added
stringlengths 24
24
| created
stringlengths 23
23
| id
stringlengths 3
9
| metadata
dict | source
stringclasses 1
value | text
stringlengths 1.06k
297k
| version
stringclasses 1
value |
|---|---|---|---|---|---|---|
2015-09-18T23:22:04.000Z | 2012-06-25T00:00:00.000 | 5878622 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine",
"Physics"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/1420-3049/17/7/7722/pdf",
"pdf_hash": "45ba79e7c68ded48ff4e58ec30667aaf8a837fa0",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118823",
"s2fieldsofstudy": [
"Chemistry",
"Materials Science"
],
"sha1": "45ba79e7c68ded48ff4e58ec30667aaf8a837fa0",
"year": 2012
} | pes2o/s2orc | In Situ Electrochemical SFG/DFG Study of CN− and Nitrile Adsorption at Au from 1-Butyl-1-methyl-pyrrolidinium Bis(trifluoromethylsulfonyl) Amide Ionic Liquid ([BMP][TFSA]) Containing 4-{2-[1-(2-Cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]diazenyl} Benzonitrile (CTDB) and K[Au(CN)2]
In this paper we report an in situ electrochemical Sum-/Difference Frequency Generation (SFG/DFG) spectroscopy investigation of the adsorption of nitrile and CN− from the ionic liquid 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ([BMP][TFSA]) containing 4-{2-[1-(2-cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]- diazenyl}benzonitrile (CTDB) at Au electrodes in the absence and in the presence of the Au-electrodeposition process from K[Au(CN)2]. The adsorption of nitrile and its coadsorption with CN− resulting either from the cathodic decomposition of the dye or from ligand release from the Au(I) cyanocomplex yield potential-dependent single or double SFG bands in the range 2,125–2,140 cm−1, exhibiting Stark tuning values of ca. 3 and 1 cm−1 V−1 in the absence and presence of electrodeposition, respectively. The low Stark tuning found during electrodeposition correlates with the cathodic inhibiting effect of CTDB, giving rise to its levelling properties. The essential insensitivity of the other DFG parameters to the electrodeposition process is due to the growth of smooth Au.
Introduction
Electrochemistry in room-temperature ionic liquids (RTIL) is a rapidly developing topic, with prospective applications in electrodeposition and energetics [Li-ion batteries, supercapacitors and proton-exchange membrane fuel-cells (PEMFC)] [1]. Despite the abundance of recent literature, spectroelectrochemical methods are seldom used, at the time of this writing, the following approaches have been described: Fourier-transform infrared (FT-IR) spectroscopy [2], surface-enhanced infrared absorption (SEIRA) spectroscopy [3], surface-enhanced Raman scattering (SERS) spectroscopy [4] and sum-frequency generation (SFG) spectroscopy [5][6][7][8]. Spectroelectrochemistry during metal plating provides useful information on the growth interface and a range of approaches has been proposed to achieve information on the chemical composition, electronic structure and adsorption at the dynamic electrochemical interface. In particular, SFG has proved particularly informative because it combines utmost surface sensitivity (bulk signal is not allowed within the electric dipole approximation) and single state capability (steady-state electrochemical conditions are able to yield a high signal-to-noise ratio, at variance e.g., with FT-IR and SERS) with sensitivity to both vibrational and electronic structure of the interface [8,9]). A particular advantage of in situ spectroelectrochemistry during electrodeposition processes is the possibility of monitoring the state of additives at the growing interface, yielding molecular-level information that can be directly correlated to phenomenological or ex situ quality indicators of the performance of agents, such as brighteners and levellers, that are of paramount importance in industrial plating processes. Among plating additives, 4-{2-[1-(2cyanoethyl)-1,2,3,4-tetrahydroquinolin-6-yl]diazenyl} benzonitrile (CTDB) has been recently proved to be highly diagnostic of a quite comprehensive range of interfacial processes in which levellers are involved [10,11].
In this paper we propose an investigation of the potential-dependent electrodic behaviour of CTDB added to 1-butyl-1-methyl-pyrrolidinium bis(trifluoromethylsulfonyl) amide ([BMP][TFSA]) electrolytes in contact with Au electrodes, comparing the interfacial action of this model leveller in the absence and in the presence of ongoing Au electrodeposition. Cathodic operation of CTDB at sufficiently negative polarisations and reduction of K[Au(CN) 2 ] independently lead to the release of CN − in the electrolyte. Since this pseudohalide tends to adsorb strongly on Au, coadsorption of CTDB with CN − takes place, resulting in a rich interfacial compositional scenario.
Cyclic Voltammetry
Cyclic voltammograms (CV) of Au in contact with [BMP][TFSA]-based electrolytes, without and with CTDB and K[Au(CN) 2 ] are shown in Figure 1. The CV measured with pure RTIL is essentially the same as that reported in [7,8]. Anodic and cathodic decomposition reactions of RTIL occur at about 2.0 and −2.9 V; the small peaks can be explained with selective adsorption or reorientation of the RTIL ions-as discussed in [12,13]-as well as to some degree of reactivity of the organic [14]; in fact, the RTIL is electrochemically stable to −2.25 V and +1.75 V vs. Au QRE: The electrochemical window of stability is therefore ca. 4.0 V. Extending the potential excursion, gives rise to: (i) oxidation processes at +2.0 V, followed by a corresponding reduction event around 1.0 V in the reverse scan and (ii) reduction processes beyond −2.0 V, followed by a corresponding oxidation process around 0 V. The large potential differences between these RTIL breakdown processes and their corresponding reverse reactions indicate the strongly irreversible nature of the corresponding reactions. The CV corresponding to the addition of 1 mM CTDB exhibits an irreversible cathodic peak at ca. −0.5 V in the cathodic-going scan. This cathodic reactivity can be interpreted in terms of denitrilation or diazo bond breaking, on the basis of cognate experiments performed by some of the authors in aqueous solution [10,11] as well as of the literature describing the reaction of similar molecules [15]. Another minor voltammetric feature brought about by the addition of CTDB is the couple of anodic peaks centred at ca. 0.9 and 1.5 V in the anodic-going scan, due to the oxidation of one of the reduction products of CTDB [10]. From our results of [7] we can exclude that this peak is related to the release of CN − caused by denitrilation. In the presence of K[Au(CN) 2 ], we found a current density increase from ca. −2.0 V, due to Au electrodeposition (e.g., [16]), followed by a classical mass-transport controlled peak at ca. −2.5 V. The new anodic features that appear after addition of K[Au(CN) 2 ] can be related to CN − adsorption, oxidative adsorption and/or formation of Au(I) complexes with RTIL ions, as extensively illustrated in [8]. The CV recorded in the presence of both CTDB and K[Au(CN) 2 ] is essentially a combination of those obtained with the single reagents, with the difference that the features corresponding to the electrodeposition processes are smaller, as expected from the inhibiting action of the leveller [11]. Mechanistic details on the heterogeneous and homogeneous electrochemical reactions occurring in the different electrolytes are beyond the scope of the present paper.
In Situ Sum-and Difference-Frequency Generation Spectroscopy (SFG/DFG)
In order to pinpoint the interfacial behaviour of CTDB at Au electrodes in the absence and presence of Au electrodeposition, we followed-as a function of potential-the CN stretching band, that according to characteristic position, can correspond either to adsorbed nitrile (ca. 2,200 cm −1 ) or to adsorbed CN − (ca. 2,100-2,150 cm −1 ). The peak position, width, sign and Stark tuning of this adsorbate mode are highly diagnostic of the interfacial structure. Furthermore, since in the case of Au the visible energy lies close to the interband transition, SFG and DFG spectroscopies yield complementary information, sensitive to the orientation of the adsorbed dipole as well as on the non-resonant part of the second-order polarisability containing 1 mM CTDB and the corresponding fits: Anodic-going scan (from −1.75 V to +1.50 V, measurements performed after those reported in Figure 2). The potential scan sequence (anodic-going scan) is indicated by the arrow. 2 ] and the corresponding fits: anodic-going scan (from −2.50 V to +2.00 V, starting with pristine Au electrode). The potential scan sequence (anodic-going scan) is indicated by the arrow.
Adsorption and Cathodic Reaction of CTDB in [BMP][TFSA]
Working with a static Au electrode (in the absence of the Au electrodeposition reaction) during the cathodic-going scan (Figure 2), for potentials higher than −1 V, a single, negative SFG CN band was detected at 2,210 ± 5 cm −1 -the peak position does not show a measurable correlation with the applied potential-corresponding to nitrile of CTDB, adsorbed via the C atom [17].
The denitrilation reaction can be related to the shoulder found at ca. −1 V in the cathodic CV peak of the cathodic-going scan ( Figure 1). For lower potentials, a negative SFG CN − band appears in the range 2,130-2,150 cm −1 , exhibiting a typical Stark tuning, again denoting adsorption via C. As found in the case of aqueous solution, CN − is the result of cathodic denitrilation of CTDB [11]. It is worth noting that the Stark tuning recorded with incipient formation of adsorbed CN − released by denitrilation is notably higher than that found with CN − adsorbed from KCN [7] (A) Cathodic-going scan, SFG spectra (see Figure 2); (B) Anodic-going scan, DFG spectra (see Figure 3). (C) Anodic-going scan, DFG spectra (see Figure 4); The vertical grey line indicates the reactivity threshold for CTDB. The error bars correspond to estimated 95% confidence intervals.
After the cathodic-going scan imposed to an initially pristine electrode, yielding the SFG spectra discussed in the previous paragraph, we switched to the DFG mode and measured an anodic-going scan ( Figure 3), with pre-adsorbed CN − resulting from denitrilation. Pre-adsorbed CN − is in this case present in the whole investigated potential range and the nitrile band can still be noticed, though with a lower relative intensity with respect to the CN − one, since the latter species is more strongly adsorbed to Au. The nitrile band position in the return scan was found to be 2,203 ± 4 cm −1 , essentially the same value as in the forwards one. Figure 5B shows the peak positions of the adsorbed CN − band, exhibiting a Stark tuning for potentials more cathodic than the CTDB reactivity threshold (see Figure 1) and an approximately constant value (2,131 ± 2 cm −1 ) for higher potentials. The estimated Stark tuning value (3.3 ± 0.5 cm −1 V −1 ) is essentially identical to that found in KCN-containing solutions [7] (SFG 2.9 ± 0.6 cm −1 V −1 , DFG 3.6 ± 0.2 cm −1 V −1 ).
The nitrile bandwidth exhibits a clear decreasing trend in the cathodic-going scan ( Figure 6A), while it is essentially constant in the anodic-going one ( Figure 6B), denoting a selection of the type of adsorbed nitrile, probably corresponding to the moiety belonging to one of the cleavage products pinpointed in [10]. The CN − bandwidth is smaller in the initial stages of pseudo-halide formation in the cathodic-going scan ( Figure 7A); once it is formed, the bandwidth follows a trend ( Figure 7B) that is very similar to that of nitrile, though with slightly higher absolute values. The explanation given above for the increase of with potential in the case of nitrile, can be conjectured to hold also for CN − . Figure 2); (B) Anodic-going scan, DFG spectra (see Figure 3). The error bars correspond to estimated 95% confidence intervals.
The height of the nitrile peak shows a general anticorrelation with the applied potential, due to reactivity at cathodic polarisations ( Figure 8). The decrease in values found at at −1.75 V between the cathodic-and anodic-going scans is due to the fact that we kept the potential applied while switching from SFG to DFG and the reaction, leading to CTDB consumption, continued. Competition for adsorption with CN − on Au corroding at high anodic potentials gives rise to a drop of . Since CN − forms during the cathodic-going scan, the peak height of CN − appears only at sufficiently high cathodic polarisations ( Figure 9A), then it grows during the anodic-going scan ( Figure 9B) according to the customary potential-dependent adsorption behaviour of this pseudo-halide on Au [17]. Again, as in the case of nitrile (Figure 8), the discontinuity in the value of at −1.75 V between the cathodicand anodic-going scans is due to the build-up of the reaction product during the holding period corresponding to switching from SFG to DGF. (A) Cathodic-going scan, SFG spectra (see Figure 2); (B) Anodic-going scan, DFG spectra (see Figure 3); (C) Anodic-going scan, DFG spectra (see Figure 4). The error bars correspond to estimated 95% confidence intervals. Figure 2); (B) Anodic-going scan, DFG spectra (see Figure 3). The error bars correspond to estimated 95% confidence intervals. (A) Cathodic-going scan, SFG spectra (see Figure 2); (B) Anodic-going scan, DFG spectra (see Figure 3); (C) Anodic-going scan, DFG spectra (see Figure 4). The error bars correspond to estimated 95% confidence intervals.
The value of the interference parameter (for details, see the Appendix) does not exhibit a definite trend in either scan and it fluctuates close to zero: −0.018 ± 0.025. The potential-dependence of the non-resonant parameter estimates from SFG measurements is shown in Figure 10. Figure 2); (B) Anodic-going scan, DFG spectra (see Figure 3); (C) Anodic-going scan, DFG spectra (see Figure 4). The error bars correspond to estimated 95% confidence intervals.
We report data normalised on the value of the parameter estimated from the spectra recorded at the most cathodic values, because the absolute value of is affected by the specific configuration of the optical setup, as detailed in [18]. A clear potential-dependent, hysteretic behaviour can be observed, with higher values at cathodic potentials. Even though a mechanistic justification of this behaviour is beyond the scope of this paper, some correlation can be noticed between the discontinuity in plot (A) and the potential of formation of adsorbed CN − in the cathodic-going scan (ca. −1,25 V); the hysteresis, showing higher values in the anodic-going scan (B) might be related to the presence of adsorbed CN − , the drop at higher potentials might correlate with the CV features discussed in Section 2.1.
Electrodeposition of Au from a [BMP][TFSA]-based solution containing CTDB and K[Au(CN) 2 ]
The DFG spectra recorded during an anodic-going scan starting at −2.5 V are reported in Figure 4. As far as the nitrile peak is concerned, its parameters are essentially independent on the potential: (i) the peak position o is 2,204 ± 3 cm −1 , the same value found in the absence of electrodeposition (Section 2.2.1); (ii) the peak width is 7.6 ± 1.9 cm −1 , very close to that estimated in the anodic-going scan with just CTDB in the solution; (iii) the peak height is 0.10 ± 0.06, very close to the values recorded in the absence of Au(CN) 2 − , but it does not seem to exhibit the maximum shown is Figure 8B.
The CN − peak exhibits a very small Stark tuning of 1.2 ± 0.6 cm −1 V −1 ( Figure 5C). This value is smaller than that found without K[Au(CN) 2 ] in the same solvent and notably smaller than that measured for a [BMP][TFSA] solution with K[Au(CN) 2 ], but without CTDB: 11.2 ± 1.1 cm −1 V −1 [8]. This notable reduction in the Stark tuning in the case of coadsorption of CN − and CTDB-related species reasonably correlates with the levelling activity of the organic. The behaviour of the peak width ( Figure 7C) and height ( Figure 9C) is very similar to that found in the absence of electrodeposition and the same comments of Section 2.2.1 apply also here. Also the potentialdependence of the non-resonant parameter behaves as in the anodic-going scan measured from the electrolyte without the Au(I) cyanocomplex ( Figure 10C). These results show that the interfacial behaviour of CN − at the Au surface, both is the presence and in the absence of Au electrodepositionas studied by DFG-is essentially the same: since in previous investigations we have found notable effects of the electrodeposition process on the in situ spectroscopic behaviour of CN − , due to the optical properties of nano-sized crystallites [16,19,20] or layered structures [21] forming by electrodeposition, the present result can be correlated to the excellent levelling properties of CTDB, giving rise to growth of Au with spectroscopic properties that are not distinguishable from those of polished polycrystalline Au.
Experimental
The basic Au electrodeposition bath was the same as described in [8]: Details on solution preparation and handling are also provided in [8]. The composition was 0.025 M K[Au(CN) 2 ] (Engelhard) solution in [BMP][TFSA] (99% Iolitec). To this bath we added CTDB 1 mM (Maybridge). The working electrode was polycrystalline Au disk of 8 mm diameter and 3 mm thickness, treated by flame annealing, as detailed in [7]. The quasi-reference (QRE) and counter electrodes were Au wire, as customary in the literature [1]: All potentials are reported vs. Au QRE. The thin-layer cell is described in detail in [22]. The optical setup using the infrared optical parametric oscillator (IR-OPO) is detailed in [22]: Briefly, p-polarised tunable IR is delivered between 2.7 and 6 μm with energy resolution of 2 cm −1 . The p-polarised VIS is a doubled Nd:YAG. Spectral modelling and data-processing methods are illustrated below.
Single-Resonance Model for SFG/DFG
According to the classical approach of [17], SFG/DFG spectra exhibiting a single peak can be modelled as: where: (2) and the subscripts R and NR stand for "resonant" and "non-resonant" respectively, a and b are the freeand bound-electron contributions, A is the resonator strength, o is the corresponding resonant frequency and its width. Elaborating on Equation (2) and defining: x o , by simple algebra it can be shown that: where: . The form of Equation (3) -with o , , and as fit parameters, ensures minimal parameter correlation for the NLLS fitting procedure [9].
N-Resonance Model for SFG/DFG
Elaborating on Equation (3), it can be straightforwardly proved that: defining: , by lengthy, but otherwise simple algebra one can derive: where: . The additional terms jk express the pairwise interference between couples of resonances.
Identification of a Guess Set of Parameters by Graphical Approach and Linear Least-Squares
In this section, the discussion is limited to the case N = 1 for DFG, but the same approach can be followed for a general N and both SFG and DFG, provided the resonances are separated (i.e., , where the subscripts "indep" and "coupled" refer to independent vs. couples resonances). The authors were not able to find a general approach to the problem of guess set identification in the case of strongly interacting resonances. With these provisos, following the analytical interpretation of Equation (3) as the starting parameter choice. The NLLS code hopefully will seek a sound minimum (in the sense defined above) along a reasonably hyperparabolic objective function.
Recovery of the "Physical" Parameter Set from the "Minimal-Correlation" Parameter Set
In this section we discuss the special case of N = 1 for DFG. A similar approach can be taken in the general case, again, provided the resonances are sufficiently separated, in the sense discussed in Section A3. The original parameter set b a A , , can be recovered from the transformed parameter set through the algebraic manipulations explained below.
(i) Since, in the case of Au, b a for Au, we can take: (ii) It is possible to use the approximation (i) to estimate A from as follows: . Since physical solutions ought to be positive, it follows that: (iii) At this point, it is possible to estimate a from : , whence: (iv) Once an estimate of a is available, it is possible to produce a better estimate of b by using the exact expression: It is worth noting in conclusion that, in any case, the "minimal-correlation" parameter set can be used directly for a meaningful physical discussion of spectral results and it is not always necessary to go back to the original parameter set of Equation (2).
Conclusions
In this paper we report on the electrochemical adsorption of CTDB from an [BMP][TFSA] RTIL solution on Au. The Au electrode is either metallographically polished polycrystalline Au or the dynamic surface resulting from ongoing growth by electrodeposition. This study is based on electrochemical measurements and in situ SFG/DFG non-linear spectroscopy. As a function of applied potential and electrode history, the adsorbed species are either a nitrile moiety of CDTB or coadsorbed nitrile and CN − . In the solution containing only CTDB, CN − derives from cathodic decomposition of the organic. In the electrodeposition bath, CN − is also released as a result of the reductive decomposition of the Au(I) cyanocomplex. Quantitative analyses of potential-dependent SFG/DFG spectra have disclosed details on the adsorption modes of CTDB and CN − at the Au surface and on their mutual interaction. On the basis of Stark tuning measurements, CTDB notably lowers the interaction of CN − with the growing Au surface: This behaviour correlates with a beneficial effect on electrodeposit quality, in terms of morphological control. Apart from the potential-dependent (CN − ) resonance position, in the presence of CTDB the electrodeposition process was found to have a limited bearing on the vibrational properties of the coadsorbates as well as on the electronic properties of the metal substrate, proving that the empirically observed levelling effect of CTDB in electrodeposition has a molecular correlate in the fact that the optical properties of the Au surface are the same for a polished sample and for the material growing by electrochemical reduction. | v3-fos-license |
2018-12-21T12:26:45.471Z | 2016-07-30T00:00:00.000 | 73665529 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.5539/apr.v8n4p64",
"pdf_hash": "f6b2611d171cf9e771e29935563a8d426f4f9507",
"pdf_src": "ScienceParseMerged",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118838",
"s2fieldsofstudy": [
"Agricultural and Food Sciences"
],
"sha1": "f6b2611d171cf9e771e29935563a8d426f4f9507",
"year": 2016
} | pes2o/s2orc | Characterization of Water and Nitrogen Stress of Maize by Laser Induced Fluorescence
Water and nitrogen are essential for the optimal development of corn plants. A deficiency of these elements leads to lower crop production. Also, the health status of a plant influences the photosynthesis process. The photosynthetic diagnosis of a plant from the chlorophyll fluorescence spectrum induced by laser is non-destructive to the sample, reliable and fast method. As part of this work, we showed that it is possible to detect the nitrogen and water deficiencies of corn from the chlorophyll fluorescence ratio at 690 nm and 740 nm, when the measurements are performed before the senescence phase. Indeed, we found that the R fluorescence ratio increases over time, for any stress on the plant. However, R decreases with the nitrogen stress and increases with increasing water loss. The measures should be performed 51 Days After Planting (DAP) to detect water deficiency and the suitable date for nitrogen deficiency detection is 61 DAP. Before each of these dates, the plants will be considered water deficient if the fluorescence ratio R ≤ 1.34 and will be nitrogen stressed if R > 1.36.
Introduction
Corn is the most consumed cereal in the world.Indeed, it represents 41 % of world cereal production (Perrier-Brusle, 2010).It is mainly used for feeding cattle in industrialized countries, but in sub-Saharan Africa and Latin America, it is used to feed the population (Bassalet, 2000).In Côte d'Ivoire, the 2014 national production of this cereal exceeded 600 000 tonnes (Réseau Non-Gouvernemental Européen sur l'Agroalimentaire le Commerce l'Environnement et le Développement [RONGEAD], 2014).However, the country is not self-sufficient in this cereal.It is forced to import corn to provide industrial and agro-pastoral needs.Therefore, it is necessary, even imperative to increase the production of this cereal to meet the existing needs and ultimately ensure food security of the Ivorian population.In Côte d'Ivoire, the corn growing areas are mainly located in Savannah, low rainfall area (Yéo, 2011).
Water and nitrogen are essential mineral elements for the optimal development of corn plants (Saccardy, 1997;Plénet, 1995;PNTTA, 1999).A deficiency in these elements leads to lower crop production.In agronomy, detecting the nutritional deficiencies of plants is usually carried out by foliar diagnosis which is a destructive method.
The fluorescence emission is directly related to the photosynthesis process (Papageorgiou & Govindjee, 2004;Stirbet & Govindjee, 2011;Wim & Andrej, 2013) in which are made of many biological exchanges.The health status of a plant influences this process.Thus, the study of the fluorescence spectrum can detect any stress on the plant at leaf and canopy scale (Chappelle, Wood, McMurtrey & Newcomb, 1984;Méthy, Olioso & Trabaud, 1994;Bourrié, 2007).The interest of this photosynthetic diagnosis is that it is non-destructive, fast and reliable.As part of this work we characterize the water and nitrogen deficiencies of corn plants by chlorophyll method of laser-induced fluorescence.
Experimental Material
Data were collected in vivo and in situ using an USB4000 -type FL fluorescence spectrometer.This device can record plant chlorophyll fluorescence spectra whose wavelengths range is from 360 nm to 1 000 nm in steps of 0.22 nm.The samples were excited by a LED emitting at 450 nm through a bifurcated optical fiber.The acquisition, storage and processing of the collected spectral data were conducted using a laptop.The Figure 1 shows the experimental setup.
Vegetal Material
The corn variety used in this study is called DMRESR-Y.It was provided by the Centre National de Recherche Agronomique (CNRA) in Côte d'Ivoire.Its maturation cycle is 90 to 95 days and its grains are yellow and horny (L.Akanvou , R. Akanvou, Anguété & Diarrassouba, 2006).
Methods
The plantations for both studies were divided into blocks.Each block contained the same deficiency levels (nitrogen or water) to ensure that the arrangement of the buckets in the field does not influence the results.
Water Stress Induction
In the case of the water stress study, the corn planting was made in a greenhouse as we did not want to be dependent on the weather and we had to control the water amount we had to provide to the corn plants.
A mineralogical analysis of the soil used to fill the buckets revealed that it had high content of.all essential nutrients for the corn plants development.
We first sought the soil field capacity : it is the amount of water that the ground can retain.Knowing this value allowed us to determine the various doses to apply to the soil to induce the hydric stress.The field capacity of the used ground was 2 liters.We then generated four levels of water stress as listed below: W12: 12.5 % of the soil field capacity per bucket (0.25 l of water) W25: 25 % of the soil field capacity per bucket (0.5 l of water) W50: 50 % of the soil field capacity per bucket (1 l of water) W100: 100 % of the soil field capacity per bucket (2 l of water) After a heavy watering the day before, we sowed corn grains the next day.The plantation in the greenhouse consisted of 72 buckets of 20 l capacity, left in 3 blocks (see figure 2).
Figure 2. Water stress study planting plan Every bucket contained two growth pouches at the rate of three grains per pouch.We removed corn plants from the bucket, to have a unique plant in a growth pouch 15 Days After Plantation (DAP).So, every bucket contained two corn plants.
We induced the water stress 30 DAP.Then, we started to collect spectral data 37 DAP.From this date and once a week, the fluorescence spectrum of every plant was recorded.This operation took place between 09:00 am and 1:00 pm.This phase ended 72 DAP when plants reached the senescence phase.
Nitrogen Stress Induction
The buckets were filled with poor nitrogenous soil, in order to control the intake of nitrogen fertilizer.Each bucket with a capacity of 30 liters had three growth pouches with three seeds per growth pouch.
We brought an amount of 2.27 g of nitrogen, phosphorus and potassium (NPK ) to every hole to allow a good seeding of the corn grain.Then, the corn seedlings were thinned to one plant per hole 15 DAP.So, there were only three plants per pot.
The nitrogenous stress was led 30 DAP by providing various doses of urea.So, we generated five fertilization levels as listed below: N0: 0 g of urea/plant (no nitrogen provided to the plant) N1: 0.377 g of urea/plant (1/4 part of the nitrogen recommended dose) N2: 0.755 g of urea/plant (2/4 part of the nitrogen recommended dose) N3: 1.133 g of urea/plant (3/4 part of the nitrogen recommended dose) N4: 1.510 g of urea/plant (nitrogen recommended dose).
This plantation consisted of 80 buckets of 30 l capacity, left in 4 blocks.Every block contained the 5 fertilization levels and each fertilization level included 4 buckets (see figure 3).Ten days after the application of nitrogen stress; that is 40 DAP, we began collecting spectral data.From that date, once every week, the fluorescence spectrum of each plant was recorded.This operation that ended 82 DAP took place between 09:00 am and 01:00 pm.A total of seven series of measurements were carried out during the different development stages of corn plants.
Data Processing
During the measures at leaf scale, every deficiency level (hydric or nitrogenous) applied to the plant in the same block, is characterized by the average fluorescence spectrum.
We noticed that for the same applied stress level, there is no significant difference between the measurements performed on the blocks.We then worked with the average values of the ratios R computed on the blocks, for the same given deficiency level.
For all the recorded spectra, the digital data are converted to text files and then imported into the MATLAB software to compute the ratios of intensities of the two characteristic chlorophyll fluorescence peaks (R = F 690 /F 740 ).F 690 corresponds to the intensity of the fluorescence peak at 690 nm and F 740 is the intensity of the fluorescence peak at 740 nm.We used the fluorescence ratio in our study, among other fluorescence parameters as it is a pertinent indicator, widely used in plant stress detection (Tremblay, Wang & Cerovic, 2012).
The various graphics were edited with the software ORIGINPro 8. R values given on the charts are the average values for every deficiency level.Indeed, it is recommended to use the mean value of ratio for many measurements for several plants to have reliable results instead of one single measurement (Fedotov, Bullo, Belov & Gorodnichev, 2016).
Water Stress Case
The graphs in Figure 4 show for each stress level, the intensities of fluorescence ratios depending on the development stage of corn plants.For all treatments, we notice an increase in the value of R depending on the plant development stage.Thus, the value of R increases with the plant age.From 51DAP to 65DAP each curve compared to other is a function of the nutritional stress: greater the stress is, smaller R is.
From the date 51DAP, we also find that the curves (W12, W25) and (W50, W100) are close to each other.The differences between the ratios values for considered couples treatments are weaker at 65DAP.We can then consider the two extreme curves : W12 represents stressed plants and W100 represents non-stressed ones.At 51DAP the gap between the extreme curves is maximum.It would be the indicated date for the water stress detection.The water deficiency detection measures are efficient in the time interval [51DAP, 65DAP].
As the histograms in Figure 5 show, until 51DAP, all water -deficient plants have a ratio R ≤ 1.34.But, for nondeficient plants the ratio is still greater than 1.34.In addition, as water is an essential element for plant survival, a lack of water causes early senescence.This is the case from 58DAP.Then, we notice that all plants have R > 1.34.So, the appropriate time to make the measures for the hydric stress detection would be 51DAP.
Nitrogen Stress Case
The charts in figure 6 show the fluorescence ratio over the treatment applied to corn plants.We find that at any plant development stage, the ratio R decreases when stress decreases.
According to Méthy, Olioso & Trabaud (1994), the amount of chlorophyll in the plant is proportional to the photosynthetic activity.However, the nitrogen deficiency causes the decrease of the activity.The ratio R therefore increases when the nitrogen stress decreases.Figure 6.Changes in the relationship between the fluorescence ratio and the nitrogen treatment The Figure 7 displays the fluorescence ratios over the plant development stage, for each nitrogenous stress level.Despite serrated evolution of certain values, we observe for all treatments, an increase of the R value depending on the plant development stage.Thus, the R value increases with the plant age.This increase is more pronounced for N0 and N1 treatments than for those of N3 and N4.
We also notice on Figure 7 that charts (N0, N1) and (N3, N4) are close to each other.
The median position of the N2 treatment chart compared to curves treatments couples (N0, N1) and (N3, N4) illustrates the average fertilization rate that we applied.Furthermore, the arrangement of each chart compared to other highlights a parallelism with different fertilization levels we generated.
The table 1 shows the differences between the pairs of curves (N0, N1); (N3, N4) and (N0, N4).Table 1 shows that the greatest differences between the fertilization levels during the plant development, are obtained at 61 DAP and 82 DAP.We cannot consider the second date because it is already in the plant senescence phase.Thus, the best period to conduct early nitrogen stress detection measurements would be 61 DAP.
This table also shows that the differences between N0 and N1 on one hand and N3 and N4 on the other hand are very low compared to the differences between N0 and N4.N1 and N0 Fertilizations produce the same effect of stress on the plant.It would therefore be useless to bring 25 % of the nitrogen needs to the plant.However, it would be economical for the farmer to provide 75 % of the nitrogen needs of the plant because the N4 and N3 treatments produce the same stress effect.
We then considered both extreme fertilization levels : -nitrogen deficient level for N0 treatment plants; -nitrogen fertilized level for plants that have undergone the N4 treatment.
For both generated fertilization levels, figure 8 shows the fluorescence ratio over the development stage.
The maize variety used in this study has a short-cycle production (90-95 days).At 70 DAP, the culture is in the senescence process.Figure 8 shows that the fertilized plants have a ratio R = 1.36 on that date.All measurements performed before the senescence phase are such that: -R ≤ 1.36 for fertilized corn plants; -R > 1.36 for deficient corn plants.
Moreover, the measures we took during the senescence phase provide R values greater than 1.36 whatever studied plants.In addition, the R value for fertilized plants is still lower than deficient plants.
Conclusion
This study allowed to show that it is possible to detect the nitrogen deficiency and the water deficiency of corn plants from the ratio of chlorophyll fluorescence intensities of at 690 nm and 740 nm, when the measurements are performed before the senescence phase.The senescence phase occurs earlier in plants for water stress: − to detect water deficiency, the favorable date is DAP 51.Corn plants will be considered water deficient if R ≤ 1.34 and water unstressed if R > 1.34 before the date specified for detection − While to detect nitrogen deficiency, the convenient day would be 61 DAP.Corn plants will be considered nitrogen fertilized plants if R ≤ 1.36 and nitrogen deficient plants if R > 1.36 before this date.
We find that the fluorescence ratio R increases over time, for any stress on the plant.However, R decreases with the nitrogen stress and increases with increasing water deficiency.
However, further experiments must be led to determine the amount of nitrogen and water to provide to corn plants to correct any detected deficiency.
Figure
Figure 1.Experimental setup
Figure 3 .
Figure 3. Plantation plan for the nitrogen stress study
Figure 4 .
Figure 4. Temporal changes of the fluorescence ratio for the four hydric treatments
Figure 7 .
Figure 7. Temporal changes of the fluorescence ratio for the five nitrogen treatments
Figure 8
Figure 8 also confirms that the date 61 DAP is convenient to perform nitrogen stress detection measures.These results are similar to those obtained bySoro, Adohi-Krou, Diomandé & Ebby (2004) in a study on oil palm trees.
Figure 8 .
Figure 8. Fluorescence intensity ratios for N0 and N4 treatments over the development stage | v3-fos-license |
2020-07-09T09:10:40.829Z | 2020-06-30T00:00:00.000 | 225684425 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://bds.ict.unesp.br/index.php/cob/article/download/1989/1526",
"pdf_hash": "e9f273d145a8de95a8c9ffd8893b184585afe731",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118850",
"s2fieldsofstudy": [
"Materials Science"
],
"sha1": "0787c0d0d911d7257c31000708f0def02f827ed1",
"year": 2020
} | pes2o/s2orc | Efficacy of diode laser and sonic agitation of Chlorhexidine and Silver-nanoparticles in infected root canals
Objective: To assess the efficacy of agitation of chlorohexidine (CHX) and Silver nanoparticles “AgNps” with 810nm diode laser or sonic endoactivator compared to side –vented needle on infected root canals with Enterococcus “E” Faecalis biofilms. Material and Methods: Sixty-five extracted human premolars with single oval canals were instrumented by protaper system up to F3. Biofilms of E. faecalis were generated based on a previously established protocol. Two teeth were used to check the biofilm formation, then the remaining Teeth were randomly divided into three equal experimental groups according to agitation techniques used: group 1 (810 nm diode laser with 1 watt) , group 2 (sonic endoactivator) and group 3 (Side vented needle). Each group was further divided into three equal subgroups according to the irrigant solution into; subgroup A: chlorohexidine, subgroup B: silver nanoparticles and subgroup C: distilled water: Confocal laser scanning microscopy “CLSM” was used to assess bacterial viability. Data were analyzed by appropriate statistical analyses with P = 0.05. Results: Regarding the activation method, all groups had a significantly high percentage of dead bacteria (P < 0.05). However, Laser was significantly the highest and Endoactivator the least (P < = 0.001). Diode laser agitation of AgNps irrigant showed the highest reduction percentage of bacteria (78.1%) with a significant difference with both CHX and water irrigation, Conclusion: Under the condition of the present study; results reinforced that laser activation is a useful adjunct, 810 nm diode laser agitation of AgNps or chlorhexidine was more effective in disinfection of oval root canals than endoactivator and side vented needle techniques. RESUMO Objetivo: Avaliar a eficácia da agitação de clorohexidina (CHX) e nanopartículas de prata (AgNps) , com laser de diodo de 810 nm ou endoativador sônico, em comparação à agulha de ventilação lateral, em canais radiculares infectados com biofilmes de Enterococcus “E”; Faecalis. Material e Métodos: Sessenta e cinco pré-molares humanos com um único canal oval, extraídos, foram instrumentados pelo sistema protaper até F3. Os biofilmes de E. faecalis foram gerados com base em um protocolo previamente estabelecido. Foram utilizados dois dentes para verificar a formação do biofilme, e os dentes restantes foram divididos aleatoriamente em três grupos experimentais iguais, de acordo com as técnicas de agitação utilizadas: grupo 1 (laser de diodo 810 nm com 1 watt), grupo 2 (endoativador sônico) e grupo 3 (Agulha com ventilação lateral). Cada grupo foi dividido em três subgrupos iguais, de acordo com a solução irrigante; subgrupo A: clorohexidina, subgrupo B: nanopartículas de prata e subgrupo C: água destilada: A microscopia confocal de varredura a laser foi usada para avaliar a viabilidade bacteriana. Os dados foram analisados por análises estatísticas apropriadas com P = 0,05. Resultados: Em relação ao método de ativação, todos osgrupos apresentaram percentual significativamente alto de bactérias mortas (P < 0.05). No entanto, para o laser foi significativamente o mais alto e, para oendoativador, o menos alto (P < = 0.001). A agitação com laser de diodo doirrigante AgNps apresentou a maior porcentagem de redução de bactérias (78,1%), com diferença significativa tanto para irrigação com CHX quanto comágua. Conclusão: Sob as condições do presente estudo; os resultadosreforçaram que a ativação a laser é um complemento útil, a agitação por laserde diodo de 810 nm de AgNps ou clorexidina foi mais eficaz na desinfecção dos canais radiculares ovais do que as técnicas de endoativador e agulha com ventilação lateral. O R I G I N A L A R T I C L E Efficacy of diode laser and sonic agitation of Chlorhexidine and Silver-nanoparticles in infected root canals Eficácia do laser de diodo e agitação sônica de clorexidina e nanopartículas de prata em canais radiculares infectados Latifa Mohamed ABDELGAWAD1, Niven ASMAIL1, Somia Abdel LATIF2, Ali Mohamed SAAFAN1 1 Medical Laser Applications Department National Institute of Laser Enhanced Sciences Cairo University Cairo Egypt. 2 Microbiology and Molecular Biology Department Faculty of Medicine Cairo University – Cairo Egypt. doi: 10.14295/bds.2020.v23i3.1989 UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO DE MESQUITA FILHO” Instituto de Ciência e Tecnologia Campus de São José dos Campos Ciência Odontológica Brasileira
INTRODUCTION
O ne of the main challenges facing the dentists in the endodontic steps is how to totally disinfect the root canal [1]. E faecalis is the most prominent microorganism involved in persistent infections after root canal therapy. E. faecalis has the ability to penetrate the dentinal tubules and cementum. It can survive in biofilm form at anatomical complexities of root canal system, over the foreign bodies like gutta-percha or other obturating materials extending into periapical tissues and can survive for prolonged periods under nutrientdepleted conditions [2].
Trying to overcome the challenge compulsory by the presence of biofilm and reach complete disinfection or significant bacterial reduction in the root canals, many irrigants have been indicated during endodontic treatment. Chlorhexidine gluconate (CHX) at 2% is one of the most commonly used irrigants and considered as an effective antimicrobial agent. It has many properties; broad-spectrum, substantively (extended outstanding activity) and a relative absence of toxicity that recommend it to be used as an endodontic irrigant [3,4].
Silver nanoparticles (AgNps) have gained popularity because of their unique ability to penetrate tissues, interact with bacteria, exhibit potent antimicrobial activity and biocompatibility [5].
The agitation of irrigating solutions with the laser has become common [6]. Researchers examined many laser systems to attain complete disinfection of root canal system and the adjacent dentinal tubules and yet there is still argument about which is the most powerful laser system in regards to providing a sterilized root canal system. The high bactericidal effect of diode laser has been reported in multiple studies [7]. Therefore, due to the bactericidal effect of diode laser and its low cost compared to other commonly used laser systems in endodontic, it can be used in agitation of the irrigation during the mechanical debridement procedures [8].
The Endoactivator System "EA" is a sonically driven irrigant activation system planned to produce dynamic fluid agitation inside the canal that has been shown to improve the effectiveness of irrigation better than the traditional syringe irrigation [9]. So the present study highlighted the effect of 810 nm diode laser and sonic agitation on two types of irrigants; [chlorohexidine (CHX) and silver nanoparticles (AgNps)] applied in root canals.
MATERIAL AND METHODS
This research was approved by the Ethics Committee of National Institute of Laser Enhanced Sciences (NILES), Cairo University, Egypt (CU/NILES/30/19). Also this study was done in the microbiology and molecular biology department, faculty of medicine, Cairo University.
Selection and Mechanical preparation of samples
Sixty -five extracted human premolars with single oval canal and fully formed apices were selected from hundred extracted teeth for periodontal reasons. Each root was digitally radiographed using RVG 6200 digital sensor (Carestream, Rochester, New York, United States) and measured by its software to select canals with ovality ratio more than 2.5. The crowns were sectioned such that roots were standardized to 12 + 2 mm and stored in labeled vials at 100% humidity.
Final irrigation and sterilization of the samples
Final irrigation was performed with 5 ml 15% Ethylenediaminetetraacetic acid "EDTA" (Endo-Solution, Cerkamed, Stalowa Wola, Polska) for 3 min and 5 ml NaOCl for 3 min to remove the smear layer, and then the canal was irrigated with 10 ml of physiological saline solution to remove the EDTA. Finally, the teeth were sterilized in the autoclave at 121°C for 30 min .
Inoculation and incubation of the teeth with E faecalis
Using a sterile micropipette, twenty microliters of E .faecalis suspension (matching McFarland's turbidity of tube no 0.5) was syringed into each root canal. Each inoculated root was kept in separate sterile test tube with caps in a rack. Then incubated at 37°C for 7 days, to allow the proliferation of microorganisms, and their further penetration into the dentinal tubules and formation of biofilms.
Classification of the samples:
Two teeth were used to check the biofilm formation, then the remaining teeth (63) were randomly divided into three equal experimental groups according to agitation techniques used: group 1 (810 nm diode laser with 1 watt), group 2 (sonic endoactivator) and group 3 (Side vented needle). Each group was further equally divided into three subgroups according to the irrigant solution into; subgroup A: chlorohexidine, subgroup B: silver nanoparticles and subgroup C: distilled water: The agitation mechanisms in the three groups were as a follow:
Group 1 (diode Laser)
Agitation was done with 810 nm Diode laser with continuous mode and output power 1 watt (Zolar lasers, Canada) which delivered into 200 um flexible plain endodontic fiber. The fiber was inserted parallel to root canal wall and used with helicoidally movement in apical-coronal directions. Agitation was done for 10 seconds to 1 ml irrigant. The sequence was repeated 5 times, giving 5 ml total volume and 50 sec total agitations.
Group 2 (Sonic endoactivator)
In this group agitation was done by Sonic endoactivator device (Dentsply, Tulsa) with red polymer tip # 25/0.04 at speed 10000 rpm. The samples in this group were irrigated with 5 ml of an irrigating solution, where each 1ml of the irrigant was followed by 10 seconds of sonic agitation [11].
Group 3 (side -vented needle)
Side vented needle delivered 5 ml irrigant during moving slowly up and down along canal length. All agitations were performed at 2 mm away from the working length.
Confocal laser scanning microscopy (CLSM) examination
Sixty -five roots were sectioned for detecting viable and nonviable bacteria on root canal walls. Roots were set in blocks of fast setting acrylic resin and two lines were drawn with a marker on the exposed part of the root, one buccal and one palatal for vertically sectioning into two halves, approximately parallel to the tooth axis, utilizing the microtome saw. A sample from each sectioned root was taken for scanning. Each sample was stained by both Acridine Braz Dent Sci 2020 Jul/Sep;23 (3) 4 orange (AO) and Propidium iodide (PI) dyes separately, just before the CLSM examination. Zeiss LSM 710 confocal microscope (Carl Zeiss, Germany) was used with 40 x objectives for scanning. Three random areas of the middle third of the root canal were scanned with a 2-mm step size by the CLSM. For each image the median intensity of green and red bacteria were calculated by the soft-ware (green for live and red for dead bacteria), this number was tabulated and statistically analyzed.
Data presentation and analysis
To identify the effect of activation protocols on bacterial reduction (dead cell %) in each irrigation protocol, one-way ANOVA was applied. Bonferroni's correction for multiple testing was used in one-way analysis of variance. P = 0.05 for the analyses. Twoway ANOVA was performed to weigh the effect of the irrigation protocol and activation method as the two independent variables on the outcome (percentage of dead cells. Data was analyzed using IBM SPSS advanced statistics (Statistical Package for Social Sciences), version 21 (SPSS Inc., Chicago, IL).
RESULTS
The data obtained from the CLSM are tabulated (Table I). Figure 1 shows a homogenous penetration of E. faecalis deep into the dentinal tubules of the root canal. figure 2 shows biofilm destruction within the root canal lumen for all groups. Regarding the activation method, all groups had a significantly high percentage of dead bacteria (P < 0.05). However, Laser was significantly the highest and Endoactivator the least (P <= 0.001).
Regarding the irrigant type; AgNps activated with diode laser had the highest percentage of dead bacteria (78.1%) followed by needle agitation (76.47%) then sonic (72.94%). Without significant difference (p > 0.05) In chlorhexidine subgroup, the high percentage of dead bacteria was in laser group (71.81%) followed by needle group (70.18%) then sonic group (68.99) Without significant difference (p > 0.05). while distilled water subgroup showed high percentage of bacterial reduction in laser group (71.46%) followed by sonic (62.7847%) then needle group (60.6%) with significant difference between laser and sonic and laser with needle (p < 0.05) while there was no significant difference between sonic and needle (p >0.05). Table I percent of apparently dead bacterial cells in the biofilm within the dentinal tubules, assessed by confocal laser microscopy after three different activation techniques with three different irrigant.
(*) means significant between laser and sonic in H2O irrigant (#) means significant between laser and needle in H2O irrigant (a) Means significant CHX and AgNps within the same group (b) Means significant between CHX and H2O within the same group (c) Means significant between AgNps and H2o within the same group.
Group
Subgroup
DISCUSSION
The main goal of endodontic treatment is the complete disinfection of the root canal system; however, it is difficult due to complex anatomy of the root canal system and biofilm mediated infection. E. faecalis was chosen because it is generally believed that it is one of the most resistant microorganisms found in the infected root canals and endodontic treatment failures [9,10].
The clinical challenge to deliver irrigants into unprepared infected canal extensions; as well as the most apical infected segment recommended the use of automated agitation of irrigant in disinfection of root canal systems [7]. So the present study evaluated the antibacterial effect of activated agitation of diode laser, sonic and side-vented needle with three types of irrigants; Chlorhexidine, AgNps, and distilled water in infected oval root canal with E faecalis. Chlorhexidine (CHX) was selected in the present study as it has a broadspectrum antimicrobial effect and kills E. faecalis in the dentinal tubules. [9]. .as well as AgNps exhibit potential antibacterial activity and does not allow to develop resistance [11] Positively charged AgNps interact with the negatively charged bacterial cell walls, adhere, and penetrate into the bacterial cell leading to the loss of cell wall integrity and permeability [12][13][14][15][16][17].
Diode laser induced cavitation and side vented needle non laminar streaming probably provided better mechanical turbulence to penetrate infected dentin and effectively carry away the microorganisms than acoustic streaming by vibrating inserts of endoactivator [18][19][20].
In the present study the lasing protocol favored the disinfection of the root canal. Through limited studies existed specially on 810 nm diode laser; generally, diode agitation seems promising [6,18]. Agitation of AgNps by 810 nm diode laser I watt for 50 sec improved E. faecalis eradication compared to sonic or needle agitation. Using 10 sec continuous 810 nm diode laser which repeated five times for agitation of AgNps improved e faecalis eradication by 78.05% however inadequacy of diode laser to remove more percentage of bacteria may be due to using of low output power (1 watt) which is in accordance with other studies [21][22][23][24][25][26].
Sonic agitation produced bactericidal effect in the present study probably due to oscillating movement which allow hydrodynamic circulation of the irrigant. A reduced antibacterial efficiency of sonic compared with other techniques may be due to the greater displacement amplitude of the small vigorously vibrating polymer tip, also due To weakened. Currents, impeding microstreaming and irrigant activation in apical part of the root beyond the vibrating tip [27][28][29].
In the present study, laser activated agitation was more efficient than endoactivator Braz Dent Sci 2020 Jul/Sep;23 (3) 6 [18 ].Endoactivator in the present study was less efficient than needle agitation this may be due to vacuum and remove of irrigant before replenishing [30 ].Side -vented needle agitation came after laser and better than sonic as vertical up and down movements of the needle allowed distributing the localized high dynamic flow at the side exit along the oval canal allowed effective reflux of irrigant coronally as previously reported [ 30] .
The enhancing effect of 810 nm diode laser agitation in disinfection of oval canals can be complemented by a further study to evaluate other different protocols in canal disinfection with different irrigant and providing better bactericidal effect.
CONCLUSIONS
Under the condition of the present study; the results reinforced that laser activation is a useful adjunct, 810 nm diode laser agitation of AgNps and chlorhexidine was more effective in disinfection of oval root canals than endoactivator and side vented needle techniques. | v3-fos-license |
2020-10-18T13:05:39.003Z | 2020-10-01T00:00:00.000 | 223556097 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/2227-9059/8/10/411/pdf",
"pdf_hash": "77d9b89f94433c5b743f1bdddd2ce972b34a5b1e",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118854",
"s2fieldsofstudy": [
"Chemistry",
"Medicine"
],
"sha1": "c9c36191245c109fa60be79d272cd94e07c233db",
"year": 2020
} | pes2o/s2orc | CMT-308, a Nonantimicrobial Chemically-Modified Tetracycline, Exhibits Anti-Melanogenic Activity by Suppression of Melanosome Export
CMT-308 is a nonantimicrobial chemically-modified tetracycline (CMT), which we have previously shown exhibits antifungal activity and pleiotropic anti-inflammatory activities, including inhibition of the enzymatic activity of matrix metalloproteinases (MMPs). Based on its chemical structure, we hypothesized that CMT-308 could inhibit melanogenesis and might be a candidate for the treatment of skin hyperpigmentation disorders which occur due to unregulated melanin biosynthesis and/or transport. CMT-308 was first studied for any effects on activity of the enzyme tyrosinase in vitro using a purified preparation of mushroom tyrosinase; the mode of inhibition of the soluble fungal enzyme was evaluated by Lineweaver-Burk and Dixon plots as well as by non-linear least squares fitting. Next, the effects of CMT-308 were tested in mammalian cell cultures using B16F10 mouse melanoma cells and further validated in darkly-pigmented human melanocytes (HEMn-DP). Our results showed that micromolar concentrations of CMT-308 inhibited mushroom tyrosinase enzyme activity, using the first two substrates in the melanogenesis pathway (l-tyrosine and l-3,4-dihydroxyphenylalanine (l-DOPA)); CMT-308 inhibited mushroom tyrosinase primarily via a mixed mode of inhibition, with the major contribution from a competitive mode. In B16F10 cell cultures, CMT-308 (10 µM) significantly diminished total melanin levels with a selective reduction of extracellular melanin levels, under both basal and hormone-stimulated conditions without any cytotoxicity over a duration of 72 h. Studies of potential mechanisms of inhibition of melanogenesis in B16F10 cells showed that, in mammalian cells, CMT-308 did not inhibit intracellular tyrosinase activity or the activity of α-glucosidase, an enzyme that regulates maturation of tyrosinase. However, CMT-308 suppressed MITF protein expression in B16F10 cells and showed copper chelating activity and antioxidant activity in a cell-free system. The significantly lower extracellular melanin levels obtained at 10 µM indicate that CMT-308’s anti-melanogenic action may be attributed to a selective inhibition of melanosome export with the perinuclear aggregation of melanosomes, rather than a direct effect on the tyrosinase-catalyzed steps in melanin biosynthesis. These results were validated in HEMn-DP cells where CMT-308 suppressed dendricity in a fully reversible manner without affecting intracellular melanin synthesis. Furthermore, the capacity of CMT-308 to inhibit melanosome export was retained in cocultures of HEMn-DP and HaCaT. In summary, our results offer promise for therapeutic strategies to combat the effects of hyperpigmentation by use of CMT-308 at low micromolar concentrations.
Introduction
Melanin, a biopolymeric pigment, is produced by melanocytes within specialized vesicles called melanosomes [1], which are exported to keratinocytes where they form a supranuclear cap believed to protect against UV damage by conversion of UV photons into heat [2][3][4]. Ultraviolet (UV) irradiation triggers the secretion of α-melanocyte stimulating hormone (α-MSH) from epidermal keratinocytes [5]; this hormone binds to the melanocortin 1 receptor (MC1R) on melanocytes and activates microphthalmia transcription factor (MITF), which in turn increases the expression of tyrosinase and other proteins [5,6]. Despite having other protective benefits of free-radical scavenging activity and toxic metal-ion chelation in addition to UV photoprotection, the aberrant production of melanin pigment in melanocytes and the over secretion of melanosomes from melanocytes can cause accumulation of melanin in keratinocytes, which manifests as hyperpigmentary disorders such as post-inflammatory hyperpigmentation (PIH), melasma, and lentigo senilis (LS) [7], which cause significant psychosocial stress as it compromises the aesthetic appearance. Furthermore, enhanced melanogenesis might be a risk factor for skin cancer, melanoma [8]. Hence, inhibitors of melanogenesis are also appealing as adjuvants for sensitizing melanoma cells to anticancer therapeutics [9] and to improve radiotherapy outcome [10,11]. Tyrosinase (EC 1.14.18.1) is the central rate-limiting enzyme in the melanogenesis pathway, as it catalyzes the hydroxylation of l-Tyrosine to l-3,4-dihydroxyphenylalanine (l-DOPA) as well its subsequent oxidation to Dopachrome [12,13]. As tyrosinase is a metalloenzyme with two copper ions; chelators that can sequester copper have also shown promise as a target for pigmentation disorders [14][15][16]. The intracellular transport of tyrosinase is regulated by copper uptake and the N-glycosylation process [17]; the role of the enzyme α-glucosidase has been implicated in this glycosylation process in previous reports [18,19]. Consequently, certain antidiabetic drugs such as voglibose [20] and acarbose [21], which are known to inhibit α-glucosidase activity, also suppress melanogenesis. The use of commercial depigmenting agents, hydroquinone (HQ), kojic acid (KA) and arbutin, has been limited since they inhibit tyrosinase in a manner that cannot be fully reversed [22] and cause deleterious effects such as erythema, contact dermatitis, genotoxicity, and carcinogenicity [23,24]. As the process of melanogenesis involves a multi-step pathway, compounds which can target different steps in this pathway provide an attractive target for melanogenesis inhibition. After synthesis and maturation within melanocytes, the melanosomes are exported to the neighboring keratinocytes via multiple molecular pathways [25]. The process of translocation of melanosomes to keratinocytes is accomplished by dendrites, which can retract or extend [26], thereby reducing or enhancing the export of melanosomes and modulating skin pigmentation [27,28]. Currently, several reports have documented novel compounds that have shown efficacy in reducing melanogenesis by inhibiting melanosome export through the reduction in dendricity [29][30][31]. Additionally, we have previously reported on a synthetic steroidal compound, asoprisnil [32], and a fungal-derived natural antibiotic, Thermorubin (TR) [33], both of which suppressed dendricity as one of the modes of inhibition of melanosome export. MITF, one of the key transcription factors which controls tyrosinase and other melanogenesis-related enzymes [34,35], also regulates melanocyte dendricity [36].
Chemically-modified tetracyclines (CMTs also referred to as COLs) belong to a group of novel synthetic tetracycline derivatives, which have the dimethylamino group at C4 carbon eliminated; while this elimination abolishes antimicrobial activity, the anti-MMP activity is retained or even enhanced; these CMTs showed pleiotropic inhibitory properties and were primarily developed as host-modulating agents by Golub et al. [37][38][39]. We have reported on CMT-308, a nonantimicrobial 9-amino derivative of CMT-3, which inhibited the zinc metalloproteinase activity of Bacillus anthracis lethal factor [40], in part through its capacity to chelate metal ions such as Zn 2+ . In addition, we have also demonstrated that CMT-3 displayed inhibitory activity towards serine proteinases in a previous patent [41]. Other studies have documented that CMT-308 has also shown anticancer potential against a variety of cancers including melanoma, prostate [42], lung, and breast cancer [43]. In addition to the anticancer therapeutic properties of CMT-308, another study described the potential of CMT-308 for the treatment of systematic mast cell disorder and rheumatoid arthritis by targeting mast cell proliferation [44].
Previous reports have documented that tetracycline and doxycycline, a semi-synthetic tetracycline, induce cutaneous pigmentation [45,46], but the effects of CMTs on epidermal pigmentation have remained largely unexplored. In the current study, we have selected CMT-308, the 9-amino derivative of CMT-3, because of its exceptional profile of biological actions when compared to other CMTs. For example, CMT-308 was shown to inhibit MMPs with a greater potency than the original 10 CMTs, with an IC 50 of 1.5 µM against MMP-8 and an IC 50 of 4.2 µM against MMP-9 [47]. In addition, CMT-308 has shown minimal phototoxicity as compared to other CMTs when tested using the standard 3T3 NRU phototoxicity test in our laboratory (unpublished results). CMT-308 bears structural similarity to chemically-modified curcumins (CMCs) [48,49], as they both share a β-diketone moiety that confers the capacity to bind Zn 2+ ions. In our previous study, we have reported that the polycyclic antibiotic TR inhibited melanosome export in vitro [33]. As CMT-308 shares structural similarities, including a polycyclic structure containing a β-diketone moiety, to TR, we were prompted to test if CMT-308 might also exhibit anti-melanogenic efficacy. Hence, we hypothesized that CMT-308 might inhibit activity of the enzyme tyrosinase, as well as subsequent steps in the pathway of melanogenesis, that could form the basis for its potential use for the treatment of hyperpigmentation.
Mushroom Tyrosinase Activity Using l-TYR and l-DOPA Substrates
The direct effects of CMT-308 on tyrosinase enzyme activity were tested using a purified mushroom tyrosinase enzyme using l-TYR (monophenolase) and l-DOPA (diphenolase) as substrates. For assaying monophenolase activity, CMT-308 (80 µL) at different concentrations was diluted in 50 mM sodium phosphate buffer (pH 6.5) and was added to a 96-well plate followed by the addition of 100 µL of 0.5 mM l-TYR substrate solution. The reaction was initiated by the addition of 20 µL of 125 µg/mL mushroom tyrosinase enzyme and the reaction's progress was monitored by measuring the kinetics of absorbance at 475 nm (for 20 min every 30 s). The slopes of the kinetic readings were calculated to determine and compare tyrosinase activity from control and expressed as % of the untreated control.
For assaying diphenolase activity, 80 µL of CMT-308, prepared at different concentrations in 50 mM sodium phosphate (pH 6.5) buffer, was added to a 96-well plate followed by the addition of 100 µL of freshly prepared 0.75 mM l-DOPA substrate solution. Subsequently, 20 µL of 35 µg/mL mushroom tyrosinase was added and the production of dopachrome was monitored by measuring the kinetics of absorbance at 475 nm (for 30 min every 30 s). The slopes of the kinetic readings were calculated, and results were expressed as % of control similar to the aforementioned method.
Kinetic Analysis of Enzyme Inhibition
In order to study the mechanism of tyrosinase inhibition by CMT-308, a kinetic study of monophenolase and diphenolase activities at multiple concentrations of substrates were undertaken. For the monophenolase activity assay, the final concentrations of l-TYR substrate selected were 0.125, 0.25, 0.5 and 1 mM, with the final concentration of mushroom tyrosinase enzyme as 12.5 µg/mL. In the case of diphenolase activity assay, the final concentration of enzyme was 3.5 µg/mL and the final concentrations of l-DOPA substrate were 0.375, 0.75, 1.5 and 3 mM. The slopes from the linear range of the progress curves of absorbance at 475 nm vs. time were recorded as apparent velocities and the inverse values, 1/v, were plotted vs. the inverse substrate concentrations at different fixed inhibitor concentrations based on the Lineweaver and Burk (L-B) method [50]. Dixon plots of the inverse velocities, (1/v), as a function of the inhibitor concentrations at different substrate concentrations were also constructed to further study the apparent mode of inhibition by CMT-308.
Copper Chelation Assay
Copper-ion chelation activity was evaluated using a pyrocatechol violet (PV) chromogenic reagent based on the method reported in our earlier work [51]. Briefly, 100 µL of different concentrations of CMT-308 were prepared using 50 mM sodium acetate buffer (pH 6.0) and aliquoted in a 96-well plate. Next, 10 µL of 2 mM copper sulfate solution was added and incubated for 10 min followed by the addition of 10 µL of 2 mM PV solution and further incubated for 20 min. The absorbance was read at 632 nm using a microplate reader and copper chelating activity was reported as % normalized to control.
α-Glucosidase Activity Assay
In order to test if CMT-308 might directly affect the α-glucosidase activity, we assayed the α-glucosidase activity using α-glucosidase purified from Baker's yeast based on the method described previously [33]. Briefly, 80 µL of CMT-308 was prepared using 0.05 M phosphate buffer (pH 6.5) and was aliquoted to a 96-well microplate followed by the addition of 100 µL of 1.2 mM p-nitrophenyl-α-d-glucopyranoside (PNG) substrate. A total of 20 µL of 0.45 units of enzyme solution was added; the rate of the formation of p-nitrophenol was monitored at 405 nm for 15 min using the kinetic mode at 37 • C in a microplate reader. The enzyme activity was computed as: (Rate of sample reaction/Rate of control reaction) × 100%.
DPPH Radical Scavenging Assay
DPPH (2,2-Diphenyl-1-picryl-hydrazyl) is a stable free radical which, after reaction with antioxidant compounds that can donate a hydrogen atom, leads to a color change from violet to yellow which can be easily measured and has been widely used to assess antioxidant activities of compounds previously [52]. Briefly, DPPH was freshly prepared in methanol and mixed with different concentrations of CMT-308 in triplicates in a 96-well plate. The control group consisted of DPPH only and ascorbic acid (AA) at 2.5 µg/mL was used as a positive control. The final DPPH concentration was 100 µM and the final volume was 200 µL in the plate (20 µL samples with 180 µL of DPPH). The plate was covered and incubated for 30 min. Absorbance was read at 517 nm and the % DPPH radical scavenged was calculated based on this formula: = [(Ao − Ac)/Ao] × 100, where Ao is the absorbance of the control and Ac is the absorbance of the compound. The concentration of CMT-308 which scavenged 50% of DPPH radicals (half-maximal inhibitory concentration; IC 50 ) was calculated from non-linear regression analysis of a dose-response curve.
Cell Culture
B16F10 melanoma cells (CRL-6475™) were procured from the American Type Culture Collection (ATCC, Manassas, VA, USA) and were cultured using DMEM supplemented with 10% HI-FBS and 1% antibiotics (penicillin-streptomycin). Human epidermal melanocytes from neonatal darkly-pigmented donor (HEMn-DP; lot# 1781055) were obtained from Cascade Biologics (Portland, OR, USA) and were cultured in Medium 254 supplemented with 1% human melanocyte growth supplement and 1% antibiotics. HEMn-DP cells were used between passages 5 and 10 for all assays. Human keratinocytes (HaCaT) cells were obtained from AddexBio (San Diego, CA, USA) and were cultured in DMEM with 10% HI-FBS and 1% antibiotics. For all cell cultures, we did not use amphotericin B as a supplement in the medium.
Cytotoxicity Assay
B16F10 cells were seeded at 5 × 10 3 cells/well in 0.2 mL medium in a 96-well plate for 24 h, after which the culture medium was aspirated, and CMT-308 was added at various concentrations and further incubated for 72 h. At the end of 72 h, the culture medium was aspirated and replaced by 100 µL of fresh medium containing 20 µL of MTS reagent and incubated for 40 min. Subsequently, the absorbance was read at 490 nm using a Versamax ® microplate reader and cell viability was calculated from the absorbance values relative to control groups and expressed in %.
HEMn-DP cells (2 × 10 4 cells/well in 0.2 mL medium) were inoculated in a 96-well plate and cultured for 48 h. After this, the culture medium was replaced with fresh medium containing CMT-308 at various doses (5-25 µM) and incubated for 72 h. After the treatment, MTS assay was conducted similar to the method above except an incubation period of 3 h was used. Data were expressed as % normalized to control.
Melanin Content Estimation
B16F10 cells were seeded at 5 × 10 4 cells/well in 1.5 mL medium in 12-well plates and incubated for 24 h followed by the replacement of medium with fresh medium containing CMT-308 in the presence or absence of 100 nM α-MSH [53,54] and cultures maintained for a period of 72 h. KA (500 µM) was used as a positive control. At the end of treatment, the extracellular melanin was estimated by measuring absorbance of the culture supernatants at 475 nm using a microplate reader. For intracellular melanin assay, cells remaining in the wells were detached using TrypLE Express (1×; Gibco) and cell pellets were washed in PBS. After aspiration, 250 µL of 1N NaOH was added and heated to 70 • C to solubilize melanin. The absorbance of the lysate was read at 475 nm; a standard curve was made using synthetic melanin prepared at different concentrations in 1N NaOH and was used to quantify amount of both the intracellular and extracellular melanin which were subsequently reported in µg/mg protein for each group.
For melanin content estimation in HEMn-DP cells, 1.1 × 10 5 cells were cultured in 12-well plates in 1.5 mL medium/well, cultured for 72 h followed by replacement of fresh medium containing CMT-308, and cultures were maintained for another 72 h. At the end of treatment, the intracellular melanin was quantified similarly to the method reported above.
Cellular Tyrosinase Activity
B16F10 cells (2 × 10 4 cells/well in 1 mL medium) were cultured in 24-well tissue culture plates for 24 h, and CMT-308 was then added in the presence or absence of 100 nM αMSH, and further incubated for 72 h. At the end of treatments, cells were detached, washed in PBS, and lysed in lysis buffer. Following lysis, they were centrifuged and 50 µL of lysates were then aliquoted in a 96-well microplate with the addition of 100 µL of 3 mM l-DOPA substrate solution. The absorbance was then measured at 475 nm in the kinetic mode setting every 30 s for 40 min at 30 • C using a microplate reader. The % tyrosinase activity was calculated from the slope of the linear range of the velocities of inhibition. For the assessment of intracellular tyrosinase activity in HEMn-DP cells, we seeded 1.1 × 10 5 cells/well in a 12-well plate and cultured for 48 h, after which CMT-308 was added, and cultures were maintained for a further 72 h. At the end of the treatments, cells were pelleted, lysed, and the tyrosinase activity was similarly measured in lysates as outlined above.
Intracellular α-Glucosidase Activity in B16F10 Cells
In order to test if CMT-308 might inhibit the activity of the enzyme α-glucosidase which regulates the maturation of tyrosinase enzyme in cells, we conducted experiments to assay for cellular α-glucosidase activity. B16F10 cells (1.2 × 10 5 cells/well in 3 mL complete medium) were seeded in 6-well plates, the next day CMT-308 was added in the presence or absence of α-MSH, and cells were maintained for 72 h. At the end of 72 h, the cells were detached, washed in PBS, lysed, and centrifuged; 50 µL of supernatants were aliquoted in a 96-well plate followed by the addition of 100 µL of 2 mM PNG substrate solution; the rate of the formation of the reaction product: p-nitrophenol was monitored at 405 nm in kinetic mode for 45 min (with reading every 40 s) at 37 • C in a microplate reader. The intracellular α-glucosidase activity was calculated as (rate of sample reaction/rate of control reaction) × 100%.
Intracellular ROS Measurement in B16F10 Cells
We assessed the levels of intracellular ROS generation using the probe 2 ,7 -dichlorodihydrofluorescein diacetate (H 2 DCFDA), which is well-established for the estimation of cellular H 2 O 2 [55]. This probe is cell-permeable and forms 2 ,7 -dichlorodihydrofluorescein (H 2 DCF) after deacetylation by cellular esterases; H 2 DCF is subsequently oxidized in the presence of ROS to generate highly fluorescent 2 ,7 -Dichlorofluorescein (DCF). Briefly, B16F10 cells (2 × 10 4 cells/well in 1 mL complete medium) were cultured in 24-well plates for 24 h, followed by treatment with CMT-308 in the presence or absence of α-MSH and cultures maintained for another 72 h. Following treatment, the cells were washed with HBSS, and incubated with 50 µM probe diluted in DMEM medium (phenol-red free, sodium pyruvate free and serum-free) for 30 min at 37 • C. Subsequently, the cells were washed with HBSS and the plate was read using a fluorescence microplate reader (Gemini EM Spectramax, Molecular Devices) set at excitation/emission wavelengths of 485/535 nm using the well-scan mode (5-21 points/well). The relative fluorescence units (RFU) of CMT-308 was expressed as % of the control samples.
Estimation of MITF Protein Levels in B16F10 Cells
We assayed MITF protein levels in B16F10 cells to identify if the suppression of melanosome export by CMT-308 might be mediated, at least in part, by the downregulation of MITF. To this end, we employed a cell-based MITF ELISA kit (LifeSpan Biosciences, Seattle, USA). Briefly, B16F10 cells were seeded in a 96-well plate (4.5 × 10 3 cells/well in 0.2 mL medium) and, after 48 h, the medium was replaced by fresh medium containing CMT-308 in the presence/absence of α-MSH and cultures were maintained for a duration of 72 h. After 72 h, the wells were washed, fixed, and further steps were conducted based on the manufacturer's protocol. The relative levels of MITF levels were expressed as % of the untreated control.
Quantification of Dendricity in HEMn-DP Cells
The effects of CMT-308 on melanosome export in HEMn-DP cells were estimated by quantitation of dendricity indices of cells. Briefly, DP cells were seeded in 12-well plates (1 × 10 4 cells/well) and after 48 h, CMT-308 was added, and the cultures were continued for another 72 h. At the end of treatments, the cells were imaged using a Nikon Labphot microscope equipped with a digital camera and computer-interfaced NIS Elements 5.0 imaging software package. The lengths of each dendrite in a cell was manually traced and added to calculate total dendrite length (TDL) similar to previous methods [56,57]. The number of dendrites in each cell were manually counted from images and expressed as % of the control group. In addition, the number of cells which had more than 2 dendrites were counted and reported as % of the total number of cells; this parameter is similar to that reported in previous studies [58].
Quantification of Recovery of Dendricity in HEMn-DP Cells
In order to assess whether the effects on dendricity by CMT-308 might be reversed upon removal of the compound from cultures, we conducted an exposure and recovery study. Briefly, 1 × 10 4 DP cells/well were plated in a 6-well plate and treated with CMT-308 for 72 h. After 72 h (exposure), the wells were imaged. After this step, the cells were washed with HBSS and the culture medium was replaced with fresh medium without CMT-308, and the cultures were continued for an additional duration of 9 d (with two medium renewals in between). At the end of 9 d, the wells were imaged (recovery) and both sets of images (exposure and recovery) were analyzed for quantitation of dendritic parameters which were outlined earlier.
Fontana-Masson (FM) Staining
HEMn-DP cells were cocultured using the method reported previously [59] with some modifications. Briefly, HEMn-DP cells were seeded in a 6-well plate for 24 h, after which HaCaT cells which had been precultured in serum-free keratinocyte growth medium (SF-KGM, Gibco) were added at twice the seeding density and cultured for another 24 h. After this step, CMT-308 was added to cocultures in SF-KGM medium and cultures were continued for 72 h, after which the wells were fixed in 4% paraformaldehyde. Subsequently, the cells were stained to visualize the melanosomes in coculture using FM staining method described in previous studies with some modifications [60,61]. FM staining was conducted according to manufacturer's instructions. Briefly, cells were treated with ammoniacal silver solution, followed by incubations in 0.1% gold chloride solution and 5% sodium thiosulfate. After washing with distilled water, cells were counterstained with nuclear fast red and bright-field images were taken from random fields in the wells and were studied for visualization of melanosome accumulation.
Quantification of Dendricity in Cocultures
Next, we evaluated if the inhibition of dendricity obtained in melanocyte monocultures by CMT-308 might be retained in melanocyte cocultures with keratinocytes. To this end, we cocultured the cells using the method described earlier. Briefly, HEMn-DP cells (1 × 10 4 cells/ well) were seeded in a 6-well plate for 24 h followed by the addition of HaCaT cells in SF-KGM, and, after 24 h, CMT-308 was added for 72 h in SFM. At the end of treatments, the wells were imaged, and dendrite morphology were analyzed similarly to the method adopted in monocultures.
Statistical Analysis
One-way analysis of variance (ANOVA) with Dunnett's or Tukey's post-hoc test was run using GraphPad Prism software (version 8.4.2, San Diego, CA, USA) when comparing three or more groups, whereas a students unpaired t-test was used when comparing two groups. Differences were considered statistically significant at p < 0.05. All data are reported as Mean ± SD.
Effects of CMT-308 on the Activity of Mushroom Tyrosinase Enzyme for l-TYR and l-DOPA Substrates
We first tested if CMT-308 (chemical structure; Figure 1A) exhibits any inhibitory effect on the activity of mushroom tyrosinase enzyme using two substrates (l-TYR: monophenolase activity and l-DOPA: diphenolase activity). Our results showed that CMT-308 inhibited monophenolase activity of the soluble fungal tyrosinase with a robust inhibition of 42.46%, 54.47%, and 63.89% at 5, 10, and 25 µM, respectively ( Figure 1B). The IC 50 value of monophenolase activity inhibition was calculated to be 8.91 µM. Our results further showed that CMT-308 inhibited diphenolase activity of the soluble fungal enzyme by 25.37%, 37.93%, and 45.68% at 5, 10, and 25 µM, respectively ( Figure 1C). The IC 50 value of diphenolase activity inhibition was calculated to be 20.92 µM. Collectively, these results reveal that CMT-308 was 2.34-fold more potent in suppressing monophenolase activity of mushroom tyrosinase as compared to diphenolase activity.
tyrosinase as compared to diphenolase activity.
Kinetic Analysis of Mushroom Tyrosinase Inhibition by CMT-308
We next tested the mechanism of mushroom tyrosinase inhibition by both substrates (L-tyrosine and L-DOPA) using linear classical linearized Lineweaver-Burk (L-B) and Dixon plots. The nature of the intersection of lines can provide clues to the type of inhibition. For the inhibition of monophenolase activity by CMT-308, the results of the analysis of the L-B plot ( Figure 1D) and Dixon plot ( Figure 1F) revealed that CMT-308 does not inhibit activity by a purely competitive mode since all the lines did not intersect on the Y-axis. Furthermore, the mode was not that of a pure uncompetitive inhibitor since the lines were not parallel to each other. Additionally, the mode was not that of pure noncompetitive inhibition, as all lines did not intersect on the x-axis. Taken together, the mode of inhibition of monophenolase activity appears to be mixed.
In the case of analysis of the mechanism of inhibition of diphenolase activity by CMT-308, our results from L-B plots ( Figure 1E) and Dixon plots ( Figure 1G) showed that CMT-308 appears to be a mixed inhibitor of this reaction as well, as the patterns of inhibition were not those of pure competitive, pure noncompetitive inhibition, or pure uncompetitive inhibition. ; and (C) anti-diphenolase (using l-3,4-dihydroxyphenylalanine (l-DOPA) substrate) activity of CMT-308 using purified mushroom tyrosinase enzyme; # p < 0.01 vs. Ctrl, one-way ANOVA, Dunnett's test; data are mean ± SD of triplicate determinations; mechanisms of inhibition were studied using Lineweaver-Burk plots for (D) l-TYR and (E) l-DOPA substrates as well as Dixon plots for (F) l-TYR substrate and (G) l-DOPA substrate.
Kinetic Analysis of Mushroom Tyrosinase Inhibition by CMT-308
We next tested the mechanism of mushroom tyrosinase inhibition by both substrates (l-tyrosine and l-DOPA) using linear classical linearized Lineweaver-Burk (L-B) and Dixon plots. The nature of the intersection of lines can provide clues to the type of inhibition. For the inhibition of monophenolase activity by CMT-308, the results of the analysis of the L-B plot ( Figure 1D) and Dixon plot ( Figure 1F) revealed that CMT-308 does not inhibit activity by a purely competitive mode since all the lines did not intersect on the Y-axis. Furthermore, the mode was not that of a pure uncompetitive inhibitor since the lines were not parallel to each other. Additionally, the mode was not that of pure noncompetitive inhibition, as all lines did not intersect on the x-axis. Taken together, the mode of inhibition of monophenolase activity appears to be mixed.
In the case of analysis of the mechanism of inhibition of diphenolase activity by CMT-308, our results from L-B plots ( Figure 1E) and Dixon plots ( Figure 1G) showed that CMT-308 appears to be a mixed inhibitor of this reaction as well, as the patterns of inhibition were not those of pure competitive, pure noncompetitive inhibition, or pure uncompetitive inhibition.
Inhibitory parameters were also computed using a nonlinear least-squares fit of the kinetic data to three models of classical inhibition-competitive, noncompetitive, and uncompetitive-for each of the two substrates. Our results showed that while mushroom tyrosinase showed somewhat greater affinity for l-DOPA than l-tyrosine, CMT-308 was an inhibitor of both the monophenolase and diphenolase activities of the enzyme (Table S1). The mode of inhibition for both activities appears to be mixed, with the major contribution from a classic competitive mode. This predominance of a classic competitive mode was especially evident for inhibition of diphenolase activity, which was inhibited by CMT-308 binding in a competitive mode with an apparent affinity for the enzyme (Ki) approximately one order of magnitude greater than that for binding in a noncompetitive or uncompetitive mode (Table S1). Collectively, these data indicate that CMT-308 is a mixed inhibitor for both substrates, with a predominant component of competitive inhibition, due to which it may be capable of binding both to the free enzyme and, with significantly lower affinity, to the enzyme-substrate complex (ES complex).
Effects of CMT-308 on Copper Chelating Capacity
As tyrosinase contains copper in its active site, we next tested if CMT-308 may chelate copper, which was tested using the chromogenic substrate, PV. Our results showed that CMT-308 showed a significant copper chelating activity of 10%, 11%, and 29% at concentrations of 5, 10, and 20 µM, respectively ( Figure 2A). activity of CMT-308 using purified mushroom tyrosinase enzyme; # p < 0.01 vs. Ctrl, one-way ANOVA, Dunnett's test; data are mean ± SD of triplicate determinations; mechanisms of inhibition were studied using Lineweaver-Burk plots for (D) L-TYR and (E) L-DOPA substrates as well as Dixon plots for (F) L-TYR substrate and (G) L-DOPA substrate.
Inhibitory parameters were also computed using a nonlinear least-squares fit of the kinetic data to three models of classical inhibition-competitive, noncompetitive, and uncompetitive-for each of the two substrates. Our results showed that while mushroom tyrosinase showed somewhat greater affinity for L-DOPA than L-tyrosine, CMT-308 was an inhibitor of both the monophenolase and diphenolase activities of the enzyme (Table S1). The mode of inhibition for both activities appears to be mixed, with the major contribution from a classic competitive mode. This predominance of a classic competitive mode was especially evident for inhibition of diphenolase activity, which was inhibited by CMT-308 binding in a competitive mode with an apparent affinity for the enzyme (Ki) approximately one order of magnitude greater than that for binding in a noncompetitive or uncompetitive mode (Table S1). Collectively, these data indicate that CMT-308 is a mixed inhibitor for both substrates, with a predominant component of competitive inhibition, due to which it may be capable of binding both to the free enzyme and, with significantly lower affinity, to the enzymesubstrate complex (ES complex).
Effects of CMT-308 on Copper Chelating Capacity
As tyrosinase contains copper in its active site, we next tested if CMT-308 may chelate copper, which was tested using the chromogenic substrate, PV. Our results showed that CMT-308 showed a significant copper chelating activity of 10%, 11%, and 29% at concentrations of 5, 10, and 20 µM, respectively ( Figure 2A).
Effects of CMT-308 on α-Glucosidase Activity
Next, we tested if CMT-308 may have any direct inhibitory effect on the activity of the enzyme α-glucosidase in a cell-free assay, as this activity is important in the delivery of tyrosinase to melanosome membranes; however, there was no alterations in levels of enzyme activity on treatment with CMT-308 ( Figure 2B).
Effects of CMT-308 on DPPH Radical Scavenging Activity
Our results showed that CMT-308 is a strong scavenger of DPPH radical in a dose-dependent manner; CMT-308 at concentration 5, 10, and 25 µM scavenged DPPH radical by 15.24%, 23.86%, and 56.77%, respectively ( Figure 2C). The mean value of IC50 of DPPH radical inhibition by CMT-308 was calculated to be 21 µM. These results demonstrate that the antioxidant capacity of CMT-308 was
Effects of CMT-308 on α-Glucosidase Activity
Next, we tested if CMT-308 may have any direct inhibitory effect on the activity of the enzyme α-glucosidase in a cell-free assay, as this activity is important in the delivery of tyrosinase to melanosome membranes; however, there was no alterations in levels of enzyme activity on treatment with CMT-308 ( Figure 2B).
Effects of CMT-308 on DPPH Radical Scavenging Activity
Our results showed that CMT-308 is a strong scavenger of DPPH radical in a dose-dependent manner; CMT-308 at concentration 5, 10, and 25 µM scavenged DPPH radical by 15.24%, 23.86%, and 56.77%, respectively ( Figure 2C). The mean value of IC 50 of DPPH radical inhibition by CMT-308 was calculated to be 21 µM. These results demonstrate that the antioxidant capacity of CMT-308 was comparable to the positive control ascorbic acid which scavenged 29.81% at the concentration of 2.5 µg/mL (~14 µM).
Effects of CMT-308 on Total Melanin in B16F10 Cell Cultures under Both Basal and Hormone-Stimulated Conditions
We next conducted cellular assays using B16F10 mouse melanoma cell model to study if CMT-308 could demonstrate anti-melanogenic activity in cell cultures. To this end, CMT-308 was first tested for cytotoxicity; our results showed that CMT-308 was nontoxic to B16F10 cells over the concentration range 5-25 µM for the duration of 72 h (Figure 3A), hence these concentrations were used for further experiments.
We next conducted cellular assays using B16F10 mouse melanoma cell model to study if CMT-308 could demonstrate anti-melanogenic activity in cell cultures. To this end, CMT-308 was first tested for cytotoxicity; our results showed that CMT-308 was nontoxic to B16F10 cells over the concentration range 5-25 µM for the duration of 72 h (Figure 3A), hence these concentrations were used for further experiments.
The morphology of B16F10 cells after α-MSH stimulation showed a visibly higher dendritic appearance ( Figure 3D) than that seen in cells maintained under basal conditions, while co-treatment with α-MSH and CMT-308 at 10 µM resulted in perinuclear aggregation of melanosomes; some perinuclear aggregation of melanosomes in the presence of CMT-308 alone was also observed in cells maintained under basal conditions. Collectively, these results indicate that CMT-308 exhibits enhanced antimelanogenic activity in the B16F10 cells stimulated with α-MSH, with potent suppression of total melanogenesis in the presence of CMT-308 concentrations of 10 µM or greater.
Effects of CMT-308 on α-Glucosidase Activity in B16F10 Cells
Since α-glucosidase plays a role in the maturation of tyrosinase in mammalian cells, we next tested if CMT-308 might inhibit activity of this enzyme in cellular lysates. Our results showed that CMT-308 did not affect the α-glucosidase activity at any concentration, either under basal ( Figure 4A) or under α-MSH-stimulated conditions ( Figure 4B), indicating that other mechanisms may be involved in its anti-melanogenic action.
perinuclear aggregation of melanosome granules which was noticeable in CMT-308 treated groups; intracellular tyrosinase activity in B16F10 cellular lysates under (E) basal and (F) α-MSH-stimulated conditions (# p < 0.01 vs. Ctrl; one-way ANOVA with Tukey's test); all data are mean ± SD of at least three independent experiments except for (B,C), which is representative of one independent experiment performed on triplicate samples.
The morphology of B16F10 cells after α-MSH stimulation showed a visibly higher dendritic appearance ( Figure 3D) than that seen in cells maintained under basal conditions, while co-treatment with α-MSH and CMT-308 at 10 µM resulted in perinuclear aggregation of melanosomes; some perinuclear aggregation of melanosomes in the presence of CMT-308 alone was also observed in cells maintained under basal conditions. Collectively, these results indicate that CMT-308 exhibits enhanced antimelanogenic activity in the B16F10 cells stimulated with α-MSH, with potent suppression of total melanogenesis in the presence of CMT-308 concentrations of 10 µM or greater.
Effects of CMT-308 on α-Glucosidase Activity in B16F10 Cells
Since α-glucosidase plays a role in the maturation of tyrosinase in mammalian cells, we next tested if CMT-308 might inhibit activity of this enzyme in cellular lysates. Our results showed that CMT-308 did not affect the α-glucosidase activity at any concentration, either under basal ( Figure 4A) or under α-MSH-stimulated conditions ( Figure 4B), indicating that other mechanisms may be involved in its anti-melanogenic action.
Effects of CMT-308 on Intracellular ROS Generation in B16F10 Cells
Our results showed that CMT-308 at a concentration of 25 µM significantly attenuated ROS generation by B16F10 cells maintained under basal conditions ( Figure 4C). In cells maintained in the presence of α-MSH, CMT-308 showed a trend for reduction in ROS generation, although no significance was reached at any concentration ( Figure 4D).
Effects of CMT-308 on MITF Protein Expression in B16F10 Cells under Hormone-Stimulated Conditions
Our results showed that, under basal conditions, CMT-308 at 10 µM showed a trend for reduction in MITF protein levels (by 12.92%), which did not reach significance ( Figure 5A), while it
Effects of CMT-308 on Intracellular ROS Generation in B16F10 Cells
Our results showed that CMT-308 at a concentration of 25 µM significantly attenuated ROS generation by B16F10 cells maintained under basal conditions ( Figure 4C). In cells maintained in the presence of α-MSH, CMT-308 showed a trend for reduction in ROS generation, although no significance was reached at any concentration ( Figure 4D).
Effects of CMT-308 on MITF Protein Expression in B16F10 Cells under Hormone-Stimulated Conditions
Our results showed that, under basal conditions, CMT-308 at 10 µM showed a trend for reduction in MITF protein levels (by 12.92%), which did not reach significance ( Figure 5A), while it significantly attenuated MITF levels by 21.56% ( Figure 5B) under α-MSH-stimulated conditions. Altogether, these results are consistent with the idea that the inhibition of melanogenesis by CMT-308 under α-MSH-stimulated conditions may be related, at least in part, to downregulation of MITF expression. significantly attenuated MITF levels by 21.56% ( Figure 5B) under α-MSH-stimulated conditions. Altogether, these results are consistent with the idea that the inhibition of melanogenesis by CMT-308 under α-MSH-stimulated conditions may be related, at least in part, to downregulation of MITF expression.
Effects of CMT-308 on Melanin Synthesis and Cellular Tyrosinase Activity in HEMn-DP Cells
We next evaluated if CMT-308 might display anti-melanogenic activity in human melanocytes obtained from darkly-pigmented skin. To this end, CMT-308 was first assessed for cytotoxicity over a duration of 72 h in HEMn-DP cells. Our results showed that CMT-308 induced significant toxicity at 25 µM (mean cell viability was diminished by 40%, p < 0.01), while concentrations of 5 and 10 µM were nontoxic ( Figure 6A); these concentrations were used for further analysis. Figure 6. (A) human epidermal melanocytes-darkly pigmented (HEMn-DP) cell viability after treatment with CMT-308 for 72 h as measured by MTS assay; # p < 0.01 vs. Ctrl, One-way ANOVA with Dunnett's test; data are mean ± SD of three independent experiments; (B) intracellular melanin levels in HEMn-DP cells treated with CMT-308 for 72 h; data are mean ± SD of a representative independent experiment on triplicate samples; (C) representative bright-field images of HEMn-DP cells in control (Ctrl) and CMT-308 (10 µM)-treated group; red arrows show perinuclear aggregation of melanosomes in the CMT-308-treated group; objective magnification 40×; (D) tyrosinase activity in HEMn-DP cellular lysates after treatment with CMT-308 for 72 h; data are mean ± SD of at least two independent experiments. CMT-308 did not affect intracellular melanin levels in HEMn-DP cells at 5 or 10 µM ( Figure 6B). Interestingly, we noted a distinctive aggregation of melanosomes in the perinuclear region in melanocytes treated with CMT-308 at 10 µM; in contrast, melanosomes in the control group could be seen in both the cytoplasm and dendrites ( Figure 6C). This observation confirmed that CMT-308
Effects of CMT-308 on Melanin Synthesis and Cellular Tyrosinase Activity in HEMn-DP Cells
We next evaluated if CMT-308 might display anti-melanogenic activity in human melanocytes obtained from darkly-pigmented skin. To this end, CMT-308 was first assessed for cytotoxicity over a duration of 72 h in HEMn-DP cells. Our results showed that CMT-308 induced significant toxicity at 25 µM (mean cell viability was diminished by 40%, p < 0.01), while concentrations of 5 and 10 µM were nontoxic ( Figure 6A); these concentrations were used for further analysis. significantly attenuated MITF levels by 21.56% ( Figure 5B) under α-MSH-stimulated conditions. Altogether, these results are consistent with the idea that the inhibition of melanogenesis by CMT-308 under α-MSH-stimulated conditions may be related, at least in part, to downregulation of MITF expression.
Effects of CMT-308 on Melanin Synthesis and Cellular Tyrosinase Activity in HEMn-DP Cells
We next evaluated if CMT-308 might display anti-melanogenic activity in human melanocytes obtained from darkly-pigmented skin. To this end, CMT-308 was first assessed for cytotoxicity over a duration of 72 h in HEMn-DP cells. Our results showed that CMT-308 induced significant toxicity at 25 µM (mean cell viability was diminished by 40%, p < 0.01), while concentrations of 5 and 10 µM were nontoxic ( Figure 6A); these concentrations were used for further analysis. Figure 6. (A) human epidermal melanocytes-darkly pigmented (HEMn-DP) cell viability after treatment with CMT-308 for 72 h as measured by MTS assay; # p < 0.01 vs. Ctrl, One-way ANOVA with Dunnett's test; data are mean ± SD of three independent experiments; (B) intracellular melanin levels in HEMn-DP cells treated with CMT-308 for 72 h; data are mean ± SD of a representative independent experiment on triplicate samples; (C) representative bright-field images of HEMn-DP cells in control (Ctrl) and CMT-308 (10 µM)-treated group; red arrows show perinuclear aggregation of melanosomes in the CMT-308-treated group; objective magnification 40×; (D) tyrosinase activity in HEMn-DP cellular lysates after treatment with CMT-308 for 72 h; data are mean ± SD of at least two independent experiments.
CMT-308 did not affect intracellular melanin levels in HEMn-DP cells at 5 or 10 µM ( Figure 6B). Interestingly, we noted a distinctive aggregation of melanosomes in the perinuclear region in melanocytes treated with CMT-308 at 10 µM; in contrast, melanosomes in the control group could be seen in both the cytoplasm and dendrites ( Figure 6C). This observation confirmed that CMT-308 Figure 6. (A) human epidermal melanocytes-darkly pigmented (HEMn-DP) cell viability after treatment with CMT-308 for 72 h as measured by MTS assay; # p < 0.01 vs. Ctrl, One-way ANOVA with Dunnett's test; data are mean ± SD of three independent experiments; (B) intracellular melanin levels in HEMn-DP cells treated with CMT-308 for 72 h; data are mean ± SD of a representative independent experiment on triplicate samples; (C) representative bright-field images of HEMn-DP cells in control (Ctrl) and CMT-308 (10 µM)-treated group; red arrows show perinuclear aggregation of melanosomes in the CMT-308-treated group; objective magnification 40×; (D) tyrosinase activity in HEMn-DP cellular lysates after treatment with CMT-308 for 72 h; data are mean ± SD of at least two independent experiments. CMT-308 did not affect intracellular melanin levels in HEMn-DP cells at 5 or 10 µM ( Figure 6B). Interestingly, we noted a distinctive aggregation of melanosomes in the perinuclear region in melanocytes treated with CMT-308 at 10 µM; in contrast, melanosomes in the control group could be seen in both the cytoplasm and dendrites ( Figure 6C). This observation confirmed that CMT-308 appears to inhibit melanosome transport and is similar to the findings obtained earlier in B16F10 mouse cells.
Next, our results on the effects of CMT-308 on tyrosinase activity of HEMn-DP cellular lysates showed a trend for reduction of activity by 23.53% ( Figure 6D) at 10 µM, but this inhibition did not reach statistical significance.
Effects of CMT-308 on Melanocyte Dendricity
Melanosomes are exported from melanocyte tips to keratinocytes via dendrites from melanocyte tips; a reduction in dendrite number and/or length hinders this transport leading to hypopigmentation. The typical morphology of HEMn-DP cells is arborized with several dendrites; this was visibly reduced to mostly bipolar dendrites upon exposure to 10 µM CMT-308 ( Figure 7A). Next, quantification of various indices of dendricity revealed that CMT-308 significantly reduced TDL by 43.80% ( Figure 7B) as well as the number of dendrites by 46.74% ( Figure 7C). Additionally, CMT-308 altered the distribution of cells with different dendrites; the % of cells with >2 dendrites were significantly diminished by 60.60% ( Figure 7D). Collectively, this data showed that CMT-308 is a potent suppressor of melanosome export at the low micromolar concentration of 10 µM, as reflected in its diminution of all the parameters of melanocyte dendricity. appears to inhibit melanosome transport and is similar to the findings obtained earlier in B16F10 mouse cells. Next, our results on the effects of CMT-308 on tyrosinase activity of HEMn-DP cellular lysates showed a trend for reduction of activity by 23.53% ( Figure 6D) at 10 µM, but this inhibition did not reach statistical significance.
Effects of CMT-308 on Melanocyte Dendricity
Melanosomes are exported from melanocyte tips to keratinocytes via dendrites from melanocyte tips; a reduction in dendrite number and/or length hinders this transport leading to hypopigmentation. The typical morphology of HEMn-DP cells is arborized with several dendrites; this was visibly reduced to mostly bipolar dendrites upon exposure to 10 µM CMT-308 ( Figure 7A). Next, quantification of various indices of dendricity revealed that CMT-308 significantly reduced TDL by 43.80% ( Figure 7B) as well as the number of dendrites by 46.74% ( Figure 7C). Additionally, CMT-308 altered the distribution of cells with different dendrites; the % of cells with >2 dendrites were significantly diminished by 60.60% ( Figure 7D). Collectively, this data showed that CMT-308 is a potent suppressor of melanosome export at the low micromolar concentration of 10 µM, as reflected in its diminution of all the parameters of melanocyte dendricity.
Reversibility Study of Melanocyte Dendricity by CMT-308
The effects of a 72 h exposure to CMT-308 (10 µM) on melanocyte morphology, characterized by a drastic reduction in multi-dendritic morphology, were visibly reversed after replacement of the culture with CMT-308-free medium: After an additional 9 d of culture in CMT-308-free medium, the dendrites appeared similar in number and size to the recovery control group ( Figure 7E).
We also quantified the dendricity parameters and our results demonstrate that, whereas exposure of HEMn-DP cells to CMT-308 (10 µM) showed an expected significant reduction in TDL, after the recovery period, the TDL reverted to baseline levels (recovery control; Figure 7F). A similar recovery was noted for the number of dendrites, which was reduced in the CMT-308-treated groups after 3 d but fully recovered to baseline control values after 9 d in CMT-free medium ( Figure 7G). Lastly, the parameter of % cells with >2 dendrites, which was significantly reduced in CMT-308-treated cells after a 72 h exposure, also completely recovered to control after culture for 9 d in CMT-308-free medium ( Figure 7H). Collectively, these results showed that the inhibitory effects of CMT-308 on melanosome export were fully reversible upon continued culture after removal of the compound from the culture medium.
Effects of CMT-308 on Dendricity in Melanocyte Cocultures
As a single melanocyte is in contact with several keratinocytes in the epidermis, we tested if the inhibition of dendricity by CMT-308 observed in melanocyte monoculture might be retained in cocultures, which would support our conclusion that the inhibitory effect of CMT-308 on melanosome transfer appears to affect melanocytes alone and is not diminished when melanocytes are cultured in the presence of keratinocytes. CMT-308 was screened for cytotoxicity before proceeding with coculture experiments and was found to be nontoxic to keratinocytes over the tested concentration range ( Figure S1). Our results showed that, in cocultures, CMT-308 (10 µM) exhibited a similar effect on melanocyte dendricity as that obtained in monocultures, with the appearance of perinuclear clustering ( Figure 8A) and bipolar dendrites ( Figure 8B). Next, the dendricity indices in the cocultures were quantified using the same parameters as those used in analyzing the monocultures; our results showed that CMT-308 significantly inhibited TDL by 40% ( Figure 8C) and reduced the number of dendrites by 42.87% ( Figure 8D). Furthermore, the % of cells with >2 dendrites were also significantly reduced by 21.6% ( Figure 8E). Taken together, our results confirm that the capacity of CMT-308 to inhibit the machinery of melanosome export by reducing dendricity is retained in melanocyte cocultures.
Discussion
Our results demonstrate the novel finding that CMT-308 can suppress melanogenesis by targeting one or more steps of melanosome export in the melanogenesis pathway after the tyrosinasecatalyzed reactions. In addition to its capacity to suppress melanosome export in mammalian cell- quantitation of dendricity in cocultures of HEMn-DP: (C) Total dendrite length; (D) Number of dendrites; (E) % cells with >2 dendrites; # p < 0.01 vs. Ctrl, students unpaired t-test; data are mean ± SD from one representative experiment in triplicates; a total of 50-60 cells were counted per group.
Discussion
Our results demonstrate the novel finding that CMT-308 can suppress melanogenesis by targeting one or more steps of melanosome export in the melanogenesis pathway after the tyrosinase-catalyzed reactions. In addition to its capacity to suppress melanosome export in mammalian cell-based assays, CMT-308 also demonstrates potent inhibition of the first two reactions in the pathway of melanin synthesis catalyzed by a soluble preparation of fungal tyrosinase, functioning as a mixed inhibitor with a predominant competitive mode. CMT-308 also can chelate copper and inhibit ROS production in a cell-free system. Moreover, CMT-308 downregulated MITF protein levels and induced perinuclear aggregation of melanosomes, both of which may contribute to its capacity to attenuate melanin secretion. Interestingly, CMT-308 did not have any effect on the levels of melanin within cultured mouse or human melanocyte cell lines, which indicates that the mode of action of CMT-308 uniquely reflects a selective inhibition of melanosome export in the absence of effects on melanin synthesis. To the best of our knowledge, this is the first report of a synthetic CMT derivative which may function to reduce skin pigmentation via a novel mode by inhibiting melanosome export without affecting melanin biosynthesis.
Tetracyclines have been shown to exhibit a much higher affinity for Cu 2+ than Zn 2+ [62]. Our results on the copper-chelating activity of CMT-308 is in agreement with the cation-chelating capacity of CMTs [63,64]. By chelation of Cu 2+ ions, CMT-308 might block the function of the essential metal in tyrosinase and could; thus, interfere with the process of tyrosinase-catalyzed melanin formation, if it could be shown that the tetracycline could have access to the enzyme in vivo. Furthermore, our results showed that, in a cell-free assay, CMT-308 exhibited antioxidant activity that might be mediated by the interaction of ROS with the phenolic hydroxyls of CMT-308; this is similar to the mechanisms of antioxidant activity of the antibiotic minocycline [65]. Steric hindrance due to the polyphenolic nature of the ring system of CMT-308 and intramolecular hydrogen bonding (IHB) involving the 9-amino group might contribute to ROS scavenging by stabilizing the phenolic radical. We used B16F10 mouse melanoma cells because this cell model has been well-validated as a robust model to screen for compounds which can diminish extracellular as well as intracellular levels of melanin.
Our results in B16F10 cells demonstrated that CMT-308 was more effective in reducing total melanin levels under α-MSH stimulation than basal conditions, indicative of a stimulus-dependent enhanced inhibition of at least one step in melanogenesis. Reports have documented that culturing B16F10 cells in DMEM is not a true basal condition for expression of melanogenic activity, as l-tyrosine in the medium may mimic the effects of pro-melanogenic stimulus (α-MSH) inducing melanogenesis [66][67][68]. However, this induction is insignificant when compared to that achieved by α-MSH itself. Despite the capacity to exhibit antioxidant activity in an in vitro cell-free system, the reduction in ROS levels generated by B16F10 cells maintained in the presence of α-MSH and CMT-308 did not reach statistical significance, although a significant reduction in ROS levels generated in cells under basal conditions in the presence of 25 µM CMT-308 was detected. This discrepancy might be ascribable to differences in the actual profiles of detected analytes in both assays: The cellular ROS assay measured DCF while the cell-free assay measured DPPH radicals. Consequently, the direct comparison of cell-free and cellular effect need to be interpreted with caution. Differences in lipophilicity, cellular permeability, and cellular uptake might also explain the lack of effects in cell culture, as has been shown for CMTs previously [69]. Our results of the absence of effects on intracellular tyrosinase activity in both B16F10 and HEMn-DP cells stand in marked contrast to the results of potent suppression of mushroom tyrosinase activity obtained in the cell-free assay. This apparent discrepancy might be ascribed to the source of the tyrosinase purified from mushroom which exhibits distinct molecular differences from human tyrosinase [22] and different substrate specificities and catalytic activities [70]. However, mushroom tyrosinase remains as a popular reagent due to its ready availability and low cost. The caveats of relying solely upon data obtained with the fungal enzyme must be acknowledged. Similarly, our assays on the effects of CMT-308 on α-glucosidase were conducted using an enzyme preparation derived from yeast, which has been shown to have some structural differences from the mammalian enzyme [71]. Finally, we have used synthetic melanin as a standard for quantitation of intracellular melanin in lysates and extracellular melanin in culture media, but it exhibits some differences from natural melanin generated by cells, hence might introduce a systematic bias in our measurements [72].
Unlike B16F10 cells, which secrete copious amounts of melanin in the culture medium in a short timeframe, facilitating the study of extracellular melanogenesis-modulating agents, human melanocytes do not secrete comparable quantities of melanin into the medium. Consequently, we have employed measurements of dendricity as a surrogate marker for melanosome export in human melanocytes [33]. Our results of inhibition of melanosome export by CMT-308 bear some similarity to those obtained with TR, except CMT-308 appears to be more effective at inhibiting melanosome export without accumulation of intracellular melanin, unlike TR. Our results of reduction in dendricity are similar to those reported for the compound centauridein [31]. Our observations of perinuclear aggregation of melanosomes by CMT-308 are similar to the findings in previous reports where compounds, 16-kauren-2-beta-18, 19-triol [73], 2-methyl-naphtho[1,2,3-de] quinolin-8-one [74], and wogonin [75] suppressed the export of melanosomes by inducing their perinuclear aggregation. Melanosome aggregation and melanocyte dendritogenesis have been described as arising from the opposing actions of kinesin and dynein on melanosome trafficking, but they can be uncoupled by certain interventions [76]. There have been reports where dendritogenesis was suppressed without any alterations in melanosome distribution [31,33], while, in other cases, melanosome distribution was altered (perinuclear aggregation) in the absence of any changes in dendritic morphology, as seen in melanocytes of mice carrying the "dilute" mutation [77] and chick with "lavender" mutation [78]. Under both conditions though, melanosome export was disrupted leading to hypopigmentation. Our results of CMT-308 in this study indicate the involvement of both phenomena viz. alteration in melanosome distribution with perinuclear clustering and reduction of dendricity. In our recovery experiments, we noticed a complete reversal of suppressed dendricity and no substantial perinuclear aggregation. However, further experiments to evaluate the effects of CMT-308 on disruption and distribution of melanosomes in the presence of inhibitors of actin filaments, microtubules, or molecular motor proteins involved in melanosome trafficking will be necessary to dissect whether the inhibition of export is linked to cytoskeletal rearrangement or is independent of it.
A previous study compared the compound thiamidol with HQ and showed that thiamidol fully reversed inhibited melanin production, while HQ's effects were irreversible in HEMn-DP cell cultures [22], although no information on melanosome export or dendricity was reported. Our results in HEMn-DP cell cultures showed that the diminution in dendricity by CMT-308 was fully reversible after its removal from the culture medium; this is an important prerequisite for its safety as a potential agent for the treatment of hyperpigmentary disorders, especially since disruption of melanosome export due to perinuclear clustering has been a hallmark of the Griscelli skin disorder [79]. Other studies have also documented the reversibility of inhibited melanosome export with compounds, wogonin [75], platycodin D [80], and niacinamide [81]. In particular, our results of recovered dendricity are similar to the compound platycodin D, in which the authors demonstrated recovery of dendricity based on qualitative evaluation [80]. Rac and Rho pathways regulate the export of melanosomes along dendrite tips [82]. Whether the inhibition of melanosome export by CMT-308 might be related to the involvement of these pathways was not assessed; however, future studies to evaluate them are warranted.
The inhibition of melanosome export by CMT-308 was further validated in a coculture model with melanocytes and keratinocytes in direct contact enabling cross-talk and transfer of pigment under conditions that may be expected to replicate those in vivo. Our results of a significant reduction of dendrite number, total dendrite length, and proportion of dendritic cells are similar to that of another study conducted with cocultures of melanocytes from burn patients where a similar attenuation of dendricity was noted [83]. We have also quantified melanosome transfer in cocultures after FM-staining based on previous methods [59,83]; however, we found no reduction in the number of melanosomes in keratinocytes of CMT-308-treated groups as compared to control after 72 h ( Figure S2). We speculate that this might be due to the absence of an external stimulus in the coculture conditions employed in the current study, because of which melanosome transfer might not have been sufficiently stimulated, although we obtained an increase in TDL in cocultures as compared to monocultures. This reasoning is further supported by our results with B16F10 cell cultures, where CMT-308 showed a higher efficacy to inhibit melanosome export under α-MSH stimulation. Pigmentation in cocultures in the absence of an external stimulus is prolonged and can take >10 d [84]; external factors such as UVB irradiation or α-MSH are necessary to stimulate melanogenesis and melanosome transfer in HEMn-DP cocultures [85], although HEMn-DP cells are unresponsive to α-MSH-stimulation in monocultures [86]. Moreover, a recent study demonstrated that a mild stimulus involving a combination of l-tyrosine and NH 4 Cl stimulated pigmentation in HEMn-DP cocultures within a short duration of 5 d [87]. Further studies employing the use of such coculture methods with external stimulators to validate whether CMT-308 could in fact suppress the transfer of melanosome in recipient keratinocytes are warranted.
Several reports have documented that keratinocytes not only modulate melanocyte proliferation and dendricity [88,89], but also possess differential capacities to phagocytose and distribute melanosomes [90][91][92]; keratinocytes from light skin have melanosomes clustered perinuclearly, while those from dark skin have single melanosomes dispersed throughout cytoplasm [93,94]. Although we found no change in number of melanosomes transferred to keratinocytes in CMT-308-treated group, as compared to control, the hypothesis that CMT-308 might alter the arrangement of melanosomes in keratinocytes cannot be ruled out and would be interesting to explore in future studies by the ultrastructural analysis of transferred melanosomes in keratinocytes. We have used the spontaneously immortalized HaCaT cell line instead of primary keratinocytes to establish cocultures, since they have been previously used for cocultures [59] and provide a convenient model as they retain all the functional differentiation properties and markers of primary keratinocytes [95] without the challenges of limited proliferative capacity and changes in differentiation markers with the increasing passage [96,97]. Additionally, the difficulty to obtain skin phototype-matched keratinocytes poses another limitation. Our coculture experiments were conducted using a ratio of 1:2, which is different from the physiological ratio of 1:36 in vivo [98]. Thus, whether the efficacy of CMT-308 to inhibit melanogenesis is retained in a more physiological model such as a skin-tissue equivalent needs to be evaluated in future studies.
Rok et al. have reported that tetracycline [99], doxycycline [100], oxytetracycline [101] and chlortetracycline [102] show toxicity and alter the antioxidant status of HEMn-DP cells, but only after UVA exposure. They used a broad range of concentrations (2.5-250 µM) of these tetracycline derivatives in HEMn-DP cells (without UVA treatment) and reported lack of effects on melanin synthesis and tyrosinase activity, while melanosome export/dendricity at nontoxic concentrations was not reported. Although, their results are similar to our results of CMT-308 obtained at concentrations <25 µM, CMT-308 also suppressed dendricity indicative of its action as an inhibitor of hyperpigmentation, which is in contrast to the aforementioned tetracyclines, that induce hyperpigmentation, which is likely related to their capacity to stimulate melanin synthesis under UVA irradiation, as a part of a phototoxic reaction. Doxycycline has been previously shown to bind to melanin, which may explain its phototoxicity, although its binding affinity was weaker after UV exposure [103]. Although we have not evaluated the phototoxicity of CMT-308 in UVA irradiated HEMn-DP cells as it is beyond the scope of work, we speculate that CMT-308 might be less phototoxic to melanocytes than other tetracyclines; however, further rigorous studies to address this hypothesis are warranted. Previous studies in our laboratory have shown that CMT-308 exhibits lesser phototoxicity as compared to doxycycline when tested using 3T3 neutral red uptake test system [47]. We have not evaluated the melanin-binding capacity of CMT-308, which should be also investigated in future studies, especially if CMT-308 is administered in vivo. The advantages of CMTs include a balance of hydrophilicity and hydrophobicity, with generally acceptable stability and solubility profile, in addition to the absence of antimicrobial activity with fewer side-effects than antimicrobial tetracyclines. CMTs have shown to inhibit invasion and metastasis of human melanoma cells in vitro and in vivo in a previous report [104]. The significance of the discovery of CMT-308 as a skin depigmenting agent with a unique mechanism of inhibition of melanosome export lies not only in the identification of the apparent novel anti-melanogenic activity of this class of compounds, but also in the potential use of CMTs to be used as adjuvants for depigmenting melanomas in concert with other depigmenting agents. However, since CMT-308 has not been yet tested in humans, further studies are warranted before the clinical potential of this compound can be met.
Conclusions
In summary, our results demonstrate the novel anti-melanogenic activity of the chemically-modified tetracycline analog, CMT-308, which was validated in B16F10 mouse melanoma cells and HEMn-DP monocultures and cocultures. CMT-308 inhibited both steps of the reaction catalyzed by the soluble enzyme, mushroom tyrosinase. In addition, our research findings uncovered that CMT-308 exhibits a novel mechanism of inhibition of melanogenesis by exclusively targeting melanosome export with the induction of perinuclear aggregation without affecting intracellular melanin biosynthesis. Future studies to test the molecular mechanisms of downregulation of melanosome export by CMT-308 and whether the capacity to inhibit melanogenesis is retained in skin-tissue equivalents are warranted. Furthermore, studies to test the potency of other CMT analogs for their capacity to inhibit pigmentation are currently underway. Moreover, future studies to dissect the structure-activity relationship of CMTs with antimicrobial tetracycline and their derivatives (doxycycline, oxytetracycline, chlortetracycline) would be also interesting.
Author Contributions: S.G. conceived the idea of the use of CMTs for melanogenesis, designed all experiments, generated results, and wrote the manuscript. S.R.S. arranged financial resources and reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding: This research did not receive any external funding.
Acknowledgments:
We would like to especially acknowledge Lorne Golub (Stony Brook University) for seminal contributions to the field of CMTs and Francis Johnson (Department of Chemistry, Stony Brook University).
Conflicts of Interest:
The authors declare no conflict of interest. 50 Half-Maximal Inhibitory Concentration | v3-fos-license |
2020-04-16T09:24:13.979Z | 2020-04-01T00:00:00.000 | 216121003 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.26452/ijrps.v11i2.1978",
"pdf_hash": "75aced87ae51f1b364242077ddb49b4430a94225",
"pdf_src": "MergedPDFExtraction",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118878",
"s2fieldsofstudy": [
"Medicine",
"Chemistry",
"Materials Science",
"Environmental Science"
],
"sha1": "439c9095ffe8407c9b933034699f0999c54b9f37",
"year": 2020
} | pes2o/s2orc | Anti-diabetic activity of silver nanoparticles prepared from cumin oil using alpha amylase inhibitory assay
Studies suggest that cumin oil havemany health and cosmetic bene its such as weight loss, improving skin conditions and also treating cancer and diabetes. People have used these tiny black seeds of N. sativa as a natural remedy for thousands of years. Cumin oil contains thymoquinone, which is an antioxidant and an anti-in lammatory compound having tumor-reducing properties therefore useful in treating cancer. Plant mediated biological synthesis of silver nanoparticles has been gaining importance due to its simplicity and ecofriendliness. The aim of the present study was to prepare cumin oil mediated silver nanoparticles and evaluate it for its anti-diabetic activity .using alpha amylase inhibitory assay. The green synthesised cumin oil mediated silver nanoparticleswerepreparedusing1mMsilver nitrate. The anti-diabetic activity was evaluated by alpha amylase inhibitory assay. The formation of the nanoparticles was con irmed both by visual colour change as well as by scanning the absorbance by UV-Visible spectrophometer between 300 nm to 700 nm. In the present study, cumin oil mediated silver nanoparticles inhibited alpha amylase in a dose dependent manner. Hence, these nanoparticles may be used for control post prandial hyperglycemia.
INTRODUCTION
Nanotechnology is an advanced ield of technology which has lot of application in biomedical ield such as dentistry, neurodegenerative medicine, drug delivery system and so on (Menon et al., 2018;Rajeshkumar and Naik, 2018) The metal nanoparticles such as gold, zinc oxide and silver has wide and unique properties with wide range of applications (Santhoshkumar et al., 2017;Agarwal et al., 2018a;Rajeshkumar, 2016). Silver nanoparticles synthesized using different herbal plants are having wide range of applications in various ields (Rajeshkumar and Bharath, 2017).
Silver nanoparticles have many applications in medical ield. The silver nanoparticles synthesized using root extract of Acorus calamus showed very good antioxidant and antibacterial effect against gastrointestinal pathogens (Chellakannu et al., 2019). Silver nanoparticles from lemon grass is reported to have good antidiabetic activity (Agarwal et al., 2018b). The bark extract of Garcinia mangostana mediated nanoparticles showed good larvicidal activity and antimicrobial activity against fungus and disease causing bacteria (Karthiga et al., 2018). The aqueous leaf extract of Clome gynandra mediated silver nanoparticles showed peak at 420 nm and showed good antimicrobial potential (Asha et al., 2017).
Many plants are reported to have hypoglycaemic (Roy et al., 2011;Ashwini and Anitha, 2017;Aneesa et al., 2019). Nigella sativa is known for its antidiabetic effect. Extensive studies on N. sativa have been carried out by various researchers and a wide spectrum of its pharmacological actions has been explored. Due to its miraculous power of healing, N. sativa has been top ranked among evidence based herbal medicines. Most of the therapeutic properties of this plant are due to the presence of phytochemicals like thymoquinone which is the major bioactive component of the essential oil (Wafai et al., 2010).It is reported that , the presence of thymoquinone is (30%-48%), thymohydroquinone, dithymoquinone, p-cymene (7%-15%), carvacrol (6%-12%), 4-terpineol (2%-7%), t-anethol (1%-4%), sesquiterpene longifolene (1%-8%) α-pinene and thymol etc (Kanter et al., 2009). Plant mediated biological synthesis of silver nano particles has been gaining importance due to its simplicity and eco-friendliness. Cumin oil was used as the sole reducing and capping agent for the synthesis of silver nanoparticles. In this study, cumin oil mediated silver nanoparticles were evaluated for anti-diabetic activity using alpha amylase inhibitory assay. 1 mM silver nitrate (90 mL) in double distilled water was mixed with 10 mL of cumin oil solution to make 100 mL and kept in an orbital shaker with magnetic stirrer for synthesis of silver nanoparticles .The colour change was observed visually and photographs were recorded.
Characterization of Silver Nanoparticles
The synthesised nanoparticles were primarily conirmed by UV-Vis spectroscopy. 3 mL of the solution was taken in a cuvette and scanned between 300 nm to 700 nm. The results were recorded for graphical analysis.
Alpha-amylase inhibitory assay
The antidiabetic activity of synthesized nanoparticles were anlysed based on our previsous studies (Roy and Geetha, 2013). % inhibition was calculated using the formulae- Where, C= control, T= test sample.
RESULTS AND DISCUSSION
The Figure 1 depicts the image of the cumin oil mediated silver nanoparticles. There was a visible colour change in the reaction mixture indicating the nanoparticle synthesis induced by cumin oil. Figure 2 shows the UV -Vis spectroscopy of the synthesised nanoparticles. The surface Plasmon resonance peak of cumin oil mediated silver nanoparticles around nm con irmed the formation of silver nanoparticles. Figure 3 showed a dose dependent inhibitory effect of cumin oil mediated silver nanoparticles on alpha amylase enzyme. Inhibitors of this enzyme are potential compounds for management of diabetes. Plants are known for their enzyme inhibitory activity. Many plant mediated oils were used for the green synthesis of different metal nanoparticles for their biomedical application. The present study claims the Alpha amylase inhibitory effect of cumin oil mediated silver nanoparticles.
CONCLUSIONS
Present study prove the antidiabetic activity of cumin oil mediated silver nanoparticles by its excellent alpha amylase inhibitory effect. Carbohydrate metabolizing enzyme inhibitors are a very good choice for postprandial control of hyperglycemia so the blood sugar levels are improved well. | v3-fos-license |
2020-04-23T09:06:33.387Z | 2020-04-01T00:00:00.000 | 216110760 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/2072-6643/12/4/1157/pdf",
"pdf_hash": "0dbb0a5db6bf01edf738806ed5e596d7b2b8885e",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118903",
"s2fieldsofstudy": [
"Agricultural And Food Sciences",
"Biology"
],
"sha1": "fe3f95df1665ca377408d1173a1cd017d3b73dae",
"year": 2020
} | pes2o/s2orc | Is Acrylamide as Harmful as We Think? A New Look at the Impact of Acrylamide on the Viability of Beneficial Intestinal Bacteria of the Genus Lactobacillus.
The impact of acrylamide (AA) on microorganisms is still not clearly understood as AA has not induced mutations in bacteria, but its epoxide analog has been reported to be mutagenic in Salmonella strains. The aim of the study was to evaluate whether AA could influence the growth and viability of beneficial intestinal bacteria. The impact of AA at concentrations of 0–100 µg/mL on lactic acid bacteria (LAB) was examined. Bacterial growth was evaluated by the culture method, while the percentage of alive, injured, and dead bacteria was assessed by flow cytometry after 24 h and 48 h of incubation. We demonstrated that acrylamide could influence the viability of the LAB, but its impact depended on both the AA concentration and the bacterial species. The viability of probiotic strain Lactobacillus acidophilus LA-5 increased while that of Lactobacillus plantarum decreased; Lactobacillus brevis was less sensitive. Moreover, AA influenced the morphology of L. plantarum, probably by blocking cell separation during division. We concluded that acrylamide present in food could modulate the viability of LAB and, therefore, could influence their activity in food products or, after colonization, in the human intestine.
Introduction
Acrylamide (AA) is a chemical compound used in many industries. It is produced as a substrate for the synthesis of polymers widely used in the paper, chemical, and cosmetics industries. In 1994, the International Agency for Research on Cancer (IARC) included acrylamide in a group of compounds "probably carcinogenic to humans" after laboratory tests in mice and rats [1].
Acrylamide in foods is formed mainly by the reaction of free asparagine with reducing sugars (especially fructose and glucose) during the Maillard reaction, but it can also be formed by other pathways, e.g., the acrolein pathway [2]. The most important factors for AA formation are time and the temperature of the thermal processing of food products, and it is thought that a prerequisite for AA formation is temperature exceeding 120 • C.
Acrylamide has been shown to be a reproductive toxicant in animal models [3,4]. It exerts neurotoxic activity [5][6][7], and many studies have proved that AA also has genotoxic, cytotoxic, and carcinogenic impacts on the human organism [6,[8][9][10]. However, due to the fact that acrylamide does not exert a mutagenic effect in bacterial cells [3,11], it has been agreed that its carcinogenic activity is related to glycidamide (GA)-an acrylamide metabolite formed in mammalian cells. The mutagenic and genotoxic effects of GA have already been confirmed in various in vitro and in vivo studies, showing that this AA metabolite can induce the formation of DNA adducts, resulting in mutagenesis and the development of cancers [6,8,9,12].
The impact of AA on microorganisms is still unclear. The results of many assays made by various laboratories are consistent in showing that AA is not a mutagen in Salmonella Typhimurium tested strains at concentrations up to 5 mg/plate, with or without metabolic activation [3]. However, three epoxide analogs of acrylamide, e.g., glycidamide, have been reported to be mutagenic in Salmonella strains ± S9 activation [11,13]. Tsuda et al. [14] reported that AA did not induce any gene mutations in Salmonella/microsome test systems (TA98, TA100, TA1535, TA1537) and in Escherichia coli/microsome assays (WP2 uvrA − ) up to a dose of 50 mg AA/plate, but acrylamide did show a strong positive response in a Bacillus subtilis spore-rec assay (induced DNA damage) at 10-50 mg/disc. According to the authors, the results suggested that AA had the potential to induce gross DNA damage rather than point mutations detected by the Ames test. There are also studies demonstrating that after introducing 1%-3% acrylamide into the growth medium, Escherichia coli cells undergo various changes, such as blockage of cell division, elongation of cells, inhibition of DNA synthesis, decreased osmotic stability, and ultrastructural alterations of the outer membrane [15].
Taking into account eukaryotic cells, it is worth citing the research of Kwolek-Mirek et al. [16]. They demonstrated that acrylamide caused impairment of growth of Saccharomyces cerevisiae yeast deficient in Cu, Zn-superoxide dismutase (∆sod1) in a concentration-dependent manner. This inhibitory effect was not due to cell death but to decreased cell vitality and proliferative capacity. Exposing ∆sod1 yeast to acrylamide caused the increased generation of reactive oxygen species and decreased glutathione levels.
It has also been proven that some microorganisms have the ability to use acrylamide as a carbon and nitrogen source for their growth and that amidases are the main factor involved in AA degradation. Amidases are enzymes (EC. 3.5.1.4) that occur ubiquitously in nature and are characterized by a broad spectrum of catalyzed reactions [17]. Classification on the basis of catalytic activity takes into account the substrate specificity profile of the particular amidase and divides known amidases into six classes. During the amidase-catalyzed deamination reaction of acrylamide, acrylic acid and ammonia are formed. Then, acrylic acid can be reduced to propionate or transformed into β-hydroxypropionate, lactate, or CO 2 , in a pathway involving coenzyme-A [2,5,8].
To date, laboratory tests have shown the ability to degrade AA by many environmental microorganisms, mainly bacteria, such as Ralstonia eutropha [18], Pseudomonas chlororaphis [19], Enterobacter aerogenes [20], Pseudomonas aeruginosa [21,22], Bacillus cereus [23], Rhodococcus sp., Klebsiella pneumoniae [24,25], and Burkholderia sp. [26]. It is worth highlighting that among the amidase producers are certain species that naturally occur in human organisms or are delivered with food, such as Escherichia coli [27], Bacillus clausii [28], Enterococcus faecalis [29], and Helicobacter pylori [30,31]. However, the substrate specificity of their amidases and the potential for reaction with acrylamide have not yet been confirmed. In some cases, it has even been proved that those bacteria produce only cell wall amidases, such as N-acetylmuramoyl-L-alanine amidase [32], with no affinity to acrylamide. Either way, there is a possibility that members of microbiota could degrade acrylamide directly in the human intestine.
Lactic acid bacteria (LAB) constitute very important members of intestinal microbiota and play an important role in proper organism functioning and maintenance of our health [33][34][35][36]. Representatives of LAB are also important in the food industry, both as starter culture added during production and as native microbiota of raw materials used for food production [37][38][39]. The positive role of LAB could also be related to their ability to reduce AA levels in organisms or foodstuffs. To date, the possibility of degrading AA by amidase production has not been confirmed, although synthesis of N-acetylmuramoyl-L-alanine amidase, involved in the degradation of peptidoglycan and hydrolysis of the amide bond between N-acetylmuramic acid and L-amino acids of the bacterial cell wall, has been reported in LAB [40,41]. Other studies [42,43] have shown that Lactobacillus reuteri Nutrients 2020, 12, 1157 3 of 22 NRRL 14171 and Lactobacillus casei Shirota are able to remove acrylamide in aqueous solution by physically binding the toxin to the bacterial cell wall, probably with a significant role of the teichoic acid structure. Later, Rivas-Jimenez [44] demonstrated that both mentioned bacterial strains were able to remove dietary AA (commercial potato chips with an average AA content of~34,000 µg/kg) under different simulated gastrointestinal conditions. The percentage of AA removed by each bacterium exposed to different concentrations of the toxin (10-350 µg/mL) had a similar tendency; the lower the concentration of AA, the higher the percentage of toxin removed. The results showed that L. casei Shirota showed a higher percentage (68%) of AA removed than L. reuteri (53%) when bacteria were exposed to the lowest concentration of toxin (10 µg/mL), but no significant differences (p < 0.05) were observed in the percentage of toxin removed by both strains (~2%) when ≥100 mg/mL of AA was used. These findings proved that strains of the genus Lactobacillus could be employed to reduce the bioavailability of dietary AA. However, the strong dependence on AA concentration suggests that the mechanism of AA reduction is still the physical binding of AA by bacteria.
To the best of our knowledge, no one has investigated how acrylamide affects the viability of lactic acid bacteria so far, and this is an important issue considering their important role in the human body. First of all, lactic acid bacteria can be exposed to acrylamide just in food products. There are many fermented milk products that contain various "additives" rich in AA, such as biscuits, muesli, roasted almonds, nuts and seeds, dried fruit, breakfast cereals, and bran flake cereals. Also, so-called pro-health foods, such as probiotic bars and cereals, contain live strains of LAB, as well as crispy cereals, roasted nuts, almonds and seeds, almond and peanut butter, dried fruits, flakes, etc. Moreover, intestinal LAB can also be exposed to dietary acrylamide after intake of various fried, grilled, toasted, roasted, or baked foods. Although acrylamide is rapidly absorbed from the intestine, there are studies suggesting that some food matrices (or components) can reduce the intestinal absorption of AA. For example, a high protein concentration in the human diet may reduce acrylamide uptake [45], causing unmetabolized acrylamide to reach the colon. Therefore, the aim of this study was to evaluate whether acrylamide could influence the growth and viability of lactic acid bacteria belonging to the Lactobacillus genus.
Bacteria
Pure cultures of lactic acid bacteria belonging to the Lactobacillus genus were used in the study. For the experiments, 4 strains constituting a typical microbiota of fermented milk products and 2 probiotic strains were chosen: Lactobacillus plantarum DSMZ 20205, Lactobacillus brevis DSMZ 20054, Lactobacillus lactis subsp. lactis DSMZ 20481, and Lactobacillus casei DSMZ 20011. All were purchased from Leibniz Institut DSMZ (Deutsche Sammlung von Mikroorganismen und Zelkulturen GmbH, Braunschweig, Germany). Two probiotic strains-Lactobacillus acidophilus LA-5 and L. casei LC01-were obtained from Christian Hansen (Hørsolm, Denmark).
Bacteria were delivered as freeze-dried cultures and were handled according to supplier protocol. Briefly, after opening the ampoule, bacteria were rehydrated and then transferred to a tube with sterile liquid De Man, Rogosa, and Sharpe (MRS) agar medium (BioMaxima, Lublin, Poland) and incubated at a temperature optimal for strain. For L. acidophilus LA-5 and both L. casei strains, the optimal temperature was 37 • C, while, for other Lactobacillus species, it was 30 • C.
Measurement of Optical Density of Bacterial Suspension: Calibration
To tubes containing 5 mL of sterile MRS medium, a volume of 0.1 mL of 24-h liquid bacterial culture was added, the contents were mixed, and the tubes were incubated for 24 h at the optimum temperature for the tested strain. After incubation, bacterial cultures were centrifuged at 194× g for 15 min (MPW-35JR centrifuge, MPW MED Instruments, Warsaw, Poland), and the supernatant was discarded. The pellets were rinsed by mixing with 5 mL of sterile distilled water followed by centrifugation (using previous parameters). The resulting pellets were resuspended in sterile water so as to obtain an optical density of the bacterial suspensions equal to McFarland standard 1.0 (using a Den-1B densitometer, Biosan, Latvia). Then, serial 10-fold dilutions were made in sterile water, and 1 mL of subsequent dilution was spread over the surface of the MRS medium (in triplicate). After 72 h of incubation at an optimal temperature, bacterial colonies were counted, mean bacterial cell density in cfu/mL from 3 replicates was calculated for each tested strain, and the relationship between the optical density of McFarland = 1 and bacterial cell density was determined. The relationships obtained for individual strains were as follows (1 McFarland unit equivalent): L. plantarum, 1.55 × 10 8 cfu/mL; L. brevis, 4.5 × 10 7 cfu/mL; L. lactis subsp. lactis, 1.6 × 10 8 cfu/mL: L. casei, 4.9 × 10 7 cfu/mL; L. acidophilus LA-5, 4.45 × 10 7 cfu/mL; L. casei LC01, 4.8 × 10 7 cfu/mL. Before each experiment, a 24 h culture of adequate Lactobacillus strain was centrifuged, washed in sterile water, and resuspended (as described above). The optical density of the bacterial suspension was adjusted to a value corresponding to 2 × 10 7 cfu/mL.
Model Medium for Experiments
All experiments were carried out in carbon-and nitrogen-limiting conditions because model medium composed of 0.45% NaCl (POCh, Gliwice, Poland), and 0.45% bacteriological peptone (BioMaxima, Lublin, Poland) was used. If a solid medium was required, bacteriological agar was added in a final concentration of 2% (BioMaxima, Lublin, Poland). All media were sterilized using a Microjet Microwave Autoclave (process parameters: 135 • C, 80 s, 3.6 bar; Enbio Technology Sp. z o.o., Gdynia, Poland).
Preliminary Assessment of Acrylamide Impact on Lactobacillus Growth
The impact of acrylamide on Lactobacillus was assessed by evaluating visible bacterial growth on the solid model medium containing acrylamide at various concentrations: 10, 50, 100, 250, 500, and 1000 µg/mL. Serial 10-fold dilutions of the suspension of tested bacteria (2 × 10 7 cfu/mL) were made in sterile water. Then, a volume of 1 mL of acrylamide "stock" solution of adequate concentration was added to 18 mL of sterile, cooled, but still, liquid, model medium and poured into a sterile Petri plate containing 1 mL of the diluted bacterial suspension. Positive controls were Petri plates with 19 mL of the model medium (without acrylamide) mixed with 1 mL of a diluted suspension of tested bacteria. After media solidification, all plates were incubated for 72 h at a proper temperature optimal for the tested strain, and then the bacterial growth was assessed according to the following scale: ++++ very intense growth (colonies cover the whole surface, creating lawn plates) +++ intense growth (too many colonies to count, but they are distinguishable) ++ good growth (30-300 colonies/plate) + only a few colonies (<30 colonies/plate) − no growth First, the growth of bacteria on plates with positive control was evaluated, and the dilution of bacterial suspension with good growth (30-300 colonies/plate) was chosen. For the same dilution, growth in the presence of AA was assessed. The experiment was performed in 5 replicates.
Determination of Cell Concentration and Viability by Flow Cytometry
The Lactobacillus strains whose growth was influenced by acrylamide in the preliminary analysis were chosen for this stage of the experiment. A volume of 1 mL of bacterial suspension (containing 2 × 10 7 cfu/mL) was inoculated into 19 mL of liquid model medium, with the addition of acrylamide to a final concentration of 7.5, 15, 30, or 100 µg/mL, and incubated for 48 h. The final bacterial cell density was 10 6 cells/mL, which corresponded to the average number of LAB cells found in fermented milk drinks (FAO/WHO Food Standards). The proposed AA concentrations were selected based on the literature [42,46], and the 100 µg/mL concentration is higher than the possible level reached in the human gastrointestinal tract or in food products. The positive control was medium with 1 mL of sterile distilled water added instead of an acrylamide "stock" solution (marked as 0 µg/mL). Immediately after adding bacteria to the medium (marked as 0 h, but taking into account staining times and cytometric measurement, the analysis was actually done about 2 h after adding the bacteria), after 24 h and 48 h of incubation at an optimal temperature, the cell concentration (cell/mL) was evaluated by flow cytometry (BD Accuri TM C6 Flow cytometer, BD Biosciences, Bio-Rad, Poland) equipped with fluorescence detectors FL1 533/30, FL2 585/40, FL3 670LP. For this purpose, the commercially available BD™ Cell Viability Kit with BD Liquid Counting Beads (cat. # 349480, Becton, Dickinson and Company, BD Biosciences, San Jose, CA, USA) was used. According to the protocol, cells were stained with provided dyes, and cytometric analysis was conducted using the following parameters: fluidic flow rate 14 µL/min, the threshold set at 10,000 on (Forward Scatter-Height), sample volume set at 10 µL. The bacterial cells and counting beads were gated based on (Side Scatter) parameters and FL2, while the populations of alive, injured, and dead bacteria were discriminated based on an FL1 (thiazole orange) vs. FL3 (propidium iodide) plot. In live cells, the membrane is intact and impermeable to dyes, such as propidium iodide (PI), while when cells are injured or dead, the propidium iodide can leak into the cells because of their compromised membranes. PI is a nucleic acid intercalator, so it stains nucleic acids. On the other side, thiazole orange is a permeant dye that also reacts with nucleic acids but enters all cells-alive, injured, and dead, to varying degrees. Therefore, it will stain all cells containing nucleic acids. Thus a combination of these two dyes provides a rapid and reliable method for discriminating live, injured, and dead bacteria. To determine the concentrations of cell populations (expressed as cell/mL), Equation (1) was used: * This value was found on the vial of BD Liquid Counting Beads and could vary from lot to lot. In the case of Lactobacillus plantarum, changes in cell morphology under the influence of acrylamide were noted, which manifested in the form of cells with twice or several times stronger FL1 signal. Analysis of microscopic preparations stained by the Gram method confirmed that they were Lactobacillus plantarum cells appearing individually (bacillus), in pairs (diplobacillus), or in the form of chains (streptobacillus).
Statistical Analysis
All experiments were carried out in 5 replicates, and results are expressed as mean ± standard deviation (SD). When the impact of acrylamide on bacterial cell number was assessed, one-way analysis of variance (ANOVA) with Tukey's honest significant difference (HSD) posthoc test was used to compare mean values and determine the significance of differences. The Brown-Forsythe test was used to verify the hypothesis of homogeneity of variances, while Shapiro-Wilk test was used to test the normality of distribution. A p-value < 0.05 was considered statistically significant. This part of statistical analysis was carried out in Dell Statistica (Data Analysis Software System, version 13, 2016, software.dell.com). Two-way ANOVA in a mixed model was used to assess data from flow cytometry, which means the interrelationship of two independent variables (incubation times and acrylamide concentrations) with a dependent variable (% of particular cell types), using IBM SPSS Statistics for Windows (2017, Version 25.0; IBM Corp., Armonk, NY, USA). Bonferroni posthoc test was used, and the differences were considered significant when p-value < 0.05.
Impact of Acrylamide on LAB Growth on Solid Medium
The model medium used for experiments was low nitrogen and low carbon; therefore, the growth of Lactobacillus was significantly limited compared to the MRS medium. Acrylamide added to such medium did not show bactericidal or bacteriostatic activity against tested bacteria from the Lactobacillus genus even in very big concentrations, not reported in food (Table 1).
Moreover, it was surprising that AA could stimulate the growth of L. plantarum and probiotic strain L. acidophilus LA-5 at a concentration of 1000 µg/mL, while L. brevis and L. lactis sp. lactis growth was more intense compared to control in the presence of 500 µg and 1000 µg of acrylamide per mL. The acrylamide concentration used in that part of the study was much higher than that detected in food. The concentrations of acrylamide reported in the literature vary from <10 to even 80,920 µg/kg, with the highest levels in potato chips, French fries, roasted coffee, and coffee extract [44,[47][48][49][50]. Considering the quantities of particular foodstuffs we consume each day, it has been estimated that total AA uptake varies from 0.3 to 1.4 µg per kg body weight per day [48], depending on the age group (high consumption of coffee in adults) and eating habits. In particular cases, it can reach up to 5 µg/kg/day [5].
The obtained results suggested that some lactic acid bacteria probably could utilize acrylamide as a source of carbon and nitrogen if they lack in the environment (medium). The possibility of acrylamide degradation (not binding) by LAB has been suggested by the results of a study conducted on rats fed with acrylamide 3 h after consumption of four species of Bifidobacterium. A significant reduction in the degree of liver damage [51] has been observed. Other studies have demonstrated that in portions of potatoes prepared for French fries subjected to 15 min of fermentation before frying, the AA level is reduced by 90% [52]. However, these results only confirm that lactic acid bacteria can utilize substances that are precursors of acrylamide for their own use; the possibility of AA degradation by LAB has not been studied.
Another strategy to reduce acrylamide formation in bread was proposed by Nachi et al. [53] by using selected lactic acid bacteria strains for dough fermentation. When the LAB was used to inoculate sourdough, the acrylamide concentration in the bread was reduced. This was due to the lower pH of the LAB-inoculated sourdough after fermentation for 16 h compared to the spontaneous sourdough (using only baker's yeast). The acidification was accompanied by a significant increase in the concentration of reducing sugars, which were then used as electron acceptors by LAB and reduced to mannitol. The lack of sugar and low pH prevented the Maillard reaction. The most pronounced reduction of acrylamide formation (by 84.7%) was obtained in bread made with Pediococcus acidilactici strain S16.
Impact of AA on Lactic Acid Bacteria Concentration in Medium
Three LAB strains were chosen for further experiments: L. brevis, L. plantarum, and probiotic strain L. acidophilus LA-5. The bacteria concentration was measured by flow cytometry immediately and after 24 h and 48 h of acrylamide addition at various concentrations ( Figure 1). The number of bacteria cells in the medium was determined according to Equation (1) using the number of events in the bacteria and bead regions and expressed as cell number per 1 mL.
Nutrients 2020, 12, x FOR PEER REVIEW 8 of 21 medium for LAB growth. Therefore, the LAB number also decreased in the medium without the addition of AA. This environment is, therefore, ideal for assessing the impact of AA in the absence of other, more absorbable sources of carbon and nitrogen. In milk, lactic acid bacteria use casein as a source of amino acids, thanks to having appropriate proteolytic enzymes [54]. Gene encoding the cell-wall bound proteinase (PrtP) is only found on the chromosome of L. acidophilus; neither L. plantarum nor L. brevis [55] has it. Also, some peptidases are unique to individual species. The presence of these enzymes, however, is important primarily in the environment typical for these microorganisms (milk) and affects the rate of multiplication of individual bacteria due to various assimilation possibilities of proteins available in the environment, as well as the final effect of the fermentation process, including the resulting secondary metabolites. In the medium used in this experiment, the only source of carbon and nitrogen was 0.45% of peptone obtained as enzymatic meat tissue hydrolysate, while, in MRS, usually about 2.5% of addition of AA to the medium, so the bacteria have time to change their metabolism and can already start using AA as a source of carbon or nitrogen. The presence of AA in the medium resulted in a decrease in L. brevis number after 24 h and 48 h incubation, but not significantly correlated with the AA concentration used ( Figure 1B). For L. acidophilus LA-5, differences in population size compared to controls and between AA doses were not statistically significant ( Figure 1A). The initial increase in cell number in the sample with 7.5 µg AA might have resulted from the use of small amounts of AA, but the concentration was too low to guarantee adequate conditions for bacterial growth and multiplication over a longer period of time. After 24 h, very large fluctuations in culture were reported, but after 48 h, the observed differences were not statistically significant, except for incubation in the presence of 15 µg/mL AA, when LA-5 was lower than in other samples.
These results suggested that L. acidophilus LA-5 was sensitive to AA because of decreased cell numbers, which would be consistent with the results of studies on other bacteria. However, these studies have used a medium-low in nitrogen and carbon, and not, as in most other studies, an optimal medium for LAB growth. Therefore, the LAB number also decreased in the medium without the addition of AA. This environment is, therefore, ideal for assessing the impact of AA in the absence of other, more absorbable sources of carbon and nitrogen. In milk, lactic acid bacteria use casein as a source of amino acids, thanks to having appropriate proteolytic enzymes [54]. Gene encoding the cell-wall bound proteinase (PrtP) is only found on the chromosome of L. acidophilus; neither L. plantarum nor L. brevis [55] has it. Also, some peptidases are unique to individual species. The presence of these enzymes, however, is important primarily in the environment typical for these microorganisms (milk) and affects the rate of multiplication of individual bacteria due to various assimilation possibilities of proteins available in the environment, as well as the final effect of the fermentation process, including the resulting secondary metabolites.
In the medium used in this experiment, the only source of carbon and nitrogen was 0.45% of peptone obtained as enzymatic meat tissue hydrolysate, while, in MRS, usually about 2.5% of nitrogen compounds and 2% glucose are present. Furthermore, L. acidophilus and L. brevis possess all three known LAB peptide transport systems: the di/tripeptide Dpp and DtpT systems and the oligopeptide Opp system [55]. LAB are auxotrophs relative to amino acids, and, depending on the species, they can synthesize only a few amino acids, while the others must be provided with the medium. This means that a medium-low in protein and amino acids will quickly become a factor that limits bacterial growth because bacterial growth and multiplication require the assimilation of substrates to supply the cell with the necessary energy, carbon, and nitrogen to build new structures. That is why the ability to degrade acrylamide to be used as a source of nitrogen (released by NH 4 + amidase) and carbon was so important in this experiment. It should be recalled that in this part of the study, all cells were counted: those that were alive and able to function properly and further divide, those that were damaged and whose metabolism was temporarily switched to repair the damage, and dead cells that had not yet broken down.
The situation differed in the case of L. plantarum ( Figure 1C). After 24 h in the control medium without AA, an increase in the number of bacteria was observed; however, by analyzing their morphology, it was clear that this correlated with the grouping type in which these cells occurred. In the initial population (0 h), 92.55 ± 0.08% of cells appeared as single bacilli and 7.41 ± 0.08% as diplobacilli, while no streptobacilli were observed. After 24 h, the number of cells in culture without AA increased slightly; however, this was mainly due to the fact that the diplobacilli split into single cells. A lack of division meant that after another 24 h, 99% of the population were single rods, and their numbers significantly decreased compared to the initial value.
Acrylamide Impact on LAB Viability
Cell concentration and viability were measured by flow cytometry immediately and 24 h and 48 h after acrylamide addition at various concentrations. Populations of dead, injured, and alive bacteria were discriminated based on fluorescence signal after staining with thiazole orange (FL1) and propidium iodide (FL2) provided in the assay. The concentrations of various cell populations were determined using counting beads.
First, it was checked whether incubation time, regardless of acrylamide concentration, had a significant impact on the percentages of specific cell types (main effect of incubation time). All tested main effects of incubation time were statistically significant, except for dead cells of Lactobacillus brevis ( Table 2). The viability of L. brevis increased after AA addition, while the percentage of injured cells was significantly diminished. Contrary to that was the viability of Lactobacillus acidophilus LA-5. The highest percentage of live cells was at the beginning of the experiment, while the lowest was after 24 h. Tracking changes in the percentage of injured cells, it appeared that some were repaired, and after 48 h, they were considered to be fully viable. Moreover, some dead cells underwent autolysis, and the cell content released in the medium was utilized by survivors. Lactic acid bacteria are characterized by differentiated autolytic activity, but the process allows them to eliminate weak or impaired cells from the population [56]. In the mentioned study, L. plantarum strains were autolyzed more than other LAB strains; however, the authors did not test the autolytic activity of L. brevis or L. acidophilus [56]. It is well known that some lactic acid bacteria can undergo enzymatic cleavage of cell wall peptidoglycans by peptidoglycan hydrolases present in the bacterial cells and that the autolysis depends on factors, such as carbon source, temperature, osmotic concentration, and pH [56]. It has also been demonstrated that N-acetylmuramidase has a critical function in Lactobacillus bulgaricus autolysis [57] as one of the major degraders of the cell wall. In our experiment, the percentage of live L. plantarum cells was significantly lower after 48 h than at the beginning or after 24 h. Moreover, significant differences in L. plantarum morphology were observed. After 48 h of incubation in the presence of acrylamide, fewer cells were present in the form of single bacilli, while the amounts of diplobacilli and streptobacilli were significantly increased (Table 2 and Figure 2). Such an effect was not observed in other LAB strains. Then, it was tested whether the acrylamide concentration, regardless of the time of incubation, had a significant effect on the percentage of specific cell types (alive, injured, dead) or L. plantarum morphology (main effect of acrylamide concentration). The ANOVA results are presented in Table 3 and posthoc tests in Table 4. Table 3. The main effect of acrylamide concentration: influence of acrylamide concentration on the percentage of occurrence of certain cell types (expressed as arithmetic mean (SD)), regardless of the incubation time. The analysis showed that the main effect of acrylamide concentration did not occur in the L. brevis strain, which meant that in this case, acrylamide (regardless of the incubation time) had no effect on their viability. The AA impact was observed in other tested strains and when the morphology of L. plantarum was taken into account. Posthoc analysis showed that acrylamide significantly increased the percentage of alive cells of L. acidophilus LA-5 strain, but this was only observed at a concentration of 30 µg/mL and was accompanied by a significant decrease in the number (percentage) of injured cells. In the L. plantarum strain, acrylamide at each concentration significantly reduced viability while also significantly increasing the number of injured cells. In addition, morphological examination of L. plantarum showed a decrease in the proportion of single cells (bacilli), mainly in favor of increasing their frequency in pairs (diplobacilli). The number of cells in the form of chains (streptobacillus) also increased, but to a lesser extent.
Bacteria Strain % of Cells
Finally, the interaction effects (simultaneous impact) of incubation time and acrylamide concentration were tested. Acrylamide significantly increased the viability of L. acidophilus LA-5 cells at a concentration of 30 µg/mL after 24 h incubation and at 0, 30, and 100 µg/mL after 48 h, when compared to the model medium without acrylamide ( Table 5). The increase in alive cells was mainly accompanied by a reduction in injured cells, rather than dead ones. In turn, the viability of L. acidophilus LA-5 decreased at an acrylamide concentration of 15 µg/mL after 48 h. In the case of Lactobacillus brevis, acrylamide at each concentration decreased the percentage of injured cells after 24 h and 48 h incubation (compared to control), although a statistically significant reduction in the percentage of alive bacteria was observed only after 48 h at 100 µg/mL (Table 6). All other changes were not statistically significant. After 24 h and 48 h of incubation in the presence of acrylamide at concentrations higher than 7.5 µg/mL, reduced viability of L. plantarum cells was observed, while the number of injured cells increased compared with medium without acrylamide (Table 7). We observed that the morphology of one of the tested bacteria, Lactobacillus plantarum, was significantly influenced by acrylamide. Based on the fact that cells with both twofold and several times stronger FL1 fluorescence signal (thiazole orange) appeared in the population, we concluded that acrylamide did not inhibit or even stimulate the division of L. plantarum but blocked cell separation; hence bacteria in the form of diplobacilli and streptobacilli were present in the population. This conclusion was confirmed by microscopic preparations. A statistically significant reduction in the number of single rods (bacilli) in the presence of AA in amounts of 7.5 and 15 µg/mL after 24 h incubation and in all AA concentrations after 48 h was demonstrated compared to the medium without acrylamide. This was mainly accompanied by a significant increase in the number of cells found in pairs (diplobacilli) and to a much lower extent in chains (streptobacilli). For each analyzed concentration of AA, this increase was especially significant after 48 h, reaching even~50% at 30 µg/mL (Table 8).
Discussion
In this study, we demonstrated that the tested lactic acid bacteria strains were tolerant of acrylamide even at high concentrations (up to 1 g/mL). Moreover, the growth of Lactobacillus plantarum, L. lactis sp. Lactis, and L. brevis, as well as probiotic strain L. acidophilus LA-5, was more intense in the presence of acrylamide at high concentration than in medium with limited accessibility of carbon and nitrogen compounds. The obtained results suggested that: (1) acrylamide had no toxic impact on LAB; (2) some lactic acid bacteria probably could utilize acrylamide as a source of carbon and nitrogen if they lack in the environment/medium. Of course, fermented milk beverages and the human gut cannot be considered nutrient-poor environments, as the availability of easily digestible food for bacteria is large, but the possibility of using acrylamide by lactic acid bacteria might be beneficial for both bacteria and the human intestine where the LAB reside.
Our results proved that acrylamide not only influenced the number of lactic acid bacteria but also their viability. The impact of acrylamide on LAB viability depended on both the AA concentration and the bacteria species. First of all, when the impact of incubation time on bacterial viability was analyzed, all the main effects were statistically significant, except the percentage of dead cells of Lactobacillus brevis. Secondly, the main effect of acrylamide concentration on the percentage of alive, injured, and dead cells was not observed only in L. brevis. This suggested that L. brevis was less sensitive to acrylamide among the tested bacteria strains, and it was confirmed in the further analysis as almost all observed differences were not statistically significant.
The posthoc tests showed that acrylamide caused a significant increase in the percentage of alive cells of probiotic strain L. acidophilus LA-5 at an AA concentration of 30 µg/mL compared to the cultures without AA. This increase was mainly accompanied by a reduction in the number of injured cells rather than dead ones. On the other side, acrylamide reduced the viability of L. plantarum cells after 24 h and 48 h incubation at each AA concentration except 7.5 µg/mL, simultaneously increasing the amount of injured cells. Moreover, we observed a strong influence of acrylamide (especially at a concentration of 30 µg/mL) on the morphology of bacteria only in L. plantarum. Based on the fact that cells with both twofold and several times stronger FL1 fluorescence signal (thiazole orange) appeared in the population, we concluded that acrylamide had no impact on the division of L. plantarum, but at the same time, it inhibited cell separation, as cells in the form of diplobacilli and streptobacilli were present in the population (confirmed in microscopic preparations). This suggested that in this case, acrylamide could have a harmful or even mutagenic impact on L. plantarum.
It is known that many proteins and hydrolytic enzymes are involved in the proper growth and division of bacteria. Various enzymes participate in turnover (remodeling) of peptidoglycan, and their proper activity and specificity are critical, as bacterial division requires both localized hydrolysis and de novo biosynthesis of the peptidoglycan layer. For example, amidase and glucosaminidase displaying murein hydrolase activity are necessary for the generation of the equatorial ring on the staphylococcal cell surface and complete cell division and separation [58]. Escherichia coli division requires the activity of amidases-AmiA, AmiB, and AmiC [59]. It is important that muralytic enzymes distinguish elements of peptidoglycan of specific species. Generally, these enzymes are secreted into the surrounding medium, so they need to distinguish between the cell walls of other species and their own. It seems likely that the targeting mechanisms of murein hydrolases employ species-specific receptors for either physiological cell-wall turnover or the bacteriolytic killing of competing microorganisms [58,60,61]. Most Gram-positive bacteria contain a structurally similar peptidoglycan layer [62]. Thus, targeting of muralytic enzymes cannot be achieved by simple enzyme-substrate interactions but requires specific surface receptors [63]. For example, choline within teichoic acid moieties serves as a receptor for the LytA enzyme of Streptococcus pneumoniae [64]. A mutant of S. pneumoniae showing complete deletion in the lytA gene coding for N-acetylmuramyl-L-alanine amidase has been isolated. It shows a normal growth rate, and the most remarkable biological consequences of the absence of amidase are the formation of short chains (six to eight cells) and the absence of lysis in the stationary phase of growth. In our study, L. plantarum morphology changed in the presence of acrylamide, and bacteria started to form diplobacilli and streptobacilli. It is possible that acrylamide reacted with the active site of muralytic amidases and, therefore, blocked cell separation during division.
Different influence of AA on Lactobacillus species tested in the study could also be caused by the diversity of their teichoic acid (TA) structure. Teichoic acids in lactic acid bacteria consist of poly(ribitol phosphate) polymers with attached glucose, D-alanine, and/or glycerol molecules, among others [43]. Their structure is highly variable; thus, even closely related strains can differ in their ability to bind toxins. This is coincident with our results, showing that L. brevis was less and L. plantarum most sensitive to acrylamide among tested LAB strains. Serrano-Nino et al. [43] proved a significant correlation between the binding percentage of acrylamide and the content of some constituents of cell wall TAs. They proposed that H-bonds could occur between the carbonyl oxygen and the amino group (NH ··· OC) between adjacent acrylamide and D-alanine attached to the ribitol. Moreover, the amine group of D-alanine might react with acrylamide units by means of a Michael addition, while hydrogen bonds might also occur between carbonyl (C=O) oxygens of acrylamide and the hydroxyl groups of glucose residue or glycerol phosphate substituents attached to the poly (ribitol phosphate) chain. Moreover, they demonstrated that acrylamide binding to teichoic acids in Lactobacillus was irreversible.
The role of teichoic acids in cell division and morphogenesis has been investigated in some bacteria species, and it appears that wall teichoic acids (WTAs) are involved in elongation of bacteria, while lipoteichoic acids (LTAs) participate in the cellular division [65]. By obtaining the mutants of L. plantarum, it has been revealed that WTAs are not essential for survival, but they are required for proper cell elongation and cell division [66]. Therefore, the reaction of acrylamide with teichoic acids could impede division and cause that L. plantarum remains in the form of chains and diplobacillus.
Studies of Zhang [67] showed that the ability of acrylamide binding also depended on the peptidoglycan structure. The peptidoglycan of L. plantarum (strain 1.0065) had the highest affinity for AA binding (87.14%), whereas peptidoglycans of L. casei ATCC393 and L. acidophilus KLDS1.0307 showed lower affinity (75.50% and 56.75%, respectively). This binding ability of L. plantarum positively correlated with the carbohydrate content in peptidoglycan and the contents of four amino acids (alanine, aspartic acid, glutamic acid, and lysine). Additionally, it was demonstrated that C-O (carboxyl, polysaccharides, and arene), C=O amide, and N-H amines groups were involved in the AA binding.
Analyzing the interaction of acrylamide with peptidoglycan, one should take into account the differences in the structure of cell wall stem peptides. The amino acid sequence of stem peptide involved in linking glycan chains in LAB peptidoglycan is L-Ala-D-Glu-X-D-Ala. The third amino acid (X) is a diamino acid, which in LAB usually is L-Lys (e.g., L. lactis and most lactobacilli), but can also be meso-diaminopimelic acid (mDAP) (e.g., in L. plantarum) or L-ornithine (e.g., in L. fermentum) [62]. Peptidoglycan with mDAP is typical for Gram-negative bacteria, and in such cell walls, a direct cross-connection between neighboring stem peptides takes place (the mDAP in position 3 of one peptide chain binds to D-Ala in position 4 of another chain). In lactic acid bacteria with Lys-type peptidoglycan, an additional interpeptide bridge made of one D-amino acid (e.g., D-Asp or D-Asn in L. lactis, L. casei, and most lactobacilli) is included [62]. It means that the structure of L. plantarum is unusual among LAB peptidoglycans, and it is different from the structure of other tested species. Additionally, this bacterium is characterized by a unique process among bacteria-O-acetylation of peptidoglycan [66]-which has an impact on L. plantarum autolysis. O-acetylation of N-acetylglucosamine (GlcNAc) inhibits the N-acetylglucosaminidase Acm2 (which is required for the ultimate step of cell separation of daughter cells), while O-acetylation of N-acetylmuramic acid (MurNAc) has been shown to activate autolysis through the activity of the N-acetylmuramoyl-L-alanine amidase LytH [68]. It is possible that acrylamide interacts with the mentioned enzymes (amidases) and hence influences cell division and separation. In our study, we observed that in the presence of AA, the L. plantarum morphology was changed, i.e., the percentage of cells in pairs or chains increased. It is worth mentioning that in L. plantarum, almost all the mDAP side chains are amidated. Defects of mDAP amidation in the L. plantarum mutant strain strongly affect the growth and cell morphology, causing filamentation and long-chain formation, suggesting that mDAP amidation may play a critical role in controlling the septation process [69]. Further studies are needed to explain whether acrylamide interacts with the amidation of mDAP or the activity of muralytic amidases. It is also possible that the presence of AA in low-carbon and low-nitrogen medium induces the synthesis of other amidases necessary for acrylamide degradation to acrylic acid and ammonia, but also able to cleave the amide bound in mDAP, influencing cell morphology.
The impact of acrylamide on LAB morphology should also be discussed in terms of the importance of bacterial aggregation on their functioning. First of all, bacterial aggregation (auto-aggregation) may facilitate biofilm formation by favoring bacterial attachment to surfaces or other microbes (co-aggregation). It also implicates better survival of LAB in the gut. Some studies indicate that biofilms are a stable point in a biological cycle that includes initiation, maturation, maintenance, and dissolution. According to O'Toole et al. [70], microbe development involves changes in form and function that play prominent roles in the life cycle of the organism, and biofilm formation is a prominent part of the lifestyle of microbes. Moreover, bacteria seem to initiate the development of biofilm in response to specific environmental conditions, such as nutrient availability. It has been proposed that the starvation response pathway can be subsumed as a part of the overall biofilm development cycle [70]. Secondly, when growing in biofilm, organisms become more resistant to higher deliverable levels of antibiotics or other antimicrobial compounds compared to single "suspended" cells [71]. The last matter is that aggregation and co-aggregation among bacteria are important in the prevention of colonization of surfaces by pathogens. It has been proved that some lactic acid bacteria are also able to control biofilm formation by pathogens and can, therefore, prevent the colonization of food-borne pathogens [72]. It is true, for example, for some Lactobacillus plantarum strains showing an aggregation phenotype [73].
Conclusions
In conclusion, we can assume that the tested strains of lactic acid bacteria found in the human digestive tract or in fermented milk drinks are tolerant to high concentrations of acrylamide (up to 1 g/mL). Some show better growth in medium with AA than in medium with limited carbon and nitrogen sources, suggesting the possibility that they use AA for their own metabolism. Of course, in the digestive tract, especially in the initial sections of the intestine, there is sufficient availability of easily digestible food, but the possibility of using AA is beneficial for both the lactic acid bacteria and the human in whose intestine the LAB resides.
Moreover, we can assume that eating AA-containing products with a properly functioning microbiota will be less harmful to human organs than previously thought. It is also good information for producers of food (e.g., yogurt) with the addition of AA-containing ingredients, such as roasted coffee, almond or nuts, muesli, baked biscuits, or cornflakes because it should not negatively affect the microorganisms necessary for their production. | v3-fos-license |
2017-06-15T18:50:07.919Z | 2017-05-30T00:00:00.000 | 1746132 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.frontiersin.org/articles/10.3389/fnins.2017.00308/pdf",
"pdf_hash": "aed2635891d294b2de0225a3cc504685c4cb4cf7",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118936",
"s2fieldsofstudy": [
"Biology",
"Medicine"
],
"sha1": "1960ae181e7b6e1b3891a30abc813cdc1367f863",
"year": 2017
} | pes2o/s2orc | Glial Endozepines Inhibit Feeding-Related Autonomic Functions by Acting at the Brainstem Level
Endozepines are endogenous ligands for the benzodiazepine receptors and also target a still unidentified GPCR. The endozepine octadecaneuropeptide (ODN), an endoproteolytic processing product of the diazepam-binding inhibitor (DBI) was recently shown to be involved in food intake control as an anorexigenic factor through ODN-GPCR signaling and mobilization of the melanocortinergic signaling pathway. Within the hypothalamus, the DBI gene is mainly expressed by non-neuronal cells such as ependymocytes, tanycytes, and protoplasmic astrocytes, at levels depending on the nutritional status. Administration of ODN C-terminal octapeptide (OP) in the arcuate nucleus strongly reduces food intake. Up to now, the relevance of extrahypothalamic targets for endozepine signaling-mediated anorexia has been largely ignored. We focused our study on the dorsal vagal complex located in the caudal brainstem. This structure is strongly involved in the homeostatic control of food intake and comprises structural similarities with the hypothalamus. In particular, a circumventricular organ, the area postrema (AP) and a tanycyte-like cells forming barrier between the AP and the adjacent nucleus tractus solitarius (NTS) are present. We show here that DBI is highly expressed by ependymocytes lining the fourth ventricle, tanycytes-like cells, as well as by proteoplasmic astrocytes located in the vicinity of AP/NTS interface. ODN staining observed at the electron microscopic level reveals that ODN-expressing tanycyte-like cells and protoplasmic astrocytes are sometimes found in close apposition to neuronal elements such as dendritic profiles or axon terminals. Intracerebroventricular injection of ODN or OP in the fourth ventricle triggers c-Fos activation in the dorsal vagal complex and strongly reduces food intake. We also show that, similarly to leptin, ODN inhibits the swallowing reflex when microinjected into the swallowing pattern generator located in the NTS. In conclusion, we hypothesized that ODN expressing cells located at the AP/NTS interface could release ODN and modify excitability of NTS neurocircuitries involved in food intake control.
INTRODUCTION
In the early eighties, the search for an endogenous ligand for the benzodiazepine binding site of the GABA A receptor led to the discovery of a precursor polypeptide named Diazepam-Binding Inhibitor ( DBI; Costa et al., 1983;Guidotti et al., 1983;Corda et al., 1984). DBI and its proteolytic fragments octadecaneuropeptide (ODN; Ferrero et al., 1984) and triacontatetraneuropeptide (TTN; Slobodyansky et al., 1989) were collectively called endozepines (Tonon et al., 2013;Farzampour et al., 2015). DBI is identical to acyl-CoA-binding protein (ACBP, Knudsen, 1991), a cytosolic protein involved in fatty acid metabolism (Mogensen et al., 1987). It has been shown that astrocytes secrete DBI/ACBP through an unconventional pathway, in response to a variety of treatments (for review see Tonon et al., 2013;Farzampour et al., 2015).
The DBI gene is widely expressed in the central nervous system (Alho et al., 1989;Tonon et al., 1990;Costa and Guidotti, 1991;Malagon et al., 1993), with particularly high levels of expression in areas involved in food intake control such as the ventromedial and dorsomedial hypothalamus and the lateral hypothalamic area (Alho et al., 1985;Tonon et al., 1990;Malagon et al., 1993), suggesting a role of endozepines in food intake control. Accordingly, intracerebroventricular administration of ODN, or of its C-terminal octapeptide OP, in rodents exerts a potent anorexigenic effect (de Mateos-Verchere et al., 2001;do Rego et al., 2007;Lanfray et al., 2013). Moreover, intraparenchymal unilateral injection of OP in the arcuate nucleus of the hypothalamus also reduces food intake (Lanfray et al., 2013). The anorexigenic effect of endozepines does not depend on CBR or PBR signaling, but solely on ODN-GPCR signaling, since it is blunted by cotreatment with a selective ODN-GPCR antagonist (do Rego et al., 2007;Lanfray et al., 2013). Although, DBI mRNA and immunoreactivity has been found both in neurons and astrocytes (Alho et al., 1985(Alho et al., , 1989Tonon et al., 1990;Bouyakdan et al., 2015), DBI is mainly expressed in non-neuronal cells, such as ependymocytes, tanycytes, and proteoplasmic astrocytes (Tong et al., 1991;Lanfray et al., 2013;Bouyakdan et al., 2015). Consistent with a role of glial endozepines as anorexigenic factors, food deprivation reduces the mRNA expression of DBI in ependymocytes bordering the third and lateral ventricle as well as in median eminence tanycytes and arcuate protoplasmic astrocytes (Compère et al., 2010;Lanfray et al., 2013). The impact of endozepine signaling on neuronal populations involved in food intake control has been evaluated, with a focus on the hypothalamic leptin-sensitive neurons. Two populations of leptin-sensitive neurons located in the arcuate nucleus of the mediobasal hypothalamus play a major role in food intake control, one of which is inhibited by leptin and expresses the orexigenic neuropeptide Y (NPY), whereas the other one is activated by leptin and expresses the proopiomelanocortin (POMC), the endoproteolytic processing of which leads to the anorexigenic alpha-melanocyte stimulating hormone (α-MSH). It has been shown that central administration of ODN or OP reduces the expression of arcuate NPY mRNA, whereas it increases the expression of POMC mRNA (Compère et al., 2003(Compère et al., , 2005. Moreover, pharmacological blockade of the melanocortin receptors type 3/4 (MC3/4R) abolishes the effects of OP on food intake, suggesting that the melanocortin signaling is a downstream effector of ODN-GPCR signaling in food intake control (Lanfray et al., 2013).
Up to now, the relevance of extrahypothalamic targets for endozepine signaling-mediated anorexia has been largely ignored. The dorsal vagal complex (DVC) located in the caudal brainstem is strongly involved in the homeostatic control of food intake. It comprises three interconnected structures: the area postrema (AP), a circumventricular organ, the nucleus tractus solitarius (NTS) and the dorsal motor nucleus of the vagus nerve (DMNX). Similarly to the arcuate nucleus of the hypothalamus, the NTS comprises a population of POMC-expressing neurons. Several lines of evidence showed that NTS POMC neurons mediate the acute anorectic effect of melanocortin signaling. NTS POMC neurons are activated by refeeding (Appleyard et al., 2005) and cholecystokinin (Fan et al., 2004). Moreover, their selective pharmacogenetic stimulation induces a rapid and strong anorectic effect (Zhan et al., 2013). By contrast, acute optogenetic (Aponte et al., 2011) or pharmacogenetic (Zhan et al., 2013) selective stimulation of arcuate POMCneurons does not reduce food intake. Since endozepines mobilize melanocortin signaling, the DVC appears as a probable target site for endozepine-signaling-mediated anorexia. We previously studied the particularly dense glial coverage within the DVC. Interestingly, we described leptin-sensitive tanycyte-like cells form a barrier between the AP and the NTS and named these cells vagliocytes (Pecchi et al., 2007;Dallaporta et al., 2009Dallaporta et al., , 2010. In the present study, we explored DBI expression profile within the DVC, as well as the effects of 4th ventricle administration of endozepines. We show here that DBI is highly expressed in non-neuronal cell types within the dorsal vagal complex, with a strong labeling in ependymocytes and vagliocytes, and a more scattered labeling in protoplasmic astrocytes. Intracerebroventricular injection of ODN or its C-terminal octapeptide OP in the fourth ventricle reduces food intake in starved-refed rats treated in the light phase. This anorexigenic endozepine action goes with a cellular activation specifically located within the DVC. We also show that, similarly to other anorexigenic effectors acting at the brainstem level, microinjection of ODN into the swallowing pattern generator (SwCPG) located in the NTS inhibits the swallowing reflex elicited by stimulation of the solitary tract (ST). The swallowing reflex is a motor component of the alimentary canal involved in ingestive behavior. It allows the propulsion of the alimentary bolus from the oral cavity to the stomach.
ANIMALS
Experiments were performed on adult male Wistar rats (Janvier, France) of 250-350 g body weight. The animals were housed at controlled temperature on a 12:12 h light/dark cycle (lights on at 07.00 am) with food (SAFE, AO4) and water available ad libitum. Experiments carried out in this study were performed in strict accordance with European Economic Community guidelines (86/609/EEC) for the care and use of laboratory animals. The experimental procedures have been approved by our local Animal Care Ethics Committee (Comité Ethique de Provence N • 13; license N • #2207-2015100819154639).
SURGERY AND INTRACEREBROVENTRICULAR INJECTION OF ENDOZEPINES
Cannula implantation: Animals were anesthetized by an intraperitoneal (ip) injection of ketamine (100 mg/kg; Imalgen 1000, Merial) and xylazine (6 mg/kg; Rompun, Bayer), and placed in a digital stereotaxic apparatus (Model 502600, WPI) coupled to the neurostar software (Neurostar GmbH). A 26gauge stainless steel cannula was implanted into the fourth ventricle at the following coordinates: 12.7 mm posterior to bregma, 0.2 mm lateral to the midline, and 7.2 mm ventral to the skull surface. Verification of coordinates was performed by injecting 10 µl of China ink through the cannula. After rapid cryofreezing, 40 µm brain sections were realized and observed under an optic microscope (Nikon Eclipse E600W). The presence of the blue colorant in the walls on the 4th ventricle attested the right placement of the cannula. The right cannula placement was also checked at posteriori for each animal by histological observation of the cannula trace. The cannula was secured to the skull with dental cement and sealed with removable obturators. The animals were sutured, placed in individual cages and allowed to recover for 7 days. During this resting period, animals were injected with physiological saline every other day for habituation. One week post-surgery, rats were administered either 7 µl (2.2 µL/minute) of physiological saline, ODN or OP (2 µg/animal) solution 2 h after lights on. The correct cannula positioning was checked for each animal at the end of experiment by cresyl violet staining of brain sections. Subgroups of rats were anesthetized as previously described and perfused with paraformadehyde 4%, 90 min after injections for c-Fos procedures.
FAST-REFED EXPERIMENTS AND FOOD INTAKE MEASUREMENTS
Rats were fasted for 20 h before being injected. Food was removed 6 h before lights off. Two hours after lights on, rat received either icv administration of ODN (n = 10), OP (2 µg/animal, n = 7) or vehicle (NaCl 0.9%, n = 12) as described above. The corresponding molar amounts for microinjection experiments of ODN (1912.13 g/mol) and OP (911.11 g/mol) are 1 nmol and 2.1 nmol, respectively.
Forty-five minutes after treatment, a fresh supply of preweighed food was given and food intake was calculated as the difference between the pre-weighed and the remaining pellets measured with a precision balance (0.01 g; Denver Instrument from Bioblock) as previously described (Gaigé et al., 2014).
IMMUNOHISTOCHEMISTRY
Adult rats (n = 15) were deeply anesthetized with a mixture of ketamine (100 mg/kg ip; Merial, France) and xylazine (16 mg/kg ip; Bayer, France), transcardially perfused with 0.1 M sodium phosphate buffer (PBS; pH 7.4) and then, with freshly depolymerized 4% paraformaldehyde (PFA) solution in 0.1 M PBS. The brains were immediately removed, post-fixed 1 h in 4% PFA at room temperature and then cryoprotected for 24 to 48 h in 30% sucrose at 4 • C. After freezing of the brains in cold-isopentane, coronal, horizontal and sagittal free-floating sections (30-40 µm thick) were cut on a cryostat (Leica CM3050, France) and rinsed in PBS. Sections were then treated with PBS containing 3% bovine serum albumin (BSA) to block nonspecific binding sites and 0.3% Triton X-100. Sections were incubated overnight at 4 • C with the respective primary antibody at 1/1000 (ODN: 403 2207 Tonon et al., 1990; GFAP: G3893, Sigma; vimentin: AB5733, Merck Millipore), washed in PBS and incubated for 2 h at room temperature with respective secondary antibody (1/200, Vector, CA, USA). Fluorescent images were acquired on a confocal microscope (Zeiss LSN 700) using the 488-nm band of an Ar-laser and the 543-nm band of a He/Nelaser for excitation of FITC and TRITC, respectively. In double labeling experiments, images were sequentially acquired. All images were further processed in Adobe Photoshop 6.0; only contrast and brightness were adjusted and figures were not otherwise manipulated.
For c-Fos immunohistochemistry (n = 6), an anti-c-Fos rabbit antiserum (1/5000, Santa Cruz; SC-52) was used. Briefly, the freefloating sections were incubated 10 min in a solution containing 0.3% H 2 O 2 in PBS 0.1 M for quenching of endogenous peroxidase activity. After 1 h in PBS containing 3% normal goat serum (NGS) and 0.3% Triton X-100, sections were incubated for 48 h at 4 • C in PBS containing 3% NGS, 0.3% Triton X-100 and anti-c-Fos antibody. A biotinylated goat anti-rabbit IgG (1/400, Vector Labs) was used as secondary antibody. After incubation with the avidin-biotin complex (1/200, Vector Labs), horseradish peroxydase activity was visualized using a nickelenhanced diaminobenzidine (DAB) as the chromogen. The reaction was closely monitored and terminated when optimum intensity was achieved (3-5 min) by washing the sections in distilled water. Three animals of each conditions and height sections per structure were analyzed. Non-specific labeling was assessed on alternate slices that were treated identically to the above but in which the primary antibody was omitted. c-Fos immunostaining photomicrographs were acquired using a 10fold lens with a DXM 1200 Camera (Nikon) coupled to ACT-1 software. The microscope was set at a specific illumination level, as was the camera exposure time.
ELECTRON MICROSCOPY
Adult male Wistar rats (400-500 g, n = 6) were deeply anesthetized with a cocktail of ketamine (100 mg/kg ip; Merial, France)/xylazine (16 mg/kg ip; Bayer, France) and perfused by intraortic perfusion of 50 mL of 0.1 M PBS followed by 500 mL of 2% paraformaldehyde-1% glutaraldehyde in 0.1 M phosphate buffer. The brains were collected and immediately postfixed in the same solution for 3 h and then in 4% paraformaldehyde in 0.1 M phosphate buffer for 3 h. Coronal and sagittal serial sections of 50 µm thickness were made at the brainstem level using a Leica vibratome. The sections were treated with 1% sodium borohydride for 5 min. After thorough washes in PBS, they were successively incubated in 10% NGS for 30 min, in 10% NGS, 1% BSA and 0.1M lysine for 30 min, and then in rabbit anti-ODN antibody (#403; 1/800) overnight at 4 • C. Following three washes, the sections were then transferred in a biotinylated goat anti-rabbit IgG (Vector Lab.) diluted 1/400 for 2 h at room temperature, washed thrice and incubated in the avidin biotin complex (Elite Vectastain kit, Vector Lab.) diluted 1/400 for 2 h at room temperature. Unless specified, the dilutions and washes between each of the above steps were made in PBS containing 1% NGS. The peroxidase activity was revealed with 0.003% of DAB and 0.01% H2O2. After that, the sections were post-fixed in 1% osmium tetroxide in 0.1 M phosphate buffer for 45 min, dehydrated in ethanol, and embedded in Epon. A portion of the DVC containing the interface between the AP and the NTS was then cut off under binocular. Ultrathin sections of ∼70 nm in thickness were cut with an Ultracut ultramicrotome (Leica) and counterstained with uranyl acetate (5 min) and lead citrate (5 min). The ultrathin sections were then examined with a Philips CM 10 electron microscope (Center for Microscopy and Imaging of the Jean-Roche Institute) or JEOL JEM 2010F URP22 (Pluridisciplinary Center of Electron Microscopy and Microanalysis).
REAL TIME RT-PCR
DBI mRNA expression within the brainstem and the hypothalamus was examined as previously described (Gaigé et al., 2014). Briefly, total RNA was extracted from frozen brainstem and hypothalamus (n = 5) using Trizol. After RNA reverse transcription, gene expression analysis by real time PCR was performed using the ABI Thermocycler 7500 fast (Applied Biosystems). The equivalent of 6.25 ng initial RNA was subjected to PCR amplification in a 10 µl final volume using specific 2.4 µM primers and SYBR Green PCR master mix (Applied Biosystems). Product formation (DBI primers: Fw TGCTCCCGCGCTTTCA; Rev CTGAGTCTTGAGGCGCTTCAC) was detected at 60 • C in the fluorescein isothiocyanate channel. The amplicon was then submitted to agarose gel electrophoresis to evaluate its size.
SWALLOWING RECORDING
Experiments were performed on adult male Wistar rats weighting 350 g (Charles River, I'Arbresle, France), anesthetized with 0.6 ml of a mixture of ketamine (100 mg/ml; Merial, France) and xylazine (15 mg/ml; Bayer France), injected intraperitoneally in a proportion of 90% and 10%, respectively. The anesthesia was then continued by perfusion of the same mixture diluted at 10%, through a catheter inserted in the femoral vein, at a rate of 0.01-0.05 mL/h. After occipitoparietal craniotomy and removal of the posterior part of the cerebellum, the floor of the fourth ventricle appeared to lie in a horizontal plane. The surface of the medulla was exposed in order to allow the stereotaxic introduction of the microelectrode in the intermediate NTS containing the SwCPG for ODN injection, and of the stimulatory bipolar electrode into the ST. The medulla was covered with warm liquid paraffin. Swallowing was triggered by central stimulation of the ST corresponding to the entering of the sensitive fibers which convey through the superior laryngeal nerve. Stimulation with a long train of pulses produced several swallows [or rhythmic swallowing recorded by electromyography (EMG)], at a rhythm depending on stimulation frequency. In the present study, repetitive long trains of pulses (5 s duration at 15 Hz frequency every 30 s) were used. The pulse voltage, duration and frequency varied according to the animal (2.6-4.8 V; 0.02-0.6 ms) in such a way as to trigger around 4-6 rhythmic swallows. To monitor swallowing, the EMG activity of sublingual muscles (mainly the geniohyoid) was recorded by means of bipolar copper wire electrodes inserted into the muscles, using a hypodermic needle. The respiratory activity was recorded by means of a mechanotransducer placed around the thorax, and the electrocardiogram (ECG) by subcutaneous electrodes placed on each side of the thorax. Moreover, the electrocardiogram and swallowing EMG signals were fed to loud speakers for auditory monitoring. Rectal temperature was monitored and maintained around 37 • C with a heating pad. The EMG, ECG and respiration signals were recorded on a computer using an analog-to-digital interface (PowerLab 8SP data acquisition software for Windows, AD Instruments, USA). A stable control sequence involving three 30-s trains of stimulations was performed before ODN injection. The mean values obtained during this sequence were used as control values. Afterwards, stimulations and recordings were maintained until recovery. ODN injection in the SwCPG is a brief application. ODN was delivered in the SwCPG by pressure ejections through glass pipettes (70 µm O.D. at the tip) using an injection device (PMI-200, Dagan Corp., Minneapoli, MN USA). The pressure ejection was adjusted between 150 and 200 kPa for pulses of 3 s in duration, and the injected volume was 100 nl.
STATISTICAL ANALYSIS
Comparisons between groups in Figure 6 were performed with repeated ANOVA with Tukey's HSD (Honestly Significant Difference) test used for post-hoc analysis. P-values <0.05 were considered significant. Comparisons between groups in Figure 7 were carried out with unpaired 2-tailed Student's t-test. Pvalues <0.05 were considered significant. S.E.M values were derived from at three independent experiments. For swallowing experiment (Figure 8), statistical analyses were performed using one way analysis of variance (ANOVA) followed by Fisher's protected least-significant difference post-hoc test. Differences were considered significant when P < 0.05. Data were expressed as mean ± SEM. StatView for Windows 5.0.1; SAS Institute was used for statistical analysis.
ODN Immunoreactivity within the Caudal Brainstem is Associated with Glial Cells
ODN immunohistochemistry within the rat brainstem, visualized on horizontal sections, revealed a striking pattern of immunoreactivity within the DVC, which distinguished it from the surrounding brainstem nuclei (Figure 1A). Within the DVC, a distinct subregional distribution of ODN immunoreactivity was observed. Indeed, the AP appeared heavily labeled throughout its rostro-caudal extent while a moderate ODN labeling was observed in the NTS (Figure 1A). Noticeably, the border between the AP and NTS i.e., the funiculus separens appeared also strongly stained (Figures 1A,B). At this level, a bundle of thin ODN-positive processes which radiated rostro-caudally into the NTS parenchyma was observed. Preincubation of the ODN antiserum with synthetic ODN (10 −6 M) resulted in a complete loss of the immunoreaction ( Figure 1C). Hypothalamic sections were used as positive control of ODN immunohistochemistry.
As previously described (Lanfray et al., 2013), ODN staining was mainly observable in tanycytes lining the 3th ventricles and tanycytes located within the median eminence ( Figure 1D).
To investigate the possible glial identity of brainstem ODN positive cells, we next performed ODN and GFAP double labeling. ODN-positive processes extending horizontally at the NTS/AP interface were also GFAP-positive (Figures 2A-D). Within the AP, ODN staining did not co-localize with GFAP since GFAP labeling was virtually absent from this structure. The presence of a sub-population of ODN/GFAP-positive cells exhibiting atypical morphology prompted us to perform vimentin immunolabeling since this intermediary filament protein is known to be expressed by tanycytes-like cells present at the brainstem level (Pecchi et al., 2007;Langlet et al., 2013). In the DVC, vimentin immunoreactivity was mainly observed in the NTS/AP border and on the edge of the 4th ventricle (Figures 2E-J). As expected, immunohistochemistry revealed the presence of ODN/vimentin immunoreactivity at the border between the AP and the NTS (Figures 2E-I).
XZ orthogonal projection of images acquired on horizontal sections confirmed the co-localization of ODN and vimentin in thin processes surrounding the AP (Figure 2J). Within the AP, a part of ODN expressing cells remained vimentin negative, suggesting the existence multiple ODN-positive subpopulations in this structure. The dopamine-and cyclic adenosine-3 ′ :5 ′ -monophosphate (cAMP)-regulated phosphoprotein (DARPP-32) was found to be present in hypothalamic ependymal tanycytes lining the walls and floor of the third ventricle or located within the median eminence (Meister et al., 1988). At the AP level, DARPP-32 partly colocalized with ODN both within the AP and in the thin processes located in the funiculus separens (Figures 2K-N). In addition to ODN positive fibers located in the funiculus separens border area, ODN staining was observed within the NTS. This labeling exhibited a rounded shape and was observed in the vicinity of the f. separens. This ODN staining progressively diminished as one get away from the NTS/AP border (Figures 3A,C). Similarly, the GFAP labeling was heterogeneously distributed within the NTS, with a lesser concentrated staining in the lateral parts of the nucleus (Figures 3B,D). High-magnification images revealed an ODN/GFAP co-localization in cells exhibited typical features of differentiated protoplasmic astrocytes were observed (Figures 3E-G and inset in G).
Electron Microscopy of the NTS/AP Border and ODN Immunoreactivity
We next performed electron microscopy at the NTS/AP border zone of coronal brainstem sections. Serial mapping with electron microscopy at low power magnification provided an overview of this area, and showed that it was organized with numerous glial processes ( Figure 4A). Interestingly, these fibrous processes seemed to shape a continuous layer between the AP and the NTS. It seems likely that these processes observed in electronic microscopy match to the atypical and thin glial processes described above. This level of analysis revealed also that these glial processes originating from tanycyte-like cells located at the NTS/AP interface were rounded with very short ramifications (Figures 4A,D-F). These processes were clearly identified by numerous intracellular cytoskeleton filaments ( Figure 4B and inset), exhibiting a compact organization with a similar orientation ( Figure 4C). In some cases, short ramifications originating from fibrous processes were found in close apposition to neuronal elements such as somata, dendritic profiles, or axon terminals (Figures 4D-F). At the electron microscopic level, ODN immunoreactivity was also found exclusively in glial processes and cells (Figure 5). In addition to tanycyte-like processes located at the NTS/AP interface (Figure 5A), ODN staining was also found associated with protoplasmic astrocytes located in the subpostremal NTS ( Figure 5B). In both cells types, ODN immunoreactivity was cytosolic. ODN-positive protoplasmic astrocytes were sometimes found in the close vicinity of synaptic profiles ( Figure 5C).
Finally, the presence of DBI mRNA in rat DVC was investigated by RT-PCR analysis. A cDNA band of the expected size (95 bp) was detected in the reverse transcribed products from this structure. cDNA from hypothalamus, a structure known for its high ODN expression (Alho et al., 1985;Tonon et al., 1990;Malagon et al., 1993), were used here as a positive control ( Figure 5D).
Fourth Ventricle Endozepine Administration Reduced Food Intake
To determine whether endozepines could modify food intake by acting at the brainstem level, we performed 4th ventricle injection. The DVC which is involved in the initiation of meal as well as in the satiety reflex lines the 4th ventricle in the caudal brainstem. A single administration of ODN or OP (2 µg/animal) resulted in a decrease of food intake consumed during refeeding [ Figure 6A, F (2, 26) = 3.901, P = 0.0218]. This effect presented a short latency, since it was significant in the first hour posttreatment and feeding behavior remained profoundly affected during the first 3 h post-treatment. Cumulative food intake measured over a period of 9 h, revealed that OP affected food intake more deeply and durably than ODN [ Figure 6B, F (2, 26) = 18.006, P < 0.0001].
Cellular Activation Induced by 4th Ventricle OP Administration
We next sought to confirm that 4th ventricle OP injection resulted in cellular activation within the DVC and determine whether this cellular activation spread out of the brainstem. Central structures activated in response to OP (2 µg/animal) administration were identified using the immune detection of the c-Fos protein. Animals were sacrificed 90 min after injection of either NaCl 0.9%. or OP 2 µg/animal. A very low basal level of c-Fos positive nuclei was observed in the brainstem of NaCl-treated rats ( Figure 7A). OP-treated rats exhibited a strong rise in the number of c-Fos positive nuclei within the NTS whatever the rostro-caudal level analyzed (Figure 7B). At the brainstem level, other DVC regions such as the AP and the dorsal motor nucleus of the vagus nerve (DMNX) were devoid of labeling (Figure 7A). At the time point analyzed here i.e., 90 min post-treatment, pontine and hypothalamic structures did not exhibited significant c-Fos expression increase in OP-treated animals as compared to control rats (Figures 7A,B).
ODN Inhibited Swallowing Reflex in Anaesthetized Rats
Given the pattern of OP-induced c-Fos expression observed within the DVC, we next tested the impact of a brief central ODN injection on the swallowing reflex. The present results showed ODN microinjections induced a dose-dependent decrease in the number of swallows recorded during ST stimulation (Figure 8A), with a slight non-significant effect at 50 µM (5 trials, 3 rats; Figure 8B), and a significant effect at 100 µM (10 trials, 5 rats; Figure 8B). The inhibitory effect observed upon 100 µM ODN microinjections appeared with a latency of 4.4 ± 1.4 min and persisted during 41.20 ± 4.96 min. This inhibitory effect of ODN on rhythmic swallowing pattern after its central injection within the SwCPG was not associated with variation of either cardiac frequency or respiratory activity (data not shown).
DISCUSSION
In the central nervous system, endozepines exhibit a wide distribution as reported by several groups (Alho et al., 1989; Tonon et al., 1990;Costa and Guidotti, 1991;Malagon et al., 1993). Indeed, using in situ hybridation or immunochemistry approaches, DBI or its major central processing product ODN was observed in many brain regions, such as olfactory bulb, cerebral, and cerebellar cortex, hippocampus, hypothalamus, inferior colliculus, and periaqueductal gray matter. Noticeably, very few data are available on brainstem DBI expression, with the exception of two in situ hybridization studies mentioning DBI expression within the AP (Alho et al., 1988;Tong et al., 1991). The present study was designed to perform a more comprehensive analysis of ODN expression at the brainstem level with a focus on the DVC. We observed a strong ODN expression in the AP, thus confirming previous observations (Alho et al., 1988;Tong et al., 1991). In addition, we reported a labeling in AP-surrounding regions i.e., the funiculus separens and the subpostremal/commissural NTS. From a functional RT-PCR of DBI mRNA from hypothalamus (Hpt) and dorsal vagal complex (DVC) extracts. Scale bars: 500 nm in A; 1 µm in B and C. Ast, astrocytes; d, dendritic profiles; Ax, axon terminals; G, glial process.
point of view, the AP constitute a circumventricular organ of the brainstem necessary to relay the anorexic effects of circulating compounds such as amylin or leptin (Lutz et al., 2001;Liberini et al., 2016;Smith et al., 2016;Levin and Lutz, 2017). Furthermore, a subpopulation of AP neurons project heavily onto the immediately subjacent NTS i.e., subpostremal and commissural subnuclei (Shapiro and Miselis, 1985). The nervous peripheral input to the NTS through the vagus nerve exhibits a viscerotopographic organization (Loewy, 1990). The subpostremal and commissural NTS receive afferents from the gastrointestinal tract and integrate a wide variety of signals involved in the regulation of appetite and satiety (Shapiro and Miselis, 1985;Loewy, 1990). The brainstem ODN expression, we reported here, was thus associated with regions strongly involved in the integration of signals linked to the gastrointestinal tract and energy homeostasis. We next sought to determine the cellular identity of ODN positive cells within the brainstem. Previous works using in situ hybridization have reported that in numerous brain areas, a specific labeling was associated with non-neuronal cells including ependymal and subependymal cells bordering the 3rd ventricle (Tong et al., 1991). By light microscope immunocytochemistry, ODN staining was also reported in glial and ependymal cells in the olfactory bulb, hypothalamus, hippocampus, periaqueductal gray, cerebral cortex, and the circumventricular organs (Alho et al., 1988;Tonon et al., 1990). These studies performed at the electron microscopic level confirmed the association of immunoreactive material with glial and ependymal cells (Alho et al., 1989). More recently, the identity of the endozepine-expressing cells within the hypothalamus was examined by immunohistochemistry. A strong ODN immunoreactivity was detected in DARPP 32/vimentin-positive thin processes, a labeling characteristic of tanycytes extending from the 3rd ventricle into the hypothalamic parenchyma (Lanfray et al., 2013). The results we obtained, at the brainstem level, showed that ODN and GFAP are coexpressed by protoplasmic astrocytes located in the subpostremal and commissural NTS subnuclei. Astrocytes from other parts of the NTS were devoid of labeling. In addition to ODN-positive astrocytes, ODN co-localized with GFAP in thin processes located within the funiculus separens known to originate from tanycytes-like cells i.e., vagliocytes previously described in this structure (Pecchi et al., 2007;Dallaporta et al., 2009). The cell bodies of these atypical glial cells are located at the border of the 4th ventricle or within the AP (Pecchi et al., 2007;Langlet et al., 2013). Co-staining of ODN with vimentin or DARPP-32 confirmed the ODN expression by DVC vagliocytes. The only partial overlapping between vimentin and DARPP-32 staining observed in the funiculus separens and the AP suggested that different sub-populations of vagliocytes co-exist within the DVC. Interestingly, these cells were reported to express leptin receptor (Dallaporta et al., 2009). Electron microscopy showed a cluster of ovoid fibers forming a continuous layer at the AP and NTS border. These processes were obviously identified by their numerous intracellular cytofilaments showing a similar orientation and a high density. These glial processes could exhibit small and short lateral ramifications. Interestingly, fibrous processes or their ramifications were sometimes found in close apposition to neuronal elements such as dendritic profiles or axon terminals. The localization and the shape of these processes are evocative of the transection of vagliocytes processes and previously visualized by immunohistochemistry. ODN staining observed at the electron microscopic level confirms its expression by vagliocytes and protoplasmic astrocytes. ODN expressing astrocytes were also occasionally found in the immediate vicinity of synapses. In total, these data show that, at the brainstem level, ODN is expressed by multiple glial cell populations mainly located at the AP/NTS interface. The localization of these ODN expressing cells at a neurohemal interface, together with their juxtaposition with neuronal components strongly lead us to put forward the hypothesis that ODN expressing cells could act as sensors of circulating compounds and could in turn release ODN and modify excitability of NTS neurocircuitries. Intracerebroventricular administration of ODN or its Cterminal octapeptide fragment OP in the 3rd ventricle has been shown to exert a potent anorexigenic effect in rodents (de Mateos-Verchere et al., 2001;do Rego et al., 2007). Moreover, Lanfray et al. (2013) reported the inhibition of food intake after a unilateral injection of the ODN agonist OP into the arcuate nucleus, supporting the view that endozepines may control arcuate neurons involved in feeding behavior. The NTS is known as a primary integration site for satiety signals involved in the termination of a meal (Grill and Kaplan, 2002). Direct information about meal size arising from the gastrointestinal tract conveys through the vagus nerve to reach the NTS. Vagal mechanosensors located in the gastrointestinal tract sense the volume of ingested food and locally released satiety hormones, such as cholecystokinin (Schwartz and Moran, 1994;Berthoud et al., 2001). Despite, this major role of NTS in the termination of food intake, functional evidence for a role of endozepines in the brainstem regulation of feeding is missing. The brainstem ODN expression we reported here, led us to evaluate the impact of 4th ventricle endozepine injections on refeeding-induced satiety, a condition known to strongly mobilize the NTS (Timofeeva et al., 2005). We demonstrate here that 4th ventricle ODN or its C-terminal iso-active fragment OP (Leprince et al., 1998) injections strongly reduced food intake. OP was significantly more effective to reduce food intake than ODN at the same 2 µg dose. However, it should be noticed that the OP molar dose was twice that of ODN and partially explains this difference in cumulative food intake. This effect was observable rapidly after ODN or OP injection into the 4th ventricle, suggesting a local endozepine action restricted to the DVC region. This hypothesis was confirmed by c-Fos expression mapping since at a time point where OP reduced food intake, cellular activation was confined to the NTS, whereas more rostral structures and particularly endozepinesensitive hypothalamic nuclei did not exhibit significant cellular activation. Reductions in food intake caused by the administration of exogenous compound must be cautiously interpreted because this could be secondary to aversion and induced sickness behavior. The involvement of the NTS and AP in the development of conditioned aversions and gastrointestinal malaise was clearly established. The activation of NTS and AP neurons was reported in response to a variety of aversive inputs and stressful stimuli (Yamamoto et al., 1992;Swank, 1999;Spencer et al., 2012. Interestingly, we did not observe any significant difference between elicited c-Fos immunoreactivity in saline-and OP-treated mice in the AP. Moreover, Grill and Norgren (1978) reported that decerebrates rats, in contrast to controls, neither rejected nor decreased ingestive reactions to a novel taste after that taste had been repeatedly paired with lithium chloride-induced illness supporting the idea that the forebrain may be important for taste aversion learning. Here, we did not observed c-Fos expression in forebrain structures after OP administration. Altogether, these data lessened the possible presence of an OP-induced sickness behavior. Nonetheless, this point should be experimentally addressed in the future.
Cerebroventricular OP injection resulted in a significant increase in c-Fos expression within the interstitial solitary tract nucleus subnucleus. This subnucleus is known to be involved in the control of respiratory, cardiac and swallowing autonomic functions. Swallowing, the first motor component of ingestive behavior, allows the propulsion of the alimentary bolus from the mouth to the stomach. Swallowing is triggered by sensory afferent fibers conveyed by the superior laryngeal nerve that project through the solitary tract to the DVC and premotoneurons located within the interstitial and intermediate NTS constitute the SwCPG (Jean, 2001). Anorexigenic and orexigenic factors have been shown to modulate the swallowing reflex. For instance, we have previously shown that different anorexigenic factors, such as leptin (Félix et al., 2006), the growth factor BDNF (Bariohay et al., 2008), and the mycotoxin deoxynivalenol (Abysique et al., 2015) inhibit the swallowing reflex. Concurrently, the orexigenic cannabinoids are reported to induce a facilitation of the swallowing reflex (Mostafeezur et al., 2012). This led us to conceive a possible modulation of the swallowing reflex by endozepines. The present study constitutes the first demonstration that endozepines could inhibit the swallowing reflex. We studied the effect of ODN microinjections within the SwCPG and we reported a transient but significant inhibition of rhythmic swallowing. Extracellular ODN microinjection used here may concern both passing axons and NTS neurons surrounding the injection site. ODN could indeed reach multiple neural components but the observed inhibitory effect appeared to be specific since (i) swallowing inhibition was never observed with NaCl alone and (ii) in our experimental protocol, other autonomic functions regulated at the brainstem level such as cardiac and respiratory functions remained unaffected. Hence, in the light of the present data, endozepines join the group of anorexigenic substances that both decrease food intake and inhibit swallowing.
In summary, the present work provides the first demonstration that endozepines are expressed by glial cells within the DVC. In this structure, ODN was found associated to protoplasmic astrocytes and tanycytes-like cells, located in regions known to integrate signals linked to the gastrointestinal tract and energy homeostasis. Moreover, the demonstration that endozepines affect food intake and swallowing reflex together with the close relationship of ODN expressing cells with neuronal elements strongly suggest that endogenous endozepines could act as local modulators of food intake behavior. The downstream ODN targets supporting the brainstem action of this peptide should be investigated in the future, with a particular attention to the melanocortin pathway (Lanfray et al., 2013).
AUTHOR CONTRIBUTIONS
FG, CG, AA, SG, RB, JV, and MD performed, analyzed and interpreted data for the work. JL provided ODN and OP peptide, MT provided ODN antibody. MT, JL, MD, AJ, JT, and BL designed the work. JL, MT, BL, and JT wrote the paper. All authors revised the final version and approved it to be published. | v3-fos-license |
2019-12-17T16:05:04.864Z | 2019-12-01T00:00:00.000 | 209381017 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.nature.com/articles/s41598-019-55892-3.pdf",
"pdf_hash": "65e0fd62e65dc6952f7048fc330143a0d6078878",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:118998",
"s2fieldsofstudy": [
"Biology"
],
"sha1": "65e0fd62e65dc6952f7048fc330143a0d6078878",
"year": 2019
} | pes2o/s2orc | Real-time PCR for direct aptamer quantification on functionalized graphene surfaces
In this study, we develop a real-time PCR strategy to directly detect and quantify DNA aptamers on functionalized graphene surfaces using a Staphylococcus aureus aptamer (SA20) as demonstration case. We show that real-time PCR allowed aptamer quantification in the range of 0.05 fg to 2.5 ng. Using this quantitative technique, it was possible to determine that graphene functionalization with amino modified SA20 (preceded by a graphene surface modification with thionine) was much more efficient than the process using SA20 with a pyrene modification. We also demonstrated that the functionalization methods investigated were selective to graphene as compared to bare silicon dioxide surfaces. The precise quantification of aptamers immobilized on graphene surface was performed for the first time by molecular biology techniques, introducing a novel methodology of wide application.
evaluation of such incorporations demands high resolution scanning, which is time-consuming and limited to small areas. Additionally, CVD graphene usually contains intrinsic defects and chemical impurities, which may lead to tip artifacts and misinterpretations in AFM topography imaging [24][25][26] .
In particular, biomolecules association with graphene are generally assigned by charge transfer between these compounds. In this sense, Raman spectroscopy is a technique sensitive to doping and, in principle, it could be explored do quantify the incorporation of aptamers on graphene. Charge transfer between graphene and molecular adsorbates are monitored by shifts and/or broadening/narrowing of the G and 2D bands of graphene 27 . To use this tool for quantitative analysis of aptamer incorporation, for example, the quantity of aptamers attached on the graphene surface must be previously known in order to correlate any changes in the G and 2D bands of graphene with this quantity. Nowadays, this calibration method is lacking.
So far, the real effectiveness of the surface functionalization with aptamers can only be determined by the final biosensor response to the target biomolecules 16 . Therefore, the lack of prior quantitative knowledge about the surface coverage by aptamer makes difficult a more precise study, encompassing a correlation between the biosensor device final performance and the surface functionalization quality. This difficulty impairs and delays the optimization of functionalization procedures and protocols.
Real-time quantitative Polymerase Chain Reaction (qPCR) is a well-known technique applied for DNA detection and quantification 28 . A considerable number of biosensors are based on DNA aptamers, so it is possible, in principle, to use qPCR to detect these molecules on the functionalized surfaces. qPCR is a widespread tool able to amplify DNA and, consequently, it can detect very small amounts of this biomolecule. With this technique, it is possible to work with very small amounts of starting material and analyze a very limited amount of raw sample. By using a standard curve, it is possible to calculate the initial quantity of the target DNA with high sensitivity and precision taking into account the exponential amplification phase of the reaction. Due to its sensitivity, reliability and simplicity qPCR has become the most widely used technique for quantifying DNA 29 . Despite all its potential for DNA detection, this assay has not been used, as far as we know, to detect and quantify the immobilization of DNA based aptamers in nanomaterials, especially graphene. In this sense, these techniques have a great potential to be explored in the analysis of aptamer-functionalized nanomaterials.
In this work was developed a qPCR strategy to detect and quantify aptamers in functionalized graphene surfaces. Using this novel quantitative methodology was possible to compare directly the efficiency of different kinds of functionalization in graphene with unprecedented simplicity and accuracy. With the increasing interest in DNA aptamers-based biosensors this work provides a novel and efficient tool for the development of these nanobiodevices.
Methods
Graphene and silicon dioxide samples. The graphene substrates used in this work consist of CVD graphene on top of a 285-300 nm-thick SiO 2 layer, grown by dry oxidation on a highly-doped p-type silicon substrate (Si/SiO 2 ). The graphene substrates were purchased from either Graphenea Inc. or Grolltex Inc. The pristine Si/SiO 2 substrates were purchased from Waferpro LLC. The actual 2.5 × 2.5 mm, for graphene samples and 1.5 × 1.5 mm for silicon dioxide samples used in the work were diced from the substrates.
Aptamers and primers. The S. aureus binding aptamer SA20 30 was modified in the 5′ end with a 3C spacer followed by a pyrene cap phosphoramidite (SA20-pyrene) and in the 5′ end with a 6C spacer followed by an amine moiety (SA20-amino). The SA20 aptamer sequence is: Primers for qPCR were designed using the Primer 3 software (http://frodo.wi.mit.edu/) The primer sequences were: Lastly, the samples were dried with N 2 gas before performing PCR assays. The reason to keep the samples in 1.0 mM PBS overnight was to allow sufficient time for desorption of excess molecules that did not bind to the exposed surfaces.
Graphene and pristine silicon dioxide samples functionalization with SA20-amino was performed by at first binding thionine into the graphene samples surfaces. Thionine has already been used to bind biomolecules to carbon nanotubes 31 .
The thionine functionalization step was performed by 15 minutes incubation with a drop of 1.0 mM thionine chloride (Santa Cruz Biotechnology) solution followed by washing with 1.0 mM PBS for 10 minutes and overnight incubation in a wet atmosphere with a drop of a solution of 1.0 μM SA20-amino aptamer dispersed in 1.0 mM PBS, pH7.4. As in the pyrene-based method, the samples were washed with 1.0 mM PBS for 15 minutes and kept immersed in 1.0 mM PBS overnight. The last step was to blow dry the samples with N 2 before performing PCR assays.
www.nature.com/scientificreports www.nature.com/scientificreports/ The materials functionalization with the SA20 and SA20-amino aptamers performed without previous surface modifications were carried exactly as described above after the surface modification steps. conventional pcR reactions. Conventional PCR reactions were carried out in a Veriti Thermal Cycler (Applied Biosystems, Foster City, CA) in order to assess primers performance before qPCR. The assays were performed in 60 µl reaction, which contained 15 U of Taq DNA polymerase (Ludwig Biotec, Alvorada, RS) in the presence of 10X buffer (6 µl), 2.5 mM of MgCl 2 and 1.0 µM of each primer (SA forward and reverse). The functionalized graphene samples were placed directly in PCR tubes.
The cycling conditions were performed as follows: after an initial denaturation step of 2 min at 94 °C, 25 cycles were performed for 45 s at 94 °C, 30 s at 60 °C, and 1 min at 72 °C. A final extension step for 10 min at 72 °C was used.
At the end of PCR cycles, the aptamers presence was checked on a standard 2% agarose gel stained with ethidium bromide. A total of 8 functionalized graphene samples were tested by conventional PCR (4 functionalized with SA20-pyrene and 4 with thionine and SA20-amino). The negative template (NTC, without DNA) and positive (with 10 ng of SA20 aptamer) controls were performed.
Real-Time quantitative PCR (qPCR). Reactions were carried out in a
Step One Real-Time PCR System (Applied Biosystems, Foster City, CA) using the Power Up SYBR Green Master Mix (Applied Biosystems, Foster City, CA). The assays were performed in 20 µl final volume of reaction containing 10 µl of the Master Mix and 250 nM of each primer (SA20 forward and reverse). Graphene and silicon dioxide samples were placed directly on the PCR plate wells. After an initial enzyme UDG activation at 50 °C for 2 min and an enzyme dual-lock DNA polymerase activation at 95 °C for 2 min, 40 amplification cycles were performed using 95 °C for 15 s for denaturation and 60 °C for 1 min for annealing, extension, and fluorescence acquisition.
A standard curve with SA20 aptamer was performed using concentrations ranging from 0.00005 fg to 5.0 ng with a dilution factor of 1:10. In all assays, we used a positive control with 0.5 ng of the SA20 aptamer to evaluate the reaction reliability. In all of these experiments a non-functionalized graphene or silicon dioxide slice was included on all the wells of the standard curve and positive controls in order to circumvent and take into account any possible graphene or silicon dioxide interference in the essays, such as in the fluorescence acquisition. This is important to guarantee the experiments reproducibility and reliability. A negative template control (NTC), which contain all the reaction components but does not have any DNA (template), was also included in all q PCR assays. All samples, standards and controls were processed in triplicate For each qPCR assay, a total of 12 functionalized graphene or functionalized pristine silicon dioxide samples were tested. These devices were divided into 3 groups containing four samples each that were functionalized at different occasions.
In order to obtain the number of aptamers per square centimeter, PCR results obtained in nanograms were converted to grams and this value was divided by molecular weight of the corresponding aptamer divided by Avogadro constant. After that the results (number of aptamers) were divided by the sample area in cm −2 . The actual area covered by graphene in the graphene samples was measured by optical microscopy using as a guideline the contrast difference between graphene covered x uncovered sample surface. We used only graphene samples with more than 75% of covered area. Statistical analysis. Data normality was tested using the D' Agostino-Pearson omnibus test. Statistical analysis were performed using the One way ANOVA with Bonferroni´s multiple comparison test for the comparison of the SA20-pyrene and SA20-amino linked on graphene and silicon surfaces. Student's t-test was used for all other analyses by means of the software package GraphPad Prism 5.0 (Graph-Pad Software, San Diego, CA, USA).
Results and Discussion
The SA-20 aptamer immobilization on graphene was achieved in this work by non-covalent functionalization, in order to better preserve the inherent properties of pristine graphene. For comparison purposes, and in order to look for the best strategy of aptamer incorporation, two different methods of functionalization were used to attach the aptamers to graphene. In the direct functionalization approach, pyrenil moieties (pyrene cap phosphoramidite) were previously introduced at the 5´end of the aptamers (SA20-pyrene). The SA20 aptamer modified with this pyrene functional group, has an affinity to the graphene π orbitals and can be directly attached onto the graphene surface via π-stacking 32 .
In the indirect approach, amine moieties are introduced at the 5´end of the SA-20 aptamer. This amino-functionalized aptamer (SA20-amino) can now bind to surfaces having chemical affinity to the amine functional groups. To allow the SA20-amine aptamers binding to the graphene, a previous functionalization step promoting thionine molecules incorporation into the graphene surface was included. The thionine molecules then act as an intermediate binding layer between the SA20-amino and the graphene surface.
Thionine has a planar aromatic structure that allows strong interaction with the surface of graphene sheets through synergistic non-covalent charge-transfer and π-stacking 33 , leaving a large amount of hydrophilic amino groups (NH 2 ) available for interaction with other molecules. In a recent work 34 , we have demonstrated that, contrary to what was previously believed, thionine molecules do not lie flat on the graphene but are vertically attached to the surface. In this same work, we also demonstrated that the thionine bounded onto the graphene surface undergoes a structural transition, driven by the amount of surface coverage, were a preferential alignment of domains along graphene crystallographic directions takes place. qPCR was developed in early 1990s for nucleic acids detection and quantification; it is widely used in almost all fields of biomedical research, agriculture, food and environment sciences 28,35-37 .
In our approach, in order to monitor DNA amplification during qPCR assays, the SYBR Green dye was employed. This dye is a fluorescent nucleic acid stain that binds double-stranded DNA molecules by intercalating between the DNA bases. The reason for choosing this dye for quantitative PCR is because the fluorescence can be measured at the end of each amplification cycle to determine, relatively or absolutely, how much DNA was amplified.
PCR assays yielded a single product of 56 bp (the expected amplification size by using the primer set), as it can be observed in the lanes of positive control and of SA20-pyrene functionalized graphene. Negative template control did not presented any amplification (Fig. 1a). The qPCR standard curves were optimized using several SA20 aptamer dilutions, and the optimized reaction conditions were obtained using from 0.00005 to 0.5 ng of aptamer (Fig. 1b). These standard curves were generated by plotting the SA20 aptamer quantity log versus the corresponding Ct (cycle threshold) value. The Ct corresponds to the PCR cycle in which a particular sample emits enough fluorescence to reach the threshold above the background fluorescence. The linear regression determination coefficient (R 2 ) was 0.999 in all performed assays as represented on Fig. 1c, indicating linear responses in the SA20 aptamer detection.
The minimum and maximum qPCR limits of detection were determined considering the linear part of the curve of serially diluted SA20 aptamer. Quantities ranging from 0.05 fg to 2.5 ng of SA20 could be detect by qPCR, independent of 5´end modification. The same range of detection was also obtained for qPCR using pristine Si/ SiO 2 samples, instead of graphene samples. These findings highlight the qPCR sensibility and flexibility for detection of a wide range of aptamer quantities. Moreover, these limits of detection are in accordance with the expected number of aptamer molecules to be found on the functionalized graphene or silicon surface.
After qPCR standardization, this methodology was used to quantify the number of SA20-pyrene and SA20-amino molecules that were retained on graphene surface after the functionalization protocols. All of qPCR data showed R 2 of 0.999. Twelve graphene samples were functionalized with thionine and SA20-amino (indirect functionalization), and other twelve directly with SA20-pyrene (direct functionalization). In Table 1 was present the obtained results. The mean value of SA20-pyrene molecules surface coverage was 277 × 10 8 cm −2 , whereas for the SA20-amino this mean value was 2385 × 10 8 cm −2 , indicating one order of magnitude higher surface coverage. In addition, Table 1 also shows that the number of molecules per square centimeter detected in all samples for the same functionalization type was similar, which is characterized by a low standard deviation, showing the functionalization process reproducibility. According to these results, the functionalization with SA20-amino, using thionine as an intermediate molecule, was considerably more efficient than the SA20-pyrene functionalization of the graphene surface.
Although this results demonstrate that qPCR is an effective method for quantitative detection of functionalization it is still important to further demonstrate that it can be applied to readily identify the specificity and effectiveness of functionalization protocols.
The issue to be investigated is if the SA20 really attach preferably onto the graphene surface, which is responsible for the sensing activity, rather on the silicon dioxide. To address this central question, additional experiments were performed using pristine Si/SiO 2 as substrates for functionalization with both SA20-amino and SA20-pyrene aptamers. Our goal is to directly access and compare the affinity of these aptamers for graphene and for silicon dioxide.
In Table 1 was shown that the SA20-amino aptamer has a mean surface coverage area of 12 × 10 8 cm −2 whereas the SA20-pyrene aptamer shows a mean coverage of 4 × 10 8 cm −2 on silicon dioxide surface. This result confirms that the aptamers affinity was appreciably greater for graphene than for silicon dioxide. The SA20-amino (in www.nature.com/scientificreports www.nature.com/scientificreports/ association with thionine) and SA20-pyrene bond to graphene via π-π stacking. The absence of this mechanism may be a plausible reason for the low affinity of these aptamers with the silicon dioxide, in comparison with graphene. Table 1. Number of SA20-amino and SA20-pyrene aptamer molecules per square centimeter retained on graphene and silicon dioxide surface in three independent experiments. For the functionalization with SA20amino, the material surfaces were previous treated with thionine. *Mean and standard deviation of the three experiments.
Figure 2.
Quantification of SA20-amino and SA20-pyrene retained on graphene and silicon dioxide surface after functionalization. Graphene and Silicon dioxide samples were functionalized with thionine and SA20amino or with SA20-pyrene and subjected to absolute quantification by qPCR. Data represent the mean ± SEM of three independent experiments, using 4 samples in each one. ***P < 0.0001. The F value for this one way ANOVA test was 248.5.
The SA20-amino, in association with graphene thionine functionalization, and SA20-pyrene bond to graphene via π-stacking could be, for the first time, directly and quantitatively compared and proved to be efficient surface modification strategies. In Fig. 2, all the results were summarized.
Although it was clear that SA20-pyrene and SA20-amino conjugated to thionine have much higher affinity to graphene than to silicon dioxide, a significant number of molecules were retained on silicon dioxide surface. In order to further explore our methodology, and also evaluate the aptamers binding without any functional group modification to either SiO 2 or graphene surfaces, a set of experiments employing unmodified aptamers were conducted.
The mean value of SA20 aptamers surface coverage on the silicon dioxide surface was 59 × 10 8 cm −2 , whereas on graphene surface this number was 57 × 10 8 cm −2 ( Table 2). There is no statistical difference between the number of molecules in graphene or in silicon dioxide surfaces when they are functionalized with aptamers without any modification.
Since amine is a very polar group, we could imagine that amine modified aptamers could have also a large affinity to bare graphene surfaces, what was not the case. To stress the fundamental role played by surface functionalization, SA20-amino was also used to functionalize graphene samples without previous functionalization with thionine.
In Table 2 it can be observed that the mean value of SA20-amino molecules at the silicon dioxide surface was 12 × 10 8 cm −2 , whereas on the bare graphene surface this mean number was 13 × 10 8 cm −2 . There was also no statistical difference between the number of molecules recovered from graphene and silicon dioxide when they were exposed with SA20-amino without previous thionine treatment of the surfaces.
Many of the graphene-based biosensors are produced in the FET (field effect transistor) configuration. In this architecture, graphene is on top of a silicon dioxide substrate, which acts as a dielectric layer between graphene and the highly-doped silicon. However, regarding graphene-based biosensors it is desirable that aptamers attach preferably on the surface of graphene, which is responsible for the sensing activity, rather on the silicon dioxide. It is clearly demonstrated by the results presented in this work that this is indeed the case if proper and matched aptamer and surface modifications are introduced.
In summary, we have developed and applied a systematic method for the analysis of aptamer-functionalized graphene and silicon dioxide samples using qPCR. In an unprecedented way, direct aptamer quantification of a functionalized 2D material was demonstrated, using an easy, robust, reproducible and direct methodology. By this new method, it was possible to compare different functionalization strategies, in two different materials, demonstrating that the combined use of thionine and SA20-amino presented better results over SA20-pyrene.
In addition, it was demonstrated directly and quantitatively, by comparison of results for bare SiO 2 /Si substrates and SiO 2 /Si substrates with graphene, that pyrene-moieties have specific affinity to graphene, because of the stable π-stacking across the basal plane.
This novel tool has wide potential to be applied to any materials as long as the target functionalization is a DNA-based molecule. This technique can be readily and independently used to evaluate the efficiency of different functionalization strategies and to compare different methods and materials. More importantly, this approach is also a powerful tool to be applied in the biosensor production quality control. Table 2. Number of SA20 without any modification and SA20-amino aptamer molecules per square centimeter retained on graphene and silicon dioxide surface in three independent experiments. In these experiments for the functionalization with SA20-amino, the material surfaces were not previous treated with thionine. *Mean and standard deviation of the three experiments. | v3-fos-license |
2017-06-20T20:33:52.733Z | 2013-07-11T00:00:00.000 | 14225408 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://bmccancer.biomedcentral.com/track/pdf/10.1186/1471-2407-13-342",
"pdf_hash": "2a378dcf9ff17ad197808a9fb6d8160ea6c7ea55",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119105",
"s2fieldsofstudy": [
"Chemistry",
"Medicine"
],
"sha1": "fdf2d83e12a877a2cd8710ffc1494d0b2188894c",
"year": 2013
} | pes2o/s2orc | Disruption of focal adhesion kinase and p53 interaction with small molecule compound R2 reactivated p53 and blocked tumor growth
Background Focal Adhesion Kinase (FAK) is a 125 kDa non-receptor kinase that plays a major role in cancer cell survival and metastasis. Methods We performed computer modeling of the p53 peptide containing the site of interaction with FAK, predicted the peptide structure and docked it into the three-dimensional structure of the N-terminal domain of FAK involved in the complex with p53. We screened small molecule compounds that targeted the site of the FAK-p53 interaction and identified compounds (called Roslins, or R compounds) docked in silico to this site. Results By different assays in isogenic HCT116p53+/+ and HCT116 p53-/- cells we identified a small molecule compound called Roslin 2 (R2) that bound FAK, disrupted the binding of FAK and p53 and decreased cancer cell viability and clonogenicity in a p53-dependent manner. In addition, dual-luciferase assays demonstrated that the R2 compound increased p53 transcriptional activity that was inhibited by FAK using p21, Mdm-2, and Bax-promoter targets. R2 also caused increased expression of p53 targets: p21, Mdm-2 and Bax proteins. Furthermore, R2 significantly decreased tumor growth, disrupted the complex of FAK and p53, and up-regulated p21 in HCT116 p53+/+ but not in HCT116 p53-/- xenografts in vivo. In addition, R2 sensitized HCT116p53+/+ cells to doxorubicin and 5-fluorouracil. Conclusions Thus, disruption of the FAK and p53 interaction with a novel small molecule reactivated p53 in cancer cells in vitro and in vivo and can be effectively used for development of FAK-p53 targeted cancer therapy approaches.
Background
Focal Adhesion Kinase (FAK) is a non-receptor tyrosine kinase that controls cellular processes such as proliferation, adhesion, spreading, motility, and survival [1][2][3][4][5][6]. FAK is over-expressed in many types of tumors [7][8][9][10]. We have shown that FAK up-regulation occurs in the early stages of tumorigenesis [11]. Real-time PCR analysis of colorectal carcinoma and liver metastases demonstrated increased FAK mRNA and protein levels in tumor and metastatic tissues versus normal tissues [10]. Cloning and characterization of the FAK promoter demonstrated different transcription factor binding sites, including p53 that repressed FAK transcription [12,13]. In addition, analysis of 600 breast cancer tumors demonstrated a high positive correlation between FAK overexpression and p53 mutations [14,15]. Recently, p53-dependent repression of FAK has been demonstrated in response to estradiol in breast cancer cells [16]. Thus, FAK and p53 signaling pathways are crosslinked in cancer [12,17].
Recently we have demonstrated a direct interaction of the p53 protein with the N-terminal domain of FAK [18]. We performed mapping analysis and have shown that the N-terminal domain of FAK binds the N-terminal domain of p53 (from 1 to 92 a.a) [18]. The binding of FAK and p53 has been demonstrated in different cancer cell lines: cells as well as normal human fibroblasts [18]. In addition, we have shown that overexpressed FAK inhibited p53-induced apoptosis in SAOS-2 cells and decreased p53-mediated activation of p21, BAX, and MDM-2 targets in HCT116 p53 + / + cells [18] The interaction of FAK and p53 has been confirmed by another group, who demonstrated that FAK interacted with p53 to down-regulate its signaling [19]. These observations are consistent with FAK's role in sequestering proapoptotic proteins to enhance survival signaling [15]. We next identified the 7 amino-acid binding site in the proline-rich region of p53 protein (aminoacids 65-72) that is involved in interaction with FAK [20]. In addition, the p53 peptide containing this binding site was able to disrupt the binding of FAK and p53, to activate p53 and to inhibit viability of HCT116p53 + / + cells compared to HCT116p53 -/cells, suggesting that FAK-p53 targeting can be used for therapeutics [20]. A recent review provided a model of the FAK and p53 interaction, where the FERM N-terminal domain of FAK mediated signaling between the cell membrane and the nucleus [21].
Reactivation of p53 is critical for development of p53targeted therapeutics [22]. It is estimated that approximately 50% of human cancers express wild type p53, and p53 is inactivated in these tumors by different mechanisms [22,23]. There were several reports on reactivation of p53 with different compounds that disrupted the Mdm-2 and p53 complex [24][25][26][27][28][29]. In fact, most studies that report reactivation of p53 have focused only on the p53-MDM-2 interaction. However, FAK binds to both p53 and MDM-2 and is a key component of this complex [15]. As FAK sequesters p53, it inactivates p53 repression of its promoter, resulting in more FAK in the tumor cell [15]. Thus, one of the novel mechanisms inactivating p53 function is overexpression of FAK in tumors [18,30]. These observations from the rationale for disrupting this interaction and reactivating p53 tumor suppressor functions.
In this report, we sought to identify small molecule drug-like compounds that disrupted FAK and p53 binding and caused p53-dependent cytotoxicity and tumor cells. We performed a three-dimensional computer modeling of the p53 peptide structure involved in interaction with FAK [20] and docked this p53 peptide into the three-dimensional crystal structure of FAK-NT, reported in [31]. We generated a model of the FAK and p53 interaction and performed screening of >200,000 small molecule compounds from the National Cancer Institute database, which were docked into the region of the FAK and p53 interaction. We called these compounds Roslins (from Roswell Park Cancer Institute) and identified a lead small molecule compound R2: 1-benzyl-15,3,5,7-tetraazatricyclo[3.3.1.1~3,7~] decane, that bound to the FAK-N-terminal domain and disrupted the FAK and p53 complex. The R2 compound decreased viability and clonogenicity of HCT116 cells in a p53-dependent manner, and reactivated FAK-inhibited transcriptional activity of p53 with p21, Mdm-2 and Bax transcriptional targets. The combination of R2 and either doxorubicin, or 5-fluorouracil further decreased cancer cell viability more efficiently than each inhibitor alone in HCT116 cells in a p53-dependent manner and reactivated p53-targets. Thus, targeting the FAK and p53 interaction with small molecule inhibitor R2 can be a novel therapeutic approach to reactivate p53 and decrease cancer cell viability, clonogenicity and tumor growth.
Cell lines and culture
The HCT116p53 -/and HCT116p53 + / + colon cancer cells were obtained from Dr. Bert Vogelstein (Johns Hopkins University) and maintained in McCoy's5A medium with 10% FBS and 1 μg/ml penicillin/streptomycin. The HCT116 cell lines were authenticated by Western blotting with p53 antibody and passaged less than 6 month after resuscitation of frozen aliquots. MCF-7, PANC-1, and SW620 cells were obtained from ATCC and cultured according to the manufacturer's protocol. The cell lines were passaged less than 6 month after resuscitation of frozen aliquots.
Peptide docking
We used a structure-based approach combining docking of FAK and p53 peptide interaction and molecular docking of small molecule compounds with functional testing, as described [33]. Initially, we predicted the three dimensional structure of the p53 region involved in interaction with FAK in the N-terminal domain of p53 by the PHYRE (Protein Homology/analog Y Recognition Engine) server (http://www.sbg.bio.ic.ac.uk/phyre) [34]. PHYRE is an efficient protein structure prediction method by sequence homology to existing structures [34]. While the portion of the p53 region described [35] was successfully modeled by the PHYRE server, the region, which involved in interaction with FAK-NT [20] was predicted as disordered. We therefore isolated the disordered seven-amino-acid peptide (RMPEAAP) known to be involved in interaction with FAK [20] from the model, assigned residue charges and add hydrogen atoms with the UCSF CHIMERA program and performed flexible docking to the FAK-FERM domain by DOCK 6.0 software to find the highest scoring complex of FAK and p53 peptide. The crystal structure of FAK, N-terminal FERM domain (PDB ID:2AL6), reported [31] was used for docking and computer modeling of the FAK and p53 peptide interaction. To model the FAK-NT-p53 peptide interaction, the DOCK 6.0 software analyzed >10,000 possible orientations of this interaction, based on the scores of the resulting interfaces using electrostatics (ES) and van der Waals (vWS) energies. The model with the highest scoring of FAK-NT and p53 peptide interaction has been generated and compared with the FAK lobes amino acids reported recently to interact with FAK [19], and FAK-NT region [20]. All binding poses were evaluated using the DOCK grid-based scoring, involving the non-bonded terms of the AMBER molecular mechanics force field (vDW+ES).
Molecular docking of small molecule compounds
More than 200,000 small-molecule compounds from National Cancer Institute Development Therapeutics Program NCIDTP library (http://dtp.nci.nih.gov) [36] and compounds from ZINC UCSF (University of California, San Franscisco) database (http://zinc.docking.org/ catalogs/ncip (version 12) [37] following the Lipinski rules were docked into the pocket of the N-terminal domain of FAK and p53 interaction in 100 different orientations using the DOCK5.1 program. The spheres describing the target pocket of FAK-p53 were created using the DOCK 5.1 suite program SPHGEN. Docking calculations were performed on the University of Florida High Performance Computing supercomputing cluster (http://hpc.ufl.edu). Scores were based on a grid spaced five angstroms from the spheres selected for molecular docking. Each compound was docked in 100 orientations, and grid-based energy scores were generated for the highest scoring orientations. Scores approximate delta G values based on the sum of polar electrostatic interactions and van der Waals energies. Small molecule partial atomic charges were calculated using the SYBDB program, as described [38,39].
Small molecule compounds
The top compounds that were detected by the DOCK5.1 program to best fit into FAK-p53 pocket were ordered from the NCI/DTP database free of charge. Each of the compounds (called Roslin compounds) was solubilized in water or DMSO at a concentration of 25 mM. The R2 compound was chemically synthesized for biochemical analyses in vitro and for mice studies in vivo.
Clonogenicity assay
The 1000 cells were plated on 6 well plates and incubated with or without tested compound for 1-2 weeks. Then cells were fixed in 25% methanol and stained with Crystal Violet, and colonies were visualized and counted.
Cell viability assay
The cells (1×10 4 cells per well) were plated on a 96 well plate and after 24 hours treated with compounds at different concentrations for 24 hours. The 3-(4,5dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4sulfophenyl)-2H-tetrazolium compound from Promega Viability kit (Madison, IL) was added, and the cells were incubated at 37C for 1-2 hours. The optical density at 490 nm on 96-plate was analyzed with a microplate reader to determine cell viability.
Western blotting, immunoprecipitation and immunostaining
Western blotting, immunoprecipitation, immunostaining and immunohistochemical staining using were performed, as described [40].
Pull-down assay
For the pull-down assay we used recombinant baculoviral FAK, GST and GST-p53 proteins, as described [18] and performed pull-down assay, as described [20].
Octet RED binding
The binding was performed by ForteBio Inc. company (www.fortebio.com). The human FAK-N-terminal domain protein was biotinylated using NHS-PEO4-biotin (Pierce). Superstreptavidin (SSA) biosensors (FortéBio Inc., Menlo Park, CA) were coated in a solution containing 1 μM of biotinylated protein. A duplicate set of sensors was incubated in an assay buffer (1× kinetics buffer of ForteBio Inc.) with 5% DMSO without protein for use as a background binding control. Both sets of sensors were blocked with a solution of 10 mg/ml Biocytin for 5 minutes at 25°C. A negative control of 5% DMSO was used. The binding of samples (500 μM) to coated and uncoated reference sensors was measured over 120 seconds. Data analysis on the FortéBio Octet RED instrument was performed using a double reference subtraction (sample and sensor references) in the FortéBio data analysis software.
For detection of FAK and p53 protein dissociation by R2 compound, p53 protein was biotinylated and bound to the streptavidin biosensor at 25 μg/ml. Then 500 nM FAK-NT was used for association and dissociation step in a 1× kinetics buffer, either without R2 or with R2 at 111, 333 or 1000 μM. The association and dissociation plot and kinetic constants were obtained with FortéBio data analysis software.
Dual luciferase assay
The dual-luciferase was performed, as described (18). In brief, 2×10 5 cells were plated on 6-well plates, and cotransfected with the p21, Mdm-2 or Bax promoters in the pGL2 or pGL3-luciferase containing plasmids (1 μg/ well) and pPRL-TK plasmid containing the herpes simplex virus thymidine kinase promoter encoding Renilla luciferase (0.1 μg/well) using Lipofectamine (Invitrogen) transfection agent according to the manufacture's protocol. HCT116 p53 -/cells were cotransfected with the above plasmids and p53 in the presence or absence of FAK plasmids and tested either without or with 25 microM R2 compound for 24 h.
FACS analysis
Flow cytometry analysis was performed by the standard protocol at Roswell Park Flow Cytometry Core Facility. The percentage of G1, G2, S phase-arrested and/or apoptotic cells was calculated.
Tumor growth in nude mice in vivo
Female nude mice, 6 weeks old, were obtained from Harlan Laboratory. The mice experiments were performed in compliance with IACUC protocol approved by the Roswell Park Cancer Institute Animal Care Committee. HCT116 p53 + / + and p53 -/cells (3.7×10 6 cells/injection) were injected subcutaneously into the right and left leg side of the same mice, respectively. Three days after injection, the R2 compound was introduced by IP injection at 60 mg/kg dose daily 5 days/week. Tumor diameters were measured with calipers and tumor volume was calculated using this formula = (width) 2 ×Length/2).
A B D C Figure 1 The computer modeling and docking of p53 peptide involved in interaction with FAK and small molecules targeting FAK-p53 interaction. A. The secondary structure of p53 peptide (43-73 aa) predicted with PHYRE (Protein Homology/analogy recognition engine), as described [34]. The 7 amino-acid p53 peptide (65-72 amino acids of p53) found to be involved in interaction with FAK [20] is shown by grey color. B. The docking of the 7 amino acid p53 peptide involved in interaction with FAK inside the crystal structure of FAK-NT (N-terminal domain of FAK). The amino acids of FAK-NT interacting with the 7 amino acid p53 peptide are shown in white color. C. Zoomed image of FAK-NT interaction with the 7 amino acid p53 peptide. The amino-acids of FAK interacting with p53 peptide: R86, V95, W97, R125, I126, R127, L129, F147, Q150, D154, E256, F258, K259, P332, I336 and N339. D. Small molecules targeting FAK-p53 interaction. Screening of NCI small molecule database with DOCK5.1 program identified small molecules (called R compounds) docked into the region of FAK and p53 interaction. The purple color marks small molecule spheres. Peptide is shown by blue color and FAK-NT by green color.
Statistical analyses
Student's t test was performed to determine significance. The difference between treated and untreated samples with P<0.05 was considered significant.
Results
Computer modeling revealed compounds targeting the FAK-p53 interaction We detected the 7 amino-acid region in p53 involved in the interaction with FAK [20], and because the crystal structure of this N-terminal region of p53 remained unsolved, we performed computer modeling with a PHYRE program (Protein Homology/analog Y Recognition Engine) that allowed us to predict its three-dimensional structure, based on protein homology and an analogy recognition engine [18]. The region containing 43 to73 amino acids of the N-terminal proline-rich domain of p53 had an alpha-helical conformation and contained the 7 amino-acid peptide involved in the interaction with FAK) ( Figure 1A). We performed docking of the 7 amino acid p53 peptide (65-71 amino acids) involved in interaction with FAK into the N-terminal domain of FAK and found the best complex of FAK and p53 peptide ( Figure 1B). The model with the highest scoring of the FAK N-terminal domain (FAK-NT) and p53 peptide interaction was created, which included amino-acids from the F1 (33-127 aa) and F2 lobes (128-253 aa) of FAK reported to interact with p53 [19] ( Figure 1C).
To find small molecule compounds targeting the FAK and p53 interaction we screened more than 200,000 small-molecule compounds from the National Cancer Institute database and docked them into the region of FAK-p53 interaction ( Figure 1D). We identified a series of small molecule compounds that we called Roslins that effectively docked into the FAK-p53 interaction region ( Figure 1D). The p53 peptide (blue color) and small molecules (purple color) which target the region of FAK and p53 interaction are shown in Figure 1D.
The small molecule compound R2 decreased HCT116 viability and clonogenicity in a p53-and dose-dependent manner We selected 19 compounds targeting the FAK and p53 interaction, R1 to R19 (Table 1), and tested them for p53-dependent decrease of cell viability in HCT116p53 + / + and HCT116p53 -/cells ( Figure 2A). The R2, R4-R11, R13, R17 and R18 compounds decreased HCT116 p53 + / + cell viability more efficiently than in HCT116 p53−/− cells (Figure 2A). Most of these compounds also decreased viability in a A375 melanoma cancer cell line with wild type p53 (Additional file 1: Figure S1). Then we tested R compounds that decreased viability in a p53-dependent manner for disruption of FAK and p53 interaction by immunoprecipitation of FAK and p53. Among these compounds R2, R5-R10 and R13 effectively disrupted FAK and p53 interaction. To test specificity for the FAK and p53 pathway we used control p53-null MEF FAK -/cells and PANC-1 with mutant p53, as negative controls (Additional file 1: Figure S1). As expected, most of these compounds did not affect viability of control FAK -/ -p53 -/cells, except for R9, R10 and R13 or PANC-1 cells with mutant p53, except for R9,R10 and R13 (Additional file 1: Figure S1). Thus, among all R compounds, R2, R5, R6, R7, and R8 were the most specific compounds in targeting the FAK and p53 interaction and pathway.
To test these compounds for long-term effects, we performed clonogenicity assays in HCT116 p53 + / + and HCT116p53 -/cells. Among the R compounds targeting FAK and p53, R2 compound (Table 1, marked in bold) maximally decreased clonogenicity in HCT116p53 + / + (Additional file 2: Figure S2). The R2 compound decreased clonogenicity in a p53-and dose-dependent manner ( Figure 2B). The structure of R2 is shown on Figure 2C. R2 also decreased viability of HCT116 cell in a p53-and dose-dependent manner ( Figure 2D). Thus, the small molecule compound R2 was selected for further study because it decreased viability and clonogenicity in a dose and p53-dependent manner in HCT116 cells. Figure 2 R2 is a lead compound targeting FAK-p53 interaction. A. The viability MTT assay with HCTp53 + / + and HCTp53 -/cells identified small molecules, called R compounds that significantly decreased the viability of HCT116 p53 + / + cells compared with HCT116p53 -/cells. * P<0.05 viability less in HCT116p53 + / + cells versus HCT116 p53 -/cells. B. R2 significantly decreased cancer cell clonogenicity in a p53-dependent manner. The compound R2 decreased clonogenicity in HCT116p53 + / + cells more significantly than in HCT116p53 -/cells. C. The structure of R2 compound. D. The R2 compound decreased cancer cell viability in a p53-and dose-dependent manner. MTT assay with different doses of R2 compound was performed in HCT116p53 + / + and HCT116p53 -/cells. *p<0.05, R2-treated HCT116p53 + / + versus HCT116 p53 -/cells. E, F. R2 compound decreased the viability of cancer cell lines with wild type p53 more efficiently than with mutant p53. MTT assay was performed with different doses of R2 in MCF-7 (wild type p53) (E) and MDA231 (mutant p53) (F) breast cancer cells. * p<0.05 treated with R2 versus untreated cells. G. MTT assay with R2 in pancreatic cancer cell line, Miapaca-2 cells (mutant p53). H. MTT assay with R2 in normal human WI 38-hTERT fibroblasts. The MTT assay was performed as in Figure 2 E, F.
R2 compound decreased viability in cancer cells with wild type p53 more effectively than in cancer cells with mutant p53 or in normal cells
We tested the effect of the R2 compound on viability of the MCF-7 breast cancer cell line with wild type p53. R2 decreased viability in the MCF-7 cells in a dosedependent manner ( Figure 2E). In the MDA-231 breast cancer cell line with mutant p53, R2 also decreased viability, but the significantly decreased viability was observed at higher dose than in cells with wild type p53: 50 μM in MDA-231 ( Figure 2F) versus 20 μM in MCF-7 cells ( Figure 2E). R2 did not significantly affect viability of Miapaca-2 pancreatic cancer cells with mutant p53 ( Figure 2G). In normal fibroblasts, WI38-hTERT cells, R2 also did not significantly affect viability ( Figure 2H). Thus, the lead compound R2 significantly decreased the viability of cancer cells with wild type p53, without a significant decrease of viability in normal human fibroblasts and in cancer cells with mutant p53.
The R2 compound bound the FAK N-terminal domain and disrupted the interaction of FAK and p53
We performed computer modeling of the R2 compound docked into the FAK-NT region involved in interaction To detect direct binding of R2 to the N-terminal domain of FAK, we isolated human N-terminal domain of FAK and performed Real-time binding assays with R2 compound using ForteBioOctet Red384 system ( Figure 3B). The assay demonstrated that R2 directly bound to the FAK-NT protein, but not to the negative control (Materials and Methods) ( Figure 3B). In addition, we performed by Octet assay kinetic analysis of association and dissociation of FAK and p53 proteins, either without R2 or with three different doses of R2 (Additional file 3: Table S1). The increased doses of R2 increased dissociation constant K D of FAK and p53 protein interaction, supporting disruption of FAK and p53 complex by R2 in a dose-dependent manner.
To test disruption of FAK and p53 binding by R2 in cells, we performed immunoprecipitation (IP) of FAK and p53 proteins in HCT116 p53 + / + cells without R2 and with R2 ( Figure 3C). While we detected the complex of FAK and p53 by IP in untreated cells ( Figure 3C), we did not detect this complex in R2-treated cells. Thus, the R2 compound disrupted the interaction of FAK and p53 in HCT116 cells ( Figure 3C). To test that R2 directly disrupted the binding of FAK and p53 proteins, we performed pull-down assays using purified recombinant baculoviral FAK, GST and GST-p53 proteins ( Figure 3D, left panel). The pull-down assay clearly showed that FAK bound to p53 without R2, but there was no binding in the presence of R2 ( Figure 3D, right panel). R2 disrupted the binding of FAK and p53 in a dose-dependent manner, while the negative control compound (A18), [32] which did not bind the FAK-p53 region did not disrupt the binding of FAK and p53 ( Figure 3E). Thus, R2 bound FAK-NT and directly disrupted the binding of FAK and p53 proteins in vitro and in vivo.
The R2 small molecule compound reactivated p53transcriptional activity with p21, Mdm-2 and bax targets To study the effect of R2 compound on p53-dependent signaling, we tested the effect of R2 on p53-regulated transcriptional targets, such as p21, Mdm-2, and Bax. We have shown before that overexpression of FAK plasmid blocked the transcriptional activity of p53 through Figure 4 R2 increased and reactivated p53 transcriptional activity that is inhibited by FAK. A. Reactivation of p53 activity with p21 target by R2. The dual luciferase assay was performed in HCT116 p53−/− cells co-transfected with p53 and p21 promoter either without FAK plasmid without R2 or with 25 microM R2 treatment or with FAK plasmid without and with R2 treatment. The dual luciferase assay was performed as described in Materials and Methods. R2 compound reactivated p53 activity with p21 target inhibited by FAK. B. Reactivation of p53 activity with Mdm-2 target. The same assay as in Figure 4 A was performed with Mdm-2 promoter. R2 reactivated p53 activity with Mdm-2 target that was inhibited by FAK. C. Reactivation of p53 activity with Bax target. The same assay as in Figure 4A, B was performed with Bax promoter. R2 compound re-activated p53 activity with Bax target inhibited by FAK. *p<0.05, p53 activity with FAK versus no FAK, no R2 treatment, Student's t-test.
interaction with p53 protein [18]. To test if disruption of the FAK and p53 interaction by R2 de-repressed p53 transcriptional activity, we co-transfected HCT116 p53 -/cells with p53 plasmid and p21 promoter luciferase plasmid in the presence of R2 compound either without FAK plasmid or with the FAK plasmid. After 24 hours we added R2 at 25 μM and compared its effect with untreated cells. FAK blocked p53-induced p21 activity ( Figure 4A), while treatment with R2 compound reversed this inhibition and re-activated p53-activity of the p21 target ( Figure 4A). The same reactivation of p53 was demonstrated by R2 with Mdm-2 target ( Figure 4B) and Bax target ( Figure 4C). This effect was specific and not observed with the negative control compound M13, that targeted the FAK-MDM-2 interaction [33], but not the FAK and p53 interaction (Additional file 4: Figure S4). Thus, R2 specifically targeted FAK and p53 interaction and re-activated p53 targets: p21, Mdm-2, and Bax promoters.
The R2 small molecule compound increased expression of p53-targets in a p53-dependent manner
To study the effect of R2 on p53 and p53-regulated targets, we performed Western blotting on HCT116 p53 treated cells with different doses of R2. We treated cells with different doses of R2 from 1 to 50 μM for 24 hours and performed expression analysis of p53 and its targets: p21, Mdm-2, and Bax ( Figure 5A). R2 increased expression of p53 targets: p21, Mdm-2 and Bax in a dosedependent manner in HCT116 cells ( Figure 5A, left panel). In addition, we treated wild type p53 breast cancer MCF-7 cells with R2 ( Figure 5A, right panel). R2 also increased p21 and Mdm-2 levels and at higher doses caused PARP-1 cleavage and caspase-8 activation in MCF-7 cells. In contrast to cancer cells with wild type p53, there was no up-regulation of Mdm-2 and p21 in SW620 colon cancer cells with mutant p53 (not shown). Thus, R2 increased the expression of p53 and its targets in a dose-dependent manner in cancer cells with wild type p53.
The R2 small molecule compound increased nuclear localization of p21 and p53 and increased G1-arrest in HCT116 cells a p53-dependent manner To detect the effect of R2 on p21 and p53 localization and activation, we performed immunostaining of p21 and p53 in HCT116p53 + / + and HCTp53 -/cells that were either untreated or were treated with R2. We and MCF-7 (right panel) were treated with different doses of R2 and Western blotting was performed with p53, Mdm-2, Bax, PARP-1 and caspase-8 antibodies. R2 induced expression of p53 targets in a dose-dependent manner in HCT116 and MCF-7 cells. The affected proteins by R2 are shown by arrows. The densitometry quantitation was performed with Scion Image software. The protein level was measured and expressed relatively for the beta-actin control, and then normalized to untreated sample, which was equal to one. B. Immunostaining demonstrated that R2 activates p21 and increased nuclear localization of p53 and p21 proteins in HCT116 p53 + / + cells, but not in p53 -/cells. Immunostaining with primary p21 (upper panel) or p53 (lower panel) and with secondary Texas-Red conjugated antibodies was performed on HCT116 p53 + / + and p53 -/cells either untreated or treated with R2. The Phalloidin-FITC stained actin was used to observe cell morphology. R2 increased nuclear p53 and p21 in HCT116p53 + / + cells treated with R2 in contrast to HCTp53 -/cells. C. R2 increased G1 arrest in R2-treated cells. Flow Cytometry analysis was performed as described in Materials and Methods on HCT116 p53 + / + and p53−/− cells that were either untreated or treated with different doses of R2 for 24 h. R2 increased G1-arrested cells and decreased G-2 arrested cells in p53 + / + cells but not p53 -/cells. detected activation of p21 and increased nuclear localization by immunostaining of p21 in R2-treated HCT116p53 + / + ( Figure 5B, upper panel). The activation and nuclear localization of p21 was observed in HCT116p53 + / + cells, but not in p53-negative cells, indicating p53-dependent activation of p21 by R2. Increased nuclear localization of p53 was observed in HCT116p53 + / + cells treated with R2, but was not detected in the negative control HCT116p53 -/cells ( Figure 5B, lower panel). Thus, R2 activated p53-targets in a p53-dependent manner.
We also performed cell cycle analysis of R2-treated and untreated HCT116 p53 -/and p53 + / + cells by FACS ( Figure 5C). We treated HCT116 cells with 10, 20, and 100 μM of R2 for 24 hours and then performed analysis of the cell cycle. We detected a significant dosedependent increase of G1-arrest in R2-treated HCT116 p53 + / + cells from 46% in untreated cells to 56% at 100 μM of R2 (p<0.05). We also observed a decrease of G2-phase in these cells from 16% in untreated to 6% in R2-treated, but not in HCT116 p53 -/cells ( Figure 5C). Thus R2 activated the p53-target, p21, and increased G1 arrest in HCT116 cells in a p53-dependent manner.
The R2 compound significantly decreased tumor growth, and up-regulated p21 expression in HCT116 tumor xenografts in a p53-dependent manner To test the effect of R2 on tumor growth in vivo, we subcutaneously injected isogenic HCT116 p53 + / + and HCTp53 -/cells in the same mice into their right and left sides, respectively, and then treated them, with R2 and measured xenograft tumor growth ( Figure 6A, upper panels). R2 significantly decreased tumor volume in HCT116 p53 + / + mice xenografts ( Figure 6A, left upper panel), while it did not significantly decrease tumor growth in HCTp53 -/xenografts ( Figure 6A, right upper panel). We analyzed tumors from HCT116 p53 + / + xenografts and detected up-regulated expression of p21 in a p53-dependent manner: R2 increased p21 in HCT116 p53 + / + xenografts but not in p53 -/xenografts, while it did not affect FAK and p53 protein levels ( Figure 6A, lower panels). We also observed activation of caspase-3 in HCT116 p53 + / + , but not in p53 -/xenografts, consistent with a significant decrease of HCT116 p53 + / + xenograft tumor growth. Western blotting demonstrated increased p21 in HCT116 p53 + / + xenograft tumors but not in p53 -/xenograft tumors (not shown). In addition, we performed immunoprecipitation of p53 and FAK in untreated and R2-treated HCT116p53 + / + xenografts and detected disruption of FAK and p53 complex in the HCT116 p53 + / + xenografts ( Figure 6B). Thus, R2 blocked tumor growth, disrupted FAK and p53 and re-activated p53 by up-regulating p21 in HCT116 p53 + / + xenografts in vivo. Furthermore, the p53 specificity of R2 was confirmed with the lack of effect in the control p53 negative xenografts in each animal.
The R2 sensitized cancer cells to doxorubicin and 5-fluorouracil
To test the effect of R2 on cancer cell viability in combination with chemotherapy, we treated HCT116 p53 + / + and HCT53 -/cells with R2 alone, doxorubicin alone, or with R2 and doxorubicin together ( Figure 7A). R2 sensitized HCT116 p53 + / + cells to doxorubicin ( Figure 7A, upper panel) but not HCT116 p53 -/cells ( Figure 7A, lower panel). Western blotting detected increased / p53, p21 and Mdm-2 expression in the case of a combination of R2 and doxorubicin compared with each agent alone in HCT116p53 + / + cells ( Figure case of the combination of R2 and 5-fluorouracil in HCT116p53 + / + cells, but not in p53 -/cells ( Figure 7C). Thus, R2 sensitized cancer cells to different chemotherapy drugs, which can be important for developing FAK-p53 combination therapy approaches.
Discussion
In this report, we have demonstrated that the binding between FAK and p53 can be disrupted within a small molecule mimetic that targeted their interaction site. This released normal p53 and activated its downstream targets, including MDM-2, p21, and Bax. Furthermore, these effects were highly specific for p53 as demonstrated in the isogenic HCT-116 colon cancer cell lines that differed only in the presence or absence of p53.
Our results are consistent with the role of FAK in binding pro-apoptotic proteins in cancer cells to inactivate their normal function and thus provide a growth advantage to the tumor cell. This model for one of FAK's functions has been termed sequestration by Frisch [15,41,42]. In addition to p53, FAK binds other proapoptotic proteins such as RIP [43] and NF1 [44]. Given the massive overexpression of FAK in tumor cells [7], binding and sequestering these tumor suppressive proteins appears to be an important part of FAK's function in survival signaling. We have shown that FAK inhibits p53 transcriptional activity [18] and disruption of FAK and p53 de-repressed activity of p53 to activate its downstream targets.
The binding of FAK and p53 is one axis in a tripartite complex between FAK, p53 and MDM-2 [19]. The p53-MDM-2 interaction has been extensively studied and small molecules have been created that disrupt their binding [45]. They have been tested in both preclinical as well as early-stage clinical trials. Our group has recently reported the development of small molecules that disrupt the FAK-MDM-2 interaction [33]. The combination therapy approach can be studied in the future with FAK-p53-Mdm-2 inhibitors.
We have described R2 as a lead compound that provides "proof of principle" that the FAK and p53 interaction can be disrupted by small molecules with reactivation of p53 activity and resultant cytotoxicity to HCT116 cells. In addition, the disruption of FAK-p53 binding and reactivation of p53 activity was seen in the tumor samples themselves, demonstrating the specificity of R2 targeting. The reactivation of p53 in HCTp53 + / + tumors also had a sensitizing effect to chemotherapy that will be important for future therapeutic efforts. In fact, we were able to show that a combination of doxorubicin or 5-fluorouracil and R2 was more effective in decreasing colon cancer viability than either one alone. This may be the result of R2 making the cancer cells more sensitive to cytotoxic therapy, or it may be the effects of chemotherapeutics like doxorubicin that have been shown to induce expression of p53 [46].
These results also demonstrate the importance of the non-kinase or scaffolding function of FAK. There is a mounting body of evidence that the non-kinase functions of FAK are separate, but as significant as its kinase function [47,48]. For example, FAK−/− knock-out mice had shorter survival than kinase-dead mice [49,50], additionally supporting the concept that FAK has important functions in addition to its kinase-dependent function.
In fact, recent reports demonstrated that this scaffolding function of FAK is very important for cancer cell functions [48]. Thus, targeting the kinase-independent function of FAK such as the interaction between FAK and p53 is a novel approach that is complementary to existing therapeutic strategies that target the FAK kinase function.
Conclusions
In conclusion, we isolated the novel small molecule compound Roslin 2 and demonstrated that it disrupted the FAK and p53 interaction and reactivated p53 transcriptional activity with its downstream targets. Disruption of FAK and p53 and reactivation of p53 with R2 compound decreased cancer cell viability and clonogenicity and inhibited tumor growth in vivo in a p53-dependent manner. In addition, R2 compound sensitized cancer cells to chemotherapy. These data define a novel approach to reactivating p53 by disrupting the complex of FAK and p53 with the small molecule compound R2 that can be effectively used for future preclinical and clinical therapeutic models.
Additional files
Additional file 1: Figure S1. The screening of R compounds in different cell lines. A. The viability MTT assay with R compounds was performed in A375 melanoma cells with wild type p53. B. Viability MTT assay with small molecules targeting FAK-p53 interaction in FAK -/ -p53 -/ -MEF cells. To test specificity for FAK and p53 interaction MTT assay with R compounds was performed in normal FAK -/ -p53 -/ -MEF cells. Most of compounds did not affect the viability of the FAK−/−p53−/− MEF cells except for R9, R10, R12, and R13 compounds. C. The MTT assay with R compounds on Panc-1 pancreatic cancer cell line with mutant p53. Most compounds did not significantly affect viability of PANC-1 cells, except of R13 compound.
Additional file 2: Figure S2. R2 is the most effective compound to decrease clonogenicity. The clonogenicity assay was performed with the R2, R5 and R7 compounds (structures are shown on left panels) and identified that R2 is the most effective in decreasing cancer clonogenicity (right panels).
Additional file 3: Table S1. The dose-dependent effect of R2 on kinetics of FAK and p53 protein interaction by Octet assay.
Additional file 4: Figure S4. No induction of p53 activity with control compound M13, which did not target FAK-p53 interaction. The control small molecule compound, M13 did not induce p53 activity of p21 target in contrast to R2 compound. | v3-fos-license |
2019-11-07T14:59:23.908Z | 2019-10-31T00:00:00.000 | 209716123 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://pubs.rsc.org/en/content/articlepdf/2019/ra/c9ra07457k",
"pdf_hash": "ad9e70700c9d459aeb960e5026ac05bdb6fc7ba0",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119124",
"s2fieldsofstudy": [
"Chemistry",
"Biology"
],
"sha1": "a570525779074b01e427917087f6451ae74f481a",
"year": 2019
} | pes2o/s2orc | Discovery of dihydrooxazolo[2,3-a]isoquinoliniums as highly specific inhibitors of hCE2
Human carboxylesterase 2 (hCE2) is one of the most abundant esterases distributed in human small intestine and colon, which participates in the hydrolysis of a variety of ester-bearing drugs and thereby affects the efficacy of these drugs. Herein, a new compound (23o) with a novel skeleton of dihydrooxazolo[2,3-a]isoquinolinium has been discovered with strong inhibition on hCE2 (IC50 = 1.19 μM, Ki = 0.84 μM) and more than 83.89 fold selectivity over hCE1 (IC50 > 100 μM). Furthermore, 23o can inhibit hCE2 activity in living HepG2 cells with the IC50 value of 2.29 μM, indicating that this compound has remarkable cell-membrane permeability and is capable for inhibiting intracellular hCE2. The SAR (structure–activity relationship) analysis and molecular docking results demonstrate that the novel skeleton of oxazolinium is essential for hCEs inhibitory activity and the benzyloxy moiety mainly contributes to the selectivity of hCE2 over hCE1.
Introduction
Mammalian carboxylesterases (CEs), important members of the serine hydrolase superfamily widely distributed in the lumen of endoplasmic reticulum in various tissues, are responsible for the hydrolysis of a wide range of endogenous and xenobiotic substrates containing ester, amides, thioesters and carbamates. [1][2][3] In human body, hCE1 and hCE2 are the main carboxylesterases, both of which play crucial roles in endo-and xenobiotic metabolism. As one of the most abundant esterases distributed in human small intestine and colon, hCE2 participates in hydrolysis of the ester-bearing drugs (such as irinotecan, prasugrel, capecitabine, utamide) and thereby affects the efficacy of these drugs. [4][5][6][7] For instance, CPT-11 (irinotecan), an anticancer prodrug, exhibits strong anti-colorectal cancer activity by releasing the effective substance SN-38. However, excessive accumulation of SN-38 in the intestinal mucosa leads to delayed-onset diarrhoea even death. [8][9][10] To improve the potential clinical risk of these drugs, some highly specic hCE2 inhibitors have been used in clinical to reduce the local exposure of SN-38 in the intestinal mucosa, thereby ameliorating the intestinal toxicity of 12 Over the past decade, a wide variety of hCE2 inhibitors have been reported, including the natural triterpenoids, 13,14 avonoids, 13-15 1,2-diones 16,17 and etc. Although many compounds with strong hCE2 inhibitory activities have already been developed, the potent and specic inhibitors targeting intracellular hCE2 are still rarely reported. DCZ0358 (Fig. 1) is a novel dihydrooxazolo[2,3-a]isoquinolinium discovered in the synthesis of berberine analogues. [18][19][20] Preliminary screening indicated that DCZ0358 could effectively inhibit the catalytic activity of both hCE1 (IC 50 ¼ 4.04 mM) and hCE2 (IC 50 ¼ 16.03 mM), while its hydrolyzate 23b showed a signicant reduction of the inhibitory activity (hCE1 IC 50 ¼ 36.80 mM; hCE2 IC 50 ¼ 41.75 mM), which demonstrated that the oxazolinium moiety of DCZ0358 is essential for the CE S inhibitory activity (Fig. 1). In the synthesis of derivatives of DCZ0358, we have found that in addition to compound 23d (Fig. 2), other compounds with modication of the substituents on the A and D rings cause structural instability of the quaternary ammonium salt. Moreover, the bioactivity and selectivity of 23d were improved (for hCE2 IC 50 ¼ 6.889 mM with >14.52-fold selectivity over hCE1). These results encouraged us to make further investigation of the structure-inhibition relationships of these berberine analogues as CEs inhibitors.
The previously reported synthetic route of DCZ0358 is inconvenient to prepare more derivatives because of the harsh reaction conditions (Scheme 1). 21 Therefore, we designed a new synthetic route using compound 12 as the key intermediate (Scheme 2). Among the obtained new analogues, 23o showed the highest selectivity and the best inhibitory activity (hCE1 IC 50 > 100 mM; hCE2 IC 50 ¼ 1.192 mM, K i ¼ 0.84 mM). It was also found that 23o could inhibit hCE2 activity in living HepG2 cells with the IC 50 value of 2.29 mM, suggesting that the compound has remarkable cell-membrane permeability and is capable for inhibiting intracellular hCE2. Further molecular docking results showed that the methoxyl group at the benzyloxy ring of 23o could tightly bind to the catalytic amino acid Ser-228 via Hbonding, which may account for the high selectivity of 23o on hCE2 over hCE1.
Synthetic procedures
Previously, we reported the synthetic route of DCZ0358 (Scheme 1). 21 However, the application of n-butyl lithium reagent and low temperature condition (À78 C) restricted the synthesis of derivatives. Therefore, developing a feasible route is important for the further medicinal chemistry research. Based on the retrosynthetic analysis (Scheme 1), compound 9 could be synthesized via Suzuki coupling reaction from 10 and 11. Compound 10 could be smoothly prepared from the key intermediate 12.
Thus, we developed another route taking commercially available 3,4-dimethoxybenzaldehyde 1 as the starting material (Scheme 4). Compound 1 reacted with DMF and formic acid to afford tertiary amine 2 in 75% yield. 25 Then we added chloroformate to the mixture of 2 and n-butyl lithium under À78 C to produce 16 in 80% yield. 26,27 Next, compound 16 was attracted by electrophilic reagent TMSCN to afford 17 (82% yield). 28 The operation for the hydrolysis of the methyl ester compound 17 to the compound 15 is difficult to be control. Subsequently, both ester and cyano groups were hydrolyzed to carboxyl groups under strong alkaline condition to give 18 (76% yield). Compound 18 was easily dehydrated in the presence of acetyl chloride to obtain compound 19 in 78% yield. 29 However, compound 20 was rather difficult to achieve from compound 18 or compound 19. Aer trying various amines, we found that only ammonium carbonate could react with 19. 30 However, this reaction occurred at a high temperature (280 C) and gave a very low yield (22% yield) of 20. Thus, compound 17 was directly reacted with sodium methoxide to afford compound 21 in 51% yield, followed by demethylation to produce dihydroisoquinoline-1,3-dione 20 with a high yield of 93%. 31 In order to convert 20 to the key intermediate 12, we explored many reagents, such as PCl 5 , POCl 3 , SOCl 2 and PhPOCl 2 , it turned out that PhPOCl 2 behaved the best yield with 47%. 31 The key intermediate 12 reacted smoothly with hydroxyacetal under alkaline conditions to give compound 10 with high yield (98%), 32 and then 10 reacted with various arylboronic acids containing a benzyloxy structure to produce 22 in yields ranging from 46% to 98%. 19 Finally 22 were cyclized under acidic conditions to give a series of dihydrooxazolo[2,3-a]isoquinolinium analogues (Scheme 5, compounds 23d-23o in Fig. 2). The present synthetic route is convenient to scale up and benets further pharmaceutical research.
Biological activity assays
We designed and synthesized more than 30 derivatives of DCZ0358. However, the ve-ring quaternary ammonium component of some derivatives was unstable to decompose easily into its hydrolyzate 23b. With 12 stable compounds in hand, we conducted experiments to assay inhibitory activities against both hCE1 and hCE2 using a panel of uorescent probe substrates. 33-36 D-Luciferin methyl ester (DME) was used as a probe substrate, and nevadensin (a specic hCE1 inhibitor) was used as a positive inhibitor control for hCE1. Fluorescein diacetate (FD) was used as a specic probe substrate, and loperamide (LPA) was used as a positive inhibitor control of hCE2. The IC 50 values of all derivatives were evaluated and listed in Table 1. Table 1 showed that the inhibitory effects of these compounds against hCE2 were enhanced signicantly when the methylenedioxy group on A ring was changed into benzyloxy group. with electron-donating groups on the benzyloxy ring were similar to that of 23e (hCE2 IC 50 11.46 AE 1.76 mM), 23f (hCE2 IC 50 5.73 AE 0.79 mM) and 23h (hCE2 IC 50 3.32 AE 0.87 mM) with electronwithdrawing groups. In terms of the selectivity, it improved apparently according to the values of IC 50 (hCE2)/IC 50 (hCE1) shown in Table 1. For instance, the value of IC 50 (hCE2)/IC 50 (hCE1) of 23o was up to 83 while that of 23a was only 0.25. Thus, 23o have the best selectivity on hCES2 among all these newly synthesized compounds.
Collectively, the structure-activity relationships of these compounds were summarized as follows, (1) the oxazolinium moiety is crucial for the inhibitory activity against hCEs; (2) the benzyloxy group on the A ring mainly contributed to the selectivity of hCE2 over hCE1 (Fig. 3).
The inhibition kinetic of 23o against hCE2-mediated FD hydrolysis has been carefully investigated and the results showed that 23o functioned as a mixed inhibitor against hCE2mediated FD hydrolysis, with the K i value of 0.84 mM (Fig. 4B). Furthermore, in view of that hCE2 is an intracellular enzyme, the inhibition potential of 23o was also investigated. As shown in Fig. 5, 23o could strongly inhibit intracellular hCE2-mediated NCEN hydrolysis and reduce the uorescence intensity in the green channel (for the hydrolytic metabolite of NCEN) in living HepG2 cells via a dose-dependent manner. Meanwhile, the IC 50 value of 23o against intracellular hCE2 was also evaluated as 2.29 mM (Fig. S2B †).
Molecular docking
In order to investigate the interaction mechanism of 23o with hCE2, molecular docking of 23o to the active site of hCE2 was performed. As shown in Fig. 6, there are hydrogen bond between the methoxyl of ring D with Arg-355 (3.16Å), and a Ttype p-p interaction between the ring D with the Arg-355, as well as, hydrogen bond between the oxygen atom of ring B with Phe-307 (3.17Å) in the entrance of the active cavity of hCE2. These interactions facilitate the entry of 23o into the active cavity of hCE2. However, the hydrolysate of 23o cannot enter the active cavity of hCE2, due to its small inlet. In addition, the methoxyl group at the benzyloxy end of 23o could tightly bind to the catalytic amino acid Ser-228 (1.6Å) via strong H-bonding, as well as, with Ala-150 (3.18Å), and there are strong hydrophobic interactions between the benzyloxy group of 23o with the key residues in the active cavity of hCE2. These interactions may account for the high selectivity of 23o on hCE2. The strong Hbond interaction between 23o and Ser-228 indicates that 23o may obstruct hCE2-mediated hydrolysis, possibly because Ser- 228 is an important residue involved in substrate recognition and catalysis of hCE2. These ndings agreed well with the experimental data where 23o exhibited much more potent inhibitory effect on hCE2 but a relatively weaker one on hCE1.
Conclusions
A new compound 23o with a novel skeleton of dihydrooxazolo [2,3-a]isoquinolinium was discovered with good inhibitory activity on hCE2 (IC 50 ¼ 1.19 mM, K i ¼ 0.84 mM) and high selectivity over hCE1 (IC 50 > 100 mM). The SAR (structureactivity relationship) analysis and molecular docking results revealed that the novel oxazolinium moiety is essential for hCE2 inhibitory activity, while the benzyloxy moiety contributes to the selectivity of hCE2 over hCE1. Furthermore, 23o could strongly inhibit intracellular hCE2 in living HepG2 cells, with the IC 50 value of 2.29 mM. These ndings are important for further research and development of hCE2 inhibitors with high speci-city and efficacy.
Chemical synthesis
Materials. All starting materials were obtained from commercial suppliers and used without further purication. The 1 H and 13 C NMR spectra were taken on Bruker Avance-600 or 500 or 400, Varian MERCURY Plus-400 or 300 NMR spectrometer operating at 400 MHz or 300 MHz for 1 H NMR, 125 MHz or 100 MHz for 13 C NMR, using TMS as internal standard and CDCl 3 or methanol-d 4 or DMSO-d 6 as solvent. 13 C NMR spectra were recorded with complete proton decoupling. The ESI-MS or EI-MS was recorded on Finnigan LCQ/DECA or Thermo-DFS, respectively. The HRMS were obtained from Micromass Ultra Q-TOF (ESI) or Thermo-DFS (EI) spectrometer. Flash column chromatography was carried out using silica gel (200-400 mesh). Thin layer chromatography (TLC) was used silica gel F254 uorescent treated silica that were visualised under UV light (254 nm).
Synthetic procedure. Compounds DCZ0358 and 23b have been reported in our previous work. 18,20 Synthesis of 3,9,10-trimethoxy-5-(4-methoxy-3-((4-methoxybenzyl)oxy)phenyl)-2,3dihydrooxazolo[2,3-a]isoquinolin-4-ium (23d). To a solution of 22d (56 mg, 0.1 mmol) in acetone (5 mL) was added hydrochloric acid (1 mL, 2.0 M in diethyl ether), and then the mixture was stirred for 2 h at room temperature. The solution was evaporated in vacuo to obtain the titled compound 23d as yellow solid (46 mg, 83%). 1 161.2, 159.7, 152.9, 149.9, 147.3, 146.2, 136.8, 134.5, 130.9, 130.1, 126.1, 124.9, 124.5, 120.9, 118.8, 116 3,9,10-Trimethoxy-5-(4-methoxy-3-((4-(methylsulfonyl)benzyl) oxy)phenyl)-2,3-dihydrooxazolo[2,3-a]isoquinolin-4-ium (23e). Compound 23e was prepared from compound 22e (58 mg, 0.1 mmol) as a yellow solid (48 mg, 86%). 1 MD, USA) and stored at À80 C until use. DMSO was purchased from sher. Phosphate buffer was prepared using Millipore water and then stored at 4 C until use. All tested compounds were solved by DMSO and stored at 4 C until use. LC grade acetonitrile and DMSO (Tedia, USA) were used throughout. hCE1 inhibition assay. DME was used as a probe substrate for evaluating the inhibitory effects of all DCZ0358 derivatives on hCE1, while nevadensin (a specic hCE1 inhibitor) was used as a positive control. 39 Briey, 100 mL incubation mixture containing 91 mL PBS (pH 6.8), 2 mL inhibitor at different concentrations and 5 mL HLM (1 mg mL À1 , nal concentration), were pre-incubated at 37 C for 10 min. Subsequently, 2 mL DME (3 mM nal concentration, close to the K m value of DME in HLM) was added to initiate the reaction. Aer incubating for 10 min at 37 C in a shaking bath, the reaction was stopped by the addition of LDR (100 mL). The microplate reader (SpectraMax® iD3, Molecular Devices, Austria) was used for luminescence measurements. The gain value of luminescence detection was set at 140 volts, and the integration time was set at 1 s. The chemical structure of DME and its hydrolytic metabolite (Dluciferin), as well as the detection conditions for D-luciferin are depicted in Table S1. † The negative control incubation (DMSO only) was carried out under the same conditions. The residual activity was calculated using the following formula, the residual activity (%) ¼ (the orescence intensity in the presence of inhibitor)/the orescence intensity in negative control  100%. The residual activities are show in Fig. S1. † hCE2 inhibition assay. The inhibitory effects of all DCZ0358 derivatives on hCE2 were investigated using uorescein diacetate (FD) as a specic probe substrate, 40 while LPA was used as a positive inhibitor of hCE2 in this study. 41 In brief, 200 mL incubation mixture containing 0.1 M PBS (PH ¼ 7.4), human liver microsomes (2 mg mL À1 , nal concentration) and each inhibitor. Aer 10 min pre-incubation at 37 C, the reaction was initiated by adding FD (5 mM, nal concentration, close to the K m value of FD in HLM). Aer incubating for 30 min at 37 C in a shaking bath, the reaction was stopped by the addition of acetonitrile (200 mL). The chemical structure of FD and its hydrolytic metabolite (uorescein), as well as the detection conditions for uorescein are depicted in Table S1. † The negative control incubation (DMSO only) was also carried out under the same conditions. 42 The residual activity was calculated using the formula mentioned above in hCE1 inhibition assay. The residual activities are shown in Fig. S1. † Cell culture and uorescence imaging analyses. In view of that hCE2 was an intracellular enzyme, the inhibition potential of 23o was investigated in living HepG2 cells. The HepG2 cells were cultured in Modied Eagle's Medium (MEM) with 5% CO 2 and 0.1% antibiotic-antimycoticmix antibiotic at 37 C, supplemented with 10% fetal bovine serum (FBS) and used NCEN as substrate probe to assay the 23o inhibition potential toward hCE2. NCEN, 43 another specic optical probe substrate for hCE2, the structure and hydrolytic site were shown in Fig. S2(A). † For uorescence imaging, HepG2 cells were seeded in 96well plates (8000 cells per well) with complete medium and then incubated for 24 hours. Aerwards, the cells were washed twice with FBS-free culture medium and then preincubated in the medium containing 23o (prepared in FBS-free at various concentrations) for 30 min with 5% CO 2 at 37 C. HepG2 cells were then co-incubated with NCEN (nal concentration, 10 mM) for another 50 min to assess the intracellular hCE2 function, respectively. The living cells were imaged and analyzed using an ImageXpress® Micro Confocal High-Content Imaging system (Molecular Devices, Austria).
Conflicts of interest
There are no conicts to declare. | v3-fos-license |
2019-04-08T13:11:03.671Z | 2017-01-01T00:00:00.000 | 99398003 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "http://downloads.hindawi.com/archive/2017/6938475.pdf",
"pdf_hash": "2d4448464b4cba28df481c5b85c88767fa0642e7",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119151",
"s2fieldsofstudy": [
"Chemistry",
"Materials Science"
],
"sha1": "3cff1a81e4a39ecfe60e57e6990bb510464ab693",
"year": 2017
} | pes2o/s2orc | Isolation and Characterization of 1,3-Bis(vinylbenzyl)thymine: Copolymerization with Vinylbenzyl Thymine Ammonium Chloride
A novel bioinspired molecule, 1,3-bis(vinylbenzyl)thymine (bisVBT), was isolated as a by-product during the synthesis of 1-(4vinylbenzyl)thymine (VBT) and analyzed with various techniques: NMR, IR, and Single-Crystal X-ray Diffraction. In addition to embodying all the desired characteristics of VBT (i.e., having the ability to undergo a 2π + 2π photodimerization reaction upon UV irradiation, a derivatization site, hydrogen bonding sites, and aromatic stacking ability) the bisVBT monomer has the added benefit of having two vinyl groups for cross-polymerization. Copolymerizing the bisVBT monomer with the charged monomer vinylbenzyl triethylammonium (VBA) chloride, different copolymers/terpolymers/cross-linked network were obtained, as it was shown by the absence of the vinyl resonance in the NMR spectra. Thermal Gravimetric Analysis (TGA) and Differential Scanning Calorimetry (DSC) showed an indication of materials with low degree of cross-linking. A Gel Permeation Chromatography (GPC) method was improved to better characterize the molecular weight distributions of the cationic structures. Preliminary qualitative cross-linking studies were performed on bisVBT-VBA copolymers, and a comparison with VBT-VBA copolymers is presented.
In designing VBT copolymers, one of the desirable features that previous researchers incorporated into the copolymer is the ability to be processed in aqueous systems. Due to the high level of intermolecular forces between each monomer, the VBT homopolymer is insoluble in water. Thus, VBT is often polymerized in different ratios with styrene derivative charged monomers, such as anionic vinyl phenyl sulfonate (VPS) salts [7] or cationic vinylbenzyl triethylammonium chloride (VBA) [8][9][10] which allows the copolymer to be soluble in water. Extending the knowledge achieved from the study of the natural phenomena related to thymine reactivity and intermolecular interactions has generated a diapason of potential applications [11][12][13][14] ranging from photoresist material [15,16] and organic-inorganic hybrid devices [2] to antibacterial coatings [17], drug delivery systems [3,[18][19][20], recyclable plastics [21], and biosensors [22,23]. On the other hand, the increasing attention given to the environmental and toxicological dilemmas linked to commercial materials situates the thymine-based polymeric systems as a Green Chemistry platform [24]. From an intellectual standpoint, thymine polymeric systems offer an approach to physiologically relevant processes, while offering commercially applicable opportunities in material sciences. This synergy will make available new comprehensions and the development of innovative materials.
Quaternary ammonium groups, such as in VBA, are known to exhibit antimicrobial properties as they interact with the cell walls of certain types of bacteria and cause the destruction of cells by lysins. This property in 2 Journal of Polymers combination with the photo-induced immobilization of VBT monomers creates a host of possible applications for VBT-VBA copolymers, such as antimicrobial coatings in hospitals or antifouling agents on the exterior of boats and ships. Furthermore, the ethyl alkyl arms on VBA can be replaced with alkyl groups of different chain lengths to vary the antimicrobial properties and applications [17]. To ensure that the presence of charged monomers would not interfere with the photo-cross-linking reaction of VBT moieties, irradiation studies have been performed on varying ratios of VBT-VBA copolymers to quantify the extent of their photodimerization and immobilization [8,10]. From such studies, it was found that linear VBT-VBA copolymer chains cross-link through adjacent thymine moieties to form an immobilized thin film.
Inspired by these findings and in the attempt to incorporate Green Chemistry [24] in our practices, we focused our research on improving the synthesis of the VBT monomer by isolating and characterizing each product/by-product. One of the most common routes of the VBT synthesis is via a nucleophilic substitution reaction between vinylbenzyl chloride (VBC) and potassium thyminate (KThy) [5]. Although this method of synthesis has been predominantly used to produce VBT, its yield has not been known to exceed 40%. Our meticulous studies permitted obtaining a high yield of VBT monomer (37.4%) and correspondingly other reaction byproducts such as 1,3-bis(4-vinylbenzyl)thymine (bisVBT) (22.1%) and trace amounts of 3-(4-vinylbenzyl)thymine (3-VBT) and 4-vinylbenzyl alcohol (VBOH). Out of these byproducts, bisVBT occurred in the highest quantity, making it the easiest to isolate and characterize.
Due to the presence of only one vinyl group in its structure, the VBT monomer is only able to form linear copolymers. However, since the bisVBT monomer has two vinyl groups, it has the potential to form branched and even cross-linked networks. With the bisVBT enhanced polymerizability, it can be anticipated that the strength and flexibility of cross-linked bisVBT materials will meet the requirements of new desired applications. Furthermore, the bisVBT monomer similarly has photo-cross-linking capabilities due to the thymine base in its structure. This work describes the synthesis of three different bisVBT-VBA materials of varying molecular weights and structure and a comparison of their thermal profiles and cross-linking efficiencies to previously synthesized VBT-VBA copolymers.
A Gel Permeation Chromatography (GPC) method was modified to better characterize the molecular weight distributions of the synthesized bisVBT-VBA cationic networks. Preliminary qualitative cross-linking studies were performed on bisVBT-VBA materials and a comparison with wellknown VBT-VBA copolymers is presented.
PET film (Melinex 454/500) was provided by DuPont Teijin Films. Film coating was performed using a microscope slide edge to draw down the copolymer solution. Irradiation of the copolymers films was carried out using Spectronics Corp. Spectrolinker XL-1500 (254 nm, 40 W).
All synthesized monomers and copolymers were dried in a vacuum oven (VWR5 1410 = 80 ∘ C; pressure = 28 inHg). Purification of VBT and bisVBT were performed using Teledyne Isco CombiFlash Rf 200. 1 H NMR spectra of monomers and copolymers were performed using a 90 MHz (Anasazi EFT) and a 400 MHz (JEOL) NMR spectrometers. IR analysis was performed using Thermo Scientific Nicolet 6700 FTIR instrument. Agilent 8453 Diode Array UV-Vis Spectrophotometer was used for sample measurement. Molecular weights were determined by GPC performed using a Beckman Gold Programmable Solvent Module HPLC system (126) with a UV/Vis Programmable Detector Module (166). A guard column and two analytical columns (Jordi DVB Polar Pack Wax mixed bed) were used. Copolymer solutions in the solvent were agitated on an orbital shaker overnight (recommended by the GPC-columns manufacturer) and filtered through a 0.45 m Whatman filter attached to a BD 1 mL Luer-Lok tip syringe before sample injection. GPC mobile phase filtration apparatus was purchased from Quark Glass.
Thermal studies of the copolymers were performed as follows. TGA data were collected using a TA Instrument Q5000 TG Analyzer. In a typical TGA experiment, the copolymer sample was removed from the vacuum oven, carefully weighed, put into the furnace of the instrument, and heated, under nitrogen, over a range of 20 ∘ C-600 ∘ C on a ramp of 20 ∘ C/min. DSC data were collected using a TA Instruments Q2000 DS Calorimeter. Samples for the DSC experiment were carefully weighed, heated in Tzero aluminum hermetic pans purchased from TA Instruments. Heat-cool-heat DSC experiments were performed under N 2 flux, a heating ramp of 10 ∘ C/min, and a cooling ramp of 5 ∘ C/min.
Synthesis of Sodium
Thyminate. Sodium hydroxide (2.04 g, 0.051 mol) was added to a flask containing DI water (30 mL), heated to 50 ∘ C, and stirred at 300 RPM until dissolved. Then thymine (6.50 g, 0.044 mol) was added and stirred for additional 20 minutes. After the solution has completely turned clear, the flask was removed from heat and cooled to room temperature. 50 mL of ethanol was added slowly to the stirring solution and a white precipitate was observed. The white solid was filtered with a Buchner funnel, rinsed with additional ethanol, and dried overnight in a vacuum oven at 80 ∘ C under 25 in Hg vacuum. Sodium
Synthesis and Purification of Monomers, VBT, and
bisVBT. VBT synthesis was slightly modified from procedures described previously [5,6]. The reaction scheme is presented in Figure 1.
In a 250 mL round bottom flask containing a magnetic stirring bar, dimethylformamide (DMF) (20 mL) was added and heated in an oil bath until the temperature was stabilized at 70 ∘ C. To the same flask, sodium thyminate (NaThy, 3.5 g, 0.024 mol) was added. Once a majority of NaThy was dissolved to give a white milky solution, vinylbenzyl chloride (VBC) (4.8 g, 0.028 mol) and inhibitor 2,6-di-tertbutyl-4methylphenol (BHT) (5 mg, 0.02 mmol) were added. The light yellow opaque mixture was allowed to heat at 70 ∘ C and stir for 24 hours. The DMF solvent was removed at the end of the reaction via rotary evaporation under vacuum. The paste-like residue was redissolved in methylene chloride and adsorbed onto silica gel. RediSep Rf prepacked silicagel columns (silica 80 g) were used to separate the reaction mixture on a Teledyne Isco CombiFlash instrument. The elution solvent system used was a gradual ramp from 20% ethyl acetate in hexanes to 50% at 60 mL/min, with a total separation time of 60 minutes. The isolated VBT (2.14 g, 37.4% yield) was a white solid. The isolated bisVBT (1.87 g, 22.1% yield) was a translucent white viscous liquid, which solidified into an opaque white solid upon cooling to 4 ∘ C. Both of the isolated VBT and bisVBT products were placed in a vacuum oven to dry and then characterized using NMR (JEOL 400 MHz) and IR. Based on 1 H NMR spectra results, the monomers were deemed pure enough for the synthesis of the copolymers.
To examine the crystal packing behavior of the synthesized bisVBT monomer, crystalline samples were subjected to crystal and molecular structure determinations by Single-Crystal X-ray Diffraction. The data were collected using an APEXII BRUKER X-ray diffractometer with X-ray radiation generated from a Mo sealed X-ray tube ( = 0.70173Å with a potential of 40 kV and a current of 40 mA) at the Department of Chemistry, Texas A&M University. Detailed X-ray diffraction data are available in the Electronic Supplementary Information. Vinylbenzyl triethylammonium chloride (VBA) monomer was synthesized as described before [25]. In a threeneck 500 mL round bottom flask equipped with a stirring bar, reflux condenser, and nitrogen inlet, bisVBT (0.50 g, 1.4 mmol, 1 mol eq.) was dissolved in isopropanol (115 mL) at 80 ∘ C. Upon complete dissolution of bisVBT, the reaction temperature was brought down to 65 ∘ C. At this point VBA (11.31 g, 44.6 mmol, 32 mol eq.) was added swiftly to minimize water absorption. Following complete dissolution of VBA, 2,2 -azobisisobutyronitrile (AIBN, 0.125 g, 1% w/w) was added to the reaction mixture. The solution was allowed to stir (500 rpm) at 65 ∘ C for 24 hours under N 2 . The solution became notably more viscous as the reaction progressed. At the end of the 24-hour period, the reaction mixture was highly viscous, resembling a clear gel. The copolymer was isolated from the reaction mixture via precipitation in acetone. The mixture was vacuum filtered using Whatman grade 2 filter paper to collect the white copolymer precipitate. The collected copolymer was transferred to an empty beaker and placed in a vacuum oven to dry overnight to give 10.9 g of copolymer (92% yield). Primary analysis of the copolymer was performed using TLC (90/10 CHCl 3 -MeOH with 1% NH 4 OH mobile phase) to check for presence of monomer. Characterization of the dried copolymer was carried out using 1 H NMR spectroscopy in DMSO-d 6 , to verify the absence of unreacted monomers and the typical vinyl group signal at chemical shifts between 5 and 6 ppm was not observed in the spectra indicating the formation of a network structure. It should be noted that the copolymer swelled into a highly viscous gel when DMSO was added.
Synthesis of 1 : 32 bisVBT-VBA Copolymer (3% AIBN).
The copolymerization procedure described above was repeated with the following modifications. The weight ratio of AIBN was increased to 3% (0.325 g). An overhead stirrer (400 rpm) was used instead of a magnetic stir bar to improve the uniformity of the reaction mixture. The bisVBT solids were ground up prior to being added in isopropanol to improve solubility. The product of this polymerization reaction was also very viscous and gel-like, similar to the previous reaction. One major difference in appearance was the presence of bubbles in the swollen product. The same acetone vortex was set up to crash out the copolymer. Vacuum filtration with grade 2 filter paper was used to isolate the copolymer particles from the mixture. The isolated white copolymer after drying under vacuum (9.02 g, 76% yield) appeared to be stickier and more hygroscopic than the previous copolymer.
Preliminary analysis of the copolymer was performed using TLC (90/10 CHCl 3 -MeOH with 1% NH 4 OH mobile phase) to check for presence of monomer. Characterization of the dried copolymer was performed using 1 HNMR spectroscopy with DMSO-d 6 , to verify the absence of unreacted monomers and the typical vinyl group signal at chemical shifts between 5 and 6 ppm was not observed in the spectra, pointing to a network structure. This copolymer also swelled when DMSO was added but exhibited a lower observed viscosity than the 1 : 32 bisVBT-VBA (1% AIBN) copolymer. Terpolymer (1% AIBN). The polymerization procedure described in previous sections was repeated with the following modifications. VBT (1.35 g, 5.6 mmol, 4 mol eq.) was dissolved in isopropanol (115 mL) at 80 ∘ C. Following the complete dissolution of VBT, the temperature was decreased to 65 ∘ C, and bisVBT (0.50 g, 1.4 mmol, 1 mol eq) was added to the reaction flask allowing it to dissolve for 15-20 min. VBA (11.3 g, 44.6 mmol, 32 mol eq) was added to the reaction mixture. Once all the monomers were dissolved, AIBN (0.130 g, 1% w/w) was added to initiate polymerization. An overhead stirrer (400 rpm) was used [26].
Synthesis of 1 : 4 : 32 bisVBT-VBT-VBA
Observation of the reaction flask 18 hours later revealed that while the appearance of the flask contents was clear and gel-like; the stirring action of the overhead stirrer was sluggish, a clear indication that viscosity of this polymerization reaction was higher than in the 1 : 32 bisVBT-VBA copolymer reactions. The stirring rate was turned up to 550 rpm and an additional 100 mL of isopropanol was added to increase the fluidity of the mixture. After 24 hours, the reaction flask was removed from heat and stirring and the contents were processed similarly with the acetone vortex. While the reaction product was viscous, it still maintained the form of flowing liquid as compared to the gel-like consistency of the 1 : 32 bisVBT-VBA copolymer reaction products.
A greater volume of acetone was required to be added to the reaction mixture before precipitated particles were observed. While it was possible to see that bisVBT-VBT-VBA terpolymer did crash out of solution, the particles were so fine that the suspension resembled skim milk. An initial vacuum filtration was performed using a fritted ceramic funnel with medium pore size, followed by centrifugation for 10 minutes at 5000 rpm and the suspension was allowed to settle by gravity and isolated by decanting. A sludgy layer of sticky white copolymer was observed at the bottom of the beaker, scraped out, and placed in the vacuum oven to dry. The dried copolymer (5.874 g, 45% yield) was a translucent white hard solid and was analyzed using TLC (90/10 CHCl 3 -MeOH with 1% NH 4 OH) to check for presence of monomer. Characterization of the dried copolymer was performed using 1 HNMR spectroscopy with DMSO-d 6 , showing the absence of unreacted monomers and confirming a crosslinked network. This terpolymer exhibited slight swelling when dissolved in DMSO and was much less viscous than the previous two copolymers.
Gel Permeation Chromatography. Molecular weights were determined by GPC experiments performed using Beckman Gold Programmable Solvent Module HPLC system (126) with a UV/Vis Programmable Detector Module (166).
A guard column (Jordi DVB Polar Pack Wax mixed bed, 50 mm × 10 mm, 5 m particles) and two analytical columns (Jordi DVB Polar Pack Wax mixed bed, 250 × 10 mm, 5 m particles) in series were used. GPC analyses were performed by comparing the molecular weight of the sample against standards of known molecular weight. Therefore, the choice of the standards used was particularly important for the bisVBT-VBA charged copolymer systems. Poly(2vinylpyridine) standards (PVP) with molecular weights (Mp) of 1,820; 20,900, and 256,000 were purchased from Jordi Labs. The mobile phase used was 30/70 methanol/water with a total concentration of 1 M acetic acid to maintain the Journal of Polymers 5 positive charge of the column, which required a pH below 8. The solvent was made by adding 57.45 mL of glacial acetic acid to 30/70 methanol (ACS grade) and water (DI) in a 1 L volumetric flask, followed by vacuum filtration using a mobile phase filtration apparatus (Quark glass) with Nylon 66 membrane (0.45 m × 47 mm, Supelco). Copolymer sample solutions were prepared by dissolving 2.5 mg of sample per 1 mL of eluting solvent. The GPC sample solutions were agitated on an orbital shaker overnight at 150 RPM and passed through a 0.45 m Whatman filter attached to a BD 1 mL Luer-Lok tip syringe before injection. A flow rate of 1.00 mL/min was used for all runs at 254 nm wavelength. Calibration curves were obtained using poly(2-vinylpyridine) standards.
Irradiation Studies.
A 10% (w/w) solution of each copolymer was made in 50/50 methanol and water, since it was not possible to dissolve in pure water. Upon addition to the solvent, the bisVBT-VBA (1% AIBN and 3% AIBN) copolymers exhibited a significant level of swelling, with the bisVBT-VBA (1% AIBN) copolymer swelling the most. The clear, colorless solutions had viscosities that resembled a fluid gel. The bisVBT-VBT-VBA terpolymer (1% AIBN) did not exhibit swelling and was a fluid, clear colorless solution.
The PET substrate was pretreated with 1 M NaOH for 24 hours in an attempt to etch the surface and improve immobilization of the irradiated copolymer. Copolymer solutions were coated by doctor blading technique onto the PET film (Melinex 454/500) and allowed to dry for 10 min. The PET film was masked and irradiation was set for 30 sec, 60 sec, 120 sec, and 180 sec. The irradiated coatings were immersed for one minute in FD&C Blue dye solutions (0.5 g of methylene blue dye and 1 g sodium carbonate in 1 L of DI water) and then gently dipped in DI water to rinse the extra dye.
Results and Discussion
The structure of the isolated monomer bisVBT, a by-product obtained from the VBT synthesis, was confirmed by proton NMR, IR, and X-ray crystal analysis. Moreover, three new synthesized materials were characterized by 1 HNMR and GPC.
The crystal structure of bisVBT monomer and the unit cell are shown in Figures 2(a)-2(b), which reveals that the monomer molecules pack into tight layers. Nearby thymine moieties are generated by stacking of the layers, which brings the thymine groups slightly offset of the ring with an average thymine separation of 5.9Å.
Gel Permeation Chromatography.
The average molecular weights of the resultant bisVBT-VBA copolymers were measured by gel permeation chromatography (GPC) [27]. The primary limitation of conventional GPC is that the obtained molecular weights are relative values. Therefore, the accuracy of the method depends upon the standards and samples having the same relationship between their hydrodynamic volume, charge, and molecular weight. This is especially true for charged copolymers systems [20].
Given that bisVBT-VBA copolymers are positively charged, a poly(2-vinylpyridine) (PVP) was chosen as the standard, since it becomes positively charged upon exposure to an acidic mobile condition and exhibits similar interactions with the column phase as the cationic bisVBT-VBA copolymers. A calibration curve (log Mw versus retention volume) was created from PVP standard runs, which allows determination of copolymer molecular weight based on the retention volume. Table 1 shows the weight-average molecular weight (Mw), number-average molecular weight (Mn), and polydispersity, (Pd = Mw/Mn) of the bisVBT-VBA copolymers estimated from the calibration curves.
The results presented in Figure 3 show that all materials elute around 18 minutes, with average molecular weights ranging between 65,000 and 100,000 Da, and a possible secondary chain of copolymers with a slightly lower molecular weight. The differences in molecular weights for the bisVBT-VBA structures are mainly due to variations in initiator concentration [8]. The lower amount AIBN used (1 : 32 bisVBT-VBA 1% AIBN) results in longer formed chains and therefore in higher molecular weight copolymers.
The fact that the terpolymer 1 : 4 : 32 bisVBT-VBT-VBA (1% AIBN) has the lowest molecular weight compared to bisVBT-VBA copolymers highlights a main difference between bisVBT and VBT monomers. The bisVBT monomer having two vinyl groups has higher quantity of sites to polymerize, giving rise to network structures and thereby increasing the molecular weight of the resulting materials as it is shown in Table 1. On the other side, the VBT monomer having only one vinyl group has lower possibilities to polymerize and generally will generate linear copolymers. Consequently, in the terpolymer 1 : 4 : 32 bisVBT-VBT-VBA with a large amount of VBT monomer present, the expected molecular weight is lower than in bisVBT-VBA copolymers. From the GPC analysis it is likely that cross-linked network copolymers from bisVBT monomers will not be soluble, and therefore the observed GPC traces of filtered samples represent the soluble fraction of the materials with low degree of cross-linking. This might explain the unexpectedly low polydispersity (Pd) values of the copolymer molecular weights, compared to reported random VBT-VBA copolymerization reactions, which exhibit acceptable polydispersity values between 1.5 and 4 [3,26,28,29].
Thermal Analysis.
The thermal properties and stability of the bisVBT-VBA copolymer were studied with TGA in a nitrogen stream and with DSC. The TGA thermogravimetric curves of different bisVBT-VBA copolymers and the 1 : 8 VBT-VBA control copolymer are presented in Figure 4. For all copolymers, the initial 5 to 10% weight loss at 100 ∘ C occurs as a result of water evaporation. Figure 4(a) shows that both 1 : 32 bisVBT-VBA copolymers with 1% and 3% AIBN initiator have similar features, indicating that the small difference in MW has no influence on the thermal properties. The thermograms have two very well-defined degradation steps. The first step of 40% weight loss occurring at 209 ∘ C corresponds to VBA monomer. The second degradation point for both 1 : 32 bisVBT-VBA materials corresponds to bisVBT monomer and was found at 445 ∘ C (Figure 4(a)). This value is slightly higher than the VBT degradation presented for the 1 : 8 VBT-VBA copolymer (390 ∘ C) and the 1 : 4 : 32 bisVBT-VBT-VBA terpolymer (400 ∘ C) (as shown in Figure 4(b)). While the VBA monomer ratio decreases going from 1 : 32 bisVBT-VBA to 1 : 8 VBT-VBA copolymers, the first degradation step related to VBA monomer takes place at a lower temperature, as it can be observed for 1 : 8 VBT-VBA (1% AIBN) copolymer at 195 ∘ C (Figure 4(b)). These observations suggest that bisVBT-VBA copolymers have greater thermal flexibility than VBT-VBA copolymers.
An important information when evaluating new materials for their potential application is the glass transition temperature (Tg), which is defined as a change in heat capacity when the polymer matrix changes from "glass" at low temperatures to "rubber" at higher temperatures. This second-order endothermic transition appears in the thermogram as a step not a peak. From DSC thermograms (not shown) no distinguishable thermal phase transitions were observed, besides slight steps from where the Tg for each material was determined.
The DSC thermograms showed a decrease in Tg values when the VBA ratio in the copolymer increases going from 89.3 ∘ C for 1 : 8 VBT-VBA copolymers to approximately 74.5 ∘ C for 1 : 32 bisVBT-VBA copolymers. This can be explained since a higher content of cationic VBA monomers increases electrostatic repulsions between monomers, which makes the material less rigid. When comparing materials having similar VBT : VBA ratio, it can be observed that for 1 : 8 VBT-VBA copolymers the Tg value (89.3 ∘ C) is higher than for the 1 : 4 : 32 bisVBT-VBT-VBA terpolymer (76 ∘ C) indicating that the presence of bisVBT monomer may act as a "plasticizer," which improves the fluidity and reduces the brittleness of the material. In general, the presence of high Tg values was expected considering that the synthesized structures have high molecular weights.
The glass transition temperatures (Tg) of the bisVBT-VBA structures are lower than those of the VBT-VBA copolymers, supporting the previous conclusion that arrangements containing the bisVBT monomer have greater thermal flexibility than those containing the VBT monomer.
Qualitative Irradiation Studies.
All three bisVBT-VBA synthesized materials and the control 1 : 8 VBT-VBA copolymer were layered on thin films and irradiated for different times 30 sec, 60 sec, 120 sec, and 180 sec (equivalent to the amount of energy delivered). The VBT films are colorless and in order to quantify the extent of their photoimmobilization on the substrate, the films were toned with an anionic FD&C Blue dye. The dye molecules have low affinity to the PET substrate, nevertheless strongly interacting with the immobilized oppositely charged polycationic copolymer. Thus, the thymine cross-linking can be indirectly estimated by analyzing the dye adsorption onto the insoluble copolymer.
The immobilization degree between the substrate and the copolymer is affected by the molar mass and the chemical composition. At shorter times the photo cross-linking and the resulting increase in average molecular weight of the copolymers do not affect solubility. Nevertheless, as the reaction proceeds and more dimers are generated, the copolymer chains form high molecular weight networks, which make up the insoluble fraction of the photo-cross-linked copolymer. When all copolymer chains are connected a saturation level is reached, and continued irradiation does not cause any additional decrease in solubility. This is a typical behavior of photoresist materials [30]. Figure 5 shows qualitatively how the extent of immobilization varies between all bisVBT-VBA cross-linked materials. In all cases it was observed that the amount of trapped dye increases with irradiation time until it reaches saturation (time evolution not shown). Out of the three new synthetic copolymers, the 1 : 4 : 32 bisVBT-VBT-VBA (1% AIBN) terpolymer in 50/50 MeOH-water ( Figure 5(a)) exhibited a satisfactory degree of cross-linking, as all the photo-masked area remained immobilized. As a comparison, the previously studied copolymer 1 : 8 VBT-VBA (1% AIBN) [31][32][33] in 50/50 MeOH-water was used as a control ( Figure 5(b)). Visually, the photo cross-linking exhibited by both copolymers was comparable, as it was expected since they have similar VBT-VBA ratios.
A moderate degree of cross-linking occurred with the 1 : 32 bisVBT-VBA (3% AIBN) copolymer in 50/50 MeOHwater ( Figure 5(c)), where it can be observed that longer irradiation times (120 sec) were needed to immobilize copolymer. These circumstances were expected for the reason that, when less fraction of cross-linkable VBT compared with VBA monomer is present in the copolymer films, few thymine groups undergo photodimerization, and therefore longer irradiation time is required for immobilization. Therefore, decreasing bisVBT/VBT concentration will result in thymine molecules further away from each other, and in consequence a slower and less efficient photo cross-link. In summary, copolymers with high VBA content will possess a decreased ability to cross-link when irradiated with UV light mostly due to a low content of VBT monomers, but correspondingly as a result of increased electrostatic repulsions between VBA monomers (low Tg) which hinders the free spatial arrangement of the copolymer reducing the possibility of adjacent thymine moieties to be close enough to cross-link. Figure 5(c) also shows that bisVBT-VBA structures have a typical photoresist behavior, since after 120 sec of irradiation the dye adsorption reaches saturation.
While the intention of increasing the molar equivalence of VBA to bisVBT was to increase the solubility of the bisVBT-VBA materials, the smaller molar equivalence of bisVBT may have caused the copolymer chains to have insufficient amounts of neighboring thymine moieties in the proximity, required for photodimerization and adequate immobilization. Quantitative studies of the photo cross-linking of copolymers varying bisVBT to VBA ratios are currently under progress.
It is worthy to note that the bisVBT-VBA copolymers in a 10% w/w solution in 50/50 MeOH-water exhibited a tendency to swell upon solvation in hydroxyl containing solvents, like water and alcohols. This property is consistent with crosslinked copolymers and may reduce the processability of the new materials, increasing the difficulty of creating uniform thickness films.
Conclusions
The VBT and bisVBT monomers, in addition to specifically formulated copolymers/network structures, were successfully synthesized and characterized. The identities of the VBT and the novel bisVBT monomers were confirmed via 1 H NMR, 13 C NMR, IR, and X-ray crystallography. Currently, a design of experiments to study the conditions to maximize the yield of either VBT or bisVBT monomers is underway and will be reported in the future.
Specifically formulated copolymers/network structures of bisVBT, VBT, and VBA monomers were synthesized. Qualitative irradiation studies of the synthesized copolymers/network structures revealed that, to some extent, an immobilized film can be generated. The irradiation studies also revealed that the synthesized structures containing bisVBT exhibited a significant level of swelling upon solvation with hydroxyl containing solvents (water and polar solvents). The swelling property causes the viscosity of the copolymers to increase tremendously and should be an important consideration in characterization as well as in applications design.
The production and isolation of the bisVBT monomer introduce numerous interesting areas to explore in the future. The synthesis of copolymers with increased ratios of bisVBT to VBA monomers is needed to evaluate the mechanical properties of the immobilized films. The particle size distribution of the resulting copolymers using Dynamic Light Scattering (DSL) would provide an insight into potential nanogel formation. Additional comparative swelling and solubility studies need to be undertaken to quantify the amount of cross-linking on structures with different bisVBT-VBA ratios. These complementary studies and a further knowledge of the bisVBT monomer properties will potentially move forward to the development of valuable cross-linked copolymers. | v3-fos-license |
2020-07-23T09:06:01.216Z | 2020-07-16T00:00:00.000 | 220833143 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://downloads.hindawi.com/journals/jdr/2020/7867245.pdf",
"pdf_hash": "8f186ee7760ccc424369142a5b3d1dc1e4343b4b",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119171",
"s2fieldsofstudy": [
"Medicine",
"Chemistry"
],
"sha1": "2197ce523175e7ca3397df689ccc0a4d38f0634e",
"year": 2020
} | pes2o/s2orc | A Network-Based Approach to Explore the Mechanism and Bioactive Compounds of Erzhi Pill against Metabolic Dysfunction-Associated Fatty Liver Disease
Erzhi pill (EZP), a classical traditional Chinese medicine prescription, exerts a potent hepatoprotective effect against metabolic dysfunction-associated fatty liver disease (MAFLD), previously known as nonalcoholic fatty liver disease (NAFLD). However, the mechanism and bioactive compounds underlying the hepatoprotective effect of EZP have not been fully elucidated. In this study, a systematic analytical platform was built to explore the mechanism and bioactive compounds of EZP against MAFLD. This was carried out through target prediction, protein-protein interaction (PPI) network construction, gene ontology, KEGG pathway enrichment, and molecular docking. According to the topological parameters of the PPI network, compound-target-pathway network, 9 targets, and 11 bioactive compounds were identified as core targets and bioactive compounds for molecular docking. The results showed that EZP exerts anti-MAFLD effects through a multicomponent, multitarget, multipathway manner, and luteolin and linarin may be the bioactive compounds of EZP. This study provides further research insights and helps explore the hepatoprotective mechanism of EZP.
Introduction
Metabolic dysfunction-associated fatty liver disease (MAFLD), previously known as nonalcoholic fatty liver disease (NAFLD) [1,2], is defined as the presence of liver cells with steatosis exceeding 5% and the lack of secondary causes of liver fat accumulation, such as drinking of alcohol [3]. With dramatic lifestyle modifications, the MAFLD has developed into a global health concern over the past decades [4]. Moreover, studies have increasingly shown the multisystem disease nature of MAFLD which affects several organs and increases the risk of type 2 diabetes and cardiovascular, cardiac, and chronic kidney diseases [5,6]. Significant weight loss and change of dietary habits will have a salutary effect on MAFLD; however, new treatment strategies are urgently needed [7]. The reason is that with the changing dietary habits and lifestyle, MAFLD is one of the most important causes of liver disease worldwide. More importantly, MAFLD may eventually become the primary cause of end-stage liver disease [4]. Therefore, there is an urgent need for safe and effective drugs against MAFLD.
Previous studies have shown that some traditional Chinese medicine (TCM) formulaes, such as Dachaihu decoction, have good efficacy against MAFLD [8]. Erzhi pill (EZP) is a TCM used for liver disease in the past centuries. EZP consists of Ligustri Lucidi Fructus (LLF) and Ecliptae Herba (EH) at a ratio of 1 : 1 and functions as a liver and kidney tonic in traditional Chinese medicine theory. A previous study showed the hepatoprotective effect of EZP by the antioxidative defense system enhancement and the inflammatory response through the TSC/mTOR signaling pathway [9]. EZP has also been used to treat diabetes and metabolic syndrome. However, studies on the mechanism of EZP against MAFLD are still lacking.
The network pharmacology presented in 2008 [10] has holistic and systematic research methods and characteristics of focusing on the interaction between drugs and the body system. This is consistent with the characteristics of multiple targets and multiple pathways in TCM [11], becoming an efficient tool to systematically analyse the multiple targets and multiple pathway mechanisms of TCM. Several studies that employed network pharmacology to investigate the mechanism of TCM have been successful [12,13]. In addition, the interaction of compounds, targets, and pathways can be established with network pharmacology, which helps identify potential bioactive compounds and pathways of TCM.
In this study, a systematic analytical platform for predicting potential bioactive compounds, targets, and molecular mechanisms of EZP against MAFLD was built. Detailed methods included potential bioactive compound collection, EZP-and MAFLD-related target prediction, protein-protein interaction (PPI) network construction, gene ontology and pathway enrichment, and molecular docking. This study provides a further research direction for the exploration of the hepatoprotective mechanism of EZP. 3), a pharmacology platform that provides information on drugs, targets, and diseases, by retrieving Fructus Ligustri Lucidi and Ecliptae Herba. Twelve absorption, distribution, metabolism, and excretion-(ADME-) related parameters of herbal ingredients were also extraction from the TCMSP [14]. Considering that oral administration of EZP, OB [15], and DL [16] was used for identifying bioactive compounds of EZP, the components with OB ≥ 30% and DL ≥ 0:18 were identified as potential bioactive compounds.
Construction of the MAFLD Target Database.
Considering the different advantages and characteristics of each database, four databases were used to collect the MAFLDrelated targets. By retrieving "nonalcoholic fatty liver disease" in GeneCards (https://www.genecards.org/), DrugBank (https://www.drugbank.ca/, version 5.1.5), Online Mendelian Inheritance in Man (OMIM, http://omim.org/, updated on Jan. 15, 2019), and National Centre for Biotechnology Information Gene (NCBI Gene, https://www.ncbi.nlm.nih.gov/ gene/) MAFLD-related targets were retrieved. All the four databases are freely accessible platforms that contain comprehensive molecular information about drugs, targets, targets related to disease, gene function, etc. and can be used to collect targets related to the disease [23][24][25][26]. To maintain the reliability of the target collection, only the targets approved by the FDA in DrugBank, norm fit scores higher than 20 in GeneCards or the species limited to "Homo sapiens" in the NCBI Gene were identified as MAFLD-related targets. Finally, the target names were standardized to the UniProtKB form and duplicates were removed.
Construction of Protein-Protein Interaction (PPI) Network. A PPI network was built and analyzed by Search
Tool for the Retrieval of Interacting Genes (STRING, https://string-db.org/), which can be employed for the system-wide understanding of cellular function between the expressed proteins [27]. After removing the overlap section and standardizing target names, the intersection of bioactive compound-related targets and MAFLD-related targets were uploaded to STRING with limitations to "Homo sapiens" and a confidence score > 0:9. The PPI network was constructed and visualized using Cytoscape 3.7.1, a software that is used for analyzing and visualizing biomolecular interaction networks [28].
Enrichment Analysis and Network
Construction. Database for Annotation, Visualization, and Integrated Discovery (DAVID, https://david.nicifcrf.gov/, version 6.8) was used for enrichment analysis with the screening criteria of P ≤ 0:05 using Bonferroni correction [29]. Furthermore, KEGG Mapper (https://www.genome.jp/kegg/mapper.html) was employed for the analyses of upstream and downstream genes of the key signaling pathway [30,31]. Thereafter, pathways with the top 20 protein numbers were used for the establishment of the compound-target-pathway network by Cytoscape.
2.6. Molecular Docking. Molecular docking was performed with AutoDock Tools [32] (version 1.5.6 http://mgltools .scripps.edu/). The 3D molecular structures of the bioactive compounds were collected from TCMSP in mol2 format and transformed into PDPQT format with AutoDock Tools. Protein Data Bank (PDB, http://www.rcsb.org/) was utilised for the collection of crystal structures of the core targets. AutoDock Tools were further used for removal of water and addition of hydrogen atoms to the crystal structures of core targets and saved as PDPQT format. Molecular docking between the bioactive compounds and core targets was performed with AutoDock. Finally, the binding pattern with the lowest binding energy was selected for further analysis.
Journal of Diabetes Research
The interactions between the bioactive compounds and the core targets were visualized as 3D diagrams using PyMol 1.8.
Bioactive Compounds in EZP.
There were 166 compounds of EZP retrieved from TCMSP, including 47 in EH, and 119 in LLF, and 5 overlapping compounds were removed, resulting in 161 identified compounds. Finally, 20 bioactive compounds were identified after ADME screening with OB ≥ 30% and DL ≥ 0:18, 13 in LLF and 9 in EH (2 were duplicated and therefore removed). This is illustrated in Table 1. Some compounds that were removed after ADME screening have been identified as the main compounds of EZP in previous studies [33,34]. Therefore, oleanolic acid, salidroside, and specnuezhenide were identified as bioactive compounds.
Potential Target Prediction for Bioactive Compounds of EZP.
To identify potential targets of the 23 bioactive compounds, Swiss Target Prediction, PharmMapper, and Target-Net were used to predict the bioactive compounds' targets. There were 306 targets from PharmMapper (norm fit > 0:6), 156 targets from TargetNet (probability > 0:8), and 102 targets from Swiss Target Prediction (probability > 0:8) as shown in Figure 1(a). Finally, 30 targets were shared by all three databases, 72 targets were shared with Swiss Target Prediction and PharmMapper, and 18 targets were shared with Pharm-Mapper and TargetNet (Figure 1(b)). After removal of duplicates, 414 targets were identified as potential targets of EZP Journal of Diabetes Research for subsequent analysis. Detailed information on EZP-related targets is shown in Table S1.
3.3. Identification of Targets Related to MAFLD. DrugBank, NCBI Gene, GeneCards, and OMIM were used to identify targets related to MAFLD. There were 313 targets from DrugBank, 161 targets from the NCBI Gene, 219 targets from GeneCards, and 149 targets from OMIM. After removal of duplicate targets, 691 targets were identified as potential therapeutic targets of MAFLD (Figure 2(b)). When overlapped with 414 targets of the EZP-related targets, 107 targets were found at the intersection of EZP-related targets and MAFLD-related targets (Figure 2(a)). Detailed information on MAFLD-related targets is presented in Table S2.
Protein-Protein Interaction Network. STRING and
Cytoscape were used to analyze the interaction between the 107 common targets. The common targets were uploaded to STRING with limitation to "Homo sapiens" and a confidence score > 0:9. Then, the PPI network was established and visualized by Cytoscape 3.7.1 (Figure 3), which has 82 nodes and 247 edges. Network analyzer was used to calculate topological parameters of the PPI network for identifying the hub nodes and essential targets. In Figure 3, the size and color of the node were used to describe the topological parameters of the targets. The nodes with a larger degree were described by a larger size, and the nodes with bigger between centrality were described by a darker color. The overlap of the top 20 targets of degree, between centrality and closeness centrality, LCK, MAPK8, AKT1, RXRA, PIK3R1, SRC, RELA, ESR1, NOS2, and TNF were identified as hub nodes and essential targets of the PPI network. Non-alcoholic fatty liver disease (NAFLD) Table S3.
Construction of Compound-Target-Pathway Network.
According to the GO and KEGG pathway enrichment results, a compound-target-pathway network was established by Cytoscape ( Figure 5). The compound-target-pathway network included 150 nodes and 1141 edges, circles represent bioactive components from EZP, green circles represent bioactive components from LLF, yellow circles represent bioactive components from EH, red circles represent duplicated components of EH and LLF, blue hexagons represent putative targets, and orange V shapes represent the top 20 pathway. In the compound-target-pathway network, 11 compounds had a higher than average degree, which showed that they played a pivotal role in the network. The 11 core compounds were MOL005195, MOL000098, MOL001790, MOL000006, MOL005146, MOL005211, MOL005209, MOL005147, MOL005188, and MOL002929. Targets are bridges between compounds and pathways. The interaction of the top 20 targets of the PPI network and the compound-target-pathway network was identified as core targets, which means that they play an essential role in both PPI network and compound-target-pathway network. Finally, nine targets, MAPK8, EGFR, AKT1, SRC, ESR1, RELA, RAC1, IGF1R, and PIK3R1 were identified as core targets.
Molecular Docking.
Docking studies were carried out between 11 core compounds and 9 core targets to test the reliability of the drug-target interaction. These targets were chosen as core targets because they play an essential role in the top 20 KEGG pathway, but they were also core targets of the PPI network, which means that these targets may be the center of the regulatory network of EZP against MAFLD. The binding energy and grid box are shown in Table 2. The results showed that there was a stronger interaction between MOL000006, MOL000098, MOL001790, MOL005160, MOL005188, and MOL005209 and core targets. The binding energy of some docking pattern was even lower than that of the original ligand, such as MOL000006 binding with MAPK8 and MOL001790 binding with EGFR and MOL005209 binding with RELA. Figure 6 shows the docking patterns of bioactive compounds interacting with core targets in the lowest binding energy illustrated by PyMol, and the hydrogen bond is showed by a yellow imaginary line. The results showed that MOL000006 and MOL001790 have the lowest binding energy with 3 of the 9 core targets; MOL005169, MOL005188, and MOL005209 have the lowest binding energy with 1 of the 9 core targets, which means that these five compounds may have more important functions in the regulatory network of EZP against MAFLD.
Discussion
In this study, the mechanism and bioactive compounds were investigated using a bioinformatics method to investigate the hepatoprotective effects of EZP. The results showed that 83 pathways and 72 biological processes were involved. According to the topological parameters of the compoundtarget-pathway network and the PPI network, 11 bioactive Journal of Diabetes Research Journal of Diabetes Research compounds and 9 core targets were identified. Finally, molecular docking was used to test the reliability of the drug-target interaction. The experimental flow is shown in Figure 7. This study could provide a better understanding of the hepatoprotective effect of EZP against MAFLD in a multicomponent and multitarget manner, which provides further insights for exploring the hepatoprotective mechanism of EZP.
In clinical treatment, EZP is administered orally. Hence, ADME-related paraments OB and DL were used for screening potential bioactive compounds of EZP. Then, the degree of potentially bioactive compounds of the compound-targetpathway network higher than average was used for a second screening. Eleven bioactive compounds were identified from EZP. To ensure the reliability of the target prediction, three different target identification databases and three multiple information sources were used to predict related targets. The PPI network and compound-target-pathway network were used to identify core targets of the regulatory network of EZP against MAFLD. The interaction of the top 20 targets of the PPI network and compound-target-pathway network was identified as a core target. Nodes with a high degree often play an essential role in the network. Core targets' degrees were higher in the PPI network and the compound-target-pathway network. This means that core targets were essential in the regulatory network of EZP against MAFLD.
The pathological mechanisms of MAFLD are complicated [35]. At present, it is a widely accepted theory that the capacity of the liver to handle the primary metabolic energy is overwhelming leading to accumulation of toxic lipid species that induce hepatocellular stress, injury, and death [35][36][37]. When the liver cannot handle excessive fatty acids, the excess may serve as substrates, leading to generation of lipotoxic species which would provoke ER stress and hepatocellular injury [38]. Hence, regulating fatty acid metabolism and declining hepatocellular stress, injury, and death induced by toxic lipid species are two aspects of MAFLD therapeutic strategies.
Nine core targets, MAPK8, EGFR, AKT1, SRC, ESR1 RELA, RAC1, IGF1R, and PIK3R1, were identified for molecular docking with 11 bioactive compounds. The results showed that the bioactive compounds of EZP have good affinity for nine core targets. These core targets play essential roles in the pathophysiology of MAFLD. The hsa04151: PI3K-Akt signaling pathway, in which AKT1 plays a pivotal role, was a significant result of KEGG pathway enrichment. This pathway has been proved to be closely related to the hepatoprotective effect of EZP via inhibition of hepatocyte apoptosis [39]. MAPK8 also acts a pivotal part of the development of MAFLD. During inflammation postreceptor insulin signaling is significantly impaired by MAPK8, which leads to the production of toxic lipid species and hepatocyte injury [40].
Metabolic syndrome (MetS) is the strongest risk factor for MAFLD. Among the MetS, diabetes is the clearest biological factor associated with MAFLD and 75% of patients with type 2 diabetes have MAFLD [41]. Figure 4 shows the 16 targets involved in hsa04931: Insulin resistance. Insulin resistance is a common feature of MAFLD and leads to improper release of fatty acids further impairing insulin signaling throughout the body [42]. Molecular docking also showed that the binding energy of bioactive compounds of EZP (except lucidusculine and olitoriside with IGF1R) was lower than -5 kcal/mol, suggesting that the bioactive compounds of EZP may exert anti-MAFLD effects by insulin resistance. Figure 4 is a representation of 14 targets involved in hsa04932: Nonalcoholic fatty liver disease, which shows a stage-dependent progression of NAFLD. As shown in Figure 8, all 14 targets, marked with stars, play important roles in the progress of MAFLD, both in excess lipid accumulation and production of reactive oxygen species (ROS). This further leads to cytokine production, cell death promotion, inflammation and fibrosis. There were 14 targets enriched in hsa04932 including TNF, CASP3, MAPK, PPARA, RELA, and AKT1. These targets all play important roles in promoting cell death, inflammation, and fibrosis [43,44], meaning that EZP may exert anti-MAFLD by these targets.
Conclusion
Overall, this study provides a theoretical basis for EZP exertion of an anti-MAFLD effect through a multicomponent, multitarget, and multipathway manner. In addition, we screened the bioactive compounds of EZP and tested them by molecular docking, providing a further understanding to explore the hepatoprotective mechanisms of EZP.
Data Availability
The data used to support the findings of this study are available from the corresponding author upon request.
Disclosure
The author reports no conflicts of interest in this work.
Conflicts of Interest
The authors declare that they have no conflicts of interest. Table S1: putative targets for bioactive compounds contained in EZP. There were 306 targets from PharmMapper, 156 targets from TargetNet, and 102 targets from Swiss Target Prediction. Table S2: targets related to NAFLD. Detailed information of targets related to NAFLD; there were 313 targets were from DrugBank, 161 targets from NCBI Gene, 219 targets from GeneCard, and 149 targets from OMIM. | v3-fos-license |
2021-09-27T20:05:41.124Z | 2021-08-07T00:00:00.000 | 238770759 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/2673-4176/2/3/39/pdf",
"pdf_hash": "b02c92113ccee69e8ca339b1aa3a608a09be2b72",
"pdf_src": "Adhoc",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119188",
"s2fieldsofstudy": [
"Materials Science"
],
"sha1": "fd2b19de843a7690e1730e3e8d9ef94a1f53ebb4",
"year": 2021
} | pes2o/s2orc | Rheological Characterization of the Influence of Pomegranate Peel Extract Addition and Concentration in Chitosan and Gelatin Coatings
: In this study, the effects of an agro-industrial residue with active properties, pomegranate peel extract (PPE), were evaluated on the rheological properties of potential coatings based on chitosan (C) and gelatin (G). For this, rheological properties of the polymeric solutions were investigated in relation to PPE concentration (2 or 4 mg PPE g − 1 solution), and to its incorporation order into the system (in C or in CG mixture). All solutions were more viscous than elastic (G (cid:48)(cid:48) > G (cid:48) ), and the change in PPE concentration had a greater influence accentuating the viscous character of the samples in which PPE was added to the CG mixture (CGPPE2 and CGPPE4). PPE addition to the CG mixture increased the angular frequency at the moduli crossover, indicating the formation of a more resistant polymeric network. This tendency was also observed in flow results, in which PPE addition decreased the pseudoplastic behavior of the solutions, due to a greater cross-linking between the polymers and the phenolic compounds. In general, all the studied solutions showed viscosities suitable for the proposed application, and it was possible to state the importance of standardizing the addition order of the components during the preparation of a coating. at the moduli crossover, indicating the formation of a more intricate polymeric network. Temperature also affected the viscoelastic behavior of the samples, with CGPPE4 being the only solution with a different profile of increasing the moduli at temperatures above 65 ◦ C. Finally, the flow tests evidenced the influence of PPE in decreasing the pseudoplastic behavior of the polymeric solutions, making them more resistant to the applied shear. The results of this study contribute to the in-depth understanding of the molecular relationships between a polysaccharide, a protein, and phenolic compounds in the prepared coating solutions, and how these relationships can be related to the intended application for the materials.
Introduction
The search for edible food coatings that are biodegradable, non-toxic, and that have active properties has been increasing in recent years, aiming to extend the shelf life of foods while preserving their sensory characteristics and improving consumer safety [1,2]. In the literature, there is an increasing number of studies that evaluate the most diverse polymers, natural or synthetic, and their physical-chemical, structural, and active properties in foods. In these studies, polysaccharides stand out as one of the groups of polymers that are most applied for coating purposes, due to their attractive properties of brightness, transparency, flexibility, barrier to the passage of water and gases, antimicrobial activity, among others [3].
Chitosan is a polysaccharide derived from the partial deacetylation of the chitin found in the exoskeleton of crustaceans and insects, as well as in the structure of mollusks and fungi [4]. Its cationicity, biodegradability, non-toxicity, and its filmogenic and antimicrobial properties make chitosan one of the most studied polysaccharides for the development of edible coatings [5,6]. To improve the mechanical and barrier properties of chitosan-based coatings, the association of this polysaccharide with other natural polymers, such as gelatin, is commonly evaluated [7]. Obtained by the partial hydrolysis of collagen, this protein is well-used in the food industry as a thickening and emulsifying agent, and several studies already successfully applied a combination of chitosan and gelatin for edible coating development [8][9][10][11].
Furthermore, studies on food coatings aim to develop materials with active properties, which can also protect the food to be coated from oxidation by light, or which
Materials
All solvents and reagents used were PA grade and used as such. Chitosan was obtained from the partial deacetylation of β-chitin, found in the squid pens of Doryteuthis spp., obtained from Miami Comércio e Exportação de Pescados Ltd.a in Cananéia city-Sao Paulo State, Brazil. Gelatin was commercial (Sigma-Aldrich ® , St. Louis, MO, USA), type A, swine, with approximately 300 bloom. The red pomegranates (Punica granatum L.) used (Peruvian variety) were purchased at the Supply Centers of Campinas-S.A (CEASA, Campinas city-SP, Brazil) in February, 2019. Before extraction, the fruits were peeled, and their peels were sanitized with 2% (v/v) sodium hypochlorite, dried at room temperature under air flow for 2 h, frozen in the freezer and lyophilized for 16 h (Edwards equipment, model Freeze Dryer Modulyo, Burgess Hill, West Sussex, United Kingdom). Finally, they were crushed to obtain a thin powder, which was stored in polypropylene flasks under refrigeration and protected from light until use. The time between extraction and experiments was not longer than one month.
Chitosan Obtention and Characterization
Chitosan was obtained by the partial deacetylation process, to which the β-chitin extracted from squid pens was submitted, a procedure described by Horn et al. (2009), which involves the conversion of the acetoamide groups from the (1,4)-N-acetyl-D-glucos-2-amine chains of β-chitin to amino groups, in a basic medium (40% NaOH (v/v), constant stirring for 3 h at 80 • C, under N 2 flow) [15]. The obtained powder was characterized by its viscosimetric molar mass, being classified as chitosan of high molar mass (300 kDa); its degree of acetylation of 11.1% was determined by nuclear magnetic resonance spectroscopy ( 1 H NMR) [16,17].
Pomegranate Peel Extraction and Characterization
The pomegranate peel extract (PPE) was obtained according to the procedure described by Bertolo et al. (2020) [9]. The powder obtained after crushing the dried peels was added to a 60% (v/v) hydroethanolic solution, in the proportion of 1 g of pomegranate peel powder to 30 g of hydroethanolic solution. The extraction took place at 50 • C, for 1 h, under slow and constant stirring. Then, the solution was filtered through a filter paper (Whatman, n. 1), and the ethanol was removed slowly by evaporation. Finally, the extract was lyophilized to obtain a dry powder.
PPE was characterized in terms of its total phenolic content. For this, the Folin-Ciocalteu colorimetric method was adopted, with a procedure adapted for a 96-well microplate [18]. Gallic acid (Sigma-Aldrich ® , St. Louis, MO, USA) was used as the standard molecule for the construction of the method's calibration curve, from eight aqueous solutions with concentrations of 4,8,12,16,20,24,28, and 32 µg mL −1 . In the microplate wells, 50 µL of PPE solution (0.1 mg mL −1 ) and 50 µL of Folin's reagent were placed. After stirring and 5 min of reaction, 200 µL of a 20% sodium carbonate solution (w/w) was added to each well, followed by further stirring. All samples were taken in triplicate. After 15 min, the absorbance of the samples was read at 725 nm on a Thermo Scientific ™ UV-Vis spectrophotometer VL0L00D0 (Waltham, MA, USA). The 60% (v/v) hydroethanolic solution was used as the blank extract.
Coating Preparation
The 1% (w/w) initial solutions of chitosan (C) and gelatin (G) were prepared as follows: chitosan was dissolved in a 1% lactic acid solution (w/w), by slow and constant stirring for 24 h; gelatin was dissolved in water at 60 • C for 30 min, and its gelation was carried out under refrigeration for 2 h. The CG control sample (that is, without PPE) was prepared by mixing the polymers in the proportion of 1:1 at 45 • C for 2 h, with the addition of 1 mL of a 50% hydroethanolic solution (v/v), in order to maintain the concentration in relation to the other samples to be prepared.
Then, the incorporation of PPE into chitosan/gelatin solutions took place. For this, 2 different concentrations of a hydroethanolic solution (50%, v/v) of extract, 100 and 200 mg mL −1 , were prepared. To incorporate these solutions, two additional orders were tested: (1) Addition of 1 mL of PPE to C, followed by the mixture of G (CPPE2G and CPPE4G samples); (2) Mixture of C and G, followed by the addition of 1 mL of PPE (CGPPE2 and CGPPE4 samples).
The PPE addition order to the polymeric system was changed to evaluate how the phenolic hydroxyls of the PPE components would interact with the protonated amino groups (NH 3 + ) of chitosan, in the presence (CG mixture) or in the absence (C solution) of gelatin. This protein has carboxylic groups of its amino acids responsible for the formation of the polymeric network by electrostatic interaction with chitosan (please see the GA of our previous work [7]). Thus, different orders of PPE addition to the system can lead to different rheological responses, due to the greater or lesser degree of interaction between the polymers, as well as between the polymers and the extract. Regardless of the PPE order of addition, the proportion adopted was that of 1 mL of extract for each 50 g of mixture of chitosan and gelatin. Thus, the final concentrations of PPE in the polymeric mixture were 2 mg PPE g −1 mixture (for CPPE2G and CGPPE2 samples) and 4 mg PPE g −1 mixture (for CPPE4G and CGPPE4 samples).
All the prepared solutions (the controls C, G, and CG, as well as those containing pomegranate peel extract, PPE) presented a homogeneous aspect, without the presence of precipitates, and with varied yellow coloration, according to the extract concentration and its order of addition to the system.
Rheological Measurements
The rheological study was carried out with the samples CPPE2G, CPPE4G, CGPPE2, CGPPE4, CG, and with the 1% chitosan solution (C). An AR-1000 N controlled stress rheometer (TA Instruments, New Castle, DE, USA) was used, with a cone/plate geometry of stainless-steel of 20 mm in diameter, at 2 • angle, and a fixed gap of 69 µm. The temperature was controlled with a Peltier system, and all the measurements described below were performed in triplicate. For all measurements (strain, frequency, temperature sweep, and steady shear), the prepared solutions (in the final state of a gel) were stored under refrigeration in the dark until analysis. After stabilizing the temperature of the solutions to room temperature, they were placed on the Peltier plate of the rheometer, and their excess was removed after setting the zero gap of the equipment.
Strain Sweep Measurements
Fixed values of temperature (25 • C) and frequency (1.0 Hz) were adopted in an amplitude range of 0.05 to 500 Pa, to determine the linear viscoelastic region (LVR) of the coating solutions, that is, the strain range in which their elastic (G ) and viscous (G ) moduli do not change. The software Rheology Advantage Data Analysis, version V5.7.0 (TA Instruments Ltd., New Castle, DE, USA) was employed to analyze the parameters obtained from strain sweep measurements, which were: G LVR , the elastic modulus at the end of LVR; γ L , the maximum strain value to which the solution can be submitted before their moduli start to decrease; tanδ, the ratio between G and G ; and G -G , the difference between the moduli at 10% of strain.
Frequency Sweep Measurements
For frequency sweep measurements, a frequency range from 0.1 to 100 rad s −1 was adopted, at fixed values of temperature (25 • C) and strain (10% in the LVR). The behavior of G and G , according to the increase in frequency, was analyzed in terms of G crossover and ω crossover , that is, G and frequency values where G = G .
Temperature Sweep Measurements
G and G behavior was also evaluated, according to temperature sweep tests, performed from 25 to 75 • C, at 5 • C min 1 , 1.0 Hz of frequency, and 10% of strain.
Steady Shear Measurements
Finally, flow measurements were conducted at 25 • C, with a range and shear rate of 0.1 to 1000 s −1 . The viscosity behavior of the solutions was characterized as Newtonian or pseudoplastic, according to PPE addition concentration. The experimental curves of viscosity were fitted according to the Cross model (Equation (1).
In Equation (1), η 0 is the zero-shear viscosity (Pa s), η∞ is the viscosity limit at infinite shear (Pa s), γ is the shear rate (s −1 ), k is the so-called consistency index (s), and n the rate index (dimensionless).
Statistical Analysis
The Software Action (Estatcamp Team, 2014,São Carlos-SP, Brazil) was used for the statistical analysis of the data. The Shapiro-Wilk test was applied to verify data distribution. Parametric rheological results were examined using analysis of variance (ANOVA), followed by Tukey's test. Non-parametric rheological results were examined using Kruskal-Wallis test. Significance level was set at equal or higher than 5% in all cases.
Pomegranate Peel Extraction and Characterization
After the extraction process to which the pomegranate peels were subjected, and the lyophilization of the extract, a thin, dry, and yellowish powder was obtained, with a yield of 54.5%. Its total phenolic content (TPC), determined by the Folin-Ciocalteu method, was 213 ± 6 mg gallic acid equivalent (GAE) g −1 extract. This result is consistent with that found by Derakshan et al. (2018), who analyzed the TPC of extracts from the peel and the seed of three different types of pomegranates, finding a range of 276-413 mg EAG g −1 for the peel extracts [19]. Bertolo et al. (2020), in a previous study, determined 492 ± 82 mg GAE g −1 extract, using a yellow pomegranate of Brazilian variety [9]. It is worth mentioning that the variations observed in the TPC of different phenolic extracts are related to the most diverse factors: from intrinsic ones, such as the origin of the fruit and its harvest time, to extrinsic factors, such as the method of extraction adopted, the time of extraction, and the solvents used.
Rheological Measurements Strain Sweep Measurements
Initially, the sweep tests of the elastic (G ) and viscous (G ) moduli of the material were performed as a function of the percentage of deformation, essential for determining the linear viscoelastic region of the solutions (LVR) where loss and storage moduli (G and G , respectively) are practically constant, regardless of the applied deformation. [14] The extent of the LVR can be directly related to the structural strength of the material: solutions that are more resistant to the applied deformation tend to have a more extensive LVR, requiring greater values of deformation for the moduli to cease stability and start to decrease [7,14].
As can be seen in the graphs of Figure 1, divided into A and B according to the order of addition of PPE in the polymeric solutions, all samples showed G > G , which indicates that their viscous behavior exceeded the elastic behavior, regardless of the addition of the extract or its concentration, a typical liquid-like behavior [7,9,10,20]. From the curves in Figure 1, it was possible to determine the parameters presented in Table 1: the first, γ L , represents the highest strain value to which the solution could be subjected, before leaving the LVR; the higher this value, the greater the resistance offered by the sample to the applied deformation. It can be said that the addition of gelatin to sample C led to a significant decrease in γ L , from 48.87 ± 3.24% in C to 40.78 ± 0.32% in CG, an indication that the incorporation of gelatin and its interaction with the polymer chains of chitosan can make the polymeric system less resistant to the applied deformation.
However, the addition of PPE in CGPPE2 and CGPPE4 solutions led to an increase in their critical deformation, to values significantly equal to the original chitosan solution, not influenced by the concentration of the extract. Similar results were found by Bertolo et al. (2020) when analyzing chitosan and gelatin systems incorporated with grape seed extracts. The addition of gelatin led to a decay of the critical deformation of chitosan, and the concentration of the added phenolics changed this parameter significantly. Lower concentrations promoted greater stability for the solutions [7]. Finally, for the samples in which PPE was initially added to C, the incorporation of the extract did not significantly alter γ L , and the subsequent addition of gelatin did not promote the effect observed in the other samples, by decreasing the critical strain. However, the addition of PPE in CGPPE2 and CGPPE4 solutions led to an increase in their critical deformation, to values significantly equal to the original chitosan solution, not influenced by the concentration of the extract. Similar results were found by Bertolo et al. (2020) when analyzing chitosan and gelatin systems incorporated with grape seed extracts. The addition of gelatin led to a decay of the critical deformation of chitosan, and the concentration of the added phenolics changed this parameter significantly. Lower concentrations promoted greater stability for the solutions [7]. Finally, for the samples in which PPE was initially added to C, the incorporation of the extract did not significantly alter γL, and the subsequent addition of gelatin did not promote the effect observed in the other samples, by decreasing the critical strain.
Even though γL did not undergo significant changes with the incorporation of PPE into the system, the second parameter in Table 1, G'LVR, showed more pronounced variations: the value of the elastic modulus of the solutions at the limit of LVR suffered an abrupt decrease from 22.80 ± 1.49 Pa to 4.27 ± 0.45 Pa from C to CG. The decay trend continued with the incorporation of PPE into the system, regardless of its concentration or order of addition. The third parameter in Table 1, tanδ, is the ratio between the viscous and elastic moduli at the LVR limit, and allows particularly important rheological classifications of the material: if tanδ > 1, G'' > G' and the samples are classified as viscous; the opposite is also valid, and if tanδ < 1, the elastic character predominates. However, if tanδ > 0.1, the behavior of the samples is situated between that of a highly concentrated polymeric solution and that of a real gel [20]. In the samples of this study, tanδ varied between Even though γ L did not undergo significant changes with the incorporation of PPE into the system, the second parameter in Table 1, G LVR , showed more pronounced variations: the value of the elastic modulus of the solutions at the limit of LVR suffered an abrupt decrease from 22.80 ± 1.49 Pa to 4.27 ± 0.45 Pa from C to CG. The decay trend continued with the incorporation of PPE into the system, regardless of its concentration or order of addition. The third parameter in Table 1, tanδ, is the ratio between the viscous and elastic moduli at the LVR limit, and allows particularly important rheological classifications of the material: if tanδ > 1, G > G and the samples are classified as viscous; the opposite is also valid, and if tanδ < 1, the elastic character predominates. However, if tanδ > 0.1, the behavior of the samples is situated between that of a highly concentrated polymeric solution and that of a real gel [20]. In the samples of this study, tanδ varied between 1.32 ± 0.02 (C) and 2.33 ± 0.06 (CGPPE4), which classifies them as being highly concentrated polymeric solutions, with a predominant viscous character, as had already been observed in the curves of Figure 1.
The incorporation of gelatin in CG increased tanδ value from 1.32 ± 0.02 to 1.68 ± 0.06, reflecting the decrease observed in G LVR for that same sample; the incorporation of PPE into CG mixture led to values greater than two for tanδ, indicating that the incorporation of the extract accentuated the viscous character of the solutions; when doubling the PPE concentration from CGPPE2 to CGPPE4, tanδ increased significantly from 2.05 ± 0.11 to 2.33 ± 0.06. The same effect of the incorporation of PPE is valid for the samples CPPE2G and CPPE4G, with tanδ values also greater than two, but without significant changes observed when the concentration of the extract was doubled. Despite the proportion between the polymers prepared by Bertolo et al. (2020) being different (2:1), they obtained similar tanδ results for their solutions, ranging from 1.25 ± 0.16 for the sample without PPE, to 2.59 ± 0.12 for the sample with one of the highest concentrations of PPE [9]. Their results agree with the results of this study, reinforcing the tendency of phenolic compounds to increase the viscous character of the solutions.
Finally, to confirm the effects of the incorporation and concentration of PPE in the polymeric system, the difference between G and G at 10% of deformation was calculated (G -G parameter from Table 1); this difference indicates whether the moduli are approaching or moving away, according to the incorporation of the phenolics, and is a new indication of which character is more pronounced. The incorporation of PPE into the CG mixture led to a significant increase in G -G difference from 2.94 ± 0.06 Pa to 3.74 ± 0.07 Pa in CGPPE2, and doubling the concentration in CGPPE4, the difference between the moduli increased to 4.04 ± 0.14 Pa; this result reinforces the effect that had already been observed, that is, that the PPE addition accentuates the viscous character of the solutions, making its difference with the elastic modulus even greater. However, when the order of PPE addition was reversed, this tendency to increase the G -G difference with twice the extract concentration was no longer observed. This result also meets the other parameters analyzed for CPPE2G and CPPE4G samples, by not showing significant differences between them, and by not following the trends observed for CGPPE2 and CGPPE4. Furthermore, these samples indicate that the addition of the extract in high concentrations to chitosan, for later mixing with gelatin, may be saturating the binding sites and making the formation of the polymeric network more difficult. Thus, even if the PPE concentration in the system is doubled, the changes observed are not as significant as those obtained in the other order of addition (Table 1).
Frequency Sweep Measurements
The behavior of G and G moduli was also evaluated in relation to the angular frequency (Figure 2A,B). In all cases, G was predominant over G during a wide sweeping range, occurring in the crossing of the moduli and their inversion in variable angular frequency values, according to the PPE concentration and addition. This fact reinforces the classification of the samples of this study as being concentrated polymeric solutions/weak gels, since G > G at the beginning and the crossover occurred within the frequency range adopted; real gels or diluted polymeric solutions would not have the same profile [12,14]. The values of G crossover and ω crossover , that is, the elastic modulus and the angular frequency at G = G , are reported in Table 2. Chitosan solution (C) was the sample with the lowest ω crossover value (9.99 ± 0.01 rad s −1 ), and the addition of gelatin promoted an increase in that value to 19.98 ± 0.01 rad s −1 in CG, reflecting the effect of gelatin in delaying the inversion between moduli, probably due to the higher number of interactions formed between the polymers in the mixture. The addition of PPE in the CG mixture further increased ω crossover values, reaching 37.04 ± 4.64 rad s −1 in CGPPE4. It is worth mentioning that half of the PPE concentration, in the inverse order of addition (CPPE2G), presented the same crossing frequency value as CGPPE4. Again, the trend observed for CPPE2G and CPPE4G was different from the other samples: in these two cases, twice the extract concentration caused a decline in the angular frequency value to 31.69 ± 0.01 rad s −1 in CPPE4G, which can be another indication that the addition of PPE to chitosan for subsequent mixing of gelatin may make the polymeric network more susceptible to changes.
In relation to the G crossover values, there was a sharp decrease from 41.54 ± 2.97 Pa from C to 14.65 ± 0.78 Pa in CG; the concentration of PPE did not promote significant changes in this parameter, but the samples in which the extract was added to the CG mixture showed, in general, G crossover values slightly higher than the others. Regarding these frequency results, Sun et al. (2020) also evaluated the behavior of G and G as a function of angular frequency for solutions based on glucomannan/carboxymethyl chitosan incorporated with epigallocatechin gallate (EGCG), one of the major phenolic compounds in tea leaves. They concluded that the addition of EGCG in high concentrations increased the values of the G and G moduli at high frequencies, implying the formation of a close non-covalent entangled network between the polymers and the phenolic [2]. Hosseini et al. (2021) reached similar findings when analyzing the dynamic behavior of film forming solutions (FFSs) based on chitosan, polyvinyl alcohol, and fish gelatin, incorporated with cinnamaldehyde. While the FFSs without the phenolic compound showed a liquid-like behavior (G > G ) at low angular frequencies, the elastic behavior (solid-like) was predominant at higher frequency values; however, once cinnamaldehyde was added to the system, the high number of interactions between the oil droplets and the polymers led to an elastic behavior that was 100%prevalent throughout the entire frequency range adopted, given the formation of an elastic solid-state [3].
Temperature Sweep Measurements
In rheological studies involving materials with possible applications such as food coatings, temperature is one of the main factors influencing the viscoelastic behavior that should be studied. In general, it is necessary to predict the behavior of the material (whether it will be more viscous or more elastic, and in what proportion, for example) over a wide range of temperatures, which simulate possible situations of transport, storage, and even cooking of the food to be coated. The graphs in Figure 3A,B represent the variation of G and G moduli for the samples of this study.
(whether it will be more viscous or more elastic, and in what proportion, for example) over a wide range of temperatures, which simulate possible situations of transport, storage, and even cooking of the food to be coated. The graphs in Figure 3A,B represent the variation of G' and G'' moduli for the samples of this study. As observed in the previous tests, G'' > G', confirming once again the predominant viscous character of the samples. With the increase in temperature, both moduli of all samples started to decrease, a typical polymeric behavior. For the chitosan solution (C), it was observed that G'' modulus decreased in a greater proportion than G', going from 26.58 Pa at 25 °C to 5.93 Pa at 75 °C (more than 20 Pa of difference); for G', this difference between the final and the initial modulus values was not greater than 17 Pa (values obtained from the curves in Figure 3).
With the addition of gelatin in CG, although the initial values of both moduli were significantly lower compared to C, the observed trend did not change; the viscous modulus continued to decrease with greater intensity as the temperature rose, reaching values lower than 1 Pa at the end of the test for almost all samples, except for CGPPE4. In this case, from 65 °C onwards, a slight increase was observed for both moduli, indicating a tendency to cross at temperatures higher than 75 °C.
This tendency was not observed for any other sample, regardless of the order of addition or concentration of PPE. This may be related to a greater ease of inversion for elastic behavior at high temperatures, due to the elimination of energized water molecules and As observed in the previous tests, G > G , confirming once again the predominant viscous character of the samples. With the increase in temperature, both moduli of all samples started to decrease, a typical polymeric behavior. For the chitosan solution (C), it was observed that G modulus decreased in a greater proportion than G , going from 26.58 Pa at 25 • C to 5.93 Pa at 75 • C (more than 20 Pa of difference); for G , this difference between the final and the initial modulus values was not greater than 17 Pa (values obtained from the curves in Figure 3).
With the addition of gelatin in CG, although the initial values of both moduli were significantly lower compared to C, the observed trend did not change; the viscous modulus continued to decrease with greater intensity as the temperature rose, reaching values lower than 1 Pa at the end of the test for almost all samples, except for CGPPE4. In this case, from 65 • C onwards, a slight increase was observed for both moduli, indicating a tendency to cross at temperatures higher than 75 • C.
This tendency was not observed for any other sample, regardless of the order of addition or concentration of PPE. This may be related to a greater ease of inversion for elastic behavior at high temperatures, due to the elimination of energized water molecules and the consequent association between polymeric molecules [7,13]. Apparently, the addition of PPE in high concentrations to the polymeric network already formed in CGPPE4 may have facilitated the elimination of water molecules at high temperatures, leading to a rearrangement of chains with a greater increasing tendency of the moduli, which could result in an inversion between them at even higher temperatures. Luciano et al. (2021) analyzed the behavior of the viscous and elastic moduli of polymeric solutions based on gelatin with different concentrations of nisin, an antibacterial peptide, as a function of temperature. Their film-forming solutions showed G > G , and the addition of nisin was able to increase the sol-gel and gel-sol transition temperatures by 4 • C, which occurred around 14-18 • C and 25-29 • C, respectively [21]. In our study, similar transitions were not observed for the solutions containing gelatin, probably due to the high concentration of chitosan and the formation of an intricate polymeric network between the polymers.
In general, we can conclude the discussion of oscillatory rheology results by saying that both factors of concentration and order of addition of PPE contributed to the differences observed in the results of deformation, frequency, and temperature. The viscous and elastic moduli of the samples can be influenced to a greater or lesser extent, according to the highest or lowest concentration of extract, as well as if it was added to the polymeric network already formed or to the chitosan solution first. For CGPPE4 sample, the effects of the highest concentration of PPE were noticeably clear, leading to a sample with a higher viscous character, with inversion between the moduli in higher angular frequency values, and with a possible crossing between them in temperature values lower than the others. Figure 4A,B shows the viscosity curves of the samples as a function of the shear rate; in all cases, a decrease in viscosity was observed according to the increase in shear rate, a typical polymeric behavior known as shear-thinning or pseudoplastic. This behavior is associated with the fact that the polymeric chains orient themselves towards the applied stress, increasing their ordering and, consequently, decreasing viscosity [22].
Steady Shear Measurements
of the highest concentration of PPE were noticeably clear, leading to a sample with a higher viscous character, with inversion between the moduli in higher angular frequency values, and with a possible crossing between them in temperature values lower than the others. Figure 4A,B shows the viscosity curves of the samples as a function of the shear rate; in all cases, a decrease in viscosity was observed according to the increase in shear rate, a typical polymeric behavior known as shear-thinning or pseudoplastic. This behavior is associated with the fact that the polymeric chains orient themselves towards the applied stress, increasing their ordering and, consequently, decreasing viscosity [22]. Knowing the viscosity of the polymeric solution that will act as a coating is extremely important to predict its behavior. In general, we look for samples with intermediate viscosities, which escape from the extremes of high viscosity (which would be an obstacle to coat food by immersion or spray, for example) and low viscosity (which would make it Knowing the viscosity of the polymeric solution that will act as a coating is extremely important to predict its behavior. In general, we look for samples with intermediate viscosities, which escape from the extremes of high viscosity (which would be an obstacle to coat food by immersion or spray, for example) and low viscosity (which would make it difficult to spread the solution over the food surface, due to its dripping effect). The literature points to viscosities in the range of 1-10 Pa s as being suitable for experimental coating processing conditions [23].
Steady Shear Measurements
As can be seen in Table 3, the adjustment of the viscosity data with the Cross model allowed for the identification of some important parameters. The first one is η 0 , the initial viscosity of the solutions at zero shear rate, when the polymeric molecules are still randomly oriented, except for sample C, which had the highest initial viscosity value (η 0 = 14.90 ± 1.27 Pa·s). All samples containing gelatin and/or PPE showed viscosities between 1.92 and 2.85 Pa s, an indication that all of them are suitable for the proposed application. Although no significant differences were observed (p < 0.05), according to the addition of PPE or its concentration, some trends can be elucidated. The addition of PPE to the polymeric network already formed in CG tended to decrease its viscosity, probably due to the interaction of the extract in the active sites that had not yet been occupied by the polymers. The increase in its concentration in CGPPE4 followed the same decreasing tendency, with a viscosity of 2.05 ± 0.18 Pa s. In the samples in which PPE was initially added to chitosan, η 0 values were slightly lower than 2 Pa s, and CPPE4G showed the lowest viscosity value among all samples, of 1.92 ± 0.14 Pa s.
The second parameter presented in Table 3 is k, the so-called consistency index: the lower k, the greater the Newtonian plateau of the sample before its pseudoplastic behavior begins, that is, the greater the value of the critical shear rate necessary for the sample viscosity starts to decrease [14]. Sample C was the one with the highest k value (0.212 ± 0.020 s), and the addition of gelatin in CG decreased this value to 0.119 ± 0.004 s. This indicated that the formation of the polymeric network tended to better stabilize the polymeric chains, making them most resistant to applied shear and slowing the decline in viscosity. The k index continued to decrease with the addition of PPE and the increase in its concentration, with CGPPE4 sample having the lowest k (0.056 ± 0.001 s) and, therefore, being the most resistant to shear. For CPPE2G and CPPE4G samples, twice the PPE concentration did not significantly change k, and the values remained between 0.066 and 0.069 s. Finally, the last parameter, n, the rate index, represents the dependence of viscosity in relation to the shear rate: samples with values of n between zero and one are considered pseudoplastic, while values of n greater than one characterize Newtonian samples [24]. For the samples in this study, n varied from 0.744 (CGPPE2 and CPPE2G) to 0.800 (C), which reinforces the pseudoplastic behavior of all of them, and indicates that the addition of PPE promotes a slight decline in it. The results found here for k and n parameters agree with that observed by Tudorache & Tordenave (2019). They analyzed the pseudoplastic behavior of different polysaccharides (β-glucan, xanthan gum, and guar gum) complexed with phenolic compounds (vanillin, ferulic acid, acid caffeine, among others); in all cases, the addition of phenolics also caused a decline in the pseudoplastic behavior of the samples. At a molecular level, these results can be interpreted in view of the weak associations existing between the polymeric chains, which flow easily upon shearing, presenting pseudoplastic behavior. Once the phenolic compounds are added, they mediate a stronger cross-linking between the polymeric molecules, making them more resistant to the applied shear, which explains the accentuation of the Newtonian behavior for samples containing PPE [25]. Rodrigues et al. (2020) also evaluated the rate index of solutions based on chitosan and gelatin incorporated with extracts of grape seed and jaboticaba peel; in their case, it was possible to observe a decline in the values of n (and a consequent decrease in the pseudoplastic behavior) only for the highest concentrations of extract (5 mg g −1 mixture) when added to the mixture of chitosan and gelatin already formed. In this sense, PPE was able to promote more marked changes in the behavior of the polymeric system, even in lower concentrations [10].
Thus, it can be said that the rheological results of flow agree with the oscillatory results previously discussed for the samples of chitosan and gelatin with pomegranate peel extract. It was observed that the order of addition of PPE to the polymeric matrix is a parameter to be standardized during the formulation of new coatings, since it is able to change their rheological characteristics. The concentration of PPE was again a factor of great influence, especially for the samples in which the extract was added to the polymeric network already formed by CG.
Conclusions
PPE incorporation into chitosan and gelatin coatings affected both oscillatory and flow properties. The effects of PPE concentration were more accentuated when it was added to the CG mixture, indicating that the other addition order evaluated may have led to a possible saturation of chitosan binding sites, making it difficult for this polysaccharide to form a polymeric network with the subsequent incorporation of gelatin. The viscous character of the solutions was accentuated with higher concentrations of PPE. CGPPE4 solution showed the highest tanδ value, as well as higher angular frequency and G values at the moduli crossover, indicating the formation of a more intricate polymeric network. Temperature also affected the viscoelastic behavior of the samples, with CGPPE4 being the only solution with a different profile of increasing the moduli at temperatures above 65 • C. Finally, the flow tests evidenced the influence of PPE in decreasing the pseudoplastic behavior of the polymeric solutions, making them more resistant to the applied shear. The results of this study contribute to the in-depth understanding of the molecular relationships between a polysaccharide, a protein, and phenolic compounds in the prepared coating solutions, and how these relationships can be related to the intended application for the materials. | v3-fos-license |
2020-10-15T13:05:32.192Z | 2020-10-01T00:00:00.000 | 222352220 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/1420-3049/25/20/4592/pdf",
"pdf_hash": "cbbfa0b43beedbf2610c4416c2a488fa818ec11b",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119255",
"s2fieldsofstudy": [
"Medicine",
"Environmental Science",
"Biology"
],
"sha1": "6adc4151193f450b27a7701876a8f08d7e1ed266",
"year": 2020
} | pes2o/s2orc | Water Extract of Lotus Leaf Alleviates Dexamethasone-Induced Muscle Atrophy via Regulating Protein Metabolism-Related Pathways in Mice
Muscle atrophy is an abnormal condition characterized by loss of skeletal muscle mass and function and is primarily caused by injury, malnutrition, various diseases, and aging. Leaf of lotus (Nelumbo nucifera Gaertn), which has been used for medicinal purposes, contains various active ingredients, including polyphenols, and is reported to exert an antioxidant effect. In this study, we investigated the effect of water extract of lotus leaf (LL) on muscle atrophy and the underlying molecular mechanisms of action. Amounts of 100, 200, or 300 mg/kg/day LL were administered to dexamethasone (DEX)-induced muscle atrophy mice for 4 weeks. Micro-computed tomography (CT) analysis revealed that the intake of LL significantly increased calf muscle volume, surface area, and density in DEX-induced muscle atrophy mice. Administration of LL recovered moving distance, grip strength, ATP production, and body weight, which were decreased by DEX. In addition, muscle damage caused by DEX was also improved by LL. LL reduced the protein catabolic pathway by suppressing gene expression of muscle atrophy F-Box (MAFbx; atrogin-1), muscle RING finger 1 (MuRF1), and forkhead box O (FoxO)3a, as well as phosphorylation of AMP-activated kinase (AMPK). The AKT-mammalian target of the rapamycin (mTOR) signal pathway, which is important for muscle protein synthesis, was increased in LL-administered groups. The HPLC analysis and pharmacological test revealed that quercetin 3-O-beta-glucuronide (Q3G) is a major active component in LL. Thus, Q3G decreased the gene expression of atrogin-1 and MuRF1 and phosphorylation of AMPK. This compound also increased phosphorylation levels of mTOR and its upstream enzyme AKT in DEX-treated C2C12 cells. We identified that LL improves muscle wasting through regulation of muscle protein metabolism in DEX-induced muscle atrophy mice. Q3G is predicted to be one of the major active phenolic components in LL. Therefore, we propose LL as a supplement or therapeutic agent to prevent or treat muscle wasting, such as sarcopenia.
Introduction
Muscle atrophy, also known as muscle wasting, refers to a condition in which skeletal muscle mass is lost and is mainly accompanied by impairment of physical activity due to abnormal weakness in muscle strength and function [1]. Muscle atrophy can be caused by various diseases or conditions, such as disuse from illness or injury, malnutrition, diabetes, cachexia associated with certain systemic diseases (e.g., cancer, congestive heart failure, and chronic obstructive pulmonary disease), side effects from pharmaceutical therapy, and aging [2,3]. Reduced muscle mass and function from muscle atrophy increase morbidity and mortality. For example, loss of muscle mass is clinically related to poor prognosis and resistance to pharmaceutical treatment in cancer patients [4]. In addition, loss of muscle mass can result in frequent falls and decreased ability to walk, thereby reducing the quality of life [2]. Therefore, preventing or delaying the onset of muscle atrophy is important. However, an effective treatment for muscle atrophy is lacking [5].
Muscle atrophy is caused by various pathological molecular mechanisms. An imbalanced muscle protein metabolism has been suggested as a pivotal reason for the onset of muscle atrophy [1,2]. Proteins in skeletal muscle are constantly synthesized and degraded. However, muscle loss occurs when the decomposition rate exceeds the synthesis rate. Muscle atrophy F-Box (MAFbx, also known as atrogin-1) and muscle RING finger 1 (MuRF1) have been reported as key regulators in the process of muscle protein breakdown. These enzymes are E3 ubiquitin ligases that are expressed in skeletal muscle and control the degradation of target proteins by promoting polyubiquitination-mediated proteolysis by the 26S proteasome [6,7]. In a rodent model of muscle atrophy, the expressions of atrogin-1 and MuRF1 were highly increased at the early stage of muscle wasting, and high expression persisted throughout the period of accelerated proteolysis. In contrast, knock-out mice without these two proteins showed resistance to denervation-induced muscle atrophy [6][7][8]. These studies clearly demonstrate the importance of atrogin-1 and MuRF1 in muscle atrophy and suggest that these proteins may be targets of muscle atrophy therapy. The gene expressions of atrogin-1 and MuRF1 are regulated by forkhead box O (FoxO), a transcriptional factor that is abundantly present in muscle [9,10]. Activation of FoxO is determined by two mechanisms: cytosol-nuclear shuttling and transcriptional activity [11]. These mechanisms are positively or negatively controlled by phosphorylation, depending on the upstream kinase and phosphor-accepting sites. One of the well-known positive upstream regulators of FoxO is AMP-activated kinase (AMPK), which directly phosphorylates specific sites on FoxO1 to activate its transcriptional function [12,13].
Another major regulator of muscle mass is mammalian target of rapamycin (mTOR) [14]. mTOR, a serine/threonine kinase involved in diverse cellular responses such as cell growth and survival, causes muscle hypertrophy by increasing the rate of muscle protein synthesis [15]. In older animals, the activation of mTOR by exercise has been reported to be blunted [16]. These observations suggest that the mTOR-mediated protein synthesis response to muscle contraction weakens with aging, resulting in muscle atrophy in aged animals. In addition, mTOR has been observed to be decreased in muscle atrophy conditions, such as after rotator cuff tendon rupture in a rat model [17], indicating that mTOR signaling is a key regulator of muscle atrophy across numerous atrophy models. The activity of mTOR is positively regulated by AKT. AKT has been reported to activate mTOR, especially by transducing signals in response to insulin-like growth factor 1 (IGF1), IGF2, and insulin stimulation [18,19].
Lotus (Nelumbo nucifera Gaertn), an aquatic plant, is extensively cultivated in Australia, Japan, India, Iran, and China [20]. Traditionally, all parts of lotus, including root, seed, and leaf, have been used for medicinal purposes to treat strangury, skin diseases, diarrhea, fever, gastric ulcers, and hyperlipidemia [21,22]. In addition, previous studies reported that extracts of lotus leaf (LL) containing a number of active ingredients such as alkaloids exhibit antioxidant [23,24], antiviral [25], and antiobesity [26] properties. Several studies have shown that high levels of reactive oxygen species (ROS) can regulate muscle protein metabolism, leading to muscle atrophy [27,28]. Therefore, based on the evidence linking oxidative stress and muscle atrophy, we investigated the efficacy of water extract of LL on dexamethasone (DEX)-induced muscle atrophy in mice in this study.
LL Administration Has a Positive Effect on Calf Muscle Volume, Surface Area, and Density in DEX-Induced Muscle Atrophy Mice
To evaluate the protective effect of LL against muscle atrophy, we assessed calf muscle properties using micro-CT in DEX-induced muscle atrophy mice. While muscle atrophy was induced in the DEX-administered group, LL (100, 200, and 300 mg/kg) recovered the DEX-induced muscle wasting ( Figure 1A). The muscle characteristics were further quantified by considering the muscle distribution in the CT image. The calf muscle volume and surface area were decreased by 30% in the DEX group and remarkably increased in groups treated with LL at all concentrations (100, 200, and 300 mg/kg) compared with the DEX group ( Figure 1B and 1C). In addition, calf muscle density, which was reduced by 40% due to DEX, was recovered by 10%, 20%, and 30% in the LL 100, 200, and 300 mg/kg administration groups, respectively ( Figure 1D).
Molecules 2020, 25, x FOR PEER REVIEW 3 of 17 and antiobesity [26] properties. Several studies have shown that high levels of reactive oxygen species (ROS) can regulate muscle protein metabolism, leading to muscle atrophy [27,28]. Therefore, based on the evidence linking oxidative stress and muscle atrophy, we investigated the efficacy of water extract of LL on dexamethasone (DEX)-induced muscle atrophy in mice in this study.
LL Administration Has a Positive Effect on Calf Muscle Volume, Surface Area, and Density in DEX-Induced Muscle Atrophy Mice
To evaluate the protective effect of LL against muscle atrophy, we assessed calf muscle properties using micro-CT in DEX-induced muscle atrophy mice. While muscle atrophy was induced in the DEX-administered group, LL (100, 200, and 300 mg/kg) recovered the DEX-induced muscle wasting ( Figure 1A). The muscle characteristics were further quantified by considering the muscle distribution in the CT image. The calf muscle volume and surface area were decreased by 30% in the DEX group and remarkably increased in groups treated with LL at all concentrations (100, 200, and 300 mg/kg) compared with the DEX group ( Figure 1B and 1C). In addition, calf muscle density, which was reduced by 40% due to DEX, was recovered by 10%, 20%, and 30% in the LL 100, 200, and 300 mg/kg administration groups, respectively ( Figure 1D).
Intake of LL Improves the Muscle Function in DEX-Induced Muscle Atrophy Mice
To investigate the effect of LL on muscle function, we measured the exercise capacity of mice. The moving distance was significantly decreased in the DEX group compared with the control group ( Figure 2A) However, after 1, 3, and 4 weeks of LL (100, 200, and 300 mg/kg) administration, moving distance was significantly increased compared with the DEX group ( Figure 2A). In the second week, only the group treated with 100 mg/kg LL showed significant differences compared with the DEX group, but a trend towards increase was observed with the LL 200 and 300 mg/kg groups. Grip strength of forelimb and hindlimb was also reduced in DEX-administered mice, but recovered by LL treatment starting in the second week ( Figure 2B). In addition, loss of body weight was observed in the DEX group, but administration of LL (300 mg/kg) increased body weight throughout the 4 weeks ( Figure 2C). LL at 100 and 200 mg/kg also significantly increased body weight at weeks 1, 3, and 4 ( Figure 2C). T, tibia.
Intake of LL Improves the Muscle Function in DEX-Induced Muscle Atrophy Mice
To investigate the effect of LL on muscle function, we measured the exercise capacity of mice. The moving distance was significantly decreased in the DEX group compared with the control group ( Figure 2A) However, after 1, 3, and 4 weeks of LL (100, 200, and 300 mg/kg) administration, moving distance was significantly increased compared with the DEX group ( Figure 2A). In the second week, only the group treated with 100 mg/kg LL showed significant differences compared with the DEX group, but a trend towards increase was observed with the LL 200 and 300 mg/kg groups. Grip strength of forelimb and hindlimb was also reduced in DEX-administered mice, but recovered by LL treatment starting in the second week ( Figure 2B). In addition, loss of body weight was observed in the DEX group, but administration of LL (300 mg/kg) increased body weight throughout the 4 weeks ( Figure 2C). LL at 100 and 200 mg/kg also significantly increased body weight at weeks 1, 3, and 4 ( Figure 2C).
Intake of LL Improves the Muscle Function in DEX-Induced Muscle Atrophy Mice
To investigate the effect of LL on muscle function, we measured the exercise capacity of mice. The moving distance was significantly decreased in the DEX group compared with the control group ( Figure 2A) However, after 1, 3, and 4 weeks of LL (100, 200, and 300 mg/kg) administration, moving distance was significantly increased compared with the DEX group ( Figure 2A). In the second week, only the group treated with 100 mg/kg LL showed significant differences compared with the DEX group, but a trend towards increase was observed with the LL 200 and 300 mg/kg groups. Grip strength of forelimb and hindlimb was also reduced in DEX-administered mice, but recovered by LL treatment starting in the second week ( Figure 2B). In addition, loss of body weight was observed in the DEX group, but administration of LL (300 mg/kg) increased body weight throughout the 4 weeks ( Figure 2C). LL at 100 and 200 mg/kg also significantly increased body weight at weeks 1, 3, and 4 ( Figure 2C).
Oral Administration of LL Prevents DEX-Induced Calf Muscle Damage
To explore the effects of LL on muscle damage, we performed histological analysis on the calf muscles. As shown in Figure 3A, muscle fibers of the control group were in intimate contact to form muscle bundles. In contrast, DEX increased perimysium ( Figure 3A, black arrow) and endomysium ( Figure 3A, white arrow), which are connective tissues surrounding the muscle bundles and muscle fibers. These histological alterations were recovered by intake of LL (100, 200, and 300 mg/kg) ( Figure 3A). Moreover, the physiological cross-sectional area (PCSA) in DEX-treated mice was lower than that in the control mice ( Figure 3B). Notably, LL (100, 200, and 300 mg/kg) significantly elevated the PCSA compared with mice treated with DEX alone ( Figure 3B).
Oral Administration of LL Prevents DEX-Induced Calf Muscle Damage
To explore the effects of LL on muscle damage, we performed histological analysis on the calf muscles. As shown in Figure 3A, muscle fibers of the control group were in intimate contact to form muscle bundles. In contrast, DEX increased perimysium ( Figure 3A, black arrow) and endomysium ( Figure 3A, white arrow), which are connective tissues surrounding the muscle bundles and muscle fibers. These histological alterations were recovered by intake of LL (100, 200, and 300 mg/kg) ( Figure 3A). Moreover, the physiological cross-sectional area (PCSA) in DEX-treated mice was lower than that in the control mice ( Figure 3B). Notably, LL (100, 200, and 300 mg/kg) significantly elevated the PCSA compared with mice treated with DEX alone ( Figure 3B).
Oral Administration of LL Prevents DEX-Induced Calf Muscle Damage
To explore the effects of LL on muscle damage, we performed histological analysis on the calf muscles. As shown in Figure 3A, muscle fibers of the control group were in intimate contact to form muscle bundles. In contrast, DEX increased perimysium ( Figure 3A, black arrow) and endomysium ( Figure 3A, white arrow), which are connective tissues surrounding the muscle bundles and muscle fibers. These histological alterations were recovered by intake of LL (100, 200, and 300 mg/kg) ( Figure 3A). Moreover, the physiological cross-sectional area (PCSA) in DEX-treated mice was lower than that in the control mice ( Figure 3B). Notably, LL (100, 200, and 300 mg/kg) significantly elevated the PCSA compared with mice treated with DEX alone ( Figure 3B).
LL Negatively Regulates a Proteolysis-Related Pathway
To examine the molecular mechanism by which LL attenuates DEX-induced muscle atrophy, we assessed the levels of proteins that are involved in muscle protein catabolic pathways. DEX administration significantly up-regulated the mRNA expression of genes encoding MuRF1 and atrogin-1, which are essential ubiquitin ligases involved in muscle protein degradation [6,7], within mouse calf muscle ( Figure 4A,B). Conversely, LL administration reduced the DEX-mediated increased mRNA levels of these proteins ( Figure 4A,B). Because FoxO1 and FoxO3 are key transcription factors that regulate the expression of atrogin-1 and MuRF1 [9,10], we further examined the changes in these proteins in calf muscle tissue of each mouse group. As shown in Figure 4C, DEX and LL did not significantly alter the mRNA expression of genes encoding FoxO1. However, the gene expression of FoxO3a was significantly decreased by administration of LL 200 and 300 mg/kg ( Figure 4D). In addition, DEX slightly increased the phosphorylation of AMPK, an upstream kinase of FoxO, and LL significantly reduced the levels of p-AMPK without alteration of total proteins at 200 and 300 mg/kg ( Figure 4E).
LL Negatively Regulates a Proteolysis-Related Pathway
To examine the molecular mechanism by which LL attenuates DEX-induced muscle atrophy, we assessed the levels of proteins that are involved in muscle protein catabolic pathways. DEX administration significantly up-regulated the mRNA expression of genes encoding MuRF1 and atrogin-1, which are essential ubiquitin ligases involved in muscle protein degradation [6,7], within mouse calf muscle ( Figure 4A and B). Conversely, LL administration reduced the DEX-mediated increased mRNA levels of these proteins (Figures 4A and B). Because FoxO1 and FoxO3 are key transcription factors that regulate the expression of atrogin-1 and MuRF1 [9,10], we further examined the changes in these proteins in calf muscle tissue of each mouse group. As shown in Figure 4C, DEX and LL did not significantly alter the mRNA expression of genes encoding FoxO1. However, the gene expression of FoxO3a was significantly decreased by administration of LL 200 and 300 mg/kg ( Figure 4D). In addition, DEX slightly increased the phosphorylation of AMPK, an upstream kinase of FoxO, and LL significantly reduced the levels of p-AMPK without alteration of total proteins at 200 and 300 mg/kg ( Figure 4E).
LL Administration Increases the Protein Synthesis-Related Pathway
To explore whether LL controls protein synthesis, we investigated the effect of LL on mTOR, a key regulator of the muscle protein anabolic pathway [29]. As shown in Figure 5A, the expression of total mTOR was not influenced by DEX and LL (100, 200, and 300 mg/kg). However, phosphorylation of mTOR was decreased in the DEX group compared with the control group, and administration of LL (300 mg/kg) significantly increased p-mTOR levels ( Figure 5A). AKT has been reported as a positive regulatory molecule of mTOR, and we thus examined the levels of this kinase [30]. There were no significant changes in p-AKT and total AKT in the DEX group compared with the control, but p-AKT was considerably increased in the LL (100, 200, and 300 mg/kg) groups ( Figure 5B).
LL Administration Increases the Protein Synthesis-Related Pathway
To explore whether LL controls protein synthesis, we investigated the effect of LL on mTOR, a key regulator of the muscle protein anabolic pathway [29]. As shown in Figure 5A, the expression of total mTOR was not influenced by DEX and LL (100, 200, and 300 mg/kg). However, phosphorylation of mTOR was decreased in the DEX group compared with the control group, and administration of LL (300 mg/kg) significantly increased p-mTOR levels ( Figure 5A). AKT has been reported as a positive regulatory molecule of mTOR, and we thus examined the levels of this kinase [30]. There were no significant changes in p-AKT and total AKT in the DEX group compared with the control, but p-AKT was considerably increased in the LL (100, 200, and 300 mg/kg) groups ( Figure 5B).
LL Contains Q3G as a Major Active Component
A previous study reported that the flavonoid found in plant compounds primarily provides health benefits [31]. Thus, to determine the active phytochemical composition of LL, we performed HPLC analysis. The highest peak (peak 1) was observed at the retention time (RT) of 15.4 min in LL samples ( Figure 6A, top panel). Peak 1 was identified by comparing the RT and UV spectrum with that of the standard form. As shown in Figures 6A and B, RT and UV absorption values of the peak Figure 5. Effect of LL on muscle protein anabolic pathway. (A) Total and phospho-protein levels of mTOR were analyzed by immunoblotting in calf muscle tissue from each group; GADPH served as control. (B) Total and phospho-protein levels of AKT were analyzed by immunoblotting in calf muscle tissue from each group; GADPH served as control. All data are expressed as the means ± SEM of three independent experiments. Band intensity was measured and quantified using ImageJ. ## p < 0.01, DEX vs. Control. * p < 0.05, ** p < 0.01, DEX + LL (100, 200, and 300) vs. DEX; DEX, dexamethasone; LL, water extract of lotus leaf.
LL Contains Q3G as a Major Active Component
A previous study reported that the flavonoid found in plant compounds primarily provides health benefits [31]. Thus, to determine the active phytochemical composition of LL, we performed HPLC analysis. The highest peak (peak 1) was observed at the retention time (RT) of 15.4 min in LL samples ( Figure 6A, top panel). Peak 1 was identified by comparing the RT and UV spectrum with that of the standard form. As shown in Figure 6A,B, RT and UV absorption values of the peak 1 coincide with that of Q3G ( Figure 6A,B). The effect of Q3G on muscle protein metabolism-related signaling was further investigated using C2C12 myoblast. MTT assay revealed that Q3G did not affect the viability of C2C12 cells up to a concentrations of 25 µM, whereas DEX showed cytotoxicity at doses exceeding Figure 6C, left and right panels). Based on their cytotoxicity profile, the concentrations of Q3G (6.25, 12.5, and 20 µM) and DEX (100 µM), which were effective but non-cytotoxic, were administered to C2C12 cells. Q3G treatment significantly decreased the DEX-mediated increased mRNA levels of atrogin-1, MuRF1, and FoxO3a at all doses ( Figure 6D-F). Phosphorylation levels of AKT and mTOR were decreased by DEX, while those were increased by Q3G at all doses ( Figure 6G). On the other hand, Q3G dose-dependently suppressed phosphorylation of AMPK ( Figure 6G). These results are consistent with the experimental finding obtained from LL-administered mice, which suggests that Q3G is one of the major active phenolic components of LL.
Molecules 2020, 25, x FOR PEER REVIEW 8 of 17 1 coincide with that of Q3G ( Figure 6A and B). The effect of Q3G on muscle protein metabolismrelated signaling was further investigated using C2C12 myoblast. MTT assay revealed that Q3G did not affect the viability of C2C12 cells up to a concentrations of 25 μM, whereas DEX showed cytotoxicity at doses exceeding 100 μM ( Figure 6C, left and right panels). Based on their cytotoxicity profile, the concentrations of Q3G (6.25, 12.5, and 20 μM) and DEX (100 μM), which were effective but non-cytotoxic, were administered to C2C12 cells. Q3G treatment significantly decreased the DEXmediated increased mRNA levels of atrogin-1, MuRF1, and FoxO3a at all doses ( Figure 6D-F). Phosphorylation levels of AKT and mTOR were decreased by DEX, while those were increased by Q3G at all doses ( Figure 6G). On the other hand, Q3G dose-dependently suppressed phosphorylation of AMPK ( Figure 6G). These results are consistent with the experimental finding obtained from LLadministered mice, which suggests that Q3G is one of the major active phenolic components of LL.
Discussion
Muscle atrophy is a destructive symptom that occurs in cachexia as well as aging. Despite the prevalence of muscle wasting, most treatments depend on exercise or protein supplementation, and only few drugs are available in clinical practice for muscle atrophy conditions [32]. In 1993, megestrol acetate (MA) was approved by the US Food and Drug Administration as a treatment for cachexia in cancer and acquired immune deficiency syndrome (AIDS) patients [33]. However, administration of MA is accompanied by side effects such as thromboembolism, temporary adrenal insufficiency, and central nervous system damage [32]. In severe cases, anabolic steroids such as methandrostenolone
Discussion
Muscle atrophy is a destructive symptom that occurs in cachexia as well as aging. Despite the prevalence of muscle wasting, most treatments depend on exercise or protein supplementation, and only few drugs are available in clinical practice for muscle atrophy conditions [32]. In 1993, megestrol acetate (MA) was approved by the US Food and Drug Administration as a treatment for cachexia in cancer and acquired immune deficiency syndrome (AIDS) patients [33]. However, administration of MA is accompanied by side effects such as thromboembolism, temporary adrenal insufficiency, and central nervous system damage [32]. In severe cases, anabolic steroids such as methandrostenolone are also used, but those are limited due to side effects [34]. Thus, developing effective treatments or supplements with few side effects for muscular atrophy is important. In this study, we reported the preventive effect of LL on muscle dysfunction using the DEX-induced muscle atrophy mouse model. In addition, the molecular mechanisms were clearly identified through molecular biological analysis using tissue samples of each group.
Prior to the evaluation of effects on muscle atrophy, we administered various doses of LL (100, 200, and 300 mg/kg) and monitored body weight of mice for 4 weeks. All mice showed normal increment in body weight and did not show any toxic signs such as diarrhea and sleep throughout the treatment (data not shown). However, body weight gain was slightly increased in the LL (100, 200, and 300) groups compared to the control group (data not shown). These results indicate that LL has no toxicity up to 300 mg/kg. Interestingly, administration of LL significantly increased the body weight of mice in the condition in which muscle dysfunction was induced by DEX ( Figure 2C). In addition, administration of LL (100, 200, and 300 mg/kg) increased the moving distance and grip strength (Figure 2A,B), implying that LL improves the DEX-induced impairment of muscle functions. To confirm that this improvement was due to muscle strengthening, we also examined changes in muscle properties using micro-CT analysis. In parallel with results on muscle function, oral administration of LL (100, 200, and 300 mg/kg) also increased calf muscle volume, surface area, and density ( Figure 1B-D). Histological analysis of calf tissue also revealed that LL (100, 200, and 300 mg/kg) restored DEX-induced muscle tissue atrophy ( Figure 3A,B). These results clearly indicate that LL has a preventive effect against DEX-induced muscle atrophy.
Various cellular and molecular studies have been conducted to examine the molecular mechanisms that contribute to the onset of muscle atrophy. The breakdown of muscle proteins by atrogin-1 and MuRF1 has been identified as the main cause of muscle wasting, and these proteins are considered as targets for therapeutic agents [8]. In addition, previous studies reported that DEX, a synthetic glucocorticoid, promotes atrogin-1 and MuRF1-medated proteolysis, leading to muscle wasting [6,35]. Thus, we investigated whether LL affected atrogin-1 and MuRF1 in calf tissues. As previously reported [35], DEX increased the mRNA expressions of atrogin-1 and MuRF1. Notably, our results showed that LL administration diminished the expression of these genes at all concentrations ( Figure 4A,B). In addition, mRNA expression of FoxO3a and the level of p-AMPK were reduced by LL treatment at doses of 200 and 300 mg/kg ( Figure 4D,E). Considering that AMPK positively regulates the transactivation of FoxO1 and FoxO3 [12,13,36], we speculated that the down-regulation of MuRF1 and atrogin-1 by LL may be from inhibition of activity and expression of FoxO. Interestingly, LL significantly reduced the gene expression of atrogin-1 and MuRF1 without alteration in FoxO expression and p-AMPK levels at concentration of 100 mg/kg ( Figure 4E). This suggests that the gene expression of atrogin-1 and MuRF is regulated by multiple molecules.
We also observed that LL up-regulated p-mTOR levels by activating AKT at a dose of 300 mg/kg ( Figure 5A,B). AKT/mTOR signaling is critical for protein synthesis at transcriptional and translational levels [37]. Rapamycin-sensitive mTOR (also termed as mTORC1) is essential for hypertrophy induced by resistance exercise (RE) [38]. In addition, activation of AKT/mTOR signaling has been known to prevent muscle atrophy in vivo [30]. Indeed, nutrient supplementation, such as with leucine [39], targets the activation of this signaling to improve muscle atrophy symptoms. Therefore, we speculated that activation of the AKT-mTOR pathway contributed to the increase in calf muscle mass and function by LL. However, LL did not show a significant effect on mTOR at 100 and 200 mg/kg ( Figure 5A). This suggests that the primary mechanism for alleviating muscle atrophy by LL administration is inhibiting proteolysis via atrogin-1 and MuRF1.
HPLC analysis showed that LL contains a large amount of Q3G ( Figure 6). Q3G is a major quercetin metabolite observed in plasma after quercetin intake and a glycoside derivative of quercetin [40]. Quercetin is a flavonoid widely distributed in functional foods, including vegetables and fruits, and has powerful antioxidant properties [41]. Oxidative damage caused by free radicals has been linked to a number of diseases, including cancer, cardiovascular and inflammatory diseases, and aging [42], and quercetin exhibits therapeutic efficacy for these degenerative diseases based on its strong antioxidant activity. In addition, previous studies reported that quercetin prevents disused muscle atrophy by suppressing ubiquitin ligase or protecting mitochondria in tail-suspension mice and denervated mice, respectively [43,44]. Q3G ( Figure 6B bottom panel), like quercetin, has antitumor [45,46], anti-inflammatory [47,48], and antiviral activities [49], as well as antioxidant properties [50]. In addition, quercetin glycosides have been reported to attenuate DEX-induced muscle atrophy in mice [51]. Indeed, in this study, Q3G suppressed the gene expression of atrogin-1 and MuRF1 and phosphorylation of AMPK in DEX-treated C2C12 cells, as well as up-regulated phosphorylation of mTOR and AKT ( Figure 6D-G). Furthermore, a pharmacokinetic comparison study revealed that the area under the curve (AUC) of Q3G was 18-fold higher than that of quercetin in rat plasma after oral administration, indicating that Q3G was superior to quercetin in terms of absorption rate [52]. Based on these previous reports and our results, we predict that Q3G is the active component in LL for alleviating DEX-induced muscle atrophy.
Preparation of LL
Dried LL was obtained from COSMAX NBT INC. (Seoul, South Korea). We extracted 85 kg of LL using water at 95 • C for 4 h. The solution was filtrated and concentrated. Dextrin was added (dextrin:dry matter content = 3:7), and the sample was dried with a yield of 22.6% (extract powder g/raw material g).
Animal Experiment
Institute of Cancer Research (ICR) mice (male, 8 weeks old, 24.25 ± 1.06 g) were purchased from Orient Bio (Seongnam, Korea). Mice were randomly designated into five groups as follows: (I) Control, (II) DEX and 0.5% (CMC)-treated group (DEX + 0.5% CMC), (III) DEX and 100 mg/kg/day LL-treated group (DEX + LL 100), (IV) DEX and 200 mg/kg/day LL-treated group (DEX + LL 200), and (V) DEX and 300 mg/kg/day LL-treated group (DEX + LL 300) (n = 10 per group). The animals were housed in polycarbonate cages with wood pulp bedding, which was changed twice a week. Mice were fed a pellet rodent diet (Samyang, Daejeon, Korea) and tap water. The facility was maintained under specific pathogen-free conditions at a temperature of 23 ± 2 • C and a humidity of 55 ± 10%, with a 12-h light/dark cycle. After a 1-week acclimation, tap water was provided for the normal group, while other groups (control and drug-testing groups) were provided with 0.01% w/v DEX in the drinking water for 4 weeks (day 1 to day 28). Each water bottle was replaced daily. LL (100, 200, or 300 mg/kg) dissolved in 0.5% CMC solution was orally administered daily for 4 weeks, and the 0.5% CMC solution was orally administered to the normal group and DEX + 0.5% CMC group. Once a week, exercise endurance and grip strength were tested, and the body weight of each mouse was recorded before every forced treadmill exercise. At the end of the experiment, mice were sacrificed under anesthesia with ether. The gastrocnemius muscle was isolated and stored at −70 • C for Western blotting, gene expression analysis, and histological analysis. Blood serum was also prepared for ATP production assay.
All studies were performed according to the guidelines established by the Sungkyunkwan University Institutional Animal Care and Use Committee (Suwon, Korea; approval ID: SKKUIACUC2018-10-16-1).
Cell Culture
Murine myoblast C2C12 cell line was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). The C2C12 cells were cultured with 10% heat-inactivated FBS, glutamine, and antibiotics (penicillin and streptomycin) at 37 • C under 5% CO 2 . For induction of myogenic differentiation, C2C12 myoblasts were transferred to differentiation medium of DMEM supplemented with 2% Horse Serum (16050130, Thermo Fisher scientific, Waltham, MA, USA) and were cultured for 7 days. The medium was changed with fresh differentiation medium every 2 days.
Micro-Computed Tomography (CT) Imaging
Muscle volume and density were measured by a high-resolution micro-CT scanner (SkyScan 1076, SkyScan, Kontich, Belgium) at the Center for University-Wide Research Facilities at Jeonbuk National University. Gastrocnemius muscles dissected from mice were scanned in 360 • in vertical rotation steps of 0.6 • with a desktop micro-CT unit at 5-mm resolution. Muscle tissues were identified using boundaries in Hounsfield Units (HU) set to 270 ± 100. The scanned images were reconstructed in 3D images and analyzed with CTVox software (version 3.0, Skyscan, Kontich, Belgium). A cross-sectional area of each muscle group was analyzed with CTAn software (version 1.18).
Running Test
Running distance was measured using a treadmill (Panlab, Barcelona, Spain) once a week for 4 weeks. The running was started at 7 m/min on a 15 • incline, and the speed was gradually increased by 3 m/min every 3 min until it reached 30 m/min and then was maintained. The mice ran for at least 20 min, and the test was stopped when the mice were exhausted.
Grip Strength Test
A grip strength meter (Panlab, Barcelona, Spain) was utilized to measure the grip strength of mice. After setting the gauge to 0 g, each mouse was allowed to grasp the pull grid; the mouse's tail was then slowly pulled back until the mouse missed the pull grid. Three consecutive tests were performed for each mouse, and the mean value was calculated.
Histology
After 4 weeks of LL administration, the calf muscles were removed and fixed in 10% neutral buffered formalin. The fixed muscle tissue was embedded in paraffin, and the paraffin blocks were cut into 4 µm thick sections. To assess tissue morphology, transverse sections of muscle tissues were stained with hematoxylin (ab220365 Abcam, Cambridge, UK) and eosin (H&E). The sections were examined under a microscope (Eclipse TE 2000-U; Nikon, Düsseldorf, Germany). The PCSAs were analyzed using ImageJ software (version 2020).
Real-Time Polymerase Chain Reaction (PCR)
Total RNA was isolated from the calf muscle or C2C12 cells using TRIzol reagent according to the manufacturer's instructions. Complementary DNA (cDNA) was synthesized from 1 µg total RNA using a cDNA synthesis kit. Real-time PCR was conducted using the qPCRBIO SyGreen Blue Mix Lo-ROX (PCR Biosystems Ltd., London, UK) according to the manufacturer's instructions. The PCR reaction was performed using a real-time C1000 thermal cycler (Bio-Rad Laboratories Inc., Hercules, Molecules 2020, 25, 4592 13 of 17 CA, USA) under the following conditions: 10 s denaturation time at 95 • C, 10 s annealing time at 58 • C, and 60 s extension time at 72 • C, for 39 cycles. The gene expression of atrogin-1, MuRF1, FoxO1, and FoxO3a was normalized to GAPDH and expressed as fold increase (normal level was set as 1). The sequences of the primers used in this study are shown in Table 1.
High-Performance Liquid Chromatography (HPLC) Analysis
HPLC analysis was performed using an Agilent infinity 1260 II equipped with an autosampler, a quaternary pump, column temperature control, and DAD detector. To prepare a working solution, 40-45 mg LL powder and 2 mg Q3G were each dissolved in 10 mL MeOH (Honeywell Burdick & Jackson, NJ, USA). Each solution was then filtered using a 0.45 µm membrane filter and injected into the HPLC system. LL and Q3G samples were analyzed using a C18 column with an internal diameter of 4.6 × 250 mm (Phenomenex, Torrance, CA, USA). The detector wavelength was 255 nm and injection volume was 10 µL. The mobile phase consisted of solvent A (1% acetic acid in water) and solvent B (1% acetic acid in acetonitrile). The flow was 0.8 mL/min and the column temperature was 40 • C. The gradient elution conditions were as follows: 10% B for 0-5 min; 10-30% B for 5-10 min; 30-100% B for 10-35 min; 100% B for 35-37 min and 100-10% B for 37-40 min; and 10% B for 40-45 min [55].
MTT Assay
C2C12 cells were treated with Q3G (3.15, 6.25, 12.5, and 25 µM) or DEX (25,50,100,200, and 400 µM) for 24 h. Then, 10 µL MTT solution was added and incubated for 3 h, and the reaction was stopped by stopping solution (15% SDS), as reported previously [56]. The samples were then incubated overnight, and the absorbance of MTT formazan was measured at a wavelength of 540 nm.
Statistical Analysis
All experiments were performed with 10 mice per group. Data in Figures 1-3 are expressed as the means ± standard deviation (SD) calculated from at least eight mice. For Western blot analysis, real-time PCR, and MTT assay in Figures 4-6 (C-G), three independent experiments were performed. Analysis of variance (ANOVA) with the Mann-Whitney U test was used for statistical comparison. For all analyses, p < 0.05 was considered statistically significant.
Conclusions
In conclusion, this study provides evidence for the efficacy of LL in preventing muscle atrophy and reveals the underlying molecular mechanisms. Administration of LL for 4 weeks significantly increased muscle mass and muscle function that was inhibited by DEX in mice. These results indicate that LL has the ability to prevent muscle wasting. LL activated AKT in calf muscle, but suppressed AMPK. As a result, the activity of FoxO1/3 and mRNA expression of atrogin-1 and MuRF1, proteins involved in the pivotal pathway of proteolysis, were significantly reduced by LL. In addition, mTOR, a central molecule for protein synthesis, was positively regulated by LL (Figure 7). LL contains a large amount of Q3G, which is expected to be an active ingredient in attenuating muscle atrophy. Based on these results, LL is recommended to be used as a supplement or therapeutic agent to prevent or treat muscle atrophy, including sarcopenia.
Conclusions
In conclusion, this study provides evidence for the efficacy of LL in preventing muscle atrophy and reveals the underlying molecular mechanisms. Administration of LL for 4 weeks significantly increased muscle mass and muscle function that was inhibited by DEX in mice. These results indicate that LL has the ability to prevent muscle wasting. LL activated AKT in calf muscle, but suppressed AMPK. As a result, the activity of FoxO1/3 and mRNA expression of atrogin-1 and MuRF1, proteins involved in the pivotal pathway of proteolysis, were significantly reduced by LL. In addition, mTOR, a central molecule for protein synthesis, was positively regulated by LL (Figure 7). LL contains a large amount of Q3G, which is expected to be an active ingredient in attenuating muscle atrophy. Based on these results, LL is recommended to be used as a supplement or therapeutic agent to prevent or treat muscle atrophy, including sarcopenia. | v3-fos-license |
2018-06-21T12:41:03.864Z | 2017-03-01T00:00:00.000 | 44157510 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": null,
"oa_url": null,
"pdf_hash": "23989efc6ca9e63600c3c305f56e31af8bdfadf7",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119315",
"s2fieldsofstudy": [
"Agricultural And Food Sciences",
"Chemistry"
],
"sha1": "23989efc6ca9e63600c3c305f56e31af8bdfadf7",
"year": 2017
} | pes2o/s2orc | Antibacterial Activityand Comparison of the Volatile Oils of Tanacetum tenuisectum (Boiss.) Podl. Obtained by Three Different Methods of Extraction.
The essential oils obtained by hydrodistillation (HD), steam distillation (SD) and solvent free microwave extraction (SFME) from the stems and flowers of Tanacetumtenuisectum (Boiss.) Podl., which is endemic to Iran, were analyzed by combination of GC and GC/MS. Camphor (26.91 %, 27.23% and 25.52%), borneol (12.61%,11.48% and 7.62%) and 1,8-cineole (7.93%, 13.23% and 11.26%) were the main constituents of the HD,SD and SFME oils of Tanacetumtenuisectum respectively. All three oils were rich in regard to monoterpenes and small percentage of sesquiterpenes and non terpenoid compounds. Antibacterial activity of the essential oil of the plant was determined against six Gram positive and Gram negative bacteria. The results showed that this oil was active against all of the tested bacteria.
Introduction
The genus Tanacetum, which is an important member of the Compositaefamily, is widespread in Europe and Western Asia and consists about 150-200 species.The flora of Iran comprises 26 species of Tanacetumofwhich 12 are endemic (1,2). Some members of this genus have traditionally been used as a spicy additive for food, in cosmetics and as herbal remedies due to their biologically active compounds (3). Especially Tanacetumpartheniumhasbeenused sinceancienttimes for a variety of medicine proposes, and recently has gained considerableprominence due to its ability of alleviating the symptoms of migraine, athritisand psoriasis, and to inhibition of blood platelet aggregation (4).
This genus is also found to contain sesquiterpene lactones (16, 17) a large group of molecules with several biological activities (18,21).
As part of our ongoing work on the chemical analysis of volatile obtained from wild plants of Iran, we report the composition of the volatile oils of Tanacetumtenuisectum obtained by hydrodistillation, steam distillation and solvent free microwave extraction with its antibacterial activity.
Voucher specimens have been deposited at the Herbarium of the Research Institute of Forests and Rangelands (TARI), Tehran, Iran.
Isolation of the essential oils Distillation
Air-dried ground stems and flowers of the plant were separately subjected tohydrodistillation and steam distillation using a Clevenger type apparatus for 3h. The obtained essential oils were dried over anhydrous sodium sulfate and after filtration, stored at 4ºC until tested and analyzed. The yield was found to be 0.2% and 0.3% (w/w), respectively. Solvent Free microwave extraction SFME extractionwas performed in a Milestone ETHOS 1600 batch reactor, which is a multimode microwave reactor operating at 2455 MHZ with a maximum delivered power of 1000 W, variable in 10 W increments. The dimensions of the PTFE-coated cavity are 35×35×35 cm. During the experiment time, temperature, pressure, and power were controlled using the « easy-WAVE » software package. Temperature was monitored with the aid of a shielded thermocouple (ATC-300) inserted directly in to the sample container.
Ina typical SFMEprocedure, 250 g of dry stems and flowers of T.tenuisectum were moistened prior to extraction by soaking in water for 1 h, then draining off the excess water.This step is essential to give thestems and flowers the initial moisture. Moistened stems and flowers were next placed in a reactor without any added solvent or water. The essential oil is collected, dried with anhydrous sodium sulfate and stored at 0ºC until used.
Gas chromatography GC analysis was performed on Schimadzu15 A gas chromatograph equipped with a split/ splitless injector (25ºC) and a flame ionization detector (250ºC). Nitrogen was used as carrier gas (1 mL/min) and the capillary column used was DB-5 (50m0.2×mm, film thickness 0.32µm).The column temperature was kept at 60ºC for 3 min and then heated to 220ºC witha 5ºC/ min rate and kept constant at 220ºC for 5 min. Relative percentage amount were calculated from peakarea usinga Schimadzu C-R4 Achromatopac without the use of correction factors.
Gas chromatography -mass spectrometry
Analysis was performed using a Hewlett-Packard 5973 with a HP-5MS column (30m0.25× mm, film thickness 0.25 µm). The column temperature waskept at 60ºC for 3 min and programmed to 220ºC at a rate of 5ºC/min and kept constant at 220ºC/min for 5 min.The flow rate of Helium as carrier gas with (1 mL/ min).
Mass spectrometry wastaken at 70 eV. The retention indices for all the components were determined according to the Van Den Door method, using n-alkanes as standards (33).
The compounds were identified by (RRI, DB5) with those reported in the literature and by comparison of their mass spectra with the Wiley library or with the published mass spectra (34, 35).
Antibacterial assay
The antibacterial activity of the essential oil from the aerial parts of Tanacetumtenuisectum was evaluated by disc diffusion method using Mueller-Hinton Agar (36). The antibacterial activity of the essential oil of the plant was tested against three Gram-positive and three Gramnegative bacteria.
The Gram-positive bacteria included Staphylococcus aureusATCC 25923, A serial dilution of the oil was prepared in Mueller-Hinton Broth forbacteria. The oil was diluted by the water and ethanol solvents. The solvents, at an appropriate concentration were also used as a negative centrol. The standardized suspension of bacteria was incubated in to each tube. The tubes were incubated at37ºCfor 24h. Thelowestoil concentration, where there was no visible growth, was the Minimum Inhibitory Concentration (MIC) when compared to control.
To determine the Minimum Bactericidal Concentration (MBC), for each set of test tubes in the MIC determination, a loopful of broth was collected from those tubes which did not show any growth and incubated on Muller-Hinton Agar by streaking. Plates incubated with bacterial were then incubated at 37ºC for 24 h. After incubation, the concentration at which no visible growth was seen was noted as MBC for bacteria. All the experiments were carried out in triplicate and mean calculated.
Results and Discussion
The identified volatile components and their peak area percentages of the stems and flowers of Tanacetumtenuisectumobtained by hydrodistilliation, steam distillation and solvent free microwave extraction are given in Table 1. The components are listed in order of their elution on the DB-5 column.
As it is shown from the Table 1, about 96.87% (34 components) of the hydrodistilled oil, 91.32% (46 constituents) of the steam distilled oil and 95.1% (44 components) of the solvent free microwave extraction oil of T.tenuisectumwere identified.
Accordingto these results, the composition of the three oils show significant similarity for the concentration of the main components. All three oils were rich in regard tomonoterpenes (55.14%, 68.69%and 55.97%, respectively), while the sesquiterpenes fraction was (27.27%, 13.89% and 24.47%, respectively). The nonterpenoid fraction was relatively small, representing 14.46%, 8.74%, and 14.66%, respectively.
The oils obtained by hydrodistillation of the leaves and flowers of T.dumosum growing wild in Iran were investigated. The main constituents Table 1. Comparative chemical composition (%) of Tanacetumtenuisectum oil obtained by HD, SD and SFME. Note: a Compounds listed in order of elution from HP-5 MS column; b Retention indices to C 8 -C 24 n-alkanes on HP-5 MS column; t= trace ( < 0.1% ). (31).
The dominant compound in the flower and stem oils ofT. chiliophyllum, from Turkey, was camphor (17.3% and 10.4%) respectively,while root oil of the plant was characterized with hexadecanoic acid (37.5 %) (37).
Baser et al. reported the oils from the flowers of T. zahlbruckneri and flowers and stems of T. tabrisianum from Turkey.
Results of the antibacterial activity of the essential oil of Tanacetumtenuisectum (42,43).The antibacterial effects of borneol were also reported (44). As aresult of these findings, antibacterial activity of T. tenuisectum oil could be attributed to 1,8 cineol, camphor and borneol. The present study confirms that there is a positive correlation between the chemical content of the oils and their antibacterial activities. | v3-fos-license |
2016-03-14T22:51:50.573Z | 2012-08-22T00:00:00.000 | 4487596 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0043876&type=printable",
"pdf_hash": "e7b66d3f9b56dfebebc68d546e00e270eb3dd619",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119325",
"s2fieldsofstudy": [
"Biology",
"Chemistry",
"Materials Science"
],
"sha1": "ff57d95061d88844fb156fd7bf86f92c02bba0d2",
"year": 2012
} | pes2o/s2orc | Measuring Cation Dependent DNA Polymerase Fidelity Landscapes by Deep Sequencing
High-throughput recording of signals embedded within inaccessible micro-environments is a technological challenge. The ideal recording device would be a nanoscale machine capable of quantitatively transducing a wide range of variables into a molecular recording medium suitable for long-term storage and facile readout in the form of digital data. We have recently proposed such a device, in which cation concentrations modulate the misincorporation rate of a DNA polymerase (DNAP) on a known template, allowing DNA sequences to encode information about the local cation concentration. In this work we quantify the cation sensitivity of DNAP misincorporation rates, making possible the indirect readout of cation concentration by DNA sequencing. Using multiplexed deep sequencing, we quantify the misincorporation properties of two DNA polymerases – Dpo4 and Klenow exo− – obtaining the probability and base selectivity of misincorporation at all positions within the template. We find that Dpo4 acts as a DNA recording device for Mn2+ with a misincorporation rate gain of ∼2%/mM. This modulation of misincorporation rate is selective to the template base: the probability of misincorporation on template T by Dpo4 increases >50-fold over the range tested, while the other template bases are affected less strongly. Furthermore, cation concentrations act as scaling factors for misincorporation: on a given template base, Mn2+ and Mg2+ change the overall misincorporation rate but do not alter the relative frequencies of incoming misincorporated nucleotides. Characterization of the ion dependence of DNAP misincorporation serves as the first step towards repurposing it as a molecular recording device.
Introduction
Traditional approaches to signal recording rely on electromagnetic radiation or electronic hardware to couple the signals of interest to an external data storage device. These approaches become cumbersome, however, when signals reside deep within complex tissues, as is the case in functional neural connectomics, where simultaneously accessing millions of neurons is currently not feasible [1]. In contrast, molecular approaches to information transfer are by nature ubiquitous, massively parallel, and inexpensive. We have recently proposed that information could be recorded onto DNA [2,3,4], arguably the most robust molecular information storage mechanism in nature. Recording systems based on DNA can leverage scientific and industrial interest in technologies for manipulating and sequencing nucleic acids, as well as advances in protein design.
A DNA polymerase could be repurposed as a nano-scale recording device, bypassing many of the hurdles of sensing technologies by locally measuring and storing information rather than requiring it to be rapidly transmitted, digitized and stored elsewhere. In a simple encoding scheme, an environmental signal of interest is coupled to the nucleotide misincorporation rate of the DNA polymerase ( Figure 1A). Then, as the polymerase copies a known DNA template, the level of misincorporations produced in the copied strand will represent the amplitude of the environmental signal present. If the environmental signal varies over time, those changes could in principle also be reflected by changes in the misincorporation rate over time, enabling the DNA data storage idea to be extended to the time domain.
DNA polymerases are complex biochemical machines [5]. To establish them as molecular recording devices, it is necessary to quantify how environmental variables affect their copying fidelity. Of central importance is the transfer function associated with a particular DNAP, which maps the amplitude of the environmental signal to the misincorporation rate of the DNA sequence data. This transfer function is not only shaped by the biochemical properties of the polymerase, but also by other aspects of the experimental setup; it reflects the entire sensing pathway from environmental variable to filtered and processed sequence data. Therefore, the design of DNA recording devices requires the identification of any uncontrolled variables (such as local sequence context or secondary structure of the source template) that could alter the shape of this transfer function.
Cation concentrations are logical choices as the input signals for a DNA recording device because they are affected by many physiological variables, and some are known to modify DNAP fidelity [6]. Ca 2+ , for example, is involved in many signaling pathways, including neurotransmission [7] and immune activation [8], and can also be modulated by external stimuli [9]. Mg 2+ and Mn 2+ concentrations have been shown to strongly modulate DNAP misincorporation rate [10]. Quantifying the transfer function between cation concentration and DNAP fidelity is a useful step towards elucidating the principles of a DNA recording device. Overview of a strategy for using DNA polymerases as signal recording devices. Signals (top) are coupled to intracellular or extracellular cation concentration through direct or indirect modulation of an ion channel activity. Cation concentration is in turn coupled to DNA polymerase fidelity on a known template according to a known transfer function (orange curve), generating a DNA recording, in which data is represented by the density of misincorporated bases, and which can be read by DNA sequencing (bottom). (B) Modulation of Taq polymerase by Ca 2+ concentration, measured by a traditional blue-white colony counting assay [25]. (C) Biochemical steps of the multiplex deep sequencing assay for measuring the transfer functions of error-prone DNAPs. doi:10.1371/journal.pone.0043876.g001 There are a large number of known DNAPs with varying properties [11] that impact their usability as recording devices. A DNAP appropriate for DNA recording of environmental signals should ideally have a wide dynamic range of misincorporation rates and be active at mesophilic temperatures. Dpo4 (Sulfolobus solfataricus) [12] is a member of the Y-family of polymerases [13,14], which are implicated in translesion bypass [15] and somatic hypermutation [16] and have high misincorporation rates. Klenow exo 2 is the D355A, E357A mutant [17] of the Klenow Fragment of the E. coli DNA Polymerase I [18], which lacks 39-59 proofreading activity, and, unlike most commercially available DNAPs, is compatible with the 37uC extension temperature used for the Y-family enzymes. These two DNAPs seem particularly interesting in the context of recording device development.
Here we have developed a strand-specific deep sequencing method to measure the transfer function between divalent cation concentration and polymerase misincorporation rate in a highly multiplexed format. We performed barcoded, error-prone primer extensions using Dpo4 and Klenow exo 2 , at varying cation concentrations, and analyzed the products by deep sequencing. Analysis of the measured transfer functions reveals strong cation, template base, and sequence-context dependent effects on the misincorporation rate, which differ dramatically between the polymerases, and resolves the bulk misincorporation rate into its underlying transition probabilities. Our method for quantifying DNAP transfer functions will facilitate the development of engineered molecular recording devices that utilize DNA as a storage medium.
Results
To verify that physiologically relevant ions, such as Ca 2+ , can in principle modulate DNAP fidelity, we checked the Ca 2+ dependence of the fidelity of Taq DNAP using a lacI q -based PCR fidelity assay ( Figure 1B). We constructed a derivative of pUC19 containing the lacI q repressor allele and the partial gene encoding for the colorimetric enzyme beta-galactosidase (lacZa). The plasmid was linearized, and PCR-amplified by Taq DNAP in buffers containing varying concentrations of Ca 2+ . Subsequently, the amplified DNA was circularized and transformed into an acomplementing strain of E.coli. Replication by Taq DNAP introduces mutations in lacI q resulting in the de-repression of lacZa, whose activity after complementation is detected on X-Gal indicator plates. The ratio of blue to white colonies can be used to calculate the bulk Taq error rate if the number of DNA duplications, and mutations yielding non-functional protein, are known. There are 349 single-base substitutions at 179 codons that will result in a blue phenotype in the lacI gene [19]. Our assay recapitulates previously reported error rates for Taq (2.6610 25 bp 21 [20]) in the absence of added Ca 2+ , and demonstrates that increasing divalent cation concentration monotonically increased the bulk error rate.
While Ca 2+ modulated Taq fidelity, Taq is unable to serve as a recording device, because it requires high temperatures for extension and has a low misincorporation rate (,0.015% nt 21 ) across the physiological range of Ca 2+ concentrations [21]. We therefore focused our analysis on DNAPs that have high baseline misincorporation rates and operate at physiological temperatures.
Multiplexed Assay for Polymerase Misincorporation
To characterize DNAPs at varying cation concentrations, we developed a multiplexed primer extension assay with deep sequencing readout ( Figure 1C). Barcoded primers were first annealed to a known DNA template, followed by primer extension by the error-prone polymerase. Using a 96-well plate format allowed simultaneous testing of many cation concentrations. Subsequently, all wells were normalized to equal cation concentrations (salt correction) to eliminate ion-dependent bias in downstream biochemical steps. To eliminate bias against errorrich primer extensions, a partial Illumina adapter was then ligated downstream. Ligated products were amplified via high-fidelity PCR using primers that completed the Illumina adapter sequences. The template contained a dideoxy-C 39 modification, preventing extension by the polymerase along the upstream primer. Consequently, the template strand did not contain the primer-binding site for PCR amplification; only strands of nontemplate origin were amplified, and therefore contained the full Illumina adaptors used for sequencing.
Diversity in the initial sequenced bases is required for proper cluster identification during Illumina sequencing. We therefore positioned the 5-base barcodes indexing the 96-well plate wells such that these barcodes comprised the first five bases sequenced. Following deep sequencing using the Illumina MiSeq platform, individual reads were filtered in silico and compared with the template sequence to quantify misincorporation rates as a function of ion concentration and base position along the template (see Materials and Methods).
This method generated hundreds to thousands of reads per cation condition, some of which were not full length (the result of abortive extensions and/or extensions containing base deletions). Duplicate plate wells with nominally equal cation concentrations and different barcode sequences were analyzed independently and used to generate misincorporation rate estimates and errors (standard error of duplicate means).
Measurement of the Mean Transfer Function between Cation Concentration and Misincorporation Rate
We observed misincorporation rates for each reaction condition by comparing filtered sequencing reads with the known template sequence (Table S1). We first analyzed the cation dependence of Dpo49s mean misincorporation rate, and found it to be positively correlated with both Mg 2+ and Mn 2+ concentrations (Figure 2A-B, top). We found that Dpo4 acts as a Mn 2+ sensor with a gain of ,2%/mM. Dpo4 also acts as a sensor with a gain of ,0.01%/ mM for Mg 2+ (Table S1). Dpo4 is therefore a far better sensor for Mn 2+ than Mg 2+ .
While the misincorporation rate for Klenow exo 2 is also positively correlated with Mn 2+ (top of Figure 2C), it exhibits a weak negative correlation with Mg 2+ (top of Figure 2D). Klenow exo 2 is a sensor for Mn 2+ with a gain of ,0.6%/mM and a sensor for Mg 2+ with a gain of -0.01%/mM. Thus two cations may differ in the direction by which they modify the kinetics of misincorporation.
Note that in all cases, the measured mean misincorporation rates are much higher than the noise floor (shaded regions). This noise floor is defined as the mean plus the standard error of the mean of the misincorporation rate obtained by performing an identical protocol with the high-fidelity Phusion DNAP in HF buffer ( Figure S1), and is in agreement with previous studies that measured the substitution rate of phosphoramidite synthesis [22]. Therefore, the noise floor likely results from substitution impurities in the synthetic template strands. Deep sequencing is therefore a reliable method to characterize DNAPs with high misincorporation rates.
We further measured the transfer function for mean misincorporation by Dpo4 and Klenow exo 2 with respect to Ca 2+ concentration. Because the kinetics of primer extension in buffers containing Ca 2+ alone are at least ,50 fold slower than in either Mg 2+ or Mn 2+ [23], we performed the primer extensions in a variety of both physiological and non-physiological Mn 2+ and Mg 2+ backgrounds. Misincorporation rates were only significantly affected in a small, non-physiological subset of the Mg 2+ and Mn 2+ backgrounds tested. The misincorporation rate by Dpo4 in a 200 mM Mn 2+ background increases 2.9-fold from 1 nM to 1 mM Ca 2+ , the majority of which occurs between 100 nM and 1 mM ( Figure 2I, Table S1). Conversely, the misincorporation rate of Dpo4 decreases by 42% between 1 nM and 1 mM Ca 2+ in a 7 mM Mg 2+ background, with virtually all of the change occurring between 100 mM and 1 mM Ca 2+ ( Figure 2J). Ca 2+ has no effect on misincorporation rate with Klenow exo 2 in the same backgrounds ( Figure 2K and 2L) nor in most other enzyme/buffer combinations (Table S1). Therefore neither of the tested DNAPs is promising as a Ca 2+ sensor without further modifications.
Base Specificity of Misincorporation
The misincorporation characteristics of DNAPs depend not only on cation concentrations, but also on the particular template base being copied. Deep sequencing allows quantification of the misincorporation rate at every position within the template (Figure 2A-D). Note that misincorporation by Dpo4 opposite a template T exhibits a .50-fold increase over the range of Mn 2+ studied, while misincorporation rates opposite other bases show a comparatively weak dependence on Mn 2+ ( Figure 2B, Table S1). Thus the mean Mn 2+ dependence of misincorporation rate of Dpo4 is largely driven by misincorporations opposite T. There is no obvious correlation of the misincorporation rate with the identity of the base preceding the template base ( Figure S2).
Deep sequencing also allows direct measurement of the 464 transition probability matrix between template base and in-corporated base (Table S2, Figure 2E-H). For example, the disproportionate Mn 2+ dependence of misincorporation by Dpo4 opposite template T is largely due to misincorporation of dGTP. Likewise, mutations caused by Klenow exo 2 are generally dominated by misincorporation of dATP, except on template T, which shows a .4-fold preference for misincorporation of dGTP. Misincorporation by Dpo4 of dGTP opposite template T increases 50-fold with Mn 2+ . Note, however, that the relative proportions of the misincorporated bases on a given template base are largely insensitive to cation concentration for both Dpo4 and Klenow exo 2 . Rather, cation concentration acts as a scaling factor with respect to misincorporation opposite a given template base; it is the differential magnitude of this scaling factor between the template bases that underlies the template base dependence of misincorporation.
Misincorporation is Context-Dependent
Cations change misincorporation probabilities but not the distribution of misincorporations across incoming dNTPs. However, the template base itself is not, in general, sufficient to predict misincorporation rate; the sequence context is important as well ( Figure 3A-C). For Dpo4, the shape of the graph is dominated by preferential misincorporations at template T (red dots). The dependency on the sequence, however, is complicated: switching the first half of the template (shaded blue) with the second half (shaded red) leaves some aspects of the misincorporation curve similar while changing others. Indeed, the swapped template leads to a more even distribution of misincorporations, indicating that template choice is an important design parameter for DNA recording. There is no obvious sequence context dependence of misincorporation for Klenow exo 2 ( Figure 3C), beyond the identity of the template base. Curiously, the misincorporation rate opposite template G, which dominates at 75 mM Mn 2+ , stays relatively unchanged with increasing Mn 2+ concentration, while misincorporations opposite template A increase, becoming the predominant peaks at 800 mM Mn 2+ . Thus different DNAPs are differently affected by both cation concentrations and local sequence contexts.
Statistical Analysis of Misincorporation Events
Our deep sequencing method produces large datasets that can be used to characterize the correlations within each strand of synthesized DNA, as well as the statistical distributions across strands. To test the hypothesis that DNAPs could tend to string errors together, we analyzed the lag-one correlations of misincorporations, asking if a misincorporation on one base makes it more likely that there is a misincorporation on the next base. After correction for bias due to correlations within the template itself (see Materials and Methods), there is a weak but statistically significant correlation of misincorporations across bases for Klenow exo 2 at 800 mM Mn 2+ (0.04760.002% excess misincorporations per base). For Dpo4, misincorporations at consecutive positions appear independent from one another (all excess errors ,0.01% per base). Therefore, only for Klenow exo 2 is a misincorporation on a base associated with an increased probability of misincorporation on the next base.
It is unknown to what extent molecular heterogeneity plays a role in the generation of DNAP misincorporations. If each DNAP molecule performs misincorporations according to the same statistics, the distribution of the total number of misincorporations per read should be governed by a Poisson distribution. The variance is larger than the mean, however, for each DNAP/ template combination tested, and the null-hypothesis of a Poisson distribution can be rejected for each of the datasets (X 2 test, p,0.05). Thus the ensemble of nominally identical DNAP molecules is heterogeneous with respect to misincorporation rate.
To further study the determinants of misincorporation, we fit the misincorporation data set to a generalized linear model (GLM) containing sequence features that could plausibly impact misincorporation rates (Figure 4). Possible features included the identity of the template base and the predicted regional secondary structure. The models were able to fit the data (R 2 = 0.5860.02 and 0.5360.11 for the original and swapped templates, respectively, Figure 4A and 4B). Interestingly, the models captured the interplay of sequence properties that determine the spatial dependence of misincorporation. Fits to the original template data could predict the spatial dependence of misincorporation on the swapped template (R 2 = 0.4960.06), and vice versa (R 2 = 0.5060.01). Furthermore, the weights assigned to different features ( Figure 4C and 4D) in the model point to potential determinants of the error rate. For example, the models identify the positive contribution of a template T to Dpo49s error rate and also suggest that local secondary structure may play a role.
Information Content of Misincorporations
Because cation concentration modulates the number of misincorporations in the copied DNA, one can consider the sequenced data to store information about the cation concentration present during primer extension [24]. The information gain per base is related to the likelihood that the observed misincorporation rate at a given template position was produced at a particular cation concentration. For Dpo4 at high (800 mM) vs. low (75 mM) Mn 2 +, the most informative template bases transmit ,0.03 bits of information per base about Mn 2+ concentration ( Figure 4E), whereas only ,5610 24 bits per base are transmitted at high (7000 mM) vs. low (1000 mM) Mg 2+ . Therefore, in the limit in which Mn 2+ concentration could be modulated as each nucleotide is added, a Dpo4-based DNA recording device could in principle write 11 megabytes onto a template the length of a human genome (3.2610 9 bases).
Discussion
In this work, we have developed a method that can quantitatively map the misincorporation landscapes of error-prone polymerases as a function of environmental signals. Specifically, we quantified how the concentrations of environmental Mg 2+ , Mn 2+ and Ca 2+ affect the fidelity of Dpo4 and Klenow exo 2 . Mn 2+ has the strongest influence on misincorporation rates in comparison to the other cations. Our method resolves the misincorporation by spatial position and nucleotide-to-nucleotide transition. We find that, for Dpo4 and Klenow exo 2 , Mn 2+ and Mg 2+ change misincorporation rates but leave the distribution across incoming misincorporated nucleotides untouched. We have further shown that polymerase misincorporation rates exhibit sequence dependences. The development of a DNAP-based cation sensor, then, necessitates calibration of misincorporation rates at specific template positions, within specific sequence contexts, and at specific buffer conditions. The buffer-specificity of some DNAPs suggests that polymerase-based sensors might work best within controlled buffer environments, e.g. within living cells expressing ion channels, which can maintain buffer integrity, but selectively allow targeted ions to permeate. Our experiments quantify the transfer function of misincorporation from cations, through processing, all the way to DNA sequence data.
Our assay differs in important ways from the bacterial assays that have been used for the quantification of DNAP behavior [25][26][27]. Through deep sequencing we can readily observe polymerase trajectories with single molecule and single base resolution while simultaneously generating large datasets, both of which are critical for achieving the comprehensive analyses necessary for establishing polymerase data encoding transfer functions. Single base pair resolution allows quantifying the template dependence of misincorporations, while single molecule resolution allows quantification of the correlation structure of misincorporations.
The method introduced here does have limitations, some of which can be mitigated. For example, the measured background noise level is likely dominated by errors introduced during the chemical synthesis of the oligonucleotides used as templates. The use of clonal isolates should dramatically lower that noise level and may prove necessary in adapting this method to the characterization of high fidelity DNAPs. In addition, GLM analysis indicates that the spatial dependence of the observed misincorporation rates may be in part due to the secondary structure of the ssDNA template. Using a nicked, double stranded template would reduce this source of variance, but would limit the applicability of the method to DNAPs with strand displacement or nick translation activity. While sophisticated molecular counting methods [28] and clonal substrates are necessary to quantify the low misincorporation rates of proofreading polymerases using sequencing [22], in this study, we have investigated error-prone polymerases, and are therefore readily able to measure strong effects despite the limitations of our method.
Certain limitations of the method cannot be mitigated without resorting to engineered polymerase variants. For example, we have shown that neither DNAP studied here can act as a Ca 2+ sensor in physiologically relevant conditions. Furthermore, these biologically-based recording devices are limited to conditions that enable efficient enzymatic activity; such devices will not work, without modification, in environments of extreme pH, temperature, oxidative stress, proteolysis, etc.
While we have demonstrated how a static ion concentration can be measured by a polymerase copying DNA, it would ultimately be useful to have polymerase-based sensors for time-dependent as well as static signals. To do so, it will be necessary to optimize the sensing polymerase for speed (for temporal resolution), processivity (for recording time), low pause probability (for linearity of temporal readout), total misincorporation rate (for information density) and dynamic range of misincorporation rate (for signal to noise ratio). We have shown that divalent ion concentration can be a potent, yet continuously tunable, modulator of polymerase misincorporation rates, and that such modulation can be restricted to particular template bases and base-to-base transitions. Based on its .15-fold change in misincorporation rate over the Mn 2+ range tested here, Dpo4 could act as a high resolution Mn 2+ sensor. The fact that misincorporations are largely localized to certain template bases makes it possible in principle to preserve relevant features of the template (on the non-error-prone template bases) while transmitting information at the same time (on the other bases).
Advances in fields such as neuroscience impose spatial, temporal, and combinatorial challenges of unparalleled scope, associated with the three-dimensional recording and analysis of complex cellular systems. A molecular device capable of measuring and recording sub-cellular signals, which can be manufactured and delivered to target environments in a scalable fashion, may emerge as an optimal platform for biological signal recording. However, the basic principles for designing and testing such molecular recording devices in vitro have not yet been established.
This study measures a static environmental signal -divalent cation concentration -by using DNA polymerases as molecular recording devices. The synthesized DNA strand can be considered as an archival medium, which stores the measured signal in the form of a misincorporation rate with respect to the known template. Indeed, the use of DNA as an information storage medium leverages the rapid improvement of sequencing technology, which is currently outpacing the Moore's law rate of improvement of microelectronic technology [29], and which promises to make DNA sequencing a preferred method for extracting data from biological and bio-molecular systems [30,31]. Extension of the techniques described here to time-varying signals and engineered polymerases could lead to molecular sensing technologies of unprecedented scalability.
Reagents
All primers were synthesized by IDT. All enzymes, dNTPs and buffers were from New England Biolabs (NEB) unless otherwise indicated.
Measurement of the Misincorporation Rate of Taq Polymerase
A derivative of pUC19 containing the lacZa and lacI q allele was linearized with DraII. Linearized DNA was purified and used as template in PCR reactions containing 5 U Taq DNAP, standard Taq buffer with 1.5 mM Mg 2+ , 200 mM dNTPs (Invitrogen), CaCl 2 to indicated concentrations and 0.5 mM each of the primers CLA55 (59-AGCTTATCGATAAGCGATGCCGGGAGCAGA-CAAGC-39) and CLA33 (59-AGCTTATCGATGG-CACTTTTCGGGGAAATGTGCG-39). Reactions were cycled 30 times with 1 minute of annealing at 55uC and 4.5 minutes extension at 68uC. PCR products were purified using a DNA Clean and Concentrator-5 kit (Zymo Research). After determining the A 260 , the amplified DNA was digested at 37uC for 4 h with 10 U ClaI, and purified. Ligation were performed using the NEB quick ligation kit with 50 ng of DNA, and directly transformed into DH5a E. coli and plated on LB-Carb containing 40 mg/mL X-Gal. Blue and white colonies were counted after incubation at 37uC overnight.
The error rate f was calculated as f = -ln(F)/(db) [32], where F is the fraction of white colonies, d is the number of DNA duplications and b = 349 bp is the effective target size of the 1080 bp lacI gene [19]. Error bars for the blue-white screening experiment were obtained using Poisson statistics where, for large n, the distribution is approximately Gaussian with a variance that is identical to the mean.
Primer extensions were performed as per the manufacturer's instructions (Dpo4, Klenow exo 2 , Phusion) in 10 mL reactions containing 1 mL annealing reaction, 50 mM each dNTP, and 1 mL of a 1:1000 dilution of Dpo4 (Trevigen) in Dpo4 annealing buffer, 1 mL Klenow exo 2 , or 5 mL 26 Phusion Mastermix in HF buffer, in 16extension buffer (Table S3). Primer extensions were initiated with the addition of divalent cation (chloride salt) to the reaction mixture and incubation at 37uC for 1 h, except for Phusion, which was incubated at 95uC for 10 minutes followed by 72uC for 1 h.
After primer extension, a 10 mL mixture of divalent cations was added to each well such that the final concentration in each well was normalized to 800 mM Mn 2+ , 7 mM Mg 2+ and 1 mM Ca 2+ . An automated liquid handling robot (Agilent) was used to create stocks of the divalent cations used for primer extension and salt correction in a 96-well plate format.
DNA Sequencing
Pooled PCR products were cleaned using a MinElute Cleanup Column (Qiagen) into 20 mL buffer EB, resulting in a final concentration of 300-400 ng/uL. Cleaned products were diluted to a nominal concentration of 12-14 nM, calculated using a droplet spectrophotometer (Qubit, Invitrogen), assuming a nominal average dsDNA length of 100 bp in the sample. The diluted sample (2 mL) was combined with 8 mL water, denatured with 10 mL NaOH and added to 980 mL HT1 buffer (Illumina). To introduce sufficient base diversity for baseline intensity correction during the sequencing run, 600 mL phiX paired-end library DNA (Illumina) was combined with 400 mL of the sample and loaded on a MiSeq (Illumina) for 150 bp paired-end sequencing. Approximately 4-5 pm of sample and at least 5 pm of phiX DNA were loaded in each sequencing run.
Data Analysis
Raw sequencing reads in the forward direction were filtered for the presence of the left primer binding sequence, the first 12 bp of the right adaptor sequence, and the presence of a correct barcode. Raw sequencing reads in the reverse direction were filtered for the presence of the left primer binding sequence and the barcode. Forward reads in which the sequence between the left and right adaptors did not exactly match the corresponding reverse paired end read were discarded. We also filtered out instances of a short spurious PCR product resulting from known primer dimer contamination. The raw sequence reads are available for download (NCBI accession number SRP014521). The forward reads thus filtered were aligned with the sequence of the theoretical error-free primer extension product (reverse complement of the template) using the BioPython function pairwise2. align. globalxs with gap open and gap extend penalties of 210 and 22 respectively. Sequences with length greater than or equal to 70 bases between the left and right adaptors, and alignment scores greater than 60, were selected for further analysis. Misincorporations aligned to a given template position were counted towards the tally of misincorporations at that position and with respect to its corresponding template base. Misincorporation rates were measured as ratios of the number of misincorporations at a given position or template base to the total number of events counted at that position or template base. Insertions or deletions at a given position were not counted towards the misincorporation tally nor towards the tally of total events at a position. An alternative analysis method that did not rely on alignments was also used (Text S1 and Figure S3). All data analysis was performed in Python and Matlab; code is available upon request.
Generalized Linear Model (GLM) Construction, Poisson Statistics and Auto-Correlations
Generalized linear models (GLMs) were constructed to predict the misincorporation probability at a given template position based on sequence context and secondary structure. To construct the variable to be fit (y), we took the filtered, aligned reads and removed those that contained insertions or deletions, resulting in a set of 70 nt long alignments to the first 70 bases of the template. We further ignored the first and last 3 bases of these alignments to enable the use of regional information on secondary structure. For each base in y, the regressor contained binary features representing the identity of the template base, a continuous feature representing the position in the template, and the regional secondary structure prediction at positions ranging from three bases before the template base to three bases after. Only three of the four template bases were used as explicit features, as the fourth is included in the bias term. The ensemble-averaged secondary structure of the original and swapped templates were calculated at 37uC and standard salt conditions using NuPack software [33]. The secondary structure at a given template position was defined to be the sum of the ensemble pair probabilities of the corresponding template base with respect to all other template bases, and was calculated as one minus the probability that the corresponding template base is unpaired, as evaluated by NuPack. The data sets used for GLM fitting corresponded to individual experimental replicates. GLM calculations were performed using the Matlab glmfit function with a binomial distribution. Excess lag-one errors were calculated by subtracting the error expected based on the misincorporation probability (n p /N t ) 2 , where n p is the number of errors at a particular template position within the data set, and N t is the total number of templates in the data set.
Calculation of the Shannon information Gain Per Base
Calculation of the information gain per base proceeded by a Bayesian framework. Initially equal prior probabilities were assigned to high and low cation concentrations, corresponding to one bit of missing information, i.e., p(L) = p(H) = K, where p(L) and p(H) are the probabilities that the cation concentration is in the low state or high state, respectively. Observing the misincorporation rate updated the distribution. The expected information gain (conditional entropy) is By Bayes' rule, p(H|I) = p(I|H)p(H)/p(I), where p(I|H) is the misincorporation rate per base at high cation concentration, as shown in Figure 3. The other conditional probabilities (p(H|C), p(L|I), and p(L|C)) were calculated analogously. The misincorporation probability was then calculated through marginalization, e.g., p(I) = p(I|H)p(H) + p(I|L)p(L). Inserting these expressions into the equation for expected information gain (H exp ) allowed for calculation of the number of bits of information gained per base. Text S1 Alternate Misincorporation Analysis. An analysis that uses a sliding window, as opposed to sequence alignments (main text) to determine misincorporation rates. (DOC) Table S1 Mean Misincorporation Rates. The misincorporation rate and fold-change in misincorporation rate for all conditions studied. Mean misincorporation rates are the average over the four template bases. The fold-change misincorporation rate is with respect to the lowest cation concentration in the titration. (XLS) | v3-fos-license |
2018-12-05T16:02:51.577Z | 2016-01-01T00:00:00.000 | 102464998 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBYSA",
"oa_status": "GOLD",
"oa_url": "http://www.doiserbia.nb.rs/ft.aspx?id=1450-81091603281B",
"pdf_hash": "5c13be7d92b1b257f081f6065927a6c0aaeaaab0",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119342",
"s2fieldsofstudy": [
"Agricultural and Food Sciences"
],
"sha1": "5c13be7d92b1b257f081f6065927a6c0aaeaaab0",
"year": 2016
} | pes2o/s2orc | SPECTROPHOTOMETRIC CHARACTERIZATION OF RED WINE COLOR FROM THE VINEYARD REGION OF METOHIA
Five types of red wine produced from the grape varieties from the Metohia region (vintage 2014) were characterized on the basis of their chromatic properties. The properties of bottled wines: Merlot, Vranac, Prokupac, Cabernet and Game were analyzed. Chromatic characteristics of these wines were observed four times during the year – spectrophotometer measurements were performed on wines aged 0, 4, 8 and 12 months. Intensity, hue and brilliance of color of these wines were determined (by the usual method of Glories). The amount of coloring matter was determined by the usual method of Durmishidze and the percentage of polymeric anthocyanins was calculated as well. Wine ageing decreased the color intensity while the color hue value increased. It was also found that contribution of wine color red pigment decreased with wine ageing, while the percentage of yellow pigment in wine increased. The total amount of colored substances in wines studied decreased with wine ageing, while the percentage of polymeric pigments in wine increased. This study presents the methodology for analyses of the chromatic characteristics, and explains the origin influence of wine on these properties. On the basis of these correlations the quality of red wine can be established.
Introduction
Present-day studies point to the fact that of all the foods and beverages that people consume wine is the most important source of substances playing a protective role against cardiovascular diseases, cancer and neurodegenerative diseases (Fuhrman et al., 1995;Wood et al., 1982;Okuda et al., 1992).The protective role comes from components derived from non-alcoholic wine comprising the wine polyphenols, tannins and anthocyanins in particular, which have a high antioxidant activity.Numerous studies have shown that geographical origin and grape varieties have a significant effect on the antioxidant and also on the red wine color (Budić-Leto et al., 2003;Kovač et al., 1995).
Phenolic compounds are a widespread group of plant metabolites, which can be of a very simple structure, such as phenolic acids, or of a complex structure, i.e. polycondense compounds, such as proanthocyanidins (Lekuta et al., 2005).
Four main groups of phenol compounds include phenolic acids, flavonoids, anthocyanins and tannins.The flavonoids are yellow-hued derivatives of flavone, where R and R1 are substituents (Figure 1).A related compound is the major red pigment in wine, malvidin-3monoglucoside, and anthocyanin (Figure 2).
Spectrophotometric analysis of the red wine color
The spectrum of red wine has a maximum at 520 nm, due to anthocyanins and their flavylium combinations, and a minimum in the region of 420 nm.Color intensity and hue, as defined by Sudraud (1958), only take into account the contributions of red (520 nm) and yellow (420 nm) overall colors.Of course, the results of this partial analysis cannot claim to reflect the overall visual perception of a wine color.The current approach to color analysis in winemaking requires optical density measurements at 420 and 520 nm, with an additional measurement at 620 nm to include the blue component in young red wines, so called the Glories method (1984).These measurements are used to calculate the values employed to describe wine color.
Wine color intensity (I) is an amount of color.It varies greatly in different types of wine: Wine hue (T) indicates the development of a color towards orange.Young wines have a value on the order of 0.5-0.7 which increases throughout aging, reaching an upper limit of around 1.2-1.3.Chromatic structure, i.e. the contribution (in percentage) for each of the three components of the total color: The brilliance of red wines (d) is associated with the shape of the spectrum.When the wine is bright red, the maximum spectrum at 520 nm is narrow and well defined.On the other hand, the maximum of the spectrum is relatively broad and flattened when wine is deep red or brick red.This feature can be presented as follows: Expected results are between 40 and 60 in young wines.A higher value indicates a dominance of red wine (Rib'ereau-Gayon et al., 2006).Spectrophotometric determination of the amount of coloring matters and the percentage of polymeric anthocyanins in red wine Coloring matters of red grapes and wine are anthocyanins.They are among the most important plant pigments.The grape and wine anthocyanins are mostly in the form of glycosides.Grape variety, V. vinifera, is characterized mainly by the presence of monoglucoside.The most common anthocyanins in grapes and wine are malvidin, peonidin and cyanidine.In the pink wine, the colored matter content ranges from 50 to 100 mg/dm 3 , in normal-colored red wines from 100 to 200 mg/dm 3 , and in highly colored wines, it can occur in up to 500 mg/dm 3 .
Before the spectrophotometric measurement of the amount of colored substances in a solution is performed, it is necessary to determine the light wavelength to be used in the analysis.Experimentally, it has been found that in red wines the strongest absorbance of light of wavelengths is around 530 nm, therefore, in the spectrophotometric determination of the amount of colored substances in red wine, this light of wavelength is used (Blesić, 2006).
Among the numerous methods for the spectrophotometric determination of the content of colored substances in red wine, due to the simple execution and obtaining the results of satisfactory accuracy, the method Durmishidze (1958) has been used.This method is based on the spectrophotometric determination of transparency of the defined wine solution layer and on the basis of that, it leads to the indirect determination of the content of colored compounds using Durmishidze's table, which specifies the amount of colored substances (mg in 10 cm 3 of wine, diluted according to the procedure by the author).
The determination of the percentage of polymer of anthocyanin is performed by chemical treatment of the analyzed wine by sulfur dioxide, by the Russo method (2011).Sulfur dioxide, a product of sodium metabisulfite, bleaches any monomeric anthocyanins.The residual color of the wine is derived from polymerized phenolic compounds, mostly from anthocyanins.The percentage of polymer of anthocyanin is calculated as the ratio of the absorbance obtained for the wine tested at 520 nm to the absorbance for the same wine treated with sulfur dioxide:
Material and Methods
In this study, we analyzed the red wine produced from the varieties of Metohija regions (vintage 2014).The properties of wines: Merlot, Vranac, Prokupac, Cabernet and Game were examined.Chromatic characteristics of these wines were analyzed four times during the year, and measurements were made on the wine aged 0, 4, 8 and 12 months.We considered a very young wine (zero months) the wine that was the first to be decanted and filtrated.This process enables the essential clarity of wine samples.
For spectrophotometric measurements, Spectrofotometer UV-9200 RAY LEIGH was used.The experimental part was structured into the following main parts: • Analysis of the color of red wine (chromatic parameters); • Determination of the amount of coloring matters and the percentage of polymeric anthocyanins in red wine.
Spectrophotometric analysis of the color of red wine
For this type of analysis, the Glories method was used.The spectrophotometer was equipped with the optical path length cuvettes of 1 mm, and included the possibility of reading the absorbance at light wavelengths at 420, 520 and 620 nm.The wine used for analysis must be completely clear.The intensity, hue and brilliance of tested red wines were determined spectrophotometrically by measuring the absorbance at 420, 520 and 620 nm.Distilled water was used as a blank solution.
Values of parameters of intensity and hue, as well as brilliance of wines were calculated according to the forms set out in the introductory section of this paper.
Spectrophotometric determination of the amount of coloring matters and the percentage of polymeric anthocyanins in red wine
For spectrophotometric determination of amounts of colored substances in red wine the method of Durmishidze can be used.Contents of colored matters in red wine were expressed in mg/dm 3 .Determination of the percentage of polymeric anthocyanins was performed by the Russo method.
Results and Discussion
The data presented in Table 1 show chromatic parameters of examined wines obtained by the Glories method.By the use of this method, apart from intensity, hue and brilliance of red wine, the contributions of each pigment (yellow, red and blue) to wine color were also determined.
The contribution of the red pigment was most pronounced in very young Vranac and Merlot wines (48.0% and 48.6%), while the lowest contribution was pronounced in 12-month-old Prokupac and Game wines (40.9% and 41.4%).It can be concluded that the percentage of red pigment in the color of wine increases with the aging (Birse, 2007;Harbertson and Spayd, 2006;Poiana et al., 2007).In contrast, the percentage share of the yellow pigment of wine decreased.The participation of the blue pigment in wine color was by far the least attended, it ranged from 10.6% for the young Merlot wine to a maximum of 21.2% for the 12month-old Prokupac wine.The share of the red pigment was predominant in all analyzed wines and ranges, depending on the type and age of the wine from 41.7% to 48.0%.The contribution of the yellow pigment to red wine color ranged from 36.1% to 42.3%, which is correlated with information that can be found in literature (Birse, 2007;Harbertson and Spayd, 2006;Poiana et al., 2007).The highest value of color intensity (I) was observed in young wines, especially in Merlot and Vranac (2.26 and 2.24) and the lowest value was recorded for Prokupac, aged 12 months -1.18.With wine ageing the color intensity slightly decreased.In contrast to the intensity, the value for the color hue (T) slightly increased with the process of the wine ageing (Birse, 2007;Harbertson and Spayd, 2006;Poiana et al., 2007).Thus, the maximum value for hue in a very young wine was found in Merlot -0.86, and in 12-month-old wines it is was found in Cabernet -0.99.Brilliance of wine also decreased with wine ageing and it was most pronounced in young Vranac -47.1 and the lowest value was found in 12-monthold Prokupac -27.7.
With wine ageing, the value measured at λ = 520 nm decreased, which was accompanied by an increase in the measured values of the wavelengths 420 nm and 620 nm.This can be explained by transition of monomeric anthocyanins into polymeric anthocyanins (Pasku, 2005).
Table 2 contains the values for the amount of colored substances in the red wines tested.With wine ageing, this value decreased, which was fully in line with the decline in the share of the red pigment in the color of wine.The highest value for the amount of colored matters was found in Merlot, in which the value of wine aging decreased from 309 mg/dm 3 to 226 mg/dm 3 .The lowest value of this parameter was recoded for Game wine, and that value of wine aging decreased from 150 mg/dm 3 to only 70 mg/dm 3 . 1M -Merlot, 2 V-Vranac, 3 P -Prokupac, 4 C -Cabernet, 5 G -Game, a X -Durm.
In Table 3, the values for the percentage of polymeric anthocyanins in the wines tested are given.These values increased with wine ageing.Thus, the lowest percentage of polymeric anthocyanins was found in the young Merlot wine, 42.00%.With the ageing of this wine, that percentage increased to 62.00%, for the wine aged 12 months.The highest percentage of polymeric anthocyanins was found in the wine variety Cabernet and it ranged from 64.42% for a very young wine to 84.82% for the wine aged 12 months.From the data shown in Tables 1, 2 and 3, it can be concluded that the aging of the wine is characterized by its chromatic change in the structure -it leads to the stabilization of color.The percentage of polymeric pigments in the color of wine increased by the aging process of wine.Namely, in this process the monomeric anthocyanins turn into polymeric anthocyanins with different molecular mass.In practice, this phenomenon of color evolution of red wine is called "wine ageing".Stabilization of wine color is attributed to the reduction of participation of monomeric and copigmented anthocyanins in the wine content and the formation of combinations of tannins and anthocyanins -polymeric pigments which are characterized by red color.These polymeric pigments are highly stable compounds responsible for the color of old, red wine.Copigmented anthocyanins are complex compounds which result from the reaction between anthocyanins and copigmented molecules.
Conclusion
The wine ageing process affected the structure of the wine color.The percentage of the red pigment decreased with the aging process of wine while the participation of yellow hue increased for all red wines tested.The value of the color intensity of the wine was decreased by wine ageing in contrast to the values for the color hue of wine, which increased with the wine ageing.Most wine color intensity values were found in the young wines of Merlot and Vranac, 2.26 and 2.24, respectively.The lowest value for the wine hue was found in the young Prokupac wine -0.81.The total amount of colored matters in studied wines decreased with wine ageing.The highest value for this parameter was found in the young Merlot wine -309, while the lowest value was found in the 12-month-old Game wine -70.The percentage of polymeric anthocyanins increased with wine ageing and its highest value was reached in the 12-month-old Cabarnet wine -84.82.
Table 1 .
Chromatic properties of red wine determined by the Glories method.
Table 2 .
Spectrophotometric determination of the amount of coloring matters in red wines tested.
Table 3 .
Percentage of anthocyanins in red wines tested. | v3-fos-license |
2017-10-17T07:25:21.998Z | 1991-01-01T00:00:00.000 | 34721866 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "https://actavet.vfu.cz/media/pdf/avb_1991060010003.pdf",
"pdf_hash": "d3f9c8b7504b51bd54f0e5d904c96cb01fb94650",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119353",
"s2fieldsofstudy": [
"Biology",
"Medicine"
],
"sha1": "d3f9c8b7504b51bd54f0e5d904c96cb01fb94650",
"year": 1991
} | pes2o/s2orc | SUBMICROSCOPIC STRUCTURE OF SYNOVIAL MEMBRANE IN THE ADULT PIG
Horky, D.: Submicroscopic Structure of Synovial Membrane in the Adult Pig. Acta vet. Bmo 60,1991: 3-13. The synovial membrane of adult pigs was investigated. Samples were obtained from hip joints of pigs of both sexes at 15 to 24 months after birth. The tissues were processed in the routine manner to be examined by light and transmission electron microscopy. The synovial membrane in adult pigs involved two types of synovialocytes, A and B, which were arranged on its surface in 2 to 3 layers. Type A cells near the surface presented as single cells while B cells formed small clusters. These contained. apart from typical fully differentiated cell types, also transient A-B types which had all characteristics of A cells together with bodies corresponding in size and appearance to secretory granules of B cells. The cytoplasm of both A and B cells showed the presence of intracytoplasmic filaments. Type A cells had the basal membrane while in type B cells this was absent. Near the membrane surface the fibrillar component of synovial matrix consisted of collagen fibrils which, in areas penetrated with synovialocyte projections, were unmasked and protruded into the articular cavity. In surface layers, aperiodic filaments were prevailing while towards deeper layers increasing numbers of typical collagen fibrils running in various directions were observed. Aperiodic collagen fibrils penetrating through the B-cell membrane were seen repeatedly. When approaching the cell membrane they attained a periodic appearance. SynOfJial membrane, A, B, A-B synOfJialocytes, matrix synuvialis The synovial membrane plays a major role in both physiology and pathology of the joint. This has been a reason for thorough studies of its building units, i.e. cells and intercellular matter. Even though these building elements have been investigated for nearly 250 years (Hunter 1743 see Ghadially 1983), the information is still incomplete. At first attention was given to the synovial membrane of adults in experiments with mammalian animal species and later in man. Many authors have studied and described the microscopic structure of synovial membrane under physiologic, experimental and pathologic conditions (for review see Horky 1981; Ghadially 1982). The present trend, which is to gain a deeper insight into its structure and particularly into the development of its functions in relation to advancing differentiation, makes the use of young unmature animals including embryos (for review see Horky 1984, 1989ab). The submicroscopic structure, histochemical and cytochemical properties, and immunohistochemical characteristics have been reported under physiologic and pathologic conditions in different mammalian and avian species (Langer and Huth 1960; Barland et a1.1962; Cutlip and Cheville 1973; Horky et a!. 1975; Fell et al. 1976; Linek and Porte 1978; Horky 1981, 1984, 1989ab; Ghadially 1982; Okada etal. 1981; Tofft and Ef'fendy 1985; Karatzias et al. 1986; Gaines et a1. 1987; Itokazu et al. 1988; Lukoschek et al. 1988) and others. These observations revealed the presence of two types of synovial cells in the synovial membrane of all the species so far studied. These are: i) A or M (macrophage-like) cells reminiscent of histiocytes by their structure, showing phagocytic properties (Ball et a1.1964; Fell et al. 1976; Horky et al. 1974; Mapp ad Revell 1988); ii) B or F (fibroblast-like} cells or S (secretory) cells which, in
The synovial membrane plays a major role in both physiology and pathology of the joint.This has been a reason for thorough studies of its building units, i.e. cells and intercellular matter.Even though these building elements have been investigated for nearly 250 years (Hunter 1743 -see Ghadially 1983), the information is still incomplete.At first attention was given to the synovial membrane of adults in experiments with mammalian animal species and later in man.Many authors have studied and described the microscopic structure of synovial membrane under physiologic, experimental and pathologic conditions (for review see Horky 1981;Ghadially 1982).The present trend, which is to gain a deeper insight into its structure and particularly into the development of its functions in relation to advancing differentiation, makes the use of young unmature animals including embryos (for review see Horky 1984. The submicroscopic structure, histochemical and cytochemical properties, and immunohistochemical characteristics have been reported under physiologic and pathologic conditions in different mammalian and avian species (Langer and Huth 1960;Barland et a1.1962;Cutlip and Cheville 1973;Horky et a!. 1975;Fell et al. 1976;Linek and Porte 1978;Horky 1981Horky , 1984, 1989ab;, 1989ab;Ghadially 1982;Okada etal. 1981;Tofft and Ef'fendy 1985;Karatzias et al. 1986;Gaines et a1. 1987;Itokazu et al. 1988;Lukoschek et al. 1988) and others.These observations revealed the presence of two types of synovial cells in the synovial membrane of all the species so far studied.These are: i) A or M (macrophage-like) cells reminiscent of histiocytes by their structure, showing phagocytic properties (Ball et a1.1964;Fell et al. 1976;Horky et al. 1974; Mapp ad Revell 1988); ii) B or F (fibroblast-like} cells or S (secretory) cells which, in most mammals, are characterized by a well-developed granular endoplasmic reticulum, a large Golgi complex and the presence of secretory granules.These cells have been reported by Barland et a1. (1962), Johanson and RejnO (1976), Okada etal. (1981), Horky (1984, Graabaek (1984) and others in the whole range of mammalian species.
The synovial membrane in pigs has so far received little attention.The first more detailed data were published by Roberts et al. (1969) who studied the structure of synovial membrane in femoropatellar and tibiotarsal joints in pigs at 1 day and at 2 months after birth.Further results were reported by Fell et al. (1976) who made investigations of synovialoeyte structure in metacarphophalangeal joints of pigs at 18 weeks of age and of cell behaviour in synovialocyte cultures grown in vitro for 6 days.Horky has reported (1989ab) the submicroscopic structure of synovial membrane of the hip joint in the prenatal and early postnatal periods and has also been concerned with the arrangement of intercellular matter of synovial membrane.These studies have been completed by the results presented in this paper which deals with the submicroscopic structure of synovial membrane in adult pigs.
Materials and Methods
Samples of porcine synovial membrane were obtained from 5 pigs of both sexes at 15 to 24 months after birth.The tissue was collected in all instances from the hip articular capsule and processed for examination by light and electron microscopy.The samples of synovial membrane including part of subsynovial tissue were carefully dissected into strips (1 by 1 by 2-3 mm) in a drop of fixation liquid.Immediately, the strips were fixed in glutaraldehyde (300 mmol/l) in 0.1 M phosphate buffer (PH 7.4) for 60 then 180 min.and rinsed in three fresh baths of 0.1 M phosphate buffer (PH 7.4).Fixation was carried out in 40 mmol/l OsO, in phosphate buffer (PH 7.4) for 15 and 45 min.The specimens were dehydrated in two baths with anhydrous acetone for 30 min.each.Immersion was performed in the standard way and the tissues were embedded in Durcupan ACM.Polymerization took place in an oven at 60°C for 3 days.Ultrathin sections were cut with an Ultracut Reichert ultramicrotome, stained with lead citrate according to Reynolds or with 1 % uranyl acetate followed by lead citrate.The sections were examined and photographed with a Tesla BS 500 microscope.Seinithin sections for light microscopic observations were made from the same Durcupan embedded blocks and stained with 1 % methylene blue and Azure II.
Submicroscopic structure of synovial membrane cells
The synovial membrane of adult pigs was covered with three or, in some regions four layers of cells.Synovialocytes were embedded in the matrix synovialis which made up a thick layer above them towards the articular cavity (Fig. 1).In the opposite direction they continued into the subsynovial tissue without forming any sharp boundary.Type A and type B cells were unevenly distributed in the respective layers of the synovial membrane.
Ultrastructure of type A cells
A cells in the porcine synovial membrane were less numerous than B cells.They were seen near the membrane surface as single cells (Figs 1,2,3) or in aggregates of 2 to 3 cells among type B cells.Apart from typical A cells, transient A-B form were also found.
Nucleus
It was usually oval in shape (Fig. 2) and about 8 by 3-4 pm in size.The nuclear envelope of the usual arrangement sent wide shallow invaginations against the karyoplasm (Fig. 2).The perinuclear shape was mosdy narrow, but in some areas was dilated up to 0.1-0.2pm (Fig. 2).The zonula nuc1eum limitans was seen as a continuous line (maximum 0.1 pm) along the inner membrane of the nuclear envelope (Fig. 2).Chromatin was arranged into a continuous layer at the nuclear periphery or was found as small karyoso~es on sections through the nucleus.The continuous layer was closely attached to the zonula nucleum limitans and on few occasions was interrut>ted with nuclear pores (Fig. 2).
Nucleoli were rare and, when seen, of reticular types.
Cytoplasm
The granular endoplasmic reticulum was observed in the cytoplasm of A cells as few short and flattened cisternae (Fig. 1, 2) with scarce ribosomes.
The agranular endoplasmic reticulum, most pronounced in A cells near the membrane surface, formed large vacuoles and small vesicles (plate 1.), Fig. 1).The big vacuoles usually contained material of varying appearance and density.It is possible that some of the vacuoles were secondary lysosomes.The small vesicles were either coated-vesicles or more often vesicles of uniform appearance likely to have pinocytotic function.Identical structures could also be seen on sections through cytoplasmic projections of A cells (Fig. 1).Some of the 0.3-0.4p.m vesicles Plate II., (Fig. 2) were filled with finely granulated, medium electron-dense material.These vesicles were regarded as transport vacuoles.
The Golgi complex was not well developed in the cytoplasm of A cells.It included occasional smooth vacuoles and the transport vacuoles mentioned above.
Mitochondria had the usual structure and were few in number.Some had an elongated shape and attained a length of2-3 p.m. Apart from them, some forms with markedly dense matrix were also seen (Fig. 1).Mitochondria with transparent matrix (Fig. 2) were observed mostly in cells' cytoplasmic projections.
Ribosomes were numerous and, apart from the few ribosomes attached to the outer membrane of the nuclear envelope and to cisternae of the granular ~ndoplasmic reticulum, they were diffusely distributed in the cytoplasm.This gave the cytoplasm a dark appearance.
No centrioles were found in A cells of the synovial membrane of adult pigs.Because synovialocytes were not in close contact with each other, the intercellular supporting structures such as zonula occludens, ~onula adherens and desmosomes .could not be seen either.
Cell membrane.Cross sections showed the C-cell cytoplasm sending many projections, several p.m long and considerably thick, into the surrounding matrix synovialis (Fig. 2).The projections contained cytoplasm with all the cell organelles and a markedly high number of pinocytotic vesicles (Fig. 1).
Neither lipid droplets not glycogen were observed in the tissues under study.Intracytoplasmic filaments occurred only occasionaly as thin bands of fibres, 5 p'm thick, scattered in the cytoplasm.These were vimentine filaments belonging to the cytoskeleton structures.Type A cells were found to be separated from the surrounding matrix with a distinct, though partly incomplete, basement membrane (Fig. 1, 2).
Ultrastructure of transient type cells
Apart from typical type A and type B cells, the synovial membrane also included transient type cells (A-B cells) which combined submicroscopic characteristics of both types.They were seen occasionally within groups of 2 to 3 type A cells present in the vicinity of B cells.
Nucleus
It was pear-shaped and had similar dimensions as A-cell nuclei.The nuclear envelope had the usual arrangement with the exception of the perinuclear space which was distended along the whole nuclear periphery (Plate III., Fig. 3).The inner nuclear membrane was lined with zonula nucleum limitans corresponding in appearance and thickness to that of A-cell nuclei.Chromatin was aggregated into large karyosomes situated near the nuclear envelope.The rest of the nucleus was transparent containing a low number of small chromatin clusters.Occasional perichromatin granules were present (Fig. 3).The size of a compact type nucleolus was 2.5-3 pm.(Fig. 3).
Cytoplasm
The granular endoplasmic reticulum consisted of short flattened cisternae and broadly dilated sacks with amorphous or filamentous medium electron--dense material.
The agranular endoplasmic reticulum was arranged in a way typical of A cells.Near the surface there were numerous large vacuoles (1-1.5 pm) with an electron-transparent appearance.In addition, there were unevenly distributed small smooth vesicles filled with finely granulated or filamentous material and large numbers of small smooth vesicles of agranular endoplasmic reticulum.
The Golgi complex was well formed.It involved several fields and its structures were usually dilated (Fig. 3).Its cisternae sequestered small Golgi vesicles with dark, either granulated or homogeneous content.Most of these remained in the vicinity of the complex but some could be seen scattered in the cytoplasm or cytoplasmic projections.They were similar in appearance to secretory granules ofB cells (see below) or to transport vacuoles of A cells.
Mitochondria had the usual appearance and arrangement.No dark or very light mitochondria with damaged cristae or clear matrix were observed.
Ribosomes did not differ from those of B cells in either amount or arrangement.
Lysosomes were a regular finding in the cytoplasm of transient type cells.They were present in the cytoplasm near the nucleus or in cytoplasmic projections (Fig. 3).
Similarly to A cells, no centrioles were found in the transient type cells.Cell membrane.The cytoplasm of transient type cells produced a few short cytoplasmic projections (Fig. 3).These contained cytoplasm of the same composition as was that found close to the nucleus.The cell membrane produced a lower number of pinocytotic vesicles than that in A cells and the basement membrane was not formed.
Intracytoplasmic filaments showed no difference in either appearance or arrangement as compared with those in synovialocytes of type A cells.
Ultrastructure of type B cells
When compared to type A cells, B cells were found to be the prevailing cell population of the synovial membrane.They were observed in the deeper parts of the membrane in the form of groups or small clusters embedded in the synovial matrix.In contrast to A cells, they took the shape of an irregular polyhedron, an irregular oval or an elongated cylinder (Plate IV., Fig. 4).
'Nucleus
It was irregular in shape.Its size was about 7.5 by 3.5-4 #m.The nuclear envelope arranged in the usual manner formed deep invaginations against the karyoplasm (Fig. 4) thus giving the nucleus a lobular appearance.The zonula nucleum limitans had the same width as in A cells.Chromatin was concentrated into a narrow layer along the nuclear periphery, leaving the remaining nucleus to appear very light except for several where perichromatin bodies were surrounded with chromatin.The accumulation of chromatin, presenting as so-called perinucleolar chromatin, could be seen near the nucleolus.Nuclear pores were more numerous than in the other cell types.
Cross sections through the nucleus regularly revealed nucleoli, 1-1.8 #m in size (Fig. 4) which always included nucleolonema.On rare occassions segregation ()f the pars granulosa or the pars fibrosa was seen.Cytoplasm B cells had cytoplasm with a markedly large granular endoplasmic reti-'CuI um (Figs. 4,5,6).This consisted of many narrow cisternae varying in length, filled with medium-osmiophilic, finely granulated or filamentous substance (Plate V., Fig. 5, 6).Even though the endoplasmic reticulum was very rich in cisternae, no close relation to any of the other organelles was revealed.In some type B cells the cytoplasm near the nucleus had a region where membrane structures were arranged in parallel layers.These were reminiscent of anular membranes (membranae annulatae) (Plate VI., Fig. 7).
The agranular endoplasmic reticulum presented as occasional smooth vesicles, 0.2-0.3#m, both in the cytoplasm and near the cell membrane.The vesicles were electron-transparent.
The Golgi complex was well developed.It spread over several fields (Figs 4, 5, 6, 7, 8) taking up a large part of the cytoplasm.The structure was typical.The dilated cisternae sequestered small and large Golgi vacuoles which passed to the surrounding cytoplasm as secretory granules, lysosomes or transport vacuoles (Figs 4,5,6,7,8).
Mitochondria had the usual structure.The most frequently occurring mitochondria were 1-1.5 #m long with markedly dark matrix (Figs 4, 5).Their number was much higher than in A cells.
Lysosomes were hardly discernible in the electron micrographs.Since no histological proof was produced, it was not possible to distinguish them from secretory or transport granules.
Secretory granules were conspicuous structures of the B-cell cytoplasm.They occurred in large numbers and attained a size of 0.5-0.8#m.They were bounded with a smooth membrane and contained granular or homogenous material of varying density (Figs 4,5,7,8).Some of them had lighter peripheries and darker centres (Plate VI., Fig. 8), which made them reminiscent of heterogenous prozymogen granules.Other granules (Fig. 7) were similar to coated vesicles.
Centrioles were frequently present in the B-cell cytoplasm (Figs 4, 5).They showed the usual arrangement and were seen in various parts of the cytoplasm.
Cell membrane.In type B cells the cytoplasm occasionally sent out short thin projections and thick projections.The thin ones were free from organelles ()r secretory granules, while the cytoplasm of the thick projections had the same content as that of the cell (Figs 7,8).The cell membrane segregated a lot of .pinocytotic vesicles (Figs 4,7).
Intracytoplasmic filaments were a rare finding.In B cells the penetration of collagen fibrils through the cell membrane was frequently observed (Figs 5, 6).As can be seen in Fig. 6, these fibrils arose from the content of transport vacuoles travelling towards the cell membrane.Tropocollagen was spilled onto the surface and the following polymerization produced collagen fibrils which showed the signs of periodicity (Figs 5,6).
Synovial matrix
This is generally characterized as an intercellular substance, originating from mesenchyme, which provides a specialized environment for synovialocytes.As with other mesenchymal tissues, it consists of the ground fibrillar substance and the ground amorphous substance.
In the synovial membrane of the adult pig, the ground fibrillar substance was made up of two types of fibrils.First, typical collagen fibrils, 60-100 nm thick and several I'm long, which were branched and showed a periodicity of 64 nm.Second, aperiodic fibrils about 50 nm in thickness and 0.1 I'm in length or, on rare occasions, longer.These two kinds of fibrils were observed in the cisternae of the granular endoplasmic reticulum of both types of synovialocytes.Similar findings have been made by Wassilev (1975), Ghadially (1983) and Horky (1984 in the synovial membranes of various other mammalian species. The ground amorphous substance was composed of the protein-hyaluronic acid complex and sulphonated mucopolysaccharides.The two components were visualized by electron microscopy as finely granulated, medium-osmiophilic matter present among collagen fibres.They both probably migrated into the synovial fluid, taking part in lubrication processes (Hills and Butler 1984).
In the adult pig, the synovial matrix varied in arrangement from place to place in relation to the distribution of synovialocytes.In areas where the cells were situated near the surface of the synovial membrane (Fig. 1) the surface consisted largely of parallel bundles of aperiodic filaments.These were embedded in a relatively small amount of ground amorphous substance which produced a layer at the boundary of the articular cavity.More fibrillar structures, i. e. irregularly running aperiodic filaments and collagen protofibrils, thin collagen fibrils showing periodicity, were seen in the amorphous substance at the side of synovialocytes or in deeper layers of the synovial membrane.Aperiodic filaments in close contact with the synovialocyte cell membranes were frequently observed (Figs 1,2,3).
In the regions where the cells oceurred in deeper layers and the surface of the synovial membrane was formed mostly by their cytoplasmic projections, the surface showed a different arrangement.Numerous cytoplasmic projections were present in the ground amorphous substance while the fibrillar component was considerably reduced in amount (Fig. 2).Aperiodic filaments were present in low numbers and collagen fibrils near the surface were a rare finding.Some of the cytoplasmic projections were unmasked and got in direct contact with the articular cavity (Fig. 2).A large number of collagen fibrils could be found close to the cell membranes of synovialocytes facing the deeper layers of the synovial membrane (Figs 2, 4).In the two regions of synovial membrane, collagen fibrils were observed behind the basement membrane.
Discussion
The synovial membrane is a tissue originating from mesenchyme.It provides lining for the articular fissure.Its structure is generally that of connective tissues but the cells, which form a monolayer or a mUltilayer cover, differ from the other cells of connective tissue in morphology and function.The synovial membrane arises from the original skeletal blastema during development (Andersen 1964; Stoff and Effendy 1985).The cells covering the synovial membrane surface' ate regarded as modified mesothelial cells even though they do not produce a continuous layer and are not interconnected by intercellular bridges such as desmo-• somes or zonulae occludentes, etc.It has been known that synovial cells are, segregated.from the surface and are replaced with cells proliferating from the' subsynovial layer; this is particularly obvious during inflammatory diseases.(Ghadially 1983).As shown by experiments using 3H-thymidine, the labelled cells appear in the normal synovial membrane only occasionally.Their numbers,.however, increase following experimental inflammation or partial synovectomy, . .which was demonstrated by Schulitz (1974) in the synovial membrane of rabbits.A typical feature of this tissue is the absence of neural endings.Occasionally' seen nerve fibres are autonomous fibres of vascular adventitia (Halata and Groth 1976; Knight and Lewick 1983).
The function of synovial membrane has been studied thoroughly.Evidenceobtained up to the present suggests two principal roles: (1) production of synovial fluid (2) exchange and removal of synovial fluid and cell detritus related to the arti-• cular cavity.
The articular fluid is a specific plasma transudate enriched with substances'.excreted by type B synovialocytes; this was demonstrated by Swann in 1978• and recently by other authors who studied relationships between the synovial fluid and the articular cartilage with respect to nutrition and, particularly, to• the mechanics of articular movement (Sokoloff 1980; Swann et al. 1981, 1984,. 198; Hills and Butler 1984; Sabiston and Adams 1989) or in association. with the role of enzymes in degradation processes (Krane and Amento 1983;Markowitz 1983;Dingle 1984;Gangel 1984).The finding that hyaluronicacid (non-sulphonated glycosamine glycan) is transferred to the synovial fluid was made a long time ago (Lever and Ford 1958) and re-confirmed recently (Hilbert et al. 1984).All the components of synovial membrane, excluding~ digestive enzymes, are involved in the nourishment of the articular cartilage and in lubrication qualities of the synovial fluid.The other role of the synovial membrane, i. e. removal of cell detritus, has been reported by Ball et al. (1964) and similar data were presented by Horky et al. (1974) in hemarthrosis.
The synovial membrane surface has a villous character.In different areas• ist appearance varies in relation to the state of the membrane under either physiologic or pathologic conditions.This was studied by scanning electron microscopy by Kondoh (1973), Gaucher et al. (1976) Horky (1981) and Ghadially (1983).
Synovial cells are embedded in the matrix synoviaIis whose density ranges• from low to medium values.The intercellular matter includes typical collage fibrils showing periodicity, aperiodic collagen fibrils and fine aperiodic filaments situated in the amorphous substance (Meachim and Stockwell 1979; HorkY-1981HorkY- , 1984, 1989ab), 1989ab).Collagen fibrils of typical appearance are present in greater -amounts in the deeper parts of the membrane, while near the surface the predo-_ minant fibrillar components are collagen fibrils without periodicity and periodic filaments.One of the explanations has suggested that collagen fibrils in deep Jayers are gradually disintegrated down to aperiodic filaments (Ghadially 1983) but from the data on functions of type A synovialocytes and from the morpho--logical evidence on the ability of fibrills to pass through the cell membrane (H 0 r-.kY 1981, 1984, 1~89ab) it seems more probable that this process takes the other way round.
Although the microscopic and submicroscopic structures of the synovial membrane have been studied in a great range of mammalian species (Langer and Huht 1960;Barland et al. 1962;Cutlip and Cheville 1973;Fell et al. 1976;Linck and Porte 1978;Okada et al. 1981;Horky 1981Horky , 1984)), the _ information on the synovial membrane in the pig is scarce.The in vivo structure was described by Fell et al. (1976) who were also interested in the behaviour •of synovialocytes in vitro.The ultrastructure of the porcine synovial membrane has only been studied during the prenatal and early postnatal periods (Horky 1989ab).Thus the observations presented here can be compared with our pre-• vious results obtained in the pig or with those concerning the bovine synovial membrane.
A characteristic feature of the porcine synovial membrane under study was • a mixed population of fully differentiated type A and type B cells and transient A -B cells.The distribution of the respective types was similar to that reported in the adults of other mammalian species excluding the rat (Wassilev 1975).To distinguish between them is not difficult and it is based on distinct appearances of the cytoplasm related to the presence of organelles and secretory granules.These bodies have been described in adult animals of several mammalian species .(Ghadially and Roy 1969;Linck and Porte 1978;Graabaek 1984) and in the prenatal and early postnatal periods of different mammals including man - (Horky 1981(Horky , 1984, 1989ab), 1989ab).They have been given various names and the opinions on their origin, composition and function are diverse.The results published by Linck and Porte (1978) and particularly Okada et al. (1981) and Graabaek ,(1984and Graabaek ,( , 1985) ) demonstrated that in formation of secretory granules a major role is played by the granular endoplasmic reticulum and Golgi complex.Okada et al. (1981) and also Graabaek (1984Graabaek ( , 1985) ) showed that, in contrast to A-cell .lysosomes, the secretory granules of B cells do not contain acid phosphatase but have mucopolysaccharides and glycoproteins bound to a protein carrier, which could be proved by protein digestion.
Apart from the distinct types of synovialocytes, our observations included also cells where the presence of cellular organelles was indicative of A cells but • which also contained secretory granules.These fi ldings supported our earlier view (Horky et al. 1974(Horky et al. , 1975(Horky et al. , 1981(Horky et al. , 1984, 1989ab) , 1989ab) as well as the views of other authors (Fell et al. 1976;Linck and Porte 1978;Okada et al. 1981) that trans--formation of type A and B cells and vice versa is possible and depends on the :species of the animal and its age and the physiologic state of the joint (Cutlip and Cheville 1973).In addition, Linck and Porte (1978) and Fell et al . • (1976) ascertained that this reflects functional flexibility of the synovial membrane ,and not the loss of cell function.
In comparison with the porcine foetal synovial membrane, the synovialocytes ;under study regularly involve intracytoplasmic filaments (Lazarides 1980; Horky 1984.In adulthood, type A cells of synovial membrane form basement membranes which are absent in the A cells of the prenatal and perinatal periods and in B cells (Horky 1989ab).As seen previously in cattle in the prenatal and perinatal periods (Horky 1989) and in the same periods in the pig (Horky 1989ab), collagen fibrils were able to pass through the cell membranes of B cells.Thus the designation of B cells as S (secretory) cells, based on production of various substances, is fully justified.
Fig. 1
Fig. 1 to 8 are placed on Plates I to VI at the and of this volume. | v3-fos-license |
2020-04-02T09:33:18.975Z | 2020-01-01T00:00:00.000 | 216464946 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "http://www.scielo.br/pdf/bjft/v23/1981-6723-bjft-23-e2019115.pdf",
"pdf_hash": "5309d36cf72111a3bd6daef748f6404fa71971c5",
"pdf_src": "Adhoc",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119356",
"s2fieldsofstudy": [
"Agricultural and Food Sciences"
],
"sha1": "4478b48c5c1bd465828716d7623a9f4be39adf13",
"year": 2020
} | pes2o/s2orc | Sweet potato peel flour in hamburger: effect on physicochemical, technological and sensorial characteristics
https://doi.org/10.1590/1981-6723.11519 Abstract The aim of this research was to evaluate the influence of sweet potato peel flour (SPPF) on the physicochemical, technological and sensorial characteristics of bovine hamburger. Four hamburger formulations were prepared added SPPF: F1 (0%), F2 (0.75%), F3 (1.5%) and F4 (2.25%). The flour was characterized by high levels of minerals, carbohydrate and dietary fiber, which improved the nutritional profile of the hamburger. There was an increase in moisture retention and shrinkage, as well as a reduction in fat retention and cooking yield, as the level of SPPF addition increased. The addition of flour in the product significantly reduced ( p < 0.05) the values of L* , a* and b* . Similar acceptability to the standard sample was checked for the hamburger with the addition of up to 1.5% SPPF. However, all formulations had an acceptability index greater than 70%. It is concluded that SPPF is a potential ingredient to be added in bovine hamburger, improving nutritional and technological parameters and with low influence on the sensorial gordura e no rendimento da cocção, conforme se elevou o nível de adição de FCBD. O acréscimo de farinha no produto reduziu significativamente ( p < 0,05) os valores de L* , a* e b*. Aceitabilidade similar à amostra padrão foi verificada para o hambúrguer com adição de até 1,5% de FCBD. Contudo, todas as formulações apresentaram um índice de aceitabilidade superior a 70%. Conclui-se que a FCBD é um ingrediente com potencial para adição em hambúrguer bovino, melhorando parâmetros nutricionais e tecnológicos e com baixa influência nas características sensoriais.
Introduction
Meat and meat derivatives are much-appreciated types of food by consumers as part of the regular diet. In addition, they present a positive nutritional profile, mainly regarding protein content and quality (Utrera et al., 2014). However, high meat consumption, especially red and processed meat, has been linked to the increased risk of developing diseases such as cancer (Qu et al., 2013;Zhu et al., 2013), stroke (Chen et al., 2013), diabetes mellitus type 2 (Feskens et al., 2013) and cardiovascular diseases (Abete et al., 2014). Some meat products are notable for their high consumption, among them are hamburgers, meatballs and sausages. This fact is mainly due to the practicality, ease of preparation, besides being very tasty and generally are financially affordable to the population.
Currently, the seek for safer, healthier and tastier products is eminent in the world's population. In this case, there is an encouragement to the development of products that offer a better nutritional profile (De Smet & Vossen, 2016) and which promotes a better quality of life and a reduction in the risk of development of pathologies (Domingo & Nadal, 2016). The application of alternative ingredients, such as the peel of vegetables, can be considered a potential strategy since it can increase the value-added to the product. Annually, 95% of by-products from vegetables (peels, stems, seeds and leaves) are discarded during preparation and processing (Melikoglu et al., 2013). Besides the waste of food, this fact contributes to the increase of organic waste, which damages the environment. Research has shown that the nutritional content of vegetable peels is very beneficial for human consumption. It may also contain more nutrients than the pulp itself, such as vitamins, minerals and fibers (Moo-Huchin et al., 2014).
Sweet potato is a tuberous root belonging to the family Convolvulaceae. It is widely cultivated in several countries (Shan et al., 2013), and China is the largest producer of sweet potatoes in the world (Food and Agricultural Organization of the United Nations, 2014). In 2012, the annual world production of sweet potatoes was approximately 108,004 million tons, concentrated in regions such as Asia (71.6%) and Africa (16.9%) (Food and Agricultural Organization of the United Nations, 2014). In Brazil, sweet potato ranks third place among the most consumed tuberous roots and seventeen in total crop production (Food and Agriculture Organization, 2015). The pulp is mainly composed of carbohydrates, protein, minerals and fibers (Grace et al., 2014). The peel contains even higher levels of fiber, vitamins and minerals such as potassium, magnesium and folate (Food and Agriculture Organization, 2015). The cultivars of sweet potato peel and purple pulp may contain considerable levels of acylated anthocyanins and other phenolics, which have antioxidant and anti-inflammatory functions (Grace et al., 2014). Despite this, consumption of sweet potato peel is not frequent. In that respect, the addition of this by-product to meat products, such as hamburgers, could help increase nutritional value and reduce organic waste in the environment. In addition to the nutritional question, research has already shown that the addition of sweet potato peel in meat products can maintain or even improve technological aspects such as texture and flavor (Tokusoglu & Swanson, 2014;Mehta et al., 2015). In this context, the objective of the present research was to evaluate the influence of the addition of sweet potato peel flour (SPPF) on the physicochemical, technological and sensorial characteristics of bovine hamburger.
Sweet Potato Peel Flour (SPPF) elaboration
Purple sweet potatoes (70 kg) were used, showing a good visual appearance, smooth surface without imperfections and medium size. The whole sweet potatoes (Ipomoea batatas L. (Lam.)) were washed and immersed in a sodium hypochlorite solution, with a proportion of 8 ml for each liter of water. After 15 minutes, the tubers were rinsed again under running water. The peels (2 mm thick) were manually removed with the aid of a knife and dried in a dehydrator with forced air circulation (Pardal ® , PE 60, Brazil) at 60 °C for 24 hours. Peels were grounded in a mill (Tecnal ® , Tec mill TE-633, Brazil), yielding 1.4 kg of flour. The product was packed and stored at -18 °C until analyzes were carried out.
Beef patties processing and cooking
Four formulations of hamburger were prepared, containing three independent replicates of each treatment: beef (shoulder clod) (F1: 77.9%, F2: 77.1%, F3: 76.4% and F4: 75.7%), SPPF (F1: 0%, F2: 0.75%, F3: 1.5% and F4: 2.25%), ice flakes (15%), pork fat (5%), sodium chloride (1.5%), onion powder (0.2%), garlic powder (0.2%) and black pepper. The percentages of each ingredient were defined by means of preliminary sensorial tests carried out with the product. To elaborate the hamburgers, the meat (approximately 10 kg) was ground in a meat grinder (C.A.F. ® , Brazil), on a 3 mm disk and with a temperature around 4 °C. Subsequently, the ground beef was then homogenized in a commercial blender (Super Cutter Sire ® , Brazil) for 1 minute at 9 ± 1 °C. The onion, garlic, pepper, sodium chloride, ice flake and pork fat were added to the mixture and homogenized again for 3 minutes at 9 ± 1 °C. SPPF was incorporated into the dough and homogenized for an additional 3 minutes at 9 ± 1 °C. Additional levels of ground beef and SPPF differed in each formulation as described above. The resulting dough of each formulation was shaped into hamburgers (100 g, 10 cm in diameter and 1 cm thick) using a hand-fed hamburger (Picelli ® , HP 128, Brazil). The products were stored in plastic bags of low-density polyethylene and frozen in a conventional freezer (-18 °C) for 10 days.
The frozen hamburgers were grilled on an electric plate with grill on the upper and lower sides (Britania grill ® mega 2N, Brazil) heated to 200 °C. The internal temperature of the hamburger was controlled by a digital thermometer (Tp 101 ® , Brazil) until reaching 71 °C at its geometric center (American Meat Science Association, 2015). The average cooking time was 8 to 10 minutes.
Physicochemical composition
All analyses were performed on three replicates in triplicate for SPPF and for cooked hamburgers. Moisture, ash, protein, fat and dietary fiber content were determined by the Association of Official Analytical Chemists (2011). The moisture content was determined by drying in a greenhouse (105 ± 2 °C). Fat content was determined according to the Soxhlet method, using petroleum ether. Protein was analyzed according to the Kjeldahl method. Factor 6.25 was used for the conversion of nitrogen to crude protein in hamburger and SPPF respectively. Ash was performed by a muffle furnace. Total, soluble and insoluble dietary fiber was determined by the enzymatic method. The carbohydrate content was evaluated by means of theoretical calculation (by difference) in the results of the triplicates, according to the Formula 1: The total caloric value (kcal) was calculated theoretically using Atwater factors (Atwater & Woods, 1896) for lipid (9 kcal g -1 ), protein (4 kcal g -1 ) and carbohydrate (4 kcal g -1 ).
Water activity (Aw) hamburgers were used per treatment, evaluated in five different points of the hamburger. The color was evaluated by the system of the Commission Internationale de L'Eclairage (CIE), lightness (L*), redness (a*), yellowness (b*), colorimeter reading (Konica Minolta ® , Chroma Meter CR 4400 model, Japan) with illuminating calibration D65 and angle of observation 10º, previously calibrated.
Technological analyses
Five hamburgers from each formulation were cooked in the same procedure as mentioned previously then cooled to room temperature at 23 °C for 2 h. The following cooking characteristics were evaluated: cooking yield (2) and fat retention (3) (Murphy et al., 1975), shrinkage (4) (Berry, 1992) and moisture retention (5) (El-Magoli et al., 1996). All experiments were done in triplicate. The hamburgers were measured according to the following Equations 2-5:
Sensorial analyses
Participated in sensory analyses 65 untrained volunteer subjects, hamburger usual consumers. Consumers had aged between 18 and 50 years and were recruited among students and staff of Universidade Estadual do Centro-Oeste, Guarapuava, Paraná, Brazil. For conducting the sensory test, hamburgers have been cooked as previously described. All samples were evaluated by means of an acceptance test using a nine-point hedonic scale, with extremes ranging from dislike extremely (1) to like extremely (9) (Meilgaard et al., 1999). Attributes related to appearance, aroma, flavor, color and texture, beyond overall acceptance were evaluated. For the purchase intent test a 5-point attitude structured scale was used, varying from definitely would not buy it (1) to definitely would buy it (5) (Meilgaard et al., 1999). The sensory Acceptability Index (AI) was calculated by multiplying the average score reported by consumers to the product by 100, dividing the result by the maximum average score given to the product within the hedonic scale of 9.0 points. Each sample was served to consumers in white plates coded with randomly selected 3-digit numbers in monadic form and using balanced design (Macfie et al., 1989). Sensory evaluations were performed by consumers under fluorescence lighting. After consuming each sample, the consumer was instructed to drink water for palate cleansing. Samples were evaluated in triplicate in a separate session.
Statistical analysis
The results were analyzed using analysis of variance (ANOVA). The means were compared by Tukey's test at 5% significance level (p ≤ 0.05). Software R was used to perform the statistical calculations.
Ethical issues
The study was approved by the Ethics in Research Committee of UNICENTRO, Brazil, under the case number of 608.950/2014.
Sweet potato peel contains high carbohydrate and fiber content when compared to beef which is exempt in its composition (United States Department of Agriculture, 2014). Studies have shown that adequate fiber consumption reduces the risk of developing pathologies such as cardiovascular disorders (Mirmiran et al., 2016), systemic arterial hypertension (Evans et al., 2015), diabetes mellitus (Wu et al., 2015), among others.
Moisture, ash, carbohydrate and fiber contents increased with the addition of SPPF. The highest moisture content of the SPPF hamburger is explained by the water retention property of the fibers (Célino et al., 2014), as previously reported. In addition, fibers interact with proteins of the meat, resulting in a network that prevents the translocation of water from the product to the surface (Song et al., 2016). The higher ash, carbohydrate and fiber content in F2, F3 and F4 are due to the higher amount of these nutrients present in SPPF compared to meat. Similar results were verified after the addition of orange peel flour (5%) in bovine hamburger (Mahmoud et al., 2017). Protein, lipid and caloric contents were lower for SPPF-added hamburgers since SPPF contains lower levels of these nutrients compared to meat. These results corroborate with other studies evaluating the addition of poppy seed (Gök et al., 2011) and orange peel flour in bovine hamburger (Mahmoud et al., 2017) reduces protein and lipid content. There was no significant difference (p > 0.05) between the pH and Aw results of the formulations, as reported in the literature (Longato et al., 2017). The instrumental color results of cooked hamburgers are presented in Table 2. less red and yellow, since the sweet potato peel has a light brown color. In addition, the sweet potato peel has catalytic chelating metals, such as iron and zinc, which favor oxidation of lipids and proteins present in meat (Ahn et al., 2002;Lund et al., 2007;Andrés et al., 2017). These compounds alter the color of the product, which reduces consumer acceptability (Jha et al., 2007). Garcia et al. (2009), who evaluated hamburger with dry tomato peel (1.5% to 6.0%), reported similar results.
Technological analyses
The results of the cooking characteristics of hamburgers are shown in Table 3. The shrinkage and moisture retention increased after the increase of SPPF in the hamburger, due to the high fiber content of the sweet potato peel, which retains water in the product, increasing the succulence (Anderson & Berry, 2001). However, there was a reduction in cooking yield (p < 0.05) and fat retention of SPPF hamburgers, corroborating with the literature (Gök et al., 2011). The preferential bonding of the fibers by water in detriment of fat may explain these findings (Anderson & Berry, 2001), because the fibers form gels in aqueous solution, a process called myofibrillar protein gelation (Cordeiro, 2011).
Sensorial analyses
The results of the hamburger sensory test added at different levels of SPPF are described in Table 4. Table 4. Sensory scores (mean ± standard error) obtained for the hamburger with the addition of different levels sweet potato peel flour (SPPF).
(2.25%) reduces product acceptance, due to the residual and bitter taste of phenolic compounds present in large quantities in sweet potato peel (Anastácio et al., 2016). Moreover, the addition of SPPF in the hamburger modified the texture of the dough making it more brittle, due to sweet potato peel high fiber content. Fiber hygroscopic capacity may explain this effect since they retain water inside the product (Célino et al., 2014). All formulations showed high acceptance rates (≥ 70%), which demonstrate good sensorial acceptance of the products (Corradini et al., 2014). Thus, it is demonstrated the feasibility of using SPPF as an ingredient in hamburger, which favors the consumption of healthier foods by the population.
Conclusions
SPPF can be used as an ingredient in the bovine hamburger formulation since it contains a good nutritional profile, which increases the levels of minerals, carbohydrate and dietary fiber in the meat product. Also, it has a positive influence on some hamburger technological characteristics, such as the increase of moisture retention and reduction of fat retention. An additional level of up to 1.5% of SPPF in products maintains acceptability similar to the standard sample.
The use of meal by-products in hamburger should be encouraged as it can improve their nutritional and technological characteristics and maintain sensorial acceptability. In addition, it reduces the negative effects of organic waste disposal on the environment. | v3-fos-license |
2018-04-03T01:43:23.044Z | 2007-11-05T00:00:00.000 | 205949642 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GREEN",
"oa_url": "https://escholarship.org/content/qt9fj5v7tv/qt9fj5v7tv.pdf?t=okafrx",
"pdf_hash": "1c5ad495eb7c416f7ee69fd1828da1bf45658b1d",
"pdf_src": "ScienceParsePlus",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119370",
"s2fieldsofstudy": [
"Chemistry",
"Biology"
],
"sha1": "0d20f1252c92fedd37879cf1ef378b1dbe074526",
"year": 2008
} | pes2o/s2orc | Fluorescence Studies of the Interactions of Ubiquinol-10 with Liposomes
Ubiquinone-10 plays a central role in energy production and its reduced form, ubiquinol-10 is also capable of acting as a potent radical scavenging antioxidant against membrane lipid peroxidation. Efficiency of this protection depends mostly on its localization in lipid bilayer. The intrinsic fluorescence of ubiquinol-10 and of the exogenous probe, Laurdan, has been used to determine the location of ubiquinol-10 in unilamellar liposomes of egg phosphatidylcholine (EggPC) and dimyristoyl phosphatidylcholine. Laurdan fluorescence moiety is positioned at the hydrophilic–hydrophobic interface of the phospholipid bilayer and its parameters reflect the membrane polarity and microheterogeneity, which we have used to explore the coexistence of microdomains with distinct physical properties. In liquid–crystalline bilayers ubiquinol has a short fluorescence lifetime (0.4 ns) and a high steady-state anisotropy. In a concentration-dependent manner, ubiquinol-10 influences the Laurdan excitation, emission and generalized polarization measurements. In EggPC liposomes ubiquinol-10 induces a decrease in membrane water mobility near the probe, while in dimyristoyl liposomes a decrease in the membrane water content was found. domains of gel and liquid–crystalline phases. The results indicate that ubiquinol-10 molecules are mainly located at the polar-lipid interface, inducing changes in the physico-chemical properties of the bilayer microenvironment.
INTRODUCTION
Ubiquinone-10 (UQ) is an integral redox and proton-translocating component of the mitochondrial electron transport chain (1) and it is also widely distributed in other subcellular membranes (2).
It has been well established that ubiquinol-10 (UQH 2 ), a reduced form of UQ (Scheme 1), protects either membrane phospholipids and serum low-density lipoproteins from lipid peroxidation or mitochondrial membrane proteins and DNA from free-radical-induced oxidative damage (3). The membrane presence of enzymes capable of regenerating ubiquinol through the reduction of ubiquinone, or any ubisemiquinone radicals, is critical for effective UQH 2 antioxidant activity (4). UQH 2 can act both directly, by preventing the formation of lipid peroxyl radicals and indirectly by regenerating a-tocopherol (5). UQH 2 -derived semiquinones can also generate superoxide radicals, initiating a variety of prooxidative reactions and as this depends on the membrane localizations of UQH 2 (6), its net antioxidative capacity is strongly dependent on its membrane position.
Despite many studies by different techniques such as fluorescence anisotropy and quenching of fluorescent probes (7), infrared spectroscopy (8) and differential scanning calorimetry (9), its location inside the membrane is still a matter of discussion. Recently, the intrinsic fluorescence of reduced plastoquinols and a-tocopherol have been used to observe their incorporation in liposomes (10).
In this work, intrinsic fluorescence of UQH 2 as well as the fluorescence of Laurdan (Scheme 1), an exogenous probe, incorporated in egg phosphatidylcholine (EggPC) and dimyristoyl unilamellar liposomes have been used to elucidate UQH 2 location in the bilayer.
Fluorescence measurements. Ubiquinol steady-state fluorescence anisotropy measurements were performed by using an ISS Photon Counting Spectrofluorometer, model PC1 (Champaign, IL). The excitation and emission wavelength were 290 and 360, respectively, and the excitation and emission bandwidths were 2 nm. A Schott 320 cutoff filter was used in the emission path. The computer program calculated fluorescence anisotropy by using the expression where g is an instrumental correction factor, I V and I hu are respectively the emission intensities with the polarizers parallel and perpendicular to the direction of the polarized exciting light. The anisotropy values represent the averaged values from three different samples. UQH 2 fluorescence lifetime measurements were performed at 25°C on an ISS K2 multifrequency phase and modulation fluorometer (Champaign, IL). The samples were excited using a 293 nm beam from a frequency-doubled, Nd:YAG (Coherent Antares)-pumped, rhodamine dye laser (Coherent). A Schott WG 320 long-pass filter was placed in the emission path to eliminate scatter of the excitation beam and to collect fluorescence above 310 nm. Measurements were performed using 14 modulation frequencies ranging from 10 to 300 MHz. All lifetime measurements were obtained using 2,2¢-pphenylene-bis-(5-phenyl)oxazolone (POPOP) in the reference cell. The POPOP lifetime was 1.35 ns. Phase and modulation data were fitted with a double exponential decay model using a nonlinear least-squares procedure. The program minimized the reduced chi-square defined by an equation reported elsewhere (13).
Laurdan steady-state fluorescence measurements were performed on a Perkin-Elmer LS55 spectrofluorimeter. Phospholipids and Laurdan solutions were mixed to a final probe-lipid molar ratio of 1:1000. UQH 2 in ethanol was added to LUVs at different molar ratios. As UQH 2 was always dissolved in 5 lL of ethanol, control experiments were performed with the same volume of this solvent. Fluorescence from liposome sample without Laurdan was always subtracted from the data. The fluorescent probe is located at the hydrophobichydrophilic interface of the bilayer (at the glycerol backbone) (14) and its spectral features are largely sensitive to the polarity and molecular dynamics of solvent dipoles in its microenvironment (15,16). The polarity and dynamics of the dipoles surrounding the fluorescent moiety of Laurdan are very different in the gel and in the liquidcrystalline phases of phospholipids (15,16). Below the main phase transition temperature (T m ; i.e. in the gel phase), the Laurdan emission maximum is near 440 nm, whereas above the T m (i.e. in the liquidcrystalline phase), this maximum is shifted to 490 nm (16). Laurdan emission and excitation generalized polarization (GP) spectra were derived by calculating the GP value for each emission and excitation wavelength as follows (17): where I 410 and I 340 are the intensities at each emission wavelength, from 420 to 550 nm, obtained using a fixed excitation of 410 and 340 nm, respectively.
where I 440 and I 490 are the intensities at each excitation wavelength, from 320 to 420 nm, obtained using a fixed emission wavelength of 440 and 490 nm, respectively (17). The choice of 410, 340, 440 and 490 nm for GP calculation was based on the characteristic excitation and emission wavelengths of pure gel and liquid-crystalline lipid phases (18). All spectra were normalized.
Intrinsic UQH 2 fluorescence
Normalized fluorescence emission spectra of different concentrations of UQH 2 (1, 2, 3.2, 10, 20 mol.%) in EggPC small unilamellar vesicles are reported in Fig. 1. The emission maxima, F max , show a slight redshift on increase in the UQH 2 content ranging from 358 nm for the lowest concentration to 370 nm for the highest. At all concentrations used for the experiments we did not notice any decrease in UQH 2 fluorescence intensity, indicating no aggregation of the molecules. The same samples were used to study UQH 2 steady-state fluorescence anisotropy (r s ) in EggPC and DMPC small unilamellar liposomes at 30°C (Fig. 2). At this temperature both the phospholipids are in the fluid state. In DMPC liposomes UQH 2 r s shows higher values than those in EggPC. At low UQH 2 mol.% (up to 3.2 mol.%) similar values of r s (almost close to UQH 2 fundamental anisotropy value) (10) are observed in both phospholipid liposomes without significant changes. Increasing UQH 2 content, UQH 2 r s values show a slight, but significant, decrease. UQH 2 fluorescent lifetime in DMPC liposomes was best fitted by a biexponential decay with a major component of 0.4 ns (data not shown). In Table 1 the oxidation percentage of UQH 2 by 50 mM M H 2 O 2 in EggPC small unilamellar liposomes is reported. The UQH 2 oxidation is followed measuring the decrease in absorption at 290 nm. We observe a low value of oxidation percentage and a significant oxidation decrease with increasing UQH 2 concentration.
Steady-state Laurdan excitation and emission spectra
In control experiments the spectral characteristics of the probe were unaltered by the addition of UQH 2 , indicating the lack of a direct interaction between the two compounds.
Normalized excitation and emission spectra of Laurdan in EggPC LUVs without and with 10 and 20 mol.% UQH 2 are reported in Fig. 3A,B, respectively. The measurements were performed at 23°C and at this temperature EggPC is in the fluid state. Laurdan excitation and emission spectra are indicative of a liquid-crystalline phase-the excitation spectra displays two peaks, one at $350 nm and the other at $390 nm, and the ratio of 390-350 nm band is <1, while the emission maxima are observed at 456 nm. In the presence of UQH 2 10 and 20 mol.% the excitation spectra show the ratio of 390-350 nm band >1 and are redshifted while the emission spectra are blueshifted; UQH 2 3.2 mol.% has no effect (data not shown).
Fluorescence excitation and emission maxima values of Laurdan in DMPC LUVs at 31°C with and without 20 mol.% UQH 2 are reported in Table 2. At this temperature the phospholipids are in the liquid-crystalline phase and 20 mol.% UQH 2 induces slight, but significant blueshift in the excitation and emission spectra. No significant changes in excitation and emission spectra were observed with UQH 2 3.2 and 10 mol.% (data not shown).
Laurdan generalized polarization
The wavelength dependence for Laurdan excitation (Ex GP) and emission (Em GP) parameters are measured in EggPC LUVs in the absence and in the presence of UQH 2 2, 3.2, 10, 20 mol.% at 23°C (Fig. 4A,B). In EggPC without UQH 2 the Ex GP values decrease with increasing excitation wavelength while the Em GP values show an increase with increasing emission wavelength. This behavior is characteristic of phospholipids in the liquid-crystalline phase. The presence of UQH 2 induces biphasic Ex GP and Em GP wavelength dependence pattern which is characteristic of two coexisting phases. In the Ex GP the biphasic pattern is evident at 10 and 20 mol.% UQH 2 , while in the Em GP it starts to be evident at the lowest UQH 2 concentration.
The wavelength dependences for Laurdan Ex GP and Em GP in DMPC LUV S in the absence and in the presence of 3.2, 10, 20 mol.% CoQH 2 at 31°C are shown in Fig. 5A,B, respectively. At this temperature, a typical wavelength dependence of Laurdan excitation and emission spectra indicates a liquid-crystalline phase. The presence of 10 and 20 mol.% CoQH 2 modifies the spectral appearance-the Ex GP values increase above 400 nm; the Em GP values decrease between 420 and 440 nm, leading to a negative slope, and then increase in a similar manner to the control, but with higher values. The lowest concentration of CoQH 2 (3.2 mol.%) affects very slightly both the GP spectra.
DISCUSSION
The location of UQH 2 in the biologic membranes is still a matter of discussion and its interaction with the phospholipid bilayer is not completely understood. Many physical techniques have been used to study UQ (the oxidized form) locations but corresponding studies of hydroquinones are limited. UQ would lie parallel to the membrane plane in the bilayer center (19)(20)(21) where it could also exist in the form of aggregates interdispersed among the hydrocarbon tails of phospholipids (22). In contrast, other researchers using calorimetric techniques have suggested that the UQH 2 ring (the reduced form) interacts with the phospholipid polar heads with the polyisoprene domain anchored to the hydrophobic bilayer (23). The fluorescence properties of plastoquinol, ubiquinol and a-tocopherol in solution and in model membranes have been characterized (24). Recently, the intrinsic fluorescence of plastoquinols and a-tocopherol has been used to study their orientation and dynamics in model membranes (10). UQH 2 exhibits negligible fluorescence in aqueous solutions, while in EggPC liposomes it shows a fluorescence emission spectra with a maximum that is redshifted by increasing ubiquinol concentrations. This shift could depend on changes in its fluorescence quantum efficiency which is affected by the micropolarity of the environment where it is located (24). UQH 2 steady-state fluorescence anisotropy (r s ) does not change very much up to 3.2 mol.% UQH 2 and as its fluorescence efficiency is much higher in hydrophobic than in polar solvents (24), we should measure the r s of UQH 2 molecules located in the membrane interior. This is not in agreement with the high r s and the short lifetime values we have found in fluid liposomes, indicating that UQH 2 has a distribution much closer to the polar water-lipid interface. This finding seems in accordance with the calculations made by Kruk et al. (24) who have considered the fluorescence efficiency and the molar fractions of UQH 2 molecules in polar and hydrophobic regions of liposome membranes. The small but significant decrease in r s at concentrations of 10 and 20 mol.% could reflect a slightly deeper UQH 2 location in the bilayer at increasing concentrations. These results are supported by the oxidation experiments performed in the same sample used for the r s measurements where we observed a decrease in oxidation with increasing UQH 2 concentration.
Recent experimental evidence (25), by using NMR chemical shift-polarity correlation, has shown that the hydroquinone ring is distant from the lipid-water interface. In order to obtain a further insight into the interaction between UQH 2 and the bilayer, Laurdan fluorescence spectroscopy was utilized. Laurdan shows no preferential phase partitioning between ordered and disordered lipid phases, does not have specific affinity toward any phospholipid head group and is believed to have uniform lateral and transbilayer distribution (26). Therefore we can conclude that the effects of UQH 2 on the fluorescence properties of Laurdan in EggPC and DMPC are probably due to changes in the microenvironment of the probe and not to changes in probe localization. Its fluorescent naphthalene ring is located at the hydrophilic-hydrophobic interface of the phospholipid bilayer, at $5 Å from the membrane surface (27) and its emission spectra maxima depend both on the polarity of the environment surrounding the probe and on the rate of relaxation of water molecules, or molecular residues, that can reorient around Laurdan fluorescent moiety during its excited state lifetime (28). In gel phase membranes the rate of water molecule dipolar relaxation is too slow to affect fluorescence emission, while in LC phase the dipolar relaxation occurs during the fluorescence lifetime, inducing a redshift of light emission. Thus, the emission spectral shifts we have observed and quantified by GP in EggPC and DMPC LUVs could reflect changes in the bilayer polarity (water content) and ⁄ or changes in dipolar relaxation (mobility of adjacent water molecules). Changes in polarity cause the emission and excitation spectra to shift in the same directions while changes in dipolar relaxation cause the emission and the excitation spectra to shift in opposite directions (28). Our results show that ubiquinol affects the molecular dynamics at the hydrophilic ⁄ hydrophobic membrane interface of EggPC and DMPC LUVs in a different way. In EggPC UQH 2 caused the spectra to shift in opposite directions. The excitation spectrum is redshifted while the emission spectrum shows a blueshift reflecting a decrease in the rate of dipolar relaxation of water molecules near the probe as has been described for cholesterol effect in liposomes in the LC phase (28). In DMPC in the LC phase, UQH 2 caused both the spectra to have a blueshift, reflecting a decrease in polarity around the fluorescence moiety of the probe, that means a decreased hydration of the bilayer.
The excitation spectra of Laurdan in membranes displays two peaks-one at $360 nm and the other at $390 nm. The band centered at $390 nm is a distinct feature of Laurdan spectroscopy and its intensity depends both on the polarity of the probe environment and also on the phase state of phospholipids. For Laurdan in gel-phase phospholipids this red excitation band also constitutes the excitation maximum, while in the LC phase it is less intense (29). In EggPC LUVs it displays two peaks and the ratio of the intensities of the peaks (390:360) is <1 indicating the LC phase. In the presence of ubiquinol the ratio becomes >1, indicating a gel phase which is caused most likely by the ubiquinol-induced increase in lipid molecule packing.
Laurdan spectral shifts are usually quantified in the form of GP. Useful information about the membrane state is obtained by utilizing the wavelength dependence of Laurdan GP spectra (29). A wavelength-independent GP spectrum is characteristic of the gel phase, while in liquid-crystalline phases the GP spectrum typically displays wavelength dependence, due to the dipolar relaxation process; in particular the Ex GP values decrease with increasing excitation wavelength while the Em GP values show an increase with increasing emission wavelength. In the case of two coexisting phases, the GP spectrum shows the opposite trend (i.e. the excitation GP values increase with increasing excitation wavelengths and the emission GP values show a reduction with increasing emission wavelengths). Ex GP in liquid-crystalline phase mainly reports the rate of dipolar relaxation (29), while Em GP reports the polarity of the probe environment (28,30). Thus, if the lipid molecules surrounding the probe become more densely packed, both polarity and dipolar dynamics decrease and are reported as increased Em GP and Ex GP, respectively.
The GP values and also the wavelength dependence of the excitation and emission GP spectra of Laurdan in EggPC LUVs imply the presence of the liquid-crystalline phase. Increasing concentrations of UQH 2 cause a significant increase in Ex GP in the red excitation band and an increase in Em GP in the blue emission band. These findings mean that in liquid-crystalline membranes the presence of UQH 2 induces an increase in Laurdan molecules surrounded by phospholipids much more packed, thus inducing the coexistence of gel and liquid-crystalline domains. UQH 2 induces the same GP pattern in DMPC LUVs in LC phase with a low but always significant effect. In EggPC LUVs the effects are much more evident and this different behavior could be due to a different amount of water adsorbed (31). Importantly the GP value is independent of the chemical nature of the phospholipid head group (15), but it is greatly affected by the local membrane packing that allows water to go into the membrane and to relax around the Laurdan naphthalene group.
Based on the data presented here, the ubiquinol ring is not segregated to the center of the bilayer, but it locates near the polar head group of the phospholipids where its hydroxyl groups could form hydrogen bonds with water, increasing the packing of the phospholipids. | v3-fos-license |
2018-04-03T00:28:16.422Z | 2015-12-07T00:00:00.000 | 11490910 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.nature.com/articles/srep17795.pdf",
"pdf_hash": "7c8881985d5e87ed85939ac979e09dbf42b8260e",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119417",
"s2fieldsofstudy": [
"Chemistry",
"Biology"
],
"sha1": "7c8881985d5e87ed85939ac979e09dbf42b8260e",
"year": 2015
} | pes2o/s2orc | Molecular Assembly of Clostridium botulinum progenitor M complex of type E
Clostridium botulinum neurotoxin (BoNT) is released as a progenitor complex, in association with a non-toxic-non-hemagglutinin protein (NTNH) and other associated proteins. We have determined the crystal structure of M type Progenitor complex of botulinum neurotoxin E [PTC-E(M)], a heterodimer of BoNT and NTNH. The crystal structure reveals that the complex exists as a tight, interlocked heterodimer of BoNT and NTNH. The crystal structure explains the mechanism of molecular assembly of the complex and reveals several acidic clusters at the interface responsible for association at low acidic pH and disassociation at basic/neutral pH. The similarity of the general architecture between the PTC-E(M) and the previously determined PTC-A(M) strongly suggests that the progenitor M complexes of all botulinum serotypes may have similar molecular arrangement, although the neurotoxins apparently can take very different conformation when they are released from the M complex.
It seems that NTNH and other proteins produced simultaneously by the bacteria with the BoNT must have important role(s) to play in the intoxication process. It is known that progenitor toxin complex protects the neurotoxin during exposure to harsh conditions found in the stomach and small intestines where it is exposed to acidic pH (2.0) and peptidases like pepsin. In spite of these harsh conditions, the toxin and other components of the complex can be detected in the general blood circulation. The idea that they play an important role is also based on data that suggest drastically-enhanced oral toxicity of the progenitor toxin compared to the purified BoNT 10 . Also, the NAPs bind to glycoproteins on the surface of the epithelial cells for transcytosis of toxin. The mechanism by which the neurotoxin is protected by the NAPs or the precise mechanism of transcytosis is not yet known. While some of the NAPs of serotypes A, B, C and D show hemagglutinin activity none of the NAPs of E and G shows any hemagglutinin activity.
Three-dimensional structures of the PTC molecular assembly are necessary to understand the mechanism by which the toxin is protected from adverse environment of gastrointestinal tract by the associated proteins and the transcytosis of toxin from epithelial membrane into general blood circulation. The crystal structure of a reconstituted progenitor M complex of type A botulinum neurotoxin has been solved, where the toxin is an inactive triple mutant 11 . Low resolution cryo-EM structures of PTC-A(L), PTC-B(L) and PTC-E(M) have also been reported 12 . Also, a reconstructed model of PTC-A(L) combining EM and individual X-ray structures has been reported 13 . Here we are reporting the X-ray structure of PTC-E(M) to understand the molecular basis for the assembly (at low pH) and disassembly at neutral and basic pH. We have used EM and X-ray crystallography to unravel the conformational changes accompanying the assembly of the complex. While the crystal structure of PTC-A(M) is made of an inactive triple mutant of BoNT/A and a recombinant NTNHA, PTC-E(M) complex used in this study is purified from clostridium culture and was fully active. The domain organization in uncomplexed BoNT/A and BoNT/E structures are drastically different raising an interesting question about their respective conformations in the complex, PTC 14,15 . This is the first crystal structure of an active PTC of any serotype.
Results and Discussion
Crystal structure of PTC-E(M) complex. The crystal structure determination of PTC-E(M) complex is described in Methods section. PTC-E(M) comprises BoNT/E holotoxin (1251aa & 144 kDa) and NTNHE (1162aa & 137 kDa) both of very similar molecular mass. PTC-E(M) crystallized in space group P3 1 with three complexes per asymmetric unit. The final R and R-free values are 0.24 and 0.32, respectively. The quality of the structure was validated by Procheck 16 . The two molecules have a very similar fold in spite of low sequence homology (21.7% identity), each consisting of three similar domains (Fig. 1a). In this paper the three domains of BoNT/E are called LC, HN and HC corresponding to the light chain (catalytic domain), the N terminal half of the heavy chain (translocation domain) and the C terminal half of the heavy chain (receptor binding domain), respectively. The corresponding domains of NTNHE are called nLC, nHN and nHC following the convention of Gu et al. 11 . The two molecules form a heterodimer related by a near two fold symmetry and agree with an rmsd of 7.2 Å for 829 Cα pairs (Fig. 1b). BoNT/E is un-nicked and the disulfide bond connecting the light and heavy chain is clearly visible in the electron density map. A representative electron density region is shown in supplementary material ( Supplementary Fig. S1). The three complexes in the asymmetric unit agree with an rmsd of ~0.5 Å.
BoNT/E and NTNHE form a tight complex with about 30255 Å 2 buried surface area together (about a third of the total surface area of the complex). The binding domains HC and nHC face each other and are in the middle of the complex providing most of the interactions at the interface (Fig. 2a). The binding domains are swapped such that nHC is closer to LC + HN of BoNT/E and HC closer to those of NTNHE. Recently, a sequence motif (QXW) responsible for sugar binding has been identified in the trefoil fold region of NTNHE 17 . In the crystal structure of PTC-E(M), the trefoil folds of both nHC and HC come together and point in the same direction with both the sugar binding region of NTNHE and the ganglioside/protein receptor binding region of BoNT/E available for binding to glycans of the epithelial cell walls. The two glycan binding sites may act synergistically on the cell surface to promote the toxin transcytosis (Fig. 2b). The HC of BoNT/E makes contact with all three domains of NTNHE and vice versa. In summary, there are 224 non-bonded interactions (<4 Å) between the two with fifteen of them being hydrogen bond or salt bridge interaction. Also, a few acidic residues from both molecules make strong hydrogen bond interactions at the pH (<5.0) used for crystallization. As discussed later these provide the necessary interactions to keep the complex together at acidic pH. While HC, HN, nHC and nHN all interact with one another, LC and nLC are at the two extremes of the complex and do not interact. There is one salt bridge between the LC and nHC (K342 and D1149, respectively). Both LCs are exposed to solvent region. Interestingly, the active site is exposed to the solvent as in the crystal structure of BoNT/E in the uncomplexed form (hereafter referred to as BoNT/E(UC)) 14 . Superposition of BoNT/A LC in complex with SNAP25 peptide 18 shows that SNAP25 can occupy a similar site in PTC-E(M) ( Supplementary Fig. S2). This may be the reason for SNAP25 being cleaved in vitro by PTC-E(M) when BoNT/E is in unreduced condition 19 . This is contrary to the known fact that the native BoNT/E must be reduced and nicked for SNAP25 cleavage. However, the physiological relevance of this is not clear since SNAP25 is not present in GI tract and BoNT/E is specific for neuronal SNAP25. It is suggested that BoNT/E in PTC-E(M) is in a proper conformation for SNAP25 to be cleaved without the need for reduction of disulfide bond and separation of LC from the rest of the molecule.
Although PTC-E(M) was crystallized at an acidic pH, given the known sensitivity of the complex to the buffer conditions, we asked if the crystallization mother liquor had had an influence on the interface between BoNT/E and NTNHE. We therefore determined a 17-Å resolution negative stain EM structure of the M-particle in the purification buffer of (50.0 mM MES and 100 mM NaCl -pH 5.0) ( Supplementary Fig. S3). The overall size and shape was similar to a previous low-resolution EM map determined from a preparation of heterogeneous PTC-E(M) complexes 12 . By docking the PTC-E(M) crystal structure into our EM map, we found that the solution structure of the M-particle was very similar to the crystal structure, except for a minor and ~9° correlated tilt of both HC and nHC ( Supplementary Fig. S3). Therefore, the interface between HC and nHC observed in the crystal structure appears to be a faithful description of the native M-particle structure.
Both BoNT/E and NTNHE undergo conformational change when the complex associates or disassociates. The crystal structure of BoNT/E(UC) showed a different type of domain organization compared to BoNT/A or BoNT/B and the difference is not due to the pH of crystallization or crystal packing. A flexible linker (region 830-845) connecting the HN and HC domains enables this change in conformation possible 14 . The HC (in BoNT/E) is rotated by ~120° with respect to HC of BoNT/A or B. The conformation of HC of BoNT/E in PTC is different from that of BoNT/E(UC). It rotates further by another ~60° from that of BoNT/E(UC) (Fig. 3). Presumably, when BoNT/E separates from the complex it changes its conformation to increase the domain-domain contact. Indeed, the contact surface area between the HC domain and the rest of BoNT/E increases from 2833 Å 2 to 3848 Å 2 and the number of interactions correspondingly increases from 115 to 165 to make the protein more stable and globular. In addition, the rotation of HC on release from the complex puts the ganglioside binding region on the same side of transmembrane region in the translocation domain (N terminal end) facilitating faster translocation of the toxin 14 .
NTNHE is a dimer in solution.
Because the crystal structure of NTNHE alone was unknown, it was unclear whether NTNHE underwent similar structural changes upon binding with BoNT to form the M-particle. We therefore carried out EM of the purified NTNHE diluted to a concentration of ~0.05 mg/ml. Surprisingly we found that NTNHE formed a dimer in solution (Fig. 4). Some of the reference-free 2D class averages of the NTNHE EM images clearly showed mirror symmetry (Fig. 4A,B). Blue Native gel also showed that the purified NTNHE formed a dimer in solution even at a modest concentration of 1.0 mg/ml ( Supplementary Fig. S4). We went on to determine a 3D reconstruction of the NTNHE dimer (Fig. 4C). We found that the conformation of NTNHE in the PTC-E(M) had to be modified in order to fit the EM density of NTNHE dimer (Fig. 4C,D). Specifically, the binding domain (nHC) had to be rotated up towards the nHN domain by ~50°.
When BoNT/E separates from the complex the binding domain of NTNHE will lose its interaction with the binding domain of BoNT/E exposing its hydrophobic regions. The EM study of the uncomplexed NTNHE shows that it forms a dimer in solution. The binding regions rotate to form a tight complex with the binding domains of the two protomers interacting. The binding domain of the other protomer of the NTNHE dimer compensates any loss of interaction with BoNT/E binding domain. Therefore, it appears that both BoNT/E and NTNHE proteins undergo drastic changes at the HC/nHC regions when forming
Acidic interactions responsible for tight complex formation and the separation at neutral and basic pH. PTC-E(M) complex is formed by
BoNT/E and NTNHE and the complex is stable at pH 6.0 or below based on equilibrium and kinetic binding analysis of these two proteins in purified forms 21 . When the complex enters the general circulation it disassociates at neutral pH. There are 224 non-bonded interactions between the two proteins and several hydrogen bond contacts. Of special interest is the hydrogen bond interactions formed between acidic residues (Glu, Asp and His) from the two partners. We have identified six such interactions where the acidic side groups form hydrogen bond or near hydrogen bond interactions. They are BE:Asp469-NTNHE:Asp1149, BE:Glu558-NTNHE:Glu571, BE:Asp598-NTNHE:Asp954, BE:Asp817-NTNHE:Glu899, BE:Asp1013-NTNHE:Asp774 and BE:His1231-NTNHE:Glu795 (Table 1 and Supplementary Fig. S5). At the crystallization condition (pH < 5.0) these residues are most likely protonated and hence not charged. The PTC complex is supposedly intact when it resides in the gut and gets separated when they are released into general circulation at neutral or higher pH. We propose that the neutral or basic pH causes the acidic side chains to deprotonate and become negatively charged. The repulsion between the negative charges causes the two component proteins to separate, leading to the dissolution of the M complex.
Do these acidic interactions alone act as pH sensors ? Analysis of the interface between NTNHE
and BoNT/E brings out interesting features about the interface. It is true that there are specific acid-acid interactions between the partners. But in addition, many acidic residues from both partners cluster around these specific interactions (Fig. 5). There are six such clusters as shown in the figure. Acidic residues in each cluster are within 15 Å radius. Since electrostatic forces have long-range effects, these negative charges in such close proximity increase the force of repulsion causing the partners to dissociate at neutral pH when they get deprotonated and negatively charged ( Supplementary Fig. S6). We conclude that association or disassociation is not solely due to any single or a few interactions but is the sum total effect of all these repulsive forces.
Comparison of PTC-A(M) and PTC-E(M). Crystal structure of a reconstituted PTC-A(M) from an
inactive triple mutant of BoNT/A and recombinant NTNHA has been reported 11 Fig. S7). In PTC-A(M) there are no interactions between the LC of the toxin to any residue of NTNHA. It is to be noted that Lys342 is in the 350 loop which can undergo some conformational change 18 . Also, the corresponding residue in BoNT/A is a phenyalanine. The acidic residues clustering at the interface of toxin and NTNH are mostly conserved in PTC-E(M) and PTC-A(M). Of the forty acidic residues forming the clusters in PTC-E(M), about 58% are conserved in PTC-A(M). They can be grouped into six clusters as in PTC-E(M). The loss of non-conserved acidic residues is compensated by nearby acidic residues contributing to the acidic nature of the cluster and thereby to the dissociation at neutral pH. As shown for PTC-E(M) (Fig. 5), the acidic residues at the interface within a distance of 15 Å of one another are shown in Supplementary Fig. S8. Accordingly, the dissociation mechanism of PTC-A(M) may be similar to PTC-E(M).
The missing n-loop in NTNHE.
Though NTNHA and NTNHE share 66% sequence identity, a short loop region (G116-A148) called "nloop" in NTNHA is absent in NTNHE. This region is not visible in the electron density map of PTC-A(M) may be because it is nicked or disordered in the crystal structure. It is assumed that this region would interact with the HA protein in larger complexes (L or LL). The sequence corresponding to the nloop is absent in serotypes A2, E and F and accordingly it was believed that these serotypes cannot form higher MW complex with HA proteins. However, it has been shown that BoNT/E does form an L complex 19 . The function of nloop and its importance in forming larger complexes needs further investigation. BoNT/E and NTNHE form a tight complex by swapping HC and nHC. 4. In the M-complex the binding domain of neurotoxin is surrounded by all three domains of NTNHE. 5. The trefoil folds of both BoNT/E and NTNHE come together and point in the same direction facilitating synergistic binding to epithelial cell. 6. A number of acidic interactions play a role in association at low pH and disassociation at neutral or higher pH. 7. There are a number of acidic clusters involving acidic residues from both BoNT/E and NTNHE at the interface. 8. Our structural analyses suggest that there may not be a single pH sensor that is responsible for the M complex disassociation; rather, we believe it is the net repulsion force between opposing acidic clusters as they are deprotonated and become charged at higher pH that drives apart BoNTE and NTNHE.
Methods
Handling of toxin complex. Botulinum neurotoxin is classified as Select Agent Category A by the CDC and accordingly strict compliance to CDC specifications was followed. PTC-E(M) was isolated and purified in BSL3 lab at UMASS, Dartmouth registered with CDC. Crystallization was in a BSL2 level at Brookhaven National Laboratory registered with and certified by CDC for working with Select Agent, botulinum neurotoxin. Crystallization, structure determination and refinement. PTC-E(M) at a concentration of 7 mg/ml in a buffer containing 25 mM MES, 100 mM NaCl and 1.0 mM glutathione (pH 6.0) was used for screening crystallization condition using commercially available crystallization screens. Long needle like crystals were obtained with 10% PEG 4000 and sodium acetate buffer at pH 4.6 as precipitant. Crystals grew slowly and were stable for nearly two weeks. Crystals were mounted in cryo loops and flash frozen in liquid nitrogen using the mother liquor augmented with 20% glycerol as cryo protectant.
Preparation of PTC
X-ray diffraction data were collected at beamline X29 of National Synchrotron Light Source (NSLS), Brookhaven National Laboratory. Crystals diffracted at least to 3.0 Å resolution. Data corresponding to ф = 360° were collected at 0.5° interval to obtain redundant data. PTC-E(M) crystallized in space group P3 1 with three PTC-E(M) complex (BoNT/E and NTNHE) per asymmetric unit and the Matthews coefficient was calculated to be 3.77 Å 3 /Da corresponding to 68% solvent content by volume. Data were processed using HKL-2000 23 . Data processing statistics and unit cell parameters are given in Table 2.
Crystal structures of BoNT/E holotoxin 14 and the NTNHA of PTC-A(M) 11 were used as search models to determine the structure of PTC-E(M) by the molecular replacement method. While the NTNHA molecule was used as a whole, the BoNT/E model was used as two parts in the structure solution process since it is known that the HC of BoNT is flexible. A total of three search models, i) the whole molecule of NTNHA, ii) catalytic and translocation domains of BoNT/E toxin, and iii) the binding domain of BoNT/E 11 were used in PHASER in CCP4 suite 13,14 .
The solution with three molecules of BoNT/E and NTNHE complex refined well in the space group P3 1 . Rigid body refinement was carried out initially with four rigid bodies per molecule, i) catalytic and translocation domains of BoNT/E toxin, ii) catalytic and translocation domains of NTNH/A, iii) the binding domain of BoNT/E, and iv) the binding domain of NTNHE. Then the model was refined with Crystal Data six rigid bodies, three BoNT/E and three NTNHE molecules. Electron density map was calculated at this stage and all three complex molecules were independently checked to identify any possible dissimilarity between copies. Since no difference was found between non-crystallographic symmetry (NCS) related molecules further refinements were carried out with NCS constraints between copies. COOT and Refmac 5.7 were used for model building and refinement, respectively 24 . Refinement statistics are given in Table 2.
EM studies of M complex and NTNHE. EM grids were prepared in a specially designated biosafety lab (BSL2). The purified M complex or NTNHE was stained in 2% uranyl acetate aqueous solution.
Electron microscopy was carried out in a JEOL 2010 F TEM operated at 200 kV. Electron micrographs were recorded at a magnification of 50,000× in a 4 K by 4 K Gatan Ultrascan CCD camera. For the M-complex, we picked 10769 particles, computationally sorted the raw particle images into 100 classes in EMAN2. Many well-defined 2D class averages were obtained. We rejected raw particle images that did not produce good class averages. After such rejection, 6657 particle images remained in the final data for 3D reconstruction. For NTNHE, we picked 10039 particles, only kept 3371 particles after reference free 2D classification. Initial model calculation and 3D refinement was performed in EMAN2, and the estimated final resolution was ~18 Å. The 3D surface rendering was prepared by UCSF Chimera. | v3-fos-license |
2018-06-15T00:15:43.345Z | 2018-03-16T00:00:00.000 | 48352638 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.1016/j.dib.2018.03.053",
"pdf_hash": "00da16c9e1de3867d42b3e637ddeb3cbfe89b7a8",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119429",
"s2fieldsofstudy": [
"Materials Science",
"Environmental Science",
"Chemistry"
],
"sha1": "00da16c9e1de3867d42b3e637ddeb3cbfe89b7a8",
"year": 2018
} | pes2o/s2orc | Data on sorption of organic compounds by aged polystyrene microplastic particles
This article contains data on experimental sorption isotherms of 21 probe sorbates by aged polystyrene microplastics. The polymeric particles were subjected to an UV-induced photo-oxidation procedure using hydrogen peroxide in a custom-made aging chamber. Sorption data were obtained for aged particles. The experimental sorption data was modelled using both single- and poly-parameter linear free-energy relationships. For discussion and interpretation of the presented data, refer to the research article entitled “Sorption of organic compounds by aged polystyrene microplastic particles” (Hüffer et al., 2018) [1].
a b s t r a c t
This article contains data on experimental sorption isotherms of 21 probe sorbates by aged polystyrene microplastics. The polymeric particles were subjected to an UV-induced photo-oxidation procedure using hydrogen peroxide in a custom-made aging chamber. Sorption data were obtained for aged particles. The experimental sorption data was modelled using both single-and poly-parameter linear free-energy relationships. For discussion and interpretation of the presented data, refer to the research article entitled "Sorption of organic compounds by aged polystyrene microplastic particles" (Hüffer et al., 2018) [1].
& 2018 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Analyzed data Experimental factors
Polystyrene microplastics were exposed to an UV-induced photo-oxidation procedure with H 2 O 2 Experimental features Sorption isotherms of 21 probe sorbates were performed using UV-aged polystyrene microplastics as sorbent Data source location Vienna, Austria Data accessibility The data are available within this article Value of the data • Sorption isotherm data for UV-aged polystyrene microplastic were determined for 21 molecular probe sorbates covering a broad spectrum of molecular substance classes. • Modelling data provided information for the interpretation of molecular interactions between UVaged polystyrene microplastics and organic compounds. • Modelling data are valuable for the prediction of sorption by UV-aged polystyrene microplastics and allow a comparison with data from other aging processes and environmentally relevant polymers particles.
Data
Physico-chemical properties of the probe sorbates are given in Table 1. Fig. 1 shows sorption kinetics data of naphthalene by aged polystyrene microplastics (PSMP). Freundlich model fit data from sorption isotherms are shown in Table 2. A comparison of Freundlich fit model data between pristine and UV-aged polystyrene microplastics is given in Table 3. Data from statistical analyses of poly-parameter linear free-energy relationship model are shown in Tables 4-7. Single-parameter [4] or calculated using a combination of Eq. (6)-(15) and (6)-(17) from ref [4]: linear free-energy relationships for sorption of organic compounds by PS micro-and nanoplastics are given in Table 8. Fig. 2 visualizes the correlation between experimental distribution coefficients of probe sorbates by aged polystyrene microplastics and octanol-water partitioning coefficients.
Materials
Polystyrene microplastics were purchased as a powder from Goodfellow Cambridge Ltd. (Huntingdon, UK.). The particles were sieved to a size fraction between 125 and 250 µm. The sorbates included apolar aliphatics, monopolar aliphatics, bipolar aliphatics, non-polar aromatics, monopolar aromatics, and bipolar aromatics (Table 1). Table 3 Comparison of Freundlich parameters obtained for pristine and aged polystyrene microplastic particles.
Aging of polystyrene microplastic particles
A custom-made aging chamber was used for particle aging. The particles were weighed into quartz glass petri dishes containing 50 mL of H 2 O 2 (10 vol%). The samples were then irradiated for 96 hours using UV light (4*15 W UVC-bulbs, max. wavelength at 254 nm). The aged particles were washed with deionized water and dried prior to the sorption batch experiments.
Sorption experiments
20-60 mg of the sorbent particles were weighed into 20-mL amber headspace screw vials. 10 mL of 0.01 M CaCl 2 was added as background solution. The vials were closed with screw caps with butyl/ PTFE-lined septa and wrapped in aluminum foil. After shaking overnight at 125 rpm to pre-wet the sorbent, the samples were spiked with sorbate standard solutions (methanol did not exceed 0.5%, to avoid co-solvent effects). The vials were then shaken for 7 days at 125 rpm for equilibration at a temperature of 25 7 2°C. Equilibration was determined using naphthalene as a probe sorbate (Fig. 1). The vials were then placed on the tray of the autosampler at least 2 hours prior to analysis. The concentrations in the head space of the vials was measured with a GC-MS-system either using intube microextraction or direct injection of 500 µL of the headspace sample. The sorbed concentrations were calculated using a mass balance and the air-water partitioning constants of the sorbates ( Table 1).
Data analysis
Distribution coefficients between the aqueous phase and the sorbent (K d ) [L/kg] were calculated for all sorbates at a constant sorbate loading on aged PSMP of 1000 µg/kg, using the Freundlich equation: where C s [μg/kg] and C w [μg/L] are the sorbed and aqueous concentrations of sorbates at equilibrium, respectively, and K F [(μg/kg)/(μg/L) 1/n ] and n [-] are the Freundlich coefficient and exponent, respectively. Model parameters were obtained using Sigma Plot 12.0 software for Windows.
Declarations of interest
None.
Transparency document. Supplementary material
Transparency document associated with this article can be found in the online version at http://dx. doi.org/10.1016/j.dib.2018.03.053. | v3-fos-license |
2017-05-02T21:07:24.415Z | 2014-12-01T00:00:00.000 | 44236269 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.5562/cca2438",
"pdf_hash": "45eb932c174b219932831f74324b6c1843d4c7fa",
"pdf_src": "ScienceParseMerged",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119434",
"s2fieldsofstudy": [
"Chemistry"
],
"sha1": "f11fc8b1687edd64552fb7a8358ef7d8ff0e3450",
"year": 2014
} | pes2o/s2orc | UV Photoelectron Spectroscopy and Outer Valence Electronic Structure of Dihalobenzenes
The electronic structures of nine dihalobenzenes (C6H4FX; X = Cl, Br, I) have been studied by UV photoelectron spectroscopy (UPS) and assigned by comparison with the reported spectra of monohalobenzenes (C6H5X; X = Cl, Br, I). and quantum chemical calculations. Our results show that the fluorine substituent modifies energies of πand halogen lone pair orbitals to a significant degree depending on its location (topology). We also demonstrate that the inductive effect of fluorine atom on the benzene ring can be readily observed and interpreted.
INTRODUCTION
In their recent work Antal et al. considered the influence of through-bond and through-space interactions on the shape of molecular electron density. 1 The authors used theoretical method of shape analysis to provide quantitative measure of through-bond (TB) and through-space (TS) effects.Because of our long standing interest in the analysis and systematization of halogen substituent interactions in halobenzenes, we provide in this note some experimental results which can be useful for assessing the validity of theoretical concepts attached to TB and TS effects.We used accurate vertical ionization energies (which are good approximations of orbital energies) obtained from UV photoelectron spectroscopy (UPS) as the quantitative probe of TB and TS effects.Antal et al. 1 selected substituted styrene derivatives as their test case.However, we use smaller dihalobenzenes, because they exhibit well resolved spectral bands thus allowing accurate ionization energies to be measured; this would not have been possible with larger styrene derivatives where the bands can be expected to overlap in the spectra.Furthermore, the unambiguous spectral assignments for our molecules can be readily obtained using the empirical arguments.These arguments can thus support any conclusions drawn from theoretical calculations.
EXPERIMENTAL
Samples of the compounds studied in this work were obtained from Sigma-Aldrich.The photoelectron spectra (Figures 1-9) were recorded on the Vacuum Generators UV-G3 spectrometer and calibrated with small amounts of Xe gas which was added to the sample flow.The spectral resolution in HeI spectra was 25 meV when measured as FWHM of the 3p -1 2 P 3/2 Ar + ← Ar ( 1 S 0 ) line.The vertical ionization energy values have been determined at the band maxima.All the samples were liquids and their spectra were recorded at room temperature.The measured spectra were reproducible and showed no signs of decomposition e.g.no sharp peaks corresponding to possible small molecules (decomposition products) were observed.The spectra were reproducible over long time intervals.The quantum chemical calculations were performed with Gaussian 09 program 2 and included full geometry optimization of neutral molecules using B3LYP functional, 6-31G* basis set on all atoms except iodine where Stuttgart effective core potentials was used. 3he vibrational analysis confirmed that the resulting geometry was the true minimum (no imaginary frequencies).Subsequently, the optimized DFT geometry was used as the input into the single point calculation using the outer-valence Green's function (OVGF) method and the same basis sets. 3This method obviates the need for using Koopmans approximation and provides vertical ionization energies with typical deviation of 0.3-0.5 eV (depending on the size of the basis set) from the experimental values.
RESULTS AND DISCUSSION
The photoelectron spectra are shown in Figures 1-9 and their assignments are summarized in Table 1.We shall briefly discuss the generic assignment of the spectra first and then focus on the substituent effects which can be discerned from the spectra.
It is well established that in the UPS spectra of monohalobenzenes the lowest ionization energies correspond to π-ionizations (π 3 and π 2 orbitals) from HOMO and SHOMO orbitals.The next two bands at higher ionization energies correspond to halogen lone pairs of Cl, Br or I.][6][7] This well established, empirical assignment (Scheme 1) allows us to readily assign our spectra as well (Table 1) and furthermore, it is also supported by the results of OVGF calculations (Table 1).
Before discussing inductive and resonance effects we recall several of their basic characteristics.The inductive effects operate via the network of σ-bonds and are therefore of predominantly TB type.The inductive effects are electrostatic in nature.The resonance effects depend on orbital overlap (often involving π-orbitals).Therefore the resonance effects involve predominantly (but not exclusively) TS interactions.The inspection of Table 2 shows several distinct trends regarding the influence of substituent topology on the electronic structure of dihalobenzenes.We also recall that the fluorine substituent acts on the aromatic system mostly in an inductive manner.We discuss next the orbital energy effects deduced from the spectra.
1.
Energy splitting between π-orbital energies Δπ (Δπ = π 3 -π 2 ) can be taken as an indicator of the π-electronic structure of the molecule.Δπ increases in para-substituted C 6 H 4 FX and decreases in meta-and ortho-isomers (all measured relative to the Δπ in the corresponding C 6 H 5 X; X = Cl, Br, I).The energy splitting between two halogen lone pairs in the C 6 H 4 FX molecules (Δn X ) remains virtually unchanged in the ortho derivatives, but is reduced in the meta-and para-isomers as shown in Table 2 (changes are measured again vs. Δn X in the corresponding C 6 H 5 X; X = Cl, Br, I).
2.
In order to monitor the inductive effects we calculated average values of π and n X orbital ionization energies which we designate as <π> and <n X >, respectively.The results in Table 2 show the effect of fluorine on <π>; in C 6 H 4 FX <π> does not depend markedly on the position of the fluorine substituent (the variations are < 0.1 eV).The C 6 H 4 FI isomers are an exception.In these molecules the location of fluorine substituent has large influence on the <π> values; the strongest effect occurs in the ortho-isomer.Similar, limited influence of topology of fluorine substitution is evident for halogen lone pairs <n X >.However, the C 6 H 4 FI isomers once again show stronger dependence of <n X > on the position of the fluorine atom.
The qualitative rationalization of these trends can be made with reference to the Scheme 1 as follows.
Ad 1.In para-C 6 H 4 FX isomers the electron rich fluorine atom is located close to the maximum of the electron density of the HOMO, but not of SHOMO π-orbital.This can be expected to destabilize the HOMO more than the SHOMO and thus increase the Δπ value.In the ortho-and meta-C 6 H 4 FX isomers the electron rich fluorine atom is situated close to the maximum of electron density of the SHOMO orbital; this orbital is therefore destabilized in preference to the HOMO which results in the reduced Δπ splitting.When considering the effect of topology of fluorine substituent on the X lone pairs in C 6 H 4 FX we need to recall that the fluorine substituent acts inductively via σ-bond framework (TB interaction) and mostly affects the in-plane (n Xσ ; σ-symmetry) halogen lone pair orbital rather than the out-of-plane (n Xπ ; π-symmetry) lone pair.In general, the C-F bond dipole will tend to pull the halogen lone pair density away from X (in the direction of dipole's spatial orientation) thus stabilizing the corresponding n Xσ and reducing Δn X .In ortho-C 6 H 4 FX isomers we noticed two opposing effects.The C-F bond dipole still pulls electron density away from n Xσ , stabilizing it.However, due to the spatial proximity between X halogen lone pair and fluorine lone pair in ortho-isomers we also have TS interaction between two fully occupied orbitals which leads to the destabilization of the lone pair with higher energy which is n Xσ .The net result is that there is no significant change in n Xσ orbital energy and hence no change in Δn X .On the other hand, in meta-and para-C 6 H 4 FX isomers, there is no corresponding TS interaction and C-F bond dipoles tend to pull the electron densities away from the in-plane X lone pairs thus stabilizing the n Xσ orbital and reducing Δn X .
Ad 2. The reason why the <π> and <n X > values in C 6 H 4 FI are influenced by the positions of fluorine substituents more than in other dihalobenzene molecules is due to the large polarizability (and the low electronegativity) of iodine atom compared to the chlorine or bromine atoms.
CONCLUSION
We have shown that the inductive effect of fluorine on benzene ring can be described and interpreted in detail relying on experimental results.This is important because of the dominance of TB effects (of which the effect of fluorine on benzene ring is a case in point) as was suggested by Antal et al.
Table 1 .
Vertical ionization energies (Ei ± 0.02 eV), band assignments and results of OVGF calculations for the dihalobenzenes (C6H4FX; X = Cl, Br, I); the values in brackets correspond to OVGF ionization energies | v3-fos-license |
2020-03-22T13:05:05.544Z | 2020-03-20T00:00:00.000 | 214601451 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "https://academic.oup.com/plphys/article-pdf/183/1/67/37278606/plphys_v183_1_67.pdf",
"pdf_hash": "149b981f8abc981186e43ba25b76a50514e421e0",
"pdf_src": "Highwire",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119442",
"s2fieldsofstudy": [
"Biology",
"Environmental Science"
],
"sha1": "715360f19da663a1b2d7a37fd22853374df76792",
"year": 2020
} | pes2o/s2orc | Specific Lhc Proteins Are Bound to PSI or PSII Supercomplexes in the Diatom Thalassiosira pseudonana1[OPEN]
The diatom Thalassiosira pseudonana shows a specific organization of the antenna complexes linked to PSI and PSII, whereby higher oligomeric antenna complexes are only weakly connected. Despite the ecological relevance of diatoms, many aspects of their photosynthetic machinery remain poorly understood. Diatoms differ from the green lineage of oxygenic organisms by their photosynthetic pigments and light-harvesting complex (Lhc) proteins, the latter of which are also called fucoxanthin-chlorophyll proteins (FCP). These are composed of three groups of proteins: Lhcf as the main group, Lhcr that are PSI associated, and Lhcx that are involved in photoprotection. The FCP complexes are assembled in trimers and higher oligomers. Several studies have investigated the biochemical properties of purified FCP complexes, but limited knowledge is available about their interaction with the photosystem cores. In this study, isolation of stable supercomplexes from the centric diatom Thalassiosira pseudonana was achieved. To preserve in vivo structure, the separation of thylakoid complexes was performed by native PAGE and sucrose density centrifugation. Different subpopulations of PSI and PSII supercomplexes were isolated and their subunits identified. Analysis of Lhc antenna composition identified Lhc(s) specific for either PSI (Lhcr 1, 3, 4, 7, 10–14, and Lhcf10) or PSII (Lhcf 1–7, 11, and Lhcr2). Lhcx6_1 was reproducibly found in PSII supercomplexes, whereas its association with PSI was unclear. No evidence was found for the interaction between photosystems and higher oligomeric FCPs, comprising Lhcf8 as the main component. Although the subunit composition of the PSII supercomplexes in comparison with that of the trimeric FCP complexes indicated a close mutual association, the higher oligomeric pool is only weakly associated with the photosystems, albeit its abundance in the thylakoid membrane.
Photosystems have evolved in photosynthetic prokaryotes and eukaryotes, adapting pigments, reaction centers, and antenna complexes to the different environmental conditions (Blankenship, 2010). In the oxygenic organisms, photosystem reaction centers are highly similar between prokaryotes and eukaryotes (Nelson and Junge, 2015), whereas higher variability is present in the light-harvesting systems (Neilson and Durnford, 2010;Nowicka and Kruk, 2016).
Diatoms are unicellular eukaryotic microalgae that originated from a secondary endosymbiosis event between a eukaryotic cell and a red algal ancestor (Bhattacharya et al., 2007). Consequently, chloroplasts exhibit a four-membrane envelope and thylakoids are organized in a three-band structure, lacking the granastroma organization (Bedoshvili et al., 2009). Spatial separation of the photosystems is not as defined as in land plants, although PSI is observed at a higher abundance in the outer membranes (Pyszniak and Gibbs, 1992;Flori et al., 2017). Since the spatial separation is not as strict as in land plants, the mechanism for preventing energy spillover from PSII to PSI is still unknown. Photosynthetic pigments include chlorophyll a, chlorophyll c, fucoxanthin as the main carotenoid, and diatoxanthin/diadinoxanthin involved in the xanthophyll cycle (Kuczynska et al., 2015). The pigments are cofactors of the antenna proteins that assemble into Fucoxanthin-Chlorophyll a/c Protein (FCP) complexes. FCP subunits are encoded by different gene families: Lhcf proteins, which are mainly involved in the lightharvesting mechanism; Lhcr proteins, which resemble the only Lhcs of the red ancestor and are mainly associated with PSI; and Lhcx proteins, for some of which a photoprotective function has been proven (Büchel, 2020). From genomic sequence analysis, the so-called FCP genes have also been annotated, but their function remains unknown (Armbrust et al., 2004). In diatoms like the model organism Thalassiosira pseudonana, the number of expressed Lhc genes is higher than in organisms of the green lineage (Teramoto et al., 2001), with 11 Lhcf, 14 Lhcr, and five Lhcx gene products (Armbrust et al., 2004). The influence of this higher variability on the antenna complex organization is still under debate. Trimeric and oligomeric FCP complexes were isolated from the centric T. pseudonana and Cyclotella meneghiniana (Grouneva et al., 2011;Gundermann et al., 2019), but their physical association with the photosystems is still unclear.
Isolation of native-state photosystems is required to understand the actors involved in the light-harvesting process and its regulatory mechanisms. The isolation of stable complexes also allows us to determine their structure and the interaction between subunits, which was successfully achieved for the complexes from plants and green algae (Caffarri et al., 2009;Haniewicz et al., 2015;Mazor et al., 2017;Qin et al., 2019;Shen et al., 2019). Only recently, the structure of a PSII-FCPII complex from the diatom Chaetoceros gracilis was reported (Nagao et al., 2019a;Pi et al., 2019), but the lack of a fully sequenced genome for this organism limited subunit identification.
By contrast, the genome sequence availability for T. pseudonana (Armbrust et al., 2004) allows the identification of Lhc proteins by mass spectrometric analysis. In addition, a protocol for the isolation of intact plastids was established recently (Schober et al., 2018). Previous studies employed different methods for the isolation of thylakoid complexes: native PAGE, Suc density gradient ultracentrifugation, and gel filtration (Caffarri et al., 2009;Järvi et al., 2011;Barera et al., 2012). In this study, large-pore blue native PAGE (lpBN-PAGE), clear native PAGE (CN-PAGE), and Suc density gradient centrifugation were chosen. In particular, native PAGE achieves higher complex resolution in comparison with the other techniques and allows the different photosystem assemblies to be distinguished. This facilitates conclusions about the spatial organization of the subunits, as previously observed in Arabidopsis (Arabidopsis thaliana; Järvi et al., 2011).
In this study, we provide insights into the organization of the multitude of Lhc proteins of diatoms around the photosystems, wherein we identify the complement of PSII-associated antenna proteins.
Analysis of Thylakoid Membrane Complexes
We analyzed the composition of thylakoid membrane complexes in T. pseudonana by using lpBN-PAGE, CN-PAGE, and Suc density gradient techniques (Fig. 1). In particular, we focused on the isolation of native photosystem supercomplexes. Thylakoid complexes isolated from Arabidopsis were used as reference material (Fig. 1, A and B, lanes 3; Supplemental Fig. S1) for the identification of bands and the estimation of the molecular mass (MW) range on gels.
As a first step, we evaluated if high-MW complex isolation was possible using thylakoid membranes as starting material or whether intact plastids were needed. The same conditions (7.5 mg of chlorophyll a and a 30-min solubilization with 0.75% [w/v] n-dodecyla-D-maltoside [a-DDM] at 4°C) were applied to both T. pseudonana samples. After incubation, complexes were separated by lpBN-PAGE and the band patterns were compared. Intact plastids revealed distinct high-MW complexes (Fig. 1A, lane 2), with four major bands visible in the region above the PSII dimer band, whereas thylakoid membrane samples provided much less of high-MW supercomplexes (Fig. 1A, lane 1). An estimation of the MW range for the four major bands from plastids was carried out by comparing T. pseudonana plastid and Arabidopsis thylakoid samples, solubilized with a-DDM (Supplemental Fig. S1). PSII supercomplex bands were labeled according to Järvi et al. (2011). In both cases, supercomplex bands migrated in a similar area of the gel, indicating a comparable MW range of the complexes.
Different detergent concentrations (Supplemental Fig. S2) and incubation times (Supplemental Fig. S3) did not produce any improvement. Thus, according to these results, intact plastids were chosen as starting material and used for all the successive experiments.
BN-PAGE makes use of Coomassie Brilliant Blue (Coomassie) as a negatively charged molecule that conveys the charge required for separation of the protein complexes. This bulky dye might produce artifacts, affecting the complexes with highest MW. Thus, we also used CN-PAGE as an alternative native gel system. Figure 1B shows the comparison of complexes from plastids run on CN-PAGE and BN-PAGE gels. A similar band pattern was observed in the supercomplex area, using lpBN-PAGE (Fig. 1B, lane 1) and CN-PAGE (Fig. 1B, lane 2), excluding side effects introduced by Coomassie.
As a further control, Suc gradient separation of plastid complexes was also performed (Fig. 1C, left). After the run, three fractions were harvested and the main complexes were identified by spectroscopic analysis (Supplemental Fig. S4, A-D). The uppermost Suc density gradient band was assigned to FCP complexes, showing absorption and emission spectra similar to the isolated FCP analyzed by Gundermann et al. (2019). The middle band was identified as PSI complex because of the red shift of the Q y absorption (Supplemental Fig. S4A) and the emission peak at 715 nm in the 77K fluorescence emission spectrum (Supplemental Fig. S4C), as described by Veith and Büchel (2007). The 715-nm peak was also observed when chlorophyll c was excited (Supplemental Fig. S4D), indicating energy transfer from the antenna to the reaction center of PSI. The lowest Suc density gradient fraction was attributed to PSII because the main emission occurred at 687 nm in the fluorescence emission spectra (Supplemental Fig. S4, B-D). This attribution is also in agreement with the results described by Pi et al. (2019). The complexes of those fractions were next separated by lpBN-PAGE and compared with solubilized complexes without prefractionation by Suc density gradient (Fig. 1C, right). The upper Suc density gradient band contained mainly FCP complexes, with slight contaminations of cytochrome b 6 f ( Fig. 1C, right, lane 2). The main complex of the PSI fraction aligned with the lowest MW band in the supercomplex area (Fig. 1C, right, lane 3). The main complex of the PSII fraction corresponded to the uppermost band of the intact plastid sample (Fig. 1C, right, lane 4). In both cases, the main complexes were accompanied by some minor bands. Most of them probably corresponded to different states of PSI and/or PSII, since they were also found when plastids were solubilized directly. The subunit composition of the main PSI and PSII supercomplexes was also comparable, whether isolated with or without prior Suc density gradient fractionation, as shown by 2D SDS-PAGE (Supplemental Fig. S4E). These results demonstrate that essentially the same complexes can be isolated by different preparation procedures.
Identification of the Complexes Separated by BN-PAGE
Mass spectrometry (MS) analysis was conducted to identify the supercomplexes found via BN-PAGE. The analysis had the scope to prove the tentative assignment to PSI and PSII made above. For sample preparation, gel bands were excised from lpBN-PAGE carried out using a 3.5% to 8% acrylamide gradient ( Fig. 2A). The lower acrylamide concentration improved the resolution of the bands, reducing cross-contaminations of closely migrating complexes. Photosystem core subunits were identified and their relative abundances analyzed per band by lpBN-PAGE.
A spectral counting approach was used to determine relative abundances of identical proteins from the different supercomplex bands of BN-PAGE (BN-BANDs). This is possible because an increase in protein abundance typically results in an increase in the number of its proteolytic peptides, and vice versa. This increased number of (tryptic) digests then usually results in an increase in protein sequence coverage, the number of Figure 1. Separation of native-state thylakoid membrane complexes from T. pseudonana (with Arabidopsis complexes as a reference). A, lpBN-PAGE (3.5% to 12.5%) of solubilized photosynthetic proteins; 7.5 mg of chlorophyll a per lane was loaded in each case. Dotted lines are used to label complexes of Arabidopsis according to Järvi et al. (2011), and solid lines for the complexes of T. pseudonana according to Grouneva et al. (2011). Image contrast was enhanced to improve the visualization of the bands. Lanes 1 and 2, Comparison of the supercomplex separation using either thylakoid membranes (lane 1) or intact plastids (lane 2) of T. pseudonana, both solubilized using 0.75% (w/v) a-DDM at 4°C for 30 min. Lane 3, Thylakoid membranes from Arabidopsis (solubilization with 1% [w/v] n-dodecyl-b-D-maltoside [b-DDM] at 4°C for 10 min) were used as a reference. B, Comparison of separation patterns on CN-PAGE (3.5%-8%) and lpBN-PAGE. Lanes 1 and 2, Intact plastids of T. pseudonana by lpBN-PAGE (lane 1) and CN-PAGE (lane 2); solubilization and amount as in A. Lane 3, Thylakoid membranes of Arabidopsis as a reference (solubilization and amount as in A). C, Separation of T. pseudonana complexes by Suc density gradient centrifugation and analysis with lpBN-PAGE. Left, Thylakoids were solubilized as in A, and an amount corresponding to 100 mg of chlorophyll a was separated by ultracentrifugation (16 h at 132,000g, 4°C). The three fractions are labeled according to Pi et al. (2019). Right, Comparison between directly solubilized plastids (lane 1; solubilization and amount as in A) and Suc density gradient fractions (lanes 2-4; chlorophyll a not determined).
identified unique peptides, and the number of identified total MS/MS spectra (spectral count) for each protein (Washburn et al., 2001). This approach allowed us to compare the relative abundance of individual proteins along the four different supercomplex bands of the BN gel. The relative abundance (see "Materials and Methods") gives an estimate of the number of times that peptides belonging to a single protein were detected in relation to the total number of peptides in a given sample. The complete MS data from the BN-BANDs can be found in Supplemental Table S1. Note, however, that the ratios of peptides determined do not necessarily reflect the real stoichiometry in the protein pool of the sample, and comparison of the abundances of different proteins on the same gel band is impossible. Figure 2, B and C, show the relative abundances of PSII (Fig. 2B) and PSI (Fig. 2C) subunits across the four BN-BANDs. The subunits of PSII (PsbA, PsbB, PsbC, PsbD, PsbE, and PsbO) and PSI (PsaA, PsaB, PsaC, PsaD, PsaE, PsaF, and PsaL) were all detected in the different supercomplex bands. The overall result demonstrated a decreasing abundance of PSII proteins from BN-BAND 1 to BN-BAND 4, whereas the opposite trend was observed for the PSI protein group. According to these results, the two upper bands corresponded mostly to PSII complexes, BN-BAND 3 represented an overlap between PSI and PSII, and BN-BAND 4 predominantly contained PSI complexes. The analysis of the trends provided qualitative estimates for the most representative complex of each band, based on the relative abundance of the complex subunits. Nevertheless, both PSII and PSI proteins were detected on all the gel bands, so colocalization of different complexes on the same gel band cannot be excluded. During excision, smaller bands might overlap with the main bands and might contaminate the latter. Also, the possibility of smearing between different bands (cross-contamination) and the extremely high sensitivity of the mass spectrometric analysis have to be taken into account. All these factors have been considered in the interpretation of the data given below.
When analyzing the bands obtained by CN-PAGE, the photosystem core subunits showed similar trends to those above. However, the proteins of the oxygenevolving complex (OEC) were better retained by CN-PAGE (Supplemental Table S2), whereas the same Lhc proteins were found on both gel types (Supplemental Table S3). Since we were interested mainly in the Lhc complement of the different supercomplexes, and the stability of binding of the different Lhc subunits to the cores, we further focused on the analysis of complexes separated by BN-PAGE.
Analysis of the Photosystem Core Complex Subunits with 2D SDS-PAGE
To confirm the results obtained by BN-PAGE, 2D SDS-PAGE was performed. This analysis led to further identification of the subunits of PSII and PSI Figure 2. Analysis of the core subunits of PSI and PSII complexes in 1D lpBN-PAGE. A, Short gradient (3.5%-8%) lpBN-PAGE was performed to improve the resolution of the bands; otherwise, conditions were the same as described in Figure 1A. BN-BANDs 1 to 4 were excised, proteins digested, and the peptides analyzed with LC-electrospray ionization-MS/MS. B and C, The relative abundance of proteins in BN-BANDs 1 to 4 (for calculation, see "Materials and Methods"). B shows the analysis of PSII core subunits, and C shows the analysis of PSI core subunits. Only proteins with an abundance of minimally 1% in at least one band are depicted.
supercomplexes and, more importantly, their Lhc supplement (see next paragraph).
For the analysis, one whole BN gel lane was denatured and subjected to 2D SDS-PAGE for the separation of complex subunits. In another approach, the four most prominent bands were excised from the supercomplex area and separated individually through SDS-PAGE, yielding essentially the same results (Supplemental Fig. S5). After silver staining, the subunits were assigned according to MW by literature comparison (Nagao et al., 2010;Grouneva et al., 2011). Figure 3 shows the 2D SDS-PAGE results from a BN gel lane in the higher MW range. For the assignment of spots, two regions were analyzed: the area between 20 and 25 kD, containing most of the antenna proteins (Lhcf, Lhcr, and Lhcx, boxed in Fig. 3), and the remaining part of the gel (120-25 kD and below 20 kD). In the latter, most of the PSI and PSII core subunits were found.
The identification of core subunits on the 2D gel confirmed the results of the MS analysis conducted using 1D BN-PAGE. The core subunits of PSII (PsbB, PsbC, PsbA, and PsbD) were found predominantly in the two bands of highest MW (BN-BANDs 1 and 2). In those bands, almost no signals belonging to PSI (i.e. PsaA/B) were detected by silver staining. In BN-BAND 3, colocalization between PSII and PSI was observed, with the occurrence of PsaA/B together with PSII subunits, while in BN-BAND 4, only PSI subunits were detected. Western blots against PSI (PsaA) and PSII (PsbC) subunits confirmed the attribution to PSI and PSII (Supplemental Fig. S5C). Low-MW proteins of PSI could also be observed in BN-BAND 4: PsaD, PsaL, and PsaE, which all have MW below 20 kD. The MW shift of the different photosystem complexes by BN-PAGE might be attributed to the partial or total loss of antenna proteins or other subunits of the complex (e.g. proteins of the OEC of PSII). For instance, the magnitude of PsbO spots decreased along the different PSII complexes (in relation to the other core subunits).
It has to be pointed out that many more BN-BANDs became visible on the 2D gel. In addition to the four already described, other minor bands were revealed by silver staining of the 2D gel. Three further complexes could be observed above the main supercomplexes by BN-PAGE, above BN-BAND 1 (Fig. 3). These complexes were composed of PSI subunits only, lacking any contamination by PSII subunits. All three uppermost complexes showed the same spot pattern, with the core proteins PsaA/B, PsaD, and PsaE (but not PsaL), and a similar antenna protein profile, suggesting a multiple aggregation state of the PSI complex. Two additional complexes of PSI could be spotted: a PSI complex, running below BN-BAND 4, and another smaller complex, proximal to the PSII dimer band (Fig. 3). Two additional complexes containing PSII subunits were also observed, apart from the three PSII complexes described so far in BN-BANDs 1 to 3. The two other complexes were located in the area around BN-BAND 4 and they contained the core subunits, but not PsbO, indicating loss of the OEC. Thus, the 2D SDS-PAGE analysis gave a more detailed overview of the number of bands occurring in the area of photosystem supercomplexes.
LHC Pool of the PSI and PSII Supercomplexes
Here, we focused on the antenna proteins of the main supercomplex bands visible by BN-PAGE (Fig. 3). The analysis of the antenna proteins was conducted to identify the composition of the light-harvesting complexes bound to the reaction centers of PSII and PSI.
In Figure 4A, the gel region between 25 and 20 kD, where most of the Lhc proteins were located, is shown again. The origin of the 2D Lhc spots of this region could be assigned to the PSI or PSII supercomplexes (Fig. 3) by their relative abundances in each supercomplex ( Fig. 4, B-E). The same approach that has been used for the analysis of the complexes on 1D gels was adopted for the 2D gel spots (Supplemental Table S4) as well as for the horizontal 2D gel system, with similar results (Supplemental Table S5). In protein abundance Figure 2. The complexes in the region above the PSII dimers were resolved and subunits assigned according to Nagao et al. (2010) and Grouneva et al. (2011). Most of the photosystem core subunits were found between 120 and 25 kD and below 20 kD. The core subunits identified were as follows: PsaA/B, PsaD, PsaL, and PsaE for PSI and PsbA/D, PsaB, PsaD, and PsbO for PSII. Lhc spots were found in the area between 20 and 25 kD. The box highlights the Lhc spots that were analyzed (see Fig. 4). Contrast of the image was homogeneously enhanced in all images for the visualization of the bands.
analysis, only the most relevant proteins were included, with a consistent and clear trend for all three different gels analyzed (lpBN-PAGE, horizontal 2D, and spot 2D-PAGE). Furthermore, a relative abundance value of 1.5% at least in one of the spots/bands was used as a threshold.
The Lhc proteins were separated in three groups of spots of slightly different MWs. Spots with similar MW were analyzed together: Lhc proteins of highest MW are shown in Figure 4B, proteins of medium MW are depicted in Figure 4C, and the smallest Lhc proteins are represented in Figure 4, D and E. Assignment of spots to PSII or PSI was done as described above and is indicated by the colored bar above the graphs.
In the spots containing the Lhc proteins of highest MW (Fig. 4B), three Lhcr proteins were most abundant: Lhca2 (which is identical to Lhcr2) and Lhcr11/12, which were analyzed together because of their high sequence similarity (greater than 80%). Lhca2 showed a maximum peak of relative abundance in spots 10 and 13, with lower abundances in the other spots. Since spots 10 and 13 were derived from PSII supercomplexes, Lhca2 was assigned to the PSII antenna pool, consistent with the findings in the PSII-FCPII structure in C. gracilis (Nagao et al., 2019a;Pi et al., 2019). The opposite trend was observed for the distribution of Lhcr11/12, with maximum abundances in PSI-related spots.
The analysis of spots containing Lhc of medium MW is summarized in Figure 4C. These spots were mainly composed of Lhcx6_1, the sole Lhcx protein found in the study. Spots at this MW region were visible on the gel only for bands containing PSII (BN-BANDs 1-3; Fig. 4A). In BN-BAND 4, the main band of PSI, no corresponding spot was observed. Despite a lower abundance of Lhcx6_1 in the supercomplex band consisting of PSII and PSI (BN-BAND 3, spot 17), the relative abundance was high in all three spots, indicating the presence of this Lhcx protein in all the three PSII complexes identified. Most of the antenna proteins were found in the spots of lowest MW (Fig. 4, D and E). More specifically, most of the Lhcf proteins (Lhcf1/2/5, Lhcf3/4, Lhcf6, Lhcf7, Lhcf10, and Lhcf11; Fig. 4D), most of the Lhcr proteins (Lhcr1, Lhcr3, Lhcr4, Lhcr7, Lhcr10, Lhcr13, and Lhcr14; Fig. 4E), and an FCP protein (FCP10) were identified.
The Lhcf proteins are considered as the main group of light-harvesting proteins in diatoms (Büchel, 2020). Figure 3. The numbers refer to the excision order of the spots. B to E, The relative abundance of Lhcs in the spots with comparable MW. A colored bar above each graph indicates the corresponding photosystem complex on the 1D gel. Only proteins that had a relative abundance of above 1% in at least one of the spots have been used. In B, spots containing Lhc of highest MW (spots 7, 10, 13, 16, and 19) are shown, consisting mainly of Lhcr2 and the Lhcr11/12 proteins. C demonstrates spots containing Lhc of medium MW (spots 11, 14, and 17). Here, almost exclusively Lhcx6_1 was found. D and E show the analysis of spots containing Lhc of low MW (spots 8, 12, 15, 18, 20, and 25), that is, the relative abundance of Lhcf (D) and Lhcr/FCP (E) proteins. Figure 4D demonstrates that most of them exhibit a maximum relative abundance in the area of the PSII complexes. Thus, they probably belong to the antenna pool of PSII. The main peak for most of them corresponded to spot 12, a spot belonging to the PSII complex of the highest MW. Still, some exceptions were visible when analyzing the trends of relative abundance. The most evident difference concerned Lhcf10: this protein showed the opposite trend in comparison with the other Lhcf proteins. Lhcf10 relative abundance was lowest in the spots corresponding to PSII (12 and 15) and showed a higher value in the PSI-related spots (18, 20, and 25, as well as 8). The results observed here are consistent with those of Grouneva et al. (2011), who already assigned Lhcf10 to PSI.
Lhcr proteins are usually attributed to PSI, and they are evolutionarily related to the red algae PSI antenna proteins. This assumption was consistent with the results of the MS analysis (Fig. 4E). All Lhcr proteins were detected in spots assigned to PSI, with an increase in relative amount from spot 15 to spot 20, which was the maximum peak for most of the proteins analyzed. Most of the Lhcr proteins, with genes available in the databases, were found in those spots: Lhcr1, Lhcr3, Lhcr4, Lhcr7, Lhcr10, Lhcr13, and Lhcr14, and almost all showed comparable abundances in the different PSI complexes. One exception is Lhcr10, whereby higher levels were found in the smallest PSI complex (spot 25). The reason might be that all the other antenna proteins bound to the core of PSI are lost in this complex, resulting in an increased ratio between Lhcr10 and all other Lhcr proteins. Concerning the so-called FCP proteins, only FCP10 showed a clear trend, consistent in all the gel systems used and similar to the Lhcr proteins (Fig. 4E). Thus, it was attributed to the antenna pool of PSI.
In summary, by analyzing the spot composition, we were able to assign specific Lhc proteins to the supercomplexes of PSI and PSII, which were separated by 1D BN-PAGE. Lhcr proteins were found mainly in PSI complexes, with the exception of Lhca2, which was preferentially found in PSII. In total, 10 different Lhcr proteins were identified for PSI. Lhcf proteins, on the other hand, were mostly found in PSII, with the exception of Lhcf10, which seems to belong specifically to PSI. Here, nine different Lhcfs were found specifically associated with PSII. Lhcx6_1, the only Lhcx protein detected, was also enriched in PSII bands.
Factors Influencing the Stability of Multisubunit Complexes
In this study, we show how the use of isolated plastids, instead of isolated thylakoids, improves the probability of isolating nearly native-state complexes from diatoms. The isolation of diatom plastids (Schober et al., 2018) was developed with the aim to study the properties of the photosynthetic apparatus. This method allowed the isolation of high-quality plastids without strong contamination by other organelles such as mitochondria (Schober et al., 2019). In this study, we compared the outcome from solubilizing either intact plastids or isolated thylakoids with a-DDM prior to separation of the protein complexes on BN-PAGE. The result showed different band patterns using the two different starting materials. The PSI band pattern appeared to be similar between the two samples, unlike PSII, where PSII supercomplexes were almost exclusively detected in the plastid sample. Therefore, PSII complexes showed a high tendency of disassembly, which may be an intrinsic feature as a consequence of its high turnover rate (Li et al., 2016). Membrane integrity could also play a role in the stability of the photosystems. In fact, the stacking degree of membranes is the main difference between plastid and thylakoid samples. As described by Jäger and Büchel (2019), comparison between cells, isolated plastids, and thylakoids using circular dichroism spectroscopy revealed that the structural integrity of the membranes was preserved in plastids but not in thylakoids. Thus, the effectiveness of photosystem solubilization in a highly assembled state is likely influenced by membrane integrity, in particular for PSII.
Another hint for this was given by comparison of different isolation media used for the preparation of PSII complexes. The divalent cation concentration, in particular that of Mg 21 , influences the distance between the lamellae, regulating the stacking degree (Jäger and Büchel, 2019). Evidence for stromal interactions between PSII was found in land plants (Albanese et al., 2017), but nothing is known so far for diatoms. Using an optimal concentration of Mg 21 that leads to a physiological stacking state of lamellae might help the interaction of the high-MW complexes across the stromal gap. The isolation of stable PSII-FCP supercomplexes was only recently achieved in diatoms (Nagao et al., 2019a;Pi et al., 2019), and in both cases, MgCl 2 was present during the isolation. Conversely, for Grouneva et al. (2011), no Mg 21 cations were provided and no evidence for PSII supercomplexes was found.
The influence of the stacking degree on the stabilization of PSII might also reflect the different behavior of PSI supercomplexes. PSII was observed to be localized predominantly in the appressed region of the thylakoid membranes, unlike the PSI complex, which is localized preferentially in the outer lamellae, even though the separation between PSII and PSI is not as defined as in land plants (Flori et al., 2017). Because of the different environment, the stability of PSI complexes might not be influenced by stromal gap interactions, and this could explain why it is not affected by the loss of the stacking in the thylakoid sample during solubilization.
Therefore, despite the limited knowledge about the stability of photosystem supercomplexes in diatoms, the use of isolated plastids severely improved the biochemical characterization of the thylakoid complexes.
LHC Composition of PSI and PSII Supercomplexes
In diatoms, previous studies about the Lhc protein composition were mostly conducted on the free pool of FCP complexes (Lepetit et al., 2007;Röding et al., 2018;Gundermann et al., 2019), and only limited information is available about the Lhcs bound to the photosystem cores. In our study, we underlined the differences between the Lhcs bound in PSI and PSII supercomplexes, focusing on their specificity. To assign the antenna protein to the corresponding photosystem, the relative abundance of each Lhc protein was checked against those of photosystem core proteins. Thus, proteins that were coherently found in the respective bands were assigned to the same complex.
The antenna pool of PSII was composed of most of the Lhcf proteins (Lhcf 1/2, 3/4, 5, 6, 7, and 11), one Lhcr protein (Lhcr2), and the Lhcx6_1 protein. Members of the Lhcf family were detected in all the PSII complexes, indicating stable binding and thus a localization closer to the reaction center. In the PSII-FCPII structure of C. gracilis, the antennae are symmetrically organized, with two tetramers and three monomers bound to each side of the PSII core dimer. The subunits of the tetramers were either identified as Lhcf1 (Nagao et al., 2019a) or as Lhcf8 , which were both found in PSII in our study as well. Lhcf1 was very prominent in our PSII complexes, whereas Lhcf8 had a very low relative abundance (below the threshold) compared with the other members of the Lhcf family (Supplemental Tables S1, S4, and S5). According to Grouneva et al. (2011), Lhcf8 is the main subunit of the oligomeric FCP pool in T. pseudonana, and the same holds for the oligomeric FCPb complex in the closely related centric diatom C. meneghiniana (named Fcp5 or Lhcf3 in this species; Gundermann et al., 2019). So apparently in T. pseudonana, the FCP oligomers are not tightly connected to PSII supercomplexes and detach easily during solubilization, although energy transfer from FCPb to PSII was demonstrated at least for C. meneghiniana (Chukhutsina et al., 2013). Another interesting fact is the presence of Lhcr2 in the antenna pool of PSII. Lhcr proteins were considered to be part of the PSI antenna pool, so the occurrence of Lhcr2 in the PSII supercomplex contradicts this general consensus. Furthermore, Lhcr2 is probably bound to PSII as a monomer, since it has neither been found in the pool of FCP trimers nor oligomers (Grouneva et al., 2011). This hypothesis is also confirmed by the PSII-FCPII structure of C. gracilis, where one monomer was identified as Lhca2 .
Concerning the Lhcx group, only Lhcx6_1 was detected in PSII supercomplexes, so it seems to be constitutively expressed even under the very-low-light conditions used here. Another Lhcx protein known to be expressed under low light is Lhcx1 (Zhu and Green, 2010), but no evidence for its presence in PSII supercomplexes was found. Its absence might be explained by the much lower growth light intensities used here when, due to high cell densities, self-shading reduced the amount of light experienced by the cells even further, inducing a down-regulation of the photoprotective proteins. Another possibility is that Lhcx1 is solely found in the peripheral antenna complexes (i.e. the trimeric FCPs; Grouneva et al., 2011), detached from the supercomplex.
The antenna pool of PSI supercomplexes consisted of Lhcr proteins (except Lhcr2 as described above), Lhcf10, and FCP10. Although no Lhcx protein spots related to the PSI supercomplex were detected on the silver-stained 2D gel, the mass spectrometric analysis of the 1D gel (Supplemental Table S1) showed the presence of Lhcx6_1 in BN-BAND 4, where PSI is the main complex. Since Lhcx6_1 was also detected in PSI by Grouneva et al. (2011), we cannot exclude its presence in the antenna pool of PSI supercomplexes.
Populations of Isolated Supercomplexes
In this study, we focused on the different organization states of PSII and PSI supercomplexes. Photosystems are highly dynamic multisubunit complexes, and their subunits change according to the environmental conditions, on short-and long-term time scales (Rochaix, 2014). So structural reorganization is an intrinsic feature of those complexes.
During solubilization, the detergent disrupts the interactions between proteins, generating smaller forms of the same complex. Using Suc density centrifugation, the biggest PSII supercomplex was mainly isolated, but bands of lower MW were seen on both native gel systems. Thus, those bands are either due to the action of the detergent or they represent assembly states. In both cases, the presence or absence of subunits is indicative of the binding strength and also contains information about the subunit localization with respect to the core complex. This is particularly interesting for the antenna pool, because it helps to distinguish between outer and inner LHC proteins.
PSII
On the 2D gel, five different PSII-FCP states were identified, with different MWs. On the 1D gel, the three highest MW PSII complexes correspond to BN-BANDs 1 to 3, whereas the two lowest are located above and below BN-BAND 4. Differences between the bands could be assigned to the detachment of pigmented proteins (like Lhc) or other unpigmented subunits (like PsbO). Another explanation might be the presence of dimers of supercomplexes, but this hypothesis appears improbable because the bands are all found in the same gel region as Arabidopsis supercomplexes, but not where megacomplexes are found (Supplemental Fig. S1). Although complexes from different species probably show slightly different running behavior, such strong differences seem unlikely.
PsbO is the main protein of the OEC of PSII. The corresponding spot runs at ;35 kD, above the D1/D2 spot. Comparing the magnitude of the spots, PsbO shows a decreasing trend of its relative amount in the three PSII BN-BANDs, compared with PSII core proteins. This trend is confirmed by the results of the MS analysis. This sensitivity is probably due to the lumenal location but was less pronounced when using CN-PAGE instead of BN-PAGE (Supplemental Table S2). Therefore, the detachment could be favored by charged molecules (e.g. Coomassie) absent in the CN-PAGE.
The composition of the antenna subunits is more complex, but some hypotheses can be postulated. Lhca2 (annotated as Lhcr2 in the Joint Genome Institute database) signals were detected in all the PSII complexes, indicating a strong interaction with the core. This observation is fortified by the PSII-FCPII structure of C. gracilis , where Lhca2 is located in the inner part of the antenna pool, in direct contact with the reaction center. A different behavior was observed for Lhcx6_1. The PSII complex with lowest MW was detected with 2D SDS-PAGE, running below BN-BAND 4. In this complex, the Lhca2 spot is still present, whereas the spot of Lhcx6_1 is missing. Its position should thus be more peripheral than that of Lhca2. No Lhcx proteins were detected in the structure of C. gracilis, but two of the three monomers (FCP-E and FCP-F) could not be assigned to specific proteins, so we cannot rule out that one of them corresponds to Lhcx6_1. As reported by Grouneva et al. (2011), Lhcx6_1 was detected as part of the peripheral FCP trimers, and in C. meneghiniana (Gundermann et al., 2019), also a minor population of the trimeric FCPa contained this protein. So it appears more probable that Lhcx6_1 has a peripheral localization, and, depending on isolation method, is either found in PSII supercomplexes or as part of the free pool of trimeric FCP.
The analysis of Lhcf proteins is more difficult because of the presence of several Lhcf(s) in the same spot on the gels and the high sequence similarity of some of them (Lhcf1/2, Lhcf3/4, Lhcf5, Lhcf6, Lhcf7, and Lhcf11). Lhcf proteins were observed here in all the forms of PSII supercomplexes and in the pool of free FCPs (trimeric as well as higher oligomeric; Grouneva et al., 2011), so we assume their occurrence in both the peripheral and inner districts of the antenna pool. For those proteins, similar trends were observed and the small variations (like Lhcf7) could be due to the MS analysis. Thus, the smaller PSII complexes had gradually lost Lhcx6_1, certainly some of the Lhcf proteins, and part of the OEC.
In the largest PSII complex, we identified six Lhcf proteins of high abundance, one Lhcx protein, one Lhcr protein, and some other Lhc proteins of low abundance. This is in contrast to the studies by Nagao et al. (2019a) and Pi et al. (2019), where also one Lhcr but no Lhcx and only three different Lhcf proteins were assigned (two monomers and the Lhcf that builds both the M-and S-tetramers). However, C. gracilis is not sequenced, which made attributions difficult. Lhcf proteins are all highly similar in sequence, and the authors give some indications for a nonidentical build of the Mand S-tetramers. If one considers the high similarity of Lhcf proteins, and follows this line of argument, the PSII-FCP supercomplexes that were structurally analyzed could accommodate maximally 10 different Lhcf proteins, whereas our study revealed at least six Lhcf proteins and one Lhcx. For the latter, the argument of sequence homology does not hold, but on the level of resolution of the structure, its presence cannot be ruled out. So the question arises whether the largest PSII supercomplexes analyzed here are of the same size as those of C. gracilis. The fact that complexes isolated via Suc density centrifugation, as done for the structural analysis, were the largest found on BN gels might argue for a comparable size, despite small differences in the isolation protocols and the species difference. However, we cannot rule out that exposing the PSII samples from Suc gradients to an additional electrophoretic separation led to a loss of subunits, preventing direct comparison with the published structure. On the other hand, the presence of Lhcx6_1 in the largest PSII complexes might indicate slightly bigger complexes. Our methods are thus not sufficient to estimate the precise size, and further studies are necessary to investigate the exact location of each single Lhcf protein in the antenna pool of PSII as well as the actual sizes of the complexes.
Concerning the physiological relevance of the complexes, Levitan et al. (2019) already observed two subpopulations of PSII in Phaeodactylum tricornutum: PSII-FCP complexes and PSII core clusters, the latter assumed as a repair station for the PSII reaction centers. The PSII-FCP complexes resembled those of C. gracilis in size; however, due to the resolution of the method, bigger supercomplexes cannot be ruled out. Here, especially by CN-PAGE, the amounts of PSII core dimers were minor. Despite the evolutionary distance between the two species and differences in growth conditions that might change the amount of certain subpopulations, most probably PSII cores and one or two PSII supercomplexes coexist in vivo, resembling the situation in land plants, with core dimers found as assembly states as well as C 2 S 2 M 2 supercomplexes and those containing L-trimers as well (Boekema et al., 1999).
PSI
Concerning PSI supercomplexes, different studies analyzed isolated PSI-FCPI complexes in diatoms, but usually only one type was isolated and PSI was found to be monomeric, as in land plants (Veith and Büchel, 2007;Ikeda et al., 2013;Nagao et al., 2019b). In our study, four different states could be observed by lpBN-PAGE in the area between the most abundant PSII supercomplexes and the PSII core dimer. Above this area, another three PSI complexes were present, but these are probably the result of aggregation of several PSI complexes, since the protein composition did not change. The MW differences of the smaller complexes are most probably due to a detachment of Lhcr proteins.
Most Lhcr proteins showed similar abundance in the different PSI complexes. The only exception is Lhcr10, which showed a higher relative abundance in comparison with all the other Lhcr proteins in the smallest complex. This higher value can be interpreted as a change in ratio between Lhcr10 and all the other Lhcr(s), due to the detachment of the other Lhcr proteins. According to this hypothesis, Lhcr10 is the antenna protein most strongly bound to the PSI reaction center.
The lack of a PSI-FCPI structure limits our knowledge about the oligomeric state of Lhcr proteins. The structure of a PSI-LHCR supercomplex in red algae (Pi et al., 2018), however, gives some hints about the structural organization. The antenna proteins are arranged as monomers around the reaction center, as observed also in the structures of other photosynthetic eukaryotes (Mazor et al., 2017;Qin et al., 2019). So most probably Lhcrs in diatoms are also organized as monomers. Since red algae contain only Lhcr proteins, no Lhcf proteins could be found in the structure of PSI of red algae. According to Grouneva et al. (2011), Lhcf10 was also detected in PSI complexes, as demonstrated here. Considering the total amount of Lhc proteins found, diatom PSI complexes have an antenna size more comparable to that of green algae (Qin et al., 2019) than that of land plants (Mazor et al., 2017).
CONCLUSION
Analysis of the two photosystems of T. pseudonana revealed distinct and specific antenna pools. Lhcf proteins mostly serve PSII and Lhcr proteins mostly serve PSI, with one exception for each: Lhcr2 is an antenna protein of PSII and Lhcf10 is bound to PSI. These divergences could be a constitutive feature of the complexes or due to a movement of the antenna from PSII to PSI and vice versa. This last hypothesis appears improbable for Lhca2, because of its position close to the core in the supercomplex structure of C. gracilis, although we cannot rule out a different arrangement for T. pseudonana. However, the fact that no state transitions including antenna movements have been proven for diatoms so far also argues against this hypothesis. Concerning Lhcf8, the main constituent of the free pool of FCP high oligomers, our results argue strongly in favor of the protein identification by Nagao et al. (2019a) but against Pi et al. (2019), since this subunit and thus the oligomers are apparently not strongly bound to PSII, although transferring energy to PSII (Chukhutsina et al., 2013). An open question is the localization of the Lhcx6_1 protein. Our results indicate a higher probability to find Lhcx6_1 in PSII complexes, but other studies have reported it for PSI complexes too (Grouneva et al., 2011). The reason could be related to the amount of light experienced by the cell during growth that fine-tunes the expression of those proteins.
In conclusion, we present a picture of the supercomplex organization in cells grown under very low light intensities (Fig. 5). The photosynthetic apparatus flexibly acclimates to environmental changes, and thus the organization described here should be considered as one of the multiple scenarios occurring in the thylakoid membranes. How complexes rearrange their structure under biotic and abiotic stimuli is still unknown for diatoms, but this work can serve as a basis to better understand the dynamic of the photosynthetic complexes.
Growth Conditions
Maintaining cultures of Thalassiosira pseudonana (strain CCMP1335, Hustedt) cells were grown at 15°C in f/2 medium (Guillard, 1975) Four complexes are represented: FCP higher oligomers (FCP Oligo), FCP trimers, PSII supercomplexes, and PSI supercomplexes. Lhcf1 to -9 constitute the trimers, and FCP higher oligomers have Lhcf8/9 as main components according to Grouneva et al. (2011). They are not strongly associated with supercomplexes according to our findings. The composition of the antenna pool of both supercomplexes is represented. The dotted line around Lhcx6_1 in PSI supercomplexes indicates that its location is still uncertain, since it might be present in PSI only under high-light conditions (Grouneva et al., 2011). The model represents the antenna composition of the complexes of the photosystems but contains no information about the oligomeric state, the stoichiometry, and the precise localizations of subunits within the complexes.
The 4-L culture was grown under a light intensity of ;50 mmol photons s 21 m 22 and bubbled with air. After 6 d, cells had reached a concentration of 5 to 6 3 10 6 cells mL 21 .
Plastid and Thylakoid Purification from T. pseudonana
For plastid isolation, cells were harvested by centrifugation (5,000g, 10 min, 4°C) 1 h after the onset of light. The isolation was performed according to the protocol published by Jäger and Büchel (2019), with minor modifications. During all the steps, the samples were kept on ice at 4°C, unless otherwise specified. After cell harvest, the pellet was resuspended in a final volume of 20 mL of isolation medium (0.5 M sorbitol, 50 mM HEPES-KOH, 6 mM Na-EDTA, 5 mM MgCl 2 , 10 mM KCl, 1 mM MnCl 2 , and 1% [w/v] polyvinylpyrrolidone 40 [K30], pH 7.4), and 0.5% (w/v) fatty acid-free BSA as well as 0.1% (w/v) Cys were added. The osmolality was adjusted to the optimal value of 750 mOsmol kg 21 using 2 M sorbitol or water, helping to maintain membrane stability after cell disruption. For cell disruption, a French press was used at a pressure of 14.5 MPa (2,100 p.s.i. with a 1-inch piston). After disruption, cell debris was removed by centrifugation (300g, 9 min) and crude plastids were pelleted at 6,000g (10 min). The pellet was gently resuspended, adding 2 to 3 mL of isolation medium, and layered on a Percoll step gradient (10%, 20%, and 30% [v/v] Percoll in isolation medium; osmolality of ;960 mOsmol kg 21 ). The gradients were centrifuged at 14,400g (30 min) using a Sorvall Discovery 90SE ultracentrifuge. After the run, plastids were harvested from the interphase between the 20% and 30% layers, washed with isolation medium, and centrifuged at 4,000g for 10 min. After pellet resuspension, the chlorophyll a concentration was measured in 90% (v/v) acetone according to Jeffrey and Humphrey (1975) and adjusted to 1.5 mg mL 21 chlorophyll a, as optimal for the further experiments. Sample aliquots were flash frozen using liquid nitrogen and then stored at 280°C.
Thylakoid samples were prepared from isolated plastids by treating them with an additional French press cycle at 18 MPa (120 p.s.i. with a 3/8-inch piston). Samples were then centrifuged for 10 min at 1,000g (4°C) to remove unbroken plastids. The chlorophyll a concentration of supernatant was determined and used for complex solubilization.
Isolation Arabidopsis Thylakoid Protein Complexes
Isolation of thylakoid membranes and complexes from Arabidopsis (Arabidopsis thaliana) was performed according to Järvi et al. (2011), with minor modifications. All the steps were carried out at 4°C and under dim light. One to 2 g of fresh leaves was ground in precold grinding buffer (50 mM HEPES/KOH [pH 7.5], 330 mM sorbitol, 2 mM EDTA$2H 2 O, 1 mM MgCl 2 , 5 mM sodium ascorbate, and 0.05% [w/v] BSA). The mixture was filtered over two layers of Miracloth, centrifuged for 4 min at 5,000g, and the supernatant was discarded. The pellet was suspended in shock buffer (50 mM HEPES/KOH [pH 7.5], 5 mM sorbitol, and 5 mM MgCl 2 ) and incubated 5 min in total darkness. After incubation, the sample was centrifuged, and the remains of shock buffer were removed. The pellet was washed in storage buffer (50 mM HEPES/KOH [pH 7.5], 100 mM sorbitol, and 10 mM MgCl 2 ), centrifuged again, suspended in a minimal volume of storage buffer, and chlorophyll a concentration was estimated. The chlorophyll estimation was done according to Porra et al. (1989).
For solubilization of the complexes, 7.5 mg of chlorophyll a of isolated thylakoids was incubated 10 min in solubilization buffer (25 mM Bis-Tris [pH 7], 20% [v/v] glycerol, 1% [w/v] n-dodecyl-b-D-maltoside, and protease inhibitor cocktail). Identical conditions were applied when using a-DDM for solubilization. After incubation, insolubilized material was removed by centrifugation (17,383g, 1 min), and the supernatant was stored at 280°C or directly used for native PAGE.
lpBN-PAGE and 2D SDS-PAGE
For plastids and thylakoid solubilization, the mild detergent a-DDM was used at a final concentration of 15 mM (0.75%, w/v). The samples were incubated 30 min on ice and then centrifuged for 1 min at 17,383g. The supernatant was collected and applied to lpBN-PAGE. The lpBN-PAGE device was prepared according to Järvi et al. (2011), with minor modifications. Acrylamide gradients of 3.5% to 8% or 3.5% to 12.5% (v/v) were chosen. The samples were run 90 min at 6 mA (150 maximum voltage) with cathode buffer (15 mM Bis-Tris and 50 mM Tricine, pH 7) including 0.01% (w/v) Serva Blue G stain (Coomassie) and then overnight at 50 V in the same buffer without Coomassie. For the CN-PAGE, Coomassie was substituted by deoxycholic acid in the cathode buffer, at a concentration of 0.57 mg mL 21 , and a-DDM was also supplemented at a concentration of 0.258 mg mL 21 . The same anode buffer (50 mM Bis-Tris, pH 7) was used for all native PAGE.
After the run, BN gel strips were excised and incubated in equilibration buffer for the 2D gel (3% [v/v] (Schägger, 2006), and run 3 to 4 h at 100 V (15 mA maximum). The same procedure was followed for the horizontal configuration of the 2D gel, where gel bands from the BN-PAGE were first excised and then run separately on a single lane. The 2D gel was silver stained according to Blum et al. (1987). Gel bands and spots from the 1D and 2D gels were excised and used for the identification of proteins by MS analysis.
Western blotting was performed according to Beer et al. (2006) via 2D SDS-PAGE. Two antibodies were used for detection of PSII (a-PsbC [CP43]; Agrisera no. AS111787, diluted 1:5,000) and PSI (a-PsaA; Agrisera no. AS06172, diluted 1:2,000). The secondary antibody used was goat anti-rabbit specific peroxidase conjugate (Calbiochem catalog no. 401315, diluted 1:10,000) for both the primary antibodies. The development was performed with the enhanced chemiluminescence method (Alegria-Schaffer et al., 2009), exposing the blot to the x-ray film with variable exposure times.
Suc Density Centrifugation
Suc density gradient centrifugation was performed according to Pi et al. (2019), with minor modification. Isolated plastids were centrifuged for 10 min at 17,383g. The pellet was suspended in MMKB buffer containing 30 mM MES, pH 6.5, 5 mM MgCl 2 , 10 mM KCl, and 1 M betaine. Solubilization was performed for 30 min at 4°C, with 0.75% (w/v) a-DDM, using 100 mg of chlorophyll a per sample at a concentration of 0.35 mg mL 21 . After solubilization, the sample was centrifuged for 1 min at 17,383g, and the supernatant was layered on top of the Suc gradient. The gradient was prepared using 0.55 M Suc in MMKB buffer by three freeze-thaw cycles at 280°C and 4°C. After centrifugation at 132,000g for 16 h at 4°C, fractions were collected with a syringe and concentrated using Amicon-ultra 100-kD cutoff devices (Merck-Millipore). The concentrated samples were applied to lpBN-PAGE for the analysis of the native complexes or spectroscopic analysis.
Spectroscopy
Absorption spectra were measured using a Jasco V-650 spectrophotometer. MMKB buffer was used for the dilution of samples, and spectra were recorded between 370 and 750 nm, with a 1-nm bandwidth.
The fluorescence spectra were recorded at room temperature or at 77K in a Jasco FP6500 fluorospectrometer, using MMKB buffer with 60% (v/v) glycerol for the latter. For the measurements, samples were diluted to an absorbance of about 0.03 in the Q y maximum. Two excitation wavelengths were used to preferentially excite chlorophyll a (440 nm) or chlorophyll c (465 nm). Emission spectra were measured between 600 and 800 nm. Both emission and excitation bandwidths were set to 3 nm, and spectra were corrected using a calibrated lamp spectrum.
MS Analysis
Protein spots or bands excised from gels were subjected to in-gel digestion with trypsin (Promega) according to Shevchenko et al. (1996). Tryptic peptides were dried in a vacuum centrifuge and stored at 220°C. Directly prior to analyses, the peptides we dissolve in 0.1% (v/v) formic acid, and 5 mL was injected for LC-MS/MS analysis performed by a Q Exactive HF mass spectrometer (Thermo Fisher Scientific) connected to an Easy NanoLC 1200 system (Thermo Fisher Scientific). Peptides were first loaded on a trapping column and subsequently separated inline on a 15-cm C18 column (75 mm 3 15 cm, ReproSil-Pur 5 mm 200 Å C18-AQ, Dr. Maisch HPLC). The mobile phase consisted of water with 0.1% (v/v) formic acid (solvent A) and acetonitrile:water (80:20, v/v) with 0.1% (v/v) formic acid (solvent B). A linear 30-min gradient from 6% to 35% B was used to elute peptides from samples cut from BN-or CN-PAGE gels, and a 15-min gradient was used for other peptide samples. MS data were acquired automatically by using Thermo Xcalibur 4.1 software (Thermo Fisher Scientific). An information-dependent acquisition method consisted of an Orbitrap MS survey scan of mass range 300 to 2,000 mass-to-charge ratio followed by higher-energy collisional dissociation fragmentation for the 10 most intense peptide ions.
Bioinformatics Analysis
MS data were searched for protein identifications using the Proteome Discoverer 2.3 software (Thermo Fisher Scientific) connected to an in-house server running the Mascot 2.6.1 software (Matrix Science). The database consisted of T. pseudonana sequences (12,014 entries) downloaded from UniProt (https:// www.uniprot.org/). Two missed cleavages were allowed. Peptide mass tolerance of 610 ppm and fragment mass tolerance of 60.02 D were used. Carbamidomethyl was set as a fixed modification. Met oxidation and acetylation of the proteins' N termini were included as variable modifications. For 2D gel spots or bands, fixed value PSM validator was used, and for BN-BAND samples, Percolator was used. For protein identification, a minimum of two peptides including at least one high-confidence peptide were required. Annotations of some proteins were cross-checked by using the Joint Genome Institute (https://mycocosm.jgi.doe.gov/Thaps3/Thaps3.home.html) database.
Relative abundances of proteins detected in 1D or 2D gel bands or spots were calculated in the following way. First, proteins were quantified by spectral counting. The number of spectra identified for a given protein in 1D or 2D gel bands/spots was then divided by the total number of peptide spectrum matches detected from the same band or spot. The variation of this value along the different bands/spots of the same gel was used to assign the protein occurrence in that band/spot. Only the unique peptides that matched with a single protein were taken into account. Since Lhc proteins have high sequence similarity, many peptides were present in more than one Lhc. Thus, proteins showing high similarity (greater than 80%) were analyzed as a group, and the sum of peptide matches was considered. However, peptides matching with more than two Lhc proteins were excluded from the analysis.
Accession Numbers
Sequence data from this article can be found in the UniProt (https://www. uniprot.org/) data libraries under the accession numbers reported in Supplemental Tables S1, S4, and S5.
Supplemental Data
The following supplemental materials are available.
Supplemental Figure S1. Comparison of T. pseudonana and Arabidopsis complexes solubilized with a-DDM and MW range estimation.
Supplemental Figure S2. Effect of the detergent concentration on the thylakoid complex solubilization from isolated plastids of T. pseudonana (with Arabidopsis complexes as a reference).
Supplemental Figure S3. Effect of the solubilization time on the thylakoid complex solubilization of T. pseudonana (with Arabidopsis as a reference).
Supplemental Figure S4. Spectroscopic and biochemical characterization of complex bands isolated by Suc density gradient centrifugation.
Supplemental Figure S5. Horizontal 2D SDS-PAGE: protein identification and western-blot analysis of complex subunits.
Supplemental Table S1. BN-and CN-PAGE bands MS data.
Supplemental Table S2. OEC comparison of BN-and CN-PAGE MS data.
Supplemental Table S3. LHC comparison of BN-and CN-PAGE MS data.
Supplemental Table S4. Standard 2D PAGE spots MS data.
Supplemental Table S5. Horizontal 2D PAGE bands MS data. | v3-fos-license |
2018-01-14T09:26:46.419Z | 2018-01-08T00:00:00.000 | 3778094 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.1371/journal.pone.0190922",
"pdf_hash": "423fad0be0a02598eb4d1aad5ca182208cd10829",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119474",
"s2fieldsofstudy": [
"Engineering"
],
"sha1": "423fad0be0a02598eb4d1aad5ca182208cd10829",
"year": 2018
} | pes2o/s2orc | Biodegradative potential of fungal isolates from sacral ambient: In vitro study as risk assessment implication for the conservation of wall paintings
The principal purpose of the study was to evaluate in vitro the potential ability of fungal isolates obtained from the painted layer of frescoes and surrounding air to induce symptoms of fresco deterioration, associated with their growth and metabolism, so that the risk of such deterioration can be precisely assessed and appropriate conservation treatments formulated. Biodegradative properties of the tested microfungi were qualitatively characterized through the use of a set of special agar plates: CaCO3 glucose agar (calcite dissolution), casein nutrient agar (casein hydrolysis), Czapek-Dox minimal medium (pigment secretion); and Czapek-Dox minimal broth (acid and alkali production). Most of the tested isolates (71.05%) demonstrated at least one of the degradative properties, with Penicillium bilaiae as the most potent, since it tested positive in all four. The remaining isolates (28.95%) showed no deterioration capabilities and were hence considered unlikely to partake in the complex process of fungal deterioration of murals via the tested mechanisms. The obtained results clearly indicate that utilization of fast and simple plate assays can provide insight into the biodegradative potential of deteriogenic fungi and allow for their separation from allochthonous transients, a prerequisite for precise assessment of the amount of risk posed by a thriving mycobiota to mural paintings.
Introduction
All works of art are susceptible to microbially induced decay. From primitive decorations made out of mollusc shells around 75.000 years BC through paintings in caves of the Upper Palaeolithic and works of Gothic and Renaissance art to contemporary art of the 21 st century, the creativity and personal expression of artists have largely involved the application of a wide range of natural materials. For example, al fresco wall paintings were prepared with variously coloured mineral powders mixed with lime or pure water and applied to fresh lime plaster on PLOS ONE | https://doi.org/10.1371/journal.pone.0190922 January 8, 2018 1 / 16 a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 the wall. However, in the case of tempera, paints were made by mixing mineral powders with some natural binders, substances such as oils from seeds (of poppy, flax, and hemp), casein, egg yolk, starch, etc., and applied to already formed dry mortar on the wall [1,2]. Aside from being suitable substrates for microbial growth, microorganisms pose a serious threat to artworks, as they are ubiquitous in the environment, quiescent, and just waiting for adequate environmental conditions under which to develop. Changes, as minor as a subtle short-term increase in humidity or as major as those caused by floods, can lead to microbial infestations within hours. Among various microorganisms, fungi, now thought to number potentially up to 5.1 million species [3], are considered primary causes of biodeterioration of wall paintings and other works of art [4]. Cosmopolitan, ubiquitous, and capable of colonizing a large number of microhabitats, they are organisms which due to their pronounced enzymatic activity and ability to grow on substrates with low a w values are able to degrade all the organic and inorganic components artworks are made of, usually resulting in aesthetically unacceptable changes [5]. In numerous studies conducted in the last few decades on mural paintings within historic buildings, churches and hypogea, fungi found to thrive on painted layers or in the interspace between mortar and paint were usually ascomycetes, while zygomycetes and basidiomycetes were less frequent on murals, though abundant in the surrounding environment [6,7,8,9,10]. However, although the diversity and origin of fungal contaminants of wall paintings are now well known, studies that apart from, research into mycobiota constituents were aimed at obtaining a better understanding of the complex process of fungal-induced deterioration are few and far between, often as a result of the inability to study the process without compromising the structural integrity of wall paintings, but also due to incomplete knowledge of the spectrum of fungi that are able to degrade this unique type of substrate. In order to transcend this issue, data on the diversity of fungi on wall paintings should be complemented with research into the physiological properties of isolated fungi, as insight into the spectrum of physiological features of common colonizers is a prerequisite for precise assessment of the amount of risk they pose to mural paintings [11]. The principal purpose of the present research was to evaluate in vitro the deteriorative potential of fungal isolates initially obtained from painted layers of the wall paintings and surrounding air of the old Church of the Holy Ascension in Veliki Krčimir (Serbia), either via cultivation on a set of unique nutrient media that emulate inorganic (limestone) and organic (casein) components of wall paintings or by testing the ability of isolates to secrete metabolites (acidic and alkaline metabolites, organic pigments) with negative effects on the structural and/ or aesthetic integrity of mural paintings. The action of "harmful" metabolites and secretion of organic acids that cause considerable acidification of the substrate are among the primary mechanisms through which fungi are involved in the biodeterioration of objects comprising our cultural heritage. The type of produced acid is regulated by available carbon sources and is often dictated by the presence of metal ions in the pigments used [12]. Adverse effects of acids include dissolution of cations and chelation of metal ions from mortar and mineral pigments, which leads to formation of stable metal complexes whose crystallization in the painted layer and mortar causes an increase of internal pressure that results in cracking, peeling, and eventual loss of mural fragments [13]. Furthermore, acidification of the substrate also stimulates fungal growth and accelerates chemical dissimilatory biodeterioration through oxidation, reduction, and transformation of metal ions [7,14]. This mechanism of mural deterioration is not unique to fungi, but rather occurs with all acid-producing microorganisms; however, since fungi possess a pronounced ability to secrete acids, they are usually considered the main deteriogens of mineral substrata [15]. The selection of casein as a proteinaceous substrate for screening the fungal proteolytic potential was made based on the fact that casein was commonly used as a natural binder for preparation of paint in al secco technique [1,5]. Casein applied to canvas cloth was also used to reinforce frescoes [16]. Furthermore, casein even today is used as casein-water in restoration treatments, to repair damage to fresco structures, and it is sometimes added to lime mortar as a consolidant [17]. In Serbia, a consolidant frequently in use for wall painting conservation is called "casein-acrylic binder" or "lime-based binder with additives", and it consists of 55% lime binder, 27% casein, 14% filler, and 4% concentrated acrylic binder [18]. This is problematical, since casein not only is a source of nutrients for fungal growth, but also acts as an activator of spore germination, which explains the increased bioreceptivity of al secco wall paintings, while peptide degradation can lead to pH increase and secondary CaCO 3 precipitation [19,20]. Finally there is now a growing interest in fungal-produced pigments as biologically active substances or colourants in the food and textile industries; however, from a conservation standpoint, synthesis and secretion of pigments into the substrate and resulting aesthetic and structural damage to objects of cultural heritage is a burning issue. Pigments from melanin, quinone, mycosporine, hydroxyanthraquinone, and carotenoid groups synthesized to tolerate unfavourable conditions (high UV radiation, thermal stress, and dehydration) and secreted into the substrate interact with its components to bring about undesirable changes in the characteristics and quality of materials of works of art [5,12,21]. These changes are usually manifested as alterations in the original colouration of the substrate, with the colour of stains depending not only on that of the secreted pigment, but also on a set of other factors, such as the environmental conditions, chemical composition of the substrate, and interactions between pigments and substrate components [19,22]. For conservators and restorers, removal of these stains is very difficult, since mechanical cleaning combined with biocidal treatment only removes evident fungal growth, whereas the products of their metabolism, i.e., very stable organic pigments, remain even when the organisms that caused them are completely eliminated [23].
Seeing as how the ability of fungi to degrade organic and inorganic components of wall paintings and produce and secrete various metabolites is clearly troublesome, a knowledge of their potential ability to induce symptoms of deterioration, gained through utilization of fast and simple plate assays will allow recognition of deteriogenic fungi, thereby enabling a precise assessment of risk to be made and appropriate conservation treatments to be formulated and implemented.
Tested fungal isolates
All 38 micromycetes screened for their biodegradative potentials are original isolates obtained from deteriorated frescoes (Fig 1) and surrounding air of the nave of the old Church of the Holy Ascension (Veliki Krčimir, Serbia) ( Table 1) [24]. Surface isolates were obtained from areas of wall paintings with documented biodeteriorative symptoms (discolouration, exfoliation, cracking, pilling, etc.) and where active fungal growth was confirmed via in situ optical and scanning electron microscopy [25,26]. Likewise, viable fungal propagules dispersed in the air were also sampled and tested, since favourable microclimatic conditions for mould proliferation are present throughout the year [25], resulting in a high spore overload. Fungal isolates were previously determined by ITS and β-tubulin gene sequencing and maintained at −75˚C with 1.5 ml of 30% glycerin in cryovials deposited in the Mycotheca of the University of Belgrade-Faculty of Biology (BEOFB).
Conidial suspensions of the tested isolates were prepared by washing conidia from the surface of 7 day old malt extract agar (MEA) slants using sterile saline solution (0.9%,NaCl, HemofarmhospitaLogica) with 0.1% Tween 20 (Sinex Laboratory). Concentrations of conidia in the suspensions were calculated using the formula given in the manufacturer's guidelines
Biodegradative plate assays
All biodegradative plate assays were performed in triplicate.
Carbonate dissolution test.
The potential ability of the tested microfungi to solubilize calcite was screened using CaCO 3 glucose agar plates of the following composition, per litre of deionized water: calcium carbonate, 5 g; glucose, 10 g; agar, 15 g; and deionized water, 1000 ml. The prepared medium was sterilized at 121˚C for 15 min, after which pH was adjusted to 8.0 with 10 N HCl and the mixture was cooled to 45˚C with gentle stirring to resuspend CaCO 3 . After pouring into Petri plates, the plates were then kept in a cool place. Petri plates with agarized CaCO 3 glucose agar were inoculated with 10 μl of fungal suspensions and incubated for 21 days at 25 ± 2˚C (UE 500, Memmert). Positive strains displayed a clear zone around the colony, thus confirming calcite dissolution [27].
Acid and alkali production. To determine the capacity of fungi to affect the pH value of the substrate on which they grow, isolates were cultivated in a liquid minimal medium of the following composition, per litre of deionized water: sodium nitrate, 3 g; dipotassium phosphate, 1 g; magnesium sulphate heptahydrate, 0.5 g; potassium chloride, 0.5 g; iron (II) sulphate heptahydrate, 0.01 g; glucose, 10 g; and deionized water, 1000 ml [28]. Titration flasks with 100 ml of medium, sterilized at 114˚C for 25 minutes and having its pH readjusted to 7.0 with 10 N HCl, were inoculated with 10 μl of fungal suspensions and incubated for three days on a platform shaker (Titramax 1000, Heidolph) under conditions of room temperature (22 ± 2˚C) and rotation of 300 rpm. After the incubation period, cultures were filtered through Whatman No. 4 filter paper and a pH meter (pH CYBERSCAN 510, Eutech) was used to measure pH values of the filtrates, i.e., the culture medium. Measurements were performed in triplicate, with results presented as mean values of a number of repetitions with the standard deviation.
Casein hydrolysis assay. The proteolytic activity of fungal isolates was determined by cultivation on casein agar (CN) plates of the following composition, per litre of deionized water: sodium chloride, 5 g; peptone, 5 g; yeast extract, 3 g; agar, 15 g; and deionized water, 1000 ml. Skimmed milk (250 ml), fractionally sterilized daily (for 3 days) at 100˚C for 30 min, was added to 750 ml of warmed sterilized medium (114˚C for 25 min; pH readjusted to 6.8 with 4M NaOH), and homogeneously mixed: after cooling to approximately 45˚C, the medium was then poured into Petri plates [9]. The centre of agarized medium was inoculated with 10 μl of fungal suspensions and the plates were incubated for 7 days at 25 ± 2˚C. Following the incubation period, the agar plates were flooded with 5 ml of a 10% tannin solution to facilitate visualization of the casein hydrolysis zone [29].
Pigment secretion assay. The potential ability of the tested microfungal isolates to produce and secrete organic pigments under nutrient-limited conditions (ideally present on the surface of clean, properly maintained mural paintings), and consequently to induce alterations in the original colouration of the painted layer, was assayed by cultivation on Czapek-Dox minimal medium of the following composition, per litre of deionized water: sodium nitrate, 2 g; dipotassium phosphate, 1 g; magnesium sulphate heptahydrate, 0.5 g; potassium chloride, 0.5 g; iron (II) sulphate heptahydrate, 0.01 g; glucose, 10 g; agar, 20 g; and deionized water, 1000 ml [28]. The medium was sterilized for 25 minutes at 114˚C, after which its pH was adjusted to 5.5 with 10N HCl. Petri plates inoculated with 10 μl of fungal suspensions, were incubated for 21 days at 25 ± 2˚C. Secretion of fungal pigments was confirmed by changes in colour of the transparent medium. The colour of the produced pigment was determined by comparing it with the ISCC-NBS colour palette [30].
Results
The deterioration potential of fungal isolates obtained from the sacral ambient is summarized in Table 1. Most of the isolates tested via biodegradative plate assays demonstrated at least one of the degradative abilities (71.05%), with Penicillium bilaiae testing positive in all four. The remaining 11 fungal isolates (28.95%) showed no deterioration capabilities and hence were considered not to partake in the complex process of fungal-induced deterioration of wall paintings via the tested mechanisms. These fungi likely induce deterioration through mechanical stresses created by hyphal penetration into the painted layers and mortar, or by means of other deterioration mechanisms, i.e., enzymatic degradation, biomineralization, etc. Fungal-induced dissolution of calcium carbonate, i.e. the main component of mortar, the "building block" and carrier of painted layers in wall paintings, was detected in only seven out of 38 (18.42%) isolates, three of which were obtained from wall paintings (Aspergillus europaeus, A. niger and Penicillium lanosum) and four from the surrounding air (P. bilaiae, P. commune, P. lanosum, and P. rubens). Among the tested Aspergillus species, only 18.18% (2/11) had a transparent zone in the culture, while in the genus Penicillium, solubilization ability was observed for the majority of tested isolates (71.43%; 5/7) ( Table 1). In all isolates that tested positive, a transparent solubilization zone could be detected as early as the third day of the incubation period, though fungal growth remained very restricted for a period of 21 days, with a small amount of produced mycelia and very restricted sporulation (Fig 2A-2F), most notably in the case of A. europaeus. Likewise, to judge from diameter of the observed CaCO 3 dissolution zone, A. europaeus and P. bilaiae possess the lowest calcite solubilization potential.
Short-term cultivation in a nutrient-limited broth medium showed that five out of 38 fungal isolates (13.16%) (Fig 3A-3E) were able to considerably alter pH of the broth medium, which ranged from 2.81 ± 0.47 to 8.47 ± 0.21 (Table 1). The lowest measured pH values were in cultures of A. niger (2.81 ± 0.47) and P. bilaiae (2.94 ± 0.33), followed by P. griseofulvum, with pH 5.62 ± 0.23. Growth and metabolism of only two species, Gibberella moniliformis and Epicoccum nigrum, caused an increase in alkalinity of the medium, with measured values in the pH Table 1).
Out of the 38 tested isolates, a casein hydrolysis zone was observed in 16 (42.11%) ( Table 1), mainly in the genus Aspergillus (63.64%; 7/11) (Fig 4A and 4B) and to a lesser extent in the genera Penicillium (28.57%; 2/7) (Fig 4C), Cladosporium (100%; 3/3) (Fig 4D-4F), and Chaetomium (66.67%; 2/3). Proteolytic activity was also detected in cultures of Bjerkandera adusta and Phaeospheria avenaria. The greatest diameters of the transparent zone were measured for Cladosporium species, with C. cladosporioides showing the largest zone, indicating the strongest proteolytic potential. Furthermore, in a culture of C. cladosporioides cultivated for one week on CN medium, morphological alteration in the guise of a partial change in colour of the colony, from dull green to shades of yellow and beige, was also observed (Fig 4D).
Colouration of the transparent medium (Fig 5A) was observed in 15 isolates (39.47%) ( Table 1). Most of them were of the genera Aspergillus (36.36%; 4/11) (Fig 5B and 5C) and Penicillium (57.14%; 4/7), while in isolates of other fungal genera, such as Gibberella (Fig 5D), pigment secretion was observed in only a few instances. Most of the isolates produced pigments in various shades of orange, while green and red pigments were present in three cultures. Chaetomim murorum and P. bilaiae (Fig 5E) were the only isolates with purple and bright yellow pigments. As many as 14 out of 15 isolates produced a sufficient amount of pigments to fully change colour of the transparent medium, although in cultures of the slow-growing fungi A. creber, A. versicolor, and P. manginii (Fig 5F), the process was very slow and full colouration could only be observed at the end of the incubation period. The greatest variety in shades and colours of produced pigments among different isolates of the same species was documented for Epicoccum nigrum (Fig 5G-5I). Chaetomium murorum was the only species with an isolate that produced small quantities of pigment, manifested as a purple halo around the colony
Production of acidic and alkaline metabolites in broth cultures of tested fungal isolates (day 3, Czapek-Dox minimal broth).
Each dot on the chart corresponds to one of the screened isolates, with emphasis on fungi that considerably altered pH of the broth medium.
https://doi.org/10.1371/journal.pone.0190922.g003 margins. On the other hand, in the case of fungi from the genera Alternaria and Cladosporium, pigment production was present, but the produced melanin remained bound within the cell wall and was not secreted into the medium.
Discussion
Limestone dissolution induced by fungal metabolites is a well-known and thoroughly studied natural phenomenon in the terrestrial environment [31], albeit less studied in regard to the possible damage it causes to carbonate substrata of cultural heritage monuments [32,33]. Albertano and Urzì [27] stated that solubilization of limestone and consequent deposition of secondary carbonates induced by various microorganisms is the primary cause of structural alterations of carbonate substrata. However, though very important, only a few studies since the mid-nineties have complemented data on microbial diversity with appropriate biodegradative assays. In two very similar investigations, Pangallo et al. [9,34] cultivated fungi isolated from stone monuments, indoor artwork, wall paintings and ambient air on CaCO3 glucose agar and showed that many species of the genera Aspergillus and Penicillium dissolve calcite, which fully corresponds with the results of our study. In both cases, only a small number of fungal isolates, 12.72 and 21.15%, respectively, mainly of these two genera, demonstrated a calcite solubilization ability. Apart from the work of Pangallo et al. [9,34], experimental proof of calcite dissolution in CaCO 3 -enriched MEA inoculated with A. niger was provided by Sayer et al. [35]. On the other hand, Doratomyces sp. and Paecilomyces sp. isolated from variously coloured patinas of the Catacombs of St. Callistus and Priscilla in Rome (Italy) were the only fungi able to dissolve calcite when cultured on CaCO 3 glucose agar, while all Aspergillus and Penicillium isolates tested negative [27]. Compared to all previous research, a recent work of Ortega-Morales et al. [36] showed the greatest percentage of fungi able to dissolve calcite, with more than 59% of fungi isolated from surface microhabitats of Mayan buildings testing positive when cultured on CMEA and CR2A-A selective media. As these two agarized nutrient media vary in composition with respect to the CaCO 3 glucose agar used, fungal carbonate solubilization activity presumably depends not only on environmental factors and origin of the isolates, but on available sources of carbon and nitrogen as well. A similar conclusion was also reached in a study of fungal degradation of apatite, galena and obsidian minerals [37].This is likely due to the fact that the primary way carbonate dissolution occurs is through synthesis and secretion of various organic acids, although other mechanisms have also been proposed, for example enzymatic dissolution, ligand activity, and oxidation-reduction of redox-sensitive elements(only when CO 2 is used as a carbon source for autotrophy, as CaCO 3 is not a redox sensitive compound) [32,38,39,40]. Albertano and Urzì [27] suggested that microfungi colonizing marble and limestone monuments use nutrients produced by phototrophic microorganisms to synthesize organic acids which dissolve CaCO 3 from the substrate. According to Sterflinger [32] and Ortega-Morales et al. [36], only fungi that produce and secrete acids can dissolve CaCO 3 , and strong oxalic acid (C 2 H 2 O 4 ) is the main "culprit" in most instances. Since organic acids are synthesized, as a by-product of oxidative metabolism during primary fungal metabolism, it is no wonder that in our study and many others as well [9,34,36], a transparent zone of CaCO 3 dissolution was formed very early, i.e., during the first week of the incubation period. However, only in broth cultures of A. niger and P. bilaiae was acid production documented, via substantial changes in pH of the filtrate. It follows that in cultures of other positive isolates, CaCO 3 dissolution either occurred as a result of acid production induced by the presence of Ca ions, or by one of the other mentioned mechanisms. In most cases, to produce acids, an abundant carbon source, i.e., sugars, is needed, since intensive growth results in production of more organic acids than is necessary for normal metabolism, the excess being excreted into the substrate. Cultured in Czapek-Dox minimal broth, an essentially oligotrophic medium, only a very small number of isolates, one of Aspergillus and two of Penicillium, caused considerable acidification of the broth medium, possibly owing to acid production. Many species of these two genera, isolated from artworks are known to synthesize acids, with A. niger being one of the strongest producers, primarily of oxalic, gluconic and citric acids [41,42,43]. Penicillium bilaiae is also a strong, producer of oxalic and citric acid, while P. griseofulvum is known to synthesize two acids: genistic and shikimic [44,45]. And though results for these three fungi are in full accordance with previously published data, many of the tested species did not induce changes of substrate pH inspite of literature data acknowledging them as acid producers. Many of the micromycetes tested in our research have already been tested in other similar studies involving cultural heritage objects [28,30,41,46,47,48,49], where it was shown that numerous species from the genera Aspergillus, Cladosporium, and Penicillium genera are potent acid producers. However, some of these studies were performed utilizing nutrient media rich in glucose, so carbon source availability and abundance evidently constitutes a very important factor in acid metabolism. Moreover, several fungal isolates known to be acid producers in our experiment did in fact lower pH of the broth medium by values on the order, of one pH unit. However, on the basis of such modest changes in pH, it cannot be definitely concluded that acid synthesis occurred without additional analysis by HPLC.
On the other hand, in cultures of Gibberella moniliformis and Epicoccum nigrum, increase in the pH level of the medium was documented, possibly as a result of secretion of alkaline metabolites, such as NH 3 and some polypeptides. Although species of the genus Fusarium are mainly known as producers of oxalic, fumaric, and succinic acid [41], results similar to those presented here, obtained with Fusarium proliferatum isolate AZhT01, from an ancient stone stela, and indicating an increase of pH when cultured in the same medium, were previously reported by Savković et al. [50]. It is important to note that while acids are generally referred to as "dangerous" metabolites for cultural heritage objects, it has been argued that deterioration can also incur via alkaline reactions, through degradation of nitrogen complexes and Na-salts of organic acids [51].
The casein hydrolysis assay applied in the present study (CN medium) was originally formulated as a simple and rapid method for screening proteolytic activity of microorganisms, so that adequate microbial strains, producers of important proteases, can be selected and further investigated for various uses in industrial biotechnology [29]. As the method entails use of a non-selective medium widely employed for isolation and cultivation of lactic acid bacteria, it recently also found application in other research areas, such as study of the biodegradative potential of the microbial community thriving on artwork [9]. Here it is presumed that the fungal extracellular enzyme casease, if produced, will degrade casein into polypeptides, peptides, and amino acids, making them available for absorption, which will result in loss of colour by the white milk protein and formation of a transparent zone around the colony. Our research indicates that many fungi, mainly species of the genera Aspergillus and Cladosporium (and Chaetomium and Penicillium species to a lesser extent), produce casease, which breaks the peptide bonds in casein, a finding that corresponds well with previously published data [9,30,52]. Where CN medium was applied in those studies, fungi from the genera Aspergillus, Cladosporium, and Penicillium were similarly characterized as the main producers of casease and as such the primary degraders of proteinaceous substrata of cultural heritage objects. And while the proteolytic activity of several fungi studied in these investigations (A. flavus, A. niger, A. versicolor, and C. oxysporum) is corroborated by our results in the study of Pangallo et al. [9] C. cladosporioides isolated from wall paintings and surrounding air of the Church of Saint Catherine in Velka Lomnica (High Tatra Mountains, Slovakia) lacked any observable transparent zone, which completely deviates from the findings obtained in our study, where it showed the highest proteolytic potential. Moreover, several Aspergillus isolates used in our study lacked a hydrolysis zone, although literature data [9,30,52] indicate them to be casease producers. Such discrepancies are possibly the result of varied cultivation conditions. Molitoris et al. [53] state that temperature and substrate salinity generally have very little impact on casease activity, while Rojas et al. [30] claim that discrepancies in detecting casease activity among various isolates of the same species are due to substrate pH, with fungi more likely to produce casease in substrates with lower pH. It should be noted that, some fungi, e.g., A. niger and A. flavus, are very tolerant to a wide range of pH and can thus produce enzymes whatever the acidity. Since casein agar medium has an approximately neutral pH value (6.8 ± 0.2), the absence of casein hydrolysis in known producers such as A. oryzae is not unexpected. As for Chaetomium isolates, the two tested species, Ch. ancistrocladum and Ch. murorum, both hydrolyzed casein, which is in accordance with the generally accepted view that this genus encompasses a large number of species that are strong producers of cellulolytic and proteolytic enzymes [54]. However, another screened strain of Ch. murorum did not produce casease, this may be the result of changes in morpho-physiological features of the isolate induced by growth on frescoes, which are an extreme type of environment. It is also worth noting that, according to Vermelho et al. [55], diameter of the hydrolysis zone of CN medium indicates the amount of produced casease. While this type of assessment cannot be considered exact without direct measurement of the quantity of produced casease, many authors [29] consider the given method suitable for obtaining general insight into the proteolytic capacity of tested fungal isolates. With that in mind, attention should be paid to the fact that the screened Cladosporium isolates had the largest diameters of the hydrolysis zone, which suggests that they possess the highest proteolytic activity and points to them as the primary degraders of protein components within mortar and painted layers of wall paintings. The present study particularly emphasizes the importance of cooperation between mycologists and conservators in the exchange of knowledge regarding fungal proteolytic capacities and protein binders commonly used in secco painting in a given region, since their use even today is largely the result of an insufficient level of communication. Only in this way, by working together in selecting appropriate binders for restoring damaged wall paintings, can re-colonization of restored surfaces be prevented and long-lasting and effective safeguarding of murals be ensured.
Micromycetes are known producers of a large variety of organic pigments, each with its own structure, composition, and colour, which are regulated by a number of things such as the available carbon and nitrogen source, metals in the substrate, light (UV), and other environmental factors that limit growth [19]. Many isolates have been shown to secrete variously coloured pigments, as indicated by changes in colour of the employed transparent medium, something which has been previously confirmed several times under nutrient-limited conditions with many Aspergillus, Chaetomium, Cladosporium, Fusarium, and Penicillium species isolated from wall paintings, documents, books, paintings, and photographs [11,28,30]. Furthermore, it was recently shown that same fungal species, albeit isolated from a variety of substrata, can produce pigments of different colour or lack pigment production at all [30], which would account for the inconsistencies in colour production documented here and in previously published research. An interesting finding is the purple pigment detected in a culture of Ch. murorum. Which pigment this is cannot be said without chemical analysis, although it is known that some species of the genus Chaetomium, viz. Ch. cochliodes and Ch. globosum, when cultured on various nutrient media produce a very small amount of the purple pigment cochliodinol (C 32 H 32 N 2 O 4 ) proven to possess strong antimicrobial activity [56].
An additional complication is the fact that produced pigments can be secreted into the substrate or (more commonly) bound within the protoplasm or incorporated into composition of the cell wall of hyphae and spores, which must be ascertained via light microscopy before adequate removal methods can be applied [19]. Coloured dry conidia present in mass quantities can be easily removed by simple vacuum treatments; however, to remove stains formed by secretion of pigment into the substrate, solubility of the given pigment must be known. This is usually not the case, as the chemical nature of the pigment is rarely determined in conservation practice. However, pigment secretion assay in combination with chemical analysis could provide essential information on the structure and solubility of the most commonly secreted pigments, which would go a long way toward selecting an appropriate solvent and eliminate the need for totally unacceptable and aggressive methods such as use of 1N KOH, 5% NaOCl, 30% H 2 O 2 , H 2 O 2 /Cu 2+ mixture, UVA radiation, etc. [19].
Based on all of the above, it can be concluded that the vast majority of filamentous fungi have a very important role in the decay of wall painting components via carbonate dissolution, proteolysis, and acid and alkaline action, usually manifested in cracking, peeling, and loss of microfragments, as well as in impairment of aesthetic appearance by secretion of coloured metabolites. It should be noted, however, that some common constituents of the mycobiota of frescoes are nothing more than harmless allochthonous transients. For these reasons, detection of fungal growth on painted layers or the presence in the surrounding air of propagules belonging to species with a now known biodegradative potential should be treated with particular care and appropriate remedial measures in the form of removal of the detected growth and application of microclimate control. Furthermore, introduction of fast and simple biodegradative plate assays as an integral part of the protocol of a modern system for the protection and conservation of artworks should be mandatory, since insight into the total spectrum of physiological features of fungi, common inhabitants of sacral ambients, is a prerequisite for precise assessment of the amount of risk they pose to mural paintings.
Conclusions
The obtained results clearly demonstrate that the ambient air and deteriorated wall paintings of the old Church of the Holy Ascension are contaminated with several fungal strains associated with various biodeteriorative effects that most likely are partially or completely the cause of the documented damage. The present study also emphasizes the importance of knowledge about the biodegradative characteristics of fungal dwellers present on or in the immediate vicinity of artworks, as it represents the basis for precise risk assessment and formulation of a set of recommendations to cultural institutions regarding the implementation of preventive and remedial treatments. When known deteriogenic fungi are detected, measures in the guise of monitoring and frequent cleaning, introduction of adequate ventilation, and indoor climate management, must be carried out in order to prevent their establishment and subsequent deterioration of valuable artworks. | v3-fos-license |
2019-12-06T02:30:51.571Z | 2019-12-01T00:00:00.000 | 208647100 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/1996-1944/12/24/4062/pdf",
"pdf_hash": "20fe51904b069dbb2b1e8864eb5aa5146eeb8651",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119505",
"s2fieldsofstudy": [
"Chemistry",
"Medicine",
"Biology"
],
"sha1": "20fe51904b069dbb2b1e8864eb5aa5146eeb8651",
"year": 2019
} | pes2o/s2orc | The Radiosensitizing Effect of Zinc Oxide Nanoparticles in Sub-Cytotoxic Dosing Is Associated with Oxidative Stress In Vitro
Radioresistance is an important cause of head and neck cancer therapy failure. Zinc oxide nanoparticles (ZnO-NP) mediate tumor-selective toxic effects. The aim of this study was to evaluate the potential for radiosensitization of ZnO-NP. The dose-dependent cytotoxicity of ZnO-NP20 nm and ZnO-NP100 nm was investigated in FaDu and primary fibroblasts (FB) by an MTT assay. The clonogenic survival assay was used to evaluate the effects of ZnO-NP alone and in combination with irradiation on FB and FaDu. A formamidopyrimidine-DNA glycosylase (FPG)-modified single-cell microgel electrophoresis (comet) assay was applied to detect oxidative DNA damage in FB as a function of ZnO-NP and irradiation exposure. A significantly increased cytotoxicity after FaDu exposure to ZnO-NP20 nm or ZnO-NP100 nm was observed in a concentration of 10 µg/mL or 1 µg/mL respectively in 30 µg/mL of ZnO-NP20 nm or 20 µg/mL of ZnO-NP100 nm in FB. The addition of 1, 5, or 10 µg/mL ZnO-NP20 nm or ZnO-NP100 nm significantly reduced the clonogenic survival of FaDu after irradiation. The sub-cytotoxic dosage of ZnO-NP100 nm increased the oxidative DNA damage compared to the irradiated control. This effect was not significant for ZnO-NP20 nm. ZnO-NP showed radiosensitizing properties in the sub-cytotoxic dosage. At least for the ZnO-NP100 nm, an increased level of oxidative stress is a possible mechanism of the radiosensitizing effect.
Introduction
With an estimated 65,000 new cases in 2019, head and neck squamous cell carcinoma (HNSCC) is the seventh most common cancer in the United States [1]. Despite all innovations in diagnostics and therapy, the five-year overall survival of HNSCC patients remains poor, at around 50% [2]. Surgical intervention and/or radiation is the backbone of HNSCC patients' therapy. Although the precision of radiation has been increased by introducing technologies such as intensity-modulated radiotherapy, damage to non-tumor tissues near the tumor is unavoidable [3]. In order to increase the antitumor effect of the radiation and to focus the effect of the radiation on the tumor volume, radiosensitizing agents such as cisplatin-chemotherapy are used in special clinical risk situations like primary radiation therapy, close or positive tumor margins, perineural invasion, or extranodal lymph node spread [4,5].
Nanoparticles (NP) are defined by a particle size of less than 100 nm. Due to their ratio of surface area to particle mass, NP have special physico-chemical properties [6]. Zinc oxide (ZnO)-NP is moving into the focus of medical research due to its potential to trigger tumor-selective cell death [7] and as a cancer-inhibiting drug carrier [8]. In addition, different groups could show a biological distribution characterized by greater accumulation of ZnO-NP in tumors as compared to healthy tissue [9]. By UV-light activation, ZnO-NP induce a photocatalytic cancer cell death [10,11]. However, the use of photodynamic therapy is limited to tissue surfaces mainly because of the low tissue penetration of light. A photosensitizer activated by X-rays would, therefore, be desirable [12].
The exact mechanism of ZnO-NP's mediation in tumor-cell toxicity is unknown. In this context, ZnO-NP-catalyzed production of reactive oxygen species (ROS) is most frequently discussed [7,13], which leads to increased intracellular oxidative stress. Subsequent induction of apoptosis, cell cycle changes [14], and pro-inflammatory processes [15] is frequently observed.
Considering the tumor-selective toxic effects and the concentration of ZnO-NP in tumor tissue, ZnO-NP have a theoretical radiosensitive potential.
The aim of this study was to investigate the radiosensitizing properties of the subtoxic ZnO-NP dosage in HNSCC cells. Furthermore, the influence of ZnO-NP alone and in combination with radiation on oxidative DNA damage was assessed.
In order to achieve a good particle dispersion, the NP solution was prepared according to the protocol of Bihara et al. [16]. A total of 20 mg ZnO-NP was dissolved in 1.740 mL distilled aqua and subsequently sonicated with 4.2 × 10 5 kJ/m 3 (Sonopuls HD 60, Bandelin, Berlin, Germany) for 120 s in the continuous mode.
To stabilize the suspension, 60 µL of 1.5 mg/mL bovine serum albumin (BSA) was added. By adding 200 µL of 10-fold concentrated phosphate-buffered saline (PBS) with physiological pH 7.4, the necessary salt concentrations were achieved. The stock suspension with PBS was further diluted to achieve various concentrations of ZnO-NP for the experiments.
Characterization of ZnO Nanoparticles
The ZnO-NP were previously characterized by our group [17,18]. Transmission electron microscopy (TEM) (Zeiss transmission electron microscope EM 900, Carl Zeiss, Oberkochen, Germany) was used to assess particle size distribution and morphology at the Division of Electron Microscopy at the Biocenter of University of Würzburg. The size distribution of NP agglomerates and the zeta potential were determined by dynamic light scattering, after preparation of the ZnO-NP suspension as described above and dilution with cell culture medium to a concentration of 10 µg/mL (Malvern Instruments Ltd., Herrenberg, Germany).
The fibroblasts were isolated from skin samples of patients who received elective neck surgery. All patients gave informed consent. This study was approved by the Ethics Committee of the University of Würzburg (approval no. 116/17). Fibroblasts were isolated from the skin according to the protocol described by Vangipuram et al. [20] and as previously described by our group [21]. Briefly, the fat residuals were removed from the skin sample and then cut into 2-3 mm pieces. The skin pieces were placed on a petri dish. After 60 min of waiting for attachment of the tissue pieces to occur, Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Thermo Fisher Scientific) supplemented with 10% FCS, 100 µg/mL streptomycin, and 100 U/mL penicillin were added, taking care to avoid flushing away of the skin pieces. The medium was changed every other day. Cell passaging was done with trypsin (0.25% trypsin; Gibco; Thermo Fisher Scientific, Waltham, USA); a confluence of 70-80% was reached. The growth of the fibroblasts at the bottom of the petri dish was monitored by microscopy (DM IL LED, Leica, Wetzlar, Germany).
MTT Cytotoxicity Assay
The cell viability after exposure to ZnO-NP in different concentrations was evaluated by the MTT [3-(4,5-dimethylthiazol-2-yl)-2.5-diphenyl tetrazolium bromide] colorimetric staining method [22]. The cells were incubated with 1 mg/mL of MTT (Sigma-Aldrich) dissolved in the medium for 4 h under cell culture conditions. Isopropanol was added to solubilize the crystal formations for one hour. The photometric measurement of the color conversion was performed at 570 nm wavelength with a multiplate reader (Titertek Multiskan PLUS MK II, Labsystems, Helsinki, Finland). The half maximal inhibitory concentrations (IC 50 ) were calculated after performing first a logarithm transformation of the ZnO-NP concentration values, and second, nonlinear regression by the use of the Prism software (GraphPad software, San Diego, CA, USA).
Cell Cycle Analysis
After incubation of FaDu and fibroblasts (FB) with 0, 1, 5, and 10 µg/mL ZnO-NP 20 nm and ZnO-NP 100 nm for 24 h, the cells were fixed with 70% ethanol at 4 • C in the dark for 2 h. Next, the cells were exposed to 500 µL PI/RNase staining buffer (Becton-Dickinson, Heidelberg, Germany) at 4 • C in the dark for 15 min and subsequently analyzed by flow cytometry (FACScanto, Becton-Dickinson).
Irradiation
X-irradiation was performed using a 6 MV Siemens linear accelerator (Siemens, Concord, CA, USA) with a dose rate of 2 Gy/min.
Clonogenic Survival Assay
The influence of ZnO-NP on the survival of tumor cells after irradiation was investigated by a clonogenic survival assay. After seeding 2 × 10 3 FaDu cells to a six-well dish, ZnO-NP treatment was performed for 24 h. In addition, X-ray irradiation was performed with 5 Gy. The irradiated cells were incubated in a humidified atmosphere (5% CO 2 , 37 • C) for 10 days. Cell fixation was performed with methanol and acetic acid in a ratio of 3:1 and stained with 0.1% crystal violet. Colonies with at least 50 cells were counted.
FPG-Modified Single-Cell Microgel Electrophoresis (Comet) Assay
In order to detect oxidized bases, alkali labile sites, and incomplete excision repair sites as markers for oxidative DNA damage, the formamidopyrimidine-DNA glycosylase (FPG)-modified comet assay was used. Therefore, the alkali version of the comet assay was modified by the additional use of the FPG protein [23,24]. The classical comet assay was performed as described by our group earlier [25].
The cells were seeded into a 6-well plate (2 × 105 cells/well). After overnight cultivation, they were exposed to 0 and 1 µg/mL ZnO-NP 20 nm and ZnO-NP 100 nm for 24 h. As a positive control, another sample was incubated with 400 mM methyl methanesulphonate (MMS, Sigma-Aldrich) for 1 h. Immediately after irradiation with 0 and 5 Gy, the cells were washed with PBS, trypsinized, and dissolved in the medium. All further steps were performed on ice to reduce further DNA damage. A cell pellet was created by centrifugation at 1500 rpm for 5 min. Subsequently, the cell pellet was resuspended in 0.5% low melting agarose (Sigma-Aldrich) and transferred to a slide. The specimen slides (Langenbrinck, Emmendingen, Germany) were coated with 1.5% normal melting agarose (Roth, Karlsruhe, Germany). The cells were incubated in the lysis buffer (100 mM Na2EDTA pH 10, 10% DMSO, 1% Triton-X, 2.5 M NaCl, 10 mM Tris) at 4 • C for 2h. Afterward, 100 µL lysis buffer containing 20% BSA and ± 0.03% FPG-enzyme (New England Biolabs, Frankfurt, Germany) was added at 37 • C for 30 min. After transferring the slides to the gel electrophoresis chamber (Renner, Darmstadt, Germany), alkaline buffer (5 mM NaOH and 200 mM Na2EDTA) with a pH > 13 was added. Gel electrophoresis was performed for 20 min (25 V, 300 mA). Subsequently, the cells were neutralized to pH 7.5 and stained with 20 µL GelRed (Biotium, Fremont, CA, USA).
Further specimen slide evaluations were performed with the DMLB fluorescence microscope (Leica Microsystems, Wetzlar, Germany) and the image analysis system (Komet 5.5, Kinetic Imaging, Liverpool, UK). From each slide, 50 cells were examined with a focus on the following parameters: Percentage of DNA in tail, tail length, and Olive tail moment (OTM), which is the product of the percentage of DNA in the comet tail and the median migration distance [26].
For assessment of genotoxicity attributed to oxidative stress, the ∆ fpg OTM was calculated by subtracting the OTM of the fpg-negative comet assay from the OTM of the fpg-positive comet assay. The calculation of the ∆ fpg tail DNA was processed in the same way.
Trypan Blue Exclusion Test
To evaluate the cell viability after incubation with ZnO-NP and irradiation, the trypan blue exclusion test was performed in a Neubauer Chamber. A total of 16 counting fields were examined to compute the percentage of viable cells.
Statistical Analysis
One-way ANOVA and multiple comparison testing were applied to determine statistically relevant differences in the mean values in comparison to the negative control in the MTT assay, clonogenic survival assay, and FPG-comet assay. A p-value of < 0.05 was set as significant and marked with an asterisk.
ZnO-NP Characterization
ZnO-NP 20 nm had a mean diameter of 20-30 nm, measured with TEM. The mean diameter of the particle aggregates assessed in the culture medium was 67.1 nm, and the zeta potential was −11.2 mV.
ZnO-NP 100 nm showed a mean diameter of 45-55 nm in TEM. The mean diameter of the particles aggregated and assessed in the culture medium was 120.68 nm. The zeta potential was −11.2 mV and the polydispersity index was 0.136.
ZnO-NP-Mediated Cytotoxicity in FaDu
The cell vitality of FaDu was evaluated after exposure to ZnO-NP 20 nm and ZnO-NP 100 nm in different concentrations for 24 h by the MTT assay. A significant reduction of cell viability was observed after exposure to ZnO-NP 20 nm at concentrations of 10 µg/mL and higher ( Figure 1). After incubation with ZnO-NP 100 nm , a significant decrease in cell viability was detected at concentrations of 1 µg/mL and higher ( Figure 1). The IC 50 values were 13.8 µg/mL for ZnO-NP 20 nm and 6.4 µg/mL for ZnO-NP 100 nm in FaDu. The cell vitality of FaDu was evaluated after exposure to ZnO-NP20 nm and ZnO-NP100 nm in different concentrations for 24 h by the MTT assay. A significant reduction of cell viability was observed after exposure to ZnO-NP20 nm at concentrations of 10 µg/mL and higher ( Figure 1). After incubation with ZnO-NP100 nm, a significant decrease in cell viability was detected at concentrations of 1 µg/mL and higher ( Figure 1). The IC50 values were 13.8 µg/mL for ZnO-NP20 nm and 6.4 µg/mL for ZnO-NP100 nm in FaDu.
ZnO-NP-Mediated Cytotoxicity in FB
Cytotoxicity with respect to a significant reduction of FB viability was observed after exposure to ZnO-NP20 nm at concentrations of 30 µg/mL and higher ( Figure 2). The vitality of the FB after incubation with ZnO-NP100 nm at concentrations of 20 µg/mL and higher was significantly decreased ( Figure 2). The IC50 values were 30.4 µg/mL for ZnO-NP20 nm and 24.6 µg/mL for ZnO-NP100 nm in FB.
Influence of ZnO-NP on the Cell Cycle Distribution in FaDu and FB
The influence of ZnO-NP exposure to FaDu and FB on cell cycle distribution was assessed by propidium iodide flow cytometry. Incubation with ZnO-NP20 nm and ZnO-NP100 nm at concentrations The cell vitality of FaDu was evaluated after exposure to ZnO-NP20 nm and ZnO-NP100 nm in different concentrations for 24 h by the MTT assay. A significant reduction of cell viability was observed after exposure to ZnO-NP20 nm at concentrations of 10 µg/mL and higher (Figure 1). After incubation with ZnO-NP100 nm, a significant decrease in cell viability was detected at concentrations of 1 µg/mL and higher (Figure 1). The IC50 values were 13.8 µg/mL for ZnO-NP20 nm and 6.4 µg/mL for ZnO-NP100 nm in FaDu.
ZnO-NP-Mediated Cytotoxicity in FB
Cytotoxicity with respect to a significant reduction of FB viability was observed after exposure to ZnO-NP20 nm at concentrations of 30 µg/mL and higher ( Figure 2). The vitality of the FB after incubation with ZnO-NP100 nm at concentrations of 20 µg/mL and higher was significantly decreased ( Figure 2). The IC50 values were 30.4 µg/mL for ZnO-NP20 nm and 24.6 µg/mL for ZnO-NP100 nm in FB.
Influence of ZnO-NP on the Cell Cycle Distribution in FaDu and FB
The influence of ZnO-NP exposure to FaDu and FB on cell cycle distribution was assessed by propidium iodide flow cytometry. Incubation with ZnO-NP20 nm and ZnO-NP100 nm at concentrations
Influence of ZnO-NP on the Cell Cycle Distribution in FaDu and FB
The influence of ZnO-NP exposure to FaDu and FB on cell cycle distribution was assessed by propidium iodide flow cytometry. Incubation with ZnO-NP 20 nm and ZnO-NP 100 nm at concentrations of 10 µg/mL for 24 h led to a cell cycle shift to the G2/M-phases in FaDu and FB ( Figure 3). Subsequently, the number of cells with a low staining intensity with propidium iodide decreased under the influence of 10 µg/mL of ZnO-NP 20 nm and ZnO-NP 100 nm (Figure 3). Subsequently, the number of cells with a low staining intensity with propidium iodide decreased under the influence of 10 µg/mL of ZnO-NP20 nm and ZnO-NP100 nm (Figure 3).
Colonial Cell Survival in Relation to ZnO-NP Concentration and Irradiation
After irradiation with 5 Gy, clonogenic survival was significantly reduced in all investigated constellations compared to the non-irradiated FaDu cells (Figure 4). The addition of ZnO-NP20 nm or ZnO-NP100 nm at concentrations of 1, 5, and 10 µg/mL significantly reduced the survival of the cells within the non-irradiated and the irradiated groups, with the exception of non-irradiated FaDu exposed to ZnO-NP20 nm at 1 µg/mL concentration (Figure 4).
Colonial Cell Survival in Relation to ZnO-NP Concentration and Irradiation
After irradiation with 5 Gy, clonogenic survival was significantly reduced in all investigated constellations compared to the non-irradiated FaDu cells (Figure 4). The addition of ZnO-NP 20 nm or ZnO-NP 100 nm at concentrations of 1, 5, and 10 µg/mL significantly reduced the survival of the cells within the non-irradiated and the irradiated groups, with the exception of non-irradiated FaDu exposed to ZnO-NP 20 nm at 1 µg/mL concentration (Figure 4).
Cytotoxicity Assessment by the Trypan Blue Exclusion Test
After exposure to ZnO-NP and irradiation and prior to the comet assay, cytotoxicity was excluded by the trypan blue test. It did not reveal a significant influence on FB viability for the chosen ZnO-NP concentrations and the irradiation doses ( Figure 5).
Cytotoxicity Assessment by the Trypan Blue Exclusion Test
After exposure to ZnO-NP and irradiation and prior to the comet assay, cytotoxicity was excluded by the trypan blue test. It did not reveal a significant influence on FB viability for the chosen ZnO-NP concentrations and the irradiation doses ( Figure 5). There was no significant change in DNA damage in FB as evaluated by the OTM and the percentage of tail DNA in the conventional comet assay without treatment or after treatment with 1 µg/mL ZnO-NP and 5 Gy irradiation ( Figure 6). There was no significant change in DNA damage in FB as evaluated by the OTM and the percentage of tail DNA in the conventional comet assay without treatment or after treatment with 1 µg/mL ZnO-NP and 5 Gy irradiation ( Figure 6). )). There is no significant difference in DNA damage measured by (A) OTM and (B) percentage of tail DNA in the conventional comet assay. As compared to the irradiated cells without incubation with ZnO-NP, those exposed to ZnO-NP100 nm show greater oxidative stress, as seen in (C) Δ fpg OTM and (D) Δ fpg tail DNA. The data represents experiments with five individual FB cells.
Changes of Oxidative Stress Immediately after Exposure to ZnO-NP and Irradiation
The induction of oxidative stress after exposure to ZnO-NP alone and in combination with irradiation was investigated with the comet assay after the addition of the FPG-enzyme. Oxidative stress in terms of Δ fpg OTM was significantly increased after irradiation as compared to nonirradiated cells. After exposure to ZnO-NP100 nm and irradiation, Δ fpg OTM and Δ fpg tail DNA were significantly increased as compared to cells that were only irradiated ( Figure 6). Δ fpg OTM and Δ fpg tail DNA were not significantly raised after incubation with ZnO-NP20 nm and irradiation compared to irradiation alone ( Figure 6).
Discussion
Selective tumor-cell death mediated by ZnO-NP is discussed as a promising characteristic of ZnO-NP for its use as an anti-cancer drug [7,27,28]. We observed the cytotoxicity of ZnO-NP in FaDu
Changes of Oxidative Stress Immediately after Exposure to ZnO-NP and Irradiation
The induction of oxidative stress after exposure to ZnO-NP alone and in combination with irradiation was investigated with the comet assay after the addition of the FPG-enzyme. Oxidative stress in terms of ∆ fpg OTM was significantly increased after irradiation as compared to non-irradiated cells. After exposure to ZnO-NP 100 nm and irradiation, ∆ fpg OTM and ∆ fpg tail DNA were significantly increased as compared to cells that were only irradiated ( Figure 6). ∆ fpg OTM and ∆ fpg tail DNA were not significantly raised after incubation with ZnO-NP 20 nm and irradiation compared to irradiation alone ( Figure 6).
Discussion
Selective tumor-cell death mediated by ZnO-NP is discussed as a promising characteristic of ZnO-NP for its use as an anti-cancer drug [7,27,28]. We observed the cytotoxicity of ZnO-NP in FaDu cells and FB. However, toxic concentrations of ZnO-NP in FB were significantly higher as compared to concentrations in FaDu, indicating a higher susceptibility of the malignant FaDu cells to NP-mediated cell death. High tolerance of non-malignant cells for oxidative stress as reported by He et al. could be one possible reason for the observed differences in ZnO-NP-mediated cytotoxic effects in FaDu and FB [29]. In particular, the authors described a high expression of antioxidant enzymes such as manganese superoxide dismutase in human endothelial progenitor cells [29].
Although the exact mechanism of ZnO-NP-mediated toxicity for tumor cells is unknown, several mechanisms have been discussed. Various groups have described the ZnO-NP-dependent intracellular production of reactive oxygen species (ROS) [7,13]. Increased concentrations of intracellular ROS induce a metabolic status of oxidative stress. Oxidative stress is associated with apoptosis, cell cycle alterations [14], pro-inflammatory processes [15], and DNA damage [30,31].
Another possible mechanism of ZnO-NP-mediated toxicity could be the high content of dissolved Zn 2+ cations [30,32]. In central areas of solid tumor formations, insufficient oxygen supply often leads to low pH values. In theory, this can promote the dissolution of divalent Zn 2+ ions from ZnO-NP. This may possibly explain the higher tumor-specific toxicity of ZnO-NP. But due to the controlled normoxic and pH conditions in the performed cell culture experiments, the effects of dissolved Zn 2+ cations in in vitro experiments are expected to be low.
The effectiveness of irradiation depends on the specific dosage and is mainly limited by the damage that irradiation causes to the healthy tissue surrounding the tumor. Radiosensitizing drugs that focus the toxic effects of radiation on tumor tissue and protect the surrounding non-tumor tissue as much as possible would be desirable. The tumor-cell-selective toxic effects of ZnO-NP could prove ZnO-NP to be a potential radiosensitizer. In our study, ZnO-NP, even at the low dose of 1 µg/mL, significantly reduced the clonogenic survival of FaDu cells after irradiation. In contrast to our results, Sadjadpour et al. observed no increased cytotoxic effects after combined irradiation and ZnO-NP treatment in breast cancer cells [33]. However, the low radiation dose (1 Gy) and the evaluation of cytotoxicity by MTT assay, which does not reliably detect radiotherapy-mediated toxicity, influenced the results. In contrast, other groups described a ZnO-NP-dependent sensitivity to irradiation. For example, Zangeneh et al. observed increased cytotoxic and genotoxic effects of gadolinium-doped ZnO-NP on irradiated lung cancer cells at megavoltage radiation energies [34]. Generalov et al. could show a ZnO-NP-mediated sensitization for irradiation in the prostate carcinoma cell lines LNCaP and Du145 [35].
Despite several reports on the radiosensitivity mediated by ZnO-NP, the exact mechanisms of this action are still unclear. One theory assumes that ZnO-NP mediates by causing a higher rate of oxidation ROS generation, and that increases the ionizing effect of the radiation [36,37]. In our study, the oxidative DNA damage measured by ∆ fpg OTM and ∆ fpg tail DNA was not significantly increased after exposure to ZnO-NP 20 nm and ZnO-NP 100 nm in the low dosage of 1 µg/mL. However, there was a significant increase in ∆ fpg OTM and ∆ fpg tail DNA after exposure to ZnO-NP 100 nm and irradiation, in comparison with irradiation of cells only. These data suggest that ZnO-NP-mediated radiosensitization may be associated with oxidative stress, at least for ZnO-NP 100 nm . However, these results were not significant for ZnO-NP 20 nm . Our observation of higher cytotoxic and oxidative DNA damage potential of ZnO-NP 100 nm compared to that of the ZnO-NP 20 nm is surprising. A trend of size-dependent higher toxic potential of NP towards finer NP has been controversially discussed [38][39][40].
Tumor hypoxia is one of the main challenges in radioresistance in HNSCC [41]. The causes are rapid tumor growth, lack of compensatory angiogenesis, and metabolic changes in the tumor [42]. To the best of our knowledge, there is no report on the radiosensitizing effects of ZnO-NP under hypoxic conditions. For ROS generation in the reductive pathway, the presence of oxygen is necessary. Irradiation of ZnO-NP-exposed biological material leads to ROS generation by transferring ZnO-released electrons to oxygen [37]. For a comprehensive evaluation of the radiosensitization potential of ZnO-NP, the radiosensitive potential of ZnO-NP under hypoxic conditions should be evaluated concretely.
We observed an influence of ZnO-NP on the cell cycle in terms of G2/M arrest at high ZnO-NP concentrations. This ZnO-NP-mediated effect on the cell cycle was previously described by various other groups [17,43]. The increased radiation sensitivity in our experiments, even at low ZnO-NP concentrations, questions the ZnO-NP-mediated G2/M arrest as the main mechanism that causes radiation sensitivity.
In summary, our data suggest that ZnO-NP has a radiosensitization potential in FaDu. At least in the case of ZnO-NP 100 nm , increased oxidative stress seems to be an important mechanism for the ZnO-NP-mediated radiation-sensitization effect. | v3-fos-license |
2019-07-16T22:04:35.837Z | 2018-08-27T00:00:00.000 | 196648544 | {
"extfieldsofstudy": [
"Biology",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GREEN",
"oa_url": "http://www.jlr.org/content/60/4/832.full.pdf",
"pdf_hash": "8b2b111520502c5b6a8f9f8eb4e51a1f351180f1",
"pdf_src": "BioRxiv",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119535",
"s2fieldsofstudy": [
"Biology"
],
"sha1": "100d23e63e4f76359d941a4580c38fcd67459fb6",
"year": 2018
} | pes2o/s2orc | Cyclodextrin triggers MCOLN1-dependent endo-lysosome secretion in Niemann-Pick type C cells
In specialized cell types, lysosome-related organelles support regulated secretory pathways, while in non-specialized cells, lysosomes can undergo fusion with the plasma membrane in response to a transient rise in cytosolic calcium. Recent evidence also indicates that lysosome secretion can be controlled transcriptionally and promote clearance in lysosome storage diseases. In addition, evidence is also accumulating that low concentrations of cyclodextrins reduce the cholesterol storage phenotype in cells and animals with the cholesterol storage disease Niemann-Pick type C, via an unknown mechanism. Here, we report that cyclodextrin triggers the secretion of the endo/lysosomal content in non-specialized cells, and that this mechanism is responsible for the decreased cholesterol overload in Niemann-Pick type C cells. We also find that that the secretion of the endo/lysosome content occurs via a mechanism dependent on the endosomal calcium channel MCOLN1, as well as FYCO1, the AP1 adaptor and its partner Gadkin. We conclude that endolysosomes in non-specialized cells can acquire secretory functions elicited by cyclodextrin, and that this pathway is responsible for the decrease in cholesterol storage in Niemann-Pick C cells.
INTRODUCTION
Niemann-Pick type C (NPC) is an autosomal recessive lysosomal storage disorder (LSD) characterized at the cellular level by an accumulation of cholesterol and other lipids in late endocytic compartments (Vanier, 2010). In NPC, the traffic of LDL-derived cholesterol from lysosomes to the endoplasmic reticulum is defective, which impairs not only cholesterol esterification, but also the feedback transcriptional regulation of cholesterol metabolism via the sterol regulatory element-binding protein (SREBP) pathway (Kristiana et al., 2008;Liscum and Faust, 1987;Pentchev et al., 1985). The disease is caused by loss-of-function mutations in either one of the two late endosome/lysosome proteins NPC1 (Carstea et al., 1997), a multi-spanning protein of the limiting membrane, and NPC2 (Naureckiene et al., 2000), a globular protein present in the lumen. While solid evidence show that both proteins bind cholesterol (Infante et al., 2008;Xu et al., 2007), structural and mutagenesis data suggest that cholesterol is transferred from NPC2 to NPC1, thereby facilitating export from the organelle (Gong et al., 2016;Kwon et al., 2009;Li et al., 2016;Wang et al., 2010). However, the precise mechanism of export remains unclear. Similarly, it is not clear how cholesterol is transferred from late endosome/lysosomes to reach the regulatory pool in the ER. Several direct routes have been proposed (Pfisterer et al., 2016), but recent findings indicate that the plasma membrane may be the primary destination of LDL-derived cholesterol before reaching the ER (Infante and Radhakrishnan, 2017). This view is consistent with the earlier notion that cholesterol rapidly equilibrates between the plasma membrane and the regulatory ER pool (Lange et al., 2004).
There is no approved treatment against NPC with the exception of Miglustat, which delays but does not arrest the progression of the disease (Patterson et al., 2015). Over the last decade, cyclodextrins are emerging as a possible therapeutical strategy. These cyclic oligosaccharides clear cholesterol storage and re-establish the feedback regulation in cultured cells and NPC mice Liu et al., 2010;Rosenbaum et al., 2010). They also improve neurological symptoms and survival in NPC animal models Vite et al., 2015), and were shown to decrease the neurological progression of the disease in phase 1-2 trials in NPC patients (Ory et al., 2017). However, the mechanism of cyclodextrin action remains poorly understood.
In recent years, it has become apparent that secretory endosomes or lysosomes (Marks et al., 2013) may play an important role in LSDs. Indeed, activated or overexpressed transcription factors of the TFEB-family can revert storage in Pombe disease and other LSDs by stimulating the secretion of the endo/lysosome content (Martina et al., 2014;Medina et al., 2011;Samie and Xu, 2014). This pathway is distinct from the acute and transient calcium-induced process involved in plasma membrane repair (Andrews et al., 2014;Laulagnier et al., 2011;Reddy et al., 2001).
Similarly, storage in cells from NPC and other LSDs can be reverted by δ-Tocopherol treatment (Xu et al., 2012) or activation of BK channels (Zhong et al., 2016), which also promote endo/lysosome-mediated secretion. Interestingly, the secretion of endo/lysosome storage materials seems to depend on the activation of the lysosomal cation channel mucolipin-1 (MCOLN1), which is itself responsible for the LSD mucolipidosis type 4 when mutated (Boudewyn and Walkley, 2018). Endosome-or lysosomes-mediated secretion is impaired in MCOLN1 mutant cells (LaPlante et al., 2006), while activating mutations in the channel increase the rate of this exocytic pathway (Dong et al., 2009).
Here, we provide direct evidence that hydroxypropyl-cyclodextrin (HPCD) promotes the secretion of the endo/lysosome content via a mechanism that requires MCOLN1. Our data indicate that the process also depends on FYCO1 -a protein involved in endo-lysosome motility towards the periphery (Pankiv et al., 2010;Raiborg et al., 2015)-as well as the AP1 adaptor and its partner Gadkin, which have both been implicated in the secretion of endo-lysosomes (Laulagnier et al., 2011). Finally, we show that this pathway mediates the cyclodextrin-induced decrease in cholesterol storage within late endocytic compartments of NPC cells.
Cyclodextrin reverts the NPC phenotype
NPC1 was depleted with siRNAs in HeLa cells, to provide an experimental system readily amenable to biochemical and cellular manipulations and with a reduced danger of adaptive drift that may occur in patient cells. NPC1 KD cells exhibited the characteristic hallmarks of NPC.
Indeed, cholesterol accumulated in late endosomes as revealed by fluorescence microscopy ( Fig 1A) and subcellular fractionation (Fig 1D), resulting in increased levels of total cellular cholesterol ( Fig 1D). As expected, KD cells also exhibited a reduced capacity to esterify LDL-derived cholesterol ( Fig 1B) and to regulate the transcription of cholesterol-dependent genes like the LDL receptor ( Fig 1C). Treatment with a low (0.1%) dose of 2-hydroxypropyl-ß-cyclodextrin (HPCD) was able to correct the effects of NPC1 KD on cholesterol subcellular distribution ( Fig 1A and D), esterification ( Fig 1B) and transcriptional regulation (Fig 1C), while having essentially no effect in mock-treated control cells (Fig 1). While HPCD reduced endosomal cholesterol in NPC1 KD cells ( Fig 1A and D), the drug only marginally, if at all, affected total cellular cholesterol. Altogether, these observations strengthen the notion that HPCD is able to revert the NPC phenotype in KD cells, presumably by redistributing cholesterol from endosomes to other membranes Rosenbaum et al., 2010).
HPCD stimulates endo-lysosome secretion
We previously found that the intralumenal vesicles of multivesicular late endosomes contain lysobisphosphatidic acid (LBPA)/ bis(monoacylglycero)phosphate (BMP), an atypical phospholipid that is not detected in other organelles (Kobayashi et al., 2002;Kobayashi et al., 1998). LBPA is functionally linked to cholesterol, since interfering with LBPA phenocopies NPC (Chevallier et al., 2008;Kobayashi et al., 1999). Strikingly, intracellular levels of LBPA were strongly decreased in HPCD-treated cells (40 % of control after 18h), while other phospholipids remained essentially unaffected (Fig 2A). Cellular phospholipids released in the medium could be unambiguously quantified after metabolic labeling with 32 P. Concomitant with decreased cellular levels, 32 P-LBPA was released into the culture medium, reaching 2.5 -3 % of the total cellular content within 1h, when compared to <1% for other 32 P-phospholipids ( Fig 2B). The analysis of LBPA released into the medium was not feasible after longer incubations, likely because of its high instability (36).
Much like LBPA, treatment with HPCD for 18h strongly reduced the total cellular amounts of the aspartyl endopeptidase cathepsin D (Fig 3A), to ≈60% of controls ( Fig 3B). Interestingly, cathepsin D was reduced by HPCD to a similar extent in control (mock-treated) cells and in NPC1 KD cells ( Fig 3A-B), indicating that the mechanism controlling cathepsin D release is not affected by NPC1 depletion. In control cells, HPCD also reduced the levels of two other lysosomal hydrolases, ßhexosaminidase and acid lipase (LIPA) to the same extent ( Fig 3C) as cathepsin D (Fig 3B). By contrast, the drug had no effect on the total cellular amounts of two endo-lysosomal membrane proteins LAMP1 and NPC1 itself, or on the early endosome marker EEA1 ( Fig 3C). Concomitant with decreased cellular amounts, ß-hexosaminidase appeared in the medium of HPCD-treated cells in a time-dependent fashion ( Fig 4A). This was not due to some deleterious effects of the treatment, since HPCD did not increase the release of the cytosolic enzyme lactate dehydrogenase (LDH). Lysosomal enzyme release occurred with relatively slow kinetics and low efficiency, when compared to acute secretion triggered by a transient raise in cytosolic calcium ( Fig 4A). However, in marked contrast to calcium-induced secretion (Laulagnier et al., 2011), the process continued over hours, eventually depleting half of the total cellular amounts after 24h ( Fig 3C).
A three-dimensional analysis by focus ion beam scanning electron microscopy (FIB-SEM) showed that treatment with low concentrations of HPCD for 18h did not affect the morphology of the Golgi complex or mitochondria ( Fig EV1) consistent with the notion that HPCD has no detrimental effects on the overall cell organization. However, late endosomes labeled with BSA-gold endocytosed for 4h (at the end of the HPCD incubation period), appeared markedly less electrondense ( Fig 5B and D, low and high magnification), when compared to controls (Fig 5A and C,low and high magnification). Densitometric quantification confirmed that the lumen of HPCD-treated endosomes was significantly lighter than controls ( Fig 5E). Presumably, the endosomal content had been released into the medium upon HPCD treatment, fully consistent with our analysis of HPCD-mediated lysosome enzyme release ( Fig 4A).
Altogether, these observations suggest that HPCD-induced lysosome enzyme release occurs via endo-lysosome secretion. If so, one may expect the major endo-lysosome membrane protein LAMP1 to appear transiently on the plasma membrane upon endo-lysosome fusion (Laulagnier et al., 2011;Marks et al., 2013). After HPCD treatment, LAMP1 levels hardly changed at the plasma membrane, presumably because LAMP1 was efficiently re-endocytosed (Kornfeld and Mellman, 1989), the secretory process occurring with slow kinetics (Fig 4A). However, in cells incubated with anti-LAMP1 antibodies, HPCD increased the intracellular accumulation of antibodies captured at the plasma membrane after binding to their antigen ( Fig 4B). Altogether, these data demonstrate that HPCD triggers the secretion of the endo-lysosome content.
After depletion by RNAi (Fig EV2), cells were treated with HPCD. Cell-associated cathepsin D was analyzed by western blotting (Fig 6A and Fig EV4) and amounts were quantified ( Fig 6B). In cells treated with non-targeting siRNAs, cathepsin D was decreased by HPCD to 50%, as expected ( Fig 3). In marked contrast, the amount of cell-associated enzyme was essentially unaffected by HPCD after MCOLN1 depletion, suggesting that lysosome enzyme release was essentially abrogated without this channel. The depletion of the µ1 chain of AP1, gadkin and FYCO1 also reduced cathepsin D secretion but effects were less pronounced, while the depletion of other regulators was without effect. Much like with cathepsin D, HPCD failed to reduce cell-associated LBPA after the depletion of MCOLN1, AP1µ1 or FYCO1, and to a lesser extent after gadkin depletion ( Fig 7A).
By contrast, HPCD did not affect any other phospholipid, including phosphatidylglycerol (PG), phosphatidylcholine (PC) or phosphatidylethanolamine (PE) whether in control cells or after depletion of any of these factors ( Fig 7B). Altogether these data indicate that HPCD-stimulated endo-lysosome secretion is controlled by the calcium channel MCOLN1, together with adaptor protein µ1 and its partner gadkin and by the ER-endosome contact site protein FYCO1 involved in endosome translocation.
MCOLN1 controls HPCD-dependent endo-lysosome secretion in NPC cells
Next, we investigated whether the same mechanism also mediates the clearance of endosomal cholesterol in NPC KD cells. To this end, we generated a NPC2 knock-out cell line using CRISPR/Cas9, which showed strong cholesterol accumulation in late endocytic compartments ( Fig 8A). Treatment of NPC2 KO cells with HPCD massively reduced cholesterol storage ( Fig 8A).
Quantification by automated microscopy confirmed that, while HPCD did not affect the major endo-lysosomal protein LAMP1 both in NPC2 KO and WT cells, the drug reduced the cholesterol 9 content of LAMP1-containing compartments by half in NPC2 KO cells ( Fig 8A and Fig EV3), much like in NPC1 KD cells ( Fig 1A).
The depletion of MCOLN1 by RNAi in NPC2 KO cells had no significant effects on the amounts of LAMP1 or on the cholesterol content of LAMP1-contanining endo-lysosomes ( Fig 8A-B and Fig EV3). Remarkably, however, MCOLN1 KD in NPC2 KO cells abrogated the effects of HPCD on cholesterol accumulation (Fig 8A-B and Fig EV3), consistent with the effects of MCOLN1 KD on endo-lysosome secretion in untreated, healthy cells ( Fig 6A). Depletion of AP1µ1, gadkin and FYCO1 had a smaller, but significant, effect on HPCD-mediated reduction of cholesterol storage in NPC2 KO cells (Fig 8A,quantification in B). The difference may be due to differential effects of HPCD on cholesterol-laden endosomes in NPC2 cells vs endosomes in control cells. In conclusion our data show that the calcium channel MCOLN1 is directly involved in the regulation of cyclodextrin-mediated endo-lysosome secretion, perhaps together with AP1 and its partner Gadkin, which play a role in calcium-mediated endo-lysosome secretion (Laulagnier et al., 2011) and the ER-endosome contact site protein FYCO1 (Pankiv et al., 2010).
DISCUSSION
In the NPC lysosomal storage disease, mutation of NPC1 or NPC2 causes the accumulation of LDLderived cholesterol in late endocytic compartments, but the functions of the NPC1 and NPC2 proteins remain incompletely understood (Rosenbaum and Maxfield, 2011). The accumulation of storage materials in NPC endosomes eventually leads to a traffic jam and a collapse of endosomal membrane dynamics (Liscum, 2000;Simons and Gruenberg, 2000), accompanied by defects both in cholesterol movement to the endoplasmic reticulum and transcriptional regulation of cholesterol metabolism (Kristiana et al., 2008;Liscum and Faust, 1987;Pentchev et al., 1985). Compelling evidence now shows that prolonged incubations with low concentrations of cyclodextrins reduces the cholesterol storage phenotype and restores cholesterol-dependent transcriptional regulation (Rosenbaum and Maxfield, 2011) (Vance and Peake, 2011), while cyclodextrin also decreases the progression of neurological symptoms in clinical trials with NPC1 patients (Ory et al., 2017). The mechanism of action of these cyclic oligosaccharides, however, remain poorly understood. Cyclodextrins are thought to act intracellularly after endocytosis as a fluid phase tracer, perhaps bypassing the requirement for the NPC2 protein in the endosome lumen (Rosenbaum et al., 2010). These in vitro studies and our work (this paper) collectively establish that, in the presence of serum, low doses of cyclodextrins do not cause net cholesterol extraction, but instead facilitate redistribution within the cell. This is best illustrated by the restoration of cholesterol esterification and SREBP-mediated feedback regulation in the ER (Abi-Mosleh et al., 2009) (and Fig 1). It has been reported that very short (60min vs. 18-24h in our study) incubations with high doses of cyclodextrin (2% vs. 0.1% in our study) cause calciumdependent lysosome exocytosis [26]. These high concentrations, however, will cause massive cholesterol depletion from plasma membranes, which may trigger a response to plasma membrane damage (Hissa et al., 2013).
We find that prolonged incubations of control cells with low doses of cyclodextrin causes the secretion of the endo-lysosomal content. Compelling evidence for this secretory pathway comes first from the observed decrease in cellular LBPA content and increase in the medium, since LBPA is only detected in late endosomes (Kobayashi et al., 2002;Kobayashi et al., 1999;Kobayashi et al., 1998). We also find that prolonged incubation with low doses of cyclodextrin causes significant secretion of lysosomal enzymes leading to partial depletion from cells after 18-24 h.
Specialized cell types contain lysosome-related organelles (LROs), which have the capacity to undergo fusion with the plasma membrane and to secrete their content in a regulated fashion (Marks et al., 2013) (Luzio et al., 2014). Non-specialized cells also possess the capacity to trigger the acute fusion of endocytic compartments with the plasma membrane in response to a transient rise in cytosolic calcium, presumably as a membrane repair pathway (Laulagnier et al., 2011;Reddy et al., 2001) (Andrews et al., 2014). Given its slow release rate and prolonged duration, our data argue that the cyclodextrin-mediated secretory pathway is distinct from the calcium-mediated pathway and reminiscent of TFEB-induced clearance of lysosomal content (Martina et al., 2014;Medina et al., 2011;Samie and Xu, 2014). This view is also reinforced by our findings that cyclodextrin-mediated secretion is insensitive to the depletion of SYT7 and rab27a, involved in calcium-mediated secretion.
Similarly to TFEB-induced secretion, we find that the secretory pathway elicited by cyclodextrin depends on the endo/lysosomal calcium channel MCOLN1, which is responsible for the LSD mucolipidosis type 4 when mutated (Boudewyn and Walkley, 2018). Previous studies showed that MCOLN1 is involved in the secretion of endo-lysosomal content, since secretion is impaired in MCOLN1 mutant cells (LaPlante et al., 2006), and stimulated by activating MCOLN1 mutations (Dong et al., 2009). It should be noted that is not known whether MCOLN1 function is related to the role of cytosolic calcium in membrane repair. We find that the secretion of endo/lysosomes also depends on the Rab7 effector Fyco1 (Pankiv et al., 2010), involved in endosome translocation to the cell periphery (Raiborg et al., 2015) and in clearance of α-synuclein aggregates (Saridaki et al., 2018). Finally, we find that cyclodextrin-induced secretion of endo/lysosomes also requires the adaptor complex AP1 and its partner protein Gadkin, which are both involved in endo/lysosomes secretion (Laulagnier et al., 2011). Future work will be necessary to unravel the role of MCOLN1 and the mechanism presumably linking this channel to Fyco1 and AP1/Gadkin.
Our data argue that the same mechanism operates in the clearance of storage cholesterol in NPC cells since depletion of MCOLN1 strongly inhibits the HPCD-induced clearance in NPC cells.
Depletion of of AP1µ1, gadkin and FYCO1 had a relatively modest, but still significant, effect in NPC cells. One may speculate that the NPC machinery itself plays a role in this secretory pathway, perhaps via ER-endosome contact sites (Raiborg et al., 2015;Rocha et al., 2009). Alternatively, residual lysosomal secretion without these factors suffices to promote cholesterol clearance, perhaps because of some other compensatory mechanisms operating in the NPC KD background.
Indeed, MCOLN1 depletion also seems to inhibit more efficiently the cyclodextrin-induced depletion of lysosomal enzymes in WT cells.
In conclusion, our data demonstrate that cyclodextrins trigger the secretion of endo/lysosomes via a pathway dependent on the calcium channel MCOLN1 as well as Fyco1 and the AP1 adaptor and its partner Gadkin. Our data also demonstrate that cyclodextrin clears the endo/lysosomal content of NPC endosomes by stimulating the same MCOLN1-dependent pathway. We conclude that endo-lysosomes in non-specialized cells can acquire secretory functions and that this pathway, elicited by cyclodextrin, is responsible for redistribution of cholesterol and decrease in storage in NPC cells. Our findings also indicate the potential benefit of agents that promote lysosome secretion as possible future strategy to treat Niemann-Pick C and possibly other LSD, given the limitations of currently available therapies.
Cell Cultures and siRNA transfections
HeLa and BHK-21 cells were maintained as described (Morel and Gruenberg, 2007)
Fluorescent automated microscopy
Transfections with siRNAs of HelaMz wt and D11 (crisprNpc2) was with Lipofectamine RNAiMax (Life Technologies AG; Basel, Switzerland) using the manufacturer's instructions in 96 well-plate from IBIDI (ref 250210) (6000 cells/well). After 36h cells were treated or not with HPDC (0,1 % w/v) for 36h and then fixed in 3% paraformaldehyde for 20 min. Cells were stained with anti-Lamp1 antibody (D2D11-XP rabbit ® mAb #9091, Cell Signaling) (1:300) and treated with RNAse (200 µg/ml) followed by propidium iodide (PI) (5µg/ml), filipin (50 µg/ml) and AlexaFluor647 anti-Rabbit secondary antibodies (1:400). Cells were imaged using the ImageXpress Micro XL Confocal automated microscope (Molecular Devices LLC; Sunnyvale, CA). Images were quantified using Meta Xpress images analysis Software. The Custom Module editor software was used to first segment the image and generate relevant masks (propidium iodide for the nucleus, propidium iodide at a lower threshold for the whole cell, LAMP1 for late endosomes/lysosomes), which were then applied on the fluorescent images to extract relevant measurements. The filipin signal was quantified in the lamp1 mask and then expressed as total integrated intensity per cell.
LAMP1 uptake and analysis
Hela cells were plated in 96 well-plates (10000 cells/well). After 24h, cells were incubated with anti-LAMP1 antibodies (D2D11) (1:300) in full medium with or without HPCD (0,1 %) for 1h, washed 3X with PBS and fixed in 3% paraformaldehyde for 20min. Cells were stained with propidium iodide (5µg/ml) and Cy2-labeled anti-Rabbit secondary antibodies (1:400). Images were acquired with the IXM™ microscope (Molecular Devices LLC), and quantified using Meta Xpress Software. Cells were segmented and the total integrated intensity of the LAMP1 signal per cell was measured.
Cholesterol esterification assay
Cholesterol esterification was measured by incorporation of [ 3 H] oleate into newly synthesized cholesteryl oleate as previously described (Chamoun et al., 2013)). Briefly, Hela cells in 6 cm dishes, were starved in 10 % LPDS containing medium for 24h and then labelled for 12h with
Phospholipid analysis by 2D-TLC
Hela cells were plated in 10 cm dishes, metabolically labelled with [ 32 P]Pi (80 µCi/point) for 24h and chased for 14h before HPCD addition. At the end of the treatment, PNSs were prepared and lipids extracted with the Folch method (Folch et al., 1957). To analyze the release of phospholipids in the medium, lipids were also extracted from the medium. Lipids were separated by 2D-TLC (Sobo et al., 2007). [ 32 P]-labelled phospholipids were visualized and quantified using a cyclone Phosphorimager. LBPA was identified by co-migration with 18:1/18:1 LBPA standard (Echelon Inc, Salt Lake City).
The cholesterol content of cells and sub-cellular fractions was quantified enzymatically using the Amplex Red kit (Molecular probes) (Amundson and Zhou, 1999). Late endosome fractions were prepared from BHK cells by flotation in sucrose gradients (Aniento et al., 1993). Cells or subcellular fractions were lysed with lysis buffer (20 mM TRIS-HCl pH 7,5, 150 mM NaCl, 1% Triton X-100) and 5 µg proteins/point (total cells) or 1 µg protein/point were used to quantify cholesterol in a 96-well plate format as described in the kit protocol.
Lipid mass spectrometry
Lipids were extracted as previously described (Scott et al., 2015) with minor modifications.
Briefly, cells were grown on 10-cm plastic plates before washing with, and then scraped into, cold PBS followed by centrifugation for 5 min at 300 g at 4°C. Cell pellets were resuspended in 100 μl cold water before addition of 360 μl methanol and lipid internal standards (list). Next, 1.2 ml of 2-methoxy-2-methylpropane (MTBE) was added and the samples followed by 1 h shaking at room temperature. A total of 200 μl of water was added to induce phase separation, and the upper phase was collected. Total phosphates were quantified with an ammonium Molybdate colorimetric assay (Loizides-Mangold et al., 2012). Dried lipid samples were re-dissolved in chloroform-methanol (1:1 v/v). Separation was performed using a HILIC Kinetex column (2.6 μm, 2.1 × 50 mm2) on a Shimadzu Prominence UFPLC xr system (Tokyo, Japan): mobile phase A was acetonitrile:methanol 10:1 (v/v) containing 10 mM ammonium formate and 0.5% formic acid; mobile phase B was deionized water containing 10 mM ammonium formate and 0.5% formic acid. The elution of the gradient began with 5%B at a 200µL/min flow. The gradient increased linearly to 50% B over 7min, then the elution continued at 50% B for 1.5 min and finally the column was re-equilibrated for 2.5 min. The sample was injected in 2µL chloroform:methanol 1:2 (v/v). Data were acquired in full scan mode at high resolution on a hybrid Orbitrap Elite (Thermo Fisher Scientific, Bremen, Germany). The system was operated at 240'000 resolution (m/z 400) with an AGC set at 1.0E6 and one microscan set at 10 ms maximum injection time. The heated electro spray source HESI II was operated in positive mode at a temperature of 90°C and a source voltage at 4.0KV. Sheath gas and auxiliary gas were set at 20 and 5 arbitrary units respectively while the transfer capillary temperature was set to 275°C. The mass spectrometry data were acquired with LTQ Tuneplus2.7SP2 and treated with Xcalibur 4.0QF2 (Thermo Fisher Scientific).
Lipid identification was carried out with Lipid Data Analyzer II (LDA v. 2.5.2, IGB-TUG Graz University) (Hartler et al., 2011). Peaks were identified by their respective retention time, m/z and intensity. Instruments were calibrated to ensure a mass accuracy lower than 3 ppm. Data visualization was improved with the LCMSexplorer web tool hosted at EPFL (https://gecftools.epfl.ch/lcmsexplorer).
Analysis by focused ion beam -scanning electron microscopy (FIB-SEM)
HeLa cells treated of not HPCD were incubated with 15nm BSA-gold for 4h at 37°C, rinsed once with PBS, fixed for 3h on ice using 2.5% glutaraldehyde/2% paraformaldehyde in buffer A (0.15M cacodylate, 2mM CaCl2). Then cells were extensively washed on ice in buffer A then incubated 1h on ice in 2% osmium tetroxide and 1.5% potassium Ferro cyanide in buffer A and finally rinsed 5 X 3min in distilled water at room temperature. Cells were then incubated 20min at room temperature in 0.1M thiocarbohydrazide, which had been passed through a 0.22 µm filter, and extensively washed with water. Samples were incubated overnight at 4°C protected from light in 1% uranyl-acetate, washed in water, further incubated in 20mM Pb aspartame for 30min at 60°C and finally washed in water after this last contrasting step. Samples were dehydrated in a graded series ethanol, embedded in hard Epon and incubated for 60h at 45°C then for 60 hours at 60°C.
A small bloc was cut using an electric saw and the bloc was incubated approximatively 30min in 100% xylene in order to remove the plastic left. Finally, the bloc was mounted on a pin, coated with gold and inserted into the chamber the HELIOS 660 Nanolab DualBeam SEM/FIB microscope (FEI Company, Eindhoven, Netherlands). ROI were prepared using focused ion beam (FIB) and ROI set to be approximatively 20µm wide. During acquisition process, the thickness of the FIB slice between each image acquisition was 10 nm. For endosomal density quantification, gold containing endosomes were identified, image intensity inverted and the mean intensity of endosome was measured and divided by the intensity of the cytoplasm for each slice. Results were analyzed using GraphPad Prism. The Gaussian distribution of the data were tested using Kolmogorov-Smirnov test (with Dallal-Wilkinson-Lillie for P value). As it was a non-Gaussian distribution, a two-tailed non-parametric Mann-Whitney U test was used in order to compare conditions. β-Hexosaminidase, LDH and Acidic lipase enzymatic assays β-Hexosaminidase and LDH enzymatic activities were measured from culture supernatant (100 µl) total cell lysate (5 µg) or light membrane fractions (2,5 µg) as described (Laulagnier et al., 2011). Acidic lipase activity was measured from light membrane fractions (5 µg) using 4-Methylumbelliferyl oleate (4-MUO) as substrate (Sheriff et al., 1995). Sample diluted in 25 µl of lysis buffer was mixed with 25 µl substrate solution (4-MUO 2mg/ml in triton X100 4%) and 100 µh of assay buffer (NaOAc 200 mM pH 5,5, tween 80 0,02 %). Reaction was incubated for 30-60 min at 37 °C and stopped by adding 100 ml of Tris 1M, pH 8,8. Fluorescence of the reaction product 4-methylumbelliferone (ex. 365 nm, em. 460 nm) was measured in a spectrofluorimeter and compared with a standard curve.
CRISPR/Cas9 NPC2 KO cell line
Guide sequences to produce NPC2 KO cells were obtained using the CRISPR design tool (Ran et al., 2013): (fwd:TAATACGACTCACTATAGGTCCTTGAACTGCACC; rev: TTCTAGCTCTAAAACAACCGGTGCAGTTCAAGGA). The sequences were used to insert the target sequence into the pX330 vector using Golden Gate Assembly (New England Biolabs) and transfected into cells. Knock-out clones were isolated by serial dilution and confirmed by RT-PCR, Western blotting and filipin staining.
In western blot analysis, primary antibodies were incubated overnight at 4°C, and secondary HRPlinked antibodies for 50min at RT. Antigens were visualized using the westernbright quantum reagent (Advansta, Menlo Park, CA) with the FUSION solo Image Station; band intensities were measured on non-saturated raw images with FUSION solo image analysis software. Quantification of cathepsin D normalized to the corresponding β-tubulin signal (shown in Fig. S4).
Data are expressed as a ratio of the HPCD-treated samples over the corresponding control for each KD condition (n: 3 independent experiments). *P<0.0001; **P<0.01; ***P<0.02. | v3-fos-license |
2020-06-20T13:06:44.466Z | 2020-06-19T00:00:00.000 | 219908714 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "https://onlinelibrary.wiley.com/doi/pdfdirect/10.1002/cbdv.202000391",
"pdf_hash": "f1fbc63d9b65681602f660f687a4f91e7b91a673",
"pdf_src": "Wiley",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119550",
"s2fieldsofstudy": [
"Medicine",
"Environmental Science",
"Biology"
],
"sha1": "439a0be9bd16ba3e565ffc183b2e1bdc8b78104f",
"year": 2020
} | pes2o/s2orc | Extracts and Steroids from the Edible Mushroom Hypholoma lateritium Exhibit Anti‐Inflammatory Properties by Inhibition of COX‐2 and Activation of Nrf2
Hypholoma lateritium is an edible macrofungus with a common distribution in Europe, North America, and the Far East. The aim of this study was to investigate the potential anti‐inflammatory effects of H. lateritium extracts and its isolated steroids: fasciculic acid B, fasciculol E, fasciculol C, lanosta‐7,9(11)‐diene‐12β,21α‐epoxy‐2α,3β,24β,25‐tetraol, fasciculol F, and demethylincisterol A2. Organic (hexane, chloroform and 50 % methanol) and water extracts of H. lateritium were subjected to in vitro assays to determine pro‐inflammatory protein levels, such as cyclooxygenase‐2 (COX‐2), cytosolic prostaglandin E2 synthase (cPGES), and antioxidant nuclear factor (erythroid‐derived 2)‐like 2 (Nrf2). Fungal extracts demonstrated significant activities on pro‐inflammatory protein levels with minor differences among the activities of the fractions of different polarities. All the compounds proved to exert notable inhibitory properties on COX‐2 and were capable to stimulate the Nrf2 pathway. Fungal extracts and the compounds exerted no cytotoxic activities on RAW 264.7 cells.
Introduction
The genus Hypholoma, which means 'mushrooms with threads', belongs to the family Strophariaceae and includes mushroom species possessing characteristic well-pigmented pileus and variably developed threadlike veil, which does not form a membranous annulus on the stipe. [1] The genus consists of about 30 species worldwide, occurring in temperate to tropical regions, growing on decomposing wood, living trees, or soil. [2] Hypholoma species are recognized as active wood and litter decomposers and play a significant role in forest ecosystems, being used not only in bioconversion of cellulose, fabric and dye industrial residues, [3,4] but also in biological control of phytopathogenic fungi. [5,6] Hypholoma fasciculare is the most widespread and investigated member of the genus, which is known for its antioxidant and antimicrobial activities, [7] producing different types of fungal metabolites, e. g., styrylpyrone-type compounds (hypholomins, fasciculins), [8] steroids (fasciculic acids, fasciculols), [9,10] and sesquiterpenoids (fascicularones). [11,12] Apart from H. fasciculare, there is H. lateritium (brick cap mushroom), a less known related species, but still with a quite common distribution in Europe, North-America and the Far East. It is a saprobic macrofungus, occurring regularly in small tufts or sometimes singly on hardwood stumps and exposed roots of dead hardwood trees. H. lateritium was reported to contain steroid compounds, e. g., fasciculols, fasciculic acids and sublateriols [13,14] as well as sesquiterpenes, e. g., naematolin, a caryophyllane derivative with antiproliferative property. [15] We have recently explored the chemistry of this species and identified a series of steroids with remarkable structural diversity including ergostane and lanostane derivatives, along with highly degraded sterols with ion channel modulating properties. [16,17] As regard the pharmacology of H. lateritium, previous investigations revealed that this species possesses considerable biological properties; however, these experiments were performed with crude extracts without identifying the major fungal metabolites responsible for the observed biological activity. Lee at al. demonstrated that the extract of this species decreases TNF-α-induced inflammation in human umbilical vein endothelial cells. The butanol fraction of H. lateritium inhibited TNF-α-induced monocyte adhesion to endothelial cells; moreover, it dose-dependently decreased the expression of inducible nitrogen oxygen synthase and cyclooxygenase-2. [18] In another article, Lee et al. investigated the inhibitory effect of H. lateritium extract on highly invasive and metastatic tumor cells. The hexane fraction of brick cap significantly inhibited the invasion and migration of MDA-MB-231 breast cancer cells in the Matrigel invasion assay and wound-healing investigations, respectively. The results obtained suggested that hexane extract of H. lateritium inhibits the metastatic potential of MDA-MB-231 cells by inhibiting the phosphorylation of JNK/ p38 and reducing AP-1 and NF-кB DNA-binding activities. [19] Despite of its wide geographical distribution and richness in various fungal metabolites with pharmacological potential, the ethnomycological profile of H. lateritium is rather unexplored. Nonetheless, this mushroom was used in Swedish folk medicine as an anti-inflammatory agent in alleviating symptoms of rheumatic disorder. [20] Therefore, we conducted a research to explore the anti-inflammatory properties of H. lateritium extracts and its characteristic constituents, fasciculic acid B (1), fasciculol E (2), fasciculol C (3), lanosta-7,9(11)-diene-12β,21α-epoxy-2α,3β,24β,25tetraol (4), fasciculol F (5), and demethylincisterol A2 (6) for the purpose of confirming the traditional use of this species.
Results and Discussion
Basidiomycota mushrooms are known to possess various beneficial pharmacological properties including anti-inflammatory activity. [21] Previous studies revealed that several extracts prepared from certain edible mushrooms have anti-inflammatory potential: Cantharellus cibarius, [22] Imleria badia, [23] and Agaricus bisporus. [24] In the current study, we examined the proor anti-inflammatory properties of H. lateritium extracts and identified specific fungal metabolites (1-6) which may contribute to the favorable biological activities of this fungal species. Accordingly, organic (hexane, chloroform and 50 % methanol) and H 2 O extracts of H. lateritium were prepared, and then, they were subjected to in vitro tests in order to determine the proinflammatory protein levels, such as COX-2, cPGES as well as Nrf2 using Western blot techniques. Regarding the cytotoxic effect, no such activities were observed in RAW 264.7 cells incubated with mushroom extracts and fungal metabolites 1-6. Cell viabilities were around 100 % after treatment. According to results, all fractions demonstrated significant biological activities in the assays performed, however, minor differences were observed among the activities of the fractions with different polarities (Figure 1).
In RAW 264.7 cells activated with LPS and incubated with mushroom extracts A -D, an increase of Nrf2 was observed. In the same way, higher levels of cPGES protein were detected in macrophages cotreated with LPS and extracts A -D, but the values obtained were significantly lower compared to those of the LPS-activated cells. The investigations revealed a decrease in COX-2-levels in RAW 264.7 cells cotreated with mushrooms extracts and LPS in comparison with the experiment of LPS-activated macrophages.
To identify the main constituents of H. lateritium responsible for the detected anti-inflammatory properties of the crude fungal extracts, we proposed to perform the pharmacological assay of characteristic compounds of H. lateritium. The fungal metabolites investigated in the current study belong to the vast class of steroids ( Figure 2).
Fasciculic acid B (1), fasciculol E (2), fasciculol C (3), and fasciculol F (5) represent a special group of compounds known as fasciculols which are specific to mushrooms of the Hypholoma genus, especially H. fasciculare and H. lateritium, lanosta-7,9(11)-diene-12β,21α-epoxy-2α,3β,24β,25-tetraol (4) is a related steroid recently identified in H. lateritium, while demethylincisterol A2 (6) is a highly degraded sterol Chem. Biodiversity 2020, 17, e2000391 reported originally from a marine sponge of Homaxinella sp. [25] Previous investigations revealed that these compounds could have important pharmacological properties, including the calmodulin antagonistic activity of fasciculic acid B (1) and the cytotoxic property of demethylincisterol A2 (6). [10,25] Our experiments ( Figure 3) revealed that 1-6 activated cPGES, but levels of this protein were lower than those in LPSactivated RAW 264.7 cells. In cells activated with LPS and incubated with 1-6, we experienced an increase of Nrf2. Compounds 1 -6 in general proved to possess similar activities, however, fasciculol C (3) represents a particular case, because when cells were treated with 3 alone the amount of cPGES was the lowest, while the level of Nrf2 was the highest among the values obtained in all experiments.
Macrophages activated with LPS and incubated with fungal metabolites were characterized by decreased COX-2 levels when compared to LPS-activated macrophages.
Nrf2, or nuclear factor (erythroid-derived 2)-like 2, is an essential transcription factor that controls the expression of antioxidant proteins that protect against oxidative damage produced by injury and inflammation. It is a key participant of cellular defense mechanism; activation of Nrf2 leads to a subsequent production of proteins and antioxidant enzymes, providing the damaged cells and tissues with a complex antioxidant defense. Plenty of studies un-equivocally demonstrate that many plant metabolites from fruits and vegetables, e. g., curcumin, [26] resveratrol [27] and sulforaphane [28] are capable of regulating Nrf2. Although many plants produce a variety of compounds with Nrf2 activity, the potential of mushroom metabolites in this view is largely unexplored. However, extracts from Agaricus bisporus mycelia enriched in α-linolenic acid presented Nrf2 modulating activity. [24] Only a few fungal compounds are known to regulate the Nrf2 pathway, including the benzoid type antrolone and the ubiquinone derivative antroquinonol identified in Antrodia sp., and several steroids from the renowned Ganoderma lucidum. [29,30] The current study demonstrates that the examined fungal steroids could have several beneficial pharmacological properties providing multiple opportunities for the potential therapeutic application of these secondary metabolites.
Conclusions
Organic and water extracts of H. lateritium and compounds 1 -6 proved to demonstrate not only considerable inhibitory properties on COX-2, but they are also capable to stimulate the Nrf2 pathway. Our results provide experimental evidence that extracts of Hypholoma lateritium and characteristic compounds of the hexane (6), chloroform (1-5) and more polar (1, 3)
Mushroom Material
Sporocarps of Hypholoma lateritium (Schaeff.) P. Kumm (Strophariaceae family) were gathered in September 2015 in the vicinity of Bakonybél, Hungary. Fungal identification was made by Attila Sándor (Hungarian Mycological Society). A voucher specimen (No. H018) has been deposited at the Department of Pharmacognosy, University of Szeged, Szeged, Hungary.
Sample Preparation
Sporocarps of H. lateritium were lyophilized and ground with a grinder, then, a 10 g sample was extracted with 3 × 100 mL methanol for 3 × 15 min using ultrasonic bath. Following filtration, the extracts were combined and concentrated in vacuum. The residue was dissolved in 50 mL of 50 % aqueous MeOH and was subjected to liquidÀ liquid partition between hexane (4 × 25 mL) (extract A) and CHCl 3 (4 × 25 mL) (extract B) and the remaining material provided extract C. After extraction with MeOH, the residual fungal material was dried and extracted with 50 mL of boiling H 2 O for 15 min. The filtered extract was lyophilized to give extract D.
Cell Proliferation XTT Assay
Cell proliferation was evaluated using a sodium 2,3bis(2-methoxy-4-nitro-5-sulfophenyl)-5-[(phenylamino)carbonyl]-2H-tetrazolium) inner salt (XTT) with N-methyldibenzopyrazine methyl sulfate) working as the intermediate electron carrier (PMS). RAW 264.7 cells were seeded in 96-well plates (2.5 × 10 3 cells/well) and incubated for 24 h. The medium was then removed and 0.5; 1; 2.5; 5; 10; 50 and 100 μg of mushroom extracts A -D as well as compounds 1-6 were added to FCS-free medium and incubated for the next 24 h. Then, XTT solution (50 μL) was added to each well and incubated for 4 h at 37°C according to the manufacturer instruction (SigmaÀ Aldrich). The absorbance was measured at 475 nm and 630 nm in a Omega plate reader (BMG LABTECH, San Diego, CA, USA). The specific absorbance of the sample was calculated as follows: Specific Absorbance = A 475nm (sample)À A 475nm (blank)À A 660nm (sample). Cell viability was expressed as the percentage of control.
Statistical Analysis
All the results are presented as means � standard deviation (SD). The statistical analysis was carried out using the one-way ANOVA; p < 0.05 was considered to be significant. | v3-fos-license |
2016-04-23T08:45:58.166Z | 2010-04-01T00:00:00.000 | 2138067 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/1420-3049/15/4/2439/pdf",
"pdf_hash": "25e7fa800c5eed81cb08fe2c861342c3d64c00bd",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119555",
"s2fieldsofstudy": [
"Chemistry",
"Materials Science",
"Medicine"
],
"sha1": "25e7fa800c5eed81cb08fe2c861342c3d64c00bd",
"year": 2010
} | pes2o/s2orc | Thermal Analysis Applied to Verapamil Hydrochloride Characterization in Pharmaceutical Formulations
Thermogravimetry (TG) and differential scanning calorimetry (DSC) are useful techniques that have been successfully applied in the pharmaceutical industry to reveal important information regarding the physicochemical properties of drug and excipient molecules such as polymorphism, stability, purity, formulation compatibility among others. Verapamil hydrochloride shows thermal stability up to 180 °C and melts at 146 °C, followed by total degradation. The drug is compatible with all the excipients evaluated. The drug showed degradation when subjected to oxidizing conditions, suggesting that the degradation product is 3,4-dimethoxybenzoic acid derived from alkyl side chain oxidation. Verapamil hydrochloride does not present the phenomenon of polymorphism under the conditions evaluated. Assessing the drug degradation kinetics, the drug had a shelf life (t90) of 56.7 years and a pharmaceutical formulation showed t90 of 6.8 years showing their high stability.
Verapamil hydrochloride (VRP, C 27 H 38 N 2 O 4 ·HCl, I), a phenylalkylamine calcium-channel blocker, has broadly been used as an anti-arrhythmic drug to manage supraventricular tachyarrhythmias. Due its vasodilating and negative inotropic properties, it has been indicated for the treatment of hypertension, ischemic heart disease, and hypertrophic cardiomyopathy. After oral administration of VRP to humans, the drug is rapidly absorbed and widely distributed. It undergoes an extensive hepatic and intestinal first-pass metabolism, resulting in a low extent of absolute oral bioavailability in humans [13,14]. Verapamil hydrochloride has also been described as an inhibitor of P-glycoprotein able to improve the chemotherapy response by reducing the resistance of cancer cells against antineoplasic agents [15].
Compound I is a crystalline powder that melts (with decomposition) between 138.5 and 140.5 °C and pKa 8.6. It shows UV absorption maxima at 232 and 278 nm in water. It is freely soluble in ethanol and methanol( >100 mg/mL); soluble in water (83 mg/mL); and practically insoluble in hexane (0.001 mg/mL). Verapamil hydrochloride has a partition coefficient, Log P (octanol/water) of 3.8 [16,17]. The drug degrades in methanol solution under UV light 254 nm, with 52% loss of activity after 2 h of exposure [18]. Verapamil hydrochloride is a low solubility and high permeability drug, class II, according to the biopharmaceutics classification system (BCS) [17,19] whereby the dissolution process is a ratelimiting step for the absorption and IVIVC (in vivo-in vitro correlation) can be expected [20]. Hence, it is important to evaluate drug features, such as the presence of polymorphism, stability and compatibility of the pharmaceutical formulation, as long as any change can directly influence its bioavailability.
Therefore, the aim of this study was to evaluate the thermal characterization of verapamil hydrochloride using a variety of techniques including TG, DSC, Fourier transform infrared spectroscopy (FTIR), liquid chromatography, and X-ray diffraction (XRD). The search of polymorphism and degradation products, together with formulation compatibility studies and thermal degradation kinetics, were carried out to help understanding the solid-state characterization, consequently, evaluate the quality control and stability for this important active pharmaceutical ingredient.
Results and Discussion
In the TG and DSC drug characterization, verapamil hydrochloride ( Figure 1 bottom; Figure 6, respectively) showed thermal stability up to 180 °C, melting at 146 °C with an endothermic characteristic and fusion heat of ΔH = 121.9 J/g. After fusion, the DSC curve indicated the initiation of an exothermic process with positive slope, resulting in a complete degradation of the drug in two steps. The infrared spectrum showed no change compared to the reference spectrum, with main peaks at 1510, 1253, 1026, 1232, 1145 and 1587 cm -1 [17,21].
In compatibility studies, thermal analysis techniques allow the prior choice of more stable pharmaceutical formulations at a very short time, by means of evaluation of interactions that may exist, first, in their binary mixtures, and later in multicomponent mixtures. The quality of the provided information along with the speed of analysis is desirable for the pharmaceutical industry, but do not replace the conventional stability studies implied by law [22]. The DSC curves applied to compatibility studies may show changes in the fusion range, shape or area of the peaks and appearance and disappearance of thermal events after mixing two components, indicating interactions or chemical reactions, which must be confirmed by other analytical techniques.
By assessing the formulation compatibility using binary mixtures ( Figure 1), changes can be seen in the fusion enthalpy value of verapamil hydrochloride in the heat enthalpy ΔH (J/g). However, the fusion range of the drug in the binary mixtures remained the same. The most significant thermal event occurred at the same temperature range, with small changes related to the binary mixture, not characterizing interactions [23,24]. The liquid ingredients of pharmaceutical formulations, which are acetone, ethanol and isopropanol, were compatible with verapamil hydrochloride. In the multicomponent mixtures assessments (Figure 2), the overlap of DSC curves of drug and formulations A and B shows the drug fusion, demonstrating the compatibility of these formulations. Nunes and collaborators reported on the verapamil hydrochloride compatibility with common excipients used in tablet formulation by means of studies on binary mixtures (drug-excipients) and degradation kinetics using the non-isothermal method of Ozawa [25].
Temperature / °C
A HPLC/UV-DAD method was validated for verapamil hydrochloride in the presence of degradation products. A retention factor (k') of 1.72, peak symmetry (As) of 1.05, theoretical plates/column (N) of 2556, repeatability and intermediate precision (RSD less than 1%), intra-day and inter-days accuracy with percentage recovery of 99.78% and 101.62% respectively, were satisfactorily obtained. Linear correlation coefficient (r) was greater than 0.99 in the range of 1 to 60 g/mL. Detection limit of 0.18 g/mL and quantification limit of 0.55 g/mL. Selectivity studies, performed after drug stress conditions, and robustness were appropriate.
The chromatograms of verapamil hydrochloride obtained before and after exposure to each stress conditions can be seen in Figure 3. Data show that degradation was mostly due to oxidation, and the peak t R (retention time) 0.916 min refers to the hydrogen peroxide peak. The spectra of the degradation product peak after oxidation was compared with verapamil hydrochloride spectra (Figure 4), using HPLC with UV/DAD detector. The degradation product at t R 1.57 min presented a similarity index (SI) of 0.9982, what indicates a very similar chromophore structure. When the retention time of the analyte peak is located as close as possible to the retention time of the reference peak and both of them have spectra with SI greater than 0.99, the peaks refer to similar compounds [17].
The aromatic compounds oxidation occurs due to oxidation of the side chains of alkyl groups. Given the similarity of the UV spectra of verapamil hydrochloride with the degradation product at t R 1.5 min, suggests that the degradation product is 3,4-dimethoxybenzoic acid (C 9 H 10 O 4 ). This compound has a more polar molecular structure compared to verapamil hydrochloride, what explains its lower retention in reverse phase column, which possess non-polar characteristics. Intensity / a.u.
Verapamil hydrochloride Degradation product after oxidation (t R 1.57 min) The attempt at identification of verapamil hydrochloride polymorphism began with the search by DSC analysis at different temperature rates. Heating rates of 2 and 20 °C/min under nitrogen atmosphere, from room temperature up to 180 °C showed no crystalline transition events and no double melting peaks, which rules out the presence of polymorphs in verapamil hydrochloride.
Recrystallization was performed under different conditions, such as different solvents, temperatures and solution saturations. There was no detection of formation of different crystalline forms after evaluation of the crystals by XRD and DSC. By optical microscopy, the crystals are prismatic after observation.
In XRD analysis, no difference of crystallinity between the crystals of the drug before (pattern) and after recrystallization in acetone or isopropanol (Figure 5a) was observed on the angle and intensity. This suggests the same crystal unit cell and crystal habit. In DSC curves (Figure 5b), there is a widening of fusion peak of the crystals obtained after recrystallization indicating that impurities may be present in the process. The verapamil hydrochloride pattern showed a more symmetrical and fine endotherm. Using the Van't Hoff equation, a peak purity of 99.15% for verapamil hydrochloride pattern was obtained, 96.19% and 94.18% of purity for crystals from acetone and from isopropanol respectively. However, different crystalline transition events and double melting peaks, what can be indicative of polymorphism, were not observed. The results suggest the formation of crystals with low purity, due to enlargement of the peak and lowering of T onset . The isothermal degradation kinetics was performed to assess the stability of the drug and pharmaceutical formulation as well as to predict the shelf life at 25 °C. Figure 6 shows the dynamic TG curves of the drug and pharmaceutical formulation in which can be seen the start of degradation in the same temperature range.
Isothermal TG curves were performed at the initial stage of degradation at temperatures of 190 to 240 °C, and curve fits in the zero order model for the drug, and second order model for the pharmaceutical formulation were obtained. Table 1 shows the values of correlation coefficient (r) and the rate constants (k) for the adjustments. The kinetic data for the drug and pharmaceutical formulation were carried out according to zero order model, which in verapamil hydrochloride presented a better fit. The activation energy (Ea), the rate constants, and the shelf life at 25 °C were calculated by isothermal degradation kinetics. Figure 7 shows the graph on Arrhenius equation, 1/T vs. log k. The slope of the line is defined by Ea/(2.303 × R), where the activation energy can be calculated by multiplying slope value by gas constant R (8,314 J·mol -1 ·K -1 ) and by 2.303. The linear regression calculated for the kinetic data of the drug led to Equation (1), with correlation coefficient of 0.9956 (r). The activation energy calculated for the verapamil hydrochloride was 89.4 kJ·mol -1 : For the pharmaceutical formulation, the linear regression calculated using kinetic data show Equation (2), with correlation coefficient of 0.9992 (r). The activation energy calculated for the formulation was 75.4 kJ·mol -1 : log k = -3938.0 × 1/T 5.3648 (2) It was possible to calculate the rate constant of reaction (k) at 25 °C by extrapolation (highlighted, Figure 7) for the drug and for pharmaceutical formulation, as follows: Given k 25 °C value, the shef life, t 90 , was calculated according to Equation (3) at 25 °C, whereas the degradation follows the zero order model. The concentration of verapamil hydrochloride in the tablet formulation was considered 30% as Co (initial concentration), since the average weight of the tablets were around 270 mg. A value of 56.7 years of shelf life was obtained for the drug, and 6.8 years for the pharmaceutical formulation. A great value for formulation expiration date is justified by the absence of incompatibility with the excipients evaluated. The Ea (activation energy) was 89.4 kJ·mol -1 and 74.4 kJ·mol -1 for drug and for pharmaceutical formulation, respectively demonstrating their stability. It can be observed in Table 7 that the degradation rate (k) is always higher in the pharmaceutical formulation when compared to the drug, at each temperature isotherm.
General
Verapamil hydrochloride characterization was performed using TG, DSC and IR. TG curves (TGA50H Shimadzu thermobalance). Conditions used were heating rate 10 °C/min, from room temperature up to 750 °C, nitrogen flow rate 50 mL/min, with a mass of 5.0 mg in an alumina crucible. DSC curves (DSC50 Shimadzu calorimeter) were obtained under nitrogen flow rate 50 mL/min, heating rate 10 °C/min from room temperature up to 400 °C. The aluminum crucible was partially closed with about 0.5 mg of sample. The assessment of purity by DSC was made by Van't Hoff equation using the Shimadzu Purity Determination Program Software, version 2.20. The DSC and TG temperature axes were calibrated with indium (99.99%; melting point, 156.60 °C) and by the Curie point of Ni (353 °C), respectively, heated at the same rates used for the samples.
IR experiments were carried out using a Perkin Elmer Spectrum One spectrometer by means of dispersion KBr disks.
All ingredients listed for the tablets development were individually evaluated by DSC. In addition, a 1:1 ratio binary mixtures of drug to each excipient of the commercial pharmaceutical formulations, and placebo formulation (C) were tested in order to evaluate verapamil hydrochloride thermal behavior, as well as, pharmaceutical formulations compatibility. For the search for drug-excipient interactions in the binary mixtures 5 mg of drug were used with the same amount of excipient, in order to maximize the probability of observing an interaction. Then, multicomponent mixtures, as it occurs in dosage forms were evaluated [27][28][29].
Drug recrystallization under different conditions was assessed using dichloromethane, methanol, ethanol, water, acetone or hexane; room (30 °C) or cooled (-10 °C) temperatures; saturated or diluted solutions. Analysis was performed by DSC, thermo-optical analysis (TOA) (FP90 and FP82OA Mettler Toledo), optical microscopy coupled with camera (Siedentopf), and X-ray powder diffraction (XRD). For the XRD experiments, a Geigerflex Rigaku diffractometer with cobalt tube (CoK), operating voltage at 32.5 kV and 25.0 mA current was employed.
The stability evaluation of the drug and pharmaceutical formulation was performed by thermal analysis in order to determine shelf life at 25 °C by isotermic degradation kinetics. Dynamic TG curves and definition of the initial stage of degradation for drug and for pharmaceutical formulation were acquired. After, isotherms TG curves were carried in onset degradation temperatures for both, drug and pharmaceutical formulation, in order to assess the best fit of mathematical models for the isotherms at zero order (time versus % mass), first order (time versus log % mass) or second order (time versus 1/% mass). The mathematical model that provides the best linear correlation coefficient (r closer to 1.0000) represents the standard isothermal degradation. After establishing the reaction order, the reaction rate (k) at 25 °C was calculated by extrapolation using the Arrhenius equation. Using k 25 °C value, the shelf life, t 90 , were calculated for the drug and for pharmaceutical formulation. t 90 represents the time interval required for the drug concentration reach 90% of the initial concentration value and it is accepted as the shelf life determination [10,23,32,33].
Conclusions
Verapamil hydrochloride showed thermal stability up to 180 °C and a melting point at 150 °C, followed by total degradation. The drug was compatible with all excipients evaluated. Verapamil hydrochloride showed degradation when subjected to oxidizing conditions, suggesting that the degradation product is the 3,4-dimethoxybenzoic acid, derived from the alkyl side chain oxidation. Verapamil hydrochloride did not present the phenomenon of polymorphism in the conditions evaluated. Assessing the degradation kinetic of the drug, the molecule showed a t 90 of 56.7 years, and did not present problems of incompatibility. Pharmaceutical formulation presented a shelf-life, t 90, of 6.8 years. | v3-fos-license |
2018-04-03T00:00:40.074Z | 1999-01-01T00:00:00.000 | 8313317 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "http://www.jbc.org/content/274/1/408.full.pdf",
"pdf_hash": "36fec565b58518d08cd3e18c60956c673add4970",
"pdf_src": "Highwire",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119658",
"s2fieldsofstudy": [
"Biology",
"Medicine"
],
"sha1": "f5130a41ab76b3fff2a47bd63a54498d0a0f8382",
"year": 1999
} | pes2o/s2orc | Phosphorylation of Myristoylated Alanine-rich Protein Kinase C Substrate by Mitogen-activated Protein Kinase in Cultured Rat Hippocampal Neurons following Stimulation of Glutamate Receptors*
Glutamate-induced phosphorylation of myristoylated alanine-rich protein kinase C substrate (MARCKS) was investigated in cultured rat hippocampal neurons. In32P-labeled hippocampal neurons, exposure to 10 μm glutamate induced a long lasting increase in phosphorylation of MARCKS. The long lasting increase in MARCKS phosphorylation mainly required activation of theN-methyl-d-aspartate receptor. Unexpectatively, the MARCKS phosphorylation after the 10-min incubation with glutamate was not inhibited by treatment with calphostin C, a potent inhibitor for protein kinase C (PKC), or down-regulation of PKC but was largely prevented by PD098059, a selective inhibitor for mitogen-activated protein (MAP) kinase kinase. In contrast, the phosphorylation following the short exposure to glutamate was prevented by a combination of PD098059 and calphostin C. The phosphopeptide mapping and immunoblotting analyses confirmed that PKC-dependent phosphorylation of MARCKS was transient and the MAP kinase-dependent phosphorylation was relatively persistent. Investigations of the functional properties also showed that the MARCKS phosphorylation by MAP kinase regulates its calmodulin-binding ability and its interaction with F-actin as seen in the PKC-dependent phosphorylation. These results suggest that glutamate causes a long lasting increase in MARCKS phosphorylation through activation of the N-methyl-d-aspartate receptor and subsequent activation of MAP kinase in the hippocampal neurons.
The myristoylated alanine-rich protein kinase C substrate (MARCKS) 1 with an apparent molecular mass of 80 -87 kDa is a prototype of family members of prominent cellular substrates for protein kinase C (PKC). Comparison of known MARCKS sequences revealed three highly conserved regions: the N terminus, which contains a myristoylation consensus sequence, the MH2 domain, and a basic effector domain, which contains the PKC phosphorylation sites and calmodulin-and actin-binding sites (1)(2)(3). Within the basic internal domain of 25 residues, three or four serine residues are phosphorylated by PKC (4,5). The potential to bind calcium/calmodulin and cross-links filamentous (F)-actin is regulated by PKC-dependent phosphorylation (4,6). In addition, the PKC-dependent phosphorylation introduces negative charges into the basic cluster, reducing its electrostatic interaction with acidic lipids and results in translocation of MARCKS from membrane to cytoplasm (7)(8)(9)(10). Genomic analysis with Southern blots and polymerase chain reactions revealed the presence of only the 87-kDa MARCKS gene in bovine and human genomes and only the 80-kDa MARCKS gene in the mouse and rat genomes. These are equivalent genes in the different species, and there is about 70% amino acid similarity between the 87-kDa and 80-kDa MARCKS (11). MacMARCKS, with a molecular mass of 48 -60 kDa, is another member of the MARCKS family, which has been cloned from mouse macrophage (12) and mouse brain (13). MacMARCKS also has a myristoylated N terminus, a highly conserved MH2 domain, and a basic effector domain that contains PKC phosphorylation sites.
Protein and mRNA of MARCKS are widely distributed and are most abundant in brain, spinal cord, spleen, and lung (14). In the brain, MARCKS is widespread throughout the brain and is enriched in certain regions, including the piriform and entorhinal cortices, portions of the amygdaloid complex, the intralaminar thalamic nuclei, the hypothalamus, the nucleus of the solitary tract, nucleus ambiguus, and many catecholaminergic and serotonergic nuclei (15). In situ hybridization also revealed a high expression of mRNA in the hippocampal CA1 and dentate gyrus (16). Electron microscopic analysis revealed immunoreactivity in axons, axon terminals, small dendritic branches, and occasionally in dendritic spines. No immunoreactive product was observed in large dendrites, somata, or nuclei (15). Furthermore, disruption of the MARCKS gene in mice leads to abnormal brain development and perinatal death, with defects in neurulation, fusion of the cerebral hemispheres, formation of the great forebrain commissures, and retinal and cortical lamination (17). The observation suggests that expression of MARCKS during embryonic and fetal life in the mouse is necessary for normal brain development of the central nervous system.
The properties of MARCKS, including cross-linking F-actin and binding to plasma membrane, suggest that MARCKS reg-ulates actin-membrane interaction and in turn maintains cell shape and motility. Consistent with this hypothesis, MARCKS is phosphorylated during chemotaxis, secretion, and phagocytosis in neutrophils and macrophages (18,19), during neurosecretion (20,21), and during mitogenesis (22,23). PKC-dependent phosphorylation is possibly involved in functional roles of MARCKS. However, accumulating evidence has suggested that MARCKS is also an in vivo and in vitro substrate of prolinedirected protein kinases, such as mitogen-activated protein (MAP) kinase and cycline-dependent protein kinase (cdk) 5. A mass spectroscopic analysis of intact MARCKS purified from bovine brain revealed at least 6 phosphorylation sites in the Ser-Pro motif in the N-terminal domain and upstream of the phosphorylation sites for PKC (24). Furthermore, the prolinedirected protein kinases, such as MAP kinase (25) and cdc2 kinase or cdk5 (26), can phosphorylate recombinant mouse MARCKS and purified rat MARCKS, respectively.
MAP kinase, especially ERK 2, was found to be widely expressed in whole rat brain and enriched in the hippocampal formation. In addition, neurotransmitters and neurotrophic factors have been seen to activate MAP kinase in neurons (27,28). For example, activation of glutamate receptors, especially the NMDA receptor, causes a large increase in MAP kinase in the hippocampal neurons (29,30), and stimulation of AMPA/ kainate receptors elevated MAP kinase activity in cultured cortical neurons (31). Similarly, basic fibroblast growth factor, epidermal growth factor, and brain-derived neurotrophic factor stimulate MAP kinase activity to the same extent as seen with glutamate (30,(32)(33)(34). Taken together, MAP kinase is a possible candidate for phosphorylation of MARCKS in vivo in the central nervous system. We now report that a long lasting increase in MARCKS phosphorylation in rat hippocampal neurons following stimulation of the glutamate receptor was mainly though the NMDA receptor activation and is due to activation of MAP kinase rather than PKC. Furthermore, a transient increase in the PKC-dependent phosphorylation of MARCKS was observed following stimulation of the glutamate receptors.
Preparation of MARCKS Antibodies-MARCKS was purified from rat brains according to the method by Patel and Kligman (37), except that a DEAE-cellulose column was used instead of a Mono Q column. MARCKS purified by this procedure was subjected to SDS-PAGE, and the MARCKS protein band was excised from the gel. The gels were emulsified in complete Freund's adjuvant and used to raise antisera in rabbits. The IgG fraction from the antisera was prepared and used in the present study. To prepare a phospho-specific antibody against PKC phosphorylation sites in MARCKS, the phosphopeptide KRFS(P)FKK-S(P)FKLSG, which contains two PKC phosphorylation sites, Ser-152 and Ser-156, was synthesized and used to raise antisera in rabbits. The phospho-specific antibody was affinity-purified from the serum by se-quential chromatography on the nonphosphorylated peptide-conjugated and the phosphopeptide-conjugated columns. Further characterization of the phospho-specific antibody will be described elsewhere by Yamamoto et al. 2 (manuscript in preparation). The specificity of both antibodies is shown in Figs. 1 and 7.
Cell Culture-Neonatal rat hippocampal cell cultures were prepared as described (38). Briefly, hippocampi were removed from Wistar rats on postnatal day 1 and placed in growth medium consisting of Eagle's minimum essential medium (Life Technologies, Inc.) containing 10% fetal calf serum, 10% horse serum, 2% Nu serum, 12 ng/ml nerve growth factor, and 30 mg/liter kanamycin. Cells were mechanically dissociated by trituration with fire-polished Pasteur pipettes and seeded at a density of 3.5 ϫ 10 5 cells/35-mm dish pretreated with calf skin collagen (Sigma type III). One day after plating the neurons, cultures were treated with 5 M cytosine--arabinofuranoside to prevent the replication of nonneuronal cells. The culture medium was replaced by growth medium lacking 10% fetal calf serum at 2 and 6 days of culture. The cells were maintained in humidified 95% air and 5% CO 2 at 37°C for 8 -10 days before use.
Immunofluorescence Analysis-Immunofluorescence analysis of cultured hippocampal cells was carried out as described (38). In short, cells in a 35-mm dish were fixed for 10 min at -20°C with cold methanol. After air drying the dishes, cells were washed in phosphate-buffered saline (PBS) and permeabilized in 0.05% Triton X-100 in PBS for 10 min. Nonspecific antibody binding was blocked by preincubation in 5% goat serum in PBS (blocking solution) for 20 min. Anti-MARCKS polyclonal (1 mg of IgG/ml) and anti-MAP2 monoclonal (Amersham Pharmacia Biotech) antibodies were diluted 1:100 and 1:50, respectively, in the blocking solution. Cells were incubated with the primary antibodies overnight at 4°C. The cells were then washed in PBS and incubated in fluorescein-conjugated goat anti-rabbit IgG (Cappel) and rhodamineconjugated goat anti-mouse IgG (Tago, Inc.). Negative controls were immunostained with the MARCKS antibody preabsorbed with an excess of purified MARCKS. Following treatment with secondary antibodies, the cultures were washed with PBS and covered with a 22-mm coverslip.
Labeling of Cells-Eight-to 10-day cultured hippocampal cells were washed once with phosphate-free and serum-free minimum essential medium and labeled in 1.0 ml of this medium containing carrier-free [ 32 P]orthophosphate (0.25 mCi/ml), as described (39). After labeling for 5 h, the cells were incubated with Krebs-Ringer HEPES (KRH) solution, which contained 128 mM NaCl, 5 mM KCl, 1 mM NaHPO 4 , 2.7 mM CaCl 2 , 1.2 mM MgSO 4 , 10 mM glucose, and 20 mM HEPES (pH 7.4). After incubation for 30 min in KRH, cells were incubated at 37°C for the specified time with KRH Ϯ MgCl 2 without (controls) or with the specified test agent. After incubation for the indicated time, the medium was quickly aspirated, and the cells were frozen in liquid N 2 .
Immunoprecipitation and Quantitation of 32 P-MARCKS and 32 P-CaM kinase II-Cells were harvested and homogenized in 0.4 ml of the solubilization solution containing 50 mM Tris-HCl (pH 7.5), 0.5 M NaCl, 0.5% Triton X-100, 10 mM EDTA, 1 mM Na 3 VO 4 , 30 mM sodium pyrophosphate, 50 mM NaF, 100 nM calyculin A, 0.1% SDS, 0.1 mM leupeptin, 75 M pepstatin A, and 0.1 mg/ml aprotinin. Sonication and centrifugation were performed as described (38). Aliquots (20 l) of the supernatant were used to determine protein content and 32 P incorporation into total proteins by trichloroacetic acid precipitation. To determine the 32 P incorporation, Whatman 3MM filter papers on which the aliquots (20 l) were spotted were washed with trichloroacetic acid, acetone, and ethanol. After drying, the radioactivity was measured by a liquid scintillation counter. The radioactivities of the 32 P incorporation into the total proteins were not different between the control and the stimulated cells (data not shown). The supernatant fraction containing the same amount of radioactivity was incubated at 4°C for 4 h with antibodies to MARCKS (10 g of IgG protein) and/or CaM kinase II (10 g of IgG protein) and 75 l of protein A-Sepharose CL-4B suspension (50% v/v). The immunocomplex immobilized on protein A was washed three times with solubilization solution. After immunoprecipitation of 32 P-MARCKS and 32 P-CaM kinase II, the immunoprecipitates were eluted from protein A-Sepharose CL-4B by treatment with the SDS sample buffer (40) and boiled for 4 min. Supernatants were subjected to SDS-PAGE (40), followed by autoradiography. A Bio-Imaging Analyzer (BA100, Fuji Film) was used to quantify the amount of 32 P incorporation into MARCKS and CaM kinase II subunits.
Analysis of Phosphopeptide Mapping by HPLC-The phosphorylation sites of MARCKS were determined as described (24) using limited proteolysis of 32 P-labeled MARCKS in gel pieces with 1 or 2 g of lysyl endopeptidase (P. aeruginosa). In control experiments, purified rat brain MARCKS was phosphorylated by MAP kinase or PKC in appropriate conditions for each kinase. MARCKS (2 g) was incubated for 30 min with 20 nM MAP kinase in the presence of 50 mM HEPES buffer, pH 7.5, 10 mM MgCl 2 , 1 mM EGTA, 0.1 mM [␥-32 P]ATP, and 1 mM dithiothreitol or with 20 nM PKC in the presence of 50 mM HEPES buffer, pH 7.5, 10 mM MgCl 2 , 1 mM CaCl 2 , 0.1 mM [␥-32 P]ATP, 1 mM dithiothreitol, 50 g/ml phosphatidylserine, and 5 g/ml 1,3-diolein. An additional control was prepared by phosphorylation of MARCKS with both MAP kinase and PKC under the conditions used in PKC-dependent phosphorylation. The in vitro phosphorylated MARCKS and in situ phosphorylated MARCKS immunoprecipitated with the antibody were separated by SDS-PAGE and cut from the gel. After incubation in gel pieces for 10 h at 35°C with lysyl endopeptidase, the reaction was terminated by addition of 0.1% of trifluoroacetic acid, at a final concentration. After the gel pieces were removed by centrifugation, the supernatant was applied to a C18 column (4 ϫ 150 mm) in an HPLC apparatus (Hitachi L-6000). The MARCKS peptides were eluted with a linear gradient of H 2 O-acetonitrile in the presence of 0.1% trifluoroacetic acid at a flow rate 1 ml/min. The eluate was collected by a fraction collector, and the radioactivity of each fraction was counted by liquid scintillation spectrometry.
Cross-linking of 125 I-CaM to MARCKS-Purified MARCKS was cross-linked to 125 I-CaM (65 Ci/g) by the method of Graff et al. (4) as described (26). MARCKS (1.5 g) was incubated for 30 min at 30°C without or with PKC or MAP kinase in the presence of 0.5 mM ATP. The MARCKS protein (1.5 g) were incubated for 1 h at 25°C with 125 I-CaM (0.2 Ci/3 ng) in 38 mM HEPES (pH 7.5) and 2.5 mM CaCl 2 in a final volume of 50 l. After addition of disuccinimidyl suberate in a final concentration of 0.25 mM, the sample was further incubated for 20 min at 25°C. The reaction was terminated by addition of Tris-HCl (pH 7.5) to a final concentration of 5 mM. The sample was treated with the SDS-sample buffer and boiled for 2 min. The sample was subjected to SDS-PAGE, followed by autoradiography. The cross-linking of 125 I-CaM to MARCKS was totally abolished by inclusion of an excess amount of nonlabeled CaM in the medium (data not shown).
Interaction of MARCKS with F-actin-The interaction of MARCKS with F-actin was determined by a co-sedimentation assay as described (42). After preparation of F-actin by polymerization of G-actin, the MARCKS protein (1.5 g) was incubated for 30 min with F-actin (10 g) in 60 l of Buffer C (0.1 M KCl, 1 mM MgCl 2 , 0.1 mM EGTA, 0.2 mM ATP in 10 mM Tris-HCl, pH 7.8). When indicated, the MARCKS protein was phosphorylated by PKC or MAP kinase in appropriate conditions for each kinase before the co-sedimentation assay. The samples were then centrifuged for 15 min at 100,000 ϫ g. The pellet containing F-actin and co-sedimented MARCKS was resuspended with SDS-sample buffer and subjected to SDS-PAGE. After electrophoresis, gels were stained with Coomassie Brilliant Blue or subjected to immunoblotting analysis using anti-MARCKS antibody to determine amount of MARCKS bound to F-actin.
Other Methods-Protein was determined by the method of Bradford (43) using bovine serum albumin as standard.
Statistical Evaluation-Values are means Ϯ S.E. Comparison between two experimental groups were made by the unpaired Student's t test. For multiple comparisons, one-way analysis of variance with Sheffe's correction was used, and p values of Ͻ 0.05 were considered to have statistical significance.
Specificity of Anti-MARCKS Antibody and Immunofluorescent Localization of MARCKS in Cultured Neurons-By
Western blot analysis, the anti-MARCKS antibody recognized MARCKS with the molecular mass of 80 kDa in the purified rat MARCKS and in the hippocampal homogenate from the rat brain ( Fig. 1). In addition, the 48-kDa protein was immunoreactive in the homogenate. Preabsorption of the antibody with an excess of the purified MARCKS abolished the immunoreactivity against both the 80-kDa protein and the 48-kDa protein.
The 48-kDa protein may be a degraded product, as reported (44). Although MacMARCKS, a MARCKS-related protein with a molecular mass with 48 -52 kDa, was seen to be present in the rat brain (45) and was even cloned from mouse brain (13), the 48-kDa protein does not seem to be MacMARCKS, because the antibody did not recognize the MacMARCKS protein in rat peritoneal macrophages (data not shown).
Using 32 P-labeled hippocampal neurons, the antibody could specifically immunoprecipitate the phosphorylated 80-kDa MARCKS from cell extracts of cultured hippocampal neurons incubated in the presence or absence of glutamate (Fig. 1). Although MacMARCKS was reported to be phosphorylated by stimulation by depolarization of rat brain synaptosomes (45), there was no apparent phosphorylation of the 48-kDa protein as determined by immunoblot analysis (Fig. 1C). The finding also suggested that the antibody was not cross-reactive with MacMARCKS. After 10 days in culture, hippocampal neurons were investigated immunohistochemically for expression of MARCKS. The cultured neurons displayed strong immunofluorescence with anti-MARCKS antibody in somata and neurites of stellate and pyramidal-like neurons that were strongly stained with anti-MAP2 antibody (Fig. 2, B and C). The weak staining in somata was observed in the surrounding astrocytes (Fig. 2B). In the neurites, the immunostaining showed in punctate structures along thin neurites. This may represent localization of MARCKS in synaptic varicosities or nerve terminals on the dendrites. Thus, MARCKS was primarily expressed in neuronal cells of these cultures.
Increased Phosphorylation of MARCKS by Stimulation of Glutamate Receptors-In initial experiments, we examined effects of glutamate and glutamate receptor agonists on in situ MARCKS phosphorylation in cultured hippocampal neurons. Treatment with 10 M glutamate led to a large increase up to 170% in the MARCKS phosphorylation within 3 min (Fig. 3). This increase in phosphorylation gradually decreased but was still significantly elevated for at least 30 min with the continued presence of glutamate in the medium. Similarly, treatment with 50 M NMDA caused the long lasting increase in the phosphorylation but to a smaller extent than that seen with glutamate. In contrast, treatment with 50 M AMPA or 500 M ACPD caused a small and transient increase in MARCKS phosphorylation. In particular, in the case of ACPD, a signifi- cant increase was observed only at the 3-min incubation. In separate experiments with cultured cortical astrocytes, the concentration of glutamate required to potentiate MARCKS phosphorylation was much higher, and 50 Ϯ 10% increase in the phosphorylation was observed with 500 M glutamate. Ten M glutamate had no effect on phosphorylation in the cultured astrocytes (data not shown). Therefore, the effect of glutamate observed in the present study was considered to occur in the neurons. Exposure of cultured neurons to over 100 M glutamate or 100 M NMDA seemed to be toxic in the cultured hippocampal neurons, as we reported earlier (46), and the maximum effect on the MARCKS phosphorylation was obtained with 10 M glutamate in these cultures. In addition, the 10-min exposure to glutamate did not cause a significant neuronal toxicity, such as cell death within the next 24 h (data no shown). We therefore examined MARCKS phosphorylation using 10 M glutamate to clarify its physiological roles in the cultured hippocampal neurons. However, because the persistent phosphorylation of MARCKS was observed in the continued presence of glutamate or NMDA in the medium, it may also be involved in pathological events such as the glutamate-induced neuronal cell death.
To evaluate the glutamate receptor types associated with MARCKS phosphorylation, several glutamate receptor antagonists were tested. When hippocampal neurons cultured for 8 -10 days were used, the basal MARCKS phosphorylation did not change by treatments with AP-3, CNQX, or MK801 alone, or a combination of CNQX and MK801. However, the basal MARCKS phosphorylation was inhibited by 20% by treatment with MK801 but not with CNQX or AP3 in neurons cultured for 14 -21 days, due to the inhibition of MARCKS phosphorylation stimulated by spontaneous synaptic activity observed in mature neurons in culture. The increase in MARCKS phosphorylation following a 10-min incubation with glutamate was weakly but significantly inhibited by CNQX, a non-NMDA receptor antagonist, and strongly by MK801, a specific inhibitor of the NMDA receptor, whereas AP3, a metabotropic receptor inhibitor, had little inhibitory effect (Fig. 4B). The combination of CNQX and MK801 abolished the glutamate-induced MARCKS phosphorylation as well as the increased autophosphorylation of CaM kinase II (Fig. 4, A and B). This finding is consistent with the observation that treatments with NMDA or AMPA significantly potentiated MARCKS phosphorylation at the 10-min incubation, as shown in Fig. 3. These observations suggest that the long lasting increase in MARCKS phosphorylation by exposure to glutamate was mainly through the NMDA receptor and more weakly through the kainate or AMPA type receptor. The metabotropic glutamate receptor did not contribute to the persistent MARCKS phosphorylation in hippocampal neurons. inhibitor for PKC, or after down-regulation of PKC by pretreatment with PMA for 16 h. Unexpectatively, treatment with calphostin C did not abolish the glutamate-induced phosphorylation after 10-min stimulation (Fig. 5, A and B). Similarly, the down-regulation of PKC did not inhibit the glutamateinduced phosphorylation. Calphostin C and down-regulation of PKC were working to inhibit PKC in these conditions, because the PMA-induced MARCKS phosphorylation was largely prevented by treatment with 200 nM calphostin C as well as by the down-regulation of PKC (Fig. 5B). Interestingly, treatment with 50 M PD098059, a specific inhibitor for MAP kinase kinase inhibitor (47, 48) largely inhibited glutamate-induced MARCKS phosphorylation (Fig. 5, A and B). When the MAP kinase activity was measured by in-gel kinase assay using SDS-polyacrylamide gel containing myelin basic protein, as reported (30), the MAP kinase activity increased to 336 Ϯ 10% by 10-min stimulation with glutamate. Inclusion of 50 M PD098059 totally inhibited glutamate-induced MAP kinase activation to near control levels (108 Ϯ 6% as compared with the control). In contrast, the increased phosphorylation by 2-min stimulation with glutamate was partly abolished by PD098059 and calphostin C and totally abolished by a combination of PD098059 and calphostin C (Fig. 5C). The down-regulation of PKC also significantly inhibited the MARCKS phosphorylation. Thus, the glutamate-induced MARCKS phosphorylation for a longer period was mainly due to activation of MAP kinase in the cultured hippocampal neurons.
Phosphopeptide Mapping Analysis of Phosphorylated MARCKS-To further confirm the involvement of MAP kinase in the glutamate-induced MARCKS phosphorylation by 10-min incubation, phosphopeptide mapping analysis was carried out after limited proteolysis with lysyl endopeptidase, according to the method of Taniguchi et al. (24). To clarify the in situ phosphorylation sites of MARCKS, the purified rat brain MARCKS was in vitro phosphorylated by purified PKC and MAP kinase in initial experiments and was separated by SDS-PAGE. After cutting out gel bands corresponding to MARCKS, MARCKS was digested in gel pieces with 1 or 2 g of lysyl endopeptidase. After the digestion, the MARCKS peptides were separated from the gel pieces and analyzed using a conventional high performance liquid chromatography apparatus, as described under "Experimental Procedures." When MARCKS peptides was eluted with a linear gradient of acetonitrile-H 2 O in the presence of 0.1% trifluoroacetic acid, three major 32 Plabeled radioactive peaks were detected by PKC phosphorylation (Fig. 6A). Each peak was eluted in fractions of 26, 39, and 41 (Fig. 6A). In contrast, one major peak in the fraction of 32, a small shoulder in the fraction of 30, and several minor peaks were detected in MARCKS phosphorylated by MAP kinase (Fig. 6B). As an additional control, the MARCKS phosphorylated by both MAP kinase and PKC was analyzed (Fig. 6C). Three major peaks originated from PKC-and MAP kinase-dependent phosphorylation sites were separated, but the first peak of PKC peptides eluted in fraction 26 was shifted to fraction 28 after the phosphorylation with both kinases. Although the reason for the shifting of the first peak of PKC peptides is unclear, dually phosphorylated peptides may be produced under the phosphorylation conditions. Next, MARCKS that was in situ phosphorylated by 2-or 10-min stimulation with glutamate was analyzed using the same procedures. The elution patterns of in situ phosphopeptides were apparently similar to that of in vitro phosphorylation as shown in Fig. 6C. At 2 min, phosphopeptides of MARCKS of the control cells showed major peaks in fractions of 29, 31, and 36 and several minor peaks (Fig. 6D). Stimulation with glutamate for 2 min mainly produced phosphopeptides in fractions 29 and 31, which corresponded to PKC-and MAP kinase-dependent phosphorylation sites, respectively, as shown in Fig. 6C. In contrast, following 10-min stimulation with glutamate, a peak of fraction 32 with a shoulder in fraction 30 largely increased with minor peaks around the fractions 37-41 (Fig. 6E). However, changes in other minor peaks were not consistent in repeated experiments. The increased phosphorylation of PKCand MAP kinase-dependent sites were also evident in the PMA-stimulated MARCKS phosphorylation, because PMA is known to be a strong activator for MAP kinase as well as PKC in the hippocampal neurons (30). These results suggest that the PKC-dependent phosphorylation in MARCKS is transient and that the persistent glutamate-induced phosphorylation in MARCKS is made through MAP kinase rather than PKC. Furthermore, as shown in Fig. 6, D-F, the phosphorylation by MAP kinase and PKC already occurred in the basal conditions in cultured hippocampal neurons.
Phosphorylation of MARCKS by PKC-MARCKS is originally known to be a substrate for PKC. We further confirmed the transient increase in phosphorylation of MARCKS by PKC following stimulation with glutamate. We developed a method to detect sites phosphorylated by PKC. A specific antibody that recognizes the phosphorylation sites Ser-152 and Ser-156 in MARCKS was produced by immunization of the phosphopeptide of MARCKS. 2 In control experiments, the purified MARCKS was phosphorylated by PKC in the presence of nonradioactive ATP and was subjected to immunoblot analysis. The antibody to the phosphopeptide of MARCKS could detect only the phosphorylated form by PKC, as shown in the last two lanes of Fig. 7A. In addition, PMA could stimulate the phosphorylation of PKC-dependent sites (Fig. 7A), and its effect was abolished by addition of 200 nM calphostin C. Consistent with the results in Fig. 6, the increased phosphorylation of PKC-dependent sites by stimulation with glutamate was transient, reaching a maximum between 1 and 3 min, followed by a decline to the basal levels within 10 min (Fig. 7B). The amount of MARCKS protein detected with nonselective antibody did not change during the incubation with glutamate (Fig. 7B) These results confirm that activation of PKC following glutamate stimulation is transient and PKC can primarily phosphorylate MARCKS during the early period by stimulation with glutamate. In addition, basal phosphorylation of PKC sites was observed in all these preparations. The basal phosphorylation by PKC is possibly due to endogenous release of glutamate and/or other stimulants that stimulate PKC in cultured hippocampal neurons.
Regulation of Functional Properties of MARCKS by MAP Kinase-Finally, we addressed question whether the functional properties of MARCKS is regulated by phosphorylation by MAP kinase. We then investigated effects of MARCKS phosphorylation by MAP kinase on its CaM-binding ability assessed by cross-linking with 125 I-CaM and interaction with F-actin determined by a co-sedimentation assay. The effects were compared with the changes by PKC-dependent phosphorylation. The purified rat brain MARCKS was incubated without or with protein kinases in the presence of 0.5 mM ATP (Fig. 8). Under FIG. 5. Effects of PD098059 and calphostin C on the glutamate-induced MARCKS phosphorylation. Cultured hippocampal neurons were prelabeled and preincubated as in Fig. 3. When indicated, 50 M PD098059 or 200 nM calphostin C was added during the 30-min preincubation. In case of down-regulation of PKC, cells were preincubated for 16 h with 100 nM PMA in cultured medium. The cells were then incubated for 2 or 10 min with 10 M glutamate plus 1 M glycine in KRH (C, control) or Mg 2ϩ -free KRH in the presence or absence of 50 M PD098059 or 200 nM calphostin C. In case of PMA treatment, cells were incubated for 10 min in the presence or absence of calphostin C. The 32 P-MARCKS was immunoprecipitated and analyzed by autoradiography. A, autoradiographs showing effects of PD098059 and calphostin C on glutamate-induced MARCKS phosphorylation. B, the cells were stimulated for 10 min with glutamate or PMA in various conditions as described above. C, the cells were stimulated for 2 min with glutamate.
The 32 P-incorporation into MARCKS was analyzed by a Bio-Imaging Analyzer and calculated as a percentage of the control in each condition. The changes in MARCKS phosphorylation were statistically significant versus control (a) and versus treatment with glutamate (b) or PMA (c); p Ͻ 0.05. these conditions, the total phosphate incorporated into MARCKS were 0.9 and 2.6 mol of phosphate/mol of MARCKS by MAP kinase and PKC, respectively. There was no incorporation of phosphate without each protein kinase. As reported previously (4), the CaM-binding ability of MARCKS was totally abolished by PKC-dependent phosphorylation, as shown in Fig. 8. The phosphorylation by MAP kinase slightly but significantly reduced its CaM-binding ability to 75% of control. In contrast, the interaction between MARCKS and F-actin was largely affected by the MAP kinase-dependent phosphorylation to the same extent as seen for the PKC-dependent phosphorylation (Fig. 9). These results suggest that MAP kinase can functionally regulate the properties of MARCKS, especially in its interaction with F-actin. DISCUSSION In neutrophils and macrophages, MARCKS is phosphorylated during chemotaxis, secretion, and phagocytosis (18,19); during neurosecretion (20,21,49,50); and during mitogenesis (22,23). Because this phosphorylation seems to be closely associated with activation of PKC and its abilities to bind calcium/calmodulin and cross-link actin filaments are directly regulated by the PKC-dependent phosphorylation (4,6), the physiological functions of MARCKS would appear to be mainly regulated by PKC in vivo. However, mass spectrometrical analysis using purified bovine MARCKS demonstrated six novel phosphorylation sites in addition to the known PKC phosphorylation sites (24). The endogenous phosphorylation by PKC was a minor portion and all the novel sites were serine residues, followed immediately by proline residues, which means that MARCKS is also a good substrate for proline-directed protein kinase, including MAP kinase and cdk5, in vivo.
We reported activation of PKC and MAP kinase, as well as CaM kinase II, in cultured rat hippocampal neurons (30,38). We focused on activation of the protein kinase cascades following the activation of NMDA receptors in the hippocampal neurons, because NMDA receptor activity was exclusively associated with synaptic plasticity in the developing brain as well as in the adult brain. For example, activation of CaM kinase II in cultured hippocampal neurons was predominantly regulated by the activity of the NMDA receptor, because glutamateinduced activation of CaM kinase II was only inhibited by addition of the NMDA receptor antagonist but not by antagonists of AMPA/kainate and the metabotropic receptors (38). The NMDA receptor-dependent activation of CaM kinase II was also evident in the long term potentiation (LTP) in the hippocampal CA1 regions (51). The potentiation of CaM kinase II was closely associated with the induction of LTP, in an NMDA receptor-dependent manner (51,52). Similarly, activation of MAP kinase by stimulation with glutamate was primarily due to activation of the NMDA receptor (30). The activation of MAP kinase may be related to the induction of LTP in the CA1 region, because PD098059 attenuated the induction of LTP (53). Thus, MAP kinase became an attractive candidate related to the underlying the molecular basis for expressing a The phosphopeptide profiles obtained from MARCKS were similar after digestion with 1 or 2 g of lysyl endopeptidase. When MARCKS phosphorylated by both PKC and MAP kinase was analyzed, the first peak of PKC phosphopeptides was slightly shifted to fraction 28 (C). D-F, in case of in situ phosphorylation of MARCKS, the hippocampal neurons prelabeled with [ 32 P]orthophosphate were incubated for 2 or 10 min with or without glutamate or PMA, as in Fig. 3. MARCKS from the control and the stimulated cells was immunoprecipitated and digested with 1 g of lysyl endopeptidase. The phosphopeptides were then analyzed using the same procedures. The experiments were repeated more than three times in the control and the stimulated cells, and one representative set of data is shown.
stable LTP in CA1 regions.
In the present study, we demonstrated that MARCKS is one in vivo substrate for MAP kinase following stimulation of glutamate receptors. MARCKS phosphorylation was sustained during more than 30 min after glutamate stimulation, a long lasting increase predominantly due to activation of the NMDA receptor. In addition, the long lasting glutamate-induced MARCKS phosphorylation was largely prevented by PD098059, a MAP kinase kinase inhibitor but not by a PKC inhibitor. When examining our previous results in terms of MAP kinase activation by stimulation of the glutamate receptors, the time course of glutamate-induced MARCKS phosphorylation was closely related to that of MAP kinase activation, in which the NMDA receptor activation was mainly involved (30). Treatment with PD098059 totally inhibited the glutamateinduced MAP kinase activation, as shown in the present study. Consistent with these observations, the major site for MAP kinase detected by HPLC analysis was mainly potentiated after a 10-min exposure to glutamate. The phosphorylation of the major site for MAP kinase was elevated even after a 30-min incubation (data not shown). The finding of one major peak in MARCKS phosphorylated in vitro by MAP kinase is consistent with findings that Ser-113 in mouse MARCKS and Ser-116 in bovine MARCKS were mainly phosphorylated by the purified MAP kinase in vitro (24,25). Furthermore, Schönwaßer et al. (25) demonstrated that the mutation of Ser-113 to alanine in MARCKS largely abolished the phosphorylation by MAP kinase. However, Ser-113 was not phosphorylated in permeabilized Swiss 3T3 cells after stimulation with platelet-derived growth factor as well as PMA (25). Because platelet-derived growth factor activates MAP kinase in a variety of cells, the phosphorylation of MARCKS by MAP kinase may not generally occur. In hippocampal neurons, MARCKS may be an important substrate for MAP kinase, because stimulation with brainderived neurotrophic factor in hippocampal neurons could also elicit an increase in MARCKS phosphorylation by MAP kinase. 3 The present study demonstrated that stimulation of hippocampal neurons with glutamate elicits biphasic increases in phosphorylation of MARCKS: that is, phosphorylation with 3 M. Kanahori, K. Fukunaga, and E. Miyamoto, unpublished data.
FIG. 7. Increased phosphorylation of MARCKS by PKC following stimulation with glutamate.
The nonlabeled hippocampal neurons were preincubated for 1 h in Ca 2ϩ -free KRH and then incubated in KRH (control) or in Mg 2ϩ -free KRH with 10 M glutamate for the indicated time, or in KRH with 100 nM PMA for 10 min. After homogenization, the cell extracts were treated with the SDS-sample solution (40) and subjected to SDS-PAGE. In control experiments, purified MARCKS was incubated with 20 nM PKC in the presence or absence of 0.1 mM ATP. After SDS-PAGE, the proteins were electrophoretically transferred to Durapore membranes (Millipore) and immunoblotted with the anti-phosphospecific antibody that recognized PKC-phosphorylation sites. Immunoreactive bands were visualized by incubation with 125 I-protein A, followed by autoradiography. A, autoradiographs showing specificity of the antibody and immunoblots with the cell extracts. The phosphospecific antibody recognized only phosphorylated MARCKS by PKC in the presence of ATP, as shown in the right two lanes. Immunoreactivities to the anti-phospho-specific antibody increased after a 10-min incubation with PMA. B, inset, autoradiographs showing a transient increase in phosphorylation by PKC following treatment with glutamate. The immunoreactivity against the antiphospho-specific antibody transiently increased without changes in the protein levels shown by the conventional anti-MARCKS antibody. Immunoreactivity was measured using a Bio-Imaging Analyzer and is expressed as a percentage versus control, in each condition. Values represent means Ϯ S.E. The changes in MARCKS phosphorylation were statistically significant versus 0 min; *, p Ͻ 0.05; **, p Ͻ 0.01. PKC through the metabotropic glutamate receptor in a short period and with MAP kinase through activation of the NMDA receptor over a long period. This was confirmed by using a specific antibody that recognizes PKC-phosphorylation sites. These results are consistent with previous observations that glutamate-induced translocation of PKC from the cytosol to the membrane fraction was transient and were reverted to basal levels in 5 min (38). The translocation of PKC was only inhibited by addition of an inhibitor for the metabotropic glutamate receptor (38). Transient increase in phosphorylation of MARCKS was noted in hippocampal neurons (54), cerebellar granule cells (55), and hippocampal slices from adult rats (56). It is important to determine which kinase is involved in the phosphorylation described in previous works (54 -56).
The possibility remains that other proline-directed protein kinases, such as cdc2 kinase and cdk5, are involved in glutamate-induced MARCKS phosphorylation. The phosphopeptides eluted in fractions 38 -42 were not identified. It has not been elucidated how cdc2 kinase and cdk5 are activated by external stimuli for receptors, although these kinases are expressed in neurons (57)(58)(59)(60) and have the potential to stoichiometrically phosphorylate MARCKS in vitro (26,61).
The present study is apparently the first finding to demonstrate the in situ phosphorylation of MARCKS through MAP kinase following extracellular stimuli. MAP kinase-induced phosphorylation of synapsin I was noted in cultured cortical neurons following stimulation with brain-derived neurotrophic factor (41). Synapsin I is predominantly located in presynaptic regions and regulates the binding between synaptic vesicles and actin filaments. In vitro phosphorylation of synapsin I by MAP kinase reduced the ability of cross-linking of actin filaments but had no evident effect on the binding ability to synaptic vesicles. The regulation of bundling of actin filaments by synapsin I phosphorylation through MAP kinase suggests that MAP kinase is implicated in neurite extension rather than exocytosis in the phosphorylation of synapsin I. On the other hand, MARCKS, which is also enriched in nerve terminals, regulates interactions between actin filaments and plasma membranes. In this context, we investigated the physiological significance of MARCKS phosphorylation by MAP kinase. The phosphorylation by MAP kinase significantly regulated the interaction between MARCKS and F-actin rather than its CaM-binding ability. The results suggest a potential role of MAP kinase in the regulation of F-actin-membrane interaction. The site for MAP kinase, Ser-113, is located in the near upstream site for the central PKC phosphorylation domain that includes Ser-152, Ser-156, and Ser-163 and is conserved in all members of the MARCKS family and MacMARCKS. The inhibitory effect of phosphorylation of Ser-113 by MAP kinase on binding to calmodulin may be due to conformational changes in the MARCKS structure. In cerebellar granule cells, involvement of MARCKS phosphorylation in NMDA-stimulated neurite outgrowth was suggested as MARCKS was present in neurites and growth cones (55). The present study demonstrated that MARCKS is also present in neurites and the varicosity-like structure, as based on light microscopic observations of cultured hippocampal neurons (Fig. 2). Further investigation of localization of MARCKS phosphorylated by MAP kinase is needed to clarify the roles of MARCKS in the central nervous system. MARCKS may serve as a good substrate for MAP kinase during the LTP expression, because MARCKS can provide a reversible cross-bridge between the actin cytoskeleton and the plasma membrane, which may contribute to reorganization or morphological changes in synapses in the hippocampus during LTP expression. FIG. 9. Effect on the binding to F-actin of MARCKS phosphorylation by PKC and MAP kinase. F-actin (10 g) was incubated with MARCKS that had been preincubated without (None) or with PKC or MAP kinase (MAPK) as in Fig. 8. After centrifugation, the pellet with F-actin and co-sedimented MARCKS was separated by SDS-PAGE and stained with Coomassie Blue (A). In order to detect the co-sedimented MARCKS, the gel was subjected to immunoblotting analysis with the anti-MARCKS antibody, followed by autoradiography (B). The position of MARCKS is indicated by an arrow head. The results from six independent experiments were examined statistically (C). Values represent means Ϯ S.E. The changes were statistically significant versus without protein kinase (None); **, p Ͻ 0.01. | v3-fos-license |
2018-12-07T01:34:07.083Z | 2017-06-01T00:00:00.000 | 56286785 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.21608/eajbsd.2017.14040",
"pdf_hash": "a9fe8f4b4c5490e3249c954a1ff894febc4e7ceb",
"pdf_src": "ScienceParseMerged",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119701",
"s2fieldsofstudy": [
"Biology",
"Medicine"
],
"sha1": "a9fe8f4b4c5490e3249c954a1ff894febc4e7ceb",
"year": 2017
} | pes2o/s2orc | Effects of 5-Fluorouracil on Testes Histology and Sperm Morphology Assay in Mice
Egyptian Academic Journal of Biological Sciences is the official English language journal of the Egyptian Society for Biological Sciences, Department of Entomology, Faculty of Sciences Ain Shams University. Histology& Histochemistry Journal include various morphological, anatomical, histological, histochemical, toxicological, physiological changes associated with individuals, and populations. In addition, the journal promotes research on biochemical and molecularbiological or environmental, toxicological and occupational aspects of pathology are requested as well as developmental and histological studies on light and electron microscopical level, or case reports. www.eajbs.eg.net Provided for non-commercial research and education use. Not for reproduction, distribution or commercial use.
MATERIALS AND METHODS Drug:
Neoflur (5-FU) is supplied as a 250 mg dissolved in 5 ml water; each 1 ml contains 50 mg 5-FU.5-FU was diluted in injectable water for all doses and used immediately after dilution.
Experimental animals:
Male adult albino mice (Mus musculus) obtained from National Research Centre, Cairo, was used in all experiments conducted in this study.At the beginning of each experiment the mice age between (7 to 10 weeks) and weighing between (20-30 gm) were kept in cages under standard conditions, i.e. a well ventilated room and a controlled regimen of fluorescent light (light for 12 hours and dark for 12 hours) at the Animal House of Zoology department, Faculty of Science, Suez Canal University.Mice were housed in plastic cages, wire topped with sawdust bedding.The sawdust bedding of the mouse boxes was changed weekly and the cages were cleaned and sterilized.Mice were fed on standard diet and tap water was given ad libitum.They were acclimatized to their place for one week before the experiment.Animals were randomly allocated into four separate experiments.The animals were used according to the guidelines of the Committee on Care and Use of Experimental Animal Resources (Suez Canal University, Egypt) and all efforts were made to reduce the number of animals used and their suffering.
Experimental design:
Animals were divided into 4 groups (a control group and three treated ones) of 5 male mice each.Three groups were injected intraperitoneally with 5-FU (5, 10 and 15 mg/kg) for five consecutive days at intervals of 24 hr.Mice of the control group were injected with injectable water.All animals were sacrificed on day 35 following the last injection.Post treatment sampling at 35 days was chosen for the study to allow the germ cells, which were exposed at late spermatogonial stage to the drug (5-FU) to reach the caudal epididymis.
Histological preparation:
Animals were anesthetized using chloroform, dissected and tissues samples of testes were taken out.Tissue samples were fixed in Bouins fluid for 48 hr.The fixative was changed twice during 48 hr.The samples were then washed several times in 70% ethyl alcohol to remove the excess fixative, dehydrated using ascending series of alcohols (80%, 90%, 100% and 100%), cleared in Terpineol and embedded in paraffin wax.Tissue blocks were sectioned at 5 µ thickness and stained with Harris Haematoxylin and Eosin (Mallory, 1944).
Sperm sampling and staining:
The epididymides were excised and minced in 1 ml of 0.9% physiological saline.The contents were gently pipetted or squeezed five to six times up and down in a 5 ml pipette.The sperm solution was filtered through a nylon cloth to remove tissue fragments.A small drop of the cell suspension was put on the end of a clean slide and spread by pulling the material behind a clean glass cover held at an angle of 45 degrees.The slides were air dried without fixation for about 24 hr.Slides were stained with 1% Eosin-Y (aqueous) for 30 minutes followed by two rinses in distilled water.Slides were then left to air dry and cleared in two changes of Xylene, 5 minutes each.Five slides were prepared for each mouse.Sperm smears were examined by light microscopy.For each mouse, 800 sperms were examined and morphological abnormalities of sperm head and tail were recorded according to the criteria of EL-Nahas et al. (1989).Abnormal sperm morphology is classified as defects in the head, midpieces and tail (Burruel et al., 1996).
Statistical analysis:
The statistical analysis was carried out using SPSS Statistical Package, version 13 for Windows (SPSS Inc., Chicago, IL, USA).The results were analyzed by performing ANOVA and Tukey's multiple comparison tests with significance level was set at p < 0.05.
RESULT
Testes of control mice were histological normal (Fig. 1).Testes of treated mice showed histological altered seminiferous tubules, at all doses.This alteration was in form of sloughing (loss) of immature germ cells into the tubular lumen.Some of the tubules showed haloapperance in the round spermatids.Spermatids of some tubules were observed forming round multinucleated giant cells (Fig. 2).
5-FU treatment affected the percentages of morphologically abnormal sperms at all of the three tested doses.Various morphological sperm abnormalities were observed in control and treated animals.Morphological abnormalities of mice sperms induced by 5-FU treatment, in the present study, were grossly headed sperms, quasi-normal headed sperms, angular midpiece sperms and bended tailed sperms (Fig. 3A-C).
Figure ( 4) showed graphically the mean values of morphologically abnormal sperms for the four studied groups while Figure ( 5) showed the linear trendline for the four studied groups which revealed that the mean values of the morphologically abnormal sperms increased as the drug doses increased.
The ANOVA test showed that the statistical differences between the control group and the 5-FU treated groups (5, 10 and 15 mg/kg) were statistically highly significant (p= 0.000267 at the level of significance of 0.05).The multiple comparisons between the four studied groups using Post Hoc Tukey test revealed that the statistical differences between the control and each of the studied drug doses (5, 10 and 15 mg/kg) were highly significant (p = 0.004, 0.003 and 0.001 respectively at level of significance of 0.05).However, the statistical differences among the drug doses 5, 10 and 15 mg/kg were insignificant.
DISCUSSION
At all used doses, the testes of the treated mice showed some histologically altered seminiferous tubules, whereas other seminiferous tubules were not affected.The fact that some of the seminiferous tubules were altered and other tubules were not, had been supported by Meistrich et al. (1982) who mentioned that the intracellular half-life of the drug is 7 to 9 days so that the stem cells may be triggered into cycle by administration of 5-FU while the drug is still active.Histologically altered seminiferous tubules showed sloughing of the germinal epithelium.This is similar to studies in rats by D 'Souza and Narayana (2001) who found sloughing of the germinal epithelium in the lumen after injecting 10, 50 and 100 mg/kg 5-FU intraperitoneally.
In the present study, multinucleated giant cells and haloapearence spermatids observed in seminiferous tubulus of the treated mice are in agreement with the findings of Narayana et al. (2000) who found multinucleated giant cells in the seminiferous tubulus lumen after injecting 100 mg/kg 5-FU intraperitoneally.Regarding the results of sperm morphology assay, this work revealed a statistically significant increase in the percentage of morphologically abnormal sperms at all used doses.Such percentages were 39.5%, 41% and 47.2% for 5, 10 and 15 mg/kg 5-FU respectively, as compared with 15.1% for the control animals.The differences between the control group and the treated groups were statistically significant (p<0.05),but the differences in the abnormal sperm count between the treated groups turned to be statistically insignificant.This is not in agreement with the findings of Choudhury et al. (2002) who used a single intraperitoneal injection of 5, 10 and 15 mg/kg 5-FU and carry out sperm morphology assay at week 8 post-treatment.He reported high percentages of abnormal sperm, but were not statistically significant.He attributed this to the gradual decline in the transmission of the induced cytogenetic toxic effects of 5-FU from spermatogonia to sperm, due to gradual elimination of the grossly affected spermatogonial cells during the course of spermatogenesis.
Morphological abnormalities of mice sperms induced by 5-FU treatment, in the present study, were grossly headed sperms, quasi-normal headed sperms, angular midpiece sperms and bended tailed sperms.
According to Wyrobeck (1984) the significant increase in the number of morphologically abnormal sperm has been associated with infertility.In the three used doses (5, 10 and 15 mg/kg) of 5-FU quasi-normal headed sperms were observed in the examined sperm smears.Quasi-normal head defects do not seem to affect the motility of spermatozoa but significantly reduce the in vitro and the in vivo fertilizing capacity (Jeyendran et al., 1986).
The quasi-normal head may be due to the action of 5-FU on the genes responsible for expression of acrosomes characteristics (Topham, 1980).Sperms with abnormal tail either with coiled tail or bended tail were observed.These abnormalities affect the motility of the sperm.Menkeld et al. (1990) related tail coiling to sperm aging.Sperms with bended midpiece were recorded.Menkeld et al. (1990) suggested that bended midpiece had grown from wrong centriole.Sperm cell morphology is genetically controlled by numerous autosomal and sex linked genes (Krazanowska, 1976).Hence, formation of abnormal sperm population in the present study is very likely due to the mutagenic effects of 5-FU on the specific gene loci of germ cell chromosomes involved in the maintenance of normal sperm structure.These mutagenic effects of 5-FU are primarilary caused by the direct cytotoxicity of germ cells during spermatogenesis.The cytotoxicity is caused by the antimetabolic activity of 5-FU through the inhibition of thymidylate synthestase and the erroneous incorporation into RNA and DNA (O`Dwyer et al., 1987 andPinedo andPeters, 1988).
We conclude that even small dose of 5-FU affect the patient fertility by disturbing the testes histology and sperm morphology.
Fig. 1 :
Fig.1: Testes section of control mice receiving injectable water and left for 35 days showing normal seminiferous tubules (HE, X 200).
Fig. 2 :
Fig. 2: Testes section of mice injected intrapertoneally with 15 mg/kg 5-FU for 5 consecutive days and left for 35 days showing sloughing (S) of immature germ cells into the tubular lumen.Some of the tubules showed haloapperance in the round spermatids (h).Spermatids of some tubules were observed forming round multinucleated giant cells (GC) (HE, X 200).
Fig. 5 :
Fig. 5: The linear trendline of the abnormal sperms for the four studied groups.
Table 1 :
The means and the percentages of abnormal sperms count. | v3-fos-license |
2018-03-26T23:09:21.289Z | 2013-12-30T00:00:00.000 | 35371240 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "http://www.orientjchem.org/pdf/vol29no4/OJCV029I04P1507-1514.pdf",
"pdf_hash": "b65dfd3314f334971581ef4282b3d2bb4e5147ad",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119721",
"s2fieldsofstudy": [
"Chemistry"
],
"sha1": "a49cd2a0310b3a20baf1cfe9d70e44d2567e21b5",
"year": 2013
} | pes2o/s2orc | Diazo-Coupling : A Facile Mean for the Spectrophotometric Determination of Rasagiline Hemitartrate
A simple, precise, accurate, high reproducible and economical visible spectrophotometric method of analysis for the synthesized rasagiline hemitartrate was developed and validated. The proposed method involves diazotization of sulphanilic acid under acidic conditions in presence of sodium nitrite, followed by its coupling with rasagiline in alkaline medium. The absorption spectra of the yellow colored chromophore formed between rasagiline and positive diazonium ion has absorption maximum at 440 nm. The linear regression analysis data for the calibration plot showed good linear relationship (r = 0.99937) with in the concentration range of 0 – 10 μg mL-1. The limit of detection and limit of quantitation were found to be 0.033 μg mL-1and 0.1 μg mL-1 respectively. This method was tested and validated for various parameters according to ICH guidelines. The results demonstrated that the pro cedure is accurate, precise and reproducible (R.S.D. < 2 %).
INTRODUCTION
R(+)-N-propargyl-1-aminoindan ("R-PAI") is also known as rasagiline and is a chiral compound with one asymmetric carbon atom in a five membered ring with an absolute (R) configuration which is produced as single enantiomer 1 .Rasagiline is a propargylamine-based drug indicated for the treatment of idiopathic Parkinson's disease 2 .In addition to rasagiline base, its acid addition salts (viz., mesylate, maleate, fumarate, tartrate, hydrobromide, p-acetate, benzoate, phosphate, tolunesulfonate and sulfate) are pharmaceutically acceptable 3 .Though different methods were reported for the determination of rasagiline mesylate in bulk and in pharmaceutical dosage forms [4][5][6][7] , only one each of RP-HPLC 8 and UV spectrophotometric method 9 were reported for the determination of rasagiline hemitartrate.
In view of a lack of a commercial supplier and non development of visible spectrophotometric assay method till the date for rasagiline hemitartrate, the present study is aimed at its synthesis and development of a visible spectrophotometric analytical method for its bulk form by conducting systematic trials.
MATERIALS AND METHODS
Systronics digital spectrophotometer (model-106), Shimadzu AUX-220 and an Elico LI-120 digital pH meter were used.Chemicals used were of analytical reagent grade and Milli-Q water was used throughout the investigation.
0.6% (w/v) Sulphanilic acid (4-aminobenzenesulfonic acid) solution
This solution was prepared by dissolving 0.6 g of sulphanilic acid in 75 mL of hot distilled water and diluted with 25 mL of acetic acid in a 100 mL volumetric flask.The solution was stored in a browncoloured bottle.
Synthesis and characterization of Rasagiline hemitartrate
The procedure adopted was in accordance to our earlier report 8 .
Absorption spectrum of coloured complex
Into a 10 mL volumetric flask, 1 mL of 0.6% sulphanilic acid solution and 1 mL of 3 N hydrochloric acid solution were added.After cooling the contents to 4 0 C in an ice bath, 1 mL of 3% sodium nitrite was added and shaken for three minutes.To remove the added excess sodium nitrite, 1 mL of 4% sulphamic acid solution was added and shaken for two minutes.Then an aliquot of working standard drug solution (in the range 2 -10 mg) was added and the medium was made alkaline by the addition of 2 mL of 10% sodium hydroxide solution.The contents were made upto mark with distilled water to obtain yellow colored solution.The developed chromophore was scanned within the wavelength region of 400 -800 nm against a blank solution.The resulting spectrum was shown in Figure 1, and the absorption curve showed characteristic absorption maximum at 440 nm.
Theory of absorption spectrum of coloured complex
Coupling of diazonium ion with drug molecules in basic medium to form azodyes has been used for the estimation of drugs by researchers 10,11 .In the proposed method, chromogen (diazonium salt) was prepared by diazotization of sulphanilic acid (having amino group) with sodium nitrite in Beer's Law Limit (Linearity, µg mL -1 ) 0 -10 3.
Limit of quantitation (µg mL -1 ) 0.10 The absorption maximum for the coloured complex was found to be 440 nm.The absorption maxima of aqueous solutions of pure rasagiline and sulphanilic acid were 264 and 249 nm respectively.The l max of diazonium salt of sulphanilic acid was 270 nm.The blank solution (prepared on addition of sodium hydroxide to this diazonium salt of sulphanilic acid) didn't shift in the absorption maximum.However, a remarkable shift in the absorption maximum was observed when the blank solution was added to the drug solution.This was due to the formation of coupling product, which exhibits an absorption band peaking at 440 nm.This reaction was exploited to develop a spectrophotometric method for the determination of rasagiline hemitartrate in bulk drug form.
Mechanism of the color reaction
The primary aromatic amines (p -nitro aniline / sulphanilic acid) react with NaNO 2 in acid medium in the temperature range of 0-3 0 C to give diazonium salt 12 .Colored azo compounds are formed by the coupling of the diazonium salts with strong nucleophiles (like electron rich aromatic / heteroaromatic compounds) 13 .The diazocoupling reaction can be considered as a proton eliminating condensation of a positive diazonium ion with another compound possessing an active hydrogen atom.
The proposed method is based on the reaction of diazotization of amino group bearing sulphanilic acid (4-amino benzene sulphonic acid) with sodium nitrite in presence of hydrochloric acid at a temperature of 3 °C to form an electrophile, i.e., positive diazonium ion.The reaction is usually carried out in an ice bath and the excess sodium nitrite was removed by treatment with sulphamic acid.Since most of the diazonium salts are unstable 11 , the diazonium salt was used immediately.
In alkaline medium, the positive diazonium ion couples at third position in rasagiline to form an yellow coloured azo product.
Optimization of reactions conditions
Factors affecting the reaction conditions (concentrations of sulphanilic acid, hydrochloric acid, sodium nitrite, sulphamic acid and temperature) were studied by altering each variable in turn while keeping the others constant and the optimum conditions were established.The optimum conditions were selected based on their ability to give maximum absorbance and were maintained throughout the studies.
In 1858, Peter Griess discovered the diazotization reaction 14 which requires three key components viz., an arylamine (Sulphanilic acid), a mineral acid (hydrochloric acid) and a source of nitrous acid (sodium nitrite) 15 . - As per the above equation, two equivalents of hydrochloric acid are required for sulphanilic acid.However, addition of excess acid is suggested to avoid the triazen formation.Triazen forms by the reaction of diazotized sulphanilic acid with the free sulphanilic acid 15 .Above 0.05N, with an increase in hydrochloric acid concentration, the rate of diazotization of sulphanilic acid increases 16 .Hence, the hydrochloric acid concentration was varied in between 0.05 to 1.5 N and the diazotization was found to be completed within three minutes for concentrations of 0.5 N and above up to 1.5 N. Hence, 1.0 N hydrochloric acid concentration was maintained in diazotization mixture by the addition of 1mL of 3 N HCl.Mixing of diazotization contents was done for six minutes though, the reaction completes within three minutes.The extended mixing is required because the reaction with nitrous acid is very slow towards the end of the diazotization 17 .To determine the optimum concentration of sulphanilic acid, the absorbance was studied by the addition of fixed volume (1 mL) of sulphanilic acid solution with variable concentrations (0.05-0.8%).Satisfactory results were obtained with 1 mL of a 0.6% sulphanilic acid solution.
Carrying out the diazotization at low temperature is advantageous 18 due to (a) enhanced solubility of free nitrous acid which prevents the escape of nitrous gases from the acid medium and (b) improved stability of the diazotized sulphanilic acid (as the diazotized sulphanilic acid degrades to p-hydroxybenzene sulphonic acid at higher temperatures).Therefore, diazotization was carried out below 3 0 C. The effect of sodium nitrite concentration on diazotization was studied by the addition of 1 mL of NaNO 2 solutions with variation in the concentration range of 0.3 -5%.An increase in absorbance was observed with an increase in sodium nitrite concentration and became constant at 1%, above which, absorbance remained constant up to 5%.Therefore 1 mL of 3% sodium nitrite was chosen as an optimum value for the determination studies.
Unlike hydrochloric acid, addition of excess sodium nitrite should be avoided due to destabilization of the diazotized salt by the surplus amount of nitrous acid produced in the medium 18 .Development of immediate blue colouration by moist potassium iodide starch paper helps the detection of surplus nitrous acid 17 .After completion of diazotization, the left over sodium nitrite can be destroyed by the addition of either urea or sulphamic acid 19 .These reagents convert the excess nitrite into nitrogen gas in acidic medium 20 .Sulphamic acid was preferred to remove the excess nitrite as it reacts faster than urea 21 .
By knowing the leftover nitrite after diazotization, the amount of sulphamic acid to be added for its removal can be calculated from the stoichiometry of the respective destruction reaction.It was found to be 1 mL of 4% sulphamic acid.
The effect of the addition of sodium hydroxide to the diazocoupling mixture was studied by following absorbance.The volumes of 10% sodium hydroxide varied from 1.0 to 3 mL.It was observed that maximum absorbance was observed by the addition of 2.0 ± 0.5 mL.A decrease in absorbance beyond 2.5 mL can be attributed to the partial decolorization of the dye at higher concentrations of alkali 22 .A decrease in colour intensity of the mixture at higher alkali conditions can be explained by consideration of acid-base equilibriums of diazonium compounds 23 .In general, aryldiazonium cations (e.g., phenyldiazonium) can lose their positive charge (i.e., high electrophilicity) and form diazohydroxides due to the attachment of anion to the terminal nitrogen atom.Further increase in alkalinity leads to subsequent deprotonation to form diazotates.
Hence, in the present case, a maximum absorbance was observed when reaction mixture maintained at 0.5 M w.r.t.sodium hydroxide.In spite of rapid development of the yellow colored azo-dye, a maximum absorbance was attained after about 2 min at room temperature and the colour intensity was quite stable for at least one hour.
Validation of Method
For analytical determination of drugs the most important step is validation.Linearity and range, accuracy and precision, recovery, ruggedness, limit of detection (LOD) and limit of quantitation (LOQ) are the main validation parameters 24 .
Linearity and range
The calibration graph was found to be linear in the range of 0 -10 µg mL -1 for the proposed method (Figure 2).Each point of the calibration graph was the mean value acquired from three independent measurements (Table 1).The linear regression equation was y = 0.01195 x + 0.09944.The various optical and regression parameters were given in Table 2.
Accuracy
The mean of percentage recovery values were given in Table 3.Low values of standard deviation and relative standard deviation confirm a high level of accuracy for the proposed method.
Precision
The precision of the method was satisfactory from low relative standard deviations (%RSD) values of intraday studies (0.232 -0.447) and inter-day studies (0.145 -0.289) (Table 4).
Ruggedness
No significant difference was observed between two analysts which was evident from the reproducible results.Hence, the proposed method could be considered as rugged (Table 5).
Detection of LOD and LOQ
LOD and LOQ were found to be 0.033 and 0.10 µg mL-1 respectively and the results show that the proposed method was sensitive to detect and quantif y24
Comparison of validation parameters
The results of validation parameters for the proposed method were within acceptable limits of ICH-2005 guidelines 25 .The correlation coefficient for the proposed method is 0.99937 indicating good linearity.
% R S D i n r e c o ve r y o f r a s a g i l i n e hemitartrate by the proposed method (0.19-0.25) is lower compared to those values of visible spectrophotometric methods proposed by other workers 4,26 for determination of its equivalent drug -rasagiline mesylate.LOD and LOQ values of the proposed method for rasagiline hemitartrate (0.033 and 0.1) are lower compared to those values of visible spectrophotometric methods proposed by other workers 4,26 for determination of its equivalent drug -rasagiline mesylate.Hence, the proposed diazotization method for visible spectrophotometric determination of Rasagiline hemitartrate was proved to be better compared to red-ox / ion-pair complex formation methods proposed for the determination of its equivalent drug -rasagiline mesylate.
CONCLUSIONS
The proposed method for determination of rasagiline hemitartrate involves diazotization of sulphanilic acid under acidic conditions in presence of sodium nitrite, followed by its coupling with rasagiline in alkaline medium to form an yellowcolored chromophore.This method was tested and validated for various parameters according to ICH guidelines.The proposed method can be used for the routine quality control analysis of Rasagiline hemitartrate in bulk form. | v3-fos-license |
2020-06-09T15:32:44.846Z | 2020-06-08T00:00:00.000 | 219543738 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://biotechnologyforbiofuels.biomedcentral.com/track/pdf/10.1186/s13068-020-01745-5",
"pdf_hash": "ca94fad7c145d4066422d99f24f654a345e7c3de",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119726",
"s2fieldsofstudy": [
"Biology",
"Engineering",
"Environmental Science"
],
"sha1": "ca94fad7c145d4066422d99f24f654a345e7c3de",
"year": 2020
} | pes2o/s2orc | A microbubble-sparged yeast propagation–fermentation process for bioethanol production
Background Industrial biotechnology will play an increasing role in creating a more sustainable global economy. For conventional aerobic bioprocesses supplying O2 can account for 15% of total production costs. Microbubbles (MBs) are micron-sized bubbles that are widely used in industry and medical imaging. Using a fluidic oscillator to generate energy-efficient MBs has the potential to decrease the costs associated with aeration. However, little is understood about the effect of MBs on microbial physiology. To address this gap, a laboratory-scale MB-based Saccharomyces cerevisiae Ethanol Red propagation–fermentation bioethanol process was developed and analysed. Results Aeration with MBs increased O2 transfer to the propagation cultures. Titres and yields of bioethanol in subsequent anaerobic fermentations were comparable for MB-propagated and conventional, regular bubble (RB)-propagated yeast. However, transcript profiling showed significant changes in gene expression in the MB-propagated yeast compared to those propagated using RB. These changes included up-regulation of genes required for ergosterol biosynthesis. Ergosterol contributes to ethanol tolerance, and so the performance of MB-propagated yeast in fed-batch fermentations sparged with 1% O2 as either RBs or MBs were tested. The MB-sparged yeast retained higher levels of ergosteryl esters during the fermentation phase, but this did not result in enhanced viability or ethanol production compared to ungassed or RB-sparged fermentations. Conclusions The performance of yeast propagated using energy-efficient MB technology in bioethanol fermentations is comparable to that of those propagated conventionally. This should underpin the future development of MB-based commercial yeast propagation.
Background
In typical industrial corn/wheat mash bioethanol fermentations, yeast is propagated under aerobic conditions for 6-10 h, the yeast suspension is then diluted ~ 1:10 with fresh mash suspension, the air supply is withdrawn, and the fermentation continued for ~ 48 h. Conventional yeast propagations involve aeration systems that supply oxygen (O 2 ) using inductors and spargers in an energy intensive process that can account for up to ~ 15% of total manufacturing costs [1,2]. As the biomass increases, demand for O 2 often outstrips the supply capacity of these systems. Increasing the surface area/volume ratio of the air bubbles introduced into fermenters increases the O 2 transfer rate to support biomass propagation. Hence, several devices to aerate microbial cultures using microbubbles (MBs) have been developed. For example, an MB device was used to enhance O 2 transfer and double polyhydroxybutyrate production by engineered Escherichia coli [3]. Production of recombinant human serum albumin by high cell density Pichia pastoris cultures was increased by up to sevenfold by MB aeration
Open Access
Biotechnology for Biofuels *Correspondence: [email protected] 1 Department of Molecular Biology & Biotechnology, University of Sheffield, Sheffield S10 2TN, UK Full list of author information is available at the end of the article [4]. Microbubble sparging has also proved beneficial in xanthan gum production by Xanthomonas campestris [5]. Furthermore, a spinning disc MB device was shown to be able to provide cultures of Saccharomyces cerevisiae (up to 50 L volume) with adequate O 2 at low agitation speed, with consequent savings in energy costs [6]. Some of these savings arise because MBs provide better mixing than regular bubbles (RB), thereby reducing local concentration gradients that could lead to O 2 -starved zones in large propagators [7].
MBs produced by fluidic oscillators with no moving parts have the potential to decrease the energetic costs of culture aeration still further [8]. A pilot study using such a system at a wastewater facility suggested that a ~ 20% decrease in blower energy costs could be achieved even under sub-optimal conditions (M. Hines, Perlemax Internal Report, 2018).
Sterol lipids contribute to resisting the toxic effects of ethanol and other stresses by maintaining the membrane rigidity [9,10]. The biosynthesis of sterols requires O 2 and hence this is not possible during the anaerobic ethanol-producing fermentation phase [11,12]. Therefore, during aerobic propagation the yeast cells must synthesise sufficient sterols to provide the ethanol tolerance required during the fermentation phase.
Taken together the observations outlined above suggest that MBs could enhance O 2 availability and reduce the overall energy costs during yeast propagation. Enhanced O 2 supply could result in greater sterol content and thereby increase ethanol tolerance during the anaerobic production phase. However, little was known about the effects, beneficial or otherwise, of MBs on yeast biology during propagation and fermentation. Therefore, an optimised laboratory-scale RB-based propagation-fermentation process was compared with a prototype MB-based process.
Construction of a microbubble (MB) fermenter
The prototype MB fermenter was constructed by removing the stirrer shaft and sparger from a conventional system (Fig. 1). A plastic dome was moulded to level the concave vessel bottom and house two centrally located sintered stainless-steel diffusers. The latter were connected to the outlets of the external fluidic oscillator. A recirculation system was implemented to maintain culture homogeneity (Fig. 1). Extensive modification and testing of fluidic oscillator frequency were made before arriving at the settings used in this study [13].
Mass transfer is enhanced in the MB fermenter
Mass transfer characteristics of the RB and MBadapted fermenters were measured using a dissolved O 2 probe located at different depths in the vessels; the position and motion of the impeller limited the analysis to two depths for the RB fermenter, whereas measurements were taken at four positions in the MB fermenter (Fig. 2). Higher k L a (the overall mass transfer coefficient) values were obtained for the MB fermenter. Furthermore, k L a remained consistent regardless of the position of the dissolved O 2 probe for the MB fermenter, but decreased by ~ 40% at the lowest point of measurement for the RB fermenter, suggesting better mixing was achieved in the MB fermenter.
Aerobic propagation of yeast in an MB fermenter
Quadruplicate cultures of S. cerevisiae Ethanol Red were propagated in YPD medium containing glucose (40 g L −1 ) at 32 °C in either a RB or MB fermenter ( Fig. 1). For these experiments YPD medium was used, rather than the common industrial feedstocks of cereal starches or molasses, because the composition of the latter substrates can be variable and hence introduce unknown factors that could confound identification of MB-specific effects on yeast propagation and bioethanol fermentation. For both fermenter configurations, exponential growth began immediately with a maximum specific growth rate of ~ 0.23 h −1 (RB: 0.24 ± 0.04 h −1 ; MB: 0.23 ± 0.05 h −1 ) producing 380 ± 36 × 10 6 cells mL −1 (RB) and 332 ± 100 × 10 6 cells mL −1 (MB) after 10-h propagation (Fig. 3a). Observation of the yeast by light microscopy did not show any gross morphological differences between the RB-and MB-propagated cells. For both, cell viability was ~ 100% throughout, although the budding index peaked (~ 50%) at 6 h and then decreased to ~ 40% upon glucose depletion and entry into stationary phase (Additional file 1: Figure S1). Free amino nitrogen was above 750 mg L −1 at the end of both propagation processes (Additional file 1: Figure S2). Cell dry masses per gram of glucose consumed (RB: 0.15 ± 0.03 g g −1 , and MB: 0.13 ± 0.03 g g −1 ) were typical of oxidoreductive metabolism (Fig. 3b). These values reflected those of the cell counts (see above) and thus the biomass produced by MB propagation was marginally lower than that achieved by RB propagation; a similar decrease in biomass has been previously reported (RB 0.53 g g −1 ; MB: 0.43 g g −1 [6]), suggesting that the enhanced O 2 transfer resulted in increased toxic reactive oxygen species. Nevertheless, it was concluded that the prototype MB fermentation apparatus could be used to propagate S. cerevisiae Ethanol Red with yields comparable to those of an optimised conventional RB fermenter.
Microbubble-propagated yeast can be used for anaerobic bioethanol fermentations
To simulate industrial bioethanol fermentations, 90% of the culture was removed from the propagation vessels and replaced with fresh YPD medium containing glucose (80 g L −1 ) and gas sparging was ceased. When glucose concentrations fell below 1%, a concentrated solution of glucose was added to continue the fermentation (Fig. 3c). For both RB-and MB-propagated yeast two phases of fermentative growth were observed; a fast phase between 10 and 32 h (µ max,RB : 0.23 ± 0.04 h −1 ; µ max,MB : 0.26 ± 0.04 h −1 ), during which ethanol was produced together with cell growth, and a slower phase from 32 h until the end of the fermentation (µ max,RB : 0.03 ± 0.02 h −1 ; µ max,MB : 0.02 ± 0.01 h −1 ) where growth was uncoupled from ethanol production (Fig. 3a). The budding index remained consistent throughout at ~ 40% (Additional file 1: Figure S3). Cell viability remained high at ~ 99% in the first phase and decreased to ~ 90% at the end of the fermentation (RB: 91 ± 1%; MB: 88 ± 5%) (Fig. 3b). Cell dry mass increased from the start of the Fig. 1 A prototype microbubble bioreactor for yeast propagation and fermentation. a Schematic representation of the MB bioreactor. The inlet of the fluidic oscillator is constructed to have a decreasing diameter until it reaches the junction with the two outlet tubes, which increase in diameter and are attached to the MB diffusers at the base of the vessel. At the junction, gas (air) entering the fluidic oscillator interacts with one wall and is forced along one of the outlets to emerge from the corresponding MB diffuser. A feedback loop switches the gas flow between the two outlets. A pump (red circle) recirculates culture medium from the base of the fermenter. Images showing b the modified Infors HT fermenter fitted with a recirculation pump; c the moulding (blue) fitted to the concave base of the fermentation vessel to eliminate the dead space and house the MB diffusers; d the sintered stainless steel diffusers and the recirculation tubing; e the fluidic oscillator showing the inlet connected to the gas flow meter on the bioreactor, and two outlets which send a stream of oscillating air, at a defined frequency determined by geometric features of the oscillator and the length of the feedback loop, to prevent the coalescence of bubbles as they emerge from the diffusers fermentation, reaching a maximum of 12.9 ± 3.4 g L −1 (RB) and 12.2 ± 0.7 g L −1 (MB) and then decreased as ethanol accumulated, possibly due to cell lysis and leakage of intracellular metabolites ( Fig. 3b; Table 1). Volumetric glucose consumption rate was the highest between 10 and 17 h (RB: 11.8 ± 0.9 g L −1 h −1 ; MB: 11.5 ± 0.5 g L −1 h −1 ) and it decreased thereafter (Fig. 3c). The highest ethanol concentration achieved was 100 ± 5 g L −1 (RB) and 96 ± 2 g L −1 (MB), with a productivity of 2.2 g L −1 h −1 ( Fig. 3d; Table 1). Thus, it was concluded that the performance of MB-propagated yeast in anaerobic bioethanol production was comparable to that of RB-propagated cells.
Enhanced expression of ergosterol biosynthesis genes in MB-propagated yeast
The macro-physiological parameters indicated that the MB propagation-fermentation process was as effective as a conventional process in an RB reactor. To determine whether these similar macroscopic outputs required transcriptional reprogramming in response to the different physical properties of MBs compared to RBs, global gene expression profiles were obtained for early and late propagation, and early and late fermentation cells (Table 2). Comparing gene expression of the early (t = 3 h) MBpropagated yeast to that of RB-propagated yeast indicated that 15 genes were differentially regulated (≥ twofold, adjusted p ≤ 0.05; Additional file 1: Table S1), whereas 104 genes were differentially regulated in late propagation (t = 10 h; Additional file 1: Table S2). Gene ontology analysis revealed enrichment in metal ion homeostasis Table S4). Thus, although the macro-physiology of the cells was unaffected by the mode of aeration, MB aeration elicited significant changes in gene expression during the propagation phase, including enhanced expression of genes required for ergosterol synthesis.
Gene expression of the MB-propagated yeast was then compared to that of RB-propagated cells in the anaerobic fermentation phase. During early fermentation (t = 7 h), 34 genes were differentially expressed in yeast that had been MB-propagated compared to RB-propagated (Additional file 1: Table S5). GO analysis revealed that plasma membrane organisation [GO:0007009] and responses to stress [GO: 0006950] were enriched (Additional file 1: Table S6). In the late fermentation phase (t = 32 h), only CYB2 (Additional file 1: Table S7), a component of the mitochondrial intermembrane space, was significantly different. The expression of genes associated with pyruvate fermentation (PDC1, 5, 6; ALD4, 5; ADH1, 2, 3, 4, 5; BDH1) was mostly unchanged after transition from late propagation to early fermentation, but both RB-and MB-propagated cells exhibited two to threefold increased expression of PDC5 (pyruvate decarboxylase) and ADH1 (alcohol dehydrogenase), whose actions combine to convert pyruvate to ethanol (Additional file 2).
Enhanced abundance of ergosteryl esters in MB fermentations
The higher level of expression of ergosterol biosynthesis genes in MB-propagated yeast suggested that such yeast could possess a larger reservoir of sterols and therefore exhibit enhanced ethanol tolerance during anaerobic fermentation. Yeast membranes exposed to ethanol exhibit increased lipid head group spacing, membrane fluidity and permeability, eventually leading to the lipid bilayers becoming interdigitated. Together these effects impair membrane function and yeast viability limiting the yields of bioethanol fermentations [14]. Ergosterol counteracts ethanol-induced interdigitation of lipid bilayers and enhanced levels of S. cerevisiae ergosterol correlated with increased ethanol tolerance [9]. However, the physiological and gene expression data indicated that RB-and MB-propagated yeast performed similarly in anaerobic fermentations.
Synthesis of sterols requires O 2 . Therefore, the effect of ergosterol biosynthesis gene expression on enhanced ethanol production when O 2 is supplied by RBs or MBs during the fermentation phase was investigated. MB-propagated yeast was used as the inocula for fermentations gassed with 1% O 2 supplied by RBs or MBs Table 2 Differentially expressed genes during aerobic batch propagation and fed-batch fermentation (ungassed) with S. cerevisiae Ethanol Red using YPD medium (≥ twofold adjusted p ≤ 0.05)
Changes in gene expression during oxygen-gassed fermentations
Gene expression profiles during the fermentations gassed with 1% O 2 supplied by RBs or MBs were compared. Widespread changes in gene expression (≥ twofold; adjusted p ≤ 0.01) were observed in response to the lower O 2 supply, i.e. shift from aerobic propagation (21% O 2 ) to sparged fermentation (1% O 2 ) (Fig. 5a). However, initially the changes were fewer for the MB-sparged fermentations, likely due to the more efficient gas transfer compared to RBs. At the end of the fermentations > 2000 genes were differentially expressed (≥ twofold; adjusted p ≤ 0.05) compared to the aerobic inocula (Additional file 3). During early fermentation (t = 4 h), 690 genes were significantly (≥ twofold; adjusted p ≤ 0.05) regulated (Additional file 3) involved in a wide range of cellular processes (e.g. response to stress GO:0006950, protein refolding GO:0042026, ribosome biogenesis GO:0042254, mitochondrial electron transport GO:0006122; Additional file 1: Table S8). During mid-fermentation (t = 12 h), 24 genes were differentially expressed with an enrichment in heme (GO:0042167, GO:0006788) and sterol metabolism (GO:0016126) (Additional file 1: Table S9). At the end of fermentation, 53 genes were differentially expressed relating to processes involved in DNA damage and disaccharide metabolism (Additional file 1: Table S10). Ranking differentially expressed genes based on DNA binding and expression changes mediated by S. cerevisiae transcription factors in Yeastract [15] showed that no regulons were significantly enriched early (4 h) or late (44 h) into the gassed fermentations. However, the Hap1p regulon was differentially regulated in the mid-fermentation (12 h) samples (Additional file 1: Table S11). Hap1p is a zinc-finger transcription factor that is essential for anaerobic growth and activates the expression of aerobic respiratory proteins by indirectly sensing O 2 availability through the capacity to synthesise heme [16]. The higher expression of CYB2 (3.8-fold), CYC1 (3.1-fold), COX26 (4.8-fold) and HMX1 (4.8-fold), and lower expression of AAC3 (2.8-fold) in the MB-sparged fermentations, compared to the RB-sparged cultures, suggest that sufficient O 2 supply is maintained for longer in the MB fermenter as a consequence of the superior mass transfer values associated with MBs (Fig. 2).
Mapping of significantly regulated genes (≥ twofold, adjusted p ≤ 0.01) 4 h into the fermentations to the cellular overview of S. cerevisiae metabolism available in Yeast Pathways (https ://pathw ay.yeast genom e.org/ [17]) showed that the common responses to the switch from 21% O 2 sparging to 1% O 2 included down-regulation of citric acid cycle and aerobic respiratory genes and downregulation of trehalose biosynthesis genes (Fig. 5b). Whilst up-regulation of several genes involved in sterol and arginine biosynthesis was common to both fermentation processes, more of these genes were up-regulated in the MB fermentations (Fig. 5c). One of the most upregulated genes in both fermentations was HES1 (OSH5), coding for a protein that resembles the mammalian oxysterol binding protein (OSBP) which is implicated in ergosterol homeostasis, with an HES1 (OSH5) mutant exhibiting lower ergosterol content, but similar lanosterol and zymosterol contents, to wild-type S. cerevisiae [18]. Increased amounts of sterols and arginine have been reported to enhance ethanol tolerance and hence the increased expression of these genes in the MB fermentations could be a useful trait conferred by an MB propagation-fermentation [9,19]. Changes in the expression of genes linked to pyruvate metabolism upon transition to 1% O 2 sparging were similar for both RB and MB fermentations, but differed from the anaerobic fermentations (Fig. 6). The pyruvate dehydrogenase gene (PDH1) was more severely repressed in the ungassed fermentations, potentially increasing flux to ethanol. Furthermore, the pyruvate decarboxylase genes PDC5 and PDC6 showed opposite regulation when MBpropagated cells were used in anaerobic fermentations (PDC5 up-regulated, PDC6 down-regulated) compared to the 1% O 2 -sparged fermentations (PDC5 down-regulated, PDC6 up-regulated). Expression of PDC6 is usually lower than PDC1 and PDC5, which are considered to be more important for ethanol production by catalysing the conversion of pyruvate to acetaldehyde ( Fig. 6a; [20]), whereas PDC6 supported the growth of a PDC1/PDC5 mutant on ethanol medium [21]. The alcohol dehydrogenase gene ADH1 was up-regulated in all the fermentations, but in the gassed fermentations expression of ADH2 increased, whereas it decreased in the ungassed fermentation (Fig. 6b). Adh1p is responsible for conversion of acetaldehyde to ethanol, whereas the kinetic properties of Adh2p are thought to favour the reverse reaction permitting aerobic utilisation of ethanol [22]. Transcription of ADH2 is co-regulated by Adr1p and Cat8p in response to glucose depletion [23]. Expression of ADR1 and CAT8 was enhanced at the end points of the gassed fermentations, but was unchanged in the ungassed fermentation (Fig. 6b). The expression patterns of PDH1, PDC6 and ADH2 suggest that, whilst the gassing regime employed here enhanced the content of ergosterol esters, it also facilitated the consumption of ethanol and aerobic metabolism.
Oxygen sparging during fermentation decreased yeast viability
Microbubble-propagated cells exhibited increased expression of ergosterol biosynthetic genes compared to RB-propagated cells, but this did not result in enhanced ethanol production in a typical anaerobic fermentation (Fig. 3). Moreover, introducing low levels of O 2 using MBs during fermentation enhanced expression of a subset of genes required for sterol ester synthesis and increased the content of ergosteryl palmitoleate and ergosteryl oleate of the yeast cells compared to RB cultures (Fig. 4b). However, the enhanced expression of PDC6 and ADH2 suggested that continuous sparging with 1% O 2 during fermentation allowed the metabolism of ethanol (Fig. 6b). Previous studies have used various aeration regimens to improve ethanol production [24][25][26][27]; however, relatively little is known of the effects of O 2 on yeast exposed to high ethanol concentrations. Therefore, fermentations sparged with RBs and MBs consisting of 1% O 2 -99% N 2 were analysed for ethanol production and yeast viability. Just as in the ungassed fermentations, two growth phases were observed. A fast growth phase, in which cells produced ethanol together with higher biomass (14.4 ± 2.3 g L −1 [RB] and 14.8 ± 1.3 g L −1 [MB]) compared to ungassed fermentations (Fig. 7). The final cell densities were also higher than those obtained for non-oxygenated fermentations (641 ± 77 × 10 6 cells mL −1 [RB] and 721 ± 85 × 10 6 cells mL −1 [MB] (Fig. 7a)), indicating that metabolism was respiro-fermentative. The maximum ethanol concentrations were 96 ± 3 g L −1 (RB) and 89 ± 3 g L −1 (MB) (Fig. 7d), which were slightly lower than those of the ungassed fermentations (Fig. 3d). The lower concentration of ethanol measured in the MB fermentations was at least in part caused by ethanol stripping. Indeed, ethanol concentrations from RB-gassed (See figure on next page.) Fig. 5 Changes in gene expression during gassed fermentation of MB-propagated yeast. An overview of the experimental approach is provided in Fig. 4a. a Venn diagrams showing differential gene expression (≥ twofold, adjusted p ≤ 0.01) at the indicated times for fermentations gassed with 1% O 2 using RB (blue) or MB (red). b Cellular pathway overview of S. cerevisiae metabolism from yeast pathways [17] showing reactions associated with differentially genes 4 h into the fermentations compared to the MB-propagated inocula: up-regulated in both RB and MB fermentations (red); down-regulated in both RB and MB fermentations (dark blue); up-regulated in RB (orange) or MB (cyan) fermentations only; down-regulated in RB (purple) or MB (green) fermentations only. c Higher resolution representations of (left to right) glucose fermentation, citric acid cycle (CAC) and aerobic respiratory chain, sterol biosynthesis and arginine metabolism. Colour key as stated in b Raghavendran et al. Biotechnol Biofuels (2020) 13:104 cultures plotted against those from MB-gassed cultures deviated 5% from the identity line (y = x), whilst for the ungassed fermentation, the deviation was less than 0.5% (Additional file 1: Figure S4). Unexpectedly, cell viability for the O 2 -gassed fermentations cell viability decreased more rapidly (~ 1% h −1 ) compared to ungassed (< 0.3% h −1 ) or O 2 -free N 2 -gassed (< 0.2% h −1 ) cultures and hence the loss of viability was attributable to the presence of O 2 ( Fig. 7b; Additional file 1: Figure S5). It is known that reactive oxygen species are generated during ethanol production [28] and that these damage a wide range of cell components; it is likely that reactive oxygen species production and the resulting cell damage are exacerbated due to limited oxygenation during the fermentation phase [29].
Discussion
Saccharomyces cerevisiae Ethanol Red is used for commercial production of bioethanol. The process has two stages; the yeast is cultured in aerated vessels and these are subsequently used to seed anaerobic fermentations during which feedstock sugars are converted to ethanol. A significant manufacturing cost is the provision of air (O 2 ) during propagation [1,2]. Advances in MB technology offer opportunities to reduce these costs and thereby improve the economics of bioethanol production [7]. However, a molecular physiological analysis of MB-propagated yeast in a fed-batch bioethanol process had not been undertaken previously. The data reported here show that a prototype system fitted with an energyefficient fluidic oscillator supported enhanced O 2 transfer to the yeast culture and that the resulting biomass performed comparably to conventionally propagated yeast in anaerobic fermentations. Under industrial conditions, in which propagation-fermentation is supported by variable, poorly defined, corn-or wheat-based mash, the superior mass transfer achieved using MBs could be advantageous in maximising biomass yields. Preliminary laboratory propagation trials using wheat mash in a vessel fitted with a fluidic oscillator and diffuser suggested a marked improvement in mass transfer and cell numbers compared to conventional propagation (unpublished data). Therefore, the performance of the prototype laboratory-scale system described here demonstrates the potential utility of fluidic oscillator generated MBs and their associated cost benefits for application in bioethanol production. The comparable macro-physiological characteristics of the MB-propagated yeast were accompanied by differences in membrane composition that could provide a platform for further process development. Sterols are membrane lipids whose synthesis requires O 2 and contribute to resisting the toxic effects of ethanol [9,10]. The MB-propagated yeast exhibited enhanced expression of ergosterol biosynthesis genes and possessed increased amounts of ergosteryl esters compared to those propagated conventionally. However, these enhanced pools of sterol esters did not translate into increased ethanol production in the anaerobic fermentations reported here and nor did attempt to exploit the enhanced expression of sterol biosynthesis genes by introducing 1% O 2 MBs during the production phase. Nevertheless, these observations suggest that with further process development to counteract the detrimental effects of reactive oxygen species and ethanol consumption in O 2 -sparged fermentations, MB-propagated yeast might exhibit improved ethanol tolerance. Such developments might include optimising the rate and timing of the O 2 supply to MBpropagated yeast during the fermentation phase, as these factors have previously shown to important for biomass and ethanol production in very-high-gravity ethanol fermentations [26]. Hence, the work described here should inform the next stage in MB reactor design and process development by providing the reassurance that MBpropagated yeast perform at least as well as those grown conventionally.
Conclusion
Application of a microbubble (MB) aeration system with no moving parts enhanced O 2 transfer to cultures of S. cerevisiae Ethanol Red. The MB-propagated yeast performed similarly to yeast propagated conventionally when used as the seed culture for bioethanol fermentations. This study provides the biological underpinning for future development of energy efficient, higher yielding commercial-scale MB-based yeast propagation.
Inoculum preparation
Cells from a single colony were inoculated into YPD (10 mL) and grown for 17 h. Cells were counted in a Neubauer chamber using a phase contrast microscope at 400× magnification. The required volume of culture liquid-corresponding to an initial pitching density of 5 × 10 6 cells mL −1 at the start of the propagation-was centrifuged, pellet resuspended in sterile YPD (1 mL) and used as the inoculum for batch fermentations.
Mass transfer determination
Mass transfer was determined in triplicate for a variety of flow rates and diffuser configurations at 35 °C in 40 g L −1 glucose supplemented YPD, as per the propagation and fermentation experiments. For each configuration, the media were allowed to stably come to temperature before proceeding. Using an optical dissolved O 2 (DO) probe (PreSens, Germany), the DO was able to be measured in various positions. The position of the probe in the control system was limited to two points (0.5 and 4.5 cm from the liquid surface) due to the movement and location of the impeller. However, the position of the probe in the MB system was captured at four different vertical positions (1, 4, 6 and 8 cm from the surface). The control configuration used the standard "J" type sparge tube that comes as standard with the Infors bioreactor to deliver gas to the system. All control experiments were stirred at 400 rpm (standard Rushton type impeller). To limit biomass settling, the medium in the MB fermenter was recirculated using a peristaltic pump (58 mL min −1 ). The DO in the medium was lowered to 0 ± 0.05 mg L −1 using pure nitrogen. Using the Infors mass flow meter, the desired flow rate of air was delivered to the system. The dissolved O 2 was then allowed to rise to ~ 98% of saturation. Mass transfer was calculated using Eq. 1: where C t is the concentration of dissolved O 2 at time t, C Sat T the concentration of dissolved O 2 at saturation at temperature T, C 0 the zero saturation dissolved O 2 concentration, k L a T the interfacial mass transfer at temperature T and t time. The interfacial mass transfer was determined by regression and minimisation of the residual of the sum of squares.
Conventional propagation and fed-batch fermentation
Batch aerobic propagation was carried out in a 2-L Infors fermenter with a working volume of 1 L using YPD medium supplemented with 40 g L −1 of glucose. The bioreactor was sterilised by autoclaving (45 min, 121 °C). The temperature was controlled at 32 °C and the cultivation medium was sparged with filtered air (0.2 vvm). The agitation rate was maintained at 400 rpm. The culture vessel was inoculated with ~ 1 mL of culture corresponding to an initial pitching density of 5 × 10 6 cells mL −1 .
The exhaust gas was passed through a condenser, maintained at 10 °C by circulating cooled water. Samples (5 mL) were taken for biomass, absorbance, and metabolite analysis every 3 h during the exponential growth phase. Data acquisition of process variables was recorded automatically using Iris or Eve software. After 10 h of yeast propagation, 90% of the culture was removed by creating an over pressure in the bioreactor by blocking the exhaust. The reactor was then fed with fresh YPD medium (800 mL; 1:9 dilution of the propagated yeast suspension; autoclaved for 20 min at 121 °C) containing glucose (80 g L −1 ) to commence the anaerobic fermentation phase, without gas sparging. When glucose levels reached less than 1.0% (determined using a portable refractometer), the bioreactor was pulsed with a known volume of a concentrated glucose solution (750 g L −1 ; autoclaved for 20 min at 121 °C) via a high-speed peristaltic pump. The dispensing volumes and the time of pulse additions after the start of fermentation phase were 75 mL at 7 h, 100 mL at 15 h and 75 mL at 24 h. Samples (5 mL) were taken at regular intervals to monitor the fermentation profile and for analytical measurements.
Microbubble propagation and fed-batch fermentation
For MB batch propagations the cultivation conditions were the same as that for conventional propagations but with two major alterations: the stirrer shaft and the (1) sparger were removed to accommodate the sintered stainless steel diffusers housed within a custom-built dead space eliminator at the bottom of the vessel. Custom-built metal plates and Teflon spacers on the head plate held the diffuser in place ensuring a hermetic seal for culture sterility. Tubes emerging from the two diffusers were connected to the two outlets of the fluidic oscillator [13]. The fluidic oscillator was sterilised by filling it with ethanol (70% v/v) and leaving it for 24 h. Ethanol was drained from the fluidic oscillator just before the start of the batch process and connected to the tubing from the diffuser. Two metal tubes from two ports on the head plate were connected in a closed loop via norprene tubing. A peristaltic pump recirculated the cell suspension from the bioreactor via the closed loop, to ensure cell homogeneity.
Gassed fermentation
Yeast cells were propagated using for 10 h in an MB bioreactor. After 10 h, 90% of the contents were removed as described for the ungassed fermentations and used as inocula for RB-and MB-oxygenated fermentations. During the fermentations, a gas mixture containing 1% O 2 and 99% N 2 was sparged to supply small amount of O 2 . To promote stripping of ethanol via gassing, the condenser cooling was turned off. N 2 -gassed fermentation was carried out exactly as above but sparged with ultrapure N 2 (BOC certified O 2 free N5.5).
Biomass determination
A 3-mL sample was filtered using a pre-dried, preweighed 0.45-µm filter membrane and washed with distilled water. The filter membrane with the wet biomass was dried in a microwave oven at 150 W for 10 min. The biomass concentration was calculated from the difference of the masses and the volume of the broth used.
Cell viability and budding index
Viable cells exclude the dye methylene blue [30]. Diluted samples (50 µL) from the propagation-fermentation runs were mixed with 50 µL of methylene blue (0.01% (m/v)) and incubated for 5 min and the number of stained and unstained cells was counted. Budding index was scored by counting a minimum of 300 cells. Assays were performed in duplicate.
Extracellular metabolites' determination
Glucose was analysed using the Megazyme GOPOD kit (K-GLUC 10/15, Megazyme Inc., Ireland); ethanol was analysed using the Megazyme kit (K-ETOH, Megazyme Inc., Ireland) using the manual assay procedure for large volumes in a cuvette. The assays were performed in duplicate.
Transcript profiling using microarrays
Two time points from the propagation phase (3 h, 10 h) and two time points from the fermentation phase (7 h, 32 h) were chosen for gene expression analysis. All analyses were performed in triplicate except the early propagation sample (3 h) for which only duplicate samples were available. There were 24 samples in total including two technical replicates. Culture samples for transcriptional profiling were directly eluted into 2 volumes of RNAprotect (Qiagen) to rapidly stabilise the mRNA. Total RNA was prepared using the RNeasy RNA purification kit (Qiagen), according to the manufacturer's instructions (including the on-column DNAse treatment step). The eluted RNA was treated again with DNase and repurified. Quality of RNA was checked using agarose gel electrophoresis and PCR using DNA specific primers. RNA was quantified on a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific). Labelled cDNA was produced using SuperScriptIII reverse transcriptase (Invitrogen) with the Cy3-dCTP included in the dNTP mixture. Labelled S. cerevisiae genomic DNA was produced using BioPrime DNA Labelling Kit (Invitrogen) with Cy5-dCTP included in the dNTP mixture. Labelled genomic DNA and cDNA were combined and hybridised overnight to an oligonucleotide microarray (Agilent Technologies). Quantification of cDNA samples, hybridisation to microarrays, microarray processing and scanning were carried out as described in the Fairplay III labelling kits (Agilent Technologies, 252009, Version 1.1) and scanned with a high-resolution microarray scanner (Agilent Technologies).
Features with background intensities exceeding 10 times the array median, or with a signal to background ratio below 3 were excluded from further analysis. Background correction [31] within-array loess normalisation [32] and between-array quantile normalisation was applied to the remaining features using the R statistical package LIMMA from Bioconductor [33]. Moderated t-statistics were calculated using gene-wise linear models with an empirical Bayes approach [34,35].
Transcript profiling by RNA sequencing
Samples taken from the bioreactor (1 mL) were immediately harvested by centrifugation and the pellets flash frozen in liquid nitrogen. RNA isolation, polyA selection, transcript library preparation and paired-end sequencing on an Illumina Hi-Seq were performed by GENEWIZ.
Trimmed reads were aligned to the Saccharomyces cerevisiae S288C reference genome (NCBI assembly: GCA_000146045.2) using TopHat2 [36]. Numbers of mapped reads aligned to each gene were counted using HTSeq [37]. Raw counts were converted to log 2 counts per million using the LIMMA voom transformation [38], and further differential expression analysis was performed using the LIMMA package in R.
Analysis of transcriptomic datasets
For both microarray and RNAseq analyses p values were adjusted for multiple testing using the Benjamini-Hochberg method [39]. Transcripts exhibiting ≥ twofold change in abundance with an adjusted p value < 0.05 were deemed to be differentially regulated. GO enrichment analysis was performed using the differentially expressed gene lists in Funspec [40]. Pathway enrichment analysis was performed using Metacyc [41] to identify significantly enriched metabolic or signal transduction process. Transcription factors likely to be involved in mediating the observed changes in gene expression were ranked using Yeastract [15].
Lipidomics
Sterol analysis was performed on lipid extracts from lyophilised cell material. Samples were weighed (5 mg) into 2-mL microfuge tubes, together with 10 µL of internal standard mix containing 1 µg deuterated cholesterol and 3.5 µg deuterated cholesterol steryl ester (SPLASH lipidomix, p/n 330707; Avanti Polar Lipids, AL, USA). Water (50 µL), CHCl 3 :MeOH (2:1 v/v, 700 µL) and acidwashed glass beads (300 mg, Sigma; 425-600 µm) were added to each tube. Samples were then extracted in a bead mill (Qiagen TissueLyser II; 2 × 3 min pulses at 30 Hz with intervening plate rotation), snap-frozen in liquid N 2 , then allowed to slowly thaw at 4 °C for 24 h. Samples were subsequently centrifuged at 16,000×g for 10 min, the supernatant transferred into fresh 2-mL tubes, and developed into two phases following addition of 300 µL 0.9% KCl (w/v) and vortexing briefly. The lower phase was transferred into glass HPLC vials, and vacuum evaporated to dryness on a GeneVac EZ2 centrifugal evaporator at the very low boiling point setting. Samples were reconstituted in 200 µL acetonitrile:isopropanol (7:3, v/v), and 2 µL analysed by LCMS. LC separation was performed on an Accucore C30 column (Thermo Scientific; 100 mm × 2.1 mm, 2.6 µm particle size) and masses acquired in data-dependent MS2 mode on a Thermo Orbitrap Fusion Tribrid mass spectrometer as previously described [42], except an atmospheric chemical pressure ionisation (APCI) source was used to generate ions for measurement in positive mode only, and MS1 data were acquired at a mass resolution of 60,000 FWHM. Ergosterol was identified by reference to an authentic standard (Sigma), and all candidate sterols identified by homology as their [M-H 2 O + H] + ions (MS1 quant ions for sterols and deuterated cholesterol). Sterol esters had diagnostic in-source fragments [Sterol-OH] + (also used for MS1 quant) and [M + C 3 H 3 ] + adduct ions (identified | v3-fos-license |
2018-06-09T02:23:34.793Z | 2018-06-06T00:00:00.000 | 46954740 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://lipidworld.biomedcentral.com/track/pdf/10.1186/s12944-018-0785-6.pdf",
"pdf_hash": "c62a8ed28d6ead6226f3543481c82c19fcd9066a",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119778",
"s2fieldsofstudy": [
"Biology",
"Chemistry"
],
"sha1": "c62a8ed28d6ead6226f3543481c82c19fcd9066a",
"year": 2018
} | pes2o/s2orc | Effects of aging on serum levels of lipid molecular species as determined by lipidomics analysis in Japanese men and women
Background Aging is known to be associated with increased risk of lipid disorders related to the development of type 2 diabetes. Recent evidence revealed that change of lipid molecule species in blood is associated with the risk of type 2 diabetes. However, changes in lipid molecular species induced by aging are still unknown. We assessed the effects of age on the serum levels of lipid molecular species as determined by lipidomics analysis. Methods Serum samples were collected from ten elderly men (71.7 ± 0.5 years old) and women (70.2 ± 1.0 years old), ten young men (23.9 ± 0.4 years old), and women (23.9 ± 0.7 years old). Serum levels of lipid molecular species were determined by liquid chromatography mass spectrometry-based lipidomics analysis. Results Our mass spectrometry analysis revealed increases in the levels of multiple triacylglycerol molecular species in the serum of elderly men and women. Moreover, serum levels of total ester-linked phosphatidylcholine (PC) and phosphatidylethanolamine (PE) were increased by aging. In contrast, serum levels of specific ether-linked PC and PE molecular species were lower in elderly individuals than in young individuals. Conclusions Our finding indicates that specific lipid molecular species, such as ether- and ester- linked phospholipids, may be selectively altered by aging.
Background
Aging is known to cause the development of metabolic syndrome, including type 2 diabetes and atherosclerosis [1]. Patients with metabolic syndrome have a unique type of dyslipidemia characterized by hypertriglyceridemia and hypercholesterolemia [2]. Thus, information regarding abnormal levels of triacylglycerol (TAG) and cholesterol in the blood is generally used to evaluate the risk for metabolic syndrome. Importantly, aging is known to be associated with increased risk of lipid disorders related to the development of metabolic syndrome [3]. Lipids have many key biological functions and act as structural components of cell membranes, energy storage sources, and mediators of signaling pathways [4]. On the basis of their structures and functions, lipids can be categorized into distinct classes, such as free fatty acids, glycerolipids, and glycerophospholipids.
Additionally, each lipid class has distinct molecular species based on structure. For example, glycerolipids, such as TAG and diacylglycerol (DAG), are composed of glycerol and fatty acids, and individual molecular species of glycerolipids have distinct effects on biological functions. Interestingly, TAGs containing saturated fatty acids (e.g., palmitate) impair the insulin signaling pathway in the skeletal muscle [5]. Recent studies using comprehensive analytical methods for lipid profiling have revealed that some lipid molecules in the plasma and serum are associated with the risk of metabolic syndrome [6][7][8][9][10]. For example, high plasma levels of specific TAG molecular species (e.g., TAG 50:0 and TAG 52:1) have been observed in patients with type 2 diabetes [6]. These findings suggest that the level of specific lipid molecular species may be beneficial as a biomarker for assessing the pathological status of metabolic syndrome.
In addition to TAG, ether-and ester-linked phospholipids have been examined in the relation to metabolic syndrome and cardiovascular disease. Although phospholipids can be classified into ester-linked and ether-linked phospholipids, ester-linked phospholipids are characterized by the glycerol backbone sn-1 and sn-2 positions have acyl chains attached by ester bonds. On the other hand, ether-linked phospholipids are characterized by an ether linkage between the glycerol backbone and one or both fatty acid side chains (usually the sn-1 position). Ether-linked lipids may function as free radical scavengers and thereby exhibit protective effects on cells and tissues by mitigating oxidative stress. Importantly, recent studies have shown that plasma levels of specific ester-linked phosphatidylcholine (PC) molecular species (e.g., PC 34:2 and PC 36:2) are increased in patients with type 2 diabetes [6,7]. In contrast, plasma levels of specific ether-linked PC molecular species are decreased in patients with type 2 diabetes [8]. Those findings indicate that ester-linked lipid and ether-linked lipid exert distinct effects on development of type 2 diabetes. Therefore, it is important to examine the effects of aging on ester-and ether-linked lipids.
Aging is known to increase the risk of metabolic syndrome via the development of dyslipidemia [2]. Previous studies have shown that plasma levels of total triglycerides and cholesterol are higher in elderly participants than in the young ones. However, changes in lipid molecular species induced by aging are still unknown. Here, we used lipidomics analysis to investigate lipid molecular species profiles associated with aging. We assessed the effects of age on the serum levels of aging-associated lipid molecular species in men and women.
Participants
Elderly individuals aged 66-74 years were recruited from participants who qualified during specific health checkups conducted at Kusatsu-machi, Gunma Prefecture, Japan, with the cooperation of the Tokyo Metropolitan Institute of Gerontology. Additionally, young individuals aged 21-27 years were recruited from Waseda University. Data from 10 elderly men and women and 10 young men and women were used in this study. Table 1 shows the age, height, weight, and body mass index (BMI) of each participant.
Written informed consent was obtained from all participants. Ethical approval for this study conformed to the standards of the Declaration of Helsinki. The study protocol was approved by the ethics committees of the Tokyo Metropolitan Institute of Gerontology and Waseda University.
Blood sampling
Venous blood samples were obtained from the forearms of participants at rest. Serum samples were prepared by centrifugation of the whole blood at 1000×g for 10 min after incubation for 30 min at room temperature.
Lipidomics analysis
To examine the serum lipid profiles, liquid chromatography mass spectrometry (LC/MS)-based lipidomics analysis was performed. Lipid fractions of the serum samples (50uL) were extracted using 750 μl of methanol/chloroform (2:1) containing a 1 ppm internal standard (17:0-17:1-17:0 d5-TAG (Avanti Polar Lipids, Inc., Alabama, USA) and Octadecanoic-d35 acid (Larodan, Solna, Sweden) for positive and negative ion mode analysis, respectively). Lipid extracts were analyzed on an AB Sciex TripleTOF 4600 mass spectrometer combined with liquid chromatography (Shimadzu 20A, Shimadzu Corp., Kyoto, Japan) using a column for analysis (HSS-C18 2.11 × 50 mm 1.7 mm; Nihon Waters K.K., Tokyo, Japan). The binary solvent solutions were used as follows: solvent A containing methanol/acetonitrile/water (19:19:2) and solvent B containing isopropanol containing 0.1% acetic acid and 0.028% ammonia for positive ion mode. Solvent A containing 60% acetonitrile in water and solvent B containing 50% acetonitrile and 50% isopropanol containing 0.1% acetic acid and 0.028% ammonia for negative ion mode. Mass spectrometry was performed in the negative-ion mode for free fatty acids (FFA), PC, PE, and SM, and in positive-ion mode for TAG. Data were collected at a mass range of m/z (120-1200) and processed using software. Lipids were identified using an internal spectral library or with mass spectrometry.
Statistical analysis
Previous evidence indicates that there is difference in triacylglycerol levels in blood between men and women, because sex hormone such as estrogen affect lipid metabolism [11]. For these reasons, men and women were compared separately. Serum levels of lipid molecular species and participant characteristics parameter (age, height, weight, and BMI) in the young and elderly participants were compared by Student's unpaired t-tests. Differences with P values of less than 0.05 were considered significant.
Participant characteristics
There were differences in the average age and BMI between the young and elderly participants. In men and women, the BMI was significantly higher in elderly participants than in young participants (Table 1).
Lipidomics analysis
We performed lipidomics analysis by mass spectrometry to evaluate lipid molecular species and FFA in serum. As a result, we identified four lipid classes. A comparison of serum TAG levels between the young and elderly participants is shown in Fig. 1. Our mass spectrometry analysis revealed increases in the levels of multiple TAG molecular species in the serum of elderly men and women (Fig. 1). Serum levels of specific TAG molecular species were higher in elderly individuals than in young individuals. Differences in serum levels of specific TAG molecular species between the elderly and young individuals were observed in seven species in men and 24 species in women. We also examined whether serum phospholipids were affected by aging. Similar to TAG levels, serum levels of total ester-linked PC and phosphatidylethanolamine (PE) were increased by aging (Figs. 2 and 3). However, variations in ether-linked PC and PE molecular species were different from those in ester-linked PC and PE. Importantly, we found that serum levels of specific ether-linked PC and PE molecular species (e.g., PC O-36:4 and PE O-36:5) were lower in elderly individuals than in young individuals (Figs. 2 and 3).
We further studied whether serum levels of sphingomyelin (SM) molecular species differed with aging. Our results showed that there were no differences in SM molecular species levels between the elderly and young participants (Fig. 4).
We also examined whether serum FFA were affected by aging. Although we identified 20 FFA including long chain fatty acids (carbon chain length ≥ 12), serum levels of these FFA were not different between the elderly and young participants (Fig. 5).
Discussion
The roles of lipids in the development of chronic disease have been assessed in many previous studies [2]. In fact, lipid parameters such as FFA, TAG and SM are used as biomarkers for age-related diseases, including type 2 diabetes and cardiovascular disease [12,13]. Plasm and serum levels of FFAs are known to increase in obese patients and contribute to type 2 diabetes and several cardiovascular diseases. Importantly, higher levels of saturated fatty acids such as palmitate impair insulin signaling in skeletal muscle by induction of systemic lipotoxicity, with subsequent development of type 2 diabetes [14]. In addition, higher levels of polyunsaturated omega-6 fatty acids such as arachidonic acid may cause myocardial injury by induction of systemic inflammation, with subsequent development of cardiovascular disease [15]. This evidence suggests that elevation of specific free fatty acids may play important roles in type 2 diabetes and cardiovascular diseases. However, in our study, mass spectrometry analysis showed there is no difference in the long-chain FFA including palmitate and arachidonic acid levels of healthy elderly people and young people. Interestingly, recent evidence has also revealed specific lipid molecules species associated with the risk of several diseases, such as type 2 diabetes, atherosclerosis, and cardiovascular disease [6][7][8][9][10]. Importantly, plasma or serum levels of specific TAG, PC, and SM molecular species are increased or decreased in patients with type 2 diabetes. Therefore, these lipid molecular species are thought to be beneficial as biomarkers for assessing the pathological status of type 2 diabetes. Aging is known to cause dyslipidemia, e.g., increased levels of total TAG and cholesterol in the blood [3]; however, the mechanisms associated with these aging-induced changes in lipid molecular species are not well understood. In this study, we investigated whether these lipid parameters were beneficial as biomarkers of aging by using lipidomics analysis to evaluate the aging-induced changes in the serum levels of lipid molecular species.
In this study, we identified the profiles of four lipid classes, TAG, PC, PE, and SM. Although TAGs containing saturated fatty acids undergo β-oxidation in the mitochondria, aging induces impaired activity of β-oxidation enzymes [16]. Palmitate is among these TAG molecular species and is known to cause glucose metabolic disorder by the impairment of insulin signaling in skeletal muscle cells and adipocytes [5]. A recent study reported that high levels of specific TAG molecular species, such as TAG 48:1, 50:0, and 52:1, are associated with an increased risk of type 2 diabetes [6]. Interestingly, we found that serum levels of these TAG molecular species (TAG 48:1, 50:0, and 52:1) were higher in elderly individuals than in young individuals. Importantly, several studies reported that high levels of specific TAG molecular species containing long-chain fatty acids are associated with an increased risk of cardiovascular disease [17,18]. In this study, we observed that serum levels of most TAG molecular species containing long-chain fatty acids differed between the elderly and young participants. These results indicate that increased blood levels of specific TAG molecular species, including saturated fatty acids such as palmitate, with aging may be associated with increased risk of type 2 diabetes and cardiovascular disease with aging.
Men Women
Glycerophospholipids, such as PC and PE, are structural components of the cell membrane. Importantly, phospholipids can be classified into ester-linked and ether-linked phospholipids. Ether-linked phospholipids have antioxidant activity and thereby exhibit protective effects on cells and tissues by mitigating oxidative stress [19]. Interestingly, low serum levels of ether-linked PC are associated with an increased risk of type 2 diabetes and hypertension [9,20]. Moreover, Meikle et al. reported that plasma levels of ether-linked PC are decreased in patients with cardiovascular disease. In this study, we found that aging induced alterations in the patterns of PC and PE molecular species. For example, we observed that some molecular species of ester-linked phospholipids were higher in elderly participants than in young participants. In contrast to ester-linked phospholipids, serum levels of ether-linked PC and PE molecular species (e.g., PC O-36:4 and PE O-36:5) were lower in elderly participants than in young participants. Differences in serum ether-linked phospholipid levels between the elderly and young individuals were observed in six men (four for PC and three for PE) and 12 women (nine for PC and three for PE). Taken together, our data reveal that the patterns of PC and PE molecular species differ among the elderly and young individuals. Thus, lower levels of ether-linked phospholipids in the elderly may reflect impaired antioxidant capacity and disease risk such as type 2 diabetes and cardiovascular disease. SM is a structural component of the cell membrane and has a role as a cellular messenger [21]. Interestingly, low levels of specific SM molecular species are linked to an increased risk of type 2 diabetes, cardiovascular disease and neurodegenerative disease [22,23]. In fact, Han et al. [24] reported that plasma levels of SM containing long-chain fatty acid are decreased in patients with Alzheimer's disease. Furthermore, low levels of specific SM molecular species (e.g., SM 32:1) have been observed in patients with type 2 diabetes [8,25]. Thus, characterization of SM molecular species has highlighted specific lipids underlying aging-related neurodegenerative and metabolic diseases. In this study, we found that there were no differences in the serum levels of SM molecular species between the young and elderly participants. Thus, these results suggest that the levels of SM molecular species in the serum may not be affected by age.
A limitation of this study was that it did not reveal whether aging caused changes in fatty acid composition in lipid class. Recent evidence indicates that alterations in the fatty acid composition of lipids may be an important factor that modulates physiological function such as insulin action [5,26]. Future studies should investigate changes in fatty acid composition by aging using tandem mass spectrometry (MS/MS) platform for identifying incorporated fatty acids in lipid class.
There were significant differences in the lipid profiles between young and elderly participants. However, the mechanisms through which lipid molecular species patterns are altered by aging are still unclear. Interestingly, [10] reported that plasma levels of multiple TAG molecular species are higher in obese individuals. In contrast, the ratio of ether-linked phospholipids to ester-linked phospholipids is lower in obese individuals [10]. Another study has also shown that serum levels of ether-linked phospholipids are decreased in obese individuals compared with those in lean participants [9]. Moreover, Colas et al. [20] found that the ratio of ether-linked phospholipids to ester-linked phospholipids is negatively correlated with waist circumference. These data indicate that lipid profiles may be altered by obesity. In this study, the elderly participants had significantly higher BMIs than young participants of either sex. Importantly, we also found that the levels of total ether-linked PC in the serum of elderly were negatively correlated with the BMI (r = − 0.349, P < 0.05, data not shown). In contrast, we also observed that the levels of total ester-linked PC in the serum of elderly were correlated with the BMI (r = 0.337, P < 0.05, data not shown). These results suggest that differences in BMIs between the young and elderly participants may affect lipid profiles, including lipid molecular species patterns.
Although physical activity decreases with age, the risk of dyslipidemia in relation to the level of physical activity is known to increased [27]. In fact, a previous report demonstrated that the amount of physical activity in older individuals is negatively correlated with the BMI and blood levels of triglycerides and cholesterol [28]. Thus, these studies suggest that increased levels of physical activity may improve lipid profiles; however, the effects of physical activity on lipid molecular species patterns are unknown. Additional studies are required to elucidate the combined or independent effects of physical activity on decreasing BMIs and on changes in lipid profiles, including alterations in lipid molecular species patterns.
Conclusion
Our results demonstrate the effects of aging on lipid profiles in the blood. Importantly, our study shows that specific lipid molecular species, such as ether-linked phospholipids, may be selectively altered by aging. Our findings suggest that these lipid molecular species may be used as indicators of aging. | v3-fos-license |
2019-05-04T13:04:42.698Z | 2019-04-01T00:00:00.000 | 142504002 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "http://www.cell.com/article/S2405844018358444/pdf",
"pdf_hash": "96af7192820b69c34e52fa71d980a8c5a77ba80d",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119790",
"s2fieldsofstudy": [
"Medicine"
],
"sha1": "96af7192820b69c34e52fa71d980a8c5a77ba80d",
"year": 2019
} | pes2o/s2orc | Primary teeth microhardness and lead (Pb) levels
Objectives Lead (Pb) exposure is associated with dental caries. Whether Pb affects tooth microhardness, is unclear. Our objective was to assess whether Pb concentration is associated with microhardness. Methods Exfoliated primary teeth were collected from 46 volunteers. Teeth were sectioned, one half of each tooth was tested for enamel Knoop microhardness. The remaining half was digested and Pb measured using an inductively coupled plasma-mass spectrometer. Results The correlations between Pb levels and microhardness were very low, and were not statistically significant at p < 0.05. Conclusions Previous exposure to high levels of Pb was not associated with decreased tooth microhardness. Clinical significance This study assessed whether Pb in deciduous teeth is associated with tooth microhardness. As this was not the case, further studies are needed to identify the mechanisms behind the association between lead exposure and tooth decay.
Introduction
Childhood caries are a significant public health problem in the United States [1], recognized as a top priority of the American Academy of Pediatrics [2]. Among US children aged 6e8 years, there are significant racial/ethnic and social disparities in the prevalence of decay in primary teeth: prevalences among Hispanics and African Americans (19.4% and 20.5%, respectively) are roughly double the prevalence among whites (10.1%) [3]; further, those whose parents have less education or lower incomes are more likely to have untreated tooth decay and loss [4,5]. Diet and dental hygiene in childhood, however, only partially explain disparities in early onset of childhood caries [6].
There have been several studies suggesting that environmental exposure to lead (Pb) also contributes to disparities in childhood caries, particularly in primary teeth [7,8,9,10,11,12,13]. A 2017 study of 1,564 Korean children showed that each mg/dL of blood Pb was associated with a 1.16 (95% CI: 0.91e1.49) greater prevalence of decayed, missing and filled surfaces in deciduous, but not permanent teeth, after adjustment for age, sex, mother's education, household income and urinary cotinine [7].
Further, in an Egyptian study of teeth from children and adults, Pb levels were higher in the teeth pulp from carious teeth (n ¼ 62) than healthy teeth (n ¼ 39) (77 versus 29 ppm, p ¼ 0.004). An analysis of children participating in the Third National Health and Nutrition Examination Survey (NHANES) estimated that among 5e17-year olds, 13.5% of dental caries occurring among children exposed to high lead levels and 9.6% of dental caries among children exposed to moderate lead levels, can be attributed to lead exposure [11].
One hypothesized mechanism for the association of Pb with dental caries focuses on the impact of Pb on dental enamel formation. Children exposed to Pb have higher salivary Pb levels [14]. Salivary Pb is incorporated in hydroxyapatite crystals substituting for calcium ions, leading to enamel hypoplasia, increased abrasion, and discoloration [15]. In an animal model, Knoop microhardness levels were inversely associated with lead exposure in regions of maturing dental enamel but not fully mature enamel [16]. Consistent with this finding, Ghadimi et al. did not find an association of Pb with microhardness, but showed that Pb concentration was associated with size of apatite nanocrystals in sound, extracted upper anterior teeth; whether the teeth were primary or permanent was not reported [17]. The current study directly addresses whether Pb concentration is associated with microhardness using 46 exfoliated deciduous (primary) teeth.
Tooth collection
Exfoliated primary teeth were collected from volunteers. Participants were instructed to note the approximate date of tooth loss, and to mail the teeth in pre-addressed, stamped envelopes to the Center for Craniofacial and Dental Genetics (CCDG) at the University of Pittsburgh. No personal identifying information was requested. Teeth were maintained dry by participants and researchers. Teeth were catalogued and examined for presence of tooth decay by a licensed dental hygienist. The study protocol was deemed exempt by the University of Pittsburgh Institutional Review Board.
Microhardness
All teeth were longitudinally sectioned in the buccal-lingual direction using a South Bay Technology, Inc. Model 650 Low Speed Diamond Wheel SawÔ at the University of Michigan Dental School. Teeth were sectioned in wax using a blade continuously running through deionized water. One section of each tooth was used for lead detection as described, below. Sections used for microhardness testing were progressively polished using 240 grit, 400 grit, 600 grit, and 1200 grit sandpaper for 90 seconds respectively. Enamel microhardness was measured using a Knoop microhardness tester. Measurements were made starting 20 mm from the dental enamel junction (DEJ) moving in 20 mm increments towards the enamel surface. The load was 50 grams for 10 seconds for each test. Each tooth's microhardness was measured in 3 series of measurements containing 10 readings each (Initial measurement 20 mm coronal of DEJ; final measurement 200 mm coronal of DEJ). Each new series of measurements was started 100 mm lateral to previous series.
Lead detection
The remaining section of each tooth (i.e. not prepared for microhardness testing) was digested to detect Pb levels, using modifications of the method described by Amr and Helal (2010) to meet equipment specifications, by the Trace Metals Unit at the Michigan Department of Health and Human Services, Bureau of Laboratories. The concentrations of Pb were optimized using a standard 193 lr solution at a concentration of 10 ppb in 2% HNO 3 . Following each measurement, tubes were cleaned using 2% HNO 3 . An ESI MicroFlow PFA-ST3-84 nebulizer was used for the inductively coupled plasma-mass spectrometer measurements.
Teeth were weighed, and then digested in 5 mL of HNO 3 using a CEM Discover SPD microwave digestion system. Three quality controls using certified material (low: 963.11, %CV 5.31; medium: 7622.08, %CV 5.18; and high: 13374.64, % CV 3.98, in ppb) were included at the beginning of each run right after the calibration curve before participant specimens were assessed.
Statistical analysis
We estimated the Pearson correlation between parts per billion of Pb and microhardness at 20, 40, 60, 200 micrometers and the overall average (measured in Knoop). To test whether mean Pb levels and tooth hardness varied by time we used a two sample t test.
Results
We collected 14 sound molars, 28 sound incisors, and 4 sound canines. Teeth were exfoliated between 1986 and 2017. The average Pb level was 736.7 ppbb, STD 1214.7, range 38.8e7355.5. There was no association between year exfoliated and microhardness (r ¼ À0.047; p ¼ 0.38) (Fig. 1a), but teeth exfoliated more recently had significantly lower Pb levels (r ¼ À0.71, p < 0.001), particularly those exfoliated after 1999 (mean 280.4 versus 2188.4 ppb) (Fig. 1b). Pb was banned from gasoline in the United States in 1990 so this is not entirely unexpected. However, since we could not rule out that storage might have been associated with lead exposure we analyzed the data including and removing teeth exfoliated prior to 2000, and the results were the same (data not shown).
The association between lead levels and microhardness varied little by where microhardness was measured (closest to the dental enamel junction or the tooth surface). Therefore, we present only the results using average microhardness.
However, the associations between lead levels and microhardness did vary slightly by tooth type. Fig. 2 shows the average microhardness for all microhardness measures by Pb levels for each tooth type. For molars and incisors, the correlations were very low (R 2 ¼ 0.0005 and R 2 ¼ 0.012, respectively) and neither were statistically significant at p < 0.05. There was a strong positive correlation between lead levels and microhardness for canine teeth at 200 mm from the dental enamel junction (R 2 ¼ 0.68), but the sample size was small (n ¼ 4), so although the result approached statistical significance (p ¼ 0.06) we cannot rule out an alpha error, particularly as the correlations between lead levels and microhardness for molars and incisors were low, inconsistent, and were not statistically significant despite a larger sample size. A reanalysis excluding teeth exfoliated prior to 2000 did not change the results.
Discussion & conclusion
In contrast to results from an animal model which suggested that Pb exposure during enamel formation results in decreased microhardness thus potentially increasing risk of dental decay, we found no association between Pb levels and tooth microhardness in 46 exfoliated human primary teeth. The Pb levels observed here are lower, but overlap in range to those reported in a 2010 Egyptian study of 64 healthy primary teeth, where the average levels were 1200 AE 840 ppb (range 340e4,010) [18]. This may be due to the relatively small sample size included in each study and differences in exposure between the United States and Egypt.
As both fluoride and Pb are incorporated in hydroxyapatite crystals (Pb substituting for calcium ions, fluoride for hydroxyls), it is possible that when both are present there may be interactions leading to increase or decrease in tooth decay depending on the relative concentrations. A limitation of our study is that we have no measure of fluoride levels. At least one animal study suggests there might be an interaction between fluoride and Pb resulting in changes in enamel defects. Wistar rats were assigned to water with 1) 0.1 ppm fluoride, 2) 100 ppm fluoride, 3) 30 ppm Pb, or 4) 100 ppm fluoride and 30 ppm Pb. Rats exposed to 100 ppm fluoride and 30 ppm Pb had significantly more severe enamel defects than those exposed to 100 ppm fluoride alone (p < 0.0001) [19]. However, in a study of desalivated Sprague-Dawley rats Fig. 1. A) Average microhardness (Knoop) and B) average Pb levels (parts per billion) by year tooth was exfoliated (n ¼ 46 sound primary teeth). Note: R 2 for Pb by year tooth was exfoliated after removing outlier is 0.69. exposed to 15 ppm fluoride and 10 or 25 ppm Pb, the protective effects of fluoride on dental decay did not change with Pb exposure [20]. In human studies, the association of Pb, fluoride exposure, and dental caries is largely unexplored. Thus, it remains an open question whether fluoride use mitigates the effects of Pb on dental caries. A second limitation of our study is we only measured overall Pb levels and cannot comment on the effects of Pb in different tooth structures on tooth hardness.
In conclusion, results from the current study do not suggest that Pb contamination leads to decreased tooth microhardness.
Declarations
Author contribution statement Carlos Gonzalez-Cabezas: Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data. | v3-fos-license |
2020-11-26T09:06:53.161Z | 2020-11-01T00:00:00.000 | 227167193 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/1420-3049/25/22/5452/pdf",
"pdf_hash": "3dc367547da2550e58eff4082ef18e50b47e1606",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119821",
"s2fieldsofstudy": [
"Biology"
],
"sha1": "b8b4b8f6cdb849ba5695f4eb0c48738b5f8b6d2f",
"year": 2020
} | pes2o/s2orc | Purification and Biochemical Characterization of a New Protease Inhibitor from Conyza dioscoridis with Antimicrobial, Antifungal and Cytotoxic Effects
The main objective of the current study was the extraction, purification, and biochemical characterization of a protein protease inhibitor from Conyza dioscoridis. Antimicrobial potential and cytotoxic effects were also examined. The protease inhibitor was extracted in 0.1 M phosphate buffer (pH 6–7). Then, the protease inhibitor, named PDInhibitor, was purified using ammonium sulfate precipitation followed by filtration through a Sephadex G-50 column and had an apparent molecular weight of 25 kDa. The N-terminal sequence of PDInhibitor showed a high level of identity with those of the Kunitz family. PDInhibitor was found to be active at pH values ranging from 5.0 to 11.0, with maximal activity at pH 9.0. It was also fully active at 50 °C and maintained 90% of its stability at over 55 °C. The thermostability of the PDInhibitor was clearly enhanced by CaCl2 and sorbitol, whereas the presence of Ca2+ and Zn2+ ions, Sodium taurodeoxycholate (NaTDC), Sodium dodecyl sulfate (SDS), Dithiothreitol (DTT), and β-ME dramatically improved the inhibitory activity. A remarkable affinity of the protease inhibitor with available important therapeutic proteases (elastase and trypsin) was observed. PDInhibitor also acted as a potent inhibitor of commercial proteases from Aspergillus oryzae and of Proteinase K. The inhibitor displayed potent antimicrobial activity against gram+ and gram- bacteria and against fungal strains. Interestingly, PDInhibitor affected several human cancer cell lines, namely HCT-116, MDA-MB-231, and Lovo. Thus, it can be considered a potentially powerful therapeutic agent.
Extraction of Protease Inhibitor from C. dioscoridis, Solvent Optimization
Among a range of extraction solvents tested for improvement of protease inhibitor activity extracted from C. dioscoridis, the resulting soluble crude extracts prepared in 0.1 M phosphate buffer showed maximum protease inhibitor activity (83.3% ± 3.05) followed by those prepared in 15% sodium chloride (66.3% ± 4.1) ( Table 1). Much lower trypsin inhibitor activity was found with extracts prepared in distilled water, HCl and NaOH, with inhibition rates of 47.3% ± 2.5, 35% ± 3.6, and 18.6% ± 3.5, respectively.
Purification of Protease Inhibitor from C. dioscoridis (PDInhibitor)
PDInhibitor was purified successively from soluble crude extracts prepared in phosphate buffer by the procedure described in the Materials and Methods. The purification flow sheet is summarized in Table 2. One unit of protease inhibitor activity was defined as a decrease by one unit in absorbance of TCA soluble casein hydrolysis product liberated by trypsin action at 280 nm per minute under the assay conditions. b Proteins were estimated using the Bradford method [21]. The experiments were conducted three times. Figure 1A shows the elution profile after gel filtration through a Sephadex G-50 column (2 × 100 cm) equilibrated with 0.1 M Tris HCL buffer, pH 8, containing 0.2 M NaCl. The column was eluted at 4 • C with the same solution at a flow rate of 30 mL/hand, and 4.0 mL fractions were collected. The fractions exhibiting PDInhibitor activity emerged in a single peak between 1.5 and 2 void volumes ( Figure 1A). After the three purification steps, PDInhibitor was purified 76.7-fold, with a recovery of 26%. It showed a specific activity of 1189.1 PIU/mg. The active fractions exhibiting protease inhibitor activity were pooled and analyzed via SDS-PAGE under reducing conditions ( Figure 1B). The figure shows that PDInhibitor is homogenously pure and has an apparent molecular mass of approximately 25 kDa. A reversed-phase analytical HPLC eurospher 100, C-8 column (250 × 4.6 mm) showed homogeneity of the identified inhibitor. The column was equilibrated with 0.1% TFA in water and protein elution was performed with an acetonitrile linear gradient (0-100%) ( Figure 1C).
Effect of pH and Temperature on PDInhibitor Activity and Stability
The effects of pH on PDInhibitor activity and stability were examined. As shown in Figure 3, the maximum protease inhibitor activity was obtained at pH 9 (87% ± 1.1% inhibition). Nearly the same activity levels were observed at pH 8 and 10, with 81% and 83% activity, respectively (Figure 3a). The observed decrease in inhibitory activity under highly acidic conditions (pH 2.0-4.0) indicated denaturation of the protease inhibitor to reach 28% activity at pH 5. Interestingly, we noted that the purified protease inhibitor was highly stable at pH 7-10 ( Figure 3b). Moreover, the inhibitor maintained more than 48% of its activity at pH 11 for 12 h (Figure 3b).
The influence of temperature on the activity and stability of the purified protease inhibitor was assessed using a standard assay. The results shown in Figure 3c verify that purified PDInhibitor maintained activity at temperatures ranging from 20 to 60 • C, with maximal protease inhibition activity of 86% ± 2 at 50 • C. Interestingly, the protease inhibitor activity was preserved over a wide range of temperatures, even under extreme conditions, with more than 50% of the PDInhibitor activity being conserved at 70 • C (Figure 3d). A reversed-phase analytical HPLC on C-8 column. A reverse phase RP-HPLC eurospher 100, C-8 column (250 × 4.6 mm), was equilibrated with 0.1% TFA in water. Protein elution was performed with an acetonitrile linear gradient (0-100%) at a flow rate of 1 mL/min over 60 min. 20µL of PDInhibitor (1 mg/mL) was used. A reverse phase RP-HPLC eurospher 100, C-8 column (250 × 4.6 mm), was equilibrated with 0.1% TFA in water. Protein elution was performed with an acetonitrile linear gradient (0-100%) at a flow rate of 1 mL/min over 60 min. 20µL of PDInhibitor (1 mg/mL) was used. The effects of pH on PDInhibitor activity and stability were examined. As shown in Figure 3, the maximum protease inhibitor activity was obtained at pH 9 (87% ± 1.1% inhibition). Nearly the same activity levels were observed at pH 8 and 10, with 81% and 83% activity, respectively ( Figure 3a). The observed decrease in inhibitory activity under highly acidic conditions (pH 2.0-4.0) indicated denaturation of the protease inhibitor to reach 28% activity at pH 5. Interestingly, we noted that the purified protease inhibitor was highly stable at pH 7-10 ( Figure 3b). Moreover, the inhibitor maintained more than 48% of its activity at pH 11 for 12 h (Figure 3b).
Effect of pH and Temperature on PDInhibitor Activity and Stability
The effects of pH on PDInhibitor activity and stability were examined. As shown in Figure 3, the maximum protease inhibitor activity was obtained at pH 9 (87% ± 1.1% inhibition). Nearly the same activity levels were observed at pH 8 and 10, with 81% and 83% activity, respectively ( Figure 3a). The observed decrease in inhibitory activity under highly acidic conditions (pH 2.0-4.0) indicated denaturation of the protease inhibitor to reach 28% activity at pH 5. Interestingly, we noted that the purified protease inhibitor was highly stable at pH 7-10 ( Figure 3b). Moreover, the inhibitor maintained more than 48% of its activity at pH 11 for 12 h (Figure 3b). Effect of pH and temperature on PDInhibitor activity: Effect of pH on PDInhibitor activity (a) and stability (b). Inhibitor activity was assayed against trypsin at various pH values. For stability studies, the protease inhibitor was incubated in medium with different pH values for 12 h and assayed for residual inhibitor activity under standard conditions. Effect of temperature on PDInhibitor activity (c) and stability (d). Inhibitor activity was assayed against trypsin at various temperatures. For stability studies, the protease inhibitor was incubated at different temperatures, drawn at various time intervals and assayed for residual inhibitor activity under optimal pH and temperature conditions. The data shown are the mean ± SD (n = 3).
Influence of Stabilizers on PDInhibitor Thermo-Stability
The thermal stability of protease inhibitors is essential for biotechnological applications, and it is thought to be affected by stabilizer additives. Thus, thermal stability at 70 • C was studied in the presence of several additives, such as BSA, CaCl 2 , urea, glycerol, glycine, PEG 8000, sorbitol, and casein. Inhibitor activity in the absence of stabilizer was used as a control. Purified PDInhibitor showed thermal stability and inhibitory activity in the presence of all the stabilizers except urea, PEG 8000, and cysteine. (Figure 4). Therefore, maximum stability was promoted as follows: 10 mM CaCl 2 (86% inhibition) > BSA (70%) > sorbitol (68%) > starch (60%) > sucrose (50%). Glycerol and casein supported moderate thermal stability, with values of 38% and 28%, respectively. assessed using a standard assay. The results shown in Figure 3c verify that purified PDInhibitor maintained activity at temperatures ranging from 20 to 60 °C, with maximal protease inhibition activity of 86% ± 2 at 50 °C. Interestingly, the protease inhibitor activity was preserved over a wide range of temperatures, even under extreme conditions, with more than 50% of the PDInhibitor activity being conserved at 70 °C ( Figure 3d).
Influence of Stabilizers on PDInhibitor Thermo-Stability
The thermal stability of protease inhibitors is essential for biotechnological applications, and it is thought to be affected by stabilizer additives. Thus, thermal stability at 70 °C was studied in the presence of several additives, such as BSA, CaCl2, urea, glycerol, glycine, PEG 8000, sorbitol, and casein. Inhibitor activity in the absence of stabilizer was used as a control. Purified PDInhibitor showed thermal stability and inhibitory activity in the presence of all the stabilizers except urea, PEG 8000, and cysteine. (Figure 4). Therefore, maximum stability was promoted as follows: 10 mM CaCl2 (86% inhibition) > BSA (70%) > sorbitol (68%) > starch (60%) > sucrose (50%). Glycerol and casein supported moderate thermal stability, with values of 38% and 28%, respectively.
Effect of Various Metal Ions on Protease Inhibitor Activity
Monovalent and divalent metal ions play a crucial role in maintaining the structural integrity of the secondary and tertiary structure of cysteine protease inhibitors. Protease inhibitor activity was studied in the presence of 1 and 10 mM concentrations of metal ions. Inhibitory activity measured in the absence of metal ions was considered 100% and taken as a control. Figure 5 shows that the divalent metal ions Ca 2+ and Hg 2+ at 1 mM enhanced residual protease inhibitor activity only up to a marginal level (115 and 125%, respectively). However, the presence of Mg 2+ and Zn 2+ at 10 mM improved PDInhibitor inhibitory activity by up to 204 and 177%, respectively, compared to the residual activity of the control. In contrast, the divalent ions Cd 2+ , Co 2+ and Mn 2+ at 10 mM reduced the inhibitor activity by up to 50%, 38%, and 22%, respectively. divalent metal ions Ca 2+ and Hg 2+ at 1 mM enhanced residual protease inhibitor activity only up to a marginal level (115 and 125%, respectively). However, the presence of Mg 2+ and Zn 2+ at 10 mM improved PDInhibitor inhibitory activity by up to 204 and 177%, respectively, compared to the residual activity of the control. In contrast, the divalent ions Cd 2+ , Co 2+ and Mn 2+ at 10 mM reduced the inhibitor activity by up to 50%, 38%, and 22%, respectively.
Effect of various Reducing/Oxidizing Agents and Surfactants on PDInhibitor Activity
Among the ionic and nonionic surfactants tested, only SDS and NaTDC activated the purified protease inhibitor by 141% and 193%, respectively. However, the inhibitor protein maintained more than 80% of its initial activity in the presence of Tween 20 and 64% in the presence of Tween 80 and Tween-X100 compared to the control. (Table 3). Oxidizing agents, such as H2O2, NaOCl and DMSO, induced a decrease in PDInhibitor activity with an increase in the concentration of the oxidizing agents. DMSO was found to moderately preserve stability at 1% and 2% DMSO, with 89% and 53% inhibitory activity, respectively. The presence of 1% and 2% H2O2 did not strongly affect the inhibitor activity, and we noted 58% and 40% inhibitor activity, respectively. Beyond 2%, a significant decrease in the inhibitory activity to 18% and 8% was noted at H2O2 (v/v) concentrations of 3% and 4%, respectively. Furthermore, the effect of reducing agents (0.2-1%) on the activity of the protease inhibitor was studied, and the results are presented in Table 2. Both DTT and βME were found to improve the activity of the protease inhibitor. Indeed, the inhibitory activity was strongly increased from 7% to 60% along with a corresponding increase in the concentration of DTT from 0.2% to 1%. Nearly the same behavior was observed in the presence of the reducing agent βME at 0.2% and 1% concentrations, with an increase in the inhibitory activity of 3% and 67%, respectively.
Effect of various Reducing/Oxidizing Agents and Surfactants on PDInhibitor Activity
Among the ionic and nonionic surfactants tested, only SDS and NaTDC activated the purified protease inhibitor by 141% and 193%, respectively. However, the inhibitor protein maintained more than 80% of its initial activity in the presence of Tween 20 and 64% in the presence of Tween 80 and Tween-X100 compared to the control. (Table 3). Oxidizing agents, such as H 2 O 2, NaOCl and DMSO, induced a decrease in PDInhibitor activity with an increase in the concentration of the oxidizing agents. DMSO was found to moderately preserve stability at 1% and 2% DMSO, with 89% and 53% inhibitory activity, respectively. The presence of 1% and 2% H 2 O 2 did not strongly affect the inhibitor activity, and we noted 58% and 40% inhibitor activity, respectively. Beyond 2%, a significant decrease in the inhibitory activity to 18% and 8% was noted at H 2 O 2 (v/v) concentrations of 3% and 4%, respectively. Furthermore, the effect of reducing agents (0.2-1%) on the activity of the protease inhibitor was studied, and the results are presented in Table 2. Both DTT and βME were found to improve the activity of the protease inhibitor. Indeed, the inhibitory activity was strongly increased from 7% to 60% along with a corresponding increase in the concentration of DTT from 0.2% to 1%. Nearly the same behavior was observed in the presence of the reducing agent βME at 0.2% and 1% concentrations, with an increase in the inhibitory activity of 3% and 67%, respectively. The results are the relative protease inhibitor activity expressed as a percentage of the maximum activity recorded without the addition of compound. Data are the mean ± SD (n = 3).
Effect of PDInhibitor on Available Important Therapeutic and Commercial Proteases
We first measured the effect of the purified protease inhibitor from C. dioscoridis on several important therapeutic proteases, such as cathepsin, elastase, and thrombin. It was noted from the results presented in Figure 6, that purified PDInhibitor seems to possess the highest affinity toward elastase (94% inhibitory activity), followed by trypsin and chymotrypsin (82% and 78%, respectively). Overall, the same inhibitory effect was observed with chymotrypsin, collagenase, and thrombin (79%, 78% and 73%, respectively). Moreover, the protease inhibitor exhibited much less affinity toward pepsin and espase (42% and 27%, respectively). Next, the effect of PDInhibitor on six industrially important proteases was investigated. Visibly, the data presented in Figure 6 show that the commercial protease obtained from Aspergillus oryzae (81% inhibition) was dramatically inhibited by the C. disocoridis protease inhibitor. In addition, proteinase K and proteases from Bacillus licheniformis and Bacillus sp. possess comparative inhibitory activity when incubated with PDInhibitor (71%, 66% and 64%, respectively). The lowest inhibitory effect was found against esperase (26%).
Antimicrobial Activity of the Purified PDInhibitor
Antimicrobial assays of the purified inhibitor from C. dioscoridis were carried out separately against bacterial (gram+ and gram− bacteria) and fungal strains. The bactericidal effect was analyzed by measuring the zone inhibition diameter resulting from the anti-proteolytic action of the inhibitor against bacteria. The IC50% values presented in Figure 7a demonstrate that PDInhibitor possesses potent bactericidal effects against E. coli (ATCC 25966) and Bacteroides fragilis (ATCC 25285), with IC50% values of 13 µg/mL and 13.4 µg/mL, respectively. The tested protease inhibitor was found to be effective against both gram+ and gram− bacteria, and the activity trend was as follows: E. faecalis (14 µg/mL) > S. enteric (14.8 µg/mL) > K. pneumonia (17.3 µg/mL) > B. cereus (19 µg/mL) and S. epidermidis (20 µg/mL) strains.
Antimicrobial Activity of the Purified PDInhibitor
Antimicrobial assays of the purified inhibitor from C. dioscoridis were carried out separately against bacterial (gram+ and gram− bacteria) and fungal strains. The bactericidal effect was analyzed by measuring the zone inhibition diameter resulting from the anti-proteolytic action of the inhibitor against bacteria. The IC50% values presented in Figure 7a demonstrate that PDInhibitor possesses potent bactericidal effects against E. coli (ATCC 25966) and Bacteroides fragilis (ATCC 25285), with IC50% values of 13 µg/mL and 13.4 µg/mL, respectively. The tested protease inhibitor was found to be effective against both gram+ and gram− bacteria, and the activity trend was as follows: E. faecalis (14 µg/mL) > S. enteric (14.8 µg/mL) > K. pneumonia (17.3 µg/mL) > B. cereus (19 µg/mL) and S. epidermidis (20 µg/mL) strains.
In addition, an antifungal assay of the purified inhibitor was carried out against A. niger, B. cinerea, F. solani and P. digitatum strains by measuring the zone of inhibition observed after inoculation of fungi with the purified PDInhibitor in Sabouraud dextrose agar medium and determination of the IC50% values. Figure 7b shows that the highest antifungal effect was observed against B. cinerea, with an IC50% value of 4.05 µg/mL, and against A. niger (IC50% 4.7 µg/mL), while the least activity was observed against P. digitatum (IC50% 6.7 µg/mL) and F. solani (IC50% 14 µg/mL).
Cytotoxicity of Protease Inhibitors from C. dioscoridis and from Rhamnus Frangula
The cytotoxic effect of the purified PDInhibitor on three different human cell lines (MDA-MB-231, HCT-116, and Lovo) was investigated using MTT assays.
Protease inhibitors at concentrations ranging from 25 to 200 µg/mL were incubated with the appropriate cells in each well for 24 h. When we first measured the cytotoxic effect of protease inhibitors on the human MDA-MB-231 cell line, we noticed that cell viability was strongly affected when using crude or pure inhibitor from C. dioscoridis and reached 10.25% and 21%, respectively (at a concentration of 200 µg/mL). However, viability was slightly affected (50%) when the cells were treated with the same amount of pure protease inhibitor from Rhamnus Frangula [24], taken as a control (Figure 8a). Likewise, HCT-116 human cell line viability was affected in the same way and reached 5%, 11% and 27% after pretreatment with crude and pure inhibitor from C. disocoridis and from Rhamnus Frangula, respectively. (Figure 8b). Finally, the percentage of viable Lovo cells in treatment medium containing either protease inhibitor from C. disocoridis or from Rhamnus Frangula was moderately affected compared to the MDA-MB-231 and HCT-116 cell lines. Indeed, cell viability reached 19%, 24% and 52% after treatment with crude or pure inhibitor from C. disocoridis and inhibitor from Rhamnus Frangula, respectively (Figure 8c). It is worth noticing that the protease inhibitor did not show any effect on the viability of human umbilical vein endothelial cells (HUVEC) after 72 h at concentrations ranging from 25 to 200 µg/mL, using the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Figure 8d).
Antimicrobial Activity of the Purified PDInhibitor
Antimicrobial assays of the purified inhibitor from C. dioscoridis were carried out separately against bacterial (gram+ and gram− bacteria) and fungal strains. The bactericidal effect was analyzed by measuring the zone inhibition diameter resulting from the anti-proteolytic action of the inhibitor against bacteria. The IC50% values presented in Figure 7a demonstrate that PDInhibitor possesses potent bactericidal effects against E. coli (ATCC 25966) and Bacteroides fragilis (ATCC 25285), with IC50% values of 13 µg/mL and 13.4 µg/mL, respectively. The tested protease inhibitor was found to be effective against both gram+ and gram− bacteria, and the activity trend was as follows: E. faecalis (14 µg/mL) > S. enteric (14.8 The bactericidal effect was assessed by measuring the protease inhibitor concentration necessary to kill 50% of the initial inoculum (IC50%), which was deduced from curves obtained from three independent experiments. Ampicillin was used as the positive reference standard, and acetate buffer was used as the negative control. (b): Antifungal properties of the purified protease inhibitor PDInhibitor. The antifungal properties of PDInhibitor were evaluated against several fungal strains. The fungicidal effect was assessed by measuring the protease inhibitor concentration necessary to kill 50% of the initial inoculum (IC50%), which was deduced from curves obtained from three independent experiments. Cycloheximide was used as the positive reference standard, and acetate buffer was used as the negative control.
In addition, an antifungal assay of the purified inhibitor was carried out against A. niger, B. cinerea, F. solani and P. digitatum strains by measuring the zone of inhibition observed after inoculation of fungi with the purified PDInhibitor in Sabouraud dextrose agar medium and determination of the IC50% values. Figure 7b shows that the highest antifungal effect was observed against B. cinerea, with an IC50% value of 4.05 µg/mL, and against A. niger (IC50% 4.7 µg/mL), while the least activity was observed against P. digitatum (IC50% 6.7 µg/mL) and F. solani (IC50% 14 The bactericidal effect was assessed by measuring the protease inhibitor concentration necessary to kill 50% of the initial inoculum (IC50%), which was deduced from curves obtained from three independent experiments. Ampicillin was used as the positive reference standard, and acetate buffer was used as the negative control. (b): Antifungal properties of the purified protease inhibitor PDInhibitor. The antifungal properties of PDInhibitor were evaluated against several fungal strains. The fungicidal effect was assessed by measuring the protease inhibitor concentration necessary to kill 50% of the initial inoculum (IC50%), which was deduced from curves obtained from three independent experiments. Cycloheximide was used as the positive reference standard, and acetate buffer was used as the negative control. inhibitor from Rhamnus Frangula, respectively (Figure 8c). It is worth noticing that the protease inhibitor did not show any effect on the viability of human umbilical vein endothelial cells (HUVEC) after 72 h at concentrations ranging from 25 to 200 µg/mL, using the MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyltetrazolium bromide) assay (Figure 8d).
Discussion
Protease inhibitors are small molecules with molecular masses ranging from 5-25 kDa. [25]. They are found in different living organisms (eukaryotes, prokaryotes, and viruses) [26] and compose a large and diverse family of protease inhibitors [27]. Protease inhibitors act as protective proteins and have aroused great interest in medicine and biotechnology due to their ability to treat immune and inflammation-related diseases, emphysema, arthritis, pancreatitis, and AIDS [28]. Currently, identification of new protease inhibitors from plants is on the rise. Herein, we show extraction, purification, and biochemical characterization of a new protease inhibitor from C. dioscoridis. The antimicrobial effect of the inhibitor and its cytotoxicity were also studied.
It is well established that the extraction medium is crucial and improves complete extraction of biomolecules from any desired source. Thus, a variety of solvents were tested for extracting the protease inhibitor from C. disocoridis. Extracts prepared with 0.1 M phosphate buffer were much better than those prepared from the other tested solvents because the protease inhibitor activity was maximal (83% ± 3). In fact, several previous studies have shown that 0.1 M phosphate buffer (pH 7.6)
Discussion
Protease inhibitors are small molecules with molecular masses ranging from 5-25 kDa. [25]. They are found in different living organisms (eukaryotes, prokaryotes, and viruses) [26] and compose a large and diverse family of protease inhibitors [27]. Protease inhibitors act as protective proteins and have aroused great interest in medicine and biotechnology due to their ability to treat immune and inflammation-related diseases, emphysema, arthritis, pancreatitis, and AIDS [28]. Currently, identification of new protease inhibitors from plants is on the rise. Herein, we show extraction, purification, and biochemical characterization of a new protease inhibitor from C. dioscoridis. The antimicrobial effect of the inhibitor and its cytotoxicity were also studied.
It is well established that the extraction medium is crucial and improves complete extraction of biomolecules from any desired source. Thus, a variety of solvents were tested for extracting the protease inhibitor from C. disocoridis. Extracts prepared with 0.1 M phosphate buffer were much better than those prepared from the other tested solvents because the protease inhibitor activity was maximal (83% ± 3). In fact, several previous studies have shown that 0.1 M phosphate buffer (pH 7.6) allows a high amount of trypsin inhibitor activity from Cajanus cajan seeds [29]. After purification of the protease inhibitor, SDS-PAGE analysis of the obtained fractions clearly indicated that the protease inhibitor (named PDInhibitor) possesses a molecular mass of approximately 25 kDa, suggesting that the purified inhibitor protein belongs to the serine protease inhibitor family, characterized by a molecular mass ranging from 18 to 26 kDa [30]. Therefore, a reversed-phase analytical HPLC eurospher 100, C-8 column (250 × 4.6 mm) showed homogeneity of the identified inhibitor. The N-terminal sequence of PDInhibitor showed a high level of identity with those of the Kunitz family [30,31]. In fact, 79% identity was observed with Kunitz trypsin inhibitor A and Kunitz trypsin inhibitor 3, with accession numbers AAF65315.1 and P01070.2, respectively. Moreover, the protease inhibitor was found to be stable in a large pH range, which is an encouraging and interesting characteristic that can be exploited in biotechnological and pharmaceutical industries. The inhibitor was found to be active at pH values ranging from 5.0 to 11.0, with maximal activity at pH 9.0 (87% inhibition). Similar results confirmed that protease inhibitors in the Kunitz family are stable in alkaline pH but lose their full activity at pH values less than 5 [8,32]. In fact, acidic pH extremes seem to affect binding of the inhibitor to the protease. Therefore, some studied inhibitors from the Kunitz family are very sensitive to acidic pH but are stable in the alkaline pH range [32]. Thus, one can conclude that pH affects the activity, structural stability, and solubility of protease inhibitors. Interestingly, PDInhibitor was found to be fully active at 50 • C and maintained 90% of its stability at over 55 • C. Thermal stability is considered an interesting and promising feature for protease inhibitors with potential as therapeutic drugs. Enhancement of the inhibition activity at higher temperatures leads to increases in the efficiency of the inhibitors [33]. Among stabilizer agents, osmolytes (salts, polyols, and amino acids) are known to protect proteins against thermal inactivation [34]. CaCl 2 (10 mM) was found to be the best stabilizer to support the thermal stability of purified PDInhibitor, followed by BSA (1%). These findings fit well with a previous work showing that, at an elevated temperature of 70 • C, CaCl 2 (92%) significantly improved thermal stability, followed by glycine (22%) and glycerol (39%). In fact, Ca 2+ ions improve the thermal stability of protease inhibitors [35]. Most likely, Ca 2+ ions affect the binding site of the inhibitor with the protease and protect the protein from structural denaturation at high temperature. To better characterize the pure inhibitor for potential use in therapeutic applications, the effect of oxidizing and reducing agents and surfactants on PDInhibitor was examined. All ionic and nonionic surfactants decreased the inhibitory activity except NaTDc and SDS. Indeed, in cell lysis, SDS and protease inhibitors are mixed to maximize the solubilization of biological materials. Remarkably, all the oxidizing agents decreased the protease inhibitor activity. This is possibly due to oxidation of the methionine located in the inhibitor protein reactive site according to Johnson et al. [36]. In fact, it has been reported in a previous work that oxidation of the inhibitor at key catalytic amino acid residues, such as methionine, results in loss of human alpha-1-proteinase inhibitor activity [36]. However, reducing agents (DTT and βME) enhanced the inhibitory activity of PDInhibitor. Bijina et al. [8] suggested that reducing agents affect the functional stability of Kunitz-type protease inhibitors by acting on intramolecular disulfide [30]. Interestingly, when we studied the effect of PDInhibitor on proteases with therapeutic importance, we noticed a remarkably strong affinity with elastase compared to the other proteases tested. In fact, elastase is involved in the pathogenesis of pulmonary emphysema and in inflammatory processes. Thus, the development of inhibitors of low molecular weight, specific for this enzyme and exhibiting good bioavailability, is an active field of academic research and pharmaceutical research. Otherwise, the affinity of purified PDInhibitor with industrially important proteases was much higher with commercially available proteases obtained from Aspergillus oryzae, followed by proteases from Bacillus sp. These results fit well with previous studies investigating protease inhibitors from Moringa oleifera [8]. The biological activities of protease inhibitors are of great interest, such as antibacterial and antifungal effects, especially in the case of pathogenic microorganisms or organisms that are resistant to certain antibiotics. Interestingly, our current results indicated that PDInhibitor was as effective as ampicillin against almost all bacterial strains tested and was particularly potent against E. coli. It has been reported that protease inhibitors belonging to the Kunitz family display antimicrobial effects against both gram+ and gram− bacteria, such as Salmonella typhimurium, Staphylococcus aureus, and Escherichia coli [37]. In addition, the antifungal effect of the purified protease inhibitor from C. disocoridis is attributed to its protective role against phytopathogenic strains [38]. It is well established that proteases are associated with many biological signaling pathways, and several diseases, such as cancer, HIV, infectious diseases, and diabetes, can be treated by inhibiting proteases [13,39]. In fact, protease inhibition has led to treatment of a number of diseases and successful production of many commercial drugs by pharmaceutical companies [40]. In recent years, protease inhibitors have been extensively examined as therapeutic agents, primarily to address various human cancers. Several plant protease inhibitors are under further in vitro evaluation in clinical trials [12]. The current study indicates that PDInhibitor presents very low toxicity in normal human cell lines but affects several human cancer cell lines: HCT-116, MDA-MB-231 and Lovo. The viability of MDA-MB-231 breast cancer, HCT-116 colorectal carcinoma and Lovo colon adenocarcinoma cells was significantly inhibited by pure protease inhibitor from C. dioscoridis at all concentrations tested (25-200 µg/mL), suggesting pharmacological effects of plant protease inhibitors (PPIs) in cancer prevention. Preclinical (in vitro) studies and pharmacological effects of plant protease inhibitors in disease prevention are well documented. In fact, a protease inhibitor from Bauhinia bauhinioides affected the viability of the human prostate cancer cell lines DU145 and PC3 (50-100 µM) [41]. In addition, PIs from Cicer arietinum (chickpea) inhibited the viability of MDA-MB-231 breast cancer cells and PC-3 and LNCaP prostate cancer cells (25-400 µg/mL) [42]. However, the current study is a very initial indication that PDInhibitor could have anti-carcinogenic capabilities given its effects on the proliferation of cancer cell lines, but this initial indication might justify more focused and elaborate assays. In addition, the main challenge in the fight against cancer is no doubt finding molecules able to act against pro-carcinogenic proteases and possessing anti-carcinogenic properties.
Materials
Five available proteases with therapeutic importance were used: pure elastase from human leukocytes
Extraction of Protease Inhibitors
Wild growing C. disocoridis plants were collected in Riyadh city in October 2018 (Kingdom of Saudi Arabia), washed, and air dried at room temperature. Then, PI extraction was performed after homogenizing 30 g of the plants in 100 mL of several solvents: 0.1 M phosphate buffer (pH 7.0), distilled water, 15% NaCl (w/v), 0.05 M HCl, and 0.2% NaOH (w/v). After 4 h of incubation at room temperature in a rotary shaker at 200 rpm, homogenates were filtered and then centrifuged (12,000 rpm, at 4 • C for 15 min) [29]. The resulting soluble crude extracts were assayed for protease inhibitor activity, and the extract that showed the highest activity was selected for further studies.
Protease Inhibitor Assays
According to the Kunitz method [30] a protease inhibitor assay was performed against trypsin. A 1 mL aliquot at a suitable extract sample dilution was mixed with an equal volume of trypsin (1000 U/mg) and preincubated at 37 • C (15 min). Next, 2 mL of casein (1%) was added. The obtained mixture was incubated for 30 min at 37 • C, and then, 2.5 mL of a 5% trichloroacetic acid (TCA) solution was added to stop the reaction. Finally, the absorbance was measured at 280 nm after centrifugation of the reaction mixture (12,000 rpm, 15 min). One unit of protease inhibitor activity (PIU) was defined as a decrease in absorbance at 280 nm of the TCA soluble casein hydrolysis product, liberated by the action of trypsin per minute under the standard assay conditions [30]. Appropriate controls (reaction without enzyme extract) were run for all assays. Tests were performed in triplicate. The protease inhibitor activity was also expressed as inhibition percentage which was determined by comparison with a control experiment for comparative purposes.
Purification of Protease Inhibitor from C. dioscoridis (PDInhibitor)
Purification of the protease inhibitor was carried out using a combination of ammonium sulfate fractionation (60-90%) precipitation, heat treatment (70 • C, 10 min) and chromatographic filtration using SephadexG-50 gel. The soluble crude extract from C. dioscoridis (80 mL, 21,000 PIU) was subjected to ammonium sulfate fractionation (60-90%). The resuspended precipitate obtained after centrifugation at 15,000 rpm for 30 min was subjected to a brief heat treatment at 70 • C for 10 min. The resulting sample exhibiting protease inhibitor activity was loaded on a Sephadex G-50 column (2 × 100 cm) equilibrated with buffer A (0.1 M tris HCl buffer, pH 8, containing 0.2 M NaCl). The column was eluted at 4 • C with the same solution at a flow rate of 30 mL/hand, and 4.0 mL fractions were collected. The pooled fractions were concentrated using Amicon ® stirred cells. The lyophilized PDInhibitor was dissolved in 100 mM phosphate buffer, pH 6.8, containing 150 M NaCl and loaded onto a size exclusion high performance liquid chromatography (HPLC) column (Bio-sil SEC-125, 300 mm × 7.8 mm) previously equilibrated with the same buffer. Elution was performed with the same buffer at 1 mL/min.
Protein Determination
Protein concentration was estimated according to the Bradford method (1976) using bovine serum albumin as a reference. The purified PI was analyzed via 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) as described by Laemmli [43].
Amino Acid Sequencing
The N-terminal sequence of pure PDInhibitor was determined by automated Edman's degradation using an Applied Biosystems Protein Sequencer Procise 492 equipped with a 140C HPLC system. The N-terminal sequencing was done by Prf. Hafedh mejdoub, sequencing unit life science department, FSS -Faculté des Sciences de Sfax. Sfax University.
Effect of pH and Temperature on PDInhibitor Activity and Stability
Buffers at pH values ranging from 3 to 13 were used to test the protease inhibitor activity at 37 • C. One percent of the casein substrate was prepared using the following buffers at 200 mM: sodium acetate buffer (pH 3-5), potassium phosphate buffer (pH 6-7), Tris-HCl buffer (pH 8-9), and glycine-NaOH buffer (pH 10-13). The pH stability of the PI was determined by incubating the protease (12 h at 4 • C) at various pH values ranging from 2 to 13. The residual protease inhibitor activity was determined under the standard assay method after centrifugation (12,000 rpm, 30 min). Measurements were performed in triplicate. In addition, the effect of temperature on protease inhibitor activity was determined by testing the enzyme activity at temperatures ranging from 20 to 70 • C at pH 7. Finally, to assess thermal stability, the protease inhibitor was incubated at temperatures ranging from 30-90 • C at pH 7 for 1 h. Residual activity was measured after centrifugation (30 min at 12,000 rpm) under the standard assay method.
Influence of Metal Ions on PDInhibitor Activity
Divalent ions (such as Ca 2+ , Cd 2+ , Co 2+ , Fe 2+ , Hg 2+ , Mg 2+ , Mn 2+ , and Zn 2+ ) were added to the reaction mixture at final concentrations of 1 and 10 mM. The influence of metal ions on protease inhibitor activity was tested after incubation at 37 • C for 1 h. Assays were performed under optimal conditions.
Effect of Reducing/Oxidizing Agents and Surfactants on PDInhibitor Activity
The effect of both reducing agents (β-mercaptoethanol (βME) and dithiothreitol (DTT) at concentrations ranging from 0.2 to 1% (v/v)) and oxidizing agents (hydrogen peroxide (H 2 O 2 ), dimethyl sulfoxide (DMSO) and sodium hypochlorite (NaOCl) at concentrations ranging from 1-5% (v/v)) on PDInhibitor activity was tested by incubating the appropriate agent with the protease inhibitor for 30 min. Residual activity was then measured. Moreover, in the same manner, the effect of nonionic and ionic surfactants (NaTDC, SDS, Triton X-100, Tween-80, and Tween-20) on PDInhibitor activity was tested by incubating the protease inhibitor with surfactant for 60 min. Residual activity was estimated in the mixture dialyzed against 0. 1 M phosphate buffer (pH 7).
Effect of PDInhibitor on Available Important Therapeutic and Commercial Proteases
The activities of five available proteases with therapeutic importance were determined according to previously reported protocols [44][45][46]. The enzyme inhibition using PDInhibitor (0.25 mg/mL) was determined after preincubation for 15 min, and then, the remaining enzyme activity was measured. PDInhibitor activity on the respective enzyme is expressed as percent inhibition. Then, the effect of the studied protease inhibitor on six available commercial proteases was measured in the same manner: the inhibitor (0.25 mg/mL) was incubated with the respective reaction mixture for 10 min. The residual enzyme activity is expressed as the inhibition percentage.
Antimicrobial Activity of PDInhibitor
The antibacterial and antifungal activities of the purified protease inhibitor were evaluated against the following gram-positive strains: Bacillus cereus (ATCC 14579), Bacillus subtilis (ATCC 6633), Enterococcus faecalis (ATCC 29122), Staphylococcus aureus (ATCC 25923), Staphylococcus epidermidis (ATCC 14990); gram negative strains: Salmonella enteric (ATCC 43972), Pseudomonas aeruginosa (ATCC 27853), Klebsiella pneumonia (ATCC 700603), and Escherichia coli (ATCC 25966); and fungal strains: Aspergillus niger, Botrytis cinerea, Fusarium solani and Penicillium digitatum. Bacterial viability was assessed by measuring the colony forming ability (CFU) of bacteria incubated in the absence or presence of the purified PDInhibitor. Initial mixtures containing both 2 × 10 7 CFU/mL in sterile brain heart infusion (BHI) and the purified PDInhibitor at the appropriate amount were incubated for 2 h under shaking at 37 • C. Moreover, to calculate bacterial viability, we performed a serial dilution into the culture medium before spreading colonies onto agar plates. Based on colony counting after incubation for 24 h and at 37 • C, the bactericidal effect of the purified PDInhibitor is expressed as the residual number of CFU. Thus, we calculated IC50% values (or half-maximal (50%) inhibitory concentrations) that correspond to the amount of protease inhibitor capable of killing 50% of the starting inoculums. The antifungal potency of the pure PDInhibitor was evaluated using the well diffusion method with Sabouraud dextrose agar. The protease inhibitor was placed in sterile paper discs deposited onto the center of the inoculated Petri dishes, and then, the dishes were incubated at 30 • C for 24 h. For further comparison, a positive control, cycloheximide (1 mg/mL), was used under the same conditions.
Cytotoxicity of Protease Inhibitors
Cell viability was investigated in HUVEC, HCT-116, Lovo, and MDA-MB-231 cells using different amounts of both crude and purified protease inhibitor from C. dioscoridis. Pure protease inhibitor from Rhamnus Frangula was also studied as a control. The cytotoxicity assay was performed using MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay, first described by Tim Mosmann in 1983 [47]. This colorimetric assay uses reduction of a yellow tetrazolium salt MTT to measure cellular metabolic activity as a proxy for cell viability. Viable cells contain NAD(P)H-dependent oxidoreductase enzymes which reduce the MTT reagent to formazan, an insoluble crystalline product with a deep purple color. Formazan crystals are then dissolved using a solubilizing solution and absorbance is measured at 500-600 nanometers using a plate-reader. Briefly, 4 × 10 4 cells (in each well) were incubated in 96-well plates at 37 • C for 24 h with various amounts of protease inhibitor samples diluted in culture medium. Addition of 20 µL of freshly prepared MTT (5 mg/mL in PBS) to the cells was followed by incubation at 37 • C for 4 h in a 5% CO 2 incubator. A volume of 180 µL of saline solution (50:50) was added to an equal volume of the preparation medium. To dissolve the formazan crystals formed, homogenization was performed using a plate shaker. The absorbance was measured at 550 nm using a micro plate reader. The cell viability results are expressed as a percentage of the OD values at 500 mm for protease inhibitor-treated cells relative to the control.
Conclusions
Conyza. dioscoridis is a source of bioactive compounds with many virtues. In the current study, the biological effects of protease inhibitors from C. dioscoridis are reported. The purified inhibitor was biochemically characterized as pH and temperature stable, and the effect of oxidizing and reducing agents and stabilizers was investigated. Our results indicate that the purified PDInhibitor is a potential protease inhibitor candidate with therapeutic importance in pharmaceutical industry applications due to its antibacterial, antifungal, and cytotoxic potential. Thus, C. disocoridis is an efficient source of protease inhibitors with high potential in biotechnological applications. | v3-fos-license |
2019-04-09T13:06:39.105Z | 2017-11-13T00:00:00.000 | 104106812 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "https://doi.org/10.1016/j.soilbio.2017.11.005",
"pdf_hash": "97eed31eb715ab22617525bd2516ef9a1f2e5f2d",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119861",
"s2fieldsofstudy": [
"Environmental Science"
],
"sha1": "ee85b249336edf40058e39380f274e67263128a4",
"year": 2017
} | pes2o/s2orc | Full 15N tracer accounting to revisit major assumptions of 15N isotope pool dilution approaches for gross nitrogen mineralization
The 15N isotope pool dilution (IPD) technique is the only available method for measuring gross ammonium (NH4+) production and consumption rates. Rapid consumption of the added 15N-NH4+ tracer is commonly observed, but the processes responsible for this consumption are not well understood. The primary objectives of this study were to determine the relative roles of biotic and abiotic processes in 15N-NH4+ sconsumption and to investigate the validity of one of the main assumptions of IPD experiments, i.e., that no reflux of the consumed 15N tracer occurs during the course of the experiments. We added a 15N-NH4+ tracer to live and sterile (autoclaved) soil using mineral topsoil from a beech forest and a grassland in Austria that differed in NH4+ concentrations and NH4+ consumption kinetics. We quantified both biotic tracer consumption (i.e. changes in the concentrations and 15N enrichments of NH4+, dissolved organic N (DON), NO3− and the microbial N pool) and abiotic tracer consumption (i.e., fixation by clay and/or humic substances). We achieved full recovery of the 15N tracer in both soils over the course of the 48 h incubation. For the forest soil, we found no rapid consumption of the 15N tracer, and the majority of tracer (78%) remained unconsumed at the end of the incubation period. In contrast, the grassland soil showed rapid 15N-NH4+ consumption immediately after tracer addition, which was largely due to both abiotic fixation (24%) and biotic processes, largely uptake by soil microbes (10%) and nitrification (13%). We found no evidence for reflux of 15N-NH4+ over the 48 h incubation period in either soil. Our study therefore shows that 15N tracer reflux during IPD experiments is negligible for incubation times of up to 48 h, even when rapid NH4+ consumption occurs. Such experiments are thus robust to the assumption that immobilized labeled N is not re–mobilized during the experimental period and does not impact calculations of gross N mineralization.
tracer is commonly observed, but the processes responsible for this consumption are not well understood. The primary objectives of this study were to determine the relative roles of biotic and abiotic processes in 15 N-NH 4 + sconsumption and to investigate the validity of one of the main assumptions of IPD experiments, i.e., that no reflux of the consumed 15 N tracer occurs during the course of the experiments. We added a 15 N-NH 4 + tracer to live and sterile (autoclaved) soil using mineral topsoil from a beech forest and a grassland in Austria that differed in NH 4 + concentrations and NH 4 + consumption kinetics. We quantified both biotic tracer consumption (i.e. changes in the concentrations and 15 N enrichments of NH 4 + , dissolved organic N (DON), NO 3 − and the microbial N pool) and abiotic tracer consumption (i.e., fixation by clay and/or humic substances). We achieved full recovery of the 15 N tracer in both soils over the course of the 48 h incubation. For the forest soil, we found no rapid consumption of the 15 N tracer, and the majority of tracer (78%) remained unconsumed at the end of the incubation period. In contrast, the grassland soil showed rapid 15 N-NH 4 + consumption immediately after tracer addition, which was largely due to both abiotic fixation (24%) and biotic processes, largely uptake by soil microbes (10%) and nitrification (13%). We found no evidence for reflux of 15 N-NH 4 + over the 48 h incubation period in either soil. Our study therefore shows that 15 N tracer reflux during IPD experiments is negligible for incubation times of up to 48 h, even when rapid NH 4 + consumption occurs. Such experiments are thus robust to the assumption that immobilized labeled N is not re-mobilized during the experimental period and does not impact calculations of gross N mineralization.
Introduction
Nitrogen (N), in its inorganic forms ammonium (NH 4 + ) and nitrate (NO 3 − ), is often considered to be the limiting nutrient for plants in terrestrial ecosystems (Falkowski et al., 2008). Primary production, nitrification and denitrification are controlled by the rates at which inorganic N is both produced via mineralization of organic N and biological N fixation and consumed by biotic and abiotic processes. The understanding of this continuous cycling between organic and inorganic nitrogen forms is therefore of fundamental importance for estimating plant-available N in agricultural and natural soil systems (Hadas et al., 1992;Vitousek et al., 2002;Ward, 2012). A powerful tool for the determination of soil N transformation processes is the isotope pool dilution (IPD) technique (Barraclough, 1991;Di et al., 2000;Kirkham and Bartholomew, 1954;Wanek et al., 2010), which allows to estimate both rates of gross production and gross consumption of major plant nutrients in soil. This technique has been used across a wide range of natural and agricultural systems to study N transformation rates in soil (e.g., Booth et al., 2005Booth et al., , 2006Hart et al., 1994;Murphy et al., 2003), and is particularly recognized as the recommended method to obtain estimates on soil N dynamics (Hart et al., 1994). Depending on tracer application approaches e.g. to intact soil-plant systems in situ or to sieved soils, plant mediated processes are included such as root uptake of inorganic N or tracer dynamics only reflect microbial processes such as in sieved soils (Murphy et al., 2003;Rütting et al., 2011).
The IPD approach relies on labeling the target pool, i.e. the product pool of the reaction to be measured, which in the case of N mineralization is the NH 4 + pool, with 15 N-enriched tracer ( 15 N-NH 4 + ). The isotopic tracer is then diluted as a consequence of mineralization of unlabeled organic N to NH 4 + . Gross N mineralization (i.e., NH 4 + production or influx) and gross NH 4 + consumption (i.e., NH 4 + efflux) are then calculated from the change in size of the total NH 4 + pool ( 14 N + 15 N), and from the decline in the 15 N enrichment above natural consumption rates (Barraclough and Puri, 1995;Bjarnason, 1988;Davidson et al., 1991). Rapid consumption of 15 N-NH 4 + has been reported by several studies (e.g. > 50% tracer loss within minutes), but it is not clear which consumption processes are involved or whether remobilization of the 15 N tracer is likely (Davidson et al., 1991;Kowalenko and Cameron, 1978;Morier et al., 2008). We here define all processes removing NH 4 + from the available NH 4 + pool as consumption processes, following the accepted terminology (Booth et al., 2005;Murphy et al., 2003), which can be further distinguished into biotic NH 4 + consumption (i.e., microbial uptake and nitrification; hereafter "immobilization") and abiotic NH 4 + consumption (i.e., fixation by the mineral or organic soil fraction; hereafter "fixation"). Biotic processes are often assumed to be the dominant consumptive processes in IPD experiments lasting for a few days (Monaghan and Barraclough, 1995;Morier et al., 2008;Trehan, 1996). Indeed, several authors have reported microbial uptake of inorganic and organic compounds within minutes and even seconds after tracer addition (Farrell et al., 2011;Hill et al., 2012;Jones et al., 2013;Tahovská et al., 2013;Wilkinson et al., 2014). Nevertheless, others have suggested abiotic fixation to be the main mechanism explaining rapid NH 4 + consumption (Davidson et al., 1991;Johnson et al., 2000;Trehan, 1996). In fact, NH 4 + fixation by clay minerals is known to occur within h after NH 4 + addition (Cavalli et al., 2015;Nieder et al., 2011;Nõmmik and Vahtras, 1982). Physical sorption or chemisorption to organic matter might also be responsible for the removal of 15 N-NH 4 + from the extractable N pool (Mortland and Wolcott, 1965;Nieder et al., 2011;Nõmmik and Vahtras, 1982). However, despite the potential for biotic and abiotic processes to rapidly consume 15 N-NH 4 + during IPD experiments, the sinks involved have not as yet been clearly quantified.
The objective of this study was to determine the fate of added 15 N-NH 4 + during the duration that 15 N-IPD experiments usually last (i.e., < 48 h) in two sieved soils that differ in their NH 4 + consumption rates. We considered all possible sources of tracer reflux to evaluate whether the requirement that consumed labeled N is not remobilized during the experimental duration of normal IPD experiments is valid. Additionally we investigated the constancy of transformation rates over time. We hypothesized that rapidly consumed 15 N tracer is mainly subjected to biotic (microbial) immobilization processes, that the 15 N tracer can therefore be remineralized or released during the incubation period, and that such reflux causes an underestimation of gross N mineralization fluxes in soils that exhibit rapid 15 N-NH 4 + consumption.
Sampling site and soil description
Soils were collected from two sites in Austria differing in vegetation composition and soil pH (Table 1). Top soils were sampled from a beech (Fagus sylvatica L.) forest (N 48.228656°, E 16.260713°, 382 m a.s.l., Schottenwald, Vienna) and from a permanent grassland (N 48.049063°, E 16.197592°, 323 m a.s.l., Mödling, Lower Austria). The soils are hereafter referred to as "forest" and "grassland" soil, respectively. The forest soil is classified as a dystric Cambisol (Kaiser et al., 2010) and the grassland soil as a Cambisol (Nestroy et al., 2011). Samples were taken from the upper 10 cm of the mineral soil (A) horizon in October 2014. The soil was sieved to 2 mm and stored at 4°C until experiments were performed. Soil pH was measured in 10 mM CaCl 2 . Total carbon (C) and N contents were measured in finely ground, oven dried (105°C, 24 h) soil using an elemental analyzer (EA1110, CE Instruments, Milan, IT) coupled to a continuous flow stable isotope ratio mass spectrometer (DeltaPLUS, Thermo Finnigan, Bremen, DE) (EA-IRMS). Soil ammonium contents were determined photometrically in 1 M KCl extracts [soil to extractant ratio of 1:7.5 (w:v)] based on the Berthelot reaction (Hood-Nowotny et al., 2010). Soil texture analysis was done based on a micropipette method modified from Miller and Miller (1987), by using 5% sodium hexametaphosphate as a dispergent.
The soils were selected because of their similarity in general soil properties, such as soil texture (silt loam) and C and N content, but they differed considerably in soil pH and available NH 4 + content (Table 1). Additionally, the soils strongly differed in their consumption of added 15 NH 4 + as determined in a preliminary tracer recovery experiment, in which both soils were labeled with 10 atom% ( 15 NH 4 + ) 2 SO 4 solution (20% of the initial NH 4 + pool) and after 15 min extracted with 0.5 M K 2 SO 4 [soil to extractant ratio of 1:7.5 (w:v)]. We found that 99% of the added 15 N tracer could be recovered as NH 4 + from the forest soil but only 41% from the grassland soil (Table 1).
Experimental design
The IPD assay was performed with two treatments, live (non--sterilized) and sterilized (autoclaved) soil, to distinguish between biotic immobilization processes and abiotic fixation ( Fig. 1). Five consecutive measurements of concentrations and isotopic composition of NH 4 + , NO 3 − , microbial biomass N (N mic ), and dissolved organic N (DON) were taken over the course of 48 h. To obtain high-resolution time kinetics of measured processes, we stopped incubations within 2-3 min (0 h), 0.25 h, 3.5 h, 24 h, and 48 h after tracer addition. We thereby accommodated the standard experimental duration suggested by Murphy et al. (2003) (i.e. t 1 : 4 h-24 h; t 2 48 h-144 h), with two additional early sampling points to track rapid consumptive processes. In addition, the contribution of abiotic fixation (i.e., fixation by clay and humic substances) was determined at two fixed time points (0 h and 24 h) in live soils ( Fig. 1).
Soil sample preparation and sterilization procedure
We adjusted the soils to approximately 50% water holding capacity (WHC) prior to the IPD experiment. Following this, 4 g of fresh soil was weighed into 50 mL glass vials (Crimp Top Headspace Vials, Supelco, US) and covered with Parafilm (live soils) and aluminum foil (soils to be autoclaved). The soils were prepared in triplicates for each time period, treatment (control or autoclaving) and extraction method (± chloroform). Part of the soil samples were sterilized by autoclaving twice at 121°C for 20 min (Wolf et al., 1989). Between the two autoclaving cycles, samples were incubated at 20°C for 2 days, to allow spores to germinate prior to the second autoclaving cycle. Two hours passed between the second autoclaving cycle and the start of the tracer experiment during which samples were allowed to cool to room temperature and the water content was checked gravimetrically.
Isotope pool dilution experiment
Shortly before the experiment, soil NH 4 + contents were determined in soil extracts [1 M KCl, soil to extractant ratio of 1:7.5 (w:v)], based on the Berthelot reaction (Hood-Nowotny et al., 2010). A maximum of 20% of the initial NH 4 + pool of live soils was added as 15 N-NH 4 + tracer solution at 10 atom%. This approach increased the product pool as little as possible (thus avoiding stimulation of microbial NH 4 + immobilization processes) whilst also ensuring sufficient enrichment of the NH 4 + pool with 15 N-NH 4 + to facilitate high measurement precision (Davidson et al., 1991;Di et al., 2000). We applied 400 μL tracer solution (0.5 mM and 0.1 mM ( 15 NH 4 ) 2 SO 4 for the forest and grassland soil, respectively) to each sample (4 g fresh weight) in multiple drops across the soil surface and mixed by shaking to achieve homogeneous labeling and a SWC of 70% WHC. The samples were then incubated at 20°C in the darkness for the given incubation periods.
The incubations were stopped by extraction with 30 mL 0.5 M K 2 SO 4 solution. The vials were capped with air tight butyl septa and crimp seals (Supelco, US), and shaken horizontally for 30 min at 150 rpm on an orbital shaker. Following extraction, all soil suspensions were gravity filtered through ashless Whatman filter papers. Filters were prerinsed with 0.5 M K 2 SO 4 and deionized water and dried in a drying oven at 60°C to avoid the variable NH 4 + contamination from the filter paper. All soil extracts and the extracted soil residues remaining in the filters (see below, determination of fixed N) were stored at -20°C for further analysis.
Determination of isotope ratios and concentrations of NH 4 + , NO 3 − , DON and microbial biomass N
Filtered extracts were analyzed for the concentration and isotopic composition of NH 4 + to calculate gross mineralization and consumption rates, and to estimate the recovery of added 15 NH 4 + over time. We prepared the extracts for isotope ratio mass spectrometry using a micro diffusion approach following Lachouani et al. (2010). Briefly, 10 mL aliquots of samples were diffused with 100 mg magnesium oxide (MgO) into teflon-coated acid traps for 48 h on an orbital shaker. The traps were dried and subjected to EA-IRMS for 15 N: 14 N analysis of NH 4 + .
Concentrations and N isotope ratios of NO 3 − in extracts were determined using a method that is based on the conversion of NO 3 − to NO 2 − with vanadium (III) chloride (VCl 3 ) and reduction of NO 2 − to N 2 O by sodium azide . Concentrations and N isotope ratios of the resulting N 2 O were determined by purge-and-trap isotope ratio mass spectrometry (PT-IRMS), using a Gasbench II headspace analyzer (Thermo Fisher, Bremen, DE) with a cryo-focusing unit, coupled to a Finnigan Delta V Advantage IRMS (Thermo Fisher, Bremen, DE).
Concentrations of DON were calculated from the difference between total dissolved N (TDN) and inorganic N (i.e., NH 4 + and NO 3 − ), and the N isotope ratio of DON was calculated using an isotopic mass balance equation (Fry, 2006). Determination of TDN was carried out by conversion of DON and NH 4 + to NO 3 − by alkaline persulfate oxidation (Cabrera and Beare, 1993;Doyle et al., 2004;Lachouani et al., 2010) and subsequent
Europe PMC Funders Author Manuscripts
Europe PMC Funders Author Manuscripts measurement of formed NO 3 − by the VCl 3 -azide method via PT-IRMS as described above.
Complete conversion of DON to NO 3 − was validated by the parallel digestion of 15 N labeled glycine standards (at different atom% 15 N), along with unlabeled glycine standards at different concentrations and blanks .
For determination of microbial biomass N (N mic ) we performed a simultaneous chloroform fumigation extraction (sCFE) method modified from Setia et al. (2012), thus avoiding relatively long fumigation periods used in the traditional CFE method (Brookes et al., 1985;Tate et al., 1988). For sCFE we carried out parallel soil labeling experiments and performed extractions with 30 mL 0.5 M K 2 SO 4 solution amended with 0.5 mL of EtOH-free CHCl 3 . N mic was calculated from the difference between TDN extracted by 0.5 M K 2 SO 4 with and without addition of liquid chloroform (Setia et al., 2012) and its isotope ratio using an isotopic mass balance equation (Fry, 2006). We did not apply a conversion factor (K EN ) to correct for non-extractable microbial N, such as N bound in cell walls (Brookes et al., 1985;Jenkinson et al., 2004) since assimilated 15 N is supposed to be still in relatively labile forms at least after one day of incubation (Davidson et al., 1991).
Determination of abiotic fixation in inorganic and organic nitrogen pools
Live soils from the sCFE approach, i.e., pre-extracted with chloroform-amended K 2 SO 4 solution can only hold 15 NH 4 + consumed by abiotic fixation since NH 4 + , NO 3 − , DON and labile N mic has already been extracted. We thus determined the total fixed N (TN fixed ) content and the isotopic composition for all live soil samples subjected to sCFE 0 h and 24 h after tracer addition. Frozen, pre-extracted live soil residues were homogenized with a spatula, weighed into 100 mg aliquots and washed with 1.5 mL ultrapure water (shaken for 15 min at 140 rpm) to eliminate any remaining extractant and extractable N. Following centrifugation (1500×g for 10 min), the supernatant was discarded and the remaining soil was dried at 60 °C for two days, ground, weighed into tin capsules and measured for N content and for N isotopic composition via EA-IRMS. We additionally analyzed a set of control soils that received no 15 N amendment using the same procedure to correct TNfixed for background 15 N levels.
We distinguished between 15 N fixed held within the clay lattice (i.e., the mineral fraction) and 15 N fixed held by the soil organic material following a standard extraction procedure for soil organic matter (Stevenson, 1994). Specifically, a second set of soil aliquots (100 mg) was washed with 1.5 mL ultrapure water, centrifuged, the supernatant decanted and 0.5 mL 0.5 M NaOH added to the soil at a ratio of 1:5 (soil:NaOH; Wolf et al., 1994). The soils were then extracted for 18 h (2 h in an ultrasonic bath, 16 h on an orbital shaker at 150 rpm) and centrifuged (1500×g for 10 min). Then a 50 μL aliquot of the supernatant (containing humic compounds) was pipetted into tin capsules, dried (60°C until dry) and measured for N content and N isotopic composition via EA-IRMS. Another set of unlabeled soil samples was treated as above and served as 15 N natural abundance blanks for calculations. After correcting for soil organic matter extraction efficiency (approximately 80%, Stevenson, 1994), we subtracted the 15 N recovery of humic substances from the 15 N recovery in TN fixed to obtain the 15 N recovery of 15 N fixed by the mineral fraction of the soil.
Data and statistical analyses
In order to investigate the fate of the 15 N tracer, we calculated the recovery rate of the added 15 N for all N pools as the total amount of 15 N recovered divided by the amount added (Hart et al., 1994). These calculations are based on atom percent excess (APE) values calculated for each pool as atom% 15 N of the sample minus the natural 15 N abundance in unlabeled control samples, and then APE divided by 100 and multiplied by the pool size.
We used linear models (LMs) to test for effects of sterilization, time, and their interaction on the recovery rates of the added tracer in different pools. Models were validated graphically and, where necessary, refined to account for unequal variance between levels of explanatory variables. We determined the significance of fixed effects using single term deletions combined with likelihood ratio tests (LR) followed by Tukey post-hoc tests. As tracer recovery from the N mic pool was not determined in sterilized soils, we only tested for the effect of time on the recovery rate from the N mic pool. Finally, we performed linear regressions of time against the natural logarithm of APE to investigate the constancy of process rates over time. Statistical analyses were performed in R (R Foundation for Statistical Computing, Vienna, 2011) using the packages "nlme" (Pinheiro et al., 2016) and "MASS" (Venables and Ripley, 2002).
The possible impact of 15 N reflux from the N mic pool on gross NH 4 + production rates was investigated in both soils using sensitivity analysis. Reflux rates of 15 N-NH 4 + of 10%, 20%, 50%, and 100% were simulated for the incubation period from 3.5 h to 24 h, which is considered to be an appropriate incubation time during isotope pool dilution experiments (Murphy et al., 2003). The initial NH 4 + concentrations and APE at t0 (3.5 h) were kept constant, but NH 4 + concentrations and APE at t1 (24 h) were recalculated for the different scenarios. We simulated reflux for the amount of 15 N-N mic , which was rapidly taken up by
Total 15 N recovery in labile and fixed N pools
We found complete 15 N recovery from live grassland and forest soils in the combined fixed and labile N pool, the labile N pool representing the sum of the extractable N pool (NH 4 + , NO 3 − and DON) plus the microbial N pool (Table 2). In live forest soils we recovered 108% (0 h) and 116% (24 h) in the fixed and labile N pool, while in live grassland soils total recoveries ranged between 111% (0 h) and 103% (24 h). Time had a significant effect on total 15 N recoveries in both soils (Table 2) but mean values were indistinguishable from 100%, given the large variance around the mean which arises from the propagation of measurement errors for concentration and atom% 15 N from six different pools that finally make up total 15 N recovered.
15 N recovery in labile N pools
We recovered 99-113% of added 15 N tracer from the labile N pool in the sterile and live forest soil over the 48 h incubation period ( Fig. 2A and B), being significantly higher in sterile than in live soils and decreasing slightly with time but only in live forest soils (Table 3). In the grassland soil, tracer recoveries in labile N in sterile soil were constant, ranging from an initial 100% at 0 h to 90% after 48 h, whereas in the live grassland soil 15 N recoveries in labile N decreased significantly from 87% at 0 h to 60% after 48 h (Fig. 2, Table 3).
In the forest soil, the 15 N recovery in the NH 4 + pool decreased in the live soil by approximately 6% at 24 h and 23% at 48 h while in the sterile soil the recovery only varied non-significantly between 95% and 102% (Fig. 2, Table 3). Concomitantly the tracer recovery in the NO 3 − pool increased from 0.3% (0 h) to 4% at 24 h and to 7.5% after 48 h in live forest soil while in the sterile forest soil the recovery rate remained low between 0.2% and 0.3%. We recovered between 0.3 and 3% in the DON pool of live forest soil and up to 19% in sterile forest soil. Sterilization increased the recovery rate of added 15 N in the DON pool, but the time course was similar in sterile and live soil samples (Fig. 2 recovery in microbial biomass was not measured in autoclaved soil, and decreased over time from 1.6 to 0.4% in live forest soil. In the live grassland soil, the 15 N recovery in the NH 4 + pool decreased from 62% at 0 h to 1.5% after 24 h and 48 h, while in the sterile grassland soil recovery rates ranged between 98% (0 h) and 88% (48 h) but did not change significantly with time (Fig. 2, Table 3). In parallel to the decrease in the 15 N recovery in the NH 4 + pool in the live grassland soil the recovery rate of 15 N in the NO 3 − pool increased significantly from 13% (0 h) to 52% (48 h).
The recovery rates for the NO 3 − pool in the sterilized grassland soil varied at around 1.7% and did not change over time. We did not observe consistent changes in the 15 N recovery in DON over incubation time, either in live or in sterile grassland soils, with values ranging between 0 and 2% (Fig. 2, Table 3). 15 N recoveries in microbial biomass in live grassland soil declined from 10.3% (0 h) to 6.0-6.6% (24 and 48 h).
15 N recovery in abiotic fixed N pools
Abiotic N fixation in clay minerals and humic substances was measured in live soils after fumigation and extraction with K 2 SO 4 . Total N fixation (TN fixed ) increased in the forest soil, from 1.7% of added 15 N (0 h) to 15.4% (24 h, Table 2). In grassland soil a greater proportion of added 15 NH 4 + tracer was abiotically fixed, and TN fixed increased from 24% to 38.3% within 24 h (Table 2). Fixed 15 N from the NH 4 + pool was mainly recovered in the inorganic N fraction (clay fixation, > 97%), organic N fixation (humic fixation) contributing less than 3% to total abiotic fixation ( Table 2).
Assessment of 15 NH 4 + reflux and its effect on gross N mineralization rates
In live soils the amount of 15 N recovered in different NH 4 + sinks either increased significantly over incubation time (Forest soil: NO 3 − , DON, N fixed ; Grassland soil: NO 3 − , N fixed ) or did not show a clear trend (Grassland soil: DON; Fig. 2). Only in the N mic pool, we found a decrease of the recovery rates of added 15 N in both soils, i.e., from 1.6% to 0.4% in the forest soil and from 10.3% to 6% in the grassland soil, while recoveries in N fixed increased rather than decreased (Table 2). Therefore, we identified N mic as the main possible source for reflux of immobilized labeled NH 4 + to the available ammonium pool over incubation time. The possible impact of 15 N reflux from the N mic pool on gross NH 4 + production rates was investigated in both soils using sensitivity analysis, at reflux rates of 10%, 20%, 50%, and 100% of the 15 N-N mic pool for an incubation period from 3.5 h to 24 h. In the forest soil, the reflux caused only a modest underestimation of gross NH 4 + production rates and at a reflux rate of 10%, NH 4 + gross production rates were not affected at all (Table 4). In contrast, a simulated worst-case scenario for the grassland soil revealed an underestimation of gross NH 4 + production rates by up to 63% (reflux rate of 100% of the rapidly consumed 15 NH 4 + by soil microbes). At a reflux rate of 50%, the rate was still underestimated by 43% and by 14% at a reflux rate of 10% of the labeled NH 4 + that was rapidly taken up by microbes (Table 4).
Consistency of NH 4 + transformation rates
To test for constant rates of isotope pool dilution over time, which causes an exponential decline in 15 N: 14 N ratios, we plotted the natural logarithm of 15 N atom percent excess Europe PMC Funders Author Manuscripts against incubation time. Given constant rates this plot provides a linear relationship, while declines or increases in isotope pool dilution rates cause curvilinearity (Fig. 3). In the forest soil, we found transformation process rates to be constant between 3.5 h and 48 h (R 2 = 0.979) and in the grassland soil between 0.25 h (and 3.5 h) and 24 h of incubation (R 2 = 0.904). The 15 N atom percent excess decreased faster in the grassland soil (k = −0.128) as compared to the forest soil (k = −0.003) in the respective incubation periods. Calculating gross NH 4 + transformation rates for these time intervals, we found significantly higher gross N mineralization rates in the grassland soil (5.3 ± 0.1 μg N g −1 d.w. d −1 ) compared to the forest soil (2.3 ± 0.1 μg N g −1 d.w. d −1 ; P < 0.01; t-test).
Discussion
The objectives of this study were to assess the main sink pathways of 15 N-NH 4 + tracer during a short-term IPD experiment and to explore whether a reflux of consumed 15 N tracer into the available NH 4 + pool is likely for any of the identified NH 4 + sinks during incubation time. Such an evaluation is important since a reflux of tracer can significantly impact gross N mineralization rate estimates in soils.
Recovery of the 15 N-NH 4 + tracer
For the live forest soil, we found almost no rapid consumption of 15 N tracer and the biggest proportion of the tracer (78% after 48 h) was actually recovered as NH 4 + at the end of the incubation (Fig. 2). Biological processes (microbial uptake and nitrification) accounted only for a small proportion of 15 N-NH 4 + consumed during the incubation. The remaining consumed tracer was recovered in the DON pool (13% after 48 h) and was also found to be abiotically fixed in clay (15% after 24 h). In contrast, the live grassland soil showed rapid 15 N-NH 4 + consumption and high NH 4 + turnover rates, as the tracer in the NH 4 + pool was depleted by the end of the incubation period, and nitrification was the main consumptive process (Fig. 2). The rapid consumption of 15 N-NH 4 + in this soil was striking because nearly half of the tracer was consumed shortly after tracer addition, and was clearly due to both biotic processes (microbial uptake and nitrification; 23%) and abiotic fixation (24%). Other studies have reported that the main cause for rapid 15 N-NH 4 + consumption in IPD and tracer immobilization studies were either biotic processes (Bruun et al., 2006;Fitzhugh et al., 2003;Herrmann et al., 2007;Hill et al., 2012;Wilkinson et al., 2014), rapid abiotic fixation (Davidson et al., 1991;Kowalenko and Cameron, 1978), or both biotic immobilization and abiotic fixation (Johnson et al., 2000;Morier et al., 2008;Schimel and Firestone, 1989;Trehan, 1996). To which extent one or the other process prevails depended on factors such as the soil C and N content (Booth et al., 2005), soil moisture (Gouveia and Eudoxie, 2007), soil NH 4 + fixation capacity, and the clay content and composition (Nieder et al., 2011). We found a higher proportion of the added tracer abiotically fixed in the grassland soil compared to the forest soil. This may have resulted from a higher NH 4 + fixation capacity in the grassland soil due to higher clay content when compared to the forest soil (clay content: Grassland: 26%; Forest: 16%) in combination with the lower initial NH 4 + concentration. Davidson et al. (1991) reported similar findings on the importance of abiotic reactions as sinks for 15 N-NH 4 + in both forest and grassland soils. Moreover, at higher NH 4 + concentrations as found in the forest soil compared to the grassland soil (Fig. S1) Braun
Europe PMC Funders Author Manuscripts
Europe PMC Funders Author Manuscripts competition for the cation binding sites in the interlayers of 2:1 clay minerals may be significantly increased, and consequently 15 N-NH 4 + being less likely to become bound.
Reflux from abiotic sinks of NH 4 +
In both soils, abiotic fixation of NH 4 + was almost exclusively due to the mineral and not the organic fraction of the soil (Table 3). In general, a release of fixed 15 N-NH 4 + by clay minerals could occur in quantities that affect the dynamics of exchangeable NH 4 + (Matsuoka and Moritsuka, 2011). Both processes, NH 4 + fixation and the release of NH 4 + from clay minerals, are mainly controlled by ion diffusion processes (Kowalenko and Cameron, 1978;Nõmmik, 1965;Steffens and Sparks, 1997), and thus primarily depend on the NH 4 + concentration in the soil solution phase. As the live forest soil showed constant NH 4 + concentrations over time (Fig. S1) and 15 N recovery in the clay fixed soil fraction increased with time (Table 3), we suggest that re-diffusion of fixed 15 N-NH 4 + into the available pool was highly unlikely for this soil. Although in the grassland soil NH 4 + concentrations decreased over time (which might increase the likelihood of re-diffusion), the constant increase in the 15 N recovery rate from the clay fixed N pool over time also points away from a reflux of tracer from clay interlayers in the grassland soil. Moreover, the release of clay fixed NH 4 + into soil solution is a slow process, previously being suggested to take weeks to years (Kowalenko and Cameron, 1978;Nieder et al., 2011). Therefore, there is no need to consider and evaluate the reflux of clay fixed 15 N-NH 4 + in short-term IPD experiments lasting up to two days. Furthermore, it is unknown whether clay fixation of 15 N-NH 4 + is concomitant with the reciprocal release of native, unlabeled fixed NH 4 + , which would result in an overestimation of gross N mineralization rates.
We found a small fraction of the abiotically fixed 15 N-NH 4 + bound to the humic fraction of the soils (1.1% after 24 h in the grassland soil, Table 3). This might be due to the covalent bonding of NH 4 + in the form of ammonia (NH 3 ) to various functional groups in humic substances, such as ketones, or alternatively due to physical condensation reactions of phenolic hydroxyls, hydroquinones and quinone polymers with NH 3 (Burge and Broadbent, 1961;Nõmmik and Vahtras, 1982;Stevenson, 1994;Thorn and Mikita, 1992). Covalent bonding of ammonia to soil organic matter is expected to result in fairly stable compounds that are only slowly mineralized by soil microorganisms (Monaghan and Barraclough, 1995;Thorn and Mikita, 1992). Since bonding to humic substances was minimal in this study, and degradation is supposed to be slow, we deduce that there is no need to consider the remineralization of humic fixed 15 N-NH 4 + as a source for reflux in this study. Our findings on the contribution of the mineral and the organic fraction to NH 4 + fixation are also consistent with the results of the few other studies available (Kowalenko and Cameron, 1978;Nõmmik and Vahtras, 1982;Trehan, 1996).
Interestingly, in the forest soil, the recovery rate of 15 N in the DON pool increased significantly over time (Fig. 2). The formation of DON, a heterogeneous mixture of compounds (Farrell et al., 2011), results from a complex mix of biotic and abiotic processes (Neff et al., 2003). Biotic formation of 15 N labeled DON can result from microbial NH 4 + assimilation and exudation or cell lysis (Seely and Lajtha, 1997), which in our experiment, due to the low amount of 15 N-NH 4 + taken up by microbes in the forest soil (Fig. 2), seems to contribute only to a minor extent. However, abiotic fixation by the low-molecular weight organic fraction of the soil, similar to bonding with humic substances as described above, could also explain the observed increased 15 N tracer recovery in DON. In the case of the forest soil, an argument against the covalent bonding of the labeled NH 4 + would be the low soil pH of 4. Covalent bonding of NH 4 + to organic compounds has only been reported in the form of NH 3 , which only becomes the dominant form relative to NH 4 + in soils under alkaline conditions (Burge and Broadbent, 1961;Thorn and Mikita, 1992). Moreover, only few studies reported on the biodegradability of DON and on DON mineralization (Jones et al., 2004). Jones et al. (2004) suggested that the low-molecular weight fraction of DON comprises only 10-30% of all DON but may regulate the rate of N mineralization and nitrification in soil directly, serving as a microbial substrate (Jones et al., 2004;Wilkinson et al., 2014). DON often represents 30% or more of the total dissolved N in soil solution or soil extracts (Christou et al., 2005;Farrell et al., 2011) and low-molecular weight organic compounds can be taken up by the microbial community within minutes (Hill et al., 2012;Wanek et al., 2010;Wilkinson et al., 2014). Future studies should therefore investigate DON mineralization when considering possible refluxes of tracer (e.g. from the DON pool) into the available NH 4 + pool, especially in IPD experiments lasting longer than one or two days.
Reflux from biotic sinks of NH 4 +
We found that only the recovery rate of 15 N from the microbial N pool decreased (by 40-75%) relative to the initial time point over a 24 h incubation period (Fig. 2). Our sensitivity analysis revealed that any reflux of 15 N-NH 4 + taken up by microbes into the soil NH 4 + pool likely had a negligible impact in the forest soil during this period (Table 4). Specifically, our simulations suggested that the gross N mineralization rate of the forest soil could be underestimated by a maximum of 3%. In contrast, simulations suggested that the gross N mineralization rate of the grassland soil could be underestimated in the worst-case scenario by a maximum of 63% (Table 4), assuming all of the rapidly consumed microbial 15 N would reflux into the soil pool as 15 NH 4 + . The low impact of simulated microbial N reflux in the forest soil is explained by the low amount of 15 N-NH 4 + taken up by microbes relative to the large NH 4 + pool. In the grassland soil, a reflux of the high amount of 15 N-NH 4 + taken up by microbes, combined with the low NH 4 + concentration in this soil, had a large impact on the estimation of gross NH 4 + transformation rates. Despite this, such a large reflux of 15 N taken up by microbes in the grassland soil seems unlikely during an experimental period of only 24 h. Fast efflux of unmetabolized 15 N-NH 4 + from cells is always coupled to cellular influx (uptake) of NH 4 + (Ludewig et al., 2007;Morgan and Jackson, 1988), and channel-or carrier-mediated NH 4 + efflux from microbial and plant cells has been reported (Hadas et al., 1992;von Wirén and Merrick, 2004). The fraction of NH 4 + taken up and subsequently lost by efflux is negatively related to NH 4 + assimilation, and decreases at low substrate concentrations in plants (Forde and Clarkson, 1999). We therefore suggest that the amount of 15 NH 4 + efflux is minimal under the N limited conditions of the grassland soils, due to its low NH 4 + concentration (see also Bengtson and Bengtsson, 2005), fostering microbial assimilation rather than efflux of NH 4 + .
In contrast, re-mineralization of microbial N, that was previously taken up and assimilated into organic N, would be a much slower process than microbial NH 4 + efflux. However, re- Europe PMC Funders Author Manuscripts mineralization of organic 15 N originating from microbes could potentially represent a significant source of tracer reflux in the grassland soil, at rates impacting the gross N mineralization rate. The rapid incorporation and assimilation of 15 N-NH 4 + into microbial biomass could explain the decrease in 15 N enrichment and 15 N recovery in the microbial N pool over time (Fig. 2, Fig. S2), while the microbial biomass N content, at least for the grassland soil, increased significantly over incubation time (Fig. S1). This may be explained by continued microbial NH 4 + uptake with decreasing 15 N enrichment over time (Fig. S2) or by technical constraints arising from the sCFE method. It is impossible to extract the total amount of 15 N taken up by microbes with the sCFE extraction as applied in this experiment, especially if 15 N-NH 4 + was metabolized and built into insoluble cellular components such as cell walls (Fierer and Schimel, 2003). In general, the application of chloroform extraction methods only enables the measurement of soluble N compounds within microbial cells and not insoluble compounds such as cell wall proteins or peptidoglycans (Jenkinson et al., 2004). This means that in grassland soils we would be facing continuous uptake of NH 4 + from soil solution, in combination with ongoing removal from the extractable N mic pool as microbes produce insoluble cell components. This would ultimately result in the decrease in the 15 N recovery rate from the N mic pool, as found in both soils, rather than indicating 15 N reflux or remineralization from the microbial N pool. Usually, microbial NH 4 + uptake and assimilation, turnover (lysis) and re-mineralization of microbial N is assumed to take from a few days to weeks (Herman et al., 2006;McGill et al., 1975), which means that in a shortterm laboratory incubation of 24 h as applied in our IPD experiment, re-mineralization of assimilated 15 N-NH 4 + is relatively slow. Microbial turnover rates in temperate forest and grassland soils have been found to range between 0.004 and 0.03 d −1 (corresponding to microbial turnover times of 30-220 days; Spohn et al., 2016aSpohn et al., , 2016b, also playing against a strong reflux of tracer from the microbial 15 N pool due to slow turnover of microbial biomass. Therefore, our sensitivity analysis indicates that the reflux of recently taken up 15 N tracer from the microbial N pool could potentially have a large impact on the estimation of gross N mineralization rates, but significant reflux appears to be unlikely during incubation periods of about 24 h. These findings are in line with other studies, for example Bengtson and Bengtsson (2005), who showed that in IPD experiments, re-mineralization is lowest during the first two days of incubation. Also others (Barraclough, 1995;Bjarnason, 1988;Davidson et al., 1991;Herrmann et al., 2007;Murphy et al., 2003;Wang et al., 2001) found that remineralization is negligible in IPD experiments during incubation times between 24 h and up to a few days, even in studies on rapidly immobilizing grassland soils (Davidson et al., 1991).
Nonetheless, given the potential impact of reflux on gross N transformation rates, remineralization fluxes should be measured directly and accounted for in the IPD calculations. Though re-mineralization is hard to quantify directly in soil (but has been done in soil microbial cultures; Bengtson and Bengtsson, 2005) we here propose three approaches to assess its magnitude quantitatively in soils: (1) Gross N mineralization fluxes apparently decline over time due to increasing reflux of microbial 15 N from biomass turnover, given the time lag of this reflux relative to microbial NH 4 + immobilization. (Rütting et al., 2011), the FLUAZ model or others (Bengtson and Bengtsson, 2005;Bjarnason, 1988).
(2) Bjarnason (1988) and Herrmann et al. (2007) applied 15 NO 3 − separately in N mineralization experiments to follow its immobilization, assimilation and the production of 15 NH 4 + as an index of microbial N re-mineralization.
However, this approach targets only the part of the microbial community that actively assimilates NO 3 − and cannot distinguish between re-mineralization of microbial N and dissimilatory nitrate reduction to ammonium (DNRA) that produces NH 4 + from NO 3 − as major energy conserving mechanism. Parallel measurements of 15 N mic might resolve some of these issues as DNRA organisms putatively represent only a small fraction of the heterotrophic microbial community and therefore contribute little to 15 NO 3 − immobilization.
Moreover, this approach provides only net rates and numerical or analytical solutions need to be used to derive gross rates of re-mineralization.
(3) A third option has recently become amenable, based on direct measurements of rates of soil microbial gross growth and microbial biomass turnover and was applied to soil microbial C dynamics (Spohn et al., 2016a(Spohn et al., , 2016b. This latter approach could be applied to gross N mineralization experiments and is based on quantifying the 18 O incorporation from added 18 O-H 2 O into double stranded DNA (which is only produced during microbial growth) and conversion of microbial DNA production estimates to N mic and microbial N allocation to growth by CFE. These data would allow the calculation of microbial mortality rates at constant microbial biomass and gross rates of N release from N mic . The third approach has however so far not been applied to such settings, and instead of quantifying the re-mineralization bias in gross N mineralization studies allows the partitioning between gross N mineralization from organic N in microbial biomass/necromass ("re-mineralization") from that of organic N stored in more stable humic substances.
Consistency of NH 4 + transformation rates over time
Since constant process rates are a prerequisite for estimating gross N transformation rates (Kirkham and Bartholomew, 1954), we investigated the consistency of transformation rates over time. For the forest soil, transformation rates were approximately constant from 3.5 h after tracer addition until up to 48 h of incubation. In the grassland soil, process rates were approximately constant from 15 min to 24 h of incubation. Initial transformation rates (Fig. 3) were much faster prior to these periods, showing that gross N mineralization rates were systematically overestimated during the shortest incubation period. This is likely due to the lack of equilibration of the added 15 N-NH 4 + (tracer) with the native 14 N-NH 4 + pool (tracee) (Bjarnason, 1988;Watson et al., 2000), and relates to another key assumption of the IPD approach, namely that tracer and tracee behave in the same way in soils (Kirkham and Bartholomew, 1954). Preliminary studies of the time kinetics of consumptive processes and of the tracer/tracee mixing are thus of great importance to find a balance between: (i) the initial time needed to achieve tracer mixing with the native pool (and thereby achieving an identical behavior of the tracer and the tracee); and (ii) the extent of depletion of the 15 N pool by consumptive processes. In the grassland soil, 15 N-NH 4 + was almost fully depleted after only 24 h, which is also often observed in other soils (Booth et al., 2005). Such a time frame does not allow for an equilibration time of 24 h before initial sampling as recommended by many authors (Cliff et al., 2002;Herrmann et al., 2007;Murphy et al., 2003;Watson et al., 2000). In the case of rapid depletion of the 15 N pool, the use of nitrification inhibitors such as acetylene has been suggested by some authors in order to slow down NH 4 + immobilization and to prolong incubation time (Herrmann et al., 2007;Murphy et al., 2003). This has proven to be a viable solution for soils showing high nitrification potential (Herrmann et al., 2007), but does not prevent the continuous NH 4 + fixation occurring due to clay minerals as found in our soils. Also, some non-linear models, developed to calculate gross rates for inorganic N pools that turn over within a day, assume nitrification to be the only consumptive process for ammonium (Davidson et al., 1991), which is not in line with our findings. In our study, a uniform mixing of the tracer solution with the soil NH 4 + and the equilibrium of tracer and tracee seemed to be reached after an incubation time of only a few h (Barraclough, 1995;Di et al., 2000). Therefore, the estimation of gross N mineralization rates seemed to be justifiable for a time interval between 3.5 h and 24 h in both soils and should, at least in the grassland soil, not exceed 24 h, since errors become more significant as 15 N enrichments close to natural abundance levels are approached (Davidson et al., 1991).
Conclusion
Overall, we found that biotic immobilization and clay fixation are responsible for the fast consumption of 15 N-NH 4 + in both studied soils while humic fixation played a negligible role. Most importantly, we showed that reflux of rapidly consumed 15 N-NH 4 + was relatively unlikely during our short-term laboratory IPD assay. But one should keep in mind, as Wang et al. (2001) also state, that re-mineralization is part of the continuous process of N mineralization-immobilization and N turnover, both of which determine the net release and availability of inorganic N in soil (Murphy et al., 2003;Wang et al., 2001). Thus, depending on the primary objective of the study, one must choose the appropriate experimental design and duration, and also the appropriate approach for estimating gross N mineralization, either an analytical solution sensu Kirkham and Bartholomew (1954), or a combination of 15 N tracing studies coupled to analyses via process-based models (Andresen et al., 2015;Cliff et al., 2002;Rütting et al., 2011;Tietema and Wessel, 1992). However, knowing about the inherent assumptions and potential problems of the IPD approach, taking care in applying the method in the right way and testing the system before applying the IPD assays, allows to estimate gross N mineralization rates (and other soil N processes) in a reliable way.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material. Overview of experimental design of the isotope pool dilution experiment. The IPD assay was performed with two treatments, live (non-sterilized) and sterilized (auto-claved) soil, to distinguish between biotic immobilization processes and abiotic fixation. Five consecutive measurements of concentrations and isotopic composition of NH 4 + , NO 3 − , microbial biomass N (N mic ), and dissolved organic N (DON) were taken over the course of 48 h. To obtain high-resolution time kinetics of measured processes, we stopped incubations immediately (0 h), 0.25 h, 3.5 h, 24 h, and 48 h after label addition. In addition, the forest soil (left panel) and the live and sterile grassland soil (right panel). Labile N represents the sum of NH 4 + , NO 3 − , DON, and N mic. Significant differences between time points were tested by linear models and Tukeys HSD post-hoc test and are given by different lower case letters (live soils) or upper case letters (sterile soils); NS, not significant (P > 0.05). Error bars fell within the confines of the symbols in some instances. Table 1 Selected soil characteristics of the top soil (0-10 cm) of the forest and the grassland soil (means ± 1 SE, n = 3).
Soil parameter Forest Grassland
Soil pH 4.0 ± 0.0 6.0 ± 0.0 Table 3 Effect of time (T) and sterilization (S) and significance of interaction between time and sterilization (TxS) on recovery rates of 15 N (%) from extractable N pools (NH 4 + , NO 3 , DON), the microbial N pool (N mic ), and the sum of extractable and microbial N pool (labile N) in the forest soil and the grassland soil. The model did not allow for determining the significance of treatment and of interaction between time and sterilization on the recovery rate of the tracer from the microbial N pool (NA), as recovery was not determined in the sterilized soils. Values are given for the likelihood ratio test (LR), the degrees of freedom (df), and the significance level of the individual term or the interaction term on the recovery rate of 15 N. Asterisks indicate the significance of a single variable (T, S) or the interaction of variables (TxS) on the recovery rate of 15 N (*P < 0.05, **P < 0.01, ***P < 0.001). | v3-fos-license |
2019-04-03T13:08:12.976Z | 2018-11-02T00:00:00.000 | 91487635 | {
"extfieldsofstudy": [
"Chemistry",
"Biology",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://doi.org/10.1128/mbio.02400-18",
"pdf_hash": "bf58c69aba8d655d3731e1f48bd90136d2394ba3",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119862",
"s2fieldsofstudy": [
"Biology",
"Environmental Science"
],
"sha1": "bf58c69aba8d655d3731e1f48bd90136d2394ba3",
"year": 2019
} | pes2o/s2orc | Respiratory Heterogeneity Shapes Biofilm Formation and Host Colonization in Uropathogenic Escherichia coli.
Biofilms are multicellular bacterial communities encased in a self-secreted extracellular matrix comprised of polysaccharides, proteinaceous fibers, and DNA. Organization of these components lends spatial organization to the biofilm community such that biofilm residents can benefit from the production of common goods while being protected from exogenous insults. Spatial organization is driven by the presence of chemical gradients, such as oxygen. Here we show that two quinol oxidases found in Escherichia coli and other bacteria organize along the biofilm oxygen gradient and that this spatially coordinated expression controls architectural integrity. Cytochrome bd, a high-affinity quinol oxidase required for aerobic respiration under hypoxic conditions, is the most abundantly expressed respiratory complex in the biofilm community. Depletion of the cytochrome bd-expressing subpopulation compromises biofilm complexity by reducing the abundance of secreted extracellular matrix as well as increasing cellular sensitivity to exogenous stresses. Interrogation of the distribution of quinol oxidases in the planktonic state revealed that ∼15% of the population expresses cytochrome bd at atmospheric oxygen concentration, and this population dominates during acute urinary tract infection. These data point toward a bet-hedging mechanism in which heterogeneous expression of respiratory complexes ensures respiratory plasticity of E. coli across diverse host niches.IMPORTANCE Biofilms are multicellular bacterial communities encased in a self-secreted extracellular matrix comprised of polysaccharides, proteinaceous fibers, and DNA. Organization of these components lends spatial organization in the biofilm community. Here we demonstrate that oxygen gradients in uropathogenic Escherichia coli (UPEC) biofilms lead to spatially distinct expression programs for quinol oxidases-components of the terminal electron transport chain. Our studies reveal that the cytochrome bd-expressing subpopulation is critical for biofilm development and matrix production. In addition, we show that quinol oxidases are heterogeneously expressed in planktonic populations and that this respiratory heterogeneity provides a fitness advantage during infection. These studies define the contributions of quinol oxidases to biofilm physiology and suggest the presence of respiratory bet-hedging behavior in UPEC.
sition of mutations, or transient and reversible if it is brought about by stochastic differences in the abundance and activity of regulators in each individual cell or by metabolic adaptation to local environmental conditions. Heterogeneity often confers a survival advantage to the population by allowing at least portion of the population to survive in a given niche.
In biofilms, bacteria assemble in an organized fashion in three-dimensional space. One of the most critical features of biofilms is a self-secreted extracellular matrix (ECM) that comprises a variety of exopolysaccharides, proteinaceous fibers, and extracellular DNA (1). The ECM protects the biofilm residents from predation, desiccation, assault by antimicrobial agents, and-when biofilms form in the host-the immune system. In addition to providing a physical barrier against external threats, the ECM also serves as a barrier to diffusion. Restricted diffusion, in conjunction with the metabolic activity of resident bacteria, leads to the establishment of various chemical gradients throughout the biofilm community (2,3). Bacteria at different locales along the gradient respond to the microenvironment differently and as a result differentiate into distinct and often metabolically cooperative subpopulations (2)(3)(4)(5)(6). Previous studies in Pseudomonas aeruginosa and Escherichia coli indicated that oxygen gradients play a key role in regulating the differential expression of genes involved in biofilm formation and metabolic specialization (7)(8)(9)(10). The presence of an oxygen gradient suggests the emergence of subpopulations that utilize different respiratory components as a function of the oxygen abundance to which they are exposed. This leads to the hypothesis that the metabolic programs of differentially respiring subpopulations are distinct from one another and contribute to differential production of biofilm goods that in turn enhance biofilm resilience.
Escherichia coli is a facultative anaerobe capable of utilizing multiple metabolic pathways to fulfill its energy requirements. In aerobically respiring E. coli, quinol oxidases comprise essential components of the terminal electron transport chain that couple the flow of electrons to the reduction of molecular oxygen into water (11,12). E. coli encodes two classes of quinol oxidases with differing oxygen affinities: one heme copper oxidase, cytochrome bo (encoded by the cyoABCD gene cluster), and two bd-type oxidases, cytochromes bd (cydABX) and bd 2 (appBC) (12,13). Studies in K-12 E. coli indicated that cytochrome bo is induced at high (atmospheric, 21%) oxygen tensions, whereas the bd-type oxidases are induced at low (hypoxic, 2 to 15%) oxygen tensions (12,14). Cytochromes bd and bd 2 have approximately 60% amino acid identity, similar spectral properties, and indistinguishable reaction mechanisms (13,15). Based on the in vitro expression patterns of these quinol oxidases, we hypothesized that cytochrome bo would be enriched on the air-exposed biofilm surface, whereas cytochromes bd and bd 2 would be enriched in the hypoxic interior.
Here we report that the spatial distribution of quinol oxidases in biofilms formed by uropathogenic Escherichia coli (UPEC) is a fundamental driver of biofilm architecture. Peptide nucleic acid fluorescence in situ hybridization (PNA-FISH) analyses assigned locations to each quinol oxidase-producing subpopulation, elucidating for the first time spatially distinct expression programs for respiratory oxidases in E. coli. Depletion of the cytochrome bd-expressing subpopulation from the biofilm significantly impaired diffusion resistance by altering the abundance and organization of the ECM. Assessment of deletion mutants in a well-established urinary tract infection murine model revealed that only the cytochrome bd mutant was significantly attenuated for virulence, although the infecting pool of bacteria in the parent strain exhibited heterogeneous expression of all three respiratory oxidases. In situ analysis of urine-associated bacteria demonstrated a shift of the population to cytochrome bd expression, suggesting that the bladder favors cytochrome bd-expressing bacteria and that heterogeneity in the input pool provides a fitness advantage to uropathogenic strains. Our studies, performed on one of the most commonly acquired human pathogens and a prolific biofilm producer in vivo, unveil a potential avenue for targeting heterogeneity and homogenizing bacterial programming as a therapeutic approach.
RESULTS
Cytochrome bd is the most abundant respiratory transcript in mature UPEC biofilms. In previous studies we reported spatial organization of proteins as a function of oxygen gradients in surface-associated UPEC biofilms formed at the air-liquid interface of yeast extract-Casamino Acids medium (YESCA) (9), which induces expression of key matrix components (curli amyloid fibers, type 1 pili, secreted proteins Hu-␣/, and cellulose) that are also critical for fitness in the urinary tract (9,(16)(17)(18). We then went on to show that biofilm formation is greatly diminished under anaerobic conditions, despite the addition of alternative terminal electron acceptors used by E. coli for anaerobic respiration and irrespective of growth medium (19). Given that aerobic respiration is critical for UPEC colonization and the establishment of intracellular biofilms during bladder infection (20)(21)(22), we sought to determine the relative expression of aerobic and anaerobic respiratory machineries in mature colony biofilms formed under aerobic conditions on YESCA agar without supplementation of alternative terminal electron acceptors. Under these growth conditions, UPEC forms elaborate rugose-colony biofilms (Fig. 1A) that quickly establish an oxygen gradient from the surface to the interior of the biofilm (8). Previous studies demonstrated the presence of a matrix-rich region and a matrix-devoid region in colony biofilms imaged at 48 h and 6 days post-inoculation (8,(23)(24)(25) and additionally revealed distinct spatial expression of regulators at the growing edge versus the center of the biofilm (23). To investigate the role of quinol oxidases in biofilms, we first used RT-qPCR to measure the steady-state transcript at the growing edge (periphery) and the center of the colony ( Fig. 1; see also Fig. S1 in the supplemental material). Although overall transcript abundance was significantly increased in the periphery relative to the center (Fig. 1E), consistent with the notion that cells at the periphery are more metabolically active, we observed a similar distribution of transcript at the center of the biofilm and the growing edge ( Fig. 1B to D). Consistent with previous studies demonstrating the importance of aerobic respiration in UPEC biofilms, the majority of detected transcript corresponded to aerobic respiratory components ( Fig. 1B and C). The most abundant transcript was that of cydA ( Fig. 1B to D and Fig. S1), corresponding to cytochrome bd complex (cydABX) expression. The cydA transcript levels were approximately 2-fold higher than those corresponding to cyoABCD (Fig. 1B to D), which was the second most highly abundant oxidase under the conditions tested. Although most anaerobic respiratory operons exhibited baseline expression levels, we detected high levels of transcript corresponding to fumarate reductase (frdA) and periplasmic nitrite reductase (nrfA) (Fig. 1B to D and Fig. S1). These results reveal the presence of marked respiratory heterogeneity within UPEC biofilm communities and suggest that respiration via cytochrome bd may be preferred.
Spatial organization of quinol oxidase expression along the oxygen gradient. To define the spatial distribution of quinol oxidase-expressing subpopulations, we performed PNA-FISH on biofilm cryosections of mature colony biofilms using probes targeting each quinol oxidase operon (cyoA, appC, and cydA) as well as rrsH as an endogenous control (Fig. 2). Because cryosectioning captures both macroscopic and microscopic architecture of biofilms with minimal disruption to the overall structure or organization of the resident bacteria, this approach allows us to define the in situ distribution of transcripts in unperturbed communities ( Fig. 2A and B). Each PNA-FISH probe was designed using the validated probe sequences used for qPCR (Table S1) to ensure comparable hybridization efficiencies for each probe. Specificity of each probe was confirmed using RT-qPCR (see Fig. 4H) and through staining of planktonic cells (Fig. S2). SYTO 9 staining of sections was used as an additional control to localize the entire biofilm community and account for possible hybridization inconsistencies with the rrsH control probe (Fig. 2E and K and Fig. S3). To account for possible mislocalization of signal due to biofilm breakage during the cryosectioning and staining procedure, we focused our analysis on regions devoid of significant breaks in the cryosection. Consistent with previous observations demonstrating that the highest oxygen abundance is at the air-exposed surface of the biomass (7,8), we observed that cyoABCD transcript was most abundant in bacteria lining air-exposed surfaces of the biofilm (Fig. 2C, D, G, I, J, M, and O). In contrast, the highest abundance of cydABX transcript was (13,26), we observe different transcript distribution for these two gene clusters. Rather than organizing along the oxygen gradient, appBC transcript was observed to be evenly distributed throughout the community (Fig. S3). Interestingly, we also observe basal expression of cytochrome bo across the community with enrichment of cytochrome bd in pockets of cells in the interior ( Fig. 2J to O), suggesting that individual cells may express multiple quinol oxidases simultaneously within biofilms. Additionally, while many biofilm wrinkles are empty or sparsely populated with rrsH-staining cells, we observe other wrinkles that are densely populated (Fig. S4). We observe reduced intensity of quinol oxidase staining in the interior of those populated wrinkles (Fig. S4), suggesting that-consistent with previous reports (7, 27)-respiration in the deeper layers of the biofilm respiration occurs anaerobically. Based on the qPCR results ( Fig. 1B to D), respiration in the populated wrinkles may be occurring via terminal electron acceptors. The center and periphery of colony biofilms, including both the surface and interior of each region, were harvested and subjected to RNA extraction and RT-qPCR using probes targeting each respiratory operon present in UPEC. (B and C) Pie charts indicating the relative abundance of detected respiratory transcripts in the biofilm center (B) and periphery (C). Aerobic respiratory operons are presented in color, whereas anaerobic respiratory operons are presented in grayscale. (D) Graph depicting relative fold differences in respiratory transcript abundance in the biofilm center and periphery compared to cyoA abundance in the same region. (E) Graph depicting relative fold difference in abundance of each transcript in the biofilm periphery compared to abundance of the same transcript in the biofilm center. The graphs and pie charts depict the average from four biological replicates. Statistical analysis was performed in GraphPad Prism using a two-tailed paired t test. Data are presented as mean Ϯ SEM. *, P Ͻ 0.05; **, P Ͻ 0.01; ***, P Ͻ 0.001; ****, P Ͻ 0.0001. Respiratory Heterogeneity in Uropathogenic E. coli ® fumarate reductase or periplasmic nitrite reductase. Here we focused our studies on understanding the contribution of cytochrome bd to biofilm architecture.
Loss of cytochrome bd alters biofilm architecture, development, and ECM abundance. The highly ordered spatial organization of cytochrome bo and cytochrome bd in the biofilm raised the hypothesis that each of these quinol oxidase-expressing subpopulations uniquely contributes to overall biofilm architecture. To test this hypothesis, we created isogenic deletion mutants lacking the cyoAB, appBC, or cydAB genes and compared the biofilms formed by the resulting strains (Fig. 3A). Colony biofilms formed by the parental strain expand to an average diameter of 16.8 mm over an 11-day incubation period and exhibit elaborate rugose architecture with distinct central and peripheral regions ( Fig. 3A and Fig. S5). Strains deleted for cyoAB and appBC exhibited inverse phenotypes to each other, with the ΔcyoAB colony biofilms expanding more than the parental strain (average diameter, 19.9 mm) and the ΔappBC colony biofilms appearing more compact and with apparently higher rugosity ( Fig. 3A and Fig. S5). Strikingly, while ΔcyoAB and ΔappBC colony biofilms displayed only minor architectural changes, ΔcydAB colony biofilms exhibited pronounced defects in both development and architecture ( Fig. 3A and Fig. S5). Colony biofilms from all strains grew at similar rates for the first 72 h (Fig. S5). However, ΔcydAB colony growth was significantly stunted between days 3 and 11, with radial expansion remaining at an average diameter of 10.3 mm and colonies exhibiting a wet mass approximately 50% of the parental strain after 7 days of growth, even though the CFU produced by the two strains were comparable ( Fig. 3B and D and Fig. S5). Complementation of the ΔcydAB strain with an extrachromosomal construct expressing cydABX under its native promoter rescued the deletion phenotype, indicating that the defects observed in the ΔcydAB mutant stem solely from the removal of the cydABX cluster (Fig. S7). Furthermore, deletion of both cyoAB and appBC from the same strain led to an early onset of rugose phenotype (Fig. S6). Together, these results demonstrate that cytochrome bd is a key contributor to biofilm development and suggest that loss of cydAB alters the synthesis and organization of the ECM.
Under the conditions used, the ECM of E. coli comprises primarily cellulose and curli amyloid fibers (28). Previous solid-state nuclear magnetic resonance (NMR) spectroscopy analyses on intact ECM material defined the contributions of cellulose and curli to the E. coli biofilm ECM and determined that curli and cellulose are present in a 6-to-1 ratio (28). More recently, the ECM cellulose was determined to be a chemically modified form of cellulose, specifically phosphoethanolamine (pEtN) cellulose (29). To interrogate the effects of cydAB deletion on curli and exopolysaccharide production, we extracted ECM and performed solid-state NMR analysis to evaluate the abundance of curli and cellulose components ( Fig. 3F and G). The NMR spectra obtained for the parent and ΔcydAB ECM are very similar overall, indicating a comparable protein-topolysaccharide ratio between the samples (Fig. 3F). Consistent with this analysis, we observe no change in protein composition between the parent and ΔcydAB ECM samples when analyzed on SDS-PAGE gels (Fig. 3G). We additionally do not observe any overt alterations to curli abundance or localization between UTI89 and ΔcydAB biofilm cryosections using immunofluorescence (Fig. 3H). Despite the similar composition, the total amount of ECM recovered was reduced in the ΔcydAB biofilm, indicative of a decrease in ECM production. When quantified by Congo red depletion assays, ΔcydAB colony biofilms exhibited a trend toward reduced total ECM abundance at 7 days (82.1% of parental value) and significantly reduced abundance at 11 days (66.6% of parental value) (Fig. 3E), which could be the result of reduced CFU at the 11-day time point. Because the protein-to-polysaccharide ratio and curli abundance are unchanged between the parent and ΔcydAB biofilms, these data are suggestive of a change to the overall mixture of matrix components in ΔcydAB biofilm, with particular reductions in the abundance of non-curli and non-pEtN cellulose ECM components.
The ECM plays a central role in biofilm physiology by providing physical protection against exogenous insults, serving as a structural scaffold, and helping to establish chemical gradients which lead to metabolic differentiation and subpopulation forma-tion (2,3,16,30). As such, disruptions to the matrix can have catastrophic consequences for the biofilm community. We hypothesized that the altered matrix abundance and architecture in the ΔcydAB mutant would render the biofilm more susceptible to exogenous insults. To investigate this possibility, we probed the barrier (I) Colored water droplets were added to the top of day 11 colony biofilms to probe biofilm barrier function. All statistical analysis was performed in GraphPad Prism using a two-tailed unpaired t test. *, P Ͻ 0.05; **, P Ͻ 0.01; ***, P Ͻ 0.001; ****, P Ͻ 0.0001. Respiratory Heterogeneity in Uropathogenic E. coli ® function of the quinol oxidase mutant biofilms by applying a drop of colored water to the surface of mature colony biofilms (Fig. 3I) (31). While the parent strain, ΔcyoAB, and ΔappBC biofilms repelled the drop, the solution readily penetrated ΔcydAB biofilms, demonstrating that the alterations to ΔcydAB biofilm architecture and matrix abundance increase penetrance of aqueous solutions.
Loss of cytochrome bd increases population sensitivity to nitrosative stress under ambient oxygen concentrations. Together, our studies indicate that cytochrome bd is highly expressed in biofilms and that loss of the cytochrome bdexpressing subpopulation impairs barrier function and reduces the abundance of extracellular matrix. These data suggest that the cytochrome bd-expressing subpopulation plays a critical role in promoting ECM synthesis and providing structural integrity to the community. However, it is also possible that cytochrome bd is preferentially expressed in the biofilm because cytochrome bd provides protection against oxidative and nitrosative stress-by-products of biofilm metabolism (32,33) and, in the case of infection, components of the innate immune response (34)(35)(36). In addition to functioning as a respiratory quinol:O 2 oxidoreductase, previous studies demonstrated that cytochrome bd has catalase activity, is capable of oxidizing the respiratory inhibitor nitric oxide, and is insensitive to nitrosative stress due to its unusually high nitric oxide dissociation rate (34). These biochemical activities are thought to occur at unique locations on the protein; quinol oxidation occurs at the periplasmic Q loop, oxygen reduction and nitric oxide binding occur at heme d, and catalase activity is thought to occur through heme b 595 (13,37,38). In contrast, cytochrome bo affords no protection against nitrosative stress and is irreversibly inhibited by nitric oxide (34).
Given these additional functions of cytochrome bd, we performed growth curves at ambient oxygen concentration and evaluated the effects of nitrosative and oxidative stress on the fitness of cells lacking each quinol oxidase compared to the parental strain. Without the addition of stressors, both ΔcydAB and ΔcyoAB mutants exhibited a delay in growth, but growth of the ΔappBC strain closely mirrored the parental strain ( Fig. 4A and D). Despite the delay, all strains reached similar maximal CFU/ml by the end of the experiment (Fig. 4A). ATP measurements of normalized samples taken from each strain during logarithmic phase revealed no significant overall differences in ATP concentrations (Fig. 4G). Next, to determine whether loss of cytochrome bd impairs resistance to oxidative and nitrosative stress, we measured growth with and without these stressors. Consistent with the reported catalase activity of cytochrome bd, significant increases in the doubling time of both ΔcydAB and ΔappBC strains were observed after treatment with 1 mM H 2 O 2 ( Fig. 4B and E). Although previous studies in K-12 E. coli demonstrated that treatment with 1 mM H 2 O 2 reduced the growth rate of the ΔcyoAB strain by ϳ70% relative to wild type (39), we did not observe significant reductions in growth rate of the ΔcyoAB strain after treatment ( Fig. 4B and E). Addition of the nitric oxide donor NOC-12 to planktonic cultures induced an apparent growth delay in all strains but only significantly reduced the growth rate of the ΔcydAB mutant ( Fig. 4C and F). Whereas treatment with NOC-12 increased the doubling time from 27 to 39 min in UTI89, in the ΔcydAB strain the doubling time increased from 37 to 106 min after treatment (Fig. 4F). Together, these data demonstrate that although cytochrome bd is dispensable for energy generation during planktonic growth, loss of cytochrome bd sensitizes bacteria to oxidative and nitrosative stress, consistent with previous studies on K-12 E. coli and the multidrug-resistant strain ST131 (35,36).
While there was a trend toward increased doubling time in all strains after treatment with NOC-12, treatment of the ΔcydAB strain increased doubling time approximately 3-fold relative to its untreated control. This observation suggests that during aerobic growth cytochrome bd serves as an NO sink that reversibly sequesters NO and protects the more efficient cytochrome bo-mediated respiration. Accordingly, loss of cytochrome bd would decrease nitrosative stress resistance and render the dominant respiratory complex, cytochrome bo, susceptible to irreversible inhibition by NO. As such, treatment of the ΔcydAB strain with NO would poison all preformed cytochrome bo complexes in the membrane and force the bacteria to synthesize new oxidases prior to resuming growth. Consistent with this hypothesis, we observe a marked increase (ϳ10-fold relative to UTI89) of cyoABCD transcript in the interior of ΔcydAB colony biofilms, where NO is expected to be most abundant (Fig. 4H). These results contrast with previous studies in K-12 E. coli, in which loss of cytochrome bd induces a marked upregulation of appBC (26). These observations demonstrate that the regulation of quinol oxidases in UPEC is distinct from that previously defined in K-12 and suggest that cytochrome bd may serve as an NO sink in biofilms. In conjunction with the disrupted biofilm architecture and altered ECM abundance in ΔcydAB biofilms, these data suggest that cytochrome bd-expressing subpopulations are critical, not only for directing ECM biosynthesis but also for withstanding harmful metabolic byproducts while in the biofilm state. (H) RT-qPCR data depicting relative fold difference in respiratory transcript abundance in the center of day 11 colony biofilms in UTI89 and quinol oxidase mutant strains. In UTI89 (black), data are presented as relative fold difference in abundance of each transcript compared to cyoA abundance. In each mutant strain, data are presented as relative fold difference in transcript abundance compared to the abundance of the same transcript in UTI89. Statistical analysis was performed on GraphPad Prism using a two-tailed unpaired t test. All data are presented as mean Ϯ SEM and are representative of at least three biological replicates.
Respiratory Heterogeneity in Uropathogenic E. coli ® Heterogeneous expression of quinol oxidases at the population level. Our data thus far indicate that in addition to heterogeneity in quinol oxidase expression in the biofilm state, heterogeneous expression of quinol oxidases must also be occurring in the planktonic population. Our planktonic studies revealed a lag in growth of the ΔcyoAB and the ΔcydAB mutants when these strains were grown under ambient oxygen concentrations, suggesting that in a given culture there are subpopulations-like in the biofilm-that stochastically or deterministically express different respiratory components. Such a bet-hedging approach could provide UPEC with the flexibility to quickly adapt to a given niche, be it different locales in the genitourinary tract or in the gastrointestinal tract during host colonization. In the context of urinary tract infection, E. coli traverses from the nearly anoxic gut to the perineum, where it encounters atmospheric oxygen concentrations, prior to ascending the urethra to enter the hypoxic bladder, where the dissolved urinary oxygen concentration is 4 to 6% (40). This microbial journey is performed by planktonic cells, which can then expand into multicellular communities on and within bladder epithelial cells, as well as on urinary catheters (1,41). In previous studies, we and others demonstrated that UPEC respire aerobically during infection (20)(21)(22) and that biofilm formation is favored under conditions that mimic oxygen levels in the bladder (19).
The high abundance of cydABX transcript in the hypoxic areas of the biofilm, in conjunction with the defects observed in aerobically grown ΔcydAB planktonic cultures, raised the hypothesis that a cytochrome bd-expressing subpopulation exists in the planktonic state under ambient oxygen conditions and that this cytochrome bdexpressing subpopulation exhibits the greatest fitness advantage during infection. To test this hypothesis, we first analyzed transcript abundance in aerobic cultures used for inoculation during murine infections with RT-qPCR and PNA-FISH (Fig. 5). Under these conditions, the majority of transcript corresponds to cyoABCD (69.7%), with cydABX and appBC transcripts each comprising approximately 15% of detected transcripts (Fig. 5A). Transcript abundance was altered by decreasing ambient oxygen concentrations, with the most abundant transcript corresponding to cydABX in 12%, 8%, and 4% oxygen, the last being the concentration of dissolved oxygen concentration in the urine (Fig. 5A and B and Fig. S8) (40). This shift in transcript abundance is largely due to a marked induction of cydABX expression under hypoxic conditions (Fig. S9). PNA-FISH analysis revealed the presence of bacteria which uniquely express cytochrome bo (Fig. 5F), bd (Fig. 5E), or bd 2 (Fig. 5G), as well as some cells that have transcript of all three operons ( Fig. 5C and E to G). Intriguingly, we observed dividing cells in which each daughter had distinct quinol oxidase transcript abundance (Fig. 5C, inset), suggesting that asymmetric distribution of respiratory transcripts during division may be a mechanism by which these subpopulations are generated. This hypothesis is supported by previous studies in E. coli demonstrating that quinol oxidases exhibit unusually noisy gene expression and that asymmetric cell division is a major generator of heterogeneity (42)(43)(44).
Expression of cytochrome bd is dominant during acute urinary tract infection.
Previous studies reported that deletion of cytochrome bd impairs UPEC virulence in a UTI model (36). To gauge the contribution of each quinol oxidase during infection, we evaluated the fitness of ΔcyoAB, ΔappBC, and ΔcydAB mutants compared to the parent strain in a murine model of acute urinary tract infection. Consistent with the previous report (36), the ΔcydAB mutant exhibited an ϳ2-log decrease in bladder colonization by 24 h relative to the parent strain, while the mutants deleted for cyoAB and appBC colonized mice at the same level as the parent strain (Fig. 5M). Subsequent PNA-FISH on pooled urine obtained from mice infected with the parent strain revealed a marked enrichment in cytochrome bd-expressing cells and a corresponding reduction in the number of cells expressing cytochrome bo (Fig. 5H to L). This suggests either that the bladder environment induces transcription of cydABX or that only subpopulations of bacteria expressing cydABX are capable of efficiently colonizing the bladder. Together these data reveal the presence of subpopulations of bacteria that differentially express quinol oxidases as a potential bet-hedging mechanism to promote bladder colonization.
DISCUSSION
Cytochrome bd is a multifunctional protein that is central to respiration and can maintain activity in the face of nitrosative stress (34). As such, bacteria expressing cytochrome bd presumably exhibit a fitness advantage under growth conditions that are low in oxygen or high in metabolic by-products that increase nitric oxide concentration. The biofilm state, while protecting the bacterial residents from predation and desiccation, constitutes a high-density environment with several chemical gradients that result from the consumption and production of metabolites. Accordingly, expressing an enzyme that can facilitate tolerance to metabolic by-products, such as nitric oxide, would ensure that biofilm residents do not perish as a consequence of their own metabolic excretions. Our study elucidates the distribution of quinol oxidase expression in the biofilm state and indicates that the bulk of biofilm residents express cytochrome bd, particularly in the densely populated interior. The cytochrome bd-expressing bacteria are not necessarily using cytochrome bd for respiration, as many of them also have low levels of cytochrome bo and bd 2 transcripts (Fig. 2 and Fig. S3 and S4). Rather, the production of cytochrome bd may be leveraged toward providing tolerance to nitrosative stress, which irreversibly inhibits cytochrome bo. Indeed, in ΔcydAB biofilms we observe a marked increase in cytochrome bo expression (Fig. 4H), suggesting that loss of cytochrome bd impairs nitric oxide tolerance and that increased production of cytochrome bo may be a compensatory mechanism that allows biofilm bacteria to respire in the presence of high levels of nitric oxide.
In addition to acting as a respiratory inhibitor, nitric oxide regulates cyclic di-GMP abundance and thereby governs the switch from motility to aggregation and biofilm expansion (45,46). Consequently, if cytochrome bd decreases nitric oxide availability, it would indirectly influence ECM production. Consistent with this hypothesis, loss of the cytochrome bd-expressing subpopulation reduces the total abundance of matrix components and leads to gross alterations of biofilm architecture (Fig. 3). It is thus possible that the cytochrome bd-expressing subpopulation is critical for promoting the biosynthesis of the ECM by influencing the nitric oxide-cyclic di-GMP signaling axis. We are currently investigating this possibility.
Most importantly, this work revealed the presence of planktonic subpopulations that express distinct quinol oxidases during growth. In conjunction with the observation that only cytochrome bd expression is critical for fitness during infection, this finding suggests that basal expression of cytochrome bd under aerobic conditions serves as a bet-hedging mechanism that promotes the expansion of bacteria during the transition from the aerobic perineum to the hypoxic bladder. In addition to allowing for efficient respiration in the hypoxic bladder, expression of cytochrome bd provides resistance against nitrosative stress-a metabolic by-product and component of the innate immune response-and promotes the formation of resilient biofilm communities. Alternatively, cytochrome bd may serve as an oxygen scavenger, thereby reducing oxygen tension and allowing distinct UPEC subpopulations to utilize anaerobic respiratory pathways. Consistent with this hypothesis, the alternative terminal electron acceptors nitrate and trimethylamine oxide (TMAO) are known to be present in the urine, and the anaerobic reduction of nitrate to nitrite by Enterobacteriaceae is the basis of a commonly used clinical test used to diagnose urinary tract infection. Together our observations suggest the presence of respiratory bet-hedging behavior in UPEC and additionally suggest the possibility of targeting heterogeneity as a method for homogenizing bacterial populations and impeding their ability to colonize the urinary tract.
MATERIALS AND METHODS
Bacterial strains. All studies were performed in Escherichia coli cystitis isolate UTI89 (47). All gene deletions (ΔcyoAB, ΔappBC, and ΔcydAB) were performed using the -red recombinase system (48). Complementation constructs were created in plasmid pTRC99a with cydABX under the control of its native promoter as previously described (49). Primers used for gene deletions and complementation plasmid construction are listed in Table S1 in the supplemental material.
Growth conditions. For all analyses, strains were propagated overnight at 37°C with shaking in lysogeny broth (LB) (Fisher) at pH 7.4. To form colony biofilms, 10 l of overnight culture was spotted onto 1.2ϫ yeast extract-Casamino Acids (YESCA) agar (8) and allowed to grow at room temperature. Growth curves to assess tolerance to nitrosative or oxidative stress were performed in LB broth at 37°C with shaking, starting from an overnight culture normalized to optical density at 600 nm (OD 600 ) of 0.05. At 2 h post-inoculation, cultures were split into equal volumes and treated with 0.5 mM NOC-12, 1 mM H 2 O 2 or left unperturbed. OD 600 and CFU-per-ml measurements were taken every hour for 8 h.
RT-qPCR. RNA was extracted from day 11 colony biofilms or planktonic cultures using the RNeasy kit (Qiagen). RNA was DNase treated using Turbo DNase I (Invitrogen) and reverse transcribed using SuperScript III reverse transcriptase (Invitrogen). cDNA was amplified in an Applied Biosystems StepOne Plus Real-Time PCR machine using TaqMan MGB chemistry with the primers and probes listed in Table S1. All reactions were performed in triplicate with four different cDNA concentrations (100, 50, 25, or 12.5 ng per reaction). Relative fold difference in transcript abundance was determined using the ΔΔC T method (50) with target transcripts normalized to gyrB abundance from a total of 3 to 4 biological replicates.
Peptide nucleic acid fluorescence in situ hybridization (PNA-FISH). Day 11 biofilms were flash frozen in Tissue-Tek O.C.T. compound (Electron Microscopy Sciences) and cryosectioned as described previously (4). The PNA-FISH hybridization protocol was adapted from the work of Almeida et al. (51). Biofilm cryosections were fixed in 4% paraformaldehyde (PFA) for 30 min at room temperature and then dehydrated for 10 min in 50% ethanol. After dehydration, 100 l of hybridization solution (see below for details) was applied to the slides. All hybridizations were performed at 60°C for 30 min. Next, slides were submerged in prewarmed wash solution for 30 min, mounted using ProLong Diamond (ThermoFisher), and imaged using a Zeiss 710 confocal laser scanning microscope (CLSM). For planktonic cells, 1 ml of culture was sedimented, fixed in 4% PFA, resuspended in 50% ethanol, incubated at Ϫ20°C for 30 min, and resuspended in 100 l hybridization solution. After hybridization, cells were pelleted, resuspended in 500 l prewarmed wash solution, and incubated at 60°C for 30 min. Finally, cells were pelleted and resuspended in 100 l sterile water before being applied to microscope slides for imaging. Wash solution contained 5 mM Tris-HCl (pH 7.4), 15 mM NaCl, and 1% Triton X-100. Hybridization solution contained 10% (wt/vol) dextran sulfate, 30% formamide, 50 mM Tris-HCl (pH 7.4), 10 mM NaCl, 5 mM EDTA, 0.1% Triton X-100, and 200 nM (each) PNA-FISH probe. Probe sequences were based on the probes used for qPCR (efficiency of hybridization, rrsH, 81; cydA, 107; cyoA, 115; appC, 73) and were synthesized by PNA Bio (Newbury Park, CA). ATP measurements. ATP was quantified from mid-log (4 h after subculture) planktonic cultures using the Cell-Glo Titer kit (Promega). Cultures were normalized to an OD 600 of 0.5, pelleted, and resuspended in PBS. Fifty microliters of bacterial suspension was mixed with an equal volume of Cell-Glo Titer reagent and incubated with shaking at room temperature for 15 min. After incubation, luminescence was measured on a SpectraMax i3 plate reader (Molecular Devices). Luminescence was converted to concentration of ATP using a standard curve on the same plate.
Extracellular matrix extraction. Extracellular matrix was extracted using established methods (28). Briefly, biofilms were grown on YESCA agar containing 25 g/ml Congo red. After 60 h, biofilms were homogenized in cold 10 mM Tris-HCl (pH 7.4) using an Omni Tissue Homogenizer (motor speed 9) five times for 1 min per cycle. Next, the homogenate was centrifuged three times for 10 min at 5,000 ϫ g to remove cells. The supernatant was spiked with NaCl (final concentration, 170 mM) and centrifuged for 1 h at 13,000 ϫ g to pellet the matrix. The ECM pellet was washed in 10 mM Tris-HCl, pH 7.4, with 4% SDS and incubated at room temperature with rocking overnight. Next, the suspended ECM was centrifuged at 13,000 ϫ g for 1 h, resuspended in cold 10 mM Tris-HCl (pH 7.4), and centrifuged at 30,000 ϫ g for 20 min. Pelleted ECM was resuspended in MQ water and flash frozen.
Congo red depletion assays. ECM abundance was quantified using Congo red depletion assays adapted from established protocols (52). Colony biofilms grown on YESCA agar were harvested into PBS at specific time points and homogenized. Congo red (40 g/ml, final concentration) was added to homogenized biofilms, which were then incubated at 37°C for 1 h. After incubation, ECM was pelleted by centrifugation, the supernatant was removed, and supernatant absorbance (490 nm) was measured using a SpectraMax i3 plate reader (Molecular Devices).
Solid-state NMR measurements. All NMR experiments were performed in an 89-mm-bore 11.7T magnet using either an HCN Agilent probe with a DD2 console (Agilent Technologies) or a home-built four-frequency transmission line probe with a Varian console. Samples were spun at 7,143 Hz in either 36-l-capacity 3.2-mm zirconia rotors or thin-walled 5-mm-outer-diameter zirconia rotors. The temperature was maintained at 5°C with an FTS chiller (FTS Thermal Products, SP Scientific, Warminster, PA) supplying nitrogen at Ϫ10°C. The field strength for 13 C cross-polarization was 50 kHz with a 10% 1 H linear ramp centered at 57 kHz. The cross-polarization magic angle spinning (CPMAS) recycle time was 2 s for all experiments. 1 H decoupling was performed with continuous wave decoupling. 13 C chemical shifts were referenced to tetramethylsilane as 0 ppm using a solid adamantine sample at 38.5 ppm. The 15.6-mg wild-type 13 C CPMAS spectrum was the result of 32,768 scans, and the 8.3-mg mutant spectrum was the result of 100,000 scans. NMR spectra were processed with 80-Hz line broadening.
SDS-PAGE gels. A portion of the lyophilized ECM sample used for solid-state NMR analysis was resuspended in 98% formic acid and vacuum centrifuged. The samples were then reconstituted in SDS-PAGE sample buffer containing 8 M urea and 50 mM DTT and further diluted to desired concentrations. All samples were centrifuged briefly at 10,000 ϫ g to remove any insoluble material and used for electrophoresis. The gels were stained with instant blue and destained in water.
Immunofluorescence. An immunofluorescence assay targeting CsgA, the major curli subunit, was performed as previously described (9). Biofilm cryosections were fixed in 4% PFA for 30 min at room temperature and blocked overnight in 5% BSA at 4°C. Sections were washed in PBS, incubated with rabbit anti-CsgA antibodies (GenScript) (1:1,000) at room temperature for 1 h, washed in PBS, and incubated with Alexa Fluor 647 goat anti-rabbit IgG (ThermoFisher) (1:1,000) at room temperature for 1 h. Slides were counterstained with SYTO 9 and imaged using confocal laser scanning microscopy (CLSM).
Murine infections. Murine infections were performed as described previously (53). In brief, UTI89 and each mutant strain were inoculated individually into 5 ml LB medium and grown with shaking at 37°C for 4 h. Next, this culture was diluted 1:1,000 into 10 ml fresh medium and grown statically at 37°C for 24 h. After 24 h, this culture was diluted 1:1,000 into 10 ml fresh medium and grown for another 24 h at 37°C statically. Next, 7-to 8-week-old C3H/HeN female mice were transurethrally inoculated with 50 l PBS containing 10 7 CFU bacteria. Mice were sacrificed at 24 h postinfection, after which bladders were removed and homogenized for CFU enumeration. All animal studies were approved by the Vanderbilt University Medical Center Institutional Animal Care and Use Committee (IACUC) (protocol numbers M/12/191 and M1500017-01) and carried out in accordance with all recommendations in the Guide for the Care and Use of Laboratory Animals (54) of the National Institutes of Health and the IACUC.
Statistical analysis. All statistical analyses were performed in GraphPad Prism using the most appropriate test. Details of test used, error bars, and statistical significance cutoffs are presented in the figure legends. | v3-fos-license |
2019-05-10T13:55:48.965Z | 2019-05-09T00:00:00.000 | 148572362 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.nature.com/articles/s41598-019-43685-7.pdf",
"pdf_hash": "579b713fb47b207f87a12682edb43b11810ec13e",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119902",
"s2fieldsofstudy": [
"Chemistry",
"Biology"
],
"sha1": "579b713fb47b207f87a12682edb43b11810ec13e",
"year": 2019
} | pes2o/s2orc | De novo aggregation of Alzheimer’s Aβ25-35 peptides in a lipid bilayer
A potential mechanism of cytotoxicity attributed to Alzheimer’s Aβ peptides postulates that their aggregation disrupts membrane structure causing uncontrollable permeation of Ca2+ ions. To gain molecular insights into these processes, we have performed all-atom explicit solvent replica exchange with solute tempering molecular dynamics simulations probing aggregation of the naturally occurring Aβ fragment Aβ25-35 within the DMPC lipid bilayer. To compare the impact produced on the bilayer by Aβ25-35 oligomers and monomers, we used as a control our previous simulations, which explored binding of Aβ25-35 monomers to the same bilayer. We found that compared to monomeric species aggregation results in much deeper insertion of Aβ25-35 peptides into the bilayer hydrophobic core causing more pronounced disruption in its structure. Aβ25-35 peptides aggregate by incorporating monomer-like structures with stable C-terminal helix. As a result the Aβ25-35 dimer features unusual helix head-to-tail topology supported by a parallel off-registry interface. Such topology affords further growth of an aggregate by recruiting additional peptides. Free energy landscape reveals that inserted dimers represent the dominant equilibrium state augmented by two metastable states associated with surface bound dimers and inserted monomers. Using the free energy landscape we propose the pathway of Aβ25-35 binding, aggregation, and insertion into the lipid bilayer.
. Random walk of replicas over temperatures in a representative REST trajectory. The distribution of replicas over temperatures at the trajectory start is color-coded according to the scale at the right. Han and Hansmann [1] have proposed a quantitative measure of replica mixing defined as where T is the REST temperature and tr is the total number of REST iterations spent at T by replica r. If the total number of replicas is R=8, then the optimum theoretical value of m(T) for any temperature is 1 -1/R 1/2 = 0.65. In Fig. S2 we display the measure m(T) after averaging over all REST trajectories. Although there are some deviations near the ends of temperature range due to boundary effects, m(T) approaches the theoretical value at most REST temperatures. Thus, this figure suggests nearly ideal replica mixing.
Conformational sampling in REST simulations:
Our REST trajectories have been initiated with an equal mix of peptides that are surface bound or inserted into the DMPC bilayer. In all, we have produced six REST trajectories, in which each of eight replicas was simulated for 60 ns. To monitor equilibration, we first considered the probability distributions P(Zm) of the z-position of A25-35 peptide center of mass Zm along the DMPC bilayer normal. These distributions were computed at 330K over the six batches of 10 ns each using all six trajectories. Six corresponding distributions P(Zm) are presented in Fig. S3a. The first four distributions collected over first 40 ns of sampling demonstrate shifting probabilities of surface bound and inserted states reflecting the process of equilibration of binding of A25-35 dimers to the bilayer. However, the two distributions collected over the last 20 ns of sampling are nearly identical suggesting settling of the system in equilibrium state. The distance R between the centers of mass of A25-35 peptides forming a dimer in a leaflet can be used as a second measure of aggregation equilibration. To this end, we plot in Fig. S3b the distance R, which is averaged over six REST trajectories and pairs of dimers, as a function of REST time. If interactions between A25-35 peptides are at equilibrium, R should reach a plateu as a function of REST simulation time. Fig. S3b shows that this is indeed the case after approximately 40 ns of sampling. Thus, we determine that the equilibration time in our REST simulations of A25-35 dimers is eq≈40 ns. Aβ25-35 secondary structure: Table S1 compares secondary structure in Aβ25-35 monomers [2] and dimers by listing the average probabilities to observe helical <H>, −turn <T>, and random coil <RC> conformations. It reveals a moderate increase in the helical fraction <H> coupled with a simultaneous decrease in the turn content <T>. Similar but more pronounced changes are observed in the R4 C-terminus, which features a stable helical structure (>0.50).
Aβ25-35 intrapeptide interactions:
Effect of aggregation on intrapeptide interactions was assessed via the difference contact map <ΔC(i,j)> = <C(i,j)> -<C(i,j)>M, where <C(i,j)> and <C(i,j)>M are the dimer and monomer [2] contact maps reporting the formation of contacts between amino acids i and j. The contacts most affected by aggregation (|<C(i,j)>| ≥ 0.1) are shown in Table S2. These interactions reflect stabilization of helical structure in A25-35 dimers. In fact, two helix contacts (Gly29-Leu32, Gly29-Gly33) became particularly stable as their probability of formation reaches 0.74 and 0.70, respectively. However, because only three contacts out of 55 topologically possible are noticeably affected by aggregation and two of them (Gly29-Leu32, Gly29-Gly33) are already stable in A25-35 monomers (<C(i,j)>M>0.4) [2], we surmise that aggregation does not cause a radical change in A25-35 tertiary structure.
Table S2
List of intrapeptide contacts affected by aggregation.
A25-35 interactions with the DMPC bilayer:
Differences in the binding mechanism between A25-35 dimers and monomers were explored using the contact map <Cl(i,k)>, which reports the formation of contacts between amino acids i and lipid groups k . Fig. S4 shows the contact maps for A25-35 dimers and monomers as well as the difference in the number of contacts with lipids per amino acid <Cl(i)>= <Cl(i)> -<Cl(i)>M, where <Cl(i)> is the number of contacts formed by amino acid i with all lipid groups and subscript M refers to monomer [2]. The figure shows that peptide aggregation enhances interactions of all A25-35 amino acids with the DMPC bilayer. Detailed analysis of amino acid -lipid interactions is given in the main text.
Comparison of A25-35 inserted dimers and monomers:
Our simulations of A25-35 dimers suggest that aggregation does not qualitatively change the secondary and tertiary structure of A25-35 monomers.
To provide a direct evidence, we plot in Fig. S6 the residue-specific distribution of helical structure in inserted A25-35 ID dimers (Fig. 5) and inserted monomers I sampled in our previous REST simulations [2]. In both A25-35 conformational ensembles the helical structure is localized in the C-terminus (<H(R4)>=0.60 in ID and 0.40 in I). Consistent with Fig. 2 this figure also indicates that aggregation stabilizes helical structure in A25-35. In addition, Table S3 presents the list of stable intrapeptide contacts in these two A25-35 species. It follows from the table that all five stable ID intrapeptide contacts are also present as stable interactions in I. Fig. S6 and Table S3 also include the data for the inserted monomers IM sampled in the dimer simulations (Fig. 5). As in the two ensembles discussed above IM features a stable helix in R4 (<H(R4)>=0.66) and four out of five stable ID contacts appear among stable intrapeptide IM interactions. It is also worth noting that IM and I ensembles share three most stable contacts in the same descending order of stability. Thus, Fig. S6 and Table S3 demonstrate that A25-35 dimers utilize monomer-like peptide conformations, i.e., A25-35 monomers inserted into the DMPC bilayer are aggregation-ready.
Figure S6
Helical propensities <H(i)> for amino acids i in A25-35 dimers ID (in black), inserted monomers I from the previous study [2] (in red), and inserted monomers IM from the current study (in blue). Vertical bars show sampling errors. Regions R3-R4 are colored according to Fig. 1a.
Effect of insertion depth on helical propensity:
The helical propensity <H(Zm)> in A25-35 peptide as a function of the position of its center of mass along the bilayer normal Zm is presented in Fig. S7. It shows that in the peptides forming dimers <H(Zm)> steadily increases with the depth of their insertion in the bilayer. In contrast, the helical fraction remains largely unchanged, when A25-35 monomer binds to the DMPC bilayer. The likely reason for the differing outcomes is an increase in the hydrophobic moment of ID dimer composed of two head-to-tail helices compared to a stand-alone monomer. Indeed, using the hydrophobic scale of Wimley et al [3], we found that the hydrophobic moments of ID and inserted monomer IM are 5.0 and 4.1 Å kcal/mol, respectively. Increase in the helix fraction with the insertion depth has also been observed by Garcia and coworkers for WALP-16 peptide [4].
Possible impacts of bilayer composition and post-translational modifications on A25-35 aggregation:
It is important to discuss potential impact of bilayer composition on A25-35 aggregation. The aggregation mechanism summarized in Figs. 5 and 6 is likely to remain valid as long as binding to the bilayer induces helical structure in the A25-35 C-terminus. Although the precise details and the extent of this secondary structure transition depend on the bilayer composition, it was observed upon binding of A peptides to diverse bilayers, including the zwitterionic (DMPC, current work and [2]), anionic (DMPS [5]), or cationic (DMPC + lipopeptides [6]) bilayers and the cholesterol-enriched DMPC bilayer [7]. Therefore, we hypothesize that the formation of ID dimer may be robust against changes in the bilayer composition. Interestingly, our preliminary data on A25-35 monomer binding to the equimolar ternary bilayer composed of DMPC, PSM, and cholesterol support this conclusion by showing that binding to this bilayer promotes helical fraction approximately to the same extent as the pure DMPC bilayer [2]. It is important to note that the arguments presented above apply to A25-35 dimers, whereas larger oligomers may respond differently to changes in bilayer composition.
It is interesting to discuss the question whether A25-35 dimers promote permeation of Ca 2+ ions. We have studied binding of A10-40 monomers to the DMPC bilayer coincubated with 150 mM of Ca 2+ ions [8]. That work showed that Ca 2+ enhances binding affinity of anionic A10-40 by disrupting the intrapeptide salt bridge and by making zwitterionic DMPC partially cationic due to strong coordination of Ca 2+ with phosphate groups. In addition, anionic amino acids in A10-40 attract Ca 2+ ions bringing them with the peptide upon its shallow insertion into the bilayer. None of these factors are applicable to A25-35, which is cationic and does not have intrapeptide salt-bridges. Therefore, it is conceivable that Ca 2+ ions will decrease A25-35 affinity to the bilayer consistent with the experimental findings of Tatulian and coworkers [9]. Hence, we tentatively conclude that A25-35 dimer may not strongly affect Ca 2+ permeation and larger aggregates embedded in the bilayer are needed to change this outcome.
Importantly, the latter suggestion agrees well with the recent experiments showing that Ca 2+ permeating pores are built of up to eight A25-35 oligomers each involving from four to eight peptides [9] or formed by a single -barrel oligomer composed of six A25-35 peptides [10].
Finally, it is of interest to evaluate a possible effect of Ser26 phosphorylation on A25-35. Previous studies have shown that this post-translational modification stabilizes A1-40 oligomers and increases their cytotoxicity [11]. We are not aware of phosphorylation studies of A25-35, but our current findings allow us to speculate on its plausible implications. Phosphorylation of Ser26 will introduce a negative charge in the peptide N-terminus. Since Ser26 is bound to the DMPC headgroups, we do not expect that phosphorylation will directly affect the location of this residue within the bilayer. Also, because Ser26 is not part of ID dimer aggregation interface, phosphorylation is unlikely to directly impact the ID species. However, phosphorylated Ser26 may form a salt-bridge with Lys28 as it was recently shown in replica exchange simulations of A21-30 fragment [12]. If so, phosphorylation will indirectly compromise Lys28 binding to DMPC phosphate groups and, in turn, reduce A25-35 propensity to insert into the bilayer thus shifting its conformational ensemble away from the inserted dimers. This hypothesis will be tested in our future simulations. | v3-fos-license |
2020-07-29T14:58:01.469Z | 2020-07-27T00:00:00.000 | 220843287 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "http://www.cjps.org/article/doi/10.1007/s10118-020-2460-4",
"pdf_hash": "7e155f9d1b33284031b591895e650185adf3e9f3",
"pdf_src": "Springer",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119915",
"s2fieldsofstudy": [
"Chemistry",
"Materials Science"
],
"sha1": "7e155f9d1b33284031b591895e650185adf3e9f3",
"year": 2020
} | pes2o/s2orc | Highly Cis-1,4 Selective Polymerization of Conjugated Dienes Catalyzed by N-heterocyclic Carbene-ligated Neodymium Complexes
Neodymium complexes containing N-heterocyclic carbene (NHC) ligands, NdCl3[1,3-R2(NCH=)2C:]·THFx(Nd1: R = 2,6-iPr2C6H3, x = 0; Nd2: R = 2,6-Et2C6H3, x = 1; Nd3: R = 2,4,6-Me3C6H2, x = 1) were synthesized and employed as precatalysts for the coordination polymerization of conjugated dienes (butadiene and isoprene). In combination with triisobutylaluminium (TIBA), Nd1 promoted butadiene polymerization to produce extremely high cis-1,4 (up to 99.0%) polybutadienes with high molecular weight (Mw = 250–780 kg·mol−1). The Nd1/TIBA catalytic system also exhibited both high catalytic activity and cis-1,4 selectivity (up to 97.8%) for isoprene polymerization. The catalytic activity, molecular weight and molecular weight distribution of resulting polydienes were directly influenced by Al/Nd molar ratio, aging method, and polymerization temperature. Very interestingly, the high cis-1,4 selectivity of the catalyst towards butadiene and isoprene kept almost unchanged under different reaction conditions. The cis-1,4 polyisoprenes with high molecular weight (Mw = 210–530 kg·mol−1) and narrow molecular weight distribution (Mw/Mn = 1.9–2.7) as well as high cis-1,4 selectivity (~97%) could be synthesized by using the aged Nd1/TIBA catalytic system in the presence of isoprene (100 equivalent to Nd) at low Al/Nd molar ratios of 6–10. Polyisoprenes with low molecular weights (Mw = 12–76 kg·mol−1) and narrow molecular weight distributions (Mw/Mn = 1.7–2.6) were obtained by using Nd2 and Nd3 as precatalysts, indicating that the molecular weight of resulting polyisoprenes can be adjusted by changing the substitutes of ligand in Nd complex.
INTRODUCTION
Cis-1,4 selective polymerization of conjugated dienes, e.g. butadiene and isoprene, is of great importance in synthetic rubber industry to produce the high cis-1,4 polydienes with excellent properties such as excellent elasticity, high fatigue and crack resistance. [1] Catalyst, which mainly decides the catalytic activity and the microstructure of resulting polymers, plays an important role in the industrial production of polydienes. [2−5] Therefore, much effort has been devoted to developing various catalysts for producing polydienes with high cis-1,4-regularity and controlled molecular weight. [2−5] Rare earth based catalysts stand out as being highly active and selective for butadiene and isoprene polymerizations. [2−5] In general, these rare earth based catalysts are divided into two types: Ziegler-Natta catalytic system and cationic catalytic system. [3−5] The Ziegler-Natta rare earth metal catalysts, mainly the binary systems (LnCl 3 -R 3 Al) and ternary systems (LnL 3 -R 3 Al-X, Ln = lanthanide; L = carboxylate, phosphate, alkyl, or aryl oxide; X = compounds containing halogen atom), have been used in the synthetic rubber industry because of their advantages in easy preparation, thermal stability, and low moisture and air sensitivity. [3−5] The addition of oxygen-containing ligands, e.g. alcohols [6−8] and tetrahydrofuran, [9] enhanced the catalytic activity of the binary systems. Bidentate amidinate, [10−12] β-diketimines, [13] iminopyrrole, [14] indolide-imine, [15] aminopyridinato, [16] aminoindolyl, [17] alkoxy N-heterocyclic carbene [18] ligands, and tridentate pincer ligands, such as N^C^N, [19] C^C^C, [20] P^N^P, [22,23] N^C^O, [24] N^C^S, [24] N^N^O, [25,26] N^N^N [27−29] ligands were also used in the preparation of lanthanide complexes. Activated by organoborate cocatalyst, the obtained cationic catalytic systems display high catalytic activity and cis-1,4 selectivity toward conjugated diene polymerization. [10−29] The chemical structures of ancillary ligands could steer the behavior of the coordination polymerization and characteristics of the resulting polymers. The concept that the ligand plays regulatory role in the catalytic behavior of the catalyst was used to design Ziegler-Natta rare-earth metal catalysts. In the presence of triisobutylaluminium (Al i Bu 3 ), neodymium complexes containing heterocyclic Shiff base, [30] 8hydroxyquinolines, [31] quinolinylcarboxylates, [32] or NCN-pincer ligand [33,34] show high catalytic activity for isoprene polymerization with high cis-1,4 stereospecificity (95%−98%). Nheterocyclic carbene (NHC) has become an organo-catalyst and ubiquitous ligand in organometallic chemistry because of its extraordinary electron richness and facile access to structurally diverse analogues. [35] Scandium trialkyl complexes containing N-heterocyclic carbene ligand have been reported as precatalysts for α-olefin polymerization with excellent catalytic activity. [36,37] We also reported that the copolymerization of ethylene with propylene was realized by vanadium complexes containing NHC ligands and both the catalytic activity and microstructure of the resulting copolymers were influenced by the chemical structure of the NHC ligands. [38,39] Therefore, introduction of NHC ligand to NdCl 3 is of great interest for the development of a novel neodymium-based catalytic system with both high activity and regioselectivity for the coordination polymerization of the conjugated dienes. Herein, the synthesis of novel NdCl 3 ·NHC·THFx complexes (NHC: 1,3-R 2 (NCH=) 2 C:; Nd1: R = 2,6-i Pr 2 C 6 H 3 , x = 0; Nd2: R = 2,6-Et 2 C 6 H 3 , x = 1; Nd3: R = 2,4,6-Me 3 C 6 H 2 , x = 1) and their catalytic behavior for the coordination polymerizations of butadiene and isoprene upon activation with Al i Bu 3 were investigated. The Nd1-based catalytic system showed both high catalytic activity and 1,4-selectivity for conjugated diene polymerizations, affording polybutadienes with extremely high cis-1,4 content up to 99.0% and polyisoprenes with high cis-1,4 content of 97.8% as well as high molecular weight and narrow molecular weight distribution.
EXPERIMENTAL General Considerations
All manipulations of air-and moisture-sensitive compounds were performed in a nitrogen atmosphere using standard Schlenk techniques or under a nitrogen atmosphere in a drybox. Tetrahydrofuran (THF, Beijing Chemical Works) was distilled under nitrogen atmosphere and refluxed over sodium benzophenone for dehydration, and then stored in the drybox in the presence of molecular sieves (4Å). NdCl 3 ·xTHF [9] and NHC ligand [40] were prepared according to the reported methods. Chlorobenzene (C 6 H 5 Cl, Tianjin Fuchen Chemical Co.) was freshly distilled from phosphoric anhydride. Hexanes and cyclohexane (Beijing Yanshan Petrochemical Co.) were dried over calcium hydride (CaH 2 ) and distilled before use. Isoprene (purity: 99.9%, Beijing Yanshan Petrochemical Co.) was freshly distilled from CaH 2 before use. Butadiene (Beijing Yanshan Petrochemical Co.) and triisobutylaluminium solution in hexanes (0.74 mol·L −1 , Beijing Yanshan Petrochemical Co.) were used as received.
Procedure of Conjugated Diene Polymerization
All the operations were conducted under an atmosphere of dry nitrogen. For the polymerization using the in situ prepared catalyst, the conjugated diene monomers (butadiene or isoprene) and solvent were introduced into a vessel and Al i Bu 3 was added. Then, the solution of Nd complex was introduced into the vessel to start the coordination polymerization of conjugated diene at a defined temperature. For the polymerization using the aged catalyst, the mixture of Nd complex and Al i Bu 3 in the presence of different amounts of monomer was aged at the fixed temperature for the designated time in advance. The conjugated diene monomers (butadiene or isoprene) and solvent were introduced into a vessel and then the aged catalyst solution was added to start the coordination polymerization of conjugated diene at a defined temperature. The vessel with stirring was placed in a bath with constant temperature during the polymerization. After a definite time, the polymerization was terminated by addition of ethanol containing 1% of 2,6-di-tertbutyl-4-methylphenol. Then the mixture was poured into ethanol containing a small amount of hydrochloric acid. The precipitated polymer was further washed by ethanol and then was dried under vacuum at 45 °C until a constant weight.
Characterization of Resulting Polymers
Molecular weights of resulting polybutadienes and polyisoprenes, i.e. number-average molecular weight (M n ), weightaverage molecular weight (M w ), and polydispersity index (PDI, M w /M n ), were determined by gel permeation chromatography (GPC) using a Waters 1515-2410 system equipped with Waters RI 2410 and UV 2489 detectors and four Waters styragel HT3-4-5-6 columns (Milford, MA). The polymer sample was dissolved in THF with concentration of 2 g·L −1 . THF was used as eluent and the flow rate of the mobile phase was 1.0 mL·min −1 at 30 °C. The calibration curve was obtained by polystyrene standard. The contents of cis-1,4, trans-1,4, and 1,2 structures of resulting polydienes were determined using FTIR analysis according to the reported method. [42] The film of the copolymer was prepared by spreading a small amount of dichloromethane (CH 2 Cl 2 ) solution of the copolymer on the slice of KBr after the evaporation of CH 2 Cl 2 . The copolymer was characterized on a Nexus 670 FTIR spectrophotometer (Nicolet, Medison, WI).
Synthesis of Nd Complexes with NHC Ligands
The reaction of equimolar quantities of NHC ligands and NdCl 3 ·xTHF (x = 1,2,3) in THF under nitrogen at 25 °C for 5 h afforded the Nd complexes Nd1−Nd3, as shown in Scheme 1. All the paramagnetic complexes Nd1−Nd3 were characterized by elemental analysis and the Nd contents of these complexes were determined by titration. The results indicated that one THF molecule was incorporated in the complexes of Nd2 and Nd3, respectively. Comparably, no THF molecule existed in Nd1 complex due to the bulky isopropyl substitutes on phenyl rings in ligand.
Coordination Polymerization of Conjugated Dienes Using Nd1 as Precatalysts
Butadiene polymerization with the unaged Nd1/Al i Bu 3
catalytic system
The neodymium complex Nd1 containing NHC ligand with bulky isopropyl substituents at the ortho positions of the phenyl rings was employed as precatalysts and triisobutylaluminum (Al i Bu 3 , Al) was used as a cocatalyst to investigate the coordination polymerization of conjugated dienes (butadiene and isoprene). Butadiene polymerizations and isoprene polymerizations under various Al/Nd molar ratios, polymerization temperatures (T p ), and polymerization time (t p ) were investigated using prepared Nd1/Al i Bu 3 catalytic system, in which the active centers formed in situ in the polymerization system. The experimental results are summarized in Table 1. It can be seen from the data in Table 1 that the conversion of butadiene and catalytic activity increased along with an increase in Al/Nd molar (entries 1−3 and 5−8). The neodymium complex Nd1 displayed good catalytic activity (2.8 × 10 4 g·mol −1 of Nd) for butadiene polymerization at Al/Nd molar ratio of 50 (entry 4 in Table 1), albeit poor catalytic activities were observed at low Al/Nd molar ratio (entries 1 and 2 in Table 1). Remarkably, polybutadiene with high cis-1,4 content of ~99.0% and high molecular weight (M w = 540 kg·mol −1 ) was obtained. The conversion of butadiene could be improved obviously from 6% to 20% at the Al/Nd ratio of 15 by increasing T p from 25 °C to 50 °C. As Al/Nd molar ratio increased from 15 to 50, the conversion of butadiene increased from 20% to 60%, and the catalytic activity increased from 1.4 × 10 4 g·mol −1 of Nd to 4.1 × 10 4 g·mol −1 of Nd (entries 5−8 in Table 1). Polybutadiene with high molecular weight (M w = 470 kg·mol −1 ) and uniform molecular weight distribution was afforded at the Al/Nd molar ratio of 15 (entry 5 in Table 1). However, the molecular weight distribution became broader (4.6−14.0) indicating that multiple active species formed or chain transfer reaction speeded up with increasing Al/Nd molar ratio. Interestingly, the distinguished cis-1,4 selectivity kept almost unchanged (97.9%−98.8%) in a broad range of Al/Nd molar ratio from 15 to 50 (entries 5−8 in Table 1). Overall, polybutadienes with high cis-1,4 contents were obtained by polymerization of butadiene using Nd1/Al i Bu 3 catalytic system. The Al/Nd molar ratio and polymerization temperature have an obvious influence on the catalytic activity, molecular weight, and molecular weight distribution.
Isoprene polymerization with the unaged Nd1/Al i Bu 3 catalytic system
According to the above investigation on butadiene polymeri- zation, Nd1 containing NHC ligand with bulky isopropyl substituents at the ortho positions of the phenyl rings was also selected as precatalyst for the coordination polymerization of isoprene herein. The effects of Al/Nd molar ratio and polymerization temperature on isoprene polymerization were investigated using unaged Nd1/Al i Bu 3 catalytic system. The results are summarized in Table 1 (entries 9−20). The isoprene polymerization was carried out and the yield of polymer was negligible under the similar polymerization conditions to those for butadiene polymerization. Negligible polyisoprene was obtained in the mixed solvent of hexane and cyclohexane, possibly due to the poor solubility of catalyst in the polymerization system. Chlorobenzene was firstly selected as a good solvent in the polymerization of isoprene to investigate systematically the effects of chemical structure of ligands, preparation process of catalytic system, and polymerization conditions on the catalytic activity and the microstructure of the resulting polymers. The amount of cocatalyst, which is usually expressed by the molar ratio of Al/Nd, has a significant influence on the catalytic activity and molecular weight and molecular weight distribution of the resulting polyisoprenes. It can be seen from Table 1 that an increase in isoprene conversion and catalytic activity could be noticed as the Al/Nd molar ratio increased (entries 10−14). The isoprene conversion of 71% and the catalytic activity of 5.0 × 10 4 g·mol −1 of Nd at T p of 50 °C could be obtained at Al/Nd molar ratio of 30 (entry 14 in Table 1). The molecular weight of the resulting polyisoprene decreased with an increase in Al/Nd molar ratio probably due to the more chain transfer reaction to Al i Bu 3 at higher Al/Nd molar ratio. It is worth noting that the microstructure of the resulting polyisoprenes was not affected by the change of Al/Nd molar ratio. As shown in Table 1, polyisoprenes with cis-1,4 content of ca. 96% could be prepared at T p of 50 °C when the Al/Nd molar ratio increased from 10 to 30. Isoprene polymerizations were carried out at polymerization temperature (T p ) ranging from 30 °C to 60 °C and the results are given in Table 1 (entries 15−20). It can be clearly observed that T p influenced the isoprene conversion, catalytic activity, and molecular weight, molecular weight distribution, and cis-1,4 content of the resulting polyisoprenes. It can be seen from Table 1 that isoprene conversion greatly increased from 50% to 84% and catalytic activity increased from 3.5 × 10 4 g·mol −1 of Nd to 5.9 × 10 4 g·mol −1 of Nd when T p was elevated from 30 °C to 50 °C (entries 15−20). However, the overall catalytic activity and isoprene conversion decreased when T p was higher than 50 °C since the catalyst deactivation became more prominent at higher polymerization temperature. Similar to other reported catalytic systems, [30,31,33] a slight decrease in cis-1,4 content in polymer products with increasing polymerization temperature can be observed. The GPC traces of the resulting polyisoprenes prepared at different temperatures from 30 °C to 50 °C are displayed in Fig. 1. It can be seen that all the GPC traces of the resulting polyisoprenes exhibit bimodal and broad molecular weight distribution. The overall molecular weight decreased greatly and the molecular weight distribution became broad with an increase in T p , as shown in Fig. 2. The chain transfer side reaction could be accelerated with increasing polymerization temperature and thus the overall molecular weight decreased greatly.
Isoprene polymerization using the aged Nd1/Al i Bu 3 catalytic system
The catalyst components of Nd1 and Al i Bu 3 reacted to form the active centers prior to the addition to the monomer solution, which is also referred to as catalyst aging process. Both the aging temperature (T a ) and aging time (t a ) played important roles in the formation of active centers in the aging process of catalyst. The obtained catalyst solution after the aging process was used for isoprene polymerization. The experimental results of isoprene polymerization using the above aged catalyst are displayed in Table 2 (entries 2−7) and isoprene polymerization using the unaged catalyst is also displayed in Table 2 (entry 1) for comparison. It can be found from Table 2 that isoprene conversion increased greatly from 2% to 25%−95% and catalytic activity increased greatly from 0.2 × 10 4 g·mol −1 of Nd to 6.7 × 10 4 g·mol −1 of Nd by using the aged catalyst instead of unaged catalyst under similar polymerization conditions. The catalytic behavior of aged Nd1/Al i Bu 3 catalytic system is affected by T a . The isoprene conversion increased from 25% to 87% and the catalytic activity increased from 1.8 × 10 4 g·mol −1 of Nd to 6.1 × 10 4 g·mol −1 of Nd along with an increase in T a from 40 °C to 60 °C at t a of 30 min, while the cis-1,4 selectivity kept at around 96.5% (entries 2, 4, and 7 in Table 2). The isoprene conversion and catalytic activity increased while the Table 2). All the results indicate that the catalytic activity could be remarkably improved by aging process of the catalysts.
The reaction of Nd complex with Al i Bu 3 results in the formation of Nd compounds with σ-alkyl bonds in the absence of monomer. However, the reaction of Nd complex with Al i Bu 3 results in the formation of the π-allyl Nd complexes in the presence of monomer, which exhibit a higher stability than that of Nd compounds with σ-alkyl bonds. The isoprene polymerization using the aged Nd1/Al i Bu 3 catalyst in the presence of isoprene (Ip/Nd = 100) prepared for different aging time (t a ) was further investigated and the experimental results are displayed in Table 2 (entries 8−12). In order to distinguish two different aging methods and express clearly, aging method without isoprene is expressed as method A, while aging method with isoprene is expressed as method B. Isoprene conversion in the polymerization process could reach 99% and the catalytic activity could reach 6.9 × 10 4 g·mol −1 of Nd even at T p of 0 °C for polymerization time of 14 h by using the aged ternary catalyst with t a of 3 min. A very high conversion of 93% and catalytic activity of 6.5 × 10 4 g·mol −1 of Nd can also be obtained with the aging time of 9 min, which implies enough operation time. However, monomer conversion decreased to 21% if t a was 60 min, which was a different trend from that in aging method A. The molecular weight of the obtained polyisoprenes was also affected by aging time. The molecular weight of polyisoprenes increased with an increase in aging time, which might be attributed to the decreasing amount of active species in the catalytic system with increased t a . The aging time hardly affected the cis-1,4 content of the resulting polyisoprenes, indicating that the catalytic system displayed high cis-1,4 selectivity at even at long aging time.
Although high isoprene conversion and preparation of polyisoprene with high molecular weight were realized, the molecular weight distribution was still broad. Therefore, the isoprene polymerizations with ternary catalyst (B) with low Al/Nd molar ratios were further conducted at low T p of −15 °C. As shown in Table 2 (entries 13−22), the molecular weight distribution of resulting polyisoprenes at low T p of −15 °C became much narrower than those of polyisoprenes synthesized at T p s of 0 and 25 °C, although the conversion of isoprene and catalytic activity decreased to 21%−53% and 1.5 × 10 4 − 3.7 × 10 4 g·mol −1 of Nd, respectively. The isoprene conversion of 53% could be obtained even the Al/Nd molar ratio was decreased to 8 by optimization of t a (entry 17 in Table 2). The regular effect of Al/Nd molar ratio on isoprene conversion was not observed. Very importantly, polyisoprenes with high molecular weight (M w ) ranging from 210 kg·mol −1 to 530 kg·mol −1 and narrow molecular weight distribution (M w /M n = 1.9−2.7) could be obtained at various Al/Nd molar ratios and t a s at low T p of −15 °C (entries 13−22 in Table 2). The relatively unimodal GPC traces of resulting polyisoprenes are displayed in Fig. 3. The influences of t a on M w and M w /M n were different at various Al/Nd molar ratios due to the complicated reaction of Nd1 with Al i Bu 3 in the presence of isoprene. Polyisoprene with high molecular weight (530 kg·mol −1 ) and narrow molecular weight distribution (M w /M n = 2.4) could be successfully synthesized at T p of −15 °C using the ternary catalyst (Ip/Al/Nd molar ratio = 100/6/1) by aging method B. Moreover, higher cis-1,4 selectivity (96.9%−97.6%) was observed using the ternary catalyst than that using unaged binary catalyst (entries 8−22 in Table 2 versus entries 9−19 in Table 1). The representative FTIR spectra of resulting polyisoprenes prepared by using aged ternary catalyst and unaged binary catalyst are shown in [27][28][29][30][31][32]42] As shown in Fig. 4, a stronger band at 1128 cm −1 and a weak band at 889 cm −1 can be observed in the FTIR spectrum of polyisoprene prepared by the aged ternary catalyst as compared with that of polyisoprene prepared by the unaged binary catalyst, indicating that the aged ternary catalyst displayed higher cis-1,4 selectivity than that of the unaged binary catalyst. The results of isoprene polymerization using aged catalyst indicate that the catalytic activity could be improved obviously by aged catalyst. Polyisoprene with high molecular weight and broad molecular weight distribution could be afforded by using aged Nd1/Al i Bu 3 catalytic system, while polyisoprene with high molecular weight and narrow molecular weight distribution could be afforded by using aged ternary catalyst (Ip/Nd1/Al i Bu 3 ).
Effect of Ligands in Nd Complexes on Catalytic Activity and Microstructure of Resulting Polydienes
Isoprene polymerizations by using Nd complexes containing NHC ligands with ethyl (Nd2) or methyl substitutes (Nd3) at the N-aryl ring were investigated. The experimental results of isoprene polymerizations at various Al/Nd molar ratios are summarized in Table 3. The aged ternary catalysts (Ip/Nd2/ Al i Bu 3 and Ip/Nd3/Al i Bu 3 ) prepared by aging method B exhibited both good activity and high cis-1,4 selectivity at relatively high Al/Nd molar ratios. At optimized Al/Nd molar ratio, the isoprene conversion and catalytic activity for Nd2 were 61% and 4.4 × 10 4 g·mol −1 of Nd, respectively. Meanwhile, the isoprene conversion and catalytic activity for Nd3 were 83% and 6.0 × 10 4 g·mol −1 of Nd, respectively. Polyisoprenes prepared by using precatalyst Nd2 at the Al/Nd ratios of 15 and 20 exhibited high cis-1,4 content of 97.8% (entries 1 and 2 in Table 3). The molecular weight and molecular weight distribution of the resulting polymers were significantly influenced by the structure of the Nd complex. Compared to polyisoprenes prepared with Nd1, polyisoprenes with the drastically lower molecular weight (M w = 12−51 kg·mol −1 for Nd2 and 15−76 kg·mol −1 for Nd3) and unimodal molecular weight distribution (M w /M n = 1.7−2.6) were afforded by using Nd2 or Nd3 as the precatalyst (entries 1−7 in Table 3). The result suggests that a uniform active species existed during polymerization of isoprene using Nd2 or Nd3 as precatalyst. 26 28 30 32 34 36 Elution time (min) Al/Nd = 6, t a = 3 min (entry 20 in Table 2) Al/Nd = 8, t a = 3 min (entry 17 in Table 2) Al/Nd = 10, t a = 3 min (entry 13 in Table 2) Signal intensity Table 2).
Fig. 4
Representative FTIR spectra of resulting polyisoprenes prepared by using aged ternary catalyst (entry 13 in Table 2) and unaged binary catalyst (entry 17 in Table 1). The average number of polymer chains (n calcd ) can be calculated by the ratio of m p and M n due to the narrower molecular weight distribution, where m p is the weight of the resulting polyisoprene and M n is number-average molecular weight of the resulting polyisoprene (kg·mol −1 ). The theoretical numbers of polymer chains (n theo ) in the copolymerization system were 4.0 × 10 −5 mol. It can be observed that n calcd is much higher than n theo for Nd2/Al i Bu 3 catalytic system (Al/Nd = 20 and 30) and Nd3/Al i Bu 3 catalytic system (Al/Nd = 30 and 40), which is attributed to serious chain-transfer reaction to a cocatalyst during isoprene polymerization. The molecular weight and molecular weight distribution of resulting polyisoprenes are greatly affected by the structure of the ligand (as shown in Fig. 5). Polyisoprenes with the low molecular weights and narrow molecular weight distributions were obtained by using complexes Nd2 and Nd3 bearing NHC ligands with ethyl or methyl substitutes at the N-aryl ring due to the combination of steric hindrance effect and electronic effect of the ligands. Comparatively, polyisoprenes with the higher molecular weights were prepared by using complex Nd1 containing NHC ligand with bulky isopropyl substitutes. Therefore, polyisoprenes with low or high molecular weight and narrow molecular weight distribution could be afforded by changing the substitutes at the N-aryl rings of the Nd complex. The effect of ligand on the molecular weight of resulting polyisoprenes also indicates that the NHC ligand was associated with the active Nd centers during polymerization of isoprene.
CONCLUSIONS
A new binary catalytic system containing N-heterocyclic carbenes-ligated neodymium complex and Al i Bu 3 was developed for highly cis-1,4 selective polymerization of butadiene and isoprene. The Nd1/Al i Bu 3 catalytic system provided high cis-1,4 selectivity up to ~99% for polymerization of butadiene. The Al/Nd molar ratio and polymerization temperature had little effect on the regioselectivity, whereas the conversion of butadiene and catalytic activity increased with an increase in Al/Nd molar ratio. The new unaged binary catalytic system possessed high catalytic activity for the polymerization of isoprene, affording polyisoprenes with the high cis-1,4 content (95.8%−97.3%) and molecular weight (260−670 kg·mol −1 ). Importantly, the activity of the aged catalyst was superior over the unaged catalyst. Aging Nd1 and Al i Bu 3 in the presence of isoprene was beneficial to forming uniform active species and thus polyisoprenes with the narrow molecular weight distribution (M w /M n = 1.9−2.7) could be obtained. Meanwhile, the resulting polyisoprenes had the high molecular weight (M w = 210−530 kg·mol −1 ) and high cis-1,4 content (96.5%−97.6%). The structure of NHC ligand played a significant role in controlling the molecular weight of resulting polyisoprenes. Polyisoprenes with the low molecular weight (M w = 12−76 kg·mol −1 ) and narrow molecular weight distribution (M w /M n = 1.7−2.6) were obtained by using Nd complexes bearing the less sterically bulky NHC ligand (Nd2 and Nd3). Remarkably, the distinguished cis-1,4 selectivity almost kept unchanged during isoprene polymerization under broad ranges of Al/Nd molar ratio, polymerization temperature, aging time, and aging temperature. These results would provide significant insight into the design of catalyst for highly 1,4-cis selective polymerization of conjugated dienes. | v3-fos-license |
2018-12-12T19:54:06.416Z | 2018-11-29T00:00:00.000 | 54448002 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "http://www.scielo.br/pdf/rlae/v26/0104-1169-rlae-26-e3075.pdf",
"pdf_hash": "445348a522cc2f8182b8a18e0ce216e194ef3465",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119956",
"s2fieldsofstudy": [
"Medicine"
],
"sha1": "1887d5c3f79e2aefbc0bf8a5ba84adc639b43c56",
"year": 2018
} | pes2o/s2orc | Safety of a formulation containing chitosan microparticles with chamomile: blind controlled clinical trial
ABSTRACT Objective: to evaluate the safety of a topical formulation containing chamomile microparticles coated with chitosan in the skin of healthy participants. Method: phase I blind, controlled, non-randomized, single-dose clinical trial with control for skin, base formulation, and formulation with microparticles. The variables analyzed were irritation and hydration by the Wilcoxon and Kruskall-Wallis tests. Results: the study started with 35 participants with a mean age of 26.3 years. Of these, 30 (85.71%) were female, 29 (82.90%) were white skinned and 32 (91.40%) had no previous pathologies. One participant was removed from the study reporting erythema at the site of application, and four other participants for not attending the last evaluation. In the 30 participants who completed the study, the tested formulation did not cause erythema, peeling, burning, pruritus or pain; there was an improvement in cutaneous hydration in the site of application of the formulation with microparticles. In the evaluation of the barrier function, there was an increase in transepidermal water loss in all sites. Conclusion: the formulation with chamomile microparticles is safe for topical use, not causing irritation and improving skin hydration over four weeks of use. Its effects on barrier function need further investigation. No. RBR-3h78kz in the Brazilian Registry of Clinical Trials (ReBEC).
Introduction
The skin, as the interface of the human body with the external environment, carries part of our identity: it provides information about our age, genetics, health status, lifestyle and even our emotional state (1) . The skin has different roles, among them, the function of barrier, thermoregulation, vitamin D synthesis and also protection of the body against harmful agents (2)(3) .
Currently, there is a growing interest on skin care products and their protective and healing properties, especially those with botanical extracts (4) . Among the latter, Chamomilla recutita (L.) rauschert (chamomile) is a popular plant (5) which has its use as a phytotherapic released by the National Agency of Sanitary Surveillance (ANVISA) (6) . Chamomile has flavonoids, among which apigenin and apigenin-7-glycoside are the most abundant (7) . In different studies, these substances have proved to have antimicrobial (8) , analgesic (9) , antiinflammatory (6,8,(10)(11) , cicatrizant (12)(13) , antitumor (14)(15) and immunomodulator (16) potential. Moreover, the antioxidant blend present in chamomile extract is effective in reducing free radicals and brings potential benefits when used in skin formulations by reducing water loss, improving hydration, and aiding the maintenance of the barrier function (4) .
The risks associated with the use of this plant are small and are related to the reduction of platelet aggregation (17) and anaphylactic reactions to people sensitive to its components (18) . However, a recent study that evaluated allergic reactions to herbal compounds over the last 27 years found no reports related to Chamomilla recutita (L.) rauschert (19) .
Despite the potential of apigenin and apigenin-7glycoside, they have low stability (15,(20)(21)(22) . An alternative to improve this issue is the use of controlled release systems. The pharmaceutical sector, in line with technological developments, has gradually improved the processes of obtaining different products and invested in the forms of producing and applying them. To this end, microencapsulation is a widely used technology aimed at optimizing industrial processes as well as increasing the bioavailability and stability of the formulations. This process can be accomplished by different methods, using various coatings. In this study, the selected coating was chitosan and the method of production was spray drying (21) .
This polymer was also used to coat microparticles containing endothelial and epidermal growth factors, with positive results in improving the cicatrization process (29) , and also as a coating of microparticles capable of capturing and expanding specific cells in order to accelerate the anti-inflammatory and cicatrization processes (30) .
Despite all the potentialities of chitosan-coated microparticles and the therapeutic properties of chamomile, no studies with these compounds were identified in the literature. These microparticles are incorporated in lanolin-based formulation, a safe substance for topical applications that incorporates various bioactive agents (31) .
In view of the above, a study was carried out to evaluate the safety of the topical formulation containing chitosan-coated Chamomilla recutita (L.) Rauschert microparticles for application on the skin of healthy volunteers evaluating the following variables: erythema, variation in the amount of melanin, desquamation, burning, pruritus, pain and alterations in cutaneous hydration. The hypothesis was that the use of this formulation would be safe for cutaneous application over four weeks of use.
Method
Blind, controlled, non-randomized, single-dose Phase I clinical trial in which a low dose with biological activity of the active ingredient was administered (32) .
Extraction and microencapsulation methodologies developed and validated in a previous study were applied for the development of the microparticles used in this study (21) . Quality tests of the plant acquired according to the guidelines of the Brazilian Pharmacopoeia (34) were carried out in another study developed by the main author, as well as preliminary permeation and stability tests of the formulation in an ex vivo model. The criteria for inclusion of participants were: age (18 years and over); healthy skin in the site of application of the product (forearms); absence of history of hypersensitivity to fish, seafood or any component of the formulation (chamomile, chitosan or lanolin); non-use of heparin, oral anticoagulants, and antiplatelet agents. The exclusion criteria were: injury at the sites of application, express intention to stop participation, and non-application of the product for more than four consecutive days. National (35) and international (32) recommendations about studies aiming at the initial evaluations of tolerance and safety in healthy humans were considered; the participation of 20 to 100 individuals is recommended.
The study was carried out in partnership with the in the proximal portion of both, no product was applied to allow assessment of skin conditions (right negative control -C1; left negative control -C2). The dose was applied once a day, daily, always at the same time, and the participants were instructed not to use any other product at the application and evaluation sites during the 28 days of study.
Results
A total of 52 participants were evaluated for eligibility and recruited by the principal investigator. Of these, 17 did not attend the appointment; thus, 35 participants were allocated to the study. The study was completed after four weeks, according to the initial schedule plan. Table 2. Concerning sex, 30 (85.7%) of the participants were female (Table 1). Skin characteristics such as erythema, melanin, elasticity, thickness, transepidermal water loss and pH vary in the different anatomical sites between men and women and also in the different age groups (39)(40)(41)(42) . Authors point out the importance of considering variations in the biophysical properties of the skin at different ages, genders and anatomical locations because these differences are related to individual susceptibility to skin diseases; they should be considered in studies and in the production of skin products (41) .
Discussion
The same occurs with BMI. This variable influences skin quality and, therefore, selecting a sample with a wide variation of BMI is important to understand the action of the product in a broader way. In this study, BMI also varied considerably, with a mean of 23.2 (Standard (41) . Besides anatomical issues, this fact can be explained by difference in sun exposure (41) , corroborating with the findings of this study. Personal factors such as age, sex, race, anatomical site and skin surface properties, as well as environmental factors such as light conditions, temperature, humidity and climatic variations can influence the color of the skin (41,44) .
The function of melanin is the protection of the DNA of the keratinocytes against radiation (45) ; it is known that its concentration, its type and its location represent important factors in the evaluation of skin color, as well as in the evaluation of blood flow, thickness, softness and degradation of skin proteins (46) . A study that evaluated the effects of a tamarindcontaining emulsion on melanin identified a reduction in the amount of melanin at the application sites and attributed this result to the presence of phenolic compounds present in the extract (47) . It is known that chamomile contains several phenolic compounds in its composition, a fact that suggests the need for future studies to better investigate this property.
In the pH evaluation, there was no difference between the sites in D0 (p = 0.0819), but there was a pH is also a variable that varies in the different body regions (42) . In this study, it is believed that the difference is the result of the application of the formulation with chamomile, which caused an increase in its mean value, despite remaining within the physiological limits. Chamomile extract was evaluated for toxicity, presenting safety at the dosages recommended for humans, without cytotoxic, genotoxic or mutagenic effects (48) . The use of chitosan in nanocapsules with alginate, for the treatment of infectious or inflammatory conditions of the skin showed antibacterial, antiinflammatory and controlled release activity, without causing skin irritation (49) . A study on the toxicity of lanolin and its effect on animal cicatrization concluded that it has no toxic effect on monocytes, important cells of the cicatrization process (50) .
As for the participant who was removed from the study in D1 due to a report of local reaction, the event is attributed to a possible unknown personal sensitivity to the components of the formulation, since this was an However, these products do not present chitosan microparticles with chamomile; microparticles that promote an increase in the stability of the encapsulated botanical extract and also the slow and controlled release of their actives that can be a differential.
The study had as possible limitations the nonrandomization of the application sites and the nonmeasurement of the exact amount of the product to be applied.
It is, therefore, a technological product that uses in its composition an active principle with proven biological activities with the advantage of presenting a
Conclusion
The hypothesis that the lanolin formulation, | v3-fos-license |
2019-04-21T13:04:02.725Z | 2019-04-01T00:00:00.000 | 125079011 | {
"extfieldsofstudy": [
"Medicine",
"Computer Science",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/1424-8220/19/8/1846/pdf",
"pdf_hash": "655a397974e15af886bae37dcfb6251e61bc0ee3",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119978",
"s2fieldsofstudy": [
"Biology",
"Engineering"
],
"sha1": "965a1ee0a836b0970f4f60bf862e749ae8f56a26",
"year": 2019
} | pes2o/s2orc | A Biosensor Platform for Metal Detection Based on Enhanced Green Fluorescent Protein
Microbial cell-based biosensors, which mostly rely on stress-responsive operons, have been widely developed to monitor environmental pollutants. Biosensors are usually more convenient and inexpensive than traditional instrumental analyses of environmental pollutants. However, the targets of biosensors are restricted by the limited number of genetic operon systems available. In this study, we demonstrated a novel strategy to overcome this limitation by engineering an enhanced green fluorescent protein (eGFP). It has been reported that combining two fragments of split-eGFP can form a native structure. Thus, we engineered new biosensors by inserting metal-binding loops (MBLs) between β-strands 9 and 10 of the eGFP, which then undergoes conformational changes upon interaction between the MBLs and targets, thereby emitting fluorescence. The two designed MLBs based on our previous study were employed as linkers between two fragments of eGFP. As a result, an Escherichia coli biosensor exhibited a fluorescent signal only when interacting with cadmium ions, revealing the prospect of a new biosensor for cadmium detection. Although this study is a starting stage for further developing biosensors, we believe that the proposed strategy can serve as basis to develop new biosensors to target various environmental pollutants.
Introduction
Environmental pollution has become a major problem in recent years and has been steadily increasing with rapid industrial development, adversely affecting, among other factors, human health. Several measures have been developed and applied to reduce environmental pollution. However, mitigating pollution remains a challenge because a massive amount of industrial materials are being released to the environment. To preserve environmental systems and relieve the adverse effects of pollutants, monitoring and detecting the amount of pollutants is an essential first step.
Environmental monitoring is typically focused on the quantification of target pollutants in the environment using analytical instruments [1,2]. Typical methods are time-consuming, expensive, and only provide the total amount of pollutants in a region. However, measuring the total amount of pollutants might lead to overestimation of their risk, as instrumental analysis usually extracts the general concentration of all pollutants from environmental samples but neglects pollutant-environment interactions [3,4]. Consequently, the amount of active pollutants affecting living organisms is usually below the total ratio of pollutants. In fact, the total amount and bioavailable portion of pollutants, especially in soils, have shown divergent results [5,6]. Therefore, bioavailability and (St. Louis, MO, USA) and used to prepare 10 mM stock solutions. The fluorescence signals of eGFP were measured by FS-2 fluorescence spectrophotometer (Scinco, Seoul, Korea) equipped with a Xe lamp as a light source and bandwidth-adjustable filters for excitation and emission wavelengths.
Genetic Engineering of eGFP
The eGFP was engineered by inserting MBLs between the N-terminal region in 1-188 amino acids and the C-terminal region in 197-238 amino acids according to a previous report on a split-eGFP system divided between β-strands 9 and 10 [25]. The loop between β-strands 9 and 10 of the eGFP was replaced by MBLs known to interact with metal ions of cadmium, mercury, and zinc. Specifically, DNA sequences encoding the MBL inserted into eGFP by overlap extension polymerase chain reaction (PCR) replaced the loop between β-strands 9 and 10 [28,29]. First, the fragment encoding the N-and C-terminal regions were generated by PCR with the primers possessing the DNA sequences encoding the MLBs. Then, two fragments were used as template for a second PCR. As the end of both fragments contained the MBL region, they were overlapped and extended during PCR. The PCR products were inserted into pCDFDuet with BglII and NotI. The sequence of primers used in this study is listed in Table 1. The DNA sequences of the engineered eGFP with MBLs were confirmed by DNA sequencing.
Characterization of Metal-Sensing Properties
The WCBs were generated by introducing plasmid harboring engineered eGFP into E. coli BL21(DE3). To test the effect of metal ions, WCB cells were grown overnight at 37 • C and then inoculated into fresh media. Cell growth proceeded until the optical density at 600 nm (OD 600 ) was around 0.4. Isopropyl β-D-thiogalactoside (IPTG) was added with 1 mM as final concentration to induce the expression of the engineered eGFP and incubated for 1 h. Then, the cells were exposed to 10 µM of diverse metal(loid) ions including arsenic, chrome, cadmium, nickel, mercury, lead, zinc, copper, gold and antimony. The cells were harvested every hour, and then their OD 600 values and emission intensity of eGFP at 510 nm with excitation wavelength of 480 nm were measured. To measure the concentration-dependent responses toward the target metal ion, the WCBs were exposed to metal ion concentrations of 0-50 µM. The responses toward metal ions were first corrected by dividing fluorescence intensity with the OD 600 values, because toxicity of the metal ions inhibited cell growth. Then, the responses were represented as induction coefficients defined as following equation: [response of WCBs with metal ion exposure]/[response of WCBs without metal ion exposure].
As the engineered eGFP in E. coli cells serves as metal sensor, the metal-sensing properties of the recombinant protein were also tested. To this end, WCB cells were grown overnight at 37 • C and then inoculated into fresh lysogeny broth media. Cell growth proceeded until OD 600 reached 0.4. Then, protein expression was induced by adding 1 mM of isopropyl β-D-thiogalactoside. The cells were grown overnight at 30 • C, harvested by centrifugation, and lysed by sonication with 50 mM Tris-HCl (pH 7.4) containing 160 mM NaCl. The recombinant proteins were purified by Ni-NTA resin (Qiagen, Hilden, Germany). To test their capability, the purified proteins were exposed to 10 µM of metal ions, and then the emission intensity of the engineered eGFP at 510 nm was measured every hour. Unlike the assay with whole cells, the intensity of eGFP was not corrected, but the responses toward metal ions were still represented as induction coefficients.
Computational Evaluation
Homology modeling of the engineered eGFP considered the X-ray crystallographic structure of eGFP (PDB ID: 4KA9) given its identical sequence and high-resolution determination at 1.58 Å. The engineered eGFP contained two different MBLs instead of four residues of eGFP, 191 DGPV. Sequence alignment was carried out using the Clustal Omega software (http://www.ebi.ac.uk/Tools/ msa/clustalo/). Homology modeling was implemented on the Modeller 9v7 software developed by Andrej Sali (http://salibal.org/modeller/) based on the sequence alignment between a template eGFP and the MBL-inserted eGFP. The engineered eGFPs with inserted MBLs were further processed by energy minimization using the Sybyl 7.3 software (Tripos, St. Louis, MO, USA). All the generated eGFP structures were compared using the PyMol software developed by Warren Lyford DeLano (https://pymol.org/2/) and the UCSF Chimera software (https://www.cgl.ucsf.edu/chimera/).
Genetic Engineering of eGFP for Biosensor
The MBLs were genetically introduced between the N-and C-terminal regions of eGFP. The MBLs reported in our previous study [18] replaced the four amino acids, DGPV, on the loop between N-terminal region in 1-190 amino acids and C-terminal region in 195-238 amino acids. The DNA sequences encoding MBLs were on the primers and introduced by two-step extension PCR ( Table 1).
The amino acid sequences for MBLs 1 and 2 were CNHEPGTVCPIC and CPGDDSADC, and known to prefer cadmium and mercury ions as ligands, respectively [18]. As the loop region was lengthened by inserting amino acids, the N-and C-terminal regions would not be associated to each other, thereby impeding fluorescence without metal ion treatment. However, when metal ions were associated to the MBLs, conformational changes were induced, and the two fragments were placed close. At a sufficiently short distance, the two fragments associate, and the engineered eGFP is fluorescent. This strategy was adopted in this study, and Figure 1 illustrates the mechanism of the engineered eGFP as metal biosensor. Tris-HCl (pH 7.4) containing 160 mM NaCl. The recombinant proteins were purified by Ni-NTA resin (Qiagen, Hilden, Germany). To test their capability, the purified proteins were exposed to 10 µM of metal ions, and then the emission intensity of the engineered eGFP at 510 nm was measured every hour. Unlike the assay with whole cells, the intensity of eGFP was not corrected, but the responses toward metal ions were still represented as induction coefficients.
Computational Evaluation
Homology modeling of the engineered eGFP considered the X-ray crystallographic structure of eGFP (PDB ID: 4KA9) given its identical sequence and high-resolution determination at 1.58 Å. The engineered eGFP contained two different MBLs instead of four residues of eGFP, 191 DGPV. Sequence alignment was carried out using the Clustal Omega software (http://www.ebi.ac.uk/Tools/msa/ clustalo/). Homology modeling was implemented on the Modeller 9v7 software developed by Andrej Sali (http://salibal.org/modeller/) based on the sequence alignment between a template eGFP and the MBL-inserted eGFP. The engineered eGFPs with inserted MBLs were further processed by energy minimization using the Sybyl 7.3 software (Tripos, St. Louis, MO, USA). All the generated eGFP structures were compared using the PyMol software developed by Warren Lyford DeLano (https://pymol.org/2/) and the UCSF Chimera software (https://www.cgl.ucsf.edu/chimera/).
Genetic Engineering of eGFP for Biosensor
The MBLs were genetically introduced between the N-and C-terminal regions of eGFP. The MBLs reported in our previous study [18] replaced the four amino acids, DGPV, on the loop between N-terminal region in 1-190 amino acids and C-terminal region in 195-238 amino acids. The DNA sequences encoding MBLs were on the primers and introduced by two-step extension PCR (Table 1). native form, whereas the engineered eGFP is inactive due to loop insertion. When a metal ion binds to the MBL, the two parts of the engineered eGFP approach each other and associate to become active. (Red lines, MBL inserted into the eGFP; black dots, metal ions).
Metal-Sensing Properties of Engineered eGFP in Whole E. Coli Cells
The WCBs were obtained by introducing plasmids carrying recombinant genes encoding the engineered eGFP into E. coli BL21. To determine the capability of engineered eGFP as biosensor for metal detection, the responses toward diverse metal(loid) ions were first tested. After expressing the engineered eGFP in E. coli cells by treating 1 mM of IPTG for 1 h, the cells were exposed to 10 µM of diverse metal(loid) ions, including arsenic, chrome, cadmium, nickel, mercury, lead, zinc, copper, gold, and antimony. The eGFP emission was measured at 510 nm with 480 nm for excitation over 1 and 2 h of exposure. The WCB responses were represented as induction coefficients. The engineered eGFP with loop 2 (eGFP-loop2) showed emission signals toward metal(loid) ions (Figure 2a), whereas the engineered eGFP with loop 1 (eGFP-loop1) showed no fluorescent signal (data not shown). Thus, we further investigated the eGFP-loop2.
The amino acid sequences for MBLs 1 and 2 were CNHEPGTVCPIC and CPGDDSADC, and known to prefer cadmium and mercury ions as ligands, respectively [18]. As the loop region was lengthened by inserting amino acids, the N-and C-terminal regions would not be associated to each other, thereby impeding fluorescence without metal ion treatment. However, when metal ions were associated to the MBLs, conformational changes were induced, and the two fragments were placed close. At a sufficiently short distance, the two fragments associate, and the engineered eGFP is fluorescent. This strategy was adopted in this study, and Figure 1 illustrates the mechanism of the engineered eGFP as metal biosensor.
Metal-Sensing Properties of Engineered eGFP in Whole E. Coli Cells
The WCBs were obtained by introducing plasmids carrying recombinant genes encoding the engineered eGFP into E. coli BL21. To determine the capability of engineered eGFP as biosensor for metal detection, the responses toward diverse metal(loid) ions were first tested. After expressing the engineered eGFP in E. coli cells by treating 1 mM of IPTG for 1 h, the cells were exposed to 10 µM of diverse metal(loid) ions, including arsenic, chrome, cadmium, nickel, mercury, lead, zinc, copper, gold, and antimony. The eGFP emission was measured at 510 nm with 480 nm for excitation over 1 and 2 h of exposure. The WCB responses were represented as induction coefficients. The engineered eGFP with loop 2 (eGFP-loop2) showed emission signals toward metal(loid) ions (Figure 2a), whereas the engineered eGFP with loop 1 (eGFP-loop1) showed no fluorescent signal (data not shown). Thus, we further investigated the eGFP-loop2. Cd 1µM Cd 5µM Ni 1µM Ni 5µM Hg 1µM Hg 5µM Induction coefficient Since the responses of WCBs were represented as induction coefficient values, it was not clear the strength of original signals. In order to clear this, we compared the fluorescence signals of WCBs harboring eGFP-loop 2, E. coli cells with and without reporter gene, egfp, in the presence of cadmium ( Figure S1). The WCB without cadmium ion showed 180 arbitrary unit (AU) while with 5 µM of cadmium showed 460 AU. And E. coli cells with and without eGFP showed 1700 AU and 120 AU in the presence of 5 µM of cadmium, respectively. This suggests that the insertion of MBLs in this study effectively inactivates the eGFP. On the other hand, the emission signals are the highest with metal ions in the following order: cadmium, mercury, and nickel. The metal specificity of the proposed biosensor is discussed below. The emission signals also suggest that the metal ion-MBL interaction induces conformational changes in the engineered eGFP to be active.
Metal ion selectivity was further investigated with the WCB harboring eGFP-loop2 given its sensitivity to cadmium, mercury, and nickel. Specifically, the WCB was exposed to different concentrations of those three metal(loid)s. Figure 2b shows that only the Cd emission increases according to concentration. In fact, the responses of eGFP-loop2 to Ni and Hg did not correspond to eGFP signals but are more likely associated with the representation of emission signals as induction coefficients. As the toxic effects of metal ions were corrected based on the OD 600 values, the high toxicity of Ni and Hg appeared to retrieve considerable responding signals. However, the concentration tests revealed that the generated WCB based on genetic engineering of eGFP only has cadmium selectivity.
Specificity of WCBs to Cadmium Ions
We investigated the specificity of WCBs to metal(loid) ions according to concentration. Concentrations from 0 to 5 µM of metal(loid) ions were used to verify specificity and reduce the influence of metal(loid) toxicity. We followed the experimental procedure described in previous sections while varying the concentration of metal(loid) ions. Concentration-dependent responses were not observed using Hg and Ni, and hence, these two metal(loid) ions were excluded from further analysis (data not shown). In contrast, the emission signals of WCB to Cd increase with concentration, as shown in Figure 3a. The emission intensity of eGFP induced by Cd ions, represented as induction coefficients, reached 2.5 at 5 µM. This increase in the emission signal, however, is not substantial, especially compared to other WCBs based on stress-responsive operons. Still, it can be used for quantitative analyses of cadmium, because the emission-concentration relation has a coefficient of determination R 2 = 0.987 obtained from linear regression (Figure 3b). This result suggests that the WCB harboring eGFP-loop2 can be a suitable prospect of cadmium biosensor.
Since the responses of WCBs were represented as induction coefficient values, it was not clear the strength of original signals. In order to clear this, we compared the fluorescence signals of WCBs harboring eGFP-loop 2, E. coli cells with and without reporter gene, egfp, in the presence of cadmium ( Figure S1). The WCB without cadmium ion showed 180 arbitrary unit (AU) while with 5 µM of cadmium showed 460 AU. And E. coli cells with and without eGFP showed 1700 AU and 120 AU in the presence of 5 µM of cadmium, respectively. This suggests that the insertion of MBLs in this study effectively inactivates the eGFP. On the other hand, the emission signals are the highest with metal ions in the following order: cadmium, mercury, and nickel. The metal specificity of the proposed biosensor is discussed below. The emission signals also suggest that the metal ion-MBL interaction induces conformational changes in the engineered eGFP to be active.
Metal ion selectivity was further investigated with the WCB harboring eGFP-loop2 given its sensitivity to cadmium, mercury, and nickel. Specifically, the WCB was exposed to different concentrations of those three metal(loid)s. Figure 2b shows that only the Cd emission increases according to concentration. In fact, the responses of eGFP-loop2 to Ni and Hg did not correspond to eGFP signals but are more likely associated with the representation of emission signals as induction coefficients. As the toxic effects of metal ions were corrected based on the OD600 values, the high toxicity of Ni and Hg appeared to retrieve considerable responding signals. However, the concentration tests revealed that the generated WCB based on genetic engineering of eGFP only has cadmium selectivity.
Specificity of WCBs to Cadmium Ions
We investigated the specificity of WCBs to metal(loid) ions according to concentration. Concentrations from 0 to 5 µM of metal(loid) ions were used to verify specificity and reduce the influence of metal(loid) toxicity. We followed the experimental procedure described in previous sections while varying the concentration of metal(loid) ions. Concentration-dependent responses were not observed using Hg and Ni, and hence, these two metal(loid) ions were excluded from further analysis (data not shown). In contrast, the emission signals of WCB to Cd increase with concentration, as shown in Figure 3a. The emission intensity of eGFP induced by Cd ions, represented as induction coefficients, reached 2.5 at 5 µM. This increase in the emission signal, however, is not substantial, especially compared to other WCBs based on stress-responsive operons. Still, it can be used for quantitative analyses of cadmium, because the emission-concentration relation has a coefficient of determination R 2 = 0.987 obtained from linear regression (Figure 3b). This result suggests that the WCB harboring eGFP-loop2 can be a suitable prospect of cadmium biosensor.
Metal-Sensing Properties of Recombinant Engineered eGFP
The eGFP-loop2 acting as cadmium biosensor in E. coli cells led us to speculate that purified proteins might work as biosensors. To test this idea, recombinant proteins were purified from E. coli cells using Ni-NTA resin. Then, 10 µM of metal(loid) ions were treated to diverse concentrations of protein solutions, and the emission of eGFP at 510 nm was measured at 480 nm of excitation wavelength. The emission was measured every hour during 6 h after addition of metal ions, but no emission signal was detected (data not shown). If the engineered eGFP were stable after purification, the same result obtained from the whole-cell assay would be expected. However, no difference occurred in the emission intensity with and without metal(loid) ion treatment. These results suggest that the engineered eGFP with insertion of additional amino acid sequences was not stable enough to constitute a biosensor. In fact, the split-eGFP has been reported as not being very stable, and stabilizing the protein by introducing point mutations has been attempted [26]. Although the engineered eGFP developed in this study did not behave as a biosensor, further investigations should be conducted.
Computational Analysis of Engineered eGFP
To understand the mechanism of the biosensors for metal detection developed in this study, we analyzed their three-dimensional structures. As the structure of the engineered eGFP was not available, we implemented one using Modeller 9v7 based on the X-ray crystallographic structure of the eGFP deposited in the Protein Data Bank (https://www.rcsb.org/). The structures were obtained from Modeller using amino acid sequence alignments and then subject to energy minimization using Sybyl 9.3. Three residues, namely, 65T, 66Y, and 67G, have been biosynthesized into chromophore in the X-ray crystallographic structure. Hence, we generated a wild type model structure using Modeller for comparison with the modified eGFPs. The wild type model structure was almost identical to the X-ray crystallographic structure (4ka9.pdb), except for the chromophore region and loops. The root-mean-square error between the template and model structure was 0.8. The structures of wild type eGFP and the two engineered eGFPs are shown in Figure 4. The amino acid sequence of loops 1 and 2, CNHEPGTVCPIC and CPGDDSADC, respectively, were inserted instead of DGPV located at the loop between β-strands 9 and 10. As a result, the structures were similar, but the chromophore motif of eGFP consisting of Thr65, Tyr66, and Gly67 changed in the engineered eGFP. By comparing the structures with loops 1 and 2, the direction of helical turn
Metal-Sensing Properties of Recombinant Engineered eGFP
The eGFP-loop2 acting as cadmium biosensor in E. coli cells led us to speculate that purified proteins might work as biosensors. To test this idea, recombinant proteins were purified from E. coli cells using Ni-NTA resin. Then, 10 µM of metal(loid) ions were treated to diverse concentrations of protein solutions, and the emission of eGFP at 510 nm was measured at 480 nm of excitation wavelength. The emission was measured every hour during 6 h after addition of metal ions, but no emission signal was detected (data not shown). If the engineered eGFP were stable after purification, the same result obtained from the whole-cell assay would be expected. However, no difference occurred in the emission intensity with and without metal(loid) ion treatment. These results suggest that the engineered eGFP with insertion of additional amino acid sequences was not stable enough to constitute a biosensor. In fact, the split-eGFP has been reported as not being very stable, and stabilizing the protein by introducing point mutations has been attempted [26]. Although the engineered eGFP developed in this study did not behave as a biosensor, further investigations should be conducted.
Computational Analysis of Engineered eGFP
To understand the mechanism of the biosensors for metal detection developed in this study, we analyzed their three-dimensional structures. As the structure of the engineered eGFP was not available, we implemented one using Modeller 9v7 based on the X-ray crystallographic structure of the eGFP deposited in the Protein Data Bank (https://www.rcsb.org/). The structures were obtained from Modeller using amino acid sequence alignments and then subject to energy minimization using Sybyl 9.3. Three residues, namely, 65T, 66Y, and 67G, have been biosynthesized into chromophore in the X-ray crystallographic structure. Hence, we generated a wild type model structure using Modeller for comparison with the modified eGFPs. The wild type model structure was almost identical to the X-ray crystallographic structure (4ka9.pdb), except for the chromophore region and loops. The root-mean-square error between the template and model structure was 0.8. The structures of wild type eGFP and the two engineered eGFPs are shown in Figure 4. The amino acid sequence of loops 1 and 2, CNHEPGTVCPIC and CPGDDSADC, respectively, were inserted instead of DGPV located at the loop between β-strands 9 and 10. As a result, the structures were similar, but the chromophore motif of eGFP consisting of Thr65, Tyr66, and Gly67 changed in the engineered eGFP. By comparing the structures with loops 1 and 2, the direction of helical turn changes (Figure 4d), and the turn of chromophore in eGFP-loop1 is different from that in the other eGFPs. To understand how the three residues of eGFP-loop1 do not form the chromophore, the Phi and Psi angles of this region were examined. The Ramachandran plots of the structures are shown in Figure 5. In Figure 5a, the residues in the chromophore show positive Phi angles, which are unusual for the normal α-helix structure. Such unusual angles may be explained by the cyclization of 65T and 67G occurring during chromophore biosynthesis. However, the negative Phi angles of 66Y and 67G were observed in the modified eGFP-loop1 (Figure 5b) (Figure 4d), and the turn of chromophore in eGFP-loop1 is different from that in the other eGFPs. To understand how the three residues of eGFP-loop1 do not form the chromophore, the Phi and Psi angles of this region were examined. The Ramachandran plots of the structures are shown in Figure 5. In Figure 5a, the residues in the chromophore show positive Phi angles, which are unusual for the normal α-helix structure. Such unusual angles may be explained by the cyclization of 65T and 67G occurring during chromophore biosynthesis. However, the negative Phi angles of 66Y and 67G were observed in the modified eGFP-loop1 (Figure 5b) as values of −48.2 and −83, respectively. The modified eGFP-loop2 ( Figure 5c) showed a negative Phi angle of 67G, and two positive angles of 65T and 66Y. From the results, it is hard to explain why the engineered eGFP is fluorescent with metal ions. However, we speculate that the metal ion binding on the MBLs induced conformational changes, and the two parts of the eGFP approached, thereby activating the protein.
Discussion
Microbial cell-based biosensors, also called WCBs, have been actively developed and investigated during the past few decades given their advantages over traditional instrumental analysis. However, WCBs have not been frequently applied to environmental monitoring by the limited number of possible targets and broad selectivity. This limitation arises from most WCBs being based on stress-responsive genetic systems. Moreover, the WCBs should be modified to improve specificity to target pollutants, as living organisms have different signaling pathways. Therefore, it would be difficult to target various environmental pollutants and perform quantitative measurements with conventional WCBs.
To compensate the shortcomings of WCBs, we tried to modify the regulatory proteins involved in operons. In a previous study, we reported a cadmium-sensing WCB based on the znt operon, zinc inducible operon, that responds to cadmium ions by their interaction with ZntR, which is a regulatory protein of this operon [30]. Given that the cadmium response was induced by the ZntR-cadmium ion interaction, it would be possible to modify the metal ion specificity of WCBs by changing the MLBs of ZntR. As reported previously, the specificity of WCBs toward metal ions can be modified by genetic and biochemical engineering [18,19]. However, this approach does not notably increase the variety of target pollutants, because the metal-binding regions of the regulatory proteins involved in other genetic operons, such as ArsR, CueR, NikR, and TetR in arsenic-, copper-, nickel-, and tetracycline-inducible operons, respectively, consist of several amino acids that are not close at the level of primary structure. Therefore, we developed a novel strategy to generate biosensors based on the concept of split-eGFP.
Split-protein systems are frequently used to measure either protein-protein or ligand-protein interactions. Hence, they may be applied to detect environmental pollutants [27]. The biosensors demonstrated in this study were based on the eGFP and structurally modified by genetic engineering. It has been reported that the split-eGFP divided into N-and C-terminal regions can form mature proteins when two fragments are associated [26]. Therefore, we used the split-eGFP system to generate new biosensors for metal ion detection. Figure 1 shows the two speculations included in our experimental design. First, the separated N-and C-terminal regions of the engineered eGFP with MBLs is not fluorescent. Second, binding metal ions on the MBLs induces conformational changes on the engineered eGFP to associate the two fragments, thus emitting fluorescent signals.
To evaluate these aspects, two peptides sequenced as CNHEPGTVCPIC and CPGDDSADC were selected as MBLs and inserted into the eGFP. We selected these two peptides because they showed specificity to cadmium and mercury when replacing the MBL in ZntR from our previous study [18]. When the engineered eGFPs were overexpressed in E. coli without metal ion treatment, there was no green fluorescent signal. This result verified our first speculation, because the wild type eGFP is fluorescent (Figure 2). The second speculation was also verified because the engineered eGFP-loop2 showed fluorescent signals in response to cadmium ions, whereas the eGFP-loop1 showed no fluorescence (Figure 2). Hence, the MBL with amino acid sequence CPGDDSADC may interact with cadmium ions and induce the conformational changes to associate the two fragments of eGFP. Nonetheless, it was noticed that the induction coefficient values from eGFP-loop2 was relatively weak compared to WCB employing znt-operon regulated by ZntR in our previous reports [18]. In fact, it was natural because these two systems as metal-sensing biosensors were different. One employed native eGFP as a reporter and other employed inactivated eGFP as a sensor molecule that was known as instable as mentioned in the Results section [26]. Thus, it would be possible to enhance the sensitivity of our new sensors by improving the stability of engineered eGFP.
Additionally, we should consider the unresponsiveness of eGFP-loop1 to metal ions. When the MBL in ZntR was replaced by loop 1, it interacted with cadmium ions to induce the expression of the reporter gene. To verify this fact, the amino acid sequences of both peptides were analyzed, and it was clear the length was different. As the length of the loop region is related to protein stability, a longer loop may have hampered the association of the two fragments of eGFP. To elucidate this assumption, the three-dimensional structures of the engineered eGFPs were built using Modeller based on the structure of eGFP (Figure 4). The residues comprising chromophore were twisted in distinct ways in the model structure of eGFP-loop1, possibly disabling the chromophore. The modified loop was placed beside the fourth helix connected to the chromophore, but the longer loop may compromise interaction with this helix, and the chromophore may be unstable. Of course, these results cannot fully explain why only eGFP-loop2 worked as biosensor but provide insights to improve our strategy for developing biosensors.
The detection of environmental harmful materials can be a first step to improve life sustainability. The monitoring of well-known pollutants such as chemicals and heavy metals are relatively well-established. However, simpler and faster methods are required to quantify diverse environmental pollutants and overcome the shortcomings of traditional instrumental analysis. Thus, we believe that the development of novel biosensors will be increasingly important and propose a strategy to develop biosensors for metal detection based on split-eGFP, conforming the first attempt to develop such biosensors using split-protein systems. Although the proposed strategy requires further improvements and considerations to enable the proper design of biosensors, it can be very valuable to fields related to environmental monitoring for increasing the diversity and capabilities of biosensors.
Supplementary Materials: The following are available online at http://www.mdpi.com/1424-8220/19/8/1846/s1, Figure S1: Original fluorescence signals from WCB with eGFP-loop 2 and wild type E. coli with and without eGFP in the presence of cadmium ions. eGFP-loop 2 showed signal with cadmium ion, while basal level signal that was similar level to E. coli without eGFP was determined without cadmium ion. E. coli cells with eGFP as reporter showed much strong signals.
Conflicts of Interest:
The authors declare no conflict of interest. | v3-fos-license |
2018-04-03T05:27:26.010Z | 2012-05-23T00:00:00.000 | 14150558 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0036297&type=printable",
"pdf_hash": "a0275462e3b9210ce011caf45e914f93db8acb4a",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:119994",
"s2fieldsofstudy": [
"Biology"
],
"sha1": "eab5899a6d88611c12e8a0628be2025cd80096d5",
"year": 2012
} | pes2o/s2orc | Medium Chain Fatty Acids Are Selective Peroxisome Proliferator Activated Receptor (PPAR) γ Activators and Pan-PPAR Partial Agonists
Thiazolidinediones (TZDs) act through peroxisome proliferator activated receptor (PPAR) γ to increase insulin sensitivity in type 2 diabetes (T2DM), but deleterious effects of these ligands mean that selective modulators with improved clinical profiles are needed. We obtained a crystal structure of PPARγ ligand binding domain (LBD) and found that the ligand binding pocket (LBP) is occupied by bacterial medium chain fatty acids (MCFAs). We verified that MCFAs (C8–C10) bind the PPARγ LBD in vitro and showed that they are low-potency partial agonists that display assay-specific actions relative to TZDs; they act as very weak partial agonists in transfections with PPARγ LBD, stronger partial agonists with full length PPARγ and exhibit full blockade of PPARγ phosphorylation by cyclin-dependent kinase 5 (cdk5), linked to reversal of adipose tissue insulin resistance. MCFAs that bind PPARγ also antagonize TZD-dependent adipogenesis in vitro. X-ray structure B-factor analysis and molecular dynamics (MD) simulations suggest that MCFAs weakly stabilize C-terminal activation helix (H) 12 relative to TZDs and this effect is highly dependent on chain length. By contrast, MCFAs preferentially stabilize the H2-H3/β-sheet region and the helix (H) 11-H12 loop relative to TZDs and we propose that MCFA assay-specific actions are linked to their unique binding mode and suggest that it may be possible to identify selective PPARγ modulators with useful clinical profiles among natural products.
Introduction
Peroxisome proliferator activated receptors (PPARs a, b/d and c) are ligand-dependent transcription factors that are prominent targets for pharmaceutical development. Thiazolidinediones (TZDs) act through PPARc to elicit increased sensitivity to insulin in type 2 diabetes mellitus (T2DM) and reduce inflammation in arteries [1]. Unfortunately, TZDs also exhibit deleterious effects on fat accumulation, fluid retention and bone density and increase risk of heart failure, indicating a need for new selective PPARc ligands with improved clinical profiles [1][2][3].
In addition to TZDs, PPARc binds natural lipophilic molecules, including long chain fatty acids (FAs), oxidized or nitrated FAs, prostaglandins and arachidonic acid derivatives [4,5] but possible selective activities of these compounds have not been assessed. Some reports suggest that PPARc ligands with weak partial agonist activity relative to TZDs exhibit beneficial effects equivalent to strong agonists, with fewer harmful side effects [6][7][8][9]. At least some insulin sensitizing effects of TZDs mediated by PPARc do not require full agonist actions; TZDs block cyclindependent kinase 5 (Cdk 5) mediated phosphorylation of PPARc ser273, which reduces expression of key adipokines in fat cells [10]. Improved knowledge of relationships of PPARc ligand binding modes and relationships to partial agonism and secondary modifications could help us develop selective ligands that act as safer PPARc modulators.
PPARs are nuclear hormone receptors (NRs) [11]. Like other NRs, PPARs bind specific DNA response elements (PPREs), usually as a heterodimer with retinoid X receptor, and modulate transcription of nearby genes by recruiting coregulator complexes [3,12]. Agonists alter target gene expression by binding the ligand binding pocket (LBP) in the core of the ligand binding domain (LBD). This, in turn, induces conformational changes which result in increased stability of the entire LBD and altered position and dynamics of LBD C-terminal helix (H) 12, with the latter effect remodeling of a cofactor binding site on the LBD surface to favor binding of coactivators over corepressors [12].
Despite similarities between actions of PPARs and other NRs, PPAR LBPs exhibit distinctive characteristics [13,14]. PPAR LBPs are large (<1300 Å 3 ) Y-or T-shaped cavities which are partly open to the LBD surface and only partially filled by TZDs or other known ligands, different from LBPs of thyroid hormone receptors (TRs), steroid receptors and other NRs which tend to be small (<500-600 Å 3 ) with ligand tightly enclosed [11]. Further, PPARs exhibit multiple ligand binding modes; different PPARc ligands bind at different locations in the LBP and the PPARc LBP can accommodate two ligands at the same time [4]. Strong PPARc agonists such as the TZDs rosiglitazone (rosi) and pioglitazone (pio) directly contact H12 whereas partial agonists bind towards the base of the Y-shaped LBP, do not contact H12 and stabilize the b-sheet/H2-H3 region thereby inhibiting cdk5 phosphorylation [10,[15][16][17].
Here, we crystallized PPARc LBD in a form that diffracts to relatively high resolution in the absence of exogenous ligands. The structure resembles previous liganded and unliganded PPARs [4,18] but close investigation reveals three saturated medium chain fatty acids (MCFAs) occupy the LBP at the same time and mass spectroscopic analysis suggests that these are predominantly nonanoic acid (NA, C9) with a smaller amount of octanoic acid (OA, C8). C8-C10 MCFAs are PPARc essentially partial agonists, but exhibit assay-specific variations in activity relative to TZDs and MCFAs that bind PPARc block TZD-dependent adipogenesis. A recent paper also revealed that a C10 MCFA acts as a modulating ligand of PPARc, but this group found a single molecule of C10 binds the pocket and rationalized partial agonist activity in terms of weak H12 stabilization [19]. Our X-ray crystal structure B-factor analysis coupled to molecular dynamics (MD) simulations [20] suggests that diverse agonist/partial agonist behaviors may be linked to the tripartite MCFA binding mode and raise the intriguing possibility that selective PPAR modulators with useful context-selective properties may be identified among natural products. We discuss the possibility that MCFAs are natural PPAR ligands.
Three Ligands in the PPARc LBP
We obtained PPARc LBD crystals without exogenous ligand and subsequent X-ray structural analysis revealed that they diffracted to relatively high resolution (2.1 Å , Table S1). The new PPARc structure closely resembles previous PPARc LBD structures (Fig. 1A) [4,18]. The LBD crystallized as a homodimer (A and B-chains) with the A-chain exactly corresponding to the canonical active NR LBD fold with H12 in an active position (Fig. 1A) and the B-chain in an inactive conformation with H12 protruding away from the molecule (Fig. S1). More surprisingly, close investigation of the PPARc A-chain LBD revealed three elongated and well-defined ligands in the LBP (Figs. 1A, B). Electron density is strong, consistent with high occupancy. Two similar ligands were present in the B-chain LBD but these are poorly resolved, similar to previous descriptions of ligand binding to PPARc B-chains [4]. To our knowledge, this is the first time that exogenous ligands have been shown to occupy the LBP of a putative apo-PPARc structure.
MCFAs associate with PPARc LBP
The ligands in the PPARc LBP are bacterial MCFAs. Mass spectroscopic analysis revealed that MCFAs were associated with our purified PPARc LBD preparations and that these are predominantly nonanoic acid (C9:0, NA, 80%), with smaller amounts of octanoic acid (C8:0, OA, 20%) (Fig. S2). There is no obvious source of these ligands in purification reagents or buffers and it is therefore likely that they are bacterial in origin and persist throughout purification. Accordingly, we used the major ligand associated with the PPARc preparations, NA (C9), for X-ray structure model building and found that it fits well with observed electron densities in the LBP (Fig. 1B). Added MCFAs (C8-C10, but not C6) bind and stabilize purified PPARc LBD in a modified differential fluorescence scanning (DSF) assay [21], which detects ligand-dependent reductions in solvent-exposed protein hydrophobic surface and is indicative of protein folding ( Fig. 2A). Moreover, NA (C9) displaced radiolabeled Rosi from bacterially expressed PPARc LBD, albeit with much lower potency than unlabeled Rosi (Fig. 2B). Thus, MCFAs are bona fide PPARc interacting compounds, albeit weak binders. Longer chain saturated fatty acids (C14-C18) are known to bind PPARc [22], but this report, coupled to a recently published report [19] establishes MCFAs as PPARc interacting ligands.
MCFA Binding Modes
The trimeric MCFA ligand binding mode is unprecedented (Fig. 1B). Each MCFA binds one arm of the PPARc A-chain LBP and, together, the three molecules occupy about 52% (<630 Å 3 ) of LBP total volume (Fig. 1B, C). While it was previously shown that PPARc LBP can accommodate two copies of the same ligand [4] it has never been shown that three copies of the same ligand can simultaneously occupy the PPARc LBP.
Each NA occupies one arm of the Y-shaped pocket (Fig. 1B). NA1 is within the polar arm, close to H12, and makes extensive contacts with LBP amino acids. The carboxylate interacts with Y473 on the inner H12 surface (2.90 Å ), H323 (2.92 Å ), H449 (2.75 Å ) and S289 (3.05 Å ) and the hydrophobic tail interacts with a surface formed by I281, F282, L353, F363, M364 and L453. NA2 and NA3 make few direct contacts with protein. This position is similar to that occupied by the single decanoic acid molecule (C10) located in the recently published PPARc:C10 MCFA structure [19]. NA2 occupies a site between H1, H3 and H4/5 with the carboxylate group in contact with R288 (3.2 Å ) on H3 and the tail stabilized by hydrophobic interactions with A292, I296, M329 and L330. NA3 is close to the base of the Y, between H3 and the b-strands. Like NA2, the NA3 carboxylate also interacts with the R288 side chain (3.87 Å , Ne) and also binds the main chain at L340 (3.2 Å ) and the NA hydrophobic tail interacts with I341 and C285.
LBP amino acids that contact each NA ligand have all previously been shown to contact other PPARc interacting compounds [4,5,18]. NA1 binds Y473 on the inner face of H12, also important in TZD binding, whereas NA2 and NA3 carboxylates interact with R288, which does not bind TZDs but does bind oxidized FAs 13-HODE and 9-HODE, nitrated FAs and synthetic partial agonists. Comparisons of the PPARc+MCFA structure with PPARc-TZD structures reveal differences between TZD and MCFA contact modes (Fig. 1C). Most obviously, the Phe363 (H7) side chain binds the NA1 aliphatic chain but adopts an opposite orientation in PPARc+rosi structures and is not involved in ligand contact. There are also shifts in positions of Ser289 (H3), His449 (H11), Tyr473 (H12) and other residues. However, the main difference the PPARc+MCFA structure and PPARc+TZD structures is that all arms of the pocket are occupied by MCFAs, whereas TZDs only contact residues in two arms of the Y.
MCFA interactions with the PPARc chain B LBP partly resemble those of chain A (Fig. S1). The two MCFAs occupy positions that approximately correspond to NA2 and NA3 in Chain A. However, the NA2 aliphatic chain adopts a slightly different position in Chain B, and the NA3 aliphatic chain appears highly disordered. More importantly, no ligand occupies the NA1 position at the inner surface of H12. This implies that MCFA binding at the NA1 position is coupled to H12 packing (Discussion).
MCFAs are pan-PPAR Partial Agonists and Display Assay-Specific Partial PPARc Agonist Effects
MCFAs (1 mM) behave as partial pan-PPAR agonists in transfections. MCFAs were very weak partial agonists at a GAL-PPARc LBD fusion, which is highly AF-2 dependent (Fig. 3A). Here, C6 (which does not bind PPARc) failed to activate transcription but longer MCFAs that do bind PPARc (C8, C9, Decanoic acid, DA C10 and Lauric acid, LA C12) elicited low partial agonist activity, with C10 most effective (about 3-5% of rosi in this assay). Similar activation patterns were also seen with GAL-PPARa and -PPARd fusions (Fig. 3B). Interestingly, MCFAs were more efficient partial agonists with full length PPARs (Fig. 3C, D). Here, OA (C8), NA (C9) exhibited up to 70% of TZD activity at a PPRE-regulated reporter in HeLa cells and DA (C10) slightly stronger than TZDs (Fig. 3C) and LCFAs (C14, C16) in this cell type (Fig. 3D). In other cell types, including HepG2, effects were somewhat weaker and C8-C10 MCFAs activated transcription with about 50% of the activity of rosi ( Fig. 3E). MCFAs are not potent agonists; whereas 1-10 mM TZDs were sufficient for maximal PPARc activation, C8-C10 FAs only exhibited activity in the 100 mM-1 mM range (Fig. 3C). Effects of PPARc LBP mutations are consistent with predictions about binding mode derived from X-ray structures (Fig. 3F). Mutation of R288, which interacts with MCFAs at sites II and III but not with rosi or other TZDs (PPARcR288A) or with MCFAs at site I, compromised PPARc response to DA, but not rosi. Conversely, an amino acid implicated in TZD interaction but not MCFA interaction (PPARcQ286A) was needed for rosi response but was dispensable for DA response. Mutation of nearby residues that do not interact with MCFAs or rosi (PPARcE295A and C285S) did not affect responses to either ligand. Finally, MCFAs strongly inhibited cdk5-dependent phosphorylation of PPARc LBD preparations in vitro. NA (C9) inhibited cdk5 dependent phosphorylation of bacterially expressed PPARc LBD preparations as efficiently and potently as rosi (Fig. 3G).
As previously documented, we found that MCFAs were influenced adipoegenesis [19,23] but also showed that MCFAs that bind PPARc can antagonize rosi effects. HA C6 (1 mM), which does not bind PPARc, triggered similar levels of fat droplet accumulation to rosi (compare Fig. 4A, 4B and 4C) and failed to antagonize rosi response (Fig. 4D). By contrast, DA (C10, 1 mM) was weakly adipogenic (compare Fig. 4E to Fig. 4A) but strongly antagonized rosi response. Similar results were also obtained with OA (C8, not shown). Thus, an MCFA that does not bind PPARc cannot block rosi-dependent adipogenesis, whereas MCFAs that do bind PPARc are anti-adipogenic, raising the possibility that some anti-adipogenic actions of MCFAs may be PPARcdependent (see Discussion).
MCFAs and Rosi Induce Differences in PPARc External Stability
Given assay-specific variations in efficacy of MCFAs (weak AF-2 partial agonist, stronger partial agonist with full length PPARc and full agonist in blockade of ser273 phsophorylation), we set out to compare MCFA effects on PPARc conformation with TZDs. This required us to obtain a PPARc+rosi structure in the same space group as our PPARc+NA structure (2.5 Å resolution, Table S1) to compare NA and rosi influences on PPARc organization without confounding effects of differences in crystal packing [18].
PPARc+NA and PPARc+rosi structures exhibit identical overall fold and dimer organization. However, there are differences in crystal structure B-factors in the presence of rosi and MCFAs; these provide an index of relative mobility of different parts of the protein in the crystal lattice (Fig. 5). H12 appears better packed against the LBD surface with rosi (arrow) than NA. By contrast, the loop between H11 and H12 and the H2-H3/bstrand regions appear more ordered with NA than rosi (circles). Both regions are important in PPARc function, changes in H11-H12 loop structure have been implicated in H12 dynamics [24] and, as mentioned above, partial PPARc agonists preferentially stabilize the b-strand region [15]. Further, the H2-H3 loop region overlaps ser273, the target of cdk5 phosphorylation, which is efficiently blocked by MCFAs. Thus, the two ligand types exhibit differential effects on PPARc LBD external stability.
MCFA Chain Length Influences H12 Dynamics
To better understand between MCFA binding mode and activity we performed MD simulations based on the PPARc+NA X-ray structure in a shell of water and ions to simulate aqueous conditions [20]. The technique allows us to predict and observe ligand and protein dynamics over short times, to estimate interaction energies of ligands with components of the PPARc system and to substitute different ligands and examine receptor behaviors.
We first performed MD simulations with the PPARc+NA structure and modeled PPARc structures in which DA (C10) or LA (C12) was substituted for NA in the tripartite binding mode to define relationships between MCFA chain length and PPARc activity. We chose these MCFAs because, in our hands, DA exhibited high activity in transfections, whereas LA is weaker. Results suggest that NA (C9), DA (C10) and LA (C12) bind in the 3:1 mode, but the former two MCFAs exhibit better fit in the PPARc LBP than LA; LBP residues that comprise site I become more disordered in the presence of LA (Fig. S3). There is also a notable effect of MCFA chain length on H12 contacts (Figs. 6, S4); an important hydrogen bond contact between the MCFA polar carboxylate and the Tyr473 side chain is broken in LA simulations, but not DA simulations. This suggests that H12 is more stable in the presence of DA than NA. We propose this finding explains why LA exhibits reduced activity relative to DA and that this supports proposals that direct MCFA contacts with the inner surface of H12 are important in partial agonist activity [19].
NA2 and NA3 Water Shells Play an Important Role in Binding
Since the b-sheet/H2-H3 region of the receptor appears preferentially stabilized in the presence of MCFAs, and NA2 and NA3 lie close to the inner surface of this region yet make few direct contacts with PPARc protein (Fig. 1A), we analyzed interaction energetics of these MCFAs with LBP residues and ligand dynamics to understand how they may interact with the PPARc LBD.
The simulations revealed unexpected aspects of MCFA binding. First, average binding energies of NA2 and NA3 with the PPARc system are higher than NA1, despite fewer direct contacts of these ligands with protein, and this is related to hydration of the MCFA carboxylate group (Table 1, Fig. 7). Visualization of ligands reveals that NA1 (purple shell) interacts with small amounts of water (blue) throughout the simulation (Fig. 7A); on average less than one water lies near the NA1 carboxylate group (purple trace, Fig. 5B) although more waters (up to 5) can lie nearby at some instances (grey traces, Fig. 7B). By contrast, NA2 and NA3 carboxylates are continuously surrounded by large water pools (Fig. 7A) comprised of at least 7-8 waters (Fig. 7B, green and orange traces) with as many as 13-15 nearby in some frames (Fig. 7B). Second, NA2 and NA3 appear more flexible than NA1, judged by comparisons of initial NA position (Fig. 7A, red sticks) versus superposed conformations adopted in the simulation (white sticks) and differences in root mean squared displacements (RMSD) of ligand over the simulation (Fig. 7C and Fig. S4). In particular, the NA2 aliphatic chain (green; A2) fluctuates between two distinct average conformations; evidenced by the biphasic RMSD curve in Fig. 7C, and the NA3 carboxylate (C3) appears highly mobile (Fig. 7A). Inspection of the PPARc+NA structure suggests that predicted differences in ligand mobilities are realistic; NA1 is well defined with low B-factors whereas NA2 and NA3 are poorly defined.
Together, results suggest that pocket waters are important for MCFA binding; they bridge charged groups of the ligand to LBP polar residues (Discussion). Further, high NA2 and NA3 mobility means that both ligands can continuously form and break new contacts with LBP amino acids that are not always evident in the initial structure. Of interest (Fig. 8), the NA3 carboxylate engages in repeated contacts with Lys265 (H3) and Ser342 (b-sheets). It is interesting to suggest that these interactions could also help to stabilize the PPARc b-sheets and H2-H3 region (Discussion).
Discussion
In this study, we crystallized the PPARc LBD without exogenously added ligand, but analysis of the resulting X-ray Our studies indicate that C8-C10 MCFAs are PPARc partial agonists; this is in line with another study which shows that DA (C10) is a PPARc modulator [19]. However, we also find that MCFAs exhibit differences in activity that are a function of both chain length and assay type and we propose that combined results of X-ray crystallography and MD simulations provide possible explanations for observed MCFA properties.
Our results suggest that chain length dependency of MCFA action relates to their ability to contact and stabilize the inner surface of H12 [19]. C8-C10 MCFAs are better PPARc activators than C12-C14 MCFAs, see Fig. 3D and [22], with C10 displaying highest activity. Our MD simulations reveal more optimal contacts of C9-C10 MCFAs with Tyr473 on the inner surface of H12 than C12, which appears too long ( Fig. 6 and S3). Also supporting the idea that MCFA contacts with H12 are important for activity is the organization in the crystallographic dimer; the PPARc chain A (H12 active) contains three MCFAs in the LBP with one (NA1) in close juxtaposition to H12 whereas chain B (H12 inactive) contains two poorly defined MCFAs at the NA2 and NA3 positions which are not near the inner surface of H12. Our modeling also agrees with the proposal that LCFAs (C16 and upwards) are too large to bind the niche that is occupied by NA1 [19] and suggests that LCFAs will not be able to occupy the PPARc LBP in a 3:1 binding mode reported here (not shown) and must therefore bind the PPARc LBP in a manner that differs from MCFAs.
In addition to a role for MCFA contacts with H12 in PPARc activation, we noted surprising assay-specific differences in efficacy versus TZDs and we think that these features may be explained by the unique tripartite binding mode and differences in LBD surface stability versus TZDs. B-factor analysis reveals that MCFAs weakly stabilize H12 relative to TZDs (Fig. 5) and this correlates well with the observation that MCFAs are weak activators in the highly AF-2 dependent GAL-LBD assay (3-10% of TZD activity, Fig. 3). By contrast, MCFAs are stronger agonists in transfections with full length PPARc; we do not completely understand this phenomenon but suggest that MCFAs affect PPARc LBD activities that are important in the context of full length receptor. In this regard, MCFAs preferentially stabilize the loop between H11 and H12 and the b-sheet/H2-H3 region and the latter has been implicated in unexpected heterodimer contacts with the RXR DBD, revealed in the recent full length structure of a PPARc/RXRa complex [25]. However, we recognize that other possible explanations for the relatively strong partial agonist activity of MCFAs at full length PPARc; perhaps MCFAs alter cell behavior to enhance other aspects of PPARc activity through secondary effects. Finally, MCFAs are effective inhibitors of cdk5 dependent phosphorylation at ser273 in vitro [10] and this correlates well with their ability to stabilize the b-sheet region, in common with other partial agonists [15] and selective PPAR modulators [10,17].
Why do MCFAs preferentially stabilize the b-sheet/H2-H3 region relative to TZDs? At one level, the answer appears relatively simple; NA2 and NA3 occupy positions near the inner surface of this region whereas TZDs do not. We were puzzled by the fact that NA2 and NA3 do not appear to engage in large numbers of direct contacts with LBP residues in this region suggesting that these may be relatively weak interactions. However, our MD simulations indicate that NA2 and NA3 actually bind more tightly to the LBP than NA1 and that water molecules that bridge ligand carboxylate groups to polar LBP residues play an important role in binding affinity, similar to our proposed mechanism for TR subtype selective binding of the natural agonist Triac [26]. Strategies to enhance ligand-water contacts and ligand flexibility in this region of the PPARc LBP could yield high affinity ligands that stabilize the b-sheet region.
Are MCFAs natural physiologically relevant PPARc agonists? Studies of Malakapa et al. showed that diets containing decanoic acid or decanoic acid triglyceride improve insulin sensitivity in animal models [19]. It is also known that dietary MCFAs (usually as medium chain triglycerides) are abundant in certain foodstuffs, particularly milk, coconut and palm oil and dietary supplementation of these compounds improves aspects of metabolic syndrome and insulin resistance in humans [27]. Finally, our studies support those of previous papers which suggest that MCFAs are anti-adipogenic in cultured 3T3 cells (ref) and this property has also been observed in vivo. All of these findings are consistent with PPARc partial agonism/antagonism and selective PPARc modulation and, indeed, our results suggest that only MCFAs which bind PPARc exhibit ant-adipogenic actions in 3T3 cells. While suggestive, much more work must be done to explore connections between physiologic actions and PPARc binding. First, MCFAs used at high concentrations are likely to influence multiple metabolic pathways and regulatory events within the cell and it is difficult to parse actions that may be mediated through direct PPARc binding from other effects on cell behavior; MCFAs may also reduce PPARc protein and transcript levels by unknown indirect mechanisms [28]. Second, it is not clear whether MCFAs could reach sufficient concentrations to modulate PPARc in vivo. Serum MCFA concentrations do reach the 100 mM-1 mM range [27], comparable to effective concentrations in transfections, and MCFAs are known to accumulate in adipocytes over time (OBESITY RESEARCH 2003); it will be important to explore connections between adipocyte FA content and PPARc occupancy and binding.
Also of note is that the trimeric MCFA binding mode resembles aliphatic chain organization of triglycerides and phospholipids. Recent analysis of PPARa associated ligands in mouse liver indicates that the phospholipid 1-Palmitoyl-2-Oleoyl-sn-glycero-3-Phosphatidylcholine (16:0/18:1-GPC) is an endogenous PPARa activator [29]. Perhaps PPARc may be able to accommodate phospholipids or triglycerides with MCFA moieties. More generally, our findings suggest that there may be natural ligands that behave as selective PPAR modulators with useful properties. Finally, our results raise an obvious question; did PPARc harbor bacterial ligands in previous ''apo''-structures and could these have influenced PPARc conformation? This was the case for PPARd, where a reported apo-LBD structure was later shown to contain one long chain FA molecule in the LBP, predominantly cis-vaccenic acid (11, Z-octadecenoic acid), which stabilized PPARd H12 in an active position [30,31]. Additionally, bacterial phospholipids have been detected in LBPs of human liver receptor homolog 1 and steroidogenic factor 1 [32,33] and long chain FAs co-purify with hepatocyte nuclear factor 4 [34]. For PPARc, the LBD can be crystallized in true apo-form and we were mostly unable to find ligands in the LBP of previous apo-structures and have obtained our own structures of unliganded PPARc LBDs and cannot detect MCFAs or other ligands in LBPs. We did find one possible instance of an FA-like electron density that resembles a long chain polyunsaturated FA in the original apo-PPARc structure [18] (Fig. S5). Given that bacterial ligands have now co-crystallized with multiple NRs, it will be very important to consider the possible presence of bacterial ligands in ''apo''-PPARc and-NR structures and the potential impact of such ligands on LBD conformation.
Crystallization and Structure Determination
PPARc crystals grew in hanging drop crystallization trials. 2 ml of well solution containing 0.1 M Tris-HCl, pH 7.5+0.9 M sodium citrate were equilibrated vs. 2 ml concentrated protein solution. Crystals were obtained after 3-5 days at 18uC. Prior to data collection, a single crystal was immersed in cryoprotectant containing 20% glycerol and flash frozen in a nitrogen stream at 2100uC. X-ray diffraction data were collected at the protein crystallography W01B-MX2 beamline of the Brazilian Synchrotron Light Laboratory (LNLS), Campinas, Brazil [36]. Observed reflections were integrated, merged, and scaled with DENZO and SCALEPACK in HKL2000 [37]. The structure was solved by molecular replacement using PHASER [38] and a previously published PPARc LBD structure (PDB code: 1ZEO [39]) as the search model. PHENIX [40] was used for structural refinement with several cycles of model rebuilding in COOT [41]. The coordinates and structure factors of PPARc-NA and PPARc-Rosiglitazone have been deposited in the Protein Data Bank with the PDB ID codes 4EM9 and 4EMA, respectively.
Cell Culture and Transfection
Transfections (HeLa or HepG2 cells, obtained from American Type Culture Collection, Manassas, VA; 5XGAL4 RE or DR1 luciferase reporter) used +/2 GAL-PPAR LBD or full length PPARc expression vector. Luciferase assays were performed by standard methods, standard errors were derived from quadruplet points and experiments repeated .3 times. PPARc mutants were created using the Stratagene kit and verified by sequence analysis. For NIH3t3 differentiation assays, cells were cultured in standard FBS supplemented with Rosi or MCFA [23].
3T3-L1 Differentiation Assay and Oil Red O staining
Murine 3T3-L1 cells were maintained in Preadipocytes medium (Zen-Bio). Cells were induced to differentiate two days post confluent using DMEM/Ham's F-12 medium supplemented with Insulin, Dexamethasone and Isobutylmethylxanthine in the absence or presence of 100 nM Rosiglitasone, 1 mM HA C6, or 1 mM DA C10 as indicated in Figure legend. Cells were then fed with Zen Bio's AM-1-L1 media. On day 7 cells were fixed, stained with Red Oil O and phase contrast images were taken using an Olympus Ix81 microscope (106 magnification).
Molecular dynamics
MD simulations used the PPARc chain A X-ray structural model. The missing loop (262-273) was modeled from residues 257-277 of a previous structure (PPARc 1PRG model [18]), which fit well into the structure after alignment with LovoAlign [42]. A solvation shell of at least 15 Å was created using VMD [43] and Sodium and Chloride ions added in a concentration close to 0.15 mol L 21 to render the system electrically neutral. The final system contained 53,530 atoms. Simulations were performed with NAMD [44] using periodic boundary conditions and CHARMM parameters [41] for protein and NA (C9) and TIP3P [42] parameters for water. Auxiliary simulations were also performed for DA and LA and initial structures were modeled from the NA-PPARc crystal structure by adding missing atoms to C9.
A 12 Å cutoff radius was used for van der Waals interactions, whereas the electrostatic forces were handled by Particle Mesh Ewald sums [43]. Temperature was set to 300 K and pressure to 1 atm in all simulations. A 2 fs time-step was used integrate the equations of motions using the Verlet algorithm. 12 independent sets of equilibration and production simulations were performed. The protocol for each equilibration/simulation was: (1) Energy minimization using 500 steps of conjugate gradients (CG), keeping all atoms fixed, except modeled loop. (2) 2000 CG steps keeping only protein atoms fixed except modeled loop. (3) With same atoms fixed, 200 ps MD in the NPT ensemble, using temperature scaling at every 1 ps and a Langevin piston to control pressure with a period of 0.2 ps and damping time of 0.1 ps. (4) 500 CG steps followed by 150 ps MD with the same protocol, removing restraints on all but fixed Ca atoms. (5) 200 ps MD with the same protocol, without restraint. (6) Production runs started from the last frame of this equilibration simulation and were 2 ns long. The same protocol was used for production runs, except that temperature was controlled via a Langevin bath with a damping coefficient of 1 ps 21 . We performed MS analysis of purified PPARc preparation used for crystallization. MS spectra of the derivatized MCFAs OA (top) and NA (bottom) analyzed by GC/MS are shown. Analysis of extracts and FA Methyl Ester standards (FAMEs; C8:0-C12:0; C13:0-C17, Sigma Chem. Co, and C18:0-C20:5 RESTEK; Bellefonte, PA, USA) were performed on a GC-MS system Shimadzu, mod. QP5000, fitted with an FID and a split/splitless injector. Separations were performed on a RESTEK Rtx-wax capillary column [15 m, 0.25 mm i.d., 0.25 mm film thickness] (Bellefonte, PA, USA) connected to the MS ion source and helium was used as the carrier gas (1.5 ml/ min). Oven temperature was maintained at 80uC for 3 min, then increased at 3uC/min to 250uC and stabilized until all components eluted. The ion source (Electron Impact -EI) was kept at 200uC and the transfer line at 310uC. EI spectral (70 eV) analyses were acquired with a mass selective detector (MSD). Data acquisitions were performed using Class-VP 4.3 software (Shimadzu, Japan). Standards were analyzed by injecting 0.4 ml of a solution of FAMEs (1:10 v/v in hexane) with a split ratio 1:50, while esterified extracts were analyzed by injecting 2 mL (3.2 mg of lipid material). FAs were identified by comparison between their retention times with FAME standards during GC analysis and matching mass spectra for samples and standards. A compound was identified if its retention time and EI mass spectrum were identical with reference compound. FAMEs of the web FAs were obtained by transesterification with a solution of H 2 SO 4 10% in methanol, at 120uC during 90 min. (TIF) Figure S3 Effects of different MCFAs on the PPAR LBP. RMSD distribution of the BP residues comprising sites I, II, and III, relative to the C9-PPARc holo crystal structure reported here, from simulations with C9, C10, and C12. The distributions are unimodal for C10-bound LBD (red), suggesting a snuggled fit of this ligand in the BP. The simulations also suggest that the BP presents largest conformational variations in the presence of C12 (cyan). This is particularly noticeable for residues comprising binding site I near H12. | v3-fos-license |
2018-12-05T14:56:20.513Z | 2014-06-12T00:00:00.000 | 54677822 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://downloads.hindawi.com/journals/ijps/2014/520910.pdf",
"pdf_hash": "f7edaaaef53f41935b9b7d37487eb73664d9163d",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120003",
"s2fieldsofstudy": [
"Chemistry",
"Materials Science"
],
"sha1": "f7edaaaef53f41935b9b7d37487eb73664d9163d",
"year": 2014
} | pes2o/s2orc | Chemical Polymerization Kinetics of Poly-O-Phenylenediamine and Characterization of the Obtained Polymer in Aqueous Hydrochloric Acid Solution Using K 2 Cr 2 O 7 as Oxidizing Agent
The oxidative chemical polymerization of o-phenylenediamine (OPDA) was studied in hydrochloric acid solution using potassium dichromate as oxidant at 5C. The effects of potassium dichromate, hydrochloric acid, and monomer concentrations on the polymerization reaction were investigated. The order of reaction with respect to potassium dichromate, hydrochloric acid, and monomer concentration was found to be 1.011, 0.954, and 1.045, respectively. Also, the effect of temperature on the polymerization rate was studied and the apparent activation energy of the polymerization reaction was found to be 63.658 kJ/mol. The obtained polymer was characterized using XPS, IR, UV-visible, and elemental analysis. The surface morphology of the obtained polymers was characterized by X-ray diffraction and transmission electron microscopy (TEM). The TGA analysis was used to confirm the proposed structure and number of water molecules in each polymeric chain unit. The ac conductivity (σac) of (POPDA) was investigated as a function of frequency and temperature. The ac conductivity was interpreted as a power law of frequency. The frequency exponent (s) was found to be less than unity and decreased with the increase of temperature, which confirms that the correlated barrier hopping model was the dominant charge transport mechanism.
Introduction
Polyaniline as an electrically conductive polymer has attracted considerable attention, because of its excellent environmental stability in the electroconducting form and electrical and optical properties [1,2].It has various potential applications in many high performance devices [3][4][5][6][7][8][9].A common feature of conducting polymer is conjugation of -electrons extending over the length of the polymer backbone [10].Polymerization of conducting polymer may be performed by chemical [11] or electrochemical [12] methods.Various chemical oxidizing agents, such as potassium dichromate [13], potassium iodate [14], hydrogen peroxide [15], ferric chloride, or ammonium persulphate, were used [16].The applications of polyaniline are limited due to its poor processability [17], which is true for most conducting polymers.Several studies have been done in order to improve the solubility of polyaniline; among them is using functionalized protonic acids as dopant, like p-toluenesulphonic acid, octyl-benzene-sulphonic acid, dodecyl benzene-sulphonic acid [18], poly(styrene) sulphonic acid [19], and phosphoric acid esters [20].An alternative method to obtain soluble conductive polymers is the polymerization of aniline derivatives.The studied aniline derivatives are alkyloxy, hydroxy, and chloroaniline and substitution at the nitrogen atom was reported by Sayyah et al. [21][22][23][24] to improve the solubility of polyaniline.The substituted group of aniline affects not only the polymerization reaction but also the properties of the polymer obtained.The kinetics of chemical polymerization of 3-methylaniline, 3-chloroaniline, 3-hydroxyaniline, 3-methoxyaniline, and N-methyl aniline in hydrochloric acid solution using sodium dichromate as oxidant and characterization of the polymer obtained by IR, UV-visible and elemental analysis, X-ray diffraction, 2 International Journal of Polymer Science scanning electron microscopy, TGA-DTA analysis, and ac conductivity have been investigated by Sayyah et al. [25][26][27][28].
The present work intends to study the kinetics of the oxidative chemical polymerization of o-phenylenediamine in aqueous HCl medium and potassium dichromate as oxidant.The obtained polymer is characterized by XPS, IR, UVvisible, TGA, elemental analysis, X-ray, transmission electron microscopy (TEM), and ac conductivity measurements.
Experimental
2.1.Materials.O-phenylenediamine was provided by Aldrich chemical Co. (Germany).Concentrated hydrochloric acid, pure grade product, was provided by El-Nasr pharmaceutical chemical Co., Egypt.Potassium dichromate was provided by Sigma-Aldrich chemical Co. (Germany).Doubly distilled water was used to prepare all the solutions needed in the kinetic studies.
Oxidative Aqueous Polymerization of O-Phenylenediamine Monomer.
The polymerization reaction was carried out in a well-stoppered conical flask of 250 mL capacity; addition of OPDA amount in 25 mL HCl of known molarity was followed by the addition of the required amount of potassium dichromate as oxidant in water (25 mL) to the reaction mixture.The orders of addition of substances were kept constant in all the performed experiments.The stoppered conical flasks were then placed in an automatically controlled thermostat at the required temperature.The flasks were shaken (15 shakings/10 s/15 min) by using an automatic shaker.The flasks were filtrated using a Buchner funnel; then the obtained polymer was washed with distilled water and finally dried till constant weight in vacuum oven at 60 ∘ C.
Elemental Analysis, Infrared, and Ultraviolet Spectroscopy.
The carbon, hydrogen, and nitrogen contents of the prepared polymer were carried out in the microanalytical laboratory at Cairo University by using oxygen flask combustion and a dosimat E415 titrator (Switzerland).
The infrared spectroscopic analysis of the prepared polymer was carried out in the microanalytical laboratory at Cairo University by using a Shimadzu FTIR-430 Jasco spectrophotometer and KBr disc technique.
The ultraviolet-visible absorption spectra of the monomer and the prepared polymer sample were measured using Shimadzu UV spectrophotometer (M 160 PC) at room temperature in the range 200-400 nm using dimethylformamide as a solvent and reference.
X-Ray Photoelectron Spectroscopy (XPS).
An XPS spectrum was obtained on XPS-thermo scientific spectrometer, Model: K-ALDH in Central metallurgical research and development institute (CMRDI).Polymer was mounted on a standard sample holder using double-sided adhesive tape.Survey and XPS spectra were obtained with Al K monochromatic X-ray with the resolution of 0.7 eV.
Thermal Gravimetric Analysis (TGA), Transmission Electron Microscopy (TEM), and X-Ray Analysis.
Thermal gravimetric analysis (TGA) of the polymer sample was performed using a SHIMADZU DT-30 thermal analyzer.The weight loss was measured from ambient temperature up to 600 ∘ C at rate of 20 ∘ C/min to determine the rate of degradation of the polymer.
The X-ray diffractometer type Philips 1976 Model 1390 was used to investigate the phase structure of the polymer powder under the following condition which kept constant during the analysis processes: Cu: X-ray tube, scan speed = 8/min, current = 30 mA, voltage = 40 kv, and preset time = 10 s.
The inner cavity and wall thickness of the prepared polymer were investigated using transmission electron microscopy (TEM) JEOL JEM-1200 EX ^(Japan).
Conductivity Measurements.
The ac conductivity was measured using Philips RCL bridge (digital and computerized) at a frequency range 0.1-100 kHz and over temperature range 30-80 ∘ C. The temperature was controlled by the use of a double wound electric oven.
The ac conductivity ac value was calculated using the relation where = 2 and is the applied frequency.
Determination of the Optimum Polymerization Conditions.
To optimize the condition for polymerization of ophenylenediamine, the concentrations of potassium dichromate, hydrochloric acid, and monomer were investigated with keeping the total volume of the reaction mixture constant at 50 mL.
Effect of HCl Concentration.
The effect of HCl concentration on the aqueous oxidative polymerization of OPDA was investigated using constant concentration of K 2 Cr 2 O 7 at 0.3 M and monomer concentration at 0.1 M and using different concentration of HCl at 5 ± 0.2 ∘ C. The yield-time data was represented in Figure 2, from which it is clear that the obtained yield increases in the acid concentration range from 0.04 to 0.2 then decreases gradually up to 0.5 M.This behavior may be due to, at higher concentration of HCl, the degradation of the polymer in the early stages of the reaction, which may be due to the hydrolysis of polyemeraldine chain [13].
Effect of O-Phenylenediamine Concentration.
The effect of monomer concentration on the polymerization efficiency was investigated in the range of monomer concentration from 0.02 to 0.5 M and the data was represented in Figure 3, from which it is clear that the optimum yield formation is obtained at 0.1 M of the monomer concentration.plotted for different oxidant concentrations and the data are graphically represented in Figure 4(a).The initial and overall reaction rates were determined using the following equation:
The Kinetic
where is the weight of the obtained polymer, is the time in seconds, is the molecular weight of the monomer, and is the reaction volume in liter.
The initial and overall reaction rates of the polymerization reaction increase with the increase of oxidant concentration in the range between 0.05 and 0.3 mol/L.The oxidant exponent was determined from the relation between logarithm of the initial rate of polymerization Log ( ) and logarithm of the oxidant concentration.A straight line was obtained which has a slope of 1.011 as represented in Figure 4(b).This means that the polymerization reaction of OPDA is a firstorder reaction with respect to the oxidant.
Effect of Hydrochloric Acid Concentration.
The polymerization of OPDA (0.1 mol) in 25 mL of HCl with different molarities was carried out by addition of 25 mL potassium dichromate (0.3 mol/L) as oxidant at 5 ∘ C for different time intervals.The concentration of the monomer and oxidant were kept constant during the study of HCl effect on the polymerization reaction.The experiments were carried out as described in Section 2.2, and the yield-time curve was plotted for each acid concentration used.The data are graphically represented in Figure 5(a), from which it is clear that both the initial and overall reaction rates of the polymerization reaction increase with the increasing of HCl concentrations in the range between 0.05 and 0.2 mol/L.The HCl exponent determined from the slope of the straight line represented in Figure 5(b) was found to be 0.954, which means that the polymerization order with respect to the HCl concentration is a first-order reaction.concentration used.The data are graphically represented in Figure 6(a).The monomer exponent was determined from the slope of the straight line represented in Figure 6(b) for the relation between log and logarithm of the monomer concentration.The slope of this linear relationship was found to be 1.045.This means that the polymerization reaction with respect to the monomer concentration is a first-order reaction.
Calculation of the Thermodynamic Activation Parameters.
The polymerization of OPDA (0.1 mol/L) in 25 mL of 0.2 mol/L HCl in presence of 25 mL potassium dichromate (0.3 mol/L) as oxidant solution was carried out at 5, 10, and 15 ∘ C for different time periods.The yield-time curves were graphically represented in Figure 7, from which it is clear that both of the initial and overall reaction rates increase with raising the reaction temperature.The apparent activation energy ( a ) of the aqueous polymerization reaction of o-phenylenediamine was calculated using the following Arrhenius equation: where is the rate, is the universal gas constant, is the reaction temperature, and is constant.By plotting log against 1/, which gave a straight line as shown in Figure 8, and from the slope we can calculate the activation energy.The apparent activation energy for this system is 63.658 kJ/mol.The Enthalpy and entropy of activation for the polymerization reaction can be calculated by the calculation of 2 from the following equation: The values of 2 at 5, 10, and 15 ∘ C were 6.131 × 10 −6 , 1.054 × 10 −5 , and 1.594 × 10 −5 , respectively.The enthalpy (Δ * ) and entropy (Δ * ) of activation associated with 2 were calculated using Eyring equation where 2 is the rate constant, is the Avogadro's number, is the universal gas constant, and ℎ is planks constant.By dividing the above equation by and taking its natural logarithm we obtain the following equation: International Journal of Polymer Science Figure 9 shows the relation between 2 / versus 1/, which gives a linear relationship with (−Δ * )/ and intercept line (ln /ℎ + Δ * /) from the slops and intercept; the values of Δ * and Δ * were found to be 61.48kJmol −1 and 29.95 Jmol −1 K −1 , respectively.
The intramolecular electron transfer steps for the oxidation reaction are endothermic as indicated by the value of Δ * .The contributions of Δ * and Δ * to the rate constant seem to compensate each other.This fact suggests that the factors controlling Δ * must be closely related to those controlling Δ * .Therefore, the salvation state of the encounter compound could be important in determination of Δ * .Consequently, the relatively small enthalpy of activation can be explained in terms of the formation of more solvated complex.
Polymerization Mechanism.
The aqueous oxidative polymerization of o-phenylenediamine is described in the Experimental section and follows three steps [29].
The Initial
Step.Potassium dichromate in acidified aqueous solution produces chromic acid as shown in This reaction is controlled by the change in pH; the orange red dichromate ions (Cr 2 O 7 ) 2− are in equilibrium with the (HCrO 4 ) − in the range of pH-values between 2 and 6, but at pH below 1 the main species is (H 2 CrO 4 ) and the equilibria can occur as follows: The chromic acid withdraws one electron from each protonated OPDA and probably forms a metastable complex as shown in (11): The complex undergoes dissociation to form monomer cation radical as shown in (12): Generally, the initial step is rapid and may occur in short time, 0-5 min (autocatalytic reaction); no polymeric product is being obtained.After 5 min of the polymerization reaction, the polymeric products are obtained.
Propagation
Step.This step involves the interaction between the formed radical cation and the monomer to form a dimer radical cation.In the case of Cr(VI) oxidation of the organic compounds, Cr(VI) is reduced to Cr(IV) first and then to This reaction is followed by further reaction of the formed dimmer radical cations with monomer molecules to form trimer radical cations and so on.The degree of polymerization depends on different factors such as dichromate concentration, HCl concentration, monomer concentration, and temperature.By adding (7), (11), (12), (13), and ( 14), Termination Step.Termination of the reaction occurs by the addition of ammonium hydroxide solution in an equimolar amount to HCl present in the reaction medium (till pH = 7), which leads to cessation of the redox reaction.The reaction could occur as follows: 1.The complete solubility was found in N-methyl pyrrolidone, then in DMF 2.235 g/L followed by acetone 1.67 g/L, then in methanol 1.074 g/L then followed by iso propanol 0.879 g/L at 20 ∘ C but not soluble in benzene, hexane, and chloroform.
The Elemental Analysis.
The data obtained from elemental analysis using oxygen flask combustion and a dosimat E415 titrator shows that the found carbon content of (POPDA) is lower than the calculated value.This is due to the formation of chromium carbide during step of heating and measuring process while the found values of nitrogen and hydrogen are 20.91 and 4.37, respectively, which are in good agreement with the calculated one for the suggested structure present in Scheme 1.By measuring another sample of the (POPDA) which was prepared by using ammonium persulfate as oxidant, the found value of carbon is higher than sample which is prepared by using potassium dichromate as oxidant.For more information about the chemical composition of (POPDA), the XPS study was conducted as mentioned under point 3.5.2.
X-Ray Photoelectron Spectroscopy (XPS) Characterization
(1) XPS Survey Elemental Composition.X-ray photoelectron spectroscopy (XPS) is used to study the composition of materials, which detect elements starting from Li ( = 3) and higher elements.Hydrogen ( = 1) and helium ( = 2) cannot be detected due to the low probability of electron emission.XPS survey begins from 0 to 1400 (eV) as shown in Figure 10.The XPS survey scan spectrum of the prepared polymer shows the presence of C, N, O, Cl, and Cr.The Cl was present as doping anion in the prepared polymer.Chrome was found due to the polymer prepared using potassium dichromate as oxidant.It is possible for chromium ion (Cr +3 ) to present between polymer chains as a sandwich-bonded C 6 H 6 -C 6 H 6 groups as shown in Scheme 1 and the usual formation procedure is hydrolyzing the reaction mixture with dilute acid which gives the cation (C 6 H 6 ) 2 Cr 3+ [30,31].
The XPS elemental analysis of the prepared polymer is given in Table 2.The data shows that there is a good agreement with the calculated one for the suggested structures present in Scheme 1.
(2) XPS Spectra of Poly(OPDA).Four main peaks were obtained for C1s spectra of poly(OPDA) as shown in Figure 11(a).The sharp peak appearing at 283.98 eV is attributed to C-H (C 1 ) bond, while the peak appearing at 284.18 eV is attributed to C-C (C 2 ) bond.The peak appearing at 285.08 eV is assigned to C-N (C 3 ) bond while the peak appearing at 287.58 eV is attributed to C-O or C-N + (C 4 ) bond [32][33][34].
N1s Figure 11(b) shows the XPS N1s spectrum of poly(OPDA) which has three distinct curves.The first two peaks are assigned to imine (-N=) at 398.58 eV and amine (-NH-) at 399.23 eV.Moreover, the peak that appears at 400.58 eV is due to positively charged nitrogen atom (N + ).
Two distinct oxygen species contribute to the oxygen 1 s signals in the conducting polymers (Figure 11(c)).The distinct energy peaks at 530.68 and 533.12 eV could be attributed to Cr 2 O 3 and C-OH, respectively.
The Cl 2p spectrum of poly(OPDA) is shown in Figure 11(d).In order to estimate the anion Cl at the surface, Cl 2p peaks are fitted with a number of spin-orbit doublets (Cl 2p 1/2 and Cl 2p 3/2 ) with the B.E. for the C12p 3/2 peaks at about 197.36, 198.34, and 200.1 eV.The lowest and the highest B.E. components are attributable to the ionic and covalent chlorine species (Cl − and -Cl), respectively.The chlorine species (Cl * ) with the intermediate appear at B.E. of 198.34 eV.The lower B.E. value of the Cl * species compared to the Cl species suggests the presence of chloride anion in a more positive environment, probably arising from an increase in the number of positively charged nitrogen in the polymer chain associated with the formation of polarons and bipolarons.
The Cr spectrum of (POPDA) is shown in Figure 11(e).The main components corresponding to different chemical chromium species were observed in the high-resolution Cr 2 p 3/2 spectrums.The first peak at 576.18 eV ± 0.2 eV was assigned to Cr 2 O 3 which is in agreement with what was found by Chowdhury and Saha [13] and Stefanov et al. [35], also indicated by a distinct O1s peak at 530.68 eV typical for Cr 2 O 3 which may be adsorbed on polymer surface during chromous acid H 2 Cr 2 O 3 oxidation process.There is also a component visible that corresponds to Cr 2 p 1/2 at 586.08 eV, which was attributed to Cr 3+ .This data reveal that chromium ion is present between benzene rings of polymeric chain as shown in Scheme 1.
The Infrared Spectroscopic Analysis of (OPDA) Monomer
and Its Analogs Polymer.The IR spectra of the OPDA and its polymer (POPDA) are represented in Figure 12, while the absorption band values and their assignments are summarized in Table 3.The medium absorption band appearing at 453 cm −1 , which could be attributed to bending deformation of N-H group attached to benzene ring in case of monomer, appears at 518 cm −1 with slight shift in case of polymer.The broad absorption band appearing at 778 cm −1 in case of monomer, which could be attributed to out of plane deformation of CH for 1,2-disubstituted benzene, appears at 748 cm −1 with slight shift in case of polymer.A series of absorption bands appear in the region from 924 to 1152 cm −1 which could be attributed to the out of plane C-H deformation of 1,2-disubistuition benzene ring in case of monomer and 1,2,4 tri-substituted of benzene ring, in case of polymer.The sharp absorption bands appear at 1336 cm −1 in case of the monomer, which could be attributed to symmetric stretching vibration of C-N, appears at 1362 cm −1 with slight shift in case of polymer.The sharp absorption band appearing at 1490 cm −1 in case of the monomer may be attributed to C=C aromatic stretching vibration, which appears at 1500 cm −1 with slight shift in case of polymer.The sharp absorption band appearing at 1630 cm −1 in case of the monomer, which may be attributed to C=C deformation of benzene ring, appears at 1621 cm −1 with slight shift in case of polymer.The shoulder absorption band appears at 3032 cm −1 in case of the monomer which could be attributed to symmetric stretching vibration of C-H in aromatic ring and disappears in case of polymer.The triplet absorption bands appearing at 3190, 3281, and 3370 cm −1 in case of monomer could be attributed to asymmetric stretching vibration for NH group, but in case of polymer a broad absorption band that appears at 3354 cm −1 could be attributed to asymmetric stretching vibration for NH group and OH group present in the polymer structure.and its polymer are represented in Figure 13; the spectra show the following absorption bands: (1) in case of monomer, two absorption bands appear at max = 219 and 240 nm which may be attributed to - * transition (E 2 -band) of the benzene ring and the -band ( 1g − 2u ); (2) in case of polymer, two absorption bands appear at max = 221 and 243 nm which may be attributed to - * transition showing a bathochromic shift.Beside these two bands, broad absorption band appears in the visible region at max = 417 nm which may be due to the high conjugation of the aromatic polymeric chain.
3.5.6.Thermal Gravimetric Analysis (TGA) of Poly O-Phenylenediamine.Thermogravimetric analysis (TGA) for the prepared polymer has been investigated and the TGA-curve is represented in Figure 14.The calculated and found data for the prepared polymers are summarized in Table 4.The thermal degradation steps are summarized as follows: (1) the first stage includes the loss of one water molecule in the temperature range between 29.5 and 122.6 ∘ C; the weight loss of this step was found to be 3.21% which is in a good agreement with the calculated one; (2) in the second stage, in the temperature range between 122.6 and 203.8 ∘ C, the weight loss was found to be 6.65%, which could be attributed to the loss of one HCl molecule.The calculated weight loss is in good agreement with the found one; (3) in the third stage, in the temperature range between 203.8 and 320.3 ∘ C, the weight loss was found to be 11.79%, which is attributed to the loss of four (NH 2 ) groups.The calculated weight loss for this stage is equal to 12.11%; (4) in the fourth stage, in the temperature range between 320.3 and 400.0 ∘ C, the weight loss was found to be 16.95%, which could be attributed to the loss of one molecule of C 6 H 3 -NH.The calculated weight loss of this stage is equal to 17.22%; (5) in the fifth stage, in the temperature range between 400.0 and 523.4 ∘ C, the weight loss was found to be 13.78%, which is attributed to the loss of one molecule of phenyl ring.The calculated weight loss of this stage is equal to 14.19%; (6) in the last stage, above 523.38 ∘ C, the remaining polymer molecule was found to be 47.62% including the metallic residue, but the calculated one was found to be 46.46%.This behavior is in good agreement with the random free energy model proposed by Dyre [36].According to this model, conductance increases as a function of frequency in many solids, including polymers, which can be explained on the basis of any hopping model.The rise in conductivity upon increasing the frequency and temperature is common for disordered conducting polymer.As can be seen, each curve displays a conductivity dispersion, which is strongly dependent on frequency and shows weaker temperature dependant.
The X-Ray Diffraction Analysis and Transmission
The recorded conductivity value at room temperature of POPDA was found 0.0352 S/cm which is higher than conductivity of polyaniline-polyvinyl alcohol blends 10.5 × 10 −5 S cm −1 [37] and ac conductivity of HCl doped polyaniline synthesized by the interfacial polymerization technique 6.2 × 10 −5 S cm −1 [38].Also, the ac conductivity of POPDA is higher than polyaniline loaded with 10% molybdenum trioxide composites 0.025 s/cm [39] but lower than the determined value of ac conductivity polyaniline prepared by K 2 Cr 2 O 7 as oxidant 1.922 S cm −1 .Such difference could be attributed to the different disorder of each composite, substituted function group, and different used dopant.
International Journal of Polymer Science 0.15 0.17 In general, for amorphous conducting material, disordered systems, low mobility polymers, and even crystalline materials, the ac conductivity ( ac ) as a function of frequency can obey a power law with frequency [40].The ac conductivity ( ac ) over a wide range of frequencies can be expressed as where is a complex constant and the index () is frequency exponent and is the angular frequency ( = 2).
Figure 17 shows the relation between Ln ac and Ln at different temperatures.The value of () at each temperature has been calculated from the slope of ln () versus ln () plot.As shown in Figure 18 the calculated values of () for (POPDA) sample are less than unity.The microscopic conduction mechanisms of disordered systems are governed by two physical processes such as classical hopping or quantum mechanical tunneling of charge carries over the potential barrier separating two energetically favorable centers in a random distribution.The exact nature of charge transport is mainly obtained experimentally from the temperature variation of exponent (s) [41].The temperature exponent(s) dependences for (POPDA) sample reveal that the frequency exponent(s) decreases with the increase of temperature.This behavior is only observed in the correlated barrier hopping model proposed by Elliott [42].
Conclusions
In the present work POPDA polymer incorporated with potassium dichromate and HCl has been successfully achieved.The optimum yield formation of POPDA is obtained at 0.3 M potassium dichromate 0.1 M of the monomer and 0.2 M hydrochloric acid concentrations.The initial and overall rate of polymerization reaction increases with increasing the oxidant, monomer, and HCl concentrations.The exponent of oxidant, monomer, and HCl was found to be 1.011, 1.045, and 0.954, respectively.The chrome is present between polymer chains as sandwich-bonded C 6 H 6 -C 6 H 6 groups and the usual formation procedure hydrolyzes the reaction mixture with dilute acid which gives the cation (C 6 H 6 ) 2 Cr 3+ .The ac conductivity increases with the increase of frequency and temperature.The microscopic conduction mechanism of charge which carries over the potential barrier in polymer backbone is classical hopping model.
Figure 4 :Figure 5 :
Figure 4: (a) Yield-time curve for the effect of potassium dichromate concentration on the polymerization (POPDA) at different time intervals.(b) Double logarithmic plot of the initial rate and oxidant concentration of POPDA.
Figure 6 :Figure 7 :Figure 8 :Figure 9 :
Figure 6: (a) Conversion-monomer/mol concentration effect on the aqueous oxidative polymerization of (POPDA) at different time intervals.(b) Double logarithmic plot of the initial rate and monomer concentration of POPDA.
Table 1 :
Solubility of poly-o-phenylenediamine (POPDA) in different solvents at 20 ∘ C. Transfer of two electrons from two monomer ions radical by H 2 CrO 4 produces para semidine salt along with chromous acid H 2 Cr 2 O 3 (Cr(IV)).The intermediately produced Cr(IV) oxidises para semidine to pernigraniline salt (PS) at suitable low pH and the PS acts as a catalyst for conversion of OPDA to POPDA:
3.6.acConductivity ( ac ).Figure 17 represent the variation in ac conductivity ( ac ) for (POPDA) as a function of frequency and temperature.It is observed that the value of ac conductivity increases with the increase of frequency. | v3-fos-license |
2018-02-16T00:29:27.723Z | 2014-01-01T00:00:00.000 | 3326323 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "https://japsonline.com/admin/php/uploads/1187_pdf.pdf",
"pdf_hash": "7a090f8dcc67e4e23328c439689e5aa186844c48",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120010",
"s2fieldsofstudy": [
"Agricultural And Food Sciences"
],
"sha1": "7a090f8dcc67e4e23328c439689e5aa186844c48",
"year": 2014
} | pes2o/s2orc | Pharmacognostic Studies and Chromatographic Analysis of the Gum of Anacardium occidentale L ( Anacardiaceae )
Article history: Received on: 07/09/2013 Revised on: 08/10/2013 Accepted on: 12/02/2014 Available online: 27/02/2014 Microscopy of the gum revealed various shapes and sizes which disintegrated within a short time (3-5 minutes). They have thick walls, somewhat cracked and striated and also seen as translucent masses. Some were observed to have open fissures. However, the purified ones obtained from the precipitates depicted no open fissures, striations or cracks. Macroscopy revealed that A.occidentale gum has irregular shapes, tasteless, odourless, very coarse texture for the crude to fine coarse for the purified gum. It is yellowish brown colour for the crude to whitish milk for the purified gum. On the other hand, the gum arabic has a bland mucilaginous taste, odourless, varying shapes and sizes with a milky colour. This shows that the plant gum has features similar to available pharmaceutical gums and as such a viable pharmaceutical material and also these features are useful for the preparation of monograph of the plant. Paper and Thin Layer Chromatographic analyses of the carbohydrates in both the gums revealed the presence of sugars such as xylose, arabinose, galactose and glucose. Butanol-Acetic acidWater (BAW) 4:1:5; Butanol-Ethanol-Water (BEW) 4:1:2.2; and Butanol-Acetic acid-Ether-Water (BAEW) 9:6:3:1 were used as solvents systems by ascending technique and sprayed with Aniline phthalate for visualization.
INTRODUCTION
Gums are natural plants hydrocolloids that may be classified as anionic or non-ionic polysaccharides or salts of polysaccharides.They are translucent, amorphous substances that are frequently produced in higher plants as protective agents after injury.Thus, they are the abnormal products of plants metabolism (Kokate et al, 2002).Gums are also considered to be pathological products formed upon injury of the plant or owing to unfavourable conditions such as drought by a breakdown of cell walls (extra cellular formation-gummosis) (Evans, 2002;Kokate et al, 2002).Comparative studies using samples of cashew gum obtained from different geographical sources have been reported to show significant variations in compositions and properties linked with climatic conditions (Lima et al, 2002).Gums are heterogeneous polyuronides which on hydrolysis, they yield sugars such as arabinose, galactose, glucose, mannose, xylose and various uronic acids (Kokate et al, 2002).In most gums, the polyuronides of . .mixed composition are formed by glycosidic linkages and various sugar molecules (Wallis, 1967).The cashew gum was determined by Mothe and Rao (1999) to be acidic to litmus paper which is in agreement with range of cashew gum mucilage Gums consisting of linear polymers are less soluble than those with branched constituents, and linear hydrocolloids yield solutions with greater viscosity.Plants exudates have been the traditional gums for pharmaceuticals purposes and they still find significant application; however preparation of these gums is labour intensive and carries a premium price and their use will probably continue to decline.Marine gums are widely used as utility gums at the present time, and their competitive positions appear stable (Kokate et al, 2002 andTyler et al, 1988).
The chromatographic methods of analysis provide information on the homogeneity, molecular size and structure of a carbohydrate and gives useful information especially R F values which are used in the identification of the compound desired.Pharmacopoeias are increasingly employing thin-layer chromatography as a means for assessing quality and purity.The RF value (rate of flow, i.e. distance moved by solute divided by distance moved by solvent front) of a compound, determined under specified conditions, is characteristic and can be used as an aid to identity.The R F values vary from 0.0 to 1.00.Quantitative extracts of crude drugs are prepared and compared chromatographically with the standard reference solutions of the known constituents (Trease and Evans, 1983).The method of separation is also useful in the isolation of carbohydrates and their derivatives.Paula and Rodrigues (1995) also reported the presence of arabinose, glucose, rhamnose, mannose and glucuronic acid appearing as terminal residues in the polysaccharide of A. occidentale gum Gums find diverse applications in pharmacy as tablet binders, emulsifiers, gelatine agents, suspending agents, stabilizers and thickeners.They are also ingredients in dental and other adhesives and in bulk laxatives (Tyler et al, 1988).Zakaria and Rahman (1996) observed that differences in gum sources seem to influence the pH and the viscosity of the gum mucilage.
MATERIALS AND METHODS
Following the identification of the A. occidentale, the gum was collected upon wounding or injuring the bark using a sterile beaker container.The gum was allowed to air dry under the shade and some brownish to red particles suspected to be cork or fragments of bark were mechanically removed.The hardened cakes were size reduced to fine powder by the use of pestle and mortar.About 500g of the gum powder was dissolved in about 1 litre of hot water and the resultant solution was strained to free it from insoluble matter (organic matter) by filtering, through a clean piece of linen cloth.The gum from the filterate was then extracted or precipitated using the method of Karawya et al (1971) for gum purification and extraction.The gum was extracted severally with 95% alcohol and finally washed and dried in the oven at a temperature of 40⁰С for at least 3hours and kept in an air tight container for further use.
Detailed macroscopical and microscopical studies of the cashew gum with respect to gum Arabic were carried out.Following the acid hydrolysis, the chromatographic analysis of the gum was done using paper and Thin layer chromatography by calculating the R F values and compared with the reference sugars.Butanol-Acetic acid-Water (BAW) 4:1:5; Butanol-Ethanol-Water (BEW) 4:1:2.2;and Butanol-Acetic acid-Ether-Water (BAEW) 9:6:3:1 were used as solvents systems by ascending technique and sprayed with Aniline phthalate for visualization.
RESULTS AND DISCUSSIONS
From the physical examination of the gum, it can be deduced that it has varying shapes and sizes, odourless, tasteless.The crude gum was seen to be yellowish brown in colour while the purified or precipitated gum is whitish to milk in colour.Under the microscope, the crude gum appeared as large masses which dissolve when cleared with a chloral hydrate as a clearing agent.The precipitated gum on the other hand showed irregular with varying shapes and sizes.They have thick walls, somewhat cracked and striated and also seen as translucent masses.Some were observed to have open fissures (figure 1).However, the purified ones obtained from the precipitates depicted no open fissures, striations or cracks (figure 2).The microscopy of the gum Arabic also shows similar features like that of the precipitated cashew gum as in figure 2. The fissures/cracks have reduced due to partial purification.The observed features disintegrated within 3-5 minutes when mounted with dilute glycerol.Negligible, limited fibres were also seen.The macroscopical and microscopical feature of gum Arabic is much alike to that of cashew gum.The rapid disintegration of the A. occidentale gum may probably suggest its low stability property.Based on the R F values of the various reference sugars and compared with the test gum sample, it can be inferred that the later have xylose, glucose, arabinose and galactose sugars as revealed on both the paper and thin layer chromatography.The TLC in BEW revealed that the R F value of the gum sample (0.58) closely corresponded to that of glucose (0.55).Similarly, the TLC in BAEW solvent system indicated the R F value of the gum (0.36) closely related to galactose (0.37).These are similar to earlier | v3-fos-license |
2020-07-21T13:13:56.500Z | 2020-07-16T00:00:00.000 | 220650774 | {
"extfieldsofstudy": [
"Biology",
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0247820&type=printable",
"pdf_hash": "2e76fda01e8154e9c1f9d62544e91d12ab2a599c",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120018",
"s2fieldsofstudy": [
"Agricultural And Food Sciences"
],
"sha1": "ed6943a40d365a081dc58de74fb44c3553256fa3",
"year": 2021
} | pes2o/s2orc | Red seaweed (Asparagopsis taxiformis) supplementation reduces enteric methane by over 80 percent in beef steers
The red macroalgae (seaweed) Asparagopsis spp. has shown to reduce ruminant enteric methane (CH4) production up to 99% in vitro. The objective of this study was to determine the effect of Asparagopsis taxiformis on CH4 production (g/day per animal), yield (g CH4/kg dry matter intake (DMI)), and intensity (g CH4/kg ADG); average daily gain (ADG; kg gain/day), feed conversion efficiency (FCE; kg ADG/kg DMI), and carcass and meat quality in growing beef steers. Twenty-one Angus-Hereford beef steers were randomly allocated to one of three treatment groups: 0% (Control), 0.25% (Low), and 0.5% (High) A. taxiformis inclusion based on organic matter intake. Steers were fed 3 diets: high, medium, and low forage total mixed ration (TMR) representing life-stage diets of growing beef steers. The Low and High treatments over 147 days reduced enteric CH4 yield 45 and 68%, respectively. However, there was an interaction between TMR type and the magnitude of CH4 yield reduction. Supplementing low forage TMR reduced CH4 yield 69.8% (P <0.01) for Low and 80% (P <0.01) for High treatments. Hydrogen (H2) yield (g H2/DMI) increased (P <0.01) 336 and 590% compared to Control for the Low and High treatments, respectively. Carbon dioxide (CO2) yield (g CO2/DMI) increased 13.7% between Control and High treatments (P = 0.03). No differences were found in ADG, carcass quality, strip loin proximate analysis and shear force, or consumer taste preferences. DMI tended to decrease 8% (P = 0.08) in the Low treatment and DMI decreased 14% (P <0.01) in the High treatment. Conversely, FCE tended to increase 7% in Low (P = 0.06) and increased 14% in High (P <0.01) treatment compared to Control. The persistent reduction of CH4 by A. taxiformis supplementation suggests that this is a viable feed additive to significantly decrease the carbon footprint of ruminant livestock and potentially increase production efficiency.
Introduction Livestock production, particularly ruminants, contributes to anthropogenic greenhouse gas (GHG) emissions globally. These emissions are estimated to be 7.1 Gt carbon dioxide (CO 2 ) equivalents annually which accounts for approximately 14.5% of the global anthropogenic GHG emissions [1]. The majority of GHG emissions from livestock production is in the form of methane (CH 4 ), which is produced largely through enteric fermentation and to a lesser extent manure decomposition. Enteric CH 4 emissions not only contribute to total agricultural GHG emissions but also represent an energy loss amounting up to 11% of dietary energy consumption [2]. Therefore, reducing enteric CH 4 emissions decreases the total agricultural contribution to climate change and can improve productivity through conservation of feed energy. There is potential for mitigation of enteric CH 4 emissions through a variety of approaches with a focus on the use of feed additives, dietary manipulation and forage quality [3].
Feed additives used in CH 4 mitigation can either modify the rumen environment or directly inhibit methanogenesis resulting in lower enteric CH 4 production (g/day per animal) and yield (g/kg dry matter intake [DMI]). Reductions in CH 4 production of beef cattle, through the direct inhibition of methanogenesis, have been reported for feed additives at 22, 93, and 98% for short-chain nitro-compounds (3-nitrooxypropanol; 3-NOP, [4]), synthetic halogenated compounds [5], and naturally synthesized halogenated compounds in seaweed [6], respectively. The compound 3-NOP inhibits the enzyme methyl-coenzyme M reductase (MCR) which catalyzes the final step in methanogenesis in rumen archaea [7]. Halogenated CH 4 analogs, such as bromoform, act on the same methanogenesis pathway by binding and sequestering the prosthetic group required by MCR in order to form CH 4 [8][9][10]. Some haloalkanes are structural analogs of CH 4 , and therefore competitively inhibit the methyl transfer reactions that are necessary in CH 4 biosynthesis [11,12]. These CH 4 analogues include bromochloromethane (BCM), bromoform, and chloroform and have been proven to be most effective for reducing CH 4 production. A 93% reduction of CH 4 was shown in Brahman cattle with a feed inclusion of BCM at 0.30 g/100 kg LW twice daily for 28 days, however feed intake, weight gain, carcass quality or feed efficiency were not statistically different [5]. Conversely, Abecia et al. (2012) reported that the inclusion of BCM at 0.30 g/100 kg once per day decreased CH 4 production 33% and increased milk production 36% [13]. The authors speculated that increased milk production in BCM treated cows could be attributed to a shift to more propionate production in the rumen, which is a hydrogen (H 2 ) sink and provides more energy compared to other volatile fatty acids. However, long-term efficacy of CH 4 analogues in the rumen remains to be confirmed. For example, Tomkins et al. (2009) reported a second experiment resulting in a 57.6% CH 4 reduction after 30 days of treatment which is far less than the reductions found during the first 28 days [5]. Additionally, chloroform fed to fistulated dairy cows was effective at reducing enteric CH 4 production through reduced abundance and activity of methanogenic archaea, but only over a 42-day period [14].
Types of feedstuffs can also impact CH 4 production by providing different substrates to microbial populations which are the drivers of volatile fatty acid (VFA) production in the rumen. There are ways to influence the types of VFA produced in the rumen by changing the types of feed in the diet [15,16]. This is important for two reasons; first VFAs are utilized as an energy source for animal productivity and second VFA pathways, such as the production of propionate, are able to utilize reducing equivalents that normally would be shifted to methanogenesis [17,18]. Concentrates contain non-structural carbohydrates, such as starch and sugar, that are rapidly fermented which drives pH down, negatively impacting methanogenic populations, and are an effective way to increase propionate production [19,20]. Forages contain structural carbohydrates, such as neutral detergent fiber (NDF), and have been linked to increased CH 4 production [21]. As dietary NDF increases, rumen pH also increases resulting in preferential production of acetate over propionate, which generates reducing equivalents that are then used in the methanogenesis pathway [22,23]. Fiber content in feeds play a significant role in CH 4 production, including impacting the efficacy of anti-methanogenic compounds, such as 3-NOP and bromoform that specifically target MCR [4]. This hypothesis is based on the assumption that when high grain diets are fed, NDF decreases and ruminal MCR concentration is likely lowered thus granting greater efficacy for anti-methanogenic compounds to target a greater proportion of MCR which results in greater methane reductions [24].
Some red seaweeds are anti-methanogenic, particularly the genus Asparagopsis, due to their capacity to synthesize and encapsulate halogenated CH 4 analogues, such as bromoform and dibromochloromethane, within specialized gland cells as a natural defense mechanism [25]. In a screening process to identify CH 4 reduction potential of select macroalgae in Australia, Asparagopsis taxiformis was demonstrated to be the most promising species with a 98.9% reduction of CH 4 when applied at 17% OM in vitro [26]. Although that level of inclusion of seaweeds is not practical for livestock production, subsequent studies demonstrated effective inclusion levels below 2.0% OM for Asparagopsis in vitro [27,28] without affecting total VFA concentrations or substrate digestibility. There are only two published studies that measured CH 4 reduction by supplementing Asparagopsis in cattle diets. Reductions in CH 4 as high as 98% were reported when A. taxiformis (containing 6.6 mg bromoform/g DMI) was supplemented at 0.2% OM in a high concentrate feedlot TMR [6]. In dairy, a 67% CH 4 reduction was observed when Asparagopsis armata (at 1.3 mg bromoform/g DMI) was supplemented at 1% OM over a two-week feeding period [29]. The differences in efficacy between the two studies were the concentration of bromoform in the naturally variable wild harvested seaweed and diet formulation (high grain versus low grain) [6]. A. taxiformis reduces CH 4 more effectively compared to similar inclusions of pure bromoform in vitro probably be due to multiple antimethanogenic CH 4 analogues working synergistically in the macroalgae [30]. Furthermore, A. taxiformis synthesizes multiple anti-methanogenic CH 4 analogues such as bromo-and iodomethanes and ethanes [31] and that methanogen species are differentially sensitive to CH 4 inhibitors [32].
For adoption of the seaweed by industry it is crucial that meat quality be maintained or improved. As with any feed additive, feeding A. taxiformis to livestock has the potential to alter meat quality, tenderness, taste, and consumer acceptability. Marbling, for instance, directly impacts flavor and juiciness and it has been shown that marbling can directly influence consumer preference with some willing to pay a premium [33].
We hypothesize that a significant anti-methanogenic effect of A. taxiformis would 1.) persist throughout introduction, transition, and finishing periods in a typical beef feedlot scenario, 2.) have no detrimental effects on animal productivity or meat quality and 3.) not contain bromoform residues within the meat and liver would be present.
Materials and methods
This study was approved by the Institutional Animal Care and Use Committee of the University of California, Davis (Protocol No. 20803).
Study design, animals, and diets
Twenty-one Angus-Hereford cross beef steers, blocked by weight, were randomly allocated to one of three treatment groups: 0% (Control, n = 7), 0.25% (Low, n = 7), and 0.5% (High, n = 6) inclusion rates of A. taxiformis based on OM intake. The unbalanced number of steers between treatment groups was due to an unexpected animal injury during the last three weeks of the trial to which all data from this steer was removed from statistical analysis. The steers used in this study were obtained from the Shasta Livestock Auction Yard (Cottonwood, CA), all of which were sourced from the same ranch, and were approximately 8 months of age weighing approximately 352 ± 9 kg at the start of the trial. Each steer was randomly assigned to an individual pen, fitted with its own feed bunk, and were fed twice per day at 0600 and 1800 hours at 105% of the previous day's intake.
The experiment followed a completely randomized design, with a 2-week covariate period, used as a baseline period, before treatment began followed by 3-week data collection intervals for 21-weeks; a total of 147 days (Fig 1). During data collection intervals, alfalfa pellets offered through the gas measuring device (GreenFeed system, C-Lock, Inc., Rapid City, SD) were included as part of daily feed intake. Steers were fed 3 diets during the study; high (starter diet; 63 days), medium (transition diet; 21 days), and low (finisher diet; 63 days) forage TMRs, which are typical life-stage TMRs of growing beef steers (Table 1). Samples from the three diets and alfalfa pellets were collected once per week and bags of A. taxiformis were randomly sampled and analyzed (
PLOS ONE
Seaweed supplementation reduces enteric emissions fat, total digestible nutrient and mineral content (Cumberland Valley Analytical Services, Waynesboro, PA). Steers were offered water ad libitum. The A. taxiformis used as a feed additive was provided by Commonwealth Scientific and Industrial Research Organization (CSIRO) Australia. The seaweed was collected during the gametophyte phase from Humpy Island, Keppel Bay, QLD (23o13'01"S, 150o54'01"E) by Center for Macroalgal Resources and Biotechnology of James Cook University, Townsville, Queensland, Australia. Once collected, the A. taxiformis was frozen, stored at −15˚C, then freeze dried at Forager Food Co., Red Hills, Tasmania, Australia, and later ground using a Hobart D340 mixer (Troy, OH, USA) and 3mm sieve. Total seaweed inclusion ranged from 46.7 to 55.7 g/day for Low and 76.1 to 99.4 g/day for High treatment. The seaweed used in the study contained bromoform at a concentration of 7.8 mg/g dry weight as determined by Bigelow Analytical Services (East Boothbay, ME, USA). To increase palatability and adhesion to feed, 200 ml of molasses and 200 ml of water was mixed with the A. taxiformis supplement, then the molasses-water-A. taxiformis mixture was homogenously incorporated into the TMR, by hand mixing, for each treatment animal. The Control group also received 200 ml of both molasses and water with their daily feed to ensure A. taxiformis was the only difference between the three treatments.
Sample collection and analysis
Methane, CO 2 , and H 2 gas emissions from steers were measured using the GreenFeed system (C-Lock Inc., Rapid City, SD, USA). Gas emissions were measured during the covariate (baseline) period and experimental period during weeks 3, 6, 9, 12, 15, 18, and 21. In each measurement period, gas emission data were collected during 3 consecutive days as follows: starting at 0700, 1300, and 1900 hours (sampling day 1); 0100, 1000, and 1600 hours (sampling day 2); and 2200 and 0400 hours (sampling day 3). Eructated gas samples from each steer were taken at random across each treatment group. The GreenFeed machine was manually moved to each steer pen where the steer was allowed to enter the machine by choice and induced to eat from the machine for 3 to 5 minutes, followed by a 2-minute background gas sample collection. One GreenFeed unit was used for all gas emissions samples and took approximately 140 minutes to complete each timepoint. The GreenFeed system was calibrated before each measurement period with a standard gas mixture containing (mol %): 5000 ppm CO 2 , 500 ppm CH 4 , 10 ppm H 2 , 21% O 2 and nitrogen as a balance (Air Liquide America Specialty Gases, Rancho Cucamonga, CA). Recovery rates for CO 2 , CH 4 , and H 2 observed in this study were within +/− 3% of the known quantities of gas released. Alfalfa pellets were offered at each sampling event as bait feed and was kept below 10% of the total DMI during each 3-day measurement period. The composition of alfalfa pellets is shown in Table 2. Feed residuals were collected daily before the morning feeding to determine the previous day's intake. Feed intake and feed costs were recorded daily and bodyweight (BW) was measured once weekly, using a Silencer Ranch Model hydraulic squeeze chute (Dubas Equipment Stapleton, NE) equipped with a scale, at 0500 before morning feeding to reduce variability due to gut fill. After the feeding trial was completed, all 20 steers were sent to a USDA-inspected commercial packing plant (Cargill Meat Solutions, Fresno, California) for slaughter. On the day of slaughter, steers were marked and followed throughout the process. On the first day, livers were collected, placed in individually labelled freezer bags and stored on dry ice until placed in a −20˚C freezer. Carcasses were aged for 48 hours in a large cooler and then graded by a certified USDA grader. Directly after grading, carcasses were sent to fabrication where the strip loin from the left side of each carcass was cut and saved for further analysis. All 20 strip loins were vacuum packed then stored on ice and transported back to the University of California, Davis where they were cryovac packaged and stored at 4˚C in dark for 14 days. After 14-day of aging, strip loins were cut into steaks (2.45 cm thickness) and individually vacuum packaged and stored at −20˚C. Samples of steaks and livers were analyzed by Bigelow Analytical Services (East Boothbay, ME, USA) for bromoform concentrations following a modified protocol described by Paul et al. (2009) [25]. The limits of bromoform detection and quantification were 0.06 mg/kg and 0.20 mg/kg, respectively. Steaks were also analyzed for proximate analysis by Midwest Labs (Omeha, Nebraska) for moisture (AOAC 950.46), protein (AOAC 992.15), fat (AOAC 991.36), ash (AOAC 900.02, 920.155, 920.153), calories (21 CFR P101.9), carbohydrates (100 -Moisture-Protein-Fat-Ash), and iodine (USP 233) concentration.
To test for objective tenderness, slice shear force (SSF) and Warner-Brazler shear force (WBSF) were measured following the protocol described by [34]. One steak from each animal was thawed overnight and cooked to an internal temperature of 71˚C. Within 1 to 2 minutes after cooking, the SSF were measured using machine texture analyzer (TMS Pro Texture Analyzer, Food Technology corporation, Sterling, VA, USA) with a crosshead at the speed of 500 mm/minute. To test WBSF, cooked steaks were cooled at 4˚C overnight, and then four cores were cut using WEN 8-inch 5 Speed Drill Press from one steak from each animal parallel to the muscle fiber orientation. The WBSF was measured using the TMS Pro texture analyzer with a Warner Bratzler blade (2.8 mm wide) and a crosshead at speed of 250 mm/minute. The average peak forces for all four cores were recorded.
A consumer sensory panel was conducted at UC-Davis. Strip steaks were thawed at 4˚C for 24 hours then cooked to an internal temperature of 71˚C using a George Foreman clamshell (Spectrum Brands, Middleton, WS, USA). Internal temperature was taken from the geometric center of each steak using a K thermocouple thermometer (AccuTuff 351, model 35100, Cooper-Atkins Corporation, Middlefield, CT, USA). Following cooking, steaks were rested for 3 minutes then cut into 1.5 cm 3 pieces. Each steak was randomly assigned a unique three digit number, placed into glass bowls covered in tin foil then stored in an insulated food warmer (Carlisle model PC300N03, Oklahoma, OK, USA) for longer than 30 minutes prior to the start of each sensory evaluation session. A total of 112 participants evaluated steak samples during one of the 5 sessions held over a 4-day period. Each participant evaluated a total of three steak samples, one from each treatment group, with a minimum of two 1.5 cm 3 pieces per steak. Each participant was asked to evaluate tenderness, flavor, juiciness, and overall acceptance using a 9-point hedonic scale (1 = Dislike extremely and 9 = Like extremely).
Statistical analysis
Statistical analysis was performed using R statistical software (version 3.6.1; The R Foundation for Statistical Computing, Vienna, Austria). The linear mixed-effects models (lme) procedure was used with the steer as the experimental unit. GreenFeed emission data were averaged per steer and gas measurement period, which was then used in the statistical analysis. The statistical model included treatment, diet, treatment × diet interactions, and the covariate term, with the error term assumed to be normally distributed with mean = 0 and constant variance. Individual animal was used as random effect, whereas all other factors were considered fixed. Data was analyzed as repeated measures with an autoregressive 1 correlation structure. Statistical significance was established when P � 0.05 and a trend at 0.05 > P � 0.10. The consumer sensory evaluation data were analyzed using the Kruskal-Wallis test. The Dunn's test with P-value adjustment following Bonferroni methods was used for post-hoc pair-wise comparisons.
Dry matter intake (DMI) and cost per kg of gain (CPG) data was averaged by week and used in the statistical analysis. Average daily gain (ADG) was calculated by subtracting initial BW from final BW then dividing by the number of experimental days for each diet regimen and the duration of the study (i.e. 63 days on high forage (starter) TMR, 21 days on medium forage (transition) TMR, then 63 days on low forage (finisher) TMR with total study duration of 147 days). Feed conversion efficiency (FCE) was calculated by dividing ADG by DMI for each diet regimen and the duration of the study. Carbon Dioxide (CO 2 ), CH 4 , and H 2 emissions are reported as production (g/day), yield (g/kg DMI), and intensity (g/kg ADG).
Gas parameters
The emissions as production (g/day), yield (g/kg DMI), and intensity (g/kg ADG) of CH 4 , H 2 , and CO 2 gases from the steers in the three treatment groups (Control, Low, and High) are presented in Fig 2 (for the duration of the trial) and Table 3 (divided by the three diet regimes). Inclusion of A. taxiformis in the TMR had a significant linear reduction in enteric CH 4 production, yield, and intensity. For the duration of the experimental period, CH 4 production, yield and intensity declined by 50.6 and 74.9%, 45 and 68%, and 50.9 and 73.1% for Low and High treatments, respectively, compared to Control. Hydrogen production, yield, and intensity significantly increased by 318 and 497%, 336 and 590%, and 380 and 578% in the Low and High treatments, respectively, for the duration of the experiment. Carbon dioxide (CO 2 ) production and intensity factors were not affected by either Low or High treatments, however, CO 2 yield was significantly greater in High treatment compared to Control (P = 0.03).
An interaction was observed between diet formulation and magnitude of CH 4 reduction and H 2 formation for production, yield, and intensity factors (Table 3). Methane production, yield, and intensity in steers on the high forage TMR and supplemented with A. taxiformis reduced by 36.4 and 58.7%, 32.7 and 51.9%, and 36.9 and 56.4% for Low and High treatments, respectively. Hydrogen production, yield, and intensity increased by 177 and 360%, 198 and 478%, and 256 and 524% for the Low and High treatments, respectively. Methane production, yield, and intensity in steers fed the medium forage TMR and supplemented with A. taxiformis was reduced by 51.8 and 86.8%, 44.6 and 79.7%, and 54.4% and 82.4%% for the Low and High treatments, respectively. Furthermore, H 2 production, yield and intensity significantly increased by 326 and 535%, 404 and 753%, and 341 and 626% for the Low and High treatments, respectively. Steers fed low forage TMR and supplemented with A. taxiformis reduced Asparagopsis taxiformis inclusion effects on methane, hydrogen and carbon dioxide emissions over a 147-day period. Means, standard deviations, and statistical differences of methane, hydrogen, and carbon dioxide production (g/d) (A1,B1,C1), yield (g/kg dry matter intake (DMI)) (A2, B2,C2), and intensity (g/kg average daily gain) (A3,B3,C3) for 0%, 0.25% (Low), and 0.50% (High) Asparagopsis taxiformis inclusion. Means within a graph with different alphabets differ (P < 0.05).
https://doi.org/10.1371/journal.pone.0247820.g002 CH 4 production, yield, and intensity by 72.4 and 81.9%, 69.8 and 80.0%, and 67.5 and 82.6% for Low and High treatments, respectively. Additionally, H 2 production, yield, and intensity increased by 419 and 618%, 503 and 649%, and 566 and 559% for the Low and High treatments, respectively. No significant differences were found in CO 2 production, yield, or intensity in any of the three diets.
Animal production parameters
Dry matter intake (DMI), ADG, feed conversion efficiency (ADG/DMI; FCE) and cost per gain ($USD/kg weight gain; CPG) as impacted by treatment groups (Control, Low, and High) for the entire experimental period is presented in Table 4 and for the individual TMRs in Table 5. Initial BW, final BW, carcass weight and total weight gained are shown in Table 4. During the entire experiment (Table 4), DMI in Low treatment tended (P = 0.08) to decrease by 8% and High treatment DMI significantly reduced by 14% (P < 0.01) whereas no significant effects were observed in ADG by either Low or High treatment groups when compared to Control. With the reduction of DMI in Low and High treatments and similar ADG among all 3 treatments, FCE tended to increase 7% (P = 0.06) in Low treatment and increased 14% (P < 0.01) in High treatment. No significant differences between initial BW, final BW, total gains, CPG or carcass weight were found between Control and treatment groups. While no significant differences were found in CPG, there was a $0.37 USD/kg gain differential between High and Control and $0.18 USD/kg gain differential between Low and Control.
Decreases in DMI were also found over the three different TMR diets (Table 5) where steers fed the high and medium forage TMR and the High treatment decreased their DMI 18.5 (P = 0.01) and 18.0% (P < 0.01), respectively. No significant effects were observed in ADG, CPG, or FCE by the Low or High treatment groups during the individual TMR diets. Additionally, cost differentials for High treatment were $0.29, $0.40, and $0.34 USD/kg gain and Table 3. Effect of Asparagopsis taxiformis inclusion at 0.25% (Low) and 0.5% (High) feed organic matter on enteric gas emissions using high-, medium-, and lowforage diets.
Gas Emission Data
High
Carcass and meat quality parameters
There was no statistical difference between treatment groups for rib eye area (Table 6). No effects were found between Control, Low, and High treatments in moisture, protein, fat, ash, carbohydrates, or calorie content of strip loins ( No significant differences (P > 0.05) were found in shear force resistance among treatment groups. Mean scores of all sensory attributes (tenderness, juiciness, and flavor) by consumer panels were not significantly different (P > 0.05) among treatment groups ( Table 6). The taste panel considered all steaks, regardless of treatment group, to be moderately tender and juicy. This was consistent with the taste panel stating that they moderately liked the flavor of all steaks regardless of treatment group. There was no difference (P > 0.05) in overall acceptability among treatment groups. There was a linear increase in iodine concentrations in both Low (P < 0.01) and High (P < 0.01) compared to Control. Iodine concentrations for the Control treatment group were below detection levels, which was set at 0.10 mg/g (Table 6). However, 5 out of 7 steers in Low treatment group had iodine levels above the detection level with a treatment average of 0.08 mg/g (P < 0.01). All 6 steers in the High treatment group were found to contain iodine levels above the detection level with concentration levels ranging between 0.14-0.17 mg/g with a mean of 0.15 mg/g (P < 0.01). Bromoform concentrations for all treatment groups were below detection levels, which were 0.06 mg/kg.
Enteric methane production, yield, and intensity
This study demonstrated that dietary inclusion of A. taxiformis induces a consistent and considerable reduction in enteric CH 4 production from steers on a typical feedlot style diet. Enteric CH 4 is the largest contributor to GHG emissions from livestock production systems. Significant reductions in CH 4 yield, which is standardized by DMI, when Asparagopsis is supplemented to beef cattle diets has been established in this study and are similar to the reductions found in previous studies [6,29,35]. While CH 4 intensities have been previously reported for dairy cows fed A. armata [29], this is the first study to measure CH 4 intensity differences in beef cattle fed A. taxiformis. Intensity reports are important to determine the amount of �� P values are pooled across treatments. a,b,c superscripts = note significant differences (P = <0.05) between treatment groups. 1 A 9-point hedonic scale was used (1 = Dislike extremely and 9 = like extremely).
https://doi.org/10.1371/journal.pone.0247820.t006 methane being produced per unit of output for ruminant livestock systems. There is a concern that feed additives and other CH 4 reducing agents decrease in efficacy over time [14]. This study provided evidence that the seaweed inclusion was effective in reducing CH 4 emissions, which persisted for the duration of the study of 147 days (Fig 3). Notably, until this study the longest exposure to A. taxiformis had been demonstrated for steers in a study ending after a 90-d finishing period [6]. To date, only three in vivo studies have been published using Asparagopsis spp. to reduce enteric CH 4 emissions in feedlot Brangus steers [6], lactating dairy cattle [29], and sheep [35]. All studies show considerable yet variable reductions in enteric CH 4 emissions. The differences in efficacy are likely due to levels of seaweed inclusion, formulation of the diets, and differences in seaweed quality based on bromoform concentrations. It has been previously hypothesized that NDF levels can also influence the rate at which CH 4 is reduced with the inclusion of inhibitors [4,24]. In the current study, the magnitude of reductions in CH 4 production were negatively correlated (r 2 = 0.89) with NDF levels in the 3 diet regimens that contained 33.1% (high forage), 25.8% (medium forage), and 18.6% (low forage) NDF levels. Enteric CH 4 production was reduced 32.7, 44.6 and 69.8% in steers on the Low treatment and 51.9, 79.7, and 80.0% on High treatment with high, medium and low forage TMRs, respectively. The low forage TMR, containing the lowest NDF levels, was the most sensitive to the inclusion of A. taxiformis with CH 4 reductions above 70% at equivalent inclusion levels compared to the higher forage TMRs. Vyas et al (2018) showed similar trends of greater methane reduction potential in high grain, low NDF, diets in combination with the antimethanogenic compound 3-NOP [24]. It has been hypothesized to increase efficacy by a reduction in rumen MCR concentration when low NDF is fed, thus increasing the MCR targeting capability of the anti-methanogenic feed additive. An 80.6% reduction of CH 4
Methane production [g CH 4 /day] (A) and methane yield [g CH 4 /kg DMI] (B) from beef steers supplemented with
Asparagopsis taxiformis at 0%, 0.25%, and 0.5% of basal total mixed ration on an organic matter basis during the 21 week experimental period. Data points are treatment means for each gas collection timepoint and error bars represent standard errors. https://doi.org/10.1371/journal.pone.0247820.g003 sheep fed diets containing 55.6% NDF, however, the level of A. taxiformis intake by the sheep was unclear but was offered at 6 times the High treatment in our study [35]. A 42.7% reduction in CH 4 yield was observed in lactating dairy cattle fed a diet containing 30.1% NDF at 1% inclusion rate of A. armata [29]. The high forage TMR in our study had a similar NDF level to the dairy study, however, had approximately double the reduction of CH 4 , even when consuming 50% less seaweed. These differences relate to a large degree to the quality of seaweed in terms of the concentration of bromoform, which was 1.32 mg/g in the dairy study [29] compared to 7.82 mg/g in the current study. The same collection of A. taxiformis was used in a previously published in vivo study focused on Brangus feedlot steers for a duration of 90 days [6]. This seaweed had bromoform concentration of 6.55 mg/g, which was marginally lower than our study and may be due to variation in the collection, sampling, analysis techniques, or storage conditions. Despite the marginally lower bromoform concentration in the seaweed and using 0.20% inclusion rate of A. taxiformis on OM basis, the CH 4 yield was reduced by up to 98% in Brangus feedlot steers. The diet used by Kinley et al. (2020) included 30.6% NDF, which was similar to our high fiber diet [6]. The greater efficacy of A. taxiformis in that study could be due to collective feed formulation differences such as the energy dense component of barley versus corn, which is typical of Australian and American feedlots, respectively. Additionally, it could be due to beneficial interaction with the ionophore, monensin, that was used in the Australian study. Monensin has not been used in any other feed formulation in other in vivo studies with the inclusion of Asparagopsis species. Use of monensin in diets has shown to decrease CH 4 yields by up to 6% in feedlot steers while also having an enhanced effect in diets containing greater NDF levels [36]. A potential enhancing interaction of the seaweed with monensin is of great interest and further investigation will elucidate this potential that could have significant beneficial economic and environmental impact for formulated feeding systems that use monensin.
Enteric hydrogen and carbon dioxide emissions
Increases in H 2 yield have typically been recorded when anti-methanogenic feed additives are used, and with the addition of Asparagopsis species in dairy cattle (1.25-3.75 fold) [29] and Brangus feedlot steers (3.8-17.0 fold) [6]. Similar increases in H 2 yield have been reported in feed additives that reduce enteric CH 4 emissions targeting methanogens. For example, in lactating dairy cows supplemented with 3-NOP, H 2 yield increased 23-71 fold [37]. Bromochloromethane (BCM) fed to goats increased H 2 (mmol/head per day) 5-35 fold, while chloroform fed to Brahman steers increased H 2 yield 316 fold [38,39]. Although feeding Asparagopsis spp. increased overall H 2 yield (Fig 4), the magnitude was considerably lower (1.25-17 fold) compared to alternative CH 4 reducing feed additives (5-316 fold), with similar levels of reductions in CH 4 . This indicates that there may be a redirection of H 2 molecules that would otherwise be utilized through the formation of CH 4 and redirected into different pathways that could be beneficial to the animal. For example, increased propionate to acetate concentrations have been recorded in in vitro [40,41] and in vivo [6] using A. taxiformis and BCM [42] for CH 4 mitigation which may indicate that some of the excess H 2 is being utilized for propionate production.
Similar to the lactating dairy cattle study with 1% A. armata supplementation [29], the CO 2 yield in the current study also increased in the High group (Fig 2). However, in the current study no differences in CO 2 production were seen. Typically, CO 2 and H 2 are used in the methanogenesis pathway to form CH 4 thus increases in exhaled CO 2 is expected with the addition of anti-methanogenic compounds. The fact that only CO 2 yield increased may be due to decreases in DMI, which could have reduced overall CO 2 generation thus resulting in no increases seen in CO 2 production factors. feed efficiency in growing beef steers. Since a large proportion of on farm costs is the purchase of feed, an improved feed efficiency is particularly exciting for producers to decrease feed costs while also producing the same amount of total weight gains. Total gains were between 224 kg (Low) to 236 kg (High) combined with an average cost differential of~$0.18 USD/kg gain (Low) and~$0.37 USD/kg gain (High). A producer finishing 1000 head of beef cattle has the potential to reduce feed costs by $40,320 (Low) to $87,320 (High) depending on seaweed dosage. While the CPG in this study were not statistically significant, this may be due to low animal numbers in each treatment and warrants further investigation on a larger feedlot setting to reduce animal variability.
Bromoform and iodine residues
Bromoform is the major active ingredient responsible for CH 4 reduction when fed to cattle [43]. However, high levels of bromoform are suspected to be hazardous for humans and mice. While bromoform intake limits are yet to be defined for cattle specifically, the US EPA (2017) has suggested a reference dose for bromoform, an estimated level of daily oral exposure without negative effects, to be 0.02 mg/kg BW/day for human consumption [44]. It is essential that food products from livestock consuming the seaweed are confirmed as safe for consumption and that bromoform residues are not transferred to the edible tissues and offal of bovines at levels detrimental to food safety. Previous studies have demonstrated that bromoform was not detectable in the kidney, muscle, fat deposits, blood, feces, and milk in either Brangus feedlot steers [6], dairy cows [29], or sheep [35]. Strip loin and liver samples from steers were collected and in agreement with previous studies, no bromoform was detected in this study.
The National Academies of Sciences, Engineering, and Medicine recommendations for daily iodine intake in growing beef cattle is 0.5 mg/g DMI and maximum tolerable limit is 50 mg/g DMI [45]. Based on DMI intake from steers in this study, recommended daily iodine intake levels were 5.2 mg/day and 4.85 mg/day and maximum limits are 521 mg/day and 485 mg/day for Low and High treatment groups, respectively. The iodine level in the A. taxiformis fed in the current study contained 2.27 mg/g, therefore, maximum daily intake of seaweed iodine was 106-127 mg/day and 173-225 mg/day for the Low and High treatment groups, respectively. While these levels do not exceed maximum tolerable limits, they exceed daily iodine intake recommendations for cattle, therefore it was appropriate to test for iodine residue levels in meat used for human consumption. The US Food and Nutrition Board of the National Academy of Sciences has set a tolerable upper intake level (UL) for human consumption of foods, which is defined as the highest level of daily intake that poses no adverse health effects [46]. The iodine UL ranges between 200 ug/day to 1,100 ug/day depending on age, gender, and lactation demographics. Strip loins tested for iodine residues had levels of 0.08 and 0.15 ug/g from steers in treatments Low and High, respectively. These iodine residues are far under the UL limits for human consumption. For example, UL for a person under 3 years of age is 200 ug/day meaning that this person would have to consume more than 2.5 kg/day and 1.3 kg/day of meat from a Low and High steers, respectively, to reach the UL. An adult over the age of 18 has an UL of 1,100 ug/day and would have to consume more than 13.8 kg/day and 7.3 kg/day of meat from a Low and High steers, respectively, to reach their UL of iodine intake. At the inclusion levels and iodine concentration of A. taxiformis used in this study the margin of safety is extremely high and the likelihood of iodine toxicity from consuming the meat is extremely low. The health hazards of consistently consuming any meat at such levels is much higher than the iodine toxicity risks. Low level iodine in meat may provide for provision of iodine to populations that suffer from natural iodine deficiency, a common issue in populations with low intake of marine food products [47].
Marbling scores ranged from 410-810 while all carcasses, regardless of treatment, graded as either choice or prime. The value placed on tenderness in the marketplace is high and has even been found that consumers are likely to pay premiums for more tender beef [48]. Many factors can greatly affect meat tenderness, such as animals' age at slaughter, breed, marbling, and diet [49][50][51]. All animals used in the current study were of similar age and breed. Additionally, no significant difference in average marbling scores was observed. The lack of significant differences seen in these factors further supports that the supplementation of A. taxiformis at the current dosage did not impact the tenderness of meat. This is in agreement with Kinley et al.
(2020)'s meat taste assessment where no differences between Control and A. taxiformis supplemented beef cattle were found [6]. The combination of both the current study as well as the Kinley et al (2020) study [6] indicates that the supplementation of A. taxiformis at or below 0.5% to cattle does not significantly impact overall meat quality nor alter the sensory properties of the steaks.
Conclusions
This study demonstrated that the use of A. taxiformis supplemented to beef cattle diets reduced enteric CH 4 emissions for a duration of 21 weeks without any loss in efficacy. The efficacy was highly correlated with the proportion of NDF in the diet as demonstrated through the typical stepwise transition to a feedlot finishing diet formulation. Additionally, supplementing A. taxiformis had no measurable bromoform residues, no detrimental iodine residual effects in the product, and did not alter meat quality or sensory properties. Importantly, the use of A. taxiformis impacts DMI and not ADG, therefore increasing overall feed efficiency (FCE) in growing beef steers. This study also demonstrated a potential to reduce the cost of production per kg of weight gain. These feed cost reductions in combination with significantly reduced CH 4 emissions have a potential to transform beef production into a more economically and environmentally sustainable red meat industry.
Next steps for the use of Asparagopsis as a feed-additive would be to develop aquaculture techniques in ocean and land-based systems globally, each addressing local challenges to produce a consistent and high-quality product. Processing techniques are evolving with the aim of stabilizing as feed supplement and the economics of the supply chain. The techniques include utilization of already fed components as carriers and formats such as suspensions in oil which may be done using fresh or dried seaweed, and options in typical feed formulations such as mixtures are being explored [52]. Transportation of the processed or unprocessed seaweed should be kept to a minimum, so cultivation in the region of use is recommended specially to avoid long-haul shipping.
Supporting information S1 Table. Original data. Data sets used for statistical analysis of animal production, gas emissions, carcass parameters, and taste panel between Control, 0.25% OM inclusion of Asparagopsis taxiformis (Low), and 0.50% OM inclusion of Asparagopsis taxiformis (High) treatment groups. Petschl, S. Calderon, S. Leal, S. Lee, T. Lee, and V. Escobar that participated in the trial. We appreciate Dr. Craig Burnell and Steve Archer (Bigelow Labs in East Boothbay, ME, USA) for developing methods to measure bromoform concentration in Asparagopsis taxiformis, meat, liver, and feces collected in this study. | v3-fos-license |
2017-09-15T22:21:22.831Z | 2012-03-01T00:00:00.000 | 29282189 | {
"extfieldsofstudy": [
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.scielo.br/j/jbchs/a/xScctnNKYHnBxFRvGgXbzZm/?format=pdf&lang=en",
"pdf_hash": "c6aa20ac499c3e88999b347df589d73bcd88ce38",
"pdf_src": "Anansi",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120075",
"s2fieldsofstudy": [],
"sha1": "c6aa20ac499c3e88999b347df589d73bcd88ce38",
"year": 2012
} | pes2o/s2orc | TLC-Based Lipophilicity Assessment of Some Natural and Synthetic Coumarins
O caráter lipofílico de doze cumarinas foi investigado por cromatografia de camada fina de fase reversa (RP TLC) em sílica RP-18. Três diferentes sistemas de solvente binário compostos por água e o modificador orgânico (metanol, tetrahidrofurano ou acetonitrilo) foram utilizados para determinar o parâmetro de retenção (RM ) e o coeficiente de partição de octanol-água (log POW) como medida de lipofilicidade dos compostos testados. O parâmetro de lipofilicidade (log POW) foi determinado experimentalmente usando-se oito padrões de soluto com valores de log POW conhecidos, que foram analisados sob as mesmas condições cromatográficas de substâncias alvos. Parâmetros de lipofilicidade junto com descritores moleculares 2D foram submetidos à análise estatística multivariável (análise de componentes principais (PCA) e regressão por mínimos quadrados parciais (SLS)) para determinar os fatores mais importantes para retenção, ou seja, lipofilicidade dos compostos investigados. Os modelos quantitativos de relação entre as propriedades de estrutura e retenção revelam a importância de descritores referentes ao tamanho e ao formato da molécula assim como suas propriedades polares.
Introduction
The methods of relating molecular structure of solutes (expressed via descriptors) to their chromatographic (retention) behavior are commonly denoted as quantitative structure-retention relationships (QSRRs).Similarly, the aim of quantitative structure property relationship (QSPR) research is to find a functional dependence between molecule structure and its physicochemical properties.
Lipophilicity is a very important molecular parameter used in the QSR(P)R studies and plays an important role in drug discovery.Knowing the lipophilicity of potential drugs helps understanding their absorption, distribution, metabolism, excretion and toxicity (ADMET). 1 Lipophilicity is expressed by the logarithm of the partition coefficient (log P), which represents the tendency of a molecule to distribute between water and a water-immiscible solvent.Liquid chromatographic (LC) techniques can be considered as a traditional approach to fast estimation of lipophilicity.
Recently, a comparative study on several approaches for the determination of lipophilicity by means of thin-layer chromatography (TLC) was presented by Komsta et al. 2 In the case of TLC, the QSRR studies are usually based on the use of the R M value defined by Bate-Smith and Westall equation, 3 (1) where R F is the retardation factor.Generally, the R M values determined by means of reversed-phase thin-layer chromatography (RP TLC) are linearly dependent on the concentration of the organic modifier (j) in the mobile phase (2) where m and R M 0 are, respectively, the slope and the intercept of equation 2.
The extrapolation of the R M value to pure water based on the Soczewinski-Wachtmeister model 4 allows the estimation of lipophilicity. 5 The OECD (Organization for Economic Cooperation and Development) Guidelines for the Testing of Chemicals (Test 117) 6 describes the method for the determination of the partition coefficient (log P OW ) using reversed-phase high performance liquid chromatography (HPLC).The appropriate reference substances with log P OW values which encompass the log P OW of the test substances (i.e., at least one reference substance has P OW above that of the test substance and another P OW below that of the test substance) need to be selected and chromatographed under the same conditions as test substance in isocratic mode.A calibration graph obtained by correlation of the measured retention data of reference substances with their partition coefficients is used for the determination of the log P OW value of test substances.In many articles, HPLC method is substituted by thin-layer chromatography, 7 keeping the same principles as in Test 117 with RP-18 silica stationary phase and the composition of the mobile phase that provide the best selectivity (in accordance with isocratic HPLC mode).
In the past decade, our research was focused on QSRR of various organic compounds that are believed to exhibit biological activity.][10][11] In a previous publication, the results on the chromatographic behavior of 4-hydroxycoumarin rodenticides (coumatetralyl, bromadiolone and brodifacoum) and biocidal material impurities in various normal-and reversed-phase chromatographic systems were reported. 12The results proved the RP TLC to be suitable for the estimation of the relative lipophilicity of coumarine derivatives.
Coumarins are naturally occurring benzopyrone derivatives identified in plants and are characterized by extensive chemodiversity and various pharmacological activities.The majority of coumarins have been isolated from green plants.The genus Seseli (part of Apiaceae family) is a well-known source of linear or angular pyranocoumarins, an interesting subclass of coumarins possessing antiproliferative, 13 antiviral 14 and antibacterial activities. 15Numerous species of the genus have been used in folk medicine since ancient times.
Continuing research in this field, we selected Seseli montanum subsp.tommasinii as a source of some natural coumarins.From the aerial parts of the plant, five known coumarins were isolated.They were studied together with another two natural (isolated from the roots of Seseli annuum and Achillea tanacetifolia) and five synthetic coumarins.A study here presented deals with several topics: (i) retention behavior of coumarins in the reversed-phase chromatographic systems using different organic modifiers, (ii) comparison of different modifiers in lipophilicity assessment, (iii) comparison of two experimentally obtained lipophilicity parameters (R M 0 and log P OW ) in terms of better lipophilicity evaluation and (iv) selection of a subset of descriptors that are the most relevant for retention of coumarins.Principal component analysis (PCA) and partial least squares (PLS) were selected as ones of the most widely used chemometrical methods to build QSRR models.
Isolation procedure
The chemical structures of the investigated coumarins 1-12 are presented in Figure 1.
The plant material was collected at Gorica Hill (area of Podgorica City, Montenegro, Serbia) in Autumn 2009.A voucher specimen (P167/09) was deposited at Herbarium of the Faculty of Natural Sciences and Mathematics, University of Montenegro (Podgorica City).
All relevant 1 H and 13 C NMR data and 1 H NMR spectra of compounds 1-6 are given in Supplementary Information (SI).
Reversed-phase thin-layer chromatography
The TLC experiments were performed on a commercially available RP-18 TLC plates, (Art.5559, E. Merck, Germany).The plates were spotted with 1 μL aliquots of 2 mg mL -1 solutes of each compound (dissolved in CH 2 Cl 2 ), and developed by the ascending technique, without preconditioning.The detection of the zones was performed under UV light (λ = 254 nm).The R F values were determined as an average of the three chromatograms.Three solvent systems were used as mobile phase: methanol-water, acetonitrile-water and tetrahydrofuran-water binary mixtures, with a varying content of organic modifier (from 100 to 60 vol.% in the case of methanol and acetonitrile and from 100 to 40 vol.% of tetrahydrofuran (increment 10 vol.%)).All the components of the mobile phases were of the analytical grade of purity.All experiments were performed at ambient temperature (22 ± 2 °C).
Calculations
For the geometry optimization, the structures were subjected to the Hyperchem Program (version 7.0, Hypercube).The optimization of three-dimensional structure was calculated by semi-empirical quantum chemical calculations with AM1 Hamiltonian.A set of molecular descriptors was selected to reflect geometrical, electronic and physicochemical properties of the investigated compounds.Hyperchem calculates electronic properties, optimized geometries, total energy and QSAR properties.A set of additional physicochemical parameters was generated from the optimized structures by Molecular Modeling Program Plus program (MMP Plus).Virtual Computational Chemistry Laboratory at website http://www.vcclab.org was used for the calculation of lipophilicity of the compounds by various methods based on different theoretical procedures.
Multivariate statistical analysis and modeling
PCA and PLS were performed using demo version of PLS Toolbox statistical package (Eigenvectors, Inc., version 5.7) for the MATLAB version 7.4.0.287 (R2007a) (MathWorks, Inc., Natick, MA, USA).The data were mean-centered and scaled to unit variance before any statistical operations in order to prevent highly abundant components dominating in the final result over the components present in much smaller quantities.
PCA was carried out as an exploratory data analysis by using single value decomposition (SVD) algorithm and 0.95 confidence level for Q and T 2 Hotelling limits for outliers.A limited number of PC reduces the dimensionality of the retention data space, simplifying further analysis and grouping the substances according to their intrinsic ability for specific interactions.2][23] Validation of the models was performed by leave one out cross-validation procedure.The quality of the models was monitored with the following parameters: R 2 cal (cum) (the cumulative sum of squares of the Ys explained by all extracted components), R 2 CV (cum) (the cumulative fraction of the total variation of the Ys that can be predicted by all extracted components), showing as higher as possible values, and root mean square errors of calibration (RMSEC) and root mean square errors of cross-validation (RMSECV) showing as lower as possible values, with the lowest difference in between them.Low value of RMSEC is desirable but if the high values of RMSECV are present at the same time, this can be an indication of the poor predictability of the calibration model. 24,25 nsidering the other multivariate linear regression techniques as multiple linear regression (MLR) and principal component regression (PCR), PLS was chosen as a target analysis due to a number of advantages.Namely, the number of predicted variables is greater than the number of the compounds and it is better to reduce their number to just a few latent variables (using PLS or PCR) than select a few predictor variables, by MLR.In addition, a lot of variables are correlated and have constant values, so MLR would not be appropriate method.An important feature of PLS is that it takes into account errors in both independent and response variables, while PCR assumes that the estimation of molecular descriptors are error free. 26s it is previously mentioned, the best selectivity was obtained with methanol-water mobile phase and these results were used for the evaluation of the possible relationship between the lipophilicity characteristics and the physicochemical parameters of the molecules.The lipophilicity parameter R M 0 (chromatographic system RP-18/methanol-water) and log P OW were the response variables in the QSRR study.These values were regressed against the molecular structural descriptors as independent variables.
Lipophilicity of the analytes
The retention parameters (R F and R M ) of coumarins were determined at several compositions of the three different binary solvent systems composed of organic modifier and water: methanol-water, acetonitrile-water and tetrahydrofuran-water.For each compound, the R M value was extrapolated to the zero volume of the organic modifier by using equation 2, thus obtaining the lipophilicity parameter (R M 0 ).The slope (m) and intercept (R M 0 ) values, and the statistical data (correlation coefficient (r) and standard deviation (s)) for each binary system are listed in Table 1.
The R M values were linearly dependent on the concentration of organic modifier in the mobile phase, with r ≥ 0.99.Also, the majority of substances show the highest R M 0 values in methanol, which has the lowest elution strength among all the organic modifiers applied on RP-18 silica.
Taking into account the observed retention, it can be concluded that tricyclic compounds (1-4 and 6) exhibited stronger retention compared to byciclic coumarines (5, 7-12).Also, increased retention of 1, 2 and 6 coumarins can be ascribed to the presence of 2-butenoil and 3-methylbut-2-enyloxy group.Similar chromatographic behavior was observed for compounds 6 and 7, with identical side-chain substituent, indicating that the presence of the bulky 3-methylbut-2-enyloxy group defines their chromatographic behavior.Among all investigated coumarins, bicyclic compounds with hydroxy (9 and 10) and methoxy groups (11 and 12) demonstrated decrease of retention.
The determination of log P OW by TLC is based on the linear relationship between the chromatographic retention R M and the octanol-water partition coefficient determined by shake-flask method for a set of standard compounds.For that purpose, the investigated coumarins were simultaneously chromatographed with the standard solutes, and the retention parameters were determined (R M values are presented in brackets: 4-methoxyphenon (−0.45), 2,6-dimethylphenol (−0.13), 1,3,5-trihydroxybenzene (−1.19), anthracen (0.69), 4-hydroxybenzaldehyde (−0.57), 1-naphthol (−0.10), benzophenon (0.21), and phenol (−0.52)).As the best selectivity was obtained with methanol-water (75:25%, v/v), this mobile phase was chosen for the determination of log P OW .To characterize lipophilicity of coumarins, linear calibration between R M values of eight standards and their literature log P OW values was used R M = −1.176+ 0.423 log P OW (3) r = 0.992, N = 8, SD = 0.078, P < 0.0001 R M values of the studied compounds were substituted into equation 3 to calculate log P OW values, listed in Table 2.The same table contains calculated log P values of selected coumarins.
The determination of linear dependences between lipophilicity parameters obtained in chromatographic investigations and calculated log P values is an indispensable step for QSRR.These correlations provide evidence that the chromatography based measurements of lipophilicity are valid.A number of methods based on different approaches for calculating log P from chemical structures are available.Extrapolated R M 0 values for chromatographic system RP-18/methanol-water and experimentally established log P OW values were compared with calculated log P (log P calc ), and statistical parameters of these dependences are given in Table 3.Although linear dependence exists in most cases with satisfactory correlation coefficient values over 0.93, observing the slope and the intercept of the relevant equations, it could be concluded that the deviations from the ideal correlation (slope ca. 1 and intercept ca.0) are more pronounced in the case of experimentally obtained log P OW values, i.e., R M 0 is better lipophilicity estimate.Determined lipophilicity of the investigated compounds is in accordance with their chromatographic behavior.Additional pyran and furan ring attached to 2-benzopyran-1-on aromatic core provide increased lipophilicity versus corresponding derivatives possessing no extra ring.Incorporating polar hydroxy and methoxy groups have a more pronounced negative impact on lipophilicity.Lipophilicity is also raised with increasing substitution on the basic benzopiranon, i.e., derivatives with 2-butenoil and 3-methylbut-2-enyloxy group are more hydrophobic than compounds that possess methyl, methoxy, hydroxy, acethyl and epoxide substituents.
Principal component analysis (PCA)
PCA carried out on the set of calculated molecular descriptors and retention data can reveal some similarities among studied compounds governed by both their intrinsic structural properties and specific interactions that occur in different chromatographic systems.Loading plots highlight the mostly influential variables responsible for such a clustering and provide a picture on the similarity between R M 0 values and the other molecular descriptors.
PCA applied on a set of molecular descriptors resulted in a three-component model explaining 91.79% of the data variation (first principal component comprises 71.94% of variances).The score plot of the three principal components (Figure 2) indicates that all data were lying inside the Hotelling T 2 ellipse, suggesting that there are no outliers among the analytes.
Considering the score plot, PCA reveals different classification.Samples are clustered into two main separate groups: coumarins 7-12 and 5 with different substituents attached to 2-benzopyran-1-on are positioned in one group; while coumarins with one more pyran or furan ring connected to benzopyranon core are in the second group (compounds 1-4 and 6).First principal component distinguished samples according to the number of the rings present in the molecule (bicyclic and tricyclic compounds).Second principal component separates those with hydroxyl group in the molecule (3, 4, 9 and 10) from the other investigated.The mutual projections of loading vectors are shown in Figure 3.The highest positive impact to the PC1 is recorded by the parameters which describe the size and the shape of the molecule.PC2 separates compounds mainly according to their polar properties, i.e., physicochemical descriptors such as the count of hydrogen-bond donor, hydrophiliclipophilic balance, solubility parameter, dipole moment, etc.On the loading plot, the three R M 0 variables are in the group with those relating the size and the shape of a molecule such as refractivity, polarizability, surface area, molecular volume, molecular weight, molecular depth and molecular width.These facts could indicate the most influential factors for observed chromatographic behavior of the coumarins.
Quantitative structure-retention relationship (QSRR) PLS modeling was performed in order to qualify relationships between the factors governing the lipophilicity.The number of latent variables was selected on the basis of the minimum RMSECV, and the minimum difference between RMSEC and cross-validation.In both models a minimum value of RMSECV was obtained with two latent variables.The obtained models are summarized in Table 4.
The application of PLS methods revealed that the statistical results of these two models are comparable, and that they are statistically significant.The main descriptors in both PLS models are those relating the size and the shape of a molecule such as refractivity, polarizability, surface area, molecular volume, weight, parachor, volume and mass.Observing the X loading plot of the models, it was supposed that a simpler PLS model can be obtained after removing some variables.
The contribution of descriptors that are most influential on the chromatographic behavior was done using variable importance in projection (VIP) scores.The variables with VIP scores higher than 1 were considered as the most relevant for explaining the response variable Y, while the other are of extremely low or almost no contribution.After removing the variables that only contribute to noise (variables with low values of coefficients and low VIP values), a simpler and better PLS models were obtained.The descriptors included in the final models are presented in Table 4 in order from the highest to the lowest value of their regression coefficient, with notification of the sign of their contribution on the response variable.Taking into account the parameters that represent the quality of the model, it can be concluded that both PLS models are statistically significant.The descriptors included in the final models are of similar nature and significance.
The results obtained indicate that the most relevant descriptors influencing lipophilicity parameters are: surface area, molecular length, density, solubility parameter, Hansen polarity, Hansen dispersion and hydrophilic-lipophilic balance.From the sign of the regression coefficients, it can be observed that the descriptors describing polarity of the investigated compounds, i.e., their ability for hydrophilic interactions makes negative contribution to the R M 0 values.Solubility parameter, Hansen polarity and dispersion provide a numerical estimate of the degree of intermolecular attractions between molecules (i.e., existence of the dispersion, polar and hydrogen bonding forces), and indicate that the stronger the intermolecular interactions between molecules and the mobile phase are, the analytes are less retained on the stationary phase and the lower R M 0 and log P OW values are obtained.Surface area and molecular length influence the lipophilicity parameters on the opposite way.They have positive coefficients in models and give the higher value of R M 0 and log P OW when they are higher.The surface area of substance is a sum of all areas that cover the surface of the molecule.The higher value of this descriptor indicates the larger molecule which is stronger retained on the stationary phase causing the higher value of R M 0 , i.e., log P OW molecular length determines the size of the molecule and influences on the lipophilicity parameter on the same way as previous descriptor.Hydrophilic-lipophilic balance of a solute is a measure of a degree to what extent its hydrophilic or lipophilic properties are expressed.Its negative regression coefficients reveal the lower the values of these balances are, the greater the values of R M 0 and log P OW are observed, suggesting that more hydrophobic solutes, exhibiting stronger nonspecific dispersive interaction between their own nonpolar moieties, and those of the stationary phase are more retained under applied chromatographic conditions.
Conclusions
The focus of the present study was the estimation of the lipophilicity of twelve coumarins by simultaneous chromatographing with standard substances with known log P OW values.PCA was used for the data overview, while PLS was chosen as the multivariate regression technique for the structure-lipophilicity correlations.
Upon the presented results, it could be concluded that: (i) all reversed-phase thin-layer chromatographic systems used proved to be suitable for the lipophilicity estimation, (ii) the proposed two PLS models are statistically significant and their statistical quality is comparable and (iii) descriptors which describe the size and the shape of the molecule as well as their polar properties determine lipophilic behavior of the investigated compounds.
In terms of various model, the performance criteria parameters considered here, the obtained PLS models could be suitable for predicting the chromatographic behavior of coumarins.
Figure 2 .
Figure 2. Score values of the first, second and third principal components.
Figure 3 .
Figure 3. Projection of loading vectors for the first two PCs.
Table 1 .
Lipophilicity and statistical parameters obtained from equation 2
Table 2 .
The calculated log P values and experimental log P OW values
Table 3 .
Linear relationships between experimental and calculated lipophilicity | v3-fos-license |
2018-03-17T13:10:16.913Z | 2018-03-16T00:00:00.000 | 3929866 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.nature.com/articles/s41598-018-23038-6.pdf",
"pdf_hash": "7ff050675db5e323ad7bb42c0fc3c26deca89a52",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120096",
"s2fieldsofstudy": [
"Biology"
],
"sha1": "7ff050675db5e323ad7bb42c0fc3c26deca89a52",
"year": 2018
} | pes2o/s2orc | Health promoting potential of herbal teas and tinctures from Artemisia campestris subsp. maritima: from traditional remedies to prospective products
This work explored the biotechnological potential of the medicinal halophyte Artemisia campestris subsp. maritima (dune wormwood) as a source of health promoting commodities. For that purpose, infusions, decoctions and tinctures were prepared from roots and aerial-organs and evaluated for in vitro antioxidant, anti-diabetic and tyrosinase-inhibitory potential, and also for polyphenolic and mineral contents and toxicity. The dune wormwood extracts had high polyphenolic content and several phenolics were identified by ultra-high performance liquid chromatography–photodiode array–mass-spectrometry (UHPLC-PDA-MS). The main compounds were quinic, chlorogenic and caffeic acids, coumarin sulfates and dicaffeoylquinic acids; several of the identified phytoconstituents are here firstly reported in this A. campestris subspecies. Results obtained with this plant’s extracts point to nutritional applications as mineral supplementary source, safe for human consumption, as suggested by the moderate to low toxicity of the extracts towards mammalian cell lines. The dune wormwood extracts had in general high antioxidant activity and also the capacity to inhibit α-glucosidase and tyrosinase. In summary, dune wormwood extracts are a significant source of polyphenolic and mineral constituents, antioxidants and α-glucosidase and tyrosinase inhibitors, and thus, relevant for different commercial segments like the pharmaceutical, cosmetic and/or food industries.
Results and Discussion
Phytochemical profile. The polyphenolic content of the extracts was firstly assessed in terms of their total contents of phenolics (TPC), flavonoids (TFC), condensed tannins (CTC), hydroxycinnamic acid derivatives (HAD), flavonols and anthocyanins (Table 1). Phenolic compounds are some of plants most widely occurring secondary metabolites 24 . Although there is no instituted classification in terms of high/low values of total phenolics, some authors state that natural extracts can be considered rich in phenolic compounds when their TPC is higher than 20 mg GAE/g DW 8,25,26 . In this sense, all of A. campestris subsp. maritima extracts have high phenolics content considering that TPC was between 114 and 134 mg GAE/g DW, with the highest value determined in aerial-organs' tincture. This extract also had the highest flavonoid content (40.8 mg RE/g DW), higher HAD together with aerial-organs' infusion and decoction (89.4-88.4 mg CAE/g DW), and higher anthocyanins along with roots' tincture (3.46 and 3.36 mg CCE/g DW). Flavonols, on the other hand, were highest in roots' tincture (66.2 mg QE/g DW). As for tannins content, it was not found in the dune wormwood samples (below the limit of quantification, which was 0.78 mg/g DW). Working with the same sub-species, Megdiche-Ksouri et al. 20 reported Table 1. Phenolic contents (mg/g dry weight, DW) of infusions, decoctions and tinctures from Artemisia campestris subsp. maritima organs and respective yields (infusion and decoctions: mg extract/200 mL, tinctures: mg extract/mL). Data represent the mean ± SD (n ≥ 6). In each column, different letters mean significant differences (p < 0.05). LQ (limit of quantification) CTC = 0.78 mg CE/g DW. 1 TPC: total polyphenol content, mg GAE/g DW, GAE: gallic acid equivalents. 2 TFC total flavonoid content; mg QE/g DW, QE: quercetin equivalents. 3 CTC: condensed tannin content, mg CE/g DW, CE: catechin equivalents. 4 HAD hydroxycinnamic acid derivatives, mg CAE/g DW, CAE: caffeic acid equivalent. 5 mg QE/g DW, QE: quercetin equivalents. 6 similar total phenolics (159 mg GAE/g DW) but higher flavonoid (175 mg CE/g DW) and tannin (8.7 mg CE/g DW) contents in methanolic extracts from shoots. These differences could be ascribed not only to the different solvent and extraction procedure, which several studies have showed to greatly influence results, but also to the different analytical methods used 13 . In similar aqueous and hydro-alcoholic extracts from the aerial parts of the species A. campestris, other authors determined different level of TPC and TFC, either higher, similar or lower than those presently found [27][28][29][30][31][32][33] . These discrepant phytochemical contents may be explained by species-specific factors, harvesting time and/or environmental characteristics, since these variables affect the biosynthesis of secondary metabolites in plants 3,13 . Nevertheless, authors generally consider A. campestris rich in phenolic compounds 16,30 .
To further explore the phytochemical profile of infusions, decoctions and tinctures from A. campestris subsp. maritima a generic LC-PDA-MS (liquid chromatography -photodiode array -mass spectrometry) method for moderately polar phytochemicals was employed. The analytical methodology was adapted from De Paepe et al. 34 , previously validated by those authors for quantitation of phenolic constituents in apple cultivars, and is fully detailed in Pereira et al. 5 including performance characteristics, quantification procedures and compound tentative identification specifics. The aim was to (tentatively) identify phytochemical constituents in the dune wormwood extracts, getting an estimate of their concentrations and/or relative abundances when no reference standards were available. The phenolics and respective concentrations are presented in Table 2. As some standards can be expensive or not available, tentative identification of other compounds was accomplished based on available chromatographic and spectral information (Table 3). To get clean product ion spectra of the detected analytes, data dependent fragmentation was used. Product ions are substructures of precursor ions (ions of a particular mass over charge-range [m/z-range]), formed during fragmentation: structures were assigned to unknown peaks when both the m/z-values and molecular formulae/structures of the precursor and product ions were in agreement. Further information for de-replication was obtained from PDA spectra, in-house and commercial compound databases (PubChem 35 , Dictionary of Natural Products 36 , ChemSpider 37 ) and peer reviewed publications (a more detailed explanation is given in Pereira et al. 5 ). MS and diagnostic chromatographic data used for compound identification plus literature used for confirmation of compound identity can be found in Table S2 (supplementary material). It is important to mention that during LC-MS analysis different compounds can have different ionization efficiencies and so no absolute quantitative comparison can be made, although relative abundances per compound in-between samples can be calculated (based on the area of their most abundant ion). In this sense, the "maximum area detected" provides semi-quantitative information of compound abundance. Table 3 shows the relative abundances of these tentatively identified constituents. To visualize the extracts' main detected compounds, the UV-chromatograms at combined wavelengths (280-330 nm, the absorption maxima of phenolics) are represented in Fig. 1, despite not showing all the constituents identified (compounds with no assigned peaks had low abundances or possibly their peaks overlapped). According to Table 2, the dune wormwood aerial-organs' extracts had greater diversity and higher levels of practically all phenolics found. Aerial-organs' tincture in particular had higher concentrations of most of the determined compounds adding up to a total of 45 µg/mg DW. From this total, quinic acid amounts to half (24 µg/mg DW), Table 3. Average relative abundances (peak area/mg DW, %) of the tentatively identified compounds in extracts from Artemisia campestris subsp. maritima organs, analysed by LC-PDA-amMS. NF -not found. tincture (0.1 and 0.09 µg/mg dw, respectively) were also found in higher levels, although in comparatively lower concentrations than in the aerial-organ's extracts. In Table 3 and Fig. 1 it is also possible to observe the higher compound diversity in extracts from aerial-organs, especially tinctures. However, relative abundance of some major constituents such as coumarin sulfates (peaks 12, 14 and 17) and dicaffeoylquinic acids (peaks 25 and 26) was higher in roots' extracts, particularly tincture. Aerial-organs' extracts had higher amounts of another coumarin sulfate (peak 13) and dicaffeoylquinic acid (peak 28), along with a chlorogenic acid isomer (peak 5) and an ethoxy/dimetoxycinnamic acid (peak 36). Again, it should be stated that Table 3 provides relative quantitative measures of abundance, not to be interpreted as absolute quantitative comparison. Overall, tinctures of both organs showed higher abundance and diversity of constituents comparatively to aqueous extracts and, between organs, extracts from aerial-organs had greater variety of phenolics, generally in higher levels. To the best of our knowledge, this is the first report comparing anatomical organs in this Artemisia species. Megdiche-Ksouri et al. 20 also report a wide assortment of phytochemicals in dune wormwood's shoots, several of them also presently determined, but studies detailing compound abundance in A. campestris extracts other than essential oils are extremely scarce. In fact, only Jahid et al. 33 reports levels of phenolics in leaves' hydro-alcoholic extracts with the main components catechin and vanillic acid (>20 mg/g DW), not being found in the current study, syringic (6 mg/g DW) and coumaric (0.9 mg/g DW) acids, presently determined at lower concentrations (0.05-0.08 mg/g DW and 0.06-0.33 mg/g DW, respectively), and caffeic acid (0.2 mg/g DW), being one of the current main constituents particularly in aerial-organs' tincture (1.6 mg/g dw). These authors 33 also consider that compound nature and abundance are related to environmental conditions, a well-established notion when comparing intra-species phytochemical content 3,13,38,39 . Nevertheless, and although differing considerably between subspecies 38 , the phenolic profiles of A. campestris compiled in literature are generally in agreement with that reported here and include compounds like phenolic acids such as caffeic, chlorogenic, isochlorogenic and other dicaffeoylquinic acids, flavonoids such as apigenin, rutin, luteolin, kaempferol and quercetin, or hydroxycoumarins like aesculetin and scopoletin 16,19,20,[40][41][42] . In fact, from the wide variety of phenolic constituents (tentatively) identified in A. campestris subsp. maritima extracts (Tables 2 and 3), most if not all were already described in the Artemisia genus. However, for the species A. campestris no reports were found detailing quinic, protocatechuic, p-hydroxybenzoic and salicylic acids, 4-hydroxybenzaldehyde, cynaroside, isoquercitrin and taxifolin (although its derivatives are described), which are, to the best of our knowledge, here described for the first time in the species. Moreover, chlorogenic, syringic, caffeic, coumaric and ferulic acids, luteolin, apigenin and kaempferol were not found reported in the literature for the subspecies under study (although derivatives for the three later are reported) and are therefore here firstly described in A. campestris subsp. maritima.
Mineral composition. Aqueous extracts like herbal teas can be considered an added source of minerals for the human diet 2,6 . In this context, the presence of these essential nutrients in the dune wormwood's extracts could be of added value for their potential use as food products or in herbal beverages. Hence, A. campestris subsp. maritima extracts were analysed for mineral content and Table 4 summarizes the results. The most abundant element was Na (9.10-32.6 mg/g DW), followed by K (3.32-15.6 mg/g DW) and Ca (0.09-4.53 mg/g DW), all in higher levels in aerial-organs aqueous extracts. Magnesium (Mg: 0.39-1.67 mg/g DW) and Fe (22-1059 µg/g DW) were also relatively abundant but with higher levels in roots aqueous extract. Mn and Zn were determined in lower concentrations (Mn: 3.31-87.9 µg/g DW; and Zn: 2.30-18.3 µg/g DW). Mn was more abundant in aerial-organs aqueous samples and Zn had similar levels on aqueous extracts of both above and below-ground Toxicological evaluation. The potential toxicity of new herbal products for human use, such as plant extracts, must be determined to establish its safe consumption. Preliminary toxicological evaluations can be made by in vitro models that address the sensitivity of mammalian cell lines to possible toxic effects of the extracts, delivering reliable and quick results and reducing in vivo testing [5][6][7]44,45 . Aiming at such a predictive toxicity screening, the dune wormwood extracts were tested for cytotoxicity towards three mammalian cell lines and the resulting cellular viabilities are presented in Fig. 2. The aqueous extracts showed overall low toxicity with cell viability values higher than those obtained for tinctures. Infusions and decoctions exerted no toxic effects in the hepatocarcinoma (HepG2) cells while tinctures had moderate to low toxicity with cellular viabilities between 62% (aerial-organs) and 72% (roots). For the microglia (N9) cell line, toxicity of the aerial-organs aqueous extracts was very low (>90% viabilities) while that of aerial-organs tincture (73% viability) and roots infusion and decoction (63-68% viabilities) can be considered moderate to low; roots' tincture exerted a more toxic effect with 50% of cellular viability. For the stromal (S17) cells, roots' aqueous extracts had low toxicity (71-73% viabilities) whereas roots' tincture (61% viability) and aerial-organs water extracts (66-68% viabilities) were only moderately toxic; aerial-organs' tincture resulted in 55% of cellular viability. As a preliminary safety evaluation of A. campestris subsp. maritima extracts, results suggest that they may be regarded as safe for consumption, although some caution is advised regarding the use of hydro-alcoholic extracts. Nevertheless, for comparison purposes, the widely consumed green tea had cellular viabilities as low as 30% in S17 cells 7 . Moreover, acute toxicity tests of A. campestris leaves aqueous extracts on mice showed that up to 3200 mg/kg body weight administered orally neither killed nor impaired behaviour 42 and intraperitoneal injections rendered a LD 50 equivalent to 2500 mg/kg b.w. 28 .
Biological activities. Antioxidants can be considered a group of medicinally preventive molecules also used as food additives to inhibit food oxidation. Hence, natural antioxidant sources are increasingly sought after as an alternative to synthetic antioxidants in the food, cosmetic and therapeutic industries 3,22 . Antioxidants are scavengers of free radicals or ROS and deactivators of metal catalysts by chelation, among other activities, reducing oxidative stress and consequent cell damage. It is increasingly documented that dietary antioxidant phytochemicals effectively prevent oxidative damage, reducing the risk of oxidative-stress related conditions like neurodegenerative and vascular diseases, carcinogenesis or inflammation 10,22,46 . Their intake is also associated with the management of diabetes mellitus 22 and amelioration of skin ageing conditions 47 . In this work, the antioxidant potential of the dune wormwood's extracts was assessed by eight different methods targeting radical scavenging activity (RSA) and metal-related potential ( Table 5). The extracts were overall effective as scavengers of DPPH, ABTS, NO and O 2 •radicals and at reducing iron, but their chelating properties were moderate for copper and low for iron. In the DPPH assay the aerial-organs' tincture had the lowest IC 50 value (240 µg/mL), lower than that obtained for the positive control (BHT; IC 50 = 320 µg/mL), followed by aerial-organs' infusion (330 µg/mL), decoction (340 µg/mL) and roots decoction (370 µg/mL), all similar to BHT (p < 0.05). High RSA against DPPH was also reported by Megdiche-Ksouri et al. 20 in methanolic extracts from shoots of the same A. campestris subspecies. Aerial-organs' tincture also had the strongest NO scavenging activity allowing an IC 50 of 290 µg/mL, comparable to that of this organs' decoction (490 µg/mL, p < 0.05); most interestingly all extracts were better NO scavengers than the positive control (ascorbic acid, IC 50 = 2.31 mg/mL). This was also the case with O 2 •scavenging as catechin had the highest IC 50 (620 µg/mL). For this radical's assay, however, the lowest IC 50 value was obtained after the application of roots' decoction (180 µg/mL), followed by infusions from both organs (roots: 210 µg/mL, aerial-organs: 230 µg/mL). Roots decoction was also the best ABTS scavenger (IC 50 = 370 µg/mL), statistically similar to the result obtained with the aerial-organs' tincture (IC 50 = 400 µg/ mL; p < 0.05). As for the iron reducing capacity, the best result was obtained with the aerial-organs' infusion with an IC 50 of 170 µg/mL, followed by aerial-organs' tincture (230 µg/mL), roots tincture (240 µg/mL) and decoction (250 µg/mL). This is in accordance with Megdiche-Ksouri et al. 20 findings of a high FRAP in this subspecies. Conversely, the extracts iron-chelating activity was comparatively low, with IC 50 values higher that 5 mg/ mL, while the capacity to chelate copper was moderate (best IC 50 = 1.3 mg/mL in aerial-organs' water extracts). Tannins were not detected in any of the extracts, which may partially explain its low chelating potential since tannins are known metal chelating agents 48 . The aerial-organ's water extracts had the highest capacity to chelate both metals (CCA, IC 50 = 1.30-1.31 mg/mL; ICA, IC 50 = 6.33-6.47 mg/mL). Several studies previously highlighted the high antioxidant capacity of similar aqueous and hydro-alcoholic extracts from A. campestris 27,29,30,32,33,42 , which confirms our results of strong in vitro antioxidant potential for this subspecies. Most of these authors also credited the pronounced antioxidant activity of the extracts to the polyphenolic content which is, in fact, an association widely reported by several studies that confirm the phenolics' role as antioxidants, especially in halophyte plants 3 . Accordingly, aerial-organs' tincture had the highest levels of almost all phenolics groups (Table 1) and was also of the best-scoring extracts in terms of antioxidant activity. Actually, that extract also had overall higher abundance and variety of individual phenolic constituents (Tables 2 and 3), altogether corroborating the hypothesis that phenolics play a major role in the sample's strong antioxidant potential. For example, the main components quinic, chlorogenic and caffeic acids, determined in higher amounts in aerial-organs' tincture (Table 2), are known antioxidant compounds [49][50][51] . Nevertheless, roots' extracts showed greater relative abundances of some major constituents (Table 3), such as the dicaffeoylquinic acid (peak 25, Fig. 1) in roots' decoction, and quinic, chlorogenic and caffeic acids, although in lower levels than in aerial-organs' samples, were the predominant constituents. Synergistic and/or additive effects between these phytoconstituents may also account for the equally high antioxidant activity of roots' decoction.
Besides antioxidant activity, other bioactivities have been ascribed to extracts from A. campestris as for example hypoglycaemic effects 28 . Type 2 diabetes mellitus (T2DM) is a common health disorder characterized by high blood glucose levels that can lead to major metabolic complications if left untreated 52 . One effective strategy to manage T2DM is to inhibit carbohydrate-hydrolysing enzymes, such as α-glucosidase, delaying carbohydrate digestion and uptake and resulting in reduced postprandial blood glucose levels, therefore lowering hyperglycaemia linked to T2DM 52,53 . In this sense, the dune wormwood's extracts were tested for their capacity to inhibit microbial and mammalian α-glucosidases as an assessment of their anti-diabetic potential.
All extracts had the ability to inhibit the microbial α-glucosidase but the most active samples were roots' aqueous extracts and aerial-organs' decoction (IC 50 = 0.89-1.13 mg/mL). Interestingly, all of the extracts were more efficient at inhibiting the microbial α-glucosidase than the positive control used acarbose (IC 50 = 3.14 mg/ mL), a clinically used inhibitor of this enzyme. However, only the roots' extracts were able to inhibit mammalian α-glucosidase, particularly roots' tincture (IC 50 = 2.90 mg/mL), still more active than acarbose (IC 50 = 4.64 mg/ mL). Roots' extracts were less active towards the mammalian enzyme than for the microbial counterpart, an outcome already described for some compounds showing that enzyme origin can influence the extracts' inhibition of α-glucosidase 54 . Nevertheless, and despite the notion that the mammalian enzyme is a more reliable proxy for in vivo activity 54 •radicals, ferric reducing antioxidant power (FRAP) and metal-chelating activities on copper (CCA) and iron (ICA). Values represent the mean ± SD of at least three experiments performed in triplicate (n = 9). In each column different letters mean significant differences (p < 0.05). *Positive controls. by Sefi et al. 28 , having significantly reduced blood glucose levels in diabetic rats. Those authors considered that the in vivo hypoglycaemic activity of A. campestris extracts could be related to its strong antioxidant properties, and stated the role that this plant's water extracts can have on the treatment of diabetic patients 28 . It is recognized that polyphenolic compounds, besides potent antioxidants 3,10 , can also have glucosidase-modulating activities therefore contributing to the management of T2DM 52 . The dune wormwood's extracts had a high phenolic content and contained some compounds with described hypoglycaemic activity, namely chlorogenic, caffeic and ferulic acids 50,51 , and with reported α-glucosidase inhibitory activity, like isoquercitrin, luteolin, quercetin and apigenin 52 . Overall, our results suggest that all dune wormwood's extracts could be beneficial in managing T2DM by its capacity to inhibit dietary carbohydrate digestive enzymes, which was higher than acarbose, and consequently controlling glucose levels. Furthermore, as oxidative stress has been considered a mediator in diabetic complications 55 , the extracts' strong antioxidant potential can also be an adjuvant in preventing or attenuating the disease's symptoms when used in combined anti-diabetic strategies.
Skin hyperpigmentation (e.g. melasma, freckles, age spots) is a result of melanin over-production but, as tyrosinase is essential in melanin biosynthesis, inhibition of this enzyme can help prevent and/or manage undesired skin darkening 47,56 . Tyrosinase is also responsible for unwanted browning of fruits and vegetables, which decreases their market value 56,57 . Hence, tyrosinase inhibitors from natural sources are increasingly sought not only for cosmetic and medicinal purposes but also for their potential in improving food quality 47,56,57 . In this context, the tyrosinase inhibitory potential of the dune wormwood's extracts was evaluated and results are depicted on Table 6. All extracts were active, particularly aerial-organs' infusion (IC 50 = 4.13 mg/mL), although less effective than the used positive control (arbutin, IC 50 = 0.48 mg/mL). Tyrosinase is a copper-containing enzyme 56 and thus the extracts' moderate copper chelating activity could be related to their tyrosinase inhibitory capacity. In fact, metal chelating and ROS-scavenging properties are mechanisms often thought to be related with the reducing activity of flavonoids 47 . Some flavonoids were already identified as tyrosinase inhibitors, as for example quercetin, kaempferol and taxifolin, the last being as effective as arbutin 57 . All these compounds were detected in the dune wormwood's extracts, possibly contributing to their tyrosinase inhibitory activity. To the best of our knowledge, this is the first report on the tyrosinase inhibitory potential of A. campestris subsp. maritima.
This study reports for the first time a comprehensive assessment of the biotechnological potential of A. campestris subsp. maritima as a source of innovative products with health promoting properties. Overall, our results point to the potential role of infusions, decoctions and tinctures of the dune wormwood in the prevention of oxidative-stress related diseases and in the management of diabetes and skin-hyperpigmentation conditions. More specifically, those formulations can be considered an unexplored source of polyphenolic and mineral constituents, antioxidants and α-glucosidase and tyrosinase inhibitors that could deliver raw material to different commercial segments including the pharmaceutical, cosmetic and/or food industries. Further studies are being pursued aiming to fully explore the health-promoting benefits of this plant's extracts, namely their in vivo effects. Extracts preparation: infusions, decoctions and tinctures. Water extracts were prepared similarly to a regular cup-of-tea: 1 g of dried plant material was homogenized in 200 mL of ultrapure water. For infusions, the biomass was immersed in boiling water for 5 min; for decoctions, the biomass was boiled in water for 5 min. Hydro-ethanolic extracts were prepared similarly to a home-made tincture: 20 g of dried plant material was left homogenising in 200 mL of 80% aqueous ethanol for a week. Independent extractions (n ≥ 3) for each combination of method + plant-part were made. All extracts were filtered (Whatman n° 4), vacuum and/or freeze-dried and stored in a dark, cool and moist-free environment. Extracts were re-suspended in water or aqueous ethanol to a concentration of 10 mg/mL to determine (spectrophotometric) phenolic content and test for bioactivities. For these assays, no significant differences were found among corresponding extracts from the different extractions and therefore freeze-dried extracts were pooled accordingly for the remaining analyses.
Phytochemical composition of the extracts. Total polyphenols (TPC), flavonoids (TFC) and condensed
tannin (CTC) content. The TPC, TFC and CTC were estimated by spectrophotometric methods, respectively: Folin-Ciocalteau, aluminium chloride colorimetric and 4-dimethylaminocinnamaldehyde (DMACA), as described in Rodrigues et al. 26 . Gallic acid, quercetin and catechin were used as standards and results are presented as milligrams of standard equivalents per gram of extract dry weight (GAE, QE and CE, respectively; mg/g dw). Further information pertained to these methods is presented in Table S1 (supplementary material).
Hydroxycinnamic acid derivatives (HAD), flavonols and anthocyanins content. Total contents in HAD, flavonols and anthocyanins were assessed spectrophotometrically as described previously 26 using caffeic acid, quercetin and cyanidin chloride as standards, respectively. Results are presented as milligrams of standard equivalents per gram of extract dry weight (CAE, QE and CCE, respectively; mg/g dw). Further information pertained to these methods is presented in . For quantitative analysis, full scan data were acquired using polarity switching with a mass/charge (m/z) range of 120-1800 and resolving power set at 70 000 at full width at half maximum (FWHM). Data were also recorded using data dependent fragmentation (ddMS 2 ) in positive and negative ionization mode to obtain additional structural information. The PDA detector was set to scan from 190 to 800 nm during all analyses. The lowest calibration point included in the calibration curve was used to calculate the limits of quantitation (LOQs). The concentration ranges described by De Paepe et al. 34 were also used during the present work. Results regarding concentrations of identified compounds were calculated as µg/mg of extract dry weight. Toxicological evaluation of the samples. Samples' toxicity was assessed using murine microglia (N9), murine bone marrow stromal (S17) and human hepatocellular carcinoma (HepG2) cell lines. The N9 cell line was provided by the Faculty of Pharmacy and Centre for Neurosciences and Cell Biology (University of Coimbra, Portugal), S17 and HepG2 cells were delivered by the Centre for Biomedical Research (CBMR, University of Algarve, Portugal). Cell culture was maintained as described in Pereira et al. 6 . Toxicity was evaluated according to Rodrigues et al. 7 . Briefly, N9 cells where plated at an initial density of 1 × 0 4 cells/well while S17 and HepG2 cells were seeded at 5 × 10 3 cells/well, all in 96-well plates. Freeze-dried pooled extracts were dissolved in culture medium (100 μg/mL) and incubated with cells for 72 h; culture medium was used as negative control and hydrogen peroxide (H 2 O 2 ) as positive control. Cell viability was determined by the MTT (3-(4,5-dimet hylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and results were expressed in terms of cell viability (%). Biological activities. Antioxidant activity assessed by four radical-based assays. The extracts' radical scavenging capacity against the DPPH (1,1-diphenyl-2picrylhydrazyl), ABTS (2,2′-azino-bis(3-eth ylbenzothiazoline-6-sulfonic acid), NO (nitric oxide) and O 2 •-(superoxide) radicals was assessed as described in Rodrigues et al. 7,26 . BHT (butylated hydroxytoluene), ascorbic acid and catechin were used as positive controls. Results were calculated as percentage of antioxidant activity in relation to a control containing ultrapure water or aqueous ethanol, and expressed as IC 50 values (mg/mL; half maximal inhibitory concentration, ascertained for extracts with activities higher than 50% at 10 mg/mL).
Mineral composition.
Antioxidant activity assessed by three metal-related assays. The extracts' chelating ability towards copper (CCA) and iron (ICA) and their Fe 3+ reducing capacity (ferric reducing antioxidant power, FRAP) were assessed as described previously 26 . EDTA (ethylenediamine tetraacetic acid) and BHT were used as positive controls. Results were calculated as percentage of antioxidant activity relative to a positive control for FRAP, and in relation to a negative control (ultrapure water/aqueous ethanol) for CCA and ICA, and were expressed as IC 50 values (mg/mL).
In vitro anti-diabetic activity: inhibition of microbial and mammalian α-glucosidases. The microbial α-glucosidase enzyme was obtained from the yeast Saccharomyces cerevisiae; rat's intestine acetone powder was used to obtain a crude enzyme extract as an example of a mammalian-origin α-glucosidase. The extracts' capacity to inhibit both enzymes was assessed following Kwon et al. 53 and using acarbose as positive control. Results are expressed as IC 50 values (mg/mL), calculated as percentage of inhibitory activity in relation to a control (ultrapure water/aqueous ethanol).
In vitro tyrosinase inhibition. The extracts' ability to inhibit tyrosinase was assessed following Custódio et al. 58 , using arbutin as positive control. Results, calculated as percentage of inhibitory activity in relation to a control (ultrapure water/aqueous ethanol), are expressed as IC 50 values (mg/mL).
Statistical analysis.
Experiments were conducted at least in triplicate and results were expressed as mean ± standard deviation (SD). Significant differences (p < 0.05) were assessed by one-way analysis of variance (ANOVA) followed by Tukey pairwise multiple comparison test or, when parametricity of data did not prevail, Kruskal Wallis one-way analysis of variance on ranks followed by Dunn's test. Statistical analyses were executed using XLStat ® version 19.4. IC 50 values were computed by curve fitting in GraphPad Prism ® version 6.0c. Data Availability. The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. | v3-fos-license |
2020-07-01T13:04:16.501Z | 2020-06-29T00:00:00.000 | 220269039 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "HYBRID",
"oa_url": "https://pubs.acs.org/doi/pdf/10.1021/acs.inorgchem.0c01132",
"pdf_hash": "c589890710bb370b5fa7315f8d12f1c709f3f924",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120123",
"s2fieldsofstudy": [
"Chemistry"
],
"sha1": "a383fd1fc83e05a83941d60e6b40bd0faea9d8df",
"year": 2020
} | pes2o/s2orc | Direct Mechanistic Evidence for a Nonheme Complex Reaction through a Multivariate XAS Analysis
In this work, we propose a method to directly determine the mechanism of the reaction between the nonheme complex FeII(tris(2-pyridylmethyl)amine) ([FeII(TPA)(CH3CN)2]2+) and peracetic acid (AcOOH) in CH3CN, working at room temperature. A multivariate analysis is applied to the time-resolved coupled energy-dispersive X-ray absorption spectroscopy (EDXAS) reaction data, from which a set of spectral and concentration profiles for the reaction key species is derived. These “pure” extracted EDXAS spectra are then quantitatively characterized by full multiple scattering (MS) calculations. As a result, structural information for the elusive reaction intermediates [FeIII(TPA)(κ2-OOAc)]2+ and [FeIV(TPA)(O)(X)]+/2+ is obtained, and it is suggested that X = AcO– in opposition to X = CH3CN. The employed strategy is promising both for the spectroscopic characterization of reaction intermediates that are labile or silent to the conventional spectroscopic techniques, as well as for the mechanistic understanding of complex redox reactions involving organic substrates.
INTRODUCTION
The full understanding of a given reaction mechanism, defined as the sequence of elementary steps leading reactants to products, is vital for chemical knowledge. In fact, unveiling the identity, the concentration time evolution, and the structural properties of the reaction intermediates provides essential insight into the process and paves the way for its rational optimization. Innovative experimental and theoretical approaches are required to tackle the complexity of chemical systems dealt with by contemporary researchers and to acquire accurate information on how these tranformations take place.
Nonheme iron complexes are a class of bioinspired catalysts that are gaining special interest for their capacity of oxidizing C−H and CC bonds with high regio-and stereoselectivity. 1−3 A special attention has been dedicated to the use of the environmentally friendly H 2 O 2 oxidant in association with acetic acid, which is able to increase both catalytic activity and reaction selectivity. Under these conditions a metal-based oxidant is formed rather than freediffusing radical species with the iron center that assumes different oxidation states during the reaction cycle. 4 In a previous investigation, we employed time-resolved energydispersive X-ray absorption spectroscopy (EDXAS) to qualitatively identify the sequence of oxidation states during the reaction between the nonheme iron complex Fe II (tris(2pyridylmethyl)amine) ([Fe II (TPA)(CH 3 CN) 2 ] 2+ ) and peroxyacetic acid (AcOOH) in CH 3 CN/AcOH (99.6:0.4 (v/v)) at 25°C. 5 Investigating this transformation at −40°C, a seminal study showed that AcOOH oxidizes [Fe II (TPA)(CH 3 CN) 2 ] 2+ to the relatively stable oxo-complex [Fe IV (TPA)(O)(X)] +/2+ , which in turn decays upon warming to the μ-oxo dimeric product [Fe 2 III (TPA) 2 (μ-O)(μ-OAc)] 3+ . 6 The complex [Fe IV (TPA)(O)(X)] +/2+ was studied through a combination of electrospray ionization (ESI) mass spectrometry, UV−vis and Mossbauer spectroscopies, and an extended X-ray absorption fine structure (EXAFS) experiment, which however could not establish the identity of the sixth coordinating ligand X, maintaning X to be a molecule with a terminal oxygen or nitrogen atom bound to the Fe metal cation. 6 In that same work, the authors advanced the hypothesis that the Fe(IV) species derived from an unobserved Fe(II)(TPA)-acyl peroxo complex. While the structures of the initial Fe(II) and final dimeric Fe(III) complex have been solved through X-ray crystallography some time ago, 7,8 extensive spectroscopic studies have been performed to determine the true oxidation state and geometry of the reaction intermediate arising immediately after the initial Fe(II) species, but a definite answer has not yet been obtained. Talsi et al. measured new S = 1/2 electron paramagnetic resonance (EPR) signals at g = 2.71, 2.42, and 1.53 in the reaction of 40 mM [Fe II (TPA)-(CH 3 CN) 2 ] 2+ in 1:1.7 CH 3 CN/CH 2 Cl 2 with either H 2 O 2 / AcOH, peracetic acid or m-chloroperbenzoic acid at −60°C. 9 On the basis of this observation, the authors claimed to have identified a putative Fe V (O)(OAc) species, which has been predicted to be the true oxidant in the reaction of [Fe II (TPA)(CH 3 CN) 2 ] 2+ with C−H bond containing substrates. 4 The proposed mechanism for the reaction between [Fe II (TPA)(CH 3 CN) 2 ] 2+ and AcOOH is presented in Figure 1.
Numerous spectroscopic techniques have been applied to follow fast chemical reactions with half−life times lower than seconds. Among them, X-ray absorption spectroscopy (XAS) is a unique and versatile tool 12 that allows one to follow the variations in both the local electronic and structural configuration of a selected photoabsorbing atom. 11, 13 We recently used a coupled EDXAS/UV−vis approach to measure pseudo-first-order kinetic constants in a reaction involving a nonheme iron-oxo complex and a series of aromatic sulfides and benzyl alcohol, demonstrating the suitability of EDXAS to extract quantitative kinetic information for a bimolecular process on the millisecond to second time scale. 14 Here, we show that it is possible to use a multivariate approach for the analysis of the EDXAS spectral data relative to the reaction of [Fe II (TPA)(CH 3 CN) 2 ] 2+ and AcOOH occurring at room temperature. This procedure enables one to extract the X-ray absorption near edge structure (XANES) spectra belonging to the reaction key species, to assess their oxidation states and lifetimes, and to quantitatively shed light on their elusive structures. The decomposition is achieved through a mathematical approach that belongs to the family of the Multivariate Curve Resolution (MCR) methods, 15−18 a class of algorithms that has been applied extensively to the analysis of spectroscopic data coming from the monitoring of chemical reaction processes, such as UV−vis, 19 47 and a variety of catalytic systems in the solid phase. 48−53 To the best of our knowledge, herein we report the first application of the MCR approach to XANES spectra pertaining to a bimolecular reaction in solution on organic substrates evolving on the millisecond time scale. In the presented framework, the direct in situ determination of the full mechanistic picture for the reaction involving the TPA substrate and the geometrical characterization of the reaction intermediates are achieved.
MATERIALS AND METHODS
2.1. Materials. All reagents and solvents were employed at the highest commercial quality and used without additional purification. TPA and peracetic acid (36−40 wt % in acetic acid, stored at 4°C) were purchased from Sigma-Aldrich. Iron(II) bis(trifluoromethanesulfonate)bis(acetonitrile), [Fe(OTf) 2 (CH 3 CN) 2 ], was prepared according to a literature procedure from anhydrous Fe(II) chloride (Sigma-Aldrich). 54 [Fe II (TPA)(CH 3 CN) 2 )](OTf) 2 was prepared by metalation of the ligand TPA (Sigma-Aldrich) with [Fe(OTf) 2 (CH 3 CN) 2 ] in dry CH 3 CN, and crystallization was performed by slow diffusion of dry diethyl ether in a dry dichloromethane solution as described in a literature method. 55 Preparation and handling of air-sensitive materials were performed in an inert atmosphere by using a standard Schlenk and vacuum line techniques or a glove bag under N 2 atmosphere. Subsequently, the complex was stored under inert atmosphere. When the [Fe II (TPA)-(OTf) 2 ] complex is dissolved in CH 3 CN, two solvent molecules enter the iron first coordination sphere giving rise to the [Fe II (TPA)-(CH 3 CN) 2 2+ and AcOOH. For all measurements, 100 μL of each solution was shot by the instrument into the cell.
2.2.2. Energy Dispersive X-ray Absorption Measurements. EDXAS were collected at the ID24 beamline of the European Synchrotron Radiation Facility (ESRF), Grenoble (the ring energy was 6.0 GeV, and the current was 150−200 mA). 56 The X-ray source consists of two undulators, whose gaps were tuned to place the first harmonic at 7100 eV. The beam was focused horizontally to an 8 μm full width at half-maximum (fwhm) spot on the sample by the curved Si(111) polychromator crystal in Bragg geometry. In the vertical direction, the beam was focused using a bent Si mirror at a glancing angle of 3 mrad with respect to the direct beam. To minimize sample radiation damage, the vertical spot size was set at 40 μm fwhm. Spectra were recorded in transmission mode using a fast read out low noise (FReLoN) high frame-rate detector based on charge coupled device (CCD) cameras optically coupled with a scintillator screen. Acquisition time was 40 ms for each spectrum. Sequences of 50−100 individual spectra were acquired, covering a total time span of 2−4 s during the reaction. Each sequence was repeated three times, and the data were averaged to obtain a better signal-to-noise ratio. The energy calibration was made by measuring the absorption spectrum of an Fe foil, and the first inflection point was set at 7111 eV. All measurements were performed at 25°C. EDXAS spectra were recorded with a Bio-Logic SFM-400 stopped-flow device equipped with a flow-through quartz capillary cell. The quartz capillary cell had a diameter of 1.3 mm and wall thickness of ∼10 μm. The dead time of the stopped-flow device is ∼2.0 ms for the flow rate of 8 mL/s as calibrated using the procedure described elsewhere, and it defines the shortest kinetic time that is accessible for spectroscopic measurements. 5 2.2.3. EDXAS Data Treatment. The stopped-flow apparatus used to perform the reaction requires a quartz capillary cell that worsens the quality of the EDXAS spectra due to scattering by quartz. For each measurement the EDXAS spectrum of the cell containing pure acetonitrile was collected after the sample spectrum, using the same statistic. The cell spectrum was subtracted from the sample spectrum to gain a better signal-to-noise (S/N) ratio and a higher resolution for the structural oscillations and a more defined Fe K-edge position. The spectra were then subjected to a smoothing procedure using the Savitzky-Golay Smoothing filter, as described in refs 57 and 58.
2.2.4. Decomposition of EDXAS Data into the Spectra and Relative Concentrations of Key Components. XANES time-resolved measurements yield a large series of spectroscopic data that may be arranged in a spectral matrix D, where each column of D is a spectrum measured at time t. Following the Lambert−Beer law, each experimental spectrum may be seen as the superposition of a number N of "pure" and uncorrelated components multiplied by their relative concentration. 17 The decomposition of the experimental EDXAS data into the N spectra associated with the key reaction species and the relative concentration profiles was performed using the PyFitit code. 17 To do so, this software employs a strategy belonging to the class of the MCR methods.
The decomposition's starting point is the Singular Value Decomposition (SVD) expression: where the product UΣ contains, on its N columns, a set of values associable to the normalized absorption coefficients, Σ is a diagonal matrix called singular values term, whose elements are sorted in decreasing order, while V can be interpreted as the concentration matrix associated with the N-selected components. Finally, the error matrix E represents the lack of fit between the experimental data matrix D and the reconstructed one μ = UΣV. The SVD decomposition depends on the correct estimation of the number of components N present in the experimental spectral matrix. This may be achieved by combining different statistical and empirical evidence. 17 Among them, in this work we chose to use the scree plot analysis as shown afterward in Figure 2a, since it is easily and Inorganic Chemistry pubs.acs.org/IC Article effectively interpreted. At this stage, all matrices present in eq 1 are mere mathematical solutions of the spectral separation problem and do not possess any chemical meaning. Once N is established, the approach implemented by PyFitit requires the introduction of a transformation N × N matrix T in eq 1, using the relation where the spectra belonging to the key reaction species are given by S = UΣT, and their concentration profiles are given by C = T −1 V. The matrix elements T ij of matrix T are then modified by sliders to achieve S and C, which are chemically and physically interpretable. Once this step is achieved, one can finally write In this work, to reduce the unknown number of elements of T, which is in principle equal to N 2 , the normalization of all spectral components contained in matrix S and the mass balance condition for the concentrations contained in matrix C were imposed. Further, the first spectrum assigned to the reaction's initial species, complex [Fe II (TPA)(CH 3 CN) 2 ] 2+ , was constrained to be equal to the EDXAS spectrum recorded on a CH 3 2.2.5. XANES Data Analysis. Each XANES spectra extracted by the matrical decomposition was assigned to a reaction key species and analyzed using the MXAN code. 59,60 This code is based on the calculation of theoretical spectra with a multiple scattering (MS) approach in the framework of the muffin tin (MT) approximation using a complex optical potential, exploiting the local density approximation of the excited photoelectron self-energy. 61−63 The MT radii were calculated according to the Norman criterion. The self energy is calculated in the framework of the Hedin-Lundqvist (HL) scheme using only the real part of the HL potential, while an empirical approach is employed to account for inelastic losses in which the plasmon amplitude A s and the energy onset E s are refined. 64 In all analyses the core hole lifetime Γ c was kept fixed at 1.25 eV for Fe, while the experimental resolution Γ res was optimized during the minimization procedure using a Gaussian function.
The analysis of the XANES spectra assigned to species [Fe II (TPA)(CH 3 CN) 2 ] 2+ was performed starting from an octahedral coordination model around the Fe atoms based on the crystallographic structure of the complex [Fe II (TPA)(CH 3 CN) 2 ] 2+ . 7 In this structure the Fe photoabsorber is coordinated by four nitrogen atoms belonging to the TPA backbone (N TPA ) and by two CH 3 CN solvent nitrogen atoms N ACN . The minimization procedure of the Fe(II) species was performed by optimizing an Fe−N TPA distance with a multiplicity of four and an Fe−N ACN distance with a multiplicity of two. The geometry of the TPA ligand and of the acetonitrile molecules was kept fixed to the crystallographic initial structure.
The XANES calculations regarding complex [Fe III (TPA)(κ 2 -OOAc)] 2+ were based on a previously reported density functional theory (DFT)-optimized molecular structure. 4 In this complex, the central metal cation is coordinated to the four TPA nitrogen atoms and to a peracetate molecule through the negatively charged peracetate oxygen atom (O per ) and the oxygen atom belonging to the acetate moiety (O OAc ). The minimization procedure was applied by optimizing the Fe−N TPA and the Fe−O per distances, without altering the rest of the peracetate. The orientation of the peracetate was refined within a preset range of ±20°around the initial structure.
The MS analysis of [Fe IV (TPA)(O)(X)] +/2+ was performed using two different models. In the former (X = CH 3 CN) the minimization procedure was performed starting from the crystallographic structure of complex [Fe II (TPA)(CH 3 The analysis of the XANES spectrum assigned to complex [Fe 2 III (TPA) 2 (μ-O)(μ-OAc)] 3+ was performed starting from its crystal structure. 8 In this structure there are two Fe atoms each coordinated by a TPA ligand and an oxygen atom belonging to an acetate molecule, and they are linked through a bridging oxygen atom (O bridge ). Because of the symmetry of the two Fe sites, the minimization procedure was performed by optimizing three bond lenghts (Fe−N TPA , Fe−O OAc , and Fe−O bridge ). Theoretical XANES spectra were calculated including scatterers within 5 and 6 Å around a selected Fe atom, and it was found that scattering atoms do not contribute significantly to the theoretical spectrum outside a cutoff radius of 5 Å.
Hydrogen atoms were not included in all MXAN analyses. For all spectra, five nonstructural parameters were refined, namely, the threshold energy E 0 , the Fermi energy level E F , the energy and amplitude of the plasmon E s and A s , and the experimental resolution Γ res . The quality of the fits was estimated with the residual function R sq . 59−61 One can note that the most apparent variations in the spectra are contained in the spectra between t = 0.00 s and t = 0.40 s from reaction start. Notably, between t = 0.04 s and t = 0.20 s the energy edge progressively shifts to higher energies, while between t = 0.20 s and t = 0.40 s the energy edge moves to lower energies. In this same time interval one may note the appearance of a 1s → 3d transition located at ∼7113 eV. This transition is visible for spectra between t = 0.12 s and t = 0.20 s before decaying to zero as the reaction proceeds. After t = 0.60 s, the visible spectral variations are greatly abated. These results are consistent with the reaction mechanism shown in Figure 1, where the initial Fe(II) species undergoes a first oxidation to the Fe(III) complex, which is further oxidized to the Fe(IV) oxo complex, which returns by decay to an Fe(III) state. Iron acquires three different oxidation states (assigned to complexes stable enough to be isolated) during the reaction, and therefore one expects the number N of independent components present in the data mixture to be N = 3 or greater.
RESULTS AND DISCUSSION
Principal component analysis (PCA) was applied to the EDXAS data set to confirm this qualitative analysis and to identify the number of chemical components present in the reaction data mixture. 65 The results are presented in Figure 3. The singular values, extracted from SVD method, are the diagonal elements of matrix Σ reported in eq 1. These quantities are proportional to the data variance explained by each component. It follows that each of them can be properly plotted against the related component number, generating the so-called scree plot, as reported in Figure 3a. One can note from the plot the existence of an elbow indicating the presence of three relevant components. Conversely, for numbers of components greater than three, the related singular values decrease slowly with approximately the same decaying slope, Inorganic Chemistry pubs.acs.org/IC Article indicating that these components contribute to the data set reconstruction in the same way and are, for this reason, associated with noise. This statistical evidence suggests there are three principal components present in the data set. This result is in accordance with the chemical knowledge of the reaction mechanism that predicts the succession of three distinct oxidations states for Fe. The percentage residual error committed in reconstructing the data set with three components is shown in Figure 3b. The percentage error function was calculated with the following expression where d ij and μ ij PC=3 are the normalized absorbance values for the data set and for the data set reconstructed with N = 3, respectively (K and m represent the number of acquired timeresolved spectra and of the energy points, respectively). Interestingly, one may observe an increase in the percentage error in proximity of the spectra recorded between t = 0.04 s and t = 0.16 s. Since the main EDXAS spectral variation in the experimental data is observed in the same time interval, this finding suggests the presence of a diluted and transient species that contributes in small percentage to the overall measured signal. It is probable that by including an ulterior fourth (or fifth) component in the decomposition this error would diminish. However, relying on the knowledge of the reaction mechanism, on the scree plot analysis, and on the relatively small error (inferior to 1.2%) committed in the reconstruction with N = 3, we decided to employ only three PCs for the subsequent analysis.
The transformation matrix approach implemented in PyFitit 17 was used to decompose the data set, employing a 3 × 3 T transformation matrix. Furthermore, by imposing the set of constraints described in Section 2.2.4, the number of T ij elements was reduced from nine to four. Each of these four terms was varied preserving the mass balance condition and the non-negativity of the extracted spectra and concentration profiles. A solution to the decomposition expressed by eq 3, possessing a sound chemical meaning, was achieved through the matrix where σ is the normalization coefficient, 1/σ = −0.17, T 21 = 0.51, and T 31 = 0.57. Figure 4a shows the isolated EDXAS spectra, and Figure 4b shows their fractional components in the reaction mixture. The first spectral component (blue) belongs to complex [Fe II (TPA)(CH 3 CN) 2 ] 2+ . The second (red) and third (green) components are assigned to complexes in which iron has the oxidation states of Fe(IV) and Fe(III), respectively. In fact, the oxidation state of each spectrum is identified by the relative energy position of the main absorption edge. The first inflection point of the spectrum belonging to the initial Fe(II) reactant lies at lower energy than those assigned to the Fe(IV) and Fe(III) species, while that of the Fe(IV) is found at the highest energies. Interestingly, the Fe(IV) complex shows a 1s → 3d dipole-forbidden transition centered at ∼7113 eV. This feature is absent in the spectrum of the Fe(II) reactant and weak in that of the Fe(III) compound. This finding further supports the proposed identification of the reaction species. It is known that Fe(IV) oxo complexes show a relatively intense 1s → 3d transition due to their noncentrosymmetry, and it has been reported that this is also the case for complex Figure 4b one may note that the fractional concentration of the initial [Fe II (TPA)(CH 3 CN) 2 ] 2+ complex rapidly decays to zero, while the concentration of the Fe(IV) species shows an accumulation between t = 0.12 s and t = 0.20 s. Conversely, the concentration of the Fe(III) component is prevalent before the formation of the oxo complex at t = 0.04 s and t = 0.08 s. It decreases to almost zero when the concentration of Fe(IV) reaches its maximum, and then it gradually increases to become the reaction product from t = 0.24 s until the end of the process. These results confirm the sequence of the oxidation states that Fe assumes during the reaction shown in Figure 1 and prove, through the direct analysis of room-temperature reaction EDXAS spectra, that the starting Fe(II) species initially evolves to an Fe(III) intermediate.
The transformation matrix-based approach implemented in this investigation inherently suffers of rotational ambiguity. It follows that the solutions of the decomposition problem shown in Figure 4 are not unique. 15,17 To address the validity of the extracted spectra and concentrations for the reaction components, the time evolution of the area belonging to the pre-edge 1s → 3d transition at 7113 eV and of the edge energy position of the EDXAS spectra were evaluated turning to the raw EDXAS time-resolved spectra. Figure 5a presents the variation during the reaction of the area of the dipole-forbidden transition measured on the raw XANES spectra. One can note that there is a maximum localized at t = 0.16 s, which is indicative of the formation of the noncentrosymmetric oxo complex. The time evolution of the Fe K-edge energy (shown Figure 5b) was qualitatively evaluated by measuring the energy at μ(E) = 0.40 for each raw spectrum, an approach that we have shown to be successful in the analysis of EDXAS spectra acquired during a chemical reaction in solution. 14 The result of this procedure is shown in To test these hypotheses and to obtain quantitative structural information regarding all the reaction intermediates, a full MS analysis was performed on the three isolated spectral components. The XANES spectrum of the Fe(II) complex is quite different from those of the Fe(III) and Fe(IV) species. As previously mentioned, the Fe first coordination shell is made up by the four nitrogen belonging to the TPA backbone, which were placed at the same Fe−N TPA distance, and by two nitrogen atoms belonging to the CH 3 CN solvent molecules. During the fitting procedure, the Fe−N TPA and the Fe−N ACN distances were refined together with the nonstructural parameters to obtain the best agreement with the experimental spectrum. The best-fit results are shown in Figure 6a, while the molecular cluster obtained from the minimization is shown to the right. The agreement between the theoretical spectrum and the isolated component is excellent. The refined parameters are listed in Table 1. The Fe−N TPA and the Fe−N ACN distances are in good agreement with the crystallographic values within the statistical errors. It is well-known that systematic errors are present in the XANES analysis performed with MXAN and that they arise mostly because of the poor approximation used for the phenomenological broadening function Γ(E) that mimics the electronic damping. In all cases studied until now such systematic errors did not appreciably affect the structural results, confirming how this spectroscopy is dominated by the geometry of the atomic cluster rather than by its electronic structure. 66−69 The full list of nonstructural parameters is reported in Table 2.
As far as the Fe(IV) oxo complex is concerned, the MXAN analysis was performed using two different models. In the former ([Fe IV (TPA)(O)(OAc)] + ) the central Fe cation is coordinated to an acetate molecule and to the TPA chain. In this case, the Fe−O oxo and the Fe−O OAc distances were optimized independently together with the Fe−N TPA one. The results of this analysis are shown in Figure 6c, while the best-fit structural parameters are listed in Table 1. Also in this case the agreement between the experimental and theoretical spectra is (4). E 0 is the threshold energy, E F is the Fermi energy level, E s and A s are the energy and amplitude of the plasmon, Γ res is the experimental resolution, and R sq is the residual function. satisfactory (R sq = 2.8), suggesting that an acetate molecule coordinates the Fe atom in the Fe(IV) species.
Further proof of this hypothesis was gained by performing a second minimization using a structural model where the central Fe is coordinated to the four TPA nitrogens, the oxo oxygen atom, and a CH 3 CN ligand. In this case the Fe−O oxo and the Fe−N ACN distances were optimized together with the Fe−N TPA bond length. The best-fit structural and nonstructural parameters are listed in Tables 1 and 2, respectively. The comparison of the theoretical and isolated XANES spectra is presented in Figure 7, while the corresponding optimized atomic cluster is depicted below. In this case a slightly worse agreement was obtained between the two XANES spectra (R sq = 2.9). This finding supports the hypothesis that a molecule coordinating the central Fe cation with an oxygen atom, such as acetate, has a higher residence time compared to that of a molecule coordinating the metal site with a nitrogen atom, such as CH 3 CN. Consequently, one may suggest that the previously unidentified sixth ligand in the [Fe IV (TPA)(O)-(X)] +/2+ complex is the acetate anion.
Through the quantitative analysis of the XANES spectrum extracted from the decomposition, identical first-shell distances are found for both X = AcO − and X = CH 3 CN, as reported in 72 This slight discrepancy of our results with the existing literature may be because the 1.77(5) Å value is obtained on the direct analysis of the spectrum at room temperature of the Fe(IV) species, whereas other measurements have been all performed at low temperatures on a frozen solution or on the crystal, if available. Moreover, as previously underlined, a systematic error is present in the structural determinations conducted with MXAN, as evidenced in the geometrical characterization of other iron heme complexes and heme proteins. 66 The XANES spectrum assigned to complexes [Fe III (TPA)-(κ 2 -OOAc)] 2+ and [Fe 2 III (TPA) 2 (μ-O)(μ-OAc)] 3+ was subjected to two distinct minimization procedures. In the first one, the spectrum was analyzed starting from the DFT-optimized structure 4 associated with complex [Fe III (TPA)(κ 2 -OOAc)] 2+ , where the Fe cation is coordinated by the four nitrogens of the TPA chain and by two oxygen atoms belonging to a peracetate molecule. The results of the analysis are shown in Figure 6b, where the experimental and theoretical curves are reported together with the molecular cluster. The agreement between the data is excellent (R sq = 1.1) and the structural results coincide with the literature data within the statistical errors (Table 1). These findings represent important structural data that confirm the identity of the reaction intermediate [Fe III (TPA)(κ 2 -OOAc)] 2+ . Note that a small percentage of the corresponding Fe(V) oxo complex may form upon heterolysis of the O−O bond of the Fe(III) peroxo species as observed at low temperature by Talsi et al. 9,73 However, at room temperature the Fe(V) species is too unstable to be observed by our method given the time scale of our experimental conditions. 4,74 Finally, the XANES spectrum was analyzed starting from the crystal structure of the μ-oxo dimeric species [Fe 2 III (TPA) 2 (μ-O)(μ-OAc)] 3+ . 8 The same coordination environment was used for both Fe III atoms in the dimer. It comprises the four nitrogen atoms of the TPA ligand, the acetate molecule, and a bridging oxygen atom. During the fitting procedure, the Fe− N TPA , Fe−O OAc , and Fe−O bridge distances were optimized, while the TPA structure was kept fixed to the initial geometry, and all of the atoms within 5 Å of the central metal cation were included in the theoretical calculation. Figure 6d presents the experimental and theoretical spectra together with the atomic cluster. The agreement between the two curves is very good (R sq = 1.3). The structural results, listed in Table 1, highlight a slight compression of the Fe−N TPA and Fe−O OAc bond lengths compared to the crystal structure. One may note that the calculated first-shell distances for complexes [Fe III (TPA)(κ 2 -OOAc)] 2+ and [Fe 2 III (TPA) 2 (μ-O)(μ-OAc)] 3+ are identical within the statistical errors, as expected, since they were optimized on the basis of the same XANES spectrum.
CONCLUSIONS
This work demonstrates that it is possible to derive important mechanistic insights for a reactive process occurring in solution on the millisecond scale and to structurally characterize its transient intermediates through a multivariate EDXAS analysis. The implemented approach has enabled the direct determi- Inorganic Chemistry pubs.acs.org/IC Article nation of the mechanism of the reaction between [Fe II (TPA)-(CH 3 CN) 2 ] 2+ and AcOOH using the TPA nonheme complex at 25°C. In particular, it is confirmed that an Fe(III) acylperoxo intermediate is initially formed, which in turn evolves to a Fe(IV) oxo complex. The sixth ligand of the latter species, which was previously unidentified, is shown to be an acetate ion. This strategy allows one to characterize elusive intermediates whose geometries cannot be easily determined using the conventional experimental methods. Its combination with EDXAS holds great promise, especially for the investigation of complex redox reaction mechanisms on organic substrates that are silent to laboratory-based spectroscopies. | v3-fos-license |
2020-06-25T09:09:01.922Z | 2020-06-01T00:00:00.000 | 220048416 | {
"extfieldsofstudy": [
"Chemistry",
"Medicine"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://www.mdpi.com/2304-8158/9/6/807/pdf",
"pdf_hash": "73d0b2bb0643b4d453f7a02bec1c5f460cf65ccf",
"pdf_src": "PubMedCentral",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120216",
"s2fieldsofstudy": [
"Environmental Science",
"Agricultural and Food Sciences"
],
"sha1": "c2d2f4915e27d4f3efb2323b897eb521eafaaf20",
"year": 2020
} | pes2o/s2orc | Impact of Aqueous Extract of Arbutus unedo Fruits on Limpets (Patella spp.) Pâté during Storage: Proximate Composition, Physicochemical Quality, Oxidative Stability, and Microbial Development
Limpets are molluscs widely used in food diet and much appreciated in many regions. The consumption of fishery products rich in polyunsaturated fatty acids has been increasing through filleted products and restructured products. Since food oxidation is the major cause of nutritional quality deterioration in fish products, the interest in the replacement of synthetic antioxidants with natural sources, namely in the preparation of restructured animal products such as burgers, sausages and pâtés, has been increasing. Phenolic compounds from fruits and vegetables have recognised antioxidant properties and are therefore currently considered as good alternatives to synthetic antioxidants in the food industry. In this study, the effects of the extracts of Arbutus unedo fruits, at two concentration levels (3% and 6%), on proximate composition, physicochemical properties, oxidative stability and safety of limpets pâté, during 90 days at refrigerated storage, were investigated. After processing, the addition of 3% and 6% of A. unedo extracts into limpets pâté contributed to an increase of 18% and 36% in the total phenolic content and 5% and 36% in the antioxidant capacity, respectively. During storage, the enriched limpets pâté with A. unedo fruit extracts at 6% was more efficient as an enhancer of oxidative stability, with 34% inhibition of lipid oxidation, highlighting the potential use of A. unedo fruits as a functional ingredient in the fish industry. Overall, the limpets pâté with 6% of A. unedo fruit extracts proved to be more efficient regarding microbial control, and had the lowest changes in the quality parameters such as in colour, texture and pH during 90 days at refrigerated storage.
Introduction
In Portugal, a traditional country of seafood consumption due to its geographical location and ocean access allied with the promotion of health benefits, a high value was achieved, around 56.8 kg/capita/year compared with the European average (24.9 kg/capita/year) [1]. This healthy diet is related mainly to the nutritional abundance such as vitamins, digestible protein, n-3 long chain polyunsaturated fatty acids (n-3 LC-PUFAs) and minerals (iodine, selenium) [2]. However, the higher demand of these products has led to reductions in natural stocks, especially in fish species like cod, sardine and hake [3]. On the other hand, several underutilised fish due to an inappropriate colour or
Location and Limpets Handling
Limpets were collected from the western coast of Portugal at the beach of Portinho da Areia Norte (Peniche). The removal of limpets from the rocks was performed by knife and then they were transported in sea water to the laboratory for preparation: washing with salt water, shell removal, sand fragments with the dowel, re-washing with salt water, draining the core for approximately 30 s, weighting, sealing in a vacuum bag and storing at −80 • C until processing.
Location and Preparation of Arbutus unedo Fruits Extracts
The A. unedo fruits were harvested in Autumn in the center region of Portugal at the full ripeness stage and transported to the laboratory for preparation. The fruits were selected, cleaned, sorted to eliminate damaged and shrivelled fruits, weighted, sealed in a vacuum bag and frozen at −80 • C until the antioxidant extract preparation. The antioxidant extraction was performed in accordance with the modified method reported by Ganhão et al. [14]. The fruits were cut into small pieces, 30 g of fruits were weighed, transferred to a Falcon tube and freeze-dried at −60 • C until a constant weight (up to 72 h). Afterwards, the freeze-dried fruits were homogenised with 300 mL of water (1:10, w:v) using a homogeniser (Velp Scientifica, Usmate, Italy). The homogenates were centrifuged at 4000 rpm for 10 min at 6 • C using the centrifuge 5810 R (Eppendorf, New York, NY, USA). The supernatants were filtrated, collected and the residue was re-extracted once more following the procedure previously described. The two supernatants were combined and stored under refrigerated conditions until analysis (<24 h).
Processing of Limpets Pâté Enriched with Natural and Synthetic Antioxidant Additives
The limpets pâté was formulated according to the processing methods described by Estévez et al. [20], Sánchez-Zapata [5] and Nielsen and Jacobsen [21], with some modifications.
Depending on the experimental batch, different antioxidant compounds were added to the standard formula. The natural antioxidants are generally recognised as safe and were added at two levels: 3% and 6% [14]. The synthetic antioxidant butylated hydroxytoluene (BHT) was added according to the Portuguese law and the food product (0.01%) [22].
The limpets pâté batches were manufactured as follows: firstly, the limpets' cores were steam heat-treated at 100 • C for 10 min in an electric oven (Foinox, MM 100 E Ecomix, Codogné, Italy), and chopped in a cutter (Robot coupe, R8 V.V, Montceau-en-Bourgogne-Cedex, France) until obtaining a homogeneous limpets paste, firstly at 1500 rpm for 3 min and then at 2000 rpm for 3 min. After this process, the potato starch mixture and oil were added until obtaining a homogeneous paste (3000 rpm for 5 min) and the pâtés were packaged in glass containers and subjected to heat treatment at 80 • C for 30 min in a water bath and cooling at room temperature before being stored at refrigerated temperature (5 • C) for 90 days in the dark. The limpets pâtés were analysed at days 0, 30, 60 and 90 regarding the physicochemical, phytochemical, microbial and oxidative stability. At the sampling times, instrumental colour and texture were measured on the surface of the limpets pâtés and then the samples were stored at 5 • C until the other analytical experiments were conducted.
Proximate Composition
For the determination of the proximate composition (moisture, protein, fat, carbohydrate, ash and fibre) of the limpets pâté samples, the AOAC methods [23] were followed.
The moisture content of the pâté samples was determined by drying the homogenised sample in an oven (Binder, Bohemia, NY, USA) at 103 • C until a constant weight. The moisture was calculated as follows: The crude protein was determined by the Kjeldhal method (N × 6.25). Briefly, 1 g of sample was digested in Kjeldhal digestion flasks with 20 mL of concentrated sulphuric acid and 15 g of Kjeldhal catalyst. The digestion flask was heated at 380 • C for 45 min in a Kjeldahl digester (FOSS, Hillerod, Denmark). The flask was allowed to cool at room temperature and the distillation was carried out in a Büchi Distillation Unit (mod. B-324) (Buchi, New Castle, DE, USA) and 0.1 N HCl standard solution was used as the titration acid. Fat was determined by extracting 5 g of sample with petroleum ether using a Soxhlet apparatus (Behr, Labor Technik, Düsseldorf, Germany), ash content was obtained by incineration at 600 ± 15 • C and carbohydrates were calculated by the difference as follows: Carbohydrates (%) =100 − (g moisture + g protein + g fat + g ash) (2) Moreover, the total energy was calculated using the following equation: The crude fibre was determined by acid and basic digestion of 1 g of defatted sample that was added to 150 mL of sulfuric acid (1.25%), then it was stirred, boiled for 30 min and filtered with Whatman no. 4. Afterwards, the basic digestion was realised, in the same proportions of the solvents using sodium hydroxide (1.25%) and the remained residue. After, the residue was dried at 105 • C for 8 h until the weight was constant, following drying at 105 • C (until constant weight), and ashed in a muffle at 550 • C for 5 h, cooled and weighted. The difference between the ash weight subtracted from the weight of the insoluble matter was expressed as the crude fibre percent of the original weight content.
Physicochemical Quality
The limpets pâté samples were analysed for colour, texture and pH value. All analyses were performed in triplicate on days 0, 30, 60 and 90 of storage.
Colour of all pâté samples was evaluated by a tristimulus colourimeter (Minolta chroma Meter, CR-400, Osaka, Japan). The instrument was calibrated using a white standard tile (L* = 97.10, a* = 0.19, b* = 1.95), illuminate D65 and observer 2 • . Commission Internationale de l'éclairage (CIE) colour space coordinates, the L*a*b* values, were determined in all pâté samples in a Petri dish, previously filled, and three measurements per sample were performed at room temperature (≈20 • C). L* values represent the luminosity of the samples (0-black to 100-white), and a* and b* values indicate the variation of greenness to redness (−60 to +60) and blueness to yellowness (−60 to +60), respectively.
Texture was determined according to the modified method described by Estévez et al. [24]. The penetration test was performed using a Texture Analyser (TA.HDi, Stable Microsystem Ltd., Godalming, UK) using a 30 kg load cell and a stainless steel cylinder probe with a 10 mm diameter. The penetration test was realised at 1.5 mm.s −1 of speed and 8 mm of penetration distance. Firmness (maximum peak force (N)) and adhesiveness (N/s) were used as indicators of the texture parameter. Firmness was measured at room temperature (~22 • C) to avoid storage temperature effects on analysis.
The pH of all pâté samples was measured at room temperature using a pH meter (SP70P, SympHony, Radnor, PA, USA).
Antioxidant Capacity and Oxidative Stability
Total phenolic content (TPC) was determined by the Folin-Ciocalteu method reported by Yu et al. [25], with slight modifications. An amount 10 µL of sample/standard was mixed with 790 µL water and 50 µL of Folin-Ciocalteu reagent. After 2 min, 150 µL Na 2 CO 3 solution (20%, w/v) was added. After the occurrence of a reaction at room temperature in the dark (60 min), the absorbance of the mixture was measured at 755 nm (BioTek Instruments, Winooski, VT, USA). Gallic acid was used for the standard calibration curve. The analysis was performed in triplicate and the results were expressed as mg of gallic acid equivalents per grams of sample (mg GAE/g). The analyses were made on storage days 0, 30, 60 and 90.
DPPH radical scavenging activity was determined by the decrease in DPPH radical absorption after exposure to radical scavengers [26], according to the modified method described by Duffy and Power [27]. An amount of 10 µL of sample/standard was mixed with 990 µL of DPPH solution (0.1 mM). The reaction mixture was vortexed and allowed to stand during 30 min in the dark at room temperature. After, the absorbance was measured at 517 nm (BioTek Instruments, Winooski, VT, USA), the radical scavenging activity was calculated as a percentage of the DPPH discolouration using the following equation: where A 0 is the absorbance of the DPPH solution and A 1 the absorbance of the DPPH radical and sample. The DPPH radical scavenging activities of all pâté samples were determined on storage days 0, 30, 60 and 90.
Lipid oxidation of the limpets pâté was evaluated according to the thiobarbituric acid reacting substances (TBARs) assay reported by Rosmini et al. [28], with some modifications. An amount of 15 g of each pâté sample was homogenised with the solution of trichloroacetic acid at 7.5%, propyl gallate and ethylenediamine tetra acetic acid (EDTA) and then was filtrated by Whatman no. 4 filter paper. Next, 5 mL of TBA was added to the filtrate, vortexed and incubated in a boiling water bath at 100 • C for 40 min. After cooling, the absorbance was measured at 530 nm (BioTek Instruments, Winooski, VT, USA). The standard curve was prepared using a 1,1,3,3-tetraethoxypropane (TEP) solution and results were expressed as mg malondialdehyde (MDA) per kg of limpets pâté. The analyses were made on storage days 0, 30, 60 and 90.
Further, the percent of inhibition against lipid oxidation was calculated at day 90 as follows: where T 90 is the amount of MDA in the treated pâté at day 90 and C 90 is the amount of MDA in the control sample of pâté at day 90.
Microbial Development
Microbial development was performed according to European standard legislation [29]. Twenty-five grams of samples and 225 mL of peptone water were transferred into sterile stomacher filter bags and homogenised in a stomacher (Interscience, St Nom, France) at speed 8 for 10 min. After, a ten-fold dilution series was prepared and plates containing the agars were inoculated. Total viable mesophilic counts [30] were determined using plate count agar (PCA) and incubated at 30 ± 1 • C for 72 h. Escherichia coli [31] was carried out using TBX agar and incubated at 37 • C ± 1 • C for 4 h and 44 • C between 18 and 20 h. Listeria monocytogenes [32] was determined using Rapid L. mono and incubated at 35-37 • C for 48 h. Salmonella spp. [33] was performed using Samonella Express and incubated at 41.5 ± 1 • C for 24-26 h.
The results were expressed as the logarithm of colony-forming units per gram of limpets pâté sample (Log 10 cfu/g). The analyses were made on days 0, 30, 60 and 90 of storage.
Statistical Analysis
For each limpets pâté, three samples were performed, and all the analysis were carried out in triplicate. All data were checked for normality and homoscedasticity. A one-way analysis of variance (ANOVA) with Dunnett's multiple comparison of group means was employed to determine significant differences relative to the control pâté. In the remaining conditions, multiple comparisons were performed using Tukey's honestly significant difference (HSD). When the homogeneity of the variance and normality of the data were not fulfilled, the nonparametric Kruskal-Wallis test [34] was used, followed by the Games-Howell non-parametric post-hoc test. In addition, to evaluate the strength of the correlations between the quality attributes, Pearson's correlation coefficient (r) was used. The calculations were performed using the Statistica™ v.8 Software from Stasoft [35]. All results were considered significant at the p-value < 0.05 level. The results are presented as mean ± standard deviation (SD).
Evaluation of Proximate Composition of Limpets Pâté
The proximate composition (moisture, protein, fat, carbohydrate, fibre, ash) of the limpets pâté samples with synthetic (BHT) and natural (Arbutus unedo fruits extracts) antioxidant sources is shown in Table 1.
The addition of A. unedo fruits extracts at 3% and 6% did not significantly (p-value > 0.05) influence the nutritional composition of the standard limpets pâtés, since similar values of moisture, fat, protein, carbohydrate, ash and energy values, between samples, were found. This similar nutritional profile may result from the same experimental formula used for all pâté samples with the exception of the inclusion of different concentrations of antioxidants ingredients. Aquerreta et al. [36] found an identical proximate composition in fish pâtés elaborated with different quantities of tuna liver and mackerel flesh and also in commercial fish pâtés elaborated with tuna, large-scaled scorpion fish, salmon and anchovy, varying between the range of 164 and 301 kcal/100 g. As stated by previous studies, the traditional pâté usually prepared with goose/pork denotes a higher calorific value, near to 450 kcal/100 g [37], when compared with fish pâté.
The crude fibre content significantly (p-value < 0.05) increases after the inclusion of 3% and 6% of A. unedo fruits extracts in the limpets pâté formulation to 0.2% and 0.80%, respectively. This increment can be explained by the highest source of crude fibre revealed by the A. unedo fruits, 15.4 ± 0.8% (see Table S2 in Supplementary Material) and previously reported by Barros et al. [26] and Morgado et al. [18].
Evaluation of Physicochemical Quality of Limpets Pâté
The effects of Arbutus unedo fruits extracts on the colour, texture and pH value of the limpets pâté during 90 days of storage at 5 • C are shown in Table 2.
Considering the colour of the limpets pâté samples, the incorporation of A. unedo fruits extracts induced a luminosity decrease in both enriched limpets samples compared with CTR. However, only the highest concentration of fruits extract promoted a significant (p-value < 0.05; Table 2) browning of the limpets pâté compared with the luminosity observed in the CTR sample. In the study reported by Estévez et al. [38], no significant differences (p-value > 0.05) in luminosity between batches of porcine liver pâtés elaborated with sage and rosemary essential oils, as antioxidants, were detected.
During storage, an increase in luminosity in all pâté samples was evident wherein the PAU3 and PAU6 samples revealed the smallest and highest values, 48.3 ± 0.7 and 55.2 ± 0.7, respectively, at the end of storage. As previously mentioned by Sánchez-Zapata et al. [5], the luminosity is a colour parameter highly influenced by water, fat, collagen content and free water on the product surface, so an increase in luminosity was expected during the storage period.
Regarding the colour coordinates of a* and b* ( Table 2), no significant statistical differences (p-value > 0.05) were observed between the limpets pâté samples, with the values ranging from 1.2 to 1.8 and 27.1 to 33.0, respectively. According to Agregán et al. [6], the richness of the antioxidants of A. unedo fruits leads to a good stabilisation of the food's colour, as observed in all limpets pâté samples, with natural antioxidant extracts from A. unedo (PAU3, PAU6) and synthetic (BHT) ones.
Another physical parameter with interest from the consumer point of view is the texture. Pâté is considered a paste-like texture composed of a mixture of proteins, fat, water, salt and spices that when mixed result into a homogeneous mass [39]. The A. unedo extracts produced a statistically significant effect (p-value < 0.05; Table 2) in the texture of the limpets pâté samples. Comparing the maximum force of the CTR samples, both enriched pâté samples exhibited a significant (p-value < 0.05; Table 2) decrease of 12% and 35%, in PAU3 and PAU6, respectively. The storage time influenced the hardness of all pâté samples, where an augment of 13% was observed on PAU3, followed by PAU6 (14%) and CTR (23%) after 90 days of storage. The increase in hardness in the pâté samples comes out from separation of the water and fat of the protein matrix due to emulsion destabilisation as stated by Fernández-López et al. [40] and Amaral et al. [41] in ostrich liver pâté. Moreover, the richness of A. unedo fruits in fibre (see Table S2 in Supplementary Material) can contribute to an increase in firmness of limpets pâtés.
The pH value of limpets pâté samples during 90 days of storage are shown in Table 2. Despite the identical pH value of all pâté samples after processing, a slight and significant decrease (p-value < 0.05, Table 2) was observed with the incorporation of A. unedo fruits extracts at both concentration levels, 3% and 6%, compared with the CTR sample. The decrease in pH in all enriched limpets pâtés can be due to the richness of A. unedo fruits in organic acids, as for example, the presence of fumaric (1.49 mg/g), lactic (0.49 mg/g), malic (0.84 mg/g) and citric (0.01 mg/g) acids [42]. This fact can promote the retention of antioxidants [43] in a natural way, through the extract of A. unedo. Moreover, during storage, a similar (p-value > 0.05, Table 2) pH value was detected in all pâté samples, being the lowest and most significant value (p-value < 0.05, Table 2) encountered in both enriched limpets pâtés samples, contrary to the observed in the CTR sample. This increase in the pH value has been reported as a common behaviour in other stored pâtés [44][45][46]. The data suggest that A. unedo fruits extracts can be responsible for the initial pH changes on limpets pâté, contributing to the pH stability of the processed food product. Table 2. Effects of A. unedo fruits extracts on colour (L*, a*, b*), texture (maximum force and adhesiveness) and pH of limpets pâté samples (CTR, PAU3 and PAU6; limpets pâté with BHT, with 3% and 6% of A. unedo fruits extract, respectively). The results are presented as mean ± SD (n = 3). Foods 2020, 9, 807 9 of 16
Evaluation of Antioxidant Capacity and Oxidative Stability of Limpets Pâté
The stability of limpets pâté samples enriched with Arbutus unedo fruits extract, as a natural antioxidant additive, at two concentration levels, was determined by the total phenolics content and DPPH radical scavenging activity. Through both methodologies, it was possible to observe an increase in phenolics content and DPPH radical scavenging activity in the PAU3 and PAU6 samples, compared with the CTR samples ( Figure 1A,B).
The PAU6 limpets pâté sample showed the highest phenolic content (30.6 ± 0.4 mg GAE/g) followed by the PAU3 sample (26.5 ± 1.3 mg GAE/g) and CTR samples (22.4 ± 1.9 mg GAE/g) ( Figure 1A). This effect reveals the richness in phenolic compounds (567± 27 mg GAE/g) of A. unedo fruits and is in agreement with other authors [19,26,27]. Further, the A. unedo fruits have been identified as a good source of antioxidants and can play an important role in human nutrition [19,47], being beneficial to health as antibacterial, anti-inflammatory and anti-carcinogenic agents. [26]. During storage, a similar behaviour was constated in all pâté samples, reaching the end of storage with the same trend value (PAU6 > PAU3 > CTR).
The results of antioxidant capacity expressed by DPPH radical scavenging of the limpets pâtés are presented in Figure 1B and a higher inhibition percentage was revealed in both samples enriched with A. unedo fruits extracts. At day 0, no significant differences (p-value > 0.05) were detected in the antioxidant capacity of the PAU3 sample compared with the CTR sample. However, this difference became increasingly significant (p-value < 0.05; Figure 1B) during refrigerated storage. As observed in the TPC evaluation, the inhibition of DPPH decreases about 43%, 20% and 15% in the CTR, PAU3 and PAU6 samples, respectively, at the end of storage. Arshad et al. [48] reported a similar behaviour, between TPC and DPPH scavenging activity, where a higher TPC led to a higher free radical scavenging activity.
A positive and linear correlation (r = 0.90; p < 0.05) between the two methodologies used for the antioxidant activity evaluation for all limpets pâté samples was found. This correlation is in line with those reported by Szydłowska-Czerniak et al. [49], which proved the benefit of the Folin-Ciocalteu reducing capacity method for the assessment of the total antioxidant capacity of food samples.
Lipid oxidation is one of the major problems concerning food quality deterioration, mainly in fish products due to the higher proportions of long chain unsaturated fatty acids making them more susceptible to oxidation [37]. Thiobarbituric acid reacting substances (TBARS) values represent the content of secondary lipid oxidation products, mainly aldehydes (or carbonyls) which contribute to the deterioration of quality attributes such as flavour, colour and texture in oxidised food products [49][50][51].
The effect of extracts from A. unedo fruits as natural inhibitors of lipid oxidation in the limpets pâté samples during 90 days at refrigerated storage is shown in Figure 2.
After processing, a significant decrease (p-value < 0.05; Figure 2) in the TBARS value in PAU3 and PAU6 (0.97 and 0.89 mg MAD/kg) was achieved when compared with the limpet pâté with synthetic BHT (1.17 mg MAD/kg). During storage, the TBARS values increased gradually on all the experimental analysis days, and the CTR and PAU6 limpets samples showed, always, the highest and lowest value, respectively. Ganhão, et al. [51] explained that the increase in malondialdehydes during refrigerated storage is a result of the onset of oxidative reactions and for this reason, this behaviour was expected on the limpets pâté. Further, the inhibition of lipid oxidation in PAU6 reached almost double the percentage obtained in PAU3, 34% and 18%, respectively. These results indicate a higher protection of limpets pâté against lipid oxidation with the addition of 6% of A. unedo fruits extract. The ability of this extract to inhibit the oxidative deterioration of fish products can be attributed to the antioxidant activity of the phenolic compounds naturally present in A. unedo fruits, which is in accordance with the results previously reported. It is plausible to consider that the phenolic compounds from this fruit inhibited the formation of TBARS through the protection of polyunsaturated fatty acids against reactive oxygen species (ROS). between TPC and DPPH scavenging activity, where a higher TPC led to a higher free radical scavenging activity.
A positive and linear correlation (r = 0.90; p < 0.05) between the two methodologies used for the antioxidant activity evaluation for all limpets pâté samples was found. This correlation is in line with those reported by Szydłowska-Czerniak et al. [49], which proved the benefit of the Folin-Ciocalteu reducing capacity method for the assessment of the total antioxidant capacity of food samples. Lipid oxidation is one of the major problems concerning food quality deterioration, mainly in fish products due to the higher proportions of long chain unsaturated fatty acids making them more susceptible to oxidation [37]. Thiobarbituric acid reacting substances (TBARS) values represent the content of secondary lipid oxidation products, mainly aldehydes (or carbonyls) which contribute to the deterioration of quality attributes such as flavour, colour and texture in oxidised food products Beyond the influence of lipid oxidation products on the sensory quality of fish products, MDA and other TBARS have been highlighted as mutagenic compounds with carcinogenic potential [52]. By inhibiting the formation of TBARS in pâtés, added fruit extracts might improve the overall quality of these products and increase the nutritional value from a health perspective.
Evaluation of Microbial Quality of Limpets Pâ té
The effects of Arbutus unedo fruits extracts on the microbial development of the limpets pâté samples (CTR, PAU3, PAU6) along 90 days at refrigerated storage are shown in Table 3.
Immediately after processing, no microbial count was found in all pâté samples. The absence of microorganisms at this stage is expected and can be explained by the heat treatment applied during the limpets pâté processing. Only after 60 days at refrigerated storage, the viable mesophilic count was developed in all pâté samples. The addition of A. unedo fruits extracts on the limpets pâté samples at 3% and 6% conducted a reduced microbial development (4.3 and 4.2 Log10 cfu/g, respectively) compared with the CTR sample (4.8 Log10 cfu/g). Moreover, the microbial pathogenic species (Escherichia coli, Salmonella spp. and Listeria monocytogenes) were not detected along 90 days of storage on the pâté samples. According to Puupponen-Pimiä et al. [53], wild fruits such as A. unedo's, are rich in phenolic polymers, like ellagitannins, that act as antibacterial agents. There are several mechanisms of action that promote the inhibition of microorganisms, such as the destabilisation of the cytoplasmic membrane, permeabilisation of the plasma membrane, inhibition of extracellular microbial enzymes, direct actions on microbial metabolism and deprivation of the substrates required for microbial growth [53]. The antibacterial effect of aqueous extracts from A. unedo fruits is in accordance with Malheiro et al. [16], who reported the antibacterial effect against Escherichia coli. Further, Salem et al. [54] reported the in vitro antimicrobial activity of ethanolic A. unedo fruits extracts against Grampositive and Gram-negative bacteria as Salmonella typhimurium, Escherichia coli and Enterococcus feacium. Beyond the influence of lipid oxidation products on the sensory quality of fish products, MDA and other TBARS have been highlighted as mutagenic compounds with carcinogenic potential [52]. By inhibiting the formation of TBARS in pâtés, added fruit extracts might improve the overall quality of these products and increase the nutritional value from a health perspective.
Evaluation of Microbial Quality of Limpets Pâté
The effects of Arbutus unedo fruits extracts on the microbial development of the limpets pâté samples (CTR, PAU3, PAU6) along 90 days at refrigerated storage are shown in Table 3.
Immediately after processing, no microbial count was found in all pâté samples. The absence of microorganisms at this stage is expected and can be explained by the heat treatment applied during the limpets pâté processing. Only after 60 days at refrigerated storage, the viable mesophilic count was developed in all pâté samples. The addition of A. unedo fruits extracts on the limpets pâté samples at 3% and 6% conducted a reduced microbial development (4.3 and 4.2 Log 10 cfu/g, respectively) compared with the CTR sample (4.8 Log 10 cfu/g). Moreover, the microbial pathogenic species (Escherichia coli, Salmonella spp. and Listeria monocytogenes) were not detected along 90 days of storage on the pâté samples. According to Puupponen-Pimiä et al. [53], wild fruits such as A. unedo's, are rich in phenolic polymers, like ellagitannins, that act as antibacterial agents. There are several mechanisms of action that promote the inhibition of microorganisms, such as the destabilisation of the cytoplasmic membrane, permeabilisation of the plasma membrane, inhibition of extracellular microbial enzymes, direct actions on microbial metabolism and deprivation of the substrates required for microbial growth [53]. The antibacterial effect of aqueous extracts from A. unedo fruits is in accordance with Malheiro et al. [16], who reported the antibacterial effect against Escherichia coli. Further, Salem et al. [54] reported the in vitro antimicrobial activity of ethanolic A. unedo fruits extracts against Gram-positive and Gram-negative bacteria as Salmonella typhimurium, Escherichia coli and Enterococcus feacium. Table 3. Effects of A. unedo fruits extracts on the microbiological quality (Log 10 cfu/g, mean ± SD (n = 3)) of limpets pâté samples (CTR, PAU3 and PAU6: limpets pâté with BHT, with 3% and 6% of A. unedo fruits extract, respectively). The results are presented as mean ± SD (n = 3). 4.3 ± 0.0 b <10 2 a <10 2 a ND ND-not detected. In each column and between lines, different letters represent significant differences (p-value < 0.05).
Conclusions
Based on the present study, one endemic species of Portugal, the strawberry tree, Arbutus unedo, and its fruits, considered as a potential natural additive, revealed a successful strategy to attain the prevention of lipid oxidation of a new food product, limpets pâté stored at refrigerated storage for 90 days. Regarding the microbial development and the requirements of food legislation, a safe food product was achieved at the end of storage. The nutritional composition of the limpets pâté did not change by the addition of A. unedo fruits extracts, as a natural additive and new ingredient, with the exception of the fibre content, where an increase was observed. According to the obtained results, the enriched limpets pâté with 6% of A. unedo fruits extracts emerged superior by the quality improvement and maintenance of the stored limpets pâté, mainly in the total phenolics content, antioxidant capacity, colour and texture of the stored limpets pâté. In summary, the obtained results demonstrated the benefits of the addition of a natural antioxidant ingredient, A. unedo fruits, by the achievement of oxidative stability and maintenance of quality in a new, natural and healthy food product, limpets pâté. | v3-fos-license |
2017-06-28T19:09:36.411Z | 2009-10-03T00:00:00.000 | 208927281 | {
"extfieldsofstudy": [
"Medicine",
"Chemistry"
],
"oa_license": "CCBY",
"oa_status": "GOLD",
"oa_url": "https://journals.iucr.org/e/issues/2009/11/00/lx2111/lx2111.pdf",
"pdf_hash": "b207a29f69a880a2cf75ae803acab688e2d4f96e",
"pdf_src": "ScienceParsePlus",
"provenance": "20241012_202828_00062_s4wg2_b1a9227c-280a-4fd2-b18d-2bc3cb5c50f0.zst:120229",
"s2fieldsofstudy": [
"Chemistry"
],
"sha1": "8bd18d8b769c7a1fd103744eca39f8907df4275d",
"year": 2009
} | pes2o/s2orc | 2-Bromo-1,3-bis-(4-chloro-phen-yl)prop-2-en-1-one.
In the title compound, C(15)H(9)BrCl(2)O, the two benzene rings are twisted from each other with a dihedral angle of 47.33 (8)°. The crystal structure is stabilized by aromatic π-π inter-actions between the benzene rings of neighbouring mol-ecules [centroid-centroid distance = 3.680 (2) Å], and by weak inter-molecular C-H⋯O and C-H⋯Cl inter-actions. Additionally, the crystal structure exhibits a short intra-molecular C-H⋯Br contact (H⋯Br = 2.69 Å).
In the title compound, C 15 H 9 BrCl 2 O, the two benzene rings are twisted from each other with a dihedral angle of 47.33 (8) .The crystal structure is stabilized by aromaticinteractions between the benzene rings of neighbouring molecules [centroid-centroid distance = 3.680 (2) A ˚], and by weak intermolecular C-HÁ Á ÁO and C-HÁ Á ÁCl interactions.Additionally, the crystal structure exhibits a short intramolecular C-HÁ Á ÁBr contact (HÁ Á ÁBr = 2.69 A ˚).
Experimental
Crystal data
S1. Comment
As part of our ongoing investigations of chalcone derivatives as possible non-linear optical materials (Harrison et al., 2006), we now report the synthesis and structure of the noncentrosymmetric title compound, (I), (Fig 1 .).
S3. Refinement
The H atoms were placed in calculated positions (C-H = 0.95 Å) and refined as riding with U iso (H) = 1.2U eq (C).The highest difference peak is 0.96Å from O1.
sup-2
Acta Cryst. (2009).E65, o2648 Refinement.Refinement of F 2 against ALL reflections.The weighted R-factor wR and goodness of fit S are based on F 2 , conventional R-factors R are based on F, with F set to zero for negative F 2 .The threshold expression of F 2 > σ(F 2 ) is used only for calculating R-factors(gt) etc. and is not relevant to the choice of reflections for refinement.R-factors based on F 2 are statistically about twice as large as those based on F, and R-factors based on ALL data will be even larger.
Figure 1
Figure 1View of the molecular structure of (I) showing 50% displacement ellipsoids.The H atoms are drawn as spheres of arbitrary radius. | v3-fos-license |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.