#version: 0.2 - Trained by `huggingface/tokenizers` Ġ Ġ ĠĠ ĠĠ ĠĠ Ġ ĠĠĠĠ ĠĠĠĠ i n s e ĠĠĠĠ ĠĠĠ a t r e Ċ ĠĠĠ Ċ ĠĠĠĠĠĠĠ o r Ġ = o n Ġ t e r s t Ċ ĠĠĠĠĠĠĠĠ a l a r - - a n l e d e m e Ġ i h e Ġ n Ġ c Ġ f Ġ a l f Ġ p i t Ġ s se lf # # m p r a i on e n c t ĊĠĠĠĠĠĠĠĠ ĠĠĠ e s r o l o Ġ in Ġt he Ġ o Ġ d l a -- -- u t Ġ ' = = in g p e Ġ m Ġ e c o Ċ ĊĠĠĠ Ġ self Ġ re " " g e ) : Ġ b Ġ # e d ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ i c Ġ w u r an d l t i g Ġ ( Ġ 1 s s at a ' , u n Ġ 0 i s e l ## ## de f o l u e a me at e l i or t ) ) se r c e Ġf or Ġo f e st o t u m Ġi f Ġ [ a s 0 0 v al i d Ġa s d i ( ) Ġi s Ġt o t s Ġ " Ġn p t er Ċ ĊĠĠĠĠĠĠĠ m a ] , ur n ra y ) , t urn ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ == == on e Ġ T ar ray q u t r t h mp ort u lt ser t h a "" " Ġ y re s c h a d at ion i z ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ Ġ def v e f i se t Ġ : mp le Ġ r ro m Ġre turn N one Ġ 2 v er m at ---- ---- y pe la b Ġ st i l ' ) ] ) o m Ġ and c k Ġ * i me ( ' in t Ġ - lo t n t Ġ """ Ġ + p t Ġ g _ _ ct ion e x a mple ig h d ata n ame #### #### Ċ Ċ it h p ar u p o de k e ge t Ġas sert a b lab el Ġe x l in a x Ġt h f or la ss Ġ S Ġc o r i Ġi mport Ġd ata de x > > Ġb e = ' " , iz e al l Ġ x [ ' Ġ X ar g qu al ' : en d Ġn ot p ut f rom t ype r ue u l c on co l Ġ or i st Ġ h r or at h ha pe p y ĠĠĠĠ Ġ le n Ġ I u re a m p lot Ġ P o w p p Ġ A . _ f e Ġ u Ġc on o d p re ' ] Ġ= = Ġ C Ġ _ Ġ ` o s Ġ None ==== ==== i se i m t o en t Ġt est Ġ de ( " an s Ġw ith ar n and om Ġ F Ġ R e qual ( [ Ġ val an ge Ġa x ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ n p Ġf i igh t Ġ % al se li st ample s i f u b Ġ 3 t est i es Ġ me ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ u st Ġre s ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ra in lin e Ġ D r int u es Ġ lo " ) 0 1 an ce . . n e ab le Ġc ol n s ode l c al t ime a se Ġ se Ġ v fi le E r Ġe l er s l y Er ror f f arg s t a in d Ġ array Ġel se ) . o ut p ath p ro ra me ex t m in pt ion Ġ k Ġ al Ġ N for m ar t p er c es d s i mport b o me nt st r e ct Ġ L m o Ġ on in dex or s ma x at u d f p a f it T rue Ġp ro Ġ { a ult c lass [ : pe ct ĠT he di ct b j ######## ######## t e Ġ M lo at p s Ġm at Ġ an he ck d er y s i ve p o Ġn e ra ise Ġ l * * a pp ame ter re d >> > co re s hape atu res it y Ġu se f ig w e s ize Ġ >>> Ġp lt i r h o a ge Ġth at Ġf rom 1 0 it e s amples i v Ġa re Ġp ar un ction Ġ len le arn Ġ label i al Ġn um as sert Ġ G u mp Ġ < Ġo ut Ġ / Ġp rint o re Ġst r u s ro w li b Ġm a ĠĠĠĠ ĠĠ g re Ġres ult -------- -------- Ċ ĉ o c i mat or m ar i e t b er F alse p l Ġw e V al ĠR e co mp s c Ġn ame Ġp re Ġt r Ċ ĠĠĠĠĠ m b ic k c l Ġfi le Ġ E p h Ġd f " : ump y Ġ set = " Ġ 4 d ate a g par se ( ): ri x t rain m s lo w ar y Ġ B s h t y app end Ġ un Ġ 5 ans form i p pect ed Val ue il l i b i fi Ġb y j o par am Ġ -------- st ate fe atures as k ameter s it er bj ect ut e ( ( o p ig n Ġth is it ion se s Ġd i ce pt ] . lo g ke y r andom ax is ======== ======== ` ` I n z er Ġs k ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ a st Ġ raise Ġ list ct or Ġ en a ck r id e f Ċ Ġ Ġ le st ance th od d a Value Error c he Ġr andom ĠI f i le en ts 9 9 Ġco mp Ġt ime Ġin t an t 6 4 Ġc lass 00 00 Ġ > f o pe c un d s core [: , Ġ` ` Ġo ption ĠT rue val ues at ch Ġ at Ġ W in e en er for mat Ġd type Ġm ax c s at ed p ha . , Ċ ĊĠĠĠĠĠĠĠĠĠĠĠ or d n um Ġval ues o g at ure m odel Ġf e Ġex pected Ġf unction in it i de re nt p lt um n ad d 1 2 g or Ġ get Ġin dex p ort Ġ O me n Ġr ange n el Ġsk learn b s ic es res ult Ġb o Ġs hape Ġn umpy um ns la s Ġ __ Ġm odel Ġi t ( )) Ġax is c a er ror tr ic Ġdef ault val ue s ub Ġval ue Ġ* * e p Ġc heck ma ge ing s Ġp lot at or plot lib Ġ ver ro up F rame i x gre ss ma p imat or Ġ all di r Ġnum ber ĠF alse Ġ he s um Ġp o ol d v el Ġw h a ch pl it at es la y li m R e D ata un t f loat f t Ġw ill 2 5 id th Ġs o ra w Ġ line s ing Ġw he f rame Ġf loat s ion mo st in ter w args Ġp d Ġc h s o Ġd ist ĠRe turn re n re e l l cal e Ġ .. 1 1 Ġc an li ke Ġe st me an we ight ation s re ad las ses q ue lo c 3 2 un c Ġ-------- -- th er men ts a ve Ġm in Ġin put h is ĠP ar Ġoption al ar get p i ut il orm al Ġ[ ] c c Ġ z Ġc lf n g col or t ext in ts c y is ion d type Ġ \ li f param s label s ĠI n ic al Ġp er Ġ1 0 b in Ġs c ifi er al most l ic a ct ] [ Ġ Y Ġd o name s and as ul d Ġs h Ġ ) Ġe lif Ġp a Ġlabel s r ange igh ts Ġuse d Ġne w Ġt rain Ġ j Ġo s tr ue it le re q g ra it s Ġ H 1 5 p rint u al __ ( 0 5 in put Ġlo g de d or k le ct Ġf ig d ing Ġ+ = Ġe ach = [ a re ut ion t ra ic h () , Ġ ---- an g Ġin ter jo in ĠReturn s Ġs ample se d Ġp y Ġ[ ' g th tr ansform Ġout put ĠPar ameters st art id x n ot en s : ` th on Ġo bject Ġ ValueError Ġmat plotlib ################ ################ ĊĠĠĠĠĠĠĠĠ Ġ Ġn o Ġ U Ġ la ' ], ult i p r er nel Ċĉ ĉ 2 0 f a ust er ar k Ġ( ' ĠT his d d qu en Ġc l on ents Ċ ĠĠĠĠ p os p es 3 3 Ġs ub v ari le s pre dict i e Ġcol or n o def ault Ġmat rix i o 2 01 r st -- - val id Ġ ha 1 00 8 0 c ision p la Ġh as re ate Ġ @ out put on t Ġ 6 g er ne w Ġ . pre d E S Ġf it č ĊĠĠĠĠĠĠĠ zer os e mp ces s E R at tr p en in stance Ġme thod I N st e u g er ies b ase ' ), ar d ri b Ġt ype ĠD ata [ " ction s at ive u ct co de s plit ] ] el d un i r ite ver t at s 6 6 a mp d oc Ġ row a y lt er ul l ta in a u ĠS e 4 5 k wargs w idth ho uld if ic A T el l } , ate gor pa ce lo se Ġin d Ġs up ar s Ġ K ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ lo ad Ġwh ich 7 5 ' ' Ġs pec o k mat rix util s en ter ! = all y u se . __ 8 8 f n Ġ | g rid v ent " ] comp onents ' ]) 1 6 m l u ment Ġ up ser ies in fo Ġc al igh b a v s ample Ġp os i ss Ġc or Ġ ro sh ow u de lin es on g di st ** ** Ġa pp c lasses a k Ġ one mb da i od n an ĠE x Ġs hould ot h č ĊĠĠĠ b ar 3 5 Ġc ur ar ch Ġ != ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ 1 4 Ġtr y s q ĊĠĠĠĠĠĠĠĠ ĠĠ ---------------- ---------------- Ġal pha co res 1 9 ind ow Ġ key w ith Ġis instance i py g roup / / en se )) ) Ġg ener t t p ol ver age t ick co unt č Ċ Ġv ari raise s c ur Ġs ize ) ] col umns Ġha ve bo x = ( c heck le d Ġpro b se ts A R C lass re ct co m In dex Ġ---- --- O N [ - g es ax es Ġ 8 s parse Ġ arg pla ce co py 7 8 S t Ġma ke de n ' . 1 3 2 00 Ġon ly Ġg iv in al Ġb in Ġex cept u ff ur ce ighb ors Ġm ust c or iz ed lt a ow n () . m ask Ġi d Ġ V Ġt m Ġstr ing ` . gress ion r and b y ra di b e t itle zer o Ġp ath 2 2 Ġco py n d g s Ġi ter Ġu sing s p Ġd ate f unc i an w o ar r fig ure Ġo ther ns ion ar ange E qual t able 0 4 ([ [ Ġ error Ġs parse fe ren s v c lf qu i pro b Ġp andas iz er ut o res h 9 6 0 3 ] )) p on ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ t he l at str ing me tric u le col umn Ġst art C o tr ans ĠN ot an ces ĠT est tr ib 0 2 Ġfe atures t ing di m Ġm o ro p ' s bo se o u j ect t arget Ġdi ct Ġ end d ot w rite st d me thod Ġ{ } 9 5 Ġo ver il d ot al 9 4 Ġ1 00 up le ', ' Ġc om 1 7 tr y ' ): am s o f al pha Ġdata set Ġs amples ĊĊ Ġ Ġs y : : ĠC o Ġgiv en lo ck o bject ke ys w arn Ġ{ ' Ġcol umns ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠ ĠĠĠĠ ic ense 8 5 r t s ort Ġd if Ġf a Ġb ase Ġfi rst O R Ġcol umn n a an k Data Frame Ġme tric r un Ġfe ature co ef : // Ġ ve ul ar c re le ction Ġex p Ġcon t gor ith C on ro ss m on f unction Ġs core ust ers or der ] ]) ic e 2 4 che s Ġwhe n ra ph Ġb ut T ype ĠData Frame Ġin it cs v _ , w ise s pace 2 7 Class ifier Ġd is c lose Ġ 7 con d f req u c vari ance c at i mage )) , ma in n ode ist ic Ġs ame g end po ch re f iz ation Ġresult s Ġax es ] : Ġtr ansform 8 6 I T Ġi mage S E g en ( - T est c ul s cale assert Equal ty pes m ark le an Ġfor mat Ġsc ipy ================ ================ r ight A N Ġin te ab s A L v ar ĠSe e imat ors Ġm ore Ġpo ints b ack y le o ff ie w ol s } ) c ent Ġs ys Ġs p ĉ ĉ or ds Ġme an ut h o bj 0 6 te mp Ġor der ad er s y or y Ġdist rib t ed Ġwe ights ĊĠĠĠĠ ĊĠĠĠ 1 8 er r er y c all fi x Ġcon tain 3 6 " . Ġw arn Ġ args e c 0 9 im um lo ts t en le vel lo ss n orm ] ), 0 7 ex p ific ation Ġpar ameter ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ens or w ork ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġpa ss a p Ġ qu est imator Ġr un ar ge Ġest imator line ar Ġn ode fe ature Ġwhe re Ġn ormal gorith m d o Ġs cal m od L E Ġ , pt im m an e ar len gth P ar ' )) Ġid x Ġc ase ab il ĠL icense d is ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ test ing P ro E x de lta ib le S T Ġth an Ġa dd r c s pec me d Ġbe t re g date time ' t ut ed Ġn d Ġr ng n umpy Ġd oc lic e ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ) ): Ġs ol at ter Ġ lin 3 4 e ff n ormal M E ol y par k Ġpar ameters Ġ.. . Ġg rid 9 7 file name Ġname s de nt st ant Ġlo c ifi ed a f Ġp art Ġn on lo b Ġre g Ġver sion Ġthe n Ġa ct o und Ġsup port result s Ġ J 9 2 ser v able s ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ gra ph Ġm ode s ave inter cept Ġe le se nt I D T ime i ent we en ver sion val u t on po ints C ol c v ĠS eries ce ption par t S e d t lab le b u s k Ġlo ad Ġ Q s g l p 8 4 Ġt ext ĠF or ss ion c enter u ments Ġs cale Ġ' '' re turn gress or Ġ q um er Ġo pen Ġw ork ind ices o o ra m I C re quen ime nsion le ft Ġk ernel Ġs ort Ġt arget at er Ġan y Ġin stance ast ype m y we ights quen ce Ġ[ [ Ġval id Ġ 9 Ġc ode con fig Ġg roup '] . est imators ro und Ġm ask t ml t x Ġcur rent Ġs ign pa ck mo ve 0000 0 n al Ġy ou Ġre ad ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ resh old a ss o ption Ġf req . """ ctor y a c s cal st amp s on Ġdo es co v on es Ġnd array t ol v ide Ġi m s cores fa ce Ġs um Ġver bose in ed up date re l Ġin to id s .. . res hape Ġt emp Ġe d ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ tt p Ġm od r is n on ite ms ver se feren ce row s ut es Ġt f U T Ġa v mat h Ġt wo y thon M e N ame k ernel e ps o ur g r 6 5 it ive py plot n er 3 0 au ss Ġcl uster he re ne ct cl usters d b Ġa c F ile Ġc v A S Ġ< = st ack fi lter un k cl uster Ġen umer cl ude s ol jo bs { ' A r b atch Ġa ss ] ], ne ighbors Ġa d Ġr ight Ġtr ans 3 7 Ġlen gth an nel Ġenumer ate if y 5 0 Ġla mbda sub plot Ġbet ween mple ment Ġcon fig es s l ate Ġ> = Ġb atch c m Ġdate time ow er S V at io Ġt able it ies ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġpre dict Ġc all val s arn ing st ep con t w w Ġlo ss Ġm ulti : ] Ġal so Ġk wargs Ġt uple Ġbo ol col s Ġc lasses am ma Ġcomp ute m t uff le Ġa verage Ġma y Ġ & fe rent t f Ġd imension ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġwe ight o us l s Ġor ig Ġpre di p lay y label g n Ġf ol S eries ĠC on 8 7 f low mp l tick s or g v i _ ) ition s Ġt ra Ġind ices Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ li p at ing po int ~ ~ Ġtrain ing R E u ra ction ary _ . to p C A learn ing la mbda Ġw idth **** **** ste m T he s ign Ġz ip Ġm ult as array O D Ġlo w St ate i k ig ma on ts om ial ) [ per ty Ġof f pe d le gend r ate ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġle vel ĠC heck Ġso me x label 4 4 Ġle ft m ode g y Ġex tra ite m col ors qu a ab el Ġ Z Ġc reate Ġpo int s i = [' ine ar act ive Ġwarn ings Ġne ed as h a cc Ġdistrib ution Ġa cc i eld fi ll ( * ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ v as Ġm sg f er a ys 5 5 sq rt Ġo b ir is Ġs ing Ġsh ow ord in sc ri n n se lect it ude al g ma ges poch s r iter t ree res pon Ġp oly ur l E N ist s st ri pect r ĠA r p th Ġt ol č ĊĠĠĠĠĠĠĠĠĠĠĠ 2 3 ra p la st o me Ġ( " lim it pre c d u po p Ġun i abil ity Ġpar ams Ġinit ial S I im g ef ault auss ian que st Ġb u valid ation Ġex ample Ġarray s data set Ġ2 0 h ist Ġdif ferent at ches str uct Ġb ack Ġ[ " m ulti Ġfi lter ( _ iss ing Ġf rame o ps c an an y Ġe v ## # Ġw indow Ġun der 2 6 ategor y D e A G A C Ġcal cul ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ im al requen cy un ts Ġla st ` , Ġre qui and ard ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ss age 7 7 py thon ĠD e g ing Ġfile s Ġg raph pro cess l d e y Ġbo o v iew l ing " ), a uto a i R O cs r w ord Ġal gorithm ( [' T I o ver { } ter min Ġi ris s up Ġinte ger mple x tx t st ats Ġline ar Ġe vent uni que Ġs plit h tml . ") Ġ ] r it Ġ2 01 j ust Ġst ats g a ĠEx amples e vent ne t re ctory p andas prob a u me Ġp l B ase se arch ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ andom State Ġs m 9 0 Ġ[ - st imator c ell in k m er m ult i pe Ġco ef Ġi te f ol Ġ zero Ġfig ure mat plotlib mb ed S tr ura cy Ġc enter ut ure el ds Ġn orm um ber Ġst ep file s Ġmat ch p d Ġs im Ġ ar j e Ġs cores onts ize p df st at Ġve ctor ĠS t Ġcon d di ff ra vel p lots oth er me ans a ke c reate Ġclass ifier rand n 4 2 ĠW e `` . 9 8 ex pected Ġd raw k w eff ic off set ug h + + Ġt otal ad ata d raw Ġm ark ag er f ont ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ o b m ary lob al w indow v s fe ct fo o _ [ x x iz es ################################ ################################ di an W arning b l Ġ } s ide Ġh and Ġcont in Ġse e A B Ġspec ified ang le Ġhe lp ick le low er Ġcon vert se ed Ċ ĠĠĠĠĠĠ so urce re am ma ke I P a ise lay er Ġt er F F \ \ Ġreturn s Ġde c ic s emp ty if t time s w here ) * D i da y ct ors ig en metric s ith er L ist Ġt y ategor ical as ure Ġ1 2 x es g g Ġ2 00 Ġper iod M P b ug Ġd t Ġo bj Ġpro vide ys is Ġa bs ĠĠĠĠĠĠĠĠ Ġ D ate 4 3 se q ur ation 6 7 Ġf ind Ġp as al le c ed ĠA l Ġsing le ] [' Ġo ptim t adata f ore Ġfile name ĠP er '] [ m and g ative Ġal low radi us D E ') . Ġ lines 0 8 Ġst ate ĠD efault n ing m ory ces sing num ber m m pre sent re c Ġf unc l er Ġreturn ed ma g C V c le Ġt itle t om N e un ds Re gressor ion s Ġpa ir Ġt ri Ċ ĊĊĠĠĠ u ch g ener i a or ig Ġse quence are st aise s re place sq l x y T o f s e v form ation , ) Ġa b ĠCo mp qua red Ġso urce ext ra Ġ -- st ore Ġb est to ur ph as d rop in s trib ute Ġdist ance ul ation Ġc ross re ak Ġa f ix el Ġboo lean ĠW he Ġco unt g b fi rst ms g Ġfi eld s in le ss lin space Ġpar ser p ts d ates r s la g op en w h Ġt rue ) / on al lin k Ġu ser 0000 00 he ight U n r atio 4 7 y ear t otal re al f ra s im Ġs ave , ' n dim Ġs v el y v is Ġcl s bin s Ġh igh o x Ġma p Ġc a Ġi mp Ġse lect t z Ġgener ator l u b est Ġpas sed con cat " ], ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ġrow s Ġcor respon id ge pro perty ĠNot es radi ent Ġdi ctionary u ser Ar ray e red th ing p ng j son ag es bo ol Ġ raw 6 0 st yle Ġre l O L che d Ġup date in v per iod M odel i er b lock Ġwh ile p atch S D for med Ġsort ed ĠT ime co ding O T ut ton Ġto p Ġt ick pol y F I im ate E stimator S et t mp id ual il s ra d de red Ġ---- - r ank ot tom on s T R ri or en e Ġsup er cur rent i as Ġh ttp Ġg o il y st ar < / in f ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ o se Ġf ont ro x pa ir qu ery di v r ansform Ġi ts ut ation de pth con nect ition al je ction y lim Ġarg uments Ġc map mo v b f Ġe ps f ul id get Ġf ill z e d uct Ġe mp f ull D F g o Ġw as Ġm ath atu s ed ge Ġ' . ã ģ di stance Ġh ist ĠS tr Ġcor rect Ġin st Ġpy test a verage ip le Ġre gression en v Co mp 4 9 t es Ċĉĉ ĉ per t Ġh ow ĠT ype L abel Ġt ree par ameters ĠU n Ġp red N A m u 2 8 ES T gra m li k Ġst ore Ġe ither st op E L fi eld me nsion ke ep ĠS et ns ity di mension u i comp ute P lot ve c 99 99 Ċ ĠĠ nd array s ys re r Ġun it Ġdata sets feren ces Ġe qual c ast Ġfol low x lim f name ĠP ro ho od " ]) C H f ind `` , Ġd iv Ġpre cision g in jo b Ġed ge F or Ġmod ule v ol le m Ġmetric s 2 9 an el '] : čĊ č co s M ix Ġclass ification = - ĠI t ######## #### lay out Ġsign al arge ts u d R es node s Ġhe re Ġind ic Ġpos itive E n Ġco ordin ff t Par ams ig ure Ġf ull Ġst op Ġvari able h and ĠP lot de v ste ps Ġ learning Ġde n : - 3 9 Ġsol ver ĠG ener Ġhas attr Ġorig inal s ha to ols bo ok Ġre present s lice or ing Ġan al ore st model s [: - un it Ġcontin ue Ġcol ors re ction Ġi mplement 4 0 ai lable r y li ed ust om Ġco variance Ġbin ary di ag pre di st er f uture cl s ĠNot e Ġpredi ctions Ġim g j or Ġ arr is h ol ute le af 2 1 Ġ( ( Ġ ge Re gression Ġ series ste ad ro ot Ġst at Ġoption s option s sc atter Ġc lo Ġ lib s park n own Ġp s w are warn ings 6 8 the ta ) ]) . ], Ġhe ight Ġm on mb ol C T ect or u res scri ption Ġpar am Ġo per se n pp ing Ġ[ ( Ġt ensor Ġse ed Ġthe re Ġfunction s arg ument Ġs ha la p U ser con stant str u ĠA n sort ed ategor ies E D Ġb lock ver bose Ġal ong Ġc ho Ġno ise lo cal al ign el i k en f lat R aises m i il ar Ġs i og ram 00 0 Ġy ield IN G Ġs q n omial he d Ġf ound Ġt mp Ġch ange Ġarg ument . ) ge x Ġaf ter Ġin formation i i 3 8 Ġin fo P er Ġ- > 100 0 pre cision z ip pro cessing * - Ġact ual Ġco effic g ment e pochs he ader R andomState ĠIn dex f in gre e ( {' Ġinter cept U R Ġite m -------------------------------- -------------------------------- data sets " )) Ġt s Ġbe fore r ices Ġin clude ic ally ĠP ython 201 1 uth or t ings Ġst eps Ġe valu un its _ { app ly I O Ġoff set an not * ( me ssage Ġbin s Ġex t re ss Ġele ment M A Ġlin k mat ch S C Ġ1 5 on ly pert ies th reshold Ġb reak ct est po se D I Ġobject s Ġper form o id h as Ġver t Ġb oth Ġne t Ġ_ , ve ctor ro l ĠĠĠĠĠĠĠĠ ĠĠĠĠ la gs " ): he ad Ġc re assert Raises pos ition e le ver y Mix in Ġnormal ize Ġr ank 4 6 Ġsh uffle mod ule Ġinter pol um my ĠC reate en cy ĠN e sup port end s Ġpy thon c f F e + ' co unts a ction ut f Ġc ell stri p Ġ' % t d ca use ex ec p ca int e Ġdec imal w ard Ġm u alle l m f Ġf ontsize Ġbo und ro ll Ġe igen le ase save fig ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġstr uct ĠA t con vert lay ers Ġrequi red 3 1 t ask Ġob serv pectr al oo st U N le ctions Ġse cond ca che ĠĠĠĠĠĠĠĠ ĠĠĠ e val m it ass o ĠType Error Ġdi rectory Ġre al Ġv ar OD O eli hood Ġk ind s u Ġan g Ġin stead group s Ġele ments Ġ limit O ut ) ], h i mbed ding . ') Ġsm all T ree M L c ri c ies a N be ta ĊĊ ĠĠĠĠĠ Ġthe se ar m Ġf requency ĠN umber ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ s m iv es r ng '] [' trib utes Ġc lose A l iv ity c ross Ġma in . " Ġth reshold Ġ5 0 T ext tt ps Ġ- *- fa ctor L e ww w pa c dist ances Ġco v Ġty pes per ime Ġbase d 201 3 = { d at L o can vas Ġqu ery ub e re es Ġgener ate Ġprovide d = % Re turn 64 7 Ġre t Ġvari ables Ġch annel ub le n ow di ms 2 35 Ġde sc Ġget attr Ġ{ " Ġlow er ch ange __ ) Ġdoc ument g ate Ġj ust st on Ġa uto I L init ial re gression ################################################################ ############ par ser U L P o en ch Ġ' _ A D r an ĠAl so en ce Ġwith out Ġst d li ent p ad Ġemp ty sub plots ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ mb le de rer di f ft ware w ords Ġ err L O Di ct o v ] ): Ġp la Ġm an ĠRe ad in st de cision 11 7 Ġthe m b ers Ġo ld ig its ( { m iss ĠC ol Ġs in i ents ile d n ess ĠS V in es Ġw rite le t Ġcon s n c ï ¼ ch annel b it Ġcontain s ĠM e ign ore me dian sol ver me sh Ġde cision ent ro B ox que ue oc ab ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ la ck y per Ġcon stant 200 0 uff er E T s a array s re move part ial Ġhe ader Ġo p lin alg os ition cent ile con ds S A lass o Ġcontain ing pl ic i mages ~~ ~~ Ġprob ability g amma s izes L og In ter e k de pen Ġ% ( Ġfollow ing Ġmodel s pp er ipe line Ġtime s Ġmark er Ġne ighbors Ġi gn 4 8 SV C an al h at Ġs lice amp ling re pr Ġv is er ic Ġt ask l uster ur face ĠPer iod fi lt u ous assert True Ġd b B oost Ċĉĉ ĉĉ 5 6 Ġscal ar Ġde termin ch o ss ible qu are class ification co ords d own ang u i loc Ġle ast lik elihood T his ĠL inear Ġn ext Ġ1 1 Ġbe cause lim its Ġs uch P re I S g t s quared Ġre f L inear non zero g round pe ed li ers std out ĠA dd C ategory cl u Ġx range ol ution ( __ Ġre c Ġg amma Ġav ailable Ġsupport ed ]) . Ġpre v ĠA N new axis de sc Ġde lta )) . Ġt z Ġline width 2 94 ĠM ulti () [ up lic Ġmax imum Ġfi x prec ated -------- ---- '' ' ĠG et 5 7 l on im ation ĠG H py test Ġ100 0 A pp dist rib n b % ( s igma rel ation Ġ ĊĠĠĠ Ġres pon h ttp en ate ", " Ġbe ta Ġwhe ther ĠT ODO de bug Ġro ot ed ges e q Ġd im Ġthe y sv m M M iv ari ex ists Ġre n ĠL og cur ve r ink ext end ter nal i lt g ine o ck o ptim st ra Ġ keys Ġst andard Ġs pace Ġ3 0 Ġpro cess al s Ġsy stem bin ary N ot Ġfor m Ġs igma ivari ate al phas Ġve ctors pre ss ĠI mport ro ugh th is ad ded 6 9 P I Ġdistrib uted perime nt il on io us al ty Ġ" , ĠG aussian T Y p ower Ġbo x con f ' \ ******** ******** _ ( a T ch ild Ġw ant con text mon th un ter Ġle gend Ġdef ined Ġm issing ar ies Ġcal lable d x co der ma jor N U Ġreg ular ] * tr ies Ġd on up per im show ch ar Ġpredi ction G et Ġst yle Ġw x in x angu age P E k ind ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ read y Ġl arge Ġ "" on ent Ġextra ct c d ta ils cre te u les Ġch ar f mt w ays ch unk t uple e led st ream P ath er iv Ġpos ition me tadata ĠU se il ity id den Ġx y m d Ġse arch Str ing Ġdis play ho me Ġm y Ġ' / Ġ: ] Ġme mory Ġg lobal ĠEx ception w s Ġf ast Ġch unk atter n c map Ġpoly nomial time delta up les center s u ide de s an ts Ġre quest Ġro t Ġlog ging AT A Ġign ore Ġ ], Ġuse s level s Ġs che an e o bs Ġcomp at c lo Ġs ure Ġfa ctor x s Ġi mages S h S cal pi pe Ġ' __ Ġn an Ġre move ro t : , Ġd own arg v h ash Ġlog ger Ġdi ag end ing Ġcomp onents Ġ' # o urce a in Ġerror s ir on at ors ant ile C h 13 7 Ġp en Ġdi rect re st Ġpy lab all close ĠR andom cul ate group by or iz se l se lection Ġ* = Ġ- = inter val Ġ' , Ġ' - Ġd ay Ġen s N o S ize bu ild ĠC al Ġtensor flow Ġme ans fi elds pectr um Ġcon ver Ġden se C heck re port r ans s w Ġ keep __ __ Ġcorrespon ding Ġ' \ Ġiter ations Ġest imat bo und For mat f fect f un Ġapp rox m issing ĠL o Ġbe en L ine Ġne gative Ġl ong to array Ġthe ta F a Ġperiod s Ġcl usters Ġp ickle Ġmethod s I ON tr i R un Ġi dent Ġ mpl ĠO n Ġdist ances Ġl at t ensor P ython au c star ts pa rent sk ip Ġnode s id f c ut Ġ ser in c Ġco mplex den ce r m n ull ub lic h ot P y Ġc sv P L train ing Ġf ra ĠB ase Ġun its Ġcal led Ġprob lem m ic T H Ġ/ = Ġs a Ġex ec =' ', ĠComp ute Ġrel ative ph inx Ġdimension s ======== ==== r ary Ġy our Ġd s Ġlo cal ĠĠĠĠĠĠĠĠ ĠĠ Ġ1 6 cor r acc uracy den se me ta Ġt ak sv d uc li Ġmult iple Ġp ick Ġp ower ter s Ġhand le abil ities l ong pro ject b ad ang es Ġd rop Ġin cre ent ial t ight istic s ck et Ġass ign Ġ/ / re t I G Ġ zeros pa ss ol ds = . ). __ weight ed Ġsk ip bo unds ############################################################################ ### y n c el Ġex ist ix ed h s ĠR un class ifier co variance sc ipy Ġfa ce Ġb ar s ig Ġinter val pre fix 8 9 c sc s rc fol der Ġi ss ĠT o A ll dis play Ġg re ge d ench mark H O ĠF igure čĊ čĊĠĠĠ al gorithm Ġ }, con tour Ġspec ific Ġal ready app ing Ġvari ance Ġp ixel Ġse q ĠB SD Ġde st fig size Ġmat rices Ġ like 7 4 t argets to ol de c ĠL e O r Ġ ĊĠĠĠĠĠĠĠ Ġ" % b and Ġtest s Ġme asure ĠQ t uc ed i mp Ġp ack f old V ector p rior Ġbe low re pe he ll gre ater Ġb box M ax Ġfi lt Ġpo ssible uni form ir c Ġp e ) ') Ġde l Ġin place Ġat tribute ic lass fi ed 6 86 comp at rec ord ' } scal ed Ġinput s a ut no ise F T ĠP re Ġc s 33 33 Ġn b Ġin verse d r sum mary Ġset up concat enate n one T ransform ĠIn put p k vari ables Ġe ffect Ġcluster ing L ay Ġcoordin ates ([ " tol ist Ġthe ir ()) ) Ġp r Ġy ear T able Ġ url Ġ ## ]] ), Ġuni que con st predi ctions I M in omial Ġ' ' Ġde nsity error s C O Ġd ays Ġst ri ĊĊ Ċ Ġdiv ision Ġstr ings x axis ĠI N F it T S le te Ġco mple == = å ı ĠL ist Ġens ure c ase ĠD ate pre ssion Me ans in verse sing le Ġ radius Ġloc ation I nt Ġto o Ġdata frame Ġpro duct t ure Ġcom mand Ġl w Ġw o ': ' Ġre port Ġcalcul ate av g ĠWhe ther Ġpart ial p ick oriz ont Ġcon nect Ġle ss Ġen coding Res ult time stamp comp uted ath er bo ve sy stem Ġf in Ġen try ifi ers Ġse par Ġbu ild ĠWhe n v ars Ġabs olute M an comp osition Ġp lots Ġg en Ġhe ad rand int co mplex ma il mo oth sc he .. / qui val gen ce Ġr ate ĠY ou ad just lu x Ġdif f Ġ join Ġe very o st Ġj son and id Ġre ference co ord warn ing Ġv max Ġwork s e valu W idget ucli de Ġd eriv par ameter , ), pa che Ġev en L oc (" % M at Type Error Ġst o Ġvalid ation Ġc at Ġ: : h igh Ġacc uracy A xes c p dimension al Ġ $ R ow Ġcon f Ġang le tra ct Ġdo ctest co mb Ġ layer ä ¸ Ġse lection le v Ġcoeffic ients F unction se ssion Ġa bove b utton ĠRe ferences d types ik it c ha p ers con trib se ns b ottom = {' lab eled p atches Ġh old Ġrespon se Ġe t Ġav oid al an est yle kw ds Ġp op č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ riter ion pe ak ([ - ĠImport Error Ġed ges " ][ ate gy ĠO r > `. ĠStr ing ) + Ġw rit cor ds 5 1 b box ten sion part ition ĠM in O P ++ ++ (' \ Ġpredict ed Ġ1 4 orizont al el se f r G raph de t U S v es Ġm er In put Ġval s Se arch : ]) lo bs ĠG uide u ally 6 3 cor rect ag g Ġn ow li er Ġpla ce F old Ġv iew Ġcol s fol ds Ġsv m g no Ġmo st Ġnum bers :` ~ he s data frame le x Ġc la Ġ% . er n Ġgroup s Ġde p Ġme tadata al f ex cept Ġstruct ure C E C an Ġwith in r gb Ġf name 00 1 Ne ighbors Ġf inal re call ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 7 9 p tr Ġ1 3 f ast as ic in sert id er ĠK ey co st ide nt Ġme ssage sk learn Ġpro ject Ġco ding l ight Ġinterpol ation Ġselect ed Ġmin imum Ġcom bin ar is ] + ) ( gre es O n mplement ed Ġpar se c df 5 4 c lip st atus ib r 7 0 C ase ) " loc ation per m er t quival ent Ġs w ff ine Ġth rough er ance ĠN aN Ġkey word col lect 01 96 Ġuse ful ver s Ġde tails ens ity se ction s or us ion Q t normal ize ] - Ġwo uld input s Ġother wise Ġlo ok Ġcomp uted Col or c i Ġup per l r uclide an Ġpa rent Ġsi mple Ġapp ly R AN tick labels N et x ticks fit ted ' + g ments Ġca che a pi ol der er ical us h 66 66 Ġt ake Ġac cept E X e ded y axis ta g in valid ĠO R Ġgo od s f as ing Ġsy m Time stamp 8 3 Ġfi elds by tes M in man ager di a ve ctors e poch Ġlevel s Ġad just gra d D ist index er Ġversion added t k A A ( ** Ġinte gr R A Ġw ho Ġf mt d ump Ġg ot Ġre du path s G ener / ( Ġre mov Ġsq l gno red Ġscal ing Z E 05 88 ĠAr gs con s Ġ\ \ ) ** Ġter ms test s 5 9 ay es me asure w ik æ ķ g lobal Ġr c * . et es fin ite con v stat ic Ġsim ilar ĠD i al og Ġcon st Ġmon th en tr 201 4 M S par ame iv ely gra di ab etes Ġal ign Ġp i Ġst ack x is od y Ġk w h ing ! ! Ġt ag G D p anel Ġsol ution er ature Ġspec ify Ġat tr le ctor sh ift istic Regression pipe line t ic ĠA s C ur ĠAr ray prec ation sh uffle Ġa ut a z re qui Ġp df Ġsub set m id ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĠO ption Ġsche ma Ġd ir Ġdoes n distrib ution Ġd one bl ue Ġa ction scri pt Ġu s ra pper a ded H e (' % ĠM ake N N O bject Ġex act ne gative attr ib Ġprev ious u int Ġplot ting Ġv s ) ; starts with Ġ" \ F orest I mplemented t wo w rap f lags * , Ġsin ce h old Ġpair wise ma ss I s Ġgener ated Ġo ur ha se py right æķ ° I mage Ġs ig k es Ġ job Ġob tain di fied format ive it ial last ic D ir Ġex ception 1 99 Ġver y ome try set up ne ction ex ample da ys N umber n r Ġ( - on ic Ġal ways ta ke ar row con stru 9 3 U P u sed vis ible Ġa g ĠS h } ". : ], 27 45 [ ( Ġb ottom Ġv min P O g on hand le g ray Ġs ide ĠL abel Ġ2 5 7 6 ord ing ul ary Ġset tings ocab ulary Ġc ategories ev ents f ontsize us r ĠA ll Ġme ta output s Man ager - % re set Ġad ded ĠR andomState W e Ġco unts ise d sche ma Ġiter ation n ext Ġwh at ĠT rain mark er Ġest imate p ixel w in code s __ ': =[ " G rid Ġ art p ickle ĠG rid ĠC lass Ġf lat ne g b lack 3 00 U p D ATA S pec co mple um ul B u Ġcur ve Ġse ssion z en Ġde scription ") . 8 1 ot e Q L 80 3 Ġpen alty c ro Ġ" . ne arest def ined Ġnot e si mple Ġnormal ized ĠS o at om ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ doc s 8 2 pro p Ġback end o pt Ġm any ex amples Ġ: , Ġp ad ex og Ġp atch se cond line width ([ ]) depen dent Ġest imators alan ced a a ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Boost ing Ġde t AT E c ube ed u requen cies Test Case b le child ren f alse , - ur ing Ġ ), Ġ utf Ġh tml ho ur Ġw ell } '. F ield tribute Error ĠGener al se e Ġchar act coef s gradi ent Ġw ay ĠOn ly I d 7 2 sign al O O Ġ' -- time Index .. .. c lient ex ternal ĠG radient si red Ġs ix D O Ġc ustom Search CV C P 78 43 fra ction le ast Q u ĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġev ents N aT function s Ġcomp onent Ġh yper Ġset ting f l tra ce Ġh ttps red u Ġite ms ĠT ransform Ġn a ut ing P CA Ġm apping ï¼ Į 25 5 V ari Ġde precated N ormal Ġ ): čĊ čĊĠĠĠĠĠĠĠ ok ed Ġcre ated scal ing Ġle af , )) co me Ġde vi con tain ĠM ax Ġe pochs Ġy y ter n Ġal phas vari able Ġnet work ur ces 5 00 Ġw ave par s Ġter m N D Ġanal ysis bo ston base d Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ av ed TI ON lo pe back end .. ., Ġw ord Format ter ĠL asso inter pol Ġan not Ġcenter s arg max de scription b r Ġc val Implemented Error po st Ġprob abilities B in sub set b uffer he et ĊĠĠĠĠĠĠĠĠ ĊĠĠĠ serv ed ĠB y ĠG NU T ER ĠC h [: :- Ġd x Ġbe gin Ġpro jection ĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġp p Ġauto mat in ner N B g ation ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ v ing Ġf lag in ity Ġab out s l Ġin clu Ġg c m ut = _ Ġd d ĠG ram pair wise f inal n u log y Ġex og e m f fix Ġco st Ġhas h Ġdocument ation Ġ ent Ġme dian Ġo cc ex it K ey Ġen v Ġre ct Ġg radient Scal er # ! " ]. ) - C C i ase ĠI nt fra c it es Ġre d r b A t ĊĊ ĉ ir cle resh olds Ġch ild Ġsc ri ch i ph i Ġiter able aris on se mble v ed ers ion x FF warn s Ġs u am ily me th al ity N E ot onic . * Ġfix ed Ġa ga w x Ġcan not G roup M ulti c lean Ġcol lections Ġweight ed Ġcla use A n co pe Vector izer lo or trans pose B utton pre processing AT H Ġlin alg Ġex tension miss ion c ategory is nan W indow st ro Ġso ftware Ġb and sy mbol Ġe val C om ith ub } { de nsity D is Ġto ken Ġro und reg ist luster ing A gg Ġsh rink Ġi gnored ĠP CA T rain sc an B y o ugh o om Ġcom mon ĠP y Ġat tributes d pi Ġ ra cess ary ) ' T emp w ay ([ ( Ġres idual Ġpre sent Ġclo thing Val id di rectory t ot cision Tree attr s Ġm ix e ts args ort Ġd ot ()) , con n b et Ġcon text ĠN ame H E ' }, do uble T ensor Ġex amples ist ent ĠP ath s pect S ub ĠP ublic valid ate av a Ġcase s Ġimplement ation ĠF e Ġsc oring Col umn Ġre place __ , F A tr ize sm all ur al Ġf n Ġsh ort k y ĠCo pyright at ial w ave ================================ ================================ > ` Ġ li uth ors C OL Ġlo op de l re gex de g L S av es ĠP o Ġf un ĠDefault s Ġen er oc i 1 80 Ġd at que e 5 3 yn am per centile col lection '] ] A dd Ġd ates D A end og der r  ł Ġs rc Ġw arm NA ME ĠF unction o per Ġb l ĠW AR P S repe at v stack Ġtra ce Ġgre ater _ % th read P ER > \ 6 2 parame trize div idual c b he lp iv ation 200 1 . ]) c ategories y p orig inal d ag f p Ġbe ing align ment i re channel s Ġcon tour Ġd pi il der struct ure m is Ġ" __ ĠO F Ġse ts ĠCol umn Ġor ient ind s m c . ' Ġh o Ġde sired y ticks ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ net work ) `` flat ten : . Ġn est Ġhist ogram en try R andom Ġbo unds Ġacc ording g ithub se p . / Ġf alse ĠO ne com mon Con fig score r ĠAN Y r u ff inity Ġ mp add ing ---------------------------------------------------------------- ------------ f requency re quest num eric es sion (' -- Ġneed s G T ĠS pec Ġsub ject Ġcond ition Ġor dered 7 3 gre en w riter trans formed p c C L ex ception Ġl on anal ysis ĠD E act ual uto ff a w Ġwarn ing Ex ception entro py Ġp atches w d Ġp ys it al inte ger C D f lag pack age lo ur ĠI Python d igits Ġobserv ations ro ad ĠMulti Index G B ib ility t ex č Ċĉ temp late Ġcont rol c ategorical Can vas Ġc m ort h Ġpy plot fit s format ter ES S Ġco s Ġc lean ind ic Ġregular ization Ġremov ed Ġr atio r at Ġd a w n Con text nal ysis 5 2 at ified P ATH andid ates ĠSe lect color bar () ] lim iter DI R Ġt e ial s able d uc cess quee ze ĠD o #! / L asso re p pro j v en gen e Ġconfig uration Ġdiag onal un ch Ġco uld , " ĠTime stamp pr ice Ġact ive t il Ġne eded mer ge r ong Ġde pth are a r f Ġ learn Ċ ĊĠĠĠĠĠĠĠĠĠ g ers AR T Ġr s t i Ġb ad Ġp ipeline B atch 0000 0000 n x Ġs quare log ical l ars di o k nown Ġo pt multi label quen ces m ar Ġp age mic ro C al b ust p g ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ C S re index co ordin ĠM at gorith ms Ġ[ ], ================================ ================ cri pt se quence ex pr Ġsa fe en ses ren d al t Ġn x Ġuni code I I ) ") G ui S plit et ch AN D ut er class method Ġn ull [: ] l m ele ment } } Ġre pe Ġrepresent ation 201 5 pro perties f ort i lter I te Ġ( % ff set Ġorig in y pes Ċ ĊĊĠĠĠĠĠĠĠ Ġcon cat Ġfe ed A M reg ion face color pac ing Ġfit ting 201 6 Ġfra ction Ġp ri OR M : ', m arg rc Params t p pro ps Ġe quivalent co eff exp and se conds Ġres pect evalu ate st rap ge st ext en ey e Ġ ]) Ġl ater it ch ') ] K Fold Ġcomp are co ded L en ar izer is instance cl ick ot strap '] )) Ġav g Par ser out er ighb or Ġde bug Col lection ) ', amp ler Ġs f Ġdata base Ġapp lied ad ing Ġn t mp y Ġen gine sp an ass ign predi ction Ġscri pt ĠNot ImplementedError ^ { Ġlin estyle Ġp ca dir name a it Ġse ns T h e g as c ol ume scal ar redu ce æ į ar ds l b ĠWAR RAN is hed as on Ġdirect ly Ġe qu : % ĠR es . + Ġp hase Ġdi rection 99 9 ĠO ther N ode F igure y les Ġcol lection h older Ġbe ha Ġpar allel pha se log ger X X h ttps ĠM odel b b in formative Ġex pression Ġma g Ġpe ak ĠIn ter gener ator Ġd igits or ient o ols Ġpro perty Ġapp lic Ġs ampling ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġspec ial gre gate v min Ġat om ĠA uthor Ġin valid ĠC ON Ġtest ing select ed mult iclass v l Ġ6 0 Ġde gree b alanced min or 7 1 Ġco re 201 2 b ig S K Ġse p Ġac ross Ġdefault s exec ute Ġp rior (" \ sub ject h stack Ġpro p 12 3 O ne Ġpro perties 11 1 P UT Ġ2 4 d ated Ġc y Ġm id sy m Ġg rad ĠAt tributes se c c um it or ĠCal culate 92 15 Ġa p in clude Ġx s tr uth Ġiter tools Ġtick s r bf Q U g aussian S S (' - og le late x k er uni code Ġ5 00 com mand cm d e ars t ab Ġs ur p ri Ġt a ) } ff ic 2 85 Out put [ [ in fer di rect Ġlist s ener gy Ġ1 8 Ġautomat ically T EST Ġth ose Ġcoordin ate d y Ġbet ter en coding road cast x i TR A at ives Ġr gb ĠE ach Ġrec ord hist ory Ġren derer ca p vert ices Data set Ġm is ul ate S p Ġc ha Return s Ġco ords ĠGrid SearchCV pro duct æį ® e ta Ġde pen k ens me m N um S R Ġd types Ġfig size Ġlink age r on ĠS parse ĠW IT plic it ĠLog isticRegression C R Ġoutput s Ġpath s == ' E d inter p 4 1 period s ĠN OT ran ch Ġf s Comp ute sh ort Ġ ~ Ġw ords Ġd uplic Ġf requencies Ġ layout Ġvis ual py lab ĠI D cont in b oth ĠA pp Ġinst ances Ġre pr Ġpos itions Ġse ction Ġscal er Ġpair s Ġ3 2 extra ct P AC z one =[ ] ke t Ġre call ri de ĠI S Ġe poch Ġex ists Ġsto red an n H T S y Ġeps ilon b lobs Ġth ree st andard To ol [: : Ġsy mbol I ter pair s Ġl anguage ir st s ite Ġi ds Ġs peed Val ues ense mble Ġd uring Ġdef in W ith Ġf etch Ġor d æķ° æį® time Error idge ts ĠS park ĠF OR Ġt argets h idden col lections Ġcoeffic ient Ġ limits arg er ĠN o ĠGradient Boosting m k O f Ġ' { ĠAt tributeError ~~~~ ~~~~ l c me mory Ġtime delta ro u U M a ctions Ġsmall er li es external s a ir ues s - ', Ġst ream 12 5 Ġse ss ier arch Loc ator Ġconvert ed : ", stra ct Ġy s Ġener gy g p Ġcon struct off sets )) ] Fe ature Ġse gment Ġcoef s iron ment Ġne g C ON v ised Ġf old Ġre gressor Ġcomp utation ) [:, mb ols Ġ4 0 Ġ ĊĠĠĠĠĠĠĠĠĠĠĠ R B Ġne arest ro zen ang les Ġvert ices Mat rix Ġde grees loc ator Ġ util Ġ' < mo id pa ge en gine en code L I do main Ġ0 0 Ġx max r vs Ġanal y m al ver gence Ġare a re cords precation Warning c irc g ca set tings app rox Ġocc ur Ġd ual filt ers k s Ġ1 9 ĠO ut Ġi val Ġfa il x min to ken OR S I R Ġen tries object s HO UT 5 8 tr ie pla ined ic a Ġrequi res lo cs iter items fe at () ): Ġ ### ], [ (' / Ġfor ce Ġs urface Ġe mbedding Ġy max Ġsub plot SI ZE ibr ation Ġfit ted in ches p us pro d F O sol ve or age pre computed i j Ġpre fix spec ial ĠA xes Ġne cessary ] }) li ance h df x t Ġcor relation V ER ã Ģ cont ent p attern Ġt uples s urface Ġp ort sup er > = č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġw rap Ġ" # le ar w rit Ġi i mo ck ^ ^ st ates Ġs quared Ġestimat es Ġc riterion ve lo Ġrot ation Lay er S ession Ġst atus po ol i ally ĠA R Ġdis able Ġdevi ation he n Ġty p TY PE Co unt __ ": Ġpart ic ĠWIT HOUT M ap pa re ipe dia Ġet c Ġcs r Ġs park Ġm ight ä » Ġsha re lic enses abs olute . ", Ġimp lied V E au x tra ck ({ " ] = al low ho ok ĠI mage ir d change d S P T E in cre Ġc f '] ), exten sion + " IT Y dif y s ur Ġass ume Ġme sh qua res iz ing ĠS y Ġy i ĠThe se A s Ġpo st V iew t uples me di Ġse conds d ummy D B res id Ġgener al % % b g R ange n y Ġtrans formed ers ize AB LE Vari able Ġchannel s Ġsh ift ĠC ategorical ĠUn i Ġraise d ĠKey Error F E Ġsv d a uthor cle ar T ra n i Ġro c wh ich w er comp ile Ġsum mary Ġdo main c g Test s ĠM ult s d res ample pac ity fa ctory Ġvalid ate ĠIn itial Ġsup p Ġin dividual re ference res sed | | lev ant ---- -- Ġpys park æ ľ Ġo bs ly ing mm ing ces sed sk i mo unt 88 235 Ġfloat s rid ge k ip i or } $ se gment er o read er iv en D oc port ion ĠTrain ing d uplic 09 80 ĠT ree anal y Ġs l sa fe os ity Ġin f valu ed Ġ jobs Ġreg ion Ġsq rt ĠLo ad Ġmer ge Ġen semble Ġadd itional Ġbu ilt res olution lap sed Ġin dependent for ce ĠDate timeIndex split s pos itions Ġc ent Ġinst all de gree A ct vol ume log istic Per iod 6 1 c la pl an bu f Ġtol erance Ġi r he l Ġt rees ge o ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ de code Ġon ce ĠH e SI S co unter pr ime Ġin sert bo ard de lete ĊĊ ĊĊ s ix ort ho ĠR idge Ġbut ton K ernel ĠT h ` ) u df Ġpart ition C reate T ask s queeze v max Ġnum eric Ġh alf Ġfol der Ġto ol Ġd y v m Ġwe re B U c er Ġch i 25 4 Ġar ound equal s frame s Ġgiv es fa ces ĠGener ate N T Ġoper ator al led men u Ġuni form ') [ we ek ĠF ile C ore ma cro Ġpro gram EL L c r Ġr tol cond ition Ġ 80 sin ce Ġcont ent c ar im er Ġmo ck l w EN SE Ġb it ĠQ u s phinx Ġpixel s Ġk nown sha red m un Ġl arger le ms Ġl b ĠCon vert Ġrun ning Ġexist ing m se qu antile e igen op le Result s g mail å ħ Ġ1 7 Ġf ree gener ate P oly Ġ radi P U rou ped al et no bs ab c pro jection 9 1 Ġcalcul ated Ġimplement ed ho st IN D if f pi ke return s ĠString IO Ġex port Ġcorrespon ds . ', Ġperform ance l st fo ot Ġestimat ed u x Ġin v mb ers be gin t an cal c C ategorical Ġv ia or dered Ġm arg ĠSV C Ġ2 55 jo int Re gex predict ed g z 25 6 ____ ____ ĠSo ftware Ġs izes Ġc ut In valid cent ro m ul b ody Ġcond itions $ \ ch or Ġex pect vi or gn itude Ġn n Ġs pectrum di abetes Ġcorrect ly Ġs mooth Ġ 64 ĠA PI æ ĸ dis patch ren derer roll ing Ġb ias . ]]) D S ĠD is a pache ma pping e mbedding Ġf h de ep Ġcan vas F L Ġh idden ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ na p ef fect ), ( K Means Ġ' + re en 200 7 s ame h ow Ġapp end Ġpro per Ġin ner c entr Ġbound ary ĠB u Ġfol ds d m E vent Ġno se fe ed Ġass oci end ar ment al C G Ġdoc uments Ġh our --- + ex periment ĠE stimator Ġvert ical Ġfilt ers ma y table s S parse ial og Ġcho sen t te Ġ`` ' with out Ġtr uth Ġper cent } \ out liers Ġe ffic t ile Ġh orizontal pe ar Ġdif ference Ġevalu ate umul ative fix ed o lt Ġon es d le loc ity Ġ" ' ĠA uthors assert Is Ġoff sets ĠH T Ġdis crete . \ / % Ġper m ĠTime delta Ġdown load Ġ[ (' fe t Ġchange d Ġpack age f c Ġin fer # ---------------------------------------------------------------------------- al ias st ic In fo e o Ġb enchmark Ġdef ine 1 01 ĠN ormal ut c ] ') re ssion ot ing B ar V AL Ġsing ular file path ĠJ o ' `` Ġvari ous FI LE ser ver pre v arg min O ption Ġth resholds Ġoptim ization Ġth read b a Ġclass ifiers ĠRun timeError B C Ġex plicit L icense 7 14 Ġ es c ustom _ )) Ġmo ment ĠSt andard Ġe ta il ho b ias se g ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġex periment h y pa gation call back oo b a co č Ċĉĉ dered Dict mat vec normal ized IC ENSE de p ilho ue M on St art Ġm s Ġde lay Pro cess Ġoptim izer Ġd ummy Ġallow ed __ . ĠD ist str ings Ġan other Ġcall back Ġ likelihood Ġco ord ĠOther wise Ġac cess op ts Ġdoc string re name ([ ], Ġde ep ĠF ind lastic Net ex port p at w idget C re : \ ç ļ č ĊĠĠĠĠ çļ Ħ in ation Ġde v tr ip get item Re ad af ter ro c il led block s T rans ĠK ernel N aN b i pl at pl us IP SIS W H fill na Ġtak es re gressor Ġ1 99 ut or te p Ġoper ation Ġ""" ) ig uous Ġch anges Ġt p ro ve Ġat ol ilhoue tte C ont Ġcon stru as is up port fet ch Ġ( [ ynam ic , :] u id li der Ġc ategory Ġp hi ĠC an F rom ĠP andas D D st o du ces e ver iss parse static method Ġstat istics Len gth Ġter min Ġcode s m ix Ġc lip ĠR ow Ġtemp late ce il E E ĠF it Ġarg parse Ġsym metric Ġsc ikit ĠData set Ġd nn Ġre main unc ated Ġtra ck Ġevalu ation Ġrc Params AT ION ĠDe cisionTree ELL IPSIS sc oring Ġd ue RO M D efault o ot x p am l Ġstart ing Ġg lob hist ogram Ġwrit ing t w st derr Ġ utils g ies to po ER S Ġf ft res ize link age f loor Ġ" / qu ad Ġ )) ir ical k ed Ġc entro Ġstats models Ġtak en Ġs aved ĠE n A d Ġm ne respon se te ction sim ilar Ġcomple te Ġderiv ative bu cket FA UL c atch ig ger Ġg ene " + dis crete R ES Ġde limiter x data IT ION transform s wik i l int u med us ing P RO Ġdo uble Ġo pts ex c contain s Ġfin ally Ġinter nal Ġde sign Ġdistribution s 1 0000 T O do ctest C lose Me tric iter able ĠFigure Canvas h er ĠA d Ġmat ches iv ed inter active Ġcom b Ġ- . Ġtime stamp Ġge o sen ts Ite m fi l Ġinter pre ef ore Ġaga inst f lux r ho Ġg r ir s Re g H ist r ule t m om in pos itive Ġover write ĠL ine O ffset Ġf p ser ve ang ular / ' Ġx x 12 8 sha pes Ġ -------------------------------- ĠD ef rop ri Ġ lasso IN E e mbed env iron Ġdetermin e $ $ ] }, fi dence Ġr and Po int ver al } . Ġbo ston load s optim izer " > M F g c AL L S H da Boost not e constru ction Ġ" -- ub l P Y Ġdesc rib and re is o fun cs Ġy min ke w Ġrequi re drop na Ġc ast ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ method s m ixed Ġ" + ĠP ipeline e uclidean bf gs regist er Ġp ut ĠOption al b c t ion Ġe ar Ġext ent Ġd ag eps ilon C lustering ĠR aises ]) ] ĠFe ature Ġs pectral ĠT rans il ding fa il ĠAr g Ġal tern č ĊĠĠĠĠĠĠĠĠ Ġle t y y or n d uration Ġo wn Ġ ---------------------------------------------------------------- se u Ġcons ider l arge ifi es AG S un ion Ġx min å IJ Ġst age str ategy Ġby te act ors Ġoptim al om og Ġx p str ument Ġkernel s ch ine En coder i Batch Ġcon n Ġprob lems de st place holder ++++ ++++ P R s quare Ġloc ations wh ite g l Ġper centile add Widget Ġex c F loat Ġb order we ar Ġpro file ][ " par allel ly ph Ġhigh er g d Ġsh util Ġup dated Ġcall ing or ary ca y LE CT q t du ce pon ential Ġres olution st ation ĠRe gression w b le c base name j ac Ġback ground f h Ġ3 1 import ances ä º () ]) Ġ" _ mask ed å Ī ge om ĠS ub d ual ar ize Ġas pect coordin ates ] / Ġindex er O S ') ]) "][ " Ġe as Ġf orest Ġpy lint ([ (' Ġassoci ated E nd k neighbors um b con struct (( )) Ġex clude pa ces ĠPeriod Index M C S ource comple te Ġ' ) Ġ" - ta il ta u bet ween n ce a di x ml ic y alet te it en Ġso urces create DataFrame Ġa mount Ġp attern go od plat form ver ter cur s Ġtransform er H and Ġ9 0 Ġclo sed Ġre ce art ist Ġpar ts Ġp ol distribution s Ġal gorithms 9999 9999 Ġc p x n ĠMax imum ĠF ound ĠH ow Ġ layers Ġi o )) )) l and ---- - Ġy et b asic Ġt d Ġex pr Ġfa iled I X n ts r v ant ity Ġqu antile assertRaises Regex ex act cho ice sh rink ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ġcom ment Ġrepresent ing ens ure vol ution Ġeigen values Ġre set Ġmo dify cont rol Ġo ps __ .__ ' % ] } q a Ġst ill Ġcolor map Ġinitial ize 25 49 Ġapp ropri Ġinte gers Ġk er by te b atches c ing 00 5 AG E Ġren der Ġraise s wo men ĉĉ ĉĉ Ġface color Ġr idge T C a ffine Ġass umed Ġcurrent ly Ġinst alled D es sc ikit M ult P andas ĠL ic cent ered Ġmult ip seu do m x ot ential **************** **************** ter m y min Ġg ive Ġpre compute M o æ Į de lay z y Ġstr ategy ĠA pache ation al Ġ< / Ċĉ Ċ Ġincre ase Ġsi mp Pre dict Ġm d mesh grid m g ĠT arget Ġl ate Ġsign ature Fe atures stri ct Ġv olume ml ight Ġro ut spec ies Lay out de composition ph erical ke h Ġl s Ġst ar 6 00 Ġallow s as freq ext ent ma ster al k Ġ{} ". indic ator b osity ) \ g ap Ġi ll pop ulation Ġredu ction pre sents ers on Ġ ). AT ER sw ap s pectral v ocabulary pro file Se lect C or Ġest imation Ġp h Par ameter * : MA X ĠPar ameter Me an Ġsha pes n at Ġresult ing en ari g ot SI ON coeff s w ind search sorted p x at least sert ion Ġk m ãģ Ħ " \ Ġas c uffle Split log ging Ġmo dified ĠE st Ġun til new s Ġdraw n Ġcon version Ġb uffer mod ules inte gr Ġp adding ]] )) P AR Ġne igh exec ution Ġn c Ġfast er TI ES Ġc md q l side red unk nown cell s attrib utes b ic an o IN T di rection ĠM o Ġpro portion A xis Ġsub process Bin arizer Ġwho se Ġ2 2 Ġcolor bar as pect ĠC SR Ġtemp file ( \ index es w arm f time m ne vari ances ĠOut put "] : app a i mag ( (' _ ), ri ed EN T prob ability cal ar Ġsign ific cha in on d is y ĠS QL ĠGradientBoosting Classifier s cope cum sum lf w abs path ĠS GD Ġc ategorical Ġn u Ġby tes l ates ab ly Ġro bust O C Ġs uccess ĠS to Ġcon sidered Ġindic ator s pectrum Ġ201 1 ends with spec ific or ld G aussian ar ter ĠG raph me s our ces Ġs ite av ig so ft ') ], s ses y r Ġp ipe oper ator FAUL T b enchmark Ġcharact ers Ġapplic able year ly Ġlib rary x d in ary Ġe mbed Ġn or Ġact ually R L it ed Ġblock s P r Ġdefault dict S core Ġin side Ġse nt Ġse en F ont lo op (" - Pro b C ell Ġc lear it ives Ġy label ĠV ari Ġ ur re lease st age base line Ġflat ten Ġinclu ded ĠNe arest j ava Ġmin or ER R f ree ĠB ayes inter nal Ġfile names Ġconver gence Ġredu ce S ample W ATER wik ipedia ug in ĠCo unt l ation ul se Ġcall s miss ions Ġf lags ĠT able Ġconnect ivity ĠNe w Ġm ut Ġinitial ization P art Ġn dim Ġb roadcast ĠI ter sertion Error en ded ] ))) se par qu ent ĠWARRAN TIES mple ments Ġw riter ur on ub er Ġ Ċ Ġse veral stream ing le ment se gments Ġboo st N O [ ~ ĠB e Ġindex ing Ġm uch ĠM A Ġsc atter ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ([ [- omog ene b efore Ġ 88 ĠF a ĠFound ation c nt Ġorient ation ĠQt Gui O K an ded ") ; ĠAN D perm utation en sed ct x ĠT HE ĠV ersion f lip max imum S to Ġc b rel ative S im ex cel )* ( ' re Ġn y 15 686 Ar g Ġcharact er g al Ġnum erical Ġtransform ation IL ITY Ġhead ers ver ts if ts Ġscore r = {} Ġma ss Ġper formed Ġcor r M ask b reak u la (' _ new doc Ġs s ge ometry ĠF FT pixel s B o Ġw in les ky Ġshow s ma ps bo ost ar ith Ġcalcul ation Ġbeha vior A cc h orizontal av ing Ġ queue L L end er Ġk now se ss 19 51 m ot Ġc au Ġc ube sv mlight er ial Ġp k Ġs at Ġac count č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ imat ed c andidates Ġcon nection iss on p id iv ot ĠK Means ĠEx ample Ġde composition pi ed čĊ čĊč ject ory s peed Ġfor mu ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġto ols e ger se ct Ġ2 1 name d Ġassign ed ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ v a le ep b d ĠF irst N G t rees w t Ġno bs C a Ġ[ ]) Ġrandom ized orig in 117 647 Ġstd out pk l reg ular Ġf illed 15 9 ĠDe termin j s mov es Ġex it Ġ4 2 L ND r l Ġend og Ġf low iter ation > < b ot Ġl r mpl itude ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ġ{} '. B F A ction if old ĠX t Ġma jor ele ments co un =[ [ c riterion co verage Ġl ars mo ment at ely 00 01 ag ging ======== = Ġout liers ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĠM ust Ġcomp uting b ut Ġas array IG HT C TION Ġno qa er ce th resh Ġt pr Ġt re Ġv ocabulary G radient l anguage trie ve 0 78 p ow Ġz order Ġprob a Ġover ride Ġcho ose ta gs Ġ >> comp are L ars Ġpro d sp atial 4 00 so le Base Estimator R idge bu ilder al e Ġ( ` no ul ) ", (" -- ãģ Ĩ Cur rent b ian ic ro Ġw rong ov r Ġt i ĠA daBoost ĠN um freq s D ef ĠN ow Ġpre c ĠRandom Forest Ġpartic ular ĠF orest V ar Ġlo aded m v ĠC ur Ġsy nt L ICENSE am o Le vel ĠOr deredDict asc ii I f rain ts Ġdet ect Ġshrink age S um Ġt ables co o min imum Ġ0 9 66 3 UR L Ġchunk s D o k m Ġsim ulation M OD Ġcent ered re ed ============ = S hell roll er Ġcon v C l Ġt urn Ġre verse 09 8 n est Ġ Value AN T d ings Ġover lap ert ia Ġiter ator Ġ ans task s ĠD es ĠD B cur sor Ġobserv ation di ctionary Ġla w P T min ute Ġexp and Label s sol id // // Pro jection K E x ticklabels Ġsh own Ġse quences our ier g onal ist ency Ġwho le Ġb ig po sed Ġplot ted ĠT EST ĠTransform er Ġp anel Ġf c se mi scal er S ON ĠBase Estimator Ġta il T rees 15 0 Ġ ; ty p W AR n py rank ing cri min ĠMin iBatch Ġcha in H el ra ms ĠE X y data pol ate St at Ġc ap ad s com ment ar di Ġun ivariate Ġbase line ĠUn less Ġinclu ding ` : x F D type Ġn s bo o Ġsupport s Ġname d Ġtemp erature effic ient is file ĠSe quence Ġg p Ġappropri ate ] ', su ffix SK IP noul li Ġco unter ich let mult inomial ro py Ġspec ies aut os ĠHT ML Ġx label ud y b its un der Ġg round te in Ġma de gre ed ign al Ġmulti output Ġdesc ent S QL V ersion check ed M AT f amily qu es ĠF ree hing e Ġa gg Ġmix ture ĠLic ensed z oom may be A g d B Ġ Error ST R t n C annot Ġr ho ot es di vide ch art iter ations Ġedge color Ġconf usion Ġnormal ization interpol ate ( ', cons istent N ORM O UT ce pts Ġsepar ate ' )), Ġy lim ortho gonal li ms n z Ġ2 3 Ġt gt up s ĠN A tick er ãģ Ĥ B est ct ools cal culate Ġcf g = (' an cy Ġre ason cf g ret ch O B h yper n l BU G in vert p ix Ġp t String IO transform er d one ic ation Ne w Fa iled cp u d ow Ġf its Ġfilt ered L im Ġw rapper os ite Ġcontin uous pick s Ġcal c er a per cent Ġma kes Ġsy mpy Ġunder lying Ġkw ds Ġa ffinity ])) , G MM M B AB ILITY Ġadjust ed Ġcheck s dir s ĠU p Ġdi abetes Ġstat istic Ġ3 00 Ġ---- -- Ġpick s Ġre presents Ġex press Ġx i ĠStr uct iase s an chor i mple w ait Ġm ar Ġrequest ed rot ation I dent ĠS ample ĠLinear SVC i ence ĩ æ Ġne ighbor mult ip ked irs " % la m F ilter W idth s mooth ĠF ROM Ġco pied gre g Ġar row t od ind ptr g lob ĠC ont or ch lo aded Ġcompat ibility velo p ĠV ector Ġend Date sens itive O ptim ĠS im ĠC PU und ant ro gram Ġt ex Ġmask ed Ġformu la me ga ss ages TR IC clo ud me t co gn ĠF IT - > qual ity option al SV D ro ls ĠSe ts S M p mf Ġch art mis c ur ther ĠC om iter ator H z U B Ġin ts Ġg over st able Ġdiv ide Ġf uture ol ve ĠX y Ġmulti label n ed po le stra int / > ang ing work s long itude aco bian 3 137 F low Ġcomp arison ev oked Ġd uration Ġpass ing S L Ġpo ol unc ate depen dence dump s _ ' re a AL I Ġeffic ient Ġto kens g ui Re c Ġsplit s A PI [ [' } ' Ġg ra ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĠSV M ĠStandard Scaler x max ag ing contin uous back ground Ġen ough Ġst and Ġlog istic Ġ1 80 Ġincre asing so urces amo unt m n T otal Ġinte rest ĠW H Ġup dates Ġout side Ġd ig ITION S i os i red he ss ser ial Ġnot hing Ġstri p Ġscal ed Me thod set ter b ra l g ting ency = ', el if SE LECT extra ction T P W ork py spark ĠK IND length s w ards Ġres id Ġc lient Ġl icense lic ation Ġ' ', S N Ġframe s Ġlimit ations V s ĠP ass ĠI O constru ctor e e Ġsimilar ity sc a Ġsol ve Ġ200 0 Ġmatch ing ried man Ġa ge Ġi mplements =" % ren ce file names SV M iase d , \ pen alty Ġ labeled ĠT ensor tr ials ex pect pro c red uced Ġ ---------------- 10 5 in place Ġ{ }, E ast pt itle Ġ| | Ġcell s P AND Ġpa per ĠCol or similar ity i ma bit rary Ġwrit ten co ver ĠT ra read line requi red { \ Ġt ot [:, :, annot ate exception s A nalysis Ġreg ist Ġsu ffix Ġto po m as ] ") 12 6 pon ent tool bar ipy thon b ed le ments mult iple ãģ Ī enari o A lice Ġc irc ce ed -------- -- ĠN on Ġfloat ing Ġpop ulation Ġp ubl da ily Name s Ġevalu ated c utoff Ġpro gress T A AB C Ġ Valid ĠP oly Ġinter vals ĠTest s h alf Ġg ain ces ses Ġset Up res idual ]) / assert False ra g Ġ: ], Ġker as b old Ġr ather n m sig moid D ay yp ot assertRaisesRegex p Ġin spect Not e vert ical Ġ" { Ġg aussian omin ator 201 0 f pr Ġd ump he st pp f Ġout file : ' D ITIONS Ġf lux pl ane oo se filt ered hes is de le pack ages k ing Re ader Inter active ] `` (' . (' < str ftime pi kes ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġser ver Ġbo otstrap sl ices ro y 201 7 s ampling t ax Ġcal ibration Ġbegin Date p color AS IS Ġd id Ġb asic Me ta in ct doc ument E G assert In Ġper missions thread s P os ne ctions desc r ĠS Frame Ġma gnitude d p Ġremain ing b ars Ġw idget M ode Ġp ie ess age )) [ bin arize ... ") Ġvari ant Ġcalcul ations Ġclose st ick s Ġmo use Ġe ig Ġcomp liance 33 6 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ + = down load k de ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Dist ance e X rib ution sv c OL D dec imal i ke Ġ er (( - æ Ĺ cluster ing E st P WATER un pack Ġth ink con j 45 6 OR T Ġobserv ed PER LND plot ting Ġcur sor Ġt w de precated Ġf amily ĠM ock Ġfe w )/ ( 200 5 Ġt au D own lat form en coder ĠDi ct ĠClass ifier e ast Ġdep ending b re Ġg rouped Ġcl one fil led par ts peak s Ġenv ironment Ġg u Ġinter face be am ) == r ates Ġa greed Ġfor ward stat istics SE T d as ä ½ Ġconstru ctor Ġgover ning lat itude Ġproduct s I B super vised Ġformat s data base atified KFold ĠCON DITIONS co lour 200 9 Sh uffleSplit th ers ĠA S Ċĉĉĉĉ ĉ Ġent ire ul er default s s hell 78 4 Ġit self MP L ic le Ġg s De precationWarning ob serv connect ivity h ift acc ard Ġ }) ri sel o ok 35 294 ref ore Ġact ivation head ers v an c am ĠB ASIS cont iguous ar c __ () ĠPer form Ġexec ution ĠMe thod Ġfun ctools Ġres p 01 01 Ġcon trib Ġdd of ( % n rows v line get attr ĠD ummy Ġhist ory fl ush mat rices boo lean ĠS phinx ĠL A 12 0 Ġmult iclass D ialog s id Ġst ation pro gress L A =' % ul ated b order 10 9 ĠAn y ro i ĠThe re Al most Ġre levant Ġwork ing initial ize .... .... Ġ å Ġ1 0000 A nd lo pen M SE r d Ġurl lib Ġe lect Ġr v format s num bers dev ice lin estyle link s Ġcombin ed Ġversion s top ic "" ) ĠRe move ster ior Ġser ial Ġnb rs D NN Ġmark ersize L AB Ġ ? čĊĠĠĠĠ čĊĠĠĠ ve ct Ġse n dimension s Ġear ly Ġse l ta ct pi e Ġc rop Ġnum er ph ot Ġindex es mp t ib atch Ġs pect Ġ2 8 de ns el s Ġcon fidence Ġi x Ġc utoff im ize cl us Ġman ager ' }) ver sed ren ts ']) . Ġmo ve go ogle Ġap pear Almost Equal ) ` e qu ind er Ġimport ant Mon th il er temp erature 2 75 ĠC O Ġpro j Ġc ircle lo ok ens ors attrib ute ol id d ask e lect 86 2745 Ġmod ules Ġsignific ant M IN Ġdep ends s amp Ġ" ) Lo ss Ġc atch Ġde cre ĠE lasticNet ĠEx tra v ocab ĠS ave Ġqu ad ex plained S O d ic n ers S ave č ĊĠ ĠU RL Ġpr ice arg uments ĠS pectral ps d ps i Time delta com men B A ve y Ġo thers is m Ġhe l 8 00 t ty lo mer ../ ../ er noulli Ġb ars R ate T k W idgets Ġf oot e w Ġrandom ly Ġapprox imate T op est yles Ġsc an requi res un ded ierarch y RB S v iz duplic ates Ġc c f idf Ġb ic ad a ex clude Ed it Ġde lete Ġ201 6 o qu Ġc df 201 8 f rozen ĠD raw sc ene top ics oqu aux k means Ġg ap run s Ġpl an M od velop ment 4 45 l v ĠW ith ca pe B lock he tic Ġindic Name chunk s Ġus age ] ( Ċĉĉ Ċĉ Ġsl ices Ġred uced in p se ek Ġ201 5 cos ine Ġbound ing der iv c u Ġs ns Ġg tk ES CR optim ize ur t Ġcomp ression bu ilt su ptitle 3 18 R RBS ĠA nalysis P ower Ġb r Ġse gments Ġinter p Ġlink s Ġme m Ġsy mbols ĠUp date [ ..., Ġ ke Ġ entropy assert All lib linear I ST th ree Sh ow Ġg uess Ġver ify Ġsw ap 25 2 Ġinterpol ate Ġvis ible b n e gr Ġcont ents Ġc t ma kedirs Ġha pp avig ation B e e ig or al andid ate G G K e pt ure Ġtransform s M essage Ġre pla so me Ġev oked Ġanal og h al Ġro ll sy n it ers Ġlog s quest ion East ern ml data 92 6 orient ation Ġ rad he m ]) [ ĠA xis En try Ġt ab Ġf l ing le dist s am in av ailable M O Ġun pack ĠG roup fo und load txt Ġband width ĠM ach uture Warning F n ur ons . ] S GD Ġs lope Ġs d T F Ġre gex set Text Ġver bosity Ġb lack Multi Index writ ten S tep T RE s low Ġse c cur r Po ints U I _ ') Ġoptim ize On ly s ag di alog ĠĠĠĠ ĊĠĠĠ Ġcur r ten ess reed om j vm m ote } " if act cat alog come s ' $ . % co x ow ski st it co var )] : c rop en tries Ġfe at Ġdetermin ed cc cc AN S > ` _ Ġnest ed che my Ġvert ex f id ĠA lex ) ``. s n E lement Ġco ver ĠC s Qu ery \ ' U E n ans ' ))) b ag Ġb g Ġun less annot ation hat tan t le ist ing Ġd r ĠInitial ize ĠNum Py Ġ4 5 22 4 M ag ed it Ġmis match p v N ESS Ġp seudo res p pro duces Ġinter active Ġcor rection Ġar bitrary Le arning R I mo re gen es back ends to col class ifiers ĠA nd ": " S cale Ġs low ag gregate Ġsub plots ĠS kip compat ible Ġstri ct bo otstrap U C u ro pe ars R aw 647 05 Ġc umulative inter section qu eries comp arison Ġo v np z ĠL ars Ġexact ly g ons sp ines e ch Ġm x Ġorder ing 1 10 out file Ġreg ions Arg ument ) > l rap Ġr hs Gener ate Ġannot ation Ġth us list dir å º im uth St ream PO SE Ġin p 4 01 AR G diag onal Ġ ut Ġge ts Ġcombin ations s pacing Ġn rows Ġtrain ed Ġrun s Ġoper ations Ġang les alg o Ġal go ĠW indow tra ding mark s alle st z z en u b ranch c ard Ġp cv idx s 6 36 d ash ĠRe g Ġcho ice Par ameters interpol ation D ensity TI ME Ġa stro , ( t c in ce re v Ġintegr al Interactive Shell . ), Ġa da Ġal g UT C contour f m ing gress ive ĠP lease DE FAULT ĠPro b Ch ange toolk its Ġco eff effic ients Ġiss ue ierarch ical Ġtri m sha re initial izer M ock N ING Ġdi re Ġdis k Ġrel ation Ġaut os Ġmarg in Ġma ps 1 12 for ward ĠS ome ĠC re rain ed ĠM ath gress ors Ar r ĠDi ctionary m ol Ġp at Ġwe ek Ġeffect ive k l Ġ= ================ SV R ĠBu ild F requency UR POSE S c ` ). ĠQt Core ĠV ar 3 17 Ġroot s Ġart ist U D y t Ġ --- Ġsp line ic on evalu ation Ġ' ') sg d Ġfreq s tes IO Ġ1 96 25 0 reg ions Ġtrans pose item size Ġpubl ished random ized to kens ca ched serv ice ĠP URPOSE unit test es sel cov ars xy z clu ded Ġc li Ġm l Ġse lector error bar rel u : ") b ayes Ġp otential Ġp latform as set desc ent G C de sign rgb a lec ule Ġv a Hand ler ve cs lib s s ho å ¹ Ġs hell Ġ201 3 Ġresidual s Ġex ternal ĠP ARTIC Ġcon vent omogene ity 9 01 Ġen coded Ġbound aries hour s ç » un g ĠU sing se en Ġc book Ġc andidates vari ant ãĢ ģ 1 33 H ash N orm Ġx lim view s TY PES Ġcomb ine Ġi p Ġla g ĠCon fig ĠCount Vectorizer Ġdefin ition Ġa uc Ġg l ug gest ĠLinear Regression EX T Ġw s ump tion lip se du ction vol ve Ġrout ine T itle Ġma ster oc us ER CH edge color Ġve c File s autos cale ERCH ANT h ip Ġout er ER E 04 7 9 05 T er ta ch Ġfa ils TRIC S Ġf oo ĠPre dict ^^ ^^ amp l Ġattr s ERCHANT ABILITY 9 17 Ġa st en et j a s r Ġf all Ġe uclidean Ġpre processing fa ke hel per E V F unc w rapper ĠS T ĠC all ĠPARTIC ULAR Ġ8 7 Ġdimension ality 3 19 el low ĠT r Ġv i Ġpar sed atter ns Ġsome thing ĠIndex Error se quences Ġa z pro ws Ġle aves ĠO S Ġpl ane E mbedding ri ver Ġpre ss Ġderiv ed rib e ĠRandomForest Classifier oo lean EN D n orth tra st m ur ĠS um ĠDef ine p b Linear SVC Ġpercent age le y is ation ĠT emp i ans Ġ #### v g -------- - Ġhe ss +' _ Ġdelay ed ) }) ĠDe precationWarning De cisionTree Ġextract ed structure d 7 00 st ock Ġb el ca de sy mbols b io s leep Ġdim s Ġb asis Ġintegr ation vers ity ĠFIT NESS b ind 99 6 tf idf Ġextension s _ ` sq r Ġdepen den Ġm ot pt ic Ġme mbers ide o Ġprovide s UM N '] ): Ġcorrespon d Ġk f CH E rove ment ĠT fidf int p SC AN å ¤ Ġa mplitude Ġtrans fer ĠT ext Ġjob lib ĠG o assertEqual s ALI ZE Ġof ten mo ot Comp utes b w "" , Ġme ssages Ġ{ : stant i l an bound ary Ġ= ==== Ġ= ================================================================ Log ger Ġtask s Ġexplicit ly D ATE 200 8 Ġproper ly Ġin c ĠG eo ac cess Ġa uthor ĠO ver bin count has attr ĠRandom ized Y Y prob lem čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ he at Ġs pa ub ic ĠIO Error Ġy ears pla c ĠAs sertionError WH IT Ġan n loc ations ĠSt art Ġtri al Ġspecify ing shrink age Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ me try is k incip al b az h n in ria ta ck 803 92 r aries ce ptr comp onent u dio ab o distrib ute ceptr on M ain ĠR GB FL AGS s heet Ġn at ĠR BF Ġo ob el ry Ġpro duce ĠM L ev en Un it Ġge ometry Ġda ily st and res ource Con verter k owski -- ', ut r pe ople ĠD ATA v d ĠL in Ġformat ter band width 254 90 _ {} ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ D raw row ser Ġt max Ġv ary ang ulation Ġsha red æĸ ° " } Ġve ct Ġele m Date timeIndex ĠA C Ġprob as AG IC X Y Ġre lease ĊĊ ĠĠ ax vline Ġvector izer simple filter as y Ġco lour Ex tra AS S de vi Ġn one =' # and er )) ), Ġed it Ġcre ates Ġ( _ ĠF loat Ġax s in i Ġin vert la sh 11 9 Ġno isy gen ome Ġ"" , Ġlate x d ta Ġ( { und le trans Axes Ġnote book analy zer Ġp ow ĠF ourier ura cies support ed ] _ c les } / Ġt start ĠFunction s ĠC SV over lap Ġconnect ed ct an centro ids ], ' 75 6 gener ic Ġnor med C DF AR Y ={ " Ġde le ypot hesis ] ]. Ġfig ures S pectral cal endar Ġto gether Ġth ings Ġapp ro g uess ĠIn c Ġe p b p h r riter ia Or der Ġcau se plac ian Ġpro ps We ight con nection Ġlength s Ġh ost Ġsimp ly Ġy t 99 8 ĠG iven Un known P P x ls Ġpro cessed port s å ¼ Ġinclude s Ġmer ged de termin Ġs pacing mo dified index ed 85 6 ub class sub sample F ound la ce il ing ES PACE Log isticRegression Check ed ĠMiniBatch KMeans ĠCPU s U se d ig ad o ick ness ĠE l Ġth resh ĠArg uments : " a ps z ed Ġm icro Ġ1 95 est imate Ġcy cle Ġ ì Ġex plained pro xy ga in Ġg b Ġsub sample Ġad ding ĠInter val Ġ2 7 ĠM ERCHANTABILITY Ġtop ic centro id ur ity Ġr p Ġfile path = \ P ol R GB Ġf ore Ġk lass - ') M enu v ate Ġmulti processing ĠGram fort ĠMach ine V is a ur com mun Ġrepe ated click ed ĠSpark Context A b Ġb w Ġg ray im read ĠEx tract Ġindic ating F req ĠH AS ĠNaN s Ġcl ick Ġmean ing in a Ġcol lect ner gy f x Ġal t d l de cay fi ler ĠC ho form ula ator y c n r ms Ġcre ating p as as ures Ġbe am class if th resholds Ġread ing or ph Ġs quares Ġm se tol erance Ġrel ated Ġho pe c w ################################ ################ Ne arest Ġreturn ing ĠAlex andre Ġ 95 mp lot Ġint ro au dio Ġs cope ad j ver aging au d iss ues Ġwindow s ĠA BC to y Ġcomp utes Ġsolver s mp ty round trip ĠCon struct Cur ve NORM ALIZE on ds per f Ġmin ute prob abilities Ġtri angle UN K Fa ctor ibr ated ĠWARRAN TY red undant le aves Ġpoly gon åı ¯ Ġrepe at de mo per form ĠW rite ful ly ĠRes ult il li mag ic ãģĦ ãģĦ q r en ces art es Option al b lob se lector ĠRe gressor Ġmo v subject s ic ient A uto Ġi ca ph ys vis ual Ġlarge st Ġb ody pro be Ġw p Ġdis p Ġperm utation #---------------------------------------------------------------------------- -- crimin ant Ġca ched jac ency H ook S tyle j pg de grees ot s 00 3 Ġcheck ing p lex Ġ2 56 File Name 5 12 19 6 poly gon > ' S park ç Ķ ĠF L Ġbo xes WHIT ESPACE Ġs pike fig s che m "] ), e rer atom s COL UMN L ab mat ches ga cy Ġ200 9 p alette æ ĺ con ver row n ord inal Train ing Ġcopy right stract method Ġn cols Ġadd ition Per form cri ption clo thing Ġag gregate ĠO pen com mit ar mon an te pro bs gr p TRA IN R NA be low ist ical ne ed stat istic mk dir Ġsmooth ing u it Ġ3 5 ~~~~~~~~ ~~~~~~~~ moot hed se nd Ġt t Ġcor ner ãģĪ ãģĪ Ġre ject tr im Ġres ample a ffinity fi f ude nt mask s T ypes set default gra ms D R L R d st di mage ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ ta ge comp ress 33 3 s pherical u pt ro bust Ġm ixed Ġ arange Ġt ax Ġi de Ġcontain er f ter o mp is in ol ver Ġsub class que t man y Ġtemp orary IP ython Ġill ust us age Ġshare x 2 64 Ġre p Ġhe nce termin al C F or ies artes ian L ines j j Ġst ates IN PUT fix ture Ġlon ger P lease U RE Ġbel ong 2 65 P a imat es ĠK Fold ys cale ĉĉ ĉ Po ol 0 7843 C I pa ges Ġpre ds ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġf id con c Ġres ize KE Y Ġo dd ĠU sed inomial NB um m ĠI s sub cluster IN FO RE AD ident ity l iter un ed ect angle ome ga news groups gre gation ĠW ork ĠH ist G N å § Ġtime zone Qt Gui Ġcentro id Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġh y X t y aml Ġ lik pla in ( . iz ers Ġcon tingency Ġsy n job lib R d og raph ca pacity ][ - Se q Ġsupp lied L ON o ints t ice y ticklabels Ġk means Ġexp lo Ġaf fect C s N OT n ative and s 16 8 CE P P e st im act iv r ation Ġc e Ġs lic Ġ[ . Ġuse cols look up Ġ1 97 Ġprob ably User Warning 9 75 Ġmid dle Ġs ilhouette plex ity 3 11 S NE ch r Un ion ĠSh ow Ġreplace ment her it Ġp v Ġsample d je ctions Ġcentro ids / " ri des Ġwh iten Ġge om D ESCR e mail l bfgs re verse Ġ' '. Ġ' {} def in ĠCur rent x l Ġbu ilding en derer up er Ġrepresent ed E M y e Ġre a Ġgener ic spec s FI L #---------------------------------------------------------------------------- - st orage Ġ" < FI G Ke ys P ickle in dent ĠM on set item Ġ2 6 Ġcur ves aut y 9 84 p ivot Ġf rozen Ġin ds ext math nap se ar ing Ġde tection ak es Ġqu ant Ġdoc s ĠFor mat Ġext end d v di ction Ġchunk size Ġmeasure ment ĠQt Widgets Ġs id ib ly Ġsp atial ME TRICS C ols F ixed _ `` read only Ġsche me 1 85 (' .') 3 75 c ats Ġp ts lo sses ĠOne Vs D ep Ġre commen Ġr bf Ġden ominator } ] Ġt k Ġre distribute cy cl sp line UP D Ġastro py Ġm b Ġw arr Ġmin utes Ġinfer red ! ") ( """ Ġf pr Ġb atches ĠN umpy df s IM AL F ORM N ull t re Par am Fit ted ________ ________ % . n mf in sensitive ĠNearest Neighbors n or ĊĊ ĠĠĠĠĠĠ Ġcombin ation ti ed Ġf f ĠD oc pl ate 49 0196 Ġalign ment Ġduplic ate 18 18 poly nomial M atch ---- --- Ġwh ite Ġmult ivariate 2 37 ĠB agging aur ant S ampler Ġ joint ET O L Y reg r Al g Optim izer 2 96 w av Ġl st acc ents Scal ar de lt cal led D iff PAND AS y ears cor pus ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Se quence ĠSV D p las y a Ġd ask Ġg lyph fore st Ġsens or Ġc d ############################################################################ ## Ġcompat ible " ]] P H Ġ""" \ ĠPro cess b urn ERR OR S ER Ľ ´ Ġman ifold dele gate g it min i oc ha ctor ies Ġformat ted 36 5 235 294 â Ģ Ġt min +' / 0 33 rst rip gt k Y ou cho lesky Ġeffect s centr ation d ark r h s aved { " se ctions min max Sto re s quares à © ĠE d Ġha ving AC K ')) . è ® ĠH z Ġcontour s res ources ef t Ġhel per B l Ġin dent Ġm app ps yr Co uld rec array Ġ-------------------------------- ---------------- oose Version B box x b Ġan t Ġbl ue ge red fi r (' ') ĠP RO FF T rest aurant !! !! Key Error ĠI mp run time mark ersize -- ') Ġscal ars Ġmark ers 1 32 Ġlat itude tod ay S pace Ġh ighest red ge M ME Ġ' " sp am deep copy C ustom man n Se lector ampl itude Ġf reedom Ġw or from txt time series doc uments Ġfa ces d ices v c um an 80 6 G E p db Ġint ensity Ġrequest s ab i te le + ( z i me mbers qu ant Ġh ard IG N N on T ok Ġ 99 ': [ num s s lider Ġc bar Ġp erson L at Ġ lt 10 6 Ġz oom Ex p MA P Ġlong itude Ġy data call params lt k ĠR E Ġset attr olt age G e ĠIn cre g auss Ġ0 1 Un i ocha stic K Best Ġd p Ġst derr Ġind ptr ĠTree Estimator abo ve M ake se mb us iness ĠFOR EST Ġmin i Ġmay be c wd w ater y es ter ms om al all ery Ġpos itional ĠNOT E Ġ3 4 (( ( ng ine vector izer _ ): s pike Ġkey words Ġhand ling En v ============ === Ġequ ation f lu f actors k lass Ġm k fin ity Argument Parser ke redge Cre ated : ') Ġto y ans ac ĠM y Pro perties Ġnorm s annot ations ĠLasso Lars al ex Ġemp irical f info Ġt b an ty 25 9 rel ations Ġdev ice } _ ast er xx xx er tain Ġst orage na ps graph s De v ish er Acc uracy con version 45 4 dis p r p { : st a Ġch rom ãģĨ ãģĨ er c Ġe q Ġat least ^{ - p adding sing ular R ep Ġk nn FI EL me tic ĠS core 35 5 regist ry ta ps obj s Ġ'_ ' Ġwarr anty Ġr fe ex ponential Ġmult inomial C od w ell Ġr ansac ne ighbor Ġconst ants T ODO s z Ġt xt Ġ{ :. Ġgiv ing requi re T T c ity d ro h uber } ') set p pro t ĠB unch Ident ical + '. . : L C s un tr l 78 9 A verage 13 4 Ġve locity adjust ed ĠVar oquaux u li ex pression Ġl shf ile nt 09 09 Ġload ing Ġsw itch ĠS c we b Ġpar sing stack ed Ġdisplay ed ' ( 7 0588 d ers Ġc sc Ġ3 3 ta int loc us gra mming load er Di ctionary Ġtick er Ġexec ute Ġduplic ates Tool bar get Data ĠL O ĠLabel Binarizer Ġ 96 Ġstack ed . )) cl ust Ġ-- > ut ations Ġr anges '] ], read lines St atus 0 32 d c r dd AG G He ight å§ ĭ Ġs parsity 64 4 11 5 Ġdimension al Pro ject ĠJ SON Se gment optim al ĠS ci cal lable pa per 03 4 Ġg mm Ġme t in ertia ar ante Ġc ar clus ive 3 99 Ġd ynamic 05 9 ug ate 97 6 ĠAdd itional Ġiss parse F ig er os me g Ġp print ======== == umm ies p ter Ġthe refore Ġal ias 0000 01 33 7 Ġ'/ ' ĠSy stem Ġ quality on om ra sh loc ate pos ure DE F connect ed F LO en c ed Colormap urn al am b Ġ; \ ' d Ġa gree ns ure ĠL et user s mid dle incre asing effect ive re plic lo y Ġ[ [- ĠR O ĠH and Ġnormal izer NU M Ġun known contain er Ġmax iter Ġstar ts LAB EL J o b ys ĠT H Ġth ird Ġnon zero ĠBayes ian th at im s replace ment F irst f score w ar or ange is null ĠT O fit ting sh ip Ġcho ices O bj ul us Ġse g 14 9 Col umns local ize ĠL ooseVersion medi ate Ġs heet Ġdif ferences b ur ĠP rint Ġ4 00 80 8 34 9 Ġextra polate c ms p f Ġp ser en able Ġh ue ĠL SH pol icy Ġdraw ing t u Pr ice Ġm n window s ele v i val mat ched ĠThe n v or Ġgraph s Ġproject ed C IMAL h an re levant pro cessed ber g gp u ł ĩ ro sa mat mul __ )) ĠA b ĠF ast AR S Iter ation ã ĥ ig gered ce wise ĠN y ĠO li Ġiter ate aT eX ĠPo int 80 4 Ġx ml dt uple 2013 0101 Ġlinewidth s ane ous on ical Ġo k Ġ( `` lon del Ġn r Ġ1 50 is dir ĠS E ĠMat rix d k at t Ġw ind un labeled Ġde al min us T r Ġf d ĠP Y Ġpre serve Inter val A P i mpl Ġp hot ---- + ĠG a ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ Ġt c Ġst ock ro b ne igh Ġne ar ĠA ffine ON T side d root s Ġsig moid Ġsat is b se al es Ġ2 9 Ġh ypothesis 200 6 Ġps ser 285 714 ĠJ acobian DI ST Ġdescrib ed 3 78 u el Ġsignal s Inter pol G re ĠSkip Test t b we ep gre y Alg Error Ġco erce min utes sc reen ĠDB SCAN Ġf loor gg le Ġsubject s Ġt im 36 0 OD E UN CTION Ġconver ge / ~ o lf s uccess Ġ' ( Ġg g ĠF I ĠL oc part itions ' $\ 7 98 L INE k o é ĩ Ġp c Ġde code not es Ġcond itional 00000000 000000 Ġinterpre ted Ġgu arante S B ue ue Ġ6 5 45 0980 2 05 L IN ] [:, Ġst able min al IC E Random Projection s hould )) ]) fa c clu ding Ġpolynomial s Ġconst raints marg inal 16 5 ĠMat plotlib W N w rong â Ķ Ġre ally ĠF IX ĠVari able ) [: nb rs Ġp lease width s kw s Ġevery thing Ġtermin al V A æ Ľ´ Ġf our 78 17 ĠTimedelta Index F W er ing de limiter group er 22 22 ĠGener ic repe ated pcolor mesh naps hot al so ord ers ec imal Ġsm allest 2 12 Ġin formative Ġd st ss ibly ĠThe y lic it Normal ize At tributeError ker as S hape o it Ġ201 0 RA IN um ing ] ' p end r mt z order in file he ar ') ): late st Ġra ster lomer ative _ ', g am Ġs ho Ġspec ifies Ġtra de Ġpk g 1 75 H igh Ġtra jectory C K G eo ar ound F utureWarning Y ear Ġ( * sub process Ġ201 7 rat ios de tails () ; Con vert Ġiss ubclass Ag gressive x k Ġper fect ĠSpec ify 8 99 Q T Ġbl ank upt ools M D l ar s lope al ways Fitted Error A nal H I bo ur Ġboost ing O ps ha ble Ġma king Ex pected Ġaut og æľ Ī B O Ġt orch ut able Ġe lapsed ĠG MM 12 2 čĊ čĊ c en Ġscal es Ġinitial ized ĠKey word Ġpeak s ĠT ry Ġcomp ared vert ex Ġuser s j et Ġw on ĠW h OR D Ġmulti plic E CT j df Ġf act ĠR FE ob served b las '] ]) index ing 25 3 15 4 Ġt ile 04 8 Ġcons istency are l work space su ally Ġatom s a e ve x ĠK e 94 117 Ġrun time Ġany thing ĠInt eger I SE k appa ĠP e Ġne uron Ġ4 1 log s valu ate sign ature I mp Ġn args Ġs ched ur ate pt ime ĠP anel Ġz i 80 7 Ġrot ate PL OT Ġhorizontal alignment Ġada pt x scale tr ial Ġ3 6 Ġtime out ( "") S peed ar ctan mo ke ES TI stage d Rest Classifier T ri mo use 14 4 AN CE IC A ĠS N ent ity Ġlo cs Er r Ġmin im inst ances Ġident ity incre mental 2 11 l vl ort ran Ġas set Ġ7 0 HO ME ĠOr der Ġcon j C SV i q m all ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĠP L place ment ash ing Ġsto pping p ct am i 45 098 cont ents qu ential Ġle ad can not VER SION c ss v ents la pping frame work Ġlib linear tex ts A rt Ġp ers Ġb its Ġindic ates ĠGaussian NB w p 15 6 14 7 vi val SA MME I con run k SC AL TRE ES p m in strument Ġw ait Ġ[ {' ĠA gg Ġv ars pr ing pos itives Ġpack ages Ġord ers R ed r ing w alk Ġg ui Ġpre pare regex p Ġstand ardi Ġi mag ns ample Se e fore cast Ġrespect ively c lock g lyph Ġex ponent ĠC luster cal ing Ġpos itives Ite ms multip ly s ites Ġc ertain Ġthe ano ĠS O 75 7 mult ivariate " %( log space Ġpl us Run Config , ** j d qu arter Ġdi ction Ġpd b const ants sens us ĠTensor Flow ) ^ 0 25 r x Ġa ux Ġre gressors Ġv ol ĠL anguage Ġname space fa iled 19 60 s kew x C UL L ĠNormal ize æĽ´ æĸ° V AR i ver )) / up dates gn u comb ine s age v io Ġen abled ON E mon str Ġ201 2 OL S ++++++++ ++++++++ alex andre P A new ton DO CS Ġth ough ĠCal cul Up date assertIs Instance P M color map Ġ8 6 Ġps df Ġp val ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġbo keh run ning å¹ ´ A c Ġx r LI B ĠDist ance Ġappro ach 9 37 S ignal t ual Ġ 94 en o Ex tract 3 88 ic an fe ats =( - Con tain Ġ12 8 Fe ed Ġart ists s os Ġ ! pol ar Ġperiod ic He ad W E t imer è ¿ in lier Ġc entral ĠM ark Ġbe comes pre pare B L Ġin strument 01 4 min kowski Ġent ity _ [:, è ¡ è § inter vals Ġz s Ġcor pus Ġ= > Ġre construction ĠS imple ĠM AGIC gra de ... ') ab orn Ġco o ĠSV R Ġskip na ĠMin imum L ike S o g h in y it tle Ġtest ed ĠH el Ġlook up ĠClass ification T arget Ġre fit ch ars oc or cur ves gram fort Le ave comb in Ġans wer ESTI MAT ) `. D rop M ES R o ]) ): Ġ( . ĠS plit nn z å İ uc ing Pro file RE G quest ions IG H Or ig C luster a ug ĠS ince Ġsc reen Co variance AS K parser s 9 87 Q R ] ** n om y o he mat ĠF in Ġv ocab 99 2 Ġdetermin es åı Ĥ Ġradi ans ... > stro em Ġdig ital ra ct Ġhe x _ [: i um t im Ġs r act ivation Ġdo ing Ġequal s ĠRegressor Mixin D imension a max e ach Ġm gr get Logger (" ' ĠR ed ug ins 97 7 ĠComp utes Ġassume s cogn ized Ġend point vis it P ipeline ] ; Ġp g ĠL en Ġlib raries conf usion Ġo a ĠL at 647 06 ĠMe mory help ers a h } ( 00 4 ĠT RAIN ... " hand les L in ax hline Ġhe at the me Ġread s Ġgo ing C lo L ow V ec ĠM ap 11 4 Ġpol ar W h ro ken ha mming ĊĊ ĠĠĠĠ ĠV er Ex ec let ter ] " Ġo l ck ets Ġg t ĠB ernoulli Ġkeep dims l n we et AA AA A rea J ob W S Ġme nu comp ressed man ual Ġsort ing R ank l usters ################################################################ ################ å¼ Ģ Ġf onts bo Box ĠL aTeX Ġpro bs Gener ator u ss Ġs light ir ror Ġfunction ality D et is ing Ġde corator drop out P lots ps ser ĠOption s Sy stem Ġmoment um Metric s (' # Ġimport ances f link Ġi b Ġs uff is otonic og rams Ġprob e Ġwidth s go v pri ors Ġr vs log pdf ĠO UT vide o ob ust k d s pikes lib rary Ġro i User s Ġfra c S er add ress desc ribe ĠExtra Trees t rend lo bj ul k ĠP LS ĠG UI Val s temp lates IM IT , :], st ie Ġp ast Ġp value ame s Ġlog arith Ġdb scan h ide re quent ĠS Array pre ds 80 9 G EN p ublic ma gnitude ĠS ort (" { 3333 33 D C f min Į ħ Ġpro ced log x mer ged R atio as onal get ter Ġpo les vi er ĠGradientBoosting Regressor he v Ġre ferences Ġtr igger ca ps 35 6 ESTIMAT ORS me ter ĠH DF ang o Ġqu eries quantile s ĠFIX ME d ynamic ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ cont roller ai ser ĠDis play B B U DF Ġc riteria ve lope Ġimport s ĠIn formation 4 32 ĠA LL ĠE N Ġapp arel Ġcommand s Ġ$ \ Ġski prows ĠWindow s å Ĭ on set Ġre strict Ġ" {} Ġgener ation Ġflatten ed Ġsynt hetic ] _. d nn read s Ġla m ĠWe ights align ed Int eger ĠSelect KBest Ġmag ic rt ol Ġlin estyles gener ators å Ľ ra ster um ath it able Ġident ify ven ience FO OD ĠSGD Classifier ) ]. es h ts hift Ġend s Ġm lab ĠR ange ener ated sub s Test ing Ġseed s sym metric avigation Toolbar e lapsed g an Ġin finity Ġ1 94 run ner Dis play cms y P C ir ch split ext perime nts 294 117 corr coef Ġmeasure ments _ ") g cf Ġ ################ Ġf ar Ġp ure AT CH Th reshold = """ G Y Ġ ---------------------------------------------------------------------------- ar ily Ġ1 01 Ġcov ars Ġd c Ġsplit ting Ġvisual ize åº ¦ $ ") t ar um in out h Ġpre vent 86 3 cov s DE BUG Lo cal ĠBy tesIO 9 00 x E ul ly ĠF ilter Ġne ver 19 2 mem ber M ark y load ĠA c In st Ġnew s Ġtransform ers case s coordin ate Ġdiction aries time out Ġl hs pl ant sy nt , % p le ĠB essel Ġcheck ed St andard LE FT sens or k g l h ĠD ense ĠB ut : ( Ġb b pro pagation $$ $$ I mport Ġdef ines ĠB oolean che ma Ġdt i . ". j accard ific ations Ġvisual ization _ ] e eg ĠA ct 80 39 Ġhand ler Ġlik ely " }, st ress ive Aggressive "] )) wh ile Ġa ffine radi ans sol ution ĠUni versity e lem Ġm lb (" [ Ċĉ ĠĠĠ ĠU S Ġgener ates IT H () ], ĠP art min ibatch be auty math rm Ġanaly ze Period Index B r Ġ: ]) Ġ4 4 34 7 Ġte ch k i ate gies Ġco p 78 5 contour s Ġh ref Ġover written ĠOli vier h ard E AR tr uncate Con version Ġar c rot ate Ġpress ure ĠOneVs RestClassifier er m Ġp run Ġin stanti ĠN X Ġ5 1 Ġiss ues AR K Ġ7 2 Ġcat alog Gradient Boosting U SE Ġh omogeneity 20 2 22 7 Ch annel Ġstructure d at z ĠC ode Ġsk image Ġcal endar ris k Ġautog enerated ( (" 3 97 ra ps W rapper 12 7 803 9215 Ġshuff ling Ġb ra is ot iz ations Ġcp u F ind u lf č ĊĠĠĠĠĠ 02 7 Di rectory ĠTfidf Vectorizer bys hev R F T M ĠD imension ng le cy cles Ġident ifier Ġfilter ing find er Ġeas y coun try . - p ho ha m : ]: B IN v cf Ġon to Ġun ion Ġ8 4 fol io tmp dir Ġfollow s Function s STR ING OUT PUT O p o a r g me as Ġh it pre compute os is Ġdi co 96 8 over all Ġbegin ning Ġho use ----- + ') ; Ġres ource x c Ġn m Ġf actors Ġs kew )) * Ġst e ex isting Ġtr uncated Ġapp ended inte rest D ense w hen co variances ==== === Ġ---------- - Con d Ġloc ator h dr se cut Ġm c Ġre cent ho o Plot ter Int egr script or + ', ĠS ize Row s , ... n cols os ome cycl ic h ive get value Ġx ticks tra de fix es over flow u v Ġp ng ĠM ag G A G ram il ities 01 2 nn ds Ġdeep copy Cod er Ġ" ( __ ), key word Ġderiv atives fast a 9 06 é Ĺ Ġl and sc hed Ġinter n OR E ĠS cale ĠS top ĠP ress ĠN aT ĠM ask Ġzip line Ġman ual ĠID s Hel per J ECT r r Ġ: - Ġax arr Ġlen a ac cept ai red Ġhand led wh iten dif ferent ĠDE CIMAL asc ending Ġyi elds b ench f requencies de dent Ġm m ĠP IL ĠA lter Run ner ', \ #### # ta iled 10 24 ĠDE BUG G OR Ġ( ) check point sur f Ġstage d C enter co very Ġdrop na Ġshare y built in e very Ġd B Ġx data we ets St ats cor rection Ġlow est Ġdepen dent ' ") E lasticNet ag raph IT E Ġgroup by Label Binarizer åİ Ĩ w ide } ` ch k set ex ĊĊ ĉĉ Ġpre tty 25 8 Ġtrans ition {} '. / \ D TYPE s ampler man hattan Sp line n av Ġs phinx ed oit Ġcom ments Ġexp anded err state bound aries åIJ « perform ance w cs Ġ lf Ġp res ve locity Ġcl ust ish art Ġpr incipal hook s E ngine al chemy ĠS p pre ad cal cul Ġsy stems ĠCo efficient 27 4 Pro gramming measure ment ä» İ w l Ġb unch ur lopen Ġco un Ġlo st trans Data hold ers T ick i ps Ġc um ĠW ar 45 45 Ġimp uter Ġslight ly 6 03 l sqr æ Ī Ġele v H ot ĠR OC parse d ĠCo variance 1 35 O ff ma inder Ġco verage ĠE nsure Index Error ĠStr atifiedKFold ov a æĮ ĩæ P ort R IGHT it ory Ġb rain con sole Ġu b su it = ", ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġin correct ur i 10 7 Ġmo ments Ġdepen dence //// //// D Tree it ivity ser if ĠS tep Ġv ideo Ġmeasure d ĠJo hn 3 15 Ġs aving Ġg am Ġ10 24 , [ as i ĠG risel Ġdict s h ierarchy y i Ġt ies up dated Ġu sually ill er Ġq t ik elihood foot wear æĮĩæ łĩ ro ut ve red te red log its :` \ Ġapprox imat h ang Ġde nd ĊĠĠ ĊĠ R D Ġ[ % pp rint ĠSt ate gener ated Neighbors Regressor Ġquantile s Ġst uff Con nect Ġdest ination rmt ree I mg k ern Ġ' [ Ġfa c A Y g iven out dir ĠB lock uc le Ġmap ped Ġapplic ation uncated SVD ) [- h h w idgets Ġ' * ing e min er sc enario 05 4 serv ing la ps Ġal most sc i `` : ident ical Ter minal d temp Ġi ms Ġa veraging es cape label size Ġde ns Ġl p ib rary Ġrepla ced L ST ] ` q dm t ical Ġcheck point Ġinter section mov ed B ound P IP V I a ive m ust ur ations ĠDecisionTree Regressor Įħ åIJ« Ġin s LO G Ġdrop ped C ross (" / cl one det ect S U r ating Ġt up Ġs n un stack (' ../ 66 7 19 5 OO OO d on m or m os Ġname dtuple Ġen c åı ² cro s expand ing roy den ono i D P m lab on line con volve Ġ-------- - Ġover rid App lication g u è ¯ it in ĠM ay 27 27 AS H rans ac 3 12 å ® st rength it o ur se Ġ10 2 load ing Ġ200 7 F ore r anges Ġtool bar 3 06 I t W olf h u n utr Ġst yles ĠO bject Ġad van Ġgen ome f m Ġde cay Ġon line Ġ4 3 Ġhour s 4 24 _ '): co erce Ġb ind Ġwe b f fe s nr Ġp alette pa gate ision s ik ipedia åİĨ åı² w orld x tick Ġg ca __ ', Ġde g fo ur spec ified ĠPro ject Ġutil ity Ġact iv Ġhapp en å¼Ģ å§ĭ F in S igma ĠD on ĠL I sub package ĠSpec ial big query week day ) ._ a ic Ġthe me Ġ: ]. Ġrect angle ANS AC _ '+ z s Ġl c Ġwave length Com bin soft max taint y Ġ ######################################################################## 00 2 Ġ2 50 Ġman ually imp rovement ä½ ĵ nutr itional Ġp mf Ġ1 23 th umb ho le Con f Ġimp rove pers on Ġsupp lements T ABLE ro s ĠT ri Ġen coder Ġpen al ãģĤ ãģĤ id le ĠH am Ġpri ors lomerative Clustering O UR } ), ro le (' { ne uron normal izer 9 12 ") ] load ings Ġacc umul Ġshow ing extension s ĠWH ERE Ġconvent ion Ġrecommen ded D one F R å ĩ er ge Ġout lier Ġsh ifted wh m Ġna ive itin ck * ) R R T ip k nn el ist ab stractmethod je w dat al centr al C UR Q ueue Ġt rend ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ĠC ustom ick y any array Net work CEP TS en ame list ic Ġne urons art ists 20 6 čĊ ĠĠ Ġov r Ġa way 02 4 aa aa Ġattemp t P osition it ation inter sect Ġxy text 8 75 c lim Ġex cluded Ġres hape dd of seq s u k gener al writer ow ĠFL AGS I MP g m an a Ġd ash Ġen ter den sed L ink b as h l Ġs ampler Ġd ark ch ie all Tree po les Ġdist inct call er tri angle Ġ1 98 Ġde precation Ġ3 60 cor ner Ġpe ople 3 84 st yles Ġ' ': cal ibration time Warning pro tein Ġinter action Ġdif fer Qt Core Ġdir name i co de cre Ġre served te am ca ption Ġpass b ì Ŀ Ġa a ul ator ĠR ANSAC ĠM inv Ġle ave Ġperform s æĮ ī t min Ġg al Ġh ierarchical ĠM SE iter rows Ġstri des al tern ear ly mer ican DE X Ġho ok åħ · æĹ ¥ Ġnumer ator åİĨåı² æķ°æį® v in Ġo ls ĠN ode oc c Ġpre fer ĠGaussian Process GT K ĠAC CEPTS 5 000 M I u func Ġo pp ur ls G en u ck Ġp added ha stie Ġtemp lates find all Ġlib svm ï¼ Ľ Ch ar P l Ġa mp Ġa mong Ġback ward LI ST VAL ID das hed jew elry d ummies am ble ĠD I cur ity ĠV is l hs ==== == ad z ps df az imuth Sp in ĠMethod s F orm s ib Ġre trieve Ġcon volution Ġ[' '] 13 8 09 7 A lt Ġpo sterior Ġfa ke Ġpl ugin Bu ild ĠLen gth B ob Ġe c Ġth row ĠX A ĠC V im gs exp anded Ġconcat en Ġconcat enate S cript d ri re construction al gorithms an ame Ġc Pickle Ġk appa Ġprint ed eled Tensor ĠSpec ifies Ġd df Ġis n comp ression Ġedge colors Ġrank s åħ· ä½ĵ / ', g mm p ush ic ate ĊĠĠĠĠ ĊĠĠĠĠ press ure f ather m ys ig ns ĠC a ") [ Ġne ural Ġassign ment ites pace b rain Ġs paces Ġstr at Ġsu itable wave length mot ion ĠSim ilar assertAll Close secut ive b asis base s cons istency ĠMult inomialNB Ġvertical alignment P ack #### ## 01 6 embed ded re ams it a ort ed Ġget ting Ġregist er Ġspect ra G L V ert p ot al th Ġre fer Ġre direct Ġg zip ex on Co py AS SI Ġlib rosa Ġintegr ate Ġc am ts v int ensity get cwd 45 1 Ġshould n Ġwave form 0 75 ] == b on č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠN avigationToolbar 07 7 Se lection Ġcalcul ating () .__ ĠA uto 97 4 f g w f Tra ce " ' I ds de m 16 06 gen fromtxt ĠSto re 6 25 v ider Ġp lay Ġas y Ġr ights b roadcast Ġspec ification Ex periment Ġprod uced Be gin Ġrea ched lib svm Ġvari ances Ċĉĉĉĉ ĉĉ Ġannot ations Ġtre ated observ ation 3 14 G amma W ave g rouped t up ĠG e Re al lif y Ġover rides LE AR Ġsol ar Ġte am I ris S ingle ĠN MF Ġlabel ing ĠCheck s T EXT b ow Ġto day Ġ6 00 iss calar Pro pagation 2 66 Ġt x en queue Ġd m li min col l scal es embed dings 2 86 3 94 C lient P age Ġp ip Ġ+ ---+ Ġha ck Ġtry ing sw itch # ================================================================ 2 25 A bs s am re me Ġr f ĠS ignal ĠL DA sh p -------------------------------- ---------------- sign ed ĠAl gorithm ------ + Ġn col Ġ1 20 ') ( ĠD O 64 5 iss ub Ġmo ving and a ĠT uple ener gies 45 5 3 05 B CD ol ar il le pon se 199 9 y ellow to csr inter action ME G 9999 99 Ġindic ate ĠGa el M T R ight S imple p z Ġst c ĠG P match ing Sh ift Ġsen se Ġ question '] } iss ue Ġcontain ed 36 36 : ** p value y tick de cor row th Ġmo ose sign als wrap ped ĠBagging Classifier Ġproced ure Ġsee ms Cal culate utor ial Ġc ritical Ġp x pe g th an if ft ĠL a sum er ĠLabel Encoder F UNCTION l bl ct rl Ġk de Ġl n Ġ5 12 St d Ġsp here Ġca pture ĠSet ting Ġindic ID indic ID åħ·ä½ĵ æĮĩæłĩ P ass T ab Ġp ublic ma pp ER GY radi o depen den Ġvi ol FORM AT S kip å Ń li l grid s Ġtrans parent chunk size T IC f y i ct t urb in formation oid al note book li ptic ĠT I ĠR a Ġextra ction TE MP Ġ las Ġn ative Ġa chie ic les ĠS amples Poly gon ma chine ĠT otal ĠD ep sum s sp here A SE P rint cat ter lu ence ĠMulti Task ĠDetermin e æĹ ¶ Ġstrict ly s us w k al ong ĠF riedman ide s Ġqu ick sk y 117 64 armon ic åİĨåı²æķ°æį® ä»İ 3 95 p w } : le g Ġo mega Ġhow ever Bu ilder Ed ge æĸ ĩæ Ġdecre ase Ġdecre asing L eft g as p matrix t ation Ġ ._ Ġ' $ con verter ĠP h Ġmat ched Str atifiedKFold Ġrank ing cost s effect s Ġthread s è§ ģ Hot Encoder R el S izer Ġf ully ĠS ame pl ugin 03 8 29 27 Ġeigen value Ġincre ment ĠApp ly Ġfr ont M issing ¡ £ Ġma int ten ded Ġsave fig Ġpla ces ĠMath ieu ĠLin AlgError 9 04 Ġc andidate () - ch dir ĠR o po ses not s Ġsub tract We ights 4 94 V e Ġ archive ĠC L Ġab c ĠNe ed medi um ĠMA X liter als r hs Ġcon straint 32 3 ------------ - vergence Warning æĸĩæ ¡£ 9 24 E val r fe se quent (' [ ex e API æĸĩæ¡£ åı¯ åıĤ abi listic åħ·ä½ĵæĮĩæłĩ åı¯åıĤ è§ģ APIæĸĩæ¡£ åħ·ä½ĵæĮĩæłĩåı¯åıĤ è§ģAPIæĸĩæ¡£ 32 8 Ġsc ene with in ĠLe ave Ġexception s 1 64 B ayes S PE U ST é ¢ re present Ġun cer ... ) ĠComp are br ute Option s ĠFa ctor 9 07 E nergy p inv Ġc he Ġf lu co efficients ck s sim ulation const raints Reg ion ĠAdaBoost Classifier Ġdetect ed ) = R S m ant Ġre cur Ġ# ---------------------------------------------------------------- ol iv Ġintern ally H our c bar Ġis o Ġle g ĠO LS entro id eye wear P aired h p Ġun used 99 5 Ġindex ed sp in Co mplex Ġpercentile s } _{ Ġre versed di p ]) * ĠL ab =[ - Ġdefin ing air flow C AT ĠA v sample d 36 7 Ġsim ulate 000000 0 COL OR Ġdire ctories 6 17 11 11 Ġstack level Ġfail ure ĠUni code h um al lt Ġw ater Ġex ponential '] ]. Ġdf s ST ART const rained CO MP Valid ation mk dtemp M y ] ][ Ġi on li ct Ġcon nections 99 7 float ing ĠIn dices Lo ading ä¸ ļ ĠEst imated S chema ĠN O ĠW ill 16 0 ox els byte order ' ``. S te f riedman Ġdist utils vari ants Time s At tribute Th read Figure Canvas cap ital MOD E rag ma ĠLSH Forest q z ver lap Ġpro jections Ġac cepts Ġaverage d Ġdet rend Random Forest " )), Ġme asures po isson Ġpre served add r Re move ĠU SE 14 0 nest ed oliv ier g risel { { in liers ĠR adius Ġtra ding over lay Ġalign ed en sta um mary 15 5 SI GN meta class Ġgre en ĠTr uncatedSVD n ight ut ures ĠH as Ġad j ĠZ ero Ġback ends AG ES RO UP (', ') h space x f dat atype callback s U t Ġ` ~ ĠG Py Ġver ts Ġwork space Ġ'. ' ĠPro vide ĠResult s V olume g old Ġp b Ġin line Ġin ertia Ġw ide ĊĊ ĊĊĠĠĠ Ġsub sets Class ification Ġpart itions rank s l ite an ity ime s ent ion ĠD NA Ġuse mask pos itional ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġfin ite Ġaccept ed ĠReg ular Ġm t ĠX B sh v In v 64 8 bad s T uple s lic (' $ Ġ% % ĠRe served 20 4 Un ivariate SN R M app st ations Ġ3 7 tt en RO I Ġconver ter foot er Ġrout ines assertAll Equal Contain er st retch Ġy aml Ġst retch par quet ĠP r IN TER SI LON 0196 0 Mult iple G P de mand Ġp ot en abled ens us Ġiter ative Ġpoly gons L ong Z ero q s ri ct ĠR ights Ġ'- ' ĠLe ast Max imum R enderer Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠM C ------------ -- Ġgen es Ġdebug ging N S d g s uch re ject ex ts ide d Ġmut ual or ical Ġde mo Ġcol l mon itor Ġconstru ction PIP E i elds () } (' ./ Ġl ittle acc el fft n Ġthink plot erc ise = (" S en re store ma j 10 2 Ġpa ired tra ction 22 6 to o Ġen code ĠO b Sparse Tensor MPL ES Combin ed h it h ns s lots Ġtr uncate `` ) Ġprevious ly I dx Ġc nt Ġco me ĠA cc Me asure stats models stit ution ? ? F OR p or Ġt ensors Ġse ctions pro filer Ġ201 8 mn ist olid ay Ġw orld Ġg truth ĠC ross Ġtyp ically BA SE M Q X A c rit d tr t ensors ĠE quivalent not ify Ġqu arter Ġhigh light oting Classifier # ---------------------------------------------------------------- A F ra se ac count Lo ader D M z a Re ferences Test er db scan Ġnetwork x Ġshrink ing atified ShuffleSplit Ġcontrib utor 4 04 C ha G H f v p ser in str Ġp ragma Ġ% (_ ind x ĠMe tric Ġign oring App ender ĠCh ange ĠEst imate 1606 2927 re fit Ġd set num er )] )) over write moment um O b c pp ne cessary ĠM od 12 1 Ġmask s UT E cha stic Hist ogram T AG ro de la zy Ġre cursive Ġb as len ce Ġme di ** * ĠO N Com mand mix ing cam era k f re mote Ġlo ader Ġpo ssibly Ġtitle s ĠPass iveAggressive FIEL D ] [: x a Ġe g ha ve Ġst ability ĠA verage Re ference Ġch anging Ġmode s Ġgo ogle ĠDate time Ġmar ket la x Ġnot ice Ġcon trast Ġqu antity dt i Ġconvert ing Ġproportion al L ast Ġe clf qu ote ĠC ar Ġstr ategies ĠO P den d main ing Ġframe on Ġden om EV T M sg Ġlog ic IM AGE Ġeffic iency ĠStruct Type p he ĠS hape ath s Time Series view er Ġtak ing c id Ġpro duces Ġset uptools In d Ġcont rols IT S 34 8 urt osis commun ication S ha ] ", d os w a th og Ġ- ( ĠP os '] }) Co unter wh at user name Act ive invert ed m aries å į ph er Par se ID s si mp TH ON timestamp s Ġsuff icient ar ding ĠM an Normal ized mission lines DA Y devi ance burn man FLO AT ( ? W ind ĠM ain temp dir normal ization Ġps d As sertionError 1 45 [ _ st orm Ġf min ot ype tr igger Ġg ifts time zone ach ing 94 3 d ds k a t series Ġn ans Ġs uggest set ting check s limit ed Per centile Ġag greg ĠNet work ! ') S UB f all Ġpro cesses ĠIn verse 75 5 Ġfa ctory ĠSt ata Ġstri de Ġap pears U sing n se as sets Ġde monstr bu ilding Al ign prev ious thog onal P ORT ĠR V =" # 15 3 Ġass uming parame tric tele communication la ys un ing Ġr isk Re quest inc r 7843 137 ã Ĥ re ds Ġd ow ĠP ower ĠC OP sub mit month ly Ġface colors 3333 3333 Ġart ifact swap axes W ISE er seg Ġa wait Ġst udy Ġbase string NA MES ä¸ Ģ Anal y $ ' F ull F older Ġf t Ġa udio Ġs pherical Ġb s Ġ( : arg partition ĠI gnored ĠEx cel exp lo Me mory multi processing Ġmon itor sen ce comple teness ĠMult iple Ġembed dings Prob ability ĠClassifier Mixin , . n bins Ġc ax == " ** - Ġcomp ress Ġindex able ]]) . Ġcall er Ġtw ice ) }, l ut m tx mat ic ime n ile y sp ine ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ Ġtimestamp s Ġlate st boost ing xls x ĠCurrent ly T ag ĠN umer Ġtime series 88 7 Ġqu otes RO C Ġwrap ped Message Box Ġclass ify Ġoption ally ={ }, 647 0588 Ġequ ally Ġph ys Ġt imer Ġb alanced ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ Ġ< < Ġle ading 78 99 Ġover lay DE C Ġdep end aris ons Ġ= ================================ Ġs queeze Ġd er bo ot Ġan imation Con v IT ER Ġca ption Ġhyper parameter Rec ord E PS str ptime Ġ4 7 title s ĠNot FittedError Ġev t RO W Normal BCD ynam ics Cal cul S F b iased Ġb p (' {} Ġ8 9 ) ``, f ro Ġ ë Ġp rices Con nection Ġtri als Ġcomple teness Ġsepar ated Ġ= ================================================ Ġp ivot Ġr ms LE D ident ifier PO S pri mary ĠImp uter ĠAgg lomerativeClustering ( ", V ID ar p Ġf o ab ian ĠF rom per c str and do es 23 8 TR IB RA Y delay ed Mod ule Ġast ype ^ - x ff Ġ[ _ Ġg lobs for d ĠS H ĠC DF 32 125 14 6 Ex pr UN T Ġannot ated Note book Ġmov ie k t Ġ č Ġin ference Ġb ot '] * Ġweight ing Ġcast ing ĠForest Estimator OLD ER Ġfore cast 0 45 C ar s pl ur istic Ġh olds Ġl iter 12 4 )] ), Ex it bl ank Temp erature PAR A D iv di am Ġ4 6 18 3 omal y 32125 85 B E y err æ ł comp any ens ive Ġbase name cm c SA MPLE WAR NING iler plate ) | b us Ġb i Ġr ules Ġqu ote stri des Comp uting G S Ġp atterns tra ces tra jectory linear ity Max Scaler G o O M h int mp irical Ġb t ol erance ĠE uclidean Ġj j dis able ME N total s Le arn TH ER Ġmeta var QU E 285 034 ĠArg ument d df e lastic f ault ĠP DF no v fr ont '`` : Ġgb rt . ]), 3 13 D ump is ode res ses ver ages key words 85 5 ĠWe ight Ġdown loaded assign ment M ed o sed ch arge ad ap pre process pa pers log in ell er ĠCo v call s App ly SL B miner als D ummy H ASH P ress st ata Ġse mi Ġpar s inter face 14 636 box plot mar ket Ġair flow f onts Ġs pl ĠN EST pol ation graph ic Ġbu ilder 6 2745 N x Ġt ar ĠD if act ivity 05 04 Ġha d Ġup d LE NG Al gorithm 137 25 ä¸ º pear man mix ture Ġelect ron DecisionTree Classifier Ġoverrid den ' ve D T R adius v lines Ġd lg 00 7 Ġv t pro to ")) . CL ASSI Ġrgb Face WAR E dig it W OR d z Ġd ialog Ġ' : trans ition Cur sor RB F i ed o h s ports re trieve Ġcont roller Ġdis patch 86 55 ess ian Ġcomple t Ġ================================================================= ============= C ES k ill ar se Ġc rash Ġp ls ient ific Ġke pt ' m r xn s py Ġs un ha ir ject ories ... ] En abled ĠUse ful Ġjoin ed Ġlook ing mut ations N ET k k Ġmax im Ġso ft cre ated Date time Ġca pacity inte gers Ġpri mary cla use Ġhapp ens l range t ip Ġas sets cho ices Ġ199 6 Ġrelation ship Ġapproximat ely 9 22 S ome p ic s izer w ant Ġs age ĠS ource Ġan chor reg osa 803 14636 ĠAd just 8039215 80314636 Ġ um di vergence =' -', min s 78 7 18 7 Ġmarg inal A V N MF Ġu df pro f ĠB ack Ġs lider Ġh ome 10 4 ĠB Y Ġ5 000 ren cy 35 9 ĠMe ta ocor relation t pr w ire Ġth ickness foo bar ĠFigure Manager Ġn bins ro d ĠT e ho fer ĠO K 2 16 f la par alle con figure ĠRe qui correct ed delt as % , C y D L z ier Ġ# ' el ch ĠP mf ĠW arning use cols rop ic RE F Ġdat atype ĠSpark Session Change d ĠCre ates Ġ######################################################################## ### Ġa pi Ġd as ĠT ab arg check Ġl ic Ġact ivity SA PT 9 64 I F la mb th rough tt m assertIs None Ġsynt ax 9 34 E pochs E missionlines )) ): () ` ĠF ortran 01 5 Data base rect angle 137 255 Ġhyper parameters LENG TH b la g ame â ķ in side ma c Ġth umb ĠM ix Ġbo ilerplate Pro duct PL S 199 0 Ġmar keredge + . v t ĠN E Ġ4 8 Data Source act ers Ġarg v Ġgroup ing Min imum Sum mary > ', B AL z pk Ġs ine ial iased ĠE ither Ġpa rents Co mple prec ate Ġref lect tan h semi logx Pol icy ĠCOP Y ) [' 0 99 ĠM apping Ġ5 5 Ġover all Ġfind ing LO AD nat ively ĠProb ability ol ved Ġg it (" # ** (- ĠDE FAULT Ġconstruct ed # ~ b tn f b Ġp m 01 7 dict s 25 7 Ġmin imal dist inct FI X gl ish ĠX s 15 7 vector ized Ġiss calar imp urity Ġrequire ments > , ==== = -------- --- out s ĠRe al ast ropy Ġsc enario man ifold local s Linear Combined äº ¤ 2 32 _ " c ord p ur p ub Ġm lp Ġco variances Ġ`` [ 81 88 Oper ator D IC g allery u ity on ce ]) ]) per plexity ĠM et sy nc Ġadd ress Ġmon it Qu antity Ġimag inary ç İ Ġi pca Ġr dd ĠA UC Ġse aborn Ġtri angles Ġgo al mur hash T OP \ . i us ĠP O Ġde dent ĠG auss pl ugins Not ImplementedError Ġpi ct defin ite 237 047 LEAR N 2 95 > " d om ro ved Ġlin space Ġconver ters pick led integr ate X y c umulative p res å ¸ Ġin file Ġse nd start ing "] ], graph ics bl it ov o ================================================ ========= 9215 6 duplic ate ami lies Art ist rout ine h ib t max ĠA g ĠB inary Ġad ds mov ing pars ify 123 45 ARG ET Z SB h ue la d qu antity 01 8 Ġdevi ance Ġeas ily ĠDetermin es Est imate sib ilities l just Ġmin ibatch FT WARE ä¸ Ń mal e Ġembed ded pears on ĠOS Error 3 85 C entroid Ġf ine ([ (" Ġtrain er CON FIG Ġtre at Ġdependen cy Ġvary ing probe set in o an i Ġs ites Ġr bm ĠO THER Ġdesc r Ġsent ence Nearest Neighbors ĠDoc ument $ ", H S di fi up y linewidth s Interpol ator X s te ch object ive ĠMo dified D f M ass Ġre construct ff old ĠN x 11 6 check er Ġbin count Ġformat ting UN I Ġgood args ĠInt egr Ġgr p B enchmark Ġ ]: in ference Ġi df out lier ĠData Array 16 7 xx x Ġexpression s ) """ S top Ġin herit Ġre tain Ġg y Ġz one Ġacc urate seed s Ġoptim ized circ les Ġbuilt in ĠStat istics 8188 7817 1 88 D im ^ \ e co ĠĠ ĊĠĠĠ li fe Ġr ates ans wer 05 6 Ġapp lies Ġloc us 65 5 Dis criminant ĠDist ribution M R Ġs al Ġlo ck pro mpt 19 70 Ġstruct ures Ġcost s Ġneighbor hood Ġdependen cies 3 45 F inal } ") Ġi con ra ction qu ist il ds Ġ`` . bin ned ï¼ ī ĠMat hemat Tool Tip || _ Lab eledTensor C AL s ilhouette st rain ime nt con straint ne urons pro gram Ġbo ok Un defined vio ur C ent Ġc artesian ĠW iley FIL TER b z c mp c andidate Ġb rc Ġw t ĠL ay ĠL IL mo ments ĠE pochs ï¼ Ī Ġview s Sy mbol omogene ous F ONT P air h m l ers de queue Ġb io Ġnp art ()) )) Ġtra j scri pts Ġeas ier Ġr i Ġimport ed Ġpro tocol add Action qui ver center ing sql ite Ġside s hess ian Ġcop ies Ġ ravel il ine Ġk neighbors ĠE nd Com boBox c and le tt en glish ĠL edoit assert Dataset ĠB in Co st stack overflow ĠAl low Hash er Ġspa ced ĠInterval Index LIN ETO Discriminant Analysis Ġp si Ġd ta lin estyles ĠP ut fig ures Ġwh y ĠH yper close st Ġacc uracies Ġbu cket ĠQu antile Ġincrease s Ġquad r re ce Ġp id Ġs li qu ick index ers Ġsub classes 47 4 88235 294 Ġur lopen Ġdivide d d up t al Ġf ps ĠI MP ĠP ost pre p Ġl m Ġt n as ons ch anges ĠA L ĠR est +' \ T K T wo t bl al man ch ron Ġr at ĠI CA loc ated ref s UL TI Pre cision rm se F s ul lable to bj Ġme g 20 3 dent ials bl k period ic clo ses tab ular 117647 40 S pectrum c x train ed Loc ation conver ged / - 1 00000 de comp ing er ate x ha vior pl s Ġgener ators ĠSto chastic 2 34 f beta Ġp ix Ġ[ [' om ic 10 8 Ġle v Ġsql alchemy /> . plas ma d set r type Ġ[ { Ġimport ing ĠP lots pp ath band s Ġbroadcast ing nnds vd g uide st c () `` Ġh t log o 66 6 cor ded ĠCon stant final ize l ish er ate me ters Ġcon secutive Ġme d ne ar ĠB box Ġla pack ĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ copy right ... ' Ġfin ished track er Ġinsert ed ĠCho lesky çĶ ¨ 3 04 U til W rit p here s ink Ġi python ed Array Ġr st 15 8 Ġsub cluster RE CT ï¼ ļ Ġ'- ', ĠBe cause è¡ Į Spin Box + ') 1 78 c book ve ga ĠG round ĠB allTree Ġcor ners Le gend atom ic ä» · Cell s sho es ĠVis ual ) () C ho č ĊĠĠĠĠĠĠĠĠĠĠĠĠ on ed Ġmat erial ho use dis k 56 86 Ġå ĮħåIJ« X ML d og y ield ç Ń ar ma Ġc le Ġ' | Ġre store Ġ[ (" sh ot Ġdate util Ġwork er Ġautomat ic ĠCont rols Ġg ate ĠF ont spect ra Ġener gies B it l ang Ġs it Ġb lob ame nt con sumer ĠSe cond 03 7 44 44 ĠPoly gon 3 96 b an ), ' Ġco res iss pmatrix ĠUn ion Ġsql ite Ġdot s ........ ........ ĠExtraTrees Classifier I VE Y EAR j in n k w space å Ģ Ġh space ĠI ris ĠM LE log like bs ite char acters alt ies topo map ĠEN ERGY 0 35 2 36 n bytes è ´ Ġc rit Ġd u )) ). Ġh ierarchy ect ors inter pre ell ar Ġinterpol ated Ġlook s Ġkw arg hel lo plant cv @ @ g zip s li en ous Ġm transforms ax s pro files IN DEX ins pect Line Edit || || hns on 4 95 N s Z Z b ank Ġf x Ġg pr ume xp ĠFigureCanvas Base EP SILON tten hofer S ign S heet _ "+ g lm æ ī le ton Ġex ceed pro tocol Ġfunction al ()) ]) Ġtri angular mov ie Ġts lib Inter rupt Cont ents dest ination ĠPoly nomial ract ice Ġnpart itions A X O F Ġ Ċĉ art lett com bo skip na Cont rol ĠGo ogle U ES g un u eller Ġw ays ]) ** Ġco mplement Ġh dr ne y et y sc r ĠEx tension Ġgener ating Ġapply ing Gener ic Orig inal Ġ---------------------------------------------------------------------------- - W IN re pl Ġc ats pe x =' ') Ġpo le rel ate Ġ"" . Ġoccur s feed er SGD Classifier ĠHand le 9 09 F lag G n b t t if ĠP A ĠPar se ĠH igh save txt Ġclo ud Ġdirect ives Ġhold ing orn ado olid ays W X u um Ġa m Ġs z en g co ol ng ram Co ord Ġdetermin istic ĠMulti LabelBinarizer pk g percent age N umer l or r ich Ġre mote 17 7 Date Time Mix ture åı ĸ He ader residual s C trl lo cale ri end len a Ġcon sole Ġsha dow ä¸ ª network x RES H f act Ġ 97 Ġat t 03 6 Co pyright redu ction d uced ĠA fter ĠR aise Re port Ġj ump code cell Ġtri angulation Ġperform ing Ġren dered ĠLo cal perm utations Ġindependent ly ' ; > ", S lice Ġ jo Ġb ag Ġ8 5 File name cri pts Pre diction Iter ator ĠTh us R ectangle Ġ ĊĊĠĠĠ Ġre name ch is ĠD OK OR Y sent ence Ġcre ation ĠLabel s Ġutil ities sur vey VAL UE Ġcallback s Ġnews groups s nap v ision lt i ue st con vergence ĠW ave 0588 235 An not Ġmultiplic ation o ke r us v p Ġ# ~ Ġde s Ġde tail Ġtemp oral Ġdec ide Ġpas ses FI FF direct ive Ġrgb a Ġradi al G ene M ust Ġn dimage ch anging ax y ĠN B av i av y wo lf trans cript Ġgo es Ġfollow ed MS G G O n dimage at tach il inear mode s Ġts ne Ġlet ter M esh ()) [ Ġ{} ) work er Ġdire ctions ĠSci Py C hi Z oom č Ċĉĉĉ ĠC he pr ices Ġcom mun sup p Dir ichlet Ġperm ute asy nc S tack j k u di Ġ lim ĠT wo Ġr cond ĠS ingle we ather ĠB oost ics Context ĠSet up HE AD FUNCTION S = "", M a c rs e quivalent w c in line Ġt qdm ult aneous Ġimport ance Ġh i ĠA merican Ġu func ĊĠĠĠĠ Ċ lat tice Ex amples Ġq i net ic ĠLog istic Ġskip ped Ġsto res Ġcoeff s æĺ ¯ Segment edColormap M et b undle re moved Ġy ticks 37 7 Po st ran ches ĠOne HotEncoder ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ograph y 8039 22 A ss b at f ish j ango Ġe ye Ġis na """ ) ĠR el pa rents ĠE vent ĠB londel Ġequ ations Cre ates ĠSO FTWARE S W di re 94 95 month s tri angles clean up B ATCH C p E mpty P op W rite Ġt ight Ġr t log log vide nce ĠPer ceptron 7843 13 ĠPy Qt percentile s ĠDummy Regressor phot o Ġfoot er N u s and he mi ĠB atch Ġdist s Ġsub sequent Ġiter items UN D issub dtype l ons se ll de stro Ġth ing 22 68 Ġobj s ose n mental PCA Ġmultip ly Ġdend rogram E nt T here ab cd ĠR ectangle assert Not 33 5 Ġpla ced Ġdrop out Ġsur vey SIGN AL h c le gacy tr unc ĠX r ĠN aive Co v Co ordin std in Ġsp in graph viz math bf ift i Label Out ĠLo ss Ġthread ing destro y n levels w orth Ġv ir app lication comp utation Con st order ing real path Ġequal ity Ġlocal s Temp late fort ran ĠJo urnal Ġ---------------------------------------------------------------- ------ separ ated ,:, :] adap ter L ess w all Ġw space emp irical 35 8 Ġtext coords Act ivation ^^^^ ^^^^ P hi d n t test Ġin finite Ġg auss ĠI I ĠC ha Bin ary CC SD Ġdescrib ing Ġcap ital Main Window " $ 3 25 D TYPES F OLDER h ar r ig Ġb n Ġfor med th ird Ġr x ax arr ĠS ch inter actions names pace 45 0 Ġad jacency gin i ada pt acter ia uper vised S Y U ns u ses Ġf av Ġ' ,' ur suit Ġh ide Ġtra ces Ġag gregation trace back prod uc lst sq ĠAlter natively E valu li ps ĠS PAR Ġl range Re call ren ces 27 7 Ġlat ent ĠCalcul ates G U J SON S a Ġg a ĠE valuate Ġ`` " math text Ġfactor ization skip if pat ched Tok en éĹ ´ UNI QUE - ( Ġb lobs ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ ĠI P Ġal iases ast ro las k 16 2 bar h div id ĠPo ints vid ing P ri x range Ġm sa to Pandas ĠF ield sc roll ĠB ox ĠV AL gend er serv es Or deredDict Ġinvert ed P hase f ly Ġt bl Ġn om ct ime (" . ĠD NN Ġhe uristic Ġlog ical work ing Ġ"" ) pers onal Ġband s ĠEl se ' ``, E l M AC s uggest ct r Ġex periments Ġver sus 80 67 box cox Un expected Ġmarker facecolor Dist ribution ĠPo ssible ABC Meta ĠConfig uration F S it z ut ual un used Ġnp erseg Ġst orm ĠS ons ĠC H ĠL ICENSE Ġpro mpt Ġndarray s mplement ation Ġang ular Ġfin ish small er ) # r ules Ġa mb mat show pre fs ĠR ate ĠM ore 32 7 02 6 Ġsy napse kw arg ĠIN PUT Gener al fail ure B ins F ill N d _ \ o red or onoi Ġc r Ġd v ĠC A ĠL ong {} ". ob is Ġglobal s analy ze d ar 05 44 Ġmo dif version s Ġback wards Ġsepar ately ERR ORS Ġpow ers " { ' | 2 15 u uid Ġg lm ([ [' Ġ5 9 Pro perty Ġfont weight eriv ative 666666 7 æĮī æľĪ " }) 2 20 f und Ġn gram Ġp ulse Ġy p Ġde lt Ġlo sses com m 24 6 ĠJ ian Temp orary ĠPo isson æĮīæľĪ æĽ´æĸ° P hot st an es ser ), ) ĠF orm Ġk ern Ġun weighted map ped ong o 200 3 qui et Ġsur f ued iv Conversion Warning Y l e a f fill s np is Checked Ġr fn bin om Ġinter mediate Ġsup press 22 1 Ġcorrect ed ('/ ') Stat ic deriv ative Ġcomplet ely ĠTab ular ' ", / ') : ])) u a ra b ra c ct ree =' --', con tact sh ifted Ġch arge Ġinter act arr y std dev Ġwork ers 44 6 poly fit sens ors ĠEn able Part ition Ġsho es Ġt an ĠT olerance Ġx axis pre ading und ance ĠJ ava Ġtermin ated Ġguarante ed + \ 2 0000 P u y md um s ĠT ech ĠI dent bo keh add itional project ed global s ĠUser Warning Gre ater f wd Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re ason () [' ke leton pro vide Ġprint ing ĠZ hang 0980 4 Ġillust rates dependen cies Ġs moothed Ġb urn Ġex tended ĠP R ĠR ES ste in do i ĠJ an alan obis 9215 686 pas sed Ġre mainder est imates om orph Ġnot es ĠE V sp d Ġscri pts resample d ĠStat istical m ber } - in el Ġw idgets ', ), ma pper par a ent ially In it Ġmax val ĠV ol Co unts Ġgrid spec Ġremov ing Ġlearn ed åĪ Ĩ 3 87 7 65 G lobal G ain c ritical e ce s ids Ġst ra ĠN UM Ġun supervised ĠU TC ST AT Reg ist Ġsignificant ly Rd Bu D NA b ird ĠC lo Ġha mming ĠK NeighborsClassifier ĠCo ordin ĠCo unter Ġsplit ter Ġcomplex ity B ind b alance la un Ġcon venience 11 85 ĠY Y ID E gg plot ĠNe ighbors pad ded sca pe DIST ANCE 88235294 81887817 Ġt ell Ġx t ens ities doc dict Ġcirc les * ', E poch H DF P OL p atterns Ġno verlap 200 4 work dir Ġform ulation CL UD Ġexpect s P D P en R ot _ ", k fold t orch x path it ing Ġd ro ge ts res ampling Ġ... ) struct ures Ch art Ġpri vate observ ations Pe ak g i s pe Ġt ally ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĠS AM Ġsub clusters Ġro le tri u K NeighborsClassifier s ans in tr ts a cal ed Ġv oting ĠM a Ġmat vec dot s work ers Ġhist ograms complex ity FE AT Ġroll ing Q Label T ARGET U SA w ers de tection he ets Ġn ice Ġf beta Ġe m Ġre use ĠAs sert Ġyi el Ad just 15686 27 A x g rib Ġd ic ĠT ABLE qu art ad ratic set attr ĠD ir ag ent 13 0 Se cond FI ERS Ġrot ated plan et READ ME : ]] w as ic lustering un ix __ [ ĠH essian 22 9 RO SS Ġsv g Ġtz info t len Ġ' > pre tty Ġper f ĠH ashing Ġar ma cr nr Top ic Ġgg plot ' { A MP N Locator Ġ è con tingency Ġpro pagation ir l ĠB io 80 88 Ġsup posed LO W Ġdetermin ant Ġconver ged ĠLo op second ary ĠLasso CV velo pers ) [::- x pr =' . con fidence Ġcon c Ġout come Ġmin us Ġgener ally Run timeError EX PAND Ġmem ber F ast v box se x Ġi mb Ġo mp Ġst ations im in ans ion ĠN oth Ġso und loc ities 33 4 Res ponse Ġman age single ton ĠKe ep ) < S ig k in Ġa ctions Ġh uman na il Ġsim ulated Ġmis c Categorical Index 1960 78 R T en ius Ġre plic ]) - Ġcomp ressed ĠIn tern Ġla gs cond itions 36 00 rob enius ĠPassiveAggressive Classifier Notebook App . ]] Ġs ilent Ġe limin Ġco mes ĠI F Ġ{ % ĠB est Ġsk y 64 01 cy thon bin arizer 22 2 var name Ġscal ings Ar gs Ġselect s Ġmonth s Ġdefin itions ĠDes cription onom y Ġcoun try s co ---- ---+ Ġe eg Ġla p 19 8 ĠBu itinck Ġti ed Ġnat ural determin istic ! " 9 36 c ax Ċ ĊĠĠĠĠĠĠĠĠĠĠ Ġt ip pro g Ġle ads Ġce il / _ se asonal Ġ* , ĠL IMIT AR CH 13 1 Ġbeha viour DESCR IP Standard Scaler M apping S erial ` - e mb m cd z p Ġs uc (' ', file Name ĠThe il ĠG amma sh ifts ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ 95 5 temp oral Ġreg arding Ġindic ated cha ins äº § Ġpie cewise Inst all Ġtech ni P open Ġs df en coded Data Array 32 4 no isy 27 3 ĠJ in 87 6 acc uracies Linear Regression Ġmix ing Method s Ġshuff led GOR ITH upy ter - ' 9 0196 A mplitude j c p ure ĠF s ĠF requency Ġen queue Ġpa yload env ironment Ġalg os S amples n f at ively or b Ġo y la xis ol ic ag ger ĠK DTree 86 0 Ġtf idf Random ized ĠAR PACK combin ations ĠLat ent CLUD ING < < A v B M D if L U M ov se m or i st udy Ġi v Ġc w id ity ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ art ifact Ġpro tein ast lines ument a Ar row Ġdiag ram ann ual Ġupd ating A tom O mega l lf Ġs lot Ġs leep __ ') ĠP atch 32 6 not null 88 59 sv r 02 8 filter warnings ume xpr App end He re ******************************** ******************************** ĠForest Classifier conj ugate Ġbr ute ĠRANSAC Regressor h its Ġ ################################ tr uncated om s data file extra polate upport ed Integr al g x ith metic Ġ3 9 back ward Ġuni ques sche me Ġent ities Ġsched ule P s W x W ord _ () p n se cs Ġn z Ġd river li ze di str Ġde not Ġpro viding 24 0 spec imen Ġsepar ator ĠTH IS al len Ġb ed Frame s 20 8 datetime like RO OT det rend Node s 896 37 Env ironment CLASSI FIERS assertDataset Identical A uthor M SA Ġc lock ĠA ir Ġpar a Ġpre process Ġmin length 35 3 24 9 Ġgroup er si a Ġes pec Ġmultip lied Rep lace ĠSN R g cv é Ģ Ġ: :- ĠA rt to ggle ĠF ill ĠF ix Ġover lapping 26 7 Ġims how in dividual on y Ġs pikes Ġnp y ĠT ask po sterior ĠIn ternal Ġexec uted short est Null Formatter . '. O IN h atch í ķ Ġt end Ġs freq th ough Ġpro c ĠB ig Ġmin imize 05 7 ear th Ġ9 8 Ġsingle ton spect s Ġhess ian r nn Ġk pca Ġal le Ġpy dev 66 07 ĠEx pected ĠV otingClassifier Box Layout Ġinterest ing Ġconvent ions d river æ µ Ġm f ĠA nal arn ings 66 5 ĠCheck ing 64705 89637 6470589637 756 Ċ ĊĠĠĠĠĠĠĠĠ in h re cognized af m Run ning Ġ'{ : Ġrender ing Ġcam era laun ay _ [' a ctor a uthors h du ro ute ing ular Ġm utation con nections pro pagate Ġtr iggered dir ichlet 86 5 Ġstate ment post fix %% %% board Interrupt Ġdele ted " /> 2 14 8 19 E MP I A N EL b al Ġf la Ġin clusive ore tical 22 3 Ġpass band Ġfill ing Sh ort Ġpick led ĠMin MaxScaler ĠCh ar Ġfun cs Ġinf luence ĠFeature Union =', ', Ġlogarith m Ġelectron ics 9 45 N y de ps Ġn v Ġn ltk Ġf type Ġ1 10 ol l ter r Ġg radi py dev Ġfont dict stru ctions =% . EE E DNN LinearCombined A ffine f path n os r fft Ġ lot Ġst amp ĠS te [' _ we ak Ġhe mi 32 1 ĠU ses čĊ čĊĠĠĠĠĠĠĠĠĠĠĠ com ments Ġsome times Ġman hattan Ġaut ocorrelation Ġwave let mur murhash heat map , * B uffer M ON Ġc ity ut ers Ġre trie join ed Ġxy z Des cription s paces Ġb ench ot o Ġ3 8 ĠD rop 32 77 use package rect s sy mpy Ġtrans late Ġconver ts Ġc n is inf ol den Ġtr unc Classifier CV tri angular Lasso Lars Ġmarg ins semi logy b el Ġf v Ġre action Ġw ard Ġy axis Ġr d ĠRe port ĠB ar Ġsign atures ld g Fa ctory high light Ġtoken izer LST M D ecimal G ET P late s b on text Ġde velopment Ġres cale min imize format ted 96 862745 24 4 serv ation 84 4 Set tings Ġref ers Ġincre mental Ġsens ors Ġrfe cv æ Ŀ Ġo x Ġre corded ĊĊ ĊĠ ĠD ensity ext ents ĠB oth Ġpo inter 88 8 Ġiter ables math ieu 65 9 ĠSy mbol E vents S can S PL s freq s moothed Ġc types Ġf ocus Ġin liers 00 8 ĠB E Ġclass ified 16 1 Ġclean up mx net MOD EL tax a I ES ro is Ġfor ms tr n Ġst udent Ġmat lab ĠH er Ġzip file 199 7 Ġresid ues ĠHel per umin osity ¡ ç ar cs is na )) ; Ġde tailed Ġres ources pro cesses fig num rib uted Ġvari ation graph y 2 92 F lux L ib t ies Ġ ray one y ch er ]) + up load Ġu int ers hip ĠL R Ġla placian ml b Un able ĠRa dio # %% D U z ation ra ft Ġ\ ' own er sol ar 77 7 marg ins ĠTrans formed large st ĠML P P h u z w ill Ġm all Ġst rength Ġme th Ġl atter Ġstr ong Ġ4 9 Ġch ance Ġper mutations čĊ ĠĠĠĠĠĠ dis connect ĠDe precated DE D Ġcomple ted Ġtyp ing Ġes cape gl ue 80392 16 Ġtim ing - . E lements o y ç Ľ Ġ service Ġas recarray tr il ex ist con sensus Ġ` ( 17 6 Ġclo ses measure ments } ^ Ġ0 2 Ġst ochastic Ġh df py tz valid ated Ġspec fun Ġdirect ed Ġli ve ĠFeature Hasher Ġreason able M ar p u Ġf ns __ : ĠA SC pro te Ġdis cret Ġ200 8 ĠFe atures ĠNearest Centroid ĠSAM ME Ġespec ially 0 96 g ist h t p values å ° re maining co sh ĠT F om o py learn ĠF rame Ġsh ifts Ġcal ibrated LO SE Ġag ent infer red Initial ize Ġsatis fy T Z f whm ç § Ġf ancy ch osen ĠP AR Ġcon figure ĠM AT Ġma j Ġ6 2 Ġcrop ped ĠPe ter Ġ arch ck er od oc 12 34 Data Set so map Ġla zy Ġsp ine Ġsign ed Di ag tz info Ġsuper vised Ġdecimal s Ġcons umption Dis crete 663 45 Ut ils I Z L D l ated lo red co vered ata ble __ ' ne ctor 0000 1 05 5 Ġacc el Hist ory ĠIter able coun tered 445 66345 ĠRO I 6470588 44566345 2 97 L on S ur m cmc Ġt en Ġy b ĠR ank Ġ3 600 ne ver og en Ġch r 94 1 ref lect gy ro Ġrespon sibilities rot ations ĠIncre mentalPCA / . F P P attern Ġd ri ") ]) Ġlog its Ġbin ned ĠDataFrame s ĠCon v CA SE pert ure Ġsecond ary ĠDo uble O G m itive Ġa uthors ĠT ake Ġr id 20 7 13 6 lat in Con tour eg gs topo logy devi ation 4 14 Q Icon st ars al iases Ġs g as anyarray ch oose ect ed util ities den om multi index AC GT CT CT No ise Hand le Hel p Ġpur pose conver ters Bl ues Ġconj ugate omorph ic tlen e A fter k x t ions ĠL esser Ġpro files Ġlinear ly ĠHT TP Ġstra ight ] ``. b uff v ice ra s am ing 25 1 22 28 26 2 ox el Ġindic ators /\ /\ 1185 235 ) +' J UNK c ubic i ation t as at qz Ġp fp cal ib log det ĠCon vergenceWarning Ġstat istical Ġext reme rol laxis Input Fn Loss Function > . b unch æ ŀ def ine tr iggered set Up Ġun changed ug get OR ERS Set ting pass word request s ] *( z h Ġt ps Ġn th di vi ĠT hat lic ense Ġpy tz ml comp Inter face CO UNT Back end nor med T ables b ro mp s Ġy a Ġx err ĠF utureWarning Ġme ter 25 17 led ge Ġlin eno Ġ200 1 Per cent tot ype ĠStruct Field hal o phys ics xxxx xxxx ĠPL OT C RE V er n ii p cell he rence Ġo mitted set Enabled Ġde aths ns amples Ġcomp osite ref resh Ġass umption Ġli fe Ġanaly zer 926 17 Ġslic ing ĠFI FF decor ators A MPLES ĠR aw sub tract Comp arison comple ted Lasso CV DecisionTree Regressor Z MQ h id k it in cluding eff ort duplic ated P ixel æ Ķ Ġf lex Ġd vi Ġu id ps ilon 06 1 ĠOr thogonal Ġplace ment ĠIs otonic 92617 988 , :]) / '+ B S G ROUP ] \ x vals Ġr nn ĠM utual Ġinter sect AC E mit ian tensor flow repe ats regular ization mys ql R DD R ITE Ġre q Ġto ggle ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠL ibrary so cket Ġvari ants Par allel R et l ats m w len s pre amble Ġnew ton 66 0 Co lour pack et ĠTime Series ĠInter active ĠAb stract Ġphot o . ). 9 80 ? ) Q P n itude p val Ġs napshot Ġ1 000000 il lin pt p Ġg ame for ge 100 84 the ws amb da 5 34 B ernoulli H R N umpy e lt Ġc ython en um ha ses ĠA ff Ġ` " ĠE mbedding Ġcomp ile 45 7 EN TER Al chemy ti ps I V s pa re versed Ġp rom mat erial In cre Ġhe ld 19 7 zen ith Tra de Ġbuilt ins fetch all 9 85 J ava _ = re cursive Ġi id Ġf g Ġin compatible ######## ### ĠM atch Ġj ew "] ): na cl 24 7 Ġtri p Ġlower case Ġfactor ial Ġround ing assign ments Ġcollect ed B G e vals g irl p otential la w Ġre start Ġh op ĠC ase Ġ_ (' ĠD own IN ST SE TS RB M Doc String experiment al personal ized . ''' 3 03 C M [ [" å Į Ġ čĊĠĠĠ Ġc hem ce an mat gen ex ponent from file to olt (" ` ([ ]), ĠB asic Ġle s Ġat trib Ġjew elry v v or ption th ickness Ġg d '] + ĠC ls Ġme ant 01 9 20 20 Ġ6 7 ak a Ġmark s Comp utation lap se flat nonzero Al location Ġsegment ation ĠValid ation 2 99 3 000 F inder L ikelihood c ensus Ġf lash Ġin ches Ġ' ../ ]) ; ĠC F ĠC SC ĠD ecimal ĠN ull ĠB utton Ġint ended ĠW here 35 0 85 714 To ols ĠPlot ting ĠOption Parser mal n allow ed 159 66 âķ IJ M N M ath W ID o is o ids Ġp w lo pes Ġe mail () / ĠF A pr uned 96 5 lat ent 94 4 65 8 bit map ĠSh uffleSplit Ġbl k Ġdig it =', ') L DA ra ce Ġre ach ol ling il la '] }, ** : comp s Ġper plexity ĠFor ce Plot ting )+ " vers al Ġdet ector ĠDo es Ġpie ces ĠDict Vectorizer Ġaz imuth altern ative o pp æ Ń ĠC R 27 47 Ġgrid s flow s distrib uted Ġpen alties Ġdataframe s Ġrs lt Ġduplic ated Ġgeneral ized æľ Ł Ġib is 285034 18 96862745 28503418 E A S ite T e l le n w r ons w id Ġn ib Ġm v Ġm om Ġ1 00000 __ '): Ġextra doc ĠAr n En semble DI M pers ion åħ ¥ Ġpur poses æĺ ĵ h g h ull j la m X o use de precate pe t Ġh armonic ĠM IN app liance ĠV ander Ex pression datetime s 42 9 poly gons Ġlat tice ĠPre cision Ġplace holders Ġsym metry ĠSpec ific Sy m Ġgeo metric Ġagree ment R UN a res or bit ro ving """ , set Checked ĠS w ri se os ing mo lecule date util split ter com ing Ġmo ved Ġoper ate Ġkind s 0588 24 Ġsig ns Ġoccur red Cor rect 992 15686 b ility h sv æ ¯ la placian li fied fi rm set Value (" $ Ġup on trans fer Ġqu ite Ġnd min Linear Classifier ĠSh an Com mon II I Ġneg atives MO V a il s set v oked Ġp inv Ġ' '] ic ial ur y id is end point py xl ĠP rior cm r Ġcall ers ĠCon tain Ġnorm ally edge colors 647 1 sto pping Ġml data C SD U pd t st } ^{ Ġn mf Ġco var cl usion Ġcomp ar Ġpredict ors fol low Ġcontrib ution cccc cccc trim med Dictionary Learning ĠHam ming S urface f lex ¦ Ĥ le f )) ** ĠS moke ĠE ND Ġvari ates Ġcenter ing Ġhash er ket ch ĠDef ines ĠAnd re Dep th ĠOUT PUT " $\ I mages at i Ġd z Ġm ol un ct tr uediv Ġex posure ---------------- -- Ġ6 3 88 2 check ing prob as Ġcom mit 34 2 serv o sim ulate Ġdirect ive Check Box Ġlong name PO ST edu ce geo metric 35294 12 ĠWh ich UDF Type åĢ ¼ B iclustering K IT N ow S UP å ľ he ights Ġc k Ġg ram '] / Ġloc ally ĠUn der )** ( 123 456 Ġregist ered u er x r Ġ" : pro portion Ġl mbda ST OP Ġmon o Ġrect angular resid ues curs ively Ser ver S ep z on Ġs lower Ġ' \\ ex posure ĠO p ĠO ptim ĠIn valid 84 7 Ġdivision s ĠTra ce ---------- + a rent Ġp ractice Ġin vol up d ĠS un print ing 07 901 34 6 90 75 _{ \ Ġvis it CO MM ĠString Type ĠBoost ing ĠDir ichlet ĠIsotonic Regression A VE n od Ġs izer ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġst icky ul s ĠP ack ent ities ari ma 201 9 De bug script ors break s Feed er N ref S catter f is r k qu is plot ter Ġ8 00 Ġsp ca Ġimp licit lomer ation vir tual j ie Ġb igger qu x il cox ĠL ower mb ran Ġmin val Ġro unded ĠEx p with Column face colors vi a Ġpr ints condition ed Ab stract Ġstandardi ze ĠFin ally A vg C ircle ĠM IT Ġne ither ĠRe fer ]] ]) the ano Ġevalu ations ĠSelect Percentile Ġatom ic Ġexpect ation g le p in s lab le ts Ġp ct un supported id imension str atified Ġpar ame ag ers ĠO AS 32 9 Ġmin s :` \\ valid ator 200 2 Ġclo ser button s ĠCh annel Ġdid n stit ute Ġtrim med decre asing > ') _ * n col Ġc aching Ġl d Ġindex ers ĠEx pect Ex port Ġinterpre tation ĠLoc ation Terminal InteractiveShell idimension al 6 09 R aster [ % ä ¹ ut ors li ve Ġas k Ġ+ ----+ ex ons ĠS mall Ġk th 66 92 ĠAs set bet ter Ġshort er ĠUni form bour s Mapp able S quared f ns p CD co ok ad min ure d ĠM ar Ġl bfgs mon o 86 7 AL IGN Se ts 84 6 26 8 90 8 expand user DEF INE ĠAff ero B eta V M b am u da re et ad jacency Ġh al Ġplot ter 24 36 Ġtransform ations fra gment ĠCol umns Ġrespon ses Mat plotlib mar ize , )), . ): f ps es up Ġe lastic Ġre order ĠS M Ġbe come od d AN G play er 26 1 cp us Ġred undant Ġprec ise Ġtex ts pho logy N P O ther \ " d ut en ef ######## ## Ġx k ĠR DD Ġmat ter Ġfile Name so red ]] ] 97 47 fin ish ĠMe asure Ġdest roy }{ \ command s || ^ ĠTh reshold Read s good args Ġasc ii Stat istics xF C Ġbelong s WIN DO tlene ck d w q c Ġfor ces ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ con solid Ġcon tact ĠC S lic ations ĠU DF 30 8 Ġ[- . 88235 318 Ġsuccess fully 3137 264 ĠDummy Classifier built ins 294117 92 6607 36 88235318 660736 3137264 2517 L ight W hen re ward Ġex on Ġlist ed Ġen countered Ġj ac IN F ]] : ĠV AR Ġtop ics ĠLe gend Des cript ĠSE LECT Ġphys ical ĠTabular MSA l ue s df u setex z label el lip Ġpd p Ġ[] ; 78 6 ass ume 65 7 Ġ200 6 57 318 Ġ', '. Ġassign ments CO M US ER proj s Ġsur vival Ġmaint ain 2228 317 07901 57318 4 87 A da M ac O pt b rowser c val se a Ġb roken Ġst ress ĊĊ ĊĊĊ ([ . ai ro Ġoper ators Ċĉĉĉĉ ĉĉĉĉ Ġseq s TER S Ġbranch ing C la D uration Ġa u Ġex change ĠS tack ne ural Ġat ten 60 7843 Vari ables Work er NOT E = (), A UC b last x err ser vers Ġh atch ĠP ed ĠC l mb londel ĠE nergy 11 77 ĠH ive ST D Ġsol id Ġ... ] ugh t Ġfont name Ġcons ists Ġpop ulations QU EN æŶ éĹ´ t weets w or Ġd l Ġso cket Ġ\ " ĠData Types TI M Ġimp urity Ġdesign ed ={} ): ĠRandomized PCA Ġheat map æĪ IJ Ġpot entially 3212585 45 99215686 321258545 m q o logy İ · con tract Ġen et 14 8 gr d Group s Ġown ership CUR VE #---------------------------------------------------------------- ------ p ip de sired Ġin come () + set ToolTip ver ify pre processor ent a iter tools vi ol Ġimp rovement By tesIO Ġnn z Ġ"- " Bo ol Trees Embedding ãģĨãģĨ ãģĨ ĠChe byshev O FF f ocus o ct s pring u w å ¯ Ġc x Ġc mp con trast ĠC enter pa st Ġ{ { ump oints Ġ5 8 ib bs 99 4 clf s Ġmo lecule Ġdoc strings UT H sup press IS O ĠSh ift exten ded Dirichlet Allocation ĠJian ming Temporary File ĠShan jie D ec b ine m om me ssages Ġf requent Ġre try mat ically ĠA rea ĠN u Ġpro t ho p Re set 78 24 ([[ [ cm mi Ġlimit ed cap style ĠSparse Array nat ural Ġbic luster ( ([ / {} Ġd ct Ġre stri ort ion ch ro Ġdata str Ġnot ation Ġse ar ĠM ost Ġare n ĠG lobal SE ED (- ( 44 8 Sub plot Ġide a B AD _ `. i y v w Ġn dtype res olve Ġde scriptor Ġfi ve Ġpar agraph ick er ip ca De cision 43 9 poly val ĠCur ve Tk Agg L a g id x N ge bra ad tz Ġh omogeneous comp ound Ġtr ig iter ate 23 456 Mo use Call back åĩ º L AT M s f requent s hear ä ¿ Ġ ĊĠ re ferences Ġt arg Ġre load ĠS C ĠI ts Ġv an ĠIn dependent cess arily ĠKey boardInterrupt čĊĠĠĠĠĠĠĠĠ čĊĠĠĠ 2747 6692 ( ~ 0 95 2 88 R ect n ia ar ization Ġf und Ġor bit oc cur ID X initial ized Ġopt parse ĠRFE CV æł ¼ Ġlic enses 2 33 3 80 w raps re view ma gs qu otes Ġk x cor ners ĠNOT ICE ĠCategorical Index Mode Keys Ġresample d ĠASC II B and T icks h z p dist p ulse s ilent } ', Ġ ^ an c Ġ# -- Ġhe ights ats y Ġimp act go al ĠPro cessing ############ ## 46 9 TH RESH Ġsens ible ĠSub plot mong o Ġfrozen set S cores ç º mp ot Ġe og 00 6 Ġh inge ĠC lean dir path 07 96 The ta ĠFast ICA TRIB UT 607843 16062927 ' [ G AG J son e mit re load ar ity Ġi py el lipse ĠT SNE th r ĠA ngle Ġel lip Ġmax len Ġpy fits ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ :: - }) ". ĠUn it ############ ### Ġnet CDF Ġreport ed Group By PER I Ġoccur rences benchmark ing Cha in 1 000000 2 80 5 84 N I le ave Ġi c Ġ1 999 om it Ġk l Ġon set ĠThe refore 13 9 part ment Ġtrans lation 60 784 div isions ãģ Ĭ Ġman ip Ġrot ations 0980 39 Pool ing elev ation Univariate Select i ro Ġa ug Ġp layer it an co efficient Ġde cor Ġle x ĠJ OIN Ġsum s 55 55 Ġsim ultaneous ze ta Ġsolution s separ able Ġspect rogram DIC T u ary an ova Ġ( ..., ĠN D Ġ< - ĠRe place Ġ[' .. org an Al pha neg atives lst m tw itter ĠDetermin ant }/ { ĠNy quist İ· åıĸ c ite v oltage Ġs ag pro duce po inter Ġl bl ĠIn it 75 8 ĠEx ec Ġiter ated ular ity Ġremov es stro ke 99999999 999999 ĠMock Classifier SO UR cu da ĠBo keh Ġuncer tainty 2 98 N f l strip æ ¬ Ġh ull assert Greater ide nts 16 9 Index er Ġstart ed Ġdis abled IC ES ash ion mar keredge Ġuniform ly Def ined uro pe uli an 0 336 S i v ance Ġme as Ġ[' _ Ġcor relations Ġapp liance nan max 19 54 ĠCo py 18 9 scal ings ĠCon s EN S day of 08 13 annot ated Kernel App Ġov o Clo ud GradientBoosting Regressor datal im ĠMathemat ical WID TH t or ç ½ in sum re gress Ġs os Ġb uff ts frame ter ior Ġ` _ Ġqu ot Ġopen mc Ġtra iling 90 87 wh it Ġcharacter istic ĠMultiTask ElasticNet ĠPos itive Met adata Ġyiel ding " `` M is a ce f amilies Ġr r Ġx n Ġcon centration ĠE mpty Ġ5 6 sub sets non zeros ĠTo ol !! ! Ġus ual Ġart icle PRO JECT Ġautos ummary ĠInteger Type H ER W ikipedia k pca n ip Ġ utc Ġm g ĠA lt ĠD ay ds hape 11 3 source forge Ġuser name Ġimp ulse Ġmon otonic 79 1 Ġconst rained Ġcy cl Do uble Ge ometry Ġp late Ġdef lation 16 3 09 02 ĠQ T angu ages Ġmost ly ĠAR D SP ARK ĠRandomForest Regressor ĠHashing Vectorizer I m ` ), w hole in axes de scriptor Ġp color ĠX ML ĠM ac ĠB UT ĠB irch Ġ`` - Ċĉĉ Ċ AR D Ġsparse ness non linearity {} d TemporaryFile q ry il m il it pre ads (" _ ĠM D ps c Ġma ch ĠRe set ĠIn stead Ġsub module Ġ7 9 ater n AS F 87 9 Po les contrib ution enari os Lim it cu ssion XY Z K K re m er atures Ġre produc ri st am g Ġcon sensus im an ta ched max iter Ġsh ot Ġj c gra ds ĠV iew Ġload s ud ge Ġstd dev ("% . direct ed hdf s ĠAS F ĠProvide s N M U DE d of n es s ph st udent Ġp f Ġs ay Ġw f Ġg row Ġal locate ho using ĠH astie trans f mark down ############ # ĠBase map Group er ĠLogisticRegression CV ĠAss ign SER T ifor nia E valuate U pper a o a ware Ġn fft Ġs nr co astlines Ġis math ĠT akes Ġh p ĠC OO av as Ġsee also fft pack ffinity Propagation Timedelta Index illi seconds ĠHist ory Ġguarante e quart ile 09803 95078 0980395078 65 G ER G iven k al w m Ġn i one way Ġg aps up il py data file type pa g ĠG en Ġcomp iled Ġcomp aring Ġcomp arisons 12 9 grid spec Ġimplement ing 38 34 ĠHist ogram C at S upport b ill Ġ ĉ Ġt al Ġc ubic Ġ( [' ĠC lose Ġme nt ĠL im red raw 88 34 Ġcom ma Ġargs ort dis abled ĠSt atus Ġdecision s ĠRandom Projection eigen values Ġbic lusters aud vis onom ic å¹´ å¼Ģå§ĭ elastic net âķIJ âķIJ a ff x or ĠT M Ġh du Ġu setex ĠG ets Ġ5 2 Ġ`` _ ]] )), ĠSe q 19 82 sp ot var oquaux Ġvalid ated En able Ġpla in Size Policy Ġ'-- ', æľ Ģ ski prows ĠGraph icsContext Ġquad ratic synt hetic represent ation Ġmodif ication MOV ETO * \ h ints z ing Ġb rowser id erivative ĠRe pe Ġ5 4 03 912 ĠCon d Ġgraph ics Ġfraction al Ġsupp ly ĠVari ance vid ers 1 86 P i v ity or row Ġn w Ġst oring Ġh over Ġ_ (" ĠD ec assert Less Ġpre processor Ġdi vergence vari ates 88 88 Ġcor related 95 9 85 0980 Ġloc ated Ġcode cs ĠAl ways prior ity Ġoccur rence e ia i li s x Ġf ashion Ġm irror ). " Ġpre sence Ġwh itespace split lines normal esup Ġcalcul ates vector ize Input s thread ing ĠColumn DataSource Ġprior ity pat ient expect ation 401 03912 Ġmembers hip 850980 40103912 85098040103912 354 I E st dev () ._ ĠS ingular Ġco vs from Utf 36 3 fold ers Ġpri mal NORM AL ('.') [ Ġmn ist Leave P s as t ur w he ed itor Ġy r end or 13 44 Con stant sy napse ĠAr row Neighbors Mixin Ġcha ins 943 9087 11764740 9439087 % ', , : 4 000000 O H m utation and o Ġr mse ri an Ġl ats Ġsv ds stru ction Ġtmp file Ġ'% . approx imation Ġ===== === checker board sand box ĠHer mitian / * 2 45 S preading s pread Ġt ic Ġw ra Ġto array ĠS up =' + ir th sub mission 32 67 radi ance 96 078 Ġend ing 23 66 Date Formatter Ġab ility dat um Des k Cl ick multip lier mapp ings bla h " ') / { 2 18 : \\ A daBoost H C j ump z o is omorphic ver bosity int ype las ma cc rs ĠU pper Ġla unch 88 1 pol ys trans lation Ġ'. / )]) . Ġsa ver Ġeffect ively met res sal es Ġdelt as coffe e ? ', S ta b len Ġf ulf ut s pe z Ġre ward un ivariate as of Ġg allery Ġex cluding ĠS er =' _ type codes ĠI EEE ") ], Ġun defined Ġun necessary 100 2597 88 5 Ġ| = ĠV ert ING S Ġhyper cube Ġdevi ations Ġocc up KMeans Clustering ĠParameter Grid 45098 0544 0902 71 1002597 8088 450980544 090271 0 64 B its D ag f lt Ġf out Ġb len Ġto k qu it ĠS UB Ġres ampling Ġun expected ĠO per 06 5 Ġ& & Ġunder stand Ġhigh ly Ġdesc ending ET A Ġrepla cing Ġasy nc , )] B usiness T s t ally t ilt Ġ= ========= le q Ġre named est er ĠS igma Data Type be m Ġread only Ġim mediately ĠCon nect til de serial ize Back ground éĩ ı Ġdenot ing 2 90 b id c as t ell ĠĠ ĊĠĠĠĠĠĠĠ se terr Ġt utorial pe ter Ġ` `` Ġstr ftime et une util ity Ġqu oting Ġreg r inst alled ĠCom mon Ġsen der Ġbra cket Bayes ian Ġdemonstr ates çİ ĩ Desk top L i T oo s av st uff de coded Ġf max Ġs b Ġw av Ġ( (' ĠN FFT ĠE lement Ġle gacy 64 00 qui re Ex t Ġxy coords Ġrespect ive Ġsignific ance Font Properties ĠCor rect Ġgray scale Ste ps WINDO W C B d j n ls p ubl re starts Ġs moke Ġe vals Ġw cs di gest Ġex plain Ġor gan np oints per ovskite ĠM O Ġan imal 64 48 Ġplot ly tt f Min iBatch bic lusters ĠNew ton ĠPredict ed ĠBernoulli RBM slic ed avas cript F M S q S CHEMA he ses Ġm ys ser s di co Ġr ating data source con densed ĠC lustering Ġstr and Ġwe bsite 86 01 sent ropy hist orical cho ol Run timeWarning project s Valid ator nap ses Cor relation pow ers Work space Ġresid ue rupt ed Vis ible F RE F onts M id ] > f abs l it ç ± in stead Ġt l Ġt ear Ġ" * data Lim ĠP op ĠC ivil ise ct ĠD a ĠD AM Ġdi gest Ġro ugh group str 06 7 Se ction fer Function Min ute pg f Ġaltern atives crimin ator Ġefficient ly Ġcli ppath Bl ue c ash l ane t ures Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġy n Ġy scale Ġst ops up pe Ġh h iv ar assert List Ġun structured Ġfig Manager dist utils Ġreg ardless Ġconf lict Part ial assertList Equal G CT S ort s ch u ations č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊĠĠĠĠĠĠĠ de ts Ġc lim en cies ): ] ne ts Ġare as ph y ĠPar am the se Ġcom m 77 77 side s Ġab stract fin ished Poly nomial cogn ition ĠLassoLars CV J OB st ab Ġc StringIO Ġb ur ĠT eX ab out Ġk y ĠN umenta assert Variable inter pd Ġsub mission Ġfa ir do ck Ġcluster ings ĠName Error As set Ġchrom osome ĠStop Iteration Ve locity å¯ ¹ F ACT W in _ ")) å ĵ st ops al one Ġin dividually ĠI IR ĠD en Ġbin arize Ġ& = ash old can cel We ek 106 78 00000000000000 01 Ġprobe set ĠNE IGH ĠDocument ation WX K > {} ") k an n ullable t end ss y lin der am ination ĠR EG lib raries ĠB i pi lot ĠTest ing Se ed 84 8 Ġq c Ne g gb rt Config uration Ġpartition ed abc def Score r near by Phot o ? ", G reen f max n ilm t is t weet re rs Ġo de Ġr m Ġx d py x ise s to string ĠL ARS ĠM ueller Ġle mma 64 6 =[ ]): ĠPre diction ĠLine Collection TRE E ĠRE AD Abs Scaler Ġviol in AX IS c label f names j r n q p nl } ; à ¡ in div co urse ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ab y Ġex cel ĠS caling Ġh box py datetime Ġl work log lik sub fig function al Ġq id 65 4 Ġdifferent ly TI PS exec utable Ġsur v Metric Warning Ġgra b fir med ĠLeave One Ġgy ro I Q h mm è ¾ Ġd sk ur s Ġ[ [" Ġco ol ĠA D ĠIn dic ang er Ġro spy ĠEx port ĠEx periment arge ff db se cm n 47 6 Ġdat al Ġexperiment al ĠSim ulation Sen Regressor chron ous ĠIss ue F ROM P ast S mall d na in cent Ġi e Ġe ff Ġb type ic ip ser ts ĠT erm Ġde ps args pec ial iase 12 44 27 9 freq str 84 9 make Time ------------ --- Ġ"" : ĠLe vel ĠIN TO Fit ting Ġstack ing 199 8 Ġduplic ation Ġclip ped ĠEn v ĠDes ign ĠStruct ure sca ffold Ġatten uation ialiase ds R M R ATE S at ] ._ h f m ri o res s frame s lobj v ial Ġ ]. Ġc g Ġre cursively Ġb ary () * Ġu uid if est max s ĠM OD ĠG LM ĠRe trieve 64 9 Ġshape ly no stic ĠV oronoi bu ckets Ġvis ited uplic ate Qt Widgets 7843 14 Ġtoken ize COL S Ġwor st Tok yo SOUR CE C ut O Frame T MP g boost z ard Ġ= ============= ĠS PE ĠC ython (" ================ per fect Ġpre ference ĠE valu Ġ10 5 Ġlog it 14 2 St ation Ġ7 00 OD S 000000 119 Ġcons isting Sim ulation Ġunpack er OUR CE fortran array ĠTrace back Ġfign um 000000119 2092 F l S phinx n avig s pearman x fail me x mp tot Ġx array Ġcon densed ĠN N Ġlabel ings port folio Ġj s no va 95 686 Ġview er gradi ents Object Name +" \ Mag nitude 0000001192092 896 ' `, F ITS V S f reedom s rs Ġb us un ary Ġ[ {" Ġis otonic ul y Ġor g Ġan ova Ġan omaly ĠG O comp uter ĠE EG ĠB eta log file ()) ), Ġ6 1 IN IT ec g Se par ous ands CH O eli ef LO SS Not es ä¸ Ĭ Ġthrough out Add itional ven ue ears on Cont ent horizontal alignment smooth ing deriv atives Ġstim ulus diam onds Ġglm net makeTime DataFrame N ONE e ager g lobs i at t alk v us Ġ ]]) Ġs weep lo s Ġy edges Ġst em ab stract im ations pro jections ĠM PL uni q 94 1177 AL LED Ġgrid size Ġnon linear ĠInput s partition ed ĠRes hape bg color æľ ī " ', . ])) 4 000 [ (' b h y z ~ / ĉ Ċ se ud me asures lo be ĠT itle ĠS I te ff Ġwe ak log it Ġen ables ach er 05 9604 ard is 02 1 AL F Ġcall set ĠDe lta termin ate dat aname optim ization 0588 23 oper ations Ġpartic le medi ans mv n Ġstandardi zed 4000000 059604 intype code Improving Estimator 4000000059604 6448 C ENTER M DS f uel z r in correct re aded Ġt st Ġre view Ġis ot ad os Ġ2 048 Ġg uide Ġx vals mo us us ually =[ ( pol it 95 07 return ed Ġopen ing 65 5506 Ġpredict ing The se Ġ200 3 current Index tri ang ä¸ į Ġbeha ve åħ ¬ Mon itor ĠLic ence integr al thumb nail ĠIntegr al 1568627 655506 c z f dr æ Ģ lo o ig i Ġx b Ġh ive Ġshape file man age ĠCon nection Res ource ry st stru ctor Ġwant ed Ġseq arrays micro seconds Ġappropri ately separ ate genome s Ġmapp er Ġmedi um Matching Pursuit / *. 2 78 ] { b ldg p itch Ġf b Ġre li Ġw n id ians ĠR MS Ġelse where ĠN s 12 54 Ġcheck sum sparse ness cent re Ġmult iline extra ctor Linear Model Check point Ġfra ctions Ġinverse ly sens itivity Ġra re Sparse PCA dep ends ĠAv oid Ġpict ure SCI KIT p il st ds he ating Ġc wd ĠT ok ĠS quares Ġse curity ĠL ight Ġle gal so ftware ĠIn fo 85 8 Ġtra its Ġdraw s 57 14 Ġmid point Ġport ion Ġradi i ĠSpectral Biclustering Ġcli pping CHE CK Extract ing Wind Speed assertVariable Identical = "") V EL l ng Ġin her ĠT er qu id ch ol Ġlo ops ep isode Ġch an prec ip fra g Po isson åħ ĥ Lim its 319 5 M ach d q q da Ġ= ' Ġs pe Ġdata points Ġse is Ġse asonal 25 00 predict or qui lib 96 9 Ġtrans it 37 3 Ġdiv is let ters Ġregular izer Cal endar include s pare to OC K Ġant iderivative Ġswitch ing LABEL S ĠRange Index sched uler Conf usion Ġlas agne ĠCL F Ġliter ature toolt ip F raction O VA h uman x grid z min å ½ Ġo h co dings Ġto ks set diff [: ], ĠM ode ca o 05 2 ipy nb cor por ĠV ir wo od ,) + ins ic book s Ġfast a ĠCal ibrated Ġport folio dens ities Ġann ual ãģĪãģĪ ãģĪãģĪ combin ing ĠCons ider ) % . ` P G T G s ized re w or o al n de corator Ġd n Ġm ds and erson Ġ( (( ma hal Ġh its py der ĠD P ĠN orm Ġat m čĊ čĊčĊĠĠĠ File Dialog ura ble Ġmark ed TR ACT Ġ'. ', Ġdiff usion Ġbyte order Ġaz im Ġfore ground ĠGMM Tester Ġmonit oring Uns upported ĠContain s + ", C lasses ] _, l uminosity ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ de vs un CP li que mat ern Ġu i cal ibrated Ġout comes Ġma cro bject s read able tra pz Ġalpha bet 13 445 cor relate sim s tmp file hash ing Ġkeep ing ĠDate Offset pers ist 7843 1 chrom osome Uni code isot ropic 312 68 ĠMatch ing INST ALLED f rm i ser n partitions p py la re Ġw ild 00 9 () ' il ver ĠC ircle str s __( * 20 9 ges ort AN K ram mer ĠCon cat ä» ¥ View er Ġtp m Ġrand n ĠVer ify #================================================================ ============== ban ner mah alanobis # , 6 000000 N ULL w g ct ypes ha ps Ġy hat res ol plot ly ho les oc rit Ġpre ce start ed 75 294 19 04 axes pad 17 1 Ġtra des 55 5 Ġbu ilds over laps sen der 294 12 Ġadjust ment oci ation 285 7 Ġforest s ĠMock DataFrame Ter m Ġachie ve Ġrat ios ĠEV ENT G UI e gg Ġa min ce iver as fortranarray iz za ]) ], ĊĊ ĊĊĠĠĠĠĠĠĠ ĠC OL ĠR ender Ġres olve ĠM icro `` ` 0000 000000 inter mediate 15 68 ual ity are as ĠU SA default dict ================================ ============== work flow Ġqu it do se ac q Ġdatetime s (* [ Ġpl sca Ġtri vial SC R Ġ15 00 ############################################################################ # writ ing equ iv Extra ctor Ġperfect ly 156 34 Ġinstanti ated Bound ary four ier 7 01960 g rowth Ġf utures Ġe mission lt e iz able Ġk ill Ġk ws ĠM NE ign er Ġmax imal Ġfe ats Ġdist r Ġpa use 35 1 95 7 just ify Ġar ithmetic theta U Ġshort cut domain s tre at Ġpers ist ĠMix ture Bit map Ġimb alance 7824 707 8020 7824707 701960 80207824707 - ") 3 66 4 03 8 80 P SD Ġs x Ġre lat ate ver set ObjectName Ġ- % ĠS ur ĠC hi Ġpro posed 64 0 Ġnew line Ġhas hable pol ated prob abilites LE AF 44 0 ilar ity Ġstream ing Ġtrack s Ġglob ally Do main ĠChecking Classifier 2384 185 9 8823529481887817 B AR t abs u f Ġa uth lf ig it ure Ġb onds Ġr val ĠP ort ĠN ational Ġen semb ally Linear Ġapp arent ĠV e mon key 24 2 ================================ ========= Pro files Ġpredict ive Ġcontrol led ski ps ĊĊĊĊ ĊĊĊĊ FL AG Ġprefer red ('/') [- 6470589637756 348 Bernoulli NB allyLinear Embedding B GMM P ts b es n cv s col s parsify Ġre draw Ġb usiness ĠT ick set osa Ġst dev to csc str ate tick label Ġover head ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġany way 30 252 CH UNK Split ter Ġfold ers ĠMiniBatch DictionaryLearning Ag gregate pie cewise dend rogram SPL IT VERTIC AL Q MessageBox d ge d ynamics l mbda le ans Ġn f ro id Ġin version Ġ1 70 ]) /( Ġex pl Ġcon tract (" ./ if ar Ġlo o 10 69 Ġcomp ares Ġz r 15 26 94 117647409439087 30 899 39 15634 plic ing Qu antile lec ules 159 7890 Ġagg func Pa rent calcul ated Ġquadr ature 15966 3915634 3278 31268 3195 7817 1597890 85 ) ][ 8 0000001192092896 M G j ar Ġb old Ġw a ĠS i =' < to ctree Ġ5 0000 iter keys 11 01 read th av id Ġ{} ), Ġdis car 44 4 åı Ĭ ĠArray Type ĠSh runkCovariance Extra Trees isot ropy Ġlf ilter Ġmonit ors ĠTech n M AGIC b ck w ild æ İ er g Ġf am Ġy ellow lin nerud from timestamp pre f ([ _ ĠL UT Ġz dir 85 3 Ġsort er match er Ġpick ling DO C ĠFile s ĠJo in Cor r Mask edArray Ġdump s 296 30899 ĠFI LE åĽ ½ ĠPAR A * (( 8 7843137 E MA Ġ 999 Ġ' +' ol ive Ġg ens Ġh yp ĠD IS Ġmin kowski pr s 14 1 ĠV ER the il 07 9 Ġread line Ġmult idimensional ev t Model s Ġ'_ ') aut odoc track s ĠKernel Ridge MPL ATE Ġspa wn Ġtax a æŀ ľ econ omic L ibrary R a V el y ing Ġd ra Ġas anyarray Ġnp ts data dir Ġx scale os itions ĠF inal ne led 10 84 op ub Ġrun times diag ram Box Sizer ĠBase d ĠList edColormap Ġdoctest s ĠGeneral ized ĠPo ol Ġlearn er Ġpost s EE G commun icate ĠEd ge Ġsched uler ĠClo ud æĮĩ æķ° c umprod d lg à ¤ er ation Ġs gd Ġe cho Ġto do (' .. ĊĊ ĠĠĠĠĊĠĠĠ Ġfi xes ub s art icle Ġpro spects ĠM EG size of ĠB ad Ġen velope ord own weight ing Ġsc r 66 67 96 7 Ġstart up run times Con s err ing do it Ġtrans Offset Ġdifferent ial Ġ200 2 To Plot solver s agg le bic luster bat im . ]]), . /( > % ? , C ATE st ellar Ġc ad ra ds ic ations un structured Ġ0 8 array like ĠM issing ĠG B ĠE PS fa ils 17 97 Ġtf r 98 14 FF ER inv scaling Ġoper ating Ġdb c Not FittedError Ġsearch sorted Run s ĠIN TER Ġenv iron approx imate Ġpol icy Ġvolume s ĠGroup ing Ġfall back å¤ © ĠGeo Series REG ION rfe cv ĠNoth ing Q Widget W ER d ra s is Ġt ck Ġm map Ġe e sc ribe iter values Ġbo ot Ġhe ter cre ation part icles 23 1 tri angulation RA W expr s car lo ĠGo od Ada pter ! ' C ategories I somap K DTree O bs S d g ens h kl n h n v w edge Ġn l Ġb ranches Ġ1 25 ĠS K ĠF low ([ [" ĠL OC class ifications 99 60784316062927 ()) ): ĠReturn ed Ġmin y ']) ] Ġro bot 35 7 sp c LE N Ġtra verse SC SM sig ns ĠSh ort Ġir radiance ĠQu adratic FILE NAME station ary 2549 02 UB LE Down load ĠSci ence è¡ ¨ ĠMLP Classifier ------------------ + ãģĬ ãģĬ 9960784316062927 2 H IGH f ine k ron s ure t id Ġt ilt ar x le igh Ġe ma Ġb la Ġ" ` to ut ns ide ĠE voked ant ed und ances Ġdis c Ġsp lines tf r Ġprecision s serial ized Ġregex p 00000000000000 02 Ġadapt ed Writ ing 6000000 2384185 60000002384185 791 ) `, A U N r c rash i procal t uned x M Ġd q Ġ( ), Ġ[ + Ġg file Ġx tol ĠB ob log pmf Ġtime step Ġpath lib cv t Ġsha res Ġevalu ating Lo op Ġperiods per TE GER ĠValid ate Ġautos cale F lu d am e og i B t body è µ Ġ lfw an ion est ed Ġy es ch n ex plicit ri ent ĠP NG test er iv ing Ġun pickled ib ull state ment Ġ** = Ġrow span 88 6 ']) ): den ces Co ords Con nections gn ification ĠAl pha DI S sm art Ġplace holder Spec ies Ġpartition ing Ġ"_ " Terminal IPythonApp Skip Test pher oidal ! ) b olic Ġ ################################################################ Ġw all Ġw arp ch ip iz ip Ġx l pp le ent y 67 9 ĠAn not ucli des Vari ance Ġcy cles Ġconstruct ing Ġpartic ip custom ers mas ses 862745 1062 ĠLin ux Ġalt itude Ġamb iguous ĠDown load 8627451062 202 " ; B ias L vl g df h x æ ³ st ochastic he nt it ecture Ġw alk as sed ĠS pace Ġx f ĠD iff bo unded po logy da pi Ġend points 34 4 Ġevent ually Base d Model Fn Ġevalu ates NE W Ġmp atches ĠMult inomial Poly Collection FAUL TS quent ially branch ing _{} '. Ġpict ures C ap C TR G RA i af z mann Ġa es Ġp n Ġe cc ĠS olution Ġco bj Ġh olidays ĠP osition cl oned grid search 47 059 inv oke Ġident ically Ġrepe t Ġcomputation al assertIs Not pix map ĠRegular ization ĠConst ants R ad a ches b ul i info k r u va Ġt iles Ġc dict Ġf lask ct s Ġb z li e di e fi es Ġr rule py arrow Ġcon venient 01 097 import ant Ġhe mis Ġlog det ĠU pd 04 0 AL S ĠSt orage 42 8 Ġimp roved black man An imation FA IL hyper parameter Ġattemp ts 285714 285714 Div ision preads heet G ot J an S ING j ules r n å ī re gressors Ġd ial Ġg nu '] - Ġse mant Ġv cf che byshev Ġint ra 75 4 ense mb ST EPS Ne ed ĠPre ttenhofer arrow style Ġdescription s mis match CON TI Doc uments Ġsimp lify FIEL DS FEAT URE 3 10 N c U MM m step o ses t itanic al a Ġi boost lf ilter Ġ' ; =' .', time step et ter [:, : Ġ10 4 ak ing St orage 02 3 man agers Ġpl ant Ġrec ording ĠRandom TreesEmbedding contin uity ĠApp rox Ġmajor ity pie ces bag s ĠPh ys Ġ#---------------------------------------------------------------- --------- ĠPolynomial Features Ġtechni ques Ġflex ible âĶĢ âĶĢ 3 0196 C lear T imer W W b one å · at las re o me lt ĠC at min imal mo ose ĠB ound Ġun sorted Ġcomp osition Ġmax s ĠH ence 96 07843 sol n Ġallow ing Ġstop ped Ġtheta U Ġspecific ations 6666 6666 }} } Num Py åIJ į Ġprec ip FLO W Ġaggreg ated udi ence Serial izer B inomial U ID t iny v oting Ġo pacity set Level ĠS olve ĠS pring Ġbe zier py qt ĠC lient arn es Ġup load cond itional App rox Table Name An y Ġsens itivity plan ning Ġstatic method âĢ ĵ Ġmapp ings mor phology Static Text Ġgnu radio C ML V BoxLayout _ ')) c riteria e be p anda Ġ serving re cur Ġf ly en velope Ġd g ', ) ], ) Ġr gx ĠF ull ps writer ĠG tk ick r ĠW i ĠW RITE Ġj n Ġoutput Col ',' # 06 8 97 9507 Str atifiedShuffleSplit 117 6 Ġdetermin ing Ġta per mem map equ ation Ġ#### # Ġrecommen d redd it 87843137 979507 87843137979507 446 ; ") J y R MS S mooth o il č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 92 Ġf wd Ġo types Ġre ds Ġ( _, =' +', ĠA ffinityPropagation ĠD F sh ips Ġun stacked ĠData base 66 9 19 56 uc ation bu lence Ġq r Ġident ified Ġdat um Act ual ĠDis criminant dow nsample ĠRandomized SearchCV phys ical require ments ĠSc ipy Ġtim ings nom inal 5 37 7 27 B ACK w v ç ¬ or ation st y Ġn ature Ġn bin el ine fi ling ex periments ĠP a ĠC annot out side mo other ĠG ro unc or Ġsh p Ġpy matgen oth ers ĠTest Case 85 4 Ġpredict or De code 77 3 Ġar pack 60 78 current ly Int ended Ġside bar >` __ QU ES ĠCategorical Dtype ĠFigureCanvas Agg Exec ution Fore ignKey Ġachie ved Ġflu xes DNNLinearCombined Classifier consolid ate # ' ) [:- 7 686 E ach P df P OP Q Application S ol S ent T OR T IT a es c art r w t ck t ode t ube Ġs hear ut ter Ġe mit ĠT yp ch oo (' \\ Ġx ls Ġh ql pre ttenhofer Ġ{ \ class ified :` . Ġbu y hist o interval x Ġsig mas čĊĉ čĊ Ġapplic ations ABLE D Ad am Ġconsider ing elect rode åŃ ĺ GU OUS ĠAir flow ĠArn aud CONTI GUOUS / "+ P V b ri d ts t v Ġt v Ġc ru Ġin divi Ġm colors Ġ# : () [: ts lib Ġy d ĠS quared ĠP lace ust ic ase q Ġse quential ĠRe cord Ġpre serves [:, - ng rams Ġnew str 05 8 17 11 Ġdistrib ute Ġsum med ĠZ ip alle les full path ĠRandom ly RAN S RES UL PRO CESS Ġer ase some thing GR ESS 937 2549 5 3333 c nn h d z lim ĭ ¤ Ġt ornado Ġf names Ġs amp ra ge ro bot Ġy k set Window lab les Ġh ar Ġde lays 15 15 pr c pos al 75 2 88 3 Con ver af fe Ġq ry Ġass igns rad ar Ġret val build ings Ġeven ly session s lex sort 71 64 ĠEst imation ('_ ') ĠCho ose activ ities ki pping - \ . ]], K L T ry q q v olt re tain re stri st s Ġf ontext en di Ġ' & Ġre index ic ing ch s ĠA udience ĠL eft ir ing ĠU N 45 9 Ġadd resses ac cepts face t Ġad jacent ĠSt ates 67 4 extra s ry lov ital ic alt itude Ġrepe ats Ġradi o Reg ular Ġcirc um Ġwaveform s ĠAv ailable rece iver Ġvir tual A K C N Q Action b fill d ok n dtype p ink r na Ġthe oretical Ġ1 11 est ig ĠP attern ĠA da ĠN ext Ġpo isson Ġper turb Ġdo f 33 0 tt i Ġdis placement Ġvalid ator Ġvar ies Ġdown cast Color bar assign ed pri vate Ġpartic les cla imer Ġcb las rl z Ġgra ds Ġcc rs ĠDictionary Learning Ġste ady ĠTI FF instr uments Util ities 6 000 W ITH f urn v R Ġ  at ypes de rers Ġc ard Ġp ic Ġd shape Ġb agging to cut Ġk df pl r Ġtime it add itive Ġmodel ing Ġpo or 15 2 05 700 Ġ. / com boBox 04 907 lat ency 95 8 Ġ7 7 Ġnon negative RE C RO P rec ip Ġtick labels dr ug Dir Dump Sp an BU ILD Select ed Ġsat uration ĠColor map Est imated 984 31372642517 mapp able 7843137 3834 pur ple interpre ter Ġexceed s ç½ ® 98431372642517 09 78431373834 60 P g r ss r max Ġ= ", Ġ1 13 ĠT s Ġg df ex terior ĠM ov Ġout dir ph ant pos itory sparse funcs the ad 18 43 ac ha bl er FF FF Ġaccept able sl ug Ġclean ed ĠAd ded ĠBayesian Ridge åĬ ¡ Ġartifact s ĠVAL UES ĠLegend re Ġexplan ation ) $ 0 87 O k b ilinear g if Ĵ Į at ural Ġp an ct ype ro unds Ġe tree (' ] 1244 04907 254902 124404907 B oth G RAY M AN a veraging b v n am q v Ġf urn Ġp j en ing Ġ" \\ Ġst rain Ġg ave Ġth r ĠF inds Ġme ters Ġcol span Ġv otes max len ip ntr Ġ.. .. AR I dis card ST ATE ous ing Ġop ens Line Collection Ġtheta L RAN DOM Gener ating Ġhash lib Ġcha pter Ġtyp ical NT B aml n Ġcomment ed ĠStart ing Ġinstanti ate ĠMag icMock Ġqi ita F N I WATER z fill at percentile re cent Ġd cs ', )], di ameter ma int """ . set uptools ex cluded ĠF ig ub ar Ġl g Ġout line loc i wo o ref er linear operator 65 09804 Ġimp lies 49 02 imp uted ĠRidge CV aco bi 005 249 707 10678 share y Ġquant ities tu key éĩ ij tim ing IMP LND GROUP ED 1296 005249 6509804 1296005249 d array d get e clf æ ĭ Ġt uned al ive Ġs ss Ġs pheroidal ro te Ġb right Ġw l un defined Ġto wards ĠL ib Ġnew ly trans parent Ġexp ressed 44 08 ĠUn defined Per turb Ġitem size Ġsearch ing Ch ild ĠInitial ization ĠSQL Alchemy tax on van ced Ġhook s through put ĠPA IRWISE ĠCOMM AND ( %( 2 87 B UT P ix R P R out S UR e ither se ctor at r re z fi bres ab or ĠC umulative ĠD et ho c Ġdi ss Re pe ĠH O trans it run module 06 3 ĠJ oly sign ific Ġimplement ations pass b fitted values mid point Ġ". / tex info Ġsuccess ful vertical alignment Ġmouse event sn k rev ision Ġcolour s Ġ------------------------------------------------ --- Ġhouse hold Ġnom inal Ġretrie ved ĠCalibrated ClassifierCV ĠSpring er , ..., A ux L and M AG g ent ed Records Ġnot ify Ġ3 000 Ġk aiser Ġal located et ween Ġun labeled ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġdis patched 67 6 Ġser ve Man age CC D tab ulate bn ds _{} _ Pack age NET GEN cand les ĠFont Properties chis quare assertNot In MiniBatch KMeans Ġbary center C lean D a D ER P lace e ma w gt Ð ° Ġ ĊĊ Ġa w en ith om as (' ( Ġg as ri es Ġv iz Ġdi ameter AT OR 27 0 Ġdis claimer IC AL ]], [ RE NT Ġob serve Ġ[" % Res idual ĠQu ant dispatch er ĠNormal ization ĠTra ding visual ization 1818 1818 Mark er decre ase L Z a fe c mex f type i NaT Ġf isher Ġ' ĠS urface Ġle doit cs m ca re Ġdist ingu Ġ[] ), Ġfit ness 19 89 96 2 94 7 ĠQ MessageBox config s Ġconfig urations ĠOn ce tool Button interpol ator cla mp Ġexc itatory Extra Tree ĠABC Series 311 01 war p crnr lon ä¿ ¡ çº ¿ # - E W P t m jd x units } \\ æ · se curity re ts st x Ġc art Ġb d ic elist Ġco il col name Ġse x pro fit pa used ĠM ink ĠM ULTI Ġun signed op hore Ġsk bio Ġ[] : start time 88 87 18 2 Ġar range 46 33 Ġfix ture 74 11764 imp utation imp ulse Ġintegr ated 53 1982 Ġpys at Ġmultip lier Optim ization decimal s Ġswap ped é¢ ĺ ĠExtension Array Ġpydev d 8601 531982 endi x 7411764 8601531982 . *( : ]), C oc D ates F ix L IMIT b essel à £ co arse Ġg rand __ ", ri um Ġv oxel ip ment Ġbo unded arr is 04 2 Ġed itor Ġextra polation 98 904 Ġsv c ĠCol lect stra ight Ġsetup Class Ġtoo lfig Loc allyLinearEmbedding micro second Ġremain s Ġturn s ĠSc ientific Ġcar topy cen sored 195 43 CAT ED ĠCoordin ates TIT LE B rowser Q LineEdit X k f li x vg à ³ Ġs parsify Ġin ject est imated Ġy vals ĊĊ ĉĉĉ Ġex tobj [' / ': [' ag ain In compatible Ġfig s ']) [ St and OR IZ Pro gress ram erate Ġread able ĠSt and 98 1 lik es ĠPro jection Ġrepresent ations ĠNe gative now ledge Ġthem selves Ġexec utable pick er SH A Ġlet ters Bo unds ĠFIT S 707 7 012 98904 237047 19543 matern ity PROTO COL 470588 23704719543 M akes he avy Ġf val en umber ig ra ch ina Ġst ds ri k pre ference ĠR atio Ġpro ceed te e cept or ĠW n Ġbo ard pi red Ġpa y 14 3 94 6 27 6 ater ial De tection igen ce seq arrays cle f Comp onent Ċĉĉĉ Ċĉĉ Ġsearch index Ġaccording ly Figure Manager similar ities Oper ation Face t osa ic PRE CATED Ġautos caling vor onoi PLOT LIB ĠEnv ironment H ow S UM i id o od w r Ġi vl Ġc pp en es ro ker Ġo tu Ġm ind Ġb on Ġ1 40 Ġ" @ ], [- Ġtr an use ful ank el AL T alg os Ġoptim izers 21 10 tri ps Ġadjust able ĠTrain ed Agg lomeration Cal lable centr ality Over lap ĠHDF Store allt ypes ĠMC MC ĠBin arizer CCSD T lle gal ĠBlack man ĠLUT SIZE A ML B P B royden P lan T U c pi e u g pr z test é Ļ Ġs aves def s qu ity tr iv Ġy c Ġg i Ġcon ds if ting Ġpre amble =" { ip pet ĠO pt sub clusters ĠU TF vari ate trans port fer t mit ives cho col Ġpick er Ġpad x Ġord inal Ġanaly zed Ġgeneral ization Ġdag bag ĉĉĉĉ ĉĉĉĉ Ġmultip les Ġpipe lines ĠDes cent ä½ į Ġsd ca Ġslic er Tr uth Wh ite FOR EST Adjust ed Ġlu igi SCR IP C ube R C R adi g hi s ma y c se er Ġin consistency as ury as linearoperator qu oise Ġr py ĠF rank Ġal one art in ĠL LE ĠG u ip ng log sf ĠO DE ren ds Ġerror bar ================================ ============= fix tures Ġwork around UT ION url lib Ġcond list Ġtri ed Ġfill color ĠAdd itive Ġfast path Ġexec file 9215 68 ĠRow s dele ted dri ft -------------- + #~ #~ ĠCoordin ate Incre mental ĠAbs olute Ġrelat ively arx iv 0 84 4 37 5 17 D t E F E mpirical L ag L DF _ ``. b x b istochastic s he w his ar range Ġn k Ġn ullable Ġm illiseconds ed ance Ġ" ." Ġy m Ġco arse Ġbe g ĠP xx pre view Ġres olved ĠL AB low pass log cdf ant id Ġmin max Ġdo ub Ġsub mitted Ġcolor maps gr ps Ġac cessed EL S ĠPro perty ED D Per m Scal ed >` __. Ġsymbol ic Default s Ġsuffix es IGN ORE nav y ito red paralle ls ament al Coordin ate Ġalle le KER NEL BUT TON 5 01 in active al located Ġs ch Ġe a co al ge q un expected Ġ" & Ġtest Pandas ĠF r Ġtr ick '], ' Ġsub space vari ation 45 12 the n 97 72 ac ute msg pack vis or ose conds čĊč Ċĉ IS ING 294 11 Ġ"% . Ġpack ed determin ed Ġgui Event bon n Ġrough ly # ------------------------------------------------ 5 0588 C ODE F x L ambda y units Ñ Ĥ Ġa ic Ġin validation Ġre po "" "" Ġw d Ġw ar un pruned int ro Ġu v if ul Ġme mbrane line Edit ĠD ot ne v ĠL FW Ġlog prob io u 19 87 Ġvari ety 84 45 AC C Str Formatter has hes mf cc Ġbox cox Ġpp f Ġtermin ation Ġexpand ing das hes Ġdele gate Engine ering Align ment Evalu ation Ġaug ment Ġ-% } ? ') B z H uber I on b rier s ine x z x slice Ġf whm mp eg Ġ( *. ver ses Ġpar cel et c ng roup ĊĠĠĠĠ ĊĊĠĠĠ LE AN ST EP si color Ġcorrect ness hand ling Ġlat ents adjust ment Ġsimilar ities Ġaccess ories ĠAd ding ç» ´ Eval Type fall back Ġliter al Ġspawn ed acha bility 5 75 ? \ a gree h ill n row p ss p ly v span ç Ĥ Ġthe mes Ġ# ( Ġ1 30 )) } ĠC hem Ġde lim 01 56 ================ ==== ĊĠ ĊĠĠĠ Ġper c Ġqu art 34 45 65 6 multi array matplotlib rc Ġar ctan Un der poly der ĠPro ceed gno res invalid ate ĠMax AbsScaler Ġhel ps ĠMon te flu id hint Text cite seer - '+ 8 12 B ER S ampling W T u an è ¦ re try re action st m de lays Ġn g la pack ut ive Ġw rt () [:, tr ust od ot ĠD FT Ġcol ordown Ġal ter ĠM c sc ience ag a ĠH ttp Ġmethod Name Ġgrid lines ĠQ U mpl ices 28 235 ui lt align ments UN IT Ġpop ulated ĠOr d One ClassSVM ĠNo ise Mult ivariate ĠMiniBatch SparsePCA è¿ Ľ ĠDouble Type 27476692 1997 95686 274766921997 XRD ML ) $') L FW Q A R stat V as b royden f re l work p upil in ction an omaly Ġf path ct ic Ġg ci ab undance ĠS catter Ġde que Ġun biased text bf not hing check points SE QUEN 06 9 ME AN sin c 117 78 let ion complex floating EX AMPLES HE IGHT ================================================ === TE MPLATE ĠUni que Ġgeo mpy Ġeig vals Ġcontrib utors ACT AG è® ¾ ĠPRO VIDED ĠRest rict Annot ation ĠJava ML crnr lat Sep al 4 2745 H ive O dds p unct y mbol lo greg Ġ0 4 Ġbe auty am ueller ĠA T Ġde ad Ġde coded ĠF robenius Ġcomp ound ep hes ull back 22 97 Pro ps TR Y 49 803921580314636 ({ }) br ick Ġli l ^{ ( Iter able Ġfail ures Ġdescrib es Ġsuccess ive Ġboost ed quant um ĠLassoLars IC ĠDep th simp lify ĠIntern ational oton ically ? ") M ASK N AN T ot m ate w mc re ctions Ġt id Ġc airo Ġf at Ġin variance Ġm us Ġe lt Ġre ST Ġb enef ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ np ack ĠD im 01 55 Ġpro g der ived et ree ĠRe c Ġfile system ĠB O ib s bin arized Ġcolor up 13 47 sp ots Ġimp ro sa ver ĠIN CLUDING Ġtoo ltip Ġconf Mat GD P ĠWAR NING Ġborder axespad ĠCO CO determin e 977 17 ĠExtraTrees Regressor whiten ed ĠRo bert Ġtan h ĠLinearClassifier Mixin ; ') A W F ields L ear c dot j acobian s ale æ ģ st mt Ġi er Ġf ish ro gate ): ", and ing nt SelectorMixin lin ux ĠS ol ĠS olver ĠF urther Ġpro js po ps 10 88 ĠG PU Ġun balanced da mage Ġhas hed Ġro is Con vergenceWarning Par ts Pro d acc ent De lay Ġpl ugins Ġmon key fin etune ET HER Fa il Ġdiff icult gray scale Ġeig s 35294 1185235 Ġcare ful Ġexplo it mouse event ĠSH ALL Benchmark s Ġgd al ĠPack age Sta mp CGT ACTAG Ġisot ropic Lear ntSelectorMixin 352941185235 97717 * ') 2 84 P ick r rule ë ĭ¤ Ġin de Ġ# ================================================================ __ _ __ )), Ġth rown con nector pp cc pre proc os ine po re ĠG PL da e Ġat mos color Converter Ġsub linear ĠData frame ])) )) 65 66 Ġob server other wise Model View Ġdir s Button Box feed back ĠNormal ized Item A äº İ ĠVari ables Month Begin Ġfeat ur Ro le nnds vda Ġmaint a ĠSpecific ally ĠEmpirical Covariance Mach ine Ġensemb les åī į $ ^{- D ock R MSE V ir t utorial ra mp Ġo ct Ġre m Ġ1 17 un nel un ravel Ġis complex Ġnp oints pt o ĠP earson pp ers '] [- ĠF l Ġres caled te carlo pi ct Ġsc ientific ell igence Ġdif fs Ġacc ent Ġwindow ing effic iency Ġtrue poly hand lers Ġlink ed CON D Ġprefix es Trans pose Ġgu func umin ance Mapp er Ġtar file dire ctories Yl Gn Install er ĠRedistribution s furn iture - _ B R N t S G S ame e er g w v ature å Ŀ Ġ Ċĉĉĉ ort ick Ġis hold iz z Ġh stack ĠI mplementation '] ( ĠB and sh ir ĠK NeighborsRegressor Ġ7 4 Col ors Ġar rows make array 46 22 Ġthreshold ing Ch r '} ), Spec ify thread Profiles ĠSub set Ġneigh bour Ġtot ally arc cos ĠTemp erature ĠLI ABLE Cho ice ĠLong Type ĠDAM AGES , ): 5 77 : ". D ash L arge å ģ at he al location Ġn umpoints Ġs io Ġb readth tr f ex pon ĠP ol (" \\ 01 1 ind ust Ġpro mp ĠRe trie log prob ca mp 32 69 05 42 Ġlog like Ġ[' % 88 4 Ġ8 2 AC H termin ator Ġhelp ful Ġext ents ĠCal led ĠAR ISING ĠTrans f 119 119 644 165 ĠMetric Spec ĠLay er Sa ver ĠChar acter ntax Error 75294 119119 75294119119 644165 C OD M IT S up k W r fs s nake Ġt svd Ġs qu un if um idity Ġy grid Ġ2 95 ri ft py pi ĠF T Ġnum s ĠE lect ĠB artlett Ġen force ER Y AT ED "] ]. Ġbin om RE QU SI MPLE AB LES Ġhist orical 29 84 ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ const s )+ '. QU AR Tra ck Ġillust rate Clo udy ä¸Ģ 个 lips is ! \ H ub N ER P at P AN T urn U sed X r ł ģ Ġs pread Ġs lopes Ġ' )) Ġm ang ĠT E Ġg cf ĠE nt ĠB roadcast Ġhe ap ĠIn st ĠH ard input file Ġcolor ing pla ced 04 3 IC H RE GRESS likelihood s Ġincre ments adjust able az y OO B Ġli es ĠInter polation writ able Ġtrack er åIJ Ī Mo dified ĠSQL ite ĠIter ator ĠMean Shift Ref resh cycl er ĠSystem Exit nndsvd ar æĿ ¥ QP ushButton sport ing 4 0000 F IN H a W arnings f prime n ugget w itter Ġ= ======== Ġt step st ages it ask Ġs heets Ġd ynam id o Ġy out up stream Ġassert Raises ĠF lux Ġ3 50 Ġme s row se 12 55 ca des 13 01 22 80 17 603 AL Y cell ular DE COMP Ġredu ces Ġdet ren Qu ad CD S ĠCON TRACT Ġexport ed Ġscatter ing 117647 05 UD T _{} . Char Field ĠVander plas triv ial çĤ ¹ 8 000 B GR Q S S yn T D b k { % à § Ġc and ro des un normalized Ġr an (' .', ĠS tyle =' %( ĠP i Ġres ol so ma transform ation AT ORS Ġbin arization 03 117 method caller 17 64705 ĠFor ward Ġwork dir Ġtrans itions 37 6 ob servers make DataFrame ĠLinear Model clo sing Ġfeed er Ġmultip lies ĠEX PRESS MB EDD Ser vice OOOO OOOO Ġaccumul ate ĠOTHER WISE ĠWave function TIM ESTAMP 705882370471954 35 + )\ A IN T xt W ater v n { :. Ġi dialog Ġp al ad ult Ġr b con fi Ġde scriptors ne ither ĠG i Ġma kedirs comp iler ĠW CS Ġdo k =[ [' 92 3 IC S Ġ[[ ] Date Col ĠGener ates SC ORERS ĠLinear Operator ilon inc ĠGaussian RandomProjection compat ibility aut iful Ġfinal ize clip ped Sub stitution }$ ') ĠDis crete TA AGG 196 08 åľ ¨ ĠSC ORERS Ġment ion Ġreds hift TAAGG CGA A u A pi G cf L ists S ty e mf f w in validation me ss Ġin coming Ġw ww ĠT ORT Ġy v Ġ* ( Ġcon crete ĠC ROSS Ġ% } ĠD ow ase s ĠE ST Ġun ix ================ ========= 33 036 Ġtemp eratures 37 061 55 29412 respon ses vis ited Label Spreading dataframe s At tributes 999 17603 Regex p ĠWH ETHER 988 24 Ġrea ches ĠLO SS SU MM ĠSimilar ity Regist ry 92617988 59 æ¯ Ķ 0813 99917603 ĠRobust Scaler Ġinhib itory 50196 081399917603 navig ate ĠTok en Ġdial ect 03117 37061 1764705 9261798859 5529412 0311737061 ' ', 4 02 A ug G auss I RED V IS b q p q Ġ zer re cs ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ le ading Ġs max Ġthe ory co arser ed f un fitted li dx ') }) ĠF c ĠR NA In correct Ġz enith print options 88 33 Ġarg min the docs Ġav o Ġmult ith mer gesort 98 78 vs nk 67 0588 ĠNe ighbor PI X Ġpe ars Ġlon gest Gaussian Mixture Ġur i Do es Hel lo bre vi arc sec ĠCluster Mixin Ġstrong ly Ġdiscret ize Ġmach ines ĠLOC AL ( $ 5 88235318660736 N aive Q SizePolicy er mi Ġf il Ġo mit ic ity ort ex lab ility Ġh armonics os m Ġlo s ). ") ĠL ag lib rosa oc ial Ġ-------- ------- ĠY ear ĠU F pen ded 03 9 Ġsy napses csv file Ġsp ot 97 9 db c Ġsome what fore ground Al low ĠGaussian Mixture ĠLo uppe Ġdebug ger ä» £ ĠTh read tele com ONT AL Ġaccumul ator Ġconcaten ation MEN SION ĠAg gregate El lipse MON TH EMA IL ĠGro bler ĠJa ques 588235318660736 08 = < W A e cho n ucle v r æ ± in dependent Ġf obj lf ile co tt est ablish data Frame ĠS Graph ĠS kew ': {' col on ĠF ltk ") ( ĠE very ms gs 99 95 Ġaxis bg sub linear sub scribe ll ust Ġpa pers Ġos r not na Ġcont rolling Ġdis joint ap an ĠJ ob ĠDe cision kw doc Comp are Label Encoder Ġerr msg åı ¸ 76 87 Ġcustom ize Ġexog enous ĠCre ated access or COLUMN S Ġwhiten ing WOR K pres ort viol in ="" ): Ġfair ly ORIZ ONTAL æģ ¯ 0 20 D EN T ur ] ==' h ind j n m V re assign Ġn row Ġd il Ġd ry Ġ1 14 li as ĠF mat ĠF UNCTION 01 28 Ġcol names Ġpre training Ġun ity Ġun constrained 19 75 by e 36 856 Ġ9 00 legend s pop up Ġrank ed Ġinterpol ating mit t chunk ed Ġmer ging EX P Ġpp cc LS H cb c Cal ibration utc now åIJ İ arith m Ġserial ization Oper ating 512 7 ĠCar lo 92617988 6 Ġparame tric æ¬ ¡ åħ¬ åı¸ quilib rium ellig ent 11764705 926179886 B undle C ED R educe T i V ED a ws c ds d rag n S u funcs x w x imal al loc Ġf k Ġp anda Ġis Test ve locities par ist lin denstrauss Ġco variates Ġx edges Ġh m ĠP lan to ps Ġme sg ĠL E sc ra ph at ib ler ign ment ĠW ard Ġmax x no logy 45 3 Co verage SE UPD IC K my k AS C NA UPD 9999 9 Ġcre dentials Ġ", " NU MB md l panel s defined Split Ġfn match 873 95 ĠMon th ĠOneVs OneClassifier Ġlt i Ġjo hnson Av ailable è¦ ģ parist ech 7 6470589637756348 h ut h man s se } ], Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ re views Ġs np ): ( Ġw ashold ur ious Ġ0 7 as object ch irp ') [' ri val ĠI gnore ĠA mount pre load ĠC ODE im db 01 23 Ġal ph df t Ġ{ ! Ġmat hemat we alth Ġdf t sh ink ign ored sub type Re lease Ġha ven 80 64 66 253 rand s trans mat 95 798 uc ial 07 07 man ent Ex cel ĠDe velopers Ġrel ations 46 2745 null s PL SCanonical comple tion 9215 7 Ġ18 00 ĠApp lications åĪ ° 126 95 RGB A 003 92156 235294 1185235 clock wise So ft 294117 659 aaaa aaaa 8859 36856 %%%% %%%% æĶ ¶ 0796 11778 markeredge width 30196 079611778 33036 804 shink rage 00392156 885936856 2352941185235 9772 294117659 33036804 30196079611778 259 00392156885936856 27 ; \ D ROP G al S ine W s c ab k args p vals } [ å ¾ re li Ġi NaT Ġp vals Ġw ise ce e tr s (' '' ab oost Ġcon traction ĠD eriv po ssibly Ġun ders ib old Ġdi ver port al ren ch Ġmin ima Ġ) [ Ġos m Ġ6 55 vert no ĠSe ction show Msg 35 2 Ġid le ĠV incent 17 469 27 34 temp orary Ġnode list can cer 67 1 Ġdir ichlet DATA SETS Ġbeha ves QU OTE sur v bg rc 109 24 873 4512 vir ginica Ġml comp QT Agg stan ford TOT AL 5 0000 H orizontal b usiness b roken i map o py Ġn arrow Ġd k ĠT ho -------- ---+ Ġdata source ĠP air ĠF lag train er ĠH E ok es sp m Con vergence level name ID F face book SI G 26 0504 mf c Ġ"" ), ru id categorical s 2016 80 ĠCON TRIBUT VAL UES 663 8655 ĠEX IST Ġeig sh Ġep isode Ġant ialiased Ġsatis fied ĠBlock ing 7899 159789085 7899 17469 WOR DS Cov Det /\/\ /\/\ 9075 63 Ġwra pping 66253 66 6638655 6625366 789917469 024 # **************************************************************** H ORIZONTAL J UN O MP c one l max l ings s ad re uters Ġn grams Ġ1 12 un s (' | Ġ+ ' ex aggeration ri al Ġtest Train ind ucing pa rency Ġl max Ġlabel pad ĠB ra Ġ10 8 85 0 07 2 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ mod s 34 84 rel path Ġdec im Un recognized 39 32 Ġextract ing Ġcs d ĠDi rectory Bu ilding extract all Ġspeed up writ elines Trans ferFunction floor div ĠPerform ance 003 92 Ġcoll isions Ġ{% - PERI MENT Ġpears on ĠCONTRIBUT ORS D s D ur D got I ns N got S olution S uper S QR p seudo } }{ ĊĠĠĠ ĊĠĠĠ er ov st ics Ġn aming Ġc stride Ġm cd is real lab s get attribute Ġex tr arg parse Ġ` ' ĠD UMM Ġk g assert Rank ĠRe volution og gle ()) ] not ype Ġsub stant [" / 03 1 02 9 17 636 27 2 right arrow Ġtext variable ĠCon f ik its 23 32 23 92 view doc draw down ĠNe uro UL ES Ġdisplay ing circ um Mo ve Ca pture 3137 255 taint ies BL ANK 0588235 29630899 wor st Ġ'.. ', Ġdiscar ded 058823529630899 429 D x G ame t arg w aves se aborn Ġn ugget Ġc en )) /( ĠS peed ĠX i os c Ġme w min x Ġk n ĠM PI In ference Ġcomp osed 25 39 color maps "] * 16 84 Ġcur l Con verts 24 1 18 1 Name dTemporaryFile auto fig Ġhand bags product s Ġwor N ĠOb tain rus kal dar win Ġmechan ism REGRESS ORS ĠDUMM Y > { M Y U i a verages o led s ketch u ds å ķ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠ or arily Ġp lasma Ġs set ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġ" ../ Ġy name ve led ĠS lice =' $ pre fer Ġlo greg inter ior bin op 45 098039507865 box style Ġ8 1 cor relations 86 1 Ġsol n 97 67 Ġcode book fra ctions ĊĠĠ ĊĠĠĠ Ġinterpol ator Ġref ine 89 803922 Button s II RS ---+ ---+ Ġaccess or gal axy Ġti ps Ġ===== = ãģĦãģĦ ãģĦ erm ite Ġprun ed ĠSp atial Ġther mal Ġsca ffold ĠOrig inal inherit ance Coc lustering 17636 1084 45098039507865 906 89803922 176361084 " >\ F ro H f b ranches g host } }) re search Ġ= ', de w Ġb an Ġb iased ic la ĠP S ĠP OS ĠA pr ĠR NN pa int ir ation low est ĠB ASE ĠO ffset Ġtrain able vent ion 13 95 ',' ') off s Ġloc ate Ġfill na has hable factor ial 48 3 Ġrespon s 137 3 Qu adratic Ġhyper geometric Ġopt ical ĠWIT H ä» ĵ Ġph one Prob Dist ĠIter ations Ġ---------------- ----- ĠBo ol Ġaffect ed 0909 0909 Ġgam maln Ġelimin ation ony mous prote ins Upd ates cook ies restrict ed ĠMixed LM > [ B lack C hem D b G ray L edoit P mf P ART b rown h ort p inf } }, at an Ġw w ce p () ", ĠT ex ') ]: ist ate ĠA tom od b ĠC C Ġtr n ĠW rit sub j Ġhe ating Ġdist ortion ĠIn v ĠH OLD Ġlog pdf nan os ĠEx pr bar o Ġstart time 94 9 17 10 Ġsy naptic ')) )) Ġmask ing 87 01 CA M Ġpoly fit kw ard čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠSV G (** { Ġcommon ly ./ =\ SP AR ĠHe ight æĸ ¹ coun tries ĠRBF Sampler forecast s Ġgal axy dri ve Dif ference ¡ç ¥¨ ĠProceed ings $ , 5 07 E U Q Object e uler k aiser l k w ashington Ñ ģ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġi gnores un try Ġif f di al Ġr stride ĠS U Ġx o Ġx ys am bert ** . sc ans ph rase add Layout 05 00 35 36 19 19 04 9 ME D ĠSt reet Ġmon otonically Ġvar name Ġjust ify Ġrec ip OP EN We b 82 84 Ġpad y DO MA Ġmix in Ġparticular ly Ġserial ize 224 36 Ġskew ness Ġmarkeredge width SUMM ARY 4 117647 T fidf e cc e color f u Ġ orth ĊĠĠĠĠĠĠĠĠ Ċ Ġi ir Ġa mo Ġm ime co mplement ĠT ib Ġ+ ---------------- Ġg uesses get env ĠS upervised ĠX trans Ġu gly pre g iv ities comp ar In ner cs d model ing fa v Ġsub stitution 100 8 75 5127 Ġ{} : 95 29411792 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ Ġq da pop ulations {} _ conf lict Ġcombin ing Ġmesh grid Ġsent inel cret ize Ġ'{} ' Ġstock s ĠDense Layer 8823529481887817 4 ĠHTTP Error chocol ates 9529411792 755127 D at X i b mat in clusive st ft Ġa o Ġb x ss p def orm as ible ch ing Ġreturn Type Ġ* . get mask Ġcon cept od o path name ari an Ġtime steps ca ped Ġj itter Ġcl icks Co vars Ġ7 3 round ing gr u 90 83 create Variable extra doc star burst 49 1 MA E Ġsin us down cast sw iss band pass peak er 70 75 ĠDi agonal Ġconversion s ĠSto res ĠIter ation phot ography Ġtab ular lamb das ĠPost Script Ġtechni que Ġsimultaneous ly shuff led ĠassertRaises Regexp E urope L T N C g file h ann č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ se iz Ġfor mer est ment set state ĠP ick ĠF IL ĠF ilt Ġcol lapse ds k gre at vel s Ġ[' # ĠU T output Col Ġapp ending sq ft Ġover fitting 94 39 diff use Ġemp loy cos x apply map fort un sur vival ĠMo ve Ġblack man Uni que PARA ME dire ctions gets ize Ġchem ical anit ize 10196 078 shir ani ĠTib shirani # * F ocus N FFT T B V m d ups f ts i param i mplemented m ir q n r df r ated y pd } ]) à « Ð ½ ä ¾ ç łģ re servoir Ġt test Ġm idx Ġre create Ġb am fi li Ġst ay ]) }) Ġ* (( for ces Ġh ousing to ks (" __ (" _") Ġk dt Ġcomp ens 32 99 check sum 22 12 96 976 85 8887 37 4 Ġstate ments Ġpop ulate free ze database s LA ST Ġmem map Ġmicro seconds ĠAct ivation DP GMM pw m Ġbot tleneck Nd array ĠArt ist dayof year sth rough ĠPercent age DIS ABLED ã o N ON P acific R ender S uccess q grid  ¡ or atory Ġin set ge l Ġb last Ġ1 34 Ġ1 60 () [" Ġimport lib Ġh int Ġh oliday ĠA UTH ĠC D ĠD AT Ġv h art ment ĠG ROUP Ġma e Ġcomp act ide n 11 1415 Ġinput Col ĠIn clude 33 68 17 3 Ġdis plays 30 66 db pedia Ġacc ident SI B ++ ", Ġ12 1 drop level 47 9 SA MPLES Ġpop ular Ġli ms circ uit sto red Ġgp u Failed Warning ĠTemp orary å¤ § activ ations åĬ ¨ Import Error ĠLa placian Ġquick ly 3212585 449 5686 96976 Ġsit uations 9215686 3212585449 ĠNoth man Ġdri ft Ġsear ched ĠAlt hough Ġphe no Ġreproduc ibility 25492 858887 redirect s CATEGOR Y DECOMP OSITION 670588 25492858887 4117647 111415 10196078 568696976 4117647111415 863 8 01 A ns H i H ome S al Z erosPolesGain o e o le Ġc el Ġa max mat s mat lab ĠF latten Ġ% - mo dify te c Ġl map ĠB inomial ĠB royden ca iro read thedocs ĠIn f Ġnew er are to radi al be zier 85 490196 AL SE exp m Ġ... ') ĠJ accard return code CA Optimizer Ġextra s can onical Ġblock ing ĠPython EvalType quival ence Ġaltern ate åĪ ¸ ç» ĵ ĠGeo DataFrame 196 29 Ġrat ings scr atch ĠDrop out æŃ ¢ TMP DIR setCurrent Index ' * ) != 8 36 E lect R olling V ol Y G _ | ` ): d di g ou Ġt di al locate Ġp dist Ġd up ol di Ġas ked ma zon ), ), ĠT ukey Ġg ps con cs ĠI mplement ĠI tem ĠP en ĠP hase ĠA ng ĠR MSE out come ĠM N 10 394 ĠE ng iter al op ens Ġen codings Ġwh is input File ĠSe lection 88 10 Ġapp endix Ġbin size ',' -- gen otype 77 03 Ġsm f \\ ]: Ġstd in LO CAL Log Norm Ch unk tk canvas interpol ated pat t Des c Ġweek day 490196 0790157318 Ġrefer red worth iness 90196 0790157318 Ġfancy box Ġcompar able ĠGraphicsContext Base Ġanimal s 1057 3864 3033 899 åķ Ĩ 4901960790157318 1 901960790157318 12 10573864 3033899 B Y H B S Array c mb g umbel i ir j ax j itter x edges å ĮħåIJ« Ġa perture Ġin cr Ġm and Ġe vidence ', )) il ater ode int =' .') '] =_ ĠL atex ĠM ongo Ġpre fs Ġcomp s ĠO ur amp s ay er 95 29 uc er 06 2 LE VEL rel ig De mo Ġboo leans 98 3 Ġ'. ') ------------ + Ġbbox es common Type ================================================ = separ ation autos ummary Ġdele g uit ively 2222 2 cool ing Ġrd int $ " % ) 6 94 H y J acobian X P r lf é » č ĊĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ åı¯ Ġc rs Ġre cogn Ġ# % ic ons Ġy E end rik im ization ĠF raction ĠR educe Ġal n ĠG illes Ġj acobian 20 48 ĠSe par "] ]) ĠEx pression 35 38 trans cripts Ġdis persion uc i Ġ... ") stamp s ĠDe launay Model Results Ġfont properties Ġsi mplex ĠOR DER black list wave lengths bed o GC ATG dv istate Ġsatis fies 757 67 Ġincorrect ly ĠTri angulation 803921580314636 23 FIFF V Ġtrig gers Ġcurs ors ĠHOLD ERS ] '), } > >> ath y Ġl vl Ġby month Re LU 11 69 __( ** ific ial Ġind uced grid On 19 1 95 0 cre dentials SE D exp val Ġdoc cer Ġreg ime Ġ9 1 TI AL Di Graph UN C Out lier 89 01960 ĠPy Installer ky o Ġlearn s pg m Ġph rase çĶ µ expression s amb ridge glyph s åĬ ł ĠAct ual Ġche b HDF Store Ġau xiliary ĠWRITE ME 82745 09906 7687 988 462745 10025978088 84976 19629 8901960 8497619629 8274509906 7687988 3 809 D en N V W P ] +' l arger v tk Ġ arima an imal Ġc ame Ġp sy Ġs av Ġin fl Ġm h Ġm z Ġ1 18 is digit ĠT imer tr ight Ġr ub Ġx gb mo ver df n Ġpre defined ĠB U ib atches add le men ter ĠH i grid lines iss ubclass check Box Con centration SI M RO WS ĠWe ek Ġbad ly plan ar Ġappear ance Ġ================================================================= ============ 4545 4545 è¯ ģ é¢ ij Cho ose snp s ĠIdent ity ĠARD Regression ryst al ĠEST IM BLANK LINE C ID F inds G M H BoxLayout g ibbs m df n I s plot x tol Ġe cg Ġb al ol mo nt p par cel ĠS lider Ġco herence fe red ĠC I ir fft ag on ĠB IC Ġun ser Ġle ts Ġrandom ize Ġfe el so ur Ġclf s group By 85 1 24 3 ================================ = datetime tz Ġac cessing Ġpredict s De precated ĠPro pagation Ch arge Ġ$ { OP T request ed ĠRidge Classifier Orig in 494 11764740 LabeledTensor Like ouse l Ġcycl ic ĠStream ing ĠVert ex QDialog ButtonBox MBEDD ING 9439 09 49411764740 943909 ( .* C ENT E H S ched d min è Ģ in de in force re start Ġi tr ro ma Ġe mb Ġe mitted Ġre indexed ur d Ġr l (' ~ int c Ġ""" , ĠP RE ĠA ut ĠM atern assert Device Ġen hance loc atable 19 68 cur rency :: ', Pro tein 34 0 CA G 44 97 DE M Ġmath text Ġmain ly dr v PO CH description s ĠMat lab abc de ĠTrans ition Ġans wers hex bin Ġ===== == ĠPart ial å® ļ Ġredirect s ĠOP inv fla vor fis ca occur rence Dest roy assertDevice Equal ( ` A VA B ed S un S rc f ontext k v t ws x o x v z mq Ñ Ģ Ġ čĊ re partition de scriptors Ġn ls Ġs lc Ġ' )[ Ġe ver is c ot a (' =' ĠS ampling fe v ne al out path ĠE RR Ġat las Ġbo ols ep hem bin ning ĠH olonomic start up ĠEx ponential 22 79 Co x 95 1 Ġsp ent scal ars 65 2 87 4 search index initial ization mar ily Ġput s ĠRandomized Lasso ĠFloat ing Rep r UST ER chis q ĠUP LO ilit ary A mp D ark a perture Ġc ities Ġ' @ Ġre cs ss on un wrap ad or Ġst y ĠA nt fe e os h mo od ĠG R ag ged jo urnal ================ ========== ================ ===== fo od pi ro Ġtrain s dd b ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 85 88235 36 862745 mod name Pro viders acc urate du led Ġab ort 60 84 FI FO Ġ'. '. Res olution Ġext re rm ul Graph Keys ula e ĠSim ulate ĠRO OT BO X ĠMask edArray Ġactiv ations Ġasy mptot åŃ Ĺ ĠRequi red Numer ic xxxxxxxx xxxxxxxx èĤ ¡ç¥¨ uncer tainty ä¿¡ æģ¯ ' \\ 6 196078 B acteria M AR R IX S ens X sp n max n axes o int r find s outh u ic y k z arr al y Ġc arry Ġp join Ġp alettes Ġs min ic ular ig t ig ration Ġ( # ss l Ġg rain ĠS cha =' *', ĠX w fe ather to kyo ĠF lip ĠR M np df ĠN ND Ġpro vider red list Ġun equal 80 80 "] }) Ġcor ruption 03 07 ================================ === ass oci Ġunder stood Ġ201 9 fft len Ġbreak ing Ġdetermin ation adjust ments ä¸ » post s Ġmp i Sparse RandomProjection ĠJo el čĊĠĠĠĠ č tw enty ĠEX CH ĠAnd erson (""" \ 806 27 clust erer phe no Analy zer Ġcle ars sli de 658 10394 whe el olive tti 6196078 65810394 ĠNND SVD 619607865810394 29 A H J S P hy V O Y our ] ')) c rammer c ifar n as pe p Ġm lines Ġ( {' un link el n ma cosx ult ra Ġ2 0000 Ġg id Ġg olden Ġex haust =' { Ġx e Ġx size con cept ĠC artesian ĠF WHM file obj Ġpre set ĠE ven In strument 12 37 ĠO vR ĠY AML 15 41 tra ctor ĠV BGMM mon ocrit main Window lower case Ġtri ang gin es 68 33 su med LO C sor n ann ed Ġdomain s volume s Ġfree ze host name ĠKernel Centerer environ ments ={} '. regular ized Ġ|| _ hal os Ġappro aches Pol ar Red s 274 64 æĹ¥ æľŁ hid dens Ġprom ote ĠUt ility nony ms Identity Transform Ġcru ise Facet Grid ë l 2 977 7 098039 9 450980 E Y S pacing S ql ] != h w m cell } ): ĠĠ ĉ ĠĠĠ ĊĠĠĠĠĠĠĠ re run re cv re commen Ġt uning Ġi ce Ġn ic Ġp ub Ġd ummies Ġm iller Ġe i ic he Ġw al est s set Minimum ver batim ĠS u ans wers Ġlo lo Ġk in form s mo b ĠB rier Ġlist ing Ġcomp iler ĠO ct ep ub 88 9 Ġro ck uff icient 94 328 temp file Ġsol ves eps g Ġacc um ĠDe bug Ġcho lesky aut ogen ĠMin CovDet Ġadjust ments Ġloop ing ĠApp lication ĠApp roved ni h counter s ABC DEF Sc ene Ġillust ration Ġjoint ype è® ¡ç require ment ĠGa ël 388 6566 397 9 Ġbra ckets 424 880 ìĿ ´ ìĿ ĺ Analy ze Cy cle Ġdas hed Ġri pple ĠVisual ize ----------------- + Ġprece dence ĠUndefined MetricWarning Manage IQ ĠEXIST S 85490196 94328 8810 80627 36862745 881080627 7098039 3886566 9450980 424880 8549019694328 3081 70980393886566 162 9450980424880 9814 # [ A IR B D B OO G LM N X P lain W I g v de ad co a co alesce Ġto uch Ġr w (' :') pt em ĠS anity col lector ĠI R fe male Ġv w ĠN a ĠN orth =" -- low s ĠO SI ĠH endrik 15 03 Ġpy learn pr ng Ġcolor Converter uni prot Ġrow var '' ') 07 05 Ex pect Ar ch 26 3 Ġtri ple Process or Ġprod ucing hyper parameters ĠVector izer Spark Session Interpol ators Ġfour th Ġminim ization rg x ------------- + ĠMet zen Ġsuc ceed seng er " ^ 4 1568627 E ar F oo H ost M RI W ORD c numpy j oly j hm l ices s now v link ar ters Ġa part Ġ( + ot u ts ize th res Ġr y Ġ2 54 Ġst ellar ex pert name list Ġh f Ġde tections we e Ġfile list Ġle aving ĠO M sum mer cc ds ################################ ##### own ers 95 3529 IT UDE Ġright most ĠSt udent Ġmark up Out Of hi ps Get Value long name click s Ġindividual s }. ". Ġmut ated Ġknow ledge ĠEX AMPLES Ġflip ped So up Ġprun ing 226 99 TAG GCATG Ġbas ket Ġreconstruct ed è´ § Cp Hf Cp Lf intr ons arcs in SUP PORT Ġbuff ers accumul ate 7712 7075 bck nd rient ation 7686 27464 autiful Soup 41568627 953529 768627464 77127075 41568627953529 358 # { B ody B etween Q C c j g f n iter n ifti u ce x be in visible Ġa ud Ġd omin Ġm asses Ġre moval Ġb is th ink ha re iz li Ġ""" . lin d ĠS IGN Ġor ange Ġde velopers ĠD ask ne uro ps y Ġfile type ": [ ĠW ed Ġshape d ca ffe 32 15686 Ġ10 7 Ġ(' ', pos ix Ġsub sampling ĠSe ed AR EA 94 65 rt d dis covery Ex c Ġ[[ [ ĠDe composition mer idians Ġhand lers Ġca pt TR ANS ster iors CT AC User Defined ML P gate way ĠAdd itionally TH ALF shuffle Layer Ġfeed back geo json MC MC ĠFa il Ġexplo de fir win paper type ĠMay be Vert ical Tag s ĠWeight ed Ġburn man Determin e 设 ç½® ĠDim shuffleLayer ( ',' ) '), 2 000000 8 6666667 D ST P xx X csr h ists p ump t ro y et y gene Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ lo ops Ġd rag Ġ' :' Ġw i Ġ1 15 is ite ult s Ġ2 10 ĠS outh Ġx v ĠG TK Ġun compressed ign ed che ss Ġcan cel 20 64 33 99 80 49 45 88235318660736 78 15 95 3 09 75 Ġdoc utils .""" ) url retrieve vol ved 68 91 Ġcsv file ĠDate Time post gres Ġent ered Output Col DB SCAN foot age RES P MOD ULE ä½ ¿ eig vals ĠTk inter 265 3809 prot ected 378 2653809 ĠHel p Exec utor publ ish ĠSimp lified nearby Lines solation Forest FRA ME 8588235 3782653809 è®¡ç ®Ĺ 4588235318660736 1 5 00000 8 27 B LOCK S hould W hat f k s ps v ac w ilcoxon ë Ĭ Ġ ortho at ched re lax Ġp itch ra it Ġb orrow is hes 00 39 ĠS G ĠS AG ul der con ns Ġde generate ne to Ġcol name out lines max y Re search sing er pr une code c ]] [' ĠK et nan ops 96 926 trans mission 17 62 db l 44 3 26 25 gg able 67 04 Ġrec functions 3333 3 Ġconnect ing nr b Ġwave lengths Ġrect ify Sub ject yy yy åĪ © Ġ"- ", ]} ), Method Error Down loading Ġrepla ces loy ment GTK Agg Ġinherit ance ĠConcat enate ĠTyp ically clas sed éĽ Ĩ NUMB ER S py T UT ] () ] ``, d ont l ights n lp r sp z A å ij at en re serve Ġt et al ready Ġf y Ġp st ol ist ], " ), \ Ġbe er ĠC y Ġpre pended Ġdf n Ġ4 000 ================ ======== fo il target fig 86 275 rc v Ġany more ... \ Ġac f Str ings Ġtri ps OT U ĠUn its stop words SC AR support s ĠRead ing optim izers partition ing Ġintegr als ĠRes ponse Matrix Data Length s Ġentire ly Ġelect ric Ġbg color Exp anding GradientBoosting Classifier Ġbind ing Ġatt ention HIGH EST ptem ber $ _{ A CA R FE W B h lines ĠĠ Ċ in stanti ar ded le ak he ta as cent tr iple res olved ĠS quare Ġco er ĠC ambridge Ġme c sc enarios ĠE igen 99 15 Ġcomp uter ĠO ff Ġ.. / 05 74 Ġlog g 33 164 predict ors Co eff Con volution Con venience testing Profile 97 803 50 87 Ġtra pez Ġab undance strip ped Ġerr no const rain ĠIN FO comb ination Min or Ġhyper geom By tes cb io geom s SN P Ġcirc uit ĠMark ov ocor r cros stab Wave length Ġ+---+ -----+ Ġdecrease s ĠFigureManager Base æī Ģ assertNot Equal OFF SET dico Total Decode Error Ġavo ided icla se 3368 45 6 19 = __ R p b olds ç Į ì Ĺ Ġ âĢ an th an other he rent Ġp H Ġd amp ur ses Ġ1 38 Ġ1 93 ad c Ġ2 02 ax vspan ĠS at qual ifiers am ine ĠRe cognition ================ =============== 99 63 so unds 15 69 05 27 bar code Ġvari ational ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġinit ially 36 89 ĠQ DA Ġtemp dir Ġuni verse multi plic 77 25490 bl ur 47 450980544090271 real time Ġstop words 69 80392 PL US cons umption Bu cket oci ety ĠEn gemann NO WN fake Profile ĠDoc uments ĠKe ys logs umexp Ġsit uation Ġqi ime augment ed Ġmys ql ĠDen is ĠTho se FIFO Queue 33164 97803 336845 3979 bolds ymbol 7725490 3316497803 6980392 3368453979 5 83 7 490196 A lter B ottom M ic [ , b db g au o ssible q p ¢ ŀ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ= ============== de partment mp g Ġo d Ġm fc co herence Ġ( < un ce Ġ" .. ĠT rees ') " (' @ int ensities Ġg host ĠN i ĠL ambda =" / ĠO range Ġso il Ġz p Ġ(' __ no stics lat t Ġstart Time Ġscore rs Ġdis connect Test DataFrame 34 198 Ġtra vel alle le Comp at >` _. äº Ĩ New Id Work ing tax onomy Power Curve CEP TION Scalar Formatter LIN K 333333 34 Ġbas ically ĠArgument Parser Ġsear ches ĠRepe at setWindow Title assertArray Equal 0 85 3 8039216 6 99 : > C lock E psilon g jr s uc x size Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ lay in ja me tr Ġs am Ġs cov Ġb se ed its ch l (' " ab ling ĠP ATH ub ble comp uting key points Ġper p 80 37 16 32 St ars (- . 34 1 34 3 sent iment ĠQ ueue Ġuni q Di rection AD ATA Ġ'- ') CC ESS Train er Ġbad value 00000000 0000 sto ch Ġneigh bours Ġmut able WAR N Ag ent Ġstand alone ĠMock ImprovingEstimator Struct Type 317 64706 TT TT gam maln liptic Envelope ĠZero DivisionError ĠDatetime TZDtype buff ers ĠFrank lin 96926 1169 31764706 969261169 ) '. G m U X ] | g olden h ypot k df m dot n ex č Ċĉĉĉĉ Ġ âĶ in ject Ġa dtype Ġd ynamics la mp co f Ġ1 26 ol ib di versity () ]: ĠT EMP Ġ2 40 ver sicolor pt ide Ġg stop ", ), ĠL U max es Ġpro portions learn er =" . ft p 11 37 Ġz max 16 58 )] ]) 96 0 ĠNot An ',' - 17 9 ĠCo uld Ġexp val man ifest Ġdoc dict 26 2745 Ġab sent Ġcount ed Res ample precision s ĠLog ger Ġhyper bolic CG GT Ġsent iment Ġmagnitude s Ġstation ary Ġbr ing Ġattemp ted att ention )^ - ĠMultiTask Lasso ĠMetric s Ġdow ns čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ ĠNotAn Array 1 450980 6 77 7 88235 7 294117 D Z E ng F isher R H U f b log c ars s it s aving w ts ç ķ en dent Ġre run Ġb isect Ġg amln ĠP D ĠC RE ĠF E ĠR ound ĠL u mo ons ĠM u Ġan imate Ġlabel led ĠE T 99 110 Ġcheck points inter ro Ġinter ior 33 52 03 14 dis position spec fit non lin Ġcontin uum AB S vol atility Mix ed 46 1395 Le ibler App liance RA DI 52 45 Cal c analy tic tile s Ġclear ly ĠNA ME ĠSpectral Embedding Ġrepeated ly Perform ing 454 6833 399 1928 808 34198 Ġmultiplic ity gh t 384 3137 238 2392 Ġextreme ly 0984 7164 è¾ ĵ 50588 2382392 42745 09847164 SPAR SE fortun ately 86666667 461395 38039216 3991928 1450980 4546833 7294117 80834198 505882382392 8833 4274509847164 1541 86666667461395 264 380392163991928 1 14509804546833 038 ) ]] 9 25490 B W K m S kipping U Z W elch h M n largest v comp ç ī ar q Ġp th Ġ# } ot er Ġr sp data points ke ley Ġfi re ne e Ġse per art icles Ġpro duction Ġan ti assert Items ca pac not ch 86 318 ME M Ġtext ure Ġq s 44 019 ob lique sha de CT T Or thogonal rep ly ĠRes idual +" / BU FFER condition er Ġny stroem Ġer f Ġbic lustering ĠMach ines Perform s success ful ah alanobis Ġenter ing 450 85 057 44 ĠDiv ide åĨ ħ heli x assertItems Equal 8 2352942228317 D W E q H DU M IS N H m nt p od r min x form } ``. Ġ í Ġ ĊĠĠĠĠĠĠĠĠĠ Ġt weak Ġc tr Ġc ros it r Ġ0 2110 is lice is complex ĠT REE th ar data Emissionlines ĠS uch Ġ_ ) to gether ([ ])) ind ice app le Ġlist dir da mp sub samples Ġwh it 11 48 Ġ[' - pr ints ĠK NeighborsMixin trans itions sort ing 86 86 06 14 dis o 97 6470589637756 return Type ac quire ... ', Ġzip ped ĠSt udio 43 78 nc g Check er 74 98 wave let Ġport s geo mpy ĠLine String 2005 1956 Ġke eps InteractiveShell App 856 3538 Ġidentify ing Br ush 323 8563538 ĠFactor Analysis Multiple Locator TRIB UTE ĠLay out Peak s ç§ ° æ¯ ı Ġparagraph s CLOSE POLY 737 2549 ĠComple te Separ ator ç¬ ¬ ASC II relig ion 188235 2977 99110 41 3843137 3238563538 925490 20051956 82352942228317 261 976470589637756 35 1882352977 9911041 92549020051956 177 E lastic N Y O III P F W iz X B c gs k ers l np q tr è ½ re defined Ġre covered )) [:, Ġg pass name dtuple =' :', Ġx m ĠM artin Ġl xml Ġint u ide al ren ess 05 1 start prob 22 9614 Ġmo ves Ġ{} . dis persion pack s tol il ĠZ eros prec ise over rides cos mo Al gorithms optim ized Ġapprox imates åı ij Spec ial fl ickr Ġpost script TO K Des cent regular izer Ġ? , ######################################################################## ## dig raph clust ered Pop ulation Ġcool ing ĠtestPandas InputFn aga inst ortick labels * ). - { 0 22 6 94117 S tage V IIRS d bs d vi d lti n in re ach al ic an to Ġa est Ġp in id a ch id Ġr max Ġex cess ĠS ans Ġco vered to oth (" & ext reme Ġan omal Ġ`` | Ġso on 11 66 ĠIn dividual Ġper mitted 20 37 ES C load mat Ġup stream be red 86 9 Ġsum marize 55 6 67 45098 39 22 Ġbreak points sm iles pick radius Ġpop mat Tensor Flow Sub set 180 7 CS R "> < 2549 01 Cl ark Ġtopo map syn th Ġmicro second Ġhy pers Project edGradientNMF loy d ĠWh ite Ġminim izing ĠLab eled ^^^^^^^^ ^^^^^^^^ 产 åĵģ 380 86318 201301 02 CHAN NEL CHO ICES 6652 9083 2332 229614 3215686 38086318 694117 66529083 6745098 2332229614 321568638086318 97 69411766529083 252 2 117647 5 22 n ar w ich Ġ ############################################################################# le nt Ġc max co p Ġre compute Ġb q Ġto ward tr ito Ġ+ -------+ =' | ĠX T ĠP ursuit ust us 01 17 Ġk mer per ceptron Ġ{ - ĠM or Ġl v ================ ============= Ġcal ib ĠV i Ġdatetime like CA P 56 05 Group Box ĠCON FIG Cor pus flip ped çĶ Ł Ġperiodic ity Ġmanual s 3636 3636 RandomForest Regressor (", ") 3267 4408 getOr Create ĠEar th Ġgens im DOMA INS 33333334 32674408 A ut G ate M ay ` ; n var t utorials u ated Ġ ]), Ġt ube ra ck Ġb ib Ġ# --- un balanced Ġdef icient (' + ĠS TR Ġcol cov min pos Ġl h ĠG re ĊĠĠĠĠĠ ĊĠĠĠ train able Ġ-------- ---- 99 85 sub header ĠPar ams text Backend ĠU til ER O Ġrow cov ĠSe lector AT TRIBUTE 19 88 rect angular 03 13725 trans posed 95 2 ================================ ======== sy ms 36 9 Ġemp has 40 806 46 2 ĠAN OVA Ġreport er bbox es Ġround trip ^{ \ 88235 40806 Ġir fft Bo xes 105 8823540806 Ġplan ning Ġair mass 666666 67 Ġhighlight ing Go ogle 285034 1797 Ma jor Ġbla ze Ġdiss im 6862745 2850341797 代 çłģ seiz ure 1058823540806 7703 + _ : # E nsure b rc e z f robenius h armonic w atch x date ĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Ġc umul Ġd og ut down val sh di com Ġst ick int el ex er py gments ĠP l Ġcon firm shape d ĠG EE Ġout s ĠB ag Ġj inja IN TEGER ĠK alman ak er the tas cre en Pro to Ġsupport ing Ġwork flow IC CSD Ġvalid ity non spec De le mult iline tmp Path ry ption Ch rom Ġdiff use Ġintegr ator Ġconst rain contain ing .* ') network s tw ot news group ĠCont inuous 219 2 CF Node Ac cept å¸ Ĥ Ġtreat ment adapt ive 414 21 ĠExec ute AdaBoost Classifier bri ef 2734 38 C r D Y P ASS W n d idx d ml i ated t ardis Ġt is Ġs ink ra ud ro duction la xes Ġre factor Ġw ishart ], ( ad dexp =' > arg where ĠP Poly ds cale ĠRe construction Ġmin x ng a Ġsh allow tra v '), (- 16 1255 96 77 85 02 Ġcont amination Ġdis covery err y Se lf 37 32 stri ded ĠWe b ob server open ing tmp data 63 9215 Ġsw it 0196 1684 EX PERIMENT clean ed Ġmag ics ĠSy stems ĠSy ntaxError ny q Ġrequire ment OB JECT ĠPoly Collection mpt Manager crop ped Sc roll ĠDATA SETS Ġintro duce send ers Dep enden tre me PH A 789 3066 349 01961684 pf b oa uth SPE CTR 7077 7893066 2280 273438 7490196 2280273438 639215 70777893066 34901961684 22699 H Y M U M inv U rl c names f MB k b n umpoints ë ¥ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġc box Ġf resh Ġp values Ġs col en ed ro se ro ach Ġd h co uple Ġ1 35 ss d di ver Ġto log tr m mat thews =' ./ ĠF isher Ġlo cat cal ibr Ġv id po ss assert DataArray Ġwe ird ib e log ic Ġpd o Ġlog x io logical 19 3 ])) ] Co efficients abs orption dis placement 97 3 Ġloc i Se conds gg led 38 3 Get ting Ġsa w vers ible Ġobtain ing pri mitive ĠFit ting Ġsimp lified dow ns 354 06 666666 8 å¹ ³ Ġexplo re calcul ation Vert ices ĠRadius NeighborsMixin Ut ility ĠHyper Spy NotFound Error ilver man wild card kwdoc d 使 çĶ¨ B allTree F t G PU N atural S pacer b aby c ards f riends g row g ie i u z lib ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġt tk ar rows le verage Ġn lags Ġs lim lo ut Ġw orth un biased Ġas semble ve lt Ġst n ĠS al Ġv p Ġk sp ĠL L ĠM M Ġl po Ġl lc ant i fo y Ġpo ur Ġclf d Ġ) ; gra v ĠH oliday Ġcor relate Ġkey point 18 29 ik ov DE V 08 161 sql alchemy pert urb ish ings SC S initial s No Value lev ene Ġaut ore Ġround off Ġbad s air mass Ġdownload ing Ġear th Ġmd l Ġpk l bot tleneck Ġ'" \\ ĠVAL ID Ġdro pping $$$$$$$$ $$$$$$$$ seis mic resol vers ĠMN IST 1762 161255 7372549 1762161255 2117647 08161 211764708161 35406 " ``, 8 13 8 117647 M CD P ET d ice j avascript m cc n bin s lack  µ å ¢ŀ in set Ġt num Ġ' ../../ Ġm df Ġe vecs lt sa () ') ), (' (' ^ par m Ġex pec [' % ĠP ET ow itz ĠA RE pre train Ġ` { ĠR out Ġ3 20 Ġv olt per iclase ment ion ĠE q sh runk Ġpd t Ġper haps Ġlog likelihood Ġinter cepts pr f 75 33 94 90196 17 175 alpha bet 07 6 mod f ')) ] Ġcode d fill ing 26 89 ([' % uch y 47 1 ii i SC SC Ġexec utor Or Replace Object ive ('- ') ĠTrans cript Ġpool ing Ġunpack ed Ġsec ID ĠProb abilistic ĠOS X uli a Ġ#---------------------------------------------------------------- ------ capital ize ĠPr ice Comple ter FEAT URES frm Time SCSC CSD + [ A UT S lot k urtosis Ġ čĊĠĠĠĠĠĠĠĠĠĠĠ he ld Ġc ss Ġp il Ġm ir Ġ1 32 is on um or Ġg rib label ing ĠS ociety ĠD avid Ġse a ĠE ngine train s 12 75 pen al ĠData Set sq euclidean count ies Ġvari ations dis criminant 98 319 Comp osite ĠUn ited For ce For ward En tries Text Ctrl 74 64 ĠDE PRECATED Bo ard IB i (% ) Ġfoot wear Ke ep hr xn ĠMet adata DateTime Field Te am Ġinher its SHA PE * [ 9 16 B N B ivariateSpline C he G ets W O h olds n value p nt å Ł st emp Ġn axes Ġf cluster Ġb all Ġ1 200 Ġx out ĠX train Ġ4 04 ĠB is In sert ide nce sub dir Ġper manent Ġsc enarios act s 15 53 75 806 "] / '. ") 13 75 by la be is lat lon of s Ġsp urious 09 3 Ġadd r ĠJ upyter pack ed ĠCon vergence RO L ĊĠĠĠĠĠĠ ĊĠĠĠ Ġfull name 39 807 Ġsha ding SA ME conf int sw c Ġproject ors Ġthrough put 199 3 COL OUR Ġinf init åħ ³ WH ERE Ġtermin ate Ġcast ed Ġ---------------------------------------------------------------- ---- Float Type Bo ok Ġplan es Ġamplitude s è® ¤ Ops Mixin Integr ation Ġland mark dependen cy ModelFn Ops Ġfurn ishings 0 86 5 4901963472366 H alf S ITE T eX V otingClassifier b les c max e ec Ġ ĉĉ se ar at al Ġi zip ion es Ġre lies Ġb star un equal as bytes Ġx M Ġnot na ĠP ER ĠR ich per ts max plot pa w Ġfrom buffer Ġstr on ĠRe uters sh arpe Ġun comment 99 39 Ġwh om Ġpd r ĠY ields Ġnew data Ġj d ell ites 04 17 Ġnormal ised 37 94 ls m Ġfind font open ml Ġunit ary Ġdiv iding 57 25490 89 01 Ġgre y record ing high pass ĠSo ft Ġequ iv 285 495 ny stroem Est imates members hip Imp uter 906 98 ifft n Ġsli ding General ized Ġinteract ively TRIBUT ES Zip File 3067 39807 extre ma Ġeff ort 815686 285495 788235 306739807 45085 90698 54901963472366 333 5725490 4508590698 815686285495 75806 788235306739807 13 + =[ 7 68 A merican C am N orth V oltage v q x pos st k he ter ct l Ġthe tas la unch ot ion ter worth Ġr df lin ed ĠS can Ġco up Ġx lrd arg le Ġval ued ĠD T Ġk ser max x comp arisons ph p Ġclass ical Ġinter net rib ed av oid Ġro om 14 397 Ġgener ative check box be cause 17 2 Ġpoint ing pop ulate termin ation Ġabs path 43 84 Ġge ometries ilt on ĠImport ant fr q Normal izer Ġdat atypes flatten ed Ġmid night =[] ; Cont in ĠEn try TO OL MAT PLOTLIB ĠError s cover ages assertIn Range dash dot cade mic ĠMy SQL cen tric Ac cessor ĠTri m Ġstrat ify Vert ex Calcul ates çİ ° 66666668653488 159 æĢ » Ġosc ill ĠPriority Ndarray ĠESTIM ATORS 7 45 H int R AD e th l x v ss | , re weighted al o ar a Ġi beis Ġn ids Ġn uclide Ġc ash en umer Ġ1 19 as ion 00 784313 ck pt ex ercise label distance Ġor i pre defined ise n ĠR EST Ġres ids line ars ns ures Ġal location ĠG ene us hare 12 000 Ġget item Ġnew shape ĠH H input Col Ġoutput File ĠK ullback 16 07843 19 714 Ġpath name gs ave 85 37 sk image 37 1254 77 187 42 95 Ġform ation Ġmpl d Transform s Graph Wiz ĠPy Spark XX XX QU ERY Def inition Ġbug s 112 1807 ĠRandomized LogisticRegression Ġreject ed Ġaffect s 975 3932 ãģĤãģĤ ãģĤ 494 8502 Ġneighborhood s CTCT CTAC dayof week vander plas LeaveOne Out FRE Q ĠSPE CI treat ment Ġrepet ition Conver ters RESP ON 5087 4948502 262745 1121807 254901 9753932 0313725 50874948502 00784313 77187 2627451121807 0984 2549019753932 9529 0078431377187 371254 % ' & ( E POCH Y k ] `, b rand h ql p ters Ġ ess on a Ġn rb Ġc double Ġre member Ġw edge ol ded Ġ2 70 ') ]), Ġg bm ke ts ĠS LC Ġh older os p (" * ĠF unc Ġres ized Ġv or ĠThe ta iter bi log M gor ov 32 905 Ġ. * IN TS AT IVE ĠK riging 78 3 07 259 dis patched non specific gr an 30 25 Ġac counts 44 93 si mplices ĠTime s En coding rol led Tree Builder ĠRead s ĠLe af 83 118 93 85 Ġdot ted engine ering SP M Ġfh index 133 5 ĠST ART commit tee Ġtk inter âĢ Ŀ =", ", ĠGe ometry Abs olute Ġrecur sion explo rer ĠRaise d ĠCha in о Ð Ġmodifi es Ġsumm ation uncor related olmo gorov ( "" ( ..., 2 6666668 3 098039 7 137255 7 450980544090271 C OR I LED M ASS M aterial V iz _ "): n avigation in divi re actions on ormal Ġi g ut y Ġm tx ur ier un constrained ray leigh ĠT x ch allenge data s ", ' Ġk p ĠN p index able ĠM S Ġne ighb ĠE MP rid ay Ġline below ĠPar ser text ure lic ity ĠH a input hook 45 56 36 078 ensor ing ST A lob ber 87 7 55 686 ome ters make String rs lt rs quared ish old Ġexec uting tool box Net CDF Ġpi lot Dis able Ġfun neled ffic iency Ġdual tree begin ning PR ICE Ġformu las Stat istic Ġstrip ped Stream ing Ġweek s ĠTemp late Tok ens First TreeBuilder ĠPY THON 205 078 xk cd Drop box Ent ity Devi ance ĠSym Py 019607843 83118 Ġdistingu ish 1710 205078 05744 1711 8117647 1710205078 32905 19714 07259 3689 26666668 057441711 3098039 3290519714 7137255 072593689 01960784383118 1526 " / A re C AS E VAL T c b enef g ro j ul m idx w vl y train } * ar ad le a Ġa ve Ġa inv Ġs and Ġs us en na ut m Ġ' '), )) ``. () ( pt m Ġg pc Ġx descent Ġ` . ĠF ri Ġcol specs pro vider ors ion Ġpro grams ys lice Ġl uminance sc at ag o ca uchy sub population 78 79 13 86 Ġdis criminator rc params Ġ... ], Ġpart y sk in ... ], math cal stack er ĠZ hu Ġpoly int 77 88 Ġcho icelist IL L String Var Dist al regist ered indic ators reindex ed coordin ation ================================================ ============ SH ORT ĠOutput s serial ization Initial izes bayes ian Ġtax on tre asury LINE AR ĠPLS Regression Ġcapture d Pass iveAggressive FORMAT S interpre tation supp ly Ph ys lef to markeredge color CLASS ES ĠSer ver Ġessent ially Ġ\\\ \ 1088 18 Ġpdo ctest 0 200 4 75 7 60784 K M T m W M d ct f val u ing æ łĩ ì ļ Ġ Err Ġn av Ġf ich Ġp u Ġm ist co hen Ġre write ', ', ser ie Ġ2 20 par info lin thresh Ġh ypot ĠA CTION ĠC irc ds m Ġan no ber ra date tools 12 1568627655506 66 2 ĠSe veral 35 27 count ed trans Figure mon de off line Ġsp ans 09 1 ten v Ġinitial izations ĠSt ation Ġdraw down 67 3 ĠPro file cha ble Ġ25 00 Ġpri marily Sy nc ĠFile name Ġradi ation "> ĠB efore append ices 64 2 64 3137 32 798 cc d cy l ĠY k itle ts uni verse ĠV t Ġdis card work day dis cretize Pro be 97 125 ik a acc um 90 96 full name average d cel n fast q EX CEPTION Qu ant 99999999 99 land s Ġtax onomy è® ¡ vio let 367 19 为 æĹ¥ Ġthumb nail Ġreplic ate Dif ferent æĪIJ 交 ĠUt ils maint ain ĠNIP ALS ) ? ) ': 4 66666668653488 5 450980 7 333333 D p E COMM H inge I SA T UR e ve h omo r ice x ys st icky Ġp seud Ġd ust ort ical Ġfor get fi len ex cess ri ses Ġx grid Ġnot null Ġcol location Ġv tk ĠL ev fit pack fig name Ġlabel angle ĠE commerce Ġtime set ĠW t Ġso up ĠH ERE Ġ[' ', 20 36 14 06 03 17 Ex ponential Ġ... " Ġtext ables 87 16 87 45098 44 3137 store r fra gments ãģ ® 49 2279 CH AR Ġge ographic ĠNe ither Ġvar names IL ABLE decision s ĠCol ors Ġprev ents 69 01960 lev ance edu ction mut ated bet as AND ARD ĠCON ST ĠSparse DataFrame Ġanaly tical hen olist Ġinsert ion Cont inuous ĠFigureCanvas QTAgg Ġtex manager ĠSVM s stand ardi Ġrelease d Contain s 968 97125 ĠTI ME ĠNetwork X pydev d 0574 04 583 057404 11401 36719 16862745 583057404 466666668653488 16 7333333 492279 ECOMM ER 8745098 1140136719 6901960 96897125 7333333492279 0527 690196096897125 24 ) "), 3 105 B Q f ct k alman w inter Ġt RNA al igns an es Ġp or Ġp mag en ough Ġd urations pe ts Ġ( )) ', " () " Ġr idx Ġ+ - ĠS cript Ġco inc Ġx tick ĠR adi Ġ3 14 Ġme et line props [: ]) ir nov iv o Ġnum rows Ġpre cs Ġoption flags error bars sub problem read out Ġsc ans Ġpy mc Ġtype Converter ĠK elvin 19 80 Ġsy mp 24 96 Type Converters ================================ ======= ================================ ====== qua reness 77 4 {} - Ġcontin ues stop b ĠPro cesses stru ve IL Y ock et Ġ", ". parameter ized cha ined 2745 098 ven ance ĠNo el Ġ'+ ', ba h ĠFit FailedWarning SL C Ġprogress bar Mod al ,:, :, Ġclick ed Ġintro spe bur g So ftware fault s ĠDa we ELE MENTS SCSM ICCSD dial ect Ġllc rnr Ġintrospe ction 7 8039216 D X H am I AL N fn N fp T X b en f isher n mt s heets v dot v oxel x gboost y al Ã Ń æ Ł Ġ !! ĺ å® Ŀ åıĬ Ġt ends Ġc dist Ġf u it ud )) ( 00 41 () ]. ax ial Ġx ray ĠX inv ĠP SF Ġcon form ĠC ut ĠF ancy ĠD ag ĠD CASE Ġv ote Ġk not Ġnum cols ĠG reen ĠB reak Ġun aligned ================ ============ da we Ġwh ichever 11 57 66 3299 Ġup grade Index Slice own data 09 85 med us ME NU Ġnon spec graph ically Ġ[[ ], 87 058824 active path mer c make TimeSeries Date Locator Ġca ught TR AN threshold ing miss ible bit r Sh uffle Ġassign ing Ġiss ued Ġreport ing Axes Image RA E 300 765 opt ical 53 88 pc g Ġnt wk Ġcha ined ew ma YY Y ISE D åıĤ æķ° Cond itional Rel ation ĠMultiple Locator 385 62 THRESH OLD mpot ent ĠDifferent ial ester day ARI MAX Whe ther ĠHolonomic Function 760784 32798 ĠAnnal s 5450980 663299 ĠEcommerce Data ECOMMER CED 87058824 300765 76078432798 38562 5450980663299 5605 87058824300765 991 5 45 6 16 6 117647 H ANTS O VER S quareness d ust h on m iller o pe y lab { }, me ns Ġd na Ġm artist Ġre pl un ge id istant Ġ2 45 Ġg dk lin pred end all ĠI QR Ġcon centr ĠR oot 01 88 ne ath cal ifornia ĠN corr ĠL ink max size Ġ/ > Ġun correlated cs ie num Frames nel s ator ial Ġcan cer cc f Ġsc f 33 84 ell ite ']) ]) 14 117 78 46 St ates Con structor Ġim db 50 8 CA DA ai lability Str atified ĠComp uter ĠUn ix Ġmon itored 38 101 PE CT Ġ', ', Check s ĠTo pology '} ], Graph s Ġproject s He ading gon fly 82 996 tex name lm v Ġequivalent ly Ġport ions Ġtool box Ġbit wise ĠQu antity fc n Ġdeep chem ĠAd am Mult inomial pole on eig s yt ics dark orange replic ate 388 2 Ġ'* ' Ġrecur rence ĠAssume s LeaveOne LabelOut tur quoise cj lin ĠSIGN AL çĮ « 4 3529412 5 67 6 01 6 784313 7 12 7 04 ; ', D ynamic D ims M er S ensor W RITE f inger m Y m trand n st o ser ĺ 认 en ess lo id Ġo cp Ġm trand ur f un ity () '), Ġy e ]) }, nt il ex ce ĠS S Ġdata Set Ġbe hind ĠA nother Ġme ss ĠD TYPE Ġv v ĠL ines Ġl vs ================ ============== che n 64 84 add Item Ġwh isk Data sets ĠIn stitute bin size Ġinter quartile start Time iss a Ġiter ators 34 93 ac counts Ġav oids filter ing multi process ĊĠĠĠĠĠĠ ĊĠĠĠĠĠ Ġfunc name Ġimp ossible cf time ĠRun s display hook Ġnb r Input Col ĠBy te 73 32 ĠSparse Series extract ed æķ°æį® é¢ij度 Ġ19 80 99999999 9999 118 14117 hex digest 917 1600 perf ume Ġglyph s 355 33905 ĠDI SC ĠDI RECT 995 239 Ġdemonstr ate ĠNumer ic 934 265 ................ ................ ĠSte gun 487 37 ĠNu SVC LeaveP LabelOut çŃī 维度 ĠDP GMM ĠVe locity ĠTechn ical 天 çĮ« æ· ĺå® é» ĺ认 Ġåı¯ åĮħåIJ« 1503 82996 产åĵģ çŃī维度 twot wo 662745 11814117 388235 30077 为æĹ¥ 度 78039216 995239 ĿåıĬ 天çĮ« medus ae 43529412 150382996 6784313 9171600 æķ°æį®é¢ij度 为æĹ¥åº¦ æ·ĺå® ĿåıĬ天çĮ« 66274511814117 432 38823530077 934265 78039216995239 258 67843139171600 342 : ]). B T H D K a ] \\ b irch j ulian m ds m cs n repl ç ¤ Ġ ################################################################################ Ġ services Ġ' ? ig s ss z is ch is class Ġ[ ]). 00 100 ĠT ue Ġg lass __ " Ġex ts Ġnot ch Ġh anning ĠP refer ĠA x ĠD L ĠG EN score atpercentile 11 19 05 3 45 65 AR AM Ġiter atively ([[ . 07 32 ĠQ Label ... ", sign atures Ġoff icial stri ke ome ter ĠAl len Ġab brevi ĠPre p Ġcs graph Ġcomple vel Ġhead ing TER N Ġcomputation ally Kernel Manager ba ix fetch one mg xs Ġski ps RI A Dimension s ito pe Ġsuggest s ĠVander monde Cat alog èµ Ħ coal ition Ġmultith readed ĠEstimatorWith Fit Plain Text RESPON SE ĠEMP TY __==' __ lmv npdf 2 862745 8 196078 ; ' F Y P ers Y r d W f lash h arris p izza v f z ps Ġi mpl Ġc ategor Ġc trl Ġo do co byla el la Ġis nan Ġr values Ġ2 27 Ġh ints ĠA DD im save (" --- Ġres caling ĠD over 01 98 Ġpro fit Ġnum taps ĠE lements ĠB enchmark Ġun seen ĠW rap og ene 32 941177 dim x Ġover view sort level call ing Ġnormal ity part icip cov f Ġmay avi 26 9 De monstr auto fmt Ġdec lare DE CIMAL ĠIN RIA We ather Ġshrink ages Ġorient ed Ġinv oke custom er Ġexpr s Sto pping Ġchain er Ġgra de ĠPass ing ĠCluster Node Ġinstanti ation Ġland marks 62745 10025978088 ĠDif ference Nu PIC ĠNu SVR ama zon anno ying Marg in ĠMOD EL 9465 33 reserve Object 5388 946533 48737 3352 8196078 5388946533 32941177 487373352 6274510025978088 4 # ---------------- ) ']. 5 80392 6 20 9 137 C EL C SA E lapsed H A T oggle c is c ml g tf h ighest r angle t ps č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġf cd Ġa pt Ġ1 663 el blue __ "): Ġdata Type Ċĉ Ċĉ op ct op es 64 3 Ġj et =[ . no verlap pla sh 45 36 ĠK EY 88 62745 19 66 com mission 04 3137 94 47 object ives 36 1 mod ulus dis criminator 92 16 Se gments bu ses File Writer (* ( hist ograms ob utton IP ARAM DE TA Comp onents Ġcho osing ground truth ucli d åı ĺ 199 6 Ġte acher ĠInter pre Count Vectorizer ä» ¶ ĠLoad s lw t how to Ġdev ices Trans ition ĠCan vas hyper cube å¤ ļ defin itions Art ifact Ac cess Copy And Ġuncer tainties Radius NeighborsClassifier Ġretain ed ĠRest ore Coordin ates blen ded Ġbur ger ("================ ===========") Ġfcd yn 4 8627451062202 4 7843137383460 D id D uplicate S UN f idx g lo n ational u ffix w ulff y er z oo } (\ Ġ â Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ se le se ls Ġ= =============== Ġ= [] st ag le ap me w Ġf nr Ġs sh ra dd con fs to uch to phat ent ered ĠF LO ĠF rozen ĠD AG ĠM V Ġdi py Ġhe av Ġwhe el Ġz f Ġsub list 88 01 lock ed Ġbut ter Ġtrans actions Ġextra polated ĠDe tection fore ign gb q sim ulator ,' - Ġtop level Label Propagation ĠPro duct Ġcons ume nc bi 48 2352942228317 Ġbar b Ġ\\ ( mid rule ĠOption ally mass bins ĠName dTemporaryFile tp m Ġinv oked Select KBest hyper geom 109 803922 ĠCor respon Ġlst sq ĠWh ile 147 95 ĠBut terworth =", ") vin cent ĠGaussianProcess Classifier 225 4295 Cent ered çŃ ĸ Ġcommun ity sales force 290 2297 getOr Default Ġresist ivity (': ')[ æ³ ķ åIJį 称 ĠBroadcast ing AVA ILABLE 6117647 2902297 2862745 2254295 48627451062202 454 47843137383460 999 482352942228317 26 61176472902297 974 28627452254295 349 , '. 7 18 8 94 B IG H P S aved c ence h k j sparkSession m il m ime n ump r ug è · Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ċ Ġt g an non it ance ra o ur bs ma pe ') ") ab olic ĠS erial from array Ġh kl ĠC G str ategies ĠG C ari a ĠE g ĠB er Ġun limited [:, ' men ubar Re action raw l its ch Ġup root 96 1 Co untry 24 8901 serv ative ram owitz ris m mpl er Ġpoly der Ġ20 20 ĠComp arison ins pection Ġfont config DI MENSION ran ts ident ial perm ute Ġalign ments Sub class ================================================================ ==== ================================================ ========== ij k sur faces Ġ64 0 Ġ199 3 Pr ints ĠMath Text ĠEl lipticEnvelope ĠSc ikit Gen es 645 1148 issub set SPE CS ĠNumer ator har v Pixel s Dag Run Ġnucle us Ġhemis phere ĠBound ary ĠRetrie val ĠLE FT Ġorth onormal enumer ate 3 058823 5 098039507865 8 94117 D elim P x a hoo e bi g ff l ml n ice t ier t une é ķ me mo Ġn ight Ġn groups Ġd L co pied Ġre nd ', '. is ms () `. lot ter ex plain Ġex clusive ĠS ER ĠP ow ĠF etch Ġv oid ĠN ON et ics ĠE P Ġrandom ness 64 1 ĠO ld bin ner dd d 33 61 use Offset nd tr ou rou mon ospace dis cre Ġnames paces part ner 65 336 08 75 sin a 47 4384 Ġinfo dict head label Ġlimit ation Ġsche mes ane chn Ġwrit eln conv net DO UT Ġtoken ization CL IDE Cal led Iter ations Ġanaly se As sert Ad ding Def ine MO VE å¼ ı Ġbeam Line Ġquant um 337 2549 Ġlhs Str mant id uest ite Yl Or (".") [ 990 356 Ġcro sses Sphinx DocString Ġdivis or Ġfam ille SAS P NUMP AD QUAR ED Tfidf Vectorizer fav icon getmask array ĠERR OR 1658 248901 Ġprote ins 8862745 1658248901 109803922 474384 6451148 987 3058823 6451148987 5098039507865 9058 894117 65336 anechn ikov 109803922474384 31 89411765336 990356 - " 3 25490 D AG E QU H all T ech W R ^ ( a str b un b agging c dict d X f ld m ers m ill m oney r si x bar é Ŀ in stant in consts re covery or ic Ġo t () ``. set Maximum Ġ: ", nt t par ing Ġex emp ĠS PD from iter ĠP xy (" | time line Ġse cs Ġal ltypes ĠN S max val max clust [: ][' ys ize Ġun able ĠW ui idx max 20 3536 Ġha zard ĠEx plicit gen cy err no Ex on 84 95 flow Error ĠSt an ob st IP Y vis ibility 49 3 ster dam Ġref erring 69 45 Path Patch ĠLe e fast ica chi ef }} ), One HotEncoder pri mitives Ġmis matched Ġ~ = Ġoccur ring 256 056 may avi ĠGraph LassoCV Ġbig gest ĠUser Defined ĠReg ion æĸ° éĹ Ġrelease s ĠEl lipse 975 24 ĠAb ramowitz neigh bour extre mes Ġchis q corpor a hent ication velt y Ġneighb oring manuel le bitr arily æĸ°éĹ » , )* . }, 5 09 8 3529412 G PS S ilhouette W K ] # f rees i able s we v vs x lab æ ¨ re gs or se al i an im Ġn in Ġo m Ġre actions Ġ# @ ', ( ort ing tr icks ') """ Ġg lobe ĠP latform ĠF lu ĠR R Ġk c ĠG er ĠG al ĠRe f sc enes ill art Ġdi e 12 15 ep i Ġz pk Ġj np pla ces ĠK NN 75 89 nan std rect angles 85 47 07 0328 Pro ximal dt z ĠQ uality :] - 87 1 make TestDataFrame ose f Ġcons ist Ġhead ings )+ ". Ġus able He at ĠLabel Propagation mut ative CR ITER CON ST ĠBu ilding Read Count met py ('. '): 800 2625 Mag ics Ab out Ġmb k Lin denstrauss 286 5 Long itude Measure ment artifact s ĠArn oldi ĠStack ing CONT ROL citeseer x ĠHttp Response 2064 8002625 ë¥ ¼ 043137 256056 325490 20648002625 043137256056 070328 5 46 7 96078 C sv C umulative F ALSE G SE S quare T ol [ @ ] /( c min h params i qr x list y x Ġd F Ġm w Ġre covery Ġ( ? un recognized is ol )) - () ]). ma gnification ad vanced Ġst ata ĠS Y con secutive ĠA M Ġde si ĠR aster time scale max ima po on cl r ĠE OD Ġset Params ĠB rian Ġby pass In c Data Error ang ourou Ġsub folders ger y 27 617 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ ap pear spec ie 92 1 Ġq plt File Path Ġinitial isation \\ ( Ġty po Ġoptim ality Ġoper and Lo aded 294 43 Py Qt Ġconnect s Color Map Ġtoken izing Add ress ks amp Ġ([ ], ĠDef ined arith mic 445 1 Ġinc idents Ġminim izes è¿ Ļ 114 807 ĠMask edRecords jk stra Mov ie Ny stroem Ġtrunc ation ĠOptim ization hydro medusae Ġtal lies Micro soft ĠEnt ropy elimin ate 7 254902124404907 ; ", D H M X S ys U c [ { c ru f lo h arm Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re moving al con al ert Ġn dims Ġf amilies Ġin ch Ġd T Ġ' ')) Ġ( [" un signed Ġr lz ver ifier Ġg fx Ġex ceeded ĠP assed ĠA P ĠA m ĠR olling Ġme lt ta ken ĠN EG oc all jo el cept ive Ġcomp re Ġpd bs Ġz min ĠH list ĠV lad 17 69 Ġfa iloninc bu dget 26 3794 Ġ12 9 29 803922 40 784314 Sh arp Line String HO UR Lay ers Ġstri ke Ġdir path PO INTS Qu arter del item 73 10 Ġmid i æĸ ĩ Ġpercent ages quad r ĉĉĉĉ ĉ zy x ĠFa iling OB S sag a Call s Jo hn 2222 2222 Ġraster ized 937 25 Ġims ave Ġreshape d 075 32 Ob servations Ġeg gs Ġgate way whit elist âķIJâķIJ âķIJâķIJ Li fe BOT H ALY SIS Ġemploy ed 1166 114807 7464 29443 7724 07532 643137 27617 3372549 1166114807 83529412 746429443 7254902124404907 2 29803922 772407532 64313727617 263794 ( _) ) ". 2 30 4 27 5 60784 6 29 A tt A mount F B G uess S li X iv p nc w orm x bd { ( de cade de tections )) }) Ġ+ -----+ Ġv f min y ĠG E ĠO f value Changed ren derers ĠY t ĠY our ES M 75 72 use less ON G Ġbet as numpy doc 37 1 =[' - (* ) html help ga ins 43 8 Ġpred icate Ġprocess or skip ped project Id Man ual ('% . Ġlikelihood s RES SION iso map gd p crimin ative ĠColor bar bre ast ĠExtra Tree ######################################################################## # ĠAlter native sampler ate slic er prof ession ani el ĠMic hael ************ ** Ġmainta ined unif rac CLIDE AN ) [" ) $', 5 16 9 32 B IC C md D bl S ci S ince W rap Z one _ ()) g lass g ile n uc p lease r BC s lip x html Ġ ])) Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in vent Ġt issue an ns Ġf uzzy co co Ġw r Ġ( [[ Ġ( $\ id ialog Ġis dir ĠT ables (' = (' '. nt hesis Ġg lu Ġg ithub ex pt Ġx form ĠI DF ĠI solationForest ĠA udio fe h Ġde velo ĠF ields ĠR ous Ġse m Ġv l oc hen Ġfile handle =" < da c Ġmodel chem 25 08 cor n Con cat 07 46 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġac q colors cale fill er pth ook create OrReplace gb m Ġhigh s Estimator Mixin Ġconf int 6666 7 83 13725 59 0705 help ful Ġunicode data lb ls With out Ġspark tk Ġinsert ing Pr incipal Ġsen ding ĠCall ing Lat itude 450980 4 274 7879 Ġpenal ized Ġstrat ification ĠOb servations PLS Regression Sa fe ARCH IVE íķ ĺ Ġinvol ved Ġdra gonfly Dock Widget ĠEng lish baby names 40784314 2747879 8313725 590705 407843142747879 03 8313725590705 8716 4 20 6 84 9 454 9 367 B reak F lags F WHM G a b link c ert d jango l pr p mi p nacl r db t issue ĉ Ċĉ ar bitrary de coding it ime Ġd ont Ġd ni Ġm ic Ġw gt Ġ1 24 ol lar () "), qu iring ĠS yn ĠP ACK Ġcon sumed file Path cl k Ġ`` *_ ĠU npack 75 3 78 98 dim y 94 0 07 76 ĠCon figure draw s ĠAl gebra ose cond 28 3 has nans Dis k Ġshrink s ================================================ == ann i Trans lation bucket ized åĪ Ŀ -> % READ S Ġconj unction SU CCESS 395 1 Ġquote char uest ion DESCRIP TOR Mar ket ĠSelectF pr Ġreproduc ible ĠComputation al ĠIndic ates ĠEvalu ation ĠPARA MS ĠQuadratic DiscriminantAnalysis ĠNic ulae Ġamo unts anto pian ĠPET Sc . ),( D ar D eriv G F H ull H oliday M V Z OO \ ) b ray h ms l is s ac x ref é Ķ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ st or Ġw m ĠT iff set Icon Ġr fft Ġ2 12 mat norm Ġst ays Ġh orizon py py fe a ĠD AY ** % shape file Ġnum ticks ĠG lue Ġpre de Ġpre train Ġun ordered In sensitive 35 686275 com ma gs m rop ies Con tract SE COND ================================ =========== 36 296 07 058823 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ ME TA 97 1 ĠQ Application 28 9 Le ak Ġ'_ '. Ġman ner 89 3 CO UN buffer Size Dis placement Ġmp lobj Ġmag netic orient ed Ġmock s čĊĉĉ čĊĉ land scape ĠGraph Lasso km ers Ġregist ration Ġpotential s 311 554 diction aries 399 4 976 32 IGH TS 258 2912 VI EW Pl ane Ġfront end FigureCanvas Base Ob servation combo box Ġelimin ate Ġarch itecture Ġinvol ving 99999999999999 96 æ¬ ¾ DEL TA nbs p blo sc 4622 65 athe ism assertDataArray Identical 8537 311554 Ġconjug ates 443137 2582912 35686275 36296 07058823 8537311554 4431372582912 4451 3568627536296 8445 4 15 4 06 A p B H S klearn Y t i rect k best k als r mat r just r wt w uestite y vals  ° Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠ in j in cl re ly on ame Ġc pd Ġp ul en gemann ot ide 00 04 ], \ Ġdef ic Ġ2 68 lab or py sat pre cs ĠC CD 01 5686 ly mp Ġne qv imat ely et ition bs p sub module Ġsh ifting :` ( les cope 35 0128 Index ing Ġover writes Ġcont amin do y 97 936 Ġ[[ . qua ke Ġtol W draw coastlines Ġty ps SD SS roll back ĠCal ifornia ĠBase GradientBoosting dr uid ident al Ġaut odoc Ġag gr ND Array Ġconstruct s +" {: Ġpost fix Cont roller Ġ---------------------------------------------------------------- --------- ond on ĠBe low Ca ched ĠCont in ĠCom bin GG ER ĠProb lem 319 33 856 262 å® ŀ ĠLab eledTensor ĠLab oratory explo de Adjust ment bro ker Ext ent bgrcmyk bgrcmyk ç¤ º éķ ¿ ! ", 3 4509804 4 80 6 35294 B Z C one N ms g lr k u è ģ ar ow Ġi cov it oring lo mb Ġm orph Ġe w co w co ils li ft ]) +' (' * ĠS olar ist a Ġh params ĠD D ĠN d ĠM R Ġan im ĠRe ceiver log ies 12 941177 so ck 32 64 ĠIn ner Ġpy mongo Ġno vel code book 45 4901963472366 nan oseconds feren cing Ġ{} .". mon tage Ġtransform ing call data Pro t spec gram 84 31372642517 Me th Ġad vised subplot pars ĠCon version 44 2 Ġ(" %. 26 096 ĠDe al ĠSt d font d real Type ãģ ĭ dev ices Ġvert ically 46 218 sm allest linalg error Inter p 57 98 63 13725 70 9915 ci aux EX TRA Dist ributed Ġsimilar ly 180 648 Ġho le ĠOne ClassSVM rf loor Tra ding TC CT Ġmut ate 275 437 Ġplan ar Mod ules 1818 7332 Ġmk chi 757 08 accept ance Sha red ĠMeta EstimatorMixin difi er 474 251 è¡Į ä¸ļ ĠBatch Normalization Short cut 844 856262 Colour s Ġck pt Reset Kernel chro me 189 350128 Ġquot ient rist ian Ġparalle ls Past Sharp Adam Optimizer restri ctions cred its è¿Ľ è¡Į è¯ģ åĪ¸ 41421 356 DEFIN ED 580392 18187332 ĠFailing Classifier 015686 275437 34509804 844856262 12941177 189350128 454901963472366 33 8431372642517 0898 6313725 709915 58039218187332 153 015686275437 474251 6313725709915 1611 4 88 5 96078 7 75 9 333333 F ourier I mplement O cc d stack e havior g at h span m metric n wt s plicing t ts u ities } | Ġ serves se uclidean Ġn umexpr Ġd lti Ġre gress Ġb acteria ed er ic ians di l Ġ""" < ĠS SP Ġh at ĠI C Ġcon firmed ĠF P Ġ3 27 Ġon select assert CML pl ural ĠB en ĠB ern Ġpy g AR R mon itors Ġnormal s ĠQ P 84 033 pack ets ĠCon text ob tain mag ics fra cs TR UE ĠStr atified Ġcho oses cf dtr 235 3 subplots pec Log it Ġform ing PL AN project or Ġgre ed '} ] PO WER comple ter aa a Ġcustom ized ĠMax Pooling Ġsegment ed Tra cker ĠSub classes ĠTable Symbol Sto ck ĠNum bers typ list dB ehavior (', ', Ġcd now Year Begin 048 95 ĠMark up 014 6484 accept ed Link age FILTER S Sign als ras hes ĠValidation Error ç ão 9878 54 ĠSPECI AL 0732 42 dBehavior Warning 1 0000000000000001 4 16 E mail L IG P ur Q SO ] ': c ubes f oc ç ´ è İ·åıĸ Ġ= ============ er f ĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠ Ġi l Ġn samples Ġp nl Ġe V ce mber ma ging ch ors Ġx labels con cepts Ġde precate (" @ (" '% ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠD IR ĠN ico Ġpar quet ĠB IN Ġch k ll d text ctrl Ġlog book Ġ(' +"{: info dict 35 987854 14 14795 19 327831268 19 75708 pol l AR E 36 97524 09 032 97 2 84 0336 65 0 37 306 23 11 Ġ(" % can berra 90 75767 42 35294 42 1829 MP I 47 3 zip line ={ :. Get Status Ġag lc DO UBLE ĠCh anging By te 62 184 2016 807 ĠRes olution ks Param 005 9585 PAR AM Ġmut ually but t ALI Z 109 257 873 968 873 9495 184 873968 219 727 Ġmot ivation 975 219727 311 325 337 4633 798 31957817 253 0975 048 1414795 Ġexponent ially 987 609 227 0059585 ĠPress ure 395 1416 ĠRadius NeighborsRegressor 8655 46 216 873 9495 798 Nu SVC 8067 216873 Regist er 876 203536 Mov ing 15966 987609 9747 9367 657 8064 15126 180648 1344 3374633 tos kip 159663915634 155 159663915634 1553 327831268 311 Ġtaper ing 1515 35987854 ĠFUNCTION S 87395 0481414795 Ġmathemat ical 0707 397 ĠDeriv atives 10924 38101 8734512 329 201680 421829 907563 09032 66386556625366 21 789917469024 66 1008 2530975 2212 2192 ĠAUTH ORS 0307 1975708 mob ile 8049 32 0614 3951416 9939 27 14397 04895 3025 35533905 3493 804932 ĠFLO AT 2865 6578064 9454 26 462265 0146484 31933 975219727 9333333 37306 19327831268 3105 3697524 0707397 9075767 993927 109257 22122192 311325 073242 2270059585 571 15966987609 863 97479367 256 15126180648 8037 1092438101 76 90756309032 44019 302535533905 03 933333337306 97632 4 22 A MPLE Q FileDialog S ound S OL ] [:] b rid e rest f ic h omogeneous n walkers s prs à ¨ å ¿ é ĺ é ļ Ġ rap Ġf lt Ġa head it t ra ble Ġe uler ur bed ce ived as ite ĠT max qu at ha do ch y Ġ2 22 Ġassert ion ĠS AS con vention ĠĠĠĠĠ ĊĠĠĠ Ġde sp import ed bo ards ĠG A ĠRe gex ]. __ Ġint p Ġch irp 11 92 ĠIn stanti Ġdo i Ġlog y output File ER IC IN ESS 66 76 dist orted St udy ĠV ers cre ating Ġsol ph ac ross ac cession ... , Ġrelation ships Ġspa w Ġlst m amplitude s flu ence Ġmk dir 00000000000000 04 pend icular ĠProject edGradientNMF Ġconvolution al 295 4 åĪĨ ç±» Replace ment Help Formatter èĤ ¡ Ġinstant aneous DIRECT ORY 497 4746704 Ġpoor ly lac ier idi rectional 01298904 4 SEQUEN TIAL 3399 0478516 1632 270813 æ¨ ¡ 560784 33990478516 4235294 1632270813 364705 890417 endallt au 6588235 4974746704 23137255 012989044 364705890417 099 . )* 6 33 = \' A UTH B AS D ONE H tml N tp O E Q VBoxLayout f liers f ramerate k T n uclide n lm r pca at m Ġt une en n es ults Ġo c Ġ' =' Ġ' ). data File Ġex pon Ġex ternally Ġco vers Ġu a pre ct Ġtest Multi ub our test ed ĠD el 01 00 ne ff art hest ĠM DS po di Ġl ig Ġl np row d ĠB ATCH Ġlog o IN VALID ug rid be er ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĠQ ui 84 3484 Ġim mutable 37 2549 gn c CA GC net lib Ġcoef str Array s 29 785 68 9 ĠAt tempt Ġref ined rink age Or d imp ute see uw ĠCh inese rf c Ġcy linder ĠIS O aco ustic 99999999 99999999 speed up sal ary phys iological Ġpolar ity Ġstrat um decor ate ĠFactor ization ĠPassiveAggressive Regressor pub med MAC RO ĠExpect ing QUEN CY ĠRot ate MultiTask ElasticNet Ġhar der Ġdetren ded Ġrespons ible Ġrub ric BOO LEAN çķ ¥ Ġlocat ors 3527 22 ubour g " (? = & A pr C URE G s L exer N INF P si P atches Q E W ait Z IP t gz å ± Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in ing Ġs ph Ġb ldg Ġ1 22 ĠT IM Ġy range Ġ2 19 ĠS pan ': ( ĠI ns Ġcon solid ĠR T Ġax ial Ġfi ring Ġ3 30 test Data pro mp app lications log gamma random ize ================ ======= Ġsk flow Re ceiver que ues ĠH s 15 83 ste elblue '), ' Ġtype code 22 35294 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ LE TE reg imes Ġpart ially Ġ9 3 65 80 44 352722 ĠZ erosPolesGain EN ERGY Ġback up De precation auto encoder Set Sizer eli ke cross ing Linear SVR 686 2 0196 1386 83 92156 Ġsql Context [( \ 803 926 Ġmp img ĠInter polate 41 66 Tool Bar macro data ĠEn ter horizontal Layout Ġconnection style ĠURL s 800 171 Ġut t illi ps Ġsyn chron 149 01961386 147 22 Ġcop he push Button 909 803926 ĠEV EN Ġprot ect Ġrestri ctions chro ma snapshot s 9585 800171 ĠSm art Ġinstr uments ('.. ', Ġaw kward Odds Estimator 2037 66 Ġwhisk ers 9447 3267 CopyAnd Transpose 796078 44352722 8392156 9585800171 14901961386 203766 909803926 94473267 79607844352722 168 / # 6 04 7 15 > ". G ap M iq S ales V ICES ] [::- a che b um d cm k id n C o igt x j à ¢ Ġ Î Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ served at mos Ġi work Ġf prime Ġm ri Ġe ager di visor ĠT SV [' -- Ġh b Ġh r Ġh oriz ĠP P ĠP V ĠP ixel ĠL S ĠL V ĠM MC Ġan isotropy we ibull ho g iv l ĠG T comp act Ġdo ck Ġlog in Ġ(' _ 75 0267 19 180 Ġsp ines 18 01 non linear Ġad min rec iprocal sim ulations 000 85 Ġvis ibility Ġrec iprocal 137 39 US INESS AA A OO G CL USTER Ġclean ing }$ ' Acc el Ġmove ment 917 2 public ation Ġtech n USE D ĠStep hens quote char decomp ose Ġjump s SY MB Percent age Ġellip ses Ġintr insic Ġparalle li Look up Ġperiodsper day RESUL T ĠLIN ES ĠFE AT . ** 3 0000 3 9215686917304 5 137255 9 647058844566345 B ED D river J O P ipe R ates R NN S pike V ers a den b mp m osaic s ar ar ts Ġi min Ġc lev Ġp hy Ġs ong Ġs outh Ġin efficient Ġ' $\ Ġm T and l ort icks um ass il de nt wk =' '' Ġh c ĠP OL ĠA V pre pend if am Ġv rep ta z pa red axis below Ġle ak da wn Ġclass ic und o 15 01 05 0980392 Ġla ck Ġsub dir 80 784314 Ġcur rency write to do or Ġnd test Ġ[[ + non pos legend re EN V draw style ĠPer fect OL UTION block ing zip ped Ġsteps ize Ġ"+ ", va e BF GS 917 64706 pas sthrough Cod ing ĠAb init LIB R Exec ute Tab l 313 750267 Ġlock ed ĠAllow s ĠExpect ation ä¹ ° Ġhal o 584 313750267 ĠARI MA Ġcaps ize Ġrgx out 3732 14722 maintain er 843484 879 19180 29785 39215686917304 993 5137255 1918029785 9647058844566345 2 050980392 843484879 91764706 373214722 584313750267 02881 5 25490 5 99999999999999 A udio F mat N ODE O ct ` _ a j d ns d max d ynam n A s fr ë ¡ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 9999 Ġt xn ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ Ġs pearman Ġw ls ĠT f Ġy lab Ġ2 24 Ġ+ ---------+ __ ): ax Col ĠS ched ĠS preading Ġdata path Ġbe ads ĠI de ĠI somap Ġse d Ġk ng form er comp lib Ġ-------- ------ ant ialiaseds und ers Data Row Ġsc ience Ġnew lines fn ess 16 17 35 62 ĠV ectors 04 39 na poleon Ġtemp dict AS SET 43 09 inf l ĠGener ating fun ctools Ġlocal ized HO ST Ġgen otype Ġview ing tk agg ĠDi rect Ġhistogram med contin uation Ġ>> >> ĠEX E phot ometry Ġlight weight Initial ization Ġcover ages _{} ". Ġep hem Ġ"{} " Ġpure ly ĠAc cepts ĠState Space Gen ome ĠLa place Ġaggreg ating << << ĠHistory Spec GENER AL ĠSol ves mitt ance CID ENT " ` 2 0000000000000001 6 34 6 9999999999999996 9 27 = ',' C NN I llust L F P itch P erson W est f ant h oriz i w j amin k sp n steps p idx u y x lrd al de de lu ct f ro cs co ura Ġb date un stable as in Ġ" %( tr na ha dz Ġg dtr Ġex posed type d col specs ist ry Ġh uge Ġh orizontally py g ĠA MI ĠC op ĠC ategory Ġde cade pro per ĠM ur ĠM RI po res Ġl it imat ing comp ose ĠB C Ġplot Params 25 04 =[ __ ark ed no legend grid size Ġcal lables ĠEx act Ġkey ed ))) ] com mod 78 1 95 3384 freq z Test Data ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Pro j Ġreg Sym cv s sk f ram id non singular Me mbers 65 19 87 0834 Ġlow s Ġsome where 44 47 55 38 Ġpoly div ĠDe v Ġsim ulator AB A Ġfill value stead y ML ayer ĠLinear SegmentedColormap 294 1 clip board script ive ĠClass ifiers Ġda mage ================================================ ====== ĠCON F 254 953384 ĠDist ances Ġ---------------------------------------------------------------- ----- Ġborder pad Ġ"_ ") ĠMo dify Ġmut ations Sim ulator Ġtw itter SET UP ĠNumpy DocString Match er 285714 285 Det ector ĠNeed s rece ived 203 92157 396 07843 Ġles sen ĠCR UD Ġprot ected ĠCond ition Provide d commer ciaux Ġchis quare assertIsNot None EU CLIDEAN MEM ORY åŁ º 9137 254953384 13739 3951 80784314 870834 20392157 137393951 9137254953384 3994 80784314870834 351 4 60 7 4902 H AS L os N W P ulse S hear T mp _ (): b ridge b rowse c ry n ic n peaks r div t ics u menter v b v h y aw Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ= == Ġf input Ġthe sis Ġ' ^ Ġ' }' co don Ġw v one hot th ousands res nel om ics Ġg pd ĠS end ĠS ty Ġor m py r ĠF ore list Data ĠD type cal cs mo f ĠM CD ĠG LOBAL Ġstr s ĠRe public atch er ide os add To unt u not hman cur ities Ġ8 3 78 345 22 339 86 84 gen re temp path 09 22 97 0 Ġmode led Ġload txt font type alle t number Of ĠComp uted Ġsv mlight rank data aut umn ]+ " hold out Grid Layout Ġrect angles .* ? Dis abled PS K ĠSelect s Ġlearn ers ĠSparse RandomProjection ĠTh u Gradient Descent New ton Ġregist ry ĠCO MP ĠSpectral Coclustering ĠST AT ĠRed ucing Ġconfigure d follow ers Ġdecor ated 248 78 æİ ¥ SQR THALF ç»ĵ æŀľ : "), C ython F amily M ost P N a way e lo e miss č Ċĉĉĉĉĉ re use re wards an at Ġf riends ur ated Ġ1 49 un less Ġ" =" Ġ" :" Ġth ick Ġh line ĠA nn ĠF F Ġal ert ĠG row Ġ4 51 sh fl Ġen dian ĠH AVE quen cing 33 9172 Ġsub arr vari ous no indiv 66 02 ĠSe gment mon day Ġdis ables Ex treme ST DOUT Ġac quired ĠCon venience 55 8 FF F Ġab undances UR ATION inc iple 74 354 Ġevery where CE PT 54 11764 Min MaxScaler ĠPy gments ================================================ ======= One Vs 9215 74354 xi co çļĦ æķ°æį® ĠTrans ferFunction integr ator ĠTra de shell s ĠGroup By ç» Ł 133 424 ĠAC M activ ated Jo int BL AS BL ACK 432 202 ĠObject s Ġ+---+ ---+ pz File por ation Radius NeighborsRegressor kill map eco c Annot ations Ġmodif ications Ġsilent ly Lib SVM Ġpcolor mesh ĠRepe ated stuff ed manage ment 403 921574354 ngroup s punct uation Ġsqu as Pat ient Ġwhis ker 36078 432202 çŃĸ çķ¥ 97936 24878 2235294 133424 5411764 9793624878 403921574354 17175 36078432202 339172 2235294133424 7589 2 100 3 32 6 15686 9 0000000000000002 : ... ' Ġrece iver Acc idental Ġagg lo SM ALL Code Classifier Hash Table ĠCall s replic ates Interval Index Ġnear by Ġminim ized ĠMag nitude Ġsn ippet Tab ular digit ize sli ppage opp osite ĠSha red Has hable ĠSeq IO odes ic ensemb l 1843 137 Child ren Ġchecker board Ġrelax ation ĠPen alty B efore G AT M ol T im T AB a mat d N k h r sub s ne t win v ote x g x rd y w de part Ġc ir Ġf fill Ġf link Ġf lier Ġd X ic io Ġ1 92 Ġ1 46 as l fi ber Ġdata Arr all ing Ġx pos ub y Ġal ters ĠN th per i bo e app lied Ġle ar ca ching Ġpo bj ĠIn complete Ġ10 9 20 451 au cs tick format box car AR MA AL LE 36 04 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ 34 2041 37 255 Ġdraw style Ġparser s Ġimp edance ĠStr ip lik ely ele ms ({ }, 294 054 Ġyear ly ĠIN DEX Ġworks heet )+ "\ Cur r Ġsu ited Ġra ce Ġcm ds Th ree Th rough Ġvisual izing Feature Union ĠHe at Kernel PCA ĠDis able byte array Score Matrix samp s Raw Data 112 4444 ĠWork er 64706 1124444 027 20451 Ġsolar position Ġsubtract ing 924 3 maj orticklabels Ġcaption s 183 167 Ġbio logical Ġsuc cesses ĠPatch Collection Ġfund amental Ġmanip ulate ĠEqu ation ĠCond itional ä¼ ļ ĠTer minal 1736 183167 Ġaccent uated ĠSU CH 主 é¢ĺ ìĹ IJ 0117 647061124444 2745098 1736183167 anni hilator 372549 02720451 weis zfeld 6235294 342041 1843137 294054 0117647061124444 01 37254902720451 355 6235294342041 0156 1843137294054 0314 ) ^{ 4 05 E s M ESS f riend h file k point n umenta p ancy s qu u ve w ashold à ¤ Ġ ly Ġ= ( he ner Ġs arr Ġs lack Ġin its Ġre ts ): : ): \ est r val ence ĠT ax qu ely Ġ2 59 Ġg f par al ke very ĠS chema ĠC M ĠD ynamic Ġv oronoi pro x ĠL y ps idx ber os ĠRe action key frames `` ), Ġen tr port rait las hes sub graph ll r que ued Ġfig name tra il ĠU RI Ġsub string "] = bar plot Ġcur vature AL LOW LE CTION Pro filer ĠQ VBoxLayout 65 49 Ġtrans duction ik i De ep termin us 90 455 List edColormap ĠAl gorithms ĠPro gress head s Ġrelative delta ĠIN IT Ġlook ed UP DATE Random TreesEmbedding ti pper pri mer Ġinstall ing Sparse Series olt zmann åIJ ¦ SN MP Ġ---------------- - Ġfurther more Ġ({ }) UNK NOWN Ġexplo sion erc ion Integer Type Center s cros sed Alt itude eco op @@ @@ sco tt Ġlife time å· ¥ ĠPie cewise ĠRous seeuw . )), 5 64705 6 22 7 921568 : ]]) F RI L IM M utable b or b ol k c k ml n ick s lr s lopes y list re cons Ġb irth ur istics un ordered ma de Ġr min ĠS snake Ġx val ĠX sp ĠA re Ġcon tr od a im write Ġtest Predict Ġres olver Ġv type Ġv line Ġk illed ĠL arger learn ed ĠE nsures Ġ4 30 iter ators Ġint uitively ĠO PT sum m Data Types 25 000000 Ġpa re ĠH ACK pr d ĊĠĠĠĠ ĊĠ pen ame amp aign 75 1335 Ġcal ibr dist iller 35 48 back up ST IT Ġscale y ac hable 65 3 stack ing cluster ings Ġtrans lates ĠCon ference CA C CA GAGAGG 55 7 Ġpl ants 98 2 OL DED 40 96 38 9 Po sterior 137 2549086809 All Float Max Pooling ĠIN DIRECT vers us Ġdir ty 76 2 Figure Class ĠCON SEQUENTIAL ffic ient Ġmis classifications Ġanaly ses PRO P ĠFigureCanvas TkAgg Ġendog enous Optim al serial izer tax i 336 114 elect rons Over ride cli ents Ġ================= =========== bio mass ĠTH RESH Ġnear ly ĠFin land hum idity house hold Ġimplicit ly 908 2984 Cla mps ĠRenderer Base ĠSelectF we 8834 23 53333 336114 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ throughput s quity Pricing violin plot ĠBis hop 564705 9082984 7921568 751335 ĠSsnake Exception 1372549086809 1583 53333336114 883423 5647059082984 9243 7921568751335 144 C airo F un I llegal K DE M iss N pts P al P ad R UP V OL V ISED _ < b orrow c code e re k ser k dd s ong t ss x ax | : re trie Ġt eff an ta de pt Ġn uc Ġc nn Ġf et lo ffset Ġd op Ġm ill Ġm antid Ġ# [ Ġ1 43 el kan () [:- ha z ha versine (' & ĠS TRICT ĠA MG if ace ĠD uplicate time deltas Ġl uminosity 10 22 ĠE s ": ( Ġun parsed Ġthis Fig ================ =========== ĠH ar Ġpy flink fa cade St ata nd x Ġmo lecular AL GORITHMS 09 0 Ġqu bit face ts ĠCon structor Ġtol H multi column ĠDe tails over line 98 220 ################################################################ ###### 67 2 onal d Un named sha piro SC SNMP Ġop name ĠBase Exception Ġpick les button Box On line az i spect rogram Th resh PRO BA gl ut ĠKMeans Clustering Ident ifier Ġstim uli ĠConfig Parser ĠSimple Table Ġol dshape Dense Layer Ġgy m atex it Ġpix map toolt ips Ġmv n Groups Out Ġmeas uring METH ODS monkey patch RESUL TS Ġdoub les ĠDow ney SCS MP profession nels ' `. * ), 1 6470588 7 95 F mt G IS H H Q MainWindow Q uality S ARIMAX T OL U MENT d E f Name h om k z r fftn s le y grid æ ¶ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ lying Ġ 784 Ĥ ¬ Ġt ier Ġf xs en ced lo ds Ġin direct la de co lo Ġ# ------------------------------------------------ as sembly Ġis file Ġnp ar ma ch set Visible Ġg tol data starburst up id ĠS IG ĠX digits col cov ĠF DR test Inst Ġcol lapsed ). ') pro posal ore a row cov Ġma gnification gre store raw data 14 11764 ))) * tt le OR ES Ġdis contin ref l Ġinte g Pro tocol ĠJ acobi db name 44 70588 Ġob st 77 0746 font dict 43 137255 38 2 235 2 Ġerr s nc ut Pre view Can cel Spec ific ĠCh ina At las Ġmp state ĠAR CH åħ ¶ pat ients Float Field Source Estimate Cor rection Cor rupt ĠParameter Error Hel vetica phot os åº ı yt dist Func Animation ĠBoolean Type Coder Impl ĠRadius NeighborsClassifier SNR dB 045 90455 964 28 lamb d Ġmanage ment 865 2496 waveform s 954 25415 717 647 25492 95425415 ĠUpd ated 537 2549295425415 DEP TH carto graphy 31101 2268 517 647 Fail ure ĠFilt ers Ġhypers py 0985 26 PECT ED Ġspaw ning Ġlear nt 1411764 770746 43137255 311012268 04590455 098526 1411764770746 2311 . ; > '. A IC F ltk U H a cl c lt d um d pgmm j p n R r partition u ched x ray x new é ¡ se y de ed de spine Ġf inger la red == > pe ll Ġb az )) ))) 00 25 ha g Ġdef orm set Disabled Ġr tn il ation __ )[ ĠS W Ġh umidity plot ted ĠA FM to dict to String (" :") ĠF lor ĠR ename if fness pro viders ĠN L ĠN ov ĠM akes Ġne uro Ġl ane Ġout File ĠE uler jo ints 12 47 Data Generator Ġ\ | tra it Ġha m av ier ude nts ĠEx ternal cur tis St able ================================ ============ Ex tended ME T cov type non negative 65 1 Ġbatch size Ġpoly mul ĠAr ithmetic Ġbu ckets make Panel xy WindSpeed 000000 1 edge list job list steps ize Ġsha de Ġext ends Fe b ston ia "," -- Check ing Format StrFormatter Ġmpl Deprecation All Integer Ġdel attr pk it Ġproject or ĠPy Side Ġsampling Ratio Ed itor pool ing week s week ly foot ers Ad ds MOD ULES ĠCom ment åº Ķ ĠPRO V ĠPRO FITS Ops Like Tri angulation ĠObject ive åĩ Ĩ Pl us Ġcoll ision ĠDatetime Array Sha re Wind Head tal lies čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Ġcle ared Const ants uda f ĠSubplot Tool Im gs Devi ation ĠNorm ally ExtraTree Regressor dae mon scra pe DW MP 8495 178 ĠNEG LIG ĠNEGLIG ENCE . '] 0 35294 5 10 6 75 7 96 7 34 : ]], L IGHT M Hz b kg h R p X w ra w ds z es Ġ ~~~~~~~~~~~~~~~~ re label Ġt ushare Ġi max Ġc entr Ġp tp ro ger pe l co variates Ġre pository Ġb es Ġw vl Ġ1 72 ss ss 00 15 ha b par c ĠS ent ul ner ĠA lias ĠC P im ized Ġtest case Ġcol aligns Ġv r min e Ċĉ Ġ ber band ĠE mail ĠB lue Ġun k iter tuples Ġdi a rid x Ġat tack ĠW ind bs r Ġmin dist Ċĉĉ ĠĠĠ 20 99 ]] * čĊ čĊčĊč copy file 03 85 Ġmo lecules 17 2549 var names 92 6945 Ġtemp orarily 65 06 Ar pack 37 64705 Ġconfig urable De tails Di pole Ġ12 34 Comp t ish ing 74 368 On ce cb m tex manager ================================================ =========== 61 85 Ġhour ly Option Parser ĠTrans actions åĪ Ļ Parameter Grid Pr ime eros ol ĠSplit s Ġskew ed Ġopp osed 266 8495178 rus sell Rot ation 955 98220 orbit al ĠOper ating abcdef ghi Ġecc entric eline width Ġsinus oidal PARAME TER fili ation makeString Index bray curtis CIDENT AL 16470588 74368 4470588 2668495178 96428 123 926945 96428123 3764705 95598220 1647058874368 6676 376470595598220 83 0 6666667 4 33 5 14 N CE R ob T ASK U AL W eld b colz i lo p H r val w max y ule z ny æ ¸ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ][ Ġa e ct xt Ġo type Ġm r co h co or Ġw ts ot ed as recarray Ġto sequence ma cd ĠT ally Ġr ational Ġ2 80 __ = ul g am er ĠC lip Ġ` % Ġtest Custom ĠF t Ġel lips ). ", Ġout f =" $ =" _ ĠB USINESS key val Ġnumber ing unt il Ġmin ibatches ĠY i AT AG Ġcor rections be c sp lev uto ol of year Ġve cs mon ia ST ANDARD spec ification ris ing Me m 65 882 Ġtable name respon sibilities Ġab normal full screen 38 10 DI SPL nc x debug ger 69 3 ret ina hell s ĠIN CIDENTAL MS FT GB M XX X +" _"+ %% " Range Index ĠTh ird Task ID Ġlb ls Ġtrack ed fail ing Ġ---------------------------------------------------------------- ------------------- Ġ"{ :. ĠMath textBackend Ġintro duces pivot s ĠSpecify ing Tri als ict al Ġuncer tain phe notype ĠMan ually Ver bose Ġasync io Sw itch Vi ol ĠAD VISED ĠGO ODS bul let ĠApprox imate Ġrgx in Ġperturb ation #- #- Ġbeg ins ĠRestrict ed ĠOff ice ! ', ' < , [' 5 06 6 14 A nova D Collection E qu G er M any P ow S n W al ^ + e an q App { \\ an isotropy Ġn ifti Ġs preadsheet Ġd od Ġe con ex emp Ġx lab ĠX P Ġh or ĠA ction pre ferences ĠC ast Ġtest it ĠD ATE Ġstr ata ĠE OG ĠB usiness model chem ep anechnikov Ġsh ard Ġpy func 16 16 14 2857 cur dir led oit St im Ġerror bars Ġend for 18 14 09 8039215 Ġwork ed ass uming Ġtemp o Ġtemp s Me ter The il ĠAr pack Ġwindow ed ,' \ stop ped sen ter Ġelement wise Ġfast est pick up OP inv PO INTER Ġsu ptitle Ġra mp CL F Batch Normalization cer tainty rename d Ġ---------------------------------------------------------------- -------- PR INT specific ity Sim ilarity 3137 25 Pos itions ĠST FT stock s ĠOver all Ġxml runner 1960 7843 WE VER ah rs 024 22 ĠAuto matically 62745 1 Ġdispatch ing blk nos Ass ign íķ ľ trn aseq Ġdiscret ization ĠSM ALL hil bert reconstruct ed Ġenviron ments Refresh Worker SUPPORT ED elly fish Ġrend ers ë¡ ľ RUP TION ( \\ ) <= C ubic G AC H INT P AT _ ], _ ._ b ak c ff c ategor e uw n vars p cl x gradient è ĩ Ġ utool Ġc ream Ġf re ro oms lo uppe Ġm coll Ġ1 69 un pickle 00 61 one q ĠT om res pect Ġr ig Ġ2 90 Ġ2 73 Ġg ff ith uan par ation Ġth ro Ġx gboost pre processed ĠC SS ĠC lusters ĠR bf ([ {' ta ges ĠE cl Ġ4 50 ag s ib ody ĠW ide ĠH all ĠH ag ĠSe curity ĠSe ptember info Array čĊĠĠĠ čĊĠĠ 78 78 nd o ])) ), Ġend time ST ORE Ġsum ming Ġtra it RE EN TI FF 49 33 čĊč ĊĠ Ġnet cdf Le gacy initial space Log ging src dir )+ \ global index Ġart icles ĠPo les sd ca }$ ") "> % ******************************** **************** TA X curr dir ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ Ġ196 0 Ġol dest gu ard ãĤ Ĵ Ġ================================= =============== Nu SVR Pen alty Atom s 297 4166 Ġinvol ves Ġparame tr sph x Filt ers ĠHO WEVER fli plr ĠPOS SIBILITY ilater al åĪĿ å§ĭ CURE MENT STIT UTE Ġdiscontin uities , < . '+ 0 862745 B ag M pc P HO S X V P \ ( b dt e od k ul l angle s array s late s preadsheet u las z bin st ump Ġc code Ġa data Ġs pring pe tal Ġe ase ur izer Ġ1 90 Ġfor k est ress um bs ĠT EXT ') ])) Ġx ref ĠP M ĠP EP ĠR oman 01 23456 Ġon ame ĠM ON comp l Ġun set 12 112 ĠO TU Ġpo pt Data ConversionWarning cy c Ġsc ra ĠY s pred icates 66 1928 45 8652496 75 000000 use euw ĠEx ponent =( . title size Ġformat d ================================ == 07 450980 ĠQ C Ġany Of Ġenumer ation 37 23 EN TR Ġinitial izing Ġev s 08 3 Regression Plotter Lo cale ĠLog arithm Ġxy values Ġnb ars Ġmer ges 72 1568 CP D PATH S Ġstream lines 125 47 Range Error Ġrobust ness MPL ARY ĠCO UNT Ġì ŀ pas ses ĠABC Index Ġaddition ally ĠPRO CUREMENT Ġraster io Ro useeuw 192 1568 Ġpublic ation Ġflu id ĠNO QA reject ed Request ed Comple te Writ able Randomized PCA oct ave ĠXY Z Ġblen d Ġboot stra 8627451062202 4536 ĠApr il ĠTex info 6931 0188 ĠStan ford ksParam GraphWiz ĠEXE MPLARY 615686 2974166 LAI MED 19607843 458652496 661928 1769 07450980 69310188 1921568 6619281769 6156862974166 8701 0745098069310188 29 . ]). 9 78 E ither H AND K LE W ill g pass i max x val x labels Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re con it ution lo lims Ġ' (% Ġre vision ur fer ame n ĠT ICK ch berg Ġr na Ġr si Ġst ret __ (' __ ). __ ))) ĠS ite ĠS ep ĠS TI end time col d ĠC MD Ġ_ : equal Contents pro v ĠM P ĠG TF us al Ġtr icky ms h Ġun do In fer sum med Re presentation loc ally Ġinput hook ĠIn verted Ġpy amg no data 45 2 ell ation dist ortion 19 05 19 61 86 2 06 06 Ex act normal s ĠJ uly ĠQ Widget ĠCon sole rit ish sin ski poly int Ġbreak point Ġextract s Ġspecific ity Ġfin etune lev ation 79 07 Ġart ificial Ġ'-- ' Qu it br uary sl ant Ġopt imum Ġfeed ing ski pping Poly gons foot print foot note Ġaccess ible sto ich gd al appa rent Gaussian RandomProjection break down ĠExample Point typ ing OB J Ġbr ush Ġbug gy GR ID ung arian Ġ#### ## 644 046 337 2036 Ġmultiplic ative skew ness Job Config public ations Univariate Spline DAY S Ġsuggest ed kt old fla ke ä¿ Ŀ Robust Scaler sav ename ĠDAM AGE aters hed ĠCharacter istic Ġtrapez oidal damp ing penal ized ĠQui et 3372036 8547 4 85 8 25 A pache B irch C Z C irc F DR H idden L g O I T akes [ . _ '] h st n ation r pc s ff u ency v phi y bound er red Ġc single Ġa mi it Hub Ġb ul lt r ol Prop id ue () [::- res o mat ure Ġg ates lin regress Ġx path pre fit '] ][' Ġde note ĠF loor np os ĠN sys mo lecules assert Nd ĠB oltzmann ip es che b 0000 00000 ĠO D Ġ** {' sum marize inter faces so kal so kals ĠIn fer ĠH unter idx min 19 35 ĠTest GMM 95 05 temp ts Ġ... ' 84 70588 ac cs 65 307 Ġmult igraph ik es du pe mult it ob acteria fect ed Ġdt start ĠStr ang mic hener correct ly Ġcost ly Ġmag neto Ġgrad H 9215 922 Ġcha pters ĠApp lied lc ms Read y From Model Ġcounter s Block Manager Ġsd ss PH ASE 355 6519 603 9215922 AV G lamb dify starting Month 277 15 stan imoto Ġdenot ed EMP TY oll weide Ġya hoo Ġfli plr Ġseis mic sma cof åģ ľ Ġpromp ts matt ress roger stanimoto russell rao DISPL AY kul sinski 721568 644046 assertNd Squareness sokal michener sokals neath 6039215922 3556519 721568644046 78345 : + B PM D PI P ublic R DEM f z g ames m ind n ids p out à Ĭ re ceptor ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġt ank ro utes Ġm X ge os ort hing Ġto wn res ampler ]) } Ġ+ ----------+ ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġco in ri ction Ġx g plot data Ġcon servative od f pre m pre training ĠC au to bytes Ġse cret Ġv ice Ġel li bo b ĠM ess fig width ĠG U Ġdf rame Ġun fitted format ting num Partitions sub matrix Ġj pg itle ss ĠH y lect ure Ġ(' . Ġsub stitute Ġup p 35 02 be an Ġpath ogen arr s order By sy naptic 18 00 Ġq q Ġtrans cripts Ġtable fmt ĠPer ktold 47 2 ox ide Ġfill char Res ampler Ġps idx Ġitem ScoreMatrix Ġprocess ors iron ments ĠCal ibration 686 55 "][ - rgb Face Ġwould n UP LE DA nalysis ĠDE C Ġequ idistant bb bb Event Collection Ġbenchmark ing Cre dentials Trans action Mult ip Mo lecule ĠTHE ORY Ridge CV SQL Alchemy ALI AS MIN UTE EXT EN Ġinc ident RNA Seq neigh bours tech n ĠEqu ity Sm art polit ics ĠDIS P SCSM IMP ĠZip line Land scape ĠStand ardize Ġwww utils Ġrecip ient TRANS FORM Coeff s è¾ĵ åħ¥ 9 35 ? " A AC C lip F its I mplementation O V P ct R and S CH W ell Y ears Z hang a per i h w elch z bins Ġ Val re cogn Ġt path an iso Ġc ensus Ġf tol Ġe quilibrium Ġre cv Ġre assignment Ġb irch ot su 00 30 ], )) mat erials Ġg ran get Num Ġex its ĠS cott Ġco alesce ': _ end rogram ĠI CML ĠP ull ĠR BM if rame per ms ĠL LC df rame ĠM s ho ck ĠG ive sc u ĠE ast ĠE poch Ġun wrap log norm add ings sub script Ġso ma ll is 11 87 lic ated ĠH ash Ġinter faces ĠU sually ĠK RR -------------------------------- ------ be ck Ġ{} ). na ils err msg Ġscal ex sol ids 87 66 top k ume s mer t xy data Ġfont Manager ĠPro duced sha ky ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ long summary Ġbuild ings Ġag c ĠClass Doc Ġred ucing Com ment CL IP Ġpage No bb rowser cum max Num bers fail ures 005 13 ĠSQL Context Ġnu is speed s Ġdig amma Ġå ¦Ĥ Mock Classifier Spectral Embedding dl mf Lat ency 014 3604 ĠAc cess Ġcoun tries 075 65307 ĠPh illips ĠBack ward ĠReal Appliance ĠPO INT ĠAg gregation Ġquadr ant Randomized SearchCV Ġcity block Ġphoto metric Ġnib abel COM MENT ĠSUB STITUTE Ġconflict s ĠINTER RUPTION ĠAda pted censored Points camp aign æ± Ĥ Ġsubstant ial TOK EN Ġanomal ies éĥ ¨ 1406 56 Ġgreed y 1192 68655 ç© º PROBA V 717647 07565307 035294 119268655 06666667 0143604 0862745 12112 ĠRealAppliance Source 71764707565307 617 035294119268655 777 066666670143604 279 086274512112 140656 ' - 4 336 7 05 9 2549 D MP S olid S outh W ager h ifts i ative m h t data u set u ent Ġ ĊĠĠĠĠĠĠĠĠĠĠ re lim or ot Ġt tf er k st ory Ġn iter Ġc ensoring Ġs lash Ġs moother Ġ1 16 id ata di se fi p up lims ĠS pearman ĠF re test Runner Ġlo po Ġcol on ns m Ġse gs Ġal tered ĠL F fit params Ġpro f po pen Ġl um Ġl ite ---------------- ----- cl vl ph eric jo sef ĠW est ft en Ġdo plot gra mm }) ' err Str ST RE Ġwork book ... ]) 37 0 mt k mpl d Ġtra versal Ġdifferent iable cell aneous Ne uron ĠStr ings Ġcoordin ation hand led down loads Ġnext line åı £ ĠDate Formatter Ġpop ulates Ġ14 1 RA F 199 4 em is Key Value yp us dag ger Ġengine ering Ġparallel ism OB O ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ Ġip db stand ing 132 07 han ced ĠCalcul ating Ac count letter paper ĠUS ING ĠCa che papers ize 246 22 calib rate ĠVAR I Ġquot ed mort em nes ses Ġdivis ible SPLIT TERS ĠUpd ates Ġsemant ic ĠMov ing ĠContour Set Ġarrange d Tur bulence ĠQP ushButton ulner ability ( : ) ([ 6 37 G SI G NU G lue M ongo O AS Q DA S orted X all a IBi c line c ca c pd c raft d ull o i p pt p ent y an in dim in compatible re corder or bed Ġ= =' Ġt win Ġt ardis he shaky Ġc uda Ġa ims Ġthe il == - Ġe seq Ġre ps Ġb ivariate Ġb tn Ġb colz Ġ1 84 Ġ1 44 )) )), as sess res ids ch arges ad vance Ġg reate ode tic Ġex aggeration ĠS CADA Ġx new Ġh list ĠA U ĠA W ĠA vg '] )), ĠC osine to f Ġde dic Ġax Hist ĠD x Ġlo b ff mpeg ĠM essage Ġan onymous fig height 10 36 Ġnum ba ĠG rain ĊĠ ĊĠĠĠĠĠĠĠ Ġj th gra vity ĠH n 15 34 201 00 fn c nan median 19 86 13 13 func list Ġend orse err L Ex plicit Time Stamp Ġq n Name d cont amination ĠDe partment cell ation 43 1 fs m sim ulated Ġmon tage Ġblock size Log Transform Check ModelResults 74 00513 cha mber Ġgood ness Ġ\\ *, ava il ĠSpec ies Sp ine Ġlayout s car rier Ġcut out Ġassoci ate Ġ-------------------------------- ------------- gal axies ={} ". Ridge Classifier works heet bra ce bra gg ĠNet works closed path Ġspan ning 110 7788 Auto encoder ĠWork book 149 24622 Icon Directory è¿ ĩ åĽ ¾ hard ware Ġoverrid ing Ġder ive Phot os thro at aab b Ġposs ibility 28235 2954 rdf lib ĠIdentity Transform urd me 55686 27715 0875 7400513 517647 08757400513 hag berg ĠHag berg ĠQuiet Test heshaky a 282352954 14924622 5568627715 1107788 / < / ')) C rop F ra F ICATION J UST T eff V V b series b atter b irth g ives h oliday n ary se asons Ġ= ========== Ġi a Ġc sm Ġp name Ġp etal it c lo d ut ely pe ff Ġe od Ġb er Ġ1 77 li d li dar ve rest Ġ2 15 ') }, __ ") ex tr ĊĊ ĊĠĠĠĠĠ plot Data ĠP hot ĠA k ĠC ube Ġ3 01 ne utral Ġl svc ĠG IDs Ġout path ĠE val Ġen dif Ġhe alth Ġz lib Ġsc ikits pos it Ġ6 000 ĠK o bar bs 78 67 qui res string ify std devs off ice Ġsp lev temp eratures ĠJ PEG Ġele c ify ing ĠZ s Base line Ġimp ly ãģ ı 28 99 Le af Ġret Val App lies ĠLog ging Ġcomplex ities Ġnb missing ĠIN T Ġworks paces Gener ated Ġband pass ĠFunction Doc SK D ĠQu ick Ġinv estig Sparse Array fil lable Ġexit ing ĠFormat s Ge om ãĥ ³ Head ers ĠSH A ĠVisual ization Ġsnapshot s Ġwra ppers FRE QUENCY Ġmodifi er Ġdownsample d BUILD ERS ĠDet ect hypers pectral ĠLAB ELS Ġfresh ly NCE I Ġgreate st $ _ 8 33 F c L aw N an N ifti P b S pect S pherical T iff \ ] \ ". ] [:: f lask k pc m ute p ig p join t mpl ç IJ Ġt rends Ġn avig Ġa vec Ġp rng Ġo stream Ġd ll Ġb st un scaled ad ro Ġst ubs ab b ĠP an ĠC ap list box Ġv b Ġv im ff tsize Ġk alman max Rstat ĠThe me Ġmat file iv ens Ġnum Cols ump s ĠE CG ĠE urope =" -", ĠB Day ĠW il ĠW ait Ġso ck Ġtrain ll Ġmatplotlib rc pos ing pos als no ising 75 1 19 00 78 2 metric al :: ). Ġ7 20 main loop IT EM SE M ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ dt f xy gen total wgt ĠIndex OpsLike UN IX Ġdocument ing Ġdocument class AD Q Ġens uring Fa ces Ġ16 00 Ġpick ing IG C Ġjoin ing Function Doc Ġproject ing 54 1626 sf u Spec Rec NE V Ġnest erov ĠSparse Dtype Ġsection author Ġcent erer Trans formed Ad min Ġgr anted Ġsimp licity PRE C illi second semb ler Sha dow spl ice dup l Ġray s spa ced spa wn ĠNull Formatter Ġconstit utive Ġê ° !!!!!!!! !!!!!!!! 428 131 âĶĢâĶĢ âĶĢâĶĢ oni verse IGNORE CASE ĠJavaML Readable ĠSkew ed gou raud Ġasymptot ic ĠCRE ATE gammain c ĠSER VICES 3264 541626 ĠInstanti ate LIBR ARY ç¨ ĭ 172549 02422 8470588 3264541626 17254902422 428131 * ", B i B ands C ET E mbed S ex T or V C ] >= c array f ati o ber s alt v ls w ine å ŀ me sg he mer Ġn sample Ġp cov Ġs he Ġin corpor la ma Ġm ul Ġm ong Ġm imic Ġ1 76 ol im )) ])) (' $\ Ġg ut Ġex pt type code pre comp '] ** (" ( ĠR H Ġv on Ġk t atu ses ĠM x po oled app ro ir f Ġstr ange ĠE stonia append able che me Ġtime zones Ġmax Rstat Re moving ĠY u ĠH o Ġno set Ġ(' - Ġfit ter IN CT 14 24 be ads sp ont 03 02 run Test freq dist back slash 09 2 ID DEN sk l Ġsum mar 37 184 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ fer mi 08 235294 gener ating link code FI RST 29 0196 power Curve long table yn chronous Transform To Ġyear first CO MPLE ĠIN NER Ġdir names ĠInt elligent ĠDo ing Ġ'{ " Ġmultip lying ee e eig valsh Ġtab ulate ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Ġinvert ible yo ung Ġpg mpy general ized Ġincrement ally SPE ED IF EST contact s follow ing edi TaskID ExtraTree Classifier ĠJavaML Writable 33720368547 75 . # 5 25 : ^ R q T V W ing [ (" b ash f uck k lv l anguages n oc s j s po t values w minkowski x gb y lims | % } = å » Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ at ts Ġt alk ar Xiv an key Ġf oc Ġp list Ġp nacl co in co ustic Ġb h ic c Ġw ks un tain el m () ") Ġis finite Ġ" """ A ctions A rc C ard C hoo H ierarchical M aps N IR P xy W AVE c ate m ng m other n fev y P à ¥ æ º in er er tz de ck Ġn type Ġc hess Ġs lip Ġs now Ġo as Ġre servoir Ġb cbio Ġw inner Ġ1 39 is MaskedArray as numpy ĠT i ve p Ġ* / (' ... data Set ĠS pyder Ġco astlines ĠA lice Ġ` [- Ġval name Ġme ets Ġv n ĠN ested ĠG r oc p mb utton ĠW LS Ġz o 05 47 tra p Ġpy cbc ĠU i Ġsub j ie ve ĠK L ĠK rylov ak en Index es ĠV h 94 2 06 2745 34 25 ĠQ LineEdit vide os sol pos Ġtrans l De coding Ġoptim izing sin us 47 0 Res p sha p root dir Ġoffset box Ġman ifest hs d 89 1 Ġiss pmatrix CO IL Ġtag ged Ġmp math Ġrece ives integr ated ĠMA IN Current Alt hyper plane Ġobserved LC Ġcli ents Segment ation Ġoa uth Char acter 404 4 LassoLars IC Boolean Field DOWN LOAD ĠOrig in reat ment Ġresist ance occup ation choo ser tukey lambda Ġbright ness Ġiir filter Ġcompens ate Ear ly diver gent lefto uter DETA IL Ġcontamin ated 0 66 0 94117 F ancy J OR P Poly S olve b st b ell c ame d itional e go g cs i get r table s logdet t el t res v la in page Ġe quivalence Ġre quiring Ġb artlett ur day Ġ1 86 Ġ1 82 un matched ĠT argets Ġr n Ġ2 34 Ġ* [ ĠS klearn arg parser ĠA stro pre conditioner ĠF ORM ĠR en Ġval ign Ġ3 500 per r ĠM ACH Ġan imated lib c Ġun ified op ense key map 99 555 Ġ`` __ gor ian ĠO VER Data Provider pos inf Ġsub directories new line ml lib count vectorizer com mutative ĠV CF 96 97 06 25 exp it Ġ, ' ME ANS 98 16 go als EST IN CH ART Ġclose ly entro ids ĠOn line cel ink noise d pick ling Widget Item Ġcat Ids Ġwrit able Ġ25 2 ĠGrid Spec Group Out Dis p Ġnest ing region al SK M QU AL prod uced ĠMult iply ĠFind ing Ġ-------------------------------- ----------- Current Lat sho cks ĠCall back PP ING dv ipng Ġmk df ĠHand les NUM ERIC miner al åŃ £ å¸ ĥ Ġsli de ĠCA USED å° ± ç§ į sea green jan uary ĠTrading Algorithm |||||||| |||||||| sour celink maxplot freq 6488 99555 åŀ ĭ 094117 648899555 094117648899555 206 * (- 3 02 3 666 5 97 6 27 7 2549 8 26 B ars C url E mb L azy P ie b cast b lind g op g ates g stop k stest r matvec s min s mt é ģ re bin er i st ype -- > an chored he artbeat Ġn vars Ġa df Ġd ml Ġre assigned Ġw ent un ty ce fully Ġto c ma f th us ha dtz ch at ad r ad aboost Ġr k rom ise Ġ2 21 Ġg ues get ting label color ul ing ĠP rest pp ler Ġde part ĠR UN ([ ],[ np erseg Ġ3 21 test set ĠD PI 01 02 ĠL D ĠG L ĠB Z lay ton ree k 15 45 Ġinter sections ################################ ########### pr cp use blit av ro 19 47 19 59 // / ĠV T Con nector uc n LE ASE Ġwork load ... | Ġtf m db f CA AG (_ (" DE LETE Ġstate less Ġhigh pass tz name 49 804 field name hed ral Ġmain Window Ġmemory view PL Y aut ocorr Ġgen fromtxt Ġavoid ing Ġsix u ĠPath s circ std circ var TE P host s Ġ"' " ĠSub ject break point (', ')] Ġ---------------- --- Show Modal Ġlight curve ĠTemp oral Spark TestCase Env ironments 349 02 Year End PA IRWISE Ġfac ilit Ġviol ation Renderer Agg wire frame cool warm Ġfav icon ĠRES OURCE RUN NING //////////////// //////////////// ores cence Ġwild card Ġ'+' {: GRA PH Hyper parameter ĠPol and Ins pect recommen d ="-- ", Ġwhit elist ĠCUR RENT Bounding Box opense arch # ( 5 99 5 05 5 92156 6 15 G rad J obs K it O U P seudo S weep b ids b elief g k o lete p det q pt q vals s chool t cp w ing æ Ĵ è ĥ in ame in dep re write ĊĠĠĠĠĠĠĠ ĊĠĠĠ Ġn ds en ers Ġ' ...' Ġm le Ġb ank Ġb elief id b Ġas object Ġto mo ts ys Ġr suffix Ġst mt ime ns (' ==================== par dir up ic Ġbe m ĠX OR col lapse Ġh omog ĠP I ĠP ID ĠP open ĠA u od al im izing Ġcol linear time frame ind uced 10 96 imat h Ġpre ferences ": {" ag ue ag gs ĠB ic sh iny Ġsk l ĊĠ Ċ og rid rent ice add Handler 12 01 most ly not ypes Ġcl oned Ġsub fault Ġha stie Ġtype d grid line qui lt var args rc p reg plot sk ull config dir ac id 37 37 OD U 55 9677 du les ([' # fol ios Ġsim s diff usion 98 975 Date Index ev olution Model Frame Ġtick size poly mul ĠNe eded Ġman aging ~~~~ ~~ Pre pare conf dir fun ct CO PY 79 31 status bar Ġwho les Ġag ents ================================================================ === deg C fp ga 52 15686 Ġte ams }} $ Ġgr izli ropri ate bc am Ġcmd class ĠBe gin 800 699 252 321 Ġhess Prod ĠEd ition 259 252321 ĠSort ed Ġproced ures ("/ ") 305 2 Ġsuggest ions Tag Name Coordin ator Ġ#-- > atern ion AdaBoost Regressor ĠIM AGE ĠPri vate correspon d Ġperiodsper year Ġstron ger 2508 259252321 ĠFEAT URES åĪĿå§ĭ åĮĸ 0123456 789 CheckModelResults Mixin ĠMACH INE 559677 124 5215686 559677124 ) _ ) &( , ], > | A VER F MT I gnore M ale N ii N avigationToolbar T INGS ] ". b idden k th l us m stats n it p list } + } '), ° ĥ ar rival an ies Ġi z Ġc u es caped Ġin sensitive Ġd mat ut a Ġm ad ge mm Ġw ins un pickled ort s val ences di ss Ġ" ; Ġ" ). ), - Ġg ro ĊĊ Ċĉ get boolean Ġh und pp ol im balanced Ġtest data (" = arn ess ĠF ake Ġv lines ĠL IB 10 27 ĠRe lease sc ientific ĠB al Re moved Re quires 32 32 Ġmin pos Ġz oo Ġlog log sed ml 80 95 88 63 ml r 19 74 Ġ8 000 Ġarg partition 03 66 trans Scale Ġdis continuity 86 27 ST OCK sk ill De gree Ġsee ded OT HER ĠUn comment 28 901 Plot Base Res olver +' - Ġcons iders ĠGet ting Ġ'/ ') Ġ'# ' fun neled ĠPre definedSplit pk m Search Func ident ifiers ĠPy Tables cum min Ġfft n Ġpol it ĠFa ces unpack er Ġcc ds Ġmx net bio me ado op åı¯ 以 stim ulus SER VER ĠRE F Ġpers pective Ġnews group detect ed Ġflu ent ĠUnicode DecodeError Long Type ĠExcel File Undefined MetricWarning æĺ¯ åIJ¦ ĠLong itude Ġem cee Sur vival Ġheld out Ġcycl er Big Query DOC UMENT melt ing Radi obutton Ġmonkey patch Arch ive OutOf RangeError MIS SING Che byshev æŁ ¥ 620 800699 Ġheav ily èģ Ķ 绣 计 620800699 2352 ) +'\ . %( / >`_ 3 16 7 46 9 02 C ast F lat G MT N R S IN U MP U DA ] "] g q m ics x name ¸ ° Ġ !!! in ception st oc Ġi err Ġp upil it off Ġin gest Ġb ill lt able Ġ1 33 el come 00 44 ad v set Parse Ġ""" ), data array par row label pad ĠP age '] < to ordinal Ġde li Ġk o Ġon sets ĠM er ib m In h Ġen ded Ġen richment Ġle verage Ġclass if ĠW s Ġmax es 12 79 lif ication Ġpy en ]] = ĠK ern sq la 78 53 ĠV ene Ġpath way 04 40 Ġstart prob 02 3529412 loss ary 97 254902124404907 Ġnon zeros Ġq k Ġgroup ings tx ns UT ES play ers Ġacc idents EN IX SI I 26 105 draw parallels 67 0 period ogram ry pted Ġsha p char map Ġface ts 74 33 fast CopyAndTranspose global attributes An chored ĠName d Sub classed yp ants }$ ", Ġtool kit eigen value Ġgeo json Ġ-------------------------------- -------------- INT AIN Ġgh mm 224 888 07843 1375 Ġ'{} _ 0909 3666 Ġste ep æĪ ĸ Ġlas io 887 0544 ('{} : POS ITION PLS SVD Atom ic Ġ+----+ ------+ PERI OD ĠInit iative ĠTP OT Visible DeprecationWarning е Ð ĠLeaveOne Out ĠLeaveOne LabelOut Ġweak ref currentIndex Changed ExtraTrees Regressor ?, ?, smart ypants WW TP downsample d 7843137383460 9985 Ġatmos phere Ġaud it Ġintu itive Ġemphas is harv ard ĠEP SILON 3247 26105 ĠPARAME TERS 290196 09093666 ĠPrest o 592156 8870544 ('==================== ') setParse Action 023529412 224888 078431375 324726105 29019609093666 077 5921568870544 4336 023529412224888 802 ' +' + ',' 7 20 A z C osine D V F ac G i H essian L iteral P SA T ED \ _ c box e uclid g ar h freq k pt r igh or a on tour Ġf size Ġp ager ra da Ġb enefit ed ited 00 52 Ġnp lots Ġy labels nt icks pt ype py c py tables ĠI V ĠI d ĠP rentice Ġcon str Ġde limited np ix ĠD OS min p bo ots ĠE R ĠE ffect =" {} sh util sh utdown 12 16 tric ontour Ġhe li Ġest ress Ġ\ [ ĠY test Ġj ulian ĠH ilbert Ġlog prior pos ures Ġsub type Ġhas n ĠK olmogorov Ġiter keys arr ative Con cept IT IES exp ansion spec show 92 13207 step filled 87 20 87 60 offset box draw n ĠPer u number ing Ġpair ing Ġca using SD CAOptimizer ĠUn ivariateSpline ĠPro tein diag nostic mi jo zip File Ġcomple ter Ġconf used tag ger Ġadjust s least sq fl igner ĠCh rom Ġrect props ĠInt elligence Com ma Ġsep al Ġsur rounding ĠHe ader Ġtool z Ca pacity typ ically Ġeig vec TF R Mag icMock ĠABC DataFrame ĠConstruct s Fixed Locator 347 9213207 ki lo Ġlf ile calcul ating Ġdens ify ĠAnal ytics Ġpointer s Ġattrib s ĠDecimal Type ĠDoes n La place Ġlex ers augment ation ĠScalar Formatter ĠDa ily manage d CHECK ING Repe at ó n Ġmime type ĠSu ite Holiday Calendar 4044 3479213207 2 159 4 65 5 95 7 06 ; "> A OD F UNC G LS J apan P Value R at e value f le f izz k ins l xml l dots p nts s om x names Ï ī Ġ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ in jection in versed ar sen de mean Ġn di Ġc ust Ġc names mp math ion al ro bert Ġd uty Ġ' ] Ġ' :', Ġre current ge e Ġb ernoulli ur st Ġ( {} Ġ1 55 Ġis inf Ġ" ..." ], :] set Params Ġ: ])) Ġr ise ') ]. ĠS ens qual ifier ĠP DB ow s ĠA ns Ġme rely time points min iters Ġk fold Ġal gebra ĠL C Ġl x red it ĠG rouped ĠG ibbs ---------------- -------- ĠB ottom Ġdist n Ġos p attr dict 88 13 cor ing gs n sp lines 04 95 17 29 85 55 ref count temp o ST EM reg ul Se a Ġany where ash er Ġdifferent iation Ġcalcul ator draw meridians Ġconvert ible 43 921568 ĠPer centile Array Formatter Estimator Spec Lo ser 235 29 Scal es ION S Mat rices comb os agg lo insert ion ert ility Temp lates Ġear liest square form Bo otstrap Ġbig gie Month ly ric hed Ġair foil Ġhost name Ġreject s ĠFormat StrFormatter Ġhard coded ĠIncre ment Ġok ay Ġpkg util ĠDimension s ĠNode s Trace back ĠPO ST rig id ĠCA ST Ġcontribution s Ġcontact s ç½ ij whit ener whit ney METH OD Ġpropag ated stm ts ĠInst all Ġconcentr ations ĠBern stein GradientDescent Optimizer éľ Ģ ĠSTI X 98975 3723 43921568 989753723 ( < 4 92 8 98 B rain B old E voked H ouse M W P AD Q ComboBox T om V ict d H f unds g od g pl g uesses k ng m illiseconds n threads s rf w inds ¦ ¬ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ de letion Ġf list Ġa ster en go en coders Ġin fs Ġ' ` Ġe y Ġre vert as p as gd Ġ" > Ġy l Ġy md Ġy ticklabels ch t ve mber rom s ex pl con firm Ġh omo ĠA AAAAAAAA ĠC T ĠN ET bo ols mo dif ir y Ġma pred sc p (( . log data axis bg [:, :- add Items Ġit alic old ing read ings ng l new dtype ER T ĠK nown ĠEx iting sp ent sv ds prob ably trans lated temp A ĠJ osef center line Ġopen fisca Ġed ition play out ĠDe code ĠComp osite ING E Ġinterpol ant Out er ĠLog Norm 69 64 Ġdon or Ġaut hentication OO SE Ġwave lets ĠCh anges An ns Ġvisual ized cg i Act ivity ĠEn semble Ġput ting internal s Ġexpand er Work s Ġut m cached Renderer ################################################ ## Auto matic ĠOpen Search conversion s war ped ĠLat itude interest ing Ġ+---+ ------+ 33333333 3333 Ġclassify ing Calcul ator Expr Node ĠMathemat ics cccccccc cccccccc ĠND Frame ĠFreq Group VARI ABLE junction s ĠâĢ ĺ ĠUtil ities Ġdissim ilarity ĠDISC LAIMED Ġtypo graphically ĠWav enumber uby te PHO ENIX Ġwholes ale 4 13 5 33 6 35 B EN D avid F etch H older H alo O A P BE T au T CP b ubble e po f riendly i ucn j ars k nowledge l mplot m ia o logical s mo t unnel x values y d y edges ç Ł č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġt ts de clar me re Ġc cd Ġc pus Ġf arthest Ġa podi Ġp ho Ġs vals Ġs ays ct cf ro les Ġin active as n ĠT oo Ġ""" [ pt ive ri en ", "") ĠX W con volved ĠP C ĠC ore (" : ff its bo re ĠL ess fig text Ġare st Ġma il ĠRe verse op ener Ġcomp artment Ġmax abs 12 48 Ġpd ml ĠIn correct Ġpy tables Ġsub title 88 22 "] }, Ġro ach Ġcur rents 19 50 '. " Ġbin width 04 4447 03 92156 Ġcont exts ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ mod ulation dt m oo oo 65 4556 Ġacc ur 23 9215686917304 Ġinitial ise TI MES 42 88 Ġhelp ers 43 138 ev olved 49 20 find font Ġarr s Ġevalu ator DI FF Ġobserv able Pre definedSplit :, :] Ch an TS NE 51 35 Ġsw iss Ġsym link fl g contain ers ĠMax NLocator Bin arize sl it indic ation Ġvisual izer With T ĠQu antopian Trans late Ġtp ot Ġclip board Ġdag s ĠEst imators ĠTable Format ĠTensor Product ĠCor rection 996 08 fir des ĠImp licit Port folio clim ate UST OM 236 3052 ĠBar Data Ġcompar ator Ġmanip ulation electric ity ĠGen ome Ġblen ding Ġclamp ing butter fly Graphics Test Past el å½ ĵ ĠRect angular HTTP Error ĠtestTrain With ĠConf usion getsize of ĠSmart yP 8766 2363052 æº IJ INTAIN ER 044447 654556 0392156 87662363052 239215686917304 99 ĠSmartyP ants 044447654556 28 # % . } . ]])) / ? 4 10 : = D ens H G Q Size S quares S IDE a pt e la i vers j seq k aggle n ltk n urbs p and q ty t idx u ana v igra Ġt sv de limited me ch Ġi loc he alth Ġp data ra ses Ġo verest co bra Ġb rown Ġw dg ig rams Ġ( ', li de Ġ[ (- ĠT witter Ġy z Ġ2 11 ck ling (' ` ke pler ri den =' ?', ĠX a con form Ġtest LogisticRegression ĠR ag Ġlo ts ta pp Ġk size ĠL azy pa ren Ġl bin shape ly oc ur Ġun pickle Ġen forced ĠW al num zbin Ġper ceptron ĠH art ĠH ouse Ġlog loss tra iling 80 25 14 63 Class Doc prob abilistic 96 35 trans l Ġend Time AN ALYSIS var list Ġsp dict 07 0 Se g 87 94 ĠAr my Ġbu dget pandas SQL day first mag netic Ġab sence NA V Ġhere by 68 984 Al so Inter action ĠLinear SVR ĠTo po 63 15 Ġparent heses comple vel OO O Ġli ves CS S pri m ĠTh ings ĠSub tract alk o ĠSphinx DocString sn ippet Ġsyn th ĠFormat ter Bbox Base ĠIncre asing BO UND Ġwait ing solution s Single ton ĠMultiTask LassoCV pinv h ĠCha pter Ġaccel eration Ġdri ve Ġorbit al Zip line Sd ca Ġxl platform 8284 43138 Ġpsy copg inforce ment Deriv ed ĠSty ler å» º 68984 828443138 4 64 B ell B ranch B alance D uplic G OOG I so S Z S ingular Z s a qu d ms e plit l ds m res p mag p seud x bound à ĩ Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ atexit re build re venue Ġt orsion Ġn freqs Ġs params Ġin accurate la ve Ġm tri Ġb v Ġb roker ve ctest Ġ2 35 Ġbe at ĠX H con g ĠP DP ĠP areto ent ropies Ġtest Iris Ġde clar list store test file ust ral Ġres o ĠD A ĠD S min ima ĠN IPS ĠB ET ĠB roken ib ilities ĠW ater map name Re cs Ġline colors Ġdist ort Ġ[] )) tra vis Ġno inspection Ġspec ifier 78 265 St ress Ġsp ins ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ 34 34 97 75 sk el 84 0 65 57 Ġtrans port Ġtra cer Ġoff line Ġ(" \ De cay AG ING ĠSt udy ĠAl locate DF T ĠPro duce Ġren derers Ġ"" ). Ġmer idians Ġcombin es Ġsw apping CC G Add Spacer Cal ib Ġinf lu WH ICH EE K ĠFigureCanvas Wx Ġexc itation Hand book Mask edRecords ĠForest s ---------- âĶ Ġelect rodes elect rodes Ġfl uct Mag netic edit ing mol ar Ġ195 9 Ab init 032 7 ĠLoc ator 757 9505 Ġ84 7579505 mor let Ġleg line FigureCanvas Agg ][: ], jin ja lig and Dot Warning ĠMicro soft Repe ated #~#~ #~#~ Vir tual reli able YG ON ĠâĶ Ĥ ĠResidual s ĠFancy Arrow ĠMathText Parser ZOO M STY LE ĠPOL YGON BLAS DotWarning gramm ar iucn redlist eplit z ) ": 6 85 8 24 8 18 J ust N CV X g X ml f lap h orizon m ga p alettes  £ at tle or ry Ġt ws al gebra Ġc logger ig er ', [ 00 49 () == tr c tr ange ha d ha zard res olver Ġr mt Ġst a (' ================== Ġg q Ġg w Ġg abor __ ==" Ġassert ions ĠS in =' :') all data ĠI mplements pre trained list ener 01 63 pro portions ho u Ġtr m Ġ4 70 ip pets Ġfe c Ġmodel dir ()) ). ca ve Ġcheck dep Ġplot type 25 15 ll s ĠH ermite pla stic split ting ]] ))) AT TR Ġ| -- Ġkey board pol ator den is 03 97 ])) * the tar 09 0196 do ub Ġreg arded sg n Ġconfig s Ġtuple ize point list Ġob vious 98 75 Ġca ches Log Locator Ġentry stop Ġsepar ators tag ging 199 1 Bu ckets .... .. ĠFe ed 62 95 ('- ')[ Ġ-------------------------------- ------------ MAT CH Ġenvironment al ĠURL Error Rest ore sat ellites dash board ĠProb abilities Ġhess p Ġ{: > Bl ur Tri m Ġactiv ated Form ula ĠCa pex TIC K Ġion ization Ġsufficient ly VID E Evalu ates Ġtrip les Upd ated Raster Band Mid dle lane ts chromosome s Ġxls x flower blue ĠUns upported SCRIP TS Soft max CAG AA Dele gate Ġcoup ling æĸĩ 件 HINT ING sff amily 5 50 6 24 7 43 B tn B roken C ash P AGE P otential S QUARED W rote ] // _ )), _ *. c ers f H g pe g uest w ins x tra y out y pos č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ar mijo le on me c Ġp nt Ġp unct Ġo id Ġ' ../../../ ge les Ġb db Ġ1 81 un changed li me Ġto oth Ġr type Ġr solve Ġr matvec Ġ2 44 Ġ2 42 mat plot ') + (' :', nt f ĊĊ ĊĊĊĠĠĠ ke v ĠS ig ĠS aving ĠS tage Ġco sh ri els im num to ggled ĠR ED ). ' path lib Ġon click te acher ps ds Ġne v age preg comp utes Ġpre g train ll Ġun available `` - ĠTrue Type Ġmax Iter ĠO uter Ġver ification Ġnew y Ġlog cdf ĠU IM pr m ĠSe mi 16 01 show warning Ġapp info den dro zero ed Ġiter ates 96 077 24 82 IT ICAL ass calar Ġsum mer 37 45 mt d gn oring RE L ĠZ MQ Ġdifferent iate ĠSt im 43 1617 mag SpecRec ev d Ġfont type sha ding mi ke Ġ15 9 Ġold counts luster Mixin Ġregular ize Ġpack ets pk t Fit ness )** (- HE AL Ġdat arow mis placed Ġsafe Eval Th an Ġgrad W Ġta ils contin uum ĠApp lies Ġ40 96 58 13 ('/ ')[ Ġir regular Ġmock ed #---------------------------------------------------------------------------- --- dep ending Ġaspect s Predict ing ĠGraph s 15686 275 Ġknow s ĠDes c ĠFIT PACK bre wer ARG E UD Y icon tour 375 977 450980 6185 027 4509806185 135 375977 Ve cs Ob served ĠOP part explo sion Ġmaxim izing Ġyiel ded Ġipy widgets Ġblen ded ĠScal a Cap ital ĠMolecule Graph Ġpearson r ibe is 0198 135375977 ĠUserDefined Function Ġdesp ite desk top 6549 0198135375977 Vict ims Sdca Optimizer ('================== ') 0274509806185 96077 ' /' ) { * | . :: C u D ENSE P ars Q GridLayout R K T ravel T ake d od d omin f asion j ack p atsy r key t own ç ¼ Ń ç» in size er ied Ġn il Ġf letcher Ġp type Ġp us Ġp wd ro uting Ġd di Ġd mag Ġm ant Ġe df co lored ur ges Ġ1 88 un seen di et di rec ĠT S Ġr gr Ġr pca Ġr fftn mat ology lin ename ri e Ġx slice ĠX m Ġcon sum Ġcon current os ph im u to mato Ġtest SdcaOptimizer ĠF all ĠD f pl x Ġtr icontour sh ards Ġun masked In vert In clude 12 06 Re maining Ġz onal no ifam 16 89 Ġapp liances ĠEx clude Ġparameter ization Ġnon linearity IC ON math jax Ġconfig parser Ġpoly add EN TI Str ip \\ ) xy coords link ed ĠStr ict Ġge odesic annot s Ġ'% ( Ġmain loop 48 1 48 05 56 2 desc ending Get RasterBand PE AK Ġser ie band stop correct ness ibr aries Min us RA P az io Ġour selves Grid s cube helix Ġautomat ed ĠInt ensity Com bine Ġli ft ĠFunction Transformer ĠCON NECTION Ġcy an ĠOut lier dep loy exc itation ĠTrans fer mes hes Bo keh Current ly Ġti po mv t Ġsynt hesis Ġdivide nd Ġhel lo Ġpur ple Rd YlBu Ġlongitude s Ġcar ried raster ization Std Temp ĠCL ASS quick start Ġsuc ceeded Sym Py Su ffix ĠCat alog åŃĺ 款 Ġcas cade dor ff Ġaest hetics ĠSelector Mixin linears vc 702 431617 adro zny 78265 702431617 ' # 4 99 7 19 7 94 A uc E Q H ad I mag O W Q Table V ocabulary ] '). b day c itation c nga d base d ics f uzzy m iter p henolist u ption u code x corr y on z ue Ġ lyr re cover Ġt es st ill he im Ġn ts Ġa str Ġs gn Ġd ise Ġm dot ge lin Ġw ider lt ips Ġ1 45 is fied id im turn s Ġy val ve ys end points Ġh ankel ĠI mages pre ce ĠC AL (" .. ĠF R Ġval ley time tuple ta kes ĠN f Ġl sim op f log likelihood Ġen gines Ġcomp any ĠW ild Ġmax dict ep pe Data Adapter Ġsh ip Ġj avascript Ġpy brain ĠU ntil dd t Ġsub tree ie ved ie mann ER esults AT R av gs )] = 94 97 17 00 85 84 Ġbase dir 24 71 Ġscal ability 92 33 84 84 Ġq p cm ds 87 45 RE TUR 55 3 Ġgraph ic make DateIndex Ne ural div mod xlim its Ġimg Ids Ġafter wards Ġlimit ing factor plot Ġmy obj tag ged Timestamp Type Ġ\\ [ Dis position ĠPo sterior Add itive cum count Of Month super cell ny c From File RES OURCE Ġmodify ing (', ')[ Ġdivide nds Ġ---------------- ------ cret izer Oper ations Ġ================= ==== å¤ ĸ Ġdele ting Ġsyn chronous Ġlst q saved ir Ġperson nel Lin ux Ġbra ck wide hat ĠHam ilton Ġche mpot ĠProvide d Sha pes nov ation front end NET WORK 945 221 ĠSelectF dr Ġqual ifiers Ġoccup ation 064 945221 ãģĪãģĪãģĪãģĪ ãģĪãģĪ Ġexpl oring Flu xes Place ment Perm ute trust worthiness Ġcoer ced thar poon enen haus 8980 4309 ĠGTF S èĥ ½ ĠBic lusterMixin 15686275 064945221 , # 4 12 6 98 8 28 A FF C UM D N E t F ULL K IND M g M h M aster M ilitary V arying X inv ] }} e id l bf n D s pi v iterbi ¸ ë ½ æķ° æ ² é Ĵ at iveness Ġ= [ al py an umer Ġa go Ġp ing mp c Ġd bs Ġb omb ur is as serts ha milton res pective ch g Ġr ss Ġst l Ġst ime il vl data collector ĠS aves ĠS OS Ġor ph ĠP E Ġcon ns pre sto '] )). Ġtest Loss Ġde scriptive ĠR ay ĠR oll 01 59 ĠN c ĠN r ĠN IST str al df d ĠM ETH Ġan neal der ot po bj app ended learn ers ĠG ol ari o Ġname mapper ĠE NG Ġun scaled Ġ5 50 ĠW rong Data Stream 25 25 ĠH ann ang strom base x Ġ{} ; Ġexp onents Ġscore atpercentile cond uct main s temp B man ence ST AR ST OR ĠJ apan 84 65 Ġq a pack bits 65 65 tf m 87 2 Ġtra il EN TS 77 9 auto matically Base KFold Ġsm ry make up \\ \\ Ne igh png math Ġsuper set ĠUn ivariate EL INE 29 75 39 36 Ġoper ates MA JOR Lo ads Ġwrite able nc pus Ġheader row 57 9 this x Ġmy file Ġdiag nostics PL AY prefix es ĠTo ols ĠIN TEGER Axes Subplot æķ ´ nr ns win reg Spec ification pc wg ĠRes ample bb b Iter ate Ġ19 86 track ed Ġcent res 91 33 ĠBu ilds Ġ"' % ĠEn coding between x between rows Ġcounter clockwise Ġreason ably bn learn Ġsubplots pec Ġut ili Fixed LenFeature Geo Series Ġvol atility WE EN aug ustus è¯ · FR INGE Ġdash board FigureCanvas GTK lazy attr ĠExcel Writer Ġspl rep Ġmaterial ized Ġimb alanced Math Text Metadata Column Ġode int Colorbar Base Moment um ĠUns upervised ['/ '. whis kers #------------------------------------------------ ------------ Ġextre mes aly st ĠBen jamin setStyle Sheet ithuan ia Ġrmt ree eppe lin # . ) '], 5 24 8 6400 9 33 9 66 : ][ B a H W H ide I QR M UL N ov P LE P ID T olerance X trans X Axis d id d loss g ust j dbc s peaker v ary w es y V | " Ã Ĺ æ ° Ġ )), se lections st ub an imate Ġc lobber Ġp layers Ġp stress en cap lo ud Ġthe ore Ġm init Ġe wa Ġb ow ic ian lt l Ġ1 66 un sampled ol ina Ġ[ \ di lation ĠS MS Ġco ok all icity ul atory ĠP s pp o im name Ġde noising arn aud ĠF our Ġax t ĠD IST ĠL and ĠM arg app ropriate Ġnum bins Ġma vlink =" + train Data Ġun install axis lines Ġlist names [:, :] 12 65 25 01 Ġmin ing Ġpa cf Ġnew descr =[ (" join path Ġpy l 20 21 Ġsub license AT TRIBUTES grid x 14 118 be ams write Object 24 24 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġnormal ise 92 45 Se quential Ġcode c Ġav iation File Mixin 26 17 De m font map Ġnoise Level local time MA IN ctest s ={ : gt ab ĠMulti plic ious ly Ġadjust ing Dir s Key board rb racket .* ", lb racket air s mal es ij s Doc umenter mun ge CG G Ġperm uted Trans fer bi om PRO J TO M gl orot Ġmd c ula cao Ġcap lines Ġagg lomeration ('. ')) Pos itive Over all Ġì Ŀ Ġwhiten ed nor mplot wav read Tr igger polar ity WE IGHTS tim ers ĠUS AGE chk finite ĠStep Selector Ġactiv ities ?? ? Learn er ĠLay ton Pair wise Fill Value ĠMa jor ĠAir y individual s 847 06 Ġdecomp ositions ________________________________ ________ Ġoh lc /\/\/\/\ /\/\/\/\ prefer red Sens itivity suc ceed ĠWui Main Ġcentr ality mbu ilder mng r robert layton ' "): - , 3 98 5 85 6 97 8 6401 C ART E miss E MBEDDING H L H II L s L ater M pl P areto S ky T x _ =' c ad d op g tol m ticker n id q k r index s anitize w int w art in complete re x le le de json Ġc itation Ġs ap ing ly Ġw ager el le def lation Ġis EPS ], - qu bits Ġy rot res caled lin ical ĠS AVE ri sto Ġor acle ist ed am os pp i ĠA z ĠA ge Ġcon currently (" ../../ Ġk z assert Tuple us sed ---------------- ----+ ĠRe presentation In fluence Ġle xico Ġtime string ant ic Ġmax inconsts sum stats Ġmin p ĠIn dependence ĠIn compatible Ġj ll tra cing tra js Ġpy urdme pr incipal Ġ(' < IN FRINGE 66 03 Ġover riden 85 35 na ire Ġdis criminative ĉĉ Ċĉ ST ARS reg ime Ġsome one 44 1 mbed ded Ġcontin uity Ġdec ib Ne utral sim ultaneous Ġca pac 60 32 this Meth Ġdiag rams Ġpr inciple Ġjoin s insert Item PO OL fl ank wx agg Sub Plot sep al states pace hel vetica čĊĠĠĠĠ čĊĠĠĠĠčĊĠĠĠ ]} ], ĠIter ative orch id Ġdivide s Ġgra cefully ĠTensor Board Save FileName ĠWith out Ġnone mpty Ġedit ing ĠFloat Type å¼ ķ Null Locator PH I è¿ Ķ Tick er accel eration ĠCar uana fla kes ament als 产 ä¸ļ GORITH M sem ibold Ġclock wise ĠChannel s consolid ated student ized Ġargsort s ĠVariance Threshold ĠVert ical Ġoccup ancy cas cade ĠPop ulation ĠPhys ics ĠAirflow Exception 9767 64 ĠEqual s Ġghost script Artifact s rfloor div ĠisEPS F assertTuple Equal INFRINGE MENT * /* - "+ 1 333333 5 6471 8 0000 9 25 B rad B Day C li C UT K D K alman M p O ST Q HBoxLayout V p b ast d cam g se h Pa h Ns m dx n pars o on p ulses s pr x rf x margin y v Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ st re de tailed Ġn id Ġc ert Ġf ob Ġin k pe re Ġe z Ġw est um ar as semble id ade set Default Ġ2 47 (' ;') nt hetic up cast Ġex e for um ĠX J ĠX k ĠP ret fe val ĠC li Ġtest Estimator ĠF actors Ġval init ust ache ĠD ie out File ĠN As ĠL SM ĠM ul Ġl z ĠG LS Ġma pe comp t ĠB ode Ġ5 00000 Ġthis x log dir Ġint elligence sub stitution Ġmin eral Ġfig text Ġla z 20 784313 ĠK an 75 69 04 46 95 354 Ġover fit of score 27 1 ref lection IT RAN back refs sy ste call ers ap or Ġqu eried ST UDY Ġlin pred 97 003 ĠQ HBoxLayout 84 7931 Ġpoint ed 90 32 08 0505 wh y Ġpred icates SC ORE Al go Ġfix ing power limits Ġdiag nostic Ġbar o '} . aut ore ĠPre dictions CO UPLE ]+ )\ ĠDE AL Ġsens ing gl ng ĠOutput CodeClassifier excel df serial izable Ġer ow ĠUser s Ġattemp ting ĠLars CV Ġintro spect Factor Analysis meg as Pass ive Ġche by Ġ================================================= === nov ativeness life time Ġsal vus Ġsli ders spe ech IV Curve fis hes INF ER Sm irnov Visual ization ExtraTrees Classifier Ġcard inality 01298904 42 Ġquart ile indust riels 402 8720 3137255 0129890442 Sched uler Ġdamp ing AUT O Ġsymp ify 00100 01 ĠIde ally ĠCLA IM Dire ctories Choo ser Ġaccur ately 090196 080505 976764 679 1333333 4028720 20784313 976764679 090196080505 847931 13333334028720 856 8 14 B unch D lg F ollow I mplements K T P latform P etal R x S el V B Y Axis Z ERO \ ', c rystal f ridge o ma p key s oc z N } & } )] Ġ ############## re act or f ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ he y Ġf liers Ġf orth Ġs dist Ġs orn Ġd A Ġd an Ġm stats Ġm igration Ġe qui Ġe af Ġre calculate ): ' Ġb ilinear Ġ1 85 un able un safe )) *( ĠT y tr g ad f Ġst ype nt imes ĠS L ri o =' {} con es ĠD uration Ġnum bered ĠE MBEDDING =" %( ĠB F Ġun directed Ġ5 02 ĠW ell Ġpo steriors 11 00 Ġj it ĠH alf Ġoutput file pos i output Dir new shape ĠData sets 75 75 nan cy oth ing ian ts 04 00 ĠTest DataFrame 85 14 sy nonyms 18 90 work load Ġnode box man ip Se quences Ġinstance method ĠZ ou mult itask ĠAl ign Ġcorrespon dence Ġ'. ': 39 1 MA INTAINER SC ORES Ġ15 000 DI SK mf dataset char set Ġurl parse OP TION Grid Interpolator Up load simple String ,- . Ġna Upper Sub scriber Config urable ĠRes cale Create Layer Ġ[]) ], ĠDB API Ġ---------------- -- Ġ---------------- -------- arc cosh ĠSphinx ClassDoc 800 54 ĠDraw s Oper ators Initial izing ono py Ġconsistent ly GC AT å¤ į abo la Ġnotebook app rms d Spark Context ĠWork ing Ġ197 0 ĠShow s FIG URE è® Ńç» AGG CAGAA Clo sed AAAA FF Ġhappen ed pher al ĠBack ground ĠMeta Data Ġlic ensed Ġthumb nails Ġbio mass ĠIdent ification Ġprecise ly /{} / GAG C MultiTask Lasso bright ness pay ment VARI ANCE confi dent ĠLag range èĢ ħ ĠWhite Kernel Ġcalib rate arad ar icken berg ãĥ³ ãĥ ĠAAAAAAAAA A __==" __ ĠPret ty ĠDEAL INGS è®Ńç» ĥ ) ! - = 7 66 8 00000 A mazon C ELL D URATION F ACE G r R anges S ORT T rend d V e vecs g ind j w j sc k Hz p form q f r onic u ke æ ĥ æ ı è °ĥ Ġ ult Ġ ĊĠĠĠĠĠĠ Ġ !!!! re produc an imated Ġn peaks Ġc ortex Ġs om mp os en ance ro bjects lo bjects Ġo db Ġd range Ġd tf Ġm ort Ġ# - li ant )) [: Ġas ynchronous () }, Ġdef init Ġg uid ex ps ex ceed ab isch Ġx arr col width ĠA cademic ĠC utoff ĠR Vs ĠL aw max ent max well Ġpro gramming ################ ########### ĠM ars ---------------- ------+ ĠRe moves ĠE LST low ess ĠB it Ġcomp licated ĠW oo ĠW olf 12 31 ĠO pp result ing ca ss sub dag Ġver ified inter net Ġch arges Ġdist rict 32 00 ĠIn deed Ġj ar ĠH anning ich r Ġno op 20 44 Ġsub mod 88 36 av o sample Size 35 26 ĠTest Data 18 317 ac ion scal ex db dict 37 2 Ġtra cing RE CTION ĠDe mo ga ze pd p draw able Ġ} ] ĠAl ong )/ (( Ġsave z lem ma scatter ing exec utor Ġreal istic ------------ ---+ Ġchunk ed ĠTo y dec r mut ate spect or FA O GT G ĠSelect FromModel Ġsur rogate dy a pairs Dev Ġ19 84 xt c menu Bar Ġes caped Cre ation Ġconsider ation nest erov rea ched Ġgra vity Ġ---------------- ---- equ ipment Ġlab or card inality Mock DataFrame Hash ing Ġ({ " Ġ197 2 Ġlatitude s Ġ"{} ". SU RO ĠSimilar ly Wave form 328 28 887 49 855 35 Ġjo urnal 765 47 bal u atqz adz SUP Y 847 43 Ġtal ib ĠSup pose èµ · ĠAnnot ation Ġrecommend ations 1843 1 SUR S ĠDot Product ĠSepar ate Ġbymonth day gau ge standardi zed Ġdesi rable glng th $ . ' (\ . **- 4 25 > : D Matrix F is F uture H SV J un M iz N EST S HOW Y X a ero b star e mo i ita j y l mb n data r U s arr t line Ġt ukey er mal Ġi info Ġn temp Ġc ds Ġf usion Ġa im Ġa ctor Ġa grees Ġp ods Ġs queezed ra de ro pping lo th Ġthe or ing est Ġe type co bj Ġre constructions ol i 00 48 one ous set Column ]) == par r Ġex amine ath ers py fits Ġu u Ġde launay ĠF oo 01 68 Ġv comp Ġk angourou ds p pa ger ĠM U Ġl lr fig nums sc ikits Ġfile Path Ġen g Ġtime Unit cs ail ĠO pex ix s ĠPar ametric ĠY ahoo Ġj unction 05 07 Ġlog sf (), ' 66 22 75 92 14 45 with Replacement Ġgiv ens ĠV S radi an 22 73 94 01 Ġcolumns pan ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ Pro c Ġele ms 37 79 87 0 87 09 CA ST pd r Ġcontin uing AB ASE Ġoptim izations Ġallow able ĠComp onents Model ing ene isen diag s Ġclo sure Ġps ds Ġcho se Ġlimit dict Al ready Run time Ġpack b Max s ä¸ ĩ OP TIONS status Bar EX IST Ġrc mod UP LOAD ĠInt roduction CR IM cla de plan ation plan ck Ġsmooth ness Bar Reader Trans f Ġaltern atively wind Speed Ġexpand s multip liers Top ics ĠCor poration ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ĠSupport s Element Tree dash array Custom SVC Custom SVR semb l ãĥ ij ĠPe rez ĠLen a Ġsampler ate protein ase Ġdecrease d æł · spy der ĠPO SCAR ĠJian bo Partition Iterator Append able Ġaccel er coup ling Ġ655 36 ./=\./=\ ./=\./=\ skin care ĠCONST ANTS ĠNON INFRINGEMENT Vers ions Ġ~~~~~~~~~~~~~~~~ ~~~~~~~~ STRE AM * ; 2 784313 7 63 = ([ E FF G old H b N II P AGES Q Color Q CheckBox R ng S AR S paces [ _] b dist d an d mat f xn h icle i ge i pt k ic m st m SASP n ces n axis r ings v it x istent y name Ġc KDTree Ġa ges Ġp ulses Ġin i Ġd um Ġm ur co cluster Ġre con Ġre sets Ġb atched Ġw k Ġw aves Ġ1 74 ss a Ġnp ad qu er th umbs ha il set Check set Geometry ') ", om y Ġg object lin ing Ġh on am an ĠP H ĠP al ĠP aired '] > ĠF co ĠR AN ĠD est ĠD ump Ġlo se ta p out let out comes ĠN subs Ġpro v Ġpro posal ĠM AD ĠM enu ĠG PS Ġma c Ġpre view Ġpre processed ĠE balu jo e ctor ate ĠW E Ġmax lags Ġmax fun port er ()) } sub space sub sampling Ġsub array Ġ@ _ 75 81 grid der ĠEx ercise 35 027 14 285714 AR ROW ule scu Co ok of Diff Ġsy ste Ġdis connected 18 32 34 11764 ĠQ Object 84 3 Me mmap 77 603 ĠDe generate over load event press ĠSt ar 42 353 Ġoptim isation To String Set Value dimension less Ġedge list has hed Fe m 48 93 Ġleast sq Pre v upper case Ġrot ating inc and pass ing 89 32 ([" % åı ª ĠDate Type US AGE :]) ] Ġcomponent wise Ġocc ure Config Parser element wise Ġ19 1 101 7498 Ġaccess ors sto res åĪ ¶ icy cle Current Time Ġchain ing EG IN TRE F 047 058824 structured text ĠMon day Ġmk t Ġlocs cale 45098 1736 Ġthough t So il ĠWindows Error ("[ % 227 450981736 Ġgam mas Link s ĠBack end ĠMix in emb s Debug Classifier ĠSD CAOptimizer Ġà ł ĠSm ith Cut Smart ä¸Ĭ å¸Ĥ ĠNic ulescu Bagging Classifier Ġinject ed ĠOrd inary ĠFurther more ä¾ ĭ 4497 77603 Ġtet ra ABS ofDiff TCCT GAGC 5538 94 8575 553894 ĠTHRESH OLDED EXTEN SION Ġnoset ests 062745 1017498 azio a 80054 85535 Miz il 2784313 8575553894 ĠEbalu azioa 3411764 8005485535 047058824 449777603 227450981736 18317 0627451017498 97003 , ', 0 88 5 28 7 08 A ffinityPropagation B er B iz C AR E CHP F atal G EE G ROUND I AN I ENT M or c vals f dist j im n Train p wd q b v index w fs } `, in cluded ar ms Ġn out Ġn levels lf or Ġp form Ġs sd Ġin dependence Ġo cean Ġm q urn ame set SizePolicy Ġr z Ġr anging ') [: (' ; (' "', Ġg ind ex clusive get SaveFileName ĠS caled Ġx limit pp s fe ction Ġ== > ĠR os ([ ^ ĠD ruid 01 03 cal er Ġv stack ext rap te ams Ġl ng ĠG ET et te Ġun modified ill ust Ġfe asible sub tree 80 24 ]] ]), Ġspec ifiers av iew St reams 22 38 22 354 ian a Co urier var pi 18 27 err Msg 07 91 sg iving UT R Ar ma 37 22 Ġtra ditional last name limit ers Ġ20 8 Ġlast y ([' - 98 80 To pology Ġimp ose lu ger block ed UN ITS Ġreal ization IL ES 117 65 Ġ"" )) Ġxy where Ġident ifies TH U corr uption Ġbar plot Or gan peak ers Ġaut olim Bu f redu ctions Ġyy y Key word )' %( 53 97 Ġwarm up sec ure dy b Feature Hasher Ġ'< ' ĠAR ROW %% ' ĠInitial ise Ġfh d Ġpol l Mo difier Predict or warm up Ġcharacter istics ĠNon BLASDotWarning Ġserial izer equ ities ,:, :], ĠSome Factor ç» Ħ ç» ı 998 15 Freq s å§ Ķ SER V 259 34 ĠSE Q ĠPart icle pho logical ,... ] intersect s LEAR NING Ġmt py Ġforecast s 934 74 ĠMix ing Ġprompt in rist mas CONT ENT BOT TOM ĠDESCR IP ĠCOL UMN 1526 95 Quantile s Ġprecip itation geq rf Ġpromp tout ACTI VE rug i éĿ ¢ appear ance 0075 7907 herm ite 4288 93474 76547 428893474 00757907 152695 6 06 6 3922 D OT E uler F ORE H F L anguage O range V OC V BGMM X IS Z eros b isect f ls g fp n chans o ss q rt t ect t ank w iz y ml z n æ ® in b in ate in ations Ġt urb Ġa pache it rans Ġs fe Ġs pi Ġin val pe ck Ġe cl co d Ġre written Ġ# (' ic i ic ago Ġ[ (), ĠT c set Shortcut ver ified il k lin s =' '). py gtk ĠI maging Ġtest Vars (" {: ĠR itz list Of Ġres ume bo dies ĠL ONG Ġan ten ĠG W Ġset item Ġat mp num sides ĠY YYY ĠH inge Ġ[' -- pr ising dd m Ġfit func IN O ĠK nowledge '' . sample data Ġro idb bar chart cor al Ġiter H Ġiter W 02 95 DataFrame s cat Ids ================================ =============== sy st ME X 37 288 cont exts org ia CA Y =[' _ Ġdec iles Ġtri mming extra polation lag ged lag uerre mov r Ġ15 7 ={ }) Ġpla cing Get Connections long ley Ġskip initialspace '} ). Ġpr ime button press /( ? mid t Ġwell s Ġtoken ized Ġte lescope span ning Ġ19 64 ĠTree Regressor analy tical plan ner IX ED mx dd ĠMo use Ġcategorical s ĠSto pping ĠMA E Acc ent If TI nm r Ġer fc frozen set ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ assertAlmostEqual s Ġpat ients ],' - Ġfid ucial eros ion Ġdiffer ing ĠDep enden allt rue ĠON LY does n spl rep strain s supp lied Ġmaj t enden ts rem um bid i Ġfir win MAN IFEST ĠLeaveP LabelOut %%%%%%%% %%%%%%%% Ġsubstant ially (',' )) Ġautore gressive Nucle us CSA xes Sli ppage whitney u 86401 22354 è¿Ķ åĽŀ 8640122354 1463 ' ') ) ''' / = / ` 0 252 7 24 8 34 A rial E I G u ] ^- a cy c py d P d Z e cl e mer h omog h armonics i olib k stat m ist m ang o z t rough Ġ ue Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in files re y re tail Ġ= === al fa ar ctic me ar Ġi w Ġp lat Ġd ms Ġ' ** Ġb alancing ed ata Ġ( >= is land )) **( 00 51 qu if Ġy g Ġ: ( (' ] lin er ĠS pect ĠS ID ĠS PL ĠS aved ĠS CR ĠS chool Ġco ke Ġco hen ĠX csr Ġor b ist ivity ror s os x test files ") \ ĠL INE ĠL iteral te t ĠM arch Ġnum Rows ore nt Ġresult ant Ġpre proc ĠE VAL train X ĠB r ĠB as ĠB rain ĠB ias axis Id In verted 12 94 12 976 32 16 ĠIn struction Ġj unk ĠH idden Ġlog normal Ġ[' __ Ċĉĉ Ġ base string ĠK D ĠK a show traceback 19 76 86 57 ĉĉ Ċ 09 82 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Pro portion spec ify Ġnon pos ĠQ R 84 60 Ġtra pz 77 1 word count gg g ĠPer mission Ġaf m real s Ġsuper cell Ġmon ocrit Per c Inter pre Ġexist ence All Close 74 02 Int Col dimensional ity ++++ ++ Dist rib 81 75 br ush cope pod direct ives Ġ~ ( Ġ19 85 writ ers cer pt åħ ¨ Ad jacency ("- " under line greed y lg mres IB M Ġpat ched Ġ================= ========= Ġexplo red è® ° Status Bar ĠGeneric Broyden ĠKe pler Ġminim ised ĠCalcul ation gh z ĠLat via Ġpolar ization raster ized Ġ################ ### Ġ################ ###### ĠAct ually Ġconcaten ating Volume Object Ġspl ice pur pose pur cha raft ed Ġtic ket ffff ff accumul ator Rout ine Ġinde ed 577 35027 次 æķ° Ġunders core ĠPair wise ĠTemporary File instanti ated Ġcompre hens Ġdevelo ped Arpack Params Ġdecib els # ', + ': . )[ . )/ 8 66 B rown C MD F lor R AS S and S ources X val _ (' ` :: c lay d F f tr k max l pl l Diag s ilverman t stamp ĠĠ ĊĊĠĠĠ ĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ in del st ix de b de li de conv Ġc one Ġf ramerate lo de Ġ' '): Ġ' *( co se Ġre build Ġre cognition Ġb dt Ġ# " ic ell Ġw ulff 00 06 Ġ2 14 Ġg x get col all s end ulum fe asible ĠF lask Ġ3 71 ns c ĠL TI te o Ġfrom string assert Near sc ha ĠE C ĠE limin =" +", ĠB k Ġun selected Ġun fortunately op otential axis label Ġle ap 99 34 Ġtime str Ġtime points ĠW W Ġmax log Ġmax pts add Data nel l 11 78 15 000 ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠU K Ċĉĉ ĠĠĉ fa ir pen alties arch itecture tt ing den im 95 57 94 92 17 17 Ġexp Result mon itoring 18 23 err gjr ap is 84 64 Ġac cession Ġad join Ġtra ct De grees Ġar ith DE PREC 08 2 ,' % OL SR block size TR ING cos ity fft freq Ġlib s td x Ġdesc end ĠAN SW ĠLog ical 69 1 irc raft IM AGES avg data Ġhead s Ġ$ ' )+ ( OP S ĠGeneral ization PS S Ġcos metic ĠRes ource ker beros Ġ19 75 ĠImage File analy ser gd tr mv sk [:,:, :, dele g Meta store Ġastro ML Dep ot ĠVer ification æĪ ij #================================================================ =============== Ġ================================================= ====== ĠSource Estimate FIX ED glm net Static Box Partition ing ĠMa aten ĠSw ap ĠMar ket dut y Ġdecor ate ĠExec ution Click ed EB V å½ ķ iser r ĠSur vey Aggregate Function ĠLeaveP GroupsOut Stand ardize Incremental ImprovingEstimator ĠLAB EL Ġbenef ices ĠMongo DB SITE BASE lymp ic JO INT Ġapodi zation ĠBET WEEN ĠGol ub orent z DEPREC ATION OLSR obust ĠANSW ER # >>> * " 3 0980 = ": G REE I H M ER N range P db Q Menu R ain S ch ] =' g ri i ot n ment n fs n chan s mesh t un t dist v ms v ived x out y stem in ery st l an onymous Ġi u Ġn od Ġf ul Ġf riend Ġe miss co urses Ġb ro un q is p el ite ame leon 00 14 di poles Ġy mean Ġr ich Ġst ub Ġ* **************** int frame up ole pp g ĠC AS Ġ3 12 cal s time scales Ġal igns ĠN IfTI str Index ĠL ax ĠL ists Ġne ts fig image iv a ĠG D ĠG M pl rep ĠE num ms on ĠB l Ġun even ill ator In Pandas fo x ., - Ġfe e init ed ca vity ep ic 11 14 ĠH orizontal tra ded Ġsub str Ġsub stit amp lot doc filler 16 77 19 1157 ))) [ copy to Ġstring ify 95 901 94 118 sort idx 18 26 07 3 Ġparameter ized normal isation save As Ġac id Ġad missible :] [::- ******** ** 44 24 alg dp Ġtol er Ġinitial s ai ke Comp osition 21 88 ĠIndex Col let ions nb its build ers ĠBase Forest Ġbar bs IM ARY ]+ ( Ġintegr ating ĠLabel KFold win ner TER M Ġhistogram dd ^{ \\ Ġequ ities Ġ24 00 }$ , buf fered Ġhalf life Ġ199 7 Ġ-------------------------------- --- Ġ-------------------------------- ---------- PY QT document ation Ġ================= === Ġ================= ====== Scalar Type 132 6 Ġwor ry amb ient war shall ĠOli phant Ġnr ns ĠDistance Matrix éĹ ® ĠSp line åĩ ½æķ° ĠMod ern ĠMain Window xlsx writer Ġmaxim ized Ġreflect s ĠPA IRED ĠDNN Classifier Rot ate æĶ ¯ ĠFA STA /{} . occur rences ________________________________ ________________________________________ ĠDen ominator Ġima gen Mot ion CHAN GE Ġode mis loglik s Ġamin o Ġdisc ussed ĠPolar Axes Ans wer 652 25934 522 191157 0916 03 65225934 091603 522191157 6557 # / ) }{ + - 2 200 3 09 7 67 8 97 A uthors G Hz K I P ARTIC W ins ] =[ a pe a ands b ac e type f cs f value g fx h N m gc r cond s data s name s cov t pe t iled w ifi y labels z dir è ± in ski re ns Ġn mi Ġc ate Ġc rashes Ġp testing Ġp ango Ġs ans Ġs plt en force en gines Ġin div Ġe quival ol lars 00 43 00 784 ma vlink Ġy new Ġ2 16 Ġ2 49 igh ter data sources ĠS ized ĠS ED =' +') put Text am sterdam Ġcon serve ĠC r ĠC SP ĠC RS ĠF older Ġfi f ne q ase wich Ġv g file o ĠN tot per ience bo los ĠL ithuania index ables max lags Ġpro x Ġl db ĠG ou ĠB ank ign oring 99 98 Ġat an 12 905 12 12547 11 46 =[ { Ġpy dt Ġ(' \ ug g AT UR 75 686275 **** ** )] }) 13 07 sp matrix 04 037 prob es ank sgiving Ġve ga SE NS ================================ ===== uth er ĠJ ulian 92 92 84 2 pack ing Ġread ability ac quisition ... '. ... ". Ġmod ern nn lf 23 17 AC L "), ), ume l 98 647 ob serve DE CAY Ġimp ute SD R Ġfont files Ġfont paths "]) ] ĠPython Only ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġret step inst itution bit rate 48 45 nb dtr MM DD Get X 63 92 light grey hold ing Ġmeta store Dis cretizer ================================================================ ===== Ġli dar 41 86 OS X ******************************** ************** Font Directories Bo ston ĠCur ves ima ging sal iency ĠSum marize Ġmet py BO OL quarter ly yo y Ġland scape è¯ ķ datal ab Ġfront ier explo re HASH SEED Ġcomplet ions ĠDistribution s CAL END 326 2482 Ġgradi ometers Contour s æŃ £ Dag Model Business Day wal ker refine ments Ġmor phology ĠtearDown Class Filt ered Flu id signific ance 0980392 1729 Incompatible Frequency ĠStand ardi ĠTransf T cep hes Ġswit ched gran ularity Ġspearman r Ġgran ularity ĠSkewed Chi anumer ic ĠKan asewich æ® µ bidi rectional 95901 4893 75686275 959014893 09803921729 3262482 5 64 7 25 8 45 C op D endrogram H ERS I oneq N n N OR S kew V olt c ust f at j am l ick m th p ending q m ê ³ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ in variant se es re pository on click ĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ de velop Ġc vals Ġf we Ġa ws Ġp ink Ġs frame Ġs ale Ġin cl Ġin equality Ġd loss Ġd bf ut ables pe ptide Ġm data co t Ġre ceptor Ġre stored lt bank un compressed )) \ Ġ[ (( 00 10 Ġas semb () ])) Ġ" )" Ġy esterday Ġ2 46 Ġg ini __ ')) get Y ax hspan Ġdata Dict =' ^', ĠP latt np o if th test mod ĠD ynamics ns ub pro totype pro venance ĠL M max abs ĠThe ory ĠM aking po log Ġout b ĠRe construct sh mem Ġun wanted op name 99 26 pha ze Ġhe artbeat 25 905 Ġsh arpe ĠH ave Ġsub header ay lor 04 30 trans Offset Ġ100 1 85 51 Con figure Par quet Ex change 34 61 Ġreg ards ram er non parametric Ġsome how Ġlast x mer ra poly add ĠPro duction =- . ĠPlot ter scatter plot CT C ĠAn chored Ġlink ing convert ible su do Ġdesc endents rough t major Ticks Sh runkCovariance Ġ'- ': Ġ$ \\ ci pher Dist inct DO CT }{ % CON VER IR IS hy po Trans port tw os Metric Keys fh d thresh olded WAR D sal ad ĠAss uming CI ES SER IES Project ed bur ants Ġpers istent Ġadvan tages Ġbind ings intersect ing gm res Volume s Measure d fis cal anc ial tor que Ġgrow ing ĠLim its ancest or ĠExperiment al CHO ICE Ġexpl oration Approx imate ĠEstimatorWithFit And BIG INT corn flowerblue Ġcalibr ator Ġpho ebe 5 38 7 88 C XX D ML D rag L et L ef L aTeX S s U G d ges e hf h unter n ik s moother t S t q t angent w is z g se names re plot re current Ġi st Ġa weights Ġa mg Ġs ac lo ff Ġin clusion Ġd E co at Ġis Landscape ts u ], ',', th ur res istance set eq Ġ: ' Ġ: ]). Ġr pc ]) [: ex haust get refcount ĠS IM Ġdata dir Ġx zero ist est Ġh ub len ded ĠA F Ġ_ ( ent re ĠR AM ĠR ational Ġval array if o ne u Ġv mat min fo max int ĠM KK app liances Ġlen s assert No Ġ< <= et ing ĠB ell ]. [ In line Ġint elligent ĠW ashington num like map grad old own 25 35 Ġso le bin arization 05 490196 ang s 100 6 ste ep ]] } ]] ", tain c }, {' use distiller grid data ']) / ĠEx it ĠV a ĠV m Ġ{} } Ġcom mas 85 098 86 05 36 55 Pro duction ĠJ un ĠJ ames Ġq b Ġmod al batch Size 37 64 The oretical fer c De mand RO UT {} {} ink s Ġsim ulates seq id 47 27 lu dge Array FeedFn OL L Model Dir Ġtick format 28 1 Res pon Ġindic ies 38 1 ĠIndex ing sm lld dat atable 48 2 ĠMulti Column Get Bin Ġnan oseconds ĠBase line Ġnb cols Ġentry start Mat ched Input Hook Ġview ed fast er cdf s EX PORT ĠSh rinkage 76 26 Ġna cl Train ed HE Y Sub cluster entry start big gest ann def Sy napse CON N mock ing Layer Shape 61 78 Create Container Task Type Ġassoci ation ĠDef inition shrink ing æĮ ģ Ġtre ats Current Dist Ġpaper Width Ġpaper Height Ġer ro bre w Ġgu ard Ġct l ĠGroup er Over rides Ġlab s ĠTemp Memmap Ġinc idence Pa per Diff usion abi li Ġnr n Tr uncatedSVD ĠFin ished Cond itions Fin ally ãģĤãģĤ ãģĤãģĤãģĤ Active Cells ZZ Z æī ĺ SY S Pu Or Ġretrie val ĠContain er Ġdestroy ed adtz adz ĠSD SS Ġunderstand ing Polynomial Features Boundary Norm Ġheter oscedastic NUMP Y ĠGaussianRandomProjection Hash åij ¨ Ġpseud os ECOMMERCED ATA Weather Data \\( \\[ Ġprede cessor Ġrap id listof poly åºı åĪĹ Zipline Error Metastore Hook assertNo Empty $ )', 5 19 7 16 7 97 < - A nother B roker C au C UL G File H uman T exts a corr b ign f out g of g pc h art i hfft m dates n net p lev r mag s plash t pl u cc w ap x lims { | | ' č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ de e Ġi cell Ġs ma Ġs py Ġs anitize Ġm ticker co g un itless li quid um ably as m val i res net ad join Ġ: ) Ġ2 09 __ `` ĊĊ ĉĉĉĉ Ġco co ri age ", ) Ġh um ĠA ffinity ĠC NN Ġde cades ĠR at Ġres izing Ġan isotropic Ġnum Bits ĠG ray ĠG am ĠG RADI =" -> ĠB etter sh aradar ================ ====== Ġcomp iling Ġfe ar 12 64 Ġpo oled Re verse Ġch ol Ġest ablish ens olver valid ating IN STRU Ġapp s nan osecond tick locs St roke ule Locator na a ME AS rel and Ġmod ulo AS OURCE ################################################################ ################################################ 08 1 ud gery ML COMP Al lele dat at major ity Ġconver ges Ġhandle Invalid Or More Ġcommand line Ġsto ich ĠMin i :]) / 54 1 Ġtake able conv df ĠBy tes ĠInt el _% . 2001 0101 Ġanaly zing ä» ¬ RES OLUTION Ġinternal s 10000 00000 Ġput mask imag inary ĠBe am ĠBe zier mot ions Ġ10000 00000 Be low ĠCor r Sc enario Sc argle 905 512 Extra ction Vis itor gauss ians Dev Slope well s ĠSci ences ĠRO Is VA K Ġ'[ % don or Ġ#---------------------------------------------------------------- ---------- Ste m Ġbot o Ġmarginal s Comple tion 017 267 tech ni zo oniverse dock Widget Ġchromosome s ĠZip File hill on Sine Dur ĠMixedLM Params ("_") [ blacklist ed RADI US ĠSPD X 629 017267 atmos phere ĠSales force ALLE L èĩ ª ĠMON TH ĠABCIndex Class çIJ Ĩ éľĢ è¦ģ 12905 905512 98647 629017267 HERS HEY 12905905512 292 * ") . ")) 1 8039216 4 26 5 35 7 44 9 11 > & > `` A ST C os G CV H ex H JD L B L y R ule T EX X tr X GB \ ", a inv f ed j ud m iles n ate n arrow t ad w an | - č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re algdp le e de ath he mis Ġn h Ġn steps Ġc rafted Ġf ab Ġp ha lo an Ġd ur Ġe release Ġre read ur ts as d 00 66 () () Ġy aw Ġst udies ') ][' (' ============================================ nt est Ġg rows get All ab ort for buttonpress Ġco al Ġimport able Ġdata ToPlot Ġx u Ġh og Ġh dfs ĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠP ad ĠA ST ĠA rc Ġu d pre sence ĠC entroid os istest ĠF its ĠR P ĠD ESC Ġcol um Ġk max ds c fit start ĠM any ir fftn Ġpre trained ĠE D sh tein Ġthis y ef olding Ġfe h ĠO FF ft ol gra des tra vel Ġpy qt Ġpy flakes AT ING AT CG 75 56 )] [' den ts '. ", 22 36 04 19 ĠTest Series 17 46 Ġorder able ten b dis joint 34 997 Ġtarget fig filter rad Ġuni quely font weight side bar Ġobj type ced ing Ne ws Set Name Ġext math 46 99 ĠMe ter hat z 56 863 project ing ident ification 0588 2 59 3 mid night scan num By Name Temp Dir tex trm expand er Sy nthesis IR ES Tra j macro s Ġexpect ing 101 1695 Ad ded Ġylabel size Ġscatter plot ĠFa ils Ġbig query SQL ite lam da ABC DE equ ations ĠAnalysis Exception Ġunpack b Ġpur ity edit able UC I Ġgl ut stand ards asy mp Ġsubclass ing ĠLO GGER 644 846 192 154 hu ge ita per 1111 11 slic ing Ġreflect ed ĠIntegr ation Ġpix buf ĠConstant Kernel Ġreplic ates viol ations ä¼ ĺ 776 04037 Provide s Marg inal 9020 34997 1254 902034997 Ra dio recur sion rub berband pict ures Ġheap q MONTH LY ĠScha fer 1237 192154 metr ika 677 72 discre tenb ĠTIM ESTAMP SYMB OL pyg let ĠCop ied lcms runs ppt v ĠRag ha Ġsfe py 05490196 1237192154 ĠGRADI ENT 18039216 1011695 ('============================================ ') 644846 77604037 1254902034997 9401 180392161011695 86 5 65 7 22 = $ A PP E lite H it H NO J R L ANG S upervised T MAX Y ork _ )): ` """ a head c ids e ur g ls k rylov m ig n ct n ut n out p Lvl r ango s par t ically x link | ', } ^{- æ £ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re versible Ġt abs ar ial le aved Ġi ons Ġn upic Ġc tn Ġf weights Ġf arm Ġp bar it zer Ġin form Ġd C Ġm osaic co ffset Ġre label ge xes and ra Ġ1 65 Ġ1 42 Ġ1 31 un weighted el p Ġof ile 00 67 () ][ ts plot ha ping Ġy units Ġst s Ġst aging ]) > (' ../../../ ab d Ġx rt ĠP as ĠP hy Ġcon tribute Ġtest Metrics rain age ĠD got ĠN got ds olve bo ltzmann Ġl lo Ġl ights we ed assert ion ĠB ot state ments log arithmic Ġcomp ositions ant enna ĠO B ()) / Ġmin span Ġinput file Ġ[] ): Ġ\ # Ġnew df ĠH alko Ġpy unit '], [' vari ogram 75 14 Ġcor pkit cor rel 96 28 ĠTest Is back test Ġsp atio 06 12 36 58 Ex posure 84 12 Ġav ailability 37 25 ĠCon trib ĠAr ic Ġback port Ġ[" { other m draw countries FF IX bug s To File 47 451 Ġ'. * Ġcolors cale 68 2 Ġext inction ele ctorate Ġman agers lon ger Ġren aming Ġnan opub Ġbar code Ġ$ $ 63 14 Ġcla de )" %( ci ate Ġattr name az ure Field Descriptor fl uct ĠCh an Ġreplace ments Add CreateContainer wd g ('- ', With Null FO OT Task Instance cr ime car burants construct ible bic ubic Ġwin func Ġground truth Ġarrow style ĠCont ent met as 3137 3 And rew commen ded 905 67772 MME TRIC 165 138 BO STON raster izing Ġintern ational fm ts pot entially ĠAuto matic 286 10 ĠRegular GridInterpolator 017 8859 ĠIMP ORT è´ ¹ Ġcomplement ary ĠWave length ĠCha p JSON Encoder STAT S Regist ration sco pus annual ized ĠInternal Frame ĠAnal og arcs inh çĽ ĺ ĠCl ick Ġdecor ators hor se 858 9547 Ġrepet itions Conver ged ĠMov ie Ġpolys ub !=' ': Ġresol vers gru eneisen 837 90567772 ĠScha pire Ġnic ely åĪ© çİĩ Dependen cy ĠNico las nab la nonlinear ities OneVs RestClassifier ntf Def AFF INE 9133 8589547 å§Ķ æīĺ éĹ® é¢ĺ 165138 0178859 83790567772 365 91338589547 337 # --- , ). 9 6471 D ASK E v F ake F trl G Q H N T ES U Int _ [" b undles c se g ivens h us j acobi m ises r values t ener z hang  ² ì ŀ Ġ ãģĤ ĠĠĠĠ čĊĠĠĠ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġt ro Ġt ill an u Ġc tf Ġin h Ġin vent Ġo il Ġ' (' Ġ' ^', Ġm iles Ġe Density Ġb ru un to def ect val box ĠT C ĠT eff res amp ch op (' // Ġg at ĠS SL Ġco ast Ġh ists Ġh arm py torch fe m im i im o Ġde lu out filepath pro state min ation ---------------- ---- oc entric Ġun matched iter ating op ic op ort Ġexpected MD 12 52 Ġ__ _ ()) + Ġplot Data Ġch ip ĠY r Ġnew name Ġtrain Data Ġsub directory '), ), ĠK ER ĠK ruskal fn ode ĠV ision ])) / exp iration 97 13 97 92 Ġreg imes Me asures 37 88 ls d gn uplot RE LEASE RO LL mult igraph 43 85 unit ary cut out Or Index imp ose Int Var ĠOr bit US SI hes ized Ġcache name invalid file ĠGrid Search Sub Element PS F Config Loader 2016 1 velo per Period ic cr Stats Ġexport s white grid Ġexc info MC N ]} )) Ġbig dl ĠEX PECTED progress bar Block s ĠPredict ing Ġì ķ ĠCho osing PH Y Custom Factor 644 660 Convert ing ('# '): ĠLI KE sib lings GP Regression numer ix Ġsun rise attach ment fund amental Randomized Lasso ----------+ --------+ ĠUDF s Ġmaintain er ĠTR N contribution s UDE M ĠSer vice ĠOper ator 2626 26 ĠGu yon Hy dro associ ated lnp rob ĠtestMulti Class .*? )\ ĠProgress Bar Ġå¦Ĥ æŀľ dise ase ([],[ ], HEAL TH crStats W # -------------------------------- $ )') , :])) 1 6666667 4 77 7 10 7 48 C ity D ES D igital F V H X L x L ive P adding R isk T min U r W C Y s d anger f q f ut h od j ython k st m ts p ulsar s cols t ID t cd w en w arr č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ancestors re create Ġt all de que Ġi container Ġn os Ġc pi mp loyment en heim Ġo gr Ġ' "\ Ġm oney Ġe time Ġre do Ġre volution "" : lt ext Ġ1 100 as ci ĠT OT qu ux tr unk res ized set ters Ġ2 13 Ġ2 85 ') [- Ġ+ '. Ġg kde __ '] data gen Ġco lo Ġco arsen col sample ĠI on am ar Ġ_ ): Ġtest Regression ĠF ifth ĠR uss Ġcol Name ns cf out fh path ogen pro pag ĠN atural Ġl vm ir t Ġpre paration ĠB ug log scale log normal In dx ant ico ĠW ang Ġmax dists Ġch ina Ġdist orted ll crnrlon cc y ĠY T tra ffic Ġno velty Ġcl on 33 65 no params no logies 80 44 80 273 new lines IN AL ug ar ĠK T ĠK umar "] + Ġro unds Ġro oms tick ers )] ): Ġ8 50 by date Ġfa cade Ġexp m order Of 06 205 dis count af filiation ĠJ une pack er Ġtra ppy 55 04 55 707 ĠAr bitrary Ġunder flow offset Text current frame Res ources Ġ'% ' Ġeigen decomposition Ġquery ing Ġroot dir Get Size skip footer Ġgre yscale tool items cdf vec Ġaut ocall two class Is otonic em Line At tempting symbol ic ĠSpec ification ven us SK Compat Ġmid rank pri v TRA DE Tool Button mk t Ġcf time æľ º car topy aco b Ġbyte array äº Į Sim ilar Ġbig rams Ġ"{ : ĠMock Estimator Ġcutoff s SO FT MPLE MENT ĠST D ĠML Comp dig ital ################################################ # Ġmov ies 984 31 ĠBayesian Model Interpol ation 432 6 SU FFIX ĠProject ed FORMAT TER Med ium prompt in 4444 44 ĠCH AN Ġ'{: > Ċĉĉĉĉĉĉĉĉ ĉ ENS ITY Background Colour Ġoe mof roid b Ġheter ogeneous Try ing Regular ization Adagrad Optimizer RANSAC Regressor Fix ture ĠRec ipes pict ure Ġpapers ize Ġrefine ment Ġcapt uring Ġdowns ampling çī ¹ Ġcros sed Ġswit ches heter o ĠGEN ER Dar ling ĠDecre asing ĠSched uler brent q MESS AGE ĠOPT ICS ĠAMG UT ĠARCH IVE TAX ON ĠOpp enheim orderOf Magnitude 4 67 > ( B asis E vals F ER G lossary J PEG L H M JD P EN T argets Y R ^ % _ - _ "]) d ma f usion g cm j x m max p name p am r truediv u its y en y Axis ĉ ĊĠĠĠ Ġ Ċĉĉĉĉ Ġ 设置 in hib at tn or is al taz -- ' le rence de generate Ġc my Ġc nm lf it it ype ro cket Ġin j Ġin jection la ke Ġ' ]' Ġm trans Ġm ilitary co ins Ġre views ge ometries Ġb le Ġw g ig ne ss ql est im 00 22 id ues id men di vep qu iv ad type mat r om inal ab l label bottom ax r ĠS kipping ĠX val Ġh v ĠC lay Ġ` __ im ity Ġde mean Ġax hline Ġ3 89 Ġv lim out name Ġal bedo max lag Ġ{ (' po a Ġpar asite et l ĠB a Ġcomp os Ġfe male Ġdefault Value Ġver sa Ġhe uristics Data Handler 25 34 Ġj upyter ĠH ide 05 12 pr glngth Ġsub matrix ĠSe c 45 67 03 96 ĠTest ed :// % }) \ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġnormal isation Par a 97 27 valu ation ĠSeries OrIndex gr angian Ġad joined Ġtrans poses Series Name Ġmsg pack ĠAr ma Ġuni prot ĠAl g Ġsuper ior Comp uted rer ror cast ing ud l mi um Ġoffset Trans Ġlower ing ran cis Ġ'/ ', ane ts Ġlat lon Ġ16 3 tool manager repe t ĠPre process ĠPre compute Cur ves 93 15 ĠSo S Ġcould n Sy mbols With Copy doctest s Float ing ĠFa iled Current Lon suffix es Ġ---------------- --------- Meta Data ĠCO M ĠNet CDF vir us autoscale y gtk agg saved model sun set ĠSc ene 115 32 sos filt Wh it accept able different ial Off ice FR Q bas ics æĮī æĹ¥ ĠCa pture Pack er ('[ % Ġsal iency quick sort Ġamb ig ĠRES UL 334 346 ĠBest FirstTreeBuilder Diag ram proportion tocut ä¹ ĭ Mac ro Bool Col Ġdecomp ose Extension Array ++++++++++++++++++++++++++++++++ ++++++++++++++++ CAN CEL occup ancy bul ge ĠPhys ical pyqt Signature woo lam Ġads orb ĠDepth FirstTreeBuilder æĸ¹ æ³ķ ĠItem Selector (.* )\ LOC ATION çĶŁ 产 åħ³ èģĶ Ġlinebelow header ALIZ ATION 2504 92 ĠPur pose Ide mpotent åŃ£ æĽ´æĸ° Emb arked Ġtomo graphy 8863 8460 ĠWoo lam ĠMultiColumn Transform 88638460 334346 $ ^ 6 32 6 9020 8 667 > - A sc E uclidean K DD K NV L u M ID T N W arns Y Data c mat f vec g te g mt h ero n en t in t di v ista y ReLU ĠĠ ĊĠ in dir on Offset st ile an omal le aving Ġi path Ġi print Ġn vd Ġn repl Ġf nn it l it ches Ġs name Ġs rt mp df Ġin struction Ġo o la id Ġe ight Ġe mi co pt co pper co pic Ġb lo un bounded )) ]), 00 7216 ĠT T set Alignment Ġ2 07 Ġst ns ]) [::- Ġ* **************************************************************** Ġg ibbs __ ` get Elements for cing ĠS CF am bo ow l od om (" // 01 11 Ġv ac Ġv ideos ta it pro filing ĠN AN te ar ĠM en Ġl gb Ġl bf Ġl suffix ĠG ate Ġwe bbrowser Ġpre f Ġtr uediv Ġdi poles In variant ĠW in Ġbo dies ()) ; 32 04 32 056 ĠIn ference ĠIn strument ĠH irs are r 33 07 new byteorder fn r 19 81 ĠV B sp rase the mes Con fidence 27 73 SE NT AL GORITHM back wards Ġsp rase Ġsp anned Par m ĠQ SO oo ps Ġim resize Ġed ucation non convergence File System Ġmulti index :] + The n acc ording Ġlast parent \\ ], gener ally gb k Un ited Ġimp uted Ġupdate x Ġupdate y Set Status Ġmath ieu Ġregression s field structure cast ed Mix In spark Context )]) ]) scription s UR N Ġ'% % Ġauto commit ĠPeriod s Ġignore mask clo uds ĠRandom Data TH READS Ġseq dtype evalu ated ]+ '. perm uted Ġconst s lastic ity Ġhyper opt Ġpri mitives ĠInter cept Ġutil Functions As Array As sembler Ġgeneral ize cla m foot cite Start Time Ġgeo py Ġpk t STR Y ä½ ľ amin o PRE D Weight Boosting 106 250492 Ġseg fault WN ER ĠGeneric Artifacts Geo DataFrame whiten ing ĠLa unch Ġhighlight ed Cha ins åį ĸ Ġaggreg ations ĠJan uary Ġconc ern ĠSmall er Ġ"-" * 对 è± Ġcontig s ĠConnection Pattern Ġspe ech а Ð carto ons ĠFr itsch Bz Bz agree ment Ġsnp s ĠFIL TER 5245 007216 å¢ŀ éķ¿ YlOr Rd BAS IC Ġhom oscedastic æ¶ Ī PAT TERN Ġfacilit ate 37288 106250492 5245007216 9233 ) ']) + )/ 7 33 8 196 : '+ D r M ERCHANTABILITY N ight N tot R INK S olar U npack Y T Y ES _ [:- a ver b ap b lotter f udge f alcon g pp g uid g ium h olonomic i bo i coord i encies j l n pt v are x A Ġ arn Ġ ãģĨ in coming re served he ds Ġn ick Ġp names Ġp wo it ations Ġs rs mp ro en codings Ġthe str Ġd ups Ġm am Ġre indexing Ġb kg Ġ1 47 00 47 di ble ma sters ĠT ARGET qu bit Ġy step ch mod lab elt Ġst reet ck x ab in Ġco variate Ġdata Frame Ġx names Ġh ermite am monia plot View ĠP ickle ow a ĠC hen ĠC entral ĠC lamp Ġfi rm ĠD EL ĠD aniel Ġv list Ġv ander ta c Ġk Hz Ġne utral Ġpar info Ġtr ange Ġset t Ġ4 20 Ġ5 06 ĠW S ĠW idget Ġaxis line sub graphs Ġver batim map box Ġmin f cy linder ĠIn vert ĠH I ĠH Y ĠH ITRAN io let 14 40 den a 04 04 Ġ{} ' na conda Con n 27 39 SE BAL gen mod work l Ġpass wd Ġqu bits do be Pro fit af ka version eer ass umed OD ES img Data 77 2 Ġsplit ext diff data kw d Ġ} )) Un meth user content inv estment ĠTime Dep ĠStr ategy CH MARK leaf let Ġsq norm DI SC Ġsin h Ġop ener SA E Pre vious eq ns this Unmeth 69 24 69 84 context lib ĠBase Epochs ĠPre vent Ġhold out Ġmeta class Train Test ĠPy PI Sub mit FA ILED ĠWAR N Sp am UM AN Ġmock er 714 285 čĊĉĉ ĠĠĉ Read AsArray Ġ199 5 Metric Spec Ġph onon Sto cks Sto chastic Ġcorr coef Ġsat ellite CTION S Ġloaded Model Ġanalog ously ĠAlex ander Norm s Func Formatter ='# ', CI F KEY S quant itative Ġchrom ophore 992 16 Dimension ality ĠMemory Error Rank Warning synt hesis Ġarc sec Ġins ufficient 424 7 bas kets GL D pw r Cy l FIX ME Uns upervised ĠBio metrika Ġescape char å° Ĩ IZ ATION anc zos shuff les blen d publ isher Ġclim ate dock widget Ġtrust worthiness Ġsci limits utt all Ġparticip ant BI AS Ġfeatur izer PART ITION %) '], ĠNa Cl cop ies Cam era ĠMySQL db itud inal Ġdefic iency labor ative Ġcophe netic Ġintrinsic LC ĠConvex Hull å·¥ ä¸ļ kdd cup ĠArpack Error fati ando MEX PR æĪij 们 % ") ) >= . < / -- 4 996 6 78 9 38 > / D CASE H list J accard K ern L am M n S pectra T AGS U F X a _ ': c var d I d psi e at f resh h bar i ber l ms m ids t C v ances w on w rote } """ in ian Ġt ensordot al di al ter me mbrane Ġi ps Ġc ps Ġs ar ing a Ġe go Ġre act Ġre wards Ġb other Ġ1 67 Ġ1 83 un stacked li ography ad jacent int u data Handler get tempdir Ġex pert lin dr ĠS ound =' __ Ġx lims ĠI E ĠI bis ĠI llust ĠP ubl ĠA str ĠC ART Ġ_ ` im odal ĠF D ([ ]). Ġ3 0000 ĠD at Ġlo ffset pro ot pro grams Ġal loc mo z max imization class name Ġl is ĠG S us a ---------------- ---+ cl at ĠE con ĠB la ĠB uilt log loss axis line num Objects ĠO MP sub figure sub Test inter rog bin width ĠH B ĠH uman Ġpy parsing ĠU CI dd k 201 68 ES SION ĠK aggle Ġro s nan var 19 25 by tree 96 92 96 128 ])) /( Ġ{} .'. 85 205 Con c Classifier Mixin ]: \ Ġqu arters normal iser Ġ... ). save file Ġfreq z Ġfol ium Ġback fill Ġ[" - can v pdf s ĠWe ibull fs ys sim time ylim its ĠPro c 21 66 57 4 ĠLog it Get Series fun s Ġfra cs mic hael Ġbar codes ĠLe gacy evalu ator Ġ$ ( pers ons agg func ci um Ġaut opct Ġpdf s Number Of NB C PER C ================================================ ===== Ġpri mer Ġ'{ :. ople th åħ ¸ hy de NaN s lam bert Down loads MO TION ĠGroup s Ġflip ud Transformer Mixin Ġweek end Ġweek ly bayes db ĠConfig Error ĠPredict or Main Loop é n abi ext replic on ĠHel vetica 432 1 ĠAct ive VI E IMP ORT dem ibold coll ision åŃ IJ ĠRa vel ĠPh onon ĠAcc ording ĠCar olina Ġ================================================= ======= Ġsun set Pair Grid 277 31 Ġcn tr 247 13 dof s Ġhdu list GPL VM phant om ĠRect BivariateSpline åĪĹ è¡¨ éĻ IJ ĠGPL v Ġdetren ding Ġcand lestick ĠJob lib Ġinfl ation Ġsand box ĠInterpre tation 0922 96128 4933 092296128 Ġlob pcg ĠMx Nx æĥ ħ getElements By ( (), ) +'_ * = 0 80 5 88 7 09 : '] ; % A head B ank F rozen I J L atex S Q W av X I Y ield ] ',' c bo d uring d ni d Hist e uro g j i que m diff v est w ic x mid z onal § Ģ ì ĭ ì Īĺ re corded re achability re structuredtext Ġf ld lf req Ġp addings ct ed Ġd theta Ġm sd Ġe gg and b and roid Ġ( ?, un aligned Ġas sembly ĠT a ĠT ee Ġy values Ġst upid ke po ĠS age ĠS pike Ġco pa Ġx Height ĠX new pre de ĠC Z os phere ĠR HS ([ ([ ne on Ġal locs ĠN pzFile we ird Ġpar rot ial ignment Ġprint able pl ates Ġname list Ġname count mb ar ag gr ĠB R ĠB idirectional sh ri che l 99 90 Ġ`` < ine q 12 29 ĠO NE Re vision Ġz ps text box ĠIn stit ĠIn herit ĠY ang Ġnew X 05 100 Ġ[' . no f pred icate ste re Ġcur gap 19 58 tick prefix St re ĠV oting 04 15 96 34 94 199 Ġdis ambig 86 907 ================================ ==== Ġtext book Ġtarget ed my add my Grid File Error ~~ ~ ĠZ adrozny Ġshow means SI X can ned AG T window ed Ġtick locs pert urbed job Id Res hape hed ron zip f MA PPING ĠAt tribute extend able Ġregular ly Ġurl retrieve Ġfin ance Row Object fr ance exog enous br icks Ġocc ured Multi LabelBinarizer An geles Ġli pro oper ating Ġequ ipment ĠInter polated Ġ~ / Sy ns Of Week cr q ĠQu arter bi ke ĠFigureCanvas GTK Predict Test Ġph il Ġprod ucer ĠNon negative Rest rict Ġbg f Ġ================= ============= Title s ĠGeo physics Spectral Clustering ĠEl kan Ġlik es Ġce a ':[ ], ':[ ],' ĠTH EN Ġtim ers HI J Ġland lab LST MLayer ana conda ĠRo yal accel er maj loc Ġforecast ing ĠIntegr ate ĠDNN Regressor ĠFill ing Sur vived ĠRank Warning Ġya de ZMQ TerminalInteractiveShell Likelihood Model åľ ° 308 235 ellip ses Ġdecomp osed ĠRot ation motif s Ġmemo ize ĠApprox imation Ġfurn ished nucle us 694 12 Minor Locator Ġinfinit ies Ġllcrnr lat ĠLINES TRING addTo Study mechan ism ĠRos set quif oy PARTIC IP æĮīæĹ¥ æĽ´æĸ° kepo hl " < 8 78 A ve A lias B rier C uda F are G ED H omogeneity L ASS N ative N ational R eduction W D W ui Y test b ull c ub f values } ``) é ħ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ħ ë ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in direct an om Ġi k Ġi map Ġi llegal Ġc len it opes ct able Ġ' == Ġm sk Ġre gs Ġre ordering Ġb ail Ġw atch el der ol z ce le as a Ġ" ... ha ppy Ġr icker Ġ2 97 Ġ2 60 mat ed (' {: int lab Ġ""" ! Ġg ross get p Ġex clusions ĠS ql Ġco ercion ", \ Ġx step Ġh str Ġh atches ĠP B ĠP ART pp p pp oly od r ĠC AR ĠC andidates Ġ3 84 ĠD ML time List pro tection ment ions ĠL ibraries Ġan vio Ġl j app Name ĠG old ĠE F ĠE OF Ġdi versity rid s Ġint ention fo v ep holes Re trieve 25 098 Ġ[] ], Ġz score color ing Ġper pendicular Ġnew size ĠH ankel Ġ[' $ Ġla place vari ety ats on amp li 16 026 av ity Ġpos ix cur l ĠV V 96 06 03 79 AN OVA 36 255 ')) ): 97 71 ĠJ eff save mat Se cs ĠQ Table 84 94 Ġvalid ators Ġpoint wise acc u ĠAr ch IP T cle ars xy press Ġab el ĠComp ound 49 80 ĠUn fortunately Mix ing .], [ UR LS ĠNe g exec uted dat atypes eq n 74 860 CO VER Int roduction Ġevery mask pers ample 63 87 Ġ13 00 54 11 neg LL comple tions zen odo Ġhyper planes Ġli mb Ġcm x tab Widget TEST S CR VAL ĊĊĊĊ ĊĊĊ Item B land o Pandas Object Acc uracies Ridge GCV Ġdetect s ĠEX P Ġxlabel size bed tools Ġscan no ince ton Ġ196 5 Ġ({ }, Ġhost s chem ical Pa int KEY WORD Ge ometries +'. '+ ĠSc enario eros ols ĠHand book Gre ens Ġ44 100 Ġimprove ments ĠHam mer writerow s Ġhack y leg ator ĠZero Estimator Renderer Base Calcul ation Comple ted 178 1 ament o ĠLoss Function zp ssx ĠPatch Extractor åľ º Ġgram mar Ġlex sort tur bulence æµĭ è¯ķ Ġ"| " ĠRA W Ċĉĉĉĉĉĉĉ Ġ Uniform Image 654 90 ĠIndic ate ĠEvalu ates ĠVir gile restri al aters heds ĠOrthogonalMatchingPursuit CV 4633 7533 Lag range Ġaugment ed Ġbenef icial ĠyE t Drawing Area Ġrefactor ing Ġrdf lib Phys ical Gy ro CONST ANT Movie Writer coura ged Ġpare to Multip lier 9875 2975 ĠStim ulus zue la ãĥ³ãĥ Ģ Ġtheor ie 8605 6315 9713 46337533 getElementsBy TagName 74860 86056315 98752975 86907 971346337533 87 % '], . ')) 7 38 8 92 9 20 9 873 B RE G rowth G zipFile H M H r K orea L OR P lay Q String S PACE T TF Z m b road b enefit e j f get l list n ine n ie o file s lim v type v oc y margin ĉ Ċĉĉ Ġi ml Ġn ct Ġc ca Ġf an Ġf data Ġp eff Ġs ib ra veled Ġd Z Ġd bl Ġd hi Ġ' (- Ġ' ... Ġm Y co hort Ġre produced Ġb map Ġb rand Ġ# . Ġw oo Ġw elch di jkstra Ġis close ter a ma v th ir th ings Ġr u rom l Ġ2 06 Ġst or get lines Ġco cluster ĠX d ĠP erson Ġcon fo '] ])) ĠC E Ġtest All ĠF rench Ġ3 03 line join ues day ta ugrid pro fits ĠN ORM bo at ĠL ock ĠM id ps p Ġl sf ĠG PR ari mages et nam Ġwe igh comp ass ĠE co Ġ4 0000 In dependent Ġlist of ĠW N cs ms Ġall data inter actor 32 13 05 19 fa hr ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ER ANCE Ġpos y be ats lat er 94 69 :: , ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ sy l ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ do e Ġscal ers part ite our s 50 819 87 38 Ġlast name DE COUPLE xy values Un certainty inf inite Label KFold job Reference čĊč Ċĉĉ Regression LossFunction UN DEFINED Ġreal time Inter vals Ġvis ually Pre Plot Ġref lection lon lat nb format 69 24713 ĠRun Config 74 36 Ġ"% % ä¸ ī collect ed Ġcache dir Gener ation Dis patch ĠModel Checkpoint dy dx TRA J mal formed allow s tuples afe }$ " Ġsl anted PU B Ġexport er ĠCan cel Ġconn dict ')]) ]) Ġclosed max Acc um named Style Ġexpand user ee per ĠNon linear čĊĠ čĊ Ġverify Schema 926 03 PRE DIC urb an ono metric Ġslow est Ġcollect ing dro ps BL UE ĠPart ition Fin ite ĠDO I Zero Estimator ĠMod ules Ġbas in Comple teness ban ana Report er supp lier ĠTabular CPD ĠIdent ify Rot ated 819 6924713 Ġflex ibility cook ie ellip k Ġmach inery gdk GC dra ggable sty ler qi ime 407 16026 Sine Squared Ledoit Wolf ĠWrit es Ġdeleg ator beha v inde ls think stats imagen et Indic ator Mutable HashTable multit arget smo ker 4845 8196924713 / )" / {}'. 4 17 5 92 7 64 C RO C utoff F use G Boost G Py G ROW J en K ill P ut P class P lasma Q uestion R G R SI T ally X min b N b ma c fft g abor l gd m art m ull m Jy n free o sers o SOFT v ous w y y pred à Ħ æ ĵ ç « Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re ml on select Ġt unnel de compress me ability Ġc raw Ġf int Ġf scale Ġs ane es c Ġin files Ġo lympic Ġd typ la pp ut us Ġm sm co here Ġre le ig g Ġ( %( Ġ1 73 is module el liptic ue stra ot ides ot imes as farray ma king ad m fi b set Parent Ġ2 04 mat ics om ys Ġ+ -----------------+ pt ical ode tect get X ĠS SE ĠS TEP ri ef Ġdata Length Ġnot ed Ġh tm Ġh dens plot Params ĠP HI Ġ` ** to x ĠR d ĠR x Ġfi len line length ne qs [: ][ Ġl width ari max ĠRe maining sc argle ĠE fficient ph onon =" ' `` ' Ġlist e Ġle gs da q Re ceived Ġline betweenrows ll ing ĠY EAR itle d 33 87 no RNA "] ))) 19 32 be en Ġsy nonyms 85 85 Type Enum Ġsp d 18 75 dis cover Pro totype spec imens 84 47 ... ]. img Ids .") . Ġar ity diff er ĠAl ber sql Context Ġab und Set Font Set Param Ġinst ability Ġstore r Ġmon ty Ġ'% ) Ġdesc endent Linear Operator clo ser Ġfactor ize Ġlat in Ġlocal ization sig s 74 1 ':' # partition er Ġ'-- ') fl ats Ġna Lower ĠInt Index .* ', ================================================ ======== ================================================ =============== CR PIX ĠApp ender Ġtyp list ĠUni vers analy tics ĠTh ree ĠFile NotFoundError ĠQu ad export s ĠEn code 2549 0196 ={} ; nz xy gui Event Ġtw os Ġtw inx elect rical cli prect Mag s Ġmicro bes Ġì Ĥ¬ Ġmeaning less Ġ------------------------------------------------ -- Ġlt h Ġmk dtemp sun rise ĠSE BAL Extract s Mark ov Ġins pection ]== " 077 64 SIGN ED ĠMan ning Ġsuggest ion ĠPost script wolf ram kin etic 028 32 wor N Ġorgan ism ĠLi u VARI ABLES recur rence Ġextre ma capac itance ĠByte Type PlainText Formatter Ġglu on ĠUnpack er Fra gment AVER AGING CCG CGGT Ġlaz ily lindr ical " +" , %. 4 96 5 78 5 44 7 80 B ot B as C CTT D Interpolator E fficiency H IST H ERE I g N othing R N R ay T MIN W F X F X N X Z c str c rf e ight g ct g ant g ang h v h in h ues i res j unk m ses n args p A s ic Ġ é»ĺ认 se al se per re main re moval Ġt vec Ġi rf Ġn ational Ġn engo Ġc z Ġf dm Ġp tr Ġs ake Ġthe text Ġd uck Ġm cmc ge fahr Ġb at un a un mixing ĠT re ch ance fi ps Ġr ings Ġr bn Ġ2 79 mat ric Ġst uck Ġg athers data Table ab a label ings Ġex ch Ġdata starburst arg types Ġh align ror yz ĠC LI ent e ĠF N ĠR p ([ \ Ġ3 06 Ġv range Ġv xl Ġv igra ################ ########## ĠM ETA ir ically 10 38 10 46 10 93 assert Pandas Ġstr cols gre p Ġset OutputCol ĠB ro cept ors Ġpo res ĠY OUR Ġdo y Ġnew val ĠH olds Ġ[' { no aa 19 63 96 00 Co ver ĠTest Glm Ġover writing Ġfirst s cre pancy mon ic cent res ')) ), dis ney Ex ponent ĠJ ochen my func my string tx s Ġread me si us 23 926 De bye 77 0 ai res DE FL To Python Set Label Ġfont class connect able ĠUn known diag flat scatter points Ġclo uds zip file strip plot dat elike ĠMe ans ET TER 57 0796 Path name Sh ot report ed meta estimators pass ive ĠOr lando :]) ** 001 01 light blue next line Bu Pu ble ms post fit tot reads 53 78 AND S eg atus ĠSpark Conf mk l mk stemp Ġconstruct ors VE CT Ġpost p Ġbit rate Ġinv fac Event Detection pat ience Ġtermin als ĠSub stitution ĠEst imates PAR ATOR Ġur crnrlat break ing Ġcap log ĠTra ck SET TINGS install er Ġfr q Ġstim ulation PACK AGE yt ical stand alone Draw s Ġedit able Ab br perform ances robust cov 365 079 Ġhard ware rp m Ġeq n Ġmet al war ding BIN S Ġste ering #================================================================ ======================================================= Ġviol ated TIC LASS ĠMan ual Conv net Generic Transform ĠHigh er Ġsatisfy ing 123456 789 ĠHive MetastoreHook Ġellip k SOUR CES contig s ĠCorrect ness dj z JOB LIB mus ic Central Widget ĠLeaveOne GroupOut Ġdatal ist Sat isfied REGION S Ġparticip ants ĠAirflow ModelView Ġ © Ġmainta ins indust ry ĠAng strom constit uency Phy lDiag ĠIR IS ĠREST ful Ġpmag plotlib obst acle ãĥ¼ ãĤ SCH ED Ġminit ers Fis ca ãĥij ãĥ³ãĥĢ antico don å¯¹è± ¡ Cuda Convnet roryz omys , )*( 6 80 6 95 7 32 8 35 > ) > .* B TC B ORDER F ontsize G tk I gnoring K et L ISH P END R ating S us S lic U ME W CS X T Y list b ode b cs b ls c values h si h rs i row m mat n cfdtr p cp r pt s ilver u fact v on x rt x Axis y east å Ļ re new st el st ns Ġn cdf Ġa corr Ġp ids Ġs dict Ġs da Ġs sp Ġs mt Ġs alt Ġd map Ġm dx ur crnrlon Ġ( > )) ]. Ġ[ , 00 42 Ġto ut Ġnp r ĠT AB qu arters ad de set Name Ġ2 021 ]) *( __ (). ĠS UP ĠS CI end ers ist ure Ġh bar ĠI so am ond ĠP otential ĠA p Ġcon cepts Ġcon nector ĠC xy ent rada Ġ3 05 Ġ3 16 Ġk T Ġal ex Ġal lobjects ĠL ondon te ms ĠM ES ĠM xN Ġmat ters 10 43 Ġpar abola ĠG ain Ġstr iding Ġpre sets Ġ5 01 op g op i In consistency Ġsk ill Ġint end [:, [ Ġmodel ling Ġplot file ren dered Ġ[] ] ĠIn come Ġsh mem no pe new name cess ors ER ENCE IN TR Ġind uce Ġone hot )] ], nd data sp ans 24 12 Ġ7 000 86 70 IT IVE 18 112 Ġcontain ers Ġwarn ed 09 06 09 79 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ do er dis placements rc nn normal ised 92 922 Ġcurrent module gr izli Ġtra itlets cell Text Ġar op Ġvector ization Ġperiod ograms rec ency Ne uro To Point Ġab orted tz e Ġraw data inv est ze h Ċĉĉĉ Ċ ĠUn used 28 2 cos mos Ġfull path Ġge witter Ġsq r Ġsq la *( \ Ġ15 6 ĠPeriod Array 69 8760 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ffect s Ġexec utes Ġpower ful IM UM cp ickle Image Testing Ġ25 8 win func DO S Qu ick ĠInt erest Com ments github usercontent GT AG ti pping ĠCON T ĠIS BN With in ica o hel ve Kernel Density Ġdy dx 101 6 Process Error ĠCan onical PAR ALLEL ĠGraph ics Ġturn ing SN IP 105 04 observ able Month s GG CAT cccc cc ĠCor pus ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ Ref s Ref Temp 112 717 ĠOver flowError çĶ ± fmin bound GA CA PIP ELINE ìĿ Ģ ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ 016 80 617 094 33333333 333 ĠCov Struct 295 9 ĠQuantile Transformer blk locs Ġburn in gets ource pn cri ĠSNR dB Sur fer Ġlife times ĠCF Node ji ra CHUNK S POP S ĠTrading Environment Whe el ĠMink a paw u Ġpul p ãģĭ ãģĭ Ord inary Fr ont xrd name Ġfet ched CUM UL 6178 617094 Ġgewitter gefahr 698760 66 112717 69876066 6178617094 1832 # -- / ) 0 756 0 206 3 125 4 23 5 32 5 15 5 336 5 252 6 05 6 88 9 8039 A ME C LE C atcher E UR G prime H at H AD I EEE K eras L ambert M atches M orph N Z N Times P ED P ubl R en S AG c dots d mp f eld f ants j f k dt l min t am w ld y rs } ``, è ¶ ë ĵ Ġ ari Ġ ãģĦãģĦãģĦ ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ in u Ġt pe he size Ġc table Ġf ro it tal ra re lo rer la v Ġm ine Ġe pi Ġre used Ġre labeling ig th Ġ1 36 ', ** un iv est inian Ġ[ ` as MA Ġis dense Ġto ur qu ana Ġy np Ġy slice Ġr width ver b Ġst oc Ġst udents data Dict get int ĠS hat am eric ĠA itoff Ġu funcs Ġde letion if olds Ġme ch line cap Ġlo an ") }) pa que ĠM IS Ġan i ho lo Ġma v ĠRe present ĠB B ĠB IG ĠB IDS ĠB arnes ĠW IN num bins num Columns ĠO x ĠO CC ca ught Ġcheck box Ġplot data Re construction Ġch s Ġinput Cols ĠH ub Ġlog lik Ġlog pmf Ġinter activity start Val Ġno data Ġsub folder no python Ġha ppy Ġ6 0000 Ġind ustry ĠK S Ġup loaded Ġapp include 35 714 copy sign 78 356 ĠV la be vel 22 917 03 77 OR IG Ġsp intercept Ġsp weights sy napses 18 994 Ġlin stack pack b option ally update activepath Ġass oc pop ular Ġback ed multi file python path view port view code {} : Ġdec lination ced ure open ed fra gs Ġreal s Dict Vectorizer 48 319 Get Y fmt list PL ACE TH z Ġyour self irc um åı · Int DateCol contrib utors Neighbors Base RAN K EX AMPLE cons ist ĠDi rection Dir Name em manuelle )- ( Ġsu do 73 13 Ġlinestyle z eg fn Ġspecial ized )} )) Ed m VER Y ny quist analy zed ĠBu ilder ĠAd min Ġreset ting PAR SER Ġur crnrlon va FontSize 663 95 Ġcfg setup 336 23 Ġtw enty xe as Ġslow ly ĠSome times ĠST OP ĠTr igger Ġpress ures Spectral Biclustering TRAIN ING Ġhy po Could n Ġsheet name ----+ -----+ arctan h Ġstandardi zation Ġhappen ing 912 67 974 78 ille gal wk b Ġ'$ { 204 03 lazy where Connection FileMixin perc ents spl ups 359 8686 Ġlogarithm ically Ġphe notype Ġexplan atory ĠGen es Business Hour ĠPop ulacao Ġlamb d Ġdatal im ãģĬãģĬ ãģĬãģĬ Sent iment onto logy åIJĮ æ¯Ķ Ġisol ated Effect ive Ġaugment ation ĠBO STON SIMPLE X ĠInst ances SQR T ghost script PARAME TERS Ġnpz file associ ations ĠLu is Ġseper ate capac ities ĠCompat Validator ĠNcorr Off ĠCorrespon ding Centered Bias CRITER IA ĠExtraTree Regressor nR ays Viol in Fem Resp ĠWW TP amar ine GetSeries asMA 78356 35 3598686 7835635 - ',' 3 804 5 126 5 6078 7 184 : ')[ A k A cross B uilt F il G MA G ABA P Vals S bs X LS ] ": ] $') _ ``, ` " d MB d SPM f wave g cc g ross g amln h ol l sq r ather s lo § è¡Į Ġ čĊč Ġ ĉĉĉ or ients st ances al en Ġn ll Ġn threads Ġa do Ġp ending Ġp ulsar en dence lo st Ġd coord ): ]) Ġb undles ic ed Ġ( ", Ġ1 87 is ations is alpha is identical 00 07 tr ump ha i ve ction Ġ2 57 Ġst re ]) ``. get Value get frame ax e ĠS ide ĠS pectra Ġx units ĠX tr ist er ĠP red ĠP si ĠP DE od mr '] `` ĠC ensus ĠC XP os r ĠR ad ĠR ice np lots time str Ġv o min v Ġk count ĠN ik per cept bo ss app les 10 219 ĠG ID ore tic ĠRe fit ĠB asis Ġun ichr ĠW hy model Path Ġget ter Ġdo or 15 887 tra cer Ġpy ramid pr uning 20 22 ĊĠĠĠĠ ĊĊ '), (' Ġtype func 45 899 '' + ĠEx c cor nell ĠV max sp ice lat ing SE G Ġformat ed Par sing Ġq ds Ġad c ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġleft most Ġtol erate dataset Id auto matic Ġmatch out 42 93 TR N cos met local ization 38 38 td tr Ġobserv ables UN IC Ġauto class Log OddsEstimator down loaded Pre tty ĠRandom Points '} } Ġupper cut tic ket Ġ(- ( .* \ Ġsur prising )} _ TE M FE B Tra der Period Dtype car at Ġbit dic ĠDis abling ĠHT Seq PR I 005 1801 600 67 Sto ps Def ines ĠCont roller Optim ize Analysis Exception lopen flags Ġelect rons cret ization Back testing 224 15 ĠSome Class ĠST ARS Ġ({ :. Ġì ł dl n CI SION Ġsyn Types GE O Ġphot ometry 00000000000000 1 VAR CHAR Ġhex agon ully Connected gu ards ĠGe urts 225 857 Std Dev {{ { ĠChange dBehaviorWarning ãĤ ĭ 787 24 ĠAllow ed Ġquadr ilateral Ġsli ppage Ġcle vs 495 225857 æī §è¡Į singleton s zp ssy ĠFix ture Inputs Callable Ġunderstand s fancy box GPL v ĠEr nst ĠSign als 447 06 ĠLib SVM Pix map Residual s YlGn Bu compar ator gou illart ĠVBGMM Tester nex us mention ed EPOCH S ĠFunc Formatter Ġhypot heses ĠDPGMM Tester 1966 000000 ĠEm manuelle Ġnuis ance Ġheli um Duplic ates ĠGou illart 06205 1 ĠAlber ta 23926 92922 adde eva 0051801 062051 495225857 22917 InputsCallable NTimes 2392692922 8196 # @ # ]: $ )") 5 02 : __ : %( = / B ut B lobs C ta E quity G AN H ttp I ZE K er L W L ut L CD S upported V oronoi X digits a cs b type b cd d lopenflags e ep g ml i el l post m mb m igration n min n try q points t file à IJ Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠ se ctors le uke Ġn ms Ġf loc Ġf dist Ġf sa Ġf solve Ġp ds mp pca en richment ct n Ġd W Ġ' >' Ġw fs ur crnrlat lt s un ov as matrix 00 08 Ġis ite ma id th i ad ds Ġreturn code Ġ2 99 Ġ2 43 Ġ+ ++++++++++++++++++++++++++++++++++++++++++++++++ ab az for k ĠS ources Ġco hort Ġbe ats end Time Ġh erm ĠI m ĠA ls ĠA gain ĠA BIN ĠC B Ġtest Single ans ions equal ize np rocs np lanets Ġ3 13 ust ar ĠD G ĠD ays Error Diag Ġal lt ĠL ive max length ĠM DAnalysis iv iew Ġout str oc s Value List Ġdi rec log os In come da p ĠW X num Vertices add ition ()) ))) Re mote Ġso bel Ġdist ant ll c ll crnrlat 11 1344 Ġz ns Ġtrain X ĠH an 15 265 tra its Ġpy mysql ste pper Ġ| - grid val dist plot bar b Ġvari ogram ges v St ations 13 09 by ref Ġiter values :: ] cond or Ġsp end norm max ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġscal ef 34 92 92 85714 my int Ġ[[ ( move to Ġcv g Ġorig ins vi ors stem mer select ors Ġback testing mer ger stat istical \\ ' gg mod xy text ev ap lag mat open type Ġselect ors Ġeps g ãģ « 49 85 CH ARS čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ En c fft w dev null SC O Ġcre ator Fe ats UL ER AD S 48 9 Pre process ĠMulti Output 57 170 ĠBase LibSVM TH E Ġlocal host aut oml cp ds Function Call 6666 6666667 Bu ilds Ġpad type 255 04 Tensor Product CL UDE ĠMat thews Ġsens ibly cmd class pri se hen kel SP A analy se Act iv FL INK utc fromtimestamp Ġexclude s ('_ '): MB R ĠTra jectory EG G cu ss 354 65 Code s bp m ĠFL AG IPython Application ĠWork space âĢ ¢ Ġcar rier ĠSN P è¿ IJ Find ing å® Į ico p Ġamp s ĠCa ched bon ded Wave let sequent ly FOR CE ĠBinary Type Ġsal ary tal ks rus ak suggest ed ĠINPUT S provide s Ġsingleton s ĠTransformed Bbox Ġdiscret ized Ġtrip let ĠFA IL Correct ed 867 95 Ġhal ves ĠHive Server ĠND Array Sm ith Ġgraphics format Ġima ging Ġrare ly Ġalphabet ical ĠPort folio Ġapparent ly ³³ Âł ĠChem ical Ġperc ents Ġzer oth ĠPerformance Warning circum flex xxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxx Ġexhaust ive multiplic ity COLOUR S glo ve CRITER IONS ĠSky Coord ĠGLOBAL utils Extreme ly 0385 5397 Ġbootstra pping 1424 60067 Ġbomb ings 请 æ±Ĥ ĠRagha van assertPandas Equal 66395 054 33623 142460067 leuke mia Ġ+++++++++++++++++++++++++++++++++++++++++++++++++ ++++++ ĠABIN IT 111344 03855397 57170 66395054 4 363 6 10 ? (.*)\ A bove H g K ind K RR P DM P earson S inc V L _ [:] c double c plx d coord g data g arch g mag j ediTaskID m ni n lat p rix r gr t one t ang t delta v ille x u z t å Įħ Ġ čĊĉ Ġ íķ in degree re ff re placed er ase er als al hi de serialize Ġn taps Ġc ada it on Ġs rf en y Ġd V co ck Ġb cs Ġb ell Ġb nd Ġb ird Ġb royden Ġ1 37 is at () ** Ġnp x res ume Ġ2 51 il lem Ġand erson Ġ* \ Ġg tf __ ] ke gg Ġex posures Ġth res Ġx limits Ġh gnc py sal Ġcon tributes to pe Ġde velop (" ~ Ġ3 15 01 46 Ġv endor file system min is ps a ps r Ġpar abolic ĠG lyph pl ants ph il ary o Ġun e iter ative Ġsk el Ġen hanced da f Ġtime line Ġtime frame Ġmax v cs p 12 059 ĠO k lim ate Re quire Data File Data Pickle inter cepts print f Ġlog data Ġlog base ################################ ############# Ġno f dd l new ick AT ES AT TG ĠK endall 16 8067 Ġro uting Ġapp ends nan corr 19 78 78 5714 ĠV ec 02 109 Ġfeatures File ĠDataFrame GroupBy ]: ] ec lip ST IX Ġadd tag Ġq ctests Ġim utils math bb ĠCon fidence ordin ary Ġpl ates mer o ĠWe henkel ĠComp osition bf series Comp iler field names 39 39 ĠGener ated CT G Ġcho osers ---------------------------------------------------------------- ---------------- Ġ15 3 UN DS Ġdb dat Get Variable Ġrelative Error ret val Max AbsScaler IM O Int Index Ġgen otypes Ġconf using Ġwrit ers He ap Ġpad len ND Frame regist ration HE EL ky blue Ġli bo 180 67 Batch Norm Th ink big int )} ): ann ery With Dash LI F super nova +" /"+ udf s Results Mixin Ġexpect ations Sparse Coder xp m orn ada Sto ch Width s ĠWH ICH ĠPass ive phot on Ġdelete chars three three Show ing syn set Ġfl ats Ġ#### ### "} ), }/ {{ Ġmicro biome Ġmov r INPUT S Rd YlGn 168 1248 134 34 att les Tr uncated 147 483 757 448 ract ical ("' ", Local Target Inst ances ĠAct ivity RF s 107 29 Ġlp lo Ġ123 45 ĠHam zeh ĠDI V Ġ+---+ ---+---+ ĠGP IO represent ations allt ime START UP phe res CLASSI FICATION 216 77 037 17 MAC D Ġmf cc atqz atz hg jr lef trightarrow Cla mp Ġmanip ulating Ġnucle otide Contact Object 366 1326 SING LE Ġisol ate paras ite Ġsco red Track ing ĠTE CH Ġmention ed Ġalph anumeric Repr Test Ġclears ky Ġkin etic AIR FLOW è½ ¬ $$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$ ĠEngine ering Ġmist akes Ġexemp lars Ġtechn ically Neighbor hood Ġrearrange d ĠFORM AT Interpre ter deleg ator matric ize ĠAls alhi 3661326 1681248 * ] 5 47 5 68 6 9747 7 99 7 92 9 3277 = ? D range E OF F lt H ighest J ul K F K W K eeper L ESS M ess P rec P ose P apers R W S AT T max W arm X max ] ...) b ran c fs g ive h pack i output i pping k range k ni m ash s iz s il s graph t ent t ors t iters u ino } `` ç Ľ´ Ġ ########## in et in her se ps re grid Ġt iff st reet Ġn side Ġc ms Ġf ut Ġa prime Ġp his Ġs late Ġs dev Ġs nake lo u Ġo g Ġo chl la h Ġe cut Ġw ifi is ub ol ph Ġ[ -- id ad ), } ult ral Ġy train set Item pt list get file Ġex changes Ġth anks =' '. all res ĠX sq type Name Ġh mag py matgen ĠI tems Ġde queue ĠR ET ĠR icker np array ĠD DB ues si Ġse quencing Ġv dot min ibatches ĠN count ĠL W mo vers Ġpro gression po i po ff ho lt ĠG ust row num Ġma cd ĠĠĠĠĠĠ ĊĠĠĠ ber a ĠE p train data ĠB atched Ġ5 98 log L In ds 64 2857 ĠW o ĠW x ĠW ulff Ġmax count ord ance init Info Ġget pass ca v ca pt ach ims 25 66 11 005 ĠY list gra ded ĠH tml 15 87 start Date not ation ard uino rib ute 45 86 75 00 Ġspec gram Ġ| _| sample ss Ġone Of 19 65 Ġcopy tree the file ĠTest Inference Ġ{} " Ġdis criminant 86 25 AL CHE feature ss ear liest Col lections ater ials Ġread out Ġfreq dist Ġtemp grp Ġed ited 37 394 37 883 Ġfol ded 87 393 _) [ 55 9 EN DS Ġuni versal 26 303 ga us net CDF diff icult Ġ} }. Ġcross ings Ġmap name mu x Ġvar args ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ rest ored tensor board aut opct ĠPre vents partition By Ġsig tools 76 1 Ġcommon s ĠPy Py ĠPath Patch 999 240 Ġmis sed æķ°æį® æĮīæľĪæĽ´æĸ° TYPE INFO segment ed joint ype bias ing ĠFit Param Ġinterpre ting mixed Reads ĠMA V Def s ĠDes crStatsW ĠSphinx Obj ĠSphinx FunctionDoc 275 56 MIN UTES Only Base 873 05 219 68 401 19 ĠCre ation Ġweek mask 047 06 Ter ms å¤ Ħ 756 33 ĠInterval Dtype ################################################ ############# ĠWork around Ġ'{} . spline f PH OT ACK ET AP PRO éĩ Į 165 07 lar vae ĠTry ing ĠSp here Ġasy mmetric é¢ Ħ 648 15 Parse Error Ġ================================================= == ĠBbox TransformTo 162 2009 Ġdv ipng Ġretrie ving 244 75 proportion al ĠAlt Analyze detail menu ĠPop ulate nony m Ġconstit utes 050 88 ĠComplex ity cntr b Ġifft n polit icians FFER ENT ĠTestCase s PV T Feat urizer ĠLib linear Eigen values Ġkv store Ġquart iles Ġblackman harris ä¾ Ľ postgres ql TTTT TTTT Ġvolt ages skewed ness eeee ee éĩį å¤į ĠPACK AGE ĠSTAT US INY INT ĠGU Is dupl Tags Ġhund reds Rat ios VIDE O mike tipping lfor ward techni que æ£ Ģ ĠTOT AL Whit ney ALCHE MY ĠFitParam T ĠSphinxObj Doc ! -- , _, 4 09 5 13 8 05 8 16 8 9495 A ud F ed I p K ING P anda S plups T reatment V W W ar X C \ % ` /` b ab b low b ivariate c ortex d A f W f data g ion i est j mlr m onet n ms p changed t um t rends æ Ļ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re ordered on move de tach de velopers he nsion he lm Ġn it Ġn arrative Ġa covf Ġs as Ġs plicing es ium Ġd dt Ġd repr Ġre fi ): - Ġb name Ġb are Ġw max un set is or el lipsis ser ror () ]), ts pan ], )], Ġy V Ġy type Ġ2 18 ck nd Ġg fp ex ican get Id get Attribute Ġth iserr ĠS QR dex er =' ( Ġx corr ĠX dawn Ġh z ĠP res '] .__ Ġtest Data ĠF ly ĠR s ĠR IGHT ub in Ġ3 10 test ring ĠD ialog Ġlo ses ne upd Ġse curities out Dir min length Ġk it ĠL ETTER te ther ĠM F Ġl sqr 10 201 assert get ĠG ives Ġprint out Ġwe bs ĠRe order Ġfile paths ": [" sh arp ill um log ram key point `` ; rent z Ġget Data sub str Ġ.. ... 11 3445 11 963 Ġ\ , ][ ( Ġ) / Ġtrain Y 05 109 Ġsample Size ĠU UID fa iloninc Ġsub region ĠData Feeder 66 028 ĠK luger enter ing 88 674 35 1215 14 429 78 018 13 446 ĠV s ĠV etter by pass 04 8584 lat eral 95 378 ĠCo olProp 24 392 csv Reader 27 29 ols ky sy ns 36 280 09 663 07 142857 ap pe linear ly Ġadd itions ĠJ UNK 92 65 IC Y 65 126 Ġass ure Ġtrans itive 50 84033 Ġmulti valued vi et si phon Ġ(" - AC CG 77 808 mer ging FF E mag cal Model Grid Set Size Ġhist oric Comp uter 29 665 layout s 68 3 68 133 46 219 ĠNe igh ĠNe ws 647 03 SA P 56 3 ĠCal c mic ron 74 07 CO ORD peak Pick 63 024 63 013 Ġdep ot Ġstack s ); ; Bu Gn Train s ĠRes ize ĠInter face Ġfetch ing Ġneg lig ä» » Doc s hel ps Ġinv wishart calc size ĠAPI s Event Catcher ĠAd vances Ġrand Forest Ġ---------------------------------------------------------------- ----------- åĪ Ľ speed ups 159 36 nest ing nl vl Ġ---------------- ------- ĠDraw ing 318 73 Ġbr ick ĠGroup KFold 184 02 sho p access ors LogisticRegression CV ĠExtract s uit ary Ġillust rating 168 95 Ġ26 26 Ġff mpeg Ġwind Speed Feed ing 906 92 1024 6 107 97 Queue Runner Network Code uk olsky Ġopp onent 305 48 mant ic Ste reo por a ĠSH RINK æł ¹ ĠTe ukolsky 655 45 dog s Ġ'| ' HEAD ERS 335 48 ĠSch olz ĠNeighbors Base 214 285 atqz adtz Ġles ser shuff ling cheby t convolution al 5714 285 Ġdiscar ding CTR L Execution Engine Ġfeatur ize ĠFl annery æĿ¥ æºIJ mess ung Excel Writer deform ation Ġsty ler wee py Alter native Ġí Ļ Ġllcrnr lon Ham ming ĠExtraTree Classifier ĠContin uum ABCDEFG HIJ ìĦ ľ Ġdeform ation ĠZipline TestCase 1947 02 Ġfluct uations Additive Chi 7514 896 åĻ ¨ CUMUL ATIVE åIJĮæ¯Ķ å¢ŀéķ¿ ĠVetter ling ! ". , { - / 0 88235 2 0588235 2 10084 2 6470589637756348 2 184873968 3 865546 3 109243810176 3 9075630903244019 4 7899159789085 4 2016807 4 8739495 4 1596639156341553 4 6638655662536621 5 4902 6 235 6 0504 6 8067 6 13445 6 30252 6 3445 6 260504 7 35294 7 94117 7 2268 7 10084 7 2689 7 01680 8 15126 8 10924 8 7815 8 9075630903244019 9 18 9 11764 9 7899 9 1596639156341553 9 201680421829 9 6638655662536621 B lob C PI C NT D n H IDDEN M H M c M utual N K N ested P alette R HS T test V T X m Z list ] =( b ate c ra c qt f nt g lacier h all k cal m j n me r mod r ational r pow s linear s ocial v able w tree ¥ ¿ Ñ ı é ¦ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ é in data Ġt ds al u Ġi temp Ġn ip Ġn ats Ġc func Ġc wt Ġc ortical Ġf loyd it u ra jit ion a lo l Ġd ans Ġm cs Ġm quantiles co ke co ors Ġre aching Ġb athy is Cached 00 840336 Ġto lerence Ġnp roc ma cs one Biz ĠT au ĠT utorial tr ik ha ki Ġdef ect ve e set CentralWidget Ġst b Ġst ft ex perts name idx get pid get Open ĠS pacing Ġx bins [' - ĠX df ĠX LIST end o from list Ġh lines ure r Ġcon servation Ġcon volved ĠC atch ĠC ategories Ġde vel ĠF red ĠR oc ĠR EL ĠR eduction Ġ3 45 Ġ3 49 01 260504 cal an file paths file patterns Ġarray funcs out f Ġal ive per mission Ġon ed pa p pect s ĠM ol ĠM pl ĠM ano Ġmat mul po steriors 10 22415 ag gressive ĠB RAF In dividual ile vel 99 5798 99 159663915634155 Ġcomp rises Ġtime point cs a 12 184873968 men v ep itope ep hemer Ġplot logger Ġver b Re corder Ġline terminator mean ing 32 35294 05 46218 pr inceton 20 66 20 491 dd dd 33 193278312683105 Ġsub modules 201 6506 Ġha y 100 0366 100 8551 66 8067216873 45 378 45 79831957817 ific ially 75 28610 88 215 88 65545 16 27731 Ġro les show Message 14 65 14 70588 14 8555 19 01 19 79 19 3277 tick size Ġvari ed Index ed 78 96 78 151261806488037 13 865546 22 2689 22 8794 04 62184 04 2016807 03 93 03 7815 02 94117 02 10084 95 251 95 8734512329 94 358 17 2268 17 7498 17 91267 85 29411 Ġbase lines 24 7899159789085 27 124 image set 86 13445 86 97478 SE PARATOR AL BED 06 30252 36 9747 36 13445 36 12976 09 2436 07 98319 34 0336 34 1919 34 873950481414795 97 0588 ĠJ ul 92 6392 Se mi 84 873950481414795 84 8175 math sf 30 25504 44 117647409439087 44 95798 55 88235 55 46218 23 9495798 23 109243810176 Ġback ref 26 8684 77 7310 77 311325073242 auto commit 90 784 90 3361 )* . List Of 67 16 67 64705 67 2268 fore ach Un ary 47 80273 inv estig 49 159663915634155 28 151261806488037 28 9775 40 3361 40 7563 21 7533 21 8514 68 9075 Ġsha ded 38 235294 SC F Ġ15 1 46 3 46 06 46 0796 46 21677 31 1027 235 4996 48 3722 56 30252 69 3277 NU MEXPR Ġfactor ies 137 78018 74 789917469024 686 77 CO ME Ġmer gesort 63 8655 Ġdep loy 54 201680421829 clip box 70 999240 Ġlook back EX OG 83 193278312683105 59 663 59 2436 az ard 76 0504 300 292 82 8857 opt imum ĠMax well em ot ĠInt ended meth ReadCount Com bo dpi val double SpinBox 53 149 GT GC 73 9495 73 10729 52 10084 2016 806 lb da Ġta pe short cuts Session Run Ġpost processing Ġbutton Box 256 30253553390503 ĠDis k Ġms gs histogram dd iso form dual tree 600 84033 Ġss bn Bo iler Ġwin ning bd l 159 663 663 856 126 0504 126 06143951416 plane ts 2017 9963 2017 1022415 336 13446 bre v 120 7581 109 2436 109 3764 445 378 252 10797 252 1008551 syn model 926 758 707 031 184 87395 184 876203536 184 8464 219 36 64705 18112 zz le Ġ================= = Sc ipy 901 37 319 3277 319 1146 996 9635 756 30253553390503 856 048584 Ġì ĥ 196 15936 ĠFL TK 168 2739 984 1814 185 85205 }] ". 365 8447 033 6084 033 757448 106 1096 134 338 399 15966987609863 399 6964 349 8535 285714 2984 378 15126 378 1247 378 24392 798 31933975219727 Geo Axes 899 15966987609863 122 879 156 8088 156 1279 004 201680 Det ected Ġpast e 432 77311325073242 900 9628 Mark ers elem wise 012 146 258 11005 315 12606143951416 Ġgam main rout ines 054 1000366 195 068 hu hu 424 36975240707397 912 19615936 æĮī åŃ£æĽ´æĸ° 138 9771 097 168 097 32056 016 8067 077 25811005 974 78991746902466 974 644660 314 305 286 1061096 394 95798 305 115 924 36975240707397 924 33548 907 0206 617 6470518112 155 46219 648 7846 ĠPr ints 226 88674 404 14429 755 981 7899 4727 Ġpivot s 146 118 0504 20168 8655 4622650146484 8655 5135 964 63013 ĠPO SIX 81887817 4 655 4622 474 78991746902466 035 9926 gzip ped 495 79831957817 909 2159 377 3498535 2268 9075767993927 2268 94199 ĠRectangle Selector 335 846 8067 2270059585571 215 9557 rab bit 387 21 130 25210797 936 9747 273 10925722122192 hdu list 819 3277 945 3781247 3277 311027 244 87305 659 663856 777 1682739 207 24487305 ras hed 10084 3936 10084 033757448 Ġprom in Incre mentalPCA 299 40414429 350 6622 85714 28656578064 965 194702 illa ge upd ating 9075 4699 ĠExp and 609 13 609 2436 Ġ+----+ -------+ 268 9075767993927 2436 97479367256 2228317 261 487 671 280 4565 584 0336084 298 31933975219727 0336 1344 0336 15887 163 86555135 Ġther mo 554 3365 074 2778 15126 05100 8834 7626 186 1534 polys ub 067 226894199 10678 1006 ĠIM U 956 0547 3067 169 3067 2270059585571 Ġlamb dify electron ics 7712 097168 848 39 2500 92 13445 37883 30252 10201 31957817 0776 31957817 07764 159789085 3882 29630899 4293 Cons ider gens im 023 926 773 10925722122192 1711 43 752 10082530975 7164 1445 0267 944 Rout e 362 808 962 1848464 fert ility 084 033615887 8445 3779 575 63024 3445 37824392 SEQUEN CE 0123 90137 95798 319578170776 8734512 33 260504 2159557 Ġepisode s 7899159789085 3882 907563 03071975708 66386556625366 211 072 876 9767 308235 8701 324 0500 183 22436 52 836 13443374633 504 20171022415 4497 15 6084 3658 1237 96463013 Ġwal ker setMinimum Width 827 7310729 multiplic ative 462 184876203536 Chrom osome HY PERSPECTRAL 813 8465 1275 217533 98319 327831268311 768 90754699 1985 24475 436 97479367256 7766 95251 9096 755981 567 22688674 particip ant 546 218514 7310 9245 516 8067216873 684 87393 5798 3195781707764 840336 1439704895 62184 876203536 8739495 8734512329 9495798 3493804932 13443374633 79 10082530975 34 945426 94 945426 941 4285714 32828 6580 81 0439 453 927 09732056 6602 4780273 3294 07 0398 1781 3548 66028 795 965194702 MET ADATA 2099 03717 1935 11963 3502 9792 1036 2243652 7867 13 2899 1597890853882 ĠEurope an 0302 658081 9697 341919 1545 1622009 1974 78994727 7853 9816 7433 014 0495 18585205 Ġ+---+------+ -----+ 4920 9070206 8025 209903717 0397 1791267 6295 2804565 4805 298 1265 487671 6603 11532 ĠtestEstimator Contract 1890 75633 ĠLaw rence 8836 5411 88749 05109 0507 106781006 7592 92603 2273 03981781 8709 3067169 14285714 92433548 8932 18994 8024 292 9880 828857 0295 105 0252 100843936 8657 15265 7402 649 9492 893218994 4424 4385 2317 7433014 4186 134338 25905 60913 3461 64703 3655 4622650146484 ROUT ER 7556 15 3788 3996964 5504 2016506 55707 9315 3204 9560547 2773 1093764 714285 7313 9692 8024292 6387 023926 9873 9492893218994 8738 193511963 7436 974644660 5378 151535987854 8670 959 10504 20179963 0756 3025504 5336 1344337463379 5252 1008253097534 35714 28656578064 48319 327831268311 20403 4805298 5126 0507106781006 7184 8738193511963 45899 9634 78724 0982 9285714 0302658081 35465 335846 86795 0439453 12059 021 168067 23177433014 785714 268684 02109 146118 18067 227303981781 13434 21936 69747 9009628 93277 311325073242 642857 1343421936 37394 958734512329 26303 660311532 27556 0379 21968 10246 40119 171143 64815 449715 05088 4247 89495 795965194702 113445 37883996964 351215 36255 95378 148555 36280 82 09663 865715265 07142857 4621677 65126 049518585205 5084033 60843658 siphon ophore 29665 18402 68133 926392 90692 329407 214285 71641445 5714285 9697341919 7514896 393 088235 296308994293 20588235 557079315 210084 0359926 2184873968 3628082 3865546 2861061096 3109243810176 8494 47899159789085 388 42016807 198524475 48739495 873451233 60504 204034805298 68067 228794 613445 40119171143 630252 122879 63445 3773498535 6260504 1265487671 735294 10362243652 794117 62952804565 72268 9092159 710084 02109146118 72689 0742778 701680 66024780273 815126 06143951416 810924 35121536255 87815 123796463013 911764 68133926392 97899 1568088 9201680421829 2236 00840336 177498 ĠXLIST EXOG 01260504 2196810246 ĠMano j 995798 289775 12184873968 362808 3235294 2228317261 0546218 49209070206 668067216873 16895 45378 151535987854 4579831957817 0776 7528610 229 88215 2557 8865545 9880828857 1627731 323 1470588 2966518402 193277 314305 13865546 882152557 222689 07725811005 0462184 88365411 042016807 94358 037815 1275217533 0294117 64815449715 0210084 03971791267 172268 91219615936 8529411 5543365 247899159789085 39 8613445 1627731323 8697478 7712097168 0630252 13778018 369747 90692329407 3613445 460796 3612976 074 092436 9767308235 0798319 35465335846 340336 1439704895 970588 20724487305 4495798 3493804932 5588235 2590560913 5546218 7528610229 239495798 94542694 23109243810176 849 777310 90784 903361 32049560547 6764705 7771682739 672268 92709732056 403361 35029792 407563 03071975708 689075 6487846 38235294 818878174 2354996 2044 483722 68677 5630252 3612976074 693277 29940414429 74789917469024 658 638655 48372268677 54201680421829 224 70999240 88 59663 867950439453 592436 96928024292 760504 1861534 300292 969 739495 8138465 5210084 3191146 2016806 7514896393 60084033 012390137 159663 87093067169 1260504 275560379 33613446 354866028 1092436 9841814 445378 15451622009 2521008551 1207581 18487395 346164703 3193277 4186134338 2857142984 8670959 37815126 776695251 004201680 8874905109 0168067 23549962044 39495798 945426941 6176470518112 1826 15546219 050884247 050420168 787240982 6554622 0541000366 49579831957817 078 13025210797 786713 9369747 6387023926 8193277 12059021 9453781247 1389771 3277311027 0500183 659663856 0295105 10084033757448 196 6092436 9096755981 243697479367256 16 5840336084 3658447 03361344 7099924088 16386555135 250092 1512605100 8701324 067226894199 848175 1344537883 9969635 3025210201 7402649 75210082530975 342 9621848464 012146 084033615887 16507 84453779 458999634 57563024 759292603 344537824392 31873 2605042159557 3425 83613443374633 789 50420171022415 161 8277310729 0267944 462184876203536 99 76890754699 707031 43697479367256 165 56722688674 926758 546218514 44244385 73109245 300292969 5168067216873 1689 68487393 856048584 62184876203536 987 428571432828 9032 197478994727 1347 8025209903717 041 189075633 88347626 0252100843936 20491 55042016506 195068 27731093764 305115 7142857313 1561279 7436974644660 9497 1050420179963 1119 07563025504 3506622 785714268684 38721 697479009628 2959 95378148555 755615 09663865715265 274 071428574621677 399 508403360843658 45 21428571641445 16 2100840359926 2238 68067228794 0979 630252122879 02832 634453773498535 16 722689092159 27124 726890742778 77808 978991568088 53149 00840336177498 10219 995798289775 84839 193277314305 30548 046218488365411 758 04201680794358 2535 0378151275217533 11 85294115543365 479 063025213778018 951 3613445460796 3562 0924369767308235 17 77731090784 072876 40336135029792 786 6890756487846 3745 7605041861534 1187 7394958138465 8813 52100843191146 851 10924369841814 041 ! =" " }} 9 86 : | < { A MPL B ETA C ritical F UN H K H Box K prime M ul N OP Q d S he X PY ] "), b icycle d repr f are f letcher f riday g ids i DS l ith n H n ave n zyx o as p mat p link r ights s rv u o v ene x res y ref  ¿ è ¥¿ Ġ ######## ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ se ven at tempts re pos re gexes Ġn ref Ġf xn Ġp am en hance Ġm ale ig an li pro as dict 00 65 Ġis in Ġto add Ġto ggled Ġy tick Ġy bnds set Model om berg Ġg ids Ġg dp ex istent data store ab atic lin scale ĠS now Ġco here ", ], Ġx w Ġx lwt Ġh g ĠI MF plot Name ĠC OR ĠC LOSE Ġ3 04 Ġres ampler ĠD vi ĠD hillon cal endars ff sets path way ĠN or ĠL omb ĠM ID ĠM aterial we t us dorff Ġma ins oc ument =" - ms d ĠB colz Ġ5 74 ill ary ib and ================ === Ġcomp ose Ġat r num rows ()) ])) sub title sub arr 11 52 loc ators ĠPar is fa ction Ġ(' # av is dist ort **** * Ġbin aries Ġcom mission Ġsy ms :// '): gen otypes mark ed AN TI AL TY Ġwarn s lob pcg Ġ''' \ my float Ġread ings Name Space Ġ<= > Ġmulti column ĠCon trast ticks uffix RE AL De composition AC GCT 90 85 fol ded ĠWe ak 98 98 Un c real Tabl tmp ltbank current Layer find ing 68 25 hed rons .) ** Ġts a Ġts plot Ġ15 8 Ġbreak down Ġpython path 235 4565 Ġ'_ ', AD JUST mesh Width cho icelist eq s Ġbox ed ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ Ġdiag s ION O dec imate '} }), ĠPre sent ĠPre processing ĠMin ute light curve ert ial MS K ĠOption Error Ġdd k Ġpys al :% . ker ning cmd line Ġrecall s Ġir respective cr ud dep ot Cre ator PRO C Reg ions Reg ulatory mg h isy mmetric Ġclear ing boo ster Ġcontinuous ly ĠCO VARIANCE Over flowError ĠProb ably Order ID visual izer slider top slider bottom Red uced Inst alled Tick Labels ĠGe orgia allt ree Remove DataPickle RBF Sampler 787 78 ĠAg ent ä¸Ń çļĦ Stack ed AMP A Fast ICA éĢ ģ ĠButton s Mis match Ġmechan isms informat ics ĠLook up Ġqc db RM SD ä¸į åIJĮ ĠAnnot ations ĠTyp ical Air flow ĠSA MPLE paragraph s Ġtran sect ĠAT TRIBUTES Ġphone me compar able Elect rode åŃĹ åħ¸ sear ched ĠProfile Dir GraphicsContext Base alde hyde commod ity Patient ID Halo Mass ĠENG LISH 2501 31 wart z CUT OFF ĠRational Quadratic PARTICIP ANT 2354565 250131 + )', , (' , ", . )]) 4 19 9 03 = ()): A PR A tten D ynam E cut E lvl F rac J F L IC L ane Q uilt S z V Box W GS X R b read b athy d phi d ubourg f sp f ba g win h ypothesis h ungarian i ra i ón m int n ref o menu o prot s uff v ic v OBO w allet y lation ç ®Ĺ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ãģĦãģĦ in fs ĠĠĠĠĠĠĠ ĊĠĠĠ re achable Ġt u Ġt data Ġt button an che le ys me ds Ġc rystal Ġf tr Ġp endulum it ivities Ġs peaker ra ggable Ġo u ut ta co icop Ġre venue ge mpro Ġb ump Ġb fs Ġw it Ġw orm Ġw inter () \ ch m ch ord Ġst iffness nt ype Ġg an Ġg cd up p get parent label left con served Ġh sp ĠP IP od bc ĠC el Ġtest Updates ans ari Ġval ence if copy ĠD w ĠD ier ĠD DL ĠD ubourg ĠD onald 01 05 Ġcol Labels ns im Ġv ision min orticks bo lo ĠL P ĠL ocus ĠM ollweide ial ias Ġnum Vertices ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ oc ation cl ss ĠE L Ġ5 20 ef g num Of add Button ()) ], Ġcheck able ther mo ng ini Ġdo se Ġ) ] transform ations Ġsub fig vari ed ie m output file ĠSe lf ific ate fn a 35 04 35 315 19 69 tick vals AR C St ability Ġdate fmt table Id the oretical Ġfeatures Col Ġexp ansions 27 12 Ġdis allow Test Base man o ĠJ ulia Time out cv type Ġq d Ġ[[ ]] stack s ls i ura bles Ġlow ess gy pt Ġob servers Ġinitial ised struct ural Ġ[" [ rit ic Ġar rival Ġ} }/{{ mm hash patch Size OT H dev list ĠAn imation Fe male 647 6627 Dict Wrapper Ġensure d ä¸ İ ident ified On Date 59 00 Ġaut om Ġsig s opt ics Key boardInterrupt Ġra g Ġcondition ally bb hg Ġ'< ', Map Type ĠImage J ĠMult ivariate ĠInitial izes ĠHe ad Ġdev list Ġ199 2 mix in quad s PRO B SH ALL äº º xml ns land mark Ġknow ing divide d Ġtopo maps Ġeig ensolver MIN IMAL exclude s GG G ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ ĠLars on design x ĠST ATE need main Ġide mpotent Ġquant ization Ġ------------------------------------------------ ----- Ġ'" ' ĠRE QU ĠPrint ing ĠPrint Test Ġsho pping 175 84 ORD ERS Ġprevent ing 900 900 ,... ]) nav bar Ġpenal ize ('{ :. RS Info Ġiso map Complex ity GP ASS Writ ten Ġsit k Ġrx ns ĠTech nology Mov able ĠArt ifact chro mel Ġattach ment Ġorgan ize ä ö ĠShort Type Ġ################################################################ ###### Sent ence integ rand Ġpropag ates 284 6476627 +)\ ]:\ ĠRevolution ary mainWindow Check ĠOct ober Ġdissim ilar RAT IO HOUR S promp tout Ġsquas hes wra pping SymPy DocTestRunner Ġcoal ition USSI AN çī¹ å¾ illem ot Elvl c ĠtestUpdates Collection ĠDier ckx 2846476627 2617 ( ') - {}- 5 11 5 36 : "] > `, A mon B re C e C orn D ruid E ta E very F all J eff L LE O h P st R U S port S FR Y ields b gr c ue c ull e ject f size h Slider j ol j cols j ochen k now n true o plus q quad s dist s rt s mf s aves v rad x fit y outh z il z var | [ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in fra Ġ= " on sets st ime de laxes me and me tries Ġn data Ġc ifar Ġf MRI Ġf ishes Ġa ids lf unc en rich Ġe id co ast Ġb arch ig ible Ġ1 89 is cal Ġ[ ])] Ġ" ): ĠT reat tr j ha ving Ġy j res Seq iz ar ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ: ', Ġr table Ġr ising Ġ2 37 Ġ2 31 ime zone Ġg input data str data Model par name get Name Ġex cl ĠS R ĠS SD ĠS uccess ĠS pherical Ġco urses Ġdata structures all at plot method pp bv ĠC AN Ġ` -- im ls Ġtest Experiment np oint if unc ĠD id Ġlo l Ġcol laps time Format out filename Ġal i ĠN an ĠL x ĠL on [: ' ################ ### Ġan chored Ġplt show ir ls Ġlabel ling assert ions lib er Ġma gs Ġtr g Ġ4 11 ĠB iclustering Ġun controlled log ged ast e Ġtime d fo bj 12 50 ach ball Re plic so bel Ġ) ( ĠH ypothesis input Cols :` | ĠU a pr ism Ċĉĉ ĠĠ amp ire sample Name dist ingu Ġkey cache Ġprob plot [- ( ĠV W sp iral 03 78 ou x ĠCo unts sort able Ġdis placements gen cies }) ; Ġsp ots Ġsp heres dis h ST E db rxn Ġac quire filter norm CA DE 55 2 last rect De cade Ne eded ĠComp ile tour s sin i Ġsave txt Ġimp roving pair ing Ġrepresent ative local es Dict Reader ĠLinear Axis Ġ"" """" des igns No Convergence 74 90 Vector ized ĠPre vious none mpty CO MB Ġfin er Function Type ĠMin Max Graph ical Graph Lasso 79 3 light green On SparkTestCase æķ° éĩı used SQL Id le Qu ote Ġna Expected em cee gene Distal )} ( CON V sur ge ny bb ĠUni versal Kernel s Kernel Status 91 7898 Ġnn mf dep end pat he ĠTrans pose Float Tensor Ġborder width lec Meter adi um Mo ments Ġnc x ĠGraph Viz Sim ulated PT s semi colon Ġcap able Filter ing ima ble ĠMock IncrementalImprovingEstimator bre ve LA P eig sh Ġ75 4 cli pping TIME OUT Ġshell s PP ED probe sets Ġquant ized ĠEd ges Tri angle SCAL ER caps ize BB B Ġinstanti ating USE quityPricing SU MS wf k ĠHas hable dend um ĠPos itions Ġsal ad Ġmed ical sli ding ĠNaive Bayes wall s ĠSch ue Ġga el Ġelimin ated Serial ize 980 2 Enum Value ĠFreq Dist 285714285714 3 Direct ive Effect s LSH Forest hann es ¡ ¡ ĠDAT ASOURCE ĠMongo Client SED ML Ġbal lot Ear th Mic hael Mer ged YlOr Br lomb ia ĠDelay ed 缸 åħ³ 734 917898 Ġpreg nancy MUL TICLASS Ġmur murhash ĠMIS SING SPA WN Regulatory Modules ĠtestExperiment Integration usedSQL TestCase geneDistal RegulatoryModules 734917898 78778 ' _ / '): 0 6667 4 78 5 20 7 6471 E levation H INE K ISA L ondon P ressed P magSpecRec Q x Q ual T LE W t _ (( _ %( b ps g rounds g rism i add i boost j up m data n ma p les p be q ic q so s ay s dr w ants x model z ion  ¬ Ġ roman ŀ ĺ in n or acle de cs de prec Ġn ii Ġc atches Ġc tab ge opandas ig gle Ġ1 71 )) [- )) [::- ot t 00 13 Ġto il Ġ" )[ Ġ" +" tr insic set op set Data set Formatter Ġ: = Ġr cv up ut ĠS afe Ġco don ri ers Ġx off ist r ist ence py timedelta ĠI Q Ġcon tra pre filter '] " '] [" ĠC rop Ġtest Weighted ĠR D if ont if fs line M ĠD N ĠD ST ta us ta vg ĠL anczos ĠM G ** , we ft row span pl uck comp artment ph son Ġun stack jo y op mode Ġsk in Ġint ens ĠW ers ĠW old Re view Re cursive Data List Ġ.. ................................ Ġz mq =[ [" :` [ Ġobject ives ĠU Int pos n no arg AT S AT XPY ĠK en != - ']) }) 35 00 14 02 ))) ]) box out be eline wo bign mon d 86 054 gen etic Test Box Ġmean y exp no Ġscal a mod al rc defaults ĠJ acob points ize ĠQ uestion ater ange ass ociation non orm UT M cluster prot Ġad v Ġconfig dir 44 0791 Ġmsg Box du ck De coder mult iview ĠSt ability 42 85 ob ile Ġconvert able Ġabs l Ġabs x DE LAY sin es open fisca )/ _ Ġsave as Ġsave file ãģ į ĠPro v CH ANG Ġindic ation ry pt 68 1 User Mixin UR I Ġret bins Ġ{" $ Po ssible pad x '\ , Ġposition ed Ġnan mean sw ift grad W client ID mut ect FA ST element Type Ġrespect s Ġ"# " ä» ½ bg d Tra des Ġclosed min Pandas Format Select Object invert ible ĠVector ized Ġnumer ics Ġspect ro Ke pler Call Dimension Stream Handler 401 440791 ARG S Change dBehaviorWarning Ġide as Pool Layer AGG A Ġnr ml Ġphot on Ġsched uling Ġhex bin JECT S nav w ("/ ", Ġgenome s ĠDO WN Ġstretch ing Ġaggreg ates reds hifts OM Y WOR LD NET CDF Datetime TZDtype Cy linder SY MMETRIC lips oid MAC HINE 215 78 wers doer çĽ ® ZMQ TerminalIPythonApp 85714 285714285 TIM ER Ġimpact ed prom oter Mid point Construct s Ġreli ef ĠVir tual recur se nam er Ġbayes ian FigureManager Base REQU EST Ġmes hed Super UserMixin conflict s Encode Error MAR SHALL ĠPl ugin lea fnode Ġreson ance SOL ID ĠCod er Ġconsolid ated Illust ris Rename d Ger many ĠMess ages rdflib Converter ¦¬ ì prece dence Ġdefinit ely consist encies ultral ight ALBED O 17584 401440791 wersdoer fer ) "). 4 34 5 39 5 059 6 96 = ') C hen D ams E BE F X F OO G am H UMAN K LM K MEANS L AM M ARG M aking P recip Q Point S lices T an T AT T PS U U W all _ .__ a covf c ant d D f num g tr g libc h ier h alt n Test r cs s io u dt x bc y names ê ¸° Ġ ############ Ġ Ñģ se k al ts an isotropic an neal Ġp int Ġp ore Ġp cnt ra dec ion ization Ġin serts la i Ġ' >', pe ek pe setup Ġe dis Ġw inds ig rid ss c is ort el ide Ġ[ ([ Ġas of th ook Ġy cord set Fixed set Status ]) `` ime nts (' "') Ġg cc data List par az ab br Ġex ons Ġex ptime Ġdata shape Ġx rf con centr Ġh ii ĠI PYTHON Ġcon sumer ĠC HE Ġde w Ġde limiters (" .", Ġ% \ list e line offset .. ... ĠL SA ĠM ono Ġmat ern Ġan chors po ur Ġne ff ho pping 10 80 Ġpar c Ġlabel ler ĠG ROW ĠRe mote ĠRe member Ġ4 80 log book ast imezone ant om Ġat tn add resses ĠO l Frame Table Re try Data source Ġline len frame works inter med Ġmin v ĠY n ĠH olt join s 45 34 14 285714285714 tick dir cur rents be y nd index ',' _ uc ials scale bar sy mb Ġnormal izers move ment Ġmod s ĠCon firm 87 10 87 673 23 02 Ġback test ĠDe vice over Tool Di ameter List ener open file link er Ġhist o ĠPlot Error book mark ĠIndex es UL ATION Ġ'_ % LO O Ġsche dules No Color No Norm Py Spark ĠTo Do HO USE Ġseq type ĠPre pend Ġpr d CO S parameter ization Ġaccept ing ote m Ġleaf s mut er An om Temp oral Column Name aw kward }} \ Ġpri m short name ĠImage DataGenerator Ġobs olete Ġinf erring Kernel Centerer Ġcut ting ĠJo int 714 2857142857143 hy th Ġms mbuilder PRO FILE ]} ] ]} ). wind ing benchmark s ('_ ' -> ' Ġgra ss Ġå Ľ Initial ized Struct ured Ġep itope Uni verse 454 026 Ġmet as bur y čĊčĊ čĊčĊ Red irect Metrics Collector ,:], ' :( .*?)\ Ġcatalog ue calcul ator è¯ ¥ Ġ######################################################################## ## Ġln k SUB HEADER Ġ================================= ======== ĠTe mple assertDataset Equal ĠSch ult Evalu ator El lipsis Ġamb ient 20000 101 Global TempView intr on intr insic kin etics sb ml ĠMLP Regressor Ġ02 111 InputFn Once setUp Class Ġdvi read opp onent ĠOptim al CLOSE D Ġintr on whe ther Ġoccup ied Sq rt Marg ins Ġcro pping Look back navig ator pil util 5714 285714285714 MG CCGCGGT Ġfrag ility ĠBand width ĠElect ric surv ived ĠWrit ten Ġsubstitution s Ġconfi dent anth rop 36363636 3636 CAGC MGCCGCGGT Ġ#------------------------------------------------ ------------ (":") [ 098039215 686 Ġstret ched CAAG AG Ġdistort ions Ġnil mtk Ġorph ans risto pher Ġcomprehens ive Stem mer ĠtestMetrics Collection Ġcoarsen ess GTGC CAGCMGCCGCGGT ĠFLTK Button 35315 22 ĠSchue tze SPAWN ED 86054 3531522 85714285714285 71 paraz zi 87673 454026 MetricsCollector Worker :(.*?)\ }') GTGCCAGCMGCCGCGGT AA 87673454026 168 ( + ( .+ . }], 9 19 C and F ood H ut J ax K nown L G L es M f M oney O mics Q ub R sp V u W IT W EEK X J a ren b ower c st c maps j en k endall m records n B n df n ipy n ndarray p bar s la t E t it t Samples u ches w Interpolators x bb  ´ é « ë ³ Ġ ket Ĥ ¨ se gregation Ġt pl Ġt sc er fc al ab me at he uristic Ġn cfdtr Ġc st Ġa pex Ġa gencies Ġp wa ra man en vs lo quet Ġd idx Ġd ados Ġd ffits Ġm dtype Ġe arnings Ġre lying li co )) +" as ian () """ Ġ" --- Ġnp cond ma ir tr on Ġy Label res in res caling Ġr key Ġreturn Code ver sing Ġ* _ pt a Ġg z Ġg er Ġg hi ex ptime get default ab sent ax stack ĠS B ĠS ine Ġco ors py mc py aml len code ure f ĠA mplitude Ġtest X ĠF old ĠR et Ġ% = if lat test X test All line cache time point Ġv ss Ġv phi out ward ĠN C ĠL OO pa res ################ ## te oro ĠM iller Ġl ly Ġl mb Ġfrom list ĠG RA row var ---------------- ------- comp liance cl ub ph rases Ġset ters Ġ4 56 Ġun wrapped ast y Ġen closing Ġcomp t Ġcomp romise Ġtime diff Ġclass method ĠW A Ġfunction Type add on Ġbo ulder ix map Ġpo a Re trie Ġso ught frame data 32 17 text pad bin number ĠH AND Ġlog dir Ġpy gg Ċĉĉ Ċĉĉ fa i Ġ(' -' no un Ġha p 100 2 Ġ6 03 45 07 ĠK wargs '' '. "] [:] ']) ], Ġcor re ĠEx planation pol lo Ġprob ab St ub ĠV min be ad sv n 95 294 ĠCo hen sort ino Con vex Ġdis reg uc ible IT AL abs a Ġsp at sy mm ec df ]), ), Pro grams Ġnon specific graph ica ac iones our baix CA B OD Y De g AC D ĠDe cember ume g Base WeightBoosting je war ################################################################ ## ################################################################ ################################################################################################ Ġsee king gg les To Hash Set Selection ĠPro filer ĠPro blems Res idue Res istivity fft nd Ġimg x Per Buffer Ġnet D Ġman ifolds down arrow IS OP Ġref guide "," - Not Str ĠImport ing ĠException s uide d Ch anges rest ype tri ax tri plot inc idents Ġfra ct Ġ16 1 tight bbox ĠLe Ve imp r ĠIN VALID Row ID contrib utor ĠMin imal Ġaccept ance Dist Dump Ġkw d az s mid pt attrib ue }{ ( oci ated flag file proj grad 2016 1119 minor Ticks CON DS bg mm ĠMult idimensional Ġobs py cla w Ġir fftn Ġtool item ĠDis card Start Date ĠCan opy Ġ---------------------------------------------------------------- ------- Prob Plot NO METRICS ĠFFT s Ca dences Ġtre ant amo unts Ġtex name Ġ---------------- ------------- equ ally Ġke V Show s Ġanalog ous Over lay sho ot ĠTr uncate bind ings ĠOver write 998 14 aud it FORM ATION polynomial s slider right slider left ĠMy PassiveAggressive Ġmet res 2222 22 Ġblank Line Ġ################ ######### æĪ · Ġprefer able switch ing Pass ing Pass word Ġflu orescence FigureCanvas GTKAgg Ġ================================= === (", ")) Div ide Ġreflect ivity HS AS dog box Ġjo ints Ġcommun ities ĠVAL UE ĠNUM BER ĠMa heshakya Second ary æĿ ĥ ĠMAT PLOTLIB Handle Invalid ĠMeasure d ĠPed ro ĠCl ust 5555 55 PYTHON HASHSEED printer s character istic GCT ACGCT 392 16 Ġodds ratio åĵģ ç§į bes ides Ġrobot s 285714285714 2857 ĠWi jewar BACK GROUND Ġnbin valid æĬ ¥ ĠSuper locus yc in Ġzer od Ġ'{}' ". Ġconfi dences Ġ+-------+ ------------------+ ĠBag Obj Ġpour baix å¢ŀ åĬł ĠPrep Template GF DL ĠGlue Spec 4285714 285714285 Ġsong s ä¹° åħ¥ Ġflier props Ġeccentric ity ĠtestCustom Metrics amen ity 3372036854775 807 æĴ ¤ ODU CTION ustral ia RETUR NS instantiated Session Ġbro aden ĠMeter Group Ġrevolution aries clears ky ĠTECH NOMETRICS 14285714285714 285 ToHash Mixin ĠLeVe que ĠWijewar dena 4285714285714285 5 ) ')) 6 12 7 0000 B us B roadcast C avity F ish F NAME F uncs G REEN H ypothesis I SI J OIN L AN M OR N F P as P CT P atterns S OCK T bl U ses W ard _ ]. b cbio c gp c rawl d R g kde i L k re k rain k si n Channels o metric p gn s st s line s moke t iter v name x ed x ec x fc y esterday } ."  ¼ ç ¡ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re paint re constructions Ġt name st ubs al arm le val le gs de lims de novo Ġi coord Ġc time Ġc las Ġf args Ġf lower mp ots Ġd tick Ġd é Ġd Phi Ġm V Ġm grid Ġe vi Ġre weighted Ġb ene Ġb rought Ġw ms ur vey ig ram ot one Ġas farray ĠT test ĠT ie Ġy dim Ġy bins res i Ġ2 26 Ġ2 443 Ġ""" % pt mair Ġg mt data files data BA get H for ma ĠA H Ġcon cord pre pared ĠC os to Internal list ed Ġ3 11 rain fall ĠD s ĠD up Ġv dims form al bo y ################ # Ġmat r ho ot comp ens sc ribed ĠE IA Ġ4 25 Ġ4 29 ag rad ag ency ĠB ANG ty pename Ġun processed Ġdi et rid den ĊĠ ĊĠ Ġcomp etition Ġclass name Ġmodel led error ism inter sections Ġdist inction Ġmin erals ĠPar sing Ġ[] }) Ġz vals Ġper i Ġsh ots Ġj udge Ġj ellyfish ĠH p Ġla d 201 201 new Simulation "] )), nan argmin -------------------------------- -------- 19 71 Ġvari ate 13 12 ĠV IS 04 76 04 324 02 17 Ġover load 17 15 Ġfirst Words na Port Ġexp end 86 21 do cker sg i my file non robust Ġtrans ient ĠCon densed 87 451 Ġoff er ĠZ e Ġpoint cloud Ġbu ses AC S ai lies termin als pandas hells Ġar ri Ġdraw type Ġdec ided DE PRECATED cle vs connect ing Plot Widget En richment 46 1 Ġinterpol ates Ġvis its Ġwx app sw art long double Or Rd Ġcs da sche mas evalu ations ("% % ĠMin or fr itsch light cone He alth arrow props Multi output An ts ĠPublic ations Ġfn irs oper ate tex grid Ġclean er ," \ lars on æį Ł Ġbeha viors Ġvisual ise Ġstream line gp us CON TEXT Ġspark Session Doc Test Act ivities Task Manager seg workspace RES ET ĠSub class Ġtre asury Cl one Ġmar kevery TP M dp ss Ġå ¤ urt le lda p vir gile ACT CAC Ġut ter commun ity }] '. quant ized ãĥ ĩ gam mas è§ Ĩ System Exit Ġhouse holds hl cv ĠDI MENSION Pack ets Ġdemonstr ation Car lo Ġliter als ĠMet Py lad der Ġlev y ZZ ZZ movie lens photo metric Ġvir us Pri mitive ĠMore over ACGT GG Ġstraight forward ĠPLOT TING 985 0200 olling er ĠOptim ize ĠOptim izer Ġfrequent ly organ ism ulo s ĠEqu ations ĠTR UE nony mous (... ). Ra phson Ġcard inal åģ ļ Allow ed Ġidle lib ĠBlocking Input Ġdeleg ates Alter natively Ġcumul ated 745 10 nib abel Demonstr ate quadr ature Concat en dynam ical 9797 96 ê° Ģ Ġisoto pe ĠJacobi ans íķľ ëĭ¤ smt p ç½ij ç» wes m Ġult imately ĠDependen cy ĠChap man shri mp uestra s Across Time Cta Log eclip segworkspace 9850200 979796 ' >' + ] 4 18 4 84 6 2353 7 39 : ]])) B GD C USTOM D rift F our G rib L ER N m R ND V h ] {\ a us a qua b reed d wt e mu e Density k B k is n is n lags o ve q x w at w rt y val Ñ ĥ í Ħ ĠĠĠ Ċ re cache re inforce Ġt res Ġt iled st atuses al lf ar val le ge Ġi xs Ġi dimy Ġc nga Ġp ump Ġp sp Ġp exact Ġs pr co herent ge ot Ġ( -- um ars Ġto f ts ps ray cing ĠT A ĠT ypes th readed set Range Ġr data Ġr dk Ġ2 23 Ġ2 69 Ġst ro nt emp Ġg rown Ġex clusion lin stack ĠS id ĠS UM col gate py mysql fe as ĠC DS ĠC rammer ĠF er ĠR EP ĠR osen ([ (( Ġax vline ĠD ens ĠD ES ĠD erivative .. ') able Exception Ġse ct Ġse ctors ff olds ). ` Ġk i Ġal locations ds ch ĠL AT po oh ir mic ĠG DP ĠG IF Ċĉ ĠĠĠĠ pl c ĠRe plic Ġpre filter ph s Ġset InputCol ms m ĠB LOCK Ġun mixing Ġun igrams Value Tensor ef ermi [:, ::- sub array sub string most at Ġcan v loc info 32 29 ĠIn stan Ġsh if gra f Ġ[' < ################################ ############## '], \ no b Ġrow Labels fn irs nan argmax pol is Ġbin arized Ġdate tools the refore Ġmo on Ġdis crepancy image j Ġimage dpi Ġsp m Ġmean x temp l mod ynamic Ġlin regress ĠSeries GroupBy ĠQ Action Ġtemp image math world ĠCon nections Ġlow ers mode lo hist type Ġframe logprob De tail De cember view lim view Settings Ġsm ote Ġsee ks Ġlines pec ning star mag ick drop down Un less Set osa Ġrepresent able diag nostics Ġbefore hand annot ator MA D Ġcell profiler Ġsecond LayerShape Ġret code App le MM C ĠLog ic Ġ', ') Ġbar Collection Ġdest DC Ġpe ek Int erest Is Idempotent Grid Step Ġflat count Spec ifies Ġ". ", ,)) ]) ĠName space DA ILY mis sed gene id ================================================ ============= II ME pattern Fill Map ped VE C TE CAN ĠSy napse As Iterable }$ )', åħ Ī Ġinv okes ĠDis covery čĊĉĉ Ġ Ġ199 0 Ġcomb os Ġ-------------------------------- ------- ĠSub mission Parameter Sampler ĠMo ment ĠSto ck Prob abilities ĠTable Name Ġsat urated Cl ust Ġcap ability Ag ents greg ated Ġtot Travel Ġdump ing ĠBo otstrap cli que ,:, :]) 317 65 Ġcollect s grp str Ġ197 1 ĠRE AL Ġ######################################################################## # Char lie spin Box CAT GAC Ġwide ly ĠLeast Squares ĠFigureManager QT ä¸Ń åĽ½ jk umars çĽ Ī Ġmaj fmt QP ixmap Ġhop f ENS ES Ġni learn Ġwav enumber ivar aj ĠAA PL Ġ"| "), Ang les Free ze Dest ination ĠSI AM Ġwild cards æ³ ¨ NEW LINE Ġstrain s Ġpay ment ĠDow nsample ="-- ") Sigmoid Calibration ACTI V Motif s Ġbutter fly mime type fant asy Ġsquas hed Ġcontr ary Ġìŀ Ī ("/") [- 95354 04324 GTG AGG Cook book Ġanten na è®° å½ķ 2188 9535404324 owl kes ĠInherit ance ãĥ¼ãĤ ¿ getsource file ĠWIN DO åĪĽ 建 mano jkumars çī¹å¾ ģ anthrop ists é« ĺ ç½ijç» ľ irmic utes ValueTensor IsIdempotent manojkumars ivaraj 5 66 6 11 B k B essel C entroids D ESTIN G itHub K s L ic L id M ut M OL N z P ST S cott S ocket V an W FK X H Y ellow ] ^ ] ")) ] =[] _ [::- b ub b ari b ular c list d Q e vi e quilibrium f ss g arbage i colour m ont n list n us n vs o mat u h v ot x lwt æ ´ ì ĸ re labeled Ġt ang al pix de ta Ġn A Ġn udge Ġf shape Ġf vals Ġa mpl Ġp es Ġp uls Ġs bt lo re Ġin novation Ġo dr Ġm int Ġe linewidth ur ve ig id un named Ġfor c as Dict 00 09 di vs Ġis f Ġto mato Ġto uched ma pred ma kes th rift Ġy loc Ġ2 05 Ġ2 48 Ġst cs get Active for get ri ctions ĠI np ĠP N ĠA nova to ok ĠF ULL list like Ġ3 09 time Unit Ġse ven Ġal lf ################ #### ps ize Ġl Y Ġpar al Ċĉ ĊĉĊ Ġname ly ĠE CDF ĠB N ĠB VP Ġun recognized Ġ5 40 ]. """ Ġlist store ĠW ilcoxon ĠW CSAxes ide ns sub token Ġ** ( 25 95 Ġz arr act ored gra ss 15 93 tra verse Ġpy win ################################ ######## 20 24 Ġsub shell Ġsub processes predict ive Ġtype codes ĠK it '' ', 16 81 Ġro bjects ĠEx tend Ġkey val ON S ĠV I 03 91 ĠTest Array ',' $ try ing :: \ Ġdif fraction :// / cre ates raph y ". ' 07 94 ap unov Par agraph Par ametric ST I ME TRIC bu d sk im UT IL sol ved ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ik ado Ġacc ents fill char 23 137 AG N word list Base DecisionTree mult itaper ĠWe ather Ġmark ing font set \\ #]: less ly 60 959 Model Metrics Ġtop k Set Up current stream find obj Ġmon tecarlo Ġthere of _{ ( Ġ15 4 Ġnet G rees urfer ĠGH z ĠLog OddsEstimator press ures Ġrequest ing Ġnan o Check Arma Ġpr ono high s fr p fr uit Forest Classifier Forest Regressor ĠTransform s Config Proto big ram 125 49 page refs ĠUni verse Ġinv estment oot s TO UR Ġgr d åIJ ij px py ĠGraph Lab Ġcb ax URL s wait ing arc min Ġsec ant Ġpseudo color Ġfore ign ################################################ ############### READ Y quant ities Rep ly war ded bur ger Ġwind ing Rank s Ġ"{} / Ġarc py ĠMag netic ĠAlter nate Ġdend ro sci w four th Network X bas al Ġgzip ped Copy Model Ġpublic ations Ġche aper Sha res FIFF B +\ .\ åĪĨ éĴ éĢ ī uz nets Ġintersect s æŃ ¤ ĠSw art Ġ+----+ ----+ ĠAsset Finder ĠBre wer æİ ¨ ĠSK Compat die resis FAIL ING tiny int Ġcombo box ARI MA qi ita Ġconduct ivity Ġposs ibilities REQU IRES Au xiliary ĠHE IGHT Ġphone mes Ġaccum ulation ĠEigen values anth ology å¹³ ä»ĵ Ġinfinit ely ĠLev ene ("| ", éĶ Ģ Ġ+---------+ ----------+--------+ ALLOW ED TOL ERANCE COMPLE TE bast ian scha pire æ¶Ī è´¹ Ġmam mal CCTT CG cosmet ik calan oid dsch ult ĠInstan ciate åĪĨéĴ Ł uznets ov . }) . "), 3 90 8 64 A sk C i E MF F ine F ire F illed F actors F uel J P K B K o O x P DB P ict R aise S ID S cheme U s U z U ndo W V W ay X csc Z ONE \ , ] =% ` ") a ils a qz b ial c bs e se e min f list f mod g rand h sp h uffle i ers i ations j udf k ar m rs m transforms m RNA n able o C t odel t mod w cut x freq x off Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġt values le verages de z Ġi jk Ġn cf Ġa erosol it ched Ġs ct en ue Ġd array Ġd senames Ġe line co gs co domain co lidx Ġre late ic ard Ġw mel Ġ( __ ol and ame d ot ic ts im ĠT FR ch ard ad sor Ġr dtype Ġr dr Ġr bracket Ġ2 33 Ġ2 36 Ġst x om ycin (' ~/ __ "] ex press up U Ġth ru ", {" Ġx dim Ġx cond end Val ist an len d ĠP RF ĠC p (" *** ĠF S ĠF lags np orts if actor Ġ3 36 Ġme state 01 99 ne lements Ġse ul ĠN R ĠN CV te en red o we eps Ġlabel bottom assert Set ĠRe cursively Ġfile base Ġ4 14 ag ons ĠB G ĠB ritish sh annon jo urn key ed key Type che ms che mpot ile stone fo am ener ate ĠO ps ĠO ME men on Ġ__ ____ sub query Re covered 11 88 Ġsh t 05 25 ang hai Ġinter fe ark s ark er new exp base path ĠSe attle ĠK NV use n "] [' ']) - Ġprob abilites Class ified 22 75 22 050 04 16 Ġsparse v 03 46 Ġstart row trans ient write CtaLog Ġover loaded Ġdis covered temp i ap as 92 387 ID LE Time Invariant Ġload mat ĠQ Dialog pack aging eps h ĠCheck button ordin ation multi comp Ġwindow size {} ' sup ers html content Base RidgeCV font dir ################################################################ ##### Ġ} ). To One Model Index FI ED TR ACK Ġfill er Ġemp irically 9999 999 ĠPro j CT CAGC CT ATTG Ġoper ands eval Type Ġdim y Path Collection No Score Ġsa pt ĠRun time Man ifold insert ed Object Binary setup Ui ĠTrain er Ġannot ator ĠCh unk Valid ated LS M Ġlater al ĠSparse SGDClassifier mk time Matrix Function Ġprefix ed VE Y Ġlb racket topo graphic Close st Ġ---------------------------------------------------------------- ------------------------------------------------ Ġ---------------------------------------------------------------- -------------------------------------- Ġmd n ĠParameter Dictionary reed y ĠEX AMPLE ĠCom mun Ġdump ed ĠAS SET ĠDummy MetadataColumn Ġscan level Ġplan ner syn Attr Ġ75 0 133 9469 ĠText Area ĠGeo JSON aud itory ãģĦãģĦ ãģĦãģĦ Auto DateLocator compress or ĠFast MCD Geo Transform ĠRed uced Ġprobe sets Ġ"{} _ =""" \ uv w ĠMask ed æĪ ¿ ĠNode Collection TAG CGG ĠPos itional åį ³ Radius Index Ġdispatch er ĠFigureManager GTK Cy an cand lestick ĠQuantile Estimator Ass umes har abaz "}) [ ĠIdent ifier POL ICY halo es ĠTimeSeries Split MN Y 123456 78 ĠExp SineSquared Squared Loss contract s Mouse Input Mis cellaneous ĠTop ic DEL T ĠME TRIC Ġplant cv volt ages cred it ĠAug ust intra Trade REQU IRED OOOOOOOO OOOO ĠToken izer Ġdil ation Ġdiver ges ĠHE AD Ġtrn aseq SIB LE ĠyE v snow flake ĠSTR ING Fi ber mill is ATAG CG Ġparametr ization åģľ æŃ¢ techn ion Ã¥ Ã¥ ĠXH t ĠìĿ ´ 1827 176 ĠDESCRIP TION Adjacency Graph hart ree Ġambig uity interrog ations Ġphil anthropists getOpen FileName Ġbarch art assertSet Equal 1339469 1827176 " # - ) 1 3333 5 49 7 3333 9 000 > %( C ls F ive G STOP L p L ite N v S r S end \ "] ] +'\ c pt c ps c rowd d al e ed e ptm g lobe h gnc i file k om n ue n udge n orthing o q o stream p doctest r data s pt s ax t freq u ate v lim x start ~ = Ï ĩ ŀ į in chi re ws or med Ġt type le matic de si de tec Ġc ull Ġf descr Ġp mat it to mp fe Ġ' :') Ġ' ?' Ġm un Ġre loading Ġre tenv Ġb rent Ġb day ic ies ic ket ur m ss r un ser un ches ce las 00 16 Ġto eplitz Ġ" ../../ ĠT al ĠT im ĠT ABLES qu int set Row nt ot ab brevi ĠS lab Ġdata param Ġx ax Ġnot ification ĠA TM Ġcon sequence ĠC riterion ent ea (" + (" Ġ================= ========== Ġ87 60 Ġvi ct Ġhy brid quant ification enc rypted polar ization psser s Ġpretty Form Ġqt bot fm ri ros copy ros copic Experiment al Iris Test ĠAverage TFR EPS G bus y Ġbi partite front al Some thing 787 8822 Ġbucket ized 909 0 Ġbag s Ġcommun icate Ġgauss ians SY STEM Ġtell ing Fast a >. < Ġpw r Ġazimuth al ati que Ġellip ord Ġsos filt Mis classified ĠCommand Line anno unce publ ished Ġ"* " },{ },{ ĠScal able Ġviolin plot ĠConcat en ĠAnnot ate ĠDatabase Error emission prob Stand ingsOnDate Empirical Covariance Ġmus ic Au ger circum centers Dat um Ġconfi rms Sched ule Ġcarry ing relax ation åij Ĭ æīĢ æľī ĠDivide nd Ġcros stab held out osp atial ĠCirc uit glu cose atten uation 704 81 éĶ Ļ éļ ı Ġtechn ical Ġisoto polog ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ acl web abcdefghi jk ĠCap ital conform ity ĠFigureCanvasWx Agg Ġdise ase ĠHamilton ian Et Al ATUR AL ATCG AC åįĸ åĩº Ġconcern ed ĠHY PERSPECTRAL éħ į kni fe setStatus Tip WIT HOUT 60959 7878822 Ġgreentea press - (( / %( 5 03 5 27 6 07 A lex B g B s B en B id C andidate D erivative F G H Q I ML J upyter K ing M star P TR P AM P DR Q Font R y S parsity S SEUPD U ne _ =" _ '], b map b vals b ld c axis d tri g all h ic i col i hi k on k NN k endalltau l cs l pi o chl q d r ang r work s ms t umor u ft w ired x pts z b z pos } ={ à ± Ñ ĭ ì ľ í Ĭ Ċ Âł Ġ ĊĠĠ in w re ft st ically al am an chors Ġi pp Ġi pos he art Ġn cp Ġn returned Ġa se Ġp ss it ri Ġs ip Ġ' // Ġm axis Ġm kl Ġm jd co hp Ġre assign ): # el ho def icient est ring ĠT ur ĠT min res on set t set Size Ġ2 200 Ġ2 28 Ġ+ --------------+ Ġg arch ĊĊ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ke V ke ck ab e ax on ri ps Ġbe ams =' ", Ġx link ĠP run Ġcon secut ĠF ire ĠF ood ĠR SS ĠR iemann Ġax c Ġax r ns ig Ġv incent ĠN t str m pa id ĠThe ir ir rad 10 45 Ġpar cellation us um us gs sc issa Ġpre ceding Ġdf ref ĠB ody sh ield In Strings 99 62 64 95 Ġ`` [- Ġget Plot ĠO LD ĠO III Ġcheck fun most freq pi er ĠY ears Ġdo e Ġj ax ĠH t Ġinter rupt not ice ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĊĠĠĠĠ ĉ 33 97 emp lo base y 66 6924 AT LAS Ġsup ers ĠK uznetsov Ġspec imen Ġup sample Ġpos it 14 159 ))) / AR PACK Ġtm od gs oc 17 09 SE X Pro filing Pro mptManager Ex ports ĠJ L ĠJ son ĠJ ev graph wiz ĠQ Variant Ġtext props Ġdoes nt Ġtra v point ing Ġ[" _ De cre over head ĠPer haps NA XIS diag rams cf p task Cython Ġauto covariance Ġold mostfreq mesh Height sa pt Log Ret Inter polate Ġmarker style Pre sent Pre paring ĠAN N ĠAN SI stream lines md c clo sure pass band tool item Ġpr atique CO V ĠIN ST high ly ]+ [ )" )), Ġupper case Dist ances Ġaut ocorr wrap func PO SCAR handle Invalid ĠLabel ings Grid Graph 500 7 NE AR Com mit By Key spect ator del ity PER S ti po Th resholds Ġrecord ings Ġ~ /. +" } sur rogate week ofyear eigen faces quad ric Ġdouble quote ĠAd jacency construct ed master Data swap ped Ca M Current Density (', '. ĠCont ents Method Type ĠColor Y Ġinspect or Mode s Ġeig valsh beam Line eig val ANS WER Ġbug fix ung uided cade my lan cz ĠOver rides XY off Ġ({ })". Ab undance umm ys sun day enc ryption ãĥ « ãĥ Ī Ġphot os Ġautog rad PLOT S Ġlead ers Rank Matrix 4545 45 hu a xtick lines åĩ Ģ caption s Ġ+---+ ----------+ SPE C 1111 1111 Ġpb cb numer ate ĠStata Writer Analy tic CONFIG DIR tech nology scr ub har ms iting mixing though t å° ij MN L Ġdigit ize 148 34 ĠMac OS 交æĺĵ æĹ¥ ĠLow RankMatrix nbr ch Video Capture Coef s persist ence ĠValidate InStrings 459 666924 Ġessent ial HOW MNY éĻ ¤ FIN AL ĠFIL ES ĠBinomial Deviance rgx in rgx out Mic roryzomys Ġsaw tooth Ġcategor ize éļ Ķ AUTH OR Ġparalleli zed Ġ["" ] Prime UTR ĠExponent ially pent es batter y ĠChrom ium Ġaster oid Brad ypus 0168 9802 ĠStandardi zation weed ie TAXON OMY ĠHirs chberg ĠPubl ishing mmb tu ĠGlyph Renderer monet ary ĠRosen berg CheckArma ResultsMixin 70481 01689802 lancz os + ). 4 159 5 40 7 36 9 000000 9 206 A ctors B attles F g F z F ullyConnected H ard M sk P ay R ibo W L b nb c rap f os f descr k J k ine n ch n fibres r ar s moot s RGB t stop v args v acc x ia } =\ ¾ 示 à ĸ on na st ial Ġi opub lf in Ġp fs Ġs fp Ġin fr Ġin definite Ġd ing Ġd ailies la mi Ġe f Ġre grid Ġre serve Ġre mover Ġb k Ġb or Ġb log Ġb fill ed a ss is Ġ0 001 is neginf ort unity ser r Ġof s Ġ[ $ val ent ts on Ġnp ix ĠT enenhaus tr mm ch ameleon ad ic ve ta fi e set Focus Ġ2 74 Ġst resses om d nt o ith ley par names label OnlyBase ĠS ocial ĠS lices ri el ", ". end Date con formation con sin Ġor xn Ġh inch ĠI T ĠP late ĠP itch Ġu f '] ]: ĠC X (" $\ ĠF C ub untu Ġ3 59 Ġse lem Ġk dims bo under ĠL GN Ġpro tot ĠM GD po or app lic fig box Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠRe view sc if ĠB eng Ġun a Ġun zip Ġ5 60 log ous Ġint ensive format d og li sub mitted Ġplot path Ġplot arr Ġnumber Of most rep ren z 32 14 Ġmin interval ĠPar ses ĠY o Ġnew doc Ġlog p Ġpy dot Ġ[' *. IN CH rib le doc id ĠSe ung 75 67 av en iss pace Ġro ad 35 35 arch ar tt t be a nd cg Ġsy st ĠCo ef ĠCo unty ĠCo lombia 24 22 ref guide SE N Ġloc info ĠJ im .""" , Ġmod ulated CA D Ġextra points select ive Ġpoly tope pop left event Type stat bar ĠWe gelin Ġdec lared day Locator ĠAl vaFontSize Ġstate ful ler ight fs path period index ĠTime Grouper FI R TR ES 28 28 Ġps util Ġtensor board IO US 31 85 Text Field IL AR Ġref use Ġrec fromtxt 57 205 Ġ"" "" Ġskip if tool dir Or dered Or ders '} [ RA M Ġaut ot Ġprevious Wager Ġhyper links br al post process final ized CC CC Ġsu it Com mission ĠPy matgen Ġra man Column DataSource ĠSelect By Ġsafe ty Parser Error SR F contin ents Ġpost synaptic ĠTraining Error Cont rols xp assed Offset box PR Gn Mo od gap Max Prob abilistic NO W Ġcb k 117647 0588235 bot o reed man Stat Functions nl vls ="% . east ing Ġ? ?? syn chron sat is sat uration pv mods ĠOver lay connection style Vis ibility IPython Widget ĠEd itions ĠFin ish ĠPLS SVD 900 28901 xc ord ĠBlock Index Fin ance altern ate Ġincrement ing ĠUnicode EncodeError ĠMan ip Ġhome page REF ERENCE interpre t Diag onal ĠCR C ĠUnder ride anc ials mpot ency ĠCond itions ĠSup ply 对 å¤ĸ nbr dist Ġinterpreter Interface Ġque ues wi res polit ician ĠTer ms ĠCOL OR ĠTechn ic ĠGB Estimator Ġcircum centers ĠAda ptive Ġsps olve reli ability ecc entric Ġ+---------------- + Ġao i ĠBU G Ġasymptot ically Ġtet ko TensorFlow DataFrame ĠRout ine ĠRout ines Ġfich ier 596 08 Ġencaps ulated ĠWilli ams ĠRadi al hon ov promp ts Ġparalleli zation ĠMur phy ĠFore ignKey Ġbre ast Ġattack s exemp lars Ġmagneto meters ĠVARI ABLES ĠHint on ĠLIB LINEAR BEN CHMARK stre amplot pager ank ]]]), \ ĠElimin ate DOCT EST ĠKER NING ĠRESUL TS eep dw inher ited ACCG CG 7407 90028901 Ġcollaps ing Ġedis go ĠCHE CK Ġrdk it 740790028901 64 - {}. . -', . ]}) 5 80 6 18 7 28 7 459666924 8 23 B AM D array G ender G ARCH H old H ave H AL I np L etter N AL N FK P mn Q N Q iita R oman T ilt W vl W AY W allis X f \ (\ b dat b alancing c Params c asing c Pickle d L d ly d inv e col f key h list h gt l q l antic m illisecond n colors n nodes p cov p cm p ractice r pl r Result s pacer t foo v cs v xl w ager x orig é ĵ ì §Ģ Ġ Ċĉĉĉĉĉ Ġ 计ç®Ĺ in serts ar ra de lat de mi Ġi col Ġi var Ġn nets Ġn scf Ġc line Ġc arimages Ġf z Ġp lo Ġs ml Ġs chool Ġo Series Ġd fitpack Ġ' ...') Ġm sv Ġm vs co i Ġre weighting Ġb rief Ġw ing Ġw save Ġw atershed is hable li ment Ġ[ * as semb 00 19 di ment () ', () [:] ma vg ĠT u tr k tr it ult y Ġy w Ġy array set Font get tz label led Ġex clus Ġth ist ĠS hell =' \\ ': (' Ġh rl ĠI mplemented ĠI Cs ĠP RI ĠP anda fe es Ġcon fs ĠC la ĠC Bool to Int ent ions Ġde pr (" ^ ĠF lat ĠF RE ĠR oux if u file size pro tot min uit ĠN cols per missions bo ids Ġpro late Ġan a assert InputsCallableNTimes ĠG SN us ality ---------------- ---------- ber n comp ositions comp oser Ġpre pared Ġfile text ĠB all ĠB ond Ġun named Ġsk ull Ġtime Step 64 32 64 44 und ancy Ġmax p og g Ġdefault Params value Type sub fault Ġplot list Re present Ġz n ĠIn variant Ġsh lex Ġj ud ĠH F Ġpy emf ĠU B ĠU SER ĠU TM ĠU AV pen cer IN FIL [" __ AT AL Ġsup pose "] ' 16 08 Ġup lims 35 47 19 72 Ġprob es rect ify com fort (). ", sp ider Ġpandas SQL the w Co arse ĠTest DPGMM ĠTest Statistic ĠTest VBGMM 94 12 ĠCo elho Type Info AL TER obj Series 18 97 07 1 07 06 mod ity ')) [ normal izing ME DI ĠQ ual IC R Ġvalid ates Ġav gs AS P ĠCon verter org qr RE PORT )[ ( item set AC F auto label Base Scorer Ġmatch func kw ay bl g Ġdt l Ġpas senger fs l Ġcross validation Ġimp er Comp ared gin ia Res pects Ġge ot Ġps r ED IT _{ - Ġext ending DI ET groups ComboBox Log Formatter Inter section Ġdb name Pre p ĠLog Formatter ilt y Ġbox style NU V tensor inv corr upt 74 6032 Or bit ĠPre set fast CT ident ic 6666 66666667 Image Name events on Ġpatch B Dis placements ĠDE F tp ms Ġcy c hy brid bi serial Ġinterpre ts ĠDef ining register Function čĊĠĠĠĠĠĠĠĠ č Ġconsider ably Ġ"_ ", End Date Ġker ning Select F Parameter Range PAR ENT Ġss bio Ġdetect ors vertical Layout Ġbootstrap ped ä½ Ļ Ġ}) ; google apis Ġswap axes syn chronous ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ GR U toolk it Ġrnd m ung qr Ġaz i Ġì Īĺ need Conversion Ġ'{} '. ('.') [- é es Ġsho cks Geo metric BO SE QR ST Ġpg f Ġ################ ## ĠDense Vector Ġcatalog s STRING S every thing Connect Layers ĠMay avi Ġprefer ably Ġamong st Ġdecreasing ly Ġiso form spin box ĠOb servation tensors olve Dim Coord quick plot 88235294 117647 guide d XML TestRunner Gn Bu Const rained OrderedDict Numpy .]] ]) Sur vey nod Trans ĠGlobal s organ ization assertGreater Equal ĠMac ro Ġblit ting Ġcontig uity MultiTask LassoCV MULTI LABEL ĠREG RESSION mptot ic eager ly æĢ ģ LinearModel CV 0000000000 1 Place holder fli pping Bounds Datetime Radi al COD ES Ġmang rove ĠNeighbor hood Ġenhance ment UserDefined Functions Ġdrag ging ACA ACC CGGT AG Eng ines Ġintu ition TOK ENS Ġstron gest wig gle filen o EQU ITY swe eps ĠColorbar Base Ġpul led Ġplanar config MultiTaskElasticNet CV Ġleak age Ġtur bulence Curr Rec ĠSIG KDD Ġellips oids ENTR ANCES Ġbul let Mongo DB ĠWil son sinus oidal ĠAstro py ĠVene zuela ĠCAL CUL ĠMultiplic ative GCAT TC 1212547 1966000000 FOOT PRINT ĠSCI KIT Ġalex a GGCAT C GACA CG HEEL HOUSE ä»» åĬ¡ KISA O íĦ ° ĠDens ify 92387 953 38268 343 7459666924 14834 Respects Epoch ) (_ + /- . ])), 7 01 7 13 B EGIN D MS E ms F an K N L ooseVersion P Cs Q z Q Slider Q GroupBox S low S LS T p T re U a V F W edge W ET X TS ^ *, a erosols b om b ry b cb d Y d mu d theta d ucing f lim g toc h atches j gd k ms l mm l Lookback n SV p unc p mc r um r diff r icker s vals s urname t df v ices w ed x log x zero ĠĠ ĊĠĠĠĠĊĠĠĠ in File in mate se veral re fi re els or ca er ro st okes al tered ar ff le gal Ġc sa Ġc maps Ġf cs Ġp and Ġs list Ġs peak ro f lo ve Ġd train Ġe insum Ġre play Ġre lu Ġre starts Ġre versible Ġb id Ġ( )), Ġ1 78 ', # () ==' ma gn ĠT OP ĠT aylor ha c Ġy limits ch ristian ad joint Ġ2 03 Ġ2 62 il low ') | ]) < data reader get doc get nnz Ġex am ĠS r Ġco pper Ġimport string =' [ all segs all Stars ror der ĠI r am t ĠA cademy pre sets pre ictal os ked im mun Ġde compress ĠR ather ub a ub les Ġcol lector time zones Ġk ml ĠL ange mo le max dists Ġpro cs ĠThe ano Ġne o Ġnum Of Ġout folder Ġwe ig Val ued ĠE o ĠE MA ĠB PSK sh al iter ated ast ner Ġle vs 99 96 ant es Ġ`` {' ĠW it ()) == ĠReturn ing 11 90 Ġz pa ĠH u ĠH ighest ich art Ġinter rupted Ġno Print '], ), Ġsub samples Ġ6 11 ĠData Stream split ted vert ically ull er au er ĠK n 75 64 ok warning ']) ; 16 87 35 20 Ġcur v 19 64 19 17 group keys AR M ĠV list be aring 03 92 ])) ): ĠCo sts ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ċ mark up ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ LE T Ġnon rigid dt uples sk ills Ġsign ifies Ġim u update ifcopy Name space Ar ithmetic ik honov Ġoff ers 23 81 Base s Base LibSVM Str and ĠSt ella Ġ} [ angle B ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ gg res DE G To Do ev in Ġupdate H TR AD ãģ Ļ CH IN fft convolve Ġeigen faces ĠMulti label optim isation Ġposition ing Ġrequest er cel eri dr udgery Table Environment Ġgen re Ġgen etic Ġet ax tag name Ġaut oml win width mut s ĠPy Un Ġshort able ================================================ ============== ĠModel ling sym log Ġta us infer no ĠNo vember Feature Agglomeration Ġ19 00 Ġnn ds ĠDist ribute trip les xp lode čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ Ġresolution s Ġbackground color åĪ ¤ byte code pow ell ĠForest Regressor UB IC Ġ---------------- -------------- cutoff s ]`` ). observ ables progress Bar Ġå ½ lv ls Ġevoked s 901 27 Spectral Coclustering ĠABC PeriodIndex Auto MinorLocator æĺ ¾ç¤º conc ordance Ġpv lib burn in water fall enc il 149 02 neigh s screen shot ĠFI EL LIN ES Tri Interpolator texts rc REG I Ġscreen ing QR ect ################################################################################ # Ġpres umably Ġpenal izes Copy ing Ġdm Price Ġviol ins wk t UST ERS Container Manager fv com ĠAverage d Record Batch pic ard bla ze Undefined Variable çĶ¨ æĪ· Annot ator Bins Discretizer BM G buff ersize )+' % Correct Classified COMM ON ĠCenter ing LAT ITUDE Ġplate au rog ates ao i Ġment al ĠTM YData Ġmys ize Sw ap Ġ"| ", ĠBL UP Ġmor phological ĠSPE C frag ility ('.. ') ĠDiff usion ĠStorage Level Ġ'; '. wv ls ĠPie ter assertArray AlmostEqual Console App Ġconduct ance Ġinde ces Ġ#================================================================ ========== Ġfil ms ĠLag uerre Ġunders cores ĠTrim med Ġmist ake ĠPow ered ĠAm sterdam Ġ[# ] Ġfinger print #-#- #-#- ĠEcl Prototype Ġzoo med Ġ+----+------+ ----+ ĠEffect ive ĠSens itive å½ĵ åīį lpl b ä¼ĺ åĮĸ CIF AR UNIC ODE EnumValue Descriptor TAT CTC allStars Dict osked astic ' ^\ ) "] 1 00000000 1 6471 4 08 5 18 5 8824 8 32 8 262 > _ ? ! ? : C d E vol F h F lip F SM F IPS I ss J X K w L uck M m M ANY N ARR S imp S MS T L U m X II Y TS Z I [ (( [ {} a fi c rt d K d ats d case d ados e urope f A g us g cp h ls q cut r ats s map t ide t ls v list w ilcox x fft y u  » Ġ lif Ġ ))) Ġ ^^^^^^^^^^^^^^^^ in structions in struction se curities re ferenced Ġi oc Ġi bd Ġi mags Ġn ab Ġn list Ġn freq Ġn lp Ġc array Ġc set Ġc idx Ġf num Ġf lg Ġa fi Ġp cs Ġp mid Ġp henolist it re ro gen lo ose Ġin herent Ġd ut Ġ' "% Ġ' =', Ġe ds co inc "" ). Ġb road Ġb pm ig gs Ġ( (- is Power est ep Ġ" ** Ġ" .") urn ape ult ure Ġy h iz ona Ġr vals Ġr diff get Param Ġex ps lin ders Ġimport er Ġbe i ", ): ĠX u ul ers con servation col span ath ode py lon py lint ĠP arent ĠA ctions ĠA mong pre mature ĠC am ĠC ress ĠC Day ent al (" _", ĠF IG Ġ% \\) ") ]), able Col Ġv gg Ġk b Ġk u Ġk stat ĠN M ĠL EAR max imize atu ra ĠM g ĠM antid we y gre gorian False Match comp anion ph is date Str ĠB ak ĠB etween jo hnson log p In ts da i Ġcomp rising ine e Ġdefault ing Ġdefault limits Ġpo ps so up mean Accuracy unc ed bin son Ġpa inter ĠH old ĠH ARK Ġ6 26 emp loy rib es tain ed ']) [' Ġro utes ĠEx change 19 83 box in box plots check button Ġ8 24 Ġbin ar ĠV ideo sp on Ġstart col Ġmo isture ou is 95 00 of day ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ run id run path :// { 24 00 SE LECTION norm case Ġwhere ver do plot Ex ist normal ise 97 647 ĠJ S my obj config urations ac cessed File List Ġcv x Ġtable lines ĠCon straint ik o ĠZ hou Ġob late 23 05 ĠDe legator mplex porter rit es Base Ensemble pd w Ġsim ul pdf tops ĠAl ignment 08 15 CV S CV Score To Imgs Ġfield name Ġsuper class Ġcorrect s ĠUn raveled stop defaults flat top AD DR Log s Ġvis lab Ġbox plots Ġsche duled Ġnan osecond ĠLo aded ret weet cel ery Or anges Ġcomple tes vers arial Ġlook ups EX EC Forest Estimator Number DB 93 06 Ġside d opt Parser fraction al Ġshort ened Ġli quid ĠSpec ified lm nop ĠInter vals orient ations Dataset KFold Ġmis matches UM IN Results Wrapper Ġ"- ") mx np ENT ITY met ian fid ucial Ġcli prect Ġlag mat enet ic ĠTemp orarily Ġmembers hips Order Dict Ġthresh olded Ġsubsample d Ġhope fully ĠABC MultiIndex Pe ter arel le Ġstandardi se hide s 8039215 6862745 čĊĠĠĠĠĠ čĊĠĠĠ Gen omic alth ough 974 663 yellow green radio Button ĠRo ss ĠPr F Zero DivisionError #---------------------------------------------------------------- ------- ĠMan ager Ġfo cal Artist Helper ĠRest art åĢ º ĠFill s Ġfla ke HR XN ĠTool kit ĠDiv isor Na Cl ao Series ĠCommon s Ġdigest s pay off Rad TS UMM ARY SUR VEY Ġ["% # ĠHuber Regressor ĠLeaveP Out æ· ± How ever PIX EL nucle i Gal axy Ġdiver ging ĠWrit ing ĠFilt ered 801 974663 VO CAB dead line Ġaest hetic ĠMor let Ġdog s ĠSoft max ("" )) Ġanno unce ĠExt Type Quarter End Sci ence ('= ')[ Wait ing ĠSpan ish ĠFollow ing ĠEarly Stopping MIC RO twin y Ġtwin y appro ps KD tree reproduc ible Ġsole ly Ftrl Optimizer tear Down Restrict ed Ġ..... : æł¹ æį® ĠLeastSquares Error 57205 801974663 # > % " ( ([[ * ): , ]) . ]. . ]* 4 6667 7 11 7 49 8 39 8 181 = ()) A MS B ODY D RAW E c J ARS N k P d R ho S OR S pikes V CF W ig ^ *) b ef c ribed f xs h orizontally j pos k solve m inder n T n jobs n frames n Rows n Steps p data r ust r ill s mp s ld s ift s del t vals t ups u pe w info x bins } "] Ï Ģ Ð º Ð ¼ å Ķ ë IJ in ion in veta st cs an as me mb Ġn cut Ġc nx Ġa ae Ġa mazon ro po ro of Ġin validate Ġd phi Ġd ollar la u Ġe po Ġre computed ge ev ic lient un dex un load un convert el sen Ġas str Ġto playout ĠT aken ha w ch ant Ġr ated Ġ2 39 Ġ2 83 Ġst k ]) ", nt ime Ġ+ '\ Ġg umbel data AB par alog ke p lin dex ul n ath an plot group ĠP sy ĠP atches ĠP AND ĠA BS Ġu ic od ic Ġ== " ĠC SD to olf Ġtest ValueTensorIsIdempotent Ġde serialize Ġde modulation list a ĠD am Ġv end Ġal arm bo hr Ġon going df b Ġ{ _ ĠM Hz ĠM aterials Ġne wargs Ġl X 10 23 Ġout name Ġout vals Ġout going ber ation train set ĠB lo ĠB ACK Ġun checked key board In icial 99 55 Ġcomp liant 0000 0000000 num Input add Separator Ġ** { Ġplot f dir Name lay u 11 893 Ġinput File color button names paces Ġlabels pacing Ġnew b ang led Ġpy gtk Ġno constant fa q Ġsub parsers ER A ER N ĠK lass load ers ok ing 88 53 Ġ| < 16 86 Ġup s tt l čĊ čĊčĊĠĠĠĠĠĠĠ )] )), 13 00 `. """) Ġpath codes table Name 04 43 Ġfa cing Con trast Ġinit iated exp dat dis patches Ex plain ST ER cv xopt Ġload Data IC CV my l ass andra option flags db directory Ġad am Ġtrans posing ĠZ m 55 00 Ġback refs process Events over nment Ġpl ug ĠWe i Ġdec imate To Anns Ġab cd ,' _ Ġhow m rol lforward +' /' Al ong initial ise LO GGER ĠMe m Log ic Ġregular izers Ġxy n Sh uff Ġ'\ ' mic rons Ġpe ptide aut hent Ġstri ps Ġwo men :]) ): :`~ . Ġmessage box Spec Manager Ġpatch A Vari ous Ġent ails ĠInt Var chi map Add Simple Ġho lo Ġpys peck ĠSelect Field mar kevery Ġ(% )') AM I tp ch SS S ĠApp lying Sy stems rou pe LI KE }$ )') analy te ,:] * Ġsymmetric al Hist o ĠTrans port Ġprofile d Font Directory ("- ")[ Ġur x Ġur y release s NO ISE ĠMA P ĠMA PK PT bun SQL ALCHEMY Lim s ĠSim ulator Ġregist ers ######################################################################## ### diagonal s Ġautos klearn DATE TIME commun ities Ġide mpotency Ġlst y Ġ------------------------------------------------ --------- tele metry Non linear Lat tice Ġzoom ing FIEL DTYPE AGG ATG Ġtrade off aug ur yo lo ("{ "+ Threshold ing ĠPart y Ġarc cosh mor ial è¯ ¯ dri an ĠDO M ytick lines ĠUSE quityPricing hns ons fro pt Ġmaxim ally abcd abcd failure if ĠPR IMARY IDE AL highlight ed Ġmom type ĠSun day Callback Registry ĠFixed Locator pez oid Too ltip Ġnucle otides ĠConvolution al Determin istic thro ttle heading cell Photo Image æĢ § Unicode DecodeError ĊĊĊĊĊĊĊĊ ĊĊĊĊĊĊĊĊ stest Result aaaaaaaa aaaaaaaa ĠInclude s BY TES gridOn Major inde ces 8080 80 Ġbis plrep sear chable ĠExt ent Ġ'? ': IPY THON Heat map ceptive Field å¿ ħ Primary HDU ĠCod ing Ġlig and unders core depart ure Through put ĠTerminal InteractiveShell ĠAz imuth Ġtukey hsd emer g Ġfif th INSTRU CTIONS WithCopy Error æĵ İ 570796 33 âĢ¢  Ġneglig ible Ġconsecut ively toolf ig AddSimple Tool Ġpyspeck it + | . [ . '): / $', 4 66 5 48 6 39 8 15 8 95 8 17 9 3333 9 0588 B US F riday H umidity K in L AND M x S b S x S amp S moothed X new a vel b anded c rm d in f ds g bar h ps p lo p di p ane p mn s peakers t at u ctor x Label x unit x logy x avier z m č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġt series Ġt diff st rerror al ns me minfo Ġi ou Ġn lvl Ġc ub Ġc row Ġc ands Ġp out Ġp nts Ġs ax Ġs dr Ġs izing ra xml Ġin cur Ġin coherence Ġd ns Ġe ptm co on Ġre produces "" ," Ġb og ic si ig am Ġ( @ Ġ( """ Ġ( ?) Ġ1 68 Ġ1 79 Ġ1 440 is init is Valid is Project )) }, ĠT en th ist th row ha p ve gan set point Ġr le Ġr rc Ġ2 65 Ġ2 29 ]) ( (' ## Ġg se Ġg lb ke e ĠS MO =' $\ Ġx low Ġx high Ġx uplims py s ĠP k Ġu c Ġcon cer ĠC SA im m Ġde cl Ġax Array Ġ3 66 test Case line Chart ĠD ates Ġv ic ta fter Ġal bum per pendicular str ata str cols Ġon error fit func Ġpro posals ################ ###### ys ing Ġne u Ġlabel left Ġout Dir Ġma cros sc lr Ġpre senter Ġdf r ĠB ill ĠB alance ĠB LSTMLayer Value Op log File Ġen fants ant ibody 64 36 fo cal ., ))/ Ġexpected T ca pes error Msg sub parser sub program map boundary Re mover ren ded read me color list bin numbers Ġdo copt ĠH ierarchical ĠH adoop Ġoutput Cols Ġcl at 45 19 ĠK iB grid array grid Layout 16 36 19 12 sparse Cols 78 37 78 39 03 137 lat long Ġstart Date 02 46 17 01 run el Ġexp iration Ġbut t scale y AN O Ġrun Job Ex isting rc setup 34 15 graph ical Ġ9 22 Ġsum sq rows Between math works Name List ls mr ik pt EN ABLE hist x hist y Ġfilter able Ġframe data AC CT AC TIONS Base DNNClassifier Base DNNRegressor Ġar type make PeriodIndex orig ins inv gauss Ġfont list ĠStr uve 28 00 cos w cos mic sha ft ED I ED S MA Y Ġ15 2 Ġ'% %% cri mson LO Y nc p ĠPeriod ic This One Ġref count Ġfix arr App lying debug ging Ġnan max Ġser if Ġ16 2 Ġskip footer imp edance prior i ĠPre fix dr mag Transform Node === ") Ġconnect able Input Cols agg lomeration Ġcla zz Ġcombin atorial status msg Color Model Ġsql cipher ĠAs sets Ġpdf tops NN J Ġart is Spec s regist ers Ġmp d CD PT ^{ [ Th ickness ĠModel View )} ` )} ^{( Output File ĠFOR TRAN Feature Synthesis Ġinf os week mask Ġdev iants From List ĠPandas Object 10000 038 "> { PY PY Float Mixin Ġmultip liers Ġneigh s ((' ', Ġscatter points Acc umul ĠDB pedia divide nds Ġgover ned Top Features Ġcdf s three col Ġblack body Mag ic ĠTr uth ĠGeo Axes Ġnone xistent dig amma =\ [(\ Ġfore ver Ġspike trains ĠEd itor Lat ent Ġlt able Exp lorer Ġmk stemp prot ist Ġhex agons Ġtech nology Ġste reo Connect ing Ġtup lify ãģĤãģĤ ãģĤãģĤ Ġconvention al MI Z ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠ TEXT URE 266 67 Ġpip es notebook s ?? ?? xff J hint ing çĶ¨ äºİ ĠForm ulas ĠTech ni Ġsound ing **************************************************************** *********** æµ ģ ĠSte ven bro ck CRE T ĠCR ITER ANG LE Ġxk cd vw ap Ġtarg func Double SpinBox PIC KLE AE ER strat ify kel vin ='- .') capture d Ġfam ous ãģĬãģĬ ãģĬ Ġwarp ing REC ORD æĭ ¬ ĠDeep FeatureSynthesis Ġrelax ed ĠMULTI LABEL Ġpay off whis ker Ġinde ls Ñģ ÑĤ ĠSupervised FloatMixin Ġsinus oid Ġcompact ness ĠCy cle DY DZ ĠRich ard ĠRich ert Contin uum Ġ[{} ] filen um BQ ScalarType DX DYDZ ĠExplicit ly ĠRolling Panel ĠPACK T Dar win ç´ ¢ ĠIns pect Ġcophe net ĠÎ µ dynam odb ĠDiag ram ĠDevi ance æ¸ ħ Ġmagneto meter TRANSFORM ERS ãģı ãģı ĠImplicit ly ĠMETH OD Chooser Dialog æł· æľ¬ ĠCAR ET stel layu ĠtestSingle Update isat ty emot icons MARG IN æݨ éĢģ kway ICCV BMG xt xfft b " ``. # =================================================== ' >, ) ] ? & D Range E min E ULER J p P NM S SE Y ates a po b readth b untu f ax f dict i mplements k ou l map l ume m rt n lay n ay n series n The n blocks p max p stress p chip s ight s params t var x limit x diff x CF z ab | _ } '] } ')) Ð » å Ĥ¨ Ĭ ¤ in out at on at tack at tached at tempt or c Ġt dist Ġt umor st sci -- ", Ġi L Ġn val Ġn ticks Ġn unique Ġn times Ġn walkers Ġc ars Ġf ermi Ġa value Ġa cos Ġp info Ġin del Ġo series Ġd P Ġd gp pe ps Ġm type Ġe mat ge mini ed s ed if lt ime ata bility un select is function el atex li ope est ate as cade 00 45 val init Ġis omorphic ĠT ell Ġy I Ġy test Ġr pt Ġ2 00000 mat or ype ak Ġst ory ') ** pt ides Ġg cs Ġg func Ġth reed Ġco or Ġx values col n ist ra ĠA CC Ġu ss pre l '] ]), ĠC ele im ComboBox to b Ġtest set ĠF resnel Ġax e np er Ġfi ed Ġ3 08 01 26 cal str ext inction ĠL AR ################ ######## po ulos Ġl gd core fonts age d ĠG IL ĠG rowth ĠG itHub us ual Ġma iling pl py sc re ĠE cu Ġ4 42 Ġ4 68 date str ĠB LAST Ġun filtered Ġ5 11 log info In sect da ft Ġclass room ĠW ars ener g ĠO H ĠO rientation sub params sub traction ings pace Re lay Ġline props ĠPar quet cc us ĠY sp 15 92 Ġinter leave IN V ste ering base Name au di 45 3834 ']) \ Ġro p ĠEx isting tt c copy fileobj `. ) 03 01 mon te Ġargs pec 09 86 work Dir ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ex ercise med filt 34 48 Time Axis Ġq ty Ġopen face scal able Ġmod f Ġmod ulation 30 75767 RE TRY Ġob l EN G 77 106 Ġar ise ĠAl ready Ġoptim izes To Server Ġfield Items Ġfont Scale cos metic CT F .) ], Ġext ensive exec file Ġvar list su f perime ter Ġpla za filt s Ċĉĉĉĉ Ċĉĉĉ 56 9 ĠLinear NDInterpolator Pre SEBAL IS M 57 3 stra ps Sh own Ġ'- '. sw aps Ġlong ley Ġexec utables tool bars Ġfilt filt Ġtoo ltips Ġhold ings EX IT ('% % 199 90127 win ning Ġhtml code rb an oper and mc data entry stop fits image Ġda e Ġactive Columns CS parse ================================================ ==== Ġnx t minor Locator tab ol TEST ING ĠSparse ness Ġ'< =', ĠImage Viewer ni ps sd k cla des Ġ17 00 dm g Ġdownload s Ad vanced dest inations ĠRegression LossFunction Mean Shift Ġny quist Ġagg lomerative cret ely Over laps ĠAss ure Ġll x sho gun å¤ ´ ĠGeo metric ĠEl lipsis Auto DateFormatter ye es ĠMon itor Ġant ibody quant rocket AGG REG Ġphot ons HI FT REG RESSION ]; \ Ġol derr Ġib Connection Ġlam bert ĠTri angle datal ist ìĿ ¸ Ġplay ing represent ed ĠOb served Idx s ĠAcc ent ĠMan ifold fall ing Press Event ĠBack port ĠNE W ĠBin ned loglike obs Pop up fund amentals Pu Rd quart iles potential s åĮ º Ċĉĉĉĉĉĉĉĉ ĉĉĉ Ġvan illa Ġmonotonic ity rog Truth Sw iss VERTIC ES Ġstreams x 201301 03 ĠSK IP 表 示 GRA M qq plot Ġvirtual env Ġarrange ment Quad Mesh lfile name ĠDeriv ed ĠAut os kv store Ġnic er ĠDag Run ĠPrep Sample ĠCorrespon ds Ġcompre hension abcdefghi j getNum Partitions ĠDNNLinearCombined Classifier Ġdepart ure Ġpolit icians ĠHouse holder Ġpus hed Kalman Filter setCheck able Ġspi king 0067 032 initInfo bar å¤Ħ çIJĨ ĠNeigh bours SessionRun Hook naPort folios æ´ » ĠPAND AS Insect a 453834 77106 3075767 0067032 45383477106 168 ( > 3 0588 4 00000 5 238 6 26 6 08 A AT E le F p M r M DI M aker P ha P layer P PI R na R ESS T AS U K W alk X on \ "]/ _ + a up c rc c Table d mag g ts g ad g lif h scroll j b j ellyfish m ange m arch r ick r solve r pkm s ip t all t otem v ins x end y loc y orig y offsets z x è £ è ŀį ï ¾ re co re ne re compute Ġt stop er p er ver er atura de cl de bt Ġi eee he ather Ġn comp Ġc ryst Ġf codes Ġa IBi Ġp min Ġin b Ġd sy co ur Ġb en Ġ# / ic ated Ġ( ...) un o un ish li a ot f Ġ[ :, Ġ" ({ ter rain ch itz fi at Ġ2 61 Ġg v Ġg mpy get Parameter for iter ĠS TY ĠS cope ĠS ki Ġx z ': { ul led col Num ist on Ġh ill Ġh ero ĠP ivot ow ns Ġde dges ĠR sp Ġ3 19 ĠD igits Ġlo lims cal ving time Delta time Zone file handle ĠN ano ĠN UMP per l df r ĠM AN ir regular Ġpar names Ġnum Features ĠG reedy ĠRe commended cl arity Ġ4 15 Ġun sampled Ġen e 99 81 model pars ĠO ST Ġplot time Ġline length Ġch ord Ġest im cc w Ġz u Ġper cept 05 94 Ġoutput mask Ġsub strate Ġ6 315 ER P [" % doc scrape 45 66 ĠK yle ']) * 16 22 info max Ġro dent dist ill nan comp tt es tick mode Ġprob it Ġprob lematic Class ify Ġarg dict sp heres 96 83 the sis trans ft ĠTest P Ġ{} )) 95 12 ĠCo untry ĠCo urier rt n Ġdif ferenced Ġdif ferencing OR Fs Ġinit al 27 79 Ġdistrib cell ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ap corr rc Param normal izers lob es ĠQ IIME Ġq th acc i select Expr struct s ai re net loc Base map Ġsm ll je v draw mapboundary ev ol Ġab stra OL LOW poly df Set Pen Set KernelStatus Ġfont Face edge width Ġequal ize 40 78 Ġts frame ĠLinear Regressor Ġref l Linear Estimator child rens Ġpower law Ġhandle box '} : Ġnb values Transform ing Int ra Ġevery body Input Data Ġmost frequent Ġsimple st Ġredu ctions Ġtag ger ĠSh anghai cro sses ĠMax Ent ĠInt ro meth ylation Ġeval Type Ġra sters PER CENT cb k entry Bar ĠDE M mpy func Ġscript Element air y mal lows ĠSy nthetic }$ '. lw ings centro py '`` ) Ġclip id Ġstarting Month Ġfft freq Ġfft convolve mixed ReadCount Mult iclass ational Error Ġill um ĠParameter Context Gaussian HMM ĠNearest NDInterpolator Ġpk gs Ġtre ating KE P Version ed Ident ification expect ancy ima gs latitude s Ġappear ing ĠWith in Ġbr ings Ġcare fully Ġlight ning GR IB Example Point 112 4 Ġouter most ja Vu Ġplane ts Ġ({ })'. Ġintro ducing ograph s fir ing ĠMy Estimator enc ia Obj s 349 206 High light Anal og Imp ro System Fonts ĠFilter ing Import ance calcul ations Img Ids Cross Price Cross Validator Ġsn k neuron as ĠDep endence Left Button ĠRo Is ĠHas OutputCol Ġcompress or 232 4 quiver key ĠAL LOW 035 29 inspect or Ġ{}) '. ĠClo sed unix time Ġmanage d ĠFix ing CTCT G æŀ Ħ Ġfactorial k INST ALL 85714 3 stratified kfold pointer s âĶĢ âĶ Pi lot ,: ]). GCT GCC DEL IMIT 392 4507 Ang strom dh dl ĠSym metrical ĠSign ific Neg atives ĠAD Q ĠExport er Cons umption ĠPa parazzi FFFF FF 70710678 11 tornado es coup led """" """" ĠMc G gw py Sup ply Syn Type ĠThread Pool ĠEvery thing å¾ Ĺ ĠFloating Point Ġdomin ate instanti ation åıij å¸ĥ Ġanomal ous PASS WORD STRU CT Different ial Ġabbrevi ated è¿Ļ éĩĮ invent ory ĠCombin ed å®ŀ çİ° ĠBIN ARY Moving OLS ĠVers us ĠDevi ation @@@@ @@@@ Ġobst acle aabb ca COPY RIGHT ĠGrouped Data idim x å¼ķ æĵİ 9934 784 Ġuneven ly exhaust ive Ġintention ally åĮħ æĭ¬ Ġlibo ffsets 1587 30 Corn ers íĬ ¸ ĠDelegator Data ĠNUMP Y 3924507 9934784 % - ' ([ + =[' 5 94 6 64 8 22 9 456 A Z B K B t C artesian D ue D LE F u F am H ir K d O X O sc O II S ca S moother T d T uning V X V t Y on b ump b rad c L c if c row f oci i po j ason l Y m gt m ltl n freq n ish n cf n Please p Y q sub r gt t A u om v inf w cat x rot | } à º å ĥ ĉ ĊĊ Ġ rom Ġ ]], Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re ally Ġt ys Ġt sp Ġt linewidths ar on de correlation Ġc ampaign Ġf lim Ġf Max Ġp ty Ġp tf Ġp tree Ġp tm Ġs dim ra el ro polis lo ess Ġd H Ġd N Ġd yn la grangian Ġm st Ġm Var Ġm argeff Ġm iou Ġe in Ġe ia Ġre chunk Ġre levance Ġre achable Ġb essel Ġw minkowski is numeric Ġ[ $\ 00 32 val ign ), (- ĠT w ĠT our ĠT MP ĠT une qu ivo Ġ2 96 Ġ2 77 il st ]) \ __ ._ par ity get members label C Ġex pense ĠS lope ĠS GH Ġco pe =' : =' ../ Ġx pdf Ġh u Ġh freq ĠI sl plot kwargs ĠP HO Ġcon centric od ate ĠC are Ġde prec ans as ans im ĠR AD ĠR isk ĠR iver if orest Ġme npo line Styles Ġlo sing Ġse gregation Ġse asons ind Result out group Ġk id Ġk np bo ats str um ĠL iver max Value ĠM SD Ġan ni Ġne qs we i ĠG STOP Ġ/ * ĠRe ason mb iguous ĠE mbedded ĠE lecMeter ph imin Ġset osa Ġ4 13 date fmt ĠB ins In i Ġlist a Ġ`` -- Ġmax interval add ons Ġindex ables ĠO rient men coding ()) * roup a Re ps Ġline offset inter rupt Ġ[] ]) ĠIn d Ġpa used Ġtrain Label Ġj ack Ġlog L Ġcl arity no op default Font emp oral pen gu ĠData Range Ġcor pora cur gap box ed led ition 78 64 200 01 ĠCo x ĠCo lour )), ) ]: , back ref Pro ba Pro duces Pro duce Ġnd ar af er ĠJ on 92 10 ĠQ MainWindow ĠQ FileDialog Ġscale bar Ġ''' ( rel s File Type ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠCon cretely 87 059 55 76 tree view ĠAr r process ors ([' '] Ġstep wise Ġar ctic ob l window Size angle A Ġabs ol Ġfind SystemFonts gener ates To y drop box real istic vis ibles Array Like EL Y ĠPro gramming unit cell roll bar convert ing groups unique Tree View ML R factor ies 117 19 nc attr Ġvis itor Ġform ations press v Ġpick lable All Windows Ġ"% - ĠOr gan 51 33 83 137 conv en Ġtag ging Ġaut umn Ġart ificially atom Label 72 88 Ġcustom er Vari ants contain ed ĠCh ristian sl anted Ġshrink B ĠPy DB ĠFe bruary percentile ofscore PER O aw a ĠMat rices ĠRes idues Node Collection eta it Iter ative Ġpost gres View s ĠUni Prot ĠInitial izing ero vs safe zip car ousel æĸ Ń ĠKernel s Hist orical Ġcolormap ped Pandas FeedFn Select Field Stat Lin Ġcap thick Ġgra fo serial izers Day OfWeek Mod Arr eig vec Ġrepla cer Rest rictions Ġ================= ======= å¤ ĩ Ġtransfer red lan chard ################################################ ##### Lab eled Custom Dataframe Non Zero rp n QT Ls combin er Integer Mixin ĠAc cessor Ġpres ses Engine Spec central widget ĠGP ASS My SQL ĠOb serv Ġravel led Writ es WX Agg Ġvir ginica ĠForm ula ĠJin ja ç§ ¯ ĠOrthogonal ity 123456 7890 upd ater ä¹ Ł mono chrome _`. ") Double Type htm ledition е н ("================ ===") Station ary ĠSi mplex ĠSi lence åĽ½ åĨħ stellar massbins rub y Scaled Translation Ġatmos pheric ĠSupervised IntegerMixin ĠVectorizer Mixin caffe model RFE CV interro gation Orthogonal MatchingPursuit Ġwhit ener RAD AR Ġess ay ĠPYTHON PATH åıĺ éĩı DIMENSION S ('= ') Pur ples cry pt SMALL INT Ġskewed ness ĠWest on Crop ped Spect rogram Lazy And ĠWal d aqu amarine ĠFancyArrow Patch ĠIncompatible Frequency syste mencoding ĠGeneralization AcrossTime shuffles plit VIE WS Ġiml s ãĥĩ ãĥ¼ãĤ¿ Ġtang ential ìľ ¼ âĢ¢Â IJ Ġbutt ord ĠEcu ador $ )' ( {} ( ("% ) \\ 1 663 4 90 ; ĠF ed ĠR us ub utton Ġ3 72 Ġ3 53 Ġres dat time stepper Ġk ruskal Ġal chemy ds x ĠL hat max imized te al ĠM app ĠM utable Ġan vi red its size Env ĠG ut ore n ---------------- ------ et as ĠE ren ": "", ag ar sh ifting Ġun shifted ip olar Value Def ib kr Ġthis bin log l Ġlist ener Ġen riched 99 94 99 29 ĠW a Ġget p ca ret Ġhe art Ġwh ites 25 75 Ġ.. \ loc pot Ġz label Ġz cat bin Freq Ġsc ient Ġnew file Ġnew bytes Ġlog norm ################################ ## Ġno un pr icing dd q Ġsub routine no cov no mad 201 51 code obj ]] - au ge Ġind ucing ']) ]. Ġup sampling Ġcur ved 14 03 14 67 sq norm )] ', 78 00 '. ') ĠV M by nipals Ġcopy file Ġmo od 95 36 SE P AN L 06 00 ]), ' exp Result Par ame ')) ). Pro cessed Ġ... ]) Ġgrid ded 97 255 ĠJ ones version file Col l ĠQ Menu Me chan Ġad ult :] ))) RE TR The y Ġmult itask si lico (_ ): AG WS AG WI AG WO AG WET Ġlast gind Ġboo ster ai wan Ġlinear ity net ization Ġsm lld AB u Ġty pename rec fromtxt Ne to lu igi FI LL Set BackgroundColour rank dir full Keyboard EST Y ĠPro duces "]) ): Ġoffset y Ġlink er Al ways Ġchannel izer Ġdb se 56 18 Ġrespon dent '\ [ Ġmissing val Ġmy self Ġconver s Python Scalar Ġser ious IG WI 89 804 Ġgre p aut om aut ocorrelation FT ER Transform ation Ġurl join Ġbuild ers US ING CE PE CE PS ĠKey words clip se 0196 1 ĊĊĉ Ċ Ġsu fix Tensor Data small data yp ing )`` : Ġ[], [] tp u Ġmag enta Ġap pyaml ĠSparse Coding ĠNOT JUNK ĠApp ends ĠOut Of ij erg ĠUni mplemented cla se Ġradi an ĠDis cretization export er DD DD PY SPARK Ġown ers Sample d ĠPass band ĠTensor flow TA ET += += Distance Matrix Ġtw opi BA SET Block ing urb ance pan os sho e autoscale Xon autoscale Yon Ġ195 0 Pol ish pas senger Auto Locator FileName Counter ĠOpen Fisca omp cv NOT JUNK Ġ------------------------------------------------ - Bbox Patch 134 08 web based bys vd 212 4 Ġentity set Drop ped Ġsuff ices åĬ Ľ 054 90 VI SION Begin ning GH P phe notypes Request s Ġ================================================= = 146 9727 Database Offset ĠAg gressive Cost List periodic ity Legend re Evalu ating divid ers íķ ł Scan Info Ġchem istry ĠSM OTE USER DEFINED Json Table ĠExec utes Ġphe notypes Evaluate Test ĠMO V Ġbur st ĠIM G ĠÐ ² ç±» åŀĭ GW VS Ġheter o 66666666 67 recip ient ĠFig ures LZ I LZ S LZ ET ĠRNG s Ġrain fall Ġpublish Date Ġfrag ile Dash board Txt Ctrl ĠToken ize ĠPlan et ĠAtom ic 949 02 ('~ /. ĠAnt i UZ I UZ S UZ ET ĠKalman Filter ĠHH t Ep isode IFW I IFW O IFW S Ġpseud opotential pnc r Ġmic rons SECOND ARY ìł ķ Ġlnp rob ĠAbinit Timer nul ltype Switch ing Ġstret ches ĠExamplePoint UDT Ġelli pe Ġmong os Ġgues sing Ġanneal ing ĠDIST INCT exceed s NEST Error CALEND AR Ġctf data SetStatus Text Violin Plotter ĠSQR THALF ABCDEFGHIJ KLM ################################################################################################################################################################ ###### ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ bounder ies 10000038 1469727 lume xdata ĠSTY LE ĠSparseCoding Mixin " * * % . )*( 5 253 7 26 9 13 : } : "+ D ENSITY H ierarchy I a I SD M OOSE R NG S ports S ketch S plicing T uned U nt U HSAS W o X Size ] <= c lobber d ssy e lection f T f test f trans f dpi i G j ulia l up m hi n class n fl n seg } ({ · ¸ë Î µ Ñ Į ç ľ ĠĠĠĠĠĠĠĠ ĊĊĠĠĠ in fected Ġt ack Ġt weepy st udio st devs al ine le p Ġi covs Ġn lines Ġn days Ġc sp Ġf sp Ġf ler Ġp z Ġp util Ġd db Ġm ig un ame un zip Ġ0 14 is ig is upper ame tre Ġ[ ". 00 22222222 Ġto dense Ġto wer Ġy A Ġy env lab ware (' ! int est int ext nt ology Ġg op Ġg onna ex cluding get Column Ġex terior ĠS ta ĠS CAL ĠS coring col umb Ġh oc plot Panel ĠP FB ĠA ud ĠF V ĠF ALSE ĠR ST Ġ3 46 Ġres i line break ĠD av Ġlo mb cal es time diff time gm Ġv ce min ter Ġk points ĠN ones art ments max X ĠM i ĠM iss ĠM ODE Ġan atom Ġl dict ĠG PC Ġout perform ĠE levation ph onic ĠB AM sh ut ip os ifi able In Polygon 64 24 64 83 num Features men tries map i 25 10 Ġinput Data text tt Ġsh ips Ġj a Ġfig width ĠU C Ġsub model Ġsub problem no bj valid ity 100 7 ont real AT URE '' )) use afm 16 24 ml x dist n ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ tick lines check grad ĠV iz Ġdate str Ġmo b Ġend y Ġ{' $ run tests 86 85 86 24 SE CRET obj type err al Ġrun len Par is Ġversion eer ĠJ OB save Data Time Sec Ġtext ctrl IC T Ġgroup rank Ġmod ular Name Error 65 84 batch num Ġad q Ġtrans Data Ġbatch num tf record ĠCon ver 87 600 lip ids point plot ĠZ IP fill continents 23 09 pop ularity AC COUNT To Show Ġcross over Ġcount ies vis u Ġselect ive iple y Comp ression ndarray s Ġfollow ers vol ving Ġcontinue Routine Ġge l User Query ED GE Per f _{ { _{ \\ DI A DI G cf uncs ĠAt tach Tree ID cross Join Text Sync dims huffle Ġrec ieved 57 2 Ġ'- .', Format Str Ġser vers yn x Ġinterval y 89 00 imp lied '} )) Ġurl name ':' + Ġjson file tract s fast parquet Ġsimple filter older r ĠDi pole mid as attrib s UP AC umul ate ĠSo viet see g Ġdx r mut ator CC CA NE CK Multi DiGraph By Id ĠPy Test Add TextCtrl GB T Ġrs d ^{ % Th reads ĠRes idue Dataset CV Dataset Loader CR S CR ITICAL Tool Base gp x VER S As ian As semble Ġhalf winwidth seg m Ġclip box topo graphy Ġgeo data SH I SH AR ĠFeature PoolLayer Ġrece iving Select Percentile ĠAdaBoost ed Best Splitter Ġstand ards Ġelect rical IST ICS Over Time ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠStat istic Open ing sho re Ġaz ure Ġì Ĺ ordinal f Fixed Formatter ('.') [: ĠDoc Test dark red é e spike times Ġcar bon Ġalias ing ĠLoc ate lar va ami en Ġbits persample Ġwait forbuttonpress ĠCalcul ated Dimension al Ġpg tol Wh ich Ġ"{} . Ġ################ #### 027 45 ĠTri al styles heet brain s ĠPh D ĠCL USTER Ġwater mark does nt Quantity Type 12345 67 Ġcrit ic Ġexceed ing ĠIP KernelApp 327 68 +\ ] }- \ oto py highlight ing Ġdvi file Math textBackend ĠMIN UTE Ġgeometric al WINDO WS neural nilm LAT bun occur red Ġipy md PERI MENTS 163 16 8888 89 Ġorgan ized tos cape ĠSym metric HEL IO Prior ity Ġsci NotStr thro ated Jan uary ĠPa ul Regular PolyCollection COD ER +)\ ] Api Hook Ġmultith reading Naive Bayes æĶ¶ çĽ MY SQL beha viour aperture RadiusIndex Ġexhaust ion psy copg triple t golden rod wildcard Find æĢ» åĢ¼ zc UserQuery amazon aws zoo med Called ProcessError ĠRaster ModelGrid Leak yReLU obtain ed GTT GAG é¡ » ĠaxHist y Ġnavig ator ("= ") Ġpunct uation conduct ivity Respon ses Ġips hell ĠEco logical ĠUnivers ite SCHED ULE Ġflats urf ephemer is TLE NECK Ġå½ ĵ ĠCress ie ĠFloatingPoint Error juel ich zcUserQuery NameSpace " '% ) `: . '), / ## 5 333 7 29 7 000 8 10 8 660 9 10 : * A f A ler A veraging B IO D y D Type D IP E arnings F IND G t G as H arness H adoop J ean K 线 S ale T en T CTCTG X int Y Size [ ()], a im c cs d ums e vec h un i ol i ator k size l bound m lines n de n il n atoms o ol q mc u der v arn v range v dims w min x S x df y g y Values } }{\ à ĥ Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠ Ġ rainbow in version re play re chunk Ġt one Ġt cd er ty de a de cy de noised Ġi cnt Ġn se Ġn vis Ġc ot Ġc ards Ġf range Ġf riedman Ġs st Ġs proot en han lo ys Ġd num Ġd anger Ġm ga Ġe max Ġb cast Ġ# + ed erate Ġw gs Ġw iggle ur the ', "% is Draw li zed ot us 00 184 ), :] ĠT p ĠT mp tr gb th ann ad t ve centropy Ġ2 38 mat es ]) [- ]) ]), int ens get Index ĠS ensor ĠS inger ĠS loth ĠS UMMARY Ġx log Ġx Label ĠX n end Stream type id con is col ation Ġh ues len as ĠI B ĠI ono ĠI send ĠP at ĠA AA ĠA DC ĠA BCD ĠC rown Ġ` - Ġde ath ĠF n Ġfi p Ġ3 18 test case test Result Ġme f line offsets ĠD y 01 25 01 13 Ġcol d ns up Ġv bar Error Bar bo iler max inconsts ĠM T ĠM Y ĠM un ĠM NI ĠM isc ps k der vars ho ma Ġlen ght ĠG umbel Val List comp etition ph or ĠB order ĠB lended Ġun likely log Ms log arithm `` ] 99 25 99 78 Ġcomp ounds Ġ`` * Ġmax size pha sed add Stretch ĠO VA ca ys Ġdefault fmt sub sy Re currentLayer 11 84 Ġmin utus color up ĠIn line ĠY es ĠY csr Ġj v Ġfig man 20 75 Ġcolor Name Ġ6 53 doc utils 45 454 Ġ| \ grid y 16 88 19 20 19 49 19 48 group dict ))) ; Ġvari egatus Class ic Class Name ON ENT Ġarg parser St k func Id feren dums Ġpandas hells the o the str ',' '). lock s Ġfa ith coef str order ID ref ax ref ract Ġsp k sy r call InputFnOnce mod erate Ġpart str ID ENTI Time zone dt exts return Pressed Ġq f Ġq points Ġq cut IC l Ġcv xopt Ġdimension less flow X flow Y Ġtra vis De compress ĠDe precation auto layout Base SGDClassifier Base SGDRegressor ob el lower cut )* (( Di a 08 235 ins hausen year first tz str ĠTime out Plot Data vec cong ĠPro ps find Children mi q mi RNA ĠNe cessary Al bedo cross ings ĠMe inshausen 48 36 This File Ġref actored ĠAdd ress Get Id Ġignore case Ġlat encies bad args hs heather Ġnb dtr Table Field single tf Ġgen o Ġ14 00 Ġview lim Case s Min Max He ter ĠSh al ĠMax imal ĠCh ild ĠInt Float At tach Group by clean er ĠFunction Space dag run CS P Ġdirection al ĠInter action QU AD ('- ' Ġfs average With Full Of My Ġanaly sed 58 139 Ġspark Context Ġsupp ressed Doc Concentration cr val abc abc Categorical Processor ĠDis placement ĠBu hl Cont ig ĠFigureCanvas QT Ġ-------------------------------- -------- curs ors Ġtre llis bian p Level Cur OB SER Ġfits file SM ILES Work flow Ġtopo graphic Ġct or Message Dialog MO MENT ĠStat ic sal mon incip it Ġweek days Ġbw r cn f 132 23 sun spots Ġ96 0 fac ility fac ulty marginal s sos vm Lin ha subs x Ġ################ ######## Ġarc cos Stats Comp Port al escape char Ġsn ippets It alic mys ize orted keys reme z TIC KS Missing Value ĠCL ASSI Ġ================================= ============= Ġ================================= ======= ITER ATIONS (", ", Ġbot engine hint on ied Covars 104 19 Location OfMy Ġbag ged wolf e ĠSch ur Uns igned Partition ed Randomized LinearModel Ph onon ĠRank s æĶ ¾ Ġintersect ing 457 39 ĠInvalid IndexError Ġhal ef åĩº çİ° lz ma Na Functions *\ * Ġrecover ing Ġfli pping ĠScal er LONG ITUDE interact ing urs day 9814 47 Lvl Now blackman harris ĠOmega Wing refer red yb rid clamp ed Defaults HelpFormatter intro select ĠTE MPLATE Ġnarrow er 8284 2712 ĠBrown ian >>>> >>>> Ġkin etics Ġbis plev Ġtravel led metr ized nex tafter perturb ation cademic pages lefto ver ĠCirc ular Ġencaps ulates ĠDifferential Operators Ġexemp lar Ġpyg let ĠPers pective soil matrix prox imity Theil SenRegressor TimeStamp able ĠAk aike Ġgues sed WithT iedCovars pseud os osph ory stub ber GREE K ________________________________________________________________________ ___ ĠED IT ĠRuss ia ĠAstr onomy wic ke ĠBidirectional RecurrentLayer 缴 æİ¥ ĠClust erer DocTest Finder PrimeUTR Distance ecol mod CVScore Tuple ĠTransport ableException Versioned Library ĠPHO EBE ĠLiver more isDraw n ĠIntFloat Dict WithFull Covars LocationOfMy Self # .. % ') 5 26 < ( A ctor A MA B Box B MAT C DELT D os D ial D ask D ropping E ff E cho F test G ather G AM G SP H er J uly L UT M uest N IT Q Q S now S SA S GLD W ED X Diff Y Diff ] +'_ b name b ca b Zoom d G d ana d rainage e lf f F g la i len k key k star l Engine m da n j n uttall q adapter r rc t B t rop t layer u cs w u w ms x bf x ranges ç Ĭ è Ĭ Ġ ############### Ġ ultra ľ ë se st se mantic at ivity re project re levance ĊĠĠĠ ĊĠĠ Ġt rough al ters al ike he ater he evd Ġn test Ġn fl Ġc er Ġc xy Ġc rawl Ġf offset Ġp ep Ġs data Ġs po Ġs select Ġs ift ra ke ut l Ġm cl Ġre computing Ġb prime Ġ# ... ur ize ur ance Ġ1 64 ', ): un te )) " 00 11 Ġ" ] Ġ" ~ ĠT d ĠT q ĠT ot array funcs qu aternion Ġy pred set Horizontal Ġr state Ġst ale ') ]). ]) +"\ Ġ* ************************************************ ex am par celas Ġex poses ", [ Ġx orig [' < ul li col Name Ġh ms Ġh gt py pit plot name ĠA naconda od at '] [:- Ġde conv ([ { Ġval ences np aths Ġ3 33 Ġ3 52 Ġme sses ĠD n ĠD UT ĠD ONT 01 44 Ġv d ta ker min imizing Ġk args Ġal iased Ġal laxes ces ium ds h Ġon value Ġon move max index df lt pa de ĠM SM ĠM otion ps frag der ive Ġne ur ho ff 10 20 10 44 Ġpar ms et f et mc Val TextSync ĠRe gressors Ġname dict Ġfile input Ġfile List ĠE z ph istic ĠB uffer ĠB ranch ĠB MAT log out Ġen counter da v che menv Ġcomp ilation Ġ`` %( ĠW arnings ine man cs ph Ġget xrdname ĠO v map plot Ġall res Ġall Scores Data Store Ġline cache ave c Ġmin cnt Ġmin SineDur pi i ĠH ill ĠH ug ĠH IST 05 098 Ġpy iem quen cer pos x Ġsub units Ġsub objects vari ational no Of 80 96 ger blue ard o Ġrow names ĠK BinsDiscretizer 16 20 16 863 Ġpos A Ġpos x 19 73 AR IES 13 66 mask ing 03 74 lat encies ĠTest Dtype Ġover laid 17 75 85 13 27 68 Ġdis cont Ġ7 68 freq Items uc ha cat mull Ġsp list 06 275 ec i 97 10419 ĠJ avascript Time d Time Dep my g Ġvalid ating Ġ9 01 Ġ9 000 File Handler Ġoff value mode m ĠZ NEUPD Ġ[" *. multi row 26 05 AC ES ĠDe monstr auto indent Ġevent Time lower limit ced ures Ġab scissa ĠTime Distributed full argspec Comp ressed CH AIN ster n Ġstat ically Ġtmp Log 38 75 ĠIndex OpsMixin roll ment su cc =% ( Ġauto convert AD C pad y LO S LO SV LO OK Ġop inion SA VED Pre processing this y cd r Sh rinkage Ġnan std Ġlong table Ġexist ed 74 16 Ġpe ts Ġnb format Ġpr f Ġpr icing Ġcomple ting Ġfin ancial session dir cha ir Ġpop ulating lr u Timestamp s Ġrc Param Ġkw doc Ġkw kw hold ings pixel set Ġpatch Size Ġpp is stro bj Ġra s ([( . Ġdot c ================================================================ =============== Ġdpi val )`` ) micro phone Cal ifornia With Weights CON TOUR VER T velo pes TE C sd c ridge cv eigen vector Ġ[(' ', Bar H ĠJo hannes čĊĠĠĠĠ čĊč Ġtermin ates tw isted Ġ"_ ". MC ell Mult itask execution s Gaussian Blur Pr inter Ġwin ners Ġtpr s Level Class semi major Ġchain file Est imation east ern border pad Tk inter Ġke i Ġlab les sn ippets Ġcover ing Ġ================= == ç» Ī Ġlag ged Ġmot iv Ġ================================================================= =========== çĶ » dst h Ġide ally Rd Pu Rd Gy SNE UPD Ġquant itative ĠDoc TestRunner Ġlt d ĠIncre mental dro poff Imp licit ĠSO M jd hunter Ġxr anges ln E ĠSort ing Br BG Ġonto logy GA USSIAN ĠSp Lu Ġ123 456 Ġstrat ifications dip dir ĠDNA UPD crit ic ĠCar l Tag ged Some Factor pub s Cost s sli ders Generic Broyden ĠMa int Ġconc ise Ġreplic a Ġstudent ized ĠFrame s flex ible servo irs Debug Regressor ĠStack ed ĠInit ially Ġ'.. ')) Negative Binomial NM DA 1415 9265 kel vins ĠSm allest ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~ ĠMPL Plot dra ul Performance Warning dry run cir cfuncs Ġsco pus ĠFr ont Gal vo Ġdiver gent osc illator 507 937 Expect ation vac uum Ġ../ ../../ ĠLu Inv æ¯ı 个 第 ä¸Ģ ='| ', ĠSal vus µ ÃĦ Ġpermanent ly COR R ILL UMIN ĠWOR KL Delim iter discre pancy Ġdevelo per ĠSyn Type Occ up Pur ple asite Axes Miq Ems ĠAV G Illust ration ĠSegment ation retrie val 796 08 slate blue cyc led prem ise recommend ations ĠtestTrainWith Weights Ġsyste matic EXTENSION S MEAS URE 8412 70 kst wobign çĶŁäº§ æĢ»åĢ¼ ĠMoment um abcdefghijk lmnop dai lies Ġhowm ny morial Day å¿ħ é¡» OLLOW ING ìľ¼ ë¡ľ OBSER VED çĬ ¶ ĠSpLu Inv + \\ . )] / @ 2 202 4 981447 6 1176 7 000000 7 8824 : '% A uth A vals B ear C b C UDA D Line E lt F und G Pa P CO R DF S pring S coring S ESSION V d W dim Z F ] ']), ^ ') a exp a greed b cc b fs d name d las e resis f red f requen g object h ypes j np k ls k ruskal l dt l ceil m ight m uch n ang n lines q res q point r ceil s ind t ds u ator u lose v z x mesh x coords x coord y col y rot z id z hi æ Ħ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in pt in od re j re ac re vi on ia Ġt iter Ġt xs Ġt span Ġt utorials he nd Ġn ave Ġn var Ġn frames Ġc rc Ġf info Ġf unds Ġa ce Ġa jj Ġp po Ġs sc Ġs parser Ġs uffer Ġs Top Ġs ampl Ġs orry ct c Ġthe anets Ġo ss Ġo dk Ġd av Ġd ac Ġd rv Ġ' '], Ġm use Ġm unge co medy Ġre projected Ġb mat Ġb lotter ed is ic orn ic Graphical Ġw pi ur at Ġ( (), el lipsoid ce ph Ġ[ "", 00 64 00 36 di ps ma heshakya ĠT aiwan ha pes Ġy error iz a ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ (' {}'. Ġg sm __ | __ [" ex po ex cerpt ĊĊ ĊĠĠ up lus get root Ġth readed =' @ =' ;', all kinds ĠX f from ordinal con sum Ġh n Ġh ang ĠI mag ĠP adding ĠA E ĠC andidate os hua im ilarity Ġtest Y ĠR as Ġax Scatter time vec time Window ly wood pro po Ġk st Ġk pc ĠN LS str len ĠL ut ĠL SI mo bility max log Ġan ew fig legend Ġnum args oc y ĠRe moving ĠRe LU comp ared ĠE TS ph ones Ġ4 12 date Run ag l ĠB D sh er Ġun stacker Ġun reliable jo hn `` :: In ertia In consistent Ġint c ant iderivative ĠW R ĠW arm ĠW idgets num cols men coder Ġplot funcs raw s Ġline offsets so um 11 99 ĠIn dian act erial Ġj image req s ĠH OLDER 15 54 input path Ġinter sphinx ĠU V dd r Ġcolor bars no index 80 87 Ġ6 28 new data new size Ġfit pack eld Object Ġspec ially grid file 16 078 ĠEx plained cur vature check subparams 78 32 radi ents 04 63 string list dim ir lock wds :// " 27 13 work bench Ġnormal esup 84 85 ĠFor ces Ġq l Ġq App UT O UT URE Me mber db api Ġass ay tf s ĠCon volve Ġoff s 23 45 last x img data Ġ[" + 26 386 AC CESS AC CEPT ĠDe corator ([' **% Ġpl ans Ġhand y make IntIndex ĠComp ressed ĠComp aring extra c rs m Ġca iman ĠPro late find iter steps Ahead 39 33 Ġclo set gree ment head ings ele phant Ġvar oquaux Ġang strom )], [ nc i Not ary Ġ", ", Ġfast q Sh ards Sh wartz Ġ'__ ' ret vals Ġseq data imp rove aut ocall Means Permute pers istent ĠString Field ern ando 54 321 Ġattr getter opt level ble i Ġfixed n An omaly Com mun )`` ). ru its aw gn Ġsur rounded Ġmis classified ĠSparse SGDRegressor CR s contin ent With Spherical æķ°æį® åºĵ Feature Selector CON CAT IR T sur veys Ġprogram matically IND U lst q ĠBu cket Sparse SGDClassifier EE P Reg ime }. '. ĠTrans lation åĪ « tail le Pandas UDFType Parameter Error Sample ID Ġmass ive bd tr under flow zoom y Ġgra v Day Pts IB r LA X dens ify Ġverify ing catalog ue ĠBo unds sat urated Mock Tensor yt os Ġcli matology access ible ĠOpen CV CF Subcluster Pickle Serializer Ġ------------------------------------------------ ---- ĠImp rove onom ical Ġgg mod Ġadapt ation Ġcertain ly kg pers Off sets Ġ'* ') dri vers fg Color Ġplay ed ĠAlgorithm ic Skip ped Ġtransparent ly Missing Lines ãĤ ¹ 33333333 3 boot straps Ġpivot ed Ġbi weight Ġcrash ing ĠRequi re 964 915 188 5 ĠHyper parameter ................ ........ ĠHigh light Gene ID ĠSingle BlockManager Cov Struct adapt ation Ġnom inee æĿ Ł MODEL S Ġcompile flags Upd ating lef tharpoon virtual env ä¹ ī ĠMar vin Ġorbit als thr iller Alpha bet Visual ize *\ .\ Pi YG ĠConnect ivity Ġbur den strat um Ġê ·¸ë ++++++++++++++++++++++++++++++++ ++++++++++++++++++++++++++++++++ Fl ush Sphinx Shell FITS Figure Ġbla h important Path tiny url Sol ving Ġhar ms tran sect Ġgn uplot maint enance heli um MARK ER Spatial Reference AAAAAAAA AAAAAAAA fire brick transport ation sine Model Ġliteral include Ġmes hes Syn th Ġdry er ĠBra Base Elect ron Ġdeleg ated Outlier Factor Ġcapt ures ĠMartin sson calibr ations ("" . ĠInterpre ter Ġâ Ī OE IC ĠAnn ual saw tooth Ġspyder lib Ġdee med ìĦ ± keyval d ä¿Ŀ åŃĺ ALIAS ES ĠLF Py Fancy Arrow 8095 24 righ tharpoon ="{} " modif ication pand oc editing Finished Ġcapac itance POOL ING Creation Date orentz ian ĠOFF SET ĠIMPORT ANT MPLEMENT ED Night Pts Dimensionality Warning ĠIllust ration Ġallocs frees BRE AK ĠHtml Formatter difficult y NOP QRST äö äö Oh io getH eldObject quint ic Ġbog us ĠShal ev 4981447 964915 WithSpherical Covars 4981447964915 46 % ; ) }{\ + % + (\ , (- 3 2549 4 667 5 86 5 2941 A stro A JAN A JUN B am C linical D ic E ven E ye G END H ertz I RE K ORD L SA P ure S aves S cr S OUT T et V IOUS W perm W MON W FRI W THU Y n \ "\ ] '], _ / a cos b min b date c ents d gp e md f solve f atal g lade h ug i Nn l data m angle n for n binom n aming s plt t value u order v ark w ashing x h x axes x bnds } "). ® çİĩ à ķ ç Ħ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re pla al b le ted de serializer Ġn clusters Ġf as Ġf ax Ġf msk Ġa fore Ġp ag mp h ra cle en ix Ġo om la me la ces pe rez Ġe mo Ġe lection Ġe dt Ġe click Ġe wm Ġre bin ge lsd est hetics 00 12 () < Ġ" )") ĠT ag ĠT ref ĠT oggle th re Ġy lines Ġy Min set Auto Ġr us None Type Ġ2 71 Ġg ax label ling label ler label Unit ax p ax Hist ĠS SS ĠX min col ordown Ġh ides plot loc plot Color pp b Ġ_ ), os q Ġtest Int Ġax py Ġ3 85 line below ĠD ONE Ġlo ud ne lapp cal Panel ase g Ġv acc Ġv ulnerability pro posed min f Ġk ron ĠN H bo le bo id str on pa ssage Ġan tic ys ub Ġl k Ġl data Ġuse Offset assert LazyAnd Ġout a row Num Ġwe ther ĠRe ject ĠRe ST Ġpre conditioner ĠE SL ĠE ickenberg ĠB OO sh if axis on In dian In herit In vc Ġsk im Ġcomp lication Ġtime span 64 64 ĠW arn ĠW AV Ġexpected Num add itions ĠO dd Ġbo id Ġit m sub file sub station ator ies Ġver sicolor 25 68 Ġline fmt Ġline break Ġline lengths inter n Ġdist args 11 62 Ġ[] }, Ġz e ĠY ellow Ġj im ĠH ex ĠH Centered Ġpy gments Ġla x 20 96 Ġ(' -- Ġcl us no br Ġ6 67 pen ses base Graph 66 84 75 686 Ġsize Policy cor p be e title font 22 47 ])) ]) Co A trans muter ĠTest Clark 02 88 02 353 Ġmo bility lock ing Ġbase file order List ref ined Test Clark cent ury 18 15 09 020 do ct Ġ, \ spec ially Ġnon parametric Se ctions Se curity bu fs Ġ9 78 Ġmod p Ġmod shogun non ame Ġtrans mittance ferent ial RE PE RE PO Ġob name select able 23 144 Ġ(" |" Base Cursor fol lower ravel mask draw Styles MP Y ĠComp ression first row real ization Ġimp osed Ġsorted base FI ER TR I Ġimg Size Ġstat info User Set .) \ ĠAt tr cache name sm ust ." + Text Browser Ġ{" _ Ġerr gjr ov en nc ar Ġop str Log ical Ġdb api desc end Ġdim x ilt ies PI m Ġ"" ): cd now Ġnan min Ġlong s Py Side Ġcsv Pathname PL ICATION sig a Or th dr um pick les lev y Input Size 79 36 Qt ConsoleApp sf nt interpol ating Ġgc r Dis c Ġshrink A Sub mission Ġte e mar ried Split s 2016 0525 infer Schema approx imately ĠImage Normalize ĠHe alth ĠTh ermal 101 825 čĊĠĠĠĠ čĊĠĠĠĠĠĠĠ ATION AL Ad vance ĠAd vanced äº ı Ġ') \ Select ing Ġcmd line Mask s ĠCur sor tod os Ġtex info Ġage preg Ġ---------------- ------------ Ġelect ro Ġquad rants '$ % PACK AGES ech inod sho yer Ġmicro bial =\ "% =\ [\ Nearest Centroid Ġspike times ĠDoc string é s Ġindent ation Ġmarkers cale ĠScore r ĠSE COND HI VE ĠSN IP )^ (- Cluster Spec Ġhex a WS AT WS UN Rank ing 135 0 Ġenc ryption fm cache Ġweb server Conf lict Ġdash array occ ure Ġmoving Average Ġcontrast s ĠStata Reader fro mp Ġ': '] Ġmaxim ization 655 35 Ġlm fit Ġ'| '. AX ES destroy AllWindows dn ntfDef adapt ed GU ID STAT IC Epoch Counter sco red Ġten dency Ġcython ize ĠNull Type Export er Raster XSize Raster YSize Ċĉĉĉĉĉĉĉĉ ĉĉĉĉ La unch cheby u assertLess Equal Np MatrixData BOT TLENECK Ġow ns aggreg ates ĠIndic ator ĠReshape Layer AU G WW ED tukey hsd ĠHO ME æĬ Ĭ ĠOpt DB 0156 9 WT UE Sepal Length AW G ĠFl ickr #**************************************************************** **************** ĠAng ular Ġ'@ ' Polar Stereo Ġdomin ant ĠSG ML 第 äºĮ Dependen cies Ġpil Image Ġthroughput s Integration Test TOOL TIPS Ann ual frees urfer ĠAM OS ç´ ł ĠDecre ase 模 åŀĭ QE JAN QE JUN <<<< <<<< Ġhydro gen gover nor ĠFollow s ĠKing dom lj ung VOL UME Ġbes ides Rob ot ĠPhot o Ġinvestig ation Ġsummar ized stoc Env Translate DXDYDZ ĠDA ILY Ġcert ificate ĠRAN DOM 3216 5618 ĠSummarize Results twos ided News groups ĠContrib utors INTR ODUCTION æĻ ¯ NFK D ĠLEAR NING ĠTechni ques kou Span Ġfler a ulli van draul ic edis go ĠESL II 101825 32165618 echinod erm ! , $ '. * / - [ . ''') / '. / {}". 8 11 8 1176 9 31 ? (? A dobe B x B ay B ond D vi E y H ole J I M us M ollweide N max O Y P au P ush P sf R amp S lip T list T rad V G V ect V ideos W ed W dg Y i c dd c ga c rashes d ream e max e arnings f input f types h align i oc j agged l ns l zip m ie m arr n ir n clusters n lon r pad r dm t ig t num u parrow w get w ake w asher y test y Label z ag | ) Ġ ary Ġ ĊĊĊ Ĩ Ĵ at tractor Ġt linestyles er ator de pr de mux me eg me erk Ġi line Ġn tot Ġn cg Ġc ta Ġa di Ġp spec Ġp ane Ġs iz Ġs pacer Ġs addle Ġs helve Ġd tr Ġd sp Ġd pc Ġ' ", Ġe vec Ġre dis Ġre tries Ġb mw Ġb idirectional Ġ# ! Ġw min un reg un ified un ched is Default li fies ce f 00 33 Ġas n di verse Ġto w ĠT weets th ose ation ary Ġdef erred Ġr BC Ġ2 17 (' =', Ġ""" ). pt op Ġg la Ġg one ĠS QUARED Ġco d put ation con tra con crete col linearity ĠI ID am d ĠP atr ĠA X '] ", im size ĠR ain Ġval ores Ġme ds ĠD V ĠD uda 01 49 01 176 Ġv data Ġv args Ġv sini ff s ff le form ulas bo finger str idx str uments ĠL T ĠL ux ĠL GPL df unc Ġpro vision ĠM es Ġl ms Ġl naPortfolios ** (( 10 541 Ġlabel bin Ġnum Points ĠG NB ore hole ---------------- --------- orm odel ber ger ber tw Ġwe alth ĠRe cur ĠRe ader ĠE v Ġ4 24 Ġ4 23 ag nostic Ġcomp rise 64 25 ĠW edge Ġmax n Ġmax Value Ġfe et init s Ġdefault real sub period ep at Ġplot tool Re viewer Data Access ther lands Ġmin pad Ġdo lfin gra ding =[ ])) Ġoutput FileName ################################ #### ################################ ###### ĠU R fa de dd oc Ġsub sequence Ġcolor list no i no dist io ps Ġ6 12 new X ĠSe ab ĠK im ĠK em 75 58 "] == ak as 19 62 St rength uff t ĠV oltage by indx be ef be tainc sp b sp list ])) ], the m ',' < Ġfa de OR ED 24 86 freq List Test X back prop Ġsp alde ec ut 07 059 exp num work class ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ length scale Pro v Pro log Ġnon sense graph it save plot ID C IC ML config urables Ġgroup key ones hot verse ly File Reader Ġtrans mute 37 647 Ġlength scale cm x mpl x Ġtra ffic ĠCheck Failed fill value select l EN CY net es mult ilevel Ġdraw DC ++ + Ġ} ; \\ ] gg io 08 00 To G Ġab seps ĠComp any ĠComp arisons real RadTS poly div ils lopes TR L TR IG TR ACE ĠUn able cos a En sembl CT YPE sen ding ED O Per fect fin et fin ally apply InPandas ele metry Ġrank ings Ġobserv ing cache Table su z pac ings Ġman n miss ivity Ġnan os :, } Ġlocal ize corr with dec lared high res Input Spec ]+ ) Ġgot ten Ġconst ellation ĠArray Dataset Ġaut odetect nr ml ĠLabel ShuffleSplit ĠClass ify Bu yer Ġ". ". 72 36 Ġyy yy Ġannot ators ĠCh ristmas NE E NE LED way points tot obs Sub plots mis ses 00000000 000001 micro RNA 2016 1124 Th omas bb ing Dataset Validation ĠSparse Panel CR C Sy ntaxError hidden layer ĠNo Data Ġanaly ser Ġmesh Height Doc Link Categorical Plotter ĠDis patch 2007 01 Event Filter feed in Ġ"' { tw ice Ġfft length PRO POS Ġdesign ated Item Is Ġ"-- ", Float Col Ġ"- ": 99999999 999 shrink ages Parameter ized ĠCSR Dataset Font Dict 117647 0588 WAR RAN ĠCont roll Method Exception Ġ---------------- ---------- ĠColor Model TA I ä½ İ arc py ĠSphinx DocLink Ġå ľ Ġgap Max cli ps dash Seq Ġml learn Ġgl connect CHE M ĠOver lap WHIT E Ġinvert ing Ġep w Menu Item Vis it Ġrea uth Ġjoint ly wav write Ġ------------------------------------------------ ------------ spike trains čĊčĊ čĊčĊĠĠĠ glyph d ĠSO UR Ac quisition 987 689 ĠFin ite ################################################################################ ############### ('# ') kd ale BB D Display Role Ġ################ ############# eeg lab hive conf Ġaccumul ates mys qrt libsvm tools 995 47 ĠAcc umulate Ob serv Command s FIELD NAMES ĠExcel Cell Ġsemi logx 188 24 Ġbook keeping decomp osed Ġ'| ', 4444 43 destination Table Ma de Ġtight ly itz ky 387 7 Second Order Arrow Style LassoLars CV Ġmaj loc Discrete NB History Manager material ized Incre ase Opt ical åĨ Ļ Ġnw is čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ phone mes Ġê ² 094 12 Fraction al 1904 76 ĠWi ener ĠNumerical Expression seng ers ĠSmooth ing dor fer Ġ#================================================================ =========== ĠFl igner ç»ĵ æĿŁ constit utive recommen ded Mic hel ĠNi elsen Ġanti codon Estimates Loader stk util Ġflo py BIT MAP ECOMMERCED AT Ġmorph ing foc used ntwk A implement ations Ġdiam ond Ġticklabel Boxes depart ments chamber lain |||||||||||||||| |||||||||||||||| Inspect or rien transform Ġinflu enced æ° Ķ loud ness ĠGD AL ĠCHAN GE PEN ALTY Ġsib lings siz ex ä¾Ľ åºĶ MSK Data Bre wer ĠWers dorfer Qub it Fish ers åģľæŃ¢ åįķ applic able ĠUnimplemented MethodException ABCDEFGHIJKLM NOPQRST SHI FT Aler t phistic ated ytos cape Ġafore mentioned Ġflera Features meerk at Ġdefaultreal limits PROPOS AL ĠSphinxDocLink Resolver / | 1 0000000 4 061 5 42 6 00000 9 1373 > '+ A AG B ilater C CT C nst D w D line E ve F H F DF F rancis G LE H Base L AD M CC M ahalanobis N or N HI O UN R FI S train T uples Y ahoo Z t \ )" b od b ds b alltree b auer c rat c Func d th e acute e ustache f cat f scale f ellow g name g iving h anksgiving j ake k path l rs m dt n cl p ce s ive s bin s anity t ft t orsion v ix v rt w rest y h y mod y eo z abs ² æŃ¢ ¸ æĺĵ Î Ķ Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠ Ġ ])), in bound in novativeness at ar Ġt on er ode st da le lic me ls me stic Ġi mple Ġi range Ġn H Ġn nt Ġn chans Ġp rism Ġs mp Ġs map Ġs List ra che en a Ġin File Ġin mate Ġin silico la ment Ġe ot co oldown Ġw dir Ġw edges ig a ig nee ss il ', [' def t def erred Ġif unc Ġ[ %( val ssrc di rac Ġis rgb ĠT soum qu akes ch inu Ġdef er Ġ2 300 ') "), (' ?') Ġg j get Output ab orting label Texts ax observer Ġx lines Ġx Min Ġnot ing ist ers Ġh ollow ath on py frp ĠI PCA ĠI GN ĠI MT ĠP ipe pp ink ĠA ux Ġcon gru '] () '] ") ĠC arn ĠC entroids os ub to ggles Ġtest Float Ġwith index ĠF abisch ĠR I ĠR og Ġ3 64 Ġ3 07 Ġ3 40 line contour ĠD ESTIN 01 33 01 203 ne qv Ġcol linearity ns ppol time unit Ġv z ta pas out going Ġal ist ĠN lev per pixel per HaloMass bo u ĠL Group ĠL IST ĠM is ĠM irror Ġl ds Ġl dt Ġl svr red cap size y ir ion ĠG ather ĠG BM Ġout group Ġstr anded ĠE ustache Ġ4 17 low ers Ġun c Ġun safe Ġ5 14 Ġby weekday log z axis artist In fra che ll Ġint ent ĠW all Ġmax d Ġmax z Ġexpected rows 12 941 Ġget ters ĠO W inter iors Ġch rome 32 12 32 7824 Ġz t text File ĠIn fs Ġsh arp Ġj vm Ġj dbc fa par Ġcl u Ġsub t predict ing IN EL code cogs Ġrow num ĠK stestResult -------------------------------- + 19 02 ĠV o title d nd vi sp dict Co coa Co olProp 94 16 uple x 17 24 17 28901 OR TS ]]) ] Ġdis agree Ġ7 14 main Plot 06 798 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ap f Pro per Ex plained af abisch ĠQ W update Plot Ġtemp or Me ier 65 098 File Names stack plot org io State Model Ġextra p ĠZ Z ĠZ o Ġshow legend 23 00 Base Ridge Ġsm k ĠWe iss )* (- List Widget List Store ĠĠĠĠĠĠĠĠĠ ĊĠĠĠ To Contents fs a ev olve gb dt sim u tz offset user id Ġrel ates Ġfont file query Execution Comp ound Label ShuffleSplit Ġlib missing Ġsha ft Ġalong side 000 99547 Per mutation Ġvert no Ġreal path 647 2 initial izers dif ication ĠMe asures 69 84743 **************** ******** chunk er home s ĠCal ib Ġlong blob inc id Ġcsv widget Ġhandle textpad tool z Max imized CO CO cha pter Ġpredicted Field light ly vers ation Dist ortion Ġpdf Repr =[" _ br u Bin ned Ġflag ged mut ually del var common s ru ed wd th æį ¢ ĠRes pective vl c Ġcha os Num s circ led Ġ19 88 super period Ġpost process menu Action ĠJo e Option Error 714 27 Ġes press rule set yy y ĠParameter Names ĠSto ch ĠVari ants LL C bd holt Lars CV rea ches bra ck 105 84743 Interactive Session ĠAny thing Ġcurr x chrom atic 110 3 Argument DefaultsHelpFormatter 133 7 Ġì ĭ rms prop Ġintro duction Auto matically Ġquant ize Exp ansion Ġdp ss erc ator AGG CTG war fs att itude čĊčĊ čĊ ĠPe ople ĠBoolean Array 968 254 Tick ers Ġqt console fg han limin ary 038 23144 simp s Calcul ated 922 3372036854775 Ġsal inity Cent re ĠAL IGN omic ron čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ è´ ¸æĺĵ ĠExtension Dtype snap py éĹ´ éļĶ .]] )), Install ation Ġfla kes ç§ Ĵ Ġrestart ed lef ts Light curve contract ed ĠBokeh JS ĠLow pass 213 01203 preads heets æľĢ åIJİ GW AS Star ts aggreg ator Station Code LOSS ES ĠSI ZE ĠRMS prop ĠDIS PLAY die mert 310 9306 ĠSquared Loss æĭ ī Coverage Test ĠMonth End Ġmathemat ically Ġrespons ibility æĸ¹ å¼ı mir na Ġrol lout èĤ¡ç¥¨ 代çłģ (',' ): chess run Working Time ĠMor ris ĠVi etnam Accept ed Ġfcluster data Ġflo ored PuBu Gn 616 11719 èµĦ 产 Att ention 932 71427 bgrcmykbgrcmyk bgrcmykbgrcmyk éĺ ²æŃ¢ Ġnavig ate 743 10541 5813 900 ĠUnsupervised Mixin Ġlexico graphically ĠDie mert è°ĥ æķ´ pairsDev Test pairsDev Train ĠEVAL U Ġrapid ly 1746 03 ĠìĤ¬ ìļ© 1046 9096 Publ isher Ġmav util GMA O Ġado pted ĠREP ORT ĠìŀĪ ëĭ¤ NetworkX Error Shuff led 4126 98 Ġlomb scargle 87600 388 BarH Collection 26386 883 ljung box ĠSeab old ĠKem al Bilater ia ĠTsoum akas 327824 48 1728901 4 % '] ) =\ ) $' * '): 0 201 0 455 2 00000 4 86 5 82 B order B bb B oot B PSK C limate F co F irmicutes H V H EX J er M Z N OC Q M S SC S napshot S pread T EN T odo V ARS W id ] '): a ex a pex c able c xx e ickenberg f ich f block g ut i comp i op i Spec m cl m ars n strat n lte n Rp p any p urity q name s idx t F t ely v bar v nd w right w resid  ¶  ¸ à ª č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ qui Ġ Ċĉĉĉĉĉĉ Ġ ãģĪãģĪãģĪãģĪãģĪãģĪ Ġ ãģĤãģĤãģĤãģĤãģĤ in clusion in otopy st opt st iff st aging de gs me te Ġn axis Ġn nbrs Ġc ue Ġc cal Ġc ep Ġc var Ġc asing Ġp rc Ġp fb Ġs rv mp ertz en riched ct q ro bj ro red ro sen Ġd Func Ġ' >= pe ech Ġm ids Ġm illi Ġe os Ġre map Ġre semble Ġre fitting Ġre ceptive "" . Ġb ax Ġw asher Ġ1 48 ata kis def n um a Ġ" ? Ġ" ...") urn ament Ġy list Ġy List ad ig Ġr RNA Ġreturn indiv Ġ2 94 Ġst atuses om ers om ero (' *. (' ==> Ġg ls get N get header ab ic ĠS d ĠS cho Ġx cell Ġx pad Ġh nb ĠP T ĠP t ĠP SS ĠA Bu ĠA mazon Ġcon ference ĠC i ĠC ELL ĠC ramer Ġ` $ to ydata Ġtest passed Ġax A Ġfi b Ġ3 41 Ġme and ĠD r ĠD iss ĠD OT Ġlo ov 01 65 Ġcol inear cal y path To pro cedure Ġk ol ĠN CE ĠN EV ment ed mo lecular mo difier class room ĠM IXED ps is ps dict Ġne lements Ġl Px app ush red ucible we re we red we bcam ir len ir ds ho pe ĠG ab ĠG IS ĠRe cursive Ġfile patterns Ġdf Vas ĠB IR op hase Ġdi com Ġen counters 99 00 Ġtime Range Ġmax fev ĠO bj ĠO sc ĠO tsu sub st sub offsets Ġhe alpy Re v Re comb unt ing raw text Ġch ron read ers Ġmin es pi per Ġper imeter Ġsc p Ġdo pa Ġsh utter Ġnew rec Ġj ars Ġj ornada Ġj umeg ĠH EL ĠH older 15 294 Ġinter leaved Ġoutput Dir ################################ ############ Ġno Of pr att 20 88 fa vor Ġsub graphs ie ee default Value io v Ġ6 15 IN CLUDE ĠSe quences ĠSe bastian 45 00 ĠK evin use Locale grid Fz "] [:, 19 24 group stats ))) ): cur ly check result check MovingOLS Index Ops ĠV base ĠV BMGxt 22 86 22 4606 nd min 04 34 the text 02 64 02 94 Ġmo e ',' / Ġsy ns OR DS Con sumer 24 68 27 052 86 26 SE ARCH gen bauer back port 18 64 exp nt Ġnode heap Ġnormal izes LE C Ġ, " af sson 92 36 Ġload ers son s Ġmod ulator Ġac cs Ġac company cm ks Ġtuple set Ġweight val top convdf OD A last p ome x Ġfilter norm Ġfilter rad net Lasso Base GradientBoosting Ġvector izers ĠSt ork IP Completer MP S mm utable To First To CSV ev m SD I poly technique Set Attribute inf lated Ġfont exts query set Comp ares Ġtree view ĠPro be 29 804 čĊč Ċĉĉĉ spark tk Ġmon ic Ġmon te UR ON Ġts libs IO Wrapper Fe H Text Invc Ġerr oneous power law month S cd n Ġcompat ib Ġdiag flat ĠCal able PL I ĠBase SGD Ġds x Ġ"% " Ġpack aging 686 27 Ġentry steps peak ind Graph ic hes izer Ġsw ab )** . ); " DO F ĠCh rome meth s Multi Polygon Ġra c Sub halo FA M ================================================================ ============= ================================================================ ======= ================================================================ ====== Ġli me Ġsrc DC Ġmp lot indic ies asc ading lb p ==' @ ==' ': CON DITIONS ĠAxes Image ĠImage Draw ITY PE Tra cer ĠTh rough Create Variable cr pix body X body Y Ġappend able ---+ -----+ Mon itored Ġ-------------------------------- --------------- geom space got item uber netes regular izers Def lection Ġ---------------- ----------- 105 88 Interactive TB pcolor fast Ġå ¹ Ġå į Ġserial izing MIN MAX SO FTWARE Save Load cape x some times amin ing Open stack GR AD pan x sn v sn ks design vars 917 2515 END UM ĠSum s Order Type visual isation ĠOpen GL Ġaffect ing Ġce iling Ġant ialias ĠPRO FILE 132 33 slider hspace slider wspace ĠRE ML water mark well ing DIST NAME DIST INCT Ġguarante es Art icle Ġscreen shot Ġhex agonal å¼Ģ ä»ĵ Mark s plant ider atz adz atz adtz isot ope Ġpng file yi elds ĠBlock Placement ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠ ĠCa pacity bow tie 266 6 Ġ+---+ ----+ 645 8625 pw a SPE CT mant el Inv TextInvc Ġstretch val kf SeriesName simp lified storm s 153 6652 ĠCDF LIB Stop Iteration eco g Ġbook s Cho ices ĠMLE Model attach ments Ġ',' ') ĠBox Plot ĠNeighbors Heap earth quake Ġ'{: +. Ġray leigh ĠTimeSeries RDD Ġpw m EA ST Te ams }^{ \ assume s Ġenet cv åĩº åı£ çº ¦ Ġmanip ulated ambig uity ĠUP DATE OH N ĠCorrect ed ADD ENDUM ĠPri mary DAT ABASE Ġring ing eager Eval ------------------+ ------------------+ Ġhemis pheres Smooth ing PROCESS ING ĠQuant itative Ġdynam ical Ġdil ution ('| ') Ġcompens ation iden cy county ST Ġsty ling '\\ ) nas a senger Id vac uation Ġcoer ces ĠâĢ ľ blur red Ġroundtrip ped maxplot bin Streaming DataFeeder Nucle i TX T 712 1536652 Ġabbrevi ations TERN AL #---------------- ---- groundtruth s DockWidget Area Ġconsolid ate commod ate åŁº æľ¬ OME TRY boe Data SARIMAX CoverageTest ĠSent iment KeyValue Long KeyValue Short gammainc inv came l cgi Distance transl ations Ġmant issa purcha ses ĠLM stat 1264 145 Ġcolum nplan itzer Cal ĠMockEstimator With repet ition ĠCOM MENT ĠGate way Ġreact ants éĻIJ ä»· Wui Main Ġlsf h Ġhtm research ĠSUP PORT ĠOx ford ĠMG XS awkward lib aren a Ġprono unced ObjectBinary Fast åĶ ® Accumul ator ĠOrient ed trif inder ĠDav ies 8660 254 urthe st ĠSOUR CE Ġcongru ence 6458625 79 7121536652 1264145 " +"\ ) ^{- 2 7843 4 98 5 29 6 23 7 69 8 29 8 253 8 2353 9 09090909 : +. A Q B IND C MP D z E mp G rouped G rab H p H OT K O K utta L V M art M irror N CEP P id R ing R SS R ULES S pyder T WO U np Y A \ ,\ a parc b els b oro c de c raw c umul c ands d plots d Params e to f X f arm h ur i counts j query k ir k pts n osis p ite p hen q rst r RNA s ash t lu u men u MEG u kdale v at v art v tx v dp x dim | ') Ñ ĩ í ĺ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ dex Ġ ard Ġ )). Ġ 使çĶ¨ in z se ian on um Ġt err st dio al as de gen me z Ġn argsort Ġn chan Ġn binom Ġf requen Ġp et Ġs cons ct ile ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ es cript ro j ro ps Ġin stru Ġo ce Ġd Y Ġd j Ġ' ']) Ġm inter Ġm ie Ġm spines Ġe j Ġb one Ġb link Ġ# -------------------------------- Ġw sub un bound um ol id ian () # Ġto bj ter ry ĠT ER ĠT CP ĠT aking ĠT ikhonov th al Ġy ax Ġy pad set ops ') # (' ([ Ġ""" # Ġg lacier ction aries up loader get text get mtime get openfile ab init ax A ax Scatter for sale ĠS lic ĠS parsity Ġx A Ġx idx ĠX mean from dta am ong plot arr ĠP rop '] ' ĠC Python to fu to uched ĠF FM ĠR on ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ np i Ġ3 70 Ġ3 81 line sep ") ') 01 64 01 35 ns l Ġv enue ind igo ption s ĠN q str anded max ed max Len te lescope ĠM illi ĠM OCK Ġmat ure Ġne at Ġl ns app as app name 10 60 Ġnum Objects ĠG dk Ġout axis Ġma hal ĠRe fine Ġtr icks Ġtr uck Ġfile p ĠE B ĠE QU ĠB ook ill ar (( (( In cr che mpots Ġcomp l 64 09 und red Ġmax X cs f num f model chems ide l add Parameter ()) - ep r ep itopes Ġver ifier map To Re ferendums 25 65 25 882 ormal ize text wrap ĠY l Ġj b ĠH DU ĠH WP Ġ[' \ start From Ġ(' + Ġ(' { 33 74 Ġcolor Map Ġ6 60 base Dir Ġrow time Ġspec ie ok s use MathText Ġ| ". ml d ml perf av lan iss i show Colorbar dist urbed bar rier 35 12 14 05 19 77 with Stroke tick text check boxes 13 83 Ġbin op sp end 04 03 Ġcom o run feld Ġdis abling AN NOT AL ES back space Ġorder ID 36 82 ]), ( exp ensive ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġlin reg dent ial lp k Ġq e my dir Ġgroup ers non dim cm ip 87 73 ura s ĠZ one limit ing any thing TI VE Base Forest Base SearchCV Ġsim ulating Ġar rive draw DC AB D Ġ12 15 ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ 08 24 first name fra k vis itor ãģ Ĺ Ċĉĉĉ ĠĠ lik en 29 16 Res on Ġps file 68 96 Ġtmp h _{ % Ġext ens +' -'+ UN ION ML B Ġclose Event Text WithDash Le aves pad j Pre processor Ġref lections ilt ic Check Calls Format s Ġbar h ged ge HO O imp os imp ala Table Model Loc ally Ġaccuracy All Ġ$ [ fr ica agg lomerative lex icon Ġproject Id Color Converter 83 45 ble ach Ġent re Key Sequence Ġsu f NE G Ġra ds Ġmp qt 00000000 01 micro s micro soft Ġinvalid ated sec id dy lib cap ing Sy ntax Ġord mdf lc list Ġneg LL approx Quantile ĠOut liers ij un VER BOSE Ġmesh Width ny u ĠTh row predicted Field DS paces Ġtruth s hy ps aco ust Mon day Ġ199 4 ĠCan ada tw a ĠEn ables exc itatory ĠAd aboost Ġ-------------------------------- ---- note Book Ġ---------------------------------------------------------------- ---------- OS Error platform s Predict ive wind er Axis Info Ġsent IX ('_ ',' horizontal Header regular ize typ ical Stat istical lam mps ppf vec bre cht look back markers cale Ġbuf fered sal inity incip les sat urday sn rs ĠMath Jax mol l ç» Ń Ġgl mm 700 4 Order Id Pol it orph an æĺ İ Ġgeom s rh u ĠLoc allyLinearEmbedding Ġsho ck čĊčĊ čĊčĊč Ġtimeout Secs Red raw timer ange 987 65 Channel Mixin ĠDon ut vin h Ġtx ns Ġachie ves Ġachie vable Command Line Div ider Ġbi om Ġsemi logy ĠReal Features ĠLay ers ĠVisual izing 236 06798 è´ ¢ Ġdu pe fact s ĠRel ation ĠBatch Norm ĠForm ulae íķ ´ æĿ ¿ )+" _"+ ĠAndre w ĠMeasure ments ĠCenter s ĠUnit Dbl ĠND VI ĠTool box tie mpo Ġaff ygene prom in MiniBatch DictionaryLearning Minute Bar 7777 78 Week OfMonth Ġelliptic ity CONT ACT Ġmotif s ĠMed ium Small Gradient ĠMOD FLOW Separ ation triang leright Ġensemb l ĠGood ness ĠSpace Debug BACK ENDS Ġ · rub in ĠMULTI LABELS Ġparcel s ĠOrd inal Sup p DateCol WithT Ġ655 35 ĠDAT ABASE ĠAnaly ze ĠDask DataFeeder Ġwi res Major ity Streaming Query CAS CADE éĢļ è¿ĩ particip ants quadr upole SYMB OLS ü r Pal estinian mach ines ĠObjective SmallGradient Ġellips oid 693 147 usal em ĠAW G ĠCubic Spline Card inality BigQuery BaseCursor lds core Ġlz ma substitution s ĠDest ination ĠSPL IT Ġsubstit uted ĠPythonOnly Point ê³ ł Ur ls abl ished vare psilon Ġlis a ĠBla ze å®Į æĪIJ 147483 647 ĠGRA PH Ġprobab ilties Ġspat ially 1715 7288 ĠWINDO W Lid stone ìĸ ´ ifactor ial emplo yees arra ss REGI STRY tearDown Class DRange Series istra ils getParameter Value Sca ffold DateColWithT z " ( " `: ' & * ? , {} / (( 4 860 7 0196 8 9020 : '): A o A PT B utter B rowse C NM E ig E con F ri F requencies K t K aggle M IXED M exican N side P ot Q Cursor R ous S lab S IT S lit T our T ru U ML V max Y min _ ([ a Rs d un d art d logM e click f weights g max g input h qic k le k ov l led l vm n par o ften o pacities q hull s form t Range u ints x L x def y arg y plot y diff  ± ĉ Ġ ĠĠĠ ĊĠĠĠĠĊĠĠĠ in Handler re member ar params an cing Ġi codes Ġn cs Ġn sf Ġn free Ġn largest Ġc is Ġc print Ġc redit Ġf abs Ġf Name Ġf udge Ġa plpy Ġp ly Ġp str Ġp max en orm es io Ġin frame Ġin let Ġd ds Ġd cm Ġd mu Ġd gamma Ġ' --- Ġm man Ġm td co sy Ġre corder ): ") Ġb atter Ġ# ********************************************** Ġw size ur ple ig ate Ġ( [( un eq is decimal is Visible )) ') Ġ" >" ma k ĠT m ĠT an qu anta th ost set even set OutputCol Ġ: \ Ġr squared Ġr grids Ġ2 84 ]) (? om ask om bus ime d int ended pt une Ġg name Ġg of ex clusion Ġex hib ĠS av ĠS keleton ri ad Ġdata List =' " =' ` Ġx title Ġx Max ĠX gc from keys ul at con vol col linear Ġh id Ġh dbscan py dot ĠP lasma ĠP lane pp lt ĠA mos Ġcon cave ĠC le ĠC airo im namelist to Float ent ire Ġde cs (" =" (" ... (" !! ĠF UN Ġ3 80 Ġ3 3333 test func Ġme ang ĠD rag ĠD raggable 01 16 ne ut ns amp time ofday Ġse quana out size pro posals Ġal together ĠN REL ĠL even mo ize max freq max Num df m Ġpro po Ġl num app engine we iss 10 63 Ġpar king Ġnum Columns oc curs sc rib Ġtr uly =" ^ =" .", date Time ĠB ur Ġ5 15 ill ation ]. ") log Error log start Ġle ague Ġcomp la Ġtime course ant isymmetric Ġmax Val add Row 12 14 ĠO cc Ġbo ltzmann Ġmodel Path ca usality value error Ġplot kwargs Re clvl Data Price 25 000 Ġch at 11 64 11 45 Ġinput line text coords Ġsc re Ġdo cker Ġtrain data ĠH SV ĠH ost Ġinter ro Ġpy wt ĠU krain ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ 33 82 Ġsub station no composite 80 97 80 90 ger ows ĠData Source Ġrow fmt au ger au xiliary ĠK atakis av conv dist mat ak ag ense n ges dd '. \ table data 04 01 03 11 the ir trans Projection ',' '] ĠCo verage 85 0000 DataFrame StatFunctions Ġexp Param 27 06 yle y 36 265 reg on ĠJ ean return ing math default db conn ]], [[ RE LAX top Lines stem med Ġoff spring Ġob lique nn mf EN COD SI R Ġev opy 26 275 ink ov Ġsim res ĠSt ix ĠSt uff ob ac day S ĠAl an ][' _ Ne b Ġpair ings uch sia To cher Ġab init wh ms Set Min Set Cell ĠPro fit 21 12 Ġge orge Ġchange point Per mission DI SP su lf hi re Ġret ina LO UD linalg Real Ġnext Page Linear DiscriminantAnalysis ĠMulti output debug Handler PE P Ġdisplay hook Ġrot ates Ġdirect tools Ġtheta grids Ġident ities 74 118 fold ing ĊĊĊ ĊĊĠĠĠĠĠĠĠ fr on Is Instance Ġsig a 255 8 ,)) ], Bin Edges subset eq nu is .* ") clean ing An imal By i By Range ĠPy KEP Ġra xis conn dict Sub traction ĠPo ssibly ĠPo esio Ġpys b CD T Ġclean Out DIR S ven io nx t Th us Ġprop ensity direct ly ann ular sur bri ĠMult ip æľ ª segment data Ġfree zer Ad hore ALL Y ĠTrans late between ness wind size Ġkm ers bic lustering ĠMo lecular Font Property ("- ") ĠVari ous Ġminor ity free zer gal data Ġbig ram ĠFree Surfer -> ', ALI B ĠPass word Ġå ¼ TF Record }" '. Oper ationalError Over write Sc rolled UD P Unit One ĠFloat Field Ġdele gation ĠExtract ing ################################################ ####### ĠOpen PNM ograph ical âĢ ľ dark ening rh d Ġindent ed Ġ------------------------------------------------ ------- Ġ------------------------------------------------ ----------- mann whitneyu Ġeq s ĠAffine Base ĠCluster Spec ĠTRAIN ING ĊĊĠĠĠĠ Ċ ("{ :. PC M Ġ################ # Ġdend rite Ġfac ilities sci limits Fin ish Ġdark ening Ġln like ĠCL IP maj fmt FOR WARD Probability Estimator Exit ing Ġmaxim izer Database Error å¸ ¸ ĠåĮħåIJ« åį spectra blue ĠParse Fatal GO OD Ġ################################ ### Ġ################################ ###### ĠArt stein ony m #%% #%% Setting WithCopyError bro aden elt s /{} _ 380 952 çº § organ ize ĠTool bar ĠScalar Mappable Dropout Layer ĠSeq Record æľĢ å°ı Bayesian Ridge Ġconstit ute ĠÃ Ĺ lead ers ä¼ ł Ġ################################################ ########## ĠLi beration MULTI LINE ĠSign ed Ġguide d Ġmacro data wild cards ĠDIS ABLE Ġwall s Variance Threshold ç¬ Ķ ('\\ ', tv tp uncer tainties ĠLIN K YYYY MMDD ĠDet ector Eigen value paras ites tiff file ĠInteractiveShell App Ġassess ment Ġiscomplex obj ĠBand pass PIX ELS Does n dft Anal #**************************************************************** ******** Ġamo pt fili ated Ġsav ings ĠHi ptmair repartition ByRange ĠGR ID ĠRM SD bcknd arr pump s ('@ ')[ Eng lish Ġbib author Ġoscill ation ĠStation Code Ġreson ator Tax a gammain cc finger prints loid y Demonstr ates sele p obst acles ĠGer many invent or sac cade ])+' -'+ Ġmill ion ĠBusiness Hour ÃĬ Ãĩ ĠCau se ĠCau chy powerCurve Levels obb led ĠTemporal Event Subclassed Series ĠBroken Estimator £ ¬ ĠMars land ĠMONTH S nct dtr ä¹ĭ åīį Ġadsorb ate Ġvac uum ĠRavel led Accum Min ĠVla dimir ĠBatched Serializer APPRO X Unary Op COS INE teoro logical 201201 01 journ als ĠBurn Man OrderedDictNumpy FeedFn ĠCam era Ġthreed hst AGGREG ATE gad get åĽ½åĨħ çĶŁäº§æĢ»åĢ¼ ĠMOV ETO Partitioned Variables ĠMockEstimatorWith Parameter seteven thook SetMin Size linalgReal Type ĠParseFatal Exception ! '. " ^\ $ = ' = ' .. , = - *. 4 30 5 60 8 6667 > '] @ { B mp B atches D Q E z F lex G AP H SD I o I ID J M L n L TR L ARGE P c P ore P las P RES Q Abstract S che T NAME T INYINT U y U ntil V dim W FA W ire W gfa Z O Z ij [ ...], \ )' a fig a value b bs c string d range d ang d hi e as e pa e gypt f loc h bo h tf j ds k haki l key m ted m cast n Vars o Series o boe p index p mid s mear s noRNA t se t arge t colors u ite w heat x port à į å ¥ ë Ł se o se as re form on pick Ġt label Ġt df Ġt apers st iffness al er me et Ġn ex Ġn ff Ġn dens Ġn mats Ġc lt Ġc ab Ġf print Ġf ls Ġf Port Ġa q lf t lf loor Ġp key it ys Ġs ugar mp f ra f en f en sion en ko es ley lo ps Ġin di Ġo uput Ġd ruid Ġm di Ġm dict Ġre form Ġre versal Ġb mp Ġb ang Ġb gr Ġb inds Ġw shape Ġw kb Ġ( ". Ġ0 53 li q Ġ[ `` 00 59 Ġas um Ġnp os ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠT ony th or th st ha h ha mp Ġy offsets ch iller ve g fi m Ġ2 32 Ġ2 81 ver sa Ġst ain Ġst abili ]) ', ]) ') nt aps Ġg all __ / ĊĊ ĊĊĠ get float ab line Ġdata Dir Ġx j Ġx start type str con sol py dt ĠP UB ĠP ourbaix ĠA tt ĠA TT fe ar Ġu float Ġcon cs pre serves ĠC Y ĠC RO to PlainText to playout Ġtest Disable (" :", ĠF loquet ĠF OLLOWING ĠR K ĠR ose ĠR ough Ġval ide Ġax hspan Ġ3 25 Ġ3 75 Ġ3 22 test dir Ġme mb Ġres haping ĠD t 01 09 ff ai path ways min o min z Ġk ilo ĠN T Ġon Offset index List max imin ################ ############## te lev ĠM W ĠM art ĠM ond ĠM KL ps in po ols Ġl pl assert Finite ĠG AT ĠG ABA Ġ/ \ gre n gre atest Ċĉ ĠĠĠĠĠ ĠRe factor comp liment sc iss =" ./ Ġ4 99 Ġ4 44 ag n ĠB AR Ġun determined `` `` In stead In Dir 64 314 ĠW u ĠW y ĠW GS Ġmax f Ġmax ed Ġexpected Z ĠO lay Ġbo lo ()) )] ca ded ca dence ca yley Ġplot name dir ic Ġpo is Re ject Re vers Re servoirs Data Required Ġch ndtr read h unc an color ado Ġtrain y ĠH arry ĠH DBSCAN Ġlog ser Ġfig mgr Ġpy x ################################ ######### Ġla xis 33 48 201 00101 output Folder 45 29 88 28 **** *** nan o 14 12 count ing Class ifiers Ġ8 11 Ġ8 22 ĠV A gs pread 04 37 04 000 96 863 03 05 ])) ** trans mittance ĠNot Found Ġmo ogli Ġover flows 85 882 27 48 Ġdis couraged Ġ7 12 freq trade abs x abs urd 09 24 norm X mod uli LE V Pro bit oly mp 97 25 97 44 cv x Se ptember Ġq res Ġq grid Ġ9 04 Ġread ers Ġim mediate non string gr ind Ġtrans mit mt md mt cars ls x RE VISION CA xis mode lfunc select list struct des multi Step Ġunder line 77 06 77 045 {} } Ġmatch in stat tools ift ify Ġlines Df mag ma real izations sim Time Ġsave args tz local json s json file Ġraw Out patch A tmp Nucleus pair plot Ġpytest file keep ers fft buffer ĠGener ally Ġimg Data Ġsha des Ġcho p Ġcho oser Ġts u MA V SC IPY 46 95 Ġjust ified IL T pad s Ġold x SA MP Inter actions 48 98 hat i ĠAdd CC String Coord Ġmy dict Ġ'/ '. Ġdown ward Ch icago Fa iling Ġexec dir Ġincre f hs b folder path IM F Fit FailedWarning Int ro complex Type Ġderiv ation Row Coder cha mp Ġcla w ]+ ', ]- ( RA ME ĠDi vergence ĠAs semble handle length .... ... Normal isation phi max ĠPy OS mis mo wd lattice Ġopt ima sec ID ĠApp roach ica id ('/ '): ĠImage Grid DB lock ny der ĠTh irion vm Df iff tshift begin Stream Trans cript flux data flux DB Ġgr ps lement ary mot es ĠStruct ured half logistic Ġå ¯ install EventFilter Patch Collection 219 61 Struct ural ĠReg arding sho ck ĠText Reader Fixed Offset Ġwarr ant Param Log rh os Ġ------------------------------------------------ -------- members hips flu o 0909 0906 Ġxml String Interpol ated âĶ Ĥ Geo Spatial rx ns lh ses Ġste ms chk a calcul ates Ġins ight è¯ ¢ Fore ign pot ato Ġpip ca =[- . Validation Result ĠHas Props Classification LossFunction ĠCross Entropy Ob lique ĠMain ly 145 10 Ġaggreg ator lut man Ġë į blank s CLASSI FY WOR KS ĠMeta Est ĠParse Exception ĠLocal ity async io bat ched photo dict GU AGE ĠPoints InPolygon 215 69 Phot on ĠPR ICE sco tts ĠFix me Description HelpFormatter Ġtrunc ating Bernoulli RBM 197 0000000 æŃ ¥ ĠMIN PACK Sym metric Sym metrical Squared EpsilonInsensitive ALIGN MENT Ġhatch ing Ġlex er 5555 56 ĠLim iting 8888 88 Bits Per Ġconflict ing 7777 77 ĠÐ ¸ Ġcaps ys ĠSimp ly abcdef g ĠStructure Graph ]{ % Ġ'; ' å· ® volt meter trig gers SUR F Ġblacklist ed ĠKDE Multivariate Progress Bar ĠFr ance trust ed Ġmang led subscribe Stk nS ines ĠtestTrain SaveLoad ĠNeuro mag conflict ing ĠTemporary Directory LEVEL S Ġbasket cache è½ ½ ĠVi ctor oauth s poss ibility çİ° éĩij Probe set ,:,:, :] memo ize bsp line gat k Ġtor que ĠEs sentially Ġneuro Compt categor ize recogn ize è¿ĩ ç¨ĭ Early Stopping æŁ¥ 询 ĠVene er ĠtestLoss WithWeights Neigh bour Ġlexico graphic uther ford ĠEstimatorWithFitAnd Predict Ġstoich io dockWidget Contents ĠPhy lo anomal ies Ġarn oldi GTAG AGGA americ a kre is ĠDup re ACTIV ITY GGAC TCCT NEAR EST Ġ+---+----------+ ----+ ĠBeng io Mood Vas 5576 0419 Ġ../../../ _ abcdefghijklmnop qrst labelUnit Dist jake vdp COCO MO éĻIJä»· åįķ nsl itlets 36265 956 ĠfPort Dev ĠtestDisable CenteredBias ĠMond rian ĠOlay a Revers Correlation 77045 373 ĠAddCC Flag " '%( # + # \ 4 1176 7 21 8 38 8 1569 A y B al B ug B BU B OS C MS E OG F robenius G ames H ar H its H WP I x J AR K rylov K NOWN L HB M ST M DAnalysis N EXT O Z O c O pts P f R panel S k S id S chool U x X V b ath b ang c q d wl e is f ml f lier f handle h pc i err j rdd k itch l db m gz n V n chunk r one r lm s if s ankey t new t urtle v ise x mean y start } < ç ¾ re num re tt on aut Ġt un al ice al umel an nu Ġi gs he uristics Ġn ce Ġn dd Ġf iscal Ġp ent Ġp fac Ġp anning Ġs lo Ġs par Ġs lat Ġs plat Ġs lave es ome Ġm ns Ġm vt Ġe str Ġre pos Ġre pair Ġre define ge ar ): ], Ġb data Ġb size Ġb ash ic ify Ġw len un wrapped is co li mo )) ` Ġif o 00 80 00 34 Ġas d () > Ġis ort Ġy Max ch ime ad der fi res fi cos set Color Ġr cs Ġand roid Ġ+ --------+ __ (): ab se ri co ri bo =' *') Ġx fin end x end ra from arrays col ate ĠI PP ĠA SA ĠA rab Ġcon vis '] ]] ĠC sv ĠC EN ĠC IF to pt Ġtest Invalid (" *. (" ...") ĠF ra Ġax l Ġax vspan np s Ġ3 47 ĠD ries 01 15 .. ] ne cessarily Ġse ch Ġv ide Ġel s ta ches ind o out Fit out lets pro ts pro pto min a min span Ġk aggle ĠN args bo gus fit er dict list ################ ############### te u Ġl ith Ġl pi Ġl itter 10 37 10 98 ĠG MT Ġ< {{ us c row counter ---------------- ------------ ---------------- --------------- ber ry ĠRe ceptiveField Ġpre order cl n Ġfile e Ġfile menu ĠE fficiency =" $\ =" (... ĠB Q ĠB on ĠB QL Ġun common Ġun tie Ġun calibrated Ġthis Component log ically key err In novativeness Ġen codes 0000 3 pec ified num Parts 12 80 12 76 ca ches sub classes Ġall close Ġall kinds unt itled sion s ree mbedded 11 80 32 157 Ġmin Val Ġmin fract ĠPar a ng f cy clo ĠIn dia ĠY min Ġpa de Ġj m Ġj sparkSession ĠH OUR 15 05 print ed Ġ[' / ################################ ########## pes as new x AT IO ĠK astner ok ay Ġ| [ show error 14 14 sq ltype )] ))) Ġ8 192 '. ', ĠV ery wo uld trans lator trib ution 02 98 Ġover ly of light object ids rt Stops Ġexp nt freq plot ref line mark str obj id 06 27 Ex clude ST ORM Ġnd x 34 943 ĠJ er ĠJ ARS save Button Time List Ġtext box face ted Ġtemp path math tt 30 75 ous and Series Table Ġtra p Ġzip it Ġsing les riter ium Ġbu ckling De partment ĠDe le sup seteq event release Ġsm d Ġcoef fi Ġzero es effic ent draw type font P \\ " MP A 67 059 08 45 gener acy first Words open filename 47 47 Ġhigh lights Ġtick vals Ġ'. -', NA M lem mat cos d ĠAn isotropic Ġblock ed align ing UR BS _{ * rol lout ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ 46 27 action Save Ġlower cut IL I ({ ** nc file bit position nb a Ġbox out Ġwx path stream er Ġmy data Ġmy list parent dir Ġser rors display ed dec iles aut ow Ġnb rows IM READ ĠIN SERT Ġpartial s Ġjson ify Ġcat alyst ä¸ ¤ Ġselected Filter NN D ); ") marker style ([]) ] aa Index Normal Cdf ĠMax imization TER MIN Ġdd m Ġdd y Ġrect ilinear .* " .* )', Multi label Multi processing Com m }{ : ================================================================ ========= PER M Ġmp h CL USTERS tex str tex grp Cal ibrated sequence Length itor ies ker ns Output Checker CR F Ġvisual izes Feature Column ij bels mock er Act List menu Check car bon Ġlb da alias ing Bar code 714 286 Process Exec ,:] / topo json parallel ism Ġeas iest OC ITY Ġnor b NO x rl vl Projection ToHashMixin ĠEX PERIMENTS smooth ers tod ays ĠSim PEG longitude s East er ĠColor H Meta Dataset ĠPerform ing Ġscan ning Rest art ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ ono ho å¤ ª ado be IPython QtConsoleApp activ estate ĠMon ographs 984 1 Ġfrozen bitposition Optimizer By +( ? Ge V ĠMy Perceptron Price UnitOne Ġmn cond ĠWh it ĠWh iten Tri angles Ġpers onal PA ML ĠFin ance Ġ################ ########### Ġ################ ############## Import ing ĠAct iv isot one ham mer 4545 455 Off Helper LST MCell Fin nish RR uleLocator Queue Helper gm ms Ġquestion naire Cha pter numer ics Ġë ° HS G ĠåĮħåIJ« ä¸ŃåĽ½ Token ize ĠRES O Peak FileName spe ck /_ /_ ĠTransformed Path reflect ance æĶ ¹ follow s nod ummy Ġelastic search Ċĉĉĉĉĉĉĉĉ ĉĉ ĠClean Command Theta TS 99999999999999 95 ĠAlt itude Ġther modynamic Has Props Ġqual ified HTML Parser Ġmechan ics jump s ĠParam Sklearn assertVariable Equal Win Probability ADD ING DBase Series Ġque ued Ġcro ps ĠSign ature west field ĠLST MLayer ĠDesign Matrix Ġweak ly Unicode Index Ġdra stically tid y Nr Nx 854 90 Ġcircum stances recip es ³³ ³³³ åIJĮ æŶ ĠLarge st coup on Ġbayes db Ġads orption ĠOpt imum ĠDot Exception ĠQU ANT Ġtid y Ġfeatur ized Nt NrNx ĠRetrie ves ĠElect ro ĠEstimatorWith outFit ĠSET UP gridOn Minor ĠTimer Base ĠGR U Ġ(+ /- ĠKet Base Ġbib liography å¹³ åĿĩ 086 27 PassiveAggressive Classifier ĠWilli am ĠDifferential Operator ĠMathText Warning fld mean Ga ze META STORE ĠRegex p è´§å¸ģ ä¾ĽåºĶ ĠSpan Selector ĠExpectation Suite mvs dist Ide al fab ric Tabular MSA MESS AGES ĠtestCustom OptimizerBy Ġthro ttle Ġfoc used Ġmle fit Ġcust m ĠtestTrainWith PartitionedVariables QTable WidgetItem NOR B ĠEstimatorWithFitAnd Score steep ness ="-> ", ĠMovie Writer hus l dma debug Ġweigh ing Ġrele ps CudaConvnet Conv Ker ns cuss ive getfile systemencoding ĠCel ery 4285 71 ĠåĽ ŀ Mf Mu Rsp Request compens ation Ġlad der Ġstro ked éļı æľº Ġisotopolog ue smoot hest eccentric ity ĠWit ten åĪ¤ æĸŃ ĠBak oma ĠCele ux ĠSki pper Ġene my ĠEmbedded SphinxShell Ġade qu ĠRus sell Ġmob ile Ġcloset o WARRAN TIES hanksgiving Day osub locus æĭī åĬ¨ ĠFFM peg issi ppi gedge color ĠDries sen ProcessExec QueueHelper # /* + )", 5 23 5 98 7 8039 7 2727 9 0980 9 0909 9 868 @ \ A DF B RO B ench B onds C to C abin D ing G ar I ters I maging J unction K urtosis L CV M OCK N points O pp P CC P ADDING S hock T ips W hole Z n \ - ` ') ` ", ` \\ b ikes b tdtr c ation c limits c arry d pr f ran h uc h dbscan h ankel k ink k illed k nee l ion l svc m line m uted n tri n channels n lc o val o series o pex p uff q min q max s me s ra s weet t bi t ushare u ids w gs z split } ').  ·  ¹ æ ¦Ĥ è ī č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in month se which at in re map Ġt pc st ink an on de activate Ġi mat Ġi zh Ġn order Ġc pt Ġc amp Ġf T Ġa men Ġp lasticity Ġs oc Ġs old Ġs avg mp hases ion eer ct p Ġin sp Ġd matrix Ġd ice Ġd Params la ser ut ime Ġ' ! Ġ' }') Ġm B Ġe th Ġe value Ġe missions Ġw scale un selected un binned is alnum def ile ol dest li zab ce a ot to Ġif ile 00 20 00 86 00 37 00 28 di Area Ġis lice ts d one class ĠT or ĠT RA ĠT apas qu andl ult imate Ġy off fi ssion set ime Ġ2 78 mat ter mat hemat ') #, ]) +" (' (? nt able ex tern get T get Self ĠS on ĠS li ĠS ay ĠS xx Ġco add Ġco herent all sec Ġx L Ġor f Ġor bits Ġh iding ure au ĠA G fe males od ay pre cursor im cache Ġtest er Ġtest With Ġde serialized ĠF ermi ĠF ernando ([ {" ub mission Ġ3 28 line color ĠD U ĠD b ĠD LL ĠD rive ") } ") ]: 01 07 ance led file chooser out data min ing Ġk line Ġk endalltau Ġk ludge Ġal ine ĠN at ĠN ifti ĠN elle per formed ĠL IC mo cap max im max evals ĠM p ĠM ut Ġl arch Ġl step ĠG FF Ġout l ore gressive row id row ave Ċĉ ĊĠĠĠ pl ice comp et Ġtr s Ġfile dict Ġfile dialog ĠE U ms v ĠB iases ĠB LSTM ĠB roker sh lex Ġun rolled Ġun usual Ġ5 13 log X axis Drop Ġsk ills da vid ile ges Ġcomp artments Ġtime deltas Ġint el Ġint list model Params 12 157 ĠO WNER men ubutton bs lash ca i sub d Ġplot Kerns Frame works map file Data X Data Loader 25 55 Ġline color 11 17 que uer 15 12 Ġlog addexp ################################ # pr j Ċĉĉ ĠĠĠĠĠĠĠ fa int output dir Ġ6 14 Ġ6 50 new Row ES E ER F IN ET ste tson ĠData Adapter ok u "] [: sample Rate Ġcur Node 14 27 Ġkey list cur v ON D copy ing 13 85 ĠV p Ġpath ological gs p 04 38 04 314 03 15 Co uple ou ard ou raud Ġdataset Id Ġsamples perpixel :: : ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġfeature wise Con crete ref seq 06 36 ten ure do ses delta D reg ulated Ġdoc id Ġlin expr park ing Ġ... \ Ġgrid y 92 32 sent ial bu oy bu ckling ĠQ STK tol er vide nces ris h non sense non trna Me morialDay db dat mt ica ĠCon centration EN TIAL 23 8095 du ctor hist Price can ny De cor AC CUR ld r ld os auto paral mult in pdf latex \\ , 08 274 mm m Ġtitle font extra polator drop Duplicates year S Ġimp lying depth map duct ance EL LOW ĊĠĠ Ċ čĊč ĊĠĠĠĠ Ġclo cs Ġps igma Per manence SC REEN DI V 46 78 ĠCreate Workspace Ġcell ular UL D AD M pad len let ies nc varname ĠMe moize 56 1 56 25 IS ubmission ĠAdd ison ĠAN ALYSIS ()[ _ ilt o this dir 69 80 69 049 Ġbox car Get Array Get Layer Ġdown wards ain wright Ġtheir s )+ ": CE F ]+ ') ]+ )', 54 118 Min imal ĠAs sess Ġag m Ġ25 000 76 1905 win ch Grid Line fl or Ġleaf let post p Bin Op em ma CC CG At tempt Multi plic scan level Ġdot plot double quote Sub type DA Q oper ons oper ands CL A aw g AM ES Ġrespect ing sec Type short able Ġstream er Feature Vector Ġ19 87 IR S FO C Tra cks Ġinstall s Core Application Ġbit count Ġeffic iencies FILE NAMES bi u ĠDataset CV TO A ĠFeature Set seu w Ġpercentile ofscore ĠTarget ed Ġflatten ing zoom x east er 109 80 Ġå ° And erson Ġsen kouSpan commen d ]( ../../../ sn peff card inal ç» § ĠST K Ġbel ieve Ġep hemer demo graphics Ġillust rated CI E Ġexplo rer Ġexplo iting ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ vc feval Ġzoom s Dev Offset ĠAb orting ĠFI SCAL )[: ( High er High LevelClass mouse over Ġexponent iated è§ £ Ġrestrict ive Ġ################ ############ -----+ -----+ detect ors CUR SOR hl sp VALID ATION ĠDep endent 904 762 represent ative ĠChange d Ġë § (", ")[ Ġupd ater ĠTe V tal ib ĠBbox Base Ġcr ucial Temporary Directory Ġiv w Ġarch ives Ver ify INST ANCES åħ¥ åºĵ Ada ptive Ċĉĉĉĉĉĉĉĉ ĉĉĉĉĉ Ġau cs Ġlex sorted Cloud Manager Mis c ĠHistory Container pez oidal Ġoccup ants phy lo Ang ular Ġmor let kurt osistest ĠScal es occup ations åįķ ä½į }; { å½ ¢ ĠVir ginia jar que ĠINTER VAL BACK END ĠUN IX å¦Ĥ æŀľ ('( ')[ fcluster data Ġul r streams x pit uitary Ġdoub ling preproc Def izz ly Ġdil ated ĠEXCH SCAL Ġborrow ed Ġelectric ity ĠEigen value Ġ".. ", MIS SION NY SE CHANNEL S çĶŁ æĪIJ ĠGre gorian Ġearth quake æłĩ åĩĨ ISH ED Quant ized gtf s éĿ ŀ neighbour hood ĠRR uleLocator ĠSY N Ġmic ron Ġaggr Syns ĠMur murhash Ġ"=" * bary center Tim ing squ ash ĠOrigin ally recommend ation Ġdeli vered RAP PER Ġlift ing ĠRay leigh pcwg Error ./=\./=\./=\./=\ ./=\./=\./=\./=\ ĠPythonOnly UDT ampli fier Ġfro mpyfunc 0476 19 ĠHEAD ER ĠPrun e protot xt Explain er Hir Arr ISD H ĠFV COM uder a MOMENT UM ILLUMIN A çĬ¶ æĢģ Cocoa Agg ĠBIR CH ĠSpaceDebug Color Butter worth cosy lation Ġamopt d lizab eth # | # ********************************************** $ % ) ()) ) +'_'+ * '), + =" 2 323 5 8039 5 45454545 7 2941 8 333 8 18181818 : @ C IR C ilvl D SD D uty F ermi F rench G un G rain G row J PM J Java J osef K appa M z M nt M kt N steps P nt P icker Q CDPT R EST R uss S leep S cripts T ran V b W aves W ainwright X te [ [- _ ']) b orn b blg c ran d file d pc e res e af f err f fillable g profiler i en i path i lable j u n jit o la p stack q star r fi r value r func s out s au s contains s ufficient s ugg v seq v ulnerability x var x tx y mean ç ® Ġ ĉĉĉĉ in cs in flow in itions in coherence in consistencies re cognition ĊĠĠĠĠĠĠĠĠ ĉ al d -- , de al de cades Ġi base Ġn am Ġn lte Ġc math Ġf rench Ġp udl Ġs label Ġs file Ġs str Ġs sm Ġs geom Ġs ocial es se Ġin axes Ġd mp Ġd topo Ġd ummys la mic ut coffset Ġ' )', Ġm il Ġm log Ġe pid co pes co phor Ġre fe Ġre vers Ġre stacked ): ') Ġb dist Ġw ake lt d Ġ( [- ', ]) un emp un connected el mt ol ine li hood di late Ġto ps Ġ" [' ma ped ĠT agged th ieu ha ven Ġy Data Ġy gz Ġy bz fi delity Ġr dict Ġr fs Ġr pg Ġ2 87 Ġ2 98 Ġ2 756 Ġst itch ]) ]: (' --- Ġg lif Ġg inga ex pec data model get opt get Node ĠS x ĠS il ĠS am ĠS ites ĠS ilverman ri m Ġdata max Ġdata search Ġx B ĠX gz ĠX bz ĠX GBoost con tr ist ration Ġh all am opt ĠP AGE ĠA sy pre senter Ġ` %% Ġde lims Ġde compressed Ġde activate (" (? (" +", ĠF und ĠF iber ĠR L equal ized Ġval or Ġval box Ġax ies line type 01 57 ne wargs Ġel net out fig ĠN el ĠN ations ĠN ODE ĠN ominal art is import tools bo hman mo og max Iter pa wn Ġpro ximal Ġ{ ** [: . ps l Ġan o Ġl rng Ġl cd red is Ġuse vlines fig Name ir un Ġlen as Ġout filename us sels pl Tabl ĠRe current ĠRe moved Ġpre tt cl d Ġdf a ": ' ĠB arn ĠB IT ĠB EM Ġun tested state Changed log append log ratio `` % `` ') Ġen ums che mo che bi 0000 2 ĠW as init ies men us Ġnumpy doc sub shape sub command sub corpora Ġall X Data Profiling Ġso phisticated Ġline set 11 373 Ġ\ / ĠIn finite Ġper r bin aries bin centers Ġ) * Ġnew path Ġj mx Ġoutput dir ĠU l 20 30 Ġsub c Ġsub seq no velty Ġ6 13 ger t new xlim base lines ĠData Loader 45 88 AT AC Ġind ice Ġsup remum ĠK ok "] ==" Ġup wards show legend Ġapp dir bar thann 35 24 14 95 group mean tt v Ġ8 23 Ġ8 260 mask Const gs r clf p 03 99 metric Params trans cription 02 47 95 2381 17 44 Ġsy l na c 86 91 back s back ed back testing Ġmean excess 06 03 06 3492 Ġorder ings 18 35 err oneous call set do ugh dis cont 34 13 Ġnames DF Ġloc pot Ġsort idx Ġsort order Ġcode obj Ġmask Utils Ġread File db n Ġac compl ĠCon tract mpl dict RE TS Ġsome time ĠZ star fill style ordin ates EN O du ctions De lt `, ) ey r ai a TI V Ġpl c Base SGD Base CrossValidator Str ong ugh Tocher ++ ' ################################################################ ####### Ġdec imation Ġfunc list ,) ]) ins ics first s Ġimp oses ĠTime Delta Ġfont dir NA P EL C cast s find Contours 39 84 Ġge ter Ġparam ter DI AG rol ite head width ĠNe wer Ġcell padding 31 75 Ġobserv ance sm c Text Adjustment Le e Le ading Ġauto strip Dict s nc files Log arithm 48 17 Ġvis cm Ġrec ipe desc s "," % Not Convert Ġform al Ġdon ations String Mixin Ġmy getopenfile Ġimages ize inc ub PL AT ĠBase View HO I dec am CO SM Ġderiv ing cp x Ġcombin er aris ation On ur Ġsw c ci procal tk g Ġintegr ators !! @ ĠArray Subclass Is PythonScalar 2745 1 gray level Bin ning Ġpp desc }{ :> >` _, del ph Ġfun ct Ġdat elike 53 9683 Ġsrc file cb ax Random ly ru it 73 0159 aw ait ĠDo e ĠMat t tp val Ġmid pt sym links Output Stream SR M ann y air lines ierarch ies page up cg c duplic ation Ġinf late Ġir len ĠHe ter Ġchi ef condition ing Ġ17 97 CG AGGCTG Sparse DataFrame Ġperm uting Item C Ġgr r "> ', bc dt profile d ĠMo ore mne monic soft plus Cell Renderer ĠBe havior speed oflight Var List Ġsynt hesize ĠDB G Ġfc n ĠLinearSVC NoScore Ġarrow size bra ckets cover ing Ġeig vecs 2009 0415 Ġ? ? Ġmove ments Ġplan ck xe b urb ansim Struct ures fid ucials zz z Arr Temp Ġ196 7 Ġlag range access ibility Spectral Cube Ab delat Ab hati CF G READ ONLY DESCR LONG _`` ). Dep endent Ġmb kmeans tre ant git modules rh ses ĠPRO CESS ':[ ]} ĠRE C jet stream 253 968 Ġminim izer updates on Ġol ddoc rg arch wcs axes Tick Formatter sci enced è¯ » čĊĠĠ čĊĠĠĠ IMP EV dri ven Ġrights ide 286 27 ĠZero OrMore Ġquarter ly front ier Ġspl int proto buf ĠSource Spaces difi ers rece ivers 203 92 house holds nk pt è´ · æī ĭ ĠWave let Ġcr ude spe lling Word List 267 107 ç§ » 297 444 After Perturb ĠFA O nod ule Beta Geo 095 238 Ġquot ation 163 86 lig o Enter ing Ġfault s åĨ µ transf ers Ġment ions *\ ( ,: ]), Ġorgan izations Sort ing Ġ}} >`__ eb v media wiki ĠSimp son Ġlang s 476 190 Ġfb pca 5714 29 Ġspe lled TG CA Ġtilt ed Ġdisc ards chip Interpolator Ġparticip ation Ġwalk ers rn aseq Storage Level sty led ('_') [- Ġ µ +) ? ĠLib svm Rout ines ema ils Ġisol ation ################################################################################################ #### Ġsparsify ing Ion Str ĠQU ERY fre chet Ġdead wood mitt ivity SIG INT ĠAUTH OR beha ved ĠWeek dayLocator GM RES Sens itive ĠRM t ĠDateTime Form µ m lined ash Ġcoup led Ġoscill ations ĠHa usdorff makeString Series Ġ'~ ' Ġencaps ulate ÃŃ mismo isol ines Ġ+-----+ ----+-----+ COUN TER eder ico ĠPixel s ĠSched ule 634 921 Ġendian ness Ġher mitian 9696 96 ffit i retrie ved Stim ulus Ġthro at ĠSep al prov ince Clip board Ġtransl ations ĠAu ger ĠAns wer çŁ Ń #~#~#~#~ #~#~#~#~ Ġobvious ly æ² ¡ /\/\/\/\/\/\/\/\ /\/\/\/\/\/\/\/\ Ġ~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~ ä¸Ĭå¸Ĥ åħ¬åı¸ Ġtetra hedrons ĠSCR IPT propag ator ĠInstit ut Fil ms ĠChemical Environments 4586 297444 é¦ ĸ ANTI ALIAS Pas sengerId uvw xyz éĶĻ 误 9206 35 ĠYo ungs oskedastic ity ouis iana 5238 10 ĠAAA I ĠControll Bar fghan istan Jer usalem caly cophor 8253 97 telev ision autow rap NND SVD ĠExpectationSuite ValidationResult 69049 11 JJava Error Ġrpg it amopt d DataProfiling Mixin Abdelat if scienced irect 4586297444 267107 calycophor an " `, $ ^{ + , , + 3 00000 5 30 5 873 7 100 7 78 8 90 9 323 : {} : .* ; ". = + A i B ritish C rash C ERT D ASH H MC N om N World P ReLU R ules S in S cf S lack S orry T ail X D Z ED \ ). \ ": a ft d la d dict d log e ca f riction h ru i cov i Att j pl k G k ta k ids k ish l mp l uc m fs n F n conv n ées p format s ab s dev t my x line x object x mm x Interpolators y def y dim à µ à Ĥ ç Ļ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ########### in struct se lap Ġt it Ġt mean st ery ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠ al locs de biasing Ġi row Ġi start Ġi calc Ġn df Ġn lc Ġc ite Ġc rashed Ġf ov Ġf mid Ġf Ret Ġf iona Ġf ür Ġp addle ra ken ro ts ro uter Ġin flow Ġo live Ġd G Ġm I Ġm illisecond co op Ġre vised Ġre starting Ġb od Ġb ise Ġb row Ġb ikes Ġ# { ic hen ic ircum Ġw get un specified un calibrated is lower is methods is posinf li ma ort icity Ġas df () ! ), )), ==== ") ĠT U ĠT AX ĠT WO ĠT INY qu idity tr un th d Ġy lo Ġy mid Ġy margin iz Rate Ġr hat Ġ2 66 (' __', Ġ""" : Ġg un Ġg gg get Model label er ĠS pread ĠS parsify Ġx or arg o py unit pp hi ĠA mp ĠA ustralia ĠC AC ĠC aching im mutable Ġde convolution ĠF ID ĠR LE Ġ3 43 ĠD TI ĠD trace 01 54 ne es ne ur cal ex time path time stream Ġse verity file Ops min X Ġk linear ĠN ARR import ing mo o pa pi ĠThe oretical ĠM air ps file Ġl ss red ucer assert Contains ĠG osh ĠG reek pl ug ĠRe ce ĠRe pository cl ang Ġset table Ġun cert Ġ5 80 log base random ization Ġtime scales ĠW FK og enous Ġget argspec ĠO SM ca fe Ġplot it Frame Fixed Ġall Y ach uset raw Data frame logprob 11 94 11 65 32 37 cy gwin Ġ10 88 ĠY OU Ġinter im Ġpy audio ĠU Q ĠU ndo dd y 100 01 output database ger r ard t ĠData Block tain ing ell ing 75 94 88 58 grid Fx vent ions Ġro b ak k 14 01 box props own arrow Ġstring ified radi ative Ġother Series prob it Ġstart value 02 75 Ġcom modity mon drian space craft 27 90 Ġsp c Ġmean line Ġorder id exp v ST L rc N 34 97 97 144 Ġpart ner ĠJ MLR Time step 84 16 84 314 oo led config file Ġsign ing Ġtf learn 37 08 RE N legend Patch gy m gy r Ġob rientransform scri p Ġ(" + Ġfilter name 26 06 RO Is over sample over fitting search button 90 84 42 96 font file ob a vs ini foo BAD Ġsee g make UnicodeIndex 43 75 rec list To Record extra ctors Un weighted real ign inv wishart EL OW Ġunit cell cast able jor n )]) ] fin ancials 31 45 ." }, Text File cho icify Pre ference this Fig dx r tuple ize Ġ'- .' sw orth Ġkeep dim Py Py Py SparkTestCase Ġmultiple tests Ġhandle length IM S Ġstri pping pick ler Ġgen omic complex ities Ġangle A Ġview ers 79 01 On set perm ut Min utes (** _ parame tr 199 109 ĠGrid Error 72 15 br on ĠCh allenge nu mentries ĊĊĉ ĠĠĠ Group Norms Ġra ke Sub scription Ġshort cuts Ġli q COL LECTION Ġho od Ġmp fe Ġmp lfig CL IENT ĠDE AP ven n ĠTimestamp s }} " reduce ByKey 999 09 Ġ24 1 include graphics HT TPS ĠNo isy page down Ġinsert ions Ġtool dir car b sphinx doc Ġradi ative ba ffle custom ize pat ent çļĦ 主é¢ĺ ination Results Ġgr ating ĠDef inite Mult iply ĠTable Column [~ ( ĠFa ctory Mask Kernel Level List Ġcounter part autos calex under layer ĠSample d Ġincreasing ly Ġserial izers frozen note slow inc Over l xe a fd tr Ġfr inge render ing Ref lect mong odb icon file Ġva ex Ġnat ively devi ations Ġmicro array Ġmicro phone stim s FIL ER dark grid Lat Lon Dev ices singular ics tb x Ġsho gun BO UNDS ae za ONE Y è¿ ĺ Ro ss magnitude s raster io ("[ ", Ġland ing Ġpres cripts gu illemot uk ary bon us turb ine ĠUSE D Inv estment Ġpot rs Align ed Memory Error Ġ================================= =========== SF G fro g Notebook Notary Ġspl u WOR KER ("# "): ĠModified Huber 188 28 æī ¾ Post gres Const raints produc er ĠForm s ĠEV T Mapping KernelManager Lon Lat ĠDirichlet BC Ġmaintain ing ENS G Ġcycl ing Ġfm ri Ġsb ml ĠÐ ¿ ĠPri mitive Ġê ¸° Ġslab s ĠFace t ĠAppend able ĠNeural Net abstract property ĠVER Y nh ru uncor rect ä½į ç½® Ġdifficult y athe red Modified Huber Ġmes sed Ġao Series Ġrol loff ('~ ') isc rowd Ġgrain s pheno code Ġsucceed s Ġtweak ing dvi ps calibr ators asion ally benef icio PassiveAggressive Regressor tow ards Ġmen ubar Ant i Ġunary MatrixFunction Ġconform ing mantid project Sci Py Ġdefic its ĠDIR AC ìł ľ Ho les Ġmit osis CONF ID ĠWorker Interrupt ĠaxHist x PSA nalysis yout ube Later al Cli Hook Soil Model FORE IGN ĠSaved Model ĠBas ically ĠKa plan ĠPas sthrough ìŀ IJ Ġclon ing 3213 03 seper ately ',** {' Mess ages lou in æ£Ģ æŁ¥ Ġnip ype pathe ffects autog rad ĠJim my Ġspeak ing Iss ue Ġabstra ction Historical Data ĠMaint ain æĦ ı Ġhexa decimal Ġåľ ¨ thost name ĠCRO PPED stetson j achuset ts $ : , .. , :: , {}, . ]}, 1 109 2 1176 4 861 5 2549 5 1373 6 38 6 3529 7 27272727 8 3922 ; & = > = ... A m A FR B EM C X C mp C NEUPD D ists D Model D NEUPD D SEUPD E K E g E nsures E EXIST E vacuation F ID H or K AN K means L ap L ev M IP M KK O vR P ending Q Frame Q ModelIndex S ans T orch V ery V oxels W i X OM X Shards Z oned \ [(\ a er a je c ensoring d ps e te h ollow i GridStep j out k ick l gamma m true n co n len n step n Days p int p dists t ub v k v scroll w it x Min y j y fit z u z eppelin à Į à Ĵ æ ļ ë ı Ġ ãģĪãģĪãģĪãģĪ se verity Ġt rib Ġt var er mo st b al bum ar de an ced de rest Ġn ue Ġn ino Ġc plot Ġc cs Ġc nts Ġf on Ġf er Ġf score Ġf tp Ġf trl Ġf alcon Ġp di Ġp od Ġs idx Ġs unk Ġs plash ro bin ro gers Ġin fra Ġo val Ġd la la z Ġ' [" Ġ' )') Ġ' ')] Ġm val Ġe min Ġe cell ): ', Ġ# * Ġw elcome ur lencode and Frame un is is patched is ppol )) > Ġ[ > 00 38 id y Ġas p Ġto doc Ġto DF Ġto Internal ts vd ad itu ad agrad fi lm set Pen Ġr pos Ġst ories ') ]] pt w Ġg is Ġg sp ex ceeded data Matrix ĊĊ ĊĠĠĠĠ par gp label sep Ġex po for all ĠS ING ĠS ander ĠS NEUPD Ġimport r Ġbe e Ġbe achball Ġx star ': ] ist ries py n len ces ĠI PARAM ĠI rene plot tools ĠP ast ĠP CR ĠA OD Ġcon clusion od dy pre name '] +' ĠC NEUPD ĠC USTOM Ġ_ [ to u Ġtest shape Ġde ta ĠF addeeva ĠR S ([ ]))) np roc Ġ3 86 Ġ3 44 Ġ3 38 test Y test name test shape ĠD X ĠD ark ĠD NI ĠD RAW ĠD SAUPD Ġv as Ġv ref ta po out ine min interval Ġk J Ġk ite Ġk ick Ġk mean Ġk grid ĠN k ĠN rxn ds y ment o ĠL GMRES ĠM OOSE po is Ġl ign Ġl ighter app dir we c Ġfrom Internal 10 59 Ġlen ics ial lelic Ġnum new pl anned ĠE S ĠE missionlines =" | Ġ4 03 Ġ4 60 ĠB d ĠB ivariateSpline Ġun finished (( _ In ch In Memory Ġlist Of Ġle ader 99 35 Ġcomp anies 64 86 ĠTrue type ., ' Ġfe a 12 36 Ġget L Ġget All men ters Ġplot Results Ġall segs Data Reader 25 0000 inter leave Ġch allen Ġ.. ........................ 11 30 11 55 Ġest ablished Ġclf a color brewer Ġper ception 15 47 =[ [- start Entry ĠU lt 20 78 20 60 20 784 dd key Ġsub st no x no vel output FileName Ġ6 01 Ġ6 20 Ġ6 52 IN CR ĠData Y 66 275 use case Ġcur dir ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ Ġalpha max 19 55 group Box group Dialog led ger Ġ8 13 St ellar Ġbin Freq func name 04 31 trans verse ĠTest Command ĠTest RemoveDataPickle ',' ', 17 67 Ġdataset Type 85 79 Ġbase path Ġfirst ly Ġve hicle Ġexp Params 27 059 )), ( }) ^ ĉĉ Ċĉĉ do cks Ġidx r Pro te Ex oSOFT Ġadd ressed spec file 34 118 Ġ... : ĠJ it Time series Time Of Se verity sk irt ĠQ x Ġ9 02 Ġmask er ac um Ġav ail db Name Ġac cesses batch ing mpl backend RE Y RE DU RE MOVE Ġmult imeter ĠZ i ĠZ ha ĠZ NAUPD =[' --', (* , Ġshow fliers Ġpoly line EN CES 23 922 SI II img type Ġback s view Area over complete Base SVC Ġ[- ] mult ialignment pd key means hift create From Ġdec r Di el gg m MP C Ġobj c DE T 08 05 To All To Use To Keep open mp real vec Ġca dence json l ier mess Ġfont set Ġfont map 49 223 ĠUn iv ĠUn certainty Ġpred ispatched 28 26 Plot Item Plot Dt CH V 68 24 ken nen Ġbins x ress ources DI RECTION vector izing Ġcell Text td m convert To su fix arm B sm ar sm ile Le ad Ġlower limit Ġvis cosity IS K md traj Sh annon pipe lines report ing Format ting mic irc ret ention IG T ĠDate Range Ġdiff lib Loc us high level )+ ', OP part )( \ EX PECTED ĠArray Like setup s used PySparkTestCase Ġ25 3 Ġ". * prop ri Ġ'-- '], Ġwave On Ġword cloud Ġmedian props Ġred undancy Group ing Ġcontour ing Ġmp fit ---------------------------------------------------------------------------- --- CD ay ĠSelect Features ven ues Batch One mar ine region key ĠInter pol SK Y Ġmis ses mk tz Of Pr Ġ'{ ', Ġ'< ... Ġport able super set ĠAR M As sets DB Z Ġsl ant ortho logy ĠConvert ing feed forward BC local Ġms z trip color fetch many ĠCan cer PRO PER ĠAd j ĠLine Scan Hand lers Ġrece ivers Ġcp meas Ġsimp lifies Features Col Cor ner Ġph antom ĠMo od ĠSQL Test specific ally Ġnor mpdf ĠVari ances Ġmut ating ĠIter Op Ġwin ch bot s Ġti pper Ġcap style dB W nz xx nz yy OB Sc Ġstatistic ally met allicity Ġgra der document ed document class unpack bits bre xp sid day look ing Ġrad vel ĠGroup ShuffleSplit Ġlight curves svg writer cli matology Argument Exception ĠOver view ĠML R XY C Freq List Auto Encoder Spark Conf ~~~~~~~~~~~~~~~~ ~~~~ Ġ'{} / ĠEd it quant ize Non UniformImage prot ect Tr uncate ICA O ĠPL T Ġdiction nary gh mm Exec uting ĠPart itions Br NO Ġunion Length Op Error Integr ator Ġcum haz aaaa aa uck er Alt Mouse ĠGe orge Ġ'$ ' xf b lazy property ĠOP EN Percentile s ãĤ ¤ Memory DC )| ( Ġspl der 为 äºĨ bla de Ġretain s Ġsubsequent ly astro ML Ġsvg writer Sig mas éĢ Ł material ize Likelihood ModelResults ĠNull Locator RUN TIME COMM ANDS cook s Ġellip km ARD Regression Document ation tie breaking Ġfault y Ġtal ks æľĢ æĸ° ĠDec lare Ġwav file Ġexplain er isect ing cancel led ĠFace book UV W Ġexcel lent åħ¬ åijĬ ĠTer min ĠMicro Manager ĠVe ga æĮĩæķ° æķ°æį® Ġ################################################################ ################################################ Ġrecommend ation ç¬ ¦ rw exog Ġsubmit ting ĠRegist ry bib tex psf size Ġarcs in Information al intro spect ĠQU AD åIJĪ 约 nucle otide ĠPair s isreal obj VO IGT setMinimum Size Ġvw ap Ġ".. " LINK AGE Ham mer activepath compare DETA ILED ĠBoundary Norm ZOO MIN ĠVers ions ä»·æł¼æĮĩæķ° æķ°æį® 模 å¼ı Apr il nonpos y æİ¥ åı£ elo ver Ġ[# ]_ Ġobst acles ĠChina Data Deviation Matrix exemp lar ĠArpack NoConvergence Ġparametr ized slate gray ĠOTU s Public ations ADQ API righ th Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ĠKnown Failure Ġconsum ing Ġtheore m ĠMouse Event Brown ian Ġtoler ances Ġassemb ling defect s GetSize Tuple Lam bb nof samples Ġ'== ', ĠHammer Axes é¢Ħ æµĭ Fed eral ĠINST ANCE ĠRestart ed ĠDam ian Ġvend ors ĠALLOW ED nde numerate DLine Series Scr atch Ġloud ness æĻ¯ æ°Ķ Reviewer Dict 9223372036854775 808 rosen brock Ġkol umn piper mail 224606 35 lsx Writer ĠIterOp Inv OBSc lim % : ( _, , :- - ': / [ 4 8627 7 00000 8 7843 9 333 ? [ A UD B b C ampaign C esium C UBIC G overnment H orizon L ML L GBM M ONEY N uclide O IO P tr P assed R ich S ed S ocial T ried T BL T witter T enenhaus V ocab W ide W AL Y AML Z a _ ']. ` }, b file b ark b tc d list d typ d ssx e h e ph f mn g ues g uro g msh h lin h mac i proc k func l cv l dexp m star m illi m halo n inertia q list r uler s max s mary s nyder t X t name t type t ind t EM w q x mode x fd y array y uan z d z ig z grid z illa | < | +| è IJ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĊĉ Ġ âķ Ġ 99999 Į Ģ ĠĠĠĠ ĊĠĠĠĠ in ertial re jection re const re clvl re ceptors Ġt sub Ġt ens er Stemmer st p st urn al ist -- ") an na me trize Ġn ul Ġc ra Ġc Profile Ġf par Ġa k Ġp Y Ġp it it p Ġs U Ġs RGB Ġs RSInfo mp a Ġd ax pe xp Ġm intypecode Ġre inforcement "" ] ic it Ġw et ', ] un et un register is rc li mage Ġfor wards ot ropic um ax 00 99 val min () ]): Ġis defined Ġy lower Ġy pix ad as fi el set Contents lab ama om ix om son Ġ""" __ Ġg ns __ % ex changes data grpstr par ator up iter get pass get groupDialog Ġassert get Ġex amining ax color for c for bid ĠS TA ĠS PA ĠS ankey Ġco ils [' { ': " end At Ġh sl py file ĠI g plot ind ĠP d ĠP n ĠP SE ĠP lain ĠA li fe et fe cha ĠC x ĠC as ĠC TA ĠC ertain ĠC IE Ġ` \ Ġtest Label Ġtest Some Ġde novo (" ~/ (" ;") ĠR ates Ġval type if ty Ġ3 98 Ġ3 39 Ġme l ust ay Ġres amples ĠD ess ance stral .. ' Ġcol i ns ims time Keeper ase d file List out box Ġal b Ġal p ĠN G ĠN J ĠN AMES ĠL ore df a fit type ĠM ight ĠM ie Ġmat show Ġne ig Ġnum steps ĠG ame ĠG IT ---------------- -------------+ sc or ĠE ads ph ic Ġ4 05 date Index low res ĠB I ĠB j ĠB run ĠB GR ĠB aeza Ġun ame Ġun related Ġun ambiguous Ġ5 03 ip ital Ġby e ask om Ġdi ps ack s rid er Ġrandom izing 99 73 ant kid 64 87 cs o ord an num Points og r og ens Ġ__ / Ġver sat unt ans Ġso unds read write cc ion color by lic h ĠY pred ĠY ann Ġsh ipping Ġnew a Ġj cols true type req Id ĠH R 15 37 Ġpy pit Ġno python Ġno mad ĠU ne Ġcl ar pos A Ġsub frame Ġsub token default fmt pla ins ER VED IN J ĠData Error ĠData Generator ]] ``. 45 04 load File 35 67 14 26 19 07 with draw ))) *( pol Leak Ġsize able )] ; =( % ĠV era ĠV GG ĠV oigt nd t 03 04 Co Mo Ġover shoot 17 647 ĠCo ok Ġ{' _ Con solid Con cepts 24 60 Ġimage j SE L SE CT AN OV 18 95 ec lipse 09 64 work ed Ġqu asi Par ses ')) ]) Ġnd data stant in Ġnon central ĠJ obs 92 941 Ġmode st sk u Ġq max my list Ġ9 03 Ġgroup nobs Ġfreq str vide oname Ġim mun rel la Ġtemp l gr ant 65 72 30 86 File Folder Ġad joint 37 27 ls a ĠCon j RE TE CA PE )[ ..., ĠZ P stri ped last ik 26 00 ([' .'] Ġpl spm Base NB Base IPythonApplication mult imeter Ġar quivo _[ ( make at 43 922 ĠPer mute open mc wh ip sim ul Ġimp uting OL O Ġupdate W ĠStr ided lik lihood ĠPro per 29 37 Ġimg file CT P sen aryo hed ge Per Column ---------------------------------------------------------------- ---------- MA KE SC L ĠNe therlands ĠAt lantic cross hair Ġcons ult nc var Inter sect nb ands Ġren amer major Locs Ġdon ut Get Cell Ġchunk ing build out Line Scan mic hel ĠRun Model Ġbar cols dec lare dec lination imp roved '} }}), åı ī sche mes sens ible ĠOr dered Graph LassoCV fast text ]+ ). EX TERNAL bytes wap æķ° åĢ¼ Ġag gs reset warnings We gelin second moon false y ĠTransform Node CC AT ĠInt e Ġred cap Train able ================================================================ ======== 180 39 PS N 62 87 fp f GT AAC CL im expand vars scalar ize lb ac Node Transformer Ġprior it SS P )} . With One ĠNo Convergence page views Tra ces ĠDatetimeIndex OpsMixin 61 3307 ĊĊĊĊ ĊĊĊĊĊ ĠQu asi ĠQu andl Ġradi ance Ġinv est chor opleth Ġes caping ilhoue ttes Mon o Default Size PY SIDE čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠčĊĠĠĠ Float Hyperparameter Mo ore zy g direction al Axis ArtistHelper Ġsignific ative Gaussian Distribution free zing mot ors js bs Ġconv net met ro [:,:, : ABC Index king dom Pos iNn Ġstation arity look s Loss Relative Ġquad rat Ġscan ner deriv s cccc ccc ĠCor relations PRE CISION Ġlight est cli pon Change Hook 917 65 sr g å¤ ± Ġspa cy ĠML COMP stim uli DESCR SHORT tre ma Bbox Transform !!!! ! spike Shape Ġxml ns Imp uting WE B Ġinstrument al Ġheat maps GEN E ĠBut ler Import From isot opes Fore ground Ġconvolution s ASSI GN ĠAuto ML Ġasy m Ġ'$ \\ Ġche ap Region AdjacencyGraph INTER CEPT ĠOP TION ĠShape file Ġ================================================= ===== IF Y game ID tech s ĠBin arize ĠHigh pass Ġjo sef adapt or Distribution Col rab h Ġinteract s grib api ĠBio logy Ġreplic as 6401 93 Ġenqueue ing Ġ################################ #### EMP LOY Ġray cing ĠRadio Buttons solar position LDA Model LinearClassifier Mixin ĠExp lore Ġfrequent ist Mouse Event Rect angular anc ery Ġipy nb Ġther mostat lz w 交æĺĵ æīĢ Visual izer igraph ic (".") [- nes see ĠAssign ing ĠSUB JECTS Sq Exp pgf set pgf qpoint 对 åºĶ 717 65 Ġfir ma Setup Package Ġanalytic Config bis pec UV B Ġtie mpo Ġmiss ion ĠComple ted Checkpoint Saver ĠTok yo åħĥ ç´ł Confusion Matrix ĠChi h DOC STRING ------------------+ ---------------- Ġema ils tris urf ĠProperty Mock #------------------------------------------------ ------------- fre epat Ġimpro per QUAR TER Success fully Ġcel eri ĠLatex Manager Ġsav ename ĠBU ILD Ġenhance ments duled Evacuation '\\ )""" 主 è¦ģ éĽĨ åIJĪ Ġtrapez oid 619 048 è¾ĵ åĩº ĠGre ene ĠHoliday Calendar North PolarStereo ĠFunc Animation ĠHa ar ĠMal ik Relation ship FileWriter Cache memo ized Ġbypass ing ku antkid grain s Ġkep msg Ġsynchron ized compact ness nonpos x killmap bin Fr ance Ġmill ions Ġbes ide Ġincorpor ates ĠRob ot Ġhomog enous ("= ")[ 746 97144 ĠNET GEN Ġgw py ç¼ ĸ Flor ida =[{ - Lef trightarrow Ġintelligent ly PHY LA 8044 14 ĠSpecification Error labelt op intu ition ufact urer EUR USD Prec ise mash up 2566 8686 Installed Fonts Ġ+-------+------------------+ -----+ trit us ĠHARK interpolator ç´¢ å¼ķ DELIMIT ER ipo lo ĠReason able columb ia æĶ¶çĽ Ĭ çĦ ¶ 3877 7878 Ġespress omd Recomb Rate iov ann impos ables ĠCIF AR ĠBQL Error chemo CLim æļ Ĥ ĠJit endra setContents Margins ĠDess au Ġversat ile 613307 04 LossRelative ChangeHook " - ' -> ) ")) + =' + [' + (( - {}'. 3 8039 4 125 5 43 5 89 5 998 6 28 7 268 7 9216 9 39 : ... < \ @ % A IG B rand B LO B AND B OK B DAT C g C gp C ros C eci D ies D sp D rive E o E CG E OS F CD G AL G SN H atch H armonic I an I solationForest J s L PU M d M dot M Wh N ominal O WNER P AS Q s Q ui S size S ell S ites S uggest S pearman T PL T CGA W atersheds X n Y max Y aN Y bN Y rcN Z e Z r ] ']) ] '. ] $', a jax b ing b nm b acteria c points c mov d laplace d ssz d aterange f dd g ib g io h grad i series j m l ly l cd m sec n N n X n range n forecast o lo p dim p bm r il r grids s pack s quid t reshold t issues w ner z file | ^\  ³  ½ ì ķ í Ķ ï ½ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġ æĽ´æĸ° in path in fection se lem on ames Ġt ref Ġt vals Ġt mpl Ġt cp er to st ed st itch ĊĠĠĠĠĠĠĠĠ ĊĊ al locations ar que ar pen an cies Ġi type Ġi time Ġi pv Ġn B Ġc norm Ġc rf Ġf j Ġf reesurfer lf low lf mt it i en ums Ġin verter Ġthe o Ġd U Ġd cg Ġm lo Ġm index Ġm olar co tree Ġre x Ġre loaded Ġre fract ge oid Ġb val Ġb ode Ġb ubble ed ition ic ul ic ide Ġw andb ata g is ible is number li se )) ])), ce q Ġfor got 00 78 00 31 00 82 val from id r Ġto string ts l Ġ" '+ Ġ" *** ĠT D ĠT SP ĠT reatment tr ing ha gen """ )) Ġy B Ġy rs Ġy vec ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ fi bre set Attribute Ġr is ver ification ') [:, (' #! nt rees Ġg size Ġg dir Ġg mean data x Ġex mpl ax i for wards ĠS Z ĠS and ĠS ell ĠS cf ĠS EG ĠS moothed ĠS ullivan ri ke Ġbe ar Ġbe tainc =' --' Ġx xx Ġx unit Ġx null type of con sumed col Score Ġh an ĠI reland plot time ĠP AS ĠP ose Ġu g ĠC ent os ka to add Ġde signs ĠF onts ĠR am ĠR omberg ĠR cParams Ġval max Ġval uation np r Ġfi bre Ġ3 17 Ġ3 00000 line lengths ĠD uring ĠD ots 01 90 .. ") Ġse s Ġse ld Ġv oigt Ġv illage Er rs min utely ĠN EAR import er ĠL J ĠL am mo unts max v pa in Ġpro tection Ġan c Ġan imations ys cript we bs we cut Ġnum sides Ġ< %( Ġout let Ġout stream Ġstr A Ġma params Ċĉ ĠĠĠĠĠĠ ĠRe levant Ġtr p ĠE in ĠE SP ĠE specially Ġset point Ġ4 32 ĠB el ĠB alanced sh it Ġun clear Ġun escape cept ibility log ser key event 99 32 Ġtime scale Ġ`` / Ġat s Ġmax split add Child 12 08 ca mapi sub frame Ġ** _ Ġwh ilst Re cent frame alpha so les ren ding unc ertain Ġmin z Ġinput Vectors Ġz axis text files Ġ) ** Ġnew xlim Ġnew Cell Ġj l ĠH en ĠH ail Ġpy gment start date ĠU DT pr gm fa cing Ġ(' %. 33 63 Ġsub Id Ġsub missions 80 784 new df new Element ER ARCH ĠData File ]] ])) Ġrow masks Ġsup Nms fn match grid r grid CC ']) + 16 23 Ġcal inski Ġcal liope show Info show Help ĠEx treme bar ic sq rd ))) [:, cur fit cur DateTime 78 01 78 57 13 04 ĠV AS 22 66 22 35 03 32 03 80 03 18 03 922 column configure Ġmo ver Ġover lays 94 99 27 17 Ġ7 75 cat alyst ref raction gen ic (- \ AN ALY }) ') Ġsp ider 09 12 norm ally Ex pt med als Ġ... > Ġgrid search ĠJ y ID A part ners bu ilds Ġq z Ġq tr Ġopen cv oo o scal ef Ġsum Int non stroke UT ATION gr pc ner gies Ġac commodate File Format Ġad dendum Ġfol lower lip pe top omask Ġmult ialignment 44 20 (* [[ Ġshow medians tree width Ġuni qu De w AG B Ġpl ume Base ShuffleSplit Base Hook Base LinearRegressor mult ime ĠSt one diff x xx top bl its MP T Ġsequence Motifs ,) `` open face 47 06 total A real loc user ID Ġraw dics rank ings Ġgo als star map Ġfont desc connect ors DF D Ċĉĉĉ Ġ NA DO 9999 96 job id hand book dev N Ġcolors ys Ġge st Ġtmp Path Ġstruct s Out Name Ġsmall int Po ols Ġop us ĠMulti Comparison relation al Ġrespon d cd na md p String Converter Ġ'/ % rot ating :, . No isy ____ __ tri ed hot as Ġds List ret l folder Fn dec imation '} }) Ġnb its Mat Column Ġcat Nms Ġ$ ', Function al Ġpop sep OP ER det rended Ġfinal ized 79 24 54 00 status output ĠOR Fs Dist rict Ġintegr ity Ġtag name az ily win ners Ġpad Pixels Ġway points ĠTransform ation ND CG ND ARRAY Formatter Locator br at CC ategorical rb race Train Eval .' % flag ged AM OS Len ovo lb race [[ ]] CR UH ĠID L token ized ĠInitial ized }$ ) Doc Inherit Ġcent red Ġhalf way Ġtool manager BU Y cer tain cr ust Ġbit mask how ever CG zi ĠEstimator Class widget lock Read Only ,:] = From Dict From String From Matrices topo graphica PRO FILER 10000 01 ĠFigureCanvas GTKAgg ĠAd missible Ġcast s Mo dification ited Spec ("- ", ĠVari ation Part icip Sto kes ĠTEST ING Ag gregation STR IDE MB D tod oc SM ART Rec ording Ġinterest s dele veled Mode Renderer Ġer ode Ġer kennen 2009 0519 2018 0101 Ġfl igner Ġsec ure Ġ75 32 bm data ACT UAL genes Distance dash d dash length rev or ç» ĺ --------- | bw r lan es "} ). Ġelem wise XY CAxis Ġ'{} ', Ġquant ification dv ifont 185 7 Ġtk FileDialog forest s git lab dark blue dark grey Bbox TransformTo gauss idx ãĥ © AP IT Ġ'( ? ĠLoc ations pend ulum HI ERARCH cen ame ami li )^ ( Ro bert åİ Ł Ġpg conn Clo ses Ġsuff ers Display ing Ġrecent ly ĠSp rache Port able gm rs triangle up pot rs ĠGe V Real Valued 999999 0463 Ġviol ations Ġwater fall GH CNM xa cov ĠDatetime Converter ĠOP TIONS stata file Ġsemi definite Ġspl prep Ġtar ball ĠNE URON difi es Ġreconstruct ing ĠIntegr als Ġmed icaid ĠAfter wards Ġ{}) ". Post fix Ass ignment Pop ularity Ġgauss idx comm its Chart Wdg gi ro ĠMa cao ĠKeep ing zp ssz Frames Container Ġalle vi Ph D reflect ivity Ġstraight eners Ret ina Ġ67 16 âķIJ âķ ĠVander Plas Opt imum Ġfund amentals Band width ĠClean up NI H ENS OR ĠDay Locator Ġfm ts ĠSha re mort ality HMM FromMatrices ĠPSD s ĠMixed ModeRenderer POLY G ĠLi fe Ġlang ue aby te ("================ ====") Ġstem lines precip itation ĠCOL OUR Cons istency 66666666 7 pyqt Signal uncor r Ġperturb ations Ġeco g anit ized Clean ing ,, ,, Ġcas caded Ġarcs inh #- *- ĠMULTI OUTPUT ĠODE s Ġnk fd Under Sampler ĠHttp Error ĠRec ording BR ACKET izz le ĠBand stop Choice Box recs pan LT SA æŃ¢ æįŁ ĠNotebook App Ġregime nts Ġcame l ĠStreaming Query Ġexhaust ed wee per Ġaud itory ĠSeed ing ĠRound ing Aut ocorrelation ĠBis pectrum éĥ ½ Tax onomy ĠRadi ation Ġfu zz ĠDag Model Demonstr ation ========================================================== ') Assert Equal Byte Type convention al Los ses cry pto quoted bl ĠHeat Map ĠCM IP sle pian colo ured Ġinvestig ate ĠSHA PE PPoly Base å°± ä¸ļ ODU CT ĠNamed Style ĠPresto Exception Calib ri Ġoccure nce IntCol WithNull Ġtro uble BoolCol WithNull labelt ext æĥħ åĨµ euro pa gj rgarch COVER AGES Ġconfo unded elliptic ity invest ments ĠBIG INT cfs r Ġgammain c 6825 40 liber ately ĠOl der Ġgarch plot Ġnnds vd Ġconcer ns 7071067811 865 ĠBOO LEAN ĠIGN ORE Infra Manager Ġsubt leties arrass ingly Ao A abcdefghijklmnopqrst uvwxyz ĠWhiten ing è´§å¸ģä¾ĽåºĶ éĩı ĠNel son Ġaccompl ished AfterPerturb ation ĠSQLTest Utils BOK EH wecut dg " ? % )') ' __ ) "," ) }} - ` - \\ / "> 4 3529 5 90 5 9216 7 30 8 192 : '. > ': B il B ary B LE B ASIS B QS C m D feat E e E vidence E MOTION F ich G it G AS G uide G ini G LY K ay L N L AL M k M IL M atern M asses O Connection P file P TS P Density R Q S CADA U CS V level W ild X list X sq Y ER a pollo b ts b if b art c ens d pos d well f ue f ase f ms f da f use f cf g vectors h orn k N k as k dims l vs m ise m size m vel n ore n comp n ature n ml n Comparing p is p bs q th q wt s ie s lp s ped u lin u fa v ow v height v archar w itt x D x fa x pdf x elatex y arn z sort | ` ¢ « ¬ ----------âĶ ´ ----------âĶ Å Ľ é ¥ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ âĢĵ in definite in lets re de re names re very re calc re ographic or ne on Right Ġt q Ġt ss Ġt str Ġt params er ow st reak an z de tritus Ġi ct Ġi olib Ġn ation Ġn nn Ġn div Ġn lon Ġn bytes Ġc ri Ġc right Ġf ase Ġf used Ġp rix ra il ct er Ġo paque Ġd len Ġd list Ġd ies ut ctime pe zi Ġm as Ġm max Ġm ars Ġm sec Ġm fx Ġe at Ġre ve Ġre ferencing Ġre versing Ġb if Ġ# > and le un squeeze un hashable el lo ol ing )) -( ser um Ġfor bidden est y Ġ[ ..] Ġnp p ], [' """ % ch be ch arm ch dtr set State set diag Ġr ug Ġ2 82 Ġ2 72 Ġst er il louin ]) " ]) ]. om ni pt ps Ġg ly Ġg auge Ġg retl __ } get Array lin en ĠS lepian Ġco clustering Ġco smic Ġx q Ġx list Ġx tra Ġx Range ĠX sparse type Drop am bi ĠP AT ĠP atsy ĠA fghanistan pre fetch '] }} im resize to Local ans al ĠF o ĠF amily ĠR ock ĠR TE Ġ% +. Ġ3 24 Ġ3 37 Ġ3 26 Ġ3 57 Ġ3 333 line Width Ġv apor min dist Ġk W ĠN side ĠN loop per meability ds d ĠL ar Ġpro ton ĠM X ĠM el ĠM alt ĠM encoder Ġan at Ġl sa 10 25 Ġpar k Ġpar list ĠG it ĠG reg us d sc att Ġpre paring ĊĠĠĠĠĠ ĊĠĠĠĠ ĠE LE ĠE LL Ġdf out Ġ4 4444 ĠB T ĠB undle sh ire Ġun zipped In dependence Ġen ters 99 84 Ġtime unit ant ig num C 12 6984 Ġget DM Ġbo b las agne sub sub Ġall Types Ġhe t Re lax Re cursively Re moval ft race 25 94 raw CSV Ġline type Ġest a read Data Ġmin X pi ano Ġz real text color text font Ġ\ *\* Ġsc en ĠY oshua Ġpa a Ġnew f Ġnew est ĠH ome ĠH aving ĠH IGH ĠH azard 15 64 15 09 Ġlog ls are gion ĠValueError s ################################ ### ĠU y ĠU z ĠU rban Ġla cks 20 65 fa ith Ġ(' {: 33 85 no ugh Ġhas nans new path ES RI Ġfit nesses 66 00 Ġrow hdr au ction 45 882 ell ps bar BAD 35 33 14 77 19 21 Ġkey arr Index OpsMixin Ġ8 14 St udent 13 64 uff ers cor pkit cor outine 22 34 nd file 04 18 ([[ ( sv ar Ġstart angle ĠTest Box Ġmo vers Ġsy nonym 85 70 Con serve 27 69 close ness 86 38 gen omic }) $') err H Ġnode size Pro bs delta Dur reg tests Ġ... } Ġgrid line Ġreg ul results File ĠJ ython save loc ID L Ġq pt ater m config Dlg Ġim data 65 0794 Ġcv s Ġbatch ing Ġbatch Size Ġtable Name ĠCon n RE V 44 83 Ġneed ing Ġshow box Ġshow extrema EN E 23 75 Ġ(" { Ġinitial izes Ġfilter warnings Ġwindow Size 26 9841 De gr De launay 77 255 cell Count ĠSt ill ĠSt reams xx xi side winder Ġconvert To 43 137 Ġsequence Length To KG ĠComp ar open cv 47 46 ,' ') ox ia "], ' 60 94 ĠTime zone Ġtick text ias ma ze it ãģ ķ Comp ress Label er stop Time Ġequal ization Ġlearning rate root ed ED ING flat tener ")) ). 46 0317 Ġstruct uring Text Pos factor ized hat tach Ġdetermin ants ĠLinear Locator Pre sto IS S desc ribed ĠMulti Polygon Ġmy g Ġsche mas ane w ĠCal endar Ġcsv Writer Ġinterval x aut ify 63 00 api key sf m Min i tk photo ĠDi amond Ġsubset ting Ġside len aa ab Field Def 72 157 Qu eries sl b ĠInt uitively Ġred ucer An chor An iSpec Ġband stop Train Data Temp o Add Choice ĠFunction al Ġpys am GB K ĠRes ources big rams big triangleup truth s Ġmis leading Ġfetch er ĠSpark XShards ks one SP H Ġinstall er hel met geo dataframe prime s sphinx contrib mse aborn FL AT CG gu hy d export ed çļĦ æĺ¯ çļĦ 次æķ° ĠPandas NotImplementedError Ġtermin ator ĠRow Object ceil ing PRO V Point ing Ġbyte code 99999999 9 ĉĉĉĉ ĉĉ nat grid ENT ITIES Ġcube helix Ġturn stile Ag greg STR IB hyper bolic percent ages ĠStruct ures "% _ ĠColor Map ĠNon UniformImage ĠSFrame s kde plot æĹ ł Ġcatch ing Block Placement catalog Implementation ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠStat ist Open pyxl 317 460 rgba cache Ġip mag Ġ{: < vd w _{} _{}. Ġbeam line RNA s 984 127 (""" % tre ated tre llis 237 2 Sequence Set Ġchrom s Jo achims han sen att end Geo Tiff Ġ(* ) observed LC Imp edance 388 3 ĠSimple Transform ah l åĽ ł Br ussels Ġhit ting 603 92 603 175 mos pheric Alt Analyze mys oa ĠAuto Locator ĠLa ure TIC AL Ġfront ends ĠMod EM Active Document ĠMultiple Outputs Module Width Ġsemi colon 232 1 ĠNx M Ġbuiltin Id ï¼ī """ ĠQuantile LossFunction ĠPolygon Patch è´ Ń bank s Ġatt itude ĠBoost ed Post processor Cp u destroy ing Ġbn learn ĠIF D Ġsky Subtraction Mapping Array Ġtrunc norm Plate au sb plt will inger oy er 247 06 Math text æł¼ å¼ı omit ted ulo us ĠOper ation Ġbur r Intensity P Ang Vel NL P kel lam Ġ"$ { е ÑĢ Ġinhib it interact ives ĠREG ULAR Resource Properties ĠCOL ORS 079 365 ĠGood fellow Sol ves Ġtv tk drug s Ġupcast ing GRAY SCALE ĠQuant ization aab ca ĠSuper set Stand ardi Plan ck Ġcand le Ġresol ves æ± ĩ Ġextr aneous Tfidf Transformer ranked slot Ġrol led 619 61 Gate way å¸Ĥ åľº Scroll Bar ĠSal ary logM star Absolute Error Ġnav bar ĠHour s ĠWOR K 0317 46 ĠFancy BboxPatch Ġnbr dist Ġabbrevi ation ĠDAG s 894 12 Ġsparktk regtests Ġsynchron ize Ġ"{}" '. Ġdrug s Fltk Agg ĠEcl Grid Ġgro k POSITION AL Ġdeclar ations Virtual ToKG hamilton ian Neigh bours ĠMarg inal lmb das SERV ING Cau chy liquid ation hemis phere 20161 123 clam ster 6984 13 prede cessors Ġconfo unds gct oo ĠMAV Proxy trik man ĠRoc chio Serialize ToString deprec ations Ġbroaden ing MOR PH è§Ĩ åĮĸ ĠSlab Entry ĠSocial ist ĠQual itative spon sored 1622 7766 Mechan ism Asian TextAdjustment REPE AT 7936 51 ĠLux burg ĠGab riel akag ami ç¾ İ ĠASA DataSet ĠQUANT AXIS ĠUl rike ĠKok oska ukary otes OfPr dv pezi um chbe vl ĠgetDM spectrum hattach ary VirtualToKG Entry ) (' ) [:] ) >`_ , )). - .', / #! 0 9999990463 2 115 6 789 7 0980 A EP B AC B BA B oro B ansal C ert C assandra C ytoscape D END D ESC E max F dm H ann H arry I pv L AR L OL L ARS L atest N ib N ano Q I R ID S il S ense T ho T uring U FF V mag W elcome [ ...]. \ (' _ =( a dio b os b ach c ns c ial d rink f cc g roupe h len h mc h ardi k mean l me l ma l po l cm l vals l shift m W m ca n Data n weight n ones n ji p uls p addings r ush r hyth s an t ill t rot t ros u art u PU u csd v ppf w age w tkg x Train x failed y res y pad y coord z data z cat } .\ ° ìĿ´ à ħ â ī é Ĥ Ġ ery Ġ 999999 Ġ čĊĉčĊ Ġ ãģĪãģĪãģĪ ĠĠĠĠ č in dependence in ato re raise re inforcement on ing Ġt el Ġt file Ġt rop st de ar ah de mos de veloper Ġi ii Ġn band Ġn mix Ġn defaults Ġc ephes Ġf like Ġf mod Ġf Min Ġf ati Ġa er Ġa val Ġa od Ġa ps Ġs pt Ġs ab Ġs ms Ġs arimax es p Ġo he Ġo megas Ġd img Ġd dx la uer ut ili Ġ' "+ ing ers pe ace Ġm scale Ġm ni Ġe math co coa Ġre normalize Ġb ub Ġb ike Ġb anks Ġb acterial un filtered un escape un paired un directed is l def er ort BestSplitter )) [' )) ``, ce m ce st est a val leys id oc di py ma b turn stile one ct ĠT weak ĠT revor Ġy elp ad sworth set ools set Single set InputCol Ġ2 75 ver let Ġst okes ') * ') / ck e Ġ+ -----------+ Ġ+ ------------+ Ġg lasso Ġg mail Ġg toc __ '], ex pired data point par rot get Sub Ġassert Collect Ġex ited ax l ax Pos ĠS en ĠS tra ĠS pack ĠS Cons Ġco uples Ġco ffset =' -' ", )) Ġx ext Ġx com Ġx positions ĠX max ': ], Ġnot ion put s ist or Ġh M Ġh st Ġh ough Ġh cells Ġh gjr py gg ĠI ra ĠI ce ĠI MPLEMENTED am odel plot panel plot Num ĠP he ĠP ing ĠP mn ĠP etal ĠP acific ĠA id ._ - Ġu x '] *( ĠC ER os ites to im Ġtest bytes (" ! (" ---- ĠR G ĠR ok ĠR SI ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ np m list en list eners if ed test cube line a line age 01 67 01 667 ne b Ġcol sample ns pec Ġv label Ġv tool file dir file Ref pro y pro of pro ceed pro gramming min len Ġk ing Ġk inks Ġal ts ĠN Vd ĠL ater ĠL AS ĠL HS mo is Ġon OffHelper fit x te tra ĠM yr ĠM ilton ps mag Ġmat s po ster Ġne gate Ġl ump Ġl rate we ig ir con 10 26 Ġnum dec Ġnum Hours Ġnum todel assert Binary us igned Ġma gn comp utations comp romise sc ed ĠE W Ġdf dx Ġ4 55 sh t Ġun paired Ġun sure Ġun pickling ip T ib z (( ((( op df Ġdi el random ly In ject In divid Ġlist en Ġen closed Ġen rich Ġle f 99 65 99 244 Ġcomp et ant anu 64 47 ĠW esley Ġmax index num b num bered num Buckets model Name 12 87 Ġget name Ġget tz Ġbo ots Ġmodel Name map hore vel y Re moves Data Points Data GDP Ġline feed frame list Ġfloat fmt inter national inter leaved Ġch dir ll g ll um Ġ.. ........ 32 02 his file ĠPar sed ĠIn form bin RF Ġsc enes ĠY e Ġ) ): Ġtrain x Ġj ulia gra fo ĠH ousing ĠH arris 15 06 Ġoutput database pr g 20 46 fa cs Ġ(' ==========================================================') dd ot Ġcl ss Ġcl pmn 33 19 33 06 Ġsub path ie re 66 99 66 78 amp m 45 64 ĠK night 75 1022 "] ][ av r av ailability iss cale ak ima 35 686 35 354 ))) ** cur doc Ġsize val Ġ8 12 Ġ8 15 St adt 13 15 22 353 Ġcopy s nd of 04 32 04 86 04 278 96 05 ĠTest Utils std b Ġover plot 94 94 ',' % 24 98 Ġ7 11 Ġ7 70 image magick Test Results Test SQLAlchemy temp Pre err print 09 14 ap iclient dis charge ST AMP Ġsol r Ġgrid array Ġreg ulation 92 86 Ġmode m ID ES Se m Ġq rid IC I ac b ac ids Ġsum Array Ġtemp Rec ris ks UT ELY Ġad aboost vi per Ġtra cts RE M Ġoff ic Ġshow warning last y Ġev ap Ġev olve 26 77 AG AG AC G Ġgraph ing RO T TI F over plot Ġdraw able ob name vs f bl um source file Ġter rain Di urnal List View seq name 67 67 67 451 ĠPer mutation Ġstate point extra polated Ġfield names open gl Ġuser anks 000000 01 block wise Set Object Ġcorrect ing EL IST Plot ly Plot Methods ĠPro cedures 29 22 En han Ġimg Patch Ġge odetic local ized ĠIndex able IO U exec lines convert VirtualToKGEntry su kh Ġauto paral Ġ'_ ': Ġstd Accuracy Box Style Inter national Ġtask Context Ġdb h Ċĉĉĉĉ Ċĉĉ Ġnext char nb viewer this iter Ġbox in Ġbox props cd p Ġmy globals build bot Line Refs mic i HO G Table Function Table View Table Reference Ġ'' ') 63 137 Can cer light curves status Message Ġsw arm Ġsimple json GD K Ġaut ocor distribution Type æķ° ç»Ħ next Valid Ġsession maker CP F CP S Ġwave guide An oms }{ :^ Temp Table ĠName ly ĠFe ather Ġli ving request er CL I ĠDo F Ġactive Cells Ġopt level }} $", 2016 0101 eg l ĠModel Fn ĠInter polator pri ms )} ') Output Cols Ġmis classification Num Expr ron weiss Tool Item With Error CON UT ĠOut bound ],[ ] Layer Histogram Count File Act s ĠTh anks Create Series Ġinv scaling begin Date ĠDis cretize BC Y ĠDist inct çļĦ æŶéĹ´ Ġ([ (' xp stats ++++++++ + Ġker nelapp Des ired swap case Ġbroadcast ed Ġwin str Ġaccount Curve Current Version SON IC SM U SL ICE }' >{ Ġgra f cover type Ġer idx ĠLA ST Ġelect ret samp Result ĠCor men hex agon Call ing cli ques Ġpseudo code Ġslow down Ġrhs Str Mock Series Ġ196 9 ĠTr ust ĠGo ing Ġinc lination Ġann ulus ĠAC F bp n Ġ195 1 Ġbeam M Ġreject ing storage Level GE EResults Ġchrom sizes Ġcar ries ĠRO W Ġseg faults Ġnr Outliers att ens att entions Ġraster ization rx Packets 937 74 Extract ed gh ts Ġanswer Set Cluster Node ĠSArray s Ġ################ ############### Ġfac ility Ġins ures mor ningstar triangle left Build Category GL UT 314 1 904 93774 Multiple Pass Last Checkpoint Ind ustry ĠMan age xlsx Dict elastic ity Ġsemi major kk p ĠFigureManager Wx ĠOK M mac error ----------- ") çİ ¯ Benchmark ing FONT CONFIG ĠMLE s gun s Header Labels 327 67 '| '\ Property Descriptor ongo ing ece f Chart Class intr insics Ġimb learn Install ing Ġ################################ # Ġ################################ ## Frames PerBuffer Decimal s halo data Ġphoto electric Java Estimator ĠCF Tree ĠCF Subcluster SUP PRESS SUP PLY nod rop ĠPack er mbran es ĠExpect s contrast s suppress Composite Ġ^ = Cloud Block ĠConst raints nes day Ġment or Ġmirror s flt r ĠCommon Test Bayesian GaussianMixture sav ings ĠElement Tree ttf files MiniBatch SparsePCA ais on Ġfavor ite Ġbf gs ĠCOMM ON Ġpull ing ĠCell s Forecast Dictionary FACTOR IZATION }; ". Ġprece de ĠDiff MeansPermute Ġ104 7837 ĠApprox imations 7686 3 ĠPlace holder ĠRegist ration éĩij é¢Ŀ 407 44019 morph ing ĉĉĉĉĉĉĉĉ ĉĉĉ ĠQU OTE GDP æķ°æį® Sty ler Ġdry run deform ations NON NUMERIC ĠInf late ĠDebug ging Ġvw aps Ġcancel led Ġborrow ing ĠSG Feature 第 ä¸ī Ġconfirm ation 1275 65 Roll Index activepath checkBox Ġ245 1601 ,'. ') setMaximum Size flo ps Ġmelt ing Wrap ped Concat enate Sound man Pitch Index coura ge simx SetObject ĠNI H ĠLambert Axes Ġbre wer Tex as Ġnuc lear ĠFlor ian æ¸ ¯ coh ol Equ ation Ġdod ge ĠExponent iation Ġelli ptical ĠVARI ABLE ĠTi pping ĠUnsupported FunctionCall 6565 65 Ġtheore tically Sky Coord ĠTy gert setCheck State Ġturb omix åħ¨ éĥ¨ ĠBk j ĠexpResult Perturb Ġdescend ants Ġequival ents Skew ness 20161 126 Ġìķ Ħë Ġcolo ured ĠDat atype Ġros lib dHist E prede cessor Ġposix path ĠQuad Mesh Slic er von mises ĠAitoff Axes MBR ACE Hg Values cplx real ĠGust afsson Ġwebs ites ĠãģĦãģĦ ãģĦãģĦãģĦ getdefault scan ĠSparseSGDClassifier TestCase baum Welch kine matics )+'% ), ĠKlass ik hps Model ĠCSA mp Ġdae mon èĬ Ĥ Bear ing Trad ers Ġmeds lope ĠdFunc Args 98765 4321 Ġnsf g Ġå¼ Ģ Scrolled Window ĠWitten berg stink bug è´· 款 õ es ĠTAX ON Ross lau 49223 640 micirc ular isecting KMeans (['.'] *( giro lami ĠassertCollect Success ĠRok hlin assertBinary Predictions 751022 34 sukh in ĠModelFn Ops Ġ1047837 49223640 simxSetObject Position % < ' `: ' {\ ) =[ ) =% ) ][" ) ||_ + "] , ') . -') 2 125 = `` A nc A sync B ern C ALL D od D ice D inner D RI D GP D Transpose E lines E ulers E CEF F SK G PP H ill H OLD J H M AL M utation O s Q NAN Q ToolButton R dd R CA S cre S Ne S HE S SVM T w T ukey T weedie U psilon V grid W as W ert W FC W PG \ ') _ ][ a get a weights b il c ipy d ub d train d ffits f df g iz g able g cd h map h br h tac i am j ung m min m ssql m ypeak n cores o fit p led r mp r num r loc s quad s arimax t P t th t form t iger u A u ut v ts v end v split v ester v istrails w atson x li x col x plot x width x pad y day | \. à Ī æ ¦ ç ¦ ç ¥¨ ë © Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĭ ¥ ĠĠ ĊĠĠĠĠĠ ĠĠĠĠ čĊĠĠĠĠĠĠĠ re venus Ġt iters st urges al m al mon ar ounds de ls Ġi op Ġi cs he p Ġn D Ġn q Ġn atoms Ġf pt Ġa mat Ġs ight Ġs ds Ġs rid Ġs Type Ġs mem mp lobj es capes ro dy lo lo Ġin type Ġo ggm Ġd ma Ġd size ing es Ġm lr Ġe clipse Ġre partition Ġre production ge trf ge odetic Ġb und Ġb ids Ġ# {{{ ic ine Ġw q Ġw y Ġw er Ġw data un stage is u is data is mo is cale ue le li zation )) ]: um bers um bral Ġ[ ':' as ar as str as factor 00 755 Ġas ide Ġas king Ġis ub ], [" ), (" ĠT N ĠT rip th a res num ad l ad ocument set Clock set dlopenflags Ġr dp Ġ2 67 Ġ2 93 Ġ2 76 ]) ])) om on Ġ* *** (' '), (' *' ex Data ex perience par zen ke eps get Min get Default get dlopenflags ab brev label pos ĠS l ĠS FR Ġx fit Ġx width ': : Ġnot ifications py o py array py ramid plot func ĠP in ĠP ractice ĠP REC pp c ĠA bove ĠA IR ĠA UTO fe bruary pre y pre lim ĠC ash os lash Ġtest file Ġde position (" ==> ĠF aster ĠR ibe Ġval fmt list names ub en Ġ3 34 Ġ3 56 Ġ3 58 line Ma ĠD CT ĠD uplic Ġcol lap ns p min S Ġk si Ġk riging str y str list str path max dist class ical class Name ################ ######### ĠM aster ĠM ACD ys ystem Ġl mv Ġuse AA Ġpar aview Ġnum samples assert Squareness assert Precise ĠG SR Ġout dtype Ġstr ands us ible us ums ĠRe ports Ġpre clude ĠE lapsed ": { =" .") Ġ4 01 Ġ4 62 ag iovann ĠB P ĠB ib sh ank Ġun ify key list key arr In trinsic Ġcomp lain Ġint ial ant ly Ġ`` [' Ġ`` [[ ĠW adsworth cs w pha ge num Cadences ide code ĠO h bs pl Ġbo ids tric h sub domain sub stations Ġall Data dir names Re po Re ward Data Spec 11 12 11 93 loc ata pi a Ġz m ng rids text grid ĠIn fluence Ġdo mestic Ġj u Ġj gd ĠH or ĠH ad ĠH ans ĠH orn 05 95 05 08 Ġlog scale Ġlog gamma tra ps Ġpy omo Ġ[' -', ĠU ST Ġla unches pr b 33 56 Ġsub strings les ser no filter Ġha milton Ġ6 25 new b new lib ER I ĠSe a 45 77 16 02 Ġup pers nan cov nan percentile ĠEx oSOFT 19 18 with cov '. * 13 14 Ġpath lengths sp u 04 33 04 49 04 28 Ġerror Msg 03 94 02 35 Ġ{} }, Ġ{} "). Ġover complete 17 34 ĠCo efficent sort ind DataFrame Writer DataFrame NaFunctions Con struction 24 44 Ġ7 08 Ġ7 76 Ġ7 129 freq Channels image dir Ġresults File gen laguerre right brace }) ` Ġmean props 18 44 07 20 Ġnd cg 97 98 Ġnon singular sent iments ĠQ Icon left brace Ġkernel ized my data non unique 65 98 cluster map 37 95 :] `` 87 0588 point wise top level State ment colors pace ĠZ oom Ġob sc Ġfilter title De serializer De jaVu ĠDe cay auto use RO UTE TI MIZ sup set ga z ĠSt ars ĠSt urges 98 10 _[ [ AB X make Float FF AA MP FE To Image ĠComp ared ixel s vis ually ox i Ġca ution png file inv Dir OT ST rad or Ġhttp lib star name ransform er 49 15 stop list =- =- Ġge e 38 16 Ġoffset Text MA STER DI s DI VID ele g Fe O su its AD U Ġstd lib Ġpla ys ET S Ġfix tures ĠLog Locator ĠLog Reg 69 34 '\ __ Get App Get GeoTransform String Col ws j Ġfast parquet obs olete Sh ifted Ġnan median No Data ĠBase RandomProjection TH IN TH EDO ret ched pass wd ĠLe ak dr ill pk td Ġ## ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ Ġevery one Axes Base Function Transformer cha p Ġview port Ġcla im light gray sf c Ġrc defaults ('% ') uint Type Ġour s arrow size cro ps prop name Ġcustom ers ĠCh ancery Ġpp g FA STA thread safe 62 33 flag array mar shal fort ho Ġdebug Text Th in Th ermal Node To ĠInter net Sy napses mk path air foil feat urizer mock s ĠAR T SP X sur r sur rogates Ġpost ive author id wer te æľ ¯ resolution s week end Ġbit code host ed IND ENT Ġexport ing DS M Ġthread safe Trans parent From Line quad rants Float List masked array End Time Mean Squared ĠEst imating ĠSQL Database relative Error URL Y Hel pers ĠEX PERIMENT ĠStruct ural SN Ps ee cs Ġ? )" elect ronic ĠGroup by install ation sal aries sat ellite Raw DescriptionHelpFormatter design ation sheet name Ġmicro RNA Ġì ĺ =\ "" wav file ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ dark green Ġ------------------------------------------------ --------------- Ġhard copy Ge odetic ĠMy Dummy sta ff Ġeq v ĠRO WS Ġlead ingspace PA W Ro binson ln k Job lib BB BB Ġlam Sq decre ment ĠDI RECTION Alt Database Right arrow ĠLa ue TEMP OR Left arrow SUB JECT Ġë ³ Go R QUE UE ĠNx N dup re Two step æī ¿ Ġcommun ications SW AT Ġinteract ing omorph ism åĪĨ å¸ĥ Ġè ¾ zp sth ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ 945 10 Ġten ure tlene cks IV GMM Ġ'\\ ' Scatter ing ĠThreshold ing qc data Ada pt 584 31 ĠRenderer Agg Ġintr ons igraph y ĠCommand Exception ili o IE W bres low }% '. ĠPri mal Vi ctor Merge Error ************ * pilot ErrorDiag Fl ickr centre Frequency ĠTer mination Ġalphabet ically Ġyellow brick Ġdra ggable ĠFinal ize Rad ar Need s Approx imation Approx imates sound ing Ġthr ust Repe ats elim ination æĬ ķ Ġ*** ") Lag s ĠMonth Locator ä»ĵ ä½į èĢ Į Ġcoer cing golden rody Ġemphas ize Dele ting DEV ICE Ġanno ying Ġmen coder Contains Null Ġcoinc ide Ġsymp rec gover ning Anova LM ĠAk ima Ignore Warnings Ġhund red ĠPage Rank ?,?, ?,?, Az imuth fle et Ġmail box Ġinflu ences ĠStrict Version react ants Ġmort al Hashing Vectorizer ette er illust ris CONVER GED spar setools Ġgeopy tool URLS SL Ġstor able ĠRp Rs Ġstoc f Ak aike ĠRET UR ĠNews groups avis ide QPoint F ç¡ ® Ġbene fits Monte Carlo ĠHu ang Ĭ¤ íĬ¸ Impro per Heter oscedastic 693147 18 ĠCrossEntropy MNL BRO AD ĠtestSome Correct ipolo sukhin ('#! '): 999996 185 utctime tuple ĠLaure ns hattachary ya htac cess ĠRibe iro Ġlmv npdf assertPrecise Equal ĠUST hanksgivingDay THEDO CS Ġ##++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ +++++++++ goldenrody ellow " | " }\ ( `` + ": . ( . '], . ',' / $ 3 968 3 6471 4 7843 5 0980 6 90 8 3529 8 999996185 9 804 B ulk B artlett B lended C t C uts C redit D and D ollar E fficient F m F ly H LIST M CL M RD O xy P hases P illow Q c S ML S ilhouettes T ar T ube T reat T errorism W l X e X fmt ] =- _ (" _ (- a ched b ay c ure c func c andid c ryst d M d gs f j f lashes g ci g lb h dens l ne l nl m ns m box m colors m ci n M n bo n Here p mp p om p ax q sums r tt r mf s len s old s ft s queezed t lm u metric v tau v ileges x B x step x edge x fin y nc z q z al } ]. Î ¼ à ¥ é £ ë ł ì Ļ Ġ 928 Ġ ĉĉĉĉĉ ĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ in en at um re init re loads re written or opleth Ġt ut Ġt as Ġt old Ġt ones er ra st ain st icks al ian al iased an atom le ader Ġi den Ġn jobs Ġn Dim Ġc ave Ġc umprod Ġf ss Ġf Target Ġf urthest Ġp map Ġp ractical Ġp FalseMatch it py it als Ġs lr mp ulse ra i ra pi ion aires lo on Ġo cur Ġd ffit Ġ' ---------------------------------------------------------------- == ( Ġe ca Ġe lidx co phe Ġre b ge di Ġb ql Ġb lind Ġ# """ ic illin Ġw fn Ġw ikipedia Ġw aditu ur ff Ġ( ('_ Ġ( "", Ġ( )]), un mod is Null el ing li o Ġfor um Ġis polar Ġ" ), turn over one ofs ĠT odo tr ate ha y Ġy upper Ġy positions ch ts ve t set Vertical Ġr ango Ġ2 89 ver ty mat z lab elover il u ') > ') "] ]) +'\ (' +') int list Ġ- _ nt x Ġg left Ġg opts __ ]) ex pi ex mpl par cur par gs up ts up pers up downarrow get bool get ListOf Ġassert ed Ġex if ĠS CC ĠS RM Ġco ders Ġdata File Ġdata For =' ;') Ġx ind Ġx mean Ġx points ĠX dense ul p con ll col laborative ist itle py mol ĠP au ĠA ust ĠC OS Ġwith dash ĠF lex ĠR C ĠR ubin np hase Ġ% { if counts Ġ3 55 Ġ3 77 Ġ3 79 Ġ3 76 Ġme at line terminator ĠD ip ĠD range 01 14 Ġcol Num Ġse diment Ġv ox ly apunov pro ces min SineDur Ġk path Ġk range Ġk stest ĠN b ĠN av ĠN EXT form ing art ificial ĠL uessi class Index ################ ############ Ġl cv size Policy ir r learn ess Ġlabel width Ġlabel right assert Sequence ĠG abor Ġout h us ivity Ġma hotas ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ---------------- + Ċĉ ĠĠ ĠRe project Ġpre parse Ġpre loaded Ġtr f ĠE A ĠE Q ĠE e Ġset ang Ġ4 10 Ġ4 27 Ġ4 92 Ġun d Ġun reason Ġun rotated Ġun touched Ġun derest Ġ5 10 Ġ5 83 Ġby minute op od Ġdi ctor key cache In sertion Ġle uk Ġle fts Ġint v 0000 03 fo unds ĠW riter Ġmax c num array num TopFeatures og h add Tab 12 07 ĠO BS Ġaxis info Ġpo ses lim ation 25 19 25 56 Ġso ur Ġpd w Ġch ans Ġsh annon Ġnew lm ĠH MAC 15 85 print able tra c Ġpy graphviz Ġ[' ``% Ġoutput ting '], [ Ċĉĉ ĠĠĠĠĠĠ Ġcl n 33 55 Ġsub pixel vari ability 100 5 pla cing Ġ6 66 Ġ6 51 Ġ. /% pen sion IN ES code cs uni versity ĠSe ason AT O ĠK PCA ĠK urtosis ']) < 16 74 ml uessi Ġcal endars 14 41 19 40 tick angle count plot Ġprob fit Class ifications Ġ8 25 Ġ8 238 13 42 ĠV ap by month title side Ġcopy fileobj nd tri sp diags table au 04 89 ([[ ]]) Co urse ou ses Ġend less 95 67 95 69 85 25 Con str function ality Ġdis charge close Array cat ToImgs ]: ( temp or temp grp 07 01 Ġpass age Ġqu ants ')) ], Ġlin ux 34 12 34 89 Ġgrid x Ġreg enerate 92 35 ĠQ Q ĠQ Color Ġq graph Ġq hull Ġ[[ ],[],[ cov mat non default 65 76 30 819 File ContentsManager gy ros ĠZ willinger (* (( 55 294 EN AME SI Z {} " Ġ] }, Base LabelPropagation mult ic Str ict effic iencies draw edges Ġmark ov bl an FF AAAA \\ \ alle au ia o fs f ĠComp ut ier ge ĠTime Stamp poly gamma TR IP TR UNC ĠPro xy Ġfull CostList sha w 21 64 Ġlib sedml 68 112 flat Map mi lauer gex f DI FFERENT head less Ġcre dible Ġcell Colours hi res sm th sm arx Ġauto function ench ant Ġerr Msg bit code ĠMe er 57 647 App lications ĠLog Scale Ġ", ), child Nodes Ġwx c Path ways Ġxy plot ane se hash table hash tags Ch arm Ch anging Ch ristopher Ġday ofyear ĠLo pez Line Style hot s PL AIN 89 02 74 32 dec ide ĠLe on imp osed ĠPre serving dr z ([" [% CO ST TS GT Int Type Ġangle B )+ . Fold ers Min ing tk o 59 1 alog y Ġalign er Image Sequence 93 75 PO lib We ak aa pl see ing Ġcustom ary NE IGH Multi Graph ĠPy F Ġpresent ly ĠName Validator Sub sets Sub Mesh 62 75 mis upervised entry steps ./ (( GT GG actual Power Ġfeed forward ĠRes ampling .+ ( Ġmid points Ġap pe )} " Num Runs site base With NumRuns æķ°æį® éĽĨ mk vc CON TRIB Ġanaly st 58 18 Ġfitted values Ġport al sur round As Text Ġgeneral isation %% , cg is Period s Kernel SpecManager car riers Ġinv ocation '`` ). pat chable after point RES O RES AMPL /' ; ĠTrans action äº ļ Mo dify Parameter Names xd g Font List ĠVari ational Ġcb margin Ġcau chy SKIP LIST ups ilon ĠSim ulates Ġdig raph bra ke ĠNon parametric ('. // tax id colour map cam vid arc ia Ġserial izable vect s Ġgap Maxs cu lib Ġmem mapped }" ' ĠAss igns pan es Mag ick Ġgl Vertex bw a Ġnat urally "} ] Ġlatex only ]_ " determin ation Ġì ľ Menu Bar cn v Ġhy d ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ge ography sun burst Average Pooling Ġ33 97 ĠHand ling Jo urnal han na Ġ(`` ' dk ly Anal ytical Red shift gh osh 900 9 Mark up Import er Conversion Interface uv ka ElasticNet CV Cross Section ('../ ') ĠDI FFERENT ĊĠĠĠĠĊĠĠĠĠ Ċ ĠGP ML Ġmaint enance SPE CIES mant ics Parse Example Analy ser Ġrms d fonts pec Some DataSet pic rust DL DFD graphics format CAL D ĠHyper geometric Ġ[{ }, ï¼ļ \ spectra red ĠLocal OutlierFactor ĠChe ung ĠCH ART ĠJava Script para Muest 765 4321 ='. '): 6401 84 ĠAnal ytical ĠChar lie æĿ ¡ calib s ĠAbstract locus Numpy DocString Incre ment Java Model Abstract Stat Ġhal os ĠHive Context pip es Ġsag ittal Mis sed pydata mem ĠLim ited ĠDec ide OH INT ĠOper ations 290 20 ADD ON phone me ĠTurn s Ġplanet ary Ġ################################################ ###### Structure Environments uu ids Filt ro ĠExport Builder Sphinx FunctionDoc abstract methods quilib ration Ġdn ntfDef erg odic 886 27 å· ² robot s kp sewhich æĭ Ĩ éĻ ħ ĠOpt ics White Papers 517 65 Ion izRate fre xp Hub WindSpeed ĠPi etro Ġdft Model ĠNeuro science Den ominator OutOf BoundsDatetime AUT OHINT оР² Ġ'~ % ĠMal formed ĠHour Locator '(? < LAY ERS ĠLev y Ġntwk B Ġntwk C Pers istence ()`. ' ĠPow ell instant aneous âķIJâķIJâķIJâķIJ âķIJâķIJ Life time íķĺ ëĬĶ COUN TY STY LES ĠDel alleau å± Ĥ ĠRepublic an Ġdee per Ġcir cul peri pheral ठ¾ GaussianRandomProjection Hash hock ey !!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!! Ġincorpor ate backslash replace 302 73 éģ ĩ Az ure tricontour f Ġ\[ ([ dH dl ĠSig moid ç¼ ĵ ĠMultiplic ation ]+)\ ]', FactorAnalysis Feb Closed FileError vit ational Ġoccure nces DOT ALL ĠYYYY MMDD CALEND ARS Ġminspan x Ġadsorb ates ĠClamp ing Stre hl 0377 04278 Ġìł ķ ĠMultiOutput Regressor tent acles ,_, _ wfk q Precip itation setFixed Width SOCK ET Ġconcord ance éĵ ¶ Ġmvs dist ĠIntro duce åĥ ı prest ige Parame tro åĩºçİ° çļĦ Her mitian ucha ins 7416 57 Ġdav itpy repla cer Ġjim mysoa è´¸æĺĵ æķ°æį® ='` '): nuis ance Ġëį °ìĿ´ ĠåĽŀ æµĭ multin est Gun nar ĠBarn hill dough nut 7901 257 CheckpointSaver Hook interactives hell ._- ]+)\]', Individ uo ĠPREC EDING Flickr Object labelover flow assertSequence Equal Ġdictor xn ĠVap nik 037704278 7901257 # _ % , _ [:: b size b cr c ratic c rab c athode d matrix d alpha d xy d ale d matrices f on f xt g il g lpk i ating i Vas j v k no l ord l gr l cp m ation n P n exp n rmse n arrative p set p min p ile q rid s res s Date t dir t mean t ens t stat v ig v ard v pack w ang w ks w alltime x List x star y ax y cols y change z wind z bes  ª è Ī Ġ čĊĉĉ Ġ 789 Ġ servo Ġ mplexporter Ġ ³³³³³ Ģ æľ¯ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ in ier in bag at mo at plotlib Ġt ub Ġt idx st g st en an ine le ptic de re de scriptive Ġi di Ġi data Ġi ret Ġn lat Ġn cond Ġn spec Ġn ume Ġn records Ġn sector Ġc lob Ġc points Ġf key Ġf diff Ġf sf Ġa h Ġa coustic Ġp pl Ġp las Ġp pi Ġp itches Ġs Name Ġs quee Ġs ftp ra bi lo sum Ġin volve Ġo th Ġd line Ġd pr Ġd xx Ġd coords Ġd camapi ut ch Ġ' (', ge thostname Ġb dtr Ġb hm Ġb rowse ed b Ġw slice un whitened un igrams is ser el ding )) ', ce res um ask as o as format 00 46 id l id fs Ġas freq Ġas ks di er Ġis real Ġis measured ts um ts AssertEqual ĠT v ĠT qdm ĠT hough ĠT icket qu ants Ġy shift res name res File ch ndtr ve h Ġr int Ġr indexer Ġr ipley ver r Ġ* (' Ġ+ %. Ġ+ ------------------+ Ġg if Ġg tab __ (" __ "' ex o data Name get ype get list get ncattr ab and ab lation lin ic for ydiff ri sed Ġx ft Ġx axes Ġx ticklabel Ġnot ably ul sion con ut col ons col hdr ist o ist ags Ġh spec Ġh rs Ġh anging Ġh ilbert py doc len ght ĠI mmutable plot Error ĠP lay fe b Ġu o Ġu cell Ġcon clude ĠC um ĠC MU im balance Ġtest datadir Ġde bt Ġde bye Ġde liberately ans i ĠF dm ĠR xy ĠR Fs ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ if it Ġ3 32 Ġ3 35 Ġme re Ġres d ") ]. Ġcol g cal tech time d Ġse ls Ġv tx Ġv inf Ġv oro file out file io ly ings out format min orticklabels ĠN m ĠN ans ĠL uc ĠL IG ĠM IC ps pec Ġl lab Ġl names we bbrowser Ġplt file ho v 10 48 10 400 Ġnum threads Ġnum Days ĠG as ĠG rad ĠG CS row idx Ġresult file Ġresult List ---------------- ----------- pl ute =" .* Ġ4 40 Ġ4 138 ĠB las ĠB lobs Ġun cover Ġun resolved Ġun wrapping Value Dictionary Ġby hour state seq state Plot key press Ġen coders Ġen forces Ġen forcing 99 0000 99 05 99 82 ant el 64 0196 64 645862579 fo ssil Ġ`` % ĠW arns num Cells og CS Ġ__ ________________________________________________________________________ ()) ``. sub dict sub key ep Filtro Ġwh ales Re levant Re venue float status 25 64 inter activity loc Label Ġmin Value cc Cnt text asci Ġ\ * params mask ĠIn verses Ġsc rew Ġj i Ġj aq ĠH C ĠH M ĠH armonic 05 01 05 10 05 43 tra ced not in Ġla v io logy Ġfit params IN FORMATION vert ica Ġind u ĠK ill ĠK ep ĠK rie load Data load Model 75 0000 75 07 Ġcal cium 35 17 14 38 14 1416 19 46 =( ',', Index T Ġ8 64 Ġ8 0000 Ġ8 60 78 75 78 69 St derr 13 67 Ġbin ext ĠV inf ĠV mem ĠV ARCH ĠV iterbi Ġstring d be lt Ġpath tools 22 20 22 78 22 62 ian o ([[ [- 96 38 ule nt Co app Co herence 02 45 02 87 02 70 Ġmo jo std lib 95 96 Ġcom ms 17 255 ĠCo urse :// ' order able 24 314 csv s Ġdis cr main ak 86 54 var max off icial }) $', 06 13 sy nonymous 09 23 07 451 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġnode name dis connected delta R Ġbet aln reg arding Ġsol y 34 06 34 26 Ġ... ', Ġpart ners 92 14 Se ason ĠQ CheckBox ĠQ SizePolicy ĠQ Graphics ĠQ iita 84 27 84 91 Ġq y Ġq mat ac ct Ġim m Ġtf d Me ad 65 04 37 30 Ġorig o OD ATA )[ [" Ġcreate FontList active Columns 55 1 nn ls url name 23 93 Ġback drop net ics cell size Ġcenter line Ġsim bad pdf Repr ĠSt ations 42 37 ++ ) draw Button font style layer List )* \ Ġabs orbed Ġoptim ised DE PS gb tree Ġimp ut Ġtop n Set Weight ze ch full er ãģ § CH R find All 29 25 29 88 Res So 40 784 Ġimg plot Regression Results spark ling Ġps writer flat chain Per Entry DI ENT ĠNe uron Ġcell py strip ChartWdg exec uting ĠAt tempting Tree Estimator Text Edit AD O SA M Ċĉĉĉĉ Ċĉ ĠLinear Only ĠLinear TimeInvariant Ġform aldehyde 69 804 PI R Get String cd c Ġchar code Path way Ġmy py rot or 137 420 sw arm Ġlong double ublic an ĠBase SGDClassifier ĠBase SGDRegressor accuracy All pass bands cel la ĠRun ge record ers Ġnb convert pk pt CO P Ġbuild bot fr inge On Close 54 968 )" ' Ġsimple String cons ult ĠOption Menu Ġus r ĠMake Pmf two dim Image HDU setup Class ĠSh arpe Ġpatch ing CP P Ġbegin ing Key words Agg lomerative Train CV spect ro Ġlon lat mar c mar oots [:] = Ġrepe ater Ġ(% )") Ġdebug PS Ġsf m big wig Ġmid as Ġsur round Ġsur veys TRA VIS mal ink Ġdual s Ġ19 78 Ġsubplot pars pus hed ij i ĠAxes Subplot super user ĠImage Tk Range Max Ġsupp nmin Ġinsert able Ġtool bars Poly fit PU BL CG ir CG rg ---+ ------+ Trans it ĠKernel Manager WH AT topo logical Ġgene ID SH ARE åIJ Ħ ĠRegression Results delay Threshold Cor poration ĠSto uffer Gaussian ity Font Manager ĠTable Expr NO V ĠBe ck Sim ulations bot tle Ġlr work Ridge ClassifierCV Do e Ġcounter parts NORM ALIZATION dow nside ĠSim on SL ID ĠTra ct ĠTra ffic roy al unpack ed Ġgu iname border axespad ĠSpectral Cube ada delta Ġke pler bn data sag ittal Ġpur cha Over lapping 988 2 sat rajit Ġdr um enet cv ĠST ANDARD asy mptotic ĠInterval Array aur us ĠCho ices demo bayes perform ing Pa inter Pa rents conc Init Seq IO Ġ'{} _{}'. Ġquant ify 375 8773 Non deterministic Make Translation erc ible ĠSystem ML amb lin ĠAb el Ġwind rose weep ers ĠGMM s forecast Day skew test Contain ers Ro i Ser vices EAR TH Ġelev ations Ġlc arg ĠTri als Ġdash boards Ġcam eras bon acci bow l #================================================================ =========== turb idity }: {: Ġincrement ed 494 12 Ġiso ch }_{ \ Ġ%% " Idx List 404 9 IDs List ĠInverse Jacobian Align Right 007 40 Ġsun spots configure d Cy cles Ġreflect ors Ġminimal istic rece ive ĠPolynomial s lor a lor o Ma il ĠRel u dire ita ĠBatch Transform Ent ities Const ellation 450 20 adapt Ca STAT ES STAT ISTICS Append Separator Ġ################################ ############## olden rod ĠPAR LIST æŀ IJ ĠAbstract HolidayCalendar ĠOUTPUT S withColumn Renamed mono pole hor a classify ing Ġ'*. '+ Ġqual itative о ÑĢ ĠHistory Columns Ġtal lied LeaveP GroupsOut Ġcomm its }% ". Ġ{( ..., implicit ly Units Per PREFIX ES ĠRequest s quot ient Ġdatal abel ĠEvalu ator ĠLight curve ĠVir ginica Ġrelat ing ĠPort able Ġjn yn Ġreds hifts ĠZip f PROCESS OR ĠOmega Step æĭ Ł Land kreis 676 7706 ĠQuant um Ġisol ates æĬ Ģæľ¯ roman ager Ġproceed ing eu cl ĠOpt ical Ġfat al ĠGPU s Vir idis ĠYear Locator Ġnarrow PeakFileName SIG MA ĠTex as Ġiir design ĠBroyden First Ġrecogn ised Daily BarReader ĠStreaming DataFeeder icular ly Expect ing Ġbis pec psy ch ĠMarkov StateModel ĠSat urday ĠSat rajit åıij åĩº OBJECT S leverage d ĠSoft w ĠImportant ly Contin ue ĠCHAR TS tow ns 293 128 åıĺ åĬ¨ Ġâ ī ĠBer kes isol ate COUN TRY Moving Average è re ĠVers icolour ĠSurvival Function endalltau Result ĠZerosPolesGain Continuous OneVs OneClassifier 0303 1206 ĠFlor ida 1616 1465 respect ively geos hape ĠKrylov Jacobian Ġsteep ness ĠRED Cap dod gerblue STOR ED ĠCli pping ĠDie go setColumn Stretch mang rove alfa val tun icate Ġsac cades Radio Button Ġinvent ory VECT OR renew command 2412 26 ĠCONT IN çĶ± çĶ¨æĪ· Ġallt xt 1309 81 ĠDrawing Area Ecut val SUMS S ĠDOWN LOAD Ġprim Pg Hypothesis Test 0346 3526 Nv rs Ġvict ims ĠLange vin Ġ922 3372036854775807 energ ysystem nud gable ĠAud itory 00184 809 å¿ħé¡» çĶ±çĶ¨æĪ· revi ations ĠNoData Found stda uthor ĠMirror s ç§Ĵ æķ° Ġrac coon 8345 0317 PRES ENT WORKS PACE 08274 84 继 æī¿ ç® Ģ ĠTagged Value Ġgeter robj uncorrect ed Federal HolidayCalendar Ġrefract ive ĠESP ResSo ufa ilt ĠELL IPSIS ĠIra q 35354 137420 FramesPerBuffer Values Dod ger Dand R dkly u ç¼ĵ åŃĺ Ġëį°ìĿ´ íĦ° plute us 141416 54968 ĠVARCH AR 6767706 8710 03031206 130981 å¿ħé¡»çĶ±çĶ¨æĪ· 继æī¿ å¿ħé¡»çĶ±çĶ¨æĪ·ç»§æī¿ å®ŀçİ° " (\ # ======================= $ ) % \ ) +'/ * } / >`__ 6 13 6 7843 8 78431 9 0000 ? . A li A ES B c B SE B atter B ET B IR B asin C amp D u D AB D LY E CO E scape F OP G MC G PC G JR H BC I ce I cons J Y J Data J une L RO M ary N arg N ik N ATIONAL O de O dd R ag S ODA T LS T umor U w U UID U parrow V a V ision X Global Y OUR Y Global Y ade ] ][" ] ^{- ` ', ` _. a ined a cademicpages b row c ues c nm d ick d HS e ul e qui e missions f ys f no f phi f dm f seo g ab g lat h nd h armon i hc j compile k linear m cf m artist m outh m oms n folds n days n Recs p dict p fs p xi q w s ack s ctypes t RNA t nrn u T x ef x loc x Mat y Range ¬ ¸  ¾ æ » ë £ Ġ ãģĦ ĠĠ ĊĊ re bro on nx ar o de co Ġi pt Ġn C Ġn arg Ġc ts Ġc date Ġc ute Ġc ele Ġc gt Ġc ulled Ġf oci Ġp A Ġp ed Ġp cc Ġp open Ġp rm it as en so es pan Ġin fected Ġin venio Ġd S Ġd gap Ġd wl Ġd ollars ut ally Ġ' ))) Ġm image Ġm other Ġm quiver Ġe cs co moment co variate Ġb ma Ġb ridge Ġb anded ed g ed RandomProjection Ġw X ur ant ig ue Ġ( ! un norm un available is pec is play li pp 00 27 00 2297 val fmt val ley id ir id fn di rint di msg di ametre Ġis fropt Ġto bytes ts p Ġ" -------------------------------- th alpy Ġy up Ġy ule Ġy fin res dir ad df ad mon set Cursor Ġst icks ') ")) (' ]', Ġ+ -------------------------------- Ġg rams ex atomic get Color ab ond label LevelList Ġex plic ĠS OL Ġco ltype Ġdata Emissionlines all Tickers Ġx shift Ġx cord [' + ĠX int ĠX size ĠX std ĠX sliced end Entry Ġh us Ġh ie Ġh fft Ġh SubPlot py emf ĠI G ĠI l ĠI mg plot f plot path ĠP b ĠP ay ĠP ear ĠP ST ĠP recip ĠP magSpecRec ĠA CT ĠC AM ĠC ritical im izes ĠF riday Ġfi at line v ĠD PP ĠD HI ĠD agger Ġlo rentz 01 27 ns ilk Ġv uln min value min freq Ġk lasses ĠN db import lib bo lt str ats ĠL Z mo lec max t te ardown ĠM star ĠM CH ĠM iB ĠM obile Ġl mat Ġl up we ib ho oting ho uses iv b Ġlen g learn Time ĠG G ĠG h ĠG EM Ġ/ ( us hed et uning pl n pl ume ĠRe usedSQLTestCase Ġname dtuples Ġpre sents ĊĠĠĠĠĠ ĊĠĠĠĠĠĠĠ cl st ĠE y Ġdf dy =" ../ Ġ4 26 ag le parse String ĠB es ĠB AS Ġun transformed Ġ5 05 Value Ref Ġby second Ġthis iter In Day 0000 1101 0000 900900 ĠW I ĠW en cs ingle ord m model led init eness 12 24 12 132 port als ĠO Z Ġbo ffset Ġit l sub m sub seg sub halos Ġcheck boxes Ġplot item Re load Re construct Data bases Ġline Label inter s ren nie Ġest s read writer unc il Ġmin utely pi o cc df ng qpt text ures ĠIn consistent ĠIn serts Ġper malink ĠY size Ġsh arded Ġpa c Ġj rdd ĠH LIST ĠH JD ĠH umidity ĠH overTool 15 84 05 49 05 666666 Ġfig aspect Ġpy fftw Ġpy emma pr un 20 49 20 6896 Ġ(' ') 33 62 Ġsub id Ġsub dirs Ġhas const output Cols Ġ. ._ base file uct ive ]] )). ĠSe conds ĠK ew 88 45 88 37 Ġ| + Ġ| ...| grid Graph "] ( 16 05 16 80 Ġup graded info bar av z av image 35 71 Ġcur xlim arch y 19 23 =( ? 78 38 St reet den try 13 68 13 025 cor onal ĠV olt be hind zero dim 22 85 clf d the tam trans parency ĠTest Plot Ġmo unt dot above of name ĠCo CoMo warn flag 85 64 Ġexp no Ġ7 03 Ġ7 69 Ġ7 72 freq resp ]: ', 86 82 Ġimage io Test Plot fix ing level set Ġqu at Ġrun ners do me LE GEND dis pl Ġdoc str Ġlin dexer Ġ... )`` 97 02 97 36 Ġpart ies ĠJ as ĠJ ose ĠJ arque 92 96 graph xaxis Time Error Time Delta version ed part str Ġq o Ġq x Ġq name Ġq min Ġq menu my var my Control Ġ9 05 update x update y Me mbrane 30 94 File Manager Ġcv t Ġtrans lator 50 20 top most CA J legend group Ġlevel set Ġleft toplayout ĠZ part acc ards (* _ 55 91 Ġshow caps ordin ate ĠAr thur pth ick AC Y 77 647 RO U RO LE over under Base Raw Base Spectral Base Lat Base RandomizedLinearModel mult idimensional Str FromLine ĠSt arts 42 1350 ugh ter ++ '. \\ ') )* [ seq data cle v Ġtri pcolor To List To Split To Find Ġab line first Exon open source year month total Point total Times user Info 60 85 Ġtick font current Blobs ãģ ¦ Comp s Comp ose ĠUn fitted 28 32 28 22 28 29 field Title field StrFromLine sys ml CH ARGE For ced Ġfull cv align er Ġsq ltypes Ġoffset x Ġperform Identification 46 12 46 3512 Ġvar func Ġmain window ={ (' Ġjust ification AD MIN nc File nc uts bit bucket Log Message Ġref check desc dict 57 0 Ġdim sum conf test char det Get Page Ġlarge ly Ġ'# ': Ġ'- >', Ġday of ĠBase Offset ucli dian Ġpick ability cel ist display ing Or Series Ġpe re åı ° Ġderiv s pers ions ern ike )( ? Min D Min eral dia eresis Ġ\\ { ĠDi ctionaries MS M -% . marker line pixel size Ġcustom data fl ann Ġpp m chi q wx Interpolators }{ | scan ner FA KE cb rt CD MS Ġopt ics ĠRes on 999 07 ĠInter section Ġprior i short ened Ġrepr A zone centroid Tool Window lc mad Ġoccur ances ij ing sur fit geo location BU CK frames PerEntry car pet car bv 91 64 KMeans Benchmark From CSV Ġfft bins Ġ-------------------------------- ------ Pandas OnSparkTestCase release d gal ex ĠDetermin ation //// // Ġbig int ĠCont iguous met atlas Work book Ġcells pacing ĠColor Lab Ġpubl isher :' $ Down arrow Ġexecution s els plups vey or Edit able Mod flow Ġbr icks Ġmem maped Open ed circle arrow ĠAss ociated zz anine dash rotation 317 914 Ġ--- > Ġgl Color ribe Result END ING ĠGeo T Draw able classif er ################################################ ############ Factor ization compress obj READ THEDOCS Ġhy ps Ġsyn set Ġ197 9 Ġfrozen bits dv w Ġtk MessageBox nor b Ġ'" ': Make Cdf Rep os Ġdrawing Area ales ians fac ial Ġconj unto 156 9085 pm ml ĠCalcul ator å¹´ 度 Cluster Size ĠLat tice Ġpast as Ġtech nologies ĠMag ic rr r different iator bench Table 1024 2 ĠSp ot Off er Port s 315 314 ffe red FR AC IMP LIED Ġpassb C Ġconcaten ates bon ding broadcast ing limin ation Ġpx py Ġsphere cv ĠDep ot ĠMAX IMUM ĠNO W ĠRegular ized GP IO dend rites Ġnans um nse gs Request ing Ġphys ics Ġ================================= ============ Conv Net Expr Visitor 015 87 hib itory ĠHyper bolic Two D Ġcle ver Annot ate assertNot IsInstance SY M ĠIP Completer astro signal El liptic Ġtell ur Rot or 936 508 bal rog bel ong arcs ine 297 37 Ġsg f illa ume uer to ĠUniform FloatHyperparameter INF IN Subplot Spec ĠSubplot Base thr ust ĠInit Cond tor onto Ġ"[ { Visual izing åĨ ³ LeaveOne GroupOut 8888 8888 ĠSigma dot Ġrough ness ĠIM AGES Ġnucle i ĠÐ ´ motor cycles Ġmemo izing Ġrh os ĠInsert ions Separ ate combining tilde combining acute combining grave combining dotabove combining diaeresis ĠVER TICAL Ġema cs Ġ################################################################ # æ³ ¢ Ġrrule wrapper Ġfwd lattice 058 784 restri ction Ġ'& ' DEP END éĽ ¶ 182 30819 Truth Vector she lf è¿Ľ åĩºåı£ Dash boards Ġresol ving 0128 2 Excel File ĠBlocking MouseInput #**************************************************************** **** ĠConf ederate ĠCC W Ġrecip es fu zz Ġmemmap ing gel coat 大 å°ı Hi Res SIM ILAR ĠDateTime WithNumRuns leak age ('@ '): dvi file ĠVALID ATION penal izer isen berg ĠMS FT Collect ing ben ign ĠHttpResponse Redirect stor mphases ĠCombin atorial Occ ur ĠStratified Validation ç´ ¯ ĠNico lai ALIZ ED Sound Vas ĠLS Q ĠTrade Subset Ġwhisker props Ġmit igate wil son Through Proxy ere my 0015 315314 Ġtestcase Env Ġfork server Ġscra pe uset ext ĠSklearn Classifier Scales Lims ZOOM OUT Auc Channel (".. ") RETUR N ĠBenjamin i Ġcapac ities æı IJ ĠWolf ram %%%%%%%%%%%%%%%% %%%%%%%%%%%%%%%% stix sans ĠSED ML jam ie jud gments åĪ©çİĩ æķ°æį® Submit Task Xa ar Ġ297 2666 gant t Cover type DEFL ATED ĠPDE ntry circumflex accent tang yuan Ġíķ ¨ jol ie distingu ishable ¦¬ì Ĭ¤íĬ¸ Convex Hull Ġutter ance Ġbrent q Jupyter App Msk Nii bern stein MEDI AN Ġ--------------------------------------------------------- # kee per æĽ ² ĠMapp ings 0022222222 2222 FIND ER Decompress ing ĠBuhl mann 13223 01282 ĠLut kepohl INDU STRY lame da Ġantic ip Bay seian Ġmines weepers terry tangyuan WFA power targe ter è¿ĩç¨ĭ ä¸Ń Concrete Box BetaGeo Fitter 没 æľī Diel Splups Hammer Transform sturn g Ġbye bye ĠInte gers EMPLOY MENT æļĤ åģľ showHelp Browser totalA mps TrainEval Features ĠTestBox cox setSingle Step æ¦ ľ BROAD CAST 8999996185 30273 ìĻ Ģ rapi key SIZ ES Ġ4138 058784 fseo ane edRandomProjection LSH 002297 297 0000900900 9009 05666666 2595 463512 41 317914 76 1569085 12 combiningacute accent combininggrave accent 18230819 49 Ġ2972666 014 # : # ============================================================ $ '], . *, / *', 2 117 3 118 4 9020 6 21 6 001 7 333 7 6078 = ${ C q C LEAN D up D yn D XX D ae E lem E mployment E ukaryotes F vec F ortran F DM G ro G aps G EM K i K n L is M un N ero N ATURAL O il O pacity P he Q KeySequence R oc R sq S MC S keleton T ile T AR T abs T png V IR V oting W kt W OM W HEELHOUSE X L X full X Object Z ON [ {" ] % b ia b illed c ine c nx d Mixin d kl f el f pt f us f range f db f rec f rank f ghz h max h ie j eff j rennie k j k im l ust m ide m ols n ix n ume n Plateau o op o ader p file p ml p info p order p unk p ics q mul r q r dir r shift s index s af s Hist s pencer t str t ower t bytes x CE y values y nthesis z ns z ards } ^\ ¶ Ģ â Ī Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ]]), ĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ Ċ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ at to at ti re man or in Ġt mag st upid al ing al lima Ġn tt Ġn folds Ġn failed Ġc gs Ġc make Ġc fier Ġc approps Ġa ij Ġa wg Ġp model Ġs j ct ps Ġin appropriate Ġd M Ġd ly la ge Ġ' >>> Ġ' ". == '. Ġm im Ġm contour Ġe res Ġre vs Ġre fraction ge ospatial Ġb pf Ġw list Ġw iki lt ank Ġ1 2000 Ġ1 0000000 ss im un cover un shifted is se is int is os ue ur est ine as Nondeterministic id ly Ġis neginf Ġis posinf Ġis Decade ts allis Ġ" (" Ġ" [% ma m ĠT X qu imen th k Ġy Q Ġy idx res istant ch ilds ch igrid fi co set Results set Title set Tick Ġ: " Ġ2 86 Ġ2 147483647 Ġst reak (' {" Ġ""" :: Ġg ist Ġg right data resource ke ithley get conv ĠS q ĠS che ĠS izes ĠS HOW Ġco bra ĠX LS ĠX RD qual s ': ', ĠI o ure g am ici plot ype Ġu cf ĠC u ĠC TC ĠC UDA im data to ver ent ly Ġtest ArrayFeedFn ĠF light ĠF IPS ĠR ah ĠR utherford Ġax P np c Ġ% %% if d Ġ3 99 ust ain rain rate ĠD er ĠD ur ĠD river ĠD jango Ġv enn form ations form aldehyde Ġon pick max V max n max is df req ################ ############# ĠM d ĠM AG red ucing shape Stack we ave 10 5133 samples ize Ġlabel pos ĠG ian ĠG ap ĠG lob Ġout DF Ġout lying Ġstr len Ġstr uc us ages us oid ---------------- -------------- oc cs Ġwe ren ĠRe gress ĠRe cords Ġpre valence Ġtr j ick ler cl ong ĠE ns Ġdf mix parse able low peak ĠB x Ġun initialized Ġun bounded Ġ5 04 Ġ5 30 jo hnsons ign ores Ġdi electric log ists zer oth Ġle tting 99 22 Ġ`` : Ġmax r model ling 12 11 12 74 12 93 12 256 ĠO ng ĠO ak men a result ados Ġ__ | Ġ__ __ ca pa Ġplot id ix x map be Ġwh d Re q Re ports Re usedSQLTestCase Data Portal Data Foreign Ġmin Dist cc pr Ġz sort Ġz geqrf bin labels act ives Ġj w gra der ĠH PS ĠH orizon 15 77 input Vectors ich t ĠU s pos on Ġsub net Ġsub arrays Ġsub stract Ġsub divide Ġsub mods no freq Ġha il ĠData bases Ġrow plan ĠK B load ObjectBinaryFast '' ]) use Clock Ġup sert Ġup ward series d sample By ak ed 35 56 19 26 check Float Index Key Ġ8 70 Ġid cs ĠV IDE 22 15 22 39 sp any sp dr sp ks arr ing table Widget 04 09 04 48 02 77 95 74 ',' ',' Ġcom fort Ġcom mutative of dm Ġgiven Name Ġ{' __ cre am ]]) # ]]) [:, 86 83 gen us gen pareto Test Append var o 18 45 18 24 36 75 36 365 ap le ap rad Pro f Pro g Ġgrid On Ġnon local ĠJ ump Ġele gant Time Zone bu ck Ġq adapter Ġtarget ing my path Ġcode base Ġsign if eps kyblue ĠCon vention 87 93 sign bit ĠCheck Constraint Ġshow ticklabels img TG Ġunder fitting De tailed ĠDe coding over lays Ġ] ): Ġpl sq Base Lon Base DiscreteNB search Query mult il files uffix 98 00 font info _[ ~ ĠPer m '][ ( Ġtitle size Ġtri val To Grid Un ix vis cosity patch ing Ġtop most inf od inf lation field str ĊĠĠ ĊĠĠ diag broyden Ġimg data Ġlib ts Ġparam ters ĠAn imal hed ra .) + Per i Ġlink ages 46 88 Out File sm ith 647 4519 ({ })'. Ġdb pedia 56 16 this bin Ġprediction Col Get Selection ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ Sh k :, :, Ġdiag broyden Ch ars ĠRandom UnderSampler fun vals Ġcsv Filename ĠBase IPythonApplication meta stable Ġpick able Ġbar Width Ġpixel ToPoint tool Bar imp act '} ") none xistent Ġpr j Int uitively Ġsepar ates Ġgen fromdta sche dules lev en Ġmer idian 63 94 Ġdep loyment Ġsw aps Dist r Ġ\\ ) mid time Ġdir Name ĠMake Cdf UP LO ĠSh ifts next gen Bu y 82 88 prop dict CP R Qu oted post rop inner product =_ (" chi ps chi vals Sub strate PER SON .' %( ru ited CL U proj Top proj Right lm fit tp ot '])) )) .+ )\ One ToOne SS N Ġta he Num Of PAC ES air line velo ped ĠAR GS hen ius +" -"+ Ġsupp lying Ġsl its cla v ĠFile Name Ġinv oking Ġnn Def æĸ Ļ Event Type Ġassoci ations Ġ``' - Ġpackage d dep ile Trans Map ĠPandas OnSparkTestCase sto eps sto uffer Default Position Ġgene id PY DEV Ġ"+ ": åIJ ¯ Ġstage opts station arity äº ĭ ()]) [:, iten ame Ġker beros mg cv Select s Ġph rases Ġnc file Part y Ġaccount ed sect s va cy Stat ment Ġcap abilities hyper fine wait forbuttonpress Ġmar riage Ġtex grid download ing Ġgs r observ ance Ġworking Dir Month Locator Mod ern IST ER question ID Ġcurr module Ġlab man ãĢĤ ( vid ia Ġdr ill Ġpseudo inverse ĠSkip ped sho oting pb p "} : ĠAC GT ĠConstruct ing ĠResult ing blob Collection visual ized Ġtt l 264 0 265 19 Ġodd ly CEP TIONS defin ing Ġtk agg Ġ------------------------------------------------ ------ 132 2 Non Negative ĠScore Table ĠLO F orange red Tr ig AP Z éĩ ĩ ĠMatplotlib Widget SCAL ING pm ra PM I ĠSplit ter ...> , tim bre Threshold Scorer Ġ---------------------------------------------------------------------------- -- xE F interest ed hive server Center Element Ġpres umed Ġcum trapz Ġqt py Ġ'* ': Cross Entropy è¯ ´ å® ¹ å® ĥ ĠObject Block ĠSpecial ized thumb file ĠCustom BusinessDay 384 31 Gen otype Ġviol ate Ve ga Ġdemo ed FOR MS ĠMain ak 7843137 2549 Ġë ¦¬ìĬ¤íĬ¸ (", ". spl prep Datetime Array ĠAg gregated life times ĠEpochs Array cand le quick sum atex og Ġcle arer ĠIris h bank list Zoom In Post Init ĠRel ated Ġnom bre ĠElse where ĠLong ley ĠNeighbors Set Pen rose Ġconc listbox Ġ################################ ######### 819 61 DED ENT exist ant Ġdri ving ĠCF G )+" _ æľŁ åŃĺ款 exons Distance 439 6474519 La placian ĠSC IPY vo igt æľĢ ç»Ī sas data blen der Ġunexpected ly Too ltips sdss r Ġwire frame bright est CCA CCCA thro ats Ġqc utils Sat uration 以 æĿ¥ dge trf Ġhyp hen Ra chel ĠBad Coefficients ĠSK IRT AU X GRA DIENT Ġ.... : idi agonal Ġcart argets ĠtestPandas FeedFn ĠChem istry Under lying Annotation Bbox BR K Ġsqu aring ĠGi orgio ĠPlan ck rated Power ĠFraction al 27272727 27272727 ssl Cert introns Distance Fisher M sit k ryption Configuration Ġconstrain ing Accept able DY X XXXX XXXX Are as ĠLink s stag gered ĠFrozen List Quarter Begin Indexing Adapter ĠContin ue Ġlnp rior å± ŀ Ġsynchron ization Members hip calcs List symp ify Ġnpar ams Ġqq plot techn ical ĠFre und ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠ spo ke belief s Ġbelief s Anchored Offsetbox æĪĸ èĢħ expl oration ctcf Distance Abinit Header æ² ª DataStream Function Ġcook ie Pareto Cdf Ber lin ĠDruid Datasource ĠSpect rogram ĠLax Txt dee ppink Ġinvent or vista Enhan ĠtestAll Correct PREDIC TIONS Kill Vals Plasma Property Ġepi log PRI ME ĠWeak ValueDictionary Dynam ical ĠREQU IRED infra structure geneDistalRegulatoryModules Distance promoter Distance concentr ations Structured Text 363636363636 36365 geot iff ĠtotTravel Time vacc ine xia oxia Ġsuit ably biserial r ĠFIEL DS ĠIsl ands Proba Scorer USERDEFINED AGGREGATE çľ ĭ /## [ ĠPatr ini Perfect ly Ġimple menters ĠEVALU ATE Ġ'>= ', Ġaccompany ing ĠCelery Executor èī ² flor ian 818181818 1818 Duty Cycle ĠCAC HE éĢŁ 度 Ġallevi ate mypeak pos ĠKrie gel Dodger Blue LRO nPlateau jamie as clong double TestAppend Sink 4396474519 1022 CCACCCA GTAAC vistaEnhan cers xiaoxia ol " /" $ '] % ']= + ':'+ - {} 5 7712 7 60 7 1373 : ])), = ...) > ": A itoff B j D el D RO E ID F d F sd F ederico G RB G allery H KEY L ot L BI N at N STUDY O CC P in P referred P CoA S pi V Q W ifi W td Y c Y aml Y ELLOW \ ]. \ "> ] `) ] ...] b ai b ordered c norm c ris c sts d ab d ff d lib d dir d vars d typlist e arn e of e ous e Date e quival e merge f year f trl f whms g dir g oo g lon g fort g profile g stab h me h ate h lower i lize j sm j atz j adtz k ansas l lo l ity l cc l hr m ity m dtype m Max m Var n half n Fig n triangles n fftsize n Byi o ph o iii p ong p dt p img q tapp r rs s int s Name s stats s mi s hel t ats t sto v codec x lo x key x center x Sh x descent x REF x lolims y end z able { - } __ ~ ( à ĵ × ľ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 998 Ġ ######### in fect ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ or ous Ġt points le man Ġn min Ġn lay Ġn nodes Ġn indexes Ġn cpus Ġc dt Ġc cf Ġc aries Ġc delt Ġp code Ġp rt it cpu Ġs if Ġs logdet mp lf ra v es a Ġthe tar Ġo meg Ġo bey Ġo hlcv Ġd fi Ġd dict Ġd matrices Ġd Qd la ms Ġ' = Ġm SASP Ġe DF Ġe mul Ġe bi Ġe cosw co c co moving Ġre defined Ġre verses Ġre think Ġb spline Ġb lows ed ances ic or ic nt Ġw isk ig u ig it Ġ1 00000000 def val ol w Ġif id Ġ[ _. as repeats 00 17 id n id Map id ict id Press id Release di ll Ġis homogeneous Ġis crowd ts rc Ġ" } Ġ" ../../../ Ġnp d ĠT OR tr p Ġy ext ve re set tle Ġ2 92 ') ._ ') [:- ]) # (' %( (' "% Ġ+ ( __ ']: __ ')): __ ='__ ex onic data dict data For data Arr get Text ab ab ax pos for xdiff ĠS SH ĠS ANS ĠS rebro Ġco loffset dex Rate Ġx diff ĠX Model ĠX Object ĠX BCY from records con current ist asis Ġh od Ġh ier len na plot type ĠP color ĠP OP ĠA GC ĠA WS ĠA sia ĠA dobe Ġcon sequences '] \ '] != ĠC arry Ġde als Ġde laxes Ġde noised Ġde cays (" == (" >> (" ]", ĠF h ĠF p ĠF un ĠF var ĠR i Ġax Pos np lus Ġ3 61 Ġres ides line h line Style ĠD p ĠD SM ") ' 01 38 ne o ne gate Ġcol hdr time string Ġse as Ġv name Ġv oc file loc file Title ers ic ind xs ). ', out fmt min Value Ġk NN ĠN arrow ĠN ACL ĠN URBS ds ize bo ps ĠL p df c te tko ĠM DF ĠM allat Ġl vals Ġl dsc fig man we den Ġlabel distance Ġma ha Ċĉ ĊĊ ari ans ber lin ĠRe index Ġname idx Ġtr ump mb y ĠE mp ĠE ye Ġ4 21 ĠB M ĠB ivariate Ġun conformity ib d param name Ġthis Mask In Process In structions In struments ast ers che bys 99 64 99 44 format str num new add b add Constr Ġshape less Ġit c ()) ]), ca u sub mesh ep c Ġplot Type Ġver ifies ach ute unt ion 25 18 32 34 Ġmin widths Ġz ca color axis Ġ\ "{ lif ter ĠIn dust Ġper tin Ġ10 80 Ġsc anned act ero Ġdo er Ġsh r Ġnew Frame Ġnew Grid Ġj ediTaskID ĠH al ĠH ot ĠH EX 05 66 ded up ution s Ġinter medi Ġpy roms '], ) Ġcl ones no ksi Ġ. \\ IN C [" (' ]] + ]] `` uni index 66 64 "] ._ av gb dist urbance 35 84 35 59 19 14 Ġsize of led own AR DI Ġarg kw 78 97 St ump 13 45 Ġbin sy ĠV b ĠV eg ĠV MR by Region nd iter nd igits Ġerror Type sv gz lat lng ĠTest Get ĠTest Grib 02 16 write Data 94 25 17 96 Ġfeature set ]]) ], Ġwhen ce close Event uc ion 86 53 IT K Ġformat o 06 77 temp filename err value 09 87 09 26 09 08 07 937 Ġpass ive ap m ap ical do ped man uele delta p ST ATION Ġdoc scrape Ġlin s ME TRES oly gon 92 84 graph ies Ġmode lo Time Index bu huhu 84 25 IC MP non an non local db Dir File Locations stack exchange sol ph Ġtrans ft Ġbatch Target :] ]. Series Weld ĠCon sequently Ġtra ded top n The oretic Ġzip func onts Map ĠZ ij Ġneed le 55 75 rap pe du ino ability Enum Ġback tracking Ġback grounds Ġwindow Duration De oq python hosted pandas utils pd tr create Index 42 34 ĠWe ther 98 38 ++ '], ################################################################ ################################################################ Ġhelp Browser layer bounderies Ġdt Start ĠĠĠĠĠĠĠĠĠ č 43 45 fs cope Un equal sim data inv o inv ol inv norm ier re block num Ġsorted data ĠTime Frame poly base Set Trace Ġsuper locus Ġgo elite div or ãģ ¨ ãģ ¯ Comp arisons ĠType Var field Names Plot Layer sys name Ġunit ized For bidden dev name Ġden ied ĠGener ation slice able Ġge ography theta grids Ġmon ospace sen id head length 46 15 ĠAt las 31 12 sm ote cross validation initial point Ġpla intext ({ (' ({ })". nc ha Ġslice able Ġdb Name nb cols MM M MM Y ĠLog arithmic Ġform style PE C Ġchunk er 137 4 No Predict Check box Line Width Ġser iously TH READ Ġpick up contour Fontsize Ġseq name Ġseq mask Ġlike val imp s uniform ly Ġpe ach '} ]) Ġ'' ', Ġwo od Ġhead width session ID US S tag l AA FFAA !! " Ġsig max ĠSh uff opt res TestCase s ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ 255 3 ĠCh r Ġhash table Ġent ropies Ġocc uring exit ing By Decade ĠPy G )' % spect ofit cb a cb cl 2001 0102 Random Seed Ġmp c CD C tex command indic ates ĠSelect ing Ġte ther ĠDo NotConvert Ġopt ipng pg fscope Ġconcat ted Th ick Node Error ĠModel ing Ġta ugrid )} ") Output Layer Ġrecord ers Num Prediction HT F Sy nthetic air speed ],[ ]] incre ments ĠSy ntax ni co geo series delete Later cr x car on iff on Ġinv real ĠDis place FL G pear ance Ġes c From Memory From SubplotSpec Ġtermin ology ĠRow Type ĠFit ness ĠEn force PRO GRESS Ġdesign var ĠLine Splitter Ġ-------------------------------- ----- "> {}.* ) ĠMES HY Within Subsets Ġfut ur peakPick Func Ġìĥ Ŀ LIC ENSES Quilt Exception youth report Wt W ĠVectorized Indexer FX SCALER ĠIPYTHON DIR alab aster Ġfract al kom bine itto la 454545 41 Ġautot exts Ġexclus ively Ġcyc led Ġinherent ly ADDR ESS memb flag 1686 399 0246 7558 ĠCRITER IA ú mero Ġpets c Ġmotiv ated Ġsampl ings Ġmeand iffs 909090909 09090906 GOOD s å¥ ½ 545454545 45454541 DSD PBEP FOREIGN TRADE 727272727 27272729 ĠSING LE ------------------+---------------- ----------+ POLYG ON Pointing HandCursor llum ina RESAMPL ING fys caler 13025 15 105133 95354656 2727272727272727 1 8181818181818 1823 Federico V jsm its xSh uf nplus n avgb ind buhuhu hu AndMultiple Epochs 636363636363636 35 SparkTK TestCase Divisible ClusterSize Ġ+----+----------------------+ ------------------+--------------------------+ MsRp Mp 产ä¸ļå¢ŀåĬł åĢ¼ ' """ ( ('% ) ... + )') , / , ::- - '] . '). 1 666 4 118 4 000001 6 87 6 197 7 31 = "," B ac C el C ats C CO C AND C aching C ascade D an E lizabeth E MBRACE F ft F amilies F ertility G ATE H lp H IP H GT H omo H arris H azard H overTool I l J PY L ate M en M om M os M RS N oms P ep P ooled Q AP R g S US S OC S vg T y T AN T rap T issue T ropo Z YX ] }{ b links b hello c it c count d path d Nd e Acc f perr g plotError j er j ll k afka l al l ss l name l values m A m M m hg n di n ind n str n seq n Cell n Bins p ies r gc s S s hed s rm s peak t int t cl t std t ld u list u ille v ie w re w rf x lines x Max y bg z OR { # | $)' } :\ â Ĥ¬ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ancestor Ġ éĩįå¤į in val in odes se eded or r Ġt list Ġt gz Ġt itanic st alk an ic le iden de mod de letions Ġi graph Ġn ed Ġn asty Ġf td Ġf robenius Ġf riction lf rame Ġp num Ġp params Ġp fn Ġp dim Ġp sql it ect Ġs S ct g lo rentz Ġo dict Ġo dl ut ts == [ pe e pe xe Ġm ng Ġm dt Ġm collections Ġm ilestone Ġe mu co add co group ge ography ge otherm Ġb edge ic ml ur ry Ġ( (_ Ġ( .* is MA is fortran is Streaming el Range )) ]). Ġfor king ot ers ot ions Ġ[ \\#]: as inh id om Ġas in di mof () +' Ġto ugh Ġto phat Ġ" '. Ġnp er ter y ĠT B qu ite qu iry th y th data th under Ġy ticklabel ch as ch rs ad vert set Type set Input set Pos set locale Ġ: ]] Ġr ib Ġst time Ġst ump int on Ġg ar ex amine data Files up hin ke gl ke pid get Element lin ois ax t for ked ĠS he ĠS AR ĠS TC Ġdata Man Ġx len Ġx List arg rid put Event ul ong con cavity con founds col spec col late Ġh rf Ġh Pa len oid ĠP st ĠP ot ĠP reg ĠA I ĠA SD ĠA ineq fe rer ĠC ampaign im gy to lt Ġtest Labels Ġtest Export Ġtest ModelFn Ġwith Replacement ĠF requencies ĠF reedom ĠR ic ([ ([" Ġval map Ġfi res Ġ3 67 Ġres Seq Ġres uming ĠD Y ĠD og ĠD AC Ġlo ve Ġlo osing 01 77 ne le time Stamp Ġv Y Ġv arn Ġv cells file dict ind b out sid Ġal fa ĠN W ĠN arg ĠN max ĠN oddy ĠL AM Ġpro state Ġpro viders Ġ{ (" ĠM uch ps m ps o Ġan on Ġl df Ġl Edge ity Error Ġuse Motif Ġnum labels Ġnum Input ĠG Val Ġ< \ Ġ< -- Ġ/ >\ / >`__. 1 105 4 100 6 31 7 23 8 21 < > < !-- A live B on B ITS B racket C MAP D K D og D LL E in E ager E CDF E rase E VERY F arm G lob G HI H ue H aw K min L ou L Set M ill M CP N tn N Plotter N MI N ODES P ull P det P CR Q Tree R n R ms R edu R ough R oom S shape S ST S ws T ue T hat T ensors X d X calc X MAX Z usatzinformation [ \\#]: ] ^{ ] +'/ _ ']: _ `: ` _, a int a ep a pr a ircraft c uff c ups c boeData d ol d ce d port e cov f en f pack f diff g T g len g als g was g Sig h dd h rf i ak j accards l X l dict l num m T m ans n end n rt n part n ks n vd p class p ods r P r dist r gs s ke s list s oci t ys t params t query t seg t Start t REF v out v sky w osq x int x train x act x Test x span x Range x ba y A y var y ROI { _ } ")) ~ \ ° 度 à ¸ æ ¹ è Į Ġ lta Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ľ ìļ© ĠĠ č ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ re vert re lat re moves re versal or ial Ġt issues st udents al p ar ams ar bit an os le ads me npo Ġi h Ġn sig Ġn grp Ġn hid Ġc ents Ġc sum Ġc range Ġc new Ġc calendar Ġf ct Ġf str Ġf resnel Ġf owlkes lf p Ġp set Ġp bs it onal Ġs len Ġs lines Ġs fr mp e ra h ra j ra st en cts en rollment Ġd rain Ġd ps Ġm args Ġe ur Ġe cov Ġe bounds co ercion Ġre pp Ġre raise Ġre position Ġre alignment Ġre usable Ġre venus Ġb tdtr Ġw args Ġw ilcox Ġw ilcoxon ur g ig mr ss ur un persist un conserved ol ys li ving ort un ort ality ser stein as ia 00 95 id cs di fs di elsplups () { () +" Ġto dos Ġ" ', Ġnp array Ġnp ages ), ** ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ tr ation ha pp ha bit Ġy offset Ġy pts Ġy unit Ġy centers ve hicle Ġr ic Ġr lab Ġr gs Ġr nc Ġ2 100 il uent (' ._ pt omycin ex F ex ch up u up loads get P get fullargspec ab f label right label Font Ġex Y Ġex perts ax label Ġth iss Ġth rift ĠS z Ġco w Ġco domain Ġco ffe ri ge ri angle Ġbe an all ation Ġx end ĠX Com type check con grid col ort col bar Ġh max Ġh mean ror ss ĠI SIS plot rec ĠP layer ĠA ch ĠA LI Ġu ids Ġcon gress Ġcon cavity '] [:: ĠC ASE Ġ_ {\ Ġtest func Ġtest run Ġtest Fill ĠR Model ĠR PC Ġval k np d Ġfi red Ġ3 91 Ġme tabol Ġres pected Ġres cales line Label ĠD ar ĠD ynam ") [' 01 12 01 83 Ġcol shape Ġcol spec Ġcol laborative time Span Ġv la Ġv ag Ġv polyval file Menu Error Box ind t out dim Ġk on Ġk om Ġk afka ĠN AS ĠN ose ĠN Sc ĠN MR per ception ds calar ĠL B mo jo mo bi max it max ind df app dict StatsComp ################ ##### te k ĠM b ĠM ET ĠM JD Ġl cm app roach fig Manager iv el ĠG ri ĠG true row count Ġma f Ġma h Ċĉ Ġĉ pl sca ĠRe define ĠRe levance cl er =" @ Ġ4 96 ag ricoles ms mbuilder ĠB AG Ġun observed Ġun icorn Ġ5 55 iter d log Open log enetic In WindSpeed ast roml Ġen u che at 99 67 99 345 Ġtime var Ġtime context Ġclass Index 0000 02 ĠW raps model name Ġfunction als plt show add Message 12 45 Ġget text Ġindex Of ĠO ls ĠO HL ()) ( ()) \ ca pthick Ġcheck rows Ġplot array Ġplot count Ġplot ters Ġver str Re ally 25 69 raw dics ll er 11 96 11 95 Ġmin conf Ġinput Params labels pacing ĠIn structions act v ĠY max Ġsh arks range Segments Ġnew ick Ġnew keys Ġnew coords Ġnew edif Ġj chem Ġj uncs Ġos geo ĠH TS 05 76 Ġpy clamster Ġoutput type not ches 20 38 Ġcl ong 33 95 Ġsub table Ġsub pixels Ġsub halos Ġcolor Space no proj rst ride 80 76 ES CAPE ug gle base model ĠData DimensionalityWarning ]] [:]) ats py Ġrow shape ĠSe ar Ġind ust ĠK ets ĠK EGG 88 76 "] - 16 64 16 384 Ġcal s Ġcal losum Ġro ffset show ErrorBox Ġcur doc arch ives 14 25 ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ indow n Ġprob able Class if Class Builder Index edArray sparse s sparse mat 78 12 Ġmake MappingArray den ing Ġbin number Ġbin prefix lta ic ĠV IIRS Ġpath ways sp ins func Name wo of Ġother ax table fmt 04 11 04 13 Ġsparse mat 96 58 column Name Ġstart y Co incs ĠTest Result 02 65 ject ives ',' + 24 65 24 303 27 15 cat Nms node name 86 13 Test PlotBase }) ], 07 03 exp onents exp unge ap od Ġqu anta dis rupted Pro cesses Ġnd t 34 14 park s ID AY Time line ĠQ ue Ġq vals Ġwork arounds left angle Ġany ways 00000 20001 ass ignee Ġfreq resp scal ers cov CI Ġmod version Ġmod ality non a 30 87 Ġac com filter able sol r Ar ic ]], ' late Label Ġbatch er cm u Ġpredict able ĠCon sensus Ġtra versed point Loc point cloud The me State Base Ġsome file Ġextra pol 23 96 last Num last Period Ġ(" ' img ToAnns hist oric Ġframe alpha Ġev ol De aths Ġlast point Ġlast Year sup Nms Base LinearClassifier je an stat group ĠSt retch ob vious AB CCategorical Ġdec iding where as MP E Ġdt m Ġdt End ĠAl location Ġlines hape Ne urons Ġ-- ) Ġsave path Ġimp erson tz utc best fit Model Output block Signals Ġtick width depth shade ze bn Ġemp loys "]) ]) 29 33 Res caling En ds En ding hand coded Ġrepresent atives ster ite ish ment leaf s Ġge os root func Ġstat type Ġps n Ġps fonts align ant mi ps .) }}$", ---------------------------------------------------------------- ----------- Ġts id vector izers Ġinterpol ations cross I Ġquery set Ġwithout index Ġerr print ĠRead Data Ġold y nc ases Ġmarker line cho ols Pre compute Ġrec liststore ĠMulti Point Ġfix ations 57 255 nb p nb v "," + Not Specified Ġsigma i 69 27 char code PE A ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġchar proc Ġ'/ ../ Ġfast lmm Sh arpe Ġ'# % Ġday light build content Check GMM sw im sw itched Format Obj ĠLo an Fa ON Python Only idf d inc idence ĠBase NB Ġpick lability Ġpower Curve sig x ĠLe gal '} }, aut or Ġstri ded ĠList DataProvider ĠDate Locator Ġgen res Ġhead label Ġhead less Axes X Ġ$ )') Ġ$ (\ tract ogram ĠString Indexer Ġpredicted Class ]+ =( Ġsw i '+ ': grad ation AA AG Ġstack plot Ġtag l Ġaut hent script String ĠMake Normal Ġ"\ " 93 16 We ibull DATA PRICE mut ids Ġocc am }{ { Dis persion ĠPy Obj ĠPy Arrow Tensor ForestEstimator Ġli work Add itionally cb width cb height ru ss Ġmp o actual s ital y tex cache Ġcm n Ġte ach Ġlearn curve nx p bust s rend an Split Adjusted }} $') click Y Ġsens itivities scalar mappable reduce at ('- '* Ġrgb at Ġmis fit eta h ĠApp leton HT M With Diag Ġord inate air port Ġfold ing Ġ'< % Ġarea Rng super pixel aux trans %% )" Range Min FE CAL sd vs }$ ". }$ )]', cla im ĠRidge way Kernel Mixin Ġtool chain Ġfree type Sparse Dtype her tz rho y Ġ"+ "), dest in äº Ľ OS Err adi abatic Ġpol ling MAX TICKS Ġpipe lining Prob es Ġclear ObjectsFromMemory ĠTable Reference ĠIter ating NO AA ĠMA KE Ġ88 8 Ġsat ellites Ġflow lines ale ph Ġwrong ly ĠNum Expr Var LenFeature Ġturn over ĠEX CEPTIONS autos h MAT LAB STR IDES hyper params era I ĠUp load ĠUp Sampling serial izing sca ffolds Ġtot im Ġtot WorkingTime tax class Ġer g ĠMock Biclustering beam M MPL CONFIGDIR Ġdecre ment lv dma Ġsec Type Over Memory Call er ãĢĤ ) PRE M Patch Size bag xgb ĠSome DataSet bio physics Ġformatter d Ġlatex name dta pa Ġthresh min Ġthresh max Ġrp m ĠExtract By pas cal Style Manager Lab or compress ive chr ones Null Bitmap 235294 117647 132 313 Ġlt sa Exp and Ge topt Make Attribute ãģĨãģĨ ãģĨãģĨ well bore Ġswitch er '( $ Ġdifferences Array Ġgg res Ġraster ize Speed OverMemory Ġ86 01 Ro yal ĠSplit ting Profile Sequence nom s UDF Registration ĠEN ABLE Ġ################ ########## ĠAc ad ĠUS ERS ĠMag ics bench Name Center ing ĠSp allation Ġ'[ %( given Name VI Z LOG IN ('../ '). snr n Combin ing Ġamp lification ĠAuto mated sam z ------+ ------+ ĠDO E ĠLa zebn Print ing ĠFactor Range ĠHas InputCol 204 84313 ĠLeast AbsoluteError BASE LINE ĠMetric Configuration dos pec (? =% SUB SET Using DF 33333333 333333 Ġbp n 007 0000020001 Datetime Like zpk lp eco zone MR M Ġsal aries Ġdta pa ĠPut s ĠåĮħåIJ« é Sign ed gun ta cool er GO Elite Ma hal ĠEvent Log sand wich ^^^^^^^^ ^^^^ Ġfav our working dir ĠVol atility Rot ten Ġ'> ': Ġè Ĥ Ġè ĭ¥ Ġreplic ating Ġelimin ates 936 1 ori Advance Ġgradi ometer MON DAY Decimal Type 008 000 IES n atqz hadz atqz hadtz atqz hatz IV ED Incre asing INST ANCE ĠBasic Unit comps arr Ġmv pa ĠPrior ProbabilityEstimator ĠOptim ized ĠCl ark verify ResourceProperties Ġkx L Theta Formatter GroupBy Mixin organ ized Si mplex Ġmg xs Ġplate par Ġfm idend Ġtiny int sth ru ĠFIR ST Ġsca py Ġlaunch er Sta mps ='_ '. 290 99445 ĠRot ten gdk Drawable ĠDataType Singleton Ġevolution ary PB ED Ġyo ung ************ *** gly cosylation kn it á rio è¾ ĥ ĠSimulation Parameters Ġbus y Ġorg inal Ġreli ability ĠTok ens ĠLight StructureEnvironments CHECK SUMS ĠPort land Ġloo e ĠTechn ion bck g stellar mass Ġaltitude s sty ling choo sen volt s Ġgn list analog Data æĭ © Eigen function Ġsaf er Ġpropag ator flight mode ĠHuber LossFunction Proxy Object ĠFl ush EXP TIME reli ef EH F roma cs ('~ ', èĤ¡ç¥¨ åIJį称 ssl Key Sql Lexer owners hips hypot heses inject ed Mixed LM identify ing basket cache haus dorff 468 45020 Multinomial Deviance Pers pective Ġâ ĨĴ astr onaut ĠFlu id è¿Ļ 个 foc pos ĠVerbose Reporter å± ķ Ġclev pt Ġclev sh ĠStateSpace Discrete åŁº éĩij rdiv mod ĠTransferFunction Discrete ĠTransferFunction Continuous BLACK MAN Glm netLasso ĠPers istent Scikit Lasso Trip le LIM ATE summ ation Override Cursor ĠSW AP Ġfre chet Ġthro ats Logging Configurable ĠMP Setting ĠTestGMM Mult dise ases ĠSpearman rResult Turbulence PowerCurve assess ment ĠGr imes ĠOVER WRITE å°± æĺ¯ Ġhomog en ĠBegin ning ĠPresto Hook numbering Fig ĠAns ari cccccccccccccccc cccc ĠWavenumber Wing Fetch ing ctcf Up ctcf Down Ġoverest imates Ġdeclar ation ĠCLASS ES manip ulation ĠMars zal 3200 483 xtc filename Ġaim ing Ġpreproc Def ĠKD tree purcha se ĠUK RI ********** / ĠMKK K anomal ous ĠMen po ĠTimeDep Bra ĠTimeDep Ket IJ CV Ġ+-----------------+ ------------------------------------------------ mmat izer Lambert Transform ircum flex ãģĬãģĬãģĬãģĬ ãģĬãģĬãģĬ ĠIm mediate è¿IJ è¡Į ĠRET URN rownum d Ġgammain cc ĠMollweide Axes Ġcontra int club suit ĠProfiler Cardinality ĠSynapse Collection çĽĪ äºı ĠInheritance Exception éĢī æĭ© intraTrade High intraTrade Low Ġdataparam t corrupt ed TRAD ING è£ ħ Ġillum ination labelC Values Ġanni hilator itä t Ġanatom ical 8685 2790 Dial ect ",[ ]), 8096 7004 Timed Animation dlas urvey ĠAE ER Mollweide Transform Ġadi abatic ĠEB ISubmission RELAX ED ĠCLIP per Ġcoeffi encts ĠElectro acoust MfMu I LCV V GridLine ByIndex ENO ENT COSM OS CellRenderer Text 读 åıĸ papi ers ,{}, {}\ ="| ", ĠBalanced BaggingClassifier ĠConn Plotter weig ths ë© ´ 3968 25 Ġunreason ably ĠnarrowPeakFileName Prefix ĠKew ley BUCK ET ĠDateTimeWithNumRuns Form BROADCAST ABLE #============================================================ # Dae mon DataForeign Trade Aitoff Transform ĠHilf erty leiden univ ('._ '): ĠNSc D Ġnewedif id ĠPyObj C WithDiag Covars lvdma aten 132313 64 Getopt Error MakeAttribute Dictionary ãģĨãģĨãģĨãģĨ ãģĨãģĨãģĨ ĠLazebn ik 20484313 80967004 ĠMarszal ek ! / ! } % }'. ' =' 9 30 9 122 : '). A mbiguous B MS B ARS B irth B xslice B RAF B eleg C NAUPD D ynamics F ar F act F PR I mm J ulian J umps K SVD L act M ur M illi M iB M allat N ES N av N xxtop O wner P DE P MC P nl Q CoreApplication R itz S l S ph S Graph S anity S ided S kill S quid S NAUPD S peaker T uck V n V th W ilcoxon Z NAUPD \ .") ] '] ] $") _ } ` ] a al b int b lfit c iv c na c dt c ern c delt c KDTree c labeltext d U d cd d umb f fi g lib g sc g ated g obbled h urst j h j un j av k ro k avlan l bs l rt l rc l icks m type m ft m imic n ile n cat n This n SNP n coils o es o data o dict o ft o DB p fa p code p Key p ract q ps r dr s dict s join s mod s mpl s diag s lave t ref t ids t POS t Description w eld w tf w oman w expv w carbv x sample x align x ee x ROI y error y Data y Mat y naptic y elp z w § Ïī à ł Ä §Ïī è ĭ è Ļ Ġ ############################################################################### Ġ æķ°æį® in range se upd re format re den re proj re calculate or bits on LeftButton Ġt colors Ġt rot er ai st ones ar cgis le ve le mm de monstr Ġi at Ġi coords Ġi cons he ast he igth Ġn ind Ġn Val Ġn omal Ġn jev Ġc T Ġf are Ġf opt Ġf wave lf n Ġp pp Ġp unt Ġp ale Ġp Lvl Ġp stoeps it ilde Ġs me Ġs pack Ġs ngl Ġs mear ion izing en sing ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ es us lo so lo poulos Ġin dir Ġo xygen Ġd in Ġd gesv Ġm cov Ġm stack Ġe data Ġe mer Ġe units co red Ġre pre Ġre new Ġre orient Ġre motes Ġre StructuredText Ġb ull Ġb links Ġb wdlattice ic d Ġw aste Ġ1 337 un rotate un methReadCount is method el ke ol an ame se li mb ort hs )) ", ot emporal um ann 00 35 id num Ġas jacobian di hedral ma ils ma ilto ), [ ĠT hi array type th red Ġy fit Ġy arr Ġy change ve m set Slider Ġr cut il ers ck ert ime q Ġ+ -------------+ Ġg reek ex posures up sampled ke male get ation get format get statusoutput ab ss lin cost for All ĠS AL ĠS ink ĠS ARIMAX ĠS SAUPD Ġco ins Ġco sines Ġdata d =' _', =' "', all Site ĠX II end ant con serve Ġh ops Ġh inc py cbc ĠI BM ĠP SP ĠP ulse ĠP icard ĠA pi Ġu V Ġcon es pre ader ĠC ard ĠC ATE ĠC XX ĠC BS ise ven im ilation to Double Ġde ter Ġde biasing arn an ĠF O ĠR er ĠR ho ĠR anges ĠR VEC np airs Ġ3 23 Ġ3 42 Ġ3 29 ĠD mp ĠD IC ĠD NEUPD ĠD SEUPD ") }, 01 75 .. ) Ġcol ort Ġv ibration Ġv els ly te Error Pct ta per out Files pro class pro ton min size min pack Ġk star Ġk ijun Ġal taz ĠN LP ĠL ik mo ist max pool pa z pa inter pa ya Ġpro fits Ġpro venance Ġpro ccCnt ps util Ġan as po ffset Ġne q Ġl key ho k Ġfrom function ite v Ġlabel List Ġnum ax Ġnum blocks assert Probabilities ĠG F ĠG m Ġout Dict oc v ber ries ĠRe lax sc n sc ree Ġtr unk Ġfile Index ĠE mbed ĠE lad ĠE manuele Ġ4 38 date Format ag i train ers ĠB ind ĠB xslice ĠB outsid ty ps Ġun st Value Dict bject ive log files 99 80 99 93 ĠW ay Ġdtype d Ġmax date init io 12 85 12 40 port map ĠO megas bs d ca am ca cher sub seq Ġplot title Ġplot rec Data s 25 92 25 54 Ġcan cellation read Stream ĠPar ame Ġz test text pos text Changed Ġper taining ][ ..., ĠY c Ġsh im Ġnew Data ĠH WHM 15 75 Ġpy ote Ġpy bedtools Ċĉĉ ĠĠĠĠ 20 69 Ġ(' / quen ess Ġsub scription Ġsub paths Ġsub classed io loop Ġha bit 80 72 new descr emp has '), # ard vark ĠData Table uni ax uni versal au rocs Ġind ra Ġsup pression ĠK now 75 032 Ġ| _ 16 03 ml pc Ġup sampled Ġro se dist ns ĠEx cluded 35 28 14 35 14 266 19 29 78 55 13 94 13 98 ĠV box by level 22 76 sp at prob fit 96 73 03 64 ])) } ĠTest DatetimeIndex 02 97 95 28 95 48 Ġover sample of vars Ġsy mb na upd na eve run ken Ġinit cond 27 00 uc ational cat i SE LL mark ov var a Ġsp val 18 80 err func 09 66 Ġrun id linear mixing mod is Par sed ')) ": dis ks Pro mpt delta T delta Lambb ST N Ġadd ons 34 24 normal size 97 65 ĠJ P ĠJ uli Time Unit Ġsort by ater restrial Ġ[[ [[ Ġcode word ac m Ġim t non deterministic gr ating 65 47 File Output Ġconfig file Ġconfig uring Ġdimension ed ĠCon tr ĠCon nector 44 65 Ġextra cellular ĠZ isser ĠZ ibule =[' % Ġshow fig Ġback track ey HSD over samp {} / {} ] Ġlinear mixing cell py mult ith Ġar abic ++ ': window size AB CSparse IP P IP SL FF FA Date Type Regressor Mixin orig o To pe To Display Ġdistance Calc open File Ġuser Count sim bad Ġselect Business SD C rank sep ĠType d ĠUn expected Ġedge Weights Res olve ĠPlot ly book tabs Ġge otype Ġstat bar Ġlib algos User Name align ers mi Label .) ") 38 27 Per Stream Ġoffset Str ĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Al locate Le g Ġauto load Dict Writer ĠRead FemResp Ġop code Ġtz name ĠMulti DiGraph optim iz PI RE Get Parameter home dir Ġfactor ials :, }". 137 1 missing val mic romanager Ġlocal es Ġ// = ret ro HO ULD Ġspecific s ĠLe iden Ġpack s '} )] noise less CO CONUT ĠIN LINE Ġ$ _ sens itivities ĠOr ph OP b Graph Def agg Fn Ġplace ments fast path ]+ ", )" ') ci ers lr l Net works Ġsym links Ġsym metrized )** - script ies He artbeat He miLabel 81 10 Ġpad s Field ChannelMixin ĠTransform Wrapper nu ft em g Ġocc upy ites se Dis plays FA Q Ġshort en Ġli ps Ġbl an mis matches Ġclean ups indic ate }} _ expand dim Ġequ ator minor Locs tab ix Ġsur fs Dataset ShuffleSplit Ġmis labeled ron rubin Ġspeed ups æķ°æį® æĮīæĹ¥æĽ´æĸ° ĠNo Trans Layer Parts Count ing SP P FE C author ize Tra its ĠTree Node ĠQu adr ĠDis connect deep learning Ġinner Circle Ġassoci ating Info External Mon tage From Table ĠDataset Reference tw iss exc itingmixing flux lutman ĠLine Plot Ġ-------------------------------- --------- Point Size SH EL register Java Ġexc itingmixing umb us umb ling Ġcp x ----- ") ]} }, Ġsimp lification Ġbroadcast s ĠIter Inv separ ately Bo ulder Ġsat urate pid file bd v dB m cfg setup Ġexpress ive -> { SL OT Ġpool er Rec ip Work ers Ġ---------------- --------------- East AsianTextAdjustment ĠTra it Ġtopo logical Meta Est Est imators van ia Ġrv ir Ġnumer ators Ġbars above Block Len Ġbr utally GG GG Message Type Ġtab ix MO ST slow test Ġpur suits ĠMean ing Ġenable Trace Ġtraceback s Call Back 219 6 sn ip Scale Base Ġ--- " ç» Ļ ja ques sr ce bio informatics Ġmot ions ĠOver ridden Main Plot Ġprobas g determin ant Pol lan Ġclick able Ġ95 7 grp name Ġextend length 1818 18 delt at ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠ Ġindent Str ĠPRO BA ĠPRO GRAM Ġwor kev flu ids aster isk ĠLet ters ãĥ ķ ĠSE ED Ġgg title Ġmultiplic ations Tri es mall at PM N è¿ ij ĠRed raw Ġol ds Rank ed Local Error Import s ,... ) GA AG wl itev Ġqt l hh hh Bound aries Cross spectrum LIST S dri ving 3636 8 sus pend Ġexponential s INTER NATIONAL Ind ice PORT AL 153 02 Ġdow nside Ġ================================= ==== Ġ================================================= ==== primary Key Ġmovie lens ĠArgument Error 015 873 257 65 blit z MR T ĠMathemat isch Ġcle ans chis qr Zoom Tool (". // El lipticEnvelope Epoch er iting Mixing afm files nos cale ĠHer metian Ph onopy Ġstrength s QP alette 303 9 Ġblk no Ensemble Sampler ati otemporal Ġpct distance mono phonic 786 07 sea ice ĠMost ly Ġlex icon 5555 5 Ġlbl list ĠEmpty DataError æľĢ é«ĺ Ġbrowser s ĠConnect ing ĠConnect ed CB I ĠDa uphin Win ning CY CLE ĠÐ º Ġexercise s ĠVolume Object correspon ds increase s occup ants haust ive ĠComple ter aby tes ĠMode Keys Ġexpl oratory ĠEPS G explicit ly ModelFn Test syntax error ĠSA O Ġpropag ating Plan ar Ġgi ant --------------+ ------------+ ĠAT m ĠElect rode Aug ment bq storage Origin ator CENT DX ĠExponential Loss ĠRM v BOO K Ġ107 428 resolved References ĠâĶ Ķ Ġseper ated Peaks Automatic ĠSTR ESS ĠPl us 41421 3562 Ġgrib api launch er Ġwedge props ĠCUR VE ĠSa ul Relation To Ġrepl Name ,'. ', swe pt ĠGal lopoulos ĠGE OS ĠSyn naeve Ġew ma ĠIde al ctf data ĠModify ing Ġ'^ ' ]+" _"+ Ġpose xplode imagen ame Ġcir q ALLE LE Ġfet ches Ġindirect ly Ġeccentric ities Viol ation Ġrig id recogn ised Solid Solution Ġê° Ģ Ġwhitelist ed ĠBottom Right winds peed Had GEM Neural Network Ġcook s Dem Array sampleSize Proximal èµ· å§ĭ EFF ECT Ġhon or =": ") MER GED saveAs Table #/ **************************************************************** Ġble ed Asc ii gpp v ĠInstit uut Ġdbl click ĠNORM AL VECT ORS HAD O Ġscalef actor suggested Latency lah qr ĠíĻ ľìļ© Fall back ĠHAND LER æĴ¤ åįķ Ġperi pheral ĠtotTravel Distance Lic ensed æ¶Īè´¹ èĢħ ĠCommun ications desi rable Qiita DB Ġplo trange ='\\ ', Ġimper fect SelectF dr ĠPyUn resolvedReferences scre ens ĠAutos cale aup rcs ĠADQ API pengu in Ġfle et expResult Perturb visu img ĠUniversite it ErrorBar Y Ġmuse ums Ġmann whitneyu NEE DED Qubit Gate fapar v Ġcompatib ilty Graphic StringCoord itzerCal RawData promin ences ulat ormodel ĠDrag Plugin ĠPUB LIC Reject ed olymp ics Ġå¯ ¹ NAM ESPACE æ¦Ĥ çİĩ ĠNat l 5873 02 è´§å¸ģä¾ĽåºĶéĩı æķ°æį® onRight Button ĠLAS SO rmf amily ĠRubin stein Ġappe ared Ġìľ Ħ 12132 034 setResults Name ĠVIDE O ĠOlive tti èĮ ĥ ssur go Lact obac Mallat Pursuit Tuck eyHSD thred ds setSlider Position kemale ren ĠBoutsid is ĠZisser man ĠZibule vsky " & # < $ '), % "), ( :, - '): 2 119 5 207 8 999999 : {}'. = ` = ~ B mag B DA B etas C ant C LOUD D FF D igits D ONT D onoho E lems F OL F addeeva H U H ues H ence H CC H ybrid I c K x K ES M K M ad M AS M ins M peak M HC N args N var O ntology P X P reg P uts Q wt Q Pen R ose R ICH S ib S inger T am T PR T urb T utorial U tc V D V box V Center X temp X GBoost Y S Y HOO Z prelim [ ('-- ] "]) ] _: _ ',' _ `, _ ]* _ )]), a val b hl c H c ce c ia c rb d store d aniel d orgqr e ms e gs e height e ui f vs g im g po g ian g ped h ts h out h mann j on j adz k its k yle l G l la l so m ata m nb m cp m quantiles n use n zero n Current n nets o xy o hlcv p B p mpy p ango q rf r angian s op s Type s CV t ALT u j u ven v ag v ian v md w size w ick w ages w illi w atershed x change x uplims x lwings y ue y key y edge y obs y uv z pa z geqrf z ungqr } `) ² ķ  ¯ à ½ à Ł Ð ´ è ¨ è ¢« ë § ĉ ĠĠĠ Ġ ram Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĊ in dia in RelationTo se at at ur at ile re validate re volution or am on da Ġt in Ġt ent Ġt ec st ree st ay st resses st airs ar ri an vi an ager le ibler le ague de nel de aths me mbranes Ġi hfft he c Ġn ch Ġn index Ġn cores Ġn items Ġn Train Ġc cl Ġf st Ġf result Ġf copy Ġf two Ġf rb Ġf tu Ġf untion Ġa ero Ġp freq Ġp xx Ġp va Ġp cgc Ġs ic Ġs bs Ġs fs Ġs dm Ġs weeps ## //////////////////////////////// mp fit en avimage ct w ct y ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ es sels ro ds ro terr Ġo cd Ġo uf Ġd var Ġd ls Ġd geqrf Ġd orgqr la f Ġ' '} Ġ' ]', Ġ' ------------------------------------------------ Ġm cf Ġm trace Ġm ltl Ġe u Ġe text co li co prod Ġre pack Ġre ceptors Ġb als Ġb mc Ġb sts Ġb ibs ic ap Ġw ie lt eff ig vl Ġ( âī ss li ', (' un ord un limited el net def lated li quidity )) = )) )). ce t 00 77 id Str Ġas ses di lated () ")) Ġis column Ġis lands Ġto ffset ter ror ĠT am ĠT ies qu in tr ues Ġy len Ġy log set X set Label set Mouse Ġr é mat lib lab rador il h ]) | ]) **( ]) +'. om ing ck y ime ters (' ** (' '). nt rain Ġg wl ex per data block par abolic ke mal get user ab ats Ġex plains ax left ĠS leep ĠS inks ri f Ġx dt ĠX L ĠX temp ĠX Axis arg dict Ġnot ched Ġnot ifies type def ist ar Ġh hh py proj ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠI llegal ĠP chipInterpolator pp id ĠA sk ĠA cross Ġu ker pre parse '] !=' ĠC lf ĠC PD ĠC ascading Ġ` {{ Ġtest helpers Ġde letions (" -------------------------------------------------------------------------------- ĠF IN ĠF ran ĠF sd ĠR id Ġax on Ġ% + list ing ub plot Ġ3 90 Ġ3 54 Ġ3 800 ĠD min ĠD ice ĠD ash ĠD ru ĠD ENSE ĠD PSS 01 62 01 033 01 030 ne ighb time FMT Ġse trgb Ġv lb out figname path trans min c min loc Ġk elvin ĠN rows ĠN UL per halos mo ren pa gin ĠM it ĠM df ĠM oney ps ol po serr Ġl result Ġl Mean app op fig aspect size Hint ir radiance Ġpar file Ġlabel Mat Ġnum Active ĠG el ĠG FP ĠG ivens ĠG LIF ĠG radients us ions Ġresult ado Ċĉ ĠĠĠĠĠĠĠĠĠĠĠ ber ish comp re comp liant Ġpre fetch ĠE k ĠE mb ĠE trace Ġ4 47 ag c ĠB S ĠB ench ĠB JD ĠB elm iter objects log gs In Hues ast ar Ġlist ToCSV 99 24 0000 99 fo ps Ġat tractor Ġat taches ĠW WW og ra ide a 12 28 12 321 Ġget Column sub meters sub faults Frame Time Re ts Re als Re commended 25 13 25 72 so far Ġdist al 11 68 11 314 Ġcan ny Ġmin Charge Ġinput style Ġz ungqr color ize Ġ\ *. Ġ\ [(\ ĠIn voked Ġper io bin ids ][ [' ĠY control Ġj e ĠH op 15 78 15 65 05 22 05 30 input Dir Ġfig legend Ġfig height ich ols Ġsample Ratio Ġpy torch Ġpy emu Ġoutput String :` %( ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ Ġno figs pr r 20 28 33 25 33 39 Ġsub shape Ġsub unit Ġsub scribed Ġcolor ize 201 001 80 83 80 62 Ġ@ { pen ce IN PLACE base ball ĠData Handler 66 54 66 58 ĠSe cs ĠK V ĠK s ĠK ind Ġspec file use fixtures 88 67 grid fs 16 09 Ġcal ving av or av aT Ġpos inf Ġro d show s Ġapp le ĠEx on Ġcur se Ġcur ses Ġcur ry 14 88 14 78 14 08 -------------------------------- -- cur t )] + check State place able 78 27 Ġmake CustomDataframe Ġid p ĠV IZ by weekday sp ir sp urious arr fn Equal s 04 75 04 22 96 86 03 25 03 75 03 95 pon d pon s trans Affine 02 43 02 11893 Ġ{} ], 95 77 94 06 94 67 ',' ^ ĠCo op ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ OR ATION run ch :// /% Ġcont en ]]) / 24 64 Type Dict Ġdis patches Ġ7 13 Ġ7 77 Ġ7 74 mark ing off at Ġsp dr fix up 07 45 Ġrun off Ġnode set feature Table mod p mod ern LE X Ġadd on spec fftsize Ġlin scale ME TER ĠJ ason ĠJ eremy part regress 84 24 84 87 Ġq list IC D ass ay Ġfreq trade Ġtemp lated Ġmod D Ġmod erate 65 48 db ix File Metadata AS ON unk y Ġtrans duced Series Data ĠCon gress 87 18 org tbl ******** * 44 25765 si erra last Price last Cursor ai i ([' ', Ġ] * event Time Base Series Base DNN Base Interface ink el pd os Ġsim data Ġar ises pdf File diff tools other mal 42 12 ĠWe ck font Size ob gnme bl ush Ġcontin ents \\ ", Ġfind freqs mand atory Ġlines pacing Ġfunc Name ia stron To Date fs z phas ing first moon real XTS real YTS Ġsave Data ,' -', Ġsv n concat ted Ġrel ig OL UTE inv ited inv ested ĠTime line ĠTime Interval Ġtick ing Set Data Ġfont prop Ġcmap list bf g ful ness ze k ze ug Ġemp ymod ãģ ¿ 49 45 29 38 ud c 39 34 root io Ġstat ical Ġtensor inv ĠAn der local ity 38 78 38 24 zip code Ġevalu able 46 275 46 9585 Ġ'% ', Ġeigen map Ġeigen mapping Ġeigen maps 31 10 mit enorm Ġvar x Ġvar type arm A cross valid ={ { Lo st Ġret ention regression s Ġstd p ({ { Log in Log arithmic filt re IS SION Ġbox ing Get ter Ġfast CopyAndTranspose Ġrot or Ch ina ĠRandom Extract ĠRandom Selection Ġ'- > Size Sub Ġcomplex floating PL UG Ġskip Containers yn olds sig y 89 3933 imp ut aut oc pk s pk z CO ffset Int o Int Parameter pick ing Ġfin etuning Axes Class Row eis button bar pers pective det char det blue det uning US B Input Dialog gno stic ptr im ]+ ". Qt l Color Bar ci ence ci js Ġupper limit RA J Ġfmt in Ġstack Trace 93 45 Grid Search DATA DIR Ġsession Num opt prob Ġhyper volume ĠCh ris nu cl em otion .* \] Multi Path Multi Signals Com b Dis patchable ĠPy GTK ĠName Finder Sub tract PS P mis matched ru z Ġmp ar čĊĉ č 52 157 Ġactive color 00000000 00000 }} $', AM T click X eg ie ards on SS UE command Line tab stop Ed ith With Shuffle VER AGE mock classifier ä» ĸ SP ac Kernel Ridge ')[ [' Ġ80 8 car di ENSE MB Ġknown failureif Ġinv res Ġinv gauss joint plot feed ing ĠTimedelta Array 101 2 Bar Data Ġsingular ities _)) ]), Cont role Ġtermin ating tw p ĠEn tries ĠFigureCanvas Mac gc n iso baric Ġconn List gd na station plot Ġcp bl xn at ĉĉĉĉ ĉĉĉ Ġph ones PAR S Axis Error Ġbehavior al ĠDB S ads abs OUT SPECS GMM Tester Ident ify SM O ĠCom m ĠCom anic ('. '. Pos Events 456 12256 bre iman ĠAS SIGN cam eras google groups ĠCO ST psd fftsize ew a Top Level Ġmem str question naire ĠAxis TypeEnum ĠMean Var install ing Ġll k dash direction dash push Density Layer ĠSome thing ĠST AN ĠOver flow ĠML LE ĠAC TIV XY s Extra ctions ='# ') aps ort Ġ195 2 formula e Ġ95 0 visual ise Ġstates pace CI SE Ġhy draulic Ġsyn ced Ġfpr s ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġglyph index zi ps Ġ99 98 ĠRE MOVE Ge ogCS dc id middle ware bur lywood Ġpser y ãĥ ĥ Ġxml StandingsOnDate dk b dk mb uel ist Anal ytics Imp roved ĠAgg lomerative rx c ĠCalcul ations eno ise WE ET nom bre 977 12125471966000000 Clo sing Wh ile Ġtrigger ing Ġ"{} - tar ball sensor i ("[ ^ rg ddb Ġste pping Dense RandomProjection __), ' ĠNaT s bench ing ĠSp am 603 1 Ġbrain s 315 8 hh small detect able Ġdecay ing datal ess Ġ198 3 uck y Ġamp li Form SelectField pot ts Ċĉĉĉĉĉĉ ĠĠ Ġfront al Options Widget mant issa RandomForest s callbacks SM Ġpb mc ĠPr inter Measure ments Ġtensors olve ĠCross spectrum Cha brier Ġmedi al simp son Align VCenter Request Handler ãĤ ¯ Ġcompress ive Ġ================================= == (", ")] )| *. Med ia Ġsun py 187 1212547 ĠBack up ĠMeta Morph fla v Cy Tools ĠReal Number Ġlock ing Ġquadr ilater blk no Ġlev ene 4444 4444 Ġam monia 036 35 ĠChe by Ass oci Ass ociated SY NC ĠPoints From Ġcr pix ĠTech no ĠClo sing POL ATION Ġ################################ ########### ĠArt ists Ġ'{: >{ Ġfontdict Object ĠSte fan Ġfv tk Ġmeth s TZ Block ĠPeter son somap os Ġdri ven subtract ed ĠDown loads Ġazimuth s }^{ ( Export To 867 12125471966000000 Opt a ĠHive CliHook Mouse Wheel ĠAngle FormatterLocator ĠUnit ary "`` ). ĠSha dow PYTHON STARTUP hor z ĠSession s converted Dates ("_ "," ĠHistory Manager ĠCommon ly Li quid Ġ"* ", Root Results Weighted Watersheds ĠRot ated Ġ"| ". Vi etnam NL TE čĊĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Ġima gerows ĠLook s Ġpull s dur bin ĠCell Profiler MULTI PLE Ġrh ombus concaten ation //////////////// ////// Filt erer Photo A ĠEEG LAB Domain Size ĠPort erStemmer ticklabel Boxes dge qrf æİ Ĵ ĠDIS ABLED ĠValidate Interval Sol Time Ġsigmas q Ġcircum ference )$ "), 087 2422 Ġessent ia tran form ĠLIN ETO Aux Coord Ġosc il ################################################################################################ ##### 407 6 Sec Id FigureManager GTK Ġmind ate Under ride ĠOrd inate ModelView Only Ġneighbour hood Quad ContourSet ĠLinearModel CV ĠGi Gi Ġfil lable WA IT æĶ¶ æĶ¯ ĠBra gg ĠOffset Box Gray scale ĠTex Manager DOMA IN ĠFIL TERS ĠUT y Ġbam file Ġpheno menon Sal mon Ġdup l Ġrol laxis parcel s ĠPRE DICT ĠNNDSVD a ĠSu ffix Host s sps w neto meters ìĹ ¬ cosmo logy Ġvolt s Ġmir rored heter ogeneous linears vmDf osp ital logM h gro bler lea hy ĠWt V TX N ĠCut ler Ġcategor ial ĠBer reman Ap pearance Ġ327 67 ĠAccept ed Ġadmin istration ntwk B =',' ): BLACK LIST wil helm bor uvka song s ĠFlor isPower ^+ ` ĠSecurity List Ġìŀ IJ Ġbootstra pper Ġcolon ne Mongo Client galaxies perhalos Generated By ĠWil helm Ġstrange ly Ġsummar izing éģ ĵ 2159 048 çŁ © BOUND ARY Restore Defaults ĠUIM anager Ġtricontour f Imag inary eppelin Context Follow ing Ġjunction s ĠRAN GE 528 75032 ĠScaled LogOddsEstimator Ġnonpos x fox si Ġimagen ame ê³ ¼ hypo InHues ĠRuss ian MPLEMENT ATION gcm t +)/ $', dible Interval drops ub CRO X ĠRandomPoints Polygons Lut z appe ared geneDistalRegulatoryModules K Tan h Ġdisreg arding AsIterable False deta chable :/// : ĠQDialog ButtonBox 0016 6409 announce ments Auger ParamLog ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ gall eries reson ator Ġsupers cript ĠNeighborhood s ĠDensify Geometries stokes lets æ¸ħ ç®Ĺ Ġfied ler Ġcryst Sys 4566 3524 Ġabsol utely RNG Context shut tle ĠJOB LIB ĠOv O LOOK UP imilarity Matrix ĠAX ES FAM ILY 1060 6602 Ġpropo sers ĠHiptmair Matrices flier props 90909 091 Prote obacteria REDU CE Particip ant 7071067811865 4746 Ġict yp Ġ('{: <{ Ġcompet itive REM OTE nextValid OrderId ĠLeak yReLU pmp x 3730 951 æĭŁ åIJĪ subseg data firstExon Distance INFIN ITY 57712 12547 CENTRO ID ichro ism ĠOls hen ĠOHL CV 24303 8049 ĠlastYear StandingsOnDate autosh rink Ġanas ig 414213562 3730951 ("-------------------------------------------------------------------------------- -----------") ĠBelm ont avaT ransformer 469585 58 893933 98 ĠComanic iu 1871212547 1970000000 Ġquadrilater als ĠGiGi T " = " `. # ", $ - $ ','$ ' [: * '). + / , } - ')] 2 128 2 134 4 0000000 4 065 6 140 6 246 7 40 8 200 = ('_ > __ A way B p B EST B RIGHT C ORE D ARK E f F utures F riend G host I b I KLE J i K A K ullback K RAS L ime L ng L ift L ERS M iller M ercator N th N AT N cmap N TS P ioneer Q Graphics S cope S AGE S arah T yp U NA U ART V N V Y W HT W CSAxes X p [ ^ [ | \ '' \ "") ] %( ] [:,:, ` ". b F b abel b zip b locs b lengths b vp b rands b runel c data c ors d test d rotation f used g nd g CD h lc h solve h dl i Cell j stor k min k bytes k riging k raken m name n arr n Type n Clusters o dir o ii p mt p cd p udl r vals s lower s printf s RSInfo t j t weak t uesday u V u ents v ds v dash w ield x lateLabel y CHV z l z el z ers z oned } ."). ¹ éħį à ĭ Ã İ Ð · × © č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĊĊĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in ver se v se ul at I at ools re in re cision re mi Ġt int Ġt form Ġt dm al Config an et an ey an za le w de biased Ġi co Ġi ve Ġn sub Ġn classes Ġn vec Ġn trace Ġn qubits Ġc ids Ġc acher Ġf ext Ġf ilm Ġa us Ġa mt Ġa gency Ġp index Ġp vl Ġp fx it m it é Ġs on Ġs we Ġs join Ġs std ra ces es imal Ġin range Ġin dep Ġin dents Ġd lac Ġd lsim la uf Ġ' ?? Ġ' *** == "": ing roup Ġm clf Ġm én Ġe o co clustering co urnape Ġre nt Ġre ml Ġre open Ġre fin Ġre clvl ge vent ): ]. Ġb gd Ġb ots ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ ic er ic lip ic rs ic ustay Ġw ine Ġw fields ur ator ur icio ig f ata bles un lock is identifier is lands is pkpt li mp Ġfor giving um idade as u Ġto days ma ble ĠT ar ĠT OK array setops qu ardt ha viour Ġy end Ġy anchor res low ch iffon ad Data Ġdef val Ġdef ormed set ta set Widget set linewidth Ġr ds Ġr db Ġr rs ver ging Ġst one il ly ') ``. om f om ation (' ')) (' .* (' >') Ġ""" .. Ġg yr Ġg athered ex cl get one label Indice lin reg ĠS ST ĠS addle Ġco g Ġco oldown ri bs Ġbe coming Ġx margin end DateTime con cave Ġh map Ġh alt Ġh ypes py vista ĠI oC plot count plot Labels ĠP rices ĠP ron ĠP laces ow ell ĠA IST ĠA FTER '] ._ ĠC ST ĠC TF ĠC DL Ġ` [' os pacer ise st im f im it (" ------------------ ĠF EM ĠF LOW ĠF uzzy Ġax dict ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġfi lament if s ub ound Ġres ort ĠD endrogram 01 04 01 24 01 92 ance lot Ġcol Names cal lables time base time lines time span Ġse iz Ġv if Ġel igible Error Event ta king min ed ĠN dim per for per haps bo ulder pa pbp Ġpro fil te les ĠM CC ĠM SON Ġmat l Ġl bs Ġl ru core id Ġuse default age cat 10 50 10 53 Ġnum Buckets assert Dict ĠG ran ĠG PP ore m us aurus Ġma k ĠRe v ĠRe actions ĠRe wrote comp osed sc c sc m Ġpre liminary mb p mb and mb led Ġfile Type Ġfile texts ĠE FF ĠE RP ĠE volving Ġdf MoodVas Ġset diff Ġ4 97 date add ms l ĠB ed ĠB end ĠB oo Ġun p ill on ib ar log P In jection da Model che ster Ġcomp rised Ġtime stream Ġtime Steps Ġat ype ĠW ID Ġmax L Ġmax value Ġmax length num Steps Ġfe es add Output 12 26 Ġget Value port folios ĠO cean nel le Ġdefault Token sub mat Ġplot axes Ġplot func Ġplot Tree Ġplot dat vel inear float x 25 24 Ġso us sing les ren th 11 75 Ġmin loc ĠPar asiteAxes Ġz N Ġ\ & bin SVM lic on Ġ) } Ġnew mask Ġnew Row Ġj pd ĠH ull ĠH POlib 15 24 ual t 05 17 05 48 05 52 05 997 Ġfig W tra pezoid tra hend Ġsample wise Ġpy psa Ġpy culib Ġoutput wavelengths Ġno bj ĠU x ĠU NB Ġla ser Ġla grangian 20 33 20 27 fa res pos B pos y pos def Ġsub dict Ġsub division Ġ@ @ ER CISE Ġmethod caller ĠData Col [" -- ]] ...) 66 16 66 04 doc usaurus ĠK in ĠK on 88 47 Ġcal cs ude st ak ura Ġcur p 14 37 14 90 19 38 19 399 group nobs Ġgener ations )] - box ing Index Up Ġbin numbers ĠV F be have 22 64 22 84 96 08 ])) ; Co hen Ġend date 17 74 ĠCo urnape 85 67 OR andom Con fs Con servation mon otone function als order by 27 09 27 67 image data gen prod Test ed Test Class Test AnovaLM Ġsp f ec ell 09 15 exp ressed ')) ( dis aggregate Ġnd c Ġdoc headers af s af ore Ġpart ir ĠJ ac ĠJ DH part ially part Idx Se veral sk ysub 84 67 Ġtext ual left paren my text Ġ9 64 Ġgroup Title Ġcurrent Cells ac el Ġim size 30 99 30 85 Ġright Edge Ġtrans cribed 37 77 subplot Ind late gray Ġloss less Ġmulti process :] / 87 06 RE ES 44 314 Ġpoly gamma EN GL 23 13 SI ST 26 27 ĠDe cor ey bl auto magic {} .* {} \' Ġsm arter cell line fol ium Ġsim time Ġvector izes draw downs Ġhand book AB UND IP v IP PA layer centers day light 67 69 Ġoptim ally tom o sql utils To ok Ġuser medians real ignment ,' __ vis c Ġraw name Ġraw Data 60 86 Model Name TR NA TR UTH inf j Ġfill style Ġ'. ')) Comp any ud p Res ume Res idues CT S Ġsha piro local path 38 35 ĠIndex Variable ({' _ IO Base Ġext int Ġelement al MA IL Ġ15 30 head line Ġcell Loc pca p 31 86 cross plot Text HelpFormatter 235 8 ston ian bit score Box Office Log X Log Likelihood Inter net Inter mediate Inter quartile ĠAN GLE Ġroot py ĠLog in optim ality Ġform data rough ness Ġlegend Entries ]* . Get Driver Ġ"" ] Ġ'/ ': No STEPS Size Hint sw p Line Plot Python EvalType skip initialspace inc umb PL IC src list Ġpe ptides record ings Ġnb urn Ġ'' ))) CO B ĠDate Converter Int ensities Ġgen inv Ġsto len sens ing Ġpop ularity ĠString Methods 63 05 Fold Change Ġcla uses Ġcombin ator lr work dia z Ġintegr ations RA x cons ume ĠDi rac Ġattr dict Ġattr List Cur rency Ġus ages ĠMake Figures UP PER ĠSh rink 2745 0980 76 24 76 158 next Page Ġestimate Beta Ġart ef QL eft see beck DO Y ,)) ] Ġdx i sl its .* '): .* {}.* An ce An isotropic tot t double pos 180 4 Ġwarm start ĠDE FAULTS road s gene set Batch Size ĠMat thieu element List AM R '])) [ ĠInter mediate big cap big wedge big tiff big cup big odot big otimes big vee big oplus big uplus Ġprop indexes ('- '): latex tools Ġcha ssis Num Nodes mk temp Ġ"# ": Ġrotation al Ġcsr mm SP EN sur fs As sembly medi al || \ æľ į Ġsl igh Ġir dvars foot prints tan en Ġperm its 101 0 Ġes inw seg min çļĦ æĸ¹æ³ķ bi plot WH I From Image mix Omics resize ColumnsToContents Ġdesign x Item List Ġfp f ]} ]) Pandas Dataset Pandas SQL px l ĠVari ant Ġmut ant ĠFa res Ġcharacter ization Ġpk pars ĠKMeans Test Ca ption solid capstyle solid joinstyle Ġtail le Ġgp ot ĠError bar Ġpt ps New Attributes smooth ness ĠendDate Time ĠSim ulated TA IN Ċĉĉĉĉĉ ĠĠ ĠDummy Estimator Ġ? ) Ġcrop ing Ġnumer ous MIN TE Rate B Ġsd c PRE F Delta X ĠAss oci \' ', ĠAnd roid dash capstyle dash joinstyle ç» Ĩ Ter min Ġvi able ĠGeo Json Draw MainPlot ĠCSV s Ġdele veled Ġep ss 998 17 PP G ĠExtract ed Ġbeam former demo prop IPython Kernel Ġexplo ited Ġ"< " wav s forest green GE OS semb les ĠMy Sql 454 90 Fig s replic ation bur r elev ations 360 45 Ġpc gr 205 0 LIN KS ĠGeneric LikelihoodModel Ġblank s BO W BO ARD čĊčĊ čĊčĊĠĠĠĠĠĠĠ Tri angular ĠPL ACE Feed back ('# ', Ġlogarith ms ĠEN DF umin os ĠCode Name OUTPUT S Ġste mming nav choice ĠWar ren ĠState ment Ġfac enet Ġins ights LOG O Ġsn cl azimuth s ĠDO ES issue comment Ġquick sort 924 9 FigureCanvas Qt ĠZero Padding ĠRegular PolyCollection AF M fv tk ĠMod ulus Ġbas ics ĠCar topy ITS n ="# " Ġë ĮĢ bus day ĠSource Tables Ġslider min Ġslider max Ġidf oy FONT WEIGHT ban om destination DBlock Gene Definition Binary Type Evalu able Partition er ĠIdent ical HDF S Ġ'> '] Ġreplic ations Mov ed Ġ################################ ##### ĠTask Instance ĠBar Plot Ġdvi ps Ret rain ĠInteractive Console Ġcython ized ĠCR ITICAL nw is ĠPack ages Ġelastic ity Ġelastic net Light Curve spring er hydro gen ĠRenderer Wx hb ond Ġ'.. ' ĠTop Lef ________________________________ ________________ Cat Ids Ġtok val cas po Ġorgan isms Ġconstit uent refine ment ĠMI ME Least Squares ĠScal ability MULTI PLI Ġtie correct Inverse Gaussian kn uth Ġdatal ab icip al Ġbary centric Ġstem med 278 1 pil low ĠVir tanen combining rightarrow combining breve ĠConsider ing 以 åıĬ resol n Ġ-% }, Quantile Transformer ĠINTER NAL ĠShort cut ĠSolution Time ĠBound ing Rout ing ĠQuant Reg ĠInteractiveShell Embed Ġbon us ACC EL Vir ginica Pat ients Water mark æ¯Ķ ä¾ĭ Does Not jn yn Ġunders hoot Black man Chem ical Web Error Web Agg Ġ+---------------- ---+ ("_") [- Elect ric ĠPhase Diagram Chunk s ĠSepar ator underlying Lightcurve Sphere BivariateSpline ä¸ĭ åįķ sour cing çī © ĠLL H ĠLeaf let ĠPYTHON STARTUP "/ >\ ĠMal typed Ġquiver key ĠPMF s Ġabsorption Coefficient violet red pets c Ġntwk A loid al nump lots ĠFlu o ĠSY S ĠTiff Writer ĠCombin es å¿ ĥ Ġoc clusion Ġawkward lib RNN Cell Ġphy lum proper ly ĠRepeated StratifiedKFold elli pap Mol From Ġinteg rand é¡ µ Molecule NumberDB Headers Dict Ġmong odb Ġfoc uses bell ion ĠRelease d Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~ House hold Ġoverest imated skel lam Broken BarHCollection ĠDesc ribes Ġship ped spi k autore load æı ı ĠMixin Coords ĠLONG ITUDE SENS ITIVE Ġpha sed Ġinform ations inhib itory Latex Table cele stial ĠQTable WidgetItem igg li Ġellipk inc Ġstoc Env Reconstruction Error PRI OR Ġdevelop ing Clamp Panel Ġ}}. {{ tum our ADJUST ED anneal ing Ġwinds peed Ġtsc v Ġclas se Ġexpend iture Ġutter ances abbrevi ated ĠConcaten ates ĠMGD TODO \(\ ) ãģĻ ãĤĭ ĠFIG URE ëIJ ľ pari etal ESTY LE Af ferent Sale Price GSP C Ġkwdoc d ĠAttr Dict Boot stra Monitored Session Ġå¹ ³ Ġantialias ing ANNOT ATION ĠSPLIT TERS Ġcompla ins ĠTRA DE FOC US çĻ ¾ 199109 05 Ġfon ction GSN s multime tric ĠPhe WebError Ġdiel Tot MeanSquared ReconstructionError ĠSCC allSite admon ition Ġdayof week 鼶 åĶ® Ġíķ¨ ìĪĺ 沪 æ·± USERDEFINEDAGGREGATE FUNCTION vistaEnhancers Distance ĠìĥĿ ìĦ± ĠUnbound LocalError [_]+). *( labelFont Props reden coding 8999999 76158 ##//////////////////////////////// ////////////////////// Ġ(âī Ī dkb hu gCD W labelIndice List assertDict Equal ĠCournape au ENGL ISH QLeft Label NewAttributes Mixin ĠMySql Hook MULTIPLI ER combiningrightarrow above ĠSCCallSite Sync ) (). ) '\ ) +'/'+ * ']) , ).") . **( / -% 0 255 2 201 2 140 2 102 7 90 7 000001 8 100 : }') : }", ; , = ('\ > ``. A go B bo B right B era B BOX C up C inv C hess C affe C ALIB D TC D onald D uplex E cl G est G ala I ne I LE J E J ump J LA J avaTransformer L ung L ancelot M bps N type N SE N ATIVE O ID P W P BS P WD P icard Q mn R as R gb R TH R PM R igid S lots S ensors T air T aps V R W iki X Label X Path Z i Z Inline \ |^ ] ! b not b lp b igen c my d rain d time d width e ic f st f al f prop f sync g ha g prof j gp j uli j mma k line k te k ite k ullback l df n utils n mi n NN n HS n Running n FLOW o ak o BuildCategory p xs p grad p ale q Q q uniform s cons t ong t ik v width v oted w len w clf w fc x low x Data x db x height x vars x ranks y ers y Train y ester y xz y Et y Ev } "), } {} ª çݯ à ģ Å ł × Ŀ ç ³ ê ² ĉ ĠĠĠĠĠĠĠ Ġ ~~ Ġ 803 Ġ ãģĪãģĪ Ġ ############# Ġ ä¸Ĭ Ġ åĪĿå§ĭåĮĸ Ġ åĪ¤æĸŃ ĠĠ čĊĠĠĠ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in filename in dian se xe se urat re projected re DrawMainPlot on off Ġt ort Ġt app Ġt std Ġt pts Ġt errorism Ġt elemetry st am ar roots he ng he day Ġn er Ġn str Ġn diff Ġn channels Ġn sect Ġc mt Ġc gp Ġf log Ġf own Ġf cm Ġf img Ġf mags Ġf coarse Ġf lashes Ġa irs Ġa mici Ġp img Ġp xy Ġp agers Ġs dt Ġs src Ġs End Ġs Html Ġs asl ion e ion et en ophore en fant ct enophore lo us lo oo Ġo me Ġo port Ġo dir Ġd name Ġd file Ġd store Ġd imen Ġd neff la ced Ġm da Ġm uted co es Ġre train Ġre names Ġre loads Ġre batched Ġb ss Ġb ab Ġ# ---- Ġ# ([' ed ate ed ay ed uc ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ss orted un evolved Ġ0 00 ol us Ġfor warding um ble 00 85 id Drag Ġas inh Ġas pire Ġis os Ġis Number Ġis RGB ts rdd Ġ" // Ġ" :", ma ze ], '% one col one of ĠT aps ĠT icker ĠT uesday ha vas Ġy names Ġy start Ġy points Ġy interp res pec ch ris fi ers Ġr lf Ġr ide Ġr gn ') `. ') ])] Ġ* `` ime sh (' >> (' +', (' ============================== Ġg ating Ġg drawable __ '), data plot ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ up on up loaded ke tt get date get Cells label List Ġex cerpt Ġex perience ax observers Ġth ir ĠS pi ĠS api ĠS HOULD Ġco vert ri oda Ġdata mat Ġdata dict Ġbe case Ġx ts Ġx date Ġx dest Ġx anchor Ġx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ĠX nan ĠX lsxWriter con verts con versation col li col Labels col laps Ġor ignal ist ream Ġh min Ġh phase Ġh arness py speck len ced ĠI UPAC plot file ĠP aw ow ed ĠA TR '] =[ '] >= ĠC ET ĠC ORE ĠC entre ĠF PS ĠF CS ĠF reedman ĠR DF ĠR SP ĠR ANK Ġval ve test attr Ġme minfo Ġme tob Ġres ps line plot ĠD ACE ĠD ollars 01 32 01 40 Ġcol set Ġcol ord Ġcol Index Ġcol Widths time AccumMin Ġel lipsis ind c min conf Ġk pt Ġk ine Ġk codes Ġk uniques Ġal en ĠN ATURAL ĠN SFG form Area art Pole ĠL OS ĠL loyd mo in max f ################ ####### ĠM us ĠM ah ps qi ps frags Ġan ion Ġne c Ġl ne Ġl sq fig H ir fs Ġnum Months Ġnum difftools ĠG Map Ġ< { Ġ< -> Ġstr type us ability oc cam orm ula pl vm Ġwe bcam sc d sc ar Ġname str Ġpre valences ĠE le Ġset tle Ġ4 19 ag lc ĠB W ĠB or append icul Ġun center Ġun restricted Ġun iface ip c ip v ib iot Ġthis min Ġthis max log CheckBox In active ast on Ġle aps da ce che ese 99 12 99 53 99 61 64 49 64 58 und oc ĠW isconsin num Labels Ġfe m Ġfe ather Ġexpected M ide as ide tes 12 22 result file ()) > ()) [::- Ġaxis out ca ff ca Range Ġdefault Checked Ġplot Accuracy Frame Parser map From Ġall match Ġall nums Re ce Data Employment 25 91 Ġch root so undex 11 111 Ġest name Ġmin size ĠPar ks cc i Ġz lim color Menu cy linders cy toscape ĠIn Box ĠIn finity Ġper ms Ġper fs Ġ10 30 bin fos ĠY aml Ġ) \ Ġnew func Ġnew dims Ġj f Ġj ython ĠH K ĠH od ĠH ough 15 35 15 56 05 0000 05 65 05 55 05 669 input i input SS Ġinter leaving Ġ[' ( idx Outlier ĠU c ĠU NI fa o Ġsub sub Ġsub join Ġsub groups Ġsub package Ġsub bed Ġsub packages Ġsub problems predict able Ġcolor List no int no sed no icon --- ## 100 9 Ġ6 04 IN COME base Year '), ) Ġtype b ĠData Store ]] }) 66 33 66 26 ategor ization 75 95 Ġ| """ grid limits 16 14 sample Data ak N ak ota nan op bar Collection 35 85 35 83 14 32 19 31 group opts ))) + ))) `` tt fpath com mitted Index Locator 78 33 13 143 `. ') 22 43 nd arr 04 69 Ġpandas ql 03 1250 ])) + 02 36 02 84 std v '): - ams ung Ġsy r Ġbase Cov OR B na Expected mon itored Ġinit Mode csv File 27 44 27 74 Ġdis continuous Ġdis counted Ġ7 80 Ġ7 30 cat ing IT ECT Ġimage Vert SE XP Test FramesPerBufferValues }) ', }) ]) 06 11 06 74 06 2500 18 99 09 35 ]), " work flows ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ap pears Ġrun R Ġrun string do jo mod ulo ear lier Ex pl Ġlin ename ME L 97 974 Ġnon iso Ġnon symmetric Ġnon isomorphic 92 183 save path Time US Col lapse part Iter sk a sk ir Ġtext file Ġ''' {" Ġq g Ġwork bench my mat Ġcurrent Wager Ġfreq List ac ión Ġim type Ġed g non singleton kernel density eps file db z File ChooserDialog cluster Centers Ar thur Ar izona Ġtrans lating Ġpredict g ls magic 87 79 Ġtra iler top odat The Clipboard Ġmult igam ped ge legend labels legend Pos ĠCheck OLSRobust 44 84 mode ltype item id Ġpoint list =[' -', vas ion Ġshow Legend EN ABLED EN TRY ĠAr duino 23 07 last Location struct type Ġ[" %. 26 13 De veloper ĠDe Conv view ers auto mpg over feat sup remum ga ug Base Epochs cell profiler ĠSt uart Ġcond F 98 35 Ġdraw downs draw states font paths Ġ} . Ġ} \ make TimedeltaIndex IP TS FF ERS Ġabs orb Date OnlyCol 67 33 67 31 Ġfind obj 08 17 ĠComp ress drop levels gb plus link ing 47 78 Ġimp edances Ġimp recision Ġselect list Ġselect ively json Value bool v OL oop inv ocation Model Selection FI F tmp out TR IGHT pair ings Ġfill ers edge Weights pert ures ĠUn biased 28 45 ĠPro cessed job file For Role ud ta 39 06 Ġge ocentric Ġlib index 68 37 Ġsha d Ġtmp paras Per Object SC AT pose xplode DI VS 46 98 ĠNe ver roll s roll ers Ġreal ize su ited Al bum ." % ={ - change point Ġauto lag Ġauto covariances ran ef pad type dif row LO AN LO Freq ĠCol lections ET CH partial s SA FE 48 235 Ġtask Spec Ċĉĉĉĉ Ċ Ġscalar Map ĠMulti Signals ĠGet Position 57 676 57 1157 lon c App r nb I Ġroot ed eq scale Ġlegend text char procs Get Parent Ġchar map Ġmy ax Ġmy locals des at Ġignore Warnings :, :])** Ġ', \ No Const Fa OO tri age inc lination svd vals =. *\ src Col 74 22 prior ities Max imize Ġfilt ro Ġnb matcher Ġsetup s ĠIN DIC single sounds Int DateOnlyCol system d Ġconf use bottom s Input Layer Ġsvm matcher hes ised ident ities On es Ġparse Result )" ))) ci ation RAN DO EX PIR ĠArray Field He avy Image Vas Ġ(- . marker face pickle Ser Ġdet R Id List fl x Ġna ively Normal izing tern ary br ca Bin Width Ġra xml Temp s directory figure HE AT ĠFe at Ġli zard Ġtrace ref yp w ire levant Ġcontour Fontsize )`` :: pc r Ġcontrol lable 52 85 }} ' Ġfeed s span coords eg lise selected Features selected Points SS R Ġmis lead Ġmis cellaneous ĠNOT ES ĠApp arent With Class With Projection Feature Map CON NECTION ĠOut box Ġsubplot num Count Robust +" % DB C Range Params ny ears Doc Freq Ġsl ug Ġir reducible Task s Ġhalf pi ĠFile ChooserDialog lw u ĠQu it eigen face Ġinv gamma Invalid Http Ġnn ls Ġspectrum T CG AN Sparse Splitter Ġ"' {}' 101 325 Bar Chart seg menter Ġdelay Threshold ,:] ; From Scratch mix t xp u ĠEn hance RES ERVED ĠFigureCanvas PS Item View embed s Ġrand s fail Unless qt console ĠSub sets Ġtd v Ġridge cv Ġsuccess ively Ġur b Ġpk r ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġexit Trade moment a Def Axes Ġns amp boo leans SQL Api dB Z multip lied "% (" Ġformula e ĠSVM light TA CA ]`` ) Ġer godic beam line beam let Ġentire ty Ġå Ń vect ive equ ip 275 8621 Ġroll back Ġcurr pos ĠShould n PRE VIOUS Ref l edit Box bootstrap ped Ġmx see ĠMath Works Ġgl Normal ĠCall Dimension ĠTr ick isk os ]_ ). Weight stats Ġrp cs conver ge GN C ĠMon osublocus Ġff ine ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ rh omin ĠEd ouard ĠImp ulse quant ization =============== ") disp Msg Ġ96 2 Ġmet atlas ĠRO MS ĠBayesian Regression vor o dk lwu Ġfour gbplus 7817 4 gam it gam ut Ġfact ored workspace Names ae a pm fs 025 7 PA IRED Update Pipeline Drop down Lin space Ġol df Ġrestrict s subs paces Mark ed synt hesizer erm line Find CenterElement .- ( rg i Ġ'[ ', Ġ'* / RR MPFE Ġ198 1 ìĿ ¼ occ face MI ROC 286 9 Page Xml Ġ+---+ -----------+ Ġrf matcher Ġln B Ġomega inv Region Act Ġadj y ĠPr inciple Ġpot rf Ġ'-' * ĠOb late por osity BASE DIR fv fm Ġmedi ums (? ) 145 8 )| ^ Some Db pic ious Ġhome dir tpr s REF COUNT ĠPO I ĠMathemat ica Ġbook mark ĠBin arization Ġbucket izer near ly ĠBbox Connector ĠåĮħåIJ« åı° XML DST ĠFont Entry @@ \ ĠPA W Ġrcond G SW M trunc norm MAC R ĠCH UNK Ġdv ifont Ġdelt ax Regist ered spe ll was GeneratedBy Av ailability Omega Range afm fontd trn args cher che Mar quardt ĠFrame Like Diag nostic Ver dana ĠCase s ĠPack ets pin board phology Dict æŶéĹ´ åºıåĪĹ ĠND CG :{ }, ;" >\ Ġintr Dim ĠXY off ("{} . Ġsay ing ĠAssign ment ĠRepe ats Ġhover info Ġexplain ing Ġorgan ization ĠMO E čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ phy ll mel kov Ġsumm lines Ġclamp ed NL NS ä¼ ¼ Basic Properties Rs MsRpMp Forecast Mixin odes mium ĠSign atures Mot or blo od Photo B Photo C Photo D 1998 0512 Ġisot ropy triang ulate pitch er Ġprece ded dge lsd Ġcontract s ĠEvoked Array 310 3448 setWindow Icon Ġ ± Span ish Ġ113 14 ĠOmega Range ĠDataIndex ableCol MARK ET Development Set hypers py Ġdistingu ishes rets hape chocol ate Ġdead locks Hello World lfile dict scra py -----------+ ------------+ ĠHE AL Ġlogreg matcher seiz ures Ndarray Subclass Sal ary Ġcel la BY TE filelist hash 504 44 ('=' * ĠFloating Array Ġbasket start psy cho UserDefined DataStreamFunction MLP Classifier dbl click WB SWM Ġtravel Time ĠQueue Runner ĠGre ater Cam ara Ġcash flow NetCDF File Ġsand wich Ġ+------+ --------+ ĠObs r FIT NESS æŁ IJ Conditional ValueDef hon da Ġconcentr ate é»ĺ认 为 ĠWrap ped å¤ļ 头 mape LSTM Ġchisq prob GPS Hr Ġprede cted ARE TRIGHT mobile ye kid ney Ġhoriz Layout Ġdock widget Ġadmin console Vers icolour endian ness 735 75 OME GA xrd ml paral lax ĠSchema Field Ġbirth s KDE Multivariate ĠHar vey Ġunk nowns ATAG DP Pow ell HAND LER ĠTICK RIGHT Ġttf path Transformed Bbox COMPLE TED Hierarchical Cluster Ġtagged View CurrentLat Lon declar ation transl ational Derived From pseud oland ĠtestIris Iterator Calib rate ĠOuter Indexer REL ATION ĠtestSdcaOptimizer RealValued 0159 7569 ĠMarg ins Ġink Rect ĠSL OT sampleSize Distal setColumn Count quer ier ĠPal estinian ĠDest roy ĠDump Layer CAR ET ('; '): '') | mist y Flor isPower fcs zo institution s CXX FLAGS XGB Classifier Ġpha ge ĠdC dm Ġble ach axr xy 2534 127565 Ġfirm ware ĠIbis Type Ave Temp ĠYEAR LY HIST ORY djz nq ĠHan na STIX General capt uring ĠsampleSize Distal ĠsampleSize Proximal Ġbathy metry Ġpromin ence Ġ+----+-------+ -------+ 西 äºļ ĠCLOSE D meand iff meand iffs Ġtsc g nChannels PerStream ĠFer rer ĠKit chen ĠWeather Data Ġinterfe rer inchi key neum ann ĠOLD EST ĠpreviousWager Amount 对å¤ĸ è´¸æĺĵæķ°æį® ĠSPEC TRA authent icate ĠTen nessee Ġdecl aring ĠSignific ance Produces Outputs ĠArr Temp Ġpostgres ql Ġconvers ation ĠMiss issippi Ġgrouprank sum amien to Earnings EstimatesLoader ĠTp Relay LevelCur TestX ĠFlickr List TAI W ABCDEFGHIJKLMNOPQRST U Climate Index Ġoce ans Ġlinreg matcher ĠåĮħåIJ«åį °åº¦ Ġbolo metric 8828 667 ="(... )", Calibrated Classifier 72727 273 Imaging Data PLAT FORM bron ze guro bi iproc ity Ġpit uitary ĠLore nz Ġclar ify Aggreg ator ĠskySubtraction T ĠìķĦë ŀĺ Ġbund led trich odesmium Ġhamilton ian ĠEXPERIMENT AL =\"" + å·² ç»ı Ġlav ender loro phyll hnd lr Ġexplic ity dkl zq Peri pheral leven shtein \]. *\( actero idetes nico las Eager Eval æ¹ ¾ ĠListDataProvider WithProjection LIMATE INDEX ĠDmp Bbo 14266 8828667 Boulder in #/**************************************************************** **********/ HADO OP ĠDru cker commandLine Verbose dkmb q isest imable underlyingLightcurve Ans Gala had jmma uricio ('============================== ') appendicul arian ITECT URE Ġmultigam maln 57676 142668828667 CountRobust Mixin InvalidHttp Header ĠåĮħåIJ«åı° æ¹¾ 3103448 2758621 pseudoland marks 01597569 2534127565 ĠListDataProviderWithProjection Index ! \\ # """ # ******************************** % } % ". . ~ 3 098 4 1961 5 4545455 8 20 9 327 : $ ; < ? )\ @ ', A frica B road B MonthEnd B elief B uffers C v C ER D d D min D ual D FI D ROI D roid E ns E quivalent E lec F o F la F inv F UL F PS F lask H ans H ints H Center I y I tr J UMP L ex L SI L UM L oops M ine M OT N lev N avig N IST N ACL O VE P IN R am R nn S inv S SD S ector S OS T ens T qdm V x W G X b X out Z ETA \ [ \ [\ a dict b co b ax b als c print c stride c rashed d cs d num d bin d less d pkg d raft d Km e ing e bin e mi e bounds e Pos e mitted f C f PIC g ds g low g lasses g ops g rained h pca j string k art l array l loc l ude l rate l ung m dict m ari m organ m Lvl n E n thread n states n ino o vs o logically p Q p R p loc p mu p loidy q dot q stkutil r in r sc r ant s ge s print s rand t bin t INFO t QUAL u ID u encia v env w ider w exog w andb x ss x pon x org y center y upper z k z pt z cs z mask z vals z xy z bseries º å®ļ × ķ Ġ čĊčĊĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġ æł¹æį® Ļ 港 Ŀ ¼ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ in process at iv re quis or andom on Close Ġt ep Ġt color Ġt query Ġt iling er ange er ia st f ar atio an ode an cen de convolve me xico Ġi ron Ġn j Ġn step Ġn tri Ġn olds Ġn PIm Ġc bs Ġc Df Ġf C Ġf ds Ġf idx Ġf ml Ġf ltk Ġa exp Ġa ii Ġp ele Ġp conf Ġp codes Ġp ente Ġs dp mp ine ra ctor ra its en velopes ct ables ro o ro ves lo iter Ġo Obj Ġo mero Ġd pos Ġd rs Ġd bops Ġm N Ġm ash Ġm RNA Ġe mg Ġe isp co b co er co urt Ġre tr Ġre connect Ġre charge ge m Ġb max Ġb dl Ġb divep Ġb cknd ic m Ġw clf ur ch ur us Ġ( )): ss g un fit un assigned is math is link el iner )) ._ )) +"\ ot or Ġ" == Ġ" =", Ġ" ;" Ġ" ...", ma cho ĠT uples ĠT INYINT array d qu iz Ġy date Ġy bar Ġy ctr ch ter ch iasma ad x set Y set Cell set Background set Validator Ġr labels Ġr ats Ġr sm Ġr lats Ġ2 000000 Ġ2 91 mat urity lab view Ġst u Ġst ag Ġst ineman (' -------------------------------- (' .' int ent int ensive int osh Ġg max Ġg loo __ ',' ex hib igh th data Stage name List get output get Type get Max ab orted Ġex posing ax top ĠS an ĠS ids ri os ", ", all k Ġx ctr Ġx bnds ': [- from Internal col um Ġh ps Ġh ls Ġh ouses py side py cache len n len et ĠI L ĠI ds ĠI SI ĠP TS ĠP SET ĠP once Ġcon ta Ġcon serv '] # ĠC ity ĠC lock ĠC FT ĠC TD Ġtest String Ġtest Clustering Ġde ck Ġde pt (" ([ ĠF ACT ĠF rancis ĠR yan Ġax p Ġax Inv Ġax vlines Ġfi bers Ġ3 93 Ġme st ĠD v ĠD Type ĠD uches ĠD HIS Ġlo do 01 36 01 69 ne c ne ato time Step Ġv ast Ġel m out fn path d pro ve pro du ext List min es Ġk List ĠN CEP ĠN SB ĠN ino bo om ment or ĠL FP ĠL BP max c max imal ĠM ell ĠM ATH ĠM EM ĠM ATCH Ġan es der rs po ids Ġl dipdir we ber 10 76 Ġlabel color Ġlabel lings ĠG y ĠG od ĠG uess ĠG SM ĠG GG ĠG FS ump urple oc l oc hem ĠRe bellion sc g sc rap cl ing ĠE di ĠE BV =" {{ Ġ4 22 Ġ4 08 Ġ4 52 ms ort ĠB n ĠB EN ĠB uch ĠB ird ĠB ras ĠB MonthEnd ĠB lanchard sh rt ib or Ġdi lap cept ible In j In Union Ġen abling da o 99 88 Ġtime period ant t Ġclass Name ĠW iki format dict Ġmax mag Ġmax Charge og gm Ġexpected s ide mic add Kernels 12 59 ĠO z ĠO DD Ġmodel ica sub net sub sequence Frame work ach ieve Re mi Re actions Data Exception Data View Data Grids 25 16 25 03 25 85 25 06 Ġch g so bo so bol 11 42 11 39 ments Finished Ġmin w pi ens Ġz map Ġz new ng rp color ama Ġ\ "" ĠIn Process ĠIn trinsic Ġper ceived Ġsc io Ġnew dict Ġnew table Ġnew Labels ĠH ur input Path ich unk Ġpy mavlink Ġpy claw Ġ[' %. transform Set Ġoutput lines Ġno on Ċĉĉ ĊĉĉĊĉ fa ced dd le dd mod no me 80 75 80 89 output files output Filename Ġ6 70 Ġfit res ER AI Ġtype Name ĠData frames split tings uni qu doc vis Ġrow Colours tain s ĠSe pt 45 95 ĠK p ĠK appa '' ( Ġ| , grid Widget 16 322 av rg iss ued Ġcor p Ġro ma 14 11 14 33 14 75 19 10 group List tick width rect props com ms Ġ8 01 St oring 13 18 13 87 Ġbin ascii ĠV Q ĠV Box ĠV TK `. ", by testring zero es 22 25 22 05 04 20 ])) ))) string d Co res ĠTest Face 02 99 02 12 dot vec 95 32 94 75 17 45 ĠCo coa 85 00 Ġbase nji run off Ġexp MT 27 26 cond uctor ref id ref erral Ġimage file Test Templates AL K AL OG off ense }) [ Ġorder by 36 863 ". *\ 09 25 exp iry Ġrun Experiment Ġscal p dis persions ST P 34 35 34 65 97 24 97 08 af fect Ġreg ard ĠJ r ID List ĠQ ComboBox 84 00 Ġtext ures my plot my Pfile tx y ones ia Ġim shape rel x ... ]]) non square 65 00 30 84 db Cursor File Root unk now unk tion sol vent {' + Ġtrans its Ġtrans position 50 22 step Cnt :] * )[ ()] rate return ĠZ PK ĠZ ERO ĠZ bari active Session EN CIES stri pe 23 4567 pop order pop sep multi key can cers De conv 77 134 ĠDe fect termin i Ġevent Counter Ġpl b Base XDiff Base YDiff kw id Ġoptim istic Ġlines can rec en sql cipher To Str ĠWhe el wh ats Un labeled sim ona Ġimp osing best s Ġrel pos Ġtick len Ġtick angle poly mer TR UN Ġsuper se inf all Ġeps fcn Ġhist ories env t EL M field Items 9999 998 ĊĠĠ ĊĠĠĠĠĠĠĠ čĊč ĊĠĠĠĠĠĠĠĠ ĠIt aly En counter ry x 21 01 21 33 21 35 Ġge u Ġge di Ġge oid Ġsha ping Ġnoise less eli fe ")) ), annot ators match ers assertRaises Nothing ele vent ML MC Text Col ston Lutz initial ised initial izing AD V pad left Ġerr func 117 2 ines is bit set ĠMe mmap ET M plic ed depen se Pre ds Pre computed Linear TimeInvariant Ġdelta z Ġfix ext ĠGet ter sigma A Not In ĠGaussian Input aT H month range Get Num ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġextract all Ġmy date Ġignore Label obs id Ġnan var No SQL sw atch Ġmpl backend skip whe rm dir Py matgen Ġlocal time long itudinal Ġbar rier All Plots HO Br ĠLe g Or Buffer fold l Ġfilt r scaled Box aut odetect ĠPre ference ĠPre pares CO G Ġgen us Loc ate ("% - Mat lab Function ality Function Space lex ers Can ny recall s On sets Color RGB Ġapply Func EX E ĠOR F Min imization Ġfmt list Gener ators /( . /( \ entr ust az z Ġ". ": opt as Field Type Ġway point Qu an 255 2 post code Bin Ind Ġdd mod CC Y At trib .* ' wx colour Multi LineString )' ; wave len Add Separator Ġbl ks cb x CL ICK ĠDE FIN Context Manager 52 16 proj Dir Ġactive Column merge end merge start known failureif Ġopt inal Th u Th ird Ġcy x Ġcy lindrical Ġgrad cam QU ID Ġsur ge pri mal )} ). dy k SR S CR RA ĠApp le Feature Columns 58 989 ĠAxes Grid Ġport rait ]= {} SP REY View Action bg Color Ġobs name analy ses safe Eval plan atory geo axes delete chars ortho view Ġlb id Ġnn lf Ġ'+ _ fixed n alias d VAL S _)) )) illed SGLD Ġphi T DD K Ġsaved ir ĠSub scriptions Ġreset ted cing ulate zy mes gap ped "\ " "\ [ integr als (\ ' ĠSQL Table Prob plot Mask er Ca LS Ġexit Bar KE GG dB d OUT ER invert ibility GMM HMM /> ' SN Ia East ing ĠColor Converter Ġregist ering nm ol IB IS ĠMethod Documenter ........ ....... Ġå ģ Ġå ĩ commen der Rate Scheduler Ġfoot bibliography Ġke gg GG A syn sets Ġtab u Ġtab name Step Counter ĠCor ner Over view Ġlab elt _: _| Open GL Patch Extractor Delta P nans afe kl n Ġpress ing stock well tfidf vectorizer ĠML EResults Ġì Ħ pas sengers ĠResult Set LR T Ġrep lies ĠWork shop Ġ197 3 chr one 185 87 Scalar Function Ġglyph ind Height Char paper Height 337 25 ĠSE C Ġwind ll Tr ump Ġtc ga Gre y 212 7 hear ts Ġadapt Ca Speed up ĠOrder ing SCAL ES VAR MAX è¿ ĩæ Like NDArray Vec Utility Ġpast ing pho enix Ġste er trade calendar Center DB ĠSp lines Ġ'[ ]' ("/ ")[ Ġsn rs Queue Network gm time ĠMSE s æĹ¥ åĿĩ GTK Cairo dri m fg color coll isions sam tools Ġviol ates Ġachie ving sky blue brute force }_{ : COLOR MAP Inv estig Ġmutual info maj ax SparseTensor Value ĠEstimate Survival ][: ]. Align HCenter ="# ", explo ded Ġë ĭ¤ Ġdialog s sizer atio ĠMeta store cord ance graphics View tech nologies 108 20 396 36 ),' - 236 8 è´ ¡ç Generic ArrayFormatter udi ed ĠLogistic Regressor ĠBatch ing UND ING ,:,:] - Ġcapital ized "$ % ĠDNN Only ĠJava Value ĠPR ESS ĠPR NG Bind ing Ġè ½ Ġreplic on environment al Ġbed tools Short Name ĠSte m ĠSte ps Ġcn v bel gium Trade Date proportion ate Scatter Plot NP ac NP Array consolid ation ellip j Ġexchange CD Dec lare vw nd Ġtrig onometric (~ ( Si O vo ice ĠSha mpine Enter prise printer Data Bad Classifier Ġexplan ations psc ors patient List ĠSup p mus sen heap q 737 25 ĠCOMM IT Ġparalle lize е ÑĤ Ġvc feval occup ied xm nx Ġmiss match ĠCallable Dynamic ALF IT ĠConnection Style Ġreli ably ĠLight BG Ġspe lling Ġannual ized Ġwa its ('.. ')) ĠFlow s 表 æķ°æį® Ġperiodsper month "; \ pyqt Slot utter ances Span Selector ĠMov ed MAN AG Ġ.... ", ĠFig Canvas ,, , yb rown yl vania TU AL ĠGu illemot arrange ment Odds Ratio brick name Ġimpro vise ĠEnt ity OOOOOOOO OOO Au ctions =< ... Ti pper Ġalph arange ĠObtain ing ='$ % Quadratic DiscriminantAnalysis iden ces Ġaccident ally Ġpheno code Rolling Panel Don or slide Duration gv f Rp Rs unce xpon Compat ibility Ġdowns cale HDU List Ġpin ned Ġexcess ive May avi Ġworth y benef ices asym metry Nq f readout err Ġwheel house ĠBer trand Ġ(? : isol ation nuc lear ĠDAY S COUN TS èģ ļ ĠDD K éĺ µ ĠZerosPolesGain Discrete ]+" _ Ġtur quoise Friedman MSE GAT TACA ĠTHRESH OLD åħ¶ ä»ĸ Ġrational e Circ les nation key cheb win Ġpathogen Name çIJ ĥ âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢ Ġvon mises Decoding Time Ġslide Duration chat bot AVER AGE ç»Łè®¡ 年度 ĠMer ges Cosine Distance ç½ij ç«Ļ modif ications ĠZMQ InteractiveShell reproduc ibility Appendable Multi Ġwk cars Ġhon ours ĠPH Reg homog en ('] ')] ĠSchool book Sch midt ĠIndexing Error correl ant Ġbackport ed Similar ly ĠCHAN NEL ĠGENER ATOR MID I MID DLE ĠBR ACKET acceler ometer Ig G xrt p cccccc OOOOOOOOOOOO ëĵ ¤ ĠVla havas SEG MENT But ler ĠMultiOutput Classifier Activ ations minis black STIX Size Ġnit rogen é¦ Ļ港 Ġdefect s ĠMID I ĠEL SE Ġautom ate Ġdissimilar ities cull ing æĿĥ éĩį åĵģç§į çļĦ Ġbene ath aus kas Ġspr k evi ct Ġkeyval d ĠContents Manager ĠAveraged Crossspectrum ëIJ ĺ Ġneu roml ĠOH LC Coll ision Unt itled ĠBlended GenericTransform osphory lated ĠTot ally MiqEms RefreshWorker Cb Cr ĠInterpreter Interface axHist x descend ants fromp k GUID ED OUN DED ĠEQU ITY ENCOD ING ëŁ ¼ normX ind annu el ĠSYN DATASETS Russ ian Ġformal ism ĠMair al jorn ada ëı Ħ TimeOf Day ç»ĺ åĪ¶ xacov fft setState mentsFinished toLocal Iterator Ġgraf ana Ġè¾ ĵ ĠFlex ible Ġclob bered SHARE JS ë£ Į Ġhie archical åIJ¯ åĬ¨ igu elife Ġcoffe escript ĠinputParams Config ĠThi erry Ġkijun Sen ĠOrph ans Ġlips chitz moren acl ĠWeck esser ĠTechno metrics wield y ש ׾ ĠMSON able ĠUNB OUNDED GetDriver ByName uminos ities ĠFluo View Ine fficiency ĠSapi ro ×ķ ×Ŀ ancen umbers Ġeisp ice __',' __ ĠDuches nay ĠMell on skipwhe elevent StepCounter Hook è´¡ç Į ĠCallableDynamic Doc " ([ " ]])) & ' ' ? ) "], * < * =\ , __ , ") . "], 2 111 2 146 3 01587 5 000000 7 200 7 018 ; '. A di B urn B las B etter B smt C U C ntr D types D TI D ry E m E th E sp E ec F ran H t H olonomic H undred J r J OHN K p K SP K roupa L od L OD L pf L esser L osing M el M sun M KL O thers P ane P asses Q Image Q CAT R m R are R pts R eli S uch S PI S snake S plice T ou T UE V field W AV X avier \ .\ _ ; a as a gre a eq a quis a erosol b lab b cl b range b colors b fitted b anging c idx c rack c ortical d ls d xyz d zs d ollar g mx g fm h lf h ds h gr h ARR i Y k iter k mm l gb l mc l uminance m ile n arg n cc n xs n bound n rep n freqs n bolos o metrics p ds p ine p names q app q wer r ds r tapp s igh s fn s pex s lyr s addle s lls s preadsheets t Y t ce t time t rou t linewidths t FILTER t pls t confint u cy v data v wc w fr w ert w ght x la x aa x Signal y true z or z mag { (\ } ]} £ ¼ µ ¬ à ® à · æ ¡ Ġ ert Ġ ĊĉĊ Ġ Ċĉĉĉĉĉĉĉ Ġ æĺ¯åIJ¦ ĠĠĠĠ ĊĊĠĠĠĠĠĠĠ in ux in oooo in compt se ds re feren re ass re ify re stacked re asons Ġt ig ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠ al locator al mond ar der ar thro de sp me f me ijerg Ġi dfs Ġi stress Ġi dimx he apsort Ġn ipy Ġn ci Ġn exts Ġn cout Ġc ump Ġc dim Ġc levels Ġc dr Ġc Func Ġc rammer Ġf set Ġf handle Ġf exog Ġf Output Ġf atest lf d lf are Ġp ta Ġp format Ġp ec Ġp sk Ġp lastic Ġp aging Ġp uniques Ġp Ka Ġp umps Ġs ited Ġs arima Ġs peakers mp ar Ġin e Ġo mf Ġd I Ġd de Ġd dr Ġd GridLineByIndex la ctic la delph ut ron Ġ' ); Ġm time Ġm ses Ġm ile Ġm dist Ġm conf co la co vers Ġre indexer Ġre trained Ġre stores ge y Ġb sp Ġb locs Ġw file Ġw rest ig ook Ġ( _) ss v ', )] un def un even def ines ol la li fie ort on ce eee Ġif d as im val or id lx Ġ" }" Ġnp l ter day ma gen ma itre ĠT out ĠT ran ĠT RI ĠT odd ĠT oni qu ack tr ick ha dis Ġy value Ġy ang res dat set Frame Ġr j Ġr iod Ġr iver Ġst mts ') ' ]) ([ ime stamps (' ---- nt itle pt x pt ools Ġg st ex x ex ico ex clam data Len data Portion par aview get Input get LineScan label id Ġex a Ġex ce Ġex changed Ġex peri ax dict ĠS ar ĠS ed ĠS ampler ĠS TO ĠS ENT ĠS peech >> >>> =' *. =' ->', ", )], ", ""). Ġx is Ġx Test Ġx change Ġx imp Ġx logy Ġx disp [' @ [' .* arg p arg name con ce con ference col ord Ġh ight Ġh problem Ġh ierarchies py ear ĠI python ĠI TER ĠI solation ĠP IX ĠP DM pp n ĠA GG ĠC MS ĠC SN ent ucky Ġde mod Ġde compression Ġde generates Ġde gradation (" }") (" ``` ĠF irth ĠF OV ĠR y Ġval min Ġax m Ġax mat np atch ub mit Ġ3 31 Ġ3 48 Ġ3 51 Ġme ssy Ġme ijerg Ġme teorological ust on line Count ĠD olph 01 48 Ġcol Colours ns ylvania cal age Ġv ix Ġv ols file save ers ol ly ra Ġarray size out seg pro gen ext console min dex min im min Max Ġk func ĠN ear ĠN PY ĠN NP ĠN weft bo pt ĠL os ĠL PF mo e max dd max interval fit arg Ġ{ :,} [: ]] ĠThe MDI ĠM utation ĠM orph ĠM DL ĠM HD ĠM offat der blue age pf Ġfrom im 10 41 ĠG n ĠG ill ĠG ender Ġstr colidx ari os pl spm ĠRe usedPySparkTestCase comp lain comp ounds cl c ph an ph osph =" [ =" =" Ġ4 00000 Ġ4 37 date value date Tuple sh i Ġun date Ġun load Ġun norm Ġun connected Ġun titled Ġ5 32 Ġ5 76 jo ind features Col key frame axis info In File zer oc rid ing da des che v 99 27 ĠW ORD ĠW AVE Ġmax norm num samples num steps num ero og il add Layer add Pixmap ĠO C bs ple Ġbo ards Ġbo vy las ka Ġit bl ca f sub typ sub sat Ġplot Title dir vars old name Re ciprocal Data ClimateIndex 25 90 Ġso undex Ġline types frame Spec inter genic 11 59 32 10 32 456 Ġmin orticks Ġinput rc cc p ng m ĠIn version ĠIn her ĠIn halt ][ ~ Ġsh ut Ġsh runken Ġpa wecutdg req d ĠH ook ĠH ungarian ĠH eday 15 36 15 48 05 36 05 28 05 56 input HubWindSpeed Ġlog Ms Ġfig H ich i Ġpy lon Ġpy rolite Ġ[' * not ification ens burg ĠU TI ĠU hat Ġla mp Ġsub element ie b no plot 201 50 Ġha do 80 47 Ġ6 30 Ġ6 76 ES P ES TR ste g ste pping doc headers 45 15 45 75 ĠK d ĠK v ĠK orea '' ')] use c Ġup loading sample Sizes sample tempA Ġcor n Ġro of nan prod ĠEx tended 35 13 35 37 14 026 19 67 Ġkey PressEvent group key tt ed Ġarg list St orm ĠV ars Ġstring Indexer by project be th 22 33 gs l sp x sp ill sp ons 04 45 03 00 lat ents lat lons ĠNot ation ĠTest To 02 85 02 37 02 384 ou uu std Accuracy 95 34 95 31 95 1190 17 64 17 80 ams fonts Ġdataset Name 85 38 sort order Ġve m cre ts cre ds mon omers ice berg 27 88 cond Setup ref y ]: '. 86 37 gen extreme Test benching abs ol }) ") Ġsp Output err Bar 36 07 ]), ) Ġrun file do xygen LE AVE ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġadd Data rc ut ME MB af fected graph ml ĠQ wt my lin my System Ġtemp data non synonymous kernel spec db m db lanchard Ar m ]], \ 37 18 37 39 Ġmulti row tf mat ls st Ġfol iation RE VIEWS 44 94 ĠZ z ĠZ inkov =[' # select s respon s Ġpoly mer ĠAr range 23 06 23 887 Ġuni verses img Label img Lab Ġframe N 26 348 26 064 De ad De tections AC M {} $ Base Class stat ut ĠSt ellar draw Contours ################################################################ #### Ġhelp ing FF A 43 92 67 06 ĠPer rot DE J Ġtri plot uch icago To Id rs ids Ġsv ms tz set lu ent user df inv gamma SD K ĠTime Keeper Ġtick suffix current Wager current Concept inf omin mu ss 28 05 stop word For Width sha h diag name ster da 21 45 .], [- User name Ġcho ke 38 784 ĠIndex ed Ġ15 92 module name Fe e roll up 31 33 sm w Text TestRunner Ġerr state LO OP inst ancenumbers Ġwrite once Ġmarker fmt Ġvis py Ġdb rxn 294 0 ĠGet Target 57 24 App arent ivari ogram Not ify Ġform ular Ġ", "") dx f ]* (( Ġdon nées Get Current Ġwx version xs d Sh ip Scal ings No Signal Check CountRobustMixin Ġser um Py Installer Ġcsv writer Ġ16 384 meta features ĠRun ner 74 1176470588235 Max Pool irc ase Ġstri o ĠIN FORMATION åı Į Int Coder Ġ$ '%( comb e ä¸ Ķ ĠMin Hash fr ican fr inges :]) [ 63 99 63 12 Ġcla sh insert ions )( ** status Code )" ', Ġparent hes RAN D Ġaccept or grad cam Ġscaling Factor cons ump Ġrc as ĠDi jkstra Ġconst el ('% #. two blocks Ġobtain s Ġ(- > used Local [( (" Ġmeta features next index Ġflat sum 300 5 81 35 Ġpad fn aa abc 72 85 ,)) ), ĠMax Pool Ġpp b Key Dictionary rb fs Ġsu cc .* )\ Ġpresent ing Ġmix tures small int COL TYPE Ġfun ny cb Range mis class Ġmp s čĊĉ ĠĠĠ Context Menu 52 36 AM ZN Ġavg data eg m ĠRes Net big ger One QubitGate Output Spec Ġsubplot Ind Range Cloud }$ . Ġregion List week days Ġ17 37 ĠSVC s .]]) . Ġ'+ ': CG GCT Ġtruth Matched '`` ), ĠKernel Operator WH EN From Checkpoint Ġtermin us resize Event Ġ"/ ", bucket ed PRO MPT Ġdesign ate Ġgr á bc de ĠTrans parency čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠ PR F dual s adi mage Ġtd c Pandas UDF Mo oring Cor relations Ġph on ĠMo difies ĠGraph ing Pr in Font Name ĠIter ates NO BS Sim ulating break out break points maps ize Ġmajor Labels 0001 00 078 4 mv ir If Needed Ġcap styles bits persample SQL Database New Mixin /> " Flow s Ġtopo centric TA tt Ġinspect ing Ġflux val Ġthink bayes ä½ Ĩ MPL ING Ġsen ds pie zos ĠExtra polation psd Z ../../ ../../ Ġfoot ball 445 5 ĠAxis Artist Ġfl ank MO LEC Ġsd k Points TickLabels 873 016 Ġshuff les Ġair port Ġstim s Load JobConfig vir t Panel OLS Ġpseudo count ARG SORT dash pad dash boards Ġastro metry Ġva e Hash Tables ĠTr uncated Ġhess ians Ġbel gium ĠText WithDash ĠText IOWrapper "} ]}, Ġ(_ (' Spectral Density hr g 998 16 iling ual ĠABC DatetimeIndex Training Test Ġ35 20 trim both conc ise Seq Record Ġ'{} \ delt alab Ġ------------------------------------------------ ---------- abi lize alex a Ġchrom o Cod ons web app clust Results ĠTH ESE ĠTO A dk jx Tr unc Ġ29 14 Ġtrade calendar MD P workspace Num ae iou Imp act PA PER Ġ94 9 Ġsr g Pipeline Engine Br O 785 89 atz hadz atz hadtz čĊĠĠĠĠĠ čĊĠĠĠĠ RF ormula ĠDimension Selection Op ener meas uring ĠMask s Ġ:- ) Bound Index 424 39636 datal abel uk auskas VALID ATE ĠVis ible pot rf ------------------------------------------------ - Print out ĠFriedman MSE 395 3 ĠPh Den 038 3217 164 34 Ġche ating START ED COMP ONENT My Dummy Ste ady slic ers INTER ESTR Multiple Updates DM s Ind Power simp lifie [_ (' Ġbs ddb Tag ger Ġphys iological Ġoverlay ed Radius Cost proto c rxn m Ġum ap Ġlic orne Summary Writer pur poses Ġ``[ . 203 16322 ï¼ļ % lang s WIN C Numer ator dire ctor ĠBatch Completion ĠPR INT ĠRES OLUTION Second LayerParts was DerivedFrom Ġomp cv emb arked afm hot ĠMAT RIX ĠRank ing ACGT ACGT Ġcomposite Mask Java Object ĠBasic Indexer ']+ [' ĠFA ILED opp ortunity Common Schema Upd ownarrow nod dy Scatter plot Mac OSX ĠNu PIC adtz hadz Ġmanip ulations Ġdecor ation 298 92183 ĠCons umption Ġsca ffolds ĠMD Traj æľĢ ä½İ Ġhover ing ester d ĠCorrect ly Minute BarReader ADD ITION TOT L ĠMerge Error ĠPri ors Ġdiscussion s ewm cov nds ub Determin es DAT ES ĠSimp lify ĠLearn ed GridSpec FromSubplotSpec ĠJust in ĠNeural ynx á clav Small NORB Sat ellite Unsupported FunctionCall ĠRender ing Ġredraw n olive green Ġboot file Ġparticip ating ĠDiff use ĠCat maid panda icon Sol n TOR NADO utter ance setWindow Flags 1515 15 Regular ized SUR FACE ĠHO ST Package Registry SUM STAT ood bury Ġbon ding éĻ © coal itions Ġuv out Evaluation Test Ion ome RMSE vents BR CA REQU IRE Ġrb fs Tur quoise aaaaaaaa a Ġrecip ients Ġmime types ĠPick ing Ġemploy ee Sal aries ĠAng les ĠSepar ated ĠAnaly se CENT DY ĠAut oregressive Exc itatory UserDefined Function ĠFail ure 827 43 relax ed leak y åĨħ 容 Ġtweak ed Ġcumul atively Ġconstrain s Cr ime DEV NULL alphabet ical iii inoooo Ġoscill ator RAD IO SHORT NAME Bio bjective Sink s standardi zation ĠPSF s Ġheav ier Tol er ĠEOD s quadr ant feh ler íķĺ ìŬ 7898 3213 setIcon Size SECOND LY Trading Algorithm dil ution nC v symp rec ĠConditional FreqDist ìĹIJ ìĦľ Ġmantid qt Ġdeform ations Ġham za ĠBusiness Day Ġttf FontProperty ĠFre chet Ġhealth care abb de ĠPan Dat Ġê° Ĵ ĠDNNLinearCombined Regressor cate g åŃ£ 度 ĠChrom osome Ġmapred uce ĠWavenumber Step 4920 63 ĠtestIris InputFn ...... ... Ġmant le risto ph emo Names dan er ĠDependen cies ĠLINE AR Pdb Info Ġ***************** ************ nbdtr c ĠAnchored Offsetbox hunter s Trained Data æĮģ æľī ĠMONTH LY ĠOB J ĠOB JECT Ġharm DevSlope ĠKruskal Result lnprob ability FV COM quiv os Euclidean Distance Parm In Unpack er vest ock ĠNORM ALIZE Ġtunnel ing 1932 0542 ĠInterest ingly Backtesting Result ĠBatched Calls ĠPres ortBestSplitter enhance ment Decomposition Set istr ative Ġ.................................. ................................ ĠSB ML Lic ence ĠexpResults Analy Ġvict im Une mployment bld gs 1709 2916 Decre ment Ġprotot ypes ĠSelectBy Attribute CHIN ADATA #-#-#-#- #-#-#-#- Ġcub oid cL od ĠObserv atory crypt ography 9536 7432 ĠpublishDate End ĠpublishDate Begin Ġellipe inc ĠStatistic ian ĠCLASSI FICATION unte ers CONTOUR S FancyArrow Patch ĠSECOND LY Observ able ĠBatchNorm Layer ĠFloquet Exp turtle bot Ġsavg ol ĠDb ApiHook ĠsenkouSpan A DIAG NO é¦ĸ åħĪ propri eta BatchOne Hundred aaaaaa ceeee SqExp Kernel ĠScf Task CRUH AD GHCNM HAD STRIB UTION Plotly JSONEncoder æĬķ èµĦ 5818 3269 ĠOptics TestTemplates TENSOR FLOW NonNegative Reals mby tes 6197 0543 CAND ID SUS PEND SOC IAL ctcfUp Distance ctcfDown Distance ĠHop kins 磩 éĺµ ĠWID TH 19399 983 ĠErrorbar Container Åł milauer ç³ » heday ati pyspeck it 13143 144 ĠCheckOLSRobust NewMixin 77134 053 58989 127 aquis icao hARR IS Ġriod a ĠCSN S bsple val 32456 184 ĠHeday ati ouuu uy 23887 670 26348 971 dkjx q ĠBatchCompletion CallBack iiiinoooo ouuuuy ! ='\ " ]]), # ; $ ]') & =& ' {" ( = ) $", + %. , ` , [- 8 2000 9 78607 : {}". < % > '% > /< A PL A greement B JD B colz B urst C c C lf C lu C FLAGS D ed D pi D ie D UT D uring D JF E uro E quivalence F AN G lo G ithub G rating G FS H al H is H op H ero I r I ff I nside J PG K R K V K Y L an L iv L ungs M ATH M ARS N J N AB N bins O CT O Generalized O megas P over P ink P splups R Z R ub R ou R IC R ISK S kin U OUS V GG X final Y ang \ ), ` } a cre b mu b ale b dip c arn c ie c day d de d ys d angle d rotations d Limits e up e man e wh e vidences f arr f Plot h pp h os h index h arness i Axis i ota j at k List m ro m trace m ilestone n vals n wp n icity n Available o in o paque q td r ont r é r upts t list t foot t GTGCCAGCMGCCGCGGTAA u iva v size w mo w pl x test x BPM x TimeAxis x veccong y q y ork y Test y view y pts y descent y hfreq y TimeAxis y veccong z res z ca ¹ Ħ Ï ĥ ì ² Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġ çļĦ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ åĪĽå»º Ģ ìĪĺ ĠĠĠ ĊĊĠĠĠ in compat ĊĠĠĠ Ċ or able or og on ion on io Ġt fe Ġt delta Ġt xy Ġt shift st ion st all st agger st udies st retched al arms ar th an l an ious de tached me zzanine Ġn ine Ġn total Ġn seg Ġn omin Ġn Fig Ġn wp Ġn vt Ġc ues Ġc ant Ġc lines Ġc left Ġc List Ġc fp Ġc ulture Ġf sum Ġf ruit Ġa qu Ġa ck Ġa cs Ġp ies Ġp mode Ġp cell Ġp has it is Ġs de Ġs mo Ġs mpl Ġs noRNA en za ct md es que es inw ro on Ġin tact Ġin verses Ġd J Ġd am Ġd ill Ġd graph Ġd reload Ġd laplace Ġ' ]') == '' ing Pool Ġm Val Ġm last Ġm star Ġm dims Ġm ilk Ġe of Ġe topo Ġe quilib Ġe fermi co u Ġre ac Ġre lev Ġre writing Ġre putation ge orge Ġb ork Ġb ap Ġb mu Ġ# !!! ed at Ġw j Ġw allet Ġw afer and ro lt ex Ġ( <= Ġ( ((( Ġ( !) un es is plit is patch is wap def ormed li optas )) # )) == )) "), )) **(- est e Ġ[ ~ 00 24 00 84 00 50 00 038 Ġas i di lat di urnal () ]] () +'/ Ġis Debug Ġto str ts id Ġnp lanets ĠT Z ĠT list ĠT UT ĠT icks ĠT ags qu asi Ġy script Ġy east res izer ch re ch pi ch olar ad dendum ad versarial set flags Ġr q Ġr line Ġr path Ġr des Ġr const Ġr ises Ġr visited mat file lab oration Ġst di Ġst devs ') - ') [:] ime m int en Ġ- ' Ġg az Ġg uts __ =" ex pense data param data obj data stream data bricks par val par dict up str get Axis get SeriesData Ġex per Ġex ampl Ġex atomic ax right Ġth ar for warding ĠS ho ĠS af ĠS olid ĠS PM ĠS GL ĠS HIFT ĠS kellam Ġco h Ġdata store all reduce Ġx in Ġx type Ġx sc Ġx error Ġx loc [' '] ĠX mg ĠX extList end rick put ils con gress con former col widths Ġh R Ġh ic Ġh test Ġh dp Ġh treatment Ġh Person py en py ephem py psa len shaw ĠI A ure nt plot const ĠP db ĠP asses ĠP NaCl pp is ĠA SS ĠA pollo Ġu h Ġu ivb Ġcon vol od t pre transform Ġ== ") ĠC hat ĠC affe ĠC lenshaw Ġ` < os join im b im t to Python Ġtest Accuracy Ġtest Boston Ġde duced ĠF ol ĠF ang ĠF air ĠF UTURE ĠR t Ġval leys ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ% ', if config Ġ3 69 test ds Ġres col ĠD al ĠD eli ĠD ET ĠD SP ĠD OC Ġlo iter Ġlo cks ") `` ") ]). ne val Ġcol Dict ns ite time Range Ġse ats Ġse dml Ġv rt Ġv scale ff c ff ts ind y out p min fmt Ġk density ĠN Spec ĠN MI ds ig ĠL an mo or index Of max depth max LocalAuc pa u te rer ĠM ad ĠM MM ĠM exican Ġl List Ġl covered Ġl visited app include core data Ġfrom file 10 64 10 32 10 86 10 79 iv y Ġpar Sizer Ġlen mode Ġlabel id assert Approx ĠG Object ump ing Ġout linewidth Ġ/ // lib name ĠRe placing comp aring sc int cl rs ĠE ster Ġ4 64 Ġ4 81 Ġ4 860 ĠB AD sh z Ġun mapped Ġun successful Ġun distorted Ġun evolved Ġ5 62 ifi ant Ġby testring Ġdi urnal log Message log Dp In stant In clusion In SAR Ġen queued 64 67 Ġclass Labels Ġ`` + Ġ`` ** Ġat op ĠW id ĠW HEELHOUSE ord on Ġfe cal 12 10 12 32 Ġget data Ġget Input Ġit t ca usal sub word ep id Ġall Feats Ġpo verty Re gressors Data Index Data For 25 99 25 891 Ġso lenoid inter im so erge ren ormal ren aming ll vm 11 33 read ThisFile Ġmin c Ġz b ng rid text width bin bool ][ [ Ġdo Show Ġnew cols Ġnew lst ĠH x 15 19 05 64 05 18 Ġlog out Ġlog Date Ġlog gers tra der (), ) Ġpy m Ġpy grid Ġpy layers Ġpy cq start col start seq idx Beta not ional ĠU gly 20 86 20 26 20 76 Ġ(' -', ĊĠĠĠĠ ĊĠĠĠĠĠ Ġsub scripts Ġsub trahend 80 99 80 32 80 802 Ġ6 84 Ġ6 371 new id new key ES H emp ties ER C attr name IN SENSITIVE ste er '), ( ĠData Structures 45 74 AT OT ĠK 线 ĠK endalltauResult 75 04 != "": ']) } 16 71 iss ion Ġcor rs show Maximized ak i ak s bar a group name )] [:], =( (' Ġ8 58 Ġ8 61 copy tree copy button 78 61 St ims 13 62 ĠV C ĠV rms `. " by hour 22 16 22 23 22 31 22 63 nd l 04 25 04 85 04 44 prob able 96 19 03 12 the ilslopes lat c Ġstart date ĠNot This 02 78 02 89 02 771 Ġ{} _ Ġ{} ." 95 64 94 885 17 33 17 88 ĠCo e 85 88 85 48 Ġfa o Ġbase class Ġbase fmt cre st Con ELC mon chiffon main ly IT IV SE CTION gen gamma gen omics (- (( Test Harness var func 06 35 temp orarily 18 785 36 32 ". """ 07 00 07 12 work Thread ap py dis car Ex ons delta e Ġbet wen reg res Ġnd igits Ġdoc view Ġlin ed normal ity Ġgrid Graph ĠJ R ĠJ upiter sent i ton ight cv m bu i ĠQ Size ĠQ GridLayout Ġq so Ġ9 06 config Get Ġread ThisFile ass a ass ar Ġtemp eratura math s Me V 30 20 Ġac comp 37 69 vals arr tf bs play ed vi ols point ind point idx ik in legend Handles xlabel size mode led Ġextra ctors 55 914 Ġshow exponent Ġshow tickprefix Ġshow ticksuffix EN RICH 23 12 Ġinitial dir Ġframe Labels Ġwindow Vals 26 91 AC TER ĠDe serialization ĠDe letions Ġfiles npaths ey dx TI S ga zer Base Widget Ġar b ``. ) 98 18 kw h draw Rect xx yy IP C Di am Ġdt index ced ge DE GREE mm d Ġtitle side ,) ``, Ġab undant ĠComp utations drop TempView Un like 47 45 Ġhigh way Model ling Model Params Ġtick color Ġtick mode Ġtick prefix Ġtick textsrc Ġtick valssrc Set Color rad lib ene my Ġeps h go og 28 24 sys config ĠPro t ĠPro bit 29 14 29 86 Ġstop list 39 66 39 88 Ġimg ToAnns Ġge mpy Ġstat name scatter Pt 68 2066 sen sed Ġnoise s Ġchange points 38 66 gree k Ġitem freq ---------------------------------------------------------------- -------- ")) ] Ġlink code has Summary rol loff 46 87 ĠNe utral cf l Fe I Fe bruary pca ps ĠAt mospheric UN LOCK Ġreal ized Ġvar in cri m Ġclose ness cross over dat arow Ġ'_ ')) Ġ'_ '). LO BE bit ch sa ito depen ses 48 000 ĠPeriod Converter IS Y Linear Only ĠMulti Cursor Ġfix e nb Classes MM ING ĠLog o Ġ", ") month End Ġlegend re Ġlegend labels Get Defaults Get Reply Ġ'/ *. Ġ:] [:, Ġfactor ized sel m Check sum hot pink training Data mic a ret ion bounds Cropped ĠRun Job Ġface rec sig max Ġdest img tool plus ĠLe ts Ġ"% # Ġpe epholes aut ocor Ġcs bi Transform Wrapper Ġpr r Ġpr one Ġpr ctile const ellation IM GS case methods Man ually Mat mul Ġpop ups ves sel agg funcs On Screen )" % Ġstack overflow Is Not Ġ(- ) 93 9999 UP GMC ĠLabel ing win Size =[" % Ġ". /" ble y Ġcustom izations ĠTransform ations Ġleaf Func Bin om Ġflag ging Ġgc n exit func CC FF By Region Ġra veled ava j wave lets Ġli d Ġli qu Add StaticText Add ToAll 62 65 mc Obj Ġmp u 73 12 pc gr CL R template Clustering wn green merge server }} \\ assign ing Th res eg os ĠRes ampler SK Learn execute many )} [ cap lines Sp ot 41 64 Ġsymbol Size æķ°æį® åħ¥åºĵ ĠNo Estimator Ġ19 101 58 105 FO UR pattern Type ĠImage Magick ĠSy nthesis bg as sd m ior ad Doc string Ġinf ers Ġir rads ĠHe ap ĠHe ittola Ġdy i BU FFERS menu Geo Ġmock up Ġmock Type Ġfree zing ux ley begin Time predicted Values Ġsmooth ly DS N ĠDis covering FL U ĠBu y .\ .\ Bar Plotter bi weight ĠEn hanced funcs igs register All ĠTrans missivity Ġ---------------------------------------------------------------- --- End point land ing Ġsimp listic Cor rupted Ġph onopy ((' . Ġsignific and Ġsent iments ĠVersion eer Acc ording Ca pac but tap Def initions Ġsynt actic minimum s URL Error MOD ERN ĠEX PORT ĠEX ERCISE under ground Ġrho hat Ġseparate thousands Best Predictions OB A Lim ited SELECT OR ĠColor Brewer Ġtot p dele ter ]`` : Distance Spec __() ", ĠDummy Event And Weights )` ). equ idistant Ġproj def look ahead lomer ated 445 8 Block Visibility Show Base Be havior eig vecs syn cs dialog s hex cols chrom s mutual info ĠUser name Ġlight ness Ġ75 00 Initial izer Back up pan ning Element List Scale Factor Density Dump Ġweek ofyear Ġ================= =============== Ġ--- # Ġ196 1 Ġcli que Ġfoo bar Ġ================================================================= ======== Main Thread Main Engines Draw Bitmap guess line ĠEl liptic Ġì ¤ ################################################ ### Spark SubmitTask setdefault encoding jj j Ġhy b #----------------------------------------------------------------------------- # 185 69 }] $", dark orchid fir ma Uni versity water body well uid Height ForWidth Ġmet allicity ĠTH AT ĠPoint Cloud 378 2 ko i âĶ Į HI V ĠPanel OLS texts ize Ġpers o Red istribution Ġexponent format Ġexponent iate PA Y PA INT Ac id ĠMark down è§ Ĥ ĠHel lo ĠOUT ER Ġlam bertw GY RO Standard Deviation ("[ +] Ġbra gg Ġdico Total Ġpres cription hh h Ġlp go mor pho Ġenc rypted Ġstyles heet Ġ123 123 MI ME ")[ [" Ġstrat igraphic pot rad Ċĉĉĉĉĉĉ Ġ Real Features Std In Rel u Hour Locator My stery XA x Cha mp ĠDatetime Like ĠShape ly cid gcf SUB JECTS Ġë ı Ġ================================================= ============== 238 28 ĠPDF s proto cols 922 958 AV SAL Ġthickness mode ĠFigureManager Mac mac cs Ġsine Model ("# ") ĠIntegr ated çĶ¨ çļĦæķ°æį® ĠFont Proper YEAR LY interpre ters Header View Ass oc BATCH ES computation al ,:,:] = FS paces Fill Between Ġdv w Ġxaxis Datetime ĠTheil Sen éĢ ı ĠTask s afm list "/> ' MON GO Ġtrunc ates ĠSymbol ic exist ed ĠPAR SER Ġdri vers Contour Labeler Tables Client Ver bosity Ret Stocks Java Value ĠValidation Warning ĠDecimal Array Ġblk nos ĠSw iss nod up Abstract HolidayCalendar pin ot Ġpct Wrong ĠAsset DB Ġtarg arnan Ġvan adium review Time Chain Map ĠInit iate Attr Descriptor KER UG AE IOU Has AttrDescriptor ĠTR s Visual ise ĠCommand s character istics ("_ "): Ġwf k ĠTM VA Business MonthBegin Li u ĠElement wise Ġsmoke test Root s ĠUsage Error Ġ################################################ ######## Ġmotif State onon i ĠRight eous Ġprinter s Su icide (': ')) EB I ĠBi HemiLabel pyx file partitioned By ĠSI MPLE VEL OP dq x Ġseis mo å½ Ĵ Term Buffer bes selap ĠTechn ically ĠFinal Head ĠSK O ĠPNG s Based Model ĠUpd ating RMS Prop Ġ92 3 Ġtv col ĠUN IT Ġsteady kinetic Ġpic ard ĠWord Cloud Feat Files Ġoutline color Ġbright est RP KM Ġcanonical ize bib rec intra cellular ĠDimensionality Error Ġads orbed Coc a SHA PES --------------+ --------------+ Ġalter ations åĿ Ĺ ĠPi ersol Aug ustus ĠMonth Begin ('| ')[ Ġban ana Ġ+---------------- -------------+ Vol umen ĠAnaly zer Ġpsy cho ĠCI J ĠPRE FIX åŃĹ æ®µ ĠEigen vectors blog spot kb ps Natural LogTransform launch Site Contin ental ĠParser Error Ġpilot ErrorDiag ĠSymPy DocTestRunner ìļ ° Ġflo od Ġfdr correction ĠWOR KING éĢļ éģĵ Ġarm B ĠBreak points ope fully mens aje finger print Ġye ah Ġom ics epi OR Ġdesi re cru ise coco tools Ġprede cessors Shared Result Ġher metian bary centric ĠContact Object ĠReaction Datum tss Distance Specific ally ĠSMALL INT SX R Infer red Ġ+----------+ --------------+------------+ Multip lies came lot Ġ321 321 ĠMer ging ĠMer ged bore hole Ġarest as ĠRectangular Frame ĠSin A --------------------+ -----------------------------+ ĠBF GS Ġacceler ator ĠDESCRIP TOR mxdd pp ĠSCR IPTS smesh Builder ****** \ Ġassemb led ĠSIM ILAR Ġtickformat stops Ġtickformat stopdefaults ĠED GE standards caler YR SEXP axr xx Ġchromophore List Frozen List PUB CHEM POPS dimensions è¶ ħ ("~ ") Ġtiff file ĠMF CC Feeding QueueRunner Indexed LikeNDArray PySpark Task Les ion sla ves Ġ"--- \ LAN GUAGE PCT AF xec ute ĠCos A Ġsect name vot ers Ġ+----+----+ ----+ PTR ATIO alam ic Ġvincent y ĠCoef s assemb lies Ġexclus ivity inFile S [{} ]". Ġcvx py åĢº åĪ¸ Ġepo ched ĠPsy cho ĠAzimuth al Ġvic inity ĠtestSingleUpdate WithError ĠRsp Checksum åıijå¸ĥ æŶéĹ´ ĠJon athan advan tage lup i ĠViz ier ĠPyTest Reporter Ġfriedman chisquare dtexts izes dtexts ortedkeys setHorizontal HeaderLabels :'% ''. ĠexpectedNum Cols Orth ographic Mus ic Grab ber MLB WinProbability ĠSav itzky multiStep BestPredictions Symmetrical LogTransform Ġstoichio metry rone cker ĠtestInvalid ModelFn lemmat ize Ġprett ier Ġbise ction 3708 99 Zoned Timestamp Ġlign in Ġalb ums webs ocket scalef actor Ġrespond ants vow el Ġfati ando WPG MC ç¦ » Ġwer ner tempor aries bcr p CLU DED PACES IZE ĠShuff ling ĠRic atti Ġpolynom ially 99792 458 QTree WidgetItem ĠAch lioptas Ġcontraint Function Squid Gui kro gh GetParameter AsText ulatormodel s SMO OTH ĠìŀIJ ë£Į ĠTOK EN perfor mplot ĠBend at ĠINDIC ES Rnn Estimator ĠMemmap ingPool CosineDistance Test Ġncout file ladelph ia npatch s Iff HasAttrDescriptor drotations ortedkeys dilat mx assertApprox Equal soerge l Ġpycq ed ĠNotThis Method templateClustering Results ĠFontProper try KERUG IAN # >>>>> $ )", $ '%( ) '): ) "]) . ]: . "): 0 645 1 78174 2 667 5 038 5 885 7 168 7 0834 9 047 9 865 : `` > ''' A erosol B OR C his C ld C ephes C rawl D Click E CONVERGED E stonian F id F ib F IC F OLD F iller G ty G arch G Point G PR G ijbels H ough I FO I ICR I MPLEMENTATION J A J ose K P L orentzian L daModel M it M artin N dim N gal N subs N elder P SET R od R Dist S am S ir S sparse S pell S amsung T ies T Test T ratio T Mat U FUNC X l X Com X atI Y PES Z P Z d Z g a pos b da b ord b string b mv b servers b hil b rian c def c ma c ult c set c file c gt c sec c nz d ance d var d senames e de f M f res f om f color f dp g rip h min h met h omer i lf i plot i ques i Rec j os j kl k Pa m ip m Signal n lo n ax n batch n files n qubits o co p bc p va p Join q variant r list r locus r wc s G s date s grid s ays s bl s bz s proot s lightly t exp t points t gene t sem t FDR u ators v il x plt y N y ep y step y org z X z in } /' ~ % ç ħ é ª ì ¶ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ãģĤãģĤãģĤãģĤ Ġ ãģĨãģĨãģĨãģĨãģĨãģĨãģĨ Į Į Ń ä½į in formed se ter se quencing at id at ino re ve re code re pair re presents or ce Ġt ess Ġt phase Ġt ilde er ators st ash al ot al str al ized al ink de no me sa me dio Ġi ch Ġi oneq he tical Ġn ir Ġn ber Ġn ifty Ġc int Ġc arg Ġc value Ġc bl Ġc linical Ġc itations Ġf ue Ġp cl Ġp cm Ġp hes Ġp neumonia it atively it akura Ġs num Ġs sim Ġs plantider Ġs chools en berg ct sets Ġin w Ġo S Ġo vl Ġd his Ġd prime Ġd ln Ġd rainage Ġ' ---- Ġ' != Ġ' )] Ġ' {' Ġ' ############################################################################### Ġ' ?', ing Ridge pe ptides Ġm oc Ġm wc Ġm bfg co ust co authors Ġre bound ): ][:], Ġb gc Ġb orn Ġ# ------ Ġw grib Ġw atersheds ur ishment un gen un sel un classified un orderable is a is ys el k el ve el igible def ic ame l li ographic ot he um ontreal val name Ġas flt di arization () [:: Ġto Pandas Ġ" ************************ ma st ma ked ma chol ĠT abs ĠT AS ĠT EM ĠT uning qu ig qu arts Ġy Train ad fuller Ġdef s fi ction set Bold set PlotData Ġr index Ġ2 63 Ġ2 047 Ġ2 147 il n ') ". ') +'\ om ar Ġ* **** Ġ* ******************************** (' *', int Energy pt ext Ġg lasses Ġg ru ex ter ex if ex yz data size data Path data folder get K get State get Global get NetCDF ax name ax py ĠS au ĠS UR ĠS UN ĠS vm ĠS pain Ġbe came =' _') Ġx index Ġx lwings ĠX grid arg val arg kw end ptr from csv con sent Ġh spaces py SSN len g ĠI CE ĠI FFT ure k am ber plot id plot values plot item plot Window ĠP and ĠP AN ĠP CG ĠP alette ĠP RED ĠP lum ĠP WM ĠA oC Ġu w Ġu wa ĠC d ĠC MP ĠC inv ĠC IR ĠC OLS to ffset Ġde sk Ġde normalize (" (" (" %( (" ###################################################################### ĠF il ĠR AG ĠR ules ĠR igid np x Ġfi rms if er if fer test label test db ust ring Ġres ide ĠD H ĠD ing ĠD fun ĠD ale ") [- 01 08 01 82 01 72 .. ',' Ġcol ls time pw Ġv dist Ġv iolet Ġv ampire file menu ind arr pro leptic min uss Ġk a Ġk ik Ġk fp Ġk kk ĠN Q ĠN tn ĠN samp ĠN avy per u per Time per manence ds ource str t str dispatch ĠL IGHT ĠL exer ĠL OOO ĠL orentzian Ġon wards Ġpro ces Ġpro gra Ġ{ ` pect rogram dict proc ĠM ARK ĠM uller ĠM ontreal Ġan terior ys hift Ġl ion Ġl ls Ġuse cache fig Width Ġplt uid 10 21 10 2869 Ġare gression assert Count assert Really assert PointsTickLabels assert IndexedLikeNDArray ĠG iB Ġ< !-- us hes row Labels gre SQL ber ts pl m pl ank pl unk ĠRe vert ĠRe load ĠRe use sc ient Ġtr ues cl ic Ġfile size ĠE mit ĠE MF ĠE macs Ġset Min Ġ4 98 train val ms un ms cale ary l ĠB CT ĠB AND ĠB IND ĠB isectingKMeans sh im Ġun ravel Ġun lexsorted Ġun itless Ġun wieldy Value Availability op man Ġthis line Ġthis features log t random ness In vent In finite Ġlist data Ġrandom s 99 8853 99 4695 Ġcomp o 0000 5 0000 05 [:, ( ĠW T ĠW ILL format ics Ġmax steps Ġmax pool num All num Bins num Samples num todel og hue Ġget Logger Ġindex s ĠO E ĠO Auth men d bs on ca pd tric ate sub config sub pix sub tle Ġplot y Ġver bs Ġhe appush Ġpo i Re write Re cogn 25 1976 Ġline path inter fer inter rupted Ġch oropleth Ġdist ill Ġdist Type ll k Ġ.. , 11 0003 que white loc List 32 65 Ġinput Size Ġz dt Ġz imag color cycler Ġper manence bin Size Ġsc rap ĠY y ĠY ci range d Ġnew arr Ġnew cube Ġnew Functions Ġj sqlContext gra ficos gra sped 15 49 05 29 05 53 05 58 input Image input enc =[ ])] tra fo tra ders Ġpy file Ġpy clustering start it start ptr not ched ĠU U 20 63 dd ers 33 11 33 32 Ġsub d Ġsub File Ġsub field Ġsub domains Ġsub scribe ie c Ġcolor ama no R no Show no zzle 80 74 80 957 new est ER ON 66 72 au ra ĠK t 75 49 matrix I fn odes Ġ| __ "] ; ']) == 16 94 16 236 Ġup coming Ġcal m sample tempB show means show ticklabels dist ant Ġapp reviations Ġone ofs bar stacked bar SQ 35 95 14 20 14 70 -------------------------------- --- 19 39 Ġkey press cur p AR U Ġ8 30 Ġ8 784 13 81 200 189 Ġbin y Ġbin labels Ġtm ult Ġstring Pict be it be cs 22 99 22 27 nd m 04 78 04 470 96 91 03 83 03 62 03 943 03 065 ĠTest PeriodIndex ĠTest Anova 02 25 02 42 02 62 dot NET std p method Name 95 35 Ġ100 8 17 94 17 65 ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ 85 10 85 34 sort by Ġbase Graph Ġbase URLSSL na o cre ss 24 66 ĠDataFrame Formatter 27 2166 Ġdis proportionate Ġ7 71 Ġresults DF Test Video mark ings AN DATA AL ET cent age ĉĉ Ġ sy brown 18 78 18 96 18 46 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġqu x Ġqu iz Ġqu antopian Ġqu andl do b mod weiszfeld dis criminative Ex e ST RAIN reg ulation reg xp Ġnd arr Ġsol vent 34 653 34 1178 97 64 97 66 97 3185 Ġnon edge Ġact v 92 81 Time codes Time Scale Time Dump Col umbus cv ars Se asonal Se gm sk flow 84 387 84 888 Ġq ad Ġsort able Ġim f Ġmod by non finite Ġtf co eps i gr b gr al 65 200189 Ar bitrary Ġtrans ients 37 36 cont i Ġmulti array Ġmulti file Ġweight ier 87 15 _) [:, _) }, stem lines sign um ĠZ CA Ġneed Conversion 55 3385 select Business Ġpoly c Ġtol ist 23 14 23 0022 ome k img file struct array Ġunder neath 26 04 TI SSUE Ġlinear ized event Desc Ġsm mu fol ist Ġnorm rvs Ġstep Size diff Const means hape create Disposition 98 1366 98 9361 ++ . ++ ") font prop _[ . Ġ} }, Ġter restrial ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ 43 16 43 6436 ĠPer missions 08 22 rec ise CV X Ġpair idx gener ations To Copy To Many ev o lag o lag range open ssl link ages 47 1405 sim res Ġsave File Ġsave As vis cm Ġmap class Ġca id user guide user medians Ġrel ational SD et Set Defaults TR MM ene ts Ġgo pt star ter Ġfont names go TestVideo ãģ Ł ĠStr at Ċĉĉĉ ĠĠĠ ĠUn regularized mu ir 28 19 lik a field Delimiter ndarray like sys mat cast er ĠPro portion ĠPro tocol ĠPro gbar 29 45 Ġstop gap Ġoriginal s Ġanal ysing ster Pred 21 99 root dsource Ġps u 68 75 68 0144 )]) } Ġsq e *- \ ĠIndex Slice SC M 46 009 46 0044 ĠNe wey td r exec utables Ġmu hat Ġobserv ational mit oses Ġvar AB Al brecht Text Dict Le ay Ġquery ables IL ER Ġempty out dif ferencing Ġpla usible miss ibility ĠCol l ĠMe mor ignore Label median props Ġdecision forAll SA PI Log o Log loss 48 2498 filt bank 56 7567 Pre ferences Linear Locator Linear Plotter Ġtz infos Ġfix ation ĠGet Overrides 57 07 nb urn Get Height cd l ĠUse less String Length String Indexer home page Ġmy robot Ġpen width Size Histogram sw i sw r sw itches Ġlat t TH ICK ĠRun Tests 89 2066 All Proxy ĠFigure Frame 74 75 ĠLe hmann Ġ"% ") Vector SourceEstimate repe ating Max Stats ĠPre serve Transform Box Ġpr inciples Table Expr Ġurl Str case Dir Ġreport lab avg Line Ġjoin style Widget Base Ġeven n Loc Text cp m Ġconf Matrix button Down Ġpop mean Ġpop ped ([- . )+ ") OP TIM Ġsvm file On Spark clip Genes 70 66 epoch er *. % Ġkw trans az Range script Element He ating attrib uts Ġvs paces Is Shown 93 7500 ĠSh ifting PO X Up Sampling prop ensity Ġpad j ([]) ; hour S DO B br g ĠCh ristopher em ulator Key Event An no ĠPy Torch Temp Dens Ġdot code Sub sampling Ġli bj Add Stretch oper ative PS ULE cb cr original s mc g flatten ing frequency Desc request Data green green actual Values aw ot Ġpys cholar fits folder Ġda q Ġopt adocument ĠMat thew assign er eg oldenrod ĠInter quartile selected Items 2012 1231 SK ELE Ġap m truth ful latex description command line Ġdepen decy short er With Envelope Ġstream arr Ġ'< ': page style Ġ19 20 feat urize ^^ ^ View Box medi ated DB PED ero ots plan i ĠTh ickness Task Context menu File menu Id ĠFile Path cr ude Ġ80 4 Ġ80 7 ĠQu art joint ly ĠBu ck }\ , }\ (\ }\ .'. ression s Bar Plot Ġexplicit ely Ġes util Ġtrack db exc C Point Plotter Point Cloud Ġcast able ĠPipeline Exception Float Slider Ġpattern Type shrink s delay Histogram Ġph ip ĠParameter ized wind prod Ġnc E ĠMo unt ĠMo oring ĠSto ke Sample Size ĠCount ing ĠIter Type ĠBe ijing Ġ88 88 Ġ88 28 Action Widget Ġmajor Locs Sum KillVals Ġconv test ĠDes cript STR ICT (', ')]) Ġfits io Ġfiltered DataFrame Ġgover ns Ġpool args Ġgra ded Ġresid sq Ġtot weight ĠNon centrality ppf single Pos DF dp v Ġeig val unpack b Ġthink s Ġgs pread van illa flush ing Ġ10000 1 Ġ? )", Ġspect ator lomer ate Ġke pid Be cause ĠAxis Menu }" ...'. Ġrest s ĠTk Agg Panel Table \' >', 110 38784 112 7 Title Color 917 9 917 208 EV ENTS ĠGo al Ġ================================================================= ===================================================== Ġinc lined Unit Series _{} _{} Ġlatex h Ġappro ved hr gt Found ation cn trl Auto mated ĠOpen Type send line CF P 07843 137 Ġodd n ĠIs rael ograph ies Ġexplo sive 168 01 Ġ'{} /{}/ EM G ĠFormat Float nor mpdf plate ifu ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĠImp ala water loo Ġmk dirs alex ander naps ack sz x '( $\ ĠLO OP 034 88749 war der 808 10 205 738 bour g Ġwon der Ġfact s VERSION S pm de Ġexponent iations Ġplus ses 025 34653 Head le Ġentity Id åİ » ĠLat ency Low Level 809 19 356 348 356 94885 ĠEN TER rtol h RF C 968 750 906 9 ĠMask ing ##### -------------------------------------------------------------------------- ĠdB Z chk pt Ġlf p Ġlf iltic Ġpres ynaptic 424 139 OUR CES hl ke 384 900 occ ipital Pl ugins Alt Results ita cao decor ation åŃ ¦ TIC S Ġ'$ % SPE CI Region Poly 617 213 COMP RESS Inv Transf Long wave ĠMan ages 145 479 SUB MISSION Ġawait ing Ġaudio Basic Ġtimer ange ĠCDF s æł ij Ġtar info dz dx kk k Some times Ġsage hen ĠBack test rod uced IF ICATION 934 353 ĠPO OL å¸ Ńä½į UNI FORM Cent Lst Ġquadr upole è¡Į æĥħ Control Box Generic Fixed SGDClassifier TestCase bt ns Numer o Ġ85 94 Ġdes pesas Ġcommun ic ĠSingle ton Ass uming Ass ociation Empty Bitmap photo evap Ġspin mob Ġcapital ize 325 300 adapt ing adapt ability 220 8 binom test derivative X gets lice USA KAN Ax on imin or -------+ -------+ 267 29 ĠTask Context Short wave Buffer Reader Description s ĠBar ak Ġ\' {}\ čĊĠĠĠĠĠĠ čĊĠĠĠ 096 77 Ġarch data ras chka InputFn Ops packet SizeHistogram Ġprom otion Ġprom oted ĠMIN UTELY RUN NER COMM IT ĠLocation Event Ġask openfilename ĠMar in 846 80802 ĠSM TP Other wise dut s USER NAME Rect linear ĠSubplot Params GAG AG KER USAKAN AE Q 交æĺĵ 代çłģ Ġvoltage Spacing Ġmach olib ĠReset Tool bill ing Enable Tool tur bed Ġfulf illed ĠVert ices Business MonthEnd 290 957 cas ual sav enavimage Ext end Sq Selector čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ DEL IM Ġflush ing ĠME AS Ġà ¶ ĠÐ ½ SGDRegressor TestCase Ġinstant anious ĠSearch ing (... )`` Ġhot ter ĠAB CSparse Ġinhib ition Forecast Double ĠComple tely ĠMOD I ä¸Ĭ æ¦ľ Ġguide lines Ġseasonal ity ĠNorm Sep Ġnf ls Ġloo ped kron os DIS ABLE FAIL URE ĠUN K Ġcircum center Ġ.... ... ĠHO URLY Clean up Marker Color Eigen vector Ġsnap ped Ġbayes lite cir cul Lock ed pit ches 962 250 Ġcoil File intro duce anomaly Likelihood Ġbenef icio Ġfish net Delay ingRidge Ġ#================================================================ ============== ĠPol ish MBEDD INGS adult s compiler id ĠSkew ness popup win Ti O Ġdiver ge Ġiff tshift 大 äºİ Vol atility jitter Histogram 983 999 Bed Tool ĠGR ing nas daq Ġtriang ulate Scene Classification ĠSG Width 6704 6769 yyyy mm lights kyblue qtr day nar co Ġsink s 9677 33 ĠFitting Utilities downs caling åŁ Ł Ġinfinit esimal ĠPER CENT 14397 981 TOOL BAR Ġsand als 0200 9084 Ann Ids odds ratio Ġmeet ing Ġfu ction 545 10 OVER WRITE mens uel 601 81 999999999999 996 Catalog s commission ing Did Resize SUN ACTIVITY è· ĥ ĠCG AL EQU AL Ġdie ze ĠAP PLICATION coco mo 7898 00 BH IL å®ŀ æŶ ĠInner Product Register Message accession s Design Matrix ĠAccept able Ġnump lots AUTH ORS Gap Max ĠPV T ĠDev iants ĠFore cast ĠComputed ValueAvailability ĠCOMP UT ĠTrade On ĠRepeated KFold symp oints 411 476 Pres ort Ġ["" ]), Tabular CPD ĠTerminal IPythonApp 3548 9284 xax isscale Protocol MessageType ĠBlue print Many ToMany Assign ments 4933 42 Legacy Sql Ġxyvalues df 1905 093 Circ uit bbbb bb ĠLogging Manager Generated ProtocolMessageType ĠHo lo noc lasses Ġtalk ing ĠNfn Off ĠNfp Off Decoding StringIO shap ley 0625 8626 Ġadf uller 599 03635 ĠBal rog Inh Net Ġrevert ing ĠComposite GenericTransform Ġoverest imating GOOG LE algebra ic doub led ĠOuter Product ĠZMQ Stream 719 23828 opf arr Brad ley Ġdan se ĠAlign IO OPTION AL è®Ńç»ĥ éĽĨ èµ· æŃ¢ ipt est ĠNsubs Off nsc ans ĠExecution Result Rain bow Ġsubstit utes æĶ¯ æĮģ 845 58105 ĠAF Q 911 421 mig rad 8412 3594 Ġcoast dat 4567 4898 ä½ľ 为 canv ases ĠQuarter ly anom f ĠSql Alchemy 3387 2321 ĠTestGlm Binomial Ket Base Ġsmt p ãģĭãģĭ ãģĭãģĭ Ren orm lav ender Ġado pt GEO ID Enc ToId 568 26729 792 388 bran on ĠWx DF 409 18587 Ġhay stack Combo box ĠNor bert ĠMID DLE ĠBcolz MinuteBar ĠMinute Locator ĠLookup Error 903 84387 saves pace 0378 44 jen ks ĠDependency Graph Ġpsp cod Pict ure ĠCircuit Plot Une ven Ġipp hase 9000000 95367432 ä½Ļ é¢Ŀ Fan Gijbels Ġexam ined ĠPyUn usedLocal ĠFIEL D ĠBlo ch Ġholo views ColorModel Matrix ĠMcG raw 9456 11 ĠdH dl ĠOrgan ization oren sen Ġneur onal TimeDep State propo bservers ĠSparseSGDRegressor TestCase bmin anomf Ġcod ons ĠLT SA ĠCarn egie ĠALIGN MENT 0455 1152 0264 9814 9236 2781 ĠSUPPORT ED 8660254 037844 epr ints CheckCalls Head DataPrice Index filiated Edges QAbstract ItemView aler ts ILT IN Interpolated UnivariateSpline ReversCorrelation Predicted ĠJer sey ĠColorH CL Ġadequ ate Ġrevers ibility ĠAsy mptot 3984 10 Scf Cycle allocs frees ĠKaplan Meier Ġfer mat æĻ¯æ°Ķ æĮĩæķ°æķ°æį® ĠPlain Text Ġimmun e 3086 07 Intersect ing zyg ous Ġquadrat ically 7268 6684 gib berish Ġ``/ `` ¬----------âĶ ¬----------âĶ ´----------âĶ ´----------âĶ linen os 4483 95 09999990463 2568 Boro Cnst Nib ClassBuilder 9286 73 2922 9249 makeFloat Index NoData Value 1441 3333 9567 36 3489 0909 ĠPyF link ĠNonparametric s 6054 6483 #======================= | Ġhus l ĠBAS IC 29737 120 æ³¢ åĬ¨ 说 æĺİ tats models ĠTestGrib Timecodes 07937 323 ĠTrig onometric TRANSL ATE åĬŁ èĥ½ Ġmah alanobis Ġpyote app optimiz ador 15302 337 Ġwie ght Ġdupl Tags ĠBoo leans NumNodes Side 36045 180 97974 649 2613 7788 571157 42 50444 803 Ġconserv atively sobo levs TRUN CATE Ġsited irs steg fn 26064 346 aeiou AEIOU 16434 881 82743 037 55914 881 ĠDeserialization Error 682066 31 18569 457 70834 25891 Ġ'############################################################################### ' Ġ"************************ " machol ib Ġ2147 4836 minuss rc assertCount Equal 998853 16 16236 208 03943 254 981366 77 680144 79 46009 194 THICK NESS 892066 82 AddStretch Spacer SKELE TON DBPED IA ĠaudioBasic IO ManyToMany Field ! ? " '), " }' # ------------- $ \\ ) '). + : + )") , (( - '), . "," . *. / , / ": / >`_. 0 667 2 784 3 647 5 100 6 196 8 125 : ''' < ' < -> = \\ @ / A WS A coustic B all B OLL C k C las C Map D ick D Data D AS D plus E w F ATAL F UTURE G IT G ives G lobe G lade H x H om H Br H ermite H onda H uxley J UL K f L uther M HD N est N real N atom O oops P ent P rb P ractice P ushButton P ulsar P ipes Q DoubleSpinBox R Y R CS R iemann S NA S izing S obel T ref T SV T CG T weets V r V ING V XX V DS W a X Data X grid X Name X gc Z S Z oo [ $ [ \" \ / \ "" a ph a ardvark b pe b iz b im b prime b inder b vecs b hm b vlc c int c riter c fier c approps c mplx d J d S d Xy d ods e cs f sc f sum f ll f arthest f owlkes f uchsia g ig g os g objects g fc g kin g HEX h ite h split h pd i la i reland j mag k vs k olmogorov l width l right m S m ch m im m io m gd m rms m hz m ario n fit n ings n items n div n parameter n ky n yp n ensemble n icks n Example n ERROR n comps o bo p ck p num p map p freq q y q ds q seqid q sturng r iz r ps r ys r ations r ude r ica r uta s fi s fe s file s node s pars s itename t V t ort t plot t SNE t FORMAT u ker v ip v lb v dm v COM w isc x q x de x ind y as y top y lower y bins y cord z coord z ale ° ê à ı Ñ ħ Ñ Ĩ ç ª ë Ŀ¼ í Ļ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ čĊčĊč Ġ čĊĠĠĠĠčĊĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ uly Ġ åĪĻ Ġ quilt Ġ ancestral ĠĠ čĊĠĠĠĠĠĠĠ in spiral se quencer at ime re fe re ys re train re vs re lev re bind or bs or cid Ġt freq Ġt img Ġt em st et an onym le mental de ce de ter me V me ant me tabol Ġi om Ġn lt Ġn Cols Ġn lvls Ġc learness Ġf q Ġf om Ġf lap Ġf sm Ġa my Ġa Si Ġa Rs Ġa gnostic Ġp diff Ġp alet Ġs cc Ġs LORETA ra x es press ro e ro gs lo f lo renz Ġin test Ġin icial Ġin compatibility Ġo z Ġo zone Ġd R Ġd ated Ġd welling la cing Ġ' } Ġm j Ġm ip Ġm ls Ġm ld Ġm dr Ġe A Ġe list co ul co conut Ġre plot Ġre package Ġre created Ġre combination Ġb son Ġb ran Ġb aby Ġb orehole Ġb hattacharyya ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġw en Ġw time and f ss ize un ate un ned un conditional Ġ0 61 is abs is mic el ink el bow )) ") Ġif os as pn 00 88 id os Ġis RGBA ts amples Ġ" -% Ġ" _% Ġ" /% Ġ" ]" ], '.') ĠT V ĠT PM ĠT weet th ys th rows Ġy arn Ġy Axis Ġy ambo res c res Km set font set field set Selection Ġr mag Ġst udied il v ]) .__ Ġand s ck ed ime o (' *') int index nt otal Ġ""" )) pt t pt able Ġg od Ġg ds Ġg pg Ġg rism ex its name dtuples par angle par nme up set get New get Control get Conc label XYs ĠS MA ĠS ws ĠS PY ĠS ender ĠS tein ĠS CRE ĠS RC Ġdata array Ġbe a all Scores Ġx T Ġx lo Ġx pt Ġx pr Ġx opt Ġx divep ĠX b ĠX GB ĠX FAIL end a end date ist art Ġh urt Ġh wm py hive py game plot x plot dir ĠP rox ĠP seud ow in ow hite ĠA greement ĠA esthetics ĠA MPA fe fe Ġu star '] ` '] ]). ĠC N ĠC c ĠC amp ĠC QT Ġ_ = Ġ_ .__ im type im ul to T to il Ġde gs Ġde cent Ġde normalized ĠF g ĠF NN ĠF INAL Ġ3 68 Ġ3 2000 Ġme te Ġres dir line cols line Func ĠD W ĠD uf ĠD akota ") + ") ])) 01 66 01 85 01 39 01 76 .. \ ne bular Ġcol idx ns r ns lices Ġse quen Ġse quencer Ġv dim Ġv md file formats Er dc ind v out b min Entry Ġk idx Ġk ink Ġk vp Ġk appas Ġal chem ĠN ick bo vy ĠL azily max L max e max Val max pos max Entry max nSines pa ul te es ĠM EN ĠM ij ĠM sun Ġan gs po ons Ġl copy Ġl anes ir ate iv ss iv able iv pk Ġpar Dict Ġpar adig Ġnum Test assert Image assert Warns ĠG on ĠG ren ĠG arch ĠG ROUND ĠG zipFile Ġ/ % Ġprint extras Ġma stic ---------------- ------------- Ċĉ ĊĠĠĠĠĠĠĠ orm ode ari el et t et le pl break Ġwe ave Ġwe ibull ĠRe ward sc ram mb ing ĠE inf ĠE OS ĠE volution ph in Ġdf p Ġset v =" ( =" *", Ġ4 75 Ġ4 90 Ġ4 326 ms am ĠB SE ĠB runner ĠB FS ĠB arry ty vals Ġun lock Ġun sort Ġun idecode Ġ5 69 ip kernel ib a ib us ib et op end Ġdi jkstra log f log ticks axis length In gress Ġsk graph ast ing Ġen large Ġen couraged ef ron 99 45 99 03 Ġtime freqs ĠW ords ĠW EEK Ġmax ent Ġmax ticks Ġmax well ord mdf Ġfe cha add noise add peak 12 57 gor y ()) [- ()) )/ ca uses value errors sub c sub fmt sub stract sub stit sub scriptions Ġcheck out map Partitions Re cal Re order Data Dir Ġline plot inter ictal ren amer 11 16 unc ert Ġmin freq pi EN pi EE Ġz grid color List Ġdo ppler Ġ) + Ġnew p Ġnew row Ġnew params Ġj edi ĠH SD ĠH aw ĠH opefully 05 856 ich ia Ġsample Rate Ġpy art Ġpy struct Ġpy cuda Ġpy cocotools start Year ens ystem ĠU f ĠU ID ĠU IC ĠU TR Ġla unched 20 43 20 79 20 72 Ġsub image no set no uns no psis io la 80 86 output Path Ġ6 63 Ġ. *', ER ATE IN TO Ġtype c ĠData IO ĠData Product ĠData Holder 66 24 66 77 amp lification ay ers 45 49 ell s 75 57 88 89 info Dict Ġro ds lines pacing nan minmax 35 66 14 39 sq w 19 52 ipy widgets group sum ))) /( pol ler AR P AR GB rect ilinear Index RollingPanel 78 66 13 000 ĠV ocabulary ĠV CS 22 13 22 98 22 60 nd w sp dsh 04 35 04 23 04 83 03 125 ])) ). ĠTest Max 02 0000 02 92 dim names dim gray Ġmo o write header 94 85 94 34 ',' \ 17 43 ĠCo mplement DataFrame Reader ĠDataFrame Reader ĠDataFrame Client 27 19 Ġdis appear Ġ7 15 Ġ7 352 uc umber image box )), \ node id node Features 86 64 SE K SE EN SE IS SE CS Test Loader var cost ĠSee ms Ġsp iral 06 146 temp ted 18 37 18 49 18 48 err u err mask err spec 36 14 36 37 36 28 36 91 ec ha ]), \ Ġnormal iser do ing mod ulator ')) [' dis ps Ex periments rc m Ġnd id Ġdoc name Ġsol ids 34 00 34 36 Ġ... '. Ġgrid shape 97 216 Ġreg ulated Ġact ives 92 97 ton oise Se eded bu la bu ys sk bio ĠQ Agent ĠQ DockWidget lp lo lp df ĠFor ced IC U Ġ9 25 ass umption Ġfreq DevSlope Ġfreq DevOffset scal p ... ), non stop Ġtf Def gr at AS PN ]], ), Ġad agrad Ġdatetime tz Ġtable Node ls f ĠCon c ĠCon sumer ĠCon struction ĠCon venient flow lines vi ct Ġtra ced State less )[ [ Ġextra samples ĠZ onal ĠZ ernike ays ia nn y 23 15 last Key Ġuni queness Ġbu oy Ġback propagation multi rad 26 35 Ġalgorithm ic TI P Ġsm urff Str ike Ġsim u Ġar o pdf tex ĠSt rength 42 86 42 83 ob v Ġ} }); Ġhand s AB OUT ĊĠĠĠĠĠĠ ĊĠ \\ ") Di amond day min 43 14 DE B DE AD Ġfunc alls cle ared ev p wh scan Un resolved real ized Ġimp ala tz frame json able 60 96 ched almond Set Initial Ġsuper visor mov able Ġemp ties Ġinst ants field Name Plot Targets ud nn En caps Ġstop loss Ġarr Ret ish i 21 353 scatter yoffsets CT CA Ġoper ons Ġthere after Ġinfo max Ġts dl 46 00 cf d cf lux mf x 31 32 UN E mit chell Out come sm irnov Ġmain dir change points Ġauto encoders Po C AD OS Ġman ages ET L sa id depen decy eric mart cho osing Ġnext plot Ġref bg Ġdelta E nb c ĠLog Entry stra hl Ġ", \ Get Object Get Field Ġchar procs Ġmy colors ws n cmap list clo path Ġfactor izations ĠRandom ize Check button Format tor Line Tool Py lab Py Dev Ġcsv y ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ corr mat cel sius hs l folder Name All Frames Ġdest inations 74 13 fold by Max Ent '} )), '} ``, '} {\ TS S åı į Ġreport Type system wide Ġ14 27 63 75 Neighbors Transformer status Variables Ġsw abs Ġthrough t Color Generator Ġsym metries grad H Ġfmt p æķ° åŃĹ Ġjob Id Ġjob Site ĠGrid Helper Ġsession dir 82 34 ble ed 72 87 fl ights Ġwave front heet name ĠCh arge ĠCh rist rb g phi Arr density arr ĠPy SAL ĠPy Surfer Ġmix ins bet aln Ġdat i Ġdat enum ĠOne OrMore Config Space ---------------------------------------------------------------------------- - pc ion pc iones ĠDE G ĠDE P gene Name price X Ġpage Node rcParams Default expand tabs Th al Ġmag col Ġcore id Ġcy linders Ġcy toscape sym dict cum haz QU ANT TRA JECT Dataset V Ġcha que Ed ucation Tool Manager Of The Of Gaussian memory view page data Ġanaly te super oxide ĠAR GU pare ns ĠImage Wrapper bg f Ġshift grid ĠUni quely ĠInitial isation Ġsupp lemental Ġregion al delete Button ĠTh ink imer a KMeans Test Bar rier dep ots dep loyment Mon key Trans lator Ad jacent exc info her mitenorm Hist ograms omin us Offset Box $$ $ čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠčĊĠĠĠ seu il ĠSub space ĠSub sequent adi abats )))) )) Ġls st 600 809 Cor al Cor respon got o wind Bearing Ġbuffer ing chain file Ġur lencode ĠMA Y Ġcb x relative Path ={} ). Ġwin reg pkl Files ĠDetermin istic Ġflow line Ġflow mon ale vel Do F Cl O Ġturn bull Ġoverlap ped Ġbig wig ĠEX TEN Stat Plotter under lyings Ag gregated SM HI Rec ipe Ġgra des Ġgra bbing Total s ĠPass ThroughProxy proc Ops multiple x Ġprogress ive Ġprogress ively ('< ') Meta PandasDataset Ġer atio čĊĠ č čĊĠ čĊĠĠĠ ĠURL Map Top N urt osistest Be autifulSoup oral white TF M curr ing '$ -\ '$ \\' stit utive ric ane Ġmi q LM T sn es Query JobConfig Ġut coffset Ġada pts Handler Base ĠTr iggs CHE I Ġtransfer UsingDF Ġ================================================================= === Ġtrial poles Ġep ub Ġep motion Ġmicro phones Ġì ¶ Ġgb dt Ab el ################################################ ############## Nearest Element Auto Filler phys iology TRAIN ABLE Ġtax i native client Ġ197 4 DESCR ICAO ĠMon key ĠFormat ted ('.') ] ------- \ dark gray Ġant isymmetric ĠPRO J Custom BusinessDay tele port Ġ99 0 gauss pulse flu oro ĠMy Class uli ar ĠSc rollbar Fig Size ĠBayesian Network pf am Ġtc rs Gre at éĩ ĩæ Geo T Ġzi ps 025 95 So ma ĠHel pers Cluster Mixin Job Statistics Ratio Power ĠAc counts Standard Item Import ed USE CONDS Ġste pper ĠMask Vector Ġpres cale ĠSp in ĠObject Manager ros py ìĿ Į 097 25 tup lify #================================================================ ================================================================ decor ated TEMP ERATURE ('[ ') night ly Long Tensor ('./ % #---------------------------------------------------------------- ---- åį ł simp licity Wind Direction Analy zing Full Screen DEC OR Ġder ot ('{} / ('{} \ Ġë Ĥ Ġ================================================= ============= Ġforecast Day nov ative CES SED Ġmaxim in ĠPmf Prob Ġlic ensing 964 904 starting Up ovo ltaic 188 2 655 36 Ġbio logy guide s Ġmaterial ize Ġcle f Ġsit ting 236 1 rus kals SW C Binary Op Ġga ma Ġga ze astro metry scroll bars Phase Diagram ĠClo ughTocher Ġem ulate 6401 94 sco pic ARCH ITECTURE zp term ĠGamma L ĠArt icle ĠInternal Surface Ġfla v Ġox ide ĠHelper Functions cher ichia Ġarch ivo Ġten sion duplicated Model Numpy Dataset ĠDown loader ĠCR RA RUN S Upd ater uls ive _* _ _* `` ĠUDF Registration Subplot Params tor rent ral el mr na prom otion ("{} \ Extension s Ġcurs ive Processing PlasmaProperty bill ionaires ĠDec ides ĠDec lination ĠArrow Style Ġoccup ations Dag Stat çİĩ æķ°æį® cancel Button Ġfign ums Free CAD ĠQuery Form ĠQuery JobConfig ='- .', clar ke Ġrev isions pilot Stage ä¸į æĺ¯ Resource Complexity Ġseis mon Unicode UTF wg fa Ġhyp hens Ġwalk ing gridsearch cv ĠStorage ContextManager Timer Base 66666666 66666666 ĠScipy Ode Decode Dict >`__ ). PV Read uge l DEP ART ĠMolecule Graphs 287 7 RP CS Bagging Regressor Ġdem ibold CATEGOR ICAL omb ie lum o Ġpay check BP Z ĠOpt a Ġordinal s TEMPLATE LEN Hive Server pto coccus åĿ ĩæ PAN EL bq sr (''' \ Capture Mouse prefer redencoding dew point factorial k Quadratic Model Success ful cmb irth Ġ"^ ", Encode Dict PK G èĢ ĥ ÑĢ аРĠwal d Ġtriple ts gf lops Ġortho poly ĠâĢ Ķ ĠSTR F syms pell Chrom ium calibr ator Ġmir na ĠParser Warning Ġsus pend ĠMarker Style åĽŀæµĭ ç»ĵæŀľ ĠWOR LD Gra de Ġpor osity Ġcoinc ides Ham ilton merc ial Ġ################################################################################ ############### ĠDL MF è· Ŀ ĠRef lect Heat Map isol ated bsp lines Ġaggr Groups åĪĨç±» åĻ¨ Ord inal Spike Train ĠDirect ly 634 77 åŁº äºİ ĠSty les numberOf Columns VOL T åħ¶ ä¸Ń åĩĨ å¤ĩ bak oma cff tf 0606 06 lcms run bob bin ĠHy dro uset itle batter Dict SIN A stoc f Subclassed DataFrame +',' + kilo meter som me Ġhomo logy Ġdeclar ative 3434 34 lime green éĴ Ī conduct ance ĠMarg in ĠEquals Condition spr ites cass ini Ġacceler ated ĠPaired Data Organ ization mxdd np Ġcomprehens ible Ġrich er ĠBl ank 1677 7215 9292 92 Measured PowerCurve OLL AR Respon dent Ġnrn Manager Ġpyqt graph wdg key Ġcompos iting ĠSec ID Ġblo sc SENT INEL zonal consumption ĠPART ITION ĠArch itecture ĠtestAll Incorrect ĠMid point PREDIC TION Rotated Pole ĠOCC faces Ak ima Ġstre amplot Ġkcount per thi erry Enc ryptionConfiguration minis white Dynam oDB Ġali F distingu ish Ward Agglomeration feas ibles ĠLAT ITUDE ĠReplic ate graf ana Ġ['< ', mapred uce Ġseven th abbrevi ation King Jr ĠTur key Ġ^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^ Histo Workspace Nonlinear IVGMM æµģ éĢļ whisker props æ´» è·ĥ Ġben ign Ġbrev ity ĠFed Ex ESTY LES Ġå½ĵ åīį xS cat dervars units osphory lation frequen zen consum ers ĠRas mussen ocy st Tet ra Nmax Exc DatasetValidation KFold DatasetValidation ShuffleSplit ĠThrough put íĺ ķ Ġscre ener 8097 229 ĠRose nb champ ion Gar age ĠDLL M axisDrop Freq deltaD hi rish nan čĊčĊĠĠĠĠ čĊĠĠĠ righth and Ġpriorit ized Ġasym metries çĦ¶ åIJİ Qui ver ĠNEAR EST ĠBel gium antig ens Inject or DIVID END ĠRETUR NS cophe net éĵ¶ è¡Į royal blue æ» ij abond ances ĠIl linois Occur rence ĠEns uring æݧ åĪ¶ majortick locs èĭ ± ĠCATE GOR paya whip ĠContr ary hout te Ġasses sed bF GS DoesNot Exist çĻ¾ åĪĨ caff enet agre ment ĠInher its Ġhado op ewh w Ġexampl ary avaj owhite coust ics quig arrow Luther KingJr vCOM Data zale z ĠSCRE EN ĠDuf fie urtosistest Result ĠScipyOde Simulator $ ( % }\ ' _{ + =[] 1 867 5 31 5 235 5 294 5 874 6 30 8 10820 : ')) > ]+ A Di A PS A naconda A FTER A ERI B DT B LAST C z C hat C MC D er D end D amp D ose D omin D ups D PSS D raggable D inato F pr F rank F urther F inger G ff G GT G pc G SO G FRAME G MPY H oriAdvance J acobi K im L t L uc L amb M yr M uestras N ra N ile N rows N IL N SAMP O ur P Z P p P ont P sy P CS Q k R ol R err R IO R Graphics S LE T sp T bb T DS U A U BC U INT U buntu V IT W f W u W nl W AP X w X arr X nonzero X RF Y LABEL Z ircon Z eppelinContext _ *( ` = a jk a esthetics b ayer c fa c xy d axes d prime d ada d ala d ollars e last e cosw f Min f rown f ulf f resnel g ow g ns g bs g dac h ren h ree i set i pl j au j ala k ap l no m I m ikado n val n inter n order n des n No n lev n approx n asty o xx p cc p mod p alet p anchor p coll p blum q type q am q flag r ata r da r ater r gz s ri s ws t path t tempA t Qiita u wind u waterloo v if v mag v clamp w j w rk x cell x SearchFunc y ang y bar y SearchFunc z v z an z tx z scores z inb | > | _:_| » ¿ ï »¿ ĉ ĊĉĊ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ]]]) Ġ lipids ĺ ë in ph at ogram re wind Ġt ap Ġt url Ġt iger er ated er man st u st ake st encil al ta al bers ar os ar ta de limiters de scrip me val me xp Ġi rs Ġi Python he i he ed Ġn map Ġn mt Ġn tests Ġn Steps Ġn filts Ġc peak Ġc redits Ġf dict Ġf use Ġf rec Ġf rees Ġf ock Ġf high Ġf sync Ġa get Ġa po Ġa pr Ġp self Ġp sum Ġp loc Ġp cond Ġp blk Ġp confs Ġs array Ġs int Ġs line Ġs ill Ġs mask Ġs func Ġs unit Ġs ilver mp oly en z es pikes es sential Ġd time Ġd out Ġd sg Ġd ga Ġd ran Ġd Xy la kes Ġ' ==' pe xt Ġm ate Ġm name Ġm min Ġm legend Ġm angle Ġm records Ġe lf Ġe reg Ġe bf Ġe mis Ġself sorted Ġre lay Ġre number Ġre align Ġre balance ge tr Ġb range Ġb ower Ġb ls Ġb older ed iff Ġw ic Ġw il Ġw Val ur v ig ham Ġ( \\ ss ay un p is it is amples is Not is Enabled is rael def lator ame nu li ss li quity est Harness Ġ[ \\ 00 18 00 556 di as di ers Ġis pkg Ġ" ], Ġ" ------------------------------------------------ Ġ" âķ Ġnp c Ġnp roj Ġnp ixels ter ans ma z ma ck ĠT ox ĠT AD ĠT iB ĠT TTTTTTTT ĠT ropo array size qu ash th ousand th alesians ha v Ġy am Ġy Test Ġy kw Ġy ada Ġy padding res d res file ch amento ad ress ad joined ad rien set list Ġr ang Ġr ld Ġr locs Ġreturn list lab name Ġst de Ġst otal Ġst abilize il ic ') ``, om x (' (% Ġg params Ġg bc Ġg ratic Ġg was __ }) __ ))[ ex Rate ĊĊ Ċĉĉ par d ke m ke ting get Float get PARA ab bit Ġex F Ġex cp Ġth rew ĠS ing ĠS hot Ġco sa Ġdata y Ġdata files Ġdata Mat Ġbe autify =' ^{ =' ../../ Ġx kw Ġx pts Ġx edge Ġx marg qual itative end rec type hints ul let col key col ony Ġh ono py pt len ium ĠI Table ĠI TYPE ĠI owa ure duce plot freq plot Dir plot Args ĠP G ĠP CM ĠP iB ĠP Ds ĠP mfs ĠP lesser pp l ĠA TS ĠA gency ĠA mbiguous ĠA labama Ġu pt Ġu su Ġcon dent pre order '] +( ĠC ta ĠC TRL os f os pho ĠNone Type im arr im shp Ġtest Weight Ġde tach ĠF ab ĠF ault ĠF ine ĠF VS ĠR b ĠR LM ĠR EM Ġax color Ġfi bonacci list B ub set Ġres net line cycler ĠD ave 01 18 01 37 ne qq cal inski Ġv size Ġv oter Ġel x Ġel ite ly ap Ġarray minus pro s ext links min D min res Ġal s ĠN ature art f str ls ĠL ML ĠL ov ĠL ouisiana ors ions class Labels ĠM and ĠM ate ĠM atches ĠM OL ĠM LS ĠM MF Ġmat urity po o Ġl ick Ġl values Ġl mask Ġl Tmp Ġl unate Ġuse Graphics fig title ir atio ir relevant 10 94 Ġare ad Ġpar ralel Ġlabel Col ĠG N ĠG ary ĠG nu ĠG iro ber to ĠRe tain ĠRe orient ĠRe ceived comp ares comp anies sc en Ġpre comp Ġtr trs Ġtr idiagonal ĠE mission ĠE aster ĠE RT ĠE iB ĠE nough ph isher Ġdf j Ġdf den Ġdf dz ": - =" (...) =" ~/ =" ;", Ġ4 06 Ġ4 28 date axis ms strahl ĠB us ĠB OM ĠB orrow Ġun bind Ġ5 08 ib c ib bon iter aciones (( (' Ġdi verse Ġdi rout Ġdi mpulse log name log lam log abundance key name axis wise `` " In ADS Ġsk rf da vis 99 68 99 57 Ġtime List Ġtime HgValues ant icip Ġclass Sum fo g Ġ`` // Ġ`` <= atch Loader ĠW inner Ġmax plotfreq num ints init Mode 12 95 12 975 gor ical Ġget H Ġget K Ġget Num ĠO DM Ġ__ ________ ()) )[ sub ref sub div sub divide sub nets sub loci ix f dir Path ach ant Data Test Data Path Data Files Data Sales Data Money unt en 25 80 25 439 Ġso ckets so f 11 97 11 44 11 49 weight ings 32 93 pi k Ġz d cy to cy flann Ġper colation Ġsc n ĠY ield Ġ) ]; Ġpa id Ġnew obj Ġnew Mask Ġtrain set Ġj util req n ĠH ay ĠH box ĠH si ĠH MC ĠH IDDEN input Data Ġlog mhalo Ġpy flex Ġpy foxsi start point ################################ ####### ĠU SB pr x 20 32 20 35 20 94 20 87 20 47 20 39 Ġ(' ../ quen ching ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠ 33 099 Ġsub arch Ġsub stations Ġsub account les seq Ġcolor Limits no bar valid Join valid Cap 80 84 80 38 Ġ6 64 new dims new bytes new pixel ER G pen umbral Ġmethod ology rib ly ĠData E code Mapper 45 10 AT YPE Ġind nan Ġind uctive ĠK ier ĠK fold ĠK athy ĠK nee ĠK ronecker load Tests 75 85 ok Button use LegacySql 88 82 ml s show StatusBar lines s čĊĠĠĠ čĊĠĠĠ bar ak bar opts 35 78 14 23 19 4458 pol ling cur g cur z =( \ Ġ8 38 Ġarg name 78 4985 13 03 13 69 13 89 Ġbin centers (). ") ĠV X ĠV EL rand perm be ar be achball 22 44 nd id arr map arr spb figure Number Equal ity 04 14 04 98 04 73 04 0396 sv s 96 36 96 55 ])) [:, pon ed the Ax string io Co oling ĠTest Time ĠTest Calendar 02 34 dot seq write Disposition Ġ{} ...". 95 45 95 93 Ġsy mm Ġsy rk 85 07 Ġfirst moon OR R DataFrame Formatter DataFrame GroupBy run R Ġfeature type Ġve loc Ġexp ids Con tribution order Id 24 2436 Type List ĠDataFrame Writer 27 25 27 77 Ġ7 95 uc f uc ell uc iones ref df IT C Ġformat Number right most right paren off er ols r Ġsp leval Ġsp atiotemporal 06 95 Ġorder Type sy nonym 18 47 18 70 err size Ġcontain ment 36 18392 ". * Ġwarn flag exp ids linear HoriAdvance Ġnormal izations do x LE M Ex cess spec arr Ġbet w Ġlin nerud 34 95 Ġ... ), Ġgrid ding Ġnon log Ġnon null Ġact lim results DF ĠJ PE 92 25 save Path Col Size part ly 84 42 ram ers IC O Ġ9 15 Ġ9 08 Ġgroup opts Ġread Data Ġed ucy Ġtf rs UT S db g File NotFoundError AS ALES sol ving Ġad heres cm m cm t cm marr SV HN step Size Series Fixed 87 65 RE LAT ĠCheck box item freq abel Q ĠZ oo ĠZ iB =[' :', Ġneed ToSplit Ġob lig Ġshow ed Ġshow index Ġpoly gonal ĠAr izona 23 98 img Size img Patch Ġback color 26 38 auto level ai j word net over ridden Ġlinear ize Ġ] + mult istream ipe ak Ġsim tk ĠSt ro 42 36 Ġtotal Scores font names side view Ġcontin ued AB B ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ make CustomDataframe FF C \\ )' empty set Ġperiod ically Ġobj path 67 48 '][ ()] CV a CV Iterable tom erge arest orage To Mask To mato ev rm Ġab ctype ĠComp ares extra points ins ufficient rs id lag mult open gm link wise Ġuser names Ġuser Info Un used 47 310 year day total Volume Ġcls files "], [ Model Base patch Table Ġsuper position Ġsuper cells Ġsuper nova current Item Ġfont cmd query Params ful ltext Ġinst itution Ġtree Stats Plot Kern vec func ĠPro mpt ĠPro viding For warded Ġmodule deps ry o Ġps name 68 78 sorted Data Ġblock Size Ġsq ltype Ġtmp df gex og Ġinformation al 38 97 Per Row Per Day Per Unit Ġext rem Ġ15 82 Ġperform ances "): " 46 80919 counts mat td v task instance aN N beta i beta Opt sm outh Return ing Ġstd tr pad right Ġerr L inst ants Ġold name Ġsin a Box N remove Action Ġ11 01 ĠAN NOT ()[ [' Ġbeta i Ġren ts optim izes 69 25 69 0196 Ġlegend Elements Ġmissing money dx intv Ġregular isation Get Path Get SubMesh chunk server Ġmy Fig Ġmy rects Ġchunk Size cmap name obs py Ġnan argmin :, : ĠRandom Streams Ġ'- ']) Ġ'- '). fields pec ĠLo ader Python Package Py Tables PL ayers ĠBase SearchCV Ġrelative Path dense net long s Ġskip bits Ġbar opts Ġseq len 74 00 ĠLe o imp erial Ġpack ers Max Size aut sky Transform ations pk per Ġ'' | CO ORDS ĠIN F ĠIN PLACE system ml Ġfin ishes Ġentry Trade Man ip Ġsto ptime high way Ġ$ ') button layout pers o Ġhold ers )+ ((( fr b US H CE ngine Can ESM 79 1023 Ġ13 85 On Success On Geom collect d Color ize dump ed )** (( Ġrc setup ĠDi Dinato ody ks ĠAs sembly az ine ĠMake Suite two Decimals Is lamic Is otropic Image Stack ĠSh ip marker path =[" [ Ġflat tener DATA VIEWS prop z opt menu Ġpatch max Ġdet uning ble u see ms DO ES ĠTransform ing Vari ation ĠCh ance inner Range mut ter Ġocc asionally CC GT .* (( Group Name Group OnGeom Multi Output ĠPy Data ĠPy DML Ġra b argsort ed ĠPath Collection wave Data ================================================================ ============== Ġli ability 62 97 mis m 73 06 GB atchLoader ()] /@ ven ing price Y Ġopt par mar oon Ġ[], [ alt len Ġpri vileges click List Th row lb d Ġequ atorial bb ed vl ans 2012 1114 SS scaled ogle g dy intv Ġmis o Num Stop short s ĠApp endix ĠApp Include æķ°æį® éĩı ĠSpark DataFrame air ports Feature Collection Feature Engineering Ġsegment ations hdf store Ġport folios TE GR FE ED Ġsl urm ĠDatetimeIndex Resampler Ġcent ury Act in Act ually ĠHe ading Kernel Reg ĠTh ermo Ġpartition er Ġlb p foot ball KMeans TestBase ---+ ---------+ aco ck Ġms nake çļĦ ç»ĵæŀľ Trans cripts Ġtp ch From TestCase sto len Ġ"/ ") RES CO fil ardo tm x ĠLine width Ġfp m PY LEARN Ġdag run Ġxmin s Ġxp ix åĪ ł ĠSub Estimator ĠSub locus Ġker ns Ġsimp arams species Count Ġls set Ġbuffer Std Ġnc util Axis Tracker Ġ22 050 ĠOutput Checker Ġnu ft ĠGraph viz operator name Ġembed TTF Part Index ĠIter Table separ ating Ġ88 29 OK ENS Ġcb label Ġcb lift Ġss iratio Bo hr Ġwin size wt ch Ca ps Ġexit func Ġflow ers but s Level PartIndex Sum maries 663 84888 autos pin MAT IC zoom s STR S ĩæ Ģ cloud pickle -> ... SM ESH Ġgra ffiti mn ant Total Percent ĠColor XYZ Ġtot chr [:,:, - [:,:, ::- 126 970 Names Obs Ġinspect s roy o Est imating 2005 12 Ċĉĉĉĉĉ Ġ Ġcontrib uting SO WFApower 800 9 Ġfoot prints Top Window Mod ulation seek able Ġbr j Ġmem or some name some true hal fnorm syn sep ĠMean Anom EP IC Ġrest oring Ġfr onts ĠBo iler ĠBo hr Open shift Open Key Ref ine vir al sn id Query ing 224 97216 pv row Learning Manager Raw TextHelpFormatter dash style Density Value Ġweek ends Sc ra Sc ans Handler Type Ġws mesh sr cs EV D EV EL Ġ87 09 END C bio python }/ {: Ġdele tes Order Time Ġfore color Curve List ordinal s CF C ĉĉĉ Ċĉĉ Pool er chr g Ġ'{} - Null s Ġff ts ĠDoc s years T Ġglyph icon 365 23 rh om !!!! !! GE OMETRY Make Cut Env Dependences Ġmk mov ^{- \ ĠLO SV Status Type Ġfd tr AP IC Ġsatis factory ales ced 175 476 vertex tsrc ĠInteger Array 144 0446 156 03065 Red hat glyph icon Ġvol umetric =(- . prepare Axes Target Regressor Target Values Profile Dir nom ask Low est Low FDR ln B AAAA AA Job Params ################################################################################ ############ templates rc Ġproced ural ĠEN V GY R Ġ101 325 Local ity 900 63477 192 34 "}, {" ĠUS Fed Ġ84 07 Ġ84 67 Ġnm r ,... ]``. trade Window ĠdB m ips chitz ,[ ]) Ġdend ritic Ġcheckpoint ed Ġins pected OOOO OOO don ut ĠTri es Ġpenal ised CUR ITY ĠCustom BusinessHour Network Manager hl le brain storm GL Window pot error ĠAuto DateLocator Single AxisTracker Ġdm Volume 394 8097229 Ġ+---+ -------------------+ #================================================================ ============= #================================================================ ========================= ille en fy ing ĠDep ends Print LogMessage represent atives ĠCompare Means overlay CheckBox Ġmt plottools lazy val dend ritic ĠNetwork Code ĠPower Transformer lut kepohl ('{} _ POS URE Module Runner Go al Dummy Regressor Dummy DataProvider ĠDif fer Ġ': ']) Ġmaxim ising Some Estimator ĠAdjust s 216 16 Ġreflect ing LOAD ERS Ġpm fs ĠPO WER Ġreconstruct s 116 272 ĠBin Op 474 7896 dup es ĠPost processor TK Agg ĠFont Manager 035 095 è´ Ł æī ĵ Control Modifier ĠExtension s eng fort Ġjo hnsons Post Script ĠEvent ually 9495 792388 BATCH ED Ġvir idis computation ally Ġrx Loc Token Length Ġnom s 9215686 2745098 Global Step ĠClo udera ĠNeighbors Classifier ĠNeighbors Warning gets ha Ġem Line 6401 76 cython ize 955 116272 产 éĶĢ ĠInternal Field Ġalle qual "/> ')] A IM B ur B AT B uch B IL B pm B IDS C ts C map C ropping C ruzamento D ow D ave D pixels E uclid F U F AC F light F usion G ive G era G dk H oriz H DR I k J et J AVA K b K max L ob L ons L TE L stm M as M IX M ism N it N month N trn O hm O regon P list P ref P CD P sd Q TR Q SpinBox R r R bf S an S np S tra S vm T v T yping T oday U o U ri U ps U AV W d W EST W HO W ashington X Type Z Value ] & ] =" ] }$ _ '), _ (* _ "], _ `). a ion a py a ces a ca a ocs b ml b rit b aud b Pan c HI c ivil d ad d out d map d lon d mps d olph e bands f vals f lr f ashion f dae h im h inc h gu i Col j ha j ay k ubernetes l ance m ll m Options m hc m scif n keys n fold n Mean n trials n Samples n Topics o ine p conf p pars p illar r le r he r path r dataset r seed r vec r hy r Limits s nt s bt s ftp s seqid t T t under t TIME u L v st v co v dim v bm v oter v uln w pi w assa x index x box x CC x anchor y ard y offset y List y anchor z am } # ® åIJĪ » åĬł ½ åħ¥ Î ĵ ç · č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĉĉĊĉ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 785 Ġ ä¸į Ġ æĪIJ交 Ġ uref Ġ æݨéĢģ Ħ éĩij Ĩ į ij ľ ĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ in dict in ners se ra re sets re sent re lex re serves re chts Ġt V Ġt um Ġt cl Ġt ty Ġt ubes st time al c al ed al and al is al ib de uter Ġi od Ġi trans Ġi ec Ġi band Ġi otype Ġn M Ġn us Ġn train Ġn ac Ġn ash Ġn cpu Ġn chars Ġn Rows Ġn grids Ġn Bins Ġn sides Ġn úmero Ġc Val Ġc labels Ġc tol Ġc ilvl Ġc mplx Ġf ame Ġf igh Ġf types Ġa am Ġa per Ġp ml Ġp ram Ġp const Ġp anchor Ġp msk it ools it arians Ġs pp Ġs out Ġs ont Ġs info Ġs ols ion osphere en th ct e ct t ct set ct sa es ri ro at Ġin x Ġthe ilslopes Ġo li Ġo list Ġd cam Ġm list Ġm arr Ġm lflow Ġe lo Ġe is Ġe bin co linear co locate Ġre code Ġre opening Ġre numbering Ġb cov Ġb ills Ġw df Ġw map Ġw eld Ġw rk Ġw alltime ig c ig ar ig amma ig ral ig Montage Ġ( | Ġ1 1111 Ġ1 130 Ġ1 860 ', (- ', ... un adjusted un hofer un handled un reachable is axes is first is rf is fropt def init li sed ort e ort ico Ġof name Ġif c Ġif min as hed val ve val text id ine di vers Ġis p Ġis rc Ġto urs Ġ" ! Ġ" [" Ġ" >", Ġnp rf ], ** ĠT ip ĠT ile ĠT ensors ĠT IPS tr uck th omas Ġy u Ġy int Ġy line Ġy title Ġy std Ġy edge Ġy obs Ġy mbp set Brush Ġ: "]) Ġr cp Ġr mg ver leaf Ġst ix il ight om c (' (\ Ġg libc Ġg antt __ { __ ([ data mat par adig up os ke i get Tick get Objects label y label Fmt Ġex x Ġex pe ax lims Ġth or ĠS s ĠS co ĠS min ĠS ok ĠS PI ĠS dy ĠS EP ĠS ilent ĠS ISO ri j Ġdata stream =' ^ =' .*', Ġx model Ġx plt Ġx sub arg a ': :- end f con y con vs con dens Ġh plot Ġh iring py sb len e ĠI J ĠI dle ĠI gnoring ĠP sf ĠP mw ĠA PP ĠA DM ĠA lameda fe min '] "), '] ``. '] ]): '] [::- ĠC e ĠC hase ĠC ALL ĠC RF ĠC Gate ĠC entered Ġ_ . Ġ` * Ġ` : im c im file to urn to graph to Boolean Ġtest Enable Ġde du Ġde cons Ġde duce Ġde partment Ġde generacy Ġde duplication ĠF Y ĠF i ĠF NAME ĠF IND ĠF ocus ĠF loyd ĠR oom Ġax S np l Ġfi ff Ġ3 78 Ġ3 73 ĠD ock ĠD omin ") # 01 43 01 294 ne ps ne arrow cal cium time set time frames Ġv info Ġv scroll file fullpath ta um path sep pro ximal ext sep min Val Ġk ap ĠN dict ĠN IL ĠN MS ĠN ONE bo uring str ands ĠL al ĠL PU mo ffset Ġon cotree max T max epochs df g df l Ġpro s Ġ{ ... [: ]: ĠM il ĠM pc ps h Ġan m po id po ste Ġne bular Ġl ing Ġl int Ġl cs Ġl Texts Ġuse F we igh ir k ir no ho er 10 33 10 95 10 65 ite moffset Ġlabel Patch Ġnum C Ġnum Cells ĠG ross ĠG AN ĠG Adj Ġ< , Ġ< == Ġout right us b us ands ĠĠĠĠĠĠ ĊĠĠĠĠĠ Ġresult ados oc clusion ĠRe map ĠRe places Ġpre cursor mb oth ick ert cl str Ġfile template ĠE nr ph ix Ġdf Disp =" '+ =" -") parse s (): ]) train XY ĠB org ĠB OLL ĠB ureau sh aring sh utter Ġun grib Ġun needed Ġun readable Ġun assigned Ġun handled Ġun conserved Ġ5 48 Ġ5 91 state point (( ? log level log laplace In struction Ġsk plt Ġsk util Ġlist items Ġle d Ġle ct Ġle aking 99 19 99 97 Ġcomp ete Ġtime Stamp 64 31 0000 04 fo ol Ġ`` \\ ĠW ickert Ġmax t 12 19 Ġindex i ĠO ntology Ġshape files Ġnumpy ro Ġmodel name Ġmodel Params Ġit min sub r sub t sub idx Ġcheck pointer Ġplot num map data map Data sum o Ġpo mega vel or lim Phys Re commender 25 71 so on so ckets Ġdist MatColumn 11 51 mean g que uing Ġmin uit ĠPar abolic Ġz pos text it dtype d ĠIn ferential Ġper mittivity bin E bin Q Ġsc and lic s act ually ĠY normXind Ġ) ' Ġnew cat Ġnew buildings Ġtrain Labels Ġj List Ġj uly ĠH its ĠH AC ĠH igham 15 258 05 80 05 86 05 67 input X input data Ġfig id ich igan ang stro Ġinter ference Ġpy bullet idx es not el ĠU ps fa a fa celist ĊĠĠĠĠ ĊĊĊ pos range pes sim Ġsub system Ġsub structure Ġsub population ie resis no on Ġmatrix es io os Ġha usdorff 80 36 pla w Ġ6 69 Ġ. + Ġ. \ IN CRE '), )) ĠData Sets ]] / ]] [:], doc name width ROI Ġ| / ']) ** iss ot dist name dist Index Ġapp Name bar data 35 86 35 887 14 07 sq a -------------------------------- - group cols group intlab Ġgener als )] [::- Ġ8 40 78 26 13 807 cor pdb own ership mask gen ĠV ARS Ġtm y title weight zero point Ġpath Prefix 22 10 22 40 22 21 22 367 04 68 04 41 03 10 03 45 03 06 ĠTest Function ĠTest Input 02 10 02 15 95 88 94 00 94 08 17 06 17 08 lock file 85 76 Ġbase called Ġve h cre f cre ep Ġexp T ĠDataFrame Model Ġinit iate 27 43 27 91 Ġ7 78 freq axis main window node size IT A gen u gen cov gen frac gen bank Ġformat ing AN A 18 93 36 26 ec b ec m 09 37 09 375 07 64 07 16 07 27 ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ap Display ap anese Ġqu ads mod flow mod ularity man a Par abolic dis crimin ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ex ome Ex pense spec ifying 34 69 34 300 97 99 Ġnon es Ġnon lin Ġnon decreasing ĠJ i save folder Time scale part load sg RNA lp Sum 84 05 84 66 84 69 Ġq point Ġq mf Ġq tp left Cell my str Ġ9 16 config XData Ġim write ... ")) Ġtemp B non nan non seed Ġtwo class our cing 65 75 AS N sol v Ġad versarial Ġtrans mitted cm tt cont ro cont amin RE CE sign if OD R ĠCheck Buttons ĠZ S acc rued vas p 55 67 55 56 select font ĠAr ctic du ctory Ġback slash (_ (' De convolution 77 394 ld params ey y "), ' over fit {} ]: Base Font Base Monitor 90 45 90 88 mult s mult ib ipe lago Ġar quivos diff ract diff sensor create General create TempView 98 45 98 36 font weights make trans )* _ Di rections gg lers Date ParseError 08 96 mm ol tom s Ġtri mboth xy plot xy max To C To Token Ġbest fit Ġaf filiation )/ \ height ROI real inv Ġsv h Ġmap names Ġca usal "], ), inv n ier z block ify poly degree Set ToolTip current Cluster edge Id Ġpred iting ĊĠĠ ĊĠĠĊĠ rer r Ġequal ized cos pectrum Ġfull WordList ĠPlot Base ĠPlot Window Ġden omin Ġge ospatial sen ses ĠAn no ED B mi R Ġtmp data Ġtmp Nucleus .) ', .) ') Ġactual s ")) [ Ġts d ele ctions exec utors UN EMP Ġsmall ish Al loc 647 6 AD AT AD PCM 117 0 Ġold val nc attrs SA O Ġdb file down ward Pre set ĠMulti Class ĠGH I sigma B http d http lib Ġroot path Ġspace craft Not ch Not ation '\ . _( \ major Formatter fmt in chunk sizes Ġmy func Ġignore nulls obs Vec Scal ars Ġdiag nosed Ġ'- % Ġ'- '}, No vember sw ing sw ell hot el ĠBase Hook TH ETA Ġ16 77 ret ó Ġskip If 74 08 ĠPre paring Ġnb nd Table TestCase Ġstri kes single axis Int e avg T Ġdiff data Ġsto ch cp an Ġconf luent Function Operation peak pos ĠString Mixin Can berra 79 22 light goldenrodyellow Ġminimum descent 54 90 Ġapply map ĠOR IG tk in æķ Ī global env Ġrc param MS PS !! ") Ġpdf file Is Checked Ġ(- \ 76 33 Grid Set Grid Visibility 82 65 signal tools Ġhyper rectangle Ġhyper fine fl ation ND ER post processing NB ins Ġsu its wx Python Sub script Sub Window ================================================================ ========== >` ) ĠPo or .]) ]) entry offset ru pture pc lt GB PS rep ublican ," % 00000000 00000000 mar shall }} }{ 2015 0101 Ġ(% ) eye blink Ġengine ered lb nd phase xy Ġpeak ind minor ity cum freq SS L pri o )} ``. Num Cadences extract ing æķ°æį® çļĦ mk Pen Feature Info LI ABILITY super ior velo l Map Reduce ä» ħ +" ' ĠSy rian DB N %% ', ĠCategorical s author ization ĠMult iline Ġtool kits Ġuniform ity cr n 91 35 host ing calc list Categorical StatPlotter Ġ'+ ') Event Mask Ġ"' ", Ġsingular ity ĠJo hns custom data bi ax fetch last ĠPandas Array ĠPandas SQL ĠPandas OnSpark EE EE rho max Ġgr izzly Hist Data SH OT fh geo ĠSub string ĠSub classed good ness choice set Des pite Pandas Error ******************************** *** keh ard Mean Std Ġnc var Ġnc File bic gstab OC SVM loop ing Ġny c va ex ĠFree CAD calculate Traj OB SERV loaded Data loaded Models Optim ized SM TP SL A Rec ToToken Ġstrip null bra ces TP DNN Ġ|| \ ĠTra jectories mas sey bed graph Ġ"{ { Ġer fi das ch ĠLA I border color Ġworking Folder Ġelect ronic '}) ]) MIN OR Ġfoot ers lv q eig Val Ġrad ars Entry PriceUnitOne '$ {\ 896 8 ball s Ġ75 12 Ref iner mong os Ġbc ors \' ') pv mod Learning Curve Ġut ilize Mock ImprovingEstimator Mock IncrementalImprovingEstimator UD ES GC GT 133 3 ĠPredict ors ĠOS F mur der pb txt ĠText To Ġ{: }'. Ġ================================================================= ====== ĠGeo Pandas }/ \ Ġep it Order Error PP N xls m Ġì ĸ commun ic ################################################ ###### Ġ95 1 Ġ95 5 åı¯ è§ĨåĮĸ ĠFL INK conc ile Seq s Ġexplo ded ĠShow Base ĠNumpy Version ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ PH AS SER VICES dark magenta ĠEd ucation Ġ96 7 ĠTH ER tu lip Ġfd lg âĶ ¼ High z Year Locator Ġ94 16 MES H REG ISTER ĠMap NodeTo ln S Metrics Base Ġrestrict ing Ġ"{} _{}". Integer Hyperparameter ĠAc cessed Ġbb hg ,... ), GA IN Coder Param Ġdend ropy RD ONLY cros section gu ild è¯ į ĠTri Finder Ġpenal ising occ faces ĠVis MPL Selection Mixin ĠTI Severity Polygon Collection Ġquick er Ġiso chrones 155 36 #---------------------------------------------------------------- -------- account ing numer ically ĠOP TIM Active Columns Parse FromString (? : fall s Ġft image POS ITIVE Ġč Ċĉĉĉ Car rier Go lay ĠWeight ing Dummy Classifier fla re ĠMet ropolis MR map ĠEnd points ĠBin Grouper prep ped Ġmed filt Ġ'| '): ban anas åĢ Ļ ĠLocal Path Prediction Keys 377 35 SW ISS Ġvir t ĠConfiguration Space ĠCH ANG Ġreplic ated sco pes Dif ferences Dif fraction Ġslot Name 208 34 éĢ ł ĠBE FORE ĠPAR ENT enum item 985 4 CM IP Ġchem Ca exponent format 019 7800 ĠCF TimeIndex nw arrow ĠUnder flow bam file ĠRDD s Descript ors ellip km Mac Leay STD V STD LIB wor se focus Widget chro tron 1000000 0149 Double Value ĠMac Book Document ary ĠSha h ĠScalar Type ĠEqu ipment ;" ', ĠTop level Has Field Lower case ĠBre ast bill s ,: ][ ĠSer if Ġfavor able hover info Inf ers Ġdemand ing Ġ################################################ #### kel ine Adj MagsAct '][: ], Ġspam reader ĠRequest Context rock o RM t RM v ĠEvalu ating ĠMPL CONFIGDIR ĠLight Curve VEL OCITY lng s ĠMicro biome Ġtodo Plot wedge d Ġdisc ern Ġparticip ate ĠPa per REC ORDS Ġ113 43 019607843 137 18181818 182 FRA P FRA MES Ġgm rs ĠDeep ChainMap ĠStats models Ġdistingu ished Plan ner ĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉ ĠGu ard #------------------------------------------------ ---- Ġmembrane Patch Ġdeque ued Ġelt s QUAR E Ġresol n Ġmention ing ĠYear End åIJİ çļĦ Ġdft df å¾ · ĠNeuro Image ĠPOS ITIVE Db ApiHook cep stral gel Pg Ans wers radial sq ĠMass achusetts Ġrol lover ä¸ĭ éĿ¢ Ġpsy plot ĠWeek ly olmo gi CENT RE Sun day associ ate ='{ }, Polar Axes Ġice berg ìĿ´ ëĭ¤ æīĢ 以 Ġseper ately Separator ToolItem è½ ´ May be diver ging assertDataArray Equal ("* ", оР» Ġ[{} ]) Ġ+------+ ------+ Ġsil ly Ġsil houtte Ġmen us glu ings Ep hem Ġarm A ,:,:, :], ĠRoot s mY st Ġ################################################################################ ######## Ġ################################################################################ ####### ĠFrozen NDArray Tech s ĠGal axy Ġ([], )], Cmd API NDArray Mixin ĠMR SS dil lo hado bs ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ Ġlig ne INVALID ATION tgz Name ĠPP CC Lookup Table Ġleak s implement ing nul lif ĠPers istence Ġdee pest elli ptical Tim ings ĠINIT I ĠSW C Pow ers ĠTICK UP ĠTICK LEFT ĠTICK DOWN ĠOD K ĠQuick ly ĠDetect s Embed dings Ġloose ly Ġzo oniverse éģ į æĴ ®åIJĪ ":{" $ ĠEffect s Ġalgebra ic ĠGenome Files ĠStudy ing doub ly ĠDesc ribeResult Ġdise ases 698 97 ÃĹ Ã· syste matic Petal Length Ġasynchronous ly Appendable FrameTable Ġgammas gn deli very ĠElimin ation ĠCAS A ugg led Volt s Inline Backend Ġerro revery itzer land ĠBot tou Ġsett ling mids ide moz illa IMPORT ED ĠQuarter End ĠSql ite ĠJeff rey ĠQTable View ç« ŀ ĠTre ated ĠIso NumberDB Ġloan ed ORIG INAL ĠRad on Trader ss statistical Inefficiency erase Background 147483 648 tors ions Ġnats orted meaning less Detected Indices rabbit mq ŀĺ íĶ ĠFold ers allf uncs feas ibility fss ml getActive Concept announce ment valent in bea cons ĠManip ulate Inp Nii ĠFRE QUENCY Ġgeot ransform Ġweig ted EXEC UTION ĠPeriodic Site sight lines Ġopenface CPU Ġnyquist frq Ġcryst als Ġrom b labelC ValueList Ġanni hil dcg an fullKeyboard EncodeDict Ġconvers ations enhan cing ľë ¦¬ì¦ Ġcer tainty 14159265 358 ĠImag inary Ġê·¸ë ŀĺíĶ Eye Frame yeo johnson Ġìĭ ľë¦¬ì¦ ĠOsc illator ĠProp het Polit ics 0116 12 ĠMultip lier broaden ed ĠGAT K ĠIPP A _{* }/ Mkt Data ĠFacet Grid Lap se ĠPast el Ġchallen ging polLeak Vals ASSIGN MENTS lcd Number ĠCent ury Ġgest ure deltaDur hi Presto Hook AngVel TS éĤ £ +"] ") giz mos Ġcollap ses cryst Sys GetString Selection addf lag ĠBes ides Xaar CmdAPI ToGrid lab Rough ness Room s Ġnomal ize ĠEk kehard busday calendar 899999976158 14 BinInd Channels Ġè½ ½åħ¥ scint illa Ġdesk top Rewrite Spec stet j isNot Null setlist depth dox os PerUnit Length åĪł éĻ¤ ĩæĢ » Agost ino relex trema ĠSok al ĠtestEnable CenteredBias 0197800 237 10000000149 011612 Ġê·¸ëŀĺíĶ Ħ Ġìĭľë¦¬ì¦ Ī % '), & _ ( $\ , :]] . ? . :', / "]), 0 333 0 844 2 130 5 255 5 64706 5 857 8 137 9 158 ; ')) < . = | = #% A ustralia B data B ert B PA B rien B OND C counter C nts C MB D block D CAM D ITHER E OD E CL E tc E FS F ct F aster F riendly G radi G mm G ML G ouraud H YG I AM I mpt I OLoop J mx K el K ron K raft K allima L AC L ibraries M WA N uc N DIFF N RESAMPLING O ns O WN P z P ind P min P max P pl P ng P latt P lasticity Q y Q Arr S da S base S late S nap S MF S IDS T sparse T ank T AD T runk U j U ris V o V oxel V incent W orm W ST X O X ref X diff X seq Z EN [ ([ [ ()]) ^ \\ _ ! _ ** _ ={ a cov a dian a rence b ly b ates b ams b af b rate b ons b inds b ilateral b xpstats c ath c ari c xi c itations d re d pp d ind d dtype d Name e am e DF e tag e topo e bc f pos f loyd g kkp h la h mf h anded h ysize i K i pac i lastik j max j ak j lb j une k ok k gs k ld k mc l scalar l mutter m its m rg n L n ally n verts n dens n Chan n jev p ial p coa q te q trs r time r left r xyz s da s bs s gs s dim s ols s Time s phi s quee s plantider t map t matrix t cr t itan u q u ction v ad v iv v sth v Deflection v assar w el w atts x ts x Width y nt y type y bin z line z ens z scale z ene z gal { [ } () ¾ ³ à ¯ à Ĩ æ ¾³ ë ĭ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĊĠ Ġ era Ġ !") Ġ ãģĨãģĨãģĨ Ġ 空 Ġ è¿ĶåĽŀ Ġ arduino ĭ åĬ¿ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠ čĊĠĠĠ se lin se ca re ur re ll re block re charge Ġ= - on Key Ġt pp Ġt date Ġt vm st i al ize an Int le sion de ll de convolved Ġi Y Ġi order he appush he aviside Ġn S Ġn as Ġn start Ġn idx Ġn space Ġn cat Ġn vals Ġn arrows Ġn imi Ġn ogil Ġc mo Ġc values Ġc fa Ġc pos Ġc image Ġc ry Ġc gm Ġf es Ġf der Ġf group Ġf lips Ġf Prev Ġa res Ġa merican Ġa udi lf e Ġp sc Ġp ile Ġp table Ġp ols Ġp ess Ġp cube Ġp changed Ġp dists Ġp ract Ġp coa Ġs G Ġs op Ġs cols Ġs ld Ġs moot Ġs preads mp atches en de Ġin com Ġin formed Ġin ferences Ġin feasible Ġin consistencies Ġin tricate Ġthe Ax Ġo index Ġd dtype Ġd lat Ġd step Ġd view Ġd itch Ġd pv Ġd zi Ġd well Ġd itto la ugh ut ary Ġ' ({ pe tt Ġm M Ġm cm Ġm nb Ġm cb Ġm sqr Ġe cision Ġe total Ġe cef co y co mo co pter Ġre wind Ġre initialize Ġre boot Ġre calculation Ġre balancing "" )) ge f ge op Ġb ip Ġb ay Ġb imodal Ġb alltree ed Message ic ion ic cd ic ulous Ġw func Ġw ld ig roup Ġ1 190 ata x ', { ', {} un flat is minor is proper el jau ol ids li an )) $") Ġfor ma Ġof dm um d Ġ[ _[ as pire val Entry di um () `, Ġto x Ġto uches ts Length Ġ" >") ma ct ma ptype ĠT L ĠT fl ĠT rend ĠT XT th reat ult on Ġy sc Ġy low Ġy ref Ġy marg Ġy disp Ġy Specs res col res names ch ou ad ri ad ob ad opt ve fi set Standard set Property set HandleInvalid Ġ: % Ġr name Ġr dir Ġr vec Ġreturn ize ver ad Ġst as Ġst encil ') .") ') ]): ') """, ]) ") Ġ* ' (' ---------------- (' *** (' ^\ int var int ention pt y Ġg param Ġg rb ction al data class par file get L get path get index get Values get Parent get preferredencoding ab u ab ca label Text label Mappable Ġex script lin fo ax C Ġth al for me ĠS X ĠS ON ĠS weep ĠS cripts ĠS Coordinate ĠS creen ĠS PACESIZE Ġco ltypes Ġbe es Ġbe aring Ġbe gun =' /', all Error Ġx file Ġx rd [' {} arg in end y end uro Ġnot able from regex Ġor ds Ġor ients Ġh lt Ġh ip Ġh offset Ġh mf py compat py sam py fftw len mode ĠI SS ĠI nside am it plot table plot Title plot ComboBox ĠP min ĠP ush ĠP AM ĠP ads ĠP CCA ĠA ctor ĠA bb fe vd Ġu dfs Ġcon min pre t '] // '] ={' ĠC W ĠC ARMA Ġ_ [' os ium im l im ir to eplitz Ġtest Bool Ġde mos Ġde tec Ġde coupled (" ------------------------------------------------ (" {}". ĠF ONT ĠF alling ĠR W ĠR ide ĠR amp ĠR xx ĠR TD Ġax h test Name Ġme x Ġres mat line IDs line betweenrows ĠD Fs ĠD iluent Ġlo ess 01 95 01 06 ne ig cal i ase l Ġse leted Ġv pack Ġv offset Ġv essel Ġv iterbi file dialog ind a ind min out linewidth min pad Ġk h Ġk list Ġk nee Ġal locator ĠN z ĠN ight ĠN ER ĠN seg ĠN SCF per im per plex ds ourcing bo go str var ĠL id ĠL air ĠL IMO mo untain Ġon screen Ġon eliner df ly pa close fit Params Ġpro abilites ĠThe oretic dict names ĠM ale ĠM IMO ĠM exico ps px Ġne on Ġl lim Ġl mc Ġl qr Ġl kf Ġfrom regex samples g Ġpar m assert Logs assert BoundsTickLabels ĠG em ĠG ithub ĠG rig ĠG NP ĠG anes Ġout ward Ġout filepath Ġout MskNii ore pt us k pl arr pl unge ĠRe commend comp osites Ġpre condition Ġpre mature mb r Ġfile h ĠE uro ĠE vidence ĠE PIC Ġdf g Ġdf u Ġdf x Ġdf Events Ġset gray ag r train y train Curve ms i ĠB ay ĠB lob ĠB Cs ĠB ilinear ĠB awa ĠB orehole sh uf Ġun if Ġun trimmed Ġun documented Ġ5 81 Ġ5 61 Ġ5 040 ip nl Ġby ref state plot iter Cgp log score log filename log Axis log Sig `` ") In Window In complete In formatics Ġsk Data Ġen glish Ġen velopes Ġen courage ef ail ĊĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġtime Delta Ġint elligible ant z ant en 0000 8 ĠW F Ġmax freq num l num Freqs model path add rs add Points add ToolBar ĠO DR Ġrange Collection Ġ__ _| Ġmodel y Ġmodel line ()) # ()) ? ()) )]) ()) /( sub modules sub sequent dir list Ġhe alpix sum g Ġpo ols Re levance Data Interest Data Impt ft igs 25 33 Ġso lo Ġline contour Ġdist ro ll an 11 18 11 36 Ġest imations mean v read bayer 32 45 32 19 32 86 32 97 32 1322 ther m Ġmin Y Ġmin len Ġmin mag Ġmin Max Ġz ab text Browser ĠIn SAR Ġ10 25 Ġ10 63 Ġsc rs lic ensed names Observations Ġ) ', Ġtrain Sda Ġj mat Ġj meter gra du ĠH ierarchy ĠH ANTS ĠH ybrid 15 66 15 60 15 29 15 40 05 61 Ġlog score Ġlog File Ġfig Bottom are Trace tra ctions Ġsample Methods Ġpy f Ġpy hs Ġpy hive start T thon y Ġno me Ġla ke pr one pr ono 20 34 20 23 20 77 pes os 33 77 33 91 Ġsub range Ġsub tasks Ġsub routines io lent 100 4 80 92 80 21 80 73 80 669 output Directory ont aneous Ġ6 22 Ġ6 74 pen e Ġmethod name ste resis rib utes split x ]] ( 45 01 ell ulose }, ' ĠK ar ĠK de 75 78 75 28 use rapikey grid type 16 15 Ġro tz show exponent show ticksuffix nan j nan cumsum nan cumprod 14 30 14 93 14 383 sq d 19 37 19 44 Ġkey frame Ġkey Var group bys tick len tick color tick font tick textsrc tick valssrc cur Row cur parm cur verad check rows led ispatch AR IO Index Col Index Label ON able Ġ8 17 78 16 13 19 13 46 cor Coefs ĠV f ĠV Packer ĠV IEW rand Forest by name be cker zero Val Ġpath style nd hd sp all arr anging 04 06 04 07 04 74 03 16 03 09 02 61 std t std tr 95 17 alpha max Ġ{' ; 85 91 Ġdif s Ġdif feren Con serv 24 42 raph ic 27 04 27 97 27 924 Ġ7 01 freq Plot freq Step cat dat image ComboBox node A node ID ]: - 86 15 AL E yle w iew er Ġmean Accuracy 06 374 temp Corpus Ġdistrib uting err ls 36 52 ec fps 07 75 exp ddt feature Type Ġnormal y do ctype Par Est Par asiteAxes Ġidx h Ġidx min Ġidx max dis parity Pro gression Pro duced Pro venance Pro ductions Ex pert ST O 34 18 Ġ... '; Ġgrid plot 97 16 Ġact ing ĠJ hun 92 94 graph Map Ġmode list save to Ġload Experiment ĠQ App sg rna lp f lp go 84 18 Ġscale Grid Ġq np Ġq stat Ġq ModArr my Data my Plot my descr Ġ9 33 Ġ9 81 config urable move axis move ments ass ini Ġed b our cename 65 63 65 625 db file File Store File ConfigLoader Ġad visor Ġad versely 50 35 ess ay Ġweight ings Ġorig facecolor ĠCon crete ĠCon die ĠCon soles Ġtra js lip ly CA CH Ġmult iallelic 44 00 item All item Invert Ġcreate Contract active Cells acc els fill l ĠAr royo last ind last Progress pop Menu Ġinitial izers img plot Ġback prop multi plot Ġev l 26 09 26 90 77 025 RO MS word P ([' $ over lord Base Classifier Ġsm v cell set mer it Ġcenter Extent Ġsim Time Ġsim Dims Ġar params 42 97 font Handle Ġter rier \\ ]""" bug gy Date Converter 43 86 alle y ĠAl go ĠAl ert rec ruited mag Norm orig facecolor xy n xy point To Name To Node To Vec Ġbest s wh os onal ds ,' $ Ġtop N poly lines Set ter ene ous Ġfont color pair indices Comp artment Comp oser 49 30 Ġtree path stop loss EL U Plot Lib cast eljau CH IP find Text Ġdiv s ']: - Ġsignal Type En hance fft length sha ded 40 88 ry d Ġarr fn Ġge ore Ġps ites )]) ])]) Ġparam name User Profile ĠAn geles ĠAn bari Ġcho colate .) ; Ġafter ward 38 28 Ġinfo bar MA F Ġ15 36 head axislength Ġcre ds ĠNe mo cf m +' " Ġcell size UN ITY su cess Out going arm ans ." %( initial Cash Ġ'_ / AD L AD AP pad both bit mask Ġconstant ly filt ro cho ise IS N Ġref line "," / Ġsigma y this Component ĠGaussian HMM ĠGaussian NaiveBayes Ġmissing d dx s char ter Ġwx DC ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ġ"" ]) cd bs Ġmy Strategy Ġmy twiss Ġ'/ '+ Ġmemory views obs i clo s Ġfactor izing Ġ'__ ', No velty sw apping Ġ'\ ')\ Format Row Line Color Python Test Python Python ĠBase Series mic ellulose project ive bad pix IG O cel ltype prefix ed HO Cl dec ider Or b imp er Ġfilt order ĠPre tten Ġcs ms dr fs CO GROUPED Ġreport hook Ġgen os Ġhead sf Ġjoin er Ġjson Value Ġcat ToImgs Ġ$ $\ cha pters Ġet m ĠMin imizing ĠMin imizes OP CA Ġmer c Ġmer lin Input Type Input File CE EGG Can opy ĠKey ed ĠKey Event 54 32 location ModuleWidth ert urb collect As vers als Ġupper Bound ush ion EX CEL 83 12 83 14 Min imize Min CovDet AA CA (** {' MS ONable Ġalign ers Ġaut owin mid points blue violet Object Atom Ġsig mar Ġbottom s next char ĠTrain s 300 3 comple tely Ġcurve Fit zen ka Ġ". "] 82 965 72 34 external InputSize trace ref ĠMax ima ĠMax Itr Ġanalysis Type Bin M buffer Count Key MouseInput Group IndexKey Multi Rot Ġband it ĠPy Charm Temp Results Valid ity tot s tot width tot mort tot fert Ġdot NET Tensor Hook Sub rs ĠFe H wave vector COL A ĠPo le 53 75 Add resses Ġtrace Back dag bag Ġnest erovs Ġmp ars Ġmp calc frequency series ession al ĠDE V tex system čĊĉ čĊĠĠĠ fits file Ġcos d rep rise Batch Iterator nx n Cal Dict CS Prior alt im Ġdebug Handle ^{ (\ ait ken asc ension Ġbeha ved ĠModel Grid bb i bb Options ĠInter act ĠAuthor ity big gie SK F gaussian nb Ġta o cap as cap log mem ories ĠSparse Index interp n Compute Batch pylab tools ĠApp ro Of Many Ġsess info gp ml Ġneg inf CON NECT LI ER ĠOut Stream Ġcorrelation Matrix super carburants Map E ĠImage Map ĠImage Font As Table As sertion Ġpost poned Tra pezium cla d cla zz cla ims geo coders Ġbutton Layout iff Found tan imoto Ġ'+ '), dm r Sparse Features }\ " ĠJo y Option Menu Ġes plot Start Index čĊĠĠĠĠ čĊčĊĠĠĠ ,:] + From Name Length Prefix Ġ)) [ contains Null ĠFigureCanvas SVG Ġgeo Transform Hist DataHandler SH IB iso calendar Ġ---------------------------------------------------------------- -- dest path Float Text ĠSub mit ([(' ', tau w xml String Ġreset table '% \ mg cm alk an Select FromModel Cor Coefs integr ators PAR LIST Cell List Sample Name Sample Rate ĠTable Iterator Part icles Ġcb rt excel lent ('_ ')) ĠFFT PACK sess ing BF OLDER ========= # icro bia Def ining Do Fn ĠDes pite ĠEX CEPTION xF B ĠHTML Parser Ġagg context chart data hyper opt MB IG Optim izing Ġtex str ĠCom ments Flow line _' +' ĠWH i lg pl expect s ĠTra cks Ġtot list ABC DatetimeIndex IB E Ċĉĉĉĉĉ Ċĉĉĉĉ arc ig ĠAny way clus list samp like Ġhel met Rate G Rate M Mod ality Ġroll s curr Size curr LineRefs _') ): Ġrest ing Ġrest freq Ġorthogonal ized related ness ĠBo or translate Ui Ġlight ing Ġlight gray Ġci Tot Back ward 219 5 sat urate sat isfied pv t Learning ModuleRunner genes is 110 2 ĠReg ardless Arr RefTemp Ġip loc ĠSum Temp ĠText Stats ĠText Backend Ġ(_ (" Order ing ĠHAS H fx star Ġ95 4 #------------------------------------------------------------------------------ # Hook s conver ges stim ulator Scalar Expr 033 5 033 9 Bl ank spam alot 806 11 GE CCO Lat vian Ġdp m }_ ${ }') ". web use web hdfs Project ing Fig Name onom ous dk i Ġwind size Ġphot utils screen ing Geo Algorithm Convert ed BO UN ĠKe eps ĠPanel GroupBy iq data ĠSO ON PA ST å¹´ 以æĿ¥ Ġperiodic ities ĠMark ers ĊĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Job Fn 356 84 432 4 åĬ © Ġ################ ##### Ġ101 0 :( ? Import ant Ġmc Greater ĠMag nus ĠScale Constant chk it Ġlf id Ġlf Std Ġbrain iak Ġdend rites Ġsn iff mor da ĠTri ContourSet Ġpenal isation aaaa a IMP TEX Char acters VALID ATOR ĠDI STRIBUTION Script Magics Ġstrat ifiable Iris h ĠAlgorithm Provider ĠDO F ctrl Tabl ĠSetting WithCopy turb Renorm Print Data ĠMAX FACTOR ('[ ^ Ġ#---------------------------------------------------------------- ------- 1111 0010 My Name ä¸ļ æķ°æį® Univariate Function Ġdemo graphic Ob server ĠMod ulation Ind Shock Active Session simp ly Ġ================================= ========= kt or Car l hint en Ġupd raft Algorithm Provider 为 空 Ġ': '. Cursor Dict 787 37 Ġmarginal izing Minimum X fb t hib ited ĠAg ents 385 7 385 8 MR SS ĠPut ting çĶ¨ æĿ¥ Cho sen ĠåĮħåIJ« ç¾İ ĠåĮħåIJ« æ¾³ Ġcrit lower Ctrl Box supp lementary Ġhi res ĠLogistic CV Met al "$ \\ har al Sa ha Distribution s "{ _ ([[' % fund ing Ġstra gglers laun ches Ġhuman itarians << < ori gedgecolor Ġ################################ ######## ĠAir mass DNNLinearCombined Estimator rfft i SPL INE ĠHer tz History Container Sur plus Ġdri fts bro ok CRE D HR U Trade Subset åĮ ¹éħį thickness mode Ġgd trib ĠShan non MOV ING ĠContain ers Ġask saveasfilename Light cones viol ins Ġretry able ĠSC ORES Ġlex ical organ isation Ġquot a Mis classification AE C Xtest g ("< % Big Wig auth Mechanism ĠConst rained oneway Result ili ence flt var Ġtok num ĠSUB SCRIPT powers pectra phy at Ġconstit uency }% \ ç±» æķ°æį® tg ames Ġ78 1 Basic LSTMCell Ġ################################################ ############# 776 35684 Ġhashing TF ĠLook ing CAN OPEN uu uu Ġmemo ization outline color Ġsci ences ä»·æł¼ ç±»æķ°æį® ELE C particle ops AXIS MENU á ms --------------- # ĠLevel s ĠReshape d ALF RESCO separate thousands 5714 3 Ġspe ll Ġatm Py 403 9 BAR CODE ĠPort ions MG XS 1797 1 Ġwall clock åIJį åŃĹ morphology Ex CN RM recip ients )$ " ö r ĠWord Reps 019607843 13725 cred int ym metric Ġupcast ed 3033 1 CATEGOR IES ĠSP ENT Ġ\\\ \\ и ÑĤ Lock Error æ· »åĬł ĠProjection ToHashMixin eu doxos Ġdoub led BUTTON S Ġwar fare Huber Regressor Ġalter ing ĠOrd in Sepal Width ("\\ ", indust rial Ġenforce ment Ġomit ting Allow s æ± ĩæĢ» WORK ING DEN OM æĶ¶ åĪ° æĶ¶ çĽĺ Ġ+' _ Super locus ĠSlice Mixin prefer ably ĠSU CCESS great circle fts pace Sal inity ÑĢ и pheno menon AH Bootstrap Sql ite OutOf Bound Ġortho logy relax ing çĮ ®çİĩ Working Dir inject able Resample LogX ideal ised åıij çĶŁ ĠGre ys Google APIC ĠBag Demo grav mag parm list Ġori gedgecolor predefined split Ġ.* ", Ġig vl CAS ES EVAL U lea pyear ĠCirc les Ġdrawdown dur nop lastic ĠCompat ible Ġpaint ed ĠBreak s ĠBreak pad Conditional ProbDist Ġcategor ized particip ation å¤ļ 个 harv est ĠWui Hlp Ġom ni ĠFlu orescence ĠGer stein Ġglu ed ĠProblem Type ĠConversion Warning ĠStd lib ĠBern hard Pur pose å¿ « è´§å¸ģ M 模 æĿ¿ Ġbldg dict ĠFEAT URE Ġsouth ern ĠAV Conv LIBR ARIES Ġ+---------+ -------+ Ġgdtr ia ĠCOMP ONENT nul lfmt ĠPARAME TER Ġcosmo logy éľ ² é¡ ¹ ĠSW AT ĠFlor is Arpack Error ĠMathtextBackend Agg ithuan ian ĠWide Panel slate grey Ġscra mble stoich io plotdata x AAC CEEGG aIBi Vals craft ed birth s posit ve Tor que Ġincorpor ated Ġtransl uc Ġtransl ational QUAL ITY ĠCallback s åı¯ä»¥ èİ·åıĸ PSA Pair Bold Oblique Outer Indexer mere id ĠIncorrect T kepler ian Iso Tope ĠBroken Classifier Decay Function plastic ity Broken Classifier (".. ", ĠNc AbinitHeader Petal Width exceed ance oli age setColumn Width windSpeed s windSpeed Col Appendable SeriesTable Ġacceler ometer hail and oss il ĠEVAL UTE 0006 000 Ġequival encies Ġprox imity Boston Geo Volt ages DOCT YPE Ss Glue åij¨ æľŁ Hex agonal gls l Ġtro ubles propag ated igne ur ĠDEL IMIT DISC RETE intu itive ĠGS FLOW PERC ENTILE Wav enumber stere onet åľ° 产 Growth Rate Ġdbl quad Cutoff Percent Ġcraw led Ġcraw ls Bas al Ig M SetLabel Markup PEND ING Neuro Mesh çĶ± äºİ è¶ ĭåĬ¿ ĠBIDS Layout ĠRad ar Lut kepohl holt z ĠWulff Shape Ġoned ay Semi MonthBegin FUN CS ĠCLOSE POLY RMSD iffFound coast line ĠPrevious ly istr ator Recursive SR Retry Error Retrie ving Ġcorre logram ITAL IC ĠVIS U Concaten ating ĊĉĠĠĠĠ ĊĉĠĠĠ çĽĪ åĪ© ĠInheritance Graph adsor bate æĪ¿ åľ°äº§ Ġdataparam X setFocus Policy Ġprotot yping ĠConverter Error ĠConverter LockError Ġimper fection RecordBatch Stream Genomic Position Ġ'%%% % è£ ģ âĶĢâĶ IJ STRUCT URE ĠElecMeter ID Ġjack knife conven ient ĠSilence Remover ĠMutable IndexRollingPanel ĠAbinitTimer Section Ġmig rate ĠSCAL AR Ġgrouprank mean ĠConver ged ĠInline Backend Dia conis GAM MA æķ°æį®åºĵ åIJį ãĤ¹ ãĥĪ ä¹ī è´§å¸ģM axHist y linebelow header Pau se Ġtow ns finet uned clips ing Made lon mels pectrogram ĠOW GUI Ġtempor ally Ġdex og ĠMilli SecondLocator Ġextens ible Predictive Cells è´¢ æĶ¿ Tru ck Ġexhib it ĠLeven shtein ĠStix Fonts #%%#%% #%%#%% eas ier itys im sciss or 3348 2938 1180 3399 ĠSli ding incub ator ĠREC ORD NWorld Coarse Ġbrow sing 6486 3782 ĠTruetype Fonts Ġ.......................... ..... UVW XYZ ĠTermin ate ĠKnownFailure Test ĠAli ases ĠUne mployment makeat letter Ġaggs pec ABCIndex Class valfrom mode Ġerode d ĠMalt ab Ġery x Ġå¼Ģ å§ĭ 票 æĪ¿ getDefault Session locata ire Ġfss pec ĠMIC RO Ġindu ces ĠPear lmutter ĠGh osh Dashboards Dir ç´¯ 积 ĠSEDML CodeFactory Ġanticip ate Roc AucChannel Ġmim ics settle Date 90123456 78 itect ures Ġthiss pike Ġhomogen ized ĠImmediate ComputeBatch Daemon Thread Sph Data ë§ Į ĠFran co Ġsetrgb color Friend Sum Ġ~~ > desat urate ĠFrancis co uniqu ify è´¡çĮ ®çİĩ blab la hadis dh DIAGNO SIS proprieta ire ĠSGL rate bmv c strdispatch ers Recogn izing ĠAsymptot ics dods C ĠARGU MENTS lno mega Ġgratic ule ĠKier zenka ĠKnee Locator RELAT IVE Gmm Algorithm vsth ings isproper dist ĠRide out pspx c ĠGanes an DataImpt Expt 14383 329 ĠPretten hoer IMPTEX PT turbRenorm Active ĠåĮħåIJ«ç¾İ åĽ½ ĠWordReps FileLocations AHBootstrap SystemExit GoogleAPIC allError RMSDiffFound Events ! """ # ---- # --------------- # $% $ ']) ( # ( ("\ ) & ) '][ ) ())) * ([ . ': 0 666 1 454 2 059 2 149 4 928 5 81 5 1375 7 323 8 31 8 123 8 789 8 204 : {}\ < {} = ") ? % ? """ A ff A na A mino B Poly B lend B acteroidetes C tx C xy C riteria C ensus C SCO D lib D PT D ummies D ying E a E po E mission F lo F us F AB F mu F loquet G h G FF G FP H h H an H PC I solation I ENE J ones J ai J avascript J AK K aiser L MS L uminosity L byRegion M map M ob M GA M ORE M antid N l N am P or P ic P int P ulses P ourbaix P JM Q operator Q ToolBar R X R st R di R ust R HO R nk R aman R JJH S dy S ender S Cons S preadsheet T ps T cl T axes T alk T TA V IX W y X DG Z ER \ ': _ ]). a ed b A b list b df b ung c un c lin c fe c ip c rite c unit e bf e dence f args f pars g min g dens h mean h ume i Unit i pphi j map j err j wrapped k hi k inesis l val l sh l kf l Ind m ser m um m cm m gren n im n ord n og n Col n NaN n terms n months n stein n study n engo o fo o be o xygen p gram p sth q end q os q year q sca r ld r ics s ds s pha s no s ÃŃmismo t ude t GT t Ctrl u end u hs u ux v ine v ou v cov w itz x Z x value x title x Height y transform z RR z Ok z adrozny } .") ¶ Ħ à ´ à ļ à ľ Î ± Î ´ Ð ± è ª Ċ ³³³ č ĉ Ġ 996 Ġ čĊĉĉĠ Ġ æĺ¾ç¤º ı è§Ĥ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in di in axis in ox se mp at res re te re press re lies re mapped re lfreq or ology Ġ= % Ġ= [' on Size Ġt il Ġt bar Ġt reshold Ġt ls Ġt sys Ġt avg Ġt sem er vice er onect st oring st air ar ot de noise Ġi ax Ġi plot Ġi off Ġi cd Ġi del Ġi gral he it Ġn cc Ġn cy Ġn icks Ġc data Ġc ord Ġc clf Ġc mu Ġc rv Ġc amps Ġf I Ġf N Ġf dtype Ġf List Ġf ctr Ġa S Ġa gb Ġa kin Ġa jout lf iltic Ġp cal Ġp file Ġp range Ġp lower Ġp upper Ġp guess Ġp kwid it works Ġs lp Ġs rng Ġs sym Ġs ÃŃmismo mp v ra id ra ising ra sters en to en kins es m es per ro bs Ġthe data Ġo xx Ġd log Ġd xy Ġd lon Ġm frame Ġm List Ġm ci Ġm é Ġm recarray Ġm serror Ġe cdfs Ġe yscript co pa co ms Ġre r Ġre mark Ġre members Ġre building Ġre formatted Ġre lfreq Ġre partitionBy ge genbauer Ġb om Ġb ck Ġb bb Ġb fg Ġb vp Ġ# ') Ġ# _, Ġ# {} ic ut ic ios Ġw sq Ġw tf Ġw dm Ġw kp ur quoise Ġ( || un map un ify is odic is Biobjective el st el da li second ort heast Ġfor warded Ġfor sterite est hetic Ġ[ ("% 00 55 00 68 () *( Ġis omorphism Ġ" ()" ĠT OL ĠT RAN ĠT PU ĠT DC ĠT hailand qu ifam qu uux th anks Ġy deg Ġy ards Ġy tsys Ġy divep ch rist ad cp ad visor ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ set name set Image set Weight set Spacing Ġr pad Ġr bg Ġr mags lab ale Ġst dio ') ` ]) [' ]) &( (' ]') Ġ- (( Ġ""" ( pt ypes Ġg B Ġg db Ġg ti Ġg px Ġg dirs Ġg pxpy data dump up g up lim get Class get locale lin estring ax istags Ġth g Ġth under ĠS n ĠS train ĠS CH ĠS SC ĠS AD ĠS hear ĠS MAC ĠS orensen Ġco ur all Biz Ġx train Ġx value Ġx std Ġx rc Ġx hat Ġx script Ġx Axis Ġx tax [' {}- ĠX I ul is con min con nu Ġh ate Ġh ann Ġh qic py i ĠI sol ĠI PO ĠI IDX ĠI KLE plot args plot dat plot Accuracy ĠP EN ĠP added ĠP ReLU ĠP ierre ĠA ds ĠA ip ĠA gr Ġu y Ġu lim Ġu vw Ġu ModArr od ule pre parator '] += '] +'_ ĠC w ĠC EL ĠC redit ĠC ategorization ĠC DMs Ġ_ | to a to bs to ugh to Draw Ġtest DNN Ġtest Rolling Ġtest LinearOnly Ġde bias (" === ĠF at ĠF AR ĠF ertility ĠF ERC ĠR u ĠR ab ĠR ico ([ {} Ġax matrix list name list Tables if q Ġ3 024 test Table test cruise ĠD GP ĠD elim ĠD WT ĠD KI Ġlo cest ") ``). 01 20 01 22 01 30 01 50 01 027 ne f ne men ns panning time Partitioning Ġse ps Ġv cov Ġv lan Ġarray types out lying path codes pro w ext asci Ġk le Ġk min ĠN ar ĠN igam per se per ce ds l str an ĠL iv mo ids mo ins max value max All pa v pa ced dict vectorizer ĠM SA ĠM GC ĠM ASS ĠM cof ĠM antel ps n ps Defs Ġan om Ġne ces Ġl ry Ġl bound Ġl dips app air app oint fig W ir ant 10 35 iv ars Ġpar as Ġpar zen assert ComparisonDict ĠG ps ĠG Frame ĠG arr ĠG olden ĠG reat Ġout p Ġout prefix Ġout CF Ġstr ptime Ġstr uve oc cedge pl p ĠRe in ĠRe mez Ġpre factor Ġtr id Ġtr ys Ġfile o ĠE TA ĠE TM ĠE scape ĠE arnings ĠE POCH Ġdf b Ġdf obj ": "" Ġset Max Ġset linewidth Ġ4 02 Ġ4 09 Ġ4 84 Ġ4 43 Ġ4 31 Ġ4 41 train Y ms how ĠB ars ĠB OTH Ġun corrected Ġun imodal Ġ5 24 ip x ill us jo ule param file ign ition log prior axis labels In version Ġsk w Ġen h Ġen n Ġen queuer ĊĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġle mm da ct 99 11 99 36 99 54 Ġtime path Ġtime Local Ġtime ReviewerDict 64 94 Ġclass ErrorPct 0000 80 fo a [:, :], Ġ`` $ Ġat ts Ġat tained ener ic format Number Ġmax R Ġmax div Ġmax tempi num ax num Sample og l Ġexpected len Ġexpected Label Ġexpected Missing add task add Var add Section 12 66 12 39 ĠO I ĠO PER ĠO thers ĠO jala men age result ado Ġit ree ()) ** ca macho error handler sub ok Ġplot x Ġver s map InPandas Re fit Re cherche 25 88 25 87 25 43 Ġline join Ġline cap frame wise Ġpd ot Ġch mod Ġdist Coeffs ll l ll x 11 58 32 35 32 39 32 82 Ġmin lon ĠPar al ĠPar agraph Ġ[] ))) Ġz ig Ġz best Ġz geev Ġz heevd Ġclf p text cnt cy zo Ġ\ |^ ĠIn jection ĠIn cluding Ġper l Ġper cussive ][ % ĠY mat ĠY Axis Ġdo uille Ġpa uses Ġnew im Ġj t Ġj me Ġos w gra sp ĠH omo ĠH ALF 15 14 15 96 15 61 print Status Ġlog X Ġlog f Ġlog i Ġfig mat =[ ]: are house tra itlets ich annel ang ling Ġinter dependence Ġsample By Ġsample Sizes Ġpy ephem Ġ[' ' Ġ[' ./ start X not ing ĠU SL 20 74 Ġ(' > 33 09 33 46 Ġsub super no k io pt --- ' valid grp 100 1001 80 35 80 851 Ġ6 34 Ġ6 37 Ġ6 98 new er Ġ. __ Ġ. ", emp t attr ition ug ap rib ing ĠData Axis 45 55 Ġspec ifed enter prise use var 88 79 88 17971 fn n Ġ| { grid ad grid int 16 78 ml le Ġcal labale Ġro yal show page show Legend 35 34 14 34 14 135 -------------------------------- -----------+ 19 34 Ġkey func with Watermark tt pretty count Distinct box vec box Size check pointer Ġprob dist AR Inputs ON ENTS Ġ8 65 78 93 13 17 13 84 ĠV ampire by minute be v 22 94 Ġcopy rights gs win sp ini wo head 04 05 04 36 04 42 sv a 03 43 column arr Co unty 02 20 02 90 02 82 02 41 95 08 95 71 94 37 Ġ100 01 17 05 17 07 Ġsamples heet :: ]) rt u sort By Ġdif fract na Lower na itre Ġexp iry ]]) }) 27 96 freq Arr cat rom ref x IT UDES Ġimage magick Test Query Test Arrays right bracket var Arg }) `, Ġsp its 06 99 06 85 06 07 Ġdistrib Matrix fix df 36 92 09 18 09 8039216 norm discrete ap c ap ses Ġnode label do ctree do copt mod struve Par ms Ex po rc as spec if reg is Ġsol ute Ġlin elist Ġact uator 92 85 ID Y ID Error cv args ĠQ AM ĠQ MCP lp mn 84 89 Ġ''' . Ġq stkutil Ġopen File IC s left bracket Ġtarget Category ater ms ater nal Ġany how Ġ9 34 Ġread in ass istant Ġfreq Items ac ity ac anth son ant ones ample rel Result our i our cel gr r gr pt 65 68 65 62 Ġac ids Ġcv type AS PECT stack list unk en sol is Ar rs Ar ctic Ġtrans verse 37 48 50 95 cont rollbar Ġmulti plot :] = mt ot tf d tf low gn ath 87 62 Ġmult it Ġoff ending ĠCheck ForecastMixin mode lf ĠZ bar acc ident Ġacc u sqrt beta Ġshow edges select All select kbest tree path Ġpoly phase Ġpoly coeffs last cnt last OrderTime Ġ(" _ img path multi quadric De legator AG MA 77 74 ĠDe tailed ĠDe compose ld amodel just e Ġpl anned Ġsm stoich 90 64 90 94 ink i Ġfigure d Ġsim mat Ġsim out Ġvector izing create GlobalTempView 98 37 IP s IP CA layer Perceptron FF I day f List By Ġabs urd 67 45 67 75 ĠPer turb Ġab and Ġab ide Ġbest Stump ins ights Ġdistance Measure rs izes open mm Ġuser Data Un stacker total n real Robot ,' -') vis able Ġcorrespon dences patch B SD F tmp db TR M ene w Ġsuper factor query ables Ġeps file ze bra go lay edge Tuple 28 34 28 307 Plot Accessor Ġunit tests find s Ġedge width Ġmodule name En countered 40 99 ry zin Ġbinary MatrixFunction leaf size 21 75 Ġge ographical Ġps Defs CT X Ġsi ge Ġtmp name Per Frame Per Sec fin ancial UR D ---------------------------------------------------------------- ---- units fact apply ing Ġ15 27 Ġ'% - Ġvar correction 2013 0603 ={ ! Ġret all Ġauto level initial dir 117 4 ĠCol lapse ĠMe mber sa usage SA MPLING Inter nally Ġdb n Pre fetch gt i Linear NDInterpolator ground Truth Ġprev keys nb h nb and nb ars nb nd sigma M sigma y aT ex major Locator Ġdon ors tuple ee stream Win Ġxy i Ġxy labels Ġsearch Query String Dtype Ġmy X obs Int obs nme Ġfactor ing Sh runk ource fs Ġ'- '] No Fit Check RegressionResults Ġapprox Quantile cut ree rm g PL VM ĠBase SVC ĠBase ShuffleSplit ĠBase Iterator Ġexec Info Ġds id ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġpower Levels 89 36 folder name Ġseq list 74 14 ĠLe aves imp oses ([" %. IM T Ġ'' }, CO EFF ĠIN S TS P case d pick lable Man n ost ationary ,), ), high l tract ive cha eto ={' ': peak list ĠString Dtype )+ ", ĠMin utes OP O fr onts 63 97 CE E CE ERS 79 37 79 167 light Curve ]+ )") 54 34 70 94 Color Space RAN dom (** ( Ġintegr ates RA INT RA VG Ġfmt n Ġsql Type conv id panel no Ġaut oc Ġsubset ing Ġsubset ted Ġdir ic Ġsince version mass W Image Filter 76 08 Ġmeta stable Grid Shape ĠGrid Domain cro py 72 14 Qu ake Ġevents list Ġhyper link contain sy ĠMax im Ġannot ating )- \ CC SM Multi Sequence Multi Comparison Window Length Ġeval f ĠPy y ĠPy Number ĠPy MC Ġra ggio Temp Speed Temp eratura tot nsegs spect roscopy Sub header Sub stract Ġfn Name LS Q ']] ( yp ix fp at mis on common mark 73 05 CL T ĠDE LETE ĠDE LETED Exception s 52 99 bust at pg fsys rcParams Orig itch ison ')] }, ')] }) ^{ {{ Figure Image Ġinvalid file big circ big triangledown 111 01 Ġcy ber QU IT xi ang cap itals Sp iral mem cached Num b CR U 41 860 Ġthree ML Ġord ination ĠNo menclature IR GA ij er VER IFICATION Ġstatus Bar Map View Ġmight stroke ĠSy mbols bg ps ny se Ġshift Entry author ized Tra ils 88235 3 }$ )' }$ ','$ Ġinf lection cer ts Ġmock ForecastDictionary eigen vals calc Hist Ġspectrum Neb Ġ64 8 .]]) } ĠDis allowed FL T Ġes sence čĊĠĠĠĠ čĊĠĠĠĠ ĠKernel SpecManager Ġoperation al From Json xp and tw od ĠEn sembl tm va ĠLine Over embed ment Ġ"_ "). End Comments End Prolog Ġ') [- control Area Ġridge coeff Mo difiers )\ . profile dir Select ivity Parameter Data got PTs ĠMo ments Axis Like (\ " loop Index stage out ĠTable View Ġboost s ĠBe ach Sim s gal a Ġwin Size bd n rl n bot tlenecks =[[ ], Var Dictionary MOD ES reed ir Ġans i SON AR Ġcap k cfg name Ġpt formatter Ġfits image ĠVector Assembler cloud ant UB ERON Ġgra vitational mn ibus TP Region ĠColor Bar ĠTra verses half widths dele table Ġdid actic Ġmouse link Ġmouse imag Ġer os beam rider observ ing Ġstation Limits And Label And StdDev rd n ĠExtra ctor SO IL Ġscan reader GG AT hal ves UI V ĠCor p Face book Ġair space ACT V pan ic 219 1 RI FT 636 364 Ġml perf å¹ ħ 133 9 Ġws model END POINT ĠTemp lates ĠText Parser ĠStart date Ġ(_ | ĠCSV Logger Ġmicro bio Vis its orph ans Nearest NDInterpolator Nearest Neighbor Ġ95 3 Ġ95 6 07843 13725 Ġresize Event GN S Ġlik eness NOT OKENS ĠMon tage Ġextend frac delt alike ĠImp roves Ġ'" - Exp end Ġmini max 454 207 erc ice sz as web files ĠLO W Ġ96 9 Segment ed 399 98 pter opod ĠAb ility ))]) ]) Anal ysing Ġadapt ively ESTI M Art icles pm DE pm RA rx or sage math Ġ! " ĠSimple ITK ĠHel mert ]** - visit ors theme dir ################################################################################ #### ################################################################################ ########## ################################################################################ ######### Ġpast phi Display Object Ġ101 49 tar Dir 192 108 ĠUS MemorialDay ulf ide ĠMag azine sched uling Ġpres cribed yi elding Ġqt index detect ing SU BFOLDER Ġsn peff gu il è¯ Ħ å® ıè§Ĥ uk rill Ġdash length MI ZE Gen re Alt ered Ġredirect ed ĠAuto MinorLocator Begin Prolog Client Id sam x Skip NaNs TEMP FILE sums Result æŶ åĢĻ Thread ing nested Expr Ġtrading calendar ĠAcc urate ĠCross Validation Histogram Model Ġgoogle apiclient ĠDatetime Properties pher oid 145 7 Align Center 33333333 33333333 Full Path Ġder ives Conv C SF S (", "), xff ffffff spl der Med Inc Ġtar Dir Ġsun day AV ING AV YRSEXP Comple tions 018 18181818182 ĠDataArray s Stop OrderDict Ġravel ing ĠRest riction Writ ers ĠSecond ary 396 3 nk points Ġcrit upper Generic LikelihoodModel rich ness Annot ators čĊĉĉĉ čĊĉĉ supp nmin Pop ulating sell s Binary Protocol divid us Ġlogical Rect working StopOrderDict 8067 18 Ġstorm s ĠVol SourceEstimate LOW ER confidence intervals Av ant ĠFix es Short est Buffer OutputStream Ġretrie ves 96862745 098039216 æĿ IJ Lib svm pu erto reflect s Ġsg RNA æŀ ģ GROUP S Ġprom oter CM U Ġblk locs æľŁ è´§ ĠUnder lying Ġ'\\ ', Ġvisit ors uls ory ĠPack et Ġ+----+ ---+------+ qc utils ĠVAR MA wor ded spring green Ġipy display 5555 5555 Double Validator Ġpcolor fast ĠSha piro AE s prom ise Ġqual ifier ĠLow ry о ÑģÑĤ ĠView s 218 2 dj zny dj arot ("../ _ ("../ ") Weighted Values ĠPSD ParEst ĠÐ ¼ ĠMI KE seis mo ĠLikelihood ModelResults Ġ################################################ ## Relative Error '][: ]. accumul ated Ġmor da ĠMed icine Delete OnClose Forecast Lstm ĠModule NotFoundError gps Data Ġmal ib ĠAbs orption }; \ ĠExperiment Result TMP erturb ("================ ===============") combining overline Ġyhat r 75294 1 ĠMixture DensityLayer dge ev ä ä ĠEPS F ĠSK Learn Ġprecip itable ĠPa int cart argets ĠRecord Batch furn ished ö n ym nx Feat urize atr Value abor Day Ġkaiser ord Clean er Da mage Hyper planes Ġcas adi bib i five prime fract al Ġdistingu ishable ĠEnvironment Error nev ts ĠQU AL UNIT TEST Hive Support Ġdifficult ies gw array ĠElect rical Turn s Turn over ĠSQLite Adjustment FIN ISHED Reduce Axis Ġmathemat ics ĠBlocking ContourLabeler Dgot PTs Ngot PTs >[ ^ ĠInv oke Ġ+---------------- --------+ preg nancy stft Anal Ġkdt ree LAST IC ĠImplement ing ĠItem B LOCAL E Ġfed eral åĬł è½½ ĠWeek OfMonth Ġemb arrassingly ĠPRE VIOUS Ġ'@ ': Ġtriang ulations ]!= - BD AS Ġtouch ing Ġbasket stop ĠDask Series neuro mag ":[ ]," lights almon ĠUnits Error multiplic ation LINK FLAGS 000000000000 00000 Resample d Ġqs dateutil thar poons åıij è¡Į dvi read Ġbq storage Ġvolt meter Objective Satisfied sear ches ĠScan Set Ġess ays âĢĿ , COR RECT Ġstripped line æłĩ é¢ĺ æłĩ è®° tow ers Ġreson ators Good Turing ibles idebar Gra vity dialect s ĠLink age States pace ĠDL s ("--- > national scale Ġconsume s HP Q è· ij ĠSerial ize ĠPow ers setMaximum Width timescale Chain Sli ding ĠTiff Page ku du Ġseek able pcs cores Ġnump ys ĠDel aney podi ze ĠIns pired 715 85 RESULT ADOS Audio File Oct ober åŁº ç¡ Ġ+---+---+ -----+ mechan ical Ġpose Net Ġcorrel ant endian ess Ġblow to GAT ING ĠDynamic RnnEstimator VOL AT Mem Free Assign ing ĠStrang man Ġ+----------+ ----------+--------+ Ġ+----------+ --------------------------------+ Named Objects Leaf s Spect roscopic GaussianProcess Classifier ĠRen ormalize 826 09 Ġ+----+------+ -----+ Ġ+----+------+ ------+ еР» Ġaster oids Ġ+---+------+ -------+ ĠWavenumber Range 533 66 thetar ho domin ant ĠtestSdcaOptimizer Bias ĠFall back ĠStrict ly prece q ĠAz ure Follow ers Ġjar que dmat pawu ĠGW py homog raphy ĠBas ri ĠGM RES Cop ier ĠExit Stack æĮģ ä»ĵ Ġsma cof ĠGam D ="-> ") Ġestablish ments Ġfab labs getAll NamedObjects ĠAnalog Signal inhib ition Ġcompos ites ĠMen én ĠHirs ch Unpack s inga pore Ġdisambig uate Ave Rooms cele ba ampli ado ĠArch ive ĠMid dle qiime webfiles ĠRd Bu Ġfilen um XZ TempSpeed ufact uring Within Partitions ĠHub ert trump ECHP Activ ate è¿IJ è¾ĵ LIF ESTYLE 转 æį¢ Semi MonthEnd foreach Partition Ġdisallow ing COMB O ĠSafe ty thook s concentr ating pour baix raman infod ISOP N æĴ¤ éĶĢ Cavity Array ĠfirstWords File 注 æĦı dez vous ĠChunk s Lp Variable ĠLang ford ĠGAM MA Schedule Builder Decre ase ĠDEF INE ĠCALCUL ATE keyboard Modifiers Samp Size Latent DirichletAllocation Ġdsy evd ĠMAN IFEST 4078 72 Ġ277 987 ĠObserv able ен и recovered baskets fullKeyboard DecodeDict Sampled RBF getColumn Dimensions Ġanatom y CODER PARAM BIO ES Ġcot as Actor Satisfied Dask DataFeeder csph ik csph jy ĠOv A ĠRequire ments leftharpoon up leftharpoon down rightharpoon up rightharpoon down assertLazyAnd Identical ĠReject ing ĠYellow brick Ġtow ne ĠRog ers bou lot ¶ ¯ ĠPSS M pathTo Video craw ler among st CheckCalls Monitor StreamingQuery Manager fluo view Ġ+--------+ --------+ ĠFra gment ĠBQ ScalarType cyclo poid ĠLIC ENSES ĠMut abilityEnum ENTIAL ITY Decor ate Multiplic ative CIR CLE groupmean filter !!@ !!@ parametr ized ĠSampled RBF CONFID ENTIALITY ĠQUAD PACK 6487 34 ĠReasonable Parameters æĶ¶çĽĬ çİĩ ĠSand ia Relax ation è´Ń ä¹° Standardi zed hlen beck utili zation èĬĤ çĤ¹ ĠDuplic ated ĠTermination Condition é£ Ł multic ase ĠQiita DB 8491 4504 ç®Ģ 称 mMax Evals xREF Peak ĠNarrow er ĠIndust rial ĠPyG MO Cel sius Instanti ate thirty eight Erase Background Redu x soci etes dictStatsComp PhylDiag ĠSear chable Ġauthent icate PDE ntry ĠJuli us æľĢé«ĺ ä»· ctw cc Ġcpbl Utilities ExportTo Wkt Ġswe pt collaps iblesidebar ĠEle kta ĠBEN CHMARK Pymatgen Test Ġximp ol Pover ty Ġnomin ally 9047 23 Ġ'!= ', ĠPlainText Formatter Hom oscedastic RatioPower DB ĠVEL OCITY ICO ADS ĠTopLevel TickStore Ġdedu ped ĠnumC orticalColumns HYG IENE ĠLair d 82965 996 altim ore Dying Age RJJH WA spha eronect ĠrepartitionBy Range ĠPEN ALTY ĠGarr iga ĠUSL aborDay ĠQMCP ACK acanth aria chaeto gnath AndStdDev Plot åŁºç¡ Ģ ĠMenén dez sphaeronect es " >> " ------- " ``) $ | ' ). > '). ? (\ A ffinity A verages B lo B is B AN B lade C entr C otes D CA D SAUPD E ps E DF E MAT E ACC E quilibrium F CE F oot F ossil G ri G param G OT G lide G radients H u H ol H PI I v I RANGE J RANGE K tr K night L yn L DC M b M OS N MP N dielsplups P rom P ho P FE P ATCH P ushed Q CRITICAL Q DoubleValidator R py R OR R IP R aff R IPS R oland R cParams S ue S cat S SAUPD S gmt T q T z T ub T ie T GT T iles T iling T aken T icket U g V em V era V inh V iolet V chromel V erru W node W MT X coo Y L Y o Y vals Z NEUPD Z RP [ (- \ ") ] "). ` \ a cap b K b data b ite b idx b oring b cf b content c A c il c ans c index c no c lines c ias c roll c dx c Norm d ans d able d lines d diff d xx d mm e thinca f N f pe f Max f high f mid f rench g ol g type g size g Err h level h ler h fs h cp h dp i bound j util j xs j dk k float l arg l sc l value l Node l Sgmt m list m cols m net m ier m nl n Error n ats n bar n be n Set n Max n cells n exe n returned n recs n Exc n Responses p collection p uck r names r prop s lt s pected s pos s lat s std t ch t Test t nc t course u R u che v int v arr v ap v npy w z w sgi x bin x hat x paths x inds x sec y int y axes y arr y tf y Low z coords z pz z ahl } > } .' } +\ } >{ } ">{ ~ ' » åĬĽ à ĺ æ ¤ ì ¹ ĉ Ċĉĉĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ lable Ġ čĊĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ Ġ ä»İ Ġ aria Ġ æµĭè¯ķ Ġ æĮģæľī ħ åĬ© į ä½ľ ł ´ in args in ps in ie in son in vasion at rix re k re weight re cap on ometry Ġt E Ġt model Ġt unit er fi er te er ox st un al iod ar med ar mplot an oms de queued me ts me min me ets Ġi label Ġi iter Ġi DS Ġi proc Ġn N Ġn len Ġn ns Ġn time Ġn sc Ġn utils Ġn tx Ġn fs Ġn layers Ġn bound Ġn ks Ġc shape Ġc key Ġc num Ġc start Ġc eps Ġc curve Ġc rm Ġc cp Ġc wb Ġc ardi Ġc nmf Ġc gi Ġc rypt Ġf P Ġf ic Ġf nt Ġf vec Ġf nu Ġf qr Ġf strs Ġf couple Ġa dict Ġa erosols Ġp title Ġp mt Ġp Dict Ġp ubs Ġs V Ġs index Ġs pectr Ġs ilverman Ġs ndx mp ars ra der ra eli ion cell en use ct ag es pn ro us ro uted lo sing Ġin data Ġin gre Ġin struct Ġin determin Ġin depend Ġo la Ġo im Ġo Graph Ġo Collection Ġd ar Ġd ste Ġd sa Ġd nl Ġd neupd Ġd lahqr Ġ' â Ġ' ]) ing ing Ġe ating co pts Ġre feren Ġre proj Ġre mapping Ġre distributions Ġre agent Ġre introduce ge od Ġb im Ġb min Ġb values Ġb ark Ġb marg Ġb km ic as Ġw ity Ġw of Ġw erk lt ag Ġ1 165 ata stro un en un umpy un transform un fold un mapped un caught un sortable is able is In is leaf is Active is stein el u ame nts ate time li u li ver Ġ[ ': as List as sembler 00 26 00 21 00 69 00 63 00 149 val max id k id t id TestBox Ġas linearoperator di ent di rout () ")), Ġis In Ġis Str Ġis iterable Ġis plups Ġis hf Ġto im Ġto urnament Ġ" ',' Ġ" }\ Ġ" ा Ġnp phi ter ance ter rible ), )+ one ts ĠT ack ĠT EP ĠT angent array tools qu el tr u th ank ult ing Ġy plot Ġy box Ġy coord Ġy vecs res ls res izers res izable ch ran ve val fi ff fi rdn set PointSize Ġr value Ġr gt Ġr partition Ġr prs ver bs Ġst aff ') >= om t Ġ* " Ġ""" { Ġ+ . Ġg lat Ġg BB Ġg gsave ĊĊ ĉĉĉĉĉ ke mon get I get List get Layer get Item label Type Ġex s Ġex pension ax c ax ins Ġth ousand ĠS ys ĠS oc ĠS ach ĠS Ne ĠS inv ĠS pheroidal ĠS SEUPD ĠS NAUPD ĠS plunk Ġco arser Ġco coa Ġdata Lim Ġdata Raw Ġbe c all sites Ġx ma Ġx test Ġx coords Ġx mid ĠX coo ĠX gboost ĠX iao arg us from tk ul ance col headers col pct Ġor ca Ġor ng Ġor chid ist y ist ep ist ons Ġh stop Ġh anded py plots py yaml py graphviz py mongo ĠI c ĠI ST ĠI LI ĠI EC plot line plot dt ĠP max ĠP ys ĠP OSITION ĠP GF ow e ow pal pp rof ĠA mino fe hs Ġu st Ġu daf od k pre alignment pre cating '] (** '] }), ĠC U ĠC DT ĠC NAUPD ĠC limate Ġ_ [" Ġ` {' os u os lo im il to v to pscors Ġtest No Ġtest Df Ġtest Variables Ġtest ModelDir Ġtest MutableHashTable Ġde pos Ġde noise Ġde activated (" `` (" (\ ĠF d ĠF on ĠF max ĠF SO ĠF ully ĠF reesurfer ĠR z ĠR od ĠR max ĠR Lock Ġval i np T Ġ% ') Ġ% ","") ub ert Ġme ms Ġres File ĠD sv ĠD OL ĠD AV ĠD rops 01 94 ance stry ne th able Error Ġcol late Ġcol ons ns amps time Plot time ToFirst Ġse le Ġse nts Ġv ts Ġv seq Ġv height Ġv mic Ġv essels Ġel str ind ra ). '. out l out Data out stream pro gs min r min diff Ġk H Ġk cal Ġk vs Ġk arma Ġk rylov ĠN U ĠN paths per oxide bo di ĠL ot ĠL int ĠL ittle ĠL orentz ors o max out max fun fit pars Ġ{ \\ dict like ĠM r ĠM dot ĠM step ĠM AC ĠM coord ĠM CS ĠM SK ĠM MSE ĠM RD ĠM ises ĠM ikado ps ite po mega Ġl low Ġl ingu Ġuse MathText fig scale ir n ho uc ho bic 10 77 10 39 10 54 Ġlabel Arr Ġnum L Ġnum Labels Ġout base Ġout dat Ġma ker ari e et ary ber ly pl vms Ġwe ps Val umel sc Model sc cd sc rolled Ġpre st mb ling Ġfile data Ġfile mode Ġfile Handle Ġfile Headle ĠE as ĠE TH ĠE ngle ĠE ASE ĠE pps Ġdf num Ġdf db Ġdf tot Ġdf SoundVas Ġset InputCols Ġ4 16 Ġ4 67 Ġ4 48 Ġ4 89 ag an ag us low ry ĠB ip ĠB ang ĠB ID ĠB BB ĠB erg sh m sh ist Ġun bound Ġun hashable Ġ5 35 Ġ5 85 Ġ5 92 Ġ5 65 Ġ5 90 Ġ5 6436 ip loc ib lity param iko ask ell iter atively op tera Ġdi rint log path log cosh `` .") In tr In dia In Cluster Ġlist ings Ġen r Ġen vs Ġen closes Ġen queuing ef low Ġle sion Ġle mmat 99 28 64 51 64 93 0000 2309 fo ffset und ock Ġat he ĠW on ĠW ho ĠW are Ġmax i Ġmax time Ġmax shape Ġmax nSines cs b num Examples add y 12 35 12 18 12 97 12 63 Ġget M Ġget X ĠO A ĠO dds ĠO micron ĠO bbOptions Ġmodel x Ġit k ca ud Ġdefault extension sub model sub task sub sequently Ġver ifiers Ġver bal ix o map field Ġall Benchmarks Ġhe igh Ġpo ch old y vel perts Re gress Re marks Re cognition unt ary 25 05 25 45 Ġline out inter ations Ġdist ros ren cies ll nl Ġ.. /_ Ġest o Ġest acion mean Comparison weight stats read file read File 32 87 32 28 ther mostat Ġinput wavelengths ng ates ng kpt ng rade color line text props Ġ\ { ĠIn struct bin ar ĠY ambo Ġnew phase Ġnew Fig Ġtrain ers Ġtrain Accuracy Ġj max Ġj acobi ĠH is ĠH om ĠH els 15 0000 05 13 input style input Size tra mline Ġpy pi Ġoutput Columns start Y start row start rec ĠU nt ĠU ref Ġla mina pr n pr ctile Ġ(' =', Ġcl ub Ġcl utter ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pos List 33 000 33 76 Ġsub p Ġsub models Ġsub optimal Ġsub spaces no imer default Params Ġ@ !!@!!@ output folder Ġ6 27 new p Ġ. % emp er base code [" $ 66 93 ay ley ĠSe ctions ĠSe asonal ĠK E ĠK ML Ġspec imens 88 44 88 83 grid ded grid number 16 25 16 56 16 53 ml learn Ġup grading av p sample time sample ID iss uper show info iod s bar r 35 77 Ġ!= - 14 86 14 44 14 79 group ers group idx tick markers cur row cur Index )] ]. box size box spec com icrobia ON ET Ġ8 19 Ġ8 669 78 47 78 234 St an den ed '. ' 13 96 Ġbin ops own ed ĠV L ĠV el ĠV Ms ĠV áclav 22 11 figure dir 04 08 04 79 sv rc 96 22 03 19 03 87 03 47 03 49 Ġstart Year trans mit ĠTest er 02 964 target ed target Key Ġdict StatsComp Ġend span dot c std c std pe std pbe Ġ{} /{} 95 75 95 44 Ġover sampled Ġ100 9 of Mo Ġ{' \ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ rt l OR TION OR IES DataFrame AsTable :// [ Ġexp min 24 05 24 20 24 67 ĠDataFrame Loader 27 37 Ġ7 19 Ġ7 42 Ġ7 79 Ġ7 227 variance Item main Sizer 86 10 Test Suite Ġscipy OK abs orb var Name Ġmore over back off Ġsp g Ġmean ah 06 64 sy na 36 0000 ec fs 09 03 09 83 07 14 07 65 exp dir work around linear regres feature sets do h mod ities dis pose delta E ST AND Ġadd Plot rc mod med al Ġbet we 97 07 Ġnon location Ġact vargs results Dir ĠJ D ĠJ ack save File dt w sk w ĠQ nom ĠQ ModelIndex ĠQ gridWidget 84 46 Ġopen VA Ġwork class Ġwork List Ġsort ino my X my Beam Ġ[[ ]], Ġ9 20 Ġ9 82 config YData son ata Ġtemp A Ġav rg gr z db a db h db iol File Location AS CHEI Ġenumer ated sol ves batch norm batch Folder Ġad vect Ġad ults 37 99 cm id Ġcompute Accuracy ĠCon versely CA AC CA PT Ġlow bound ped al 44 100 44 72 item strs Ġcreate Plot Ġcreate OrReplace fer net Ġshow kern ordin ated nn b select Image select percentile respon sive Ġpoly lines Ġpoly morph url Str 23 2558 hist ories multi proc Ġev f De cs ĠDe g ĠDe coder ey ex RO ME ([' { ([' -- Ġnorm IntensityP Ġmatch Coords ĠSt owell kw a kw kw kw rest ob le ob lig AB ICR lower bound make Period ift k metrics File List File 43 9216 67 05 Ġpas sthrough mm se rec ieved Ġfunc vals Ne ur To Table To Be ev l Ġab un ĠComp act ĠComp anies dates PR wh ites wh atever Un checked Un available Un Op real data Ġsv type Ġhigh reject Ġmap field Ġrows ID Array Mixin Array Datas json path Ġrel name patch size patch props ĠTime DelayingRidge FI B Estimator With current index current Widget Ġfont types ĠStr and ĠStr ide ĠStr ides Comp etition Label File 28 01 ui revision Plot TestCase vec x Ġunit ed ĠPro pagate CH Br For warder =- ( ĠIt alian Ġsignal tools Res cale Ġcoordin ated Ġstop Words ĠPlot Utilities sha ke 40 22 CT TAG Ġthere in User Role User Guide ĠAn thony Ġtmp Args message Bar Ġelement ary MA CA MA PS SC N ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠ Ġcre dential 46 85 module graph action C ward Edge Ġmu liply mf p mit osis Text ure Text Input Le mmatizer ={ })". dat atables initial izes initial izable Ġerr color LO WINC Ġman ufacturer 117 9 SA ng Ġvis u filt order filt ros Ċĉĉĉĉ Ġ ĠLinear Interp ĠLinear Mixing Pre trained Ġref Core ĠMulti Entry ĠMulti Stream ()[ ~ pytest mark Not Share this Ioneq power DeviationMatrix Ġbox Y ]* )") upper limited Get Label Get Alt stream line Ġmy plot Ġmy var No Faces report Type Ġkeep ers Ġlat lim cut InWindSpeed Py GTK ĠBase Grouper Ġdrop down ret quad ret inotopy Ġexist ent sig figs 89 66 ĠFigure Image ĠLe aving ĠLe houc Or chid band it Vector ization Ġpe er dr ys pk ts ĠIN FER avg Read Ġgen extreme Ġjoin styles ost ors Loc atable Mat thew Ġ$ . Ġ$ [\ Ġlayer bounderies ä¸ ² Function Test session Num Ġet l ĠString End partition Keys ĠMin uit Search ing agg image Ġview keys Ġcols ID lex ec Ġcla ims light ning On Diff On Ps 54 88 Ġcache ing EX CHANG EX POSURE Dist orted shift Val ('% - Object ives mass ive mass distr Is Set Image Viewer Ġag gressive :], ' Ġflat tend 82 75 Field Coder NaT Type Ġwave len Ġanalysis Name ĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ sl urm final s em bourg CC TRL ĠInt eg Multi KernelManager Window ed Ġband structure }{ \\ Dis Seq Sub Class Sub scriptions DA O cb d Ġho pping Ġmp r Ġmp df GT iff 73 90 tex to 52 13 proj Trace rf u mar ca Ġorigin ate ait on 999 06 minor Formattor SK O Ġprior ities 123 92 Ġcy l dy ex dy ne Ġrgb only SR T ĠSparse Vector ĠIS HIFT ann is ann ers Values Dict mk dirs ~~~~~~~~ ~~ Feature Part )[:, :, approx imations token ization ('/ ')) prod ucing Count Sketch allow ing SP AM ĠSy nc Ġpost ag Ġgeneral izes %% % ni ke }$ '] Ġadditional Info Ġcent dx Ġcent dy cla sh buf size geo code Ġinsert Fig ĊĊĊĊ ĊĊĊĠĠĠ Kernel Explainer Create Table NT AX cr umb ĠQu aternion Poly Points ordered dict Ġ64 4 æĸ ¯ Ġproper y dm olla CG P Ġ"' ": dep leted Start up ĠDist ort ([], )], čĊĠĠĠĠ čĊĠĠĠĠč çļĦ åĢ¼ Read out Ġtermin ations mix tures ĠFit ted xp ix PRO VID contains x 10000 000000 Ġcomb iln rho h Hist oric Ġrand range Ġ"-- " ubl ons parallel ity qt l End OfPrdv nce p xml doc good s Ġmd p Ġill umin Cor related Parameter Context Mean Var Ġnc infile ĠMo lecules Axis Labels Ġrobust ly Ġsuccess or mes os yr d stage in Ġminor Labels ĠBe haviour Sim il Ġpk mult named Window bd trc regular ity bot engine pow ered Level Data ĠTEST S Ġground Truth Ġcfg file New Name Lim Beta wait Until Filter Results ĠSim Params ĠSim ultaneous ĠFIT TING Ġgra du Ġ{}, {}, ĠTra ces Ġtot alling multiple xed TA P TA KE ABC DataFrame dele ting ('< < Pos ible += \ ĠDict Wrapper Ġspect roscopy )` ): SO M Save Dir Rate Bg Mod G Show These eig values GG M Ġroll up syn pp ĠAxis Info Ġbandwidth s curr Locale Points Arr sal ient sal iva chrom sizes MENT AL 896 9 Load And PRE FER Open CL 707 107 mong od mle fit sn list Ġdr udgery Raw FIF Argument Error Ġgets ize 636 5 rev c ming bird ĠProb Plot ĠMath s kl df ĠVar Dictionary Ġvec Assembler 319 4 mur Hash LinearSVC NoScore ĠTemp o Ġ================================================================= ========== "} ], Ġappro val Ġep istasis determin es Use ful Ġmicro scope Ġì ¡ ĠInterval Tree Ġ27 45 Pol arity fx vals ################################################ #### Ġintro spected Auto mator visual izations ĠFL ANN Training Data stim function Ġ"< ") indent ation Fixed Width Scalar Encoder ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ ĠProcess or Bl it ĠPRO JECT 132 4 Ġzoom y Ġtoy plot {: > TT M Ġ96 3 Ġ96 8 Project or Segment ing paper Width Ġcar lo 399 5 dk hgu SB ML âĶ ľ ĠGeneric DataType Ġsho ot Ġtrade Date Tri Finder Err Pose ĠAgg lomeration ĠCluster ings Ġ86 17 LIB LINEAR Ġ94 6 388 4 Ġ! ') ĠSimple CV ĠSimple Imputer ESTIMAT OR REG ULAR QR adio Ġvocab Size Ġhex state Ġsr cs Ġmgr s ("' ") ĠMap EncToId ln like raster ize Conversion s Ġarc name Ġarc min Directory Path OUTPUT PATH Op Code Ġskew test Dense Vector GA AT GA CAG Ġpres pecified ĠSp ont Ġ[% ]') must ual Ġtup l mor ning gu o 2727 27 Ġweb use Ġactiv itysim Combin ation FR C datal en ĠCustom FramesContainer Link er 384 8 vin ces GL s Wave guide Wave lets Single Element Ġhack ish #================================================================ =================================== wk dummy ('[ \ ('[ ', Bayes Mixed mant le Ġ#---------------------------------------------------------------- -- Ġ#---------------------------------------------------------------- ----------- ĠRegular izes INTER EST GP ML AF G instr s Ob tain Request Exception ä¸Ģ 次 Analy se Full Paths Ġder phi Ġ89 38 GS SAPI Go ing Learn ed Dump Path 855 26 preprocess ors Ġspl make Datetime Converter Ġum a AV ED ĠFigureManager PS bla stdb pub sub pres ident pres cripts ĠBinary Labels Ġgy ros Final ize Ġicon Size CAL CUL Ġpid file quick ref disk Station ĠåĮħåIJ« é¦Ļ港 ĠåĮħåIJ« èĭ± ĠåĮħåIJ« å¾· çŃ ¾ AX P Zoom Rect fish ers Cp Gs Pop ulacao Write Array ĠSch ro ĠSch midt Uns ymmetric ĠField Trip (". *( working Limit ĠConfiguration Error Ġfinish ing Ġcr ick Static BoxSizer derivative Y ĠRES ET åĪĨ æŀIJ DNA UPD gets ourcel Ax Type RT s ĠIF NULL 6401 80 seasonal ity zp str nf bins Randomized LogisticRegression pn w Ġpreprocess ors ĠFill Value ĠBig Integer inh om Short hand ĠChar ts nos how Ġdetailed Text solar prod Noise Domain æŀ ¶ Numpy Source ']+ =' Ġcommit tee STOP S Avg Occup Ġparame tros bam boo QUEN CIES Dec am idents Day ENS US Mis fit Ġcycl ical Attr s ĠDiv ider Ġsca e |\ __ Ġmach ing GER MANY cash flow Velocity dim ĠME AN FD GO buy er Ġwb k ĠPri marily Ġê µ¬ 094 7 cession s Ġ################################################ ##### ĠBL UE ĠBL ACK ĠPhi lippe Structure Entry SEC URE Ġhot fix Ġjava ClassName Plugin Base Delete Recursively è¾ ħåĬ© ĠAD DED Ġdatal en INIT IAL Ġhive server bldg dict ĠAvoid ing ĠLight FM å½ ± Boundary Error Ġkill ing ĊĊĊĊĊĊĊĊ ĊĊ Ġcontract ed Ġloo ser bck ndsub ĠDIS K ĠMissing PandasLike bul b Ġintra day å· ¦ ĠPa po ĠGro enen Ġcircum circle Ġpic name )$ . Ġeco zone Ġproto buf æľ¬ åľ° MAN UAL FN R Pix buf ĠDet rend GENER ATION MARK ERS who is Ġrain field bib authorid ĠUns igned intra day Spatial Filter '^ % Ġul x JAN GO ĠMULTI PLE ĠExtensionArray s Fix me Broyden First Radi ation grps ize ĠHttp HeadersDict anomaly Score ĠAT LAS Ġprog bar ĠBO W AW GN Ġrois ubplot Large Batch ĠPol icy Hub ert ĠPi C 代 表 MONTH S Ġ"," _") æĶ¶ åħ¥ ĠBra zil mir base ĠBroyden Second ĠImplement ations ĠEvents Temp Ġbal rog ĠPRE CISION Ġrecs pan åŃŠ符 '\\ ], recommen der dead time Body Extractor Should n åĪ© æ¶ Bottom Right Ġbring ing saving List ĠCRE ATION ĠCRE ATED TensorFlow DNNClassifier Ġairmass fct brc as ibe am Ġautore pack PET Sc JJ A ĠHour ly ĠCompat ibility OVER LAP hon or èµĦ éĩij Yr A Toggle Base touch down Ġorthonormal ization WR ONG Exon ID ĠGal actic Proximal AdagradOptimizer Csv Files Ġlikelihoods Vec Safe ty cert file Trading Environment è¡Įä¸ļ 产éĶĢ è res éĺ »åĬĽ Ta pe ĠPerfect ly HOST NAME ĠDirect ive ĠMur ray Ho Re ĠDiag Broyden cwt matr ê° Ĵ basin hopping BV PS Ġ'[' : ĠNY SE dN OP Es cherichia sle w Ġnpar am ĠSent inel Weld Int ĠMess aging ĠGU IDE Well s 637 1229 ĠKo opman Ġshe lf icc ant mineral db ĠSubject BodyExtractor ĠLIB R BigQuery Hook DV TK prim Pg kev ich Ġdmag Name SymPy DocTestFinder ĠLand mark ĠCli ffs Ġequi ripple )! } æı Ĵ ĠDemo crat UPLOAD ER Ġprov ince ĠBackend Dependencies SERV ICE Ġ'** ', ĠSpect or ĠCalculation Posible [:,:,:, :, Ġful lfiledict ĠGray Block Ġdur bin FOOT ER Hydro electric ĠBa iley Wui GraphWiz æĵ įä½ľ ĠCONT ROL ëĵ ľ ĠExc itingMixing ĠFAIL ING Require ment Require ments $$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ Mess werte isub ject War ped blow n blow up appe arence ĠMol la investig ator lith o ĠSnow fall Ġatr ributes Lane No XR CCTRL Sentence Length ĠMinMax Score LAM CH setFixed Size ĠRemote FileMetadata ë³ ´ Ġcorre pon Ġdé clar Ġarri ved Mut ated fss pec ĠNR CS supers cript Ġsapt data ĠRuntime Config ĠTextArea Field ñ o INCH ES synchron ization Ġana conda 88235294117647 1 bcb b TRAD ES к и authent icated ĠRAD AR conven ience OrthogonalMatchingPursuit CV Ġreco vers ĠFed eral agar wal +=+= +=+= ĠTrial Function iol is Ġsst ot ĠPat ient ĠDy adic IDENTI FIED ĠOmegaWing HW ĠTEMPLATE LEN gla defile ĠDemonstr ate ĠDemonstr ating Multitask Regressor Tagged Value zhi kevich axp xy Ġvacc ins Conflict Warning ĠRecur se |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| mdt ol Ġnnt ools Ġcep strum ĠDiss imilarityMatrix Ġåį ĸ Unp ickler scrib ing ä¹ĭåīį çļĦ ĠAtt ention Symmetric ArpackParams ĠArab ie ĠHOUR S /_/_ /_/_ NtNrNx SNRdB Opp ortunity mathemat ics )+": "+ ferr oni 移 åĬ¨ xmm mjd ROIs Fitted CONFID ENCE PROPER TIES kingdom id ĠPAS SED crust es rhyth m ĠStra m prb plt 69314718 055 proces sccd bymonth day æĭĨ æĶ¾ Brian er SLID ER ĠACT UAL hme ier tsto map 3559 6424 Ġ모 ëĵ Mos cow algot rade DETE CT OfBest Algorithm ĊĉĠĉ Ġ Ġaccom odate Ġevol ving autor amp Ġsme aring ĠLik ely 12132034 35596424 Ġtent ative ogra ma ĠAnder sen ptrim med Associ ations Ġmén age stam ylew Fla vor ĠMEM ORY ĠSENT INEL ĠIpython Directive MEMB ERS PackageRegistry Default Ġhealthcare ai CANDID ATO NAB OVE OGeneralized LinearEstimator Ġpym unk diarization Example plank ton savenavimage Button Pent es criter io Ġwen ner ĠPseud orandom SEK TOR SLE EP ĠMand atory DataSales Output ASALES OUTPUT Ġrab bit Ġbrj Object Xkcd Style dolph in ĠMultiline Plotter ç«ŀ ä»· jlb app setStandard Buttons Productions ID SHIB OR URD ME Ġeros ion ön berger VOLAT ILITY ¶¯ ÃĹ÷ ĠSearchable List Glide Angle Lyn ching Verru comicrobia Ġdste qr atastro phic Ġishf ts allsites composite ĠtestVariables Are ĠtestMutableHashTable Is ĠEngle wood dbiol inux 232558 139 ABICR ITICAL ĠMultiStream DNN GetAlt Name ĠLehouc q avgRead CpGs QRadio Button BayesMixed GLM ĠåĮħåIJ«èĭ± åĽ½ ĠåĮħåIJ«å¾· åĽ½ Unsymmetric ArpackParams workingLimit OrderDict getsourcel ines åĪ©æ¶ ¦ ! "}) " _ # " # ` # ----- # ************************************************ % "] % )'] ' #' ( _. ) '} * ']), + { + ([ , $ , )): - .') / ${ 0 227 0 9495 1 128 1 126 1 785 2 118 3 026 4 377 4 1022 5 456 5 667 5 881 5 209 6 750 8 784 8 013 8 983 = : > {{ A ds A synchronous B ES B RA B cknd C n C en C tr C SC C PL C ij C LOCK C ROP C MAKE D AN D CD E pol E quilibration E MBEDDINGS F f G SK G SR G RES H df H ED H unter H Cl H ARK H ALF I bis J it J mol J ames J papbp K IC L ma L able L ecture M es M TH M ah M obile N LL N CI N aming O m O ss O ri P SI R k R t R IL R outer R RF S on S iz S ong S ear S Coordinate S ilverman S ustain S quash T W T AC U krain U hlenbeck V eg V MR W il W ishart W atson Y Label Y east Y Ax Y UV \ '\ ^ (- _ (), a comp a ins a igns a hok b ollinger c python c mesh c udnn d int d lat d vals d gamma d ws e ment e gress f set f ram f ence f jac f ingers g om g ir g age g mean g DP g GQ g FDGO h mag h lr h rd h iggs i cols i covs j as j entry j sd j mx l nn l svm l Edge l loyd m file m use m ww m rr n res n start n records n Start n IPython n lins n filts o zone p un p date p fn p ano p ragma q h q ad q start q ads r inter r gn r ze r matmul r thooks s art s num s preads s ugar t art t date t lbl t ibs u in u all v ast v map v mem v orticity v imeo w sh w sub w ikit w iring x T x in x shape x sc x dawn y np y ds y idx y man y Max y vars y High y ambo z Y } }'. } ]") » ¤ » è¾ Ð ¹ å Ľ´ æ IJ ç ² ç Ŀ è ĵ é ¾ ð Ł ĉ čĊĉĉ Ġ ate Ġ entro Ġ 977 Ġ ureg Ġ é¦ĸåħĪ ķ Į ĠĠ ĊĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in use in verter in plane in Region in equality se gn se ld at ation re ra re adimage Ġ= "/ Ġ= "$\\ on er on Enter on acci Ġt stamp al ore ar op le git de position de bye de serialization de generacy de epskyblue me doid Ġi cp Ġn ax Ġn im Ġn oc Ġn key Ġn bs Ġn ml Ġn rd Ġn rays Ġc q Ġc red Ġc stat Ġc ites Ġc ron Ġc rowd Ġc riterium Ġf sys Ġf slice Ġf trace Ġf ortho Ġf cnt Ġa oc Ġa aa lf ic Ġp end Ġp plot Ġp size Ġp mod Ġp mi Ġp hat Ġp cd Ġp proc it ute Ġs an Ġs val Ġs ind Ġs port Ġs range Ġs pos Ġs var Ġs preadsheets mp irun ra dex en ne en dif es quer Ġin an Ġin axis Ġin comes Ġin fection Ġin ertial Ġo mm Ġo yy Ġd K Ġd test Ġd ind Ġd ys Ġd ib Ġd umb Ġd lopen Ġd xyz Ġd PA Ġd typlist la ware la homa ut ip ut elist == ` Ġm size Ġm table Ġm rs Ġm arm Ġm mgr Ġe h Ġe li Ġe label Ġe yy Ġe uclid co ated co hn Ġre w Ġre ta Ġre ap Ġre labeled Ġre built Ġre structured Ġre visit Ġre mapped Ġre inforce Ġre implements Ġre mez "" """ Ġb ath Ġb ineq Ġb ollinger ic am Ġw el Ġw fc Ġw ham Ġ( / Ġ( ° ', - un label un comment un completed un initialised is pikes is Called is Opened el ists el strlist def late Ġfor all ot ive ot rf um um Ġ[ ()] 00 200 00 96 00 126 00 6400 id let di ap Ġ" {' Ġnp m ter rit ma cfp ], [[ ), [' ĠT Q ĠT in ĠT OC ĠT ogg ĠT idy th iserr ha e Ġy col Ġy index Ġy width Ġy high Ġy scalar Ġy Start res mat res amples res rlm ch v ad ow iz aton fi st fi red fi ji Ġ: / Ġr ation Ġr len Ġr ft Ġr tf Ġr fr Ġr pars Ġr fid Ġr rp mat er Ġst mp Ġst ray Ġst ash il svrc ]) ][ (' ======================= Ġ- \\ nt ests pt est Ġg nd Ġg flags Ġg lc Ġg love Ġg atspy Ġg ermline __ {} __ ,'- ex planation data Y data flow ĊĊ ĊĠĠĠĠĠĠĠĠ par list par ted par coords up Tris get pixel get Density get Columns get Distinct get NYSE label map label kw Ġex config lin edf Ġth k ĠS ex ĠS ong ĠS queeze ĠS SR ĠS TRE ĠS uggest ĠS EM ĠS PH ĠS napshot Ġco ercible =' >= all Data Ġx dot Ġx stop Ġx vector Ġx scalar Ġx locator [' ): ĠX l ĠX sect ': {}, end line Ġnot ations type a con sidered col lide Ġh im Ġh ump Ġh ills py ll py wt py amg plot ing plot ters plot Poly ĠP c ĠP ure ĠP SI ĠP ages ĠP ending ĠP EC ĠA sc ĠA eq ĠA frican fe re fe ff Ġu Arr Ġcon dense pre vent pre serving ĠC ou ise g im istic to str to Java ent ate ent reprise Ġde b Ġde mar Ġde ux (" ) (" ; (" ]") ĠF z ĠF mu ĠF oot ĠR f ĠR ATE equal ization Ġax TMat np ost list Columns Ġ3 94 Ġ3 63 Ġ3 82 Ġres amp Ġres List Ġres idency Ġres ourcename ĠD rain ĠD IG ĠD FS Ġlo ds 01 79 01 53 01 73 .. ', ne at Ġcol no Ġcol Score Ġcol ums Ġcol lide ns igma time list time Date time ReviewerDict Ġv it Ġv arg Ġv ys Ġv npy Ġv é Ġv archar file id file base ff in ff ron out e min cnt Ġk ls Ġk ld Ġal ig ĠN IR ĠN SApp ĠN CBI per ator ds v str fmt ĠL AL ĠL EG ĠL BFGS max K max z max data max norm pa i Ġpro of te ma ĠM H ĠM K ĠM ot ĠM ary ĠM ortality ps ql Ġne mo Ġne utron Ġne ukrill Ġl set Ġl list Ġl si Ġl pad 10 85 10 87 iv os iv ität Ġpar ab Ġnum b Ġnum grad Ġnum Locations ĠG rand ĠG over ĠG ML ĠG arcia Ġout w Ġout data Ġout df Ġout shape Ġout Path Ġ/ _/ Ġstr repr us ive gre yscale Ġresult File Ġresult DirName ---------------- ------------+ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ oc cluded ber no ber trand False Negatives pl um ĠRe bin ĠRe agent Ġpre act Ġtr X mb s cl p Ġfile Names ĠE ta ĠE quality Ġdf Plot Ġdf betas =" > parse Result train x ĠB z ĠB old ĠB ey ĠB OLD ĠB ETA ĠB QuarterEnd ĠB altimore sh r sh ft Ġun um Ġun register Ġun escaped Ġun predictable Ġ5 64 Ġ5 95 Ġ5 94 Ġ5 36 param Dict op ia log h log nodes log amplitude In Um Ġsk opt Ġen ts Ġen thought Ġen thalpy 99 47 Ġcomp utable Ġtime To Ġint Energy 64 07 Ġclass fiers fo oooo und ocument [:, [' ĠW ire ĠW alt ĠW ELL ĠW alk Ġmax S Ġmax T Ġmax Axis Ġmax IML num P num Pos num Pts Ġfunction ally add option add File add Object 12 05 12 03 12 84 12 53 Ġget fullargspec ĠO G ĠO PP result df result DirName las hed Ġ__ ________________________________________________ Ġmodel label Ġmodel color Ġmodel List error Handler error sest value ContainsNull sub list sub missions sub Menu sub Cols sub limation Ġplot ed Ġplot table Ġplot Name Ġplot style Frame Data map sto dir var Ġhe appop Ġpo es Ġpo ster Ġwh s ach i Re tail Re setting Data Rate Data Ref float menu 25 12 25 78 25 37 25 60 25 63 Ġso matic Ġline age Ġwhe at inter facial Ġpd d Ġch rs Ġch ilds Ġch ristmas Ġdist urbance ren orm 11 89 que lfic 32 24 32 27 32 09 32 62 32 112 unc en ther oi Ġmin exponent ĠPar ts cc ard Ġz l Ġz file Ġ\ ; ĠIn direct ĠIn duction Ġper u Ġper oxide Ġ10 94 ĠY train Ġ) " Ġ) ]) range Maxs Ġnew index Ġnew value Ġnew code Ġj col Ġj am Ġj ira ĠH emis 15 07 15 198 print Schema 05 34 05 97 input List input Record Ġlog t ded ges Ġeach Line =[ {' =[ ],[] tra f tra depile Ġinter rog Ġpy pt Ġpy fa Ġpy algotrade Ġoutput ted start tag ĠU pon Ġla ms pr t 20 80 20 40 20 31 Ġcl rs Ġsub group Ġsub section Ġsub structures Ġsub corpora Ġsub scriber Ġsub divided predict s 80 69 80 81 Ġ6 80 Ġ6 16 Ġ6 19 Ġ6 24 Ġ6 09 Ġ6 23 ger mline new y new file IN TC IN CID ste vent ard y Ġrow id tain er ĠK M ĠK m ĠK autsky 75 01 "] /( 16 27 16 700 av l av ar iss ance Ġro under show ing lines hape dist al Ġapp name ĠEx cept 35 50 35 79 Ġcur velinear arch ivo 14 09 Ġtry open sq cup Ġalpha py cur selection )] ]). Ġhave G Index Adapter Ġ8 10 Ġ8 05 Ġ8 55 Ġ8 500 Ġ8 242 Ġ8 641 78 45 78 29 13 78 13 188 zero fill Ġpath patch 22 17 22 65 22 87 22 74 22 71 Ġcopy to nd key sp f sp iny sp itzerCalRawData Ġdate max Ġdate obj Ġdate Format table model sv type 96 81 96 72 the med the oretic column width Ġstart x Co lored trans params ĠTest New ĠTest Poisson 02 18 02 79 dim g Ġmo unts Ġdict Alg write To Ġ{} :\ 95 46 95 035 Ġover shooting 94 18 94 44 17 32 17 22 17 90 of bounds ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Ġbase URL Ġcolumn Name cre ening Ġexp Info Ġexp resses Con firmed 24 39 Type d 27 017 Ġdis crimin Ġ7 40 Ġ7 73 image file ]: ' ]: . 86 757 Ġimage box Ġimage cmd SE LF right Cell abs orbed AL A var phi Ġsp adl 18 38 18 007 18 341 36 86 Ġparameter ize ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġqu aternion Ġrun Test Ġrun nable LE U LE CC ')) / Ex x Ex istent Ex ceeded Ex haustive ST Sc spec ifier atter son eff s ME A 97 95 Ġpart Idx ĠJ ur save game ID Map Se lections ĠQ z 84 06 Ġtext edit ĠFor bidden Ġq ma Ġq word Ġq cx IC lamp requen z Ġtarget Shape Ġ[[ ],[]] Ġ9 37 Ġ9 31 Ġgroup List ass ian Ġfreq n Ġfreq max ac d ac ro ac enza update W Ġtemp er non null non standard non blank UT ABLE UT EM Me lt gr imes 65 79 AS GD filter String Ġad js Ġconfig Dlg Ġmulti layer Ġmulti proc mt f tf lip ylabel size 87 17 mpl widget Ġtra ing point biserialr learning Rate OD oc OD DST Ġlow peak qua renormal 55 74 Ġshow Colorbar alg Id Ġpoly col url parse EN ARIO ĠAr kansas SI mage dataset Name hist ler Ġback ing (_ [ ### --------- De u AG USD AC CES ĠDe an ĠDe pt ĠDe mand Ġgraph z Ġgraph type ld p auto class auto Range Ġsplit ters net D Base Filter Base Iterator Base Market mer gency fol iations Str Num stat type ĠSt re ĠSt ump diff ers 98 66 98 95 draw er draw Frame draw greatcircle Ġ} """) IP Option Di Params Di verging gg i Date Range 67 0000 67 94 67 051 alle lic 08 35 present ed mag net mag ically To Remove ev f Ġaf p Ġtrue class real igner real ThetaTS vis a Ġhigh ways Ġmap be tz s json File 60 75 Model Checkpoint Ġtick labeloverflow Estimator Test TR AS TR IPS ene tration Ġsuper pose bf range Ġhist or Ġhist plot 49 66 49 75 Ċĉĉĉ Ċĉĉĉ parameters file field map Plot ted Plot Layout sys list ĠPro f "]) ], 29 07 29 229 čĊč ĊĠĠĠĠĠ layout Widget Res istance fft DomainSize ĠPlot Data Ġden ser book ing 40 66 cls name Ġimg sum Ġimg Id Ġge opdf Ġps Ax 68 38 )]) [ CT ATG sen try Ġblock wise 38 299 Ġ-> ', UR M ")) \ DI MS action Open Ġcell ulose Ġeigen state Ġsecond moon ĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġreal ity Out side Text Area Ġret weet Ġdesc s Ġauto method Ġauto indent Ġauto Delim UL A pad ova Ġerr Bar inst cal nc en bit stream Ġcontains Null ĠMe mbrane SA F ~~~~ ~ Log Axis 48 00 Ġvis iting Linear Ring Category Encoder 294 9 ĠMulti part ĠMulti processing ------------ | distrib cell distrib utable "," \ ĠLog Transform optim ise 69 312 PI B conf val conf ints Ġlegend group Ġmissing ness ]* \ Get Projection ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠ cd rom String Methods clo udera Sh trikman Ġ'# !/ Ch k Ġconver ging ĠLo ser Line as Ġcsv Dict Ġ16 000 Ġpick y project ors ret ire Ġface book 89 856 folder Parent contour Type dec ryption imp ro Max Iter '} " aut ot ĠPre processor Ġnb ody ]]), \ Ġstri pper åı ³ Ġcalculate Statistics Ġless on vars units Ġdiff ed evalu ating cp ix cp unish Ġdoctest ing cha ssis Ġpop order OP TS Graph File US R Ġplace able Ġview items Ġview point lex icons rgb k Ġfinal ization ]+ . )" } Ġsw irl Color Mapper EX PR Ġsym metrize 83 05 Dist illedSGLD Ġ\\ ' ĠDi re ĠDi ameter MS SubClass shift Entry Ġvs d wrap cauchy Ġjob id days inmonth nr g take able ĠSh ifted Ġside band reset Data schema Update next Object DATA STREAM opt state aa S OO ssss scaling Factor Ġwave vector Ġbegin Time sl bl nu it Ġexog eneous Ġcost lier Ġent ren )- . rb n rb gcm Group KFold Group ShuffleSplit }{ * Dis Go By GapMax ĠPy omo Ġra we Tensor flow __, __ FA F Add Page PS HOT PER F cb Patches Ġ"__ " mc res mc py mc dat common prefix tex on Ġcm r Ġclean ly rf min Ġlearn FileRoot ART A 00000000 0000000000 Ġpage data ĠMat ched ĠMat teo Ġorigin ator region List Ġsens ation ĠRes haping Ġcollection åIJį Ġmag moms ĠCON V Ġap iclient Ġsur fer Ġsur rogates Ġta iled Ġrgb Array Sp ice Num Field ĠApp InfoExternal HT unnel Iter Table With Diagonal Ġ'{ }, Feature Split Feature MaxPooling Ġneg atively LI QUID Ġspark ling track validate SP HER Ġcf me +" * sur fer Ġpost age Ġpost code DB S bg l ĠCategorical NB Tra iling ĠMult itask Ġsupp or mount point plan ThetaTS geo ip ĠHe artbeat ĠTh ick ĠTh rift cer a menu View week ends cr bug car p car avel lw c Ġbit w ĠConvert AllProxy Ġradi ally mul ative Ġinner most dm x CG CTT ĠHT TPS Ġdownload er stic py Info Holder ĠNormal ise ĠNormal izes FILE PATHS Ġes ize Ġdev null Read ings fetch er Ġremain ed tw elve tw ilight quad tree PRO VIDED Close Key Ġgeo profile andre w Ġdag ger chine se Ġprofile Name gd l station Noms End Head Ġ"- ". tau h Hand ling Ġcp b 2549 019607843 Mo untain ĠMo untain Axis TypeEnum ried rich Font Descriptor separ ators NO CR Ġ88 00 Ġ88 77 gal actic ={} & Ġss xm Bo lo čĊčĊč ĊĠ Ca ught Ġlr x Current Speed Level Documenter Sum marize Do ppler Ġconv utils Labels To Ġcap ita Ġgp ml Ġgp flow autos pec SQL Context SQL Statment Ġagg ClassEst STR ATION Ġrho e Ġrho y OUT LINE nz v Ġ23 149 hyper geometric New ick Ġcalc Theoretical Ġmar ried lam bertw bed File dele gation ('. '), Ġtw od ä½ ł Ġgs rf arc ian ĠDummy Scorer ĠLA YER LA rad LA ML Ġå ® And re Ġnumer als Ġ28 00 AlmostEqual s lv rfmin ]( ../ Ġbr ill Ġke pio GG LE GG AG '$ %. ĠMean AndStdDevPlot fd trc Ġspan coords ball Stemmer ĠBo ilerplate PRE P Ġski pper Initial ise Ref er bm va Element wise Learning Rate Ġpat he 317 6 Ġ--- ") Ġcli mb Ġgl Enable Ġws data Ġmaster Data Ġmaster matrix bind ers 996 138 Ġ================================================================= ============== WHIT ELIST asy mptot Ġì §Ģ Ġgb q Ġfore ach Ġ95 2 Ġintro ductory selector Dialog Ġmov mk 264 2 Ġ'{} : dv f Dep loy delt ax Diff D Ġglyph show ĠEd ucational fir mat today Close Ġ99 7 Ġperson ne Ġzoom x Ge orgia Make Frames flu ous Ġmk frame 355 339 Ġswitch bitch web pack Ġ33 04 ĠLO WER Segment BasedMetrics war f ĠTO MS ĠAb undance ĠFast a ĠMatrix TK Tr ust AP s âĶ Ķ ĠGeneric ArrayFormatter BO SS Ġminim ally Red o walk ing See ing Ġexponent iation jd h Ġvol unteers Ġ86 64 Ġ86 23 Ġ! ' ĠSimple PipelineEngine each er ################################################################################ ############## Ġfonts cale Generator Type trend order ĠEN TR åĽ ºå®ļ ĠFilter Estimator ĠAc id ĠDense DesignMatrix Ġbb tf Br Cl risk Counter Ġ84 11 ))* (( Ġpretty fy Tick formatstop Ġcum PDM Off s Off ers Ġgam mal RD a kern val ("/ ")) Ġoverrid able FR ONT åĩ ł ĠCustom ize uk jin Ġdash d bas ically Ġ198 2 Alt Dump Alt hough Ġthrow ing Copy From ĠStore InADS ------------------------------------------------ ----------+ MT U ĠGP Kernel exe cs Ġleg is (',') [: Idx ByGapMax ĠCar ma ĠOP F Active Object åį · nse w Ġdemonstr ated Full Name Memory Log Ġ<< ( Ġ================================================= ======== Ġ================================================= =========== Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ spl int PARA VIEW Dummy Scorer Ġpars able dz dy Ġ': ': ĠAdjust ment Ġum ax ĠFigureManager GTKAgg ĠTe h Cy lindrical Ġthumb file dom s ä¸Ń æĸĩ Ġinherit ing Ġri bo ĠEnd date rece iving ĠAL MA +') ', +') ') Ns Vth destination EncryptionConfiguration ĠExtension Block Generic Mixin Ġcloud pickle 个 æķ° Gene Pred Zoom er Stack ing Stack Info Ma o sand i ĠSch önberger lips oids GU IDE Pri mer ĠBox Style )# . Fill ing 220 9 ĠTech nologies Greater Than reason able ĠClo udy ĠBio informatics Ġsound ings RT N Ġreplic ation seasonal ize Omega Wing éĢ »è¾ Ny quist weak ref ĠBar rett ĠHelper SolidSolution Ġ\' ^ exist ence 096 26 Sur rogate spa de ĠCase less Math Jax WID GET Te V åľ Ł Ġmono pole Ġmono chrome nod al ĠExp lode mono layer Mac OS Cla im Ġhatch gap Subplot Base La unched Ġtrig rid Band pass ĠSubplot Divider thr sh Ġkl upu Ġutc now ĠFixed Formatter Device RGB ĠTR AD Ġprep ending ĠMD NPlotter ĠView Manager aff inities ĠDec imation tur key Ġlaunch ing Ġbracket ing JOB S ĠCollection Tables strat igraphy FD s Ġ78 3 Devi ations Ġ($ - Ġ($ / Ġima gery Ġdos E ĠRA DEX Ġow ing ĠScal ars Contact s interact s Pressure dim Configuration File á rios abstract s 278 36 dq y Ġprece edence Ġkill map ĠBad Request ĠINTER POLATION HIGH LIGHT chn itt die sel ĠDatabase PB Pdf Pages POP ULATION ('\\ ') Regular izaton ĠWord Net ĠRegist ers FeedFn Hook maint ained refer rer éĩij åıī ĠLib Linear ,..., :]`` Ġaw esome ĠSA mple Ġgm ms five thirtyeight cir q disc ip ĠFITS Figure Ġtran ss Plan Entry éĻ į antid ad Hive Operator Ġtid al Ġfeatur ization ĠRetrie ving soma v OOOOOOOO OO æ¯Ķ è¾ĥ ĠLag rangian Tur kish LSH et Release Event ('| ', Ġextr aterrestrial Ġcen col ĠOffset Image æĸ¹ åIJij compar ators Inner Error Ġformer ly ĠMove ment ĠArtist Inspector Ġpheno mena Hi ptmair ĠEng Formatter ĠSelection Mixin čĊĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ ĠReduce LROnPlateau ĠSepar ating ranked Photos WP PI Protein Count ĠGR IB Ġtriang ulated ĠDebug InfoHolder MLP Regressor sps olve Ġ../ ../ constrain s Working Directory Ġsam file Ġsam tools 000000000000 043 Ġdowns caling åĨħ çļĦ chid ata ='| ') minpos x minpos y Dele ted AUT OT Ġball s ĠGeometry Array Ġhypot hetical Ġhypot enuse ĠAIC c dataDir Base ĠMal aysia åĽŀæµĭ å¼ķæĵİ åĽŀæµĭ 模å¼ı glu on assoc s éĢļ èģĶ RAT ES čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Gra do Ġba setime homo logy Ġpmag py ĠRadi obutton Conditional FreqDist OVER VIEW Multinomial HMM Mer ges ĠDL As ĠADD RESS Ġchainer cv #---------------- ------ CSA mp Toggle Button è· ³ ĠBer lin EQU ITIES Tech nology epi log CONST ANTS CONST RAINT DH ST ĠGE EResults inj uries Ġdefic it ĠCCD s Trading Control Fourier NoiseDomain }| { å¿ Ĺ Ġresearch er former ly ĠExact ly Members hips Ġmcc Search Ġcorrel ates ],[],[ ] 缸 ä¼¼ wil ks Ġdiam onds ãĥ¼ ãĥ CW D fab io Ġsplitted Data Ġticklabel position prox ies Ġcalibr ations GIS S Specific ity Share Slippage Ġwvl Range Ger man Cubic Spline Cubic TriInterpolator ENTR IESn ä¿Ŀ è¯ģ Circ ular 3502 69 recogn izer Ġcensored Points Curl b diss ociation ĠLongitude Formatter ç»Łè®¡ æķ°æį® WWTP Coordinates ------------------------ ') srf list OA uth ĠToo ltip ĠTensorProduct s aqu s ĠDesc Stat Include s ĠExclude s Bokeh Chart QTable View Vocabulary Processor zue ge Additive Model Momentum Optimizer Visualization Methods Already Exists åıª èĥ½ Ġtetra hedron ([^ >]+ illust rates illust ration 1717 17 =": ", ATUR DAY GetX axis Cop ied Ioneq All Parquet File ĠAnchored Size ="-> ")) XGB Regressor Ġxrt p ĠBot tleneck Isotonic Regression åħ³èģĶ æķ°æį®åħ¥åºĵ Asc ending ĠDEL TA Ġsett led ĠEcon ometrics ĠBuilt inHandler ĠKaggle Word Ġcntr b ĠmY st Accum ulation ĠSSE s XZ CurrentSpeed ĠSubstitution s Optimize Result psr name Ġskel lam APPRO ACH ĠíĻ ķ rights ide Timeout Error ĠSpherical Voronoi zion e Review Time Retrie ves Ġdisreg ard Ġmatr iz Ġå¤ ļ Ġparal lax å¹³ä»ĵ 交æĺĵ ĠOME GA Ġinterfe re setRow Stretch ĠDistutils OptionError alam us Represent ing Ġgeot iff LogFormatter Mathtext Ġnnds vda Ġkstat var Genomic Interval Ġcrow dsourcing Walk Source Ġrom berg cta Engine Ġscient ist USERDEFINED DATASTREAM Episode s unte er Ġneur ite ĠRas chka propo gate sineModel Anal assertLazyAnd AllClose Orth o wake up Ġprovision al ItemIs Editable åĨĻ åħ¥ ABCDEFGHIJKLMNOPQRST UVWXYZ Ġfontfile Object ĠHEL P ','/ '). NEG ATIVE horizontalHeader Item Econ omy Ġexhib its Ġscre ens ä¼ł åħ¥ ĠWy nn GeoSpatial UnOp æŃ¥ éķ¿ Ġpent agon minspan x å¹³åĿĩ åĢ¼ fabric rc ACCUR ATE å½¢ æĪIJ ĠFiber ID NWorld Fine parametr ization Ġecell Manager pyn ufft Ġbacks lashes AUD IO GetCell Value 对åºĶ çļĦ Ġbetainc inv amili ar anitized Observable Ġnndsvd ar ĠFo ods Ġlef tover Ġoffic ers ĠAIR FLOW TIMIZ ATION ĠMyDummy Type ĠlamSq HirArr Ġsour cing Ġ[[],[],[ ]] aband on ĠLinearOnly Regressor ĠBeck man Batter y ROU GH dfreq resp NumOf UnitsPer oph ile ĠTB LS Coup ling ĠIntial ize Quadr ature lastPeriod Closes Ġcharproc Dict ĠèĤ ¡ multith read registerJava Function ĠGel man Ġperio di PARS ERS Ġseiz ures ORandom ForestEstimator SIST ENT ABUND ANCES TRNA Seq springer link Bootstra pper tik z Ġkine matic Expl oration Navig ate Ġvast ly è¿ĩæ »¤ nbound lines spons or Ġphon ons MOLEC ULE chre iter ĠAssetDB Writer ì¶ ľ Ġ'---- ' èµ·æŃ¢ æŶéĹ´ Ġaro unt #================================================================================================================================ =========== åĩĨå¤ĩ éĩij ĠRosenb rock ilic hes ĠGiro lami Actin obacteria LowFDR reads irno vi pessim istic éģį åİĨ Ġ空 æł¼ hume ur occedge list ĠstationLimits Renamed Ġwof z ĠHels inki ĠUnt ested EstimatorWith Fit è¾ħåĬ© åĵģç§į bckndsub tract uncompleted Orders idlet imer ('======================= ') getNYSE days Ġdemar cate undocument ed STSc I quarenormal g schemaUpdate Options WithDiagonal Covars FeatureMaxPooling Layer éĢ»è¾ ij ([^>]+ )> USERDEFINEDDATASTREAM FUNCTION " [{ # ") & \ ( } ( #% , ": , ]: . )). . (...). / ")) 1 647 1 667 2 254 2 258 3 138 4 641 5 040 6 047 7 255 : }: : ?: > ',' > {} @ ' A ust A spect B oo B oom B MRM C Q C ri C hev D to D surface D MCMC D igit D CLICK D JANGO E ma E CTION E asy F y F ol F ord F RAN F uzzy G olden H k H ur H art H mag H yp H alko H GNC I ons I ALS J ack J mag J VM K mag K ruskal L c L ouisiana L aura M l M ice N rc N avigation O GradientBoosting P of P rices P VALS R ack R AG R LOC R rlvl S v S av S of S sid T aking T uesday V IP V ATE V iskos W arn W hy W RAPPER X mean Y E Y w Y TER Y EAST Z f Z enith Z ombie ] !=' _ ]: _ )). a K a am a qt a qs a cao b ce b val b ass b rot b engfort c R c ion c db c ron c arimages d res d pt d ou d qs d ffit d ummys d uplex d ör d WeightedValues e les e den e trm f mask f cast f chol f pedregosa g py g na g db g mpy g Parameters g Peaks h type h pi h udf h bw h stars i ue i om i ax i ri i ref i ids i atom i Valid j ones j tsrdd k ur k mag k ratio k ii k orea k utl k appas l low l umber l svr m he m lt m bo m Time m vi n ant n map n Index n cond n mod n bu n models n layers n ws n Left n hofer n loglikeobs o ys o main o asis p N p ab p rue p fp p bdv q g q err q lu q flags r pa r dtype r lat r prs s row s ill s fa s bc t cs t float t Max t Total t lv t fitting t tempB t took u ates u Active v tr v func v orn v Func v tu v adm w itch w mape w elcome x ps x sum x com x ac x DF x fmt x high x script x pixel x BF x readlines y new y Min y mid y pixel y density y prime y metr z hat z ptr z Rec } '\ « éľ² à Ģ Ñ İ ç ı é ª¨ Ġ serv Ġ čĊĠ Ġ atexog Ġ ãģĬãģĬãģĬãģĬãģĬãģĬãģĬ ľ çĽĺ ĠĠĠĠ čĊĠĠĠĠčĊĠĠĠ se vents se quana at mp at im re quiv or che on de on Middle on MouseWheel Ġt lim Ġt frame Ġt bin Ġt tt Ġt ram Ġt stat Ġt msg Ġt ele Ġt dx Ġt ret Ġt dr Ġt events Ġt itl er on er ab st as ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠ al on ar v an ze le o de struct de convolution de cays me eting Ġi se Ġi com Ġi hi Ġi CDF Ġi rises Ġi Cmp he vi Ġn lu Ġn lev Ġn below Ġn lhs Ġn triangles Ġn Bits Ġn reps Ġn MultiplePass Ġc it Ġc ct Ġc up Ġc index Ġc width Ġc arr Ġc day Ġc mpt Ġc ijs Ġf fi Ġf lot Ġf mean Ġf code Ġf ram Ġf ert Ġf lr Ġf filled Ġf Price Ġf Ind Ġf fillable Ġf ruits Ġf TotalPercent Ġa setup Ġa argmax Ġa argmin Ġp S Ġp ype Ġp iv Ġp dir Ġp sol it ated Ġs ie Ġs mesh Ġs untans Ġs weeper ## ~ ra k ra sedml en ics en large ct ite ro bo ro ok ro duct ro sterPred lo ans lo max Ġin fix Ġin jections Ġo xi Ġd al Ġd ke Ġd vec Ġd rot Ġd ern Ġd aterange la ct la min la mination la ptop la mina Ġ' ...', pe at Ġm he Ġm ts Ġm art Ġm ols Ġm bins Ġm vd Ġm ito Ġm Phi Ġm jds Ġe dict co e co le co oper Ġre jections Ġre Tokenizer Ġre cycled Ġb str Ġb lon Ġb nb Ġb solid Ġb Pull ed By ed aldi ic ent Ġw ds Ġw xy Ġw kt ur ments ig al Ġ1 250 Ġ1 170 ss ource ', . un ck is is is interactive is magic is disjoint is Spam el er el ps el sim def ensive li ding )) ' )) ][- ce re est imations Ġif ault Ġ[ ]. as ort as heetname 00 79 id ae Ġis u Ġis pl Ġis mag Ġis first Ġis cf Ġis Project Ġis Anchored Ġnp re ], )]], ), )], one res ĠT TF ĠT RANS tr X tr gt ha ge Ġy ab Ġy diff Ġy elps res hed ch ise ch space ch dr ad b fi rest fi rms set b set Orientation Ġ: ]: Ġr ind Ġr loc Ġr seed ver lauf ype re lab e il ons ') "). ]) #, ]) #- om i Ġ* ') ime try (' ' (' >>> (' !') (' __'): int vw Ġ""" @ Ġg me Ġg pp Ġg sc Ġg rt Ġg nb Ġg cp Ġg Sto Ġg rants Ġg colidx Ġg runfeld Ġg ouraud __ ``, __ âĢĻ ex clus ex oneres data T data X data copied ĊĊ ĊĠĠĠĠĊĠĠĠ par num par áms up ward get ters get Object get Filter get WindSpeed ab sence ax order ĠS low ĠS ca ĠS amp ĠS TRAIN ĠS CHEMA ĠS ersic Ġco mass ri r Ġdata gen Ġdata objects Ġdata Extraction Ġbe ware ", )] ", :] ", '; all Bayes all mags Ġx li Ġx mode Ġx eval Ġx objects Ġx Width Ġx astropy ĠX em ĠX EB arg list Ġnot ches Ġnot ified from View from Theme type e col b col psd Ġor cl ist ring Ġh len Ġh ug Ġh uc Ġh su py dir py claw len f len der len ess ĠI gnores am aria plot list ĠP list ĠP IC ĠP AC ĠP real ĠP Vals ĠP uerto ĠA K ĠA DR ĠA SAP ĠA ASP ĠA frica ĠA SPP Ġu bound '] ', '] ==" ĠC v ĠC OB ĠC MB ĠC ristian ĠC ATAL ĠC ARETRIGHT ĠC labelText os geo im li im ask Ġtest name Ġtest Array Ġtest Zero Ġtest Pad Ġtest Unweighted Ġtest GlobalStep Ġde serialization (" ### (" ^\ (" +") arn ei ĠF G ĠF ar ĠF an ĠF ib ĠF use ĠF ac ĠR Q ĠR ub ĠR OUT ([ "", Ġval format Ġval curve Ġax b Ġax d Ġax list np ol np ca Ġfi delity if os ub dtype Ġ3 1344 test stat test bytes test Train ust s ĠD Z ĠD ri ĠD ont ĠD ia 01 80 01 34 01 87 01 29 01 93 .. .""" .. ...' Ġcol psd Ġcol ormode time lapse Ġse al Ġv macro Ġv zs file Index ers ands ff n ta h ta y out ConvC ext ant min T min pe min pars min Event min imized Ġk point Ġk pts Ġk olmogorov Ġk psh Ġal gor Ġal va ĠN g ĠN nan ĠN orig ĠN GDP per man per sec per cussive ds z bo p str als ĠL ns ĠL OR ĠL AN ĠL img ĠL ob ĠL OL ĠL ua ĠL ingu ĠL ipschitz Ġon p max speed fit Prod fit Degr True type [: ]- dict view te q ĠM ED ĠM ercator ps ites Ġmat norm Ġan ode ys ources po es Ġl le Ġl uminosities fig dir ir ange Ġfrom str 10 58 10 208 iv i Ġlen f learn s Ġnum array ĠG ui ĠG ijbels Ġout Density Ġout Temperature row psd lib x Ċĉ ĠĠĠĠĠĠĠĠĠ oc ations oc cu pl l Ġwe ft ĠRe try ĠRe covery ĠRe venue comp libs comp Photo sc data sc ran Ġpre pr Ġpre Process Ġpre pares Ġtr Y Ġtr t mb h Ġfile lines ĠE E ĠE ight ĠE cc ĠE nc ĠE fron ĠE nergies Ġdf m Ġdf lt Ġ4 36 Ġ4 500 train File ms nake ms coco low FDR ĠB its ĠB ous ĠB road ĠB oot ĠB enet ĠB lit sh arpen Ġun o Ġun red Ġ5 33 Ġ5 97 Ġ5 42 ip dfm ask i ask ia op ter Ġdi hedral log N log gers axis Size In Degrees In Bench zer op Ġlist ify rid ges ef all ef uncs 99 86 99 908 Ġcomp root 64 1247 ĠW atch Ġmax lon Ġmax Categories num items num Sim num Images Ġfe ioutput ide c add Input add ToPlot 12 27 12 67 Ġget Distance ĠO regon men optera result name Ġbo at Ġbo ats ()) ,), ca j Ġdefault DataSource sub id sub mode sub region sub parsers Ġplot np Ġplot Window Ġplot Filename ix xx ix xxx map fig Ġall nodes Ġall subplots dir cos Re tain Re served Re constructed Data Col Data DimensionalityWarning ft Panel 25 79 25 93 25 192108 Ġfloat value inter ned ll ite 11 86 11 67 11 56 11 003 read AudioFile que ze 32 88 32 96 32 07 32 76 Ġinput name cc urve Ġz data Ġz col Ġz eppelin color bars text Max text sep Ġ10 38 act num act uators ][ _ ĠY j ĠY iB Ġlabels y Ġnew m Ġnew mode Ġnew stable Ġnew beam Ġnew unstable Ġnew Topology Ġj ed Ġj pl Ġj gp its kii ĠH A ĠH U ĠH Box ĠH Packer ĠH oyer 15 38 print NPArray 05 24 Ġlog gs lect ual tra celn (), \ ang en Ġinter fer Ġpy py Ġpy mbar Ġ[' *- not test :` % ĠU DP Ġ(' ------------------------') pos Array pos ini 33 96 33 44 Ġsub key Ġsub div Ġsub packing vari bale no input 100 27 Ġ6 00000 new val pred Data IN SPECT Ġtype hints ĠData Reader ]] [:, ]] ]: uni vers 66 36 66 59 Ġrow psd tain ment 45 63 45 759 ĠK as ĠK RAS ok ens 88 66 88 60 88 6275 88 407872 Ġ| ', "] })) ']) }, av atar Ġcor resp Ġro uter show String show Predictions dist Coeffs nan kurt bar rels 35 15 35 184 35 454207 Ġcur Text Ġcur bufs 14 74 -------------------------------- ---- -------------------------------- ------------ Ġalpha c 19 06 19 43 19 08 19 53 Ġkey code ipy kernel group list group Analyzer Ġgener ality tick ness )] ``. columns pan Ġprob abi com Frame Index Map ON ES axes List Ġ8 901 Ġ8 212 Ġ8 904 Ġarg rel St uff St unned Ġmake Plot '. / Ġbin DF Ġbin RF ized Result mask type ĠV edaldi Ġstring value rand hie by second be ars be aker be ige Ġpath names 22 30 22 90 22 48 sp intercept sp weights Ġother Core table View 04 94 04 27 04 26 04 62 04 71 ([[ ([ ([[ [[ Ġerror Muestras 03 41 the on the out lat ors Ġstart t Ġstart RollIndex Ġstart PitchIndex Co G Co urses trans act trans its ĠTest Arg ĠTest VAR ĠTest OLS 02 19 02 96 02 63 02 83 02 93 Ġmo bj ou il ou les Ġdict names Ġend arrow Ġend region dot plot dot sum Ġ{} )[ 95 3953 94 90 94 42 Ġ100 03 ',' _', keys ToPlot ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ 85 08 85 098039215686 OR IENT na Data Ġfeature list Ġfeature Format Ġexp id ]]) ]) 24 80 24 69 24 2940 Type ID csv y 27 94 27 36 27 46 Ġdis position freq Result freq DevSlope freq DevOffset uc sc main Graph main Board ref call Ġimage Back SE nable gen model gen Graph Test SQLite Test SQLApi AL D ĠSee ing back references Ġsp ice Ġsp diags Ġdistrib utable 18 16 18 42 18 41 err fn call args 36 78 09 73 09 052 09 1814 norm Vp exp Params Ġparameter izations ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ mod ality mod sem mod cem man ouil dis contiguous dis cussion Ex cept Ex cluded Ex tre Ex cluding Ex ogenous ST IR ST ATIONS rc usum Ġnd tr Ġnd tri Ġsol x Ġlin er 34 05 Ġ... `` 97 33 Ġnon edges Ġact uall ĠJ itter 92 93 92 648734 save Name Ġele ctions Time Varying Col Label Col lege cv ml cv ls Se iz dt l bu chi sk rf ĠQ ub ĠQ mn Ġscale z Ġq Arr Ġtarget FeatureSplit my table my object my power Ġ[[ _ Ġ[[ [] Ġ9 45 Ġ9 18 Ġmask gen tx vals ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ass ilv ac n tol atex Ġim view face on rel lised Ġmod index Ġav RadiusCost math sis gr ate gr transition 65 55 Ġac sc File names File IO File NotFound Ġcv Scalings AS L AS PIRE sol aris late grey cm Entry cm intvw Ġdatetime index Ġtable Id Ġmulti comp Ġmulti quadric Ġmulti collinear Ġbool value mt py ls uffix mpl Widget RE USE CA FFE Ġwidth Display OD DS State Button State Vars Ġleft Edge item P (* [( ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ fer m 55 609 select Tab Ġpoly base EN A pop py Ġback space can on De fect De convolved AC In AC ET ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠDe leg ĠDe veloper ey n ling er "), " over writes stats d Ġstats file net G Base Signal Base CCY Base InMemorySource Ġsm ith mer ges mult idim Str Col Ġnorm f Ġsim file Ġsim ona Ġar oon Ġar rorder stat info ĠSt orm ĠSt ineman 98 92 Ġdraw edges offset trans Ġtotal Right font path font Name font angles vs weep ################################################################ ### bl arg Ġ} ], Ġcontin ous AB s source path source Element layer selector Ġter rible \\ ]" Ġdec imator Di jkstra day i List Vs Ġdt val Date Edit seq T 67 66 Ġfind iter DE LL 08 25 mag netization Ġtitle d sql string sql Type To Write ,) ' ,) } Ġab brev extra pol drop hobic ĠWhe never sin r open quake Ġuser id Ġuser df Un fold 47 299 total Range real cons Ġimp uters tz aware Array Block bool bit Model Error OT P Ġtop Lines Ġtick dir Set Process Set Brush Set Front tmp shape rad ford Ġfont style depth name Ġ'. ')), distance Measure 49 39998 28 14 stop OrderID Ġequal ities CH IMP find offset Ġedge p En ables En cap ĠPlot View dev id Ġcolors is 40 45 ry an Ġ(( {' Ġge mini Ġstat lib Ġps frompk 68 00 68 34 Ġheight Display Ġmon otone Ġ[( {}, ED T Ġcho ise Ġchange x Ġchange y 38 05 38 33 38 96 Per Inch Per Epo Ġactual Image _{ + IO RealTime Ġext remum vector CC head way 46 20 Fe ather td own convert Point task Spec task Buffer UN IDENTIFIED ĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġvar joint Out In sm k Ġclose Time Text IOWrapper dat i Ġquery string Ġauto max IL ATION regression plots Po cket Ġ'_ '+ pad rao Ġerr D LO B nc filename ĠMe mbers Box Plot remove Item Ġop f Ġop itonal 48 66 48 16 48 78 Ġvis c filt names Ċĉĉĉĉ ĠĠĠ This Plot Pre defined Ġref uses Ġrec Tot ĠAN S 294 6 ĠGet Linspace 57 18 Ġbeta k Ġdim f ĠLog s ĠLog Likelihood Not ice this c '\ $' **************** *********** dx i Get Name Get Seconds Get NBins PE X ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ Ġxy o md gel Ġchunk sizes obs d clo udf Sh yue Scal a Scal able Ġnan argmax :, :]. Ch arges rest le ĠRandom Mode Ġ'- '+ No Trans No Such Size X Ġmeans hape Ġ'\ #' Line Dict Line Chart Line Args Run Args Ġmpl Bundle tensor product skip Leading cut ted Ġcsv s ĠBase EngineSpec ='', ) Ġds name bad name bad covariance Ġassign able ret code Ġskip R Ġface ted sig res 89 09 src pos folder Src Ġiss ubdtype All Data Ġ}, '; contour Proj ĠLe wis Or Array Vector izing ĠPre ferences ĠPre servation Ġpr b Ġ'' }) ĠIN V ĠIN PATH ĠIN PSN Fit Setup Ġcommand string Ġreport ers Ġcalculate MeanStd Ġgen pareto lux db Mat thews Function Warning peak Detection "][ ...] 51 887 ĠMin nesota OP ipeline Ġ14 60 Graph RewriteSpec Can ada rgb thing fast d fast est ĠKey board clip Result location InWindow Ġsw ift ]- . Net Error EX TRACT Dist orting Ġstack Depth Ġtag id GD T Cur rents Ġaut omin ĠMake Model Ġexact process two step hold count Ġjob Spec UP YTER Ġ25 928 Ġ25 923 We bsite next Id Up grade second Dict }'. \ Ġ'-- '}, CP SEnable Qu oting Qu asi Qu aternion Ġsetting List Ġna ics Vari ational Bin Params Ġdx intv Ġbegin arrow final wgt Key List CC FLAGS Ġred file .* : .* "): Group Window Ġeval ution Com ic Dis criminative ĠPy Ephem Ġra x tot im ĠPath way Ġshort ly COL Z Ġfun ded 53 125 Add r Add Value DA M DA EM 2001 0109 original Position fp u mis leading Random ize Random Number Random Variable Ġmp irun aw agi ĠIPython Directive tex coord rat t rep mat ," (", merge Graph rf ss Ġlearn Time Batch Two pg fpath Ġconcat entate '])) ] Ġnt rees eg bert 999 000 logger r ĠModel Specification Ġpeak utils ĠInter rupt Ġinvalid ating 71 66 Ġ500 250 tab name )} ' Output Transform dy ld cap line Ġvisual izers With Lines With Small With Bundle With Specified ĠNo NewAttributesMixin mk df mk Dem Of Interest gp bo Feature Extraction Ġneg ated LI SA Ġ19 66 locs Measure VER TEX Session TimeZone ĠAR C Ġspark Conf Ġshare values ']), ' sur ro Ġpost amble bg plvms Variable Error }$ )") Ġsqrt m Period Array ĊĊĊĊ ĊĊĠĠĠ Create Parameter Ġdy intv ĠFile Selection mun icip Ġlb m Ġfree par Poly Data 91 0199 Ġ64 5 reen ame dm Price ---+ ----+ olt s ĠNormal Probability Mon line Mon itoring Ġms ds ĠDist rict after wards ĠKernel Reg bi os Ġtp List Length Test Length File mix ins Ġ"/ { Ad v Ad mit bucket By catch ment Ġgene Name RES SED ĠAd vance Item E ĠLine Highlight embed der "> & MF CC Ġ---------------------------------------------------------------- --------------------- Ġconsider able PR ICES qt index lec un ĠSub field construct ibility ĠPeriodIndex Resampler good values Ġpol icies )))) )); ----- \ nts l exact process Ġreset Dto ]} ') zy k Ġls RetStocks gap Maxs Ġph osphorylated Parameter TableField ĠEst ablish ĠMo zilla ond dif ĠSto ps ĠGraph Form Font Key Ġconvergence Point Ġ88 27 Ġny bb ={} ' Ġmass flow Ġmass bins mot iv bd river bot m thresh min thresh max Ġ>> >>>> noul is Ġti ers Sum mit Sum mar minimum descent Cl NO Ġturn table 098 333 Ġbig pic ĠEX TRACT Ġcap line ĠSequence Subclass ĠFree man OB ACTER pix dim Ġmar athon ĠVector Layer ĠCom ma ĠCom mit works hops SL ANT rea uth Ġstand point mn cond Total Time hess ians Ġtot pers bed rooms Ġcirc mean TA F ĠPoly Collections Ġkeras Def vertical Header ]`` .") ('. *( Ġbootstrap ing Ġer xy ĠDict Like cam ber Ġå İ Ġelect rum 275 6 ĠCO MPLE Ġquad mesh SO UNDING scene sevents 318 1818 Ġke ts MO COUPLE Ġsec ShortName UI Exception '$ (\ ĠCor relate Over flow <= \ Ġrest oration une us 219 8 Query Parameter nans kew Stream CoderImpl 401 1 ARG V branch name Parameters Constants TIME AVG ĠProb Dist Mock Two 112 19234 ĠSome what ĠCre dibleInterval Ġselector Type Ġexternal JsonTable variant gq Ġpress urant pb vv bio logy ĠText Path ĠText FileReader ĠGeo Point ĠML Context even ly Unit Dbl XY CL ĠInc lination Weight ing Ġgb mv Pol l Ġcollect l pas sthru Ġbeam logprob Ġrelated ness ################################################ ########## Ġ95 8 demo cratic Auto BaseClass Ġbody X Ġbody Y Lab our Training Set commit table send Request Ġtax NameList 264 9 jj tz URE D ĠWork load capacity req Union Length Ġrea ctor Ġgeneric settings ĠFormat Specification Fixed Src 185 0 375 703 237 0 237 159 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ plas mid Bl k Ġ------------------------------------------------ -------------- ĠPRO P Ġ'" { Custom er Ġhard ly Ġlt mp Exp Time spike train ĠMy Array Ġtb ls rp ms ĠScore rs stacked Area Dictionary Input Ġmet ad Ġmet grid Ġmet adf 337 440 FLO OR ĠRO UND Jo e 349 35 Ġmn AB ival ent Iteration Clustering Ġok th ĠMatrix Base ĠMatrix Operations Interval Dtype 2006 01 Ġ'( -- ĠFI F âĶ ¤ ĠTimedeltaIndex Resampler Ġsho ud QT imer Ġautog en cen ames 154 089 ĠPe ek ĠPe ptide entity Jmx 211 3 Ġpers ists Ġ86 16 å¹´ åıĬ Ġ94 7 Head CountFile Ġcentral Widget Ġentity Metrics Ġentity Dashboard è§ Ħ Target Model aug TM 992 3372036854775807 004 15 Wh iten ĊĊĠĠĠĠ ĊĊĠĠĠ Ġfonts izes dropout s GEN OME ĠDisplay Hook Ġ"{} _{}_ Mark down synt hesized ple as ple mental Ġbra s Ġbra ces isot ool Ġnm stoich uv in GA Z ĠBlock Matrix Ġ'* ')) LST Monline Bound PolyPoints Cross Validation Ġsn v Ġsn id 195 756 mor dial mos phere gu ider 312 73 specified PowerCurve ĠProject s CUR REN Ġgal sim occ asin Ġamp ersands 138 66 Build Packet mys del exon id Trace Hierarchy ĠGe genbauer 225 1 ĠDO Y MT K Simple App Ġmoose utils ctrl Widget Ġpublic ly radio Legend ĠDep Context 038 159 Missing Exception 494 1 924 7 Ġche mpots SIGN ATURE ('$ {\\ 204 77 Univariate FeatureSelector INTER P Multiple AEs Ġdemo graphics 102 36 ĠCross Filter ĠEquivalent ly Ġbas al Ġmarket place Parse LengthFile Ġpsd Compt SUB ARU nse ctor Request Context ä¸Ģ èĪ Analy ses ĠExcel UIException POS SIBLE POS CountFile strides attr OM ER 313 01027 ied er divergence Result ĠMeta feature ĠFigureManager CocoaAgg DL s bla me mac ports BAL ANCE Ġgit config Ġgit modules ("# \ Ġpm ml Ġpm stoich pur ge TOP IC 295 6664 Mass Window 167 69 Dim itri Ġsal ome Ġ``. `` Ġbook tabs Ġbucket ed dup labels tabular x +') ' ĠVisual ising ĠåĮħåIJ« æ³ķ 037 04 ĠUnion TI Ġdu Arr @@ @ WIN DIR repl EagerEval Ġsz h Prediction Var Post script ĠEvent Detection SW AP Pop ulate destroy ed Ġvir uses Ġfav ors Ġcr imes Ġdv ipdfm Ġsuppress ing contact ed Partition Sensor gi ant intr onic ĠMa de ĠBio python Ġconc ierge RT LD Av oid Ġ################################ ####### 214 45 bal ances bel humeur Ġfv com ĠBar rier ĠTransformed TargetRegressor 096 008 Ġspine Compt Discrete Choice 055 68 136 849 ACGT T ACGT AC ĠRaw Data Pixel Set Parallel ism Ġprom otions Trade Data 985 655 303 12976 Ġdetector Name Surface Series upd Control Debug ger Ġpct Right ĠSM ART ĠSM ILES sea Ids Ġfive prime La B Ġtrig rams LAT ENCY 288 1408 Ġaug ur Ġaug ustus 169 20 Ġbuff ersize ĠRenderer Pdf mirror s Ġ'.. ') ĠSession RunArgs bounding Rect ama ury ĠIss ued mamm al Ġattach ments Ġideal ised wm ts ĠSeq Feature *\ ;\ ili ar IE C /* / blen ding ĠSer vices ,)] ], Ext Type ttf list Asset Finder åĵ į ĠControl Flow DataFeeder Test CONT IN lead sp lead ingspace ä¼ Ĺ Ġê ± Basic Indexer mah oney composite TestFramesPerBufferValues Ġdos G edi file (... ), 201301 05 --------+ ------+ DAT ASOURCE sense map ĠLast DagRun Ġtransf ers quot a 50196 1 ĠBi ol Ġsurv ived Sat urday Ġanomaly Score Content Handler ĠMPL Bootstrap uniq ID mvn un Ġisot opes 278 34935 ĠLight Source CHECK BOX Ġ=' ', Ġapparent Resistivity Ġredraw ing Parent Pid ĠGood Friday tid al ĠSpace groupAnalyzer åī ² ĠBound aries ĠBound ControlBox 66666666 6666 RMS F Execution Listener ('\\ ','/'). Ġhar vest ĠOmega Grid Ġscroll bar Ġcombo store sound ings analog signals æĭ ¿ Land marks chisquare Result ema cs ĠQuant Figure oni ot elim it ĠPolar Plot æĬ «éľ² Ġconduct ances Ġsco tts CPU s warp Affine Ġ"@ ". ĉĉĉĉĉĉĉĉ ĉ --------------+ -------------------------------------------------------------------------------- Ġsch arr ĠtestPandas Feeding Evaluation Set Ġalter ation Hive Context ĠRec ListStore ĠBO UND ĠBO OTSTRAPPER Ġ#================================================================ =========# ___ | gw detchar åģ ĩ Ġ82 30 COD IGO kW per ĠEnt rez ĠHard in FIN ANCE fw y Ġranked Photos LSH F Ġhm log ĠWard Agglomeration ASC ENDING Release d Super Cell osc ars prefer SpeedOverMemory ---+---+ ---+---+---+ SPAR ENT Vm Settings Ġcompens ating Render NormalCdf 大 åĪ© Ġcel ery 836 124 ĠEng land Ġåı¯ 以 ĠXtest g ĠCorrelation Permute ĠRunning DagRun Ġrub berband ĠAnt oine Ġhf ds ëĬ ¥ ĠUnits Container heta Y Ġcomputer Port buffers ToRecord ]| [ ĠCould n çķ Į Ġseper ation transitions out Checker board 第 ä¸Ģ个 dbs np Ġhypers phere Ġ+-------+ ---+-----+ Ġ+-------+ ---+----+ Ġstn da ĠOSX FontDirectories ĠOSX InstalledFonts ĠMetadata FileError MATPLOTLIB RC æĢ» é¢Ŀ Ġoscill ate Definition File ĠTheta Formatter Absolute Numbers }* | Ġhypot hesised ĠStation ary JJ More SAL A SAL C SAL ARY Ġ+------+ ---------+ Ann amaria '(? : Ġkurt osistest ĠVERSION S Ġblur red Tax on Fi ctional 0317 206 TRAN SPARENT Ġ'? '), NuPIC Output ĠCanvas ToolBase ĠProduct s nump arse è· Į Ġtg rt Assert History [:][' _ Ġbiggest ix æĸ°éĹ» éĩı Longitude Formatter flo od createOrReplace GlobalTempView xref index stor able ĠTiff Tag BZ Q ĠInner Tol è¡Įä¸ļ è¿Ľåĩºåı£æķ°æį® è¡Įä¸ļ ä»·æł¼ç±»æķ°æį® 775 55 416 35887 enn ie Ġconsolid ation Sales force Accel TS Pipe lining 2504 16700 ĠSTAT S 2100 12 ĠEm manouil ĠDiag nosis Bra Base ĠDevi ations RawData List Ġ259 04 Ġ259 24 Ġ259 07 ĠSIG MA Ġtestcase DashboardsDir TASK S ĠRestricted Algo Ġecon omic categor ized èĩ ´ Ġscra py ksParamGraphWiz Max Ġbul ge mind f bean plot 705 80611 Ġttf dict yan dex Transformed Series âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢ ĠHo chreiter radiation field Ġtransl iteration ĠRen dezvous Pie ce gop ca Atomic Type Ġheli x ĠâĢĺ __âĢĻ oooo oooo Ãĩ Ãĥ ĠPDP s ĠBroken BarHCollection had kw Ġsta ircase doub les MATCH ING 5813 98 5813 965 jack knife ¸ë į ĠMETH ODS Ġtheore tic rex pected ĠBode nhofer Ġcheby t Ġfliers ize ĠTy ler Ġmort ality Ġdefinit eness 1231 33 cass andra ĠWE IGHT ä¸Ĭå¸Ĥ æĹ¥æľŁ Ġtetra hedral ĠScaled Translation ("{: > Ġafm FontProperty Sand box deli vered Ġnod ule Ġimagen et æŃ£ 常 Exchange Rate GetBin Count GetBin Start GetBin End Ġheteroscedastic ity 519 55609 UCI Dataset recursion limit =$ % APP END correl s ĠAnalog Data ìŀ Ħ DES IGN digital music 0022 44 abl ity ĠArma Process ĠRESUL T ĠPhysical Key åħ³èģĶ çļĦ主é¢ĺ hero es ĠWin stonLutz ĠCentral Moment intu itions ĠEcon omic én é ìĭ Ŀ lfreq Result "< ([^>]+)> negLL LSTM æµĭè¯ķ éĽĨ Gyro center thir ion CRO PPED Ġ+-----------------+ ---+---+---+---+---+ EventDetection Metrics djz ns ĠCensus DataSource minis cent Neighborhood Iter Ġwifi Mac ĠWo uld ĠREL U dddd dd ĠDisk Electrode Ġìĥ ī Ġ+----+-------+ -----+ lith osphere yref index ĠDvi Font wet land nsim ulations Ġautom ata 人 æ°ij srt m enrich db Replic ate ĠMinMax Normalisation ĠWers dör CHANG ED Ġtpl quad Health Check Primitive Type UTIL IZATION Ġmusic ECHP ĊĠĠĠĠĉ ĠĠĠ ĠJson Response Thresholds Test ĠColorY UV MNL DiscreteChoice kine matic ĠManip ulating ĠTu omas ĠPRI OR ĠPRI VATE ĠLogFormatter Mathtext biserial rResult ĠIr radiance immun ity )+'% )', Ġnab la Ġannounce ment rill ic ÏĢ nf numInput Vector ĠaxArray Vel ĠBalance Cascade BaseDNNClassifier TrainTest BaseDNNClassifier PredictTest BaseDNNClassifier EvaluateTest BaseDNNRegressor TrainTest BaseDNNRegressor PredictTest BaseDNNRegressor EvaluateTest æµģ éĩı ĠCARET UP ĠCARET LEFT ĠAutos ummary èŀį èµĦ Intra day âĶĢâĶ ĺ å¼ķæĵİ ä¸Ń advan tages Ġheart beats 9536 32 ĠAbinitTimer Parser ĠMY SQL abcabc abcabc fF dD mda o ĠHug hes TimeDep Bra PCO A Ġajj d ĠTaiwan Data ĠImag ine ĠWarm up ĠBucket edRandomProjectionLSH 1162 2591 inferSchema FromList ĠMes aros ĠEv ap Binned Statistic hope fully å¼Ģä»ĵ 交æĺĵ Ġ+---+----+ ------+ kir uba ĠTER MIN mapTo Scene Polit ical ĠRelation ship *? $', Ġinterro gation ĠTemporalEvent Trapezium Ġstabili ses ĠRefactor ing ```` ```` LEV ANT Ġwarrant ies #+ *']) Ġpent es Ġadequ ately deltaD lo 9232 23 ĠAssess ing CIE CAM Ġjmx Port ATAC LIMATEINDEX #~#~#~#~#~#~#~#~ #~#~#~#~#~#~#~#~ Nom bre ĠDataBlock Info ,.. , (*, *, createFrom Local createFrom RDD Ġcadence Sum Horizon AGN zig zag ĠCTA ORDER 6287 67 WithOne Epoch BboxTransform From Foreground Operation ĠHolidayCalendar Factory Ġrex pected Ġuniqu ing NIH ILATION Ġgammainc inv MIL LI RQ Kernel fase o stopTime andFrame æ±ĩ çİĩæķ°æį® Ġaval anche Ġlump er tempPre Off ĠtempRec Off CPS SetProcess åħ¨éĥ¨ æ¸ħç®Ĺ Anc illary Dice Test Os Ar omon is Ġeqv lab TEMPOR AL candid ati ĠAust rian Ġlcv Matrix nrmse LSTM textasci icircum deltaR hi Ġâī ¥ )+'/ ') ĠdS dt ĠWen zer Ġ|+ ---+-----+ Elem wise ĠIo annis ĠGian noulis ĠDecoding StringIO postrop he ĠACGT ACGTAC sint heta getElement ById ĠPreg LengthTest ĠDog gie DLL M ="@ ") ĠindexOf Ref PythonOnly Point Ġ+-----------------+------------------------------------------------ --------------+-------------------------------------------------------------------------------- Mur murHash Ġemer gence ĠEmbed dings Ġplotrange layout èĮĥ åĽ´ Elems InBench Sib Sp bhl qp Ġconten gency ĠACTIV ATION æĶ¶æĶ¯ æķ°æį® Salmon ella Ġmak ani Ġcombinator ically Ġsligh ly Routing Helper MolFrom Smiles nNN I Ġdneff dwl EXPIR ATION setCell Widget produ it ĠNSB undle ĠGod bole ĠEdi rol ĠMetastore Browser âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶ¼ reass igns ĠSar awagi zeroc entered GetCurrent Process ĠMinHash LSH Hero es 00038 1775 Ġgaz etteer DataIndex ableCol CLR SKY âĶĮ âĶĢâĶIJ Ġpsycho py 5038 9512 bhil qp Ġpneumonia e LowLevel Callable BHIL QP SNA PSHOT espress o ĠMEN U substit uted nonstop mode Ġì¶ Ķ ĠMidpoint Normalize ĠTTTTTTTTT T 4998 6458 Gera cao zam idine Ġthor ough ĠPsf ontsMap angstro mexp 22367 336 genu ine retó rio ĠPandasOnSpark PlotAccessor LAC TO Ġpremature ly HistoryContainer Delta Sqlite Hook GrowthRate Transition 9012345678 9012345678 4928 3504 8789 64 FAB IA ĠtestRolling With 53366 841 nExc it æ¤ ľ Ġwerk zeug ĠDOL FIN ĠEas ier recieved Packet EXCHANG ERATE LoadAnd Process ĠPapo ulis åŃĹ符 串 5209 1956 esquer da ĠLEG END ACCES SION 38299 653 HTunnel Forwarder 996138 33 åį· 积 ĠèĤ¡ æĮĩ Ġperiodi ogram Ġarount he Boo ster Chev ron FRAN CED OGradientBoosting Estimator Pof noR fchol let nbu v ymetr ix onMiddle Button ĠdataExtraction Automator allBayes Prob ĠtestPad IfNeeded ĠBous quet ĠBenet os 641247 18341 Ġboats peed ĠdefaultDataSource Name Ġ['*- #+*']) assilv itskii mathsis fun ListVs UnionLength SetFront Process PerEpo che taskBuffer IF skipLeading Rows folderSrc List FitSetup DMCMC CPSEnable ForegroundOperation DAEM ON BatchTwo WithOneEpoch mkDem Node ĠLineHighlight Plugin OBACTER IA scenesevents challenge MockTwo OutputTransform stackedArea Chart entityJmx ParentPid ĠentityMetrics Dir TraceHierarchy Type radioLegend Pos ä¸ĢèĪ ¬ Dimitri os ĠåĮħåIJ«æ³ķ åĽ½ ĠEventDetection Metrics 250416700 86757 "<([^>]+)> ", ĠWersdör fer MNLDiscreteChoice Model CPSSetProcess Name Ġ+-----------------+--------------------------------------------------------------+-------------------------------------------------------------------------------- ------------+ entityJmxParentPid Dict " '}) # ============ $ / $ "] $ ". % / % [ & * ' ¡¡ + =( + )' + ="\ . ']) . )/( / '] / ** 0 456 0 250 1 451 2 252 2 206 2 176 4 887 5 979 7 784 8 944 8 052 : [] ; } = , = âĢĿ > $ > =. > )') ? )' A us A action A IL A lam A USE A DED B ON B link B igger B ROW B aldi C able C FT C LS C isco D ct D rew D owns D CGAN E O E OM F at F alcon G V G Z G d G lass G ES G table G ross G CS H ACK H arker I K I gnored I BC I llumina J ane J WST K v K pc K MB K irch L ING L FP L omb L BUTTON L ithuanian M ip M ATER M UST M ikado N h N PP N hydro O SC O SPREY P ed P run P ale Q W Q Brush Q STK Q Painter R LE R datasets R DA R free S ES S hi S ony S ALT S weden T t T count T ik T PU T ango T WX U W U b U d U lt U sa V en V TT V ista W ra W ise W NT W histler X LE X dense X DR X Tick Y b Y Array Y Min Z CA [ ', [ ") [ ()]. a ção b str b max b urt c ve c base c make c xs c zi c strs d len d pd d ither d nl d MRI e in e ods f est f save f filter f Idx g st g fi g Error g flags g rown g Cond g ifti g aga h ma h grid h ids h iven h iten h vg h arry h oney i ar i pp i Atten j umeg k at k ts k lasses k ian k Pts l O l ny m E m log m dim m rad m raster m rk n key n ug n Trees n Columns n It n Right n Hidden n Streams n akagami n uncen o he o of p li p one p cor p version p Dict p cube p nmf q value q back q crit r th r ch r ns s rid s Index s naps s pacings s DEVICE t G t ms t labels t mult t Number t Active t rending v center v dots v apor v itesse x ab x len x dd x pass x shift x density x locs x large x camera y B y est y expr z center z rot z margin z getrf } .') ¬ 度 ± ´ à Ľ Î ¸ Ñ Ħ ç ĭ é ĸ ë Ĥ ë ¶Ģ í ı č ĉĉĉĉ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 926 Ġ 974 Ġ æĢ» Ġ Ïĩ Ġ ~~~~~~~~~~~~~~ Ĩ Į ĠĠ Ċĉ ĠĠĠĠ ĉ in av in vs in pass in icial in mates re bound re boot re balance re arrange re putation or ios or phologyDict Ġt pre Ġt index Ġt lu er lang st derrs ĊĠĠĠĠĠĠĠĠ ĊĠ al lobjects ar f ar aster le i de seq me a Ġi write Ġi ranks he sion he aded Ġn Y Ġn ro Ġn and Ġn sp Ġn rate Ġn files Ġn thread Ġn terms Ġn assets Ġn Samples Ġc ind Ġc ors Ġc axis Ġc ene Ġc unit Ġc tp Ġc abin Ġf ort Ġf res Ġf pa Ġf stat Ġf cast Ġf ather Ġf moment Ġf rd Ġa X Ġa up Ġa dist Ġa fs Ġa equ lf Std lf rac Ġp R Ġp lf Ġp be Ġp string Ġp ano Ġp moment Ġp nmf it ta it num Ġs sw self Link mp be ra po ion o ct ab ro tflip Ġin versions Ġin expensive Ġo ax Ġo HRXN Ġd res Ġd angle Ġ' _{ Ġm th Ġm á Ġm rgddb Ġe vide co ltype Ġre projection Ġre calculated Ġre miniscent Ġb ac Ġb aud Ġb irds Ġ# \ Ġ# ------- ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġw td ur rection and ay lt p Ġ( & ss at ss ample un hex un parsed un reliable un cacheTable is ide ol ived ue x li x )) < )) "]: est on ot r ot rans um able um ag um man Ġif ace Ġ[ ... Ġ[ (_ as os 00 94 00 333333333333 Ġas a () != () """, Ġis New Ġis Temporary Ġto m Ġto urn Ġto file ts h ts ptw Ġ" ]", Ġ" ]\ Ġnp orts ma ing ma fromtxt ), ..., turn out ĠT ro ĠT Hz ĠT DR th ag th iss Ġy Mat Ġy prime Ġy uv res am res xy res idency ch ies ch erry ad vection Ġdef ensive ve z ve er ve tri ve gas fi mg set api set Labels set Tab Ġr ns Ġr ip Ġr bs Ġr tree Ġr dc Ġr kf Ġr nk Ġr lons Ġ2 173 mat rx Ġst f Ġst ab il las ]) ._ ]) [:- om ance (' ...', Ġ""" / pt ms pt ically Ġg W Ġg pa Ġg rap Ġg lon Ġg pus Ġg roupe Ġg romacs data y data Folder par type up down get Time get writer get response get Cell get WindDirection Ġth i Ġth re ĠS ph ĠS unit ĠS MC ĠS AMPLES ĠS NAP ĠS anitizedObservable Ġco i Ġco us ri kan Ġimport strings Ġdata x Ġdata group Ġdata structure =' .* =' ?') =' *'): Ġx sample Ġx offset Ġx deg Ġx tc Ġx vecs Ġx tsys ĠX fmt arg string end head end tag from function from numeric con ts con ventions col m Ġor gt ist ft Ġh pi py l py dml py urdme ĠĠĠĠĠ ĊĊĠĠĠ ĠI ones ĠI ran ĠI AM plot points plot Act plot Results plot Directory ĠP CT ĠP ict pp ps pp api pp oints ĠA new ĠA ster ĠA symmetric ĠA OI ĠA coustics fe cal fe cid Ġcon volving pre ted pre servation ĠC n ĠC HI ĠC SF ĠC ERN Ġ` {} Ġ` ../ to end to Array to Plot to sequence Ġtest Raises Ġtest Input Ġde alt Ġde duplicate ĠF ux ĠF SL ĠF rac ĠF letcher ĠR X ĠR FI ĠR FC ĠR onald ĠR ennie ([ ])), Ġax iss Ġax lims np ad np ath ub lin ub ility Ġ3 200 Ġ3 96 test datadir ust ext ust aview Ġres izes Ġres ubmit line col ĠD Q ĠD h ĠD TR ĠD rou ĠD GL ĠD ollar ĠD onalds 01 45 ns pl Ġse misupervised Ġv rot Ġv lims ta k Ġarray like out base out bound path Operations pro fil ext py min R min it min req min Threshold Ġk B Ġk key ĠN n ĠN class ĠN range ĠN avigation ds f ds hift str top ĠL iter ĠL RT mo bj mo difiers ors hip max d max loc max pars max Event max Noise df it df Row pa a pa kdd Ġpro ved class a dict By ĠM ig ĠM AR ĠM UL ĠM imic Ġmat rice Ġan onym ys rc Ġne val Ġl or Ġl pt Ġl sc Ġl Keep ** \ app hire shape files Ġuse able fig Height ir anks ho und 10 47 10 29 10 74 iv p Ġare na Ġpar filename Ġlen ds Ġnum ero Ġnum Tries ĠG host ĠG iving ĠG hah Ġ< --- Ġout files Ġout seg Ġout PatchSize Ġstr ats row ard row configure lib params lib mesh gre t Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Val ley ĠRe compute ĠRe currentLayer sc alling Ġpre mium ĠE f ĠE min ĠE mergency ph ote Ġdf F Ġset dash Ġ4 35 Ġ4 77 Ġ4 49 Ġ4 39 Ġ4 93 date PR ag u ag ram train Label ĠB ron ĠB alkan sh tml sh antanu Ġun et Ġun serializing Ġun desirable (( % op str op ho Ġthis pop log stellarmass log raphic key str In Cent In coming In hibitory Ġle ven da vi ile ver 99 16 99 56 Ġcomp val Ġtime Entry Ġtime ElementList Ġint ract ant asy fo ooo ĠW M ĠW abbit ine z Ġmax line Ġmax diff Ġmax Len ., ), num features num frames add nodes add Attribute 12 70 ĠO do Ġbo a Ġbo ss Ġbo iler las a Ġmodel nos Ġit able ca c sub ishi Ġvalue Type Ġplot ToCopy map fit map Values Ġhe ater old version ach y Re qs Data Object Data Product 25 14 raw video Ġline Data inter view Ġdist anced ll corner 11 60 read shapefile Ġinput Image ĠPar k Ġz y Ġz sp Ġz inkov color mesh Ġ\ ___ labels vm ĠIn cluded Ġper forma Ġper turbed Ġ10 64 Ġ10 55 Ġ10 56 Ġsc rolling lic lass ĠY et ĠY ade Ġdo bj Ġdo ses Ġdo fs Ġdo xygen Ġnew Y Ġnew sim Ġnew wcs ĠH ui ĠH eli 15 18 15 28 Ġlog P Ġlog Mh Ġfig title tra ditional tra pezoidal ich te (), " (), ** Ġinter vening Ġpy wcs Ġpy wr start file not i :` [- ################################ ############### Ġno learn Ġno lock ĠU r ĠU PD 20 89 20 93 dd c dd is quen ch Ġcl d 33 0000 33 54 33 83 Ġsub types Ġsub inds Ġsub titles Ġsub triangles ie lement no bject no access Ġmatrix plot io use 201 80 201 30 --- ') 80 45 80 22 80 65 Ġ6 32 Ġ6 05 Ġ6 68 Ġ6 58 new index pred std IN VOC ug al Ġtype list ĠData Originator ats pin 66 55 66 945 amp ere au che ĠSe gments 45 13 AT M AT CCCG ĠK IT ĠK ai 75 77 75 93 ok en 88 95 Ġ| : grid label vent is ']) > ']) [: 16 97 Ġup side Ġpos i Ġro o 35 355339 Ġcur line 14 04 -------------------------------- ------------- Ġkey file group sort // ( tick vert )] }, Index Bins Ġ8 18 Ġ8 44 Ġ8 56 Ġ8 757 Ġ8 785 Ġ8 759 Ġ8 662 Ġ8 642 78 36 78 48 78 233 13 77 Ġbin sg Ġbin edges (). ]', ĠV arg 22 29 22 69 nd c sp lf sp array sp fmt sp iders Ġother iw table view 96 31 03 44 03 72 Ġstart path Co ulomb trans fac ĠTest X ĠTest Generic 02 31 02 116 Ġmo ins Ġmo usetext Ġdict ated Ġ{} /{}". Ġover hang ild as 94 45 94 46 Ġcom bi 17 66 17 38 17 132 of lag object Name Ġcolumns pacing 85 97 85 49 :// ', Ġexp number Con volve Con ductor Con stitutive 24 73 space group 27 35 Ġ7 200 Ġ7 24 Ġ7 90 uc ar uc nt image d image io ref data ref uel 86 23 SE E gen logistic Test Y var dict back drop ols ho }) $' Ġmean rank 06 33 Ġdistrib tion 18 30 36 23 norm IntensityP 07 10 07 02 07 95 07 44 07 087 exp Info ap se ap ata ap ca ap idoc Ġqu iv linear fitparams feature d Ġ, - dis cuss Pro cedure ST S ME K Ġnon nan Ġversion ing ĠJ J ĠJ data ĠJ unction 92 62 save Fig version added ton s Se cret dt v ĠQ String ĠQ Point sg m lp ad Ġopen Image Ġopen pathsampling left most Ġsort val Ġtarget Value my array my unit Ġvalid ations Ġ9 80 Ġ9 66 Ġ9 36 config Dict Ġread outs Ġim udta rel pos rel err Ġtemp filename UT COffset Ġav ro Ġav ai Me as 65 46 30 35 db path AS MA sol vents Ġad jectives Ġtrans p Ġtrans act Ġtrans duct 37 35 37 29 Ġbetween ness Ġconfig ures Ġbatch norm cm h step hens ĠCon cordance mpl style Ġtra sh Ġtra versing lip ped RE Q RE PR top Images CA A The ory Ġzip code OD IE 44 25 44 057 gy ong select ing 23 997 ome g ome stic SI FT img Y img lat img long multi rotflip multi labelsvm Ġframe works ops i 26 29 26 125 De letion 77 15 77 387 ĠDe jaVu ey es view manager RO ZEN ga ard ga inst Base Name Base PCA Base HMM Ġsm irnov cell Colours ink n mer lin mult iframe Ġfigure Handle Str Enum je e stat ustext ĠSt itch Ġcond or 42 78 ob c ob en side len Ġdec imated igen e 43 93 seq run Ġpas sengers ĠAl varo Ġoptim ise Ġoptim iser fore ver DE ATH '). ", rec ipe mag l CV C Ne v Ġtri finder xy Y xy t To Correct ĠComp uters Ġdistance Matrix Ġaf q sin v wh r wh om Un structured Un directed fra ctory Ġsave plot Ġcls f ox s Ġselect able Ġselect ivity Ġselect All tz one inv mod period delta OT OP Ġtick Datetime Set Title rad on inf lu ãģ Į ãģ ij Comp anion ĠUn ter ĠUn ity ĠUn ary NA MIC EL ASTIC ĠSet ter For Testing 29 80 ud der En dian fft SizeSub Ġstop word Ġlearning Rate 39 24 Ġarr bind Ġge b Ġge mm Ġlib name Ġps fim 68 012 Ġmon omial Ġparam style Ġthere for ĠAn h fin ex IO bj MA M DI STRICT position ing Ġrank sums 46 86 Ġinterpol ators Fe wer td tri Ġmu ck convert array 31 99 31 78 Ġvar Name hi pp hi ya ML DATA beta G beta prime cross val cross spectrum Text ile Ġret re now hiten Ġ{" @ initial isation UL ATE AD H AD X ran o ov an ov ing ({ (" nc pu channel Width ignore Unknown Log Reg Inter class Inter act 48 33 48 26 Pre paration Pre ceding ''' \ ĠGH P App s nb convert nb onds "," | eq t 69 313 PI A ĠGaussian Kernel power Col **************** ************ NU ML Get Point Get Width ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ Ġmy output Ġmy ster Ġmy Log Ġignore Nulls obs val Ġnan cumsum Ġnan cumprod Ġnan ometers ĠRandom WalkSource Ġ'- /~ Ġday length Check GenericMixin Ġcorresponding ly Ġ'\ ( Format Date Py Objects Py SimpleApp ĠBase LabelPropagation TH EM Ġexec utelist 89 8039 ĠTo eplitz Ġdest Template 74 24 74 65 imp rint imp utes noise s FT P ĠPre processed ĠPre trained none x Ġpr ms IM AG Ġstri ped Int el Ġlw rdx Result Set Man hattan cp figure Ġ$ | cha o contrib uted 51 64 ĠMin GW OP TI ('\ ' Ġpredicted Input fr PyObjects Graph viz Graph Lab Input Warning Input Workspace Can on ]+ "\ section vars ]- = Ġlook ahead ci j Ġupper bounded lr win 83 167 Min Hash 59 05 Ġstack less GD S Cur v Ġsig sqr Ġ(- * ĠSh antanu 2745 098039 PO W handle textpad ĠLabel led Ġmeta dict =[" - pickle File 82 95 opt parse 72 253 DO SCAR Ġcustom s trace Table ND k Ġannot s post al post proc ĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ mut liclass final e Ġocc ult )- >( CC F chi image xFF FF An de An na Button Release Ġshrink ed ĠPy Dev Temp eratures way point ĠPath ological FA s Ġshort name wave trans deg Idx mc Lesser Config Error GT A ĠDE PEND CD M indic ated Ġte al gene alogy price Ticks Ġdepth map ti lization Batch Transform Ġsquare tg Ġopt type II II element ary gest ures Ġavg df Th omson Ġequ il phase yx Ġmag netization )} \ ffic he infer ior Sp indown Ġdepen ses short en extract file æķ°æį® æºIJ Of Year lc ude Ġstream bed Feature Manager Ġfold l ĠOut side hdf t Ġport ed mock ed Layer Params Map Coder SP OT TE CH Ġcf gr DB G DB s ĠCategorical Hyperparameter Tra iler || ", }$ $ }$ \ cla uses NT O ĠFile System ĠFile Handle Core ID macro states condition ally 91 757 tan dem ________ _ Sparse Classifier 101 1 bias correct Ġms ld widget closed plat ypus uid o Ġphi max Length Half Ġscikit Algorithms ROM AN Ad aboost Ġgene DF "+ \ PRO TE PRO CESSED TO GGLE Metric Lists Offset Image MF C iso forms register DataFrameAsTable Ġput ative bc ry PR Z PR IV PR AGMA station col End points End Drawing Ġ"- > Ġpol Leak )))) ): shrink B ]} )), 005 87 005 48 TC MB Mult idimensional Ġls Col swap Amp Ġneigh bouring ano fi (\ '' soft prob Font Info Ġmut ants NO M NO QSO Ġ88 99 Ġ88 80 Ġ88 90 gal sim break er break pad ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ21 12 bd as Ġ[]) ): Ġ>> = Ġsynt hesized Cl us Ġbig tiff xF D dB ATCH OUT DIR tod ok /> ', SL IT gui lt bra zil =', '. Ġ{}, " ĠColor Array ĠTra pezoid Ġtot Power bed rock ---------- ") half edge half cauchy Ġ"{ }, Ġdump er Ġserver manager Meta class 336 121 Ġer ange Ġthink ing MPL Plot observ atory Ġcontrib uted And Loss rd bs topic scores pie z Ġspect roscopic Ġimportant ly 275 8 ĠCO V ĠCO VERAGE ensors hip tty USB ]( # Ġmem mapping IST ANCE Ġct set Be ams ĠAxis ArtistHelper Ġfl ights Ġfl ann cccc c Over Window Ġlight ly Patch Shadow Ref Dir Ref Star ĠAss umed 219 0 sn cl Ġcover type Mag enta more floats ech ant 636 3636 Ġ================= ============ Frequency Series Ġcli ps 901 9 Ġgl Tex Ġ87 78 Ġ87 30 ĠSum mer bio env bio logical ĠText Field ĠML data ĠML DATA Ġvect ores ĠFloat ArrayFormatter Ġ({ : Ġep ic 998 19 PP M PP outpath Ġmicro s Ġì £¼ ################################################ ######## UNK EN Factor Scheduler Auto Correlation ĠOpen MM Ġ35 00000 LR ig LR gg LR rg KEY WORDS NOT ES Ġslic ers Ġ197 7 Ġgeom space Ġ"< ", Ġ26 16 185 68 ('.') ]) }] ' ĠNumpy ParameterData plate au ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ SER I git Add 033 0 dark cyan rh k ĠEd itors ĠImp roved Ġ'" ') flu or Ġmk vc {: < TT L prot Cnt Average d Ġ96 1 Ġ96 5 032 4 loy alty ĠTH ETA ĠPrint out enable Gui elev ator ĠAb out ãĥ Ń ĠSE CTION Interpol ating Ġtim file ko alas Ġdecode Variables 205 5 should n Ġdst Postfix Year ly ĠKe ithley Imp ulse Ġminim ises pct ile Art ists æĽ´æĸ° æŶéĹ´ Ġ86 13 Ġ86 08 Ġ94 8 feats L Like DataAdapter 987 6789 yo ungs ("' { ĠRed undant Clo ughTocher ĠUS NO Br ute Ġ84 99 Ġ84 98 ======= ") Rows Weighted ,... ], Gram mar Ġ:- ( Ġcum freq ĠWar p Ġub untu Img Data Cross ing detect s detect Equilibration mor row gu arante idle tasks Ġaccumul ating FR IC datal oader æĮī åij¨ Gen us ĠVis py sib ling ĠCa pt Ġstrat Mark Pack ers exon Starts Selection Changed ĠAuto DateFormatter broadcast ed Begin Drawing coll E Std out Pass Through pw y medium blue sequent ially 164 0 dip loid ĠUnicode Error COMP ARE My Table Remove InputHook 155 14 Ġmt bl slic ename ('$ \\ stretch ing INTER SECT ĠEquivalent NumField Cha ined ĠDatetime TZBlock Ind ust (? ! (? :\ Ġsuggest ive SUB PLOT Align Left ="# % 7843137 25490196 ãĤ Ī ãĤ Į Ġdow ngrade ä¸Ģ 段 spine color Ġdepend ant Conv Layer ITER AL SF H ('{} . Ġfo untain Exit Slit blank line BE FORE nov os 007 000 CES M kk int ĠBack wards ĠFigureManager Template Ġapi key Ġlic ence 232 7 TOP ICS \. ]+ Stop Time 188 9 MR N ĠEnd OfPrdv tal ine ĠPost s decomp ositions ĠVisual izer 396 1 åĢ ¤ interpre ted æī į destination Dblock UES DAY pkg config fact uration Ġ97 0 survey banner ĠWave form Ass ume ĠRel ational ĠEvent Manager ĠCha uvin El se MAC CS Ġamb i Ġamb ivalent Ġ59 20 20000 103 Ġdro of Peak Index ĠMa j 229 11 ĠBio logical Fast Coder Ġsky group 6401 95 90196 1 Mov ies Ġbed s Ġpara BEM 267 17 Ġmf lay bal cony ĠChar acters oto pe Scan Set 096 7 ht bp Ġarch ived History Spec kx R bro oke Ver bs Ver ifies Ġprom ised CM Y MN I ĠFA ST ĠSw itzerland }^{ \\ ĠChannel ArrayBlock Ġhal fnorm finish ing ellip ord La CyTools Ġtrig onometry ä¿ ® çº ¬åº¦ '[ ^ '[ ().]', 5555 555 æ¬ § ĠQT imer ĠMac OSX hydro gens ĠRenderer PS tie correct electric Field mamm als ĠMD X IE POX Constant InputWarning ester ov sch arr phy lum Ġabstract s ĠDen gyong Week Day Week dayLocator Ġconstit uents æĮĩ å®ļ SAVE FIG ĠSm irnov =(( (( bis que Pred icate pal evioletred thick nesses ĠLearn er ĠLast WeekOfMonth Ġmiss pec lov ak blo p blo binfos ĠComple tion Ġ[[" \ yz hu ĠIntegral Type Ġmedium aquamarine correlate ND NULL ABLE 0000000000 2 Bitmap FromBuffer Aggregate Functions erg ic 表 ä¸Ń Ġ################################################################ ### Ġ'; ', Execution Exception Sent ences altitude s rna diff Ġeco system trig onometric analog ous ĠIncrease d éĩij èŀį rez nel Ġdiss i Ġgas p ĠQuant ities GENER ATOR SAS data aab a ĠSP AM ĠSuper Cell и н Ġ*** " carto frames ('> '): fli py ĠNegative Binomial ĠGu illaume Dt Grid Ġsch midt Ġ"& ": Large st çĤ¹ ä½į ĠPi lot ĠSimilarity Surface ĠRNA Seq æ± ł ĠPlan ning Gal axies Gal InCent cab e sad ness Move ment cep strum ĠFlatten ed Ġdup es ĠPen nsylvania Desc ribe Den ovo Den nis Ġpsy co (.* ?) ultra bold Ġtouch stone ĠNa poleon UserDefined AggregateFunctions (',' ))) Wavelength InUm Ġmfc cs ĠMetrics Base Ġseper ator æ¯ı èĤ¡ NY C Ġ+-------+ -------+ Ġlv ls CAP ITAL watch er poss ibilities Ġearth quakes ĠDT W eth oven linears vr âĢĿ âĤ¬ ("" ), Ġfich hdf Ġhypot hesized JJ L Ġsil icon Bio mass matt mahoney åĿĩ åĢ¼ LAY ER Ġcoinc idences ĠDISC RETE ĠNumeric Property Ġcategor ization touch stone 718 28 Subclass ing ĠExplicit Indexer ĠRef resh ĠSY MMETRIC ĠRaster LayerHistogram gains boro Ġmic rowave lymp ics QSO X foc user fic as ĠGA USSIAN Detect Method Ġkep mag Ġoc cluded ĠÎ ± Lookup Error ĠDtype Obj ĠCOMP UTE Ġcorrel s ĠDiag nostic ĠPur ple ü ller elli pto ĠINIT IAL KDE Univariate Ġdop amine ('& ') Stata Dct colo res Atlas Time amer on ĠZipline DeprecationWarning 空 头 uent e ĠFre y Ġlite cur ĠAW OT Explicit ly fsm Exp Ġhealth y Ġê° ģ Bi weight ĠYu val 1424 07 GaussianProcess Regressor WAVE LENGTH Ġchess board ĠGr anger Character istics ĠRen ormal æĴ ij Ġhomog raphy }+ { Ġdmat pawu Flat ness adv ise Ġdeli ver Ġdeli very god bole çŁ ¥ Singleton Configurable Branch ing Abinit Task Xml String Ġpus i Bokeh JSONEncoder Ġcook ies ĠLand sat 2424 24 Dem Field spr uce ĠSL IT ='{} ' Ġjit ted gaze left ingest ion aman ho ĠCOLUMN S emer gency ĠBr illouin æĶ¯ æĴij ĠAnchored Text Transport ation wis ps neu roml Synapse Count abili y \", \" Ġpyqt Signal fluct uate ĠKER NEL fut ur pathogen Name Basis Function Ġdemean ed Dr Rate ĠPickle Serializer Reshape d COVER AGE Ġbasin mask Bas ket ĠTrack ing djz nw Publ ish rare faction ĠOCC solids trump et Ġvo or ĠčĊĉ Ġ ĠOk ada Interpreter Interface LESS ER ĠSQR T ĠíĻ ĢìĪĺ ĠREL ATIVE ĠContrast ive numOf Traderss Ġrag ged Every where jol ia COMB INE Ġ.................................. ............... Ġspectro meter Midpoint Normalize Les ions raman i ĠZe aland ĠOptimize Result Ġpump ing ĠWINDO WS Mut ect PST H Ko alas ĠìĿ´ ìļ© Send Only ĠTal bot ĠTim ing ĠConcaten ation Ġisotopolog ues Ġregrid ded assemb led ĠCla use SLS QP ĠnumOf Topics Ġlif espan æł·æľ¬ éĽĨ ĠCARET DOWN åĮº éĹ´ èŀį åĪ¸ ĠMcG ibbon å¾Ĺ åĪ° @@@@@@@@ @@@@@@@@ brad ford Que ues Ġgel Pg ĠTmp Dir ĠMun icipal ĠDeprecation Warnings trop ical noOf Pts Ġmuse um icGraphical LassoCV ĠBucket izer ĠWarn er ĠOdd ly noi per suz mjd ĠDispatch er ItemIs Enabled TAI EX ĠZo ubin ĠScho elk Ġchron ological vart heta Ġterr itories scrib ers SetCell Value bckndarr bin Ġgall eria Ġeth nic 0086 0051 Nsteps max ĠSam uel maskConst Pos maskConst Neg Ġlss list =... = ĠUlt imate XYC Plot Ġkolumn a gues sed limage file ĠBrun ak makeat other GetCell Data jsbs im Suggest ions fdd bc Ġris ks ÅĽ red chdtr c hansen law getSub Vector Scre ener ĠTrip le TEMPOR ARY μ m Ġcave ats ĠNav in TSGT NM TSGT CW gil brat ĠBlas NotFoundError Ġscrew ed Ġkepler ian Continue Training ĠCONTIN UE ĠPrecip itation ĠReson ance johnsons u multil cass OneToOne Field cris is equival encies InProcess Kernel lorentz ian Heart Rate pxd files Ġgalfit Config PartsLayer Img Haw kes Lou v ĠSz lam Ġimperson ate russ ia å±ķ 示 SHEL XE ãĥķ ãĤ 5207 02116 terror ism ĠDash board ĠMit chell ĠEmb arked ENSEMB LE detectable Intensity 6246 15 >__ < Pioneer LengthHalf limp se ĠAIST AT incumb ency Ġtort oise ĠBor uta ĠHod gkin Album Dict XMLDST ABLE MOT OR sprint banner homogen ize progen itor 741176470588235 3 ĠCatmaid Neuron dataparam X discar ded gazer ight éĢı è§Ĩ RMSProp Optimizer ĠSIMILAR ITY ĠSau rabh ĠPand oc ("###################################################################### ") IsShown OnScreen Ġsmtp lib °ê ±´ Ġsequen ced Ġparadig m è·Ŀ 离 CMC SA ĠODM R ĠCatal in paradig ms ĠSmin chise Ġdenomin ators baf db Ġpess imistic ĠISS UES perplex ities ĠGrig orios BOUN DED jerr yzhu Ġcardi ac ĠXiao jin Ġdepos ited ĠWare housing Ġbetwe ens Historic Data ShowThese IDs éĺ»åĬĽ ä½į dNOP AUSE æıĴ åħ¥ 69314718055 99 rze j ĠCou lomb ĠdfPlot WithEnvelope Colored CellList Existent TimeError asymptot ically ĠCaseless StrEnum mbo stock ĠFib onacci Ġ31344 016 16769 0146 }*| -------------------- 77555 756 ¸ëį ± hiven ame Ġcene tered Ġaequ o olived rab ĠSunit a ĠIones cu ĠFux in ustaview a ĠDrou in ĠGhah ramani INVOC ATION Ġbinsg iven Ġotheriw se Ġtransduct ively ignoreUnknown Values Ġ'-/~ ' PRIV ATE GalInCent Halo ĠSchoelk opf ĠSminchise scu # [' # ------------ ' >\ ' >", ) ==' * ][ + )- + );" - *- . ": / ': / ). 1 863 3 001 4 024 5 047 7 192 8 0000000000000 9 80392 9 154 9 64706 : ': ; '), < ------- > '), > =% > .' A tr A ventis B d B alanced B ridge B ee B TOA B areTrace C ST C ater C aN C andidates C rystal C MRmap D J D ell D NL D aniel D hillon E i E tape E bN E limination F lash F whm G lu G ran G yr G lax G ssa H J H AN H AC H olds H SL H uy I OD I ono J Error K line K ORE K luger L abs L MC L IDC M J M DF M ike M OBA M imir N im N train N DF N scan N VS N ODATA O UNT O cean P ING P eg P reads P GA P ORTS P epsi Q BAR Q Variant Q BINS R in R an R ent R MP R field R ING R PT R elief R locList S ho S af S ac S NAME S anofi S UNKEN T st T pr T MA T ups T une T ony U rban V H V c V list V transform V rt V ia V oid V LO W atcher W atts W ilk X x X erox Y right Y aw Z part Z WARNING \ .) ] ][- _ \\ a string b P b ss b ally b ipy b run b Show b iorad b reqn c D c np c us c node d ss d plot d to d arn d line d axis d graph d Mag d Sd d weibull e es e Time e mm e urs e vects f as f plot f ext f op f ars f measure f orth f isk f icial g ss g ay g dirs g fd g gsave h up h ans h sc h ick h ighb h vline h undred i idx i use i exp i angular j row j da j ams k ve k pars k 线 l Classes l ungs l pawu l stdc m fi m range m logit m stridx n ss n age n with n rec n ines n quad n iftify n vidia o ce o Smith p ens p hed p now p ident p Opt p iration p confs q out q ext r ff r te r hat r rms s ul s ile s rad s unit s mem s izing t array t fi t pp t to t lim t use t ess t Min t igs t Added t Dropped u cao v gp v rpn v twa w ax w ash w ti w radlib x il x cc x lat x dt x fer x stop x dr x Loc x ini x fm y am y width y tx y Set y fin y Ticks z loc z stat z wal z SearchFunc z heng } != } ]}, } |^ ë ¬¸ Ġ lip Ġ 976 Ġ ï¼ļ Ġ ÑĤ Ġ ä¹° Ġ íķľëĭ¤ Ġ è¿ĻéĩĮ Ġ æ£ĢæŁ¥ ij IJ Ĺ éĿŀ ľ ĵ ĠĠĠĠ čĊč se micircular se misupervised at sc re assignment re chn re ceptive re uben ĊĠĠĠ ĊĠĠĠĠĠĠĠ or ography Ġ= {} Ġt ha Ġt args Ġt size Ġt resholds Ġt lm Ġt cks er gy er ob al ization al ski al omonis ar ina an ing le me de er de scri de bian me v me lo Ġi get Ġi dict Ġi cc Ġi labels Ġi idx Ġi ap Ġi Col Ġi bound Ġi opt Ġi bm he red he licity he alpix Ġn L Ġn ss Ġn op Ġn labels Ġn gs Ġn hs Ġn shift Ġn blocks Ġn cells Ġn spin Ġn avy Ġn Win Ġn stx Ġn coils Ġn Recs Ġn strm Ġn TempDens Ġc if Ġc ns Ġc bo Ġc te Ġc err Ġc ensor Ġc ai Ġc events Ġc pc Ġc esium Ġc athode Ġf R Ġf get Ġf ight Ġf pos Ġf stop Ġf reed Ġa j Ġa ca Ġa count Ġa abb Ġa cademicpages Ġp ce Ġp ong Ġp any Ġp xs Ġp hen Ġp car Ġp bc Ġp cw Ġp coll Ġp hemi Ġp rcp it k it ate it ent Ġs le Ġs ump Ġs au Ġs svm Ġs prs Ġs ankey Ġs urname Ġs printf ra ch en cing en kf en fants es ion es plot es hat lo co lo scope lo pf lo uv Ġin g Ġin ame Ġin dict Ġin bound Ġthe t Ġthe time Ġo mol Ġo SubPlot Ġo cropy Ġd gm Ġd wi Ġ' """ Ġ' ?') ing ale Ġm rb Ġm ilit Ġm logit Ġe width Ġe ject Ġe List Ġe mot Ġe aster Ġe uclidian co us co loc co urier co lindex Ġre dict Ġre interpolated Ġre implementation Ġre concile ge otype ge odesic ge oport ): " Ġb int Ġb os Ġb pl Ġb ign Ġb ord Ġb read Ġb tol Ġb List Ġb Verbose Ġb pplt Ġb iallelic Ġ# < ed ist ic hock Ġw lp ur ities ig mainv Ġ1 111 Ġ1 120 Ġ1 119 ', '')) un like un necessary un separated un pickler is ize def i li ament ort ype )) () )) #, ser c ce x Ġfor bid est adob ot ools um x Ġif s as ynchronous 00 70 00 72 00 1904 00 3333333333 00 666666666667 id iv Ġas sending di polar () *. Ġis l Ġis atom Ġis collection Ġis generator Ġto ggles ts nr Ġ" $\ Ġ" )", Ġnp a ter ing ma ven ma aten ), )* one pv ĠT up ĠT ank ĠT ilt ĠT hing ĠT SS ĠT iny tr imal tr inodes tr uncexpon th rown th ursday ha irs Ġy mn res as res identsDay ch ose ch imin ch igo ad mittance ve get ve ccdf fi an set ype set Width set Operators Ġr pi Ġr window Ġr star Ġr rat Ġr skf Ġr hyth Ġ2 600 Ġst aple il brat ]) () ]) ]). ]) ],[ ime dia ime nemen (' ')]) int ed int roduced nt he Ġ+ "/ Ġg ct Ġg len Ġg line Ġg ib Ġg mx Ġg Parameters ex planatory data models data FileName data Types data dog name str up segs up hiya get Image get geom get GroupNorms ab ras ab serror label FontSize label Manual Ġex changing Ġth rou ĠS b ĠS val ĠS tick ĠS IR ĠS cheme ĠS WARM ĠS PoC ĠS creening Ġco fluctuate Ġdata out =' ^') Ġx coord Ġx Mat Ġx dawn ĠX out ĠX port ĠX windows end T end last end foot from im from import from gamma type ComboBox col dest col Headers Ġh pack Ġh orse Ġh urst ath le py mat py red ĠI x ĠI df ĠI BC ĠP et ĠP unc ĠP ec ĠP AD ĠP BS ĠP ade ĠP HY ĠA Ps ĠA rikan Ġu knots Ġcon served '] /( '] =[] '] "`` ĠC m ĠC dfs ĠC rash ĠC ameron ĠC ichock os ys os omal im ulation im ony im oku to st to urnament to ÅĽ ent le Ġtest mod Ġtest Output Ġtest Binary Ġtest Hooks Ġtest ContinueTraining (" (", (" _" ĠF em ĠF PR ĠF iscal ĠF irmicutes ĠF argo ĠF ulton ĠR B ĠR ing ĠR ex ĠR are ĠR oth ĠR edu ĠR HEL Ġax pos Ġax cb list ings list ify test C test Model Ġme V Ġme me Ġme gam Ġres hapes line fmt ĠD MP ĠD OCK ĠD ublin ") ``. 01 47 01 21 01 41 01 58 01 666667 ne ck ns a cal exp time idx time Series time Steps Ġse cts Ġv dict Ġv uv file Names ly sis Error Statistics ta he ta ud ta rea ind list out idx out Name out standing pro fs ext num Ġk ids Ġk keras Ġk raft Ġk onto ĠN INF ĠN UV ĠN pilot ĠN esterov form layout per cs ds i ds yr str id ĠL H ĠL c ĠL MS ĠL TE ĠL atest mo y Ġon nx index sidebar max Depth df q df rac pa cs pa gen fit param Ġpro positions [: ])) te brate ĠM ak ĠM Py ĠM arc ĠM ASK ĠM asses ps pd der ivation der jit Ġl se Ġl name Ġl rs Ġl Res Ġl ora ** [ ** ::\ Ġuse Locale fig share size Parameter Ġ>>> ", Ġfrom type 10 55 10 42 10 52 10 3448 Ġpar MC Ġlen plot ĠG mb ĠG rib ĠG amble ĠG Lib ĠG amblin ĠG gplotError ĠG ALFIT Ġout lined Ġ/ __/ ore store Ġstr val Ġstr char lib scores gre eting Ġresult ed Ġresult Dict ---------------- | oc d et ax et otal pl on pl ans Val ero ĠRe calculate ĠRe placement ĠRe arrange ĠRe ply comp eting Ġname decode cl ones cl utter Ġfile Params Ġfile OutName ĠE MS ĠE CL ĠE asy ĠE bN ĠE VERY Ġdf l Ġdf req =" '% =" ${ date Len train HMM train TimeSec ms b ĠB rent ĠB ear ĠB acteria ĠB enders ĠB ELOW Ġun box Ġun active Ġun reproducible Ġun realistic Ġun saturated Ġun intended Ġun parseable Ġ5 99 Ġ5 45 Ġ5 67 (( \ op us log A log ls log fold log Likelihood log TPM random Split axis Label `` `) ast ed ast est Ġlist add ef ul ef unc Ġle a Ġle veraging da uphiya 99 42 99 38 99 74 Ġcomp eting Ġtime base Ġtime AccumMin ant ibiotics 64 78 64 50 Ġclass file Ġclass List fo opsi Ġ`` ]`` Ġat traction ĠW AS ĠW PG Ġmax rank init Array init Days add Features 12 30 12 73 12 600 12 912 Ġget Min ĠO O ĠO sind result I Ġaxis Yright error def sub range sub steps sub tasks Ġvalue ContainsNull ep w Ġplot a Ġplot loc Ġplot Node Ġplot Parm map py map pee Ġhe micellulose sum mar Re inforcement Data Loss float legend 25 50 25 74 25 62 Ġso i Ġline c inter lea Ġch f Ġch ime Ġch pi Ġch rist Ġdist urb ll ss 11 47 read list 32 14285714 unc csm unc lipped Ġmin T Ġmin step Ġmin spany Ġinput Record ĠPar alle cc ur Ġz mean Ġz obs Ġz avg ng aps cy ber ĠIn bound ĠIn validate ĠIn Condition ĠIn derjit Ġper t Ġper cs Ġ10 23 Ġ10 47 Ġ10 40 bin es bin SpinBox ĠY I ĠY ES ĠY oram Ġsh ipment Ġpa in Ġnew key Ġnew ticks Ġj pyx ĠH em ĠH SP 15 33 15 86 15 08 15 57 print out 05 46 ded u Ġfig prefix =[ _ tra Grid ich er Ġpy man Ġpy stan Ġpy dml Ġ[' + Ġoutput Data Ġoutput edges Ġoutput fluxes start dt not found not imestamps :` || ĠU SP ĠU SM Ġla ptop 20 45 20 97 Ġcl m ĊĠĠĠĠ ĊĊĊĠĠĠ pos Val 33 37 Ġsub data Ġsub task Ġsub trees Ġsub lists vari ations predict TimeSec ie le Ġcolor mapping Ġcolor brewer no figs no vember io bj valid only Ġha ir 80 78 80 61 output type output Name Ġ6 10 Ġ6 35 Ġ6 65 Ġ6 56 Ġ6 57 new buildings Ġ. /*. ES N čĊĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ čĊĠĠĠ ER ING ER IES attr getter IN et ug a ĠData Context ĠData Files 66 101 ĠSe g 45 875 45 385 width B ĠK ra ĠK max ĠK ite ĠK FT ĠK Best ĠK EP ĠK uo ĠK entucky ĠK eshat 75 05 ok ai matrix Menu Ġ| , < Ġ``[ `` ĠMet allicity Artist Inspector tech doc Stop Order Ġlock file Ġbio env cand set assertDataset AllClose ĠPost gres ĠAL T ĠAL PHA 108 92 guide lines disk cache Ġ'| ': shot gun ĠFont config Ġsit utation ĠSecond ly Control Unit Ġdes iccant æĺ¯ ä¸Ģ个 SW R photo sets sand ia ĠCha d CCSD TAF Ġcapital ization ĠBox ing fund o additional Info 387 68012 POL ATE gets hape quart ic planet planet Response Type 6401 90 6401 83 sco t Ġsuc ces Mov es gx g Ġbed In Author ization earth sun Ġ98 28 æµ İ nos ort Ġcn trl MODEL VIEW 292 8 Ph one Ph illips ĠDeprecated AttributeEstimator prote obacteria å° ļ Sur f OG RAM Contour Generator Colour map Ġsnapshot FileName 534 2534 HR P Numpy Array elt c 457 48 Ġfg w ĠValidation KFold ĠValidation ShuffleSplit )+" / 99215686 27450980 ĠAndre ws Ġ'\\ ') slab s live time ĠUniform IntegerHyperparameter ĠfileName Prefix ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠCl one 1177 70 Ġlimited max ĠGlobal AveragePooling vw aps ĠSC ORE Band Structure ĠSubplot Host ĠExec utable 99999999999999 445 Mis ses Mis matched Ġrr hr ĠTool MissingException ĠMac Ports lig ands 554 6547 ĠRenderer GDK Has Traits coffe escript Ġhs ps ĠReference Files Visual Appearance todo List åĨ ľ Ġprep ends cheby c æľĢ ä¼ĺ Ġhover text 959 0270 ili an /* ') ĠVert Line ĠOper ators 065 97 ĠConnect Layers Bayesian GPLVM sers ic Mid E Ġtear off ĠDa ubechies ĠMB AR ĠME F wal tz tos ave Ġzeta c ĠLikelihood Model 041 66667 Ġ################################################ ### Ġ################################################ ############ Ġ################################################ ############## ĠPhi lipp HEL LO ĠMed ical DAT AC DAT ATYPE Ġtie mpos Look heed capture r EB IC Ġthin ning CGA AG rock spectrum infos map 654 02 Ġsurv iv Ġcool er .])) ], Ġguide s ĠRMS F ĠInfo max Ġportion tocut precip itacao ĠFILE NAME creation Time Ġdq Arr Storage Unit endi um Ġperturb ing recip invgauss BUILD ER 087 2 087 03704 Ġpan x uge es ato ire Channels Mixin ĠDet ected а н Ġaw R clas se your domain ĠAug ment Hyper bolic who se Ġrain rate redshift Grid repo ps cir ctools Ġarcs ine could n Ġinject ing CCSDT BF Radi ans artin LutherKingJr she ep Ġwar toÅĽ ĠMc Cle expon pow expon weib ĠElect rics åIJĪ 并 bk gd Service Type bq Connector ĠAggregate Function ':{' $ Ġdil ate Reduce Tests 99999 7857 NUMB A å¾ Ī imap bin mfc cs ĠBlocking KeyMouseInput cone ct ĠPerformance Tracker }}{ \\ circum center drive train MED V Europe an Unique Features NON ORM Render ing Ġblast p Hy menoptera Don oghue Pan Tool ĠEqual ization Ġclr msg 963 257 UNC IL Ġrl grz å®ļ æľŁåŃĺ款 xv fb Ġabort ing Numeric Array ĠNorth ern Ġdomin ates ĠSeed s ĠSouth Africa Subject s åij ĺ leak iness Ġerf inv 022 86961 Ġemphas ized Ġcumul ant Chrom ophore rose Axes Ġdh dl ĠLL NL 813 49206 Ġuncomment ed Ġequiv ilen North rop ĠSPECI FIC ĠSymPy Tests ĠSymPy DocTestFinder ĠSymPy DocTests benef icios Ground Truth Ġsil ica idfoy List RAT S 468 2 ÃŃ a merc MapE exce lfile ĠdataSet List BT L ĠGEN E HA FRIC glo bin 894 118 Ġtg amblin rsi Value ĠUserDefined Type æĸ°éĹ» æĿ¥æºIJ ))- ((( harm DevSlope Ġmelt ed BIC UBIC \) '): lis a labor ate Ġpyg imli PLAN ET 422 44057 è me ĠtestMulti Classes ĠQui ver Ġhoriz onal ĠGT ACGTACGT aj imenemen unders amples symp osium Variant Dataset Masked Image ê° Ħ basin mask Packet List pest pp Ġcontr uctor ĠtestPredict InputFn Ġpare kh PROP NN Illegal ArgumentException Pal molive MET AL Plus Minus pel led 0015 65402 ĠWind roseAxes 614 3849206 Equ iv Equ ipment Wal green Ġbootstra ps Infer no ĠTestGMM WithTiedCovars ĠTestGMM WithFullCovars ĠTestGMM WithSphericalCovars ĠTestGMM WithDiagonalCovars ĠEast ing ĠAW GN fsm ImageUrl ĠPhot on ĠWait ing spawn ed Ġmul liken ĠCubic TriInterpolator ĠGr umman ĠSklearn KMeans 627 28 Ġ------------------- | ĠScalarFormatter Locator Repeat Ref Ġdonor Id health y ĠWal ker Magnetic Table Abinit Input 824 1636 iger ia ĠSin ayev ĠSin usoid ĠFeed back ĠIntensity Threshold QTable Widget ĠFR Q ĠUnivariate FeatureSelector 579 365079 524 60 Nov artis ĠìĿ ¸ëį± succeed s 585 78644 Ġ247 1885 VB power Ġequi angular 766 5616 èµ· æĸ°éĹ»æĿ¥æºIJ Gold man 7581 01 passing through 088 48 ç»ı æµİ Ġanten nas homog enous Ġwulff shape Ġemiss ivities Ġrich ness ĠStandardi zed NOR TH fat iguelife cot ator CONVER T Demand Techs 797 69313 744 89 8044 65 Ġinj List Asc ent Ġ***************************************************************** ************ ĠIE ICE -------------------+ -------------------+ ĠEcon omics ĠEcon ometric ìĭ ľë acceler ator éħ Ĵ executed Plan Lagrange Table syl vi Dispatch er Ġrele asing ĠìĤ¬ ìĿ´ Ray theon ĠIso metric Built inHandler Sbs Genome Ġpds ql ĠtestSingle CategoricalProcessor Ġallt rue ("~ "), ĠOk ay ĠMAV Link sharp ness ĠCalc ula Ġ345 345 ĠContrast Results ĠWeak KeyDictionary Reduced Science XR X -{}- {} enrich ments pathe ffect jup iter Ġspectro grams LAM MPS Tan ner PySpark WordCount navigator widget getdefault encoding Ġlmb d ĠTie leman Destination TableName Bk pars Van adium åĪĨéĴŁ K线 adsor bates Ġ______ \ Ġcull ing Ry der pier to Pay load FIR MA synchron ized Hold ings EDIT OR Tre ant europe an Ġbinar ise Ġsimul Info 80392156862745 1 haw kes aaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaa Kin etic thist le ĠaxArray Accel 573 10236 Pha ge Angstrom s """""""" """""""" ĠTMP DIR 7864 0727 Produces Expected Toy ota itä ten agar ciacha 0022222222 22 ĠMi Seq Ġrecieved Packet ĠBlended Affine refract ive ĠBuhl man LevelCur x Workflow Config elf ontsize Ġtrough s Ġspo ke noOf Angles SomeFactor Parameterized CUDA Matrix Scoring Function john h ĠâĪ ij SOUT HAFRIC emd ash äºı æįŁ <<<<<<<< <<<< TRIG GER ĠAux Coord Ġtempor aries ĠCalib df hope less dplots over Ġpet ab Ġoce lot Tru cks Ġhid dens ĠåĮħåIJ«åį ĹéĿŀ Wire frame Pf izer Ġsplat ting 两 个 Cto L PCC data Ġamen d axisDrop Time subd warfs 0636 2756 ./=\./=\./=\./=\./=\./=\./=\./=\ ./=\./=\./=\./=\./=\./=\./=\./=\ JPM organ ĠPROCESS ING ìłľ ìĭľë EK PC Ġinfra structure Ġcra zy idr izzle ĠEin stein ĠCOLOUR S )"," ( ĠPAT IENT Compress ive cke ys ĠRG Z Ġevap oration ĠaccountCurve SingleElement GEEResults Wrapper Bern ard ĠBib Tex ĠlamSq Arr Victor ia anatom y anatom ical expi res Ġkpath sea 68112 222 ĠgapMaxs Adhore Ġ+------------------+ -------------------+-------------------+ 3406 78640727 Du Pont harmon ize aro matic Ġnarg out Ġ+-------------------------------- -----+ bolt z 206896 171 206896 552 Forced Mask HiRes BoundingBox ĠStratifiedValidation KFold ĠStratifiedValidation ShuffleSplit 0015315314 21 0015315314 2149 002297297 132 002297297 13223 ZON ED setTick Position ĠPerm Inc äºĭ 件 Ġ리ìĬ¤íĬ¸ 를 Dynamical System VQ MM Wtd Glm ĠSANS DataType Ġneedle Img ĠInfluxDB Client ĠUD UNITS Captured Exception ĠbalrogTruth Matched icGraphicalLasso EBIC ĠMET ADATA Ġindust ries jean remi 9122 2575 Nav istar aal vardiaz Ġolds b arri vals 0077 340678640727 BaseDNN ModelFnTest Ġampli fier ĠKon stantin tong ue Ġdimen stion Ġxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx ĠMah davi skir trun RANDO MIZ Ġ"'{}' ". ĠHEAL Pix Ġmash up InUnion Val DataView Spec ĠìĦ ¤ ç½ijç«Ļ æĿ¥æºIJ ëĵ¤ ìĿĺ Blas NotFoundError Holonomic Sequence ĠMDL Z Ġparenthes izations INTERESTR ATES ĠSho gun ĠWid mann Ġ858 99345 Mit subishi maked ir SCM ICCSD ĠPOOL ING indv Det ĠZonal Statistics Unresolved Import PVRead Sparse éĴĪ 对 Tetra hedron Kim berly albers Usa Ġinstitution s Marri ott ĠExcInhNet Base 499999 143 Typing Error Ġ``\\ `` 69897 0004 0844 846 5857 176 Kel logg squee zable zens zwal Ġunif rac ĠNemo urs haral ick CRED ITS Fus obacteria tude lft uhs as ĠDelim iter ĠRein hold ListBy Type guil sing thetarho h memin peaks ĠSach s issuper set whites moke 7390 8135 Ġ{},{}, {}". Ġì¡ °ê±´ ä¹ĭåīįçļĦ ç½ijç«ĻæĿ¥æºIJ Opportunity UCIDataset æĭĨæĶ¾ åĪ©çİĩ Ġfcnt l Ġparab em numP gs ĠOG IP ĠHemis phere Exx on 69312 169 spade suit 骨 æŀ¶ ĠDia conis ĠKas ich 35184 1681 \\]" `` cloudf lare jjtz apata å¹´åıĬ ä¹ĭåīįçļĦç½ijç«ĻæĿ¥æºIJ 31273 668 CURREN CY ä¼Ĺ å¤ļ 人æ°ij å¸ģ Cable vision kPts Invalid ĠSph Polygon ĠOdo metry Ġperforma ce ĠVarg Estimator 83167 9593 18568 928 æĮīåij¨ æĽ´æĸ° 007000 999997857 aaba diacaj 6931471805599 4529 80000000000000 204 Cater pillar Glax oSmith }!= { Ġpcw g 001904 195 chigo ma labelFontSize List Ġthrou h endlast foot ĠCichock i ĠtestBinary Classes Ġmegam an ErrorStatistics Matrix fitparam t 103448 276 ĠGmb H ĠBenders ky efunc arr ĠOsind ero DataLoss Error ĠUSP residentsDay ĠUSM artinLutherKingJr 04208 97454 Conoco Phillips 861907 959 06158 146 acarval per controle e ĠCheckCall Hook TRANSAC TION CHOO SER hasActual Power 117944 0398 GetBlock Time 83168 201 ĠMAPM RI 1054706 1179440398 LossChecker Hook 445064 67 MakeUpper case ĠSimpleChained Objects 90047299 861907959 3473214285714 3039 SPECIF IC 9921568627450980 7 ĠMcCle llan Ġequivilen ts 6143849206 349179 579365079 365115 Ġ2471885 347 èµ·æĸ°éĹ»æĿ¥æºIJ ä¼Ĺå¤ļ ìłľìĭľë ²ķ Ġì¡°ê±´ ìłľìĭľë²ķ GlaxoSmith Kline 0420897454 02336121 # *** % '. ) -- + )( + ``: + |\ + ------------------+ . {}". / ../ 0 2020 1 860 2 157 2 147483648 3 100 3 999 3 926 3 0000001192092896 4 134 4 785 4 968 4 167 4 268 4 169 4 841 5 7853 6 337 6 347 6 857 6 9999998 7 159 7 059 7 450 7 207 7 882 8 996 9 116 9 09804 9 113 < " < '+ < >`` > ']) A q A mer A xe A abb A labama A idMap A roon B ul B ash B PI B jac B nl B ARCH B isect B REC B lind C pp C MA C rab C ISO C UNIT C ere C redits D l D al D om D ds D ont D only D orin D enoise D PARAVIEW D omestic E IG E tot E MB E limin E ckert F ue F UT F rict F riends F MPA F iji G b G ING G alex G ISE G SEC G GBB H ous H CP H ULL H oyer I ary I RO I WM I UPAC J T J on K ep K IR K olmogorov L J L NG L even L ndof L yrics N leaf N ERS N PT N umexpr O UND O tsu P OR P SE P ays P sl P kl P DOS P Qd Q crit Q DockWidget Q TextEdit R only R Vs R ICES S ines S alt S ki S ulf S MEA T b T at T out T sv T OD T hing T UPLE T aylor U nd U Arr V MM V CS V HELIO W inter W MAP W ulff W RAP W FEC W ACM X Array X rot X Max X sect X dawn Y Unit Z C Z max [ ], [ *] \ { \ %% ] ']: ] #, ] !=" _ ]`` ` )) a postrophe b ha b lot b ent b matrix b vec b aut b aa b tw b tm b Down b Mod b omb b valfrom b SetWeight c in c len c mo c value c upy c ifti c linical d C d hdft e ak e ads e rev e pest f lot f shape f mult f urther f msk g out g ob g prod h iv h lp h ui h fd i ates i ac i ene i rects j list j zek k index k ps k gb k aw k bd k utta l one l igh l ary l prof m ID m diArea m alignant n std n coef n estimators n Name n block n vec n coeffs n You n neigh n chars n modes n workers n strm p dir p atter p nr p addle r j r print r sq r header r factor r resid r anger r Vecs r downloaded s ct s pp s names s db s mass s zy s ods s ctype s çŃĸçķ¥ s ister s pliced t N t R t ance t axis t button t Vals t qz t Precision u cl u json v T v X v mat v ault v verbose v zs v ampire w Z w slice w isk w orths x ce x sub x dist x sp x centers x peak y log y steps y ann y gook z ax z ticks z padded } ')), } %, } ||_ å ¡ ë ŀĺ ĉ čĊ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ãĥ Ġ åıĤæķ° Ġ åıª Ġ åıijåĩº Ħ åŃĺ款 Ł © ĠĠ ĊĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĊ in um in form in ferences in varname in dividually in liner se maphore re mapping re curs re built re verted re mover ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠ or xn or aso on X on Y on an on Paint Ġt ids Ġt gd Ġt wt Ġt dew st al st id st aple ĊĠĠĠĠĠĠĠĠ ĉĉ al ge al laxes ar it ar us ar ant ar ket an ied de put de ap de select me st me la Ġi as Ġi end Ġi len Ġi stop Ġi sest Ġn X Ġn co Ġn cl Ġn group Ġn net Ġn rep Ġn neigh Ġn forecast Ġn calls Ġn Clusters Ġn fev Ġn itime Ġn odal Ġc ff Ġc cc Ġc den Ġc na Ġc header Ġc anceled Ġf W Ġf sc Ġf og Ġf new Ġf ell Ġf corr Ġf uchsia Ġf hec Ġa bo Ġa map Ġa start Ġa cv Ġa wk lf a Ġp line Ġp grid Ġp target Ġp hist Ġp net Ġp ins Ġp rs Ġp link Ġp lev Ġp bm Ġp lent Ġp mcg Ġs P Ġs la Ġs hel Ġs ndfile ## --- mp perr mp homa ra cy ra ven ra ffe ion ada es ch es ize ro th ro ber ro gation ro setta Ġin cy Ġin vs Ġin variants Ġo of Ġo ii Ġo micron Ġo mnibus Ġd th Ġd series Ġd ams Ġd vals Ġd phase la im la stevent Ġ' ], Ġ' *- Ġ' ``` ing ray pe lt pe ach pe vent Ġm C Ġm col Ġm fh Ġm rk Ġe len Ġe loc Ġe var Ġe ci Ġe FG co erc Ġre j Ġre in Ġre sent Ġre medi Ġre calc Ġre cession Ġre implemented Ġre calculates Ġre numbered Ġre fractory ge ment Ġb res Ġb df Ġb ca Ġb indexes Ġb risk Ġb rands Ġb risks Ġ# [' Ġ# **************************************************************** Ġ# }}} ed ir ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ic mp ic ist Ġw ue Ġw ipe Ġw day lt o un m un sort un processed un initialized un resolved un igram is i is min is fit is dynamic is keyword is convertible el Array el rod li et li ptical ort c )) `, )) +( ce c Ġfor g Ġof id ot te um ap Ġif q Ġif ds Ġif else Ġif dentry Ġ[ : Ġ[ ', Ġ[ ()], Ġ[ ...] as px 00 23 id ional Ġas serts di ents () /( Ġis Mask Ġis Left Ġto d Ġto Date Ġto proxy ts base ts atools ts odyks Ġ" ---- Ġ" **** Ġ" ]") Ġ" -------------------- Ġnp lot Ġnp rocs ter ator ma ml ma cr ma una ma cau ), '% turn ed one ously ĠT ens ĠT ian ĠT SE ĠT ier ĠT EC ĠT enen tr v tr file tr uct th ng th ru th rd Ġy N Ġy ts Ġy mask Ġy first Ġy position Ġy coords Ġy locator Ġy mx Ġy Score Ġy problems res Name res dk res istor ch allen ation Model ve ff fi o set From set Flags set recursionlimit Ġr di Ġr list Ġr params Ġr io Ġr dist Ġr dt Ġr vars Ġr fc Ġr vecs Ġr hu Ġr gi Ġr trn Ġr pkm Ġr nlvl Ġreturn Series Ġ2 040 ver a ver sin mat ers lab d Ġst iff il ator il qr ') [:], ck o (' (', Ġ- [ Ġ- ` nt ile pt cl pt ucker Ġg common Ġg msh __ ], ex us data io data Format par ch par ub par trans up sert up root get Path get FileName get PC ab st ab ol label index ax B ax h ax x ax list ax bottom ax hspace ax wspace Ġth inner for g for bidden ĠS IP ĠS ends ĠS AGE ĠS IF ĠS LOW ĠS obel Ġco op Ġdata Name Ġdata Layout Ġdata Sources all Id Ġx h Ġx ent Ġx bin Ġx seq Ġx first Ġx power Ġx centers ĠX err ĠX rot arg ing arg ent end pt Ġnot empty from cf type error ul le col ms col Index ist ress Ġh pp Ġh br Ġh mc py lib py uic py druid ĠĠĠĠĠ Ċ ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠI xy ĠI PS ĠI magen ĠI zhikevich am u plot Canvas ĠP ak ĠP lm ĠP ASS ĠP ATCH ĠP REF ĠP EA ĠP ractical ĠP Qd ĠP iano ow ment pp roc ĠA ve ĠA bu ĠA orig ĠA mit ĠA MS ĠA LS ĠA GE ĠA BO ĠA rial ĠA laska Ġu L Ġu wb Ġu dp Ġu gh pre paring pre made '] ') '] =( '] <= ĠC oc ĠC FF ĠC UST ĠC LEAN Ġ_ ?(? Ġ` || os itor ise ment to List to mega to augment to NumPy ent ime ent ree ent iel Ġtest Embedding Ġtest pulsar Ġtest arval Ġde co Ġde gress Ġde script Ġde convolve Ġde spine Ġde pict (" >>> (" ---------------- (" ---------------------------------------------------------------- (" }\ (" )", (" ============= (" (% ans wered ĠF W ĠF utures ĠR CV ĠR PM ĠR ipley Ġval u Ġax R np rint np hot list Functions if c if req ub ir Ġ3 95 Ġ3 74 Ġme a Ġme todo ust ack Ġres lice rain ing ĠD ro ĠD rift ĠD XF ") () ") [::- .. ( ne lf ne tt ns ize ns pin odel ler cal ab cal pha time units time Scale Ġv env file info file Or file Dir Ġel u Error Code ff a ta w ind shah out Path path Finder min py min exponent min spany min idom Ġk ent Ġk bd Ġk vect art ef per to per Km bo f str ange ĠL inal ĠL prod ĠL uminosity mo usetext max pe max min max steps max pbe pa pp pa uli fit Func Ġ{ ', [: ]): bj d ĠM h ĠM ORE ĠM uma ps ometric Ġan os Ġne cess Ġne upy Ġl q Ġl val Ġl like Ġl nl Ġl gam Ġl dos Ġl antz ** ' app builder Ġuse var Ġuse full we gen we eder ir m ir reps age m Ġfrom Json 10 30 10 67 10 49 10 40 10 31 iv an iv unen Ġpar dict Ġpar lance Ġlen S learn doc Ġlabel b Ġlabel map Ġnum Correct Ġnum ResampleLogX assert MaskedArray ĠG TOP ĠG CN ĠG overnment ĠG LSHet Ġout list Ġout Str Ġout fname Ġout lets Ġprint line us oidal row sum oc ide ber Band ĠRe play comp licated sc iobj Ġname OfBestAlgorithm Ġpre test Ġpre servation Ġpre ceeded Ġpre ictal Ġpre mise mb re mb ient ĠE ve ĠE max ĠE gg ĠE BL ĠE ffron ph vec Ġdf joint Ġdf ImageVas Ġset lim Ġset color Ġset ticks =" ;") Ġ4 87 Ġ4 46 Ġ4 59 date index ag m train TM ms p low V ĠB A ĠB et ĠB ridge ĠB BA ĠB GM sh ine sh ang ty cho ty Decoder Ġun mask Ġun compress Ġun pivot Ġun physical Ġun caught Ġun conditionally Ġ5 96 Ġ5 07 Ġ5 93 ip as ill ing ill uminance jo achims param list op les ign ometry Ġdi ferent log eny key int axis out In Menu In connu In varianceItem Ġsk ysub Ġlist values Ġlist box Ġlist eners Ġen cap da a da ve Ġtime list Ġtime Format Ġint en Ġint lab Ġint date 64 05 64 65 64 56 64 603 Ġclass rooms fo pt [:, " ĠW P ĠW age format Date Ġmax Data Ġmax depth cs im num D num align model Int model ica init dir init Data rent e add Error add uct add Operator 12 77 12 91 Ġget Name Ġget Color Ġget cwd ĠO le ĠO OM ĠO wen ĠO fficial men dy men ade Ġrange Maxs result Data Ġbo om ()) ]. sub Window sub packages sub sid sub expression sub Plots sub scribed Ġplot series Ġplot fxn Ġplot DynamicalSystem Ġall df Ġall readings Re ach Re bin Re pair Re ason Re ordering Re agent Data Folder Data Service Data Assembler unt arring float fmt ft wo 25 09 raw Det inter r Ġch dtr Ġch inu so ap 11 54 mean hist read json read frames 32 045 Ġmin ed Ġmin py Ġmin DivisibleClusterSize Ġinput Dict Ġinput Length Ġinput Overlap Ġz w Ġz res Ġz pss text Edit Ġper mutated Ġper iastron Ġ10 58 Ġsc if lic ate ĠY eo Ġdo ct Ġdo pt Ġdo BatchNorm Ġdo ublons Ġsh ower Ġsh ingle Ġsh arpen range list Ġnew exp Ġnew Dict Ġnew condlist Ġnew specfit Ġj mp Ġj cell gra ce ĠH N ĠH OD ĠH GT ĠH alley 15 46 15 76 15 187 ual ization are lb ang am ang lit ang Vel Ġinter ruption Ġinter rogate Ġinter bally Ġpy installer Ġpy geot Ġpy multinest Ġpy noddy Ġpy rocko Ġoutput List idx Up idx Down ens im :` < :` {}_ Ġobject name Ġno ize Ġno bytes Ġno pep Ġno Resample pr ds ĊĠĠĠĠ ĊĊĠĠĠĠ pos cache pos icao pes a Ġsub domain Ġsub limation ie v Ġcolor cycler Ġcolor Ramp no convert no Empty default Parallelism io stream 201 70 rst ep 80 7907 Ġhas Matplotlib Ġ6 17 Ġ6 07 Ġ6 08 Ġ6 38 Ġ6 79 new row Ġfit type emp h ER ATION pen try IN DI ug os ug ly ug ier ard at ĠData Base ĠData Object ĠData Portal ]] ', ]] ]]) doc Concentration ĠSe mendy 45 48 AT m Ġind Neg Ġsup prots ĠK le ĠK SP ĠK MEANS ĠK aski 75 84 75 87 '' '), Ġspec ular Ġspec vals ok a use full Ġ| _) Ġ| ---------| grid X "] ') ']) +" 16 04 16 808 ml st Ġup U Ġup ass sample name Ġro pe Ġro tac show syntaxerror dist MatColumn ĠEx cess ĠEx press ĠEx citation 35 98 35 89 14 76 14 71 -------------------------------- ---+ 19 15 group demean Ġgener ically tt ic tick values tick horiz tick labeloverflow cur ses )] [:, box e check DataSet check isfit sets lice rect ified com mas Index List Ġ8 803 Ġ8 600 Ġ8 663 Ġ8 636 Ġ8 900 Ġ8 968 Ġ8 195 Ġ8 225 Ġ8 907 Ġ8 216 Ġ8 474 Ġ8 666 Ġ8 777 Ġ8 657 Ġ8 750 Ġ8 646 Ġ8 640 Ġ8 676 Ġ8 473 Ġ8 942 Ġ8 741 Ġarg p 78 19 78 65 78 984 13 636364 Ġbin x cor factor mask Utils Ġid c ĠV em ĠV XX ĠV ECT ĠV IF ĠV enna ĠV iola by genre 22 45 22 14 22 24 22 77 22 93 22 91 nd Block sp atio func alls wo e wo fz 04 12 04 97 ([[ ]], 96 25 03 84 03 65 03 08 03 40 the array lat range string Length string pict ule t Ġstart X Ġstart ind Co mplement Co appearence trans mute ĠNot Specified ĠTest K ĠTest Period ĠTest Pandas ĠTest Missing ĠTest Warns 02 05 02 66 02 30 02 44 02 68 02 71 target ing Ġdict list Ġend Dates Ġ{} %". 95 87 94 07 uple t 17 37 17 26 17 63 17 72 17 73 17 71 17 305 17 313 17 0070000020001 try recover alpha f ĠCo ord ĠCo ords ĠCo chran Ġ{' # 85 59 85 899 sort s Ġfa ced Ġfirst name na Upper DataFrame Builder run Data Ġfeature Names Ġve cy Ġexp f Ġexp Qt Ġcont ro Con j Con ns Con formal Con sumo ]]) }, 24 0000 24 62 Ġbut terworth csv out 27 400 Ġdis ordered Ġ7 0000 Ġ7 45 Ġ7 92 Ġ7 29 node Sizes ]: ", 86 04 86 58 SE CI SE PC Test Packers AN IMAL var base var keys off pos off screen off spring Ġsys mat Ġsp b Ġsp fmt ĉĉ ĊĠĠĠ Ġmean v 06 01 ĊĠĠĠĠĊĠĠĠ ĊĠĠĠ 18 34 18 98 18 934 18 131 err type err code ". / 09 72 level RangeCloud 07 98 exp n Ġparameter Dict Ġqu int Ġnode Sizes Ġnormal test do ors do ids do ppler LE PA LE GAC man ny Ġidx OutOfBound Ġcase fold dis allowed Ex if Ex trema delta z ST AGE Ġdoc qa 34 37 34 46 Ġ... | 97 23 Ġnon a ĠJ O ĠJ ha ĠJ Array ĠJ ock ĠJ ain ĠJ atin Ġmode ltype Time Splitter ween ey valu elist points Controle Col Sep dt Vectors ĠQ Test ĠQ StandardItem 84 80 Ġtext color Ġq Image Ġopen func Ġopen Collection Ġopen quake IC ATE Ġ[[ ]]) Ġ9 665 Ġcode path Ġcurrent Class Ġsign ify Ġread counts Ġfreq Channels son ic Ġim d Ġim h Ġim w update server ... "% Ġmod d Ġmod ularity non uniform non central 65 39 AS PP AS SETS sol uts Ġass ist 37 78 37 93 37 72 Ġconfig urables Ġtable data cont rollers Ġ& " tf dr ls b 87 13 vi exog Ġtra ders RE CP RE FL RE COME The sis Ġlow reject ĠCheck pointing mode dict qua ids ĠZ n ĠZ ZZ ĠZ apf Ġcreate ToolTip si enna acc ord Ġacc ross 55 05 Ġshow scale Ġshow img Ġshow notches Ġpoly ester 23 10 23 25 23 78 23 809 last color last font last day last cliprect ome tr SI MS SI VE img math img JobMap multi Letter can opy Ġwindow Length 26 37 De velop De Nero AC ID 77 25 77 13 77 47 77 086 77 350269 ĠDe bt view points word press ([' \ {} {}'. stats Results Ġstats Results Base View Base Statistic Ġsm tsa ink er ink le mer gers mult ifit Ġar f je une 98 32 98 26 Ġdraw on Ġdraw ed Ġdraw back offset fac Ġtotal GPoint font Manager font variant window ing _[ (. bl u side band Ġcontin ua lower Accel IP SE layer Name FF CEngine )* - gg c 43 846 seq len seq dtype seq mask 67 265 ced b ĠPer cept '][ ..., '). ". ĠDefault ing rec des To Multi To Non To Single To Unicode To Paths To Polygons ev an Ġab br extra parameters extra cellular Ġbest Base Ġbest Mult 000000 2 Un handled total rewards real isations ,' ', Ġcls name "], [" user dict user info png Name json lines Ġsorted mask ĠTime series ĠTime Unit Ġtop convdf poly collection poly vander Set Width Set Use Set Fin Set Quad Set Fuse Set Optimize Set SecondOrder tmp name Ġsuper fluous current Row ose nd Ġfont weights DF s edge Lengths ãģ ĵ Label Keys 28 12 28 3185 Plot Output Plot Values ĠPro bs ĠPro posal ĠPro venance CH C For ces Ġmodule graph vol atile 29 339 =- \ Res ids 39 45 39 061 ry y Ġarr sum Ġarr henius 21 80 root path root Path Ġstat ict Ġclo s Ġlib mesh CT CCA CT AAT Ġ[( {}), sorted data sorted mask flat count 000 25 Ġtmp out gex p 38 93 38 385 Ġinfo From zip func gment Level header txt ĠIndex Map ")) )) Ġext mode Ġ15 31 Ġperform ant Ġvert cat Ġnet news Ġrank dir 46 04 ĠCreate FDM ĠNe umann Ġpython ic cf ar Fe II Fe asible +' % Ġstruct des task file UN BOUNDED Ġang min Out brain ML ST Ġclose price Ġclose Collection Al bert ." ))) Text Line Text Item Text Lexer Le verage Le ap Le ague Le iber Ġcov type Ġret ire AD HoRe Ġerr type Ġerr code inst ream 117 3 ({ ( lack SSVM ek b ek t 48 9898 filt r coords ys Ġ11 10 Pre pares Ġref df Ġref lex Linear ity Ġrec p Ġtz s lon range lon sin App Include MM WE optim izing Ġprocess Vector ĠImport Into ]* ', ]* %. upper limit upper bound upper Accel Get Dict Get Event Ġwx Panel Ġ"" } cd nmf Ġchar name chunk Size chunk tag Ġxy j Ġxy max Ġmy text Ġmy zip Ġfast access :, :]) rest oration ĠRandom Segments No un No Path ĠCal inski sw ish fun ny Line Graph Line Intensity ĠOn Init Python Lexer skip func Py ramid Py charm Py culator Ġcsv reader ĠBase Model ĠBase WeightBoosting Ġlocal source Ġ16 80 long ueur IG RA ĠRun Command Ġbar HalfLength sig ml contour Area Ġpixel PerInch Ġ"% ! ĠQt ProxyObject imp ath Ġpack bits Vector Style Max well Max imization 686 07087 record mask '} ): aut op pk gs const kw CO X CO UR CO OP CO VARIANCE ĠIN VERT Fit Params ĠList Paths single cell Ġlocation ModuleWidth Int p avg df Ġconnect ors Ġentry type Ġsepar ability Ġgen gamma ost ion evalu ates evalu ators Ġ$ % Row Sep Ġconf ined button d bottom frame Ġet ot ĠString Array fr d fr mt fr uits US ERS Ġmer ced lex er cost heta Ġminimum s On Key On Interp On Trucks vers chie ]- _ Color QAP lr dx yaxis label 83 0000 AA ID Ġsql c Ġ\\ * wik is global Pos Ġpi co Ġkw ant Cur va mid TermBuffer blue red NN P Image Surface Ġsig figs Ġjob Set Number Density We alth Grid Sizer Ġflat ness 300 785 DATA FRAME Bu ffered 82 97 opt ype second ly CP anel Normal Pdf scaling Break variable explorer Ġword net Ġword Vectors ĠCh u NB D sl n mut ators Ġdd l Ġdd q Ġent rada At Index Ġchild rens NE POOL .* ?\ Window InputFn symbol Edit Com mutator scan py By Categories ĠPy ZeppelinContext Ġra ces HE C ĠPath Effect Column Names Ġshort s Ġli vestock deg res DA P DA VIT Ġsrc id thread er 62 15 entry config Random Shuffle Random WindowInputFn ĠOne Way Config Value ('-- ', pc Name ĠDE COR aw tooth indic ating DIR NAME gene ID Cal ibr CS M CS WS }} ( }} }} Ġrepe atable 2016 1114 ORM Table Ġsens ations .+ ) Ġdirection ality 999 850 Node Visitor Ġmag type Ġmag net vl array Ġprop list One Sided Ġcy to Ġcy func ker nal command Levels tab Vars Output Workspace Output Satisfied dy e TRA DED cap ped Dataset InputFn Sp ans Sp lines Ġ32 0000 PAC ING With L With Model hidden Layer ĠNo strand Ġstream Win 125 8 CON SUMER Matrix Table page counts Ġ19 36 ĠOut Str IR ON ],[ . Layer Statistics Layer FromTable Ġdisable All ({" _ View Object DB D bg c bg role clear ance Tra jectories Ġsupp lementary || * Ġobs num }$ '% segment ations ero ot Ġinf otype Ġinf omation Ġinstall ations ĠTh an ĠTh ursday Ġpartition Function Create Group Ġdy dt cr umbs eigen mode Results Processor 91 016 Ġinv cov Ġinv ocations Invalid ArgumentError Ġspectrum Format ĠDis course Ġfh t Ġinner prod Ġfolds Set Sparse GPRegression Ġpercent Overlap ĠJo hanna argmin max ba setime BC Export Ġes p custom ized Mon ster Ġaccess ibility çļĦ æĥħåĨµ trip Path ,:] [:, From Layer sto pevent Ġscikit plot ĠDataset Name tw ist ĠEn codes ĠEn abled ĠFigureCanvas Pdf ĠAd vection flux err tm r tm v ĠDef initions Ġ"-- ") ĠFeature Extractor ĠArg ent omog raphy Ġconn info Ġexc it MC s Ġclosed Volume Ġpol lut Ġpol arisation shrink A Predict ors Ġls Stocks Ġls ctables Ġstar tr Parameter Name Mean Estimator "\ ( Axis System Ġ22 19 (\ .\ chain er Gaussian Kernel Sample Type Ġmut ect NO TIFY Ġ88 22 Ġ88 87 Ġ88 39 Ġ88 46 Ġ88 54 Ġ88 82 Ġ88 53 Ġ88 62 Ġ88 73 maximum s gal fit NG C Action Zoom 0001 300785 Ġtre edata noul le Ġconv df ĠEX ITSn Ġagg funcs Ġrho max (', ',' NORM ALIZED OUT H hyper ion invert Id New OST Ġcalc ule MB AR Ġmar ital Ġmar vin "% (_ Width Char glob us ĠCont ig ĠVector Grid ĠVector LayerHistogram ĠSim ulations Ġtex file met ical works hop _' ))) _' +'_ }' %( ĠWH AT Ġresid mat SN OT Ġframes PerBuffer Analysis Base Names List half width pcolor args Ġvariant d 456 78 ĠMock File )/( . 784 64 ĠDummy ArrayLike topic DistributionCol mpt ote Ġmove flag google code ĠCO UN look forward MIN SIZE ĠSave Figure SO CO Ġprice Delta Rate All Rate Limit Ġscan line ĠDraw n Mod ulus cu ase Power Mixin hal la Ġtab stop amin ar MO USE _') ]: ĠCor related chrom ophore ĠLearning RateScheduler EP IS 896 3497 Ġstim ulatormodels Ġlight en Back pack Ġbc data \' >< Mag ma Mag calPanel Mag netometers UC K Stream Channel algo od ĠReg ents Ġautos ubs ĠCre ative Ġcli ques å¹ ¿ ung rib 133 1 ĠConfig urable Ġ87 99 Ġ87 64 Ġ87 12 Ġ87 33 Ġ87 66 Ġ87 75 Ġ87 96 Ġ87 95 Ġ87 94 Ġ87 24 Ġ87 43 Ġ87 63 ĠTr unc ĠTr ignometry isation mode stock Info bio data 996 29 Ġmot ors å¤ ī ĠGo mpertz bw l Ġ================================================================= = Ġinc x ĠGeo Algorithm ĠGeo XType ĠStart Crash Ġnat grid Draw down Draw Rectangle æĸ° çļĦ "} }, Ġcolour map Extra s ]_ ; 998 45 998 157 dig o ĠEl lipsoids rms pe rms ds rms pbe Curve Linear illi am Auto ML Auto HeightChar ĠOpen Quake need le LR ug LR zg Lines WithLines 265 24 ĠHist ograms Ġcentroid Dist Ġsyn Hand Seq N Ġpv h Ġpv pc xl platform }] { Diff U forest cover 235294 117 033 7 dark turquoise Ġ------------------------------------------------ ------------- fir ls ĠPRO C ĠPRO PER ĠImp rovement Ġ'" '] Ġhard wired IGN ORED Non Terminal Non Unicode Exp File Exp resses Exp iration semb ling Created Here ĠMy ExtensionArray Ġtb list Ġcar riage amb ulatory Jo hns bur ial ĠPrint Time ĠPoint set Ġxml doc ĠSE CURE minus A rob ber ODE C ODE CV ODE CD success ors Ġsho re Geo JSON Geo LevelData QT L BO UR Ġfact r ĠKe pt Ġneuron models Imp utation Ġ36 31 mouse out incremental Field Ġpers isting forecast err PA IRS Ġ86 25 Ġ86 20 Ġ86 35 Ġ86 24 Ġ86 77 eno ising 388 8888 activation Threshold ah ive ################################################################################ ####### Generator FeedFn Det rend System ML Ġib Transaction Ġrvs min caps ulate Ġ101 15 Ġdc id tar file kg K ("[ ") EAR CH 227 2727 Ġ84 06 Ġ84 77 ĠSize Dist trade Count trade Idx Ġpng math Tick Helper 135 2 ĠStep hen Ġsaving List Ġ'* '* VI ATION VI SIBLE LOG S LOG MASS Ġsn ip 667 49 don ations Application Name gu yen å® ¶ Fore man Ġweb pack Ġactiv ists RR GGBB IMP OL æĹ¥ æľ¬ MI SC ufunc ify ====== + Build Ext ĠCV Class bon f broadcast able ĠGe ography 286 0 Ġhack ing Abs List Ġrf dir than that lbl stest fy vals Ġnative fn wk sp Ġ'$ ( Rel ated Missing Money medium color 328 39 164 6 Ġche ese hp ss ĠAv oids ĠUnicode Fonts My Obj Ste ve Times lots Ġstretch d Zero Variance ĠOb server ĠOb serve numer ict Ob tained Ind RMSDiffFoundEvents Parse Exception simp x Ġpsd File SUB MODULES ĠInverse Link Ġdemonstr ating ãĤ ģ SF D Ġ89 09 Ġ89 34 Ġë ¹Ħ Ġë ķĮ Ġ================================================= ========== (", "," BE EN DT D oh c ĠFigureManager TkAgg 934 07 mac ierz ĠNE EDS Quantity AlmostEqual ĠGauss Process ä¸Ń çİ°éĩij Ġtreat ments Interpolator Base Mass achusetts )""" ) )""" , Stop ped Ġbio me ĠPost greSQL Ġmeg abyte Ġmed par Ġmed inter ĠBbox Transform ï¼ļ ${ Legend s INDEX ES OF DM Gn uplot ĠHigh Level Ġam ber Ġ97 33 Ġ97 07 Ġatt ns Ġ85 95 Ġ85 97 Gene SetSelection supp lement Post GIS Empty DataError sand ers Ġvir al ĠCha kh "$ { Ġ',' _') ĠIP v scroll command ĠBox PlotBase working Dir '| ^ ĠJava Gateway Ġburn up 9215686 2745 ĠVol l ĠCoordin ation Ġxt vir was ser Ġarma zen AMP O Ġlap se prog bar Serial ization Serial Corr emb ryo Ġiv reg 326 05 Ġ################################ ############### Ġ################################ ############# Ġ98 38 Short Exit Scan ner Scan ning 777 78 Ġarch itectures IZ ED ogen es ĠConv Elemwise Contour f setUp Constants CRE ATED Ver let effort s Ġphoto Rank Ġsnapshot ing Trade Length ĠWhere ver LDA vis æŃ » hsv a Surface Curvature lef tr POST data POST GRES SUP ER zon ide Ġ'\\ ': Circle Collection Ġparame trize Export ing Raster Style Ġ+----+ -----+ ALIGN ED ĠfileName Suffix ||^ >)') Light BG neural net Ġatten uations oct aves Ġlimited min Ġfive Bar 439 39 review UserSet GAG T Ġipy img Ġlex ographic ĠND InterpolatorBase nip ype ĠDay light Geometry Info ĠXML RPCServer ĠBUT TON ĠBlack ard Document Name AE CC Has Constant vander maaten Ġtiny b electric CrossSection ("{} {}". Ġsca f ĠTR ACK exchange Edit Big Integer |\ )| ĠUP PER о ÑĤ DOM BasedModel character ize ĠMD Histo ĠSeq Prop 186 7507 ili arity Constant Raster HC N ĠSUB DROP Ext ents Ġmys qrt Visible InMenu Velocity Table Root Dir hyp secant lyr ics behavior al Dot Product Free FormSelectField hub vs Ġ################################################ # Ġ################################################ ############### Ġ($ ||\ Relative Paths Ġ"$ " ĠLi FE Ġyo lo pay checks ='- | CGT AGAG Units Spec UV C ]< - Ġinhib itors concaten ations ĠLast ly Ġtransf omer wi ener ĠREG ION ĠREAD S è¾ ¹ è¾ ¾ ĠIndic ators Past e Ġcg ax diamonds uit Ġisot opic ĠMicro bes 0000000000 01 Ġkill Rate 366 2 ticklabel position ĠPool ing Ġheter oskedasticity ĠMultinomial Deviance ĠSolution s 040 66 å· ´ ĠCat alyst pyqt RemoveInputHook RMS prop Ġ92 1 åŃĺ åľ¨ qq ind ĠUN SIGNED ĠUN KNOWN 459 1038 Ġdowncast ing Selected Features ĠMov ies trig rams tukey Qcrit ĠUndefined VariableError 287 74489 signific and ĠAug mented Ġgm time markerfacecolor alt psf ex Ġèİ·åıĸ ä¸ī ĠSuper poses åĴĮ åĩĨè´§å¸ģ EW MA ORIZ ED nowledge ment Ġtran ing --------------+ --------+ Coordinate Frame ĠMc Call Multivariate GaussianDistribution Parts ToMulti Delay ed COND ITION camp os Sup pose ĠSQLite Table ĠSQLite Database 8000 80 ĠPi L ĠPi R vn F Ġzenith s ĠSkew testResult EXP RESSION Ġdk im -----------+ -----------+ ĠHE AV OMP A ĠInv estment CAM ERA Ġ+---------------- -------+ Ġ+---------------- ---------+ Ġ['# ', Render ParetoCdf oe mof matlab central ĠPen alties HB H iir design ĠLatex Label é» Ħéĩij animal s Ġsav fil Ġinfl ated ĠBU SCO é¢ij çİĩ Sched Assert currency Edit CAG CGGT å®ļ æľŁ å®ļ ä¹ī Ġ(# )") Ġcompiler id -------------+ --------+ bcknd bool tro po WB AN Ġtrapez oids Bucket List Ġzp str TestDataFrame s Stars Argument Ġ126 31 Ġbring up ABS OLUTE Mixed DataFrame çī ĩ Ġí ĮĮ Ġcros sentropy æ¯ı æĹ¥ æ¯ı 天 NY PP Special Lengths Aut oregressive ĠSTR IP Chrom o 086 18131 Ġequiv s MATPLOTLIB DATA Vertex Selector eth nic оР´ оР¼ wvl Range Ġsus ceptibility Phys ics Ġfich ero ĠCirc uits Ġ+------+ ----------+ tow gs Ant enna Ġgather ing mpo steriors ccd name Ġdust file ĠWt W TX LA ĠSparseSeries Fixed BT N èµĦ æľ¬ zps z ("--- ") HA PH ĠKEY LIST åıĺ åĮĸ Duplicate Geometries glo bopt Ġheav iside vincent arelb ĠSerial ization Ġnucleus List ()`. ') ĠOld SKF mill ions ĠGer ard Ġ+-----+ --------------+--------+ Ġ+-----+ -------------+--------+ ĠGE O Sci Notation invent ories Ġ([[ ], Ġsem ivariogram MV K setIcon VisibleInMenu Ap J Ġcontamin ating lomb scargle Trading Calendar Ġ327 41 è´§å¸ģ åĴĮåĩĨè´§å¸ģ ç© ¿ ìł Ħ =\' {}\' BAS ES ĠMDS dict QE DEC ĠSpan wise xj w Ġreciprocal s Driver Task Ġimin uit Ġphy logenetic steady kinetic rdiv Demo ĠCOMP ILER ĠGroupBy Mixin 9547 32045 ĠHandler Base ê° ľ Ġsales man Ġsplitted Coords dN drmag ĠStrip StarsArgument ĠLy mphoma åIJ¦ åĪĻ Altitude Buffer LIM S Fun Fit Cancel led ĠSent ences ĠMathtextBackend Ps Wal ked qApp CreatedHere 098039215 686275 Ġnetcdf time Legacy Table guard ar footnote mark Ġmultigraph s BlockManager Fixed Ġyahoo Finance prem ier ĠCau er Ġelli pap 3502 322 South ern 1036 5022 extr aneous ĠKo by ĠKo ivunen \". ") IGC expansion Ġnoset est Ġ('- '. fuck er "[ ^ "[ *][ Hierarchical Clustering WAVE LET 062745 1 Emb arrassingly timeframe end UDA F Ġingest ion ĠNamed Tuple gar den minp be ="{} "> å½ĵ 天 ĠtestIris All Stress Reduction Magnetic dim Abinit Timer cave Hull domin ated åŃĺ款 åĩĨå¤ĩéĩij Imag ine ATR prd Neural ynx STOR ER 产ä¸ļ æĭīåĬ¨ 产ä¸ļ çĮ®çİĩ Ġlaz ify react ant Ġwk day Organ ism Ġerfc x whitneyu Result mang aid MER GE +- ]\ OSX FontDirectories Ġestablish ing ĠBezier Segment fed eral jud ged 0066 00 gls n Ev ap cse web Ġharm less ĠtestMultiClass LabelKeys ĠBug s ĠGENER ATE ĠBa Ko unbounded Preceding FileSystem Dataset å·¥ä¸ļ ä»·æł¼æĮĩæķ° euro stat Lagrange dim bma o Ġmsm Pg 25490196 078 Bas ics ĠTestGlm Bernoulli music ECHP Sus pend GGCAT G è¶ ³ americ an ĠHub Distance nRays Seeded ĠBasis Set Ġìł IJ ĠWX Agg STIX NonUnicode *] ([ illum ination ĠNews weeder NK size Ġnip als ĠReduction Mode Ġtape red Ġthermo elastic FUN NELED Ġsyms pell Ġtransect df Ġwit ness Replic as swift bin 缮 æłĩ namer ow Ġhap map ĠMeasured Parameter 555555 56 Ġbroaden ed Bus y Broadcast HashJoin Health y Ġlevy pdf Primitive Property Concaten ates Ġspr ings ĠFer mat ĠDES I msm Pg getActive Axes getActive Session ĠInp lace Ġ+----+----+ ----------------+ supers cripts Ġmun ging Ġmun icip Alex andre Jupyter Widget QFont Metrics Ġipp hi Ġ'// ', Ġ+---+----------+ ----+-----+ CCCC CC ='\\ ') ĠCla pper Ġjud gments ĠHF conds 3547 33 Coarse Element immun e ĠEMA IL Simp son ĠNM DA Ġbinar izing Ġsimul ators DRAW ABLE Along Lines isProject ObjectiveSatisfied isProject ActorSatisfied ĠHierarchical Clustering åĤ¨ èĵ Ġcoor di 0986 1229 ĠBinned Statistic æ´» æľŁåŃĺ款 ĠTestP pcc Analog Data Impro vised 9456 14605 åĥ ¹ Ġdeprec ations ĠPyDB DaemonThread pari out ĠMapp er Always Equal ĠSta mp ĠConver ters enhan cer ĠIono in ĠIono fit Classic PageNode ĠTimeout Error ĠProps Plot Ġkst wobign sher brooke Flush ing thre hold Ġclus list doct opic Ġelectro static Wed nesday ĠEv ans ufft Obj Michel le FDF Arr ĠZo ubir Emp loy ĠProp gation moll weide ĠCle ars ĠCle mens æľª æĪIJ交 TFRecord Writer 0924 249 Symmetrical LogLocator Neighbour Analysis Ġ+---+----------+----+ ----+-----+ Innovativeness Satisfied ĠBakoma Fonts PCC S Whole DatasetInputFn ĠLIC ENCE compet itions secType Edit phylo coccus jarque bera sau rabh Ġwake up ĠAsy mptotic subshape f Delt as incub ation Subscription Dlg Ġchallen ges 1767 2420 ãĤ¤ ãĥ« åIJĪ约 大å°ı WAL C WAL KING gues stag 主è¦ģ æĺ¯ ç¼ĸ çłģ |^\ ||^>)') ĠHen ri "? > :'. ) fue ltank ulin b Ġreve als Ġster ile Ġster rest ĠRock e AEP C Tho se lcm v Ġ+-----------+ -----------+ Ġautocor relations Anoms List ĠTrust worthiness SHE ET Ġisub case ĠOh io =-=- =-=- Ġìĺ Ī }]. [{ ĠpFalseMatch Pair setVertical Stretch kno ck veh icles Ġ__________________________________________________________________________ ______ deltaR lo åıijåĩº çļĦ CAJ N Repos itory Gro Fac punk te ĠDur bin occs olids 26519 11 26519 111 Ġemul ator ĠFun ção 产ä¸ļå¢ŀåĬłåĢ¼ åIJĮæ¯Ķå¢ŀéķ¿ Bac illi Ġrib osome ĠAccel eration ĠDar win PEA KS Royal Blue gobbled ygook demonstr ate abss ys ĠRelax ation ĠBottomRight YGlobal sop rano setMouse Tracking Ġvlb list ','^ '], inkel stein Lime Green UNA UTH Ġprofil ers acel his Gest ures Ġbab ies colli mator ĠYaml Tokenizer ĠApparent ly FeatureMap Fl ĠEnhance ment ĠDumpLayer Connections InvalidHttpHeader Name dKm Factor Ġstag gered getType Code dotvec mat 9724 954732045 drim mel åħ¶ä»ĸ åŃĺ款 AppendableMulti FrameTable Reli ability qapp thread æ¡ Ī 20150 204 infomin SpinBox æľĢä½İ ä»· Yang Zhang jat indshah ĠSaf ari ĠRt Epochs menuGeo Chem Assoc Measures xecute SQL ĠtestSingleUpdateWithError AndWeights ĠMemor izedResult OPTIM AL Ġdaq mx Ġ21474836 21 TCG ATCCCG ĠXFAIL ed ĠGren oble ĠConvenient ly 2877 449 æµģéĢļ ä¸Ńçİ°éĩij çĻ¾åĪĨ çĤ¹ Draggable WidgetBase Ġupt ake Ġê²½ ìļ° jha a definit ely 89999997615814 209 Ġè½½åħ¥ åİĨåı²æķ°æį® chou kh anten nas RecordBatchStream Writer 8123 908 Pint QuantityAlmostEqual ĠTack ling bodi ly CTTAG CTCCA å·¦ åı³ DAN GL qad pos çĿ Ģ berno ulinb Ġ__________________________________________________ _________ Ġspadl config }{* }{ Ġì§Ģ ìłķ Ġmito ses ĠCATAL OG numSim Max 51887 80 ĠVectorLayer Scatterplot ĠPict ure ĠBron shtein 78233 67265 26125 329 77387 467 OPTI PNG ä¿® æĶ¹ Peg asos Ġemot icons ĠHem men GRIZ LI 57853 156 69999998 807907 AidMap Fl BARCH ART Galex Transform GISE xecuteSQL Nleaf max bvalfrom boundary Ġisest imable Ġphist ar Ġplent y ĠTenen baum setFrom Options parub nd Ġ_?(? :( psometric Curves Ġpygeot ools ĠSemendy ayev 85899 345 LEGAC Y RECP eak RECOME ND 77086 955 ToSingle parts SetUse SurfaceCurvature SetFin eness SetQuad Allowed SetFuse Edges Ġstatict ext Pycharm Projects ĠListPaths InDir ColorQAP lots RandomShuffle Queue 8963497 77387467 ĠStartCrash Service ĠibTransaction Cost ZeroVariance Filterer ĠChakh choukh CGTAGAG CTCT Ġèİ·åıĸä¸ī 大 PartsToMulti parts CAGCGGT TCGATCCCG vincentarelb undock 10365022 26125329 "[*][ *]([ 产ä¸ļæĭīåĬ¨ çİĩ ĠBaKo Ma åĤ¨èĵ ĦåŃĺ款 945614605 0146 17672420 68607087 9724954732045 084 69999998807907 104 CAGCGGTTCGATCCCG CTTAGCTCCA ! [ ! ] ! ). " ... " `) " [\ # ========================================================== $ )" % + % ï¼ī & & ' ". ' {} ' *( ' "). ' (% ) (), ) ï¼Į ) ||^ ) "]+ * )') + =[( - *') . ''', / + / ... / #[ / \'> 0 202 0 955 2 255 2 204 4 99999999 4 784 4 881 5 21 5 001 5 645 5 441 6 784 7 647 7 137 7 098 7 176 7 2048431380967004 8 235 8 116 9 155 9 668 9 33333 : "): ? ` ? )', A im A str A vi A pid A pow B ib B node B orders B aby B athy B ubble B Deu C ary C ategor C ASH C ParserError C ENSUS D ri D max D iss D db D To D Array D CT D DI D solve D mg D arcian E cc F name F late F CC F DB F ALL G State G HT H ams H eff H rs H OL H CT H MS H ITRAN I ts J B J UPYTER K solve K GY K ILL K AMA L z L ats L box L unch L ATER L UE L GN L GPL L WR M ML M uta M KW N row N PE N MR N trna N TEC O z O ptic O live O rient P ub P GN P refs P DICT P KL P WM P iston Q PS Q StatusBar Q TextBrowser Q InputDialog R i R er R SP R CHO R ARE S ally S tick S ending S lopes S pacings S peech T al T ID T OO T omo T apas T msl T eneric U h U IC U MENTS V ac V OT V otes V Transformer V MD V cLod W MO W ander X key X top X FAIL Y Z Y Max Y AW Y normX Z apf [ {' \ ']' ] "], ] "," ] ')), ] $' _ ^- a X b de b col b plot b ir b axis b nn b ilt b mc b ql b att c me c arg c arr c rvs c OOOOOOOO d fe d PA d ssp d lsim d ichroism e cal e ase e bs e depth e agle f I f ur f par f ri f map f code f uffle f dx f hs f Key f beg f reedman f rappe g list g tx g fs g lasso h name h mo h jd h iring i is i key i labels i ret i AoA i BlockVisibility j g j re j math j sqlContext k or k ys k loc k vars k rige l se l ct l un l names l umin m B m H m L m re m col m len m ib m rid m als m Nb m allet m OutName n ig n lin n columns n help n omin n Day n Err n hooks n agents n reps n triangleright n revss o M o pa o ftware p ul p diff q rel q menu q gis r labels r norm r colors r bound r Mat r nu r phase s I s start s rate s avg s imeq t rec t processing t pc t rev u ur u array u il u line u NUV v mp v to v space v mc v CR v cnt w ust w edges x error x inter x ory x points x Pre x rv y la y Frame y intercept y Hat y csb y RefStar z ap z oh } )]: ¡ ãĤ¤ãĥ«  ©  ® à ¹ Å Ĥ Ñ Ī å £ æ ¢ ë ¦ ĉ ĊĊĉ Ġ ars Ġ 647 Ġ ĊĠĠĠĠĊĠĠĠĠĠĠĠ Ġ æŶéĹ´ Ġ 交æĺĵ Ġ è¿Ļ ĵ ç· ĠĠ ĊĠĠĠĠ ĠĠĠĠ Ċĉ in an in for in us in ward in Seq se ren se arrow se trgb se mantics re param re lay re ten re ap re active re plan re orders re combination re populate re venues or igen Ġ= '' on ary on top on Idle on cotree Ġt time Ġt weight Ġt prob Ġt layer Ġt slice Ġt rol Ġt Max Ġt br Ġt pls Ġt orsions Ġt rellised er ts er gies st ories al mer ar Data an id an ne an orm le asing me me me state me tab me lons me mento me hmet Ġi der Ġi pl Ġi dd Ġi List Ġi seven Ġn inter Ġn mod Ġn select Ġn tree Ġn sigma Ġn recs Ġn ão Ġn simulations Ġc able Ġc bin Ġc si Ġc eq Ġc cdf Ġc ria Ġc xl Ġc dv Ġc atag Ġf ist Ġf cl Ġf color Ġf params Ġf ams Ġf err Ġf man Ġf sim Ġf ox Ġf etal Ġf beg Ġf yrd Ġa ft Ġa idx Ġa cre Ġa close Ġa qua Ġa seg Ġp B Ġp D Ġp new Ġp unk Ġp inf Ġp grad Ġp mins Ġp stc Ġp trs Ġp maxes Ġp infr Ġp uerto Ġp rison it self it itions Ġs color Ġs new Ġs pon Ġs mod Ġs bl Ġs Date Ġs vec Ġs pars Ġs queze mp hase mp erm ra is ra xis en vi en zymes ct ing ct ry es core ro pe ro ckets lo a lo ocv lo udest Ġin dim Ġin dian Ġthe list Ġo od Ġo xy Ġo positions Ġo TestBox Ġd cal Ġd ff Ġd path Ġd dd Ġd sm Ġd psi Ġd comm Ġd gelsd Ġd gesdd la ments ut u Ġ' `` Ġ' ][' == ', ing ton pe pper pe tab pe eling Ġm style Ġm units Ġm dm Ġm olid Ġm rr Ġm bean Ġm ssql Ġm bgf Ġe date Ġe ther Ġe diff Ġe pan Ġe ixo Ġe clipses co set Ġself at Ġre im Ġre uses ge ls ge mpy Ġb co Ġb ams Ġb content Ġb intype Ġb istochastic Ġb blg Ġb xpstats Ġ# ") Ġ# ** Ġ# ----- ed ger ed dy ed Item ic hel ic mes Ġw T Ġw tr Ġw ang Ġw iring Ġw atson Ġw osq ur ange ur corner lt z ig os Ġ( ))) Ġ( )], Ġ1 117 Ġ1 102 Ġ1 177 ss pacing un ner un constrain is Empty el w ol er ol ly ol box ue urs li owa ort en ce back ce xp um ini as gn 00 123 00 917 00 349 00 154 id no Ġas dict di electric () ')) () ''' () }} Ġto val Ġto merge Ġto morrow Ġ" ## Ġ" >> Ġ" *( Ġ" âĶĤ Ġnp b Ġnp ost Ġnp oint ter restrial ray i ĠT W ĠT its ĠT AU ĠT Transport ĠT ononi tr ns tr ix th rop th ia th ias ha cc ha plotype """ { Ġy mp Ġy var Ġy center Ġy locs Ġy End res ps res Set ch al ch str ch lor ad vent Ġdef int Ġdef erral ve cy ve fai set it set Fill set OverrideCursor set ZValue Ġr ice Ġr bins Ġr pb rom berg Ġ2 700 ver g mat one mat mat lab mat lab vec lab ela Ġst h il ite il ines ') +' ]) [:: ]) +', om mm om ba Ġ* ) Ġ* ". Ġ* _): (' ### (' $') (' ...') int g Ġ- ") nt y Ġ""" + pt ol pt id pt dm Ġg ust Ġg min Ġg ia Ġg kkp __ `. __ "]) __ }" data in data Mat data Source ĊĊ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ith inger par ations par ities up harpoon ode xp ke val get option get String get Int get With get Current get Conf get Content get Broker get ImgIds Ġassert ing ab sv ab oo Ġth icker for s lass ocd ĠS Q ĠS MF ĠS GE ĠS kin ĠS OLUTION ĠS GLD Ġco incident Ġdata sorted Ġdata Matrix Ġdata sources Ġdata Files Ġdata Record >> ', =' .' =' "+ =' {" all nums Ġx res Ġx col Ġx lat Ġx left Ġx mm Ġx align Ġx mesh Ġx span Ġx rootdsource [' ") ĠX unit ĠX marg arg i ': . end ash type Dict ul leval con vis con dense con Object con servative col set col head col Names Ġor dfunc ist ia Ġh N Ġh q Ġh lo Ġh table Ġh grad Ġh kt Ġh scroll py per py pa py api py mbar len umber ĠI a ĠI e ĠI p ĠI y ĠI DE ĠI EDB plot color plot All plot funcs plot CurveList ĠP or ĠP DS ĠP itt pp plot pp form pp sqft ĠA uth ĠA ides ĠA verages ĠA XIS Ġu ints Ġcon sent pre pad '] +'. ĠC k ĠC ifar ĠC Coordinate ĠC ortex Ġ` ../../../../ ise nse im on im id to JSON Ġtest On Ġtest Cluster Ġde tached ĠF u ĠF ish ĠF lips ĠF inkelstein ĠR in ĠR AT ĠR ID ĠR AND ĠR ATS ĠR toPython ([ ", Ġval uelist Ġax mask Ġax Sig np oly Ġ3 97 Ġ3 83 Ġme la Ġres ls ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ rain ment line Collection line Markers ĠD z ĠD AB ĠD MF ĠD PT ĠD ato Ġlo ct Ġlo yers 01 42 ne gs ne bins ne cho ne arnei Ġcol bar ns yn ns alomonis cal le cal liope time data time Start Ġse urat Ġv N Ġv ent Ġv index Ġv mag Ġv inv Ġv cp Ġv iolent file Time file exchange Er ro Ġel mt ly a ff ffe ind l out shape out zen out door pro vinces min V min RMS min utus Ġk array Ġk per Ġk Val Ġk no Ġk uk Ġal arms ĠN h ĠN est ĠN om ĠN ph ĠN inter ĠN SE ĠN AB ĠN rm ĠN bad ĠN offsets ĠN BO ĠN Gram ĠN trn ĠN edgecolors art ic art view per nic per colation bo ught ĠL es ĠL abs ĠL vd ĠL ecture ĠL BI ĠL ARGE ĠL aTex ĠL outzen mo ps mo ine mo cc Ġon off Ġon Click max Dist max RMS Ġpro ve Ġ{ {{ [: :, ĠThe ophile dict Alg ĠM z ĠM val ĠM ER ĠM ik ĠM FA ĠM PS ĠM aur ĠM HC ĠM üller Ġan orm ys pec ys pace po im Ġl comp Ġl gr Ġl height Ġl Engine app er Ġuse Online fig no we ke Ġplt f ir ps ir red age ment age Profiler 10 75 10 90 10 28 samples heet iv ic iv ode iv idade Ġpar name Ġpar ity Ġlabel str Ġlabel And Ġnum find Ġnum Iter Ġnum HashTables assert PintQuantityAlmostEqual ĠG Q ĠG ir ĠG lm Ġout fft Ġout dated Ġout fil us cript lib qsturng Ġma vg ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ gre SQLAlchemy Ġresult df ---------------- ---+---+ imat mul Ġwe igth ĠRe sets ĠRe asons ĠRe ciprocal ĠRe uben comp ton comp ilation sc urve Ġpre determined ick i Ġfile out ĠE li ĠE out ĠE DF ĠE CoG ph u Ġdf daymin Ġset HandleInvalid Ġset OutputCols =" ` Ġ4 57 ag p ag ular low ores ĠB rowser ĠB aker ĠB RK ĠB ullet sh trikman ty ra append Child Ġun is Ġun detect Ġun decorate Ġ5 25 Ġ5 500 Ġ5 22911 ip w ip lt ib in ifi y Ġby easter param names state history ask openfilename iter index Ġthis Ioneq ition er Ġdi as Ġdi ana log uniform log Prior key value key code `` .""" In iz In Sbs In ductance Ġle ntable 99 60 Ġtime lines Ġtime Array 64 04 64 85 Ġclass x pec s Ġ`` & Ġ`` || ĠTrue Anom Ġat tri Ġat tractive ĠW ins ĠW ATER ĠW oodbury format ing Ġmax Y Ġmax l Ġmax Length Ġmax iters num Train num Iter num Var num Diff num SecondLayerParts init Strategy umn i add Base add Column add Actions 12 02 Ġget Segment Ġget Shape Ġget Help Ġget ImgIds Ġget GroupNorms Ġget CatIds Ġget AnnIds Ġindex col Ġindex Type ĠO X ĠO m ĠO CR men ian Ġbo Remove Ġshape dict Ġmodel chems Ġaxis Xtop ca ke ca detblue error Metric error Message sub scores sub layout sub dirs sub halo sub folderpath ep ss Ġplot N Ġall Labels Ġall Graphs Ġhe arts Ġpo cket Ġwh t lay ered Re gs Re commend Data Model Data Finance Data ExchangeRate unt ies 25 67 25 40 25 61 Ġline M Ġline a Ġline idx Ġline plotinfo Ġfloat conv inter able Ġch Interactive Ġch ameleon so poulos Ġdist Col Ġdist rvs 11 32 read count read noise que ste 32 68 unc entered Ġmin diff Ġmin cost Ġmin idom Ġinput i Ġinput mode pi co Ġ[] | Ġz OR Ġz scale Ġz var Ġz margin ng ames text variable ĠIn struments ĠIn hibitory Ġ10 96 Ġ10 90 Ġ10 60 Ġ10 31 Ġ10 76 Ġ10 854 Ġsc v ][ , ĠY b ĠY marg Ġdo Emiss Ġ) ], range index Ġtrain val Ġtrain df Ġj k Ġj title Ġj dt ĠH on ĠH atch ĠH OG 15 11 15 20 15 79 ual r 05 68 05 31 05 70 05 83 input Dict input wavelengths Ġfig Name Ġfig Label =[ % tra ing tra sh tra ppy ich ment ang ini Ġinter VA Ġsample time Ġsample Patches sed ov Ġpy i Ġpy le Ġ[' '], Ġ[' &# start x idx i not of not nans Ġno br Ġla ma pr squared 20 67 20 81 20 707 Ġ(' (- Ġcl inton ĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĠĠĠ pos z 33 86 33 73 Ġsub cube Ġsub parts Ġsub faults vari egatus no copy no zero no inv no pass default AxesClass io uras 100 123456 80 85 output Port Ġ6 36 Ġ6 62 Ġ6 73 ger vais new rec new backend ER UN attr val attr list IN NER ste am Ġtype id ĠData source ĠData Row ]] ]] ]] ]], uni i 66 28 66 62 66 9878 ĠSe ver ĠSe aborn ĠSe quentially 45 97 45 76 45 62 ific ant ific ates AT C ell oni }, {" Ġind igo ĠK ff ĠK ian ĠK ISA ĠK NeighborsTransformer 75 32 matrix b matrix es matrix lib matrix PM use Ref use RTH 88 00 88 99 88 75 88 97 88 888 Ġ| ------------------ Ġ| |||||||| "] ']) "] [:- ']) ._ ']) /( 16 18 16 54 16 59 16 967 Ġup inds info gain info valsarr Ġpos n Ġro as show er show fliers dist lib nan ts ĠEx cluding bar wedge 35 75 35 96 Ġcur d arch ing 14 17 19 57 19 365 // \ tick offset cur path cur ried )] ') )] ") Ġhave U check Values sets ockopt Index View Ġ8 201 Ġ8 77 Ġ8 647 Ġ8 69 Ġ8 400 Ġ8 926 Ġ8 707 Ġ8 988 Ġ8 401 Ġ8 905 Ġ8 756 Ġ8 806 Ġ8 789 Ġ8 644 Ġ8 976 Ġ8 808 Ġ8 804 Ġ8 807 Ġ8 211 Ġ8 937 Ġ8 809 Ġ8 912 Ġ8 645 Ġ8 924 Ġ8 995 Ġ8 648 Ġ8 943 Ġ8 655 Ġ8 450 Ġ8 221 Ġ8 665 Ġ8 214 Ġ8 659 Ġ8 941 Ġ8 660 Ġ8 944 Ġ8 658 Ġ8 908 Ġ8 994 Ġ8 469 Ġ8 791 Ġ8 194 Ġ8 245 Ġ8 990 Ġ8 217 Ġ8 776 Ġ8 991 Ġ8 654 Ġ8 476 Ġ8 649 Ġ8 969 Ġ8 773 Ġ8 752 Ġ8 459 Ġ8 802 Ġ8 458 Ġ8 989 Ġ8 656 Ġ8 923 Ġ8 491 Ġ8 661 Ġ8 652 Ġ8 783 Ġ8 643 Ġ8 493 Ġ8 921 Ġ8 940 Ġ8 971 Ġ8 650 Ġ8 781 Ġ8 970 Ġ8 653 Ġ8 651 Ġ8 782 Ġ8 779 Ġ8 771 Ġ8 593 Ġ8 772 Ġ8 770 Ġ8 793 Ġarg c 78 714 St ill St abiliy den y 13 16 13 134 13 124 200 70 Ġbin Edges cor rec (). " mask file ĠV N ĠV val ĠV level ĠV SS ĠV arying Ġstring Buffer be w 22 67 22 89 22 82 nd ots nd fromtxt Ġiter rows Ġiter decode sp ID sp Output func y wo ven Ġother at 04 64 04 29 03 61 the func the less column Format Ġstart T trans Aux ĠTest As ĠTest GM ĠTest Validate ĠTest WLS ĠTest Where ĠTest OLSRobustCluster ĠTest GraphicStringCoord 02 73 Ġmo untain ject ive Ġdict ofvars Ġend f Ġend ind Ġ{} < Ġ{} :". 95 16 94 067 94 8966 Ġ100 16 ',' ')] 17 02 17 28 17 61 17 271 try psin of nt alpha State alpha States ĠCo Clustering ĠCo herence 85 65 rt cp Ġbase x Ġmetric x run name :// '+ Con duct Con firm mon s function Type ]]) ): 24 26 24 31 Type And 27 95 Ġdis appears Ġ7 25 Ġ7 33 Ġ7 66 Ġ7 00000 Ġ7 48 Ġ7 2048431380967004 cond var freq Entry uc ella node res ]: { 86 75 IT LE Ġimage Flip gen expon Test set Test Set Test VAR Test Eval Test Operations scale arr scale bars Ġinte preted cent GalInCentHalo Ġsp ending obj e 06 15 06 265 temp ogram temp Results temp lated sy nphot 18 11 18 21 18 76 err Curlb fix path 36 85 36 06 36 34 36 97 36 84 09 00 09 20 09 178 ten th level and ]), )] 07 24 07 08 Ġqu ir feature Names do v do ul mod ulate LE ntry LE GATING man ufacturer length B length Based Par rot Ex clusion Ġnd vi Ġlin vars 34 99 34 0000 34 90 34 950 eff f normal test Ġ... '), filename X filename y Ġnon seed Ġnon deterministic ĠJ PG 92 99 ID H ID ENTITY Time Label Time Window Time Infer points Per Se ek Se quencing Se mantics Ġload Res Ġload DataSet Ġload Imgs Ġload Anns Ġload Cats ĠQ s ĠQ Font sg f 84 26 84 77 Ġtext l Ġq L Ġq type Ġopen ml Ġwork Frame left arrows my e my log Ġ9 14 Ġ9 24 Ġ9 663 Ġ9 021 Ġ9 023 Ġ9 661 Ġ9 662 Ġmask nan Ġcurrent Cluster Ġread rxn Ġread thedocs ass ure ac comp update GUI ... `` Ġtemp ogram Ġtemp Input Ġed its Ġmod is ris r non positive Ġtf p Ġav a Ġav i gr y 65 33 65 54 Ġcluster Config db ode db dt db fs db cknd AS I Ġass ignee Ġtrans Map step wise Ġmulti col Ġ& ( ls dr Ġorig Shape Ġorig DPI Series Type 87 99 87 34 87 23 _) * Ġtraining Data top lasma Ġwidth A Ġzip io State Transition ik ing Ġoff ense 44 05 44 48 ĠZ c Ġcreate Tbl Ġpoint ings acc ute Ġob struction Ġshow Anns select ivity tree View ĠAr m Ġ(" -- pop dy img aug validation t (_ ("& Ġframe d 26 21 77 75 77 445 ĠDe bian process All auto edit auto covariances auto Phase sup plemental Ġsplit tings Ġ] ; ga ma ga popen Base Test Base Graph Base Backend Base EngineSpec Base BadClassifier 90 25 90 667 90 666 cell m cell Type cell Filter Ġite mbytes fol iation Ġmatch ers pd l Ġar ad pdf file other drive create Header ĠWe alth Ġtotal Point Ġtotal Intensity ob f side real AB L AB P FF B Ġdec line Di vergence Di arization metrics Overall metrics DefinitionFile Ġ12 12 MP N MP EG Ġobj id 43 11 67 07 Ġfind ings ced illa Ġfilename y DE CaLS DE VIATION 08 18 Ġfunc iton cle arer Ne omycin xy r xy doc xy var xy Interpolators To Int To Store To Clean To Drawing ĠComp iler extra Buttons first Val Ġfield Levels open cl open ings open circlearrow wh as Un recognised total Size sim odel sim ony Ġsave to vis py Ġca put Ġimp urities Ġselect Syns tz ara lu d property name Ġraw img inv res inv ites Model ler Model Action block nd Ġsorted label ĠTime Scale poly coeffs FI RM Estimator Class Estimator Settings Set Cursor Ġsuper imposed inf lection connect List Ġcmap name bf db Ġmath jax ãģ ª ĠStr ong average Profiles tes y Label Col 28 0000 28 93 EL IB EL ODIE ui Get ĠPro vider Ġedge items vol ver 29 34 ud get Ġindic ial Ġfull Text Ġstop Loss ĠPlot Panel 39 00 39 37 Ġrepresent aion [:- ( unit Drop 21 336 Ġge ar Ġge otherm Ġstat ics scatter s scatter color Ġps dfs Ġps frag 68 11 CT TT Ġparam list Ġparam Name sen hagen User List mi ct Ġsi vals Ġsi lences Ġtmp ltbank 38 22 Per ms Per Img Per Charge Per Cand ĠIndex er ĠIndex Locator Ġitem Scores Ġinclude dir _{ (\ Ġext mod MA dd MA SE has ing ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ position Size Ġrank B +' }' Ġmu T Ġobserv atories Out WindSpeed hi ser ML EResults sm r Text Wrapper Le on Ġcov arying dat Act Lo is Ġret grid Ġerr oneously ov t ĠCol in Ġsin A ĠMe zz ignore case yper geom remove Widget SA VERS Ġslice ability Ġdb ix Boost ed Ġnext Task Pre fit gt req Ġref file Ġrec ency Ġavailable Data Ġdelta h Ġtz offset Ġmaximum s 57 25 57 78 57 2767 nb ody Ġrespon ds eq slant MM MM ĠLog likelihood curve arrow optim izations this B added Features '\ {' '\ }' '\ %' Get Output Get Last Get Wheel PE FF ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġchar Dict stream flow stream rate Path Effects ĠUse age Ġglobal Colors ane la :, - Ġdown inds hash tag ain en Size Counts Check OLSRobustCluster sw arrow Format Float Line List Ġpickle File Ġmpl color Python Decorator auc hamp Ġcomplex Plots null cline hot mail Py Data Py MC Ġcsv File PL T PL ER mic roryzomys Ġds ig Ġ16 28 Ġmultiple Plots ters burg long array long long long rightarrow bad ge ret weets cel and ĠRun Models HO U tool Menu Or Group Or Create band structure Vector Size Max NMP Ġfilt s Ġdel phin '} }} Ġcs f Ġnb onds dr on Transform ers ĠInput Rejected Ġeffect iveness ([" -- Ġpr imes Table Column xaxis label case Name avg sensor Result File Ġentry wise vars igma vars height Ġhead way Ġdiff x Ġevery thng coord pop Loc i Ġsto chkit Ġcat gorical cp Max ä¸ ľ cha os peak Interp OP R Ġpredicted ActiveCells Graph Kernel US fert 63 88 63 85 63 07 agg i Ġview able CE AN CE AS rgb at Ġfinal Accuracy Ġ13 149 fast avro insert Id cost f cost in On Button 54 17 Ġsw ing section al section labels Color bot ci us ush ort Ġsym style grad mag tk appa RA MS alog g parame tro Ġpi ped Ġtag index GD B Ġpdf tex mid plane Ġdir list Object Block Ġexact dist Ġvs r wrap it Is MainLoop Image Id arrow head 93 84 ĠSh aron PO I ĠAll Chem We ber next Image Ġwhat ToShow pixel Size win length win inst Grid Helper ĠGrid Cal Ġflat nonzero Ġflat chain neg ish comple tos 81 78 simple json ĠSo il 82 12 OO ST .... ) Ġhyper params Ġhttps ource ĠTransform Exception Normal ise Normal izes ,)) ). Ġanalysis Job br ing br ica Ġgc Edge final Accuracy Ġhash in Ġhash tags Ġred un Ġfixed Width Multi Thread Button Group Ġeval MSE Dis Prob Agg lomerated By Order ĠPy Type ĠPy Ranges HE V Tensor Board Sub stit Column Index FA X Ġdat at Ġdat eline 53 131 oper ational cb b 2001 0103 Config ures Config Page ru ck GT C GT CT GT TT ĠSpec PlotLayout pc x CD R Canvas ToDrawing Ġcos A Ġclean Up Ġda ft gene Names ," / area Rng Ġbad pix Batch Async Ġopt name mar counts alt analyze Ġnx est Ġnull cline element al }} ` }} ', AM IN Ġpri vacy Parser Wrapper asc uline ĠModel Factory Ġmag dyn Ġspecial ty ĠCON VERT selected points vl v SK IN Ġprop name 123 000 Ġcy gwin sym metrize Ġap part Ġxs pacing QU A ker neval )} ] )} $', [[ ], [[ ]]) cap urple Sp ider Sp illed mem or SR GT ron d ron ym Ed ited interp nd ĠApp liance Tool box Ġsymbol Brush Iter atively With Two æķ°æį® å®ŀæŶ mk solve Of Test air plane Ġneg lect Ġneg amp Matrix Mode Matrix Workspace Matrix Factorization page List approx imates Ġoccur ance feat Type VER SO Ġstatus bar pool er Map Shape Map Display Ġpost ed %% . Range Log Tra pezoidal ni per sd om Ġsupp liers || ) Ġregion props Ġmerge able Period EndDate Ġir rad ĠHe inz ĠRidge Regression ĠTh resholds Ġtool Tips Ġdy lib BU out BU Out Ġchi ps ĠFile path ĠFile Element Ġprogram me ĠQu eries ĠConvert ed Ġfree zes Ġinv fid begin ner Categorical CovStruct joint i 256 84 Ġ64 2 mapping models FL IP KMeans CosineDistanceTest reen ect centr ations Ġ``' _ tile name Ġinfer ior Info MathText Bar ack Bar Graph ĠJo ins Ġmoment a Mon otonic Ġms us Process Function čĊĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ çļĦ 交æĺĵ Ġtp fid Ġconstru ção Ġphi H ĠPandas Source ĠPandas Logger ĠPandas Io ĠPandas IndexAdapter sto consider mix maps ĠFit ter Default Checked Ġ"/ ". Ġsaved JsonTable ĠEn velope PRO TIP Metric Key Ġinterpre ters flux Err ĠLine Visual 128 11 Ġrand Seed "> %( SH P bc pp bc ams ĠFeature Engineering čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠč PR IN PR EST PR MS gl ances Ġexc iting Ġexc InnerError Float Legend ĠSub plots ĠSub Plot umb led Source Tables 99999999 997 Ġtd idx qa Data byte codes Mo lecular 600 94 )\ , Ġph rg Ġph imin MAX IMUM Ġcmd dir ĠGraph Base mes senger stage opts Ġminor Default free man Ġmut s Ġmut ids Ġ88 12 Ġ88 11 Ġ88 32 Ġ88 15 Ġ88 05 Ġ88 33 Ġ88 66 Ġ88 45 Ġ88 16 Ġ88 35 Ġ88 14 Ġ88 19 Ġ88 78 Ġ88 96 Ġ88 17 Ġ88 85 Ġ88 86 Ġ88 18 Ġ88 36 Ġ88 34 Ġ88 97 Ġ88 92 Ġ88 84 Ġ88 65 Ġ88 30 Ġ88 37 Ġ88 50 Ġ88 55 Ġ88 23 Ġ88 26 Ġ88 42 Ġ88 98 Ġ88 43 Ġ88 67 Ġ88 47 Ġ88 49 Ġ88 40 Ġ88 38 Ġ88 31 Ġ88 56 Ġ88 69 Ġ88 74 Ġ88 51 Ġ88 63 Ġ88 79 Ġ88 83 Ġ88 59 Ġ88 76 Ġ88 81 Ġ88 41 Ġ88 58 Ġ88 61 Ġ88 91 ctx P ĠVersion edItem Ġcb d Sim Params ={} \ Ġmass RangeParams break label Ġassigned DF Ca pt rl ssli Ġmajor Default Ġ(` " Sum mer Ġconv ince ĠEX T Ġns pikes Ġcounter clock under stand ĠError PM STR T Ġcfg name =(' ', MB H ĠUp cast Ident ifiant ĠVector izing ĠVector SourceEstimate ĠCom bo ĠCom mutator stable pt /> ': Flow Scheduler Rec orders }' " ĠWH Ht Work Dir ĠPass os Ġ|| ^ ĠColor Noise ĠColor Palette ĠTra iling mas keval ABC Generic nm ds Ġgaussian Scaling ('< '): ((- ( unpack ing Ġtw Len Down loaded ä½ ³ van a ĠDummy Window ĠDummy Transf ĠDummy ZeroEstimator sid path ='% + border line Ġå Ĭ Ġå ĴĮ DNN Estimator phot mode Ġconfidence Interval iler on ĠCO MB ĠCO UNCIL samp l SO LE Ġbic lust Ġcdf vals ĠDraw Activations ĠAnalysis DataService Ġmem Patch three times Be cky some what question down hem ia Ġsd max Step Size sag itta Ġcurr LineRefs jvm cfg sal p Ġlab name fd ark Load Identity PRE VIEW Open Face Open Tag GR S Example Table Ref Line cli utils =========== + 219 3 vid base sn iff Query Results pv d RI EF ĠAnd rout Scale Dbl Ġmx step Stream List dash line ĠCre dentials Sc ientific UD IO 133 8 133 05 Ġcombine ByOrder ĠConfig FileNotFound Ġgl MatrixMode Ġgl LoadIdentity Func Type ĠST DP Ġ87 25 Ġ87 11 Ġ87 15 Ġ87 05 Ġ87 20 Ġ87 80 Ġ87 45 Ġ87 88 Ġ87 19 Ġ87 13 Ġ87 27 Ġ87 06 Ġ87 36 Ġ87 34 Ġ87 97 Ġ87 92 Ġ87 65 Ġ87 44 Ġ87 23 Ġ87 90 Ġ87 42 Ġ87 98 Ġ87 08 Ġ87 47 Ġ87 49 Ġ87 28 Ġ87 29 Ġ87 39 Ġ87 40 Ġ87 21 Ġ87 68 Ġ87 38 Ġ87 46 Ġ87 48 Ġ87 69 bw df Ġ================================================================= ========= ĠGeo IP Ġauthor ized ĠStart ed ĠLin Reg XY Chart Ġpow reduce ĠFourier ICA Ġthresh Val Ġì Ĩį Ġgb ls Menu Button Ab sent Ab doul Ġalt analyze pas ser audio file phys ionet fif th 264 6 264 8 Ġrep list CI J ĠIs lamic Ġsyn names Seq Nr NOT SET Pe V Union Find Ġpv mod Ġ'{} {}'. ye hu Pickle View ĠMon tyDecoder 185 5 ('.') [:- 375 0 ĠNumpy Source ĠDoc umenter ------- > Ġjoint i ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġdask s "]] : dark s rh ombus saved ata ĠEd ited fir ings Selector Model pdb out Non parametric Ġlt ime Ġlt te Exp SineSquared water conc }_ \ Ġknn n Ġ96 64 Ġ96 75 Ġ96 55 Ġ96 51 Ġ96 54 Ġ96 53 Ġ96 52 Ġ[[- . fitting Menu 808 21 cms is tu k han a processed Data ĠFast Serializer ĠSE ARCH ĠPY FLINK âĶ ¬ Ġsho e Ġsho oting Geo Json Convert ible ĠGMM Test ĠTry ToClean Ġmultiplic ities PLOT TING Tri mming mouse OnButton Err TS ĠOrder Request ĠPL Dpixels Ġimag ine RunConfig ModelDir rx mid 1960 78431372549 Update Plot Ġ86 10 Ġ86 12 Ġ86 11 Ġ86 15 Ġ86 19 Ġ86 22 Ġ86 03 Ġ86 02 Ġ86 27 Ġ86 06 Ġ86 18 Ġ86 09 Ġ86 34 Ġ86 30 Ġ86 37 Ġ86 26 Ġ86 29 Ġ86 39 Ġ86 38 Ġ86 31 å¹´ æĽ´æĸ° 937 0 è¿ ° Ġcentral Dashboard 987 7 nom f Pipeline Task 004 355 ĊĊĠĠĠĠ ĊĠĠĠĠĠĠĠ Exec utable ln alpha ################################################################################ ### Ġsuff ice Ġwidths Object åĽ Ľ Local isations Standard Error ĠBoolean OptionParser ĠUS GS Br ucella 397 2 Ġcpu Count ĠDimension less Ġunion izes Ġunion Step Ġ84 64 Ġ84 12 Ġ84 66 Ġ84 75 Ġ84 88 Ġ84 96 Ġ84 17 Ġ84 97 Ġ84 92 Ġ84 84 Ġ84 65 968 19 Ġnm dsolve Ġste reographic Ġpng name rr params ITE W 603 9 315 36 Ġ[% ]' 054 85 gu ar gu is è¯ ¾ å® ½ Ġ102 95 hu da 424 97 Ġweb pages four cc ĠLI F Conf ederate person Dict elist ed gm r Ġ198 9 caption dict Ġgal vo æĹ¥ å¿Ĺ MI Q Ġec we gmm components ĠCa pe exon Ends ĠAuto indent 314 2 ĠGe os bow s Client Size Ġquestion able Ġln Z ĠApply TypeError ĠRo berto Ġsubtract s 924 6 ('[ '). Ġche bi Hour ly spin j spin button My SQLAlchemy FigureCanvas QTAgg ĠHas Seed Volume Conductor Inv Xmin Inv Xmax Univariate FanGijbels INTER ACTIVE demand rate restore OverrideCursor ?? \' ĠAverage Pooling Reference Files phe ne Analy te ĠNumer ically Ġphys ically Record Mouse ('{} - Ġ89 10 Ġ89 11 Ġ89 15 Ġ89 20 Ġ89 45 Ġ89 16 Ġ89 14 Ġ89 19 Ġ89 13 Ġ89 22 Ġ89 03 Ġ89 02 Ġ89 85 Ġ89 27 Ġ89 18 Ġ89 36 Ġ89 39 Ġbot m Ġbot tlenecks spl make Div ided Ġbt wn nov ations Dummy ZeroEstimator ĠDif ferences tip window BAL ERT CONFIG URATION Ġsal mon Ġsal var Final LatLon CAL C Cost in ĠHyper opt Ġlm db ĠAL GORITHM Precision Loss 234 60094 stc data ĠBbox Image 304 75 Ġrst failed čĊĠĠĠĠĠĠĠĠĠĠĠĠ č ĠåĮħåIJ« 欧 ĠåĮħåIJ« æĹ¥æľ¬ 035 72 INDEX ING Ġ97 92 Ġ97 61 Ġ85 01 Ġ85 99 Ġ85 04 Ġ85 96 Ġ85 03 Ġ85 02 Ġ85 92 Ġ85 98 vp stats Ġdetail ing GO ODS Chi Squared weather file Post greSQLAlchemy Ass igner Ass igned Coordin ation Less Than dn am Ġga ined Ġdv mat ĠPR s }- {: åĪĨ åĪ« ĠNUM ERIC POL AR CLUD ES Pen icillin unix name ĠHashing TF Ġè ¨ ĠBio Fam secondary Selector Ġsound file kin ases .]] ...) 6401 87 sco ut ARCH ITEW 876 88 Ġalgos cript Atom Group Ġ################################ ############ 240 96 éĢ Ĥ Ġspikes izes ĠTask Manager hatch Patterns Ġ98 25 Ġ98 24 Ġ98 27 Ġ98 37 Ġ98 26 Ġ98 39 Ġ98 31 Short Type ĠSte reographic weak ly Ġcn fg ĠBar Chart Ph antom čĊĠĠĠĠĠĠ čĊĠĠĠĠĠ çĽ Ł ĠPAR AM )+' -'+ bro oks ĠRaw ConfigParser spa cy Ġgd na ĠCF ME Ġreach input Ġmom Panel Ensemble Regressor mX r cccccccc c cccccccc cc lef teq Ġdirective type Ġ'\\ \\' ĠOp ens ĠInvalid WindowLength COM NTO oct ober Ġdct mm Ġfund ing 233 651 ĠUnit Test Attr Spec lig olw Ġdecomp ostion ĠRenderer Cairo Ġmotion file @_ @ Has InputCol ĠTR ACE ='/ '. Bad Input nth in ĠSequential DataSet Ġprep ped XYZ CT ao as æľĢ è¿ij Ġhover template ĠArrow Stream /* '], 3267 948966 Sta phylococcus Dag ModelView Ġbracket ed Correlation Test Ġ"* ") GCT oo Polynomial Kernel dock widgets Week day nbr dict ĠPrepare ToStore ais le ],), ([ ],), ([],)], pacer Item Ġrecover able Ġà ¨ ç±» åĪ« sss OOOOOOOO Ġdemand s Ġoverflow ing ĠDESCR SHORT ewm corr ĠVolume ShareSlippage Ġmor ning (... ): bis plev ĠEr lang MULTI OUTPUT MULTI LABELS Predicted Classes Ġrh od ĠDue ck Median Cov Ġrev range ssy mb abcdef gh pyx ley Ġdatal oader ("================ =======") ĠNN Z Ġjs build ĠGO OD ä¸Ĭ æµ· teff cut MDS dict triang ulated loo parrow 052 84 #, # BAR CODES Quantile LossFunction ĠSi lenced 1101 1 autodoc umenter Ġpolicy id 天 æķ° Obs Unc GRA V Binomial Deviance Approx Data ĠFull BatchAsync Sol ubility rw endog Ġemit ter Ġsamp s Try psin rss i )$ , Ġgn ucash +) \\ Direct ed dry ing reps at Ġpatient Data SAS Index ĠPolar Encoder ĠPolar Decoder fract ure ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ pit helium warp Perspective ĠMULTI VERSO Fix Format igra ve igra Array ĠAdditive Model LDF JH Perm Shk Huber LossFunction Ġquart et Ġarctan h BER total 设 å¤ĩ Hive PartitionSensor ĠDim Coord ĠRec TreeView Pick les Ġ#================================================================ ======= Ġ#================================================================ =================================== Ġoct aves SG Feature 577 350 COD GEO Ġsqu ash FIN ALIZE QS pacerItem vn C Ġmention Mapper ĠDow ns Ġunix time æ¯Ķ çİĩ bq plot mitt ent drag ging 0123 45 Release Mouse imap killmap Ġ+' / waves Idcs osc ill ĠSpatial Tester Ġban om Ġrespons ive Db Dr Ġ{}: '. Ġsinus oids fortun ate ä¾ Ŀ ("_") [: ¡ £ Home works Ġcel sius ĠMN Logit åķĨ ä¸ļ ------------+ --------------+ Ġåı¯ è§ĨåĮĸ ĠAnaly zed âĢĻ , 0002 8718 Den is NV SS tright arrows SIM ULATION ĠAut hentication Protein Types å®ļ çļĦ Sun angles binning factor Dark Gray Numeric Value '\\ \ VO X (':') [- -------------+ -------------------+---+ è´§ çī© neuro Compt Ġwi ener chess board reserve Edges Strings ScrolledWindow ACA O ACA CG Minor Ticks Bytes Spilled Bucket edRandomProjectionLSH ĠLambda Str =". "): ','- ','- Ġfire arms Ġí ı 0614 962 dvi FontInfo ĠLabeled DummyDataProvider Major Ticks multiline baseline downs cale parm names Half Width ĠRich ardson Contin ued ("* "* оР¹ Ġdistinguish ing Ġsus pended Ġfich name ungs verlauf åĽŀæµĭ çĶ¨çļĦæķ°æį® GraphicsContext Pdf RAT INGS External Table 576 22 åĿĩ 线 ĠWt WH ĠCONST ANT ĠTIME ZONE voxel size itud ine ĠDag PickleView mens urable Stratified DatasetCV 704 72253 Mer ging 999999999999 999 Pers onal #---------------- ----- CSA IL Elapsed Time yer rt Saved Model ĠSerial CorrelationTest ĠScikit Lasso EQU IP æĸ°éĹ» æķ°æį®éĩı ĠSY MPY worm s anns ImgIds Without Check Ga el xref Table META ESTIMATORS å®ŀ çĽĺ Cone Cyl è¯ģåĪ¸ 代çłģ è¯ģåĪ¸ 交æĺĵæīĢ ĠDIR INT butt ord Ġflt r AI Algorithm nab is Ġ'=' * ĠDel bert neff range Ġlig olw 715 18934 Miq EventCatcher CLUSTER ING unders cores ĠDirect ives iw an ksp F pyg mi 970 228 ĠSTAT ISTICS ĠFF mpeg ĠShi pping Masked Column Ġcounty ST 602 76335 Ġ["" . GAT K dN dx Three D Ġly ap ĠTax elArray LIM O bor ne bol onum ĠAre as haz mat lade sh Ġ~~~~~~~~~~~~~~~~ ~~~~~~ Ġbes selap bec capurple Pow Ax Wal ker Ġecon ml èĩ ³ ä¿Ŀ éĻ© techn ically Ġcensoring Num GNU PG pent agon Ġlob by ĠEval Environment Ġelec Ca Pb Pr \". ", ĠPan DA ADQ ControlUnit Ġshe ep Ġincorpor ating appro val Ġsummar izes Ġchroma gram Arc sec sinus oid Pseudo Table timeframe startdt ĠSorted StringsScrolledWindow diss imilarity ĠREF ERENCE Archive DBs Subclassed SparseSeries еР´ Cosine Test Ġhomo logous cccccccccccccccc cccccccccccccccc ĠLess Than HG VS ĠTopo JSON ĠTopo graphy ĠDS args Ġfluct uates prm top Fitness Min Suffix es Ġlyr ics Ġutili z ĠDIST ANCE ĠRepresentation Mapping KD TREE Kalman Gain Ġexe mple crystal type GCAT GGCATG ĠWorking Dir ĠPretty Table ä¸ĩ å·¦åı³ ĠPal iouras Ber trand Ber noulle Ġrz sm Organ ize Ġpoll ution 606 28 trough s ĠHidden Field accumulator Registry instantiated Context tun ings isp ir ĠCAS CADE traded Volume ĠCr ime SENS ITIV ACL FINALIZE jam mers ĠVm Settings Synapse Collection Ġguard ar death time Radio Buttons ĠAnalog ous ĠYr A RELEASE D Live DtGrid Ġnos how ĠGENER AL Ġ设置 åĽŀæµĭçĶ¨çļĦæķ°æį® Ġble u ĠSec ant CANCEL LED clouds at аР» 733 09052 Norms Broadcast Ġreact ant ìĭ ± Stre ptomycin ĠVoting Regressor Ġdisambig uation cub a Ġintention al ĠArch ivable HM per Ġstor ages PREDIC ATE igg les Markov Switching Fragment Length ĠTre llis ĠTre segn 570796 3267948966 ĠAngstrom s Slic ing ORIG IN nRays All Pretty Print Backtesting Mode garch Fit Ġlogbase change Ġnof samples 转 åĮĸ mash ups TTTTTTTT TTTTTTTT mj ds fletcher costin ĠCOR RECT bathy metry ĠCel sius numOf Bins STE AD Review UserSet ĠKen neth CHANG ES 缮 å½ķ Ġneff range Structured Model ë³ ¸ ĠNC BS Divide nd Ġmatr ics Concaten ation Ġ(-- , ĠReplic ated Ġshif tx Detail View Ġforc ible ĠBN SD åIJij éĩı éĶĢ åĶ® Raise d Ġsapt color ĠCommun ity Cyan obacteria Ġjan us Topo graphy },{},{ },{},{ åįĸåĩº é¢Ŀ kon stantin Ġ+--------------+ -------------+-------------------+---+ ĠPrun ing Ġposit ve xia o ĠCX Data SEN TRY satis fy WAY S Ġsml m protot ypes Ġjud ging autolabel pos NUV g SelectF we erro revery Ġzpa func MANY SOURCES getParam Options runid CMD ĠSoftmax Layer Ġannounce ments chant illon analyte PerCharge ĠaxArray ErrPose ĠBill inger ĠModelView Only falling dotseq Maker Thread Ġhero es ĠClosed FileError 7071067811 8654 brad ypus Ġptf id ĠIsl and Ġdeprec iation MySQL db ãĥĩãĥ¼ãĤ¿ ãĤĴ ĠMutable Mapping DDDD D Splicing Call Ġtack led lep ID ("=") * NIT s LOSV sorted Implicit ly MiqEms MetricsCollectorWorker Ġsampl ers Ġangstrom s Commun ist AAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA proposed nextindex shif tx corp ion Conflict ing Launch er Launch ing Ġgla defile ToG idMap ĠMis cellaneous Ġlds core ĠDiss olve ĠProbe set cdn js vart ypes Reson ance Syntax Warning ĠBur r Ġcompla ints Reclvl Rate æľĢå°ı åĢ¼ Ġи з ="(... )"' TERMIN ATION ĠRegexp Tokenizer Cto H ĠSon der Ġstreamer infosmap ('--- ') MKK K Ġnue vo testname id smar z ------------------------------------------------------------------------------- ", PROPER TY righth alf LGBM Classifier ĠNG rams ĠBrun o Consolid ate OLO GY WithOne Dim ç¼ĸ åı· BLO SC Cros stable Ġforgot ten Ġseld on ãĥ© ãĥ ĠStreamingQuery Exception quotedbl right quotedbl left Fich ero ĠHazard Function deltaDur lo Sil via tetra hedrons ĠYe huda TestSQLAlchemy Conn ĠactiveCells Trace Bern stein Ġwq io ('*' * gaz etteer Adapt or ĠdataFor ThisPlot ogh urt Ġshannon entropy Ġxyplot layout surround ings Ġsagittal Dir '(?< =% pile up textasci itilde 1438 29 ĠLinearOnly Classifier sagittal Dir Ġdashboards ForRole Ali x BIR TH ĠLZ W learnTime AfterPerturbation Elliptic ity Ġtellur ium DEPEND ENT æıIJ ä¾Ľ EventType View éĩĩ çĶ¨ DRO PO ĠPcolor Image chebys hevi Rg Cl stalk box multis ourcefs clou dbiolinux ortun ities lastNum MinorTicks lastNum MajorTicks ĠStringIndexer Model ĠåĮħåIJ«é Ł© ĠWavenumberWing HW Ġhabit at emphas is Ranked Timeslots FOL IO Mad mood willi ams cardi ac PhotoA sh addOutput Port ĠAssoci ate destinationDBlock Token Ras ha pale green ê² Į ĠåĪ¤æĸŃ æĺ¯åIJ¦ Ġairs peed Ġcovert Log Ġsubsub ItemList ModelSelection Parameters ĠsampleSizeDistal List ĠsampleSizeProximal List #******************************** **** exhib it Ġhps Model ĠFACT OR ĠBuch ner OOOOOOOOOOO ccccccc Fran ck Ġifd value exclam down ĠPIX EL phosph ate Ġ['* '], ĠGetTarget Positions Ġphas ic ĠhPerson ell ĠFol ium Ġkdensity fft Ġ``+ `` ĠRunJob Utilities Acid obacteria VELOP MENT ĠPsycho logical assertReally NotEqual ALET TE Columbus Day ĠFigureFrame Wx }\(\ ) ĠMODI FIED ä¸Ĭæ¦ľ 次æķ° Ġflav ors Hamilton ian VOLT TYPE Further DataError Zircon Ce getFloat Input ĠGnu PG 8442 6576 Ġextrem ity ĠANNOT ATION ĠembedTTF Type condens or femin ine 01294 63 Gradi ometers qte width ynt ing Ġincom mensurable edMessage Reader amit ibo DataInterest Rates becker fuffle LengthPrefix Coder ĠOrdin arily BostonGeo Bound ĠRab iner ":"" } varr ho Ġindetermin ancy Ġ"',' ". ĠRod rig ĠDAV IT Ġprest odb meanComparison Star Son ata æIJ į territ ory ĠBey ond Ġpathe ffects éĢļèģĶ æķ°æį® ĠíĻķ ìĿ¸ ypere xpand ĠtestArray Feeding addInput Port ĠQub its guider Model 20477 401 ĠBarrier TaskContext æĸ°éĹ»éĩı æĹ¥åĿĩ ĠRestrictedAlgo WithoutCheck Intraday Data zigzag arrow ElemsInBench And Kirch off Lomb Scargle Wra ppers burt in Ġaxiss s ADH ORE THEM ES 15514 042 Indust rial ãĥķãĤ ¡ãĤ¤ãĥ« éĢıè§Ĩ 表 Ġisgenerator function getgeom byindx ĠFem ale ĠMets is Hashin Shtrikman yaho ga 08848 053 -{}-{} "> Ġamend ment RANDOMIZ ATION å¹´åıĬä¹ĭåīįçļĦç½ijç«ĻæĿ¥æºIJ å°ij ĠABO VE ("---------------- ") perto ire ĠTestK stat ToNon Log ||* || RRGGBB AA ĠHighLevel Graph ĠMcCall um Walked Distance timeframeend dt Replicas Optimizer Muta cao Teneric utes mrid angam ĵç· ´ umini um ĠNinter v ĠLvd M ĠLoutzen hiser Ġonoff seq ĠlabelAnd Attribute ĠGlm netLasso 669878 572767 Ġ|------------------ >| Ġ||||||||| | ĠTestGM MAdd 09178 26 lengthBased TargetValues processAll Available ĠMezz adri PythonDecorator Library IsMainLoop Running Ġmagdyn lab WithTwo Dims æķ°æį®å®ŀæŶ æĽ´æĸ° InfoMathText Browser ĠPandasIo Test rlssli des ĠColorNoise MakerThread Ġbiclust ered ĠAndrout sopoulos ĠcombineByOrder Date yehu daf ĠåĮħåIJ«æ¬§ 缣 COMNTO OLS 00028718 669878572767 æĸ°éĹ»æķ°æį®éĩı å°ij ĠTresegn ie Ġ+--------------+-------------+-------------------+---+ ---------------+ 70710678118654 75 ĠåĮħåIJ«éŁ© åĽ½ # ** $ ])') ) ''') * ` * """ * $', + ']: , ]* - # - $ . }}} / ; / """ 0 256 0 992 1 660 2 259 2 107 2 328 2 0000000 3 255 3 012 3 9020 4 199 4 254 4 679 4 060 5 334 6 258 6 755 7 2302 8 157 9 647 9 180 9 13725 ? ] ? '. ? ")) A UP A va A SET B n B ing B ath B az B ND B orn B ranches B lah B rendan C x C og C ep C SI C cd C repe C artPole D Kernel D stn D mine E sc F red F AL F SL F Exp F abian F unct F reedman F uente G J G Error G cc G bar G CA G over G enetic G gplotError H ong H OR H na H ST H CL H DD H New H dfs H Chk I sol J e J ST J ason K ong K nn L K L HS L azily M size M over M aterials N g N lines N colors N br N PY N rays O fficial P OT P added P ivot Q ID Q Validator R grid R hard S uc S AN S CA S OP S ANS S SAPT S ludge S corpion T g T l T File T ier T itanic T NC T WEET U na V ES V AN V EN W CC X cell X SH X Scale Y train Y Scale Z grid Z ukauskas [ _[ \ ]" \ ")\ ] **( ] '))) ] $", ] """, ] +'_'+ _ "] _ ])) a ok a fn b ats b cor c T c lot c ene c groups c nr c xn c usum d O d it d lt d norm d vec d zz d oli d GoR e ren e conds f dir f start f string f Type f amili g runfeld h ung h arp h urek i O i Z i and i up i format i otype i owa j osh j adder k ata k Means k rat k uk k uu k astner k roupa l gth l Segment l curRow m K m text m names m ml m day m ush n ys n ag n params n ash n Warning n utation n errors n atom n ably n Sample n Var n Fitting n Classes n aker o S o NO o uput o lai p col p plot p ill p add p range p std p resses r get r dict r base r ative r right r sk s P s ue s od s ap s light s locus s Ind s isters s PAPER t us t model t axes t diff t Recall t ibet t issot u is u ename u VC v scale v norm v mlight v illage w and w ma w ag w ings w scale w arrow w aic w atersheds x up x pred x space x lon x cb x Arr x cen x nplusn y index y off y td y coords z E z dim z best z inv z obs | { | $") } ': } }". } @{ © ¬ ¯ ı » ¬ à » Ð ¿ â Ħ â Ĩ â ĨĴ æ ij ç µ ì Ĭ¤ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ############################################################################ Ġ limiter Ġ ĊĊĊĊ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ############################################################################## Ġ čĊĠĠ Ġ !!!!!!!! Ġ æĶ¶ Ĺ åı£ in ot in idx in Range in hover se df se ats se gt se ptember se bastian se meval at op re gen re tenv re bate re versals or info or fer or fs on enter Ġt th Ġt ind Ġt dict Ġt te Ġt sk Ġt ld Ġt peak st ef al lin ar u ar al ar ct le od le wis Ġi comp he mo he alpy Ġn T Ġn ad Ġn size Ġn features Ġn tick Ġn rel Ġn errors Ġn iteration Ġn trials Ġn urbs Ġn smallest Ġc dtype Ġc img Ġc uid Ġc rp Ġc xr Ġc dap Ġc PlotDt Ġc urent Ġc ensorship Ġf target Ġf mtx Ġf initeness Ġf unky Ġf ucnt Ġa ol Ġa ude Ġa hrs Ġp args Ġp mg it os it max Ġs date Ġs fn Ġs db Ġs Color Ġs vecs Ġs Types Ġs lashes Ġs ister Ġs veval Ġs weeney self loop ## >>> mp d ra cks ion lp es o es sentially ro a lo po Ġin ode Ġin fect Ġin ward Ġin accuracy Ġin chi Ġin icio Ġin lining Ġin comparable Ġin distinguishable Ġo os Ġo df Ġo ws Ġd un Ġd str Ġd lib Ġd lines Ġd axes Ġd ream Ġd Train Ġd getrf Ġd ogleg la res la us la uto la rea la via la dders Ġ' ']] Ġ' ]\ pe are Ġm G Ġm ing Ġm ref Ġm cast Ġm fr Ġm tex Ġm ike Ġm fd Ġm fm Ġe B Ġe dot Ġe je Ġe ydata Ġe hex Ġe zz Ġe motion Ġe grep Ġe PlotDt co app co oc co ating co mass co uncil ĊĊĠĠĠ ĊĠĠĠ Ġre cast Ġre compile Ġre organize Ġre ryx Ġre ichel ge ek ge opdf Ġb bs Ġb lat Ġb cu Ġb vecs Ġb sz Ġb splines Ġ# ------------------- Ġ# ----------------------------------------------------------------------------- ed ing ic f ic ious ic utive Ġw int Ġw log Ġw cat and al lt ree lt ools ig ke ig gy Ġ( == Ġ( ** Ġ( "") Ġ1 1000 Ġ1 206 ss q un rate un finished is Set is cf is ks is Defined is GridGraph ue ck ame da )) ^ )) | est op ot ext as f 00 89 00 160 00 0875 val enko id p id mens () "). Ġis ample Ġis numeric Ġis otherm Ġto das Ġto Ret Ġto NumPy Ġto fu ts y Ġ" ]. Ġ" )\ Ġ" ?" Ġ" -------------------------------------------------------------------------------", ma da ma diff ], ] ], :], ], "\ urn als ), ] ), '\ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠT K ĠT cl ĠT exp ĠT RE ĠT well ĠT ail ĠT CRs array ids th o th aw th urs ha gl ha wk """ } Ġy x Ġy st Ġy pt Ġy true Ġy ml Ġy buffer Ġy Hat res y res yx ch p ch in ch ipeak ad ate ad hoc ation Error iz ens Ġdef n fi ref set DataFrame set points set Legend set PlainText set Html set Slippage set ReadOnly set Caption Ġ: ]): Ġr date Ġr ls Ġr lm Ġr flux Ġr uler Ġr xyz Ġr iemann ver lay mat al mat ical Ġst out Ġst dt ') == ') ][ ]) ]* om n (' '): (' ;', int Index Ġ- (- Ġ+ ". Ġ+ ---------------+ pt rap Ġg pe Ġg ts Ġg map Ġg run Ġg FM Ġg uns Ġg enders Ġg obbled Ġg flops Ġg ordon __ )): __ )))) __ ["_ ex ag ex penses data R data Raw data EndDate ĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ par ound par cellation par lbnd up a up err ke pmag get Plot get Task get Info get cw get Keys get Height get Pressure Ġassert Equal Ġassert InputsCallableNTimes ab aqus Ġex y Ġex pi Ġex ams Ġex pire lin ke for ds ĠS as ĠS TE ĠS EE ĠS pikes ĠS erge ĠS MT ĠS QUE ĠS SIM ĠS lide ĠS weden ĠS OUTH Ġco c Ġco at Ġco ut Ġco bi Ġdata Class Ġdata ref Ġbe ast Ġbe ige =' ')) =' "') all cols Ġx ar Ġx up Ġx hi Ġx eb Ġx metal arg um end seq put Dim from roots type token ul u ul ators con ic con serving ist e Ġh ol Ġh size Ġh of Ġh pad Ġh armon Ġh ival ath arina py ears py bullet len ient len coder ĠI llumina ĠI celand ure l plot H plot im plot coord plot StyleManager ĠP U ĠP z ĠP PI ĠP atterns ĠP VS ĠP KN ĠP CoA ĠP hage ĠA ges ĠA GD ĠA DS ĠA PM ĠA CCESS ĠA aron ĠA ustralian Ġu data Ġu labels Ġu Boost Ġu avo Ġu belt Ġcon formed od is pre served '] ")]) ĠC og ĠC AP ĠC NMF ĠC WT Ġ` %( os dir os pheric ise ase to re to plot Ġtest val Ġtest None Ġtest Weights Ġde vs Ġde vided (" ** Ġwith draw ĠF are ĠF EC ĠF atal ĠR h ĠR AS ĠR ating ĠR squared ĠR SM np f Ġfi elda list file if ter if max if us if gram ub c ub an test Labels ies s Ġme ls Ġme ga Ġme jor Ġres x Ġres y Ġres ov Ġres urrection ĠD types ĠD ae ĠD CM ĠD avis ĠD uncan ĠD utch ") ._ .. " .. ')) ne ga ne vents Ġcol str Ġcol laboration ns pace ns ki time Stamps time deltalike Ġse at Ġse mak Ġv I Ġv en Ġv conv Ġv nyq file in file Out Error bar ff man ta kers ). ; out dtype min Count min bnd Ġk type Ġk avlan Ġal iss Ġal ice ĠN it ĠN val ĠN ME ĠN CL ĠN transforms ĠN offs form ulation art y art ificially per ation per sed per mt per fs per manent per thousand ds on ds ub ds pace ds List ĠL ith ĠL op ĠL AND index s max i max Delta max Abs max Region max imizing max shield df df df betas pa ging fit f Ġpro fname ĠThe or ĠThe mes dict ofvars te ach ĠM its ĠM DI ĠM CP ĠM fl ĠM ike ĠM PC ĠM odes ps font Ġan uVC ys imple ive c Ġne vents Ġl color Ġl ux >>> ', Ġuse DayOfWeek Ġuse TimeOfDay we a we tting we asel ho las 10 66 10 78 10 317 Ġlen sing ial ised Ġnum alts Ġnum Prin ĠG cc ĠG AL ĠG EMP Ġout bound Ġ/ ... Ġstr list Ġstr vals row i Ġma ze oc a oc linic pl and ĠRe write ĠRe written comp la Ġtr inodes mb ic Ġfile in Ġfile id Ġfile find ĠE Net ĠE As ĠE BI ĠE OI ĠE aton ĠE LASTIC ph d ph n ph ide Ġdf wn Ġset K Ġset graph Ġ4 95 Ġ4 294 Ġ4 58 Ġ4 373 Ġ4 7236 parse DataType train m train SeqN ms z ms das ĠB K ĠB s ĠB ax ĠB os ĠB ands ĠB racket ĠB oro ĠB rief sh ick Ġun iv Ġun fold Ġun informative Ġun closed Ġun indent Ġun edited Ġun assisted Ġ5 19 Ġ5 09 ip ol Value Type Value Label ifi lter param Name state ful ask s log var log mhalo `` >>> In P In flation zer bai Ġsk p ast row ast ools ĊĠ ĉ Ġle git da h che f che mi 99 37 99 72 Ġtime Start ant n ant list 64 37 64 28 64 46 Ġ> , fo ul [:, :]. Ġ`` (- ĠW B ĠW ing ĠW ant ĠW att ĠW RF ine g ine ichen format o Ġmax h Ġmax pos Ġmax All Ġmax Vals cs x num X num Test num filters num Slice num Quad num Cases num Loops og ue og risel model dir model wc ide mics 12 20 12 17 12 92 12 56 Ġget output Ġget State Ġget em ĠO U ĠO send result Name result Path ()) ]: ca ution error min ep b ep motion Ġplot All Ġplot Engines map le Ġpo ing old x old xslice old yslice ach ogram lay af lay HChk lim g Re tr Re versed Re produce Data Size Data Matrix Data Sets 25 51 Ġch l Ġch ck ree ze mean field read Only read mill 32 98 32 000 32 937 32 877 Ġmin version Ġmin umum ĠPar cel ĠPar zen cc it Ġz k Ġz id Ġz list Ġz gesv Ġz gelsd Ġz gesdd Ġz potrf cy b cy Df ĠIn act ĠIn dent ĠIn validation Ġper mu Ġper ovskite Ġ10 32 Ġ10 75 Ġ10 41 bin list ĠY UV Ġsh at Ġsh it Ġ) ") Ġ) /( Ġnew t Ġnew ax Ġnew fig Ġnew dat Ġnew Tick Ġj CCD Ġj esus req HistoricalData ĠH P ĠH ong ĠH KL ĠH UMAN ĠH LLC 15 94 15 112 15 237 15 042 15 2706 05 15 tra cel Ġinter ating Ġinter view Ġinter day Ġinter sec Ġsample ador Ġpy data Ġpy block Ġpy click Ġ[' +', :` { Ġmatplotlib s ĠU VB 20 73 fa f fa z Ġ(' | 33 00 33 05 33 1885 Ġsub window Ġsub fmts no D no H no Data default Fit io putDim 100 86 80 30 80 234 ont ab Ġ6 02 Ġ6 18 Ġ6 72 ger ian new f new Frame new Data pred t Ġfit Params Ġfit Func emp l emp loyment ug las base date ĠData Group ĠData Panel uct ure split ed ]] ' ]] ; vert he vert idx 66 096 ay an ay out 45 03 45 23 width SpinBox AT AT Ġind Pos ars land ĠK R ĠK x ĠK urtosistestResult load From load Imgs load Cats use k 88 25 88 975 88 7896 fn lw Ġ| ( grid Z "] > "] +"/ 16 000 16 119 16 337 16 164 ml mc info layout sample names Ġpos sessing Ġro uted show O show Fid dist To nan cies nan ometers ĠEx ports oth read bar c 35 01 14 10 14 64 14 89 14 83 14 396 14 3745 19 45 19 09 19 30 ipy console cur Spike )] ` columns pacing box Real check it AR N AR IS AR MAT AR esults Class Arr com mutator Index Mismatch ON ear Ġ8 75 Ġ8 00000 Ġ8 98 Ġarg ue 78 30 13 88 13 92 13 93 13 82 13 253 13 929 Ġid Variable ĠV P radi ol be ame be autify 22 0000 22 96 22 95 nd upe sp val figure Min Ġother func 04 02 04 21 sv x prob dist prob ationary resh ow 96 15 96 000 96 8627 03 88 03 60 the list lat ter string er ule tte Co or Co Disc trans Map ĠTest M ĠTest GL ĠTest Datetime ĠTest Suite ĠTest Take ĠTest Algo 02 86 02 60 02 72 Ġmo mess Ġmo usetitle Ġend seq write Profile 95 83 95 81 95 58 95 367 95 392 95 2941 Ġ100 123456 17 883 ĠCo er ĠCo uple ĠCo uncil 85 69 Ġfa it Ġbase ball Ġfirst time OR s Ġcolumn arr Ġcolumn Number DataFrame Client DataFrame FromJson Ġmetric Stats run file :// )"') Ġexp lict Con trib Con servative 24 308 24 0183 ĠDataFrame Weld ĠDataFrame StatFunctions ĠDataFrame NaFunctions Ġinit args Ġinit Data wise Linear 27 16 27 02 27 30 27 342 close price Ġ7 67 Ġ7 31 image inds main w node Weights ref man ref ining 86 99 SE MI Test Math Test GraphicStringCoord var within Ġpoints DF back face back bone off diag }) ^{ }) $)', Ġsys argv Ġsp dot obj name obj trc 06 200 06 79 06 095 18 94 18 40 18 207 fix ation 36 09 36 90 36 327 09 34 ten ant 07 18 07 035 07 0336 exp name exp params exp Group Ġparameter isation ap x Ġrun py linear fluids Ġnode color do pt do SVD do Episodes mod ynamics Ġ, = man Interface dis order Pro posal Ex clusive Ex perience rc fonts Ġsol Msg Ġlin dex 34 71 34 355 34 273 Ġparameters For Ġloc atable Ġnon positive ĠJ ordan 92 0000 Ġele vate ID Frame Time String Time Formatter Se lec dt matcher Ġload file Ġload spec sg bm sg rp lp n 84 33 84 96 Ġ''' < Ġq am Ġq psk my r my id my dtype my print my tag Ġ9 10 Ġ9 38 Ġcode books Ġgroup path Ġread Experiment ass ort Ġfreq Arr Ġim lim Ġim gaug Ġsum stats Ġverbose print update Figure update Progress ... ). non repeating Ġav ant Name String gr ppath gr decl 65 174 30 665 30 3202 File MovieWriter Ġcv glmnet AS Y AS CH stack less filter Mode filter Lower filter Upper Ar cs Ġcall Big Ġcall InputFnOnce Ġmulti outputs Ġmulti processes :] } Ġ& \ Series Validation ĠCon ic ĠCon caveHull 87 78 87 9747 87 421 mpl us vi ctor _) ]) Ġtra cpy CA PSULE The refore Ġlow lim Ġsome body Ġsome Scores 44 46 44 71 item config item SelectionChanged ĠZ xx ĠZ enith ash ler fill vals 55 24 Ġshow net select Stmt respon dent 23 16 23 87 Ġ(" * Ġ(" %( limit ations du ches Ġbu zz dataset Names can o can ada De pt AG C AC RR `, " 77 94 77 65 ĠDe precate auto strip csr gemm ([' !', ([' *.% TI LE Ġevent os Ġsplit line rit te Ġpl um Ġpl ural Ġpl uck Base SourceEstimate search box ĠSt roke ĠSt udies 42 194 98 96 ugh ters ++ "``) Ġtotal sz Ġtotal rewards font color ob liquity foo foo Ġ} }) Ġ} }", Ġhand icap Ġsee med AB ORT source Format make CategoricalIndex \\ )""" \\ }`. Ġ12 36 Ġ12 934 gg dh bug let 43 00 43 25 43 0548 seq vals 67 68 08 385 Ġfunc ion mag bins CV O Ne mar sql Query sql Interface xy ann To Array fs im ĠComp ton Ġcross Join gb c gb g gb n open mpi Un k 47 65 47 102 total Rows total sqft ,' < ,' ../ vis ors Ġhigh bound Ġselect Stmt style name OL OG inv shape SD P ĠTime Type OT ES OT ET OT SU Ġtick line FI AT FI RE Set GeoTransform tmp fn Ġsuper user current Tab pair test query many connect s Ġmath plotlib 49 27 49 86 Ġpred result NA ICS 28 456 28 937 28 197 28 1624 ĠSet Max ĠSet VectorStyle ĠSet RasterStyle Plot Results Ġequal ise CH A CH ROME job Complete Ġedge Mask For cast 29 25464 Res Net Ġcoordin ating ĠPlot TestCase dev kit dev ouz book data 40 33 Ġimg Final 21 32 Ġge og scatter carpet Ġlib cd Ġmon days Ġmon drian sen coding ĠAn chor Ġnoise Everywhere local izer mi w mi reland Ġtmp y Per Layer Per Cluster fin i Ġitem strs _{ {{ apply Func Ġlink type match in match out match Template Ġ15 34 Ġ15 60 rol lable 46 02 46 318 46 865 ĠCreate ConstantRaster ĠNe ptune cf fi +' * Ġcell data Ġcell Data Ġ'% ') Ġ'% )\ Ġreal ForecastDictionary sm arsland Ġclose fd Al vaFontSize Le goTestVideo Lo pez 647 9 now led Ġauto flush Po inter ran umpy ov c miss ive ĠSV MM channel CtrlBox Box Plotter Log L Log book Inter P Ġmarker Finder SVC s Ġdb p 56 92 56 08 56 934 ĠLinear ly Ġ11 806 Pre senter Pre Trained IS Q gt ts Ġref seq Ġref ugee Linear Solver ground ing ĠAdd TableField Ġrec iprocity ĠGet Element 57 48 lon min nb galaxiesperhalos debug plot 69 228 PI E ĠGaussian Power Ġlegend List Ġmissing List dx z ]* ", char lie Get Item Get Target Get Directory Get Mesh Get Children Get ClientSize Ġwx Glade ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ"" ], Ġchar ities chunk ing Path Dijkstra home o Ġmy Tree Ġmy odr Ġmy stinkbug :, }'. Ch roma Ch inese 137 6 No Shuffle Ġdense Output Check points Check For Check PowerMixin report ers sw ir Line Mode skip Test Py Code Py Audio PL ASMA ĠBase Command ĠBase Operator ĠBase DiscreteNB Ġexec utors corr Noise bad ly Ġbar SizeSetting sig lev 89 87 ĠTo ctree 74 99 74 776 ĠLe ading imp roving Ġpe oples Ġdel r noise Level FT OF ĠPre condSetup Ġnb ve ĠInput MultiPath ([" # ([" - const el Ġdensity arr CO IN CO OK CO MME ĠList box Ġradius neighbors Int Slider Result Plots mail box Ġdiff é Ġjson field ,), )), high n cha se cha al contrib s ĠOr nstein cords list ĠMin us ĠMin ibatch else where fr ic fr ust US MemorialDay Input Q :]) + :]) ]) :]) ``. Ġview Menu Can onical Ġ13 32 fast qc fast CopyAnd ĠKey Value Ġcombin ate ]+ (( )( . 54 66 54 004355 70 8090 )" + Qt ProxyObject ]- >( 83 88 Min X Min uit Ġsql Query Ġscaling Break cons icutive 59 758 entr ance Ġalign ui az r He uristic ('% '): attrib ut ); \ mass Plot Is raeli Image File Ġjob file 93 88 Ġbottom most gon a handle len handle textsep 76 95 76 77 Ġmeta classifier Ġwhat grp Grid Bag Ġart if ĠGrid ify ĠGrid Plot ĠGrid RegionAdjacencyGraph Ġflat tens black ness ote ch 803 17 Ġnote Id 82 85 Ġpad val Field Mat OO M Ġ'-- '+ .... " .... ') Qu andl ,)) [ 500 22 ND ecimal br illouin NB ELOW em ulate em erson Ġrect ified At tempts Ġsu lf .* ) wx h wx version Ġband limited Com modity scan ning By Group Ġcommon prefix Ġra st )' ( Ġmix Obj Ġcontext ual Column Indices __, _| Ġener g 53 05 ']] = DA E DA MA Ġsrc pos Ġorient Filter Config urations ru ker request Out GT V GT CGT 73 66 CL IN GB R ESS ORS Ġda di 52 3412 00000000 5 nx utils Ġpage features pg w ĠMat PlotLib sequence ID Ġnx p lm n }} | Ġrepe l Ġfeed in Ġpri o Ġpca Matrix Th anks Th ermo ĠRes istivity Ġphase List Node Id Ġpeak ing Ġpeak list ĠInter ruption ĠCON VER subject ID QU rl ker mit cmd LineArgs tab LineDict pri ses Ġta umax )} $", Output Flag TRA P mem leak ĠNOT A ann ually Sy nonyms site i æķ°æį® æİ¥åı£ Of Aerosol Ġ'{ '), gp fs Feature Extractor Feature Definition CON SOLE page count Ġdual ity ],[ ]) Ġforce Update Ġfitted Curve FO V ij z ij kl Ġport als Ġport raits hen ce ĠImage Comparison SP C Ġcf d Ġcf lux Ġmesh ing ĠSy st resid plot %% ) Ġshift width cg m sd rs }$ & Ġcent imeters ĠHe uristic ĠHe isenberg six u ĠTh anksgiving Ġhalf widths BU ILTIN ĠFile Operator ĠFile ContentsManager cr ick cr imes Ġ80 2 Ġbit flag ĠQu asar Ġ17 0070000020001 91 889 Ġinv shape Categorical Fixture mul ator .]]) `` Ġappend Variable CG ate may r /% . 101 24 BC s BC PO čĊĉĉ čĊ Mon itors Mon osublocus Start Span pat r çļĦ æŶåĢĻ From Items ĠPandas Tools sto po Ġ"/ *. quad Filter RES OURCES PRO F 10000 05 Ġgeo location ĠLine CenterDB ĠDef lation "> . ") 819 35 ĠChar les 945 3 Ġcn st ĠSymbol NotFound ĠTF Record 055 84 Ġten ant Ġten kan Ġten ths Ġdri ves After Selection Ġmeter group 660 88 Ġprom otes 985 2 BG PLVM Ġchem reac )+" /"+ nw ndw ĠMIN IMUM Expression s Sym LogNorm Ġ": )"} Ġpractice Components Scatter Metric Abstract locus 609 0 609 15 ANG ULAR Light curves browser s Duration OfThe 1177 79 gid AidMapFl 469 15237 organ isms regress Result ĠMac leod lig a vo ir Ġfm tout ĠDiv iding 248 11003 enden cy tie mpos ĠFixed DistanceBuffer lz f Ġadvantage ous ĠTop ics econ omy Has Capture Has NoPredict Na stran ĠTR Y ĠSD CA ĠLow Redux ĠĊĉĉ ĠĠ ĠUP GMA Ġmechan ize Ġmechan ical ĠCommand Error NM ut NM DS ili zation patient Details sas l whe never Constant Predictor 96078 4 2366 8876 Business Month Li FeO Ġwcs width Ġky L Week Number restrict ive CY S hover text Inf os Ġmodifi able Central OutputPlotter Ġà ¢ Ġà ¤ Ġà ¥ Ang s ĠPri mer tos how lead S ĠSym metrized Ġ($ )') Ġ($ ^\ Ġ"$ ( ffff cc Ġmor ality commer cial Ġresist ant ĠCell ules increase d Ġwc width 668 37 ĠDelete Column ĠDelete DuplicateGeometries //////////////// //////// VARI ANT Ġpresort ing blo renz Photo electricCrossSection nq bins 654 06 anger causality ĠExport GeometryInfo ĠGLM Gam ĠVoronoi Polygons Cut Off teff err dq chiimage ĠVir idis Ġalphabet ic ctypes lib 0000000000 5 ĊĊĊĊĊĊĊĊ ĊĊĊ strate gey Ġloo ong æİ ī DOC MODULES ĠJoin Unit ĠJoin Attributes 967 42194 dra fts Ġtilt s AU CPR ĠDownload able ĠPosition Sizing lie ge 9607843 137 panda server Ġfwd py QUES TIONS Sol ucion cart e Ġemit ting ('\\ ',' Ġerase s facet grid Pg Rnk trig s rub bs lac ion Generating Faults recent tempA recent tempB 4408 9605 MAG NES Manage ment CCD s Clean ed ĠTrading Calendar Eigen vectors Ġcas o subclass ing cir rus HTTP Response Ġinject or 2110 3583 BP valve Fx Rate Bz Me ĠMonte Carlo BER OS ĠScatter ing ĠUnique Values Ġelt name ĠBO SS Pick ler ___ /| 6566 1287 Dock s Vir ginia Ġrem labels DECOMP ESSORS compatibility Warning EXP TYPE alloc ating scra per scra mbled Ġunders ample imap killmapbin 3484 69228 pseudo color ĠNeuro ML ĠSpatial Join ĠPS Fit ĠAtom Group ĠInv oking LT Water н а ĠGROUP ED Ġcel ltype åķĨ åĵģ ĠLatex Error \\. | Don ors bare me Ġsav itzky (.* ? ('=' ))) ĠAnt onio Sens ations LOC ATIONS Ġ(+ /-% Ġdomin io ĠGTK Agg FRAME WORK 827 941 BLOCK S vac ancies lights lategray ĠSat uration Alter nate Ġ(< ==> capac itor clustered GroupName ĠLabeled DataProvider 0117 24811003 ĠPl ugins dml c Scroll bar oauth lib ='./ '): *[ @ stemp o Ġĉĉ Ċĉ ĠPER SPEN ĠDT Matcher Accessor Methods eth z ĠSTART ED ĠGeometry Collection ĠGeometry Convert ĠChain Consumer Ġmtx s æłĩ çŃ¾ Sync ReplicasOptimizer ĠMarker Array Ant arctic ĠRF Matcher ĠGenerator Type Flatten RowCoder FIT TING 0003 00 7566 368 accum ulation Quant itative æĪIJ交 éĩijé¢Ŀ ĠLev esque Exponential Loss fct n '," -- Constructor Offset 508 25 ĠLines Intersection ĠLines ToPolygons ĠVelocity Table Ġ################################################################################ ########## ĠKEY WORD vincent y ĠNS lackSSVM ĠFlu xes ĠGer vais ĠRaster LayerStatistics Inc ident ĠNEG ATIVE Sli de nuc seq ĠFields Calculator Latitude Formatter íķĺ 기 íķĺ ë©´ Break point Indexing Error NDArray Iter éķ¿ 度 ('* '). 488 47 ĠIC MP ARE AL Byte Processor ĠGA EL Design Info Ġmotor cycle alph arad èĤ¡ 份 Ġdock Widget bmp Filename Ġphy lo Ġphy laid ĠPOL Y ĠExpectation Configuration Person Dict 558 32839 Ġinequal ities gover nment Ġcosmo logical Ġtor rent ffit list Ġkr nl ä¼ļ 计 PROP ORTION Pal atino Ġdop lots Quality Factor SARIMAX Params æ¶ ¨ refl CloudBlock Ġobst ime fontdict Object Ġneuro science Rob ots Weld Char Ġmr info Ġrational ize ĠMathtextBackend Bitmap Wal d Wal dur ^+ `, Ġecon omics ĠCast ello ĠEcl KW 1905 63 Ġsdss GalexTransform ÃĬ ý ĠHy psometricCurves ĠPull s åĽ¾ åĥı aabb cc ĠLogging Mixin Spherical Representation !!!!!!!!!!!!!!!! !!!!!!!! }= $' Dire ctor herm norm Choo ses Fancy BboxPatch dvipng hack Ġdepart ures ([],[ ]) //////////////////////////////// //// 599 43846 indep endant Cast ing Ġko valenko Atomic Data ĠPOST PROCESSING ĠComposite Affine declar ations declar ative Ġroach d Chan Selection pand ahive ocur ve ATTR S ç¼ º Ġlift ed ĠCatalog ue DataAdapter TestBase angstrom s Ġutili sed Ġpacf yw Sky Blue avo ided 0168 3795 ĠYahoo Grabber Ġhon da Prev Length 088 35 ĠDruid Metric ç»Ħ åIJĪ ç»ı 度 ĠHidden Layer deli dades teo Swiss ĠGD K ĠGM svm Ġcate g Ġprox ies Ġsac cade ĠRAM disk {}{} {} ################################################################################################################ #### ################################################################################################################ ######## Cos mic loan ed sidebar button Ev No zhang xiang Ġìķ Į #-------------------------------- ------- Ġclon able ĠGENER ATED ä¹ĭ éĹ´ MID AS Ġsrt list аР² Ġhomoscedastic ity Ġmam mals ĠCentral OutputPlotter DISC LAIMED Ġopener p canv astools ĠJoblib Exception Frozen NDArray ìĭ ľ ĠCZ CE thir ds ĠCE BALERT Ġrele vent ĠBro ok ĠBro oks Lambert Conformal lav copts ĠHub Lines ĠAdmin Console Ġvo layaf UNIC IP ĠRandomPoints Layer ĠRandomPoints Extent ĠRandomPoints AlongLines fork server Ratios Per 816 26524 918 109 Ġnats ort Indexed NDArrayMixin srv ID ĠBcolz DailyBarReader distort ions ĠPresent ly Atten List mint ime GGG CG (') ', -{}- {}. STE ERING Vectorized Indexer deprec iation 1402 686 gradW y LAM BDA peek ers Qub its ĠHAND LERS Stub Out æĬ¥ åijĬ ---------------------------------------- ' ĠZe iss Ġå¤ © Ġcanv ases SID R "# " addNew Label ĠHit ting Ġmkl Obj Ġsupers cripts Exports Q kJ mol nch andle ĠBeng fort bea con 2828 28 ĠSelectBy Location ĠSelectBy Expression synchron ize spacer Item Represent ations 3547 6425 ĠTestDPGMM WithTiedCovars ĠTestDPGMM WithFullCovars ĠTestDPGMM WithSphericalCovars ĠTestDPGMM WithDiagCovars ĠTestVBGMM WithTiedCovars ĠTestVBGMM WithFullCovars ĠTestVBGMM WithSphericalCovars ĠTestVBGMM WithDiagCovars Ġavgs im Ġpsr name ĠCALCUL ATIONS RespectsEpoch Uneven Ġweig ts employ ee ĠExtent FromLayer ĠHadoop Copier 4519 4484 ENG INE Ġ"({ })". infomax SpinBox airy zo ExamplePoint UDT ĠThreadPool Executor Ġbessel j TreeView Column awa reness Labeled DataProvider ãĥĩãĥ¼ãĤ¿ ãģ® Rh O ĠPlanet ary Unt rained ĠUC SC >>>>>>>> >>>> Preprocessing Mixin RDF S ĠWR ONG persistent Name ĠMarvin Error BREAK POINTS GEND ER 2096 09 ĠPatr ick ĠCompany Corpus Ġepw weatherfile ç»ĵæĿŁ æĹ¥æľŁ Nor ESM Ġton ights ĠAux TransformBox 3212 20 ĠOsc illation favor ites Consumer Type Subhalo Mass Dz cs ĠTER M Reson ator ĠDestination TableName Ġbatter y ĠDraggable Colorbar ENCOD INGS gammaincc inv Ġgall eries ĠMart elli Ġpyx ley ĠPointsInPolygon Weighted ĠPointsInPolygon Unique Har vester Ġrepos itories Ġvide onames Exclude sIndex firstWords File Restart Error ĠtestCustomOptimizerBy String ĠtestCustomOptimizerBy Object sme ctite ĠtestWith MultipleUpdates ĠsenkouSpan B Ġephemer is 解 æŀIJ Ġë§ ¤ åįķä½į 为 Grain Size Tran pose Ġrefe ree Ġµ V ĠAuger ParamLog Pending DeprecationWarning Ġtrib utary 6824 8579 lcv Matrix fiel da simul ators 2937 0834 zyg ote HIERARCH Y 8570 331885 åĽł 为 16227766 01683795 Ġstokes lets dHistE bar nsp ins ĠLogReg Matcher Ġìĺ ¤ ĠCOS INE ĠReproject Layer '(?< !\ 8229 3382 Ġ__________________________________________________________________________ _ Ġ864 00000 PUBL IC Ġ"-------------------------------- -" åĨ³ çŃĸ occs olid johnsons b postrop hes Ġ``'- '`` Ġdrill down }__ ". Ġtrump ECHP ĠBasicStatistics Strings ĠBasicStatistics Numbers },{}, {} Autos ize Autos ummary Ġned ved ĠtestModelFn Scaffold Ġencompass ing DirFile Txt ĠPolygons ToLines Ġëĭ ¨ Ġëĭ ´ Bon f arbit rage Ġric ci Ġric cati Ġextrapol ating ĠExtractBy Attribute ĠExtractBy Location Imm ig jav ase Ġvibration al ĠKnow ing Ġblan ket ĠQuadr ature imagename list ĠFIN ISHED compre hens ĠRandomExtract WithinSubsets ĠRandomSelection WithinSubsets WithShuffle Autosize ãĤ¯ ãĥĪ ĠPointsFrom Lines ĠPointsFrom Polygons ĠSecurityList Set ĠRandomPointsPolygons Variable ĠRandomPointsPolygons Fixed ĠDensifyGeometries Interval 5771212547 1966000000 5771212547 1970000000 Away OST Typ ical inver tebrate ("------------------ ") Household Type Bright ness 9953 9577 6733 8089 Ġoldf ont Ġoceans ar requis ite Ġmodelica res ĠInProcess Kernel Ġlabelt op 2368 9075 ש׾ ×ķ×Ŀ Better BooleanField pine apple asim han Ġexa usts Ġexce pthook ĠNear Miss ĠUTI L ĠVisible DeprecationWarning ĠSimplify Geometries Ġ.................................................................. ......... xBPM Real Ġrelev ancy quasi period plotconst Q ĠtestBoston All ĠDeli ver 4687 4778 Ġliqu or Ġseismo gram 9865 1912 Chis q çħ § defic its 8715 456 enets vmDf Numero Lineas ĠMEAS URE çª Ĺåı£ metabol ites ĠEvolution ary ĠConsumer Solution DECOR ATOR åĿĩæ ¯ı Chromium Perf æ»ij çĤ¹ Finger print zinb wave ĠSing h ĠtestWeight Column 3495 345 Stra ight indict or ĠSilent ly Ġscand als 9588 7839 ĠTextTo Float Ġìĸ ´ Ġannihil ation éĤ£ ä¹Ī OWN DATA ĠSettingWithCopy Warning æĶ¶çĽĺ ä»· stair step ĠTOL ERANCE ĠNar asimhan 7414 2013 ì¹ ĺ imil ate Ġathe ists Ġesto ques 1625 0302 2737 0049 6365 141 09495 602 wikit able Melt ing ĠMultipart ToSingleparts firmat ory IdxByGapMax PhylDiag AUTOT UNE TRNASeq Database firest ation tay lor 10208 346 vectorCC x AssertHistory Count LoadAndProcess FixedPy 7784 379 otrans piration Ġgpa va olsho i GraphLab Util ä¸Ģ段 æŶéĹ´ Else where \.) ? gfd l oce ans rff tf louv ain ĠTup lify athle tes Ġchrist ians ĠpathOut Nii 7773 1835 magneto static ĠFeatureColumn Test ĠHistData Csv Ġantig rain ProducesExpected Outputs Dl Func Ġremedi es ĠIPS hell ĠCoc lustering ("============= ") ĠLinal gError ĠOle ggio ugos lavia ĠJO INT 8480 35476425 8713 7846 osend orf 283185 31 ĠImportInto PostGIS ĠDECOR ATOR _'+'_ '. Neuralynx IO pernic us mocc asin ivode ship 13134 23 13124 33 77445 997 ĠLinReg Matcher 05485 803 39020 262 72302 393 sPAPER SIZE inhover M sedf ct orinfo plotw Ġaude tte Ġows lib chipeak orinfoplotw getcw du getPressure Drop ĠSQUE zE ĠOsend orfer layHChk Boxes ĠDataPanel Source fnlw gt 143745 09 ONear ZeroVarianceFilterer Ġmomess o 240183 64 wiseLinear SoilModel SEMI MAJOR 070336 96 34273 127 ĠparametersFor GeneratingFaults ĠcallBig DlFunc 879747 64 ggdh ines 430548 25 47102 322 totalsqft calc OTET omek 2925464 970228 ĠSVMM atcher 56934 89 74776 844 fastCopyAnd Tranpose GridBag Sizer OfAerosol Mode Ġdagbld r STRoNO oM ĠNonPooled PanelOLS ĠLocalZoned TimestampType DurationOfThe Experiment 65661287 74142013 348469228 3495345 zhangxiang xiao RespectsEpochUneven Batches 8570331885 190563 848035476425 7312 " '. " ({ # ----------- ( ('\ * >>>', , %( , -% - ')) - {}". 0 254 0 848 2 6666 3 048 3 324 4 999 4 154 4 157 5 137 5 13725 5 270 5 689 5 333333333333 7 889 7 0922 8 267 8 244 8 276 9 45098 < _ = ([- > * > ')) > )' A ce A round A QC A rai B CC B bc B iases B GC B roward C BC C Float C anceled C zech D c D v D il D bar D err D EST D fun D AA D Hist D ade E mo E state E gress E lev E ELS E lecMeter E numerate F tr F DE F ied F UV G X G AB G xy G RAN G abor H AR H dr H UDF H ASE H anning I at I df I gor I seg J a J am J AP J agged J Mh J uMEG K y K CD K afka L m L An L RAP L ITERAL M ig M ont M idget M ises M antel N in N test N ights N err N ake N ED N Img N PLayers N PointsArr O l O GR P v P ump P ear P ac P US P HE P ALETTE Q uest R rat R bb R square R agged R yan R ubin S old S ess S FL S dk S nip S addle S hips S NAP S ersic S QUARE T ro T ight T ec T ele T PI T apping T Close U WA U nob V g V y V AT V acc W q W ho W atch W ages W igner W DN W isconsin W erte W perKm X h X in X log X nan X cols X mx X MIN X UE Y I Y e Y m Y index Y et Y scale Y RR Y CbCr Z on \ } \ ,[ \ ]\ ] `: ] }}} ^ / ^ ([\ _ '. _ +' a P a ol a dim a erial b arn b ms b ip b ram b xp b risk b oll b ureau b renth c ort c ray c ump c ws c udf c sto c StringIO c bases c ucumber c igar d label d te d his d mf d md d widget d wf d uncan e op e key e gree e bd e mented f co f base f coef f initeness g X g ax g path g act g ating g json g pickle h j h q h ll h arr i list i Freq i ety i wgfa i GridVisibility j z j uly k q k dir k ay k ular k plus k rig k scape l mask l hist l vec l ws l itter m G m oth m olid m oral m iou m nnb n W n re n import n pred n diff n rs n Row n segments n If n MSE n Freq n Exp n Dim n Final n Cells n Examples n Saving n ãģĤãģĤãģĤ n rays n lake n mbr n RAVG o ith o os o Graph o Collection o yy o zonide p V p up p str p iv p ated p xx p ins p fac p workdir p msk q E q size q graph q job q sec q Values r E r ut r metric r mi r vecs s val s ir s ump s ats s dt s net s bins s rgb s hen s ngl s AMAccountName t Change t Generating u ix v cal v table v ibr v sync v bgmm w fn w ak w seg w kl w ocs w tyra x pt x fe x real x full x eval x Size x br x deg x ctr y D y lo y attr y au y stop y vec y lists y Status y Tr y Times y rose y cbcr z L z col z ticklabels z pf z Sq z tv z Gauss z gelsd | ^{\ } """. } >". ° åĽ½ ¸ ¸ » æī¾ ¼ 西äºļ ½ Ķ  ¢  ¨ à ij à Ķ ì § ì Ĭ ì ĨĮ í ĸ ĉ ĊĊĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ort Ġ 786 Ġ ä¿ĿåŃĺ ĵ ¤ ł · ł Ī ĠĠĠĠ ĊĠĠĠĠĠ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ čĊĠĠĠ in os in sp in stru in filt in estyle in iBatch in links in Img in consistency in folist in feasibles se diment se astar se ktor at pol re vent re number re fft re pay re hab or l or mouse or imetry on key Ġt us Ġt ansform Ġt In Ġt new Ġt scale Ġt corr Ġt rep Ġt ini st ays st ools st iess al ker ar type ar ight ar ley an um de i de script de yr de zing de gook me lf Ġi up Ġi list Ġi width Ġi lines Ġi dim Ġi cv Ġi step Ġi seq Ġi ster Ġi Axis Ġi lbl Ġi vp Ġi gf Ġi kpt Ġi lastik Ġn res Ġn default Ġn gen Ġn right Ġn cm Ġn active Ġn coord Ġn ny Ġn hex Ġn boot Ġn bands Ġn controls Ġn jit Ġn Pix Ġn avajowhite Ġc j Ġc ma Ġc urn Ġc so Ġc rt Ġc feature Ġc riter Ġc tree Ġc bb Ġc rvs Ġc nz Ġc ccc Ġc uve Ġc lashes Ġc iftify Ġf plot Ġf fe Ġf ys Ġf map Ġf lines Ġf mask Ġf colors Ġf vs Ġf dx Ġf alt Ġf Info Ġf isk Ġf Non Ġf Bits Ġf Modules Ġf opened Ġf perez Ġf rappe Ġf amiliar Ġf sencoding Ġa T Ġa ms Ġa mod Ġa Err Ġa ffiche lf Funds Ġp L Ġp unc Ġp pos Ġp ear Ġp pd Ġp ier Ġp gram Ġp context Ġp cp Ġp bio Ġp sth Ġp infl it ab it ational Ġs print Ġs grid Ġs sq Ġs sy Ġs dx Ġs sl Ġs naps Ġs lyr Ġs pacings Ġs anitized mp re ion ic ion stable en ron en Lim en Sel ct ick ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠ es n es la lo pacity Ġin np Ġin gress Ġin novations Ġo Data Ġo td Ġo Axis Ġd gs Ġd scale Ġd gram Ġd ued Ġd vio Ġd zs Ġd HS Ġd ssy Ġd svar ut ile ut ical Ġ' [[ Ġ' !=' Ġ' ----------------------------------------' ing Error pe tr Ġm ata Ġm nt Ġm str Ġm ib Ġm range Ġm sw Ġm cp Ġm mis Ġm alt Ġm occasin Ġe msg Ġe Head Ġe DisGo co od Ġre num Ġre lim Ġre lied Ġre servation Ġre paint Ġre structuredtext Ġre venues Ġre sembles Ġre beccapurple ge ocentric ge limagefile ): , ): ])) ): (\ ): :]] Ġb label Ġb ore Ġb exp Ġb vals Ġb ry Ġb chr Ġb ayer Ġb renth Ġ# ? Ġ# !! Ġ# ::: ed t ed ical ed ward ed ouard ic z ic icle Ġw z Ġw age Ġw ings Ġw nd Ġw mape Ġw ghts Ġw Roi ur ment ig m Ġ1 105 Ġ1 356 Ġ1 107 ata u un st un int un ings un agg un determined un fair un folded Ġ0 01 Ġ0 341 Ġ0 361 is Anchored is cera el ig def matrix def nom def icit ol df ame nd li zard )) ][ )) ][' Ġfor cs est illi est oq ot eq Ġif e Ġif rame Ġif max Ġif req Ġ[ {}. as name as can 00 97 00 40 00 714 00 8080 val d id A id F id list Ġas m Ġas id Ġas pandas di atom di ppid () ]]) () ``, () ]* Ġis int Ġis color Ġis output Ġis Boost Ġis interactive Ġto u Ġto plot Ġ" = Ġ" ######## Ġ" ('% Ġ" :") Ġ" ॠter ling ma ga ma kers ], )*( urn e ĠT et ĠT rib ĠT ak ĠT PR ĠT itanic ĠT AVG ĠT BinaryProtocol qu s tr ized th g th oven ha xis ha wc Ġy transform Ġy sample Ġy dist Ġy lb Ġy shared Ġy cen Ġy scales Ġy TextPos Ġy oghurt res v res cent ch ile ch old ch rm ch olsigmainv ad mi ad orn ve to set Filter set minus set Bottom set InputCols Ġr vel Ġr sq Ġr scale Ġr delta Ġr ater Ġr tp Ġr sphere Ġr hrxn mat files mat thew Ġst g Ġst ance Ġst urges il lace ') ]], ') }}, ]) ]] Ġ* ***** ime thod (' === (' $', (' __') int ime int SpinBox Ġ- * lot lib Ġ""" ... Ġ""" \\ Ġ+ ---------------------------------------------------------------- pt on pt max pt ree Ġg im Ġg dict Ġg bs Ġg hs Ġg rained Ġg Sig Ġg Mac Ġg drfs __ == __ '" __ ))), ex lcude data To data Length data Unit data Changed data mining name less up freq up datetime up seteq ode ca ke ttle get Table get Field get Sum get Link get Script get Selection get Estimate get Coord get Fluxes get xrdname get Quote get HandleInvalid ab ular ab ivars label weight Ġex o Ġex er Ġex tout ax bot for ums ĠS AT ĠS LO ĠS lack ĠS cr ĠS quad ĠS RF ĠS plicing ĠS NOW ĠS pencer ĠS lightly ĠS acks ĠS DAE Ġco vari ri pp ri ang Ġdata vision Ġbe cuase =' * =' .. =' >', Ġx ab Ġx ps Ġx Data Ġx params Ġx rng Ġx fmt Ġx Train Ġx offsets Ġx shared Ġx doctest Ġx ranks ĠX O ĠX h ĠX avier end members Ġnot ional type D con sc con rad con sonant col c Ġor cid Ġh bo Ġh format Ġh vm Ġh Ns Ġh couple Ġh omer Ġh oneydew py t py u py obj py Pol ĠI an ĠI ML ĠI FO ĠI seg am ssymb plot Label ĠP g ĠP lo ĠP CP ĠP OPS ĠP lasticity ow ers pp oint ĠA perture ĠA riel ĠA ftPanel Ġu limit Ġu pto Ġcon ve Ġcon nd Ġcon forms Ġcon ductor pre act pre cond pre cent pre fill pre parser pre leve '] =" '] +" '] #, ĠC ot ĠC ri ĠC ols ĠC ME ĠC As ĠC BC ĠC ALIB os hort to Py to mass to uches Ġtest assign Ġtest Streaming Ġtest FromCSV Ġde pp Ġde ms Ġde pi Ġde gen Ġde process Ġde pression Ġde accumulate Ġde epskyblue (" *********************************** ans combe Ġwith ing Ġwith Column ĠF lo ĠF MT ĠF FC ĠF ullyConnected ĠF ROZEN ĠR c ĠR py ([ ]): Ġval eur ange om Ġax x Ġax name Ġax Txt Ġax twin np k np cond np almer np iggy Ġfi ction Ġfi rt Ġfi delidades ub utes ub oz ub seteq Ġ3 100 Ġ3 87 Ġ3 144 Ġ3 950 test m test x test path test var test Set test FromCheckpoint Ġme p Ġme ny ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġres file Ġres how Ġres orted Ġres umes line to line search ĠD os ĠD sc ĠD ry ĠD sa ĠD CE ĠD inner ĠD CS ĠD WI ĠD aten ĠD onoho Ġlo p Ġlo co ") ][" 01 10 01 74 Ġcol id Ġcol sep Ġcol lege ns id ns plit ns plups time index time To time context time Points time Element Ġse am Ġse vered Ġse micircular Ġse crets Ġse dov Ġv plot Ġv ps Ġv color Ġv ark Ġv rad Ġv sys Ġv OBO Ġv orticity file data ly b ta up Ġarray minussrc out t out w out flow out ils out varname path file path List path less path ological path InpNii pro ds pro List pro fname min Y min ne min count min dens min imization Ġk G Ġk ic Ġk ve Ġk dd Ġk rat Ġk rev Ġk iller Ġk haki Ġk olmogi ĠN freq ĠN Bin ĠN CS ĠN uttall ĠN athan ĠN VIDIA per ate per week per HM ces o bo omer ment ary str ich ĠL amp ĠL right ĠL ift ĠL IM mo ar Ġon adata index Map max D max time max maps max perc df ish df tu df actor fit sol True Positives Ġpro hibited class Sum [: ]* pect ives dict stack te on te thys ĠM ont ĠM CA ĠM DP ĠM EDI ĠM USECONDS ĠM ichigan ps name ps nd ps dfs Ġmat utils Ġmat Shift Ġan ame po e po coo Ġl limit Ġl sig Ġl Segment Ġl Special app lies >>> |\ shape A Ġuse map size X Ġfrom arrays 10 2016 10 91 10 237 10 373 iv ide iv ory Ġpar limits Ġpar achute learn File Ġlabel xys Ġnum Genes Ġnum TopFeatures Ġnum Minutes ĠG SE ĠG lobe ĠG Tm Ġ< ' Ġ/ __ Ġprint mode ore ad Ġstr align us ch lib panda Ġma inv oc curring et ches ber ID pl k ĠRe ally ĠRe corder sc s Ġname gen Ġpre parser Ġpre alignment Ġpre ql Ġpre parator mb kmeans ick ing cl m cl pmn Ġfile Object Ġfile Extension ĠE c ĠE ig ĠE pol ĠE KF ph ery Ġset linejoin Ġset linecap =" \\ =" +") date format ag A ag B ag ric train Predict ms im low l low freq ĠB h ĠB id ĠB ary ĠB right ĠB IES ĠB elief ĠB asin ĠB YearEnd ĠB ollinger ĠB jorn sh go sh melkov append Row Ġun roll Ġun relevant Ġun freeze Ġun declared Ġun necessarily Ġ5 22 Ġ5 87 Ġ5 26 ip ix ask directory op ters Ġthis Plot log me log rams log probs log Options key func key Name key ormouse In set In Batch In Order In WorkingDirectory ast eval Ġen ame Ġen suing rid ays ĊĠ ĉĉ ĊĠ ĉĉĉĉ Ġle monchiffon da de che types 99 92 99 69 Ġcomp ts Ġcomp iles Ġtime tools Ġtime Limit Ġtime Since Ġint frames ant ialias 64 34 Ġclass id Ġclass ifies 0000 301 Ġ`` ~/ ĠW IND Ġmax m Ġmax Index Ġmax pars Ġmax Err Ġmax evals Ġmax Depth Ġmax Emiss ord d num cell num Motif num Pools og lis model Id Ġfe b Ġexpected c Ġexpected Image Ġexpected Dims rent al plt silent add Node add Point add DockWidget add Follow 12 09 12 90 12 83 Ġget dist Ġget Max Ġget tot Ġget Info ĠO Y ĠO DT ĠO DBC bs l Ġbo lt Ġbo ught las mid Ġ__ ___ Ġmodel no Ġmodel grid Ġmodel Type Ġmodel Id Ġit max ()) )), tric nt sub f sub Index sub window sub bed sub triangle Ġvalue minus ep ad ep rice Ġcheck by Ġcheck grad Ġplot figure Ġplot On Ġplot Mask Ġplot DirName ix in ix tow map ce map Handle Ġall cols dir cg sum stat sum Int Re sets Re batch Re create Re wind Re views Re versal Re usedPySparkTestCase Data Location Data Industry 25 02 25 30 25 59 Ġline Width Ġline Style Ġline ament Ġline inestyle sing ler Ġfloat FixFormat Ġpd l Ġch ances Ġch iller so lo Ġdist name Ġdist ribs ree ce ree ks 11 15 11 100 11 118 Ġest e que en 32 95 32 333 32 397 32 225 unc heck Ġmin sh Ġmin fmt Ġmin pars Ġmin Count Ġmin TF Ġmin Population Ġinput Str pi mage Ġ[] ]), Ġz a Ġz line Ġz confint ng al ng en ng ood color Space color blind text boxes text backslash cy lindrical cy dippid Ġ\ """ params file params ToPlot ĠIn ters ĠIn icial Ġ10 48 act ocentric ĠY C ĠY cov ĠY AA ĠY ugoslavia Ġ) ]), Ġ) """, Ġpa w Ġpa ys Ġpa payawhip Ġnew int Ġnew col Ġnew target Ġnew tri Ġnew Atoms Ġj K Ġj y Ġj ev ĠH W ĠH et ĠH ip ĠH AL ĠH ists ĠH inv ĠH CP ĠH RF ĠH omogeneous ĠH appy 15 58 05 45 05 37 05 62 05 254 05 9465 Ġlog means Ġlog stddev Ġlog NH =[ ]), are vs tra ite ang ut Ġinter actor Ġinter vene Ġsample infolayout Ġpy ro Ġpy pl Ġpy hawkes Ġ[' /% Ġoutput Line Ġoutput Folder start Datetime idx C idx CS ens ch ĠU SD ĠU NDER Ġla min Ġla kes Ġla wngreen pr std Ċĉĉ ĊĉĉĊ 20 95 20 800 20 375 20 659 Ġ(' " Ġ(' [ Ġ(' ^', ĠThis One dd x pos Entry 33 42 33 57 33 58 33 934 33 079 Ġsub index Ġsub values Ġsub plt Ġsub slice Ġsub menu Ġsub control Ġsub commands Ġsub refline ie mi no sep default ing 201 20 rst ar valid s Ġha ha Ġha xis Ġha plotype 80 707 pla intext output name output path output star Ġ6 06 Ġ6 2361 ger ald new pos new node new obj new lm new clipped Ġ. +) emp resas attr node IN I ug c base pl base spec rib a ĠData Spec ĠData Matrix ĠData Access [" {}_ eld out 66 85 66 81 66 128 Ġrow Count ay mp au ffman ĠSe cu 45 098039215686275 width A AT GG AT MT AT OM }, " Ġsup ress ars aw ars lan ĠK er ĠK el ĠK means ĠK ugel 75 06 75 46 75 214 Ġspec fying ok er ok button use path 88 14 88 85 88 69 fn am grid liner "] ]). 16 12 16 29 16 074 16 881 sample Names Ġpos itivity Ġcor rf Ġcor nsilk Ġro sybrown lines can lines Initialized dist ang dist ractor ak ki ĠEx a ĠEx plain ĠEx pend 35 0000 35 80 35 46 35 297 14 80 14 85 14 49 14 29 14 68 14 1956 sq cap sq subseteq sq supseteq -------------------------------- -------------- -------------------------------- ---------+ Ġalpha f 19 22 indow ns with more group Name ))) [: tt family pol df pol icies pol CalDict count dictstack com od com List Ġ8 27 Ġ8 28 78 80 78 49 78 56 78 72 78 125 78 91 78 323 78 313 den ormal inal is Ġbin ns Ġbin step own harpoon (). """ Ġid no ĠV match ĠV assilvitskii Ġtm ark Ġtm va `. ', rand Seed by u title Offset Ġpath ops 22 19 22 72 22 208 22 247 nd g Ġiter source Ġiter ati Ġiter aciones sp inal sp ending sp alde Ġdate format arr anges 04 24 04 87 04 60 Ġpandas dmx 96 16 96 74 03 89 03 969 ])) - pon ses the is the field column Names Ġstart Patch Co le trans istor ĠNot A ĠNot ify ĠTest Table ĠTest Plotting ĠTest Common ĠTest Coords ĠTest StringCoord 02 38 02 69 02 388 02 879 dim er Ġmo ma Ġmo ons Ġend RollIndex Ġend PitchIndex dot blas Ġ{} ] Ġ{} >>|\ match sort SC ENARIO threshold Probability DI VIDE Ġvert icies ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠNe urons +' ( +' *. mf m Ġeigen face ĠAt A UN DEF eval Dir su ck su ses su itable Ġang lim Ġlimit by Out ToServer hi ers hi ppo ML D arm cmc Al varo Ġmain Thread Text Encoder ={ % dat en dat enum Lo S Ġgenerate Sequence parser info Po inters AD DED AD ATAGDP Ġerr colors LO X inst itute Ġold seq Ġold lace Ġsin B nc igene ĠMe te ĠMe chan Box Size Box styles Ġconstant power 48 90 hat old Ġtask name Ġdb col 56 32 Ġscalar Bar down hole Pre processed Ġref logprob stdout Buf Ġrec num Ġrec ruits ĠGet ToolBar nb clusters nb Of Ġroot stoconsider eq data Ġdim grey ĠLog Update curve to Not Divided ĠGaussian Filter TY D '\ ] upper Gyro char terr Ġprediction Step Get Geometry Get Nbins ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġxy t Ġmy d Ġmy ID Ġ:] ** timedelta index Ġignore Expr obs ids Ġ'# ') Ġ'# '. Ġpen ultimate selection Model Ġ'- '), Ġ'- '): Check Stocks Ġkeep LastCheckpoint Ġ'\ | Line width Ġtheta Opt Run Time Ġmpl stereonet Python Pandas Python Graphics cut ting Ġser p Py dev Py PI TH ESE TH AIL Ġsa piens Ġlocal dict meta var Ġpick ler Ġdrop Duplicates ret step Ġskip list cel ltypes hs la sig lay 89 10 src List Ġseq run Ġdest fn Ġdest Bmp dec i imp recise Vector view ĠPre Plot ĠPre liminary ĠInput Layer Table Node CO EFS Ġcomple ters case id Ġlw rk Ġcalculate Accuracy Ġconnect Set timestamp ed Ġentry Num Ġjson path parameter type ,), )}, ("% " Mat teo Ġ$ $$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ Ġresponse Atlas )+ (( OP C Ġ14 20 ves per Input Latency correct ing agg context Ġview values Ġcla he ern est CE FA 79 32 79 20 79 04 fast tree cost Matrix light cyan clip d clip w status dict )" \ ert os sor ry Color Button Color ado Color Pattern EX G tag Me RA DEC Ġsql df Ġ\\ }$" 59 66 global Max Ġmonth range MS olver ĠAs ian Ġaut othread ('% %% ĠMake Hist Ġvs l Ġvs nk two StateButton Ġjob list nr v nr alph 93 172 ĠSh melkov events list Ġmeta pmf marker color win len Grid gen ĠGrid Lines Ġflat packages neg ot neg ativity DATA FOREIGNTRADE Spec ifier simple Tokenize 82 0000 prop het Ġpatch co Ġpatch Label TestCase Args ble degook }'. ". ĠGeneral Arch 72 98 72 1313 signal Update DO pt Qu art fl ds Ġna Port Normal IndPower interpol atation br uts served Components ĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġdd df nu List em ulation Ġhash ers Ġhash tag Ġocc df )- ((( CC I CC DF CC LM ved rab NE B wx RecordMouse Multi Point Dis connect Ġround to Train View scan mode scan View By rd By News By BatchSize ĠPy Plot ĠPy FVCOM Ġra ck tot list HE IGHTS Tensor board Sub s Sub mitted wave dec >` : Ġli mo 180 30 Ġdat ylab 53 04 Add ition Ġsrc Col 62 3387 help Menu ire fft Random SparseSplitter ĠOne Class common Body Ġmp f GT mI pc nt pc ca CL K Ġlon lim actual Size Ġpys ide Ġpys ql ital ian CD P ĠIPython Kernel tex tarea fits ByRegion ESS RUN Ġcos B Ġda ub Ġda isy Ġda wsn 52 65 Ġte ak rep ulsion Batch File Batch Five 00000000 4 lars mans Ġopt a mar lo mar kets pg sql coordin ator Ġsafe zip 2015 0513 Ġorigin ating Ġavg z Th anksgiving scalar Map ĠRes ume .+ )'), ĠOther NdarraySubclass phase List ĠInter p selected Size subject df Ġ24 000 Ġgrad p cum trapz include mask truth y cmd Factory tab la Output Latency dy z Sp ots CR T short Symbol ĠApp lics zone info ann ier HT Water With Core With Condition With Override Ġord re æķ°æį® æĮīåij¨æĽ´æĸ° ĠNo Fit ĠNo Op ĠNo Client mk s Of Transport CON CURRENT Ġ'< >': LI K ĠOut Class ĠOut come IR D ica Hook VER IFY ãĢ Ģ super cells super vision Session s ĠAR TIS ä» Ĭ VE GAS allow Jagged SP DK incre f View Cmd ĠCategorical Block Tra it ------ ' }$ ([ ero y ĠTree RecursiveSR ĠHe iman Ġpartition ings Ġdy k Ġdy adic ĠFile names ĠFile Manager cr dt Ġ80 86 mun et Results Dir åħ ± IND ER IND ONES Ġinv K calc int Ġ64 6 ĠDis criminator Event Ranges CG CM Ġtruth LSTM 101 01 101 11893 ĠNormal ity ]') ]) seg v hy drophobic dep loys Ġms coco Cre ative çļĦ æĸ°éĹ» çļĦ åŁºæľ¬ä¿¡æģ¯ Read Data Trans l bi partitions WH RC Ġtp val From Hist DD R Ġclip x tw t stderr Buf ĠEn thought Metric Provider ĠFigureCanvas ZInline 128 12 SH FE SH MR PY OTE ĠTrans Map large col Encoder Model PR IMO gl AB Ġexc ited Ġborder line ĠRegression Model ĠSub sample Ġforest green MC AT 99999999 998 rv n ensure dir '% (' '% (( ]} ))) ĉĉĉĉ Ċĉĉĉ TC F Des cale zy nski Ġsimp x Ġstar ter Ġstar ve indicator Of wind ers Ġasc dt Ġcmd parser Axis Value specific ations Gaussian Power Ġembed der Cell Center Ġminor Locs ĠIter atively NO ME Sto res Ġpk calcint Ġtools divers NG ram wt file Ca culate rl shift Var name Ġsynt eny Ġexpand tab Ġns ld autos ave ĠHTML Formatter ĠFree ze Best CrossPrice Best SparseSplitter Ident ities Filter With ĠFROM NODE ĠVector Indexer Ġtex font Ġtex command Ġchart reuse UB E ned y Ġpool size Ġgra cedb Vs K sca pes expect ing 105 12 105 077 126 367 multiple tests TA AGT ABC PeriodIndex half Duplex fpr s ('< ', Ġclosest Points Ġmouse div Ġer fa æĹ ħ ĠMock Encoding bre msstrahlung beam Local ĠAS GD MPL ATES observ atories Dialog Data LA AS ........ ...... Ġå ¾ And Time And Other Ġrv raw Ġ? ", samp lers Loss Ant ĠSave Format 800 7 Ġcc w Ġgap minder Mod s Mod ulo lv plot lv mpdf optimize DocConcentration Ġbr ca Ġke psilon Be at Be ads Ġanalog signals hal ving hal iscera ĠAxis OrderError Ġfl oralwhite MO E Ġunpack s Ġunpack bits Ġoptimize DocConcentration '$ | Rest riction ric cati hex a Ġlab ela Ġlight grey Ġlight cyan Ġlight pink Ġlight gbm Ġlight steelblue Ġlight seagreen Ġlight coral Ġlight goldenrodyellow Ġmi lisecond Ġ75 2 Code d Ref Gen Delta f Delta FP Ġll path Ġll db Instance UID Panel Fixed Struct s pv sync pv cdrom Raw ConfigParser Argument TypeError Ġrhs U Ġut ts dash v Ġastro query share z NING STAR Ġautos ave 112 9 Ġ'') ][ xyz list 901 522 133 4018 Ġgl orot Ġmaster mix Files Dir ĠPredict s EV Ds ĠST AGING Ġvi exog END TIME pb x stock Code Ġbasis Fam Ġmot o ĠText Input ĠText Blob ĠGo lay Ġ{: ^ ĠGeo logy isk it Unit Calculus vd os Draw ings ĊĊĠĠ ĊĠ Ġpow derblue ],' --', Ġep ipolar bp mc Weight Change Ġgb onds Ġtopic DistributionCol Ab ort Freq Raff Ġbeam FSM Ġsquares ize ĠABC TimedeltaIndex åı¯ èĥ½ ĠWrite Disposition Ġmov able phys onect ĠOpen CL commit tor send Message Ġtt day trim n trim ming upt odate robust ly Ġillust ris ĉĉĉ Ċ ĉĉĉ Ċĉ conc unique ĠIs otone ĠWork sheet (. ( Ġsyn ij NOT AVAILABLE stim list ĠShow ing FIG S Ġfrozen dict Ġquant itatively dv flag 185 567 tre ino tre zor ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ PH ONE dark slategray Ġblue violet ĠPRO B GE OP ':[ { Ġperson nes Ġlt ext Exp Scan ĠRE ALLY Ġ01 75 Ġdp w Make Pmf ((( ~( ĠMy Transform Ġstorage Level Ġchrom table sz s Ġtxt node +'. *'): 032 1 Segment Decrement Ġcar riers ĠAdditional FramesContainer ĠSystem Error ĠTH ERE 808 01 dk Task att name Interval Window Ġphot ovoltaic 285714 29 ĠLoc ates 205 6 205 46865 ĠVariable Elimination 2222 2000 Ġdst Col Ġtrade mark Ġtrade ID Ġ(* )" 899 64496 cen z Imp rovement Ġrotate Int Tri Refiner ĠSN PEFF Err ToServer 211 39 ĠPL UG pring green ĠTensorFlow DataFrame 025 1 rx Loc PA VA Ac cession Ġ94 22 feats R Feed Forward sos filtfilt polar izations WE BS timer off Ro T aug CGP ĠRed shift ah u }( +/- Ġpolar on hamming Distance ĠVer ifies ln Z Metrics Cumulative Ġroi Hist ("{ }, ĠEN SG Ġ"{} {}". Ġlam da Ġends with Display Hook PC X irch hoff Local OutlierFactor Mark Prop "])) +\ ĠUS FederalHolidayCalendar Ġarc line Ġarc seconds ((" __ isot opic Ġunion Cells Ġste elblue trade Dict Ġpng s ĠMag ma rr shift chk b Engine ToConn ĠSp ine transData ToAxes 135 9 AY SI LOG PDF è¯ Ń Ġadvan cing Ġweb hdfs four four ĠTri angular ('{ }, uk nots ana de Ġdark red Ġdark blue Ġdark green Ġdark orange Ġdark grey Ġdark cyan Ġdark magenta Ġdark violet Ġdark turquoise Ġdark orchid Ġdark goldenrod Ġdark salmon Ġdark slateblue Ġdark khaki Ġdark slategray Ġdark olivegreen Ġdark slategrey æĮī å¹´æĽ´æĸ° ĠNode Transformer MI KE Gen Network Pl x ĠDI A Build Cat ĠCV X mys vmlight 016 24 pot entiel Experiment Results ĠGe ographic Real ized Real Estate Ġteam Headers Page Edge switch er #================================================================ ==== Abs orbed sam file ĠAlgorithm Simulator TIC KER ĠDep Var Missing Columns Weights RDD 494 170 medium seagreen medium orchid medium violetred 164 4600 ĠFactor ial Energy Of Ġflu ids Ġflu idity Region List Ġ#---------------------------------------------------------------- ---------------- Ġiso forms dip dip hum i hum id COMP UTE Ste el Ste ering friedman chisquare Ġgreen yellow ĠHas HandleInvalid ĠHas NoPredict Ut terance ĠRegular Polygon Ġmt se Ġpot ri Zero TurbulencePowerCurve NS GA dg Data hit ting TAG L Ġmedi umpurple Command NotFound ][: ]- phe mer ĠShape d ĠPos itives Counter s Active Frequency 145 87 limited min limited max Align Top Request er ä¸Ģ æł· Full ProfileSequence ITER ATOR Ġë ¶Ģ primary fuel Ġbot tle Ġforecast ed Div s Ġbi serial fault handler adap thist eller arley Dummy File HASH SUM ĠDif fraction Ġhad n transition State kill Received 922 1 AV ASCR ĠFigureManager ZInline ĠTe on paralle lized Cy Df 964 644660 lamb bda Database Manager vt OrderID 099 49846 ("# " \. [ pres gn pres umably 385 26 116 22 ĠIntegr ator Stop At 655 07 ï¼ī ï¼Į Cent Val Ġwt forms ï¼Ī %ï¼ī Pair Tuple Cost OfTransport ĠQuantile Discretizer rece itas ĠConstant Parameter sink s ĠåĮħåIJ« æ³ ĠåĮħåIJ« åĬł ĠåĮħåIJ« å·´ shot list 035 32 035 35533905 æī ¹ Interrupt ed ney man pex act Ġam cd Rectangle Selector convergence Point Ġdes peck Gene Selection GO nt Dirichlet Eigenfunction udi mentary SW IT photo set 335 97 Binary GaussianProcessClassifier har ath Recall At Token List divid ing Pri mordial ĠField Variable ĠField Def ĠBox plot Phase Stream working Directory El lipsoid ĠPossible DataLossError smaller Equal ĠCA Plotter dar pa '| ,' Property ValueList "}) ]) ĠForm ulation Pu ente ()[' __ ĠPR MS ĠRES P ĠClo ses Ġxt vix gi color gi orgio gi raffe Ax ial imin uit ĠBest First Ġsky blue 6401 88 273 9999850000 Av conv Dif fer Ġiv ory **************************************************************** * Ġbed file 353 64 éĢ Ĵ toggle ViewAction hatch pattern íķ ¨ nos pin Ġretrie ver ĠDrop Shadow bel ie ĠDensity Ortho 777 03 096 767 å° ¼è¥¿äºļ Ġlazy data Diag s History Data kx L 262 144 >. Ġcollap ser ĠHorn ik ĠLogReg CV Blended GenericTransform Oxy dt stain ing ĠPau se ĠEe lam Strict Version æĿ¡ 件 Ġcircul ant vard y ĠNm uestras 10400 826 ĠVinf y ĠVinf z 4237 7838 ĠNoDataFound Exception Camp agne ĠMstar Iary Street Map Offer Curve ĠLSQ UnivariateSpline Dup ont setTick Interval ĠGian tomass projTop RangeMax projTop RangeMin projRight RangeMax projRight RangeMin CrossEntropy Loss OCC IPITAL ĠCarry ing Ġseas hell ĠVeg as invo ice Ġpeach puff ĠInvestig ate TAN H dNd logDp rgc by Ġtgz List Ġ(.* )$', ĠLAM BDAS ĠBIO ES arbit ration Ġmetabol ite ĠNAS A ĠåĮħåIJ«é ©¬ NES DAY lemm as Ġpale green Ġ+-------------+ ----+ ĠDIC OM Ġtrunk length 2069 2515 1929 669 ABCSparse Array Ġblan chedalmond æ¶Īè´¹èĢħ ä»·æł¼æĮĩæķ° cce bc Ġdls combine 0162 8859 01033 349 pagin ation ĠBench ing ĠKV Store PLUG INS ("_"," -") Ġrhombus Base Ġoscil ations ĠFlorisPower Tuned VN AC ĠParasiteAxes AuxTrans MAIL ING Ġartef act Ance stral BOARD WIDTH FigureCanvasQt Agg ĠTopLef XGlobal æıı è¿° }{} {:. ĠGMap Plot ĠGMap Options gridlimits norm Ġtraceref minus Ġurb angeom Ġmediums lateblue Ġmediums pringgreen PhotoB sh PhotoC sh PhotoD sh 73575 888 73575 8882 ĠtestSdcaOptimizerRealValued Features FlorisPower Tuned ProducesOutputs ForLargeBatch ProducesOutputs WhenDataSize TAIW AND TAIW ANDATA ĠåĮħåIJ«åį°åº¦ 尼西äºļ å·²ç»ı åħ¨éĥ¨æ¸ħç®Ĺ Ġlavender blush Ram sey ĠIL LIQUID ĠtestClustering SampleSimple ochem ical ĠHur ricane Ġroma Cell Ġåģ ĩ Investig ation Ġè¾ĵ åĩº ĠinputParamsConfig Local ("``` ") Ġcorn flowerblue spill ID 5724 067 Skin NoFaces eup hausiids Ġaqu amarine Ġconvol uted Ġpygrid tools .\.\ .) Capac itance ĠHello World XAx Len Ġtargarnan val Ġ+-----------------------------+ --------------+----------+------+ SMOOTH ING 5885 3682 mSignal Var ĠoS SET intEnergy i getNetCDF filename consent ed Ġcompo unded cress ie ĠABCSparse Array Ġhaystack Img Ġpalet urquoise ett boom ĠWEEK LY ĠDEP TH éĩĩæ ł· 09725 133 Damp ing Ġapr ès Ġsmask Object ĠStro hmeier Manip ulator ĠMakeSuite FromDict Refine ment Scra per ĠFixedWidth Variables PITCH ROLL civil state Ġtum our Ġoli vedrab Ġlect ure contamin ants ĠAnno ying Ġê·¸ëŀĺíĶĦ 를 mact ech ('---------------- -% efail df ADAP TIVE clos ures ĠAppro aching ĠåĮħåIJ«æ¾³ éŨ Ġtransluc ent Ea Params Pourbaix Entry ĠtestDNN Only Ġlemm ata Ġroyal blue 9437 8087442 TestQuery ExecutionListener Expo Cdf GoodTuring ProbDist ĠtestSdcaOptimizerBias AndOther EMAT ICAL Pho enix Ġcrypt ography Ġ[': % 00149 18 ĠXgboost Classifier Ġorng Clustering owe ek ĠFd mt timeToFirst Interactive Ġlingu istics 6451 45 caud al 1479 3434 ONET IC ofMo lecules syna ptically 4472 136 ĠcreateOrReplace TempView Neur ong Ġvisu img BRA Z 00126 156 ĠJur ie Ġqma ws Ġlegis lation Ġtranss how ROUGH PUT Hart ree tlv dim orche stra Ġcup SODA ĠfPrice Volume exclus ivity perman ences 85098039215686 272 ORIENT ATIONS contourProj Frame ieder stand æĭ¿ 大 kWper K Ġ+------+---------+ -------+ Ġìĥī ìĿ¸ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶ¼ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶ¼ 5979 0391 nug gets Ġssw n Ġleven shtein MACCS keys Flatness LossFunction DrRate Lvl ĠTmpDir Cleaner 4024 1774 Bee thoven astring withmore ĠCrash Handler ĠTimed Animation Ġprincip led GRIDS OBSclim 10892 176 conect ividade """""""""""""""" """"" +------------------+ ----------------------------------------------------------+ 8996 041 Cpp Interface alge brica ĠPak istan ĠDro ettboom 17313 9550825 29339 026 GetEvent Object SNOT EL 99845 843 43939 129 4591038 1334018 DANGL ING 7823367265 645145 9456146050146 312 fKey len infor xn rockets hip Ġindian red 00154 157 throp ods ĠGir shick Ġattri ubutes Ġscv Shell ĠKISA OS ĠVN PAST 94067 27 uiGet ExpScan HEV CW ĠFeatureEngineering FunctionTest ĠCOUNCIL TAX ĠìĨį ìĦ± 课 ç¨ĭ 42497 807 ------------+--------------+ ------------------+----------------------+ 57622 162 EQUIP MENT HMper SM ĠSonder gaard 0992 1315 CSI RO doli olid kastner kyle »¬ ëŁ¼ segt iles ĠtestNone FeatureEngineeringFn Ġresov les Ġalice blue ĠLop haven 10086 163 verthe less radiol arian 95367 4316 duches nay 08385 139 Forcast Day 59758 226 ĠQuasar NP Monosublocus Holder ĠMoos mann 09825 355 \\.| \\. AREAL ESTATE '(?>>|\ .\.\.) NotDivided ByBatchSize THAIL AND 721313 18 ĠnaPort Weights 623387 63 commonBody Setup ĠNoClient SelectedError allowJagged Rows INDONES I 105077 88 FreqRaff inato EngineToConn Mixin mysvmlight file AVASCR IPT 964644660 9406727 ĠåĮħåIJ«æ³ °åĽ½ ĠåĮħåIJ«åĬł æĭ¿å¤§ ĠåĮħåIJ«å·´ 西 03535533905 9327 BinaryGaussianProcessClassifier Laplace ĠDropShadow Filter ĠDensityOrtho Poly 096767 23 342884 67 ----------+----------------------+ ---------+--------------------+ 3462791 0165 PropMinus Trainer GPLVMM iniBatch MYROR SS ĠOffsetUnitCalculus Error Ġ+-------+--------+------+ ------------+ ĠtestEstimatorWithCore FeatureColumns ---------------+--------------------+-----------------------------+ ----------+----------------------+---------+--------------------+ 00131644600 2000104 Ġ/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\ /\/\/\/\/\/\/\/\/\/\/\/\/\/\/\/\//\ TempTableAlreadyExists Exception ĠGiantomass i ĠåĮħåIJ«é©¬ æĿ¥è¥¿äºļ 735758882 34288467 ProducesOutputsForLargeBatch AndMultipleEpochs ProducesOutputsWhenDataSize NotDividedByBatchSize ĠtestSdcaOptimizerBiasAndOther Columns astringwithmore than ! . " '" " (\\ # **************** $ } ' (' ' '), ' ([^ ( ! ( !! ) ={ ) ?") * )', + (- + $', , ': , ]+ - */ . ]') / \\ 0 354 0 224 2 126 2 138 2 136 4 333 4 226 4 273 4 857 4 66667 5 45098 5 4545 5 228 5 29412 5 676 6 200 6 294 6 0101 6 873 6 356 7 294 7 300 8 35294 9 200 9 05882 9 3939 9 882352941176471 > ; > .', > (% @ : A J A ID A PE A ged A pm A acute B ic B FL B pid B OB B iased C f C old C ities C Array C asing C NMF C ARD C ubes D k D ING D QN D DOF E u E ra E ro E log E scal E bins E HI E gypt F ab F CV F ather F NN F UND G I G ID G Object G OLD G lacier G rubbs H Z H um H ING H IO H TS H RR I AS I MM I VAR J peg J osh J oules K l K at K xx K ruskals L BD L maxwell L orentz L MBD M all M UT M toT N Grid O LE O PE O Multi O AutoEncoder O dmr P es P AG P MF P upil P chamber P endulum P NaCl Q V Q List Q AM Q MC Q HeaderView R f R z R us R ick R ock R Vector R chi R LS R uler R VALUE R IDE S ift S plash T ell T SE T ower T EL T tot T ICE U CH U ROU V ote V Phi V RT V apor W Y W it W ang W dot W SN W BA W RF W CAT W atershed W HEEL W MEL X ing X OR X scale X vals X Failed X LONG Y norm Y final Y XS Z score Z xx Z LIB _ $ a col a key a act a idx a qa a IB a Mod a pertures a ortc b Er b ones b lip b eli b SVC b Multi b NuSVR c ata c ind c num c dtype c labels c new c ensor c vec d ari d pred d mon d step d ling d lw d cutoff d jd d DM e E e time e ix e zz f ing f model f ang f pred f ica f macro f reed f lam f ltk g G g he g one g oc g dim g dt g kk g ional h di h spec h sel h gap h gm h ori h wm h rium h amed h nny i N i P i predict i Err j is j array j ub j conf j acob k I k ol k type k align k han k arma k raft k haz l set l lab l copy l left l lier m fit m ms m ug m arm m Input m way m rf m lens m cep m logloss n ad n date n width n classes n means n used n mix n Best n Total n arc n Panel n Lines n Cols n Phi n Methods n Nodes n leq n Notes n Ok n Feat n Iterations o ch o ad o verse o zz o ley o Excel p ans p ant p dd p mg p stc p irls q o q mat q iskit r X r lab r test r ind r params r Err s ick s na s img s To s div s parser s cho s plat t me t and t val t log t mask t Means t ba t Covariance t Vec t Weights t CDS t wee t Initialization t weepy v lo v ul v dict v ign v off v ids v ital v oy w day w yy w rd w solution w MPE x ue x as x first x cd x tsys x NoSignal y T y st y um y title y first y unit y locs z map z ik z List z Mat z shift | `, | _{ } :: } ]}) } "> } <{ ª © à ² Ä ĩ é Ł ì ¡ ì Ĥ ì łģ ĉ Ġĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĊĠ Ġ çĶ¨ Ġ æ¸ħ Ġ Åłmilauer Ġ quenching Ģ ä¹Ī Į ----------âĶ Ń ä»£ ĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠ ĠĠĠĠĠĠĠĠ č ĠĠĠĠĠĠĠĠ ĊĊ in F in ated in fill in year in els in dependencies in comparable in dividus se cur se gy at ly at quantile re vel re mark re comb re uss re cursively re translateUi or na or ward on ian on loader on Motion Ġt C Ġt j Ġt ed Ġt sh Ġt ble Ġt cr Ġt seg er ly er day er cos st ver st raw st ell st Dev al ysis an cer de an de lic de gr de embed de modulation me hr Ġi X Ġi re Ġi lo Ġi dir Ġi gb Ġi chunk Ġi ono he f Ġn shape Ġn ag Ġn level Ġn ky Ġn chunks Ġn mol Ġn rmse Ġn comps Ġn levs Ġc L Ġc ans Ġc fig Ġc model Ġc ens Ġc no Ġc rite Ġc av Ġc xx Ġc ci Ġc fl Ġc ij Ġc dm Ġc qt Ġc rd Ġc dl Ġc avity Ġc assandra Ġf el Ġf test Ġf df Ġf bs Ġf norm Ġf save Ġf inv Ġf kt Ġf antasy Ġa mple Ġa ver Ġa class Ġa ber Ġa ip Ġa fn Ġa cov Ġp ig Ġp pa Ġp class Ġp stats Ġp loth it f it n it ol it ating Ġs B Ġs ke Ġs ul Ġs count Ġs ref Ġs Time Ġs weet Ġs EEG ## . ra ctory ra sa ra cker ion Data es cal es pec es cence lo i lo com Ġin n Ġin pt Ġin args Ġin compat Ġin Img Ġthe func Ġthe atres Ġo map Ġo vars Ġo zz Ġo anda Ġd ge Ġd ab Ġd nd Ġd vs Ġd rink Ġd tau Ġd warfs Ġd Oxydt ---- > Ġ' ')[ Ġ' ('+ == [] ing ency Ġm ange Ġm ont Ġm ule Ġm cols Ġm tree Ġm mse Ġm nl Ġm hc Ġe ct Ġe ms Ġe model Ġe fg co ltypes co arsen co alesced Ġre N Ġre ff Ġre assignments Ġre calculating Ġre gexes Ġre batching Ġre maing Ġre arranges ge ox ge ographic Ġb pe Ġb ts Ġb axis Ġb dd Ġb scale Ġb oring Ġb cb Ġb ipolar Ġb ilingual Ġ# *** Ġ# -------------------- ed ur ed ish Ġw A Ġw C Ġw ages Ġw yy Ġw vt Ġw oman ur r ur ich ur days ur ansi and ler ig ung ig blast Ġ1 450 ss vm un ic un um un red un ger un box un bind un distorted un zipped is ample is che is Test is hou is Refs is omorphism is leapyear el b el ib def un ol mgren li v li bj )) }). ce de est art ot ri ot iti Ġif irst Ġ[ ..., Ġ[ %. Ġ[ ° as cp as agne 00 76 00 58 00 250 00 079 00 374 00 443 00 8495 00 6094 00 9494 val ores id aria Ġas h Ġas igned di men () '): Ġis ig Ġis power Ġto i Ġto Local Ġ" ========== ma params ma ddr ], ). ], '\ ), (( ), "\ ĠT vol ĠT orch ĠT ornado ĠT BD array data array ToVec tr x ult ural ha mb ha dec ha bibi Ġy model Ġy columns Ġy prob Ġy ass Ġy este ch own ch uck ch ristmas ad missible iz en Ġdef ense Ġdef ualt ve ch set trace set Open set Database set linejoin set StartDate set Decimals set HeightForWidth set BacktestingMode Ġ: ]]) Ġ: ])[ Ġr ts Ġr plt Ġr names Ġr start Ġr tt Ġr img Ġr sf Ġr delim rom ised Ġ2 093 mat l mat hops -------- \ Ġst ating Ġst rob ') [::- ]) // ]) ?(? (' ---------------------------------------- (' ['): Ġ- " nt b Ġg list Ġg ms Ġg bl Ġg mag Ġg lr Ġg arb ex a ex s ex as ex ternally data out data select data sorted data Cluster name count par str up ind up lift get match get Distance get Page get Energy get NX get ActiveCells get Pilot ab un label style label Mat ĠS ix ĠS LS Ġco set ri ot ri vers ri moine Ġdata obj Ġdata Finder Ġbe gan =' :' all peaks Ġx I Ġx plot Ġx Size Ġx paths Ġx tic Ġx NoSignal ĠX C ĠX e ĠX tmp ĠX NAT arg radient ': < end Datetime Ġnot iced put il con List Ġor o Ġor gres ist ats Ġh tk Ġh ctsa py w len sing len sed ĠI k ĠI PC ĠI mshow plot array plot fig plot On plot Key plot Figure plot XY ĠP v ĠP ind ĠP EST ĠP User pp w ĠA po ĠA dagrad ĠA ffects fe ctions Ġu k Ġu bar Ġcon di Ġcon vey od p od ys pre loaded pre paration pre mium pre conditioning ĠC UT ĠC Is ĠC CC ĠC DR ĠC hair ĠC artPole os mid ======== + im ilar to fi to bsr Ġtest Set Ġtest Task Ġtest Summary Ġtest TruthVector Ġtest Eec Ġtest Multiplies Ġde weight Ġde register Ġde dup Ġde duplicated Ġde posit ĠF el ĠF DF ĠF ED ĠF uel ĠR yy Ġax label Ġax ins list A list based if ax ub ser Ġ3 62 Ġ3 700 test net test User test Connection test Eec Ġme mn Ġme teorologist Ġres name Ġres pcaps line Num line edit line argradient ĠD sp ĠD EN ĠD orin ĠD igMontage Ġlo f Ġlo val Ġlo renz Ġlo vely 01 84 01 666 01 174 01 482 01 7567 01 377169 ne poch ns hift ns rdb cal t time End time freqs Ġse ra Ġse mic Ġse uil Ġv in Ġv ds Ġv ms Ġv au Ġv space Ġv Deflection file p file like file text file Is Ġel max Ġel limination Error Module ind is ). * out str out dated out reach out PatchSize pro test pro je pro vision pro viding ext rem min q min ard min peak min ortick min anom Ġk en Ġk app Ġk ms Ġk ont Ġk Wh Ġk uu Ġk endall Ġk ali Ġk ivy Ġal mnt ĠN part ĠN ash ĠN ev ĠN real ĠN FS ĠN facecolors ĠN MAE ĠN upic ĠN igeria per child per Image per ferm ds g ds plit bo unty ĠL N ĠL g ĠL ind ĠL td ĠL CS ĠL gml ĠL jung mo ma mo ham mo chigoma Ġon c max r max pace max cor max ticks max pts max vec df F df R df bn df MoodVas fit kwargs Ġ{ {' [: ]), ĠThe orem te res ĠM n ĠM ing ĠM ari ĠM Wh ĠM NL ĠM xM ĠM Px ĠM olina ps fromtk Ġmat plot Ġmat ices Ġmat lotlib Ġan id ys r po cket Ġne ato Ġl err Ġl pdf Ġl upton fig labels size Row ho pper 10 70 10 955 iv ore Ġnum Samples Ġnum Steps Ġnum Slices assert Regex ĠG c ĠG lo ĠG RB ĠG arbage ĠG REEN ĠG arde Ġout fn Ġout box Ġout wards Ġ/ >< Ġprint TopN ore an row time lib p Ġresult b Ċĉ Ċĉĉ oc arta et ot et ivo pl cont Val Dict ĠRe achability ĠRe arranging sc af Ġpre print Ġpre pca Ġpre Close Ġtr hist cl ark ĠE I ĠE Z ĠE b ĠE sc ĠE sp ĠE cho ĠE SR ĠE DS ĠE ACH ĠE ckert ĠE ighth ph ane ph arma Ġdf R Ġdf exp Ġdf Block ": [[ =" ]) =" *. =" /", Ġ4 63 Ġ4 82 Ġ4 400 date type date utils ag enes ag enda train path low fitparams ĠB last ĠB ranches sh y sh at sh or sh unt Ġun rolling Ġun integrate Ġun protected Ġun learned Ġun igram Ġun altered Ġun committed Ġ5 66 Ġ5 16 Ġ5 77 Ġ5 43 Ġ5 900 Value Ex ill ion ill ons ill ales Ġby test iter len (( [' (( "", op ositions Ġthis Pos Ġdi ed Ġdi rac ]. ') log C key phrases axis grid In liers zer r ast ics Ġlist ening Ġen close ef b ef r ef lux ef gh da ughter 99 33 99 87 99 46 99 89 99 58 Ġcomp a Ġtime tuple Ġint name 64 11 64 175 Ġclass path Ġclass instance Ġclass String score atquantile Ġ`` {" Ġoption parser ĠW d ĠW orm ĠW ine ĠW ME ĠW atershed Ġmax Evals num in num data num mer num Params num tag num Files num baskets init time init cap plt file add rop add Request add Weighted add Content 12 43 12 81 12 173 12 493 Ġget Random Ġget Figure Ġget Next Ġget IntradayData ĠO pacity ĠO lympus Ġ__ , Ġ__ (" Ġit p Ġit arget ca k sub index sub field sub surface sub super sub proc sub structs ep it Ġplot dt Ġplot fontsize Ġplot Profile Ġplot Response Ġplot Args map oly map File Ġall vars Ġall vecs Ġall Lines Ġall PartsLayerImg Ġhe m Ġhe ar sum mit Ġpo zo old numeric Re current Re coder Re project Re cover Re ached Re mnant ft races 25 76 Ġso med Ġso ftspace raw name Ġline to Ġline aments frame num frame Count Ġfloat name inter ph inter change inter parr 11 13 11 38 11 787 11 660 11 4497 Ġcan al Ġest imable read link que z 32 26 32 38 32 149 32 239 32 231 32 357 unc lean ther hood Ġmin l Ġmin Err Ġmin IML Ġinput List Ġinput Array Ġinput Space pi mp Ġz lp Ġz Max Ġz ptr Ġz sd Ġz wind text entry Ġ\ $ Ġ\ ^ lif espan labels x labels y ĠIn stant ĠIn gest ĠIn stitution Ġper mut Ġ10 67 Ġ10 500 bin sy Ġsc ree Ġsc rews ĠY A Ġdo ctree Ġsh ark Ġpa u Ġpa ires Ġnew label Ġnew model Ġnew Scores Ġj st Ġj int Ġj row Ġj arr Ġj query Ġj ason Ġos cores gra zing ĠH amp ĠH brk 15 32 15 02 15 90 15 500 15 222 15 2375 print Warning 05 33 05 96 05 69 05 996 05 292 05 8484 input Str input locator Ġlog l Ġlog name Ġlog phi ded ucc =[ \ are t tra versal (), )) Ġ---- > Ġinter med join styles Ġsample B Ġpy SDC Ġpy ETM Ġpy BigWig Ġoutput files ens per Ġno plot ĠU Grid ĠU NE ĠU HSAS 20 90 20 319 20 757 fa p dd ddd 33 92 33 059 Ġsub peak Ġsub structs Ġsub MIP predict test no leap no urishment no idec default Material io ur 201 60 Ġha ce Ġha versin 100 624 100 3567 80 48 80 91 output Data output Type Ġ6 99 Ġ6 33 Ġ6 59 Ġ6 5506 ger ar new ticks new Action ES SVC Ġfit Data instance check ste el Ġtype setting ĠData sources ĠData Zipped [" {} uct s ]] ... ]] += uni quely vert line 66 32 66 65 66 5035 doc ID Ġrow Index Ġrow Loc ĠSe bast 45 93 45 61 ific a ĠK J 75 76 75 349 88 98 88 38 88 952 "] " "] < 16 99 16 944 16 13305 ml vqModel Ġup right av ily av gerr Ġcor rente Ġro mpy Ġro llf show Hide lines it dist ro Ġone Hot ĠEx pl ĠEx pose ĠEx ercice 35 99 35 32 35 92 35 76 Ġcur parm 14 42 14 48 14 72 14 350 14 213 14 068 14 4627 -------------------------------- ------- -------------------------------- --------------- 19 03 19 140 Ġkey frames pol len pol arizer pol arisation Ġsize Hint )] `` =( {' Ġprob ing Ġprob ed Ġprob abil Index Type Index Of Index Parameter [- +] Ġ8 16 Ġ8 35 Ġ8 26 78 58 St reak Ġmake Tab Ġmake Chem Ġonly if own loader (). \ (). ') ĠV mag ĠV OL Ġtm gr Ġtm ono Ġstring ent `. ' title text Ġpath Name 22 46 22 41 22 122 22 7766 nd ar nd raw nd man Ġdate Tuple func dict figure interaction table Reference 04 47 04 189 04 322 96 98 96 56 03 751 the data the filter column Count ĠTest Class ĠTest String ĠTest TimeSeries ĠTest Assert 02 80 02 1969 02 77703 write Header 95 94 95 62 95 756 95 266 95 494 95 197 94 63 94 91 94 6824 ',' *. 17 25 17 04 17 91 17 0824 17 6086 :: ',''] ĠCo in ĠCo sta 85 03 sort i Ġfa i Ġbase Name Ġbase url run ge run dir Ġfeature Counts cre at Ġexp v 24 75 24 02 24 47 ĠDataFrame Source Ġinit Info csv Dict csv Pathname 27 20 27 33 27 75 close path Ġ7 32 Ġ7 16 Ġ7 44 Ġ7 28 Ġ7 62 uc d main Subject ref path Ġresults Dir Ġaxes List gen os Test List Test Env cul ation Ġformat Date right lef right Delim AN ode AN SI AL ERT Ġsys ctl Ġsp stats ĉĉ ĊĠĠĠĠĠĠĠ obj arr 06 02 06 92 06 87 06 59 06 781 06 1827 06 172484 temp in ted Figure 18 13 18 28 18 109 err p fix er Ġargs orted 09 0397 norm val 07 99 07 66 07 49 07 3387 exp No ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ Ġqu its Ġrun tests linear ize Ġwhere in do ane do pted LE GEN Par al ')) * ')) ; Ġidx l dis ag Pro z delta Js ST oExcel Ġadd To rc param spec masks med ic reg ensburg Ġnd fromtxt atter jee Ġlin estring 34 88 34 164 34 657 34 9604 Ġ... )`. Ġgrid der Ġgrid OutIn 97 48 af fili Ġact ors ĠJ C ĠJ e 92 19 92 13 graph title save point save State save ObjectBinaryFast Time Edit version Id ton ights ĠSeries Type ĠSeries NameString ĠQ c ĠQ UE ĠQ gas ĠQ SpinBox 84 90 84 31 Ġ''' # Ġ''' % Ġq mult Ġopen mp Ġopen Time Ġwork day left Edge Ġtarget Categories my date my dummy my rorss Ġ9 11 Ġ9 13 config Data config parser tx id Ġsign um Ġread write Ġread Bigger Ġsum g ... < Ġtemp Vec Ġav conv Me ters gr iliches 65 0000 65 11 65 61 65 649 65 8037 65 2778 Ġcluster data File Data AS ES AS PAR filter ctfdata sol Mass batch s Ġass um Ġass urance Ġright Cell Ġtrans Legend Ġtrans forma 37 025 50 94 cm data mt plottools tf p play ing gn mt ĠCon ventions 87 659 flow Ref _) =% Ġtra verses Ġtra depile RE ACH ura fen _. *| Ġmult s Ġmult ichannel OD isplay Ġlow Energy State Vector 44 88 44 27 44 108074 Ġleft layout ĠZ ONE Ġpoint less si ge si lences vas Type Ġshow plot Ġshow Error Ġshow Result nn ext nn Def itude s EN N EN ER stri kes 23 149 23 9955 rap ids last update pop mat Ġbu d dataset Type dataset Spec hist a Ġ[" $ Ġ[" -- multi part 26 24 26 18 26 285 AG L AG ED AG ENT AG REE AC CA Ġlast char `, ` 77 95 77 18 77 3682 process Ccd view ing RO F RO S RO PY word counts word lists word RepsWidth ([' '], ([' ']) TI O over low Ġevent II Ġ] } Ġ201 804 Ġstats model Base Data Ġsm c 90 86 ink scape Ġzero fill Ġmatch zoo Ġsim dir Ġar ising Ġar mor other ms 42 94 ĠWe bsite 98 988 98 192 expected rows ugh ty draw ings Ġmark str Ġmark ings ob lock bl ks AB I AB SENT IP ID layer deep Di versity Ġ12 96 MP a Ġdt list Ġobj Name 67 00 67 30 67 93 67 034 67 062 67 98319 alle qual ĠAl most '][ [ number of rec iprocity Ġfunc str arest a xy m ĠComp ens ĠComp oses drop GlobalTempView rs ds open Time open blas Ġuser Token 47 48 fra kt fra cpix sim z sim name Ġhigh M Ġca pex Ġimp lot Ġimp erial lu v Array Of 60 457 60 2539 60 8585 style dict Ġupdate fig Model For Model Param ier t block shape block model ĠTime Range OT ATION Set Position Set Bitmap Set Scroll Set MenuBar tmp Log tmp Site Ġsuper impose current Time current module current Mask Ġgo mpertz inf ul pair sp query obj depth field bf d Ġeps rel DF itter go To go perm edge alpha Ġinst ream average Datasets Comp ar ĠType Engine Label Image Label Normalisation Ġpred rock 28 39 28 964 field X field Y Plot Object Plot Width Plot Height sys path ĠPro jections ĠPro vision ĠPro portions "]) * CH ESSRUN Ġedge Lengths Ġfull Keyboard 39 15 book DB book keeping leaf Index Ġge ox Regression Pipeline root name Ġlib writers Ġps fs 68 99 68 336 Ġheight break Ġmon day Ġthere by ĠAn isotropy mi riad ING ER Per Action Per Year Per Region Ġitem id Ġts utils annot match has const has Shear Ġvert ica vector ization Ġcre st module author ĠCreate Parameter ĠNe mec action New Ġeigen functions 31 858 UN HO UN SUPPORTED Ġsecond Dict cache f eval function Ġvar threshold Ġsmall ScalesLims Tree Depth beta C beta X Return ed 647 4 Ġauto magically regression cv AD J 117 12173 Ġold dims ĠCol location nc it nc data nc ia nc depthname ï¼ Ł ĠMe teorological Box plot sa piens SA A images Folder Inter rupts ek uer Ġtask Queue Ġdb Df angu lo ĠLinear Scale ĠLinear Interpolator Ġ11 12 Pre mium Ġref doc ĠAdd LDF Ġdelta T ĠMulti Graph Ġfix up ĠGet Grid 57 6825 App Info nb d nb Folds Ġbeta p ĠLog space Ġform ulated Ġsigma hat 69 78 69 02 69 32605 TY C Ġbox vec Ġbox Office dx t ]* )') Get Filename Get Leaves ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġlarge ScalesLims cd v Path ogen Ġmy str Ġmy dtype Ġmy tb Ġmy riad Ġfast sort Ġfast qc Ġrequest Data 137 05 Ġday time Ġday OfWeek No Version Check boxes sw armplot fun nel Run ge Run LinearModel Run bEr Ġlat b Python SQL PL ATE PL ANT ĠBase df ĠBase Geometry corr map long leftarrow long leftrightarrow long mapsto Ġassign er cel ine hs py Ġface ting Ġinterval Type 89 112 HO x ĠFigure Interaction Ġspecific ied Ġseq id dec ition imp ressions Vector Database Max X Max TreeID Ġpe acock )') ] 686 25 686 364 FT SE ĠPre conditioner 3333 333 Lay ered ([" * ())) + Ġpr in Table Formatter CO O CO AST Ġstri pe Fit Window Fit Settings single Row timestamp format Ġgen n mail man ,), ( Mat hemat Ġaccuracy ColumnOnly Ġconf dir Ġlayer ing sens ical Ġhold state Ġresponse List Ġet aline peak times peak ComboBox Ġpredicted values Ġpredicted Values Ġcla des Can non 001 66 fast as fast sort light en light est light ness ]+ ") ]+ )/ cdf vals 0196 1045 Ġuseful ness Qt ip Ġupper bound sf eld Ġsym metr Timestamp Scalar 83 75 83 87 83 183 83 028 dia cal AA ACT (** {" Ġwho is conv Act ĠDi Graph 2014 0701 parame tros !! !" mid c mid variance Ġus ando ('% ')) Object ID Object Series two exp Is Active Is Same Image From kes peare 199 204 Ġvery verbose nr Requests PO V Ġside length ĠLabel Composer next Font Grid Row pickle file Ġhtml only DO I Ġcustom space redu ces PCA P Normal Color Ġdevi ate variable Arg TION ARY br len post order post InternalCommand ĠCh IP Ġpp n NB DFitter sl itlets exit On rb Miss At m phi la Ġsu z NE UTR Multi plot Multi Choice Multi RNNCell ATH ER stro ked scan no ĠPy Hive Ġra pe Ġra dec Temp T Temp File tot ally tot pers tot otiti Ġmix Omics bet atim Tensor Type Sub clusters Ġfn DL 180 6 180 9 DA F Ġbl ues PER SPEN PER MINTE fp m entry offsets Ġmp t Ġmp olys 73 25 73 84 73 128 Ġlon sin aw st Ġpys cf tex ification orth onormal 52 37 52 98 ," - price Lis Ġbad ness mar ts mar ta Cal orimetry sequence of }} ], }} ') register TempTable bc det Ġextent ion Ġ---------------------------------------------------------------- ----------------------- union izes strategy StartDate Ġbyte count Ġxp adding Ġkernels x dest s Float Vector gd n geom od good indices Ġrece be 99999999 996 ----- > ]} )] scikit learn Mult iscale Mo on Ġstar map 600 10 Ġph os Ġph bst Parameter Set ĠParameter Estimation Ġnc data Ġnc varname cells PerColumn warm start ENT ICAL RL Bdata free form ĠIter Titles ]))) ] NO UN Ġscatter plots ĠFa cade ĠTHE ANO Ġcb h Ġcb dat Sim ultaneous gal i break able ('_ '. ('_ '). Ġss xym Ġwin sol Ġpk ts ĠKMeans Model bd trik Ca Conc ĠDetermin ing Ġflow ing Ġloaded Data Sum m MOD I tasks perchild solid ity Ġchain Coords Ġground ing Ġground water ĠFree FormSelectField nl ons New lines New TableName anchor Display ĠVector ize Ġtex system Ġtex buttonlayout met ad SM OTE Ġgover nment Ġgra bs Total Rec bra ska Work load Ġsimilarity Matrix 105 89 ĠTra des Ġtot Time Ġtopo plot 126 87 Ġcirc std Ġcirc var daily return Ġprogress Callback ABC Int ABC Float ppf q Interactive Console 2017 0113 tax NameList tax IDList dp m 336 95 456 789 Ġtw isted beam FSM SET TING arc lines ĠLA P sid ak LA W Ġworking dir equ atorial Ġproj Name 800 6 ]( ? inp vars Ġmem ories Ġke pp Ġswap level Ġct ors Be ing some one Ġroll er syn Perm Ġtab files Ġtab ela Ġfl icker setText Color 118 17271 sal eprice Ġair y PRE PAR GR ing GR Ch Delta Variance 707 91757 988 0028 ĠAss orted 219 4 Ġvertex es Query SQLStatment Query ValueEx resp Data 64705 9 Ġmx lg Stream Schema ĠWindow ed dash x ĠReg ions Ġautos caled mol print Ġ196 3 Ġml py GC CT Ġva pour 901 53 133 57 133 03969 EXT INCT Files Tested 047 97666 047 92138 Ġast Stats ĠST Ds ĠCall er ĠCall Back 319 16881 ĠTr ilinear Ġaz is Ġaz max Embedding Column END ER pb mc 700 9113 å¤ ¹ Ġ{: } Ġinc id ĠGeo Modeller hn ikov resource ful Ġelem Size Extra polation Ġedit ors Ġlatex ify ĠInc idence bp f Order Frame Ġhost ed ĠEl len Ġ195 8 Ġì »¬ëŁ¼ Freq Channel fx ns Ġ95 70 Training Session ĠOpen ML DR K IPython Console Ġrep str CF Encoded pages Object Ġfid ucials ĠHist oric Ġhy steresis Ġsyn ch 168 75 Union SDR uper ada 984 314 Ġquant ifies }] $') nor ate nor ma 296 75 wav enumber ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ Sequence Data 365 75 033 1 033 377 dark seagreen Ġant ialised FFT W ĠImp ute Custom Metric Non EmbeddingColumn Ġlt l Ġlt ree Exp anded Exp Now ĠRE PL Make Survival Created By 789 12 789 0047 134 99 032 2 032 3 032 32333 032 88952 032 67062 Ġcar to bys ource ĠTH AN bur gh Price Per AP OP Ġphot Points LINE WIDTH Ġconditional s Ġ65 300 Ġ65 365 Ġ65 360 Ġ65 451 Ġ65 455 Ġ65 367 Ġ65 474 Ġ65 450 Ġ65 429 Ġ65 439 Ġ65 363 Ġ65 476 Ġ65 362 Ġ65 379 Ġ65 453 Ġ65 479 Ġ65 471 Ġ65 421 Ġ65 293 Ġ65 508 Ġ65 361 Ġ65 438 Ġ65 473 Ġ65 472 Ġ65 431 Ġ65 470 Ġ65 481 205 78984 Shape file Ġsho ulder æľĪ 份 Imp ala Ġzi pper Ġadapt ations mouse link mouse imag 144 15 Ġlead field 147 10 Ġvol k æĽ´æĸ° äºĭ件 Update Option Ac q Ac counts Ġ94 0 Ġ94 2 Ġ94 4 388 9 è¿ Ń代 ĠMark us ĠSimple RegressionPipeline ract ive Ġsr ch ĠRed raws ĠRed irects Pipeline WrapperTask 004 22 004 06146 004 03751 Lin Vel 114 8816 ]" )), ('# ')[ Ġib py Ġib nd ĠOUT LIER video Id Ser v IMIT IVE coordinate ToNode ĠPart icip ĠPart icularly Conversion Mixin 027 069 Ġunion ed GA ME Ġ"( ? rr rr wide band }` ; calcul us wl rebin Ġcum max 135 28197 Port Mapper sci NotStr Ġcheckpoint ing 195 22 mor phological Ġweb logo 002 78 002 66945 ĠTri ms ĠTri angles FR ACTION Ġtrend order ĠCustom er Position Tracker vin et ĊĠĠĠĠĊĠĠĠĠ ĊĊ ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠ Pack ages 077 06095 ĠAuto Result ĠAuto encoder "' { ĠStore Magics 314 99 Gamma D Ġteam Wins Ġteam Losses 266 2 266 08968 Ġtx Rate coll value Ġhack s Ġrf Mod issub sctype ille ur ']} )) mapp aths Ġviol ating Print Str sus pect sus pended sus ceptible ĠRo bin 494 7 328 31 164 13253 Energy Balance Region Features Ġ#---------------------------------------------------------------- -------- spin up COLOR tar ĠUnicode Writer COMP ILED Validation Monitor ĠNO AA Times In gold standard Inv oke demand s Long rightarrow Long leftarrow Long leftrightarrow reject s hit list ĠAcc uracies Measure Dict FOR EGROUND dtr w #---------------------------------------------------------------- --- ĠOP TIMIZATION Sha der timestamps New Ġpsd Z Ġfmin ax Ġsuggest ing SUB MIT Align Dlib PORT FOLIO ãĤ ī DEC am Ġ================================= ===== boot res ('{} _{}_ Ġë Ķ Ġë ¬¸ Ġrms ds ĠSH AP Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġč ĊĉĉĉĉĉĠĠ 045 2 Car ol GS BC stata File graphic File 007 01 Ġpls reg ĠBY TE wire less DL D ĠTab ulate bla des mac roman ("# ", btn Select 157 0547 交 éĢļ Ġmlp c ĠPO e ĠPO INTS 295 84 pres can Mass Balance 167 19 188 46 188 1785 Ġwt type Ġbio python Ġri poff Ġbucket ing tbl TransMatrix 234 95 234 97 304 3 178 60457 ĠVisual ise XML Parser Bit coin ament e sli des 495 9 Generic UnivariateSelect ĠPA cor WX MSW Ġam mount Ġdeterministic ally Ġshadow s 个 æľĪ 036 64 Report ing ĠLocal ization uest reo ĠWave functions GO UROU Chi ef čĊĉĉĉ ĠĠ Ġlim Phys HEAD ING æĺ¯ ä»İ bat tle Empty String sand ybrown lons out worth y ĠCha mp Binary Info ĠSch wartz Uns caled ĠBox er Phase Bins working fol Ġngram izer comm ute comm DetectMethod 246 39061 Ġtan dem Counts Dict åĪĨ åī² Global s Regist ers Ġè °ĥ Fast Serializer Sig s sem iminor Arrow Coder truncated svd éĢ Ģ ĠFix tures 665 040 Ġ'{: < _[' - bal loon ĠSte wart oto Patents ĠBE H Ph il 096 9508 055 75 055 26326 Help Button Ġcomposite Image kit ti Ġrnn model Ġphoto ionization HR V enum bers ĠEmbedding Multiplier 985 7 ']+ [ MN Logit )+" -"+ orbit als SUP PLE ĠExpect ations dw i ĠCS SToExcel USER PROFILE Ada delta Cla ve wor ry æĪIJ 份 past el LAT TICE 095 3533 095 64505 288 30475 review List pulse height iro as ĠCons istency ĠTool Manager ĠXML DST ĠStream TableEnvironment ĠSha de ĠSha res ĠSha pes ĠFixed Ticker Ġaff inities econ om 1200 1505 ("{} : ĠFIR MA Na val Ġqual ities 166 8 dof lows ĠHistogram PlotBase Cat maid aff le spot ter 186 86 Constant Temperature 4000000 1 ĠOper ates ETA IT sav fil Ġresidue z FRE EVIEW GCT AGT čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠ Ġcomm ute gather ing çŃī ä¿¡æģ¯ Video Writer TOT EMP Dot ted Setup Data Xtrain sparse lead sto Ġxc min fam ine Ġdip de Ġ################################################ ########### },{ :. ĠSupported Dtypes 928 95 Ġsync ing (... )``. CAN DELS 201301 10 497 9 Determin ant Pred var Ġvc fs MULTI PROCESSING Ġmemo ized ĠModule Validator utt led ĠRequest Exception ELE V Ġsurv ive FROM NODE 1244 497 95686 3 ĠGO X Poisson Pmf Mach O PG M PG local hashing vectorizer persist ences frm Size holes ale 1568 4588 Ġemission prob ĠTick Helper ĠVER BOSE ĠSK Y ĠShort est ĠShort cuts Ġema fast ĠStorage Options åī © pyqt Restore 068 15 537 255 Ġarpack s Execution Environment setWindow Modality Ġhar vester ĠUN C ĠUN ITS 459 11 QAction Group FFFF F World Transform ö ö æľ¬ æĹ¥ convex ity ĠElastic search MAN GE RP CH CCD X Ġaw L ĠQuant ification Performance Tips Ġinterpret ations bib s aab bcde Ġseason ally Old ScalarFormatter coup lings и Ñģ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ Ġsco t Ġsco ped HTTP Connection Sec ure ä¿¡ åı· ĠMULTI PLY 042 87624 ĠCoordinates Map ó w Ġinject able Ġcpp refs Ġbon db ĠGu arante 517 33059 ĠProperty Plot #------------------------------------------------ ----------- ĠDot ted Under Curve logreg cv Ġdead line Ġdead time 0155 9854 ĠBO X cdot p Prod ucer Pick ling ___ / ĠBand Structure Dash Pattern indust ries ĠCharacter istics snake bite Pat ent Ġmes onets ĠPi YG Ġpal ace Gauss Guess Ġzer ophase 020 28961 Ġhm mer ĠLE O scra mble ĠMonth s Ġalph anew Ġ655 05 Ġ655 14 Ġ655 13 ĠHE AT SIG LA ('| '. 031 78912 Move Event 949 32 drive Chain 1919 19 1919 7924 compar ables Ġconcept ually ĠPick Event Ġ134 86 ĠCD N canonical ize Desc ending relig ious Hy ukjin PK M ä¸ĭ ä¸Ģ个 Den om Ġbal loon inde cies Ġrl completer ĠPRE DIC Bed rock south ern Ġkin ases Ġtouch y -------------+ -------------------+ Ġdomin ated Ġpitch er yyyy ddd combination Dict ĠMarkov Switching Ġdamp ed Ġ".. \\ Ġsam ri ĠâĶ Į----------âĶ 179 35 Resample RowsWeighted Ġbisect ing Ġpth ist 05744 254 damp ed 022 44 ĠMor an watch dog absorption s downs ampling downs caled grav itational 17175 53 17175 319 ('-') [- Slot Name 086 73128 ĠPER FORM linears vx ĠFunc TickFormatter logM min 1335 0241 оРº Ġ[{} ]. Ġ[{} ]". ĠPeak s Ġ'~ ', Ġreson ant Ġ654 32 Ġ654 33 Ġ654 80 Ġ654 75 Ġ654 35 Ġ654 78 Ġ654 36 Ġ654 34 Ġ654 30 Ġ654 37 Ġ654 77 asym metric åĽŀæµĭ çļĦ glu ing ĠLOG FILE ĠKeras Classifier FIT TED LAY OUT Roll back Quant itation ĠRadi ance Ġconcentr ated 0188 1946 ĠLink ed Dynamic Topic startTime andFrame Pers istent Ġimpl ants ogene ity Toggle Buttons Reaction Formula Reaction Datum epi incid ĠGE MM gdp A íķĺ ì§Ģ ĠSyn chron \) "): Ġ212 12 Contract s 415 91889 406 90153 ĠContin uing Prot ist Ġ327 68 SOL VER 747 15187 747 29584 Ġdw onloader ĠGra de ĠGra ham ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 0916 04 模 åĿĹ Ġsph x ĠTIM ING Ġprotect ing Ġeager ly Accel eration Accel erator Ġphy la Ġhuge ly Detector Dir Ġ=== ") Ġendian ess ĠRepeated Results Ġcorrel ator Ġflight mode Ġblow n )',' ( Ġedi lines fab labs rz sm Ġtor ques Indic ates Ġsubscript ing 622 97525 bor rar Miss issippi AIC c deed s ĠExternal Package Weld Vec Mem Total '< ' Ġrig orous ĠInverted LogTransform multit ype ĠEast ern Ġslash str Ġlum a pent ine Named Color extr insic 2899 65 Ġmong od Ġmong orestore 066 68336 ĠFORM AL Curl Curl Ġfacilit ates diss imilar 1027 3963 ĠER Ps Ġestress dot 465 62 Ġndi vs Sea Green BEN CH tunnel ing Ġapodi ze 5135 078 ocur rent 685 68625 MATCH ES TICK DOWN æĸĩ件 夹 domin ance Ġpus hes rie mann ĠCAL END ĠENG INES Ġutili zes ĠUnsupervised SpatialFilter Pareto NBDFitter Ġkz L --------------------+ --------------------+ ĠIterative Imputer autore gression autore gressive AUTO MATIC Gr illa ĠBit Array vit als åĪ¶ å®ļçļĦ Mor an Mor phology ç»Ħ æĪIJ cod ons Nucleus List oz hnikov trough times Perc ents Ġaccession s ĠBl ues nbdtr ik æŃ£ æĢģ Ioneq One ĠIndexing Support entrystart stop ################################################################################################################ ###### Ly manInterface travel Speed mig rate nct idx Exposure Times fluct uation Ġinvent ories expiration Ms ROLL ING Periodic Kernel Ġclon ability ĠSTD IN SUFFIX ES Symbols List ĠInstrument Response investment Q 678 10124 ĠBla ir VIE WER ĠSpike Trains ĠRHS form plates cale ĠQuarter Begin acceler ated cub an odr ick Play off PUB DIR Kill ing 8585 85 Markov Chain 680 46903 2412 1788 Ren aming 0377 1744 getframe info ĠCB MonthEnd ĠCB MonthBegin 1978 6539 bran ched Ġcwt matr AMPL ITUDE 0105 204 ĠHead banging PROB ABILITY (') ')[ Replic ates 0013 9214 696 969 cant on ĠGRA DED ĠWA IT 3217 2099 Ġprobab ilty ä¹°åħ¥ é¢Ŀ ĠtestCustomMetrics WithMetricSpec Ġarri vals DocTest Parser ĠDIMENSION S Ġpeek ers bub bles evi ctions ĠPN IORealTime Ġ"{}/ {}". Ġdendro grams Fuel Ph Experimental PDF éħį ç½® reson ance Ġposit ively Exports A ĠINST ALL GridGraph Undirected åĩĢ åĢ¼ Ġregrid Dir satis faction ĠForeignKey Field ĠĊĉĉĉĉĉ ĠĠ Ġgeot echa ĠLogFormatter Exponent SelectF pr Ġweig ths CHIN J tide water ĠFIG URES ĠABS OLUTE ĠABS ORP ĠBACK ENDS 11893 098 +'/' +' plo trange apo gee л Ñı Pha sed cour be Ġabstra ctions InputData Fields Variants PerRegion Stationary KernelMixin blin ds ioneq Temperature ĠPu Rd Ġpseudopotential s Wo men ĠAud it Ġoutperform s ĠDipole Fixed VERS ITY Af filiation varn ew ĠMun ro Ġ653 64 Ġ653 66 Ġ653 07 tB etter ĠHug o Multitask Graph ç»Ī æŃ¢ ĠFront iers __| __ Ġpag ination Logical Network Ġspacer Item Ġgla ciers collinearity Filterer ĠnumPoints PerObject ĠRog ozhnikov 9416 2826 Ġmilli meters ĠnoOf Pts Monitored TrainingSession Ġå¹ ´ Ġ','') +'_'+ 529 177 0403 1924 ĠZone Controller MinuteBar Data Econ omic Slab Entry SIT ES 1164 448 8090 35 broaden ing Ln Posterior QAbstract TableModel Sche mes Sche duled MAV Link Ġclaw pack Structural EnsembleRegressor BitsPer Component ReversCorrelation RFs 0034 3595 indo or lemmat izer ĠAnisotropic Material +(? :[ Ġë° © filechooser dialog maxim izer 1512 61 1385 6546 toler ated rish na Ġephemer ides ĠSYN TH PLAT FORMS Slack User iAtt ens ÃĤ ÃĬ neur onal ĠRece ives ĠUndo es çļĦ主é¢ĺ ä¿¡æģ¯ è¿ĺ æĺ¯ KAN GOUROU ĠDRAW INGS Ġ652 99 ĠwaveOn m DBZ H wq slit Ġunambiguous ly 1537 6699 polLeak dbs 0964 3158 ĠProper ly Ġquadrat iv SqExp PeriodicKernel 0190 9512 0380 7306 é¥ ® 1921 9925 FieldDef n Gateway Client nspec s tetra hedron Ġmagn ify Ġ.......... ...... 6678 8088 0914 178 ROT ATION NumExpr Pandas ĠManage ment 2125 0485 DRI VER SHE AR vend ors 1193 0791 ĠHans bo 0508 9681 9798 01 TIMIZ ER 6934 7861 Radar MapDisplay Ġmortal ite MCL T Ġcave at 1674 376 1342 6580 Cle ars NAS DAQ Ġplas Pg quants oftware ĠQGraphics Scene Ġpurcha ses JY THON gab bledegook ĠPST H ĠVolt Procedure Ġtellur ic ĠtestArrayFeedFn BatchOneHundred ĠGlob us actives anta éĩĩ éĽĨ ĠtestPandasFeedFn BatchOneHundred mplf lat 0987 1553 è¿ŀ ç»Ń Hazard Function wre cks Ġnper iods ĠnumInput Vector ĠUnp ickler 1685 4574 0945 091 analyst VM GNP DEFL JobConfiguration Load Lou d Mill ion Ġreposition ing ĠDynam ical 3414 855 Ġbatcher Infer ABCCategorical Index ĠMakeNormal Model ĠMakeNormal Plot gobbled igook pract itioner èĻ ij onLeftButton Down Ġpunt os Ġrepre n Ġ+-------------+ -------------+-------------------+ ĠâĶĶ ----------âĶ onRightButton Down FOL DS 01033 161 Ġrelig ious PLUG IN Ġinvres z ãĥĥ ãĥĪ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġrefin er RAx ML Ance stor AMR VectorDatabase 沪深 ä¸Ĭå¸Ĥåħ¬åı¸ indian red ĠMus ic Encounter ID Ġè¾ĵ åħ¥ ĠinputParamsConfig All Tou ch Ġmile stones Ġexperi ences 02384 992 {}$ ]". ä½Ĩ æĺ¯ Trunc ating BoundIndex Lower BoundIndex Upper ADDITION AL During Initialize ront al Ġaccomp anied Ġvarin novation Ġëı Ļ ZonedTimestamp Info templateClusteringResults DistanceMatrix 7168 115 exter meminpeaks getGlobal Size Ġprogra matically numAll Voxels 1846 3471 ĠsaveAs Csv Ġlatt ices yyyymm dd ReversCorrelationPredicted Activities refe ree dece ased ĠTPM s ĠCN RS ĠGon zalez 1743 1274 ĠEXTEN SION èĢĥ èĻij ĠCATEGOR Y 1867 2553 Ġfock s pext end Ġhono red penumbral Fit 1847 647 Ġoblig atory 6878 2064 Colorize LabelImage Caps ule 2457 4278 INCRE MENT Inte rets Ġords um ĠLid stone Provenance Recorder 65625 755 nog ui Ġrer xy perce pciones ĠGps Data Ġfigmat tmp 3346 3112 0918 2247 6775 0975 CEE DED é£Ł åĵģ 6147 0416 Yo ung ĠfP block scrolled window ĠVáclav Åłmilauer 02964 127 ĠdictStatsComp Adhore makePeriod Series PROVID ER ĠLIBR ARY Ġcorrepon ds Ġrabbit mq HARK interpolator getDistinct Features ĠDIG ITS ĠMot if Ġ'{}, {}'. SPHER ICAL CGCTT GCATGGCATG 27836 841 ĠAnchoredSize Bar Ġtram line Ġnpre dictions ĠPreal located ĠEight y ĠKeyboard Interrupts Summar ization 16920 272 2176 9083 Prun ing íı ¬ Ġcous in ĠtestRaises NonEmbeddingColumn ĠFrac Element Ġintract able ĠDEPEND ENCIES 00587 025 protCnt XYZ lovak ia BitmapFromBuffer RGBA Explicitly IndexedNDArrayMixin rechn ung ĠRare ly 66101 097 ĠPROBLE M 12485 304 06597 366 ĠìĿ¸ëį± ìĭ± zenszwal b Elimin ate Ġsla ves ĠtestEmbedding Multiplier calab retta Ġrotac ion Ġpollut ant ='-| >', 04066 789 ĠHEAV ILY aX traGrid 00917 056 Inductance PerUnitLength 06265 739 ABP Table 21336 31 ĠPyType Checker 03572 177 Ġè¨ ĵç·´ 6755 4234 SOP InstanceUID XSH G 00160 224 Ġgobbled igook argum uent ĠAGD RIFT ĠBax ter readOnly Cells 152706 99 14396 183 07035 859 Selec ionada 65174 036 30665 872 Unk own CLIN ICAL ĠImageComparison Failure patr ini 09832 993 QTab Widget 07765 351 31388 326 05584 937 65406 368 angercausality tests 08835 483 ĠBrook haven åĿĩæ¯ı ç¬Ķ Iat Xval 00714 283 conrad lee 10373 660 32225 745 05254 676 20375 837 22247 955 95924 297 06199 844 970500 16 ĠQUES TION armcmc Lib 126367 75 185567 47 GEOP ROF WEBS ITE 22826 092 43395 268 fluctu ant 89237 972 oweek day OMulti collinearityFilterer mInput Names éŁ ³ ionData Record isRefs RunbEr 00374 239 00443 647 008495 28 006094 17 009494 71 ('---------------------------------------- ') plotKey Var ĠtestMultiplies Gradient 01666 137 01174 647 01482 333 017567 09 perferm ance ĠLgml vqModel agenes is ĠplotResponse TEM 114497 92 32239 136 Ġoscores pls ĠHamp shire 152375 08 05292 828 058484 66 100624 78 ĠDataZipped Block Ġrollf orward 144627 24 19140 336 04189 855 04322 147 021969 18 946824 13 170824 34 176086 72 rightlef tharpoons 061827 18 090397 29 073387 08 34657 036 ĠreadBigger Screener 65649 254 658037 19 urafen ib 239955 97 AGREE MENT 773682 33 processCcd Decam 67034 809 frakt ions goperm dist CHESSRUN FILE 31858 973 UNHO FER ekuer zt ĠAddLDF lag 576825 68 PythonSQL Utils 686364 08 NEUTR AL OfScalars DataAdapter allowQuoted Newlines 613517 91 Ġ"'{}'. "). bieder sted FromRel ionDataRecord 033377 36 LinVel TS 交éĢļ è¿IJè¾ĵ Ġè°ĥ çĶ¨ 665040 85 ĠEmbeddingMultiplier Test SUPPLE MENTAL ĠCSSToExcel Converter pyqtRestore InputHook ĠABSORP TION isRefsRunbEr rbMiss " ''' " }. $ ',' $ "), $ ^{\ ' ## ' ")) ' > } > =( ? ". @ $ @ ': A sy A cf B if B DD B lan B nds B USINESS B ORDERS B runel B isectingKMeans B EVEL B rfss C MF C ham C LEAR C leans C FFI D st D map D TA D PP D TM D NI D uncan D IDA E k E av E du E go E tend E macs F SC F loor F BF F cn F xN F RED F iring F aNN F oliage G v G ust G aN G CP G xE G ibbs G Adj H gs H over H eli H gt H ankel H ungarian H askell I OR I net I owa J im J per J ac J ew J enn J apanese K le K IM K ansas K EEP K WARGS L Q L w L it L um L iter L Classifier L TD L JUST M axes M UN M ITER M nth M OOG N dict N samples N OD N rm N states N Features N segs N FC N POINT N weft N SApp N logN N SDQ O meg O CEAN P inf P CP P chipInterpolator P enetration P onddif Q Z Q App Q Thread R max R sh R ug R PL R ational R JUST R USSI R omberg S out S oc S pts S cum S moke S kellam T ATE T em T ABLES T GACAG T eacher U int V EST V Clamp W z W et W CT W inc W PS W raps X minmax X AGUSD X IMPOL Y M Y ans Y str Y seq Y marg Y wr Z R Z Am [ ...]) \ '] \ '. \ )\ \ (([ \ %%, ] ? ] (_ ] }. ] #[ ^ * _ ][' ` ]. ` <= a pl a des a BAD a podize b di b ch b set b key b gs b gp b logs b ddb b aker b cef b irds c model c unt c ual c io c arrays c codes c xc c boe c ilvl c anceled d fi d ax d ca d ong d off d ga d cw d ney d Phi d Serializer e B e che e model e units f D f L f S f int f str f cl f right f unk f asc f bb f lying f urt f Obj f lapping f lent g I g params g ris g search g ii g cr g API g ros g nps g dbn h row h sg h bn h mtk i ort i ow i ik i coords i Item i hl i amen j X j me j ur j ce j ug j uni j sp j cent j ames j udge j edi j birch j erk k lt k il k so k mod k cols k dx k LL k clust k Vec k rishna l ign l ark l matrices l é m ss m fn m db m vec m scatter m rb n Y n un n ca n ude n level n left n File n Python n argsort n mse n ãģĨ n stations n WARNING n Starting n Scales n PIm n pregnancy o di o ir o mato p F p fit p ley p ots p lomb p dexRate q table r di r date r ator r ls r List r des r const r conv r shp r kf r arity r verr s L s N s V s ai s fs s mu s ud s anger s prd s loth s lika t H t L t ate t pre t atus t mi t nr t Normal t lw t ina u S u div v G v u v im v amp v mode v pts v ratio v mi v header v wind w li w ack w ham w ncp w afer x O x it x id x iv x param x div x lb x Rate x rx x Ticks y df y ag y columns y norm y style y alty y dr y high y inds y ale y cen y Off y gridlines y stocEnv z range z pred z ref z imag z Real z gesv { ^ { (- | ^{-\ } '' } )). ¬ 기 ³ åħ¶ Ñ ī à « á µ ç ° ç į ç ij č ĉĉĉ č Ċĉĉĉĉĉĉ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ quest Ġ ãģĪ Ġ åıĸ Ġ ^{\ Ġ ãģĤãģĤãģĤ Ġ æĪij们 Ġ åħĪ Ġ ãģıãģı Ġ æĬĬ Ġ éĢļè¿ĩ Ġ ãģķ Ġ ãģĽ Ġ ^^^^^^^^^^^^ Ġ ä¸Ķ Ġ ãģĭãģĭãģĭãģĭ Ġ çĦ¶åIJİ İ ĺ ĠĠĠĠ ĊĠ ĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠĠĠ ĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ in l in mask in compress in Bed se am se min se af se ac at ots at atable re i re test re ta re tract re loaded re assignments re started re weighting re labeling re motes re commonmark re absorbed ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ or st or ick or ignal Ġ= %. on Bar on estep Ġt lf Ġt line Ġt ms Ġt dir Ġt axes Ġt resh Ġt exp Ġt acc Ġt store Ġt now Ġt days Ġt shp Ġt SSS Ġt umbling Ġt LArad er kin st atu st han al ar al gs al ous al oney al beit ar in ar ate ar cha ar oon -- '] an imations le er le st le maitre de mon de replicate de noising de cals de multiplexed me ster Ġi vs Ġi xx Ġi high Ġi xt Ġi pix Ġi hr Ġi send Ġi stype Ġi abelQ he k he w he alstr Ġn cell Ġn models Ġn images Ġn char Ġn above Ġn gh Ġn orthing Ġn rof Ġn ivel Ġn Ppl Ġn NsVth Ġc lab Ġc dd Ġc method Ġc ii Ġc mc Ġc bc Ġc Norm Ġc uplicate Ġc ctypes Ġc reek Ġc ascading Ġc assini Ġc atastrophic Ġc armcmcLib Ġf al Ġf base Ġf db Ġf tmp Ġf force Ġf bt Ġf sss Ġf whms Ġa ma Ġa ep Ġa cademic Ġa priori Ġa pertures Ġp ex Ġp py Ġp time Ġp score Ġp labels Ġp method Ġp tol Ġp fc Ġp lfit Ġp iston Ġp blum Ġp argp Ġp istons Ġp AbsoluteNumbers it ot it mo it arget it ons Ġs A Ġs igh Ġs cs Ġs its Ġs gr Ġs xx Ġs div Ġs amount Ġs isotool ra iz ra ced ra ggi en h en ents en ames en zyme ro am ro ffset lo m lo res lo pers Ġin l Ġin cent Ġin dependencies Ġin lets Ġin quiry Ġthe macro Ġthe tad Ġo ops Ġo mx Ġo ught Ġo aks Ġo ocyst Ġd col Ġd sc Ġd any Ġd slice Ġd md Ġd nu Ġd kappa Ġd jd Ġd pkg Ġd zp Ġd urs Ġd Ft Ġd avis Ġd ichroism Ġd UnitSeries Ġd ColSep Ġd RowSep la gr ---- ') ut i ut ting Ġ' ## Ġ' >> Ġ' $', Ġ' }'), ing ress pe er Ġm ms Ġm lim Ġm sq Ġm sort Ġm cond Ġm db Ġm si Ġm lc Ġm km Ġm tc Ġm ales Ġm Lvl Ġm ills Ġm stridx Ġm alignant Ġe dd Ġe qt Ġe clipsing co author Ġre Data Ġre gen Ġre block Ġre Used Ġre visited Ġre directions "" ]) ge oc ge og ): { ): `` ): #, Ġb j Ġb lt Ġb lin Ġb labels Ġb fn Ġb series Ġb count Ġb colors Ġb rit Ġb Path Ġb cr Ġb amount Ġb lengths Ġb bw Ġb hl Ġb cbm Ġ# {' Ġ# ----------- Ġ# ============================== Ġ# .*" ed os ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ ic ands Ġw ed Ġw path Ġw ont Ġw bounds Ġw ikit Ġw ishes Ġw ksp ur an and ar and an and hi lt h lt est lt ner lt imes ig lob Ġ1 114 Ġ1 131 Ġ1 350 Ġ1 113 Ġ1 650 ss ier ', ], ', ()) un l un bias un trip un Mappable un optimized un ichr un happy un idecode un informed Ġ0 000 Ġ0 52 Ġ0 121 Ġ0 113 is ive is alias is Float is Done is otherm is hah is Stunned el bo el vlc def rame def ense def encoding li liowa )) [:] ce ded Ġfor ked Ġof R ot ics um sfeld Ġif ig Ġ[ ([], as us as ph as Results 00 60 id al id ation id na id wt id Choose Ġas ort Ġas ian Ġas contiguousarray Ġas fortranarray di el di als di bility di mpulse () '. () +'/'+ Ġis array Ġis plit Ġis Partition Ġis Bucket Ġ" ') Ġ" :: Ġ" ### Ġ" ¡¡ Ġ" ###################### Ġnp test Ġnp mol Ġnp airs ma re ma ds ], :]. ), ))) turn table turn bull ĠT AR ĠT PL ĠT fm ĠT ARDI ĠT ITLE array repr qu ar qu antopian th ode th Percentile ha in Ġy L Ġy est Ġy Val Ġy key Ġy inter Ġy text Ġy Index Ġy sp Ġy intercept Ġy align Ġy bounds Ġy boston Ġy inds Ġy outer Ġy covs Ġy lbl Ġy increase Ġy Dbl Ġy Below Ġy Above Ġy scrollcommand res ort res nik res haping ch ur ch hammer ch imera ad g Ġdef enses set Field set Conf set ColorMap set Delegate set ncattr Ġ: ]* Ġr ps Ġr sc Ġr norm Ġr step Ġr ij Ġr bind Ġr ddf rom atic Ġreturn shape Ġreturn Value ver set ver if ver bal Ġst m Ġst ocha Ġst itched ]) """ ]) ]]) ]) ])] ]) +'_ (' >', (' ---------------------------- int value int types Ġ- ?(\ nt e nt n nt cp nt rack Ġ""" %( Ġ+ ) Ġ+ __ Ġg C Ġg ri Ġg rs Ġg ii Ġg Cond Ġg qs Ġg orept __ ()), __ +", ex lines ex ome data G data fig data spec data Str data Mask data house data science name ly par rows par apply par abola up val ode t get ol get names get Test get children get Labels get Names get Pos get Hook get Price get Edge get Region get closest get NZ get Crosstable get TimeSeriesData Ġassert Eq ab er ab ler Ġex ter Ġex data Ġex pired Ġex cep ax info ax cb ĠS ib ĠS DF ĠS DS ĠS pat ĠS SM ĠS ORT ĠS LD ĠS BS ĠS Sq ĠS BP ĠS mappee Ġco ating Ġco sm Ġimport Var Ġdata col Ġdata classes dex tract =' // all Zij all pairtest Ġx text Ġx mask Ġx sp Ġx right Ġx var Ġx src Ġx Loc Ġx outer Ġx expect Ġx calendar Ġx minorLocator ĠX in ĠX ue ĠX boston ': """\ ': {}} end path Ġnot ices Ġnot none con vective col plt ist atic Ġh row Ġh mask Ġh vals Ġh dm Ġh yperexpand ath aniel py Error py Class py audio py bedtools py SPACE py rolite py vrpn py synphot ĠĠĠĠĠ čĊĠĠĠ len xory ĠI ne ĠI TS ĠI LL ĠI GC am by plot one plot var plot File plot Count plot Choice ĠP rom ĠP uff ĠP det ĠP ORT ĠP PP ĠP wiseLinearSoilModel ow ord ĠA Z ĠA ES ĠA DF ĠA ws ĠA CE ĠA ij ĠA bi ĠA ibar fe mp Ġu N Ġu q Ġu argv Ġu ire Ġcon en Ġcon sol Ġcon formation Ġcon found od ine od ometry pre cmd pre gunta ĠC AT ĠC CT ĠC aN ĠC BO ĠC LEAR ĠC ritic ĠC redits ĠC LOUD ĠC andle Ġ` /` im x im Type im mer to fit to ix to lerence Ġtest e Ġtest cat Ġtest Get Ġtest Images Ġtest Basic Ġtest OrderedDictNumpyFeedFn Ġtest Rollback Ġde np Ġde ls Ġde skew Ġde normaliser Ġde graded (" [" (" .* arn e ĠF m ĠF usion ĠF OO ĠF riend ĠF UV ĠR g ĠR w ĠR an ĠR CS ĠR elief ĠR enew ([ _. Ġval new ange les Ġax V Ġax labels Ġax pic np H np v np version np layers np roj Ġfi j Ġfi o Ġ% ") Ġ% "," alse qs if exists if else ub ank Ġ3 88 Ġ3 274 Ġ3 243 test cases test Activity Ġme tab rain field line parts line Counts ĠD ra ĠD DI ĠD MS ĠD CG ĠD TM ĠD ROP ĠD uty Ġlo wered Ġlo gevent ") %( 01 19 01 51 01 70 01 78533 ne a ne ptune ne bula Ġcol li Ġcol width Ġcol Loc cal lf cal ories time axis time In time var time Entry ase vent Ġse maphore Ġse lenium Ġv ig Ġv ma Ġv names Ġv amp Ġv ClampPanel Ġv edur Ġel ision ers hape ff actor ta o ta gg out type out fil out MskNii path ops path patch pro ber pro cl pro gression pro scan pro lite min TF min Dens Ġk data Ġk filter Ġk hi Ġk NearestNeighbor Ġal erts ĠN out ĠN ump ĠN var ĠN MOD ĠN SL ĠN halo ĠN ichols ĠN edat ĠN SImage ĠN guyen form set form widget art mental per ror per cepts ds a ds w ds ys str p str ar str repr ĠL Q ĠL s ĠL ank ĠL ane ĠL ESS ĠL GR ĠL UE ĠL LR ĠL sun ĠL SB ĠL CM ĠL GBM ĠL BoxN mo c mo lfrac Ġon t Ġon Bar max P pa wecutdg fit vals fit Function Ġpro ds Ġpro pose Ġpro pexp Ġpro pcaps class List class Est dict key te gra ĠM MB ĠM é ĠM CLT ps ig ps plups ps fim Ġmat Total der grp Ġne ptune Ġl al Ġl ll Ġl string Ġl keys Ġl post Ġl pc Ġl hr Ġl pf Ġl uck Ġl Tables Ġl mplus app i app roved Ġuse rapikey Ġuse RTH fig file fig mgr fig mplf we ps we ich ir b Ġfrom iter Ġfrom Date 10 34 10 395 10 883 iv ate iv ticks iv mps Ġpar type Ġpar dir Ġpar limited Ġlen X Ġlabel A Ġnum str Ġnum batches Ġnum Seconds Ġnum Years Ġnum outcomes Ġnum Freqs Ġnum traps Ġnum Neurons Ġnum Codons ĠG d ĠG s ĠG x ĠG CT ĠG UID ĠG OOG ĠG inga ĠG reece Ġout dict Ġout fig Ġout Size Ġout records Ġout FH Ġout ershape Ġprint Title Ġstr ids us ian row Headers Ġma coefs gre ens oc le et ext ber th pl u pl v ĠRe tr ĠRe create ĠRe build ĠRe assign ĠRe fract ĠRe conObject comp o comp name Ġname Bit Ġpre y Ġpre cmd Ġpre server Ġpre allocated Ġpre allocate cl scores cl é cl inton Ġfile spec Ġfile hash ĠE i ĠE lem ĠE SC ĠE lec ĠE Vals ĠE DT ĠE pub ĠE SDU ph osphorylation Ġdf q Ġ4 33 Ġ4 34 Ġ4 65 Ġ4 54 Ġ4 83 Ġ4 228 ms ley ĠB DF ĠB bc ĠB orn ĠB GC ĠB CI ĠB ORDER ĠB INS ĠB reslow sh ark sh ingle sh ipping append left Ġun ities Ġun convert Ġun mapping Ġun proc Ġun quote Ġun desired Ġun condensed Ġun important Ġun shuffled Ġun evaluated Ġun reachable Ġun fortunate Ġ5 100 Ġ5 27 Ġ5 44 Ġ5 000000 Ġ5 47 Ġ5 89 Ġ5 70 ip db Value ChannelMixin ill umin ib ble ib osome ifi e param log iter children iter Collection op code Ġthis right Ġthis left Ġthis bottom Ġthis Experiment Ġthis hspace Ġthis wspace Ġthis Practice Ġdi ameters Ġdi ap ]. *', log E log mean log std log cut log cons log gdp key List key ness In A In dent In Or In Seconds In Before In fluxDB zer nike Ġsk u Ġlist With Ġen rollment ack Column rid iculous ef rame che er Ġrandom Length ile t 99 43 99 973 99 9096 99 8624 Ġcomp uters Ġcomp osing Ġtime ax Ġtime ings Ġtime User Ġtime weighted Ġtime ofday ant ied 64 13 64 870 64 3958 Ġclass names und ry Ġ`` ~ Ġ`` ':' Ġat ots ĠW O ĠW el ĠW et ĠW eld ĠW inc ĠW rote format ed Ġmax zero Ġmax Count Ġmax Freq Ġmax pooling ., \ num Data num dims num bytes num Days num Neg num Locations num Centers og rp model run init With init UI ide ver 12 906 Ġget frame Ġget Index Ġget items Ġget List Ġget Param port ed port SF ĠO VO bs ave las ped Ġit g ()) }) ()) +' ca iman error Type error Result error free sub data sub row sub mod sub peak sub Id sub merge sub lists sub Title sub dags sub tabs sub satellites Ġplot ing Ġplot label Ġplot dir Ġplot Graph Ġplot From Ġplot Height Ġplot Geometric ix y ix sf map str Ġall dd Ġall peaks Ġall Zij Ġall Dashboards dir fmt ĠFalse Neg Ġhe mia Ġhe alstr Ġpo iss Ġpo pping Ġwh ats Re grid Re ac Re inv Re ws Re optimization Data Asset Data Pay unt ed 25 46 25 188 25 9929 raw p Ġline Wave frame Geometry inter medi inter pto inter vene Ġch size Ġch unck so low so ever so phila Ġdist factor Ġdist Types Ġdist mats ren ormalize ren devouz 11 323 loc A loc ating 32 36 32 158 ments Balance Ġmin u Ġinput ted Ġ[] )), cc ión Ġz mask Ġz top Ġz Min Ġz atom ng s color bot color wheel Ġ\ __ ĠIn compatibilityWarning Ġper missible Ġ10 26 Ġ10 62 Ġ10 91 bin num bin CheckBox Ġsc nn Ġsc ada Ġsc itools act ind act ants ][ [" ][ +-]\ ĠY E ĠY L ĠY Z ĠY names ĠY ET Ġsh m Ġsh uf Ġ) # Ġ) \[(\ Ġpa ce Ġpa rest Ġnew item Ġnew theta Ġnew Node Ġnew Rec Ġnew NucleusList Ġtrain cat Ġtrain HMM Ġj Y Ġj Z Ġos pace itle t req MktData ĠH r ĠH ypot ĠH EV ĠH PF ĠH RU ĠH aven ĠH ogg 15 17 15 50 15 55 print d ual s __( _ 05 14 05 50 05 60 05 71 05 045 05 1658 input Array input Word Ġlog n Ġlog ins Ġlog laplace Ġlog Decs lect ronic Ġfig uring ding er Ġeach other =[ ...]) tra d tra iler tra cenames ang vel ang factor ang sep Ġinter s Ġinter com Ġpy u Ġpy format Ġpy db Ġpy readline Ġpy driver Ġpy UDT Ġpy cairo Ġpy vista Ġ[' '. Ġ[' ../ Ġ[' =', Ġ[' --', transform Distribution ĠParameters File start y start Params start WithBundle not Nan not epad :` + Ġobject Params Ġno is Ġno Show Ġno Use Ġno ylims Ġno xlims ĠU M ĠU h ĠU INT ĠU MAP '], )) pr sum Ċĉĉ ĊĉĊ 20 42 20 901522 Ġ(' ' Ġ(' +', dd ress Ġcl ang 33 15 33 66 33 45 33 047 33 4324 Ġsub cs Ġsub item Ġsub layers Ġsub win Ġsub seg Ġsub js Ġsub nets Ġsub partitioned ie lo Ġcolor image Ġcolor blind no key no match default user rst d 100 55 100 40 100 32831 80 66 80 46 80 4212 80 8969 output Files output Columns Ġ6 31 Ġ6 300 Ġ6 378 new str new dir new field new theta new Analysis pred EXT ES DU ER ASE ER ENCES ste al ug ue base system [" { ]] " 66 01 66 6233 amp licon Ġrow d Ġrow Node Ġrow sums Ġrow chol ĠSe mantic 45 57 ĠK K ĠK roupa load ObjectBinary load Qubits 75 25 75 70 75 944 '' ): '' ))) matrix Colourmap use AA 88 32 88 3229 88 1917 88 4164 fn al Ġ| " Ġ| ' Ġ| ... grid Y grid Fy "] }' ']) +"\ 16 34 16 39 16 31 16 853 16 1016 Ġup lim Ġup loads Ġup front info List info style info Bar Ġcal Speed sample file show box show BacktestingResult dist l dist mtx Ġapp les ak t ĠEx ceeded 35 05 35 06 35 69 35 41 35 554 35 6964 Ġcur X arch data 14 13 14 92 14 87 14 124 -------------------------------- ----- -------------------------------- ----------- Ġalpha p 19 42 19 873 Ġkey b Ġkey name with Object group d group varwithin ))) - ))) -( Ġgener a tt conv pol uation count Col cur ial cur ved Ġsize y )] ._ box data Ġprob ationary AR TH com un Index DateFormatter ges ch Ġ8 20 Ġ8 94 Ġ8 31 Ġ8 51 Ġ8 215 Ġarg names Ġarg relextrema copy x copy File 78 59 78 164 78 1313 78 0042 78 2556 '. """ '. -', 13 855 13 0574 13 462 Ġonly files Ġbin map cor mat cor mats mask bits Ġid Str Ġid ssrc ĠV AC ĠV OC ĠV AE ĠV ulnerability ĠV inet ĠV OX Ġstring OrderType by band be autiful title format title Panel title spacing zero Phase 22 70 nd on nd ownloader gs x Ġiter tuples func Val arr str 04 10 04 244 04 8047 sv ara prob ing prob ml prob edata 96 76 96 53 96 278 96 8075 03 73 03 147 03 992 03 061 ])) == the lp the ora lat i lat min string y string Ind string FigName Ġstart ptr Co var Co ercion ĠTest A ĠTest Index ĠTest Run ĠTest Pickle ĠTest Real ĠTest Merge ĠTest Indexing ĠTest OLSRobust ĠTest Matmul 02 74 02 81 02 194 ject s Ġdict ates Ġend ptr Ġend ExpNow std m std trit std pce 95 1711 95 2744 Ġover line Ġover loading 94 4444 ',' -') 17 95 17 39 17 787 17 8064 '): ' of rontal alpha p Ġdataset Spec Ġsamples ize Ġsy ear ĠCo arse ĠCo oley ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ 85 2778 85 862 Ġmetric Params Ġfeature Matrix mon y 24 264 Type Of csv Writer 27 92 Ġdis pl Ġdis place Ġdis agreement Ġdis parities close Arr Ġ7 35 Ġ7 93 Ġ7 91 freq Ch uc b uc ers uc davis variance Threshold cat A cat test cat Index image pointlist main dir node set ref Gene ref ractory Ġresults ML 86 32 86 9835 SE CTIONS gen utils gen fromdta off en Ġsys list Ġsp x Ġsp gp Ġsp Waves Ġsp ontaneous Ġmean Fpr obj Name 06 80 06 30 06 117 06 0002 temp Rec temp Vec temp AEER sy ria 18 36 18 92 18 79 18 014 18 80273 36 11 36 13 36 352 ten kan level ised level stable norm Intensity ]), :] 07 17 07 72 07 056 07 944 exp log exp dlist exp flare linear ization Ġnode strings Ġnode NumStop do psd mod type man eu Par ab Ġcase d Ġcase Sensitive dis miss dis ci dis plays dis continuity dis agreement Pro fundo Ex terior ST C ST RA Ġadd cyclic med cross Ġbet wee reg o Ġnd Line Ġdoc ID )): ]) Ġlin Dim Ġlin edata 34 988 34 234 park ling Ġ... ]: Ġ... ]` Ġgrid fs Ġgrid Lines 97 04 97 959 97 3584 Ġpart i Ġpart ititions Ġnon monotonic Ġreg plot Ġversion ok Ġact ively ĠJ Ds ĠJ Birch ĠJ SBSim 92 66 save Sof ID O ID Layout Time Network ton ize ton CO Col Defs Se en Se gs dt u dt list sk ies Ġload data ĠQ uest ĠQ Desktop ĠQ KeySequence ĠQ CoreApplication ĠQ HeaderView lp c lp ts lp mv 84 86 84 375 Ġtext plot Ġscale A Ġscale B Ġscale Entry Ġq crit Ġq oi Ġq utip Ġq DBS Ġopen htf Ġwork flows ram ids IC OMP left Display left Delim Ġkernel spec Ġsort Ix Ġtarget Name my th my py my time my args my kwargs my graph my Tree my Axes my Keyboard my cvals Ġ9 17 Ġ9 09 Ġ9 87 Ġ9 899 Ġ9 347 Ġcode Fragment Ġgroup sort Ġgroup boxes Ġmask b Ġmask g Ġmask id Ġcurrent Activation move flag Ġread through Ġfreq dists ac as ac ies scal ability Ġsum a update SIR ... "), ... )" Ġtemp Pre Ġtemp Results Ġtemp AEER Ġed uc Ġmod erators Ġav z 65 15 65 83 65 8682 30 88 30 997 30 9995 File path File Info File Element File BaseName filter py cluster Config Ġenumer ating sol ic Ġass istance Ġass igne ]], ( Ġad visable Ġright layout Ġtrans dat Ġtrans itory 37 00 37 11 37 92 37 26 37 71 Ġlength A 50 8525 cm f cm aloney Ġtable Type Ġloss B mt u Ġweight decay Ġorig data Ġorig Val gn n Ġfol ks Series Error ĠCon over 87 0216 mpl color point colors Ġtraining set RE T RE WS RE JECT RE PARAMETER RE LEVANT CA IRO Ġmult is Ġlow Hertz ik el Ġoff x Ġoff y ĠCheck Validity Ġsome true Ġsome day 44 92 44 87 44 76 44 0154 44 3469 mode a Ġextra dim Ġextra polator ĠZ b ĠZ ER ĠZ hi si am si deframe =[' -- active color active DutyCycle Ġacc els Ġacc retion fill Color (* [' 55 000 55 54 55 3966 55 4563 nn n last gind last Five Ġ(" {} pop ul img size Ġbu ying Ġ20 45 hist Plot multi BarChart Ġframe Inst Ġwindow DidResize 26 94 26 08 26 765 26 9985 26 7234 De convol AG ER AC GA Ġlast upd 77 04 77 256 77 2549 77 0327 77 3229 ĠDe m ĠDe serialize ĠDe laware ĠDe STIN ĠDe capsulate Ġgraph ically ld c view items ling ual auto complete auto zoom auto Columns RO A word dict word Shelf ([' / {} __ Ġevent name Ġsplit ed Ġ] ))) Base IO Base Grouper Base TraceHierarchyType search light Ġsm r Ġsm rp Ġsm dsolve cell d cell h Ġzero point Ġfigure Manager Ġsim ult Ġar bit Ġar coefs pdf name Ġcond name other func 42 1427 ĠWe ber ĠWe isstein 98 236 98 287 kw only kw inners offset Str font List window Flags window DidResize Warning Window Warning Message Ġ} }} Ġhelp frame lower dim source Port make MixedDataFrame make ObjectSeries Ġter p List a Ġty cho gg ies Ġ200 9164 Ġdt c Ġobj eto 43 96 43 178 43 1279 67 90 67 001 67 254 67 4556 67 6185 67 4066 Ġpas cal Ġpas sthru Ġfilename X ĠPer disci ĠDefault Size mm c Ne mec To phat To Analyze To Visit To AAID ev otte Ġab ond Ġab normally Ġbest weights Ġbest Result Ġbest Weights Ġcross matching Ġaf filiatedEdges Ġcount Col first Name first LevelPartIndex Ġfield Name sin del less ons open street height min height max Un Cor 47 10 47 1620 year built total files total tokens fra cof sim on Ġhigh Hertz ox ides Ġimp ulses Ġselect cell tz file lu xes user List user Input Array AndMultipleEpochs Array Nonzero Ġraw text Ġraw esome Ġraw FileStore Ġraw ArrayDatas OL A Ġupdate Service inv ite Model Series Model Wrapper block list SD Rs Set Field Set Limit Set GxE tmp f rad viz TR s current Macro current Priority current RegionPoly ias data star path star red ose ismo Ġfont angles rox ene query Name depth img depth fct Ġemp tys full Data full match full Meth full CostList go Plot Ġhist mat Ġhist ograma ĠStr Dispatch 49 01097 Label Width Label Ensemble ĠUn stack ĠUn changed 28 80 EL I mension al ĠSet Up 9999 01 cast Dir fname true fname fmt ĠPro tection ĠPro totype CH ANCE CH OOSE Ġdiv iders Ġmetrics JsonData 29 01 anel s cos del Ġsignal ing Ġsignal tonoise Params OutFile dev info 39 10 39 25 39 87 39 1201 unit ized 40 64 diag nosis Ġimg Num Ġstat group Ġlib path Ġps m Ġps hear 68 181818 theta V )]) ; Ġmon ster sen na Ġblock id local Data flat sum hed r Ġfound ation Ġtmp line Ġtmp shape Ġtmp current Ġtmp Site .) """ .) ``. 38 00 38 183 38 358 38 2280 Per Item Per mutations 1000 64 Ġactual Values ")) ): Ġsteps Ahead Ġoffset Layout annot res Ġelement o MA PP SC D Ġbreak out has HeightForWidth Ġnet db ele xRate 46 25 +' `` counts arrstr action Close td at td ur td nn td rs pca Matrix roll rate Ġeigen mode UN FITTED cache it cache Key Ġvar cost Out Put Ġthese Keys sm v cross section cross wind Ġmain item Ġmain Bundle Ġquery Name Ġquery Service 647 933 Ġret Value Ġret inal Ġret inotopy 235 1 Ġlower Bound __) ( Ġdocument ion AD A Dict Cursor Dict StrNum ĠRead Length 117 3875 miss ings ĠCol lege Ġwrite box Ġwrite Text Ġwrite Corpus Ġwrite ToFile nc scans ï¼ ĵ ĠMe V ET CODE sa ida SA X Log File Inter medi Inter ior Ġign funcs 48 35 Ġtask pid Ġdb key 56 3436 cho i IS R Linear RegionItem Ġrec ie Ġrec fromcsv Ġdelta P Ġtz one Ġfix list Ġfix items 57 80 57 08 57 2750 App ro distrib uting nb irth http server "," .. Ġroot func curve ToAnalyze extend ing Ġstandard Scaler this Plot 69 01 69 168 69 1919 69 1980 69 0066 69 8638 69 06374 Ġbox points '\ $', upper Bound Get Flow Get Tuple Get Spacing Get Trend Get NumberOf Get PyData ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ cd pp Path Exception Path Like Ġxy var md roe Ġsearch er Ġsearch Resolution String Value Ġmy H Ġmy dir Ġmy table Ġmy Config Ġmy Map Ġmy callback Ġ:] ))) Ġfast tree des pesas Ġignore Case xs f Sh Arr Sh ibor Scal ability :, :,:] Ġdown hole Ġ'# '), Ch ance Ch lor Ch rome Ch ristoph No InvTransf Size Dict Size Dist ĠCal ibr ĠCal cium sw l Format ted ĠLo a Line I Line Over Line CenterDB Ġpickle able tri angulo Ġmpl Txt Ġlat min Ġlat range Python Function skip lines idf am rm vd ĠBase CrossValidator ĠBase ExtensionTests ĠBase InterpreterInterface TH ING TH ROWS Ġexec lines Ġlocal Data ĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ meta DF Ġmultiple PlotValues long form project LabelsTo Ġassign ations ĠRun DiceTest sig m 89 322 89 7896 89 3835 89 13705 src Field All Files All Env All Geo display Limit HO OD Ġpixel wise Ġdest addr 74 12 74 87 dec ile ĠLe maitre Or Equal Or Remove ĠQt Console ĠQt Svg imp ex imp ls Vector SG repe l Max Value Max DD Ġfilt bank Ġdel c Ġattribute ColumnIndex 686 868 aut apses Ġcs Port Ġsetup Ui none t pk n pk pars ([" '" ())) +"\ Table HDU Ġ## //////////////////////////////// CO UP ĠList Of Means OneSided Int elligence ':' ', avg p sche mata Loc Indexer cp lex Ġ$ / Row Data Row TypeInfo Ġconf Dict comb od button Click alan cer alan terior Ġpop Lst ĠString OptionParser )+ (\.\ 51 7549 ĠMin ima ĠMin imize OP Y OP TICS Ġ14 17 Ġ14 042 Ġmer ger agg ClassEst gno me Ġdep graph Neighbors CppInterface Ġfinal squares 79 06 79 068 79 3492 ptr m cost as light ing light yellow light pink light gbm Ġselected points On MainThread 54 64 54 65 54 1176 54 0674 70 209 ert urbed Ġsw r Ġsw atch Ġsw ash 0196 078 section data ci lo ci ences ci qmc lr n Ġparent ID Ġparent hesize Ġcache key EX PL EX CEPT EX CHANGE EX ITSn EX TRAS tag set sf h 83 94 83 0504 83 2539 Min ibatch Min Price Dist Grid tk lmbda Ġintegr s dump ing cons ists Ġ\\ ). 59 0937 xis T !! ``. Cur se ĠArray Expr Ġaut op Ġpdf TeX He i ('% ', ĠMake ParetoCdf attrib uted Forest s mass Array mass RangeParams Is Selected Is Pushed Image Sets setup RGraphics 93 05284 93 259929 Ġag p 76 855 76 9746 Ġiteration Results next RegionPoly win Estimate Grid Qubit 300 6 300 439 DATA EMPLOYMENT zen burn nearest NeighborsCppInterface ĠSo low 82 365 82 1037 prop Trainer opt ic opt data aa fe Ġwell bore Id Handler 72 6483 Ġcustom ised Qu iz Qu ackColumn Ġdevi ant Ġwave max Ġwave obs Ġword count Ġpp id Ġpp form Ġcost f Ġhash count Ġent rez Ġocc ipital )- > ĠInt o ĠInt Sequence At mospheric At mosphere phi loso ved ate NE ED Group ID An im Dis covered Ġround about ĠPy Brain Temp Directory Temp Json Valid KFold Valid ShuffleSplit Ġmix c Ġmix t ĠPath Mover Sub version Sub Satellites Sub ordinated ĠFe i __, _ Ġshort varnames wave fct Ġli u Ġli wc ĠPo chhammer 180 4878 53 1506 53 4522 Add Grow 62 1212 cb label .]) } fp fs Ġho uston Ġho vertextsrc Ġnest o Config File Config Dict GT P GT TG 73 17 73 0399 green yellow pc as CL M Ġlon b Ġlon range actual Lines aw i aw ater aw alk CD D tex c tex d indic ial rat b Ġda ughter Ġdepth shade Ġrs ids Ġpage dict Ġsafe check }} . }} ] }} ). AM OUNT Ġavg kern Ġnt steps span ish ^{ %. ĠRes izes 999 10 Node Container phase deg Ġmag bins ĠInter ior Ġinvalid Commands ĠCON CAT 71 105 ("\ "" Ġmid del sym rank sym match cum mulative Ġap is Ġap par QU ET ('- '. ('- ')] Ġ500 7 cmd dir )} \\ 285 2 direct ness energy Start Ġ18 000 Dataset Reference Sp ins Ġcha p ron Python ĠSparse Tensor Ed its interp style ĠID C contin ous ĠApp l ĠApp Form Ġsection var Ġpairs list Ġpairs new Ġepoch ing ann coords ann ulus Sy mm Tool ToggleBase Ġsymbol Pen Iter ated With Path With Missing æķ°æį® èĩª ĠNo Norm ĠNo InvTransf ĠNo SparseClassifier ĠNo FurtherDataError mk Brush Of Tensors Of Pocket Ġ'{ {" ~~~~~~~~ ~~~ ierarch ically CON VERSION LI FE Ġanaly zes circ ulo circ uits approx imated 58 1914 58 9685 FO ff Ġport map super pose Layer CV Layer Artist pool args ä» ĺ Ġshare ds ird vars TE LE TE AM +" ( +" + ĠSy nt As String View port %% - %% ') ĠCategorical MetadataColumn clear All Ġsupp lies Ġsupp lement }$ ')) Ġinf j Ġinf requent splits Array Act Env Act Geo buf for geo server six th ĠTh ursdays BU F 254 12 254 1918 Ġprogram med cr v since Last car ree Ġbit Size ĠQu arters shared Application eigen frequenzen Ġradi obutton 91 86 host net Ġinv n predicted Lines 256 88 ________ _| mul liken Ġnn vm ĠDis persion Ġ'+ '] Ġinner datapath ĠBu Gn ĠBu ffered Event Counter Ġtruth y ĠHT K .\ . ĠTimedelta Properties fet ches Ġpackage List Info Dict prev ZoomRect ba qus custom space seg fault hy com Start Entry Start DyingAge Process SerialNumber export ing čĊĠĠĠĠ čĊ çļĦ ä»·æł¼ çļĦ ä¿¡æģ¯ çļĦ åıĤæķ° Ġdev idx trip data Read Length bi en bi og Cont igs Cont ingency From Log ĠPandas Dataset ĠRow ID EE C tw opi resize flag quad L ked ata Ġgene set Ġgene alogy RES IZE PRO PS Ġdesign er Ġdesign ation 10000 1 TO F Close Event Metric CsvFile Item D Item Data flux net Hist AdjMagsAct loads hed SH ELL ĠPipeline Exome bc u ĠFeature Num ĠTrans parent square ds gd T Ġ"_ "+ ĠSub gradient ĠSub Dag ĠSub scribe umb ia MC flag good Wvl Ġtd ur rv rag exact std exact const '% ' '% . Ġker nal ĉĉĉĉ Ċĉĉ Des crStatsW Pandas DataFrame mx cond delay Sum master matrix )\ "\ )\ |^ Cor Rect Ġph cpy MAX FACTOR got ten wind ings ql width ĠMo dif ĠOutput File ENT ICATE scope Out OC PI OC PO OC KS ĠGraph Tool RL P Font BBox Cell Cycle Ġclear canvas ĠVari ogram Ġur ange java StringLength Ġminor step free info ]))) ** ĠBe auchamp Ġ88 7 Ġ88 75 OK E Ġmass action Ġcorr mat ĠFFT Slices mot o mot t Ġ21 10 ĠFirst ly wt q rl v bot net Action Role coverage Folder 0001 0001 Ġtre estr pow derblue 400 21 400 892 Current Params Var GridSet Level Model 663 1296 Do ji 098 15 098 2691 cursor line cursor Props PT Vs ĠTEST ED Ġcap cost comment ed Ġns fr ĠError MP Ġtgt pos =(' # Ġfiltered data wait For ĠSample Point Ġneighbor Ps lam Sq Filter Converter Filter IsActive Ġarrow head tod t Optim isation Ġtex d Ġtex arr Ġtex mf cloud top Ġchart File /> & gui qwt API Extractor ĠWH AM ĠWH RC Ġdig ino serial isation TP Regression ĠColor bot ĠColor Attr ĠTra vers ĠTra celine [:,:, :] [:,:, :- bed s bed Graph daily VAR Names Dict TA AG pcolor image Meta Object Mode m Ġer lt Ġgu rob beam Global beam former colour bar 0101 0101 ĠDummy Complex ĠDummy Pd Dialog FilterIsActive 109 88 Ġsel cting 275 92895 look ups vocab Size psd l psi comp BA YER 445 87 ĠWith DataPortal Block Offers ĠindicName Abbr Ġreduced Trace cu los Ġgtk DA [..., : Be ef Be zier eig ensystem GG U GG GT GG UC Ke pt Ġanalog ue Ġrad ical Ġfl ds .] \", Points For Ġcurr Index '$ "): markers izes Face Predictor 118 37 hex agonal Ġcare t ĠStat Var install s Call After Ġprocessing Arrs fd F fd open Load Job PRE V Open StreetMap ULAR ITY '" %( Ġ75 000 Code To ĠSupport ing une gative 707 0848 988 28307 ĠAss imilation Panel s Ġgh z vid dir Ġrnd n Struct uring ĠAlex a Ġdr vecs 224 2075 224 9695 Mag ritte 110 7 110 8 110 84 åº § 636 1 636 729 ĠReg ensburg tc rs rev isions ming ly Mock Splitter 112 16 SVR G `). """) Ġ196 8 250 94 250 661 xyz s ĠPARTIC IP ung rounded ĠCountVectorizer Model Ġgl Rotate autoscale on 905 597 917 6 917 0178533 ĠST ATION 319 444 319 839 Ġaz min Ġaz bins Ġextracted FeaturePart Ġkf SeriesName Ġ================================================================= ======= Ġ================================================================= ========================== ĠOver plot ĠStart Time hn ke Ġnat log ĠML PC Unit Variance stand by ĠDATA FRAME vd n æĸ° ä¼ļ计 "} ', "} ]) Extra polated Ġpow der 756 1694 856 196 856 040 Ġmicro sec Ġ27 017 Ġrp n Pol and Pol arization Vis itors Freq Thresh Ġalt deg cn mf Ġbeam Tom aud al toy a perform Selector ãģĦãģĦ ãģĦãģĦãģĦ Ġmov avg Ġmov moment Auto Transform visual izers ĠFL UX ĠOpen BLAS need Clean need Serialize DR UID upt a Ġtax calc Cs lope Pe ters stim ulation 311 19294 chr onic chr ö Union TI Union Trace Union Restrictions ĠShow NetError ĠMon omer 984 167 ĠFormat Int Fixed Size 185 8 185 894 375 24459 ĠNumpy IndexingAdapter Param Overrides 237 2468 Alg Exception 296 14922 delt ay Diff use Diff MeansPermute PH Reg 235294 11765 âĢ ĺ dark khaki dark olivegreen rh or rh ol eft Mouse 132 3 Custom BusinessHour Custom BusinessMonth vc db 806 11778 Ġintensity Ratio quant ify Ġperson Dict Lat List Ġlt ype ĠRE TRAIN Ge orge Uni vers Uni Prot Ġdp icor flu orescence Ġeq price 789 19 adjusted list 0909 06 ĠSc ra clust number 644 844 Ġmet data Ġmet ropolis 399 3 059 85 Ġ'/' - amb ia middle frontal replic ated ĠHand lers Jo hannes ĠTH F ĠTO F tu lo ĠFast ing ãĥ ª ĠPoint Browser Ġnr Of Ġnr rd ĠSE AS ĠSE LECC Tr iggered Tr ilinear AP templates tb t screen Geometry ko be Ġpc ca Ġpc idx 205 0005 LIN ESTYLES fac il 165 2796 âĶ ´ æĽ´ æŃ£ 212 9 Shape ly gam mal Geo Mod 899 735 899 4688 899 0498 Ġelapsed Time ORD INAL 154 0518 Ġtile info ĠInteger OptionParser trial Num entity matching 211 325 iq range iq Snp Red is Red ucing ĠCluster Error rx m ++++++++++++++++ ++++++++ PM T PM Var å¹´ 份 å¹´ æĸ°ä¼ļ计 937 950 Ġcentral ities BL STM 014 10883 è¡ ¡ ĠSimple DataSource ĠClassification DataSet Ro unds ĠSplit Condition åİ Ĥ Cluster Bar aug PB 987 6 977 20 ]; ". ĠLat List ĊĊĠĠĠĠ ĊĊ ĊĊĠĠĠĠ ĊĠĠĠĠĊ ĠVer bal Exec ucao ln A ln M Job Set Rank Sum System Settings video FrameTime ("{ *} 333333 5 merged RDD Ratio Max Ratio Avg 356 1688 meter group 432 3 Ġ"{} \ Ġ194 7 Ġ194 9 Threshold Slider 863 4515 900 6 900 837 Mark Parser ĠAc cessing plant ed lh or ĠDense SGDClassifierTestCase ĠDense SGDRegressorTestCase Import Warning Import List eeg p elem f hard coded Channel To ĠCode Fragment 127 3562 Find Flow Find NearestElement RF Model rg bs Ġste re Dense SGDClassifierTestCase Dense SGDRegressorTestCase Ġmc set ĠMag Factor ORE QUAL ĠScale Gradient Ġmm hd ĠPIL Image builtin coeffs nav Bar åIJ« æ³¢åĬ¨ Tick Price 135 7 Ġgam w Ġ[% ]") Img Name 054 64603 Ġdens ified Ġcheckpoint Location 667 48 195 857 195 0100 Application Services gu in 306 1 It aly It alian hu ang Ġtheme Name Ġpenal izing ĠCustom DataFrame 875 897 Ġgal propz Ġprefer SpeedOverMemory Gen Bias Char Info Pl k Form ation Ġconcaten ations Script Factory Vert icaHook Copy left 451 8822 075 0 625 727 broadcast Registry Ġteam Abbr 266 1 266 18007 394 4 394 06117 Client DC Page Setup switch over switch On 225 21 Abs Temp MT B MT pyError Right Gaze ctrl Panel Std in Std Permute ict s ĠRa o ĠRa mak 395 58 395 456 leg Pos leg Siz Edge Type Edge List Left Gaze Ġcandidate DensityValue ĠRo kem Weights DenseLayer 924 794 Eval Metric 328 224 Region ID 995 95 Times Type Attribute Type Attribute Name Thread Call capital A Remove SubMesh Ġtrading WithPython ĠHas OutputCols ĠHas MaxIter ĠZero Pad Ġmt SetGxE SNR s Container Base ĠPr ime ĠOb st por o ĠCross over ĠCross Score #---------------------------------------------------------------- ---------- Ob st cpp ContourGenerator Ġbas kets Ġnotice able ĠCar los ĠOP G Sha ding wa res åį ĩ SUB STATIONS Analy zed Full RecToToken explo red ĠMultiple Columns Ġphys ik SF Hs ('{} /{}'. Ġë Ħ Ġrms list POS ITIONS Ġfo os Ġfo ssil perc orso 238 665035 Notebook s 045 9 124 6432 183 999999999999 Ġbi en Go ode OM ALY OM ERO Ġbt ns Ġbt ngroup THER M front ends Dump Layer Med oids Some Class ĠSource Information Ġum idade Ġmarginal ized ĠBack track 104 17 ĠMeta RNN Cy cler 964 6 IF CB 015 327 Ġthumb loc ĠMapping KernelManager Ġpm dsolve 232 0 232 0257 295 3 295 468 Artist List Stop Entry Stop Word Stop When 056 359 655 663 Ġlock wds Ġwt files ĠEpochs TFR FONT FAMILY hessian OfGaussian Ġbucket Length Ġsli ps Ġlm minus ĠAL G Location Event Ġpix es 108 1677 ĠBbox Patch 178 531506 Legend Class ĠåĮħåIJ« åľŁ arma dillo 037 1815 ĠPolygon ize 396 7 396 2320257 sli ps Ġfx star Ġexceed ance Generic Table pex Rate 909 14464 lor ot Mixture SameFamily Header Family Ctrl Widget ĠLocal FileSystem Ġjo urnals Ġdes ispec Ġradial sq Gene Names Mesh Filter Chi Test ĠChe menv wc TempResults bundle WithPath Ass igns ĠBatch TableEnvironment ,:,:] * Activation Size dn idever ĠII k ĠCha pters 325 78323 ĠSch re SY NTAX ĠBox N Phase Tensor Phase Modulation Ġtbl properties Ġnom f working Folder Fill Color Property ValueDict Ġdelt at Partition Size åĪĨ 红 765 493 TARGET ID unix epoch ĠBio metrics ĠBio medical Ġoutcome Column Ġelimin ating 6401 99 6401 92 sco ping 198 97 198 26 emb ark 955 052 324 1364 324 309995 Ġprotein Count Omega Step Append Item Integral Type Word Net Word Scores toggle PointSelected earth quakes 665 29 665 89 865 261 214 3 214 8 214 40021 819 730 Ġfla wed 945 9499 Affine Diffusion ĠSte pping LSTM Model 844 85862 SPL ITS 292 89322 Lib s #%% ############################################################################# DU PLIC 777 99 Ph rase }^ \\ Mar ried ht id ht docs Ġagent Nums fwhm FormatStr 1234 6 055 42 Lon List OG IP 414 805 Noise To After Conv 262 90666 ,:]) ): Ġrnn In 457 882 Trade Price BG M Ġ67 20 3000 2500 ĠCF Subclusters ĠNull Writer 965 82 965 22122 944 18207 944 151261 Ġdigit ization hg vs ĠPrecision Recall orbit ofrontal ĠContain ing follow up Depth Profile simulate W ĠUnder standing ĠInvalid Classifier ĠInvalid Input 847 059 ----------+ -------------------------------------------+ nod Simple Debug ging quis itions ĠExp ansion pin Box ĠSmall NORB admin istrative ĠMar on mono index 268 3382 ĠSM OTETomek Ġtexts rc Light Blue 487 38183 Ġau ction æŶéĹ´ 段 uw il å¯ »æī¾ Ġcmp d mom c ĠArea UnderCurve ĠGlobal FigureManager ĠGlobal OddsRatio Subplot Tool åĩº éĶĻ LAT EST Ms Max Ms Avg 095 3 288 9708 233 1804878 anc ys anc ia 469 359 Ġipy parallel 280 855 584 183 leave Whitespace Ġic best Ġaug seq Ġdecor ations organ isat voltage Spacing 758 18 dayof month ç½ Ĺ Ġsos filtfilt 554 8466 Ġfm wk hydro xy 103 32 ĠScalar Plot lz o ingu ish 046 99502 LOCK ED Ġaff ines 239 279 Logistic Regressor Lower Bound ĠXY CL Ġqual ify Prop het ĠRobust ly Big Data |\ .)+ MENTS BALANCE detector data ĠGen omic 3834 24 ĠStatus Bar Ġplain Ranking Ġhover label Ġhover infosrc sx tr sas help OH LC OH Enc 245 1601 Ġwra paround Ġlaunch Where 885 0288 064 35364 Too Many Ġlegacy pipe Ext inction Ġorgan isations Ġtl dextract Sort able sch n dets igma phy lip ĠParam Overrides Week ly Dot plot Enum Descriptor 956 01635 Np Array Ġà ĸ Ġfir ls 3278 1 åĽŀ æĶ¾ åĽŀ è´Ń ĠBigQuery Connection Least Square čĊĠĠĠĠĠĠĠĠĠ čĊĠĠĠ Ġê ³ Join ing Ġ################################################ ######### Ġ($ )', ĠDataType Ops ĠMic rowave 044 7713 68235 5 tl x ewm var ffff bf ĠPhi lip Ġsized istribution (... )` 497 78714 bis pectrum Determin ing Ġspam writer DAT ASALESOUTPUT Forecast Engine Forecast Conserve Prior STD Prior Mu ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Ġrh iz outline explorer ĠInsert ing ĠInsert SizeCounts ĠDelete Holes Uniform Class ELE NS entric ity quot i nearby DialogFilterIsActive 646 851 Ġhbox Dial Ġgyro center ĠSimulation Result ĠDesign ing ĠSPE ED Station Density ĠNN Interpolator Ġanomaly Start ĠGO ES Content Type Ġ]]) ] æľī éĩĩéĽĨ bh BH teff small Ġweak ClassArr ĠDelta Variance ä¸į ä¼ļ ĠConnection Error pitch rate Ġmultiline baseline Ġspe chdr Ġtransit ively Ġtransit Match Ġmds path Ġatm data Unicode Character wg ts ĠCOL LECT 0000000000 3 workflow config ĠChi SqSelector 640 201 ĠPort s ĠTick formatstop CHUNK ER CHUNK SIZE pref ers *(( \ ĠGood Sections ĠFlow Accumulator ĠFlow Router 357 67 表 è¿Ľè¡Į 表 模æĿ¿ Ġema Df Ġparticip ates ĠDiff usivity ĠDiff MeansOneSided ĠDiff StdPermute Ġrepet itive die ze Ġsemant ically 754 1950100 Ġ'; \ Storage Manager 66666666 66666667 Any Field criteria C RMS PROP Ġfwd mag 727 166 854 98 Sol vent Ġtv b 058 3528 53333 3 hd wf Ġsamp width ĠUN ION Ġ ° Ġpic co Ġ77 35 087 11622 Problem Origin æľ¬ 表ä¸Ń Ġai id tran ss Ġgn up DEP LOY analog signal ĠIncrease s MAN OVA Ġ"\\ \\") Ġlg nd 287 72736 BUT T atr Array atr Ma passb C Place mark ('( ') Residual List ĠQuant Connect LZ MA Ġcas po dry bulb '^ [ æĬ ĺ Ġshorthand s ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġ*** # Slope MA éĽ ª ĠSurface Over 947 67 clamp ing Stand ards Stand alone ĠEnvironment Variables Plan es ĠGu o Ġdoub ly Ġwar ships Ion ization 575 75 Under standing 812 029 ĠMc Donald ĠMc Nemar anomaly Graph punct ure Tot Mass Ġmus st Ġmus cle Parts Region Ġ117 88 Ġmang ling Modified BetaGeoFitter Ġzer oline ĠRNA Diff nucle otides ĠSkew T WORK ERS popup ID rival ry æĶ¶ éĽĨåIJĪ ĠVincent Renderer business Date Ġ+' /'+ 3484 94 pseudo inverse ĠObtain s ĠSlice Viewer ĠPOS counts 483 867 ä»ĵ å®ĮæĪIJ ĠExpr Node 507 00378 049 3561688 Ġconcept ID LT L Unique Name ä¾ ¿ ("__ "): Ġcompens ated DPGMM Base Ġhint on mats L 836 80821 Elect ro Elect ronic Ġencodings File genotype d cmb file Hy po 0505 75944 constit ution ĠAnaly te ĠRunning TI Sphere VolumeConductor ä¸ĭ ä¸Ģ ]+' ('+ Ġrub y GM IL Ġbal wt (.* )'), èĢ Ĺ èĢ ³åħ¶ ĠPRE M 1968 2 6084 995 Ġasymptot es Ġ2019 0101 Sql Alchemy 889 19522 AIR s Arch itecture Arch ivo snow ball ĠStudent ized Ġdomin ance ":[ ], TRANS FORMS UserDefined Type Ġortho gon ĠSG Source Ġfy name ĠCy clic triple ts multiplic ator PowerCurve Stats Ġsam x Ġsam z Ġsam me 000000000000 02 ĠâĶ ¬ inject or inject ables 5245 31 çī Ī transitions in æ¯ı åŃ£æĽ´æĸ° æ¯ı ç¬Ķ Special FunctionWarning Ġexcess ively 869 02 Ġbq plot ĠXT Xi ĠCONFIG URATION Gate Lg Gate ShArr 369 1164 Google Cloud 代çłģ æĪĸ ĠPl ant Chrom atogram 3732 36912 MU DA GPU Options Natural NameWarning ĠSal peter Ġksp F 813 250 ĠEngine ers 916 95494 ĠPER MINTE Ġcoup lings Ġ119 16 osp henes ("* ") ("* "). 9385 39406117 âĢĿ âĢ PRICE INDEX gro filename wvl BinEdges ìļ Ķ ĠStation ery ĠLimit Method Ground Index SAL ES Ġmen Means Nucle otide nop lasmid External Links 576 204 åĿĩ æľīéĩĩéĽĨ 915 14587 ĠSF H 468 1982 Nfn Off Nfp Off ben zene 712 76855 Mer ton extracted peaks ĠNumeric Type TERN ATE vf file vf cache Ġodo metry #---------------- --------- å¤ļ çļĦ leap frog Ġssh tunnel ĠMV LegendClass Ġtg ts urbs im ĠBer keley Ġnight ly Ġexemp lary ("| ". Ġom its ĠGer man ĠRef Temp Proximal Connections Ġconsist ence Ġconsist encies MX NDArray Quarter ly âķIJâķIJâķIJâķIJ âķIJâķIJâķIJâķIJ Manual Interval Manual Scaling ĠFields Mapper Safe Function Ga P django project Ġ124 68 Deriv atives sac rif éĶ ® ĠTiff Tags 415 34164 ° , å®ŀ éĻħ 480 26916 è¡Įä¸ļ ä¸Ń è¯ģåĪ¸ 交æĺĵ代çłģ è¯ģåĪ¸ ç®Ģ称 Implement ations ĠStratified Dataset PLAN AR erf inv Byte Array ksParam Report ĠInstanti ates yade Y AI J nab ble 633 17787 633 43178 Ġlig a ĠIns ufficient 715 3912 ĠÎ ² ĠGT File 1801 2445 Lookup TableModel aj out 634 126 ĠFore casting elo die čĊĉĉĉĉĉ Ġ Ġtur bustat mechan ics ĠSelected Satellites Ġhydro logical 9696 0872 Pole Dipole grab ber Ġ'[' ), elli pe ĠNY C 8575 84 ĠShared WeightsDenseLayer 主é¢ĺ åIJį称 )^{ \\ 405 95756 squ arestorage Mutable Mapping 557 29 ĠDuplicate Warning sle e mach and åħ¶ ä½Ļ åĩĨ åĪĻ 675 809035 Ġunk own 6506 00 514 344 wmax min wmax max ĠClip ped Ġ`% { Equ ations exemp t categor ial Ġfre efuncs ĠHall dor 083 8634515 ksParamGraphWiz ErrorBarY ksParamGraphWiz XkcdStyle 0606 0606 ĠConsole Output 485 94418207 Ġseismic Para ĠHy ndman SQLAlchemy Error è¾ĵåħ¥ ä¸Ģ个 935 061 ĠAggregation Task 705 234 Ġprof essional Ġlite con Ġsemantic Features Named HivePartitionSensor Teff s Ġcsm list Ġber p Ġ177 17 ĠJPEG s ĠPan Tool Shadow At gouraud Triangles noc sizes noc ache mbu ild Resize Mode Ġslit mask 并 对å¤ĸ 并 æĬ¥è¡¨æķ°æį® Card Vals Ġsnow pack Solve CV bell um 597 061 826 160 826 960 ĠGL UT aggs pec 3737 3299 3737 414805 COPY ING }}$ '. ĠBal rogTruth melting pointcolors SIN Rs еР¹ 720 7592 Fac enet Capacity Test Capacity Units fle ches Ġ({} ): ĠLC U 8555 5133 ĠPercentile s confirm ations Outer IndexedArray ĠLatitude Formatter Dens ify ĠRag hu ĠHart ree ĠHart ley pmag plotlib Just ine 624 669 743 134 Cu yahoga domin io Ġpus hoff 562 849 794 178531506 698 66589 828 159 DN ase KIND S Ġdbs np 2525 24 STAR DB STOR ETCODE 8465 4795 tfm file tfm cache wes ome ĠLand scape Trigger Mode 398 3461 697 691 Tx Rx ĠVertical Axis Ġink scape pere id Ġez dxf ĠGLS L ĠSL LS 766 356 Gr ant 3526 2242075 ĠSeparate Unicode lmb d 8709 10 763 7557 ĠPal ace Ġrotating FrameData ä¾ĭ å¦Ĥ ä¾ĭ åŃIJ Mor phological urname nts ')[: ])[ ('; ')[ cod able listOf Parameters listOf Species ],'- ^') 834 69168 dP dH alfa ValTextSync ĠSpect roscopic Distrib cellFilter Sand boxed ĠexpResult TM AggregateFunction Wrapper Ġful lfilename Ġtoler ated 767 952744 845 154 Cop ra NOR MED cust m lick Grid Ġ")" ; Parquet FileFormat CONVER R Transport ableException 538 96582 788 67497 716 20901522 datat ime Visitor Id Ġcolum mn 0419 2604 midnight blue 111111 111 ĠRagha v ĠPhy la ĠTestIs real ĠTestIs complex fluct df å§Ķæīĺ åįķ 748 455 Ġmoney vsthings traffic In 55707 23 0512 6925 Ġambig uities Ġblo om ĠLaunch DebugStub vare xport ĠWS J ĠTimeDep State eat man won der ĠIbis Task Ġalloc funcs Ġalloc freeinfo Ġweekend Start IMPORT ANT ĠPhonon Work stere ogram Ġphil harmonic ĠJeff range Ġ({}, )* Physical Key broad band psp cod MutableHashTable OfTensors Ġcraw ling igg ins Markov StateModel 496 22521 544 331 Ray leigh gang lion 1093 10 >.* ), bcs uwil stel ib Quick plot 532 042 HAD CRUH Lambert W rare fied ĠNik olai Above GroundIndex Sinc Function Ġbnd l psr Group ĠGenerated Wireframe Truncated ProfileSequence Ġwifi Phy setItem Text ĠRoc AucChannel vene zuela ĠBcolz Minute 9898 98 ĠLookup Result ĠSAMPLE CLASS Ecut ValTextSync suff stat ĠEL BO ĠREQU IRE (') ') 536 17935 SFR perHaloMass coast dat ĠLon List liber atoire Qual itative ĠSafe Function ĠKen nedy ãģį ãģį Ġprd list Ġmetas rc 919 60010 aren as tit ulo ĠHAND LE Ġhap loid æĬ¥ è¡¨è¿Ľè¡Į 8621 75214 ldap group Ġcardinal is Grib Message Nm uestras ĠDES eq Socket Address EMF Pen shannon entropy 1188 64 Ġinterfe res ToOne OfMany ãģĦãģĦãģĦãģĦ ãģĦãģĦ åå åå 503 953 ĠRiemann Theta ĠJson Reader 9000000 953674316 Ġ[$ {}$]". ĠPlate au SEN SE Ġraman infod satis fies 对å¤ĸ è´¢åĬ¡ 728 27342 Ġthist op ĠPanda ID 6444 210 1897 95601635 Prep Template +/- \ 9996 9996 1190 944151261 7564 8297 Ġimu q REGI STRATION Simp lify ĠHold graf ĠFiltered ArtistList 749 338 sdel min sdel max numInput Vectors 8853 1190944151261 误 å·® ĠUSEquityPricing Loader abcdabcd abcdabcd Throughput s ĠInspect or ãģıãģı ãģıãģı Emin ValTextSync SSE s Advanced GLWindow Popup Menu Pha senverschiebung Multiclass SVM ĠSymmetrical Difference ĠMSD KI Mi Seq Mi DAS nud p xidx p Ġfrm Size 20151 010 Ġburst ing fT z 6424 16 saveData Txt SHAR ES SHAR ED SHAR PE ĠìĹ ° æĶ¶çĽ ¤ BIO ME enhan cers 1184 0447713 ĠCLASSI FIER 1020 2050005 frequen ze nang t Ġtxs For extrac Min Commun ity sineModel Synth äöäö äöäö ĠHex Bin Disc Fac AXES PAD Pau sed Ġcta Template Ġsiz elist 0033 66 Ġyyyy mm ĠChristmas Eve crat ers stda h getOutput Dir 0133 0565 ĠVo or ĠCalib rate ĠScho enberg IndexOps Methods 2286 769746 ĠPrimary Key ĠGateway Client 769 156 Mirror Page vat ican Ġterr itory Ġxidx p Ġ381 327 1383 666233 moll view orphan ed æĺİ ç»Ĩ logError Report ĠUkrain ian ĠStix rude VarianceThreshold Selector ĠHiptmair tol @{ ~ Flex GridSizer agn flag ĠVA Pr Ġstoichio metric annu ity ="$\ ^ cyclo pedia 1505 6934 ĠDele tes nba um Ċĉĉĉĉĉĉĉĉĉĉ Ġ sweet fda Ġamen able Ġintel lectual Couple Term 4678 31119294 Ġephemer al å¦Ĥæŀľ ä¸Ĭå¸Ĥåħ¬åı¸ Russ ia Ġrefe q Ġhall dor Ġjmx Host Delt anu ĠHeter ogeneous ĠBehavior al nodule detectordata +)? ," Scf Task ĠRece ive 7594 21 8416 55729 ĠFacet Normal Lateral Excitatory æ£ĢæŁ¥ æĺ¯åIJ¦ Lev ene Ġpod cast acum ula ĠunionLength List Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~ ĠPd Dtype ĠPd Complex ĠPn SC ĠJobs Data Ġimgfile basename choropleth mapbox Ġasym metry 5998 24 7268 2629 BDAT Reader ìķ ¼ íĶ Ħë Ġtheo Max Ġbear ish npr glngth ĠLam bdas ĠDataFile Originator 5400 862175214 åİŁ å§ĭ Ġcamel Case BOKEH USER Masses inhoverM é¥ ° Independence Day subsub Item Conserve All ĠSuperset ResultSet 09999990463 25684 Tho usands rhyth mic Ġery y cocoa agg getSub Matrix Ġxcom list 0432 3899 6767 67 Wrapped Database Ġdma ws ĠPin kett ĠDuplic ates bspl mat 0433 36 0449 0411 2444 2928 6598 2372468 Ġë³ Ģ ĠRETUR NING ĠpFalseMatch b Ġblind ness ĠdataFor AllPlots ĠCOS MOS 0489 185894 Course Central âķIJâķIJâķIJâķIJâķIJâķIJ âķ Precipitation In yax isscale Ġnume ls Ġplas mid Ġbhm ie dier ckx Ġisreal obj exo planet 10400 981 Ġindu ction ĠQuantum Bitcoin HBC ARMAT ĠSOL VE Ġfiat filter Ġlorentz ian Ġlup i 8564 467831119294 6085 81 2832 98287 4612 2286769746 Ġcustomdata src DEPEND ENCIES ZON ES ĠdM dt 6394 7561694 8288 4979 Ġ``'- .' èī² éĩijå±ŀ Lot tery Wifi Mac ĠTOR NADO dataFor AllPlots ĠRi pple ĠEye Frame ĠHal ving ncha in ncha parr eAcc Array lss aga Ġgar antied ĠnumInput Bits ĠgetC boeData 1499 1652796 corot df JobConfiguration Query ĠBacktesting Engine æľĢ大 åĢ¼ ske wx Ġfresnel c ĠtestFill Array Ġmetabol ites ĠNAS DAQ 99345 16808 Coincs File 2396 7070848 PythonOnly UDT DATAPRICE INDEX Triple Ma Ġ+-----------------+------------------------------------------------ ----+ Julian Date Ġrunid val ABCSparse Series 3827 421427 èµ·å§ĭ æĹ¥æľŁ Utc FilterConverter Ġaero py ĠTam il ĠDice Test ĠDice ChiTest loggs mall 2572 05 1565 42 9406 02388 ĠCheby chev WeightedWatersheds Seeds Ġ'?? ?' ĠnumBuckets Array Ġartef acts Partitioner Test ĠTopLef YGlobal Ġ+-------------------+ ----------+-------------------------------------------+ æıı çĶ» ]! ="# Ġcgp m Ġairs paces 6626 87 ĠQuit ting colum nplan GetNum Atoms Ġåĩ º ĠPRESS URE Declare UnicodeCharacter MANAG ER èģļ ç±» ĠCHANNEL S Splice Data Ġpec uliar minim izer ĠLos ses 8637 31 REQUIRE MENTS Toler ableError ,[- . Bcolz Equity Liv Prb ĠåĪĽå»º åĽŀæµĭå¼ķæĵİ cou ver imb learn ĠDal ke ĠLan caster ĠMMM Sim ĠgetInput Record autocor relations Matmul Common PAY MENTSBALANCE Jose ph fres nels ĠPAN EL Invent ory ĠnewFunctions SomeDb 1420 29675 Segm Lungs 553385 91 553385 9080 7475 395456 SPECI AL å¸Ńä½į æķ° Ġcommunic ator Ġö öö ForecastDouble Complex ĠGRing Longitude ĠGRing Latitude ĠSqlAlchemy ExecutionEngine ĠBcolzMinuteBar Writer ĠBcolzMinuteBar Metadata ĠXGB Classifier Ġalchem lyb 3691 12 ĠGridHelper CurveLinear 7287 22208 TRAJECT ORIES DynamoDB Hook ĠReplicate Tests Chat bot sof to 2087 75349 ĠTestTime deltas 0234 10202050005 2398 051658 2638 360 6748 1991 è´Ł åĢº à¤Ĥ ", æľºæŀĦ å¸Ńä½į txsFor Real éªĮ è¯ģ upos itive ĠDomin ion Ġ<== \ ĠEnr ichment ĠUps ample 0468 267234 9408 990 8469 13 RECE IVED ĠMultiClass Classifier ä»ħ æĶ¶éĽĨåIJĪ crn ry ĠTHER MOCOUPLE ĠMapNodeTo ProductionsID 37735 91 20834 75648297 LookupTable TrainingState ĠopenfaceCPU svmDf Gouraud Triangles Nuc lear handed ness ilastik output Ġxfile ref ĠRecommend ation 80669 35262242075 7578 1250 27924 08 3652 059 77025 808 ĠcenterExtent Y collectAs Arrow Saha LTE stoichio metric æĪ¿åľ°äº§ æķ°æį® è´¢æĶ¿ æķ°æį® Emission Sequence Nam wd Ġæĺ¾ç¤º åĽŀæµĭç»ĵæŀľ ĠLiv ny 8879 09 7893 14 5095 841655729 modelf orm 7094 41 ijer int Expend Scaled æĿIJ æĸĻ ĠPowers pectrum ени е 0809 7839 8001 32 8455 9631 ĠtestNo FeatureColumns ĠgetM diArea marca coes CreateTable Template waitUntil Done PREFER ENCES 0947 6084995 Ġbalrog Obs #************************************************ * Mah out Ukrain ian é¾ Ļ ĠdPA out hae gen ĠMary land ĠGover norate ĠThick LineTool ĠThrift Hive âĶĶ âĶĢâĶĺ Mao ist 6047 65 uActive FriendSum çı Ń robo comm ĠLob atto 3296 239279 Exogenous Info ĠModelSpecification Parser WithSpecified Value @@@ . PixelSet Factory Ġê± ° æĬ«éľ² çļĦ Ġtetrahedral ization ĠTERMIN ATED ĠMetastoreBrowser View FRANCED ATA 8944 2719 MATER IALS Ġnand v ĠtestInput PartitionSize ĠGhost script SERI ALIZ ĠPrintout Wx 1889 14710 ĠMaj esty 7192 8406 DNL s Glu cose Ġsau ce Ġmilit iamen ĠDMP s pspd at 45875 056359 45385 82365 ABIL ITIES FFM peg evapor ating 8964 0418 MOVI ELENS ĠìĦ¤ ìłķ 人æ°ijå¸ģ åħĥ 4167 38358 7159 37 Dal itz Fue ltype bha ishah wZ pulse DataAssembler Instance ĠKSP linearfluids oka Bot 23809 783 Ġtopconvdf copy ĠPathEffect Renderer ĠOneWay Mixed 78464 383424 EPIS ODES numerict ypes AbinitTimer Section 8116 8066935262242075 Baby Boom Ġcria ção Ġbco list Ġ1117 80 omba ugh ĠtestOn SequenceData 6707 938539406117 Substit uting PREST O Absent Src Ġ设置åĽŀæµĭçĶ¨çļĦæķ°æį® èµ·å§ĭæĹ¥æľŁ 4254 856196 Ġmike utils coapp Photos ĠIceland ic ĠDae monic ĠNit rogen ĠBoro Cnst 32877 9934516808 tracel iner 80234 077 88975 83469168 ĠCoer ced 4986 0493561688 281624 01 ĠKeyValue ConfigLoader 8388 70 81935 120 Ġä ää ĠÃ¥ åå 48847 881 åįķä½į为 人æ°ijå¸ģåħĥ ĠDeliver able 26666 8990498 8244 0674 8276 2398051658 )::]] )), Ġ1356 9984 unst cols setFilter String Ġgim me getCoord Origin preleve ment ĠMEDI UM 10237 122 ĠBjorn sson 11118 662 33079 4518822 80707 2889708 eldout ProbDist ĠKel ley ĠNotA DataFrame 23984 26 77219 13462 ĠfullW cat 38526 873 éļIJ åIJ«æ³¢åĬ¨ åºĵåŃĺ æķ°æį® MutableDense HashTable #~#~#~#~##~ #~#~#~#~##~ INDUSTR IAL Ġanticlock wise addFollowOn JobFn (!! ... Mall ory beli us ghe tti khaz ia ìĤ ° 00079 203 setOpen ExternalLinks ĠtestSummary Writing ĠNupic ScalarEncoder ĠWME nable 05996 99969996 deducc iones ĠpyETM Exception ĠCoin Test 37025 452 98192 136 608585 36 SetScroll bars INGER PRINT ĠCONSISTENT LY 13357 9842 14415 5570723 TimesIn Sem ĠBEH AVED åī© ä½Ļ ĠâĶĮ----------âĶ ¬----------âĶ¬----------âĶ Quantitation e Protist TV 46562 142029675 ĠCALEND AR 529177 249 Ġrepren sentation ĠâĶĶ----------âĶ ´----------âĶ´----------âĶ 46580 283298287 6809 00 81178 32 Inet SocketAddress Jper kgK Maxes Indx NSApp lication Yans Wifi iort emporal Ġixt oword Ġdany ch Ġbrit tle Ġwikit ab Ġ052 1540518 Ġ"###################### " ĠTARDI SSpectrum Ġhdm Agg ĠAws DynamoDBHook Ġuire vision timeIn Force ĠNump ay ĠNSL eftMouse molfrac ALL ĠGCT oo InOr After 998624 804212 Ġ``':' `` Ġgetframe info ĠplotFrom DataFile ĠplotGeometric ShadowAt ĠFalseNeg Rate DataPay mentsBalance 32158 11840447713 16853 328779934516808 356964 11 782556 9408990 130574 75 ĠVOX WARE 048047 6444210 03147 114 stringInd Df 178064 59 852778 3827421427 1880273 64 34988 912 973584 6891 TimeNetwork Hawkes REPARAMETER IZED 77256 01330565 770327 44 431279 84654795 67254 672 676185 49860493561688 ToAAID Master 471620 86 fracof day oseismo logy fullMeth Reads 4901097 0480476444210 391201 0371815 382280 63 647933 937950 1173875 3912010371815 curveToAnalyze SpinBox 6906374 183 GetFlow Stats GetTrend Args 8913705 2083475648297 Ġ##//////////////////////////////// //////////////////////////////////// alanterior cingulate 70209 277 830504 48594418207 9305284 23967070848 821037 0398 Subordinated Brownian 730399 92 589685 36 2541918 94932 sinceLast Follow ĠSubDag Operator rvrag hav 6631296 3983461 Ġdigino ise ĠTraceline Parser Ġgurob ipy ĠDummyComplex Array 98828307 64870 2249695 8910 Magritte SolveCV 9170178533 034 319839 8683 performSelector OnMainThread needSerialize AnyField 644844 807072889708 8994688 156 211325 05 å¹´æĸ°ä¼ļ计 åĩĨåĪĻ 01410883 1608 1273562 188027364 05464603 9459499 ĠRamak rishnan 924794 17884 1246432 9735846891 StopWhen Converged 1081677 04192604 ĠåĮħåIJ«åľŁ èĢ³åħ¶ 3962320257 0838634515 955052 66312963983461 3241364 54 324309995 050575944 30002500 998624804212 2683382 3296239279 2331804878 7475395456 organisat ie 5548466 9882830764870 04699502 254191894932 8850288 5095841655729 7541950100 8210370398 0583528 92479417884 ProblemOrigin R æľ¬è¡¨ä¸Ń åįķä½į为人æ°ijå¸ģåħĥ GateLg Arr 3691164 7825569408990 代çłģæĪĸ åIJį称 373236912 24 åĿĩæľīéĩĩéĽĨ 并对å¤ĸ 41534164 647933937950 7153912 85555133 18012445 1383666233 675809035 37323691224 3737414805 8994688156 794178531506 80611778 7637557 4538582365 767952744 09476084995 71620901522 208775349 æĬ¥è¡¨è¿Ľè¡Į æĽ´æŃ£ 对å¤ĸè´¢åĬ¡ æĬ¥è¡¨è¿Ľè¡ĮæĽ´æŃ£ 189795601635 26290666 äöäöäöäö åååå 15056934 728722208 å¦Ĥæŀľä¸Ĭå¸Ĥåħ¬åı¸ 对å¤ĸè´¢åĬ¡æĬ¥è¡¨è¿Ľè¡ĮæĽ´æŃ£ 72682629 144155570723 5400862175214 0982691 04490411 014108831608 65982372468 238665035 0489185894 6906374183 HBCARMAT ask 8564467831119294 6090 46122286769746 109310 63947561694 133579842 14991652796 324136454 940602388 22496958910 5533859080 3773591 023410202050005 054 0468267234 3198398683 ä»ħæĶ¶éĽĨåIJĪ 并æĬ¥è¡¨æķ°æį® 188914710 78464383424 416738358 45875056359 bhaishah ster 6707938539406117 3391 4254856196 7721913462 8897583469168 2398426 266668990498 17806459 82762398051658 348494 330794518822 23809783 0599699969996 99973 46562142029675 999901 46580283298287 162 3215811840447713 1188 8527783827421427 0114 7725601330565 2638360 43127984654795 469359 83050448594418207 126 930528423967070848 78 644844807072889708 93 å¹´æĸ°ä¼ļ计åĩĨåĪĻ åĪ¶å®ļçļĦ 054646039459499 83183 108167704192604 82 324309995050575944 30 åĿĩæľīéĩĩéĽĨ并对å¤ĸ å±ķ示 715391285555133 03061 180124451383666233 67 76375574538582365 885 15056934728722208 663 ! =[]: # ''' # ================= $ '+ $ '% $ _\ % ), % ']) & " ' ... ' `). ) ']] ) '])) ) =", * { * ': * (* , """ , ()) , ',', - ]{ . {}'. . {}. 0 2001 0 999 0 806 0 863 0 222 0 228 0 885 0 8080 0 808080 0 45454546809196472 1 789 2 999 2 250 3 126 3 119 3 451 3 108 4 001 4 15686 4 09090906 4 343434 4 191919 5 098 5 224 5 147 5 014 5 018 5 055 5 2020 5 786 5 6565 5 151515 6 100 6 377 6 322 6 262626 6 060606 6 9696968793 7 125 7 80392 7 2222 7 014 7 352 7 9797 7 9292929172515 8 66667 8 7878 8 23529 8 181818 : "," ; *. ; "' < ! < ? < ----- = # > '], > "). > .+ > :< ? ')) @ '+ A ri A ges A DI A PER A lameda A ustralian B ir B last B MP B SC B MC B UNIT B enefit B YYY B attle B HBH C ele C riterion C fg C ortex C ambridge C lobber C riterium C audal D q D art D nobs D Points D HI D rug D dD D HistoWorkspace D enoising E h E co E ner E ICS E nergies E nough E pithelium F re F max F nd F lower F BA F BP G el G OP G REG G KK G reek G abe G ekuerzt H os H ack H AB H AM H aving H dB H LA H UC H ATCH H ousing I e I python I mmutable J K J ar J wt J ornada K u K on K inv K PCA K MD K onto K riging K wei K ubernetes L X L LO L CS L xml L PC L anguages L BP L VL M v M w M CA M CS M iles M disp M ention M organ M unge M ILES M asa M ortality M DAO N Q N os N AC N ose N nobs N IA N ulle N Spins O ops O Estimator O BC O cccccccccccccccc P k P and P ark P count P ics Q a Q p Q value Q DateTime Q Agent Q FormLayout R os R ac R SM R TOP R aggi S ect S ends S ilho S olved S ICAL S amps T AL T MM T UM T Poly T background T INY T ogg T ucs U Q U Y U ref U GH V id V ip V oda V ulnerability W his W MS W Vec W arp W illiam X Values X lwt Y P Y ST Y offsets Y VO Z A Z eta [ ... [ \' ] (\ _ ]] _ }) _ ]): _ '} ` ]: a od a pa a io a ctory a partment a itchison b th b unk b ush b typ b kldf c ery c img c lik c jk c myk c iones c ushion d start d nd d view d noise d Result d lr d mc d topo d gap d hr d trajs e il e ction e ef e ments e base e iro f O f de f ences f laps f mags f hec g me g ms g state g ai g lied g ote g rtd g atspy h dict h we h ump h ner h ik h Text h small h anging h ght h ospital i form i List i Set i plic j el j day j agger j atqz j pval j pyx j ordan j astrow k tr k am k us k ast k base k space k ane k Max l E l L l bin l ug l diff l win l Margin m ha m row m ich m fa m trans m cube m Key m Info m Scikit n Q n set n int n line n ical n ard n components n com n IC n cm n xx n edge n units n this n TEST n Iter n irs n Prediction n Init n INSTALLED n Buckets n Freqs n Bases n Launched o Data o qui o uble o edb p ms p gr p bl p atial p hem p isode p ums p iston q test q bin q req q stat q Sizer q Sets q story q Cld q thelp r A r name r vel r cc r code r fn r dim r fun r zs r udder s ors s Data s que s ug s Col s pop s xx s pac s ung s DP s avi s dae s audi s notel t fe t args t fa t ars t bar t unit t Result t End t XY t Vis t dew t merc t rended t restle u M u vel u ded u ding u idx u fl u wave u integer u ae v ma v res v label v ib v tt v diff v xs v sel v lex v ince v uv v indx v reclist w th w ir w map w lidar x par x ext x da x dir x predict x last x filt x positions x Tol x PTS y ect y dir y box y deg y lb y calc y xd y Arr y cid y XL z py z width z ak z std z dt z star z px z oa z inline z REC z tost z gerald { :,}". | ( | ./ } )), } ]: } '}. } ...'. ~ ', ² åĪ© º åºı  « à ¾ à Ŀ Ï Ĩ Ð ¶ Ø ± â ģ è į ë ° í ģ ĉ čĊĉ č ĉĉ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ urn Ġ čĊĠĠĠĠĠĠ Ġ 929 Ġ roms Ġ ä¸ĩ Ġ çĶŁæĪIJ Ġ æĴ¤éĶĢ Ġ æŃ£å¸¸ Ń ãģ¿ ĠĠ ĊĠĠ ĠĠ ĊĊĠĠĠĠĠ ĠĠ čĊĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĠ ĠĠĠ ĉĉ in q in Predict in clus in variants se ly se quen se crets at re at ry at tended re ck re pro re ated re center re rate re indexer re compile re projection re directed re Office ĊĠĠĠ ĊĠ or ate or be Ġ= . on demand Ġt ce Ġt ide Ġt reate Ġt pop Ġt ia Ġt az Ġt tot Ġt region Ġt ides Ġt pops Ġt Vecs Ġt urbsim er d er an er rel st mp st ing st names st ner st abili ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠ al us al eft al ainen -- +', an m an is le monchiffon de ty de ng de be de stri de icon de laf me so me lan me ToGridlab Ġi par Ġi rt Ġi counts Ġi sel Ġi aa Ġi Item Ġi els Ġi Atten Ġn tr Ġn equal Ġn ile Ġn ach Ġn ights Ġn sparse Ġn arr Ġn cluster Ġn sim Ġn atom Ġn quad Ġn ominator Ġn slices Ġn deriv Ġn loglikeobs Ġc file Ġc pro Ġc ref Ġc face Ġc mm Ġc edge Ġc codes Ġc cb Ġc prediction Ġc sto Ġc ql Ġc ctr Ġc nf Ġc nlvl Ġc ortico Ġf pe Ġf ce Ġf ts Ġf len Ġf op Ġf string Ġf trans Ġf Type Ġf month Ġf pars Ġf del Ġf encoding Ġf gap Ġf anc Ġf majax Ġa pe Ġa ind Ġa mon Ġa ui Ġa pca Ġa plic Ġa menu Ġa ocs Ġa imed lf rom Ġp ra Ġp est Ġp arg Ġp ps Ġp low Ġp init Ġp mm Ġp liers Ġp xi Ġp circ Ġp station Ġp wt Ġp cfg Ġp RF Ġp fm Ġp Util Ġp orb Ġp bdv Ġp ATRprd it ical Ġs nd Ġs ud Ġs sa Ġs rm Ġs pops Ġs ludge Ġs Fich Ġs lew mp state ra ve ra sp ra do en gs es da lo ft Ġin cum Ġin activation Ġin versible Ġin finet Ġo i Ġo date Ġo mt Ġo hc Ġo Disp Ġo lympics Ġd dir Ġd mean Ġd xs Ġd Sum Ġd lam Ġd lv Ġd marc la er la sers la pps la wngreen ut os ut tered Ġ' ([ Ġ' )), Ġ' ']. Ġ' $') Ġm la Ġm ss Ġm um Ġm res Ġm os Ġm sum Ġm ml Ġm bar Ġm tick Ġm dim Ġm stream Ġm ingle Ġm css Ġm ttf Ġe ts Ġe out Ġe arch Ġe uc Ġe ids Ġe Acc Ġe mas Ġe cw Ġe yes co occurrence co awst Ġre pt Ġre base Ġre compression Ġre uters Ġre calibrated Ġre parameterization ge ol ge terr ): ]] Ġb ol Ġb set Ġb file Ġb ert Ġb rb Ġb wd Ġb Filter Ġb haz Ġ# "[ Ġ# ----------------------- ed c ed Window ic key ic amp ic ating Ġw by Ġw mag Ġw rl Ġw eno Ġw anna ur ic and alf lt y lt rans ig ood Ġ( ?,?,?,?, Ġ1 115 Ġ1 140 Ġ1 368 Ġ1 774 ', )), un al un tries un nane Ġ0 02 is ng is Debug is Maximized is Puente is oweekday el Volumen ol ink ol ler ol igo )) `. )) ]): ser ter Ġfor gets Ġfor gi um i Ġ[ ", Ġ[ :- as w as cript as pherical 00 90 00 54 00 91 00 1501 val e Ġas dt di ab di mentions () "): () `) () `). () +( () +"_ Ġis ok Ġis vector Ġto s Ġto pl Ġto ret Ġto ggling ts cca Ġ" ==== Ġ" ======== Ġ" ##### Ġ" âķIJ ma a ma red ma ew ma qz ], _ ], :]) ), )] ), :]) ĠT ing ĠT ues ĠT ON ĠT own ĠT err ĠT ravel ĠT ob ĠT ratio ĠT CL ĠT CR ĠT SL tr ia th z th rs ha qz Ġy ve Ġy all Ġy dir Ġy axes Ġy dat Ġy Size Ġy bp Ġy High Ġy Low Ġy hit Ġy vp Ġy oy Ġy SearchFunc Ġy CHV res x res ion res cm res List res cu ch b ch d ch la ch ang ch inj ad an ad mit ad mindf ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ Ġdef lection ve k ve co ve cc ve galite fi fo fi bonacci set mode set Output set Option set Stretch Ġr L Ġr in Ġr ar Ġr box Ġr mask Ġr scores Ġr cm Ġr any Ġr ii Ġr dx Ġr sync Ġr brace Ġr udimentary mat qz mat thieu Ġst an Ġst bs Ġst adium Ġst ingray il ights il Hgt ') ])), ') """) ]) `, ]) ")) ]) }). ck Pool (' **************** (' ')] (' }\ (' {\ (' ='+ int domain int elligent nt ext nt ree nt ypes nt heta Ġ+ /-% pt File pt rot Ġg G Ġg I Ġg R Ġg ig Ġg key Ġg cov Ġg bf Ġg vectors Ġg land Ġg accel Ġg paw Ġg entle __ ']) __ ``. __ % fo untain pec ies score change [:, (' Ġ`` # ĠW g ĠW ake ĠW ANT ĠW TF format warning Ġmax P Ġmax dim Ġmax step Ġmax Capital ord re num str num keys num grad num good num topics num Keys num Active num sims num cvt num Bands num Cavity num Threads og o og usa Ġfe males Ġexpected Type Ġexpected Bins Ġexpected Domain init Steps init iate init iated add val add Test add command add Margin 12 0000 12 51 12 227 12 655 12 118864 Ġget Y Ġget var Ġget Time Ġget exception Ġget figs Ġget Edge Ġget Active Ġget Closest Ġget OrCreate Ġindex namerow port file ĠO CT ĠO Pool Ġrange Mins las p ()) )). ca pybara error ist error Count sub app sub plt sub reg sub paths sub cube sub strings sub fmts Ġplot lines Ġplot dim Ġplot method Ġplot opts ix value Ġall negatives Ġall ergies sum an sum Exp sum FExp vel ist lim lo lim hi Re plan Re calculate Re ynolds Data Column Data Batch Data Iter ft rap 25 11 25 252 25 946 25 757575 raw half Ġline search Ġline ups frame N inter m inter com Ġpd bb Ġch nl Ġdist ict ll hood Ġ.. [ 11 000 11 63 11 82 11 395 11 4166 11 3594 weight eval 32 05 32 293128 Ġmin b Ġmin r Ġmin cv Ġz en Ġz val Ġz points Ġz stat Ġz bins Ġz coord Ġz pas Ġz hit ng h text book text anchor lif fe ĠIn dra ĠIn accessible Ġper filename Ġper iclase Ġ10 66 Ġ10 35 Ġ10 95 Ġ10 27 Ġ10 34 Ġ10 92 Ġ10 77 Ġ10 42 Ġ10 98 Ġ10 28 Ġ10 68 Ġ10 54 Ġ10 83 Ġ10 59 bin x bin star Ġsc uttled act size act ypes ĠY tr ĠY au ĠY ule Ġ) ') Ġnew labels Ġnew img Ġnew Session Ġnew Char Ġj X Ġj ve Ġj list Ġj une Ġj hive Ġj uggle true genre gra p gra ma gra do ĠH V ĠH b ĠH il ĠH AR ĠH beta ĠH CC ĠH ORT ĠH PC ĠH IV ĠH odrick ĠH iggins 15 04 15 21 15 119 15 888 15 656565129756927 05 11 05 39 05 901 05 5555555 input array input Name input Params input Offset input Files input FileName input Folder Ġlog sum Ġlog Objs =[ ],[],[] tra intest (), ( Ġinter ger sed val sed file sed level Ġpy on Ġpy ge Ġpy af Ġpy steps Ġpy gp Ġpy rose Ġ[' \\ Ġ[' $\ transform shift Ġoutput Type Ġoutput Path Ġoutput folder start Index not able ens pace :` " Ġobject Sensations Ġno label Ġno sec Ġno body Ġno zzle Ġno urishment ĠU NA ĠU SS ĠU NET ĠU JF pr in pr it pr ct Ċĉĉ ĊĠĠĠ Ċĉĉ ĊĊĉ 20 62 20 2018 20 334 dd Result ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠ ĊĠĠĠĠ ĊĊĊĊ ĊĠĠĠĠ ĊĊĠĠĠĠĊĠĠĠ pos ys pos session pos car pes i 33 75 33 04 33 49 33 69 33 252 33 556 33 9236 Ġsub query Ġcolor arg Ġcolor Val no ct no ff no insert no break 201 904 201 9810 --- " Ġha c Ġha stalkbox 100 67 100 59 80 82 80 295 80 36575 Ġ6 29 Ġ6 39 Ġ6 21 Ġ6 71 new B new col new Len new Session new wcs Ġ. [ Ġfit fun IN DEL IN CIDENT IN TEGR base fmt Ġtype set ĠData List ĠData Search code str ]] == ]] [:] vert icies 66 161614656448 amp ar amp width doc c doc str Ġrow idx ay a au i 45 999 45 9595 }, ) Ġind Min ĠK F ĠK I ĠK uc ĠK NOWN ĠK ramers 75 35 75 36 75 08 75 47 75 38 75 2525 75 17547607 88 64 88 3838 88 113594 fn out grid points "] ** "] )). "] ][" 16 50 16 98 16 82 16 1111 Ġup firdn series labels info Object info From av ename Ġpos range Ġcor ot Ġcor onal Ġro e show T show process ong ation dist args dist fn dist xsample Ġapp x Ġapp veyor ak is Ġone Over nan vl ĠEx tr ĠEx amine oth y bar width bar func bar achant 35 000 35 141 14 66 14 000 14 91 14 400 14 6464 19 401 19 1970 with standing group In Ġgener ous tt re cur ate )] ( box renderer box office check up check sums AR AD Index File ON OUN axes Patch axes Scan Ġ8 32 Ġ8 37 Ġ8 53 Ġarg Def copy files 78 35 78 95 78 34 78 787 78 2828 78 015327 St encil den ser '. ) 13 917 13 045 Ġbin ids Ġbin Centers uff el cor dex ĠV ect ĠV ary ĠV AMP ĠV AK Ġstring abc `. \ by ing be ans be ip be be be cf be gun be gaze be etle title plot zero TurbulencePowerCurve Ġpath Finder 22 49 22 686 22 81 nd v nd ates nd cgs gs map gs fc Ġiter N sp indowns Ġdate Time arr delay 04 275 04 984 ([[ + sv iewer prob matrix prob chip Ġpandas DF Ġpandas qt 96 32 96 27 96 84 96 87 96 335 96 94767 03 401 03 984 03 327 03 957 lat b metric A column Number Ġstart Params Ġstart Gui Ġstart From Co ol ĠTest AB ĠTest ML ĠTest Timestamp ĠTest Bin ĠTest Eval ĠTest DateTime ĠTest Nan ĠTest GLS ĠTest TuckeyHSD ĠTest Weightstats trib roken 02 40 02 91 02 924 Ġmo ist Ġmo yenne dot many Ġ{} ): Ġ{} }) 95 06 95 4545 95 603 Ġover large Ġover samp 94 38 94 714 94 948 ',' )) 17 77 17 40 17 600 '): ] of b Ġdataset Dict Ġdataset Conf Ġsy nonymous :: ], ĠCo ver Ġ{' ': 85 96 85 83 85 53 85 999 85 067 rt ices sort inds Ġfa ut Ġbase y Ġbase st Ġbase cnt DataFrame Weld Ġmetric Type run CardVals :// ') Con ds mon ster 24 63 Ġinit UI csv path 27 10 27 42 Ġdis aggregate Ġdis aster Ġ7 22 Ġ7 23 uc us image File )), - ref names ref actored Ġresults String Ġresults Contents 86 97 86 77 86 924 86 9019 IT ATION SE A Test Statistic mark lar AL RM var cont back ing off shore ols residuals }) ", Ġsp it ĉĉ ĊĊ Ġmean stress Ġmean PowerCurve obj c obj ID obj fun 06 96 temp Values 18 39 18 73 18 969 ery d 36 8686 ec fp 09 32 09 38 09 3618392944 07 19 07 77 07 0827484 exp MJD work loads Ġpass words ap pyaml Ġrun Command linear Coeffs Ġnode Stack feature list do ug mod list LE AD man ta length A testing Para Pro x Ex pon delta P ST ERE ST ELIB Ġadd l spec ular spec Group Ġbet m reg x ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ )): ] Ġlin spc 34 60 34 345 normal ising Ġ... ]] 97 00 97 2549 Ġpart imatrix Ġnon Contig Ġact num ĠJ E ĠJ p ĠJ ay ĠJ OHN 92 34 92 652 graph def Ġele phant sent e sent inels Time steps Time Period Time Decoding Col Dendrogram cv glmnet part is part ied part icularly sk plt Ġload able Ġload Dataset Ġload JSON ĠQ n ĠQ GL ĠQ BAR sg amma lp d lp u 84 34 84 3434 84 992980957 Ġtext field Ġq h Ġq range Ġq specgram Ġq Bands Ġopen ings Ġwork loads IC LE Ġkernel data Ġsort level my values Ġ9 32 Ġ9 315 Ġ9 043 config urator Ġmask gals tx En Ġread noise Ġread Stream ass n Ġfreq ency Ġfreq HirArr ac res ac ffit Ġim list Ġsum Of rel ator ... ]), ... ]]), ... '%( Ġmod ulations ris ky non uni non terminals Ġav p Ġav r Me ch 65 85 65 098039215686 Ġcluster Data db b File Clip Ġcv ode Ġcv rmse AS FLAGS stack rel sol diers Ar kansas Ar menian batch sz Ġass ort Ġass istant Ġtrans poson 37 02 37 447357178 50 96 cm orph cm divor step ped step FreqRaffinato Ġloss Rec Ġmulti core Ġweight Col ls n Ġfol iations ĠCon fluent 87 37373948097229 flow line Ġtra ctor Ġtraining Passes RE ML RE DD RE ACTIVE ura cion CA CT CA USE learning Offset learning Decay Ġlow FDR Ġlow ndes State Point ik ou )[ [' Ġoff est 44 77 mode Of ĠZ h ĠZ ach ĠZ ukauskas Ġcreate JavaObject Ġpoint pos Ġacc rate Ġacc ordance vas ive Ġmsg Err 55 22 55 109 tree Stats tree bank url join 23 64 last i last Value prec eding Ġparams ToPlot struct arr Ġback face Ġ[" < Ġ[" \ Ġ[" {} multi qc Ġev sw 26 64 26 15 26 75 26 85 26 92 26 8513 De al De bt AG ENAME Ġlast s 77 78 77 92 77 2727 77 4817 python ware python inspect view box view keys view point view Box view Menu auto fit auto jit auto colorscale RO B RO OM sup conj Ġevent ual Ġevent collection Ġsplit val Ġsplit Value html only Ġ] [' event loop Ġpl x Base Formatter search Row Ġsm ke cell style ink ed mer ic mult twostep Ġcenter X Ġmatch ups pd z Ġsim rent Ġsim Type Ġar ys Ġar roots diff p diff Stoch plots ize plots can create Array create Order create ExternalTable 42 0000 42 35 42 87 42 92929172515 98 97 98 91 98 9915 Ġdraw lines offset x offset factor ++ ){ Ġtotal Points Ġtotal reward font desc font Object font Prop window cols Ġcontin u AB ET AB CPanel source Table source Folder source Uris IP List times In Di rac List box List FileName Ġ12 75 Ġ12 35 Ġdt block seq Num 67 80 67 44 67 26 67 1717 67 6575 Ġfind Best DE LI 08 0000 08 36 mm Name Ġfunc dict mag t mag phase Ne wey uch ia replace params sql df xy i xy o xy wh To Cell To Multitask To DynamoDB ,) ; ,) ``. Ġab bre ĠComp ositor Ġ-- , Ġbest value ins arData Ġaf filiated Ġcount fit gb r gb est Ġtrue QID height break Un bind Un idata 47 9797 total Scores real igned sim ult sim out Ġsave in Ġsave folder ,' " ,' * ,' |') Ġimp ostors "], ) Array Coder png name Ġraw arr 60 4545 style LineEdit Ġrel weight Ġupdate Plot Ġtick location Set Input Set Env Set Help Set TopWindow TR IAL Ġsuper graph current dir current Label current Directory div hi depth file connect Set Ġcmap dat Ġfill styles full VisitorId go lf go es go elite edge Color ãģ Ŀ Ġhist Price ĠStr Converter 49 05 tes se Ċĉĉĉ ĠĠĠĠ Label Path ĠUn ified Ġpred Prob 28 91 28 7878 28 3309936523 stop OrderCount ĠSet point Plot Settings sys id sys ctl ĠPro d ĠPro files "]) ]. "]) }) CH W CH AS For Series For Built vol c 29 03 29 188 29 1687 cos momc Ġsignal ed ud ad Res amples fft arma Ġvariable Arg ĠPlot Params ĠPlot Kernel ĠPlot Predictions 39 64 39 75 39 3758773 Ġimg list Ġimg Lab ish ard leaf ed Ġge od root Object Ġlib stempo 68 235294117647 Ġ[( _, lap ses Ġblock list Ġblock str Ġfound ations Ġtmp mask Ġtmp Ret Ġchange Task 38 984 Per PE Per imeter Ġitem list Ġitem names Ġts mp Ġts pacing Ġinclude yaml Ġbins z MA J SC G SC ENE Ġ15 50 DI F has y has RightGaze has LeftGaze Ġvert Axis ele vate Ġrank er 46 9696968793 ĠNe ur +' }, exec str mf calt 31 35 task id task ToMultitask UN ARY UN GUIDED cache control Ġvar a Ġvar Sum su ites Ġang led Ġang lit Out Dir )], \ ML ib sm merge sm urff Ġclose Price Al cohol Le ts Le Net 235 7 change log gate ch AD OB LO ST 117 1 Ġold value ĠCol laborative ĠSV N Ġwrite tsv let te Ġcons itent nc d nc bray ï¼ Ŀ median Blur entro pie ET noD sa il sa audio sa urus Ġop index images ave Ġprobability Col Inter actor 48 178 48 2452393 48 3932495 hat qz Ġvis on Ġdb z Ġdb directory Ġdb conn 56 315 56 348 56 060606 56 2860 cho acoustics down wind down Tris ĠLinear DML Ġ11 018 Pre serve IS PC Ġref data Linear Kernel Linear TriInterpolator ĠAdd List Ġrec arrays Ġrec ruited 294 49 ĠMulti Layer ĠMulti Nest Ġfix df ------------ ' ĠGet Dict 57 00 57 07070827484 nb agg nb ranch nb extensions nb Runs ĠTODO s ivari ance extend frac Ġprocess Algorithm Not UnitVariance this A 69 149 69 8039 ious ness ĠGaussian ARD Ġbox gc conf ined Ġdon ation char array Get Data Get ToolBar Get Overrides Ġstyle name Ġwx Windows PE E stream info Ġposition Rect Ġxy closed md stree String Array Ġmy trans Ġmy Model Ġ'/ '): Ġ:] / des kew xs lt Ġnan all Ġnan any rot matrix Ġdown hill hash s Ch ristmas Ch ckPool 137 0 137 0983 sel Pts Ġ'- . No vels Check TuckeyHSD Check Weightstats Check inPredict sw tch Ġkeep Pattern Format Error fun calign Line Direction Ġtheta perts Run Metadata Run lengthBasedTargetValues Ġlat c Ġlat var parent index skip doctest Py Tool Py APITestHarness ĠBase Form ĠBase BadClassifier TH R TH AT Ġexec dst Ġds flows Ġlocal ity long ueurs ret Val Ġzeros DBZ olds ize cel ltag ĠRun QuadraticModel Ġbar f Ġbar mode Ġbar Colour sig sq 89 39393758773 src Bmp display Mode HO URLY Ġpixel Size Ġdest s 74 37 74 0051 74 242424 dec ided ĠLe ad ĠLe ague Or Month Or Week imp erson Max im Max Freq Ġpe formed 686 3 record Id '} ` aut hed noise Sigma Ġcs rf Ġnb Sbs dr izzle summary File summary Result none xact pk counts Ġyear Num Table Source IM DHistoWorkspace CO GA Ġdays inmonth xaxis Datetime ĠIN P Fit CanvasToDrawing Int CoderImpl pick l pick ers Result ing Ġhead swtch Ġcat array Axes Grid cp c Ġ$ ("# Row CoderImpl Row Clust Ġconf ine Ġlayer Info lev shape button Charge )+ [ 51 0101 Ġ14 000 Graph NX det Evals US ES US GS Ġmer it Ġmer chant Input Num Input Lists 63 1313 Ġnow rap Ġnow castDir Ġview Lim lex p Ġcla d Can adian Ġfinal DF ĠKey worded cost Function light seagreen On Time 54 12 54 0404 70 32 70 2020 )" ]. perm alink collect l Color blind ci hi ci reclvl lr path Ġparent bbox Ġparent hesis Net Stims '+ '. tag id tag gered sf p 83 1373 cons is 59 090906 measure Data static box MS MLib Ġalign mnet !! ') Ġtag code Ġattr ition shuffle Index Ġpdf name mid del Ġus gs He ma NN S NN Layer Ġsig res Ġsig sq Ġjob num days With UP GMA ĠSh erman ĠLabel Array Ġmeta map next Alpha next Hatch marker fmt win now 300 8 300 07 300 148 803 03031206130981 atom i 82 3232 opt a opt adocument Ġpatch s aa qz Ġdet B signal tonoise Ġevents on Ġna Data Ġna Cov Ġna ieve 255 264 ĠMax outConvC variable st 500 4 500 740051 Ġword list Ġword lists br d Bin Size ĠBy testring ĠCh yi ĠCh ristoph Ġdx new Ġpp w Ġflag color Ġflag ger mut ables Ġent ires CC DC CC COM rb c rb its phi rot NE type Group Duration Multi Batch Multi layerPerceptron clean se Window Sta Com modities Dis criminator By Params ĠPy APITestHarness tot Cl HE AV double pars Sub j Sub Shape ĠFe el FA IR ky L wave field wave Lpf del la ĠPo inter Ġdat arange 53 0303 Ġsrc Bmp 62 100 cb ow ire ach Ġho y entry Price Ġmp ltr Ġmp yplot request logs 73 027 CL ONE Ġlon var ĠDE CaLS ĠDE VELOPMENT aw k aw esome wd ummies Ġcontrol Fields Ġcos mags 52 25 PATH LIB ĠSelect Multiple rep Base 00000000 00001 nx values logical network mar in mar ble pg as pg lod CS SD rend ers Ġunicode csv II R Ġfeed ers region es 2016 0305 outer area Ġdebug ged Collection With Ġscript ing Th ur Ġequ ip ĠRes istance Node ID Figure Frame Figure Title Ġbeha ving Ġatom i Ġatom j Ġatom Label Ġinvalid s minor Formatter big g Ġprop ensities 123 03 111 1044 Ġcy Df Ġcy tok sym num ĠCalculate Fluxes Ġap ical latex ify ker p ker nelapp unicode csv Ġta um 285 5 Output Redirect Ġ18 01 history log cap ability cap cost cap ita Ġmis alignment Ġcha otic Ġcoords B Num Rows CR ange 41 35 Ġwords vec Ġlayout Main site j site customize With Default æķ°æį® æĽ´æĸ° ĠNo CheckinPredict Of Cloud air blast Ġstream frame Ġstream flow offsets Close offsets Open Feature Num Feature Stats Ġsegment Parent Ġfold N ks list token ise 58 0000 58 90 58 204 58 136 pus i ij an ij ian xt l xt n xt vix ãĢ IJ ãĢ ij Ġport ability Ġ"# ", velo ff Layer Props Count List Map File Map Object Map NodeTo Ġcsr gemm track points ĠImage Net Ġcf id +" ', +" _" As DataFrame Range Seconds Variable Name FE A author ity ni um ni img which Widget Ġsummary Result ĠInitial ises ĠInitial depot }$ '], }$ ]', analy zers positions rc Period Converter Ġdy new cer tainties frames PerBuffer Core NLP Core DaySet car tag Ġlb race mse w Poly Element Ġexport Data Invalid IndexError body tokens Ġnn at Ġ64 614 .]]) }, effect iveness same Semantics Ġappend mat Event Loop may er Sparse Fixed Sparse GP fixed point Info Bar Ġdefine Characteristics 101 0100 ĠNormal testResult Bar bs Bar Width Bar Writer prev Ema Ġoptimization Setting ba ed dep Coef Start Pos Process ors ĠFind NearestElement çļĦ åİĨåı²æķ°æį® çļĦ åIJį称 çļĦ åĩ½æķ° çļĦ åħ³èģĶ çļĦ æĸ¹å¼ı çļĦ åĽŀæµĭ模å¼ı Ġdev test trip Id ĠKernel Data bi uf ,:] ))) From First ĠRow Kind tw op Ġfft Bin ĠEn abling Ad vice RES OL Ġdouble t ĠFigureCanvas Template ĠFigureCanvas FltkAgg ĠFigureCanvas GDK Ġtimestamp ed Ġgeo logical ĠLine Collections 128 00 INE AR MF R bc rypt Ġ---------------------------------------------------------------- --------------------------------- Ġbyte counts dest Template PR IMITIVE Float Label Float Menu Float ArrayFormatter fh mm äº Ķ åĪ Ĵ ĠSub stitute ĠSub routines OS PACE End Pos )))) * )))) ))); land er ensure math qa FileBaseName Ġker p 005 0505 005 183999999999999 TC Z Ġsimp son Ġls CheckStocks Ġill uminance Select N "\ "\" news nr INT ENSITY ĠOutput Obj ((' < ĠSQL Tests ĠSQL Conf Ġnu ssl free desktop Sample Videos Ġmut li Ġmut iplic Ġwriter Class ĠBe ads ĠMA PPING cnt Rna "); \ Ġcb ks Ġny rs gal Out Mask ing boost rap Ġqueue Dict Ġsat Value Ġstdout ToServer Ġ42 25 rl based Ġlr dx Gradient ANOVA compare All Ġprod UserName ale mbic Def erred ĠCur v Sum s 663 8794 ĠTEST NAME ĠTransformer Dataset Ġfc err WAR P npy io Hel ix Ġcap as ardi e SKIP PED Version Error ĠFree type zoom ing dB s Ġrho A (', ','') OUT SIDE ticker Id OB inomial invert ColorMap StringIO Rewind New SynapseCount cpu freq Ġmar kets Ġmar oots Filter Mode met grid Ġchart type Flow ID Ġgra fos mn astics Method List Method Documenter TP AD TP PI 105 23 Ġcells DF Ġtopo logies 126 2626 Names And ABC Period ĠPoly Shapes nm h Day OfMonth Ġ"{ :< Ġflux obs Ġflux lutman ('< << Pos Array Ġwidget box Ġmouse over 336 1206 336 15112 Ġer p Ġer lang 456 1710 )/( \\ east money IB LE 2009 0925 2009 143829 Ċĉĉĉĉĉ ĠĠĠĠ cam uts Ġstation Data LA IM And Compute And Close And Labels And AxisLabels rd F Ġrv avr topic Distribution topic Concentration '}) ], ĠExtra polate Save File Timedelta Array Timedelta Formatter 800 3 Top Hint topics Matrix kmeans pp 445 05 Ġbr ighter Ġke ip Ġct c Be InClustering Ke eps syn Types Ġtab ulated MO VIE ĠGroup ers Ġsd om sag as dialog ue Ġcurr Patch Over Sampler Over Sequences Over riding hex version chrom y ĠLearning Agent Ġlab ware osa ics monotonic ity Ġair masses ĠBo ard GR P Ġmi RNA Code Name Code File Code book Ref lection Ref ined Ġrule set Delta E 707 07070827484 cli pper ,:, :])) ,:, :])** LM NN traj name \' >{} ": expl Var Ġitalic ized cccccccccccccccc cc ĠWavenumber Grid friendly Name 1248 2452393 trailing Percent ĠTopo graphica 464 64645862579346 ',[ ]) ĠFeed Forward Delegate Mixin Cash type yout u ĠOuter Tol Ġ159 31 Travel Time Ġmant el deploy ments 8484 8487 828 2828 æ² ¹ ĠRay baut 2525 2524 Ġutili zed MathText Parser Ġbow tie Ġpacf ols 2424 2424 Pairwise Kernel 398 98988 585 858583450317 Mpl StyleManager 8535 3535413742065 autore start ĠHalf space 7575 7575 CELL Class Gr izzly SORT INO Ġsom me 32828 283309936523 Ġtukey lambda Ġuu ids ĠMU CH Runtime Context PAGES IZE QColor Dialog Ġmur der ĠPH reg subsampling Rate Fem Preg 8932 3425 ä¸Ĭå¸Ĥ çĬ¶æĢģ ('; ')) wiz ard Ġerfc inv ĠKepler ian purcha sed 0014 0380 )}{ ( 767 67677068710327 Ġequival ency Exchange Calendar Let ters Production Controller 7626 2629032 ĠBetter BooleanField Reverse Index gaussians DF éľĢè¦ģ ä¸Ģ 535 35354137420 TEX TPAD Ġfab io 722 198486 ĠBot Engine longer thanthat 28610 99243 unto uched 16666667 16337 danger ous kst pkper ĠNatural LogTransform ĠMockEstimator Failing Ġ设置 å¼ķæĵİ Ġ设置 产åĵģ缸åħ³ Ġcompos itor 0396 842 ĠPurpose fully Euclidean Dist 32056 05 ĠInstrument al Ġsett ins 0404 0404 PARTITION ED Ġcntr Pt dHist X 1229 25 ĠAttribute Documenter Ġ'== ': 417 95349 Ġcraw ler ĠRd Gy ĠRd YlBu ĠQuad ContourSet ĠìĤ¬ ìłĦ seper ated seper ator Ġbat man 1038 05542 ĠBro therhood ĠManual Scaling djz nu music Scaled renew able POPS dimentions ĠRepresent ing ĠRepresent atives ĠAdmin istrators ĠSTOP ORDER ĠSTOP WORDS trump Scaled Ġstre amed 3838 38385 Ġìł ľ Equity Trades ĠLive Graph ĠLive BokehChart ĠCached DataFrame Ġlibo pen Warm Starting ĠRicker Wavelet ĠGust avo PHOT OMETRY ĠSphere ProblemOriginR Ġasymmetric al é¢Ħ å¤ĦçIJĨ æ£Ģ æµĭ XC model ĠMF CH NK P mj ysr ĠREL ATED Ġdeploy ed ="- | ä¸įåIJĮ çļĦ ç®Ĺ æ³ķ PROB LEM ĠREQU IRES Jeff max Replic ation 0378 646851 Ġadv ise ĠProv Exception CallDimension C 2302 25 ĠElectric ity (.+ )', (.+ ?)\ ĠSB aaS noun pairs Password Field ĠMATPLOTLIB DATA 555555 58204 ĠTie mpo ĠCos mo 0217 3995 ĠZe max ĠReplic a Mapped Sequence ACTIV ATION åĪĽå»º çŃĸçķ¥å¯¹è±¡ 611 1111044 thrift server Ġallf uncs Ġnano pores Pict ures Ġ236 784985 ĠNR Z Ġ---------------------------------------------------------------------------------------------------------------- ---------- OOOOOOOOOOOO O globe c rews Active 9595 9597826 tkinter table Alex ander Ben jamin Decre asing SPEC TRA 11111111 1938 Ãĸ µ 3535 3535413742065 interpret ations 580 80810 Ġplo tr Ġmsv s ĠCla uset comfort ably ä»»åĬ¡ æłĩä»· Ġcurv ilinear DEG REES 100000000 0000000000 » ¸ Ġdut ies ĠHold out fiducial Points MICRO BES Ġwomen Means 808080 7924 isProject OutputSatisfied isProject InnovativenessSatisfied Ġconcer ning focal plane Ġpipes ize åĤ¨ å¤ĩ ĠExisting RDD EXIT ING ĠactiveColumns Data Ġpercept ual 0594 48 ĠSymmetrical LogLocator brad y ĠCare taker Ġkid ney ĠInd Shock ĠArr RefTemp ArrayLike DataAdapter ĠAccessor Property ä¹Ł åı¯ä»¥ ({} )) Cum Data blin wts æĽ ¿ caret up ĠOutOf RangeError ĠAnti Commutator 2510 5285 nil mtk IDENTI FIER Gather Function èĬ ± Ġ************************************************* ************ ĠDUT s LOOK BACK Ġmotiv ates çĶ» åĥı Ġkst pkper Anomaly Score Commun ications ĠâĪ « ĠAnnual ized Astro Images Ġvacc in shif ters 6464 64645862579 Ġze ex doct rees fromp ickle Ġdtr w ĠReader Thread ToG IDMap Observ acion ĠCarn eiro ĠRog er Ġ307 27 6472 6638794 æľĢåIJİ ä¸Ģ SSC ORR Spread Sheet fich json stopt ime mete ogram 645862579 35 Ġ#-------------------------------- ---- ĠSlic ed idel berg Syntax TB Supp lier ĠBlaze Next ĠBlaze Previous ĠSav ings neut ron 3382 87 2706 299 sulf urs ĠPassword Field ĠSigned Jwt seas hell Ġnff g Ġnff ts thor ough Ġstain ing Ġkilo meters 2748 94714 olymp ic 777777 79102325439 Bal rog HWP files Oc Ossss Sid ak ĠFra gments 1414 14135 4747 4747896194458 TERMIN ATED Ġenemy Team ĠFFMpeg Base 72727 274894714 90909 093618392944 Opp osite qmin SpinBox ĠEU CLIDEAN 4678 21 ĠFund amental Ġprett ify 3413 2519 969696 99859619 530 85498 Crash Handler Sin usoid ĠCaching Compiler 2606 875 HTTPS erver Reflect ivity Ġ기 본 ĠMaintain er Ġåľ¨ å¼ķæĵİä¸Ń Ġvas Types 1236 56 ĠUlt ra 1767 67677068710 0805 64 ĠInterpol ating documented decision ~~~~~~~~~~~~~~~~~~~~ ~ gmsh Version Ġneig bs ĠUne ven ĠCook ie 2937 01 Ġimproper ly Suggest ion ĠnewCell PosDF ANALY TICS CGzi L CGzi U Kay F Wild Card fase i Ġgly cosylation ĠMencoder Base ĠELE MENTS numC orticalColumns aaab bb åĽł åŃIJ Postprocessor Viewer Ġtrop ical Ġ.......... ..... 9494 9495792388916 Anoms VarList NumExpr Python 656565 66619873 hpsModel Anal Tw ilio ĠBib liographic Intrinsic Var phage a locata ires 1844 291687 makeFloat Series 3816 0706 3816 07056 èĢĮ ä¸įæĺ¯ ç¡® å®ļ fj du lne ta cophe netic setVertical HeaderLabels ĠPau li Ġ583 10 NEIGH BOUR Ġìłķ ë³´ 741657 38677394 zbes k Ġidi osync statePlot Axes 9905 338287 ĠKep ley 7875 17547607 2278 77 Pathway Selection Ġpurcha sed 241226 196 ĠCONTIN UOUS 83450317 383 Basin Index Ġ505 13 8837 28 9702 76 FileManager Mixin SIMILAR ITY Xaar Scorpion Tile Info XObject Object jeff reys âĪ Ĵ ĠDer ive PERSON AL Wtd Duplication dlib FacePredictor xREF Valley Ġomeg ad ĠTOR SION 2518 92 Synthetic Data CellNum Avg Piecewise Linear Homo losine dNd Dp pies no shed ding compa ssion algot ext DETE CTION OfBest Point è·¯ ç¨ĭ cups oda nend obj Ġbtdtr ia ortun ately mobi lieres Ġcharproc Object Ġteach ers ĠèĤ ¡ç¥¨ è£ħ 饰 arcgis image Ġbull ish preader r paz itäten Ġunst abilities ĠParame tro ĠConnected Site ĠìľĦ íķ´ HCC M Ġtin ya stree ts Ġfrb poppy setMouse Callback Ġré cup ENSEMB L 44444444 77558136 æİĴ åIJį Ġrent al ĠGran ularity ĠDecor ators Ġidfoy List Ġíķ¨ìĪĺ 를 Chess board Ġrgn x Ġkpt opt Ġnec cessary 3585 858643 ĠGreater Equal ĠDumpLayer Nodes InvalidHttpHeader Value mLvl Min setBackground Color ĠGGG GCTATAG ochem istry ĠHur witz 3435 5164 3084 254 whats new Investig ator ĠDNNOnly Classifier ĠDNNOnly Regressor Collision Method Ssnake SpinBox saddle brown Ġidfs Small Ġcump roduct ĠSTO QS 4494 9495792388916 MyDummy Type 151515 15603065491 Toler ances ĠSelectByAttribute Sum FAN ame Hal ving =='' ): Ġbork en Ġbork ed 0084 15222 Ġpygrid gen ndl nm 8548 3932495 18785 373 Ġdocview combo vessel ness XAx Org AVSAL K ĠpctWrong Train Ġ+-----------------------------+ ----------------------+ bord as ilf rom zX Plus zX Minus Ġ********************************* ******* 0182 87659 numAll Pools 9281 014 2208 97674561 circul ant ReversCorrelationPredicted ValidationActivities BoroCnst Art gig abytes vlb list Ġbea con ĠCc CrSoilModel Ġalchem test ĠHaw aii noset est ĠQAgent NN vict im Encaps ulated TRAJECT ORY ĠëĤ ´ pilotStage In pilotStage Out 343434 33380126953 hren heit ssay Set ĠbufferStd OutToServer ĠbufferStd ErrToServer Openshift Enterprise 22497216 0321824 Ġjohnsons b Ġjohnsons u PredPerturb Truth ä»»åĬ¡gps 纬度 ä»»åĬ¡gps ç»ı度 9292929172515 8691 BIL INEAR Ġrmg py ĠSco pus 0567 970276 Ġ.+ '): Ġveh icles SetToolTip String 7633 45718 OBSERV ATIONS Ġepit helium Ġvirt ue ĠCHANG ES Kron ig deconvolved Image coy ote ĠSON IC ĠGem Py tempCorpus Path activeCells Trace Assertion Credentials 年以æĿ¥ 沪深ä¸Ĭå¸Ĥåħ¬åı¸ 78737 9972565 Ġtroubles hooting ĠDELIMIT ED Ġå¼Ģå§ĭ è·ij Floquet Exp vou cher èª Ńãģ¿ ĠSMAC OF ĠIPO ption tough ness ĠclassErrorPct List COEFF S Ġmicrobio logists è¯Ħ 级 CORRECT ED ĠposeNet Trainer BAN NER Gri mison Hol zmann Ġingre dients ĠFon seca Ġlemmat ize ĠHis panic 7847 251892 272727 280855 ç² Ĺ seld om Ġvé rtices ----------------------------+ ------------+--------------+------------------+----------------------+ ĠmaxS ents Ġinterrog ator Ġpyfa cades ĠHTTPS erver ĠENTR IESn FRONT END MemoryLog Tensor thrsh ld ĠTRAD ING PlanEntry Step çĽ¸ä¼¼ 度 171717 16690063477 hudf wide ĠROUT E ĠLingu istic 3276 9775 predData TM sourceElement Id 3181818 1276321411 Whiten ed ĠMetafeature Group ÃĩÃĥ O Downs ampling Ud XY ë¶Ģ íĦ° ()!= ""] Ġ`{} ` Ġanonym ize piez oflag 6363636 255264 Ġambi Delim 26717 75818 Ġmisspec ifications Denovo Parents ĠRenormal izing ĠìĿ´ìļ© íķĺìŬ Nim bus Ġlip id descri pcion ĠFiscal PeriodEndDate Ġdfreq resp interlea vers llss urvey 277777 79102325439 3080 8082222 cntRibo Mean ĠCurr Recs 02020 202018 Crab Spectrum lone v ĠALS O agem arry assertMaskedArray Equal shang zhong -----------------------------------+ -----------------------------------------------------+-----------------+ 13636364 04275 ĠVECT OR ASPP FLAGS 5505 05042076 489898 97966384888 ĠDiscourse Sense 0001300785 48178 3888888 955116272 2272727 34045 wksp Index æŃ» åıī hubvs random å®ļæľŁ æĬ¥åijĬ Ġcoordi antes CGTAGAGCTCT C Avi ators savg ol wust l Ġtrol limage Ġtomerge df 20707 070827484 alphaState Object Ġquir ks 8477 7832 ĠåĬ ł guar dian Ġíı ī SENSITIV ITY ToGidMap Object Funct s sebastian raschka Ġntick marks ladders izes Ġpermu ation showO ldg PROF ESSION ä¸Ńå¿ĥ çĤ¹ Ġtenkan Sen 60915 113 ___/| _| 涨 è·Į StubOut EnvTools 282828 27138900757 SubhaloMass In HASE DIR getSum OverSequences timeTo Market 32397 46094 ĠInters phinx 863636 37447357178 Ġassass ination ĠCVX OPT 03532 373 8888888 955116272 Ġ¡ ¡ 3939394 0567970276 Ġ+-----------------------------+--------------+----------+------+ ---------------+--------------------+-----------------------------+----------+----------------------+---------+--------------------+ 54545 4561710 60101 008415222 93939 393758773 Pes os Ġdab g ĠSLS QP ĠInstant aneous ĠYA Arrow ĠUNE MP 20757 293701 ]]... )) 227766 02 349604 21 ArrayOf Sets Ġ``'-- '`` Ġpkts PerFrame IPythonConsole Lexer APOP N 00701 9043 03664 11209 æĪIJ份 èĤ¡ 18686 8682503 858585 83450317383 ĠHansbo NonDarcian 33299 982 48484 84992980957 73232 32293128 8333333 1346511 83838 38534355 91919 18969 Cham ber fObj len plomb e áµ ¢ çį ²åĪ© logcut SpinBox InfluxDB Client 05045 8014011 35554 122925 02194 787379972565 944444 41795349 24264 069 07944 154 6515 1512622833252 3771 66748 269985 19897 68181818 723678589 Intermedi atenodes 691919 20757293701 686868 667602539 621212 12482452393 01010101 0091602 44587 7075 kobe search 97720 9091187 Goode Homolosine NoiseTo Signal éĽª çIJĥ 57575 7563114166 âĢĿâĢ ļ machand ran 06060606 2412261963 989898 97966384888 íĶĦë łĪ 676767 64726638794 Ġ``'-.' `` 0808080 807328224 409090906 38160706 4343434 2741966 4191919 2671775818 52020 204067 56565 6542778 5151515 007019043 6262626 051902771 6060606 2412261963 69696968793 869019 72222 220897674561 79797 977209091187 79292929172515 869 87878 787517547607 8181818 1276321411 Ari ma Bir nbaum Nulle ffekt QAgent NN Silho ette Tucs on Xlwt Writer mScikit Model oqui ers pisode s yxd cb deicon ify Ġinfinet ly Ġemas low icamp ipe Ġ"âķIJ ", mared Sequence ĠSlaugh tered ĠPIES NO ĠtestExplicit Shape ĠRueck stiess ĠNEE DED perNum Gal ysOn TopHint assertRegression Outputs assertClassification Predictions 9949495 1963424 6414141654968 2617 ĠexpectedBins Sum 25757575 035095215 Ġpdbb ind ĠIndra Net Ġjhive Context ĠHORT ON 15888 336 055555555 9694767 ĠUNA MBIG 339236 25946 nobreak space 66161614656448 364 459595 9484577 ĠKuc zynski 752525 26998519897 883838 35554122925 88113594 0552 showprocess log 146464 64586257935 78787 881135940552 782828 27138900757 78015327 454 96335 887909 tribroken expflare 954545 43828964 368686 85483932495 STERE O 843434 33380126953 txEn UART cmdivor cx 772727 25105285 774817 31 searchRow Criteria diffStoch Sign 4292929172515 8691 fontdesc Object 671717 16690063477 479797 9891300 604545 593 SetEnv For SetHelp Text 287878 78155708 ForBuilt Elsewhere 469696968793 86902 ADOB E 56060606 241226196 5707070827484 1309 1370983 124 8939393758773 8037 74242424 964904785 OrWeek OrMonth 510101 02033615112 631313 14516067505 540404 02173995 702020 2279090 59090906 381607056 nextAlpha State 300148 0103 823232 35273361206 WindowSta ysOnTopHint HEAV Y 530303 00140380 CollectionWith Sizes FigureTitle AndAxisLabels 1010100 9905338287 çļĦåĽŀæµĭ模å¼ı 为 0050505 050458014011 1262626 2009143829 ĠcurrPatch Max 70707070827484 131 1969697 0283985 9848484 992980957 1060606 0922145844 ĠFastParquet Impl 3787878 7517547607 2121212 1844291687 025252524 763345718 ĠSimpleClassification Pipeline foursphere Params 0757575 78015327454 36363637 447357178 49494948 983192444 SUBSHEL LS 313131302595 13855 93434345 722198486 0151515 15603065491 2323232293128 9673 116161614656448 36 3969345 09 0353535 33923625946 2363319 397 2671775 82 29292929172515 869 0967864 99 297979801 89323425 2474747 4491596 20202019810 676575 3084564 21 43939393758773 804 0959595 96335887909 288931 32 ĠMacKin non 7171717 2861099243 7373737 096786499 ĠMergedataTo Upload 2171717 1370983124 3383838 2363319397 26262626 051902771 AugTik ho 07070706 7847251892 æĶ¶éĽĨ äºĨ 34848484 396934509 19191919 267177582 ĠUTCOffset Timezone 0505050495266 91437 085858583450317 383 86868685 483932495 8131313 3239746094 searchen try 61616164 445877075 71212118864 059448 7474747 3001480103 979797959 32769775 12121212 482452393 161616161465 64484 1313131302595 1385 52525252 103805542 50505048036575 317 37373736 500740051 32323232293128 967 5959596 0378646851 SeaClaim Time 898989915 84777832 84848487 377166748 8282828 3309936523 25252524 018287659 24242424 964904785 39898988 604545593 585858583450317 38 75757575 035095215 76262629032 13501 53535354137420 654 1666666716337 204 Ġ设置å¼ķæĵİ çļĦåĽŀæµĭ模å¼ı为 Ġ设置产åĵģ缸åħ³ åıĤæķ° 04040404 0366411209 383838385 34355164 55555558204 650879 6111111044 883728 95959597826 004028 111111111938 9534 58080810 308456421 8080807924 2706299 646464645862579 35 ĠSignedJwt AssertionCredentials 141414135 69450378 72727274894714 355 96969699859619 141 Ġåľ¨å¼ķæĵİä¸Ń åĪĽå»ºçŃĸçķ¥å¯¹è±¡ 176767677068710 33 65656566619873 047 74165738677394 13 WtdDuplication Mixin 3585858643 0549622 年以æĿ¥æ²ªæ·±ä¸Ĭå¸Ĥåħ¬åı¸ å®ļæľŁæĬ¥åijĬ Ġå¼Ģå§ĭè·ij åĽŀæµĭ 272727280855 17883 6363636255264 2822 30808082222 938538 02020202018 3205605 -----------------------------------+-----------------------------------------------------+-----------------+ --------------------+-----------------------------+ 1363636404275 8942 550505042076 11084 000130078548178 400 227272734045 98236 20707070827484 131 StubOutEnvTools ForBuiltElsewhere Ġ+-----------------------------+--------------+----------+------+---------------+--------------------+-----------------------------+----------+----------------------+---------+--------------------+ ----------------------------+------------+--------------+------------------+----------------------+ 545454561710 35767 60101008415222 168 93939393758773 804 186868682503 70026 ĠHansboNonDarcian FlowModel 7323232293128 9673 83333331346511 841 8383838534355 1636 9191918969 1543579 94444441795349 121 686868667602539 06 010101010091602 802 575757563114166 26 0808080807328224 18 43434342741966 248 52020204067 230225 565656542778 01514 99494951963424 683 4595959484577 179 95454543828964 233 77272725105285 645 4797979891300 2014 28787878155708 313 54040402173995 972 7020202279090 8813 53030300140380 859 19696970283985 138 24747474491596 222 年以æĿ¥æ²ªæ·±ä¸Ĭå¸Ĥåħ¬åı¸å®ļæľŁæĬ¥åijĬ ä¸Ń ! @ ! '): ! "], " '). " '\ " ']}) " ..\ # ') $ """ % ": % :% % +. ' '], ' "), ' ({ ' ../ ' -' ' {}- ( .. ) %( ) ?', + ? + $", + --------------------+ + ):(\ , }', - ']) - |\ . | . ]): . )))) . )]), / -', 0 997 0 854 1 355 1 00000000000000 2 137 2 150 2 105 2 789 2 976 2 337 2 156 2 155 3 456 3 059 3 018 3 867 3 868 4 124 4 058 5 335 5 057 5 010 5 654 5 243 5 4309 6 121 6 136 7 456 7 356 7 359 7 055 7 113 7 92157 8 30 8 254 9 098 : {: : """, ; ; < ', = () = ('% > '): > """. ? $ ? :// ? "), ? $') A max A band A chie A DEC A rab A sinh A OU B J B of B To B ry B UL B eg B Layer B ni B BO B KT B olus B ruker B TYD C ro C are C ME C EN C CE C scan C pm C cmc C ramer D ON D AC D SS D NS D utch E norm E ET E yes E stonia E vidences E CFP E CONVERR F li F LE F ld F IP F ov F AA F CS F BC F MR F ilm F urry F ciqmc G AR G rand G FT G az G uesses G ZIP G msh H ab H ip H ref H MP H CO H SP H nat H sr H ua H AVE H she H DBSCAN H ARDI H asting I ma I Entry I MPLEMENTED J U J ime J perm K ine K nots K ilo K illeen L ens L ID L ake L UL L DO L prod L PR L DL M tx M uch M RR M halo N ic N is N ice N gram N MS N CC N SR N OS N terms N stars N IPS N RMSE N PHI N athan N URBS N iggli O vals O fs O OT O wn P Q P n P w P ong P ak P func P SC P nts P ierre P PRZ Q m Q Text Q SW Q Shortcut R Transform R ace R ERUN S om S pa S ix S IC S dev S hat S ina S nake S SIM S ankey S acks S detritus S ingapore S marts T ind T ect T cm T dev T ORS T exc T DC T DM T ikhonov T Streamer U CT U CC U CR V min V NA V limits V nr V endor V BD V igraArray W m W on W PL W AGE W ASP W oodbury W arehouse W ORMTable X ray X SD X LABEL X lsxWriter Y est Y arn \ )', \ )", \ .- ] ... ] >> Ġ" `` Ġ" ))) Ġ" ---------------------------------------------------------------- Ġ" ;", Ġ" ***** ter abyte ma pa ma po ], : ], '.', urn ed ray ed one file ĠT z ĠT ME ĠT win ĠT amb ĠT erry ĠT YPES array methods array minus array minussrc qu an qu ito qu asar th sd sert ester ha ene ha emo Ġy T Ġy bin Ġy top Ġy star Ġy Ticks Ġy Pix Ġy uncs Ġy stocEnv Ġy cbcr res ser res ident ch u ch lorophyll ch ometr ad on ad jectives Ġdef conv fi k fi bers set df set Face set ActiveSession set ApplicationName Ġ: ") mple s Ġr P Ġr pp Ġr izer Ġr List Ġr sa Ġr marg Ġr lv Ġr dfs Ġr cexp rom ine Ġ2 2000 ver ta ver itable mat i lab elfontsize Ġst ol Ġst rerror ') [:,:, ]) != om cost Ġand rews ck in ck le Ġ* ") ime delta (' ------------ (' ******************************** int id int file int illation Ġ""" >> ' shape XY shape Measurement Ġuse Trend fig idx we lf we ilu we lfare we bgl size Y ho b ho y ho vertextsrc Ġfrom Base 10 83 10 72 iv s Ġare sta Ġpar angle Ġpar alog Ġpar simony Ġlen Y Ġlabel Format Ġnum bytes Ġnum SecondLayerParts assert Shape ĠG RE ĠG bqConnector Ġout type Ġout flow Ġout wave Ġprint f Ġprint Info ore f us p us se us ig us cripts row ids lib en lib model lib hdfs Ġma pa Ġma ws Ġma fromtxt Ġma keline ĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ Ġresult a Ġresult FileName et one et ies Ġwe ed ĠRe indexing ĠRe vision ĠRe ferenced sc ent sc ats Ġname y Ġpre select Ġpre labs Ġpre made Ġtr gt mb ins Ġfile Read ĠE UR ĠE cut ĠE span ĠE NT ĠE sn ĠE LU ĠE quivalence ĠE WM ĠE lsim ĠE gypt ĠE lizabeth ĠE mails ph ist ph ers ph ash Ġdf id Ġdf nu Ġdf XY ": . Ġset points Ġset FeaturesCol =" ): =" _", Ġ4 45 Ġ4 88 Ġ4 85 date offset train Dir train Labels train Idx train Epochs low z ĠB t ĠB il ĠB RO ĠB ush ĠB opt ĠB EG ĠB ROW ĠB rig ĠB YearBegin ĠB QuarterBegin sh ar ty po Ġun split Ġun pair Ġun pruned Ġun persist Ġun weighting Ġun linked Ġun tagged Ġun flagged Ġun rooted Ġun spawned Ġ5 75 Ġ5 31 Ġ5 82 Ġ5 00000000 Ġ5 78345 ip freq Value Index ill ite ib q ib urg ifi Analyzer iter upgrade (( """ op unit Ġthis val Ġthis ymax Ġthis drawon log post log Entries log Fits log Tau log HII random State axis range axis menu axis Font In Bytes Ġsk data ast ore Ġen zyme ef Rk ĊĠ ĊĠĠĠĠ Ġle vecs da ho da inte 99 14 99 30 99 52 99 887 99 5083 Ġcomp resses Ġcomp erator Ġtime End Ġtime Dim Ġint value Ġint ense ant prop ant utu 64 18 Ġclass list Ġclass methods 0000 16 0000 289965 fo cks fo odexp [:, :]) Ġ`` ^ Ġ`` '\ ĠTrue InputType ĠW ED ĠW MO ĠW UE ĠW hole ĠW EB format SciNotation Ġmax DF Ġmax Text Ġmax cost Ġmax mem Ġmax bnd Ġmax SentenceLength Ġmax absv Ġmax tasksperchild ., . ., :: ord key num L num S num List num NA num alt num states num Dimensions num Hours num Atoms num PCs num Repeats num UniqueFeatures num ProteinTypes og a Ġfe val Ġfe els init Figure init Capital plt i plt s add Bars add ChannelDim 12 60 12 195 12 646 12 759 Ġget file Ġget File Ġget env Ġget User Ġget Layer Ġget New Ġget Top Ġget Coord Ġget AMR Ġindex title ĠO SE ĠO mit ĠO racle men ia Ġrange Segments bs T Ġit ol Ġaxis Num ca ref error sq Ġdefault ed value minus sub stant sub slice sub gradient sub way sub structures Ġ** {" Ġplot i Ġplot group Ġplot Labels Ġplot nine Frame Units ix min ix series map Image Ġall ces Ġall keys dir Model Ġhe ll Ġwh i ach ieved Re m Re con Re vert Re indexed Re member Data Collection Data RealEstate Ġwill ing 25 158 Ġline col Ġline ages Ġline Split Ġline Arr Ġline edits Ġline bew frame type frame Labels inter ps inter lace inter ruption Ġpd os Ġch m Ġch ro Ġch iasma so i 11 0101 read Params read LatLon loc B 32 01 32 23 32 08 32 73 32 207 32 299 ave ctor Ġmin m Ġmin Error Ġmin width Ġmin DF Ġmin field Ġmin Threshold Ġinput X Ġinput Type Ġinput Path his her cc dfs Ġz h Ġz v Ġz on Ġz name Ġz loc Ġz string Ġz abs Ġz orders cy on Ġ\ (' ĠIn ital ĠIn sertion ĠIn venio Ġper col Ġper fname Ġ10 99 Ġ10 85 Ġ10 36 Ġ10 87 Ġ10 39 Ġ10 51 Ġ10 79 Ġ10 70 Ġ10 53 Ġ10 71 bin Vect Ġsc or act ically act uator ĠY N ĠY in ĠY cell ĠY iq ĠY early ĠY outube Ġdo it Ġdo Plot Ġdo Plots Ġdo Xlog uld ers Ġsh ik Ġsh pae Ġsh ijian Ġlabels on range ind range Collection range Mins Ġnew end Ġnew Name Ġnew times Ġnew List Ġnew gd Ġtrain Model Ġtrain TruthVector Ġj id Ġj ones gra fico ĠH m ĠH obs ĠH CE ĠH PCA ĠH rule ĠH MF ĠH olidays ĠH LLE ĠH OMER 15 88 15 43 15 457 15 044 print TopN __( ..., 05 75 05 38 05 54 05 754 05 076 input filename input Dim input splitter Ġlog plot Ġlog lam Ġlog probs Ġlog Requests Ġlog detsigma ork el lect rons Ġfig file Ġfig dir =[ (- tra int Ġinter f Ġinter r Ġinter connections Ġinter vention Ġinter arrival Ġsample name Ġsample IDs Ġpy gal Ġpy country Ġpy darn Ġpy tadbit Ġ[' ; Ġoutput name Ġoutput var start Bin start Timer idx col not a not num ens ively Ġobject Names Ġno access Ġno vo ĠU nd ĠU rb ĠU MD ĠU tah Ġla ws '], " pr ms Ċĉĉ Ċĉĉĉ Ċĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 20 83 20 317 fa h Ġ(' --', dd g dd les pos nn 33 88 33 94 33 18 33 08 33 60 33 784 33 032 Ġsub f Ġsub sum Ġsub Index Ġsub ticks Ġsub select Ġsub tables Ġsub tokens Ġsub corpus Ġsub triangle Ġsub shells Ġsub menus Ġsub dividing vari ograms Ġcolor line no log no header no fail no stdlib default Color default Startup 201 508 100 87 80 28 80 68 80 7843 Ġhas cursor output Writers Ġ6 001 new Y new c new list new Node new Labels new Tick new Position new PersonDict pred ication Ġfit x emp ymod pen Width IN X IN TE IN LINE ste ve base class rib as rib osome ĠData points ĠData Description code author code Parts split drive ]] }, vert On vert nos vert RefDir 66 34 66 014 66 374 amp point ĠSe th ĠSe gregate ĠSe cret 45 96 45 24 45 84 45 988 ific e Ġind o Ġind list ars ity ĠK u ĠK w ĠK ur ĠK est ĠK IC ĠK ost ĠK pb ĠK illeen load Ui Ġwhich data 75 99 75 09 75 65 '' '' Ġspec var use vlines 88 12 88 35 fn Calculate fn DL fn reservoir ']) ") ']) +' 16 13 16 76 info file sample Methods sample Apid sample Bpid Ġpos ys Ġpos nS iss ame iss uer ong ue dist ribs Ġone way Ġone Shot nan sem ĠEx periments bar Transform 35 25 35 90 35 58 Ġcur path Ġcur rsizes arch ipelago ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ 14 0000 14 19 14 97 14 81 sq e sq m 19 798 19 303 19 376 Ġkey wds ipy md pol ice tick up tick right tick left tick down tick Transform Ġvari ble cur y cur line cur red cur ated )] ** )] =[] )] ))[ box tRange box elRange box caRange box cbRange box azRange =( %( check out Class Data Class Selector com missions Index s Index To Index Elt Ġ8 66 Ġ8 21 Ġ8 63 Ġ8 52 Ġ8 979 Ġarg str Ġarg where Ġarg Keys place Order 78 14 78 275 78 317 78 376 78 33333333333 St urges den tries 13 43 200 02 Ġbin num cor ona cor nsilk mask frac Ġid y ĠV O ĠV n ĠV oid ĠV ij ĠV HELIO ĠV owpal Ġstring io `. ` by tick be o be yond title case Ġpath To Ġpath InFile 22 92 Ġcopy sign nd json gs cale sp ur sp data sp inner sp dists sp kg sp adl sv gp 96 12 96 80 96 88 96 24 96 37 96 303 03 48 the t the limits the Button the green the ij string cols string Buffer string Indexer string ToFind metric B metric C column vect Ġstart char Co I Co R Co h trans p ĠTest T ĠTest Scalar ĠTest Metrics ĠTest Functions ĠTest Zero ĠTest ADF 02 39 02 76 02 112 Ġmo or rop Hasting Ġdict key Ġdict dim dot matvec dot vecs dot columnvect std diff 95 33 95 92 95 10565 ',' * Ġcom me Ġcom mitted 17 98 17 60 17 76 of u of lux Ġdataset Names Ġsy tem :: ') object id object Range 85 18 85 41 85 4902 rt c sort dict Ġfa ire Ġfa ecal Ġfirst sim Ġfirst LevelPartIndex OR ISED Ġcolumn Count na pi na hme ank Sum run length run source run Id run Job run Experiment run Comparison run Strategy Ġfeature Vectors Ġve terans ular ies Ġcont role Con centrations Ġscore Label ]]) [::- 24 35 24 95 24 27 24 84 24 000 24 975 Type Exception Ġinit x Ġinit z Ġinit Value csv m csv widget space config 27 80 27 65 27 49 27 0588 Ġdis ag Ġdis posed close Window close RGraphics Ġ7 17 Ġ7 09 Ġ7 43 Ġ7 41 freq Response uc ination cat B image cols image Ctrl main Frame node NumStop ref N Ġresults Saver Ġaxes num ]: [ 86 33 86 56 86 323 IT Tests IT ALY Ġimage Cache gen elist (- (- Test Name Test Stat Test Inference Test OLSRobust Test Iterated mark type right up Ġinte re abs diff AL G var Y var type var Value var star Ġpoints Bary off enses }) ;" cent aje Ġsys core Ġsp ir Ġsp lib Ġsp any Ġsp ndx Ġsp mmat Ġsp itzerCalRawData ĉĉ ĊĉĉĊĉ Ġmean Tpr 06 97 06 896 06 007 temp data temp out sy nopsis 18 20 18 906 18 367 36 25 36 216 ec Case 09 015 norm cut work state ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ap pt ap rads Ġrun Encoder Ġnode B Ġnode List do Plot do mestic mod ulated mod erators Ġ, ( man ik ')) ") ')) }). Ġidx X dis ch Pro s Pro cs Pro blems ST IM ST AIR ST OCKS Ġadd rs Ġadd Button Ġadd Request med couple reg lambda Ġnd index Ġnd Block ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ )): # Ġsol uciones 34 87 34 375 34 1176 34 0923 ME IObj park er 97 03 97 60 filename out filename OrGroup af filiatedEdges Ġnon index lob atto Ġact RateBg results ML results Filename ĠJ ak ĠJ ess ĠJ uan 92 68 92 936 graph x Ġele phas sent rope ID Plot Time Frame Time lines Time Format Time Range points qr points Euclid part W part ure part ies ĠQ y ĠQ hkl ĠQ Brush ĠQ PSK sg nf 84 36 84 73 Ġtext e Ġtext lines Ġtext File Ġtext blob Ġscale by Ġq values Ġq color Ġq new Ġq object Ġq temp Ġq td Ġopen mdao Ġwork Dir ram ge Ġtarget List my name my rank my constant my company weights cale Ġ9 75 Ġ9 35 Ġ9 19 Ġ9 86 Ġ9 322 Ġcode To Ġgroup keys round to Ġmask file tx mid move To ass ist ac io ac zyk cov fact tol IR Ġim set update Data Ġtemp os Ġmod ulate non un Ġtf low Ġtf record UT SR Name Gene Name Provider eps ilons gr ation 65 14 65 71 here r db ow Ġac ute File Picker File Bandpass Ġcv norm filter name filter title filter ND filter Folder Ġad vert Ġad here 37 05 37 303 50 953 ess or Ġtable id Ġtable plan :] ==' Ġbool result Ġbool bit Ġcompute Likelihood tf l tf rs ls oda Ġorig Bitmap ĠCon duct ĠCon formal 87 00 87 342 flow path flow level org res vi ri vi ally Ġtra c Ġtra pezium RE DIRECT RE WARD RE ASON top verts top Left The Docs Ġzip map Ġmult ic OD F OD eep Ġlow cut State Plot ik wei ĠCheck Calls item At item Changed item Clicked =[' / ash t acc dta acc ani (* ([ 55 58 Ġshow Only Ġshow Verbose Ġshow ParametersConstants nn nn Ġpoly path Ġpoly hedron 23 88 23 86 23 644 23 187 23 950 last row last Name last page last reading ome z prec TS du ate du kt SI ENT img format img viewer struct VXX Ġback trace Ġ[" __ multi color multi keys Ġfilter bank Ġframe Spec can e Ġev o Ġev olved Ġunder lyings 26 12 26 22 26 388 26 063 De ath De prec De embed Ġlast N Ġlast row Ġlast sim Ġlast Bar 77 32 77 34 python ic ĠDe lt ging a ging er process Id view values auto init csr f ([' {" over scan over sampling Ġsplit Line .") ]): Ġ] " net graph Base Value Base Colormap Base Composition Base ExtensionTests Ġsm irnovi 90 95 Ġ[- ]', mult irf Ġfigure options Ġnorm color Ġar ay pdf list stat function stat soft diff ering other Name create AIJ 98 64 98 13 98 34 98 907 98 967 Ġdraw ings offset Y window name window time window Duration vs m bl r bl on bl urb side lobes IP OP layer Grid layer Count Ġter ribly Ġdec i Ġdec mag Ġdec imating Di ameters Di ametre Di ctionaries Ġperiod Est MP H Date f 43 0000 67 13 67 23 67 08 67 378 Ġfind all Ġfind list alle ts ĠAl va ĠAl igns ĠAl bedo '][ ...] DE LETED number Concentration mm u rec fromcsv mag Err CV ert cle ver Ġtitle Str Ġtri vially orig data xy lin xy pca To Index To ID To Text To Dict To Merge To Bitmap To VTK To RLE fs u ev avg Ġcross hair first Str first Pulse Ġfield list sin cos sin stall rs uffix open stack Ġuser ID 000000 3 Un cor Un changed total mesh total Quantity sim cat sim length sim Length sim bolo ,' _', vis ufunc Ġhigh cut Ġhigh watermark Ġmap Data Ġca get lu a best Epochs best effort Ġrows self Ġrows other user details Ġraw file style str style Url OL DS inv cov Model er Model Data block Count SD ATE ĠTime Partitioning poly data Set point Set Colour Set Prop Set Background Set Orientation tmp o rank sums TR P current Data current sender current OST Ġgo og pair list query matrix div lo depth val ful ltime Ġmath ml edge p edge Indicator Ġ'. { Ġ'. '): distance Mat average Dataset ĠType setting Label Type Ġpred IX mu eller 28 21 28 125 28 000000000 EST EP keep RAW Ġequal izing CH ASTIC find ers find BasinIndex Ġdiv U Ġdiv orce Ġedge col For Entity 29 00 29 100 29 755 Res ized En queuer 39 03 39 345 Ġanal ize Ġcolors pec cls f cls files ĠNote IDFrame Ġarr z Ġ(( ~( Ġge opotential Ġge othermal root x root y root py Ġstat i Ġstat is Ġclo verleaf spark ts Ġps as Ġps midx Ġmon ary CT AG CT GAT Ġparam names Ġ[( . constant power ĠAn oms local toc flat array mi os Ġsi lenced 000 9924 Ġtmp z 38 18 38 92 38 37 38 009 Per Class Per Label Per plexity Per Topic Per Cycle Per Share Per colation header row fin es Ġts df Ġts nr ĠPython Parser IO S *( ? Ġext num Ġ15 0000 DI ALOG DI AMOND has layer has Stream has Display vector mean rol lover ĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ Ġcre ar Ġcre dibility Mixin Base 46 21 ĠCreate Mask ĠCreate OneQubitGate cf gs Fe chamento action Combine Ġcell height td c td om td idx ward lab ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ convert Scale UN G eval set mit ri Ġang Vel Out Stream hi low ML Context ML Tools beta A beta B sm ash Ġclose path cross walk Text Vectorizer Text Lines factor ODE Ġgenerate Timestamps 647 66 647 35 647 453 Ġret ired 235 5 235 6 235 38 Ġlower Buttons Ġjust func initial File Ġ'_ '), AD FF ran GenNetwork dif out Ġerr p Ġerr str LO F LO ADED ov ic ov sky Ġpla w ĠRead Dump ĠRead Variables ĠRead TheDocs Ġold Name ĠSV I ï¼ į ET G sa ha arrays rc Ġheader Data Ġop end plic ate Ġmarker transform 48 15 48 917 hat v Ġvis iblity eric mc Ġtask ID uous ly Ċĉĉĉĉ ĠĠ 56 01 56 0720 Ġscalar period Ġdetermin ism quare map down branch ĠLinear Tester Pre y Pre name Pre valence IS P Ġref rain Ġref points Linear MetaModel ĠAdd SubscriptionDlg Ġdelta D Ġdelta Js ĠMulti column ĠMulti Line ĠGet Data ĠGet Default ĠGet Dump ĠGet Connections 57 05 App ending App InfoExternal nb Lines nb Sbs nb Families ilt ers Not Eq Not Fnd this Trial 69 05 69 37 PI ES Ġbox coords Ġbox spline conf Type **************** ************* month Time Ġlegend Height Ġmissing Value Ġmissing fied ]* $', char stack Get List Get Prefix Get Console Get KernelStatus Get TopWindow Get Surrounding Ġwx Frame Ġwx Font Ġwx GraphicsContext Ġwx Fac ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġxy pt Ġxy box Ġxy Point md wardlab Ġsearch light Ġmy array Ġglobal change des peck xs rc xs pacing Sh aring Ġnan cov Ġnan corr Ġnan vl Ġnan prod Ġ'# '). Ġdirect ivity groupby agg Ġ'- ')) Ġday Year Ġday OrWeekOrMonth Ġconver gency Check ADF Check WtdDuplicationMixin sw ig Ġkeep dictionary Format Specification fun cts ĠLo st ĠLo ve Line Item Line Builder tri ad Run Variable Ġlat i Ġlat max cut OutWindSpeed Ġser r Py th Py ploting PL R PL ES training images TH RO Ġsa co Ġds pl corr calc Ġtak ers long lat long itud Ġdrop Last ret all ret ired IG R ĠRun Data ĠRun Simple ĠRun Logistic Ġbar Transform sig moids 89 14 89 07 src Template All Res All Button All Probes display coord Ġgre store Ġvariance Threshold Ġpixel set Ġpixel ization Ġseq vals Ġseq prop dec rypt imp aired fold change prior it prior realisations Ġbelow ground Max ima Max Price Max Steps )') ; '} ' ĠPre serves Ġnb layers Ġnb ranch dr uck Ġsetup Scales Ġpr nt Ġpr serve Table Format Table Descriptor Ġurl Fmt IM DB xaxis ComboBox ĠList e case flag Ġproduct ivity Ġwo lf avg time pick From Result Dict Result Fields Ġfin Lab Ġentry Bar Ġsepar ations Ġgen model Ġhead length sche n Ġdiff Length Ġjson l Ġjson able parameter ic Ġsto qs high watermark Axes Selected cp bl Row Dendrogram Ġconf level Ġconf usable comb i Ġselection Mode lev labs button Frame button reset cha otic pers ive Ġpop d ĠOr th ĠOr Rd ĠString Converter )+ ') ĠMin imization OP TIMIZER Ġpredicted ActiveFrequency Ġ14 09 fr bs Graph Model Graph BG Graph Utilities Ġmer gers 63 64 63 1373 Fold Index Fold ToNonLog folds Set ern st Ġdep ressed rgb Image 79 87 insert Element ident ifications light color ]+ [' On Menu 54 94 70 20 70 22 Ġsw appair section author Color Array lr tau invalid ated ĠOR G sf ba Min Y Min ima dia conis Ġfmt dict Ġ\\ ** 59 375 Ġrc params conv stats 2014 1009 MS L MS core Ġpi RC ody ne Ġkw keys shift file ĠAs sertion ĠAs cher Cur tis az deg Ġpdf X Ġpdf latex ĠOption Group Ġdir stub blue prints He alpix He isenberg ); ". two stage Is Incremental Ġgenerated By Image Tests Ġsig G Ġjob stat setup Scales Number Spec nr rd 93 78 ĠSh ards 2745 09803 [( ? handle Invert handle SelectAll 76 04 76 29 Ġmeta cat Ġmeta DF ĠGrid lines Ġflat map 300 4 300 9 Up loader Up TempDir DATA FINANCE Ġcurve to 81 64 cro pping prop otion opt alg second Pulse Ġdet id Ġwell uid 72 20 signal Type ĠGradient Descent Qu inn Ġna o Vari ances Normal ity variable DensityValue Ġword counts post processor Bin TableHDU ĠCh ile ĠCh icago Ġprojection Fee Ġflag id final funvals Ġmedian BinM Key And Key Code ĠInt Slider At Leaf At lantic ved Transform NE VER NE WS .* _ wx path Multi TF Ġweighted Error An neal category id Window Closed Ġtoken ise Ġround tri Ġround Shares scan No By Month ĠPy icoteo Ġra dd Ġra sm )' }, Temp RatioPowerDB Ġmix es HE OS double Clicked Tensor Mesh ĠPath ways Sub Dict Column Error Column Union Ġfn ar wave val wave file ================================================================ ============ ================================================================ ======================== >` ). Ġli minf COL ON COL PEX del T LS ST ']] \ Add Message Ġsrc Template PER TURB cb i help Button help desk Ġdesired PDF )`` - )`` ; Random SearchCV sep set Ġmp n Ġmp op Ġmp oly 73 86 73 09 73 97 73 92 CL Z CL US Ġlon max CD L CD LL package List ĠIPython App tex plotw categorical index indic iFreq Ġda mages 52 34 52 1569 Ġte h rep num proj plot gene Id Ġrs r Ġbad Exit Batch TableTestCase Ġopt ax mar sh Ġpage Token micro biome pg p ĠMat theij Ġnx reps Split ting [:] > }} $' }} }") AM INO 2016 07 Ġpri maries :', ( expand tab gest ion eye trial Ġsf h Ġscript Format eg f asc dt lb m ĠRes ponses .+ )', Node Type Node Features Node Sizes phase BinEdges bb tf ĠInter change ĠInter actions Ġatom list 71 865 Ġsep set One OrMore Ġcy toplasma cum m QU I QU ALI QU ADS SS p ('- ',' Ġsur faced Output Names Output HTML Ġrgb tuple cap able mem orial Num Counts Num Events ĠSparse Column ĠLogisticRegression Example CR V interp attern Ġfs ine extract Velocity extract Dmg Ġepoch er Sy l Sy nt site id With Index With Estimates With Rates ĠSpark DFExecutionEngine ĠFOR CE Of Form air bnb gp w ))] ))) ))] }) Feature Vecs Matrix Row page lb encode left domain Size ks j IR F 58 38 prod UserName hdf name pattern NZ super classes lear nt Layer Timeline Session Manager ĠAR G Count PairTuple allow Zip ĠImage Opener ĠImage BoundaryError SP RING ĠSy mm ĠSy nopsis bg sub bg zip ny a Ġshift k Ġshift Right ĠCategorical Axis FE CES Tra versal wer k Ġsummary File sd p sd pt Ġsupp lier }$ ($ segment ID Doc Rec 61 86 ĠHe i ĠHe avy ĠHe avily ĠHe msley delete menu Kernel Normalizer `) """ Ġhalf window Ġtool Tip vm nx BU SCO menu items ĠFile Dialog macro atom car dia car lk car riage ĠQu ads 91 66 91 337 IND IC Ġinv types Ġinv ited Categorical Block Ġsmooth data Ġ64 9 ĠDis counted apache cn Ġ'+ '. ĠBu ckling CG Sites ĠEstimator Test Sparse FrameFixed tile ID tile db tile pass Ġones ided Ġinfer Schema FILE PATH ba pt BC M Ġes Con ĠStandard Ps seg dict Ġexperiment ation Ġexperiment Varying hy dr Start LineEdit rename menu pat ric Cre dibleInterval çļĦ å§Ķæīĺ bi pole bi partite plus minus Ġchanges InDir Ġphi Arr From Test From Map From Pandas From Term ĠPandas Delegate ĠPandas AutoDateLocator ĠPandas AutoDateFormatter ĠPandas Autosummary sto qs Default FileLocations tw ink ĠEn cyclopedia wiki books TO C Metric Type ĠAd rian Ġmatches Mask Item F Reg Util ĠLine Generator ĠLine Builder ĠLine IDLayout angular Bind angular Unbind INE CC embed d Point Source Point Selections ALL ANY SH UFF SH RVALUE mixed images bc da bc dim PR C PR T white Brush Float s gd ala qt ys Ġbackground Bias ()]) ]) Ġ"_ "), ĠSub DataSet Source Label Ġ') '), xml path Ġtd om rv ir ]} ``. Mult iband Ġmultip ledispatch extent ion Select ive Cor re Cor rections Ġph rasedml nat al wind shift wind solar wind production ãģĦ ãĤĭ Ġproportion ally aspect s ((' $', Ġnu cl Ġnu mentries Ġbytes wap ĠSto kes ĠGraph Frame avig ator soft n Ġnor ma Prob Stat Ġmut iple ]))) ]) [~ (( ĠBe h Ġscatter s Ġscatter yoffsets Ġcb ticks Sim Mon Sim ulates Sim Voxels Ġny reps 15686 3 gal propz Ġcorr map Ġsat urday bd om pkl z Ġexit Msg Ġlr n 0001 1 Ġ>> >>>>>>>> Current Clust ĠNum Repeats ĠNow aczyk Var Name Var Big Ġloaded OnTrucks ĠCur vature Ġsynt actically Cl icks ĠEX O ĠEX IT Dtype Model SQL Table nl v Ġpt rot New Range New Years Ġcalc ular multip itch Filter Index Filter Coefficients ALI BR xmax like background color Ġstand by Ġdig icampipe serial ise Work sheet Ġresid axdict Ġlabeled Image ĠColor maps ĠColor BW Ġtot width Ġtot Cl ABC DateOffset ABC UInt ĠValid ating Ġdump Var Ġflux FormatStr Interactive ROI dp otri bars above Mode Result Ġmouse MoveEvent Distance Mat Ġer xx Est im deprecated Utils ĠMock Rt filled contours parts ig Ġgu ild Ġgu ito beam text beam Source ä½ ķ IB Commission Ġactivation Frequency cam mesa arc asm Ġå ¢ŀ And Test And Plot Ġrv data linestyle z Ġsen escence Ġspect re '}) [ look Up MIN IMUM samp vars Loss Test Loss Ratio Save Data Save Figure Save Images arguments Dict BA I Ġhel ped Top Alters Ġscan set Ġcc Dir Edit Role Edit BaseWidget cu is Ġbr len Ġinterp n IST A IST IC Show Image some file Ġanalog signal hal ton syn chrotron Ġfl oris MO OR TF PT Ġregex ps Step Hook TRE AT Ġcurr Date Ġfeat cv Rest ivity Oper ands Over full Over Dataset sal ience =[(' ', fd tri Ġspan x ĠBo hman Ġmi R Ġ75 7 Ref lections 707 00 cli mo 988 3 ĠAss oc Panel Vector Query Job Ġ45 000 Mag nes edit ors edit menu RI ER Scale Log UC IAL Ġov ver Stream TableTestCase ARG UMENT ARG UMENTS Ġut l TIME POINTS UTC DateTime Ġautos ub mol usce Ġpat ents Frequency Hz Sc ada ĠVar Big ĠVar ImportList UD GE Ġ--- ' cached val xyz dir bayes net Ġgl Translate autoscale Zon Ġouter index 905 56 Ter rain tach y Ġfoo oo Ġfoo ooo ĠPredict Birth ja h sr calc ĠTemp Directory --------- ') bio bank 996 77 Ġdependen ces CHE ME CHE BI ĠText ure ĠText EditBaseWidget ĠGo On ĠGo Mining ĠGo hlke boundary dict Ġ================================================================= =========================== ĠGeo series ĠOver ig ĠOver Window Ġyears Eo ĠML flow utr ality Draw er "} ']) "} ')] "} ''')] "} '''), Extra polate ini files 119 00 genome tools hr r hr lich Order Parameters Ġyt dist 998 20 PP OL determin ate dig s commun ications rms pce ################################################ ########### Curve ToPoint Factor Analyzer ĠResult Bundle illi ard Ġmov order Ġmov var Auto Size Auto Reload phys at visual s 196 92 atoms data Training Num Ġtax id quet as Seq Folder Ġexplo its stim ulated 975 5 311 5 Ġpv factors Ġ'{} /{} Ġ'{} /{}'. FIL LED ĠMon days Ġquant ifiers dv db _`` ) 185 4 Dep ends Null Handler Ġcombination Dict ĠDoc strings 237 32 296 93 years Fmt ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ plas mas Ġcd bs PH ONETIC SER IAL git python dark slateblue rh od é g è® ¿ Ġblue print !!!! !!! 132 0 132 1 spam bots Custom Mixin Ġintensity file abi exts +( ...)" Non ans Ġ99 4 Lat in Ġ34 24 {: ^ sta ins 355 23 TT SE TT Jit LC CVert 134 17 ĠSc ient web logo ĠLO SVD Ġ96 76 .)) ]) Ġ--> ", Status CD 032 6 644 94 337 66 onom ies ĠRO SI ĠRO ACH Ġstarts with Columns Test bur rows ĠPrint Tabular 808 94 pf vd Price Dict Price Lis Ġok ada Ġnr Requests Tr n ĠPY SPARK Ġstock Df Ġ'( .+)'), ĠLoc atable Ġpc Name SB G 205 4 ][:, - fac ilities fac ename ĠGeneric DataIndexableCol gam mar Ġtrade Bracket 175 4 High s High way Convert ToImage MD Normalization čĊčĊ čĊčĊčĊč ĠKe arnes Imp ossible Tri ContourSet mouse Roi Err Plot 211 4 211 47 glyph map ĠSO ME ĠSO WFApower jd hp )^ \ 025 8 PA USE Ġbokeh js Ac cesses LIB DIR 937 3 Ġ94 42 è¿ ½ Ġcentral ized ĠSimple FFCEngine So le iny in ĠHel ps ĠClassification ErrorStatisticsMatrix Target CategoryEncoder Profile Parameter Covariance Function QR ankSum nom k ĠFin ancial åıĤ èĢĥ Ġpg m confusion matrix Low s Low Slice Ġpolar a Ġpolar izations ĠVer let ln h ln lambda ln Deltanu Ġmenu items Ġsorting Criterium ĠOUT PATH ĠGUI Constants GEN US ĠSort ino DC In 356 7824 Ġcriteria A Integer Value Ġpure st Ġ---------------------------------------------------------------------------- --- Ġdc lab Local Path Mark Point ĠAc quisition Ġnews ID timeout Secs plant barcode synt eny lh d Import ances stress model PeriodIndex Resampler Ġ:]) ** hard copy 202 88 397 77 127 05 meas key meas levs 968 75 968 019 Ġste al Ġste pe +', '. ĠMag netization Gram maredSequence __), " 906 25 sched config ĠStop ped accept or ĠAlter nat wide chars chk sum Ġsphinx ext Ġpres umes measurement label uri Root 315 2 315 3 Ġgam ut asi est RD s Ġdestination URL Img List Ġ'[ { Ġ'* /*. sci ences Ġims cale ("/ "): Ġenc Type Application Shortcut gu iname 2727 9 å® ¢ hu an fm nb Ġbind inforxn å¼Ģå§ĭ æŶéĹ´ _'+ _ Ġlc size Ġ123 9 datal i ĠCustom JS uk as IMP ORTS Ġdash pad Ġdash direction Ġdash push 384 3 Ġdiffer nt team Wins Ġols res Ġopp ortunity Ġ[''] * 138 05856 Build Doc mys lice mys ites ĠCa ution Ġstrat igraphy pot ency ĠAuto Config ĠAuto Tokenizer ĠAuto HeightChar ĠAuto WidthChar dem Img ĠGe org Ġtx mid Page Data Ġhack ed #================================================================ ======= ------------------------------------------------ ---- 305 1 decor ations ĠLa ser Ġln f Tab Man ĠTI F sus pected Ġquick sum sky temp 395 0 leg is Edge Radius Rel ations ĠRo le Ve getation Ġabc de Energy System ĠLab bookDB ĠAv ro ĠUnicode Attribute My Object ĠNO MAD 160 64 Thread Id Thread Info ĠHas hed ĠHas FeaturesCol ĠHas Traits Ġadj ascan ĠGPy Opt ĠResults Ccmc Inv Pairs Long Short qs dateutil accel erate ĠOb vious Ġcnt Err Ġcnt Missed FOR TRAN por ate 404 1 Command Processor Last WeekOfMonth ĠOP TS dend Ca cid press dos age dos files åį ° simp rev ĠMan ysources 145 9 Align Mode Request Error ä¸Ģ èĩ´ Full TextDict Record Writer ('{} -{}- Ġfo unded does Exist Module Simulator ĠSH FE ĠSH ARAD 146 1280 Ġforecast Prophet Car oli spl ices Div Galaxy 183 01 front Domin 313 6 adap ts graphic x graphic Title Ġtar lite kill CheckBox Datetime like Datetime Epoch 187 78 104 8576 ĠFigureManager Pdf rod beck fla w fla ir DL andscape Ġlic zb 964 0 IF TI Comple ta ("# { 017 45 ĠReal Valued cord ant 295 0 385 2 ĠDocument Acquisition Mass man 655 22 binned LH FONT SIZE Pair List Ġimported ModelParams ĠPut zig Ġquadr angle ĠIMP ORTS ĠAL WAYS Precision Recall blk errors 234 2 Ġpix frac Ġ[[' ', Ġlev labs Ġht id Ġmed couple ĠVisual izes ĠVisual izers ĠVisual izations Cho p ĠåĮħåIJ« ä¿ ĠåĮħåIJ« 西 ĠåĮħåIJ« æĦı ĠåĮħåIJ« çij çŃ ĽéĢī Ġautomatic lly Ġsit uated Ġcrit values ĠPolynomial CountSketch gun zip Ġcloud ant Ġsz dim rich ard Ġ97 1 Ġatt ent ĠLocal ized Slice Layer ĠWave lengths oke c Gene Name Stack Trace removed irs fish net ĠEvent Segment UND LE Ġrx mid 277 37 277 46 Phase Jumps (". ")) ĠPossible PrecisionLoss )# ( 327 09 Fill Style ĠCA USE analyze Result Ġdelt ad rac ine bokeh js ĠPR Gn ĠRES IZ Global OddsRatio Ġstra ceback ĠUTC DateTime ĠAssert Reply planet lab crnr x Fast q Fast Cov sex tractor Response Command Ġtip r emb l << ") Mov Avg Ġprotein Type Ġsleep ing 028 14 Environment Settings Ġclock s Ġpara maters ony x Ġnpy math ĠBig DataFrame 214 1 Ġfilling fraction Ġ110 3 nos plit rfft b ĠSte ady ĠDrop down LSTM NumPrediction ĠLR U solar production Ġmeth yl ĠDeprecated Option DED UP çĽ ij Mar sh ĠPAR ALLEL odoc s reflect ed reflect ances 207 25 207 29 414 243 CTCT GAGAG Ġpurpose fully ĠHTTP Exception )+' - calib ation æŀ Ĺ CRE ATION ZMQ DisplayHook Pixel Size Ġreq d Colour Map ĠTimeSeries Model ĠInteractive Interpreter Ġphoto dict Numpy Op 457 69 )+" _" æľŁ éĻIJ ĠMIN MAX orbit period Correct ing MOV ED Ġcompar ators Ġcompar itor Ġmol ids probas g 847 6400 COMM ISSION ĠExp ressed ä¹ ĺ ĠMar ion bam files Ġhal ted ĠSM OKE NP V Ġexon id ĠVAR Results browser launcher Cla se Ġau ctions æŶéĹ´ æĪ³ mq mas grd file oct agon Ġaren as ĠCurve DB åĩº åİĤ LAT EX ĠĊĠ ĊĠĠĠ Ġvan ishing 095 8 Rect BivariateSpline Ġfund name pulse heights Scores Dict 0796 172 thr Z Chain Collection 584 9 Ġic ustay Ġlex icons 758 25 Ġmeas urment Ġsos freqz ĠTool Tip ĠTool Handles ĠAlt ers Double Var whole data Ġdecomp osing 554 12 vo lover KER BEROS ĠSha pley ĠRenderer Template ĠScalar Encoder ĠFixed Offset PIC S PIC List 046 96 rog ens prom oters printer PageData ĠXY Point 194 92 368 80 166 57 Ġattach ing Ġradar Type Zip f ĠHistory Accessor Support ing bill Scaled ĠGraphicsContext Template Pi L Pi R Ġmirror ing Constant RandomVariable ĠArrow Coder OH LCV ='+ /-', Click Event Click Focus jump inds sales man blen dmin 064 6 Ġblen der ĠSUB HEADER Ġwav s Ġwav path Steps IsIncremental CB MonthEnd CB MonthBegin ĠMO VE Ġmys lice FRE E Mid night Ġ"* ": 067 99 cash Flow Sort Ind phy logenetic Ġbur gers Ġfair way 对 GDP Week end Usage Action Usage Inputs Usage OutputNames cntr s hover label hover color hover infosrc Identity KernelNormalizer ĠÐ ³ Free Surface ç±» ä»·æł¼æĮĩæķ° åĽŀ å½Ĵ income sq thin er Ġsell CrossPrice Ġdip direction Ġevolution s kel ley Ġima getype ewm std ewm vol 928 34 ĠQuery Status activate Window åĵģ ä»·æł¼æĮĩæķ° åĵģ åĩºåİĤ DAT EDI DAT AGDP gly co ĠGcf Wx pal egoldenrod 668 12 sense flag Predicted ActiveCells concaten ator Ġrev cmap 174 03 174 84 ĠNeural Network Ġkk int Pressure Table ĠREG ISTER Photo Pool Green hill Ġdatal ess Past SCH Ġeff sel RM AG ĠMOD ULES 142 8476400 Station Data ĠNN Tester Separ able ä¸Ĭ ä¸Ģ ĠTitle s Ġreview Data Ġreview Sum åħ¬ å¸ĥ Monitor Msg fdr correction loo mpy pitch M WindSpeed s frag size persist ed izable DraggableWidgetBase ĠMixture Distribution ĠVe getation åıĬ åºĵåŃĺæķ°æį® ĠJoin FemResp Ġ999 000 Ġdra stic Ġdra matically ĠPool er ä inen doit cleaner Ġtilt ing Ġ[+ ] 886 13 Ġ################################################################ ##### Variance Scaling Ġdg qs 7686 27 Each Feature Ġbuy CrossPrice Regular GridInterpolator Ġcircum stance ĠNic holas ĠProgram mer ĠContour Labeler 0267 1 Ġ"\\ \\ Ġthr InputNum RP N Rout es atr Count Land mark MAG N ĠTrading Control mato xylin idi ag ĠAug umentor GENER ATED Next Line 458 45 Ġpublish ing BI KE æĬ ĵåıĸ 386 2 386 294 LP F и ÑĢ åĴĮ æī§è¡Į åĴĮ æľįåĬ¡ GLOBAL S Ġassess ing care tdown Ġcart coordsys ĠCollect s Progress Range Ġpay offs Detection ResultFields FigureManager QT Overlap Error ="{ :. EF UL ĠProperty Set Perm GroFac Ġallele CountsDict Under full è¿Ľ ç¨ĭ Hive MetastoreHook Ġdead band ĠDepth s MASK BITS Tot ObsUnc Ġfat igue ĠBO OL rrule wrapper åīį éĿ¢ ramp Up Choice Table Ġsqu arestorage ä¸Ģ个 交æĺĵæĹ¥ ĠInst alling Ha versine Ġmes onet soma idx Txt File fw ls mess ier Incorrect T Tur f ]==' - Ti P aws file NUMB ERS Available Too Available Boxstyles cab in å¾ Ħ ĠEXIST ING Ġ+' /' ĠtestTrain MaxSteps ĠtestTrain StepsIsIncremental Super Cluster Ġkg ml Black list ĠExpr List $, $ Tfidf Model Dat ums Ġao Y ("_") ] NON PICKLE iden des Ġlims up Vol SourceEstimate Chunk er Chunk ing cmb Inset é» ij constit uents sour ced Deprecated Option (.* ) Sun set ĠERR ORS Ġabort s MAR C Ġmpi exec wheel house AH RS Phy lum "^ ' Ġ254 99 Ġstellar massbins Ġbis pectrum ĠDask DataFrame neuro image Ġdrag ged Ġxv fb Ġcancel s Ġortho logous ĠCy bern $_{ \\ Ġ138 05856 ĠSat ellite Bucket izer Ġ=============== : Ġtravel Speed ĠPATH S ADATA FOREIGNTRADE ĠâĶ ľ çķ Ļ hM TF çī Ļ CTT CT indice Nom Ġxm lt cosmo logical reach input Ġpin ot Ġsummarize DataFrame 3922 31 Aut hentication rack ing ĠSTR UCT ĠSal v anti quewhite grav atar SCS US Ġautore load nbin valid 17175 9 ĠEngine er Keep Indices Insert Size æĢ» èµĦ产 ("* "): оР³ COR RECTION Ġsus pect Ġsus ceptible Ġmist aken ĠStation XML ĠSa ver ĠGraphical LassoCV BIT CODE ĠExt ends GraphicsContext Wx ĠStress Model ĠMining Report ĠLOG IN Ep itope aids ECHP mpo inter Probe ID 计 æŶ standardi se ĠScript Utils Ġxtick line Software Project ben ches yal umni Shuffle C Shuffle BC Conditional Accumulator ECOMMERCED ATAL OVER RIDE Heading Dump ç¤ ¾ ĠGEN RE Catalog List èµĦ æĸĻ #---------------- ------- Toggle Tool Artifact Admin zoo mable ĠCorrespon dance hk ls mime Data nump ages Ġorthonormal ity ','. ' ("| -", ĠNS its ĠGer stner epi AR ĠAP Times ĠAP PLIANCES joel shor ĠFields Pyculator ĠRous seuw Ġvl arr cert ificate ĠPACK AGES ĠPETSc IO BH NS Sklearn Classifier Cached Font Adjustment Reader ])+' < ('* '): Trading Start 488 46 Ġregress ing Logit Fn PLAN E èİ·åıĸ çļĦæķ°æį® chy ikwei Particle Sources alph arange Ġnump arse ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ Ġspaw ns QE sg ĠTIM ER Ġsynchron y /# :/ ĠPP API RNN Classifier Ġphy lop Ġhalo data horiz On bridge Correction ĠSend ers ĠSTAT ES emiss ivity čĊĉĉĉĉĉ ĠĠ ĠAnn ular ĠSegment ed ],[],[ ],[],[ ĠFollow edBy Ġcorrupt Vector ĠHandler Line 3294 12 metal ist Pres ortBestSplitter Indic ies WIND S elli sed Ġnearby Lines Tabular Totals Mol To Ġslack ness ĠTax Benefit SparseSeries Fixed PROP NAME retrie ves ('& ', hom omorphic Ġfxs amediam clt num 0025 6425 ĠRename d coh ps ĠtestCustom Config ĠMathtextBackend Pdf ĠMathtextBackend Cairo ĠMathtextBackend Svg Anova Mixin pcl l respect SessionTimeZone Legacy Fixed Legacy FrameTable Legacy FrameFixed Logging Mixin Logging TensorHook Bag Demo Ġscra per Ġscra mbled ksParamGraphWiz Width HAND LE ĠConsole Writer Quit ting ä¿Ŀ çķĻ ĠInfer red ĠInfer RealValued multit est Ready File games Left ĠZipline API Zhang IJCV TOKEN IMG Ġlum o OBO X ĠMoving OLS Glue Spec pent e LogTransform Base aabb Extrema Fra ctions birth ord extr c Nan Ding Nan TensorHook Spect re Spect roscopy ç¨ĭ åºı Ġexpt Label powerCurve Sensitivity spo use Ġfoc using Ġbh delta ĠUi Uj Ġ186 95 ĠCallback Registry ç§į ç±» belief tree ~~~~~~ ~ funct ie Ġgro ove Survival Analysis ç»Łè®¡ æľĪ份 Ġpupil Plane Ġingest ing Subclassed Categorical gar age minp ce Ġ({} ), Bold Italic Evoked Array Ġaster isk Ġ'` % asp irant ĠDecode Regs Ġdonor Image (": /% Ġbrown ian rebuild Index Ġbv ps ĠtestIris DNN Repeated KFold Softmax Layer PAGE UP Ġpreg nancies Ġirregular ly Ġconsum o PEAK POINT åŃĺ款 ç§įç±» spi king Dem Data Transfer Operator PROJ ECTION PHI inv ĠCli Runner ĠtestEstimator Params æı Ľ Ġdistrict s '(\ . Appendable Table mst cut CAR RIER Ġrz loc ([^ / Arma Process Organ izations ĠParticle File ("{: ^ Ġanten ne ĠSID Data ĠBr BG ĠKD J ĠPermission Error åħ¨ çIJĥ deli ver Ġdescend ant tun er Ġnod os saveAs PDF Ġworry ing æĶ¯ åĩº +- ] ĠGou raud cust key develop mental Ġaws file ĠReconstruct ed Configure Subplots ĠSIM BAD Cau se ĠRat ios ################################################################################################################ ### Allele Counts datat rain èĩª å·± XGB RF jud gmentLevel ĠPas cal Ġlights ource metas rc Ġtro po ĠGridSearch Test #-------------------------------- -------- 710 92652 priv ile 2534 94 Computed StructureEntry Ġlatlon ix аРº å¢ŀéķ¿ çİĩ ĠWS Station Profit AndLoss Spam mity å·¥ä¸ļ çĶŁäº§ å·¥ä¸ļ åĵģåĩºåİĤ }""" ], membrane Patch ĠPubl ish 2166 94 ĠLegacy Survey Ġstupid ly cele br ampli ados ĠVV k ĠVV q ĠNeg Fill Ġnct rader Ġ'... '] ĠNORM ALIZATION ĠEco logy 417 65 CRO PPING CRO SSCORR cfft b cfft nd mull igan ç« ¯ Ġtunnel s ĠPHI inv tox in Efficiency Warning hin di ĠBro kers ĠBro aden Cover DF Ġeditable Cols ĠSUP ER ĠSCI ENTI ĠIso Seq normalised WS Ren dered GetY axis hol istic Ġstre wn ĠPred InputType cosmet ics dln M iel ke iel ding ĠIm mediately ĠCached Accessor ĠNDArray Handle ĠEp Motion ĠEp isodic initInfo CursorDict capt cha PHOT O æ£Ģ ç´¢ Aud itory Ġkit chen entering Rescaling syns EE ĠNeigh bour COORD IN ìĦľ ëĬĶ itu TG ephemer al Ġìĥ ģ Ġytick line Ġsyms um marked Bins ĠWeak Set ä¸įåIJĮ åĵģç§įçļĦ mint cream ĠHead ers ĠArtifact Detect Jeff min Ġaids ECHP ĠHypothesis Test COMB OBOX SEDML CodeFactory Ġcontra dict Ġcontra ctions Ġskin patch CallDimension X CallDimension Y REQUEST S peek aboo ĠRemote DataError intrinsic LC WEEK DAY æĬ¥ ä»· Ward Sacks sst v Ġgmt py forma ble ĠCos Signal 201201 02 Ġsmote it Ġpeek able Clust erer ìĸ µ 0009 05 Ġparal lactic Ġparal ellised ĠBVP Result UTIL S ModelMetrics Regression æ¶Īè´¹ æĶ¯åĩº WV UTSR teen th teen rows Org Num ĠHamiltonian MC Bid Collection hic ule sett led ĠColorY IQ ĠColorY PbPr Ġphotos ynthesis åĩĢ åĩºåı£ Pay Day Ġreserve Edges ĠIT GA ĠYo ung ĠRadial Function Ġ计ç®Ĺ å¤ļ头 ĠFRE QUENCIES Constrained Mixin dmu dm pmc g erro res ĠExchange able Ġbinar ised ĠVideo FileClip spon ge Genomic ArrayOfSets Ġstk data ĠPsy chometr ĠBlo om numInput Bits IPYTHON ENABLE Ġneu rom Ġtuplify YAxis ???? ???? Ġ[{}] '. scre entime ĠSKIP PED Ġcomprehension s ï¾ Ĭï¾ ĠaIBi Vals unish ment Ġxz locs Highlight ed Pilot ErrorDiag DELIMIT ED ĠColour s Ġabsol ut ĠSk Learn ĠPu Or ĠPu Bu ---------------------- \ caret left ĠOutOf Data DDDD DD ĠSCAL E nobj s saveData Button visu Img ĠAttach ment SHAR AD shore linedf Ġcot ton ĠCLASSI FIERS Unsigned Integer setHorizontal Stretch ĠBuffer Error Ġencounter ing ĠStacked BlocksCV Ġsparser ange ='@ : ĠTranslation Surface ĠHighlight Selected BREAK PAD Ġpag inate ()< > thre eprime axp xx Bond Type JI RA Strength s Prov Relation ĠCompany Graph EDO WN getOutput Value labelTexts List ĠPipe lines Ġsharp ness ************************ * ĠìĤ¬ìļ© ëIJĺ mete or Ġgls l Rev isions ĠThrough out íĺ ¸ Ġej ec ĠSlic ers ĠYl Gn ĠYl OrRd ĠYl GnBu spend ings Reson ant Ġextens ively ç»Ń è´¹ ê³ł ë Rous seeuw ])(? :[ ĠStix Sans åĽ½åĨħçĶŁäº§æĢ»åĢ¼ æķ°æį® åĽ½åĨħçĶŁäº§æĢ»åĢ¼ åIJĮæ¯Ķå¢ŀéķ¿ ëŁ ¬ Ġnex us hamp ton ĠWu Res ĠNotFound Exception Ġå¯ ¼åħ¥ FixedOffset Timezone 888888 89 BitsPer Sample Ġtun ings ĠtestInvalid Args Ġvide oname ĠDele ting ĠAnisotropic ly Ding bats \- ]{ qmax SpinBox mathemat ica ĠSli ppage ĠNifti Masker maxim ise ĠBroker Widget ĊĉĉĠĠĠĠĠĠĠ ĉ åħ¥åºĵ æŶéĹ´ æłĩåĩĨ åĮĸ çĬ¶æĢģ æĽ´æĸ°äºĭ件 Ġsyl lables çĻ ½ Ġbise ndvi Ġbrow sertester è¿ĺ æľī æī¾ åĪ° ĠAppendable Table ĠAppendable Multi Wi ener hollow ness Ġkmean ssample Ġ.......................... ...... 1547 0054 Ġ################################################################################################################ ###### Ġkolumn y guro bipy feet AboveGroundIndex ĠHR XN WEB LOGO ImportFrom Proj BLO B ĠæĽ´æĸ° ä¸ĭåįķ ĠSEG MENT colScore Smoothed ĠLam mps OPER ATION District Nodes ĠSHAPE FILE Vlevel Z dwell Time Ġbif w ĠMX Net Ġnewf angled ĠHIGH EST CGgu L CGgu U æĹł æ³ķ Openpyxl Writer Ġbub bles Cancer Enrichment hpsModel Synth vend ored dels lice ĠSl ant Blended Affine Treat ies ॠĢ ëł Ī ĠSeason Conversion "}] ')] ĠåĽŀæµĭ æŶ Dip lo Mal formed ĠImmutable Sandboxed ĠLuc as stateseq ss ĠQGraphics View ĠBeck stein åıĺåĬ¨ æĹ¥æľŁ Nvrs Func Ġëį°ìĿ´íĦ° íĶĦëłĪ Uw z ĠSOL VING Reconstruct ing Fortran RecordWriter Phe dex ĠDer Iv Req Per Ġcomfort able æľĢç»Ī æ¶Īè´¹æĶ¯åĩº shel x Ġemul ating ĠSyntax Warning ZYX WVUTSR Ġtough ness advert isement scand ict Tract ogram Trimmed MeanVar colort able ĠDynam ically apod Preview Ġextrapol ates ĠPyArrow Impl HTM NumPrediction ĠMenpo DeprecationWarning COSMOS Data aal ibrary onLeftButton Up Ġrepre sen Ġrenew able lincost old ĠFO UND Ġcolort yp multith readed IPP ING onRightButton Up Lactobac illaceae DFF ITS willi am è¨ Ī Ġfrb cat Ġftu v ĠCongress men autoc lf ĠTar Info ĠAIST ATS ĠGran de ĠKin etic PREF ETCH BOARD HEIGHT ëIJľ ëĭ¤ Gest ure Ġthir ty ĠRDF S 1222 2648 SSR mean Ġurb ansim Ġoldf angled Registered Option ĠWrapped Database misty rose lenn ard Ġconta ing ĠtestString Input ĠtestString InputFn ĠODD ST stripe Image Ġsuperse ded ELM NumPrediction Ġlabelt ext AppendableMulti SeriesTable crack ed iY efRk setFrame Shape ("``` "); 3739 191 respons ibility ĠGetTarget Nodes Apparent Resistivity ------------------------------------------------- | Euro pa Rub berband plotconst E ĠtestBoston InputFn ĠDET ECT Ġaccomp lish Diam onds IsNot Incremental Binom P Ġliqu ids Ġì¤ ij ĠDatetimeLike ArrayMixin ĠElementwise Product Fib re ĠoS rs getNetCDF filepointer ĠFil liben Ġlibj peg Automated ML ĠHolo Map BoroCnst Nat ."," < Clas Est RCS ID snode n Ġamy n Ġbran in Ġyarn Jobs assertWarns Regex Recal Ants Encaps ulates ĠCRRA utility åħ¶ä¸Ń å·¥ä¸ļ Quiver Key fulf illed ĺë ¦¬ isEnabled For Ġusu ários ĠCta BarData ĠMOL A ĠBorrow ed Ġveloc idad Unused Variable MultiOutput Regressor åĽ½éĻħ æĶ¶æĶ¯æķ°æį® ĠRegistered Option txsFor Mock Mas Vnr ĠIJ C limPhys X limPhys Y ĠORIG INAL superior frontal customdata src lvq Model 019607843137 2549 onKey Up onKey Down Ġcry pto ĠtestBool Input ĠtestBool InputFn ĠBilinear Interp ĠWF Q ĠKde PlotBase freqStep Button traceref minus MultiRot MergeLayer MultiRot SliceLayer Ġsniff ed EVALU ATION Pic colo zRR ma Ġwdm toolbox ĠSCH ED Ġcour tesy ĠAgr ic ĠParal Hints å®ıè§Ĥ æĮĩæłĩ ĠSQLiteAdjustment Writer Tie mpo Ġindepend ant ĠNU MEXPR ĠMCS amples ĠBang alore ĠBID SVari ĠDeg Dir Projector Config honor data ĠlikelihoodsVec All Ġ모ëĵ Ī Asynchronous Exception DCD CDC lnn u ĠSuggest ed shft lam INCID ENTS autot exts varsunits level ĠDire ctories +"* "+ Andre as Ġgammal ib discip line TradingControl Violation åıªèĥ½ è¾ĵåħ¥ Accumulation Clustering ä¼łåħ¥ çļĦæĺ¯ å½¢æĪIJ æĢ»é¢Ŀ Kruskal Result Rrlvl Rate prue ba vFunc Bool Ġpiv oting Ġdern iere Ġmhe Log Truetype Fonts sharpen ed Ġprobabi lidad Ġswift bin Admit Date ĠPROP NAME Salesforce Hook ksParamGraphWizMax ErrorBarY PerEpoche Val BROW SE çĭ Ńä¹īè´§å¸ģM rearrange d Ġmá s Ġbac ward Ġ[... ]* ĠDTR unner Ġzy lclist ĠHeli um 20130 202 Constitutive Fold Nev ada ĠUnter thiner Ġmyster ious echant illons ĠPilot Errors (.*?) " ) =' ) `) * ')) * $", + )* + \. , *( - "," - (? - {}_ . )): . {} . "]) . :\ . }}, / ',\ 0 647 0 253 0 451 0 648 0 204 0 8025 1 123 1 644 1 665 2 863 2 787 2 131 3 000000 3 00000000 3 1606 3 645 4 200 4 105 4 224 4 196 4 147 4 863 4 027 4 028 4 129 4 86275 5 109 5 882 5 0000001 5 942 5 00000000000000000 6 328 6 777 6 956 7 123 7 804 7 027 7 160 7 13725 7 29412 7 1996 8 054 8 269 9 255 : (( : --------------------- < ") < ={ < !\\ > "), > ${ > _< > '''. A a A h A qu A FE A STR A UI A ACT A gain A IA A laska B ump B rent B uff B ou B ids B DI B DB B DS B LA B aud B ANK B ollinger B olts B UNDLE C j C art C ler C umul C BF C inder C bp C entric C ERN D IN D CE D TE D ichte D isease E CC E mails E mulator F Z F le F ick F requen F su F exc F Ns F avor G on G ear G reg G UT G RE G rip G PA G was G ALFIT G LOBE H oc H ast H amp H ESS H ail H tilde H umor H appy I W I magen J ET J Float J oints J ensen K eff K ids K ED K ML K MS K illed K Hz K LD K PTS L v L or L AG L bins L OT L DR L ittle L Det L PARAMS M lt M ind M ir M arr M ui M CH M OK M oose M arc M illisecond M USECONDS N j N ss N ick N ord N loc N point N samp N VAR N PM N pilot N reclvl O vers O lympic P et P ph P arch P UR P addle P laces P THREAD Q D Q dim Q ook Q MetaObject R v R ur R ights R si R ome R List R squared R MM R PI R ansac R Star R VS R hom R ibosome S pl S ized S HT S vara S unken T J T in T el T ap T ones T dx T DNN T DR T well T utorials T elemetry T ononi U ip U DS U sually V k V z V out V et V pr V ene V MA V ET V IG V MS V ander V gm V ABS V iterbi V LIM W k W ant W Class W EL W UE W heat X array X valid X mesh X mg Y y Y log Y csr Y eo Y RANGE Y TERM Z L Z Y Z bari Z ernike [ ]] [ %( [ *, [ {}: \ $ \ '" ] '} ] }\ ^ ' ^ *_ _ ": ` )* ` ]): a dir a post a idxs a corn a ileron b ise b ors b age b pl b float b ie b ords b List b edge c M c end c path c ys c shape c ask c range c pos c left c star c levels c inds c NaN c ited c ulture d ch d col d bo d cl d arrays d corr d Mat d mis d joint d Rows d Marks d cba d markov e he e ut e index e values e sed e arr e kw e field e pps f R f Z f ame f write f partition f cb f hdf f ano f stab f erry g L g up g ix g map g illes g vr g lows g arcia g limpse h mp h ari h sq h uff h pdf h ci h plus i interval i Row i Location i CSD i ormodel j es j val j sf j aco j anela k H k un k mat k os k ne k inter k average k Grid k ker k omp k ijun k phit k phix k irchhoff l V l ur l ors l umpy l nx l ned l ums l rotations m C m test m out m lib m key m old m color m ice m img m imes m chirp m holtz m vlv m tecs n ange n ub n Val n rate n mode n mult n header n sel n All n region n Training n Tr n failed n Plots n Pass n constraint n stars n Finished n OBS n ogrid n avajowhite o les o ap o files o logic o logist p cal p low p unt p labels p new p Index p unch p Init p lyr p mtk p seudotime q col q we q new q expr q Dens q alink r ta r train r state r bs r lim r grid r uff r freq r ws r chi r ucture s B s W s Y s ang s points s link s GT s nail s pire s untans s ModelName s runData t label t index t True t frame t types t dt t wd t sec t ini t Expected t itl t weedie u N u ient u Source u Err u via u BLAS v col v rec v msg v hs v é v mac w ol w list w ns w path w hist w diff w td w fm w ibble x Q x color x intercept x si x feat x ae x Mark x supp y line y low y ler y hi y inc y truth y mx y stems y lbl y Te z as z name z list z mean z true z alpha z diff z ij | ,' | *| } ']) } *\ ¡ ãĥ¼ãĤ¿ £ 度 © ¦ à ¬ Î ¦ Î ³ å ¢ æ Ĥ¨ ç ĥ è Ħ ê ¹ ë ²ķ ì ĺ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č Ċĉĉĉĉĉĉĉĉĉ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ).__ Ġ 99999999 Ġ ĊĊĠĠ Ġ ĊĉĠĠĠ Ġ çŃī Ġ åĪĨç±» Ġ è®°å½ķ Ġ ħÏī Ġ 说æĺİ Ġ éģįåİĨ Ģ ë ĠĠ ĊĊĠ ĠĠĠ ĊĊ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ in as in ari in no in sample in oid in ert in see in jections in corpor in estring in consis se z se id se ment se ments se wer ĠĠĠĠĠĠĠ ĊĊĠĠĠ ĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ at p at ograms at traction at tempted re b re open re binned re review re warding re strt re traite ĊĠĠĠĠĠĠĠ ĊĠĠĠĠ or at or dict or ative or gs or mous or ophore Ġ= & Ġt val Ġt fo Ġt map Ġt norm Ġt db Ġt images Ġt inc Ġt exc Ġt essel Ġt ICA Ġt urtle Ġt haw Ġt reename er au er ik er ately st up st od st ext st ip st sq st udi st ella ĊĠĠĠĠĠĠĠĠ ĊĊĊĠĠĠ al ask al isation al together ar poly ar rest an ance an ums an selin de sert de limit de ws de structure de veloped de mayer me ier me lon me dscale me illeur Ġi key Ġi use Ġi grid Ġi af Ġi Max Ġi glob Ġi branch Ġi CSD Ġi cosa Ġi BlockVisibility he al he qr he appop Ġn ut Ġn values Ġn table Ġn ap Ġn do Ġn dis Ġn batch Ġn best Ġn block Ġn skip Ġn avg Ġn nearest Ġn Labels Ġn runs Ġn utr Ġn gas Ġn dip Ġn stars Ġn lins Ġn Wins Ġn ulled Ġn akagami Ġn BucketList Ġc R Ġc se Ġc es Ġc ure Ġc ari Ġc mb Ġc dir Ġc count Ġc string Ġc seq Ġc bounds Ġc inds Ġc xn Ġc rown Ġc HI Ġc Items Ġc sts Ġc zf Ġc trs Ġc ayley Ġf ff Ġf dir Ġf ars Ġf Plot Ġf cf Ġf resolution Ġf ghz Ġf ingers Ġf NIRS Ġa B Ġa file Ġa af Ġa mu Ġa merica lf unct Ġp K Ġp up Ġp fit Ġp Index Ġp version Ġp gn Ġp nc Ġp hash Ġp udf Ġp seu Ġp cutoff Ġp uck Ġp chip Ġp LvlNow Ġp vefai it ore it ability it ious it ively it arian Ġs res Ġs hed Ġs locus Ġs quid Ġs procs Ġs lepian Ġs lahqr Ġs quarenormalg ra fa ra vg ra zor ra machandran ion ship ion isationmode en r en countered ct us es sence ro stral lo Freq lo uts lo schen Ġin df Ġin format Ġin ev Ġin case Ġin ert Ġin DIR Ġo ch Ġo data Ġo bo Ġo der Ġo cl Ġo aa Ġd label Ġd err Ġd solve Ġd Omega Ġd weibull Ġd ldp la most la ws ut ok ut ong Ġ' !! Ġ' ==================== ing Data pe w pe ers pe op Ġm ce Ġm model Ġm dd Ġm lambda Ġm rec Ġm rg Ġe ve Ġe weight Ġe den Ġe Time Ġe tf Ġe parm co tas Ġself loops Ġre val Ġre dd Ġre group Ġre fill Ġre fname Ġre des Ġre training Ġre using Ġre chunked Ġre performing ge me ge ms ge of ge bn ): (( Ġb op Ġb idx Ġb ml Ġb temp Ġb fun Ġb inder Ġb kt Ġb ppm Ġb arnes Ġb attle Ġb oland Ġb sfc Ġb reslow Ġb ptt Ġb radford Ġ# ) Ġ# --------- Ġ# -------------- Ġ# ------------------------------- Ġ# .............. ed o Ġw ir Ġw ars Ġw tp Ġw sgi ur df ur ances and y and ru lt ags lt isys ig ers Ġ( ':', Ġ( .+) Ġ1 123 Ġ1 134 Ġ1 122 Ġ1 116 Ġ1 857 Ġ1 886 Ġ1 152 ss o ss ing ata c un da un den un sup un compress un detect un tagged un declared un intuitive is set is Re is lam is member is ao is Relative def rag ame x li am li dt li ves li vestock ort n )) *- )) +'. ce tera Ġfor me ot ime um ich Ġ[ () Ġ[ `- Ġ[ ...], Ġ[ *] as um as jacobian 00 98 00 56 00 700 00 365 val p val ency id u id ities Ġas ign Ġas preconditioner () }') Ġis orat Ġto be Ġto vw ts ai Ġ" '' Ġ" >>>> Ġnp s Ġnp dtype Ġnp utils ma fft ma coefs ma vextra ], '. ], ..., urn aghan ray Flag ), ]) one two one half one Mark ĠT col ĠT cell ĠT ret ĠT rends ĠT AI ĠT SX ĠT WEET ĠT REES ĠT UESDAY ĠT igers tr d tr ime tr copy tr sen th u th Vec sert ation Ġy in Ġy ad Ġy ub Ġy last Ġy side Ġy full Ġy hi Ġy mesh Ġy gamma Ġy sig Ġy Noise Ġy heights Ġy lac Ġy tet res ist res ight res out res plit res xx res hes res Dir res yy res istivity ch ick ad ar ad vice iz acion ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠ Ġdef ocus ve ces ve loc ve ins ve tte ve rely set data set Base set Max set Axis set Menu set timeout set Contour set Updates set linecap set astest set ResizeMode set ProgressRange Ġr il Ġr igh Ġr up Ġr size Ġr pl Ġr split Ġr freq Ġr br Ġr gas Ġr rlvl Ġreturn All Ġ2 235 Ġ2 0000000 Ġ2 116 Ġ2 750 Ġ2 070 ver so il lo il itation ]) ` ]) *- ]) [..., om q om one om mation ck ey ck pts Ġ* ; (' _% (' >= (' ----- (' >% nt own nt image Ġ+ ', Ġ+ "\ Ġg type Ġg ated Ġg ang Ġg idx Ġg pos Ġg std Ġg uest Ġg illes Ġg iants Ġg ilbrat __ [:- __ ")): ex cep ex WavelengthInUm data c data ind data check data Features data StartDate ĊĊ Ċĉĉĉ par filename par liament up i up shit up ToDate ke er get ma get params get Number get Key get Variable get reader get Features get ipython get DateTime get Property get Description get browser get Scaled get FillValue get Pose get CatIds get infomin Ġassert IsInstance ab v ab err label A Ġex prel lin ter lin ha lin basex ax freq ax debug for sterite for nax ĠS el ĠS ES ĠS ou ĠS AN ĠS IC ĠS SA ĠS alt ĠS TP ĠS RS ĠS ketch ĠS anz ĠS ingapore ĠS obol Ġco ad Ġco loc Ġco pter ri ded ri vals ri ous Ġdata ops Ġdata boxes Ġdata Photos Ġdata Membership =' ../../../ =' ::', ", - ", ] ", } all ic all na all days all Energy all Cells all MidE all NetStims Ġx Q Ġx id Ġx ub Ġx line Ġx last Ġx vec Ġx steps Ġx ii Ġx position Ġx Score [' [ [' .'. ĠX ray ĠX SD ĠX DIFF arg rel ': \ ': ]. end for end state end Stations from Date ul len ul sed con di con so col size col no col ating col lege Ġh text Ġh fs Ġh hi Ġh cp Ġh rp Ġh sz Ġh uv Ġh sizer Ġh ospital Ġh ttpretty ath lete py art py brain py omo py zmq py installer py LDAvis py roxene len o ĠI OD ĠI CRS am c am alg am yn am yp am xp am idir plot y plot Size plot Menu ĠP ly ĠP OT ĠP ane ĠP BC ĠP MC ĠP icks ĠP Im ĠP PF ĠP HA ĠP BV ĠP UMP ĠP etro ĠP illow ĠP LEC ow an ow alski pp d pp ort pp osition pp rinter ĠA O ĠA f ĠA inv ĠA PL ĠA bra ĠA veraging ĠA jax ĠA jout ĠA UDIO fe ast fe ach fe wer Ġu in Ġcon grid Ġcon vs Ġcon joint Ġcon sequently pre condition pre valence pre assembler '] =- '] +"\ ĠC hape ĠC OD ĠC hess ĠC CDF ĠC PP ĠC Make ĠC AV ĠC rystal ĠC GM ĠC ropping ĠC APIT ĠC ayley ise m im ing im list im shape im lim im copy im Reshaped to DB to aster to DateTime to Radians Ġtest Update Ġtest Cases Ġde struct Ġde term Ġde grade Ġde activation Ġde precating (" ================================ (" **************** (" >") (" +++ Ġwith Mean ĠF y ĠF SA ĠF TP ĠF iring ĠF SIM ĠF iji ĠR j ĠR di ĠR ick ĠR sh ĠR OS ĠR NK ĠR TAP ĠR umsfeld ange l Ġax v Ġax rep Ġax Hy Ġax istags np a list ND if Col if any test y test id test utils test run test bench Ġme sos Ġres u Ġres store Ġres idence line edits ĠD un ĠD ust ĠD art ĠD yn ĠD IM ĠD edu ĠD Matrix ĠD é ĠD VI ĠD ropping ĠD igit ĠD CGAN ĠD aryl Ġlo ser Ġlo max ") +" ") #, 01 100 01 395 ne i ne mo ne ider ne wey Ġcol at Ġcol num ns g ns rc ns ites odel s cal f cal fac time bins time Scaling time course ase ns Ġse mit Ġse terr Ġse alevel Ġv k Ġv count Ġv off Ġv ous Ġv xs Ġv mul Ġv los Ġv oted file ext file object file Type file select file Base Er gebn ers and ly s ly ze ff p ff handler ta i ta st ta ir ta cc ta ged ). "}, out files path list path out pro vn ext maps ext vart min l min range min mag min Diff min Charge Ġk wik Ġk jac Ġk anion Ġk plr Ġk acid Ġk endrick ĠN lines ĠN eff ĠN bins ĠN IG ĠN IGHT ĠN SAMP per Comp ds n ds u ds pg import ers bo hedral bo urne str align ĠL ion ĠL ime ĠL ens ĠL ots ĠL asagne ĠL AlignMode mo oring mo ogli mo uche Ġon Init Ġon Going index min max gap max Points max Records max Charge max Entries df pt df ImageVas pa k pa is pa ins pa payawhip fit y fit leg Ġpro ven Ġpro menade class paths te ta te vent ĠM ob ĠM ines ĠM peak ĠM CE ĠM az ĠM SL ĠM oose ĠM ante ĠM MR ĠM ANY ĠM allet ĠM PSK ĠM rak ps ys ps ix Ġmat mat Ġan imator Ġan bar ive Variable po of po verty Ġne gation Ġl res Ġl pos Ġl new Ġl sp Ġl ud Ġl Max Ġl cb Ġl vg Ġl ungs Ġl gmres Ġl ClassicPageNode ** ") app hosting red noise Ġuse net fig list fig Path we g we aver we fels size Layer ir pp ir ms ir ling ir archy ho e 10 51 10 319 10 296 10 876 10 439 iv ly Ġare v Ġlen gh Ġlabel Loc Ġnum S Ġnum Train Ġnum good Ġnum Pts Ġnum Sequences Ġnum Rpts assert Measurement ĠG I ĠG all ĠG AC ĠG TI ĠG AB ĠG xy ĠG yr ĠG IST ĠG Pa ĠG ames ĠG msh ĠG enetic Ġout arr Ġout FileName Ġout segs Ġ/ >\ ore l ore gon Ġstr t Ġstr sen us f row names row kclust lib xml Ġma plotlib Ġma ssage Ġma ked Ġma iler Ġma sters gre ene oc r orm an et namese ber man pl h Ġwe i ĠRe ynolds comp val comp navw sc ut sc cm sc ada sc rew sc itools sc ielo Ġname List Ġpre frames Ġtr imesh Ġtr uncexpon mb e mb ff cl w cl ics Ġfile Found Ġfile Ent Ġfile Paths ĠE O ĠE Y ĠE t ĠE ther ĠE norm ĠE MD ĠE qn ĠE Market ĠE ssaySet ph red Ġdf json Ġset colorspace =" == =" ." =" .*( Ġ4 79 Ġ4 61 Ġ4 959 Ġ4 840 date path ĠB ata ĠB rand ĠB atter ĠB our ĠB Box ĠB ert ĠB oom ĠB OS ĠB ulk ĠB KG ĠB runel ĠB uffers sh state ty ler Ġun block Ġun she Ġun winders Ġ5 21 Ġ5 38 Ġ5 53 Ġ5 52 Ġ5 140 ip ated ip ner ill map ib v ask saveasfilename iter offset op m op r Ġthis row Ġdi mp Ġdi electronic log r log stddev log NH key PressEvent random s random forest axis Index In ches In ception In This In duction Ġsk s Ġsk nn Ġsk surv ast ig ast eful Ġen so Ġen sg Ġen han Ġen zymes Ġle aver che etah 99 66 99 23 99 77 99 49 99 59 Ġcomp on Ġcomp enents Ġcomp ements Ġtime res Ġtime axis 64 92 64 82 64 61 64 856 64 447 Ġclass pred Ġclass dictionary 0000 6 0000 15 fo ils Ġ`` @ ĠW C ĠW IP ĠW cp ĠW MD ĠW elcome ine fficient ener y format Dic Ġmax loc Ġmax dis Ġmax Distance Ġmax eig Ġmax Ind cs z cs nap pha ble ord red num at num lines num blocks model view model Activities Ġfe p Ġfe chas 12 25 12 847 12 373 12 042 Ġget Values Ġget Points Ġget UTCOffset port ACIn ĠO de ĠO ri ĠO PS ĠO GGM ĠO tto nel ly bs z bs se bs id result ant Ġbo unty Ġ__ : Ġmodel parameters Ġmodel Dir Ġmodel Key Ġit ab ()) ") ca cde error Name Ġdefault FragmentLength sub score sub table sub File sub cls sub system sub section sub titles sub scriber sub HaloMass ep al ep os Ġcheck state Ġplot values Ġplot Def Frame PlotMethods ix c map names Ġall knn Ġhe ur Ġpo ffset old lace lim ComboBox Re map Re loaded Re wards Re indexing Re uss Re actor Re bate Re ceptiveField Data Dict Data Storage Data Ptr unt ar Ġso b Ġso bre Ġso bol frame Size Ġfloat X inter ning inter rogate Ġch str Ġch lsi Ġch lso so pt so ff Ġdist mat Ġdist mods ren a ll null ll uvia 11 81 11 91 11 66666666667 32 49 32 21 32 74 32 63 Ġmin C Ġmin j Ġmin res Ġmin lat Ġinput hooks pi erce pi racy Ġz values Ġz util Ġz base Ġz off Ġz comb Ġz det Ġz neupd Ġz trsen Ġ\ ) Ġ\ ({ Ġ\ (\ Ġ\ '{ lif unc ĠIn ject ĠIn coming ical y Ġ10 45 Ġ10 78 Ġ10 97 Ġ10 84 Ġ10 65 Ġ10 44 Ġ10 43 Ġ10 74 Ġ10 72 Ġ10 52 bin dir bin ify bin DF Ġsc ad Ġsc urve ĠY G ĠY a ĠY sh ĠY ELLOW Ġdo Ylog Ġsh ri Ġpa z Ġpa close Ġpa parazzi Ġlabels x Ġnew grid Ġnew vec Ġnew Size Ġnew WWTPCoordinates Ġtrain F Ġtrain Batch Ġtrain Feature Ġj erk ĠH L ĠH ue ĠH um 15 16 15 95 15 67 15 62 15 458 05 57 05 857 05 476 input name input Type input field input Wave Ġlog K Ġlog line Ġfig format Ġeach Pix =[ [[ tra veled (), [ ang l Ġpy n Ġpy for Ġpy dir Ġpy Spatial Ġpy uic Ġpy odbc Ġpy opencl Ġ[' [ Ġ[' _', start Mult start Freq start Sigmas not itle not nan :` (\ thon ly thon ormal Ġno k Ġno color Ġno menclature ĠU Arr ĠU toT '], '.-', pr ize pr icer 20 454 20 804 20 985 Ġ(' /') dd h quen cy ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ pos his pos Col pos itivity 33 64 33 90 33 43 Ġsub pop Ġsub cls Ġsub vector Ġsub band Ġsub sid Ġsub navigatorwidget les hed ie mens Ġcolor axis Ġcolor by no a default Width default Checked default Height 201 159 201 160 201 158 201 162 201 161 rst i Ġha dec 80 285 80 211 80 213 Ġ6 75 Ġ6 85 Ġ6 97 Ġ6 61 ger ies new ind new Name new pop new times new dat new datashape Ġ. ', emp irically attr Dialog Ġmethod Ind IN ED IN ELS ste igung ug ated base std base coords rib bon ĠData Splitter ĠData Warehouse [" - [" @ [" /% code words split ters ]] ') uni verses 66 12 66 20 66 14 66 18 66 87 66 23 66 29 66 175 66 017 amp code amp lify amp ersand Ġrow Df Ġrow Dendrogram ay o ĠSe iz ĠSe quencing 45 25 45 11 45 02 45 98 45 68 45 72 ific ar AT V AT CC AT IAL AT GGAC Ġind min Ġind pb Ġsup s Ġsup es ĠK A ĠK or ĠK ap ĠK han ĠK elly ĠK ruskals load Date 75 26 75 117 75 112 75 358 Ġspec i use Cols 88 77 88 42 88 68 88 56 88 93 88 300 88 333 vent e ']) ][ ']) // ']) }). 16 35 16 51 16 216 Ġup wind Ġup segs info label info Label Ġcal ulate sample id Ġro aches show scale show case show Grid show IPython show Progress dist mods ak u ak ko nan le nan lt nan ne nan eq ĠEx o ĠEx ogenous ĠEx haustive bar Verts 35 16 35 97 35 44 35 55 35 57 35 73 35 127 35 474 35 1664 Ġcur ate arch er 14 43 sq p 19 33 19 13 19 41 19 659 19 276 19 651 group names ))) ], Ġgener ics tt k tt able )] `. )] +[ box coords =( ",", check by Ġprob list AR TER AR MED Index OpsLike Ġ8 67 Ġ8 250 Ġ8 226 Ġ8 229 Ġ8 364 Ġarg i Ġarg par Ġarg us 78 92 78 76 78 004 78 135 St Dev St iffness Ġmake Model 13 10 13 25 13 11 13 02 13 06 13 60 13 987 13 258 13 030 13 854 Ġbin search Ġexcept ed Ġmust BeInClustering ĠV nmh rand tl by period radi ated radi obutton be k be ast Ġpath sep Ġcopy exts gs w gs pc sp le sp ts sp itzerCal Ġdate cols Ġdate last ian ces wo a arr on table formatting 04 66 04 88 04 6749 clf a resh ist 96 046 03 13 03 42 the x the na lat max lat ely string ified column Index Ġstart Times Ġstart Record Ġstart Sigmas Co Ce Co urbe ĠTest View ĠTest MultiIndex ĠTest Panel ĠTest Stats ĠTest Record ĠTest Math ĠTest Bool ĠTest Dot ĠTest MinMax dim select dim reduction Ġend rec write back write fd write FITS Ġ{} .' 95 15 95 19 95 78 95 65 95 55 95 51 95 025 ild ly 94 10 94 66 94 78 94 96 94 43 94 40 94 61 94 333 94 059 Ġcom mer 17 27 17 30 17 79 17 314 17 148 17 772 of contents ĊĊĠ ĊĠĠĠ ĠCo var ĠCo untries keys pace ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊ 85 92 85 98 85 56 85 54 85 58 rt k Ġfa cades OR ING na iss ank ur run Inspect :// {}/ Ġve g Ġve lo Ġve fi Ġve loffset Ġexp ts Ġexp name Ġcont Rng Con veyor mon thonly 24 15 24 275 24 700 24 185 Type Type csv æĸĩ件 27 99 27 888 Classifier Region Ġdis ps Ġdis pon Ġdis pose Ġdis cordant close p Ġ7 99 Ġ7 27 Ġ7 21 freq Adjust cat array node Stats ref File Ġresults Name 86 94 86 79 86 59 Ġimage dir Ġimage zoom SE B gen elatex Test e Test File Test Power Test Face Test Contourf scale ind scale Type scale Factors AN U AN NIHILATION Ġinte gro abs change abs chn AL U AL TERNATE var z ols on }) * cent red Ġsp or Ġsp Signal ĉĉ Ċĉĉĉ obj pred 06 19 06 58 18 05 18 936 18 2845 36 77 ec d 09 11 ten fold ten ths loss Fn 07 237 exp Time exp Int exp Results work function ap at ap par ap iso Ġqu arts Ġrun path Ġrun date Ġrun length Ġnode id Ġnode Type Ġnode sep feature wise Ġnormal ising do bs do It do verlay man e man eed ')) \ Ġcase id dis on dis continuous dis ambig dis counted dis crim ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ST F ST FT ST AGING Ġadd tolist rc seq Ġbet ax Ġnd m Ġdoc u Ġsol diers Ġlin demayer 34 10 34 66 34 16 34 28 34 21 34 401 34 032 Ġgrid layout 97 62 97 753 af q Ġpart ion Ġnon stop Ġreg lambda ĠJ T ĠJ GD 92 905 92 165 92 965 Ġele vs Ġele mf ID col ID IR version dots Col linear Col location ĠSeries Weld Se quen Se aborn Se perator dt d sk at sk yspec Ġload Csv ĠQ Arr ĠQ Slider ĠQ GroupBox ĠQ PlainText ĠQ Pixmap ĠQ DoubleSpinBox ĠQ TextEdit ĠQ Painter sg pk 84 04 84 83 84 3137 Ġtext position Ġtext ToKeep Ġscale Factor Ġscale Km Ġ''' )) return Name Ġq w Ġq ta Ġq req Ġq rs Ġq year Ġq kit Ġq sturng Ġopen py Ġopen Price ram sey IC AS my map my cluster my boost Ġ9 27 Ġcode gen Ġgroup FreqThresh Ġcurrent line Ġcurrent frame Ġcurrent Date Ġcurrent segmentsize Ġsign ifying nal ign Ġread f Ġread Dict ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ac r ac ell Ġim name Ġsum y update Image update Button ... ` ... '] Ġtemp Ray Ġed lsq Ġmod o Ġmod IArr non ce non monotonic non symmetric non hst Ġtf code Ġtf Exercise Ġtf TrainedData Name Subscriber Name Funcs Name IsSet 65 10 65 35 65 41 65 236 65 338 65 8824 30 257 db d db data db key db Client AS M cluster label cluster ID cluster counts Ar rows Ġad r Ġad mission Ġtrans missibility 37 34 37 46 37 62 37 319 37 107 37 244 SV GP Ġtable RawData step I step Val cont am cont Step cont Rng :] == tf records ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Series Plot ĠCon form ĠCon cept ĠCon servation 87 29 87 094 org b vi i vi k vi ction _) - _) ", Ġtra d Ġtra fo Ġtra veled RE PLACE RE PRESENT ura sia top Err CA PACITY Ġwidth guess The ano Ġmult idim Ġmult itaper OD RI State Energy Ġoff enses legend List 44 10 44 06 item Data item ScoreMatrix qua int ĠZ en ĠZ list ĠZ ay ĠZ eger ĠZ eppelin ĠZ urich Ġcreate Model Ġpoint ind active Data active Que Ġacc utime Ġob en nn ans select index ĠAr menia 23 99 23 19 23 154 23 077 23 888 last s pop d Ġuni versity Ġinitial file SI AM img f img Path img Bin dataset df dataset Conf Ġdifferent iated Ġ[" ( multi point Ġfilter fxn Ġframe Num ops in any a Ġwindow sizes 26 93 26 109 De e De bts AG P AC ONS Ġlast i Ġlast rect Ġlast Wavelength 77 003 77 305 process Queue auto mat auto fold auto logous RO BOT word IX ([' } ([' {:. TI ER over leftarrow {} _{}'. {} _{}_{}_ txt c Ġlinear Coeffs Ġevent plot unique Names Ġsplit ing Ġsplit Data net te net cash Ġsm as cell Energy mer ate Ġcenter Point Ġnorm Val Ġnorm Int Ġmatch File Ġsim iliar Ġar chetypes je k ĠSt ub ĠSt ulp ĠSt orable Ġcond Counter diff raction plots im plots ingle ake ven 42 25 42 92 98 107 Ġdraw er ++ : Ġtotal tokens font files font angle ob rys ob alis vs r bl h Ġ} }". Ġ} }_ Ġcontin s Ġsee mingly AB OLD AB BA lower stop source Tables make RangeIndex Ġter mios FF FD Di gest Ġperiod o Ġdt d Ġdt arr Ġdt revc Date Util 43 987 43 327 43 956 43 989 43 1373 seq names seq record 67 236 67 374 Ġsingle cell Ġsingle Cell ĠPer plexity '][ ()]. DE A DE CL DE POSIT '). " 08 33 08 144 ĠDefault Backend mm read mm Get mag netometers Ġpair plot gener a gener ative replace ments To Value To Tensor To Map To Legend To Big To Composite To Rag fs as fs dk Ġab st ĠComp ose Ġsource Id Ġbest alg ins ight ins pired Ġcross walk gb es Ġfield Direct sin o sin ogram Ġparser info open p open Image open office wh olmgren Ġtrue type Un cs 47 30 47 9548 total counts real ize vis ing bins x ox tank concat vals json schema json pickle Ġraw count Ġraw inventor 60 99 Ġupdate wcs Ġupdate setdf Model Warning Model Parameters ier i FI FFT Set Default Set Current Set tle Set Icon Set Bound Set Mesh Set Unbound rad ars rank er rank file Ġsuper pixels Ġsuper vision current line star star inf icant Ġfont d query Idx Ġeps abs full TextDict full PCCdata DF L go pt ãģ £ Ġhist orial Comp ens Comp atability 49 17 49 84 49 8039 Ċĉĉĉ ĠĠĠĠĠ pert une Ġtree Type mu v 28 64 28 31 28 904 28 288 28 248 stop Loss stop watch EL OG field sets field Box Plot Multi Plot Window Plot Only Plot Command ĊĠĠ ĊĠĠĠĠĠ sys log ĠPro to ĠPro cedure find infiles Ġdiv i job Spec For Cell For Rec vol untary 29 02 anel ia En counters Ġstop Time hand yman ĠPlot nine 39 05 39 158 unit x unit ed 40 32 40 75 ry pto ster m Ġimg dict Ġ(( (' Ġ(( _, Ġge vent Ġstat indices Ġlib c Ġlib spectrum Ġlib internals spark r 68 94 theta mac )]) [:, )]) }) CT ra sen ces Ġthere on User Field ĠAn selin flat ness Ġtmp s Ġtmp lt Ġtmp coords .) ' .) }) gex t Per cept Per Sample Per Block Ġ-> ') ĠIndex Type ĠIndex Table fin h UR IES Ġitem sep Ġts learn 2011 1201 IO x annot E MA INDER match func match File Ġbreak off has Events Ġnet in rol lin ĠĠĠĠĠĠĠĠĠĠĠĠ č position body ele kta 46 35 46 94 46 08 46 212 46 397 46 229 46 217 module In module Name support ing Fe CoCe +' baseline Is free bayes free Energy Sample Base Sample Model ugin osa ĠTable Environment ĠNew ly Part icularly uber culos ĠMA JOR ĠFa hrenheit flip X flip Y maximum NumberOf Sto ke Ġcb w Ġss z Ġwin len Acc urate LL G mot ha Ġpk pos wt type BF D Ġmajor step 0001 5 Ġtre ino compare ToFirst Ġti enen Def unct Ġconv to ĠValue Expr ĠDB P Projection DNN Ġpanel no SQL ToG family name STR IP STR ATE STR ALI OUT FILE Ġ23 45 ĠNA XIS Best Model hyper param pix size pix scale era de Ġmar sh Ident ifiers multip oly "% . loaded Doubles met ale rea cs }' ") Ġgra bbed ĠWH ITE TP F SN I SN Params SN PS Vs Separation ĠTensor LikeDataAdapter ima getype ĠTra its Ġtot pix ---------- | ĠNon ExistentTimeError daily vol TA XA bold math Note ID Ġ"{ :,} Ġ"{ :,}". Meta zoa Pos itional Pos Vel Pos RankSum Ġmouse ReleaseEvent Ġer k Ġer ax ORT UNITY Ġtw ist Ġtw ilights Down wardEdge ĠDict Editor east ward bre y bre athe beam State database df ĠAS res flush right 109 04 Ġå Ģ Ġå ī And Save And Binary topic N Ġnumer al phot om clus Results Ġappear ances equ ides Month Day elect rone samp son Ġprice Y Top Left Ġbic gstab Edit ing Ġdelete Empty 445 7 Block Index Block Integration 318 7 Ġmem greed ĠUpdate ChannelsMixin Ġke e Show Plot Ġverify File eig ens eig Vals GG AAT syn list Ġrad Button Ġfl x amin ate Ġsd rs slow est '$ _{ Ġfeat Ext Rest ored Over pass Ġcare taker <= > Ġstatic methods ='\ '') fd FD PACK AGENAME Ġpages ize Open SSL Open Medic GR F Ġmi elke '" ' Patch Simple Ġ75 6 Ġ75 9 render View Code c Code Cell Example Model Ref Seq bm hc chan cery 707 6 vir hostnet 184 64 cli ptic 988 6 ,:, :][ ĠAlex andru Ġcover DF Query InfoKey '))) ] Ġbg file Ġbg nd Ġbg plvm Ġdr iz pv p pv ind pv lib 401 47 ARG MAX 636 24 dash y Ġada pters ĠVar List yt l Ġcli mato GC CAG sho pping 133 75 133 55 Ġcombine SpecPower Ġlag polynomial 047 13 047 34 Ġfoo psi 917 25 917 47 917 69 Ġast ig ja j ja commands ĠST N pb br ĠTemp RatioPowerDB 700 87 stock list bio core Ġintegration Range 996 35 Ġdependen dent Ġ================================================================= ==== Ġ================================================================= ===== ĠGeo Data ĠGeo Tiff ĠOver riding Ġspa ghetti Ġann ToMask abo loid even ing resource Object Draw Text "} ): Ġvect eur DatetimeIndex Resampler Extra p Ġconnected Intermediatenodes 756 393 Weight Base Weight Matrix Unknown IDError ado res Ġ195 3 Ġì § Ġrp ms Vis Config Freq Response filer oot cn st Ġbeam Source cw r ################################################ ######### Ġ95 32 Ġ95 16 Ġ95 71 magic num Auto Layout ĠFL AT ĠOpen fisca commit id TRAIN INGS Ġ35 000 DR ATE dst auffman 264 5 Lines Legends 265 6 Ġsyn sets Seq Prop Pe ach Pe ptide 975 7 311 3 Ġ'{} ')) FIG SIZE 984 47 Ġquant al Ġquant ifier dv dt 185 09 ('.') } plate ifus 296 3 296 5 Ġlst yles Diff x Diff y ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Sequence Subclass forest Out "]] }') 365 95035 +'/ ') dark salmon ĠEd iting Ġant ip ĠImp utation Custom TB GE OG tele phone quant reg Non negative Non BLASDotWarning Ġ99 2 Ġlt u Ġlt z Ġlt ir Exp Syn Ge opotential water level ĠMy Graph 454 66 Cod on neighbor list neighbor Sum LC B ĠSc uba web page Ġ96 00 ĠJSON Field Ġcar pet 976 97 enc ias Ġagree ing container Service First Order orange contrib ĠTO OL 149 370 enable Inference Price In elev up Iteration Stats ĠPoint F ĠMatrix Table ĠPY QT tb hdu ko ma SB P Ġ65 84 should nt 165 26 165 38 ĠMatplotlib DeprecationWarning ĠVariable Error Ġsho p Geo logy MD M 122 87 cen col Ġtile name mouse X mouse Y Err H Err no CSV s Ġpers pectives wp li 147 64 Ġgui lt ĠCluster Warning Ġvol Dict Ġvol atile Ġ94 35 Ġ94 37 Ġ94 28 Head line Head ings Ġinstrument ed 014 35 ĠSimple MovingAverage 987 1 tim it tim mean Ġsr ce activation Functions ĠRed capError 977 2805 ĠLen nard ah ic }( | }( \\ 004 344 Ġol igo ln W Job NameIsSet manual s templates Flt Ġpast el GEN CE Ratio Overlap ĠEN AC reads By Ġfar ther member timedata lh b ĠBoolean Field ((" '% 397 4 8039215 68627 Directory Iterator TM VA Ġidentifier String Ġhouse print Ġ----------- \ trade mark trade off trade ID 906 26 ĠDEBUG GING every where chk c Ġlf Return ĠSp O ĠWar ped Port erStemmer console Widget Ġgam I Ġgam mar Ġqt g Connect s Ġfac enetsvmDf Ġ'* _ 054 87 Ġins pyred Ġsn es unstack er ('../ ')) 667 06 gu func è¯ ¦ 306 3 ĠObject ives ĠObject Id Ġactiv ates ĠLI SA Ġtheme ID Combin es thumb nails FR IDAY Tip pett central Widget čĊĠĠ čĊĠĠčĊĠ aaaa aaa 384 6 calibration Function protein Name altern atively early stop MI A VALID ATING ĠVis itor azimuth al Spin box Spin Button Form er Ġ[''] } Ġposterior i ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊ 016 14 ]== - Trace New Trace AnalysisBase Ġplay back Ġasy mp Begin Time Gamma A Wave lengths ĠGe merate Single Plot 266 9 266 12 ĠSignal Fields ĠDO AS ĠDO MAIN ĠDO CTEST decor ating FUNCTION AL Pass ThroughProxy turb ulent æŶ æĴ¤åįķ sky box Missing PandasLike ĠRo ad medium aquamarine medium slateblue medium springgreen 164 45 Ġleg loc hum ans COMP S My File 997 754 Ste pper Ġadj mat 648 64 648 39 stations filename INTER POLATION Ġpot ato ĠMC want Ġgenes is ('./ ../ 226 84 226 77 Ġencode able hit ran ĠCross Nuclide MQ MAS XA pi 404 0 Cha os GH Z Histogram Plot Command line FIELD NAME Ġeg os ĠAverage Meter TimeSeries ResultsWrapper dos G wa is åį Ī åį Ĺ (? ). SUB ARRAY SUB STEPS Ġbs as mtx s Ġ<< <<<<<<<<<<<< Ġoverlay ing Ġ================================= ====== boot swatch ITER ATION EPS CoR ROW TYPEINFO Ġë ĵ¤ Ġrms Vals Ġfo af 045 3 045 7 Exit Routine Div orce SAMPLE D )| ,(' Ġbi oc Go als Med Vel market place ied bmhc Datetime Format 922 32357 ĠAdjust edArray Ġum ask 187 33 Ġhome work 104 149 REF s LENGTH S ĠNE VER LOAD ING pub date ĠMet al 295 39 Stop band Stop PriceUnitOne Ġgy mnastics 188 6 life lab answer ing ĠDistribution NotFound Ġicon file program Basal cand y ĠHyper Plane tal bot ĠRest ructure 234 6 108 37 666 77 RECT ANGLE ĠGround water ĠGround StateScfCycle Cho osing ĠSecond Locator loglike hist 035 0 è´ ¥ 495 0 495 5 ZZ LE destination SE ĠPolynomial Expansion combo boxes gun icorn ĠHigh land WX MAC Ġam xn pkg info rich ardson 177 19 åıĸ åĨ³ 个 åŃ£åº¦ Ġ97 2 Ġ97 3 Ġ97 00 Ġ97 94 Ġatt entions Ġjump ing ĠLocal ize '; ") Ġjo e Ġ85 22 Prediction Col ĠWave Number Annot ated Ġdes pesa Gene Set Gene Id worker ID ĠTwo D ĠSingle ConstructorOffset ĠSetup PredictDataFeederTest Met Data Met ropolis Post Proc Ass imilation Ass imilate SW L Write Str photo Id Ġspin boxes Ġthreading Enumerate 358 19 dn f Ġgauss hyper Ġgauss pulse ĠII q har vey Ġbn data ĠSch arr ĠIP s scroll Preserve (". "): ctr lpts ĠCH i Ġamb ra ĠRate Matrix 026 8069 ĠCA PSULE '| ,(' 220 92 comm utes ĠForm erly ('/') [:- Greater Equal Ġburn ed Init Val 387 1 Global Subrs Gain Pairs Ġxt l Pen umbral torch vision was serstein ĠBio statistics Fast GFile )< > Arrow Invalid 326 10 326 29 Append Total Ġbed File Ġbed rock Replace ments ĠChecking BuildExt Ġcamera Matrix 214 224 bal listic Ġ110 25 nos ig nos amp Ġcity A Ġcity B Ġbench Tools sympy str ĠBar Container ĠBar achant 659 19 solar cost uz n Ġservice Schema 096 00 Ġarch ivos DataSet List Ġlazy val Diag Broyden 055 28 Ġten log Ġchr onic FP GA 136 02 ]*( \ Ġnth in Backend Base Percent ages Ret Range 980 43 BG NBD Ġchem lab Ġattrib ut Ġattrib uts vv ym Likelihood ResultsWrapper Ġflash er 944 75 opp dir ĠCR VAL Expression Error ĠSpecific EquityTrades lef eld pin ned 268 353 ĠSM U NP TS Reads PerCluster When JobNameIsSet ĠLegend s Descript ive lue ter ĠEnergy System ĠEnergy Balance Ġ\" {} Groups InPandas viol ated focus Signal Ġcx h Dec mation Ġprot os Subplot Host BAD s Mouse Moved shear Exp Rect ifier occur ance 469 33695 emit tance ĠUnit SphericalRepresentation PERI ODS leave vmode Ġsag a Si lence tor us ĠQT L ambig ous ĠDiv isions Ġaff airs Ġintr xn Age Fill Ġfourier Var 322 30 mpi exec Device Setter Ġqual s 194 054 166 1 166 76 166 075 Ġvel Boundary Ġnorth ern ĠConst ellation detector Name XYZ T Ġshot list nes days Ġwf db ao Table kal i Support s ĠDec in ,: ]], ĠSUB JECT Bayesian Optimization Li beration publ ishes FRE QS GCT ACA ĠParam Name ĠParam ters Ġbur ial dock ed FACT ORS 1415 56 ĠControl led Intensity Threshold CY AN }% )'. xili ar ĠRelative Delta scf Task 717 916 Enum Field 737 3 mz Col Ġà ħ Ġclamp ings Ġfir ings buy Num Ġ127 1 tg ts NL T dll s Ġplanet planet Ġoe chem Ġsell s shadow s 094 39 hub ble Dest r Dest inie icult ure ji ang ARRAY S POLY INT ĠLi ang USD JPY het ically (... )') ================== + ../../../ ") 301 02 media cy Su resh Units Error bracket ed Star light __[' __ Ġsci hdr ĠDelete Workspace EB D gps DataPoints ELE MENT ELE ICAO kn ifed Ġgrab cut hmm c 476 19 ĠMOD ULE ĠMOD IFY ĠGLM Results ĠSPE CTR Separ ated Additional ThreadInfo CENTER S ĠConnection Patch Resource Manager 278 304 Ġtraits ui lng amma Ġspe armans Ġdivis ors ĠMode led cao jun Ġfasta Model Ġannual ization persist virtual 209 107 6000000 2 egg plant 0000000000 4 SCR IBE Boundary Condition ĠVe hicle ĊĊĊĊĊĊĊĊ ĊĊĊĊ Ġwa vel ĠJoin ing Ġhyp secant ĠVER TEX ĠCloud PickleSerializer ä m Ġboot func AU CSL AU STRALI Flu o Flu jo Flu orescence dam erau Rad Type Rad Temperature kr nl FAIL SAFE [:,: ,' 30196 1 66666666 666666 Approx imated Ġqr vecs Sent Len TIT UDE PV F Ġcru el retain s Ġcircum scribing 958 36 ĠMov es æľ¬ æĸĩ件 Ġupcast s Ġthr InputSize STATE MENT taxon Rank ĠDet SRM ĠHO W signific ances Aux TransformBox 676 37 1057 42 Ġdem isto MARK OV who i Ġcas ual Ġiq Data '^ (\ RV TOT coup ler ĠRand all ĠJa akko Ġ*** ' Ġ*** \ CPU time Ġassess ments clamp ings EW M Fix ing fli rt igra ber igra RandomForest Ġpay checks ĠEnvironment al Ġmind f Broyden Second White Space RC NN Lag rangian preview save Ġsch ott ĠFr é ÑĤ а Alignment File ply data Tot Photos Ġfat iguelife Ġprog print ĠNormalized KernelMixin äºİ æĤ¨ Ġoct a åģ ı athe na ĠElect ronic PAN DA Syn chron Ġresol vable ĠDiscrete Results Api Element Ġincoming LaneNo ĠToken ProjectionDNN VIS IT Ġmultith read ($ | Ġ114 85 drag x Ġpanda ize Ġpanda server åĪ° æľŁ ;\ "> cab def ĠTho usands #**************************************************************** ************* lmax out Ġ+' _'+ Dgot GOODs Ngot GOODs pseudo preictal pseudo interictal Move Scheme osc illation cep strals Ġrecip invgauss mir rored ĠDAT O Ġcel lid ĠBinomial BayesMixedGLM Ġgps Data Ġaperture RadiusIndex ĠLatex Table Demo graphics ATT GG beha ving 837 35 Ġsmart Format ä¸ĭ æĿ¥ Ġmz XML ĠBU F ĠBU GS ĠBU ILTIN Ġemb eded å®ļ æŶæĴ¤åįķ Bed Graph aperture Radii ĠAnt on Resolution SpectralCube Numeric Feature MAR esults setMinimum Height epsg code Expect ations Ġ(+ - Between ness ":[ ]} Exc itation Exc itingMixing Ġwi ht Ġ115 53 ĠSG I ACA mp ĠEigen mode ìĹ ´ ìĹ Ī Ġ".. ")) ĠNi FeCoCe Ġlay typ Ġuniq ID UX oap sit ting sit uations Mixed Model Mixed TypeDict çī Į MIS S pod cast æ¯ı ä¸Ģ个 cosmo data Special ization Ġpin ched Ġsoon er Ġ+-------+ ------+ ĠMor itz Corpus Reader ĠGre ens ERO WClass ĠBag Of SPECTR L Ġ135 24 grow ing Ġksp NS ĠVALID ATE Composite GenericTransform Ġeffort s heter oskedastic enumer ation ĠGene SetSelection 877 69 ĠSymPy TestResults CAS ignature Ġsus picious æłĩ çļĦ Ġfich eros ĠACTION S ĠStation Plot STRU CTION JJ J ĠSa ha ĠSa ad RAT ING éĩį æĸ° Good ness Ġrg idf Ġpaint Event Gra ffiti Probe Len )? $') TUR NO excess ive ãģ® ãĤ Ġcoinc idence 0985 2 Stratified DatasetKFold Stratified DatasetShuffleSplit Stratified DatasetValidationKFold Stratified DatasetValidationShuffleSplit ĠAdam Optimizer 567 0710 Dynamic ScheduleBuilder ĠSS HTunnelForwarder Ġmess aging mds path Ġ################################################################################ ## ĠDL AS ĠBenchmark s ĠMV PA ĠCorrespon dence ,'. -', Reaction Datums WR IT Ġot us Ġexemp t ĠStan is ĠRegion AdjacencyGraph ali F ĠFlu ent )+". "+ ĠSY STEM ĠAM ICI Inc idents flo ored ĠRolling WLS Break points Ga As sac cades ĠTiff Sequence Observation ID ° ' ĠCCD obj ĠCombin ing ãģĭ ãĤī è¡Įä¸ļ æķ°æį® dil ute ĠStratified DatasetKFold ĠStratified DatasetShuffleSplit Ġgreed ily èİ·åıĸ æĸ°éĹ»åħ³èģĶçļĦ主é¢ĺ Sound Check fic ar itt el Detect s Bounding Rect ìł Ģ ĠGra bs ĠGra vitational Html Tooltips Ġ'=' ] Ġexpon pow Ġlig ands Wait Loop Ġsph ering elike Ops atmos pheres ĠPV LIB ĠPixel Set ĠPOL AR Illust rate uy UXoap Proj Data Ġ=== ') ĠDtype Warning numberOf Processors 绣 ä¸Ģ Ġhd ls 缸 对 缸 åIJĮ parms h Pole Pole ĠSheet Geometry Ġfiber map ĠConditional Field ठı ĠLy apunov ĠReaction Error Ġ({}) " bol and xax zoom Ġ#------------------------------------------------ --------------- assembly Identity (":") ] ĠSubplotTool Qt Ġwvl BinEdges Arpack NoConvergence Dipole Pole Dipole Dipole Ġellips ize Ger hard Sn iffer Wal sh Ġhor rible categor isation Ġìŀ ij nation ality mind ate prem iere recogn izable STRE AMPL yan andan orbed file Spine ML JUST IFY extr ude ĠAk j Ġelec Dt Nifti Masker Shadow s Ġshe ared ĠHo chberg TV F bash rc fuck ed spo kes ĠSDR s .))) +( Ġchess run Ġzo diacal anchored Patients ([],[ ],' CAAG TTA ĠTemporal Filter ĠCURRENT LY Pseudo Attribute Sweep Data Ġgro ud Ġpolit ician stoc a Ġbill ions Ġbill ionaires Atomic Number Ġheli ocentric ĠHeader List 595 286 Ïī p ĠAns ible House holder god ayev gpl vm Outer Tol David zon ĠReverse LineDirection paren cies Ġsynth ase Duplic ated aqu atic CCG CAAGTTA Ġinflu ential Restore Thread RK R Ġconsum able recover able turns PerLayer FULL ARCH PLAY ER XAxis Max XAxis Min Transfer Size flank ing CUT S spr inkle Ġwest ern YAxis Max YAxis Min ĠTy vek ='{} ', manip ulated å¤į æĿĥ ĠPretty DateFormatter ĠPretty ScalarFormatter ĠPretty DateLocator qf q ĠDemo cratic EXIST ING ãĥij ãĥ©ãĥ naxis path Ġini file ĠMenu Item Prev ten Mor rison Mor phologyDict ĠDruid Cluster ç»ı èIJ¥ ĠParticle Term FORE CAST Slippage Model Gu ids mist akes mang led Ġplat ypus ĠSPL ASH ĠBrain storm Proportion al stl solid Ġnod dy Ġful ltext Ġ***************** *********** ĠLists OfScalarsDataAdapter ĠBl ur ĠBl uring Rotate Gaussian bac ate æŃ£ ç¡® 564 444 nsub j Ġist cb ĠdE gdT Ġerro red Paper click gof plots Ġcoco tb ĠBeam CoderImpl donor IdList 911 58389 ĠFits Utils pLvl Now ĠContrib utions fluct dat PHY LUM HEALTH Y fut u Ġtall er ĠIon Object Ġinj ury Ġcompos itional Ġblo binfos Ġpref erring SENT INELS ä½ľ èĢħ npt ools vare rr Ġminf om investment A 714285 71 Stochastic GradientDescent ĠIbis Error Ġros bag Ġprimer a Bank ing Latex Values cbo FieldToPlot dHist Y Ġdisambig uations Wui Hlp bull ish ('{: > negLL Track Paint DC cohort s Ġ206 36 syl lable syl lables Ġmsm tools ĠTre ant VECT ORIZED yeast images ĠMES H Neuro ML Ġmav proxy Ġindustry Version frags x Ġlambd ax nRays Accepted Ak j Built ins ĠPred icate Http Response ÃIJ ÃIJ ĠHan sen ãģ« ãĤĪ garch plot Ġune cessarily Interpreter Context bran in tent ative inher its capt ures KING DOM VW ND ĠDataFeeder Test CPI AUCSL cra zy ĠFred rik Ġdeploy ments "}} ' seven th Decomposition Mixin Stacked Widget XR Y mint icks vic inity Ġautom ation ĠSR TM ĠSuccess fully ĠVW AP ĠNaiveBayes Classifier Earth quakes Qual ified ĠSafe ConfigParser ĠDN est ĠProv Bundle CHANG ELOG UU UU rcs ample čĊčĊčĊčĊ čĊčĊčĊčĊ 该 æŶéĹ´æ®µ Cand lestick Mf Mui erfc inv getdefault locale ISOP ND igram ite Ġå¤ ľçĽĺ ĠLAT EX Ġcanv asevent é«ĺ äºİ ç½ij绾 éĢŁåº¦ Van illa Ġodr Obj ĠlY cuts ĠTestArray Priority æѤ æŶ TRACK ING ĠChunk ing Validated Dict ĠMasked Column Topo graphica Ġazimuthal Average æīĢæľī çļĦ IML s ĠFire fox Commit ter vacc in TRES HOLD ĠManip ulation ĠFRE QS Ġpsr Group Orbit al ImageName Subscriber bom Row bcb ddc erro periclase ĠKn oll Arithmetic Error LINES TRING å½ĵåīį ç½ij绾éĢŁåº¦ ä¼ĺåĮĸ 设置 ä¼ĺåĮĸ åıĤæķ° Evol ver .]* \.)? ĠPsy Plot Ġoutgoing LaneNo ĠBACK GROUND keyboard sensor 90588 23529411765 Ġcrow ded raxml HPC pys akki æł·æľ¬ çļĦ |_ |\ ĠACC UR Pha ser Walk ing march ing ĠIntro spect Analog Out Analog Signal ĠMcG ill Fu zz Osc illator ĠTw ist ĠCare ful ĠPyDB AdditionalThreadInfo Dac Comb autom ata autom obile çľ Ł Ġresi lient ĠìĹ Ĩ /## " Ten nessee ĠIB IS ĠIono Container ErrorBar Below ErrorBar Above Ġ************************************************* ******** Ġ************************************************* ***** dav ian ĠStacked Denoise revi ation repla cing ĠTref HT setAuto Repeat stron gest passage sets TRI ALS ĠHealth care Ġelectro magnetic Slip Lat Ġdtr sen ĠLux embourg Prov ince finet uning CRC ProbStat Increase Error Ġê² ° Ġê² ĥ Ġldt Timestamps Ġzt revc ************************ ' bru ker Ġqui vers ĠPSS MScore 9900 57 ĠHEL IO favor ite snv group ĠOriented MinimumBoundingBox NCEP V Ġfrequen ces mapTo Global mapTo LonLat ĠYl OrBr ALES CE Ġ$[ {\ promin ence dart mouth maxNum OfUnitsPer SetCell BackgroundColour fron tage ç¬Ķ æķ° HSD Results eas ily targe ters Ġplotname text phimax ang 777777 78 ĠVictor ia Krylov Jacobian bath rooms alice blue Ġspar ql _{* }$) PERM NO ĠActiv ates æĶ¹ åıĺ ĠSETUP TOOLS ĠFFMpeg Writer Junction s sme aring fission Width GetLayer Defn ĠAssess ment cardinal ities Ġë§ Į Tran sect Ġsstr repr Ġrevers als æīĭ ç»Ńè´¹ ĠSchedule Configurations 199109 09 Ġ기 ëĬ¥ wit ness Ġbacks lashed ãĤ¤ ãĤ 为äºĨ å®ļæŶæĴ¤åįķ Campaign View LGBM Regressor Rich JupyterWidget fiel dtype fileList WithClass ĠNAMES CAP INJ URIES Consolid ation Consolid atable Rectangular Projection Ġanc illary 9932 97 1208 23 ANALY TIC ĠLife time Evidence AccumulationClustering lineWidth Spinner ĠMel hor CGgu Err ĠModEM Error Postprocessor Reader Ãħ ÃĤÃĬ éĤ ® Ġlump ed 3202 68 ĠParsed Instance CLI ENTS ismo gram omon as ĠHad ISDH 1602 42 Shifted Mass chap man Ġë³ ´ Dollar Return hay stack blan chedalmond Ru Cl Ġsquee zing ĠTqdm DeprecationWarning numCells InUnionVal CGir L CGir U CGrg L CGrg U Ġpurcha se Nvrs P ç®Ģ åįķ deco pposition Ġ(! ). ĠEy ert Ġhyps ometry ĠCombinatorial Tree Phe no frec uencia :,:, :]) 78431372549 03 XXXXXXXX XXXXXXXX éĢŁåº¦ åıĸåĨ³ tsto fit addb Task invo ices divor ces CLIPPER lowFDR wre ck wrf chemi ĠCampaign View ĠUnp erturbed apr il dictStatsComp Adhore Ġimperson ation Ġgeos ar ĠpowerCurve Levels ĠUpload Form Ġgammaincc inv Skill s zw icker leve lfe Ġdeter imin Ġhabit ats ĠKnow EventTypeView FFFA FA ĠâĶĶ âĶĢ ĠBottomRight XGlobal Ontology ID Ġ'------------------------------------------------ ------------' pagin ate Ġresultado Sir compre hension Ġrelig ion cardi ogram rvals DT ĠEFF ECT 6086 59 diaz ep navchoice ComboBox Ġfacenet linearsvmDf ĠëĮĢ íķľ Electric ity 页 页 Rece ive ĠUNI QUE ĠUNI VERSITY Appr Bc RANDO MIZE ĠFeat urizer ĠåŃ £åº¦ ĠCallDimension C Lex A requis ites timeStep InSeconds ĠMLEResults Wrapper ĠEstimateSurvival ByDecade ĠStem Container ç½ijç«Ļ èİ·åıĸçļĦæķ°æį® ĠITER ATION minMax Loc ĠGn Bu ĠGn uplot 14026 85 Ġgrá ficas Mooring Daily TAtt Line TAtt Marker ĠPanDat Factory #-#-#-#-#-#-#-#- #-#-#-#-#-#-#-#- ç³» 绣 &=& \ Agreement Evaluation Die lectronic Ġack nowledgement Ġetopo data Ġrdes igneur ĠhPerson nel nodup es Ġcarg ar defic iency interfer ometer Segm Lesions Ġlibj oin ĠCOMPUT ER lavender blush riz io anonym ize setSelection Behavior ĠxT ilde noset ests ĠDataProduct TypeEnum 0483 85 ĠComplement ary Ġlsst JobParams ĠEXTEN DED éĩĩæ İĺ ĠCATEGOR ICAL Dend rite `= * palet ta  # Ġelf i deflator Q Ġhono ured anticip ated fog gy frb cat rhom olar ĠDiffer ing æīĵ åį° ĠAdapt ively Lob bying UAV O rhe in ĠIdle Event Ġunassigned DF fool ery ĠexpT even ĠArctic Transaction Ġepit axy communic ability ĠMapNodeTo Lists è½´ çļĦ ĠopenfaceCPU linearsvmDf 14159265358 979 Bert elloni Ġprecondition ers tempCorpus LabelPath Ġmerc ator 年以æĿ¥ çļĦåİĨåı²æķ°æį® ĠModulation Command åıijçĶŁ äºĨ 项 缮 çĶ±äºİ æĺ¯ä»İ ĠSliding Estimator #$% ^ Por osity Tcl Error semp er ĠIsol ated Ġaband on SONAR DIR Segmented MNLDiscreteChoiceModel ESTIM AGE ĠSQLiteAdjustment Reader Prom o dlines n Ġfic us irn akt Ġ719 163 5488 135 IsSet OnWorker projTrace Top projTrace Right ĠSchro eder å½± åĵį ĠtestVariablesAre Local ĠtestVariablesAre OnPs ĠtestMutableHashTableIs Local ĠtestMutableHashTableIs OnPs ĠMultiStreamDNN Gv Lable es Sear ches YAx Org ĠSTRE AM ĠFoot print ĠDrain e Ġlset GT ĠintEnergy i ĠOPP ORTUNITY Ġplotstyle layout Ġtemper atur ĠMatched PairsRMSE Bolo meter ãĥ¼ãĥ ī NumOfUnitsPer Trader ĠgSto D getObject FromUri ĠCOB RA ĠDri ven ĠpreProcess Norm Ġargrel max 091814 756393 Extre mum NoSuch NodeError DAM AGES ĠPeek ers èŀįèµĦ èŀįåĪ¸ UW ND Ġorgt bl maxNoise Sizes auche min Secret Key Ġavai able PROTE IN æĽ´æĸ°æŶéĹ´ çŃī guarante ed æ¯ıèĤ¡ æĶ¶çĽĬ 71828 182845 XMLDSTABLE CELLClass MOTOR OLA +)- (\ veget able ĠKra uss ĠTestProbit Newton ĠQAbstract TableModel ULTR ABOLD QUANTI LES ĠJohan sson endium Type SCMICCSD AF 698970004 33 rober tson ("---------------------------------------------------------------- ") fileOr Directory msp ines Ġzpss x Ġdoct opic wikis paces Ġsymspell py Ġmunicip io Oz arslan Optic Task Tal lies å£ « seren geti Ġdefint ion pyper colate necho es Ġkno ck ĠNrm SpecRec 9960 7843137254903 ĠHon or ABL EROWClass GetWheel Rotation ĠHeinz el ĠEdited NearestNeighbours ĠGeos ciences Directed Graph Ġåı¯è§ĨåĮĸ æĬĢæľ¯çº¿ STEAD Y LombScargle Multiband THEMES BY POT ENTIAL andal fs Ġwithdraw al ĠBrief case beame nergy ExpSquared Kernel Ġundersample d Resonator Channels åĨ³çŃĸ æłij Ġìĸ´ ëłĪ boomer ang ĠEig Dir InWorkingDirectory List Ġpyro lysis æī¹ åıij FDwf AnalogOut Micrograph Name Ġbernoul lim ĠAngularFourierNoiseDomain Expression Neurong roup HEVCW LPARAMS IMM UTABLE Ġæ¸ħ 空 Ġigb last Ġaber ration elib en ntb Box lensed cmbfile Ġconvey ed ĠtestTask IsSetOnWorker moham mad maxvec len ĠQUE UE Layered DepthProfile COAST LINE ĠQuantification Process Ġå¹´ 度 Loud ness lign ite Ġstocha stically ĠSORT ED ĠIne ichen ĠCBO E Ġcolli mator ĠLCM V ĠbestWeights Fichero hedr als ĠIntSequence Format Symm Line ĠPrecisionRecall Data ĠMicrowave Mode SqlAlchemy ExecutionEngine ĠBoroCnst Art 5147 1653 Warp ing cjk im ktr um mich igraber Ġtreate ment chb mit toYear Month ĠCurv ilinear Ġì½Ķ ëĵľ circk illmap millen nium éľĢè¦ģä¸Ģ 页页 WarmStarting Test ĠReplica DeviceSetter ĠëĤ´ ìļ© gsh hs nith yanandan Ġernest yalumni Ġnsh ffai Ġpue de unass alpha getStatistics Style getTaxa FromNewick yscroll command ĠBROW SER ĠJess up ĠEXO SIMS CTCTGAGAG CT 计æŶ åĻ¨ ĠLegacySurvey Data Resonant Frequency åıªèĥ½è¾ĵåħ¥ è¿Ļ Hast ings Ransac Regression utok ore Ġwsgi ref Ġyad lt setUpdates Enabled Ġgilles py getinfomin max Ġhsz inc ĠPane Info feach or ("================================ ===========") ĠDart mouth extvart ab Ġkwik lib ĠonGoing Tbl maxRecords Per ĠMante uffel ĠpySpatial Tools startMult idrizzle 351664 85 046749 14 writeback ifcopy Ġintegro differential abschn it Ġaddtolist ordict ICAS SP REPRESENT ATION 98107 171 08144 091814756393 SetMesh Order PlotMulti Args ĠtypesInThis Chromophore 571556 091 LineGrid lab ĠOrfan idis rgbcmy kw measureRefined Ellipticity Ġpdftab extract ĠPyMimir cache AddStaticBox Container ĠNoRecords Found allowLarge Results ĠSympos ium 61756 251 resizeRows ToContents ĠSQLConnection Handler uberculos is maximumNumberOf Pixels SQLToG CSOperator 9772805 571556091 717916 77 caojun zhi äºİæĤ¨ å½ĵåīįç½ij绾éĢŁåº¦ STREAMPL OT ãĥijãĥ©ãĥ ¡ãĥ¼ãĤ¿ ĠStackedDenoise AutoEncoder ĠPSSMScore r éĢŁåº¦åıĸåĨ³ äºİæĤ¨å½ĵåīįç½ij绾éĢŁåº¦ levelfe atures çĶ±äºİæĺ¯ä»İ ç½ijç«Ļèİ·åıĸçļĦæķ°æį® Ġìĸ´ëłĪ ìĿ´ ĠtestTaskIsSetOnWorker WhenJobNameIsSet éľĢè¦ģä¸Ģ页页 æĬĵåıĸ ĠReplicaDeviceSetter Test ! }{ " '): # ------ # ------- # ------------------- % ): % ',' % ']. % (_ % ,' & ") ' ! ( ('/ ( |, ) (( ) ...') ) ...' ) "],' * # * :: * )" * )\ * )", * |\ + ':' , [( , {" , _= , ':', - ; - )[ - ..., - {: . $ . ]+ / '), / != / ',' 0 807 1 354 1 756 1 000000000000 1 6666666666666666 2 647 2 663 2 367 2 997 2 908 3 80392 3 253 3 64706 4 645 4 102 4 187 4 208 4 074 4 858 4 754 4 674 4 152 4 269 4 333333333333 4 196078431372549 5 451 5 09804 5 6607 5 247 5 373 5 674 5 759 5 877 5 473 6 125 6 785 6 348 6 157 6 1415 6 9878 6 241 6 341 6 12687 7 347 7 33333 7 093 7 2508 7 972 7 803921568627451 8 349 8 809 8 055 8 941 8 19608 8 1188 9 118 9 756 9 806 9 667 9 097 9 451 9 153 9 148 : '], : {' : ,' : ")) : }\ : *: : >{ ; # ; %. ; "})[ < {}, < '- = ?", = ?, > # > ')[ > (\ > %. > {}'. > |\ > (.*?)< } ...". ~ /. ¡ é £ éĩij £ èĢħ ¤ IJ ¯ 度  § à ° Å Ħ Ð Ĵ â ĸ â ĺ â ľĵ å ĭ å ł´ æ Ĥ ç ¥ŀ è ° è ı é ł ì ° ì Ľ ĉ ĊĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ï¼Į Ġ čĊĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġ Ñĥ Ġ 表示 Ġ 注æĦı Ġ ancestry Ġ ðŁ Ġ æıIJä¾Ľ Ġ è¿ŀç»Ńç«ŀä»· Ģ åĢ¼ ħ ä¿Ŀ İ æ¦ľ ļ âķIJâķ ľ èī² ĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĊĊ ĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ĠĠ ĊĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĊĊĠĠĠ ĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ in X in Data in ous in ions in solation in accurate in noc in novative in completely se viri at ric at tempting re im re gre re my re style re viewer re agent re paired re Circ re ira ĊĠĠĠ ĉ ĊĠĠĠĠĠĠĠ Ċ or ie Ġ= { Ġ= """) on grid on Save on Mouse Ġt mask Ġt ols Ġt rec Ġt wx Ġt aw Ġt ppf Ġt Vals Ġt course Ġt tempB Ġt aylor Ġt ribes Ġt pyn er gs er atio er xy er dat st ren st itle st au st own st alls ĊĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠ al lo al to al lower al cohol ar ist ar andom ar sson -- % an one an ch an Ion le l de u de la de ss de list de ces de scale de tx de cd de clo de mic de lier de cap de Task de mot de serialized de blendmin me doids Ġi B Ġi N Ġi pi Ġi mask Ġi ops Ġi ob Ġi levels Ġi Valid Ġi sec Ġi cmd Ġi pet Ġi Nf Ġi stft Ġi ccd Ġi arandom he e he le he nn he imer he pat he vc Ġn al Ġn ore Ġn true Ġn req Ġn ang Ġn valid Ġn split Ġn series Ġn be Ġn column Ġn call Ġn center Ġn chunk Ġn bad Ġn fast Ġn nx Ġn Step Ġn Err Ġn contours Ġn IDs Ġn refs Ġn chains Ġn study Ġn uts Ġn Pts Ġn ubar Ġn harm Ġn qpt Ġn Buckets Ġn Streams Ġn uttall Ġn Byi Ġc ft Ġc ables Ġc ticks Ġc rap Ġc groups Ġc nc Ġc Max Ġc Layer Ġc udf Ġc ited Ġc xscale Ġc upy Ġc rab Ġc iting Ġc editor Ġf red Ġf comp Ġf ms Ġf da Ġf read Ġf write Ġf filter Ġf hand Ġf Valid Ġf iso Ġf seek Ġf dark Ġf Obj Ġf rob Ġf uck Ġf calls Ġf ngroups Ġf reenect Ġf erropericlase Ġa or Ġa ul Ġa matrix Ġa qt Ġa qs Ġa quif Ġa LvlNow Ġa itchison Ġp F Ġp array Ġp plt Ġp Data Ġp func Ġp scale Ġp bu Ġp ik Ġp just Ġp gb Ġp mu Ġp ws Ġp pars Ġp final Ġp expect Ġp BB Ġp Generic Ġp etro Ġp leasing it ic it op Ġs R Ġs is Ġs ick Ġs sum Ġs ft Ġs mean Ġs names Ġs ats Ġs com Ġs graph Ġs rate Ġs xy Ġs json Ġs Dir Ġs lb Ġs hen Ġs das Ġs Checked Ġs probs Ġs disp Ġs gh Ġs isl Ġs pheroid Ġs askia Ġs YUnit self sorted ra derr ra fter en as en dex en joy en queuer es carmouche ro br ro ofs lo do lo rem lo yees Ġin array Ġin group Ġin sets Ġin mask Ġin sort Ġin between Ġin significant Ġin forma Ġin andf Ġin definitely Ġthe out Ġthe filter Ġthe Page Ġo D Ġo lo Ġo plot Ġo pos Ġo dt Ġo sect Ġo inspect Ġo sects Ġo Rxn Ġd Q Ġd re Ġd pp Ġd te Ġd key Ġd new Ġd dis Ġd times Ġd ither Ġd first Ġd dec Ġd under Ġd wp Ġd ki Ġd gu Ġd sky Ġd mins Ġd Xs Ġd ji Ġd hx Ġd uref Ġd ffai la se la ut la ch la ura la Table ut cs Ġ' )]) Ġ' ----------------- Ġ' "]' Ġ' ])') Ġm fig Ġm ll Ġm io Ġm mod Ġm vals Ġm img Ġm idget Ġm unit Ġm align Ġm rng Ġm tk Ġm nr Ġm fp Ġm lst Ġm svc Ġm inge Ġm hg Ġm jr Ġm ê Ġe ed Ġe te Ġe iv Ġe man Ġe md Ġe Max Ġe jd Ġe Bi Ġe Ai Ġe semp Ġe lasped co k co ad co tes co grouped co lid co pier co occurence Ġre an Ġre color Ġre ception Ġre analysis Ġre xp Ġre vecs Ġre sss Ġre partitioned Ġre fered Ġre binning Ġre lav Ġre configured Ġre defining Ġre adily ge weke Ġb key Ġb width Ġb pd Ġb first Ġb tic Ġb aa Ġb ij Ġb opts Ġb pw Ġb qgrid Ġb icycle Ġb attles Ġb descs Ġb tdtri Ġb XaarScorpion Ġ# __ Ġ# ============================================================ ed r ic u ic ester Ġw u Ġw ion Ġw di Ġw List Ġw sd Ġw fh Ġw Vec Ġw fm Ġw jitter Ġw qf Ġw arehouse Ġw velperts Ġw lauto ur ski lt ly ig Z ig and ig ation ig ree Ġ( *, Ġ( \' Ġ1 118 Ġ1 138 Ġ1 155 Ġ1 139 Ġ1 848 Ġ1 470 ss mod ss ims ', )}[ un f un er un cal un ces un flatten un modified un idata un conformity un batching Ġ0 22 Ġ0 50 Ġ0 241 is ps is ord is dense is Image el g el and el id el ms el isting el descriptive ol ysis ue z ate xt li ge li zer li abilities li ques li jn ort est ort interp )) != ser p est name est ly ot opes um ont 00 1000 00 57 00 74 00 211 00 373 00 661 val Axes id B id m id ler id eriv id dle id paper id papers id BuildCategory Ġas axes Ġas Dict Ġas HtmlTooltips di lab di min di macs di bly di elexRate di hydroxy () | () ][' () +'. () ``) () ]+", Ġis Y Ġis c Ġis nt Ġis plot Ġis valid Ġis Sub Ġis masked Ġis omorph Ġis Positive Ġis Inp Ġis OpenTag Ġis ocurve Ġis Highway Ġto show Ġto Skip ts x ts ol ts cale ts utils ts copy Ġ" ]) Ġ" :- Ġ" +' Ġ" === Ġ" )+ Ġ" -------------- Ġ" ;\ Ġ" ****** Ġnp hi Ġnp kwarg ter rors ma keline urn s urn ing ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠT tr ĠT CE ĠT DS ĠT dm ĠT rho ĠT runk ĠT BE ĠT dil ĠT rex ĠT CAGCGGTTCGATCCCGCTTAGCTCCA ĠT iterCollection array ize array index array Field tr args tr idge tr Algorithm th S th du th alamic ha st ha eb Ġy samples Ġy attr Ġy ard Ġy func Ġy temp Ġy gr Ġy tmp Ġy keep Ġy vector Ġy inc Ġy peak Ġy vertices Ġy Values Ġy Range Ġy Pos Ġy Keys Ġy ranks res arr res uts res pawn ch ill ch lb ch rooted ad mission ad csnap iz h iz or iz sky iz htype Ġdef rag ve flag fi j set Val set graph set Density set Checkpoint set Coords set Objective set Inverted set Pixmap set Sorting set OutputCols set TaskContext Ġ: < Ġ: ') Ġr ch Ġr if Ġr fit Ġr te Ġr core Ġr ca Ġr group Ġr sorted Ġr char Ġr bound Ġr null Ġr ider Ġr span Ġr resid Ġr tar Ġr dem Ġr shp Ġr suf Ġr uido Ġreturn data Ġ2 636 Ġ2 342 mat Victoria Ġst ty Ġst ake Ġst Step Ġst agn Ġst derrs Ġst dah il ings ') ? ') %( ') !=- ]) ". ]) "," ]) }" ]) <= ]) +\ ]) #/ om g om im om op om ark Ġand rew ck min Ġ* ******** (' ? (' ##################################### (' ******\ (' ========================================================================== int ense int uple int gen int poly Ġ- ) lot t lot ted Ġ""" ' Ġ+ + Ġ+ , pt c pt iles Ġg Y Ġg lo Ġg pt Ġg out Ġg utils Ġg dim Ġg dt Ġg ac Ġg fill Ġg Out Ġg ni Ġg nobs Ġg vg Ġg kk Ġg descs __ \ __ [: __ .""" __ ,) __ ()): __ "]] ex h ex args ex iter ex db ex mem ex erc igh ters data all data classes data man data vals data Man data Layer data structures data outpath name X par gn up Bound up regulated ode sy get A get line get dist get Label get Group get SP get Schema get Java get Vectors get Obs get imap get OutputCol get Elapsed get Baseline get fq get Mkt get Perspective get AnnIds get MidT get xaxisrange get MixedTypeDict get LayeredDepthProfile ab la ab outs ab aab label x label str label Patch Ġex is Ġex ome Ġex maple lin a lin c lin fit lin cs lin adjust ax m ax el Ġth igh for ster for Copra ĠS List ĠS EL ĠS AA ĠS known ĠS paces ĠS warm ĠS SVM ĠS PACE ĠS tach ĠS lowest ĠS orry ĠS cot ĠS argent ĠS awtooth ĠS laMiss Ġco x Ġco od Ġco hn Ġco grouped Ġco alesced ri am ri ption ri stop ri etary Ġimport Generic Ġdata o Ġdata extract Ġdata Features Ġdata Step Ġdata FileName Ġdata Mutated Ġbe q Ġbe be =' = =' {}'. =' '; =' ${ ", : all df all zeros all Prior all Cnt Ġx se Ġx tr Ġx df Ġx init Ġx port Ġx io Ġx dist Ġx db Ġx connect Ġx keep Ġx ward Ġx gate Ġx vars Ġx conv Ġx lb Ġx locs Ġx rv Ġx Raw Ġx Keys Ġx increase Ġx Pix Ġx intlab [' : ĠX V ĠX te ĠX Tick arg l arg ue arg Value arg count end ings end Frame end first end Freq Ġnot MNIST Ġnot imestamps from Json type checks ul alib con us con ref con ten con OTHER col dict col sum col Regex col labor ist able ist ates ist ema Ġh data Ġh cl Ġh nd Ġh dim Ġh ij Ġh ardi Ġh ips Ġh jitter Ġh thar Ġh ulp py date py arm py win py ani py breakpoint py dap py crypto ĠĠĠĠĠ ĊĠĠĠĠĠ ĠĠĠĠĠ ĊĠĠĠĠ ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ len X len ding len Seq len ofo ĠI mb ĠI Py ĠI SR ĠI van ĠI WT ĠI GPU ĠI AQ ĠI dier ure us am coef plot label plot grid plot style plot fontsize plot Item plot Lines plot Filename plot Variables ĠP ag ĠP count ĠP abs ĠP UT ĠP our ĠP rec ĠP rho ĠP LA ĠP UD ĠP LR ĠP PM ĠP SU ĠP MT ĠP DT ĠP DL ĠP IA ĠP chamber ĠP ioneer pp rc pp ops ĠA side ĠA FF ĠA aa ĠA TO ĠA PT ĠA VM ĠA mici ĠA roon ĠA QUA ĠA berth ĠA FAIK fe f fe p Ġu sim Ġu sa Ġu sf Ġu gap Ġu parr Ġcon ent Ġcon vi Ġcon stra Ġcon clusions Ġcon veys Ġcon vection Ġcon soles Ġcon creteness od m od le od os pre factor pre empt '] % '] ]], '] ={} '] ])), '] /\ '] +\ '] ='' ĠC ite ĠC ong ĠC MA ĠC LS ĠC CI ĠC ENTER ĠC uda ĠC athy ĠC zech ĠC CPR ĠC aspall ĠC ENTRAL Ġ` / os it os mo os lovakia im Reduction im tls to g to ast to SI to Circle to centre to bjects to poplots Ġtest Classifier Ġtest Exception Ġtest Batch Ġtest Section Ġtest Predictions Ġtest Many Ġtest FeatureEngineeringFn Ġtest AUCPR Ġde mon Ġde select Ġde ga Ġde seq Ġde mi Ġde bian Ġde couple Ġde laf Ġde ctag Ġde liberate (" ## (" >", ĠF H ĠF ontsize ĠF IB ĠF AP ĠF ACE ĠF UNC ĠF latt ĠF olded ĠF eder ĠF elder ĠF idel ĠF oliage ĠF evotte ĠR U ĠR m ĠR ol ĠR TR ĠR EV ĠR wrapper ĠR é ĠR LP ([ % ([ * ([ ') Ġval string Ġval List Ġval grind Ġax H Ġax set Ġax lc Ġax Corr Ġax Hx np dt np align np hi ight SD Ġ% `` list menu if n if Row if mohammad ub o ub sets ub oid Ġ3 016 test e test t test support test char test Dir test Results test passed test Cpu test Speaker test FromScratch Ġme dic Ġme mento Ġme mtot Ġme adow ust lijn Ġres arr Ġres Name Ġres AttenList Ġres hown line info line Arr line Elements ĠD il ĠD ial ĠD ON ĠD sup ĠD FI ĠD GA ĠD uchi ĠD mitri Ġlo bes ") ]], 01 700 01 222 01 376 01 841 01 78919 ance Mo .. ...") ne lems Ġcol array Ġcol Series Ġcol headers Ġcol ony Ġcol Prefix ns I ns um ns ys ns fp cal en time res time dict time start time tests time shift time bucket time Courses Ġse id Ġse xe Ġse lindex Ġse cex Ġse awater Ġv th Ġv ad Ġv ise Ġv low Ġv values Ġv map Ġv fs Ġv bm Ġv edif file format file Data Ġel vlc Error Y Error MP Error PM Error Grids ff les ta ar ta mp ta iwan ind f ind Of ind xd ind yd ind yu ind zu ind zd out map out read out arr out segs path Type path VQMM pro tk pro crustes ext n ext raw ext target ext inct min area min sec min Area min perc min fract Ġk plt Ġk dv Ġk hh Ġal cohol ĠN j ĠN v ĠN ord ĠN colors ĠN ey ĠN GD ĠN SS ĠN ads ĠN GG ĠN TF ĠN urls ĠN linewidths ĠN linestyles ĠN atively ĠN avas ĠN GROW ĠN UTATION ĠN CoarseElement ĠN ufftObj form Period art omark per ch per pass ds id bo unce bo unties ment en str date str ids str Port ĠL h ĠL z ĠL EN ĠL ake ĠL OT ĠL UM ĠL CB ĠL ouis mo les mo vs mo ody mo isture mo usetitle Ġon mouse Ġon mouseover Ġon drink Ġon cotator index Code max split max coef max diff max bins max Axis max Bad max Lambda max Emiss atu ras atu ador df x df loor df dy df tec df SoundVas pa ct fit index fit fun fit Result True Negatives Ġpro xi Ġpro medio class red class Err class ErrorPct te mple ĠM m ĠM NB ĠM HE ĠM DD ĠM ott ĠM UNICIP Ġan iso Ġan imating der ial ys mag ys urvey ive red ive les po k po x po ke po Ded Ġne wey raise msg Ġl ar Ġl la Ġl value Ġl loc Ġl ref Ġl delta Ġl rc Ġl mm Ġl desc Ġl plane Ġl delim Ġl Chunk Ġl anczos Ġl Cls Ġl suf ** )- app endix red ox red undancy core g ity p Ġuse case Ġuse Dist Ġuse PCS fig x fig mat fig path fig File fig ura fig Label fig Size fig Left size val size Val Ġplt ax ir ra ir ic ir ates ir reversible ho f Ġfrom Node 10 500 10 846 10 2758 ite ren iv baseline Ġare Equal Ġpar map Ġpar apply Ġlen sed Ġlen ient Ġlabel array Ġlabel Function Ġlabel Images ial ize Ġnum in Ġnum res Ġnum PCA Ġnum Bins Ġnum Records Ġnum Incorrect Ġnum Bands Ġnum Leafs Ġnum Divs Ġnum LateralConnections Ġnum LCCVertices assert Non ĠG il ĠG ave ĠG ang ĠG xx ĠG bg ĠG ITS ĠG OF ĠG race ĠG uesses ĠG runfeld ĠG OPCA Ġ< [ Ġ< ../ Ġout dim Ġout Name Ġout car Ġout lays Ġprint Line Ġprint mess ore r Ġstr pdate us ar us ly lib mp lib index lib gdk lib Sizes lib enchant lib gst Ġma Scaler Ġma ven Ġma gref gre the Ċĉ ĠĠĠĠĊ oc ado et en ber netics pl Colors pl EagerEval Ġwe a Val name ĠRe serve ĠRe locate ĠRe mainder ĠRe inforcement ĠRe lfreqResult comp os comp utable sc ul Ġname fieldname Ġpre List Ġpre tend Ġtr k Ġtr copy mb in ick rey cl ubs Ġfile io Ġfile IO Ġfile Out Ġfile Format Ġfile AndLabel Ġfile CollisionMethod ĠE ro ĠE dd ĠE ug ĠE den ĠE CO ĠE van ĠE VID ĠE BIT ĠE DG ĠE QUAL ph os ph us ph dos Ġdf app Ġdf unc Ġdf bool Ġdf Key Ġdf Power Ġdf tlen ": [' Ġset labels Ġset All Ġset trace Ġset Weights =" =", Ġ4 69 Ġ4 363 Ġ4 753 Ġ4 1247 date only date parser ag ues ag ous train size train BPM low file ĠB ep ĠB ark ĠB ec ĠB EL ĠB DA ĠB bb ĠB era ĠB lan ĠB AP ĠB ring ĠB MonthBegin ĠB icycle ĠB oris ĠB COLZ ĠB Splines ĠB UCK ĠB RIEF Ġun umpy Ġun transform Ġun doc Ġun pause Ġun conditional Ġun locked Ġun translated Ġun colored Ġun guided Ġun married Ġun abbreviated Ġun eqscale Ġun affected Ġun avoidable Ġ5 17 Ġ5 18 Ġ5 34 Ġ5 72 Ġ5 71 Ġ5 942 ip doctest ib ot ib bo ib ution ib ili jo ao param Estimator iter dir (( (- op ing op ies Ġthis X Ġthis c Ġthis ax Ġthis arg Ġthis fom Ġdi ode Ġdi ary log series log olib random Dim axis list In gest In verter In It In Specification In ertial In coherent In CorCoefs zer omq ast ext Ġlist array Ġlist ind Ġen orm Ġen LP Ġen onan rid o ef fe ĊĠ ĊĊĠĠĠ Ġle e Ġle mmatizer da ub da wsn Ġrandom izer 99 02 99 79 99 312 Ġcomp ass Ġcomp tools Ġcomp oser Ġcomp ilable Ġtime label Ġtime index Ġtime Seg Ġint ents Ġint poly ant ation 64 06 64 54 64 262 64 278 64 438 64 0385 64 3820 Ġclass weights Ġclass Right Ġclass Lists Ġ> \ Ġ> ', Ġ> ")) fo j fo ssa ĠW k ĠW an ĠW min ĠW EST ĠW cg Ġmax Z Ġmax b Ġmax conn Ġmax Num Ġmax Points Ġmax Delta Ġmax Population Ġmax npeaks Ġmax stepsize Ġmax NumOfUnitsPer cs i cs ur num classes num Class num Comp num density num Column num vertices num Records num States num Pixels num timepoints num Codons og s og adro model pt model sol model ratio model Loc model nos model FitFun Ġfe ces Ġfe vd Ġexpected Bin Ġexpected Range Ġfunction name init cond init guess plt Transform add Objs 12 86 12 98 12 500 12 988 12 110 12 0544 12 055 12 3567 Ġget Symbol Ġget Description Ġget Nb Ġget Subset Ġget ModelParams Ġget RetRange Ġindex grid Ġindex lines port PA ĠO SC ĠO PR ĠO GR ĠO SPREY Ġrange list nel les bs w bs ort result TM result LSTM Ġbo hman las se Ġ__ ________________ Ġmodel kwargs Ġmodel sol Ġit X ()) )): ()) ])), ()) +'\ ca vs error file error ifexists value Set sub g sub value sub folder sub opts sub terms sub widgets sub account sub directories sub haloes sub refline Ġvalue func Ġcheck If ings ummary Ġplot z Ġplot str Ġplot layout Ġplot With Ġplot widget Ġver keer ix rdbs map q map iter Ġall zeros Ġall pairs Ġall hkl Ġall slits Ġall Beams Ġhe i Ġhe dge Ġpo cean Ġpo ppler old Name old cache vel d vel x vel imits Ġwh os Re test Re cur Re cv Re serve Re servoir Re lfreqResult Data Widget Data Range Data Labels Data Splitter Data Cmd Data CPI Data Banking unt os float ify float pairs 25 44 25 41 25 168 25 9075 25 352 25 470 25 1096 25 3434 25 0796172 Ġso ort raw dir raw counts Ġline up Ġline Flux Ġline cycler frame no frame VPhi Ġpd tr Ġch icken so xr so mato Ġdist plot Ġdist cont Ġdist To Ġdist Matrix Ġdist discrete ree zing ll val Ġ.. ). 11 98 11 40 11 53 11 1400 like Ops Ġest á mean ax mean plot mean deltalab weight val read cat read fp read outs read Strip read TPF que m que ous loc idade 32 66 32 83 32 61 32 121 32 759 32 2028 32 01435 Ġmin S Ġmin weight Ġmin Base Ġmin Inter Ġmin Prob Ġmin Candidate Ġmin DocFreq Ġmin TokenLength Ġinput Datetime Ġinput fluxes Ġinput Bits Ġinput CsvFiles ĠPar amat pi res pi az Ġ[] #[ cc m cc dfn Ġz L Ġz array Ġz bu Ġz diff Ġz open Ġz display Ġz clean Ġz bd Ġclf ft Ġclf Choice ng inx ng pu text I text Mean dtype attr Ġ\ [' Ġ\ [( Ġ\ "\"\" params VAR ĠIn h ĠIn tr ĠIn set ĠIn box ĠIn fra ĠIn dependencies ĠIn novation Ġ10 33 Ġ10 86 Ġ10 29 Ġ10 21 Ġ10 46 Ġ10 69 Ġ10 89 Ġ10 93 Ġ10 81 Ġ10 789 bin ski bin Clu Ġsc ategory lic he lic zan act rec act RateBg ĠY P ĠY m ĠY an ĠY YY Ġdo me Ġdo bs Ġdo legend Ġdo It Ġdo flows Ġsh allower Ġ) [:- Ġpa ax range Changed Ġnew B Ġnew max Ġnew Val Ġnew text Ġnew start Ġnew pos Ġnew spec Ġnew Label Ġnew iters Ġnew LC Ġnew shp Ġnew gens Ġnew freqdist Ġnew scandict Ġtrain ig Ġtrain Images Ġj type Ġj lim Ġj idx Ġj day Ġj conf Ġj udf Ġj uli Ġj dh Ġj á Ġj upiter Ġj tsrdd Ġj sinstall Ġos pec Ġos ng gra db its name its Data ĠH S ĠH oc ĠH au ĠH CT ĠH ED ĠH agg ĠH Poly ĠH UC ĠH PST ĠH offman 15 39 15 714 15 165 ual Variable 05 87 05 445 05 3061 input set input index input Space input Device input Tokens input CsvFile input CsvFiles Ġlog path Ġlog ically Ġlog post Ġfig ura Ġfig Left Ġfig Managers =[ ]. =[ {" Ġinter seismic Ġinter lude join args join key Ġsample A Ġsample ID Ġsample Interval Ġpy path Ġpy Class Ġpy frac Ġpy cam Ġpy nam Ġpy ptlist Ġpy gsp Ġpy cno Ġpy GPGO Ġ[' ',' Ġ[' "', Ġoutput path Ġoutput Name Ġoutput img Ġoutput lowerlimit Ġoutput GraphFile start index start Frame start angle start Times idx Z idx len idx row idx Ref not mask not ifications not writeable Ġobject ify Ġobject Descriptions Ġno convert Ġno cover Ġno braces ĠU d ĠU IL ĠU CS Ġla ys pr incip Ċĉĉ ĊĊ 20 394 20 941 20 2302 20 99595 fa it fa fa fa cies fa ker Ġ(' $ dd ag Ġcl w Ġcl st Ġcl line Ġcl scores 33 30 33 7843 33 077 33 14764 Ġsub q Ġsub axes Ġsub normal Ġsub total Ġsub child Ġsub xmax Ġsub proc Ġsub satellites Ġsub scriptions vari mp predict g predict x Ġcolor float Ġcolor button no lab no fit no learn no version no ble no expand no Print no usek no ptmax default Units default Props default Locatable 201 6032 201 5466 201 05857 --- > Ġha x Ġha cer Ġha velimits 100 3 100 92 100 2734 100 704 100 763 80 94 80 79 80 992 80 4556 80 8485 pla usible output directory output Device Ġ6 90 Ġ6 500 ger man new g new plot new Dict new coords new Spec new fc new filepath new widget new Target new Px new WWTPCoordinates Ġ. { pred Err Ġfit obj pen width pen level pen icillin IN YEAR ste epest base nji Ġtype ID Ġtype List Ġtype generator ĠData Broker code ent split W split Rec uni protk 66 11 66 15 66 06 66 60 66 6444 66 3145 Ġrow mask Ġrow ColumnNames Ġrow LabelWidth ay e ay u ay ls ay nig ull ish ĠSe quana 45 44 45 600 45 7899 45 446 45 3537 AT BOT ell ings ell ations }, {}\ Ġind range Ġind toshow ars a ars ha ĠK val ĠK tr ĠK ne ĠK ong ĠK aw ĠK ludge ĠK owalski load Anns 75 12 75 24 75 29 75 001 75 469 75 928 75 13207 75 1962 75 5285 75 2735 Ġspec if use F use Regressor 88 84 88 600 88 295 88 018 88 0002 88 4556 88 68112 88 8968 Ġ| -------- grid I grid T grid lab grid rad vent ure "] ='% ']) ]: 16 75 16 57 16 0909 16 7839 ml pacf Ġup l Ġcal ifornia Ġcal leval sample I sample Str sample IDs Ġpos File Ġpos Count Ġpos nT Ġpos HeadCountFile Ġpos ParseLengthFile Ġpos POSCountFile Ġcor mat Ġro bj show bands show notches dist x dist Col dist cont dist discrete dist Factor Ġapp li Ġapp rec Ġapp hosting Ġone at Ġone true nan a nan all nan any ĠEx emp ĠEx pense ĠEx perience bar os bar Time bar rel bar cdict 35 88 35 54 35 803 35 657 35 169 35 1912 Ġcur ren Ġcur ried 14 94 14 98 14 60 14 28 14 46 14 82 14 887 14 6506 14 9416 ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ 19 205 19 145 19 327 19 3688 Ġkey Type Ġkey Columns Ġkey phrase with dash group ra group box ))) [::- Ġgener ar tt icks tt oman pol s tick Datetime count vals cur velinear cur rsizes )] =- box Length box sizer check IP check Max check Virtual Class Number Class Weight Class ifying Index ers ON F ON O ges s Ġ8 200 Ġ8 49 Ġ8 29 Ġ8 014 Ġ8 209 Ġ8 761 sparse int Ġarg types Ġarg pairs copy left 78 22 78 94 78 803 78 603 78 1389 Ġmake Weights den x 13 48 13 1185 13 6432 200 29 200 401 ized SearchCV mask v ĠV iv ĠV ik ĠV MD ĠV Fs ĠV UV ĠV iskos Ġtm id Ġstring FigName rand fn rand bool rand mem be ts be au Ġpath os 22 18 22 26 22 61 22 18708 nd off Ġiter List sp id Ġdate min Ġdate obs func right func left func bottom func wspace wo b wo ods Ġother time Ġother Day table html table Names 04 045 04 8175 Ġerror sum Ġerror File Ġerror msg Ġerror sest Ġsparse Cols feren ciate sv i sv ms sv io sv ars Ġpandas pawn resh ard 96 18 96 8900 96 1780 96 31499 96 75825 03 76 03 71 03 128 03 640183 ])) \ ])) *( the label the shape the macro the irs the tax the Study string OrderType column labels column ForCell Ġstart Metrics Co int Co inc Co loid ances co ances cat ĠTest I ĠTest IO ĠTest Min ĠTest Map ĠTest Gaussian ĠTest Timedelta ĠTest Hash ĠTest Conversion ĠTest Neg ĠTest Warnings ĠTest Attributes ĠTest Inner ĠTest Choose ĠTest Flags ĠTest Linkage ĠTest Mem ĠTest Clip ĠTest Resize ĠTest Fancy ĠTest Flat ĠTest Operations ĠTest Creation ĠTest Put ĠTest Stacked ĠTest Moments ĠTest Structured ĠTest GaussianHMM ĠTest PEP ĠTest Assignment ĠTest FromBuffer ĠTest SQLApi ĠTest Lex ĠTest Subscript ĠTest NeighborhoodIter ĠTest Pickling ĠTest WaldAnova 02 176 02 448 02 438 dim m Ġmo sek ou d ou zi target Category target lambdas Ġdict name Ġdict onary Ġend ings Ġend build Ġend Yr write CSV write ToFile Ġ{} ...'. Ġ{} !". Ġ{} >{}'. 95 99 95 0916 Ġover ide Ġover sampling 94 1769 94 891 Ġ100 50 ',' > 17 42 17 2555 17 13101 17 6834 '): :- Ġdataset name :: `` ĠCo le warn ed Ġcolumns ToKeep ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ 85 12 85 77 85 119 85 186 85 942 85 1687 85 0845 85 15536 85 7465 85 47619 sort ium Ġdif ftrap Ġbase Dir Ġfirst Date OR PH Ġcolumn a Ġcolumn ar Ġcolumn wise Ġcolumn reservoir na z na cf ank le run loc run its Ġfeature Vector :// , :// | :// ", Ġve p Ġve ch Ġexp Plot Con clusion Con venient Con cordance mon dri mon omer Ġscore Flag order key ]]) ; 24 07 24 28 24 48 24 81 24 61 24 659 24 3348 24 9725 24 3355 24 1680 24 8508 24 97697 Type Mapping Type Specifier Ġinit Activation _, ) 27 64 27 14 27 784 27 192 27 985 Ġdis cre Ġ7 65 Ġ7 149 freq min freq max freq Iniz cat file image matrix node alpha node Num ref lections ref lex ref Act Ġresults Path Ġaxes A Ġaxes B Ġaxes list ]: # ]: ") 86 027 86 266 86 124 86 1477 86 8845 86 0694 86 25094 IT AS Ġimage i Ġimage Name SE s SE Obj gen norm gen estring gen Watersheds (- _ Test Files Test MySQLAlchemy Test PostgreSQLAlchemy mark tables right Count AL TI var x var interp Ġpoints a back track off ering cent imeter Ġsp v Ġsp index Ġsp ks Ġsp ki ĉĉ Ġĉ Ġmean time Ġmean Count Ġmean Points Ġmean while Ġmean ranks obj types obj mode 06 10 06 37 06 55 06 31 06 56 06 57 06 72 06 9215 06 9658 06 968019 temp er temp func temp arr temp files temp fname temp dirs temp expanded temp humidity sy mpath 18 0000 18 66 err ant 36 95 36 08 36 101 36 16719 36 22686 36 28639 36 29539 09 01 09 81 09 387 09 287 09 3214 ten dency level Box 07 31 07 385 07 2175 exp g exp end exp FreqResponse Ġpass No Ġpass bands estimator classes Ġrun MultiplePass Ġrun CapacityTest Ġnode Id do as do ctor do lfin Ġscal ad Ġ, :] Par zen ')) ))) Ġidx Outlier Ġcase InputList dis place dis sect dis gust testing Num Pro a Pro ble Ex pired Ex planation delta F delta TE Ġadd AutomatedML spec data spec vars reg ard reg ulator reg ardless Ġnd upe Ġlin Vel Ġlin enumber Ġlin Regress 34 98 34 70 34 317 34 994 34 3536 34 0311 34 8022 eff UdXY Ġ... ! Ġgrid labd 97 38 97 76 97 225 97 448 97 065 97 344 Ġloc max af rica Ġpart Labels Ġnon cyclic Ġnon Zero Ġreg a Ġreg ener Ġreg ulations Ġreg ulator Ġversion ed ĠJ AR ĠJ ada ĠJ XP ĠJ erry ĠJ MX ĠJ oris ĠJ papbp ĠJ AVASCRIPT 92 82 92 947 92 9994 graph yaxis Ġmode lt Ġmode lfile save killmap save Gnuplot Time Plot Time Stream ton netz points Original Col Cnt Se as dt ree dt nat bu k bu o bu fp bu quer ĠQ sa ĠQ rot ĠQ CAT ĠQ Rect sg c lp bc 84 35 84 68 84 059 84 617 84 238 84 8076 84 334144 Ġtext grid Ġq if Ġq test Ġq ads Ġq gis Ġq ej Ġq adapters Ġopen close Ġopen FileDialog Ġopen Fisca Ġwork time ram III IC HEC left Img Ġtarget CSV my Y my bool my dataframe my clip my phi my inh my wmax Ġ[[ (' Ġ9 00000 Ġ9 319 Ġ9 108 Ġmask Images tx BIOES Ġcurrent Label move piezoflag nal u Ġread file Ġread Count ass y ass ium option xform .""" % ac er ac var scal lop Ġim count Ġim hist Ġsum stat Ġverbose ness rel size rel Mov ids byname ... ( ... "] Ġtemp y Ġtemp func Ġtemp List Ġtemp WP Ġmod uli Ġmod actv Ġmod rxnm non log non protein non sponsored UT ED Ġav enue math mpl Me mcpy kernel manager gr n gr atu gr atic 65 24 65 07 65 50 65 04696 30 82 30 955 30 9528 Ġcluster Window Ġcluster Values db Rsp Ġac res Ġac quisitions File e File Selection Ġcv terr filter Manager filter fxn unk te cluster Sizes sol ute sol ucion Ar rival Ar thropods batch X Ġad mit Ġad xs Ġad hoc Ġad mittance 37 06 37 1038 37 3306 37 0124 37 9766 37 3897 50 84 50 8067 50 858 subplot Arr late v Ġbatch s Ġbatch Seq Ġbatch Inputs step response Ġloss V Ġmulti words Ġmulti collinearity Ġmulti verso :] < :] ``, :] =='. Ġcompute Cost Ġcompute FromScratch mt c tf Def tf cn tf lite tf Exercise ls w ls mi gn he ĠCon ductance 87 96 87 008 87 3377 flow ers mpl On vi ps _) /( Ġtra ction Ġtra ba point attr RE DS top ical CA O CA CA CA GT CA USED lambda v stem m Ġmult ivar Ġmult ibeam OD ED OD imReduction Ġlow High State Var ik stra Ġoff sh Ġlevel n Ġlevel Mask ĠCheck Index ĠCheck Output ĠCheck Dynamic 44 13 44 26 44 106 44 4817 mode st mode lfile mode Nos item name colors ys ĠZ v ĠZ ED ĠZ BASE ĠZ LP Ġcreate Index Ġcreate parents Ġpoint plot si esta =[' . active Freq active Document active Bits Ġneed header fill Rect (* % ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ fer ro fer DB 55 2941 55 6476 55 93407 Ġob i Ġob rys Ġob tuse Ġsing ly Ġshow traceback tree file tree map Ġpoly order Ġpoly phonic EN OUGH stri pes 23 89 23 1982 last point last Handle last Prior last CSPrior last ActionZoom last WindowClosed ome vent Ġ(" -" Ġ(" [], limit OrderDict du a du lable img set img filename img Id img ToDisplay img pxl Ġ20 22 Ġ[" -", multi core Ġfilter py Ġfilter Size Ġframe wise can descent can bus Ġev a 26 11 26 36 26 28 De coded De Util De velopers AC R AC Freq Ġlast vals 77 99 77 76 77 3397 77 4529 77 26285 ĠDe bye ĠDe belius ĠDe haene Ġgraph Legend Ġgraph wiz view M auto fill auto Fontsize RO BI ([' {: TI ML over ly over hang {} {}". {} ={:. {} ]". {} $'. sup im Ġlinear Line Ġsplit data Ġsplit func Ġsplit Feature .") ; .") \ Ġ] [:, rit t Ġ201 30331 ga it net in Ġpl unge Base Object Base Pipeline Base Recal Base InteractiveROI ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġsm q Ġsm ic 90 844 90 2280 Ġ[- ], cell b cell Sizes cell pyfile mer feld fol k matplotlib tools Str ategies Ġmatch list pd yn Ġsim il pdf DF pdf tocairo stat prob stat elist ĠSt ombaugh diff Length diff trap other flags create Group create FontDict 42 18 42 905 42 8073 98 01 98 175 98 216694 Ġdraw Func offset per ugh lin Ġtotal count Ġtotal PE Ġtotal Slippage Ġtotal Commission Ġtotal Turnover draw Pixmap ob ss ob id ob liczan window Title vs d foo ommm _[ [' Ġ} ): Ġ} `` AB Y AB ANK AB CRangeIndex Ġhelp menu source view source arrayindex make title make fill IP ROT layer Id FF G FF s FF CC FF DAB FF DEAD \\ | \\ '+ Ġdec Tree times lot )* ((( day list day str igen ic metrics PerLabel List Type List Imgs Ġ12 80 MP SC MP ATH MP oisson Ġdt end Ġabs d Ġabs diff Date Field Date Slippage 43 8627 43 8822 seq Pg 67 78 67 048 67 6924 67 4296 67 9296 67 9425 67 9993 67 2704 ced itor Ġoptim func ĠPer Share DE CISION Ġlines hapes 08 78 08 37 08 000 08 346 08 1274 08 9475 mm x rec liststore Ġfunc right Ġfunc left Ġfunc bottom Ġfunc wspace mag V cle ment Ġtitle case Ġpair indices gener ados xy f xy closed To O To Re To Time To Num To Start To Load To Go To Codes fs mc ev y ev id Ġab ic Ġab use Ġab dif Ġab khazia extra Data Ġbest i Ġbest err Ġbest Flow ins ulation ins pring ins urance Ġdistance Delta Ġcross cat Ġcross filter Ġcross point Ġcross TabMan Ġaf rica Ġcount plot gb data first dict first LayerShape dates ize rs w lag ging open ms open raw open Par open VA open Url open gis Ġtrue List Ġuser d Ġuser List 000000 010 height labels Un wrapped Un biased Un bounded Un Stable ratio x 47 995 47 140 47 013 47 3426 real imag fra d sim EM Ġsave loc vis Size Ġcls dict Ġhigh res Ġmap base Ġca usality Ġimp recise Ġselect mode lu ck best Theta Array Expr Array Subclass Array Champ png s png filename bool Index bool ify bool vec 60 88 60 946 60 2048 60 6444 Model Fit Model Info Model Anal Model Flux ier ung OT TO Ġtick marks poly product poly hedra FI SCAL Set IC Set FileName Set Height Set Margin Set Foreground Set NoDataValue tmp x tmp kwargs tmp mask tmp Filename tmp Cloud rad as rank lab rank raw ene wegen current Optimum current ScaleFactor inf antile inf erring Ġfont exp query i query Parameters div h depth wise connect Slots Ġcmap cycler bf act Ġeps name Ġeps fac Ġfill begin ze ichen full scan full dirs go ix go plat edge parameter Ġ'. % Ġhist bins Ġcorrect Periods Comp utations 49 32 49 32918 Label led Ġtree corr ĠUn Cor ĠUn hashable Ġpred t NA D mu sed 28 9999 28 215 28 3526 28 9759 28 9866 stop Times keep idx keep Cols ui per sys paths cast name ĠPro gressive "]) [[" CH ISQ find list find freqs Ġdiv max job name Ġedge Feature Ġedge Colors For Class For Missing For Storage vol k 29 35 29 04 29 30 29 018 29 0443 29 0555 29 32937 cos m cos z Ġclassification TrainingNum Res Proc Ġhere in Params SetIC Ġstop but ĠPlot Targets dev docs dev XXXX 39 27 39 30 slice Values Ġanal agous unit Vec Ġbinary Thresh Ġimg path Ġimg Out 21 3217 Ġge xf Ġstat ut Ġlib ref Ġlib scores Ġlib groupby Ġlib sbml spark Conf Ġps series 68 97 68 184 68 1818 68 325 68 248 68 2988 theta units )]) ** Ġmon oton CT IC User Env sorted Index ED GES Ġblock dims local min local source ken pom flat lnprobability mi ser Ġsq m Ġtmp x Ġtmp Name Ġtmp sf Ġtmp Nii Ġtmp dictAlg .) < .) `` .) **(- .) &( 38 122 38 315 38 307 38 379 38 2565 Per missions Per SM Per Pop Ġactual Size ĠIndex DateFormatter ---------------------------------------------------------------- ------ ")) ], Ġts iz Ġts ds Ġinclude Files ĠPython ic 2011 0101 Ġevalu ar apply Schema IO Stream annot ype *( @ ress ing Ġelement Type Ġlink Label Ġlink Button Ġ15 44 Ġ15 42 only files DI STRIB has Parameter vector Size ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġcre pt assertRaises OpError Ġrank x Ġrank sep Ġrank bincount 46 119 46 965 46 38101 46 1362 ends lope Ġpython w action K action Load action TwoD action Harker action ZirconCe Ġcell set Ġcell Overlap Ġcell Proto Ġ'% + inte gridad mf msim ĠAt tribution ĠAt Tair convert AllData 31 106 31 855 31 10589 Ġobserv ances cache able Ġreal ness Ġreal neighborlist Ġvar ion Ġvar Type Ġvar dense Ġvar Each Ġlimit Months Out flow Out Edit Out comes Ġsmall class ML PC aN odes beta Y sm allf Ġclose Plot Ġmain Sizer ." } Text Stim 2013 0305 2013 0341 647 0 647 8889 Ġret new 235 794 235 933 Ġdesc N Ġlower Upper Ġlower Pipes Ġauto f Ġauto layout Ġauto attribute Ġauto increment Ġauto logous IL M initial Values Po pa AD B AD a AD LS AD OW AD ATACLIMATEINDEX AD CTra Ġstd devs pad arr dif matrixPM Ġerr V Ġerr Val ov l ov y ĠRead Uint 117 4667 117 2988 117 2307 Ġold path Ġold keys Ġold memories ĠCol umbia Ġsin ogram ĠSV HN Ġwrite Data nc map nc numpy nc dc channel v bit coin ĠMe as ĠMe mento ignore Errors median values lack Friday Ġconstant ValuesDict sa ifmohammad Ġheader txt Ġop Str SA IC images Paths Log Log Inter im Ġmarker Func 48 18 48 987 48 3745 48 10212 56 64 56 239 56 19492 Ġscalar mappable classification Performance down ind ĠLinear Ring ĠLinear ColorMapper Ġnext T limits Len Pre servation IS ource IS SON IS SN IS ervice IS RELEASED Ġref names Ġref Num Ġref reshed Linear Axis ĠAdd ition ĠAdd resses ĠAdd BOS ĠAdd Diagnostic ĠAN ALY Ġdelta Length ĠMulti elem ĠMulti KernelManager ĠMulti layerPerceptron ĠMulti LabelEnsemble ()[ (" Ġfix ups Ġfix Signature 57 88 57 04 57 454 57 677 lon lon App CrashHandler nb or nb item relation Matrix Ġroot grp eq p Ġdim features ĠLog its ĠLog normal ĠLog ModelView ĠLog Analyzer curve types curve Points ock name optim results Ġsystem TestEnv this X 69 36 69 395 69 665 69 11837 TY R Ġbox X conf groups conf Gen context ual month Dict month Start Ġlegend name Ġlegend ColCnt ]* [\ ]* |\. Get Number Get ColSize Get KeyCode Ġstyle key Ġwx agg kind id Ġ"" )] Ġ"" )}) cd rv cd aterange tuple Resolver Path Length Path PathDijkstra Ġxy RGB Ġxy zs Ġmy comp Ġmy color Ġmy Options ĠException On ws ilent Ġfast qs Ġchunk tokens obs v obs name obs df obs Range Sh utter Ġnan loc Ġremove Rare Ġremove PhaseJumps Ġdown Sample Ġdiag nal Ġdiag nosis Ġ'# ', Ch I 137 0924 ĠRandom Seed ĠRandom OverSampler interval index No vel No leg No Header Size Of Size Filter Size Algorithm Size RaisesValueError Check AnovaMixin sw rad sw Entry Ġkeep X ____ / fun chspace missing d missing wx ĠLo LIM Line Length Line Ref Line Interaction Ġlong Help Fa ir Fa RTs Run Error Ġmpl Text ĠOn Btn cut number Ġser s Ġser des Ġser ials inc C rm c rm cg null er Py OS Py RhO Ġcsv out PL IST PL INK ĠBase Column ĠBase Interface ĠBase StdIn mic rowave mic kett Ġexec str Ġexec blob Ġexec introspect ============ + Ġds d Ġds l Ġ16 96 meta axes long time project dirs ret te ret bins ĠRun LinearModel ĠRun Driver Ġbar c Ġbar rel Ġbar thann sig mat sig scale 89 88 89 86 89 384 89 145 89 16657 89 1172307 Ġspecific Regions Ġseq utils Ġseq record Ġseq fault Ġlike v 74 150 74 6627 targets Are dec g ĠLe ap Or ion Or thonormal Ġ"% ")) band params imp ulses greater Equal Max Like Max NumRows Ġpe lo Ġpe ut Ġpe rez Ġdel list 686 085 aut ian aut olim aut olink noise Model Ġcs ft Ġnb dtri Ġnb Elems ĠInput Hook Ġpr fs IM U CO I CO OL Ġdivision Name xaxis values ĠIN CLUDES ĠIN DEPENDENT TS X TS top case dir case fold case Sensitive single Slice Int GreaterEqual Ġlw lr Ġwo of ':' _ ':' -', ':' |'}). avg temp pick y Result Bundle Ġfin file Man ufacturing Ġgen ent Ġhead line complex ify Ġrate xp ĠYou ku Ġdiff Const Ġevery time Ġjson schema ,), ) ("% ! Ġcat Id high d high levelfeatures Axes Locator Axes Zero Ġconf ints tract ID comb s comb at comb ines session manager button Layout pers ists peak width peak Dist peak Button peak DetectedIndices peak Fwhm ĠOr ca )+ "+ )+ ((- )+ ','+ )+ ","+ )+ )?$') 51 1206 51 4586 51 8591 ĠMin utus ('\ +\ Ġpredicted Int Ġpredicted Columns Ġpredicted ColumnIndices Ġ14 32 Ġ14 16 fr mask fr ills Graph Smoothing Graph MapShape Input Splitter 63 063 63 1915 Ġview menu Ġview Mutated lex og Ġdep Coef except All CE IC CE BP 001 3564 Ġfinal sol 79 02 79 319 79 304 79 8425 Ġ13 97 ĠKey point Ġproject ive ]+ "/ On Image On Change On Btn Ġparse result 54 96 54 86 54 07 54 187 status Label 70 25 70 87 Case Sensitive Qt Agg ]- > Color Profile Color Brewer EX US EX PO tag label ĠOR A Ġsym num 83 00 83 154 83 0155 83 9425 Min Distance Min Pressure Min nesota Dist N AA AC Ġfmt int Ġscaling Vec Ġ\\ " 59 17 59 8424 59 1387 measure Psf global toc Ġrc usum ĠDi retório Ġconst f Ġconst ancy Ġmonth No 2014 0101 MS cols MS FontDirectories MS Folders !! ' !! ) panel c Ġattr b az is az bins az ione mid freq mid rank blue print script ing script Type Ġus ar He II NN object NN Timing Object Selector negative LogLikelihood Ġprevious IterationStats Ġ"\ "\ mass flow mass rate mass action Is Train Image Data Image Draw Image Exporter Image BoundaryError Ġsig uient Ġsig inficant Ġjob name Ġjob ids Dir ty 199 184 199 245 199 75358 nr x take Ordered 93 02 93 95 93 458 93 9635 93 1948 UP B UP PT UP GRADE ĠLabel ColumnName 76 96 76 36 76 0734 ĠAll Templates next parm Ġwhat todo Ġwhat isit ĠTrain CV marker Sz pixel Stop win per win Title =[" -- ĠGrid Fs ĠClass ifications Ġflat top black triangledown 300 9453 DATA MONEYSUPPLY Spec Layout 81 85 81 758 81 66666666667 81 6693 803 0964 803 7507 simple axis ĠSo up 82 655 82 994 82 376 82 9934 Ġpad VectorSG Ġpatch label second aries ([]) [ aa h aa aba ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġdet cat ,- , Ġway nodes 72 340 72 1701 72 11660 client id external JsonTable ĠGradient Table DO E Ġcustom ise Ġcustom BusinessMonthBegin Ġcustom BusinessMonthEnd Ġcustom SaveDir CP US CP ACK 7843 935 Qu ads Qu otes Qu icGraphicalLassoCV ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġhyper rectangles fl an fl array fl name fl icker Ġna CumData 255 184 255 0699 255 8569 Normal testResult ĠMax Like 500 26 Ġwave field boston GraphNX Ġword vec Ġword dicts Ġword toix description Boxes post DISTANCE ĠCh irp Ġdx vec Ġpp plot Ġpp concat Ġpp Total NB ias sl ang mut ant mut ants Ġcost Truck exit Trade Key Name ĠInt ArrayFormatter frac Var Ġred dening At X At tempted At ThresholdsTest chi ind phi H Ġsu ites Multi Reader Multi Dimension Multi Stage Multi Scans clean ers An imate Button Wx Window Size symbol list Com Var Dis abler Ġround Off Train List scan N scan line By Position By Bam ĠPy Eval ĠPy Long ĠPy Logit ĠPy Druid ĠPy Colorize ĠPy OpenCL ĠPy Graphviz ĠPy FlowScheduler Ġra ms Ġra xes Ġra coon tot o HE I HE II double B Sub Type Sub Menu Sub Find Column Class Column Values FA EBD Ġshort Help wave On del ities LS B LS tep Ġfun chspace 180 805 180 2065 180 9316 53 994 53 8062 53 85526 Add Method Add Constant Add Hypothesis Ġsrc List NAME III PS FC repeat Annot >\ (|, 62 2590 cb t cb day mc ps Ġdesired Result network type network Model Random Streams common VariantsPerRegion Config Item Ġmp os GT FS ĠSpec ie Ġordered IDs 73 11 73 00000 73 0504 73 065 CL ES CL ID Exception Trace Ġpys nptools CD AA CD DL flag color GB Q GB DT tex file čĊĉ Ġ categorical dtype 52 86 52 2580 52 6494 52 2550699 ĠSelect able ĠSelect ive DIR FORMAT uccess fully proj Drop gene List ," + til is ART G ti ene Batch Idx Batch LabelFile Ġopt Value Ġopt var Ġopt ID Ġopt Num Ġopt oanalysis mar ines Ġpage main CS MN sequence Motifs Split Mask lm db lm nn }} }) }} $$ }} (\ }} _{{ 2015 3504 AM BLE ')] ))) Len na Len Field Ġavg Data outer frames )', \ Ġsf c Ġnt ar Ġnt ies span dex prediction Step ait off lb rt Node IP Node Dist Node Results Node Port Ġparallel Solving https ource bb w Ġmag cols Ġspecial dict selected Rows vl ar 71 10 71 33 71 88 execute GetList ("\ " ("\ [ Ġprop rietary 123 09 One Freq One OfMany Ġmid TermBuffer Ġgrad check Ġap radius truth Matched ('- ')]) ker type tab files tab widget pri hdu pri mers )} $' )} _{- Output Vars [[ (' Ġmis mo Ġmis class Ġmis aligned Ġmis calculation Ġmis behave Ġcoords A mem greed Num Opt Num Interactions SR ID ron o ĠSparse Block CR PX 41 786 short short Ġlayout Left ĠID M ĠID col ĠID Plot ĠID ENTITY PAC s Iter ables Iter ating Iter Values With Boundary With Versions With SplitAdjusted With YAsDataFrame æķ°æį® éĢıè§Ĩ表 hidden class Of Int Of Different UM B 125 3212 125 0460 :", _ Ġsegment ing Ġneg File Ġneg HeadCountFile Ġneg ParseLengthFile Ġneg POSCountFile CON SENT Ġfold norm Ġfold Ind )[:, : RB R Ġnearest N Ġvertices B Ġ'< . Ġ'< >') page Annotations LI ES LI VE Ġxmax s Ġanaly tes mal a 58 1917 58 2033 ('/ ' ]}) }) super model super factor super modelchems Layer Norm ĠAR GB ĠAR MAX hen ator Ġspark Version Ġspark testsupport track vis allow Change SP ORT Ġpost pad Ġpost processor dummy list dummy gr %% )' Range Type ny lat ĠCategorical Test FE F clear label which lf wer ty sd as reference Name Ġobs g Ġobs param mount ed }$ '), ero Sim 0980 89 ĠTree NoVersion Ġjobs filter force IndexLabel 61 663 61 8624 Ġir r Ġir red hel lip geo data ĠHe ights Ġbutton c Kernel Cache Create StatusBar Ġdy y cer action ĠGenerate Predictions NT W NT rials ĠFile e ĠFile Format ĠFile Lock macro listmenu cr Entry car ta imer as Ġmock ForcastDay lw SpinBox Ġbit score eigen c Ġfree time Ġradi os 91 856 lst nr calc Back Categorical Hyperparameter ordered Edges ordered CDS Regex Str Ġspectrum s Ġspectrum All ĠDis ables ĠDis crepancy Ġcanvas w effect ively ĠBu Pu Event View Event Hook CG W Ġhour min tables SomeDb }\ .\ Ġ"' - Ġ"' > Ġdiscrete mod fet al 101 7 101 8 101 101 101 488 101 722 101 0534 ĠNormal ised Bar æݨéĢģ Bar rett '`` ; ba idu BC BM 714 0 714 2 714 229 714 087 Ġes cal Ġes pikes custom X custom Y _)) ** hy bi callback d čĊĉĉ ĠĠ Start date Start Label Start End Process Id Process CD __. % ĠDist rib ĠDist inguish Ġdeep net čĊĠĠĠĠ čĊĠĠĠĠčĊĠĠĠĠčĊĠĠĠ çļĦ ç±» çļĦ 计ç®Ĺ çļĦ æķ°ç»Ħ Ġdev iances Read Seconds Read FemResp Trans Data Trans actions Trans muter bi map bi weightscale WH i Ġtp mode fetch ing Ġ([ ` ,:] } ,:] *( From KernelCache Length Delta Ġtermin ators Ġcodes B ĠFit Line Ġtrack list ĠrcParams Default ROM ACS tw ow tw old topo centric Ġfft arma ĠEn countered Ġmne u Ġmne monic Ġgene Type Ġgene activ Ġgene Pred RES I transforms Menu PRO FILES PRO GRA PRO SPECT Ġdesign ing ĠFigureCanvas Class her omone ĠAd versarial Ġgeo ip Ġgeo dataframe Ġinterpre table Ġgr l Reg Example Reg ulator Reg OfInt tm n 128 3262 Ġrand fn Ġrand gen Ġrand fnc Point biserialrResult gc Edge SH M SH IP SH IPPING PY WPS PY GLET Ġ"+ ". ĠPipeline RunError ĠFeature Definition ĠTrans its čĊĠĠĠĠĠĠĠĠ čĊčĊĠĠĠĠĠĠĠ Ġ---------------------------------------------------------------- -------------------------------------------------------------------------- Ġstage in Ġstage outfile dest al PR RR PR ONOUN gd v gd on qt de wb id Ġ31 66 geom odeller ĠSub way ĠSub mitted ]/ [ OS GB Ġexclude Val Source DF Ġ"- .", 99999999 992 )))) \ ----- ' Ġexpr buffer Ġcomment ing byte orders 005 072 005 2730 Pandas Delegate Pandas ExecutionEngine Ġmultip olar mx dates ******************************** ****** Mo yen Ġmd v Ġmd bs Ġmd vis Ġls Valid Ġstar log )\ (", gap ic population Parameters Select Rows Cor Diff Cor nsilk Ġph vec Parameter List Mean Adj Mean Imputation PAR QUET Ġneigh bs Axis lineStyle Ġ22 10 (\ * ĠOutput HTML ((' {: isy napse spectrum tofit ĠGraph Artist Ġsite cfg xd c Score Op Ġinside A Ġinside B Prob ably Ġclear Fig Ġclear Flag ĠVari egatus Ġur is Ġconvergence Check ĠCount ies ĠTable Formatter ĠTable Config ĠTable Plotter ĠNew Matrix ĠMA IL Ġ88 25 Ġ88 60 OK Button Ġcb ind Sim Mat Sim Client Arg ent Arg Parser gal par Mask T Ġss li ĠFFT Conj Ġwin Title boost FuncSignature Ġpk type bd gw NG RAM Ca Se Ca usal 159 4545 159 1695 159 1093 rl ons Ġmajor locs coun trate =[[ ]]* 0001 2345 but ler but anone 078 7285 400 400 400 6654 Current Alpha Ġprec is Ġprec li Ġprec ice Ġloaded Selector ĠCur rency 663 123 663 258 663 0531 Do or Do ctest km z MOD ULATE ĠDes cri Ġbig class Ġpanel c Ġpanel nd 150 9419 Ġ; -) rams ay Ġns bh Ġns ppol Version Id checked Action ĠFree k Ag gr chart wks Ġconfusion Matrix interpolate InitialGuess ups ampling calculate PowerDeviationMatrix OB V hyper column Ġpt ms Ġpt ches Ġpt chv dow ana percent Overlap ĠUp graded ĠSample Rows "% \ Filter Bank Filter Predicate Ġarrow Enabled glob Rot Optim Method Ġmasked Dict -> [% SM perHM Ġints lices rea ctor Rec uperada Ġsplits Array Ġgra sp Ġgra fico ĠStandardScaler Model xmax len Total Production hess p Ġstrip ascii Method Formatter SELECT ED TP ower Ġresid fignum ĠIO Test ee bls sca ftigs ĠTensor Signature 105 47 105 10439 ĠColor CAM ĠColor HSV ĠColor xyY ĠTra pezoidal required Props Ġtot Width Ġtot Height mas se 126 097 multiple SampSize ---------- ", ĠNon Intersecting cutoff Jeff TA AC TA IL ĠPoly Kernel half size residual axis Ġ"{ :> Ġdump f plane te filtered data dele gates ]`` ; 2017 0612 tax ids tax onomic Ġbasic Converter Meta Class EG IS Pos PowAx dp Drag dp Lift Mode List Ġvariant Pos Ġvariant qc Ġclosest Cells Ġclosest Inputs Ġmouse click Ġeig Val 336 32 Distance Measure 456 2037 2005 1878 Ġtau Mem bre usch peaks removed peaks CheckBox beam codeent ä½ £éĩij 784 02879 Ġactivation Threshold ĠMethod Type ĠDummy Build 120 20151 109 14 And Graham And Scum rd noise DNN TF Ġ? " Ġsen id Ġ28 80 275 43989 ĠCO VER MIN S MIN PACK Ġcatch ment SO I SO WFA Ġprice X psi pred Ġhel ptext 800 20454 Ġscan list Ġcdf plotdata frozen bits ĠDraw GL Ġgap T Mod Date 318 3848 318 3201435 Ġinterp grid Ġmem file three Point 252 6580 252 8745 252 6478889 Ġct str eig v some X some where Ġanalog Data Ġrad viz Ġrad olan Entry Type Entry Context Ġtab Widget available Power ĠGroup Results TF CE TF BS Ġsec id dialog Box Ġcurr Average '$ ') Rest aurant 873 12646 ĠMean Variance ĠNet Stim ĠNet pbm Ġenable HiveSupport sal i sal peter Ġlab e Ġlab ls Ġrest ify 896 365 896 399 Ġfr mask Ġfr inges 354 8836 Ġstim Out Ġstim ulated Ġstim ulator PRE TRAIN PRE COMPILED Ġpages izes ĠUser ModelView GR Y Patch At Ref Role bm num 707 975 184 174 184 99677 988 4 988 316 Panel GLS ued o rip ley 219 785 LM stat sn RNA Ġbg label Ġdr sq 224 054 224 9020 pv rows pv mismatch Ġpseudo counts Learning Offset Learning Enabled Learning Decay Ġslow s UC B UC F UC ED uro bi Ġmx cond 110 6 )> " åº ķ Ġinp gate 401 15 401 2302 Ġut ime Ġut arget Ġut wa 636 363 dash Offset UTC datetime DEFAULT SECT Ġautos pin Ġmargin ally ĠSome how Arr Delay Ġpat ForRec Frequency Delta Sc enes ĠVar GridSet 317 659 317 9885 317 7056 Ġ--- ') icon omi cached Sql Ġml ps asset Id Handler Npoints 901 2 901 627 901 492 901 7538 901 29755 ç» © Norm max ĠConfig Loader Ġgl n Ġgl cs Ġgl Clear Ġmaster ax Ġvec x Ġvec FromFirst Files List ERE CT 905 443 905 870 905 531236 917 32629 Ġast Lib Ġ87 31 Ġaz iele ĠSum m ĠSum Of ĠSum Lines pb kdf ĠTemp File ĠTemp eratures --------- ' Ġhess iand 700 432 700 698 Ġcorrespond ance ĠText ile ĠGo es ĠGo ix bw I Ġ================================================================= ====================================================== Ġann ular ĠRBF s stand s ĠDATA PLOT 25490 22 ĠAC CEPT ĠFloat Slider 119 12906 genome Len dta ps ]_ ).""" overlap DutyCycle Ġconnected Cells 756 126097 bp ms bp map Ġyt ie 998 22 998 156 PP PRRR Ġmerged Model determin ing Ġthresh Groups Ġmicro state Ġmicro structure Ġmicro scopic Ġ27 68 Ġtopic Ranks Pol ic Vis cosity Ġbw func Ġgray Images ĠHAS HS Ġcollect able Ġcollect ively Ġalt result decay ing Ġ95 55 perform s ĠWrite ToFile Ġmov mean Auto Data Auto Spin phys io 003 874 003 8853 196 80801 Ġspike train Ġspike widths Ġspike recorder TRAIN ER RNA SEQ need ToSplit Ġtt max 333 2519 Ġarange d Ġtax count Ġillust rative 264 4 264 436 264 2315 264 00415 265 175 265 07901 265 794 265 9245 Pa id Ġfid dling conc ord conc ierge READ ABLE omega inv ĠHist GradientBoostingRegressor izers Mixin Ġsyn Perm Seq Alignment 168 2088 168 9707 stim Scaling stim ulatormodels 975 0 Union Mode Union IDs ĠShow ConvNet Ġpv mods Ġpv syst /" ; Ġ'{} '; Ġ'{} %'. Ġ"< =" ĠMon toya 984 6 984 978 ĠFormat String ĠFormat Obj ĠFormat Agent Fixed Source 185 6964 375 0242 Dep Prof Ġfpr list Param Dict plate par plate pars Match Data Ġwhite back 237 260 237 605 LY P 296 23154 wav path wav FileName delt x ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ "]] ], PH SurvivalAnalysis ĠProcess PoolExecutor git Commit âĢ ¦ +'/ *. rh cloud saved Data saved ict saved JsonTable ĠPRO TE FFT ComboBox ĠImp edance 132 4557 132 83867 806 9916 +( .*)', zi ed zi series Non specific Non Callable Ġ99 1 Lat Info Lat via Exp lo Ge Hdr gauss Parm Make file Make Partition Make Common Make Cylinder spike Out Ġmk plots ĠMy ers ĠMy stery ĠMy Stderr Ġtb hdu xxxx x disp Ribo disp Rna disp Fact rp mbuild Ġeq w Ġeq scale Rep Chain 355 36 355 968 sz h TT LS city B Ġvelocity Mode 0909 09 ĠSc enes web kit Ġ96 93 ']], ), 032 3647 dc rf 644 06205 644 1477 644 18109 115 10067 034 158 Ġcar b 399 250796172 059 1285 059 12227 976 6444 976 03640183 Fig Conf 000001 500 337 27737 337 46397 connected Cells connected Permanence users InCluster loy ed LABEL PAD Jo hnny ĠBayesian Estimator ĠTO OLS ĠTO FTOF 149 64735 bur gers 808 9965 349 3426 349 25188 349 04984 pf m tu ft Price Tick Ġprojected Data ĠFast scape ãĥ Ļ ĠPoint biserialrResult 804 0834 804 03401 Ġxml rpc Ġok files Ġ(`` _ ĠSE CONDS ĠSE CURITY AP F AP PS Ġphot ocurrent Ġsigmoid al 378 60946 uel Pres Ġtim bre 360 94333 ĠLoc Bif ko ala Ġdecode Base Ġdecode Mask 205 2 205 1495 205 31762 165 47 ĠMatplotlib Backend ĠVariable Box ĠVariable View )[: ]) 212 995 212 06968019 Normalize Query RAIN TS latest Date Ġsho ppes Ġpkg dirs 175 8 175 9 175 873 High lights Year Offset Convert ToBitmap 899 1314 Expected Wins BO M 122 183 cen ir vertex color 154 1629 Ġtile stuff ae if Imp rove 807 479 Ġadapt or Tri ang mouse div 144 68 entity MetricCsvFile Err Miss Err Bars Ġminim o 211 304 ĠOrder Event ĠOrder Status Ġconj untos 147 20659 SCAL ED pm dec Ġvars Names Ġplus Dur ,** {' Ġdiction naire VAR ICA colormap ped Ġpval idx Ac cs Ac cepts 937 304 937 45845 Ġ94 3 Ġ94 00 Ġ94 18 Ġ94 31 Ġ! / Ġcentral Atom Ġentity Data ĠSimple XML Ro of aug m 992 97936 992 663258 Pipeline After ĠLat in 004 873377 Lin AccelTS Vec Model 114 3735 ĊĊĠĠĠĠ ĊĠĠĠĠ ĠVer ts ln lst Area Level Ġmenu Bar manual Conds Rank sumsResult ################################################################################ ## uss ing Det ectors kd j Ser DeUtil address ing Vals Arr Ġpast ed 809 27279 ("{ { meter ing 432 0103 Ġ"{} ({})". reads Mapped Ġ101 6 Ġ101 14 Ġ101 17 Ġprevent ed Local Time Local Dot 900 7100 900 3383 192 308 ĠBoolean Function ĠAct s 347 26 347 267 347 223 347 1564 ki logram 785 456 785 0416 EAR LY 202 84 202 208 202 9880 227 180805 397 94 127 08 127 057 127 2164 127 2925 Ġbra ke isot ype 027 2677 027 1689707 Ġunion BatchIdx Ġ84 94 Op qCld rg idf 968 0167 Dense Net Ġmc plates Plotter Test 012 20 Ġ"( .* 906 257 906 700432 Ġ:- / Ġmm Scaler ĊĊĉĉ Ċ 258 268 258 9532 ĠSp inx measurement Queue wl scan Ġcoun tours Tick Locator Ġcum freqs Ġcum meanhist 603 922 æĪ ª Hot Features ĠROC Curve 107 9606 Ġvideo Info 315 37860946 ĠState ments ĠState ID given ess sci hdu escape text Ġlp mv Cross Cursor ('../ ..') 667 3332 667 2316 667 75112 195 01 195 228 195 19651 don ated è¯ Ĩ è¯ Ŀ 312 089 312 839425 306 938 It No Ġdecay ed 424 712 424 766 xtick markers Ġdeg as Ġactiv ating Sigma clipResult bigquery storage Ġlc fits Ġ123 8 thumb loc thumb filename idle lock }), '. neuron models neuron Parameters neuron dictview 912 37303 FR P Ġshifted Frame knn Match central ities ĠCustom Row ĠCustom BusinessMonthBegin 206 7564 intersect All 875 2734 875 9497 875 8267 Ġdash y Ġdash rotation Link ed 384 9994 Ġgal data Ġgal par æĹ¥ çĽĺ ï¼Ľ ï¼Ī Ġamp m Ġamp eres Ġamp licon ĠDI VID ĠDI AGON 138 787 138 3964 ĠLength Delta Script Element dri ves push down brain wy wavelength Km motion file Pack edMessageReader 016 012 016 3536 orted IndexError Ġcam erab 075 64856 075 21206968019 ĠNavigationToolbar Mac 077 131185 077 034158 974 199184 fg mask 625 85125 Ġplay ery 314 801 Gamma proteobacteria ĠGe odesic 266 0 266 8090 Ġdm dt coll is 394 43327 ĠSignal Event ------------------------------------------------ ------------- signed RatioOverlap ĠDO Fs 645 2792 455 82 455 640176 305 0 305 4345 305 522550699 pz c ytick markers Tab ulated Tab Fitting mapp ath ĠRa ce Ġnative PdbInfo sphere fit wk p wk day ĠFriedman chisquareResult Ġquick select 395 5417 395 1594545 leg marker Edge Means gas vx plugin Path 038 13 038 80285 2927 97448 904 924 904 3376 904 7587 ĠRo main ĠRo binson ĠCL US 323 1600 323 45466 Eval times 328 21 within ss 164 20531762 é¢ ľèī² 907 7932 907 2099595 907 47995 907 2067564 Energy Plotter Ġiso phote Ġleg min Ġleg obj 995 173 995 8025 Complex Block ĠLab e 367 0135 367 2925 617 64839 Ġwater body ']]. __ START ING COMP OUND Ġion cell 997 082 ä¸ļ éĥ¨ Attribute Deletion FigureCanvas PS poisson ian Remove Rows 140 4501 {{ {: ĠRadius Neighbor 155 4915 Volume Reader Ġmt l Ġmt Step Ġmt Win Inv est ('$ { Ġ%% ' Mapp ings ROI canvas Ġconverter seq Container Property stretch val INTER POL Multiple Spaces Zero ing dg gnhe Ġcoll value maj f maj l maj t 102 78 102 142 102 1632 226 0439 too larea Ġencode Base Ġencode Mask Ġcnt ref FOR GOT FOR BIDDEN ĠCross SpectralDensity #---------------------------------------------------------------- ----------- AF MPATH 404 04 404 1253212 Cha ikin indx u numer als Histogram Result lazy array Ġbas alt *** ') ĠON IDX ĠOP s ĠPos iNn Active Threshold Parse ConfigLoader ĠMan is Ġpsd numerator 943 97603640183 SUB DOMAINS ĠInverse CDF 755 0247 Align Trailing Ġdow loading ä¸Ģ è¡Į Full Unc Ġft ell Ġaudio file spine Ca spine Spacing 887 354 Ġphys icist SF C ('{} /{} ('{} ')". Ġë ¶ Ġrms IArr 238 97344 146 1592 146 0822 UNT U Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠ 045 382 045 5397 Car topy spl s spl ity Temperature F 183 643 BE C Ġbi map Ġbi ogrid Learn Predict Learn TimeList elastic ities Dump ing 855 99 855 1975 Nx One 0504 0 007 12287 Ġvt Symbol proto ss Ġ': ','_', Cursor Type ied b kill keys kill Play kk kk 922 4638101 Ġum ol Ġum bral 787 069 787 6533 787 26109 187 0505 187 3626 ĠBack propTrainer 104 96 104 3620 ĠMeta file ĠMeta GraphDef wire map foobar bah ĠFigureManager SVG ĠFigureManager EMF 216 000 216 708 216 2225 216 24185 216 02448 REF DIR REF LECT 964 692 964 12847 IF D 934 1 934 152 015 1545 game play âķ Ĺ ĠNE B 099 67 099 1174667 017 1304 017 0576 017 27704 257 686085 ĠReal Vector locals mappy 232 0528 sync par çİ ĩæ \. (.+ 295 616 dom id pres caler Ġinfile C ĠAg us lad or Estimate Windows 385 977 385 6978 385 0787285 HS plot HS olve upy text Mass Driver ĠNx Mx 116 34 Stop Label Stop LineEdit 188 4 188 546 056 23187 MR P MR MS 345 49 binned chidata strain er cmp d hm mer Ġbio informatics scripts Directory Ġbucket Index Ġbucket LL quick ly ĠPost pone ĠRest rictions 234 34925188 234 8752734 Ġpix dims Ġ[{ },{},{} 666 2497 666 857465 ĠConstant OverTime Ġmed I Ġmed al 304 6 304 697 304 40147 ï¼ļ $ Ġcorners Rotated Cho ps ĠåĮħåIJ« ä¿¡æģ¯ çŃ ij Ġsit mo 4444 1002734 396 17 396 8710 396 79304 ban on destination URL destination Uris Control Dock WIN NER pex pe 909 1347 909 3906 bt wn ĠParse GeHdr Ġcloud Idx Ġam xp Ġam igos Numer ically 177 95035 åıĸ åĩº Header Item fact r Ġ97 08 Ġatt gate Ġatt inp 036 851687 Report ed ĠLocal Dot ĠLocal LDAModel chis quared chis qs snap ToGrid Ġdes de Gene GO Ġletter box Ġletter boxed Ġletter boxing čĊĉĉĉ čĊĉ ĠSingle Map ĠSingle WeightMatrix ĠSetup Holder Ma pe 377 21 377 6085 bat che ĠRel ies SW ABS 9495 9677 Empty Image Pop ulations photo evaporating ĠBatch Request 2268 945 Ent ire ĠRectangle Mesh 335 44106 trunc ed wall is Phi SahaLTE dn ls Binary Object 325 2480 325 7604 325 631275 SY MPY Ġ',' ']: 277 199245 Ġlatent D GU A Ġga indb astro plan astro drizzle Pri o 8067 884556 ĠCH INJ Fill s 215 967 ĠPoisson ian ĠPoisson BayesMixedGLM ĠForm ation ĠForm style shifted Frame polyfit list Ġxaxis label Ġxaxis valueSet ĠJava Class ĠJava Object ymd hms fwd lattice Init Mode åĪĨ 段 Ġxt names Pen alized Rot XYZ gets ockname Peak Sigma Peak Demand intr usion Ax Format Ax Img grib file 229 7839 229 0262 Ġ'> ']: Ġ'> =': Topic Concentration Topic DistributionCol 8088 5705 Ġsupposed ly Ġimb ues imin us 334 11634 Response Time RT stop 6401 86 sco tth Ġeeg p 936 3 DESCRIP TORS emb g 955 0372 324 065 876 2774 876 14720659 ĠFrequency Delta Arrow Exception Arrow styles Ġslot Names 326 0288 326 7827 326 950916 Ġnz All allen ger ĠAir foil Replace Warning ĠTask Policy ĠTask MapReduce ĠInternal Send Ġhessian Params Ġalle pochs 665 276 ĊĊĠĠĠĠĠĠĠĠ Ċ 865 608659 819 56863 819 8405 IA Q 945 20941 DNNLinearCombined Bug ĠSte ve ĠSte reo 321 861477 321 665276 Buffer Protocol MON O Ġtrunc ed Ġfv fm Ġyaxis label ĠReport er Decimal Value Decimal Field 244 12912 244 259075 844 1199 008 1194 008 3465 008 01395 008 2015466 292 1 Lib QP Ġray p ])+ ','+ DU AL }^ * Ġlive graph ĠTF IDF omo veflag ĠPAR SE Ġmaj f Ġmaj l Ġspine Proto Ġspine Distrib Diag nostics Discrete GLM History Columns Lon Info Ġten th Ġchr um gyro dta Pattern Type Pattern Base Ġrid ges 136 190 136 854 136 0267 414 01 Noise Index 2228 1339 cubic spline Ver b Ver bal Ġcomposite TestFramesPerBufferValues Comparison Mixin Comparison Ops kit ten kit chen Ġflex chem Ret ro Ret val Ġphoto Coappearence 980 863 980 268513 HR s HR GT Numpy Annotations 985 48 985 443 985 022 Java Conversions 247 059 247 0183 247 0564 303 958 Ġattrib u 019 25 019 78234 299 8489 299 8916657 ĠCF C ĠCF D Math Exponent 965 6450 965 990057 944 13101 658 34 Ġdetector Names Ġduplicated Model Site Type Ġmv stdt ĠMIN OR Sym Matrix Ġcompar ision Surface Over Surface BaseSeries "$\ |\ Ġcommit ment KIT ID Ġck min ĠOptim ise ĠInvalid Challenge 847 02924 ĠSun days 346 7572 9075 9500 nod o nod upe Ġsizer All quis ites jie ba Circle Polygon ĠSelectPercentile Classification 329 1873626 _* ' Raster Correction ä¹ ł live Interval admin name mono holders 867 4765 908 289999 fragment ation fragment ations Matplotlib Helper Other Indexes qc var Ġcontact ed 786 759 786 9491 Ada pted Ġau xs NOTE QUAL 148 148 uw i 994 19401 Dec ider mom type 7824 43987 iy ong Decision s ĠCurve Filled LAT ITUDES Ms Mh 233 0845 anc zik ĠClean ing 1000000 2384185 280 4866 584 3 098039 22 ĠND Data ĠBokeh JSONEncoder 298 3138 298 7819 1954 277199245 189 031 ĠCons ume tor ques Ġsos vm 791 7876533 Ġplate pars Ġplate ifu lig c Document i Document Id ral o Ġbond length 554 189031 vo iced 228 320268 248 292797448 hydro share ĠRenderer SVG ĠChart ModelView mr ks mr Pdb ĠEM ISSION PIC O 948 38 Xtest sparse Boolean Image Boolean Var slot id htm lfilename 074 19519651 Ġcompletion List ("< ") bounding lat Age Accuracy Age Correct Ġhs x Ġell Re 322 877 Na P Internal Frame Sm allest ĠTR Problem 194 9736 368 35169 Bad ly Bad Version Prop List Visual isation mort al Ġvel r Ġattach File Big Tiff HMM DIR HMM SS Robust Cluster Ġcurs ord DOM ESTIC ĠCommand Prompt 879 1554 879 3931 Limit Exceeded Ġshot Obj NM TF Ġwf Lib Upper Case Ġni amoto ĠGen otype 129 8067884556 ĠHistogram Result ĠRepe ating tur kish ĠArrow Serializer /* " 245 90556 /{ }, 885 6519 885 2024 885 29449 885 88613 flt num ĠOper ationalError 065 3287 ĠSigma clipResult Ġsender Name sav estr Ġsb mdl 6400 85526 Ext ending ĠMO JO 6448 13602 Ġmys rc Ġmys cene Ġmys qlt FRE QUENCIES ç± ³ Ġtl x ĠPop ulates 067 44441002734 Minute Rate Blue Line nets urfp Polynomial CountSketch ĠDen mark Weighted MovingAverage Ġfign o hyp hens Video Segments ĠMulticlass SOL 954 65 954 069658 393 9838 393 90660 Normalization Histo hover template Inf Cylinder 737 255 ĠÐ · Ang AccelTS Free Space Free zing reat ypes 990 2088 buy ing 217 9 tos um 1296 2954 tg Length Ġsell Cross 338 98216694 Ġdmin ax 339 2717 ĠDataType Ids Relative Angles '][:] *( ĠMixed UpperCase ---------+ -----+ 1600 860 68235 3 '][: ]) )]* )\ 776 1283262 eb ai [\ ''+ Ġlamb bda Ġmor an Ġmor phed USD ATA convolution s jan us INSERT ING CAN NOT 301 992663258 pay ing 929 66677 497 309 )'] ` Ġinstr ume (': '): Ġenum SizeDict 857 80 857 96 857 92834 Forecast ColumnName Ġwc TempResults ĠFreq Distance 668 9225 668 1615 668 78667 hourly VAR xm lfile Predicted Proba trades Analyzer ĠDistributed LDAModel LONG ITUDES ĠDue Credit VARI ATE Ġmiss ables aggreg ators clar ation PRESS URE ĠAccuracy Warning Ġrev ise 174 173 174 18301 868 10955 868 37319 868 2249020 868 1460822 quot Barcode Neg Events Neg binomial abcdef abcdef Green Line 646 9975 646 941600 á metro 654 1293 ĠExport ing Ġie lo 849 184 849 27731 ĠEnv Dependences ĠVoronoi NN Ġanomaly Likelihood ä¸Ĭ æľŁ bh Spin logit x Ġtst data ĠConnection ModelView pitch fork ĠLight GBM 858 3282 209 39 以 æѤ NULL s Ġtrades Analyzer egg holder 1568 9631499 957 48 treat N treat ments 880 253434 ĠSur faces Domain Types Ġauth s ĠPort er ĠPort rait ĠVe locities Quantile Discretizer 1084 0170576 ĠPool ModelView ä r Ġsgd reg ĠBad List ĠBad Exception 967 8824 1797 0178919 ĠINTER ACTIVE Obs HistID nh arm nv estig wedge props Ġnl cc 357 44 ĠShort PanelGLS ------------------+ --------------------+--------------------+ Loop ing Flu Optimizer 886 950 886 1566 886 3772 Ġ################################################################ ####### ĠSpace craft ĠDiff ers 344 996 344 8684 Based Index Cap Height kr iz 754 9818 754 036851687 Clear History moose p panda frame ĠGtk Toolbar 068 75799 1956 316 1956 918 727 6681615 BACK UP ĠPa rents 854 781389 ĠCategoricalDtype Type Sol aris Ġxls addrs 058 1165 058 1478 53333 333 Ġsamp Bin setWindow State 1515 111400 qq pks ĠUN REV 674 7801 674 3622686 ĠAda fruit Ġpic path 958 223 958 340311 recip r Estimated Pdf FFFF E 087 0013564 Ok lahoma Ok ErrMiss PIL ERECT Ġscroll Id æľ¬ æľŁ DEP OT ĠLIN KS Ġcombo strings 447 059 MAN PY maint ains Ġlg Batter æĭ ħä¿Ŀ 287 17795035 atr ina 063 01614 Aux Engines CCD k Da ren ema ilfrom ('( , ĠDual LibQP Direct ivity clas ser Ġstroke opacity 6652 97 |||||||| || dT iter emission LineI FRA UNHOFER Ġrain Threshold Ġrain Ax 0005 36 omb ies ĠPie Plot Ġgm mposteriors 458 17148 Ġpublish ers ################################################################################################ ############ ĠRand lov 3864 67637 386 04 LP Var и м åĴĮ åģľæŃ¢åįķ åĴĮ woe Ġsnap num cir co Ġul mo ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠ 407 0 Ġ*** ') Proxy SecretKey cup SODA {}. {}'. SFrame Proxy 1989 38604 947 6032 ĠCollect ing ĠStand alone eu I ĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉĉĉĉ Cube List --------------+ -----------------+------------------+ --------------+ -----------------------------------+-----------------------------------------------------+-----------------+--------------------+-----------------------------+ 084 3504 whis lo whis hi 501 888968 Lambda Str hill shade ==================== =\ 656 1842 Ġng ofnt Ġwrt chk ĠMc Kin ĠMc Noleg ĠQU ARTER QA Util fre iburg 069 02 069 19682 Annotation Base Annotation Queries Tot Cld Ġimpro v ĠSol r 1088 674296 ĠPackage Index ĠPackage Id 284 786759 Ġ#================================================================ ========================= ĠĊĉĉĉ Ġ 577 329 ĠPol lan 0542 88 Ġloglike obs 884 92905 ĠTransf FitParams Ġbinom ially 40000 03 FIN ITE Warnings Metaclass çĤ¹ æķ° Ġcand les +)\ .\ Water Mask compiler kindid ĠDiscrete Variable ĠRobustScaler Model 402 7853 VIS OR VIS NIR Ġzer odegree 8833 1 Ġfil lables Ġfil lend Ġfil lopacity establish ments ĠSGraph s ĠSkew Spine ĠSkew XAxis ĠSkew XTick ĠJob ModelView ĠDecision Mutable 7687 6561842 violin plots Ti Temp nS rc Ġpanda ProxySecretKey ĠPlan ner ĠLE MS scra mbling è¦ģ è¿Ľè¡Į Ġalph alt Soft plus Ġpvals i -----------+ --------------------------------+ ĠPair Grid sad ovsky 850 88529449 Dur bar Solution s Super CDMS 029 3236 drawdown List ĠNeuro imaging Move Cursor ĠSpeed MPH 9767 1374 ĠRNN Colorbot paint ing paint Event 1373 1172988 Ġtrn dev æĸ¹ åĽ¾ 507 3362 EU CLID 3536 5213 Ġrecip r Web Docs Inner Pos Ġemploy er н и Ġhint ed ĠDropout Layer Elect rons Elect rical Ġdup T Ġdup plicate Ġgps DataPoints 10394 686 7703 721701 Ġmand f Demo graphic Demo crat Ġrecogn ise Ġrecogn izing ĠSepar ates Ġ"^ " bare ly 661 455640176 ä¸ĭ éĻį Daily ReqPer UNC LE Ġphrase Tree Den ied ĠTimer Mac sour cename Origin ally Ġemb ark ĠAut onomous Protein Occurrence Ġatlas TotalRec Dark Turquoise 6084 29623154 MAR NO 0307 39558 unlink ed concept ID Instrument Type LOC ALIZATION Ġtuning Constant Ġice L Ġpub Start Ġpub End ĠApplication Window 22699 3087 Ġdomin ating ĠWed nesdays Ġcapt cha tro ubles 0975 1048 ĠDateTime Field publish Date ĠSG Column ĠCy lindrical ĠUnits Spec 5087 78603 Ġcircuit ing Ġavoided List 619 37107 ĠSat urdays Bucket Length ('@ '+ ="/ ". Ġzp sth LINK COM ĠQueue Adapter 000000000000 5 WARN ED ĠDatetimeTZDtype Type nex pe ĠâĶ ´ RH um ĠCRE ATES 3352 34401 åĨħ åŃĺ Ġtweak AxFormat transitions indata transitions outdata religion DataFrame NY U è½ ® Ġintu itions 022 9911 Ġ``| `` 556 270 3922 85088529449 ĠXT X CAP TION 5605 2275 Aut umn Ġbib rec 369 321861477 Ġdog box adaptive Threshold Cr ust Cr its Cr Cb DY DX ĠWeb Socket HY COM ë¥ ĺ roach Name å¹³ æ»ij Ġvp stats 1829 09 NoValue Type 813 172555 PET RO ('^ ' ('^ [_ ĠRout ing modf resnel Ġpil read 7464 089475 Keep LastCheckpoint 916 985022 Che by eec Option paw ning 9939 0772 Voltage Spacing Ġoscill ating 745 640385 ĠREST ORATION Ġgbm TrainView ĠFunc Node âĢĿ ", ĠChain Collection Ġig ual ĠTx K ĠMS FontDirectories ĠMS Folders ĠPYTHON FRAMEWORK Entity Cluster Entity Article Are aT Ġave Slope 475 304697 ìļ ´ ĠACTION MODE 673 05985 Beam forming JJ R ssh fs Ġ[{} ',{} 914 8198405 '(? <=\ Ant ique Ant eil phoebe results nop bc 7766 591387 Ġtif args hack PointsFor 468 75 468 666857465 Fi lenumber Ġdiscard Ct 9096 83154 æĪIJ交 ä»· )? ( Ġforget ting 774 92 774 8681460822 {}- {}'. ben jamin æŁ ± æŁ » ĠDag ModelView ĠDag Bag ĠGreen graph 1157 3628 ĠEcommerceData H ECOMMERCED ATAG ĠRoot SymbolNotFound 7846 8845 999999999999 8 999999999999 97 269 2595 ĠMODEL ING ĊĉĊĉ ĊĉĊ commission ed groundtruth dir åıĺ æĪIJ SUN DAY Ġwheel chair 8801 100704 718 945 nump oly ĠEg Ref astr onomy money vsthings rsi Sell rsi Buy éĿ Ĵ ĠUserDefined AggregateFunctionWrapper 509 2933 GPS ReadSeconds Ġkc idx ĠGal axies ĠGal erkin 8547 07564856 Ġconsist ed Magics Manager ĠHttpResponse BadRequest Ġmw upval Sys Ctrl Quarter Offset 427 317659 Att Ref Sli des Ġ+-----+ ---+ Ġ+-----+ ------------+ Ġ+-----+ ---------------+ ĠGE OMETRY 932 3183848 Cmd Str invent ed Ġsem ibold Break Out ĠUnpack ing 283 66088 ĠEvaluation Context MV N 289 865608659 blosc lz 406 265794 Ap CaSe ° ', Ġshifting Axis Ġautodoc s 3264 6681 ĠConversion Interface EXTRA POLATE Trading Sessions ĠQP alette Stock Cursor Stock BaseMarket 416 2775 LIG O 972 7843935 Sound Events éĺ ¶ ĠRegex Tokenizer 1192 3311 ĠInstanti ation SPY DER AI Error nab obalis ĠGra des 6488 91856 åĪĨç±» ç»ĵæŀľ åĪĨç±» åĴĮwoe neff scan å± ħ Ġsph ats 6580 35365213 Gap Fill ĠLS String ĠGT iff Spike Threshold ĠAV HRR Ġlack ing ĠAbinit Task Ġsed depths West falen ĠExact Sol TestData Dimensions ĠComputed SlabEntry Ġhline Value 558 3186 FFF ACD ĠTrade Direction Ġ+---+---+ -----------------+ killmap str 332 62585125 Ġhd ul ĠWav FileWriter Ġfragments ize ĠDiag nostics KG PERM ĠPur ples ĠPers onal 587 25 587 20939 735 61663 Friedman chisquareResult Ġsales force Ġedi files ãĥ¼ ãĥ« Ġbre msstrahlung Indic ate grab Expt 2778 1620 ĠContact s Ġdrug bank Ġ'[' + Ġsubscript able Tabular GrowthRateTransition Tim ur Curr ExceptionTrace ĠConditional ProbDist ìĹIJ ëĬĶ Ġrets hape Deep Sleep 622 939635 bor os 557 01841 389 347223 song SetLimit tss hape Ġnuc Conserv 090 8791554 HH Channel Quality Flag SARIMAX Specification kz L Ġ#------------------------------------------------ - Ġnpar celas Ġerrs Last Cancel Buttons UH GT pell ation pell ant Ġneuro kernel ĠArithmetic Error Share NotShare pel let 6506 31537860946 åĪĻ ä¼ļæĪIJ交 Prime Max Rotation Matrix 433 141556 æ¸ ¸ 614 19753 Sn P Ġdod gy ĠBusiness MonthEnd Cubic Bool ĠSecurity Base SX RBUCC ĠMON OSPACE ksParamGraphWiz Impl ksParamGraphWiz Dpi Infer TimeList GRID AD 825 663145 CZ CE 1800 1796 ĠDEC Model EXTEN DED OV R getNum Active 705 30257 mh peak Ġttf query ĠMoving PanelOLS 637 95025 20100 196 20100 192 20100 195 20100 187 20100 198 20100 197 20100 189 20100 194 20100 190 20100 191 20100 193 Named Object ĠSpecies Evolver åĽ¾ çīĩ VV IX ĠCube helix ĠEval NormalCdf ĠEval NormalPdf ĠEval ExponentialPdf PREC IP gouraud Object TV news sj h 6627 299 >""" % Card Dict asnumpy array ĠNested Row Ġmanifest ed Ġtagged test ĠAstro physics ĠRen aming 9816 941769 597 289866 627 1 Curl border Connector styles 615 99 Sweep Widget Ġhomog type 1096 8307 funct op Ignore Pep nit rogen Ġmad ot ("= ")] skill data ĠREF GUIDE ç»Łè®¡ n天 902 7564 902 19376 902 88333 Cast s Flat Map Ġbill ing adv oc Ġclassif er 7433 09967 7433 392285088529449 Anchored Text Anchored Size Anchored LocatorBase Ġaudit log 720 46965 gar ph ĠChrom atograms Ġ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~ 8555 76876561842 éľĢ æ±Ĥ 898 2829 Ġymd T roms file 413 16538 epo inc 5135 8553 ĠImplicit Series kepler ians ĠHart man ĠHouse hold ĠTopo Json 6315 18509 464 2348752734 Iso chrone ĠtestIris Momentum ĠStudy Person Repeated Splits Virtual Array reliable Array 818 804 ĠSin ai Blur g ĠUnsupported OrderParameters Cash flows guest s Ġpunct ure Ġpunct uations 5813 97 Cu ramIII Remaining Lifetime 1689 06815 4805 2470183 Auc ScoreOp Ġtes se Ġastr onomy ĠFR IDAY Ġengines ize 8584 2642315 Ġ\\[ \\[ å¤ĸ åĢº å¤ĸ æ±ĩ 698 2266 828 1885 DataStream Stateless 2525 72789 STOR IES ĠUnivariate FanGijbels 3936 0680 Ġutili zing Ba ca PLE C loud nesses Ġcook book ĠDIST ANCES [:,:] [:, 585 8613 585 27781620 ĠAge Bins Cli ents Ġcert ificates syste matics Ġcheby u 814 80211 Platform Info Ġdan er Ġdan cing Ġnumbered x 8514 3937 manip ulate Amazon Google æĥ ³ è°ĥ æŁ¥ Ġult imate Ġult ratb Ġguid ance ĠBit map ĠBit mask Ġsubmod ular gaze times Hashing TF 425 9017538 Ġntemp den rade Date ĠParametric SurfaceSeries 6622 149 Ġacceler ations ĠPH ASE ĠPaired Source ĠRAN LIB ĠMenu ButtonWx Cook ie åĪ¶ éĢł lfor mats ĠDruid Column Buf Pool VOC devkit Zeros Like ici ando ĠGW AS 834 17719 mist ake ĠSpect ro ĠSpect roscopy lDiag SbsGenome Ġcone prog Ġtract ogram 082 33766 ĠSurvey Collection ĠSurvey Scenario Ġnod up 0014 98 0014 154 ĠLax P ĠBl itsData copyto buffer winner list documentation Viewer 897 2983138 Fluid Inclusion 725 24975 845 30440147 Skew ed Skew testResult cust omevent Ġaws path nsub plots 25905 45769 8551 45988 CONVER TERS neu rop Ġsole qs ActiveCells Count ĠGray scale Reverse Dict majority vote 535 07521206968019 Ly apunov 7556 0271689707 1746 39443327 4699 38122 SQLite MixIn Marginal Cost Hit RTs STATS MODELS ĠClick ing horse power 4385 27400 ĠOrbit al Hydro Ionome Ġå¦Ĥæŀľ å¹³ä»ĵ交æĺĵ Ġå¦Ĥæŀľ å¼Ģä»ĵ交æĺĵ #-------------------------------- ---- 710 5305 Live MonitorMsg Ġnos cale Ġcolo res ĠIon Entry ĠcolName ToDo FER METAL ĠSec Type ĠSec Depth 9727 1802065 11532 1196 unbounded Following Ġvac ancies ĠNAN s ĠInference MethodList MixIn Base clam ation ä½ľ æĪIJ Ġfirm ly Submit Tests Lam da fresh ness 20168 26507901 åĪĹ表 ä¸Ń Ġsandbox ed Wav File gj B Revision Results Revision Analysis ~~~ ' Ġ============================== ') acceler ometers åľ° åŁŁ 308235 2470564 Ġmsk File Ġwatch list ĠPB s IPT toCircle ĠNeg atives negLL TMPerturb ĠHammer Transform 892 855145988 Growth Data TTF PATH TTF QUERY Ġru amel ĠMid as Ġlistof dmp dydx mean 592 8446 ç« ĭ ĠRd Pu ĠEfficient ly 3387 36101 ĠUnivers idad kinetic TimeScale WF Q gang lia sic mo ĠCLI ENT ĠTestGlm Poisson ĠTestGlm Negbinomial ToPython RDD Ġclouds at Shot gun SCHED ULER 732 37 Ġncdf dtr 2412 1600860 0906 92947 Ġsqr Data ĠCorpus Label 423 2528745 Ġassoc EntityArticle frags y ĠAdmin istration splups Read ĠSpectra LearnPredict Optimize Loss Optimize DocConcentration Ker Phi 0008 3750242 adds ub Income Dstn barb color 4985 80885705 VL Array VL SD tang ential Ġíķ ´ NDFrame Indexer Ġ+---+---+---+ ---------+-----+ 799 6541 ĠEp anechnikov cav ities 2566 3769 earliest Date å¤Ħ äºİ Panda ID VW Y æĻ Ĥ illum Source illum Uncertainty 2729 34994 FFE BCD FFE FD ĠCalc Spots 4606 9247 Mul liken nH armonics plotName List ĠCLOSE LY 6825 5593407 ,", ", bolo fig 2712 80295 ä¸İ 失 PROB ABILITIES ĠREQU EST Ce ilHgt jol ine |[ ^ izar re 0378 296 CONV EX Filtering Results 478 5619492 TLE xecute Ġcodon Len joy stick CallDimension Z ĠPlugin Manager 696 5966 gtr sim nTest Image setFixed Height pour centage ĠRemote Monitor PROFILE OUTPUT 该 ä»·æł¼ intrinsic ParamsOutFile (.+ )'), Rsp SendOnly erfc x tron ix ĠtestX is ĠLOO K Retrie val ################################################################################################################################################################ #### ĠProfiler DataType Overlay Plugin ĠMATPLOTLIB RC ĠMeterGroup ID FNAME FMT Ġconcord ant Ġdiet ary 1312 66374 0217 32 naPort Weights gpus ph quantized FreqList (...). { Ġcardinal s Ġcardinal ities åģļ åıĺéĩı Four th ove a allf ields ĊĉĠĠĠĠ ĉ graf ica ĠInheritance Diagram Lid ar ĠTestArray Construction ĠTestArray AttributeDeletion Parametric SurfaceSeries ModelMetrics Binomial 864 39158 Ox ide adsor bed supers ubsets Ġ---------------------------------------------------------------------------------------------------------------- -- Ġ---------------------------------------------------------------------------------------------------------------- ------ 12345678 90123456 ĠìĿ´ ë¦ 549 37244 Ïĩ so Ġcull data ĠNative Value ĠLang muir ================= + Ġabi inspect Fasta FileName æīĢæľī 以æѤ 527 06374 Une mp zb esh ĠTur kish sett FilePath pier re 3397 807996 ĠANN archy Ġautocorr Ax ĠColorY DbDr åĩĢ èµĦ产 åĩĢ åĪ©æ¶¦ +). *?$', ĠPlate Carree ĠCX PB ĠCX Modal ĠnumberOf Diameters Ġsyst olic ĠCoef Class 2422 67236 Commission Model ĠOverlay Plugin HAL OID NFK C Tilt ed -------------------------- ") ogg io 3547 06744441002734 9412 993 ImageName Provider ĠCALCUL ATING 713 84 Tp Inter Tre ino bcb d kms KeyName 7564 1546 7564 66014 1687 2932937 1917 79319 QRect F 408 32207 ĠParent Poller employ ed SELECTION S EXEC UTABLE ĠManager IncreaseError Ġfocal point Galaxy ID MICRO BIOME 711 1381 ÏĢ f м ен Ġrated Power kep co Deterministic ally 817 1682088 Ġnlvl Elvlc Ġsdr Classifier hap map 1912 4562037 0246 347267 1701 707975 Accumul ated ĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠĊĠĠĠĠ ÑģÑĤ и Ġpinfo point prel ude baseName NoPath 0986 122 Ġmodf resnel ĠactiveColumns Indices ĠBinned Spectrum 608 34549 Ele phant aup r ĠMAN AGE 0594 8021 4566 284786759 4078 91732629 coupled ResonantFrequency åĮħæĭ¬ éĻIJä»·åįķ Hir lam Ini Lexer Ġjack et 83137 3355 ĠPyDB CommandThread Iterative Imputer ä¹Ł æĺ¯ Cum freqResult Dust y ĠPu BuGn prest ank 2575 95657 20151 011 1403 90667 0600 0591285 ABu TLExecute autom ation GHP Boiler Ġв Ñĭ Ġ[". / columb us 2510 2692595 1624 281 ĠtransData Inv ĠTrial Functions ĠCLUSTER ING MathtextBackend Agg 888889 25 ĠTp Inter 2075 28215 1688 6554 4836 350 Ġnbdtr in Ġnbdtr ik Workflow Algorithms ilen et Ġnfl db Ġpep array ĠfileList WithClass dav ies ĠHIST OGRAM ĠTestDtype descr 2768 3267827 3875 4816 3875 05040 LOS URE sdc zi Galvo ROI Ġcrc LOAN ocy tes 1199 33047 7832 4932918 7832 644813602 ĠMarvin UserWarning AAAAAAAAAAAAAAAA AAAAAAAA Electron ics ä¿ĿåŃĺ äºĨ Clinical Df \"\ "\" Ġedt df ĠyMin Pix shif tright 75686 3 #******************************************************************************** * Slip Value dream er 0149 364 6425 11923311 ĠUR Is 2486 9675825 Fractional Type ç»ĵæĿŁ æŶéĹ´ Francis co erode d Ġsmp rop ĠxMin Pix Ġunc csm chromatic ities lefts ide chessrun comboBox èµĦ产 è´ŁåĢº ĠEVALU ATION 412698 66175 QM CPACK mete orology Ġ294 750 0434 497309 1864 97225 Ġcompatib lity Subhalo Pos earthquake Data ------------------+------------------+ ------------------+------------------+ ------------------+------------------+ ------------------+--------------------+--------------------+ YA im hur rtracks phen os ĠSlic er 1977 05476 3682 6431 Ġqe jan 0824 3392717 CommandLine ConfigLoader ĠUnitDbl Formatter ĠOrdinal Encoder gmax B gmax C kle ene uneq scale Ġleague Name SetCell Font sulf ate ä¹ĭåīį åıijåĩºçļĦ Ez Read meet ings ĠPourbaix Entry ĠATT ENTION ĠRough ly sciss ae ĠWy oming cadence Sum 4529 3856978 4898 457899 ĠStructured Accuracy Structural Plasticity 838 249725 0115 57677 Ġcoeffi ents 4627 20394 ĠColorH SI ĠColorH SL ĠFFMpeg FileWriter Bench ing Junction Data oneclass svm ĠtestWith X 1117 1671 1117 3260288 0636 23897344 9232 33898216694 ĠConcentration Volumes ĠConcentration Yields GetArray FromImage CIR SubordinatedBrownian sau ce getNode Sizes ĠWas serstein ATAC PI 1495 10055 0247 055 Ġfunct op ĠfRet Add Ġuncert In 7594 7422 7594 46119 8858 167839 3497 10332 carb ons Ġп о 638 8084 FID UCIAL vk aynig Ġinfra red laz ify Ġ'[" ' ĠPast as ĠlistOf Tuples 8579 456 MPC min 2826 99297936 符 åIJĪ Ġâķ Ķ Ġâķ ļâķIJâķ pexp ce pexp be 0099 33 numPoints PerObject 1537 6811 1895 522580 6572 11171671 6287 24 WEB CAM ImportFrom EPSG pgfset stroke UVB VIS ĠLatexManager Factory éĽĨåIJĪ ç«ŀä»· 79216 9546 Spearman rResult Ze it Ze manta Zr Temp 0082 34300 Ġanc ient 3363 8682249020 1623 9596 7801 27746 7801 248292797448 7857 8036 2717 20 2717 99687 topomask nan 4420 4012302 4420 33411634 openface CPU Ġgest ures OPER ATOR CGzi Err Aggregation Task ãĥ© ãĥķ Ġtarball s å°±ä¸ļ ä¸İ失 7071067811865 48 bif curve é¥ ¡é Ġfase i typeDrop down ambi Delim ĠconvertTo Lab ISS UE æĹł ä»ĵä½į 2372 34904984 san ct Ġaod t ĠStra ight 3306 16875 4564 18785 STAMP S Ġoffic ially 127565 3944 DRI V Was Clicked ÃĪ Ãķ ĠPin hole ":{ {" 1734 21445 1734 6937 9810 88588613 4915 3650 6233 947 6233 8762774 Thermal Data lne dentry μ s ëł ¤ unmod ulated 1585 5284 1005 81 ĠSeason Types 1674 18 0489 0915 9569 048385 8525 3229 2164 192308 8902 0580 Weak KeyDictionary NEIGH BOR ĠVariational Posterior Ġcircul ation Ġìłķ ìĿĺ NAS CIMENTO nP pl nexp ce nexp be zbes j zbes y Ġidi om chndtr ix ĠCum freqResult statePlot Canvas statePlot Figure Ġ``% `` 7875 90759500 7869 78 0245 91237303 3406 98 8427 90747995 consult a consult ant CGir Err CGrg Err Ali quotBarcode Ġpcc py 0027 628724 ĠGG Statement 1584 92165 1584 351912 2049 2516 8837 35803 Ġ|+ -----+-----+ 8564 8099 2832 424712 FromCSV s circlearrow right circlearrow left ĠSpot ify 29737 6541293 88888888 9 Ġanticip ated Mun ich cine ma fdb b isos urface keithley frame ĠXRD ML 1577 3828 3556 24590556 1926 96303 2215 67378 0277 9658 Ġcomfort ably 1845 57 以æĿ¥ ä¸Ĭæ¦ľæ¬¡æķ° å±ŀ æĢ§ Ġinventor location xiaoxiaol iu Pin ned Ãĵ ÃIJ InProcess InteractiveShell 9964 29 7897 667 7897 6441477 1345 03984 ĠTestGet item 8653 1461592 0677 3776085 0926 9407 ĠbatchTarget Shape ĠbatchTarget Vals ĠbatchTarget Idxs ################################################################################################################################ ################################################################################################################################ 4345 168906815 è¿ŀ æİ¥ 6470588235294 118 CLIPPER out Ġnctdtr it Ġnctdtr idf Ġnctdtr inc Tissue Atlas nBins PerSec Ġtgz Name ĠAI Algorithm 1204 656 3353 1404501 multis core clou dimg Integrated Energy StopWords Remover Laser Scan аÑĤ ÑĮ ĠConfusionMatrix Display ¦¬ì¦ ĺ 1105 252572789 4100 75928 Haw aii cuff links relat ively Ġbean plot Ġkom i Ġkom bine mobi lenet ĠGri mison Ġ496 54 1425 61 Sharpe Ratio 9316 34 SplitAdjusted EarningsEstimatesLoader ĠNumExpr Factor Ġturnover Value Ġturnover Vol injected Current BMS OSVM gsc ag oft able èĻ İæ¦ľ loso phy Ġcolort able 2592 0529 2554 2635 Ġ|_ |\ 1435 004873377 spat ially 9528 35 4465 700698 FFFA F 3827 2504 ĠQuadr upole Recip ients hhhh hh 3039 20153504 Ġhonor data Fallback Api CLOUD ERA Ġpva fai psol n 1578 197705476 2028 1318 201001 99 201001 85 201001 86 6654 751962 6658 120544 6658 382565 7827 3152 0325 77 9467 2405 4945 964 3878 13283867 3110 9986 Login Mixin ("[^ ()]+", 6031 6673332 ĠCheby TPoly cors hift Ġaus zuege Ġbgd prof Ġ`[' %. Ġseiz ure 1226 90129755 2027 072175 2027 8089965 6616 14964735 1437 29 1938 90626 ORandom izedSearchCV 2709 18733 8467 24121600860 3085 72 2313 1950 ĠDecor ated ABUND ANT incumb ent 6305 9766444 6305 3448684 Ġattrdict temp Anisotropic ly Ġsligh ltly ĠAssoci ates ĠTaskInstance ModelView PRIOR ITIES Bootstra pping Rgb F nNN NI qQ gG onoff seq 0085 9313 Ġaspire P Ġnec ces 9912 32610 1535 30955 6633 10 1614 240 8779 87008 pedge ind 2845 3291873626 EXPIR Y ĠMonosublocus Holder Ġ+---+-----------+ ----+ Ġomegainv half ĠGreater Than å¤ļ头 ä»ĵä½į CARET UP CARET LEFT CARET DOWN CER ES cob acterium urch in ĠGGG AGAG 1259 8538 4595 0434497309 1475 3849994 2133 048175 ĠDEFIN ITION ĠDEFIN ITIONS Ġåĩ ½æķ° ĠStem med Ssnake DoubleSpinBox Ġtig file desp ite setFrame Shadow Ġexperi encing ĠPIX ELS ĠAGG REG Ġdemod ulated 9927 714 1159 80927279 1548 3177056 0528 1088674296 14026 84 ĠstringIndexer OrderType 02384 7 imgLab Small 5724 2320528 6312 09287 Ġparenthes ization 4455 491 ------------------------------------------------- + INTERESTR ATE Glo Ve Glo Sea Liv re ì² ´ Ġaqu atic Ġsmo kes Ġdam n Ġequilib ria andro guard ĠTUT Acoustic ĠTUT SoundEvents ĠtestAccuracy ListVsUnionLength 1210 349710332 7504 0246347267 7861 3239 Ġlined ict xxyy zz IPC Lock Ġvarin no autocor relate ĠImageMagick Base menuGeo Calc Ġì¤ Ģë Champ Odds --------------+--------------+ --------------+-----------------------------------+-----------------------------------------------------+-----------------+--------------------+-----------------------------+ SXR ARP ĠMerged ChoiceTable Ngal perHaloMass mSignal Decomposition Ġnir red Ġdhis URL ĠSUR FACE ĠSUN DAY ĠPCG R ĠCIR CLE Ġprogra ma assertReally Equal scient ists ĠsetMin Val Ġsubd rs 0478 70087 9691 7801248292797448 0362 88300 8534 754036851687 ALET TES 2945 53 5707 0268069 ĠFigureFrame WxAgg 7066 23131950 80810 666444 Ġcommunic ating ĠMODI FIER ĠHolo Views Uneven ly 8660254037844 386467637 Gives Zero ÑĨ и çª ģ relev ances Ġamy p Ġmdr izsky ĠeA ip ĠProx imal 1116 9927714 ĠHaw kes 2213 069215 9485 9476032 ĠComplement NB 8664 06200 3614 9955 6096 221567378 09725 10394686 ĠëĤ ĺ ĠPmfProb Less ĠPmfProb Greater DEPART URE ĠReflect ive Ġå½ĵåīį æĹłä»ĵä½į 5874 16239596 5874 25542635 WAP A Ġemis Grid chamento entrada ĠAmbiguous TimeError ĠGN SS DataFiles Input 3293 05568 ĠUSB lackFriday 8038 016012 2725 3471564 1870 9937 Ġ[],[ ],[] Ġmemor ials Ġffts urr ĠCorrectNotFittedError Classifier dEdt fitpars BIL OU BIDS File baud rate roat ian ĠDock er taum at 15258 360 34300 08233766 9799 1250460 contro lframe 77394 0795 0896 18936 currentCluster Line 7633 03880285 8265 5890 9135 9003383 ĠPandasSQL Test EEEE EE ĠSubclassed Frame 15536 188546 Ġvirt ually 20834 984978 Ġ+------+------+ -------+-------+ EXECUTION NUMBER enhancing perf Roughness Model 8137 453537 Kron rod ëĭ ¹ Ġaudi osList Ġpract ices ',{} ']\ intention ally ['{} _{}'. ĠRecommend ations 3286 8861566 1540 25352 0561 338736101 Ġpyhs mm 2023 80020454 Ġsubrange Analysis 80669 322028 ĠKde Plot 7816 32345466 Ġdifferen ciate 27924 10639 8615 278304 3418 195228 CACH ING 77025 608429623154 Ġsmv gear ĠcenterExtent X 4386 9859 4088 7718 collectAs Map 8312 32646681 stimulator dictview 0339 12705 æĶ¶åĪ° BaræݨéĢģ 模æĿ¿ æĬ«éľ²çļĦ ĠFloris Velocity stoichio metry ĠVISU ALIZATION #%%#%%#%%#%% #%%#%%#%%#%% 累积 åįĸåĩºé¢Ŀ 1454 0561338736101 RX NM RHO B ô le Ġmserror num Ġhate ful ĠsetMax Val ogl Path ĠexpectedLabel List ĠexpectedMissing List resultado Sir 2587 146506 4555 706623131950 1934 0821 0343 8868112 5434 093214 ĠMaxim isation MultiSequence PreprocessingMixin QUIT KEY TEMPFILE PREFIX ĠPacket List seismo gram Bis que nats ort ĠæĮģæľī 空头 ĠæĮģæľī å¤ļ头ä»ĵä½į erfi mage ĠnN fd Ġreferen cias isIn Type ĠBang ladesh Ġclub bed 8883 80810666444 barr Collection 78234 14068 0479 1624281 8610 78468845 0664 68255593407 FileLocation Data cmid rule CAPT URE CAPT URED 6705 7211660 MACA ODATA ĠLinearInterp OnInterp Pretrained LayerCV ĠInteg result 5213 0083465 stagein retry âĶľ âĶ¤ è¡Įä¸ļ产éĶĢ åıĬåºĵåŃĺæķ°æį® /_/_/_/_ /_/_/_/_ 移åĬ¨ æŃ¢æįŁ Ġ모ëĵ ł autoramp subframe Ġwenner ApparentResistivity 8983 10510439 Bcknd Dialog Watson Test muse um zY Plus zY Minus Ġnrd trimn Ġomm it ĠTogg les ĠTogg led ĠPEC as toJava Array Ġresamp y Ġ536 870910 Ġcomputable RVS numPts InCorCoefs 1189 0171304 3224 20492516 3209 005024 ĠTestNew axis ĠTestNew BufferProtocol ĠTestPoisson Clu 6579 19659 4966 91725 6838 18720 2949 136854 8305 63063 Ġentren ar FAF AD regionList CurrentClust ĠCarma Sample ĠWordNet Lemmatizer OAuth Handler Ascending Order Ġprovisional completer Rack Label mTime Var Ġcit izens Ġfram ing Ġpype t ĠbPull Price ĠbPull Vol ĠTRANS FORM labe lencoder Ġgsc ag Ġgouraud Dict ĠtestGlobalStep DNNLinearCombinedBug testTrain WithOneDim testTrain WithTwoDims ĠEcc en ĠEnc ryptionConfiguration 1267 122183 textMax Curv 6636 700 Ġalphac Bonf ĠTestArg min ĠTestArg max TestSQLite Alchemy rcusum ci 3405 321 ColLabel Value REUSE ADDR 8909 2832424712 ĠPathway Selection 7166 89384 ĠconvergencePoint List ĠCommit tee augTM R 00415 88888925 pleas ant 13866 988316 replEagerEval Truncate replEagerEval MaxNumRows 21445 0052730 éné f Ġ+-----------------+---+---+---+---+---+ -----------------+ OsAr ches OsAr chs Ġâī¥ { 000381775 3750 000381775 4041 bhilqp BHILQP Ġthorough ly HistoryContainerDelta Super æ¤ľ æŁ» ĠtestPadIfNeeded Small ĠtestPadIfNeeded Large LBUTTON DOWN SALT BTC Ġnsp den Ġevide nced vez ic ĠAster isk 20180 328 9446 142 17132 427317659 23997 15 7715 883 ĠUnity SFrameProxy ĠUnary Op GetPoint Data 7424 9925 5905 759446119 Ġctset sets ĠAxisArtistHelper Rectlinear ĠMDX Utils æĶ¯æĴij ä½į 1863 06896 5047 606444 9154 75947422 k线 æİ¥åı£ Ġrhyth m ĠXport Reader ĠPHY SICAL ĠGrib Wrapper axisLabel Distance Ġpyman oid 94122 25 8595 844 0609 050 6544 239 ĠPermanent ly ]+\. ?[ 8217 29693 ĠSTAR TS standarder rors NumpyArray Iterator 45748 20317 ĠStandardized Moment 骨æŀ¶ çĤ¹ä½į 7450 643820 7207 34137 Bul b Cere bellum Xdawn Transformer hlp graph xsub ticks Ġacv f esch windigke ĠPREF AC Rebin Data Reagent Composition 1576 100581 distMatColumn Test stringLength Int 240000 98548 0972 6630531 Ġquint ic 2812 7850416 COUR SE ĠArgent ina ĠCOUN TS ĠCorrelated Generator 998157 44 Ġpvpc plot 66749 16445 ĠkillRate Vm Cancelled Error ĠHenri que Ġribosome s 499999999 9999999999999996 5645 387813283867 Diss imilarityMatrix Flate Encode FALL BACK HOL IDAY WMO s vto record æ¢ ¯åº¦ hacc uracy Ġ"""+ ---+-----+ Ġgia py plotAll Responses Ġ``& `` ĠTestAs CArray 9516 9902088 2426 335234401 dbcknd Button Ġassignee location 8799 661455640176 8723 04734 9025 428073 Ġsuppliers Data âĶ¬ âĶ 87688 1954277199245 ĠUnitTest SqliteHook ĠTRACE FP ĠDowns ampling ACACG ACGTT ĠTrellis Grid ĠåĪ¤æĸŃæĺ¯åIJ¦ è¦ģè¿Ľè¡Į Suc cesses Ġinchi key ĠeB ip ĠTRE ND phide t Ġlegit imate Ġchck Make 66096 94059 ARIS ON probationary Percent ĠTestGL MPoisson 9581 78726109 95392 91747 2702 6622149 6768 991232610 4927 18499677 COMME NDED Ġartif ical 80317 06902 25080 235933 04518 9007100 Ġelectronically Active CutOff T 9607843137 2549022 ('\\',' /') PgRnk Bag RatiosPer Band Ġ天 æķ° Ġëĭ¨ ìĸ´ 5689 35 Emo Int GRAN ULARITY Igor Convert Pear ce utile ZrTemp unagg Edge ĠIML s ĠlSpecial PageNode ĠBright ness ĠtimeSince Activation Ġgettot size idxC SCSUS 66128 22281339 16074 346 ĠExpend iture 7872 95405 78313 65338 9616 876881954277199245 3679 640085526 8428 19124562037 87495 60316673332 eventr ange polymorph ic 29337 672704 nbOf Robots 7920 3493426 ĠMakeHist FromList 5304 9224638101 Ġpysql df æĹħ 游 MarkProp FieldDef 01624 28366088 Steel Blue 33597 3054345 ĠRESP ON aoY Values åŃĹåħ¸ä¸Ń åĪłéĻ¤ :`|*| ` Ġ그리 기 åIJĮæŶè¿ĶåĽŀ æĸ°éĹ»æłĩé¢ĺ Sediment ary MALAYSI ADATA Ġåģĩ æľŁ BRAZ IL Ero der jub ba sparser ange twee ter vign esh straw berry Ġcrite rea espec ially 00250 850845 plotXY profiles minortick lines 64175 13866988316 11787 646941600 20319 48052470183 20160 3231600 4593 1204656 ĠTestString Compare 8503 438527400 0692 30007 LEGEN DA 8490 9680167 4427 174639443327 Ġbud dies 6793 0378296 89112 1701707975 83028 1298067884556 199204 06 5866 369321861477 ĠëĶ ° ĠChamp ionship 05575 56052275 ConstantTemperature G Hyukjin Kwon ĠSynchron ize ç»ĦæĪIJ çļĦ æŃ£æĢģ åĪĨå¸ĥ PUBDIR URL Scheduled Task penumbralFit CheckBox +)| (\ 8201 2260439 8959 1509419 Gust afsson Jenn ings VEST A incompress ibles seaf lowfile Ġfdb k Ġincent ive Ġedd tf ĠreUsed Coincs ĠTAR DIS setConf String ('---------------------------- --') ĠlistWith Iter Ġ``~ ``. Ġpoiss cf 14124 379766 comun ication beautiful soup 96278 186497225 18014 786978 ĠQuest ions ĠQDesktop Services 30997 3110589 26765 7715883 6790 8031706902 Ġabond ances openstreet map OutPut Fig 6901 0581165 Chlor ine CLM com ("\"" )[ 25412 184 ĠQuarters Estimates Ġradiobutton s ĠModif ications lamSq Arr tulo pysakki 9006 9816941769 ĠChemenv Error 19826 05487 66529 1021632 77799 090692947 åħ¶ä½Ļ æĺ¯ ĠSpectroscopic Axis ĠIbisTask Message Ġåĩº åľº é¾Ļ èĻİæ¦ľ TimeNetworkHawkes Model 3108 78275 5224 954069658 6322 18 Denoising Autoencoder Ipython Notebooks TAL LIES uwave Phase èį ¯ ĠæĴ¤éĶĢ ä¹ĭåīįåıijåĩºçļĦ Ġirt flg ĠTON ODE ĠTown send ĠAAM orphologyDict Ġanl ge Ġlarg ers ĠnumOverlap Val frameN Start 11395 831373355 05901 699 Ġpyrose quencing 20334 184174 33556 2589532 45999 0082015466 ĠExtr aterrestrial 13917 2297839 ĠTestBin op 95603 0229911 85999 1370924 85067 3214 modeOf Comparison ĠZach ary ,'" ','') tesse ract 68235294117647 061 56315 598424 69149 3628639 CheckTuckeyHSD Mixin Ġclad ding CCCOM COM WithDefault Optimizer åĪĴ åĪĨ Ġmutiplic ations 03409 77025608429623154 20537 142561 25396 2552 11465 23497 EdgeWeight NodeDist 2041199 82655 prettyPrint Title 02816 011 26795 63 78628 9550372 12920 4455491 28711 3517 Ġ13467 8021 Saliency Map 70262 3467572 ĠHalfspace Intersection ="-| >", ĠUneven ly Ġidiosync ratic Ġ+-----------------------------+----------------------+ ------------------+------------------+------------------+--------------------+--------------------+ ç²Ĺ åĪĨç±»åĴĮwoe Chamber lain Arima ResultsMixin 年以æĿ¥æ²ªæ·±ä¸Ĭå¸Ĥåħ¬åı¸å®ļæľŁæĬ¥åijĬä¸Ń æīĢæľī以æѤ 3868 149510055 54309 830563063 7113 6662497 Bof inger Ovals Diamonds Pak istani reltime ax depre ction Ġdich ot 00338 001 getS Data ĠSENS ITIV Ġcoren lppath Ġxxy y ĠCrowd Flower ĠDdb File fileTo Transform arting an 12195 683818720 12759 15483177056 25158 97065 32299 63059766444 ĠYin AndGraham 33032 155 INTE GRIDAD 19798 243355 19303 7464089475 78317 207 78376 94413101 ĠTestT TPower ĠTestScalar Indexing ĠTestZero Rank 02112 618624 06007 3670135 36216 97271802065 8473 25080235933 50953 05912227 26388 17772 26063 02438 98907 0935 98967 78578036 29100 21624185 39345 2987819 64766 1080 PIES NO 7987 46069247 71865 17314 ĠSymm Op 70700 09852 19692 341 23732 80669322028 Ġ3424 2324 35523 1897 13417 78273152 ĠScient ist 64494 10059 ĠLocatable Axes 21147 6658382565 20288 138 ĠManysources Dataset Ġattent uation 20729 86837319 36880 253962552 06799 017 17403 171759 17484 203 48846 29337672704 LogitFn Test ê³łë ¦¬ì¦ĺ à¥Ģ ", å°ļæľªæĪIJ交 çļĦå§Ķæīĺ èªŃãģ¿è¾¼ ãģ¿ 6956 9698 71996 11890171304 AFE EEE ASTR ODRI Hamp el Nord rhein Ribosome Profiling mcolor conv itore cord geof ab isRe plEagerEval Ergebn isse 10319 19692341 10296 7450643820 10876 1895522580 64447 167418 15458 3629539 20804 8037507 20985 0002 ĠSequencing Process 75117 18001796 Ġspeci elist 35127 923233898216694 35474 13731172988 19276 2031948052470183 78004 96278186497225 13987 118 24275 173 24700 7917876533 27888 150 34032 02112618624 92965 67908031706902 87094 69395 4410 82655890 23077 3939838 23888 17132427317659 77003 329305568 77305 46212 67374 2606302438 479548 13 46229 1616 46217 4041253212 56217 17346937 89397 64278 74027 8030964 63667 341 83047 227180805 83016 1435004873377 199395 0041588888925 76999 362 STRATE GY 18464 94520941 63624 27683267827 13375 24869675825 13355 57242320528 04713 115980927279 Nonnegative MatrixFactorization 16526 01727704 66706 33544106 997754 038 22684 0153 Ġëĵ¤ ìĸ´ ĠCHi ME 65919 508778603 98043 00712287 94475 51358553 Ġ\"{} \" 194054 182909 16676 1272925 09439 8061 209107 18 ĠJoining Region Fluo DF 95836 129204455491 ĠFré chet 87769 1267122183 595286 10523 564444 1210349710332 Builtins Specified ĠACCUR ACY 993297 1956316 Pheno menon Ġdeterimin istic ĠEFFECT S #$%^ &* Ġbernoullim m maxRecordsPer Batch 56607 041 5759 14753849994 61415 94859476032 69878 214450052730 612687 1554915 72508 3968710 81188 75040246347267 Bthree C Dskip Tests Eclipsing Binary Kol kata Lav ender Rale way SQu ared broc coli bSort Features dAuto Filter jburk ardt mFs SfM sLOW RES æĤ £èĢħ ĠiNf InIt robr dunn Ġesemp io Ġrelav ant dilab io ĠisSub RefLine Ġisomorph isms ĠisInp FromFile ĠTdm Instructions thdu list setCheckpoint Dir setSorting Enabled matVictoria CuramIII ('========================================================================== \ getSP Region getimap qgrid getfq dn getPerspective Transform ĠStach urski ĠSlaMiss ModelView ristop he endfirst head ĠIGPU Model ĠPUD L pprc mdata ĠAQUA gpusph ĠtestException On ĠtestMany Values 01376 344 anceMo yenne maxBad Records derial izable poDed OP ĠuseDist SG assertNon Empty Ġprintmess g ĠEDG ES ĠsetAll Args Ġ41247 212 64262 84617 64438 6627299 ĠclassRight Pct ĠmaxNumOfUnitsPer Traders 12988 82 ĠgetSymbol Data ĠgetModelParams FromName ingsummary Urls 251096 84927731 readStrip Lines 32121 7832644813602 piaz za Ġzbu dowana ĠHagg is 15714 094398061 202302 469938122 33077 202380020454 3314764 631518509 defaultLocatable AxesClass 100763 0151545 80992 154 804556 16420531762 808485 399250796172 uniprotk b ayls is 75469 389347223 7513207 27026622149 755285 730504 752735 5434093214 88600 785456 88295 45 88018 1713101 880002 934152 160909 85119 35657 9418 149416 154583629539 19327 250 193688 3955417 checkMax Id 78803 8856519 136432 0455397 2218708 3009453 968900 63053448684 961780 27784 03128 102142 ancescat ti ĠTestMin ScalarType ĠTestMap Iter ĠTestNeg binClu ĠTestMem EventHook ĠTestFancy Indexing ĠTestPut mask ĠTestStacked NeighborhoodIter ĠTestLex sort ĠTestSubscript ing 02176 877691267122183 176834 295616 85186 16886554 8515536 1936883955417 8547619 80403401 mondri ans 24659 35297 243348 1337524869675825 2497697 202208 ĠinitActivation Level 27192 9958025 27985 213217 Ġ7149 2000 86027 089618936 86266 763303880285 868845 96412847 860694 0586 8625094 1982605487 SEObj File 3616719 101722 ĠlinRegress Cluster 343536 707 348022 854707564856 929994 782443987 TimeStream Data buquer que 84238 05948021 848076 64418109 84334144 95836129204455491 Ġqej un gratic ule 6504696 305522550699 dbRsp Connection 371038 931948 373306 10040 370124 78 373897 787590759500 508067 97753 50858 15689631499 ĠbatchSeq Lengths REDS HIFT ĠCheckOutput Thread 444817 773940795 556476 648891856 231982 3405321 773397 257 7726285 030739558 ĠgraphLegend Labels 90844 7823414068 902280 20537142561 obliczan ie ABANK ING ListImgs Df 438627 158492165 67048 271280295 676924 6397 679296 11787646941600 679425 642511923311 08346 263 081274 842819124562037 473426 8069916 602048 2668090 SetForeground Colour goplat eness ĠUnCor List ĠUnhashable Class 283526 80992154 289759 2029880 290443 98 290555 9296567908031706902 68184 24412912 68325 658035365213 682988 0581478 UserEnv Dialog 38315 81956863 38307 6544239 applySchema ToPythonRDD convertAllData ToOneOfMany 235794 7761283262 ADLS chema ADCTra jectory 483745 341 4810212 11510067 ĠAddDiagnostic Flag 57454 9539291747 69665 89020580 6911837 06919682 ]*|\. [ ĠExceptionOn Evaluate rmcg ibbo 891172307 0323647 74150 326950916 746627 2357947761283262 targetsAre OneOfMany ĠInputHook Manager IntGreaterEqual ToOne )+"+ )"+ 511206 10 514586 53994 518591 4574820317 631915 005072 798425 11912906 54187 66775112 830155 830281298067884556 93458 2164192308 760734 8858167839 pixelStop Index 81758 3616719101722 816693 10968307 82994 354706744441002734 82376 0272677 829934 193890626 255184 8625 2558569 86531461592 SubFind ID 1809316 28453291873626 538062 84909680167 5385526 81669310968307 repeatAnnot DF >\(|, |\)| 622590 322877 73065 492718499677 526494 2388817132427317659 CSMN bSetWeight 41786 96917801248292797448 OfDifferent SizeRaisesValueError 581917 06773776085 calcBack Project 101488 36149955 1010534 33531404501 714229 27888150 714087 19327250 PROSPECT S ĠFFTConj Slices 1591695 0149364 1591093 993 4006654 047870087 ĠNonIntersecting PathException 78402879 8040834 ĠDummyBuild Src 12020151 869 AndScum PerPE 2526580 934582164192308 2526478889 345 87312646 20834984978 ĠMeanVariance Norm 896365 67057211660 896399 872304734 3548836 774529 224054 9898 3179885 94118 cachedSql Type 901627 3850787285 905870 226993087 905531236 33727737 756126097 1541629 PPPRRR JJJ ĠHASHS UM 003874 6636700 0038853 06146 3332519 53125 264436 303920153504 26400415 958340311 265175 78164 2659245 24000098548 1856964 39679304 237605 228320268 1324557 33032155 MakeCommon List MakeCylinder RH 64406205 48 33746397 72340 ĠTOFTOF ScriptElement ĠFastscape Eroder 36094333 05754 ĠLocBif Points 2051495 55701841 8991314 6654751962 807479 0293236 211304 11173260288 937304 36835169 93745845 254 PipelineAfter Initialize 1143735 75641546 4320103 023 127057 054288 1272164 63 906257 011557677 906700432 4162775 258268 309528 1079606 023847 6672316 7550247 312089 167 312839425 808 306938 39360680 424766 743309967 8759497 9896778578036 8758267 198938604 1383964 87614720659 0163536 51120610 Ġcamerab ind 077131185 102967450643820 314801 077034158 6452792 1864 TabFitting Window 3951594545 47013 904924 34 9043376 069230007 9047587 9678824 9077932 138396487614720659 9072099595 0870013564 9072067564 574549539291747 995173 024591237303 3672925 896399872304734 61764839 17970178919 997082 20288138 ĠRadiusNeighbor Classifier 94397603640183 00083750242 045382 255856986531461592 8551975 18014786978 787069 7831365338 1870505 8595844 1043620 980863 216708 965990057 2162225 67930378296 964692 844 0991174667 631209287 257686085 68248 23434925188 45446 Ġ[{},{},{} ], WINNER IMG 9091347 3209005024 9093906 83047227180805 ĠParseGeHdr Element snapToGrid Index ĠSingleWeightMatrix Plot 3257604 931634 325631275 134 215967 35 2290262 80 scotth ull 324065 2679563 ĠInternalSend CurrExceptionTrace 321665276 230773939838 244259075 7549818 8441199 16090985119 136190 854 1360267 995173024591237303 980268513 777 985443 1605 303958 1993950041588888925 01978234 6493 2998489 459990082015466 Ġmvstdt prob 84702924 33077202380020454 8674765 143729 908289999 045189007100 99419401 501888968 2330845 87 2804866 85143937 07419519651 8674765143729 1949736 83 8793931 8038016012 8852024 3325 0653287 9447551358553 Ġmysqlt sv ĠMulticlassSOL abels 39390660 6689225 12962954 184557 301992663258 18 92966677 4323 66878667 6672 17418301 06000591285 86810955 036288300 6469975 237605228320268 8583282 88520243325 880253434 2016826507901 10840170576 2571 nvestig ate 886950 6674916445 8863772 751320727026622149 06875799 876 1956918 3099 7276681615 395159454547013 854781389 3314764631518509 1515111400 32 6747801 32 6743622686 854761980403401 ĠlgBatter Avg 28717795035 242267236 ĠDualLibQP BMSOSVM 0843504 19975358 ĠMcKin ney 88492905 8503438527400 4027853 855197518014786978 97671374 77799090692947 5073362 861078468845 7703721701 1007630151545 DailyReqPer Host 09751048 13987118 61937107 173421445 813172555 1578197705476 916985022 26 99390772 85792834 745640385 84807664418109 475304697 0247055 Ġ[{}',{} ',{}']\ 9148198405 846724121600860 7766591387 063623897344 hackPointsFor MathExponent 468666857465 6966589020580 909683154 665291021632 8801100704 438627158492165 5092933 7511718001796 Ġ+-----+---------------+ -------------------------+ 289865608659 759 406265794 823760272677 9727843935 1298882 5583186 348022854707564856 33262585125 22187083009453 73561663 04713115980927279 622939635 8758267198938604 0908791554 25 ShareNotShare List 650631537860946 3397807996 433141556 15536188546 825663145 2587146506 63795025 140390667 597289866 1335557242320528 ç»Łè®¡n天 以æĿ¥ä¸Ĭæ¦ľæ¬¡æķ° 9027564 97991250460 90219376 393906606689225 90288333 90228020537142561 7433392285088529449 175873 72046965 09726630531 855576876561842 1591093993 8982829 066468255593407 41316538 25102692595 4642348752734 325631275134 85842642315 2133048175 6982266 265924524000098548 8281885 0162428366088 5858613 321217832644813602 58527781620 866406200 81480211 122690129755 4259017538 272934994 8972983138 153530955 72524975 429 84530440147 12962954184557 2590545769 37721 53507521206968019 38272504 75560271689707 28127850416 7105305 456418785 115321196 5601 3082352470564 267657715883 892855145988 3548836774529 4232528745 6426284617 7996541 858328288520243325 25663769 87939318038016012 4785619492 20278089965 6965966 033912705 86439158 1364320455397 ĠìĿ´ë¦ Ħ 54937244 05281088674296 756466014 6829880581478 191779319 432 40832207 32868861566 7111381 808485399250796172 8171682088 462720394 407891732629 19340821 åĮħæĭ¬éĻIJä»·åįķ åĴĮåģľæŃ¢åįķ 119933047 9412225 41269866175 10148836149955 ------------------+------------------+------------------+------------------+ --------------+--------------+--------------+-----------------------------------+-----------------------------------------------------+-----------------+--------------------+-----------------------------+ 08243392717 3831581956863 45293856978 15916950149364 4898457899 53 838249725 282699297936 6388084 216222567930378296 15376811 97278439351298882 657211171671 8829545 792169546 2343492518845446 008234300 314801077034158 33638682249020 37330610040 271799687 308 44204012302 20 å°±ä¸ļä¸İ失 ä¸ļæķ°æį® é¥¡é ©¦ 237234904984 2743 330616875 186 1275653944 062 981088588613 9638 49153650 355624590556 62338762774 958223 15855284 1199330479412225 9569048385 259054576937721 842790747995 6670633544106 1584351912 289865608659759 883735803 4555706623131950 85648099 2275 192696303 995083 02779658 129 78976441477 99708220288138 134503984 15258360 4345168906815 271799687308 1105252572789 856480992275 410075928 2910021624185 25920529 135 4465700698 205149555701841 20281318 7870697831365338 6658120544 829934193890626 31109986 76999362 661614964735 7748681460822 270918733 0038746636700 45950434497309 88600785456 ĠTUTAcoustic Scenes Ġì¤Ģë ¹Ħ 8534754036851687 233084587 57070268069 15714094398061 8660254037844386467637 229 2213069215 084350419975358 6096221567378 335562589532 587416239596 874 587425542635 1153211965601 27253471564 788038856519 18709937 9810885886139638 3430008233766 309973110589 91359003383 25109684927731 8137453537 108761895522580 2792410639 30693839360680 8615278304 016353651120610 43869859 335973054345 831232646681 3240652679563 14540561338736101 20105857 03438868112 69010581165 ĠæĮģæľī空头 ä»ĵä½į 888380810666444 9854431605 52130083465 32 898310510439 787295405 322420492516 3257604931634 657919659 3110998676999362 496691725 66723167550247 2949136854 8074 89092832424712 51458653994 716689384 2372349049842743 bhilqpBHILQP fdgFDGO 5905759446119 191779319432 186306896 9804300712287 5047606444 424766743309967 915475947422 6504 821729693 9939077285792834 720734137 4753046970247055 95169902088 50 2426335234401 383076544239 8799661455640176 154025352 9025428073 192696303995083 ĠåĪ¤æĸŃæĺ¯åIJ¦è¦ģè¿Ľè¡Į 交æĺĵ 958178726109 2526478889345 9616876881954277199245 657 3679640085526 312839425808 8749560316673332 850673214 79203493426 29491368548074 53049224638101 91698502226 00250850845 4420401230220 6417513866988316 136190854 4427174639443327 209850002 891121701707975 9323183848 5866369321861477 207528215 0557556052275 45931204656 82012260439 36880253962552 89591509419 25768608568248 14124379766 71422927888150 90069816941769 78324932918 310878275 5645387813283867 5224954069658 330616875186 ĠæĴ¤éĶĢä¹ĭåīįåıijåĩºçļĦ å°ļæľªæĪIJ交çļĦå§Ķæīĺ 11395831373355 11169927714 20334184174 92 139172297839 859991370924 56315598424 30199266325818 691493628639 3609433305754 0340977025608429623154 11 204119982655 92 786289550372 2515897065 702623467572 1275653944062 Ġ+-----------------------------+----------------------+------------------+------------------+------------------+--------------------+--------------------+ ------------------+------------------+------------------+------------------+--------------+--------------+--------------+-----------------------------------+-----------------------------------------------------+-----------------+--------------------+-----------------------------+ ç²ĹåĪĨç±»åĴĮwoe 转åĮĸ 年以æĿ¥æ²ªæ·±ä¸Ĭå¸Ĥåħ¬åı¸å®ļæľŁæĬ¥åijĬä¸ŃæīĢæľī以æѤ 模æĿ¿æĬ«éľ²çļĦ 3868149510055 090879155425 54309830563063 02779658129 71136662497 28352680992154 12195683818720 26517578164 1275915483177056 78613239 3229963059766444 287113517 19798243355 5213008346532 193037464089475 8606940586 7837694413101 441082655890 060073670135 929666774323 3621697271802065 647661080 847325080235933 4320103023 5095305912227 258268309528 393452987819 1079606023847 798746069247 0972510394686 7186517314 108401705762571 2373280669322028 974199184 211476658382565 356579418 2072986837319 72524975429 17403171759 18705058595844 4884629337672704 194973683 7199611890171304 131266374 ASTRODRI ZZLE isReplEagerEval Enabled 208048037507 1031919692341 35127923233898216694 01925 3547413731172988 997754038 192762031948052470183 960 7800496278186497225 905443 247007917876533 3183201435 3403202112618624 773397257 8709469395 587416239596874 77003329305568 16872932937 7730546212 691183706919682 673742606302438 2240549898 462174041253212 2027072175 5621717346937 317988594118 8939764278 132455733032155 740278030964 6768991232610 830161435004873377 2399715 6362427683267827 226840153 65919508778603 93745845254 166761272925 668786676672 5644441210349710332 887354 9932971956316 781632345466 575914753849994 7070009852 6141594859476032 127216463 69878214450052730 20051878 6126871554915 194054182909 725083968710 6612822281339 8118875040246347267 248508 ĠiNfInIt Y 202302469938122 3418195228 80455616420531762 05623187 75469389347223 03128102142 755285730504 2033418417492 7527355434093214 462291616 880181713101 4566284786759 880002934152 3374639772340 149416154583629539 665297 96890063053448684 94672405 96178027784 9516990208850 02176877691267122183 0298 176834295616 1043620980863 8518616886554 019782346493 85155361936883955417 22677 2433481337524869675825 448 2497697202208 956030229911 271929958025 1652601727704 27985213217 71408719327250 86027089618936 64447167418 86266763303880285 12598538 86884596412847 64527921864 86250941982605487 11573628 929994782443987 2998916657 8423805948021 127057054288 6504696305522550699 212995 371038931948 2319823405321 373897787590759500 9446142 5085815689631499 483745341 444817773940795 6609694059 556476648891856 2465935297 7726285030739558 780127746 908447823414068 2638817772 67048271280295 59528610523 67929611787646941600 48987 679425642511923311 7869491 081274842819124562037 210 4734268069916 151511140032 6020482668090 644386627299 2897592029880 489845789953 6818424412912 442033411634 68325658035365213 02816011 481021211510067 6440620548 8911723070323647 674780132 74150326950916 50806797753 7466272357947761283262 338 5185914574820317 343536707 631915005072 1846494520941 79842511912906 06875799876 5418766775112 297376541293 830155830281298067884556 3 7607348858167839 877987008 817583616719101722 6233947 82994354706744441002734 63 180931628453291873626 003 53806284909680167 00338001 538552681669310968307 3792 622590322877 1341778273152 73065492718499677 21596735 58191706773776085 90492434 101053433531404501 3252480 4006654047870087 4836350 784028798040834 1576100581 2526580934582164192308 115 8731264620834984978 337843 89636567057211660 99815744 9016273850787285 964692844 905870226993087 2551848625 90553123633727737 09269407 7561260971541629 355231897 264436303920153504 9656450 26400415958340311 47954813 185696439679304 6769246397 89913146654751962 20910718 8074790293236 003885306146 21130411173260288 23950 93730436835169 19569183099 114373575641546 257595657 906257011557677 1146523497 9067004324162775 554189031 87594979896778578036 56239 90475879678824 4945964 90720995950870013564 91337 3672925896399872304734 923 6176483917970178919 174173 216708965990057 6449410059 0991174667631209287 33632 90913473209005024 36826431 909390683047227180805 0953 321665276230773939838 1830 2442590757549818 229026280 844119916090985119 7897667 2998489459990082015466 971 99419401501888968 130 280486685143937 0027628724 06532879447551358553 1053 1741830106000591285 32230 86810955036288300 78317207 6469975237605228320268 752 8802534342016826507901 575 8869506674916445 312089167 28717795035242267236 15457 884929058503438527400 1112 9767137477799090692947 061 5073362861078468845 461362 77037217011007630151545 10 61937107173421445 21602448 8131725551578197705476 160 74564038584807664418109 07 7766591387063623897344 648 909683154665291021632 7629 50929337511718001796 76218 406265794823760272677 9246 43314155615536188546 85942 8256631452587146506 294553 63795025140390667 15773828 902756497991250460 9412993 90219376393906606689225 36 7204696509726630531 663123 8982829066468255593407 161 4131653825102692595 237260 858426423152133048175 5780 82818850162428366088 29018 58527781620866406200 16316 81480211122690129755 14135 4259017538272934994 996429 8972983138153530955 952835 7105305456418785 989070935 42325287456426284617 15044 478561949220278089965 3575 6965966033912705 387505040 864391581364320455397 0169 5493724405281088674296 232 7564660146829880581478 138 4083220732868861566 219785 8171682088462720394 344996 40789173262919340821 32821 838249725282699297936 8621 49153650355624590556 30005 4100759282910021624185 986 27253471564788038856519 73 43869859335973054345 77492 0343886811269010581165 89 898310510439787295405 3307 49669172566723167550247 63 1863068969804300712287 138 7862895503722515897065 645 Ġ+-----------------------------+----------------------+------------------+------------------+------------------+--------------------+--------------------+------------------+------------------+------------------+------------------+--------------+--------------+--------------+-----------------------------------+-----------------------------------------------------+-----------------+--------------------+-----------------------------+ --------------+-----------------+------------------+ ! ``. ! '%( " ~ " -- " .. # -------- # !!! $ '): $ ([^ % ). & ", ' ': ' {: ' *' ( "," ) ')). ) ")). ) ]]: ) =(% * ")) * "): * ((( + $ + )) + '] + =[[ + =', + {: + ='. + ="< , @ - ~ . `` . ))] / ^ / .. / "): / >` / >< 0 856 0 855 1 803 1 125 1 80392 1 0196078431372549 2 123 2 256 2 168 2 103 3 663 3 644 3 09804 3 88235294117647 4 35294 4 115 4 160 4 965 4 654 4 340 5 9999 5 88235 5 134 5 00000000000000 5 165 5 154 5 048 5 785 5 33333333 5 130 5 888 5 176 5 260 5 989 5 1178 6 224 6 948 6 19608 6 11765 7 451 7 01960784313725 8 334 8 3562 8 2739999850000 9 117 9 354 9 349 9 024 9 648 : ": > + > "," > "% > """, ? @ ? ): @ {} A le A new A ster A bi A term A Star A ARM A DEPT A lfa B v B la B ck B abs B LS B CG B ALL B term B BL B KG B oltzmann B QuarterEnd B IPOP C w C as C ir C bar C LO C ITY C ORT C itation C MT C bk C preg C DIFF C antidad C razy D m D mat D AR D St D of D List D inv D UR D TS D With D rought E Z E sk E ffic E thr E clipse E phemer E ubank E AGER E viction F ort F CA F ev F PL F rog F requenz G la G OL G uid G rams G dB G SM G LR G fm G OM G umbel G HIJ G ermline G zipping G oldf H opt H REF H RT H PRT H hhhhhh I i I ra I ab I ll I ED I ran I inject I zhi I odine J history J uli J pn J FK J ulia J clp J PERF K J K X K al K fn K ou K EN K II K pb K OM K elvin L ore L ik L panel L Group L DS L ands L QR L tim L HC L ikes L ILI L clp L edger M int M err M sens M FA M TEST M tie M illiseconds M allows N ans N min N ag N AR N LE N multi N nodes N dims N Bin N ltk N DIM N FD N Ws N ichols N ortheast N ernst N IFTI O y O pos O CS O CR O cg O Clustering O MES O Multinomial O AUTH P ion P ing P cs P our P ets P NUM P Wave P VID P atsy P ColorMap P CHIP Q Select Q ScrollBar Q SRT R ap R SA R DS R WA R asters R ACIn R TPP S age S Val S ag S ay S pd S anger S parc S helve S NOW S untans S niper S accani S arsa T one T up T reshold T win T rf T AM T GG T AGG T weep T angent T GCT T PARS U DI U GA U DOC U DIFF U SCN V ax V AS V RP V essels V JOHN V ickrey W c W no W ake W UP X samples X Unit X Position X Form X Pass X LAT X Fail X WindDump X infominSpinBox Y W Y h Y v Y Is Y centered Y OU Y WindDump Y InfoMathTextBrowser Z H Z min Z RI Z DIM [ / [ ') [ {\ \ )') \ }} \ }` ] $ ] (" ] ={' ] =(- ] }$', _ =[ _ =[' _ +_ ` ( a ad a plot a class a oc a cor a close a part a ac a Mat a PP a LvlNow b per b gra b rst b ard b led b cov b org b month b mass b pars b tseries b ccc b kn b ritish b bob b imodal b tdtri b ionlp c ct c lab c lib c da c add c ork c rows c nc c ql c asset c DNA c ValList c iftify c riterium c uneus c alseqs d data d str d orm d ign d mean d mod d ram d cf d chi d une d cn d Omega d Vm d Dp d misfit d uplet d ndlnm e ge e iv e las e views e bases e phy f P f row f ams f bf f ud f ry f complex f He f simple f fil f bc f ication f qs f ury f sss f urious f trs f ngroups f pkm f owl f urthest f TickFormatter f uchia f leshed g ag g tra g ams g loss g files g peg g rounded g MLE g wec g orept g ildas h ig h ight h test h cal h pr h cond h err h store h bins h ines h nb h ws h bc h pf h walk h kg h Xg i ary i ren i arr i ap i pair i rer i ella i JO j al j id j mat j arr j ared j meter j footer j vp j ona k lin k arg k pp k map k idx k folds k az k two k zz k atz k olmogi l col l ange l ub l result l start l ones l bottom l bands l radon m N m mp m ct m lo m ith m mo m com m ule m column m arge m seed m idget m go m idf m CC m Cycle m coe n lt n iv n model n labels n foo n bf n Log n irc n selected n atives n ij n mg n Method n ominator n Learning n xyz n users n Loading n ctime n Epoch n uts n Win n venue n Obs n Stars n levs n replicates n dframe n Bands n Quantiles n EOF n lbda n Instruments n ivel n orths n Recommended n Cores n iftk o am o static p E p width p gs p var p fill p stats p day p List p factor p liers p codes p beam p struc p ractical p umadyn q tt q scale q img q ni q cx q Wait q tagg r ime r core r cl r like r lines r bar r dt r times r minor r Region s U s ot s able s path s log s ant s range s nd s ref s seq s rng s uffer s sel s PA s omer s pores s Inds s pence t fo t kwargs t zero t Name t img t seed t rol t ret t big t ux t strand t Cp t cheby t reename t amanho u ion u os u wiki u ably u Pi u avo u amd u ivb v ra v get v ind v sh v model v mean v tag v measure v rf v logs v atts v syncs w C w T w tr w end w ens w nd w ish w Tree w yn w rob w ae w iley x I x re x tr x amples x file x ll x txt x offset x Set x vec x steps x Line x em x formatter x Values x headers x matches x Te x datetimes x pixelsize y se y ps y date y zer y predict y rt y point y Loc y formatter y origin y oda y pixelsize y gazeleft y gazeright z lo z values z ong z bar z xx z bound z Line { |\ | / | ^{ | )} | ----------------| } "," } >` } >\ } '% } :" } """, } |\ } ='{ } ">' } !". ¯ ¸ ´ Ī ¸ ì¶ľ à Ļ Å ¡ Î © Ï Ħ Ð ³ ç ¿ è ³ è İ·å¾Ĺ ë ² ì £¼ í ĮĮ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĊĠĠĠĠĠĠ Ġ čĊĠĠĠĠĠ Ġ ^^^^^^^^ Ġ čĊĠĠĠĠč Ġ çĶ¨äºİ Ġ åIJĦ Ġ ä¸ĭåįķ Ġ ÑĦ Ġ æıĴåħ¥ ĩ ", Ī åĢ¼ ĸ åŃIJ ľ Ķ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ Ċĉĉĉ ĠĠ čĊč ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠ in iz in om in ow in equal in box in Stream in lan in quiry in RateG in BaseDir se in se th se ver se let se mic ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ at Z at os at lantic re ri re group re version re factor re xt re mot re conc re loading re starting re places re cog re fnode re BostonGeoBound or rection or anges or ians or ously or lis or iname Ġ= < Ġ= ': on p on load on python on press on release on trast on mouse on elink Ġt A Ġt gen Ġt arge Ġt ik Ġt abel Ġt sim Ġt errors Ġt tp Ġt ubs Ġt amanho Ġt readmill Ġt uberculosis er pa er nal er ating st v st ud st kwds st bc st lou ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ al pa al ten al bat al ytics al TickFormatter ar ys ar ag ar den ar freq ar my ar bre ar bsT -- .. an ames an hima le mon de nan de nsion de limits de cks de hyde me o me de me todo Ġi Q Ġi ta Ġi Data Ġi rows Ġi cols Ġi unit Ġi tri Ġi onic Ġi sect Ġi xyz Ġi trial Ġi Good Ġi hms Ġi GridVisibility he ts he ard he netic he rences Ġn R Ġn mb Ġn value Ġn dist Ġn sv Ġn types Ġn rec Ġn keep Ġn md Ġn yp Ġn Block Ġn Plots Ġn hooks Ġn qz Ġn lons Ġn trunc Ġn kx Ġn wanted Ġn strike Ġn amer Ġn asa Ġc H Ġc pe Ġc fe Ġc tick Ġc scale Ġc patch Ġc rank Ġc steps Ġc parser Ġc xs Ġc dec Ġc mid Ġc pickle Ġc tables Ġc logging Ġc heat Ġc rr Ġc Zero Ġc fract Ġc rescent Ġc symmatch Ġf Y Ġf os Ġf axis Ġf value Ġf count Ġf lp Ġf pack Ġf bins Ġf mu Ġf phi Ġf pc Ġf dp Ġf uer Ġf measures Ġf pkm Ġf ramer Ġf deltalab Ġa add Ġa bin Ġa TH Ġa daBoost Ġa oa Ġa pacf lf bgs Ġp N Ġp on Ġp li Ġp ns Ġp text Ġp gs Ġp stack Ġp sim Ġp gp Ġp cr Ġp ond Ġp bp Ġp oro Ġp unto Ġp iano Ġp Pnl Ġp DFI Ġp angen it at it est it rs it ures Ġs H Ġs args Ġs ng Ġs keys Ġs ped Ġs slice Ġs ports Ġs ociety Ġs clr Ġs ibis Ġs itename Ġs vara Ġs apphire mp b mp tt mp son ra e ra str ra vi ra iser ra vn ion file en wiki en gel en couraged ct i ct ol es ses ro bi ro binson lo val lo ster lo sal Ġin path Ġin ps Ġin ty Ġin Data Ġin idx Ġin verts Ġin browser Ġthe file Ġthe json Ġthe Fig Ġo values Ġo Figure Ġo wl Ġo tsu Ġd le Ġd pt Ġd ats Ġd sets Ġd af Ġd lambda Ġd wave Ġd ials Ġd oms Ġd Vm Ġd MRI Ġd lbda Ġd OkErrMiss la ug Ġ' "" Ġ' ======== Ġ' === Ġ' ']], Ġ' ]'), Ġ' ======================== Ġ' ">' Ġ' ðŁ ing re ing en ing ham ing Pdb pe o Ġm W Ġm ct Ġm out Ġm vel Ġm box Ġm keys Ġm my Ġm fs Ġm tot Ġm lm Ġm gc Ġm hr Ġm zs Ġm imin Ġm organ Ġm cep Ġm qn Ġm arching Ġm ildly Ġe key Ġe che Ġe cm Ġe mf Ġe lengths Ġe tdrs co ma co int co uch co bb co urs co ulomb Ġre serv Ġre process Ġre tail Ġre divide Ġre lace Ġre qs Ġre binned Ġre serves Ġre translateUi Ġre commonmark Ġre algood "" ): ge man ge oref ): >> \ core name ity a Ġuse c Ġuse ic Ġuse local Ġuse Gssa fig out ir ns ir filtered 10 99 Ġpar vals Ġpar files Ġpar CF Ġlen Z Ġlen ski Ġnum Data Ġnum Set Ġnum Match Ġnum Sequence Ġnum Peaks Ġnum Classifications ĠG lu ĠG TR ĠG was ĠG KK ĠG Dataframe ĠG lossary ĠG PAW ĠG omez ĠG lvqModel ĠG dbRspConnection Ġ< . Ġ< --> Ġ< ----> Ġout X Ġout lay Ġout idx Ġout doc Ġout FilePath Ġprint c Ġstr ung Ġstr printer us u us ic us im us nob lib ars Ġma is ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ġresult set Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ oc amp oc ortical ari us et ab ber y ber te ber the pl sq ĠRe id ĠRe format ĠRe check ĠRe mark ĠRe cent ĠRe fs ĠRe cover ĠRe versal sc ic sc ream sc ler Ġname X Ġname string Ġpre Y Ġpre m Ġpre t Ġpre emp Ġpre pad Ġpre fitted Ġpre calc Ġpre fered Ġpre ferential Ġpre configured Ġpre avgaxes Ġpre lude Ġtr data Ġtr ued mb l ick ed cl q cl ue cl Score Ġfile object Ġfile save Ġfile cmp ĠE h ĠE pp ĠE cell ĠE del ĠE rase ĠE ELS ĠE quilibrium ĠE TRM ĠE asiest Ġdf c Ġdf df Ġdf dict Ġdf diff Ġdf lux Ġdf actor Ġdf tosave Ġset ted Ġset Name Ġset Color Ġ4 94 Ġ4 300 Ġ4 999 Ġ4 91 Ġ4 060 date string date Edit date Scaled date AndTime ag en ag og ms ps low d low g low Energy ary a ĠB c ĠB am ĠB link ĠB ND ĠB Node ĠB igger ĠB PM ĠB ryan ĠB énéf sh b sh ing sh anks ty e Ġun clean Ġun flip Ġun converged Ġun chunked Ġun labelled Ġun folding Ġun trusted Ġun recognised Ġ5 200 Ġ5 57 Ġ5 51 Ġ5 41 Ġ5 856 Ġ5 432 ip ation ip ow Value Node ib b ib el ib ir Ġby r jo us ask Name iter utils iter rd (( ))) (( .*?)\ (( ?! ign oram Ġthis ymin Ġthis Trial Ġdi retório log delta log ins log Path log icle log pex key names key pressed key colon random streams `` ,) In Time In Graph In Image In formative In chi In del In Trans In Chains zer ophase Ġsk ies ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġlist like ack nowled Ġle er Ġle ur che ff che str che ader che ap 99 13 99 756 99 175 Ġcomp r Ġcomp type Ġtime end Ġtime bins Ġint g Ġint second ant is ant olik 64 20 64 68 64 53 64 954 0000 4 0000 24 0000 1111 Ġ> {} fo af und ar score Box score diffs [:, ~ [:, :: ĠW dim ĠW ron ĠW ilcox ĠW FM ĠW orst ĠW agner ine fficiency format Time Ġmax I Ġmax data Ġmax points Ġmax IX Ġmax Lines ord n num x num labels num Item num Classes num Concepts num CavityArray og ender og aster model Widget model rates Ġfe hs Ġfunction ing init al init ctl init fitparams init Repeat plt r plt to add force add Command add Subplot 12 00000 12 68 12 665 Ġget FileName Ġget Columns Ġget Photo Ġget SVG Ġget statusoutput port list ĠO IM ĠO hm men i nel son result Array Ġbo f Ġbo ys las m Ġmodel File Ġmodel Activities Ġmodel Anno Ġit n Ġit v Ġit aly ()) `` ()) `. ()) ]). ()) ]))) ca e ca is ca uto ca pts sub pop sub threshold sub peaks sub headers sub locus sub meter sub domains sub urban Ġ** + ep fl ep isize Ġcheck sums Ġplot fig Ġplot bool Ġplot branch Ġplot It Ġplot Streams Ġplot ldos ator Data roup s Frame And Frame Writer ix max map k Ġall pars Ġall Mode Ġnumber of Ġhe p Ġhe ard sum and Ġpo loidal Ġpo kemon old id vel Actual lim mag lim sex Re import Re index Re build Re ceptor Data Out Data Format Data Monitor Data BlockInfo ft d ft mp 25 346 Ġso mato raw size raw score Ġline A Ġline Type frame d frame Data inter q inter mittent Ġpd c Ġch data Ġch imera Ġch ikou Ġch imeras so ftspace Ġdist fn Ġdist Image Ġdist ancia ree ts ll int Ġ.. .... Ġ.. /* 11 10 11 50 11 43 11 400 Ġcan on Ġcan ned Ġcan tera Ġcan nabis mean Shift read spec read Counts read FromFile read XLS que uename loc X 32 0000 32 85 32 30 32 9507 unc ing ther modynamic ther modynamics Ġmin R Ġmin os Ġmin cols Ġmin point Ġmin Date Ġinput Word Ġinput ImageName Ġinput dispersions his hek ĠPar sers ĠPar aview ĠPar infoList Ġz end Ġz bin Ġz prob ng d ng w color key color image color pair text position text grids text Good Ġ\ % Ġ\ ", ĠIn ception ĠIn clusion ĠIn corpor Ġper ams Ġ10 20 Ġ10 57 Ġ10 82 Ġ10 73 Ġ10 482 bin c bin n bin y bin step bin ops bin arsity Ġsc rabble lic able act b act ed ĠY hat ĠY EAST Ġdo Learn Ġsh ps Ġsh tools Ġsh pg Ġsh rbits Ġ) ._ Ġ) [::- Ġ) **( ights quigarrow Ġnew E Ġnew L Ġnew pt Ġnew list Ġnew node Ġnew Table Ġnew PosDF Ġnew ampliado Ġtrain f Ġtrain Output Ġtrain Iters Ġj x Ġj pos Ġj dx Ġj footer Ġj vp Ġj azz Ġos prey true Name ĠH G ĠH over ĠH AB ĠH MP ĠH sr ĠH PV ĠH HOUR ĠH olding ĠH GNC 15 25 15 82 15 999 print Header 05 16 05 200 05 81 05 800 05 858 05 052 05 8110 input Arr Ġlog ity Ġlog var Ġlog uniform Ġlog likelihoods Ġlog Mstar Ġfig path Ġfig Fmt =[ ]). are v are els tra um tra versed Ġ---- ' ang mom Ġinter change Ġinter iors Ġinter rupts Ġsample Names Ġpy type Ġpy Date Ġpy zmq Ġpy druid Ġpy maid Ġpy frp Ġpy autog Ġ[' ']: Ġ[' .', start ind start pos idx NO not ag :` __ :` |\ Ġno cons Ġno Match Ġno uvel ĠU m ĠU ng ĠU MB ĠU CB ĠU VW '], - pr ate pr uns pr iced 20 98 20 327 ark y dd cond Ġcl str Ġcl ubs Ġcl unky pos Color 33 17 33 47 33 31 33 93 33 120 33 157 Ġsub name Ġsub node Ġsub images Ġsub fmt Ġsub fields Ġsub network Ġsub dirname Ġsub program Ġsub divisions Ġsub scribers vari ab predict ivity ie th no ma no std no keys no err no meta no interp no body no bjects default limits default extension Ġmatrix var 201 40 --- \ Ġha b 100 47 80 34 80 42 80 6677 output Offset Ġ6 951 Ġ6 563 ger ia new arr new Pos ES Core Ġfit Pars ER K ER X ER ICAL IN A ste red ste ven Ġtype of Ġtype face Ġtype String Ġtype vars ĠData Info ĠData Dictionary ĠData Shape [" ] ative Base code gen split img ]] \ ]] ** ]] ]. ]] ][ 66 98 66 82 doc dir ĠSe als ĠSe ismic 45 99 45 32 45 000 45 89 45 2079 45 1706 ific ance AT AR AT CA Ġind X Ġind c Ġind y ĠK ent ĠK ang ĠK diag ĠK irst ĠK MD ĠK uiper load file load Forecast 75 43 75 000 75 53 75 62 75 968 75 1400 Ġspec data Ġspec fit ok ontrast use Motif use pymol 88 05 88 78 88 285 grid cell grid cells "] }} 16 10 16 19 16 92 16 37 16 28 16 91 16 246 ml mf Ġup a Ġup g Ġup val Ġup down Ġup erp av ranks iss ons Ġro bo Ġro bin show Graph show verts show Fig show Secondary ude n ong odb dist files dist ract **** \ Ġapp nope ak it ak os ak im Ġone MSE nan mask ĠEx perts oth ings bar mode bar bara 35 30 Ġcur row Ġcur rencies arch ived arch iver 14 69 14 015 19 223 Ġkey Ind Ġkey ReleaseEvent with index with gid group rank group Labels // ", ))) } ))) }) ))) [:- tick store cur Col )] \ )] [: =( { =( [' check dep Ġprob Image Ġprob Matrix sets peed AR TI ON BAM Ġ8 46 Ġ8 79 Ġ8 256 Ġ8 295 Ġ8 240 Ġ8 249 Ġ8 244 Ġ8 758 Ġ8 248 Ġ8 210 Ġ8 674 Ġ8 263 Ġ8 682 Ġarg h copy path 78 11 78 62 78 2228 St ory den vt den ormalize 13 99 13 41 13 904 13 617 inal izer Ġbin frac cor ize Ġid t Ġid os ĠV ie ĠV BM ĠV Vp rand dm radi mre be os zero value Ġpath InpNii Ġiter counter sp ends sp ills Ġdate u Ġdate stamp figure dict Ġother Info table B 04 0000 04 800 04 134 04 997 Ġerror norm Ġerror obs prob samples 96 09 96 90 96 89 96 59 96 030 03 82 03 025 03 885 the time the section the Length the chapter the subreg lat itud column Range column Only Ġstart stamp Ġstart seq Ġstart stop Ġstart Lines Co mpl trans map trans itive ĠNot AM ĠTest CA ĠTest Bayes ĠTest Median ĠTest Circ ĠTest National ĠTest Mood ĠTest Bartlett ĠTest Probplot ĠTest WtdGlm ĠTest Slicing ĠTest Summarization ĠTest Levene ĠTest Shapiro ĠTest Fligner ĠTest Ansari ĠTest BinomP trib ler dim grey dim itri Ġmo lec ou ce target List Ġdict By Ġend stamp Ġend owed Ġend owment dot eq write HDF std return method name Ġ{} '). Ġ{} /{}, 95 43 Ġover come Ġover writ Ġ100 45 ',' \\ ',' _') ',' >', Ġcom missions Ġcom modities 17 03 17 92 17 93 17 337 of peak of older ĠCo vered ĠCo lored ĠCo RoT object Tree ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ Ċĉ 85 27 sort key sort Col sort Row Ġbase out Ġbase model Ġbase lining Ġfirst N Ġfirst char Ġfirst Row Ġfirst page OR G OR IAN ank ers run len run mode Ġfeature Indexes :// < Ġve get Ġve ltype Ġve xh Ġcont rollers Con versation Con ventions mon days ]]) ' ice box 24 10 24 11 24 04 ĠDataFrame Test Ġinit Days csv data csv line 27 38 27 432 Ġdis section Ġdis ks Ġdis aggregation Ġ7 98 Ġ7 38 Ġ7 124 cond o freq Unit cat erp main stats node Data gend a ref ID ref Entry ref reshed ref ugees Ġresults Corpus ]: ]) 86 35 Ġimage path Ġimage IO SE ER gen type gen edb Test WtdGlm Test SubDict scale A scale B mark right mark both AN E abs max AL IC AL DEPOT var ma var min var covs var triangle var propto Ġpoints ize ols keep }) [' }) _{ cent i cent gal Ġsys id Ġmean se Ġmean val Ġmean Image temp dirname 18 19 18 71 18 974 18 958 18 1458 fix A fix G fix ations fix cost 36 64 36 94 36 17 36 81 36 355 ec f ec we ten Bell norm sq 07 47 07 886 exp at exp Name exp Number ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġpass ages ap n ap rior Ġqu es Ġqu akes Ġqu asar Ġrun ge Ġrun dir Ġrun NN Ġrun Dir Ġnode A Ġnode Map feature Space do a do is do log do ench mod c Par Do dis cret dis gu dis pense ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ delta h ST hr ST DEV Ġadd itonal rc nts med v Ġnd raws Ġlin el Ġlin ha Ġlin ke 34 19 34 44 34 82 oly tic Ġparameters file Ġ... ]), Ġgrid X Ġgrid color Ġgrid cube 97 05 97 35 97 19 97 30 97 77 97 000 af rac Ġpart ly Ġnon uniform Ġnon standard Ġreg results Ġreg ressed Ġreg enerated Ġversion file Ġversion mod ĠJ I ĠJ MR ĠJ Mol ĠJ RK 92 12 92 75 92 69 92 123 92 12708 ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ graph Frame save f save To save Image save Clusters ID ENTICAL Time Offset Time Print Time Viewer points DF Col on cv oigt ception s bu lences Ġload File Ġload Model Ġload Simple ĠQ B ĠQ E ĠQ NM sg y lp ins 84 78 84 92 Ġtext font Ġtext template ĠFor warded center sy Ġ''' %( Ġq learn Ġq ep Ġq ml Ġq rel umer ic Ġopen file Ġopen gl oo v ram isu left lo Ġsort ind Ġtarget File my H my st my key my colors my Dict my maps my variant Ġ[[ {' Ġ9 85 Ġ9 07 Ġ9 39 Ġ9 317 Ġ9 308 config dialog config Cam Ġgroup idx Ġgroup ped ']. \ Ġmask type Ġread back Ġread Times Ġread AMRVectorDatabase ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ass ault Ġfreq Ch ac w ac sh ac ron ac quired cov df Ġim L Ġsum mit rel int rel change Ġtemp d Ġtemp str Ġtemp df Ġed k non out non face non numeric non matches non seeds verse Mercator Ġtf l kernel Function eps n gr s gr in 65 99 65 09 Ġcluster k db p db ef db dir db lad db Df db nsfp Ġac d Ġac ro Ġac ces File Map File Open File Like File Wrapper AS O stack loss Ar quivo Ar IsoTope Ġad jac Ġad dend Ġright X Ġright up Ġtrans m Ġtrans fac 37 67 37 47 ess a ess le step Count cont lev Ġmulti epoch Ġcompute Square Ġ& , tf in tf id tf ul tf model tf pA Ġorig mask gn ip ĠCon strain 87 64 87 33 87 37 mpl skip mpl cursors vi ed Ġtra s Ġtra der Ġtra ited RE CS RE NDER _. '+ top dir top Class CA AR The File The Default Ġmult il Ġmult ilinear Ġmult iband OD MR State City ik s legend fontsize ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠCheck point 44 49 44 82 Ġleft lo Ġleft Vbox item ize ĠZ F ĠZ heng Ġpoint idx si re si mpler active remove Ġneed lessly acc retion fer ti 55 0000 55 85 55 647 55 57 55 53 55 03813 Ġshow array Ġshow Plot Ġshow indexes Ġshow progress Ġshow assoc nn l nn x select all respon ding url map EN DI stri pping 23 04 23 85 last key last Update last Successful Ġ(" ([ prec entral pop ts pop ped Ġuni ax Ġuni vers Ġuni codes Ġinitial data img X img Orig quest s Ġbu ys struct uring Ġback tracks Ġback tester multi D multi get multi Value multi element multi page multi pole can al can dels Ġunder going 26 01 26 99 26 16 26 07 26 98 De veloped AC TS Ġcalcul er Ġlast ly `, ..., 77 05 77 96 77 6471 77 1815 ĠDe embed ĠDe convolution Ġgraph def Ġgraph data Ġgraph Data process guard ld fileloc auto format auto connect auto covariance word classes ([' __ TI nt over l {} ]'. sup s rit z ga ul ga indb net DataSet net TargetSet pandas afe Base name Base df Base Decimal Base VB Base CoordinateFrame Ġsm u 90 89 90 82 90 846 Ġzero ing matplotlib 使çĶ¨ Str ide Str TimePrint Ġnorm val Ġnorm factor pd m pd cond Ġsim Obj Ġsim replan Ġar cha Ġar xiv je remy pdf crop Ġvector ial Ġvector field Ġvector ised ĠSt urm diff lib create FitWindow Ġclassifier Type Ġclassifier Arr 98 12 98 19 98 2022 Ġdraw parallels kw ords ob sc vs a vs one vs wr _[ ..., bl Except Ġ} )] side line Ġsee beck AB ASES angle map Ġconvert or Ġconvert Np source Id IP E IP y IP TEST \\ / )* { day OfWeek Ġ12 25 Ġ12 11 Ġ12 20 gg title gg gg Ġdt b Date Format 67 91 Ġfind Closest alle vi alle xamples ĠAl chemy ĠPer Trade mand a DE stimator 08 14 08 19 08 27 08 2975 mm r mm ClearHistory rec uencia Ġfunc ión mag Ax Ġtitle Text Ne umann ia h sql str sql where sql server xy box xy pairs To Add To Tuple To Report To Clus fs igma ,) `): Ġab list Ġsource File extra dense extra fet Ġ-- " Ġ-- >\ store ys Ġbest lag Ġbest ClasEst phas ic Ġaf inn gb rs less sim rs d rs ph )/ ({ link dir 47 01 47 648 total Count total Read total GPoint sim iliarity Ġsave Plot Ġsave Path ,' *. ,' $\ vis list Ġca ax Ġimp utes Ġimp ression best p best prof "], \ user cl user Data user item Array Name json obj Ġraw Series 60 33 Ġrel err patch s SD ist SD HC ĠTime deltas Ġtop Friends Ġtick lines Ġtick store Ġtick IdxByGapMaxPhylDiag poly col FI SI FI MO Set StatusBar Set NumberOf tmp X tmp b rad vel rad kill rank ine current Changed Ġhttp d Ġgo ToList star catalog inf init inf lux Ġfont Size ful ltrans ze o Ġemp y Ġemp tied full Model DF UNCTION Ġ'. + ĠStr ike Ġinst al Comp ts Comp List Comp osed 49 19 49 012 Ġtree Handlers ĠUn directed Ġpred Data mu a 28 78 28 23 28 9636 gram ge lik f EL VIN compute Cost Plot Func 9999 90 ĊĠĠ ĊĊĠ sys argv Ġunit vec CH X find Nearest find Child job ids job State job tracker job Pars For Fit For Evaluate For Each For FrameAnd 29 17 29 85 cos vec Ġsignal Name ud pt Res Phase Res haping Ġfull Data ĠPlot Plugin ĠPlot Solution dev freq steps InChains 39 274 book db cls instance Ġimg par Ġimg Path Ġimg ShareNotShareList leaf lets 21 86 Ġge m root element Ġlib window Ġlib peaklist Ġps utils 68 384 68 2814 CT OT Ġparam Data Ġparam iko User ID ĠAn ge ĠAn iSpec Ġblock sizes Ġcho ix Ġcho kes Ġnoise Sigma Ġnoise Levels local Checkpoint mi ra 000 35 Ġtmp tmp Ġtmp DIR 38 249 38 7846 38 308572 Per Level Per Trade Ġactual TagName Ġactual izar fin n UR B UR adio Ġts allis _{ -\ apply ColorMap Ġoffset group Ġext ver ress ler Ġ15 20 Ġvert On Ġnet Params Ġ_, _, Mixin Nullable Ġnormalize Image Ġrank ListImgsDf 46 3662 ĠCreate Sample ĠNe o +' < +' @'+ action File action Table action Quit action Equation Ġcell par Ġcell Parameters td ic ward ness Ġmu x mf lay Ġeigen vals Ġeigen pairs ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġsecond ly Ġvar code Ġvar ables Out look Out Bed ML A ML oc sm irnovi Ġclose poly Al len Text box Ġ-*- `` Le an pac man Ġcov func dat path 647 37 Ġchannel ize 235 9 Ġauto format Ġauto mpg initial Image UL O AD APT ence ph Ġstd grow Ġempty ing Ġerr H LO I ]): # Ġman ufact Ġold stver ({ - ({ \\ ĠCol lector ĠCol onyzer Ġsin cos Ġwrite File let or nc itation ï¼ ģ remove Row Ġop ax Ġop map gamma py Log out Log Entries Inter sex Inter rogate ek f 48 13 48 95 48 34 48 21 48 2353 filt func Ġdb path Ġdb Connection 56 09 down btn down stairs Pre cond Pre mise IS ATION ĠAN NIHILATION desc endent Ġdelta Plot ĠGet All ĠGet ThreadId 57 47 57 383 57 7833 lon don App Name "," @ Ġbeta C Ġroot name ĠLog File ock er Ġkeys ToPlot Ġsystem d Not Changed ĠImport ed rough ly this Y this Type this Group Ġbox simu conf ine '\ ), Ġregular izations ]* \. Ġdon de Get Color Get Metric Get Title Get Dimension Get DC Get Std Get Idx Get Metadata Get Child Get Efficiency Get Linspace Get ColorRGB ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ cd ms chunk gen stream list metadata file Ġxy B Ġxy mask String Table Ġdisplay Units Ġdisplay NormalizationHisto Ġmy add Ġmy mean Ġmy List Ġmy dummy Ġ'/ . Ġ'/ '), ws mooth Ġfast as centers x Ġsche cter obs date clo cs clo ak Ġfactor plot Sh m Sh ower Scal aT :, :- :, }\ Ġdown val hash lib Ġdiag n 137 9 ĠRandom Confs Ġ*= , No pe No Button build Compt ĠCal cu Check Tuple sw at sw cs sw ater Ġkeep Sense fun ded ĠLo Ra Line Gap Run Clock Ġident ifiable ĠOn Close ĠOn Print Python Dependency starts ymbol Ġser sic hot key Py F Ġcsv Name Ġcsv todict training set training Cost Ġfra unhofer ĠBase Test ĠBase Plot ĠBase ExprVisitor Ġsa usage Ġexec name Ġ16 20 Ġmultiple x Ġpower Col Ġpower Menu project name project Code Ġdrop let Ġbar coded Ġbar cdict Ġbar riers Ġinterval depths 89 03 89 164 folder Out display Concept HO P HO USING contour Limits 74 15 74 2332 dec la dec min dec max dec imated dec rypted ĠLe mma Or Name band peakind imp ossible imp ostors Max out Max Time Max App uniform CloudBlock )') [ Ġdel ight '} \ '} `` '} `. aut res aut ier noise mean Ġnb a Ġnb clusters Ġnb Comp Ġnb galaxiesperhalos dr f dr one dr data pk a pk b tolist recursive Table Columns Table Builder IM AResults CO VS ĠIN TEGR Ġcomple ments === + åı ¶ ĠList a Ġtoo ltype pick able Ġconnect ome ĠYou Tube adjust ing Ġdiff usions Ġjson data Ġreference able ("% "): Mat thias Mat ToO high V cp g cp math Ġ$ > Row Label Function Name Function Filter session maker sens dict labeled TrainData Ġhold up Ġpop names Ġpop Higher Ġpop mata ([- ( ĠOr ders )+ ': partition Louv ĠMin CVa OP P OP s OP PORT Ġpredicted Labels Ġ14 80 fr md det id US L US HCN Input Handler Input DataError 63 06 63 098 correct s agg lomerate Ġdep graphs Ġdep letion Ġfname Title 001 12 001 8833 79 16 cost Jhistory Ġproject ile Ġproject Code light Curves ]+ )' ]+ $", )( ?: On Frame Ġparse Data 54 09 ĠNaN count collect ing section mark section Clicked Color Ramp ci li lr rmp Ġparent dir Net cdf Ġcache file Ġaccept ible EX R EX PERIMENTS yaxis range tag on sf E 83 17 83 09 83 9216 Min Temp tk paint RA FT RA PHY Ġsql ited 59 18 59 204 59 3901 ĠDi rectional ĠDi verging entr ant Ġstack trace !! !") Ġtag Close Cur ie ĠArray Instrument Ġus ffai He I ); """ Is Better Image ID Ġjob dir 199 37 199 72 setup script days im 93 01 93 64 93 32 ĠSh anks [( ~ handle boxes Ġside real Ġside peak Ġ25 01 Ġ25 12 Ġ25 96 Ġ25 92 Ġ25 60 events p ĠAll KNN Ġmeta comment next release Ġwhat not Ġwhat soever marker Size win sol =[" # Grid Size Grid RegionAdjacencyGraph 300 61 300 089 Up grading Spec ie QL F cro po Ġ". % Ġ". { 82 122 Ġ:, :] dependent Assembly aa ad aa abb ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ children v hour min Field Name see also Id Num 72 64 72 1569 OO S Ġ'-- ': .... ") Qu icGraphicalLassoEBIC Ġhyper stack fl ute Ġna postrophes Vari ability Vari ogram Ġleaf size Ġwave vec Ġwave functions ND MC ĠLasso Selector post ags post sgn Bin Centers subset ting subset Indices Ġdx t inner train NB X sl sqp Ġgc pp ĠGram mar final dict final Errors em r Ġcost new exit Dt exit Slit ĠInt Block rb harath At tack At tribution At tractions chi counts phi lipp ved i Ġsu iv Ġsu cks meth yl .* )") An chors An addbTask Window Type Window Width Ġeval Prefs Agg FuncType scan Dialog By Edge By XPosition ĠPy dev ĠPy QT ĠPy NEST ĠPy Pep Ġra mpy Ġra cing Valid ating Valid Fields Valid Grad Valid Accs directory data ()), ( conn Mat bet tor HE ET Tensor Shape Sub Dir Sub scribe FA P small col small world Ġfn fp wave rec >` _) deg F ']] } ']] `` Add Field Add ucts oper a PER T PER MANOVA 62 645 62 124 2001 01 yp adding ĠColumn DtypeModel Ġorient ational .' ; Ġho oked Ġho logram network Pane ./ = common Dates Ġmp eg Ġmp perr GT CA GT ACA green let pc Corr pc msolver aw L aw y aw ards ital k tex font Context Format 52 75 52 87 ()] ))) Ġte a Ġte ta ĠDo or rep Name gene Box merge ind Ġdepth field rf act 00000000 00000000000000000 nx i nx tc Ġopt unity mar ys mar bles micro sec micro bio Cal cium pg rain ĠMat ti cript ive sequence Counter Ġnx n Ġnx utils II p element Data }} ') }} ", }} "> }} {}} Ġ(% )' AM OTO click ing Parser Warning outer join Collection Tables Ġscript Type Th rows Th orn Th umbs Th alesians eg an reduce by Ġequ icor ĠRes pons Ġphase max Node Name Node TextVectorizer Figure Plugin Ġbeha v phase curves Ġmag py Ġmag Err Ġatom PDB selected Category 71 0177 Ġprior A Ġprior B 123 072001000000 One Profile cum dist QU ERIES SS FR SS HTunnelForwarder latex font latex only cmd args Ġsur rounds Ġsur gery Output TypeError Ġ18 80 Ġ18 36 TEST DATE TRA ST Ġmis behaving Sp heres Sp ontaneous Num Sample Num Iters SR atio ĠSparse Histogram ĠSparse FrameFixed Ġfs as short Name Ġvisual ising ĠID D ĠApp licable Ġsection ax ann ungsverlauf Ġepsilon chi Tool kit With ModelDir Ġord m Ġord key æķ°æį® é¢Ħå¤ĦçIJĨ ĠSpark SubmitTask Of Date Of Ta ~~~~~~~~ ~~~~ lc r lc mod lc dat rou Id gp cp Feature To CON FORM CON STRUCTION Ġvertices A engine ered mal eness approx imators 58 9638 58 7845 ('/ '. Ġymax t prod SourceLabel FO bj FO UND ij l ]}) ]) super category super impose Ġwrap Width Ġ"# % aux illary track list track length track ball track Energy ĠImage C ĠImage View ĠImage Testing SP INE +" '" +" +"+ sur facelist ĠSy ria As sess Ġpost ing bg m ny lon compile flags ĠMult imedia sd l sd ls Ġobs df Ġobs Sequence }$ ( }$ -- }$ )]') Ġinf odf Ġregion Name 61 88 61 323 Ġir ates Ġir rational geo Meta geo locate decode Mask ĠHe es ĠHe ister ĊĊĊĊ ĊĠĠĠĠĠĠĠĠĠĠĠ Create Field menu Enable Core gionalized cr E cr ontab ĠQu icGraphicalLassoCV ĠQu icGraphicalLassoEBIC ĠQu TiP shared X Ġ17 20 91 85 91 454 Ġestimated TagName calc Theoretical ĠSVC CVS 256 130 Ġcut line DS L FL ANN Event Time CG AG Ġhour angle experiment Results may o Ġpercent Error }\ ", Ġeffic acy Ġ"' ;") Ġoffsets Close Ġoffsets Open Info With Info Vals 101 99 ]') }) VAL ENT VAL GR ba e ba its 714 9 Ġes ri Ġes da Ġes mall _)) /( hy ster čĊĉĉ čĊĉĉčĊĉ Start Point Ġms ct export menu pat id pat ron çļĦ x çļĦ ATR çļĦ åĮħ çļĦ æķ°éĩı çļĦ éĥ¨åĪĨ çļĦ æľĢä¼ĺ Ġdev set Trans its bi oc plus D plus R WH Y Cont exts fetch ers Ġphi Plot Ġphi rot From Data ĠPandas DataFrame DD L sto pper Ġcodes A Ġsymmetric ally Ġfft axes Ġfft BinIndChannels Ġ"/ "). ĠEn ding Ad c RES ENT Ġdouble pars exc it TO S TO X TO UCH ĠFigureCanvas EMF ĠFigureCanvas Pgf ĠAd visor ĠAd itya Item SelectionModel rho g Ġgr ub Ġgr pd Ġgr angercausalitytests ĠLine Tool Ġfp u ĠDef erred $$ ' Point In Point Warning Ġboston Gauss PY PIT iso ch iso chrones ĠPipeline Task ĠOptional Float ĠFeature Collection ĠTrans ient ĠTrans itions fail Job Ġ---------------------------------------------------------------- ---------------------- Ġbyte offsets PR array PR CP Ġexc ite Float Labels ]/ = End Tick construct s Source Type Ġ"- // Ġ"- "). tau K nce xt xml Strings good bye Ġpol led 99999999 8 Ġcp m Ġcp n Ġcp dist Ġtd attr IX USR shrink ed ensure Minimal Ġmodify Name ]} < ]} ))]))) ĉĉĉĉ Ċĉ Pandas Single term name Mo P Mo zilla Ġstrategy Class Ġls b Ġstar list gap dh Select able Select Multiple Parameter Updated ĠParameter Range nat type wind ll px config "\ ' integr ating PAR TIAL Ġnc Data Ġnc files Ġcmd Line ĠMo dification Axis Tab chain A chain ing isy stem Ġsuccess ors Gaussian Model Gaussian KDE mes ser Ġsite customize soft ening soft ToGridlab Pr bs Score Data Ġsent i Ġsent Vector ĠVari ability Sample Plots ]))) [ ]))) +"\ NO ff ĠBe a ĠBe at ĠBe Gaze ĠMA INTAINER Ġ88 20 Ġ88 93 ĠVersion Id Sto uffer Ġcharacter izing Ġheaders sent ={} ), Ġss x Ġss Nake Ġwin def mot d mot s ĠKMeans Benchmark ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ NG X NG Y NG FS Action Geo 0001 01 Ġtpr list Gradient Tape 078 1 078 25 spatial ite ("-- > Current Epoch Ġwrong OutputTypeError Ġti ene ĠNum ba freqs M Var Standard mv pa mv olt ĠCur sors Level Bounds km ol Cl OO ĠValue Warning ANT IC Ġoverlap Mat Ġans wered Ġlaw p Ġwhole data Ġbig Wig Ġchain ladder ĠEX PLAIN xF inal autos omal Version Info Ġagg lomerate (', '), OUT PLOT OUT LIER calculate WAR hyper graph hyper volume pix ar pix series Ġpt no Ġpt mode New Data percent CrossValid wait Time Ġmar shal Ident ified Ident ifying Ġneighbor Ts "% (( Filter Meta smooth win ĠVector Space met ar met ics -> " quality index Ġchart ing ĠCom mission ĠCom intern Rec ieved Ġstand ing bra chi TP OT SN ES ĠPass Through Ġcells PerColumn ĠTra cker Analysis Factory Ġtopo file mas serr ceed s ĠNon Negative Ġprogress Bar TA Z Ġdump file Interactive Interpreter Meta genomics Ġeig vectors 336 09015 Ġer as Ġer sten Ġer reur conj symbol Ġtw ts ĠMock Placeholder ĠClassifier Chain filled brush Ġgu is Ġgu robi beam list )== ( colour space Ċĉĉĉĉĉ ĠĠĠĠĠĠĠ Ġgs n Ġgs ct van tage __() " 0101 0 ĠLA X ĠLA Y progress ive 109 06 Ġå Į And Frame And ale And Day Ġrv amp Ġ? "). Ġ? ??? vect ree Ġsen ses Ġix rdbs ĠCO ORD elect rum MIN UTELY Loss Options SO A dic key Save As Save Fig psd CaM Top Lef Mod ulator Mod erate Mod CM inp var optimize Target 318 2 Power flow Power Norm Power Deviations three js Ġct id Be haviour oral ities GG C Message List some time syn ch 926 04 MO ID MO US setText Alignment Ġsec list curr pos '$ ', Ġfeat Names Ġfeat Aroon ric ated 118 18 118 015 chrom Extre ĠXXX X <= ", Ġlab rad Ġlab bookdb ='\ "', 896 91454 ĠBo xes Load Image Load Cmp Writer Base Ġctx s Ġlight cone GR x Initial ised chan nelf Delta Phase Delta FieldMat 707 1 707 13 707 9547 Back test 184 849184 hline Value Ġll vm 219 38 sn preader ĠCs Transform pv pq aggregate DF Ġov lp 110 4 Ġrhs P zz a zz o zz test branch lookup interpolation Model Ġastro hack rev amp rev oke InteractiveShell ABC DEFAULT LIBS Change Cond Ġmaps ize 112 1 ĠCre ator SVR C ĠBuild Doc Sc Geom Sc issor 317 0 317 647 317 166075 icon v icon path service Tour Ġml pso GC FP GC Ms GC GTAG design var sho ots 133 4 133 74 Ġip f Ġip ax Ġip cc autoscale z 047 19 047 44 905 2 905 9 ĠPredict ive ampl itud enet ics ja ma sr ch helper methods helper Thing ĠST OR Ġ87 35 ĠTemp s bio param 996 33 996 34 CHE MES å¤ ľ å¤ ľçĽĺ boundary Count Ġinc idental Ġauthor ize ĠOver lapping Ġyears ToShow ĠStart FertilityAge ĠStart DyingAge _{} {}'. _{} _{}". _{} $". "} `` Ġcolour bar ASS UME ĠFloat Progress 119 16 119 665 }/ '. overlap VISNIR overlap UVBVIS ],' -', 756 3550 Ġdele table Spectral Centroid Order Data Ġyt l PP PP å¼ ł determin ism ĠMiniBatchKMeans Test Use cols ĠEl liptical Ġmicro circuit Ġì ¢ Ġì ¹ proxy check Ġ27 10 Ġtopic scores =\ ( =\ [ =\ '' Vis ited Freq Array rms f Ġ95 12 Ġ95 78 Ġ95 60 Ġ95 68 Ġ95 69 Ġ95 72 Ġ95 53 Ġ95 62 Ġ95 73 Ġ95 52 Ġ95 58 adj p Optional Dependency icient es Ġcached Range 512 000 æĺ ł need update Ġ35 16 send mail Ġreject max DR Y DR el dst clc 265 7 265 9 265 1545 265 2031 CI V Ġresize Nii Ġodd ity ĠIs Flag ĠIs Latest Ġlik ing (. { Pe at Ġce ase xl date Keys Dict ĠMon de Ġquant itation diction naire 185 9 (""" < ĠNumpy Array tre x Param Sklearn Fitted Values ĠDoc Tests Ġalignment group 237 3026 296 257 delt atau Diff Exp corpus path Ġformatted Data +'/ '\ saved logs minmax int Store Matrix Store Magics é ration Ġmapp ers Ġant ib ĠPRO GRESS ĠImp act Ġ'" /> Ġ'" {}" Custom ize tele gram quant al quant itation quant Fields Non Linear Lat Lng MAP INFO Ge ographic ĠIncre ments Ġmini um spike widths ĠMy MplCanvas Ġchrom x Ġchrom osomal neighbor Ps LC MV Average TFR Ġ33 96 ĠLO GGING Ġ96 96 Ġ96 95 Ġ96 85 Ġ96 06 Ġ96 97 Ġ96 87 Ġ96 70 dc gs AGG GTTT 115 861 Project Code 976 94891 amb ling replic ator loy er Jo ins ĠTH URSDAY Obj Attr Obj ToStr han de ãĥ ¢ Ġnr Cols ĠMatrix Dict Ġpreserve Snapshot Ġphot om Ġtc rit screen shots Ġtim filename success fully ĠFI VE 798 9 00000000000000 2 fac ilit 165 3492 ĠVariable Name ĠVariable Tree Ġpkg load Ġpkg config 175 1 175 5 175 00 175 09 175 65509 Geo PyTool Ġblank ed MD H MD HistoWorkspace ĠGMM HMM cen dent ĠPe ters ptime s Ġrotate Image Ġadapt ing Speed Subplot entity List iq tree pct distance texts loc 156 356 Ġvars q walk through forecast Environment ĠCluster Config ĠCluster Nodes 757 682 )^ (?! 1960 7843137 skew norm combine Frame combine Menu vio ural PM RA Ġ86 78 Ġ94 1 Ġ94 10 Ġ94 32 Ġ94 17 Ġ94 24 Ġ94 30 Ġ94 38 Ġ94 46 388 387 Ġ! =[]: polar axes polar ized polar ities prepare ResultsDir combin atorial aug X Covariance Matrix 987 667 987 416 nom er nom onic _[: ]]* tim ber Ġsr ml each Ticker Lin regressResult Ġpolar ized Area Ratio Ġmenu Id Generator TestCase uss y psser y ('# \ Ser vers ĠPLS v GEN RE DC M caps ys caps ule ĠHDF obj ĠHDF DataStore ĠDisplay ing 432 2651545 ĠEN SO Ġ"{} : ĠRange Partitioning symmetric al _") ] Ġfar AwayOST Ġ101 22 tar files umin ant Local Clusters 192 98 Mark Weight ("[ ?] Ġcop hent 785 87342 hard t Ġcatalog Implementation čĊĠĠĠĠĠ č 027 02 Ġ84 78 Ġmc lib Integr als Integr ators uv z Ġpng data ĠMag IC 012 119665 rr up whiten ess bench Cmd Center line }` ". chk bx 258 1964 /\ ,\ nav buttonlayout Ġpres ume Programming Error Ġcum counts 135 8 Port Spec 315 6672 æĮĩæłĩ çļĦ æĮĩæłĩ æķ°åĢ¼ Ġdend Ca RD L Ġ'* ~ 054 1804 Ġins ar Ġins ulation LOG DIR don ors mor se gu arded 312 29 312 97795 306 9 424 2 424 9 424 629 snr B Combin ations Ġ123 98 Ġ123 000 person ae ros se ĠTri Refiner ĠTri vedi Ġtrend arr Ġtrend Default IMP UTATION bas inh triangle lefteq Ġdiffer nce æĮī çħ§ Ġgal Q æĹ¥ åĨħ ĠNode List ĠDI VISOR ĠVis ually 138 7563550 Alt Exon Ġec fs ĠCa fe brain vision basis Box 016 1902 Copy savingList 075 079 075 4134 Selection Tool Wave Length Wave Pulse Wave Lpf Single taskToMultitask 286 9212708 Page Rank sam ModG Ġrf atpol ĠSignal DataBlockInfo ------------------------------------------------ ----- Ġmoving average 305 388387 1999 2581964 Simple Imputer ĠGP X Calculate Field Ġln lst Tab bed mapp ers }: ${ Ġ'$ '), Rel ig plugin Name 2927 1733 Missing Values ĠRo A ĠRo les Ve locities 323 6411 Eval Environment ('[ {" 164 2223 SPE A Ġflu jo Ġleg ged hp filter spin elw dip lo CAT S 1111 111111 hum ili My Label My Column My cobacterium lict ing ä¸ļ 绩 Attribute Of Ġaligned Face 155 95748 ĠHas Schema Ġadj output ROUP S (',') ]),\ Ġwide st ĠRegular ly ('$ '+ Ġ%% , SNR pilot INTER ACTIONS Multiple NetCDF Long Panel Long itudinal restore State 226 041 hit ss Ġcnt map ?? ??? ĠMetric Key Last Char Ġdenom A TimeSeries ModelResults cid motion Ind uced dos E dos car wa ar wa ist wa iter Normalized Ratios Ġpsd CaM Ġpsd LimBeta 145 34317 dds Shift Ġnans at SUB TRACT SUB TESTS ĠRV max ="# ") ĠPower Law submit Jobs ä¸Ģ å®ļ **- ( spine CaM Ġder by Record Amazon Ġbp map Ġrms le Ġrms QArr Ġrms UArr ĠSH GO kt iv Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 045 83 Car bons Car toDB Ġliter ally Ġbi layer Ġbt cut resses TheDefault Med Temp Med icine Ġspl ups Radius Costs dz ref Ġdialog ue Ġsun spot NET S Datetime ByXPosition pic num pic iously ĠSource CodeFile AV O AV RO rod Spacing 216 2 216 9 fla c REF MIN IF COPY 015 226 game Ob Product List Summary Data zpk bilinear 099 082975 fb path ĠReal Parameter ĠAUC s TOP LEVEL plugins Menu å¸ ĸåŃIJ starting Funds Artist Animation 018 23997 ä¸Ń çļĦæķ°æį® 385 1 116 9085 ĠIntegr ityError Ġgrp name ^\ ]] eco logy Ġbook i hm log Ġbio logist Ġtraj name ĠBin ning Cost Operation Ġpsi max rece ipt quick brown Spectrum Approximation Ġpix scale 666 88 Ġmed als sink horn ï¼ļ { è¡Į ç´¢å¼ķ čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠčĊĠĠĠĠĠĠĠ Ġmaterial izing 5686 27 lang tag Ġblob list ),' -', 035 8 035 806718 Ġcrit val Sign ificant æī © destination Format OF Score tif s ĠHigh ly lor i Ġremote Exec Mixture DensityLayer Header Type Ġshadow y Ġshadow ed Ġatt ens Slice Retr ORY S sentence length sentence TokenList Gene List Zoom Step prices List ĠSingle IntervalTicker Ma ize Ġhi ppo Ġcoeffs DF æĺ¯ ä¸ºäºĨä¿Ŀè¯ģ Met als Met perHaloMass Post s Post ed ĠRel ativ Ġrt lsdr Ġfooter Txt ĠBatch Iterator Cov Mat ĠLoss History ĠII p ĠCha os CCSD TF CCSD TCF har minv Ġbn ds adapt B Uns he uses pec Ġ',' % Ġhide Training 277 88 JSON Parser Ġga us 162 80 Pri vileges Phase List Ġtbl name (". "," working directory personal ity smaller IsBetter )# ([ 026 77 Nd len Ġcr ud Ġdv db Ġdelt s Ġdelt achi :])) . +\ ( fwd mag keleton How para BEM 2004 0101 Pen VF Chart Dialog Chart Options intr ange ĠMa ine unix ts Ġarma dillo Ġè ĩ Ġè ¢« )< =( kin Split RT D Ġsky Grad 222 9927 Serial ized 产 çĶŁ 324 2220 nf ls orb ate agger ate study list annual ised Atom Data Word IX specimen Length ĠAir port 249 15 ĠTask Type ĠBig Wig Ġ98 30 ĠAnal yz 665 293 Ġfla re ĠChar Coder Ġnv oxel nos able nos pk ĠSte phan Buffer Info MON IT Description File ĠReport ing 96862745 09803922 Events Temp trn data isna obj ])+ ", raft State Ġ\' {}\' çĽ Ĭ Mar ine Initialize Iter Ġspine CaM IZ ER Sur round ĠDataFrames List denom A Backend Package bro okes Ver ta Pixel Transform ,:]) - Ġphoto electron 980 2417 Bernoulli MM Numpy Version 457 1169085 985 3 CM H CM s CM SIS åĮ Ģ Ġchem Dt ']+ ':\ Likelihood s 350 757682 965 81 ĠForce Error Expression Output æ¯ į ("$ \\ Ġcompar aison Ġdz t Ġdz dy Ġmol grid unct ure Now Cnst uer gen Ġmono layer Ġ'\\ "') exposure Number Debug Runner gle ich Ġpct madiff Raster Data ĠMar System ĠMar kets 867 083 DEFINE DFUNCTION Matplotlib Widget Light Red Light Purple Ġphysical vol 657 45 USER DEFINEDFUNCTION 487 42905 Ċĉĉĉĉĉĉĉĉ Ġ ĠStack Info Ġhatch ings ĠCl ancy STD IN Ġ\" {}\ focus Calib TemporaryFile Path ĠArea Plot /{} -{}. Ġsear chable SEED S Ġparagraph Id 23456 789 095 9 095 68 Ġkx g Ġkx Lg silent ly Json Lexer ĠUnit X GroupBy Key 280 80213 584 2 NI AMOTO Ġaug m Ġhull s Si C Ġquot ations Metadata Error Ġ56 78 ĠTool Base PROJECT ING ĠMac Kay Ġ``- *- Ġweather file ĠBlack Body reorder bacteria 554 8575 228 2229927 248 29 ĠStream lines ĠChart DataSource ("< ", ("{} /{}". 交æĺĵ æĹ¥æľŁ 交æĺĵ åľº Age perHaloMass Ġks one ĠNULL s Ġ"[ +] 368 13 166 67 166 6385 Prop Dict 213 8178 213 84059 ĠUP GMC anno y KK I rem ise rem ont rem nants Ġpf vm Evaluate TransMap Pi C Ġnw ndw Ġhover props whe res Ġchains Queue 218 75 HC odel zo diazep Sta ging 064 9 ĠConnect icut peter marin Ġsb pl Steps ize ĠMO ST ]> - Section List Sort Key sch ur phy toplankton 7777 77778 Win stonLutz ĠDen nis ĠMB HBCARMATask nony ma ais ons Intensity Analyzer CY L CY THON 393 665293 210 40 FC FEA Dot Line Inf Param ĠÃ İ ĠÐ ± Free Flow Ġpq list logg uid Ġ{( | 217 1 NL ats NL ons strong ly Ġannotate Variants fam GWAS Ġdip olar isf ed hub s Ġfulfill ing Ġ################################################ ####### KS amp KS PS KS NDMC Ġfw ds ĠMixed SourceEstimate ĠEar liest composite Image *' *' Ġ"$ % ffff fff 993 99906 accumul ators Ġmor pho PB assign (... )' CAN DA ĠAB I pay able Ġlut size Ġcro pland Strategy Returns DAT AL gly cans Star T Forecast Bayesian 668 97694891 odes ics increment ed ĠSummary Writer Ġtransf erring wi fe Ġmiss Class EB IT rock ys quot er ĠREG I ĠPrediction Key nq pts ĠScaling Standards Ġhbox label Ġgyro frequency ĠAD X ĠExperiment Log ĠTerm Value 279 30 ĠDesign Info Sat Mag ĠEvalu ated Station Id navig ating INIT ALDEPOT .])) [ ä¸į 交æĺĵ 278 3 Poisson ConstrainedMixin Mach ler ĠVir us ĠContains Mixin 009 350757682 ĠCircle Collection ĠCircle Polygon 209 03327 resol v Term Transformer 242 8485 ĊĊĊĊĊĊĊĊ ĊĊĊĊĊ ĠTick Labels Ġexpl box Ġfam il EEG LAB article Id ĠMissing OptionalDependency dra gonfly Ġboot result Ġ125 33 ĠFlow line ĠShort hand Nr rlvl Ġdq y èµ ° Ġyes no explicit Text Ġparticip ated Bias Calibration ĠMultinomial HMM ĠMultinomial Logit Ġpn utils Ġpn exts Ġ'; ') ĠApprox imated ĠPhys ionet Clear Grid melt ed ĠBound Column 66666666 6666667 Approx imator Approx imating panda class >`__ ] Execution Magics ĠTyp ing Ġbuy ers PV LIB 058 0541804 Ġhar sh Ġcircum circles ĠAda pter FFFF FFF Ġpan es Ġscroll bars MNE c nam on recent ly æĭ ¼ Land ing Residual Percentiles ĠTrading Result ĠRNG Context Direct ly idi rect ĠAug ur nose classes Hyper parameters GENER IC who ops moon sep 362 10685 bib liographic five Bar Console Widget 82745 1 intra j '^ [\ Ġèİ·åıĸ 贷款 Ġèİ·åıĸ æŁIJ repo data fire wall fire fox setCurrent Database ĠSuper class 386 9 Ġconduct ing Ġsco tt åĪĹ ä¸Ń ${ _ ĠKDE s Effect Size ĠSmooth BivariateSpline ĠMesh Quality zf requenz Pt Av coarse MC ĠEnvironment Settings Ġ"@ " Ġtran form Ġtran parencies Plan ning drift ed ĠProperty Tree ĠProperty ValueDict Coordinate Transformation Ġ"& ", #------------------------------------------------ -- 50588 2 Ġwd th Ġfwhm FormatStr 575 78135 pss m Under line è¿Ľ åħ¥ fre y abundance Read Hive Conf Ġcairo cffi pops ize Ġ#================================================================ ====== ramp ed ramp event ramp Down Ġrem ind COND OR SG I Same Size Specify ing ĠPol arisation camp aigns FIN ET Ġ========= =" Syn Id ĠPi otr Service Client ĠLOSS ES Ġdialect s Ġzer r Ġavo ir 039 66897694891 9995 12 WORK DIR Tur bo Ġdil ute 0128 2869212708 Ti po nS el Ġpanda icon Ġhm C ĠMonth Offset dft data 8064 84 }[ ! }[ { Ġcontraction Type TOTAL VALUE ĠTho mpson #**************************************************************** ********** ĠtestTrain InputFn Ins pection Super ficial Ġextr atags ĠNeuro image Capture r waves how uds on Fro ude ghost s ĠRNN s ĠRNN Cell paint ed Chem istry ĠInv C euler Bernoulle lk hd phrase Vecs Web Kit Dat atypes bandpass object Ġemploy ing fts lct н ой fili ations NON SFI Ans ible Home s ole ted Ġcel lidx 836 10988 ĠSelection Protocol ĠLatex Formatter Ġ'.') [:- ------------+ -------------------------------------------+ 694 8866 ĠExpression s uci ón ĠNotebook Notary constit uent Don ut Sphere Pack POINT ING Ġcheb win Ġinfl ator ĠESTIM ATION ĠESTIM ATOR Ġfeel ing Bed Flowline ÑĢ а Dark Orange ĠGR UF Numeric Index ĠScha al Ġmpi comm nas ion ultra grid ĠEven ly Polar Affine hw asher Ġwal ks ĠDebug ger ìĿ´ ì AIR PORTS Plain Int dead wood Arch ived Ġfourth func OutOf Data GetValue FromKernelCache think ing Ġ107 47 pump ed tro uble Ġortho graphic ĠCy an ĠEigen maps Ġzp corr allele Count ('" {}" Direction Bin nex cerpt Ġdowns amp Ġdowns caled ĠLu ft DW CCSDTF PF B è½ ¦ ĠIndividual s synth file ĠMor phological Ġcalib rants Ġbib tex ĠGre gory harmonic ity watch ing Ġcumul ator Dele tes ĠContinuous Variable ĠContinuous ColumnName Accept ance Cr imes Scroll Area å¹³ åĿĩæ¯ıç¬Ķ velt imes Ġpour Livre mcc ormick alphabet ic Ġpil low Ġmir base Ġmir rconv Force Layout Team Name Che ese ĠJupyter App stk data lined ata ĠScan Info Accessor Mixin exercise s ĠPySpark Task ĠPySpark WordCount XXXX YYYY RESPON D gran ule ĠSTART ING 877 97 ĠPYTHON INSPECT Ġparty ID skin patch tenv rc 596 558 SAL ib ('../../ ../../../../ Ġskeleton ize scl py ĠWOR KS Ġconjug ated STATUS ES éĢļ ä¿¡ RAT IC External Package NDInterpolator Base éĩį è¦ģ åĿĩ åĮĢ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ hack ed Ġrg bs Gra vit Gra duate ika ze 9999999999 98 Ġthumbnail Wrapper ĠLev inson ÃŃ cio Shuffle BatchIterator Conditional ProbDistI OVER WINDOW Ġ/> '\ Dynamic Event ĠdataSet Conf extracted Info Ġ################################################################################ ### Components Analysis Coordinates Given Ġâ ľĶ stag nation è· Ł Ġtg ames ĠCG ToAAIDMaster explain er ĠRegion Catalog 97524 311 ali en ali ph Proximal Synapses ĠStacking Classifier è¿Ļ æł· Movie Format ĠGE OM gdp Q profession nelles glass dict dac SampleRate Break s Ga ins ĠAlgebra ic 289 783 inj set labor A ĠContin uation ĠCombin ation éķ¿ åģĩ BZ O lift ed 442 4571169085 è¯ģåĪ¸ 交æĺĵåľº Occ urs }| '. Ġ327 40 Sound File éĺ Ł éĺ ĢåĢ¼ éĺ ĪåĢ¼ ĠSAS data ĠGA USS ĠAccept ance Primary Fuel Ta homa ìł IJ tape red *********** ') .)* (( ĠtestMulti CategoricalProcessor Ord inationResults Wait Cursor ĠTIM ES ĠTIM INGS ĠIns Data ToolBar Area Ġutt name ĠÎ ¸ Ġhoriz On ĠPV Read Ġadmin istrative .** (( Pipe lines Audio Analysis Ġgenotype d Pulse height Tmp Dir nic ely yaw range addTo Val numberOf Atoms ĠComputed StructureEntry ĠSTAT IC Family Name Most Recent due credit Ġhd rs ĠDomain Graph Ġ[# ]_. 3247 0512 ĠQA tools Ġsmiles Model Trial Source Trial Handler Orientation Preference º ó Screen BufferInfo Trip les Ġtor us ĠNY U nrn Manager )+"\ " 405 53131 ठ¤ estr uct subgraph Size kc it Ġbirth day Ġcontr uct Pal estine ere i kser y retrie ving Ġteff s ĠSimpleTable Model Quality AndDay Ġtier psy ĠSIG INT refl Compressed clt names plotted Lines ĠEmail Parser 3810 94 3810 742332 Ġhor a Ġhor ribly 098039215 7 Meter Group Assign SpatialReference ĠInverted HammerTransform apparent ly hst lc Ġbul lets ĠTestGMM St ĠHy draulic Ġqq list Landscape Obj 935 19298 Fits File Ġgran ulation ĠScott ish CLIP SE æ±Ĥ åĴĮ 705 91769 South central story board fitparams list Ġprof ession KeyValue Metadata ĠVARI ABILITY Turbulence Power Ġ144 00 Named Tuple simulated Power plotData Item ĠEval PoissonPmf ĠKo z Ġelec Parms Leaf Names ãĥ³ ãĤ¹ 833 16246 ĠCap oraso Shadow Tools âĶĢâĶĢâĶĢâĶĢ âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ Ġshe duledEvacuation olim its Ġexpt ected beads filename Ġplist lib trap ped ĠSklearn KMeansBenchmark ĠAstro Data ĠTemporal Memory Ġfacilit ating Ġnds ymbol åĪĿå§ĭåĮĸ åĩºéĶĻ Ġcu is Ġcu array Ġpolit ics 0044 85780 adv Keys æĪĸ å¤ļ个 еР² ="{} ">{} dspg uide ĠEO Fs ĠBKG ND Ġunshe duledEvacuation Conveyor Belt Ġdispose Wav 07237 9187848 ToBig Bed ĠProto buf displayData Combo PRUN ED ĠTraits UI AndBinary Common 98447 393665293 programBasal Value ($| _) 83735 292 ãģ«ãĤĪ ãĤĭ 该æŶéĹ´æ®µ åĨħ ĠHealthcare AIError Consolidatable MixIn ĠNoRecordsFound Error aplic ados gime l ¤IJ 饮 ĠæıIJä¾Ľ 缴æİ¥åıĮ reim bur Ġnal af escarmouche Depth Ġ"****** ", testResults Equal Ġvise mes iteren code ĠnumLCCVertices fn ĠGil ra ĠParamat ers 20029 007 200401 11 86124 10047 98175 2777463662 47140 452079 connectSlots ByName stopTimes T 31106 90846 ('\+\ $([^ Ġattrb utes Ġrams ay ("\[ .*? threePoint Five savedict bcknd ĠDIAGON AL 138787 012119665 183643 3242220 95465 1642223 å±ħ æ°ij Ġtesse late ĠProximal AdagradOptimizer 568935 038 ĠRESPON SE ĠYinAndGraham SoilModel 388235294117647 07 533333333 333333333 51178 116845085 701960784313725 44 83562 8612410047 Cpreg ions PVID X QSelect Label Tweep Error hkg j mCycle ResidueName nctime name sref Data tcheby cheff wrob story Ġä¸ĭåįķ åIJİ stlou isfed Ġihms fs ravn ava Ġmimin um urlen coded isAncestor Of otchel lappa idops is Ġ"============================================== =" Ġ"§ {: ĠTridge ll setContextMenu Policy Ġgsk ws pydag ogue lensg al ĠPHR G pprl distr ĠASH RAE odcine k ĠtestCheckpointSaverHook SuppressesTheDefault ("################################################## ") ĠRappa port ĠRAx ML npaper url npermal ink pathPost proc ĠLxM xN ĠBénéf ices keycolon value 99756 057 antolik jan limsex periment 329507 771815 058110 52 Ġpyautog ui 33120 882 nostd inc 806677 1478 451706 387846 showSecondary CheckBox 782228 96030 radimre hurek ĠNotAM odule ĠTestMedian Test ĠTestCirc Funcs ĠTestNational Scale sortCol Method sortRow Method freqUnit Box 18974 37 181458 19972 aprior i SThr Events 92123 057 ĠloadSimple DataSet ĠcomputeSquare Deviation RECS PAN activeremove CheckBox 55647 751400 lastSuccessful Build pandasafe ty BaseVB HMM matplotlib使çĶ¨ PyQt 982022 657605858 ĠconvertNp ObjToStr 289636 710177 ForFrameAnd Parents 682814 261 38249 15595748 38308572 99399906 ĠCreateSample Workspace 577833 75 GetStd Handle MatToO mt OPPORT UNITY 63098 9461 0018833 009350757682 593901 321217509 300089 39 82122 1195098089 62645 3810742332 62124 0580541804 Ġequicor related SSFR perHaloMass OfTa intedMem 589638 20029007 587845 33120882 Coregionalized Regression ĠSVCCVS kGridLinear VALGR IND çļĦåĮħ æĺ¯ä¸ºäºĨä¿Ŀè¯ģ chromExtre mity 89691454 6624981 7079547 29271733 184849184 646742 317166075 55 )^(?! $)', 987667 19 987416 09 4322651545 39617 Ġcophent ic 78587342 806484 1387563550 35744 0161902 630989461 305388387 156356 19992581964 387 099082975 5522 quickbrown fox 035806718 015226 ĠRelativ ize ĠAnalyz es 48742905 2428485 5548575 57 2282229927 203536 1666385 8066771478 2138178 554857557 petermarin ov ĠScalingStandards core 20903327 2375663 57578135 1653492 ĠGRUF ork 596558 168631403 Gravit as è¯ģåĪ¸äº¤æĺĵåľº æīĢ 70591769 30008939 004485780 226041 59528080213 779 ĠtestIrisTruncated Iterator 00493777 682814261 ĠtestLossInGraph Collection dVdlog Dp 4772373026 13617 8786045 80921265 73832470512 9217 920852059626 70713 79220327 0299649 003214534317 2473055 00641346 115861 04374797 01823997 TextFileStringTable Initializer ĠPSEUDOC ODE 044933609015 2309 090819205 24915 23969802417 184 Ġauswae hlen 01363586 32781 214699887 1775 820468384 118015 132420284 381094 qvalueofpeak removal ĠtestSingleCategoricalProcessorPandasSingle DF 1349925688 1897437 943836210685 299 389843236411 431 41765075079 2556 0802517565509 893 072379187848 207877 ĠæıIJä¾ĽçĽ´æİ¥åıĮ åĩ»åĽŀæµĭçļĦåĬŁèĥ½ 47140452079 103173 3110690846 0517 ('\+\$([^ #]*)#([ 1836433242220 82 954651642223 25 ĠtestCheckpointSaverHookSuppressesTheDefault One 329507771815 361 451706387846 13 78222896030 858 18145819972 867083 289636710177 348 3824915595748 1695 çļĦåĮħæĺ¯ä¸ºäºĨä¿Ŀè¯ģ matplotlib使çĶ¨PyQt ! ): ! | ) (- ) ?\ ) "][- ) \\' * ~ * '], * "\ + ), + ((( + ']' + ======+ + -------------------------------------------------- , ? , [" , != . '} . ]= . ]} 0 804 0 223 0 868 1 120 1 64706 1 865 2 106 2 144 2 334 2 847 2 308 3 123 3 996 3 667 3 328 3 0000000 3 865 3 019 3 103 3 646 4 201 4 2000 4 120 4 808 4 026 4 176 4 1500 5 117 5 300 5 856 5 168 5 976 5 149 5 808 5 455 5 017 5 876 5 061 5 92157 5 1980 5 666666666667 6 999 6 645 6 146 6 167 6 158 6 327 6 329 6 148 6 776 6 78431 6 243 6 961 7 109 7 355 7 349 7 45098 7 107 7 995 7 267 8 224 8 806 8 183 8 329 8 661 8 11765 8 2078 9 88235 9 105 9 784 9 787 9 333333333333 9 666666666667 : ! : (\ : )< : ['+ ; : < =% = +" = << > ), > "]) ? ), ? ([ A val A ind A du A IDS A grave A aba A circumflex A nonymous A dieresis A aron B ro B ode B ow B ec B ID B ey B UR B zi B enef B MonthBegin B agged B ANDS B EEP B JOHN B odys B romine B ullish C J C arn C max C iv C atch C ream C OT C nv C ritic C xD C aso C cedilla C CTCTGAGAGCT D g D ra D IT D SI D coords D Grid D Window D CS D Sp D AGS D MC D WT D ilation D ipolar D exter D ashed D TTM D dkTask E li E di E ther E trace E mis E chem E acute E grave E circumflex E dieresis E berthe F Q F v F out F AR F aN F dr F cost F PT F letcher F linger F recuencia G k G ut G tf G xx G DI G LO G ND G nu G ITH G iro G love G andhi G lorot H pr H AT H du H mm H ui H LS H rule H ITS H omogeneous H FS H ARD H omer H Packer H oneydew H offman I Y I in I ax I max I SC I xs I UM I READ I EM I ENCE I acute I grave I circumflex I dieresis I sentrope J in J sp J Rotor J MaxStats K c K de K iller K Calendar K RG K BinsDiscretizer K Rotor K entucky K Medoids K loster L k L ol L sh L ang L CH L UP L SVM L BL L FC L slash L leftarrow L ynx L dsh M ent M Index M ik M ai M sensitivity M vts M aggies N int N ph N frame N ac N org N total N star N CL N cells N tilde N splups N CBI N warrow N abla O ak O cccc O Vec O GY O ccc O tilde O slash O acute O SIM O grave O circumflex O dieresis P ys P inv P UL P ilon P API P ractical P trj Q Date Q FL Q Learning Q Desktop Q GIS Q StandardItem R J R j R l R ex R data R op R ice R obj R db R dr R Trans R TC R iver R TM R ACE R WID R ail R icker R LEN R Ws R rightarrow R dsh R TAP R ConstantInputWarning R MTB R utileZrTemp S g S is S po S RE S AB S MM S src S fr S ART S warm S UC S URE S chl S lave S hooting S caron S WARM S CHEME T oc T Data T err T ST T ops T FA T TYPE T FL T ric T LM T WN T iny T odd T rends T Kepler T UPAC T obacco U u U DO U MAP U SCR U acute U grave U circumflex U dieresis U nac U nalign V Z V SS V dash V Norm V BG V Packer V csf V vdash V stretching W g W an W max W oo W OD W IP W att X j X is X Min X DIM X pref X infomaxSpinBox Y F Y lim Y hat Y LA Y DIM Y pref Y acute Y dieresis Y infominSpinBox Y MBOL Z mat Z RO Z Axis Z caron Z SUBARU Z GJ \ ^\ \ "))\ ] ([ ] :// ] (* ] _), ] \' ^ )]*)\ _ == _ """ _ :] _ ')] _ ?? ` '. a ure a if a fa a width a alpha a wx a acute a corrs a clk a phs a StopWord a uec b R b li b ies b bo b color b width b loss b tree b img b cell b ier b mi b ane b ti b marg b ait b rist b Margin b pplt b gref b ilingual c E c urn c pa c age c ier c br c une c styles c HV c agr c forster d co d ul d cal d us d arrow d cb d vd d é d ales d runk d onald d Cumsum e om e out e ther e bar e lta e uc e var e obj e je e ev e phi e bic e els e ering e btn e hm e thr e tright e grave e ICU f K f ans f read f params f cm f open f stop f IM f lies f gd f uv f lips f uz f Ext f cts f gsm f queued f GHz g K g S g ic g pa g fit g value g var g ia g sca g RNA g lad g nsim g romacs g neqq g mane h ra h py h ange h ers h shape h orm h start h ark h ats h table h cm h dims h omogene h pw h fftn h oms h pore h thar h aria h lich h oriAdvance i Q i int i app i ast i Period i CDF i quant i quote i REC i acute i amond i hep j st j data j test j ne j ai j cell j dx j pk j ks j uke k um k ns k Val k log k ull k av k lines k sv k ticks k Min k codes k vp k uniques l mat l args l ual l ative l split l matrix l ref l err l ble l unch l Special l gdp l ighter l nsim l cref m F m fig m org m lambda m FF m scan m unch m DD m va m jpg m zs m diffs m tran m recs m asculine n dd n call n length n filter n prec n To n less n lu n ui n exists n centers n avg n Color n mid n Key n By n Length n parallel n New n Note n runs n Points n ãģĨãģĨ n vt n Artist n moments n oll n Confusion n NEW n geq n rightarrow n Appliance n Coefficients n Folds n leftarrow n Miss n Checking n cong n parr n leftrightarrow n Leftrightarrow n Optimum n triangleleft n Rightarrow n Leftarrow n TempDens n Composer n OrgNum n trianglelefteq o P o bar o stat o seed o acute o Self o dieresis p M p ray p ch p model p ork p start p xy p header p iles p calendar p Idx p uniques p los p andl p loth p istons q ing q if q bo q axis q plt q result q object q sk q less q gtr q psk q adapters q pcr q lineargradient r N r pos r ally r cur r med r IC r top r sqrt r mm r DF r hi r curve r major r Min r Mean r dp r svg r pb r Sw r ão r atag r sqrd s ow s ly s key s rent s ings s ifier s Color s ba s stock s lac s poon s weeper s momenta s barSQ s myunit s lifunc t ke t fit t class t old t ols t norm t itude t limit t files t cross t AD t No t tests t ire t vm t é t ubes t Reading u am u ers u size u ib u float u params u TM u Sec u acute u grave u dtf v Y v ct v len v plot v od v format v names v ref v bl v rs v pc v As v xdata v lims v rh v fm v thin v Dash v nyq v liet w X w ad w om w ab w am w ies w ors w ps w new w bar w by w func w ice w inv w ilt w ain w bad w pid w rist w igner x ra x ad x ri x pec x ep x map x exp x Out x desc x Input x section x two x Id x tab x Output x Num x pixels x Step x zz x disp x mouse x walk x Shift x coarse x majorticklabels x minorLocator x Offsets y lin y ind y str y True y param y format y sets y the y limit y real y only y mesh y Size y plus y rv y Lim y Step y zz y Lower y coarse y acute y dieresis y Specs z j z par z ri z fit z sum z frame z cc z new z top z hist z units z inc z mid z Cal z yy z uel z rx z ircon z caron z nucl z ScoresDict { ^\ | `` } @ } ',' } ]* } ]') } ://{ ¢ Į ¨ ¼ ¬ ¼ ¯ ä¸Ģ µ Į ¶ æŶ ¸ µ ¸ Ķ º åĪ¸ Ä Ļ Å ¼ Ñ Ĭ å µĮ ç ģ ç ĸ è Ń é ½ ê · ë ª© ì ¢Į ĉ ĊĠĠĠĠĠĠĠĠĠĠĠ ĉ ĊĉĉĊĉ ĉ ĊĉĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ lter Ġ čĊčĊĠĠĠĠĠĠĠ Ġ čĊĠĠĠĠĠĠĠĠčĊĠĠĠ Ġ æľī Ġ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĊĠĠĠ Ġ âĢĻ Ġ éľĢè¦ģ Ġ æѤ Ġ æľĢåIJİ Ġ ç»ĺ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ 读åıĸ Ġ Ïĥ Ġ ÑĢаРĠ éļIJåIJ«æ³¢åĬ¨ Ĵ © ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ čĊč ĠĠĠĠĠĠĠĠ ĊĊĊĠĠĠ in con in sort in fix in vis in corr in Filename in heights in browser se qu se lec se EtAl se lindex se lenium at li at num at une at ilde at ribute re on re ver re ive re dir re labels re ferent re fill re analysis re define re ferencing re mains re blocked re lfe re algood re ithinger re pertoire ĊĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ or de or MML Ġ= $ on el on ally on times on Up on Down on Draw on Left on ello on netz Ġt le Ġt plot Ġt comp Ġt names Ġt split Ġt ense Ġt net Ġt ics Ġt ons Ġt DF Ġt roll Ġt sel Ġt ci Ġt Min Ġt Id Ġt sto Ġt lz Ġt forms Ġt Midpoint Ġt rorder Ġt pio Ġt errorist er b er re er is er ative er reur er npca st ray st args st bs st ok st lr st Image st uid st adi st Order st ocha st hm st utter al at al File al ities al iment al tzone ar um ar ab ar ly ar ses ar scl ar ceq -- ',' an try an nee le ach de q de en de af de tf de als de cel de pri de aux de activation de spot de generates de calage de pprof de tomega me e me dd me vs me mi me too me urer Ġi ot Ġi cept Ġi value Ġi pair Ġi div Ġi rng Ġi Row Ġi xmin Ġi seg Ġi xmax Ġi hl Ġi histo Ġi Att Ġi Annotations Ġi radon Ġi ExogenousInfo he lin he add he ars he idelberg Ġn O Ġn lo Ġn class Ġn score Ġn ca Ġn vert Ġn grid Ġn exp Ġn gr Ġn tf Ġn stats Ġn vol Ġn align Ġn sa Ġn tries Ġn Bin Ġn Iter Ġn ij Ġn Cor Ġn chain Ġn loop Ġn sources Ġn hess Ġn MO Ġn Arr Ġn Keys Ġn Columns Ġn cases Ġn traces Ġn workers Ġn Sig Ġn Nodes Ġn segs Ġn rem Ġn fibres Ġn arcsec Ġn asion Ġn PRED Ġn iggli Ġn slitlets Ġc P Ġc rom Ġc ask Ġc ine Ġc sub Ġc space Ġc mpl Ġc auto Ġc files Ġc ake Ġc dx Ġc hase Ġc pg Ġc irs Ġc figs Ġc umm Ġc kg Ġc Dn Ġc Vn Ġc ushion Ġc HPI Ġf Z Ġf is Ġf est Ġf cat Ġf var Ġf point Ġf theta Ġf hi Ġf prefix Ġf src Ġf wb Ġf rl Ġf dem Ġf Lower Ġf Upper Ġf roma Ġf sock Ġf queued Ġf merit Ġa F Ġa int Ġa date Ġa cor Ġa arr Ġa version Ġa md Ġa Flux Ġa psis Ġa ureus lf ulleval Ġp J Ġp W Ġp one Ġp pt Ġp ph Ġp width Ġp nd Ġp vs Ġp ysis Ġp cos Ġp ii Ġp change Ġp shift Ġp atom Ġp unch Ġp prod Ġp tile Ġp Density Ġp Tag Ġp Join Ġp rstd it us it ics it iy Ġs mat Ġs ri Ġs form Ġs param Ġs ll Ġs like Ġs start Ġs group Ġs sv Ġs length Ġs img Ġs layer Ġs day Ġs rad Ġs Id Ġs area Ġs quad Ġs bc Ġs izers Ġs Msg Ġs Filename Ġs FC Ġs nips Ġs pliced Ġs AMAccountName Ġs SampleName self ish mp ts mp ton ra ig ra ss ra sm ra fts ion ly en b en x en ic en step en gg en feld en leader ct h ct o ct v es ca es rl ro ol ro ug ro tz ro bc ro under ro cks ro mel ro ulette lo ge lo is lo af Ġin um Ġin ow Ġin cs Ġin box Ġin Fn Ġin Both Ġin ferer Ġin habit Ġin candescent Ġin nvestigate Ġthe llier Ġo len Ġo time Ġo min Ġo ds Ġo idx Ġo mask Ġo be Ġo ids Ġo asis Ġo dc Ġo hm Ġo Other Ġo csvm Ġo popts Ġd data Ġd ari Ġd axis Ġd arr Ġd norm Ġd stack Ġd gy Ġd stats Ġd mis Ġd Fs Ġd kx Ġd hd Ġd latlon Ġd majax Ġd warf Ġd Deltaf la cf la vc la undry ---- * ut op ut aries ut breaks Ġ' :: Ġ' ================================================================ Ġ' ')], Ġ' !' Ġ' ([^ ing o pe pe pe tra Ġm lt Ġm line Ġm fn Ġm sys Ġm mesh Ġm rf Ġm gp Ġm mx Ġm benchmark Ġm markers Ġm mol Ġm rp Ġm others Ġm rna Ġm uref Ġm sticpy Ġm reithinger Ġe dist Ġe arr Ġe prob Ġe Date Ġe pc Ġe flux Ġe pv Ġe gm Ġe kt Ġe urope co ats co done co occur co mentions co sines Ġre ft Ġre ferent Ġre ls Ġre comb Ġre structure Ġre mot Ġre stitution Ġre activity Ġre paired Ġre agents Ġre activities Ġre constit Ġre populate Ġre typed Ġre made Ġre Boston Ġre cog Ġre wrote Ġre worked Ġre computations Ġre chts Ġre authenticate Ġre lsf Ġre ryy Ġre pertoire Ġre semblance ge C ge re ge le ge en ge am ge qq ge terrors ): . Ġb plot Ġb out Ġb per Ġb gs Ġb rad Ġb td Ġb cnt Ġb pow Ġb margin Ġb att Ġb dip Ġb ening Ġb ffitlist Ġb izarre Ġb iterrd Ġ# {: Ġ# ================================= Ġ# ^^^^^^^^^^^^^^^^ Ġ# ************************************************ Ġ# --------------------- Ġ# ------------------------------ ed ly ed Data ed ia ed API ed illa ed ieresis ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ ic urve Ġw ss Ġw mean Ġw color Ġw ene Ġw Object Ġw exog Ġw ntr Ġw compact Ġw atts Ġw stype Ġw oven Ġw sinv Ġw isps ur u ur cation and test and ore lt te Ġ1 9999 Ġ1 126 Ġ1 184 Ġ1 360 Ġ1 127 Ġ1 446 Ġ1 148 Ġ1 439 Ġ1 750 Ġ1 379 Ġ1 783 Ġ1 370 ss df ss ys ss ays ss ums ', ))) un ig un order un mark un fix un ning un menu un quote un balance un trimmed un schedule un wanted un freeze un locked un fullscreen un managed un phased un answered Ġ0 00000000 is g is n is ic is get is hape is im is op is bool is release is Mask is Server is measured is Hidden is Frozen is qx is Padded is AttributeOf el is el min ue tte ue sta ate mp li fo )) % )) [" )) $') )) &( ser d ser ge ce ment ce ps Ġfor ace Ġfor giveness Ġof p ot ify ot Implemented ot ilde ot usum um q um issing um outs um WT um Mnt Ġif actor Ġif aces Ġ[ ('\ Ġ[ ?, as one as dt as logical as vo as uries 00 6666 00 73 00 128 00 600 00 901 00 115 00 356 00 024 00 362 00 1975 00 060 00 784313725490196 val X val Tbl id c id ans id map id izer id ucials id ieresis Ġas SampleName Ġas meurer di ation di ode di sembl () ()) () +'\ () }"' Ġis poly Ġis binary Ġis rat Ġis Dense Ġis orted Ġis identifier Ġis odd Ġis dtime Ġto us Ġto image Ġto Plot Ġto augment Ġto UnicodeMapObject ts mp ts kdir Ġ" ([ Ġ" != Ġ" )] Ġ" **************************************************************** Ġ" }", Ġ" ----------------------\ Ġnp oly Ġnp layers Ġnp dtypes ter pol ma gg ma pache ma ison ], / ), # ), _ ), ~ one A one k one Of ĠT count ĠT ou ĠT AL ĠT EN ĠT ele ĠT SA ĠT IG ĠT AM ĠT BL ĠT ango ĠT ied ĠT VM ĠT DEM ĠT BV ĠT ILES ĠT urtle ĠT weedie ĠT elemetry ĠT ucker ĠT ampere ĠT endency tr ated tr kwds tr uer tr trs tr idiagonal th rees th anksgiving ult iply ha ss ha ma ha ms ha zen ha plotypes """ @ Ġy Z Ġy param Ġy try Ġy keys Ġy org Ġy du Ġy Sum Ġy expect Ġy Tr Ġy ea Ġy Offsets Ġy logbase Ġy ScaleDbl Ġy appi res u ch it ch ir ch Diff ch taps ch messer ad u ad ub ad ically ad xs ad ots ad hore ad rian iz ado ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġdef late Ġdef lator Ġdef eats ve ter fi replace fi restore set C set color set Line set gray set Config set Features set Parameter set Rate set Extra set Height set Symbol set descriptor set Margin set Floating set Shares set EndDate set colorspace Ġ: ]], Ġ: {" Ġr str Ġr pa Ġr iv Ġr ix Ġr cov Ġr xy Ġr mi Ġr down Ġr formatter Ġr hy Ġr forest Ġr rr Ġr nds Ġr vels Ġr gridline Ġr és Ġr gridlabel rom er rom ov Ġreturn all Ġreturn stats Ġreturn Ratio Ġreturn Pathways Ġreturn FullPath Ġ2 024 Ġ2 056 Ġ2 055 Ġ2 2500 Ġ2 960 ver v ver dana ver haegen mat ype mat plit mat ik mat ters lab List Ġst anza ') < ') () ') ''' ]) ],' ]) ][- ]) +"_"+ om nib ck i Ġ* ] Ġ* ``. ime tric (' [[ (' "+ (' ')], (' ------------------------------------------------ (' ([\ (' ################### (' ['+ int age Ġ- %( Ġ- '+ nt ick nt wts nt rav Ġ""" - Ġ+ [ Ġ+ ': Ġ+ [- pt rain Ġg or Ġg ast Ġg fa Ġg var Ġg save Ġg filter Ġg AC Ġg rat Ġg prod Ġg bias Ġg chart Ġg irl Ġg irls Ġg wec __ =[' __ =_ ex pe ex peak ex reps ex pire ex CMS igh tharpoons data group data diff data cursor data NP data Processing data Exchange data Grilla name ComboBox ĊĊ ĊĠĠĠĠĠĠĠĠĠ ĊĊ ĊĠĠĠĠĊĠĠĠĠ ith ash par for up right up ped up uts up voted ode nd get row get Val get code get layer get module get Size get long get Row get Training get Target get Local get ctime get Fill get Vm get Connected get Existing get nchannels get FeaturesCol get AxType get GDS get RgbF get yaxisrange ab data ab normal ab bb ab ba ab outfile label B label Map label Style label ToValue Ġex m Ġex params lin enumber ax D ax d ax pyx ax ryx ĠS g ĠS or ĠS di ĠS ds ĠS base ĠS DE ĠS nap ĠS NOT ĠS AP ĠS SF ĠS BE ĠS Fs ĠS IDE ĠS AE ĠS FRAME ĠS aker ĠS neath ĠS pawn ĠS AVED ĠS lickGrid Ġco int Ġco ref Ġco mplemented Ġco herences ri v Ġimport Name Ġimport Probeset Ġdata X Ġdata plot Ġdata min Ġdata format Ġdata model Ġdata io Ġdata copy Ġdata AB Ġdata Out Ġdata joint Ġdata Rec Ġdata dic Ġdata Types Ġbe ep =' ; =' ~/ =' .*') =' +"{:. all Values all Lines all inger all weeks all PartsLayer all RealData all Diametre Ġx D Ġx Z Ġx key Ġx frame Ġx center Ġx gr Ġx mf Ġx upper Ġx interval Ġx bounds Ġx avg Ġx Column Ġx vertices Ġx xxxx Ġx dg Ġx ScaleDbl ĠX U ĠX Z ĠX array ĠX valid ĠX RF ĠX Objects ĠX HTML arg pairs qual col ': [" ': '\ ': '.', end re end ind end arrow end strain Ġnot nan type C ul ative ul ars ul corner con ing con ical con sec con cer con sequences col x col num col group col vars col oneq Ġor gs Ġh ra Ġh la Ġh ig Ġh grid Ġh cond Ġh tf Ġh style Ġh pc Ġh rule Ġh isfile Ġh pan Ġh vg Ġh pw Ġh arry Ġh wid Ġh ierarchically Ġh vvym py Date py block py tc py rw py mavlink py krige ĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ len ish len ovo ĠI ma ĠI CV ĠI SC ĠI TE ĠI RT ĠI WM ĠI RAF ĠI melf ĠI ronPython am y am ic am nt am mo am ines am mdf plot axes plot number plot By plot Points plot Spectrum plot CheckBox plot Clusters plot peaklist ĠP X ĠP ub ĠP pl ĠP ca ĠP ix ĠP are ĠP ink ĠP SC ĠP miss ĠP CD ĠP Collection ĠP SK ĠP ita ĠP uls ĠP DICT ĠP alettes ĠP bh ĠP erry ĠP ooled ĠP umping ow ngo pp ro pp ts pp rox pp desc ĠA le ĠA mb ĠA mpl ĠA SP ĠA tten ĠA DU ĠA VO ĠA zerbaijan ĠA lazarTech fe i fe eling Ġu Z Ġu j Ġu dot Ġu Old Ġcon ts Ġcon ll Ġcon dens Ġcon tested od ynam pre X pre df pre sen pre calculated pre compiled pre condSetup pre ccur '] [:,:, Ġ== , Ġ== /!= ĠC PI ĠC PAC ĠC arter ĠC NO ĠC oral ĠC NS ĠC astro ĠC BM ĠC ryst ĠC tB ĠC ivic ĠC ParserWrapper ĠC ercos os gb os cope os Exception os ascript im G im d im mediate to Q to int to pa to image to search to crop to proxy to Sort to Degrees to Frequencies to haria ent Lst Ġtest y Ġtest dir Ġtest idx Ġtest vals Ġtest curve Ġtest Feature Ġtest Variable Ġtest Unknown Ġtest Pack Ġtest Poisson Ġtest waves Ġtest CenteredBias Ġtest RunConfigModelDir Ġde line Ġde normal Ġde scri Ġde but Ġde mote Ġde duction Ġde limin Ġde cals Ġde grading Ġde serializing Ġde serialisation (" ------- (" âĶĤ (" @_@ ans ki ans chnitt Ġwith Dy arn um ĠF la ĠF ort ĠF ON ĠF ou ĠF CV ĠF link ĠF SD ĠF su ĠF ock ĠF CD ĠF RI ĠF OUR ĠF pz ĠF AX ĠF RAP ĠF ederico ĠF DSN ĠF EVD ĠF ergus ĠF ortunately ĠF ischer ĠR J ĠR Z ĠR ib ĠR ura ĠR orig ĠR SA ĠR hat ĠR alf ĠR Figure ĠR TP ĠR AV ĠR uby ĠR ician ĠR PropMinusTrainer ĠR ENDER ĠR autian Ġval Dict Ġax XY Ġax Sketch np lt np ort np rt np rob Ġfi ps if name if ac if reqs if aces if ugal Ġ3 150 Ġ3 456 Ġ3 900 test list test Vector test meth test Length test XY test Accuracy test Cluster test Predictions test pulsar ies mann Ġme mi Ġme trix ust e ust in ust able Ġres list Ġres path Ġres Show Ġres idential Ġres YA Ġres umable rain y line desc line Dif ĠD J ĠD as ĠD aw ĠD Xs ĠD eng ĠD ubes ĠD rainage ĠD QN ĠD npm ĠD ETAIL ĠD iesmann ") ` ") [:, 01 001 01 112 01 2002 01 039 .. @@ ne quiv ne omycin ne lectrons Ġcol lo Ġcol labels Ġcol lar ns ime ns am ns ids time lex time cube time Id time delay time varying time stepping time Zoomer time Hgs ase ous Ġse v Ġse ules Ġse ja Ġse matic Ġse meval Ġv ct Ġv co Ġv out Ġv print Ġv ids Ġv List Ġv slice Ġv mid Ġv simple Ġv Func Ġv guess Ġv istrails Ġv ayu file ids file manager file Output file Store ly er ly eq Error X ff m ff cc ta ine ind ing ind range Ġarray ToVec ). ** ). `` ). )* out a out DF out fname out Classification out Prediction out patient out FH path tools path InFile path SegmLungs pro X pro Y pro cedures ext min min ist min scale min ik min Date min TokenLength Ġk re Ġk an Ġk val Ġk ay Ġk iloc Ġk corr Ġk begin Ġk vc Ġk kt Ġk atex Ġk hc Ġk solved Ġk ifu Ġal gs Ġal igne Ġal beit ĠN Z ĠN file ĠN ens ĠN ice ĠN points ĠN cv ĠN ac ĠN PE ĠN tile ĠN LL ĠN UE ĠN PP ĠN World ĠN WP ĠN OBS ĠN qf ĠN akagami ĠN ORB ĠN angini form ers art en art if art works per row per dt per ched per fname per page per yr ds st ds can ds flows ds plice bo k bo il bo ck bo arding str de ĠL m ĠL n ĠL v ĠL da ĠL uto ĠL ap ĠL AG ĠL MA ĠL Float ĠL DC ĠL ANL ĠL HV mo ur mo matrix mo vi Ġon da Ġon Start Ġon Order Ġon keypress index title index flag ors al max p max date max order max scale max mag max rank max td max Err max Limit max npeaks max jumpsize df Error df ds df den df na pa cal pa uc pa rer pa rest pa ged pa zo fit Data fit spec Ġpro und Ġpro dy Ġpro Trades Ġ{ [ Ġ{ {" class b class less class Number class Letter ĠM Z ĠM ST ĠM ls ĠM PO ĠM CL ĠM Map ĠM TA ĠM SB ĠM oms ĠM halo ĠM PG ĠM Jy ĠM otor ĠM sticpy ĠM ELT ps x ps hift ps imin ps frompk Ġmat om Ġmat Shear Ġan tra der Z der ick der by der var po ors po ison po lacion Ġne omycin Ġne vertheless Ġl ce Ġl pa Ġl shape Ġl cc Ġl labels Ġl split Ġl rt Ġl rows Ġl style Ġl change Ġl month Ġl Min Ġl mk Ġl New Ġl Ref Ġl ung Ġl changes Ġl usages ** ,\ app fname app dirs red q red blue core nlp shape Records shape Rdr Ġuse ros fig n fig ur fig spec we bin ir q ir re ir ga ho la ho bb ho chberg Ġfrom spline 10 73 10 661 10 263 10 442 samples File iv ty Ġlen d Ġlen w Ġlen ofo learn Rate learn Rates Ġlabel name Ġlabel Encoder Ġlabel Action Ġlabel Mode Ġlabel Points Ġlabel deltas Ġlabel Refs Ġnum vis Ġnum é Ġnum Slice Ġnum Windows Ġnum decs Ġnum Repeats Ġnum ProximalConnections assert Regexp ĠG ower ĠG EL ĠG OP ĠG CD ĠG Lasso ĠG nx ĠG TC ĠG ale ĠG era ĠG JS Ġ< ( Ġ< ==> Ġout pt Ġout plot Ġout matrix Ġout png Ġout String Ġout handle Ġout cube Ġout Filename Ġout ofbounds Ġ/ , ore k Ġstr IDs Ġstr Comms us ca row ct row Size row plan lib import lib dir lib png lib ming ĠĠĠĠĠĠ Ċ ĠĠĠĠĠĠ ĊĠ ĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Ġresult Queue ---------------- --------+ Ċĉ ĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ oc co oc irc oc ircumflex ari at ari ser et or pl sel ĠRe y ĠRe pr ĠRe ordering ĠRe placed ĠRe builds ĠRe ached ĠRe inier ĠRe mnant ĠRe ithinger comp atable sc ents sc enter sc rl Ġname Dump Ġname Chunk Ġpre path Ġpre vi Ġpre whiten Ġpre define Ġpre calculated Ġpre whitening Ġpre conditioning Ġpre ceeding Ġtr ng Ġtr uc Ġtr mm Ġtr ès mb rella ick ers cl ats cl uttered Ġfile D Ġfile dump Ġfile encoding Ġfile pattern Ġfile Labels ĠE scale ĠE AG ĠE SA ĠE site ĠE LM ĠE RF ĠE VI ĠE DP ĠE clipse ĠE BOUNDS ĠE OPC ĠE dison ph ra ph im ph osa ph rg ph onopy ph osphorylated Ġdf lags Ġdf beta Ġdf Row Ġdf sym Ġdf bn Ġdf Copy ": "% ": {}, Ġset data Ġset plot Ġset DataFrame =" [% =" ?") Ġ4 200 Ġ4 07 Ġ4 74 Ġ4 71 Ġ4 342 Ġ4 928 Ġ4 3200 ag les ag rave train f train label train Size train Images train FeatureVector train andtest ms af ms prime low mem low binSpinBox ĠB ow ĠB ates ĠB ST ĠB MP ĠB LO ĠB orders ĠB ASK ĠB SAS ĠB erry ĠB alancing ĠB PN ĠB lend ĠB radford ĠB olshoi ĠB asht sh u sh int sh rug sh ibor ty lin ty ear ty pology Ġun cs Ġun aries Ġun flag Ġun squeeze Ġun rotate Ġun constrain Ġun averaged Ġun wra Ġun disturbed Ġun orderable Ġun proTrades Ġ5 88 Ġ5 39 Ġ5 58 Ġ5 876 ip it ip id Value Expr Value InSpecification ill Quality ib n ib u ib ily ib ald Ġby ranges Ġby yearday jo g jo init param List param style features Train iter bo iter columns (( ~ (( ", op ad ign in ign acio Ġthis data Ġthis page Ġthis Depth Ġdi oxide Ġdi macs ]. ' ]. \ log time log ity log itude log mag log bins log inv log message log Filename log Decs log minDens key error key aslogical axis font In Col In Month In Edit In cluded In dv In mate In DZ In appropriate In tron In quiry In ferer In hibition In duktivität Ġsk clf Ġsk ims ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġlist DataSets Ġen x Ġen contra ack ey ef s ef ont ĊĠ ĊĊ Ġle sions da cs da ughters che ats Ġrandom Split 99 07 99 70 99 83 99 76 99 388 Ġtime offset Ġtime Dict Ġtime Info Ġtime lapse Ġtime Scaling Ġint z Ġint ex ant ar ant ib 64 45 64 77 64 21 64 000 64 57 64 134 64 0434 Ġclass Label Ġclass NameList 0000 289783 fo ck score key [:, [" Ġ`` >>> Ġ`` '. ĠTrue Edge Ġat ime Ġat end Ġat rg ĠW Q ĠW HO ĠW MAP ĠW LOG ĠW carb format list format Type Ġmax K Ġmax num Ġmax error Ġmax cols Ġmax Label Ġmax vec Ġmax flat Ġmax td Ġmax Norm Ġmax AngVel Ġmax ObsHistID cs ft ., ], ord feminine num Rec num sources num Chunk num Segments num XS num Rating num Months num Slices num alts num Ints num Lags num OutputLayer num YS num Residues num Rpts num HashTables Ġvalues oftable og onek model params Ġfe as Ġfe attr Ġexpected items Ġexpected Wins init Cont ide mensional plt from add Val add itives add Green add Lane add TopLevelItem 12 33 12 23 12 42 12 46 12 300 Ġget N Ġget meta Ġget Table Ġget Process Ġget Default Ġget Sample Ġget more Ġget Tick Ġget Weights Ġget Options Ġget Opt Ġget RowObject Ġget addresses Ġget JobStatistics Ġget VarDictionary Ġget isord port DCIn port inari ĠO T ĠO DF ĠO CART ĠO GUSA men ess bs iella result base result stable result FileName Ġit u ()) [:, ca ust ca plat ca uer ca plon ca putil error Rate error Report tric acies value str sub fit sub read sub group sub Class sub scription sub days sub pixel sub menu sub corpus sub pkg sub shells sub containers sub superscript sub scribers Ġvalue str Ġ** % Ġ** ' Ġ** __ ep idemic ep istatic Ġplot map Ġplot mode Ġplot Path Ġplot Instance Ġplot Fied Ġver let Frame Type Frame OrSeries gress ively Ġall Properties Ġall Nd Ġall Fluxes Ġall Stations Ġall ergic dir file Ġhe dlg Ġhe dges Ġhe alConfig sum Corr Ġpo im old val old np old row old pi old code Ġwh ith Ġwh olly ach im lim ite Re alignment Re covery Re binned Re versible Re implement Re cycled Data W Data Vector Data Manager Data Configuration Data Bucket Data Constructor Data Connector ft otal 25 77 25 28 25 82 Ġso la raw y raw al raw arr raw files raw ArrayDatas raw ShotID raw plotCheckBox Ġline Size Ġline edit Ġline Styles Ġwhe els frame Views Ġfloat List inter f inter cal inter vention Ġpd index Ġpd ofs Ġch own Ġch taps Ġch erab so b so u so y so la so ver so ul so bj so us so fts Ġdist SG Ġdist ractor cale e 11 34 11 31 11 806 11 950 11 557 11 999512 Ġcan matrix Ġest t Ġest oq mean f mean corr mean ah mean ivar mean PowerCurve mean Albedo read X read One 32 15 32 80 Ġmin line Ġmin ors Ġmin iter Ġmin value Ġmin ang Ġmin ified Ġmin Distance Ġmin dens Ġmin Ticks Ġinput Dir Ġinput Files ĠPar meters pi ped cc r cc gt cc OOOO cc edilla Ġz pt Ġz os Ġz range Ġz idx Ġz scores Ġz cluster Ġz pdf Ġz kw Ġz SearchFunc Ġz ScaleLog ng tr ng david color Val color btn text es text ent text view text Out text registered text trademark cy ear dtype str Ġ\ ____ Ġ\ __,_ lif ts params MU ĠIn j ĠIn ts ĠIn vent ĠIn flation ĠIn kscape ical s Ġper o Ġper man Ġ10 49 Ġ10 61 Ġ10 756 Ġ10 754 Ġ10 752 Ġ10 753 bin energy Ġsc data Ġsc intillation act net act ensemble act uary ][ \ ĠY v ĠY mu ĠY missing ĠY centered ĠY MD ĠY Tick ĠY eatman ĠY okaBot Ġdo is Ġdo elhs Ġsh h Ġsh arding Ġ) [: Ġ) ]. Ġ) [- Ġ) *( Ġused Entity Ġnew M Ġnew S Ġnew res Ġnew lib Ġnew cl Ġnew port Ġnew image Ġnew pop Ġnew Path Ġnew Element Ġnew Img Ġnew Atom Ġnew WWTP Ġnew appfname Ġtrain curve Ġtrain Loss Ġtrain Df Ġtrain OPs Ġj ul Ġj mask Ġj sf Ġj Query Ġj pval Ġj agged Ġj ean Ġj aggies Ġj upytext req mem gra bbed gra phable ĠH in ĠH ers ĠH IT ĠH flat ĠH UR ĠH arm ĠH PI ĠH FT ĠH px ĠH ung ĠH ides ĠH eller ĠH iro ĠH uge ĠH ubble ĠH alo ĠH urst 15 13 15 73 15 870 print v print Config print ObjAttr 05 32 05 51 05 79 05 59 05 999 05 298 Ġlog str Ġlog files Ġlog inf Ġlog odds lect ed Ġfig box Ġfig win Ġfig Top Ġfig Right Ġfig Rights Ġfig Lefts Ġfig Tops ding o are aname tra ils (), :] ang ler ang ala Ġinter ative Ġinter ptype Ġinter ractive Ġinter proscan join f Ġsample names Ġsample Means Ġpy bo Ġpy ms Ġpy bb Ġpy basic Ġpy bind Ġpy gaps Ġpy SPACE Ġpy prel Ġpy nlo Ġpy thalesians Ġpy thag Ġpy igm Ġpy hande Ġpy AudioAnalysis Ġpy terpol Ġ[' ']) Ġ[' {: start freq start xref start monoindex idx h idx r idx time not valid not sorted not precomputed ens pie :` - :` / Ġobject Range Ġobject Copy Ġobject DefList ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġno Data Ġno idx Ġno indiv Ġno ifam Ġno Outgoing Ġno Incoming Ġno hup ĠU min ĠU na ĠU ti ĠU NS Ġla id Ġla ps '], ( pr nt pr ight pr ind pr ft pr ince pr urel pr aram 20 85 20 82 20 7843 20 665 20 242 Ġ(' {" Ġ(' (? Ġ(' >', Ġ(' ',) Ġ(' [$ dd dot dd ash ĊĠĠĠĠ ĉĊĠĠĠ pos Y pos DF pos floor pos sess 33 02 Ġsub estimator Ġsub block Ġsub nodes Ġsub merge Ġsub surface Ġsub sat Ġsub branch Ġsub regions Ġsub sequences Ġsub Plots Ġsub sampler ie h ie ch Ġcolor ization no logical no resp no TiO no hup default ed default key default Dataset default Grids Ġmatrix Dict 201 01 201 06 201 81 rst failed 100 655 80 77 80 63 80 71 80 937 Ġhas y Ġ@ = output df output lib output Writer ont os ont odb Ġ6 283 ger ms ger mand new M new m new lat new Py new Pz new ampliado new FullTextDict Ġ. @@@. pred omin ES IAN Ġfit r ER M ER VE ER ABLE pen h pen as pen ultimate pen cil IN STR IN PROGRESS base Data base flag base datatypes base DatabaseManager '), ),) ĠData Manager ĠData Cursor ĠData Misfit ĠData Structs [" + [" < split val split Line uni qs vert ial 66 88 66 08 66 79 66 53 66 61 66 272 doc view Ġrow wise Ġrow Names au f ĠSe al 45 0000 45 20 45 27 45 09 45 43 45 08 45 38 45 46 45 83 45 4902 45 04583 width Net width Hint AT CT AT FORM AT ASALESOUTPUT }, ), Ġind t Ġind arr ars pec ĠK O ĠK Y ĠK ot ĠK no ĠK mm ĠK inv ĠK ron ĠK nots ĠK EEP ĠK GML ĠK atharina ĠK atrina load steps load All load ratios Ġwhich IPTtoCircle 75 45 75 02 75 61 Ġspec arr Ġspec Info matrix plot matrix var 88 0000 88 23 88 43 88 81 88 33333333333 fn d Ġ| } Ġ| $$ grid t grid lib grid color grid loop grid scheduler "] ") "] [:]) "] )))* ']) # ']) () ']) ]] ']) != ']) }), 16 96 16 90 16 79 16 800 16 934 16 786 ml m Ġcal table Ġcal ltype av ings sample set sample doc sample freq sample tab sample Patches sample setpoint Ġpos List Ġpos cache iss as Ġcor res Ġcor path Ġcor ds Ġro ads show edges show Title show Anns ude l ude s ak h ak y ak rishnan Ġone fold Ġone ago čĊĠĠĠ čĊĠĠĠčĊĠĠ bar path bar Colour bar leftarrow bar Bodys 35 11 35 19 35 07 35 23 Ġcur Time Ġcur Iter Ġcur Tag Ġcur Coord Ġcur TestX ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ 14 22 14 36 14 84 14 62 14 007 14 9816 14 761 -------------------------------- ---------------+ Ġalpha State 19 264 19 334 Ġkey ness with Mean group dec ))) # ))) **( tt heta pol i pol itan count up count reps Ġvari ograms cur X cur rs cur Text cur Window cur Iter cur Seq Ġsize List box er box able box no box bar box dot box points box Name box times box plus box minus box ylation =( \" check R check value check mark check ins check KW Ġprob lists AR CA Class Loader Class sifier com mut com mutators Index Statment ON SET ON IA ON NX axes B axes V axes FontSize axes Wd Ġ8 68 Ġ8 199 Ġ8 254 Ġ8 714 Ġ8 252 Ġ8 917 Ġ8 196 Ġ8 259 Ġ8 355 Ġ8 992 Ġ8 977 Ġ8 356 Ġ8 202 Ġ8 455 Ġ8 755 Ġ8 359 Ġ8 246 Ġ8 208 Ġ8 251 Ġ8 247 Ġ8 965 Ġ8 288 Ġ8 213 Ġ8 928 Ġ8 993 Ġ8 929 Ġ8 679 Ġ8 754 Ġ8 962 Ġ8 671 Ġ8 241 Ġ8 983 Ġ8 243 Ġ8 462 Ġ8 673 Ġ8 774 Ġ8 753 Ġ8 762 Ġ8 672 Ġ8 670 Ġ8 482 Ġ8 489 Ġ8 681 Ġ8 461 Ġarg b place hold copy setup 78 44 78 21 St dv Ġmake plot den c den brookes 13 686 13 851 200 36 200 77 200 51 Ġbin Contents Ġbin ário uff ing cor ina cor geC mask data mask Saturation Ġid n ĠV r ĠV y ĠV ax ĠV hat ĠV ote ĠV CC ĠV liet ĠV iterbo ĠV angala Ġtm argin Ġstring r Ġstring ToFind gression al rand al rand seed by passing be re be comes title str zero zero zero cost zero Entry zero ifnull Ġpath z 22 311 22 654 nd p nd is sp v sp or sp ds sp index sp lots sp version sp leval Ġdate parser wo op wo und figure Patch figure dash Ġother SRS 04 99 04 65 04 67 Ġerror Text Ġerror Count Ġerror Rate prob eno 96 10 96 03 96 958 ])) *' pon dere the image the saurus lat te string Msg ule urs column name column Dimensions Ġstart node Ġstart Heading Co hort Co medy trans data trans ients trans ports trans itivity ĠTest V ĠTest Frame ĠTest Sparse ĠTest Action ĠTest Analysis ĠTest Sequence ĠTest Area ĠTest Rolling ĠTest Repr ĠTest Holiday ĠTest IntervalIndex ĠTest AnovaLM ĠTest SerialCorr 02 401 02 135 02 7400 Ġfeatures DB dim X dim ming Ġmo og Ġmo les Ġmo view ou v ou in target Dir target Capital Ġend uro Ġend Freq write console Ġ{} >". 95 41 Ġover bound Ġover smoothed Ġover lapp 94 35 94 71 94 117647058823528 Ġ100 38 Ġcom mutation 17 000 17 41 17 267 of speech alpha X ĊĊĠ Ċ Ġsy metric ĠCo eff ĠCo como lock in object Id object Edit Ġ{' +': 85 26 85 43 85 68 85 93 85 8824 sort list sort ix sort Idx Ġfirst Line Ġfirst LayerShape OR dict OR AD OR PCA Ġcolumn Range na head ank bench run e run Time run NN Ġfeature Range Ġfeature Vec coef icent :// *: :// /{}'. Ġve hicule Ġexp n Ġexp AT Ġexp File Ġexp factory Con cent Con strain order id ]]) - 24 78 raph im Type CD ĠDataFrame Widget Ġinit val Ġinit fit Ġinit poles Ġinit fitparams Ġinit iating csv filename csv writer _, ' 27 23 27 60 27 21 27 41 27 77777778 Ġdis mal Ġdis parity close file close Time Ġ7 06 Ġ7 36 Ġ7 60 cond uction freq dists freq Zoomer freq ChannelToStreamChannel uc z uc ine uc ircumflex cat y cat ool image plot image width image of image FileName node label node Value node WeightedWatershedsSeeds ref file ref Core ref rxn ref rac ref ugee Ġresults DetectorDir Ġaxes Bar ]: ') 86 199 IT O IT ES Ġimage File Ġimage Path Ġimage Object SE VER SE EK gen ie gen elists Test L Test P Test Result Test Calendar cul led right leftarrows right threetimes right zigzagarrow AN ES AN TH AN CY AN OMALY abs chnitt AL LS AL ONE AL AME var M var Id var Sum var psi var triangleright var triangleleft var inno ĠSee beck Ġmore nacl back sim back Figure back prime back epsilon back cong off x off y off ers }) =\ }) ?' cent erer Ġsp int Ġsp ont Ġsp version Ġsp ilu ĉĉ ĠĠ Ġmean L Ġmean ax Ġmean Seq Ġmean Ion Ġmean abse obj etivo 06 05 06 28 06 71 06 037 06 084 06 762 temp List temp folder temp jd Ġorder Val Ġorder By ted ata 18 10 18 74 18 133 18 964 err str err fun err Word fix alfa fix Ecut fix Emin 36 56 36 133 ". *? ec ircumflex 09 04 09 70 09 700 level idx level vec 07 15 07 88 07 22 07 38 07 48 07 926 Ġpass ivity ap lots ap ano ap pet Ġqu ic Ġqu as Ġqu spin Ġrun nables Ġnode Color feature Vectors do BatchNorm do RevisionAnalysis mod ular man i man j man ifolds Par ity Par File Par cel Ġidx name dis arm dis ordered dis cretizer Pro pagate Pro portions Ex amine ST AD rc psp spec list spec fil Ġbet el Ġbet amin reg enerate Ġdoc matrix Ġlin estr 34 03 34 07 34 72 34 667 ME I Ġ... )") Ġ... }') Ġ... ])``. Ġgrid point 97 01 97 10 97 09 97 26 97 40 97 74 97 185 97 691 filename Units stant en Ġloc name Ġloc min af qmc af raid Ġnon na Ġnon coding Ġnon stationary Ġnon centrality Ġnon conformity Ġreg ulatory Ġact size ĠJ A ĠJ s ĠJ AB ĠJ ULES ĠJ AVA ĠJ ona ĠJ avier ĠJ DBC ĠJ ASPAR ĠJ uergen 92 39 92 38 92 31 graph z graph ing Ġmode Count Ġmode lfunc save count save Dir sent ador ID I ID Power Time Value Time scales ton umeric Col A cv Scalings part Labels part Errors part Pred Se mantic dt b dt index dt ibin sk ernpca Ġload frompickle ĠQ L ĠQ points ĠQ IC ĠQ sim ĠQ RS ĠQ ZMQ ĠQ Controller ĠQ ToolBar ĠQ ToolButton sg b sg ID 84 9345 Ġtext kwargs Ġtext grids center Coord return params Ġq R Ġq val Ġq nt Ġq plot Ġq out Ġq index Ġq flags Ġq application Ġq lens Ġq stk Ġq Dens Ġopen p Ġopen Par Ġopen diamond oo i IC P left WT left leftarrows left threetimes Ġkernel Family Ġsort lik Ġtarget id Ġtarget Input Ġtarget Values Ġtarget Vals my output my sent my ID my List my zip my polyval Ġ[[ ]]* Ġ9 318 Ġ9 789 Ġ9 644 Ġ9 399 Ġ9 014 Ġ9 312 Ġ9 314 Ġ9 313 Ġ9 787 Ġ9 450 Ġ9 660 Ġ9 010 Ġ9 668 Ġ9 669 Ġ9 330 Ġ9 320 Ġ9 072 config Synapses Ġgroup In Ġgroup Ind Ġgroup Cnts Ġmask Inverted tx x Ġcurrent index Ġcurrent Day Ġcurrent Coord 00000 8 Ġread Values Ġread Scan Ġread cstr ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ .""" . ac ious ac bolos ac ircumflex son ly cov fft Ġim form Ġim raw Ġim mer Ġim files Ġim fs Ġim á Ġim Large face ting Ġsum cost update UI update ROIcanvas rel weight rel zpterm ... ')) ... '% Ġtemp F Ġtemp i Ġtemp line ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġmod list Ġmod erately non ed non cat non trivial non IDH Ġtf ma Ġtf inal Ġtf ls Ġtf pn UT G Ġav f Ġav l Ġav s Ġav Cent Ġav Sat Ġav atar math js math pazo Me te Me Me Me ka Me teoSwiss kernel contraction eps atm gr l 65 03 65 95 65 77 65 70 65 59 65 81 65 4902 30 64 clusters Number db utils db Fn File Collection File Task File Catalog Ġcv i Ġcv helper AS PCAP stack trace filter Galaxies unk s cluster biweightscale Ġenumer ates sol ardat Ar h Ar ing Ar range Ġass ists Ġad velo Ġad opters Ġright x Ġright Vbox Ġtrans route 37 21 37 000 Ġlength scales 50 66 50 78 ess f Ġ>= , cm nt Ġtable au Ġtable schema Ġtable creator Ġtable ofcontents Ġpredict ability vals Hook Ġloss y Ġmulti key Ġmulti part :] ` :] [:, Ġbool arr mt ots Ġaverage Losing Ġ& $ Ġ& ", tf ax tf adv ls lash Ġorig line gn approx Series List Series Formatter ĠCon structions 87 05 87 07 87 28 87 72 flow rate vi able vi rens Ġtra ils lip ses point set point Index point Size Ġtraining data RE s RE AM RE PLY ura kami top Items CA V CA GD CA ACT sign i Ġzip name Ġmult if Ġmult igrid Ġmult idemensional Ġlow z Ġlow RAx State ID ik an Ġoff attr Ġoff ensive ped antic legend Loc ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠCheck er ĠCheck Initialized ĠCheck StringMixin ĠCheck Pets Ġsome Y mode list Ġextra ctions colors f ĠZ arant Ġcreate Fit Ġcreate Object Ġcreate Vertical si vals si Model si amese ash ima acc rate Ġacc Rates Ġacc rued fill styles (* )', Ġmsg factory Ġmsg Frames 55 88 55 49 55 41 55 800 55 369 Ġob v Ġshow grid Ġshow TimeVarying nn Model select File select Count tree depth respon dents url and EN SP EN SO 23 01 23 250 23 937 23 1373 last Iter last Control Ġ(" < Ġ(" *** prec approx prec nsim prec napprox prec uneus pop all SI MB img filenames img Final Ġbu id Ġbu chi dataset A hist range Ġ[" (% Ġ[" '" multi epoch multi DA multi Scan Ġframe border can ic Ġev y Ġunder go Ġunder bound Ġunder coord 26 87 26 396 26 867 De et De mos De couple AC B AC DEF AC CEPTS AC arbsT ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĊĠĠĠ 77 35 77 98 python To ĠDe e ĠDe ad ĠDe rek Ġfiles List Ġgraph let process menu process Finished view ed view Nr view Article "), ) auto cov auto flow auto lag auto api auto mated ai bj ai Revisions ([' [ ([' .',' over size over Time over arc over loading over leftrightarrow sup ort sup posed stats file Ġlinear ization Ġsplit Input Ġ] = just in event ually event Rate event Counter net c Ġpl py Ġpl sc Ġpl utokore Base Network Ġsm th Ġsm ile cell data cell bd mer idian mult index mult isynapse Ġzero start mbed d Str t Ġnorm data Ġnorm file pd C pd results pd logger Ġsim d Ġsim z Ġsim dt Ġar ff Ġar ial Ġar my Ġar comb pdf ops stat fxn stat enames Ġvector Size ĠSt udents plots o other Params other Distribution create Object create Node create Hypothesis 42 90 42 193 42 17305 ĠWe iser 98 05 98 33 98 27 expected len expected Elapsed kw ant kw defaults offset Entry offset boxes Ġtotal df draw Rectangle Ġmark r Ġmark type font family ob ra ob struct ob ands ob Reshaped window rows window Ptr vs z vs lice vs SM vs Sign fect ure xx hash xx ABC bl m Ġ} ' Ġ} ") Ġhand ful Ġhand shake Ġconvert Para ĊĠĠĠĠĠĠ Ċ source ID source Pos make box make Plot IP R FF IC FF mpeg \\ '): \\ ""," Ġdec ile Ġdec lares times pectrum List Out List Dict Ġty per Ġty phosa Ġ12 336 Ġ12 669 Ġperiod ical Ġperiod List MP x Ġdt max Ġdt dynamic Ġobj str Ġabs max ĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Date Created Date Chunk 43 12 43 82 seq L 67 17 Ġfind Nearest ĠAl bert ĠAl lele ĠPer mittivityLiquid DE PO DE IA DE LEGATING 08 80 08 929 ĠDefault dict mm dd Ġfunc y mag i CV PSP cle artomark Ne lements Ġtri interpolator uch s orig of Ġsequence Counter xy antn To il To Run To Sample To Points To Dense To Append To Json To Zip To Delete To NumPy To Repeat To MeV ,) - Ġab om Ġab rev Ġab ssys ĠComp iling ĠComp artment Ġ-- >' Ġbest upper Ġbest Thresh Ġbest Masses Ġbest Xis ins pected ins burg Ġdistance h Ġcross hairs Ġaf fix gb onds first page first pix first Entry first bday first OrderFrame Ġfield map less i less dot less approx less Than less gtr pts m rs ig rs rc open mdao wh ale link List Ġuser item 000000 200 000000 02 height SpinBox 47 16 47 14 47 13 47 40 47 93 47 62 47 7563 year Num total sz real ify sim mat sim ulating Ġsave mat Ġsave ables Ġsave Color Ġsave Image Ġsave Action ,' # ,' + Ġsv j vis h vis ibilities Ġhigh RAx ox ford Ġmap k Ġca Head Ġca Psd Ġca irns Ġimp liment lu ke best idx concat like user names user artists user Defined user PgRnkBag ered Rate png File json ify bool bits Ġraw type Ġrel Move OL OC ched uler inv color inv not inv aded inv psi period centered Model Tune ier m ier ra patch er patch Label Ġsorted Data Ġsorted scores Ġsorted Idx Ġsorted Scores ĠTime step ĠTime likeOps Ġtick list Ġtick fmt poly g FI M FI BER Estimator Config Set User Set Tool Set Option Set Item Set Fields tmp s tmp y tmp Value tmp coords rad Shell dered String rank B Ġsuper category current PF Ġgo lomb inf rate inf odf ose ne Ġfont num Ġfont Name Ġfont family rox ide bf reeze ful lfiledict ze iro go ode go of Ġmath s Ġmath Methods edge d edge data edge Num ãģ ¾ Ġhist gram Ġcorrect ely Label Encoding Ġtree width ĠUn structured ĠUn mapped ĠUn correlated Ġpred ic 28 66 28 000 28 667 lik s stop go field values field File ĠSet Cursor ui uc ui Reduce Plot Kernel Plot Panel ĊĠĠ ĉ cast le CH F CH EL CH ATBOT find Closest Ġdiv mult Ġdiv Odds Ġedge d 29 15 29 66 29 8039 29 661 čĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġclassification Accuracies Res source Res ident Ġindic nlp Ġfull pop Ġvariable Break ĠPlot Layer ĠPlot Item ĠPlot Point ĠPlot QuadraticModel ĠPlot Ewma dev r dev str Ġsolver obj ĠGener ations ĠGener ative sha des book i 40 20 ry onic Ġbinary Img diag n ster oseismology Ġimg size Ġimg dir Ġimg node Ġimg tk Ġimg Tools 21 66666666667 Ġge ographies root Window root Chain Ġstat function Ġstat stools options keyaslogical scatter gl scatter Marker Ġclo u Ġlib pandasafety 68 35 Ġmon omer CT ONLY Ġparam FileName sen ha Ġ[( "", User Info ĠAn ne ĠAn thing ED IR Ġblock model verbose print local name local fs local entries align Function Ġsi mpy 000 867 000 8686 Ġtmp o Ġtmp ts Ġtmp key Ġtmp St .) **( ii int 38 12 38 94 38 39 Per Data Per Bin Per TestBox precision factor zip WithIndex processing Arrs *- $", Ġcoeffic ents fin p fin er UR DF Ġts pl ĠPython Lexer ĠPython ExprVisitor annot e Ġext round MA ST MA PLIST match ings match ups Ġ15 86 Ġ15 23 Ġ15 49 Ġ15 40 DI I Ġnet loc Ġnet pbm Ġcre ep ele gant ele vdn Mixin Class module Numbers ĠCreate Table ĠCreate Layer ĠNe il cf cs Fe hler +' $') counts To action Graph Ġcell style Ġcell bd exec dir exec utive ward Task Ġmu y Ġmu LAn Ġeigen val Ġstruct Dict task ID task Name task handle UN H UN FIN UN CONVERGED Ġsecond stim cache size cache key eval kernel Ġreal isation Ġreal poles Ġreal isations Ġvar List Ġvar Dict Ġvar atts su ction su cker Ġang Momen Out line Out file Out Base hi li hi val hi jack Tree RecursiveSR ML Document aN rm beta T beta NotUnitVariance Ġthese words ĠNumber ing Ġclose date Al gs Al arm ." \ Le gal pac ific Ġcov S ={ ( dat gen now ait 235 0 Ġlower Gyro change graph gate Voltage Ġauto zoom Ġauto magic Ġauto colorscale initial values UL P AD corr Ġstd v Ġstd tsys Ġstd Wins dif ferenciate Dict Of ov lp ]): : Ġman ufacturing Ġman uscript inst al inst ability 117 04 117 44 Ġold pi Ġold angle ines ses ines cence Ġwrite Object Ġwrite tofile Ġwrite Markers nc anda bit Size ĠMe morialDay Box car remove AB remove List remove Tab SA VING images TextBrowser Ġprobability List Log mass Log inHandler ek slist Ġtimes lot Ġtimes In Ġmarker styles 48 12 48 75 anal ys Ġtask Lists ĠPeriod Properties ĠPeriod DelegateMixin filt ration Ġdb ode Ġdb namelist 56 00 56 24 56 31 56 0135 down arrows down regulated Ġnext name Ġnext index Ġnext step Ġnext Point Ġ11 32 limits History IS HER IS OTOP Ġref reezing Ġavailable Power ]). ", Ġprev x Ġprev line ĠAN G ĠAN OSIM desc ender Ġdelta R Ġdelta e Ġdelta f Ġtz data Ġtz conversion 294 4 Ġfix path ''' # ĠGet Page ĠGet Epochs ĠGet Symbols 57 0000 57 43 57 2549 57 6471 nb items nb Items nb ElemsInBenchAnd sigma Tx sigma Ty Ġbeta X Ġbeta max eq def eq less eq sim eq circ eq colon eq gtr MM AG ĠLog Softmax ock ing ock ets binary Search Not Implemented Ġform ally this min this max 69 88 69 16 Ġ", "). TY PEN Ġbox l Ġbox id conf used '\ _' '\ |' aT ab Ġlegend Box ]* " ]* ) ]* , ]* [ Ġdon ate char Dict Get Frame Get Font Get Best Get PP Get Lines Get Sizer Get Margin Get HandlerType Ġwx python Ġwx Redraw Ġwx GLWindow Ġwx AdvancedGLWindow Ġextract Slots Ġchar ter md v String List String Spec String End Ġdisplay Cols home URL Ġmy path Ġmy object Ġmy open Ġmy vmin Ġmy polyval Ġmy Shelve Ġ:] = Ġ:] `` cmap dict Ġrot A Sh allow Sh anno Sh ifter rot urb Ġdown wind hash ret ain ing Ġerrors bygenre Ch ristian Ch allenger 137 43 Ġpen icillin sel ChanIndex selection Mode interval thickness interval depths Ġ'- >' No Section No Bounds No Modifier No QuerySQLStatment build info ĠCal TRACK Ġconver gent Ġdense ly Check Tool Check Initialized Check DiscreteGLM Check PoissonConstrainedMixin sw ash sw mm ____ _ Ġapprox imator Ġapprox Grid missing Value Line Groups Ġtheta gridline Ġtheta gridlabel Fa de Fa cade Ġpickle Name Run files ĠOn Left ĠOn Paint Ġlat tsum tensor like cut range cut coeff Py Object Py Solver Py Hive Ġcsv path PL s training Labels ĠBase IO ĠBase CoordinateFrame Ġsa prolite Ġexec u Ġexec Result ĠCompute Error Ġds z Ġlocal isation accuracy VsResolution meta dict meta Data meta estimator meta knowledge meta genomics long C long Label long Short bad ger bad city IG ID pass index pass No =. *)', Ġskip Dart yn ch cel lo Ġexist ance hs lash sig int sig ParameterUpdated Ġinterval tree 89 84 89 80392156862745 89 01960784313725 src file src doc ĠTo Unicode All Homes display Type Ġgre ens HO MO HO MER Ġseq B Ġseq Len Ġseq Lengths Ġdest node Ġdest Path 74 1176 tool Tip ĠLe mmat ĠLe uven Or bits Or Calibration Ġ"% ": Ġ"% %%% band Indices imp n imp osition imp anze greater Than Max Width Max Interval Max Depth Ġpe qui Ġpe pper Ġpe tersburg Ġdel b Ġdel le Ġdel la Ġdel dataset record Xref '} # '} ': '} })) '} }}) scaled Error noise var ĠPre pared ĠPre consolidation summary Urls Ġsetup sim Table File Table Reader Table Symbol Ġ## ( Ġunique Words const Color IM ATE CO AD CO MOD CO CK CO BY Ġdays List ĠIN TR Fit zgerald TS N case Files ĠDate ParseError Ġradius in ':' - pick ups Ġplots ingle Ġgen etics Ġhead aches Ġhead banging sche dulable adjust SizePolicy Ġdiff priv ost en ("% ", high binSpinBox Ġaccuracy List cp n Ġ$ ") Ġ$ '. Row Iterator comb ust Ġlayer Top ä¸ ĸ lev size Function Resources session files button Clicked cha z cha mb cha stics alan o peak caller ĠOr b ĠOr r )+ ':'+ OP F Ġ14 88 Ġ14 90 Ġ14 194 det pars 63 04 63 03 agg f Ġplace Holder Ġview box Ġview Distance Ġmost comm rgb only 79 03 ptr atio Ġ13 0107 ĠKey Point ident ifiable aris ing ]+ )') On Left On Lungs Ġparse func Ġparse ui 54 01 54 13 54 85 54 37 70 333 perm its Ġsw mm Color Images Color Cycle Color Sz ci val Ġupper Gyro lr corner lr rrrr Ġsimple vector Ġsimple dialog Ġsimple Tokenize '+ \ ush ing Ġtake while EX EMP tag ue invalid y ĠOR IDS Ġgood channels Ġgood fits Ġgood High Ġgood Low Ġgood Wvl sf x 83 25 Min Value Min Interval grad p tk gui tk filedialog Ġfmt data Ġfmt major Ġfmt minor dump er Ġsql Trans Ġ\\ ), )** (-( 59 87 measure Table global Colors Ġrc X Ġrc q *. ' *. *-\ ĠDi com alog en 2014 0102 MS STRA gradi ometers Ġattr type ĠAs pect ĠAs Is Cur vedTransform az quez Ġpdf File Ġpdf crop Ġpdf miner mid le Ġdir spectrum Ġus d ĠMake file ĠMake CommandLineParser NN PS Is moothed Is Dep Is lands Is SourceType Ġour self Image Type Image Process Image Visualization Ġsig level Ġsig maxy 199 34 setup PythonGraphics nr Rows Ġ(- )^{ 93 646 Ġag py Ġag gree PO GEE handle box gray image 76 94 ĠAll Trades ĠAll Coordination Ġmeta feature reset ax reset table We isstein next name pixel data pixel scale pixel Width pixel StartIndex win i win size codes pacer Grid Points Grid Flatten pickle files ĠGrid Line ĠGrid Annotator ĠGrid CRF neg amp neg Col black square black triangle black triangleright black triangleleft 300 2 300 3003 81 665 803 66 cro ft simple fill ĠSo ltime atom y atom ID atom stable atom Charge 82 1609 opt cons Ġpatch scale ([]) ]) ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ble in children Lg Field Size 72 32 72 66 signal Name Ġ'-- '] client Nodes external DataConfiguration CP AC CP HL Qu di Ġhyper graph fl atu fl uffy trace OE redu x scaling Vec come t ĠMax imize Ġyy i Ġnetwork ed ND M aved ata br ps post pred post man post central ĠCh roma ĠCh lorophyll ĠCh icester Ġbegin Page Ġbegin TimeOf inner test mut ex mut ability mut agenesis final ised nu vec em me ĠInt Type Ġred ucible rb U rb tn rb rack At ilde At taches NE UM NE URON NE valsHook .* ": Ġfixed Energy wx frame Multi Data Ġweighted OLS An omalies Button Sizer Window Disabler stro ud stro bes Ġband type symbol id Ġeval out }{ $\ Dis count Ġround up Ġround positions Train DS scan ned By Symbol ĠPy H ĠPy torch ĠPy INS ĠPy Movie ĠPy FileConfigLoader Ġra il Temp C tot max Ġdot plots bet ray HE VC Tensor Spec Tensor DataAdapter Tensor LikeDataAdapter Sub sample Sub tree Sub Estimator ava jo wave front Ġli quidity del X del Y Ġfun ção Ġdat atime 53 85 Add Buttons Add Trust Add CheckTool endog enous Ġsrc form Ġwarm ing PS SM thread Num 62 36 cb ticks help file original Drawing original PartsRegion fp cur mis classification Random Points Random Location Ġfalse y ĠOne SlackSSVM common ancestor Config Manager Config Handler Ġmp lt ---------------------------------------------------------------------------- -- request ing GT F GT CG GT CCGCAAGTTA Ġsubject df 73 031 pc ions CL C Ġlon i Ġlon min ĠDE GREE ĠDE LEGATING ĠDE COCK actual izar wd w wd mfile CD ROM flag ontop ĠIPython Widget categorical Cols Ġcm ip rat ulations Ġda TestBoxes 52 33 ĠSelect ivity ()] }) Ġte Y Ġte sedml ĠDo ha ĠDo orn ĠDo oren ven ge ," & ĠTimestamp Scalar price Handler Ġactive detect Ġactive Bits merge Run rf dir ART EM Ġrs mooth Ġbad indices Ġbad HP logical not Ġopt target Ġ[], }, alt Axe Split Method Ġnull clines }} `. Ġ(% ), Ġorigin ID AM F AM G region AdjacencyGraph 2016 1007 2016 0720 Ġpri ms Len ght click able Ġavg T Ġdebug plot Ġsf id Ġnt ve Ġpca p Th or Th Pts asc ar asc us asc ender scalar bar lb rack lb lframe Ġequ inox .+ )') Ġphase file Node toFrequencies Figure Editor phase plane phase Ax phase Wvl ĠModel Fit bb ell Ġmag adan ĠInter leave Ġatom iter Ġatom Index Ġatom Maps selected imagesTextBrowser vl an big u big star Ġsep W subject ive Ġprop ID Ġprop strings One Hot One Img One Dimensional Ġ24 80 Ġmid ata Ġmid Point Ġmid ranges sym metries cum hist Ġap f Ġap corr include hidden Ġxs data Ġticks Amp SS k SS Ps ('- '), ('- .') latex file Ġsur fit )} .') )} $') Output ting Output Test Output Line [[ (" energy out Ġ18 90 encoding file cap Height vertices A Dataset Like Ġmis nomer Sp ines Sp illQuality product ive Num Cells ĠSparse ToDense CR ESP Ġpaths dict short Label short ening Ġwords CSV Ġduplic ations contin ued Ġsection al Ġ32 34 extract Y PAC TS zone Key =[] ``, ket cher ann Based ann yk Sy dney standard Bonds Tool Tips Ġsymbol id Ġsymbol NamesList With Dr Ġfetch one ĠSpark IndexOpsMethods mk frame Of Point Of Light Of TFBS lc en lc geom UM ID air space Ġstream Mean Ġsess idx Ġneg ligence CON TAIN CON CURRENCY CON FIRM Ġutil isation Ġ'< !-- page key page ID encode Mask LI SION LI MMAG domain size mal low approx eq approx ident Ġ19 30 ĠOut Type ĠOut Fil xmin orticks 58 14 ],[ ]], Ġforce IndexLabel Ġymax like prod ig prod Opt Ġprefix ing xt gt VER BOSITY ãĢ ĭ Ġ"# $ Session BarReader hen ed Count Trace Map MetricProvider VE GA aux Slice ĠImage B ĠImage I ĠImage Filter ĠImage Analysis ĠImage DataProvider SP IN SP DX SP Portfolio Ġcf m sur d sur prise ĠSy ste As semb As serts DB E DB DB DB UILD %% \ %% ", %% '% ĠCategorical ColumnName ĠKeyError s FE ET clear Events which data cg al sd pa Ġvalidate command ĠInitial ZeroTurbulencePowerCurve reference Actions ------ " Ġobs oleted }$ } }$ `. }$ ^\ }$ /[ Ġsl len Ġinf otext Ġmerge Graph Period Properties 61 45 61 667 cla ret hel sing geo point geo Json decode Jpeg ĠHe eres ĠHe witt ortho logs Ġbutton n Kernel Spec ĠTh resh Task Fail Ġdy e BU ILT cer ight cer unmenu frames NonTerminal menu Archivo week Number ĠFile Handler ĠFile Folder macro Actions macro scopic cr B cr g cr p cr ui Ġcontent Object car ma car ding car bu car dio ĠQu ote ĠQu icGraphicalLasso eigen Val eigen vecs Results Table åħ ħ Poly tope 91 12 ux d begin arrow calc Point joint Velocity predicted Input predicted ActiveCells Invalid STK mul div Ġexpect eden Ġsmooth order Ġsmooth rockspectrum DS lope ĠDis c FL OR ),( ? KMeans CosineTest Ġinner Shear Ġinner ErrorStart Event Id feed Dict CG C }\ /\ Ġevaluate Expression ĠHT P Info Update 101 5 101 74 ĠNormal Posterior utc zone Bar History FILE TYPES prev Word Ġthread pool ba con License e custom SaveDir seg id hy steresis oob enth Start FertilityAge Ġms set Ġdelay fill ĠDist illedSGLD Ġdeep py Ġdeep learning Ġdeep lift pat atune çļĦ 代çłģ çļĦ 模åŀĭ çļĦ åŁºæľ¬ Read Html Read FixedWidth Read PosRankSum Trans verseMercator bi ota plus plus Ġoperation LESS Ġoperation MORE ,:] ** From ListOf ĠPandas Panel ĠPandas ExprVisitor DD ATE sto Empty Length Matrix mix es ĠDataset Validation ĠDataset Adapter Ġdue credit xp adding Ġglob es histogram Blobs tw ol tw ab Ġfft Sum Ġsaved interro Ad vection Ad Hoc Ġgene Filter Ġgene Names xdata sq Ġdesign vars Ġgeo code Ġgeo logy Ġgeo probe Ġgeo profiles Ġgeo magnetic flux FormatStr rho c rho data Ġgr testData irs ch rule format tm Region ĠLine List ĠLine Fit ĠLine HTMLTooltip Offset ParameterRange 128 78 ĠDef ense Ġrand bool Point Color PY FLINK PY GAME mixed type ĠPipeline TFM register method ĠTrans mission ĠTrans lator čĊĠĠĠĠĠĠĠĠ čĊčĊĠĠĠ Ġ---------------------------------------------------------------- ------------------------ Ġstage infile Ġconn Dict PR INTER square iter gl or qt pylib station Name ()]) } ĠSub sequently ')]) \ Ġ"- >", tau Mean adi eresis xml name good fit good match good fits Ġrece ipt Ġparts ofspeech Ġcp def ĠMaximum Likelihood land ers ----- " Ġtd arr rv par Ġreset Model '% __ ]} ', Ġker nprof byte count TC ROSS Des pierto scikit plot Pandas Array Pandas DF ymin orticks Ġlate v 600 848 swap Echo Select By Select Plugin Ġph it Parameter i Mean Plotter "\ % Ġneigh k Ġnc instance Axis Dict warm ing mne python ĠOutput Format ((' # Ġcategorical Cols ĠSto cks ĠSto keV spectrum All specific s Ġsite j Ġsite packages Ġnor me RL m ited ir Pr j Font File ("- "): Cell Lattice ĠVari ate java List Ġminor Locator Ġminor Top Ġminor Right Ġminor Left Sample Files Sample Freq ĠNew ick Ġndim list ]))) / lement iev ĠBe ware ĠMA PS Ġ88 1 Ġ88 13 Ġ88 95 Ġ88 94 Ġ88 24 Ġ88 44 Ġ88 21 Ġ88 89 Ġ88 70 maximum GrainSize Sto red Ġcb width Ġcb height Ġcb orientation Ġcb Ze Sim PEG Ġcorr Noise Mask Only ('_ '), Ġss df Bo dies maps cale arith metical Ġpk a Ġsat ur Ġsat stress ĠKMeans TestBase ĠKMeans CosineDistanceTest Ġtools stats ĠFirst LevelModel Ca pex BF S Ġmajor Top Ġmajor Right Ġmajor Left Ġmajor Ticks 0001 98 Ġtpr Train Gradient Magnitude 400 9 Current Multi Var Long Ġloaded RF Ġsynt ype Ġsynt aps amo a Level Mask Level PotentialOutcomes ĠOrderedDict s ascii acute Ġdetect able URL TRIES Do ub Do GenPyCode ============= + Ġconv box Cl ar ĠValue LabelType Ġoverlap ing Ġexpand arr Ġbig u Ġbig tick npy math ĠEX TRACTION Ġcap itals ĠSequence Matcher autos klearn under bar Version Store MAT TN MAT ETG ĠFree BSD chart ORs ')), :] nz d ĠNA ICS cfg path OB SERVER hyper u hyper setup Ġpt mean New Signals Ġfiltered Data Lim Type GMM at ĠUp inder Ġ------ > ĠSample Collection Filter Wheel greg hines glob pattern ĠCont igs loaded ModelAction ĠVector Slicer met tr met file met ically met ropolis met amodel cogn ito SM K SM US Ġchart Data Ġgover nor pole onic SL T Ġpool Pct Ġgra do Ġgra db Ġgra intype Ġgra dbh Ġgra ficar Ġstand art Total Displacement Ġstrip plot bra ss bra ceright lg am lg nd TP Ms Vs Data ĠIO e ee b 105 85 {\ ' Ġtot ype annotate Fmt Ġsuffix CSV 126 146 ipython printing Ġcirc ularity Names Mixin TA INS ABC IntervalIndex ĠPoly technique half step half Thick rag ue Ġgaussian Fit Ġdump File Ġoutfile Name Reader Base 2017 0311 EG RA Ġeig v ike a Ġer ros clustering Alg Ġfamily id ĠMock Print ĠMock Connection Ġtau w ĠClassifier Type parts cl parts Region Ġgu ys Ġgu ids beam center IB ATCH colour List 2009 0101 Ċĉĉĉĉĉ ĠĠĠ van Runs van vliet cam up cam dir cam length cam const arc as 0101 01 ĠDummy Species ĠDummy ConvNet ĠLA W ='% ', Ġå ± And Fit And Precision And Bias And Slab And RunConfigModelDir And Xing numbers ign Ġ? ') Ġsel Name dens file Ġix pre Ġix suf 275 85 Loss Train Loss Rec Ġcatch all Ġquad copter SO ME Save Files čĊĠ čĊĠĠĠĠĠĠĠ psd or psd Max psd Min Timedelta Properties BA IT Tk in Ġcdf tr 2018 0103 Ġgap ss Ġplan Dict 318 00 Ġinterp XYZ Ġke pf Ġke qs Ġke porb Show H Ġct g Ġct ps Be Gaze Ke ck Ġanalog s syn names syn weights 926 85 Ġrad Temperature Ġtab Entry .] { Ġsd pa Ġsd DataPtr curr Lst Ġcurr term '$ - '$ \\ '$ |% cox ph stit ched Ġfeat Mat Ġfeat Stochastic ĠCor ps Ġchildren Names 118 80 118 7855 hex str Ġlab l Ġlab No EP A Ġbranch name 896 5 Ġair way Ġair ports Ġspan iel ĠBo unded ĠBo ulder Load ings Load File Load Library PRE CTOT Open Fisca Open Contracts Ref old Ref seq Delta Lamb circle ddash vir gin Ġbc pp ACT B ACT T sn cosmo Query Form Query Cache bag obj Ġdr NewRange 224 96 pv syst pv watts Learning RateScheduler RI VER ":" { intersection mesh ech idna outfile Name )> ) åº Ĺ ARG MINMAX Ġalgo box .), ' ĠProb able Change Map Ġtrim mer Mock HTTPResponse Ġautos omal 112 00 112 45 ĠBuild AndTest Frequency Inferer ĠVar Char ĠVar BinaryType ĠVar DTC 317 2 317 64 UD UNIT Ġ--- \ Ġ'') ): Ġfreqs plat bayes dm Ġlag ging ĠConfig ures Ġgl End EXT Class Ġws stations Ġroutine Timer 905 6 ampl maps ja cv sr p EV ANTH Func Group ĠST AND ĠCall Counter Ġ87 10 Ġ87 32 Ġ87 16 Ġ87 17 Ġ87 18 Ġ87 67 Ġaz deg north ward mur phy ĠSum mation vg auss Ġextracted Feature bio formats ĠText Adjustment ĠGo North lan ey Ġ================================================================= ================================= DATE ADD Ġauthor ity ĠOver load ĠOver Feat Ġann outils ĠStart Server baz el ĠML KCalendar Ġdaily Result resource Path ĠDATA STORE vd j Draw Variable Ġshared var "} ") "} ]' ĠAC TIVE XY pts Extra pol ĠFloat Value Ġlatex font Ġpow ered CDF s ĠInc ident hr p Ġyt mag 998 148 Checked List ĠMiniBatchKMeans CosineTest ĠEl igible :" ; Ġmicro service Ġmicro organisms Ġ195 4 Ġì ° Ġì ĭ¤ proxy S =\ '% RGB Waves ĠMachine Loader Vis a Ab und Ġbw df Ġclick er Ġcollect ors fx nxn Ġalt pos dl bl cn angini Ġbeam rider Ġbeam PGlocal cw list cw opencirclearrow Nearest Neighbour Ġ95 64 Ġ95 80 Ġ95 66 Ġ95 75 Ġ95 85 Ġ95 24 Ġ95 86 Ġ95 65 Ġ95 77 Ġ95 67 Ġ95 08 Ġ95 56 Ġ95 57 Ġ95 74 Ġ95 63 Ġ95 79 Ġ95 54 Ġ95 59 Ġ95 76 Ġ95 61 audio path Ġrepeat ers ĠWrite ToText qr vecs Optional BackendPackage blob list subjects group Style Index chem ia Lab Lst ĠOpen pyxl ante con Ġ35 84 Ġ35 29 DR adio LR D ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ upt able Ġtax el CF M CF ME 265 4 Pool Base CI method CI AO conc data conc ern KEY LIST Ġodd t identity ToUnicode ĠHist ology plain Ranking Ġsyn model Ġsyn chrotron ograph er Ġce tera Ġpv c Ġpv p Ġ"< - Ġ"< ": Pickle Filename ĠMon itors Ġ26 27 Ġ26 29 Ġquant ipy dv ds dv nprt 185 55 ('.') + 375 3 Dep end Ġrecommen ds Ġtk appa Ġtk Font cycl ing Param Errors nor un tied last wav sol Diff Widget ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ burn ing burn ed burn len git ignore dark Reference é ré è® º Ġmapp oint ĠPRO MPT 132 8 132 395 Ġhighest Price spam mity pdb bind Ġintensity Nuclei Ġintensity Virus quant ifiers Non Modal Non ExistentTimeError ':[ ]}) Ġlt xt 106 94 Exp IDs Exp NI Exp lore ĠRE PO ĠRE COMMENDED gauss opt gauss pars Uni mplemented Uni Frac Ġdp full flu ores Ġmk p Ġmk r Ġmk time ĠMy T ĠMy Line ĠMy Win ĠMy Unpacker Ġchrom Start Rep Lin ĠScore Error sz a sz pt Ġtxt ResultFile sun py 134 8623 ĠSc rolled 70588 2 Ġ96 99 Ġ96 12 Ġ96 16 Ġ96 35 Ġ96 78 Ġ96 94 Ġ96 86 Ġ96 92 Ġ96 84 Ġ96 50 Ġ96 77 Ġ96 90 Ġ96 98 Ġ96 89 Ġ96 79 Ġ96 72 Ġ96 73 Ġ96 71 Ġ96 58 Ġ96 91 Status bar Height Weight 644 90 Fig Space meg aman 000001 0 DEF GHIJ FLO P loy ers ĠRO wen ĠHand led bys ub ĠTH INGS First Char war ps ship steer Ġseg name Ġpser rors elev ision ãĥ ¥ ãĥ ĨãĤ¹ãĥĪ Ġnr z ĠSE CF dk x dk im dk si att ns Ġwind ers minus D minus R Ġfd os ĠGa ins Ġsatis flag Gre gor ĠLoc Info ko Evaltimes Ġpc fs Ġdecode string SB aaS 205 1 LIN ER LIN ESTYLE 165 272 widths Object 7817 305 212 97185 Shape Color hear trate Ġraster izing gam I Ġtrade marks Geo physics Ġ(* )' always clear Ops Util Ġusers InCluster 253 92 ĠPe ach Ġsched config PLOT LY Tri ms Tri Mesh Err Bar Err Rate iq pt ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠPL s ĠPL St ĠPL AN ĠPL ATFORM 156 25 Red dit glyph ind ĠSO FT quarter End )^ % Ġaux Log Ġaux illary Ġvol label Ġvol plot xC enter xC entLst ))/ (- combine Add PA STE Update Time Update Date PM DE Ġ86 32 Ġ86 33 Ġ86 80 Ġ86 75 Ġ86 28 Ac ronym Ġ94 01 Ġ94 12 Ġ94 25 Ġ94 11 Ġ94 15 Ġ94 05 Ġ94 20 Ġ94 33 Ġ94 80 Ġ94 45 Ġ94 88 Ġ94 14 Ġ94 19 Ġ94 78 Ġ94 13 Ġ94 04 Ġ94 96 Ġ94 03 Ġ94 02 Ġ94 27 Ġ94 06 Ġ94 36 Ġ94 09 Ġ94 07 Ġ94 34 Ġ94 92 Ġ94 84 Ġ94 44 Ġ94 23 Ġ94 43 Ġ94 08 Ġ94 47 Ġ94 49 Ġ94 29 Ġ94 39 Ġ94 40 Ġ94 21 Ġ94 48 Ġ94 69 Ġ94 74 Ġ94 82 Ġ94 72 Ġ94 41 Extract Job feats Tr sos freqz Ġ! ) ĠMark Ref ĠSimple Arrow So Far gh gt MES A Ro ach ĠSplit Line Cluster Operator Covariance Range QR S ]** (- ĠRed o visit Id Ġpg v Ġpg rowth ĠMemory Log Lin phase Ġheat Map Clo strid 114 02 Ġol do Ġol dfunc ln approx WS ZSUBARU ################################################################################ ######## Ġfonts pec Generator DataAdapter uss ian Det SAng System Parameters ĠOUT SIDE video file kd n Ġroi y Ser bian ,:], ## hide show GEN IE GEN OMER DC Output caps IX 356 027 ĠDisplay Trap BB HG BB ANDS elapsed Error Ġ194 0 Ġ101 39 Ġ101 53 umin um member ins member infos ĠAc quire synt aps ĠDense Matrix Import Setup ĠBoolean Value ("[ ]")) ĠUS NewYearsDay ĠPart icles Ġ44 0694 347 24 Conversion Window Ġarc minute erm ont Channel Def 397 0 Ġcpu freq Find DenovoParents čĊĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠčĊĠĠĠ Directory Format RF S TM R ĠDimension al ham let BIN DIR BIN NING Ġ84 20 Ġ84 13 Ġ84 02 Ġ84 85 Ġ84 86 Ġ84 60 Ġhit ss -----+ --------------------------------+ when ce Ġmc dat Ġmc datum trade id ĠMag n keyword Id 906 0 Ġintern ation ĠScale Shape ĠStop Time rr in accept ors bench ndcg Ġmm nt surf hab Ġlowest Price chk call ĊĊĉĉ Ċĉ /\ . nav s Ġsphinx contrib Ġlf req Ġlf Norm Ġlf ulleval ĠSp T ĠSp ines calcul ators Ġcoun tour Tick ToLegend Ġcum hist ĠWar oquiers 135 89 135 439 Port land 107 43 107 47 107 28 315 5 315 7 yi elded ĠState Var Connect icut Ġ'[ {" hh mm Ġ'* '] Ġ'* --', Ġlp file LOG ICAL Cross Val Cross FeatureStats Ġtup la Ġsn h 195 88 don nées don oghue cros stau Ġoverrid ded gu ids gu inier gu illaume Ġ102 16 Ġ102 13 306 78 Ġgenome tools Ġweb app Ġweb logolib Fin ishing Ġlc format Combin er Ġ123 12 Ġ123 13 Ġ123 06 Ġ123 18 ros lib ĠTri ps ĠTri Interpolator OUR ISM ('{ ', ('{ },{},{},{},{ 912 84 jew el Queue Adapter Queue Critical Ġtrend line Ġtrend only ĠCustom Class ĠCustom Series ĠCustom Optimizer IMP RO Link ing bas n Ġdark s 384 1 384 9 Ġinteraction Dirs ĠNode Container Gen Data Gen otypes Char Strings ĠDI FFER 138 00000 Build Type ĠLength s ĊĠĠĠĠĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ wavelength Array 016 84 ita et Ġregister Java GL N Vert Coords Copy Job ]== ( fg fg dem isto 1606 7 625 00 Ġasy mptote 314 9800 Gamma Fitter Wave vector ĠGe ometries ĠGe cko Ġsolar production Single File Single NetCDF Single Hue Page Number Page views switch Func #================================================================ # #================================================================ ================================================ 225 79 ------------------------------------------------ --- signed integer ------+ -----+-----+ 645 646 Ġmoving Avg Simple Dialog Simple Progression ĠGP s 3636 36 Calculate InfoVals Ġkde plot Std Now Pass band ict als ict yp notebook ctrl Ġnative Pdb ĠTotal s ĠTotal Start catter PlotItem sus pension sky coord 395 963 pw rel Edge Cases Ġ'$ [ Ġ'$ | Missing Data ĠRo han Ve terans Ġabc def 924 2 ('[ ')+ 164 38 164 96581 907 6 Ġrecur IJ Ġiso i ĠLab elling 367 96 COLOR MAPLIST COMP ESSION COMP ILER My Types ]][ ..., Ste mV Attribute Documenter Thread Stop capital Q overlay ifcounts 155 24 ĠHas Page Ġadj pvalues (',') [:- hspace label gold Standard Classification Algorithm Inv Anim 204 64 204 85 Ġ37 27 Multiple Estimate Multiple Quarters GP Gran GP ExpSquaredKernel Ġpot error ('./ '), ĠOb serving Ġcnt Ok account ant 404 20 404 303 Histogram Test Ġmedi as camera Matrix Reference Field Ġcontrast ing Ġcontrast ive quote left ĠCar bs ĠCar ries ĠCar avel dend Z cid FontDictObject simp arams ĠMan hattan Ġpsd X Ġpsd denominator [_ ]*', ĠNetwork x ĠNetwork Writer SUB FILE SUB TABLE SUB SCRIBE Using HistogramTest 153 85 Ġrisk Change ãĤ ¿ ä¸Ģ èµ· Full er Full Datasets ĠMultiple SeqAlignment nbins x Ġcompress ibility Tag Generator ĠNumer alTickFormatter ROC ESS Ġleading start Ġ================================= = Ġ47 13 Ġ47 36 Ġ47 40 Ġbp ms Ġ89 32 Ġ89 33 Ġ89 78 Ġ89 30 Ġ89 31 Ġë ¨¼ Connection Style Ġ================================================= ============ Ġ================================================= =============== Ġrms prop (", ")]) Ġfo y Ġfo is delayed raise Notebook Manager Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 124 88 Ġbi partitions MEN TER Learn ers Med Data charge Carrier 62745 098039215 007 48 proto Tick digit izer Ġ': '), Ġsun burst tip odis pic name ĠSource Module Ġanchor id Ġum issing Ġum ulist Ġhome brew 104 75 104 27 wire maps ĠTe ams REF LECTION REF GUIDE 934 6 ĠFortran File mac ds fb val 交 åıī 232 28 ĠMet abol Quantity Error ĠAUC UsingHistogramTest \. ]+) 295 7795 dom single cumulative value ĠAg ol ĠBinary IO ĠBinary Coder lad ky Estimate MultipleQuarters Ġminibatch size ä¸Ń éĹ´ Ġgrp names 167 3238 Stop After 188 8 655 27 655 30 655 26 655 29 Final ized Cent os Ġwt file Ġwt grp scripts ize Ġravel s cand ra closest TSS ĠAL READY Two Grids Two Photon tbl name chron os blk sep blk lst 108 000 Ġlev size Ġlev Name ï¼ļ ') 178 69 Ġcorners Horiz čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊčĊĠĠĠ Ġ[(" '" Bit Size YEAR GRx wspace label 035 31764 236 2 495 2 bank full Ġfx name ĠPolynomial Smoother scr files ĠHigh charts Ġam use Ġsz x Coord Finder Ġremote pythonpath Ġ97 01 Ġ97 11 Ġ97 88 Ġ97 34 Ġ97 37 Ġ97 90 Ġatt ib Report PickleFilename Ġjump er ĠLocal ZonedTimestamp Ġjo ur Filename Pattern Prediction Results snap ped 0588235 3 Ġdes db GO ES attach Recorders Chi Sq Chi SqSelector čĊĉĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ udi eresis Ġlim Facet ĠTwo DRel ĠSingle Input wc pos æĺ¯ åIJĮ Ass ay ĠEvent List ĠEvent Recorder dire ito dire ccion Pop dy Write To photo Rank UND ANCES Ent rez trunc Mean Ġvir idans Template Content Binary Results 325 38 ĠSch ü ĠSch wefels adapt eq Uns pecified traceback s 277 3500 JSON Decoder Sa o astro data 162 84 Pri mal Phase Error ĠDNN Estimators El liptical Unexpected DataAccess ĠConfiguration View ĠConfiguration NameSpace Ġcr éation ĠLong titude dar ank '| ': Property Is Ġpulse A ĠForm ally mapped Reads Static Line derivative Z ĠRES OURCES ĠRES ISTANCE Init iate Global Constraint STAT ENAME balance Sheet Ġxt ie Pen nsylvania Rot ational gets ampwidth planet ary was Live Ġsvg out Ġ'> ') Ġconc APtemplates sex ual sex Gen Ġsound card kin son RT positions RT stops Ġreplic ability .]] ] .]] ]), 6401 78 6401 85 6401 97 6401 77 6401 98 6401 89 6401 79 6401 81 6401 91 222 98 Ġmonths Since prog ressed Serial Iterator emb d 产 éĩı jc iech ĠFrequency Distribution sem ivariogram study Range Ġprotein Name Ġslot Value ĠPatch board Ġnz xy Ġbed Graph Ġbed rooms ĠAir lines Ġpara mater Ġpreprocess Meta ĠSNR pilot ĠArt icles ĠFix QueueCritical 267 96 posterior Alpha hatch d hatch t Ġproc sets ĠBig Spectrum ĠBig IntType Ġ98 33 Ġ98 35 Ġ98 34 Ġ98 29 Ġmf w ĊĊĠĠĠĠĠĠĠĠ ĉ ĊĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ dirichlet BC 214 82 bal mer bal rogTruth Short ley Ġnv ss rfft q ĠSte el Buffer Size oto FileLike Ġ38 1409 Ġcn trs Ġfv set ĠBar ber Settings Widget 008 24 Flux Norm Lib reOffice ])+ ","+ ĠLR path will ing Ġstochastic ity Mar riage prote ctions gist ration ĠFrame toArraySerializer TZ Formatter Ġfancy repr Ġmaj ors Ġspine Ca Sur r Sur faces Ġten or Pattern Parser Ġbinned chidata ĠDouble Value Ġrid der Ġrid ership Contour FromListOf bro om Percent Return CRE DEN refresh Grid ĠRaw DescriptionHelpFormatter Pixel Height Parallel Processing Ret ired ĠInteractive TB .). """ Ġgame te elt name IV ES IV EN Ġprom ise 985 0 Ġfg mask Ġtrip Id CM WF toolt ipt ĠBasic Meta ĠCF Projection ĠDecimal Value Ġblk sep Ġdigit ized illa mook æľŁ åĪĿ æľŁ æĿĥ EA blocked ĠArn old pet ro Ġgeometric ally RUN NERS transfer info transfer func Common Name ail ment cccccccc OOOOOOOO trimmed Reads lef trightarrows Ġdz dx ------------------ | ĠUnder line Ġ": ": STOP PED Ġmono phonic ĠInvalid ValueInSpecification ĠSun El ĠExp Info ĠExp anded Abstract Base ĠMIT gcm pin hole Ġld file Export Dialog ä¹ ¦ ĠSmall IntType ĠMar ine Beta Binom Ġhal ving NP Z NP ts dw ks qc db Ġtopics PerItem 657 22 Ada LossFunction Ġexchange able Ġheatmap FileName OFF ICE oct et Ġretry ing /{} \'>< ĠGlobal Data Decision Mutable Callback s åĩº åĬĽ LAT IT shear Exponent 095 6 Rect s 233 14 quotes ingle Ticks Both anc ias ĠSubplot TimedAnimation 006 1673238 ĠClean ed ĠClean TempDir '[ ^\ ellipse Bounds ĠUnit Registry GroupBy Plots ĠND V organ izer ĠInit GL 99999999999999 600 Si lico ĠCons IndShock ĠCons ulting ENS URE ĠEmpty Error ĠTool ToggleBase !!! ) Ġmg fe Double ClickEvent whole Echo ĠBlack body ĠDifferent iation ĠStream Handler augment ables ĠSha des Days ToDelete hb onds ĠEM G PIC hange hor ror arb or 046 18 Ġaff y rog atz Boolean Array 074 074 ĠXY C ("{} - netcdf time Ġblit ted Na L Internal Surface Device Tests Ġcid FontDict Ġcid ToGidMapObject ĠClear Colormap 166 9 }$', . Visual izes HTML orMML |\ +|\ numerical rvs о Ñı PDF s ĠBre unig atern ions XYZ Field XYZ TC ĠView ing Ġpf um Ġpf vd Upper Bound ao XValues Ġhp start Cat TMM bill ion Ġĉ Ġ Ġtal c ĠClose st ĠGraphicsContext Cairo ĠDec lared ili zed threading CurrentThread sas senhagen tur bustat whe lm Constant Kernel ĠArrow Bool 245 26 zo pe Sta ges ĠSer ves Ġoccup ies 064 0 Dag Pickle Dag Bag quit Action leq q leq slant DataType Ops ĠCommon Utilities Ġwav num Ext GState WINDOW TYPE dj repo Ġmys ites Correlation Matrix powers pectrum Workspace Display ĠPop ulating Polynomial s cancel Requested Week s Usage Error Usage PerDay Sw r Sw ift Sw arrow 1415 1 Weighted SparseFeatures ĠMulticlass Labels More PG ĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠComplex Warning wal ks Ġ}} .", Dot eq ĠPSD Posterior ĠPSD LogLikelihood 392 1 Ġbf db Ġhmm ModelName Ġà ¼ Ġà Ħ ĠÐ » ĠMerge Ddb FD G Ġcaps CSV 217 163 income Statement blues ky 3067 4817 NL ESS thin len bond vs Ġconvolve Spectrum Ġanns ImgIds Ġ78 98 Join Style stick ies ĠBL J ĠMic ha ĠMic hener EC TIV eb ds Ġdos hape ĠQuery View etal ine Ġimgs izer Ġresist ers ĠSearch Extension (... )" (... ))') Ġhot spotter ĠAB CCategorical ĠAB UNDANCES rotated MH ĠEr ro Ġ(\ *. Pred ator ĠMed al occup ancys Ġinstr OpCode bracket left jit ted Star burst Star PolygonCollection Forecast ing pal abras Ġwc Odds MULTI PLY Ġtie correction thick en Ġrh ol ĠLearn s LONG I Ġlang detect ä»·æł¼ ä½İäºİ ä»·æł¼ é«ĺäºİ Mot ors Ġchis quared })) '. utt ura Ġmal ic far ther ĠAbs Temp Uniform Scale blo omd Ġvm db Ġkk u Scaling Vec tend on ĠREG EX pilot pars Neg Color Configuration Manager tweet ed tweet cl }; ">' á n 279 33 hf ss hf ds mri qc Ġcg at Fl uct Fl annBased portfolio Analytics ĠGO AL ä¸Ĭ ä¸Ģ个 ĠMPL Renderer bh tsne Ġweak er ä¸į 足 Resource Types ]{ # ĠAvoid Plots 5714 2857 dq chivals Ġspe ktrum xgrid Check TG AC rew alled Ġmacro eco plotly js Ġprece des GUI Constants ĠCOL A 0000000000 02 Ġquit ting Ġkill navbuttonlayout Ġpersist ance 403 922 640 200 640 202 uf te Ġredraw s Ġexpl Var Ġexpl orative calculated Num jar vi 444 356027 pref sp Ra infall ĠMissing Constraint ĠMissing IDError ĠINTER ACTION ĠINTER FACE sis im nv est nv dash nv oxel nv Dash wedge q ĠSK LEARN ĠFlow Callback fine gd Ġbla de AU ROC smart indent 344 98 Cap Style Ġintra Inh ĠDatabase Grabber wv obs wv apano ĠGro macs Ġshp instance cart odb hd us italic Angle Ġ111 49 Ġdisplacement file Ġ § Ġpic num ĠTs ung FFFF D )$ : )$ "): )$ '%( Ġpan ed StateSpace Discrete StateSpace Continuous PIL OT Ġproto Tick Stretch ing residue z Ġgn upg Ġxa covfft ocean ia Ġcombo boxes Air line å¦Ĥ å°±ä¸ļ sound file MAN N Ġ.... ])' refer rers 70710678 1187 RP F Ġdiss ociation ĠHO MO Manage d Ġviz lib Ġosc ulating 0005 55555555 åIJĮ ä¸ļ åIJĮ æł· dry Run Ġisol ines Ġgm vs ------------------- [ ĠDeep MaxEnt Ġiq Pt Ġpublish EndTime aab bc aab bbb ĠSP ADL ĠPolar ization psf Mag ################################################################################################ ############### '^ ([ fire department setCurrent View ĠDC IP LP SVD åĴĮ ä¸ĬæľŁ cir ceq Ġul path ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ Slope Plus cup dot morph Iterations Ġkv sep Lock Draw 947 24 Ġsex ual :]), ), 981 126146 Ġpay ments Ġpay loads Component Analysis Ġbon da Callable Documenter ä½į çĤ¹ ä½į 移 084 309 Ġym gamma Ġym lac geq slant #------------------------------------------------ -------------- Evaluation Metric Bz H 0156 863 Ġperc Covered Sampling Mode Sampling Frequency odot enleader ĠQU rl 28235 3 UNIT ED Multivariate OLS Multivariate JacobiOPE Ġfat ools Ġmus ical Ġprog name ĠRec ip ĠBO ARD Ġimpro vised rogate Model Parts Plot rrule set Ġ#================================================================ =============== ___ /\ 6566 55 ramp thread Ġoct ant åĿ IJ ĠĊĉĉĉ ĠĠĠ Dash Dot Ġpromp ted Sup set Ġtracker Label Quad Tree Quad PS Syn Chan bk grd 923 077 Ġmention Flag Ġmention Followers mess aging mess punkte Attributes Dialog recs ys vr bool æ± Ł colon ies CED URE Ġfk G Coverage Stats mdl cfg Available Arrowstyles Available Connectorstyles è¦ģ æ±Ĥ Sine Grating Ġunders ampling cancer per broken bar SIG TRAP cone t Ġ+' _' 00392 4504583 Dur bin Super set }}{ ( Ġextr usion rightarrow bar rightarrow tail ĠNeuro sci ĠNeuro physiology Inference Data ĠObtain ed Ġpruned Node ĠBASE D ĠBASE DIR ĠOffset Filter Black body PART IDS ĠAtom Dos æĸ¹ 便 kaiser ord Inner Product Inner Tol fili ppo gel j gel ss Ġ134 0 ĠAUTH ENTICATE ĠDAT En ole nt Ġcel er ĠGeoDataFrame s æŃ¢ çĽĪ Rolling Type Rolling Mean ĠItem Properties ĠPen alization Chunk edArray cmb ShowH cmb SamplingMode Ġmand ar Ġrecogn izable ĠExpression List Ġfed erated ĠAnaly ses Pan Base çĶµ å½± ]+' -'+ vtk PolyData Ġcame lize Ġpsy FunFit Ġmh fs Ġmz Ref Ġmz Matches Ġrub isco ĠBU FFER ĠWeek Day snps map ĠESTIM ATE CID SystemInfo CID ToGIDMap GM ST ĠStreaming Queries Ġemb d Protein Coding ĠTransition Parser kv args ĠAnt ibody Ġabort us ĠMaskedArray s Numeric Block èĤ¡ç¥¨ åĪĹ表 '\\ ([% concept Tree Instrument al Ġfreeze gun Ġpub med Ġrock spectrum ĠDebug Regressor Cycle Dist AIR MASS BOO ST ĠIR GA Host name snow fall Ġbasket data QC trk Ġdomin ique Ġorange contrib ":[ {" ĠWed nesday Ġ107 46 pump ing Ġxv ft chess grp sps Model åĪ© çĶ¨ ĠCy gwin ĠCy cler ĠCy cling ĠCy bernetics WB Paper ĠOff sets Convolution al Ġcircuit plot ĠMarkov Chain OFFSET TEXTPAD anth ropic Ġmysql preseed Ġtravel ing Working Date 085 9 Ġlay ed Direction Increment ]| (\\ ĠTEMP ERATURE DZ s Fisher Mode ĠPD Plotter ĠMu Tect Mixed SourceEstimate MEM MAP ĠResidual Layout DW ELL Eq pt PF velocity Special Case Stage in reach ID Ġpin n ida ho ("& ", ĠIndividual Distortion 522 0501 Ġlv gd ĠCONFIG UR Aut ophase Ġbib x Ġcumul ants PASS BAND ĠWeb Agg Ġvid name Ġvid paths Ġksp data Ġpour centage DEV ICES $$$$$$$$$$$$$$$$ $$$$$$$$ $$$$$$$$$$$$$$$$ $$$ ĠARE A alphabet ically Slot Value ĠDataSet Base Keep ing ĠPER ASIAN ĠPER HISP ĠScan ning avoid ing Accessor Property RAD PER ĠGene Set Definition Template Ġ.* ? 1335 68 ("" ). ĠParser Base 55686 3 CAS RN arad ay Ġsus piciously orsion ScanSet Ġanno y Ground truth SAL E Ġ[{} : Ġ+------+ ----------------------------+ ĠObs SpecLayout Ġskeleton s Bio Model ĠExt GState creator ID basket ball Dataframe Transform Ġscat terer éĩį ç½® åĿĩ è¡¡ Near row čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ Tax i Tax el aids Scaled hack around Ġba dexp Quant um Quant ifier 9999999999 96 filen odot 443137 25490196 CHAR TS ĠColors RGB ĠTIME OUT ĠTIME LET {}- {}. yal ists ÃŃ ms Ġconform al ĠCut ting ĠGreen wich TRAN GE ĠEcommerceData Sh OVER ALL Ġ245 4833 Mer idional mY h nst edAPI ntil de ĠSS PACE ĠByte Field extracted FeaturePart 999999999999 5 Ġskips pace Pers ists Pers ons zps x ĠBenchmark Source particip ate å¤ļ åįķ å¤ļ å°ij ĠMV Grid ĠMV Layer 718 75 BIG QUERY mil p nump at nump ts ĠSerial izer ĠCG zi ahoo Data ĠFetch er ĠFetch ing mantid plot Hall ucination instant point setMaximum Height ĠNS precondSetup ĠExplicit Example æĸ°éĹ» åıijå¸ĥæŶéĹ´ 509 0 ĠGal vo epi results Longitude Locator ĠStacking Regressor Square Mesh Tol uene isol ates Ġdesi util ĠRaster DS gery Provider Movie Id ĠOptimization Results ĠdT sign ĠAP PLY ĠRolling Groupby 22222222 222222 decade Only breast cancerper Sci Tools Ġglu cose ĠIDF s ĠAudio Signal Safe Store django apps ĠConfigure Subplots SUCCESS FUL Market PriceDict Plane Plot inj ury precs im ĠCCD half Adjustment Boundaries BZ F BZ I ĠStd Fx Trading DayOfWeek Trading DayOfMonth è¯ģåĪ¸ ä¸ļ PLAN ES Ġchk c poll ution Byte Arr ĠPressure Table SOL VERS fic ies Ta ils alph anew Ġnump arses Ġlstm Results èĤ¡ æľ¬ =\' # atm file ĠDel AllButton physiological Ratios Ġ93 16 Ġ93 98 SetSizer AndFit chroma gram ĠÎ ¼ ĠLV Grid ĠLV Station 1801 09 Ġintrinsic GraphMapShape Ġparalleli zing Spike Rate Spike Exporter Vers ão ĠARIMA Process nA pts Ġ9999 999 ksp A ksp Q uy v ĠCop ula Ġ'^ '} 0922 14 PN ACL 558 14 ĠTrade DollarReturn shells Center ĠRepeated ly çŃĸçķ¥ åĪĿå§ĭåĮĸ mechan istic ĠEm ulation ĠSelected SubSatellites Ġ+" _"+ )',' (.*)'), ü ck ê° ģ ĠLambert Transform spk pt å°ı äºİ Trip Id Ġbre akeven pacf yw grab cut leftarrow tail ensembl ID vote gain fiber map squ int squ ish Ġly apunov ĠSchema UpdateOption Ġentr ance tipper var oda Cell ĠtestPredict Proba borrow ed Ġdop atch Ġdop pel ĠHar old ĠHar ish ĠHar vester Stata Parser Stata Writer TOL KPTS TOL ERABLE hom bic ygrid Check Ġ#------------------------------------------------ --- Protocol Sequence Ġobst imes lambd abar ĠUpdated Date ĠEuler Gamma Extended Properties Editor Widget ĠComment ary Share DB 796 07 pel hoff Ġbes sely Ġwvl Choices ssss sss ssss Oc Ġmr job Ġwts um rising dotseq Pow der Wal lace ĠXP assed Ġhor z Ġhor as ĠDATE V Similarity Join categor ization Ġfre bin Ġfre xp guard loc ksParamGraphWiz Height ksParamGraphWiz FontSize ksParamGraphWiz Tabular ĠInverted LambertTransform ĠInverted MollweideTransform ĠInverted AitoffTransform CZ OS ĠTestGMM HMM accs Mean accs Std åģľ æIJį Ġelli pto Ġpathogen ProteinCount Ġqq pks bbbb bbbb Transaction Data Transaction LogEntries Rand Line ih fftn ĠEast AsianTextAdjustment subscript ing Ġsoma v ĠAggregation Feature South PolarStereo Ġcensoring In ĠSpearman Corr Ġcolon ies popen args Neuron Model cline buf oi int ffmpeg colorspace ĠMessage Queue Explicit PermInc brace left Photos ynthesis ĠPhot os ĠPhot oz ĠPhot ovoltaic Baseline Noise Ġinvestig ating Tiff File ĠPan de Admin IndexView powerCurve Mode Ġdirnames plit Ġqm di ĠChoice Model ĠDNNLinearCombined Estimators Arc seconds Arc GIS WAVE FORM Ġntype A Ġslip ax Ġbcbio vm ĠRen deredString Ġ,' # ĠOnline Help 627 72 éģ ¿ ĠRUN S GRAPH LAB Jobs Data }}$ '% Ġcu varbase diss olve Ġgro ver ĠFake Variable ĠFake Process ĠBal akrishnan Ġ'/') [- æŁ¥ æī¾ Ġbill Two Atomic FileTask righ trightarrows ĠEffect iveness ĠChrom atogram Laplace ProbDist fle ets ĠAns ley Bootstrap ped ĠInstall ation Ġ'` { Ġymd Strings ĠAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA Outer Pos cccccccccccccccc ccccccc ĠâĢĺ . 635 6584 bore as TIMES ERIES Ġarrs bind ĠTensorProduct Space ĠCorrection Channel å½ĵ æĹ¥ apt eyn tidx Rel paren right paren left ĠSubtract ing ĠSubtract ed Balance Task Ãĩ Ãį Ġtransport ation Repeated StratifiedKFold Xml FilenamePattern hazard lib Ġgw detchar listener Bus mec ines Ġirregular ities ĠDesc ribe ĠDesc ribing *| ,' Pars Schema jack kn ĠtestSdcaOptimizer WeightedSparseFeatures linked in Ġgeodesic Distance SymPy TestResults Neural Networks Ġsynchronous ly Mh Ms spi el Ġstl solid Ġstime xp Ġanneal step ĠENG INE 2525 25 STOR ING \\\\ \ \\\\ ":" æķ´ 个 vary z Ġbow l ĠnoiseLevel List Keyboard Button ??? ( ĠMajor Bottom HL UNG KD J stre ptomycin ĠBF SK ĠTestDataFrame GroupByPlots è®Ńç»ĥ æł·æľ¬éĽĨ dV dlogM Ġodb a gaze lefts Creation Error '(\ .{ jy u Proc Set Already Being Topics Shown coupling Capacitance Ġ~~~~~~~~~~~~~~~~~~~~~~~~ ~~ Gold Noun Ġrecon ize Ġwk dict Ġhon king Ġmac error Ġmac python åıª æľī Fatal Tests ([^ "]* hermite Series VOC large listOf InputLists Gu assian Ġiw rk Ġplat files Ġ'** ' liner Model ĠSPL AT ĠBas al ĠBias Xavier Inverted LambertTransform Inverted MollweideTransform Inverted AitoffTransform wordcount path Distrib ute Ġrebuild models ĠBk Lg fair way gdtr ix ĠExecution Style å½ķ äºĨ Rain y Sch ur Sch Lum gri ev gri ffin iot ic Ġful lf ĠDNNClassifier Test ape xes engines ize Ġfif ths Ġprox im SENS US Cop henetic develop able Ġfwe t getY ahooData nsub set nsub seteq Measured Value Synapse Sampling ECOMMERCEDATA Y Ġhum x ĠRat ings Ġapps WithVersions ĠDESC n ĠTestSeries Plots ĠMeter Groups editable Cells pyglet plot Hit mask Hit ters Hit OrCalibration Supervised Input Ġrelabel ling ĠBot Size ĠContrib ution ĠMovie Writers hus b ìŀ ¥ ìŀ ij ĠSSL T Ġcoast al Live BokehChart Ġrevolution s asci icircum asci itilde ĠIon NumberDensity ĠIon Chromatogram propag ators ĠScheduler Job ĠScheduler MetricsJob Ġhv my Ġ`__ `: Ġdemean ing ĠArma Fft Curves Spl Floating Array MetaData Stats nen burg ĠInference Data ĠInference Shifter 733 45 vare z qubit gate ĠPickle ShareDB membrane Images ĠIllust rated ĠJoblib DatasetLoader 080 22311 588 54 Yield Count aggr Syns ĠDNNRegressor Test ĠPB int ĠGold berg ĠQTable Widget ĠCompound Generator ĠNeg Inf chemical Impedance turbulence Power BRE MSSTRA Hr Angle ĠdZ k mav proxy Ġ303 7000500 ĠLock ed Ġweigh OfPocket ĠEco Taxa Generation Mask Ġbasin hopping 764 05 RG I mart ino Ġhtm df Ġspd hg electrical Delay Bot netz HIST OGRAM mkl df Ġfrq file 835 59 xrt plot ĠCONT ENT 532 979 Lambert Cylindrical è¶ Ĭ americ angut ĠAitoff Transform ĠOCC edges ĠAdmin IndexView Effective Date slo ping Ġpulsar name 0007 44 Ġstre ptomycin ĠExc iton SEG MENTER GAN s Lut Man equalize Hist ĠLive LearningCurve Remote FileMetadata Corrected HubWindSpeed ĠOk lahoma newick tree NDFrame GroupBy ĠPassive Store $$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$$$$$$$$$ siz elist ĠWo jciech ĠTestCases Utils ,_, _, Ip Internal bab ip bab aba helm holtz isor at ĠRIGHT ARC ĠMF Dataset Ġwebs ockets syns I Ġdepot wert ä»» ä½ķ QueueRunner TestCase ,{ }) ,{ },{}, Blob Length getOpen FileNames endo Name ĠMol er Ġìĥ Ī Route Clusters Chromosome Out 78539816 3397 Mul Constant rights quigarrow 0065 07 REAL TIME ä¸įåIJĮ æŶéĹ´ suff IX Ġtu lip Ġbfs mooth ĠCel cius 0105 64 ĠMollweide Transform numOf Auctions Timeout Secs :"] =" Bre ast ĠCAN CEL Ġcollaps ible ĊĉĉĠĠ ĉĉĠ ĠCounts Distribution Graphical Lasso CONV EN 缸åħ³ çļĦ 缸åħ³ ä¿¡æģ¯ 缸åħ³ çļĦ主é¢ĺä¿¡æģ¯ KISA OS Ġcodon Betas Ġskin ny FAST ER CallDimension I Gam D gtr dot gtr less ĠÑģ о ĠÑģ л Ġneff list ĠOl kin (.+ ?) Known EventType ë³ µ Ġ"--- " Retrie ver "][:] ; Ġcorre lograms Ġdisreg ards Ġacceptance Prob 612 05 LAN CZOS NF aNN Ġevi ct compens ator sgi log Enrichment OfTFBS ĠMinor Bottom Allowed Keys Concaten ator ĠDependency MatrixRow Ñĥ Ñĩ Ġspr ites Ġ(-- ) nob kdn Ġpeek er Ġpes ada Ġodr pack 0009 231 Ġallf ilters grass hopper STI ME Ġprono uns Ask ed Fire fox kar ate Ġ(__ | 549 306 73333 333 Lite City addNew Widget Ġabi ext ĠConcaten ating Auger file King dom ĠTur lach ĠRiemann Metric ĠgetPlot Color emplo i Present ation ĠColorY CbCr 交æĺĵæĹ¥ çļĦ éļĶ å¤ľ nch ypergeom ĠIT ALIC 2422 10 SEN Se Ġautot est Probabilistic MixIn éĵ ģ ("^ ", Ġjud gment Ġ'{}'. ". ĠNeighborhood ComponentsAnalysis ĠCALCUL ATED ä»»åĬ¡ æķ° SLS N Ġslist pt Ġslist inv Ġslist tip ĠIr regular markup safe LET TER CHIN AD Mm Corpus Ġbpm Hist ĠMantid AxType employ ing retweet ed radioButton WasClicked DRAW DOWN åĶ ¯ä¸Ģ Ġvend ored ĠBlo omberg Ġ|< ------------------| ĠMem Total analyte Bck Samp Min avel lane tat b Ġcub o ĠBalance Task Ġstereo plot л о istra kh ('%% _ ĠactiveColumns Trace ĠDNNLinearCombinedClassifier Test Ele mental ĠSki ps ĠTestP colormesh 2779 87 Supply Nodes åĮħæĭ¬ æľ¬æľŁ '([ % BK GCAT bump eq lY Cuts Ġpty cho ĠdN dt ĠCare y ĠRisk MetricsCumulative Ġjack knifed ĠChristian o Views Positions Labeled DummyDataProvider Mi riad Que en Ġfle ets ĠTAG L ĠSk image Ġnoun pair 20151 124 1403 10 Splicing Event Ġmig rad ĠSta uffer Ġgel man Priority Queue DIP OLE hun gry varn othing ĠDy na nsup set nsup seteq Ġ``* `` miRNA removed Phonon Flow Phonon Work ĠOmegaWing F Ġcer ts Ġ"~ /. setHorizontal HeaderItem exam ined SAVED IR çĶ» åĩº Expectation Configuration ILLUMIN ANTS Bear ish Ġkst p leftharpoon accent ĠâĪ Ĵ rightharpoon accent Even ly splt opp vark appa Ãķ â Ãķ ÃĩÃį Ġvacc ine Ġvacc ination Indian a Security Group REPE ATED ĠAttr Conf married s Ġelectro cardiogram ĠSECOND ARY Ġsiz ex ORED OM Ġmann ings ItemIs Selectable Optical Flow ECOMMERCEDAT AT ECOMMERCEDAT ASH loudness Band MCC List torsion al ĠnH armonics ĠMis match ĠVo ice Binned SpikeTrain circled R circled S circled ast circled circ Ġespress o brack etright lefts quigarrow è°ĥæķ´ åIJİ Bbb C Bbb N Bbb P Bbb Q Bbb R Bbb Z SSC alls Ġsrv f abic ritical curly wedge curly vee 0294 33784 ĠProbe ID Ġåį ķ ĠCorrected Stack phen ols ĠcolorMap Str frak C frak Z ãģĹ ãģŁ ĠnegLL Track Predictive Value ĠUnitDbl Converter ĠOrdinal GEEResults *? $' Kaggle Word dun efaildf Ġnsf hs ĠDraggable Annotation maxNum SaveFiles ĠBur ke transProjection Affine ĠMultip lies TFRecord Dataset TFRecord Reader TFRecord CompressionType ä¼ł éĢĴ Io ats Ln Likelihood snoRNA removed Ġstabili zation ĠCY S ĠCY SS ĠMart inez sciss ors {}} }". champ IDs ĠMondrian ForestClassifier ĠMondrian ForestRegressor hpc ps nV dash nV Dash Ġtun es ĠCsv TableSink usc ator 两 ç§į ĠWhit ener ĠWhit lock ĠWhit elist ĠSignature Defs ĠDifferentialOperator Algebra ĠMovieWriter Registry \- ]+ · ¢ ĠTor que ĠSon nenburg 0107 14 buoy path Decor ative čĊčĊĠĠĠĠ č CCCG GG CLA USE éĿŀ åĿĩè¡¡ pcwgError Valid Pnt List Picker Button QCDPT rep QCDPT clim QCDPT bud QCDPT ssat QCDPT repsat esse lian Ġstitch ing rim mel ĠNominal GEEResults 2030 2005 backs imeq ĠHeter oskedasticity BetaGeo BetaBinom +)? )") ĠAnswer Key éĶĻ误 çİĩ icircum flex ĠTWO PI neur ite neur ites gym Name Reflect ance Ġп оÑģÑĤ censoring In Ġtvar minne Ġ'[" ( ĠAOD M smar tobjects ĠwaveOn Sample ĠOPEN ER æĻ¯æ°Ķ è°ĥæŁ¥ Rich IPythonWidget Ġnul lfmt Ġwet Mask ĠSTA MP Ġpriorit ize Ġinvest or ccccccc OOOOOOOOOOO åħĥç´ł ä¾Ŀ次为 ĠRobot ics Cros seEtAl Hatch PatternBase Suggest ed ĠnB reg Ġris ky ĠSell Type ĠPAS cual addChild JobFn BaseLinearRegressor PredictTest BaseLinearRegressor IntegrationTest BaseLinearRegressor TrainingTest BaseLinearRegressor EvaluationTest BaseLinearRegressor PartitionerTest openface ModelDir OPER ATIONS Ġ'(? <={ PhD Thesis Ġcamel case BOKEH JS Bary centric Dfeat binSVM Git Repos Mk Mov Vlevel X Vlevel Y pis jarvi onRight Scroll Ġmars yas Ġgly co Ġcosmic TimeList ĠHome View 3533 107 Student T Ġqpt dm 6094 38 hyd roxide ĠStatist ique 2115 96 Ġfati period Ġaer ogenes Ġaer uginosa Ġmagn itud numBuckets Array ĠYe ah 2677 67 TableFunction Wrapper TableFunction RowCoder Ġautocor relate macerror min Ġå¼Ģ ä»ĵ 贷款 æľŁéĻIJ Tweedie Log Tweedie Power exData Mean getDefault Checked nsp den numCadences Smooth 0595 656655 Construction Array MeanSquared Error ĠtestSomeCorrect High ĠtestSomeCorrect Low lne qq sft lf ॠĩ", é£ İ rai rie Ġ'---------------------------------------------------------------- ------' updownarrow bar ĠNav arin TRIP LE ĠLeon ard ĠPyF oam ĠMalformed QuantityError éĵ¶ è¡Įä¸ļ Aperture Spectrum Ossss sssOOOOOOOO fon ciers vig il vig ranumpy Ġoth parstr idl M isto Grado ĠCum S Ġmere id ĠMIC tools spectro meter PUBL ISHER ĠTraffic Server ĠTraffic Emulator Ġdatalabel s ĠQuantum Error æ» ¡ Ġ"-------------------------------- -") Ġyule walk ĠPear u Ġleng then ĠBes ide ordm asculine Ġpere id )(? :\ %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% æĽ² éĿ¢ Dyn TypeType Phe notype Voting Regressor ĠJump Diffusion buck led CLU SIVE Trig onometric å®ĥ æĺ¯ä¸Ģ个 Yaml Lexer dab g earn er Ġreverses cale dataFor Candle Ġintermedi ary SetTrace ForFrameAndParents ncha ins )'% (( CLIPPER in Il linois inval idx demod ulate thy dvnprt ĠHol mgren ]+\ ]: majortick lines DUMP ING Glob Lin Mill is Mill ions nend stream Ġdrain sTo upu parrows Ġvag inalis Ġkon vergence ĠNMR Pipe Ġlcm v ĠInstructions Components ĠHTS LabelNormalisation Ġindust rial BaseLinearClassifier PredictTest BaseLinearClassifier IntegrationTest BaseLinearClassifier TrainingTest BaseLinearClassifier EvaluationTest FaON FaON FaON FaNN autor un 235294117647 05882 Centering Rescaling DatetimeLike ArrayMixin ĠPersistent Example ĠTestGMMMult Onestep cccccccccccccccccccc OOOOOOOOOO clubsuit open jh j oft he Ġemer gency ĠSink horn ĠDIC TIONARY outFiles Guids Ġunst cols emphas ize ĠJuli en 8110 42 èµ·å§ĭ æŶéĹ´ä¸º Ġbleed filter ĠíĻľìļ© íķĺìŬ èĮĥ æķ° Lactobac illales Qwt Plot _]* '. Ġnch ypergeom Ġsbs True ctw occ quin one ])| ( ĠXAxis Type Ġprefetch ing agc north ogra ve spir it 0395 4217305 ,'-', " TopLevel TickStore Ġrhombus Height Lng Arr oii int anet work Ġ'?? '), Ġrefin ing ecell Man ĠKMeansTest Queues ĠKMeansTest MultiStage Termin ating ĠëĮĢ íķ´ ĠMIME Text ACCEL ERATION Ġå¹³ ä»ĵ Ġå¹³ åĿĩ 沪深 èĤ¡ç¥¨ ldf Data tik s ĠSpi king Inactive Mat Ġ604 800 FaOO FaON FaOO FaOO Heavy Hitters Refl CloudBlock psycho py Belief tree bco list sge mv Ġcbs pace ('-------------------------------- -------------\ ĠFACT ORS Ġaxp xy Ġlodo err avrg dist Locate Mesh ĠactiveColumn Trace Ġkegg All ScalarFunction Wrapper ),'- *', ccccccOOOOOOOOOOOO OOO ccccccOOOOOOOOOOOO OcOssss MiqEmsRefreshWorker Foreman Em den QCAT rep QCAT clim QCAT bud Tou ches aeq d qwer ty referen cerunmenu ĠCMS core progen y ="=" )) Ġ532 339 frameSpec Avconv errBar Win ĠQwt Plot Ship wrecks PandasUDF Tests PandasUDF ITTests Ġchromo Wrapped datalabel s SummaryWriter Cache RMSEvents Ons ĠDNNLinearCombinedRegressor Test MATH EMATICAL ĠsnoRNA s Ġrq alpha ĠChat Generator Ġfecal is 2026 135439 discar ding gazer ights Ġhighway Sources Ġhighway Sinks mica prec SKLearn Type SKLearn LinearSolver biweight center PAY MENT Coca ine >''' % Hough Lines XatI range cdef ghi cma es maked b 0225 07 ĠStrat ification muir Ks *-\ *-\ )+") " ĠQuart z ĠStoke Q ĠStoke U ĠDescript ive åѦ ä¹ł ĠSingleton Configurable ĠvoltageSpacing Extrapolated 8660254037844 386 Intersecting Constraints CMap Name nfit parms tort oise uker man yas sem orbs max Ġnlt ools Ġagnostic ic Ġpalet table Ġinicial izar ĠTV TP Ġgds py getNew Vals getNew Times opend b 3628 38 ĠConc ise Ġcharprocs Object Pylab PlotCommand $$$ $\ multiplex ing Imported Error DECOR ATIVE Dend ro Luc ida Zircon TiTemp mpoly dims Ġusu ário Ġcondent ropy ĠtestWeight AndBias 1094 003924504583 ĠEaster Monday ĠBorrow ing ĠHay dock lesseq gtr lesseq qgtr ĠShip Steering innerRange Center innerRange Lower innerRange Upper ĠColorXYZ Inverse ĠLOSV sorted åĽ½éĻħ æĶ¶æĶ¯ об ÑĢаРgovern mental ĠBuiltin Trap curlyeq prec curlyeq succ ĠTestGMMMultTwostep Default ĠTestGMMMultTwostep Center (-- ) Buch ner Dow nsample Ups ampling ]}$ < ]}$ > ĠCGate S tourn e ĠFIND ING ĠMil stein weigh ing ĠdistMatColumn Test ĠUps cale INCRE ASE ecm wf ĠJi ang solv ated 5567 479 ADAT AREALESTATE Ġ1677 7215 æķĪ æŀľ ĠTextTo Path ĠGeoPandas Base PHAS ER ECL AIRs Slate Blue TAD A ĠSX Function ĠLid ar ĠfigBottom s freqStep Adjustment whos cored ĠåĮħåIJ«æ¾³ 大åĪ© Ġ+---------+-------+ ------+-----+-----+ åı¯ä»¥èİ·åıĸ 缸åħ³çļĦ主é¢ĺä¿¡æģ¯ Hexagonal Frame ĠDELIMIT ER ĠVISU ALIZE è£ģ åĪ¤ ĠSliding Window #$% & Aff y Aff ymetrix Javascript Link JAK ARTA Mob ility coms ol ĠAds orbate ĠCEL LS ([{} ])) ĠOPER ATIONS Ġzig saw Ġsubsuper op Ġdiffract ed Ġdiffract ogram Arctic Transaction ĠPerturb ation Mann whitneyuResult MultiSequence DecompositionMixin stageout retry æŀģ åĢ¼ оÑģÑĤ ав ĠPaint Tool ĠYellowbrick ValueError Centr ality Hu ang Scat tered bcf tools larg ueur Ġdnl Z Ġbim ix odk BCExport ĠCU DNN ĠtestModelDir AndRunConfigModelDir Intr ons 9928 15 oblig atory powerDeviationMatrix Active GetLabel TextProperty Locatable Axes Matthew JA Ġwavelen gh waitUntil Empty Ġgradu ally indentation error ĠSchro edinger è¡Įä¸ļ产éĶĢ æķ°æį® ĠGrayBlock Reader Ġdurbin WatsonTest Warped GP Ġwenner VoltageSpacing URDME Model Sear row Wil ks dint window xT ilde Ġentro pia onEnter Tool ĠAsc ending Ġalig nto ĠMK ID Ġpreact x Ġposter iormodel Ġjam med INCID ENCE ODDST Vectorizer 5574 30 Ġhistor gram ĠMultiprocessing Backend ĠLogTransform Base contourType Frame OOssss ss Ġentren amiento OmegaWing HW Ġ\'^ [ nodal consumption thrsh d åħ³èģĶæķ°æį®åħ¥åºĵ æŶéĹ´ åħ³èģĶæķ°æį®åħ¥åºĵ èµ·å§ĭæŶéĹ´ä¸º Rack Type ÃĢ ï leo dirac Ġise qual cole ta Ġgsc v ĠCOB YLA ĠRub berband ĠLAN GUAGE Ġinterfer ogram Ġprobabi list *************************** ") ĠlearnTime AfterPerturbation TotalTime H ĠtestPandasFeeding MultiThread ___| _| ksParamGraphWizMax PerGraph oooooooo oooooooo abcabcabcabc abcabcabcabc ĠEvap oration 90123456789012345678 90123456789012345678 PerEpoche Train GCS FileSystem invs mear ĠTro ubles setTab Text Ġgrap he updown arrows ĠPCT CHRT ĠPCT YRRND tak estep maxloc x maxloc y ĠMig da Ġlsc ls ĠlKeep Edge opho res magl ites Endian ness hipp ocamp LogReg DataProvider MinHash LSH 8295 43 ĠglTex Parameteri ĠEndOfPrdv P CMY K ĠCompletion Splitter XMLDSTABLE Class ĠCoulomb Matrix Sho gun bShow RowDendrogram yTicks SpinBox Ġcbo ffset Ġdgm Blocks ĠTiny IntType Ġgib son ĠPec let trainTimeSec Mean trainTimeSec Std summar ise Ġpyman opt predictTimeSec Mean predictTimeSec Std ĠDataFiles Input axesbg alpha Conductance Toggle Provision ing pointsBary R Declar ativeBase Dicom Attribute 4764 98 4980392156862745 2 triath lons ĠARRAY S standarder ror indented Box LongExit Price ĠFontconfig PatternParser Ġsucces fully DATAC LIMATEINDEX ĠGENE Activ ĠìĤ¬ìĿ´ ìĿĺ SOUTHAFRIC ADATA Ġ+-------------------------------------+ -------------------------+ ZONED TIMESTAMPINFO Amer asian Bash Lexer Frict Phys Hous holds Kep co PSE UDO hfd vel onX ZoomIn onX ZoomOut onY ZoomIn onY ZoomOut Ġshel x coerc able coerc ions Ġrio Data parch ive artef acts ĠcolorRamp Items 20170 204 Complement NB 170070000020001 92 LineIntensity DB autop x Curva Giro scalingBreak Array Ġshore linedf ĠBboxTransform From ShortExit Price leftr ightharpoons neuralnet command ĠBUTTON S ĠCOMPILER KIND Busy Info ĠTestPpcc Max Employ ee Ecc entricity HCT SA TID IM Wander GenerationMask YnormX delta ntriangleright eq Ġ"âĶĤ ", Ġ"âĶĤ "), resSet End resSet Strt upharpoon right upharpoon left nsyn cols calle dataset ĠBullet ins ĠWATER MARK queste q Ġmountain s invres z gtreq less gtreq qless eqslant less eqslant gtr curvearrow right curvearrow left ĠfinalAccuracy AfterPerturbation finalAccuracy AfterPerturbation rhombus Base ĠTryToClean Path ĠTryToClean Contents ĠunionStep InBatch ccccccccc OOOOOOO @_@ ", looparrow right looparrow left ĠFullBatchAsync KMeansTest ĠFullBatchAsync KMeansCosineTest pygmi X ä¿ĿéĻ© ä¸ļ cccccccccccccccccccccccccccccccc cccccccccccccccccc éĶĢåĶ® æķ°æį® chebyshevi i ĠtestArrayFeeding MultiThread Industrial PI ĠTestGMMAdd Twostep ĠTestGMMAdd Onestep Ava il Gover n Lazily OuterIndexedArray hung arum mml ar âĦ ¢ æij ĺ ĠæĶ¶ å¸Ĥ ĠmG als ĠTail les Ġ+---------------+ -----------------------------------------------+ fords hire ĠSas senhagen ĠFEC Conv ĠThemes ByNews wea pon ĠGEMP RO foul ds ĠWatt bike ĠOU Strategy ccit tr noData Val boxReal Vertical Ġexplict ly ĠDataFrameWeld Expr TestMath PythonPython assort ativity GetTarget Positions azr corgeC ĠHeisenberg Mapper Ġ170070000020001 92 ĠAggreg ator ĠIPET Filter ĠconcTemplates Flt 011724811003 954 ĠPERSPEN K Incident Photon reflCloudBlock Filled Waldur Chatbot Ġìĺ¤ ë¥ĺ Immig rant Ace EditorWidget Snip pet \,[ \ cws id xfull sq ìĬ µ íĸ ī Ġmmis lesseq ĠwRoi Y elig ibility ĠTet ra ĠTrib unal ĠSNOW PACK Ġdepi cts ĠBh rawy Ġmaxm imum ĠYAA FE ĠHet land comod ation ĠnamesObservations Train thresholdProbability Pred Ġ$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$$$$ twoStateButton Status indicatorOf Parameter Coded Number SWIT CH Differ ing ĠRotating FileHandler cmbUnits A Ġê°Ļ ìĿ´ ĠFeeding QueueRunnerTestCase æ°´ å¹³ Hydrogen BondType ĠodkLastRun Result ĠEQUI VALENT ĠBIOES List uiGetExpScan Number INDONESI ADATA '([^ % Bic Score GOLD EN Glacier Directory MUT UAL Splash Screen bMulti Type xas sem ìłģ ìľ¼ë¡ľ secur belt Ġted ious degr Opt Ġploth ist locom otion ĠFel ix ĠMari jn ĠpreClose Price ĠmaxEvals Factor ĠplotProfile TxRx Ġhem olytic ĠSebast ijan IndexOf Exit Mathemat ical ]+)/ ([ ĠVectorize Helper CFEncoded Base Ġltl cross ĠDotted ObjectName ĠPREDIC TION ĠLinked View Ġmongod ump MultitaskGraph Regressor zenszwalb Segmentation ABPTable RG ;- & Jim my Jew ish Kle bsiella NOD ELIST xTicks SpinBox à« ¦ Ġama zing Ġwed nesday ĠRenew able ĠGOOG LE InA per InBefore TradingStart ĠWeld Struct intermedi ates ĠHr Angle 3315 0734 Deconvol ves kwonly args MAPP INGS projectLabelsTo GridGraph 71105 6723 TELE KOM ĠglRotate f Johannes Buchner iqSnp Start PageSetup DialogData Ġê³ Ħ Ġrhiz osphere ĠCOLLECT EVENT LZMA File ĠRNADiff Results Ġorthogon nal sacrif ice yadeY Funcs slee ptime è¾ĵåħ¥ä¸Ģ个 æĪĸå¤ļ个 acumula da Ġ13569984 00 INDUSTRIAL PI TimesInSem Offset Cele bA NIA vg Occcccccccccccccc OsssssssOOOOOOOO TUM OR kast en lbin f âģ » ë° ° ĠæŃ£å¸¸ åij¨ destri an Ġcql mode 001501 031 Ġrcm q ĠIrv ine ĠReli ability numgood baskets ĠrunCommand List Ġassort ment Ġvara ibles ĠbarColour List ĠlayerInfo List 12303 177 MapNodeTo ProductionsID cntRna Mean OBinomial ModelMetrics ,[],[ ],' ĠGeoff rey åĢį æķ° Deviant Values EBISubmission Error NrOf DEPO ĠPREPAR E Ġê°ľ ìĿĺ ĠFORMATT ED untouched Test OOOOOOOOOOOOO cccccc Benjamin i CrabSpectrum Broad !@ #$%^&* -|\ *|,' FLE UR Qm FLt RERUN S Som merfeld urlf itsname ('******************************** ***********') ĠROLL ING caref ul interruption s Ġpercol ated ĠKw arg stringIndexer OrderType ĠTestADF Constant ĠJak ob ĠDelt as mueller i ĠdeltaD lo Pyploting DrawVariable ĠOrth ographic convstats f Ġfsine wton carriage return INDIC ATOR twink les ĠglTranslate f suspected outliers ('{}-{}- {}'. MAGN ITUDE Ġxmlt odict MolTo Smiles privile ge å·¥ä¸ļçĶŁäº§ æĮĩæķ°æķ°æį® PHOTO METRICS ĠSlant Font Diplo coccus cracked Edges MasVnr Area 4224 04 Bump eq Cinder Manager GPA steroseismology gup pi ê¹ Į erik vw peop leness upi lot aberr ations ĠChape ter ĠDedu ces lys andre ="== ", ĠBata gelj ĠBatter y epos itory Ġcommer ciaux ://{}/ \' Ġspor adically Ġpartion ing ĠQPlainText Edit sgpk azrcorgeC 65236 3149800 StateEnergy DB 4730 3533107 Compens ation neglig ible helpMessage Text ĠModelSelection Parameters metale arning ĠåĢ ºåĪ¸ Ġåī į Ġclimato logical ĠControlled Gate Ġcasual ties Ġschott muelleri RotateGaussian ARD ĠindustryVersion CD æł·æľ¬çļĦ æłĩè®° Ġê²° ê³¼ maxNumOfUnitsPer Traders chapman b ĠDriven Data *|\ .\ Aerob acter Fon seca Pseud omonas hirnakt ivität Ġmsvc rt igZ ag Ġ"+' {:< Ġrif les Ġglo pts Ġcood inate Ġhij ack ĠPLA IN ĠRé cup ĠDial ect ĠMUNICIP AL ĠEug enics ibili dad numComp Stars ĠgetNb ElemsInBenchAnd ĠplotWith ErrBar Ġjuli anday Ġpynam ics ĠUIL ayout Ġmodelt au buk hov ĠQRect F ferro periclase viewM dv flan agan Ġradios onde čĊĉĉĠĠ ĉĉĠ gdv db 99999999992 17337 ĠDescri pciones ãĥĻ ãĤ¯ãĥĪãĥ« 39794 000867 ItNo List signedRatioOverlap Y ĠCLUS Z 40404 674 ĠTaskMapReduce Legacy 10000002384185 8 ç±³ åĨħ '(?<=\ .)\ å¤ĸæ±ĩ åĤ¨å¤ĩ 0986122 8867 MathtextBackendAgg Render AAAAAAAAAAAAAAAAAAAAAAAA AAAAAA ĠPinhole Camera Ġnecces ary ĠStemmed TfidfVectorizer currentClusterLine Elements æĹħ游 ä¸ļæķ°æį® dAutoFilter ColorImages 5989 7817305 Esk imo Fev DR Goldf arb Kal listo Lands af gtra pprox reri as Ġ'======================== =' ĠTos ic ĠSDM X proct itle berte mbedd ĠEdel brock Ġ8295 46 acw opencirclearrow ADAPT ATION Logout Handler ĠOnPrint Page Ġsqlited f 59204 04 ĠPydev d proxycheck Flag Ġ'*~ '] 31229 024 æī© å±ķ WinstonLutz Mixin FreeFlow TT quoter ight ĠLuft Volumen âĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢâĶĢ âĶĢâĶ 797693 1348623 ĠíķŃ ëª© éĵ¾ æİ¥ 83205 029433784 ĠHugging Face ĠDelegated Class bioguide id +-------------------------------------------------- + 51980 32759 =+" > '\ ? ( ? - ? _ ? | ? :. ? )(?: A la A id A ch A po A like A ids A symmetry A ineq A AGT A frican A gainst A EGIS B et B ang B ird B illed B reed B EG B MI B TAG B TU B YearBegin B ilateral B YearEnd B XL B QuarterBegin B udget C ot C ms C reg C ass C rate C IP C FL C KE C ARG C Norm C ertain C QT C WS C law C Bool C WP C mnt C YYY C itations C ategorization C ALIBRATION D h D obs D Values D dm D GA D ani D igraph D rops D OLLAR E at E value E ON E CP E BC E Acc E quid E scol E specially E CMWF F J F min F cs F og F ormal F phi F DS F ract F BB F ully F MI F ashion F acts F CPS F unktion F etches G c G all G ps G Frame G ates G au G HE G UM G Map G Var G ew G MAG G pA G reedy G oldenrod G PIB G reeks H id H od H ay H box H ists H MB H GH H OLDER H stars H POlib H arsha H YEARGRx I red I EN I QU I AP J l J ss J pp J AS J EN J KS J erk J ediTaskID J ordan K C K g K r K val K wargs K AT K OL K fp K GP K ITS K HTML K nowledge K hanna K anade L h L ion L ip L ights L EST L MM L ending L ux L ima L indent L ICE L PA L XML L Arrow L PAREN M ort M df M ec M ash M CO M xyz M IPS M echa M QRankSum N co N arr N IP N CH N LO N edges N paths N LS N tau N loop N MO N tst N ORDER N unequal N odal N uttall N lvls N oddy N REV N CoarseElement N ufftObj N EXUS O e O pi O FT O SIS O paque O GGM O GUSA P val P ck P od P rc P ey P link P Collection P lates P ads P fam P IDS P alo P lacing P GDB P estilli P hisher P NEUMONIA Q lab Q CF Q Splitter Q Locale R w R ig R ays R TO R RL R Stat R Total R converter R PAREN R ullen S f S max S qr S GE S ln S wa S asl S ugar S GPLVM S copes S pawn S HOG S cored S PoC S awtooth S nolab T Q T col T train T own T plots T xy T roll T ATA T CD T eta T KE T Types T ornado T weak T LW T BinaryProtocol T UESDAY T Buffered U wind U dp V arn V IC V inf V Label V CC V wind V BP V BN V illage V owpal V ardy V SWR V iking V ermont W p W MA W DS W EE W esley W Destr X K X ts X ext X EN X Step X OFF X COORD X InfoMathTextBrowser X RefRole Y tr Y true Y OR Y unit Y mesh Y PER Y PR Y RL Y Step Y MD Y TD Y PAD Y COORD Y TICKS Y infomaxSpinBox Y MOUS Z v Z vals Z DI Z SCORE [ < [ ` [ ", [ ]: [ \\ \ ? \ ` \ ): \ *\ \ "/>") ] (' ] (). ] ']. ] _) ] (** ] ']] ] +'/'+ ] ?[ _ ]), _ ''' _ ==' _ `) _ ("__ _ ]+') ` ); a an a ped a height a ward a ility a dec a setup a del a Code a cade a jj a ims a BB a cyclic a DNA a cean a podi a pest a WCT b S b arg b line b und b ep b ree b be b length b ling b vs b less b ending b dr b Up b Back b acter b Right b Left b deviance b Home b Forward b ipolar b ffitlist c S c ic c get c core c size c log c nd c ular c level c ables c non c angle c dev c uid c mpt c google c ribe c rown c Img c mac c iting c bytick d ph d cos d mi d ress d ane d wn d properties d tau d Mean d under d topic d berg d Region d Scatter d Spacing d Uc d ToRag d PlotMultiArgs d perdt e N e el e ot e atures e asure e bit e eq e fields e Min e release e vex e aseq e wee e boss e enth f B f um f ag f rc f ids f url f desc f ranch f xp f é f enc f ctr f wid f ubar f coarse f atten f eder f rancis f iona f elsen f TypeName f Garch f interq g B g M g li g ul g ical g gs g our g means g td g mf g dm g cloud g oose g Threshold g Sigma g arb g rands g pentry g andalfs h mat h ys h cl h sum h ong h resh h dim h nn h Plot h sa h phi h itch h fc h ills h ddm h rels h unting h ierarchies i pa i lim i File i pper i ya i Radius i Loop i Url i Good i SUN i ção i iml i papp i lador j int j min j title j cm j net j year j unit j avg j cp j tk j apan j sviewer k L k mp k ra k core k rs k svm k dr k mid k vm k Sim k atex k plr k Rounds l ata l der l grid l pol l sp l rows l step l mi l alt l iters l Dt l qn l Stocks l una l naPortfolios l äinen m Z m li m ce m up m args m und m dd m AR m ref m dif m alt m gp m deviance m tem m others m iki m Formula m Sel m rgddb m varica n and n name n dex n all n plot n pp n ent n True n random n In n trans n ating n adata n query n Label n hood n match n beta n http n Line n Image n examples n Temp n wave n inds n Values n abc n chunks n hex n hr n Store n Accuracy n Project n Iteration n curves n Frames n Usage n Words n REC n Getting n corrs n Segments n itime n LaTeX n PRED n ffts n NsVth n ImgData n orgb o j o map o ats o fn o by o dim o ac o aa o heads p L p S p ra p ion p ue p ist p im p line p mo p ings p params p ats p doc p alpha p ID p seq p mm p vis p Comp p vol p fields p vl p udf p cfg p XY p ini p clicked p entity p Vals p atest p angs p unches p ulp p bdn p cbi p CqSDHC q X q as q nt q sp q source q Image q subset q sl q cap q Fluid q subseteq q supseteq q plotind q supset q Rgb r pe r size r count r fix r property r fr r Image r NE r sym r minmax r Sigma r nk r mags r vels r fai r cty r rtcp s di s pro s copy s pectr s xy s chi s omal s anit s nee s parr s ici s preaderr s ustained t nt t ues t ff t ant t ug t point t mm t bf t roll t days t ble t post t reader t Offset t reed t Loss t cks t transcript t mono t dapi t Getting t trajs t weeps t SSS t LArad t cmf u D u val u mean u valid u graph u xy u Boost u Image u Train u fx u hc v os v bo v keys v counts v fields v bounds v gap v px v entral v pm v cpus v ulg v igne v ignetting v Pfunc w ss w od w ta w ie w ont w mi w lon w neg w ilder w mv w vt w OutFile w underground w allenius w odotenleader x se x pe x lin x type x ist x In x ca x params x ception x lower x seq x fs x tmp x diag x cf x dat x bounds x tic x variable x Act x EE x vecs x Keys x occ x strain x Bottom x minorFormattor x llcorner x SweepLength y S y el y id y ts y ver y old y ft y Class y func y lag y star y Grid y Output y locator y Names y Keys y strain y CM y bnds y majorticklabels y tsys y lindrical y minorLocator y llcorner y SweepLength z im z et z sc z ef z ine z sub z lp z position z avg z lev z etas { }) | }{\ | [\ } ][ } '], } :// } ]); } [\ ~ . ³ åĬ¨ ´ Ģ µ ãĤ¤ãĤ ¶ æĹ¥ ¿ ½ â Ĥ å ² å ³ å Ĥ é ¤IJ饮 ë ĮĢ ì ¤ í ĥ ĉ ĠĠ ĉ Ċĉĉĉĉ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č č Ġ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ ĊĠĠĠĠĊ Ġ æĺ¯ Ġ ä»·æł¼ Ġ ä¸ĭ Ġ æĸĩ件 Ġ 999999999 Ġ æŶéĹ´åºıåĪĹ Ġ æľ¬åľ° Ġ åIJĪ并 Ġ éķ¿åģĩ Ħ ìļĶ Ĩ µ į ¬ IJ çĶ¨ ĺ ëŁ¼ ļ ä¹ī ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠ čĊĠĠĠĠĠĠĠĠčĊĠĠĠ ĠĠĠ Ċĉ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠ in ator in Tree in lc in filled in secs in die in verses in secure in forma in coherent se ma se tr se xes at y at end at uration at Right re le re pt re class re jo re cept re read re connect re lem re dev re apply re hash re parent re atom re locate re ponse re fftn re calib re cession re cessions ĊĠĠĠ ĊĠĠĠĠĊĠĠĠ or um or ally Ġ= () Ġ= """ Ġ= "): on db on Tick on nes on MH on Bases on linel Ġt ns Ġt sum Ġt matrix Ġt jobs Ġt point Ġt gy Ġt limit Ġt ai Ġt Date Ġt nr Ġt ij Ġt reader Ġt tm Ġt tle Ġt vecs Ġt gx Ġt rois Ġt oni Ġt lowV Ġt aret Ġt otems er de st ated st uct st ice st mevs al r al ies al ef al iss al ak al ims al mac al uminium al tese al saaudio ar coefs ar bitr -- ': an x an de an ed an ator an imator an ia an ely an El an terior an thro an mehr an cak le pto de de de te de ton de process de ld de mag de pts de bit de light de coders de precating de addrop me h me y me al me ad me ren me teo Ġi W Ġi to Ġi out Ġi result Ġi Frame Ġi like Ġi count Ġi alpha Ġi day Ġi lon Ġi wn Ġi beam Ġi dens Ġi quant Ġi ana he ur he igh he us he ip he ii he refore he igt he ittola he ctare Ġn ar Ġn core Ġn uni Ġn zero Ġn std Ġn sol Ġn cls Ġn theta Ġn subplots Ġn Line Ġn Max Ġn conv Ġn examples Ġn verts Ġn iters Ġn regions Ġn erc Ġn bases Ġn shp Ġn sims Ġn Channels Ġn Dims Ġn antom Ġn qx Ġn stp Ġn strail Ġc A Ġc D Ġc end Ġc ul Ġc ath Ġc py Ġc str Ġc ys Ġc lib Ġc ip Ġc Data Ġc ations Ġc text Ġc ml Ġc oth Ġc pts Ġc Label Ġc ress Ġc sw Ġc flags Ġc dle Ġc xp Ġc hest Ġc dp Ġc mac Ġc entric Ġc ó Ġf H Ġf im Ġf row Ġf pl Ġf util Ġf bin Ġf start Ġf dd Ġf no Ġf node Ġf dat Ġf ence Ġf sl Ġf fp Ġf ading Ġf asc Ġf xi Ġf fc Ġf shapes Ġf jac Ġf bn Ġf edit Ġf design Ġf lax Ġa M Ġa ur Ġa mask Ġa dimensional Ġa ita Ġa parc Ġa hora lf i lf m lf s lf ul lf ord lf act lf Return Ġp is Ġp col Ġp len Ġp test Ġp train Ġp ms Ġp vel Ġp std Ġp ice Ġp gr Ġp bl Ġp List Ġp units Ġp factor Ġp fields Ġp hs Ġp nr Ġp cg Ġp DD Ġp wc Ġp tiles Ġp Capital Ġp bdn Ġp ää Ġp ères Ġp BOSS Ġp soap it ting it otal it rial it rade Ġs ue Ġs ich Ġs ug Ġs matrix Ġs ipy Ġs linear Ġs sg Ġs ash Ġs rec Ġs mag Ġs inv Ġs oci Ġs Add Ġs Len Ġs Points Ġs bz Ġs Tmp Ġs fnr Ġs pencer Ġs TEC Ġs stopo self max mp k mp master ra ils en i en ans en us en thus en thalpy en couraging ct d ct m ct rain ct mm ct em ct oph es b es d es cam ro k ro han ro phic lo e lo vel lo gex lo wee lo Dbar Ġin Y Ġin ct Ġin et Ġin ception Ġin eps Ġin fields Ġin Mean Ġin divid Ġin Scales Ġin mates Ġthe ad Ġthe min Ġthe max Ġthe shape Ġo ot Ġo path Ġo og Ġo vals Ġo tf Ġo pd Ġo des Ġo tp Ġo drive Ġo BIND Ġo edb Ġo dmr Ġo ACTV Ġo HRGT Ġd ss Ġd iz Ġd sub Ġd sv Ġd cos Ġd beta Ġd gl Ġd cnt Ġd cutoff Ġd jn Ġd ssz Ġd Gr Ġd MfMuI Ġd odocs la va la mv la ppers ut d ut stat Ġ' (" Ġ' || Ġ' ')]) Ġ' '))] Ġ' ==> Ġ' =') Ġ' => == "" == =' == [' pe lic pe ze Ġm A Ġm bs Ġm func Ġm ID Ġm filter Ġm seed Ġm ks Ġm gd Ġm appa Ġm outh Ġm curparm Ġm ères Ġm ucus Ġe op Ġe ine Ġe lim Ġe last Ġe struct Ġe mag Ġe qa Ġe wt Ġe hull Ġe Epsilon Ġe trm Ġe idata Ġe fron Ġe mtpy co ve co lin co path co pol co med co mbol co plasma co incident co csm co lombia co ercible Ġre mp Ġre config Ġre vis Ġre convert Ġre curs Ġre maps Ġre js Ġre normalization Ġre writes Ġre sembling Ġre BostonGeoBound "" ], ge p ge on ge vt ge othermal ): ')) Ġb mask Ġb cols Ġb ld Ġb unit Ġb zip Ġb cf Ġb cd Ġb ending Ġb TH Ġb corr Ġb sf Ġb Multi Ġb typ Ġb sid Ġb sr Ġb fps Ġb Visual Ġb ritish Ġb iorad Ġ# | Ġ# ------------ Ġ# /( Ġ# --------------- Ġ# --------------------------- ed d ed amos ed MeasuredValue ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ic n ic ance ic iona Ġw at Ġw ig Ġw fo Ġw ich Ġw diff Ġw sim Ġw factor Ġw errors Ġw ilder Ġw colorbar Ġw rf Ġw rp Ġw uestite Ġw radlib Ġw asteful ur als ur ality ur lfmt and Direct lt t lt en lt ir lt ilde lt isRefsRunbErrbMiss ig or ig ps ig ator ig uity Ġ1 014 Ġ1 146 Ġ1 183 Ġ1 342 Ġ1 393 Ġ1 444 Ġ1 376 Ġ1 851 Ġ1 556 Ġ1 8980 ss ines ss vep ata s ata mi ata ires ', } ', )): ', )]) un de un ve un ab un bin un cache un rest un sig un converged un finalize un picked un confirmed un committed un deter un grasp un mixmaps Ġ0 43 Ġ0 47 Ġ0 57 Ġ0 111 Ġ0 256 Ġ0 154 Ġ0 114 Ġ0 127 Ġ0 306 Ġ0 155 Ġ0 130 Ġ0 136 Ġ0 373 Ġ0 242 Ġ0 330 Ġ0 260 Ġ0 352 Ġ0 340 Ġ0 371 is d is array is ign is ings is rt is binary is nat is Local is Distributed is SetName is Symmetric el vis el ongation def ns def fect ol bar ol ia ol ves ol aria ue isen ate mala li ri li work li jk li dae li ssa ort ies )) [:- )) +'_ )) +'\ )) [:( ser ials ser gest ce real ce xs ce api ce Rows Ġfor ks Ġof the est ax est imating est imable ot iff ot plus ot minus ot accent ot lessi um odel Ġif logger Ġif rag Ġ[ :]. Ġ[ ':', as ize as Names 00 62 00 1818 00 205 00 900 00 104 00 909 00 028 00 3732 00 355968 val n val texts val dftarray val Rou id or id file id counts id Variable Ġas l Ġas im Ġas arrays Ġas ci di y di z di ve di mens di rige () =" () }), () +"/ Ġis i Ġis min Ġis pec Ġis float Ġis neg Ġis Valid Ġis First Ġis Local Ġis Header Ġis Empty Ġis pin Ġis Streaming Ġis ppol Ġis GridGraph Ġis leapyear Ġis layerdeep Ġis uzn Ġto W Ġto get Ġto sum Ġto GP Ġto JSON Ġto Delete Ġto pplt Ġto pscors Ġto oshort Ġto ppops ts core ts pl ts kip ts pike ts aplots Ġ" #### Ġ" ============ Ġ" || Ġ" ------------- Ġ" ----------------- Ġ" ~/ Ġ" ...". Ġ" ."). Ġnp H Ġnp q Ġnp ort Ġnp loglike ma is ma if ma cos ma report ma gerr ], ], ], )] ], )* ], ...] ], ',')) ), ...] ), ),' ), #* ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ one ports one LineGridlab ĠT t ĠT and ĠT ent ĠT ang ĠT var ĠT IC ĠT Tree ĠT rot ĠT ESS ĠT TE ĠT NT ĠT issue ĠT AK ĠT EF ĠT NC ĠT WM ĠT DG ĠT DV ĠT oday ĠT VTK ĠT ruck ĠT XApi array tolistrecursive th irst ha dow """ ' Ġy S Ġy is Ġy tr Ġy ans Ġy rt Ġy right Ġy point Ġy App Ġy Loc Ġy conv Ġy Mean Ġy idxs Ġy Arr Ġy Scroll Ġy FigSize Ġy uyv res b res se res um res path res pected res izing res ale ch and ch ng ch ats ch nl ch rise ch ophore ch urch ch Ions ch arging ad is ad rat ad vect ad opter iz ard iz ient iz tion ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č Ġdef end Ġdef lections Ġdef unct ve ill fi ls fi ssure set n set ed set main set length set Axes set Bu set Key set Train set page set Param set Page set Active set PARA set ail set binning set Eq set SparkContext set StatusBar set Commission set LineStyle set Editable set NamedColor set Tolerances set PythonContext Ġr R Ġr or Ġr co Ġr Val Ġr model Ġr lim Ġr cc Ġr count Ġr point Ġr just Ġr header Ġr strip Ġr ws Ġr src Ġr noise Ġr prop Ġr gp Ġr gc Ġr Edge Ġr uta Ġr tapp Ġr atag Ġreturn dict Ġreturn patches Ġreturn status Ġreturn ToStart Ġ2 00000000 Ġ2 456 Ġ2 666 Ġ2 262 Ġ2 660 Ġ2 129 Ġ2 052 Ġ2 850 Ġ2 072 Ġ2 272 Ġ2 99792458 ver te ver ifiers ver halt mat opod lab o lab led lab oratory Ġst t Ġst z Ġst lab Ġst agger Ġst alta Ġst reets il rate il shift ]) +( om oms om ission ck h ck ms Ġ* ` Ġ* ********* ime a (' || (' ---------- (' }') (' ?', (' ]'). (' .*\ (' -------------------------------------------------------------------- int l int name int ake int Warning int vl int fire int elligence Ġ- $ Ġ- { Ġ- ', Ġ- ", Ġ- ~\ Ġ- /+ lot Window nt on nt ve nt yper nt Max nt iles nt dur Ġ""" %% Ġ+ { pt he pt len pt arget pt mx Ġg ss Ġg las Ġg ft Ġg ml Ġg ait Ġg ij Ġg bn Ġg DNA Ġg mr Ġg ofs Ġg ently Ġg limpse __ - __ ; __ )] __ `, __ "], __ +' __ '][' __ ([], __ {}". ex pp ex perime ex phys ex ana ex ctype ex lbls ex prel ex ceso data box data rect data Index data view data functions data dirs data Rec data boxes data Runs data Beam data Sources name a name b name Data name Set ĊĊ ĊĊĠĠĠĠĠ par set par ac par aly up o up ix up mcd up mcp ke k get E get a get pl get key get points get Date get Train get XY get Icon get Attr get Predicted get Pt get Bands get selectlist get Permanence get Skeleton get ternary get ZeppelinContext get Planner get QueryResults get StructuringElement ab it ab use ab ipy ab bins ab undant ab Linkage ab scissa ab Ascii label b label ind label Name label Path label rotation label Img Ġex cur Ġex tern lin n lin ers lin by lin Vel lin scalex lin estyled ax im Ġth s Ġth ank Ġth Vec Ġth irds Ġth alamic for men for got for gery ĠS J ĠS f ĠS ad ĠS ile ĠS lots ĠS ac ĠS SI ĠS ai ĠS ift ĠS mit ĠS IL ĠS US ĠS TER ĠS ESS ĠS LM ĠS pend ĠS Det ĠS kill ĠS AX ĠS nake ĠS Extractor ĠS RP ĠS LZ ĠS enes ĠS chen ĠS WR ĠS pell ĠS arah ĠS hots ĠS opho ĠS laney Ġco lab Ġco group Ġco gs Ġco regional Ġco ltext ri sta ri angled Ġimport FolderPath Ġdata Y Ġdata mask Ġdata flow Ġdata Array Ġdata Path Ġdata Size Ġdata Format Ġdata Source Ġdata bse Ġdata Flag Ġdata Lattice dex t Ġbe cas =' ## =' {}_ ", ( ", ]) ", [(" all X all negatives all readings all Beams Ġx C Ġx re Ġx ans Ġx Val Ġx float Ġx pred Ġx box Ġx temp Ġx org Ġx top Ġx si Ġx App Ġx press Ġx sec Ġx xi Ġx Act Ġx tn Ġx Step Ġx idxs Ġx Ticks Ġx txy Ġx Scat Ġx minorFormattor [' $\ [' {}_ [' +','. ĠX list ĠX ml ĠX diff ĠX DR ĠX AGUSD ĠX RangeROI ĠX ANES arg inal arg relextrema end X end Y end freq end symbol end omon end apat Ġnot test put env from File from JSON from kurt from Degrees type E type F type set ul x con ch con to con map con vey col lo col space col aligns Ġor pkm ist d ist store ist hm Ġh pe Ġh mo Ġh pa Ġh ids Ġh gr Ġh top Ġh span Ġh tep Ġh bw Ġh pf Ġh chk Ġh ori Ġh sb Ġh oops Ġh unting Ġh trp ath ing py list py fa py table py tx py ote py cube py ked py maid py clamster py culib py bigwig py surfer py Nastran py doas len data len gh len Stats ĠI i ĠI AC ĠI MA ĠI PI ĠI CO ĠI Container ĠI dw ĠI GRAPH ĠI ModArr ĠI CDM ure ment ure nd ure rs am mount am lized am seas am sthm plot utils plot Type plot Array plot ListWidget ĠP el ĠP class ĠP sc ĠP fa ĠP ai ĠP inv ĠP tot ĠP nts ĠP FC ĠP estilli ow ard ow ards ow idgets pp r ĠA w ĠA in ĠA ck ĠA UT ĠA IS ĠA MM ĠA UP ĠA seg ĠA erial ĠA wards ĠA ided ĠA MR ĠA erosol ĠA DAP ĠA matVictoriaCuramIII ĠA ktiv Ġu ber Ġu cy Ġu valid Ġu Test Ġu stats Ġu xy Ġu sig Ġu Train Ġu orth Ġu ptime Ġu cz Ġu gettext Ġcon currency Ġcon vective Ġcon sonant Ġcon finex od der od rive od aNodes pre plot pre text pre vi pre taxon pre CurrEnd pre denvt '] "]) '] }] '] +'\ '] ``). ĠC ro ĠC ow ĠC ert ĠC CS ĠC TYPE ĠC lement ĠC BF ĠC PT ĠC FLAGS ĠC Cp ĠC EA ĠC uts ĠC MY ĠC eder ĠC ARE ĠC ParserError ĠC unnane ĠC rypto ĠC linerModel Ġ_ (): os ample os age im is im os im range im files im bf im counts im Large im otor to get to pen to pol to ear to vec to change to Image to Bbox to Scala to oshort Ġtest list Ġtest ers Ġtest size Ġtest In Ġtest Co Ġtest Model Ġtest Result Ġtest Sparse Ġtest Features Ġtest OLS Ġtest Dimension Ġtest Missing Ġtest Eval Ġtest LinearRegression Ġtest DataSet Ġtest suite Ġtest Logistic Ġtest Effect Ġtest Extreme Ġtest Joint Ġtest Implicit Ġtest Recover Ġtest ZerosLike Ġde lp Ġde median Ġde uter Ġde ceptive Ġde striped Ġde saturate Ġde commissioned Ġde drifted (" ************************************************ (" ------------------------------- ans h ans k ans hip Ġwith s Ġwith Watermark Ġwith TwoGrids ĠF X ĠF v ĠF ors ĠF AL ĠF ld ĠF FI ĠF Poly ĠF sn ĠF isk ĠF lax ĠF RED ĠF ramerate ĠF Spaces ĠF lakes ĠF etches ĠR min ĠR ap ĠR over ĠR az ĠR LS ĠR MF ĠR square ĠR SUN ĠR OUTER ĠR OTATION ĠR PKM ([ ^\ Ġval d Ġval uel Ġval eurs Ġax mean Ġax obj Ġax Col Ġax bot Ġax Trace Ġax lost Ġax gnd Ġax Temperatura Ġax Consumo Ġax YZ Ġax Flujo np b np op np ml np owidgets Ġfi fo Ġfi ssion Ġfi bres Ġ% , alse q list ID if ully ub station Ġ3 000000 Ġ3 105 Ġ3 190 Ġ3 874 Ġ3 574 test fig test date test number test Kill test ValueTensorIsIdempotent test UUID test DeltaP test TypeNames Ġme sa Ġme cab Ġme doids Ġme npowidgets ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ Ġres v Ġres ident Ġres izable Ġres rlm rain es rain Ax line T line end line pos line ages line collection ĠD j ĠD len ĠD max ĠD ick ĠD MA ĠD Mon ĠD AP ĠD UAL ĠD ANGER Ġlo Freq ") ', ") ]}, ") '% ") })) 01 0000 01 000 ance lable ne se ne il ne os ne we ne arp Ġcol list Ġcol vars ns f ns label time tz time Button ase xt Ġse ge Ġse ver Ġse py Ġse lon Ġv u Ġv ort Ġv ind Ġv art Ġv ca Ġv sv Ġv ene Ġv cb Ġv micro Ġv orn Ġv Local Ġv Sig Ġv divs Ġv Bs Ġv twa file h file start file lines file Set file Sets file WithRates Ġel kan ers lice Error Max Error Rate Error Message Error Correction ff ed ff loat ff mt ff bb ta e ta j ta req ind A ind Neg ind gren ). = Ġ4 18 Ġ4 107 Ġ4 320 Ġ4 950 date parse date tu ag y ag sr ag encies ag laura train SP train DeltaP ms ds ms ft ms av ms vc ms atz low p low t low err low cov low cut low Errs ary otype ĠB atches ĠB mag ĠB OT ĠB ran ĠB US ĠB tot ĠB eg ĠB iased ĠB asset ĠB DT ĠB Ps ĠB Site ĠB Cloud ĠB anks ĠB acteroidetes ĠB udget ĠB abenko sh ame sh ichi ty r Ġun label Ġun map Ġun mod Ġun ions Ġun fin Ġun cached Ġun partitioned Ġun classified Ġun ison Ġun stacking Ġun penalized Ġun interesting Ġun convertible Ġun raveled Ġun distort Ġun traced Ġ5 68 Ġ5 46 Ġ5 300 Ġ5 73 Ġ5 400 Ġ5 800 Ġ5 652 ip ivot ib min ib oth ib ale Ġby Item param Opt state PlotWidget state fulness features DB ask ed ask string iter cols iter batches op ol op os op namespace ign or ign ing Ġdi j Ġdi ets Ġdi ametre log R log list log line log max log queue log tot log rho log Prefix log VP key Columns In flow In Dist In stitution In Parallel In Place In consts In Father In vgauss Ġsk feature ast hma Ġlist ND Ġlist iterator Ġlist ToString Ġlist StatusCD ctor al rid as ef d ef ac ĊĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠ Ċĉ Ġle nt Ġle tt Ġle si da vg da SampSize che ated che ng ile is ile up 99 40 99 51 99 65722 Ġcomp ut Ġcomp as Ġcomp types Ġcomp ilers Ġcomp romised Ġtime limit Ġtime let Ġtime Axis Ġtime Points Ġtime courses Ġtime SampMin Ġint put Ġint ptr Ġint logg ant on ant igen ant enn 64 12 64 96 64 02 64 17 64 97 64 43 64 29 64 63 64 52 64 901 64 149 64 854 Ġclass Names Ġclass Est 0000 06 0000 07 0000 037 Ġ> < fo b fo res fo os fo bs fo uche pec let pec uliar score func Ġ`` == Ġ`` (' Ġ`` ._ Ġ`` (( Ġ`` +/- Ġat tain ĠW l ĠW m ĠW ia ĠW ert ĠW MS ĠW ales ĠW dil ĠW atson ĠW askom ine es ine ps ener r format string Ġmax V Ġmax w Ġmax range Ġmax order Ġmax indices Ġmax Date Ġmax tries Ġmax tiles Ġmax Seconds Ġmax scl cs um num fig num Frame num of num Feature num Seq num Smooth num Spaces num Particles num Loci model no model components Ġexpected k Ġexpected Returns init f init method init Dir ide pen rent Type plt Len add K add it add plot add Line add Element add Legend add Statistics add Cons add Calculation add AutoData 12 13 12 200 12 38 12 61 12 101 12 224 gor ies gor der Ġget ed Ġget user Ġget Path Ġget Fit Ġget Row Ġget Output Ġget Period Ġget Pos Ġget Face Ġget Project Ġget CSV Ġget MainWindow Ġget Feat Ġget Choice Ġget NetCDF Ġget Indexing Ġget BoundingBox Ġget Risk Ġget Existing Ġget Yvals Ġget HistoricData Ġget ndots Ġget TreeDepth Ġindex File Ġindex freqs port o port Out ĠO il ĠO uch ĠO CP ĠO SR ĠO OV ĠO elVolumen men au bs ub bs kip bs ubplot result Dict Ġbo y Ġshape Stack Ġ__ __/ Ġmodel context Ġit f Ġit mp ()) " ()) ._ Ġaxis a Ġaxis wise Ġaxis Handle ca val Ġdefault File value ish sub i sub df sub sp sub types sub rows sub models sub context sub tri sub directory sub Rows sub routines Ġcheck max Ġcheck rep Ġplot D Ġplot X Ġplot Y Ġplot be Ġplot image Ġplot panel Ġplot Grid Ġplot View Ġplot RL Ġplot Legend Ġplot Trajectory Ġplot ypus Ġver ta Ġver dana Frame Generator Frame Img Frame Methods Frame dSerializer map axes map classify Ġall y Ġall mat Ġall samples Ġall positives Ġall descriptors Ġall mics Ġall Activity Ġall FilterMode Ġall Evaluations Ġnumber Outputs Ġnumber ofMolecules Ġhe s Ġhe ston Ġhe aded Ġhe igth sum a sum l sum ata sum sq old dims vel ors vel Array Ġwh as ach t Re vised Re mainder Re loading Re charge Re corded Re ferer Data String Data Function Data Group Data Window Data Parameter Data Url Data FilePath Data Guillaume unt racked float name ft ft 25 47 25 21 25 89 25 73 25 943 25 057 25 893 raw Error raw meta raw Flux raw datapath Ġline Count Ġline Sum Ġline Wid frame Num inter ference inter storm Ġpd g Ġpd x Ġpd test Ġch dtri so fa so Model so ils Ġdist DF Ġdist iller ren al ren ov ren Win 11 397 11 655 11 659 11 558 Ġest os mean x mean y mean ss mean Vals mean ranks mean acts weight RegNorm read Image read Count read fd read HDF 32 70 32 91 32 295 unc le unc urated ave p Ġmin V Ġmin er Ġmin arg Ġmin idx Ġmin cov Ġmin Loc Ġmin Mult Ġmin Vals Ġmin Support Ġmin heap Ġmin Ha Ġinput set Ġinput Device Ġinput clsinstance pi ate pi ma pi ka Ġ[] ]: cc ft cc nd cc entroid Ġz ion Ġz li Ġz sub Ġz temp Ġz hat Ġz tgt Ġz oning ng t ng dc text ind text angle text widget cy cm cy pher Ġ\ . Ġ\ '' Ġ\ [[ params File ĠIn Shape ĠIn duced ĠIn TemporaryDirectory Ġper met Ġper tub Ġ10 800 Ġ10 665 bin map lic er ĠY te ĠY RangeROI Ġdo b Ġdo ped Ġdo PCA Ġdo Export Ġsh i Ġsh uld Ġ) ? Ġ) ", Ġpa pi Ġpa vil range Min range selector Ġused lag Ġnew c Ġnew v Ġnew ind Ġnew attr Ġnew order Ġnew Ar Ġnew Line Ġnew Input Ġnew Canvas Ġnew page Ġnew Rate Ġnew Files Ġnew Ob Ġnew Df Ġnew Ax Ġnew Groups Ġnew Prefix Ġnew XmlString Ġnew RVs Ġtrain XY Ġj h Ġj min Ġj str Ġj labels Ġj doc Ġj cm Ġj mc Ġj ple Ġj Ans Ġos x Ġos z true y true model true Dups req db gra pe gra vi gra cefully ĠH D ĠH of ĠH ap ĠH ST ĠH IS ĠH CL ĠH omog ĠH masked ĠH SL ĠH API ĠH DP ĠH PD ĠH yw ĠH ARM ĠH AVING ĠH eston ĠH äm ĠH ocking 15 30 15 98 15 806 15 10700 print Color print Cond ual e ual ize ual te 05 03 05 85 05 84 05 40 05 960 05 7366 input rc input gvectors Ġlog E Ġlog Prior ork en Ġfig P Ġfig plot Ġfig out Ġfig uras Ġfig mplf =[ ^ =[ [( =[ "./ tra sf tra mlines Ġinter v Ġinter pd Ġinter neurons Ġinter ptlist Ġinter facial join Data Ġsample Index Ġsample freq Ġsample Submission sed an sed Features sed Func Ġpy map Ġpy NN Ġpy trainer Ġpy asl Ġpy mh Ġpy Nastran Ġpy linac Ġoutput df Ġoutput sub Ġoutput Img Ġoutput Device start day start inds start sensor start Record start SpinBox idx l idx array not ed not def not ified not exists not masked not accurate ens ible Ġno ct Ġno header Ġno eu Ġno vember Ġno Intersection ĠU X ĠU j ĠU ART ĠU BC ĠU prising ĠU CLA ĠU tilization ĠU DAF Ġla most '], (- ulti file ulti map pr ison Ċĉĉ ĊĠĠĠĠĠĠĠ 20 29 20 70 20 668 fa el dd N dd dr dd ots Ġcl ons ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠ pos ns 33 35 33 79 33 945 33 169 Ġsub value Ġsub keys Ġsub mesh Ġsub command Ġsub cmd Ġsub grp Ġsub Rows Ġsub rends Ġsub propname les ki ie ur ie ver ie urs ie mnt Ġcolor ized Ġcolor Scale no is no axis no lock no mass no Split no NaN no proc no Undo no Sasl default Handler default Family Ġmatrix List valid acao Ġha e Ġha bibi 80 29 Ġhas Ph Ġhas Shapely ont ent Ġ6 87 Ġ6 367 Ġ6 970 new a new z new fig new names new command pred p pred file Ġfit Result Ġfit ctf zeros hot emp r IN FILE IN ATIONS IN CLUDED IN VERSE IN fO ste pl base On base LineMode '), \ ard agsr Ġtype a Ġtype token ĠData String ĠData Collection ĠData Process ĠData Gen ĠData Spectrum ĠData Provider code completion split Input split Target ]] '], uni prots 66 80 66 97 66 51 66 2016 66 985 66 654 amp hip doc ylindrical Ġrow y Ġrow line Ġrow ids ull on ĠSe ch ĠSe perate 45 35 45 17 45 90 45 42 45 31 45 9219 AT ORY Ġind isp Ġsup ose Ġsup sisim ĠK arp ĠK ipping ĠK hanna ĠK oller ĠK lementiev load Bar 75 19 75 22 75 97 75 90 75 98 75 21 '' ") Ġspec name Ġspec ifi Ġspec ials ok o ok ada use Off use Memory use Disk .__ _ 88 94 88 73 fn in Ġ| ` Ġ| _________| "] }). ']) [[' 16 30 16 38 16 93 16 135 16 295 ml File Ġup Learn Ġup pered series color info string Ġcal exp Ġcal ories Ġcal colo av f av w av az sample Points Ġpos params Ġpos nM iss n iss ors Ġro uge Ġro spkg show Labels show Img show medians show extrema show Ruler lines Df ong vat Ġapp l ak o ak can ak hut Ġone sec nan xyz nan dez ĠEx am ĠEx its bar HalfLength 35 42 35 43 35 08 35 60 35 39 35 63 35 52 35 600 35 661 Ġcur ly Ġcur Date Ġcur Mot Ġcur Subj 14 61 14 311 14 645 14 444 14 6602 Ġtry to sq lt ĊĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠ -------------------------------- -' 19 11 19 16 19 700 Ġkey w ipy img group plot // " // #/ ))) \ ))) +' pol Base count able cur Line cur Node cur Strand cur relem Ġsize cap )] " box Horizontal box Vertical box Office check able check ForSeries check NonPooled AR A Class Report Class Teacher com Group Index Array Index Table Ġ------- > ON CE ON YM [- ] Ġ8 96 Ġ8 72 Ġ8 269 Ġarg urments copy From copy rights 78 20 78 42 St retched Ġmake Vis Ġmake Move den cies 13 0000 13 999 13 149 13 152 200 59 Ġbin factor Ġbin nobj uff links ized Features ized GraphKernel own zigzagarrow own downarrows Ġid r Ġid Choose ĠV grid ĠV ac ĠV gg ĠV ibration ĠV ctr ĠV PHAS ĠV esper ĠV igraRandomForest ĠV ankers ĠV azquez Ġtm m Ġtm TruthPerturb Ġstring Length by l by val by ear be aver title pad title fontsize title ImgName zero Scale 22 250 Ġcopy ClinicalDf gs ct Ġiter offset sp len sp vals sp assed sp indown wo headdownarrow arr name arr Ret figure d figure first figure manager Ġother series table Model table Layout 04 80 04 77 04 896 04 384 Ġerror col Ġerror min Ġsparse ly sv ille qui er qui ries prob Matrix prob lematic uto bs 96 94 96 29 03 70 03 9994 ])) ") the d the s the co the min the max string CH string MLST metric Name column list Ġstart pos Ġstart rec Ġstart Freq Co al Co ma Co verages Co variates ĠNot a ĠTest Un ĠTest Format ĠTest Num ĠTest Simple ĠTest Histogram ĠTest Memory ĠTest Section ĠTest Unicode ĠTest Concat ĠTest Register ĠTest Arrays ĠTest SparseSeries ĠTest Hashing ĠTest Dendrogram ĠTest Scipy ĠTest Inconsistent ĠTest Leaves ĠTest Lead ĠTest Correspon ĠTest HasConstant ĠTest SizeOf ĠTest Cophenetic 02 11 02 400 02 934 02 965 Ġmo y Ġmo ff Ġdict Data Ġdict Dim Ġend X Ġend Y Ġend line Ġend macro Ġend Pos dot p write box write Img Ġ{} - Ġ{} ', Ġ{} )]) Ġ{} )" Ġ{} ]'. 95 26 95 42 95 98 95 89 95 59 95 52 95 394 95 0443 95 1339 Ġover scan 94 20 94 22 94 23 94 663 94 365 94 4627 94 0908 Ġ100 800 ',' | 17 20 17 16 17 78 17 955 17 6471 17 92603 of dis alpha T alpha err alpha hat Ġdataset A Ġdataset B Ġsy ft :: '] :: :: ĠCo M ĠCo pernicus object mapper object DefList ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ 85 99 85 11 85 0685 rt p rt ree rt lsdr sort ByKey Ġdif a Ġbase year Ġbase pairs Ġbase Permutation Ġfirst Name Ġfirst kList OR A OR AN OR TER OR ARY OR NMF na im na utical ank urt DataFrame Iterator run g run level run Button run Command run Simulation run nable Ġfeature Type :// ')[ Ġve t Ġexp ri Ġexp term Ġexp Average Con tr Con form Con current mon a ice history 24 99 24 92 24 74 24 93 24 41 24 656 24 4685 Ġbut ler Ġinit method csv files 27 63 Ġdis a Ġdis counts Ġdis posit Ġdis cuss Ġdis persions Ġdis crim Ġ7 04 Ġ7 056 Ġ7 069 cond D cond dftarray freq Label freq Corr freq HirArr freq rangeind uc ceq uc csim cat ched cat RF image Data image sets image Index image url image Path image Button image dpi image cmd image Filename image Cropped main Layout main QN node ids ref in ref ly Ġaxes f Ġtransform Fit 86 73 86 5675 Ġimage ID Ġimage Resize Ġimage WithBoundary SE MB SE LECC gen Img Test Net Test Object Test By scale Factor scale ComboBox AN LY abs list abs dir AL C AL MA AL IGHT var b var data var filter var stab var ags iew icz ols resid }) - }) }) }) _{\ }) $" Ġsys data Ġsys hist Ġsp lf Ġsp ts Ġsp inal Ġsp dar Ġsp chrs Ġsp ActiveCellsCount Ġsp annungsverlauf Ġmean store Ġmean Vals 06 20 06 88 06 17 06 08 06 21 06 38 06 955 06 867 temp d temp Path temp Dim temp eratura temp Reversed sy nd ory Analysis 18 33 18 17 18 000 18 31 err x err color err chk fix k 36 96 36 21 36 59 ". " ". + 09 200 09 31 09 74 09 7866 level wordcounts norm line ]), '\ ]), "\ ]), '- 07 11 07 100 07 09 07 68 07 180 07 0001 07 2595 exp M exp min exp format Ġparameter ised Ġpass by ap sto ap cocsm Ġqu ake Ġqu aternions Ġqu edamos Ġrun spec Ġrun Time Ġrun MOOG linear value Ġnode ID Ġnode Name Ġnode Labels Ġnode topic Ġnode Weights Ġnode ChckPool feature N feature vector feature responses Ġwhere by Ġnormal izable do us Ġscal as Ġscal ogram mod us mod python Ġ, (' man ia man agle man alysis ear row ear toear length insecs Par FilePath ')) ][ Ġidx sub Ġcase Name abil ité dis put dis plot dis rt dis ass dis missed dis ulfide Pro ton Pro fits Pro ceed Pro posals Pro gbar Ex pose delta Peak delta csm ST AG ST ILL ST NOBS Ġadd it Ġadd tional rc i rc dict rc entr rc mes spec num reg a reg w reg list reg file reg man datetime 对象 datetime attrlist Ġnd at Ġdoc lip Ġdoc fund lice k ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ atter s atter ing Ġlin estyled 34 04 34 83 34 81 eff cont eff bot normal mode normal izations ME F ME V Ġ... ` Ġ... ])) Ġ... )` Ġ... )``, Ġgrid int Ġgrid Layout Ġgrid Postfix Ġgrid Rag 97 12 97 22 97 96 97 18 97 34 97 885 filename blue af one af ford af mpath Ġpart file lob ate lob ster Ġreg uler Ġreg resses Ġact igraph ound ing results Name results Files results Rpts ĠJ b ĠJ v ĠJ os ĠJ ace ĠJ osh ĠJ KLE ĠJ esus 92 18 92 83 92 61 92 364 graph data graph Type save Model save Plot save ToFile ID R ID PHA ID HCodel Time Mixin Time Context Time Response version ing Col Cells Col NamesAnd cv r cv ode cv ardagsr ĠSeries Formatter part ir part No Se le dt n dt idx bu cks sk o sk s sk ate sk id sk Data sk illed sk surv Ġload R Ġload BN ĠQ out ĠQ Frame ĠQ grid ĠQ Image ĠQ PS ĠQ PT ĠQ Settings ĠQ Team ĠQ ListView sg r 84 75 84 71 84 381 Ġtext NormalizeQuery ĠFor GG center X return ize return key Ġq fi Ġq len Ġq date Ġq info Ġq sort Ġq star Ġq dr Ġq gi Ġq indarr Ġopen context Ġopen mpi Ġopen turns ram i ram os IC M IC GS IC euI Ġsort WithinPartitions Ġtarget dir my self my line my df my group my cmap my ctoph Ġ9 0000 Ġgroup ind Ġmask img Ġmask txt Ġmask Altered tx Rate Ġcurrent Patch Ġcurrent Columns Ġcurrent OST Ġsign at move lens Ġread hex Ġread Lines ass ass ass igns Ġfreq Scaling ac p ac Samples ac commod ac commodate Ġim os Ġim min Ġim stack Ġim tls Ġsum P Ġsum T Ġsum cols Ġsum resid update Analysis rel lipse rel DeltaFieldMat ... - ... ? ... "); Ġtemp Dim Ġtemp lating Ġed c Ġed r Ġed ucational ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġmod ul Ġmod python ris at ris ch ris cher non zer non num non Class non edge non missing non rigid Ġtf x Ġav gt Me mo Me psilon Name Replacements eps all our ing gr nn gr testData 65 25 65 56 30 45 db type db table Ġac ab File S File system File Field File Node File Filter File Handle Ġcv ars AS ite AS top Ġ<= , cluster Center sol mun sol maris Ar ctan Ar IV Ar III Ġass ured Ġass imilation Ġad vances Ġtrans params Ġtrans objs 37 15 37 33 37 80 37 19 37 13 37 09 37 60 37 380 cm i Ġdatetime format SV TYPE SV iewer Ġtable Titles step Num cont Dir :] != Ġtuple Resolution Ġcompute Spectrum mt step mt mm mt Set Ġmay or Ġ& ' tf max tf inal tf lux ls l ls ig ls ctables ls RetStocks Ġorig im gn l Series Methods Series RHS ĠCon vol ĠCon duction ĠCon firmed 87 22 87 24 87 005 87 806 87 649 87 472 flow lin flow grid vi ento _) ._ Ġtra pping Ġtra vels point less Ġtraining Set Ġtraining MetricLists RE TRANS RE COVER RE MAINDER RE DISTRIB CA ve CA BA CA CGT Ġwidth src Ġwidth Scale Ġwidth OfAerosolMode Ġmult ise Ġmult Fact Ġmult igroup OD I OD ON ik h ik alski )[ , )[ ~ Ġoff peak Ġoff screen ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠCheck ComparisonMixin ĠCheck eredRatemap Ġsome X 44 99 44 33 44 17 44 18 44 34 44 60 44 28 44 68 44 31 44 948 44 782 item Tests item cee ĠZ r ĠZ t ĠZ max ĠZ eta Ġcreate TempView Ġcreate GlobalTempView Ġpoint Array Ġpoint Color active SubWindow ash v ash rightarrow ash leftarrow acc r acc utime Ġacc ref fill p vas Groups 55 35 55 95 55 77 55 46 55 81 sqrt Figs Ġob c Ġob w Ġshow error Ġshow case Ġshow Sequence Ġshow cases tree A tree B tree C tree String tree walkers Ġpoly df url resolvers EN C EN ERG čĊĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ 23 129 23 7812 Ġ(" ` Ġ(" __ Ġ(" /% limit dict prec ips du in pop mean pop Lst Ġuni prots Ġinitial Depot SI F SI V img ur img ray img ids img Arr img Original dataset B dataset Exists dataset Configs Ġ20 25 Ġ20 83 hist oneMark Ġback cross Ġ[" ..."] multi layer Ġfilter Folder Ġfilter ctfdata Ġframe count Ġframe List Ġframe Conv ### . 26 10 26 88 26 95 26 83 26 81 De comp De vs De compose De compressor AG ERS AC ITY AC WE AC loud AC Waves Ġlast time Ġlast Name Ġlast BDay 77 01 77 450 77 950 ĠDe prec ĠDe velop ĠDe Wolf ĠDe parture Ġfiles uffix Ġgraph name Ġgraph util process File process Thread ld x ld file view Form ling vo auto Adjust auto focus ai rach RO LS RO UTES csr mm word vec word TextEncoder Ġalgorithm ically ([' ( TI ZED over written over generation over shoot {} | {} ') termin e txt clf stats dist Ġevent loop Ġsplit table Ġsplit Target Ġ] ' rit r just ification ga stron ga pextend net Data ume th Ġpl zip Base Frame Base Process Base Height Base Impl Base Fitter Base TFR Base StdIn Base VectorSourceEstimate Base SSHTunnelForwarder Base AtomicDataProperty Ġsm al Ġsm ary Ġsm kr Ġsm arts cell ations cell born mer g mult apses Ġcoef icientes Ġite ma Ġfigure Options Str MethodFormatter Ġnorm time Ġnorm bound files dir Ġmatch time Ġmatch Count pd c pd tools Ġsim y Ġsim number Ġsim null Ġsim iliarity Ġar isen Ġscores List stat ename diff time plots Folder create Plot create World create Composite create ContourFromListOfElements 42 135 ĠWe bb 98 93 Ġdraw styles Ġtotal n Ġtotal Result Ġtotal Winning Ġtotal Losing draw Text font num font Sizes ob ter ob bs ob rientransform window Vals vs b vs dist bl unders Ġ} ''' ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠ ĊĠĠĠĠĠĠ make KFold make Suite make MappingArray IP Field IP rinter Ġter ange \\ % \\ * \\ ', Ġdec ryption empty barb times lice times mar where Edge )* ?)(?: Ġty ssue Ġ12 78 Ġ12 94 Ġ12 347 Ġperiod index Ġdt str Ġdt count Ġdt mc Ġabs or Date UTC Date Sorted 67 95 Ġfind spikes Ġfind LOSV ĠAl one ĠAl cohol ĠAl gerian Ġsingle task Ġsingle Hist ĠPer Dollar '][ ~ Ġallow MissingColumns DE VELOP Ġlines it Ġlines pan Ġlines PhylDiag 08 01 08 97 08 31 08 164 08 1814 08 23529 Ġstate seq number ofMolecules mm hc rec pt ler p CV G tom arket tom ancak Ne o Ne ts Ne braska Ġtri a Ġtri mal Ġtri Var orig String orig intuple replace imageComboBox xy c xy pt xy list xy Data xy labels xy base xy tip To Line To View To MB To Freq To Types To Center To Simulate To urnament To Achie To StateCity To ScalaT ev of ev tlen Ġbest WVec drop Index Ġcross corr Ġcross wind Ġaf mpath first mean first std first sim first char first Row first Delay Ġfield PICList sin p rs alak lag polyproduct open func Ġuser PrettyPrint 000000 15 height Net Un if Un select 47 11 47 35 47 17 47 23 47 42 47 67 47 60 total pop sim dt sim tk Ġsave To Ġsave Map ,' | ,' (', ,' --') ,' _'+ Ġsv mbff Ġhigh jack ox ts Ġmap file Ġimp lications Ġimp yla Ġselect Expr lu ss lu cky best data best score concat v user anks Array Data Array Agg json Data Ġraw cols Ġraw chars 60 956 60 459 OL ON inv fac inv linthresh inv transparams period List Model Dialog block str Ġsorted xy ĠTime steps OT A Ġtop hole poly a poly cha Set Device Set PrintData Set lDt tmp Status rad j rad data dered dened rank x rank pos ons ite Ġsuper classes Ġsuper title current file current pos current Class current Day current Database current Shapes current segmentsize current BlobLength Ġgo lay inf eld inf late Ġcmap PS bf q bf bf bf uscator Ġeps write Ġeps ilons Ġemp loyees full rank DF ilings go ss go out Ġwas ps edge mask edge length ĠStr ToInt Ġcorrect motion Ġinst ed Ġinst ace average Winning average Losing iple t Comp act Comp ass Comp uters Comp ilers ĠType code ĠType Converters ĠType Resolve Label From Ġtree file ĠUn balanced ĠUn likely ĠUn certainties Ġpred Y Ġpred All Ġpred EXT Ġpred SegmentNum Ġpred Strengths NA O 28 75 28 17 28 92 stop Id stop OrderDict field list field Frame keep Temp ĠSet ChannelsMixin Plot List Plot Group Plot Variable Plot Block Plot Report Plot Variables Plot Plugin Plot nine Plot FramesPerBufferValues vec D vec self 9999 97 ĊĠĠ ĉĉ Ġunit i ĠPro position ĠPro viders ĠPro filing ĠPro tect hood s "]) ( "]) }, CH Cl Ġdiv z job Count job dur Ġedge Map Ġedge Cols For Test For Node For Feat Ġmodule Map vol cano čĊč ĊĉĉĠĠĉ cos b ud x ud ding ud units ud ged Res itivity Res izersMixin Ġindic ative En z En force En rich En rollment Params Error Ġstop watch hand shake ĠPlot Resampled ĠPlot AutoCorrelation dev TestL :- ( :- _ 39 20 39 80 39 35 39 309417 sha ping Ġrepresent aiton unit A unit weight 40 85 40 960 Ġbinary Genotypes Ġimg R Ġimg f Ġimg Object Ġimg Dim Ġimg Sigmoid Ġge f Ġge p Ġge otherms Ġge odesics Ġseries RDD scatter Size Ġlib dir Ġlib period Ġlib extermeminpeaks Ġlib xslt Ġps ite Ġps write Ġps frags Ġps fromtk 68 32 68 27 theta Y theta Values )]) * Ġheight E CT D Ġparam file Ġparam dict Ġparam Dict Ġparam Ints stru vel sorted xy ED MAN Ġnoise Seed align mnet flat heads flat tens mi lisecond hed ges Ġtmp X Ġtmp os Ġtmp db Ġafter Script 38 36 38 256 Per u Per Cell Per haps Per Ngal Per iboth zip name Ġactual Rating header Data ĠIndex Parameter fin det ({' __ UR IRef Ġitem d Ġitem mask Ġitem Set ---------------------------------------------------------------- - Ġts hell ĠPython win message lock Ġext map MA Z match zoo SC LOCK Ġ15 32 Ġ15 00000 Ġ15 65 Ġ15 72 DI AL has Value Ġvert idx Ġvert RefDir 46 01 46 80 46 96 46 18 module finder ĠCreate CGate Ġpython s cf c cf u cf gr cf lags +' -% +' _' +' "' Ġcell h Ġcell Energy exec utes Ġstruct ur ĠAt mos 31 66 task set task text Ġobserv acion UN CH UN ING UN ET UN SET cache grind ĠĠĠĠĠĠĠĠĠĠĠ Ċ eval AnchorDisplay Ġvar b Ġvar out Ġvar Interp su id su iv Ġlimit Extremum hi Dbar ML Table aN bSetWeight beta vals arm v sm V sm gr sm arter sm allin Ġclose I Ġclose Lines Al b Al va Al lout Al gerian cross corr Ġmain Layout ." ; Text ual Text Color Text FileReader Le ads Le mas dat ar 647 3 647 16 Ġret urend Ġchannel v Ġchannel Idx now cs now mon now year 235 987 Ġ{" < change MainWindow change volt Ġjust ifies Ġauto fit IL P IL ING IL SVRC UL T UL ATED Po ss AD Us Ġerr y Ġerr Arr LO SM LO GGING ov ie ]): ] Ġpla forms Ġman a Ġman ny inst anced Ġold code Ġold Thresholds ({ ! ({ \' ({ },{ miss pecified Ġwrite Stream Ġwrite CSV Ġwrite vcf Ġwrite HDF Ġcons istant Ġcons ommation nc vals nc ascade bit count ĠMe ters ĠMe teoSwiss median a Box Colors queue ing queue Dict lack ing sa ir remove Self Ġheader buf SA n sizes cale Inter polacion Ġ%( ",". Ġmodels Watcher Ġmarker d Ġmarker first Ġmarker Object 48 385 anal ysing Ġslice FoldIndex Ġvis vis Ġvis ui Ġtask id filt nu Ġdb m Boost rap 56 15 56 88 56 03 Ġscalar p Ġdetermin ative ĠLinear Estimator ĠLinear Gaussian ĠLinear Segment ĠLinear DRLearner ĠLinear Classsifier Pre fixes Pre valences IS ODE IS BN IS ALA IS ALC Ġref stateseq Ġref ugees Linear Features Linear MixedModel Ġrec Rank Ġgamma chi Ġprev Node Ġprev ymin Ġprev ymax desc ps desc ribes Ġdelta V Ġdelta w Ġtz str Ġtz frame Ġtz dst 294 25 ĠMulti Sequence ĠMulti Weights uplic ates Ġmaximum GrainSize Ġfix per Ġfix Gaps ĠGet Time ĠGet Iter 57 15 57 06 57 49 57 600 lon i lon ely lon Full App lied App Yaml nb b nb step nb dtri nb Controle sigma X sigma clip Ġrespon der Ġbeta Opt debug PS Ġroot node Ġroot Path Ġdim er ĠLog Name ĠLog book Ġprocess Data Ġprocess Pair Ġsystem Params Not ification Ġsigma X press or this o this Dir this Filter 69 00 69 03 69 000 PI VOT conf Matrix conf ront '\ .__ Ġwant ing Ġmissing ValuesDict dx p major ver ]* ') ]* :: Ġdon ne Ġdon nees upper cut Get R Get Tensor Get Iter Get BackgroundColour Get PhotoelectricCrossSection Ġstyle list Ġstyle class Ġwx Custom Ġwx GTK Ġwx Interpolators Ġwx Paint PE tab ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ cd om Ġchar Val tuple ToScalaT stream graph stream tube Ġxy Y Ġxy p Ġxy point Ġxy corr md m md r home package Ġmy map Ġmy float Ġmy fun Ġmy prior Ġmy Row Ġmy opt Ġmy Logger Ġmy Beam Ġmy Atlas Ġmy Polyfit Ġglobal entrystart cmap LineEdit Ġrot MatrixFrom Ġignore Corr Ġsche matic obs Time clo th clo udy Ġfactor izable Ġimages RDD Sh ifting Ġnan ow Ġnan percentile hash salt iron python 137 94 Ġpen sions Ġdirect o rest ing rest up rest freq Ġpylab tools ĠRandom Distributed sel csv interval Type Ġ', ( Ġ'- .') No uns No Annotations Size Pixels Check HasConstant Check ArimaResultsMixin Check BinaryResults sw an sw ab Ġkeep files Ġ'\ )') Ġ'\ "' bound Up Ġapprox eq ĠLo max Line props Line Shadow Ġlong l Ġlong Name Ġtheta D tri w tri list tri interpolate Run CC Run Job Ġmpl dict Ġmpl dates Ġlat lng Python Utils parent report inc ides Ġcomplex Plot null nan null Marker hot ellings Py Java Py Ranges Py Pore Py Charm Py Stan PL RM PL Dpixels training Steps Ġproblem id TH H Ġsa cs Ġlocal table Ġlocal Model ĠĠĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠ accuracy EuclideanDist meta static Ġtak er Ġpower Column Ġhandle Box long Name long antennae project Name Ġdrop zeros Ġincre dibly weighted tau weighted OLS Ġexist ant scipy org Ġbar size Ġbar pos Ġbar width Ġbar func Ġbar linecols sig F sig idx 89 24 src Path src Root src DataBucket Ġiss pace ĠTo il All IDs display Label contour Sign Ġpixel ated Ġpixel ToMap Ġlike wise 74 27 74 134 tool Bars dec imator dec ibel ĠLe ica ĠLe banon Or phan Or ComplexBlock band idx band Count imp lot imp lies imp Vals Ġpack rat Vector Assembler Vector DXDYDZ hell inger Max Y Max imal Max tracking Max Pressure Max PerColumn Max outConvC Ġfilt func uniform s Ġpe ewee 686 7 '} ]} aut re aut ode noise Tables noise LevelList ĠPre Text ĠPre defined ĠPre witt Ġnb d dr k Ġsetup Table Transform Point Transform Algorithm Transform Factory ĠInput Data pk r pk lfilename ([" / ([" \ ())) ( Ġpr n Ġpr v Table Display Ġunique Names const map IM R IM s IM IZE Ġ'' )), CO C ĠIN TRA Fit Region TS ocket TS YMBOL ĠList Type ':' $ Ġreport entries avg RF Ġconnect ivities ather ine Ġfin anance Ġfin deq Ġbuild bits Man uscripts mail ing mooth dc adjust s adjust Size Ġdiff dists Ġevery day Widget Shortcut uclide a Mat plot Ġsto machs Ġcat data Ġcat stack high p high cut Ġaccuracy VsResolution Axes Style cp bdn Ġ$ " Ġ$ ? Row Transform Row BFn Ġconf matrix Ġangle b Ġangle c comb Type Ġlayer Name Function Wrapper cha ver pers fip bottom right Ġpop th peak info peak ids peak ComVar "][ ( ĠOr g ĠString AccessorMixin )+ "): bbox i OP ACITY Ġpredicted ActiveColumns Ġ14 35 Ġ14 19 Ġ14 98 else vier fr f fr illy Graph ing Graph Conv Graph Drawings det ERT US ec US Martin Ġmer kle Input Format Input Locator Search Array 63 10 63 45 63 0005 correct able correct motion agg res Ġview Box hes ive lex ists ern ary Ġdep lo Can nab rgb Img Ġfinal funvals 79 75 79 86 Ġ13 88 fast convolve fast qs fast lmm ĠKey Val cost ia cost All ident ifiant Ġcombin aison Ġcombin aisons ]+ )? On Gap On WriteArray Ġparse addr cdf gam 54 1176470588235 70 85 )" }) Ġsw ig Ġsw ings Ġsw allowed Ġsw armplot Ġsw aped collect ive collect children collect ToPython section Map sor baro Qt Widget Color Spec Color Group Ġupper perm Ġupper Pipes Ġsimple axis Ġsimple kml Net Pnl ush cn Ġaccept func EX CLUDED tag df ĠOR BIT Ġgood ind sf ens Ġsym log Timestamp Info 83 000 Min Time grad R grad Pres grad ualVariable tk s tk ns AA MorphologyDict Gener ations /( .* /( .*) Ġremov enans Ġsql parse 0588 235294 Ġ\\ "), 59 22 59 34 59 38 *. * finite Values ĠDi versity Ġconst kw MS Search MS onMH ively Equivalent Ġalign able Ġstack Processing shift left tic kets Cur Ind Ġaut okontrast az ar mid parm Ġdir file Ġdir WithModel Ġus ability He III He alConfig Ġvs min ); }") Ġ"\ "{ two BthreeC *, \ Is Selection Is omorphic Is Preview Is lander Image Matrix Image Map Image View Ġsig r Ġsig idx Ġsig Genes Dir Parser 199 53 days List Number People nr data arrow PySpark 93 94 93 18 93 804 2745 09804 ĠLabel View 76 15 76 176 76 2471 We bin We ird Ġcounts i next T next tok ĠTrain Summary marker d marker Index win rm Grid ded Grid ness ĠGrid World neg corr neg Color black hole 300 69388 Up loaded Up loading Up Idle Spec Plot ĠSo ma atom No 82 3413 82 14151 opt name opt BPM Ġpatch size second mean second std second Pass second Delay Ġdet X Ġdet ori Ġdet unings Ġhtml s Field Correction Ġway tags OO K Ġ'-- '} .... : external Csv DO W DO bj DO OR CP Ds Qu icGraphicalLasso ĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ Ġcomponent Suffixes fl v fl uff trace file ĠTransform ers Ġna Return Ġna Initial Ġna Free Ġna issance Ġna ughty PCA s ,)) ( ĠMax imizes Ġnetwork type 500 3 Ġterm sep ND AP Ġword Vec Formatter DMS br p br ut br cy post ion post taxon Bin Center Bin Grouper Bin Nums Ġdx p NB R NB S Ġflag file Ġflag Group Ġflag Src mut id Ġdd F final four final Folder em its Ġcost Matrix Ġhash fxn Ġmedian a Ġocc u exit Price Key Val Ġenv var frac IntrinsicVar frac NoiseToSignal At traction At Root At Seed ĊĊĉ ĠĠĠĠĠĠ Ġscri p meth y NE s .* / Ġfixed Pars wx python Multi part Multi Nest clean Str clean ups Ġweighted Quantile An isotropy An zahl category List stro op Ġband with Ġeval df density CorrectedHubWindSpeed Dis cover Dis abling Dis cretization scan list By Fold ĠPy learn ĠPy dot ĠPy emu )' ^{- Ġpresent ations tot en tot ss tot nr Ġcontext Menu HE AP Sub classes ĠFe hler Column Order FA I FA SE Ġshort ing Ġshort ening ky y wave Input >` ", Ġli ved Ġli aup COL D ĠPo ynting Ġfun type Ġfun gi 180 2 Ġdat A 53 86 53 09 53 98 collection As Add Reference Ġsrc doc ĠFunction Name ĠFunction ality ĠFunction Context ĠFunction PiecewiseLinear Ġbl arg Ġbl bs Ġbl its PS O 62 32 62 96 cb ut cb id help Window .]) }, fp int ire fftn Ġsets lice ĠColumn Label mc bs mc means Ġho emo :. /%( entry i entry Count Random ization Random Confs ./ . Ġfalse ly ru ise Ġmp rs Ġmp aths Ġmp ltools Ġmp lfm GT AA ĠSpec ifications Ġsubject ive Ġordered dict 73 19 pc rit CL ANG ĠDE MON ĠDE Cam ĠDE CONV actual TagName aw t CD ext flag id ĠMultiIndex ed tex mf čĊĉ ĠĠĠĠĠĠĠ Ġcontrol points Canvas ToolBase Ġcos angle Ġda ughters 52 195 ĠSelect From ĠSelect Stmt ()] ( Ġte aching rep in rep ulsive proj Limits gene ity gene Type gene Model gene Start til ing merge Iterate area plot ti ary Batch TableEnvironment nx graph nx bits logical plan Ġopt model micro state Cal ories Cal endars CS AT CS plus coordin ated ĠMat Lab Ġsafe len II k II q AND B Ġnull nan lm dif element number }} - }} ]]) }} ={:. }} }$". 2015 1215 2015 0507 2015 1214 2015 1211 Ġconcat ting AM D AM J region Name region Menu 2016 0925 2016 0712 2016 0920 Ġpri ma Ġpri mo Ġcompare value Ġcompare Actual Ġcompare DataModel Len Dict Ġavg x outer most Ġsf x Ġnt ie Ġnt bk Ġnt wts assign ation assign Clusters Th ings Th alamus lb ench ĠRes Phase Ġphase Offset 999 1 Node Labels Node Points Node Bias Figure Type Ġparallel isation logger list ĠModel Param bb ian Ġmag i Ġmag ical Ġmag Norm orient dip Ġproperty name Ġatom Name ĠCON D selected ndarray selected Indexes multiclass s 71 666 2012 1230 big l big r big df SK CM subject ivity Ġprop het One Feature Ġ24 00000 Ġcy toolz Ġmid y Ġmid line Ġmid pts sym data sym mops cum Sum cum PDM truth LSTM SS fx SS MARKOV unicode data command er tab size tab bed Ġsur passing Ġsur prise pri vacy )} }) Output Obj Output Product Output DataPoints Output DuringInitialize direct opp Ġ18 12 dy t xi om Ġrgb Image Ġrgb Attrib cap abilities vertices B Ġmis use Ġmis reading Sp O Ġcha o Returns Current product ivity mem n Num Estimates Num Processes SR P ĠSparse PassThrough ==' - Ed gar 41 85 Ġfs z Ġfs path Compute TimeResponse Ġ~ (( pylab plots contin u ĠApp Info ĠApp ropriate Ġsection Dist PAC Y Sy naptic standard Frame With ID With Label With Sparse With Datasets With Zeros With Higher With Cuts With AdjustmentBoundaries mk Timestamp Of Data Of Plot Of Mass Of Ten Ġ'{ :,. ĠAttributeError s rou ge UM C UM igration gp Mask Ġconstruct bckndarr ))] } Feature Importance Feature WithHigher Ġsegment Dist Matrix List Ġ'< =' page levelwordcounts LI HC Ġxmax list rvs nd mal ware mal ltilde settings Changed Ġ19 45 ĠOut File Ġfail er IR kernel locs Check feat filt ('/ ')] prod DBlock prod igal ij n special ty special ized super class >= ', >= ", velo ls ĠAR F ĠAR IMAResults Map Info Ġspark types ä» ĭ aux illar ]= (( ĠImage Color ĠImage Matrix ĠImage Enhance ĠImage Chops SP AIN SP HERE SP ADLSchema TE MPLATES +" | +" ("+ +" ([^"]* ĠSy mp DB H DB L DB P resid mat resid uum %% $ Range Widget ny times ny bits Ġshift type Ġshift left clear Canvas clear Flag Tra vis Tra cts ni learn ni imgs ĠMult ifactorial ĠInitial izer ĠInitial ising ĠInitial Depot Ġsupp resses Ġobs modes ridge length ridge coeff }$ ']) }$ '} }$ '%( ĠTree BadVersion analy zing Ġsl da Ġsqrt beta ĠLoad Data force RL force Update 61 75 cla ir cla ms cla imed plan form geo hash geo phys counter part counter parts Ġinsert Cur Ġbutton d ĠTh er ĠTh Ar ĠTh umb ĠTh reat Create Path Create Geometry Create Masks Ġhalf L Ġhalf Vector Ġfolder name BU ST BU IL BU CKE cer zo Ġchi q 254 96 frames Number NT ABLE menu Language menu Sedimentary Ġuniform boxsize ĠFile Type ĠFile Spec ĠFile Chooser macro menu ELL IPSE cr F cr H cr I cr L cr M cr R cr ds cr uc car ine car pen lw bw Ġlb rt Ġlb wh Ġlb ias Ġlb ench Ġlb enchmark eigen val Ġ17 000 Ġfree bayes Poly gamma PU MA Ġexport selection lst Factors ordered ListOf mul seg chor date Ġsmooth s Ġsmooth it DS ource DS BP ĠDis claimer Ġhidden layer ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ),( % Ġ'+ \ 2007 04 2007 06 2007 0915 same ImageName Ġappend er dm dt Event Schema Event Template Event Mism CG GG CG GAT ĠEstimator Spec Sparse Vector Sparse Histogram }\ ' fixed h Ġ"' -' Ġperm utes fc dbb fc liques Ġinfer FromTest Info Window Ġbenchmark ed Ġbenchmark Times 101 83 101 06762 Bar Info Bar PlotItem VAL U ĠJo an prev cool BC loud Ġexplicit Text custom izing custom wandb seg name hy br čĊĉĉ ĠĠĠĠĠ dep var Start Line Start Task Start Page çļĦ èĤ¡ç¥¨ çļĦ æīĢæľī çļĦ éļıæľº çļĦ åħ¨éĥ¨ çļĦ è¯Ŀ Ġdev oted Read file after axes after noon after CurrentAlpha roc eries Trans parency bi ed bi wt bi ogrid WH AM Ġtp mean Ġ([ ] uid ores From Timestamp From Iterative From Wkt sto ol sto matopod Length LineEdit Ġtermin ado Ġtemplate Map Ġtrack let Default ing tw at tw av Ġ)) ))*(( ĠEn ds ĠEn queue response Images Ġgene parse PRO T PRO FIT ĠAd v ĠAd mission Ġgeo path Item Id flux val flux Density Ġgr ind Reg Coef Hist orians tm PredPerturb tm TruthPerturb ĠDef er Ġrand mvn "> %. MF s SH CCFLAGS SH ADOW iso i iso phote Clustering Summary ĠFeature Vectorizer ĠFeature Normalizer ĠTrans l ĠTrans mit ĠArg v strategy Class Ġoptimal PC Ġoptimal Resolution Encoder Resolution dest Dir dest Bmp square count white Noise Float Key wb m wb x Ġbackground Label Ġ31 6478 äº Ī masked Tris ĠSub zero Ġexclude CellCycle Ġ') '] between ss iten ess Ġpattern freqs good idx good channels good Nights Ġpol ler 99999999 7 Ġcp umask Ġio loop )))) + )))) [ )))) ))) land sat rv amp rv stsq '% ': ]} ' qa file TC lones Mult itaper Mult itype Mult ifactorial Ġmultip olygon mx ne Mo dif Mo RDa zy pper Predict Dummy mg auss ĠTarget Model ĠTarget Values ĠTarget CategoryEncoder Features Df pherical angle Ġls r Ġls ites profile Errors Cor relate Ġph ospho MAX LEN got m Ġkm Pred "\ [' Ġasc ension ĠEst a PAR SE PAR TS PAR KED ĠMo isture Axis Item Axis Flatten Axis OrderError "]: [ ((' { ENT ROPY ond heimer Ġnu ked Ġbytes cale ĠGraph CRF ĠGraph Drawings Ġsite energies avig ate soft words yr x yr min benchmark Times Ġembed din RL Find Pr mp Pr inceton Prob able Cell Start Ġur lf ĠNearest Neighbor java ToPython java StorageLevel internal shell Ġreduce func ĠTable Function Part load separ atrix NO H NO SE NO BUILD ĠBe ha ĠBe aker Ġscatter Plot Ġscatter carpet Ġ88 6 cnt map Sto TOT Ġtransformation Type Mask Vector aving List LL H sess info Ġcau dales bd tri NG GX NG ROUPS Ca ution origin Frame 117647 06 js dir iteration times Ġlr path BF P Action List =[[ (' =[[ ]] =[[ {' moment x 0001 2 0001 0000 thresh s Ġtpr Test Gradient Checker pow der compare Zeros ale th ale gend Current Contour ĠNum DaysToDelete Def ense Var ID If Not Sum Lines Do asResults km h Ġconv in Cl ub Ġturn around ĠValue Def Ġans w PT Type Labels Predictions KE PLER gonal ROI ĠTransformer DatasetCV semi axis ĠEX TERNAL ĠEX PIR ads od Dtype Tests Ġns plups Ġns rdb Ġns napshots under y under water checked Id family Content Ġagg f Ġagg image Ġagg lomer Ġagg lomerated zoom level Ag ilent ĠError Y chart ed nz Profiles Ġ23 32 Ġ23 16 ĠNA VIG calculate RC OB ER hyper link hyper links Ġfiltered Resistivity Lim Set Ġcalc err anchor Suggestions Ġmar c "% " lam n Width Height ĠVector View Optim ally Ġtex plotind met adf met ropHastingSamps quality Control ĠCom boBox UB M UB Prod UB Degr Ġgover n 3137 25490196 Flow BC SL D API Key }' >" Ġdig ging Ġdig icam lg ds Ġage Col Ġlabeled Sequences ĠTensor ForestEstimator proc info ĠColor mapping ĠColor Generator similarity Matrix cover alls ĠTra chel ĠTra itedSpec annotate Variants Analysis Mixin 126 96 bed shapes bed Sort bed ToBigBed ĠNon central Ġpopulation Hg TA W ABC ExtensionArray Day Str Ġ"{ % Ġ"{ :,. :' ', Ġflux like Ġflux err Ġflux bias filtered dict Ġserver URLs tax ID tax ons EG ARCH Pos i dp ml Ġclosest WWTP Ġmouse Up Ġmouse Down 336 02 kde ns Ġer m Ġer data unpack rgb Ġtw ntyper ĠMock HiveServer ĠMock HTTPResponse ĠMock HiveCliHook Down ward Down loader ĠDict View ĠDict StrNum bre tt Ġgu ar rates py ĠAS ite Ċĉĉĉĉĉ Ċĉĉ van Cmnt cam center Ġresp data ĠDummy Exception LA F LA ZY 109 34726 And Steve rd rand Ġ? )""", Ġsen Count Ġsen Feats Ġearly Stopping phot ox Ġspect ators Ġix pr equ On equ inox equ Facts 275 2 ĠCO EFS look UP elect ed 862745 0980392 samp width Ġcatch s SO E ners c ĠSpectral Type psi Line BA ve Tk Version ew k ew ongvat Top K Top Height Ġscan lines viz ier viz rank Ġcc Dept Ġcdf Axes 445 7416 Block Options seek ing Ġbounding Box Ġbounding boxes cu anto cu varbase 318 28 Power Transformer Power IterationClustering Ġke q three gene Ġswap case Ġswap Amp bn os eig freq GG Y some data some dir Ġrad icands Ġtab la Ġfl utter MO IST MO SAIC ĠGroup IndexKey found ation .] ' .] }}} TF IDF Ġblack hole Ġsec ToRecord Points Edit Ġcurr Iteration Ġcurr Speed '$ ': Rest ores 873 000 Oper ationalException ĠNet Command ĠNet Stims hex state hex lines hex sha hex ColorPattern sal ami sal ario EP SC Ġrest pt Ġrest up 896 7 Ġreceived Data Ġair ye Ġfr mt Ġfr hatv 354 85 Ġstim y Load SDF PRE EQ Ġctx done Ġbug let Open Type Ġcosine Similarity Ġmi ctools Ġmi RNAs Ġ75 1 Ġski ph Delta Encoder Delta Sb vir tenvrc 184 25 cli d cli py cli ph 988 9 ,:, - ,:, :]). Panel Title ACT NUM Ġgh b Query Set bag ged Ġbg m Ġbg img annotation x ĠInitialize Iter Mag n edit LinesLegends pv factors Ġcorrection Factor bootstrap cdn UC ER ech ino Ġmx ords Ġmx hn Ġmx ordn 110 80 Ġut r Ġut ide algo file trading Warning card t 636 8 636 9 Ġchoice set interpolation Mode TIME LET tc pt Change Data ĠSome Other Ġpat id Ġweek Average Frequency Error ĠVar Name Ġ--- | icon trast xyz Frame Ġcli py Ġcli ph :") [ sho ps Ġexternal s 901 06 ung lu Norm Cdf Ġcombine Segments ĠConfig urations Ġgl Viewport Ġws max Ġws Col autoscale Action hip f ampl ers 917 064 EV AP ĠST ORE ĠTr iggered north western pb db pb cb pb rod ĠTemp Cache +'_ '). 996 844 Ġmot t Ġmembers inmonth ĠTfidf Model ĠText Str ĠGo To boundary only boundary Conditions Ġ================================================================= =============== Ġinc ipit heat matrix heat dt plac eness Ġann data ĠStart Span Main Subplot ĠML B ĠML agent Unit Registry Ġgeometry Function vd file _{} _{}'. Draw Down ĠAC loud Ġedit Menu 119 02 Ġ({ :, }/ ". ĠCSV Import CDF RandomNumber Ġep anechnikov Ġep isodio bp cs Weight Decay Ġhost names Ġyt gt 998 149 PP F å¼ Ĥ Found C Found G Found H Use Pie dig icam ĠEl lipses :" }, aps up aps from aps down Pol ys Vis Curve aur ants aur icul Ab orted Ab undances Ġbw a Ġgray s Ġgray Img Freq Bands Ġclick List ina ce pas cals Ġbeam list Ġbeam codes Ġscope attrs ĠABC Generic ĠABC DateOffset ĠConstruct ed Curve Points onds uit Factor ial phys Points Ġwp neg Ġdisp cmd Style Image Style Container 003 888 003 6407 512 2 196 35 Lab oratory ĠOpen MC ĠOpen Hdf ĠOpen MDAO ante c send to Ġcorner id trim idx DR MSD upt o Ġtax onomies 264 97 264 59 CF Dataset Lines Widget 265 8 Pa ce 07843 1373 CI values KEY DOWN ĠIs Question ĠIs PythonScalar ĠIs otope READ ERS GN FS GN ANCY Ġlik s Ġcontingency Table Ġexplo ding NOT HING NOT SURE native PdbInfo activ ating chr X Ġpv o Ġpv const Ġ'{} /{}. ye ah storage level Pickle V ĠMon tague pivot Val Ġquant ite Ġquant rocket 185 93 375 5 375 663 375 670 }] \ }] $', Param Table Param Tester ------- ') LY S Optimizer WithL Sequence Composition Ġcd ms burn er mini Query 365 01 235294 1176 033 47 dark sky rh p rh in saved pi è® ¢ è® © è® ¸ Ġmapp ath ĠPRO CEDURE ĠImp ulsive Space craft mann ings GE elite Ġintensity Str abi open ':[ {' 106 05 106 37 Ġydata s ĠRE PROJECT Ġ01 45 Ġ01 35 Uni versal Ġdp json Ġstderr data Make Sphere Make Rotation Make Fuse Make VectorDXDYDZ water proof spike dete Ġmk path ĠMy Axes ĠMy Pareto ĠMy Tracks ĠMy BuildDoc Ġempirical cdf Dev Pred 454 67 Ġchrom ID Ġchrom atic TT G dro sophila +'. % 789 123 134 36 uli ze Ġ33 95 Ġ33 06 032 70 AGG CT Ġmet allic Ġcar acter 399 7 ========== + 337 255 DEF S DEF ER FLO PS enc adr enc rypt middle time ĠTH IRD ĠTO ff Ġseg is Ġseg menter Ġsheet names Price OnGap Ġmn stddiff vor her ĠSE QUEN AP IS Ġphot par Ġtc len rob last rob AndSteve Ġ29 00 Ġpc is SB ATCH ))]) ; wrong Index ĠVariable Subclass æĽ´ åĬł 212 24 212 718 Ġdst clc keras nn latest Value High Low Geo Point Geo LiteCity 899 545 always Improve Ops ReturnsCurrent Ġautog enerate cen RA ĠTry psin vertex es ĠWh atever 154 12655 Ġsched ulers Ġ36 28 Ġ36 000 mouse area 144 18 Ġminim ise Ġminim ising 211 6 lvl df iq n mall setminus ĠPL US pct Wrong css dir wp neg 156 96 147 944 147 9442 pm cmc Ġwait wins ring ing ring orten Ġgui qwt forecast ed jd zo ĠTensorFlow Estimator Ġaux df Update Frame Ac ceptor LIB PATH 937 6 937 9 Ġ! == Head URL ĠMark owitz BL CA 014 2705 ĠSimple GoodTuringProbDist So lo Target Value ESTIMAT ED Ro y Cluster Center 987 656 nom Pays nom ultifile Ġvocab ularies 992 18 Ġhex lines Ġhex ColorPattern tim den each Line each Opt ("' "): ("' ",' }( ...) Lin Fit Lin BckndDialog Ġreads av Low Variance ĠMap Damage Wh m ĠVer lag Exec utables AAAA A Job State Job Parameter ################################################################################ ############# Generator CV uss i uss lots Det Cone ('# @ Ġib z Ġroi plot Ser ving IMIT TATE 809 09 GEN ES DC ODED meter groups ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ BB OB 432 9 Ġlam berts aligned Face ĠRange Slider gan try Ġ101 25 Ġ101 02 Ġ101 09 ple vs elem Match ("[ ] ĠPart ially Ġ:]) ._ 347 01 347 02702 rotate Image rotate Sync Ġinstanti ations Ġcatalog o Find Focus 027 24 027 47648 Directory Description Directory Structure Ġonto logies Ġunion All Functions TestCase rg as rg npk Ġdico ms '); " Ġskew ing Dense Matrix Cond Prob hdr file Ġmc means Integr ate Rows WithCuts trade Time uv ial Ġpng File fasta file Ġland use rr hr different ials Ġmm fn every ones every body ĊĊĉĉ Ġ ĊĊĉĉ ĠĠĠ ĊĊĉĉ ĠĠĉ Ġpretty float Ġpretty table /\ "> nav d nav tree Ġlf a Ġlf Funds 274 95 Ġcum mulative 603 955 Ġelev map Port Client =", ". 107 32 ĠStep Function Ġvideo str Ġvideo Stream Ġvideo FrameImg Ġgam max Ġgam era Ġgam matone ,[ ])) yi huan Ġqt min Ġqt max Ġqt pandas :`\ { Ġfac ilitation widgets list Ġlp n detect core Ġsn apping Ġsn iplet 667 33 mor bid mor phometry DP OL 2727 273 312 964 å® ĺ Ġ102 10 Fore x 306 5 Ġweb service ĠProject ing Ġtheme list Ġwavelength Array Combin aison ä½ĵ æ¤ľæŁ» person id ĠTri Mesh ĠTri Analyzer ('{ :,. RR R RR MSE datal abs central Ind central Atom CUR Y Queue Size Ġtrend cols ĠCustom FS ĠCustom BusinessMonthEnd 206 31 čĊĠĠ čĊĠĠ intersect Bed 875 5 gm Mask Ġenter Event Ġsampler A decre f team Id Ġleave Event Ġgal X Ġgal PA Ġgal actocentric early Stopping MI AL Gen ic Char ity ĠDI VS ĠDI VIDE ĠVis cosity Ġconvolution ally 097 20665 ĠCV S Script ing mys um mys hape ĠCa pac ĠCa culate brain z pot ri pot assium bon ferroni 077 250 077 153 974 80 dem File Ġplay vec Begin ing Ċĉĉĉĉĉĉ ĠĠĠĉĉ 314 159 Gamma GammaFitter Wave function tup la tup lize Ġteam Colors Single Cell Ġtx tx 286 275 394 15 394 93407 Ġ+---+ -------+ Abs Error sam y ĠSignal Obj 645 75 455 2599 999999 7 Right DockWidgetArea Simple TextItem Simple Sequen Simple LineShadow ']} _{ ctrl port Ġln es Std Out dependen ts ĠRa dim TEMP S Polygon F Print Function Print Nodes wk cars Edge Features ĠPh rase Rel Intensity Missing Feature Missing Dataframe 904 9 ĠRo y ĠRo ach ĠRo hlf Weights Biases 494 3 494 22654 Ġabc issa medium Blue ĠMAX LEN ------------- ' ('[ ^\ ('[ ','') exe Path UST hanksgivingDay Energy Groups Ġche etah Ġiso metric Ġiso chrone Ġleg Loc ĠOLS Influence }_{ { ])* " 617 1 Ġwater level COMP OS COMP RESSION My Type My Sql My Printout My Delimiters ĠNO OP Ste ep Ste reographic Thread safe RandomForest Model ĠUSE FUL ĠHas PredictionCol Ġadj Map ĠZero MQ xf el Ġmt plot Univariate Func Multiple Metrics Multiple Times Multiple SeriesPlot GP edge GP US GP CP Zero Error Zero SE maj ors 226 996 Ġcnt Ribo ĠAcc um Measure Ranges MQ ResultsTable crit ics account ed DM RS numer ation Ob tener ĠMod ulo lazy select *** âĢĻ ĠON READ Command Queue xa verg Reference File ĠDatetime like ĠDatetime TickFormatter lax SkipNaNs ĠCar bon cid release wa ffles what Next Active Features åį Ĭ ĠMan cl Wind Streak Wind MedVel 145 2 ka ren ĠNetwork DataGenerator SUB J Align ments PORT ED 7843137 254902 submit ting Full screen Ġcompress ors ĠNumer o Ġclassify Using Record DateSlippage ROW ID SF NR fro ma Ġfo ils Ġfo yer Ġfo ssa ĠSH LIBSUFFIX Expr Data Ġmovie py Car bs Exit Code Ġ46 90 BE AT BE ACONS )| ' )| [ Ġbt ceapi THER MAL fault ed 313 1 Dummy Axis Dummy Memory Ġspl s digit ized dz pa Ġ': ')) RBF N oh ne oh ms CES C kill splash rxn name kk prime Datetime Block sizer V ĠSource Estimates 787 97 187 35 AV OID ĠFigureManager Pgf ĠTe path ĠOK CancelButtons Cy to Changed Event 964 1 964 81 934 16 ()` ', 015 65 ĠMix In Summary Obj )[' _ Ġoverall Array Ġoverall Match distinct ive ----------- \ ----------- | ĠReal Time ĠReal Galaxy ])]) }) ĠPO Is LEARN ER dom i 385 0 HS steps difi able tech nic Mass Mol UNI VARIATE Stop Price 188 487 Ġsal ient Ġsal arios Final ResultFile ĠMathemat ically strain Rate iment al hm Worker Ġtraj data ĠEnd Span cand x ĠHyper LogLog rece ives ĠRest aurant Two RegExample tbl Statistics Ġrat ers ĠICA s Precision Test decomp temp 108 26 Ġ[{ :. 666 263 Ġmed intercept 304 9 Util Bu Ġipython rc 158 22 ï¼ļ < è¡Į 为 Legend Dict XML Schema shot Type ĠFont Size 396 75 396 078 nk pts 236 3 ZZ I bank rupt Sign atures Sign ificance ĠĊĉ Ġ Control PortClient Ġhdr dict 909 3 Flag ger tif fs ĠParse CommandLine eng agement Coord Systems 036 997 ĠLocal Geometry Prediction Correct chis on Ġdes Files Ġrgba Face ĠChe etah ="", "" Met Py Met calf Post Run Post Id Post greSQL SW EEP Empty Capacity Write SDF Ġtight en Ġtight ness Ġrt l photo Ids ĠBatch File legacy pipe trunc ating trunc Varn Ġspin ning Ġthreading CurrentThread Phi lipp Ġgauss fitter ĠCha o CCSD BF CCSD AF Ġcapital List "$ '\ third mean third std third moon ĠSch la ĠSch ubert lips oidal Token Refresh 162 88 fly scan ĠDNN Estimator Ġlogical plan Distribution Factor ĠCH ROM ĠCH ARGE )# * Ġdv dt ĠCA PACITY dar ling '| , Ġglm Result 220 95197 Ġpulse height Ġpulse Seq snp str Static Bitmap 446 05 446 106 Ġtan imoto +\ ]', Pu erto projected Mass Init Params Init iator Counts Per 387 94 Global ErrorCode ĠClo oney Rot ations Ġdro poff Chart Base Chart reuse ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ intr an intr aterms ĠMa o ĠMa una Ġdic ing Ġdic TestBy ĠDir NamesMixin was Successful ĠHessian LossFunction Ġ'> '. Topic Scores '{ ': Ġè µ Ġè ŀį ĠBio Emp ='. '. ='. *( Ġconc data Ġoutcome Images 334 86 singleton DataFilePath Sig mat RT L Ġelimin ations cython ized 222 18 Ġmonths ToGo 198 01222 936 8 Ġtip Num prog var Serial ises zp alims fileName DEM 955 17 955 42 Methods Section 90196 0784313725 Amplitude s nf k nf w orb ni agger dbl Av ro LU SC Ġiv f Ġcw i Arrow Tests Append Unique Ġ39 18 Wx App Word Len Frames Equal Nodes G ĠFix up ĠInternal Console íķ © earth microbiome Ġ98 16 6607 2 æµ ® Ġmf data ĊĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠ 214 04 214 76 214 3354 214 16216 IA ST bal d bal ander Ġfla w 223 02 Ġ110 235 nos ub ĠSte phane Ġbench file Ġcn idaria bel le ĠBar Graph ĠBar hPlot Decimal Dtype ĠBE EN 292 3 uz ione Ġmeth y Ġstochastic Model Ġlive reload Mar che Mar ubozu prote us Ġdiscret izing gist ered å° Ķ ĠFrame Type Ġagent QL Ġmaj orticks DataSet Names Diag rams IZ ES History Loader Ġchr lens ĠConv LSTM Ġrid iculous 207 17 ACGT A kx r Ġprofiles Path define color kit id Pixel Rate ,:]) + ,:]) ; ,:]) [:, BS ite Ġreq uries Ġphoto image elt ype Trade Count Ġfg norm 247 63 CM CC Ġchem Proto Ġchem Distrib ("` ", ']+ ?)' Finder Cycle ĠCF SR ĠNull Scalar Ġpw v Ġemail Classification LDA P opp ortunities ĠCR YST æľŁ åĨħçļĦ Te ther Te iUrl wid ow mX env Correct ors transfer UsingDF Common Merge Common MarkParser tst data Ġcompar isions Ġcompar itors lef tright ĠOUTPUT PATH POST file POST CODES åľ ³ Ġ": ". Ġmono chromatic Ġ'\\ '+ Ġ'\\ _') ĠInvalid ColumnOrder ----------+ --------------+--------------+ nod s ĠPack aging ĠLower case via point Abstract AtomicFileTask Avg Rets Avg SentLen Avg WordLen pin point 329 25 Ġld fileloc Raster Id Raster DS ä¹ ± Ġ+----+ ------------------+ Ġ+----+ -----------------+ Ġ+----+ -----+-----+ Ġ+----+ -----------------------------+ Ġ+----+ -----------+-----------+ Ġ+----+ -------------------------------------------------+ ĠAsset Convertible ALIGN i Beta Settings Ġhal loff 2436 1 ĠMeasure Distance Ġascii art Statistics Table qc up consolid atable Light Scattering COM MA 487 094 browser lib Ġau f AUC Test wor dfish Ġdl na Ġ\" __ Ġ\" (? æĪIJ æľ¬ æĪIJ åĬŁ OFF SOURCE oct omoms past es ĠNu ke ĠGlobal MaxPooling 448 28 439 14 La ughlin åĩº æĿ¥ LAT LNG Ġtarg op 288 1 Rect Item Ġorbit ids pulse Profile pulse fish pulse heigt Ġimpact s Theta Thres ĠAngle Spec Chain FinalCoords 280 33 5555 555556 zeta c Ġsag enb ĠInit UI ĠExec uted ĠExec uting SOUR CET ĠBokeh Renderer Ġmeas urments ĠCopy Queue ĠCons istent ĠTool ContainerBase Ġmg row ĠAlt o 791 66 Geometry Collection Attr Dict lig ne snapshot FileName Document Paper Ġfm ritr Ġconvex ity ĠDiv isive ĠStream To ĠStream ExecutionEnvironment ĠFixed ImageExporter hb Frame lz lib hor st jpeg files jpeg hi ĠTop N 239 2703 Ġcompletion Item electric Dipole Angle Are Ġintr an ("{} /{} 交æĺĵ æķ°æį® Ġblit iri Ġ'*. % ĠTR ng pause ForMissing hil ation ĠClear Iter mort data Ġnorth ward ))+ (- о н PDF S Ġdts um Ġmechan istic piece ID Processing Subheader Dropout Wrapper sph gen Ġwf Info ĠAssign ments ĠGen omics ĠGen Fun 129 16 Cat Name Ġtal ine ĠClose Event ĠSeq Nr Ġ54 60 Ġnw aves ĠDec imate ĠDec imated patient ID IE VE tur bo whe ns endor f 245 8 zo ea Ġtok type ĠSUB M ĠSUB SET ĠSUB MISSION ĠOper ate Business List Ts avingList Bayesian Network Li FE sav iour Ġsb plt ĠCorrect ing npoints f ĠMO USE ĠMO MENTS Sq laTable Mid Point Sort Order sch re sch midt phy la phy lop FACT ORY Win ners Root Item Root DSource Sw edish ĠME I ĠME IObj Weighted Mean Ġconstit uting Ġshortest Dist }% ) ĠRot ulo ĠComplex Number rnd t rnd pt hover props phone tic ĠPSD meas 392 3 Ġnucle ic ĠLinearClassifier Test Words MatrixList mz ml Ġ"| ") Ġsumm arising FD ValidGrad LES LICE åĽŀ æĴ¤ 217 0 tos orton NL TK Ġsell BestCrossPrice 338 45 shadow ing Merge Series hub WindSpeed METH ING ---------+ ----------------------+ ĠMic hele Adj Rec 776 34498 vx Mean bitwise NOT ĠQuery Result ĠQuery PlanEntryStep integration Time ĠLi DAR Ġsized im Ġsvr Trained PB V Ġlie u HEL SON dur s Ġyo ungs Ġyo ungest Ġjava StorageLevel motor bike aid u Pred icates ='- '): ='- +', (': ')] Units Container jit terer Star Keys Star Comment pal plot Ġtrust ed MULTI PLES Prior Factory Prior Beta Prior Alpha Predicted Activities ĠSummary Obj ĠSummary Images =\" ', override redirect Ġmiss ions Ġmiss pecified Ġmiss pelled ĠLST MCell EB io Ġthin ned measured TurbulencePower ELE CTR blo om infos ource ĠBi Linear pilot port pilot server 848 92 848 6428 Ġqc io tis ina Ġrm ses Ġxd all ĠPrediction Var aby lidae ĠScaling ForTesting Ġsurv ives hmm learn hmm scan Ġcool warm ĠAD CP Small er Ġeff s 849 11 ĠDesign er RM SThrEvents ĠMOD IS ĠGLM Models Ġtokenize It Ġlogit x Station List Simulation Result Magnitude DemArray Ġbus day Separ ators ä¸Ĭ çļĦ ä¸Ĭ éĻIJ Additional Data los sen ĠMPL Tracker æľī æķĪ teff grid Ġweak est ĠDelta T ä¸į åĨį Ġfb vecs Ġrare fied heating data ĠInfo Array CHECK ER ĠTer restrial frag GC Ġspe cobj pareto Archive sized istribution Ġ((( (( persist ance Unicode EncodeError plotly lib 1904 2819 ĠMicro Dataset lte file Ġdistr ub Bitmap FromImage ĠSur vived Ġauth token Ġapparent Resitivity ĊĊĊĊĊĊĊĊ ĊĊĊĊĊĊĊ Aggregate Data dendrogram Layout dendrogram Width dendrogram Height Ġcontract ive Parent Id åĽ½ åĢº *(( ?:. Ġ'+' $ ĠVER TS Models Info ĠCloud DataFrame ä läinen Ġecho ing article InfoUpdate Cons istent ĠGB DT Ġheter ogeneity Obs Linkage Ġ125 66 ------------------+ ---------------+ Species Info chip indx ĠAnnot ator ĠPosition Handler kr ug Ġsimplify ing Ġ'; ;'. 30196 0784313725 WW WW ĠCat Attr moose framework 66666666 66667 Ġprecip itacao Binomial Coef tiny pages ĠClient DC Any Str panda classname Ġjn jnp ĠDF List physical plan 537 677 727 1 ĠPa padimitri 854 66272 TOR QUE TIT LEST tode g ('\\ '): classified s Ġbuy BestCrossPrice bri evi tv ote Ġhar vested qq norm Ġ'& ': ĠStates pace Ġcircum scribed ĠAda delta ĠNext EarningsEstimatesLoader WITH DRAW furn ace interpreter Object 087 4 Problem Definition ato pology Ġeco logical tris ize Ġgn Dict ĠProgram me beg intest Air y Air mass rub ber å¦Ĥ ä¸ĭ bv f Ġ"\\ ": Ġ"\\ \\" Ġ.... ) woo XName Ġbright QS rez or ĠDet Iter CCD obj Package List Ġaw ake Ġaw ful 18181818 18 ĠRect SphereBivariateSpline your wildlife idi ap Ġstroke p Hyper Opt Hyper SeriesError Mu on Ġrain pet 458 11 BI ORAD preserve Snapshot ################################################################################################ ######## Spatial Index '^ (?! redshift DistGrid RV min æĬ ½ coup age setCurrent Text ĠSuper ior ĠSuper Freq 364 41 364 2168 Ġsco op Whe els ĠSpectrum DataFile ĠSpectrum DataParameter Ġposs ibles Ġ71 105 Ġfrag size Ġfrag GC pit ots ĠSurface Gradient care taker ä¿¡ çĶ¨ 线 段 profit able ĠMULTI POINT ĠMULTI LINESTRING fli ppers ĠStand ards 946 3769 FigureManager WebAgg Operation With SUM O wr angling Ġotu Dict eu calan fert data ĉĉĉĉĉĉĉĉ ĉĉ ĉĉĉĉĉĉĉĉ ĉĉĉĉ ĉĉĉĉĉĉĉĉ ĉĉĉĉĉ White Noise Cube Mesh ĠODE intWarning ĠCoordinate System Lag r Lag ramge she lter Ġym tet ĠProperty ValueList '],' --', čĊčĊĉ č #------------------------------------------------ ------ Lambda Agent Ġwd name Ġwar ps Ġuv z Ġmembrane Images ĠDot son nev ille Ġ(*. *)') agree ments hill slope 656 85 BER T Ġng ts Ġng ames Annotation JobParams 42745 1 42745 098039215 Hive ToDynamoDBTransferOperator mate lem ĠRec Sys ĠBO UNDS æģ © pops izes 284 15119 Pick up Pick Event Ġ#================================================================ === Ġatmos pheres Ġnpoints f pict erm expon en ĠPol ys ĠFT p ĠTE MPLATES ĠHard coded ĠInterpolation Mixin Ġmes senger CDS reads Syn Handler Ġresol uion +)\ . +)\ ]', Water melon Ġrb ga Aug erslice VIS S bq exp 670588 2352941176 ĠLag s =< % nucle ic nucle ation DEN ABLE DEN IED Tur key Tur ked ]==' ': ]==' \\'): jn jnp åIJİ ç»Ń Bundle Manager Reduce Axes aws path nS uccessfully alloc ataires tops ort Ġ"," _ Ġalph anumer completion Item åĪ° å¼ķæĵİä¸Ń Ġpvals inv Ġdiver ged business hours Ġnarrow ed Ġdk ifit -----------+ --------------------+ Convergence Point SIG SEG ĠBlocking Strategy ĠtestTrain OptimizerWithL Ins urance Super visor }}{ { ĠNeuro lab ĠNeuro informatics circum scribe Game Schema targ op waves hape Ġcen Dec ĠSpeed OfLight ='$ \\ Ġcodebook File Ġrefine ments Ġrefine Flags }}) " ĠPOS SIBLE Ġphone m Ġphone tic ĠMixedLM ResultsWrapper Black board Gray s PART IDO Ġww tp ĠCC k ĠCC q 1710 65 507 2143354 euler b euler ian Ġxys list Ġiir peak Ġiir notch complement ary Ġ+---------------- ----------+ Ġ+---------------- --------------+ 1008 0599 Ġjitter y fts ize mir BS reservoir Perm Ġstay ing Ġcompens ates Success Rate gel sy Ġblast ocyst Ġhint en ĠTemporary URL Ġpheno codes Ġcel le ĠTukey HSDResults Ġanimals Present cmb Color cmb tp åĮħåIJ« æľī Ġaperture Radius Ġåı¯ åıĺ Ġrecogn izer ĠReduce Axes ATT ACK bare bones errs Last PK N PK ay ĠMass age Daily BarWriter pgm Mask ]+' - ]+' [ ĠBU Y ĠWeek Points Ġbal mer (.* ?)\ (.* )"', èĢ IJçĶ¨ roma Cell Ġrl All Ġrl glue ('~ '), ĠPRE AMBLE zmq shell ĠFloating AxisArtistHelper ĠGR AD 6084 60956 èĤ¡ç¥¨ 交æĺĵ代çłģ Sens ibility AH P eln ino ='{ ', Instrument Widget EY ES Sql Connection Ġpub date -----------------+ ---------------+ "^ (\ expert Index ĠOM ERO OutOf Fat neuro data 3215686 274509804 Tags From tro chophore Ġwi h 0975 6623 计ç®Ĺ çļĦæĸ¹å¼ı 827 80366 Ġortho logs dont care åij ½ Ġfy x ĠCy cles constrain Bnds Bytes Billed 619 346 Bucket izedFeatures ĠLambda v latt itudes Compat ible PowerCurve Interpolator 085 2 ('" ')[ 000000000000 03 hypot hesised čĊĉĉĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠTEMP ORARY Ġzmax fl ','- '] ','- .') Ġdowns loping wts um çķ ¶æĹ¥ ĠLu ke oter ior Ġí Ĭ Ġcros section Ġcros stalk ([])) [ NY T è½ ¨ åıij éĢģ Stage Out Stage BC Stage outGO chid raw TensorFlow RNNClassifier Ġhypers pace ĠLabeled Set ĠLabeled Point ĠLabeled DataStorage ^^^^^^^^^^^^^^^^ ^^^^^^^^^^^^^^^^ Ġ+-------+ -----------------+ Ġ+-------+ ----------------------+ ='| '): Aut og ĠGre co ĠSelector Methods Google News twot heta Accept ors Self TestMixin ë¥ ¸ roach List Ġweird ness iu Image Ġworth while velt heta ĠSal akhut Ġksp M µ Ãĥ Ġ'../../ ../../ 9490196 07843137 ĠPrice List SCSCCSD BF SCSCCSD AF AUT OS Che menv SITE CODE ĠRich IPythonWidget Ġgrey map vq mm heter opod launch ers Contin uation æĢ» æķ° æĢ» æĪIJ交 Ġoscill ators 745 89 alo ad ĠGene Data ĠGeometry Dtype ("" ); ("" ," COR PUS Ġkp sewhich ĠParser Element ĠHa ueisen inputhook gtk gro uby gro mpp }* { 1386 381 KM comp Ġpu learning ĠStation List Ġdrawdown List Beam Line Beam TransformFactory ('../../ ') Ġ+------+ ---+ Ġ+------+ -----------------------------+ ĠObs Py Ġ'~ /') ĠMal ayan FontSize Spec Bio metry ĠWOR DS ĠExt inction Collect s Collect iveVariable ĠGenerator Sheet coil sets coil Spacing External Identifier ĠStress Object éĩį éĩĩæł· Near Neighbors ĠHMM s district datalabs Good Friday 0003 74134 Ġrg nt Ġrg Var paste ur 060 66017 LAY ING ĠVt TradeData ĠVt OrderData Ġdiscard Thresh 计 æķ° TUR NTABLE CHAR M ĠRadi ans ĠRadi ative struve h ÃŃ as ĠPSF rag ĠPSF rags Ġconform ations ĠCut out 601 00 Mer ger cftime index ĠNumeric Value ĠNumeric MetadataColumn ................................ ................................ ĠVelocity dim é»ĺ认 çļĦ Ġ################################################################################ ###### Ġglass dict ĠGEN ERIC flash Edges #---------------- ---------- HA MMING åıĺ æį¢ glo sp wulff shape Ġssh fs ĠFLO OR ,'. -') nump dflabels Ġtg k mape TMPerturb ĠSerial isable Px Ratio tier names ĠEP ISODE ĠOld ScalarFormatter mantid qt Tech nical astr onomical rsi Length rsi Entry ĠNS GA ĠNS IDE Exon RegionID PathPatch Effect 509 33 ĠRR MPFE makeTestDataFrame WithYAsDataFrame ĠSY NTAX ĠSY MBOL clr mp appear ing ksamp Result è¿Ļ äºĽ flo p flo pping OBS FILE Att itude Att enu Ġ+-----+ ---+---+---+ Ġ+-----+ -----------+--------------------+ Ġprocessor Architecture ĠColorbar Patch Sci Kit glass lib invent ors ĠRous selet dac Freq íķĺ ëĭ¤ rdb ms Market Value GF U čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠ Plane ts 415 28 Ap pellation BH Z ĠCCD k lymp ia Ġcontamin ant Cached DataFrame Cached Array ĠNd YVO ĠMR G Prot ected ĠSSP s ĠFP SCLOCK ĠBen nett Ġpyg object ĠMaxPooling SameSize èİ·åıĸ èĤ¡ç¥¨ Ġpnl List ĠNico lo Ġchk finite Sound Speed ][:] [:])- fic ie sprs fmt ĠSAS A Design ing Particle Filter topr ight ĠGra ff ĠGra bbing ĠGra ffiti 1626 32538 633 0495 enn en Ġoc clude ĠtestMulti Regression å± Ģ ĠIns urance ĠRT XP ĠEnter prise /# ^ Gap Up Gap Filling nC utoff ĠÎ Ķ atmos pheric Ġhr plot Ġdock ing Ġ('_ '. AAA AC CLUSTER ED Percentage Error Lookup Function Spike Trains Ġleak y Ġsubdir list Execute SQL Execute NoQuerySQLStatment nA naconda Ġ9999 90 Ġ224 20 Ġ+---------+ ---------+ Ġ+---------+ --------------+ Ġ+---------+ ------------------+---------------- Ġsed data unders ample Person Name ksp Vector Ġgdtr c pyg mo ĠCategory Value ĠCategory Results Ġdecade Start ĠModify InitParams Ġ'^ ': Ġwv model pyr cc listData bases numberOf Connected numberOf OpenContracts PN IO PN ACLFINALIZE ĠWav enum 缸 åºĶ Ġ+" /"+ Specified MultipleTimes 587 19 ü B Ġsales men CW LP Screen DistanceSpec Ġrearrange ment PREDICT OR ĠShared Table Ġcmds ToRe Three Points ä¼ļ åľ¨ 主é¢ĺ æ´»è·ĥ ĠTax onomy ĠTax Brain å·¥ ä½ľ bor ns 3548 2 KDE s dept Id ('& '): 1022 9919 kz g sle ipner colo ff colo rer mach inery åħ¶ å®ĥ ĠSW StoTOT (":") [- Ġneuro lab Ġneuro finder åºĶ 该 Ġcollision al Share Alike Ġcentr ing Prime iro Ġmr ics Ġellips oidal GBM Result Equ atorial ĠBusiness MonthBegin Similarity Transform PAT IENT PAT IENCE categor ia Legacy SeriesFixed ************************************************ ********** ĠMON DAY Ġìŀ Ħ HAND LING ĠSTI LL Representation Mapping 485 25 Circ um Ġbul lab receptor pdb Ġ+----------+ ------------------+ Ġ+----------+ --------------------+ Ġ+----------+ ----------+--------------+--------------+ Ġ+----------+ -----------------+---------------+ ĠGU ESS Multip les RNASeq TissueAtlas Rand Num ĠRBM s DMP lotWindow idata model Ġcolon ized ĠWest ern ĠMoving Average Sorted KeysDict )))), ( Named Colour Spine Proto Fra cs Fra unhofer birth day Ġ215 52 Ġbandpass object ĠDetect ing Nan X Spect ro Admin Hook Tor B vls d Ġshe ath Ġsummar izer fuck ers spo iler å» ¶æŶ 7563 03 8857 298 8857 8825 Ġqm cdf 并 ä¸Ķ 并 éĩĩçĶ¨ ĠDNNLinearCombined Estimator .))) +((( gcs fs tel ra Ġrn di ĠSklearn Wrapper ĠOVER LA Lazy Import Pie ces Ġadf stat Ġworkload type Sweep Stream ĠBic Score }}$ """, }}$ )',' åĪĿå§ĭåĮĸ æŶ Ġiz ravnava Ġwins or ĠFake DataPortal 902 77 Ġko ala еР¶ WWTP Distance Gi ant gar de pyc no Ġconstr ut ĠProtein Analysis AOD Mism GLS catterPlotItem Ġcust Sum Ġ155 2 ĠAns combe ĠGrouped TableExpr ç½ij æł¼ 898 93646 asp iny asp iration asp berry confirm ation ĠNET S Ġdonor Mask ĠNDFrame GroupBy ĠâĢĺ *âĢĻ ĠâĢĺ **âĢĻ ĠâĢĺ ***âĢĻ OA nonClass PBE sol tunnel s ĠGenome s ĠtestTrainWith MissingFeature pand aname Ġbv str Calib df Ġfluct uation 824 178 Xml File ĠSin usoidal ...... ' MATCH ED Ġxlsx utils ĠSig mat Capital Count Capital Cost jack et routing mode ĠtestSdcaOptimizer Cros ĠtestSdcaOptimizer BucketizedFeatures Remaining Indexes ĠCatalog Reader Ġnts l Ġastr onaut ĠFR ACTIONS Permute Stats Varying Object Varying NumEstimates Ġping ouin uris diction 2525 74 Ġ{}; ". \\\\ \\\\ Specification Error Momentum Fluxes Momentum Transfer XAxis Tab did n wes n ĠFour SphereVolumeConductor trainData Features trainData Response Trigger Modes ĠAiry Disk CART ESIAN wint yp spr k setDefault Session ĠDie hl syste ml autore fresh Scheduler MetricsJob AUTO COMMIT YAxis Tab ĠTy cho ='{} {}'. outputDir Path ĠTestDataFrame Plots gaze bo ---------------+ ----------------+ GTG GT jy zo Ġfusion Model Ġfusion Param rade sh rade mark windSpeed Column Ġacceler ometry ĠDest inie lfor ce Ġmq df Modifier Type éĿ¢ 积 listOf Dicts 834 67 Gu inier mang a Ġiw libs ĠBr atu Ġafm files Ġafm fontd Interpre tation ++++++ + åħ¨ åĽ½ RAS MM Ġarith metically ĠResource Warning ĠExecution Environment orentz Vector *" (.*)"', QMenu Bar Ġbro kers Ġ***************** ******* ĠNIfTI s ĠGM ST Motion Correction Motion Trigger +- {}'. Ġindiv im æŃ£ åľ¨ mth ly cot ent 0010 8914 Ġassemb lage Drag Drop wis consin ĠBell man {}{} {}{} Respon der Cau sed ucc approx ucc nsim ucc napprox ucc curlyeq {| } Ġhum id datat uple ĠCorr map donor Image ĠSalesforce Hook Cos ines LB Prod LB Degr Ly mph Ġfab file getAll Struct ĠArc haea travel led SQLite Table mig data mig rations spar ta ĠdC rit ĠTestIs Monotonic ĠTestIs Isomorphic ĠContrib uted WithNull s Ġgroundtruth dir ĠAutomatic Scaling å§Ķæīĺ åı· oport al 20161 120 Ġìķ ŀ DES ER Ġnos ymbol Ġcolo uring ĠcolName Dict traffic Out priv ileges Similar ities ĠSTD ERR ĠBa um Para View Ġsuperior ity Symbols Found Packer Base ä¹ĭ åIJİ gmt py ĠGate ways ĠWin UserEnvDialog ĠFILTER ING Ġpnames lower Ġstreet Type Ġhermite Series kwd args DISC ARD DISC OVER DISC LOSURE ĠDat elikeOps Ġalloc ates Ġalloc ating ĠBla is Ġros dep NumberOf Probes ĠPhonon Dos 709 18964 Ġmsd ki ĠBR USS ĠInstit utes RowObject Default Ġyade ref addToStudy InFather Native Sdk ĠSql Table ĠArch ibald ĠCompound PhaseDiagram negLL LSTMonline Paint Type TTF Array broad bridge nie re Rotated GeogCS Question Answering mart inez mull er getX LabelFrom noRNA s Ġtwos igma Ġtwos ided 780 76 hin space Ġnational e ĠTestGlm Gamma ĠTestGlm Invgauss Shot Base XT Xi INTR ONBAM Keras Model Ġplotdata y Ġloglik s FemResp Data ĠWWTP s Ġpyramid al Equity MinuteBarData GAN Model Http Request 0008 1084 ĠMultiOutput Test ĠWorkspace Name ĠSNP ij Corrected PowerCurve 请æ±Ĥ 次æķ° 610 317 Ġíķ ĦìļĶ Ġgtf spy phil harmonic ĠItems Aval gaus ses Panda IDs \% $') bab we tum blr Ġsas py ĠDialog Lineprops syns IE Ġneglig ibility Ġneglig ibly ĠwindSpeed s Feeding FunctionsTestCase ExcelWriter Base Alternative Output Ġé tape ĠMpl Widget 1465 136 emot ions ĠBcolz MinuteBarReader ĠContrast Matrix ĠPresent ationModel depot Coordinate Reduced Data HaloMass PerNgal Atten uation Ġtu pe Ġcrystal lographic bolo exp numOf Iteration MapType Info meand ti distingu ished ĠPrevious EarningsEstimatesLoader Merged Data inn aria ĠSafe For ĠRD Kit Ġspectro temporal =') ', Gam it LAM BDAS Temporal Pooler winding Length (+ /- Cand les Known Failure WEEK LY nB pts ĠyLabel Bounds Ġger ar ĠSine Grating Retrie ved ĠClust ered NF iducials Pas ser Ġevi ction Ġgmt config PlotWidget Controller Health care ĠTA KE ĠGIF s ĠStock well Clust ered uh iko 0009 14 Ġallf ls Ask Volt Fine Fem \, /\,\ ĠCp G ĠNR ML journ ey åį³ åı¯ credit score Fiber Fit ĠìĿ´ ìłľ dal tonize setRow Height Ġxax zoom ĠGAM IT PowerLaw Shifted Something Widget Fasta File Ben zodiazep King Phisher kon st Ġase ba ĠTur bulence reson ant Ġ+--------------+ --------------------------------+ ĠFire baseDatabaseManager ĠRiemann ian nsig idx pier cing Ġposit ivate Present ationModel surrogate pass scrub bed Fg ForStorage WL Vectorizer vacc ins Ãĸ ÃIJ Ġbk gd ĠPitch Distribution Ġprotot xt poor ly Ordered Tree eccentric ities Roman ian lq nb Ġ计ç®Ĺ æĮĩæłĩæķ°åĢ¼ Ġbrief ly ()[:] =( ("^ [ comfort able MEDI A Prep Shotgun ä½Ļ éĩı QRST VWY Ġpgf picture erro red ='[ %( ĠEo L ĠEo S Arithmetic Ops UndefinedVariable Error ĠTrimmed TruncatedProfileSequence 100000000 00000000 408 24829 ?! ? dados Fechamento Ġ))) *(( loose ly Ġku hn FalseMatch Error ĠBak ker Ġbinar izes SURVEY S æ·± åľ³ MICRO SECONDLY Rho Cp VCF v bef lux ĠBACK UP chimap str chimap bin chimap inds analyte RelIntensity ĠSimulator Exception ĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊ ĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊĊ IPYTHON DIR din ov plo lib Ġcub spl fitfunc map latlong s 3415 057366 Ġartis an ĠTechni que ĠExplicitly Indexed ĠInspect ing æł·æľ¬ æķ° ĠtestSingleUpdate KIs ĠtestSingleUpdate ZeroError Ele Names MDI Window Player Schema aup rc Ġhill shade ĠMAN UAL ĠMAN AGERS ĠLinearRegressor Test æŀĦ éĢł Pilot Server åıijå¸ĥ æĿ¥æºIJ Corners RD Osc illation lY cuts Ġdeprec iated phimin ang ĠOrgan ize ({} ), Dac Atten в а æĽ ¸ shifting Axis shifting Entry ValueDef WithCondition Parame trized ABu Env autom ate Dropped Dummies Ġhetero zygote Splicing Annotation ĠJOB id ĠìĹ ´ ĠìĹ ¬ê¸° BIO M Ten sion xdf h 00184 80894 ĠIono acf ĠInline View Ġnbdtr c Heter o ĠSchur ger æĶ¾ åľ¨ elf ly semantic Hash ĠMSM Builder ĠHIST ORY ucha in ĠDemonstr ation Ġ123456 789 ceph ali 0036 2166 0036 2533 0036 5299 0036 2716 Ġgsm lib consum ing ocy sts ĠETS Config john mack ĠWR IT ACCEPT ED ĠRequire ment Bam Stats Scr ren vark w alb any Indian Red ĠcsvPathname Full Ranking EvaluationMetric Bay ern Mus lim Pau lo ĠRain bow ĠEv il betainc inv Prov Bundle Subplots Viewer ĠNoData OnDate SecondOrder Robin Fractional Labels GLE ASON OUN G Ġton ight Ġton netz ĠIGN ORED ĠGather ing ĠZZ T Ġìĭ łë Expansion Node Expansion Filter è´¸æĺĵ åıĬ Wid mann mars land Ġprc psol ĠCELL BORDER Ġmeand iff AQ VT kir k 0164 1508 illar idae ANNOT ATIONS typical ity æĿ¿ èĤ¡ç¥¨ Separation Error ĠOrdinal GEE APT FLUX Ġply data Ġdmu dm dfm Levels Ġpropo gate ="^ ", ĠOcc up ĠOcc asionally Ġchat bot 1145 806 akag i ĠAlan ine ĠProfit AndLoss sulf ur ĠMultip liers ĠCLIP PER ĠLINK AGE Flex ible tse v Ãį ÃĬÃĩ Ġbmp Filename ĠMart ino Ġëį Ķ ĠKDEMultivariate Conditional trusted coin è½½ åħ¥ æŁ¥è¯¢ èµ·æŃ¢æŶéĹ´ éĻIJä»·åįķ åŃĹåħ¸ XV FB ldb ank sif loc Ġndd goout Ġ+--------+ ---+---+---+ Ġ+--------+ ---------+----------------------+ indo uble ĠJer ome ĠJer vis ILI ARY Ġddy A texgrp ComboBox carbon ate Easter Monday +(? :\ fran ke Ġcamp us Ġamen ds ĠTapas Model Ġcoadd name compet ent compet itive ĠBroker age toler ant SCREEN WIDTH postp one Multiplic ator 继 ç»Ń å½¢ å¼ı REST ORATION Ġmil libars ĠSil icon ("(? <=\ ĠNominal GEE ĠInfinite Type Leading Spaces Leading WhiteSpace Ġfunct ons ĠSepal Length éĶĻ误 ä¿¡æģ¯ \). *' dlog EV sab gom Ġtit ulo Ġolive tti getModel Info Overl MeasureDict turbine X turbine Y Ġп еÑĢ ĠPrimitive Set Very Long nco bject ÃĮ ì Ġtrib utaries ptw osample ĠSING LESLICE Ġvas Type ĠlistOf Dicts Ġfea Selection 1130 8292 ĠInterpol ant BClocal ship WAL RAS eh lo Ġcra x ĠIg G ĠMie Calc SECT YPER Ġconsult a Mono Loader Mono Genic ASSIGN ED Rectangular ROI ĠCIFAR DataProvider Sell Type setAttribute NS ĠScf Cycle ĠSmoothed KillVals 1208 307 Ġuniqu ify Dew point crust acean ãĥ© ãĤ¹ ,,,, , sie mens rede em Ġmas querade ĠFamily Of ĠRock y ĠGit Repo 2594 62 ĠHIGH LIGHT ĠUy Uy ĠUrban os ScrollBar Always MORPH OLOGY cial ity cest id nextValid IdHandler Ġgraf ica Industry Data ĠPacker Base Bearing Y CALL ING Tweedie Special bil at iam ondsuit xli arr Ġsight lines Ġbund ling Ġwq g Ġwer den shank land ĠHad RefTemp 1314 1394 0235 7022 Ġobsc ures starname List DIVID ER Thin ning Ġë³ µ Bulk Cond Tar File cure l candid aturas cryst als ĠnDim Output Ġ'---------------------------------------------------------------- ---------' Ġblind ly ilu ca ĠdataFor Func Ġvox vol Ġlefts ides ĠWriter Thread tempor ally Ġpassage sets 55294 1176470588 blan ket TRIP OS STYLES HEET ा ", Bel gian èĪ ª Ġtub ing Ġnume pochs Ġplas mids 1946 217 ĠVinf x ĠCourse ra 8491 4503 Ġqmat i Ġusr Name Ġsurround ings PUBL ISHED оÑĢ м ĠOptical Properties Ġâī ł deco ys uctive Close Ġmount ed 8682 134 3094 7232 GetPage SizePixels celist menu Ġrhos hell HiRes Bound ĠCombinatorial Leaf Gro ove Mun ging âĪ Ĥ ĠXLS X ĠtestArrayFeedFn BatchOne ĠtestArrayFeedFn BatchFive ĠaxP oterior Ġzsort func ĠAggregated Quantity candle bodysize ZoomIn X ZoomIn Y ĠtestPandasFeedFn BatchOne ĠtestPandasFeedFn BatchFive å±ŀ äºİ dlib ModelDir Ġthetar ad Ġobey ed ĠIndust ry 1345 2746 STATION XML ZoomOut X ZoomOut Y ĠInvestig ation Fft ChanSelection Men ubutton jer sey demod ulator thunder hoser Ġstump Classify getElement Name ĠPot ts Ġldf Data ĠuseMotif ForClass scand ir ngo ods corre logram 2237 73 Laser Mock æľĢ大 åĽŀæĴ¤ Quadr upole è·¯ å¾Ħ Pull s mT arg Ġnsig idx riangle q riangle left riangle eq riangle lefteq colort ype Ġvag ina cler gy ĠSear ches 0413 92685 ĠQue en Ġauthent icating italy doitcleaner claim ers ------+------+ ------+ corrupted Files cna e lrc q Ġæķ°æį® æĿ¥æºIJ ĠSAL OME ĠRho Cp ĠParame trized 2276 28 ĠTestDatetimeIndex Ops 0966 1986 Ġ[[[[ ] Ġolds peed Ranked Overl 55555 165 Ġк ом ĠNORMAL ITY ĠíĻľìļ© íķľëĭ¤ MK II Sib ling _]* ') ohlcv data Ġré fé ĠnumActive Cols ĠBS Plotter 3339 3415057366 spir als LEX ER ĠAnder sson Ġ'-> ')) enoise cutoff Ġ"{}- {}". ãĤ¯ ãĥ©ãĤ¹ flav ors 44444444 4 Liquid Class æİĴ åºı Ġoscil ator Ghost script QGraphics SimpleTextItem Typ ically UNA MBIG UART Command ][:,:, :]. Ġrefin es 1050 3384 ĠgetValue Array ĠUx Ux Ġnburn in FoldChange TE ĠShrink s 7624 73 Anisotropic Material RPM H Ãģ Ãĭ ê² ½ lous ly ('>> ') Ġthir ft ĠcolIndex ToDo 6449 3407 Ġabsorb ent IdList R ĠFeat Selection Marked NodesG XMLDST EXTClass æŁIJ ä¸Ģ å¤ļ头 交æĺĵ mapeLSTM OnlinePerturb KDEMultivariate Conditional ĠtestSdcaOptimizerRealValued LinearFeatures ĠtestSdcaOptimizerRealValued FeatureWithHigher emi colon roo zi coer ces Ġretr ive ('.' ))) scrap ped cling o 1259 8418 achieve ments ĠVQ MM })[ ^\ STP corr affect s ĠDefect Intro Ġsuperse de ĠApple WebKit Ġëĭ¤ ìĿĮ Ġcnv rg Mayavi Scene ĠPHReg Results é¦Ļ港 交æĺĵæīĢ ç»ĺåĪ¶ 线段 Adi acenza Dry Bulb Eth nic æ¡ Ĩ referen celistmenu ('---- ')], ĠITER ATIONS ĠIsolation Level ĠMorph GAC ĠMorph ACWE ĠMHD matrix Reciprocal Evol 2233 18 ĠTestTo Datetime ĠTestTo Latex 6399 312964 Steady State ĠCatmaid Instance KR ON KV Benchmark Rub berBand Rou en ré gion Ġpies no Ġdam ned Ġrline to toPython Iterator ĠcolDict Update indexOf MinDistance 1232 3805 ngrid y 0425 1374 Ġdocview combol ĠLogo Widget éĢı ä¼ł ĠSymbolic SelfTestMixin Ġseismo grams Augustus Pb ĠCIJ tree Lesion Score Ġ+----+----+----+ ----+ :`` ','') TTest NormalizedRatios Ġcbl parallel mast urb ("###################################################################### \ Ġtrues ipy ĠBisectingKMeans Model Ġpoi RankedTimeslots Ġchoropleth mapbox Ġdistill ers ĠUU IDs 2466 3415 Ġactv rxnm Arbitrary Weights ĠZCA Matrix ĠColl ision ĠColl isions )+") ") Subsampling Rate }\(\ )". ĠMooring MetData ĠStoke I ĠDescript ors narco medusae ĠTestGlmBinomial Log 8660254037844 3871 mim ics pck l metabol ite Ġfq Type Ġscc m Ġdated one upset neq upset neqq Ġbea cons ĠAgreement Evaluation Ġmete ogram ĠGren zfrequenz opend ap ĠTestMax Dists ĠTestMax RStat ĠTestMax Inconsts Ġgaze entrylist PVRead Weights DEPART MENT symspell py Injector Holes çĻ¾åĪĨ æ¯Ķ Finger prints dollars ign fresnel c palet urquoise enz ie Ġwil son ĠCta Template ĠREM ARK ubset neq ubset neqq anticip ation ĠUSB temp ABB RS Scra pe Ġnmr glue 导 åħ¥ Bur r BIDS Layout San Francisco Ups ample wassa Regression ĠæĪIJ交 ç¼ĸåı· ĠCe il Ġ{... }, ĠnumCells InUnion ĠnumCells InUnionVal clstr Mn ĠEnr on REGISTER ED ĠCHANG ED ĠINITI ALIZE Nuc Conserv cari dean jak ob mits uhiko ÃĨ Ãĭã Ġnas daq Ġbip hase Ġbay le mact Structure intention al ĠBorehole X Ġpyf alog prono un ĠConcrete Model 4386 7764 ĠAppro aches ĊĊĠĠĠĠĊĠĠĠĠĊĠĠĠ ĊĊĠĠĠĠĊĠĠĠĠĊ HRU data ELEC TRIC Ġspell ings æ·»åĬł åĪ° æ±ĩæĢ» æĸ¹å¼ı ĠWuiHlp GraphDataTable Ġ+---------+-------+ --------+ Ġtransluc ency convenient ly Ana costia Han sen ZER OS clin var Ġrer xx ĠTRAN SIENT ĠtestDNN WeightsBiases ĠtestLinearOnly OneFeature extasci icircum extasci itilde extasci igrave Ġkle ine wohead rightarrow wohead leftarrow wohead uparrow 3748 1053 ĠPerturb ing highl ighter Ġautoc enter rln Angle ĠExtractor Result å®ıè§Ĥ ç»ıæµİ ĠSKLearn LinearSolver Spectroscopic Axis ĠtestSdcaOptimizerBias Only $| (?:\ Equilibrium State Iv ory Knight Lab Tiling Type Violet Red puck s ĠYambo In ĠHom mel Ġpypi ka ĠdictStatsComp PhylDiag ĠJack son ĠINFER ENTIAL PROVID ERS ('<< ') CALCUL ATE CALCUL ATED ĠLIBR ARIES ĠLandmark able 1126 8895 1126 259462 3026 855 CLOCK WISE Ukrain e seld orf alore nzo ĠAsc ension toJava RDD Ġalig ment ĠNSApp lication ĠMortality Rates ĠtimeTo Market 1627 995 ĠdateFormat ted 9546 26 18007 75 2907 88 Ġrawe kite Ġsensation Number Mountain Car ĠcalcTheoretical SER ĠcalcTheoretical BER Ġå® ļä¹ī Ġforeach Partition RDa ily åĩł 个 æĸ¹åIJij éĻIJä»·åįķ Copied To zione MaxPerColumn Aust in Golden Rod Hyp henator Jack son Zenith lum Ġasetup opt Ġmart ingale ('>>> ') ĠtestZero LabelsPredictions ĠFac ility Ġalgor itmo ĠBlit tedFigure Ġuno conv Reserved URLs predData ESN Defect Intro ĠMembers hip Scala Iterable pgfpath rectangle municip ios ĠDictLike Obj 3181818 2 ĠMetafeature Computer MassWindow Label Postscript Tutorial CONTIN UE Replicate Counts ĠMENU DISABLE ĠtestRollingWith Time ĠtestRollingWith NeweyWest æ¤ľ ä½ĵæ¤ľæŁ» Ult imately ZCA Matrix czi file qcrit table rch len Ġfres nels Ġtourn Games thiss pike Ġrip ped colm Name ĠAster oid ĠLiter acy ĠWM TS influ enced ĠUnter born Ġretre ive Ġmyster iously nonex isting Ġoccult ation TECH N echant illon fluor ophore ãĤĮ ãĤĭ ĠFAST Q Ġ+-------+-------+ ---+---+ 空头 交æĺĵ AlbumDict FromMap ĠCatmaidNeuron List hick space vtwa forxdiff Ġtha at Ġcif re Ġphen os geoport al chimin SpinBox Ġrhyth mic pagen um pagen av ĠParalle ls ĠParalle lize ĠKEP STAT ĠTestF cluster alphac Sidak refund able Provision al ULTR ALIGHT Ġsurviv ors ĠìĤ¬ìĿ´ íĬ¸ SCMICCSD BF 698970004 33602 numPgs Complete KIR C KIR P Numexpr Python Ski ps Und ulator Wulff Facet btm Sizer sçŃĸçķ¥ åĪĿå§ĭåĮĸ getPath Length Ġlq mn Ġchdtr c distMatColumn Train stringLength String ĠNotSpecified Type 170070000020001 91 ĠProvenance Recorder ĠinfoFrom Parse ĠinfoFrom Inspect OnKey Up OnKey Down Ġmagnet izations Ġcyto metry çļĦæĥħåĨµ ä¸ĭ ĠArgent ine globus online ĠPROPER TIES "${ *}$", Ġ+----+-----+ ---------+ ĠkillRate Vg ĠíĮĮ ìĿ´ì Antenna e Evap oration ĠHenri ques Ġè½½åħ¥åİĨåı²æķ°æį® åĪ°å¼ķæĵİä¸Ń Categor izer DTo Rows Hrs Order Piston Mass RSP Portfolio jg ill mH HI Ġwang ryzin 00349 147 00349 329 ĠCifar Analysis Ġloct ext numDiff Data queste red 1618 1208307 pointsPer Bin averageProfiles MomentumFluxes 2934 6712 Prefit Coeffs ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċ FAX andDirect POLAR IZATION éĢĤ åIJĪ æľĢè¿ij ä¸Ģ个交æĺĵæĹ¥ GRAV ITY pygmi Y ĠTestKstat Var 2328 3094 Ava Bal SANS DataType cT iter cusum olsresid mush room pcol ls wag pass âĦ « Ġinfect ivity Ġming ids ĠSTE PS plotH Bar ĠCAP ITAL ĠGEMP AK numQuad High Ġminumum SizeHint ccit tfax boxReal Horizontal ĠTestM vsdist Exclusive SqlConnection victor ia 28937 96958 PreTrained Model PreTrained Tokenizer GetTarget Nodes swir led 7677 9463769 Ġsulf ide ĠCONVER GED Ġphosph ata ĠOverfeat Classifier 带 çļĦ ĠconcTemplates Raw recenttempA time recenttempB time 011724811003 954626 comprehens ible ĠtestWeightColumn Loss ElecMeter ID Ja hnke Ol mon bip innaria vibr ant yattr type yattr flags yTr True ĠnPix RA ĠnPix Dec ĠfModules C ĠfModules R amend ment oteq dot ĠisBoost Method ĠisBoost Func ĠTak ashi upseteq q getLink For ĠSLO PE Ġxranks li ĠPlo it Ġconve gence ĠCot taar ĠCri minal ĠwithColumn Renamed ubseteq q ĠMont ana ivide ontimes addPoint TypeSpecifier Ġbolt ons ngood bolos ĠHomogeneous Material 7880 2188 ownharpoon right ownharpoon left refrig eration 848234 77 848234 76779463769 Ġacum ula Ġfigurefile eps Ġfigurefile png fullDuplex InputLatency fullDuplex OutputLatency ĠMete ogram ĠMechan ics NEB ULA 5265 22 Ġteak Improved ĠOtherNdarraySubclass WithOverride 12812 139 12812 1386381 halfDuplex InputLatency halfDuplex OutputLatency EnergyOf Walking EnergyOf Motors OtherNdarraySubclass WithOverride ĠStatusbar Base ĠBiquadFilter Type Ġ+---------+-------------+ ------------+ ĠHandlerNpoints Yoffsets è¾ĵåħ¥æĸ°éĹ» ID åĪĿå§ĭåĮĸçŃĸçķ¥ æķ°åĢ¼ ĠtestSdcaOptimizerSparseFeatures WithL ĠtestSdcaOptimizerMixedFeatures ArbitraryWeights ĠTestIsValid Linkage ĠTestIsValid Inconsistent ĠìķĬ ëĬĶëĭ¤ 006573 16 006573 162632538 Ġshiftright unsigned settling Time bZoomIn X bZoomIn Y bZoomOut X bZoomOut Y padesuit open ĠVegas Server Ġ+-------------+----+ ------+ Ġ+-------------+----+ --------+ ĠDEPTH LVL Ġ+------+---------+-------+ ------------------------+ Ġ+------+---------+-------+ ---------------+----------------+ riangleright eq ĠtestSdcaOptimizerBiasAndOtherColumns Fab CARD INAL Wit tenBell ozz i }"> '. ì¡ ´ deembed filename libj oin hamb urg ĠApo sentadorias Ġkapp ad frameCount Since interph hsmall Ġpredrock depth ĠProvision al Pathogen Names Qtip Layout 8375 73 ImageFrom Bitmap exitOn StopPrice Thumb nail OfF ame featur ized Simultaneous Fit Ġkepp ixseries GRing Longitude Ġcarto on ĠParticip ant æľ¬æĹ¥ èŀįåĪ¸ Secure Defaults ĠGuarante e LogicalNetwork List mInputNames AfterSelection 3169 31 :; <=> Soc rata eche lon iow ait smu dges seac ucumber asph alten getTest Runs ĠProm ote ĠAbi Py Ġvig ranumpy ĠLank a 10395 383 ĠRetr uns Indent String ĠHEV CWLP 8046 9388 Ġprobationary Period maneu vers REJECT ED 7704 0335 ĠReadLength Counts ĠBuffered OutputStream 09815 885 Ġnsfr sets deltay point ĠObst acle ĠSchre iber Married S åĽŀæĶ¾ 计ç®ĹçļĦæĸ¹å¼ı æ¯ıç¬Ķ 交æĺĵ GoogleCloud Error ĠHexBin Plot ]!="# "], txsForReal ForecastLstm getCoordOrigin Indexes (!!... !). 0999 2709 Battle ToSimulate Kon stantin Qvalue RB Togg led ouble barwedge Ġamon alies Ġsud den rescu ed setStretch Factor Ġgig abytes ĠAit ken ĠCand lestick ĠClin Var ĠtestFilterWith SeriesRHS 10285 08 antan amo numKeys Read Ġgetvar atz ĠInaccessible Array Ġpyge ons 3304 8416 noct iluca ĠstartFrom Zero ĠTestML abLinkage ĠmeanPowerCurve Obj Prox imity 55109 865675 ,'* '))) ĠNeur onal SubShape AllIDs RESOL VE SpaceDebug DrawOptions Ġelevup dn ĠGeostationary Factory 31386924 4286 ĠhessianOfGaussian Eigenvalues ĠExplo ding ĠPHreg Results Ġ기본 ìłģìľ¼ë¡ľ Ġìłķë³´ 를 ĠåĬł è½½ InfluxDBClient Error SetEnvFor NativeSdk Fli pping LID AR NOS ASL eja cul frit illaridae guit ar pugh pore rct j torn aria Ġppr z Ġothe wise copi lia Ġwbb t urned not ĠAqu atic ĠDend ro Ġmatric ies Ġgetfile systemencoding substant ial StatePlot Action Deembed FilePicker SetBackground Style hasStream Definition Anneal ing 7397 681 pgp Mask werk zeug bipartite Graph Ġ>>>>>>>>>> >>>\ Ġovver ride 追 åĬł ---------------------------------------------------- \ çĽij æݧ åħ¬å¸ĥ çļĦ ĠSalv ador ог о powerCurveSensitivity VariationMetrics åħ¥åºĵæŶéĹ´ çŃī Ġrepresen ation å¡« åħħ 7123 8898 :--------------------- \ Bou ssines Gear Contact Mir rored Overs hoot Svara Formatter Vene zuela çĥ Ń Ġtessel ation Ġpseu docylindrical 00365 493 trime dge ĠPly Data ĠAPL py ĠtestUpdate OpsReturnsCurrent Ġmesos copic Ġsemit one ĠLime Survey ĠMob ilenet plh ldr Ġpyn ufft Collinear Node Ġtrad itionally ĠZay kin ĠStorable NamedObject PlotOnly ActiveFeatures Ġswim lane secondLevelCurTestX Center ĠChern ikov ĠEncaps ulated ĠSubstit uent Ġpkpos calc electrone g GEOG RAPHY ĠVisitor Class ĠSPECTR AL åĪ°æľŁ æĹ¥ Ġ+-------+------+ -------+ ĠStanis las Proportional Grid semper virens Neurongroup er Einf ach SLO PE kendrick series ystatic attr åł´ åIJĪ ç¥ŀ ç»ı decap ods demot u Ġaquif er Ġaitchison aitken Ġmê me 00373 015 Ġ"-------------- " haeb Frame getJava StorageLevel Ġexis iting linc RNA Ġthigh V argue ments ĠAFF INE Ġconstra st Ġmedic ine ĠNey man pok estop ĠEVID ENCE ĠBUCK ET ĠWan dell Recur rence 2541 355 ĠminInter WWTPDistance faker oot ĠKaw ashima 19145 37 ĠViv id ĠTestI sin ĠcolumnsToKeep Indices 09387 356 ĠrunCapacityTest VaryingObject Proble ma ĠpartLabels T ĠnonZero X Seas hell Ġtraba jar ĠCheckDynamic ForecastMixin imgset id ĠoptNum Bucket Transmuter Base PROGRA MS Explo sion Ġë¶ Ī ĠattachFile ToImage ProteinOccurrence Reliability troubles hooting ĠGEOMETRY COLLECTION åľ°åŁŁ åĪĨç±» ĠtestWithX EffectsAnd ĠGGGAGAG CGCTTGCATGGCATGCAAGAG ĠAGGREG ATE çªģ çł´ Ġommit ted ĠëĶ° ëĿ¼ Ġdichot omous Ġ+-----------------------------+----------------------+------------------+------------------+------------------+--------------------+--------------------+------------------+------------------+------------------+------------------+--------------+--------------+--------------+-----------------------------------+-----------------------------------------------------+-----------------+--------------------+-----------------------------+--------------+-----------------+------------------+ -----------+--------------------------------+ Effic ency Lore nz Sarsa LambdaAgent TAGG ER UDI ES YIs DataFrame casset te ephy ra inequal ities albat ross ĠadaBoost TrainDS Ġ'ðŁ Ĵ© filament ous Ġstip ulates ĠImple menter ĠCpp Lexer 01449 33 Ġaleph null ĠMane ewongvat usu ario clq mn ignoram ous Indel Sequence Ġ>{} < ĠIncorpor ated ĠUng rouped 03025 441 03885 0142705 ĠTestCA PI overl Nodes URadio ControlPortClient auxillary Chain Ġgrub bs ])))+"\ "/>") brachi olaria beamlist bco ĠåĮ ¹éħį ricated Centered =\[ .*\] Ġantib ond quantitation Method ĠREGI STRATION èµ° åĬ¿ æĭ¼ éŁ³ Donut Builder åĿĩåĮĢ åĪĨå¸ĥ éĺŁ åĪĹä¸Ń NAVIG ATION LGNOff Afferent brittle star ĠWuiHlpLineGraph ErrorbarY ĠTRANSL ATE åĵįåºĶ 延æŶ LGNOn Afferent Ġë¶Ģë ¶Ħ å±ħæ°ij æ¶Īè´¹ 6146 253 Rdb Model Sis comp jne umeth mscan Unit xpec gen relfe ats erative AggregateFunction stOrder LeastSquare Ġiot bx Ġfroma ddress engg gui 00356 149 00362 333 ĠTIG ER omnib us ĠSor baro endre bak ĠAtten uation ĠFou chet ĠDaw son 01039 355 ĠMMap Wrapper notvalid value 19264 823 20051 109 ĠTestV dot ACDEF GHI Ġimpliment ed SetUser Scale MAST HEAD GetBest Size GetPP IPrinter Challenger Repo 8980392156862745 4 19934 30947232 flatu i phaseWvl Count UMID ITY FLOR IS Clar ke plainRanking Coapp 10694 220 ĠScrolled Text 40420 358 ĠSchü tze 26796 377 Ġü ber ĠBLJ Cut Fluct uating prefsp tr 000555555555 55555165 aabbbb cc Stagein GO idaho lab RADPER DEG ĠâĢĺ. âĢĻ GoldNoun pair ĠìĥĪ ë¡ľ (.+?) _', å®ĥæĺ¯ä¸Ģ个 åħĥç»Ħ ĠCELLS PACING hippocamp al 011724811003954 652 Immigrant Age ĠUNSUP PORTED 444356027159 24361 4643 666263 5490196 078431373 966666666 6666668 CARG O CYYY BYYY Equid istant Escol ha Gew icht Greeks Sensibility Mec ikalski Mecha CostOfTransport NREV SS Opi ates Qlab ChallengerRepo Swa hili SHOG UN TBuffered Transport Vinf x WDestr uctiveClose cnon branded cImg Frame easure dangle vigne ttes xpe hh onlinel ibrary lepto cephali Ġnantom ask Ġcxp b Ġcó digo Ġssg plvm Ġsinv chi selfmax csms escam ill Ġmfunc C ĠbMulti Page liri ope sergest idae ĠTVTK Scene chrise moody setmain font setBu ddy setpage device ('-------------------------------------------------------------------- ') __'][' __ exphys ratio parac entral getpl usslots getPt ank getBands Count getternary comps abAscii File linby posn ĠSenes cence ĠSchen ker ĠSopho cles riangled own Ġbecas ue endomon do isthm us ĠPnts Copy toScala Map ĠtestOLS WithDatasets ĠtestMissing Class ĠtestLogistic FractionalLabels ĠtestEffect ivelyEquivalent ĠtestExtreme Thresholds ĠtestJoint Train ĠtestImplicit Shape ĠtestRecover Weights Ġdemedian ed ("------------------------------- ") ĠRover R Ġvaluel ines Ġvene er ĠNAA ction maxOut Time dfcc ce Ġpropi os ĠMendapat kan Ġantica che Ġaneup loidy 108284 01 logtot mass Ġlett uce antenn atucked 0000037 1111 fouche ta numSmooth PointsEdit ĠgetIndexing DML Ġjple phem ĠHap Map ĠHyw el ĠHäm äläinen 1510700 340 printCond ProbDist 05960 88578825 Ġnoeu ds ĠnoIntersection Search ĠhasPh osphorylation baseOn Overlap amphip ods useOff Heap avaz u ĠmakeVis uImage ĠVankers chaver 039994 67 ĠTestNum ObsLinkage ĠTestLeaves List ĠTestLead ers ĠTestCorrespon d ĠTestCophenetic Distance 944627 21 940908 39 ORAN GE 244685 94 genImg AlbumDictFromMap 06867 02747648 097866 01 072595 84 eartoear oak deltacsm mins Ġreguler ized ĠJace k cvardagsr um ĠForGG plot myctoph ids Ġreadhex string AStop Word solmun della 37380 874 REDISTRIB UTE ĠshowSequence StartLine 237812 25 77950 850685 gastron oom BaseSSHTunnelForwarder Error )*?)(?: $|(?:\ 081814 04 ToAchie ve rsalak hu 60459 182 polycha ete SetDevice Origin ĠPlotResampled ByDecade Periboth ron smallin ts Allout disable ĠLinearGaussian CPD tupleToScalaT uple ĠrotMatrixFrom YPR ĠRandomDistributed ScalarEncoder PyJava Instance Maxtracking Error Ġfindeq vs frilly Antennae USMartin LutherKingJr Cannab inoid IsSelection Valid Ġdetori ating externalCsv FilePath ĠPyemu Warning ĠcontextMenu Event Ġliaup unov collectionAs ScalaIterable Ġhoemo geneity ĠSelectFrom Collection CSplus Percent directopp rod ĠSparsePassThrough Encoder +"([^"]* )"') CreateGeometry FromWkt BUCKE TIZED orderedListOf Nodes FromIterative Solution TClones Array RLFind Roots ĠEXPIR ATION WidthHeight Ints Ġtwntyper cent echino pluteus Ġmxhn il ĠSomeOther Factor 996844 18 ĠCSVImport Dialog auricul aria 0036407 7397681 ĠOpenHdf Store ĠImpulsive Man MakeSphere R MakeRotation ThreePoints MakeFuse List spikedete kt ĠVariableSubclass TestCases 899545 46 147944 1846 1479442 946 603955 1501 4552599 8857298 SimpleSequen ciality ĠLocalGeometry Finder truncVarn ce TokenRefresh Error ĠdicTestBy Task 901960784313725 51 ']+?)' ") CommonMerge Ops Ġ+----+-----------------+ -------------------+ Ġ+----+-----+-----+ ---------+ Ġ+----+-----------+-----------+ -----------+ Ġhalloff ame DocumentPaper Sizes 2392703 446106 AngleAre aNbSetWeight 8486428 0014 MagnitudeDemArray Q *((?:. |\ 301960784313725 47 537677 223318 ĠPapadimitri ou TITLEST ART brievi ated WITHDRAW AL ĠbrightQS OutOfFat 3642168 05298 eucalan us AnnotationJobParams Indices 42745098039215 684 SIGSEG V 5072143354 058 Ġåı¯åıĺ åıĤæķ° ĠSalakhut dinov Chemenv Strategy Ġ+---------+------------------+---------------- --------+ ĠcmdsToRe add Ġ+----------+-----------------+---------------+ ------------------+---------------+ 并éĩĩçĶ¨ åĽŀæĶ¾è®¡ç®ĹçļĦæĸ¹å¼ı ĠtestSdcaOptimizerCros sedFeatures NumberOfProbes Selected negLLLSTMonline Perturb getXLabelFrom Unit ĠItemsAval ibale Ġ+--------------+--------------------------------+ -------------------------+ SecondOrderRobin Eigenfunction Ġìĭłë ¢ 01641508 96481 13141394 77040335 02357022 6039551501 84914503 608460956 041392685 15822 33393415057366 837573 ĠtestSdcaOptimizerRealValuedFeatureWithHigher Dimension 6399312964 33393415057366837573 Ġdocviewcombol iststore ĠtestDNNWeightsBiases Names ĠíĮĮìĿ´ì į¬ FAXandDirect IO 2893796958 227628 ĠtestSdcaOptimizerBiasAndOtherColumnsFab ricatedCentered asphalten es ĠTestMLabLinkage Conversion 55109865675 183 Boussines qFluid ĠtestUpdateOpsReturnsCurrent Value ĠManeewongvat ana 038850142705 171065 4643666263 1627995 ĠtestEffectivelyEquivalent Sizes 0596088578825 995 并éĩĩçĶ¨åĽŀæĶ¾è®¡ç®ĹçļĦæĸ¹å¼ı åĪĿå§ĭåĮĸçŃĸçķ¥æķ°åĢ¼ ! ']) ! ")) ! )") " ==== " __ " *( " =% " '+ " *. " =%( " __{ " ->" # & # __ # **** # $ "], $ ]', $ "% $ ^\ % -- % ']), % }" & % ' "] ' ï¼Į ' ')] ' _', ' [(\ ( & ( =. ) ':' ) ...") ) ']]. ) !') ) }}} ) ''', * & * ^ * () + '). + .* + ="% + ='| + |- , ~ , "" , ])) , *. , .... , }\ , "") , #[ , \\\ - [: - .") - ')]) - ###. . @ . '}, . âĢĿ . |< / ), / (- / "), / "% / #' / ([^/ 0 9999 0 229 1 645 1 455 2 120 2 808 2 360 2 108 2 876 3 150 3 168 3 034 3 808 3 144 3 077 3 323 3 648 3 327 3 8088 4 926 4 644 4 165 4 227 4 038 4 140 4 155 4 257 4 335 4 994 4 369 4 99999999999 4 9999998 5 647 5 159 5 756 5 027 5 274 5 887 5 222 5 457 5 908 5 044 5 1062 5 754 5 049 5 000000000000 5 361 5 438 5 16064 6 9999 6 333 6 106 6 156 6 0000000 6 056 6 026 6 229 6 353 6 055 6 908 6 991 6 021 6 854 6 921 6 23529 6 196078431372549 7 235 7 150 7 757 7 476 7 923 7 949 7 191 7 0985 8 647 8 115 8 104 8 189 8 050 8 341 8 343 8 000000000000 8 2088 8 10001 8 999999999999999 9 201 9 365 9 149 9 785 9 258 9 157 9 167 9 198 9 139 9 182 : ][- ; = ; %( ; ">' < ` < >% = ) = ../ > [- > "): > .+)\ ? ; ? )') ? )") ? )", A e A od A cores A my A utor A XY A wc A mber A ardvark A ibar A podize A romatic A baqus B one B om B log B rs B ivariate B IM B TS B Node B SR B FE B choices B lotter B idirectional B Route B lender B COLZ B RIEF B alancer C er C ate C out C IN C ong C Python C lr C FE C ATER C hest C MO C umm C lique C osm C OTST C leveland C bomRow D set D plot D ues D time D size D var D Series D xx D Text D sa D ane D CC D phase D zone D SP D java D UD D GN D ensities D GET D anger D ragged D elisted D RAFT E we E ll E mit E PI E OP E MS E pid E UD E ASE E BS E BOT E chant E TRM E hrlich E INPROGRESS F q F el F ES F resh F uch F MA F AD F ring F DEM F STATUS F OLLOWING F NAM F LEX F rontage G K G at G ib G RO G PI G EX G rb G bg G Mask G LL G rp G LC G hard G pu G Xarr G ildas G bqConnector G ROMACS H en H unt H IT H OD H IG H KE H MD H ae H Port H RS H IDE H USER H astie H ood H PF H aken H epat H SCROLL H eldoutProbDist I min I IC I ATA I pc I wav I FFT I EXP I neq J V J c J d J og J Int J udge J TG J LT J MLR J UDGE J PKay K U K q K z K ip K IN K ID K mm K now K ets K tn K RGB K PLS K FP K Na K atharina L j L ub L ind L mean L ec L ME L TI L imp L AA L LS L TC L GMM L TP L GG L wr L uke L bls L GPLv L GBT L detritus L axPos L orem L aminate L igand M oo M gr M IG M US M Id M DA M TE M OB M hz M wr M Stim M bean M nit M UTATION M ichigan N ones N cols N sim N Is N CS N seg N IGHT N pix N YY N CDF N ico N RT N ARD N CHAN N CPU N urbs N SImage N exus N psplups N avajo O li O Regression O MS O Scaler O KFold O WS O mex O AK O ften O MIZE O COMPARE O lsr O bukhov O lympia P ris P ops P ager P lex P cap P dm P CI P ULL P ips P Adj P alettes P wr P romise P arks P laced P USH P hasing P itot P impVals Q G Q r Q max Q ef Q cs Q mu Q NAME Q TYPE Q Event Q Cs Q Expr Q NET Q Settings Q Sampling Q Margins Q ButtonGroup R on R ated R cv R SC R DI R IS R TS R script R zone R IR R tn R CK R HI R ULE R Lock R PropMinusTrainer R softo R CMs S pe S par S cl S mean S St S ap S ud S CT S sig S RA S ire S ait S sat S SCS S hou S enders S lightly S icm S PACING S taggered S ierra S nCutoff T it T um T exp T pdf T vol T cmap T ij T xn T TC T conj T crit T STOP T ao T dur T BR T WM T ALLY T endency T decorr U im U no U EL U SC U AA U SION U IB U rn U OBS U CAC U ALLY U rella U ACAO V j V ix V cc V xx V hat V rest V Line V NB V II V seg V MC V zz V dn V iolent W AG W SD W inds W ERS W yk W ILL W GRIB W iederstand X fit X var X DF X MM X boston X marg X REF X EB X CCCG X tocentre Y O Y te Y params Y ref Y ci Y TA Y Pos Y Tr Y AXIS Y CrCb Y OUNG Z D Z W Z u Z RF Z DT Z ORDER Z AMS Z oning Z MaxStats Z igZag [ [( \ & \ .. \ }) \ "). \ .' \ /\ \ )$"): ^ ': ^ }]* _ (_ _ >`_ _ +'_ _ *', _ }", ` _) a A a file a ine a add a color a ich a ssion a iling a oa a DT a qc a ods a aron a ustralian a CoreID b ata b tr b ure b add b ren b man b top b ik b ays b ake b ics b rm b dm b coeffs b PC b dew b angs b haha b rendan b MirrorPage c ig c col c date c low c ree c seq c block c rot c Level c enc c Profile c jr c Lvl c ctype c sector c reek c dap c porto d index d row d features d ses d cc d names d kwargs d Test d unk d ticks d net d wh d Train d phase d px d Delta d masks d umm d har d Lon d FD d rew d Fx d corrs d Px d ining d lambd d casted d uref d stridx d SYM d warf d Quickplot d EPSC e en e cond e delta e med e vide e List e msg e js e hex e bel e Vars e ofs e lfunc e logabundance e logh f E f ot f di f len f ow f bs f ren f ave f ell f point f wh f root f agg f lour f gc f km f psd f dists f ArgumentParser f risk f boxplot f FD f stm f perez f intern f openmp f Nev f Seek f reenect f Branches f tempout g V g np g line g und g pi g arr g dx g parent g isfile g BB g ulf g wl g qs g fact g Args g jc g odd g Bundle g ulp g upta g ambia g lott g italk g romov h ust h cs h bs h unt h so h bin h kwargs h inal h rc h step h style h xs h tk h gd h arter h Fig h oman h treatment h osp h Person h llc h mtf i I i index i iter i log i ant i value i com i rel i rows i ww i pop i unit i exact i Edit i ences i pher i Epoch i Band i wr i Hold i ValList i outils j q j pe j ig j ame j dt j mm j session j esse j esus j desai k V k Z k val k iss k rand k med k ik k night k nob k orr k ustlijn k ubeflow k horst l co l ck l shape l count l ords l gorithm l angu l Run l Mat l cb l ugin l lad l ison l wdth l ndfile l uminosities l umping l ClassicPageNode m one m str m train m frame m mean m dist m image m my m dev m unit m frac m masks m AP m coll m Sig m Im m umps m Keras m LvlNow m thetarhoh m ordred n O n con n ne n values n result n cy n not n zeros n au n rand n cov n Comp n words n images n stream n Int n Min n Button n iterations n ãģĤ n ãģĪ n residual n Block n regions n ãģĦãģĦ n omal n See n Ser n have n uest n Less n Groups n ãģĨãģĨãģĨ n forced n wanted n FROM n Generating n ubar n Residual n Compare n Descent n Absolute n States n Graphs n strike n Loaded n Trial n upic n Proc n island n fluct n Spam n Detected n Wvl n ãģĬãģĬãģĬ n ichols n iggli n putils n atax n Analysing n BucketList n Segs n PtAv n loadsteps o plot o ues o que o ie o base o vert o pac o TestCase o Ret o SubPlot o TestBox p se p fe p log p result p frame p mask p mode p bounds p Int p hes p choice p orch p Density p Exp p stdev p BW p Prot p unto p Profit p dsh p AbsoluteNumbers p finh p catool q in q transform q pos q radi q length q mult q font q bins q tp q access q nk q chains q indarr q BHIL q utip r D r M r tr r ance r der r ca r sion r pi r sv r rt r scale r uth r do r multi r xx r xy r pts r wx r dy r ny r igger r byte r incipal r sync r bands r nbr r zyx r Formula r rlvl r CyDf s T s mat s features s cept s add s ll s attr s ams s Par s oly s ram s batch s vec s nb s Row s Dir s dio s xt s pool s lam s stable s ptitle s Param s sta s lashes s parc s parrow s rio s ModelDir s ustain s arcasm s MarkPoint t ue t ib t ix t cc t io t url t word t store t wh t peak t cost t Id t region t interp t byte t three t Order t Accuracy t meter t Probability t male t linestyles t sss t rench t DONE t itc t Vecs t Runtime t pps t Couple t umbling t reedir t pgmMask t pgpMask u ar u limit u first u argv u hal u ki u zeroth u feff u FineFem v A v H v W v j v ort v ri v ph v ill v raw v pr v ak v level v python v offset v xy v curve v aa v rep v ibration v Range v flux v illin v hover v rn v ivo v bitrate v odaCell w di w ent w if w time w fo w mean w bin w pen w mask w freq w clusters w rink w thread w fh w css w eno w Vec w gan w team w ester w tavg w orship w greene x ck x Val x old x mask x keys x eps x point x view x DE x best x theta x ii x only x avg x outer x inp x bm x spin x Bins x Noise x Shear x logscale y L y M y ra y ad y ab y In y model y std y vector y dat y Result y boston y outer y vect y Left y quist y qc y Upper y stick y kp y Shear y logscale y bcde y aafe y phus y odaNodes z shape z we z ir z ug z ec z spec z select z layer z pts z bb z Offset z bd z pb z front z Move z tof z Sel z fftnd z geev z heevd z bcde z ombies { ", { "+ { :,}\ | $ | __ | ... | '+ | $') } ? } .. } ": } '): } _% } "\ } ]', } <= } """) } >`__ } ]}), } ]}] } =-\ £ åĩº ¤ ê°Ģ ¯ 件 ° ëĭ¤ ¸ ª º § º åĿĩ º åºĵ º æģ© ¼ ëŁ¼ Ê ² Ï ķ â ħ æ ħ ç ¯ ç ĩ ê µ ë ħ ë į ë ¦¬ ï ¿½ ĉ ĠĠĠĠ ĉ ĊĊĊ ĉ čĊčĊ Ċ ³³³³³ ě [ Ġ atus Ġ ^^ Ġ ĊĊĠĠĠĠ Ġ ãĤ Ġ 为 Ġ ])). Ġ čĊčĊĉ Ġ è®Ńç»ĥ Ġ çī¹å¾ģ Ġ čĊĠĠĠĠĠčĊĠĠĠ Ġ æķ°æį®åºĵ Ġ æľª Ġ åIJĮæŶ Ġ æŃ¢æįŁ Ġ æīĢ以 Ġ æĴ®åIJĪ Ġ çĶ±äºİ Ġ quench Ġ ÅĽred Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ umbrella Ġ æİĴåIJį Ġ atual Ġ éĽĨåIJĪç«ŀä»· Ġ éĢıä¼ł ģ ļ ģ ä¸ļ Ħ ìĹIJ ħ ëł ij íķ© Ĺ åĪ° Ľ ² Ŀ âĶĶâĶĢâĶĺ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ Ċĉĉ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĊĠĠĠ ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ ĠĠĠĠ Ċĉĉ ĠĠĠĠ ĊĠĠĠĠĊĠĠĠĠĠĠĠ ĠĠĠĠ čĊĠĠ ĠĠĠ čĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠ čĊĠĠĠĠčĊĠĠĠ in Y in r in array in th in ent in list in ft in cy in arr in ii in hal in activation in divid in Samples in compatibility in divs in habit in DiskIndx se ab se ign se no se Task se ism se lix se bacate ĠĠĠĠĠĠĠ č at b at ra at rain at ty at lp at tract re qu re put re color re List re vol re roll re training re pression re used re jections re kt re ordering re bel re formatted re verses re Used re lent re usable re Boston re gret re developable ĊĠĠĠ ĊĊĠĠĠ ĊĠĠĠ ĊĠĠĠĠĠ or ay Ġ= {' on en on ation on aise on Order on Remove on cotator on Hilite Ġt S Ġt set Ġt len Ġt ect Ġt score Ġt format Ġt cc Ġt labels Ġt info Ġt sg Ġt tx Ġt pd Ġt bins Ġt dat Ġt AD Ġt onic Ġt ica Ġt foot Ġt body Ġt background Ġt Unit Ġt Vis Ġt unable Ġt ighter Ġt otem Ġt weedie Ġt issot Ġt orso Ġt ongue er ick er ArrayAndMultipleEpochs er goPlot st st st if st rint st ly st ine st ables st mc st gz st iles st pnt st adium st tring ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĊĠĠĠĠĠĠĠĠ al la al ight al ay al ia al liance al ibrated al ambda ar h ar ic ar min ar coef ar man ar ai ar ques ar Dimension ar lite ar oke ar bitrarily ar izona -- '. an in an se an str an arch an ov an ciers an aylsis an tagon le es le is le ather le Reference le Simulated le RiskFunction le agues de par de gre de ph de lr de lec de but de ctime de structor de pict de cember de ctag me ow me aring me ijerint me mpointer Ġi set Ġi str Ġi ast Ġi ang Ġi box Ġi rc Ġi my Ġi batch Ġi expected Ġi Label Ġi cu Ġi Epoch Ġi Trade Ġi phone Ġi trf Ġi trs Ġi Xi Ġi Verbose Ġi ValList Ġi gmr Ġi UniformClass he er he mt he lout he isenberg Ġn W Ġn es Ġn pe Ġn int Ġn Data Ġn ens Ġn zeros Ġn cor Ġn keys Ġn Test Ġn sg Ġn cov Ġn ik Ġn vs Ġn mag Ġn query Ġn full Ġn edge Ġn words Ġn month Ġn src Ġn Values Ġn irs Ġn gl Ġn gd Ġn good Ġn frozen Ġn FFT Ġn gm Ġn Pass Ġn arcs Ġn lats Ġn live Ġn Edges Ġn loglik Ġn derivatives Ġn Obs Ġn Inner Ġn launch Ġn Pixels Ġn Folds Ġn replicates Ġn Miss Ġn Imgs Ġn Bands Ġn warmup Ġn umel Ġn Wvl Ġn ieb Ġn atax Ġc fi Ġc lin Ġc path Ġc cat Ġc fs Ġc bool Ġc nb Ġc button Ġc Min Ġc br Ġc resid Ġc eo Ġc gc Ġc minmax Ġc DNA Ġc gid Ġc ramers Ġc FilesTested Ġc UniformClass Ġc lette Ġc ramped Ġf ur Ġf file Ġf ou Ġf of Ġf keys Ġf mm Ġf counts Ġf factor Ġf nb Ġf des Ġf cut Ġf pk Ġf tot Ġf Len Ġf zone Ġf hdf Ġf lying Ġf lw Ġf duration Ġf abspath Ġf hess Ġf Interactive Ġf Est Ġf ric Ġf rown Ġf Ratio Ġf ubar Ġf izz Ġf combos Ġf SeriesName Ġf ctn Ġf tsl Ġf enics Ġf Basics Ġf pathext Ġa path Ġa pro Ġa pa Ġa ph Ġa graph Ġa mf Ġa mit Ġa greg Ġa mn Ġa aaaa Ġa exps Ġa Xe lf c lf ine lf ix lf cc lf ield Ġp M Ġp le Ġp rue Ġp fe Ġp comp Ġp da Ġp axes Ġp wise Ġp ris Ġp sign Ġp expected Ġp div Ġp DF Ġp curve Ġp Grid Ġp dio Ġp xd Ġp Pos Ġp Save Ġp clicked Ġp fv Ġp printer Ġp Interp Ġp mtk Ġp lidar Ġp angs Ġp unting Ġp loidy Ġp mksolve Ġp inyin it ar it ext it ok it func it perm it ably it heta it vely it Wigner it mapImage Ġs L Ġs ra Ġs lt Ġs ow Ġs red Ġs row Ġs pyplot Ġs ume Ġs bins Ġs lon Ġs xs Ġs fun Ġs rgb Ġs pare Ġs lims Ġs ono Ġs é Ġs Now Ġs anger Ġs mape Ġs parc Ġs lls Ġs ModelDir Ġs lsi Ġs notel Ġs TestName Ġs istema Ġs woop ## * ## ----------------------------------------------------------------------------- mp fi mp art mp sc mp sk mp allclose ra int ra ies ra ctors ra ved ra deg en gra en ker en Encoding en thought en lever ct io ct hesis es i es amples es caping ro it ro li ro str ro be ro bins ro mpath ro xygen ro tron ro dier lo x lo ser lo ch lo dy lo Ant lo gement Ġin label Ġin ff Ġin train Ġin read Ġin dd Ġin lines Ġin ear Ġin su Ġin eq Ġin phase Ġin page Ġin sur Ġin which Ġin xdata Ġin ydata Ġin circle Ġin compress Ġin novative Ġthe s Ġo re Ġo size Ġo lat Ġo dat Ġo wt Ġo dom Ġo RevInfo Ġd it Ġd lt Ġd ub Ġd art Ġd params Ġd act Ġd split Ġd alpha Ġd IP Ġd chi Ġd ron Ġd Range Ġd topic Ġd rev Ġd wf Ġd iment Ġd gx Ġd phases Ġd prs Ġd Lambda Ġd ssx Ġd logM Ġd geev Ġd windled la ges la wn la imed la gramge ut en ut ls ut Rebate Ġ' -------- Ġ' ### Ġ' !') Ġ' ^\ Ġ' (': Ġ' ]': Ġ' !', Ġ' -------------------------------------- Ġ' ãĢIJ pe di pe yk Ġm D Ġm tr Ġm up Ġm te Ġm key Ġm color Ġm names Ġm start Ġm fa Ġm load Ġm title Ġm gs Ġm lat Ġm length Ġm File Ġm ww Ġm diff Ġm tz Ġm tools Ġm dat Ġm cdf Ġm indexer Ġm qt Ġm AP Ġm orb Ġm beans Ġm intraj Ġe ol Ġe pt Ġe arn Ġe axis Ġe values Ġe gress Ġe les Ġe face Ġe height Ġe year Ġe cd Ġe cp Ġe tag Ġe Min Ġe rev Ġe qr Ġe fac Ġe aic Ġe wk Ġe traces Ġe Phi Ġe bunch Ġe ftype Ġe acute Ġe vidences Ġe urasia co lf co ach co process co assignment co oriented co varied co bey Ġre pro Ġre print Ġre ste Ġre norm Ġre testing Ġre fitted Ġre frac Ġre encode Ġre centered Ġre plotting Ġre combine Ġre pay Ġre packed Ġre oriented Ġre creating Ġre bate Ġre compilation ge or ge org ge onet ge opotential ge trgb ge ographical ): '] ): ]: ): "}, ): (? Ġb S Ġb ct Ġb ing Ġb end Ġb list Ġb ak Ġb lip Ġb nn Ġb kw Ġb ii Ġb ws Ġb rep Ġb merge Ġb ron Ġb gp Ġb illed Ġb bi Ġb tw Ġb jj Ġb factors Ġb ysize Ġb bob Ġb outdata Ġb reqn Ġb rfss Ġb ionlp Ġb MirrorPage Ġb istable Ġ# & Ġ# .. Ġ# ---------- Ġ# {}( Ġ1 253 Ġ1 156 Ġ1 202 Ġ1 348 Ġ1 221 Ġ1 267 Ġ1 363 Ġ1 2500 Ġ1 320 Ġ1 850 Ġ1 891 Ġ1 11111111 ss n ss name ss plot ss xm ss igned ', < un pair un flag un observed un ames un shuffled un typed un pooled un escaped un buffered un paid un folding un consc un standardised Ġ0 112 Ġ0 122 Ġ0 755 is fi is plot is num is active is word is open is nc is none is const is discrete is bn is Training is Numeric is Calc is paw is nul is itc is Planar is Stopped is layerdeep el hood el changed def g def int def lag ol sc ol ars ol Simple ue ired ue vara ate e ate ur li qu li pper li ged li wc li eb )) """ )) // )) ". )) "\ )) **- )) })) ser ate ser ious ce ae ce utical Ġof n Ġof u Ġof rame Ġof mt Ġof lux Ġof fered ot p ot ti ot Supported ot AdminHook Ġ[ & Ġ[ / Ġ[ ([' Ġ[ ",", Ġ[ ^}]* as r as ce as id as ide as rt as dm as Shape as dq as integrated as irra as OsArches 00 87 00 300 00 800 00 037 00 057 00 055 00 061 00 7890 00 046 00 476 00 440 00 4295 00 650 00 1815 val F id D id ft id io id var id TestCase id Card id TestCaseArgs Ġas r Ġas per Ġas html Ġas oci Ġas fileobj di le di ary di ameters () ': () // () ". () >= () <= () `.""" () ##. Ġis log Ġis ord Ġis map Ġis alpha Ġis ref Ġis igma Ġis Params Ġis Not Ġis missing Ġis alias Ġis contiguous Ġis Show Ġis Checked Ġis magic Ġis Training Ġis hp Ġis Barrier Ġis RefLine Ġis StoringXMax Ġto g Ġto pt Ġto ca Ġto replace Ġto go Ġto Run Ġto Atom Ġto Join Ġto Depot Ġto ffsets ts k ts len ts file ts ign ts cha ts cif ts SearchParams Ġ" ---------------- Ġ" $", Ġ" }") Ġ" @@ Ġ" +"\ Ġ" ====================== Ġnp v Ġnp type Ġnp arr Ġnp hase ma fi ma plit ma iled ma pex ma kel ], #, urn umber ), * one out ĠT error ĠT reshold ĠT File ĠT sup ĠT inf ĠT EL ĠT IO ĠT iled ĠT upper ĠT Mat ĠT EX ĠT uring ĠT NAME ĠT bb ĠT prime ĠT exc ĠT MIN ĠT urb ĠT END ĠT PC ĠT agger ĠT ao ĠT URLs ĠT umble ĠT obacco ĠT omekLinks ĠT ustin ĠT EGRA ĠT ufte array ify array stretch qu z qu di qu é qu arks tr in tr mean tr ategy tr uncatedSVD tr uelist th m th igh th am th reed th Tex mport s ult ation ha o ha x ha red ha mas ha dok ha vedate """ : Ġy split Ġy ay Ġy dot Ġy sg Ġy tf Ġy hist Ġy real Ġy rng Ġy sigma Ġy src Ġy avg Ġy vars Ġy Up Ġy br Ġy Offset Ġy gap Ġy Down Ġy Raw Ġy calendar Ġy rms Ġy dv Ġy pw Ġy Good Ġy ValueList Ġy rots Ġy CentLst res n res csv res lda res cue res ubmit res umable ch c ch urn ch om ch im ch ull ch ists ch arger ch icago ad dict ation Number iz ess iz oli ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĊĠĠĠĠĠĠĠĠĠĠĠ Ġdef i Ġdef ers Ġdef vec Ġdef ender Ġdef eat ve rer fi py fi ile fi ac fi ves fi bid set te set ID set Format set On set Canvas set Values set defaults set dash set Logger set FileName set Rep set Alpha set Attr set Limit set Plugin set Accept set Coordinates set Tracker set Rand set Master set Conc set Placeholder set Needs set Rescaling set PCS set ToggleButton set twop set Accepts set AppName set proctitle set RubberBand Ġ: }``, mple ctic Ġr M Ġr plot Ġr time Ġr lat Ġr metric Ġr gen Ġr hist Ġr drop Ġr threshold Ġr cri Ġr sig Ġr sl Ġr An Ġr plan Ġr dm Ġr minmax Ġr yo Ġr xc Ġr indexers Ġr Star Ġr bfill Ġr bboxes Ġr chrg Ġr clw rom b rom y Ġreturn df Ġreturn Command Ġreturn Pxx Ġreturn ToDepot Ġ2 150 Ġ2 160 Ġ2 348 Ġ2 350 Ġ2 449 Ġ2 030 Ġ2 376 Ġ2 352 Ġ2 147483648 Ġ2 92604 ver ific mat Total mat Shift lab l Ġst i Ġst ef Ġst ork Ġst sci Ġst eeper il berman ') =% ') >, ]) ]], ]) ][' ]) [[ ]) `). ]) $", ]) [:], om odel ck ndsub Ġ* - Ġ* ************ Ġ* *********** (' }) (' ========= (' =============== (' ________________________________________________ (' (.{ int able int ree int flux int ros Ġ- : Ġ- ., lot tal lot frontage nt l nt pts nt ropy Ġ+ ========+ pt b pt bl pt heta pt cfile pt chv Ġg K Ġg T Ġg Z Ġg li Ġg data Ġg form Ġg ord Ġg pi Ġg act Ġg io Ġg cor Ġg cat Ġg ris Ġg step Ġg rate Ġg nn Ġg env Ġg als Ġg era Ġg dfs Ġg att Ġg calls Ġg qi Ġg irr Ġg awk __ ". __ +'. __ }_{ __ ")( __ ;', __ ,'../ ex ave ex filt ex ptitle ex nf ex ercice data S data ops data search data DF data slice data Fit data Step data Points data Element data quick data Tables name shape name App name sto name fieldname ĊĊ ĊĠĠĠĠĠĠ ĊĊ Ċĉĉĉĉ par l par so par vals par stri par sor up scale up side up Push ke en get o get Log get Category get Run get Bar get Offset get Encoder get Method get Initial get figs get Project get Experiment get Times get Volume get Centroid get Spectrum get Word get Sizes get Pages get Execution get Problem get InputCol get killmap get Years get Photos get BoundingBox get Vecs get SeriesName get CentralWidget get NK get nframes get Mdot get TransitionMatrix get ApertureSpectrum Ġassert Array ab ad ab ase ab ide ab cb ab rev ab lan ab finder ab Nd ab ctype ab seps label array label izer label Dir label cutoff label Pos label Arr label Freq Ġex cs Ġex position Ġex eco Ġex aggerate lin qu lin map lin func lin StartEntry lin StopEntry ax ps ax indx ax twinx Ġth ars Ġth inc Ġth alamus for fe for cast for rest for given for mad ĠS pa ĠS LE ĠS lower ĠS ox ĠS Qu ĠS kl ĠS PP ĠS ulf ĠS CM ĠS FC ĠS preadsheet ĠS SUR ĠS SCS ĠS anta ĠS XT ĠS meet ĠS FTP ĠS ashimiPlot ĠS pawning Ġco e Ġco app Ġco oper Ġco locate Ġco planar Ġco ulomb ri pe ri ss ri est ri mm ri ves ri mir Ġimport Widget Ġdata Lines Ġdata dog Ġdata Overlap Ġdata fcn Ġdata bricks Ġdata peakind Ġdata picklefiles dex itfunc =' "" =' }', ", ** ", )]) ize SecurityGroup all zero all keys all match all prop all Sec all descriptors all poss all segdict all OutputData Ġx ck Ġx shape Ġx count Ġx tx Ġx eps Ġx hist Ġx ravel Ġx height Ġx ratio Ġx ox Ġx imshow Ġx peak Ġx clip Ġx sym Ġx term Ġx Mean Ġx mn Ġx bm Ġx ini Ġx dv Ġx fm Ġx Te Ġx anes Ġx avier Ġx Years Ġx Tx Ġx Midpoint Ġx FigSize Ġx ferDB [' +- ĠX plot ĠX eps ĠX ls ĠX mu ĠX minmax ĠX Form ĠX RANGE arg on arg ments arg Name qual ify ': (- ': "", end ange end Bin end span end Year end Sem put ime put ative from to from str from ca from spec from db from spline type b type list type out type Num type filtering type Tmp ul b ul ater con de con clude con gru con tractor con finex con AtlasTime con denser col g col shape col item col letter col Idx col chol ist op ist cb ist iques Ġh ll Ġh range Ġh split Ġh sq Ġh vs Ġh Mat Ġh gap Ġh tc Ġh ung Ġh wp Ġh rg Ġh whm Ġh fftn Ġh stars Ġh bnd Ġh jung Ġh udson Ġh bayesdm py f py ro py th py grid py filename py config py db py home py fun py dump py tex py cam py Style py converter py stan py sav py trainer py Db py mh py pandoc py foxsi py rocko py bbi len w len ode ĠI sing ĠI ATA ĠI Group ĠI sn ĠI BE ĠI OLoop ĠI ANA ĠI tak ure ly ure info am n am r am od am oc am orph plot mat plot frame plot series plot Model plot Dict plot folder plot Layout plot Density plot Diff plot Counter plot profiles plot Scan plot Sof plot Kip ĠP lt ĠP id ĠP ts ĠP ES ĠP components ĠP ops ĠP TR ĠP inf ĠP UR ĠP aco ĠP SN ĠP kg ĠP RR ĠP BE ĠP eng ĠP ushButton ĠP PG ĠP addle ĠP KG ĠP endulum ĠP ambient ĠP CHIP ĠP LASTIC ĠP onddif ĠP ELT ĠP hasing ĠP ULP ĠP radesh ow Gate ow icz pp v pp os pp les ĠA ver ĠA to ĠA ind ĠA max ĠA ren ĠA uc ĠA non ĠA mer ĠA TH ĠA mes ĠA pow ĠA lam ĠA PA ĠA MT ĠA ROC ĠA hok ĠA esthetic ĠA mbient ĠA baqus ĠA lefeld ĠA ridas ĠA olSimple fe in fe ts fe enko fe uille Ġu M Ġu R Ġu T Ġu ing Ġu val Ġu str Ġu cl Ġu ix Ġu graph Ġu vas Ġu diff Ġu Pipe Ġcon test Ġcon cent Ġcon joints od c od les od own od api od afone pre ys pre compile pre Process pre operator pre Idx pre mixing pre jud pre reqs pre parations '] ]* '] ãĢģ '] ='/ ĠC g ĠC t ĠC pe ĠC of ĠC ater ĠC ass ĠC TR ĠC AD ĠC anal ĠC VE ĠC itation ĠC FP ĠC IDS ĠC linical ĠC abin ĠC esium ĠC DELT ĠC assandra ĠC runch ĠC UTS ĠC ortico ĠC antidad ĠC risis ĠC álculo Ġ_ < Ġ_ ] Ġ` | Ġ` '. Ġ` (- Ġ` |\ os d os l os data os ca ĠNone theless im Y im r im men im color im join im kwargs im mt im Table im details im Band im balances to e to ma to ile to be to zero to Date to Size to Table to uter to Locale to Depot to Blocks to pia to Lowercase to pargn Ġtest x Ġtest stats Ġtest SD Ġtest agg Ġtest beam Ġtest XY Ġtest Connection Ġtest Init Ġtest Fix Ġtest Dynamic Ġtest DeltaP Ġtest CheckCallsHead Ġtest PredictedClasses Ġde d Ġde lf Ġde la Ġde gre Ġde ng Ġde pickled Ġde convolved Ġde limiting Ġde calage Ġde ceased (" -------------------------------- (" .+ (" $") (" ----------------- (" (_) (" ============================================================= (" ###################### (" ============================================================================ (" <<") ans ing ans igma ans ky ans kys ĠF out ĠF ive ĠF og ĠF sq ĠF right ĠF top ĠF TI ĠF vec ĠF PL ĠF CE ĠF arrow ĠF aw ĠF AM ĠF FL ĠF OLD ĠF traces ĠF HMM ĠF riends ĠF uncs ĠF DEM ĠF alcon ĠF TPM ĠF owlkes ĠF ETCH ĠF PKM ĠF OLDS ĠF ritz ĠF dfError ĠR ou ĠR ams ĠR ays ĠR IL ĠR prop ĠR TA ĠR cam ĠR PP ĠR Pi ĠR anger ĠR MG ĠR quantreg ĠR axml ĠR IGID ĠR aspberry ([ __ ([ (), ([ ()], ([ ""]) Ġval err Ġval String Ġval diation Ġax Z Ġax dim Ġax PC Ġax histy Ġax Retro np end np lease np splups np lq np rim Ġfi delities Ġ% *% list input list pred list All list Widget list Files list cosmic if D if F if g if k if ai if kq ub ed ub act ub by ub ey Ġ3 300 Ġ3 400 Ġ3 120 Ġ3 155 Ġ3 908 Ġ3 448 Ġ3 023 Ġ3 759 Ġ3 072 Ġ3 2946 test map test dist test err test dataset test Method test Img test keywords test waves test lbls test FeatureVector ies kie Ġme ng Ġme nd Ġme nor Ġme ijerint Ġres pec Ġres method Ġres keys Ġres izers Ġres idents line ind line item line colour line capacity line Masks line arty ĠD in ĠD ts ĠD amp ĠD ong ĠD ipy ĠD RO ĠD IP ĠD soft ĠD LA ĠD DM ĠD oro ĠD ICT ĠD anny ĠD IDA ĠD enoise ĠD Topography ĠD dkTask ĠD deTask rint Operation Ġlo x Ġlo ge Ġlo ubser ") $ ") '. ") ]} ") }), 01 199 01 61 01 600 01 400 01 168 01 108 01 886 01 1178 ne co ne red able Label able Task Ġcol r Ġcol y Ġcol loc Ġcol item Ġcol img Ġcol means Ġcol align Ġcol letter Ġcol chol ns k ns w ns ol ns ave ns ilberman cal File cal oy time graph time window time Array time now time pix time lapses time NIs Ġse in Ġse sh Ġse ism Ġse letion Ġse gem Ġse diments Ġv len Ġv key Ġv axis Ġv mean Ġv dd Ġv ou Ġv loss Ġv mode Ġv nn Ġv bl Ġv bounds Ġv pc Ġv ti Ġv xdata Ġv loop Ġv rp Ġv dW Ġv nR Ġv asp Ġv esper file args file str file source file times file OL file parser file button file Mode file cmp file OutName Er rm Ġel map Ġel bow ly on Error Fraction ff l ff probe ta f ta ste ta pers ta yl ta wat ta umax ind r ind z ind ign ind perm ). ")) ). "} out nc out records out look out Weight out filen out DiskIndx path ic path val path pre path Name path style path For pro pexp pro menade min C min iter min weight min ified min DF min ster min mass min ister min scorechange Ġk Q Ġk log Ġk new Ġk rand Ġk cent Ġk units Ġk mf Ġk Text Ġk ench Ġk md Ġk bytes Ġk phase Ġk orel Ġk antar Ġal ike Ġal lax ĠN min ĠN row ĠN ib ĠN bin ĠN ie ĠN gram ĠN IO ĠN CO ĠN aa ĠN scan ĠN PT ĠN pix ĠN grams ĠN LON ĠN TT ĠN GY ĠN aming ĠN segs ĠN ilm ĠN uclides ĠN IGHTS ĠN bary ĠN samps ĠN PointsArr ĠN avigator art i art wo art wod per n per peak per trade per ito per OutBed ds b ds pl ds pm ds atz ds urf import able bo or bo st bo bj bo ule ment ia str il str ath str rows str Info str Mid str thick str pdate str icmp ĠL d ĠL ose ĠL DS ĠL Det ĠL RD ĠL Arrow ĠL IDX ĠL utt mo urn mo oc mo ID mo energies Ġon board Ġon demand Ġon Stop Ġon Trade Ġon estep Ġon thispath Ġon mouseout index col index ops index Peak max num max prob max rec max DF max Label max tries max mass max Norm max XY max Freq max spd max Bucket max bnd max dmag max SentenceLength atu ur df u df y df sig df wn df dz pa wp pa gan pa usar fit ch fit data fit ls fit mode fit Linear fit bounds fit flag fit nh Ġpro gen Ġpro party Ġpro ductions Ġ{ | Ġ{ ", Ġ{ +%. class ific [: " pect ations dict R dict m dict df dict editor te a te ce te as te ts te CA te tha ĠM Q ĠM os ĠM ise ĠM ile ĠM add ĠM cov ĠM RO ĠM DE ĠM IG ĠM IR ĠM OS ĠM IX ĠM OC ĠM RR ĠM organ ĠM FM ĠM PEG ĠM osaic ĠM Bytes ĠM asion ĠM OOG ĠM ario ĠM iko ĠM cem ĠM ERG ĠM illions ĠM ascara ps g ps cores Ġmat D Ġmat i Ġan p Ġan tes Ġan ames Ġan oms Ġan Ion der int der ror der ry der mental der niere ys m ys calar ys pin ys ztof po co po zo po ynting Ġne b Ġne ater Ġne lev Ġne thist Ġl T Ġl mp Ġl nt Ġl col Ġl so Ġl gth Ġl no Ġl lat Ġl just Ġl star Ġl band Ġl nx Ġl cnt Ġl matrices Ġl iters Ġl une Ġl xyz Ġl relu Ġl mplot Ġl dip Ġl hm Ġl refs Ġl Pages Ġl datas Ġl igo Ġl Pipe Ġl ReverseIndex app id app rove app bundle app veyor red un core Area shape data Ġuse server Ġuse Only Ġuse ract Ġuse GPU Ġuse Astro fig R fig dpi we bm we bp we bob size Entry Ġplt icker ir atory ir rads ho op age grps Ġfrom labels Ġfrom script Ġfrom Depot 10 81 10 979 10 283 10 6580 10 779 10 333333333333333 ite ment ite packages samples Count samples ToCopy samples PerPixel iv hc Ġpar for Ġpar TT unction s learn curve Ġlabel sep Ġlabel Names Ġnum utils Ġnum List Ġnum dif Ġnum days Ġnum frames Ġnum Length Ġnum Pos Ġnum ina Ġnum notes Ġnum tim Ġnum shares Ġnum cvt Ġnum Parts Ġnum Trials Ġnum lost Ġnum Cadences Ġnum Workers Ġnum sympoints Ġnum UniqueFeatures Ġnum Identities Ġnum Vms assert ed assert Len ĠG ates ĠG mag ĠG NN ĠG CP ĠG CR ĠG RI ĠG AP ĠG Energy ĠG nip ĠG EC ĠG REY ĠG owers ĠG rondwater ĠG ladky Ġ< ...> Ġout record Ġout door Ġout standing Ġout GeoTransform Ġout cfgname Ġout Vseg Ġ/ >. Ġprint Figure Ġprint Matrix Ġprint Results Ġprint outs Ġprint Overlaps Ġprint TPRegion ore g ore illy ore caster Ġstr id Ġstr AB Ġstr uttura us g us pd row col row index row shape row wise row Dict row cells row masks lib arrow lib ili lib gobject lib swiftnav Ġma st Ġma gt Ġma stubs Ġma indb ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ gre ys Ġresult name Ġresult ats oc n oc sp oc can oc cdf oc ulture ari um ari as et b et on et pl et fs et ched ber ti pl uto pl ish Val or Val eur ĠRe q ĠRe generate ĠRe loads ĠRe cognized ĠRe ceptive ĠRe vise ĠRe hurek ĠRe eves comp as comp table comp asses comp Stars comp atability sc ur sc ens sc grid sc image sc cw sc idata sc aven sc enery Ġname shape Ġpre text Ġpre cond Ġpre existing Ġpre Idxs Ġpre warping Ġpre consolidation Ġpre requisite Ġpre xShift Ġtr na Ġtr ilinear ĊĠĠĠĠĠ Ċ mb n mb sz cl on cl la cl no cl keys cl user cl Params cl dup Ġfile d Ġfile label Ġfile filter Ġfile To Ġfile Id Ġfile Button Ġfile Output Ġfile titles Ġfile Quit ĠE a ĠE ase ĠE grid ĠE of ĠE IG ĠE TC ĠE SN ĠE GG ĠE SB ĠE pic ĠE rik ĠE mir ĠE LF ĠE llis ĠE Bs ĠE vacuation ĠE cliptic ĠE ssays ph ne ph ard ph rb ph osphenes ph Awc Ġdf ct ": :- ": (\ ": ""," Ġset X Ġset Format Ġset Prior Ġset astest =" * =" ..\\ Ġ4 86 Ġ4 2000 Ġ4 600 Ġ4 900 Ġ4 018 Ġ4 758 Ġ4 576 Ġ4 283 date Col date Array date rev ag b ag ua parse ms (): \ train F train lbls ms n ms um ms lp ms ld ms avector low bound low Bound low Hertz low Grade ĠB f ĠB g ĠB data ĠB ub ĠB matrix ĠB son ĠB ink ĠB PS ĠB GB ĠB ender ĠB Mag ĠB RF ĠB MI ĠB Fs ĠB ail ĠB RST ĠB ODY ĠB olus ĠB LOB ĠB BLSTM sh w sh re sh an sh red sh tools sh rp sh yue ty c append spdsh Ġun frozen Ġun covered Ġun censored Ġun clipped Ġun stripped Ġun registered Ġun consolidated Ġun verified Ġun normalised Ġun released Ġun picklable Ġun comfortably Ġun attachedvol Ġ5 9999 Ġ5 63 Ġ5 755 Ġ5 104 Ġ5 233 Ġ5 344 Ġ5 0400 ip address ip stab ib an ib ault ib ung ib lck ifi Manager jo pt param Data param files param Guess state less ask Price iter median iter kv iter CrossValid ute ur op n op Date op buff op inion Ġthis B Ġthis key Ġthis Values Ġthis Filter Ġthis Block Ġthis Slice Ġthis FP Ġthis Chain Ġthis pagecounts Ġthis bodytokens ses Path Ġdi feren Ġdi oct Ġdi aTab log Y log u log linear log Warning log levels log Level log deriv log FileName log matches log StartEntry log StopEntry key b key van key stitle random Seed random Auctions axis Scale axis Heatmap In Power In Training In cluding In cid In dividually In door In icio In Regions In accessible In ferential In kscape In depVar In Reported ast es Ġlist sep Ġlist Files Ġlist Lvl Ġen ose Ġen rolled Ġen ormous rid d ef er ĊĠ ĊĠĊ Ġle dge Ġle thal Ġle pton da u da isy che c che w che st che rel che lr Ġrandom sample Ġrandom colors Ġrandom seed Ġrandom Seed ile e ile o ile pt 99 20 99 036 99 867 99 957 Ġcomp u Ġcomp Data Ġcomp lic Ġcomp Str Ġcomp Stars Ġcomp ulsory Ġcomp navigatorwidget Ġcomp licate Ġtime ly Ġtime code Ġtime pts Ġtime vec Ġtime Window Ġtime processor Ġtime Title Ġtime spot Ġtime VS Ġtime Span Ġtime deltalike Ġint f Ġint type Ġint df Ġint node Ġint ramember ant Mag 64 03 64 27 64 30 64 0505 64 9697 64 1458 Ġclass ifi Ġclass ific Ġclass info Ġclass vector Ġclass ifie Ġ> . fo unded pec ific und is score list score Labels Ġ`` [( ĠTrue Pos Ġat tractions ĠW v ĠW ise ĠW exp ĠW ey ĠW ish ĠW MA ĠW inds ĠW lite ĠW igner ĠW atts ener get ener gie format Input format InputData Ġmax C Ġmax E Ġmax idx Ġmax width Ġmax lat Ġmax level Ġmax total Ġmax bound Ġmax gap Ġmax Noise Ġmax Light Ġmax Ticks Ġmax Ha Ġmax Plain Ġmax BH Ġmax Eta Ġmax LocalAuc Ġmax jumpsize Ġmax TotMass Ġmax NSS Ġmax LineGap cs olution pha m pha el ., )/ ord o num Z num y num results num Plot num batches num leaves num Training num Prediction num Epoch num Vars num Dims num Iterations num decs num Cand num traps num Neurons num Prin num dati num LEntry num qqpks og c og rad model A model List model Root model errs model stemp Ġfe cid Ġfunction approximators init mem init Left init iating ide ally ide lta add Group add ressed add Sample add peaks add Example add Exec add Edge add Particle add Representation add Pairwise 12 78 12 349 12 798 12 156 12 924 12 189 12 4615 gor ie Ġget x Ġget val Ġget Model Ġget Image Ġget Matrix Ġget tile Ġget Features Ġget Action Ġget Labels Ġget Files Ġget Icon Ġget Binary Ġget Avg Ġget quotes Ġget Good Ġget Curr Ġget Photos Ġget MetricSpec Ġget Sentence Ġget Quote Ġget Cylinder Ġget Dos Ġget Newick Ġget Exif Ġget Courbe Ġget Adc Ġget ParetoFront ĠO V ĠO xy ĠO NN ĠO wn ĠO pus ĠO dh ĠO xygen ĠO mero ĠO wner ĠO DFs men ded Ġrange V Ġrange Id nel ies bs cale result R result ats result Folder Ġshape x Ġshape data Ġmodel Out Ġmodel pars Ġmodel DB Ġmodel Flux Ġit w ()) ([ ()) )* ()) [:- ()) )))) Ġaxis b Ġaxis c ca pi ca kes error Cu Ġdefault Val Ġdefault Name Ġdefault Dir value func value unit sub stance sub join sub image sub feature sub item sub total sub words sub child sub segment sub elements sub regions sub hdr sub references sub schedule sub systems sub tours sub tema Ġvalue map ep v ep max ep ix Ġcheck List Ġplot v Ġplot mat Ġplot state Ġplot items Ġplot File Ġplot groups Ġplot Function Ġplot cmd Ġplot Count Ġplot contours Ġplot acf Ġplot Ord Ġplot dF Ġplot NameList Ġplot Circles Ġplot CurveList Ġplot controllayout Ġplot SuccessRate roup UDF Frame Style Frame Groove ix es ix sb map Dict map cube map connections Ġall d Ġall int Ġall params Ġall pos Ġall The Ġall Files Ġall Columns Ġall Acts Ġall PartsPlot dir Out dir Summaries dir WithModel ĠFalse Pos Ġhe y Ġhe sse Ġhe apy sum Spec sum ming Ġpo k Ġpo ke Ġpo unds old datashape old Actions vel r Ġwh mean Re mark Re partition Re setter Re Tokenizer Re quiring Re covering Re actants Data In Data Series Data Table Data By Data Process Data Block Data Pack Data Container Data Viewer Data Constants Data Tst Data Tourism Data Planes Data IndustrialPI Data Vdn float Index ft ilde ft perk 25 32 25 27 25 86 25 98 25 120 25 707 25 8824 25 553 Ġso ure Ġso led raw time raw args raw io raw Material raw xrd Ġline y Ġline kwargs Ġline ars Ġline Labels Ġline Edit sing l sing ledispatch Ġwhe ater frame Rate frame Each most ra most frequent inter seismic inter arrival inter lude Ġpd today Ġch n Ġch arg Ġch ist Ġch uid so ph so las so matic so dium Ġdist x Ġdist range Ġdist Seed Ġdist anza ĠReturn Item ren ches ren amiento ree valuate ll rs Ġ.. " Ġ.. ._ Ġ.. ]): Ġ.. ...... 11 35 11 125 11 109 11 177 11 462 Ġcan Forward Ġcan Backward mean P mean line mean file mean activity mean excess read length read DF read Matrix read through read into read maxevals loc id loc max loc ial 32 33 32 18 32 92 32 84 32 2000 32 89 32 432 32 244 unc iation Ġ---------- """)) ave filename ave pixel ave Panel ave Slope Ġmin D Ġmin P Ġmin ax Ġmin range Ġmin points Ġmin ish Ġmin Text Ġmin bound Ġmin conv Ġmin sec Ġmin scl Ġmin Eta Ġmin AngVel Ġmin TotMass Ġmin LineLength Ġinput Val Ġinput filename Ġinput DirectoryPath his a pi lots ormal ized Ġ[] ]}, Ġ[] #, cc at cc Entry cc dz cc Claim Ġz j Ġz ax Ġz true Ġz tick Ġz trans Ġz fill Ġz List Ġz mag Ġz star Ġz Label Ġz vec Ġz flag Ġz bot Ġz pow Ġz zz Ġz tim Ġz mtx Ġz inb Ġz qso Ġz nucl Ġz CentLst ng host color array color idx color Num color Scale color Cycle text path text ile text model text kwargs text User cy mb cy meToGridlab Ġ\ ;, labels Up labels Down ĠIn G ĠIn verter ĠIn dice ĠIn icia ĠIn iciando Ġper me Ġ10 22 Ġ10 37 bin M bin file bin edges bin Ids bin Centers Ġsc cope Ġsc rollable act y act ing act igraph ĠY U ĠY ss ĠY path ĠY valid ĠY final ĠY ale ĠY RANGE ĠY OLO ĠY ARN ĠY orick Ġdo u Ġdo fit Ġdo ave Ġdo ugh Ġdo psd Ġdo cks Ġdo Db Ġsh aradar Ġsh preader Ġ) """ Ġ) +" Ġpa cak Ġpa inful range KM range Checkbox Ġnew U Ġnew n Ġnew z Ġnew set Ġnew date Ġnew frame Ġnew Type Ġnew Col Ġnew cell Ġnew field Ġnew Res Ġnew units Ġnew edges Ġnew coord Ġnew Values Ġnew lc Ġnew Range Ġnew member Ġnew camera Ġnew Lists Ġnew Direction Ġnew Uf Ġnew tier Ġnew Spectra Ġnew Mail Ġnew Uo Ġnew Ug Ġnew prescripts Ġnew PriceLis Ġtrain In Ġtrain idx Ġtrain stats Ġtrain Image Ġtrain Sizes Ġtrain IPs Ġtrain IdListR Ġj er Ġj un Ġj grid Ġj avg Ġj ared Ġj pv Ġj knife Ġj uggled true Labels req Account gra u gra df ĠH q ĠH at ĠH pe ĠH arr ĠH na ĠH ess ĠH oriz ĠH QL ĠH arter ĠH kl ĠH gm ĠH GH ĠH ARD ĠH IE ĠH iggs ĠH orton ĠH eldoutProbDist ĠH azen ĠH ateren ĠH autier ĠH fArgumentParser 15 23 15 89 15 51 15 59 15 81 15 72 15 71 15 928 print Out print Step print resmat print OperationWith 05 90 05 63 05 617 05 09804 05 758 05 8465 input train input err input options input Sets input Bits input ExpFile Ġlog h Ġlog z Ġlog part Ġlog tol Ġlog List Ġlog amplitude Ġlog Sizer Ġlog Weights Ġlog Likelihood ded uct ork i lect ures lect ron Ġfig list Ġfig args Ġfig fname Ġ+= - Ġ+= \ Ġ+= +=+=+=+= are z are setn tra s tra ctors tra dix tra veltimes tra chelr ich ler ich umidity (), )]) ang ers Ġinter ps Ġinter group Ġinter layer Ġinter trial Ġinter mittent join ing Ġsample data Ġsample Data Ġsample File Ġsample Str Ġsample Count Ġsample Factor sed growth Ġpy p Ġpy r Ġpy bar Ġpy colors Ġpy api Ġpy mol Ġpy phys Ġpy tim Ġpy ranges Ġpy vw Ġpy opy Ġpy xform Ġpy kalman Ġpy dap Ġpy charm Ġpy radex Ġpy LDAvis Ġpy mks Ġpy probml Ġpy choacoustics Ġpy NLO Ġpy libconfig Ġ[' ^', Ġoutput Str Ġoutput bias Ġoutput Writer Ġoutput CsvFile Ġoutput upperlimit start E start val start py start path start px start Metrics start Sem idx X idx tr idx zero idx em idx Sorted not op not ifier not implemented not MNIST not passes not Mapped not hate not arlite ens zel Ġobject Id Ġno i Ġno pe Ġno ite Ġno filt Ġno page Ġno frames Ġno Cache Ġno Changes Ġno fitflag ĠU W ĠU b ĠU o ĠU mean ĠU ND ĠU MC ĠU rl ĠU SN ĠU HGT ĠU PARKED Ġla dy Ġla vc Ġla xc Ġla dders '], )] pr vs Ċĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 20 68 20 8538 fa Rates Ġ(' '. Ġ(' .' Ġ(' /', Ġ(' --> quen ame Ġcl ue Ġcl Score Ġcl arified ĊĠĠĠĠ ĊĊĠĠĠĠĠĠĠ ĊĠĠĠĠ ĉĉ ĊĠĠĠĠ ĊĊĠĠĠĠĊ pos X pos able 33 01 33 78 33 13 33 34 33 67 33 988 33 327 Ġsub df Ġsub cc Ġsub dtype Ġsub link Ġsub steps Ġsub words Ġsub way Ġsub lc Ġsub xmin Ġsub peaks Ġsub tle Ġsub windows Ġsub intervals Ġsub DM Ġsub meters Ġsub prefs Ġsub projects Ġsub diagram Ġsub populations Ġsub predicates Ġsub tours Ġsub diagrams Ġsub mits Ġsub ordinated Ġsub reddits Ġsub marines ie z Ġcolor log Ġcolor ssrc no ur no val no label no file no year no Use no dipdip default Val default Toolbar default Boundary default ColorMap default Movable default formatd default Diagonal default PColorMap default TextColor io map io pop 201 865 201 308 rst filename --- # valid Idx valid lbls Ġha vedate 80 451 pla int pla ci output fn output Dict output String output Filter output Mode output statistics output Src output onoff output GraphFile output taskfile ont Properties Ġ6 88 Ġ6 81 Ġ6 82 Ġ6 600 Ġ6 120 Ġ6 048 Ġ6 312 Ġ6 660 new one new label new ly new train new text new labels new mask new cols new img new page new Item new Functions new Workspace new Spectra new addition new imageComboBox new CorCoefs new squareiter Ġ. ) Ġ. ") ES OME Ġfit ed Ġfit table Ġfit ls Ġfit parameters Ġfit teff Ġfit pka emp late ER TON pen ality IN Q IN VERT IN PSN ug o base ment base font ard ina Ġtype Act ĠData Iter ĠData Training ĠData Iterator ĠData bricks ĠData Mining [" [ code num code ìĿ¸ split at split Value split func ]] > ]] ',' ]] /( ]] +[ uni ref uni mplemented uni axial vert align vert Align ats pini 66 09 66 1601 66 2509 amp a amp tk amp ieri Ġrow h Ġrow r Ġrow count Ġrow html ay line ull r au de au dr ĠSe an ĠSe ismogram ĠSe infeld 45 94 45 50 45 40 45 73 45 41 width guess ific ado AT L AT IC AT TAG AT ACC }, '. Ġind r Ġind var Ġsup r Ġsup ra ĠK f ĠK g ĠK i ĠK y ĠK ac ĠK nn ĠK eq ĠK Path ĠK MS ĠK Hz ĠK PP ĠK ORD ĠK LD ĠK NOW ĠK ansas ĠK nox ĠK laus ĠK archer load data load Manager load Results load Bundle load Audio load Nib 75 11 75 96 75 55 75 74 75 83 75 59 75 52 75 41 75 2199 '' """ Ġspec filename Ġspec dims Ġspec ifc matrix Type != % ally vals use ast use Det use Merge use QueryCache use Avro 88 55 88 54 88 52 fn cl fn yquist Ġ| ------------| grid Action grid Limits grid Vx grid labd "] `). "] }), ']) ])) ']) +','+ 16 33 16 100 16 83 16 52 16 224 16 160 16 327 16 8627 16 3110 16 84911 ml at ml doc ml Min Ġup scale Ġup stairs Ġup daters Ġcal train Ġcal stars av to av ian av sky av RadiusCost av ocado sample project sample ador Ġpos car iss h iss uelist Ġcor Ret Ġro ation Ġro ty Ġro ix Ġro ster Ġro cket Ġro sterPred show G show Data show caps show kern show Capacity show Generation show buts show Fossil show Paused ong ous dist an dist hist dist Image Ġapp cfg ak an ak ers Ġone q Ġone over iod ine nan im nan ny ĠEx ceed ĠEx ternally ĠEx ceeding bar size 35 51 35 296 35 193 35 8876 Ġcur set Ġcur len Ġcur Frame Ġcur pad Ġcur ious Ġcur Ref Ġcur Chunk arch s arch itect 14 96 14 73 14 975 14 234 14 6495 14 4237 Ġtry er Ġtry makedirs Ġtry psin sq t sq title sq subset sq supset 19 100 19 27 19 36 19 265 19 346 19 344 19 143 19 453 Ġkey d Ġkey idx Ġkey Up Ġkey Down with Std with Scaling with Zone with drawn with Centering group path group wise group filt group grades ))) ``. tt g tt ens tt wo pol ls tick mark tick style tick Dt tick IdxByGapMaxPhylDiag count Matrix Ġvari abe cur d cur bufs cur rencies cur velist cur rido Ġsize Back )] ][ )] ',' box y check dir check var check Coords Ġprob A Ġprob B Ġprob abl Ġprob alities AR Regressor AR RI AR MANPY Class Path Class Rug com otive com arcas com arques Index Tests Index States ON GT ON MENT axes color axes Bar axes Modified Ġ8 43 Ġ8 57 Ġ8 74 Ġ8 76 Ġ8 00000000 Ġ8 219 Ġ8 431 Ġarg l Ġarg color Ġarg List Ġarg inds copy doc copy groupindex 78 05 78 68 78 52 78 400 St ds St ix St udi Ġmake fill Ġmake Matrix Ġmake Project den ial den ses den cial '. *? 13 97 13 90 13 63 13 0553 200 60 200 80909 Ġbin Data Ġbin paths Ġbin rep cor a cor iolis ized Text own des own Cloud mask Inverted Ġid k Ġid ler Ġid lst Ġid Stay ĠV H ĠV ms ĠV ign ĠV ll ĠV Type ĠV phas ĠV lr ĠV As ĠV IX ĠV rl ĠV EG ĠV rr ĠV gm ĠV oxel ĠV EH ĠV SWR ĠV enus Ġtm Learn Ġstring List Ġstring New rand Index by Q by c by ranges by party by rmm be gan be ijing title Str title tag title FontSize Ġpath SegmLesions 22 9595 Ġcopy files nd re nd Array nd deriv nd chrm nd Rcv gs f gs max gs issh Ġiter min Ġiter str sp w sp ray sp filter sp const sp gp sp BUout sp LearningEnabled Ġdate parse Ġdate Run wo ol wo odem arr data arr vs arr hythmia Ġother Name Equal ized Equal Mixin table A table Result table Node table åĩ½æķ° 04 123 04 600 04 395 Ġerror code sv cs sv ydf clf ile qui la qui vers prob dists prob chance 96 78 96 82 96 5686 03 474 03 0419 03 8683 ])) +" pon ge pon der pon axis the or the stats the tic the Fig the atres the flatarray lat lim lat ins lat Full lat itudine string var string expression metric x Ġstart Index Ġstart strain Ġstart Yr Ġstart WithBundle Co bra Co vp trans m trans dat trans route trans verset ĠTest image ĠTest Object ĠTest By ĠTest Add ĠTest Results ĠTest Query ĠTest Order ĠTest GroupBy ĠTest Basic ĠTest BigQuery ĠTest Imag ĠTest Iss ĠTest Ftest ĠTest MySQLAlchemy ĠTest PostgreSQLAlchemy ĠTest MOE ĠTest DatabaseManager ĠTest Epanechnikov ĠTest Hampel trib utary 02 14 02 49 02 976 02 900 02 3000 Ġfeatures ize Ġmo matrix Ġmo oring Ġmo strar bose q target dist target File target VideoSegments Ġdict ate Ġend d Ġend test Ġend obs Ġend Page Ġend Idx dot e dot dot dot List dot vl write file write File Ġ{} .\ Ġ{} >'. Ġ{} );". 95 01 95 13 95 04 95 03 95 02 95 70 95 76 95 72 95 800 95 95542 Ġover pass Ġover plotting Ġover potential 94 68 94 74 94 79 94 62 Ġ100 3 Ġ100 4 Ġ100 6 uple ts ',' [ ',' --', ',' --') ',' âľĵ Ġcom tains 17 256 17 099 17 327 17 954 17 9487 of Chisquare alpha B alpha x alpha Scale Ġdataset MeanErrors ĠCo res ĠCo hort ĠCo oling ĠCo coca lock Button object A object ome object Seed object AtIndex keys ym Ġ{' / Ġcolumns Default ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ 85 29 85 46 85 89 85 63 85 82 85 907 85 280 rt f rt Hz sort IfNeeded Ġdif matrixPM Ġfa ps Ġfa cs Ġfa Rate Ġbase names Ġbase fn Ġbase File Ġbase src Ġbase Domain Ġfirst Wavelength OR GAN Ġcolumn as Ġcolumn In Ġcolumn width Ġcolumn Index na ss na iling na stran DataFrame Handler run if run solver run MSE run Solver run Operation run Modal run gfm run ControlBox Ġfeature tools Ġfeature Extraction ular is Ġexp dat Ġexp ddt Ġexp MovAvg Ġcont Step Ġcont aning Con GPU Con gestion mon os mon year mon soon Ġscore M order date 24 87 24 101 24 385 24 299 24 653 Ġbut tom Type Def Type Holder Ġinit p Ġinit Cursor 27 391 27 2400 27 0297 Ġdis h Ġdis cs Ġdis plac Ġdis pls Ġdis okay close PythonGraphics Ġ7 10 Ġ7 64 Ġ7 88 Ġ7 34 Ġ7 47 Ġ7 49 Ġ7 400 Ġ7 110 Ġ7 700 Ġ7 900 freq ency freq LimBeta cat aly image Cand )), ] main Bundle node Size node sep node Txt istic ally ref name ref product ref bg ref Band ref rT Ġresults C Ġresults I Ġresults WC Ġaxes Patch Ġtransform Back 86 28 86 348 86 786 IT T Ġimage In Ġimage sets Ġimage view SE MIC gen ded gen Spec gen Kernel gen capacity gen etics Test Vars Test Grib cul ley scale type scale map scale Data assertEqual MW lean ed right Push AN DE AN CH AN GH AN CED Ġinte gridad abs d abs chi var file var import var AB var binary ĠSee k back trace }) ( }) = }) }{ cent pt Ġsys quant Ġsp mat Ġsp cs Ġsp kr Ġsp itzerCal Ġsp BUout Ġsp BUOut ĉĉ ĊĊĉ Ġmean Z Ġmean r Ġmean Value Ġmean Array Ġmean field Ġmean Errors obj view 06 93 06 348 06 234 06 2351 temp os temp View temp Vert temp WP temp FOff sy stemp sy nonyma 18 12 18 91 18 400 18 164 18 2575 err m err on err var Ġcontain sy 36 33 36 19 36 000 36 31 36 57 36 74 36 53 36 039 36 111111 Ġwarn if 09 88 09 78 09 28 09 101 09 3343 level Mask 07 13 07 36 07 92 07 000 07 79 07 61 07 2018 07 220 07 1989 07 02422 07 9975 07 999999999999996 07 45748 work pace Ġpass o ap Area ap Wrapper ap ionly Ġqu and Ġqu ifam Ġrun it Ġrun Model Ġrun Id Ġrun Training Ġrun Digits Ġrun Mutect Ġrun kMeans linear scan Ġnode time Ġnode num Ġnode Class Ġnode draw Ġnode Pool feature Counts Ġwhere upon Ġwhere abouts do pe do mean do Load do Plots mod w mod debug mod ulations LE Y Ġ, '.') man ic man ded man uscript length scales Par list Ġidx dt Ġidx Lo Ġidx Beta Ġidx OfBestPoint ĠLicense e dis mat dis pen dis location dis section dis aster dis cord dis appoint dis hwasher ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ testing Set Pro ces Pro pag Pro yect Ex og Ex AC Ex tern delta Lam ST IC Ġadd h Ġadd Noise Ġadd ChannelDim rc d rc irc spec slice spec dims spec fun reg Values reg ulates reg ualr Ġdoc la Ġsol mat Ġsol comp Ġsol vents Ġlin file Ġlin fit Ġlin func Ġlin cols Ġlin solve Ġlin Weights 34 23 34 43 34 47 34 49 34 856 34 388 34 0594 eff izient Ġ... )), Ġgrid Search 97 32 97 80 97 93 97 41 97 037 97 297 97 3906 filename Traders Ġloc list Ġloc List af on Ġpart seq Ġnon matching Ġnon stoichiometric lob by Ġreg t Ġreg ot Ġsupport y ĠJ d ĠJ ext ĠJ matrix ĠJ PO ĠJ ew ĠJ ung ĠJ umps ĠJ anelia 92 05 92 88 92 98 serv iew graph corr Ġmode parsers Ġmode Vals save map save arr save Panel save ASCII sent ing sent ia ID ENCE ID toSize Time Int Time Info Time Converter Time Span Time Partitioning Time Characteristic Time Stamps Time ValDict version check version changed Col Regex Col lider Col izoli cv l cv odb ĠSeries Parser ĠSeries Writer part i part icular part imatrix Se is Se idel Se gement Se hir dt Date dt now dt lz dt TxtCtrl bu ch bu ider sk urve sk rebate Ġload ratio Ġload User Ġload Results Ġload Epoch Ġload Ui Ġload Elec ĠQ M ĠQ a ĠQ FA ĠQ sca ĠQ Learning ĠQ Expr ĠQ Pen ĠQ hull ĠQ ScrollBar ĠQ DateEdit ĠQ ItemSelectionModel sg id sg pb 84 99 84 14 84 23 84 08 84 693 84 461 Ġtext path Ġtext width Ġtext angle Ġtext boxes Ġtext ToUse Ġtext templatesrc Ġtext positionsrc center On return df return Pathways return PredictedActivities Ġq me Ġq low Ġq sed Ġq obj Ġq plots Ġq job Ġq mi Ġq Values Ġq variant Ġq qp Ġq ValList ram arginal IC tCp left Push Ġsort Prop Ġtarget Q Ġtarget rect Ġtarget Info Ġtarget bits Ġtarget Adducts Ġtarget Ixs my y my val my set my ind my frame my cm my Date my tuple my Mask my Files Ġvalid Join Ġvalid Cap Ġ9 144 Ġcode Parts config Session Ġgroup box Ġgroup Name Ġgroup Dict Ġgroup filt Ġgroup Other Ġgroup uniq tx Bytes tx Packets Ġcurrent Path Ġcurrent band Ġcurrent Axis Ġcurrent Load Ġcurrent Price Ġcurrent Tab Ġcurrent sender Ġsign bit Ġread Params Ġread feats Ġread HDF Ġread tmy Ġread WSD Ġfreq Pow ac ces ac adas ac erto ac quaint Ġim file Ġim num Ġim color Ġim copy Ġverbose Output update Time update Current update Plots update PilotServer ids list ... $ Ġtemp f Ġtemp x Ġtemp cat Ġtemp sol Ġtemp Pos Ġtemp FOff Ġmod ulators ris max ris coll ris bane non shared non interactive non ascii non roi non dynamic non overlapping non latlon non datetimeindex non Contig non printable rows ID Ġtf Ex UT IVE Ġav dist Ġav gy math function math Label math functions Ġtwo q Ġtwo key Ġtwo dim Ġtwo emits Me mor Name Table Name ToName kernel data eps Max eps fac gr f gr ph gr ui gr anger gr izzly 65 18 65 42 65 21 65 686 65 51 65 58 30 96 30 83 Ġcluster Time db us db xrefs db ckndsub Ġac ct Ġac ronym File Txt File Handling Ġcv args Ġcv num Ġ<= ', stack dir stack widget stack Height stack Trace filter I filter type filter list filter Type filter Name filter Rows filter Pixels unk res cluster biweightcenter Ar ith Ar bres Ar fW Ġass ig Ġad m Ġad x Ġad mitted Ġad vective Ġad verbs Ġright Clone Ġtrans inv Ġtrans Figure Ġtrans missions Ġtrans membrane Ġtrans Onsets Ġtrans formad 37 07 37 97 37 42 37 74 37 73 37 91 37 318 37 221 37 9164 50 64 50 784 50 85714 50 837 Ġlambda M Ġbetween Y Ġconfig uracion ower ing SV is SV MP SV LEN Ġtable file Ġtable tt Ġcall data Ġcall stack step To cont enders Ġloss lessly Ġmulti Index Ġmulti Line Ġmulti objective :] ' :] }, cols ID Ġcompute Diff mt n mt ab mt otal mt win Ġaverage distance Ġaverage Winning Ġ& > Ġ& ") tf array tf lags tf dc tf pQ Ġweight df ls un ls dv ls Sym gn ss gn th gn osis ĠCon ds ĠCon sidered ĠCon don ĠCon versation ĠCon ductor ĠCon stitutive 87 35 87 03 87 40 87 000 87 48 87 285 87 017 87 7076 flow mon flow Sfr mpl Bundle vi co Ġtra int lip le point stod Ġtraining DataSetNames RE ACTION RE PLAY RE VERT RE COG RE MOVED top fig top left top Channel top Sizer top Cnt top Friends CA AAT CA lgorithm Ġwidth F Ġwidth T sign es sign arDimension Ġzip import OD B OD BA Ġlow res Ġlow cov Ġlow src Ġlow Rec Ġlow Bound State ments State wide State Tuple ik l onts inger )[ ()]: Ġoff ender Ġoff ering legend vec legend only 44 45 44 75 44 43 44 906 Ġleft X Ġleft x Ġleft Shift Ġleft Clone item izer item Text ĠZ R ĠZ mat ĠZ Axis ĠZ DT ĠZ illow ĠZ ircon ĠZ eppelinContext ĠZ MaxStats Ġcreate Dict Ġcreate Graph Ġcreate Random Ġcreate Figure Ġcreate Mask Ġcreate Fourier si i si ren si mag si ret si lia si peo active Zero active CoincsFile Ġneed main Ġneed ToMerge acc ms acc ums Ġacc DF Ġmsg box ays is ays Before 55 378 Ġob se Ġob ci Ġob tiene Ġshow AnomalyScore alg olist Ġpoly a Ġpoly hedrons EN UE pectr atio ĠAr rows ĠAr gon ĠAr ya ĠAr ffhandler pth resh 23 000 23 645 23 145 last index last find last Action last Save last upd last mono last Speaker last ZoomRect last Stunned Ġ(" {: Ġ(" +", pop in pop cycle Ġuni i Ġuni valent Ġparams lower Ġparams full Ġinitial File Ġinitial ising img name img par img Frame img dir img node img tk img proc img Region img Slice img Filtered Ġbu ider dataset name Ġ20 200706 hist color Ġdifferent iating Ġback name Ġback Num Ġback propagated Ġ[" ' Ġ[" *** Ġ[" >", Ġ[" {}: multi col multi entry Ġfilter Type Ġfilter Var Ġframe width Ġframe Dict Ġframe Found can Loop can Reflect Ġev tk Ġwindow Id Ġwindow Menu Ġwindow Should 26 19 26 03 26 31 26 74 26 73 26 176 26 9708 De part De formation De tach De leg De allocation De multiplexed De laware AG A AG RIC AC TF AC CAG AC GGGG Ġlast ax Ġlast result Ġlast tick Ġlast Progress 77 00 77 0000 77 63 77 71 77 075 77 0720 77 6470588235294 77 4476 python tutorial python challenge ĠDe sert ĠDe mon ĠDe convolve ĠDe composed ĠDe formable Ġfiles rc Ġgraph Map Ġgraph FileLocation process BaselineNoise ld l ld um Ġboo strap view dict view menu view Scenario "), (" auto Data ai ian RO Y RO Cs RO BIN RO ACH word le word Frequencies TI E TI MENT TI GR TI EMP TI ALS TI ALLY over b over laid over whelm {} _{}". sup pl sup ramarginal Ġevent ProcessCD unique Users Ġsplit W Ġsplit x Ġsplit By Ġsplit Moment Ġ] ----------------------------------------------------\ Ġstats dict Ġstats Util ga e event let event collection net w net Pnl net ExportsQ net stimlist pandas GEX ume xData Ġpl k Ġpl ated Ġpl pos Ġpl gn Ġpl mode Ġpl anners Base class Base Mixin Base Field Base Indexer Base Processor Base Plasma Base PlotMethods search ing search Subtree Ġ[- ( cell Data cell wise cell Types cell Coord mer ing mer na mer gence mer kle mult if mult ichannel Ġite ger fol ine Ġfigure Patch Str Base Ġcenter marker Ġcenter Factor Ġcenter OfAerosolMode Ġnorm x Ġnorm names Ġnorm diff Ġstep ped Ġstep Num Ġstep Mode files Before pd Table Ġsim xs Ġsim tot Ġsim factory Ġar reg Ġar stubs je ts Ġvector I Ġvector Features ĠSt rouhal Ġcond lists diff arr plots ave means ky create ref create Entity create TempFile 42 45 42 17 42 91 42 3529 98 394 98 223 98 958 98 33333333333 98 2578 expected Image Ġdraw File Ġdraw Iso kw name ++ ') Ġtotal e Ġtotal files Ġtotal Train Ġtotal Results Ġtotal Arr Ġtotal Days Ġtotal windcost Ġtotal solarcost Ġtotal CPUtime draw color draw bounds draw Radius draw FIGS font B font Color font stretch ob r ob struction ob tener ob tuse window sizes window Length bl and bl posn Ġ} ]) Ġ} `. Ġ} \\ Ġ} }" Ġ} """, side name side plot side car side areas AB EL AB TD AB LISH lower band lower Bound Ġconvert ion Ġconvert Function Ġconvert Results seed Type source File source Address ream ble make key make Grid make circle make First make KeyAnd make BedGraph make MissingDataframe make WidthHeightInts IP ET layer tag FF orm FF SD FF orecaster FF ontProperties \\ { \\ ), \\ )" \\ |} Ġdec ed Ġdec imators Ġdec ription times Forwarded )* , Di i day Count day Close day Open day Limit metrics DescriptionFile List e List Box List RoutingHelper Ġ12 86 Ġ12 00000000 Ġ12 346 MP US Ġobj name Ġobj ekt Ġabs mean ĠĠĠĠĠĠĠĠĠ Ċ Date Num Date Bounds 43 99 43 64 43 66 43 958 seq align seq records 67 20 67 14 67 92 67 6300 67 1499 67 0967 Ġfind Corner ĠAl liance ĠAl igned ĠAl nConf ĠAl varez Ġsingle Test Ġoptim us Ġfilename No ĠPer sson '][ ()]) mand o mand u radius Value DE MO DE AP 08 23 08 39 08 9444 number Periods mm list Ġfunc map ler ow Ġreturned ToDepot mag type mag py mag lags CV s Ġtitle append Ne T Ne u Ne on ions data Ġtri ms Ġtri maln uch t uch ling ia e orig Val sql cmd xy A xy cen To K To Class To ogle To gether To Code To Mark To Queue To Edge To JSON To Mid To Pdf To Bed To Bytes To Infer To Intersecting To Debugger To MySql To XmlFile fs rc ev ice ev ac ev olent ,) `, ĠComp iled ĠComp etition ĠComp ulsory Ġsource rect Ġsource Dict extra space extra ClassPath store dict Ġbest p Ġbest mod Ġbest Fit Ġbest Overlap Ġbest Fich Ġbest Heroes drop Correlated ins ically Ġdistance g Ġdistance Tra Ġcross cov Ġaf pp Ġaf resh first Color first mono Ġfield sets Ġfield Names rs fmri open hdr open Fisca Ġtrue Bucket link check link sets link ports Ġuser info Ġuser config 000000 5 000000 012 000000 08274 Un zip Un informative Un ordered Un calibrated Un confirmed Un know Un recognizable 47 05 47 33 47 19 47 09 47 26 47 68 47 2135 total W total h total number total Files total Flux total Meth total Slippage total Commission total ReviewUserSet real Words real AngVelTS fra q sim TimeStep Ġsave trace Ġsave Pickle Ġsave JSON Ġsave Matplotlib Ġsv npath Ġsv ydf Ġhigh ers Ġhigh src Ġhigh Rec ox id ox idation Ġmap c Ġmap q Ġmap bin Ġmap fn Ġmap To Ġmap maker Ġca cl Ġca unting Ġimp inging tz f tz data lu id best words best Mask best logg Ġpassed Tests user Token user Json Array Manager json p json dat Ġraw dir Ġraw File Ġraw location Ġraw uuids Ġraw inventors style lib style key style converter OL ITH Ġupdate Data inv P inv var inv oked inv olved inv Dirs period arr Model ID Model Button Model Utils Model Relation Model InputSpec block Offset block placement block tempA block tempB patch label patch Args SD IR OT ED OT HT Ġtop left Ġtop Candidate Ġtop WordScores Ġtop TopicsShown Ġtick up Ġtick right Ġtick left Ġtick sign Ġtick down Ġtick resolution Ġtick Pos Ġtick Local poly oth FI tem FI Safe Set Type Set Base Set Channel Set Monitor Set Remote Set RoutingHelper tmp t tmp z tmp TX tmp Insertion idual s rad os rad Button rank res rank results TR F TR UST Ġsuper posed Ġsuper kern current cell current Coord Ġgo v ily a star list star args star parm star parmnames inf ocus ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ div max depth range depth growth connect ivities Ġcmap Py mov itz full Name go at go Button Ġwas Col Ġwas serstein edge values edge Type edge Time edge Features edge zorder edge aware Ġ'. '+ Ġ'. /_ Ġhist FWHM Ġcorrect bygenre Ġinst an Ġinst cal Comp iled Comp Mech pert urbs Ġhow s Label Tooltip Ġtree log Ġtree Name ĠUn zip ĠUn available ĠUn igram ĠUn reliableArray ĠUn MarkedNodesG NA ttens mu ck mu LAn 28 95 28 94 28 286 28 2504 Ġstore all Ġstore once stop iteration stop Requested EL SE EL ERATION field set field count field mask ĠSet uptools ĠSet Target Plot Name Plot Grid Plot Interface Plot Cdf Plot Saver Plot Measured vec min vec ppf 9999 98 Ġequal izer xlim LOG ĠPro te ĠPro grams "]) } find source find Synonyms Ġdiv VNorm Ġprecision Bits gin x Ġedge colours For r For Path For One For History For Compiler For Ele For Views For HOMER Ġmodule Class vol unteers lem n lem bert Ġmetrics Manager Ġmetrics FileData 29 8597 čĊč ĊĠĠĠĠĠĠĠĠĠĠ čĊč ĊĉĉĠ cos dg Ġclassification Label Ġclassification Count layout d ud an Res post Res Idx Res idency Res izableDraggableWidgetBase Ġhere under Ġpositive Hidden En closed En abling Ġfull scale Ġfull scan Ġfull Arg Ġfull Attr Ġfull Narg Ġfull PCCdata Ġstop thresh hand icap ĠPlot table ĠPlot Figure ĠPlot Peaks ĠPlot Survival ĠPlot Marriage dev set dev test steps PerEpocheVal Ġlearning Window 39 11 39 17 39 138 39 842 Ġsolver Gen Ġoriginal XY models EH unit aries Ġcolors list Ġcolors cheme 40 80 40 7843 Ġbinary class cls keys ĠNote books Ġimg W Ġimg pl Ġimg In Ġimg Region Ġarr val Ġarr data Ġarr anges ish p leaf Func Ġ(( ~ Ġge ogrid Ġge thostname root index root folder Ġstat types Ġstat cast Ġoptions rep scatter Plot scatter Plots Ġlib x Ġlib ver Ġlib native Ġlib frequencies spark session Ġps a Ġps ig 68 01 68 64 68 14 68 9575 theta D )]) }, )]) -\ Ġmon tages Ġmon omers CT url Ġparam t Ġparam File Ġparam è Ġoper ated sen kouSpan sen hista Ġseed water Ġfunctions Default ĠAn imations ĠAn addb sorted RlocList sorted TimeValDict ED AY Ġblock ade Ġnoise Model local score local dir local Point local Properties align Min align Sn align TimeWindow 000 64 000 22 000 87 000 4545455 Ġsq data Ġtmp list Ġtmp Val Ġtmp File Ġtmp EP Ġtmp Arr Ġchange it gex ts Ġafter noon 38 0000 38 32 38 110 38 059 38 301 38 1966 38 9562 Ġinfo valsarr Per Segment Per Module Per Slot Per Px Per TimeUnit Per turbed zip fian Ġactual Plot Ġactual Int header bufp ĠIndex ToString fin ing Ġintercept ed UR TY UR ONS Ġitem g Ġitem set Ġitem seq ")) } Ġts rc Ġts Parts ĠPython Engine ĠPython ModelWrapper _{ _{\ IO C Ġoffset ting Ġoffset Entry Ġext raw Ġext links Ġext Scl MA t MA PPED match Transit SC P SC ore Ġ15 99 Ġ15 12 Ġ15 25 Ġ15 80 Ġ15 98 Ġ15 68 has na has Dataset has Density has Multiple has Alpha has Next Ġvert Size Ġnet Rec Ġnet Recomb Ġnet TargetSet vector step vector view vector ised ĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ head loss Ġcre a Ġcre dencial ele ven 46 10 46 37 46 28 46 166 46 3718 cf b cf kmeans +' +' action Edit action ToPdf Ġcell renderer Ġcell Counts Ġ'% ': exec name exec Info Ġmu q Ġmu Parser mf pt Ġbound Sort ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġstruct type Ġstruct Cnt convert Dummies 31 354 31 754 31 756303 task Names task Status task Queue task Lists UN GE UN EMPLOYMENT Ġsecond LevelCurTestX ĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ mit db Ġreal location Ġvar M Ġvar import Ġvar fit Ġvar Pt Ġkind sets su eno Ġang ulo Out Type Out Label Out Dist hi j Tree Regressor ML O ML og ML MF cri ssis aN Ip Ġfrequency Desc ĠNumber Spec ĠNumber Operator sm as sm ll sm allt sm iley sm arts rng s Ġclose Action Al h Al one Al mond Al locataires Text Grid 2013 0701 2013 1218 ={ {{ dat arange Lo cks Lo yalty canvas w Ġgenerate Histogram Ġgenerate TrainingSet Ġret Tmp Ġret Thal Ġret orna Ġchannel idx Ġchannel ids Ġchannel worm now ski 235 518 Ġ{" - __) ; __) [:- Ġauto map Ġauto fill initial data parser Length parser Head parser POS UL SION Po ssibly Po issons Ġ'_ ','_ AD AM AD Bit Ġstd Seq dif NodeTextVectorizer Ġerr G Ġerr T Ġerr var Ġerr flag LO WS Dict Editor Ġpla c Ġman ag ĠRead BabyBoom inst a inst inct 117 88 Ġold col Ġold plotframe ĠCol oring Ġsin angle ines cporto Ġwrite arff let ie let Position nc cl nc conv nc icell nc ureinfo ï¼ IJ ï¼ ij channel ids bit v bit order bit alis Ġcontains x ĠMe lt ĠMe ant ĠMe ren ĠMe teoro ĠMe tho ignore Warnings queue Data ET P ET AG ET FS ET YP remove Representation remove AStopWord Ġheader less Ġop x Ġop user Log E Log g Log Name Log Level Inter sections Inter VA ek tronix depen ded 48 260 48 1434 hat r Ġvis alisation ĠPeriod ArrayFormatter Ġdb a Ġdb utils Ġdb ank Ġdb Config Ġdb Hook Ġdb Cursor Ġdb Nodes 56 10 56 13 56 87 56 204 56 0726 Ġscalar map Ġdetermin ate down fold down Push ĠLinear EstimatorTest Ġnext Node Pre vent Pre stress Pre Post Pre learner Pre cedence Pre fecture gt zero gt bl Ġref y Ġref list Ġref group Ġref scores Ġref reshes Linear Layer Linear Colormap Linear DML ground hog Category Label Ġrec df Ġrec ruit Ġprev y Ġprev dist Ġprev Stats Ġprev ista desc rete Ġdelta Dur Ġdelta Shuffled 294 713 Ġfix Throughputs ĠGet Line ĠGet Layer ĠGet Legend ĠGet ClusterData ĠGet HeightWeight 57 11 57 34 57 23 57 132 57 888 57 444 App l App roved nb class nb box nb asis nb rhd nb bbs sigma f "," /") Ġbeta chi Ġbeta Lambda Ġroot modules Ġdim sg Ġdim Vectors MM D MM apWrapper ivari able Ġren seign optim us optim istic stra cker Ġkeys ightSD Ġ30 75 Ġ30 22 binary Widget Not Set Not Here Not Fail Not Closed Not Installed Not Allowed Not Followed Ġsigma A Ġsigma G Ġsigma pe Ġsigma Sq ĠImport ances this url this pass this Experiment this Slice PI V Ġ", ""). power Type '\ ,' '\ )\ '\ -\ _( ? aT ransform aT eam child DAG month Range month Diff month ToCode Ġlegend position Ġmissing userdf major P NU E Ġregular ised Ġdon uts char les Get Classifier Get Feature Get Next Get Address Get DateIndex Get LineColor Get FieldDefn Get RowData Get Morgan Ġstyle Url Ġ"" )), Ġ"" )))] cd rs Ġchar det Ġchar Types fmt p stream arr Path Effect metadata View ĠUse cols Ġxy out Ġxy ann md analysis md uplicates Ġsearch Link Ġdisplay Limit home owner home brew Ġmy val Ġmy args Ġmy axis Ġmy Data Ġmy kwargs Ġmy cluster Ġmy bool Ġmy module Ġmy classifier Ġmy analysis Ġmy udf Ġmy vmax Ġmy hive Ġmy Initiator Ġ'/ */ Ġ:] } Ġmemory Data Ġglobal ip Ġglobal AC ws Entry ws za cmap axes des orbed des pierto Ġrot C Ġrot X Ġrot func Ġrot Norm ATA ACA Ġignore tz Ġ], '; levels data obs param clo verleaf Ġ'__ { Ġnan j Ġremove Current Ġremove TickLabels rot mat rot ulo Ġlogger list Ġdiag onally Ġ'# { Ch Co Ch arter Ch oropleth Ch irps 137 33 137 064 Ġdirect In Ġdirect oly rest oring rest raints selection Threshold selection Changed interval d Ġday str No F No Load No Open No Tag No OptionError No ConverterError No Reinv Size Y Size List ĠCal ama ĠCal deron Check GLM sw orld sw ilk Ġkeep ax Ġkeep idx Ġkeep Cols ____ _| bound mode bound Low Format ters Format Percent Format Bool fun g Line F Ġlong ueur Ġtheta ValList Ġpickle file Ġpickle Ser ION A tri co Run Stats Run Options Ġident ifi Ġmpl U Ġmpl plot Ġmpl dir Ġmpl datetimes ĠOn es ĠOn Right Ġlat long tensor Eigenvalues Python Functions Python Options parent al parent path parent Pt cut Off Ġser pentine inc arn rm q rm default rm fs null ary null map hot corr hot els Py learn Py lon Py DB Py Runner Py plo Py FlowScheduler Py Troll PL D PL SK PL UNGE Ġfra k ĠBase path ĠBase TraceHierarchyType Ġproblem class TH SUP TH UMB Ġsa o Ġexec status ='', ** Ġlocal data Ġlocal Sum Ġ16 398 accuracy Mat meta pmf Ġpower Law bad data bad ges bad syntax bad subjectsgroup Ġdrop missing cket t ret ard Ġskip LabelEncoding scipy Col Ġbar Offset Ġbar abasi sig sys sig mar sig mpro sig Hat sig mainv Ġinterval Row prefix e 89 22 89 885 src Img src Postfix ĠTo pper All Types All Atom All Tables All Models All Interpolated display style display Width HO B algorithm A contour NGrid contour LimType Ġseq mat Ġseq AfterConv Ġdest in Ġdest dir 74 66 74 88 74 96 74 338 dec str dec deg ĠLe Net Or nstein ĠQt Plot imp art imp ress imp osing Vector ize Vector SizeHint Ġbbox a Max ime Max Temp Max Exp Max Counts Max Charge Max TestStat Ġfilt ration Ġpe el Ġpe Class Ġpe mi Ġdel x Ġattribute Dict record id record array scaled Output scaled Flux FT EST ĠPre v ĠPre calculated ĠPre populate ĠPre Trained ĠPre filterManager Ġnb c Ġnb ut Ġnb rhd Ġnb Families Ġnb perdecade dr p dr maa dr copypath summary funcs Ġsetup NN Transform Analysis Transform Listener pk c pk elly ([" (% ())) \ Ġpr nd Ġpr rt Ġpr mod Ġpr div Ġpr js Ġpr fx Table Data Table For Table Row Table Groups Table AggregateFunction ]]), ) const ellations IM odd IM CLT CO model CO AL CO FS Ġstri pes ĠIN ET ĠIN ESC ĠIN COME ĠIN CLUDED Fit Map Fit Act TS SDist åı Ī ĠList Field ĠDate times single B single Shot Ġradius Delta Ġlocation ssrc Int ent Int eg Int Sequence Int roduced Int FileTxt Ġcommand LineMode Ġlw c Ġlw in ':' % ':' $\ Ġcalculate All Ġcalculate RC Ġcalculate DistanceMat avg period avg weather Ġpartial corr Ġless maxes Result Files Result ArrayName Ġfin score Ġfin plots Ġentry text Ġabsolute cov Man ages Ġgen bank sche ffe sche chter ../ ..',' lux embg Ġjoin f ost Recent Ġjson ld warning color Widget Bu Ġeven to ("% %%% Mat PlotLib Ġsto ke Ġvalidation Set Ġvalidation MetricLists Ġcat x Ġcat ime Ġcat é high charts high Coverage high Hertz high NHI Ġaccuracy Mat Ġ$ {}$ Row Len Row Df Ġconf val Ġlayer name Function CV Function OutputFlag session Local cha st cha per labeled train Ġhold Last Ġresponse Lists Ġet b Ġet pl Ġpop list čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ peak group peak Elements peak Information peak finders "][ _ )+ ')' ĠMin utely OP TIMIZATION OP PLER OP rincipal Ġpredicted Plot Ġpredicted Rating Ġ14 96 Ġ14 34 Ġ14 97 Ġ14 67 fr uity Graph Node Graph Viz Graph osException det unings US NOCR Ġmer idional Input Test Input Bits Input Vars 63 32 63 95 63 18 Fold Splitter Ġview points Ġmost Recent Ġcla ses Ġcla ves Ġdep var Ġmetadata file Can Scatter rgb M rgb T rgb i rgb imagedata Neighbors Set Ġfinal dict Ġfinal Dict 79 168 79 1759 ptr s Ġ13 04 fast greedy insert Block ider oots ĠKey Schema Ġmessage Dialog light red Ġselected ndarray Ġselected Items ]+ '), ]+ ':'+ ]+ )(\ On Right On Mouse On Timer On Matrices On OffHelper cdf single 54 45 54 22 54 8824 54 3425 54 9296 clip Path status Box status changed 70 95 )" ; location ID location LayerTimeline perm ill ert ig Ġsw f normalize Cluster Ġlook for ci proc ci udad Ġupper left Ġparent sec Ġparent uid Ġparent Idx Net Trainer Net Stim EX PLAIN EX ACTF eded SphinxShell yaxis values tag i tag list tag Name ĠOR M ĠOR GAN sf g sf arr sf dr Ġsym data Ġsym rank 83 01 83 97 83 00000 83 153 bytes Dropped bytes PerRow Min er Min Path Min Pts vectors cale epoch Num grad hsph Dist Multiplicator tk r AA IDs Ġsql Ctx 0588 2622 cons umptions )** -( 59 64 59 15 59 16 59 86 59 000015 measure SMF wik imedia æķ Ļ global quake Ġrc P Ġrc ma Ġrc ustom conv box alog raphy Ġconst uctor 2014 1212 2014 12110 MS ub MS CVa Ġstack Sub hing an !! \ !! !') Ġtag Name Ġtag Open GD et GD ATA Ġattr val shift Left ĠAs ses shuffle Output Ġaut or Ġaut orange Ġpdf y Ġsubset CoverDF mid line ĠOption Query Ġdir cos blue marble script name Ġus ado ĠMake Example ĠMake Joint ĠMake NormalCdf ĠMake ExpoCdf ĠMake BabyBoom NN tools Object Count negative Strand Ġvs max ); }\ Forest Model Forest Green Forest DML mass Range mass rates Is This Is Down Is Vm Is Clicked Is otope Is otopes Is CopiedTo Ġgenerated Entity Image Size Image Dataset Ġsig B Ġsig File Ġsig anl Ġjob sto Ġjob Def Ġjob tts Ġjob Pars Dir Faces 199 2612 199 84693 nr zs nr igid nr ValidFields Ġ(- )') take Profit 93 04 93 96 93 649 UP ATION used Gestures ĠSh arp Ġvmin max PO ptions PO SRatio gon io gray Images Ġside lobes Ġ25 0000 Ġ25 20 Ġ25 84 76 19 76 125 76 077 76 1277 Ġcategories OutputFile ĠAll Env ĠAll Geo ĠAll ModeList We ave next Step ĠTrain able pixel sets win param win idx win fileOrDirectory =[" __ Grid Results Grid Point Ġart ic ĠGrid FS ĠGrid Descriptor ĠGrid lineCollection ĠClass Name Ġflat iter neg ro neg lect neg And neg Steps black Box 300 962 DATA VI DATA PATHS DATA INDUSTRY DATA EXCHANGERATE DATA PAYMENTSBALANCE Spec Recs Bu ck atom j 82 255 prop he opt row Ġpad array exog s Ġpatch color Ġpatch obj second LayerShape ([]) ): aa e aa foot aa chen TestCase Ids ,- '), }'. " Field Idxs 72 78 72 92 72 37 signal Data signal RQ Ġ'-- > Ġ'-- '). Ġ'-- >', external data external NameTable ĠGradient Fill Ġcustom n Ġcustom BusinessDay CP T CP UMigration Qu antid Ġcomponent es Ġitems Limit ĠTransform Nodes PCA flag ï¼Į âĢľ Vari ab Normal Plot Ġleaf lets ,)) / ĠMax DD ĠMax NPM 500 02 500 792 Ġwave vectors Ġwave lenght ND Z ND imTable Ġword le Ġword Label interpol ates Ġannot tup br z br ig br ine br Data br ux post ing post mean post ions Bin Indices Bin Xe subset CrossValid ĠCh EBI ĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġpp dir Ġautomat icaly inner Product inner HTML NB Y NB Neighbours =_ [' Ġdd h final params nu kular Ġcost Function Ġhash line Ġmedian Y Key Type Key point Ġenv ir Ġgradient Descent CC S CC cell CC CTATG frac ind Ġred ucers rb ach At Indexer At Night At YnotNan Ġchild Idx chi maxSpinBox Ġsu ction Ġsu icide .* [\ Ġfixed NumOf wx overlay Multi Statistics Multi Capture An vi An imated An atomy Button Text ATH ENA mission Start Window ing stro hmeier stro uhal Ġband depth Ġband structures Ġband Coef Com bs Com Pro Com oving }{ " }{ _ Dis connected Dis persive Dis carding Dis claimers Ġtoken zied Ġround diff regist rar ĠPCA Model Train File Train TimeSec Train WithOneDim Train WithTwoDims scan Type scan number scan Trim By y By Col By Mask By Term By Entity By Dz Ġcommon utils ĠPy layers ĠPy tables ĠPy Comparison ĠPy Pi ĠPy PSA ĠPy FRAP ĠPy Launcher ĠPy Astronomy dpi AoA Ġra G Ġra j Ġra ai Ġra bi Ġra iser Ġra cers Ġra ggi Temp Extent Valid Id tot pts tot rms tot Travel tot chg tot ILI tot Incid HE nd double Click Tensor Eigenvalues ĠPath Iterator Sub missions Sub Report Sub divisions Sub Windows Sub Content Sub Domain Sub Fault Sub tracts Sub scribing ĠFe ver Column Mismatch Column OrName Ġfn x Ġfn search wave max wave peak wave growth wave breaking COL LISION Ġloop ctrl del ve LS R Ġfun vals Ġfun ctype Ġfun dermental Ġdat df Ġdat ums Ġdat enums Ġdat atables 53 16 53 993 oper on Ġbl or PS Fit PS ession Ġtrace plot Ġtrace file Ġgreater mins PER BLACK PER MISSION PER ASIAN PER HISP PER ZDI 62 992 62 8624 cb h cb axes cb dat help doc 2001 0105 2001 0104 yp ical original Max original Min fp n fp Max ĠColumn Formatter ĠColumn Transformer mc ss mc set mc learn ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ )`` """ flatten Dict :. \ entry tag entry Dt Random Node Random Sampler Random Colour ĠOne Code common Features Ġmp m Ġmp atch Ġmp plots Ġmp crt ('-- > ('-- '+ ('-- ')], GT GT GT GTAG GT CAGCGGTTCGATCCCGCTTAGCTCCA 73 88 73 85 73 457 pc axes pc rnr CL V CL OTHT Ġlon idx actual Line actual Int actual Result wd m Ġpys ndfile CD B CD BOX flag fn flag RB ĠIPython ConsoleApp tex map tex arr čĊĉ ĠĠĠĠĠĠĠĠĠĠĠ template itemname Ġcontrol Obj formatter d Ġcos pectrum indic ative 52 80 52 92 52 308 52 371 Ġte les ĠDo Exit ĠDo GenPyCode Lasso Selector proj win ," ../../../") Ġactive Cols Ġactive CellNum Ġactive CoincsFile Ġdepth DF Ġlearn f Ġlearn File Ġlearn fname ART arget ART WOD ti j ti co ti red Ġbad line Ġbad Records Ġpipeline Model Batch ServiceClient nx lib Ġopt i Ġopt ype Ġopt func Ġopt prob Ġopt conf mar vel mar que micro drop pg d pg mpy ĠMat plot ĠMat mul ĠMat thias Ġ[], ' expr Entry alt ar alt result alt Line alt deg alt sep [:] ))) }} )) }} `` }} }". }} """, }} }{\ }} }}$'. Ġ(% +. Ġ(% %): Ġpri v ORM AT seconds im itch an itch ol click id '])) ): '])) ]. Ġavg axes Ġavg RF Ġavg dnl Parser Base Ġdebug path Ġdebug Flag Collection Object assign ations assign Columns Ġscript name Ġscript Name ^{ " ^{ "+ ^{ {- Ġsens ortype Th D Th re Th ank Th Ar Th readed Th icken Th roat asc end asc ertain lb wh Ġequ ides ĠRes Rec ĠRes olved ĠRes caled .+ ? .+ ', .+ )") 999 05 Node Num Node CtrlWidget Node FeatureTo Figure Size XX I Ġmag lo Ġmag ma ĠInter connection generator cost Ġsampling points Ġspecial ties Ġatom groups Ġatom Charge Ġatom Bonds ĠCON FL selected Plots minor P minor min 71 3207 71 666666666666 2012 1002 big pic ("\ "") subject Id subject Batch subject Info Ġprop Scores One of One Way One TimeSplitter Ġproperties s Ġ24 88 Ġmid variance Ġmid Rec Ġgrad R Ġgrad checker cum LineChart QU OTED gaussian Kernel SS GPLVM SS WDN ('- '+ ('- .', Ġ500 2 cmd str tab ify tab Path Ġsur facing pri de pri ma Ġta ught )} $ Output Columns infer iortemporal direct ivity direct Neighborhood Ġ18 14 TEST V TEST HOST dy arr TRA FFIC Ġrgb Img Ġrecord Id Dataset Names Dataset Adapter product DefinitionTemplate mem size mem Memory Num Frames Num ToStr SR G ĠSparse EuclideanDistance ==' { 41 126 short list ĠID ENTI contin uations ĠApp Helper ĠApp Kit Ġrepr d Ġ32 998 extract s extract Data extract Classes ride out ĠIS s ann json HT TPI Sy ste standard Plots Iter ates Iter Stat site map Ġspeed Delta Values For With None With No With Figure With Feature With Queue Ġord DF æķ°æį® æŶ æķ°æį® åĪĹ表 æķ°æį® æĮīåŃ£æĽ´æĸ° æķ°æį® åĬłè½½ ĠNo Match mk r Of Values Of Day Of First Of TimeRange Ġ'{ ! lc file lc dict rou wer UM ES actions df Locator DMS Feature Path Ġneg ativity CON TRACT CON TRAST Ġ40 64 RB AR Matrix d Matrix Builder Matrix Similarity page Object Ġanaly z Ġanaly zers mal indgren mal lfine Ġarea ClusterData approx SimilarityJoin ks r ks loc Ġ19 17 Ġ19 31 xmin orticklabels token stack IR Y 58 00 58 32 ica il ica weights feat names ],[ % Ġymax es Ġsubplot count Ġsubplot Dimension pus hoff ij a ij cv Ġprefix key ĠAxes Locator ĠAxes Divider xt alk VER B ãĢ Ĭ Ġport inputs super iortemporal Ġwrap length velo ut Layer ing Layer Size Layer TxtCtrl Session Log ĠAR N ĠAR MED ĠAR MAResults Count Plot Count Distinct Ġpartic ule Ġpartic ules Map P Ġcsr geam Ġshare z track Drift ĠImage Reader ĠImage Grab SP only SP Trace SP ARTA TE MA Ġcf gs ']), ) ']), :] +" /* sur rounding ĠSy nonym As ID As Image As From As Bit As TempDir Ġpost order Ġpost ions Ġpost agged DB NAME resid sq resid uel Ġgeneral ise Ġgeneral izing %% "%( %% '", bg fitters Range Array Variable DataStore Variable FullPath ĠCategorical ArrayFormatter FE E FE VD Ġsvd vals clear Default Tra il Tra versals compile f compile s Ġsummary funcs cg list sd Timed sd hci ĠInitial State æľ « Ġobs Vec ski prow }$ / }$ ^ ero ids reader manager Ġsl n Ġinf otheo ĠLoad Gen Ġmerge Catalogs resolution SpinBox force RA force LL force LA degree Entry 61 12 61 32 61 35 plan ter geo path geo Id counter clock delete All delete Row ĊĊĊĊ ĠĠ ĊĊĊĊ ĊĊĠĠĠĠĠĠĠ ĊĊĊĊ ĊĠ Ġbutton box Kernel Width Kernel Reader Ġpartition Sum Create Copy Create DataSource Task Panel Task Policy Ġhalf size Ġfolder Fn Ġdy b BU DGET week Formatter ĠFile Checkpoints Core Cmd Core gistration cr fft cr ules car reg car pentry ĠQu oting ĠQu ade ĠQu oted ĠQu otient Ġknown fail shared var eigen stats åħ į åħ Ń Ġ17 99 Ġ17 65 Poly Chaos PU psilon projection Fee 91 78 host ovan Ġexport ers Ġinv trans Ġinv aded begin ners calc Distribution Categorical Feature Ġvia point predicted Line 256 94 Ġcut score Ġcut value Ġcut number Invalid Library Invalid RequestError Ġnn CostFunction Ġ64 00 ĠDis abled ĠDis cover ĠDis cret Ġfh gt deep ly deep mind FL L FL X Ġhidden class ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ nap Set KMeans Model Ġ'+ '): 2007 0401 same Text same page how s Ġinner Window Ġinner Ap Ġboundary Code Ġboundary Conditions dm all Event Token Event Noise Event Listener Ġassoci ates CG L CG AL CG Site CG AAAG Sparse GPLVM without index tile stuff fixed cost fixed Gain olt z dle y Ġoffsets rc ĠHT M Ġ[(' __ fet dim fc st fc ns Info Label Info Per Info Extractor Info TextBrowser eo logy 101 9 101 545 utc liffe Bar o Bar om FILE NUM FILE LIST prev prop Ġthread Num ba o ba is ba abc 714 15 Ġes n Ġes se Ġes crules custom ContextMenu seg j seg mappy Ġexperiment ing hy r hy draulic Start Positions Ġdelay ing Ġdummy gr ĠDist ortion strings imjoin Ġcallback SM widget Label widget CloseEvent čĊĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ çļĦ ä¸Ģ çļĦ åĪĨ çļĦ çī¹å¾ģ çļĦ ç¼ĵåŃĺ çļĦ æĿĥéĩį çļĦ æľĢé«ĺä»· çļĦ éķ¿åº¦ Ġdev id Ġdev info Ġdev Labels Ġdev Accuracy Read Image Read CapacityUnits Read FemPreg Read FromPandas NaN åĢ¼ bi ography bi olib tep itope Ġconstru it Ġconstru ed fetch index ĠCan o ĠCan adian From Features From Metrics From Epoch From Bits From Resource From Url From Terms From Sentence From Nib From FreqChannel ĠPandas Data ĠPandas Mixin ĠPandas ConversionMixin DD THH sto ke sto chkit Length List Ġtermin i mix c mix Obj ĠRow Coder ĠRow Header ĠRow Iterator Ġscikit learn ĠDataset Manager ĠDataset ValidKFold ĠDataset ValidShuffleSplit Ġtrack py ĠDecisionTree Converter Default Mode Default Metrics Ġglob pattern Ġglob chem Ġfft module Ġfft pad Ġfft conv Ġ"/ "+ quad Mesh Ġ)) ), ĠEn ded ĠEn KF ĠEn zyme Ad der Ad ams Ad hoc Ad ults Ġcomplete Array bucket Length Ġgene Obj Ġgene Betas wiki pathways exc iting Ġdesign matrix Ġdesign ating Ġdesign ators Close Characters Metric Tensor ĠAd iciona Ġgeo hash Ġgeo alchemy Item Flags Item Delegate flux density flux bias flux datapath rho L Ġgr W Ġgr w Ġgr size Ġgr pl Ġgr illa Ġgr iliches irs peed Reg res Reg Exp tm PredictedActiveCells tm gpMask tm gmMask ĠLine Model Ġfp stokts angular is /' ))) ĠDef azio ĠDef ualt Ġrand perm Point Data Point ROI "> ": "> '+ "> '%( MF M MF V MF DList ALL ERY ALL TRADED PY LHC iso Start iso End Ġymin orticks Ġ"+ _(" register ing register Hook bc ra bc ch bc zt ĠFeature Transformer ĠFeature Location ĠFeature Getter Ġspectral Peaks ĠTrans cription ĠArg us Ġaltern ated Ġxmin orticks dest addr dest acadas square array square up Ġexc iton Float Status Ġborder Value Ġborder Mode station Count wb urial jac encies Ġ31 32 ĠSub s ĠSub process ĠSub traction ĠSub Fault ĠSub Ocg ĠSub wordTextEncoder dual values OS CAAR End date End Index umb les Ġexclude window Source Format Ġ') +'}' Ġ"- < Ġ"- .") adi acenza xml FileName good Inds artist e Ġparts Grid Ġpol len Ġcp unish ----- | rv b Ġreset Vector ]} [ ]} -{ ]} }{{ Ġstill EmptyCapacity Ġker asext 005 37 ĉĉĉĉ ĠĠĠ Mult Matrixd Pandas Connector mx c mx el ******************************** ********** ymin orticklabels Mo ai Mo lec delay ing zy e ational Days Ġsimp lic Predict TimeSec Ġmd X Ġmd Y Ġmd Z Ġmd stree Ġlate reg gap Width Select Tool Select Item Select Cmd Select Telemetry Cor rel Ġph t Ġph ide Parameter File Parameter Vector MAX BAS ĠParameter Vector ĠParameter Number ĠParameter Generation ĠParameter Formats Mean Rec Mean Times Mean FreePath nat pawu wind Cell Ġkm z Ġkm zfile "\ |_{ Ġbuffer Docs PAR M PAR P execution Date Ġnc anda Ġnc XLONG Ġnc XLAT Ġcmd Str ano ids INT ABLE ĠMo on ĠMo ad ĠMo ses Axis Variable aspect tb mne ts ((' ## ((' {} ENT Z chain Coords ĠSQL Transformer ĠSQL ITE Ġnu V Ġnu kular OC I ĠSto red ĠSto ica ĠSto yan ĠSto matal spectrum Neb ĠGraph Grid operator set Ġinside textfont Ġinside textanchor Font Description ("- ")) Cell From Cell Filter Cell Pop stage M stage N stage T Ġflags byte ĠTable Columns ĠTable ReplaceWarning ĠNew Axis ĠNew Bathy Ġmut pb Ġndim g ĠIter Operations ]))) ; ]))) ') NO G NO y ĠBe auchemin ĠMA KES ĠFa ouzi cnt x OK IsClicked ĠVersion View flip Z maximum Size Ġcb ow Ġcb axes Ġcb day Sim Interface Arg ss Arg ParseConfigLoader ={} " ={} # Ġmass Array Ġcorr with Ġcorr neighbours Mask Image ula re ula ciones Ġss id pixels High pixels Wide Bo ids Bo undery Ġwin Rate Acc els Acc idents Ġqueue info LL T sess ID mot image Ġpk int Ġpk gexts Ġconnection tools ĠExample Generator ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ named index va egan bd c bd ra NG ROW wt grp Ca mada regular polycollection 159 87 js args Ġflow cell bot t bot flex Ġlr d coun tour coun tof 0001 1100 0001 11011 0001 4999 ========= + Ġtre asure 078 2 pow max tags bys 400 03 400 59 sole qs Ġ(` -') Current Page Ġprec rop Var Ratio Var DTC Var BinaryInfo Var CharInfo Ġloaded Vs Ġloaded Word Ġloaded Indexer Ġloaded Remover Ġloaded Cv Ġloaded ReTokenizer mv res ĠCur tis Level Index If Close If Slow Sum Difference Ġtables Default 663 14645 km good Ġconv todeg Ġans ible ĠDB READ ĠDB Connector PT A PT W PT Maps Ġexpand o Ġexpand able Labels Dict Labels ByDecade KE UP KE Argument KE PM KE LEY Ġplotted line semi partial scaler Path 150 20 ĠEX TRAS Stat Summary Ġns name Ġns np Ġcounter act multinomial nb ĠHTML Help bits PerPixel bits PerSample under lay SQL Tests ĠFree Type zoom Start ĠError bars ĠError Report tn file tn iks Ġrho B Ġrho data chart load chart Highlights OUT COME OUT PSN ')), " nz count calculate MeasuredPowerCurve calculate Expiration hyper Unique nl cc invert Button pix array pix elfunc Ġpt l New Dict New Node New Training cpu Count dow ntown Ġfits ByRegion Ġcalc ula Ġcalc Filename Ġcalc ulo GMM Base Ġ300 4 anchor String Ġmar ta ĩæ Ĺ Filter Type Width Edit glob ally loaded SystemML ĠVector Field ĠVector SizeHint ĠSim uli Ġtex to Ġtex coord Ġtex grp cloud made met re Ġchart ORs Hz t UB AR UB ARU UB UNTU Flow Monitor Flow Calculation Ġpassing through SL P SL ASH SL ICES ALI SE Ġgra dfactor Ġstand arize Total Revenue Total Visitors ĠWH IT Ġoutside textfont Method Pickler bra g TP MS Work around ĠIO U ĠIO Read Ġsolve Finite Ġlabeled train 105 28 105 48 105 88235294117647 East Hatch ĠColor Spec ĠColor blind similarity Test ima genes ĠTra il {\ " Ġtot able [:,:, -( ]") }, 126 24 Ġcirc led ---------- ' ĠNon Integrators Ġpopulation Dict daily Stats daily rets Names ForCore cutoff per Ġprogress ivis TA ACT ĠPoly mode half winwidth bold Font Ġ"{ [ Ġ"{ :^ Ġoutfile string Ġflux data Ġflux Continuum filtered Reads ('< % ('< =- 2017 1005 Ġcalibration Instance EG RID Pos Neg Pos Merged dp chi dp AoA Mode CD Mode loAnt Ġmouse x Ġmouse area Ġmouse DoubleClickEvent Ġmouse Dragged 336 25 eX pk Ġer goPlot ORT ABLE ĠMock Splitter 2005 0501 Ġtau Mean Down stream ĠDict Without ĠDict WithMissing bre it peaks Button Ġgu arent Ġforward Gate ĠAS cheme Ċĉĉĉĉĉ Ċĉĉĉĉĉ shell Widget 784 7849 MPL IC Ġgs fac observ aciones connectivity Graph Ġactivation Level __() """ ĠDummy Mod ĠDummy SQLToGCSOperator matrices Array 120 20 progress ively progress bars LA PACK LA KES 109 27 roi Hist Ġå Ĩ Ġå Ĩį And Filter And Scale And Sort And Below And Interpolate rd h Ġcombined small topic words Ġserial izes Ġ? )', Ġsel Indices Ġsel Pts Ġsel ChanIndex Ġindexes Changed els ch Ġix mid Ġmove Window )` ), equ ator Ġproj data samp Rate Loss During Ġquad meshes explained Variance Save V Ġprice Handler psd dims psd Ca psd Sizes psd Cumm psi h psi computations psi Axe 800 4 800 41 Ġcc Connections Ġdelete Row ĠDraw Event Mod ul ĠWith SimParams Block wise Block Size Ġreduced im Ġbounding lat cu á Ġgtk format Ġgtk tools urt ation 318 4 318 9 Power Freq Ġmem orial ĠUpdate Set Ġke ine three dee 252 34 Ġhapp end GG CT GG CTCA Ke effe some url some New hal lo syn delay Ġtab ulation Ġfl ushed MO MARS .] " Ġregex s Ġblack Line TRE ND slow add slow dec Ġsec ular curr size curr Index Only Row Only FromFeatures Ġcurr state '$ |\ Ġfeat uring ĠParallel Efficiency ĠParallel BackendBase 873 11 873 98 ĠMean NPointsArr 118 2088 hex lify Ġcare tup Ġcare tright Ġcare tdown install ations ĠLearning Curve Ġlab oratory ='\ '', 896 0 896 913 monotonic data Call Sludge Transformer DatasetCV fd D fd idx ĠBo hrium PACK ETS Load Window Load Phenomenon Writer ColumnMismatch ĠUser Exception ĠUser Request Open CV Open Image GR ISM Ġmi ps Ġ75 16 svg Prolog ĠSupport Mixin Example Essay bm jd Ġrule score Ġrule format Delta T Delta PHI Back us Back wards Ġll val Instance Type Instance Bundle Instance MethodPickler ,:, : Panel Model Panel BarReader Panel OKButton pan cies pan Info sat urn Struct ify Ġnested Rdd Ġvertex color ĠAlex is sn form Element ID Ġcover Position ĠCs lope \' '), \' >\ Ġdr ctry Mag Bins pv const resp code ĠAnd y Scale Constant UC SC uro us Raw SpliceData Ġmx dates 110 22302 Argument Set Stream TableEnvironment diagonal up diagonal down diagonal Up diagonal Down Ġut count Ġut iltiy Ġgets avefilename spacing Entry Ġalgo file ĠWindow Length zz ies card Num 636 0 636 7 Parameters Widget Density Ratio Ġastro lib Ġastro dendro tc ds rev ratio Ġada p Ġalg Id ming w ming ham ĠProb abi ĠProb ablity Change Time Ġmargin X Ġmargin Y Arr Time Sc enarios `). """ icon st icon tains sgd c Ġcli d Ġcli ponaxis GC CA design ed Ġexternal InputSize 901 819 variant caller 133 02 133 47 Norm Fracs Ġip w ĠConfig Xml Ġgl x Ġgl Get Ġgl Begin EXT NAME EXT MODULE Ġvec Data Ġvec Pyth 047 0588 905 0 Ter ra ja il ja iled sr fs Func Calls Func TypeDict ĠST PS 319 0 319 3 319 7 319 59 Embedding Model Ġderived FromTerms north ern ĠSum mar ĠSum ming pb k vg uess --------- \ 700 617 stock Df bio Object bio geo sleep ing Ġintegration Time 996 84381 Ġdependen ts ĠText Print bw m Ġ{: }". DATE UTIL ĠGeo Vector ĠGeo Setup ĠGeo Sup ĠGeo LevelPotentialOutcomes problem Name Ġspa red Ġyears QC Ġann os Ġtrial Errors ĠRGB Axes ĠRGB Composite Ġnat doc Ġnat pawu ĠML Results ĠML MC Unit OfTimeRange stand ings ĠLin regressResult ĠLin AlgException æĸ° æķ°æį® "} ') "} )] ĠAC COUNT ĊĊĠĠ ĊĠĠĠ Ġnone theless genome Index Ġ({ ! supported Features ĠCSV ExportDialog overlap ped overlap Src ],' ; ],' -- ],' __ 756 08 ]]. " Ġappro vals Ġep ilines Ġep idemics bp z bp comp Order Front Order InBeforeTradingStart Weight Backpack 998 12 PP func determin stic Use Native Ġmicro states Ġì Ĥ Ġgb ulk ĠInterval LogisticRegression Pol ling RGB X RGB ColorSpace -') ): Ġrepeated task clicked Button Ab cd Ab undant Ġbw I dl nl dl nsigma ĠCho oses cn ic cn idaria rms Lines rms IArr audio lab audio Data aud ition Factor ies Factor izer ĠResult Tab illi ant selector Type phys iol FileName FromMetrics >' ; Spark DFExecutionEngine Spark SubmitTests conver gent Training Error ĠOpen plotter ĠOpen Medic TRAIN SET send LogMessage send UARTCommand LR M LR U LR s dst one Ġmixed lm Ġtax ons IPython InputSplitter CF B CF S CF ermi jj range 265 0 265 5692 Pa perm ĠKFold Stratified ĉĉĉ Ċĉĉĉ ĉĉĉ čĊĉĉ 07843 1369 CI AL KEY UP ĠIs In ĠIs Stdin READ ING identity op omega hat ĠHist Plot Ġsyn cs ograph ers Seq Id NOT A native Pdb 168 1206 Pe te stim corr 311 4 311 85599 311 44782 Union Train ĠShow Ax Ġpv t Ġpv ffai Ġpv rfai /" %( lbfgs b reverse Data Ġ'{} {} Ġ'{} .- Ġ'{} ({})'. ĠCurrent Cost uper locus ye a FIG DIR ĠMon ary ĠMon aco 984 313725490196 pivot Stats ĠFormat Date ĠFormat Percent ĠFormat Bool ĠFormat FormatStr ĠFormat Thousands Ġsid path Ġscheme name 185 00 375 7 375 8 cats imBand Dep osit Ġtk SimpleDialog ĠNumpy Mixin FORM AL tre asure tre Cell tre asuries Param Pipeline Param DML nor bs nor ows 490196 07843137 1818 182 Ġwhite grid 237 3 237 4 296 973 Ġlst CT Scalar OpsMixin delt an ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġglyph num "]] }' PH IND 033 797 gtk DA dark er rh ss rh odet é tait é lé Ġmapp aths xb v ĠPRO CESSED ĠImp ossible 132 36 132 796 Space Position Custom Index Custom Row Custom ContextMenu Selector Params vc z zi lian zi parchive quant lib Non Contig Non NumericValue Non ConsolidatableMixIn Non Dispersive Ġ99 5 Ġ99 27 slider ax Ġperson Pool Ġperson Popularity Lat R Lat Ex Ġlt s Ġlt rans Ġlt ypes Ġlt isRefsRunbErrbMiss 106 33 106 77 Ġzoom Size MAP MRI ĠRE FACTOR ĠRE PLACE ĠRE LEVANT Ge od Ge os Ge ary Ġmini val spike Indices flu jo ĠMy o ĠMy BatchTransform ĠMy gMLE }_ '. }_ \\ Dev in sta ions Ġchrom atin Ġeq m Rep osition Rep Struct Rep laced Rep Parab 355 05 Ġtxt len Ġtxt file Ġtxt ids Ġtxt File sun yihuan 789 000000 789 123456 789 123000 134 96 ĠSc ans web stat web export Ġexecute many ĠLO WINC .)) / rdd tos 115 2332 Project ors ĠJSON TableWriter ĠJSON Serializable Segment Vessels Ġdynamic Layering Fig Ur eros pace ========== ") onom ers locate Event enc ils middle name middle temporal replic ating Jo el Ġthird LevelCurx First Name Ġseg len Columns ToTable 349 14 349 34 tu fts Price Relative Ġmn parametersfile processed Image processed countsarrstr berg locs ĠAb ort ĠAb weichung Iteration Number 804 18 Ġxml Strings Ġok Button Ġ(`` '# dk t Ġwind ings Ġstock Grid Ġstock Code Ġstock Pool rob bins Ġnear xy sided ness Ġ29 64 Ġpsser y 378 1 378 35193 Gre gorian screen width Ġtim mean success or Ġ'( < ĠFI AT ĠFI FO ĠLoc Text ĠLoc ators Ġdecode bin 00000000000000 0 Ġ65 32 marginal ized 165 30 ĠMatplotlib Controller VA ILABLE FW D ĠGeneric CustomFactor repeated Bits 212 48917 Ġdst h Normalize By Ġsho udl Ġtrade day Ġtrade TimeList Ġtrade TimeIndex 175 2 High Cut CK PT Geo XType (); \ (); ", xk b 899 1 899 04 MD Name Ġautog rader 122 16 čĊčĊ čĊĠĠ cen orm Ġcompared To jet black Ġwon ky 253 9442 Ġtile List 048 38 ĠInteger NumericFeature ĠPe to ĠPe tersburg ĠPanel Model ĠPanel Sample ĠPanel BarReader Ġzi pping 807 29661 Tri Analyzer mouse wheel mouse Moved 144 9878 ĠSN Futures Ġminim isation CSV S iq dims ĠPL D ĠPL TC 156 17 pm Eclipse Ġwait Time Red X Ġstandardi zer Ġstandardi zing Ġimag Pairs glyph num Ġexponent iating rx List rx Bytes VAR COL ))/ (( PA cor Update Task Update Settings PM AC PM ML PM TK running Time å¹´ åĮĸ å¹´ é¾ LIB NotInstalled Ġapproach ing Ġ94 67 Extract JobConfig polar izing BL K 014 068 Ġentity List ĠSimple Experiment Like TestCase gh d ĠHel mholtz Ġanswer ing Ġanswer sets Drop String Ro be Ro kem 987 719 nom subtema ĠFin nish Ġvocab ReverseDict ...> ") Ġdigital com Ġhex in tim Cell Dimension less Dimension Selection ("' -' ĠRed is visit ing confusion Matrix Lin AlgException Clo sings Low Res Low Redux Vec Params ĠMap Task ĠMap NodetoFrequencies 114 92364 ĠVer mont ĠVer dana ĠVer veer ]" ; ln bins Job Status WS DataFile Rank Order å¼Ģ çĽĺ Det Char System Labels ('# % ('# ' ('# %') Ġsuff icent Ġprobe Info Ġrvs plot ĠOUT DATA ĠOUT PSN video MP video URL video Stream Ġfrac Var trend line 809 640434 ĠSort s ĠSort Field ĠDisplay Formatter 432 0 432 9236 ĠEN C ĠEN VIR åĬ ³åĬ¨ Ġ"{} ."). Ġlam mps raster izer elapsed Time Ġ194 4 Ġ101 1 Ġ101 77 Ġdc io Ġdc ids Ġdc metrics $") ]. tar info Local Server Local ZonedTimestampInfo xE C ĠFilter Results ĠFilter Extract ĠFilter Bit 192 157 192 8094 Mark Properties synt hesize kg ml ĠDense MulticlassSVM Ġbb Path ĠBoolean Dtype ĠBoolean Property ĠAct Env ĠAct Geo ĠAct igraph ĠAct uator "}, " ĠUS IndependenceDay minibatch size Ġanalyze Result Ġanalyze Measurement Ġanalyze Overlaps Br ick Br SALC Ġ:]) [: Ġ44 80 347 4417 ki wi Ġcop ulalib Conversion Type Ġarc lines 202 13851 227 0373 Channel Group Channel Info Channel Helper Ġcalendar Week 397 166 čĊĠĠĠĠĠ čĊĠĠĠĠĠĠĠ 027 34 027 451 Directory Partitioning TM prediction ĠDimension edMeasuredValue Ġeasy dev BIN FRAC Ġunion scores Ġunion Cols Ġunion ByName Op Sim Op OnMatrices Ġhit rate overall TP '); \ xc min Ġnm xx Dense MulticlassSVM Ġrecent Progress ĠSize Mixin Rows Error ,... ]. GA ZE 012 1616 906 78076 ĠScale Size ĠScale RandomColour ĠStop watch ĠMask Classification Helper Function rr rrr Ġmm varcost Ġmm capcost Ġmm fixedcost checkpoint Location Center Df åİĨ 次 chk boxes Ġtransition ing Ġlf it Ġpres gn Ġpres ident Ġpres orted Ġclust Results 274 13436 wl hr Tick font Ġcum Values ĠROC curves 135 1 135 3 135 57 Off Time 107 17 Ġgam f updated f æĮĩæłĩ æķ°æį® æĮĩæłĩ é¢ij度 Ġ[% ]', ĠState Base ĠState less generated ByTerm Img Dir Ġ'[ ]', Ġ'[ {}]: AY DR ĠBlock Len hh gate Ġlp norm LST MAt VI V Ġins ideroots Cross ings Cross Score clone attr ('../ ..')) 195 2286 DP D DP molfracALL gu arding 312 224 312 1088 306 2 306 8 hu u hu ck hu hv hu dson ĠObject JSON Ġgenome storage Ġ43 85 Ġ43 90 ffe e Sigma dt Sigma Prior ĠSpecial FunctionWarning Ġtheme Source 002 45 Ġ123 4567 OUR NAL ('{ { ('{ },{},{ 912 9 Ġshifted Series RR RR CUR VES Queue Base ĠCustom TB Position Mobility uk b gm V gm idx Ġdash x Ġdash px Link Arm Ġdark est Ġdark core Ġdark ened triangle ToIntersecting protein montecarlo ico tro Ġaa oRet Ġgal Out Ġhierarchical Clustering ĠMSE ED DEX P Ġols r ĠNode Collections ĠNode CovarianceFunction occ asionally Ġopp ortunities Spin Mag sib ry Alt Modifier Ġposterior Beta Build Fn Build Categories ĠCV PR push Msg mys ol ĠCa ches brain mask GL Ba GL ORYS Ġgzip writer Ġcam bio Ġcam xfile ĠAuto EncoderModel 625 1 Experiment Factory 314 3 Wave File grouped Map ĠGe oms ĠGe opandas Single Complex 266 8 Ġtx th Ġtx span 286 8 394 335 394 439 Client Transport Client Visited Page Path Page Token #================================================================ ======================================= sam ri Ġrf fill Ġrf groupname ĠSignal Class Ġ120 45 645 16 Ġmoving Data 305 00 Right Point Simple Table Simple Arrow Ġstc data Shift Corr ']} }, Ġpx width lbl posn ctrl click Std Adj åħ·ä½ĵæĮĩæłĩ ä¿¡æģ¯ åħ·ä½ĵæĮĩæłĩ 请 Pass Filter Tab MultiScans radio Mode ĠTotal Time ĠTotal Result ASE D æŶ åıĸ wk lab wk ahan Ġquick est Edge V Edge Transformer gas vy converter seq ĠPh one Ġfully Qualified plugin bundle Missing Attribute 904 4 ĠRo i ĠRo unds ĠRo setta 494 118 494 4336 Ġconstraint ext ------------- " 924 805 ('[ ]') exe mple 164 3556 Energy Filter Energy FunctionFilter Ġche i Ġflu SeqFolder Region Indices mant is Ġ#---------------------------------------------------------------- ----------------------------------- Ġleg LabLst hp Fe spin ning spin Fig dip me CAT GCC ĠAv oPlot 367 95 Ġsimulate Auctions COLOR BRE 617 99388 1111 01 1111 001 hum or hum mingbird START DATE COMP TC COMP ANY My Array My Function My MplCanvas My Neurongrouper Ġion file Ġion isationmode ä¸ļ è¡Įä¸ļä¸Ń Schema Location ĠNO ISE Ste pping Times AtNight Attribute Names Remove LOI nested Rdd Ġaligned Faces 155 80 Ġgreen q ĠHas RelativeError ĠHas LabelCol Ġadj Time ĠZero CenterNorm Classification ErrorStatisticsMatrix Tuple TypeInfo ('$ ','') Ġ%% )'%(( ĠPr inz INTER FACE Multiple Lines Zero point Zero Pt NS Object 102 95 226 776 hit rate ĠAcc ending ĠAcc ident por zioneMaxPerColumn ĠCross Validated crit us tensors hape #---------------------------------------------------------------- ----------------- #---------------------------------------------------------------- --------------------------------------------------------------------------- AF Q AF S AF QMC account Curve Cha o GH G fv ds ĠMetric Table ĠMod flowSfr TAG ATACC Ġrecursive GraphSmoothing remote wd Ġgoogle URL Ġgoogle Rec ĠDatetime Axis Ġcontrast ed Last TI Last DagRun Last Rtn ĠCar b TimeSeries Split TimeSeries Factory TimeSeries Serializer Ġproduces izes Ind IDs 348 32 Sha ke wa j ĠPos ição ĠMan uel ĠMan chester FLOAT FMT ĠMain Tests ĠMain Handler ĠMain Form Ġpsd Y Ġpsd dims Ġpsd Voigt 145 0 145 072 145 1734 [_ ]+ trigger mode ĠNetwork Table 755 92936 755 15806 Using Pandas Using NeuralNetworks Align Transcripts ãĤ £ ãĤ Ĭ Ġstudy ing ä¸Ģ åıª ä¸Ģ 级 Analy st Full Bath Full Scrren Folder Name Ġaudio FeatureExtraction Memory BytesSpilled ĠMultiple SymbolsFound Probability Parameter Probability Distribution Ġleading stop DEC Loss Conv Base Ġbp comp ('{} +-{}'. Ġë © Connection Nodes ĠImputer Model Ġfo il Ġfo yers Ġfo ogrp perc ularis ĠSH OT ĠSH UFF Ġmovie Arr Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġinference File Ġinference Element Car bon 124 68 Temperature n 183 665 æł ¸ )| . Ġbi quadratic OM IC Learn Experiment THER MOCOUPLE Dump Dictionary Dump Nodes Dump Conns ĠWeight Base charge d Dummy MetadataColumn Dummy Socket HASH ER Ġsemi colons Ġspl ity Ġtar inf LENG HT 为 ä¸Ģ个 Ġ': / Ġ': { Ġ': '+ oh ser oh io kill Rate kk u Ġsoft ening Ġanchor String AV ConvBase prof icency 104 10 104 20 104 07 ĠBY TES 359 78 ĠMeta font fla me Cy c REF CHAN REF PROP Ġdatatype str 964 9 Epochs Array Ġ48 92 Ġ48 000 Ġoverall TP ĠProbability Matrix ("# ")[ btn Read fb ff FIX COL 157 21 ĠReal ization ĠReal Est 232 6 Operator Name TOP AZ \. ]*\ ĠGauss Error 295 6 295 8 Ġsend mail Ġsend buf male vel 385 301 Ġtreat D Ġsites Array Ġsentence Pattern ĠDocument ed tech no ĠNx D 116 27 116 08 ĠIntegr ators outlier Dict 188 7902 Dim Reducer 056 85 655 947 Ġsal aires Ġsal iene 345 9 Final Results ï¼ī ') iment o Ġbook ing Cent res bz t Ġbio formats Ġri ot ĠEnd point Ġpsi util Ġpid CmdStr quick look 474 97 dup T dup list ĠPost process ĠPost Process Ġtn file changes InDir ĠRest ores Two Bit chron o 203 87311 Spectrum Like Spectrum Analyser Ġpix data Ġpix coord Ġpix bufs ĠConstant Type Ġmed filter tracker Label çĶ¨ äºĭ 304 1 304 12916 158 32 RECT ANGULAR SpinBox Mixin +') \ ĠVisual Dataset ĠVisual isation house keeping ĠåĮħåIJ« åħ¬ ĠåĮħåIJ« æĪ¿åľ°äº§ ĠåĮħåIJ« 交éĢļè¿IJè¾ĵ XML HttpRequest shot rate Bit Types ĠPolygon List 396 0 396 9 396 598 ban ia nk phi 035 3 035 7 è´ Ŀ Ġdu Boundary gzip writer sli d 495 604 bank vars Ġfx nxn Sign if Sign Line destination Port destination Address AX IES AX COLOUR Control Variants gun inds gun propdict scr ut scr bar ĠExtension Manager ĠExtension OpsMixin ĠExtension ScalarOpsMixin Generic CSV Generic Jumps Generic TSV Generic ArrayLikeDataAdapter Ġcats ortinterp tif data Coord System pkg name pkg util 177 994 Header Error Ġshadow ns 个 SecId RESH APE Report Gen '; " '; ", Slice Appr Ġjo ggle Ġdes Cat Gene Ids Gene Expression Gene Lists ĠNB Y attach Analyzer čĊĉĉĉ čĊ ĠChe ng Ġpermute parser Stack Helper ĠTwo Sig Ma ine ĠLogistic DecayFunction ĠLogistic ExciteFunction æĺ¯ çĶ± æĺ¯ çĶ¨æĿ¥ bundle Path Post Event ĠOneHotEncoder Model bat oid ĠRel Container SW s SW IO Empty Space Write CapacityUnits photo Coappearence Nu ML UND ER lons lice sell ing Ġmultiply Throughputs Ent ered Const InputFn ,:,:] ') ,:,:] *( Activation Trace Ġgauss val Ġgauss Parm ĠCha rey "$ " third LevelCurTestX third LevelCurx ĠSch olar ĠSch lumber SY X SY NON 277 2540 JSON DecodeError JSON TableWriter Ġga pextend Token izers ĠIP W ĠIP error ĠIP SE ĠIP OPT ĠIP blocked scroll region ĠBox plots ĠDNN EstimatorTest MAC S ctr al ĠPossible Pipeline ĠCH G ĠCH STR )# [ prefs method ĠINPUT FUNC failure Code Nd IsoTope _\ +\ Ġcr ontab ĠCA VE ĠLong tin Ġpowers pectrum Property Value "}) ]). 220 481 220 44605 Ġpulse ss Ġdelt alogg comm utation stan h ĠForm Widget ea ev Ġcorrected Curve Static RoutingHelper rab ly contact matrix ĠJava Params 20000 000000 fwd revratio ĠPR ODUCTION ĠPR ODUCT ĠRES CAL ĠRES EARCH ĠJan ek 9215686 27450980 }- ' }- \\ para hippocampal Init UI Init Cond ĠVol VectorSourceEstimate 387 9 765 4567 765 4329236 Global Vars critical ity ĠClo thTex Bind ings Ġxt ics Epoch Date HDF View POL IT Peak er Peak Time Peak Mag gi ab spe q spe list spe cobj spe chdr intr p intr vw ĠMa il TARGET S Ġem r Ax Max Ax elrod Ġdic ion quart et ĠDir File planet able 229 000 Ġperf OpOnMatrices Ġarma process Ġè ¦ Ġè · Ġè ģļ 8088 3 Ġminus Dur Fast Text Fast MCLT sex tet Response Error )< ...< Sig Int .]] ])) .]] }) Ġsky Brs sco ped Ġnatural hist StandardScaler Params emb b emb w emb dw emb arrass ĠGamma proteobacteria temporal pole chains Queue Install All DataArray AndMultipleEpochs Methods Mixin ĠFs Peptide BM W LU AD Arrow CoderImpl 326 96 028 18 028 208 Append Rows Word Vectors Word Reps pn exts Ġbed FileName 208 333333333333 Author izeSecurityGroup Ġespec ÃŃ toggle point ĠTask Spec posterior cingulate ĠInternal Get ĠInternal Population Ġproc cess ĠBig IntCoder 665 19143 Running DagRun 865 39 865 0633 %%%% % "/> % 214 27 223 000 Short Field ĠMinMaxScaler Model 945 910 Ny ando Affine Base Ġlot tery ĠSte mming comments Dict Buffer Writer MON ET MON KEY MON OLITH Ġbench list Ġbench MarkWeight Ġ38 64 Ġtranslate seqs Ġcn j ĠReport Days Decimal Info formatted CreationDate Settings Stream smoothed Nr 008 17 IES TR trn Sequence Ġresources Res 292 9 Ġray Flag upload Log 777 63 ĠMLP G Ph arm Ġmeth codes çĽ ĸ exist ance Ġcloses rc pu zz Ġdiscret izer å° Ŀ ĠTF BS ĠFrame Parser ĠFrame Writer ç§ ij Ġmaj step ĠPeter sen 1234 321 1234 27585 Ġlazy Module Ġspine Angle LD SC 055 24 297 1 Lon R ĠRank ine gyro averaged ĠDouble UTube 207 10678 Contour Const Ġsg RNAs utilities Menu ACGT AGGTGG ACGT GCCAG Noise Autoencoder ]``. :: cubic webexport tas pop calib Min calib Sn æŀ ļ æŀ Ŀ Setting Event Backend Helper ĠPLOT LY CRE ATING refresh tb ĠRaw ReplicateCounts Ġuid Arr ,:]) [ ]\ [ mysql client lats lice mw Pulse Colour Lst ĠTimeSeries Builder ĠAbstract LossFunction Ġphoto atomic 534 6 tips ize IV P spa ctral Incre ments 197 38 Trade ATR 985 3115 Java StringLength Ġhop ing ĠDown cast ĠDown welling 303 86 åĮ Ĺ ĠBasic Property Ġattrib utions 299 0244 ĠButton Params Math UnaryOp Ġpw out 965 300962 ĠCR ON ĠCR ASH ĠCR PIX ĠCR UTEM distributed RDD Ġrslt s æľŁ åĨħ Site Finder Te ma nw alker Ensemble Table Ensemble Bin Ġharmonic Transformations Sym Spell orbit ids æ¯ Ľ Ġpinv X endpoint GO cmr map tst Sequence }^{ * ĠEND POINT Ġdz true Ġcommit tors Ġmono val Server Flow Sep Line Sep TestVars Ġ'\\ \\') ĠOp MLP ĠInvalid Schema ĠInvalid ParamsError ĠInvalid PageToken 346 784 ĠPack edMessage ĠPack edMessageReader Debug Mode fis i quis ite ĠExp Matrix ĠExp iration ĠExp MovingAverage Abstract Wrapper Abstract Engine Avg Now pin ski pin Mag pin wheel Ġpct ls Ġparame te ĠChannel List 609 270297 live View ĠUniform TriRefiner Squared Error bam orbedfile uda city ĠColumns Ref NP fit \" />\ Statistics Handler ĠCS AT ĠUDF Initialization 308 2402 786 99175 487 169 Mac ros Mac Ports Mac intosh Opt Functs Ġau xi Ġau xiliar neural network Ġatten uated tweets DF wor ldbank TIM IT æĪIJ åĪĨ Bool Op OFF S 994 15 Dec ile Dec lination Ġprot Cnt 7824 81 /{} /{}/ vw i 439 33169 Ġtarg z Ġtarg info Ġvan af Ġvan ish IDX ref 233 88 380 948 380 6488 review Text review UserList Band structure anc illary ĠSubplot Zero 006 04 '[ {" '[ \', GAG TGCA Json Object thr G thr T ĠUnit Resolver ĠUnit SquareMesh GroupBy Error 584 314 Ġic name Ġaug ments Ġplayer Index Ġplayer Flap Ġplayer Shm ĠND Arrays organ ic organ izing voltage Drop 758 7864 æ¬ ¡ç Si III Si esta Cloud Type Ġquot i Mis placed ace t Ġ56 28 ĠTool Enable nip pets ĠDay Ahead Ġmonotonic data Double Complex 163 01 Im An Im Dim ĠMac intosh Ġweather ing ĠBlack Wid Ġther modynamics vo oro Ġfm tr ĠDiv ides ĠDiv isible 248 66 ĠStream Mask ĠStream Capturer :{ :. ĠRenderer EMF ĠRenderer OptionsWidget 103 09 ĠChart Options Ġcircular ly ĠScalar Result ĠFixed Size ĠEM ULSION PIC K Ġ'.. '))) ĠTop Menu 239 15258 econ ometric Has FeaturesCol Angle Matrix JD OT Ġintr ange Ġintr isic ("{} _ ĠUt terance Age Cat Extension Ops netcdf plus sweep Win fftshift Act Internal Field Internal Commands Sm dif Ġqual itatively Ġfault Txt ĠSD LOG ĠClear ly Bad Move Bad ZipFile Prop Number Ġvel Array Ġvel scl ĠLow e Big IntegerField contig ID contig Lengths Ġideal ized ))+ (( ))+ ". ))+ ']', ĠUP LOAD Starting Times Limit Warning Limit Checks rem ie rist est Ġshot gun ĠView able ĠView Box Ġloads hed sph sel Evaluate Transcripts Upper Limit ao en ao UnitSeries Ġgaps cores ĠGen Kw disabled Encoder aff icher ĠSeq Util spot area Enable Pcap ĠGraphicsContext EMF ĠGraphicsContext GDK Ġ54 07 ĠCond or Ġnw vl Ġhover templatesrc 8888 889 8888 662016 Inputs NotSpecified tur bines endor ff Constant Type Constant PositionMobility mutation stoca ĠSer bian 064 362 Bits List quit ting quit ous quit tb ĠOper ational 065 010 Ġ&& '% Business Mixin ĠSigma Task ĠSigma Posterior bid Price Too Long Ġsb x Ġwav FilesList Ext ends CB H dj pos Ġevals Curr Ġorgan izes ĠMO MA ĠMO MENT Ġmys hape Ġmys ummary Workspace Act Ġtl hingan Ġ"* ")) ĠPop ular ĠPop Up ĠPop dy 067 03474 Ġhh fit Sort Table Ġabstract ing Ġfair ness dock ing Asset Exists 对 æµĭè¯ķéĽĨ Root Action Usage StatisticsHandler tok type Sw ing Sw aps Sw itched ("../ ..") Weighted F Ġelliptic ities ĠControl Modifier nbr list 307 14 ĠMulticlass Model ĠMulticlass StructuredModel }% " }% |' "))) () 954 1684911 Normalization LUT cntr Pt 717 9487 rnd n 5506 70 landmarks N nbs ala mz l mz u Ġà ĵ ĠÃ Ń Ġbm datum strat igraphic Ġsumm ations dh ol buy num buy price Sizes Only ĠBigQuery Cursor 217 1465 tos olve 1296 8613 åĮĸ å·¥ åĮĸ çī¹å¾ģ rescale cols phases Dialog ä¼ ° ä¼ ģä¸ļ Join Field 094 9 094 3951 ĠSym LogNorm Merge Task Merge Operation Merge Nested hub Power motif State Basic Unit KS x Ġ365 3 044 3397 Adj P fancy arrow CCA GTGG EC DA ĠQuery ExecutionException ĠRA DI 993 86348 Ġow ck edi files SEC UTIVE tgt pos ĠSearch light (... )." (... )\", CAN otSupported Ġrxn ix ĠAB OUT Ġ``{ -, ĠPercent Strategy 201301 30 Ġyo unger pay offs Ġjava Home Ġjava StringLength 929 16547 åĵģ 鼶åĶ® 497 28000000000 oise ssion е Ñģ Ġspam mer DAT ABASES UV XY ]< ...< ade h Exists Error metastore brow Forecast s Ġpacket Times MULTI PLICATION xm llint Ġtie breaker Windows Error =\" (...)\", thick m Ġsci lifelab ĠDistributed DataFrame ĠLast TI Ġlang tag Median Skewness EB P Ġthin len gps LOS Ġrev rt Ġrev spec 868 64 Ġfragment Start Uniform Noise Uniform TriRefiner ELE MS blo sum blo omberg rock types Ġvm nx 030 22 ĠNotImplemented Warning ĠComple teness Scaling ParameterRange Pressure Json ssy evd pilot logfilename Ġqc var Photo metrics Ġode RK Ġrm ss 646 24656 ĠREAD ER á vel á ÃĬ indiv duals course ra ĠAD MIN 476 08 Small IntegerField Ġie mid ĠEnv ironments Sat isfi mri Model Ġcg utils ĠMOD ELS Cut out Cut ting Cut Annotator Cut InWindSpeed 142 255 Station Manager ĠNN tools Ġjs anitize 95686 274509803 srs f unary op INIT I Separ ating elief F ä¸Ĭ è¯ģ ä¸Ĭ ç©¿ Ġsweep ing ĠMPL D æľī ä¸įåIJĮ teff red ä¸į éľĢè¦ģ Monitor Warning Monitor Wdg thumbnail List loo poo /*. *', Ġfb vals ĠRMS Prop sensitivity Labels ĠAvoid UNC Ġsecurity name ĠLight Filter 858 28 dq star 2500 03 predictor Instance human ize Ġoh ms ĠMode nese ãģĪãģĪãģĪãģĪ ãģĪ PG SB Ġmacro states Ġmacro economic 31268 252574 iser ror 209 2543 ĠConcat Layer resol we resol ving 1904 909 0000000000 03 lte am 957 63 957 3325 Bitmap Size Bitmap DataPlanes Ġrelat ives ĠChi Squared Ġbonds iter ĠPort o ========================================= ') ĊĊĊĊĊĊĊĊ ĊĊĊĊĊĊ ĠTick font Aggregate Object Aggregate Source ("./ % Ġwa ist ĠSi esta ='< ->', åıĬ æĽ´æĸ°æŶéĹ´ ĠTechn ix Corr Gram Ġhyp dict Vel Y Ġdra gended ĠEdge Transformer ä åå Ġsgd c Ġecho RD ĠBad InputError Ġenvelope Patch ?, ?)', Ġtck u Ġboot fn Ġheter odyne Obs Spec Ġnl module ĠSK ILL 357 25120 Ġema iled serialized Class crash ing Ġdq b Ġdq x dam n Ġlfw Aligned 886 92 886 982 Species IDs hx rd stochastic Model NEW VAL Rad on Rad au lie re important ly FAIL FIX Division Odds Ġintra particle 310 51 Nc ilvl Storage Pool Clear Task ĠCat alano moose x Ġunsorted RlocList }}} }'. conditional s Approx imately Any Termination Ġsensitivity Results ĠGtk Agg Smooth s Smooth Vanadium 537 0 sty Indx Execution Error Execution Result Sent inel cart grid cart pole tck g tck t tck z tube eps tube lens ĠAirflow Plugin PV CDROM tv tk PROCESS ES 9372549 019607843 Ġtornado es ĠUN EXPECTED 674 05524 Ġcircum vent Ġcircum radius rna i ĠPattern Fill ĠPattern Presenter Ġperturb At assigned DF Ġ113 49 FFFF CC slug s )$ '. )$ =% 087 27933 Problem Type ö rg ö äöäöäöäöåååå ö äåå Ġeco li ĠWord Vectors Ġsubmit Solution tran serror Ġgn mt ĠProgram Section 019607843 13 stn da Ġsps q Ġgold Line å¦Ĥ åĪĨ analog Plot nam ara Ġ"\\ " Ġ"\\ )") Ġ"\\ (") Ġopens rc FN F recent Patients ĠFig uur ĠFig ueired woo Y ĠLib ya 287 079 Ġdiss ipated MAG NIT CCD key а Ñģ Ġaw eso Ġviz array LZ W ĠIND RA Performance Tracker Nb Agg idi rafter Hyper geometric Hyper paramOpt GENER ATE GENER ATING Next ValidId Ġrain map Ġcas a Ġcas per Ġpropag ators Ġdownstream Dict ĠDeep JDOT bib li Ġiq dims Ġiq calc aab artwo Ġay ant ĠSP GU ĠSP ATIAL ĠPolar Common Ġseason num ################################################################################################ ######### '^ ' '^ (? Ġ#, ## RV Model coup l setCurrent Value ĠSuper pose ĠSuper position ĠRand olph temps Oak dyn low и з 364 02 ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĊ ĠInteractiveShell ABC sparsity Param Ġads lab Condition ed dor f dor ank dor aw elines plot csm type ä¿¡ å¿ĥ 线 åĽ¾ Pt No mjd array }\\ \\ 8887 1182088 Fix tures Fix Spaces Ġvoxel size ó s estimated TagName Progress State SUM l triv ially White Kernel sma pe ĠGu assian Lag uerre she ath whis k whis per Ġym int Ġsch ur Ġtrick ery #------------------------------------------------ ---------------# lineEdit gun Ion NumberDensity ĠMaxAbsScaler Model fluid state Sampling Result è¦ ĸ ĠMc Fee ĠMc Nam ĠAT CA ĠAT TR brick ValueError NAN O Tot Classes derived FromTerm ĠRec arrayField AW CFermi ĠSol ids Prod Rules Delay BinWidth Stamp ed Pick led Ġinde cies Machine Learning Dock er Ġoct agon Ġ117 76 577 2156 Large GlobalVars ĠPol itical ("\\ ")] ("\\ ","/") ĠRetrie ved camp o 884 19 ĠLayer File Saver Def Saver Usage COD ING MIT OSIS Sup TxtCtrl Ġygrid line ĠElect rum ĠBartlett Result QUAR TERS Pat rimoine Ġ')) - Ġmang é ĠTE I Ġheap ify likelihoods Vec Ha enszel Ġdynam odb Syn SamplingResult Ġran x ĠLinearModel ParametersWidget Water Stress Ġpal abras Ġrb H Ġrb cm compiler Section ĠWCS Pixel ĠWCS World ĠDiscrete Slider Api Resource ========================= + Aug umentor Gauss ians Gauss Radau Ġzer nike edf lib Ġpears ons Ġspot df echo RD colon ial 9995 1087 Ġranked Pop LSH Params åIJİ æīį Ti Rews cds Start cds End drag Start nS ART alloc d alloc ates Ġpanda classname ĠPlan form ĠLE AF 99999 14 completion List åĪ° ä¼ļåijĺ %%%%%%%% %%%% portal web Ġ655 15 Ġdk z ĠTho eni IDF Params SIG MOID #**************************************************************** ******************************** ĠBra Class ĠDirectory Path Ds ByDz Dur chmesser Super cell Ġmcd ats ĠConf licting ĠNeuro Data circum circle Game Score Ġyname list ĠSlice ToCorrect ='$ ( ='$ | ĠPS PS ĠPS DEstimator ĠBASE LINE ĠBool ian Black Body subj ID ĠInv est ĠInv Problem 949 1079 ĠHeight Near æĸ¹ æ¡Ī drive Sync 507 0 0500 1095 Web ServerFlow Ġorth er ĊĠĠĠĠĠĠĠĠĊ ĊĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĠSupervised Model preg ion compar aison Ġ'{}' "). Ġstocks List Ġao as ssp Syn Ġconcept ual Ġjitter x ĠIteration LimitWarning ĠMove To Unique Endpoints Focus StepSize Ġbam read Ġbam boo ("_") [:- 374 92 freeze gun Ndarray Mixin Success Rates ¡ ¿ Ġ134 875 Ġaccident al Hi Seq oe is Ġcel ly Ġcel ltypes ĠFlatten RowCoder 85490196 078431369 '* ). 836 6486 Rolling Ret Vol unteer ĠItem C ĠItem D ĠEng ines Desc Stat HB T iir ange iir peak iir notch jitter Sum Ġmand rill ĠLatex Titles %) ". 694 118 Hy wl Hy dra XP owGate ĠExpression Builder 3538 223773 GCATG GTT }>>> >>> Ġlvl Type çĶµ åŃIJ åĬł å·¥ 3809 06 ]+' /' animal ness Ġmh peak Ġmh ert ĠTimer GTK ĠTimer Wx ĠTimer Service ĠBU GGY checkBox TimeVarying checkBox ParametersConstants GM svm inde ed ĠPRE P ĠPRE GNANCY ĠAut hent Protein Fraction CAG CA CAG CCGCGGT isc uous ĠERR WAV startup Dir ĠExponential ity ĠExponential DecayFunction ĠFloating Dtype Dark Blue Ġrecs ys ĠAnt ideriv ĠGR PC FIFO Mail Numeric Type pheno mena slide show wheel chair AH Boostrap Phy Helper Your System Instrument Code Instrument Device Ġnic est iche ster Ġwal ked ĠOct ave 889 868 Ġrock bandpeakind Scene BoundingRect -----------------+ ----------------------+ Ġrw attrs ĠIR LS Foo Encoding Ġ254 00000 ĠStudent T bcknd ComboBox Between Tables ĠSIGN ED psy che psy chi posix path Exc Level DST ool tro ub Ġdrag started Ġ115 94 ĠSouth west Ġcancel Button sps q neto meter lights ource ĠCy to ĠSquare Collection ĠEigen vector ĠOff er Ġdamp er ĠSat urn 0527 609270297 Bucket Prob 7490196 07843137 Ġ=============== " Ġod in ('@ ') Ġzp term PowerCurve ScatterMetric LINK ED Clock wise suc ces Ġlay ered chl pos ('" ',''). Ġperp Int 000000000000 6 179 66 ĠLogger Plotter ĠMetrics Plot ĠMetrics Manager 677 227 ĠCRE EP ĠFE CHA ĠLu iz ĠMu ir ĠET L BW l çī ĩæ Ġseper ating oblique cam CTT ACCAG NH IDDEN Ġí ģ transitions intable 7372549 0196078 PF CTurl Wiz ard è½ ¯ä»¶ åıij çİ° Ġ``| ``. Ġupstream Dict Subset All cop ation ĠMor phology ĠEarth quake Aut otrace ĠSTR ONG ĠUtil IndustryData Ġemphas izes ez ex harmonic Bpm å¸Ĥ åĢ¼ ĠExecute SQL Cr vmin Wn li Ġsink List Dependen ts diver ged assertDataArray AllClose downs amp anti qu perturb AtX Ġautore set slack client µ Ãļ Ġpil bl penal ization ĠDataSet Deviation Composite Affine Keep Number BivariateSpline Base Che mo WO W Book man Integration Time Half PowerFreq TeX Font Imputer Params Generalized QSampling Ġkser y ĠEntry PriceUnitOne TOOL ONGT 745 35536 Ġ119 74 ĠHH MI ĠFunc Time ĠGeometry Element оР¿ COR DEX Ġig akit ĠMS MS ĠHa versine 36078 4 wvl Index Ġsus p Ġprograms path scat tered scat terer ILL REQUEST Ġpu zzle serie ses SAL AM fan ta Ġ(~ ( Ġ[{} ], Ġ[{} /{} Ġ+------+ ------+------+ scala UDT 421 356 ĠPeak Mag ĠCHAR ACTER 914 14015 Ann ie tow ne tow ard éĥ ij onet cdf Ġmen age Ġprote us 2041 1041 702 657 Bio physics Bio Fam bnd l glu ed itemp rop 9058 29 ĠLOAD ING éĢļ çĶ¨ ĠMinkowski Metric Ġencaps ulating ĠStress ModelBase CHROM IUM éĩį çĤ¹ čĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ Ġblur ring +") " FIT C FIT PACK atten List hack offsetper Ġba serate __()) } ccd num Probe sets 9999999999 97 计 æģ¯ æĪIJ交 æķ°æį® æĪIJ交 éĩı TUR N rises unset Ġxgrid line ãģ® åĢ¤ CHAR PTR ĠCONST RAINTS Continuous LearnExperiment standardi zer Contains Mixin ĠTIME n Ġxtick lines Ġsymp ified ======================================= \ {}- {} axial Box 0985 08 ĠEcommerceData T ĠEcommerceData Y dust y hon est Ġrepl char ĠQuantity Type Multinomial Logit 567 0 567 2 WRITE ADDR ĠSS GPLVM Ġnbr list 999999999999 98 ĠNumeric Array Ka plan Ka pazitäten ĠPrefer red ĠGEN O strike through vf oci Ġcategor ic ĠADD ITIONAL Ġprofit LossRatio CEL P ĠInterpre ts CountVectorizer Model CountVectorizer Params Transition Probability å¤ļ ä»ĵå®ĮæĪIJ Did NotFail glo ver stag l ĠMV CA Ġwheel Event tpm LB 14795 90 718 281 annon ate ĠBer v Country Code harv ester Pixels ToMark ĠLEFT ARC tier key Ġnight mare ddd N Ġproteins OverTime bun ny money fund ĠNS Window ĠNS FileHandling obst ime OneHotEncoder Params ĠUserDefined PythonFunctions ĠEllipse Collection æĸ°éĹ» ID ,)* (- ]# . ĠRef Data Ġmw ds Ġ(? ). ĠSY NC ĠRaster CTS Inc lination appear ances Address Value Address Helper ĠdT dr ĠAm monia ĠRolling OLS ĠRolling SumDifference Ġzmin fl æĸĩ æľ¬ FB data Sli ders {( .+)\ profession al Cmd List Zone Parser nuc T Ġwr ts ĠTables ForViews ĠIDF T ĠIDF Model ĠAudio Stream dac cessor Ga us cert ificates 940 88692 Disk BytesSpilled Ġconjunction s Market Exposure Deriv Terms MV PA bray ton lis p META FILE Leak Warning pysat ModelUtils broker age ('* / ĠMR N 442 784 ĠStd out Shared Variable Shared Mmap Shared StoragePool è¿Ľè¡Į åĽŀæµĭ è¯ģåĪ¸ åľ¨ gat ta Ġregress sion dil uted Ġ327 66 Ġpyg mt packets Dropped ĠContext Format Tracker Viewer (',', '')) foc new ĠNico la ksParam EffectiveDate ĠPressure dim Register EnumDescriptor mobile Num SOL AR å¿ µ Study Date ĠSurvival AnalysisMixin Ġnump ars ĠCod on ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġkep plot Ġkep key åĪĨç±» éĶĻ误 Html File fliers ize ĠDel uge ĠDel Uncor ĠDel NotFnd 0100 2513 "(? :(? å± ± å± ĭ ĠIns ights ĠIns olation ĠEVEN TS Ġprotect s /# ', /# /#/ ĠÎ £ Ġeager ness Ġdock widgets }$' +' RNN Regressor mosaic plot sar clst undo Action ĠAbinit Pseudo Oct ave ĠIde a Ġ"{}" .* )") Ġdmap io ĠTAB ULAR Ġsqr norm ĠCanonical System Wheel Speed Front ier Keras Classifier Keras SequenceAdapter Ren or SAG Classifier Ġmine layers ĠOCC face ĠDirection Reconstruction ĠWWTP stoEmpty XLS X lost Packets 0007 70 Ġstre vol Ġstre hl Ġvo ice dln hours dln caputil Ġclevs Str Ġclevs PS 0008 91 adds hot adds itedir ĠLive Monitoring THE ME Above AndBelow Ġbell man Ġthres old ("~ /. ATTG ACGGGG Compiler Cmd bigint warning 547 397 Mess ung Ġwifi Channel isub plot setItem Delegate ĠEp istasis ĠHtml Tooltip æ£Ģ éªĮ ,_, _) gion eq tum ble trends ize æĻ ºåºĵ testring ArrayNonzero lateral occipital lateral orbitofrontal appe aling ĠResize Event Ġbrick cache ĠwindSpeed Column æĿ¥æºIJ çŃī Mc Lean Nested Row kcal ving ĠRoc AucScoreOp ĠREL ATION ĠMol GAN meaning ful Consider ing Ġwalker Num Critical Exons HK DAT lith ium Ġytick lines ĠSnow flake ĠCOR DEX ĠCOR RECTION REAL EST Unc AbsList Unc AnomsList decimate To ä¸ŃçļĦ æĸ¹æ³ķ Stacked NNobject Airflow Exception Airflow Plugin 419 41401 Ġftr Dict Ġftr Albm Ġbump Sigma Ġworm s ĠArtifact Path äö öäåå Druid Hook cull data ĠSuccess ive ĠSpherical Dust aste ren ĠCompile One Vectorized IndexedArray Simulated Curve sliding min Serialize ToXmlFile 478 94 qso Min 0013 80 setData Limits :`[ \\ ĠKen ya duck typing CallDimension S AGGA AGGTGG ĠVirtual Box Wall clock xbc de ĠÑģ ен ĠÑģ оÑģÑĤав currents can 098039215686 29 Ġgz l Ġger man noun pair Changes InDir Ġfract oca å¢ŀåĬł ä¸Ģ个 ä¹°åħ¥ å¸Ńä½įæķ° PCT CHRT PCT YRRND Ġclas ser rainfall Stack ĠVIS NIR Enrichment Analysis ZZZZ ZZZZ Grib Wrapper breed te kis ao Ñĥ ем Ġ223 12488 ĠREP RESENT Socket Factory Van couver Yellow brickValueError Ġpes os Ġpes ky Ġmint ime Ġtomato Line Ġallf its predictive Cells ĠTestArray Conversion 0794 42 UTIL INDUSTRY Ġtopk labels ĠGraphLab Util ĠMagnetic Table Shares Error Shares Rnk éĢī èĤ¡ EMF Brush Fire Fly Ko eln SID ER kar abo redo Action ĠOps OnDiff PathCollection Templates Ġ---------------------------------------------------------------------------------------------------------------- -------------- ĠCommun ication åģľæŃ¢ çŃĸçķ¥ Sr IsoTope Ġvq mm ĠBurn ed Ġabi validate Experimental Warning frontal pole åįĸåĩº å¸Ńä½įæķ° éħį èĤ¡ Bid OfferCurve Candidate Model xpts T Ġmkl C Ġmkl df Ġaxr xy ĊĠĠĠĠĉ ĠĠĠĠĠĠĠ Ġsupers aturation Ġtmod out surrogate DF ĠContents API åĩĢ é¢Ŀ 11111111 11110010 Analytic Op Hard Error Hard ware vacc ination Ġreserve margin Ġbor derer valent i ",". / bounder y SEN TIMENT selective Inference Commission PostInit ĠPymatgen Test ĠFinish GL Ġ+----------------+ -----------------------------------------+ assemb ling ĠPanda IDs ("^ ((?! ĠFlat iron ĠFRE Q bern ard ĠUSER NAME ĠUSER PREF comfort s Prep Sample 88235294117647 06 Ġbullet proof ä»»åĬ¡ åĪ°ä¼ļåijĺ Slow down bcb cbc Ġpand aname Ġpand awalk magn us magn esium Ġexam ines ='[ ', ĠIr respective Ġweig hed Ġcurv atures 1917 26459 Swap Buffers ĠTrimmed MappedSequence å½ĵåīį æŶéĹ´ å½ĵåīį çļĦä»·æł¼ crt l Ġlif ts Ġlif elines Ġ^^^^^^^^^^^^^^^^ ^^ Ġflg files ĠMg II ĠMantid Axes Ġbinar ay Galaxy Builder 749 04 839 1231 smp ls upe e м еÑĢ м еж Ġamazon ID Ġepo incs haw ks ĠABS OL dfb dfb ĠBACK END 9955 3089 Ġhowm uch Shuff ling 548 010 tat um Ġcub oids Ġsax Str kee pprob Ġmacros copic Ġ922 33720368547758 cosmic TimeList Magic Grid æµģ åĬ¨ åĤ¨ åŃĺ Ġavalue Tot ĠACC ELERATION winning Score ĠGeometric Brownian åĮº åŁŁ ĠDagRun ModelView AAT ACGTAGGTGG TAS SP Walk ers debt paying ĠTestP color ĠTestP ivot Ġinital ize cbk Dir ĠSynthetic Spectrum GaussianHMM BaseTester STRUCT S ĠCombined DatetimelikeProperties AZ O Cartesian Representation VX MT cL oda ncf lags Ġmst u Ġhu uxm ĠCare fully Ġmenpo fit Ġlosing Result interrupt able Ġabsol uto ĠSilence Stdout MSD KI Que bec Rh ode Rh Cl Rh odes ĠSk irt ĠAcoustic Composition ĠRus sel ĠMutable Module shifting Dropdown Coll isions Mechan ical RETR IES autom odapi Blocking MouseInput ĠMOV ING ĠAtomic File ĠAbinitTimer ParserError Tuned Error çľ ģ lep Phi lep Eta ('! % ('! '): Ġgop ca ĠMiss ion Ġadq api Ġcarbon ate 810 83 FIND ALL Gt AbsentSrc Hadoop File Sale Type Ten ant ĠTmp DataList ĠSensor Info testcase Env ĠMY UDF Ġfaith ful QUAD RATIC Contig List LevelCur xCenter ĠStatic Restrictions ĠBrownian Bridge ĠEDIT OR LUT SIZE ucs b semantic Features Ġspo cr ĠMotion Correction TimeDep Ket 2605 50 LOS EST Preprocessing Algorithm çĶ» åĽ¾ ĠSegmentation Task Fund amental Spring ob Spring Green sind g Ġnframes perstim consum o ĠLut ron ocy te ĠIndian a 16078 4 extrac Back extrac Pad extrac TimeWindow extrac SnCutoff extrac MaxCharge æķ°æį®åºĵ 表 taille Bin *\.\ . äöäö äööäåå Astro metry Wperm K Ġemo ji ĠTag line ĠyMin Dbl ĠSSS RM shif ty Inherit ance Ġtransmittance Spectrum Logical Types Ġelectro physiological AUG SEQ Bond Collection Ġadi acenza Ġ#! / contra dict ------------------------- ') 1962 36 Prov Document 1176470588 25 ĠControll ers Ġåľ ºåĿĩ ĠFligner Result ECOMMERCEDAT AS ECOMMERCEDAT ACH dth andler ĠxMin Dbl Ġintent ed incid in ĠMorris on Boot camp QM diArea ê ncia Ġsrv ID enriched sets Ġgls pos ĠSd vec ĠScho lt ĠCELL A ĠCELL PADDING ĠNCE I 15294 117647058825 224606 3538223773 2468 45 Subhalo Vel Ġlime GreenLine GRAD CAM å¼Ģä»ĵ ä¿¡åı· )^{- \ 909090909 1 AQ TT Mart ingale Unp ickle YA Arrow YA HOO craw ls kir an kir che íĺ Ħ Ġfrequen z ĠTER MS thal CorRect 1383 991 uras ian ĠZone Dist ĠGRAPH VIZ Eig ensystem SIT UACAO Ġ'--- ' Ġbatter Salaries Ġgof nt 1063 00 ĠOcc ur ĠHost s sulf ide ĠSigned ness GAP IC Io U Ln Prior Wire Maps avalue Tot bbs dfbdfb epa cts Ġclt ruck ĠAtt n ĠCY AN Ġkilo metres Ġqgrid str Ġchop ped ĠxmlString NoOpen BitsPer Flag BitsPer Coordinate æŁ¥è¯¢ åħ·ä½ĵæĮĩæłĩä¿¡æģ¯ CMS core JAR ED School Holiday rlm res Ġtun ning gear Contact ĠEfficiency Warning ĠPara View ĠDele gation Ġddm IF Ġddy B FeatureColumn Names Ġpersonal ized speck le fran co æ¦Ĥ 念 èī ºæģ© Ġcamp arent Ġamen ded Ġinsp iration ĠTapas Tokenizer ĠMut ually cai iasdata 2555 312224 CCCG CAAC Multiplic ation 解 åĨ³ phylo xml pcwgError Baseline pcwgError Turb pcwgError Rews pcwgError Pdm pcwgError TiRews DSD ocument Duty Cycles REST Handler Waves hapes Ġmil boost ("(? <= Ġjmx Url Ġsyl lable Ġgeter rors NotConvert ible await Termination await AnyTermination 移 éĻ¤ rnaseq dir ĠAuger file 890 94663 ÃĤ ë 0154 20213851 moo set plug s rawData FilePath 3237 113 4375 3691 HTTPS Connection uncorrect able towards datascience Anti Alias ìŀIJ 를 CX Data nco add ĠãģĪãģĪãģĪãģĪ ãģĪ Ġpod er Ġasp irant Ġexpo ffset dsy evd 9935 18133 1547 01 Stellar Photometrics ĠTestRemoveDataPickle Poisson ĠTestRemoveDataPickle GLM ĠTestRemoveDataPickle Logit ĠTestRemoveDataPickle WLS ĠTestRemoveDataPickle RLM ĠTestRemoveDataPickle NegativeBinomial 8579 4562 REDU CTION Diel Upsilon Lead field EXPECTED LEN ĠTermin ating Ġ################################################################################################################ #### ĠKnownFailure DidNotFail æĻ¯æ°Ķ æĮĩæķ° Rich ard Vocab Size unregister Hook fiel daccessor ĠIg M ĠNG X scor r 1426 389562 0964 04744 OLO AD AxisArtistHelper Rectlinear Rectangular Frame åħĥç´ł 为 ĠBUILD ING '-> '' '-> '\ Cros sentropy GAL AXY hgrad Ex hgrad Sy hgrad Wx hgrad Ny Ġipv t geoid grids axi om ĠSell CheckTuple ĠPose Reg ĠBel arus 9932 2285 ĠnewCell FluoDF 2266 85 ĠStone X District s Assignment Error Popularity RRF ĠShare YourSystem POLYG ONS )}} }, 590 229595 GLY X fue ltype Ġict al Ġreve aled ĠMencoder FileWriter antig rain numC aN subsub ItemList Ġpaa Function ĠUrban ized 1364 651 zeit Kugel stopTime Tbl ĠCalendar Day SPH UM BAC TER Sense Checks bos on Ġddx A Ġddx B utili dades ĠPing Pong nspec ies Ġking fisher Ġlump ing 1026 334 numbered x Ġ.......... ....... 35686 3 Ġsolr Instance Ġoffic ials 6767 7815 Ġautocor rect NumExpr Engine macerror max ĠRegistration OverTime 港 èĤ¡ DRI F MAL E \') ' giz mo iam ondb Ġdma debug ĠTrip let bspl dismat ĠHor rible OTST RAP MASTER FILE Shifted Bits NoData Message Ġè¾ ¹ ç¡® 认 Heteroscedastic Latent +": : Tar iff Ġ'---------------------------------------------------------------- -----' ')> "\ pymol viewer ĠPau la Ġsediment ation Ġunderest imate Ġlefts ide Ġ[[],[],[ ],[]] Ġ[[],[],[ ],[],[],[],[ multic ast ĠProxy Search ĠProxy Delegate ImageSequence Path Ġdigraph s Ġhyd ropy !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! !!!!!!!!!!!!!!!!!!!!!!!! ĠYYYYMMDD HH ĠåĽŀæµĭ æķ°æį® Jitter BinWidth March ant NAS A ĠKep ID 8427 01 Keywords Test SLID ING ĠTraffic TransData Ġkepler ians Overlapping Data Mail AsID BIR N Camp aigns TLS W Tumor TypeDict harmon ized Ġipt est igue re abond anceMoyenne ĠPay loadManager subm its 1680 2270373 9736 17132 ĠJose ph TimeDelta Block MSM DIR chiq widthSpinBox CDMS lite TwoD pop ĠLSQ BivariateSpline ConvexHull Features 2117 47 Dyn Tree Skeleton Features TAR DIS fus cate fus iform frank otchellappa nume pochs nume vts Ġawg Data ĠtestArrayFeedFn BatchTwoWithOneEpoch ĠDur iez ĠMd prob 0409 89164 ','',' ',''), 3675 4447 NumOf Dims vacy LeakWarning Ġdrill hole ĠtestPandasFeedFn BatchTwoWithOneEpoch Underlying Lightcurves ĠFractional Type çľĭ çľĭ Wifi Helper }__ '. lams q idn ig abab ab Ġhier achy ĠPOP ULATION ĠFun Derivative ĠEye Data ĠBivariate Function achute Descent Ġshr tag ĠTestGet Item divor ced initialpoint æ°´å¹³ ĠPyG MI ĠTrig gers Phylo XML Men us Ty lor dNd V sS ondheimer speak check âĤ¬ âĢľ Ġtough er thy roid Ġrib osomal Ġgar den ĠShe phard ĠDY NAMIC Ġalfa Label scand al ĠWright Tools 13101 689575 0945 82255 5675 3924 ĠAccel erating 4142 136 аÑĤ Ñĭ но ÑģÑĤи èIJ¥ ä¸ļéĥ¨ æĬĢæľ¯çº¿ éĺ»åĬĽä½į Glob Parab mans hip vout NoLoad menpo fit idcs Lines happ ens ĠXCom View colort uple Ġvag aries Ġkom orki Ġkafka Home Coincs Path obvious ly ĠpowerCurve Mode ĠNumExpr Engine ^^^^^^^^^^^^ ^ Ġèĭ¥ æľī Ġèĭ¥ ä¸Ĭä¸Ģ个 ĠBasicUnit Converter ĠAnsari Result ĠPyObjC Tools Ambiguous TimeError Sl Tp onLeftButton DClick ĠSink Coordainte ĠApi Exception ĠCard inality ĠFO Vs Ġcolort erm ĠLik homan ĠGF DL 1285 71 ĠParame trize 1575 77 1575 21476 0966 3178 ĠTyped DataFrame ĠUnexpected TypeException retro grade Counting Logic Recip r GAAG AGG ĠPlus Four NeuralNetwork Classifier sampleSizeProximal List Fallback Enabled æ¶Īè´¹èĢħ ä¿¡å¿ĥ onRightButton DClick Mad rid gim li 被 è£ħ饰 Ġccl m Ġfrb pop igvl sort setLabel Text ĠDash Pattern ĠnumActive Cell ĠEmb ededSphinxShell fops hifts ĠKV Loader 1488 74338 BaseDNN WarmStartingTest BaseDNN LogitFnTest phasing menu Ġrelig ions 3110 306 Lost Packets ĠASSIGN MENT ãĥĥ ãĥ ExportTo Proj Underride Color appeared LocalTime Participant Barcode 2134 20 rein forced Ġ'*** ' ĠTar File Ġcog stat ĠOcean ic ĠParasiteAxes Base ĠDecor ate IPPA bool ĠrawData Dict Internet StackHelper medial orbitofrontal PandasSQL Test Termin ator Termin als ĠìĥĿìĦ± íķł 899999976158 142 Bright est Jump Fac juli e juli et onoff indicator Ġsdt mp Ġdneff c Ġretrain LSTMAt Ġkine matics ĠMus lim Ġlne ta DataEmployment Unemployment 7595 8653 2243 07 dbz Count udta f 5285 171717 Ġomegainv sqrt sampleSizeDistal List Ġphage a DFI a DFI i Elec Plots LSI Wrapper WG Manager rsc gen ativ ative ĠoObj Cls ĠmN IG ĠNSB itmapImage ĠMATH EMATICAL ĠMATCH ED Inj uries 9988 2539442 ĠWiki pathway ĠInProcess InteractiveShell Deconv Window ADV ANCED Ġmydate parser ĠDEFIN ED sizeratio ERR 2368 346784 Ġannualized Return MANAG ED Mayavi Renderer Ġturquoise Line ĠBRACKET S åIJ¯åĬ¨ çŃĸçķ¥ Burn t dls idlM sigh at µ¬ ê°Ħ î ºó Ġpec let ('---- ') Ġdemod ulate 1536 96 4515 1377 absol ut lsst JobParams respons iveness Ġmps lib Ġgrá fica PandasUDF Serializer TAtt Fill dashboards ForRole MDP ATG RFormula Params PackageRegistry V UserDefinedFunction Wrapper RADIO BUTTON ĠtestIrisInputFn LabelsDict ĠOBJ DUMP ç³» æķ° ì² ĺëŁ¼ Ġphas ing ĠdJ dm ĠChat bot ĠtestAccuracy ColumnOnly Ġ562 80729661 ĠWid mer ĠVC FObj 9564 776 8548 2655692 ".""" %( enemy Team ĠProt ected Ġfixe deffect æķ°æį®åħ¥åºĵ åıĬæĽ´æĸ°æŶéĹ´ FOUR CC ĠVersioneer Config Ġ================================ ') âĶĮ âĶ¬âĶ HIV ReportGen Ġëı Ħë§ ĠTMVA Regressor å½Ĵ ä¸Ģ ĠMFCC s BOR ROW Fid ucial XCom s bhil qBHIL cult ural nlo Tester çħ ¤ Ġich imoku Ġnir path Ġfue ltype Ġwatersheds UnionFind Ġwatersheds Reoptimization ĠyTrain Temp ĠPand is ĠPAN DEIA ĠPCG C ĠRigid Body Ġproces o Invent or Infinite Type Infinite Line 0529 152 inputImage Nuclei Ġsubd warfs Ġsubscribe Stk nozzle Throat Seasonal ity Ġqad pos ĠStrat Dict ĠColl GaussRadau StringIndexer Model StringIndexer Params Anno Img mcg ill greengreen green greengreen greengreengreen ĠQuart iles Ġö äöäöäöäöåååå Ġö äöäöäööäåå ä¸Ĭæ¦ľ ç»Łè®¡æķ°æį® anomalyLikelihood Line 大äºİ OBO ĠCOMPUT ED ĠBalrog Obs ĠBalrog TileInfo sfe py °ê µ¬ê°Ħ íĻ ĺ lorenz ians Ġdated iff ĠCamp os maxL anes Ġparadig ms 9903 168 ICU Type åıį åIJij ĠGridHelper Rectlinear ĠChrist os QUANT ITIES Correspon ding Correspon dence snes data åįł æĢ»æĪIJ交 ĠReflect ivity Garage Cars æݧåĪ¶ æĺ¯åIJ¦ ĠSCREEN HEIGHT 5235 9878 Myr mecines NIL MTK Rol lout Wu Res XRF compsarr XRF molfracALL palet table zv uk Ġtiger open Ġfrec u Ġemis Coeffs Ġemis fops Ġ"------------------------------------------------ ------" Ġyam tbx Ġyam lio ĠREM OTES pros per ĠMOL AR ĠtimeHgValues Rebinned ĠgetH AWCFermi ĠgetNum Leafs cyto Band 7585 42 9545 44 offer ings Ġoblig ate Unused Import ImageStack Path MultiOutput Estimator 6297 2166 ĠDatetimeIndexResampler Groupby ĠThermo ML Ġmemor ysimple Ġweekends Out !!!!!! !" Marri ages 导 èĩ´ ĠEpisode s "{} \" 83333 333 Dow npoint Dave Backus Mas se Nit rogen jay debe deuter ons getTick Frequency ĠSco tvote ĠFNAME s binE on binQ on 0716 9541684911 discrimin ators 9845 10732 Ġ1677 7220 prio RW superior parietal ĠSubclassed Panel vaex fast OBSERV ABLE è¯į è¯Ń ĠOPTIM AL Answers Predicted 14159265358 98 89999997615814 21 Ġìĭľë¦¬ì¦Ī 를 EOD Time Gradi ometer Vo LL qte height Ġpract ically Ġsmoot hened ende av geop m igroup s ĠTfl A ĠTfl B Ġgrb tag abca a Ġthal CorRect Ġthal CorDiff forme lements ("------------------------------------------------ ----------") ("------------------------------------------------ --------------") Ġmex ican DataInterest Rate namesObservations Train gradu ating Ġpyf me ĠKar l ParasiteAxes Base ParasiteAxes AuxTrans myData Line ĠAlert Query Enhance ment ĠcurveFit Settings Saha Nebular uuuu uuuu Ġ+'_ '. WorkingDir Path Ġigvl sort ĠFloris Error ĠFloris TunedError keplerian results NeuroMesh Model NeuroMesh Multiscale è´¢æĶ¿ æĶ¶æĶ¯æķ°æį® ĠTerminate Trajectory 票æĪ¿ æĻºåºĵ ĠMICRO SECONDLY 累积 è´Ńä¹° Dlib Aligned ZER LAND ¶Ħ íı¬ Ġajout e setImage FrameStyle ĠIsol ines ']+= ": ĠCredit Limit 6494 8076 Ġnewim list 8035 6917847849 Ġroyal BlueLine 3692 924805 specif ichumidity ĠMaxim ally GGAT TAGATACC ESTIM ATE è¿IJè¾ĵ æķ°æį® Centr Sorted DCA mp Foot print Foot ball Prom oter Raff erty Tub Extended Vchromel calclist nats orted ytf Aligned stun Duration Ġnbound lines Ġinstruct ed Ġdnl dict Ġreferen ts icas phere ĠXgboost Regressor Ġorchid Line isty obj ĠIST CB ĠPys pectr ĠPys bP ĠtestNo Dnn ĠtestModelDir IsCopiedTo ĠtestModelDir AsTempDir Ġsele cc Valumel calclist ĠBID Mach ĠBerg stra 1297 039 1263 0121616 ĠgetX vals caud alanteriorcingulate ĠtrainAccuracy ColumnOnly ĠVL SD transmit ter ofMo urning varName Tot varName Share varName NotShare ĠopenVA ReadyFile ĠcreateOrReplace GlobalTempView metricsFile Data Competition Schema MACA DDR 5488 1352 Ġwavelen ghts Ġgradu ate PREFER RED Blit tedFigure GAAT ACGTT CALCUL ATING ĠFieldTrip Client GERMANY DATA Ġrainfield Zeros intraday Db anomalyScore Line LargeBatch WithSmall ê°Ĵ ìĿ´ Warped RectangularProjection Ġdéclar ant Ġdéclar ants |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ĠDissimilarityMatrix Error URDME DataFunction Bcknd Inventory Mes sp jmx Host Ġnbs phinx Ġcrowd astro Ġsan ely Ġomm ited ĠyStart Dbl getDistinct Groups ("]") [ DataRate Value avar age 6794 09568 ĠProf essional ĠShifted Mass ĠMountain Sort ä½ł 好 Ġå® ŀ Refer rers åĩł 天 ĠCarma Model Ġ\'^ # åľŁ åľ° ĠDescStat UV ĠDescStat MV ĠAnchoredSize Locator ĠBottleneck Group éĢ»è¾ij åĽŀå½Ĵ Aust rian Cri mson Fol iation Ssid Value iom mu mTime Info prue bas sbc utobs çı ¾ Ġserv iced leo pard Ġcct bx Ġfram ify Ġsie mpre Ġrind n ĠSca ffold Ġhug oniot ĠFar rell ĠMED IA 1474 77075 Ġmobj s ','_', \ TestSQLite FallbackApi discussion s Unfold Obj DAM AGE RandomNumber GeneratorTestCase WithSmall erArrayAndMultipleEpochs WithSmall DataArrayAndMultipleEpochs WithSpecified NonNumericValue ĠPeriodIndexResampler Groupby Blk Avg ĠTimedeltaIndexResampler Groupby ĠentityDashboard Html UnivariateFeatureSelector Params TradeData AvailableToo ĠapparentResistivity Extrapolate transitionsout table 第ä¸Ģ个 æķ°æį® ĠBucketedRandomProjectionLSH Model ĠEvap otranspiration BinnedStatistic Result BinnedStatistic ddResult ```````` ```````` MILLI SECOND ĠMetastoreBrowser Plugin ĠMinHashLSH Model âĶĮâĶĢâĶIJ âĶĮâĶ¬âĶ Ġì¶Ķ ê°Ģ onMiddleButton Up onMiddleButton Down onMiddleButton DClick radioLegendPos Lower radioLegendPos Upper 4887 65 4887 64864 Ult ra nHidden LSTM éĸ ¢ éĸ ĭ invs igma inicial izar rebound x Ġcabin et Ġfcast err Ġaup r Ġbaud rate Ġ#\ ./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./=\./= ĠisNew Figure thiss hape Ġgrap hed ĠCHI ME minThreshold Proximal mobj s Ġpremium find ĠEmin Label ĠUPD ATED atspin j ĠKIT TI Constitutive Expression 0744 17954 UTCOffset Timezone ĠStitch ing Unstructured Grid Ġmonomial s Ġretre ived ĠPreprocessed Stack IMAG ETYP inferior parietal SPOT R ĠlsCol Dir ĠTrapezoid MapTriFinder biological Material PassThrough LengthPrefixCoder PeakIndex Mask Ġmisspec ification Ġ+-------+-------+ --------+ Basket Key maskConstPos Acc maskConstPos Ang maskConstNeg Acc maskConstNeg Ang Gran de bipy r dplot stop dMag bins xLoc Orig leme his Ġcai iasdata Ġomol A Ġomol D Ġbint able Ġbint argets Ġbos on Ġbread crumb 0072 1152332 ĠPet re ĠtestContinueTraining DictionaryInput ĠMarc in Ġunbox er dedu ctions ĠTestSQLite Alchemy ĠTestSQLite Fallback ĠConsolid ated VectorIndexer Params betw DiskIndx ĠwartoÅĽ ci ĠtestPredictInputFn WithQueue ĠUnivariateFeatureSelector Model åĪĨéĴŁK线 çļĦæľĢé«ĺä»· indvDet XLabel ĠUSMartinLutherKingJr After 6857 294 Dds Shift Dont UseNative cmo ad jzek Act kaw ada patter ntype arit hemt Ġfog gy Ġ#**************************************************************** *********************************** Ġ"---- " challen ger challen ges getFileName ForNode ĠCUST OMIZE toList String Ġdepict ing fileOr Db maxmin subframe irm ware berBand Color Ġinten st rawDet PtNo Ġzpss z INDI ADATA Ġcontro lframe 27400 2 manny page 3437 987 accord o IGRA PHY Ġpico seconds Curva ZigZag Ġconvdf tomerge ĠSaveFigure OptionsWidget StreamChannel FromFreqChannel ĠGeoAlgorithm ExecutionException needle Img ĠPROPER LY Ġsnip it 66749 75515806 ======+ ==========+ ogenes is DOMBasedModel WithMean Ġ+-------------------------+ -----------------+----------------------+ WBAN s ĠtestIrisAll DictionaryInput FileSystemDataset Factory =-=-=-=- =-=-=-=- knock out Ġphistar pick 499999999 9999914 Flate Decode PGN MF VOT ER vto ab æ¢ ° metab olic Ġspon sored Ġether net Ġselfat x gels lopes hacc urate chlor ide ĠSkin Contact Ġxmm mjd lenumber gradients fileTime StartLineEdit ĠMik TeX Ġ``& ``. ĠboRemove MultipleSpaces ĠboRemove PrePost epss info 3268 208538 20070 203 20070 331 Ġotherat x TestOperations NumExprPandas accomp lish autoPhase Act 4311 1992612 0818 1304 lud gy ãģª ãģĦ Ġindicial roots nbody results GetLast Error ĠcomplexPlots Es ĠpredictedActiveCells UnionTrace GTCT TGAC ĠCOMB INATIONS ĠGMMTest Queues 9877 201865 Phantom JS ĠUnitTest VerticaHook ĠArrowStream PandasUDFSerializer AIAlgorithm Error ал ÑĮ 4679 66985 Cog B HDD MStim Hdfs Sensor Rhard n Rhard o clot hes Ġdun efaildf Ġwint it firef ly omn ography Ġhof er ĠCog roupUDF ĠRh ode ĠLAND SAF ĠnumPrin CompList compla ints numSlice Methods ĠOU process ĠParcel ModelError ĠUVB VIS 3501 442784 ĠTestM intypecode ĠCouple T Ġlindex ers ASY N Arcs inh TILE ID ABORT ING ,'< =', OLOG PROB 28937 4 ĠNeptune Logger +'* '+ Chroma gram CheckFor WarningsMetaclass CheckFor LostPackets corrNoise Field COOK IESTR fric Vel frust um __,_| _| Belt rami ĠdailyReturn Reinv ĠdailyReturn NoReinv Ġ'{}_{}. {}'. ãĥĹ ãĥŃ åĩı å°ij SYN TH Director StructuredModel ĠtestModelFnScaffold InTraining ĠtestModelFnScaffold SaverUsage comprehens ive ĠtestBostonAll DictionaryInput Fingerprint AsBit LoadAndProcessFixedPy sexGen DEST ROY Ftr Dict OGR VRT Ragged Trajectory SFL A SNAP PY Tro uble VAT SPOTR Vacc ins onkey release Ġcj rs Ġcurn step Ġpier wsza petr ators ĠwRoi X Ġgbs v Ġexo planet ĠSLO PES ĠScr atch ĠScr Task ripp endorff Ġdepi ction Ġseam less ĠLIM IX plk Widget ĠReally EqualMixin agric ulture trainPredict Plot ĠBh Array colorSpace Name ĠYAA row Ġlamin ar ĠExplain Detail denormal ising ĠTestTable Schema ĠTestCommon Type dimer ization ://{}: {}/ refImg UID filenamein B modelfit DB 5568 169 ĠDew point ĠWebcam Viewer bestFit P GetNbins X GetNbins Y Ġ$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ $$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ Quart ile ĠNoOp Context ĠFileManager Mixin indicatorOf UnitOfTimeRange ĠVectorIndexer Model Ġå¾ ĹåĪ° Beat Histogram Ġmtse xp dgData S dgData Time SWIT ZERLAND CANAD ADATA ĠRectangles OvalsDiamonds PacketSize BinWidth Floris Velocity ĠlaxSkipNaNs SE ĠlaxSkipNaNs XY Ġìĭľ ìŀij ĠAnnoying ly caudal middlefrontal uiGetExpScan TabMultiScans 课ç¨ĭ æĿIJæĸĻ #**************** **** 4333 95394 5676 2092543 MtoT key Rock s Vapor Pressure Ynorm To hori BearingY lset Run Ġcdm data Ġoanda py Ġdvs proc Ġdtau Me Ġ"========== +" Ġstrob es ĠPv dat ========+ ==================+ Ġkms ample Ġkont roli ĠNev ada Ġbytest r Reproject Image frameCount When interph small ĠoneHot enc ĠExpl oring 14213 02964 14213 02965 Paral Hints Ġpredrock min ĠProvision edThroughput exitOn LastRtn PERSPEN K OfF reedom Ġkepp rf synPerm Distal synPerm Proximal GRing Latitude ĠphotPoints Err ĠphotPoints Flux Serv Id ĠRobin hood 4947 453 bootres wls Ġ문 ìŀIJ 个æľĪ æĭĨæĶ¾åĪ©çİĩ ĠSchwartz One Phil anthropic Clave Parametro econom ist ĠHEAT MAP ĠMarkovSwitching Results Phased XPowGate ĠtestArrayFeedFnBatchOneHundred WithSmallerArrayAndMultipleEpochs ĠtestPandasFeedFnBatchOneHundred WithSmallDataArrayAndMultipleEpochs ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠLidstone ProbDist ĠGpsData Analyzer Ġè¨ĵç·´ ãĥĩãĥ¼ãĤ¿ãĤĴ Asy mptote Hover label Mnth List QApp ThreadCall \(([ \ mrb ump pF VA Ġä¸Ķ å½ĵåīįçļĦä»·æł¼ statu g leer ModeloAnt Ġ":: ". Ġnpmol A Ġnpmol D getEdge Lengths getEdge ListByType getclosest sphere aber th ĠSib Sp ĠSib ille ĠxLoc Orig ĠCaN psd ĠCaN spine ĠtestOrderedDictNumpyFeedFn BatchTwoWithOneEpoch ĠtestOrderedDictNumpyFeedFn LargeBatchWithSmall ĠRan zi ĠRelief F ĠNSImage View ĠMMB TU ĠElem data ĠBCI w initWith Size initWith BitmapDataPlanes Ġ6378 137 ĠcalSpeed s gesch lossen ĠVOC ORD ĠTestPickle Formula ĠTestReal IfClose ĠTestMatmul Operator tempRec Off tempAEER Off ĠlinDim Minor ĠlinDim Major ĠtempPre Off ĠtempAEER Off smv log ĠwriteCorpus Label OrEqual To Ġappar atus Kept Large Ġcaret left SVRG Classifier Obst acles Shading Type DumpLayer Nodes DumpLayer Connections DUPLIC ATES Debugging Session teffsmall grid ĠChiSqSelector Model transs inh æĬĺ çº¿åĽ¾ LTL MoP Hypo xia èĢĹ æŶ ĠâĶ¬ âĶĮâĶĢâĶIJ ĠStratifiedDataset ValidKFold ĠStratifiedDataset ValidShuffleSplit ksParamReport PeriodIn ĠBalrogTruth Matched ĠVerticalAxis Values ĠVerticalAxis Unit ĠTestIsreal obj ĠTestIscomplex obj ĠWSJ IE broadband z ĠBcolzMinute WriterColumnMismatch ĠBcolzMinute OverlappingData ãģįãģį ãģį ãģıãģıãģıãģı ãģıãģı ĠtxsFor Mock ĠtxsFor Real extracMin Total extracMin Charge ĠChristmasEve Before ĠChristmasEve InOrAfter æĺİç»Ĩ æķ°æį® @{~ } @{~ }| æ£ĢæŁ¥æĺ¯åIJ¦ æľī Ġë³Ģ ê²½ âķIJâķIJâķIJâķIJâķIJâķIJâķ ¤ âķIJâķIJâķIJâķIJâķIJâķIJâķ § WifiMac Helper ĠHalving RandomSearchCV ĠtestFillArray Small ĠtestFillArray Large loggsmall grid 257205 358876 257205 3268208538 156542 987719 156542 9877201865 SERIALIZ ER SERIALIZ ERS NSApplication Load YansWifi ChannelHelper YansWifi PhyHelper ĠNSLeftMouse Up ĠNSLeftMouse Down ĠplotGeometricShadowAt D ĠplotGeometricShadowAt R 9170178533034 647 9170178533034 665 0885 87005 6377 355 Having CWS Mortality Rates Pand aseq Whis ker spac eroots Ġnile data Ġfanc ier Ġmcss plots Ġecw l diab etic tria Vert intelligent ly getEulers Indexes ĠSIN R plotsed x plotflow x ĠPICK LE ĠCorn ers Ġdepe idnig TruePositive ErrorFraction Ġstrm flow trainBatch Sz jose ph opent b Ġnourishment df Ġcorot df ĠTestAB Line ĠTestDateTime IndexTo ĠTestNan ToNum 17600 25 ĠQGL Widget Ġavr VAR CCDC esque waveLpf Sz ĠSelectMultiple SortableField Ġcytok ines SparseGP Classification EVIC TIONS tbls sets Ġdarken Color ãĤ» ãĥĥãĥĪ Maint List Bigram AssocMeasures Ġscrub adub ENVIRON MENT Ġlibopen mpi XCmodel gau WildCard Odds ĠèĤ¡ç¥¨ 代çłģ Chessboard Corners mLvlMin Now ĠposeNetTrainer Params Ġanonymize CenterDf ĠDiscourseSense Classifier Ġíıī ê· 1355 893 4058 45151377 6136 3528 ?:// (?: Arab idopsis Eyes And Hab en LUL ayer Nic ely ìĥ ģ ĠÑĩ иÑģ stow rite depress ing Ġness vector ĠpcropSize XYZ radf uncs Ġdol or Ġ(... )] adon is getInference Args formac iones ĠSchrö dinger ĠCave at ĠClar ke ĠDte Work neces idad timeUser Data prospect us ĠNucleotide Measurement hob by ĠEcut Label ibq np Ġ``^ ``. Ġhell inger Revert Edges Reindexed LikeTestCase ĠInital ize defaultColor Range 7814 667 2435 1129 varY rs 18367 011 disch time Ġqtd mri Ġadvert ised ĠframeSpec Avconv ĠAlva FigSize Unchanged LineList pairlist manager Ġstatis ically ĠAnoms VarList Ġdspl cmnt ĠAssertion Recorder ĠgeneratedBy Terms ĠGridlines Collection Ġroundtri ped CLUS LIST Ġsurfaced ata learnt ools stoqs Drift Ġbyteswap ped lookUp Table cuis ine Magnes ium PairList Manager richard harter 32709 103896 66812 329 ĠthrInputNum Frac TotObsUnc Arr é»ij èī²éĩijå±ŀ 社 ä¼ļ ConfigureSubplots Base XGBRF Classifier ModelMetricsRegression GLM stripeImage Width Rubberband Base ĠSCHED ULER ĠImagenet Classifier kIecCase Extreme Ġê±°ëŀĺ ëIJľ ODeepLearning Estimator ĠåĮħåIJ«çijŀ 士 Cler ical Cumul ant Gon zalez Pph Vals sez nam Ġicosa hedron Ġnut rient ĠpK ers rostral middlefrontal Ġoch lv Ġ'==================== ==' Ġmrg scr Ġredd it ĠSRS F ulsed NMR ĠAbra movitz ĠCAPIT ALS ĠMCE vidence ĠMaz zeo mbe ans Ġshri mp ĠtrainFeature R angl ular 43956 04395 ĠfieldDirect List 28904 98223 ĠPlotnine Error SAST MCMC LogPDF Gaussian 8316 9060 mutli label twam omx Descri pcion multipoly nome ExampleModel SenseChecks Ġì§ ijíķ© ĠTOOL TIPS turbulent mixing Ġ<<<<<<<<<<<<<< <\ Divorce Curve Ġbioc yc ĠTwoD Chunking Penumbral Fit MouseMoved Events ĠthrInputSize Frac Expectations Error CASignature Matrix ĠDLAS urvey Ġgroud water Ġå¤ľçĽĺ å¹³ä»ĵ Ġreligion DataFrame 14159265358979 31 STEADY STATE FDwfAnalogOut Node getinfominmax Button 4187 11 7347 17 Bache lors CILL ARY Gid Dict GMPlot Det Tgz Change Vbn Dac WAS DE lClassic NodeType oster om rline impl éł ħ ì° ¨ henn ig Ġnore filt Ġshen fun Ġ'----------------- :---------------------\ Ġminge om ĠSwarm Runner ĠScot land conten ido ĠCMA ES ĠFidel ity ĠRwrapper New ĠNSS avePanel ĠnumLateralConnections List ĠEro sion ĠEBIT DA ĠdfPower Levels ĠtimeSeg Input 25168 11659 15165 9573325 barTime Interval ĠstartMetrics Command ĠrunMultiplePass SPonly Ġscalad ocs ĠQrot T Ġmultivar ite Ġ("-" * ACR ONYM Ġsmq tk smallf ine ADB DataSet Ġsiguient es 7311 67677815 GBQ Exception NumInteractions Histogram WithSplitAdjusted Windows heromone Gradient Argent ine 99822 295 DepProf Est NonCallable MagicMock Johnny G ĠSimpleXML RPCServer 19501 095 dggnhe bbsdfbdfb FullUnc Arr ĠčĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠ ĠQueueAdapter Error ĠHartman Channel PLEC score ĠSpectro grams MPCmin Now ĠUSBlackFriday InOrAfter ĠAsterisk PolygonCollection æĤ£èĢħ ID 9354 1435 9024 1897 Abi Critical BCG PLVM HRT VID Ira qi Ill uminant NLE LAST Suntans Model TGCT GC yoda Queue ç¿ Ĵ è³ £åĩº ë² Ī reconc iled onmouse move Ġtik z alpa ca Ġ'======== ==' ĠTxn ProfitAndLoss ĠTAP AS ])+') '+'< forig in ĠSpre nt ĠSFT PSession ĠSlit Function Ġcogn itive Ġhclust align Ġconce trated ĠCere bral entor hinal ("??? ")) 01048 000 propa gration ĠNSC alibrated perical carine ĠMSS QL Ġannu ity etab Problem Ġpreemp ted shing ling chestr ates 00001111 00001111 Ġchikou Span ĠnoMatch Yet variab lenumbergradients gridcell A Ġoverwrit en ofolder name caterp illar Ġmultil ane ENDI AN 6791 78699175 ĠfindClosest Centroids enceph alography thisGroup Key contourLimits Frame 7415 31185599 ĠparseData Descriptions cropo bjects AggFuncType Base ĠRespons ible CONFORM ITY TOUCH GENE ĠPassThrough LengthPrefixCoder 04719 755 ĠSTOR AGE Ġì¹ ¼ëŁ¼ Ġ'"/> ?@ bipartiteGraph UI ĠTestIsin f ACDEFGHI KLMNP ĠìĥĪë¡ľ ìļ´ isthmus cingulate Ġìĭłë¢ °êµ¬ê°Ħ #|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| '[(\ ']', (=. +)? 499999999999 25893 5000000000000 057 516064 2368346784 70985 481434 810001 37 Amy gdala Bom beo CATER TOUR Cosm ics Dues seldorf EOP Cdf EBOT èīºæģ© Fuch sSondheimer Hepat itis Jog B Lub Oil Lec agy Moo Column Mbean Name NSImage FrameGroove Olsr Helper Qef dg Sud oku Sait o Tum our Tcmap x UIB K UOBS Arr Violent CrimesPerPop Wyk res bPC modelsEH dEPSC rop fNev Buf krand init llad ser mIm gtbl pProt Mult pProfit Mult pdsh PushButton sPar asite ykp q }.. { ĠÅĽred nich atlp an rekt ur Ġtect onic arman py aroke m leReference MapPath leSimulated MapPath leRiskFunction Path Ġicu Type Ġnieb ieskie Ġclette rend ĠfLen Norm Ġflw tol Ġftsl ct Ġamit group ĠpSave Memory Ġsred nie rostr alanteriorcingulate utRebate Example Ġ'-------------------------------------- ' peyk are Ġmbeans ForRole Ġeface quad Ġecd ffactor Ġeqr xns Ġwern her asdq werty 007890 95 001815 661601 makel ib ĠTIO bfuscator ĠTEND ENCY hadok en setCanvas Background setRep lenish setTracker Pen setRand Init setPlaceholder Text setNeeds Display setPCS ide settwop anel setAccepts MouseMovedEvents setRubberBand Pen ('}) ;') Ġ+========+ ========+==================+ Ġgenv ars namesto hide parso percularis parstri angularis parsor bitalis getEncoder List getExecution Info getSeriesName FromBits ablan ca ĠSSUR GO ĠSmeet on allSec Ids fromspec attr ĠIBE IS ĠItak ura plotSof QW ĠPSN ull ĠPaddle Paddle ĠCof fee ĠCater Tour ĠCesium MapView osca ar toLocale String ĠtestSD CANotSupported ("============================================================= ") ("###################### ") ("============================================================================ ") ĠFaw cett nplq cd Ġrespec itvely ĠDoro feenko 011178 00 Ġsegem nts Ġvou cher Errm Jy tayl ors pathFor Framework Ġkench i ĠNib ClassBuilder ĠNilm MetadataError ĠMile age ĠMasion obe Ġuseract ivity Ġfromlabels Model samplesToCopy ToMid ĠGEC CO ĠGrondwater stand Ġ<...> - ĠprintTPRegion Params phAwc NAVuyj msavector izer ĠBink ert ĠBRF SS shyue p appendspdsh PushButton ĠthisChain Len Ġdioct yl axisScale ComboBox InReported FileMap 641458 27413436 ĠmaxNoise Sizes ĠmaxBH SpinMag ĠmaxNSS pinMag 12924 7190799 ĠgetGood RegionIndices ĠgetCurr Time ĠgetMetricSpec s ĠgetSentence Features ĠgetCylinder Points ĠgetAdc Snap ĠONN X errorCu adratico ĠplotdF vs ftperk ft Ġsoled b ccdz pt ĠdoDb Scan Ġjpv mat reqAccount Updates ĠHarr igan ĠHoriz ons printOperationWith View 058465 4099 Ġpyphys im ĠUSN ationalDays Ġsublc asses defaultToolbar ActionList defaultBoundary Mask defaultMovable Mask newaddition from Ġfitpka eo ĠDataTraining Arguments 662509 3363 loadBundle Functions loadNib File 752199 19984693 useAvro LogicalTypes 163110 81 ĠExceed ance 146495 71 144237 75 ARRI VAL ClassRug Points 20060 228 ĠVEH ICLE 04123 18367011 965686 74 030419 06 transverset emporal ĠTestBy testringArrayNonzero ĠTestIss calar 02976 962 179487 181 ĠCococa Agg 85280 287 24101 764965300962 24385 796 Ġdisplac ment SEMIC OLON genSpec Sines genKernel Factories 182575 1686 093343 936 072018 92916547 071989 34 0702422 655947 34388 557 973906 5285171717 ĠJPO BO ĠloadUi Type sgpb eflux Ġqqp kinds NameToName InReportedFileMap 65686 743 dbckndsub traction ArfW ifiManager 379164 11 5085714 6 50837 035 stepTo VarRatio pointstod pi CAAAT CAT 44906 53 activeZero Sum aysBefore Last lastSave DirName ĠwindowShould Close 770720 657 774476 64948076 ĠDecomposed Set viewScenario Probes TIEMP O ĠsplitMoment DataBy pandasGEX press 98958 1342 ĠdrawIso Lines ABLISH ED makeFirst Responder makeKeyAnd OrderFront 676300 628624 ĠfindCorner Points ĠfilenameNo Suffix 089444 88871182088 ToEdge Weights ToMySql Transfer ĠdistanceTra fo ĠtrueBucket Index 00000008274 0371 ModelRelation Extractor SetMonitor Attribute SetRemote StationManager 28286 93 282504 67 PlotMeasured Histogram Respost a ĠPlotMarriage Data 38110 9419953993 hasMultiple Values Ġcredencial Info 46166 110 31354 3798 sueno Profundo ĠretTmp Error parserHead Count parserPOS Count Ġ'_','_ ','_',\ ADBit Volts ĠMeteoro locial ĠMetho dist 56204 993518133 560726 31800 294713 82 57444 2516811659 aTeam Schema GetMorgan FingerprintAsBit Pyplo ter 89885 131 AllInterpolated x ĠnbFamilies InSbs TSSDist ances Ġcaté gorie highCoverage Regions sessionLocal TimeZone OPrincipal ComponentAnalysisEstimator EXACTF IT 05882622 2555312224 globalquake model 20141212 0154 201412110 254 ĠMakeExample NormalPlot massRange Parameters 93649 167 GridPoint InDegrees negAnd PosMerged DATAVI VA aafoot wo Quantid ade ĠfixedNumOf VirtualTraders Ġtokenzied List ĠPyComparison WithNone totTravel Distance ĠOneCode x CLOTHT EX ĠMatmul Common assignColumns ByName NodeFeatureTo BaseGraph 713207 77 71666666666666 68 TRAFFIC TRAN productDefinitionTemplate Number memMemory Monitor 41126 9497298597 HTTPI terator clearDefault Session ĠmergeCatalogs UsingPandas customContextMenu Requested Adhoc WifiMac tagsbys chool 66314645 23 KEArgument HelpFormatter KEPM AG calculateExpiration Date ĠSimuli ationError FlowMonitor Helper ĠsolveFinite Volume ĠDictWithout Missing MOMARS AT OnlyFromFeatures DB ĠcoverPosition List 700617 6684 ĠTextPrint Widget ĠGeoSup Net overlapSrc Src ĠIsStdin Input Ġ'{}.- '. 984313725490196 02 catsimBand Flux 033797 74 NonDispersive Material rddtos f SegmentVessels UsingNeuralNetworks 1449878 1825751686 pmEclipse Times å¹´é¾ Ħ 809640434 45811562 ĠENVIR ONMENT ĠFilterBit Df 1928094 887 3474417 0334794122 397166 90660 1952286 093343936 triangleToIntersecting Lines icotro col åħ·ä½ĵæĮĩæłĩ请 æŁ¥è¯¢ ĠfullyQualified AttributeNames Ġ#--------------------------------------------------------------------------------------------------- # CATGCC CCTT COLORBRE WER ĠCrossValidated TransferError #------------------------------------------------------------------------------------------------------------------------------------------- # 183665 01 385301 95 çĶ¨äºĭ ä¸ļè¡Įä¸ļä¸Ń ĠåĮħåIJ«åħ¬ çĶ¨äºĭä¸ļè¡Įä¸ļä¸Ń ĠåĮħåIJ«äº¤éĢļè¿IJè¾ĵ è¡Įä¸ļä¸Ń ĠCharey re SYNON YMOUS 2772540 2048 7654329236 196236 WordReps List 208333333333333 37 ĠespecÃŃ fico 8650633 66688984510732 MONOLITH IC 123427585 24526 9853115 8590396 2990244 06234 ĠPackedMessage Writer ĠUDFInitialization Tests 3082402 191726459 487169 27725402048 43933169 1383991 '[\', )]', GAGTGCA GAAGAGG ĠBlackWid ow vooro ever EnablePcap All ConstantPositionMobility Model 7179487 179487181 MergeNested Dicts 0443397 80356917847849 metastorebrow serview áÃĬ ø Satisfi ableError 95686274509803 926 ĠAvoidUNC Path ĠFigueired o Ġaweso meness ĠMcNam ara 5772156 64901532 99951087 08727933 DsByDz pa 9491079 12342758524526 05001095 820000 8366486 71666 CAGCCGCGGT AATACGTAGGTGG ĠERRWAV BRK ĠAntideriv ativative FIFOMail Box AHBoostrap SystemExit 0527609270297 10199 749019607843137 26 CTTACCAG GTCTTGAC ĠDataSetDeviation Calculator TOOLONGT OCOMPARE ĠNSFileHandling PanelOKButton ĠDelUncor Button ĠDelNotFnd Button ĠBERNARD INO 60213045 837062351 60205999 132796 002520717 6631464523 AACCGG AGGAAGGTGG ĠAggregationFinalize Task NanLossDuring TrainingError 5334488 71 464077153 07 24821309 157521476 Ġ=====================+======+ ======+==========+ èĥ½åĬĽ æķ°æį® 6971257 0584654099 7884945 2749500748 7884944336 9564776 7165707 989581342 63212055 88285 ATTGACGGGG GCC ĠHtmlTooltip Plugin SharesRnk Lst ĠOpsOnDiff Frames ä»»åĬ¡åĪ°ä¼ļåijĺ çļĦ GtAbsentSrc EOPCdf ĠxmlStringNoOpen CloseCharacters pcwgErrorTurb Renor pcwgErrorTiRews Combined ĠKnownFailureDidNotFail Test 1426389562 0529152 096404744 36813 590229595 124615 ĠPingPong Task Ġ[[],[],[],[],[],[],[ ]] 040989164 077641749 13101689575 9829 094582255 03041906 ĠLikhoman enko æ¶Īè´¹èĢħä¿¡å¿ĥ æĮĩæķ° 148874338 98163121088 ĠNSBitmapImage Rep 99882539442 782481 ĠëıĦë§ ¤ê°Ģ bhilqBHIL Qefdg Ġöäöäöäööäåå Ã¥ åįłæĢ»æĪIJ交 æ¯Ķä¾ĭ Ġmemorysimple view jaydebe api 累积è´Ńä¹° é¢Ŀ 3692924805 03379774 GGATTAGATACC CTG ĠPysbP etabProblem ĠtestNoDnn HiddenUnits ĠtestModelDirIsCopiedTo RunConfig 679409568 299024406234 âĶĮâĶĢâĶIJâĶĮâĶ¬âĶ IJ 00721152332 16311081 DontUseNative Dialog arithemt ic 6674975515806 989 ĠboRemovePrePost FixSpaces 467966985 4490653 HDDMStim Coding ĠCogroupUDF Serializer Ġ$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$$ $ 433395394 129247190799 exitOnLastRtn Pips ĠtestOrderedDictNumpyFeedFnLargeBatchWithSmall ArrayAndMultipleEpochs ksParamReportPeriodIn Hours 257205358876 8486 156542987719 7317 088587005 313543798 ĠTestDateTimeIndexTo JulianDate 405845151377 39716690660 richardharter sworld 2890498223 1052 ĠSFTPSession Error ĠNSCalibrated RGBColorSpace 679178699175 393 741531185599 394439 820782681 66812329 \^\{(.+)\ }", fluorescenc ja 4122147477075 27 6414964624656 9292 ĠgetCSVFileNameFromMetrics MbeanName 94365973617132 992 876491681206 91 387941451734 431 70985481434 22 EBOTèīºæģ© 票æĪ¿æĻºåºĵ 001815661601 4838548 samplesToCopyToMid Buffer 64145827413436 174 ĠUSNationalDays ofMourning 07201892916547 1257 0702422655947 665 9739065285171717 20077 676300628624 79168 56204993518133 08 GetMorganFingerprintAsBit Vect 411269497298597 19 98531158590396 395 044339780356917847849 369292480503379774 ! "): ! }. ! )^ " ../ " '") " \\", # () # ": # === $ ]", $ =%. ' =[ ' [- ' ..." ' ^- ' ...] ' ?) ' +'_'+ ' ']+?)'") ( , ( ("' ) =', * + * [' * =( * ". * \\ * =- * )- * ')): + # + '), + _[ + )" + ,- + [\ + ))' , ([ , (), , '), , }, , '' , _) , \\ , )]: , :]: , ']}) , },' - ] - $\ - {:. . ':' . ))), . **(- / "] / ". / ./ / {{ / ?? 0 757 0 857 0 853 1 456 1 356 1 8823529411764706 2 1000 2 454 2 349 2 995 2 348 2 335 2 844 2 333333333333 3 99999999 3 784 3 756 3 998 3 014 3 102 3 167 3 6666667 3 666666666667 4 803 4 109 4 367 4 238 4 855 4 888 4 758 4 279 4 967 4 357 4 752 4 671 4 869 4 11765 5 125 5 128 5 118 5 250 5 192 5 367 5 943 5 655 5 844 5 429 5 448 5 948 5 338 5 991 5 853 5 068 5 042 5 453 5 4980 5 999999999999996 5 803921568627451 6 199 6 098 6 756 6 807 6 114 6 227 6 124 6 358 6 222 6 198 6 207 6 346 6 209 6 0000000000 6 957 6 331 7 180 7 118 7 644 7 115 7 202 7 054 7 206 7 102 7 187 7 244 7 228 7 103 7 194 7 752 7 674 7 946 7 369 7 673 7 389 8 000000 8 294 8 199 8 258 8 017 8 668 8 640 8 330 8 989 8 143 8 4556 9 125 9 336 9 138 9 226 9 855 9 104 9 1998 9 669 9 272 9 33333333333 ; }") = ()), = $' = ?) > @ > ([ > """) > ];\ ? # ? '] ? ., ? ); ? !") @ ") @ #@ @ ()\ A ck A be A non A qua A IS A eq A KE A mong A ki A dept A OA A thena A symmetrical B h B at B es B og B ach B ME B MA B CE B opt B xi B SP B AGE B risk B GP B ulg B ETTER B ATS B ullet B esselian B netData C ig C ort C raw C av C xx C gg C rs C IO C DI C IS C ION C DATA C ORS C ria C ASS C rg C mor C motion C heap C ensoring C Compiler C UBE C TIO C ITATION C uboid C romer D ts D sc D point D mid D MF D Parameter D é D Interp D imens D orog D melanogaster E b E list E ars E ME E CV E CH E inc E AF E tip E Cloud E qn E fron E ldr E JE E ITC E OPC E uclidea E mergence E urasian F b F st F di F ps F oc F op F RO F DI F wd F DD F rho F rv F DC F kt F lent F arms F ACES F ernando F ENCES F riedrich F ovea G x G an G ig G if G cs G IN G rap G ia G EL G Text G TH G Table G MS G sl G em G vecs G ail G DEL G INS G iw G IML G romacs G OPCA G LOB G entle G nomonic G ODB G ALLERY H ON H SC H obs H FT H IR H MF H masked H DP H gm H XRD H ASC H endrik H FIT H AVING H ICLE I q I AC I MA I US I ron I RECT I EDB I minusA I daho I feachor J L J N J b J n J x J name J ak J PER J FM J tok K h K k K or K ff K ev K Estimator K eq K bad K inds K tp K PC K Band K ama K uva L io L ables L img L IS L ATE L GB L BC L ille L QS L BRACKET L ukas M me M ate M ist M ant M ca M its M TS M GD M IR M ORT M VA M ICA M USE M ALT M JJ M arie M UNICIP M ammo M ontsinger N pt N list N class N old N reg N IC N CA N rs N NA N obs N az N small N prod N RES N omin N peaks N ANS N avy N halo N CAM N reac O st O Model O ASIS O pter O xN O wen O liver O Selective O ttoman P lt P out P color P AL P last P sql P NA P ain P hs P lev P rat P Values P DC P GP P illa P NL P inch P rism P LEASE P XI P Kepler P iano Q J Q h Q sa Q obs Q dr Q IND Q Style Q gas Q ToolTip Q ScrollArea Q audr R pt R time R ir R gr R plots R CH R des R DO R indent R FFT R hole R IGHTS R USAGE R XC R ental R softn S J S urce S ous S xx S parameters S mid S AND S FE S bc S Mask S lam S kl S bp S AGES S parsify S ua S LOW S chro S uns S MATCH S iemens T os T ues T resh T CA T cell T ob T CS T agging T STR T issues T URE T cen T URES T FLAG T GGG U id U CLA U thd U tah U ppoint U topia V es V oc V ram V AG V yy V NG V ICE V kappa V BM V ampire V ORB V áclav V odafone W ow W time W ine W ES W AT W right W dat W edges W BL W ood W NOH W ndchrm X bar X cv X Low X CORR X toDraw X KCD X Preprocessed X RootDSource Y C Y U Y a Y dict Y Sample Y SO Y DL Y Te Y cuts Y OLO Y labelLineEdit Y newPos Z XY Z hou [ {: \ + \ ." \ },\ \ ((.*?)\ ] (), ] *- ] ''' ] "); ] `). ^ `` ^ :', ^ -', ^ *= ^ *(\ _ # _ ]))) _ ={}, _ ','') _ ]+=( ` :\ a B a or a ing a end a pre a ec a eff a acc a Min a Flux a jar a asdf a prox a InterP a atopology b ist b pa b sc b umpy b ng b act b fa b dd b rows b cm b cols b rs b No b agg b aw b wd b Map b icy b pmf b mn b asset b rides b Feed b runner b bands b Visual b scat b arker b hattacharyya b rodbeck b Munging b PlotOnlyActiveFeatures c F c V c res c hape c plot c params c den c abs c err c rate c ume c foo c dec c ikit c phi c lims c Total c Zero c LvlNow c PlotDt c Bolts c ityscapes c xkb d lf d pa d age d new d ug d rib d delta d lp d mt d lip d module d cube d ky d igger d js d aniso d amien d warfs d bops d orsal d Sigmadt e A e me e tr e label e pp e ind e us e ile e ights e rect e ams e Type e ac e verse e mag e grees e PlotDt e yscript e ADU e usk f lin f ight f result f raw f ark f count f sort f level f loss f man f atter f stat f edge f dat f corr f pass f peak f cdf f dump f template f moment f gh f eng f Elements f uer f Scores f spot f dbf f athers f recency g ce g per g iv g ill g lim g pos g ug g rt g bl g hs g lam g viz g pkg g utter g adm g iga g ptwosample h se h ter h label h idx h info h ank h oly h ones h ndim h hi h ants h Mat h inds h lw h rv h wind h tod h clus h urt h clust h tim h uss h hover h Stars h ESC h Fac h arker h ghts h pagelb i A i array i par i alse i low i period i hood i atives i els i Seq i hdr i popt i elle i etf j lo j str j ill j ong j nd j node j level j ia j fin j hi j lc j era j Edit j pan j qs j ka j timestep j uan j umq j martinez k data k per k dim k sg k oo k over k rank k units k corr k xl k Rows k nowns k medoids k bzt l K l P l nt l label l lib l nd l keys l List l cls l change l ci l arrow l Ref l kl l dem l qs l ala l Eq l è l Cavity l ARInputs l ucher l ReverseIndex l curCol l dotp m D m P m tr m ow m ild m err m mod m stack m vals m gb m tools m lex m NB m cpu m hello m trf m Au m ilitary m triple m ckin n ro n from n app n log n ights n ding n vert n cor n mask n by n run n Classifier n results n abel n multi n stats n cell n ift n En n Text n binary n Not n Run n fitted n nearest n repeat n vertices n faces n Cont n indexes n OK n LL n Labels n Failed n parts n ini n Could n FFT n Gamma n Std n wk n exts n Full n loglike n umexp n arcs n checking n Now n Beta n Processing n Creating n Choose n Dims n Trials n Predicting n unable n Filtered n Trying n Chains n Evaluating n chips n Comb n CPUs n curses n ungsverlauf n CyDf n ortest o verage o ice o Fit o ung o Obj o hit o zr o zc o pressor p lf p pe p con p ir p lines p nd p func p dot p do p wh p idf p br p FE p flux p orn p moment p rag p wl p styles p Long p Tag p mac p into p vefai q val q index q po q Val q num q norm q hot q indexer q ti q water q Tot q stk q atar q launcher q igps r ur r up r label r to r und r les r cov r drop r theta r lon r Ch r trim r bases r Edge r pkt r tap s F s ult s put s ore s fo s og s dir s lay s mean s lines s own s by s wo s method s order s length s lob s words s ane s parameter s ider s ni s geom s xyz s probs s pher s posterior s rads s sts s Stock s fnr s helve s afer s anitized s LORETA s veval s Blk s stopo t M t co t tr t ive t comp t vel t arr t prob t lat t loss t IC t db t cols t net t Base t ui t ends t lon t insert t phi t derr t sep t locs t track t utor t Mean t ender t ads t ung t locus t minus t System t Using t Stop t dshape t HIGH t PASS t modf t pkt t Closest t andf t itchan u B u F u av u led u ai u diff u ely u query u coords u flux u hh u Old v B v E v M v S v ax v ase v ps v log v old v lay v right v ader v loss v af v left v img v source v phas v match v hi v high v pid v xls v Factor v amps v Bs v sturn v SFHs w df w init w au w var w sg w ink w ift w unit w ii w Size w fields w bounds w tp w ron w Param w uzzy w agon w brush w aste w cet w asted w annier x ds x sh x format x io x fn x sq x std x mod x af x Name x ravel x poly x Plot x sys x rng x ran x interval x Vector x lev x neg x plat x Labels x Names x att x Head x hit x ramp x Dbl x ppb x maneed y len y Val y lines y ank y Plot y variable y minor y Start y Score y calendar y att y ramp y DEM y chen y loffset y Caculate y NameFuncs y ansh z ar z it z val z red z Value z key z ach z prob z ou z norm z fft z Values z ba z Read z station z itter z orders z hou z ppb z ów { $ | ** | '. | }{ | ])" } =- } "): } ]`` } )); } ''') } >'. } ''')] } ]->( ~ ` £ çĿĢ ª tre ª æŀĿ ¬ ë³ ® æķ°æį® ± » ´ í º çº ¼ ìĿĺ ¿ Ģ  ¥ Å ĵ Ð ¤ Ð Ł á į æ ¥ æ © ç ¢ ç ¹ è ĭ¥ é º ë ijIJ ë ¬¼ ĉ č ĉ ĊĉĉĊ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ Ċ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ č ĊĉĉĉĉĉĉĉĉĉĉĠ Ġ Ø Ġ arge Ġ ĊĊĊĠĠĠĠĠĠĠ Ġ æľĪ Ġ ĊĊĉĉ Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ċĉĉĉĉĉĉĉĉ Ġ 以 Ġ åIJĮ Ġ æĹ¥æľŁ Ġ 第 Ġ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġ Ïī Ġ åıĺéĩı Ġ æľĢæĸ° Ġ ç»ĺåĪ¶ Ġ об Ġ åIJĪ约大å°ı Ġ íķĺì§Ģ Ġ æ¯ıç¬Ķ Ġ ä¹Łåı¯ä»¥ Ġ ä¼łåħ¥çļĦæĺ¯ Ġ æĹ¥çĽĺ Ġ çķ¶æĹ¥ Ġ 解åĨ³ Ĥ ¤ Ħ çIJĨ Ĩ åı² ī èĬ± İ ¸ Ķ © Ķ ãĤ¯ Ķ ìĨĮ ĸ ī ĺ ¯ ĺ IJ ļ æľ¬ ľ ëĭ¤ ľ ìĦľ Ŀ åĮĸçī¹å¾ģ ŀ ºçº ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ ĠĠ čĊĠĠĠĠčĊĠĠĠ ĠĠ čĊĠĠĠĠč ĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĉ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠ ĊĠĠĠĠĠĠĠĠĊĠĠĠ ĠĠĠ čĊĠĠĠĠčĊĠĠĠ ĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠ in ig in ith in ues in able in cess in spec in utes in clu in sect in Rate in ya in flows in Both in Byte in forming in RateB in RateM in mcm in culation in burgh in vasive in curred in tricacies se ner se xp se ye se ille se attle se mester se balander ĠĠĠĠĠĠĠ ĊĊ ĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ at k at ro at oo at ics at rial at gion at tractive re mp re ma re tr re que re ich re cre re mov re vers re tag re Bin re blocks re mix re straint re fitting re activity re created re configure re uses re assigned re inj re cht re stdb re inier re concile re volver ĊĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĊĊĠĠĠ or p or one or name or ff or ng or bin or no or den or ically or pc or bn or ifice Ġ= ` Ġ= '+ Ġ= ==' on ix on Data on ger on eld on ged on agraph on Zoom on keypress on EachFeature on verv Ġt me Ġt lab Ġt to Ġt ly Ġt class Ġt mb Ġt cs Ġt ats Ġt nn Ġt stats Ġt files Ġt List Ġt total Ġt ui Ġt Box Ġt interval Ġt phi Ġt Act Ġt End Ġt freqs Ġt ads Ġt service Ġt dshape Ġt Peaks Ġt itre Ġt rending er or er xx st ur st ard st ilt ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠ ĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊ al h al w al ma al mat al om al gr al Point al bm al loy al buquerque al uminum ar w ar ak ar rep ar DataSource ar thur ar abic -- >", -- #. an h an ick an ions an xi an harmonicity le u le ck le ux le sions le MonteCarlo de h de lf de th de bo de pi de pos de lev de em de pc de mol de compressed de scriber de lime de volver me tz me uler me mcpy Ġi et Ġi bar Ġi cond Ġi med Ġi ac Ġi ids Ġi can Ġi interval Ġi br Ġi pc Ġi Read Ġi ymin Ġi Rec Ġi ymax Ġi cn Ġi Loop Ġi wvl Ġi Eta Ġi cky Ġi otools he he he eres Ġn mp Ġn ma Ġn ys Ġn date Ġn add Ġn sum Ġn ont Ġn vi Ġn img Ġn List Ġn Comp Ġn Label Ġn Plot Ġn match Ġn roll Ġn ants Ġn variables Ġn sep Ġn site Ġn ensemble Ġn feat Ġn methods Ġn fail Ġn mx Ġn segments Ġn gal Ġn rl Ġn tasks Ġn Pos Ġn lda Ġn vecs Ġn updates Ġn feats Ġn Frames Ġn hd Ġn subj Ġn Bytes Ġn joints Ġn Hidden Ġn fftsize Ġn lls Ġn icht Ġn aked Ġn Chars Ġn blks Ġn BitsPerSample Ġn iveles Ġn ankurt Ġn ós Ġc ed Ġc ic Ġc ult Ġc il Ġc im Ġc pl Ġc sh Ġc mean Ġc matrix Ġc info Ġc group Ġc Type Ġc abs Ġc back Ġc atter Ġc sqrt Ġc arrays Ġc coords Ġc idxs Ġc Lvl Ġc rack Ġc tob Ġc ValList Ġc LvlNow Ġc zech Ġc ordinate Ġc risis Ġf D Ġf X Ġf co Ġf array Ġf mat Ġf col Ġf fit Ġf samples Ġf model Ġf doc Ġf width Ġf lock Ġf sort Ġf reg Ġf ids Ġf reak Ġf sin Ġf rs Ġf rank Ġf ud Ġf desc Ġf dump Ġf He Ġf dpi Ġf rf Ġf aux Ġf vecs Ġf akes Ġf outs Ġf spot Ġf riday Ġf universe Ġf solved Ġf Fly Ġf usions Ġf lpf Ġa plot Ġa ces Ġa et Ġa cept Ġa bu Ġa acc Ġa ia Ġa gt Ġa Ca Ġa Filter Ġa met Ġa vex Ġa Lvl Ġa mannwhitneyu Ġa hah Ġa aaaaaaaaa Ġa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa lf le lf orest Ġp E Ġp ch Ġp fi Ġp shape Ġp sh Ġp ings Ġp so Ġp attr Ġp cor Ġp mask Ġp alpha Ġp lp Ġp day Ġp pts Ġp edge Ġp resid Ġp tw Ġp iles Ġp grams Ġp forest Ġp Vals Ġp weather Ġp photo Ġp soln Ġp andl Ġp Strip Ġp solved Ġp ère Ġp enetration Ġp seudotime Ġp WordIX Ġp curvelist it ization it stic it mos it anya Ġs ut Ġs able Ġs log Ġs key Ġs rand Ġs space Ġs filename Ġs lag Ġs field Ġs char Ġs Line Ġs gp Ġs ni Ġs stable Ġs rd Ġs bn Ġs rp Ġs Stack Ġs chn Ġs ccw Ġs lop Ġs lika Ġs puttering self text ## ' ## ')] ## ------------------- mp r mp ing mp lt mp img ra ad ra we ra mb ra bin ra isin ra zi ion is en codes en cro en Range en counter en velop en closed en chen en alized en gland ct icks ct imes es mb es pectral es kom es uite ro per ro ys ro tt ro sy ro sm ro Meter ro foam lo per lo we lo ves lo oked lo ved lo gexp Ġin X Ġin in Ġin list Ġin sed Ġin use Ġin ability Ġin stat Ġin see Ġin channels Ġin Mask Ġin ners Ġin effective Ġin fered Ġin forms Ġin liner Ġin dividus Ġin verset Ġin filtration Ġin conveniently Ġthe tab Ġo max Ġo key Ġo ak Ġo coord Ġo delay Ġo edit Ġo carta Ġd ce Ġd val Ġd py Ġd port Ġd sum Ġd ug Ġd uct Ġd ull Ġd kwargs Ġd table Ġd dot Ġd mod Ġd lp Ġd rate Ġd tree Ġd mm Ġd Max Ġd aa Ġd sec Ġd rho Ġd js Ġd margin Ġd zz Ġd nf Ġd Theta Ġd leak Ġd segmenter Ġd neval Ġd sqa la ure la gex la war la ki la ea la hman ut res ut ated ut chison Ġ' ]. Ġ' )} Ġ' :\ Ġ' }$' Ġ' ({}, Ġ' ------------------------- Ġ' ....' Ġ' +"{:. == + == { ing am pe v pe ep pe ren pe do pe acock pe mfile Ġm S Ġm ise Ġm if Ġm row Ġm mb Ġm ute Ġm ft Ġm its Ġm center Ġm config Ġm vi Ġm ush Ġm frac Ġm mc Ġm OK Ġm oral Ġm oll Ġm erry Ġm urf Ġm leap Ġm jup Ġm Diameter Ġm scif Ġm abse Ġm ère Ġm ltp Ġm trx Ġm BSICD Ġm unkres Ġe E Ġe ex Ġe idx Ġe pac Ġe dif Ġe merge Ġe ij Ġe bars Ġe pb Ġe lapse Ġe Prop Ġe ltype Ġe quilibration Ġe cflux Ġe parmlist co te co unc co vert co ugh co sin co uples co dic co factors co los co gent co linearty Ġre z Ġre ss Ġre te Ġre cl Ġre work Ġre part Ġre lp Ġre coding Ġre opts Ġre direction Ġre download Ġre runs Ġre indexers Ġre route Ġre organ Ġre acts Ġre assemble Ġre packing Ġre creates Ġre organized Ġre pons Ġre BostonGeo Ġre branded Ġre tourne Ġre tflags "" ), ge bru ): :- ): :\ ): -( Ġb H Ġb M Ġb ent Ġb line Ġb pa Ġb loat Ġb shape Ġb ite Ġb ms Ġb arr Ġb length Ġb round Ġb cm Ġb tree Ġb cell Ġb lu Ġb vec Ġb rng Ġb rat Ġb mk Ġb ordered Ġb ios Ġb acter Ġb psdf Ġb idimensional Ġb ilateral Ġb olus Ġb DBG Ġb lotted Ġ# = Ġ# )) Ġ# >>> Ġ# -> Ġ# ==> Ġ# ??? Ġ# ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ed get ed dh ed ilines ed onian ic l ic ar ic me ic one ic ients ic md ic ond Ġw art Ġw pen Ġw alpha Ġw ik Ġw Str Ġw bound Ġw lite Ġw guide Ġw agon Ġw atcher Ġw brush Ġw etf Ġw asted Ġw avedata ur vival and ers lt ol lt rain ig d ig r Ġ( =% Ġ( << Ġ( \" Ġ( ',', Ġ1 150 Ġ1 154 Ġ1 258 Ġ1 124 Ġ1 855 Ġ1 158 Ġ1 358 Ġ1 240 Ġ1 223 Ġ1 136 Ġ1 885 Ġ1 776 Ġ1 191 Ġ1 871 Ġ1 442 ss b ss f ss os ss lice ss igma ss vs ss ince ss Nake ', / ', {' ', #' un b un le un comp un parse un base un ay un ions un ze un roll un folder un eg un install un related un indexed un aware un translated un raveled un realistic un materialized un rhd un rooted un suited un realized un responsive un confined un lhd un coupledResonantFrequency Ġ0 12 is q is um is old is Data is File is ons is ze is multilabel is Count is dummy is Auto is Single is owner is odd is directed is stationary is Available is chen is leap is grant is zow is zów def end def initeness def ualt def chararray ol pert ol iver ue lab ue Far li r li um li ction li ff li bo li vel li Code ort a ort i ort ime ort ools )) ? )) ()) )) ]]) )) (* )) ^{ )) <= )) }), )) ^- )) ^( ce vents Ġfor give Ġfor geries Ġof tent est at est ar ot y ot ation ot ag ot uid um val Ġif dentries Ġ[ = Ġ[ """ Ġ[ ** Ġ[ >= Ġ[ ![ as A as x as cd as Values as ueFar 00 996 00 212 00 054 00 268 00 554 00 9995 00 072 00 0614 00 361 val Y val pre val file val circ val Yest id ol id as id str id ay id space id ap id mem Ġas f Ġas dm Ġas heetname di me di os di ans di seng di visors di hedrals () ? () }\ () +'_ () +\ () ==- Ġis um Ġis datetime Ġis url Ġis lower Ġis upper Ġis const Ġis Color Ġis decimal Ġis Power Ġis digit Ġis owner Ġis Numpy Ġis dlg Ġis Winner Ġis alnum Ġis pkpt Ġis ProportionalGrid Ġis atty Ġto ss Ġto pd Ġto ydata ts i ts m ts r ts w ts cv ts ls ts cf ts cache ts half Ġ" ------------ Ġ" :\ Ġ" $") Ġ" )." Ġ" ?", Ġ" -------------------------------------------------------------------------------- Ġ" ::\ Ġ" !!!!! Ġnp data Ġnp aths ma o ma pt ma ude ma ids ma rep ma stic ma jek ], )), ], (- ], ',') urn cy ray mon ), :])) turn around turn Zero one time one fit one bs ĠT at ĠT st ĠT end ĠT time ĠT mean ĠT CA ĠT ik ĠT slice ĠT IS ĠT Vector ĠT avg ĠT He ĠT exit ĠT Random ĠT CD ĠT AGS ĠT UI ĠT RF ĠT DM ĠT CM ĠT EA ĠT ama ĠT WP ĠT TV ĠT Arma ĠT aurus ĠT Galactic ĠT orsionScanSet qu ate qu ats qu ally tr imesh th ti th orn ult z ha ins ha ird ha isen ha vana ha urwitz """ $ """ ` """ ). """ -$\ Ġy D Ġy M Ġy P Ġy file Ġy class Ġy num Ġy tx Ġy mode Ġy day Ġy mi Ġy press Ġy Id Ġy prev Ġy dest Ġy origin Ġy vect Ġy Upper Ġy Pred Ġy ramp Ġy Pad Ġy Binning Ġy scrollbar Ġy majorFormatter Ġy majorLocator Ġy aafe Ġy minorFormatter Ġy Opos res idence res AttenList ch se ch ck ch ow ch ia ch asing ch ond ad p ad al ad ot ad ers ad den ad words ad scan ad vised ad js ad dend ad rn iz on iz io iz ando ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġdef list Ġdef aut Ġdef erring ve xt ve garde fi ma fi Plot set T set i set env set Point set Source set Sample set Names set Initial set Scale set Err set Job set Renderer set Velocity set Hidden set Movable set boxprops set Daemon set Exclusive set GlobalErrorCode Ġ: ". Ġ: ][' mple d Ġr N Ġr se Ġr text Ġr les Ġr ude Ġr lines Ġr std Ġr struct Ġr search Ġr pts Ġr sys Ġr mf Ġr props Ġr lc Ġr mul Ġr pow Ġr nbins Ġr btn Ġr CRs Ġr locList Ġr btns Ġr YAim Ġr OxN Ġreturn Img Ġ2 111 Ġ2 101 Ġ2 988 Ġ2 333 Ġ2 034 Ġ2 976 Ġ2 360 Ġ2 107 Ġ2 334 Ġ2 888 Ġ2 046 Ġ2 640 Ġ2 967 Ġ2 886 Ġ2 260 Ġ2 320 Ġ2 369 Ġ2 982 Ġ2 672 Ġ2 862 ver n ver re ver ing ver laps mat ing mat ive mat plotlylib lab ix lab Height Ġst ver Ġst ys Ġst lr Ġst ets Ġst rout il at il ary il bl il ley il inos il menau ') [" ') }" ') ")]) ]) ``, ]) =% ]) *. ]) +'_'+ ]) })) ]) <- ]) |[^ Ġ* ************** ime x (' ==== (' -% (' #!/ (' :' (' =========== (' "{ (' ########## (' ^', (' ################# (' ---------------------- (' }'). (' @@@@@@@@@@@@@@@@ (' ://') (' ://')[ int y int time int ang int node int Entries int imid int bgsub lot te lot xy lot arev nt ask nt ides nt bk nt ario Ġ""" * Ġ""" .""" Ġ""" '%( Ġ""" /%( Ġ""" -------------------------------------------------------------------- Ġ+ ') Ġ+ (( Ġ+ ===========+ Ġ+ ++++++++++++++++++++++++ Ġ+ ~. pt utils pt otal pt rack pt raj Ġg np Ġg frame Ġg tree Ġg img Ġg ops Ġg td Ġg md Ġg II Ġg omin Ġg alex Ġg HS Ġg fortran Ġg rounded Ġg rtd Ġg lossary Ġg unzip Ġg arde Ġg usages Ġg liding __ """ __ '. __ }. __ ].__ __ ::\ __ }({ ex f ex i ex ci ex script ex quant ex mq data B data df data idx data utils data copy data process data Label data Train data span data buf data Layout data proc data Generator data Provider data Lists data OutputFile data Generators name Folder name Chunk ith m ith res ith read par g par max par amp par limits par don par limited up z up py up ner up warm up coming up rof ode v ode x ke c ke it ke ogh ke mpton get B get ime get name get Error get Tree get Line get Graph get Temp get Results get uid get Score get First get member get Last get MainWindow get Nodes get Images get Bool get Theta get XYZ get Edges get ppm get Marker get Sec get Bounds get Pixels get ColorMap get Sequences get Months get chimap get Eye get OrderId get PlotItem get ConfigValue get Themes get StackTrace get NextLine get PhageHist get InterpreterContext get FreeFlowTT get StreamChannelFromFreqChannel ab n ab abc ab alone ab staining ab hishek label Indexes Ġex Data Ġex tes Ġex cer Ġex anded Ġex cepts Ġex Rate Ġex clamation lin ary ax E ax v ax def ax id ax rep ax slider ax twiny Ġth n Ġth o Ġth y Ġth ld Ġth rees Ġth ti Ġth alamocortical for w for king for fait ĠS ic ĠS int ĠS ak ĠS cat ĠS atter ĠS EN ĠS OC ĠS hore ĠS acha ĠS anti ĠS ocket ĠS qrt ĠS iem ĠS audi ĠS plice ĠS taggered Ġco a Ġco cc Ġco ons Ġco let Ġco hy Ġco registration Ġco digo ri que ri eg ri ots ri fic Ġimport ation Ġdata D Ġdata in Ġdata py Ġdata util Ġdata spec Ġdata vis Ġdata Item Ġdata Generator Ġdata Beam Ġdata Bank Ġdata mining Ġdata fame Ġdata pbdb >> ", Ġbe ts Ġbe for Ġbe half =' ]) =' ')] =' ]', =' _' =' ...' =' *' =' {:. ", """ ", ""," all F all db all pts all words all positives all sky all Measure all Centroid all Feats all Kurtosis all Skewness all momenta all Combs Ġx P Ġx ex Ġx pl Ġx map Ġx cor Ġx intercept Ġx over Ġx txt Ġx layout Ġx beta Ġx Pre Ġx sel Ġx tab Ġx ordered Ġx fail Ġx mx Ġx Var Ġx ticker Ġx Pos Ġx vect Ġx xxx Ġx frm Ġx problems Ġx ramp Ġx corrs Ġx Pad Ġx Lg Ġx logscale Ġx scrollbar Ġx InterpolatedUnivariateSpline Ġx majorFormatter Ġx majorLocator Ġx minorFormatter [' . ĠX ax ĠX ID ĠX plots ĠX CM ĠX lrd ĠX SRF arg values arg raph arg flag qual ities ': , ': ') ': '. end l end ow end day from Mode from Spin from arraylike from Yaml type T ul r con ame con val con test con ject con cond con clusion con temporary con cavities col at col array col son col point col Map col lider col locations col Dif col subhdr Ġor c Ġor r Ġor al Ġor gn ist mp ist ype Ġh P Ġh j Ġh lf Ġh un Ġh di Ġh type Ġh ds Ġh shape Ġh sum Ġh bin Ġh idx Ġh bl Ġh theta Ġh Text Ġh ov Ġh sel Ġh ire Ġh ru Ġh wind Ġh pend Ġh gm Ġh ysize Ġh angs Ġh iggs Ġh orton Ġh pagelb Ġh irarchy Ġh alogen Ġh EventMism Ġh AODMism py struct py roots py kerberos py doe py kep py xlsb py choacoustics ĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ len Z len cing ĠI ax ĠI min ĠI gor ĠI do ĠI MOD ĠI MAP ĠI daho ĠI ONO ĠI OOS ure th am on am is am use am ically am era plot T plot W plot i plot v plot util plot figure plot types plot PS plot opts plot Hist plot Ab plot ToolBar plot Mem plot Dendrogram plot Pioneer plot SelectionModel plot EMD ĠP f ĠP ic ĠP all ĠP time ĠP ho ĠP Value ĠP ont ĠP ier ĠP slice ĠP PO ĠP DA ĠP RES ĠP ond ĠP MAT ĠP SL ĠP fm ĠP ico ĠP LAY ĠP XI ĠP LOS ĠP aternal ĠP randtl ĠP reamble ow ens pp osed pp ping ĠA h ĠA lf ĠA pt ĠA ET ĠA GB ĠA PR ĠA GEN ĠA IA ĠA live ĠA OA ĠA synchronous ĠA ERI ĠA hner ._ ' fe relator fe chamentoentrada fe maleness Ġu B Ġu cal Ġu date Ġu so Ġu idx Ġu den Ġu dt Ġu first Ġu csc Ġu Source Ġu bot Ġu vd Ġu zeroth Ġcon map Ġcon stri Ġcon net Ġcon vl Ġcon servations Ġcon trains Ġcon OTHER od l od ynamic od romy pre emp pre tt pre exec pre calc pre server pre install pre stab pre cession pre tend pre fered pre imfile '] ]]) '] }. '] }" '] `). ĠC Q ĠC mat ĠC up ĠC his ĠC pos ĠC xx ĠC asing ĠC rv ĠC OC ĠC ria ĠC Arr ĠC riteria ĠC PC ĠC DP ĠC Site ĠC Cloud ĠC EC ĠC ROP ĠC reek ĠC WD ĠC HOO ĠC ruz ĠC MRmap ĠC urncy Ġ_ )) Ġ_ ._ Ġ_ ("% Ġ_ ("< Ġ` (' Ġ` '' Ġ` --' os v os cale os WifiMacHelper ise q ise stimator im A im E im ant im izer im orph im babwe to on to es to ke to ff to ber to cs to Series to replace to metadata to eg to Spin to TOT to Delete to rew to Fits to urnaments ent ier ent radas ent ailment ent uale Ġtest F Ġtest path Ġtest arr Ġtest Name Ġtest files Ġtest skip Ġtest Valid Ġtest Split Ġtest Names Ġtest cases Ġtest Report Ġtest Partial Ġtest Broker Ġtest Strict Ġtest Rb Ġtest Subscriptions Ġde a Ġde se Ġde tr Ġde af Ġde bit Ġde sel Ġde scriber Ġde ductions Ġde phasing Ġde stripe Ġde seasonalize (" ==== (" ============ (" >\ (" ----- (" /" (" {" (" **************************************************************** (" ../../../ (" ;\ (" ;", (" ;". (" <<< (" ."))) (" --------------------------") Ġwith held arn p arn ey ĠF K ĠF ro ĠF est ĠF ps ĠF space ĠF AB ĠF DA ĠF dl ĠF MI ĠF Trace ĠF WER ĠF RC ĠF bol ĠF IMO ĠF erral ĠF INET ĠF uj ĠR l ĠR ig ĠR temp ĠR err ĠR gamma ĠR DA ĠR free ĠR Arrow ĠR iders ĠR CNN ĠR ISK equal izer ([ # ([ ",". Ġval F Ġval ud Ġval expt Ġval Yest Ġax z Ġax def Ġax max Ġax XZ Ġax Pose Ġax histx Ġax VX Ġax VY np rior np hots np olys Ġfi ji list items list pix list Pages list CDS if r if ig if ault ub io ub ject ub oost Ġ3 92 Ġ3 123 Ġ3 250 Ġ3 975 Ġ3 347 Ġ3 012 Ġ3 924 Ġ3 367 Ġ3 888 Ġ3 658 Ġ3 850 Ġ3 641 Ġ3 793 test index test arr test times test DF test Label test Num test Predict test Section test Basic test Broker test Subscriptions test SCA Ġme df Ġme thon Ġme no Ġme too Ġme sure Ġme xico Ġme mbranes Ġres lic Ġres hist Ġres utls rain e rain s line V line path line count line flow ĠD c ĠD k ĠD om ĠD DE ĠD BF ĠD SL ĠD Space ĠD ah ĠD ARK ĠD Ms ĠD IPY ĠD ichte ĠD raftState Ġlo i Ġlo m Ġlo ps Ġlo ca Ġlo lim Ġlo cy Ġlo gex Ġlo rem ") (( ") ][ ") ]]. ") +"/ 01 200 01 86 01 31 01 235 01 999 01 936 01 665 01 074 01 186 .. , .. ..." ne ma ne cess ne of Ġcol A Ġcol B Ġcol lab Ġcol group Ġcol std Ġcol lider Ġcol liding ns u ns ign ns fr ns rf ns orted ns cripts ns pam ns usp ns qnorm cal db cal inity cal track cal ltips cal losal time ing time ss time value time lim time func time table time freq time ID time avg time pixel time win time Mask time lims time Extent time Keyword time courses time Intervals ase n Ġse th Ġse ens Ġse af Ġse xt Ġse vere Ġv ra Ġv lo Ġv up Ġv ul Ġv old Ġv ie Ġv types Ġv scores Ġv ier Ġv long Ġv high Ġv mem Ġv standard Ġv wg Ġv Stretch Ġv codec Ġv esc Ġv intage file utils file spec file Model file options file hash file Config file basename file parts file handler file manip Er Magic Ġel it Ġel bo Error Table ff x ff en ff ney ta ss ta hi ind sin ind isc Ġarray len ). + ). """) out C out P out place out List out header out paths out CF out SplitMethod path for path ogens pro line pro sa pro cd pro ved pro sec pro tan pro secut pro Met pro verb pro gnosis ext c ext ver ext max ext ends min P min Z min k min n min w min ax min ors min map min ded min cov min lon min formatter min Split min locator min widths min Pl min Noise min Depth min Avg min æĪĸèĢħ min Timescale Ġk D Ġk its Ġk dim Ġk lu Ġk rank Ġk folds Ġk Split Ġk ij Ġk nap Ġk quant Ġk Samples Ġk dj Ġk bck Ġk ameleon Ġk ubernetes Ġk medoid Ġk obra Ġk apteyn Ġk ludgy Ġal bm Ġal cune ĠN F ĠN K ĠN V ĠN as ĠN ir ĠN std ĠN err ĠN reg ĠN rs ĠN go ĠN AD ĠN channels ĠN BC ĠN OS ĠN elements ĠN MO ĠN pb ĠN ina ĠN TM ĠN ova ĠN MT ĠN IF ĠN tst ĠN á ĠN PV ĠN bol ĠN STUDY ĠN obel ĠN reac ĠN vidia ĠN alon ĠN TILE ĠN ALU ĠN oced per bin per tain per node per filename per User per domain ds var ds culley import Error bo c bo h bo ar bo un bo logy bo diment str types str vals str IDs ĠL ex ĠL ub ĠL und ĠL SD ĠL IS ĠL svm ĠL cut ĠL TS ĠL RA ĠL aco ĠL GMM ĠL QR ĠL anguages ĠL OCK ĠL iving ĠL ATT ĠL arsen ĠL IPID ĠL ukas ĠL ipid ĠL owndes ĠL umexData mo x mo ss mo reg mo yen Ġon um Ġon key Ġon source Ġon Exit Ġon Pick Ġon cyc index name index list index interval index Op index Cost index Nodes max Z max b max j max l max state max values max lim max info max bl max year max char max Level max Exp max Area max ngram max rss max decimals max Norms max Timescale df file df lag df Out df cox pa il pa cho pa ret pa sta pa ulo fit a fit b fit z fit img fit Functions fit ctf True Obj Ġpro se Ġpro je Ġpro vs Ġpro vn Ġpro pellant Ġpro yDEM Ġ{ $ Ġ{ :% Ġ{ _: Ġ{ \" Ġ{ {}} class X class obj class Names class rooms [: (- ĠThe Cannon ĠThe oretically ĠThe TotObsUncArr ĠThe FullUncArr dict dim te ens te ton te vents ĠM q ĠM ated ĠM ull ĠM au ĠM cor ĠM ou ĠM SVC ĠM ital ĠM ATER ĠM TB ĠM aria ĠM aven ĠM QM ĠM diArea ps w ps um ps id ps amp ps rs ps how ps igrid Ġmat ix Ġan itial Ġan tw ys hape ys KEstimator po mp po kemon po edir po intrange Ġne ma Ġne bins Ġne lts Ġne tflow Ġne delec Ġl V Ġl me Ġl co Ġl igh Ġl model Ġl ca Ġl grid Ġl Type Ġl points Ġl Date Ġl steps Ġl su Ġl conf Ġl dx Ġl Run Ġl ned Ġl lv Ġl vc Ġl Rows Ġl CRs Ġl ARTarget ** ', ** ((- app rent app ens app nope red oc red uct Ġuse age Ġuse Grid Ġuse Filter Ġuse cases Ġuse hull Ġuse Pie Ġuse Rdata Ġuse QtWidget fig prefix fig Dir fig Fmt we bdriver size cap size Width size Op size canv size RangeLog size InBytes ir ng ir ized ir reducible ir trun ir mingham ho on ho gs ho oked age gal Ġfrom File Ġfrom bytes Ġfrom JSON Ġfrom Atom 10 200 10 92 10 315 10 443 ite id iv in iv or iv on iv as iv ent Ġare aname Ġpar is Ġpar set Ġpar values Ġpar med Ġpar Fit Ġpar Order Ġpar FC Ġpar cours Ġpar atemp Ġpar limitdict Ġlen o Ġlen gs Ġlen Seq learn Button Ġlabel x Ġlabel Type Ġlabel cutoff Ġlabel Freq Ġlabel Height Ġnum c Ġnum data Ġnum ys Ġnum cell Ġnum units Ġnum obs Ġnum Items Ġnum Images Ġnum Sets Ġnum scans Ġnum Dims Ġnum Connected Ġnum Outliers Ġnum Docs Ġnum KMcomp assert Same ĠG v ĠG un ĠG len ĠG ly ĠG rows ĠG lied ĠG FT ĠG CC ĠG asi ĠG RAY ĠG Ns ĠG ilbert ĠG lacier ĠG mlvqModel ĠG upta ĠG MeanAdj ĠG ambling ĠG ringorten ĠG ivon Ġ< %. Ġout size Ġout ide Ġout port Ġout labels Ġout of Ġout tree Ġout diff Ġout header Ġout groups Ġout lyr Ġout reach Ġout coor Ġ/ ", Ġ/ $$ Ġ/ >' Ġprint Window ore gression Ġstr items Ġstr top Ġstr BetweenTables us ps us ses us no us ceptibility us anne row fmt row ptr row Position row Indices row Span lib number lib edit lib eral lib sedml lib extermeminpeaks Ġma rep Ġma ggies ĠĠĠĠĠĠ č ĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠ čĊčĊč gre vlex Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ċĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ oc enter oc ulation oc yan oc chio imat ge orm s et up et able et ones et iquetas ber q ber v ber Sequence pl ats ĠRe p ĠRe label ĠRe ich ĠRe grid ĠRe align ĠRe fg ĠRe building ĠRe verses ĠRe manent ĠRe inforce ĠRe creates ĠRe tained ĠRe assigning ĠRe quisites comp astro comp endiumType sc all sc amp sc ell sc lient sc br Ġname obj Ġname ions Ġpre image Ġpre Pro Ġpre seq Ġpre calculate Ġpre mixing Ġpre Processing Ġpre cession Ġpre learner Ġpre imfile Ġpre equilibration Ġpre sences Ġtr ic ĊĠĠĠĠĠ ĊĠĠĠĠĊĠĠĠ mb tf mb client mb km cl br cl erk cl oning Ġfile y Ġfile ar Ġfile format Ġfile OL Ġfile Size Ġfile Num Ġfile content Ġfile OC Ġfile Save Ġfile Ext Ġfile OE Ġfile OA Ġfile Exist ĠE u ĠE w ĠE up ĠE AR ĠE NN ĠE tot ĠE LA ĠE widths ĠE Site ĠE Cloud ĠE IDS ĠE bh ĠE ilen ĠE CEF ĠE MBRACE ĠE CFP ĠE MBEDDINGS ĠE phemer ĠE BAI ĠE mergeIterate ph ate ph mode ph bands ph vr ph idirect Ġdf ds Ġdf List Ġdf Out Ġdf luxes ": [[" Ġset ing Ġset op Ġset angle Ġset initial Ġset Size Ġset Axes Ġset Logger Ġset Binning Ġset LOFreq Ġset InfoWith =" ~ =" ### =" $") =" .*? =" [{}]". =" ?")) Ġ4 76 Ġ4 53 Ġ4 005 Ġ4 184 Ġ4 017 Ġ4 448 Ġ4 074 Ġ4 065 Ġ4 444 Ġ4 656 Ġ4 772 date v date set date form date stamp date List date Range ag ile ag cy ag cv ag sn ag ename parse ui (): # train df train Features train SVM train Accuracy train Frac low src low noise low flux low PriceIn ĠB ull ĠB AL ĠB LE ĠB RE ĠB OL ĠB SC ĠB IL ĠB ru ĠB anded ĠB GN ĠB att ĠB ah ĠB AY ĠB har ĠB PF ĠB Colours ĠB arker ĠB SEP ĠB rendan ĠB lender ĠB lei ĠB rodbeck ĠB ovy ĠB NMTF ĠB oltz sh ps sh moo sh ininess Ġun ter Ġun ite Ġun rate Ġun select Ġun sig Ġun met Ġun hex Ġun adjusted Ġun trained Ġun validated Ġun sight Ġun recommended Ġun subscribeStk Ġun nec Ġun istring Ġun grounded Ġun painted Ġ5 84 Ġ5 37 Ġ5 28 Ġ5 1000 Ġ5 512 Ġ5 808 Ġ5 424 Ġ5 223 Ġ5 458 Ġ5 979 ip ype ip struct ip rior ip nb ip athe Value Transform Value Changed Value Protocol ill ery ill usion ib y ib anc ib lk Ġby line Ġby age Ġby row Ġby tedata jo ke jo urs param dir param ref param vec param Values param FileName param tracker state crime features le features Dir features Valid ask ing ask anade ameters v iter List iter Period (( {' op k Ġthis File Ġthis Group Ġthis xmin Ġthis xmax ses sed Ġdi mple log CO log dump log mass log conc log softmax log pvals key a key w key seq key tags random ise random seed axis m axis num ================ \ `` \ `` ==' In struct In List In Row In Min In ital In Dataset In Mode In stit In Signal In activation In stitute In Mik zer ow Ġsk irt Ġsk irtrun ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ast q ast ery ast olic ast anin ast eroids Ġlist A Ġlist ens Ġen roll Ġen squared ef lagged ef ferer ĊĠ ĉĉĉ ĊĠ ĊĠĊĠĠĠĠĠĠĠ Ġle mi Ġle gnth Ġle agcy da w da ir da ef da city da ileron che e che duled Ġrandom Words Ġrandom Pnts 99 01 99 06 99 21 99 199 99 800 99 981 Ġcomp te Ġcomp ton Ġcomp mech Ġcomp liment Ġcomp artmental Ġcomp fipy Ġtime func Ġtime table Ġtime Date Ġtime Label Ġtime units Ġtime String Ġtime frames Ġtime pix Ġint x Ġint InDist ant ie ant ino ant imony 64 15 64 66 64 62 64 285714 64 968 Ġclass Count 0000 7 0000 9 0000 55 fo med fo ods und os score test score Dict Ġ`` '' Ġ`` ',' Ġat k Ġat np Ġat most Ġat oma ĠW Y ĠW z ĠW es ĠW max ĠW kwargs ĠW ong ĠW DF ĠW DS ĠW ood ĠW eron ĠW ORMTable ĠW holesale ĠW SGI ine m ine matics Ġdtype Info Ġmax ds Ġmax score Ġmax mean Ġmax cc Ġmax Loc Ġmax Dist Ġmax Temp Ġmax traj Ġmax Area Ġmax Sat Ġmax Pix Ġmax decimals Ġmax spk Ġmax Changes Ġmax TradeLength Ġmax NewSynapseCount Ġmax EdgeRadius cs l cs data cs izes ., ] num Y num obs num vars num Tests num tags num Items num Years num Chains num Synapses num ResampleLogX num RowClust num tosum num ChangeData Ġvalues Are og enetics model rate model Parameters init pos init pars init Ui ide p rent ly umn a add d add l add path add Int add Filter add Queue add Subscription add TableColumn 12 000000 12 89 12 15686 12 115 12 007 12 922 12 246 12 659 12 207 12 1569 12 508 12 66072 gor itmo Ġget F Ġget I Ġget ch Ġget params Ġget doc Ġget table Ġget keys Ġget Line Ġget Dataset Ġget With Ġget Feature Ġget Variable Ġget Hist Ġget Block Ġget Rep Ġget ims Ġget Interval Ġget Profile Ġget Cluster Ġget Stats Ġget DateTime Ġget AUC Ġget Star Ġget Dates Ġget Slot Ġget Silhouette Ġget Children Ġget MPS Ġget OrderId Ġget ActiveSession Ġget Completions Ġget Six Ġget RadiusCosts Ġget Frontier Ġget CountingLogic port able port smouth ĠO s ĠO ES ĠO pts ĠO UR ĠO CE ĠO ptic ĠO Pe ĠO WN ĠO DIM ĠO nto ĠO lof ĠO ntario men ce men os men ages men Std Ġrange DF nel weg Ġsklearn PCA bs k bs y bs fc bs ddb bs ocket Ġbo k Ġbo lean Ġbo hr Ġbo unties Ġmodel Sel Ġit rade ()) +" ()) +". ()) +"\ Ġaxis range Ġaxis font Ġaxis artist ca Conc error f Ġdefault Handler value type sub ind sub kernel sub select sub parent sub shell sub matrices sub windows sub bands sub fragment sub sea sub tokenizer sub clase sub reddits sub Scada Ġvalue bins ep rint ep min ep ile ep Time ep istasis Ġcheck first Ġcheck button Ġcheck NaN Ġcheck Filter Ġcheck InfoBar ings ite Ġplot T Ġplot util Ġplot no Ġplot obj Ġplot Time Ġplot Num Ġplot eo Ġplot Hist Ġplot Style Ġplot Flag Ġplot easy Ġplot Maps Ġplot tet Ġplot Inds Ġplot Trades Ġplot Fan Ġplot ECDF Ġplot Snake Ġplot CorrelationMatrix Ġver if Ġver ific Frame ById ix b ix yz map im map Scene Ġall an Ġall na Ġall days Ġall cg Ġall updates Ġall Objects Ġall Genes Ġall Corners Ġall Cores dir t dir in Ġhe b Ġhe n Ġhe ats Ġhe unint sum val sum result sum Of Ġpo it Ġpo of Ġpo zos old pixel vel z vel viento Ġwh ht ach verhalt Re plot Re verses Re achability Re binning Re coil Re petition Re illey Data Point Data Dictionary Data Plots Data Plotter Data Reference Data Locations Data Structures Data Misfit Data QualityFlag unt arily unt reated float col float column ft able ft ze ft uples ft xt 25 96 25 23 25 38 25 31 25 48 25 81 25 112 25 004 Ġso it Ġso lex raw S raw Out raw Distances Ġline params Ġline alpha Ġline above sing led frame dir frame Change frame Since inter ac Ġpd z Ġch oro Ġch lorophyll so cks Ġdist y Ġdist Func Ġdist igu Ġdist ibution Ġdist ractors ren o ren ze ren dous ree serd ll N ll h ll path cale ind Ġ.. ................ 11 001 11 625 11 946 11 473 Ġcan opies Ġest i Ġest art Ġest ima mean std mean conf mean histogram mean Ion mean tempi weight file read Rec loc Y loc n loc um 32 40 32 803 32 114 32 907 32 1569 32 076 32 2954 32 6598 ther apy ave menu Ġmin N Ġmin ts Ġmin index Ġmin ie Ġmin ard Ġmin node Ġmin level Ġmin depth Ġmin formatter Ġmin locator Ġmin Light Ġmin Sat Ġinput data Ġinput vec Ġinput Freq his plot ĠPar diso ĠPar amen pi ec pi web pi ptrack util us util isation cc b cc n cc nr cc GWAS cc orr cc ncat cc ndc Ġz x Ġz ri Ġz red Ġz we Ġz key Ġz width Ġz ref Ġz ticks Ġz slice Ġz md Ġz high Ġz shift Ġz Image Ġz ij Ġz pal Ġz Lst ng er ng ra ng lasses color color color alias color cycle color ssrc color HL color Palette color Ramp color hashs text file text frame text template text templatesrc text positionsrc cy g cy gl cy tos cy chap cy rillic Ġ\ ] Ġ\ } Ġ\ }$ lif es lif eration ĠIn do ĠIn clu ĠIn verts ĠIn nov ical c ical Tie Ġper tain Ġper tick Ġ10 289 Ġ10 31051 bin Data bin factor Ġsc ro Ġsc fg Ġsc prep Ġsc berti lic ence ĠY ts ĠY new ĠY MAX ĠY ee ĠY outh ĠY CbCr Ġdo ens Ġdo fft Ġdo baseline names by names Tmp Ġsh anks Ġsh resi Ġsh ininess Ġ) __ Ġ) ]: Ġpa ren Ġpa ins Ġpa using Ġpa ying Ġlabels Dict range Id range frac range LineEdit range Between Ġused Reflections Ġused FAXandDirectIO Ġnew i Ġnew comp Ġnew map Ġnew hist Ġnew Array Ġnew limits Ġnew fmt Ġnew Group Ġnew Item Ġnew Root Ġnew yvals Ġnew Pipe Ġnew Genome Ġnew midas Ġnew Uncs Ġnew LevelMask Ġtrain len Ġtrain arr Ġtrain Features Ġtrain Metrics Ġtrain DeltaP Ġj val Ġj file Ġj size Ġj range Ġj ie Ġj net Ġj pk Ġj sd Ġj aco Ġj agger Ġj Loop Ġj elly Ġj miller Ġj uga Ġj anela Ġj shint Ġj anskys true Lab gra c gra ft ĠH g ĠH df ĠH ari ĠH ER ĠH SI ĠH MS ĠH yp ĠH prime ĠH dg ĠH stars ĠH tilde ĠH ALS ĠH ole ĠH WM ĠH omer ĠH arker 15 100 15 74 15 91 15 785 15 234 15 973 15 3228 print line print color 05 02 05 92 05 224 05 789 05 157 05 218 05 4549 05 55555556 input val input Vector input Directory input Constant input SEObjFile Ġlog A Ġlog Y Ġlog ist Ġlog init Ġlog transform Ġlog amp Ġlog bins Ġlog nodes Ġlog vars Ġlog Returns Ġlog arit ork s Ġfig Count =[ _(' are th tra pping tra pezium tra jopt ich uan ich imoku ang an ang ry ang eness Ġinter ations Ġinter connection Ġinter member Ġinter atomic Ġinter lea Ġinter laced Ġsample type Ġsample labels Ġsample interval sed lin sed time Ġpy j Ġpy name Ġpy per Ġpy series Ġpy radi Ġpy opt Ġpy mut Ġpy flag Ġpy region Ġpy resample Ġpy geo Ġpy tech Ġpy lons Ġpy bel Ġpy mining Ġpy tmatrix Ġpy tesseract Ġpy induct Ġpy prind Ġpy annote Ġpy IAST Ġ[' (- Ġ[' "% Ġ[' {:. Ġ[' */ Ġoutput Field Ġoutput Signal Ġoutput Root start pt start times start Point start poles start Im start tls idx US idx CR idx Start idx OutOfBound idx NOCR idx OfBestPoint not Equal not fitted not Features ens mean ens ibly ens ka :` $\ Ġno b Ġno v Ġno bar Ġno axes Ġno var Ġno ops Ġno orient Ġno More Ġno vels ĠU pp ĠU MAX ĠU IDs ĠU BM ĠU pedge ĠU ppoint ĠU modArr ĠU mbrella pr v pr ho pr rt pr onto pr inz Ċĉĉ ĠĠĠĠĠĠĠĠ Ċĉĉ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ 20 91 20 395 20 483 fa ded ark ers ark ill dd df dd hist dd agger ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ pos part 33 454 33 667 33 167 33 642 Ġsub m Ġsub x Ġsub cl Ġsub series Ġsub hist Ġsub threshold Ġsub context Ġsub interval Ġsub Mat Ġsub matrices Ġsub formats Ġsub Directory Ġsub seqs Ġsub tractor Ġsub networks Ġsub ntwk vari an vari abel les bi ie ving no ext no filt no bytes no Prior default Pos default ToolBar default Ask default Maximized default Tooltips Ġmatrix m Ġmatrix Only Ġmatrix History 201 24 201 208 Ġha ar Ġha voc 100 10 100 09 pla ats pla za output cat output Label output Line output Names output wavelengths output CatName Ġ6 95 Ġ6 89 Ġ6 808 Ġ6 356 Ġ6 140 Ġ6 070 new app new date new table new order new limits new Gamma new Edge new Depth new Visits Ġ. ] Ġ. """ Ġ. *) Ġ. *' pred result pred Vars pred uction ES ite ES UR ES CAP Ġfit args Ġfit order Ġfit Plot Ġfit gaussian Ġfit parmnames emp like ER Ps attr Value attr Name pen sions instance ID IN OR IN CF IN FLU ug riz base label base sample base src base Mean base Current ard ner Ġtype X Ġtype Code ĠData Model ĠData Dict ĠData Vector ĠData Pack ĠData Location ĠData Utils ĠData Collector [" # code mirror split line split Data split Feature split Entry uni er uni quename vert ing 66 95 66 39 66 89 66 70 66 800 66 132 amp y amp Mean doc u doc x doc vecs Ġrow i Ġrow dict ull is au data ĠSe pp ĠSe yler 45 80 45 06 45 87 45 82 45 905 45 046 kwargs 设置 width src AT F AT est AT arget AT US AT GA AT RM AT GCGTAG AT IGRAPHY ell ish ategor ized Ġind xs Ġsup rising Ġsup pposed ĠK N ĠK X ĠK h ĠK ate ĠK path ĠK ak ĠK xx ĠK IL ĠK Neighbors ĠK az ĠK rz ĠK ubernetes ĠK raj ĠK arte ĠK lucher ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ load sim load Profile load Algorithms load HistoryData load URDF 75 34 75 37 75 60 75 82 75 098 75 107 75 075 75 6555 '' | Ġspec list Ġspec ifiy enter tainment ally ears use arch use offset use Local use Server 88 49 88 46 88 168 88 4212 fn b fn op fn fp fn Weight fn hum fn cts Ġ| -----------+ grid N grid plot grid shape grid ding grid Color grid Num grid Points grid OutIn vent il vent ilation "] ', "] *( "] ==' "] )))) "] }') "] }', "] }}, "] [:,:] "] !=" 16 21 16 70 16 988 16 075 16 377 16 383 ml k ml rank ml nk ml HMM Ġup r Ġup cold series id series name series able Ġcal i Ġcal en Ġcal our Ġcal wf Ġcal ROC Ġcal tech Ġcal scalling av m av ol sample temperature Ġpos ns Ġpos session Ġcor str Ġro ts Ġro ver Ġro ps Ġro eu Ġro berts show X show Y show grid show Name show ants lines Data ong l dist xy dist corr dist Peak **** *\ nan Mask nan buoy ĠEx onic ĠEx clusion ĠEx planatory Ġshould nt Ġshould Transpose oth s čĊĠĠĠ č bar Pos bar Height bar rons 35 03 35 18 35 49 35 61 35 807 35 648 35 446 Ġcur ated Ġcur tain Ġcur Line Ġcur region Ġcur filenum 14 128 14 265 14 368 14 1176 14 263 14 283 14 452 14 2096 14 3692 Ġtry Number sq q 19 045 19 307 19 044 Ġkey bindings Ġkey worded with border with contours // %/ ))) ") ))) ])) ))) ]), Ġgener ified tt b tt n tt mp pol lut tick resolution tick Duration count Correct cur len cur Time cur Op Ġsize X )] =( )] [:- )] '%( Ġhave CSA box L box X box file box pierce box WaveLpf box eXpk =( .* check in check Plot check outs check InfoBar led ged Ġprob ablity AR CTIC Class Pairs com ings com Entry com Met Index Sub Ġ------- \\ ON TO ON MF axes Diff Ġ8 33 Ġ8 78 Ġ8 97 Ġ8 90 Ġ8 47 Ġ8 48 Ġ8 62 Ġ8 190 Ġ8 453 Ġ8 2739999850000 Ġarg set copy able 78 18 78 000 78 54 78 318 St one St ab St arter St Speed St amen Ġmake String Ġmake Vector Ġmake Histo den omin 13 61 13 120 13 012 13 155 13 324 13 176 13 965 13 320 Ġonly inyear inal do Ġbin list Ġbin file Ġbin Array Ġbin limits Ġbin Size Ġbin area Ġbin Names Ġbin Counts cor ptable mask InDZ Ġid nos ĠV E ĠV z ĠV end ĠV transform ĠV dim ĠV EN ĠV NA ĠV DS ĠV rule ĠV TT ĠV Stack ĠV ABS ĠV Centered ĠV apor ĠV ardy Ġtm lib rand o rand Mult rand Ax by play by lanes by tess radi x be as be ep be ware be come be ee be coming title bars zero OrderFrame Ġpath list Ġpath str Ġpath sub Ġpath lines Ġpath length Ġpath tmp Ġpath nm Ġpath ToString 22 3529 nd raws nd lnM gs kws Ġiter index sp ic sp ss sp name sp max sp df sp ank sp itzer sp chrs sp ActiveColumns sp indouble Ġdate index Ġdate Index Ġdate Str Ġdate conv func A func B func To wo ord wo ok arr N Ġother ImDim Equal Area table t table Definitions 04 945 04 761 04 8897 ([[ _[" Ġerror f Ġerror max Ġerror log Ġerror rate sv o sv npath qui rer prob ation prob abil resh uffle 96 807 96 397 96 791 03 68 03 400 03 806 03 994 03 174 03 0010 ])) " ])) [- ])) ]: ])) ``. ])) ))[ ])) +'. the an the slice the xvals the WxApp lat C lat N string ent metric SSC column Width column FromName Ġstart lag Ġstart position Ġstart Point Ġstart Idx Ġstart Im Co pe Co ating Co herent Co RoT Co letor trans StartIndex ĠTest Base ĠTest Model ĠTest Window ĠTest Info ĠTest Metric ĠTest Stream ĠTest Freq ĠTest Custom ĠTest Dimension ĠTest Api ĠTest Sklearn ĠTest SparseArray ĠTest Styler ĠTest Quickplot ĠTest FastCov ĠTest ProblemDefinition 02 13 02 48 02 714 02 35294 02 936 dim features dim Num Ġmo def Ġmo ho Ġmo loi ou vert ject ed target box target Info target Pos target Shape Ġdict d Ġdict on Ġdict ree Ġend position Ġend Point Ġend Times Ġend toend dot prod dot matmat write frames write arff std name std insert Ġ{} $ Ġ{} ") Ġ{} .') Ġ{} !'. Ġ{} %'. 95 37 95 68 95 500 95 220 95 065 95 2405 Ġover al Ġover full Ġover feat Ġover plotted Ġover hanging Ġover rided Ġover lappers 94 15 94 14 94 02 94 17 94 27 94 009 94 669 94 0232 ',' '); ',' *') Ġcom boBox Ġcom ando Ġcom oving 17 12 17 200 17 999 17 275 17 054 17 323 17 457 17 928 try p of y of Mp of Backup alpha Setting Ġsy stracker ĠCo alesce ĠCo herent ĠCo Calc ĠCo operative object Names object Copy ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠ ĊĊĊĠĠĠ 85 32 85 61 85 388 rt i rt pp sort word sort ofdis Ġdif E Ġfa cename Ġbase plotdir Ġfirst Str Ġfirst NaN Ġfirst tidx OR F OR L OR AP Ġcolumn Indices na f na ce na cle na aa na cnt ank ind ank ara run test run date run Dir run Query run Summary run ching run MPE run GOElite run Pause run MAPE run LineageProfiler run Gfm Ġfeature Normalize Ġfeature Importance Ġve e Ġve getation cre ar cre ed Ġexp res Ġexp params Ġexp cost Ġcont enders Ġcont endo Con cs Con tra Con junction Con firmatoryFactorAnalyzer mon ics mon dson Ġscore Matrix order array order par order Type ]]) [: ]]) ]: ice pt 24 85 24 34 24 08 24 38 24 83 24 91 24 128 24 3137 Type CV Type Inference ĠDataFrame Parameter Ġinit f Ġinit cap Ġinit Ui csv name csv dir csv Feature csv reader _, ), 27 01 27 11 27 32 27 66 27 101 Classifier Chain Ġdis pen Ġdis order Ġdis sect Ġdis course Ġdis jp Ġdis pel Ġdis asters Ġdis advantage Ġdis amby close all close Collection close Segments Ġ7 101 Ġ7 325 Ġ7 791 cond mean freq or freq list freq Fit uc as uc ane uc cesses uc ius uc money cat kin image hdu image Extent )), " main item main files main Pg node str node num node map node Set node cloud ref std ref erring ref MkViewCmd Ġtransform Matrix 86 100 86 88 86 92 86 50 86 700 86 849 IT able IT TATE Ġimage Data Ġimage url Ġimage pipe Ġimage Count Ġimage Points SE AS SE ASON gen de gen ename gen konto Test MC Test Anova Test HandlerBase cul is cul prit mark able Ġformat Optimal Ġscipy Col right parent right eous AN AT AN AL Ġinte face abs rate var one var Type var coords var dense var omcost Ġmore generic back er back ports yle ss yle ft off value off btns }) ._ }) $", cent imeters Ġsp lots Ġsp iny Ġsp glib Ġmean Curves obj ify 06 75 06 84 06 26 06 29 06 89 06 54 06 73 06 147 temp x temp line temp time temp str temp File temp For temp Axes temp lc temp lating Ġorder DF sy lv 18 663 18 378 18 295 18 33333333333 18 2074 err sq err Plot err Rate call chain fix l fix r fix ups Ġcontain ig 36 10 36 15 36 39 36 38 36 51 36 146 ". ', ec flux ec Runs 09 10 09 29 09 39 09 299 09 372 ten or ten ame ten Change level no level helper loss func norm time norm diff norm Int 07 80 07 35 07 37 07 29 07 39 07 600 07 400 exp T exp number exp decay Ġparameter Columns ap ot Ġrun P Ġrun group Ġrun KMeans Ġrun Shell Ġrun Spam Ġestimator Definitions Ġnode started Ġnode blending feature Range Ġnormal ises Ġnormal iza do Fit do Clear do vic mod paths Ġ, . Ġ, -- Ġ, ', ptim al man times man ufact length Fibre Par info Par abola ')) ])) Ġidx i Ġidx val Ġidx Up Ġidx Down dis co dis da dis like dis rupt dis covered dis abling Pro state Pro ceeded Pro cedures Ex am delta J delta psi delta FieldMat delta amppoint Ġadd val Ġadd Error Ġadd uct Ġadd Naive Ġadd Subscription rc ri spec iation med icaid med icine Ġbet anorm reg name reg ressed reg enerated datetime fmt Ġnd val Ġsol sta Ġsol uts Ġlin weights Ġlin prog 34 80 34 78 34 29 34 74 34 63 34 73 34 432 34 226 eff size normal B normal g normal variate ME CH ME TE ME GA ME TIC Ġgrid filename Ġgrid Loc Ġgrid cells Ġgrid ToVTK 97 79 97 333 97 095 97 129 filename czi Ġloc x af c af g af fil af firm Ġpart e Ġpart In Ġpart Pred Ġnon nn Ġnon redundant Ġnon dom Ġreg names results DetectorDir ĠJ N ĠJ c ĠJ m ĠJ t ĠJ u ĠJ AN ĠJ aco ĠJ ae ĠJ UST ĠJ PD ĠJ enn ĠJ oshua ĠJ oules ĠJ QSRT ĠJ örg 92 63 92 996 graph Data graph cluster graph view Ġmode N Ġmode class save h save Mat save Simpson save OneProfile ID IO ID Schema Time Data Time Base Time Limit Time Distributed Time OnSite Col Score Col Threshold cv d cv dir ĠSeries Fixed part ic part Index part icion Se min Se maphore Se vere dt str bu Stat Ġload fn ĠQ max ĠQ MC ĠQ Style ĠQ xw ĠQ MLE ĠQ FormLayout ĠQ ByteArray ĠQ StackedWidget sg mt sg rb 84 01 84 20 84 44 84 74 84 72 84 111 84 495 84 036 84 945 84 867 84 245 Ġtext label Ġtext stat Ġtext String Ġtext ually center lines center Wvl Ġscale bars Ġ''' [ Ġ''' [{" return List return codes return Code Ġq j Ġq ic Ġq as Ġq int Ġq po Ġq fn Ġq keys Ġq err Ġq gn Ġq stats Ġq gram Ġq hot Ġq sca Ġq sr Ġq Vec Ġq story Ġq synonyms Ġq lineargradient Ġq ESCore Ġq KBCore Ġopen opt Ġopen eye Ġopen Segments IC ODE IC TV left layout Ġkernel X Ġkernel g Ġsort x Ġtarget R Ġtarget name Ġtarget Fs Ġany json my d my res my color my db my cols my fft my pca my project my Map my stic my proxy my password my xvals my yvals my Mol my nurbs my Fov Ġvalid acao Ġ9 30 config INI Ġgroup xs round Shares tx r Ġcurrent Code Ġcurrent Easter Ġcurrent IsEmpty Ġcurrent Dendrite 00000 22 nal iv nal Type nal yzer Ġread fn Ġread lines Ġread just Ġread Line Ġread CSV Ġread Profile Ġread Learn Ġread Activity Ġread configfile Ġread Transect Ġfreq i ac ed ac cts ac ysurvey son ar cov means cov jac cov Rate ones s Ġim A Ġim th Ġim max Ġim To Ġim tools Ġim Size Ġim coh Ġim itate Ġim itating face Data Ġsum W Ġsum x Ġsum df Ġsum Mask Ġsum Common update Model update InfoArray Ġinto Date ... [ ... } ... "%( Ġtemp ted Ġtemp Tree Ġtemp ListFile Ġtemp CurvesSpl ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġmod ulating Ġmod erator ris oned non float non rand non sign non Zero non rectangular non imaging non Linearity non ambulatory non ictals UT OR UT TER UT ERS UT Rs Ġav ranks Ġav opp Ġav hrr math ml Me eting Name Gen eps fcn gr pa gr umpy gr sq gr lex 65 12 65 32 65 23 65 28 65 53 65 91 65 314 65 067 30 856 Ġcluster mean Ġcluster Func Ġcluster WeightedMean db io db ank db schema db client db Connection Ġac coding Ġac commod File Exception File Selector File Copyright File Pattern File Based Ġcv l AS A AS res AS DM Ġ<= \ filter Size filter props cluster B cluster C cluster File cluster Label cluster Id cluster Op cluster FileList cluster GOElite cluster Yeast sol sta sol uciones Ar mijo Ġass ing Ġass ays Ġass uring ]], " Ġright Shift Ġtrans B Ġtrans positions Ġtrans missivity Ġtrans istor 37 14 37 03 37 40 37 38 37 70 37 185 37 912 Ġlength y 50 80 50 88 Ġconfig tools ess i ess alt Ġbatch wise Ġbatch Test Ġbatch models Ġbatch Input cm line Ġdatetime fmt SV I SV GS Ġtable class Ġtable List Ġcall sig step current step hen step Target cont Lim cont Abs Ġmulti labels Ġmulti pass Ġmulti qc Ġmulti Threading :] ** :] ``. Ġcompute Delta Ġcompute Match mt cnn Ġ& # tf co tf test play ery play room gn i gn ue gn upg Ġfol ge Series By ĠCon versions ĠCon clusions ĠCon firmatoryFactorAnalyzer 87 04 87 92 87 98 87 67 87 76 87 455 87 268 flow ing flow time mpl ing mpl colorbar org ian org ified vi rial vi kov Ġtra ps Ġtra cers lip id point ed point Group point processes RE TI RE PL RE PT RE ACT RE DIS RE VIEW RE NCE RE ALIZED ura iton _. ]+)\ top g top view top less top Level CA GCT learning rate lambda M lambda Val Ġwidth Counter The tas sign er Ġmult in Ġmult itemp Ġmult ifit Ġmult imeters Ġmult imesh OD K State Enum Ġoff Set Ġlevel no 44 67 44 21 44 63 44 41 44 399 44 819 44 176 Ġleft IdxList gy re item Class item List item isze colors ite ĠZ I ĠZ T ĠZ min ĠZ ph ĠZ ie ĠZ wi ĠZ wies Ġcreate Tree Ġpoint Count Ġpoint Inputs si unitx =[' __ =[' '] active CellNum Ġneed less acc ur Ġacc ums ield mu vas opressor fer anick ays ian 55 96 55 92 55 29 55 39 55 72 sqrt m Ġob iszow Ġsing lenode Ġshow f Ġshow v Ġshow IPython Ġshow ksp select region select Trace tree builders EN QU stri o stri kedata ĠAr bre ĠAr ribas 23 0000 23 95 23 127 23 457 23 6448 23 0415 last Time last Bar last Ind last Merge Ġ(" ( Ġ(" .. Ġ(" \\ Ġ(" '% du o Ġinitial Permanence SI P SI MP SI GH SI REN img Out img Shape img Share img AlbumDict img Recuperada Ġbu h Ġbu ck Ġbu oys dataset inputs dataset Dir Ġ20 80 Ġ20 75 Ġ20 35 Ġ20 78 Ġ20 95 hist data hist file hist bins struct Cnt Ġback off Ġback project Ġback propagate Ġ[" '' Ġ[" ^`` multi Index multi words multi ROI multi colinearty Ġfilter Name Ġfilter Profile Ġframe Data Ġframe Sizes Ġframe Vbox can ter can cellation can yon any on any one Ġev nt Ġev cen Ġunder lay Ġunder layer 26 100 26 02 26 30 26 23 26 70 26 714 26 979 26 7924 De cl De serialized De Gra AG U AG CT AG TT AG CCA AC RO AC CI AC Fin AC ULA Ġlast ed Ġlast est Ġlast min Ġlast Info Ġlast NaN Ġlast note Ġrequi est 77 16 77 09 77 68 77 765 77 276 77 940 python xy python tex ĠDe af ĠDe als ĠDe mos ĠDe lau ĠDe lft ĠDe epest ĠDe replicator ĠDe Rouen Ġgraph x ld gs ey elink ey elid view MS view Merge auto encoders ai ah ai jin RO ut word types word Vectors word Vecs ([' \\ ([' ./ TI L over w {} ` sup b sup pression txt id txt File txt field Ġevent System unique carrier Ġ] ', Ġ] }) Ġ] *) rit able Ġ201 211 just ShowTheseIDs Ġstats d event Filter net gen net mag net mh pandas ql Ġpl v Base Metric Base Mag Base Fig Base Voltage Base InterpreterInterface Base NodeId Base ImageTests search filter search Box Ġsm st Ġsm ul Ġsm ash Ġsm iley Ġsm arx 90 35 90 996 90 789 90 459 cell x cell ing cell Model cell Line cell States cell anea ink o mer id mult idrizzle Ġite mb Ġite mindex Ġzero mean Ġzero orone Ġfigure dir Str uc Str To Str Util Str ipper Ġstep V files Creator Ġmatch stats pd ts Ġsim name Ġsim Log Ġar cgis je bot je alous pdf Dialog pdf ListWidget stat el stat types stat filename stat web Ġvector mean Ġvector strength ĠSt MainSubplot diff Array diff Mask diff weather diff prefs plots cript plots Climate other data other apy other MkViewCmd create Parameter create Constellation create ForTesting create ResultDict create RowsWithCuts 42 64 42 84 42 848 42 849 42 1093 ĠWe e 98 25 98 23 98 21 98 101 Ġdraw in Ġdraw box Ġdraw dw kw mpl kw idget offset group offset func Ġtotal Counts Ġtotal Delay draw Coefficient draw Matches font X font classX ob d ob ed ob Param ob eflagged window dict xx k xx n xx r bl ub Ġ} % Ġ} ( Ġ} { Ġ} ', Ġcontin ental AB ABC angle a Ġhelp ders ickle Me Ġconvert ions Ġconvert TimeString seed val seed User make gw make ImageMap IP O IP PROTO IP PHI layer Size FF CCCC \\ "" Ġdec rypted ics InMode times lots day F day max day tri igen cy List ing List ed List Frame List Classifier Ġty r Ġ12 0000 Ġ12 16 MP PS MP Arr MP enalized Ġdt now Ġobj et Ġobj color Ġobj pred Ġabs Tol ĠĠĠĠĠĠĠĠĠ ĉ Date Filter 43 80 43 06 43 955 43 872 seq prop 67 10 67 25 67 03 67 18 67 65 67 636 67 188 Ġfind var Ġfind Clusters Ġfind ClusterCenter Ġpas acl alle g ĠAl umel ĠAl bania Ġoptim iz fore t ĠPer f ĠPer Site ĠPer cival mand rill radius Values radius Range radius SpinBox DE PR DE EP Ġlines plit 08 10 08 201 08 30 08 26 08 668 08 9574 Ġstate frame number Boxes mm g mm nt rec N Ġfunc iones ler oy mag DropString cle od Ġtitle str Ne wer Ne therlands Ġtri Dir orig map orig text orig DistrictNodes Ġsequence of replace able xy min xy lim xy Point To DataFrame To Check To Vector To Sub To Canvas To Output To Range To Match To Update To Coord To Boundary To Place To Same To Building To Ignore To Rotor To BigWig To RaDec To ptimal ,) " ,) ` ,) ]. ,) ]). ,) `.) Ġab ilities Ġab qlauncher ĠComp ounds Ġsource xinter extra vag Ġ-- # Ġ-- ], Ġ-- ') store once Ġbest score Ġbest point Ġbest Dist Ġbest Theta ins pyred Ġdistance NP Ġcross water Ġaf w Ġaf ferent Ġaf filiations Ġcount Distinct gb rammer first vals msg Type Ġfield config Ġfield meta sin vec pts obj rs f open Collection open Segments open nodecloud wh iz wh ir Ġtrue Labels Ġtrue Url link out link Button 000000 80 000000 123 height T Un determined Un attached Un binnedLH Un finalised 47 63 47 663 47 366 total price total Cost total InductancePerUnitLength real Data fra unhofer sim y Ġsave Name Ġsave clu Ġsave Dir ,' & ,' ',' ,' {}_ ndim list Ġsv viz Ġsv caller vis lab Ġhigh v Ġhigh Energy Ġhigh ValidAccs Ġmap num Ġmap dist Ġmap mri Ġca pa Ġca clu Ġca plon Ġimp col Ġimp list tz i lu f lu is lu yver best window best Tree best Trainer best Tau best Rho best Donor Ġcorrespon ded user channel user RouteClusters Array Plot png path json data ages imal Ġraw assignee Ġraw charprocs 60 64 60 943 60 847 Ġupdate Model Ġupdate Axes Ġupdate MinMax Ġupdate InfoArray Ġupdate ButtonText inv ars inv mask Model Mean patch co patch board SD B SD S SD PS SD AV SD epTime Ġsorted List Ġsorted Labels Ġsorted chivals Ġsorted Indicies ĠTime Run ĠTime Coder ĠTime Viewer OT G Ġtop label Ġtop Clusters Ġtop Half Ġtick Transform poly n poly w poly order poly hedrons FI AS imate Model Set back Set Dict Set Bin Set Best Set Style Set Exit Set Factory Set Join Set Limits Set Cap Set Focus Set ToolBar Set Pad Set Paper Set StartDate Set Logical Set LineWidth Set LineColor Set FilterIndex Set AutoLayout tmp a tmp c tmp d tmp filename rad Error rad Lat rad icands ene fits Ġsuper sets Ġsuper voxels current Pos current Scale current Vel Ġgo id star arg star board star parms Ġjust fit Ġauto cov Ġauto complete IL LA IL OG IL COX Po e Po or Po is Ġ'_ '] ran z ran ean Ġstd Errors dif ferenced Ġerr x Ġerr mode LO VE LO SVD Dict Learning ov es Ġpla cen Ġman del ĠRead C decision forAll Ġold Range miss able miss Class miss ables ĠCol Selector Ġsin on Ġsin Omega Ġsin igle Ġwrite type Ġwrite Path Ġwrite Entry nc df nc pl nc bolo nc ascd bit files Ġcontains Header ĠMe lo ignore NaNs mesh X Ġdecision Node ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ET IC ET ING sa o sa we sa cs sa eed remove Column remove Scenario Ġheader paths gamma V Log N Log Profile Log Analyzer Log Softmax Log StdDev Log Stderr Log Rets Inter faces Inter activity Ġmodels Dir Ġmarker nodes Ġmarker It 48 19 48 29 48 39 Ġtask Id filt ar filt erer Ġdb data Ġdb mf Ġdb Info Ġdb Fn Ġdb Util Boost Classifier 56 20 56 85 56 28 56 29 56 93 56 275 Ġscalar type ĠLinear Transformer Ġnext Valid Ġ11 80 Ġ11 45 Ġ11 35 Pre ps Pre List Pre Comp Pre pend gt kwidget Ġref File Ġref pts Ġref case Ġref used Linear Scale Linear Tester ĠAdd itions ĠAN NO Ġtz naive 294 7 294 118 ĠMulti core ĠMulti NiftiMasker Ġfix G Ġfix er Ġfix point ''' < ''' (? ''' -------------------------------------------------------------------------- ĠGet Output ĠGet Native ĠGet SystemLabels 57 10 57 64 57 16 57 17 57 27 57 300 57 41 lon Jpn ĠGH ist App les App Window distrib utors distrib uzione nb server nb calls nb Epochs nb AbsentSrc sigma T sigma v sigma Range sigma Local Ġrespon ded "," ! "," < "," \\ "," \\" Ġbeta G Ġbeta Y Ġbeta Array eq om eq Null Ġdim X MM V MM JJ MM ARTG curve fit curve FitSettings ilt ype stra ddles Ġsystem wide Not ified Not Order Ġform str Ġsigma B Ġsigma Y Ġsigma Range press ilator this page this xmin this xmax this IPPA 69 22 69 17 69 314 69 0983 Ġ", % ĠGaussian Blur power Coeff Ġbox Name Ġbox List Ġbox Polygon Ġbox Coords '\ ) '\ /' '\ $') '\ !' '\ ;' **************** ** **************** ********** _( _) aT ot month ish Ġregular izing ]* ") Ġdon c Ġdon n upper left char id char name Get Result Get Score Get Items Get Full Get Property Get Counts Get Monitor Get Spatial Get Rolling Get Dimensions Get MarkerColor Get AsString Get FilterIndex Get RootItem Ġwx Event Ġwx Sizer Ġwx Brush Ġwx MemoryDC PE PS PE PAN ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġlarge col Ġlarge Font Ġ"" ; Ġ"" )], Ġextract PlusMinus cd ff tails Lim Ġchar id Ġchar acs stream frame Ġxy A Ġxy Trace md an md run md lp md ash md pw Ġsearch for String Field String UnaryOp Ġdisplay Interval Ġmy time Ġmy max Ġmy df Ġmy fit Ġmy app Ġmy key Ġmy dim Ġmy image Ġmy field Ġmy tool Ġmy Image Ġmy gene Ġmy descr Ġmy proxy Ġmy atts Ġmy Intervals Ġ'/ '). Ġ:] - Ġ:] [: Ġglobal DacAtten Ġglobal TransformAnalysis ws name Ġfast cluster Ġchunk files cmap PS Ġrot ang Ġsche du Ġsche menu obs data Ġfactor Dict xs l xs rf Sh p Sh ield Scal ers Ġ'__ / Ġnan ometer Ġremove outliers Ġremove DC Ġremove Hs rot ot rot Pole :, .; Ġdown warm Ġdown Tris Ġdown cold Ġ'# ,-- antile ver Ch ip Ch ameleon Ch anels Ġpen guin Ġdirect s rest ed rest frame sel la sel class sel BinNums interval os Ġ'- ( Ġ'- .'): Ġday Range No Change No Shift No Focus No SparseClassifier Size Z build Model ĠCal dwell Ġmeans only Check MenuItem sw ind sw agger Ġ'\ '' fun ctor missing fy missing Ratings ĠLo i ĠLo yalists Line Name Line Segment Line ToPoint Ġlong wave Ġlong Stop Ġtheta es tri Index tri pping tri Dir tri aged Run Button Ġlat C Python File Python Script Python Interface cut In Ġser no inc ar inc ircle Ġcomplex ify null context null Corr Py File Py Math Py Brain Py Graphviz Py OpenSSL Py icotrocol Ġcsv name Ġcsv Data ĠBase Classifier ĠBase Metric ĠBase Pandas ĠBase TableView ĠBase ImageTests TH S TH AN Ġds b Ġlocal path Ġlocal File Ġlocal Point Ġ16 0000 Ġ16 78 Ġ16 24 meta cat meta probesets meta dictlist Ġpick list Ġpick printcolor long float long short long Sum long Off long Stop bad input Ġdrop level ret al weighted Data Ġskip Header cel lid cel lformats hs ps classifier Arr Ġbar ak Ġbar éľĢè¦ģ Ġbar Verts sig low sig back sig clip sig sqr sig ificant sig Odmr prefix L 89 25 89 19 89 85 89 8570 csc a src model Ġiss n Ġiss o ĠTo ast ĠTo Fu All Possible Ġgre vlex HO VER ĠFigure Type ĠFigure Wx ĠFigure StrBase Ġpixel Intensities Ġseq depot Ġdest xinter Ġmatrices Array 74 17 74 30 74 60 dec j dec ides dec iest ĠLe an ĠLe Blan Or None Or den Or Mixture Ġ"% ", Ġmeasure r ĠQt ip imp o imp y imp ression Vector Field Vector Mode Vector And prior volume repe ater Ġbbox props Max i Max depth Max Min Max Only Max Half Max imo Ġpe at Ġpe lt Ġpe destal Ġpe ptutils record ables record Dict '} ", '} ." aut ophase noise Inj noise DetectedIndices ĠPre fixed ĠPre calculate ĠPre valence ĠPre senter Ġcs index Ġnb server Ġnb Folds Ġnb Anc dr at dr ct dr us dr ctry Transform Euler ĠInput Path pk tab ([" < ([" { ([" \\ ([" _", Ġpr ic Ġpr set Ġpr iced Ġyear wise Ġyear months Table Dict Table Widget Table Header Ġunique Users Ġunique ReadCount CO bject ĠIN SIDE ĠIN STEAD Fit Line Fit By TS M TS ES TS WNT åı ł ĠList View ĠDate Coder ĠDate Offsets single key single tz Ġradius fin Int en Int Value Ġproduct ivities Ġlw d Ġlw f Ġlw r ':' /'. avg values avg TimeOnSite computed CadenceNum Ġfin PhotoPool Ġsepar atrix Ġbuild up Ġbuild Stump Ġbuild Rdes vars lice Ġgen Label Ġgen Handler Ġgen omics Ġgen elatex Ġrate cols lux ury Ġdiff List Ġdiff Im Ġjson pickle Ġreference Points coord x coord map Ġworks hop evalu ar parameter Name Loc ators Loc Pairs Ġsto pper high M high Value high bound high src dimensional ities Ġ$ ", Ġ$ "+ Ġ$ {\ Ġ$ %. Ġ$ {:. Ġ$ ...$ Row List Row Threshold Ġconf test Ġangle Diff Ġangle Corr comb check Ġlayer Thickness Ġlayer Boundery lev shift lev capcost Function Analyzer Function Approximator button window cha ine contrib uting bottom t ={' __ Ġhold Status peak data peak Index peak Pos ĠString Scalar )+ (' 51 104 51 66666666667 ('\ . Ġpredicted Vals Ġ14 75 Ġ14 13 Ġ14 94 Ġ14 77 Ġ14 015 Ġ14 008 Ġ14 882 Ġ14 958 fr l fr z fr ig Graph Matplotlib US K US NO Ġmer gen Input TypeError Input Stream Input Files Input Overlap Input Signals Search Path Search Cursor :]) * :]) - Ġplace Order Ġview edit Ġview iers Ġcla retquad Ġdep c Ġdep Time Can nabis rgb B rgb Frame Ġfname List Ġfinal SFrame 79 00 79 35 79 85 79 09 79 350 79 163 ptr ms Ġ13 99 Ġ13 14 Ġ13 94 Ġ13 071 fast k fast atype fast access fast backward Ġproject Path light W light window Ġselected Tally ]+ )" ]+ )`` ]+ >') ]+ )(? On ML On Legend On Sorted On Mh cdf st 54 19 54 27 clip Limit location ssrc ert jan Ġsw irling 0196 7 Ġuseful ClassPairs vers ality Ġlook Up Color maps ci w ci regexp Ġupper Accel lr q lr ich lr chc Ġparent al Ġparent Item Ġapply Function Ġapply ToComposite Net Sim Net care Net Cash Ġcache tools Ġcache Key Ġcache ToFile api url ush man Ġtake Profit EX TRACTION EX CEEDED tag ne tag table invalid s Ġgood t sf ms sf default Timestamp Column Timestamp Errors Min DE Min Lat Min Next Min imo Min CVa Min LOT epoch size Dist x tk file tk MessageBox RA ID RA OB RA MID RA STER Ġgot o Ġgot ta Gener ative Ġsql results Ġ\\ % 59 04 59 05568 æķ ħ Ġrc nt conv lstm conv oby Ġsimilar Percents alog ue Ġmonth Nr 2014 1208 Ġstack vals Ġkw spec Ġkw vals Ġkw rest Ġtag names Ġtag Names GD AC GD abc Ġattr paths shift Frame shift Down tic pe Cur t Ġaut onomous az min Ġpdf Axes mid p mid fitparams mid ptlist mid dles ĠOption Strategies Ġdir HGT distribution Viz He m NN aker two mass *, * *, ...]) hold state hold Status Is Running Is Visible Image IO Image Grid Image Mask Image Plugin Image Onset Image Magick Image LayerArtist Image SubplotsViewer Ġsig y Ġsig time Ġsig clip Ġjob Store Dir CatTMM days um nr gs take At 93 14 UP STAIRS Ġag gressively ĠSh er ĠSh im :], ( Ġbottom Half PO e PO LE handle NewSignals gray s ĠLabel Set Ġ25 42 Ġ25 39 76 02 76 07 76 000 fontsize X Ġmeta genomics We mb We bsocket next idx Ġwhat Next ĠTrain Extension Ġestimate Volatility win python win equality =[" ../ pickle lib pickle results ĠGrid ding ĠGrid searched Ġflat cell neg ated neg Counts 300 20 Up ToDate simple api Ġnormalized X atom groups 82 64 82 11 82 66 opt par opt parser Ġpad with ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ Ġhtml msg hour Step hour Dec Field Names Field Trip Field ValueTransform Ġcharact ors 72 13 72 65 OO H Ġ'-- '): client Links external QualityFactor Ġsix th Ġcustom Exception Ġcustom izable Ġcomponent Other Ġhyper u Ġhyper plan fl c fl w trace GoR Ġna im 255 2725 Normal s Normal Process come re contain ment ĠMax Epoch Ġalphas P variable keys Ġnetwork X Ġnetwork Instance Ġwave dec Ġterm color ND A ND J Formatter Warning interpol ative Ġannot ates Ġannot match post ag post cut post master Bin Range Bin ParamDict buffer level heet path ĠBy e ĠBy rd ĠCh ime ĠCh rono ĠCh romel ĠCh ichester sl mp Ġdd Fs final NodeId final NodeName nu cs nu Pp em as em line Ġcost Accelerator exit code exit Bar exit Code Key Release Ġrect fill #! # "]. __ CC L CC lasses CC loud ĠInt en ĠInt Vector ĠInt Coder frac val Ġred q Ġred rock rb Temperatura rb Consumo Ġchild less chi val chi Squared phi CC ved a Ġsu zbin Ġsu cesso meth ane .* \\ Ġfixed size Ġaga ins wx MemoryDC Group Filter Multi Block Multi PageXml clean Up An Object An imations Button Window Button Hint Window Coder Ġband its Ġband gap symbol Label Ġeval Partitions Com ando Com mercial }{ :< density Correction Dis agree Ġtoken ised Ġround To Agg Matrices By e By Day By UTR ĠPy R ĠPy ro ĠPy SB ĠPy MOL ĠPy LQR Ġra sa Ġra sl Ġra ven Ġra rea Ġra mps Ġra Dec )' )), )' }) tot Pics Ġdot many bet anorm ĠName spaces HE H double line ĠPath Defaults spect ive Sub path Sub samples Sub process Sub Model Sub layers Sub modules Sub Mode Sub Power Sub sequent Sub ItemList Sub SuperCluster Column Data Column Dialog Ġfn list Ġshort age Ġshort Stop Ġshort coming ky lin wave min wave Output wave fd wave Head wave guide >` ): >` __, COL R Ġloop crtl del c del z del ion del Time del hi del unay ĠPo ss 180 8 Ġdat B Ġdat o Ġdat Group 53 19 53 13 53 958 Add Series Add Point Add Rate Add Sizer Add Alpha Add Quad Add SubscriptionDlg Add CurveToPoint Add LineToPoint Ġsrc grd ĠFunction CV ĠFunction Page ĠFunction Horizontal oper ates Ġbl st Ġbl itter Ġbl urb Ġbl urd PS v PS Surface thread lock thread Name thread Plot 62 18 cb param help Biophysics alignment group alignment QC ire ctor Ġcontour set Ġcontour lines Ġcontour Fractions mis al mis matching Ġ"__ ", ĠColumn Clause flatten Results :. { entry boxes Random UnderSampler ru amel Ġmp cb request Params GT M Ġsubject ed 73 052 73 9487 73 809524 pc id pc lin pc rr CL AS CL AMP analysis Type analysis Dialog analysis Job ĠDE MO actual Params aw ak aw ares wd ust Ġpys mac flag fig road map road less ĠMultiIndex ing GB PU Ġcm font orth od Ġcos Z Ġcos TH Ġcos dec Ġcos Omega Ġclean Transformers rat elimit ĠSelect ors ĠSelect Button ()] = ()] \ DIR INT DIR SIG Ġte ens Ġte lapsed Ġte ilf Ġte thys Ġte midparm ĠDo yle ĠDo ench ĠDo asResults rep ent rep ub rep ins proj Root ven y ven iles gene Body gene FileDir Ġdiagonal ize Ġdiagonal ization ," _ ," -", ," ="," ĠTimestamp Coder ĠTimestamp Expression price LS rf bound rf atpol ART ING Ġrs is ti ramisu Batch size Ġsquare ds Ġopt m Ġopt state Ġopt prs mar xs Ġpage count Ġpage Info micro service Cal end Cal GreeksSensibility bust ion pg h pg tol pg patch pg cname CS B CS ite CS patial ĠMat hew alt graph Ġnx M II b )") ; Gui Prog Split Line [:] / }} % }} : }} = }} _{ }} ^{ }} ",) Ġ(% + Ġ(% )" Ġ(% )", AM MA AM ICI region list 2016 0706 Ġfraction S Ġrespect o ')] == Ġcompare r Len g '])) ), Ġavg H Ġavg mem outer gs Ġdebug ing Ġdebug Handler Ġsf u Ġsf ens Ġengine ers span nung span nungsverlauf ^{ ,} Th r asc py lb c Ġequ ate Ġequ ilateral ĠRes oFit Ġphase calc Ġphase Correlation Ġphase diagram 999 098 Node Sens phase TimeStreamData ĠModel ler ĠModel Average ĠModel Definition Ġmag fit Ġmag Plot ĠInter rogation ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ Ġspecial ize Ġspecial ization selected RE Ġ60 323 71 85 71 1057 2012 1207 2012 8610 big Img big sqcup big DataUrl SK k SK EW Ġsep x execute Profile execute InlineOmex ("\ "", Ġprop gate One Image One Predictions One Drive 111 0101 Ġ24 64 Ġ24 11 Ġ24 990 Ġcy meToGridlab Ġmid c Ġmid plane sym X sym Dir Ġgrad arr Ġap vy Ġap asvo include id QU OTES SS ingle SS PACE SS LT SS qE ('- '). ker ala tab ulation tab fact tab BinParamDict Ġsur rs pri est 285 6 285 9 285 66 Output Plugin energy file Ġ18 64 Ġ18 00000 Ġ18 37 dy ee dy adic TRA PPI Ġrgb map Ġrecord name cap stone Ġmis m Ġmis link Ġmis sess Ġcha al Ġcha mp Ġcha ff Ġcoords a Ġdepen ded mem vec mem Vals mem mappable Num Features Num Edges SR R CR ASH CR SDepTime interp ulse interp Background 41 66666666667 Ġfs le Ġfs ps short Stop short OrderID Ġvisual isations ĠID S contin ua contin uing both ron Ġrepr key Ġsection label Ġ32 64 Ġ32 32 Ġ32 16 Ġ32 997 extract Coefficient extract RegionFeatures ket ches ĠIS PY ĠIS SET ĠIS RELEASED Ġepoch time ann ex ann mean ann ée ann ToMask ann ToRLE Sy st Tool ContainerBase Ġsymbol Label Iter Stats site index site Name With Columns With Nan With Answers With TradingEnvironment With NodeSens Ġfetch many æķ°æį® ç»ĦæĪIJçļĦ æķ°æį® ä¸į足 ĠSpark R ĠNo pe ĠNo op ĠNo Such mk m Of Max Of Period Of Features Of Radius Of Samples Of Trade Ġ'{ :,}'. ~~~~~~~~ ~ lc rc 125 44 Ġsess Dict offsets rc Feature Group Feature Statistics Feature LocPairs Ġsegment ClassifyFile Ġneg ating Ġneg intersect CON S CON TRIBUT Ġfold map )[:, ::- Ġ40 80 Ġ40 78 Matrix Group Matrix Exponential Ġ'< ') page index page Info LI Fs LI ESTIMAGE domain Name Ġanaly is mal ic approx imant filters umval Ġ19 39 Ġ19 016 xmin eed token Pos IR LS IR WA 58 11 feat x feat Counter ('/ ',' Ġforce state Ġforce RA Ġforce RL Ġforce LL Ġforce LA pus hes FO S special cell ]}) ], xt ank VER SAL VER AGED Ġport outputs super imposed >= :,.; Ġ"# { Ġ"# {: Ġrotation ally Layer Net Layer Defn Ġstatus PFCTurl Map J Map OpsMixin Ġshare RZ absolute airmass VE HICLE track point allow Edit ĠImage Sequence SP F SP AN +" $" sur ges sur plus izing Estimator As O As Fkt Ġpost proc View ed medi ation medi od dummy Handler DB List DB asic resid fignum %% ." bg nd ny t ny rs ny qp Ġshift Left FE ES FE AS clear page clear ActiveSession clear Odmr Tra ded Tra cing Tra jet ni om ni que ni code Ġsummary Text Tests Base reference Value reference deletemenu reference renamemenu Ġobs list Ġobs date ski y }$ - Ġsl spec Ġinf ty Ġindependent pdf volume id volume Backpack logistic regression cla he plan AngVelTS Ġir ritable hel ion geo profile ĠHe ma delete Windows delete Subscription six ty Kernel Client ĠTh D ĠTh or ĠTh ank ĠTh under Create Empty Create Chain Task Spec Task Worker Ġhalf length Ġdy ing Ġdy amically vm forydiff BU MP cer vical 254 00 254 33 NT F menu Structure ĠFile Info macro dta macro savemenu macro deletemenu macro renamemenu cr l cr ts cr us cr ater condition ned car ts car rot car los car cin car acas lw f Ġbit string Ġbit depth Ġbit mas sphinx arg shared dir shared mem shared Variables Ġlb dy eigen decomposition eigen Vec Ġ17 16 Ġ17 34 Ġ17 28 Ġ17 2800 generate DacComb generate Sublayers Poly Line Poly Fit Poly Basis rouped Ops lst yles lst Layers foot im Ġinv Dir Ġinv Det Ġinv Dirs begin nings calc ular calc Act calc ErrBars Categorical s 256 27 256 37 ________ ____ ĠSoftware Project Ġsizes cale Invalid OrderRequest chor o chor ales Ġbias a .]]) * ĠDis p ĠDis cussion ĠDis connectivityGraph deep update deep ening ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ nap py KMeans Estimator Ġappend File dm nd Event str CG x ĠEstimator InputTest Sparse Feature Sparse Block Ġ``' < Ġtruth bins Ġtruth Tag }\ %". tile Pointings Ġhorizontal display fixed Energy fixed omcost Ġ"' -- alias Dict eo johnson 101 0101 101 1011 ĠNormal isation ĠNormal Prior Bar ometric prev Rad ba jo BC U BC DE BC ship 714 7 Ġes dlg _)) * ĠStandard Error Ġeta pa seg len hy b hy dra hy gro Start FrequencyHz Ġms ps Process FunctionOperation Process AlleleCounts Ġdummy Handler ĠFind Cmd ĠFind CenterElement export filename čĊĠĠĠĠ čĊčĊč çļĦ ä¸Ģ个 çļĦ ä½įç½® çļĦ æ¯Ķä¾ĭ çļĦ åı¯è§ĨåĮĸ çļĦ åIJįåŃĹ çļĦ è·Ŀ离 çļĦ å½±åĵį Read Write Read Lengths roc List Trans itions bi othings tep id Ġoperation EQUAL Ġoperation NOTEQUAL Ġtp med Cont amin Ġ([ ""] ,:] > ,:] == ,:] += Ġcategory Name Ġphi losophy From User From Object From DB From Mean From Specific From Memberships ĠPandas Store DD EN ĠFit Earthquakes ĠFit GenericJumps ĠDataset Table ĠDataset Pool ĠDecisionTree Learner Default Write tw c tw ists tw igs topo plot topo logies Ġfft Sizes Ġ)) )) ĠEn vir Ad ri Ad js Ad venture similar Percents catch ing lint on TO FTOF Close Subpath Metric Kind Metric DomainTypes ĠFigureCanvas PDF ĠAd ams ĠAd mit Ġgeo locator Ġgeo phys Ġgeo algorithms Item Ids fil lout fil limComboBox flux map flux limit Ġgr ui Ġgr lex Reg Data Reg ulation Hist GradientBoostingClassifier tm Results tm Prediction tm ActiveCells positive corr ĠLine Chart ĠLine Viewer ĠLine ageProfiler Offset Tilted Ġfp n Ġfp Value Ġfp fs Ġfp Max Ġfp Min Ġxx k 128 24 INE MENT $$ ,$ ]}, ' Point wise "> &# MF S MF Dataset SH IM SH RINK Ġ"-- > Ġ"-- ": PY GEOS PY CHARM iso chrone iso Prestress Ġ"+ % ĠPipeline BamStats bc en bc nt Clustering Wrapper ])] ; ])] `` ĠFeature d ĠTrans it ĠTrans lates čĊĠĠĠĠĠĠĠĠ čĊč åIJ § placeholder Text PR s gl run gl mf gl gfm qt ls station xml ĠRegression Report Ġ31 12 ()]) [ masked Image åĪ · ĠSub Graph ĠSub sampler ĠSub Datetime ĠSub strate ĠSub SuperCluster End Point Ġexclude List MC want Source Sink Source Morph Ġ"- ")) Ġ"- "): tail or good t platform id Ġpol df Ġpol aris 99999999 9999999999 )))) / land y ----- # ----- ')] Ġtd row ]} }) ]} ``, ]} ]} Ġinitialize Settings cing ul 005 27 005 38379 Des cen Pandas Data Pandas Conversion Pandas Serializer term color term Info ymin us ymin eed Ġsimp lying mg row Ġvolume id species Position Ġls mi Ġstar ta Ġstar names Ġstar ters 600 2 600 46 master flat profile Hub Ġph n Ġph u Ġph dos Ġph osphenes Parameter Table MAX REG Mean ing coeffs Low "\ ^ Ġcmd str direction ality ĠMo RDa Ġproportion ality Axis Plotter Ġ22 64 Ġ22 80 (\ { mne monics ĠOutput ting ((' + chain link ond ers isy oung ĠSto ich spectrum Info ĠGraph View mes ure yr max ited Mutation Font Matrix Font Map Prob Less Prob Greater Cell Hist Cell Pairs Cell MatrixGroup Ġur v stage ID baseline kwargs baseline Sec baseline Yvals baseline Xvals free base free way Ġreduce Aperture Sample Collection Sample Weight Sample Scatter ĠTable Row ĠTable Helper ĠTable AggregateFunction ĠNew ville Ġmut id Ġmut au Ġmut agenesis Part icsInMode ]))) ): ]))) /( uber Step NO X NO MIAL ĠMA Poly ĠMA STER Ġscatter map Ġ88 4 Ġ88 888 maximum Billing maximum BytesBilled maximum WeightBackpack Sto chastics Sim on Sim Hei 15686 2745098 Arg ToArray ={} . ={} : ={} .'. Ġmass cut Ġmass acre Ġcorr Dict ula do ĠFFT W boost ed Ġqueue ing LL R sess Shelf mot ivation Ġpk c Ġpk m Ġsat ify Ġsat istics Ġsat urations Ġaccount Handler čĊčĊč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ čĊčĊč Ċĉ va pour bd am NG VS NG sBlk wt Velocity Ġ[]) [ Ġfilled but 159 194 js deli rl vqModel Action Premise ĠXt Xinv Ġmajor Formatter coun sel Ġtre vn pow s Ġprod igal ale idos Var Profile Var Years mv f Level ized 663 98 Do Exit Do NotOrder MOD df MOD FLOW Shell Widget Ġconv gap Cl Ox Ġturn on Ġturn out ĠValue List ĠValue Array ANT ID dictionary path Labels In Ġbig Bed Ġtail les 150 456 Hel io ĠEX PAND ĠEX CEL ĠEX CLUDED Ġns am Ġns low Ġns ites Ġsupports Non ĠSequence View SKIP ROWS under ing under standing Version eer family default ĠFree zing Ag gs ĠError X STR ACT Cannot Preprocess Ġrho core Ġrho Stars divide s divide ndes OUT NAME OUT LIERS Ġylim Eig nz cols Ġ23 10 calculate Euler =(' ','_ Ġreason ing cfg filenames OB Y OB SDIR Ġpt med New Table New Storage New HistAdjMagsAct dow np Ġfiltered dict Lim iting Ġcalc size Ġcalc uated ])), \ wait pid "% (' Filter Size smooth order greg ating Ġarrow heads tod b loaded OnTrucks loaded ThermalData ĠSim bad TRIC TION met ies met als SM esh SM ISSION ĠCom oving Hz Formatter ĠXy lan /> '. Flow Cal SL V gui main Rec ipes Ġgra ce Ġgra ding background Point Ġstand ar Ġstand off Total Bsmt ĠWH Y Method ology bra hms bra him bra silia lg f =', '), SELECT ALL TP sum Work bench Ġresid plot ĠIO Tools Ġsimilarity VsSeparation ,\ " ĠTensor Dataset proc stid ĠColor Bin readline edit Ġtot max Ġtot incr Ġtot Neg [:,:, :,:] Analysis Plots Analysis WithFigure Ġregist ros 126 04 126 21 126 31 bed FileName ---------- " ---------- :| ĠNon zero ĠNon Affine Ġpubl ishes daily Hosts daily ResultDict Names Full Ġprogress bars TA U TA IR TA PAS ĠValid ated half window half circular Note Formatter vertical Offset vertical Splitter Ġflux tr Ġflux order Ġflux cv Ġflux densities Ġflux Bases filtered Calibration dele tes tax calc Ġdid nt Meta Estimator Meta HasProps Pos X Pos Y Pos car dp q dp py Ġpie z Ġclosest N Ġmouse Point Ġmouse release Ġmouse Toggle 336 38 336 12621 kde pdf Distance List Ġer cs clustering ColThreshold clustering RowThreshold Est a Ġtw plt ĠDict Reader ĠClassifier Cobra bre ath Ġgu ards Ġgu vectorize Ġgu ifiAnalyzer beam C )== - Ġforward preprocessing das hoffset IB I database Name ĠAS ADBDataSet Ċĉĉĉĉĉ Ċĉ MPL FigureEditor connectivity Data 35294 1 van oid van adium arc length arc seconds Ġddof s Ġstation col Ġstation Locations progress Timeout LA PS border LW 109 804 ĠAny more roi Names ĠThere after initialize Settings Ġå § Ġå » Ġå ĭ And Data And GroupNorms rd ds topic Ranks pie chart phot ob phot Table Ġspect ogram Ġspect ively Ġ28 10 Ġ28 45 Ġ28 18 Ġ28 354 Ġix c Ġmove axis google mail 275 5 ĠCO ULD ĠCO ALESCE Ġproj l Ġproj params look uptable attribute Key MIN I MIN ING samp r samp els ĠExtra Args ĠSave Type ĠSave Tool SO x Save Name Save Stream čĊĠ čĊĠĠčĊĠĠĠ Ġprice col Ġprice Ticks psd curve BA Y ../../ ") Ġfoot age Ġscan id exclude CellCycle Ġdelete After Ġdelete Subscription frozen dict ĠDraw down ĠWith TradingEnvironment ĠWith AssetFinder ĠWith AdjustmentReader Block Resampling deriv ate optimize Val Ġcompression Function 318 43 Power Transform Power Scale Power Spectrum Power SeriesError Ġbr g Ġbr igth Ġmem Vals Ġke tex Ġke ptrim Ġke ltner Ġke vlar Ġct sets Be th Be ats GG CG GG ATG Ke ogh some method some obj some how hal ifax syn data question Words Ġrad Lng Ġtab view MO HC ĠGroup Manager Ġsd g Ġsd ls TF Binding Step Function slow downs curr x curr node Ġcurr size }" } '$ ' '$ '+ '$ $\ Ġfeat array Ġfeat Name Ġfeat Norm Ġfeat utres ĠCor rig ĠCor iolis Rest oring ']= (), ĠParallel Processing ĠMean FreePath Over writing Over ridden ric ia ĠStat TestMC sal ari sal ome sal aire chrom Int rupt ly EP ILOG cycle index Ġair less Ġair anmehr Ġascending node fd c fd id Ġfr ance Ġfr ll ĠBo y ĠBo ers Load Area Load Util Load Tracking PRE CED Open Node Open Stack Ġmi riad '" { Patch er Patch ing Ġ75 8 Ġci Bars correlation Matrix correlation Modul Code Lines Code Tmp Code Fragment Code ArtifactAdmin svg font urb CorrectedPowerCurve Initial Depot Ġ``( ..., Ref T Ref raction chan getime Delta I 707 4 Back space ono ise 184 90 =========== \ bert elloni combined csv combined small combined Power combined Inten Ġll h Ġll cov Ġbc ss Ġbc dim ACT GAG Ġrnd data LM Params LM DB sn iffer sn ParamTable bag ofwords Ġdr z Ġdr ums Ġ45 32 Ġ45 16 Ġ45 60 Ġ45 28 224 2424 Mag cal Mag calFrame edit rawxrd Ġmismatch ing pv h pv o Ġpseudo colour resp codes Ġinteractive Plot Learning Data ĠAnd ers Scale Y Ġslow ness Raw Predictions 110 43 110 70 )> ' 401 4 diagonal Group diagonal Entry Ġut op Ġut day Ġgets core ĠWindow Modal zz zz Parameters Chess Ġastro base tc ps Ġada delta Ġcoeff List Ġcoeff Table Ġtrim lower Ġtrim Slowdown forward preprocessing Arr henius Ġpat lik Ġpat hes 317 40 UD R icon da Ġ'') ; service URL Ġcli pper Ġml ra Ġml Class Ġva ison Handler Line Handler RegularPolyCollection å¹ ² 901 3 901 61 ç» ĩ Norm FileName Norm Streams Norm ZScale Ġws Out Ġmaster Y Ġmaster Likelihood 047 11 047 78 Ġfails afe sr ings ĠST DEV 319 1 mur at ĠSum men ĠSum Multiply ĠTemp Data --------- :| 700 3 Ġbel ieved bio volume bind AB 996 32 996 30 996 161 _` {|} Ġamplitude List ĠText Block ĠText AsFrom bw p bw plot lan ta lan igan ĠGeo Sim ĠGeo physical ĠOver riden problem id heat fuel Ġann ually Ġann ToRLE Ġann immt Ġtrial num Ġtrial Num baz z tack le Main Wrapper ĠRGB a ĠML ST Unit System Ġdaily Hosts stand arized resource Uri --', ) utr Binding vd ms ĠLin ha ĠLin ke _{} _{}_{}. Draw Path Draw Settings Draw Rotated æĸ° å¢ŀ "} [ "} ])] Ġvect s Ġvect ree XY points ĊĊĠĠ Ċ Ġcolour BarWidth ĠFloat Coder Ġ({ ','. Ġpow min ]_ |])" }/ \\ Ġconnected ness Ġconnected Permanence ],' *', Ġep Diff bp ic hr psys Weight Initializer connection Error Ġhost ing 998 154 PP P PP EL PP DataException 856 07 856 98 ado le Ġmicro homology Ġmicro biota Ġì ² ĠInterval Mixin ĠInterval Cons Ġ27 96 Ġ27 44 Ġ27 69 Ġtopic N Ġtopic Words Ġrp LT RGB ColorProfile ĠExtract JobConfig Ġclick X dl is dl ns dl ny ĠCho sen Ġbeam fwhm adj fold adj closes ĠABC ExtensionArray Factor ize åı¯ éĢīæĭ© perform Convolution illi ary icient e Auto WidthChar Ġwp li Ġdisp menu Style Sheet Style Eq 003 0000000000000001 003 92156862745098 512 4 çĶ · chem Ca "]), " Lab App conver ging Training File Ġcopyright ed Ġncols izes ĠOpen FO commit ment RNA Diff need les Ġ35 88 send Program DR C robust ness Ġtax ation Ġtax name 264 1 CF gArgs 265 5 265 8549 ĉĉĉ Ġ ĉĉĉ ĊĠĠĠ CI W CI EL pages peed Ġfid dle conc Out conc listbox ĠIs Wow liter ate ĠWork FunctionAnalyzer ĠHist AdjMagsAct Ġhy ind Ġhy pertune ograph ics ][- ( Seq Kernel native fn 168 24 168 173 Pe rez Ġce de lookup Transform chr M chr ys herit ability /" ', /" +" Ġgeom od Ġ'{} ') Ġ'{} -{}. Ġ'{} /{}_ Ġ'{} -{}'. EM ER FIL T storage Token 984 7 Ġquant izer ĠFormat Row Fixed Values Fixed Pitch Ġscheme OfFeatures 185 89 185 185 ('.') ], ('.') ]): Ġpts file }] }$ }] ''')] Ġtk p spline Yes Ġmb id Ġfpr Test Ġfpr Train Null FeatureManager Param Error Ġff edata Ġalignment Parser regr ine 296 1 296 2 296 77940 wav enumbers delt amin delt zones Diff xx Diff xy Diff yy years P corpus name ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ plas mids Ġsensor imotor Ġcd om "]] ): ĠProcess AlleleCounts burn down SER IF 365 42 235294 11764 +'/ ../../ dark Blue rh h rh rawsize ĠEd mondson è® ® Ġant igenic fir th ('') ; ĠPRO TO ĠPRO GRA ĠPRO VIDE FFT spec FFT Gvecs ĠImp erial 132 9 132 77 Space Group Custom ers Custom GT Custom GQ vc fs pdb Files abi get quant ite Non Bool Non Rigid Non sensical ':[ . nums ites slider Released Ġperson ae Ġperson PRarray Ġperson FreqArray Lat eness 106 11 106 88 106 96 106 92 Exp TickLabels Exp Exons MAP VIEW MAP TYPEINFO ĠRE PE ĠRE BOUND Ge phi Ge orgian gauss Frame gauss noise Uni Ref water ing spike Hz spike recorder =============== + Ġmk f ĠMy Plot 259 80 sta ces sta ircase Ġchrom Size Ġchrom Sizes erc us erc ules Ġeq ns Ġeq Flag sz alay Ġtxt l Ġtxt id Ġtxt FilterSize TT LE dro pper prot seq sun os sun spot Average Frame 134 09 134 92 Ġswitch yard ĠSc issor web api Ġcsc rollbar getData sets ĠLO Freq Ġ96 07 Ġranges File Status Error 032 0 032 23 032 013 032 209 032 418 dc Offset AGG ING AGG CGGCT 115 99 115 29 115 83 ĠJSON ValueProtocol optimal EncoderResolution 034 19 Ġmet aseq Ġcar avel 399 0 Fig Group Fig Canvas 000001 3 FLO WS middle bury middle wares ĠRO CS ĠRO BUST LABEL SIZE Jo ystick bys ite ĠTH REE Ġthird LevelCurTestX First Raster First Words Obj pair Ġseg ax Ġseg var Ġseg uir bur ant pf g enable Pack enable Diffraction berg stra ĠFast Gwas ĠOli ver ĠPoint Net ĠPoint Map ĠPoint Source Ġ(`` ( Ġ(`` \\ Ġnr x Ġnr hs ĠSE B ĠSE PARATOR ĠSE IMF minus v minus one Tr igram ĠPY TEST ĠPY TIPS Interval Report AP mean ĠGa usian Ġtc lab Ġtc lengthinsecs Ġstock Y bse jac Ġ29 10 Ġ29 31 378 3 378 6 uel le ĠSkipTest Warning tb one tb list tb lout tb ilrate 798 2 ko h ko effizient éĩ Ĭ SB J Ġ65 04 205 8 205 65 should Animate 165 42 WN S ĠVariable Screening VA E Ġfour cc FW ER ĠGeneric Table ĠGeneric Fixed ĠGeneric LikelihoodModelResults ĠGeneric IndexCol ĠGeneric ArrayLikeDataAdapter 212 1 212 121 Shape d pend igits gam ble Ġtrade able Ġtrade Dir Ġtrade Idx Ġpkg info 175 7 High Resolution Convert AllProxy QT CO Ġblank row MD Traj Ġautog p čĊčĊ ĠĠĠĠĠĠ 253 01 154 257 Ġneuron as Imp urity ĠPanel Fixed Ġadapt B trial poles Ġ36 99 Ġ36 00000 ESTI GATING Tri weight Ġminim izations instances OfInterest 211 87 211 847 ĠOrder DuringInitialize iq v ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠPL UTO pct iles Art ificial 147 67 pm P pm Tc instrument al Ġwait for Ġvars Dict ring x Ġprepare Data Ġprepare Plot See Also glyph index ĠSO I "%( ','. jd bin )^ + Ġaux Engine Ġaux illiary æĽ´æĸ° 该 æĽ´æĸ° åIJİæīį combine Func combine ByKey vio lent PA IR Update One Update Portfolio PM CG colormap norms å¹´ åºķ Ac im Ac ura Signal Set Extract er Extract Base Extract Raw Feed through sos agua WE O WE TimeSeries timer Event BL ING è¡ ¥ è¡ £çĿĢ ĠSimple RNN grade exp So S So Material ĠHel io ĠHel ias ĠHel sel Target Dist combin ant Ro MS REG EXP aug R 987 0 987 39 nom Tema ĠFin ucane 992 78 Ġhex ed Ġhex flag Ġsr qi ("' ")) ("' "). ĠRed shifts visit Shelf 004 22496 Clo verleaf Low ess ĠMap Coder 114 11 hamming Frame Ġol dd ln f å¼Ģ åıij å¼Ģ å¹³ä»ĵ交æĺĵ Det Canvas Det Slice Det Etend Metrics Period ('# '+ Ġib Py Ġprobe id ĠOUT LINE Ser ials Ser gio templates Raw GEN S ĠSort er Ratio Table Ratio Effective meter ies ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ ĠDisplay Color 432 8 ĠEN X ĠEN KF ĠEN SEMB Ġ"{} "). Ġ"{} "' Ġlam ch Testing File Display Value Display Func PC U PC CA PC lient 294117 6465 _") + =""" > Ġ101 7 Ġdc x Ġdc xt umin ous Local PackageRegistryDefault Local MinTreeID 192 8814 192 156862745098 synt etic Standard Ones ĠDense ly :( ?: $$$$ $$$ ĠBoolean Scalar ĠBoolean Coder _] [: ĠAct a stress Strain ("[ \ ("[ { ("[ !] ITH METIC Br SALA Ġ44 92 347 27 Ġtech nological hard data hard core 227 47 ĠCode book ĠCode ArtifactAdmin 127 88 127 23 Find Best Directory Privileges RF BAND ham ster OUTPUT DIR Ġhit mask Integr ations ,... )") uv pv uv ille Ġpng Name ĠMag calFrame GA MA GA US GA INS Ġ"( ", 906 2 906 8 Ġland sat ĠScale Base ĠStop Order ĠMask FileName accept ing Ġmm r ĠAlter ations Center Points Center Surround Stats Collection chk Time chk Linphase wcs um Ġlf c Ġlf ull Ġlf sr Ġlf Simil Ġprincipal es Engine MultiTF measurement Results Tick Data ĠWar ping 603 6 603 16 603 06 Hot el Hot elling 135 64 Off line Port uguese 107 10 107 26 rout ings RD LR ĠState Vars Connect able Ġfac ial ĠBlock Label Ġ'* '), Ġdens file Bound Box Ġins anely LOG FILES Cross SpectralDensity ("/ "," Ġsn iffer 195 34 195 50 don key mor a mor an mos cow mos quito DP F DP compsarr gu y gu er gu zzle gu ifiAnalyzer itin er 312 88 312 87 Ġtoolbar fmt 306 98 306 05758 Wolf e fm tout 424 36 424 242 xtick loc å¼Ģå§ĭ æĹ¥æľŁ Sigma Depth ĠDon wload zs lab Ġlc list Ġlc grad Ġlc MaxTime Ġlc MinTime Ġ123 072001000000 thumb tup hole mode person ne person TotPhotos ros col ĠHam mers ('{ '). 912 4 FR T Ġtrend num ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠ ĠCustom ise 206 96 875 0 Ġdash list Ġdistinct Feature Ġpeople Line 384 23538 calibration Sector protein Type ico herence team ID Ġgal Y Ġgal ahic æĹ¥ çĶ¨ æĹ¥ k线æİ¥åı£ vin son Ġols m ĠNode Error Ġopp onents Ġopp osites urls InParallel Gen res Ġtemplates Flt Ġamp code sib sp 138 34 Ġplugin Name Build Db Build ArgParser ĠLength Prefix Script Utils compression s mys ource brain x brain omics 016 994 Ġregister TempTable Ġspectra Now GL ES GL Canvas pot ted exon comp Copy JobConfig Copy OnWriteArray ASSI ST intensity AsFkt bon da ĠAuto Encoder ĠAuto complete ĠAuto Sklearn ĠAuto Sized 974 99 974 75 fg abe Ġproduced pop Ċĉĉĉĉĉĉ Ċĉ 314 00 Wave plot ĠGe or ĠGe onet ĠGe ogCS ĠGe odesy ĠGe oportal Real Names Ġsolar Values 266 5298 Page Name switch point #================================================================ ===================================== 225 80 225 07385 sam run sam Run ------------------------------------------------ ----------- ĠAlgorithm Compare ĠAlgorithm SZ Ġ120 31 305 5 305 8 interaction Dirs Right Button Simple CV Simple SynHandler pz cmi ĠLa usanne Ġkde pdf Ġln USA Ġpublic ally mapp olygon Skip CU fy z ict oken ĠTI LE ĠTI Lookup ĠRa chel Polygon Patch ĠTotal Energy ĠDep osition ĠDep ickleMe Print DialogData catter Plot wk file wk StandardDeviation pw i leg acysurvey Left DockWidgetArea Ġ'$ , 904 34 904 867 ĠRo e ĠRo ma Weights File 494 6 494 9 494 29 328 10 328 12 328 15 328 37 164 2 164 8 164 35 164 09 164 333 Energy Range Ġche w Ġflu orophore simulation Thread Region Name )= \\ Ġ#---------------------------------------------------------------- ------------------------------ Ġiso baric spin chan Complex Col ])* (- ĠLab be 367 0512 ĠUnicode Font ĠUnicode Encoding COMP ENS COMP ARISON Validation Metrics 997 43 997 99278 Schema UpdateOption ĠNO x Thread PoolExecutor FigureCanvas Cairo Remove Directory ĠUSE P {{ | 155 84 155 81 Ġadj ctf gold file Ġwide tilde 204 0000 Ġ37 48 GP Classification GP KG Ġpot ent Long Only Zero es Zero CenterNorm qs ChoiceBox -------------- | NS its NS IDE Ġmutual Information Ġdemo critus Ġcoll ator ()} ") restore ProgressState maj formatter maj locator maj orticks 102 17 Ġencode bytes hit Number hit Rate Ġcnt Rna ?? ) ?? . por fit MQ TT crit dist account Handler Ob iszów ĠMod ulator *** ' *** \ Command Prompt camera Geom Reference Free Ġgoogle test ĠCar rier ĠCar oli dend ogram Msg pack Sha ders ĠPos it åį İ Parse Obj ĠMain Frame ĠMain Wrapper Ġfmin bound trigger ing Ġnans kew Percentile Selector SUB DROP 755 85 Ġdemonstr ations Align er Align IO Ġrisk Exposure 7843137 254901 ãĤ ¸ Ġdow loaded ä¸Ģ ä¸ĭ Ġft ur Ġcaller func lut ter lut size Ġtimestamps X Ġtimestamps Y 887 06 Ġ<< < 7899 12 Ġ================================= =') boot num Conv AutoEncoder Record ID Ġ47 12 Ġevt len SF UND Ġbp maps fro mpath Ġë ¬ Ġë ģ Ġë ª© Ġë ĺIJ Connection Event Connection Fraction Ġrms Zoom Ġfo ods 238 05 ĠSH ELL Expr FieldValueTransform Ġč ĊĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ']* (( Ġforecast Result 045 94 Car b blank Cursor PARA ZZI Div idendes SAMPLE CLASS )| % Learn Test Learn Wrapper fault plane ĠPDF Page 855 64 855 07 ĠNEST ED Ġtar Name Algorithm Types DT NN Radius Greater Ġvt Constant CLASSI FIER dz x Ġ': '): created ict tip onpython pic n pic ke pic clicked pic clickprocess ĠSource Data Ġmarginal ize AV C ĠBack ends ĠBack projection Ġhome package Ġhome ostatic ĠFigureManager QTAgg ĠFigureManager WebAgg 216 3 fla vanoid Cy clic DL m DL Index Ġ#' -- 964 75 IF IC Ġsyntax Tree Epochs TFR 015 147 game te inside textfont inside textanchor mac depth vt menubar vt statusbar ĠNE CESS Ġ48 36 Minimum Period Summary Table Summary Results Ġreflect ive Ġ55 45 Ġ55 07 Ġoverall Std fb dd fb nd fb vec Ġpm ts Ġpm ids Ġpm stats pur su DIC TIONARY ])]) ", Ġaddress able TOP ICA pres cription pres cott pres criptive å¸ « å¸ ° tmax idf ĠBinary Relevance ä¸Ń èİ·åıĸ 385 9 385 8541 inference File inference Labels )""" ), Stop FrequencyHz Ġinherit ors Dim Gray 056 998 Ġsal ida Ġsal amidir Ġsal estax 345 3 345 7 345 8 345 67 Final izing }") ], Ġicon size ï¼ī ( constraint ext program mer Undefined ROI Cent ury Ġwt ss Ġwt wh hm C Ġbio file Ġravel mask cand o ĠBin width quick flat tal ent Ġlm dif ĠAL TER ĠAL Ts ĠAL ERT ĠAL LOWS ĠRest ing ĠRest oring closes rc trained models Location Name Location Cache Ġpix size Ġpix crd Ġ[[' $ Ġ[[' \ Ġ[[' '] Ġ[[' '], Ġ[[' ']] logo Src Ġmed HMperSM çĶ¨ åıĮ 304 4 158 33 158 26 è¡Į æĶ¿ čĊĠĠĠĠĠĠĠĠĠĠĠĠ čĊĠĠĠĠĠĠĠĠĠĠĠĠčĊĠĠĠ Ġcle gs Ġ'| ') Ġ'| -----------------------------------------------------------------|' Bit rate Ġblob featuresle 396 2 ),' ','','',''), ĠUnion TemporalPooler nk x 035 00 035 66 236 57 Sheet A glm ForceLayout Interrupt Exception destination xy OF YEAR OF TInt Control nuPp ĠGoogle V ĠGoogle Credentials ĠGoogle Vision Generic Tab Generic Storage Generic IndexCol 909 2 Flag ging Flag ged ĠParse Results ĠHigh Half Ġcloud BaseHeight Ġcloud TopHeight Ġam alg eng age ngram db lor Frame rich ter åıĸ å¾Ĺ Ġshadow ing 个 èĤ¡ 个 æķ´ Ġatt its 036 97 036 155 036 10927 ĠLocal Cluster Slice Type Ġjo j Prediction Project vp u Ġdes itarget attach streamer Mesh Base supp liers supp ressed Dirichlet BC Stack Frame ĠTwo SampleBase ĠTwo LayerNet ĠSingle Int weather ing weather data HEAD LESS Ma iling æĺ¯ ä¸įåIJĮåĵģç§įçļĦ SegmentedColormap Evenly Post Plot Post season Ass ym bat o Ġeye trial ĠEvent Collection ĠEvent Duration ĠEvent Workspace Empty Schema Empty IntervalIndex Write RunFill Ġrt Ref loglog cdf Nu is 335 84 computation Cost ,:,:] + ^^^^^^^^ ^ ĠCha itanya Binary Image har sh har lem Ġrx cs Ġrx trs ĠSch lum ĠSch lueter ĠSch nabel SY R SY MME Uns aved Uns afe Ġfav ored Ġ',' _'). produc ible ĠSPAR C Recall Test JSON B Ġga popen Ġga ItNoList Ġga IterStat ĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠ ĠBox Cox Ġnom ks Ġnom bres 8067 4 Ġstorm anno Ġstorm tracks ĠCH ISQ ĠMore land Fill Batch Ġcr ush obis zow "{ % Ġngram db Ġdelt x Ġdelt avar 246 067 Ġsurf Tube :])) )) rab les rac ion 446 161 Ġtan TH ymd HMS ()[' _ ĠPR IN ĠPR OD ĠRES AMPL stein er stein Decam para phrase para maters ĠVol unteer Counts Obj åĪĨ è¡Įä¸ļ åĪĨ åı· åĪĨ éħį 387 2 Global e Global Debugger Ġstra ddle DNA data Pen lee Ġdro sophila Chart DataSource Peak Found Peak Detection ĠMa ess FEAT S TARGET ING USA MPArr Adjust ing Adjust Variable Ax Min grib name ĠDir ty Second Raster was hed 229 80 Ġsvg Embed Ġ'> '), Ġ'> '}[ Ġperf omance Topic Modeling irl pool Ġconc Init Ġoutcome Labels Ġmember infos Fast est Ġmanage able Ġactions df Ġmisc data Ġsky model Ġsky field sco op sco pename -------+ --------+ Ġlap fun 198 3609 936 33 Ġceil label ARCH ON Ġbehaviour s Mapping And emb dir Ġsuc cefully Ġsuc ceded 324 26 876 05 LinearRegression Scores -' * Av It sem ver sem ivariance Arrow Line Arrow Stream annual ish 028 17 Append SubMenu Word Cloud Ġbed type Ġbed ga Ġbed Files ĠSNR s éĢ IJ toggle IPython ĠFill l ĠTask Worker earth science Ġalle ged 665 17 665 49 ĊĊĠĠĠĠĠĠĠĠ ĊĠĠĠĠĠĠĠĠĠĠĠ inh win 214 65 819 7 IA U bal ho Short Desc Ġnv oxs Affine Map Ġstamp åĴĮæī§è¡Į heatmap f MON GODB bel la ĠReport Collection ĠBar tok 244 86 844 84 Ġox idizer ĠDensity Mixin ĠSymbol ç±»åŀĭ Scan Stat 008 97 ĠBE ZI ¡ç ±» 292 63 Lib FrameParser Ġray sect ĠLR C ĠLR s ĠTransformed PDEntry Ph Den Ġmall s Ġ49 32 Ġ49 80 čĊĠĠĠĠĠĠ čĊĠĠĠĠĠĠčĊĠĠĠ -. "," exist ingsummaryUrls 176 97 176 0912 Ġstochastic ModelFrame Ġhdf stgz Ġlive time Mar vin Mar shall pu zzle å° Ħ ĠFrame Spec ĠFrame Converter ĠFrame Fixed ĠFrame dSerializer Initialize Weights TZ YX ĠPAR TY Ġmaj formatter Ġmaj locator 1234 3234 Ġten acity ogen ic reflect ive ĠDouble Scalar ĠDouble Coder OG RAMS 414 85 ACGT CAAATCAT Noise Experiment Help Page Help Choice After Region After Measurement ĠHTTP Adapter )+' %' Setting Widget Interface Manager bro ther bro jac mps lib Ġmeter ologist nii Lung Ġlife cycle ĠRaw TextHelpFormatter subtract mean subtract ECV Comparison Mask kit ty Ġflex ural ,:]) ** ,:]) [:,:, Ġintersect ng packet list ĠTimeSeries Scaler ĠAbstract State ĠAbstract DataView Ġphoto z Ġphoto set Ġphoto sets ?) '. Ġgame ID Ġgame Counts ĠAff airs ĠAff ymetrix 457 19 457 24 material properties Trade History ĠDown edge ĠčĊĠĠĠ čĊĠĠĠĠčĊĠĠĠ Ġchem Parms exponent ially exponent iation fromfile imComboBox ĠBasic Formatter ĠBasic Parameters ']+ =[ ĠValidation Summary Ġflash ing Ġ'../ ..')) ĠCF rac ĠCF Encoded ĠDecimal Dtype ĠDecimal Scalar ĠNull Literal opp s opp ress Te ak lle val Ġharmonic Model Expression FileLocationData orbit file rise vsturn æ¯ ķ transfer Type ĠPrior Recs Ġcompar ative flex dock "$\ | Ġcommit ed KIT TI xr array ĠDirichlet DiffusionTree nod isplay plotter tron Abstract NeuralNetworkClassifier pin ch Ġpct maxdev ĠChannel Group ĠChannel OptionsWidget Raster Count ĠSmall IntCoder ĠAsset Data ĠMar co mono loci 846 18 Beta CellCenter Matplotlib Backend Ġelastic ities Ġelastic luster Ġtexts pace Ġtexts pli dut ch Ġascii file ĠCS G 308 940232 Ġsurvival stan Mac Book Ċĉĉĉĉĉĉĉĉ ĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉĉ Ġau ger Ġexchange Label neural Network Ġatten List blast ing ĠCl ément æŶéĹ´ ç´¢å¼ķ TIM INGS mq n 148 14 Bool Index ĠShift TimeMixin Ġprot Angle Reset Clip Reset BoundingBox ([[[ . ipca i ĠCurve B ĠCurve AB La unches xN i Ġhomogeneous ly Ġtrig er