydrogen phosphate (Na2HPO4) (Carl Roth, catalog number: T876 )
Glycine (Carl Roth, catalog number: 0079 )
Glycerol (Carl Roth, catalog number: 4043.1 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Methanol (Sigma-Aldrich, catalog number: 322415 )
Potassium chloride (KCl) (Carl Roth, catalog number: HN02.3 )
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth, catalog number: 3904 )
Nonidet-P40 (NP-40) (e.g. IGEPAL CA-630) (Sigma-Aldrich, catalog number: I8896 )
Protease inhibitor cocktail (e.g. cOmplete) (Roche, catalog number: 04693116001 )
Phosphatase inhibitor cocktail 2 (Sigma-Aldrich, catalog number: P5726 )
Phosphatase inhibitor cocktail 3 (Sigma-Aldrich, catalog number: P0044 )
2-Propanol (Carl Roth, catalog number: T902.1 )
Tris-HCl (Carl Roth, catalog number: 9090.3 )
Cell type specific growth (see Recipes)
Cell type specific starving medium (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
Cell lysis buffer supplemented with protease and phosphatase inhibitors (see Recipes)
Standard SDS-PAGE running buffer (see Recipes)
2x Laemmli sample buffer (see Recipes)
Western blot transfer buffer (see Recipes)
TBS (see Recipes)
TBS-T (see Recipes)
Western blot stripping buffer (see Recipes)
Equipment
6-well plate and 10 cm dishes for cell culture
Standard centrifuge to spin down cells and protein lysis
Cell scraper (e.g. Corning cell scraper) (Sigma-Aldrich, catalog number: CLS3010 )
Standard SDS-PAGE and Western blot equipment
Cell culture Incubator 37 °C, 5% CO2 for standard cell culture conditions
Flow cytometer (e.g. BD FACS Canto) using FlowJo as analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rognoni, E. (2014). TGFβ Stimulation Assay. Bio-protocol 4(23): e1313. DOI: 10.21769/BioProtoc.1313.
Download Citation in RIS Format
Category
Cell Biology > Cell signaling > Phosphorylation
Cell Biology > Cell viability > Cell proliferation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,314 | https://bio-protocol.org/exchange/protocoldetail?id=1314&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
TGFβ Release Co-culture Assay
Emanuel Rognoni
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1314 Views: 11004
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
TGFβ is a potent cytokine modulating various processes including proliferation, differentiation, ECM synthesis and apoptosis (Siegel and Massague, 2003). Thus in many tissues availability of TGFβ is tightly regulated. TGFβ is secreted as an inactive complex where it is encapsulated by the latency associated protein (LAP), a ligand trap protein, which inhibits TGFβ binding to its receptor and retains TGFβ in the extracellular matrix (ten Dijke and Arthur, 2007). TGFβ can be released from the matrix and converted into its biological active form by huge number of processes including heat, high and low pH, release of reactive oxygen species (ROS) or various proteases (e.g. plasmin, elastase, matrix metalloproteinase-2 and -9) (Barcellos-Hoff and Dix, 1996; Lyons et al., 1988; Taipale et al., 1994; Yu and Stamenkovic, 2000). However, under physiological conditions the interaction of αv-class integrins with the RGD tripeptide motif in the LAP protein represents the key factor for TGFβ release in vivo. The relevance of integrin mediated TGFβ release for in vivo development and homeostasis is further underlined by the observation that mice with the integrin-binding deficient LAP proteins (RGD motif mutated to RGE) recapitulate all major phenotypes of TGFβ1 null mice, including multi-organ inflammation and defects in vasculogenesis (Shull et al., 1992; Yang et al., 2007). This striking phenotype overlap with TGFβ deficient mice and phenotypes of mice lacking αv-class integrins (Aluwihare et al., 2009; Bader et al., 1998) demonstrates an essential interconnection of integrins with TGFβ signaling in vivo, while the role of non-integrin mediated release mechanisms (ROS, pH, proteolytic cleavage etc.) during development remains less clear.
The TGFβ release assay measures the ability of cells to release TGFβ from a matrix. The assay was developed by (Annes et al., 2004) and we further optimized the protocol for keratinocytes. For other cell types the cell culture medium and culturing conditions would need to be adapted accordingly.
In keratinocytes TGFβ release is mainly mediated by αvβ6 integrin but also integrin αvβ3, αvβ5 and αvβ8 have been shown to liberate TGFβ, while other RGD binding integrins, such as α5β1 or α8β1 cannot release TGFβ (Asano et al., 2005a, 2005b; Mu et al., 2002; Munger et al., 1999). Mechanistically, the interaction with αvβ3, αvβ5 or αvβ6 integrin induces a conformational change in the LAP-TGFβ by generating an actin cytoskeleton dependent pulling force, allowing TGFβ to access its receptors. For αvβ8 integrin mediated TGFβ release it was shown that proteolytic cleavage is involved [see (Mu et al., 2002) for blocking conditions of TGFβ release by proteolytic cleavage and αvβ8 integrin].
The following protocol is optimized for the study of αvβ6-integrin mediated TGFβ release in keratinocytes.
Materials and Reagents
Cell lines
CHO-LTBP1 TGFβ rich matrix producing cell line, generated by the Daniel Rifkin lab expresses high levels of LTBP1-TGFβ (Annes et al., 2004).
Transformed mink lung epithelial cells (tMLEC) TGFβ reporter cell line, stably expresses a luciferase reporter plasmid under control of a truncated plasminogen activator inhibitor type 1 promoter (PAI-1) (Abe et al., 1998).
Note: CHO-LTBP1 and tMLEC are cultured in DMEM growth medium. tMLEC DMEM growth medium is supplemented with 250 mg/ml Geneticin (Life Technologies, InvitrogenTM, catalog number: 10131035 ).
Antibodies
αvβ6 integrin blocking antibody (Millipore, clone 10D5, catalog number: MAB2077Z )
TGFβ neutralizing antibody (R&D Systems, clone 1D11, catalog number: MAB1835 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E6758 )
BrightGlo luciferase assay kit (Promega Corporation, catalog number: E2610 )
Dulbecco's minimum essential medium (DMEM) (Life Technologies, Gibco®, catalog number: 11966-025 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10270-106 )
Calcium chloride (CaCl2) (Carl Roth, catalog number: A119.1 )
Chelex 100 resin (Bio-Rad Laboratories, catalog number: 143-2832 )
Penicillin-streptomycin (pen-strep) (Life Technologies, Gibco®, catalog number: 15070-063 )
Minimum essential medium (MEM) (Sigma-Aldrich, catalog number: M8167 )
Insulin (Sigma-Aldrich, catalog number: I5500 )
Epidermal Growth Factor (EGF) (Sigma-Aldrich, catalog number: E9644 )
Transferin (Sigma-Aldrich, catalog number: T8158 )
Phosphoethanolamine (Sigma-Aldrich, catalog number: P0503 )
Ethanolamine (Sigma-Aldrich, catalog number: E0135 )
Hydrocortisone (Calbiochem®, catalog number: 386698 )
L-Glutamine (Life Technologies, InvitrogenTM, catalog number: 25030-081 )
Trypsin powder (Life Technologies, Gibco®, catalog number: 27250-018 )
0.5%Trypsin/EDTA (Life Technologies, Gibco®, catalog number: 15400-054 )
Sodium chloride (NaCl) (Carl Roth, catalog number: P029 )
di-Sodium hydrogen phosphate (Na2HPO4) (Carl Roth, catalog number: T876 )
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 258148 )
Potassium chloride (KCl) (Carl Roth, catalog number: HN02.3 )
Potassium dihydrogen phosphate (KH2PO4) (Carl Roth, catalog number: 3904 )
DMEM growth medium (see Recipes)
Keratinocyte growth medium for murine keratinocyte culture (KGM) (see Recipes)
Starving KGM (see Recipes)
0.4% keratinocyte trypsin (see Recipes)
Phosphate-buffered saline (PBS) (see Recipes)
PBS/EDTA (see Recipes)
0.1% trypsin/EDTA (see Recipes)
Chelated FBS (see Recipes)
Equipment
Flat bottom 96-well plates for cell culture (Corning, Costar®, catalog number: 3595 )
Round bottom white 96-well plates (Corning, Costar®, catalog number: 3789 )
1.5 ml Eppendorf tubes (Sigma-Aldrich, catalog number: T9661-1000EA )
Cell culture incubator (37 °C, 5% CO2)
Standard centrifuge to spin down the cells
Luminometer, e.g. GloMax (Promega corporation)
Standard bright field microscope
Multichannel pipette (recommended)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rognoni, E. (2014). TGFβ Release Co-culture Assay. Bio-protocol 4(23): e1314. DOI: 10.21769/BioProtoc.1314.
Download Citation in RIS Format
Category
Cell Biology > Cell signaling > Development
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,315 | https://bio-protocol.org/exchange/protocoldetail?id=1315&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Creating a Rat Model of Chronic Variate Stress
Rocío M. de Pablos
Manuel Sarmiento
Ana María Espinosa-Oliva
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1315 Views: 11149
Edited by: Soyun Kim
Reviewed by: Emmanuelle Berret
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Stress is a condition of human experience and an important factor in the onset of various diseases. There are numerous studies showing how stress can accelerate cell aging, immune senescence and some age-related diseases such as neurodegenerative disorders and osteoporosis. However, the effects of stress have different consequences depending on the type, duration or severity and predictability of the stressor applied. Although stress can be beneficial in its acute phase, repeated and severe stressful stimuli produce adverse effects. There are different models of stress depending on the exposure time; acute (when the stressor is applied for a short time, e.g. hours or days, and intensely) or chronic (when the stressor is applied for a long time, e.g. weeks or months, and less intensely. In these cases, the stressor can be repeated each time or different stressors can be used). The latter model is most frequently used to achieve similar conditions to those found in human diseases related to stress. Also, there are several different paradigms depending on the purpose of the study [development of drug therapies or modeling depressive behaviors; for the different paradigms see Dagnino-Subiabre, (2012)]. Here, we describe a 9-day variable-stressor paradigm with repeated and prolonged stimulation and a random daily stressor over days or weeks to minimize its predictability. This protocol has been adapted from other models of variable stress with significant modifications. The absence of predictability of the stressor applied is an important characteristic of this model compared to other models in which repeated stress is used. We avoid the use of a strong stressor, such as foot shock or tail pinch, and describe an easily reproducible new chronic mild stress model. Some models of chronic mild stress have been reported to lead to a wide range of behavioral disturbances and have been proposed as models of depression in animal studies (Cryan et al., 2005).
Keywords: Stress Rat Protocol Chronic
Materials and Reagents
Male albino Wistar rats (250-270 g)
Equipment
Glass tank (44 x 33 x 30 cm)
Plastic tube (21 x 6 cm, 6 cm diameter)
Individual cages (47 x 32 x 20 cm)
Cold room or refrigerator (4 °C)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,316 | https://bio-protocol.org/exchange/protocoldetail?id=1316&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of Starch Granules from Arabidopsis Leaves and Determination of Granule-Bound Starch Synthase Activity
TA Tomás Albi
MO M. Isabel Ortiz-Marchena
MR M. Teresa Ruiz
José M. Romero
Federico Valverde
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1316 Views: 9195
Edited by: Tie Liu
Reviewed by: Xiao-qing Xu
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Starch constitutes the most important carbon reserve in plants and is composed of branched amylopectin and linear amylose. The latter is synthesized exclusively by the Granule-Bound Starch Synthase (GBSS, EC 2.4.1.21). Here we report a readily reproducible, specific and highly sensitive protocol, which includes the isolation of intact starch granules from Arabidopsis thaliana leaves and the subsequent determination of GBSS activity. We have applied this method to study GBSS activity in diurnal cycles in vegetative growth and during the photoperiodic transition to flowering in Arabidopsis (Tenorio et al., 2003; Ortiz-Marchena et al., 2014).
Keywords: Starch granule Starch purification GBSS activity Granule-bound starch synthase
Materials and Reagents
Plant materials
Note: Arabidopsis thaliana (A. thaliana) were grown in controlled cabinets on peat-based compost.
Liquid N2
HEPES (Sigma-Aldrich, catalog number: H4034 )
Potassium hydroxide pellets (Panreac Applichem, catalog number: A0566 )
TritonTM X-100 (Sigma-Aldrich, catalog number: X100 )
Miracloth (Merck KGaA, catalog number: 475855 )
Percoll® (Sigma-Aldrich, catalog number: P1644 )
Glycogen (from rabbit liver Type III) (Sigma-Aldrich, catalog number: G8876 )
Tricine (Sigma-Aldrich, catalog number: T0377 )
Potassium acetate (Sigma-Aldrich, catalog number: P1147 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA) (Sigma-Aldrich, catalog number: E5134 )
Sodium hydroxide pellets (Panreac Applichem, catalog number: 131687 )
Maltotriose (Sigma-Aldrich, catalog number: M8378 )
Adenosine 5’ diphospho, [D-glucose-14C(U)] ammonium salt (ADP [U-14C] glucose) (American Radiolabeled Chemicals, catalog number: ARC 3297 )
Methanol (CARLO ERBA Reagents, catalog number: 412532 )
Potassium chloride (AppliChem GmbH, catalog number: A2939 )
Ecolite(+)TM liquid scintillation cocktail (MP Biomedicals, catalog number: 882475 )
1 M HEPES-KOH (see Recipes)
1 M Tricine (see Recipes)
0.25 M Potassium acetate (see Recipes)
1 M DTT (see Recipes)
0.5 M EDTA (see Recipes)
0.1 M Maltotriose (see Recipes)
3 M KCl (see Recipes)
20 mg/ml Glycogen solution (see Recipes)
Extraction buffer (see Recipes)
Percoll buffer (see Recipes)
Washing buffer (see Recipes)
Precipitation buffer (see Recipes)
Equipment
Small mortar and pestle
1.5 ml microfuge tubes
Automatic pipettes
Precision scale
Centrifuge (Eppendorf, model: 5810 R )
Microcentrifuge (Eppendorf, model: 5424 )
Scintillation Counter (Beckman Coulter, model: LS 6000 IC )
Scintillation vials (Sigma-Aldrich, catalog number: Z376817 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant metabolism > Carbohydrate
Plant Science > Plant biochemistry > Protein
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,317 | https://bio-protocol.org/exchange/protocoldetail?id=1317&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Soluble Sugars in Arabidopsis thaliana Leaves by Anion Exchange Chromatography
MO M. Isabel Ortiz-Marchena
MR M. Teresa Ruiz
Federico Valverde
José M. Romero
Published: Vol 4, Iss 23, Dec 5, 2014
DOI: 10.21769/BioProtoc.1317 Views: 14223
Edited by: Tie Liu
Reviewed by: Xiao-qing Xu
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Determination of soluble sugars is basic for the study of carbon metabolism in plants. Soluble sugar quantitation can be achieved by enzymatic methods implying different coupled reactions. Here we describe a simple method that allows rapid determination of the most abundant soluble sugars (glucose, fructose and sucrose) in Arabidopsis leaves by anion exchange chromatography. We have applied this method to study the levels of soluble sugars during the photoperiodic transition to flowering (Ortiz-Marchena et al., 2014).
Keywords: Sugar determination Soluble sugars Arabidopsis HPLC
Materials and Reagents
Plants grown in soil for 3 weeks
Note: Treatment of samples is explained in the Procedure section.
Liquid N2
Absolute ethanol
HEPES (Sigma-Aldrich, catalog number: H4034-1KG )
KOH (Panreac Applichem, catalog number: 121515 )
NaOH 50% (w/v) solution (AppliChem GmbH, catalog number: A3720, 1000 )
Milli Q grade water
100 mM HEPES-KOH (see Recipes)
Extraction buffer 1 (EB1) (see Recipes)
0.1 M NaOH (see Recipes)
21.6 mM NaOH (see Recipes)
Equipment
Small mortar and pestle
1.5 ml microfuge tubes
Automatic pipettes
Precision scale
2 ml microcentrifuge (Eppendorf, model: 5415R )
Vacufuge concentrator 5301 (Eppendorf)
Nylon filters (Whatman, catalog number: UN203NPENYL )
Dionex HPLC system (Dionex ICS 5000)
CarboPacPA10 column (4 x 250 mm) (Thermo Fisher Scientific, catalog number: 046110 )
CarboPacPA10 Pre-column (4 x 50 mm) (Thermo Fisher Scientific, catalog number: 046115 )
Gold electrode (Dionex ICS 5000)
Computer connected to HPLC system
Software
Chromeleon software (v.7.0) (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ortiz-Marchena, M. I., Ruiz, M. T., Valverde, F. and Romero, J. M. (2014). Determination of Soluble Sugars in Arabidopsis thaliana Leaves by Anion Exchange Chromatography. Bio-protocol 4(23): e1317. DOI: 10.21769/BioProtoc.1317.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Carbohydrate
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
132 | https://bio-protocol.org/exchange/protocoldetail?id=132&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of GST-tagged Proteins from E. coli
Lin Fang
Published: Sep 20, 2011
DOI: 10.21769/BioProtoc.132 Views: 21659
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes a method for the small and large-scale expression and purification of GST proteins. Due to the diverse nature of proteins, a small-scale expression and purification test is always recommended.
Materials and Reagents
Escherichia coli (E. coli) strain of choice
IPTG (Sigma-Aldrich)
Imidazaole (Sigma-Aldrich)
Protease inhibitor (Roche Diagnostics)
Lysozyme (Sigma-Aldrich)
Glutothion sepharose 4B beads (Thermo Fisher Scientific/Pierce Antibodies, catalog number: 15160 )
Glutathione (Thermo Fisher Scientific/Pierce Antibodies, catalog number: 78259 )
NP-40 (Sigma-Aldrich)
Bacto trypton
Yeast extract
Liquid nitrogen
NaCl
KCl
Na2HPO4
KH2PO4
Protease inhibitor
Lysis buffer (see Recipes)
1x PBS buffer (see Recipes)
Elution buffer (see Recipes)
2x YT medium (see Recipes)
Equipment
Sonicator
Centrifuges
Pellete
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Expression
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
133 | https://bio-protocol.org/exchange/protocoldetail?id=133&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Antibody Purification from Western Blotting
Lin Fang
Published: Vol 2, Iss 6, Mar 20, 2012
DOI: 10.21769/BioProtoc.133 Views: 22678
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes a method of purifying antibodies from sera with denatured antigens immobilized on western blot membranes. Advantages include (1) fast and easy; (2) purification of antibody with antigen in denatured form allows high yield in case antigen protein solubility is limited. Disadvantage is that possible antibodies that recognize certain 3D structure in solution of antigens might not be purified using such a method. Regarding this issue, the flow through is recommended to be kept and can be used for other purification methods with folded antigens.
Materials and Reagents
Antigen protein
PVDF or Nitrocellulose membrane (Amersham biosciences/GE Healthcare Dharmacon)
Ponceau S (Sigma-Aldrich, catalog number: P7170 )
non-fat Milk powder (Carnation, any your favorite brand in local store)
Tween 20 (Sigma-Aldrich)
Glycine
Acetic acid
2 M Tris-HCl (pH 8.5)
NaCl
KCl
Na2HPO4
KH2PO4
Ultra pure water
TBST (see Recipes)
10x TBS (1 L) (see Recipes)
PBS (pH 7.4) (see Recipes)
Ponceau S solution (see Recipes)
Equipment
Dialysis bag (Thermo Fisher Scientific/Pierce Antibodies, catalog number: 68035 )
Comb
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Antibody analysis > Antibody-antigen interaction
Immunology > Antibody analysis > Antibody detection
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
134 | https://bio-protocol.org/exchange/protocoldetail?id=134&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Yeast in situ Hybridization
Wei Zheng
Published: Sep 20, 2011
DOI: 10.21769/BioProtoc.134 Views: 11711
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol describes the procedure to label a certain mRNA species in yeast cells with fluorescence probes and prepare slides for visualization under microscope. Probe design/synthesis and microscopy operation are not covered.
Materials and Reagents
HCl
Poly L-Iysine
Formaldehyde
β-mercaptoethanol
Oxalyticase
SDS
70% ethanol
Formamide
20x SSC
NaH2PO4 buffer
Triton X-100
1x PBS-DEPC
DAPI
40% formamide/2x SSC (see Recipes)
80% formamide (see Recipes)
Hybridization solution (see Recipes)
Equipment
Incubator
Centrifuges
Glass beaker
Autoclaved glass cylinder
Baked glass pipette
Hotplate
Fume hood
Petri dish
Foil
50 ml conical tubes
Parafilm
Light microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > RNA
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
135 | https://bio-protocol.org/exchange/protocoldetail?id=135&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
qPCR of Yeast ChIP DNA
Wei Zheng
Published: Sep 20, 2011
DOI: 10.21769/BioProtoc.135 Views: 17103
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol is adapted from Chris Yellman's personal notes for qPCR of yeast ChIP DNA to verify binding sites already identified by microarray/sequencing analysis. In addition, qPCR is a quick way to assay the quality of a ChIP sample (provided you have a few well-characterized binding sites) before submitting it for sequencing/microarray analysis. This protocol is designed for use with a Roche LightCycler.
Materials and Reagents
PCR primers
a. Prepare 10 µM primer stocks in water from 100 µM stocks in TE.
b. Pick several positive control primer pairs and at least one negative site. Primer design criteria are described in the protocol.
LightCycler 480 SYBR Green I Master mix (Roche Diagnostics, catalog number: 04707 516001 )
The mix contains Taq, dNTPs and the intercalating SYBR Green dye.
Yeast genomic DNA for a positive control dilution series
You can use a glass bead lysis yeast genomic DNA preparation that has been RNase treated, Qiagen cleaned and stored in TE, or purchase directly from Invitrogen.
10 µl capacity multi-well pipetter
384-well reaction plate with transparent adhesive plastic cover
Equipment
Covered container
Microcentrifuge tube
384-well reaction plate
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > RNA
Biochemistry > Protein > Immunodetection
Molecular Biology > RNA > qRT-PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,357 | https://bio-protocol.org/exchange/protocoldetail?id=1357&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cyclohexane Diamine Tetraacetic Acid (CDTA) Extraction of Plant Cell Wall Pectin
GB Gerit Bethke
JG Jane Glazebrook
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1357 Views: 11724
Edited by: Renate Weizbauer
Reviewed by: Marisa Rosa
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
The goal of this procedure is to extract pectin from plant cell walls. Pectins are galacturonic acid containing polymeric sugars that are important components of plant cell walls. Various procedures aimed at studying plant cell wall components require the extraction of pectin. Pectin is synthesized in the Golgi apparatus in a highly esterified fashion and is de-esterified in the cell wall (Mohnen, 2008). Pectin is generally water soluble. De-esterified pectin can form so-called “egg-box structures” in the presence of Ca2+ ions (Mohnen, 2008; Harholt et al., 2010). Pectin in these “egg-box structures” is cross-linked and less soluble. Cyclohexane diamine tetraacetic acid (CDTA) chelates Ca2+ ions and hence allows extraction of Ca2+ cross-linked pectin from cell walls.
Materials and Reagents
Plant material or cell wall preparation of choice (see Note 1)
Cyclohexane diamine tetraacetic acid (CDTA) (Fluka, catalog number: 34588 )
Tris-base (Sigma-Aldrich, catalog number: T6066 )
Sodium hydroxide (Thermo Fisher Scientific, catalog number: S318 )
Liquid nitrogen
CDTA extraction buffer (see Recipes)
Equipment
Liquid nitrogen container
Paint shaker (e.g. Harbil, model: 5G-HD) and ball bearings (e.g. 3 mm diameter steel beads) (mortar and pestle or bead beater)
Media bottle
Single-channel pipettor
Microfuge tubes appropriate for use at 95 °C and for freezing in liquid N2 (Thermo Fisher Scientific, catalog number: 02-707-355 )
Note: We use 2 ml screw cap tubes.
Pipette tips
Water bath or incubator
Vortex mixer
Microcentrifuge capable of spinning at 10,000 x g
Optional: Screw cap tubes or lid locks
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bethke, G. and Glazebrook, J. (2014). Cyclohexane Diamine Tetraacetic Acid (CDTA) Extraction of Plant Cell Wall Pectin. Bio-protocol 4(24): e1357. DOI: 10.21769/BioProtoc.1357.
Bethke, G., Grundman, R. E., Sreekanta, S., Truman, W., Katagiri, F. and Glazebrook, J. (2014). Arabidopsis PECTIN METHYLESTERASEs contribute to immunity against Pseudomonas syringae. Plant Physiol 164(2): 1093-1107.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,358 | https://bio-protocol.org/exchange/protocoldetail?id=1358&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans
Germano Cecere
Alla Grishok
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1358 Views: 14362
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The RNA chromatin immunoprecipitation assay (RNA-ChIP) allows detection and quantification of RNA–protein interactions using in vivo cross-linking with formaldehyde followed by immunoprecipitation of the RNA–protein complexes. Here we describe the RNA–ChIP protocol that we have adapted for Caenorhabditis elegans (C. elegans) to detect interaction between the nuclear Argonaute CSR-1 (chromosome segregation and RNAi deficient) protein and its target nascent RNAs. We have used a transgenic strain expressing a recombinant long isoform of CSR-1 protein fused with N-terminal 3x FLAG epitope.
Materials and Reagents
Escherichia coli (E. coli) OP50 [available from the Caenorhabditis Genetics Center (CGC)]
Anti–FLAG M2 affinity gel (Sigma-Aldrich, catalog number: A2220 )
1-Bromo-3-chloropropane (BCP) (Sigma-Aldrich, catalog number: B9673 )
1 M CaCl2 solution (Sigma-Aldrich, catalog number: 21114 )
Distilled water (DNase/RNase-free UltraPureTM) (Life Technologies, InvitrogenTM, catalog number: 10977-015 )
10 mM dNTP mix (Thermo Fisher Scientific, catalog number: R0191 )
EDTA (0.5 M, pH 8.0) UltraPureTM (Life Technologies, InvitrogenTM, catalog number: 15575-020 )
Ethanol 200 proof (for molecular biology) (Sigma-Aldrich, catalog number: E7023 )
FLAG peptide (Sigma-Aldrich, catalog number: F4799 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
GlycoBlueTM coprecipitant (15 mg/ml) (Life Technologies, Ambion®, catalog number: AM4530)
100x halt protease inhibitor cocktail (Thermo Fisher Scientific, catalog number: 78430 )
Isopropanol (2-propanol, for molecular biology) (Sigma-Aldrich, catalog number: I9516 )
KH2PO4 (Sigma-Aldrich, catalog number: P0662 )
8 M LiCl solution (Sigma-Aldrich, catalog number: L7026 )
Maxima reverse transcriptase (Thermo Fisher Scientific, catalog number: EP0741 )
1 M MgCl2 solution (Sigma-Aldrich, catalog number: M1028 )
1 M MgSO4 solution (Sigma-Aldrich, catalog number: M3409 )
Na2HPO4 (Sigma-Aldrich, catalog number: S3264 )
5 M NaCl solution (Life Technologies, Ambion®, catalog number: AM9759 )
NP-40 [10% (w/v) aqueous solution] (Pierce Antibodies, catalog number: 85124 )
Paraformaldehyde (32% solution, EM grade) (VWR International, catalog number: 15714-S )
Phase lock gel heavy (1.5 ml) (5PRIME, catalog number: 2302810 )
Phenol:Chloroform:IAA (25:24:1, pH 6.6) (Life Technologies, Ambion®, catalog number: AM9730 )
Proteinase K (~20 mg/ml) (recombinant) (PCR grade) (Thermo Fisher Scientific, catalog number: EO0491 )
2x QuantiFast SYBR® Green qPCR master mix (QIAGEN, catalog number: 204154 )
Random hexamers (100 µM) (Thermo Fisher Scientific, catalog number: SO142 )
RNase inhibitor SUPERase InTM (20 U/μl) (Life Technologies, Ambion®, catalog number: AM2694 )
20% SDS solution (Life Technologies, Ambion®, catalog number: AM9820 )
3 M sodium acetate (pH 5.5) solution (Life Technologies, Ambion®, catalog number: AM9740 )
Sodium deoxycholate stock solution [10% (w/v) in distilled water] (Pierce Antibodies, catalog number: 89904 )
TRI Reagent® solution (Life Technologies, Ambion®, catalog number: AM9738 )
1 M Tris-HCl (pH 7.5) UltraPureTM (Life Technologies, InvitrogenTM, catalog number: 15567-027 )
Triton-X 100 detergent solution (Pierce Antibodies, catalog number: 85111 )
The sequence of primers used in Figure 1 to detect mes-4 pre-mRNA: Forward GGATACATCAATGGAGAAATGGA (spanning exon 2 and intron 3) and Reverse ACAACTCGCGTGAAATTTACTAC (spanning intron 3)
Note: DNA oligos has been synthesized by Integrated DNA Technologies (IDT).
1x M9 buffer (see Recipes)
Nuclei extraction buffer (see Recipes)
RIPA buffer (see Recipes)
TSE 150 buffer (see Recipes)
TSE 500 buffer (see Recipes)
TSE 1,000 buffer (see Recipes)
LiCl buffer (see Recipes)
TE buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
1.5 ml Bioruptor TPX® polymethylpentene tubes (Diagenode, catalog number: M500-50 )
Microfuge tubes (1.5 ml, RNase free) (Life Technologies, InvitrogenTM, catalog number: AM12400 )
Bioruptor® standard UCD-200 sonicator (Diagenode, catalog number: B01010003 )
Dura-GrindTM stainless steel dounce tissue grinder 7 ml size (Wheaton Scientific, catalog number: 357572 )
Real-time PCR machine (e.g. Eppendorf, Mastercycler® ep realplex4)
Refrigerated tabletop microcentrifuge
LabquakeTM tube rotators (Thermo Fisher Scientific, catalog number: 400220Q )
Vortex
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cecere, G. and Grishok, A. (2014). RNA Chromatin Immunoprecipitation (RNA-ChIP) in Caenorhabditis elegans. Bio-protocol 4(24): e1358. DOI: 10.21769/BioProtoc.1358.
Download Citation in RIS Format
Category
Biochemistry > Protein > Immunodetection
Biochemistry > RNA > RNA-protein interaction
Molecular Biology > RNA > RNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,359 | https://bio-protocol.org/exchange/protocoldetail?id=1359&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virus-induced Gene Silencing (VIGS) in Phalaenopsis Orchids
Ming-Hsien Hsieh
ZP Zhao-Jun Pan
Hsin-Hung Yeh
Hong-Hwa Chen
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1359 Views: 12732
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
This is a protocol to produce stable silencing efficacy and efficiency for VIGS using CymMV as a silencing vector for floral functional genomics in Phalaenopsis orchids. This protocol is established based on a method created by Lu et al. (2007), and then modified by Hsieh et al. (2013a; 2013b), Lu et al. (2012) successfully engineered a cloning vector (pCymMV-Gateway) in that the target gene fragment is simple to insert and can be manipulated with high efficiency. The silencing vector is inoculated into plants by Agro-inoculation by using Agrobacterium tumefaciens (A. tumefaciens) strain EHA105. Agro-infiltration of leaves for use in VIGS study of orchid flowers is a time saver and produces less damage to flower buds.
Materials and Reagents
Virus-free Phalaenopsis plants
TOP10 Escherichia coli (E. coli) competent cells
Agrobacterium tumefaciens strain EHA105
Gel/PCR DNA fragments extraction kit (Geneaid Biotech, catalog number: DF100 )
Gateway® BP-ClonaseTM II enzyme mix (Life Technologies, InvitrogenTM, catalog number: 11789-020 )
Selective plate (LB plate with 50 µg/ml Kanamycin)
High-speed plasmid mini kit (Geneaid Biotech, catalog number: PD100 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
Murashige and Skoog salt (Sigma-Aldrich, catalog number: M5524 )
Tryptone (US Biological, catalog number: 12855 )
Yeast extract (Affymetrix, catalog number: 23547 )
NaCl (Sigma-Aldrich, catalog number: S1446 )
Tris-HCl (US Biological, catalog number: 22676 )
CaCl2 (Inter-County Mechanical Corp., catalog number: 03-11250 )
Glycerol (J.T.Baker®, catalog number: 2136-01 )
Luria Broth medium (LB medium) (see Recipes)
Proteinase K solution (see Recipes)
Murishige and Skoog medium (MS medium) salt (see Recipes)
Equipment
GeneAmp PCR system 9700 (Life Technologies, Applied Biosystems®)
Laminar flow cabinet
BioChrom Libra S50 UV/Vis Spectrophotometer (Biochrom)
Incubator shaker
Electroporation machine (Kaneka Corporation, Eurogentec)
Electroporation cuvettes (EquiBio, catalog number: ECU-102 )
Centrifuges for MiniSpin Eppendorf and 50 ml conical centrifuge tubes
1-ml syringe with a needle
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Hsieh, M., Pan, Z., Yeh, H. and Chen, H. (2014). Virus-induced Gene Silencing (VIGS) in Phalaenopsis Orchids. Bio-protocol 4(24): e1359. DOI: 10.21769/BioProtoc.1359.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA interference
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
136 | https://bio-protocol.org/exchange/protocoldetail?id=136&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Taq DNA Polymerase
Wei Zheng
Published: Oct 5, 2011
DOI: 10.21769/BioProtoc.136 Views: 34363
Download PDF
Ask a question
Favorite
Cited by
Materials and Reagents
Dialysis tubing cellulose membrane avg. flat width 33 mm (Sigma-Aldrich, catalog number: D9652 )
E.coli BL21 strain
Ammonium sulfate (Sigma-Aldrich, catalog number: A4418 )
IPTG
Ampicillin
(NH4)2SO4
1 M dextrose
1 M Tris - HCl (pH 7.9)
0.5 M EDTA (pH 8.0)
KCl
PMSF
Tween 20
NP40
Lysozyme
Glycerol
Triton-X 100
Lysis buffer (see Recipes)
Buffer A (see Recipes)
Pre - lysis buffer (see Recipes)
Storage buffer (see Recipes)
TAQ buffer (see Recipes)
MgCl2 solution (see Recipes)
Equipment
2 L flask
Centrifuges
Oakridge tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,360 | https://bio-protocol.org/exchange/protocoldetail?id=1360&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Imaging and Measurement of Nanomechanical Properties within Primary Xylem Cell Walls of Broadleaves
Jaroslav Ďurkovič
MK Monika Kardošová
RL Rastislav Lagaňa
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1360 Views: 12029
Edited by: Arsalan Daudi
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
A technique of atomic force microscopy (AFM) called PeakForce quantitative nanomechanical mapping (PeakForce QNM) is an efficient tool for the quantitative mechanobiological imaging of fibrillar aggregate, human epidermal cell and woody plant cell wall topography (Sweers et al., 2011; Heu et al., 2012; Ďurkovič et al., 2012; Ďurkovič et al., 2013). Here, we describe a detailed protocol for the measurement of nanomechanical properties of primary xylem cell walls in woody plants, for the determination of reduced Young’s modulus of elasticity (MOE), adhesion, deformation, and energy dissipation (Figure 1). This new technique provides direct control of the maximum loading force and the deformation depth in cell wall samples keeping indentations small, while at the same time eliminating damaging lateral forces in order to preserve both the AFM tip and plant sample. High-resolution and non-destructive imaging shed new quantitative mechanistic insights into the structural biology of woody plant cell walls. This procedure can also be adapted for other biological samples with a varying range of stiffness.
Keywords: Atomic force microscopy Cell wall nanomechanics Modulus of elasticity Adhesion PeakForce QNM
Figure 1. Basic principles illustrating how the different nanomechanical properties are extracted from the force curve. The image shows a typical force curve for a primary xylem cell wall sample in the Dutch elm disease-sensitive hybrid 'Groeneveld'. PeakForce QNM mode performs a very fast force curve at every pixel in the image. Analysis of force curve data is done on the fly, providing a map of multiple nanomechanical properties that has the same resolution as the height image. The adhesion is the vertical distance between the base line and the lowest portion of the retraction curve. The deformation is the horizontal distance between the contact point and the turn-away point (representing maximum indentation). The Young’s modulus of elasticity can be extracted by extrapolating the linear portion of the retraction curve after the contact point using a Derjaguin, Muller, Toporov (DMT) model fit. The slope of the linear portion is determined according to the least square method procedure. The energy dissipation can be calculated by integrating the area between the two curves.
Materials and Reagents
Leaf midribs from broadleaves (Ulmus spp., Sorbus spp.)
Glutaraldehyde solution, 25% in H2O (Grade II) (Sigma-Aldrich, catalog number: G6257 )
Ethanol solutions (Analytical Reagents)
Note: 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, each of them prepared by diluting of 96% ethanol in a 0.1 M cacodylate buffer, and 100% ethanol.
25% glutaraldehyde (Grade I) (Sigma-Aldrich, catalog number: G5882 )
Xylene (Analytical Reagents) or alternative cleaners with a lower toxicity (for example D-limonene)
Note: Work with xylene or D-limonene only in a properly operating and certified fume cupboard.
Paraplast plus (Sigma-Aldrich, catalog number: P3683 )
(3-Aminopropyl) triethoxy-silane (Sigma-Aldrich, catalog number: A3648 )
0.1 M cacodylate buffer (see Recipes)
Circle glass slides coated with (3-aminopropyl)triethoxy-silane (see Recipes)
1x phosphate buffered saline (PBS) (see Recipes)
Glutaraldehyde fixative solution (see Recipes)
Equipment
Razor blades (fine tweezers and heated forceps)
pH meter
Exicator with a vacuum pump
Petri dishes
Laboratory drying chamber
Retracting base sledge microtome (Series 8000) (Bright Instrument Co.)
Circle glass slides (11 mm in diameter, 1 mm thick)
Slide warmer
Steel AFM sample mounting disks
Sample adhesive pads
Silicon probes MPP-12120 (model: TAP150A ) having a 180° rotated tip and the spring constant at least 5 N/m (Bruker AFM Probes)
Fused silica reference sample (nominal MOE 72.9 GPa) or any other reference sample having the MOE value higher than 70 GPa
TGT1 commercial tip characterization grating (NT-MDT Co.)
MultiMode 8 atomic force microscope with a Nanoscope V controller and a PeakForce Quantitative Nanomechanical Mapping mode (Bruker Corporation)
Software
NanoScope analysis (version 1.40r2) (Bruker Corporation)
MATLAB (version 7) (MathWorks)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ďurkovič, J., Kardošová, M. and Lagaňa, R. (2014). Imaging and Measurement of Nanomechanical Properties within Primary Xylem Cell Walls of Broadleaves. Bio-protocol 4(24): e1360. DOI: 10.21769/BioProtoc.1360.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell structure > Cell adhesion
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,361 | https://bio-protocol.org/exchange/protocoldetail?id=1361&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Trichome Isolation and Integrity Test from Brassica villosa and Other Species
NN Naghabushana Nayidu
PB Peta Bonham-Smith
MG Margaret Y. Gruber
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1361 Views: 9526
Edited by: Arsalan Daudi
Reviewed by: Cindy AstMaria Sinetova
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
The outward growths from one or more epidermal cells are well known as trichomes (plant hair cells) (Levin, 1973; Mathur, 2006). Preparation of pure intact non-glandular trichomes from trichome-rich Brassica villosa depended on rendering the trichomes sufficiently stiff to dislodge them from the leaves in an undamaged state, which can be further used for structural, transcriptome, genome and biochemical or chemical analysis. Dislodging the flexible trichomes from Brassica villosa (B. villosa) with a paintbrush [as in Zhang and Oppenheimer (2004)] proved too gentle, and scraping trichomes off the leaves with a razor blade [as in Zhang and Oppenheimer (2004)] resulted in trichome cell disruption. Aziz et al. (2005) reported isolating alfalfa glandular trichomes by shearing in liquid nitrogen (N2). In the present study, a similar method was used. Non-glandular leaf trichomes were isolated by treating tissue with liquid N2 to stiffen the flexible trichomes, followed by 1 min of shearing force with a common vortex mixer to dislodge the trichomes from their leaf bed (Nayidu et al., 2014). Up-to ~20 % of the trichomes were removed from the leaf surface and the majority were unbroken (confirmed by no staining by trypan blue; Figure 1). Trichomes were then purified by straining a tissue/trichome/water mixture through a sieve. However, leaf tissues also became very brittle after dipping in liquid N2 and broke up into very small pieces if the leaf tissue was agitated for a longer time period. Hence, N2-treated leaf samples could not be re-used to recover remaining attached trichomes. Contaminating leaf pieces from a 1 min shear were larger and easily to separate manually from the detached trichomes within the sieve, rendering a purified intact trichome preparation. The method was also successful at purifying trichomes from soybean (Glycine max) and tomato (Solanum lycopersicum).
Keywords: Trichome Brassica Isolation Villosa Vertex
Materials and Reagents
Fresh trichome-bearing leaf tissue from Brassica villosa (drepanensis cv.) (from two month old up-to two year leaves), soybean cv. B220, and tomato cv. Roma
Note: Depending on the plant species and the subsequent type of analysis after trichome isolation, any tissue with non-glandular trichomes will likely suffice. However, tissues with denser trichome coverage will provide a greater yield of detached trichomes.
Liquid nitrogen
Note: Training in the safe use of liquid nitrogen is imperative.
Sterile Millipore purified water
Ice
0.4 % trypan blue (see Recipes)
Equipment
Gloves to resist freezing temperatures (Cryo-Gloves) (VWR International, catalog number: 32885-736 )
Polyfoam insulated box with ice
1-ml pipette with plastic pipette tips
50 ml BD FalconTM conical plastic centrifuge tubes (BD, catalog number: 14-432-22 ) or plastic 250 ml centrifuge bottles (Thermo Fisher Scientific, catalog number: EW-06105-20 )
BD-Falcon nylon mesh cell strainer (40 μm pore size) (BD Biosciences, catalog number: 08-771-1 )
Blunt end forceps to remove contaminating debris from the strainer (Seton, catalog number: AA969 )
Genie 2 vortex mixer (Thermo Fisher Scientific) having round mixer head (for tubes) and flat mixer head (for larger bottles)
-80 °C freezer
4 °C refrigerator
FlexidryTM unit (FTS Systems, catalog number: 4283 )
Controlled environment greenhouse or growth cabinet.
Note: Plant growth conditions depend on the nature of subsequent analyses. For example, chemical composition of plant tissuses can change substantially with altered light intensity and temperature (16 h light/8 h dark, at least 400 µE.m-2.s-1, 20/17 °C recommended, but light intensity from 700-1,400 µE.m-2.s-1 will mimic outside daylight).
Axiovert 100 microscope (ZEISS) with 10x magnification
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant physiology > Tissue analysis
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,362 | https://bio-protocol.org/exchange/protocoldetail?id=1362&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Agrobacterium-mediated Transformation of Mature Ginseng Embryos
Ok Ran Lee
JH Jin Haeng Han
YK Yoon-Ri Kim
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1362 Views: 11355
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Ginseng refers to species within the genus Panax and is a slow-growing perennial herb from the Araliaceae family. The most widely used Panax species is Panax ginseng Meyer (Korean ginseng). Panax japonicus (Japanese ginseng), Panax notoginseng (Chinese ginseng), and Panax quinquefolium (American ginseng). Due to the various pharmaceutical importance of ginsenosides, ginseng plant has been cultivated for its highly valued root over 2,000 years as a medicinal plant in East Asian countries particularly in China, Korea, and Japan and North America. Korean ginseng (Panax ginseng C. A. Meyer) consists of nine cultivars from three Jakyung, Chungkyung, and Hwangsook lines. Cultivar “Yunpoong” has characteristics to have more axillary shoots and lateral roots compared to other cultivars. Thus “Yunpoong”: Ginseng seeds are relatively more feasible for regeneration of adventitious roots during gene transformation. Here, we describe how to prepare and treat ginseng seeds after harvest till the ginseng immature embryos are ready for the germination, and to be used in Agrobacterium tumefaciens-mediated gene transformation.
Keywords: Panax ginseng Adventitious root Agrobacterium tumefaciens Binary vector Regeneration
Materials and Reagents
Ginseng seeds, in which zygotic embryos were in a mature state (4 mm in length)
Agrobacterium tumefaciens C58C1 (pMP90) strain
Binary (pCAMBIA1390) vector
MS powder (Duchefa Biochemie, catalog number: M0222 )
Sucrose (Duchefa Biochemie, catalog number: S0809 )
2-(N-morpholino) ethanesulfonic acid (MES) monohydrate (MB cell, catalog number: MB-M4837 )
Phytoagar (Duchefa Biochemie, catalog number: P1003) or Gelrite (Duchefa Biochemie, catalog number: G1101)
Yeast extract (Duchefa Biochemie, catalog number: Y1333 )
Peptone (Duchefa Biochemie, catalog number: P1328 )
NaCl (Affymetrix, catalog number: 4171746 )
Bactoagar (BD, catalog number: 214010 )
Hygromycin (Duchefa Biochemie, catalog number: H0192 )
Kanamycin (Duchefa Biochemie, catalog number: K0126 )
Cefotaxime (Duchefa Biochemie, catalog number: C0111 )
6-benzylaminopurine (BAP) (Duchefa Biochemie, catalog number: B0904 )
2,4-dichlorophenoxyacetic acid (2,4-D) (Duchefa Biochemie, catalog number: D0911 )
Indole-3-butyric acid (IBA) (Duchefa Biochemie, catalog number: I0902 )
Sucrose
Phyto agar
70% ethyl alcohol (EtOH)
2% (v/v) sodium hypochlorite (NaOCl) (Sigma-Aldrich, catalog number: 425044-1L )
B5 medium (Duchefa Biochemie, catalog number: G0209 )
MS (Murashige & Skoog) medium (see Recipes)
YEP medium (see Recipes)
Antibiotics stock solution (in ddH2O) (see Recipes)
Plant growth regulators stock solution (see Recipes)
Equipment
Laminar flow cabinet (HEPA filter 99.99% efficient on particle of 0.3 μ and vertical type)
Shaking incubator (100~200 rpm on a gyratory shaker)
Centrifuge (3,000 x g) (Labnet International, catalog number: C2500-R-230V )
Micropipette
Forceps (Phoenix Technologies, catalog number: ESD-16 )
Erlenmeyer flask (50/100 ml) or autoclavable plastic tube for seed sterilization
Autoclave machine
Growth chamber (23 °C ± 2 °C)
Sterile filter paper
Petri dish
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lee, O. R., Han, J. H. and Kim, Y. (2014). Agrobacterium-mediated Transformation of Mature Ginseng Embryos. Bio-protocol 4(24): e1362. DOI: 10.21769/BioProtoc.1362.
Kim, Y. J., Lee, O. R., Oh, J. Y., Jang, M. G. and Yang, D. C. (2014). Functional analysis of 3-hydroxy-3-methylglutaryl coenzyme a reductase encoding genes in triterpene saponin-producing ginseng. Plant Physiol 165(1): 373-387.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Plant Science > Plant physiology > Plant growth
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,363 | https://bio-protocol.org/exchange/protocoldetail?id=1363&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Localization and Topology of Thylakoid Membrane Proteins in Land Plants
ST Salar Torabi
MP Magdalena Plöchinger
JM Jörg Meurer
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1363 Views: 12381
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Thylakoids are a formation of flattened membrane vesicles and protein complexes found in cyanobacteria, algae and plants. In the chloroplasts of land plants the thylakoid membrane systems form a network of densely packed stacks called grana lamellae, which are connected by unstacked stroma lamellae. Photosystem II is mainly localized in the appressed grana region, while photosystem I and the ATP synthase complexes are enriched in the stroma lamellae. The cytochrome b6/f complex is distributed laterally throughout both stacked and unstacked membrane regions. The photosynthetic complexes consist of integral and peripheral proteins. The first part of this protocol (A) shows how to fractionate thylakoids into grana and stroma lamellae. The second part of this protocol (B) shows how to distinguish between strong hydrophobic integral membrane associations and weak electrostatic membrane and/or membrane complex associations. As it is necessary to specifically detect the protein of interest in the fractions, a specific antibody raised against the protein of interest or a complemented null mutant of a structural component expressing a tagged fusion protein would be of great advantage. The last part of this protocol (C) shows, how to investigate the topology of integral and peripheral proteins. This method requires a specific antibody for the protein of interest. For integral membrane proteins peptide-specific antibodies or epitope-tagged versions are required. The protocol is suitable for the investigation of low molecular weight proteins (LMW) below 5 kDa (Torabi et al., 2014).
Keywords: Stroma Grana Photosystem Topology Thylakoid
Materials and Reagents
Freshly isolated thylakoids
Digitonin (water soluble) (SERVA Electrophoresis GmbH, catalog number: 19551.02 )
Thermolysin from Bacillus thermoproteolyticus (Calbiochem®, catalog number: 58656 )
NaBr (Sigma-Aldrich, catalog number: S-9756 )
NaSCN (Merck KGaA, catalog number: 6627 )
Na2CO3 (Merck KGaA, catalog number: 6392 )
NaOH (Roth North America, catalog number: 9097.2 )
Sucrose (Roth North America, catalog number: 9097.2 )
EDTA (SERVA Electrophoresis GmbH, catalog number: 11280 )
HEPES (Roth North America, catalog number: 9105.3 )
Na2HPO4 (Roth North America, catalog number: 4984.3 )
NaH2PO4 (Roth North America, catalog number: K300.2 )
0.1 M sodium phosphate buffer (see Recipes)
Fractionation buffer (see Recipes)
HS buffer (see Recipes)
0.4% digitonin solution (see Recipes)
Thermolysin stock solution (40 mg/ml) in HS buffer (see Recipes)
Salt containing HS buffers (see Recipes)
Equipment
Centrifuges (Beckmann Coulter, model: Avanti J-25 ; Eppendorf, model: 5430 R )
Ultracentrifuge (Beckmann Coulter, model: Optima LE-80K )
Sonifier (Branson, model: B-12 )
Photometer (Amersham biosciences, model: UltraspeTM 3100 pro )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Torabi, S., Plöchinger, M. and Meurer, J. (2014). Localization and Topology of Thylakoid Membrane Proteins in Land Plants. Bio-protocol 4(24): e1363. DOI: 10.21769/BioProtoc.1363.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant biochemistry > Protein
Plant Science > Plant cell biology > Organelle isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,364 | https://bio-protocol.org/exchange/protocoldetail?id=1364&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Polysomal-mRNA Extraction from Arabidopsis by Sucrose-gradient Separation
SL Shih-Yun Lin
Guang-Yuh Jauh
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1364 Views: 11694
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
mRNAs surrounded by polysomes are ready for translation into proteins (Warner et al., 1963); these mRNAs are defined as polysomal-mRNAs (Mustroph et al., 2009). The process is affected by various growth conditions or surrounding situations. Microarray analysis is a powerful tool for detecting genome-wide gene expression. Therefore, using polysomal-mRNAs for microarray analysis can reflect the gene translation information (the translatome) under different developmental stages or environmental conditions from eukaryotes. Polysomal-mRNAs can be collected from the polysomal fraction by sucrose-gradient separation for further quantitative PCR or microarray assay. We modified a protocol (Mustroph et al., 2009) for collecting polysomal-mRNAs via sucrose-gradient separation to eliminate monosomal-mRNA contamination from pLAT52:HF:RPL18 Arabidopsis. This transgenic Arabidopsis uses a pollen-specific promoter (ProLAT52) to generate epitope-tagged polysomal-RNA complexes that could be purified with a specific antigen (Lin et al., 2014). The polysomal-mRNAs we obtained via sucrose-gradient separation and antibody purification underwent in vivo translation in pollen tubes grown from self-pollinated gynoecia of Arabidopsis thaliana.
Keywords: Polysomal-mRNA Sucrose-gradient seperation In vivo translation of genes
Materials and Reagents
pLAT52: HF-RPL18 transgenic Arabidopsis
RNase-free water
Tris buffer (Sigma-Aldrich, catalog number: T1378 )
KCl (Sigma-Aldrich, catalog number: P9541 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
MgCl2 (Sigma-Aldrich, catalog number: M8266 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Cycloheximide (Sigma-Aldrich, catalog number: C7698 )
Chloramphenicol (Sigma-Aldrich, catalog number: C0378 )
Polyoxyethylene 10 tridecyl ether (PTE) (Sigma-Aldrich, catalog number: P2393 )
Sodium deoxycholate (DOC) (Sigma-Aldrich, catalog number: D6750 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Triton X-100 (Sigma-Aldrich, catalog number: X-100 )
Polyoxyethylene(23)lauryl ether (Brij -35) (Sigma-Aldrich, catalog number: P6938 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
NP-40 (Sigma-Aldrich, catalog number: NP 40 )
Polyoxyethylene (Sigma-Aldrich, catalog number: P2393)
Deoxycholic acid (Sigma-Aldrich, catalog number: D2510 )
ANTI-FLAG® M2 Affinity Gel (Sigma-Aldrich, catalog number: A2220 )
RNAsin (Promega Corporation, catalog number: N2511 )
3x FLAG peptide (Sigma-Aldrich, catalog number: F4799 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
Polysomal extraction buffer preparation (see Recipes)
20% detergent mixture (see Recipes)
20% PTE and 10% DOC (see Recipes)
Sucrose gradient layer preparation (see Recipes)
10x sucrose salts (see Recipes)
Preparation of the FLAG M2 Agarose beads (see Recipes)
Equipment
QIAGEN QIA shedder columns (QIAGEN, catalog number: 27115 )
15-ml tube (Labcon, catalog number: 9205-946CB-946C )
Hitachi ultracentrifuge himac CP100WX (Hitachi, catalog number: CP100WX )
Hitachi P40ST swing rotor (Hitachi, model: P40ST )
13PA tubes (Hitachi, catalog number: 332901A )
Spectrophotometer (Beckman Coulter, catalog number: DU648B )
UV monitor (GE Healthcare, catalog number: UVIS-920 )
Pump (GE Healthcare, model: P-50 )
Fraction collector (Gilson Products, catalog number: FC80 )
UV detector system (GE Healthcare, catalog number: monitor UVIS-0912 )
Recorder (GE Healthcare, catalog number: pharmaria LKB REC102 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lin, S. and Jauh, G. (2014). Polysomal-mRNA Extraction from Arabidopsis by Sucrose-gradient Separation . Bio-protocol 4(24): e1364. DOI: 10.21769/BioProtoc.1364.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA extraction
Biochemistry > RNA > mRNA translation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,365 | https://bio-protocol.org/exchange/protocoldetail?id=1365&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hepatitis C virus Cell-to-cell Spread Assay
Naina Barretto
Susan L. Uprichard
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1365 Views: 10632
Reviewed by: Lee-Hwa Tai
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Hepatitis C virus (HCV) can infect naïve cells via entry of “cell-free” extracellular virus or direct “cell-to-cell” transmission. Here, we describe an assay for detecting HCV cell-to-cell transmission, using a non-growing cell culture system that avoids confounding effects of cell growth. The assay consists of infecting a small number of cells in a confluent monolayer and then blocking subsequent cell-free extracellular virions with a neutralizing antibody such that only cell-to-cell transmission may occur. Under these conditions, incubation at 37 °C results in the formation of infected cell foci. The extent of cell-to-cell spread can then be determined by counting the number of cells in each focus. The assay may be modified to assess the effects of inhibitors and/or specific cellular genes on cell-to-cell spread of HCV.
Part I. Main protocol: HCV cell-to-cell spread in non-dividing Huh7 cell cultures
Materials and Reagents
Huh7 cells (from Dr. Francis Chisari, The Scripps Research Institute, La Jolla, CA) (Zhong et al., 2005)
JFH-1 HCVcc (generated as previously described and quantified by limiting dilution titer assay) (Yu and Uprichard, 2010; Knipe and Howley, 2007)
Note: Other infectious HCVcc clones can be used as well.
Dulbecco’s modified Eagle’s medium (DMEM) (Mediatech, catalog number: MT-10-013-CV )
Fetal bovine serum (FBS) (Hyclone, catalog number: SH30910.03 )
Penicillin, streptomycin, L-glutamine (Mediatech, catalog number: MT-30-009-CI )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D4540 )
1x PBS (Mediatech, catalog number: MT- 21-030-CV )
Hydrogen peroxide (H2O2) (Thermo Fisher Scientific, catalog number: H325 )
AEC detection substrate (BD Biosciences, catalog number: 551015 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Ezetimibe (Sequoia Research Products, catalog number: SRP04000e ) prepared in DMSO at 20 mM
Rabbit anti-human CLDN1 polyclonal antibody (Abcam, catalog number: ab63070 )
Rabbit anti-human NPC1L1 polyclonal antibody (Santa Cruz, catalog number: sc-67236 )
Human anti-HCV E2 monoclonal antibody MAb AR3A (from Dr. Mansun Law, The Scripps Research Institute, La Jolla, CA) (Law et al., 2008)
Mouse anti-HCV NS5A 9E10 monoclonal antibody (from Dr. Charles Rice, Rockefeller University, New York, NY) (Lindenbach et al., 2005)
HRP-conjugated goat anti-human (Thermo Fisher Scientific, catalog number: 31410 ), goat anti-mouse (Thermo Fisher Scientific, catalog number: 31430 ), and goat anti-rabbit (Thermo Fisher Scientific, catalog number: 31460 ).
Mouse IgG (Santa Cruz, catalog number: sc-2025 ), rabbit IgG (Santa Cruz, catalog number: sc-2027 )
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 )
Triton X-100 (Sigma-Aldrich, catalog number: T-8787 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9647 )
Lipofectamine RNAiMAX transfection reagent (Life Technologies, catalog number: 13778 )
OptiMEM (Life Technologies, InvitrogenTM, catalog number: 31985-070 )
50 ml centrifuge tubes (Dot Scientific, catalog number: 451-PG )
Complete DMEM (cDMEM) (see Recipes)
Equipment
96-well BioCoat collagen-coated tissue culture plates (Corning, catalog number: 356698 )
BioCoat collagen-coated T75 cm2 flask (Corning, catalog number: 356485 )
Inverted microscope
Hemocytometer
37 °C, 5% CO2 cell culture incubator
Table top centrifuge (e.g. Sorvall, model: T6000D or Eppendorf, model: 5810 R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Barretto, N. and Uprichard, S. L. (2014). Hepatitis C virus Cell-to-cell Spread Assay. Bio-protocol 4(24): e1365. DOI: 10.21769/BioProtoc.1365.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbial cell biology > Cell-based analysis
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,366 | https://bio-protocol.org/exchange/protocoldetail?id=1366&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24Gag
MG Marianne Gesner
MM Mekhala Maiti
RG Robert Grant
Marielle Cavrois
Published: Vol 4, Iss 24, Dec 20, 2014
DOI: 10.21769/BioProtoc.1366 Views: 10799
Reviewed by: Yu Chen
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
The fluorescence-linked antigen quantification (FLAQ) assay allows a fast quantification of HIV-1 p24Gag antigen. Viral supernatant are lysed and incubated with polystyrene microspheres coated with polyclonal antibodies against HIV-1 p24Gag and detector antibodies conjugated to fluorochromes (Figure 1). After washes, the fluorescence of microspheres is measured by flow cytometry and reflects the abundance of the antigen in the lysate. The speed, simplicity, and wide dynamic range of the FLAQ assay are optimum for many applications performed in HIV-1 research laboratories.
Keywords: Viral Production HIV Supernatant Elisa P24Gag
Materials and Reagents
Sphero Protein A Polystyrene Particles (6-8 µm) (Spherotech, catalog number: PAP-60-5 )
Human anti-p24Gag HIV-1 IIIB polyclonal antibodies (ImmunoDX, catalog number 2503 )
Normal Human IgG (Sigma-Aldrich, catalog number: I2511 )
p24Gag recombinant protein (Abcam, catalog number: ab43037 )
Anti-p24Gag KC57 clone conjugated to fluorescein isothiocyanate (FITC) or to phycoerythrin also called RD1 (Beckman Coulter, catalog numbers: 6604665 and 6604667 )
1x phosphate-buffered saline (PBS) without calcium and magnesium (Corning, catalog number: 21-031-CV )
Bovine serum albumin (BSA) (Axenia Biologix, catalog number: S200 )
Triton X-100 (Thermo Fisher Scientific, catalog number: BP151-500 )
16% paraformaldehyde (PFA) solution (Electron Microscopy Sciences, catalog number: 15710 )
Fluorescence-activated cell sorting (FACS) staining buffer (see Recipes)
Equipment
Eppendorf centrifuge
Rotating mixer
96-well V-bottom plate (optional) (Thermo Fisher Scientific, catalog number: 12-565-216 )
Thermo Fisher lids for 96-well microplates (Thermo Fisher Scientific, catalog number: 14-245-53A )
Plate sealers (VWR International, catalog number: 62402-921 )
Eppendorf tubes
Multichannel pipetman (optional)
Pipetman
Tips (1 ml, 200 µl, and 10 µl)
Reagent reservoirs (optional)
Tissue culture centrifuge for Eppendorf tubes or for 96 well plates (optional)
37 °C incubator
Flow cytometer
Note: The FLAQ requires a flow cytometer equipped with a blue laser excitation (488 nm) and one measurement parameter. The photomultiplicator tube (PMT) with a 525/50 nm or a 585/42 band pass filter is used for the detection of FITC or RD1 (phycoerythrin) signals, respectively.
Software
Forecyt (Intellicyt)
FlowJoX software (Tree Star) or other FACS analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gesner, M., Maiti, M., Grant, R. and Cavrois, M. (2014). Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24Gag. Bio-protocol 4(24): e1366. DOI: 10.21769/BioProtoc.1366.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Immunology > Antibody analysis > Antibody-antigen interaction
Biochemistry > Protein > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,367 | https://bio-protocol.org/exchange/protocoldetail?id=1367&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Collection of Root Exudate from Duckweed
Yufang Lu
LS Li Sun
Weiming Shi
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1367 Views: 13647
Edited by: Arsalan Daudi
Reviewed by: Samik BhattacharyaTie Liu
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Root exudates play an important role in rhizosphere interactions between plants and microorganisms. However, collection of chemicals from plant root system is difficult due to their low concentrations and high level of contaminants in growth media. The continuous collection method has been described in several terrestrial plants over the past 30 years (Tang and Young, 1982; Kong et al., 2004). Here, we describe a protocol for the collection of sterile root exudate from a floating aquatic plant, duckweed.
Keywords: Root exudate Duckweed Collection Plant-bacteria interactions
Materials and Reagents
Duckweed fronds, Spirodela polyrrhiza (collected from the paddy field drainage in the Tai Lake region of China)
Sterile deionized water
Methanol (HPLC grade) (Sigma-Aldrich, catalog number: 179337)
Hydrochloric acid (HCl) (Sigma-Aldrich, catalog number: 653799)
Formaldehyde solution (37 wt.% in H2O) (Sigma-Aldrich, catalog number: 252549)
Sodium hypochlorite (NaClO) (available chlorine 4.00-4.99 %) (Sigma-Aldrich, catalog number: 239305)
0.15% formaldehyde solution (see Recipes)
0.5% v/v NaClO (see Recipes)
Modified Steinberg nutrient solution (see Recipes)
Equipment
Duckweed root exudate collection device (Figure 1)
Plexiglass pot (D x H, 16 x 16 cm)
Glass column (D x H, 23 x 170 mm)
XAD-4 resin (20-60 mesh) (Sigma-Aldrich, catalog number: 37380-42-0)
Hydrophobic fluoropore (PTFE) membrane (14 x 14 cm)
Glass wool (Sigma-Aldrich, catalog number: 18421)
Teflon stopper
Aluminum foil
Silicone tube
Figure 1. Equipment used in root exudate collection
Clean bench
Peristaltic pump
Rotary evaporator (Tokyo Rikakikai, EYELA, model: N-1100D)
Freeze dryer (Freezone Plus 2.5) (Labconco)
Incubation chamber (23 ± 1 °C, under fluorescent lamps at 100 μmol/m/s, 16 h light/8 h dark)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lu, Y., Sun, L. and Shi, W. (2015). Collection of Root Exudate from Duckweed. Bio-protocol 5(1): e1367. DOI: 10.21769/BioProtoc.1367.
Download Citation in RIS Format
Category
Plant Science > Plant metabolism > Other compound
Plant Science > Plant physiology > Plant growth
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,368 | https://bio-protocol.org/exchange/protocoldetail?id=1368&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Manganese Cytotoxicity Assay on Hippocampal Neuronal Cell Culture
Alexia Daoust
Yasmina Saoudi
JB Jacques Brocard
NC Nora Collomb
Cécile Batandier
MB Mariano Bisbal
MS Murielle Salomé
AA Annie Andrieux
SB Sylvain Bohic
EB Emmanuel L. Barbier
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1368 Views: 8997
Edited by: Soyun Kim
Reviewed by: Hong-guang XiaKae-Jiun Chang
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Compared to an in vivo experiment, neuronal cell cultures are immediately accessible to observation and manipulation. In this protocol, we describe a technique to evaluate the cytotoxicity of a metal, manganese (Mn2+), on hippocampal neuronal cell cultures. Interestingly, this protocol is easily adaptable to any type of primary culture (e.g., cortical neurons) and any type of toxic compound (e.g., chemical product).
This protocol is similar to "Neuron-enriched Cultures (Method 2)" protocol (Gao, 2011).
Keywords: MRI MEMRI Axonal transport Manganese enhanced MRI
Materials and Reagents
Pregnant mouse (embryonic day: E18.5)
Borax (Sigma-Aldrich, catalog number: 71997 )
Boric acid (Sigma-Aldrich, catalog number: B6768 )
50x B27 supplement (Life Technologies, InvitrogenTM, catalog number: 17504-044 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Dulbeccos modified Eagle medium (DMEM) (Life Technologies, InvitrogenTM, catalog number: 31966-021)
Fetal bovine serum (FBS) (Life Technologies, InvitrogenTM, catalog number: 16000-044 )
100x glutamax (Life Technologies, InvitrogenTM, catalog number: 35050-038)
10x HBSS (Life Technologies, InvitrogenTM, catalog number: 14185-052 )
1 M MnCl2 (Sigma-Aldrich, catalog number: M1787 )
Neurobasal medium (Life Technologies, InvitrogenTM, catalog number: 21103-049 )
Penicillin-streptomycin (PS) (10,000 U/ml) (Life Technologies, InvitrogenTM, catalog number: 15140-122 )
Dulbecco’s phosphate buffer saline (DPBS) with Ca2+ and Mg2+ (Sigma-Aldrich, catalog number: D8662 )
Poly-L-Lysine hydrobromide (Sigma-Aldrich, catalog number: P2636 )
Sterile water
Thiazolyl blue tetrazolium bromide (MTT) (Sigma-Aldrich, catalog number: M2128 )
10x trypsine (Life Technologies, InvitrogenTM, catalog number: 15090-046 )
Borate buffer (see Recipes)
1 mg/ml poly-L-lysine (see Recipes)
First culture medium (see Recipes)
1x HBSS (see Recipes)
Second culture medium (see Recipes)
MnCl2 (0, 20, 50, 100 and 150 µM) (see Recipes)
0.5 mg/ml MTT (see Recipes)
Equipment
One sterile curved plier and one sterile sharp plier (Figure 1)
One bag of sterile plastic Petri dishes (100 mm diameter)
24 wells plate (sterile)
96 wells plate (non sterile)
Syringe filter
Pipette P1000 with a P1000 cone and a P200 cone (sterile)
Neubauer or Malassez cell counting chamber
Eppendorf tubes
Cell scraper
Tissue culture hood
Optic microscope inside the hood
Water bath at 37 °C
Incubator at 37 °C (humidified atmosphere with 5% CO2)
Microplate reader (Pherastar plus) (BMG LABTECH)
Figure 1. Pliers for the hippocampi dissection
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,369 | https://bio-protocol.org/exchange/protocoldetail?id=1369&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Imaging and Quantitative Analysis of Size and Distribution of Spherical Bodies, e.g. Embryonic Oil Bodies
Martine Miquel
GT Ghassen Trigui
AT Alain Trubuil
Bertrand Dubreucq
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1369 Views: 8270
Edited by: Renate Weizbauer
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Oil bodies (OBs) are seed-specific lipid storage organelles that allow the accumulation of neutral lipids that sustain plantlet development after the onset of germination. Using fluorescent dyes and confocal microscopy, we monitored the dynamics of OBs in living Arabidopsis (Arabidopsis thaliana) embryos at different stages of development (Miquel et al., 2014). Image acquisition was followed by a detailed statistical analysis of OB size and distribution during seed development in the four dimensions (x, y, z, and t).
Keywords: Oil body Embryo Size Imaging Statistical analysis
Materials and Reagents
Plant material
Arabidopsis thaliana plants, wild type or mutant or transgenic plants.
Developing siliques between 6 and 11 days after pollination of plants grown in a greenhouse under the following conditions (13 h of light, diurnal temperature of 25 °C, and nocturnal temperature of 17 °C), and irrigated twice per week with mineral nutrient solution.
Nile Red (a neutral lipid stain, at 2 μg/ml final in acetone) (Sigma-Aldrich, catalog number: 72485 )
Equipment
Confocal microscope
Note: In this study an inverted LEICA SP2-AOBS spectral confocal laser microscope (Leica Microsystems) equipped with an HCX PL APO CS 40 x 1.25 objective and a multiline argon laser was used.
Forceps (Dumont No.5) (Sigma-Aldrich)
Scalpel (11 P, blade) (Swann Norton)
Glass slides or glass-bottom dish, cover slips
Binocular (Nikon Corporation, model: SMZ1000 ) (Champigny sur Marne with a led ring - Shott easyledTM for illumination)
Software
ND-SAFIR (http://serpico.rennes.inria.fr/doku.php?id=software:nd-safir:index)
AVIZO® FIRE (http://www.vsg3d.com/avizo/fire)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Cell staining
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,370 | https://bio-protocol.org/exchange/protocoldetail?id=1370&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracellular Cytokine Staining on PBMCs Using CyTOFTM Mass Cytometry
DL Dongxia Lin
SG Sheena Gupta
Holden Maecker
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1370 Views: 22704
Original Research Article:
The authors used this protocol in 2009
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
2009
Abstract
In this protocol, we use a CyTOFTM mass cytometry to collect single-cell data on a large number of cytokines/chemokines as well as cell-surface proteins that characterize T cells and other immune cells. The current selected mass window in AW 103-203 includes the lanthanides used for most antibody labeling, along with iridium and rhodium for DNA intercalators. The output data are in the format as .txt and .fcs files, which is compatible with many analysis programs. This protocol could be adapted to include tetramers into the staining panel, but we have not optimized for that purpose.
The principal steps of intracellular cytokine staining are as follows: First, cells are activated for a few hours using either a specific peptide or a non-specific activation cocktail. An inhibitor of protein transport (e.g. Brefeldin A) is added to retain the cytokines within the cell. Next, EDTA is added to remove adherent cells from the activation vessel. After washing, antibodies to cell surface markers are added to the cells. The cells are then fixed in paraformaldehyde and permeabilized. We use a gentle detergent, saponin, as the permealization buffer because it is less destructive to surface and intracellular epitopes compared to harsh detergents or methanol. After permeabilization, the metal-conjugated anti-cytokine antibodies are added into the cell suspension. The stained cells are then sequentially introduced into the mass cytometry for signal intensity analysis.
Materials and Reagents
PBMC (fresh or thawed frozen)
RPMI-1640 (Hyclone, catalog number: SH30027.01 )
FBS (Atlanta Biologicals, catalog number: S11150 )
Pen-strep-Glutamin 100X (Hyclone, catalog number: SV30082.01 )
Benzonase (2.5 x 105 U/ml) (Pierce, catalog number: 88701 )
Brefeldin A (Sigma-Aldrich, catalog number: B7651 )
Monensin (Sigma-Aldrich, catalog number: M5273 )
0.5 M EDTA (Hoefer, catalog number: GR-123-100 )
Sodium azide (10% w/v solution) (Teknova, catalog number: S0209 )
16% para-formaldehyde (PFA) (Alfa Aesar, catalog number: 43368 ))
10x PBS (ROCKLAND, catalog number: MB-008 )
BSA (Sigma-Aldrich, catalog number: A7284 )
Maleimide-DOTA (Macrocyclics, catalog number: B-272 )
Lanthanum (III) chloride heptahydrate (Sigma-Aldrich, catalog number: 203521 )
Indium (III) chloride (Sigma-Aldrich, catalog number: 203440 )
MilliQ water
Note: Beakers or bottles used here are not washed with soap due to barium content of most commercial soaps.
Phenotyping antibodies (filtered with 0.1 µm spin filters) (Millipore, catalog number: UFC30VV00 )
Ir-intercalator stock solution (Fluidigm, catalog number: 201192 )
Note: Rh103-intercalator can be used.
10x saponin-based permeabilization buffer (eBioscience, catalog number: 00 8333-56 )
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: P8139 )
Ionomycine (Sigma-Aldrich, catalog number: I0634 )
Phytohemagglutinin (PHA) (Sigma-Aldrich, catalog number: 61764 )
SEB (Sigma-Aldrich, catalog number: S0812 )
Anti-CD3/CD28 (various vendors)
Peptide mixes (JPT)
Complete RPMI (see Recipes)
CyPBS (see Recipes)
CyFACS buffer (see Recipes)
Live-dead stain (see Recipes)
Equipment
96- well round-bottom plates
37 °C water bath
Biosafety cabinet
Centrifuge
CO2 incubator at 37 °C
Calibrated pipettes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lin, D., Gupta, S. and Maecker, H. T. (2015). Intracellular Cytokine Staining on PBMCs Using CyTOFTM Mass Cytometry. Bio-protocol 5(1): e1370. DOI: 10.21769/BioProtoc.1370.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Mass cytometry
Immunology > Immune cell function > Cytokine
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,371 | https://bio-protocol.org/exchange/protocoldetail?id=1371&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Migration Assays for Neural Stem Cells, Intermediate Neurogenic Progenitors and Immature Neurons
JL Julia Ladewig
PK Philipp Koch
Oliver Brüstle
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1371 Views: 18049
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
In the vertebrate central nervous system (CNS), different neural precursor populations such as neural stem cells (NSCs), intermediate neurogenic progenitors (INPs) and immature neurons have to migrate from their places of birth to their location of function. Coordinated migration is mediated by direct cell-cell interactions and by extracellular matrix components, chemoattractants as well as repellents. The migration potential of such populations as well as the responsiveness to chemoattractive compounds can be addressed in isolated cells using in vitro migration assays. Here we describe two migration assays, a matrigel migration assay and a Boyden chamber migration assay, which allow the in vitro assessment of neural migration under defined conditions (Ladewig, Koch and Brüstle, 2014). A matrigel matrix is a soluble basement membrane extract. The major components of matrigel matrix are collagens, laminin and proteoglycans, which provide the substrate for migrating cells. In the matrigel assay migration can be analyzed using a phase contrast microscope. The Boyden chamber assay (Richards and McCullough, 1984) is based on microchemotaxis chambers, which consist of two compartments separated by a membrane with a defined pore size. Cells can be plated in the upper compartment and allowed to migrate through the pores towards the lower compartment, in which a potential chemotactic agent is loaded. Cell migration can be analyzed following fixing and immunohistochemical staining. In principle, the described protocols should be applicable to other cell populations such as endothelial cells or cancer cells using conditions adapted to the individual needs of the specific cell type.
Materials and Reagents
Neural cell populations: e.g. pluripotent stem cell (PSC) derived neuroepithelial stem cells (lt-NES) and neurons derived thereof (Ladewig et al., 2008; Koch et al., 2009)
DMEM/F12 (high glucose) (Life Technologies, catalog number: 11320074 )
Neurobasal medium (Life Technologies, catalog number: 21103049 )
B27 supplement (Life Technologies, catalog number: 17504044 )
N2 supplement (GE Healthcare, catalog number: T1129,2205 )
Glucose (Roche Diagnostics, catalog number: HN06.3 )
Trypsin/EDTA (Life Technologies, catalog number: 15400054 )
Trypsin inhibitor (Life Technologies, catalog number: 17075029 )
DNAse (CellSystems Biotechnologie Vertrieb GmbH, catalog number: LS002140 )
Specific for matrigel migration assay
MatrigelTM Basment Membrane Matrix (BD Bioscience, catalog number: 354230 ) or equivalent such as Geltrex® Matrix (Life Technologies, catalog number: A1413202 )
4 well tissue culture dish (VWR International, catalog number: 176740 )
Rock inhibitor (Cell guidance systems, catalog number: SM02-100 )
Specific for Boyden chamber migration assay
Millicell culture plate inserts 8-μm pore size (Millipore, catalog number: PI8P01250 )
Nylon mesh (Pall, http://www.pall.com)
24 well plate (VWR International, catalog number: 734-0056 )
Poly-l-ornithine (Sigma-Aldrich, catalog number: P3655-1G )
Laminin (Life Technologies, catalog number: 23017015 )
PBS (Life Technologies, catalog number: 14190094 )
Chemoattractant such as FGF2 (R&D Systems, catalog number: 233-FB/CF ) or VEGF (R&D Systems, catalog number: 236-EG-01M )
Potential inhibitors for used chem¬oattractant such as VEGF receptor 1 and VEGF receptor 2 blocking antibodies (both R&D Systems, catalog numbers: AF321 and AF357 ) and the FGF2 neutralizing antibody (Millipore, clone bFM-1)
Cotton bud (drug store, e.g. Q-tip®)
Solutions and antibodies for standard immunohistochemical staining
Neural stem cell media (see Recipes)
Neuronal differentiation media (see Recipes)
Equipment
Cell culture centrifuge (e.g., Megafuge 1.0 R, Kendro Laboratory)
37 °C, 5% CO2 cell culture incubator (e.g., Thermo Fisher Scientific, model: Heracell 240 )
Counting chamber (e.g., Fuchs-Rosenthal, Marienfeld)
Glass object slide (e.g., Thermo Fisher Scientific, Superfrost Plus)
Microscope (e.g., ZEISS, model: Axiovert 200M )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ladewig, J., Koch, P. and Brüstle, O. (2015). In vitro Migration Assays for Neural Stem Cells, Intermediate Neurogenic Progenitors and Immature Neurons. Bio-protocol 5(1): e1371. DOI: 10.21769/BioProtoc.1371.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Cell isolation and culture
Developmental Biology > Cell growth and fate > Neuron
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,372 | https://bio-protocol.org/exchange/protocoldetail?id=1372&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Extracellular Ammonium Concentrations and Transporter Activity in Yeast Using AmTrac Fluorescent Sensors
Cindy Ast
WF Wolf B. Frommer
GG Guido Grossmann
Roberto De Michele
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1372 Views: 11085
Reviewed by: Belen Sanz
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
AmTracs are the first example of “activity sensors”, since they report the activity of ammonium transporters by means of fluorescence readout in vivo (De Michele et al., 2013). AmTracs are based on a single fluorescent protein, a circularly permuted GFP (cpGFP), inserted into the cytosolic loop connecting the two pseudosymmetrical halves of the Arabidopsis and yeast plasma membrane ammonium transporters AtAMTs and ScMEP (Figure 1). Recently, FRET-based activity sensors for nitrate and peptide transporters have also been developed (Ho et al., 2014). Since transporter activity directly depends on the availability of substrate, AmTracs measure extracellular ammonium concentrations. Several versions of AmTrac exist, with different fluorescence intensity (FI) responses and affinities for ammonium, and based on different ammonium transporters (AmTrac: AtAMT1;3; AmTrac1;2: At AMT1;2; MepTrac: ScMEP2). Currently, the most useful AmTrac versions are probably AmTrac-GS (bright, with Km of 50 µM) and AmTrac-100 (a high capacity version with Km of 100 µM). The protocol for measuring ammonium concentrations in yeast cells at the fluorimeter is the same for all versions.
Figure 1. Model of AmTrac/MepTrac sensors and AMT transport mechanism. We propose that AMT switches between at least two distinct states during transport of ammonium: An outward, open state A and an inward, open state B. The movement of TMH-V (red) and TMH-VI (blue) is transmitted to the connecting loop, affecting the inserted cpGFP (green) and resulting in a change in fluorescence emission.
Keywords: Sensor Ammonium Transporter Fluorescence Yeast
Materials and Reagents
Yeast strain, with auxotrophic selection marker
Note: We used ura- strains 23344c: MATa ura3; or 31019b: MATa ura3 mep1Δ mep2 Δ::LEU2 mep3 Δ::KanMX2 (Marini et al., 1997). Strain 31019b lacks the endogenous ammonium transporters MEP1-3 and therefore can grow on ammonium as sole nitrogen source only when transformed with vectors harboring functional ammonium transporters. AmTrac should work in any transformable strain.
Vector pDR-F’-GW containing AmTrac under control of strong PMA promoter and ADH terminator, and with the selection marker URA3
Note: Vectors with many different AmTrac- and MepTrac versions are available through Addgene (www.addgene.org). An empty vector can be used as control.
pDR-AmTrac (Plasmid, catalog number: 47770 ) (original sensor, Km 55=µM, ΔF/F~30%)
pDR-AmTrac-IS (Plasmid, catalog number: 47766 ) [variant with enhanced fluorescence and response (500% FI with respect to AmTrac), ΔF/F~40%]
pDR-AmTrac1;2 (Plasmid, catalog number: 47765 ) (AmTrac based on AtAMT1;2)
pDR-AmTrac-LS (Plasmid, catalog number: 47767 ) [variant with enhanced fluorescence and response (400% FI with respect to AmTrac), ΔF/F~50%]
pDR-AmTrac-GS (Plasmid, catalog number: 47769 ) [variant with enhanced fluorescence and response (850% FI with respect to AmTrac), ΔF/F~40%]
pDR-AmTrac-100 (Plasmid, catalog number: 47771 ) (high capacity sensor, Km=100 µM)
pDR-Meptrac (Plasmid, catalog number: 47768 ) (sensor based on ScMEP2)
pDR-Meptrac-H194E (Plasmid, catalog number: 47764 ) [high capacity, pH insensitive and pseudohyphal growth-impaired Meptrac variant (Boeckstaens et al. 2008)]
pDf1-GW (Plasmid, catalog number 36026 ) (empty vector)
Note: It is useful to remove the GW cassette since it contains a ccdB suicidal gene.
Ammonium chloride (EMD Millipore, catalog numer: AX1270-7 )
Yeast nitrogen base w/o amino acids w/o ammonium sulfate (Difco, catalog number: 233520 )
Glucose (Fluka Analytical, catalog number: 49159 )
Proline (L-Proline) (Sigma-Aldrich, catalog number: PO380 )
Agar (Sigma-Aldrich, catalog number: A1296 )
Arginine (L-Arginine monohydrochloride) (Sigma-Aldrich, catalog number: A5131 )
MES (Sigma-Aldrich, catalog number: M2933 )
NaOH (Sigma-Aldrich, catalog number: S5881 )
Glycerol (BDH, catalog number: 1172-1LP )
MilliQ water
100x proline solution (see Recipes)
50x arginine solution (see Recipes)
SD medium (see Recipes)
Washing buffer (see Recipes)
Resuspension buffer (see Recipes)
Equipment
Petri dishes (plastic, any size/brand)
Sterile plastic tips for pipettes (1 ml and 200 µl sizes)
50 ml sterile plastic tubes (like Falcon®, any brand)
Tube rack (any brand)
Surgical tape (3 M Micropore, catalog numer: 1535-5 )
96 well ELISA microplate (flat bottom) (Greiner Bio-One GmbH, catalog numer: 650 101 )
Multichannel (8) pipette (for 50 µl) (Sartorious, catalog numer: 725240 )
Reservoir with 12 compartments (VWR international, catalog numer: 80092-466 )
Autoclave (tuttnauer Brinkmann, model: 3850 E )
Orbital shaker, with temperature and velocity control (New Brunswick Scientific, model: innova 44 )
Incubator for 28-30 °C plate incubation (VWR International)
Sterile hood (Heraeus Holding)
Centrifuge with swinging rotor for 50 ml tubes (Beckman Coulter, model: Allegra 25R )
Fluorimeter for 96 well plates (for example: Tecan Trading AG, Safire or M1000 )
Procedure
Transform yeast with the pDR-F’ vector containing the desired AmTrac. We routinely use the lithium acetate method (Gietz et al., 1992). Briefly, we add about 100 ng plasmid to a PCR tube containing 100 µl of the transformation solution (containing PEG, lithium acetate, salmon sperm DNA and yeast cells) and heat-shock at 42 °C for 13 min. The first time the reader might also transform with an empty vector, to measure background fluorescence.
Plate the transformation on selective synthetic dextrose minimal medium (SD), with 1 mM arginine (from a filter-sterilized 50x stock dissolved in water) as sole nitrogen source. Wrap the plate in plastic cling wrap to prevent dehydration.
Incubate the plate (upside down to prevent condensation) at 28-30 °C for 3 days.
In the sterile hood, pick a colony with a sterile 1 ml pipette and place it in a 50 ml tube containing 5 ml SD medium, supplemented with 0.1% proline (from a filter-sterilized 100x stock dissolved in water).
Tape the opening of the tube with surgical tape to prevent contamination, still allowing gas exchange.
Place the tube in a rack in the orbital shaker.
Grow for 36-48 h at 30 °C, 230 rpm. The culture should at least be turbid (OD600 >0.5). Even at saturation, the sensor still works. Avoid overgrowth though, since cells will start to die and degrade the sensors. In that case, start a new inoculum.
Remove the tip with forceps, and centrifuge at 3,000 rcf at RT for 5 min to pellet the cells.
Discard the supernatant by inversion. The reader should see a whitish pellet.
Resuspend the pellet in 20 ml washing buffer, RT. The reader can ease resuspension by pipetting up and down, or by pouring a few ml first, shaking vigorously, and then bringing to volume.
Centrifuge as above (step 8).
Wash the pellet a second time as in step 10, to remove any trace of growth medium and released ammonium.
Resuspend the pellet in 5 ml resuspension buffer.
Pipette 200 µl of the culture in a well of the microplate and measure OD600 using the spectrofluorometer (mode: absorbance). As blank, use 200 µl of resuspension buffer in another well.
Adjust to OD600 = 0.5 by diluting with resuspension buffer in the 50 ml tube.
Mix well and aliquot in the wells, 200 µl each.
An excitation and emission spectrum should be recorded first to confirm the fluorescence properties of the cpGFP as part of the sensors (parameters: mode: fluorescence; read: bottom reading; excitation: Fix emission to 530 and record spectra from 350 - 510 nm; emission: fix the excitation to 480 nm and record the spectra from 500 - 600 nm; step size 5 nm: bandwidth: 7.5/7.5 nm; gain:100), see Figure 2A. With knowledge of the major excitation maximum the reader can decide on the excitation wavelength for the single point measurements.
Read basal fluorescence. It should be the same for all wells (parameters: mode: fluorescence; read: bottom reading; excitation: 488 nm; emission: 513 nm; bandwidth: 7.5/7.5 nm; gain:100; shake: orbital, medium, 3 sec, initial and between readings).
Since response is saturated above 1 mM for all variants, it can be useful to make a calibration curve with ammonium chloride ranging from 0 to 1 mM final concentration in the wells (0, 1 µM, 10 µM, 100 µM, 1 mM), see Figure 1B. It is useful to include negative controls, e.g. sodium chloride, to exclude artifacts and to include other salts to check for specificity. In that case, use the highest concentration (e.g. 1 or 10 mM), see Figure 2C.
Add the treatment solutions (as 5x concentrated stocks, dissolved in water) to the compartments of the reservoir (Figure 3).
Add 50 µl of each treatment solution or water control to each wells with a multichannel pipette, pipetting up and down for about 5 times for mixing the treatment with the cells. Set up at least three replicates per treatment.
Response is immediate, within the time limits of the microplate reader. With the parameters as above, it takes about 1 min to read a full plate.
Repeat reading as step 18 after 5 min from the treatment. We usually consider these latter responses, as they tend to be a bit stronger.
Figure 2. A. Excitation and emission spectra of AmTrac-GS treated with indicated ammonium chloride concentration. Data are normalized to the initial value. B. Response of AmTrac and AmTrac-100 to increasing concentrations of ammonium chloride. C. Specificity of AmTrac, the concentration of the indicated salts was 1 mM (De Michele et al., 2013).
Figure 3. Schematic representation of the treatment procedure for building a calibration curve. Wells in a microplate are filled with 200 µl of yeast culture, resuspended in 50 mM MES buffer with 5% glycerol. Samples can be arranged in columns, with triplicates for each construct. Fluorescence from yeast transformed with the empty vector will be used as background value. After reading basal fluorescence, 50 µl of 5x stock treatment will be added to the wells, by using a multichannel pipette. In this example, we use a solvent control (water), four concentrations of increasing magnitude of NH4Cl, and a chloride control at the highest concentration.
Data analysis
Subtract background fluorescence (from a yeast transformed with an empty vector) to all fluorescence values (spectra as well as single point measurements).
AmTracs respond to ammonium by decreasing cpGFP fluorescence emission. For this reason, fluorescence of the water control shows always the highest value. Calculate ΔF, by subtracting the response to treatment to that of the water control (0 ammonium). Divide ΔF to the response to treatment (ΔF/F). By using ratios instead of absolute values, it is possible to compare different experiments, and in theory even using different dilutions (not just to OD600 = 0.5). However, it is good practice to maintain conditions as similar as possible.
Calculate averages and errors from all replicates, for each treatment.
Plot as histogram or line. Figure 2B shows the response of AmTrac and AmTrac-100 to increasing concentrations of ammonium chloride.
The reader can then use the calibration curve to quantify unknown ammonium concentration in a solution.
Recipes
100x proline solution
10 g L-Proline dissolved in 100 ml MilliQ water
pH ~ 5.5
50x arginine solution
50 mM L-Arginine monohydrochloride dissolved in MilliQ water
pH ~ 5.5
SD medium
1.7 g/L yeast nitrogen base w/o amino acids w/o ammonium sulfate
30 g/L glucose
Autoclave, 120 °C, 30 min
When hand-warm, in a sterile hood, add proline from a 100x stock to a final concentration of 0.1%
The pH of the SD medium is ~ 4.2 and changes minimally upon the addition of proline to pH ~ 4.3
For solid medium, add 15 g/L agar before autoclaving
Add 1 mM arginine (final concentration) when medium is hand-warm before pouring plates. In case the SD medium does not solidify well, which may depend on the autoclave used, it is recommended to adjust the pH of the SD medium to pH 5.8 with NaOH before addition of agar and autoclaving.
Washing buffer
50 mM MES, bring to pH 6.0 with NaOH pellets
Resuspension buffer
50 mM MES, bring to pH 6.0 with NaOH pellets
Add 5% glycerol, to delay sedimentation of the cells
Acknowledgments
This work has been supported by grant MCB-1021677 by the National Science Foundation (Wolf B Frommer). The protocol has been adapted from De Michele et al. (2013).
References
Boeckstaens, M., Andre, B. and Marini, A. M. (2008). Distinct transport mechanisms in yeast ammonium transport/sensor proteins of the Mep/Amt/Rh family and impact on filamentation. J Biol Chem 283(31): 21362-21370.
De Michele, R., Ast, C., Loque, D., Ho, C. H., Andrade, S. L., Lanquar, V., Grossmann, G., Gehne, S., Kumke, M. U. and Frommer, W. B. (2013). Fluorescent sensors reporting the activity of ammonium transceptors in live cells. Elife 2: e00800.
Gietz, D., St Jean, A., Woods, R. A. and Schiestl, R. H. (1992). Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20(6): 1425.
Ho, C. H. and Frommer, W. B. (2014). Fluorescent sensors for activity and regulation of the nitrate transceptor CHL1/NRT1.1 and oligopeptide transporters. Elife 3: e01917.
Marini, A. M., Soussi-Boudekou, S., Vissers, S. and Andre, B. (1997). A family of ammonium transporters in Saccharomyces cerevisiae. Mol Cell Biol 17(8): 4282-4293.
Copyright: Ast et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ast, C., Frommer, W. B., Grossmann, G. and De Michele, R. (2015). Quantification of Extracellular Ammonium Concentrations and Transporter Activity in Yeast Using AmTrac Fluorescent Sensors. Bio-protocol 5(1): e1372. DOI: 10.21769/BioProtoc.1372.
De Michele, R., Ast, C., Loque, D., Ho, C. H., Andrade, S. L., Lanquar, V., Grossmann, G., Gehne, S., Kumke, M. U. and Frommer, W. B. (2013). Fluorescent sensors reporting the activity of ammonium transceptors in live cells. Elife 2: e00800.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Nutrient transport
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,373 | https://bio-protocol.org/exchange/protocoldetail?id=1373&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Three Dimensional Spheroid Co-culture Invasion Assay
EV Eldo T Verghese
TH Thomas A Hughes
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1373 Views: 12625
Reviewed by: Lin Fang
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
The assay was developed to investigate the impact of stromal cells of different types (in our case breast cancer associated fibroblasts stably manipulated to modify expression of genes of interest) on the invasive capacity of epithelial cancer cells (in our case breast cancer cell lines) (Verghese et al., 2013). Typical two dimensional invasion assays do necessarily account for the presence of extracellular matrix that is present around the stromal and tumour cells in vivo and therefore cellular behaviour within these cultures may be non-physiological. This spheroid assay was developed to attempt to replicate more closely the environment that is present around breast cancer stromal and tumour cells in actual tumours (Verghese et al., 2013). Extra cellular matrix composed of both collagen IV and collagen I is included and fibroblasts and epithelial cells are given the opportunity to develop “physiological” interactions (Verghese et al., 2013; Hooper et al., 2006). The method was developed from Nowicki et al. (2008), and we have published data using it in Verghese et al. (2013).
Materials and Reagents
Epithelial cells and fibroblasts [see Verghese et al. (2013) for the type we have used, although many others may be applicable]
Growth factor reduced matrigel (BD, catalogue number: 356231 )
Collagen-1 (BD, catalog number: 354236 )
Fetal calf serum (FCS) (Sigma-Aldrich, catalog number: F7524 )
DMEM (Life Technologies, InvitrogenTM, catalog number: 31966 )
MEM powder (Sigma-Aldrich, catalog number: M0268 )
1 M N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES) (pH 7.5)
NaHCO3
Rabbit anti-cytokeratin (Abcam, catalog number: Ab9377 )
Zymed antibody diluent (Life Technologies, catalog number: 003218 )
DPX (Sigma-Aldrich, catalog number: 317616 ) (a mounting agent)
Mayer’s haematoxylin (any supplier)
Scott’s tap water substitute (any supplier)
Eosin (any supplier)
Formalin (any supplier)
Ethanol (any supplier)
Xylene (any supplier)
Collagen-1/Matrigel mix (see Recipes)
Collagen medium (see Recipes)
Equipment
Tissue culture incubator (37 °C, humidified air/5% CO2) (Panasonic Corporation, Sanyo)
35 mm petri dish (ibidi GmbH, catalog number: 81158 )
E1000 Eclipse microscope (Nikon Corporation)
Superfrost Plus slides and cover slips (Menzel Glaser)
Access retrieval unit (The Menarini Group) (a machine performing automated antigen retrieval giving enhanced reproducibility)
Automated stainer (IntelliPATH) (a machine performing automated immunohistochemistry protocols giving enhanced reproducibility)
Software
Photoshop (ADOBE)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Cancer Biology > General technique > Tumor microenvironment
Cell Biology > Cell movement > Cell motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,374 | https://bio-protocol.org/exchange/protocoldetail?id=1374&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Protein Stability by the Cycloheximide Chase Assay
SK Shih-Han Kao
WW Wen-Lung Wang
CC Chi-Yuan Chen
YC Yih-Leong Chang
YW Yi-Ying Wu
YW Yi-Ting Wang
SW Shu-Ping Wang
AN Alexey I Nesvizhskii
YC Yu-Ju Chen
TH Tse-Ming Hong
Pan-Chyr Yang
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1374 Views: 61489
Reviewed by: Hsin-Yi ChangGuillermo Gomez
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Comparison of protein stability in eukaryotic cells has been achieved by cycloheximide, which is an inhibitor of protein biosynthesis due to its prevention in translational elongation. It is broadly used in cell biology in terms of determining the half-life of a given protein and has gained much popularity in cancer research. Here we present a full cycloheximide chase assay in our laboratory using a lung adenocarcinoma cell line, CL1-5, as a model.
Materials and Reagents
Cell lines
CL1-5/Flag-wtSlug stable cells
CL1-5/Flag-4SA stable cells
Antibodies
Flag M2 antibodies (Sigma-Aldrich, catalog number: F3165 )
β–actin antibodies (Sigma-Aldrich, catalog number: A5441 )
Buffer and media
100 mg/ml cycloheximide (CHX) stock solution (Sigma-Aldrich, catalog number: C7698 )
RPMI-1640 medium (Life Technologies, Gibco®, catalog number: 11875-176 )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10082147 )
HEPES (Sigma-Aldrich, catalog number: H3784 )
Streptomycin/Penicillin (5,000 U/ml) (Life Technologies, Gibco®, catalog number: 15070063 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P5280 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S5761 )
G418 (Sigma-Aldrich, catalog number: A1720 )
Sodium chloride (Sigma-Aldrich, catalog number: S7653 )
IGEPAL CA-630 (Sigma-Aldrich, catalog number: I8896 )
Sodium orthovanadate (Sigma-Aldrich, catalog number: S6508 )
Sodium fluoride (Sigma-Aldrich, catalog number: S7920 )
Sodium pyrophosphate (Sigma-Aldrich, catalog number: 221368 )
Protease inhibitor cocktail with EDTA (Roche, Catalog number: 04693116001 )
BCA protein assay kit (Pierce, catalog number: 23225 )
DTT (Sigma-Aldrich, catalog number: 43815 )
SDS (Sigma-Aldrich, catalog number: L3771 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Bromophenoblue (Sigma-Aldrich, catalog number: B5525 )
Complete medium (see Recipes)
Protein lysis buffer (see Recipes)
5x sample buffer (see Recipes)
Equipment
CO2 incubator (Thermo Fisher Scientific, Forma series II)
35-mm culture dishes (Corning, catalog number: 430165 )
1.5 ml tubes
Standard sonicator
Software
MetaMorph software (Molecular Devices)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kao, S., Wang, W., Chen, C., Chang, Y., Wu, Y., Wang, Y., Wang, S., Nesvizhskii, A. I., Chen, Y., Hong, T. and Yang, P. (2015). Analysis of Protein Stability by the Cycloheximide Chase Assay. Bio-protocol 5(1): e1374. DOI: 10.21769/BioProtoc.1374.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Biochemical assays
Biochemistry > Protein > Synthesis
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,375 | https://bio-protocol.org/exchange/protocoldetail?id=1375&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lipid Extraction from Mouse Feces
Daniel Kraus
QY Qin Yang
BK Barbara B. Kahn
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1375 Views: 17328
Reviewed by: Peichuan Zhang
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
The analysis of feces composition is important for the study of energy metabolism, which comprises various measurements of energy intake, energy expenditure, and energy wasting. The current protocol describes how to measure energy-dense lipids in mouse feces using a modification of the method proposed by Folch et al. (1957).
Keywords: Energy metabolism Lipid excretion Feces
Materials and Reagents
Mouse feces
Normal saline (about 5-10 ml per mouse, depending on the amount of feces) (e.g., Sigma-Aldrich)
Chloroform in methanol (2:1 by volume) (about 5-10 ml per mouse)
Equipment
Forceps suitable for picking up mouse feces
Sieve, coarse enough to hold back mouse feces
Optional: Flour sifter
50-ml and 15-ml conical polypropylene tubes (one of each per mouse)
15-ml glass tubes (one per mouse)
Tube stands
Analytical balance
Chemical fume hood
Potter-Elvehjem tissue grinder and drill
Centrifuge with rotor to hold 15-ml tubes (e.g., Beckman Coulter GS-6 with GH-3.8 swing bucket rotor or similar)
22G 1½ hypodermic needles (two per mouse)
5-ml syringes (one per mouse)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,376 | https://bio-protocol.org/exchange/protocoldetail?id=1376&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Construction of FWPV Chimaeric MVA
KB Karen R. Buttigieg
Michael A. Skinner
Published: Vol 5, Iss 1, Jan 5, 2015
DOI: 10.21769/BioProtoc.1376 Views: 8660
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Construction of chimaeric MVA is a useful tool with which to study gene function of related viruses. The protocol given here describes MVA chimaeras containing genes from Fowlpox virus (FWPV), although this can be applied to DNA derived from other organisms. There are a number of steps required to make the chimaeric MVA: 1) Purification of viral particles; 2) Extraction of DNA from purified viral particles; 3) Assembly of linear recombination templates; 4) Transfection of linear recombination templates; 5) Selection of chimaeric MVA.
Note: This procedure uses live virus, and should be conducted using Good Microbiological Practice, in accordance with international and national biocontainment requirements. This procedure also involves Genetic Modification of microorganisms, and appropriate safety approval should be obtained before commencing.
Materials and Reagents
Purification of viral particles
Fowlpox virus (FWPV) (e.g. ATCC, catalog number: VR-251 )
Modified Vaccinia virus Ankara (MVA) (ATCC, catalog number: VR-1508 )
CEF cells (Institute for Animal Health)
Tris-EDTA buffer (Sigma-Aldrich, catalog number: 93283 )
DMEM (e.g. Sigma-Aldrich, catalog number: D6429 )
Foetal bovine serum (FBS) (e.g. Sigma-Aldrich, catalog number: F9665 )
10x medium 199 with Earle’s salts (Sigma-Aldrich, catalog number: M0650 )
Heat Inactivated newborn bovine serum (Life Technologies, catalog number: 26010074 )
Tryptose phosphate broth (Sigma-Aldrich, catalog number: T8159 )
Nystatin (Sigma-Aldrich, catalog number: N1638 )
Penicillin-streptomycin solution (Sigma-Aldrich, catalog number: P4333 )
L-glutamine solution (Sigma-Aldrich, catalog number: G7513 )
Sodium bicarbonate (Sigma-Aldrich, catalog number: S8761 )
Amicon Ultra-15 Centrifugal filter unit (100 kDa membrane NMWL) (Merck Millipore, catalog number: UFC910024 )
FWPV virus growth medium (see Recipes)
MVA virus growth medium (see Recipes)
TE (see Recipes)
Extraction of DNA from purified viral particles
Phenol saturated with 10 mM Tris-HCl (Sigma-Aldrich, catalog number: P4557 )
Phenol-chloroform-isoamyl alcohol (25:24:1, saturated with 10 mM Tris, pH 8.0) (Sigma-Aldrich, catalog number: P2069 )
Chloroform-isoamyl alcohol (24:1) (Sigma-Aldrich, catalog number: 25666 )
3 M Sodium acetate (Sigma-Aldrich, catalog number: 71196 )
Ethanol (Sigma-Aldrich, catalog number: E7023 )
10 mM Tris-Cl (pH 8.5) (QIAGEN, catalog number: 19086 )
Tris-HCl (Sigma-Aldrich, catalog number: T5941 )
EDTA (Sigma-Aldrich, catalog number: EDS )
NaCl (Sigma-Aldrich, catalog number: S3014 )
SDS solution (Sigma-Aldrich, catalog number: 71736 )
β-mercaptoethanol (Sigma-Aldrich, catalog number: M3148 )
Proteinase K (Sigma-Aldrich, catalog number: P2308 )
2x extraction buffer (see Recipes)
Assembly of linear recombination templates
PCR oligonucleotides (Sigma-Aldrich)
Accuprime Taq high fidelity polymerase (Life Technologies, catalog number: 12346086 )
pNEB193 (New England Biolabs)
Plasmid encoding Escherichia coli (E.coli) gpt under p7.5 promoter (e.g. pGNR, available on request)
QIAquick PCR purification kit (QIAGEN, catalog number: 28104 )
QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
Transfection of linear recombination templates
DF-1 cells (ATCC, catalog number: CRL-12203 )
DMEM (e.g. Sigma-Aldrich, catalog number: D6429)
Foetal bovine serum (FBS) (e.g. Sigma-Aldrich, catalog number: F9665)
Penicillin-streptomycin solution (Sigma-Aldrich, catalog number: P4333)
Salmon sperm DNA solution (Life Technologies, catalog number: 15632011 )
Opti-MEM (Life Technologies, catalog number: 31985062 )
Polyfect (QIAGEN, catalog number: 301105 )
DF-1 culture medium (see Recipes)
Selection of chimaeric MVA
DMEM (e.g. Sigma-Aldrich, catalog number: D6429)
Foetal bovine serum (FBS) (e.g. Sigma-Aldrich, catalog number: F9665)
Penicillin-streptomycin solution (Sigma-Aldrich, catalog number: P4333)
Mycophenolic acid (Sigma-Aldrich, catalog number: M5255 )
Xanthine (Sigma-Aldrich, catalog number: X3627 )
Hypoxanthine (Sigma-Aldrich, catalog number: H9636 )
Hydrochloric acid (Sigma-Aldrich, catalog number: H9892 )
Sodium hydroxide (Sigma-Aldrich, catalog number: S2770 )
2% DMEM + MXH (see Recipes)
Equipment
Benchtop centrifuge (e.g. Hettich®, model: Rotanta 460 )
Thermal cycler (Techne Progene®)
Laminar flow microbiological safety cabinet (e.g. HeraSafe®, model: 51022738 )
Humidified CO2 incubator (e.g. Thermo Fisher Scientific, model: BB15 )
Cuphorn sonicator (e.g. UltrasonicsTM, model: W-375 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Buttigieg, K. R. and Skinner, M. A. (2015). Construction of FWPV Chimaeric MVA. Bio-protocol 5(1): e1376. DOI: 10.21769/BioProtoc.1376.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA cloning
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,377 | https://bio-protocol.org/exchange/protocoldetail?id=1377&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Mitochondrial DNA Upon Drug Treatment
MP Michel Perron
Joy Y. Feng
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1377 Views: 8213
Reviewed by: Vanesa Olivares-IllanaPia Giovannelli
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Drug-induced mitochondrial injury can be caused by many different mechanisms including inhibition of mitochondrial DNA replication, transcription, translation, and altered protein function. Determination of the level of mitochondrial DNA relative to the nuclear DNA levels provides important information on potential mitochondrial toxicity.
Keywords: Mitochondrial toxicity Nucleoside analogs Inhibitor of DNA synthesis
Materials and Reagents
HepG2 cells (ATCC, catalog number: HB 8065 )
DMSO (cell culture grade) (Sigma-Aldrich, catalog number: D2650 )
Phosphor-buffered saline (PBS) (Life Sciences, catalog number: 10010049 )
QIAamp DNA mini kit (QIAGEN, catalog number: 51304 )
TaqMan universal mastermix (Life Technologies, Applied Biosystems®, catalog number: 4352042 )
β-actin Assay-on-Demand kit (Life Technologies, Applied Biosystems®, catalog number: 4331182 )
Eagle’s minimum essential medium (Life Technologies, Gibco®, catalog number: 41090 )
GlutaMAXTM
Fetal bovine serum (FBS) (HyClone, catalog number: SH30071.03 )
100 units/ml penicillin, 100 units/ml streptomycin (Life Technologies, Gibco®, catalog number: 15140 )
Sodium pyruvate (Life Technologies, Gibco®, catalog number: 11360 )
Cells were cultured in Eagle’s minimum essential medium (see Recipes)
Note: Cells were cultured in Eagle’s minimum essential medium.
Equipment
12-well plates (Corning, catalog number: 3513 )
ABI Prism 7900HT Fast Real-Time PCR system (Life Technologies, Applied Biosystems®)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Perron, M. and Feng, J. Y. (2015). Determination of Mitochondrial DNA Upon Drug Treatment. Bio-protocol 5(2): e1377. DOI: 10.21769/BioProtoc.1377.
Download Citation in RIS Format
Category
Molecular Biology > DNA > DNA damage and repair
Molecular Biology > DNA > DNA quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,378 | https://bio-protocol.org/exchange/protocoldetail?id=1378&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Mitochondrial Biogenesis Assay after 5-day Treatment in PC-3 Cells
Yili Xu
Joy Y. Feng
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1378 Views: 11285
Reviewed by: Vanesa Olivares-IllanaPia Giovannelli
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Drug-induced mitochondrial injury can be caused by many different mechanisms including inhibition of mitochondrial DNA replication, transcription, translation, and altered protein function. Determination of the level of mitochondrial protein synthesis, or mitochondrial biogenesis, relative to the cellular protein synthesis, provides important information on potential mitochondrial toxicity.
Keywords: Mitochondrial toxicity Mitochondrial protein synthesis Nucleoside-related toxicity Chloramphenicol MitoBiogenesis™ In-Cell ELISA Kit
Materials and Reagents
PC-3 cells (ATCC, CRL-1435, catalog number: 7348669 )
Three-fold serial dilutions of compounds
MitoToxTM MitoBiogenesisTM In-Cell ELISA Kit (Abcam, catalog number: ab110216 ) including
1,000x IRDye®-labeled secondary antibodies (species were not disclosed by vendor)
200x primary antibodies (species were not disclosed by vendor)
100x Triton X-100
10x blocking buffer
10x phosphate buffered saline (PBS)
400x Tween-20
1x Janus Green stain (optional)
DMSO (cell culture grade) (Sigma-Aldrich, catalog number: D2650 )
CellTiter Glo (Promega Corporation, catalog number: G7571 )
Kaighn’s F12 (Life Technologies, Gibco®, catalog number: 21127 )
FBS (HyClone, catalog number: SH30071.03 )
100 units/ml penicillin and 100 µg/ml streptomycin (P/S) (Life Technologies, Gibco®, catalog number: 15140-122 )
Cell fixing reagent: 4% paraformaldehyde (20% paraformaldehyde, VWR International, catalog number: 15713-S )
Chloramphenicol (10 mM solution in DMSO) (Sigma-Aldrich, catalog number: C1919-5G )
Kaighn’s F12 medium (see Recipes)
Note: The cells were maintained in Kaighn’s F12 medium. The cells were passaged twice weekly and maintained at 90% confluence. Cells between passages 4 and 15 were used in the assays.
Equipment
96-well plates (collagen I coated 96-well plate) (VWR International, catalog number: 73521-028 )
Titer plate shaker (Lab-line Instrument, model: 4626 )
LI-COR® Odyssey instrument (LI-COR)
Software
GraphPad Prism 5.0 (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xu, Y. and Feng, J. Y. (2015). Mitochondrial Biogenesis Assay after 5-day Treatment in PC-3 Cells. Bio-protocol 5(2): e1378. DOI: 10.21769/BioProtoc.1378.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antiviral assay
Biochemistry > Protein > Immunodetection
Molecular Biology > Protein > Detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,379 | https://bio-protocol.org/exchange/protocoldetail?id=1379&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Camalexin Quantification in Arabidopsis thaliana Leaves Infected with Botrytis cinerea
Daniel V. Savatin
NB Nora Gigli Bisceglia
MG Matteo Gravino
CF Claudia Fabbri
DP Daniela Pontiggia
Benedetta Mattei
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1379 Views: 10958
Edited by: Tie Liu
Reviewed by: Sollapura J. Vishwanath
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Phytoalexins are heterogeneous low molecular mass secondary metabolites with antimicrobial activity produced at the infection site in response to pathogen invasion and represent an important part of the plant defense repertoire. Camalexin (3-Thiazol-2′-yl-indole) is a known phytoalexin first detected and isolated in Camelina sativa, from which it takes its name, infected with Alternaria brassicae (Browne et al., 1991). Production of camalexin is also induced in Arabidopsis thaliana leaves by a range of biotrophic and necrotrophic plant pathogens (bacteria, oomycetes, fungi and viruses) (Ahuja et al., 2012) as well as by abiotic stresses, such as UV and chemicals (e.g. acifluorfen, paraquat, chlorsulfuron and α-amino butyric acid) (Zhao et al., 1998; Tierens et al., 2002). Camalexin originates from tryptophan and CYP79B2 and CYP71B15 (PAD3) are P450 enzymes that catalyze important steps in its biosynthetic pathway (Glawischnig, 2007).
The detection and quantification of camalexin content is required to understand how it is produced upon various stress conditions. Here we describe an easy method for camalexin extraction from Arabidopsis leaves infected with the necrotrophic fungus Botrytis cinerea, and further determination of camalexin levels by liquid chromatography–mass spectrometry (LC-MS). The method is sensitive enough to trace amount of camalexin down to the low pico-gram (10 pg/mg FW) range.
Figure 1. The structural formula of camalexin
Materials and Reagents
Arabidopsis leaves
Liquid nitrogen
Dichloromethane (DCM) (Sigma-Aldrich, catalog number: 270997 )
Methanol (LC/MS grade) (Carlo Erba Reagents, catalog number: 414831 )
Formic acid (gradient grade) (Sigma-Aldrich, catalog number: F0507 )
Water with 0.1% formic acid (LC/MS grade) (Sigma-Aldrich, catalog number: 34673 )
Camalexin standard (Sigma-Aldrich, catalog number: SML1016 )
Extraction buffer (see Recipes)
Equipment
Mortar and pestle
Spatula
Glass Pasteur pipettes
Tube adapters
Screw cap round bottom borosilicate glass culture tubes (16 x 125 mm) (Pyrex) (Sigma-Aldrich, catalog number: Z653594-40EA )
Disposable borosilicate glass culture tubes (Pyrex)
Spin-X centrifuge tube filters with nylon membranes (Sigma-Aldrich, catalog number: CLS8170-200EA )
Glass vials with cap (capacity: 100 µl)
Vortex mixer
Rocking shaker
Nitrogen evaporator (e.g. sample concentrator with dry block DB-3D) (Techne) (Figure 1)
Balance
Variable speed refrigerated centrifuge with rotor having number of rotor cavities x nominal largest load (capacity: 8 x 50 ml) (e.g. Beckman Coulter)
HPLC (e.g. Thermo Fisher Scientific, model: UltiMate 3000 HPLC )
High performance reversed-phase columns C18 for the separation of small molecules (e.g. Acclaim120 C18 Reverse-phase column-3 μm, 200 Å, 2.1 x 150 mm) (Thermo Fisher Scientific, catalog number: 059130 )
ESI-Mass Spectrometer (e.g. Orbitrap XL Discovery, Thermo Fisher Scientific)
Software
Analysis software (e.g. Thermo Xcalibur software 2.10, Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Perception and signaling
Plant Science > Plant biochemistry > Other compound
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
138 | https://bio-protocol.org/exchange/protocoldetail?id=138&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phenol-chloroform Based RNA Extraction from Yeast
Wei Zheng
Published: Oct 5, 2011
DOI: 10.21769/BioProtoc.138 Views: 14237
Download PDF
Ask a question
Favorite
Cited by
Materials and Reagents
DEPC treated water
Phenol (TE)/Chloroform (1:1)
3 M NaAc (pH 5.2)
NaOAc
10 mM EDTA
10% SDS
EtOH
Hydroxyquinoline
Complete buffer A (see Recipes)
Buffer A phenol or RNA phenol (see Recipes)
TE phenol (see Recipes)
Equipment
RNase free tube
RNase-free plastic ware
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,380 | https://bio-protocol.org/exchange/protocoldetail?id=1380&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Loading of Cells with Fluorescent Probe to Study Intracellular Acid-base Homeostasis in Lactic Acid Bacteria
PM Pablo Mortera
FZ Federico Zuljan
CM Christian Magni
SA Sergio H. Alarcón
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1380 Views: 12117
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Here we describe a protocol which we have used to study the homeostasis intracellular in vivo in lactic acid bacteria (LAB) using a fluorescent probe. This type of probes can be used for determining changes in the pH of cytoplasm with high sensitivity, temporal resolution and technical simplicity as well as accessing the rate of change of intracellular pH in response to a stimulus from kinetic measurements on short time scales (Breeuwer et al., 1996; Molenaar et al., 1991). This protocol has been designed to measure the intracellular pH using the pH-sensitive fluorescent probe 2´,7´-bis-(2-carboxyethyl)-5(and-6)-carboxyfluorescein (BCECF) in LAB, Enterococcus faecalis (E. faecalis), Lactococcus lactis (L. lactis) and Lactobacillus casei (L. casei).
Keywords: Fluorescent probe Loading cell Ph measurement Lactic acid bacteria Intracellular acid-base homeostasis
Materials and Reagents
Lactococcus lactis IL1403
Enterococcus faecalis JH2-2
Lactobacillus casei (ATCC, catalog number: 334 )
2´,7´-bis-(2-carboxyethyl)-5(and-6)-carboxyfluorescein (BCECF) (acid form) (Life Technologies, Molecular Probes®)
Luria-Bertani broth (Sigma-Aldrich, catalog number: L3147 )
MRS broth (Sigma-Aldrich, catalog number: 69966 )
Citrate (Sigma-Aldrich, catalog number: C7254 )
Malic acid (Supelco, catalog number: 46940U )
Pyruvate (Sigma-Aldrich, catalog number: P2256 )
D-(+)-glucose (Sigma-Aldrich, catalog number: G8270 )
D-(+)-galactose (Sigma-Aldrich, catalog number: G0750 )
Electrode filling solution (Orion, catalog number: 900011 )
Na2HPO4 (Merck KGaA, catalog number: 1006559 )
NaH2PO4 (Merck KGaA, catalog number: 106349 )
HCl (Merck KGaA, catalog number: 100317 )
NaOH (Merck KGaA, catalog number: 106462 )
Triton X100 detergent (Merck KGaA, catalog number: 648466 )
Valinomycin (Sigma-Aldrich, catalog number: V0627 )
Nigericin (Sigma-Aldrich, catalog number: N7143 )
BCECF stock solution (see Recipes)
50 mM potassium phosphate (KPi) buffer (see Recipes)
Equipment
Stove Lab Tech (LIB-080M)
Centrifuge for Eppendorf tubes (Eppendorf, model: 5418 )
Centrifuge Sorvall ST 16R for centrifugation of Falcon tube under refrigerated conditions (Thermo Fisher Scientific)
Fluorescence spectrophotometer (PerkinElmer, model: LS55 )
Thermostatic bath (Lauda Alpha, model: RA8 )
pH/MV meters (Orion, model: 420A )
4 M KCl saturated with AgCl for combination Ag/AgCl pH electrode (Orion, catalog number: 900011)
5 ml Quartz cuvette (optical path 1 cm)
pH microelectrode (Horiba, model: 9669-10D )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial metabolism > Other compound
Cell Biology > Cell-based analysis > Ion analysis
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,381 | https://bio-protocol.org/exchange/protocoldetail?id=1381&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Dynamic Model of a Catheterized Bladder and Biofilm Assay
MM Mario Maierl
MJ Michael Jörger
PR Patrik Rosker
Andreas Reisner
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1381 Views: 12508
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Biofilm formation on catheters is thought to contribute to persistence of catheter-associated urinary tract infections (CAUTI) which represent the most frequent nosocomial infections. Understanding of factors relevant for CAUTI pathogenesis and evaluation of new therapeutics or interference strategies requires a model system that mirrors the physico-chemical conditions prevailing in a catheterized human bladder. The described in vitro dynamic model of a catheterized bladder enables to emulate many of the characteristics of a catheterized human bladder albeit in the absence of a bladder epithelium. A minor modification compared to the original model system (Stickler, et al., 1999) allows temperature maintenance of the top 10 cm of the catheter, thereby enabling reproducible monitoring of biofilm formation on the internal catheter surface.
Materials and Reagents
NaCl (Carl Roth, catalog number: 9265.1 )
70% ethanol
dH2O
NaCl (Carl Roth, catalog number: 9265.1)
Tryptone (Carl Roth, catalog number: 8952.3 )
Yeast extract (Carl Roth, catalog number: 2362.2 )
Agar-agar (Carl Roth, catalog number: 5210.2 )
Na2SO4 (Carl Roth, catalog number: 8560.1 )
CaCl2.2H2O (Carl Roth, catalog number: CN93.1 )
MgCl2.6H2O (Carl Roth, catalog number: 2189.1 )
NaCl (Carl Roth, catalog number: 9265.1)
Na3C6H5O7.2H2O (Carl Roth, catalog number: 3580.1 )
(COONa)2 (Carl Roth, catalog number: 4267.1 )
KH2PO4 (Carl Roth, catalog number: 3904.1 )
KCl (Carl Roth, catalog number: 6781.1 )
NH4Cl (Carl Roth, catalog number: K298.2 )
Urea (Carl Roth, catalog number: X999.3 )
Tryptic soya broth/CASO medium (Carl Roth, catalog number: X938.1 )
Gelatine (Carl Roth, catalog number: 4582.2 )
NaOH (Carl Roth, catalog number: 6771.1 )
LB medium (see Recipes)
LB agar (see Recipes)
Artificial or human urine (see Recipes)
Equipment
Peristaltic pump for urine filtration (e.g. Heidolph Instruments GmbH, model: Pump drive 5006 )
10 L polycarbonate carboy for urine reservoir (e.g. Thermo Fisher Scientific, Nalgene®, 10 L PC with polypropylene cap with three inlets)
SARTORIUS P Midi Cap filter cartridge (SARTORIUS, catalog number: 5235307H9 )
Peristaltic multi-channel pump for urine feed (Watson-Marlow Pumps Group, model: 205U )
Borosilicate Glass bladder models (Figure 1) (Georg Becker Laboreinrichtungen GmbH & Co KG, www.laborbecker.at)
Figure 1. Glass bladder model scheme and dimensions. Schematic representation including length and inner diameter (ID) indications A and custom-made model B. Relevant parts are indicated: Artificial bladder compartment (1), temperature control compartment (2), connection for incoming (3) and outgoing (4) temperature control water circuit, artificial urethra for catheter insertion (5).
Water bath with connections for external water circle (e.g. LAUDA, model: E10 )
Tripod or other holders for mounting of glass bladder models (e.g. Bochem Instrumente GmbH, Portable table frame TG, catalog number: TG500 )
Silicone stopper (35 mm) with 6 mm decentralized hole
Glass tube (15 cm, 6 mm outer diameter = OD)
Note: We use cut 1 ml glass pipettes (BRAND).
Silicone tubings: 2 m (ID 3 mm, OD 5 mm)
Silicone tubings: 1 m (ID 9 mm)
Silicone tubings: 1 m (ID 5-6 mm)
Tygon tubings (ID 8 mm) (VWR International, catalog number: 228-1294 )
Tube Connectors (PP, 3-5mm - 6-10 mm) (Bartelt, catalog number: 37.559 )
T-connectors (PP) for tubings (ID 3 mm) (Carl Roth, catalog number: E763.1 )
Urinary Catheter (all silicone Ch14) (BARD, catalog number: 153509 )
10 ml syringe
Drainage bags (e.g. SARSTEDT AG, catalog number: 74.5220.005 )
Clamps (e.g. VWR International, catalog number: 229-0072 )
Ultrasonic cleaner (BANDELIN electronic, model: Sonorex RK100H )
Vortex (e.g. VWR International, catalog number: 444-0206 )
Recommended (air vents as breathing barrier for urine reservoir flask) (e.g. VWR International, catalog number: 28144-160 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Maierl, M., Jörger, M., Rosker, P. and Reisner, A. (2015). In vitro Dynamic Model of a Catheterized Bladder and Biofilm Assay. Bio-protocol 5(2): e1381. DOI: 10.21769/BioProtoc.1381.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antibacterial assay
Microbiology > Microbial biofilm > Biofilm culture
Microbiology > Microbe-host interactions > In vitro model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,382 | https://bio-protocol.org/exchange/protocoldetail?id=1382&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phenotyping of Live Human PBMC using CyTOFTM Mass Cytometry
ML Michael D. Leipold
Holden Maecker
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1382 Views: 19134
Original Research Article:
The authors used this protocol in Jan 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2012
Abstract
Single-cell analysis has become an method of importance in immunology. Fluorescence flow cytometry has been a major player. However, due to issues such as autofluorescence and emission spillover between different fluorophores, alternative techniques are being developed. In recent years, mass cytometry has emerged, wherein antibodies labeled with metal ions are detected by ICP-MS. In order for a cell to be seen, a metal in the mass window must be present; there is no analogous parameter to forward or side scatter. The current mass window selected is approximately AW 103-196, which includes the lanthanides used for most antibody labeling, as well as iridium and rhodium for DNA intercalators.
In this protocol, we use a cocktail of antibodies labeled with MAXPAR metal-chelating polymers to surface-stain live PBMC that have been previously cryopreserved. Many of these markers were taken from a standard fluorescence phenotyping panel (Maecker et al., 2012). No intracellular antibodies are used. We use a CyTOFTM (Cytometry by Time-Of-Flight) mass cytometer to acquire the ICP-MS data. Subsequent analysis of the dual count signal data using FlowJo software allows for cell types to be analyzed based on the dual count signal in each mass channel. The percentage of each cell type is determined and reported as a percent of the parent cell type.
Keywords: CyTOF PBMC Phenotyping Mass cytometry
Materials and Reagents
Peripheral blood mononuclear cells (PBMC) (fresh, or frozen after Ficoll isolation procedure)
RPMI (HyClone, catalog number: SH30027.01 )
FBS (heat-inactivated before use) (Atlanta Biologicals, catalog number: S11150 )
Pen-Strep-Glutamine (100x) (HyClone, catalog number: SV30082.01 )
Benzonase (25 x 105 U/ml) (Pierce Antibodies, catalog number: 88701 )
MilliQ water [no contact with beakers or bottles washed with soap (due to barium content of most commercial soaps)]
PBS (10x stock) (Rockland, catalog number: MB-008 )
Bovine serum albumin (BSA) (30% w/v in 0.85% NaCl) (Sigma-Aldrich, catalog number: A7284 )
0.5 M EDTA (pH 8.0) (Hoefer, catalog number: GR123-100 )
Sodium azide (10% w/v solution) (Teknova, catalog number: S0209 )
2% para-formaldehyde (PFA) (16% w/v aqueous stock, methanol-free, diluted to 2% in 1x CyPBS) (Alfa Aesar, catalog number: 43368 )
Maleimide-DOTA (Macrocyclics, catalog number: B-272 )
139-Lanthanum (chloride salt) (Sigma-Aldrich, catalog number: 203521 )
115-Indium (chloride salt) (Sigma-Aldrich, catalog number: 203440 )
Phenotyping antibodies (filtered with 0.1 μm spin filters) (MIllipore, catalog number: UFC30VV00 )
Ir-intercalator stock solution from Fluidigm (catalog number: 201192B ; Rh103-intercalator catalog number: 201103B can be used)
10x saponin-based permeabilization buffer (eBiosciences, catalog number: 00-8333-56 )
Complete RPMI (see Recipes)
CyPBS (see Recipes)
CyFACS buffer (see Recipes)
Live-dead stain (see Recipes)
Equipment
37 °C water bath
96-well plate: 300 μl well volume (250 μl washes) or 1.2 ml well volume (500 μl washes)
Note: If using a 300 μl plate, do an additional wash step (resuspension and centrifugation) at each point.
Biosafety cabinet
Centrifuge
Calibrated pipettes
ViCell (Beckman Coulter) or Hemocytometer cell counter
CyTOFTM version 1 mass cytometer (Fluidigm Sciences)
Software
FlowJo software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Leipold, M. D. and Maecker, H. T. (2015). Phenotyping of Live Human PBMC using CyTOFTM Mass Cytometry. Bio-protocol 5(2): e1382. DOI: 10.21769/BioProtoc.1382.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Mass cytometry
Immunology > Immune cell staining > Immunodetection
Cell Biology > Single cell analysis > Mass cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,383 | https://bio-protocol.org/exchange/protocoldetail?id=1383&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PBMC-MSC Co-cultures for Induction of Treg Generation
SM Sara M. Melief
CS C. L. M. Schrama
HR Helene Roelofs
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1383 Views: 15248
Reviewed by: Hui ZhuNingfei An
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
To assess the capacity of multipotent stromal cells (MSC) to induce the generation of Tregs, transwell co-cultures were performed as well as cultures with MSC-conditioned medium (CM). In short, peripheral blood mononuclear cells (PBMC) were co-cultured with allogeneic MSC or CM for one week followed by one week of culture in the absence of MSC.
Materials and Reagents
Peripheral blood mononuclear cells (PBMC) [isolated from a healthy donor using Ficoll-Paque (own pharmacy) density gradient (1.077 g/cm3)]
Multipotent stromal cells (MSC) from healthy donors
Roswell Park Memorial Institute (RPMI) 1640 medium (Life Technologies, catalog number: 31870-082 )
Penicillin/streptomycin (5,000 U/ml) (Life Technologies, catalog number: 15070-063 )
L-glutamin (200 mM) (Life Technologies, catalog number: 25030-024 )
Fetal calf serum (FCS) (Greiner Bio-One GmbH)
Phosphate buffered saline (PBS)
Trypsin/EDTA (1x 0.05% Trypsin-EDTA, phenol red) (Life Technologies, catalog number: 25300-096 )
Equipment
T75 culture flasks
12-well transwell plates (pore size 0.4 μM) (Sigma-Aldrich, catalog number: CLS3460 )
10 K Centriprep Centrifugal filters (Millipore, catalog number: 4304 )
12/24/48-well plates (Sigma-Aldrich, Corning Costar cell culture plates)
37 °C, 5% CO2 cell culture incubator
Microscope
Centrifuge
10 K Centriprep centrifugal filters
Hemocytometer (counting chamber) or Sysmex F-820
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Hematopoietic stem cell
Stem Cell > Adult stem cell > Stromal cell
Stem Cell > Adult stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,384 | https://bio-protocol.org/exchange/protocoldetail?id=1384&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Monocyte-MSC Co-cultures
SM Sara M. Melief
CS C. L. M. Schrama
HR Helene Roelofs
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1384 Views: 11590
Reviewed by: Hui ZhuNingfei An
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
To assess the effect of multipotent stromal cells (MSC) on monocytes, 3-day cultures were performed of freshly isolated monocytes in MSC-conditioned medium (CM). As a control condition, monocytes were stimulated with low dose macrophage colony-stimulating factor (M-CSF). Monocytes were isolated from peripheral blood mononuclear cell (PBMC) populations by magnetic activated cell sorting (MACS) using CD14 microbeads.
Materials and Reagents
Peripheral blood mononuclear cells (PBMC) [isolated from a buffy coat from a healthy donor using Ficoll-Paque (own pharmacy) density gradient (1.077 g/cm3)]
Multipotent stromal cells (MSC) from healthy donors
Roswell Park Memorial Institute (RPMI) 1640 medium (Life Technologies, catalog number: 31870-082 )
Penicillin/streptomycin (5,000 U/ml) (Life Technologies, catalog number: 15070-063 )
L-glutamin (200 mM) (Life Technologies, catalog number: 25030-024 )
Fetal calf serum (FCS) (Greiner Bio-One GmbH, catalog number: 758072 )
Phosphate buffered saline (PBS) (produced by in-house pharmacy)
M-CSF (Pepro Tech, catalog number: 300-25 )
CD14 MicroBeads (human) (Miltenyi Biotec, catalog number 130-050-201 )
Antibodies
Anti-CD14 PE (BD Biosciences)
Anti-CD206 APC (BD Biosciences)
Anti-CD163 PerCP-Cy5.5 (BioLegend)
Anti-CD80 PE-Cy7 (BioLegend)
Trypsin/EDTA (0.05%, phenol red) (Life Technologies, InvitrogenTM, catalog number: 25300-054 )
Culture medium (see Recipes)
Proliferation medium (see Recipes)
Equipment
T75 culture flasks
6-well plates (Sigma-Aldrich, catalog number: CLS3506 )
37 °C, 5% CO2 cell culture incubator
Microscope
Centrifuge
Hemocytometer (counting chamber)
MS Columns (Miltenyi Biotec, catalog number: 130-042-201 )
MiniMACS separator (Miltenyi Biotec, catalog number: 130-042-102 )
MACS MultiStand (Miltenyi Biotec, catalog number: 130-042-303 )
24-well plates (Sigma-Aldrich, catalog number: CLS3526 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Hematopoietic stem cell
Stem Cell > Adult stem cell > Stromal cell
Stem Cell > Adult stem cell > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,385 | https://bio-protocol.org/exchange/protocoldetail?id=1385&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of CNS-infiltrating and Resident Microglial Cells
YJ Young-Hee Jin
BK Byung S. Kim
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1385 Views: 15692
Reviewed by: Savita Nair
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
Variety of immunological and biochemical studies associated with infection or inflammation in the central nervous system (CNS) utilize CNS-resident and/or infiltrating cells which were isolated from the CNS of naïve and affected mice in order to investigate the underlying mechanisms and the potential roles of the cell populations. Mechanical and enzyme-based single cell preparations of CNS cells are subjected to a density gradient to obtain functional single cells. In combination with cell-specific biomarkers, the function and/or status of resident microglia and infiltrating lymphocytes, including B and T cells as well as macrophages, can be characterized.
Materials and Reagents
Isoflurane (Vedco, catalog number: 50201 )
Hanks' balanced salt solution (HBSS) (Cellgro, catalog number: 20-021-CV )
Note: 10x solution, diluted to 1x in house in sterile distilled water.
RPMI-1640 medium (Sigma-Aldrich, catalog number: R8758 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11055H )
Penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
Collagenase type IV (Worthington Biochemical, catalog number: 4188 )
DNase I (Sigma-Aldrich, catalog number: DN25 )
Percoll (GE Healthcare, catalog number: 17-0891-01 )
Phosphate buffered saline (PBS)
Anti-CD45-allophycocyanin (APC) and anti-CD11b-phycoerythrin (PE) antibodies (both from BD, catalog numbers: 559864 and 557397 , respectively)
Anti-CD8-APC (clone Ly-; 2) (BD, catalog number: 553035 )
Anti-CD4-PE (clone L3T4) (BD, catalog number: 553049 ) antibodies
Complete RPMI-1640 medium (see Recipes)
Collagenase and DNase I solution (see Recipes)
100% Percoll (see Recipes)
70% Percoll (see Recipes)
30% Percoll (see Recipes)
Equipment
Scissors and forceps
10 ml and 50 ml disposable plastic syringe (BD)
18 G needle (BD)
Steel mesh (250 m) (VWR International, catalog number: AA13478-RR )
37 °C water bath
Table top refrigerated centrifuge
High-speed centrifuge (Beckman Coulter, model: J2-21 )
50 ml screw-cap tube
LSRII Flow cytometer (BD)
Low-speed table top centrifuge (1,000-3,000 rpm)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jin, Y. and Kim, B. S. (2015). Isolation of CNS-infiltrating and Resident Microglial Cells. Bio-protocol 5(2): e1385. DOI: 10.21769/BioProtoc.1385.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Microbiology > Microbe-host interactions > Virus
Neuroscience > Cellular mechanisms > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
May I ask how much volume of digestive fluid is added to digest brain tissue
0 Answer
2 Views
Nov 9, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,386 | https://bio-protocol.org/exchange/protocoldetail?id=1386&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of the Secondary Structure of an RNA fragment in Solution: Selective 2`-Hydroxyl Acylation Analyzed by Primer Extension Assay (SHAPE)
MM Manuel Miras
RS Raquel N. Sempere
JK Jelena J. Kraft
WM W. Allen Miller
MA Miguel A. Aranda
VT Veronica Truniger
Published: Vol 5, Iss 2, Jan 20, 2015
DOI: 10.21769/BioProtoc.1386 Views: 13129
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
This protocol describes the methodology for the determination of the secondary structure of an RNA fragment in solution using Selective 2´-Hydroxyl Acylation analyzed by Primer Extension, abbreviation SHAPE. It consists in the very fast chemical modification of flexible and therefore possibly single-stranded nucleotides in a sequence-independent manner using benzoyl cyanide (BzCN), forming 2´-O-adducts. The modifications in the RNA are then analyzed by primer extension. Reverse transcriptase is blocked by the 2´-O-adducts formed. The advantage of the method is, first, that not each RNA molecule studied but the primer used in the extension reaction is labelled and, second, that the resulting cDNA analyzed in sequencing gels is much more stable than the modified RNA.
Keywords: RNA secondary structure RNA structure RNA chemical modification SHAPE
Materials and Reagents
Yeast tRNA (Life Technologies, Ambion®, catalog number: AM7119 )
MEGAshortscript T7 Transcription Kit (Life Technologies, Ambion®, catalog number: AM1354 )
Oligonucleotide (50 μM)
Recombinant RNase inhibitor (Takara Bio Company, catalog number: 2313A )
Potassium chloride (Sigma-Aldrich, catalog number: P9541 )
HEPES (Sigma-Aldrich, catalog number: H4034 )
Magnesium chloride (Sigma-Aldrich, catalog number: 63063 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
Benzoyl cyanide (Sigma-Aldrich, catalog number: 115959 )
Note: Keep in desiccator!
3 M sodium acetate (pH 5.5) (Life Technologies, Ambion®, catalog number: AM9740 )
T4 Polynucleotide kinase (New England Biolabs, catalog number: M0201S )
ATP ([γ-32P]- 6,000 Ci/mmol 10 mCi/ml Lead, 250 µCi) (PerkinElmer, catalog number: NEG002Z250UC )
Micro Bio-Spin P-30 Gel Columns Tris Buffer (Bio-Rad Laboratories, catalog number: 732-6250 )
dNTPs mixture for primer extension (2.5 mM each) (Takara Bio Company, catalog number: 4030 )
ddNTPs (set 5 mM) (GE Healthcare, catalog number: 27-2045-01 )
dNTPs (set 100 mM diluted to 10 mM for ladder) (Life Technologies, catalog number 10297-018 )
SuperScript II (Life Technologies, InvitrogenTM, catalog number: 18064-014 )
Gel loading buffer II (Life Technologies, Ambion®, catalog number: AM8546G )
Sodium hydroxide (Sigma-Aldrich, catalog number: 221465 )
Ammonium persulfate (APS) (Bio-Rad Laboratories, catalog number: 161-0700 )
100% ethanol
Biospin columns (Bio-Rad Laboratories, catalog number: 732-6250)
10x TBE buffer (see Recipes)
Denaturing polyacrylamide gel electrophoresis (PAGE) (see Recipes)
Sequencing ladders (ddNTP/dNTP mix) (see Recipes)
5x SHAPE buffer (see Recipes)
0.4 M benzoyl cyanide (see Recipes)
Equipment
Standard laboratory equipment
Nanodrop device
Incubator or water bath
Sequencing gel electrophoresis system
Power supply
Vacuum pump
Gel dryer (Bio-Rad Laboratories, model: 583 )
Phosphorimaging instrument and screen
Typhoon 9410 scanner
The UreaGel System (National Diagnostics, catalog number: EC-833 )
Software
Image analysis software (Bio-Rad Laboratories, Quantity One; SAFA footprinting software, https://simtk.org/home/safa)
RNA secondary structure prediction
MC-Fold: http://www.major.iric.ca/MC-Fold
Mfold: http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Miras, M., Sempere, R. N., Kraft, J. J., Miller, W. A., Aranda, M. A. and Truniger, V. (2015). Determination of the Secondary Structure of an RNA fragment in Solution: Selective 2`-Hydroxyl Acylation Analyzed by Primer Extension Assay (SHAPE). Bio-protocol 5(2): e1386. DOI: 10.21769/BioProtoc.1386.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,387 | https://bio-protocol.org/exchange/protocoldetail?id=1387&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Conceptual Outline for Omics Experiments Using Bioinformatics Analogies
Prashanth Suravajhala
JB Jeffrey W. Bizzaro
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1387 Views: 11456
Edited by: Arsalan Daudi
Reviewed by: Modesto Redrejo-Rodriguez
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Hypothetical proteins (HP) are those that are not characterized in the laboratory and so remain “orphaned” in genomic databases. In recent times there has been a lot of progress in characterizing HPs in the laboratory. Various methods, such as sequence capture and Next Generation Sequencing (NGS), have been used to rapidly identify HP functions and their encoded genes. Applications and methods, such as the isolation of single genes, are greatly facilitated by pull-down assays to characterize proteins. Furthermore, there are methods to extract proteins from either the whole cell or a subcellular fraction. But the weakness is that some assays are fairly expensive and laborious, and characterizing HP function is always imperfect. In the recent past, statistical interpretations of the in silico selection strategies have improved the identification of the most promising candidates, including those from various annotation methods, such as protein interaction networks (PIN). Given the improvements in technology that have permitted a substantial increase in computational annotation, we ask if the prediction of HP function in silico (validation of models through algorithms and data subsets) could likewise be improved. In this work, we apply a bioinformatics analogy to each step of a wet lab experiment performed to predict aspects confirming protein function. Although it may be a less bona fide approach, assigning a putative function from conservation observed in homologous protein sequences might be worthwhile to consider prior to a wet lab experiment.
Keywords: Hypothetical proteins Omics Systems biology Functional genomics Annotation
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Suravajhala, P. and Bizzaro, J. W. (2015). A Conceptual Outline for Omics Experiments Using Bioinformatics Analogies. Bio-protocol 5(3): e1387. DOI: 10.21769/BioProtoc.1387.
Download Citation in RIS Format
Category
Systems Biology > Interactome > Gene network
Biochemistry > Protein > Interaction
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,388 | https://bio-protocol.org/exchange/protocoldetail?id=1388&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Water Deficit Treatment and Measurement in Apple Trees
CB Carole L. Bassett
TA Timothy S. Artlip
MW Michael E. Wisniewski
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1388 Views: 8985
Edited by: Arsalan Daudi
Reviewed by: Yuko KuritaYurong Xie
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Water is considered perhaps the most limiting factor for plant growth and productivity (Boyer, 1982), and climate change predicts more frequent, more severe and longer drought periods for a significant portion of the world in coming years. Unfortunately, drought resistance is particularly difficult to measure due in part to the complexity of the underlying biology that contributes to a plant’s ability to cope with water limitations. For example, water deficit is frequently examined by detaching leaves or withholding water for a set period of time prior to tissue collection. Such approaches may elucidate the early stages of drought response but are generally not physiologically relevant for maintenance of drought resistance over a longer period. A more realistic approach is to impose a gradual water limitation with a sustained soil moisture level, particularly in the case of woody perennials. We describe here a protocol that imposes a long-term water deficit under controlled laboratory conditions that allow a molecular biology approach to understanding how woody plants survive severe water limitations. Representative data can be found in Artlip et al. (1997) and Bassett et al. (2014).
Keywords: Malus x domestica Tissue culture Water limitation Climate change Pressure bomb
Materials and Reagents
Woody plants (seedlings, grafted, or own-rooted)
Potting soil (MetroMix 360; SunGro Horticulture)
Water source for watering plants
‘Play’ sand (can be obtained from any ‘home and garden’ store) washed three times with hot tap water and dried
Slow release fertilizer (Osmocote, Scott’s Miracle-Gro Products, catalog number: 19-6-12 N-P-K )
MS salts (Phytotechnology Laboratories, catalog number: M524 )
Sucrose (Phytotechnology Laboratories, catalog number: S391 )
Agar (Fisher Scientific, catalog number: BP1423 )
Myo-inositol (Sigma-Aldritch, catalog number: I3011 )
IBA (Sigma-Aldritch, catalog number: I5386 )
Nutrient solution (MiracleGro, Scott’s Miracle-Gro Products, catalog number: 24-8-16 N-P-K )
Rooting medium (see Recipes)
Equipment
1 gallon plastic pots (or desired size to accommodate plants)
Plastic beaker for measuring soil
Aluminum foil (optional)
Small ruler
Oasis rooting cubes (Smithers-Oasis LC-1 Horticubes, catalog number: 5240 )
Conviron TC16 tissue culture chamber (Conviron)
Greenhouse or Growth chamber for maintaining appropriate light, temperature and photoperiod (equivalent to Conviron, models: PGV36 or PGW36 )
Scale appropriate for weighing pots with plants, (e.g. Weigh-Tronix, model: 830 )
Scholander pressure bomb (SoilMoisture Equipment Corp., model: 3005 Series )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bassett, C. L., Artlip, T. S. and Wisniewski, M. E. (2015). Water Deficit Treatment and Measurement in Apple Trees. Bio-protocol 5(3): e1388. DOI: 10.21769/BioProtoc.1388.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,389 | https://bio-protocol.org/exchange/protocoldetail?id=1389&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Heterotopic Bone Formation Assay Using Isolated Mouse and Human Mesenchymal Stem Cells
Li Chen
ND Nicholas Ditzel
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1389 Views: 17239
Reviewed by: Salma Hasan
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Exogenous (human or mouse) mesenchymal stem cells (MSCs) seed in HA scaffold and transplant subcutaneously in immunodeficient mice, the cells can finally form bone tissues in the in vivo environment. This protocol describes how to get heterotopic bone formation in mice by mesenchymal stem cells (MSCs) in hydroxyapatite (HA) scaffolds. This is a simple and robust approach to detect the bone formation by tissue engineering approaches in vivo, and it also fits for examining the roles of different factors in bone formation.
Keywords: Bone formation Mouse model Stem cells
Materials and Reagents
Human or mouse mesenchymal stem cells (cultured, treated or transfected)
Note: If using the primary bone marrow stem cells (attached cells from bone marrow culturing), it’s better to use cells in low passages (not over passage 3); if using MSC cell lines, it’s also better to use low passages than high passages.
Mice [NOD.CB17-Prkdc/J mice (NOD/SCID), around 8 weeks old]
Hydroxyapatite/tricalcium phosphate (HA/TCP) (Zimmer, catalog number: 60-130)
4% paraformaldehyde
Hematoxylin/Eosin (H&E) staining solution
Formic acid solution (see Recipes)
Equipment
1 ml syringes
Cotton sticks (Pro-Ophtha)
Scalpels
Racks (for fixing the syringes in vertical position in cell incubator)
Tools for mouse surgery (scalpel, forceps, needle holder, scissors, sutures, sterile swabs, sterile drapes)
Scan microscopy (Leica Microsystems or any scan microscopy)
Computer (with image analysis software, such as ImageJ® or Photoshop CS®)
Software
ImageJ® or Photoshop CS®
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, L. and Ditzel, N. (2015). In vivo Heterotopic Bone Formation Assay Using Isolated Mouse and Human Mesenchymal Stem Cells. Bio-protocol 5(3): e1389. DOI: 10.21769/BioProtoc.1389.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Mesenchymal stem cell
Cell Biology > Cell isolation and culture > Cell growth
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
139 | https://bio-protocol.org/exchange/protocoldetail?id=139&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Polyribosome Profiling
Wei Zheng
Published: Oct 5, 2011
DOI: 10.21769/BioProtoc.139 Views: 11612
Download PDF
Ask a question
Favorite
Cited by
Materials and Reagents
Acetone
Sucrose
Cyclohexamide
Bromophenol blue (BPB)
Urea
Tris-HCl
Tris-Acetate
MgCl2
DTT
NH4Cl
NaCl
DEPC-treated water
Heparin
Stocks (see Recipes)
Lysis buffer (see Recipes)
60% sucrose (see Recipes)
7% sucrose solution (see Recipes)
47% sucrose solution (see Recipes)
Diluted sucrose (see Recipes)
Cyclohexamide to add to cells (see Recipes)
Equipment
Autoclaved, RNase free 500 ml centrifuge bottles (1 per sample)
Autoclaved, RNase free 40 ml centrifuge bottles (1 per sample)
Centrifuges
Colored Epi tubes. Need 30/sample
15 ml, 50 ml falcon tubes (BD Biosciences, Falcon®)
Ultracentrifuge tubes (Don't autoclave) (Beckman Coulter, catalog number: 344059 )
Beckman JA-10, JA-20, and Epi rotors to 4 °C (Beckman Coulter)
Ultra SW-51 buckets to 4 °C
RNase-free glass beads and bead scoop
Foxy fraction collector
BioRad Econo UV monitor (Bio-Rad)
Peristaltic pump
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Organelle isolation > Polyribosome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,390 | https://bio-protocol.org/exchange/protocoldetail?id=1390&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection and Quantification of Heme and Chlorophyll Precursors Using a High Performance Liquid Chromatography (HPLC) System Equipped with Two Fluorescence Detectors
JP Jan Pilný
JK Jana Kopečná
JN Judith Noda
RS Roman Sobotka
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1390 Views: 11946
Edited by: Tie Liu
Reviewed by: Seda Ekici
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Intermediates of tetrapyrrole biosynthetic pathway are low-abundant compounds, and their quantification is usually difficult, time consuming and requires large amounts of input material. Here, we describe a method allowing fast and accurate quantification of almost all intermediates of the heme and chlorophyll biosynthesis, including mono-vinyl and di-vinyl forms of (proto) chlorophyllide, using just a few millilitres of the cyanobacterial culture. Extracted precursors are separated by High Performance Liquid Chromatography system (HPLC) and detected by two ultra-sensitive fluorescence detectors set to different wavelengths.
Keywords: Chlorophyll biosynthesis Tetrapyrroles Flourescence detector High Performance Liquid Chromatography Synechocystis 6803
Materials and Reagents
Methanol (HPLC grade)
Pyridine reagent Plus >99% (Sigma-Aldrich, catalog number: P57506 )
H2O (HPLC grade) (Merck KGaA)
Acetonitrile (HPLC grade)
HPLC solvent A (see Recipes)
HPLC solvent B (see Recipes)
Equipment
0.5 ml polypropylene tubes
HPLC 2 ml glass vials and 200 μl glass inserts
HPLC system with an autosampler (Agilent, model: 1200 ) (Figure 1)
Figure 1. The Agilent 1200 HPLC system equipped with an autosampler and two fluorescence detectors marked as FLD #1 and FLD #2
Two HPLC fluorescence detectors (Agilent, model: 1200 ) (see Note 1)
The original Agilent 1200 detectors offer adequate sensitivity for emission wavelengths ranging 300-600 nm, however for longer wavelengths the sensitivity quickly falls almost to zero. This issue also applies to the newer 1260 version of the detector. As sensitivity to longer wavelengths is essential for detection of several heme/chlorophyll precursors, the original Agilent photomultiplier was replaced with the R928 photomultiplier tube (Hamamatsu, catalog number: R928) in both detectors. This modification significantly improved sensitivity within the entire wavelength range, and dramatically improved the sensitivity to wavelengths >600 nm. The replacement for the photomultiplier was provided by Agilent’s technical service.
Tabletop centrifuge (Eppendorf, MiniSpin plus)
Reverse phase column (ReproSil 100 C8-AB, 5-µm particle size, 4 x 250 mm) (Dr. Maisch, catalog number: r15.8b.s2504 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Pilný, J., Kopečná, J., Noda, J. and Sobotka, R. (2015). Detection and Quantification of Heme and Chlorophyll Precursors Using a High Performance Liquid Chromatography (HPLC) System Equipped with Two Fluorescence Detectors. Bio-protocol 5(3): e1390. DOI: 10.21769/BioProtoc.1390.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Photosynthesis
Plant Science > Plant metabolism > Other compound
Biochemistry > Other compound > Chlorophyll
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,391 | https://bio-protocol.org/exchange/protocoldetail?id=1391&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Application of Silicone Tubing for Robust, Simple, High-throughput, and Time-resolved Analysis of Plant Volatiles in Field Experiments
Mario Kallenbach
DV Daniel Veit
Elisabeth J. Eilers
Meredith C. Schuman
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1391 Views: 14071
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Plant volatiles (PVs) mediate manifold interactions between plants and their biotic and abiotic environments (Dicke and Baldwin, 2010; Holopainen and Gershenzon, 2010). An understanding of the physiological and ecological functions of PVs must therefore be based on measurements of PV emissions under natural conditions. Yet sampling PVs in natural environments is difficult, limited by the need to transport, maintain, and power instruments, or else to employ expensive sorbent devices in replicate. Thus PVs are usually measured in the artificial environments of laboratories or climate chambers. However, polydimethysiloxane (PDMS), a sorbent commonly used for PV sampling (Van Pinxteren et al., 2010; Seethapathy and Górecki, 2012), is available as silicone tubing (ST) for as little as 0.60 €/m (versus 100-550 € apiece for standard PDMS sorbent devices). Small (mm-cm) ST pieces can be placed in any experimental setting and used for headspace sampling with little manipulation of the organism or headspace. ST pieces have absorption kinetics and capacities sufficient to sample plant headspaces on a timescale of minutes to hours, producing biologically meaningful “snapshots” of PV blends. When combined with thermal desorption (TD)-GC-MS analysis - a 40-year-old and widely available technology - ST pieces yield reproducible, sensitive, spatiotemporally resolved, quantitative data from headspace samples taken in natural environments (Kallenbach et al., 2014).
Keywords: Polydimethylsiloxane Silicone tubing Headspace analysis Herbivore-induced plant volatiles Nicotiana attenuata
Materials and Reagents
Acetonitrile (gradient grade)
Methanol (gradient grade)
Nitrogen (gaseous)
Scentless soap (Labosol S)
Argon (gaseous)
Note: Argon provides a clean, inert atmosphere which is heavier than air, for long-term storage of conditioned ST pieces. For shorter time periods, storage under nitrogen is adequate.
Equipment
Silicone laboratory tubing (ST, 1 mm i.d. x 1.8 mm o.d.) (Carl Roth, catalog number: 9555.1 )
4 ml screw-neck glass vials (brown) (Macherey-Nagel, catalog number: 702973 ) and screw caps (N13 PP) (Macherey-Nagel, catalog number: 702051 )
1.5 ml screw-neck glass vials (Macherey-Nagel, clear, catalog number: 702282 ; brown, catalog number: 702293 ) and screw caps (N9 polypropylene [PP], Macherey-Nagel, catalog number: 702028)
Polytetrafluoroethylene (PTFE) seal tape (RS, catalog number: 231-964 )
Paddle wire
Retractable-blade utility knife or single-edged razor blade
Cutting mask (custom-made) for uniformly cutting 5 mm PDMS pieces, made out of polyoxymethylene (POM) (Figure 1A)
Note: PDMS pieces can also be cut manually, but a cutting mask increases uniformity and saves time when cutting large numbers of PDMS pieces.
Laboratory borosilicate glass bottle (volume: 100-250 ml) (Carl Roth, catalog numbers: A358.1 or A359.1 )
Stainless steel spatula (Carl Roth, catalog number: 1902.1 )
Stainless steel forceps (Carl Roth, catalog number: 2687.1 ) and aluminum foil (Carl Roth, catalog number: 0192.1 )
Glass column (50 ml) with screw-cap ends, containing a size P0 glass frit (Figure 1C)
Note: The glass frit should be sufficiently small to cause a turbulent nitrogen gas flow.
Polyether ether ketone (PEEK) screw-caps with PTFE lining and stainless steel hose connections, for glass column (Figure 1D)
Flow meter (5-10 L volume)
PTFE gas hoses
Heating oven (max. temperature at least 210 °C)
Polyethylene tetraphthalate (PET) trapping containers (30-600 ml, Solo or Iso-pack)
Note: The trapping container volume should be as small as possible without significantly changing environmental conditions (e.g. humidity, temperature). This can be tested by enclosing a test sample for the planned trapping period and checking for any visual change (e.g. wilting, condensation) as well as by placing environmental sensors (e.g. temperature, humidity) inside and outside of the trapping container.
Thermo desorption (TD) unit (Shimadzu, model: TD-20 )
89 mm TD sampler tubes (Supelco, catalog number: 28714-U ) and caps with O-rings (Shimadzu, caps, catalog number: 2235461791 and O-rings, catalog number: 2235716691 )
Note: Caps can also be milled from brass as long as the exact dimensions are kept.
GC-MS (Shimadzu, model: GC-MS-QP2010Ultra )
5MS GC column (30 m long, 0.25 mm i.d., 0.25 µm film thickness) (Restek Rtx-5MS)
WAX column (30 m long, 0.25 mm i.d., 0.25 µm film thickness) (Phenomenex ZB-Wax Plus)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kallenbach, M., Veit, D., Eilers, E. J. and Schuman, M. C. (2015). Application of Silicone Tubing for Robust, Simple, High-throughput, and Time-resolved Analysis of Plant Volatiles in Field Experiments. Bio-protocol 5(3): e1391. DOI: 10.21769/BioProtoc.1391.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,392 | https://bio-protocol.org/exchange/protocoldetail?id=1392&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infection Experiments (Hepatitis C Virus)
Lidia Mingorance
Claudia Vasallo
Martina Friesland
Pablo Gastaminza
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1392 Views: 9032
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
The establishment of a cell culture system for hepatitis C virus based on the JFH-1 strain and human hepatoma cell lines has been instrumental for the study of the viral replication cycle. The robustness of the JFH1-based cell culture models enabled many laboratories around the world to perform HCV infections in cell culture, accelerating the identification of cellular and viral targets to develop novel antiviral compounds. Although other robust infection systems based on different molecular clones and different cell lines have been developed since then, here we describe the protocols corresponding to infections with JFH-1 and JFH1-derived viruses carried out in our laboratory to produce virus stocks and persistently infected cell cultures. We also describe the experimental setups used to determine virus spreading capacity (multiple cycle infections) as well as to dissect early and late aspects of HCV infection (single cycle infections).
Materials and Reagents
Biological materials
Human hepatoma cells Huh-7 (Nakabayashi et al., 1982) and derived subclone Huh-7.5.1 clone 2, hereafter clone 2 (Pedersen et al., 2007)
Viruses: Genotype 2a JFH-1 strain (Zhong et al., 2005) and a cell culture-adapted JFH1 variant D183 (Zhong et al., 2006)
Human monoclonal anti-E2 (AR3A) (antibody provided by Mansun Law, The Scripps Research Institute) (Law et al., 2008)
Alexa Fluor 555 Goat Anti-Human IgG (H+L) (Alexa 555-conjugated antibody) (Life Technologies, InvitrogenTM, catalog number: A21433 )
Fetal bovine serum (FBS) (LINUS, catalog number: 501805 )
BSA (Roche Diagnostics, catalog number: 10 735 086 001 )
Reagents
1 M HEPES (pH 7.4) (Sigma-Aldrich, catalog number: H3375-500G )
100x MEM nonessential amino acids (Life Technologies, Gibco®, catalog number: 11140-050 )
Penicillin/streptomycin (10,000 U/ ml) (Life Technologies, Gibco®, catalog number: 15140-122 )
0.5% trypsin/EDTA solution (10x) (Life Technologies, Gibco®, catalog number: 15400-054 )
Prolong (Life Technologies, catalog number: P-36930 )
Triton X-100 (Sigma-Aldrich, catalog number: T-8787 )
Formaldehyde solution (37% wt% in H2O) (Sigma-Aldrich, catalog number: 252549 )
4,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich, catalog number: 32670 )
Dulbecco´s Modified Eagle Medium (DMEM) (Life Technologies, Gibco®, catalog number: 41965-039 ) (see Recipes)
10x phosphate buffered saline (PBS) (see Recipes)
Immunofluorescence (IF) buffer (see Recipes)
4% formaldehyde solution (see Recipes)
Equipment
CO2 incubator
1.5 ml safe-lock PCR clean microtubes (Eppendorf, catalog number: 0030 123 328 )
Falcon 50 ml tubes (Falcon®, catalog number: 352098 )
75 cm2 cell culture flask (canted neck, 0.2 µM vent cap) (Corning, catalog number: 430641 )
162 cm2 traditional straight neck cell culture flask with vent cap (corning, catalog number: 3151 )
6 well culture cluster (flat bottom) (Corning, Costar®, catalog number 3506 )
12 well culture cluster (flat bottom) (Corning, Costar®, catalog number 3513 )
24 well culture cluster (flat bottom) (Corning, Costar®, catalog number 3527 )
96 well culture cluster (flat bottom) (Corning, Costar®, catalog number 3599 )
5 ml stripette (Corning, Costar®, catalog number 4487 )
10 ml stripette (Corning, Costar®, catalog number 4488 )
25 ml stripette(Corning, Costar®, catalog number 4489 )
Pipet aid (IBS INTEGRA Biosciences, catalog number: 155000 )
Pipetman p200 micropipette (GILSON®, catalog number: F123601 )
Pipetman p1000 micropipette (GILSON®, catalog number: F123602 )
Centrifuges (Hettich Zentrifugen, catalog number: EBA 12R )
-20 °C freezer
-80 °C freezer
Fluorescence microscope (inverted fluorescence microscope with long distance objectives)
Microscope slides and coverslips (Thermo Fisher Scientific, catalog number: 5425508 )
Filter tips 10 µl (Sorenson Bioscience, catalog number: 35200 )
Filter tips 20 µl (Sorenson Bioscience, catalog number: 35220 )
Filter tips 200 µl (Sorenson Bioscience, catalog number: 35230 )
Filter tips 1,000 µl (Sorenson Bioscience, catalog number: 35260 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mingorance, L., Vasallo, C., Friesland, M. and Gastaminza, P. (2015). Infection Experiments (Hepatitis C Virus). Bio-protocol 5(3): e1392. DOI: 10.21769/BioProtoc.1392.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Antiviral assay
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,393 | https://bio-protocol.org/exchange/protocoldetail?id=1393&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hanging Drop Aggregation Assay of Breast Cancer Cells
Yong Teng
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1393 Views: 20084
Edited by: HongLok Lung
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Hanging drop assay can be used to investigate cell-cell cohesion and cell-substratum adhesion through generation of 3D spheroids under physiological conditions. It also can be used to elucidate the role of cell-cell or cell-ECM interactions in specifying spatial relationships between two (or more) different cell populations. This simple method requires no specialized equipment and provides a means of generating tissue-like cellular aggregates for measurement of biomechanical properties for molecular and biochemical analysis in a physiologically relevant model.
Keywords: Hanging drop Cancer Aggregation Migration
Materials and Reagents
Human breast cancer cell lines T-47D (ATCC, catalog number: ATCC® HTB-133TM ), MCF7 (ATCC, catalog number: ATCC® HTB-22TM )
Trypsin-EDTA (0.05%) (phenol red) (Life Technologies, catalog number: 25300062 )
Gibco® RPMI media 1640 (Life Technologies, catalog number: 11875-085 )
Gibco® PBS (Life Technologies, catalog number: 10010023 )
Fetal bovine serum (Life Technologies, catalog number: 16000-044 )
Gibco® penicillin-streptomycin-glutamine (100x) (Life Technologies, catalog number: 10378-016 )
Complete medium (see Recipes)
Equipment
CorningTM culture dishes (Corning, catalog number: 430591 )
Inverted microscope (ZEISS)
Haemocytometer (Thermo Fisher Scientific, catalog number: 02-671-52 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Cancer Biology > General technique > Tumor formation
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,394 | https://bio-protocol.org/exchange/protocoldetail?id=1394&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Filter Binding Assay to Quantify the Association of Cyclic di-GMP to Proteins
DS Disha Srivastava
CW Christopher M. Waters
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1394 Views: 10649
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Cyclic di-GMP (c-di-GMP) is a ubiquitous second messenger that regulates many processes in bacteria including biofilm formation, motility, and virulence (Hengge, 2009). Analysis of c-di-GMP binding properties of bacterial proteins is an important step to characterize c-di-GMP signaling pathways. C-di-GMP binds numerous proteins such as transcription factors, enzymes, and multimeric protein complexes (Hickman and Harwood, 2008, Ryjenkov et al., 2006, Weinhouse et al., 1997). The c-di-GMP binding assay described here is a relatively simple and cost effective method to characterize c-di-GMP binding to a protein using [32P]-labeled c-di-GMP. Radiolabeled c-di-GMP is readily synthesized with a purified GGDEF enzyme [such as WspR from Pseudomonas aeruginosa (P. aeruginosa)] and [32P]-GTP (Srivastava et al., 2013). After incubation of the labeled c-di-GMP with the protein of interest in solution, the resulting mixture is filtered through a nitrocellulose protein binding membrane. The amount of labeled c-di-GMP that is retained on the membrane indicates the interaction between the signal and protein. The specificity of c-di-GMP binding can be tested by competing with unlabeled c-di-GMP or other nucleotides such as GTP in the reaction. By examining binding of a fixed protein concentration to increasing concentrations of c-di-GMP, this method is able to determine the dissociation constant of c-di-GMP-protein interaction.
Keywords: Cyclic-di-GMP Ligand binding Affinity Kd Protein c-di-GMP interaction
Materials and Reagents
Purified proteins to be tested
Note: Any kind of buffer can be used to prepare protein samples. We have tested this for sodium phosphate and Tris based buffers.
[α-32P]-GTP (800 Ci/mmol, 10 mCi/ml, 250 µCi) (PerkinElmer, catalog number: BLU006X250UC )
c-di-GMP unlabeled (Axxora)
GTP (Sigma-Aldrich, catalog number: 51120 )
Purified diguanylate cyclase [WspR (R242A mutant), P. aeruginosa (Sambanthamoorthy et al., 2012)]
Antarctic phosphatase (New England Biolabs, catalog number: M0289S )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Bradford reagent for protein concentration estimation (Bio-Rad Laboratories, catalog number: 500-0205 )
Safety-SolveTM complete counting cocktail (RPI, catalog number: 111177 )
Protein purification buffer (see Recipes)
Binding buffer (see Recipes)
Equipment
Nitrocellulose paper (0.2 µm) (Whatman, Optitran®, catalog number: BA-S 83 )
Whatman filter paper (Whatman, catalog number: 3MM )
Radioactive working area containing a centrifuge and heat block
Scintillation vials (20 ml, with Poly screw caps, case of 500) (PerkinElmer, Econo Glass Vial, catalog number: 6000097)
Scintillation counter (Beckman Coulter, model: LS 6500 )
Biorad slot blot (Hybri Dot Manifold) (Bristol Robotics Laboratory, catalog number: 1050MM )
1.5 ml eppendorf tubes
Filter tips
Forceps and scissors
Software
GraphPad Prism 5.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial signaling > Secondary messenger
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,395 | https://bio-protocol.org/exchange/protocoldetail?id=1395&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phosphatase Protection Assay: 14-3-3 Binding Protects the Phosphate group of RSG from λ Protein Phosphatase
Takeshi Ito
YT Yohsuke Takahashi
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1395 Views: 9957
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Aug 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2014
Abstract
14-3-3 proteins regulate diverse cellular processes in eukaryotes by binding to phospho-serine or threonine of target proteins. One of the physiological functions of 14-3-3 is to bind and protect phosphate groups of the target proteins against phosphatases. REPRESSION OF SHOOT GROWTH (RSG) is a tobacco (Nicotiana tabacum) transcription factor that is involved in the feedback regulation of biosynthetic genes of plant hormone gibberellin. 14-3-3 binds to phospho-Ser-114 in RSG. Ca2+-dependent protein kinase NtCDPK1 was identified as a kinase that phosphorylates Ser-114 of RSG. Our recent study revealed that NtCDPK1 forms a heterotrimer with RSG and 14-3-3 and that 14-3-3 was transferred from NtCDPK1 to phosphorylated RSG (Ito et al., 2014). In the course of the study, we found that 14-3-3 protects the phosphate group of RSG from λ protein phosphatase in vitro. Here, we describe a protocol for in vitro phosphatase protection assay. To detect the phosphorylation state of proteins, we used Phos-tag SDS-PAGE and autoradiography. This protocol can be adapted for the examinations whether the phosphoprotein-binding proteins protect the phosphate group of target proteins from phosphatases although protein kinases may be required for the phosphorylation of target proteins.
Keywords: Phosphatase 14-3-3 Phosphorylation Protection Phosphate
Materials and Reagents
20 mM ATP
[γ-32P] ATP (5,000 Ci/mmol, 10 mCi/ml) (Institute of Isotopes, catalog number: SBP-401 ）
λ protein phosphatase (New England Biolabs, catalog number: P0753S )
Amylose resin (New England Biolabs, catalog number: E8021 )
COSMOGEL His-Accept (Nacalai Tesque, catalog number: 08368-12 )
Glutathione Sepharose 4B (GE Healthcare, catalog number: 17-0756-01 )
Phos-tag acrylamide (Wako Pure Chemical Industries, catalog number: 304-93521 )
Wide-view prestained protein size marker III (Wako Pure Chemical Industries, catalog number: 230-02461 )
His.tag monoclonal antibody (Merck Millipore, catalog number: 70796-4CN )
Phenylmethanesulfonyl fluoride (PMSF)
Dialysis buffer (see Recipes)
10x phosphorylation buffer (see Recipes)
Binding buffer (see Recipes)
Dephosphorylation buffer (see Recipes)
2x SDS protein sample buffer (see Recipes)
Equipment
1.5 ml microcentrifuge tubes
Refrigerated microcentrifuge
Microtube rotator
GELoader tips 0.5-20 µl (Eppendorf, catalog number: 0030 001.222 )
Heat block
SDS-PAGE apparatus
Gel transfer apparatus
Power supply
Shaker
Phosphorimager
Chemiluminescence imaging system
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Ito, T. and Takahashi, Y. (2015). Phosphatase Protection Assay: 14-3-3 Binding Protects the Phosphate group of RSG from λ Protein Phosphatase. Bio-protocol 5(3): e1395. DOI: 10.21769/BioProtoc.1395.
Ito, T., Nakata, M., Fukazawa, J., Ishida, S. and Takahashi, Y. (2014). Scaffold function of Ca2+-dependent protein kinase: Tobacco Ca2+-DEPENDENT PROTEIN KINASE1 transfers 14-3-3 to the substrate REPRESSION OF SHOOT GROWTH after phosphorylation. Plant Physiol 165(4): 1737-1750.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Interaction
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,396 | https://bio-protocol.org/exchange/protocoldetail?id=1396&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Anxiety-like Behavior in Crayfish by Using a Sub Aquatic Dark-light Plus Maze
PF Pascal Fossat
JB Julien Bacqué-Cazenave
Jean-Paul Delbecque*
Daniel Cattaert*
*Contributed equally to this work
Published: Vol 5, Iss 3, Feb 5, 2015
DOI: 10.21769/BioProtoc.1396 Views: 11238
Edited by: Arsalan Daudi
Reviewed by: Soyun Kim
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Crayfish are omnivorous freshwater arthropods that naturally explore their environment during day and night, but also frequently hide under a shelter or in a hole in case of danger. They may be submitted to various stressors, including predation, social interactions or changes in environmental parameters (temperature, water quality, oxygen, etc.). It has been recently demonstrated that, as a consequence of stress, crayfish is able to adapt its exploratory behavior by restricting movements to protective areas, a response similar to the anxiety-like behavior (ALB) observed in rodents. To reveal such a behavior in an aquatic species, we designed a plus-shaped sub aquatic maze divided in two protective dark arms and two more aversive illuminated arms. The aim of this paradigm was to place crayfish in a conflicting situation between its innate curiosity for novel environment and its aversion for light (Leo, 2014; Pellow et al., 1985). Unstressed crayfish generally explore the whole maze, including illuminated arms. By contrast stressed crayfish remain preferentially in the dark arms (Fossat et al., 2014). Stressed crayfish injected with anxiolitics (chlordiazepoxide-CDZ), behave as unstressed animals. Several parameters, related to the light arms can be easily measured from video records by commercial software This protocol could be suitable for analyzing the effects of any stressful situation on ALB in crayfish, as well as in many other aquatic species.
Materials and Reagents
Animals
The study has been performed on adult male crayfish, Procambarus clarkii , fished near Bordeaux (France) in the "Réserve naturelle de Bruges" and stored in an animal house with 12:12 dark light cycle. Crayfish were fed ad libitum with pellets (Novo Prawn). Crayfish used for this study were 8.7 ± 0.8 cm and 22.1 ± 1.1 g. We generally used male crayfish in our experiments (distinguished by their first abdominal appendages), but this protocol is also suitable for experiments on females.
Before any experiment, crayfish were isolated in enriched aquariums (75 cm x 40 cm x 50 cm), filled with recycled oxygenated water and enriched with pebbles and plastic tubes (behind or inside which they can hide). Animals were kept isolated at least 3 weeks before any experiment in order to erase past life histories and to avoid social interactions.
Water must be chlorine free (agitating fresh tap water during 24 h is generally enough to remove chlorine). Change water after each session or use a conventional filtering system for aquarium.
Fishnets are used to manipulate crayfish.
Reagents
Ringer: Crayfish were injected with a classical invertebrate ringer containing 195 NaCl, 5 KCl, 13 CaCl2, 2 MgCl2 and 3 HEPES (Sigma-Aldrich) with a pH of 7.65
Chlordiazepoxide hydrochloride (CDZ) (Sigma-Aldrich) (dissolved in crayfish ringer and was used at a dose 15 µg/g)
Equipment
Dark/light (D/L) plus maze
Customized apparatus (65 x 65 cm, see Figure 1) is adapted to the size of adult crayfish. Smaller or larger dimensions might be necessary for young crayfish or other species.
The illuminated arms were made of transparent Plexiglas and dark arms of opaque Plexiglas (Figure 1).
The maze is filled with ca. 7 cm of oxygenated freshwater. It is placed in the center of a larger round tank (Figure 2). The round tank (1.5 m in diameter) is also filled with 7 cm freshwater to equilibrate water pressure on each maze wall and to allow for good oxygenation and recycling of water (Figure 2).
Figure 1. Dark/light plus maze. The total length of the maze is 65 cm x 65 cm. Each arm is 25 cm long and 15 cm wide. The middle zone is 15 cm x 15 cm. The light is generated by four sources comprising two LEDs. Each source of light is placed on the outside face of the opaque Plexiglas.
Figure 2. The dark/light plus maze is placed in a larger tank (diameter 1.5 m). Right: Room light switch on. Left: Room light switch off under experimental conditions.
Illumination of the light arms is performed by a series of LEDs (white light; voltage; 3.5 V, light intensity; 880 to 2,530 mcd) disposed outside the plus maze, on the outward side of the dark arms on the outmost extremities (see Figure 3).
Figure 3. Two LEDs placed at the end of the dark arm illuminate a light arm. The height of the maze wall is 20 cm.
Other devices
A video camera must be placed above the maze. We used a handycam (Sony inc, model: HDR-XR155) but any commercial camera can be used.
A pump (NewJet) is placed on a large tank between experimental sessions to agitate and oxygenate water.
Light intensity was assessed with a luxmeter (Chauvin Arnoux).
Software
We used Ethovision v8 (Noldus) but any tracking software can be used. Measured parameters are listed in Table 1.
Table 1. List of parameters that can be used to analyse the anxiety-like behaviour in the D/L plus maze
Name of variable (and abbreviation used in Figure 2)
Definition
Measurement
Range
Total distance moved (Distance)
Distance moved in the entire arena.
cm
≥0
% Time in zone (%T light, dark)
Time spent in a zone (dark or light)/(divided by total time)*100
%
0-100
Latency to first in light (Lat.Light)
Time from start time to first entry in a light arm
Second (s)
0-600
Latency to first in dark (Lat.Dark)
Time from start time to first entry in a dark arm
Second (s)
0-600
Mean number of entry in light arms (Nb. ent. Dark)
Number of entry from middle zone to a light arm
NA
≥0
Mean number of entry in dark arms (Nb. ent. Light)
Number of entry from middle zone to a dark arm
NA
≥0
Mean duration per visit in light arms
Time in light arms/mean number of entry
Second (s)
≥0
Mean duration per visit in dark arms
Time in dark arms/mean number of entry
Second (s)
≥0
Retreat Ratio (RR)
Number of retreat / total number of attempts
NA
0-1
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Behavioral neuroscience > Learning and memory
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,397 | https://bio-protocol.org/exchange/protocoldetail?id=1397&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Degradation Assays in Arabidopsis Protoplasts
Filip Mituła
Anna Kasprowicz-Maluśki
MM Michał Michalak
MM Małgorzata Marczak
KK Konrad Kuczyński
Agnieszka Ludwików
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1397 Views: 15188
Edited by: Zhaohui Liu
Reviewed by: Cindy Ast
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Plant transformation and exogenous protein expression is essential for molecular biology and biotechnology. Current approaches of stable plant transformation might be problematic and very time-consuming. Because of this, transient expression in protoplasts has become valuable alternative, being less cost and time-effective at the same time. Excellent for eukaryotic proteins, representing a natural cell habitat, protoplast isolation is widely used in protein interaction visualization techniques, like BiFC (Bimolecular fluorescence complementation) and FRET (Förster resonance energy transfer). In this protocol we present a another use of Arabidopsis protoplast in protein degradation assay, proving its high versatility as a tool in proteomics.
Keywords: Degradation assay Transient expression Protoplasts ABA signalling Ethylene biosynthesis
Materials and Reagents
3-week old Arabidopsis plants
Mannitol (BDH Prolabo, catalog number: 25311 )
CaCl2 (POCH, catalog number: M00015143 )
KCl (USB, catalog number: 20598 )
2-(N-morpholino)ethanesulfonic acid (MES) (LabEmpire, catalog number: MES503 )
NaCl (POCH, catalog number: BA4121116 )
Polyethylene glycol (PEG) 4000 (Sigma-Aldrich, catalog number: 81240 )
Cellulase (SERVA Electrophoresis GmbH, catalog number: 16419 )
Macerozyme (SERVA Electrophoresis GmbH, catalog number: 28302 )
GenEluteTM HP Plasmid Midiprep Kit (Sigma-Aldrich, catalog number: PLD35 )
Benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal, Z-Leu-Leu-Leu-al (MG132) (Sigma-Aldrich, catalog number: M7449 )
Dimethyl sulfoxide (DMSO) (Sigma-Aldrich, catalog number: D8418 )
HEPES buffer (Sigma-Aldrich, catalog number: H3375 )
MgCl2 (USB, catalog number: 18641 )
Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: D0632 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Protease inhibitors (Roche Diagnostics, catalog number: 11873580001 )
Enzyme solution (see Recipes)
W5 (see Recipes)
W1 (see Recipes)
MMg (see Recipes)
40% PEG (see Recipes)
Protein isolation buffer (see Recipes)
Equipment
Light microscope (Nikon Corporation)
Hemocythometer (Sigma-Aldrich)
Tape (Scotch® MagicTM)
Stainless steel forceps (Sigma-Aldrich)
Scissors
10 ml pipette
50 ml tubes
90 mm Petri dishes
Amicon Ultra-15 centrifugal filter unit (Millipore)
NanoDrop spectrophotometer
Tabletop centrifuge
Horizontal shaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Mituła, F., Kasprowicz-Maluśki, A., Michalak, M., Marczak, M., Kuczyński, K. and Ludwików, A. (2015). Protein Degradation Assays in Arabidopsis Protoplasts. Bio-protocol 5(4): e1397. DOI: 10.21769/BioProtoc.1397.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell isolation
Plant Science > Plant molecular biology > Protein
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,398 | https://bio-protocol.org/exchange/protocoldetail?id=1398&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Synaptosomes from the Motor Cortex of Motor Skill Trained Mice
Anand Suresh
Anna Dunaevsky
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1398 Views: 13864
Edited by: Soyun Kim
Reviewed by: Masahiro MoritaPamela Maher
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Learning and memory are thought to occur due to changes in synaptic strength. Strengthening of synapses due to Long Term Potentiation mechanisms are mediated by increases in synaptic α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPAR) levels. Here we describe a protocol to isolate and quantify synaptic AMPAR subunit GluA1 levels from the motor cortex of mice which have undergone motor skill training.
Keywords: Synaptosome Motor cortex Slices
Materials and Reagents
C57BL6 mouse (Mus musculus)
Isoflurane (Isothesia) (Butler animal supplies)
Sodium chloride (NaCl) (Thermo Fisher Scientific, catalog number: S-271 )
Potassium chloride (KCl) (Thermo Fisher Scientific, catalog number: P217-500 )
Sodium bicarbonate (NaHCO3) (Thermo Fisher Scientific, catalog number: S233-500 )
Monosodium phosphate (NaH2PO4) (Thermo Fisher Scientific, catalog number: S369-500 )
Magnesium sulphate heptahydrate (MgSO4.7H2O) (Thermo Fisher Scientific, catalog number: MG63-500 )
Calcium chloride (CaCl2) (Thermo Fisher Scientific, catalog number: C79-500 )
Dextrose (Thermo Fisher Scientific, catalog number: D16-500 )
Sucrose (Thermo Fisher Scientific, catalog number: S5-3 )
Radio immunoprecipitation assay (RIPA) lysis buffer (see Recipes)
Roche complete protease inhibitor cocktail pellets (Roche Diagnostics, catalog number: 11697498 001 )
Protease inhibitor (Sigma-Aldrich, catalog number: p8340 )
Phosphatase inhibitor (Sigma-Aldrich, catalog number: 3 p0044 )
Krazy glue
Millipore anti GluA1 antibody(Millipore, catalog number: ab1504 )
Cell signaling anti-rabbit HRP antibody (Cell Signaling Technology, catalog number: 7074S )
Agar powder (Alfa Aesar, catalog number: A10752 )
Artificial cerebrospinal fluid (ASCF) (see Recipes)
High magnesium ACSF (see Recipes)
Agar block (see Recipes)
Sucrose media (see Recipes)
Equipment
Leica vibratome S1000
Scissors (one large and one small)
Forceps
Sharp blade
Vibratome injector blade (Leica)
1.5 ml Eppendorf tube
Pellet pestle motor hand held homogenizer (Kontes, catalog number: 749540-0000 )
4 ºC table top centrifuge
Ruler
Aerobic air mixture (Lindweld Alloy, model: MAA140 )
Square petri dish with Grid (Thermo Fisher Scientific, catalog number: FB0875711A )
Sonicator (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,399 | https://bio-protocol.org/exchange/protocoldetail?id=1399&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phenol-based Total Protein Extraction from Lily Plant Tissues
YC Yun-Chu Chen
YH Yu-Chun Hsiao
CW Co-Shine Wang
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1399 Views: 10982
Edited by: Arsalan Daudi
Reviewed by: Pablo Bolanos-Villegas
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The phenol-based total protein extraction method is unique in that water-soluble components such as polyphenolic compounds and nucleic acids can be easily removed. Thus, total protein is free from contaminants and allows for high quality two–dimensional gel electrophoresis. The phenol-based extraction of total protein was used in various lily organs and may likely apply to other plants whose content of polyphenolics is high (Note 1). An additional advantage of this extraction method is that nucleic acids can be easily removed and thus, avoid adverse effects of nucleic acids on protein resolution in the gel. This method is modified from that of Hurkman and Tanaka (1986).
Keywords: Protein extratction Phenol Plant
Materials and Reagents
Sucrose (United States Biological, catalog number: 21938 )
Tris base (United States Biological, catalog number: 75825 )
HCl (fuming, at 37%) (Merck KGaA, catalog number: 100317 )
EDTA (United States Biological, catalog number: 15699 )
KCl (SERVA, catalog number: 26868 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
Phenol (Merck KGaA, catalog number: 100206 )
NH4OAc (Merck KGaA, catalog number: 101116 )
100% MeOH (J.T. Baker®, catalog number: 9093-03 )
Urea (United States Biological, catalog number: 75826 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
K2CO3 (Merck KGaA, catalog number: 106683 )
L-lysine (Sigma-Aldrich, catalog number: L5501 )
DTT (Merck KGaA, catalog number: 111474 )
Extraction buffer (see Recipes)
Dissolving buffer (see Recipes)
0.1 M NH4OAc in 100% MeOH (see Recipes)
Equipment
Ceramic mortar and pestles
Beaker
Stir bar
Centrifuge (Eppendorf, model: 5424 )
AVANTI® J-26 XP High-Performance centrifuge with a JA 25.50 fixed-angle rotor (Beckman Coulter)
COREX® tube,DuPont Instruments (catalog number: 00152 )
1.5 ml Eppendorf tubes
Fume hood
Speed vacuum (Savant Systems LLC, model: SC110 )
Mixer (Vortex Genie 2, Scientific Industries, Inc.)
Stirrer (Corning)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y., Hsiao, Y. and Wang, C. (2015). Phenol-based Total Protein Extraction from Lily Plant Tissues. Bio-protocol 5(4): e1399. DOI: 10.21769/BioProtoc.1399.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant physiology > Tissue analysis
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
14 | https://bio-protocol.org/exchange/protocoldetail?id=14&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Whole Cell Lysis of Yeast
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.14 Views: 42777
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol describes how to perform lysis on whole yeast cell samples using NaOH. The lysed cells can then be used for downstream applications such as the extraction of total proteins.
Materials and Reagents
NaOH (Sigma-Aldrich)
Beta-mercaptoethanol (beta-ME) (Sigma-Aldrich)
100% (w/v) trichloroacetic acid (TCA) (Sigma-Aldrich)
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
PMSF (Sigma-Aldrich, catalog number: P7626 )
Acetone (Sigma-Aldrich)
Protease inhibitors
DMSO
Glycerol
BPB
Ethanol
SDS lysis buffer
7.5 ml 1 M Tris-HCl (pH 6.8) (see Recipes)
DTT stock (see Recipes)
5x SDS-PAGE gel loading dye (see Recipes)
Protease inhibitors (see Recipes)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Editor, B. (2011). Protocol for Whole Cell Lysis of Yeast. Bio-101: e14. DOI: 10.21769/BioProtoc.14.
Download Citation in RIS Format
Category
Biochemistry > Protein > Electrophoresis
Cell Biology > Cell viability > Cell lysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,400 | https://bio-protocol.org/exchange/protocoldetail?id=1400&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Separation of Microspores from Anthers of Lilium longiflorum (Lily) and Subsequent RNA Extraction
ML Ming-Che Liu
YC Yun-Chu Chen
CW Co-Shine Wang
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1400 Views: 9742
Edited by: Arsalan Daudi
Reviewed by: Pablo Bolanos-Villegas
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
This protocol has been designed in order to facilitate the isolation and extraction of total RNA from microspores collected from lily anther sacs. This protocol allows the extraction of high amounts of high quality RNA, as observed in agarose gels.
Keywords: Microspore separation RNA extraction Lily plant
Materials and Reagents
Young anthers (at the microspore stage of lily buds normally from 30 to 65 mm of bud length)
Lithium chloride (LiCl) (Merck KGaA, catalog number: 105679 )
Tris-base (United States Biological, catalog number: 75825 )
Ethylenediaminetetraacetic acid (EDTA) (United States Biological, catalog number: 15699 )
Sodium dodecyl sulfate (SDS) (AppliChem, catalog number: A2263 )
Isoamylalcohol (J.T. Baker®, catalog number: JT9038-1 )
Phenol (pH 4.0) (United States Biological, catalog number: 77510 )
Chloroform (Merck KGaA, catalog number: 102445 )
Deionized distilled water (ddH2O)
Diethylpyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758 )
Sodium acetate (NaOAc) (Sigma-Aldrich, catalog number: S2889 )
Isopropanol (Merck KGaA, catalog number: 107022 )
75% ethanol (analytical grade)
Liquid nitrogen
0.1% DEPC ddH2O (RNase-free water) (see Recipes)
Extraction buffer (see Recipes)
3 M sodium acetate (see Recipes)
10 mM sodium acetate buffer (see Recipes)
4 M LiCl (see Recipes)
75% ethanol (see Recipes)
Equipment
Scalpel
Tweezers (stainless, length: 11.5 cm; tip: 0.1 mm)
Ceramic mortar and pestle
1.5 ml Eppendorf
Centrifuge (Eppendorf, model: 5424 )
Fume hood
Speed vacuum (Savant Systems LLC, model: SC110 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, M., Chen, Y. and Wang, C. (2015). Separation of Microspores from Anthers of Lilium longiflorum (Lily) and Subsequent RNA Extraction. Bio-protocol 5(4): e1400. DOI: 10.21769/BioProtoc.1400.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > RNA
Plant Science > Plant physiology > Tissue analysis
Molecular Biology > RNA > RNA extraction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,401 | https://bio-protocol.org/exchange/protocoldetail?id=1401&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Chitin Binding Assay
Geneviève Ball
Frédéric Cadoret
Romé Voulhoux
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1401 Views: 12027
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Chitin is polymer of N-acetylglucosamine (GlcNAc) found in the exoskeleton of arthropods and the fungal cell wall. GlcNAc is also implicated in bacterial development, adherence, and signal transduction but can also be used as a carbon source. In vitro chitin binding assay is performed to determine the affinity of a purified protein to the chitin molecule. The principle is based on the co-sedimentation of chitin-binding proteins together with chitin-coated beads.
Keywords: Chitin N acetylglucosamine Chitin beads Co-purification Affinity
Materials and Reagents
Purified protein with chitin binding affinity
Note: We used histidine-tagged chitin binding protein CbpD. The protein was purified by affinity chromatography onto a 5-ml HisTrap nickel column (Pharmacia) on an Äkta system (Amersham Biosciences). The complete purification protocol is described in details in Cadoret et al. (2014).
Chitin beads (New England Biolabs, catalog number: S6651 )
Tris Base
EDTA
NaCl
Tween 100
Freshly made solution of chitin binding buffer (see Recipes)
Equipment
Laboratory vortex adapted to Eppendorf tubes
Laboratory rotating wheel adapted to Eppendorf tubes
Cold room or refrigerated incubator (4 °C)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ball, G., Cadoret, F. and Voulhoux, R. (2015). In vitro Chitin Binding Assay. Bio-protocol 5(4): e1401. DOI: 10.21769/BioProtoc.1401.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Polysaccharide
Biochemistry > Protein > Interaction
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,402 | https://bio-protocol.org/exchange/protocoldetail?id=1402&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Protein-DNA (ZMYND11-DNA) Interaction by a Label-Free Biolayer Interferometry Assay
YL Yuan-Yuan Li
HW Hong Wen
XS Xiao-Bing Shi
Hai-Tao Li
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1402 Views: 12622
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
This protocol describes a robust technique for the measurement of ZMYND11-DNA interaction by a label-free Biolayer Interferometry (BLI). ZMYND11 is a novel histone reader protein that specifically recognizes H3.3K36me3 via its tandem Bromodomain, zinc-finger and PWWP domain (BP). ZMYND11 links the histone-variant-mediated transcription elongation control to tumour suppression and may therefore represent a novel class of drug targets. Like other PWWP domains, ZMYND11 PWWP domain shows highly positively charged surface and interacts with DNA. Previously reported methods include NMR, FP or EMSA. Biolayer interferometry (BLI) is an emerging technology for analyzing all kinds of biomolecular interactions, such as protein-protein and protein-DNA binding. BLI allows for the real time monitoring of the interactions between biomolecules without the need for reagents with enzymatic, fluorescent, or radioactive labels. The technology is based upon the changes in interference pattern of light reflected from the surface of an optical fiber when materials bind to the tip of the fiber. The technique represents an alternative to technologies such as surface plasmon resonance, providing a simple platform that enables label-free monitoring of biomolecular interactions without the use of flow cells. Label-free biosensor methods provide information on binding, kinetics, concentration, and the affinity of an interaction.
Keywords: Biolayer interferometry Protein-DNA interaction Label free Epigenetic regulation PWWP domain
Materials and Reagents
Purified proteins of interest untagged or with tags such as GST, Flag, Biotin or His tag, depending on which kind of sensor to use (refer to manufacturer’s manual)
Note: Here GST-tagged ZMYND11-BP protein is used (Wen et al., 2014).
Two complementary single stranded DNA (Life Technologies, InvitrogenTM)
MilliQ water
10 mM glycine (pH 1.0~2.0)
BLI binding buffer (see Recipes)
DNA solutions (see Recipes)
Equipment
Anti-GST antibody-coated biosensor tray (Pall Corporation, catalog number: 18-5096 )
96-well black microtiter plate (Greiner Bio-One, catalog number: 655209 )
1.5 ml Eppendorf microfuge tubes (Axygen, catalog number: MCT150C )
Octet RED96 (fortebio) (Pall Corporation, catalog number: 30-5048) (Wen et al., 2014)
Software
Octet Data analysis 7.0
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, Y., Wen, H., Shi, X. and Li, H. (2015). Determination of Protein-DNA (ZMYND11-DNA) Interaction by a Label-Free Biolayer Interferometry Assay. Bio-protocol 5(4): e1402. DOI: 10.21769/BioProtoc.1402.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Molecular Biology > DNA > DNA-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,403 | https://bio-protocol.org/exchange/protocoldetail?id=1403&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Lung Infiltrating Cell in Mice
EA Eduardo P. Amaral
EL Elena B. Lassunskaia
MD Maria Regina D’Império-Lima
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1403 Views: 18953
Edited by: Fanglian He
Reviewed by: Lee-Hwa TaiKanika Gera
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Inflammatory lung diseases induce strong leukocyte recruitment into the organ, culminating in pneumonia area formation. Here, we describe the protocol for isolation of lung infiltrating cells. Using this assay, we analyzed the lung cell phenotyping by flow cytometry and spontaneous cytokine production by cultivating lung cells ex vivo (Amaral et al., 2014).
Keywords: Tuberculosis Inflammation Lung cells Isolation Single cell
Materials and Reagents
Mice
Collagenase Type IV (0.5 mg/ml) (Sigma-Aldrich, catalog number: C5138 ) or Liberase Blendzyme 2 (2 μg/ml) (Roche Diagnostics, catalog number: 1988433 )
RPMI 1640 (Life Technologies, catalog number: 11875-093 )
Gentamicin (10 μg/ml) (Life Technologies, catalog number: 15750-102 )
Type IV DNase I from bovine pancreas (25 units/ml) (Sigma-Aldrich, catalog number: D5025 ) or DNase I from bovine pancreas (25 units/ml) (Roche Diagnostics, catalog number: 11284932001 )
Fetal bovine serum heat inactivated (Life Technologies, catalog number: 10437-028 )
Red cells lysing buffer (see Recipes)
1x phosphate buffered saline (PBS) (see Recipes)
2x digestion medium (see Recipes)
Equipment
Syringes (BD Biosciences, catalog number: 301604 )
Centrifuge 5810 (Eppendorf)
18-gauge needle (BD Biosciences, catalog number: 305180 )
Cell strainer (100-μm pore size) (Corning, catalog number: 352360 )
Sterile culture hood
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Amaral, E. P., Lassunskaia, E. B. and D’Império-Lima, M. R. (2015). Isolation of Lung Infiltrating Cell in Mice . Bio-protocol 5(4): e1403. DOI: 10.21769/BioProtoc.1403.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Immunology > Immune cell isolation > Macrophage
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,404 | https://bio-protocol.org/exchange/protocoldetail?id=1404&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transmission Electron Microscopy for Tobacco Chloroplast Ultrastructure
Lina Yin
SW Shiwen Wang
NS Norihiro Shimomura
KT Kiyoshi Tanaka
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1404 Views: 10500
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The chloroplast is the site of photosynthesis that enabled and sustains aerobic life on Earth. Chloroplasts are relatively large organelles with a diameter of ~5 μm and width of ~2.5 μm, and so can be readily analysed by electron microscopy. Each chloroplast is enclosed by two envelope membranes, which encompass an aqueous matrix, the stroma and the thylakoids. Components of stroma include starch granules and plastoglobuli, which can be observed by electron microscopy. And the thylakoids consist of stromal thylakoid, granal thylakoid and as well as granum (a stack of thylakoids). These structure components are quite sensitive to developmental changes and environmental variations, such as drought, salinity, cold, high temperature and others. Transmission electron microscopy (TEM) is a powerful technique for monitoring the effects of various changing parameters or treatments on the development and differentiation of these important organelles. Here we describe a reliable method for the analysis of plastid ultrastructure in tobacco plant by TEM.
Keywords: Chloroplast Ultrastructure Tobacco
Materials and Reagents
Tobacco (Nicotiana tabacum) plants (about 6-week grew on MS agar plates, 3-week grew in 1/4 Hoagland solution, and 2~3 weeks grew on soil)
Glutaraldehyde (Wako Pure Chemical Industries, catalog number: 071-01931 )
Osmium tetroxide (Nisshin EM Corporation, catalog number: 300 )
Ethanol (Wako Pure Chemical Industries, catalog number: 057-00456 )
Propylene oxide (Wako Pure Chemical Industries, catalog number: 165-05026 )
Quetol 812 set (Nisshin EM Corporation, catalog number: 340 )
Uranyl acetate (Wako Pure Chemical Industries, catalog number: 6159-44-0 )
3% (w/v) lead citrate (Wako Pure Chemical Industries, catalog number: 121-01722 )
Dodecenyl succinic anhydride (DDSA)
Methyl nadic anhydride (MNA)
DMP
0.1 M phosphate buffered saline (see Recipes)
1% osmium tetroxide (see Recipes)
Quetol-821 resin (see Recipes)
Hoagland solution (see Recipes)
Equipment
Razor blade
Lens tissue
Scissors
Tweezers
Needle and thread
Glass tube
Vacuum equipment
Balance
Petri dish
Oven at 60 °C
Plastic flat embedding mold (catalog number: 70900 )
Beaker
Ultramicrotome (RMC, model: MT-7000 )
Copper grid
Transmission electron microscope (JEOL, model: JEM-100CX II )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yin, L., Wang, S., Shimomura, N. and Tanaka, K. (2015). Transmission Electron Microscopy for Tobacco Chloroplast Ultrastructure. Bio-protocol 5(4): e1404. DOI: 10.21769/BioProtoc.1404.
Wang, S., Uddin, M. I., Tanaka, K., Yin, L., Shi, Z., Qi, Y., Mano, J., Matsui, K., Shimomura, N., Sakaki, T., Deng, X. and Zhang, S. (2014). Maintenance of chloroplast structure and function by overexpression of the rice MONOGALACTOSYLDIACYLGLYCEROL SYNTHASE gene leads to enhanced salt tolerance in tobacco. Plant Physiol 165(3): 1144-1155.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Photosynthesis
Plant Science > Plant cell biology > Cell structure
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,405 | https://bio-protocol.org/exchange/protocoldetail?id=1405&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Chloroplast Inner and Outer Envelope Membranes
SW Shiwen Wang
Lina Yin
JM Jun’ichi Mano
KT Kiyoshi Tanaka
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1405 Views: 13743
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The chloroplast is an important organelle found in plant cells that conduct photosynthesis. It is enclosed by a pair of closely spaced membranes, the double-membrane envelope, consisting of the inner membrane bounding the matrix or stroma and the outer membrane in contact with the cytoplasm. Like many bio-membranes, the chloroplast envelope plays an important role in mediating the complex interactions between the chloroplast and the cytoplasm. The envelope is also the site of various biosynthetic reactions, including the formation of the galactolipids, which are the major components of both envelope and the thylakoid membranes. The inner and outer envelope membranes have differences in both structure and function. For example, the outer membrane exhibits lower density of intramembranous particles than the inner membrane dose, suggesting that the protein content of the outer membrane is low. Also, the outer membrane is nonspecifically permeable to low molecular weight compounds, whereas the inner is impermeable to such compounds and contains several translocator systems for the transport of metabolites.
To prepare the envelope membranes, it is necessary to isolate intact chloroplasts first. Then the inner and outer envelope membranes are separated by: 1) the protease-treatment method and 2) the centrifuge method which based on the fact that the outer envelope is lighter and the inner membrane heavier. Both methods need to isolate the intact chloroplasts firstly. However, the centrifugal separation can get the pure inner and outer envelope preparations, which therefore are suitable to the subsequent analyses. Also, the centrifuge method can avoid the destruction of inner envelope polypeptides during the protease treatment, because some of the protease may gain access to the inner membrane. Moreover, the centrifuge method is easy to operate and to get the complete enveloped that contain less of the adhesion regions of the outer and inner envelope membranes. Here we describe a reliable method for isolation of the inner and outer envelope membranes of the chloroplasts from tobacco, which is the plant that relatively not easy to use for envelope isolation.
Keywords: Chloroplast envelope Chloroplast membrane Tobacco
Materials and Reagents
6-week old tobacco (Nicotiana tabacum) plants (3-week after sowing, the seedlings were transplanted and grew for another 3 weeks)
2-(N-morpholino) ethanesulfonic acid monohydrate (MES) (Dojindo Molecular Technologies, catalog number: 345-01625 )
2-[4-(2-hydroxyethyl)-1-piperazinyl] ethanesulfonic acid (HEPES) (Dojindo Molecular Technologies, catalog number: 342-01375 )
Sobitol (Wako Pure Chemical Industries, catalog number: 191-14735 )
di-sodium dihydrogen ethylenediaminetetraacetate dihydrate (EDTA-2Na) (Nacalai tesque, catalog number: 15111-45 )
Manganese chloride tetrahydrate (MnCl2.4H2O) (Nacalai tesque, catalog number: 13446-34-9 )
Magnesium chloride hexahydrate (MgCl2.6H2O) (Nacalai tesque, catalog number: 7791-18-6 )
Sodium hydroxide (Nacalai tesque, catalog number: 1310-73-2 )
Sodium chloride (Nacalai tesque, catalog number: 7647-14-5 )
Isoascorbic acid (Nacalai tesque, catalog number: 89-65-6 )
Polyvinylpyrrolidone (Sigma-Aldrich, catalog number: PVP40 )
Percoll (GE Healthecare, catalog number: 17-0891-01 )
Pyrophosphate aci (Wako Pure Chemical Industries, catalog number: 163-05485 )
Glutathione (Wako Pure Chemical Industries, catalog number: 071-02014 )
Tricine (Nacalai Tesque, catalog number: 5704-04-1 )
Sucrose (Nacalai tesque, catalog number: 57-50-1 )
Acetone (Wako Pure Chemical Industries, catalog number: 016-00346 )
Extraction buffer for homogenization (see Recipes)
Gradient buffer (see Recipes)
TE buffer (see Recipes)
40% (v/v) Percoll in gradient buffer (see Recipes)
90% (v/v) Percoll in gradient buffer (see Recipes)
0.2 M, 0.6 M and 1.2 M sucrose in TE buffer (see Recipes)
Linear gradient of 0.6~1.2 M sucrose-TE buffer (see Recipes)
Equipment
Juicer mixer (TESCOM, model: TM837 )
Scissors
pH meter (Horiba, model: F-71S )
Refrigerator 4 °C and -20 °C
Funnel
Centrifuge tube (250 ml, 50 ml, and 10 ml for ultracentrifuge)
Miracloth (Calbiochem, catalog number: 475855 ) and/or gauze
Paint brush with soft hair
Pasteur pipet
Spectrophotometer (Shimadzu, model: MPS2000 )
Density gradient device (round type, inner diameter: 10 mm, total volume: 10~15 ml) (Sanplateccorp)
Magnetic stirrer (Pasolina, model: TR-300 )
Super centrifuge (Hitachi, model: CR20F )
Ultracentrifuge (Hitachi, model: CP 70MX )
Syringe (1 ml volumn)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Wang, S., Yin, L., Mano, J. and Tanaka, K. (2015). Isolation of Chloroplast Inner and Outer Envelope Membranes. Bio-protocol 5(4): e1405. DOI: 10.21769/BioProtoc.1405.
Wang, S., Uddin, M. I., Tanaka, K., Yin, L., Shi, Z., Qi, Y., Mano, J., Matsui, K., Shimomura, N., Sakaki, T., Deng, X. and Zhang, S. (2014). Maintenance of chloroplast structure and function by overexpression of the rice MONOGALACTOSYLDIACYLGLYCEROL SYNTHASE gene leads to enhanced salt tolerance in tobacco. Plant Physiol 165(3): 1144-1155.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Photosynthesis
Plant Science > Plant cell biology > Organelle isolation
Cell Biology > Organelle isolation > Chloroplast
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,406 | https://bio-protocol.org/exchange/protocoldetail?id=1406&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Macrophage Phagocytosis Assay of Staphylococcus aureus by Flow Cytometry
QY Qin Yan
SA Sun Hee Ahn
VJ Vance G. Fowler Jr
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1406 Views: 14842
Edited by: Fanglian He
Reviewed by: Alka Mehra
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
This protocol describes a straightforward technique to evaluate the phagocytotic capacity of murine macrophages for Staphylococcus aureus (S. aureus). By staining S. aureus with Hexidium Iodide and staining murine bone marrow-derived macrophages (BMDMs) with FITC, the macrophage bacterial up-taking ability can be rapidly analyzed by flow cytometry. S. aureus is a Gram-positive bacteria causing severe human and animal infections. Host immune cells such as macrophages serve to eliminate S. aureus by phagocytosing the pathogen and save the host from life-threatening diseases. Study of host macrophage ability to phagocytose S. aureus is important for understanding the host-pathogen interaction and can help to elucidate the pathogenesis of S. aureus infection. This protocol may also be applied for macrophage phagocytotic assay of other gram-positive bacteria.
Materials and Reagents
Cell line-L929 (ATCC, catalog number: CCL-1 )
Staphylococcus aureus strain-Sanger 476 (Wellcome Trust Sanger Institute, catalog number: MSSA476 )
Dulbecco’s Modified Eagle’s Medium (DMEM) (Life Technologies, Gibco®, catalog number: 11965-092 )
L-Glutamine (Life Technologies, Gibco®, catalog number: 25030-081 )
Penicillin-Streptomycin (Life Technologies, Gibco®, catalog number: 15140-148 )
Fetal bovine serum (Hyclone, catalog number: SH30070.03 )
DPBS (Life Technologies, Gibco®, catalog number: 14190 )
EDTA (Sigma-Aldrich, catalog number: E6758 )
Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 25200-056 )
ACK lysis buffer (Life Technologies, Gibco®, catalog number: A10492-01 )
Tissue-culture water (Hyclone, catalog number: SH3052902 )
Tryptic Soy Broth powder (TSB) (BD, catalog number: 211768 )
Hexidium Iodide (Life Technologies, InvitrogenTM, catalog number: H7593 )
FITC-anti-mouse-F4/80 (BioLegend, catalog number: 123107 )
DMEM complete media with 10% FBS (D10) (see Recipes)
Supernatant of L-cell cultural media (L-sup) (see Recipes)
Bone marrow macrophage medium (BMM medium) (see Recipes)
500 mM-EDTA (see Recipes)
5 mM-EDTA (see Recipes)
TSB (see Recipes)
Hexidium Iodide stock (see Recipes)
Equipment
26G needle (Sigma-Aldrich, catalog number: Z192392-100 EA)
Syringe (Terumo Medical Corporation, catalog number: SS-30L )
Cell culture dish (Corning, catalog number: 430293 )
6-Well Plate (Falcon, catalog number: 351146 )
75 cm flask (Corning, catalog number: 430641 )
Vacuum filtration system (Corning, catalog number: 430758 )
50 ml Corning tube (Corning, catalog number: 430290 )
5 ml flow cytometry tube (BD, catalog number: 352054 )
Bacterial incubator shaker
CO2 incubator
Sorvall RT7 centrifuge
Flow cytometer (FACSCanto)
Software
FlowJo
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > Macrophage
Microbiology > Microbe-host interactions > Bacterium
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,407 | https://bio-protocol.org/exchange/protocoldetail?id=1407&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Whole Genome Bisulfite Sequencing and DNA Methylation Analysis from Plant Tissue
Daniela Pignatta
GB George W. Bell
MG Mary Gehring
Published: Vol 5, Iss 4, Feb 20, 2015
DOI: 10.21769/BioProtoc.1407 Views: 19662
Edited by: Tie Liu
Reviewed by: Emily Cope
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
This protocol describes whole genome bisulfite-sequencing library preparation from plant tissue and subsequent data analysis. Allele-specific methylation analysis and genome-wide identification of differentially methylated regions are additional features of the analysis procedure.
Part I. Whole genome bisulfite sequencing library preparation
Materials and Reagents
RNAse-treated DNA (at least 1 µg, volume should not exceed 130 µl)
AMPure XP beads (Beckman Coulter, catalog number: A63880 )
200 proof Ethyl alcohol (Sigma-Aldrich, catalog number: 459844-500ML )
Illumina TruSeq kit (Illumina, catalog number: FC-121-2001 )
Methylcode Invitrogen kit (Life Technologies, InvitrogenTM, catalog number: MECOV50 )
Note: Other bisulfite conversion kits can be used, but were not tested in this protocol.
T4 DNA ligase (NEB, catalog number: M0202T )
Pfu Cx Hotstart DNA polymerase (Agilent, catalog number: 600412 )
TOPO Blunt cloning kit (Life Technologies, InvitrogenTM, catalog number: 450245 )
TOPO TA cloning kit (Life Technologies, InvitrogenTM, catalog number: 450030 )
Ex Taq DNA polymerase (TaKaRa, Clontech, catalog number: RR001B )
1 Kb-plus DNA ladder (Life Technologies, InvitrogenTM, catalog number: 10787-018 )
Agarose
1x TAE buffer (see Recipes)
Equipment
Agarose gel electrophoresis apparatus
Covaris microTUBE prep station (Covaris, part number: 500142 )
Covaris microTUBE AFA Fiber Pre-Slit Snap-Cap (6 x 16 mm) (Covaris, part number: 520045 )
Low-retention 1.5 ml tubes (Thermo Fisher Scientific, catalog number: 02-681-320 )
TempAssure PCR 8-Strips (USA Scientific, catalog number: 1402-4700 )
Magnetic stand for 1.5 ml tubes (DynaMagTM-2 magnet, Life Technologies, InvitrogenTM, catalog number: 12321D )
Focused-ultrasonicator (Covaris, S-Series, model: S220 )
Microcentrifuge (VWR International, catalog number: 93000-204 )
Thermocycler
Procedure
Prepare reagents before starting
Make fresh 80% ethanol.
Tip: It is important to use fresh 80% ethanol for Ampure bead purification.
Shake the Agencourt AMPure XP bottle to resuspend beads. 180 µl of beads will be needed per sample (ratio of 1.4:1 beads to DNA). Keep at room temperature.
Shear DNA with Covaris sonicator
Fill tank with deionized water to 12.5 on the graduate fill line label.
Turn on the machine, the chiller (set temperature at +3 °C), and the computer.
Launch the application software (Covaris SonoLab 7). Push the degas button. Degas the instrument for at least 30 min before use.
Settings: Peak power 175 W, duty factor 10, cycles/burst 200, time 6 min, temperature 6 °C. Note that the temperature rises while the machine is in use, which could interfere with the shearing cycle. Thus, the machine is initially set to 3 °C as a precaution.
Transfer 130 µl of DNA sample (~10 ng/µl) into the Covaris microTUBE, spin down briefly and proceed with shearing.
Run 1.2% gel with sheared DNA (250 ng) and un-sheared DNA side by side to evaluate shearing. Samples can also be run on a Bioanalyzer. Expected size range is 100-300 bp. See representative data Figure 1.
DNA purification (AMPure beads)
Refer to Agencourt AMPure XP PCR Purification - Instructions For Use (B37419AA)
(https://www.beckmancoulter.com/wsrportal/techdocs?docname=B37419AA).
Place the tube into Covaris microTUBE Prep Station and remove the cap. Transfer the 130 µl of sample to a low-DNA binding microfuge tube. Add 180 µl of resuspended beads and mix well by pipetting.
Incubate for 5 min at room temperature.
Place the tube onto the magnetic stand for 2 min to separate beads from the solution.
Aspirate the cleared solution from the tube and discard. Do not disturb the beads.
Dispense 250 μl of 80% ethanol to the tube and incubate for 30 sec at room temperature.
Aspirate the ethanol and discard. Repeat for a total of two washes.
Let the beads air dry for 5 min.
Tip: Be careful not to over-dry the beads (bead pellet appears cracked if over-dried) as this will significantly decrease elution efficiency.
Remove the microfuge tube from the magnetic stand. Add 52 μl of water to the beads and resuspend the beads by pipetting 10 times. Incubate for 2 min at room temperature.
Place the tube back on the magnetic stand. Transfer 50 µl of the clear supernatant to a new PCR tube without disturbing the beads.
End Repair of the purified sheared DNA (Illumina TruSeq kit)
Preheat thermocycler to 30 °C.
Add 10 µl of Resuspension Buffer and 40 µl End Repair Mix to the sheared DNA from step C9.
Adjust pipette to 50 µl then gently pipette the entire volume up and down 10 times.
Incubate for 30 min at 30 °C.
DNA Purification (AMPure beads)
Vortex the AMPure beads until they are well dispersed.
Prepare a diluted bead mixture by combining 125 µl beads with 35 µl of PCR grade water.
Add the entire volume from step D4 (100 µl) to 160 µl of the diluted beads.
Adjust pipette to 200 µl then gently pipette the entire volume up and down 10 times.
Incubate at RT for 10 min.
Place the tube on the magnetic stand for 5 min.
Remove and discard the supernatant from each tube without disturbing the beads.
With the tube on the magnetic stand, add 200 µl of freshly prepared 80% ethanol without disturbing the beads. Incubate 30 sec.
Remove and discard all the supernatant from each tube without disturbing the beads. Repeat ethanol wash once.
Let the tube stand at RT to dry for 5-8 min. Remove the tube from the stand and resuspend the dried pellet with 17.5 µl Resuspension Buffer from the Illumina TruSeq kit. Gently pipette the entire volume up and down 10 times to mix thoroughly.
Incubate the tube at RT for 2 min.
Place the tube on the magnetic stand at RT for 3 min.
Transfer 15 µl of the clear supernatant to a new PCR tube without disturbing the beads.
SAFE STOPPING POINT DNA can be stored at -20 °C for up to 7 days.
Adenylate 3’ Ends (Illumina TruSeq kit)
Remove the A tailing mix from -20 °C and thaw at RT.
Preheat thermal cycler at 37 °C.
Add 2.5 µl of Resuspension buffer and 12.5 µl of A tailing mix to the tube from step E13.
Adjust pipette to 30 µl, then gently pipette the entire volume up and down 10 times.
Incubate at 37 °C for 30 min.
Immediately proceed to adapter ligation.
Ligate Adapters (Illumina TruSeq kit)
Illumina TruSeq DNA adapters, which contain 5-methylcytosines instead of cytosines, are ligated in a 50 μl reaction.
Remove the Adapter Index tubes from -20 °C and thaw at RT.
Combine sample and reagents as indicated.
DNA sample (from step F6)
30 µl
Adapters
2.5 µl
T4 DNA Ligase (2,000,000 U/ml)
2.5 µl
10x T4 Ligase buffer with ATP
5 µl
Water
10 µl
Incubate overnight at 16 °C.
DNA Purification (AMPure beads)
Vortex the AMPure beads until they are well dispersed.
Add 42.5 µl of the beads to the sample.
Adjust pipette to 85 µl then gently pipette the entire volume up and down 10 times.
Incubate at RT for 10 min.
Place the tube on the magnetic stand for 5 min.
Remove and discard 80 µl of supernatant from each tube.
With the tube on the magnetic stand, add 200 µl of freshly prepared 80% ethanol without disturbing the beads. Incubate 30 sec.
Remove and discard all the supernatant from each tube without disturbing the beads. Repeat ethanol wash once.
Let the tube stand at RT to dry for 8 min. Remove the tube from the stand and resuspend the dried pellet with 22.5 µl Resuspension Buffer. Gently pipette the entire volume up and down 10 times to mix thoroughly. Incubate at RT for 2 min.
Place the tube on the magnetic stand at RT for 5 min.
Transfer 20 of µl of the clear supernatant to new tube without disturbing the beads.
SAFE STOPPING POINT. DNA can be stored at -20 °C for up to 7 days.
Bisulfite treatment
Use the MethylCode™ Bisulfite Conversion Kit Invitrogen following the manufacturer’s protocol.
http://tools.lifetechnologies.com/content/sfs/manuals/methylcode_bisulfite_man.pdf
Elute bisulfite-treated DNA in 10 µl.
Library enrichment PCR
Use 3 µl (from step I2) as a template in each of two PCR reactions.
Thermal cycler program:
95 °C for 2 min
12-15 cycles*:
95 °C for 20 sec
60 °C for 30 sec
72 °C for 1 min
72 °C for 7 min
*Keep the number of cycles as low as possible to reduce PCR duplicates.
PCR master mix (50 µl reaction)
10x Pfu polymerase buffer
5 µl
10 mM dNTPs
1 µl
PCR primer cocktail (Illumina TruSeq kit)
5 µl
Pfu Cx Hotstart DNA polymerase
1 µl
Water
35 µl
Library purification
Make fresh 80% ethanol.
Vortex the AMPure beads until they are well dispersed.
Add 50 µl of beads to the sample.
Adjust pipette to 85 µl then gently pipette the entire volume up and down 10 times.
Incubate at RT for 10 min.
Place the tube on the magnetic stand for 5 min.
Remove and discard 80 µl of supernatant from each tube.
With the tube on the magnetic stand, add 200 µl of freshly prepared 80% ethanol without disturbing the beads. Incubate 30 sec.
Remove and discard all the supernatant from each tube without disturbing the beads. Repeat ethanol wash once.
Let the tube stand at RT to dry for 8 min. Remove the tube from the stand and resuspend the dried pellet with 16 µl water. Gently pipette the entire volume up and down 10 times to mix thoroughly. Incubate at RT for 2 min.
Place the tube on the magnetic stand at RT for 5 min.
Transfer 15 of µl of the clear supernatant to new tube without disturbing the beads.
SAFE STOPPING POINT. DNA can be stored at -20 °C for up to 7 days.
Library validation
Subject libraries to quality control on a Bioanalyzer before sequencing. Libraries should have a size range between 250 and 400 bp and the adapter dimer peak, if present, should be less than 10% of the library. See Figure 2 in representative data.
Clone 1-2 µl into TOPO Blunt and sequence a few clones to check that the adapters are ligated as expected.
Bisulfite conversion checkpoint: In plants, the chloroplast genome is expected to be unmethylated. Amplify chloroplast DNA from the library by PCR. Clone into TOPO TA cloning kit following manufacturer’s protocol and sequence by standard Sanger sequencing. Each C in the amplified PCR product should be converted and sequenced as a T.
Template: 2 µl library
10x Ex Taq buffer (Mg2+ plus)
5 µl
10 mM dNTPs
1 µl
10 µM For Oligo
2.5 µl
10 µM Rev Oligo
2.5 µl
TaKaRA Ex taq (5 units/µl)
0.5 µl
Water
36.5 µl
Oligos for chloroplast DNA (Groszmann et al., 2011):
For: 5’-ATGATGTTGTTAGAATTTYATATAGG-3’
Rev: 5’-CATCATTTARCTATCRCAATTCTTT-3’
Thermal cycler program:
95 °C for 2 min
40 cycles:
95 °C 15 sec
52 °C 30 sec
72 °C 2 min
72 °C 10 min
High throughput sequencing
Sequence library (~10 pM) on Illumina HiSeq 2500 machine. Paired end or 80 bp single end reads allow for better mapping to the genome, but standard 40 bp single end reads are also acceptable. Sequencing depth needed depends on the size of the genome and can be calculated using the Lander/Waterman equation.
The general equation is:
C = LN / G
• C stands for coverage
• G is the haploid genome length
• L is the read length
• N is the number of reads
Please refer to http://support.illumina.com/downloads/sequencing_coverage_calculator.html for more details.
Part II. Whole genome bisulfite sequencing data analysis
Equipment
Linux computer with standard utility applications (including Perl)
R (http://www.r-project.org/; base installation only is needed)
Bismark (http://www.bioinformatics.babraham.ac.uk/projects/bismark/)
FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/)
FASTX Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/)
SAMtools (http://samtools.sourceforge.net/)
bedtools (https://github.com/arq5x/bedtools2)
Procedure
Note: For all the scripts used in the Procedure, please download here.
Quality control of sequenced reads
Copy sequencing reads to desired location on local computer or server.
Unzip and untar sequence files if needed.
gunzip file_name.txt.tar.gz
tar xvfp file_name.txt.tar
Run quality control of sequencing reads with fastqc (http://hannonlab.cshl.edu/fastx_toolkit/).
Usage: fastqc file_name.txt
Examine the fastqc report to determine if/how to filter and/or trim reads. Discard adapters and low quality reads (less than 75% quality scores above 25) if necessary.
Usage: fastq_quality_filter –q25 –p 75 –i file_name. txt –o file_name_trimmed.fastq
Re-run quality control to check final quality of the reads.
Usage: fastqc file_name_trimmed.fastq
Align bisulfite reads with Bismark
Align the reads to the reference genome of your choice using Bismark (Krueger and Andrews, 2011).
We strongly encourage the reader to consult the review written by the authors of Bismark (http://www.ncbi.nlm.nih.gov/pubmed/22290186) before starting the data analysis. Here, we describe alignment of single end reads, but alignment of paired end reads is also possible.
Prepare bisulfite-treated genome for future mapping (only needs to be done once).
Usage: bismark_genome_preparation --path_to_bowtie reference_genome/fasta/
Map BS-reads to converted genome (map forward and reverse reads separately).
Usage: bismark --non_directional -o bismark_file_name_trimmed.n1l50 -n 1 -l 50 reference_genome file_name.trimmed.fastq
Options are as follows:
-non_directional: reads are not strand-specific (a strand-specific option is also available)
-o output directory
-n max number of mismatches
-l length of seed (first number of nt that are mapped with <n mismatches)
*fastq: short reads in fastq format
From this point onwards the analysis follows different steps based on the genotype of the sample used to prepare the library.
Option #1: Libraries from a single inbred strain
Convert Bismark aligned reads from SAM to BAM, sort, and index
cd bismark_file_name_trimmed.n1l50
Usage: SAM_to_BAM_sort_index.pl file_name.fastq_bismark.sam
Expected output file: file_name.fastq_bismark.sorted.bam
Convert sorted BAM file to SAM format
Usage: samtools view -h file_name.fastq_bismark.sorted.bam > file_name_sorted.sam Samtools (Li et al., 2009)
Eliminate redundant reads
Using a sorted SAM file, keep only one sequence per strand that maps to the same start and end position. This eliminates PCR duplicates. A log file (SAM_redundancy_stats.log.txt) of counts for each read is created.
Usage: ./make_sorted_SAM_non-redundant_fewest_MM.pl file_name_sorted.sam > file_name_sorted_nr.sam
This is how it works:
The script reads a sorted SAM file and gets all the reads that map to the same position and strand and then
Sorts them by decreasing prevalence and then by increasing number of mismatches (not counting bisulfite conversions) to the genome.
The most prevalent read with the total highest quality string is kept.
In the case of a tie, the read with the fewest number of mismatches is retained.
In the case of another tie, it prints out every unique read.
The output SAM file also has 3 new fields added on the end:
CT == count = number of times this read was found in the input file
MM == mismatches = number of mismatches compared to the genome sequence (not counting conversions)
QS == quality score = total quality score for this read
Calculate a methylation value for each cytosine
Run Bismark’s supplementary script “bismark_methylation_extractor” on sorted SAM files.
Usage: bismark_methylation_extractor –s file_name_sorted_nr.sam -o bismark_output
This script creates 12 output files with methylation status of each C in three different contexts (CpG, CHG, CHH) with 4 mappings:
OT - original top strand
CTOT - complementary to original top strand
OB - original bottom strand
CTOB - complementary to original bottom strand
Shorthand for methylation call according to context:
z: unmethylated C in CpG context
Z: methylated C in CpG context
x: unmethylated C in CHG context
X: methylated C in CHG context
h: unmethylated C in CHH context
H: methylated C in CHH context
Calculate bisulfite conversion efficiency
The mean bisulfite conversion rate for each library is calculated based on the methylation status of each cytosine from reads mapping to the chloroplast genome, which is expected to be unmethylated.
Run Usage: ./methylation_summarizer_1.pl bismark_output > bismark_SampleName.summary_step1.txt
Get info about methylation status of each nucleotide from each read mapping to the chloroplast.
Usage: grep ChrC bismark_*_trim3.n1l50.summary_step_1.txt > bismark_*_trim3.n1l50.summary_step_1.chloroplast.txt./methylation_summarizer_2_conversion.pl
bismark_*_trim3.n1l50.summary_step_1.chloroplast.txt >bismark_*_trim3.n1l50.conversion.txt
The output file contains the conversion at each position, and the mean C conversion across the chloroplast is printed to the screen.
Option #2: Libraries from F1 crosses
Map reads from hybrid libraries
In the case of F1 hybrid libraries, two parental genomes may be available as reference. You may decide to map reads to both the parental genomes to maximize the number of mapped reads using Bismark as described above. To do that, first map all the reads to the best reference genome, then align the “unmapped” reads to the other genome.
Make file of unmapped reads from the fastq file (e.g., reads not in SAM file).
Usage: ./get_fastq_reads_not_in_SAM.pl fastqFile samFile > reads.unmapped.fastq
To assign reads to a particular strain and to retain as many unique reads as possible, separate the reads by strand.
Script: split_bismark_SAM_by_read_strand.pl
Usage: split_bismark_SAM_by_read_strand.pl file_name_bismark.sam
Classify reads by parent-of-origin (allele specific DNA methylation analysis)
Classify the forward reads according to their parent-of-origin with a bedfile where the C>T SNPs between the two genomes of interest are ignored but all other SNPs are retained, and classify the reverse reads with a bedfile where the G>A SNPs between the two genomes of interest are ignored but all other SNPs are retained. There is only one bedfile, but read strand has to be specified (pos or neg).
Script: split_bismark_SAM_by_read_strand.pl
Usage: split_bismark_SAM_by_read_strand.pl file_name_bismark.sam
Expected output files: file_name_bismark.pos.sam, file_name_bismark.neg.sam
Script: classify_bismark_reads_by_parent.one_strand.pl
Usage: classify_bismark_reads_by_parent.one_strand.pl file_name_bismark.pos.sam SNPs.bed pos > file_name_bismark.pos_class.sam"
Usage: classify_bismark_reads_by_parent.one_strand.pl file_name_bismark.neg.sam SNPs.bed neg > file_name_bismark.neg_class.sam"
Reads are classified based on their sequence at known SNP positions. After classification, redundant reads from each class are eliminated.
To differentiate between 4 cases:
ST:Z: maternal
ST:Z: paternal
ST:Z: NE means no evidence for either genome
ST:Z: both means evidence for both (conflicting data)
awk -F"\t" '$19 == "ST:Z: maternal " {print $0}' file_name_bismark.pos_class.sam > maternal.sam
awk -F"\t" '$19 == "ST:Z: paternal " {print $0}' file_name_bismark.pos_class.sam > paternal.sam
awk -F"\t" '$19 == "ST:Z:NE" {print $0}' file_name_bismark.pos_class.sam > NE.sam
awk -F"\t" '$19 == "ST:Z:both" {print $0}' file_name_bismark.pos_class.sam > both.sam
Run similar commands with file_name_bismark.neg_class.sam
Combine the SAM files
Example: cat file_name_neg.sam file_name_pos.sam > file_name_pos_neg.sam
You may delete the individual pos and neg files after checking the size of the combined files.
Prefix the header to the sam file
cat header file_name_pos_neg.sam > file_name_pos_neg.header.sam
Convert SAM to BAM, sort, and index
SAM_to_BAM_sort_index.pl file_name_pos_neg.header.sam
Expected outputfile: file_name_pos_neg.sorted.bam
Convert sorted BAM file to SAM format
samtools view -h file_name_pos_neg.sorted.bam > file_name_pos_neg.sorted.sam
Eliminate redundant reads (see step 5)
Script: make_sorted_SAM_non-redundant_fewest_MM.pl
Usage: make_sorted_SAM_non-redundant_fewest_MM.pl file_name_pos_neg.sorted.sam > file_name_pos_neg.sorted_nr.sam
Calculate a methylation value for each cytosine (see step 6)
Run methylation extractor for each set of classified reads as well as for all reads combined.
Usage: methylation_extractor -s file_name_pos_neg.sorted_nr.sam
Combine all the nr.sam files into an “allreads_nr.sam” file with cat command and run methylation_extractor again.
Summarize the methylation status across genomic windows
For each class, organize the 12 methylation extractor files in the output files folder. Divide the genome into 300 nt (windowWidth) windows, overlapping by 100 nt (windowOverlap).
Script: make_genome_windows_bed.pl (requiring a file of each chromosome and its length)
Usage: make_genome_windows_bed.pl chromInfo.txt windowWidth windowOverlap > genome_300nt_100_windows.bed
Script: Summarize_by_window.sh
Usage: bash Summarize_by_window.sh methylation_outputfiles genome_300nt_100_windows.bed
Summarize_by_window.sh features: This script summarizes methylation status across overlapping genomic windows of defined size by converting the processed Bismark methylation extractor output files into a set of bed files and determining weighted methylation values as described in Schultz et al. (2012). Bedgraph files for viewing in a genome browser are created in the bedgraph folder. Bismark's methylation extractor output by chr position (after sorting) is summarized by converting the methylation string into ummethylated counts, methylated counts, and percent methylation, producing output in BED-like format (scorePerPos folder). The folder weighted_summaries_by_window has three bed files, which merge sites across each window. For each window it provides counts and weighted percent methylation.
Identify differentially methylated regions (DMRs)
At least 5-read coverage at each site is required. Differential methylation is assayed by calculating the difference between samples (sample A-sample B of weighted methylation fractions), and confidence (p-value from Fisher's exact test) for each window in all sequence contexts is assigned. P values are corrected with the Benjamini and Hochberg False Discovery Rate (FDR). CG and CHG DMRs were defined as regions with a minimum overlap of 3 informative Cs between windows and, for example, a weighted methylation difference of at least 35 and a corrected p value < 0.01. CHH DMRs were defined as windows with a minimum 10 overlapping informative cytosines and, for example, a weighted methylation difference of at least 10 and a p value < 0.01. The user can use their own criteria for defining DMRs.
To compare mC window counts in two samples the following scripts are needed:
merge_bedgraph_data_counts_etc.pl
compare_methylation_counts_by_window.R
Make matrix of counts for 2 samples, each in 2 contexts using files in the 'weighted_summaries_by_window' folders.
Example:
./merge_bedgraph_data_counts_etc.pl genome_300nt_100_windows.bed
sample_A_reads/weighted_summaries_by_window/CpG.bed
sample_B_reads/weighted_summaries_by_window/CpG.bed
sample_A_reads/weighted_summaries_by_window/CHG.bed
sample_B_reads/weighted_summaries_by_window/CHG.bed
sample_A_reads/weighted_summaries_by_window/CHH.bed
sample_B_reads/weighted_summaries_by_window/CHH.bed >
sample_A_vs_sample_B_reads.300nt_100_windows.txt
The resulting file should have window counts in this order:
sample_A/weighted_summaries_by_window/CpG.bed
sample_B/weighted_summaries_by_window/CpG.bed
sample_A/weighted_summaries_by_window/CHG.bed
sample_B/weighted_summaries_by_window/CHG.bed
sample_A/weighted_summaries_by_window/CHH.bed
sample_B/weighted_summaries_by_window/CHH.bed
Compare counts across two samples in the same context.
compare_methylation_counts_by_window.R inputCountsFile outputStatsFile
Usage:
compare_methylation_counts_by_window.R
sample_A_vs_sample_B_reads.300nt_100_windows.txt
sample_A_vs_sample_B_reads.300nt_100_windows.stats.txt"
For each window, the output file will have (a) the raw Fisher's exact test p-value reflecting whether the fraction of meth/unmeth counts is the same for both samples, and (b) the difference (sample A-sample B) in weighted methylation fraction. Methylation fractions appear next to the results of each statistical calculation.
Overlap genomic features (genes, transposable elements, etc.) with the windows
Open the stats file in Excel and sort based on p value.
Copy the rows representing selected DMRs [(with a FDR below your threshold (0.01) and
with a methylation difference above your threshold (e.g. 35%)] into another file and delete all but the desired 5 columns (chr, start, end, difference, FDR value).
Save the file with the extension “bed” and intersect with genomic features using Bedtools (Quinlan and Hall, 2010).
Run:
bedtools intersect -wao -a sample_A_vs_sample_B.CpG.bed -b genome_GFF3_genes.gff > intersect_ sample_A_vs_sample_B_genes.txt
bedtools intersect -wao -a sample_A_vs_sample_B.CpG.bed –b genome_GFF3_transposable_element.gff > intersect_ sample_A_vs_sample_B.CpG.bed _TE.txt
Representative data
Figure 1. 1.2% gel with sheared DNA (250 ng). Expected size range is 100-300 bp.
Figure 2. Bioanalyzer results. Libraries with higher concentration perform better in Illumina sequencing. Bioanalyzer analysis of libraries before sequencing is an important quality control step. Both libraries were in the expected size range (as indicated by blue bracket in panel A) and therefore suitable for sequencing. Library 1 (with higher molarity) was subjected to an additional clean up step using AMPure XP beads in order to reduce the amount of residual adapters (indicated by a red arrow in panel A, and panel B). Library 2 (panel C) was not cleaned up because it was at a low concentration and additional clean up might have caused loss of enough library such that sequencing would not be possible. Sequencing resulted in 12,489,378 and 3,824,500 total non-redundant reads for library 1 and 2, respectively.
Recipes
50x TAE (1 L)
242 g Tris base
57.1 ml glacial acetic acid
100 ml 0.5M EDTA (pH 8)
Acknowledgments
This work was supported by the NSF (MCB 1121952) and an award to MG from The Pew Charitable Trust’s Pew Scholars Program in the Biomedical Sciences.
This protocol was adapted from Pignatta et al. (2014).
References
Groszmann, M., Greaves, I. K., Albertyn, Z. I., Scofield, G. N., Peacock, W. J. and Dennis, E. S. (2011). Changes in 24-nt siRNA levels in Arabidopsis hybrids suggest an epigenetic contribution to hybrid vigor. Proc Natl Acad Sci U S A 108(6): 2617-2622.
Krueger, F. and Andrews, S. R. (2011). Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics 27(11): 1571-1572.
Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G. and Durbin, R. (2009). The sequence alignment/map format and SAMtools. Bioinformatics 25(16): 2078-2079.
Quinlan, A. R. and Hall, I. M. (2010). BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26(6): 841-842.
Schultz, M. D., Schmitz, R. J. and Ecker, J. R. (2012). 'Leveling' the playing field for analyses of single-base resolution DNA methylomes. Trends Genet 28(12): 583-585.
Pignatta, D., Erdmann, R. M., Scheer, E., Picard, C. L., Bell, G. W. and Gehring, M. (2014). Natural epigenetic polymorphisms lead to intraspecific variation in Arabidopsis gene imprinting. Elife 3: e03198.
Copyright: Pignatta et al. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Pignatta, D., Bell, G. W. and Gehring, M. (2015). Whole Genome Bisulfite Sequencing and DNA Methylation Analysis from Plant Tissue. Bio-protocol 5(4): e1407. DOI: 10.21769/BioProtoc.1407.
Pignatta, D., Erdmann, R. M., Scheer, E., Picard, C. L., Bell, G. W. and Gehring, M. (2014). Natural epigenetic polymorphisms lead to intraspecific variation in Arabidopsis gene imprinting. Elife 3: e03198.
Download Citation in RIS Format
Category
Systems Biology > Epigenomics > DNA methylation
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,408 | https://bio-protocol.org/exchange/protocoldetail?id=1408&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Differentiation of Naturally Produced Extracellular Membrane Vesicles from Lipid Aggregation by Glucuronoxylomannan Immunogold Transmission Electron Microscopy in Bacillus subtilis
Lisa Brown
P Geoff Perumal
AC Arturo Casadevall
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1408 Views: 10147
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Recently, membrane vesicle (MV) production was described in Gram-positive bacteria, which harbor a variety of components such as toxins, antibiotic resistance proteins, proteases, DNA, and immune modulators. Free lipids have the ability to form micelles, thus it is important to rule out spontaneous association of lipids into vesicle-like structures and rather, that MVs are produced naturally by a metabolically active cell. Here, we describe a protocol utilizing the polysaccharide, glucuronoxylomannan (GXM) from Cryptococcus neoformans (C. neoformans) as a marker to differentiate naturally produced MVs from vesicles that form spontaneously in the Gram-positive model organism, Bacillus subtilis (B. subtilis). MVs are purified from bacterial cultures grown in the presence of GXM; MVs naturally produced by cells would not contain GXM in the lumen whereas vesicular structures forming in the media could encapsulate GXM and this can be visualized via immunogold transmission electron microscopy.
Materials and Reagents
Purified glucuronoxylomannan (GXM) (protocol included)
YPD broth (Difco, catalog number: 242820 )
C. neoformans H99 fungal strain
100 kDa, 50 kDa, 10 kDa, 1 kDa cut-off EMD Millipore Ultrafiltration Membranes (Millipore, catalog number: 14442AM )
B. subtilis 168 bacterial strain
BHI broth (Difco, catalog number: 299070 )
8% glutaraldehyde (Polysciences, catalog number: 111-30-8 )
16% paraformaldehyde (Electron Microscopy Sciences, catalog number: 15700 )
0.5 M sodium cacodylate (pH 7.4) (Electron Microscopy Sciences, catalog number: 11650 )
100% ethanol
Lowicryl HM-20 monostep resin (Electron Microscopy Sciences, catalog number: 14340 )
Gelatin (Thermo Fisher Scientific)
Aurion Donkey Block (Electron Microscopy Sciences, catalog number: 25599 )
α-GXM monoclonal antibody 18B7 (mouse monoclonal IgG1) (Casadevall lab-generated)
BSA-c (Electron Microscopy Sciences, catalog number: 25557 )
10 nm conjugated secondary Ab (donkey α-mouse) (Electron Microscopy Sciences, catalog number: 25814 )
4% uranyl acetate (aq) (SPI Supplies, catalog number: 615-44-0 )
1x phosphate buffered saline (PBS) (see Recipes)
Equipment
Express PLUS Membrane Filters - Pore (0.22 μm) (Millipore, catalog number: SCGVU01RE )
Ultracentrifugation tubes (thickwall, polyallomer/pollypropylene, 3.5 ml, 13 x 51 mm) (Beckman Coulter, catalog number: 349623 )
200 mesh nickel grids (Polysciences, catalog number: 24916 )
Centrifuge capable of 15,000 x g
TLA 100.3 rotor (Beckman Coulter, catalog number: 349490 )
Amicon ultrafiltration system (Millipore, catalog number: 5124)
Optima TL ultracentrifuge (Beckman Coulter, discontinued comparable to B11229)
Sonicator (sonic dismembrator) (Thermo Fisher Scientific, model: 100 cpn-214-161 )
Freeze substitution system (RMC, model: FS-7500 )
Reichert Ultracut UCT Ultramicrotome
JEOL 100CXII or JEOL 1200EX Electron Microscopes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brown, L., Perumal, G. and Casadevall, A. (2015). Differentiation of Naturally Produced Extracellular Membrane Vesicles from Lipid Aggregation by Glucuronoxylomannan Immunogold Transmission Electron Microscopy in Bacillus subtilis. Bio-protocol 5(5): e1408. DOI: 10.21769/BioProtoc.1408.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell imaging
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Cell imaging > Electron microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,409 | https://bio-protocol.org/exchange/protocoldetail?id=1409&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Vesicle Isolation from Bacillus subtilis Biofilm
Lisa Brown
AK Anne Kessler
AC Arturo Casadevall
Published: Vol 5, Iss 5, Mar 5, 2015
DOI: 10.21769/BioProtoc.1409 Views: 12535
Original Research Article:
The authors used this protocol in Jul 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2014
Abstract
Bacterial biofilms are associated clinically with many bacterial infections including those caused by bacteria such as Pseudomonas aeruginosa and Staphylococcus aureus. In recent years, extracellular vesicles produced by bacteria have been isolated from biofilm communities. Vesicles have been described in depth and can encapsulate various virulence factors including toxins and immunomodulatory compounds. Vesicles may be important for virulence and survival by serving as a vehicle for the secretion and concentrated delivery of these molecules. Studying extracellular vesicles is an important step towards understanding biofilm formation, structure, and disruption with the ultimate goal of preventing or treating hospital infections caused by bacterial pathogens residing in biofilms. Here we describe the protocol for isolating vesicles from biofilm produced by Bacillus subtilis.
Materials and Reagents
Bacillus subtilis (B. subtilis) 168 bacterial strain (available from ATCC, catalog number: 23857 )
BHI broth/agar (BD, catalog number: 211059/211065)
Amicon Ultra centrifugal filter units Ultra-4 (MWCO 100 kDa) (Millipore, catalog number: UFC910024 )
1x phosphate buffered saline (PBS) (see Recipes)
MSgg medium (see Recipes)
Equipment
Petri dishes (100 x 55 mm) (Corning, catalog number: 351029 ) (dish size can be variable and ultimately depends on the amount of vesicles you wish to purify)
0.22 μm syringe filters (Fisher, catalog number: 09-719C)
Tube (thickwall, polyallomer, 3.5 ml, 13 x 51 mm) (Beckman Coulter, catalog number: 349623 )
Optima TL ultracentrifuge (Beckman Coulter)
TLA 100.3 rotor (Beckman Coulter)
Centrifuge capable of 15,000 x g
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2015 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brown, L., Kessler, A. and Casadevall, A. (2015). Vesicle Isolation from Bacillus subtilis Biofilm. Bio-protocol 5(5): e1409. DOI: 10.21769/BioProtoc.1409.
Download Citation in RIS Format
Category
Microbiology > Microbial biofilm > Biofilm culture
Microbiology > Microbial cell biology > Organelle isolation
Cell Biology > Organelle isolation > Outer membrane vesicles
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
141 | https://bio-protocol.org/exchange/protocoldetail?id=141&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
GST-tagged Yeast Protein Purification
HI Hogune Im
Published: Oct 5, 2011
DOI: 10.21769/BioProtoc.141 Views: 16883
Download PDF
Ask a question
Favorite
Cited by
Abstract
Glutation S-transferase (GST) tagging is the most commonly used purification strategy for recombinant protein. It was developed with the goal of preserving the enzymatic activity by utilizing gentle elution condition of the target protein from purification matrix (Poon and Hunt., 1994). The method described here can be applied from single protein to proteome scale purification of recombinant protein from yeast (Zhu et al., 2000; Zhu et al., 2001).
Materials and Reagents
Ethylene glycol-bis(2-aminoethylether)-N,N,N′,N′-tetraacetic acid (EGTA) (Sigma-Aldrich, catalog number: E0396 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
HEPES (Sigma-Aldrich, catalog number: 54457 )
Roche protease inhibitor tablets (containing EDTA) (Roche Diagnostics, catalog number: 11697498001 )
Phosphatase inhibitor (Roche Diagnostics, catalog number: 4906845001 )
Glutathione (Axxora, catalog number: 157-002-G005 )
Galactose (Mp Biomedicals, catalog number: 0210174701 )
Zirconia/Silica beads (Biospec Products, catalog number: 11079105z )
Glutathione beads (Thermo Fisher Scientific, catalog number: 16100 )
Tris
NaCl
TritonX-100
Glycerol
Beta-mercaptoethanol (BME)
Sc-ura liquid media with raffinose
Lysis buffer (see Recipes)
Wash buffer I (see Recipes)
Wash buffer II (see Recipes)
Elution buffer (see Recipes)
Equipment
Table top centrifuge
Bead beater
50 ml Falcon tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits