Type
stringclasses 4
values | ConceptID
stringlengths 1
31
| mention_counts
stringlengths 7
7.84M
| mention
stringlengths 1
99
⌀ |
|---|---|---|---|
Disease
|
MESH:C535549
|
{'Pelvic lipomatosis': 125, 'pelvic lipomatosis': 148, 'pelvic lipomatosis of nerve': 1, 'renal pelvic lipomatosis': 1, 'pelvic lipomatosis mass': 2, 'PL': 8, 'Pelvic Lipomatosis': 6, 'constrictive pelvic lipomatosis': 1, 'intra-abdominal and pelvic lipomatosis': 1, 'familial pelvic lipomatosis': 1, 'obstructive pelvic lipomatosis': 1, 'benign pelvic lipomatosis': 1, 'Abdomino-pelvic lipomatosis': 1, 'Renal pelvic lipomatosis': 1, 'abdomino-pelvic lipomatosis': 1, 'intra and extra-pelvic lipomas': 1}
|
pelvic lipomatosis
|
Disease
|
MESH:C535550
|
{'abnormalities of scapula with shoulder and pelvic tilt': 1, 'weakness of the pelvic and shoulder girdle muscles': 6, 'Cousin': 30, 'cousins': 1, 'Cousins': 12, 'stiffness of the neck, shoulder, and pelvic girdles': 1, 'deficiency of the pelvic and shoulder girdle': 1, 'COUSIN': 2, 'Familial myopathy of the shoulder and pelvic girdle': 1, 'aching of the shoulder and/or pelvic girdles': 1, 'shoulder and pelvic girdle weakness': 7, 'stiffness of the shoulders and pelvic girdle': 2, 'weakness of pelvic and shoulder muscles': 1, 'dissociation of the shoulder and pelvic girdle': 1, 'pelvic or shoulder girdle muscle weakness': 1, 'stiffness of the shoulder and pelvic girdles': 1, 'pelvic dysplasia': 29, 'weakness of proximal shoulder-girdle or pelvic muscles': 2, 'fractures of pelvis, scapula': 1, 'shoulder epimetaphyseal dysplasia': 1, 'shoulder dysplasia': 23, 'Epimetaphyseal dysplasia of the shoulder and': 1, 'Congenital shoulder dysplasia and luxation': 1, 'shoulder and pelvic girdle stiffness': 1, 'atrophy of the pelvic and shoulder girdle muscles': 8, 'wasting of the pelvic and shoulder girdle muscles': 4, 'stiffness in the shoulder and pelvic girdles': 1, 'Cousin III': 1, 'atrophy of the limb muscles, pelvic and shoulder girdles': 1, 'shoulder or pelvic girdle aching': 3, 'wasting of the muscles in the shoulder and pelvic girdle': 1, 'Cousin syndrome': 18, 'Plevis-Shoulder Dysplasia': 1, 'Fragility vertebral, shoulder or pelvic fracture': 1, 'atrophy of predominant pelvic and shoulder muscles': 2, 'atrophy of predominantly pelvic and shoulder muscles': 1, 'wasting of the shoulder and pelvic girdle muscles': 5, 'stiffness of the shoulder and pelvic girdle': 2, 'inflammation of the shoulder and pelvic girdles': 2, 'pelvic and shoulder girdle muscle weakness': 5, 'Pelvic and shoulder girdle weakness': 1, 'Pelvic dysplasia': 1, 'shoulder and pelvic imbalance': 2, 'shoulder and pelvic imbalances': 2, 'carpus, shoulder, and pelvic limb injury': 1, 'pelvic and shoulder girdle muscles weakness': 1, 'Pelvic, acetabular, femur, and shoulder fractures': 1, 'congenital shoulder dysplasia': 1, 'atrophy of shoulder and pelvic yard and back muscles': 1, 'pelvic and shoulder muscle disorders': 1, 'SHOULDER DYSPLASIAS': 1, 'dysplasia of the shoulder': 2, 'hypoplasia of scapula and pelvis': 2, 'pelviscapular dysplasia': 1, 'weakness of the shoulder and pelvic muscles': 2, 'shoulder and pelvic girdle involvement': 1, 'weakness in shoulder and pelvic girdle': 2, 'muscle weakness of shoulder, and pelvic girdle': 1, 'shoulder and pelvic asymmetry': 4, 'Shoulder dysplasia': 4, 'stiffness of the neck, shoulders and pelvic girdle': 1, 'FIRST COUSINS': 1, 'pelvic and shoulder': 1, 'morning stiffness of the shoulder and pelvic girdle': 1, 'juvenile shoulder and pelvic girdle weakness': 1, 'wasting of pelvic and shoulder girdle musculatures': 1, 'weakness of shoulder and pelvic girdle muscles': 2, 'pelvic-sacral dysplasia': 1, 'pelvic and shoulder strapping': 1, 'Dylan Cousin': 1, 'degeneration of pelvic and shoulder girdle muscles': 1, 'atrophy of skeletal, pelvic and shoulder girdle muscles': 2, 'Heriditary patello-pelvic dysplasia': 1, 'weakening of shoulder, pelvic girdle, and': 1, 'HSFC': 1, 'HFC': 1, 'weakness of the shoulder and pelvic girdle muscle': 1, 'facial, shoulder, and pelvic girdle weakness': 1, 'pelvic and sacral dysplasia': 4, 'bilateral aching of the shoulders and pelvic girdle': 1, 'weakness of the pelvic and shoulder girdle musculature': 3, 'pelvic fibrous dysplasia': 2, 'weakness of the pelvic and/or shoulder muscles': 1, 'cousin': 3, 'Maternal Cousin': 2, 'congenital dysplasia of shoulder joint': 1, 'Shoulder and pelvic girdle weakness': 1, 'pelvic and/or shoulder girdle muscle weakness': 1, 'vertebral, shoulder, and pelvic fractures': 1, 'shoulder and pelvic': 2, 'shoulder and pelvic injuries': 2, 'atrophy of the shoulder and pelvic girdles': 1, 'stiffness of the neck, shoulder, and pelvic girdle': 1, 'fractures of the scapula and pelvis': 1, 'Sisters Cousins Disorder': 1, 'weakness of shoulder and pelvic muscles': 1, 'weakness of pelvic and shoulder girdle muscles': 1, 'shoulder and/or pelvic girdle aching': 4, 'atrophy of the shoulder and pelvic girdle musculature': 1, 'wasting of predominantly the shoulder and pelvic girdle muscles': 1, 'limb-shoulder and pelvic girdle': 1, 'shoulder and pelvic girdle dissociation': 1, 'stiffness in the neck, shoulder, and pelvic': 1, 'shoulder or pelvic asymmetry': 2, 'shoulder girdle and pelvic muscle weakness': 1, 'shoulder and pelvic girdle': 2, 'spine, clavicle/scapula, and pelvis': 2, 'wasting of the shoulder and pelvic girdle musculature': 1, 'wasting of shoulder and pelvic girdle musculature': 1, 'Dysplasia of the shoulder joint': 1, 'wasting of pelvic and shoulder girdle muscles': 2, 'spondylar and pelvic dysplasia': 1, 'weakness affecting the shoulder and pelvic girdles': 1, 'femur, pelvic and shoulder upper arm fractures': 1, 'shoulder or pelvic girdle stiffness': 1, 'spinal, pelvic, and shoulder-upper limb fractures': 1, 'hypoplasia of the scapulae, clavicles and pelvis': 1, 'atrophy of pelvic and shoulder girdle muscles': 1, 'wasting of proximal pelvic and shoulder girdle muscles': 1, 'weakness of the shoulder and pelvic girdle muscles': 1, 'weakness of muscles of the pelvic and shoulder girdle': 1, 'weakness of pelvic and shoulder girdles': 1, 'muscle weakness of pelvic and shoulder girdles': 1, 'Cousin Grief': 1, 'Cousin syndrome': 1, 'UNCLE FATHER AUNT STEPFATHER COUSIN MOTHER FRIEND': 1, 'weakness of shoulder and pelvic girdle': 1, 'stiffness of shoulders and pelvic girdle': 1, 'pelvic or shoulder pathologies': 1, 'Cousin Syndrome': 5, 'Shoulder girdle and pelvic exostosis': 1, 'shoulder joint dysplasias': 1, 'knee and pelvic dysplasia': 1, 'shoulder and pelvic girdle fractures': 1, 'shoulder and pelvic girdle muscle': 1, 'shoulder and pelvic muscle weakness': 4, 'bony dysplasia in the shoulder and elbow': 1, 'pelvic or shoulders imbalance': 1, 'pelvic and shoulder area weakness': 1, 'weakness of proximal muscles of the shoulder and pelvic girdles': 1, 'pelvic and shoulder girdle weakness': 3, 'Pelvic FD': 1, 'pelvic FD': 1, 'dysplasia of the pelvic joint': 1, 'stiffness in shoulder and pelvic girdles': 1, 'pelvic and sacral "dysplasia': 1, 'Forgotten Cousin': 1, 'mPCs': 1, 'wasting of the pelvic and shoulder girdles': 1, 'weakness of pelvic girdle and shoulder muscles': 1, "Cousin's syndrome": 1, 'of the spine, scapula long bone or pelvis': 1, 'shoulder/pelvic girdle weakness': 1, 'shoulder and pelvic girdle aching': 1, 'wasting of muscles of the pelvic and shoulder girdle': 1, 'fractures of the scapulae and pelvis': 1, 'FC': 2, 'DFC': 2, 'shoulder and pelvic girdle muscle weakness': 2, 'neck, shoulder, and pelvic muscle weakness': 1, 'trunk, shoulder, and pelvic disorders': 1, 'weakening of shoulder and pelvic muscles': 1, 'pelvic or shoulder': 1, 'shoulders and pelvic dissociation': 1, 'tumors of the pelvis and scapula': 1, 'weakness of shoulder or pelvic muscles': 1, 'left shoulder dysplasia': 1, 'stiffness of the shoulder and/or pelvic girdles': 1, 'pelvic injuries or dysplasia': 1, 'Shoulder joint dysplasia': 2, 'shoulder girdle, pelvic': 1, 'stiffness in the shoulder and pelvic girdle': 1, 'dysplasia of the shoulder joint': 1, 'weakness of the legs, pelvic and shoulder muscles': 1, 'weakness of the pelvic and shoulder girdles': 2, 'dysplasia on the shoulder': 1, 'osseous dysplasia of the shoulder': 1, 'pelvic and shoulder lateral balance': 1, 'abnormalities in the pelvis, spine, and scapulae': 1, 'shoulders and pelvic girdle': 1, ', shoulders and pelvic girdle': 1, 'wasting of shoulder and pelvic muscles': 1, 'atrophy of mainly pelvic and shoulder girdle muscles': 1, 'femoral and pelvic dysplasia': 1, 'muscle atrophy of the shoulder and pelvic girdle': 1, 'stiffness in the shoulders and pelvic girdle': 1, 'fracture in extremities, pelvis, scapula and vertebrae': 1, 'CONGENITAL DYSPLASIA OF THE SHOULDER': 1, 'shoulder pelvic defect': 1, ', shoulder, pelvic girdle': 1, 'wasting of shoulder and pelvic-girdle muscles': 1, 'shoulder joint dysplasia': 1, 'spine, scapulae, and pelvis abnormalities': 1, 'shoulder-girdle and pelvic muscle weakness': 1, 'reduction of shoulder, pelvic, and hip frontal': 1, 'pelvic and/or shoulder girdle': 1, 'Shoulder and pelvic girdle': 1, 'musculoskeletal, spine, shoulder, and pelvic conditions': 1, 'shoulder and pelvic girdles': 1, 'muscle weakness of shoulder and pelvic girdle': 1, 'degeneration predominantly in the shoulder and pelvic girdle': 1, 'posterior glenoid dysplasia of the shoulder': 1, 'wasting of the pelvic or shoulder girdle musculature': 1, 'stiffness in the neck, scapula and pelvis': 1, 'pelvic and shoulder girdle muscular dystrophy': 1, 'shoulder and pelvic morphological imbalance': 1, 'Shoulder and pelvic imbalances': 1, 'shoulder and pelvic girdles weakness': 1, 'COUNTRY COUSINS': 1, 'cousin syndrome': 2}
|
Cousin
|
Disease
|
MESH:C535551
|
{'South American Leaf Blight': 18, 'SALB': 28, 'SAA': 1, 'SADA': 2, 'SA': 18, 'Endemic pemphigus foliaceus': 32, 'endemic pemphigus foliaceus': 19, 'fogo selvagem': 150, 'EPF': 43, 'Fogo selvagem': 47, 'fogo selvage': 5, 'endemic pemphigus': 2, 'SACs': 22, 'FS': 62, 'South American leaf blight (SALB) disease': 4, 'SALB disease': 2, 'SAC': 32, 'folha-fogo': 1, 'SASL': 6, 'El Bagre-EPF': 7, '-EPF': 4, 'Bagre-EPF': 3, 'Fogo Selvagem': 45, 'SAMAs': 1, 'de fogo': 1, 'FAF': 1, 'selvagem': 2, 'SASM': 3, 'endemic PF': 2, 'Endemic PF': 4, 'genotipo homozigoto selvagem': 1, 'South American leaf blight': 16, 'SAM': 8, 'WASA': 1, 'South American trypanosomosis': 2, 'fogo na serra': 1, 'SOUTH AMERICAN': 2, 'South American (SA)': 2, 'EPF diseases': 1, 'FS disease': 6, 'SAPW-': 1, 'SAPW': 3, 'fogo': 2, 'EPF acantholysis': 1, 'FS lesions': 2, 'FS LV': 1, 'EPF disease': 2, 'CSAs': 1, 'CSA': 6, 'SAMS': 7, 'SALMA': 4, 'Fogo': 6, 'SAYCARE': 2, 'MASALA': 2, 'SAfs': 1, 'SAFS': 4, 'Limao Verde FS': 1, 'SAMR': 1, 'Bagre endemic PF': 1, 'south american': 1, 'SAm': 2, 'cafe selvagem': 1, 'BPF': 7, 'FS/PF': 1, 'AMR': 1, 'pescada selvagem': 1, "Fogo's": 1, 'FREE-LIVING SOUTH AMERICAN COATI': 1, 'Bagre-EPF disease': 1, 'endemic foliaceous pemphigus': 1, 'SL': 1, 'MCS': 1, 'South American blastomicosis': 1, 'South American citrus canker': 1, 'pemphigus fogo selvage': 1, 'SA-A': 1, 'SA-C': 1, 'Endemic Pemphigus foliaceus': 1, 'South American leaf blight (SALB)': 1, 'folgo selvagem': 1, 'SAmerM': 1, 'SAD': 1, 'EP': 1, 'NEPF': 1, 'SAP': 1, 'South American Ocular Toxoplasmosis': 1, 'CSAFOT': 1, 'Fogo selvage': 2, 'Hevea-SALB': 1, 'TPF': 1, 'Fogo selvagem': 1, 'Fogo A eruption': 1, 'SALB)': 1, 'South American Leaf Blight (': 1, 'Brazilian fogo selvagem': 1, 'tipo selvagem': 1, 'Autoimmune Fogo': 1, 'Selvagem': 1, 'FS lesion': 1, 'FROM FREE-LIVING SOUTH AMERICAN COATI': 1, 'South American Myasis': 1, 'south American myasis': 1, 'SAFSs': 2, 'NSA': 1, 'fogo salvagem': 1, 'MCSAI': 1, 'South American rattlesnake bite': 1, 'SAAs': 1, 'amiloidose de tipo selvagem': 1, 'BP': 1, 'South American trypanosomiases': 1, 'SA gray fox': 1, 'SA canid': 1, 'SCA': 1, 'SAILS': 1, 'FS autoimmune response': 1, 'rolinha-fogo-apagou': 1, 'autoimmune skin disease FS': 1, 'BRAZILIAN PEMPHIGUS FOLIACEUS': 2, 'FS 12': 1, 'SAIAs': 1, 'SA-I': 1, 'BPf': 1, 'SAPF': 1, 'CAUSED BY SOUTH AMERICAN': 1, 'SASLs': 1, 'fogo selvagem-FS': 1, 'SAE': 2, 'South American Leaf Blight (SALB) disease': 1, 'endemic pemphigus foliaceous': 1}
|
fogo selvagem
|
Disease
|
MESH:C535553
|
{'intra-abdominal cystic lesions': 33, 'abdominal cystic lesions': 46, 'retroperitoneal lymphangiomas': 26, 'intra-abdominal cystic mass': 42, 'retroperitoneal cystic mass': 36, 'retroperitoneal cystic lesions': 27, 'primary ARL': 1, 'ARL': 1, 'adult retroperitoneal lymphangioma': 1, 'retroperitoneal lymphangioma': 88, 'retroperitoneal cystic lesion': 31, 'primary retroperitoneal lymphangioma': 1, 'Primary ARL': 1, 'intra-abdominal lymphangioma': 26, 'adult intra-abdominal lymphangioma': 1, 'Primary Retroperitoneal Lymphangioma': 1, 'gastrointestinal, retroperitoneal, cranial, and intra-abdominal bleeding': 1, 'mesenteric and retroperitoneal cystic lymphangiomas': 2, 'abdominal lymphangiomas': 50, 'cystic abdominal mass': 22, 'abdominal cystic mass': 76, 'hepatic, abdominal, and retroperitoneal masses': 1, 'retroperitoneal cystic masses': 20, 'retroperitoneal cystic diseases': 1, 'retroperitoneal cystic lymphangioma': 66, 'intra-abdominal lymphangiomas': 26, 'Intra-abdominal lymphangiomas': 18, 'Scrotal and retroperitoneal lymphangioma': 1, 'abdominal scrotal lymphangioma': 1, 'SRL': 1, 'abdominal scrotal lymphangiomas': 1, 'scrotal and retroperitoneal lymphangioma': 1, 'Abdominal scrotal lymphangiomas': 1, 'intra-abdominal retroperitoneal mass': 1, 'Retroperitoneal cystic lymphangioma': 54, 'Cystic abdominal lymphangiomas': 1, 'intra-abdominal and retroperitoneal visceral trauma': 1, 'meningeal, intra-abdominal, or retroperitoneal hemorrhage': 1, 'Abdominal cystic mass': 4, 'cystic retroperitoneal lesions': 5, 'Primary retroperitoneal cystic lesions': 2, 'abdominal cystic lymphangiomas': 19, 'abdominal cystic lymphangioma': 30, 'Cystic Abdominal Lymphangioma': 1, 'Abdominal Lymphangioma': 4, 'Intra-abdominal cystic lymphangiomas': 14, 'Abdominal cystic lymphangioma': 27, 'Retroperitoneal lymphangioma': 34, 'abdominal lymphangioma': 62, 'Abdominal lymphangiomas': 37, 'Intra-abdominal and retroperitoneal lymphangiomas': 2, 'retroperitoneal cystic disease': 1, 'pulmonary and abdominal cystic lesions': 1, 'Abdominal cystic lesions': 6, 'abdominal cystic masses': 35, 'abdominal and retroperitoneal masses': 4, 'cystic abdominal lesions': 15, 'Intra-abdominal lymphangioma': 16, 'Retroperitoneal lymphangiomas': 28, 'giant retroperitoneal lymphangioma': 2, 'Giant retroperitoneal lymphangioma': 1, 'abdominal or retroperitoneal organ inflammation': 1, 'intra-abdominal cystic variety': 1, 'Retroperitoneal Cystic Lymphangioma': 7, 'Abdominal lymphangioma': 18, 'abdominal or retroperitoneal mesenchymal tumors': 1, 'abdominal unilocular cystic diseases': 1, 'intra-abdominal or retroperitoneal hemorrhage': 14, 'abdominal and retroperitoneal lesions': 8, 'intra-abdominal cystic lymphangioma': 21, 'retroperitoneal cystic hamartomas': 1, 'Abdominal cystic lymphatic malformations': 1, 'abdominal cystic malformation': 1, 'abdominal cystic lymphatic malformations': 1, 'abdominal and retroperitoneal mass': 2, 'abdominal and retroperitoneal diseases': 1, 'Cystic retroperitoneal masses': 1, 'retroperitoneal or abdominal trauma': 1, 'abdominal and retroperitoneal hemorrhages': 2, 'intra-abdominal cystic lesion': 12, 'abdominal and retroperitoneal lymphadenopathy': 9, 'Intra-abdominal cystic lymphangioma': 14, 'intra-abdominal cystic lymphangiomas': 6, 'Cystic retroperitoneal lymphangiomas': 1, 'abdominal, retroperitoneal and pelvic schwannomas': 1, 'Intra-abdominal giant-cystic lymphangioma': 1, 'retroperitoneal or abdominal hemorrhage': 1, 'abdominal retroperitoneal lesion': 1, 'intra-abdominal cystic masses': 19, 'retroperitoneal and intra-abdominal disease': 1, 'Retroperitoneal cystic lesions': 4, 'retroperitoneal/abdominal leiomyosarcoma': 1, 'Abdominal cystic lymphangiomas': 24, 'retroperitoneal and mesenteric lymphangiomas': 2, 'intra-abdominal or retroperitoneal bleeding': 8, 'Retroperitoneal cystic endometriosis': 1, 'Retroperitoneal cystic masses': 11, 'retroperitoneal CL': 3, 'cystic retroperitoneal lymphangioma': 3, 'abdominal CL': 2, 'Abdominal CL': 1, 'abdominal and retroperitoneal cysts': 1, 'cystic abdominal swellings': 1, 'congenital abdominal cystic lesions': 2, 'Retroperitoneal cystic lymphangiomas': 11, 'pelvic /retroperitoneal cystic lesions': 1, 'retroperitoneal cystic lymphangiomyoma': 1, 'Retroperitoneal cystic lymphatic malformations': 1, 'retroperitoneal cystic lymphatic malformations': 1, 'retroperitoneal cystic malformation': 1, 'retroperitoneal-abdominal leiomyomas': 4, 'retroperitoneal cystic schwannoma of the pelvis': 1, 'Retroperitoneal and intra-abdominal sarcoma': 1, 'cystic abdominal lesion': 3, 'giant retroperitoneal cystic lymphangioma': 1, 'retroperitoneal or intra-abdominal disease': 1, 'retroperitoneal/abdominal lesions': 1, 'Cystic Abdominal Mass.': 1, 'intra-abdominal and retroperitoneal sarcomas': 4, 'Primary retroperitoneal mucinous cystic tumors': 5, 'intra-abdominal and retroperitoneal pseudocysts': 1, 'Cystic retroperitoneal lymphangioma': 8, 'abdominal cystic lesion': 26, 'abdominal or retroperitoneal abnormalities': 2, 'abdominal/retroperitoneal mass': 1, 'abdominal cystic hydatid disease': 2, 'retroperitoneal or abdominal inflammation': 1, 'abdominal, inguinal and retroperitoneal adenopathies': 1, 'cystic intra-abdominal lesions': 3, 'intra-abdominal or retroperitoneal sarcomas': 3, 'abdominal cystic lymphangioma in mesocolon': 1, 'intra-abdominal cystic lymphoma': 1, 'intraperitoneal or retroperitoneal lymphangiomas': 1, 'retroperitoneal abdominal mass': 5, 'abdominal and pelvic cystic lesions': 2, 'retroperitoneal or intra-abdominal sarcomas': 2, 'Intra-abdominal and retroperitoneal sarcomas': 1, 'intra-abdominal cystic': 1, 'intra-abdominal or retroperitoneal malignancies': 1, 'Primary retroperitoneal cystic tumor': 1, 'retroperitoneal or intra-abdominal bleeding': 1, 'abdominal hydatid cystic disease': 1, 'retroperitoneal abdominal lesion': 2, 'abdominal cystic anomalies': 1, 'fetal abdominal lymphangioma': 2, 'infected ACL': 1, 'ACL': 4, 'abdominal cyst lymphangioma': 3, 'intra-abdominal cystic swelling': 1, 'mediastinal and upper abdominal retroperitoneal lymphadenopathies': 1, 'mediastinal and abdominal cystic mass': 1, 'Retroperitoneal cystic lesion': 1, 'retroperitoneal/abdominal bleeding': 1, 'abdominal cystic swelling': 1, 'retroperitoneal cystic venous malformation': 1, 'abdominal and retroperitoneal leiomyosarcoma': 2, 'abdominal, perineal, or retroperitoneal infection': 1, '-abdominal and retroperitoneal': 1, 'intra-abdominal and mediastinal lymphangiomas': 2, 'Retroperitoneal / intra-abdominal sarcoma': 1, 'retroperitoneal and abdominal bleeding': 2, 'retroperitoneal or abdominal sarcoma': 3, 'abdominal or retroperitoneal carcinoma': 1, 'benign abdominal and retroperitoneal tumors': 1, 'Abdominal and/or retroperitoneal sarcomas': 1, 'Abdominal or retroperitoneal sarcomas': 1, 'primary retroperitoneal mucinous cystic tumor of': 1, 'Retroperitoneal cystic mass': 7, 'mediastinal, abdominal, retroperitoneal and pelvic lesions': 1, 'IAL': 1, 'Retroperitoneal cystic ectopic adrenal gland': 1, 'Retroperitoneal Cystic Mass.': 1, 'retroperitoneal cystic mass.': 1, 'cystic abdominal masses': 10, 'intra-abdominal multiple lymphangiomas': 1, 'retroperitoneal or intra-abdominal mass': 1, 'retroperitoneal and abdominal lesions': 2, 'COMPLETE RESECTION OF RETROPERITONEAL CYSTIC LYMPHANGIOMA': 1, 'Retroperitoneal Lymphangioma': 7, 'RCL': 1, 'intra-abdominal and retroperitoneal malignancies': 1, 'retroperitoneal cystic hamartoma': 5, 'Cystic abdominal lymphangioma': 2, 'abdominal and retroperitoneal hydatid diseases': 1, 'thoraco-abdominal lymphangioma': 1, 'abdominal/pelvic cystic mass': 1, 'retroperitoneal and intra-abdominal sarcomas': 2, 'Congenital abdominal cystic lymphangiomas': 1, 'abdominal cystic lymphangiomatosis': 1, 'retroperitoneal and abdominal abnormalities': 1, 'Intra Abdominal Cystic Lymphangioma': 1, 'retroperitoneal/abdominal leiomyomas': 1, 'pelvic/abdominal cystic mass': 1, 'Cystic retroperitoneal mass': 1, 'abdominal and retroperitoneal hemorrhage': 3, 'abdominal and retroperitoneal lymphadenopathies': 2, 'Retroperitoneal cystic harmartoma': 1, 'retroperitoneal cystic uterine myoma': 1, 'Abdominal Cystic Lymphangioma': 2, 'CASE OF THORACO-ABDOMINAL- RETROPERITONEAL': 1, 'retroperitoneal cystic mass in the': 1, 'retroperitoneal, abdominal, and pelvic sarcoma': 1, 'retroperitoneal or abdominal bleeding': 3, 'thoracic, abdominal, and retroperitoneal hemorrhage': 1, 'retroperitoneal and pelvic lymphangiomas': 1, 'Abdominal lymphangioma infected': 1, 'abdominal retroperitoneal mass': 2, 'abdominal, pelvic and retroperitoneal lesions': 1, 'abdominal or retroperitoneal sarcomas': 3, '-renal retroperitoneal Lymphangioma': 1, 'retroperitoneal-abdominal leiomyosarcomas': 1, 'Retroperitoneal-abdominal leiomyomas': 1, 'Abdominal and retroperitoneal lymphadenopathy': 1, 'Retroperitoneal adrenal cystic lesions': 1, 'abdominal and submucosal cystic lesions': 1, 'Intra-abdominal cystic lesions': 1, 'Retroperitoneal multiple lymphangioma': 1, 'abdominal and retroperitoneal infection': 1, 'abdominal/retroperitoneal bleed': 1, 'Abdominal Cystic lymphangiomas': 1, 'pelvic and abdominal retroperitoneal hemorrhage': 1, 'intra-abdominal cystic hydatid disease': 1, 'abdominal or retroperitoneal trauma': 1, 'Intra-abdominal cystic lymphangioma of the mesocolon': 1, 'Retroperitoneal Cystic Adenocarcinoma': 1, 'abdominal and retroperitoneal sarcoma': 4, 'intra-abdominal and retroperitoneal lipomas': 1, 'retroperitoneal cystic lymphangiomas': 7, 'retroperitoneal and intra-abdominal hemorrhage': 2, 'intra-abdominal and retroperitoneal hemorrhage': 3, 'retroperitoneal and abdominal sarcoma': 2, 'retroperitoneal/abdominal sarcomas': 1, 'retroperitoneal and abdominal sarcomas': 2, 'retroperitoneal and nonvisceral abdominal sarcoma': 1, 'lymphatic, abdominal and retroperitoneal masses]A': 1, 'retroperitoneal/intra-abdominal sarcomas': 3, 'Retroperitoneal and gluteal cystic lymphangioma': 1, 'Abdominal cystic formations': 1, 'abdominal mesenteric lymphangioma': 1, 'abdominal or retroperitoneal bleeding': 2, 'mediastinal and retroperitoneal cystic lymphangioma': 1, 'abdominal and retroperitoneal lymphosarcomas': 1, 'Abdominal cystic lymphangiomatosis': 4, 'intra-abdominal cystic disease': 2, 'retroperitoneal cystic mass lesions': 1, 'Mesenteric and retroperitoneal lymphangioma': 1, 'Intra-Abdominal Cystic Lymphangioma': 1, 'Splenic ACL': 1, 'abdominal cystic Lymphangioma': 1, 'splenic ACL': 1, 'abdominal (retroperitoneal) lump': 1, 'abdominal/pelvic cystic malformations': 1, 'Cystic abdominal masses': 3, 'abdominal/retroperitoneal trauma': 1, 'abdominal aortic retroperitoneal and mesenteric AL amyloidoma': 1, 'Abdominal cystic masses': 2, 'retroperitoneal and intra-abdominal bleeding': 3, 'intra-abdominal or retroperitoneal lymphadenopathy': 1, 'abdominal and retroperitoneal disease': 5, 'abdominal and retroperitoneal lymph node enlargement': 1, 'Cystic abdominal mass': 1, 'abdominal and retroperitoneal bleeding': 2, 'Retroperitoneal and abdominal bleeding': 1, 'retroperitoneal and abdominal bleeding complications': 1, 'abdominal, bone and retroperitoneal lesions': 1, 'abdominal or retroperitoneal lymphadenopathy': 1, 'Giant Abdominal Lymphangiomas': 1, 'Giant retroperitoneal cystic mass': 1, 'abdominal mesenteric cystic lymphangioma': 1, 'ACLs': 2, 'intra-abdominal retroperitoneal lesions': 1, 'intra-abdominal (retroperitoneal) hematoma': 1, 'abdominal or retroperitoneal hemorrhage': 4, 'retroperitoneal perirenal lymphangioma': 1, 'abdominal and retroperitoneal arterial hemorrhage': 1, 'Abdominal Cystic Mass': 1, 'Cystic abdominal swelling': 1, 'retroperitoneal cystic infection': 1, 'Retroperitoneal abdominal masses': 1, 'intra-abdominal, hepatic, splenic, retroperitoneal and renal injuries': 1, 'retroperitoneal and splenic lymphangioma': 1, 'splenic and retroperitoneal lymphangiomas': 2, 'splenic and retroperitoneal lymphangioma': 1, 'retroperitoneal and abdominal adenopathies': 1, 'Abdominal Cystic-Like Lesion': 1, 'abdominal and retroperitoneal fatty masses': 1, 'Retroperitoneal and mediastinal cystic lymphangiomas': 1, 'retroperitoneal or abdominal lymphangiomas': 1, 'Retroperitoneal cystic schwannoma': 4, 'retroperitoneal cystic schwannoma': 2, 'retroperitoneal abdominal schwannoma': 1, 'NRS': 1, 'retroperitoneal and mesenteric cystic lymphangiomas': 1, 'abdominal and retroperitoneal mass lesions': 1, 'abdominal, pelvic, and retroperitoneal sarcomas': 1, 'Giant Retroperitoneal Lymphangioma': 2, 'intra-abdominal and retroperitoneal diseases': 1, 'primary retroperitoneal cystic serous adenomas': 1, "Abdominal and retroperitoneal Castleman's disease": 2, "abdominal and retroperitoneal Castleman's disease": 1, 'cystic abdominal lymphangioma': 1, 'cystic intra-abdominal mass': 2, 'retroperitoneal or intra-abdominal sarcoma': 1, 'abdominal CHD': 1, 'Abdominal cystic hydatid disease': 1, 'diffuse retroperitoneal lymphangioma': 1, 'pancreatic, gastric, intestinal, abdominal and retroperitoneal disease': 1, 'intra-abdominal or retroperitoneal hemorrhages': 1, 'abdominal and retroperitoneal lymphatic abnormalities': 1, 'abdominal and retroperitoneal': 2, 'Retroperitoneal Abdominal Mass': 1, 'Retroperitoneal Abdominal Mass.': 1, 'cystic RS': 1, 'retroperitoneal and genital lymphangioma': 1, 'Retroperitoneal and genital lymphangiomas': 1, 'Retroperitoneal and Genital Lymphangioma': 1, 'Retroperitoneal and genital lymphangioma': 1, 'intra-abdominal, retroperitoneal malignancy': 1, 'Intra-abdominal, Retroperitoneal Malignancy': 1, 'Intra-abdominal cystic masses': 1, 'abdominal cystic angiomatosis': 1, '-abdominal cystic masses': 2, 'Intra-abdominal or retroperitoneal lymphadenopathy': 1, 'intra-abdominal/retroperitoneal hemorrhage': 1, 'Retroperitoneal and intra-abdominal masses': 1, 'abdominal, and retroperitoneal bleeding': 1, 'retroperitoneal, abdominal, and mediastinal lymphadenopathy': 1, 'abdominal cystic diseases': 2, 'intra-abdominal or intestinal lymphangiomas': 1, 'intra-abdominal or intraluminal lymphangiomas': 1, 'Intra-abdominal and retroperitoneal disease': 1, 'retroperitoneal or colonic lymphangioma': 1, 'intra-abdominal and retroperitoneal disease': 4, 'intra-abdominal and pelvic cystic masses': 1, 'thoracic or abdominal cystic lesions': 1, 'retroperitoneal abdominal masses': 3, 'Abdominal and retroperitoneal masses': 1, 'retroperitoneal rupture of the cystic duct': 1, 'retroperitoneal Cystic Lymphangioma': 1, 'RIA': 1, 'intra-abdominal or retroperitoneal bleed': 1, 'abdominal or retroperitoneal disease': 2, 'CYSTOID LYMPHANGIOMA OF THE ABDOMINAL CAVITY': 1, 'intra-abdominal, retroperitoneal, or': 1, 'abdominal and/or retroperitoneal leiomyosarcoma': 1, 'abdominal/retroperitoneal leiomyosarcoma': 1, 'abdominal and/or retroperitoneal disease': 1, 'abdominal MCL': 1, 'retroperitoneal cystic leiomyosarcoma': 2, 'abdominal or retroperitoneal masses': 2, 'retroperitoneal and intra-abdominal sarcoma': 1, 'abdominal or retroperitoneal mass': 2, 'mediastinal, retroperitoneal and abdominal lymphadenopathies': 1, 'Cystic intra-abdominal masses': 1, 'intra-abdominal or retroperitoneal cysts': 1, 'abdominal/retroperitoneal lesions': 2, 'abdominal cystic textiloma': 1, 'Cystic abdominal lesions': 1, 'intra-abdominal and retroperitoneal sarcoma': 1, 'intra-abdominal or retroperitoneal sarcoma': 1, 'Abdominal retroperitoneal lymphadenopathy': 1, 'cystic retroperitoneal disease': 1, 'Congenital peritoneal and retroperitoneal lymphangiomas': 1, 'intra-abdominal/retroperitoneal bleeding': 1, 'cystic intra-abdominal masses': 2, 'Retroperitoneal and intra-abdominal sarcomas': 1, 'Retroperitoneal Cystic Mass': 1, 'cystic retroperitoneal mass': 2, 'retroperitoneal cystic-like lesion': 1, 'postoperative abdominal or retroperitoneal bleeding': 1, 'Abdominal or retroperitoneal hemorrhage': 1, 'Lymphangioma of the abdominal cavity': 1, 'Abdominal and retroperitoneal sarcomas': 1, 'Intra-abdominal and retroperitoneal masses': 1, 'RL': 1, 'thoracic or abdominal cystic mass': 1, 'Lymphangioma of the retroperitoneal space': 1, 'retroperitoneal or abdominal leiomyomas': 1, 'intra-abdominal/retroperitoneal disease': 1, 'RETROPERITONEAL LYMPHANGIOMA': 1, 'perinephric retroperitoneal lymphangioma': 1, 'Paravesical cystic retroperitoneal lymphangioma': 1, 'intra-abdominal CL': 2, 'abdominal-retroperitoneal disease': 2, 'intra-abdominal and retroperitoneal lesions': 2, 'MARSU': 1, 'abdominal multilocular lymphangioma cysticum': 1, 'Intra-abdominal mesenteric lymphangioma': 1, 'retroperitoneal cystic adenocarcinoma': 1, 'Retroperitoneal cystic metastasis': 1, 'retroperitoneal multilocular cystic lymphangioma': 1, 'intra-abdominal or retroperitoneal hematoma': 1, 'Multicystic retroperitoneal lymphangioma': 1, 'cystic degeneration of intra-abdominal testis': 1, 'retroperitoneal or/and abdominal bleeding': 1, 'Intra-abdominal Cystic Lymphangiomas': 1, 'inflammatory and cystic diseases of abdominal organs': 1, 'abdominal and cystic lesions': 1, 'thoracic and abdominal lymphangioma': 1, 'intra-abdominal/retroperitoneal hemorrhages': 3, 'cystic abdominal or pelvic lesions': 1, 'retroperitoneal or abdominal': 1, 'extra-abdominal lymphangioma': 1, 'axillary and intra-abdominal cystic lymphangioma': 1, 'intra-abdominal or retroperitoneal hematomas': 1, 'Intraabdominal and retroperitoneal lymphangioma': 1, 'retroperitoneal and intra-abdominal lymphadenopathy': 1, 'intra-abdominal and retroperitoneal myxoid sarcoma': 1, 'Retroperitoneal/abdominal': 1, 'abdominal retroperitoneal lump': 1, 'abdominal and retroperitoneal leiomyosarcomas': 1, 'RPC': 1, 'abdominal and retroperitoneal sarcomas': 2, 'abdominal LA': 1, 'intra-abdominal Cystic Lymphangioma': 1, 'Primary cystic retroperitoneal tumor': 1, 'abdominal and retroperitoneal metastasis': 1, 'abdominal and pelvic cystic lymphangioma': 1, 'pelvico-abdominal cystic lesions': 1, 'mediastinal, abdominal and retroperitoneal adenopathy': 1, 'Retroperitoneal cystic adenoma': 1, 'abdominal/retroperitoneal malignancies': 1, 'Retroperitoneal and pelvic cystic lymphangioma': 1, 'intra-abdominal and retroperitoneal bleeding': 1, 'intra-abdominal and retroperitoneal cystic lymphangiomatosis': 1, 'Omental, mesenteric and retroperitoneal cystic masses': 1, 'Giant retroperitoneal cystic lymphangioma': 1, 'Cystic retroperitoneal paraganglioma': 1, 'Abdominal Cystic Masses': 1, 'RETROPERITONEAL CYSTIC LYMPHANGIOMAS': 1, 'megacyst-abdominal cystic finding': 1, 'abdominal or retroperitoneal lesion': 2, 'retroperitoneal/ intra-abdominal sarcomas': 1, 'retroperitoneal pelvic cystic mass': 1, 'intra- abdominal cystic lesions': 1, 'cystic abdominal mass 2': 1, 'abdominal or retroperitoneal infection': 2, 'abdominal and retroperitoneal malignancies': 2, 'CYSTIC LYMPHANGIOMA OF THE RETROPERITONEAL ORIGIN': 1, 'colorectal, abdominal and retroperitoneal diseases': 1, 'Abdominal/pelvic cystic mass': 1, 'abdominal/pelvic cystic/mass': 1, 'ALs': 1, 'retroperitoneal cystic schwannomas': 1, 'abdominal lymphatic malformation- lymphangioma': 1, 'abdominal or retroperitoneal': 2, 'retroperitoneal or abdominal aortic paraganglioma': 1, 'Intra-abdominal and retroperitoneal bleeding': 1, 'Retroperitoneal and Abdominal': 1, 'abdominal, and retroperitoneal sarcoma': 1, 'Retroperitoneal Cystic Adenopecoma': 1, 'abdominal cystic lump': 1, 'benign intra-abdominal cystic masses': 1, 'pelvic, abdominal, and retroperitoneal malignancies': 1, 'retroperitoneal and abdominal lesion': 1, 'Lymphangiomas of the abdominal': 1, 'Intra-abdominal CL': 1, 'Retroperitoneal cystic metastases': 1, 'abdominal and retroperitoneal neurofibromas': 1, 'Cystic Abdominal Mass': 1, 'intra-abdominal and retroperitoneal hematomas': 1, 'abdominal or retroperitoneal metastasis': 1, 'abdominal and retroperitoneal haematomas': 1, 'abdominal or retroperitoneal space lesions': 1, 'retroperitoneal/intra-abdominal': 1, 'retroperitoneal abdominal mass condition': 1, 'retroperitoneal giant cyst lymphangioma': 1, 'Benign abdominal cystic tumors': 1, 'retroperitoneal cystic lymphagioma': 1, 'Retroperitoneal abdominal mass': 1, 'abdominal, retroperitoneal, or pelvic sarcomas': 1, 'abdominal/retroperitoneal sarcomas': 1, 'intra-abdominal cystic lymphatic malformations': 1, 'Retroperitoneal chylous lymphangioma': 1, 'abdominal and pelvic cystic masses': 1, 'Retroperitoneal cystic lymphangyoma': 1, 'Congenital Abdominal Cystic Lesions': 1, 'CACL': 1, 'Retroperitoneal cystic lymphagioma': 1, 'abdominal and retroperitoneal cavernous hemangioma': 1, 'retroperitoneal or intra-abdominal': 1, 'abdominal mesenteric lymphangiomas': 1, 'intra-abdominal lymphangioma leak': 1, 'Abdominal/Retroperitoneal Infection': 1, 'abdominal/retroperitoneal infection': 1, 'abdominal and retroperitoneal nocardiosis': 1, 'abdominal/retroperitoneal nocardiosis': 1, 'abdominal or retroperitoneal nocardiosis': 1, 'Abdominal cystic massHydroureter': 1, 'abdominal and retroperitoneal trauma': 1, 'abdominal/retroperitoneal lymphadenopathy': 1, 'Abdominal cystic lesion': 1, 'abdominal cystic LMs': 1, 'retroperitoneal and abdominal masses': 1, 'renal, intra-abdominal, and retroperitoneal organ injuries': 1, 'Infected abdominal cystic lymphangioma': 1, 'retroperitoneal multilocular lymphangioma': 1, 'Abdominal giant cystic lymphangioma': 1, 'abdominal and retroperitoneal malignancy': 1, 'Retroperitoneal cystic abdominal lymphangiomatosis': 1, 'benign retroperitoneal cystic lesions': 1, 'PRCL': 1, 'abdominal cystic disorder': 1, 'retroperitoneal or abdominal lymphadenopathy': 1}
|
retroperitoneal lymphangioma
|
Disease
|
MESH:C535554
|
{'neurological, respiratory, cardiac, abdominal, and metabolic disease': 1, 'Abdominal obesity metabolic syndrome': 5, 'abdominal obesity status (n, %) < 0.001 Metabolic healthy abdominal nonobese': 1, 'abdominal or metabolic diseases': 1, 'Abdominal obesity-metabolic syndrome': 3, 'abdominal obesity-metabolic syndrome': 6, 'abdominal (android) obesity': 2, 'metabolic, or abdominal diseases': 1, 'MUAO': 8, 'POTASSIUM METABOLISM AFTER SURGERY FOR ABDOMINAL DISEASES': 1, 'metabolic, abdominal, or thoracic disorders': 1, 'Abdominal Obesity metabolic syndrome': 1, 'Metabolic disorders and abdominal symptoms': 2, 'MUNAO': 1, 'metabolically unhealthy abdominal obesity': 3, 'MUHAO': 2, 'dys-metabolic abdominal obesity': 1, 'Metabolically unhealthy abdominal obese': 1, 'abdominal obese with metabolic syndrome': 1, 'Metabolic Syndrome Abdominal Obesity': 1, 'abdominal obesity metabolic syndrome': 5, 'Metabolically unhealthy abdominal obesity': 3, 'Abdominal Obesity and Metabolic Syndrome': 1, 'AOMS': 1, 'Abdominal Obesity - Metabolic Syndrome': 1, 'metabolic disorders and abdominal symptoms': 1}
|
MUAO
|
Disease
|
MESH:C535555
|
{'Aberrant Right Subclavian Artery': 20, 'ARSA': 200, 'aberrant right subclavian artery': 196, 'Aberrant right subclavian artery': 108, 'right subclavian artery aneurysm': 36, 'RSA': 49, 'ALSA': 47, 'right subclavian artery': 133, 'aberrant left subclavian artery': 31, 'aRHAs': 1, 'Aberrant right hepatic arteries': 2, 'aLHAs': 1, 'aberrant left hepatic arteries': 2, 'ARSA dissection': 2, 'right subclavian': 40, 'Aberrant left pulmonary artery and': 1, 'aberrant left pulmonary artery': 13, 'Right Subclavian Artery': 6, 'aberrant left hepatic artery': 14, 'Aberrant Left Hepatic Artery': 5, 'ALHA': 14, 'ALBCV': 3, 'aberrant left brachiocephalic vein': 3, 'Aberrant Left Brachiocephalic Vein': 1, 'ARHA': 7, 'Aberrant right hepatic artery': 4, 'right subclavian artery anomaly': 1, 'ASAs': 3, 'ASA': 18, 'AA': 1, 'left bundle aberrancy': 1, 'occlusion of the right subclavian artery': 30, 'aRSA': 5, 'aneurysmal dilation of aberrant subclavian arteries': 1, 'aneurysm of an aberrant subclavian artery': 2, 'right subclavian artery disease': 1, 'occlusion of aberrant right subclavian artery': 1, 'occlusion of an aberrant right subclavian artery': 1, 'occlusion of ALSA': 1, 'Aneurysm of anomalous right subclavian artery': 1, 'origin of the right subclavian artery': 2, 'aberrant bronchial artery': 2, 'Right subclavian arteria lusoria': 1, 'right subclavian arteria lusoria': 1, 'MANAGEMENT OF INTRAOPERATIVE AHA INJURY': 1, 'AHA': 5, 'AHA injury': 1, 'AHA injuries': 1, 'Aberrant hepatic artery': 6, 'right subclavian artery (arteria lusoria) aneurysm': 2, 'right subclavian artery occlusion': 3, 'occlusion of the right subclavian artery pulse': 1, 'left bundle aberration': 1, 'ARSCA': 16, 'retroesophageal right subclavian': 1, 'right subclavian (lusorian) artery to oesophagus fistula': 1, 'Aberrant subclavian artery (arteria lusoria)': 2, 'aberrant subclavian artery': 47, 'A. lusoria': 1, 'RAA-ALSCA': 1, 'congenital aberrant RSA': 1, 'AIA': 2, 'aberrant innominate artery': 4, 'right aberrant duct injury': 1, 'RETRO-ESOPHAGEAL RIGHT SUBCLAVIAN ARTERY': 1, 'Aneurysm of aberrant subclavian artery': 1, 'ARSA aneurysm': 12, 'occlusion of RSA': 1, 'ARSA lesion': 1, 'LCX abnormality': 1, 'A-RSA': 5, 'aberrant right pulmonary': 1, 'aberrant artery aneurysm': 1, 'Aberrant hepatic arteries': 3, 'aberrant subclavian arteries': 7, 'Acquired diseases of aberrant subclavian arteries': 1, 'right subclavian artery or': 1, 'of the right subclavian artery': 3, 'aberrant right hepatic artery': 20, 'left circumflex artery abnormality': 1, 'pseudoaneurysm of the right subclavian artery': 1, 'aberrant or replaced right hepatic artery': 1, 'Aberrant right subclavian artery Brachycephaly': 1, 'the ARSA': 1, 'hypoplastic aberrant left subclavian artery': 1, 'Aberrant Bronchial Artery': 1, 'anomalous right subclavian artery': 6, 'stenosis of aberrant right subclavian artery': 1, 'ALGV': 4, 'aberrant left gastric vein': 1, 'aneurysmatic ASCA': 1, 'Aneurysmatic ASCA': 1, 'ASCA occlusion': 1, 'ASCA': 8, 'Aberrant subclavian artery': 19, 'RIGHT SUBCLAVIAN ARTERY': 5, 'thrombosis of the right subclavian artery': 3, 'Defects of the aortic arch and right subclavian artery': 1, 'RSA:12': 1, 'Aberrant subclavian right artery': 1, 'aberrant splenic artery aneurysm': 3, 'occlusion of right SA': 1, 'Aberrant left pulmonary artery': 9, 'aneurysm of right subclavian artery': 5, 'retroesophageal right subclavian artery': 2, 'Retroesophageal right subclavian artery': 2, 'AcALCA': 1, 'ALCA': 1, 'aberrant right hepatic ducts': 1, 'isolated right subclavian artery': 2, 'occlusion of right subclavian artery': 5, 'ALHAs': 1, 'Aberrant left hepatic arterie': 1, 'malformations of the transverse aorta and right subclavian artery': 1, 'aRHA': 17, 'thrombosis of an aneurysmal right subclavian artery': 1, 'aberrant right subclavicular artery': 1, 'ARPHD': 2, 'Aneurysm of the right subclavian artery': 2, 'pseudoaneurysm of right subclavian artery': 6, 'of right subclavian artery': 1, 'Abberrant right subclavian artery': 1, 'Aneurysm of aberrant right subclavian artery': 1, 'Aneurysmal Aberrant Right': 1, 'aneurysmal aberrant right': 2, 'atherosclerotic occlusion of the right subclavian artery and': 1, 'RAA/aLSCA': 1, 'Right aortic arch with aberrant left subclavian artery': 1, 'Left renal vein aberrations': 1, 'right subclavian artery aneurysms': 5, 'AScA': 2, 'Aberrant right subclavian artery aneurysm': 2, 'Syphilitic aneurysm of the right subclavian artery': 1, 'Aneurysmal aberrant right subclavian artery': 1, 'aneurysmal aberrant right subclavian artery': 6, 'aneurysm of an aberrant right subclavian artery': 4, 'Aberrant R/subclavian artery': 1, 'aberrant R/subclavian artery': 1, 'aberrant radial artery': 1, 'RSCa': 1, 'rupture of the right subclavian artery': 3, 'aberrant right SA': 1, 'right subclavian artery (SA) aneurysm': 1, 'ASA complications': 1, 'aberrant right subclavian': 5, 'aneurysmal aberrant left': 1, 'Aberrant subclavian arteries': 2, 'aberrant right hepatic duct': 3, 'Aberrant Right Hepatic Duct': 1, 'abnormality of the right subclavian artery': 2, 'aberrant right subclavian artery (ARSA) aneurysm': 3, 'aberrant right subclavian artery (arteria lusoria) aneurysm': 1, 'anomaly of the right subclavian artery and vein transposition': 1, 'Right Subclavian': 3, 'right subclavian artery (SCA) aneurysm': 1, 'RSA.18': 1, 'RIGHT SUBCLAVIAN ARTERY PASSING BEHIND THE': 1, 'Aberrant origin of the subclavian artery': 1, 'RSCA': 10, 'aberrant right bronchus': 1, 'aneurysmal dilatation of right subclavian artery': 1, 'occlusion of anomalous right subclavian artery': 1, 'Aneurysmal aberrant right subclavian arteries': 1, 'Aneurysmal degeneration of aberrant right subclavian artery': 1, 'duplication of right subclavian artery': 1, 'AbBAs': 1, 'RSA with': 1, 'aneurysm of the aberrant right subclavian artery': 3, 'aberrant right subclavian artery syndrome': 3, 'Aberrant right subclavian artery syndrome': 3, 'congenital artery aberration': 1, 'arterial malformation of left aberrant subclavian artery': 1, 'aberrant subclavian artery aneurysms': 1, 'Right subclavian artery aneurysm': 3, 'aneurysms of the right subclavian artery': 1, 'dilated right subclavian artery': 1, 'Post-traumatic aneurysm of the right subclavian artery': 1, 'AORSA': 2, 'thrombosis of an anomalous right subclavian artery': 1, 'Aortic or subclavian aberrations': 1, 'aneurysm of aberrant right subclavian artery': 4, 'Right subclavian artery abnormalities': 1, 'traumatic injury to the right subclavian artery': 1, 'aSCA': 4, 'ALS': 1, 'Aberrant right hepatic': 1, 'aberrant right hepatic': 1, 'glomangiosarcoma of the right subclavian artery': 1, 'pseudoaneurysm of aberrant right subclavian artery': 1, 'subclavian abnormality': 2, 'ARSA aberrant right subclavian artery': 2, 'aneurysmal aberrant subclavian artery': 2, 'RE-RSA': 2, 'Lusoria artery or aberrant right subclavian artery': 1, 'aneurysm of the ALSA': 2, 'ALSA stenosis': 1, 'RAALS': 2, 'ALSA (': 1, 'anomaly of aberrant right subclavian artery': 1, 'AHAs': 1, 'aberrant hepatic arteries': 1, 'ABERRANT RIGHT SUBCLAVIAN ARTERY': 3, 'RSRA anomaly': 1, 'right subclavian retroesophageal artery': 1, 'RSRA': 1, 'malformation of the right subclavian artery': 1, 'arch with aberrant left subclavian artery': 1, 'Aberrant left pulmonary': 1, 'aberrant left pulmonary': 1, 'occlusion of the innominate and right subclavian artery': 1, 'aneurysm of aberrant left subclavian artery': 1, 'AARSA': 2, 'right subclavian arterial aneurysm': 2, 'right subclavian injury': 1, 'abnormal systemic artery to left lower lobe': 1, 'Abnormal systemic artery to the left lower lobe': 2, 'ASALLL': 1, 'abnormal systemic artery to the left lower lobe': 1, 'Aberrant Left Subclavian Artery': 4, 'aLSCA': 1, 'right subclavian artery injury': 1, 'aberrant artery embolization': 1, 'Blunt injury to the right subclavian artery': 1, 'anomaly of the right subclavian artery': 1, 'Left Aberrant Renal Artery': 1, 'and aberrant right subclavian artery aneurysms': 1, 'stenosis of ALSA': 1, 'right subclavian artery defects': 1, 'ALIA': 2, 'aberrant left innominate artery': 2, 'right subclavian aneurysm': 5, 'RAA-ALSA': 1, 'atherosclerotic aneurysm of the right subclavian artery': 1, 'Atherosclerotic aneurysm of the right subclavian artery': 1, 'Aberrant Subclavian Arteries': 1, 'RIGHT SUBCLAVIAN': 3, 'ARSA.In': 1, 'RSA pseudoaneurysms': 1, 'RSA pseudoaneurysm': 1, 'aberrant arterial aneurysm': 2, 'ARSA-esophageal fistula': 1, 'Aberrant left subclavian artery': 4, 'aneurysm of ASA': 1, 'aberrant subclavian artery (ASA': 1, 'hepatic arterial aberrations': 1, 'Aberrant innominate artery': 2, 'Aberrant Hepatic Artery': 1, 'thrombosis of aRHA': 1, 'aneurysm of the right subclavian artery': 9, 'Aberrant right subclavianartery': 1, 'aneurysm of aberrant subclavian artery': 1, 'atherosclerotic right subclavian artery aneurysm': 1, 'obstruction of the right subclavian vein': 1, 'aberrant subclavian aneurysms': 1, 'Aberrant Right Subclavian': 2, 'ARSA disease': 1, 'esophageal right subclavian artery': 1, 'retro-esophageal right subclavian artery': 1, 'ALSCA': 5, 'course of the right subclavian artery': 1, 'Left aberrant subclavian artery': 1, 'LASA': 1, 'RSA aneurysm': 2, 'right subclavian artery (RSA) aneurysm': 1, 'Congenital right subclavian artery aneurysm': 1, 'Aberrant right subclavian artery or arteria lusoria': 1, 'Ruptured aneurysm of an aberrant subclavian artery': 1, 'R-SCA': 1, 'Aberrant Subclavian Artery': 5, 'Aberrant left hepatic arteries': 1, 'Retroesophageal ARSA': 1, 'type V ARHD': 1, 'ARHD': 3, 'ARHD type V': 1, 'left anterior hemiblock aberration': 1, 'or anomalous right subclavian artery': 1, 'aberrant right subclavian artery and its': 1, 'the aberrant artery': 1, 'aberrant persistent median artery': 1, 'aberrant occipital artery': 1, 'aberrant right hepatic arteries': 1, 'aneurysm of aberrant splenic artery': 1, 'traumatic rupture of the right subclavian artery': 1, 'right subclavian artery fistula': 1, 'aberrant right coronary artery': 2, 'ARCA': 1, 'Aberrant Arterial Aneurysm': 1, 'SCV abnormality': 1, 'Aberrant right vertebral artery': 1, 'Right subclavian artery injury': 1, 'left abnormal subclavian artery': 1, 'Left abnormal subclavian artery': 1, 'aLSA': 1, 'proximal stenosis of ALSA': 1, 'ALSA aberrant left subclavian artery': 1, 'ASA aneurysms': 2, 'aneurysmal anomalous right subclavian artery': 1, 'thrombosis of the right subclavian artery and': 1, 'atresia of aberrant left subclavian artery': 1, 'ASA aneurysm': 2, 'obstruction of right subclavian artery': 1, 'aneurysm of the aberrant artery': 2, 'Aberrant right subclavian (Lusoria) artery': 1, 'broncho-arterial abnormality of left upper lobe': 1, 'broncho-arterial abnormalities of left upper lobe': 1, 'Broncho-arterial abnormalities of left upper lobe': 1, 'aberrant right subclavian arteries': 1, 'calcification of the RSA': 1, 'aberrant subclavian, aorta or aortic arch anomaly': 1, 'Traumatic rupture of the right subclavian artery': 1, 'aberrant circumflex artery': 1, 'pseudo-aneurysm of the right subclavian artery': 1, 'Pseudo-aneurysm of the right subclavian artery': 1, 'Right subclavian artery': 2, 'aSA': 2, 'ARSA) aneurysm': 1, 'Dysphagia of aberrant right subclavian artery': 1, 'Aberrant right hepatic duct': 1, 'ASA degeneration': 2, 'ASA with aneurysm': 1, 'Occlusion of the right subclavian artery': 1, 'aneurysmal aberrant RSA': 1, "RSA' aneurysm": 1, "aberrant RSA' aneurysm": 1, 'Aberrant Right Hepatic Artery': 2, 'Aberrant thyroidovertebral artery': 1, 'Aberrant left hepatic artery': 3, 'IV ARGV': 1, 'III ARGV': 1, 'type I and II ARGVs': 1, 'ARGVs': 1, 'type III ARGVs': 1, 'ARGV': 1, 'Syndrome of aberrant right subclavian artery': 1, 'ASA occlusion': 1, 'thrombotic occlusion of the right subclavian artery': 1, 'abLHA': 1, 'aberrant left renal artery': 1, 'ALSA occlusion': 1, 'aberrant left subclavian aneurysm': 1, 'aberrant left subclavian': 1, 'right SAA': 1, 'subclavian vein abnormality': 1, 'Aneurysm of the Aberrant Right Hepatic': 1, 'anomalous right subclavian arteries': 1, 'aLHA': 1, 'radial artery aberrations': 1, 'of aberrant subclavian arteries': 1, 'aneurysms of aberrant subclavian arteries': 1, 'ARSAA': 1, 'Arteriosclerotic aneurysm of anomalous right subclavian artery': 1, 'RSA injuries': 1, 'dilation of the right subclavian artery': 1, 'aberrant left coronary artery': 1, 'atresia of the right proximal subclavian artery': 1, 'right subclavian artery pseudoaneurysm': 1, 'RSAP': 1, 'ALSA aneurysm': 1, 'occlusion of the ARSCA': 1, 'fetal aberrant right subclavian artery': 3, 'Aberrant Right Subclavian Arteries': 1, 'aneurysmal aberrant artery': 1, 'traumatic right subclavian artery pseudoaneurysm': 1, 'Aberrant right subclavian': 1, 'ostial occlusion of right subclavian artery': 1, 'aberrant hepatic arterial anatomy-LPD': 1, 'hypoplasia of the right subclavian artery': 1, 'Aberrant left pulmonary artery and tracheo-bronchial abnormality': 1, 'Aberrant right subclavian artery (ARSA) aneurysms': 2, 'Dilated aberrant right subclavian artery': 1, 'dilated aberrant right subclavian artery': 1, 'Traumatic aneurysm of the right subclavian artery': 1, 'RAA-ALS': 1, 'Thrombosis of the right subclavian artery': 1, 'right subclavian artery-esophageal fistula': 2, 'rupture of right subclavian artery': 1, 'LAOA': 1, 'RAOA': 1, 'Isolation of the right subclavian artery': 1, 'Right Subclavian Artery Aneurysm': 1, 'ALBV': 2, 'Aberrant left brachiocephalic vein': 2, 'aberrant subclavian': 2, 'RERSC': 1, 'subclavian abnormalities': 2, 'Right subclavian aneurysm': 1, 'subclavian vascular abnormalities': 1, 'Aberrant right subclavian arteries': 1, 'right subclavian arteries': 1, 'Degenerative diseases of aberrant subclavian arteries': 1, 'abnormalities of the aorta and left subclavian artery': 1, 'Right subclavian': 1, 'aneurysmal dilatation of the aberrant right subclavian artery': 1, '-1 aberrant subclavian artery': 1, 'aberrant right subclavian artery aneurysm': 1, 'An aberrant subclavian artery': 1, 'aberrant hepatic artery': 2, 'Retroesophageal Aberrant Right': 1, 'ARSA anomaly': 1, 'Aberrant Right Subclavian Artery Syndrome': 1, 'ARSA condition': 1, 'RAA with aberrant left subclavian artery': 1, 'aberrant right subclavian artery (RSA) aneurysm': 1, 'Aneurysm of the Aberrant Artery': 1, 'right subclavian artery (ARSA) aneurysm': 1, 'celiaco-mesenteric arterial aberrations': 1, 'stenosis of the aberrant left subclavian artery': 1, 'RSCA aneurysm': 1, 'of the right subclavian vein': 1, 'aneurysmal aberrant subclavian arteries': 1, 'abnormalities of the left subclavian artery': 1, 'left subclavian artery abnormalities': 1, 'abnormal systemic artery to the left': 1, 'aberrant right posterior hepatic duct': 1, 'Aberrant right posterior hepatic duct': 1, 'Aberrant Subclavian Artery Disease': 1, 'of the right subclavian': 1, 'aberrant splenic artery': 1, 'Aberrant splenic artery': 1, 'Left aberrant pulmonary artery': 1, 'stria vascularis aberrant artery': 1, 'hypertrophic aberrant bronchial artery': 1, 'RERSA': 2, 'RSC': 1, 'ARSCA.3': 1, 'aneurysmal ARSA': 1, 'double aberrant left brachiocephalic vein': 1, 'LARS': 1, 'Congenital anomaly of the right subclavian artery': 1, 'ARSA outlet obstruction': 1, 'Aberrant Left Colic Artery': 1, 'Aberrant left pulmonary artery and tracheal abnormality': 1, 'Vertebral and right subclavian artery abnormalities': 1, 'thrombosis of an aberrant right subclavian artery': 1, 'isolated aberrant right subclavian artery': 1, 'Aberrant subclavian artery (arteria lusoria': 1, 'a-RHA': 1, 'occlusion of the RSCA': 1, 'Aberrant right subclavian artery aneurysms': 1, 'aberrant left vertebral artery': 1, 'ALVA': 1, 'aortic arch with aberrant right subclavian artery': 1, 'aortic arch with aberrant left subclavian artery': 1, 'LAARS': 1, 'ARSA B': 1}
|
ARSA
|
Disease
|
MESH:C535556
|
{'circumference': 1086, 'MGS': 3, 'CIRCUMFERENCE': 15, 'SCH': 4, 'OFC': 50, '-circumference': 4, 'SH': 4, 'TS': 32, 'circumference loss': 2, 'FS': 2, 'L5S': 1, 'SLOPE': 29, 'BC': 2, 'KC': 2, 'MSP': 2, 'MAC': 11, 'sloping loss': 10, 'TC': 19, 'SS': 24, 'SL': 3, 'LIGURIAN SLOPE': 1, 'SLOPES OF INTERSECTIONS': 1, 'NECK CIRCUMFERENCE': 1, 'sloping': 18, 'Shelf-Slope Front': 1, 'CF': 2, 'RC': 3, 'WOS': 1, 'PSD': 1, 'AS': 10, 'SUs': 2, 'GC': 4, 'SLOPE ARGUMENT': 1, 'landslide slope': 1, 'sloping roof dysplasia': 2, 'SCR': 1, 'SCI': 1, 'Slopen': 1, 'MS': 9, 'circumferences': 6, 'Girth circumference': 1, 'PLLS': 1, 'SE': 3, 'CS': 7, 'TVM': 1, 'ASC': 5, 'CCS': 2, 'SLOPES OF': 1, 'SC': 4, '-sloping': 2, 'Circumference': 7, 'SLOPES': 3, 'SR': 2, 'ski-slope': 1, 'of TS': 1, 'slope': 9, 'CD': 1, 'sloping losses': 1, 'SD': 2, '-SLOPE': 1, 'FC': 2, 'SlopeD': 1, 'DS': 4, 'TS curve oscillation': 1, 'occipitofrontal circumference': 1, 'DRY SLOPES': 1, 'ASF': 1, 'SLOPE DEF': 1, 'Gently sloping': 1, 'CLS': 1, 'thigh circumference': 1, 'PS': 3, 'CSI': 1, 'Slope Disaster': 1, 'slope disaster': 1, 'Slope disaster': 1, 'SLP': 1, 'circumference defects': 1, 'Slippery slope': 1, 'slippery slope': 3, 'ERS': 1, 'IS': 1, 'Sloping loss': 1, 'CID': 1, 'AC': 1, 'SB': 1, 'CRM': 1, 'Sc': 1, 'Slippery Slope': 1, 'CONTINENTAL SLOPES': 2, 'Sloping': 2, 'MSS': 1, 'circumference discrepancy': 1, 'DDSE': 1, 'SHSS': 1, ') circumference': 1, 'MCD': 2, 'WS': 1, 'PC': 1, 'SLOPES OF THE GASPE PENINSULA': 1, 'SLOPED PLANE': 1, 'MCS': 1, 'BBCSS': 1, 'CTHIGH': 1, 'SLOPEs': 1, 'MCDs': 1, 'circumference to': 1, 'LC': 1, 'ski-slope loss': 1, 'SPEC': 1, 'CRCs': 1, 'DCH': 1, 'sLOPE': 1, 'Occipitofrontal circumference': 1, 'CC- MAC': 1, 'CVD*Slope': 1, 'Abidi type X-linked mental retardation': 1, 'slope defects': 1, 'TLS': 1, 'SLOPE FALLACY': 1, 'SUS': 1, '-RR SLOPE': 1, 'Slippery Slope of': 1, 'SIM': 1, 'SIM deficiency': 1, 'SLPH': 1, 'GCS': 1, 'MSD': 1, 'decreased occipitofrontal circumference': 1, 'OCF': 1, 'SPS': 1, 'Slope': 1, 'One-Slope Path-Loss': 1, 'SSA': 1, 'SAM': 1, 'decreased cephalic circumference': 1, 'MTC': 1, 'LSL': 1, 'cam': 1, 'SHA': 1, 'SO': 1, 'SA': 2, 'CSD': 1, 'Sloped': 1, 'slope loss': 1, 'Sloped Leaf': 1, 'CIR': 1, 'UC': 1, 'SOPT': 1, 'GRSs': 1, 'SU': 1, 'Circ': 1, 'NS': 1, 'ThC': 1, 'T1S.': 1, 'T1S': 1}
|
circumference
|
Disease
|
MESH:C535557
|
{'ablepharon-macrostomia syndrome': 12, 'AMS': 1384, 'Ablepharon-macrostomia syndrome': 10, 'acute (AMS) disease': 1, 'ablepharon macrostamia syndrome': 1, 'Phe-AMS': 1, 'Val-AMS': 1, 'DDE-AMS': 1, 'AMS-II': 1, 'AMS-III': 1, 'AMS -II AMS -III AMS -IV': 1, 'AMS-I': 1, 'AMS -I': 1, 'AMS-IV': 1, 'AMS-MB-5-18': 1, 'Ablepharon-Macrostomia Syndrome': 5, 'AMS chronic condition': 1, 'AMS HTN': 3, 'AMS Ca': 1, 'AMS symptoms': 12, 'cellulitis AMS': 1, 'Pneumonia AMS': 1, 'ablepharon macrostomia syndrome': 16, 'AMS-C': 8, '-AMS': 1, 'Ablepharon-Macrostomia syndrome': 5, 'ablepharon': 9, 'Ablepharon macrostomia syndrome': 16, 'Bone AMS': 1, 'Joint/ligament AMS': 1, 'Tendon AMS': 1, 'Muscle AMS': 1, 'Ablepharon-Macrostomia': 1, 'AMS symptom': 2, 'Ablepharon Macrostomia Syndrome': 3, 'Ablepharon syndrome': 2, 'AMS 6': 1, 'Sal-AMS': 7, 'Blistering of AMS': 1, 'AMS 2': 4, 'I-AMS': 1, 'AMS-': 6, 'AMS-OA': 8, 'AMS AMS': 1, 'aa-AMS': 1, 'ablepharon-macrostomia': 1, 'ataxia AMS': 1, 'AMS - AHL': 1, 'Thripline-AMS': 1, 'AMS C': 1, 'VU-AMS': 4, 'Barber-Say and Ablepharon-macrostomia syndromes': 1, 'Barber-Say and Ablepharon-Macrostomia syndromes': 1, 'AMS [MIM': 1, 'Ile-AMS': 1, 'AMS II': 2, 'AMS I': 2, 'ENIGMA AMS-TBI': 1, 'PROGRESS-AMS': 1, 'ablepharon macrostomia': 3, 'AMS-P.': 1, 'AMS-P': 2, 'ToF-AMS': 1, 'AMS.Initial': 1, 'AMS-R': 2, 'AMS-R.': 1, 'AMS LIZ': 1, 'geriatric AMS': 1, 'Leu-AMS': 2, 'AMS 2019': 1, 'AMS instability': 1, 'AMS-S2': 1, 'AMS CKD': 1, 'congenital ablepharon': 1, 'Ablepharon Macrostomia': 3, 'AMS-symptoms': 1, 'AMS coletaram': 1, 'AMS thrombosis': 1, 'AMS-like': 1, 'Ablepharon macrostomia': 1, 'AMS acute MS': 1, 'seizure AMS': 1, 'AMS 1': 1, 'VHDL-AMS': 1, 'Kagithane AMS': 1, 'Esenler AMS': 1, 'Kadikoy AMS': 1, 'decreased speech AMS': 1, 'AMS-PE': 1, 'ABLEPHARON-MACROSTOMIA SYNDROME': 1, 'AMS HACE': 1, 'ablepharon deformities': 1, 'Barber-Say and ablepharon macrostomia syndromes': 1, 'gaze defect AMS': 1, 'AMS 11': 1, 'Ablepharon': 2, 'AMS stenosis': 2, 'AMS hyperplasia': 1, 'AMS-5': 1, 'AMS-N': 1, 'AMS-NP': 1, 'AMS Hydroflex': 1, 'AMS I III:1': 1, 'AMS 37': 1, 'U-AMS': 1, 'Ablepharon-macrostomia-like syndrome': 1, 'AMS Altered mental status': 1, 'AMS condition': 1, 'JFM AMS': 1, 'AMS seizure': 1, 'AMS Osterreich': 1, 'Remote AMS': 1, 'Seizure AMS Encephalopathy': 1, 'Neurologic AMS': 1, 'AMS-S': 1, 'AMS C5 fracture': 1, 'AMS HSV': 1, 'OSB-AMS': 1, 'AMS diarrhea': 1, 'AF AMS': 1, 'AMS acute multiple sclerosis': 1, 'Ablepharon-macrostomia': 1, 'AMS X X': 1, 'aborted microspores AMS': 1, 'CNS AMS HTN': 1, 'AMS-3': 1, 'AMS+': 1, 'AMS)': 1, 'DT-AMS': 1, 'AMS 91': 1, 'AMS aCL': 1, 'AMS Altered Mental Status': 1, 'AMS[OR': 1, 'Double Ablepharon': 1, 'Double Ablepharon (Congenital)': 1, 'AMS depression': 1, 'stenosis of the AMS': 1}
|
AMS
|
Disease
|
MESH:C535558
|
{'granulo-cytopenia': 2, "Abrikosoff's tumor": 8, 'granulation tumors': 8, 'DGCs': 35, 'Abrikosoff tumor': 4, "Abrikosov's tumor": 25, 'Polypoid granulation tissue tumor': 1, "Abrikosov's tumour": 3, "Abrikosov's tumor of the lobular": 1, "Abrikosoff's tumor of the esophagus": 2, 'JCV GCN': 2, 'JC Virus Granule Cell Neuronopathy': 2, 'type 2 GCP': 2, 'type-2 GCP (C': 1, 'type-2 GCP': 1, 'GCP type 2': 2, "Abrikosov's tumor)": 1, 'DGC': 14, 'granulated cell tumor': 1, 'DGCT': 1, "Abrikosov's tumor of the cheek bone": 1, 'Abrikosov tumor': 6, 'SG tumors': 9, "Abrikosov's tumor of the esophagus": 2, 'Abrikosov': 3, 'Tumor of granulous cells': 1, 'granulation tumor': 3, 'Hepatic granulo-chromatosis': 1, 'Abrikosov-tumor of the esophagus': 1, "Abrikosov's tumor of the vagina": 1, 'granule cell tumor': 1, 'granule cell hypoplasia of the': 1, 'Abrikosoff tumor 6': 1, 'granulation cell tumor': 1, "Abrikosoff's tumours": 1, 'AT': 1, 'Malignant granulated-cell tumor of the skin': 1, '-granulated tumors': 1, 'Granulo-matosis with': 1, 'Granulo-matosis': 1, 'granulo-fibromatous lesions': 1, 'DGC defects': 1, "Endobronchial Abrikosov's tumor": 1, 'granulous tumor-': 1, "Abrikosoff's tumour": 2, 'hippocampal granule cell hypoplasia': 4, 'Abrikosov tumor) of the': 1, 'granulo-matosis': 2, "Multiple painful Abrikosov's tumors of the skin and mucosa": 1, "Abrikosov's tumors": 2, "Abrikosoff's tumor of the soft palate": 1, "Abrikosov's tumor of the vulva": 1, 'Abrikosov tumor of the esophagus': 1, 'Granulo-cellular myoblastoma': 1, 'DGCL': 2, 'DGC degeneration': 3, "Giant Abrikosov's tumor": 1, 'Granulation tumor': 2, 'JC virus granule cell neuronopathy': 1, "Abrikosov's": 1, 'hypoplasia of GCs': 1, "Abrikosov's tumor in the": 1, 'Granulo': 3, "Abrikosov's tumor of the tongue": 2, 'GRANULO': 1, 'SG) tumors': 1, 'ulcero-granulating tumor': 2, 'hypoplasia of DGCs': 1, "Abrikosoff's Tumor": 1, 'AVRAM': 1, 'AV': 2, 'granulo matosis': 1, 'Abrikosov tumor of the larynx': 2, "Abrikosov's tumor of the larynx": 3, "Abrikosov's tumor) of the esophagus": 1, 'granulated tumors': 1, "Abrikosov's myoblastoma": 1, 'GCP-like tumor': 1, "Abrikosoff's granulous cell tumor": 1, 'malignant Abrikosoff tumor': 1, 'granulo-cellular tumor': 1, 'granulous tumor': 1, 'granulation tumors of the': 1, "granulosa cell tumor of the oral cavity (Abrikosoff's myoblastoma)": 1, "Abrikosov's tumor of the skin": 2, "Esophageal Abrikosov's tumor": 1, 'Abrikosoff-tumors': 1, 'Abrikosoff tumors': 1, "granular-cell Abrikosov's tumours": 1, "Abrikosov's tumor of the oesophagus": 1, 'MALIGNANCY OF SO-CALLED ABRIKOSOV': 1, "Abrikosov's tumor of the scalp": 1, 'SG tumor': 1, 'granulos de lipofuscina': 1, 'DGC-L': 1, 'Abrikosov tumour': 1, 'Granulo$': 1, 'Granulation tumor of the right': 1, 'Gastric Abrikosoff tumor': 1, 'Dentate Granule Cell': 1, 'Granulous cell tumors': 1, 'granulo-': 1, 'ALEKSEI IVANOVICH ABRIKOSOV': 1, 'hypoplasia of granule cells': 1, 'fascia dentata granule cell hypoplasia': 1}
|
DGCs
|
Disease
|
MESH:C535559
|
{'CHARGE-like symptoms': 3, 'CHARGE-like condition': 1, 'CHARGE-like anomalies': 3, 'Aber disease': 6, 'chromosomal aberation': 3, 'X-linked-like syndrome': 4, 'CML III-X': 1, 'X-liked': 2, 'Abruzzo-Erickson syndrome': 7, 'Abruzzo': 1, 'CHARGE-like': 7, 'ADENOCARCINOMA OF ABERANT': 1, 'X-linked-like disorder': 1, 'X-Linked-Like Disorder': 1, 'vascular aberations': 1, 'ERICKSON': 1, 'nerve aberations': 1, 'Abruzzi-Erickson syndrome': 1, 'X-linked CHARGE-': 1, 'X-linked, CHARGE-like Abruzzo-Erickson syndrome': 1, 'Lens aberations': 1, 'aber fruhestens': 1, 'CHARGE-like phenotype': 1, 'OCT-TENG': 1, 'X chromosome structural aberation': 1, 'Syracuse and Abers': 1, 'Abruzzo-Erickson Coloboma': 1, 'Altersgruppe aber': 1, 'CHARGE-like diseases': 1, 'chromosomal aberations': 2, 'CHARGE-like syndrome': 2, 'CHARGE like syndrome': 1, 'Teil aber': 1, 'Fall aber mindestens': 1, 'biliary aberancies': 1, 'niedriger - aber hoher': 1, 'IPEX-like syndrome': 2, 'IPEX-Like Syndrome': 1, "Erickson's hypnosis": 1, 'Erickson and Ericksonian hypnosis': 1, 'Mortalitatsrate aber weiterhin': 1, 'Aber Disease': 1, '- aber besser hinaus': 1, 'Behandlung aber': 1, 'CHARGE like': 1, 'Erysipel - aber': 1, 'Aber warum': 1, 'CHARGE-like malformation syndrome': 1, 'CHARGE syndrome-like malformation syndrome': 1, 'AF': 1, 'Cover and Aber': 1, 'Abruzzo-Erikson syndrome': 1, 'T.aber': 1}
|
Abruzzo-Erickson syndrome
|
Disease
|
MESH:C535561
|
{'gluteal muscle metastasis': 7, 'gluteal muscle contractions': 1, 'Gluteal Muscle -A': 1, 'gluteal muscle insufficiency': 6, 'gluteal muscle wasting': 3, 'calcification of the gluteal muscles': 1, 'Atrophy of gluteal muscles 2': 1, 'gluteal muscle fibrosis': 3, 'absence of the inferior gluteal nerve': 1, 'gluteal muscle tear or': 1, 'gluteal muscle tear': 1, 'left gluteal muscle tear': 1, 'necrosis of gluteal muscles': 1, 'gluteal muscle degeneration': 2, 'loss of gluteal muscles': 2, 'gluteal muscle mass': 2, 'gluteal muscle loss': 1, 'gluteal muscle dysfunction': 5, 'gluteal muscle damage': 6, 'gluteal muscle necrosis': 34, 'gluteal muscle paralysis': 1, 'atrophic gluteal muscle': 1, 'Gluteal muscle necrosis': 4, 'paralysed gluteal muscles': 1, 'Gluteal muscle tear': 1, 'gluteal muscle metastases': 2, 'tear of the gluteal muscle': 1, 'gluteal muscle ischemia': 2, 'gluteal muscle and fascia fiber degeneration': 1, 'gluteal muscle abscess': 4, 'gluteal muscle fatty degeneration': 2, 'fatty degeneration of gluteal muscle': 1, 'Congenital absence of gluteal muscles': 2, 'gluteal muscle syndrome': 1, 'Primary lymphoma of the gluteal muscle': 1, 'gluteal skin and muscle necrosis': 2, 'gluteal muscle and skin necrosis': 2, 'gluteal muscle fatigue': 1, 'gluteal muscle myonecrosis': 1, 'fibrous degeneration of gluteal muscle': 1, 'Gluteal muscle discomfort': 1, 'gluteal and occipital congenital nevi': 1, 'Gluteal muscle fibrosis': 1, 'gluteal skin and muscle damage': 1, 'Gluteal muscle damage': 2, 'swelling of the gluteal muscle': 1, 'gluteal muscles': 1, 'fibrotic disease of gluteal muscle': 1, 'gluteal muscle scarring': 1, 'gluteal muscle compression': 2, 'congenital gluteal mass': 1, 'insufficiency of the gluteal muscle': 1, 'Fibrosis of the gluteal muscles': 1, 'gluteal muscle spasm': 1, 'abnormalities of gluteal muscles': 1, 'gluteal muscle injection abscess': 1, 'gluteal muscle tendinopathies': 1, 'gluteal muscle swelling': 1, 'gluteal muscle inflammation': 1, 'Gluteal muscle insufficiency': 1, 'Abscess of the gluteal muscle': 1, 'gluteal muscle or pelvic skin necrosis': 1, 'insufficiency of the gluteal muscles': 2, 'Gluteal muscle dysfunction': 2, 'Gluteal Muscle Necrosis': 1, 'Paresthesia of gluteal muscles': 1, 'congenital absence of gluteal muscles': 1, 'postoperative insufficiency of the gluteal muscles': 1, 'gluteal medius and/or minimus muscle tears': 1, 'GL': 1, 'gluteal muscle trauma': 2, 'gluteal muscles deficit': 1, 'gluteal muscle tumor': 1, 'injury of gluteal muscle': 1, 'paralysis of the gluteal muscles': 1, 'hypoplasia of the gluteal muscles': 1, 'hypoplasia of ipsilateral gluteal muscles': 1, 'hypoplasia of gluteal muscles': 1, 'hypoplasia of ipsilateral (left) gluteal muscles': 1, 'gluteal maximus muscle': 1, 'Hypoplasia of Gluteal Muscles': 1, 'hypoplastic left gluteal muscles': 1, 'gluteal muscles hypoplasia': 1, 'gluteal muscle crush-injury': 1, 'Pyogenic abscess of the gluteal muscle': 1, 'paralysis of munimus & medius gluteal muscles': 1, 'gluteal muscle': 1, 'gluteal muscle injection': 1, 'gluteal muscle deficits': 1, 'gluteal muscle myositis and': 1, 'gluteal muscle claudication': 1, 'ischemia of gluteal muscles': 1, 'gluteal muscle contraction': 2, 'necrosis of the gluteal muscle': 1, 'fatty degeneration of gluteal muscles': 1, 'GLUTEAL MUSCLES': 1, 'tendinopathy of gluteal muscles': 1, 'superior gluteal nerve and gluteus medius muscle injury': 1, 'epaxial and gluteal muscle wasting': 1, 'GLUTEAL MUSCLE INSUFFICIENCY': 1, 'overuse of gluteal muscles': 1, 'gluteal muscle dystrophy': 1, 'gluteal muscle contracture2': 1, 'insufficiency of gluteal muscles': 1, 'Pelvic cavity Gluteal muscle': 1, 'tendinosis of the gluteal muscles': 1, 'Gluteal muscle metastasis': 1}
|
gluteal muscle necrosis
|
Disease
|
MESH:C535562
|
{'absence of septum pellucidum': 44, 'absent septum pellucidum': 117, 'septum pellucidum': 314, 'agenesis of septum pellucidum': 32, 'absence or hypoplasia of the septum pellucidum and/or corpus callosum': 1, 'Septum pellucidum': 34, 'agenesis of the septum pellucidum': 86, 'the septum pellucidum': 13, 'absence of the septum pellucidum': 109, 'cavum septum pellucidum': 488, 'abnormal septum pellucidum': 8, 'pellucidum': 93, 'cavum pellucidum': 6, 'agenesis of the septum pellucidum or corpus callosum': 2, 'germinoma in the septum pellucidum': 1, 'agenesis or hypo genesis of the septum pellucidum': 1, 'Cysts of the septum pellucidum': 5, 'Cavum septum pellucidum': 75, 'septum pellucidum abnormalities': 12, 'of the septum pellucidum': 15, 'defects of septum pellucidum': 1, 'cyst of the septum pellucidum': 30, 'anomalies of the septum pellucidum or corpus callosum': 1, 'Cyst of the septum pellucidum': 4, 'Dilated cavum septum pellucidum': 1, 'dilated cavum septum pellucidum': 2, 'agenesis of the septum pellucidum and': 5, 'dysgenesis of the septum pellucidum': 8, 'agenesis or dysgenesis of septum pellucidum': 1, 'septum pellucidum leaflet abnormalities': 1, 'abnormality of the septum pellucidum': 2, 'disruption of the septum pellucidum': 1, 'Septum Pellucidum Leaflet Abnormalities': 1, 'defect in the septum pellucidum': 1, 'developmental abnormality of the septum pellucidum': 1, 'CSP': 124, 'Abscess of the Cavum Septum Pellucidum': 1, 'cavum of septum pellucidum': 4, 'ASP.10': 1, 'ASP': 6, 'absence of SP': 1, 'agenesis of the SP': 3, 'abnormalities of the septum pellucidum': 20, 'tumors of the septum pellucidum': 4, 'cavum septum pellucidum cyst': 8, 'cavum septum pellucidum cysts': 2, 'cavum septum pellucidum and vergae': 4, 'dilated cyst of the CSP': 1, 'Absent Septum Pellucidum': 3, 'cavum septum pellucidum agenesis': 1, 'SEPTUM PELLUCIDUM': 6, 'absence of ventricular septum': 1, 'atrophic septum pellucidum': 1, 'choriocarcinoma of the septum pellucidum': 1, 'Choriocarcinoma of the septum pellucidum': 1, 'absence of cavum septum pellucidum': 1, 'Cavum Septum Pellucidum': 25, 'absence of the corpus callosum and septum pellucidum': 1, 'enlargement of the septum pellucidum': 1, 'agenesis of septum pellucidum or corpus callosum': 2, 'septum cavum pellucidum': 5, 'deficiency of the septum pellucidum': 3, 'edema of the septum pellucidum': 1, 'septum pellucidum cyst': 39, 'septum pellucidum agenesis': 18, 'cavernous angioma in the septum pellucidum': 1, 'dysembryoplastic neuroepithelial tumor of the septum pellucidum': 1, 'intraventricular dysembryoplastic neuroepithelial tumor of the septum pellucidum': 1, 'cyst of the cavum pellucidum and': 1, 'CSP.Boxer': 1, 'absence of the septum pellucidumBoxer 2': 1, 'Cavum septum pellucidums': 1, 'disorders of the cavum septum pellucidum': 1, 'septum pellucidum cavum': 4, 'Septum Pellucidum': 17, 'dysplastic septum pellucidum': 2, 'malformations of the septum pellucidum': 2, 'Abnormalities of the septum pellucidum': 2, 'agenesis of the corpus callosum and septum pellucidum': 9, 'cyst in the septum pellucidum': 3, 'neoplasm of the septum pellucidum': 1, 'Septum pellucidum Headaches': 1, 'absent cavum pellucidum': 1, 'absence of the cavum septum pellucidum': 2, 'Septum Pellucidum Agenesis': 2, 'SPA': 2, 'absence/hypoplasia of the primary septum': 1, 'tumors of the septum pellucidum and lateral ventricle': 1, 'absence of the atrial septum': 7, 'of septum pellucidum': 11, 'Cavum septum pellucidum cysts': 3, 'Agenesis of the septum pellucidum': 2, 'septal pellucidum lesions or': 1, 'Pellucidum Agenesis': 1, 'structural abnormalities of septum pellucidum': 1, 'agenesis of her septum pellucidum': 1, 'widened cavum septum pellucidum': 1, 'myxoid glioneuronal tumor of the septum pellucidum and lateral ventricle': 2, 'septum pellucidum DNT': 1, 'Agenesis of septum pellucidum': 1, 'Agenesis of Septum Pellucidum': 1, 'tumor of the septum pellucidum': 4, 'subependymoma of the septum pellucidum': 3, 'Epithelioid angiosarcoma of the septum pellucidum': 1, 'Pellucidum': 12, 'abnormalities in septum pellucidum and': 1, 'rudimentary septum pellucidum': 1, 'deficient septum pellucidum': 1, 'cave of the septum pellucidum': 1, 'septum pellucidum cyste': 2, 'CSP bleeding': 1, 'hemorrhage of septum pellucidum': 1, 'subependymomas of septum pellucidum': 1, 'Cavum septum pellucidum hemorrhage': 1, 'septum pellucidum hemorrhage': 2, 'corpus callosum and septum pellucidum hemorrhage': 1, 'Hemorrhagic lesions of the septum pellucidum': 1, 'CSP hemorrhage': 1, 'Intact septum pellucidum': 1, 'Absence of the septum pellucidum': 11, 'SP': 12, 'malformations involving the septum pellucidum': 1, 'cavum septi pellucidum': 3, 'traumatic lesions of the septum pellucidum': 2, 'missing septum pellucidum': 3, 'cavum Septum Pellucidum': 1, 'cavum of the septum pellucidum': 10, 'cavum of the spectrum pellucidum': 1, 'cyst of cavum septum pellucidum': 3, 'absence of the septum with porencephaly': 1, 'developmental defect of the septum pellucidum': 1, 'septum pellucidum mass': 1, 'septum pellucidum cysts': 15, 'Subependymoma of the Septum Pellucidum': 1, 'septum pellucidum SE': 1, 'Cavities in the septum pellucidum': 2, 'optic nerve and septum pellucidum dysgenesis': 1, 'septum pellucidum dysgenesis': 1, 'septum pellucidum (SP) agenesis': 1, 'SP cyst': 1, 'SP abnormalities': 1, 'tumors of septum pellucidum and of fornix cerebri': 1, 'hypoplasia/absence of the septum pellucidum': 1, 'septum pellucidum anomalies': 6, 'cavernoma of the septum pellucidum': 2, 'adult pilocytic astrocytoma of the septum pellucidum': 1, 'Septum pellucidum cyst': 3, 'septum Pellucidum cyst': 1, 'aplasia of the septum pellucidum': 4, 'dysgenesis of septum pellucidum': 1, 'Septum pellucidum abnormalities': 1, 'abnormalities in the septum pellucidum': 2, 'neoplasms of the septum pellucidum': 2, 'SPC syndrome': 1, 'Septum Pellucidum Cyst': 2, 'SPC': 2, 'underdeveloped septum pellucidum': 1, 'septum pellucidum displacement': 2, 'cyst in the cavum septum pellucidum': 1, 'cysts of the SP': 1, 'septum pellucidum (SP) anomalies': 1, 'absence or hypoplasia of the septum pellucidum': 2, 'hypoplastic septum pellucidum': 1, 'Cysticercosis of the septum pellucidum region of the brain': 1, 'cyst septum pellucidum': 1, 'absence of septum nasi': 1, 'Tumors of the septum pellucidum': 7, 'staphyloma pellucidum': 1, 'cysts of the septum pellucidum': 17, 'destruction of septum pellucidum': 1, 'cavum septum pellucidum (': 1, 'CSP anomalies': 1, 'CC & CSP anomalies': 1, 'CSP) anomalies': 1, 'Giant cyst of the septum pellucidum': 1, 'Septum pellucidum cysts': 3, 'septum pellucidum tumors': 2, 'a septum pellucidum': 1, 'absence of the atrioventricular component of the membranous septum': 1, 'agenesis or abnormalities of the corpus callosum and septum pellucidum': 1, 'Congenital absence of the septum pellucidum': 4, 'cavum septum pellucidum et vergae': 10, 'absent third ventricle and septum pellucidum': 1, 'cysts of the cavum pellucidum and interpositum': 1, 'calcification of the septum pellucidum': 1, 'atrophy of the cavum septum pellucidum': 1, 'glioneuronal tumor of the septum pellucidum': 2, 'disorders of the septum pellucidum and the vault': 1, 'Disorder of the septum pellucidum and the': 1, 'disorders of the septum pellucidum and the': 1, 'ORTHOTRICHUM PELLUCIDUM Lindb': 1, 'Orthotrichum pellucidum Lindb': 1, 'O. pellucidum': 1, 'Cavum Septum Pellucidum (CSP) cysts': 1, 'absent cavum septum pellucidum': 1, 'septum pellucidum defect': 2, 'Callosal and septum pellucidum lesions': 1, 'absence of the septum': 4, 'septum pellucidum colloid cyst': 1, 'dilation of the cavum septum pellucidum': 2, 'Closed-lip schizencephaly with the absence of the septum pellucidum': 1, 'Absent septum pellucidum': 6, 'CSP enlargement': 2, 'CSP abnormality': 1, 'absent/hypoplastic corpus callosum and septum pellucidum': 1, 'giant cyst of the septum pellucidum': 1, 'agenesis of the corpus callosum and/or septum pellucidum': 1, 'dysgenesis of the previously developed septum pellucidum': 1, 'septum pellucidum cavities': 1, 'Colloid cysts of the septum pellucidum': 1, 'cavum septum pellucidum colloid cyst': 1, 'Primary tumors of the septum pellucidum': 1, 'absence of interatrial septum': 3, 'anomalies of the septum pellucidum': 4, 'corpus callosum and septum pellucidum anomalies': 1, 'Anomalies of the corpus callosum and the septum pellucidum': 1, 'septum pellucidum tumor': 2, 'cavum) septum pellucidum': 1, 'disrupted septum pellucidum': 1, 'absence of an interatrial septum': 1, 'aplasia or hypoplasia of septum pellucidum': 1, 'agenesis of the septum pellucidum and corpus callosum': 5, 'agenesis or hypoplasia of septum pellucidum and/or corpus callosum': 1, 'Septum ependymoma pellucidum': 1, 'enlargement of the cavum septum pellucidum': 2, 'hydrops of the septum pellucidum': 1, 'Septum pellucidum aplasia': 1, 'cave of septum pellucidum': 1, 'hypoplasia of the septum pellucidum': 1, 'abscess of cavum septum pellucidum': 1, 'pathologic cyst in the septum pellucidum': 1, 'defect of septum pellucidum': 1, 'septum pellucidum dysplasia': 3, 'dysgenesis of septum pellucidum and': 2, 'agenesis/hypoplasia of septum pellucidum and/or corpus callosum': 2, 'rupture of the septum pellucidum': 1, 'absence of the fetal septum pellucidum': 1, 'Cavity of the septum pellucidum': 1, 'dysmorphic corpus callosum and septum pellucidum': 1, 'cavum septum pellucidum.5': 1, 'CAVUM SEPTUM PELLUCIDUM': 1, 'malformation of the septum pellucidum': 3, 'Cleft cavum of the septum pellucidum': 1, 'ECSP': 1, 'Cyst of the Septum Pellucidum': 1, 'Cavum of septum pellucidum': 1, 'cyst of septum pellucidum': 3, 'Tumours of the septum pellucidum': 1, 'tumour of the SP': 1, 'septum pellucidum agenesia': 1, 'agenesis of the corpus callosum, fornix and septum pellucidum': 1, 'partial absence of the septum pellucidum': 1, 'agenesis of corpus callosum and septum pellucidum': 2, 'Agenesis of corpus callosum and septum pellucidum': 1, 'ependymal cysts of the septum pellucidum': 1, 'hypoplasia of the cerebellum, corpus callosum, septum pellucidum, and brainstem': 1, 'cysts of the cavum septum pellucidum': 3, 'Subependymoma of septum pellucidum': 1, 'DCSP': 1, 'Absence of septum pellucidum': 2, 'absence or hypoplasia of the septum pellucidum and corpus callosum': 1, 'absence of the IAS': 1, 'giant cell astrocytoma of the septum pellucidum': 1, 'Congenital agenesis of septum pellucidum with ectrodactyly': 1, 'septum pellucidum cavernoma': 2, 'Septum Pellucidum Cavernoma': 1, 'cavum septum pellucidum of the': 1, 'corpus callosum or septum pellucidum agenesis': 1, 'corpus callosum and septum pellucidum agenesis': 2, 'defect of the septum pellucidum': 1, 'Defect of septum pellucidum': 2, 'CSP cyst': 3, 'CSP cysts': 4, 'Septum pellucidum cavum vergae cyst': 1, 'septum pellucidum cavum vergae cyst': 1, 'absence of the septum lucidum': 1, 'Brain septum pellucidum abnormalities': 1, 'cavum septum vergae/pellucidum': 1, 'brain septum pellucidum abnormalities': 1, 'hypoplastic cavum septum pellucidum': 2, 'congenital absence of ventricular septum': 1, 'Endodermal cyst of septum pellucidum': 1, 'enlarged cavum septum pellucidum': 3, 'cavum septum pellucidum abnormalities': 2, 'Growing septum pellucidum cyst': 1, 'SPT': 1, 'enlarged cerebral ventricles and septum pellucidum': 1, 'Cavum septum pellucidum cyst': 1, 'Cavum septum pellucidum (CSP) cysts': 2, 'Neoplasms of septum pellucidum': 1, 'oligodendroglioma of the septum pellucidum': 1, 'Septum pellucidum oligodendroglioma': 1, 'septum pellucidum agenesis or dysgenesis': 1, 'Septum pellucidum agenesis or dysgenesis': 1, 'DNT-like tumor of the septum pellucidum': 1, 'width of the CSP': 1, 'absent CSP': 1, 'agenesis of the septum pellucidum and/or corpus callosum': 1, 'Cavum septum pellucidum Dysgenesis of the corpus collosum': 1, 'dysgenesis or absence of the septum pellucidum': 1, 'arteriovenous malformation (AVM) of septum pellucidum': 2, 'Astrocytoma of the septum pellucidum': 1, 'septum pellucidum fenestration': 1, 'DNT of the septum pellucidum': 1, 'Subependymoma of the septum pellucidum': 4, 'septum pellucidum et': 1, 'septum pellucidum deviation': 2, 'septum pellucidum hypoplasia': 2, 'cavum septi pellucidum cyst': 1, 'Cavernous Angioma of the Septum Pellucidum': 1, 'Cavernoma of the septum pellucidum': 1, 'septum pellucidum cavernomas': 1, 'agenesis of septum pellucidum and corpus callosum': 3, 'CSP with': 1, 'septum pellucidum defects': 3, 'agenesis of the cavum septum pellucidum': 1, 'perforation of the septum pellucidum': 2, 'cavum septum pellucidum and': 2, 'CSP et': 1, 'Absence of the corpus callosum and septum pellucidum': 1, 'giant tumor of the septum pellucidum': 1, 'cavum septum pellucidum et': 3, 'Empyema of the septum pellucidum': 1, 'hypoplasia of corpus callosum and septum pellucidum': 1, 'hypoplasia of the corpus callosum and septum pellucidum': 1, 'absence of septum lucidum': 2, 'cavity of septum pellucidum': 1, 'septum pellucidum hianya': 1, 'hypoplasia or absence of the corpus callosum or septum pellucidum': 1, 'atrophy of the septum pellucidum': 2, 'Abscess of cavum septum pellucidum': 1, 'Cavum Septum Pellucidum Cyst': 1, 'cysts of CSP': 1, 'septum pellucidum lesions': 1, 'Cavum septum pellucidum (CSP) cyst': 1, 'cyst of the cavum septum pellucidum': 2, 'septum pellucidum gangliogliomas': 1, 'glioma in septum pellucidum': 1, 'colloid cyst of the septum pellucidum': 1, 'Cavum of the septum pellucidum': 1, 'abnormalities of septum pellucidum/corpus callosum': 1, 'dysplasia of the septum pellucidum': 2, 'Dysplasia of the septum pellucidum': 1, 'aplasia of anterior septum pellucidum': 1, 'double septum pellucidum': 1, 'doubling septum pellucidum': 1, 'Doubling septum pellucidum': 1, 'absence of the aortopulmonary septum': 1, 'absent of septum pellucidum': 1, 'CONGENITAL DILATATIONS OF THE SEPTUM PELLUCIDUM': 1, 'Malformations of the septum pellucidum': 1, 'septum pellucidum absence': 1, 'noncommunicating cyst of the septum pellucidum': 1, 'Cavum septum pellucidum cavum vergae': 1, 'pilocytic astrocytoma of the septum pellucidum': 1, 'dysgenesia of the septum pellucidum': 1, 'cysts in the septum pellucidum or pineal gland': 1, 'Cysticercotic cyst of the septum pellucidum': 1, 'absence of septum': 2, 'CSP dilation': 1, 'Septim pellucidum': 1, 'optic nerve and septum pellucidum abnormalities': 1, 'Septum pellucidum agenesis': 3, 'absent septum pellucidum with': 1, 'Congenital agenesis of septum pellucidum': 1, 'Arteriovenous malformation of septum pellucidum': 1, 'cavus septum pellucidum': 2, 'agenesia of septum pellucidum': 1, 'cavum septum pellucidum dilation': 1, 'damage to the septum pellucidum': 1, 'CaSP': 1, 'PELLUCIDUM': 1, 'abnormality of septum pellucidum': 1, 'CSP cavum septum pellucidum': 2, 'Dichodontium pellucidum': 2, 'cavum septum pellucidum et vergae malformation': 1, 'CSPV': 1, 'cavum septum pellucidum epidermoids': 1, 'septum pellucidum CV': 1, 'CVs of the septum pellucidum': 1, 'Cavernoma of the Septum Pellucidum': 1, 'dilated cyst of the septum pellucidum': 1, 'cystic CSP': 1, 'Cystic CSP': 1, 'septum pellucidum agensis': 1, 'abnormalities of the cerebral ventricles and septum pellucidum': 1, 'tumor of septum pellucidum': 1, 'bleeding into the septum pellucidum': 1, 'septal pellucidum hemorrhage': 1, 'septum pellucidum hamartomas': 1, 'Septum pellucidum hamartomas': 1, 'Myxoid glioneuronal tumor of the septum pellucidum and lateral ventricle': 1, 'glioneuronal neoplasms of the septum pellucidum and lateral ventricle': 1, 'glioneuronal tumors of the septum pellucidum': 2, 'glioneuronal tumors of the septum pellucidum and lateral ventricle': 1, 'glioneuronal neoplasms of the septum pellucidum and lateral ventricles': 1, 'SPDs': 1, 'clefts of the septum pellucidum': 1, 'auto-fenestration of the septum pellucidum': 1, 'Auto-Fenestration of the Septum Pellucidum': 1, 'AFSP': 1, 'SP agenesis': 1, 'Epidermoid Cyst of the Cavum Septum Pellucidum': 1, 'hematoma of the septum pellucidum': 1, 'anomalies of the corpus callosum or septum pellucidum': 1, 'CSP agenesis': 1, 'anterior septum pellucidum mass': 1, 'cavum septum pellucidum vergae anomaly': 1, 'Septum pellucidum infarction': 1, 'septum pellucidum infarction': 1, 'Infarction in the septum pellucidum and cingulate gyrus': 1, 'Pellucidum cysts': 1, 'Congenital and acquired lesions of the septum pellucidum': 1, 'congenital and acquired lesions of the septum pellucidum': 1, 'displacement of septum pellucidum': 1, 'pellucidum displacement': 1, 'displacement of the septum pellucidum': 1, 'Communicating cyst of the septum pellucidum': 1, 'CNS abnormality of CSP': 1, 'Conus medullaris Septum pellucidum': 1, 'Noncommunicating cysts of the septum pellucidum': 1, 'noncommunicating cysts of the septum pellucidum': 1, 'absent corpus callosum and septum pellucidum': 1, 'anomalous septum pellucidum': 1, 'cyst in cavum septum pellucidum': 1, 'enlargement of CSP and CV': 1, 'Subependymal astrocytoma of the septum pellucidum': 1, 'abscess of the cavum septum pellucidum': 1, 'Abscess of the cavum septum pellucidum': 1, 'duplication of the septum pellucidum': 1, 'hypoplasia Absentseptum pellucidum': 1, 'dilated cavum septum pellucidum et vergae': 1, 'Septum pellucidum tumor': 1, 'mass at the septum pellucidum': 1, 'cavernous angioma at the septum pellucidum': 1, 'cavernous angioma of the septum pellucidum': 1, 'absence) of corpus callosum, septum pellucidum': 1, 'defects of the septum pellucidum': 2, 'septum pellucidum 3': 1, 'cavum septum pellucidum/vergae': 1, 'septum pellucidum-cavum Vergae cyst': 1, 'septum pellucidum cavum Vergae cyst': 1, 'tumor of the septum pellucidum and': 1, 'Hypoplasia of septum pellucidum': 1, 'patent septum pellucidum': 1, 'Empyema of the cavum septum pellucidum': 1, 'CCC': 1, 'cavum septum pellucidum complex': 1, 'agenesis septum pellucidum': 1, 'malformations of septum pellucidum and corpus callosum': 1, 'Agenesis septum pellucidum': 1, 'dysplasia of the midline structures, septum pellucidum and corpus collosum': 1, 'absence of IAS': 1, 'absence of the interatrial septum': 1, 'Epidermoid cyst of the cavum septum pellucidum': 1, 'agenesis of septum pellucidum and': 2, 'metastatic melanoma of the septum pellucidum': 1, 'Metastatic melanoma of the septum pellucidum': 1, 'Arteriovenous malformations in the septum pellucidum and corpus callosum': 1, 'BI-pellucidum': 1, 'K-pellucidum': 1, 'hypoplasia or aplasia of the septum pellucidum': 1, 'Cavum Septi Pellucidum': 1, 'Absent/undetermined septum pellucidum': 1, 'absent/undetermined septum pellucidum': 1, 'necrotic disruption of the septum pellucidum': 1, 'pituitary and septum pellucidum abnormalities': 1, 'enlargement of the cavum of the septum pellucidum': 1, 'hypoplasia of septum pellucidum': 1, 'Neuroepithelial (colloid) cysts of the septum pellucidum': 1, 'Septum pellucidum perforation': 1, 'cleft of the septum pellucidum': 1, 'widened septum pellucidum': 1, 'abnormal corpus callosum or septum pellucidum': 1, 'lipoma of the septum pellucidum': 1, 'Lipoma of the septum pellucidum': 1, 'neoplasm of septum pellucidum': 1, 'Developmental anomalies of the septum pellucidum': 1, 'congenital absence of the cavum septum pellucidum': 1, 'the CSP': 1, 'aplasia/hypoplasia of the septum pellucidum and corpus callosum': 1, 'impaired septum pellucidum': 1, 'cavum spectrum pellucidum': 1, 'cavum septum pellucidum or vergae': 1, 'SP IG': 1, 'SPG': 1, 'cystic lesion of the septum pellucidum': 1, 'IG of the SP': 1, 'septum pellucidum lesion': 1, 'SP lesion': 1, 'germinoma of the SP': 1, 'germinoma of the septum pellucidum': 1, 'SP germinomas': 1, 'Haematomas of the septum pellucidum': 1, 'corpus callosum and septum pellucidum defects': 1, 'septum pellucidum subependymoma': 1, 'anomaly of the septum pellucidum': 1, 'deficiency or absence of the septum pellucidum': 1, 'cysts of septum pellucidum': 1, 'Cyst of septum pellucidum': 1, 'Cysts of septum pellucidum': 1, 'septum pellucidum loss': 1, 'septum pellucidum MLS': 1, 'Anomalies of the septum pellucidum': 1, 'septum pellucidum (SP) absence': 1, 'DNET-like neoplasms of the septum pellucidum': 1, 'SEPTUM PELLUCIDUM OF THE BRAIN': 1, 'enlarged Cavum Septum Pellucidum': 1, 'septum pellucidum et vergae': 1, 'deviation of the septum pellucidum': 1, 'THE SEPTUM PELLUCIDUM': 1, 'pilocytic astrocytomas of the septum pellucidum': 1, 'septum pellucidum/forniceal pilocytic astrocytoma (PA) tumors': 1, 'absence of the membranous septum': 1}
|
cavum septum pellucidum
|
Disease
|
MESH:C535563
|
{'Tibia': 90, 'tibia': 1966, 'tibia fracture': 1583, 'Tibia fracture': 141, 'tibia fractures': 1450, 'fractures of the tibia,': 1, 'fracture of the tibia': 288, 'nonunions of the tibia': 24, 'fracture of the left tibia': 27, 'fractures of the tibia': 373, 'Tibias': 291, 'tibia nonunions': 23, 'tibia defect': 239, 'Congenital absence of bilateral ICA': 1, 'diaphysial fractures of the tibia': 4, 'tibia and': 52, 'transverse fracture of the tibia': 8, 'tibial hemimelia': 117, 'deformity of the tibia and': 1, 'tibia abnormalities': 5, 'tibia defects': 149, 'nonunion of the tibia': 88, 'Tuberositas tibiae': 3, 'Distal tibia,': 1, 'fractured tibia': 171, 'Tibia Fracture': 66, 'distal physeal injury of the tibia': 1, 'tibia DO': 4, 'mal- and nonunion of the tibia': 1, 'Tibial hemimelia': 40, 'Fractures of the tibia': 41, 'TIBIA': 10, 'the tuberositas tibia': 1, 'tibia plafond': 31, 'Tuberositas tibia': 2, 'Tuberositas tibia-': 1, 'distal tibia deformity': 4, 'distal tibia deformities': 1, 'Tibia Fractures': 91, 'tuberosidade anterior da tibia': 2, 'da tibia fixada': 1, 'Tibia fractures': 108, 'of the tibia': 77, 'fractures of the tibia plafond': 1, 'fractures to the tibia': 2, 'deficiency of the tibia': 9, 'Longitudinal deficiency of the tibia': 1, 'tibia nonunion': 44, 'deformity of the proximal tibia': 12, 'proximal tibia deformity': 5, 'Discard tibia': 1, 'to the tibia': 3, 'tibia injury': 22, 'Damage to the proximal epiphysis of the tibia': 1, 'tibia midshaft fractures': 1, 'bilateral absence of the radius': 7, 'Anterior Dislocation of the Tibia': 1, 'tibia distraction osteogenesis': 3, 'intercalary defects of the tibia': 4, 'Congenital tibial hemimelia': 2, 'fracture of tibia': 40, 'tibia deformity': 28, 'fracture in the tibia and': 1, 'fractured tibiae': 35, 'Fractures of Tibia': 1, 'myofibrosarcoma of the tibia': 1, 'Myofibrosarcomas of the tibia': 1, 'tibia replacement': 2, 'anterior dislocation of the tibia': 17, 'lesion of the distal tibia': 1, 'Fracture of the Tibia': 6, 'defects of the tibia': 23, 'shortness of the tibiae': 1, 'CONGENITAL BILATERAL ABSENCE OF TESTICLES': 1, 'proximal tibia epiphysiodesis': 1, 'Tuberositas tibiae angebracht': 1, 'tibia pilon': 2, 'fractures of the tibia with': 1, 'Tibial Hemimelia': 4, 'tibia deformities': 14, 'deformity of the thigh and tibia': 1, 'tibias': 120, 'osteotomized tibia': 10, 'MT': 41, 'tibia plafond fracture': 6, 'tibia damage': 6, 'fractured tibias': 19, 'THM': 132, 'fracture of the tibia and': 5, 'tibia lesions': 14, 'tibia lesion': 31, 'fractures of the tibia and': 8, 'the tibia': 54, 'deformities of the distal tibia': 3, 'type II tibial hemimelia': 2, 'transverse tibia fracture': 7, 'tibia injuries': 18, 'pseudo-fracture of the tibia': 1, 'Fractures of the upper tibia': 1, 'deformities of the proximal tibia': 4, 'deformities of the tibia': 17, 'of tibia fractures': 1, 'absence of tibiae': 3, 'tibia/': 17, 'tibia epiphysiodesis': 3, 'Fractured Tibiae': 1, 'Tibiae': 7, 'tibiae': 29, 'Fractured tibiae': 2, 'cortical lesions in the tibia': 1, 'bilateral absence of radius': 4, 'Epiphyseolysis of the proximal tibia': 1, 'fractures of tibia and femora': 1, 'LINEA POPLITEA TIBIAE': 1, 'TTHM': 4, 'pagoda deformity of the tibia': 1, 'pagoda tibia': 1, 'tibia Pilon fractures': 2, 'Malformation of the tibia': 1, 'sabre tibia': 1, 'Sabre tibia': 2, 'fractured the tibia': 1, 'proximal tibia dysplasia': 4, 'tibia valgum deformity': 1, 'DTA': 3, 'hypertrophic tibia nonunion': 1, 'proximal tibia fracturesComplex': 1, 'absence of tibia or radius': 3, 'deformity of the tibia': 34, 'agenesis of tibiae': 1, 'Bilateral absence of radius': 1, 'DIRT lesion': 1, 'DIRT': 3, 'DIRT lesions': 2, 'intermediate ridge of the tibia': 2, 'Distal tibia': 4, 'tibia fractureshas': 1, 'of tibia': 42, 'fractures of tibia': 35, 'tibia fractures18': 1, '2 fracture of left tibia': 1, 'tibia lengthening': 4, 'fractures of both tibiae': 3, 'injury of the tibia': 3, 'congenital bilateral maxillary absence': 1, 'Absence of the Tibia': 1, 'pseudar throsis of tibia': 1, 'Cochlea tibiae': 1, 'nonunion of tibia': 13, 'nonunions of tibia': 2, 'absence of bilateral menace': 1, 'DT': 2, 'lengthening of the tibia': 6, 'tuberositas tibiae': 6, 'fracture of a curved tibia': 1, 'tibia osteotomy': 10, 'callotasis of the tibia': 1, 'fracture of right tibia': 3, 'deformities in tibia': 1, 'tibia recurvata': 3, 'HT': 1, 'distal tibia facture': 1, 'tibia angulation': 5, 'Dysplasia of the proximal epiphysis of the tibia': 1, 'bilateral asymmetries of the tibia': 1, 'tibia or': 6, 'unilateral deformity of the tibia': 1, 'remodelling of tibia': 1, 'greenstick fracture of the tibia': 1, 'dislocated tibia': 1, 'tibia abnormality': 2, 'tibia dysplasia': 6, 'tibia,': 12, 'anddistal tibia fractures': 1, 'tibia GCTs': 2, 'tibia fractured': 19, 'fractures of both the tibiae': 1, 'pillion fractures of the tibia': 2, 'distraction of proximal tibia': 1, 'Tibia-Osteotomien': 1, 'TO': 1, 'tibias and': 1, 'tibia pilon AO-43C1 type fractures': 1, 'tibia pilon AO-43C1 type fracture': 1, 'LT': 12, 'transverse fractures of the tibia': 6, 'fracture of the right tibia': 19, 'tibia diaphysis fracture': 3, 'fracture of tibia diaphysis': 2, 'Tibia osteotomy': 2, 'fracture tibia': 43, 'tibia reduction abnormality': 1, 'Fracture of the tibia': 17, 'tibia or medial': 1, 'adamantinom of the tibia': 1, 'tibia osteotomy defect': 1, 'Deformities of the tibia': 1, 'tibia physeal fracture': 7, 'injury to the epiphysis of the distal tibia': 1, 'tibia pandiaphysitis': 3, 'congenital total absence of the tibia': 1, 'nonunion fractures of the tibia': 1, 'tibia ost': 1, 'poliomyelitic tibiae': 1, 'Fracture of upper tibia': 1, 'short tibia': 8, 'injuries of the proximal tibia': 1, 'Type III longitudinal deficiency of tibia': 1, 'Type III longitudinal deficiency of the tibia': 1, 'type III longitudinal deficiency of the tibia': 1, 'Distal Tibia,': 3, 'Distal Tibia': 3, 'dysplasia of the proximal tibia': 1, 'fracture of the posterior tibia': 1, 'traumatic epiphyseolysis of the distal tibia': 2, 'nonunion tibia': 8, 'PT': 14, 'refracture of the tibia': 5, 'loss of the tibia': 1, 'Loss of the Tibia': 1, 'Tibial hemimelia with footpolydactyly-triphalangeal thumb syndrome': 1, 'tibia avulsion': 1, 'fractures of the AM tibia': 1, 'pseudofractures of right tibia': 1, 'Traumatic nonunions of the Tibia': 1, 'traumatic nonunion of the tibia': 1, 'avulsion of the tuberositas tibiae': 1, 'extraarticular tibia fractures': 1, 'distraction osteogenesis of the tibia': 5, 'tibia osteosyntheses': 1, 'absence of radius bilaterally': 1, 'swelling proximal tibia': 1, 'traumatic fractures of the tibia': 3, 'dysplasia of the tibia': 2, 'tibia pilon fractures': 15, 'PPTA': 1, 'MPTA': 7, 'leg or tibia fractures': 1, 'fractures of the lower leg or tibia': 1, 'fracture of the lower leg or tibia': 1, 'dislocation of the tibia': 4, 'Tibia/': 2, 'absence (hypoplasia) of the tibia': 1, 'tibiae defect': 2, 'tibia physis fracture': 1, 'bilateral absence of the cochlea': 2, 'agenesis of the tibia': 4, 'TH': 6, 'tibial hemimelia-diplopodia syndrome': 2, 'proximal deficiency of the tibia': 1, 'tibial hemimelia micromelia trigonal brachycephaly syndrome': 2, 'tibial hemimelia and': 2, 'Bilateral TH': 1, 'absence of the tibia': 15, 'distal deficiency of the tibia': 1, 'tibial hemimelia type I': 1, 'Tibia defects': 2, 'tibia pilon fracture': 11, 'congenital tibial hemimelia': 4, 'deficiency of tibia': 4, 'longitudinal deficiency of the tibia': 2, 'LDT': 1, 'proximal tibia and tibia shaft fracture': 1, 'tibia shaft and tibia plafond fracture': 1, 'proximal tibia or tibia shaft fractures': 1, 'tibia platform defect': 1, 'Tibia Nonunion': 1, 'diafisaria fracture of the tibia': 1, 'fractures of the tibia diaphysis': 2, 'Intracortical lipoma of the tibia': 1, 'tibia or fibia fractures': 1, 'deformity in the tibia': 2, 'tibia-fractures': 1, 'fracture, tibia': 1, 'ipsilateral tibial hemimelia': 1, ', tibia, or': 1, 'limb fracture of the tibia': 1, 'procurvatum deformities in tibia': 1, 'portion of the tibia': 1, 'deformity of the distal tibia': 1, 'Bilateral tuboovarian absence': 1, 'tibia fracture callus': 3, 'intortion of tibia': 1, 'tibia or lower leg fractures': 1, 'TIbias': 1, ', and tibia fractures': 1, 'apophysis of tuberositas tibiae': 1, 'defect of the tibia': 8, 'tibia physeal injury': 2, 'proximal tibia': 7, 'tibia/pilon fractures': 1, 'fractures of the lower tibia': 3, 'leg flexion deformity Tibia': 1, 'bilateral absence of radial arteries': 1, 'absence of bilateral radial arteries': 1, 'Bilateral absence of radial artery': 1, 'tibia plafond fractures': 6, 'pseudarthosis of the tibia': 1, 'bilateral absence of 5th metatarsal and toe': 1, 'type III tibia fractures': 4, 'bilateral congenital absence and hypoplasia of the acromia': 1, 'congenital bilateral acromial absence': 1, 'atraumatic fracture of the tibia': 1, 'type-I tibial hemimelia': 1, 'Type-I Tibial Hemimelia': 1, 'Jones type-I tibial hemimelia': 1, 'tibia (upper': 1, 'Tibia Diaphysis Fracture': 1, 'pilon fracture of the tibia': 6, 'pilon fractures of the tibia': 2, 'and tibia': 7, 'angulation of the tibia': 5, 'tibia fracture nonunion': 10, 'defect in the tibia': 1, 'Defect in the Tibia': 1, 'tibia transverse fractures': 1, 'fracture of the diaphysis of the tibia': 1, 'Tibia epiphysis': 1, 'TB': 5, 'Tibia Physeal Injury': 1, 'physeal fractures of the tibia': 2, 'long bone (tibial hemimelia) deficiency': 1, 'Fractures of the Tibia': 5, 'fracture of the tibia,': 2, 'Distal left tibia': 1, 'shortness of the tibia': 2, 'agenesis of the left tibia': 2, 'osteomyelitic tibia': 1, 'absence of tibia, radius': 1, 'injury to the anterior tibia': 1, 'proximal osteomy of the tibia': 1, 'Tibia Deformity': 2, 'Congenital bilateral absence of the vasdeferens': 1, 'periarticular fractures of the tibia': 4, 'proximal tibia defect': 3, 'extraarticular fracture tibia': 1, 'thick tibiae': 1, 'Tibia radiolucency': 1, 'tibia radiolucency': 1, 'reduction of the tibia': 1, 'tibiae fracture': 7, 'tibia-fracture': 7, 'bilateral tibial hemimelia': 7, 'Bilateral ICA absence': 1, 'tibia fracture': 1, 'posterior dislocation of the tibia': 6, 'Tibia-fracture': 2, 'anterior dislocation of the tibia on': 2, 'tibia recurvatum': 2, 'pseudoartroses da tibia infectadas': 1, 'tibia longer': 1, 'liner fractures of the tibia': 1, 'liner fracture of the tibia': 1, 'fracture nonunion of the tibia and': 1, 'nonunion of the tibia fracture': 2, 'agenesis of the tibia and': 1, 'or defect of the tibia': 1, 'bilateral hypoplasia of the tibia': 1, 'tibia fracture nonunions': 4, 'Fracture Tibia': 1, 'recurvatum deformity of the tibia': 1, 'lytic lesions of the tibia': 1, 'tibia-': 6, 'physeal fracture of the tibia': 2, 'Physeal injuries of the tibia': 1, 'TIBIA FRACTURE': 1, 'tibia plato fractures': 1, 'pseudarthris of the tibia': 1, 'pseudofracture of the upper tibia': 1, 'traumatic complex defect of tibia': 1, 'tibia malformation': 2, 'fracture of left tibia': 4, 'eminentia intercondylaris fractures of the tibia': 1, 'fracture of the eminentia intercondylaris of the tibia': 1, 'tibial hemimelia-foot polydactly triphalangeal thumbs syndrome': 1, 'tibial hemimelia-cleft lip/palate syndrome': 1, 'tibial hemimelia type VIIa': 1, 'tibial hemimelia-radial agenesis syndrome': 1, 'tibial hemimelia-normal upper limb syndrome': 1, 'tibial hemimelia-micromelia-trigonobrachycephaly syndrome': 1, 'tibial hemimelia diplopodia syndrome': 2, 'Tibial hemimelia syndrome': 3, 'fractured at the tibia': 1, 'saber tibia': 1, 'tibia-fractured': 1, 'PTG': 1, 'fracture of the tuberositas tibiae': 2, 'PTSA': 1, 'tibia epiphysis': 3, 'anterior or lateral angulation deformity of tibia': 1, 'swelling of the tibia': 3, 'of the distal tibia': 1, 'cMT': 1, 'sclerosis of the proximal tibias': 1, 'procurvatum deformity of the tibia': 1, 'Torpid fractures of the tibia': 1, 'fracture of both tibias': 1, 'Schatzker type V fracture of the right tibia': 1, 'fractures in the tibia': 4, 'tibia (': 1, 'tibia fracture and': 1, 'tibia tubercle': 3, 'TAT': 2, 'haemangiopericytoma of the tibia': 1, 'Congenital and bilateral absence of the radius': 1, 'of tibia and': 1, 'Overgrowth of the tibia': 1, 'Gustilo Type III tibia fractures': 1, 'proximal tibia recurvatum': 1, 'fractures of the tibiae': 3, 'fracture of the tibia diaphysis': 2, 'distraction osteogenesis of tibia': 1, 'fracture on tibia': 2, 'intracortical lesion of the tibia': 1, 'fractures of the left tibia': 1, 'abnormality of the tibia': 1, 'Jones type I and II tibial hemimelia': 1, 'ski fractures of the tibia': 1, 'of the proximal tibia': 2, 'anterior tibia': 1, 'TIBIA VARA': 4, 'tibia drill injury': 1, 'Fractured tibia': 7, 'absence of the pubis, femur, tibia, and': 1, 'TF': 2, 'TIBIAE': 1, 'BF': 1, 'dislocation) of the tibia': 1, 'Tibia posterior syndrome': 1, 'tibia posterior syndrome': 1, 'type IIIa tibial hemimelia': 1, 'HUMAN TIBIA': 1, 'Bilateral absence of tibiae': 1, 'osteoperforated tibia': 1, 'Gustilo II and III tibia fractures': 1, 'developmental malformation of the tibia': 2, 'recurvatum of the tibia': 3, 'deformity of the tibiae and metatarsi': 1, 'fractures tibia': 1, 'developmental anomalies of the tibia': 1, 'injury to tibia': 1, 'tibia triplane injury': 1, 'tuberosidade da tibia': 1, 'Sabre tibia deformity': 1, 'tibia dislocation': 3, 'Tibia nonunion': 2, 'tibia non': 1, 'Lesao osteolitica da tibia direita': 1, 'calcificacoes na tibia direita': 1, 'pseudoartrose congenita da tibia': 1, 'nonunion of the distal tibia': 2, 'da tibia': 1, 'tibia/tib-fib fractures': 1, 'tibia/tib-fib fracture': 1, 'fractureee of the tuberositas tibiae': 1, 'Pilon fractures of the tibia': 1, 'tibia Inj': 1, 'plafond of the distal tibia': 1, 'ACC': 1, 'shortness of tibiae': 1, 'bilateral absence of middle toes': 1, 'pandiaphysitis of the tibia': 1, 'tibias fractured': 1, 'fracture at the tibia': 1, 'Fractured tibia 2': 1, 'or spiroid fractures of the tibia': 1, 'hypertrophic nonunion of the tibia': 2, 'procurvatum of the tibia': 1, 'deformities of tibia': 1, 'proximal tibia,': 1, 'Bilateral tibial hemimelia type 1 (1a and 1b) with T9 and T10 hemivertebrae': 1, 'injuries to the tibia': 1, 'Parachordoma of tibia': 1, "parachordoma' of left tibia": 1, 'third of the tibia': 1, 'GustilloIIIA fracture of the tibia': 1, 'Fractures of tibia': 1, 'in the tibia': 1, 'anterior tibia fractures': 1, 'maltorsion of the tibia': 3, 'tibia nonunion fractures': 1, 'anteriorizacao da tibia': 1, 'Subepiphyseal osteochondropathy of the tibia': 2, 'Schatzker type 1 tibia fracture': 1, 'diaphysial defect of tibia': 1, 'tibia agenesis': 4, 'absence of tibia': 4, 'tuberculo-troclear da tibia': 1, 'midshaft fracture of the tibia': 2, 'lower extremity fracture of the tibia': 1, 'uni- or bilateral absence of one of both eyes': 1, 'OF OPEN DISLOCATION OF THE TIBIA': 1, 'right tibial hemimelia': 1, 'malformations of tibial hemimelia': 1, 'Physeal injuries of the distal tibia': 2, 'Tibia dysplasia': 1, 'left tibial hemimelia': 1, 'tibia procurvatus': 1, 'osteoplasty tibia': 1, 'Injuries of the tibia': 1, 'injuries of the tibia': 5, 'tibia defect fractures': 1, 'fractures of the lower third of tibia': 1, 'intercodylar fracture of the tibia': 1, 'avulsion from the tibia': 1, 'Tibia defect': 2, 'bilateral absence of the acromion': 1, 'tibiae fractures': 4, 'tibia AB': 1, 'TC': 2, 'medial proximal tibiae epiphysiodesis': 1, 'absence of both radii and tibias': 1, '-tibia injury': 1, 'fractures of the diaphysis of the tibia': 1, 'medial deformity of the tibia': 1, 'avulsion of the anterior tubercle of the tibia': 1, 'fracture to the tibia': 4, 'fracture of tibiae': 1, 'bilateral absence of thumbs': 8, 'tibia and sequestrum': 1, 'those of tibia': 1, 'necrotic tibia': 4, 'bilateral absence of a cochlea': 1, 'posterior reduction of the tibia': 1, 'deformities of the proximal tibiae': 1, 'pT': 1, 'pT.': 2, 'Osteotomy of proximal tibia': 1, 'tibiae defects': 6, 'absence or hypoplasia of the tibia': 1, 'Absence/hypoplasia of tibia': 1, 'Absence or hypoplasia of the tibia': 1, 'tibia fracture injury': 4, 'Tibia lesion': 1, 'tibia physeal fractures': 10, 'defect of tibia': 6, 'tibia alignment disorder': 1, 'deformity at the tibia': 1, 'midshaft fractures of the tibia': 1, 'tibia fractures.14': 1, 'PTE': 1, 'Tibia dislocation': 1, 'osteoperiostitis of the tibia': 1, 'Distal epiphysis of tibia': 1, 'malformation of the tibia': 1, 'Subperiosteal haematoma of the tibia': 1, 'Distal Tibial Hemimelia': 1, 'Deformities in tibia': 1, 'Diaphysis tibia': 1, 'DTAPA': 1, 'tibia and pilon fractures': 1, 'atresia of the tibia': 2, 'lesions of the tibia': 2, 'fracture the tibia': 3, 'traumatic defects of tibia': 1, 'A flavus tibia': 1, 'nonunions of the tibia fracture': 1, 'pseudoarthritis of the tibia': 2, 'tibia medial': 1, 'TB injury': 1, 'mPTA': 1, 'ATT': 1, 'anterior tibia tubercle': 1, 'admantinoma of the tibia': 1, 'hyperextension of the tibia': 2, 'TD': 1, 'tibia valgum': 1, 'tibia valgum deformities': 1, 'bilateral absence of the frontal sinus': 1, 'epiphyseolysis of the distal tibia': 2, 'Divot fracture of the tibia': 1, 'Lower leg fractures of the tibia': 1, 'tuberositas tibia': 1, 'Anterior arch deformity of tibia': 2, 'Fractura condyli tibiae': 1, 'unilateral or bilateral absence of corneal endothelium': 1, 'pseudofractures in the tibia': 1, 'Tibia pilon fractures': 2, 'Tibia Pilon Fractures': 1, 'left tibia': 2, 'fraturas da tibia': 2, 'hypertrophic nonunion of tibia': 1, 'Contralateral tibia fracture': 1, 'anterior and medial angulation of the tibia': 1, 'anterior-medial angulation of the tibia': 1, 'tibia fractures injuries': 1, 'congenital bilateral absence of horizontal eye movement': 1, 'anterior dislocation of tibia': 2, 'UDT': 1, 'Fracture of Tibia': 5, 'fractures of superior tibia': 1, 'Tuberositas Tibia and': 1, 'tibia curve deformity': 1, 'fracture of tibia diaphysis and': 1, 'Fractured tibias': 2, 'tibia osteotomy fracture': 1, 'DH/THM': 1, 'bilateral absence of the hands': 2, 'physeal injuries of the distal tibia': 2, 'Tibiae II': 2, 'bilateral tibial hemimelia syndrome': 1, 'unilateral tibial hemimelia': 1, 'metaphyso-epiphyseal fractures of the tibia': 1, 'pseuodarthrosis of the tibia': 1, 'bilateral absence of tibia': 1, 'Tuberositas Tibiae': 1, 'tibia triplane fractures': 1, 'violence of tibia': 1, 'metatraumatic pseudorthrosis of the tibia': 1, 'five-fingered hand-tibial hemimelia': 1, 'recurvatum deformity of proximal tibia': 1, 'tibia osteotomies': 3, 'tibia fracturesNote': 1, 'fracture on the tibia': 1, 'type injury of the distal tibia': 1, 'tibia pilon fractured': 1, 'metadiaphyseal fractures of the tibia': 1, 'Femora and tibiae clavate': 1, 'physeal injury of the proximal tibia': 1, 'Fracture of the tibia baseplate': 1, 'Palpal tibia': 1, 'Tibial hemimelia-polydactyly-': 1, 'bilateral tibial hemimelia-preaxial polydactyly-five-fingered hands': 1, 'left tibia fracture': 2, 'al fractures of the tibia': 1, 'or bilateral absence of light reflex': 1, 'transverse fracture of upper tibia': 1, 'greenstick fractures of lower tibia': 1, 'cysticus of the tibia': 1, 'APT': 1, 'fractures of tibia diaphysis': 1, 'tibia leada': 1, 'infantile dysplasia of the tibia': 1, 'tibia diaphysis fractures': 5, 'anterior angulation deformity of the tibia': 1, 'Distal tibia mortise': 1, 'distal tibia': 4, 'of Tibia': 4, 'tibia extraarticular fractures': 1, 'hypometric tibias': 1, 'myxofibrosarcoma of tibia': 1, 'Deformity of the tibia': 1, 'Osteotomy of the Tibia': 1, 'lengthening of tibia': 1, 'diafisaria da tibia direita': 1, 'tibia transverse osteotomy': 1, 'Fractured Tibia': 1, 'antecurvatum deformities of the tibia': 1, 'fracture of both tibiae': 3, 'AO Type 42A tibia fracture': 1, 'fracture at tibia': 2, 'tibial hemimelia or agenesis': 1, 'Tibial Hemimelia Syndrome': 1, 'tibial hemimelia syndrome': 5, 'Nonunion of the tibia': 2, 'Osteotomy at the tibia': 1, 'dysplasia of the posterolateral tibia': 1, 'tibia-calcanear arthrodesis': 1, 'fracture of the lower tibia': 3, 'tibia, tibia/fibula, and scaphoid fractures': 1, 'fractures of the tibia, tibia/fibula': 1, 'absence of both tibiae': 1, 'Parachordoma of the tibia': 1, 'absence of tibia and fibular dimelia': 1, 'fibulation of tibia': 1, 'bilateral partial deficiencies of the tibia and fibula': 1, 'congenital bilateral partial deficiencies of the tibia and fibula': 1, 'procurvatum deformity of the proximal tibia': 2, 'absence of tibia, fibula': 1, 'tibia direita foi dissecada': 1, 'Bilateral congenital absence of femur': 1, 'Bilateral Congenital Absence of Femur': 1, 'Bilateral congenital femur absence': 1, 'bilateral congenital absence of femur': 1, 'Bilateral congenital Femur absence': 1, 'Tibia Physis Injury': 1, 'osteogenesis of tibia': 1, 'PTM': 1, 'Fracture of the tuberositas tibiae': 1, 'tibia and/': 1, 'deformity of proximal tibia': 1, 'tibia tunnel': 1, 'tibia and peroneum fractures': 1, 'tibia tunnel impingement': 1, 'tibia deficiency': 3, 'Fracture of tibia': 4, 'fracture right tibia': 1, 'osteotomied tibia': 1, 'bilateral and proximal limb-absence': 1, 'fracture upper third tibia': 1, 'longitudinal fractures of tibia': 1, 'absence of bilateral': 3, 'absence of the bilateral': 1, 'swelling in the tibia': 1, 'bilateral absence of the first fingers': 1, 'uni- or bilateral absence of the eyeball': 1, 'unilateral and bilateral PL absence': 1, 'injury to the proximal tibia': 1, 'osteolytic tibia': 1, 'Triatoma (Eutriatoma) tibia-maculata': 1, 'distal tibia epiphysis': 1, 'bilateral absence of the diaphragm': 1, 'BrTHM': 1, 'tuberositas tibia fracture': 2, 'abnormalities of the tibia': 1, 'arterias da tibia': 1, 'Tibia transverse fracture': 1, 'injury of the left tibia': 1, 'tibia remodelling': 1, 'lower leg fracture of the tibia': 1, 'tibial hemimelia type IA': 1, 'fracture of the posterolateral tibia': 1, 'THE TIBIA': 1, 'flexion of the tibia': 1, 'CTS': 1, 'rhaebosis of the tibia': 1, 'AT': 1, 'respuesta tibia y': 1, 'Fracture of the right tibia': 1, 'nonunion of tibia,': 1, 'deformity in the proximal tibia': 1, 'Posterior dislocation of tibia': 1, 'Anterior dislocation of tibia': 1, 'dislocation of tibia': 1, 'Lateral dislocation of tibia': 1, 'nonunions of the tibia and scaphoid': 1, 'pilon tibia fractures': 2, 'osteomyelitic defect of the tibia': 1, 'Tibia nonunions': 2, 'contralateral complete or partial tibial hemimelia': 1, 'dislocation of the tibia on the femur': 1, 'fibular and tibial hemimelia': 1, 'bilateral absence of thumbs and first toes': 1, 'Metadiaphyseal tibia fractures': 1, 'Fracture tibia': 1, 'LDTA': 5, 'osteolytic tibia tunnel': 1, 'tibia direita': 1, 'deformity in tibia': 1, 'tibia distraction': 2, 'bilateral absence of the elbow flexors': 1, 'overcorrection of the tibia': 1, 'tibia eversion': 1, 'bilateral absence of the pyramids': 1, 'absence of bilateral peripheral pulses': 1, 'deformity tibia': 1, 'tibia nonunion fracture': 1, 'deformities of the femora and tibiae': 1, 'Traumatic defect of the medial tibia': 1, 'Tibia Defect': 2, 'Bilateral absence of arteries': 1, 'fractures of the tibia or': 2, 'anterior dislocation of the tibia on the femur': 2, 'absence of bilateral toe': 1, 'genu and tibia': 1, 'at the tibia': 1, 'type 2 tibial hemimelia': 2, 'diseased tibia': 1, 'Hyphoderma tibia': 1, 'injury to the distal tibia': 1, 'Gustilo type III tibia fracture': 1, 'traumatic fracture of the tibia': 2, 'congenital absence of bilateral femur': 1, 'Bilateral absence of femur': 1, 'congenital absence of the bilateral femur': 1, 'tissue defects of the tibia': 1, 'proximal tibia block': 1, 'traumatic dislocation of the tibia from the femur': 1, 'osseocutaneous defect of the tibia': 1, 'Distal tibia physeal injury': 1, 'tibia derotion': 1, 'bilateral bowing of the tibiae': 1, 'tibia tubercle fracture': 2, 'Nonunion of the Tibia': 1, 'adamantioma of the tibia': 1, 'nonunion fracture tibia': 1, 'of tuberositas tibiae': 1, 'Procurvatum deformity of the tibia': 1, '-shaped deformity of the tibiae': 1, 'tibia thorns': 1, 'benign lesion of the tibia': 1, 'short tibiae': 1, 'tibia facture': 1, 'PTO': 1, 'Isolated tibial hemimelia': 1, 'isolated tibial hemimelia': 1, 'fracture of one tibia': 1, 'physeal injuries of proximal tibia': 1, 'Physeal injuries of proximal tibia': 1, 'Tibial hemimelia-cleft lip/palate': 1, 'physis fracture of the tibia': 1, 'Foreleg tibia': 1, 'FT': 1, 'bilateral absence of menace response': 1, 'Processus trochlearis tibiae': 1, 'tibia procurvatum deformity': 1, 'avulsion of the tibia': 2, 'PTS': 1, 'refracture tibia': 1, 'epiphysis of the tibia': 1, 'lengthening of femora and tibiae': 1, 'anterior angulation of the tibia': 1, 'tibia diaphysis': 1, 'tibia malformations': 1, 'Tibia tubercle fractures': 1, 'fractured tibia and': 1, 'dysmorphic tibia': 1, 'tibia defective lesions': 1, 'traumatized tibia': 1, 'Tapping fracture of tibia': 1, 'Solenidia of tibiae': 1, 'distal tibia,': 1, 'skeletal defects of the tibia': 1, 'Tibia injury': 1, 'tibia and pylon fractures': 1, 'tibia Type': 1, 'absence of the radius and tibia': 1, 'and tibia fractures': 1, 'split fracture of the left tibia': 1, 'Fractures in the tibia': 1, 'Tibia Fracture Injury': 1, 'abnormal tibiae': 1, 'fracture of the tibia AO type 42C2': 1, 'hypertrophic nonunion of tibia with deformity': 1, 'Cortical lesions of the tibia': 1, 'Agenesis of tibia with': 1, 'tibial hemimelia Sacral hypoplasia': 1, 'the tibia and': 1, 'Tibia cervicalis': 1, 'Tibia Plafond': 1, 'Tibia plafond fractures': 1, 'fractures surrounding the tibia': 1, 'fractures of the midshaft of the tibia': 1, 'longitudinal tibia defects': 1, 'injuries to the proximal tibia': 1, 'nonunion of tibiae': 1, 'lesions of the bilateral tibiae and ulnae': 1, 'Bilateral absence of mental foramen': 1, 'bilateral absence of mental foramen': 1, 'deficiencies of the tibia': 1, 'tibia fracture,{Terrando': 1, 'diaphysary fractures of the tibia': 2, 'Lateral of tibia': 1, 'Enthesopathia microtraumatica tuberositas tibiae': 1, 'Tibia Fracture': 1, 'swelling of the right tibia': 1, 'Dysalotosaurus tibia': 1, 'lengthenings of the tibia': 1, 'dysplasia of proximal tibia': 1, 'tibia tuberositas': 1, 'tibia ostectomy defects': 1, 'Defects in tibia': 1, 'Lateral Distal Tibia Angle': 1, 'Congenital Bilateral Absence of the Radial Artery': 1, 'nonunion of fractures of the tibia': 2, 'transposition of the tuberositas tibiae': 1, 'Fractures of the upper third of the tibia': 1, '-tibia injuries': 2, 'saber malformation of the tibia': 1, 'Pseudofracture of the tibia': 1, 'Tibia lengthening': 1, 'absence of the radial ray and tibia': 1, 'tibia plafond type fracture': 1, 'fracture of the contralateral tibia': 1, 'Hemangiomatosis of the tibia': 1, 'fracture in tibia': 1, 'Fractures of the lower tibia': 1, 'Osteotomy of tuberositas tibiae': 1, 'Spiroid fractures of the tibia': 1, 'dislocation from the lower tibia': 1, 'Weber type I tibial hemimelia': 1, 'bilateral absence of auditory nerve': 1, 'LDPT': 1, 'fracture nonuions of the tibia': 1, 'malformed tibia': 1, 'avulsion of the distal tibia': 1, ', tibia': 1, 'bilateral limb absence': 1, 'ORIF fracture tibia': 1, 'greenstick fractures of the tibia': 1, 'fracture in the tibia': 1, 'type III fractures of the tibia': 1, 'of Fracture of Tibia': 1, 'tibia HO': 1, 'deformity of tibia': 1, 'tibia FRACTure': 1, 'Nonunions of the tibia': 1, 'Seudoartrosis congenita of the tibia': 1, 'or of the tibia': 1, 'fracture of bilateral tibia': 1, 'Fracture of tuberositas tibiae': 1, 'nonunions of the tibia to the': 1, 'agenesis of tibia': 2, 'bilateral absence of the crystalline': 1, 'chondral fractures of the tibia': 1, 'of the MT': 1, 'Congenital absence of the incus bilaterally': 1, 'bilateral absence of the ICAs': 1, 'tibia anomaly': 1, 'ridge of the tibia': 1, 'Front tibia': 1, 'Femora Tibiae': 1, 'deformity of the femora and tibiae': 1, 'tibial or fibular hemimelia': 1, 'fibular or tibial hemimelia': 1, 'tibia affliction': 1, 'nonunion at the tibia': 1, 'tibial hemimelias': 1, 'nonunion of the proximal tibia': 2, 'fracture of the injured tibia': 1, 'unilateral or bilateral limb absence': 1, 'tibia Lateral Syndrome': 1, 'angulation of femora and tibiae': 1, 'tibia type III Pilon fracture': 2, 'Pilon fracture of tibia': 1, 'tibia split fractures': 1, 'tibias fractures': 1, 'Bilateral congenital longitudinal deficiency of the tibia': 1, 'Periostosis tibiae': 1, 'Bilateral absence of FDS': 1, 'bilateral asymmetry of the tibia': 1, 'Bilateral vasal absence': 1, 'deformity in flexion of tibia': 1, 'traumatic defect of the tibia': 1, 'tibia extraarticular deformity': 1, 'tibia extraarticular deformities': 1, 'fractures of the upper epiphysis of the tibia': 1, 'multiple refracture of the tibia': 1, 'Bilateral hyperostosis of tibias and fibulae': 1, 'fractures of the eminentia intercondyloidea of the tibia': 1, 'Distal tibia Fracturen': 1, 'bilateral tibiae and fibular fracture': 1, 'agenesis of the tibiae': 2, 'absence of arm pulse bilaterally': 1, 'of the tuberositas tibiae': 1, 'inclined tibia': 1, 'TCM': 1, 'MTAT': 1, 'Tibia fracturesSample': 1, 'deformity at tibia diaphysis': 1, 'tibia angulation deformity': 1, 'THM B': 1, 'THM A': 1, 'Tibial hemimelia-ectrodactyly syndrome': 1, 'deformities of the tibiae': 1, 'MPT': 1, 'nonunion of the right tibia': 1, 'Nonunion of the right tibia': 1, 'Rabbit Tibias': 1, 'proximal tibia physeal injury': 1, 'tibia related deformities': 1, 'HTO': 2, 'nonunion tibia fracture': 1, 'nonunion tibia defect': 1, 'nonunion tibia defects': 1, 'TIBIA ESTIMATION': 1, 'hypertrophic distal tibia nonunion': 1, 'Overgrowth of tibia': 1, 'tibia fracture sequela': 1, 'tibia pseudoartrosis': 1, 'proximal and distal tibia epiphysis': 1, 'Bracket epiphysis deformity of tibia': 1, 'bilateral absence': 1, 'unilateral and bilateral absence': 1, 'injury of the distal tibia epiphysis': 1, 'fractures of both the tibia and the': 1, 'Distal Tibia Physeal Injury': 1, 'distal tibia physeal injury': 1, 'fracture of tibia or': 1, 'PTD': 1, 'fractures of both the tibia': 1, 'tibia swelling': 1, 'anterior tibia swelling': 1, 'Carcinoma sarcomaiodes tibiae': 1, 'nonunion fracture of the tibia': 1, 'tibia rudiments': 1, 'bilateral absence of the thumbs': 1, 'Psuedarthrosis of the tibia': 1, 'MCTD': 1, 'Monocortical tibia defect': 1, 'related injuries of the tibia': 1, 'cortical lesion of the tibia': 1, 'tibia est fracture': 1, 'distal tibia injuries': 1, 'injuries to the distal tibia': 1, 'absence of the bilateral PCOMs': 1, 'distal tibia injury': 1, 'proximal physeal injury of the tibia': 1, 'spiroid fracture of the tibia': 1, 'distal injuries of the tibia': 1, 'recurvatum deformity of the distal tibia': 1, 'Fracture of the left tibia': 1, 'juxta-epiphyseal fractures of the upper tibia': 1, 'proximal tibia nonunion': 1, 'pain at bilateral tibiae': 1, 'pseudofractures of the tibia': 1, 'Injuries of tuberositas tibiae': 1, 'sleeve fractures of the tibia': 1, 'osseous deformity of the tibia': 1, 'tibia orthotopic': 1, 'Paley type 2 tibial hemimelia': 1, 'nondeficient tibia': 1, 'Paley type 4a tibial hemimelia': 1, 'Paley type 2C unilateral tibial hemimelia': 1, 'Paley type 5A tibial hemimelia': 1, 'tibial hemimelia-micromelia-trigonal brachycephaly syndrome': 1, 'Paley type 4b tibial hemimelia': 1, 'deficiency of the proximal tibia': 1, 'Paley type 3A tibial hemimelia': 1, 'Epiphysis of proximal tibia': 1, 'proximal tibia deficiency': 1, 'Paley type 3 tibial hemimelia': 1, 'Paley types 2, 3, and 4 tibial hemimelia': 1, 'Jones type I tibial hemimelia': 1, 'type 4A tibial hemimelia': 1, 'Paley type 3A unilateral tibial hemimelia': 1, 'Paley type 4 tibial hemimelia': 1, 'Paley type 2C tibial hemimelia': 1, 'absence of tibia,': 1, 'syndromic tibial hemimelia': 1, 'Paley type 4A tibial hemimelia': 1, 'Paley type 4B tibial hemimelia': 1, 'Paley type 5B tibial hemimelia': 1, 'Paley type 2A tibial hemimelia': 1, 'Paley type 1 tibial hemimelia': 1, 'distal tibia deficiency': 1, 'Paley type 5 tibial hemimelia': 1, 'Paley type 3B tibial hemimelia': 1, 'Paley type 2B tibial hemimelia': 1, 'type 3a tibial hemimelia': 1, 'THM-SA': 1, 'fracture nonunions at the tibia': 1, 'dysplasia of the distal tibia': 1, 'bilateral hand absence': 1, 'Tibia platau fracture': 1, 'Frontal-plane deformity of the proximal tibia': 1, 'Bilateral tibial hemimelia I.': 1, 'of the tibia and': 1, 'anterior dislocations of the tibia at the': 1, 'of proximal tibia': 1, 'tibia or pilon fractures': 2, 'MT lesions': 1, 'Fractures at the tibia': 1, 'I-THM': 1, 'deformity of medial tibia': 1, 'hyperostosis of the bilateral tibia bone': 1, 'Bilateral Tibia': 1, 'unilateral left distal tibial hemimelia': 1, 'distal tibial hemimelia': 1, 'syndesmosis fractures of the tibia': 1, 'avulsions of the tuberositas tibiae': 1, 'Bilateral absence of pulse in upper': 1, 'Tibia Plafond Fractures': 1, 'Tibial hemimelia/amelia': 1, 'Bilateral congenital deficiency of tibia': 1, 'tilt of the tibia': 1, 'tibia anomalies': 1, 'Absence of tibia with ectrodactyly': 1, 'tibial hemimelia with': 1, 'congenital bilateral limb absence': 1, 'swelling of the tibia-': 1, 'anterior angulation of tibiae': 1, 'Fracture Tibia': 1, 'absence of bilateral corneal': 1, 'tuberculum tibiae': 1, 'Reosteosynthesis of the tibia': 1, 'absence of bilateral radius': 1, 'nonunion of the distal tibia,': 1, 'Deformity of the proximal tibia': 1, 'Ischemic tibia fracture': 1, 'ischemic tibia fractures': 1, 'tibia lytic lesion': 1, 'tibia-defect': 1, 'the tibia or': 1, 'bilateral absence of fixation': 1, 'Jones type IV tibial hemimelia': 2, 'malleolar fractures of the tibia': 1, 'fracture of acetabulum and tibia': 1, 'pseudarthrotic tibia': 1, 'tibia tissue defect': 1, 'type IV tibial hemimelia': 2, 'Type IV Tibial Hemimelia': 1, 'short tibia with': 1, 'Type IV tibial hemimelia': 1, 'limb lengthening of the tibia': 1, 'MCT': 1, 'tibias defect': 1, 'maltorsion of both tibiae': 1, 'tibia midshaft fracture': 1, 'distal tibia (supramalleolar) deformities': 1, 'motorcycle fracture of the tibia': 1, 'Fracture tibia diaphysis': 1, 'defect fractures of the tibia': 1, 'Defect fractures of the tibia': 1, 'tibia tubercle injury': 1, 'Lytic lesion in the tibia': 1, 'Apophyseal injuries of the pelvis and tibia': 1, 'fracture of left tibia and': 1, 'Fractures in tibia': 1, 'TMA': 1, 'TMC': 1, 'TLA': 1, 'TLP': 1, 'TMP': 1, 'Maduramycosis of tibia': 1, 'distal tibia nonunions': 1, 'Distal Tibia Epiphysiodesis': 1, 'tibia tray': 1, 'tibia physes': 1, 'TT-TG': 1, 'TT': 1, 'TT-TG-': 1, 'Tibia recurvatum': 1, 'cortical fracture of the tibia': 1, 'dysplasic tibia': 1, 'epiphysial fractures of the tibia': 1, 'Tibia fractureA': 1, 'injury of tibia': 1, 'Fracture of lower third tibia': 1, 'Fractures of lower third of tibia': 1, 'tibia eminentia fracture': 1, 'lesion of the tibia': 2, 'nonunion of the body of tibia': 1, 'Bilateral congenital absence of the testicles': 1, 'deformed tibia': 1, 'tibia rudiment': 1, 'tibia/fibia fracture': 1, 'tibia and fibia fracture': 1, 'ligament of the tibia and': 1, 'tibia chondroblastic': 1, 'fracture of the anterior tibia': 1, 'tibia anteromedial fractures': 1, 'tibia loss': 1, 'or tibia': 1, ' fracture of the tibia\tPubTator3\n8118979\tDisease\tMESH:C536044\tType III fractures\tPubTator3\n8118979\tDisease\tMESH:D005597\topen fractures\tPubTator3': 1, 'MESH\n8118979\tDisease\tMESH:D012141\tpin-tract infection\tPubTator3\n8118979\tDisease\tMESH:D013978\ttibial pilon fractures\tPubTator3': 1, 'MESH\n8118979\tDisease\tMESH:D014947\ttrauma\tPubTator3\n8118979\tDisease\tMESH:D050723\tType II fractures': 1, 'fractures': 1, 'pilon fractures\tPubTator3\n8118979\tDisease\tMESH:D016512\t\tMESH\n8118979\tDisease\tMESH:D011183\t\tMESH\n16895979\tDisease\tMESH:D012640\tSeizure': 1, 'seizure': 1, 'seizures\tPubTator3\n16895979\tDisease\tMESH:D004832\tabsence seizures': 1, 'absence epilepsy\tPubTator3': 1, 'MESH\n21865979\tDisease\tMESH:D001260\tT-RFs\tPubTator3\n2759979\tDisease\tMESH:D007022\thypotension\tPubTator3\n2759979\tDisease\tMESH:D006470\themorrhage\tPubTator3': 1, 'MESH\n15345979\tDisease\tMESH:D053717\tventilator-associated pneumonia': 1, 'VAP\tPubTator3\n15345979\tDisease\tMESH:D007239\tinfection\tPubTator3\n15345979\tDisease\tMESH:D018410\t\tMESH\n15345979\tDisease\tMESH:D007964\t\tMESH\n15345979\tDisease\tMESH:D005334\t\tMESH\n15345979\tDisease\tMESH:D014947\t\tMESH\n15345979\tDisease\tMESH:D003428\t\tMESH\n6084979\tDisease\tMESH:D002872\t\tMESH\n6084979\tDisease\tMESH:D013789\t\tMESH\n15980979\tDisease\tMESH:D018302\tgliomatosis cerebri\tPubTator3': 1, 'MESH\n15980979\tDisease\tMESH:D003643\tdeaths\tPubTator3\n15980979\tDisease\tMESH:D054198\tacute lymphoblastic leukemia\tPubTator3': 1, 'MESH\n15980979\tDisease\tMESH:D009369\tmalignancy': 1, 'cancer\tPubTator3\n15980979\tDisease\tMESH:D001932\t\tMESH\n15980979\tDisease\tMESH:D016609\t\tMESH\n17666979\tDisease\tMESH:D009369\tcancer\tPubTator3': 1, 'MESH\n17666979\tDisease\tMESH:D001007\tAnxiety': 1, 'anxiety\tPubTator3\n17666979\tDisease\tMESH:D003866\tDepressive symptoms': 1, 'depression\tPubTator3\n29899979\tDisease\tMESH:D006261\tHeadache\tPubTator3\n29899979\tDisease\tMESH:D011832\tradiation oncology\tPubTator3\n15192979\tDisease\tMESH:D003551\tCysticercosis\tPubTator3': 1, 'MESH\n34604979\tDisease\tMESH:D000086382\tCOVID-19': 1, 'COVID-19 pneumonia': 1, 'SARS-CoV-2 infection\tPubTator3\n34604979\tDisease\tMESH:D007239\tinfections\tPubTator3\n34604979\tDisease\tMESH:D004342\tallergic diseases\tPubTator3\n966979\tDisease\tMESH:D014552\turinary tract infections\tPubTator3': 1, 'MESH\n32088979\tDisease\tMESH:D009140\tcam deformity': 1, 'pincer deformity\tPubTator3\n32088979\tDisease\tMESH:D006617\thip impingement syndrome\tPubTator3\n32088979\tDisease\tMESH:D007592\thip joint diseases\tPubTator3\n32088979\tDisease\tMESH:D025981\thip conditions': 1, 'Hip': 1, 'hip\tPubTator3\n27437979\tDisease\tOMIM:614922\tTRANSLATIONAL\tPubTator3\n11588979\tDisease\tMESH:C566857\tCLN2 disorder\tPubTator3\n11588979\tDisease\tMESH:D009472\tNCLs': 1, 'ceroid lipofuscinosis': 1, 'neuronal ceroid-lipofuscinoses': 1, 'CLN3 disorders\tPubTator3': 1, 'MESH\n11588979\tDisease\tMESH:D003643\tpremature death\tPubTator3\n11588979\tDisease\tMESH:D012162\tretinal degeneration\tPubTator3\n11588979\tDisease\tMESH:D020271\tautosomal-recessively inherited neurodegenerative disorders\tPubTator3\n11588979\tDisease\tMESH:D003072\tcognitive decline\tPubTator3\n11588979\tDisease\tMESH:D000014\tbehavioural abnormalities\tPubTator3\n11588979\tDisease\tMESH:D009410\t\tMESH\n11588979\tDisease\tMESH:D004195\t\tMESH\n37294979\tDisease\tMESH:D013923\tthromboembolic\tPubTator3\n37294979\tDisease\tMESH:D008107\tcomplications\tPubTator3\n37294979\tDisease\tMESH:D003643\tmortality\tPubTator3\n37294979\tDisease\tMESH:D014947\ttrauma': 1, 'Trauma\tPubTator3\n37294979\tDisease\tMESH:D051437\tMultiorgan failure\tPubTator3\n37294979\tDisease\tMESH:D012769\tshock\tPubTator3\n37294979\tDisease\tMESH:D009104\t\tMESH\n36801979\tDisease\tMESH:D013921\tthrombocytopenia': 1, 'thrombocytopenic\tPubTator3\n36801979\tDisease\tMESH:D050497\tstillbirths\tPubTator3\n36801979\tDisease\tMESH:D003920\tDiabetic\tPubTator3\n36801979\tDisease\tMESH:C537732\tbleeding gums\tPubTator3\n36801979\tDisease\tMESH:D017495\thyperpigmentation\tPubTator3\n36801979\tDisease\tMESH:D005334\tFever': 1, 'fever': 1, 'febrile illnesses\tPubTator3\n36801979\tDisease\tMESH:D007964\tpleocytosis': 1, 'leukocytosis\tPubTator3\n36801979\tDisease\tMESH:C536897\toedema\tPubTator3\n36801979\tDisease\tMESH:D015746\tabdominal pain\tPubTator3\n36801979\tDisease\tMESH:D014839\tvomiting\tPubTator3\n36801979\tDisease\tMESH:D016388\tfoetal loss': 1, 'volume loss\tPubTator3\n36801979\tDisease\tMESH:D006529\thepatomegaly\tPubTator3\n36801979\tDisease\tMESH:D008209\tcongenital syndrome\tPubTator3\n36801979\tDisease\tMESH:C580334\tundifferentiated febrile illness\tPubTator3\n36801979\tDisease\tMESH:D008831\tmicrocephaly': 1, 'congenital microcephaly\tPubTator3\n36801979\tDisease\tMESH:D009759\thorizontal nystagmus\tPubTator3\n36801979\tDisease\tMESH:D006470\thaemorrhage': 1, 'haemorrhaged': 1, 'bleeding\tPubTator3\n36801979\tDisease\tMESH:D008268\ttorpedo maculopathy\tPubTator3\n36801979\tDisease\tMESH:D006130\tshort stature\tPubTator3\n36801979\tDisease\tMESH:D006450\thaemoglobin SC disease\tPubTator3\n36801979\tDisease\tMESH:D001927\tbrain abnormalities\tPubTator3\n36801979\tDisease\tMESH:D020914\tfacial disproportion': 1, 'Craniofacial disproportion\tPubTator3\n36801979\tDisease\tMESH:D065632\tChikungunya': 1, 'chikungunya': 1, 'chikungunya fever': 1, 'maiden chikungunya\tPubTator3': 1, 'MESH\n36801979\tDisease\tMESH:D053591\tREFERENCES\tPubTator3\n36801979\tDisease\tMESH:D001068\tloss of appetite\tPubTator3\n36801979\tDisease\tMESH:D000022\tpregnancy losses\tPubTator3\n36801979\tDisease\tMESH:D000071243\tCZS': 1, 'congenital zika syndrome': 1, 'ZIKV infection': 1, 'zika virus infections': 1, 'ZIKV': 1, 'Zika virus infection': 1, 'Congenital Zika syndrome': 1, 'zika infections': 1, 'zika arboviral infections': 1, 'Zika': 1, 'zika\tPubTator3\n36801979\tDisease\tMESH:D006402\thematologic and gastrointestinal involvement\tPubTator3\n36801979\tDisease\tMESH:D004671\tarboviral infections': 1, 'Arboviral infections\tPubTator3\n36801979\tDisease\tMESH:D001176\tarthrogryposis\tPubTator3\n36801979\tDisease\tMESH:D002493\tneurological complications\tPubTator3\n36801979\tDisease\tMESH:D003616\tDandy Walker\tPubTator3\n36801979\tDisease\tMESH:D000208\tacute': 1, 'Acute\tPubTator3\n36801979\tDisease\tMESH:D000071072\tfebrile\tPubTator3\n36801979\tDisease\tMESH:D009896\toptic atrophy\tPubTator3\n36801979\tDisease\tMESH:D000079263\tPREVENTION\tPubTator3\n36801979\tDisease\tMESH:D010523\tperipheral oedema\tPubTator3\n36801979\tDisease\tMESH:D012769\tshock': 1, 'circulatory collapse\tPubTator3\n36801979\tDisease\tMESH:D000071069\tMedical Conditions\tPubTator3\n36801979\tDisease\tMESH:D020275\tGBS': 1, 'Guillain-Barre syndrome\tPubTator3\n36801979\tDisease\tMESH:D060825\tmultiorgan impairment\tPubTator3\n36801979\tDisease\tMESH:D005076\terythematous maculopapular rash': 1, 'rash': 1, 'urticarial rash': 1, 'maculopapular rash': 1, 'erythematous papular rash\tPubTator3\n36801979\tDisease\tMESH:D014786\tdeficits in visual acuity\tPubTator3\n36801979\tDisease\tMESH:D009325\tnausea\tPubTator3\n36801979\tDisease\tMESH:D009059\tlesions\tPubTator3\n36801979\tDisease\tMESH:C536227\tLeucopenia\tPubTator3\n36801979\tDisease\tMESH:C565406\tintellectually impaired\tPubTator3\n36801979\tDisease\tMESH:D018771\tjoint pains': 1, 'arthralgia\tPubTator3\n36801979\tDisease\tMESH:D005094\tproptosis\tPubTator3\n36801979\tDisease\tMESH:D003967\tdiarrhoea\tPubTator3\n36801979\tDisease\tMESH:D009421\tneurological and ocular defects\tPubTator3\n36801979\tDisease\tMESH:D013717\ttenosynovitis\tPubTator3\n36801979\tDisease\tMESH:D006396\thematemesis\tPubTator3\n36801979\tDisease\tMESH:D034381\tabnormal hearing\tPubTator3\n36801979\tDisease\tMESH:D002559\tcerebrospinal fluid\tPubTator3\n36801979\tDisease\tMESH:D007970\tleukopenia\tPubTator3\n36801979\tDisease\tMESH:C000629404\tacute myelitis\tPubTator3\n36801979\tDisease\tMESH:D009123\tpoor suck\tPubTator3\n36801979\tDisease\tMESH:C535542\tteratogenicity\tPubTator3\n36801979\tDisease\tMESH:C537836\thyperpigmented macules': 1, 'hyperpigmented lesions\tPubTator3\n36801979\tDisease\tMESH:D004890\terythema of\tPubTator3\n36801979\tDisease\tMESH:D063806\tmyalgia\tPubTator3\n36801979\tDisease\tMESH:D053609\tlethargy\tPubTator3\n36801979\tDisease\tMESH:D003490\tcyanosis\tPubTator3\n36801979\tDisease\tMESH:D011595\tfatigue restlessness\tPubTator3\n36801979\tDisease\tMESH:D009765\tobesity\tPubTator3\n36801979\tDisease\tMESH:C538190\tneurologic involvement\tPubTator3\n36801979\tDisease\tMESH:D000080344\tvermian hypoplasia\tPubTator3\n36801979\tDisease\tMESH:D001523\tirritability\tPubTator3\n36801979\tDisease\tMESH:D000743\tanaemia\tPubTator3\n36801979\tDisease\tMESH:D012128\trespiratory distress\tPubTator3\n36801979\tDisease\tMESH:D000090862\tneuroinflammation\tPubTator3\n36801979\tDisease\tMESH:D007239\tinfections': 1, 'Infection': 2, 'infection\tPubTator3\n36801979\tDisease\tMESH:D006261\theadache\tPubTator3\n36801979\tDisease\tMESH:D020274\timmune-mediated complications\tPubTator3\n36801979\tDisease\tMESH:D001102\tzika arbovirus infections': 1, 'arbovirus': 1, 'arbovirus infections\tPubTator3': 1, 'MESH\n36801979\tDisease\tMESH:D017490\tdesquamation of the skin': 1, 'desquamation\tPubTator3\n36801979\tDisease\tMESH:D000070631\tdiastasis\tPubTator3\n36801979\tDisease\tMESH:D000079426\tvector-borne diseases\tPubTator3\n36801979\tDisease\tMESH:D003294\tfebrile seizures\tPubTator3\n36801979\tDisease\tMESH:D001049\tapnoea\tPubTator3\n36801979\tDisease\tMESH:D009188\ttransverse myelitis\tPubTator3\n36801979\tDisease\tMESH:D001168\tarthritis\tPubTator3\n36801979\tDisease\tMESH:D004410\tRECOMMENDED READING\tPubTator3\n36801979\tDisease\tMESH:D009461\tneurological and developmental': 1, 'deficits in contrast sensitivity\tPubTator3\n36801979\tDisease\tMESH:D012872\tvesicular lesions\tPubTator3\n36801979\tDisease\tMESH:D007022\thypotension': 1, 'neonatal hypotension\tPubTator3\n36801979\tDisease\tMESH:D000070592\ttoe\tPubTator3\n36801979\tDisease\tMESH:D002658\tDevelopmental delay': 1, 'developmental delay\tPubTator3\n36801979\tDisease\tMESH:D003643\tdeaths': 1, 'died': 1, 'death\tPubTator3\n36801979\tDisease\tMESH:D056486\thepatic enzymes\tPubTator3\n36801979\tDisease\tMESH:D004673\tacute disseminated encephalomyelitis\tPubTator3\n36801979\tDisease\tMESH:D011248\tpregnancy complications\tPubTator3\n36801979\tDisease\tMESH:D003715\tDengue': 1, 'dengue': 1, 'dengue fever\tPubTator3': 1, 'MESH\n36801979\tDisease\tMESH:D000755\tsickle cell disease': 1, 'Sickle cell disease\tPubTator3\n36801979\tDisease\tMESH:D004827\tepilepsy\tPubTator3\n36801979\tDisease\tMESH:D008607\tneurodevelopmental\tPubTator3\n36801979\tDisease\tMESH:D002114\tcalcification\tPubTator3\n36801979\tDisease\tMESH:D008590\tmeningoencephalitis\tPubTator3\n36801979\tDisease\tMESH:D019595\tSevere dengue\tPubTator3\n36801979\tDisease\tMESH:D047928\tpreterm births\tPubTator3\n36801979\tDisease\tMESH:D008133\tprolonged\tPubTator3\n27894979\tDisease\tMESH:D005413\tflat dysplasia': 1, 'Flat Dysplasia\tPubTator3\n27894979\tDisease\tMESH:D009369\tCarcinoma': 1, 'tumor\tPubTator3\n27894979\tDisease\tMESH:D003966\tPDD\tPubTator3\n27894979\tDisease\tMESH:D015792\tdysplasia\tPubTator3\n27894979\tDisease\tMESH:D002278\t\tMESH\n27894979\tDisease\tMESH:D001749\t\tMESH\n8023979\tDisease\tMESH:D007511\tischemia\tPubTator3\n8023979\tDisease\tMESH:D017202\t\tMESH\n15901979\tDisease\tMESH:D007239\tinfections\tPubTator3': 1, 'MESH\n15901979\tDisease\tMESH:D007676\tend-stage renal disease\tPubTator3': 1, 'MESH\n15901979\tDisease\tMESH:D003141\tInfectious complications': 1, 'infectious complications\tPubTator3\n15901979\tDisease\tMESH:C564286\tzinc deficiency\tPubTator3\n15901979\tDisease\tMESH:D006816\tHD\tPubTator3\n24656979\tDisease\tMESH:D005767\tgastrointestinal complication\tPubTator3\n24656979\tDisease\tMESH:D007410\tintestinal injury\tPubTator3\n24656979\tDisease\tMESH:D004194\tGI disease\tPubTator3\n24656979\tDisease\tMESH:D001424\tbacterial\tPubTator3\n24656979\tDisease\tMESH:D020345\tNEC': 1, 'Necrotizing enterocolitis\tPubTator3': 1, 'MESH\n24656979\tDisease\tMESH:D013553\t\tMESH\n24656979\tDisease\tMESH:D004195\t\tMESH\n30849979\tDisease\tMESH:D009369\ttumor': 1, 'cancer': 3, 'cancers\tPubTator3\n30849979\tDisease\tMESH:D012327\tcirc-AS\tPubTator3\n30849979\tDisease\tMESH:D001749\tbladder cancer\tPubTator3': 1, 'MESH\n30849979\tDisease\tMESH:D018457\tRI\tPubTator3\n30849979\tDisease\tMESH:D002292\tClear cell renal clear cell carcinoma': 1, 'clear cell renal cell carcinoma': 1, 'clear cell carcinoma of kidney': 1, 'ccRCC\tPubTator3': 1, 'MESH\n30849979\tDisease\tMESH:D009371\tA5SS': 1, 'A3SS\tPubTator3\n30849979\tDisease\tMESH:D007680\t\tMESH\n38007979\tDisease\tMESH:D060085\tTCGN\tPubTator3\n13456979\tDisease\tMESH:D002822\t\tMESH\n5483979\tDisease\tMESH:D008607\t\tMESH\n36382979\tDisease\tMESH:D008169\tlung abscess\tPubTator3\n36382979\tDisease\tMESH:D000196\tpulmonary actinomycosis': 1, 'Actinomycosis': 1, 'Pulmonary actinomycosis\tPubTator3': 1, 'MESH\n36382979\tDisease\tMESH:D009369\tpulmonary neoplasia\tPubTator3\n36382979\tDisease\tMESH:D000437\talcoholism\tPubTator3\n36382979\tDisease\tMESH:D014376\ttuberculosis\tPubTator3\n36382979\tDisease\tMESH:D000197\tcervicofacial infection\tPubTator3\n36382979\tDisease\tMESH:D007154\timmune deficiency\tPubTator3\n36382979\tDisease\tMESH:D008171\t\tMESH\n36382979\tDisease\tMESH:D008175\t\tMESH\n12916979\tDisease\tMESH:D009369\tcancer\tPubTator3\n12916979\tDisease\tMESH:D010051\t\tMESH\n17616979\tDisease\tMESH:D003643\tDeath\tPubTator3\n17616979\tDisease\tMESH:D020022\t\tMESH\n31878979\tDisease\tMESH:D010146\tpain': 1, 'Pain\tPubTator3\n31878979\tDisease\tMESH:D001523\tmental disorders': 1, 'behavioral abnormalities\tPubTator3\n31878979\tDisease\tMESH:D001007\tanxiety\tPubTator3\n31878979\tDisease\tMESH:D015212\tIBD': 1, 'Inflammatory bowel disease': 1, 'inflammatory bowel disease\tPubTator3\n31878979\tDisease\tMESH:D053560\tIBS\tPubTator3\n31878979\tDisease\tMESH:D001008\tAnxiety related disorders': 1, 'anxiety-related disorders\tPubTator3\n31878979\tDisease\tMESH:D007249\tvisceral inflammation': 1, 'colonic inflammation': 1, 'peripheral inflammation': 1, 'inflammatory': 2, 'inflammation\tPubTator3\n31878979\tDisease\tMESH:D043183\tIBS\tPubTator3\n31878979\tDisease\tMESH:D019964\tmood\tPubTator3\n31878979\tDisease\tMESH:D003092\tcolitis': 1, 'Colitis\tPubTator3': 1, 'MESH\n31878979\tDisease\tMESH:D003865\tmajor depressive disorder': 1, 'MDD\tPubTator3\n31878979\tDisease\tMESH:D003866\tdepressive': 1, 'depression\tPubTator3\n31878979\tDisease\tMESH:D013736\tEPM\tPubTator3\n31878979\tDisease\tMESH:D001068\tNSFT\tPubTator3\n31878979\tDisease\tMESH:D000208\t\tMESH\n31878979\tDisease\tMESH:D004195\t\tMESH\n26491979\tDisease\tMESH:D064420\tcytotoxic\tPubTator3\n35012979\tDisease\tMESH:C000719206\tMTB\tPubTator3\n35012979\tDisease\tMESH:D000857\tOR\tPubTator3\n3244979\tDisease\tMESH:D012140\t\tMESH\n6805979\tDisease\tMESH:D007511\tischemia\tPubTator3\n3321979\tDisease\tMESH:D012769\tburn shock': 1, 'circulatory collapse\tPubTator3\n3321979\tDisease\tMESH:D020886\tthermal injury\tPubTator3\n3321979\tDisease\tMESH:D012774\t\tMESH\n3321979\tDisease\tMESH:D002056\t\tMESH\n29634979\tDisease\tMESH:D009442\tschwannomas\tPubTator3': 1, "MESH\n28901979\tDisease\tMESH:D002559\tFluid\tPubTator3\n28901979\tDisease\tMESH:D011183\t\tMESH\n11542979\tDisease\tMESH:D006973\thypertension\tPubTator3\n11542979\tDisease\tMESH:D054971\torthostatic intolerance\tPubTator3\n11542979\tDisease\tMESH:D054972\torthostatic tachycardia\tPubTator3\n11542979\tDisease\tMESH:D007024\t\tMESH\n11542979\tDisease\tMESH:D013610\t\tMESH\n17176979\tDisease\tMESH:D008228\tnon-Hodgkin's lymphoma": 1, 'NHL\tPubTator3': 1, 'MESH\n14152979\tDisease\tMESH:C536267\tRADIO\tPubTator3\n14152979\tDisease\tMESH:C536411\tPROTECTIVE\tPubTator3\n14152979\tDisease\tMESH:D000079524\tNARCOTICS\tPubTator3\n14152979\tDisease\tMESH:D007222\tEFFECT OF INERT GASES\tPubTator3\n14152979\tDisease\tMESH:D065606\tEFFECT\tPubTator3\n14152979\tDisease\tMESH:D011832\t\tMESH\n15413979\tDisease\tMESH:D011009\tpneumoconiosis\tPubTator3': 1, 'MESH\n27192979\tDisease\tMESH:D003643\tdeath\tPubTator3\n27192979\tDisease\tMESH:C566112\tArterial stiffness': 1, 'arterial stiffness': 1, 'stiffness\tPubTator3\n27192979\tDisease\tMESH:D015228\tHypertriglyceridemia\tPubTator3\n27192979\tDisease\tMESH:D018235\ttoxicity of smooth muscle\tPubTator3\n27192979\tDisease\tMESH:D007249\tinflammation\tPubTator3\n27192979\tDisease\tMESH:D003327\tCHD': 1, 'coronary heart disease\tPubTator3\n27192979\tDisease\tMESH:D007676\tESRD': 1, 'end-stage renal disease\tPubTator3\n27192979\tDisease\tMESH:D002318\tcardiovascular disease\tPubTator3\n27192979\tDisease\tMESH:D001161\tarteriosclerosis\tPubTator3\n27192979\tDisease\tMESH:D024821\tcardiometabolic abnormalities': 1, 'metabolic syndrome\tPubTator3\n27192979\tDisease\tMESH:D014652\tvascular disease': 1, 'endothelial dysfunction\tPubTator3\n27192979\tDisease\tMESH:D050197\tatherosclerotic disease': 1, 'atherosclerosis': 1, 'atherosclerotic lesions\tPubTator3\n27192979\tDisease\tMESH:D006973\thypertension': 1, 'Hypertension\tPubTator3\n27192979\tDisease\tMESH:D056988\tarterial wall damage\tPubTator3\n27192979\tDisease\tMESH:D051436\tChronic Kidney Disease\tPubTator3\n27192979\tDisease\tOMIM:261515\tDBP\tPubTator3\n27192979\tDisease\tMESH:C566031\tTGs\tPubTator3\n27192979\tDisease\tMESH:D007333\tinsulin resistance\tPubTator3\n27192979\tDisease\tMESH:D003920\tdiabetes mellitus': 1, 'Diabetes': 2, 'diabetes': 3, 'DM': 1, 'Diabetes mellitus\tPubTator3\n27192979\tDisease\tMESH:D056128\tabdominal obesity\tPubTator3\n22867979\tDisease\tMESH:D029424\tairway disease': 1, 'AD\tPubTator3\n22867979\tDisease\tMESH:D001172\tRA': 1, 'rheumatoid arthritis\tPubTator3': 1, 'MESH\n22867979\tDisease\tMESH:D017563\tILD': 1, 'interstitial lung disease\tPubTator3': 1, 'MESH\n22867979\tDisease\tMESH:D001982\t\tMESH\n20989979\tDisease\tMESH:D016780\tvivax malaria\tPubTator3': 1, 'MESH\n20989979\tDisease\tMESH:D008288\t\tMESH\n32510979\tDisease\tMESH:D019559\tleak\tPubTator3\n32510979\tDisease\tMESH:D012186\tretroperitoneal leak\tPubTator3\n32510979\tDisease\tMESH:D002915\tchylous ascites': 1, 'Chylous Ascites\tPubTator3': 1, 'MESH\n32510979\tDisease\tMESH:D010195\tpancreatitis\tPubTator3\n35439979\tDisease\tMESH:D009765\tObesity\tPubTator3\n35439979\tDisease\tMESH:D056844\trenal colic\tPubTator3\n35439979\tDisease\tMESH:D014515\tureteral stone\tPubTator3\n35439979\tDisease\tMESH:D010024\tosteoporosis\tPubTator3\n35439979\tDisease\tMESH:D006073\tgout\tPubTator3\n35439979\tDisease\tMESH:D006223\tCS\tPubTator3\n35439979\tDisease\tMESH:D034161\tPelvic or\tPubTator3\n35439979\tDisease\tMESH:D014570\tUrinary tract anomalies': 1, 'urinary tract anomalies\tPubTator3\n35439979\tDisease\tMESH:D053040\tnephrolithiasis': 1, 'Nephrolithiasis\tPubTator3\n35439979\tDisease\tMESH:D058426\tstone formation\tPubTator3\n35439979\tDisease\tMESH:D007669\tNephrolith': 1, 'kidney stones': 1, 'Calcium stone': 1, 'calcium stone': 1, 'Renal Calculi': 1, 'junction stone': 1, 'uric acid stone': 1, 'kidney stone disease': 1, 'Kidney stone disease': 1, 'renal stone formation': 1, 'kidney stone': 1, 'Uric acid stone': 1, 'stone formers': 1, 'pole stones': 1, 'Kidney Calculus': 1, 'Kidney stone': 1, 'ureterovesical junction stone': 1, 'stone': 1, 'KSD': 1, 'stones\tPubTator3': 1, 'MESH\n35439979\tDisease\tMESH:D003920\tDiabetes': 1, 'diabetes\tPubTator3\n35439979\tDisease\tMESH:D006949\thyperlipidemia\tPubTator3\n35439979\tDisease\tMESH:C535726\tDMC\tPubTator3\n35439979\tDisease\tMESH:C563477\tCalcium oxalate stone': 1, 'calcium oxalate stone\tPubTator3\n35439979\tDisease\tMESH:D024821\tMetabolic syndrome': 1, 'metabolic syndrome\tPubTator3\n35439979\tDisease\tMESH:D006417\thematuria\tPubTator3\n35439979\tDisease\tMESH:D006973\thypertension': 1, 'Hypertension\tPubTator3\n35439979\tDisease\tMESH:D014545\turinary calculi\tPubTator3\n35439979\tDisease\tMESH:D012008\t\tMESH\n1674979\tDisease\tMESH:D007239\tanaerobic infection': 1, 'orofacial infections': 1, 'oral infections\tPubTator3\n1674979\tDisease\tMESH:D017789\tPyogenic\tPubTator3\n1674979\tDisease\tMESH:D009059\t\tMESH\n1674979\tDisease\tMESH:D001442\t\tMESH\n1674979\tDisease\tMESH:D001424\t\tMESH\n1674979\tDisease\tMESH:D005491\t\tMESH\n25395979\tDisease\tMESH:D014832\tThought disturbance': 1, 'thought disturbance\tPubTator3\n25395979\tDisease\tMESH:D006259\thead injury\tPubTator3\n25395979\tDisease\tMESH:D006130\tdevelopmental abnormalities\tPubTator3\n25395979\tDisease\tMESH:D020210\tCIP\tPubTator3\n25395979\tDisease\tMESH:D010259\tParanoid': 1, 'paranoia': 1, 'paranoid': 1, 'paranoid/belligerence\tPubTator3\n25395979\tDisease\tMESH:D003866\tdepression\tPubTator3\n25395979\tDisease\tMESH:D006362\tgamma': 1, 'abnormalities in gamma activity': 1, 'gamma oscillations': 1, 'gamma abnormalities': 1, 'abnormal gamma oscillations\tPubTator3\n25395979\tDisease\tMESH:D006948\thyperactivity\tPubTator3\n25395979\tDisease\tMESH:D006212\tauditory hallucinations\tPubTator3\n25395979\tDisease\tMESH:D018980\tWilliams syndrome\tPubTator3\n25395979\tDisease\tMESH:D009358\tdisorders\tPubTator3\n25395979\tDisease\tMESH:D000069337\tstructural deficits in the inferior parietal lobule': 1, 'abnormalities of the inferior parietal lobule\tPubTator3\n25395979\tDisease\tMESH:D012559\tschizophrenia': 1, 'Schizophrenia': 1, 'SCZ\tPubTator3\n25395979\tDisease\tMESH:D019966\tsubstance dependence\tPubTator3\n25395979\tDisease\tMESH:D005600\tfragile X syndro-me\tPubTator3\n25395979\tDisease\tMESH:D012563\tdelusional\tPubTator3\n25395979\tDisease\tMESH:D000067877\tAutism spectrum disorders\tPubTator3\n25395979\tDisease\tMESH:D001523\tpsychiatric illness': 1, 'psychiatric disorder\tPubTator3\n25395979\tDisease\tMESH:D011618\tpsychoses': 1, 'psychosis': 1, 'psychotic symptoms\tPubTator3\n25395979\tDisease\tMESH:D009461\tneurological illness\tPubTator3\n25395979\tDisease\tMESH:D061219\tFRS\tPubTator3\n27039979\tDisease\tMESH:D002386\tcataract\tPubTator3\n27039979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n27039979\tDisease\tMESH:D005128\t\tMESH\n27039979\tDisease\tMESH:D011832\t\tMESH\n22345979\tDisease\tMESH:D000795\talpha-thal\tPubTator3\n22345979\tDisease\tMESH:D009358\tnutrient disorder\tPubTator3\n22345979\tDisease\tMESH:D018798\tIron deficiency anemia': 1, 'IDA\tPubTator3\n22345979\tDisease\tMESH:D013789\tthalassemias': 1, 'thalassemia\tPubTator3\n22345979\tDisease\tMESH:D017085\talpha+ thalassemia': 1, 'alpha-thalassemia': 1, 'alpha-thalassemias\tPubTator3\n22345979\tDisease\tOMIM:616959\tmicrocytosis\tPubTator3\n22345979\tDisease\tMESH:D017086\tbeta-thalassemia': 1, 'alpha- and beta-thalassemia': 1, 'alpha- and beta-thalassemias': 1, 'beta-thal': 1, 'alpha- and beta- thalassemias\tPubTator3\n22345979\tDisease\tMESH:C536357\tmicrocytic anemia\tPubTator3\n22345979\tDisease\tMESH:D006453\tHemoglobinopathies\tPubTator3\n22345979\tDisease\tMESH:D000740\tanemias': 1, 'anemia\tPubTator3\n30258979\tDisease\tMESH:D018487\tleft ventricular dysfunction\tPubTator3\n30258979\tDisease\tMESH:D003643\tdeath\tPubTator3\n30258979\tDisease\tMESH:D009461\tNeurologic disorder': 1, 'neurological disorder': 1, 'neurologic\tPubTator3\n30258979\tDisease\tMESH:D009205\tmyocarditis\tPubTator3\n30258979\tDisease\tMESH:D003324\tcoronary artery disease': 1, 'obstructive CAD': 1, 'Coronary artery disease': 1, 'CAD\tPubTator3\n30258979\tDisease\tMESH:D001523\tpsychiatric disorder': 1, 'mental illness': 1, 'psychiatric illness': 1, 'Psychiatric disorder': 1, 'mental illnesses\tPubTator3\n30258979\tDisease\tMESH:D012421\tplaque rupture\tPubTator3\n30258979\tDisease\tMESH:D009202\t) cardiomyopathy': 1, 'cardiomyopathy\tPubTator3\n30258979\tDisease\tMESH:D009203\tacute myocardial infarction': 1, 'AMI\tPubTator3\n30258979\tDisease\tMESH:D004417\tdyspnea': 1, 'Dyspnea\tPubTator3\n30258979\tDisease\tMESH:D015208\tsmoking\tPubTator3\n30258979\tDisease\tMESH:D006331\tsystolic dysfunction of the\tPubTator3\n30258979\tDisease\tMESH:D054058\tacute coronary syndrome\tPubTator3\n30258979\tDisease\tMESH:D002551\tventricle\tPubTator3\n30258979\tDisease\tMESH:D002318\tCVS\tPubTator3\n30258979\tDisease\tMESH:D002637\tChest pain': 1, 'chest pain\tPubTator3\n30258979\tDisease\tMESH:D054549\tTakotsubo cardiomyopathy': 1, 'Takotsubo (': 1, 'Takotsubo Cardiomyopathy': 1, 'Takotsubo': 1, 'Takotsubo CMP\tPubTator3\n30258979\tDisease\tMESH:D003866\tDepression': 1, 'depression\tPubTator3\n30258979\tDisease\tMESH:D001145\tarrhythmia\tPubTator3\n30258979\tDisease\tMESH:D012770\tcardiogenic shock': 1, 'Cardiogenic shock\tPubTator3\n30258979\tDisease\tMESH:D016388\tloss\tPubTator3\n30258979\tDisease\tMESH:D010673\tpheochromocytoma\tPubTator3\n12557979\tDisease\tMESH:D011127\tpolyp': 1, 'polyps\tPubTator3\n12557979\tDisease\tMESH:D003111\tcolonic polyps\tPubTator3': 1, 'MESH\n34461979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n4517979\tDisease\tMESH:C537767\tfacial cleft conditions\tPubTator3\n4517979\tDisease\tMESH:D005315\tfetal wastage\tPubTator3\n4517979\tDisease\tMESH:D011248\t\tMESH\n4517979\tDisease\tMESH:D002971\t\tMESH\n4517979\tDisease\tMESH:D005313\t\tMESH\n4517979\tDisease\tMESH:D000022\t\tMESH\n4517979\tDisease\tMESH:D000015\t\tMESH\n4517979\tDisease\tMESH:D002972\t\tMESH\n29372979\tDisease\tMESH:D002318\tCardiovascular Disease\tPubTator3': 1, 'MESH\n16061979\tDisease\tMESH:D007153\timmunodeficiency\tPubTator3\n16061979\tDisease\tOMIM:613390\tgroup O infection\tPubTator3\n16061979\tDisease\tMESH:D015658\t\tMESH\n30294979\tDisease\tMESH:D000076082\tmental health problems\tPubTator3\n30294979\tDisease\tMESH:D001523\tphysical and mental illness\tPubTator3\n30294979\tDisease\tMESH:D010554\tAggressive': 1, 'aggressive behaviour': 1, 'Aggression': 1, 'aggression': 1, 'aggressive\tPubTator3\n30294979\tDisease\tMESH:D002653\t\tMESH\n21974979\tDisease\tMESH:D007239\tinfection damage\tPubTator3\n21974979\tDisease\tMESH:D016388\tloss\tPubTator3\n21974979\tDisease\tMESH:D003731\tnectarine decay\tPubTator3\n956979\tDisease\tMESH:D007567\t\tMESH\n35817979\tDisease\tMESH:C563120\tCBS\tPubTator3\n35817979\tDisease\tMESH:D059327\tbrachydactyly\tPubTator3\n35817979\tDisease\tMESH:C566784\tshortening of thumb and index finger\tPubTator3\n35817979\tDisease\tMESH:C535850\tshortening of fingers\tPubTator3\n35817979\tDisease\tMESH:C580205\tInv\tPubTator3\n13780979\tDisease\tMESH:D018442\tNeisseria mucosa\tPubTator3\n20958979\tDisease\tMESH:D056784\tCACH/VWM': 1, 'leukoencephalopathy': 1, 'childhood ataxia with central hypomyelination': 1, 'VWM) syndrome': 1, 'CACH': 1, 'Vanishing white matter\tPubTator3': 1, 'MESH\n20958979\tDisease\tMESH:D015451\tPL\tPubTator3\n20958979\tDisease\tMESH:C564499\tovarian failure\tPubTator3\n20958979\tDisease\tMESH:D030342\tinherited disorders\tPubTator3\n20958979\tDisease\tMESH:C536043\teIF2B-related disorder\tPubTator3\n20958979\tDisease\tMESH:D007966\tautosomal recessive leukodystrophy': 1, 'Leukodystrophy': 1, 'leukodystrophies\tPubTator3\n20958979\tDisease\tMESH:D009422\tneurological deterioration\tPubTator3\n20958979\tDisease\tMESH:D020031\tEIL': 1, 'EBV\tPubTator3\n30539979\tDisease\tMESH:D001005\tanal incontinence\tPubTator3\n30539979\tDisease\tMESH:D013529\tdehiscence\tPubTator3\n30539979\tDisease\tMESH:D014549\tincontinence': 1, "Incontinence\tPubTator3\n30539979\tDisease\tMESH:D016156\tLIFT\tPubTator3\n30539979\tDisease\tMESH:D000080324\teffusions\tPubTator3\n30539979\tDisease\tMESH:D009122\tsphincter injury\tPubTator3\n30539979\tDisease\tMESH:D003424\tCrohn's disease\tPubTator3\n30539979\tDisease\tMESH:D005355\tfibrosis\tPubTator3\n30539979\tDisease\tMESH:D000069337\tHorseshoe": 1, 'horseshoe': 1, 'horseshoe fistula\tPubTator3\n30539979\tDisease\tMESH:D015212\tinflammatory bowel disease\tPubTator3\n30539979\tDisease\tMESH:D017695\tnecrotic tissue\tPubTator3\n30539979\tDisease\tMESH:D012003\tanal fistula': 1, 'anal fistulas\tPubTator3': 1, 'MESH\n30539979\tDisease\tMESH:D000038\tanal abscess': 1, 'perianal abscess\tPubTator3\n30539979\tDisease\tMESH:D017577\texternal\tPubTator3\n30539979\tDisease\tMESH:D009336\tnecrosis\tPubTator3\n30539979\tDisease\tMESH:D009369\tmalignancy\tPubTator3\n30539979\tDisease\tMESH:D005401\tfistula-in-ano\tPubTator3\n30539979\tDisease\tMESH:D007239\tinfection': 1, 'infected': 1, 'infections\tPubTator3\n30539979\tDisease\tMESH:D005402\tFISTULA': 1, 'fistula': 1, 'transsphincteric fistula': 1, 'fistula-': 1, 'COMPLEX FISTULA-IN-ANO': 1, 'intrasphincter fistula': 1, 'infected fistula': 1, 'fistulas': 1, 'sphincter fistula\tPubTator3\n30539979\tDisease\tMESH:D011248\tLONG-TERM OUTCOMES\tPubTator3\n30539979\tDisease\tMESH:D005242\t\tMESH\n24449979\tDisease\tMESH:D003924\ttype 2 diabetes\tPubTator3\n24449979\tDisease\tMESH:D009765\tobese\tPubTator3': 1, 'MESH\n24449979\tDisease\tMESH:D001791\tplatelet aggregation\tPubTator3\n24449979\tDisease\tMESH:D054318\tCSFP': 1, 'Coronary slow flow phenomenon': 1, 'coronary slow flow phenomenon\tPubTator3': 1, 'MESH\n24412979\tDisease\tMESH:D002534\thypoxic\tPubTator3\n24412979\tDisease\tMESH:D006331\tdysfunction\tPubTator3\n16672979\tDisease\tMESH:D008607\tmental retardation\tPubTator3\n16672979\tDisease\tMESH:D000022\tmiscarriages\tPubTator3\n16281979\tDisease\tMESH:D018805\tsepticemia\tPubTator3\n16281979\tDisease\tMESH:D001424\tbacterial infections\tPubTator3\n16281979\tDisease\tMESH:D007239\tinfections\tPubTator3\n16281979\tDisease\tMESH:C000719195\tVIDUS': 1, 'IDU\tPubTator3\n16281979\tDisease\tMESH:D002032\tBingeing\tPubTator3\n16281979\tDisease\tMESH:D000038\tskin abscesses': 1, 'Abscess': 1, 'Abscesses': 1, 'abscess': 1, 'abscesses\tPubTator3\n16281979\tDisease\tMESH:D000081015\tdrug\tPubTator3\n16281979\tDisease\tMESH:D015658\tHIV infection': 1, 'HIV': 2, 'HIV infected\tPubTator3\n16281979\tDisease\tMESH:D004696\tendocarditis\tPubTator3\n16281979\tDisease\tMESH:D010019\tosteomyelitis\tPubTator3\n16281979\tDisease\tMESH:D002481\tcellulitis\tPubTator3\n32389979\tDisease\tMESH:D046152\tGIST': 1, 'gastrointestinal stromal tumor': 1, 'Gastric Gastrointestinal Stromal Tumor': 1, 'gastric GIST\tPubTator3': 1, 'MESH\n32389979\tDisease\tMESH:D009369\ttumor\tPubTator3\n32389979\tDisease\tMESH:D000007\tabdominal discomfort\tPubTator3\n32389979\tDisease\tMESH:D009362\tmetastasis\tPubTator3\n32389979\tDisease\tMESH:D009364\t\tMESH\n32389979\tDisease\tMESH:D005770\t\tMESH\n36035979\tDisease\tMESH:D008881\tMigraine': 1, 'Migraines': 1, 'migraines': 1, 'migraine\tPubTator3\n36035979\tDisease\tMESH:D020326\tmigraines without aura\tPubTator3\n20155979\tDisease\tMESH:D020521\tstroke\tPubTator3\n20155979\tDisease\tMESH:D004827\tepilepsy\tPubTator3\n20155979\tDisease\tMESH:D006331\tDysfunction\tPubTator3\n20155979\tDisease\tMESH:D006938\tLBD\tPubTator3\n20155979\tDisease\tMESH:D007153\tATD\tPubTator3\n20155979\tDisease\tMESH:D009410\tneuronal disorders\tPubTator3\n33552979\tDisease\tMESH:D005831\tFIGO\tPubTator3\n33552979\tDisease\tMESH:D002296\tcarcinosarcomas\tPubTator3\n33552979\tDisease\tMESH:D060737\tfemale genital tract malignancies\tPubTator3\n33552979\tDisease\tMESH:D009369\ttumor': 1, 'tumors': 4, 'Cancer': 6, 'Tumor': 3, 'malignancy\tPubTator3\n33552979\tDisease\tMESH:C537730\tII\tPubTator3\n33552979\tDisease\tMESH:D036821\tLG-ESS\tPubTator3\n33552979\tDisease\tMESH:D014570\tintestinal or urinary tract toxicity\tPubTator3\n33552979\tDisease\tMESH:D018203\tEndometrial Stromal Sarcoma': 1, 'endometrial stromal sarcoma': 1, 'Endometrial stromal sarcoma\tPubTator3\n33552979\tDisease\tMESH:D011271\textrauterine disease\tPubTator3\n33552979\tDisease\tMESH:D034161\tpelvic recurrence\tPubTator3\n33552979\tDisease\tMESH:D014594\tuterine tumors\tPubTator3\n33552979\tDisease\tMESH:D003643\tdeath\tPubTator3\n33552979\tDisease\tMESH:D062706\tstage\tPubTator3\n33552979\tDisease\tMESH:D058625\tstage I to II disease\tPubTator3\n33552979\tDisease\tMESH:D051437\tpelvic failure': 1, 'abdominal failure\tPubTator3\n33552979\tDisease\tMESH:D007889\tuterine fibroids\tPubTator3\n33552979\tDisease\tMESH:D006402\thematological toxicity\tPubTator3\n33552979\tDisease\tMESH:D012509\tuterine sarcoma': 1, 'US': 1, 'uterine sarcomas': 1, 'Uterine sarcoma\tPubTator3\n33552979\tDisease\tMESH:D005833\tgynecological tumor\tPubTator3\n33552979\tDisease\tMESH:C535700\tmalignant mesenchymal tumor\tPubTator3\n33552979\tDisease\tMESH:D011832\tRadiation toxicities\tPubTator3\n33552979\tDisease\tMESH:D009362\tmetastasis\tPubTator3\n33552979\tDisease\tMESH:D000292\tpelvic disease\tPubTator3\n33552979\tDisease\tMESH:C567452\tIB\tPubTator3\n33552979\tDisease\tMESH:D009800\tLow-\tPubTator3\n33552979\tDisease\tMESH:D007890\tuterine leiomyosarcoma': 1, 'leiomyosarcoma\tPubTator3\n33552979\tDisease\tMESH:D064420\ttoxicities': 1, 'toxicity\tPubTator3\n11325979\tDisease\tMESH:D008589\t\tMESH\n3087979\tDisease\tMESH:D002051\t\tMESH\n8913979\tDisease\tMESH:D005317\tfetal growth retardation\tPubTator3': 1, 'MESH\n8913979\tDisease\tMESH:D007003\thypoglycemia\tPubTator3': 1, 'MESH\n8913979\tDisease\tMESH:D006130\tgrowth retardation\tPubTator3\n12689979\tDisease\tMESH:D018908\t\tMESH\n12689979\tDisease\tMESH:D003882\t\tMESH\n32444979\tDisease\tMESH:D016864\tLi-Fraumeni syndrome\tPubTator3\n32444979\tDisease\tMESH:D005909\tGBM': 1, 'glioblastomas': 1, 'WHO grade IV astrocytoma': 1, 'glioblastoma\tPubTator3\n32444979\tDisease\tMESH:D003967\tdiarrhea\tPubTator3\n32444979\tDisease\tMESH:D019586\televated intracranial pressure\tPubTator3\n32444979\tDisease\tMESH:D000860\thypoxemia\tPubTator3\n32444979\tDisease\tMESH:D008228\tLow-grade gliomas': 1, 'LGG\tPubTator3\n32444979\tDisease\tMESH:D009837\toligodendroglioma': 1, 'anaplastic oligodendrogliomas': 1, 'oligodendrogliomas\tPubTator3\n32444979\tDisease\tMESH:C536044\tII and III\tPubTator3\n32444979\tDisease\tMESH:D009386\tinherited tumor\tPubTator3\n32444979\tDisease\tMESH:D000092124\tWHO\tPubTator3\n32444979\tDisease\tMESH:D009369\tmalignancies': 1, 'tumor': 5, 'cancers': 3, 'Tumor\tPubTator3\n32444979\tDisease\tMESH:D001943\tbreast cancer\tPubTator3\n32444979\tDisease\tMESH:D006261\theadaches\tPubTator3\n32444979\tDisease\tMESH:D009503\tneutropenia\tPubTator3\n32444979\tDisease\tMESH:D016543\tCNS tumors\tPubTator3\n32444979\tDisease\tMESH:D015470\tacute myeloid leukemia': 1, 'AML\tPubTator3\n32444979\tDisease\tMESH:D001289\tmotor or sensory deficits\tPubTator3\n32444979\tDisease\tMESH:D007938\tleukemias\tPubTator3\n32444979\tDisease\tMESH:D003643\tdeath': 1, 'premature death\tPubTator3\n32444979\tDisease\tMESH:D009461\tneurological deficits': 1, 'neurologic deficits\tPubTator3\n32444979\tDisease\tMESH:D009190\tmyelodysplastic syndromes\tPubTator3\n32444979\tDisease\tMESH:D014839\tvomiting\tPubTator3\n32444979\tDisease\tMESH:D006402\thematological toxicities\tPubTator3\n32444979\tDisease\tMESH:D018302\tneuroepithelial neoplasms\tPubTator3\n32444979\tDisease\tMESH:D002813\tchondrosarcoma\tPubTator3\n32444979\tDisease\tMESH:D003123\tLynch syndrome\tPubTator3\n32444979\tDisease\tMESH:D001254\tastrocytoma': 1, 'grade II and III astrocytic tumors': 1, 'WHO grade II and III gliomas': 1, 'astrocytomas\tPubTator3': 1, 'MESH\n32444979\tDisease\tMESH:D000072662\tSTR\tPubTator3\n32444979\tDisease\tMESH:D005910\tglial tumors': 1, 'Gliomas': 1, 'gliomas': 1, 'glioma\tPubTator3': 1, 'MESH\n32444979\tDisease\tMESH:D001037\taphasia\tPubTator3\n32444979\tDisease\tMESH:D018281\tcholangiocarcinoma\tPubTator3\n32444979\tDisease\tMESH:D012141\tupper respiratory tract infections\tPubTator3\n32444979\tDisease\tMESH:D009325\tnausea\tPubTator3\n32444979\tDisease\tMESH:D012640\tseizures\tPubTator3\n32444979\tDisease\tMESH:D000740\tanemia\tPubTator3\n32444979\tDisease\tMESH:D001932\tbrain tumor': 1, 'brain tumors\tPubTator3': 1, "MESH\n32444979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n32444979\tDisease\tMESH:D063646\ttumorigenesis\tPubTator3\n25475979\tDisease\tMESH:D000544\tAlzheimer's disease\tPubTator3\n17513979\tDisease\tMESH:D004421\tDystonia\tPubTator3": 1, 'MESH\n19997979\tDisease\tMESH:D005355\tfibrosis\tPubTator3\n19997979\tDisease\tMESH:C538445\tmetastatic carcinoma\tPubTator3\n19997979\tDisease\tMESH:D017093\tnecrotic nodule of the liver\tPubTator3\n19997979\tDisease\tMESH:D016606\tnecrotic nodule': 1, 'necrotic nodules\tPubTator3\n19997979\tDisease\tMESH:D009369\tmetastatic tumors': 1, 'malignancy\tPubTator3\n19997979\tDisease\tMESH:D004443\thydatid cyst\tPubTator3\n19997979\tDisease\tMESH:D009336\tnecrotic\tPubTator3': 1, 'MESH\n19997979\tDisease\tMESH:D008113\t\tMESH\n19997979\tDisease\tMESH:D004444\t\tMESH\n28570979\tDisease\tMESH:D009369\tCancer': 1, 'tumor\tPubTator3\n28570979\tDisease\tMESH:D006528\tHepatocellular carcinoma\tPubTator3': 1, 'MESH\n28570979\tDisease\tMESH:D008113\t\tMESH\n11820979\tDisease\tMESH:D001929\tEdematous-erythematous lesion\tPubTator3\n11820979\tDisease\tMESH:D006229\t\tMESH\n11820979\tDisease\tMESH:D004890\t\tMESH\n11820979\tDisease\tMESH:D004487\t\tMESH\n11820979\tDisease\tMESH:D009784\t\tMESH\n11820979\tDisease\tMESH:D004887\t\tMESH\n30616979\tDisease\tMESH:D008232\tlymphoproliferative disease\tPubTator3': 1, 'MESH\n30616979\tDisease\tMESH:D007249\tmulti-organ inflammation': 1, "inflammation\tPubTator3\n30616979\tDisease\tMESH:D011014\t\tMESH\n18095979\tDisease\tMESH:D006732\tHorner's syndrome\tPubTator3": 1, 'MESH\n18095979\tDisease\tMESH:D000798\t\tMESH\n14644979\tDisease\tMESH:D001523\tChild psychiatric disorder\tPubTator3\n25572979\tDisease\tMESH:D005402\tfistulas\tPubTator3\n15458979\tDisease\tMESH:D050197\tatherosclerotic lesions': 1, 'Atherosclerosis': 1, 'atherogenesis': 1, 'atherosclerosis\tPubTator3\n15458979\tDisease\tMESH:D001018\taortic lesions\tPubTator3\n15458979\tDisease\tMESH:D013927\tthrombotic\tPubTator3\n15458979\tDisease\tMESH:D058226\tatherosclerotic plaque\tPubTator3\n15458979\tDisease\tMESH:D007249\tinflammatory\tPubTator3': 1, 'MESH\n15458979\tDisease\tMESH:D001161\t\tMESH\n36449979\tDisease\tMESH:D000086382\tCOVID-19\tPubTator3\n36449979\tDisease\tMESH:D015658\tHIV\tPubTator3\n36449979\tDisease\tMESH:D055985\tlatent tuberculosis\tPubTator3': 1, 'MESH\n36449979\tDisease\tMESH:D003643\tdeaths\tPubTator3\n36449979\tDisease\tMESH:D007239\tinfection': 1, 'infected\tPubTator3\n36449979\tDisease\tMESH:D014376\tTuberculosis': 1, 'TB infection\tPubTator3\n8019979\tDisease\tMESH:D008107\tliver lesions\tPubTator3\n8019979\tDisease\tMESH:D008113\tliver tumors\tPubTator3\n8019979\tDisease\tMESH:D009369\tmalignancies': 1, 'malignant\tPubTator3\n8019979\tDisease\tMESH:D007680\tkidney tumors\tPubTator3': 1, 'MESH\n8019979\tDisease\tMESH:D063646\tliver carcinogenesis\tPubTator3\n8019979\tDisease\tMESH:D001835\t\tMESH\n8019979\tDisease\tMESH:D008114\t\tMESH\n35855979\tDisease\tMESH:D005955\tEC\tPubTator3\n34546979\tDisease\tMESH:D007249\tsystemic inflammation': 1, 'inflammation': 4, 'chronic inflammation': 3, 'inflammatory\tPubTator3\n34546979\tDisease\tMESH:D019966\tsubstance use': 1, 'Dependence': 1, 'Substance Dependence\tPubTator3\n34546979\tDisease\tMESH:D000038\tabscess': 1, 'abscesses\tPubTator3\n34546979\tDisease\tMESH:D003924\ttype 2 diabetes mellitus\tPubTator3\n34546979\tDisease\tMESH:D004194\tcomorbidity': 1, 'Diseases\tPubTator3\n34546979\tDisease\tMESH:D007247\tFemale infertility': 1, 'female infertility\tPubTator3\n34546979\tDisease\tMESH:D009765\tobesity\tPubTator3\n34546979\tDisease\tMESH:D012878\tskin cancers\tPubTator3\n34546979\tDisease\tMESH:D013167\tankylosing spondylitis\tPubTator3\n34546979\tDisease\tMESH:D003327\tcoronary heart disease\tPubTator3\n34546979\tDisease\tMESH:D002294\tSCC': 1, 'squamous cell carcinoma\tPubTator3\n34546979\tDisease\tMESH:D015212\tinflammatory bowel disease\tPubTator3\n34546979\tDisease\tMESH:D009203\tmyocardial infarction': 1, 'MI\tPubTator3\n34546979\tDisease\tMESH:D020521\tcerebrovascular accident': 1, 'CVA\tPubTator3\n34546979\tDisease\tMESH:D001327\tautoimmune disease': 1, 'autoimmune diseases': 2, 'autoimmune': 1, 'autoimmune comorbidities': 1, 'Autoimmune conditions\tPubTator3\n34546979\tDisease\tMESH:D013927\tthrombosis\tPubTator3\n34546979\tDisease\tMESH:D050171\tdyslipidemia\tPubTator3\n34546979\tDisease\tMESH:D001523\tpsychiatric conditions': 1, 'autoimmune, and psychiatric comorbidities\tPubTator3\n34546979\tDisease\tMESH:D007239\tinfections\tPubTator3\n34546979\tDisease\tMESH:D000152\tAcne': 1, 'acne\tPubTator3\n34546979\tDisease\tMESH:D011085\tpolycystic ovary syndrome': 1, 'PCOS\tPubTator3\n34546979\tDisease\tMESH:D006965\tepidermal hyperplasia\tPubTator3\n34546979\tDisease\tMESH:D010146\tpain\tPubTator3\n34546979\tDisease\tMESH:D015619\tsystemic\tPubTator3\n34546979\tDisease\tMESH:D012868\tinflammatory skin disorder': 1, 'inflammatory skin disorders\tPubTator3\n34546979\tDisease\tMESH:D012871\tinflammatory skin disease': 1, 'skin disorder\tPubTator3\n34546979\tDisease\tMESH:D002481\tCellulitis': 1, 'cellulitis\tPubTator3\n34546979\tDisease\tMESH:D017488\thyperkeratosis\tPubTator3\n34546979\tDisease\tMESH:D008659\tMetabolic': 1, 'metabolic\tPubTator3\n34546979\tDisease\tOMIM:603663\tmental health disease': 1, 'mental health disorders\tPubTator3\n34546979\tDisease\tMESH:D003920\tdiabetes\tPubTator3\n34546979\tDisease\tMESH:D011565\tpsoriasis\tPubTator3\n34546979\tDisease\tMESH:D001157\tfollicular occlusion\tPubTator3\n34546979\tDisease\tMESH:D000082122\tInternational\tPubTator3\n34546979\tDisease\tMESH:C562393\tcutaneous malignancies': 1, 'cutaneous malignancy\tPubTator3\n34546979\tDisease\tMESH:D003141\tinfectious complications\tPubTator3\n34546979\tDisease\tMESH:D009103\tmultiple sclerosis\tPubTator3\n34546979\tDisease\tMESH:D002318\tcardiovascular disease': 1, 'cardiovascular death\tPubTator3\n34546979\tDisease\tMESH:D017497\tHS lesions': 1, 'Hidradenitis suppurativa': 1, 'HS disease': 1, 'HS lesion': 1, 'HS': 1, 'acne inversa': 1, 'hidradenitis suppurativa\tPubTator3': 1, 'MESH\n34546979\tDisease\tMESH:D003072\tfunctional impairment\tPubTator3\n34546979\tDisease\tMESH:D050197\tatherosclerosis\tPubTator3\n34546979\tDisease\tMESH:D001172\trheumatoid arthritis\tPubTator3\n34546979\tDisease\tMESH:D006973\thypertension\tPubTator3\n34546979\tDisease\tMESH:D024821\tmetabolic syndrome\tPubTator3\n34546979\tDisease\tMESH:D010864\tpilonidal cyst\tPubTator3\n30292979\tDisease\tMESH:D009369\tneuroendocrine tumours': 1, 'neoplasms': 1, 'tumour': 1, 'Neuroendocrine tumours': 1, 'malignancies': 3, 'NETs\tPubTator3\n30292979\tDisease\tMESH:D018358\t\tMESH\n30292979\tDisease\tMESH:D009360\t\tMESH\n36781979\tDisease\tMESH:D006973\thypertension\tPubTator3': 1, 'MESH\n30531979\tDisease\tMESH:D012772\tseptic shock\tPubTator3\n30531979\tDisease\tMESH:D007239\tInfection': 1, 'infection\tPubTator3\n30531979\tDisease\tMESH:D001424\tbacterial infections\tPubTator3\n30531979\tDisease\tMESH:D018805\tsepsis\tPubTator3\n30531979\tDisease\tMESH:D056587\tcryopyrin-associated periodic syndromes\tPubTator3\n30531979\tDisease\tMESH:D003967\tdiarrhoea\tPubTator3\n30531979\tDisease\tMESH:D007249\tinflammatory': 1, 'gastrointestinal inflammation': 1, 'skin inflammation\tPubTator3': 1, 'MESH\n30531979\tDisease\tMESH:D008580\tmeningitis\tPubTator3\n30531979\tDisease\tMESH:D014777\tviral infections\tPubTator3\n30531979\tDisease\tMESH:D011014\tpneumonia\tPubTator3\n30531979\tDisease\tMESH:D005767\textra-gastrointestinal infections\tPubTator3\n30531979\tDisease\tMESH:D009103\tmultiple sclerosis\tPubTator3\n30531979\tDisease\tMESH:D065626\tnon-alcoholic fatty liver disease\tPubTator3\n30531979\tDisease\tMESH:D064420\tCytotoxicity\tPubTator3\n30531979\tDisease\tMESH:D002051\tHBL\tPubTator3\n30531979\tDisease\tMESH:D019446\tendotoxemia\tPubTator3\n30531979\tDisease\tMESH:D014839\tvomiting\tPubTator3\n30531979\tDisease\tMESH:D056770\tNS\tPubTator3\n30531979\tDisease\tMESH:C537849\tND\tPubTator3\n12925979\tDisease\tMESH:D065309\tAtypical squamous cells of undetermined significance': 1, 'ASCUS': 1, 'atypical squamous cells of undetermined significance\tPubTator3\n12925979\tDisease\tMESH:D000081483\tHSIL': 1, 'SIL': 1, 'LSIL': 1, 'squamous intraepithelial lesions\tPubTator3\n12925979\tDisease\tMESH:D014412\t\tMESH\n12925979\tDisease\tMESH:D018290\t\tMESH\n12925979\tDisease\tMESH:D002583\t\tMESH\n12925979\tDisease\tMESH:D030361\t\tMESH\n32973979\tDisease\tMESH:D019966\tsubstance abuse\tPubTator3\n32973979\tDisease\tMESH:D004194\tDiseases\tPubTator3\n32973979\tDisease\tMESH:D009358\tdementing disorders': 1, 'dementing disorder\tPubTator3\n32973979\tDisease\tMESH:D003704\tdementia': 1, 'Dementia\tPubTator3\n32973979\tDisease\tMESH:D001925\tbrain damage\tPubTator3\n32973979\tDisease\tMESH:D020521\tStroke\tPubTator3\n32973979\tDisease\tMESH:D001007\tanxiety\tPubTator3\n32973979\tDisease\tMESH:D015140\tvascular dementia\tPubTator3\n32973979\tDisease\tMESH:D001523\tpsychiatric disorders': 1, 'Mental Disorders\tPubTator3\n32973979\tDisease\tMESH:D019973\tProblems\tPubTator3\n32973979\tDisease\tMESH:D006011\tDSM-IV\tPubTator3\n32973979\tDisease\tMESH:D056770\tNS\tPubTator3\n32973979\tDisease\tMESH:D060825\tamnestic MCI': 1, 'MCI': 1, 'mild cognitive impairment\tPubTator3\n32973979\tDisease\tMESH:D003147\tNeurological and Communicative Disorders and Stroke': 1, 'Neurological and Communicative Disorders\tPubTator3\n32973979\tDisease\tMESH:D009410\tneuronal damage\tPubTator3\n32973979\tDisease\tMESH:D008569\tmemory complaints\tPubTator3\n32973979\tDisease\tMESH:D012893\tsleep problems\tPubTator3\n32973979\tDisease\tMESH:D020961\tLewy body dementia\tPubTator3\n32973979\tDisease\tMESH:D001284\tatrophy of the\tPubTator3\n32973979\tDisease\tMESH:D003866\tdepression': 1, 'depressive symptoms\tPubTator3\n32973979\tDisease\tMESH:D003072\tcognitive complaints': 1, 'Cognitive impairment': 1, 'cognitive decline': 1, 'cognitive (or memory) impairment': 1, 'cognitive impairment': 1, 'cognitive impairments': 1, 'SCD\tPubTator3\n32973979\tDisease\tMESH:D000544\tAlzheimer disease': 1, "Alzheimer's": 1, "Alzheimer's Disease": 1, 'AD': 1, "Alzheimer's Disease and Related Disorders\tPubTator3\n21067979\tDisease\tMESH:D004827\tepileptic seizures\tPubTator3\n21067979\tDisease\tMESH:D012640\tseizure": 1, 'seizures\tPubTator3': 1, 'MESH': 1, 'CTD\n21067979\tDisease\tMESH:D004198\t\tMESH\n21067979\tDisease\tMESH:D011297\t\tCTD': 1, 'MESH\n13311979\tDisease\tMESH:D006258\tmalignancy of the head and neck\tPubTator3': 1, 'MESH\n29463979\tDisease\tMESH:D000073296\tNCDs': 1, 'noncommunicable diseases\tPubTator3\n29463979\tDisease\tMESH:D006973\thypertension': 1, 'Hypertension\tPubTator3\n29463979\tDisease\tMESH:D003920\tDiabetes': 1, 'diabetes\tPubTator3\n29463979\tDisease\tMESH:D051437\trenal failure\tPubTator3\n29463979\tDisease\tMESH:D017202\tischemic heart disease\tPubTator3\n29463979\tDisease\tMESH:D001007\tanxiety\tPubTator3\n29463979\tDisease\tMESH:D006333\tcongestive heart failure': 1, 'heart failure\tPubTator3\n29463979\tDisease\tMESH:D029424\tchronic obstructive pulmonary disease\tPubTator3\n29463979\tDisease\tMESH:D003643\tdeath': 1, 'deaths\tPubTator3\n29463979\tDisease\tMESH:D020521\tstroke\tPubTator3\n29463979\tDisease\tMESH:D002908\tchronic illnesses': 1, 'chronically ill\tPubTator3\n29463979\tDisease\tMESH:D006331\theart disease\tPubTator3\n29463979\tDisease\tMESH:D003327\tcoronary heart disease\tPubTator3\n29463979\tDisease\tMESH:C537985\tID\tPubTator3\n29463979\tDisease\tMESH:D003924\ttype 2 diabetes': 1, 'Diabetes type 2 CVD\tPubTator3\n27546979\tDisease\tMESH:D000073376\tNSFH\tPubTator3\n27546979\tDisease\tMESH:D060825\tDecline\tPubTator3\n27546979\tDisease\tMESH:D010538\tPMSA\tPubTator3\n27546979\tDisease\tMESH:D014717\tSWB\tPubTator3\n27546979\tDisease\tMESH:D010146\tpain and': 1, 'pain\tPubTator3\n27546979\tDisease\tMESH:D001523\tBRFSS\tPubTator3\n5647979\tDisease\tMESH:D015775\tStress fracture of the femur\tPubTator3\n5647979\tDisease\tMESH:D000081084\taccident\tPubTator3\n5647979\tDisease\tMESH:D005264\t\tMESH\n5647979\tDisease\tMESH:D009784\t\tMESH\n35636979\tDisease\tMESH:D012421\tacute Achilles tendon rupture': 1, 'Achilles Tendon Rupture': 1, 'AATR\tPubTator3': 1, 'MESH\n35636979\tDisease\tMESH:D016512\t\tMESH\n35636979\tDisease\tMESH:D000208\t\tMESH\n35636979\tDisease\tMESH:D013708\t\tMESH\n22620979\tDisease\tMESH:D009369\tcancer': 1, 'tumors\tPubTator3': 1, 'MESH\n22620979\tDisease\tMESH:D007938\tleukemias\tPubTator3\n22620979\tDisease\tMESH:D019337\thematological malignancies\tPubTator3\n22620979\tDisease\tMESH:D011371\tprogeria\tPubTator3': 1, 'MESH\n28699979\tDisease\tMESH:D003490\tcyanosis\tPubTator3\n28699979\tDisease\tMESH:D064752\taneurysmatic right atrium': 1, 'Aneurysmatic right atrium\tPubTator3\n28699979\tDisease\tMESH:D006345\tventricular septal defect': 1, 'VSD\tPubTator3': 1, 'MESH\n28699979\tDisease\tMESH:D011666\tpulmonary stenosis\tPubTator3\n28699979\tDisease\tMESH:D024741\tventricular hypertrophy\tPubTator3\n28699979\tDisease\tMESH:D000013\tcongenital anomaly\tPubTator3\n28699979\tDisease\tMESH:D014262\ttricuspid regurgitation\tPubTator3\n28699979\tDisease\tMESH:D000860\tHypoxemia': 1, 'hypoxia\tPubTator3': 1, 'MESH\n28699979\tDisease\tMESH:D006344\tatrial septal defect': 1, 'Ostium secundum ASD': 1, 'ASD\tPubTator3\n28699979\tDisease\tMESH:D013771\ttetralogy of Fallot\tPubTator3\n28699979\tDisease\tMESH:C536106\thypertrophied muscle\tPubTator3\n28699979\tDisease\tMESH:D000402\tMuscular obstruction\tPubTator3\n28699979\tDisease\tMESH:D054537\tatrioventricular discordance\tPubTator3\n28699979\tDisease\tMESH:D006332\tcardiomegaly\tPubTator3\n28699979\tDisease\tMESH:D006984\thypertrophied': 1, 'hypertrophy\tPubTator3\n28699979\tDisease\tMESH:D000092243\tobstruction in the right ventricular\tPubTator3\n28699979\tDisease\tMESH:D000080041\tcorrected transposition of the great arteries\tPubTator3\n28699979\tDisease\tMESH:D019190\tventricular overload\tPubTator3\n28699979\tDisease\tMESH:D002278\tsitus solitus\tPubTator3\n28699979\tDisease\tMESH:D003914\tdextrocardia': 1, 'Dextrocardia': 1, 'dextrocardia with situs solitus\tPubTator3': 1, 'MESH\n28699979\tDisease\tMESH:D003251\tstenosis of the inlet': 1, 'stenosis': 1, 'Stenosis\tPubTator3\n28699979\tDisease\tMESH:D006330\tcongenital heart disease\tPubTator3\n28699979\tDisease\tMESH:C562451\tAtrial Shunt\tPubTator3\n28699979\tDisease\tMESH:D054160\tejection murmur': 1, 'systolic murmur': 1, 'regurgitation systolic murmur\tPubTator3\n28699979\tDisease\tMESH:D018497\tright ventricular overload\tPubTator3\n28699979\tDisease\tMESH:D014188\ttransposition of the great arteries\tPubTator3\n28699979\tDisease\tMESH:D004374\tductus arteriosus': 1, 'PDA\tPubTator3\n28699979\tDisease\tMESH:C535682\tRight Ventricle': 1, 'RV\tPubTator3\n28699979\tDisease\tMESH:D001024\t\tMESH\n1226979\tDisease\tMESH:D018205\tadiposity\tPubTator3\n1226979\tDisease\tMESH:D009765\t\tMESH\n26518979\tDisease\tMESH:D006261\theadache\tPubTator3\n26518979\tDisease\tMESH:D012640\tseizure\tPubTator3\n26518979\tDisease\tMESH:D005076\trash\tPubTator3\n26518979\tDisease\tMESH:D004832\tabsence seizures\tPubTator3': 1, 'MESH\n26518979\tDisease\tMESH:D006985\tHV': 1, 'hyperventilation\tPubTator3\n26518979\tDisease\tMESH:D001991\tbronchitis\tPubTator3\n27073979\tDisease\tMESH:D003929\tDiabetic Sensory and Motor Neuropathy\tPubTator3\n27057979\tDisease\tMESH:D054058\tacute coronary syndrome\tPubTator3': 1, 'MESH\n27057979\tDisease\tMESH:C565153\tcoronary artery dissection\tPubTator3\n27057979\tDisease\tMESH:D014652\t\tMESH\n27057979\tDisease\tMESH:D003330\t\tMESH\n27057979\tDisease\tMESH:D005352\t\tMESH\n35274979\tDisease\tMESH:D015433\tONM\tPubTator3\n35274979\tDisease\tOMIM:242860\tCCAN\tPubTator3\n35278979\tDisease\tMESH:D006528\tHCC': 1, 'hepatocellular carcinoma\tPubTator3': 1, 'MESH\n35278979\tDisease\tMESH:D008113\t\tMESH\n35278979\tDisease\tMESH:D002137\t\tMESH\n37947979\tDisease\tMESH:D008207\tlymph node metastasis\tPubTator3\n37947979\tDisease\tMESH:D009369\ttumor\tPubTator3\n37947979\tDisease\tMESH:D000077277\tEsophageal Squamous Cell Carcinoma': 1, 'ESCC': 2, 'esophageal squamous cell carcinoma\tPubTator3\n2586979\tDisease\tMESH:D009216\tmyopia\tPubTator3': 1, 'MESH\n21879979\tDisease\tMESH:D050723\tfractures\tPubTator3\n21879979\tDisease\tMESH:D000070604\ttarsal changes\tPubTator3\n21879979\tDisease\tMESH:D007794\t\tMESH\n21879979\tDisease\tMESH:D006734\t\tMESH\n6506979\tDisease\tMESH:D010302\tparkinsonism': 1, 'postencephalic and atherosclerotic parkinsonism\tPubTator3': 1, 'MESH\n6506979\tDisease\tMESH:D009127\trigidity\tPubTator3\n6506979\tDisease\tMESH:D018476\toligo- and bradykinesia\tPubTator3\n6506979\tDisease\tMESH:D010301\t\tMESH\n6506979\tDisease\tMESH:D010300\t\tMESH\n6506979\tDisease\tMESH:D002537\t\tMESH\n31080979\tDisease\tMESH:D002357\tcartilage\tPubTator3\n31080979\tDisease\tMESH:D064420\ttoxicity': 1, 'cytotoxicity\tPubTator3\n31080979\tDisease\tMESH:D007674\trenal toxicity': 1, 'kidney\tPubTator3\n31080979\tDisease\tMESH:D009369\ttumor': 1, 'Tumors\tPubTator3\n31080979\tDisease\tMESH:D012516\tosteosarcoma\tPubTator3\n31080979\tDisease\tMESH:D013927\tthrombosis': 1, 'Thrombosis': 1, 'blood clots\tPubTator3\n31080979\tDisease\tMESH:D001847\tbone defects\tPubTator3\n31080979\tDisease\tMESH:D000092124\tOoC\tPubTator3\n31080979\tDisease\tMESH:D009471\tDMD\tPubTator3\n31080979\tDisease\tMESH:D058529\tTPL\tPubTator3\n13478979\tDisease\tMESH:D012829\tsilicosis\tPubTator3': 1, 'MESH\n9226979\tDisease\tMESH:D010146\tpain\tPubTator3\n7165979\tDisease\tMESH:D000858\t\tMESH\n11586979\tDisease\tMESH:D029424\tchronic obstructive pulmonary disease\tPubTator3\n11586979\tDisease\tMESH:D008173\t\tMESH\n11586979\tDisease\tMESH:D012640\t\tMESH\n12062979\tDisease\tMESH:D012899\tsmallpox\tPubTator3': 1, 'MESH\n13325979\tDisease\tMESH:D011041\t\tMESH\n32653979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n32653979\tDisease\tMESH:D047508\thepatic necrosis\tPubTator3\n32653979\tDisease\tMESH:D011041\tpoisonings\tPubTator3\n32653979\tDisease\tMESH:D009461\tneurological disorders\tPubTator3\n32653979\tDisease\tMESH:D064420\tcytotoxicity': 1, 'toxicity\tPubTator3\n32653979\tDisease\tMESH:D012640\tseizures\tPubTator3\n32653979\tDisease\tMESH:D009422\t\tMESH\n29389979\tDisease\tMESH:D001753\tBlasts\tPubTator3\n29389979\tDisease\tMESH:D001037\tLIWC\tPubTator3\n29389979\tDisease\tMESH:D019142\tEbola\tPubTator3\n29389979\tDisease\tMESH:D000071243\tZika\tPubTator3\n29389979\tDisease\tMESH:D005221\tfatigue\tPubTator3\n11081979\tDisease\tMESH:D000860\thypoxia\tPubTator3\n11081979\tDisease\tMESH:D002534\thypoxic\tPubTator3\n1154979\tDisease\tMESH:D005734\tVenous gangrene': 1, 'venous gangrene\tPubTator3': 1, "MESH\n1154979\tDisease\tMESH:D012170\tthrombosis of the veins\tPubTator3\n1154979\tDisease\tMESH:D009369\tmalignant disease\tPubTator3\n1154979\tDisease\tMESH:D013924\t\tMESH\n6601979\tDisease\tMESH:D014842\tvon Willebrand's disease\tPubTator3": 1, 'MESH\n6601979\tDisease\tMESH:D008595\t\tMESH\n36111979\tDisease\tMESH:D005909\tglioblastoma\tPubTator3\n36111979\tDisease\tMESH:D007153\tImmunodeficiency\tPubTator3\n36111979\tDisease\tMESH:D003924\tType 2 diabetes': 1, 'type 2 diabetes': 2, 'type 2 diabetes mellitus': 1, 'T2DM\tPubTator3': 1, 'MESH\n36111979\tDisease\tMESH:D017695\ttissue damage\tPubTator3\n36111979\tDisease\tMESH:D019636\tneurodegenerative diseases': 1, 'neurodegeneration\tPubTator3\n36111979\tDisease\tMESH:D001943\tmetastasis of breast and liver cancer': 1, "breast cancer\tPubTator3\n36111979\tDisease\tMESH:D028361\tEM\tPubTator3\n36111979\tDisease\tMESH:D011017\tSTARD3\tPubTator3\n36111979\tDisease\tMESH:C537607\tDGAT\tPubTator3\n36111979\tDisease\tMESH:D010300\tParkinson's": 1, "Parkinson's disease\tPubTator3\n36111979\tDisease\tMESH:D006333\tHeart failure\tPubTator3\n36111979\tDisease\tMESH:D053632\tSCID\tPubTator3\n36111979\tDisease\tMESH:C531633\tBioID\tPubTator3\n36111979\tDisease\tMESH:D009369\tcancers": 1, 'tumor\tPubTator3\n36111979\tDisease\tMESH:D008305\tMalignant hyperthermia\tPubTator3\n36111979\tDisease\tMESH:D010855\tCDS\tPubTator3\n36111979\tDisease\tMESH:D008107\tLiver disease\tPubTator3\n36111979\tDisease\tMESH:D015417\tCharcot-Marie-Tooth disease type 2\tPubTator3\n36111979\tDisease\tMESH:D007333\tinsulin resistance\tPubTator3\n36111979\tDisease\tMESH:C566108\tStormorken syndrome\tPubTator3\n36111979\tDisease\tMESH:D007037\tSTED\tPubTator3\n36111979\tDisease\tMESH:D015433\tOMM': 1, 'IMM': 1, 'MAM\tPubTator3\n36111979\tDisease\tMESH:D001145\tCardiac arrhythmia\tPubTator3\n36111979\tDisease\tMESH:D007674\tKidney disease\tPubTator3\n36111979\tDisease\tMESH:D016464\tM-L': 1, "lysosomal storage disease\tPubTator3\n36111979\tDisease\tMESH:D018908\tMuscle weakness\tPubTator3\n36111979\tDisease\tMESH:D006332\tHeart hypertrophy\tPubTator3\n36111979\tDisease\tOMIM:616155\tCMT2\tPubTator3\n36111979\tDisease\tMESH:D009436\tLIT\tPubTator3\n36111979\tDisease\tMESH:C564971\tMERLIN\tPubTator3\n36111979\tDisease\tMESH:D000544\tAlzheimer's disease\tPubTator3\n36111979\tDisease\tMESH:D064726\tTGN\tPubTator3\n36111979\tDisease\tMESH:C566759\tCICR\tPubTator3\n36111979\tDisease\tMESH:D016751\tCryo-ET\tPubTator3\n36111979\tDisease\tMESH:D016511\tSevere combined immunodeficiency\tPubTator3\n36111979\tDisease\tMESH:D004828\tPALM\tPubTator3\n36111979\tDisease\tMESH:D000686\tamyloidosis\tPubTator3\n36111979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n36111979\tDisease\tMESH:D065626\tnon-alcoholic fatty liver disease\tPubTator3\n36111979\tDisease\tMESH:D009901\tSTORM\tPubTator3\n36111979\tDisease\tMESH:D020795\tiLID\tPubTator3\n36111979\tDisease\tMESH:D012640\tSMLM\tPubTator3\n16125979\tDisease\tMESH:D001927\tFrontal lobe dysfunction\tPubTator3\n16125979\tDisease\tMESH:D001714\tBipolar disorder": 1, 'bipolar disorder\tPubTator3': 1, 'MESH\n16125979\tDisease\tMESH:D003865\tmajor depression\tPubTator3\n16125979\tDisease\tMESH:D003866\tdepressed': 1, 'Depressive symptoms\tPubTator3\n16984979\tDisease\tMESH:D001943\tBreast cancer': 1, "breast cancers\tPubTator3\n16984979\tDisease\tMESH:D006689\tHodgkin's lymphoma": 1, 'HL\tPubTator3': 1, 'MESH\n16984979\tDisease\tMESH:D016609\tSecond malignancy': 1, 'second malignancy\tPubTator3': 1, 'MESH\n12345979\tDisease\tMESH:D000026\tabortion\tPubTator3\n16027979\tDisease\tMESH:D002534\thypoxic\tPubTator3\n3828979\tDisease\tMESH:D001749\tbladder tumors\tPubTator3': 1, 'CTD': 1, 'MESH\n3828979\tDisease\tMESH:D014516\trenal pelvic and ureteric tumors\tPubTator3': 1, 'CTD\n3828979\tDisease\tMESH:D014571\turinary tract tumors\tPubTator3\n3828979\tDisease\tMESH:D063646\tcarcinogenesis\tPubTator3\n3828979\tDisease\tMESH:D001745\thyperplasia of renal pelvis, ureter and bladder\tPubTator3\n3828979\tDisease\tMESH:D001744\turacil stones in the bladder\tPubTator3': 1, 'MESH\n3828979\tDisease\tMESH:D003043\t\tMESH\n3828979\tDisease\tMESH:D007680\t\tCTD\n3828979\tDisease\tMESH:D006965\t\tMESH': 1, 'CTD\n3828979\tDisease\tMESH:D002277\t\tMESH\n3828979\tDisease\tMESH:D001835\t\tMESH\n29071979\tDisease\tMESH:D006973\tHT\tPubTator3\n33387979\tDisease\tMESH:D000088562\tlong-term\tPubTator3\n33387979\tDisease\tMESH:D019964\tand mood disorders\tPubTator3\n33387979\tDisease\tMESH:D003866\tdepressive': 1, 'depressive spectrum disorders': 1, 'depressed': 1, 'depression': 1, 'Depressive Symptoms': 1, 'depressive-spectrum-disorders': 1, 'depressive symptoms': 1, 'Depression\tPubTator3\n33387979\tDisease\tMESH:D003865\tmajor depression\tPubTator3\n33387979\tDisease\tMESH:D011230\tcarcinogens\tPubTator3\n33387979\tDisease\tMESH:D014029\ttobacco use disorder': 1, 'nicotine': 1, 'tobacco harm': 1, 'nicotine dependence\tPubTator3\n33387979\tDisease\tMESH:D009369\tcancer': 1, 'Cancer\tPubTator3\n33387979\tDisease\tMESH:D001523\tMental Disorders': 1, 'psychiatric disorders\tPubTator3\n33387979\tDisease\tMESH:D015208\tsmoking\tPubTator3\n7683979\tDisease\tMESH:D002312\thypertrophic\tPubTator3\n7683979\tDisease\tMESH:D000172\tacromegalic\tPubTator3\n7683979\tDisease\tMESH:D006332\tcardiac hypertrophy': 1, 'Cardiac hypertrophy\tPubTator3': 1, 'MESH\n7683979\tDisease\tMESH:D006984\thypertrophy\tPubTator3\n2059979\tDisease\tMESH:D011843\troot lesions\tPubTator3\n2059979\tDisease\tMESH:D003731\t\tMESH\n20092979\tDisease\tMESH:C566903\tmesial temporal lobe epilepsy': 1, 'mTLE': 1, 'epilepsy of the mesial temporal lobe\tPubTator3\n20092979\tDisease\tMESH:D012640\tseizures': 1, 'seizure\tPubTator3': 1, 'MESH\n20092979\tDisease\tMESH:D000092223\thippocampal sclerosis\tPubTator3\n20092979\tDisease\tMESH:D004833\t\tMESH\n3120979\tDisease\tMESH:D001424\tBacterial\tPubTator3\n3120979\tDisease\tMESH:D008173\t\tMESH\n28067979\tDisease\tMESH:D050723\tfracture': 1, 'Fracture\tPubTator3\n28067979\tDisease\tMESH:D019553\t\tMESH\n3763979\tDisease\tMESH:D003866\tdepression\tPubTator3': 1, 'MESH\n31588979\tDisease\tMESH:D003875\tcutaneous eruption\tPubTator3\n31588979\tDisease\tMESH:D002644\tVaricella pneumonia\tPubTator3\n31588979\tDisease\tMESH:D015658\tHuman Immunodeficiency Virus\tPubTator3\n31588979\tDisease\tMESH:D017254\tinterstitial infiltrates\tPubTator3\n31588979\tDisease\tMESH:D012131\trespiratory failure\tPubTator3\n31588979\tDisease\tMESH:D004417\tdyspnea\tPubTator3\n31588979\tDisease\tMESH:D012872\tvesicular cutaneous eruption\tPubTator3\n31588979\tDisease\tMESH:D012128\tacute respiratory distress syndrome': 1, 'Acute respiratory distress syndrome': 1, 'ARDS\tPubTator3': 1, 'MESH\n31588979\tDisease\tMESH:D006333\theart failure\tPubTator3\n31588979\tDisease\tMESH:D007239\tprimo-infection\tPubTator3\n31588979\tDisease\tMESH:D005076\t\tMESH\n29161979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n29161979\tDisease\tMESH:D009800\tLR\tPubTator3\n29161979\tDisease\tMESH:D002318\tcardiovascular collapse\tPubTator3\n29161979\tDisease\tMESH:D005076\trashes': 1, 'rash\tPubTator3\n29161979\tDisease\tMESH:D011537\tpruritus\tPubTator3\n29161979\tDisease\tMESH:D000707\tanaphylaxis\tPubTator3\n29161979\tDisease\tMESH:D001986\tbronchospasm\tPubTator3\n29161979\tDisease\tMESH:D014839\tvomiting\tPubTator3\n29161979\tDisease\tMESH:D002303\tHR\tPubTator3\n29161979\tDisease\tMESH:D000092582\tdrug fever\tPubTator3\n29161979\tDisease\tMESH:D004487\tedema\tPubTator3\n29161979\tDisease\tMESH:D014581\turticaria\tPubTator3\n29161979\tDisease\tMESH:D005483\tflushing\tPubTator3\n29161979\tDisease\tMESH:D004342\tallergy': 1, 'Hypersensitivity': 1, 'hypersensitivity\tPubTator3': 1, 'MESH\n29161979\tDisease\tMESH:D003643\tdeath\tPubTator3\n29161979\tDisease\tMESH:D000402\tairway compromise\tPubTator3\n29161979\tDisease\tMESH:D007938\tleukemia\tPubTator3\n29161979\tDisease\tMESH:D007022\thypotension\tPubTator3\n29161979\tDisease\tMESH:D054198\tacute lymphoblastic leukemia': 1, 'Acute Lymphoblastic Leukemia': 1, 'ALL\tPubTator3': 1, 'MESH\n29161979\tDisease\tMESH:D000799\tangioedema\tPubTator3\n29161979\tDisease\tMESH:D006967\thypersensitivity reactions': 1, 'hypersensitivity reaction\tPubTator3\n29161979\tDisease\tMESH:D004417\tdyspnea\tPubTator3\n29161979\tDisease\tMESH:D003371\tcough\tPubTator3\n34073979\tDisease\tMESH:D059445\tCPS\tPubTator3\n22570979\tDisease\tMESH:D019066\tfacies\tPubTator3\n22570979\tDisease\tMESH:D006130\tshort stature\tPubTator3': 1, 'MESH\n22570979\tDisease\tMESH:C537062\tFHS': 1, 'Floating-Harbor syndrome\tPubTator3\n22570979\tDisease\tMESH:D010024\tdelayed bone age\tPubTator3\n22570979\tDisease\tMESH:D008607\tmental retardation\tPubTator3\n22570979\tDisease\tMESH:D019465\t\tMESH\n22570979\tDisease\tMESH:D000015\t\tMESH\n22570979\tDisease\tMESH:D006345\t\tMESH\n16131979\tDisease\tMESH:D003550\tcystic fibrosis\tPubTator3': 1, 'MESH\n16131979\tDisease\tMESH:D010188\t\tMESH\n16131979\tDisease\tMESH:D004195\t\tMESH\n16131979\tDisease\tMESH:D012141\t\tMESH\n27047979\tDisease\tMESH:D016470\tbacteremia\tPubTator3\n27047979\tDisease\tMESH:D020521\tstroke\tPubTator3\n27047979\tDisease\tMESH:D014946\twound infection\tPubTator3\n27047979\tDisease\tMESH:D020820\tinvoluntary movements\tPubTator3\n27047979\tDisease\tMESH:D006987\tnumbness\tPubTator3\n27047979\tDisease\tMESH:D019636\tdegenerative joint disease\tPubTator3\n27047979\tDisease\tMESH:D004244\tdizziness\tPubTator3\n27047979\tDisease\tMESH:D004802\tEosinophilia': 1, 'eosinophilia\tPubTator3\n27047979\tDisease\tMESH:D001049\tApnea': 1, 'apnea\tPubTator3\n27047979\tDisease\tMESH:D013746\ttetany\tPubTator3\n27047979\tDisease\tMESH:D000092164\tparalytics\tPubTator3\n27047979\tDisease\tMESH:D010243\tparalysis\tPubTator3\n27047979\tDisease\tMESH:C536089\tCMS\tPubTator3\n27047979\tDisease\tMESH:D014717\tvertigo\tPubTator3\n27047979\tDisease\tMESH:D004417\tshortness of breath': 1, 'short of breath\tPubTator3\n27047979\tDisease\tMESH:D012131\trespiratory depression': 1, 'respiratory apnea': 1, 'respiratory failure': 1, 'respiratory arrest\tPubTator3\n27047979\tDisease\tMESH:D012133\tRespiratory muscle paralysis': 1, 'Respiratory Muscle Paralysis': 1, 'Respiratory paralysis': 1, 'respiratory muscle paralysis': 1, 'respiratory paralysis\tPubTator3\n27047979\tDisease\tMESH:D064420\ttoxicities': 1, 'adverse drug reaction\tPubTator3\n27047979\tDisease\tMESH:D058186\tacute renal failure\tPubTator3\n27047979\tDisease\tMESH:D009102\torgan injury\tPubTator3\n27047979\tDisease\tMESH:D010292\ttingling or formication': 1, 'paresthesia\tPubTator3\n27047979\tDisease\tMESH:D003141\tinfectious disease\tPubTator3\n27047979\tDisease\tMESH:D016905\tgram-negative bacteria infections\tPubTator3\n27047979\tDisease\tMESH:D020258\tneurotoxic': 1, 'neurotoxicity\tPubTator3\n27047979\tDisease\tMESH:D005076\trash\tPubTator3\n27047979\tDisease\tMESH:D012640\tseizure\tPubTator3\n27047979\tDisease\tMESH:D020271\tNeurological diseases\tPubTator3\n27047979\tDisease\tMESH:D000081015\tneurotoxic drugs': 1, 'Neurotoxic Drugs\tPubTator3\n27047979\tDisease\tMESH:D020879\tneuromuscular blockade\tPubTator3\n27047979\tDisease\tMESH:D013130\tspinal stenosis\tPubTator3\n27047979\tDisease\tMESH:D001281\tatrial fibrillation\tPubTator3\n27047979\tDisease\tMESH:D015508\tneuromuscular blockage\tPubTator3\n27047979\tDisease\tMESH:D013035\tmuscle spasm\tPubTator3\n27047979\tDisease\tMESH:C566593\thypomagnesemic\tPubTator3\n27047979\tDisease\tMESH:D013064\tslurring of speech\tPubTator3\n27047979\tDisease\tMESH:D018908\tupper extremity weakness\tPubTator3\n27047979\tDisease\tMESH:D051437\trenal insufficiency\tPubTator3\n27047979\tDisease\tMESH:D002544\tischemic stroke\tPubTator3\n27047979\tDisease\tMESH:D003251\tstenosis\tPubTator3\n27047979\tDisease\tMESH:D011537\tpruritus\tPubTator3\n27047979\tDisease\tMESH:D003920\tdiabetes mellitus\tPubTator3\n27047979\tDisease\tMESH:D006996\thypocalcemia\tPubTator3\n27047979\tDisease\tMESH:D003234\tpurulent\tPubTator3\n27047979\tDisease\tMESH:D006509\tPMB\tPubTator3\n27047979\tDisease\tMESH:D001145\tarrhythmia\tPubTator3\n27047979\tDisease\tMESH:D020514\thypokalemic\tPubTator3\n27047979\tDisease\tMESH:D007674\timpaired renal function': 1, 'Renal Disease': 1, 'renal disease\tPubTator3\n25733979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n25733979\tDisease\tMESH:D000013\tcongenital abnormalities\tPubTator3\n25733979\tDisease\tMESH:D005218\tfat necrosis\tPubTator3\n25733979\tDisease\tMESH:D003560\tcyst\tPubTator3\n25733979\tDisease\tMESH:D009369\ttumor\tPubTator3\n25733979\tDisease\tMESH:D005153\tfacial deformities\tPubTator3\n26649979\tDisease\tMESH:D009369\ttumor\tPubTator3\n26649979\tDisease\tMESH:D009362\tmetastasis\tPubTator3\n26649979\tDisease\tMESH:D008223\tlymphoma\tPubTator3': 1, 'MESH\n18452979\tDisease\tMESH:C565785\tepileptic foci\tPubTator3\n18452979\tDisease\tMESH:D009369\ttumors\tPubTator3\n18452979\tDisease\tMESH:D012640\tseizures\tPubTator3\n18452979\tDisease\tMESH:D001932\tbrain tumor\tPubTator3': 1, 'MESH\n3520979\tDisease\tMESH:D003231\tconjunctivitis\tPubTator3': 1, 'MESH\n3520979\tDisease\tMESH:D014141\t\tMESH\n3520979\tDisease\tMESH:D002921\t\tMESH\n3520979\tDisease\tMESH:D004892\t\tMESH\n3520979\tDisease\tMESH:D010390\t\tMESH\n3520979\tDisease\tMESH:D006967\t\tMESH\n3520979\tDisease\tMESH:D003874\t\tMESH\n3520979\tDisease\tMESH:D002057\t\tMESH\n3520979\tDisease\tMESH:D005126\t\tMESH\n3520979\tDisease\tMESH:D006086\t\tMESH\n11364979\tDisease\tMESH:D015658\tHIV/AIDS\tPubTator3': 1, 'MESH\n11364979\tDisease\tMESH:D003967\t\tMESH\n11364979\tDisease\tMESH:D017088\t\tMESH\n11364979\tDisease\tMESH:D019247\t\tMESH\n11364979\tDisease\tMESH:D008228\t\tMESH\n1201979\tDisease\tMESH:D001424\t\tMESH\n31450979\tDisease\tMESH:D014652\tendothelial dysfunction\tPubTator3\n31450979\tDisease\tMESH:D030342\tinherited disorder\tPubTator3\n31450979\tDisease\tMESH:D001007\tanxiety\tPubTator3\n31450979\tDisease\tMESH:D006712\tHCU': 1, 'cystathionine beta-synthase (CBS) deficiency': 1, 'Classic homocystinuria\tPubTator3': 1, 'MESH\n31450979\tDisease\tMESH:D004195\t\tMESH\n28602979\tDisease\tMESH:D005909\tGlioblastomas\tPubTator3\n28602979\tDisease\tMESH:D009369\ttumor\tPubTator3\n28602979\tDisease\tMESH:D005910\tglioma\tPubTator3': 1, 'MESH\n28602979\tDisease\tMESH:D000014\tabnormalization\tPubTator3\n28602979\tDisease\tMESH:D009389\t\tMESH\n28602979\tDisease\tMESH:D001932\t\tMESH\n25482979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n19527979\tDisease\tMESH:D000208\tacute MI\tPubTator3\n19527979\tDisease\tMESH:D023903\trestenosis\tPubTator3': 1, 'MESH\n19527979\tDisease\tMESH:D003643\tdeath\tPubTator3\n19527979\tDisease\tMESH:D009203\tAcute Myocardial Infarction': 1, 'AMI': 1, 'acute myocardial infarction\tPubTator3': 1, 'MESH\n19527979\tDisease\tMESH:D023921\t\tMESH\n6336979\tDisease\tMESH:D001749\tcarcinoma of the bilharzial bladder': 1, 'bladder cancer\tPubTator3': 1, 'MESH\n6336979\tDisease\tMESH:D012552\tbilharziasis\tPubTator3': 1, 'MESH\n1525979\tDisease\tMESH:D006949\tlipemia\tPubTator3\n1525979\tDisease\tMESH:D006461\tHaemolysis\tPubTator3\n1525979\tDisease\tMESH:D001171\trheumatoid factor\tPubTator3\n15703979\tDisease\tMESH:D002177\tPC': 1, 'pulmonary candidiasis\tPubTator3': 1, 'MESH\n15703979\tDisease\tMESH:C563032\tpreterm premature rupture of membranes': 1, 'PPROM\tPubTator3\n15703979\tDisease\tMESH:D008172\t\tMESH\n15703979\tDisease\tMESH:D005322\t\tMESH\n10739979\tDisease\tMESH:D003453\tcryptococcosis': 1, 'primary cutaneous cryptococcosis': 1, 'cutaneous cryptococcosis': 1, 'Cryptococcosis\tPubTator3': 1, 'MESH\n10739979\tDisease\tMESH:D007239\tinfection\tPubTator3\n10739979\tDisease\tMESH:D000163\tAIDS\tPubTator3\n10739979\tDisease\tMESH:D012871\tskin lesion': 1, 'skin lesions\tPubTator3\n10739979\tDisease\tMESH:D012536\t\tMESH\n10739979\tDisease\tMESH:D017088\t\tMESH\n7574979\tDisease\tMESH:D017180\tventricular tachycardia\tPubTator3': 1, 'MESH\n7574979\tDisease\tMESH:D011183\t\tMESH\n7574979\tDisease\tMESH:D002311\t\tMESH\n34079979\tDisease\tMESH:D001416\thip and back pain\tPubTator3\n893979\tDisease\tMESH:D009362\tmetastasis\tPubTator3\n893979\tDisease\tMESH:D009369\tbenign tumor': 1, 'malignancy\tPubTator3\n893979\tDisease\tMESH:C000625499\tJuvenile aponeurotic fibroma\tPubTator3\n893979\tDisease\tMESH:D005350\t\tMESH\n35277979\tDisease\tMESH:D057112\tperforation\tPubTator3\n35277979\tDisease\tMESH:D005355\tcirrhosis\tPubTator3\n35277979\tDisease\tMESH:D017093\thepatic failure\tPubTator3\n35277979\tDisease\tMESH:D014648\tvarices': 1, 'variceal development': 1, 'Variceal bleeding\tPubTator3\n35277979\tDisease\tMESH:D006470\themorrhage': 1, 'bleeding\tPubTator3\n35277979\tDisease\tMESH:D056128\tabdominal obesity\tPubTator3\n35277979\tDisease\tMESH:D000094724\tcirrhotic\tPubTator3\n35277979\tDisease\tMESH:D008103\thepatic cirrhosis': 1, 'hepatic fibrosis': 1, 'liver cirrhosis\tPubTator3': 1, 'MESH\n35277979\tDisease\tMESH:D008107\tof Liver Diseases\tPubTator3\n35277979\tDisease\tMESH:D003643\tdeath\tPubTator3\n35277979\tDisease\tMESH:D006528\tHCC': 1, 'hepatocellular carcinoma\tPubTator3\n35277979\tDisease\tMESH:C566112\tstiffness\tPubTator3\n35277979\tDisease\tMESH:D004417\tbreathing difficulties\tPubTator3\n35277979\tDisease\tMESH:D006975\tportal hypertension': 1, 'PH\tPubTator3\n35277979\tDisease\tMESH:D001201\tascites\tPubTator3\n35277979\tDisease\tMESH:D004932\tesophageal varices\tPubTator3': 1, 'MESH\n24342979\tDisease\tMESH:D007249\t\tMESH\n28103979\tDisease\tMESH:D010554\taggression\tPubTator3\n28103979\tDisease\tMESH:D020241\twestern medicine\tPubTator3\n34489979\tDisease\tMESH:D017093\tliver injury\tPubTator3\n34489979\tDisease\tMESH:D011014\tlung inflammation\tPubTator3\n34489979\tDisease\tMESH:D024821\tmetabolic syndrome': 1, 'metabolic disturbances': 1, 'metabolic syndromes': 1, 'metabolic disturbance\tPubTator3\n34489979\tDisease\tMESH:D010523\tperipheral neuropathy\tPubTator3\n34489979\tDisease\tOMIM:614878\timmune dysregulation\tPubTator3\n34489979\tDisease\tMESH:D050197\tatherosclerosis\tPubTator3\n34489979\tDisease\tMESH:D015430\tweight gain\tPubTator3\n34489979\tDisease\tMESH:D006973\tblood pressure dysregulation\tPubTator3\n34489979\tDisease\tMESH:D010003\tOA\tPubTator3\n34489979\tDisease\tMESH:D015658\tHIV infection': 1, 'HIV\tPubTator3\n34489979\tDisease\tMESH:D018149\tglucose intolerance\tPubTator3\n34489979\tDisease\tMESH:D064420\ttoxicities\tPubTator3\n34489979\tDisease\tMESH:D005355\tadipose fibrosis': 1, 'fibrosis\tPubTator3\n34489979\tDisease\tMESH:D003922\ttype 1 diabetes': 1, 'T1D\tPubTator3\n34489979\tDisease\tMESH:D005221\tfatigue\tPubTator3\n34489979\tDisease\tMESH:D058625\tend-stage liver disease\tPubTator3\n34489979\tDisease\tMESH:D007333\tInsulin resistance': 1, 'insulin resistance\tPubTator3\n34489979\tDisease\tMESH:D003920\tdiabetic': 1, 'Diabetic': 1, 'diabetically': 1, 'diabetes\tPubTator3\n34489979\tDisease\tMESH:D008171\tpulmonary disease\tPubTator3\n34489979\tDisease\tMESH:D018205\tadipose tissue dysfunction': 1, 'adiposity': 1, 'adipose tissue': 1, 'adipose dysfunction\tPubTator3\n34489979\tDisease\tMESH:D051437\tpancreatic beta-cell failure': 1, 'thermogenic failure\tPubTator3\n34489979\tDisease\tMESH:D001249\tasthma\tPubTator3\n34489979\tDisease\tMESH:D006984\thypertrophy\tPubTator3\n34489979\tDisease\tMESH:D055501\tinflammatory macrophages': 1, 'macrophage\tPubTator3\n34489979\tDisease\tMESH:D008659\tmetabolic dysfunction': 1, 'allergic and metabolic diseases': 1, 'metabolic disease': 2, 'metabolic diseases\tPubTator3\n34489979\tDisease\tMESH:D006526\tHCV infection\tPubTator3\n34489979\tDisease\tMESH:D020263\tdamage\tPubTator3\n34489979\tDisease\tMESH:D009369\tcancer\tPubTator3\n34489979\tDisease\tMESH:D001168\tarthritis\tPubTator3\n34489979\tDisease\tMESH:D010146\tpain\tPubTator3\n34489979\tDisease\tMESH:D007239\thelminth infection\tPubTator3\n34489979\tDisease\tMESH:D019636\tneurodegeneration\tPubTator3\n34489979\tDisease\tMESH:D009181\tfungal infection\tPubTator3\n34489979\tDisease\tMESH:D007516\tpancreatic-islet inflammation\tPubTator3\n34489979\tDisease\tMESH:D001327\tautoimmune diseases\tPubTator3\n34489979\tDisease\tMESH:D008107\tliver disease\tPubTator3\n34489979\tDisease\tMESH:D009422\tneuropathy\tPubTator3\n34489979\tDisease\tMESH:D008103\tliver fibrosis': 1, 'fibrosis of the liver': 1, 'Liver fibrosis\tPubTator3\n34489979\tDisease\tMESH:D004342\tallergic diseases': 1, 'allergy\tPubTator3\n34489979\tDisease\tMESH:D001342\tsympathetic nerve damage\tPubTator3\n34489979\tDisease\tMESH:D056486\thepatitis': 1, 'hepatic fibrogenesis': 1, 'acute liver damage': 1, 'liver damage\tPubTator3\n34489979\tDisease\tMESH:D004679\tencephalomyelitis\tPubTator3\n34489979\tDisease\tMESH:D059348\tperipheral nerve injury\tPubTator3\n34489979\tDisease\tMESH:D000860\thypoxia\tPubTator3\n34489979\tDisease\tMESH:D006943\thyperglycemia\tPubTator3\n34489979\tDisease\tMESH:D007154\tsystemic dysfunction\tPubTator3\n34489979\tDisease\tMESH:D017695\ttissue\tPubTator3\n34489979\tDisease\tMESH:D009765\tObese': 1, 'Obesity': 1, 'obesity-': 1, 'obesity': 1, 'obese\tPubTator3\n34489979\tDisease\tMESH:D003876\tatopic dermatitis\tPubTator3\n34489979\tDisease\tMESH:D007249\ttype 1 and type 2 inflammation': 1, 'Inflammation': 1, 'type 1 inflammation': 1, 'allergic-type 2 inflammation': 1, '2 inflammatory': 1, '1 inflammatory': 1, 'Adipose Inflammation': 1, 'systemic inflammation': 1, 'adipose inflammation': 1, 'liver inflammation': 1, 'adipose tissue inflammation': 1, 'WAT inflammation': 1, 'type 1 inflammatory': 1, 'gut inflammation\tPubTator3\n34489979\tDisease\tMESH:D043171\tmetabolic instability\tPubTator3\n34489979\tDisease\tMESH:D015431\tweight loss': 1, 'weight\tPubTator3\n34489979\tDisease\tMESH:D014777\tviral infection\tPubTator3\n34489979\tDisease\tMESH:D003924\ttype 2 and type 1 diabetes': 1, 'Type 2 diabetes mellitus': 1, 'deficiency in type 2': 1, 'Type 2 Diabetes': 1, 'T2DM': 1, 'type 2 diabetes mellitus\tPubTator3': 1, 'MESH\n17622979\tDisease\tMESH:D016080\tarachnoid cyst\tPubTator3': 1, 'MESH\n3497979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n2679979\tDisease\tMESH:D006470\tbleeding\tPubTator3': 1, 'MESH\n26297979\tDisease\tMESH:D001943\tbreast cancer\tPubTator3\n26297979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n30115979\tDisease\tMESH:D005530\tsmall-footed myotis\tPubTator3\n30115979\tDisease\tMESH:D009668\twhite-nose syndrome\tPubTator3\n30115979\tDisease\tMESH:D007239\tinfection\tPubTator3\n18653979\tDisease\tMESH:D012282\tRickettsial infection\tPubTator3': 1, 'MESH\n18653979\tDisease\tMESH:D002418\t\tMESH\n6816979\tDisease\tMESH:D003324\tcoronary artery\tPubTator3\n6816979\tDisease\tMESH:D009336\tmyocardial necrosis\tPubTator3': 1, 'MESH\n6816979\tDisease\tMESH:D017682\tnecrosis of the myocardium\tPubTator3\n6816979\tDisease\tMESH:D009203\tacute myocardial infarction\tPubTator3': 1, 'MESH\n8362979\tDisease\tMESH:D015658\tHIV infection': 1, 'HIV-infected': 1, 'human immunodeficiency virus (HIV) infection\tPubTator3': 1, 'MESH\n8362979\tDisease\tMESH:D007239\tinfection\tPubTator3\n8362979\tDisease\tMESH:D005923\tfocal segmental glomerulosclerosis\tPubTator3\n8362979\tDisease\tMESH:D005921\tglomerulosclerosis\tPubTator3\n37817979\tDisease\tMESH:D015163\tMBC\tPubTator3\n37817979\tDisease\tMESH:D000092124\tMAOC\tPubTator3\n32790979\tDisease\tMESH:D002547\tcerebral palsy': 1, 'CP': 1, 'spastic forms of cerebral palsy': 1, 'spastic CP': 1, 'spastic forms of CP\tPubTator3': 1, 'MESH\n32790979\tDisease\tMESH:D009128\tspasticity\tPubTator3': 1, 'MESH\n14171979\tDisease\tMESH:D008133\tELECTROCARDIOGRAM\tPubTator3\n14171979\tDisease\tMESH:D007008\t\tMESH\n14171979\tDisease\tMESH:D004487\t\tMESH\n14171979\tDisease\tMESH:D006973\t\tMESH\n12603979\tDisease\tMESH:C537113\tvulval disorders\tPubTator3\n12603979\tDisease\tMESH:D002278\t\tMESH\n12603979\tDisease\tMESH:D018459\t\tMESH\n12603979\tDisease\tMESH:D014846\t\tMESH\n12603979\tDisease\tMESH:D011230\t\tMESH\n25925979\tDisease\tMESH:D006976\tpulmonary hypertension\tPubTator3': 1, 'MESH\n25925979\tDisease\tMESH:D006330\t\tMESH\n6019979\tDisease\tMESH:D005265\tfemoral neck fractures\tPubTator3': 1, 'MESH\n6019979\tDisease\tMESH:D048909\t\tMESH\n6019979\tDisease\tMESH:D002493\t\tMESH\n6019979\tDisease\tMESH:D014947\t\tMESH\n6019979\tDisease\tMESH:D010024\t\tMESH\n6019979\tDisease\tMESH:D019966\t\tMESH\n6019979\tDisease\tMESH:D009748\t\tMESH\n6019979\tDisease\tMESH:D002318\t\tMESH\n6019979\tDisease\tMESH:D013896\t\tMESH\n2746979\tDisease\tMESH:D014012\tnoise\tPubTator3\n28670979\tDisease\tMESH:D063646\ttumorigenesis\tPubTator3\n28670979\tDisease\tMESH:D001254\tAstrocytic tumors': 1, 'astrocytic tumor': 1, 'astrocytic tumors\tPubTator3': 1, 'MESH\n28670979\tDisease\tMESH:D018302\tneuroepithelial neoplasms\tPubTator3\n28670979\tDisease\tMESH:D009369\ttumor\tPubTator3\n28670979\tDisease\tMESH:D005909\tglioblastomas': 1, 'glioblastoma\tPubTator3': 1, 'MESH\n28670979\tDisease\tMESH:D002471\t\tMESH\n36456979\tDisease\tMESH:D001068\tloss of appetite\tPubTator3\n36456979\tDisease\tMESH:D006402\thematologic toxicity\tPubTator3\n36456979\tDisease\tMESH:D066126\tcardiotoxicity\tPubTator3\n36456979\tDisease\tMESH:D005910\tgliomas\tPubTator3\n36456979\tDisease\tMESH:D004938\tesophageal cancer': 1, 'Esophageal cancer\tPubTator3': 1, 'MESH\n36456979\tDisease\tMESH:D005770\tgastrointestinal malignancies\tPubTator3\n36456979\tDisease\tMESH:D008171\tpulmonary toxicity\tPubTator3\n36456979\tDisease\tMESH:D002318\tcardiovascular toxicity\tPubTator3\n36456979\tDisease\tMESH:D009325\tnausea\tPubTator3\n36456979\tDisease\tMESH:C567116\tMF\tPubTator3\n36456979\tDisease\tMESH:D009362\tmetastasis of\tPubTator3\n36456979\tDisease\tMESH:D005767\tgastrointestinal toxicity\tPubTator3\n36456979\tDisease\tMESH:D015431\tweight loss\tPubTator3\n36456979\tDisease\tMESH:D003680\tdysphagia\tPubTator3\n36456979\tDisease\tMESH:D011475\tOS\tPubTator3\n36456979\tDisease\tMESH:D060050\tStable disease\tPubTator3\n36456979\tDisease\tMESH:D003967\tdiarrhea\tPubTator3\n36456979\tDisease\tMESH:D003643\tdeath\tPubTator3\n36456979\tDisease\tMESH:D009369\tcancer': 1, 'malignancies\tPubTator3\n36456979\tDisease\tMESH:D009477\tsensory neuropathy\tPubTator3\n36456979\tDisease\tMESH:D009503\tneutropenia\tPubTator3\n33566979\tDisease\tMESH:D065148\tleve embolia pulmonar\tPubTator3\n33566979\tDisease\tMESH:D007674\tTC\tPubTator3\n33566979\tDisease\tMESH:D005334\tfever\tPubTator3\n33566979\tDisease\tMESH:D000086382\tCovid-19': 1, 'SARS-CoV-2 infection': 1, 'Pandemics': 1, 'coronavirus disease 2019': 1, 'COVID-19.The': 1, 'de coronavirus 2019': 1, 'COVID-19 infection': 2, 'COVID-19': 1, 'SARS-CoV-2': 1, 'pandemia da doenca de coronavirus 2019': 1, 'infection by severe acute respiratory syndrome coronavirus 2\tPubTator3\n33566979\tDisease\tMESH:D000208\tacute\tPubTator3\n33566979\tDisease\tMESH:D011655\tpulmonary embolism\tPubTator3\n33566979\tDisease\tMESH:D045169\tSevere Acute Respiratory Syndrome\tPubTator3\n33566979\tDisease\tMESH:D002637\tchest pain\tPubTator3\n33566979\tDisease\tMESH:D003141\tinfectious complications\tPubTator3\n33566979\tDisease\tMESH:D019571\tarrhythmogenic right ventricular cardiomyopathy\tPubTator3\n33566979\tDisease\tMESH:D002318\tcardiovascular death': 1, 'cardiovascular': 2, 'Cardiovascular disease\tPubTator3\n33566979\tDisease\tMESH:D006111\tsindrome respiratoria aguda grave 2\tPubTator3\n33566979\tDisease\tMESH:D006331\tHT': 1, 'dysfunction': 1, 'Heart disease\tPubTator3\n33566979\tDisease\tMESH:D014693\tDAVE': 1, 'assistencia ventricular esquerda\tPubTator3\n33566979\tDisease\tMESH:D002311\tChagasic Dilated Chagasic ARVC\tPubTator3\n33566979\tDisease\tMESH:D012131\trespiratory failure': 1, 'acute respiratory failure\tPubTator3\n33566979\tDisease\tMESH:D003371\tcough\tPubTator3\n33566979\tDisease\tMESH:D007239\tinfection': 1, 'infected\tPubTator3\n33566979\tDisease\tMESH:D018352\tcoronavirus disease\tPubTator3\n33566979\tDisease\tMESH:D012140\trespiratory complications\tPubTator3\n33566979\tDisease\tMESH:D006333\theart failure': 1, 'cardiac decompensation\tPubTator3\n33566979\tDisease\tMESH:D003693\tdelirium\tPubTator3\n33566979\tDisease\tMESH:D003643\tdeath\tPubTator3\n33566979\tDisease\tMESH:D007511\tischemia\tPubTator3\n33566979\tDisease\tMESH:C535984\tChagasica Dilatada Chagasica CAVD INTERMACS': 1, 'CAVD\tPubTator3\n33566979\tDisease\tMESH:D011183\t\tMESH\n29290979\tDisease\tMESH:D002311\tdilated cardiomyopathy\tPubTator3\n29290979\tDisease\tMESH:D020257\tcardiac remodeling': 1, 'cardiac remodeling and dysfunction\tPubTator3\n29290979\tDisease\tMESH:D006331\tcardiac injury': 1, 'cardiac enlargement and dysfunction': 1, 'cardiac hypertrophic': 1, 'cardiac dysfunction\tPubTator3\n29290979\tDisease\tMESH:D000860\thypoxia\tPubTator3\n29290979\tDisease\tMESH:D009202\tcardiomyopathy\tPubTator3\n29290979\tDisease\tMESH:D014777\tviral infection of the heart\tPubTator3\n29290979\tDisease\tMESH:D007249\tinflammation': 1, 'inflammatory\tPubTator3\n29290979\tDisease\tMESH:D009223\tDM\tPubTator3\n29290979\tDisease\tMESH:D009369\tcancer\tPubTator3\n29290979\tDisease\tMESH:D054144\tdiastolic and systolic dysfunction\tPubTator3\n29290979\tDisease\tMESH:D006333\theart failure\tPubTator3\n29290979\tDisease\tMESH:C535850\tFS\tPubTator3\n29290979\tDisease\tMESH:D002312\thypertrophic cardiomyopathy': 1, 'hypertrophic\tPubTator3\n29290979\tDisease\tMESH:D003057\tOVE\tPubTator3\n29290979\tDisease\tMESH:D014947\tinjury\tPubTator3\n29290979\tDisease\tMESH:D003922\ttype 1 diabetic': 1, 'T1D': 1, 'type 1 diabetes\tPubTator3\n29290979\tDisease\tMESH:D003920\tdiabetic': 1, 'diabetic heart': 1, 'diabetic hearts\tPubTator3\n29290979\tDisease\tMESH:D006984\tmyocardial hypertrophy': 1, 'concentric hypertrophy': 1, 'hypertrophy\tPubTator3\n29290979\tDisease\tMESH:D006332\tcardiac hypertrophy': 1, 'cardiac dysfunction and hypertrophy': 1, 'Cardiac hypertrophy': 1, 'diabetic cardiac hypertrophy': 1, 'cardiac hypertrophy and dysfunction\tPubTator3\n29290979\tDisease\tMESH:D058065\tdiabetic cardiomyopathy': 1, 'DCM\tPubTator3\n29290979\tDisease\tMESH:D014652\tendothelial dysfunction\tPubTator3\n29290979\tDisease\tMESH:C563239\tIVSs\tPubTator3\n29290979\tDisease\tMESH:D006973\thypertension\tPubTator3\n29290979\tDisease\tMESH:D002551\tventricles\tPubTator3\n29290979\tDisease\tMESH:D002318\tDiabetic cardiovascular complications\tPubTator3\n29290979\tDisease\tMESH:D005355\tfibrosis': 1, 'cardiac fibrosis\tPubTator3\n4261979\tDisease\tMESH:D011604\talcoholic psychoses\tPubTator3': 1, 'MESH\n2241979\tDisease\tMESH:D003110\tcolon carcinoma\tPubTator3': 1, 'MESH\n3580979\tDisease\tMESH:D012769\tshock\tPubTator3\n3580979\tDisease\tMESH:D010842\tPica': 1, 'pica\tPubTator3\n3580979\tDisease\tMESH:D010437\tpeptic ulcer\tPubTator3\n3580979\tDisease\tMESH:D057112\tperforation\tPubTator3\n3580979\tDisease\tMESH:D001068\tdepraved appetite\tPubTator3\n3580979\tDisease\tMESH:D010146\tpain\tPubTator3\n3580979\tDisease\tMESH:D000006\tacute abdomen': 1, 'Acute abdomen\tPubTator3': 1, 'MESH\n3580979\tDisease\tMESH:D008607\tmentally retarded\tPubTator3': 1, 'MESH\n3580979\tDisease\tMESH:D003643\tdeath\tPubTator3\n23431979\tDisease\tMESH:D019042\tmuscle\tPubTator3\n146979\tDisease\tMESH:D012871\tdermatoses\tPubTator3\n146979\tDisease\tMESH:D009783\t\tMESH\n27406979\tDisease\tMESH:D006333\theart failure\tPubTator3': 1, 'MESH\n20185979\tDisease\tMESH:D006973\thypertension\tPubTator3': 1, 'MESH\n30416979\tDisease\tMESH:D006201\thair': 1, "hair damage\tPubTator3\n31494979\tDisease\tMESH:C563020\tanus and anal canal\tPubTator3\n31494979\tDisease\tMESH:D001859\tBone cancer\tPubTator3\n31494979\tDisease\tMESH:D008228\tnon-Hodgkin's lymphoma\tPubTator3\n31494979\tDisease\tMESH:D012878\tNon-melanoma skin cancers": 1, 'Non-melanoma skin cancer': 1, 'NMSCs\tPubTator3': 1, 'MESH\n31494979\tDisease\tMESH:D015179\tcancers of the colon and rectum\tPubTator3\n31494979\tDisease\tMESH:D002575\tcervical\tPubTator3\n31494979\tDisease\tMESH:D009369\tinternal malignancy': 1, 'internal malignancies': 1, 'cancers\tPubTator3\n31494979\tDisease\tMESH:D001943\tcancers of the thorax, oesophagus, breast, lung, stomach, thyroid gland\tPubTator3\n31494979\tDisease\tMESH:D007822\tnasal cavity and larynx\tPubTator3\n31494979\tDisease\tMESH:D016609\t\tMESH\n29545979\tDisease\tMESH:D005221\tfatigue\tPubTator3\n29545979\tDisease\tMESH:D003428\tHospital\tPubTator3\n29545979\tDisease\tMESH:C566176\tCar collisions': 1, 'car collisions\tPubTator3\n29545979\tDisease\tMESH:C536029\tcar crashes\tPubTator3\n29545979\tDisease\tMESH:D004630\temergency medicine': 1, 'Emergency Medicine\tPubTator3\n29545979\tDisease\tMESH:D003643\tdeath\tPubTator3\n27056979\tDisease\tMESH:D007319\tinsomnia\tPubTator3\n27056979\tDisease\tMESH:D000090862\tneuroinflammatory\tPubTator3\n27056979\tDisease\tMESH:D001342\tautonomic disorders\tPubTator3\n27056979\tDisease\tMESH:D012893\tsleep disturbances\tPubTator3\n27056979\tDisease\tMESH:D012608\tScrapie PrP\tPubTator3\n27056979\tDisease\tMESH:D009410\tSpongiform degeneration': 1, 'neuronal loss\tPubTator3\n27056979\tDisease\tMESH:D005911\tgliosis\tPubTator3': 1, 'MESH\n27056979\tDisease\tMESH:D009207\tmyoclonus\tPubTator3\n27056979\tDisease\tMESH:D034062\tFFI': 1, 'familial insomnia\tPubTator3': 1, 'MESH\n27056979\tDisease\tMESH:D017096\t\tMESH\n1236979\tDisease\tMESH:D007010\thyponatremia\tPubTator3': 1, 'MESH\n1236979\tDisease\tMESH:D007674\tKidney diseases\tPubTator3': 1, 'MESH\n16792979\tDisease\tMESH:D007239\tinfection\tPubTator3\n16792979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n16792979\tDisease\tMESH:D023521\t\tMESH\n1803979\tDisease\tMESH:D002637\tchest infections\tPubTator3\n1803979\tDisease\tMESH:D007876\tlegionellosis\tPubTator3': 1, 'MESH\n1803979\tDisease\tMESH:D011014\tpneumonia\tPubTator3\n1803979\tDisease\tMESH:D007239\tinfection\tPubTator3\n1803979\tDisease\tMESH:D007877\t\tMESH\n1803979\tDisease\tMESH:D012008\t\tMESH\n1803979\tDisease\tMESH:D002908\t\tMESH\n12432979\tDisease\tMESH:D010146\tepigastric pain\tPubTator3\n12432979\tDisease\tMESH:D014245\ttrichomoniasis\tPubTator3\n12432979\tDisease\tMESH:D014627\tvaginal\tPubTator3\n12432979\tDisease\tMESH:D010195\tacute pancreatitis': 1, 'pancreatitis\tPubTator3': 1, 'MESH\n12432979\tDisease\tMESH:D014247\t\tMESH\n28056979\tDisease\tMESH:D008288\tMalaria': 1, 'malaria symptoms': 1, 'Plasmodium infections': 1, 'malaria': 1, 'Plasmodium spp\tPubTator3': 1, 'MESH\n28056979\tDisease\tMESH:D007239\tinfected': 1, 'infections': 1, 'infection\tPubTator3\n28056979\tDisease\tMESH:D009181\tfungal\tPubTator3\n28056979\tDisease\tMESH:D003643\tdeaths\tPubTator3\n28056979\tDisease\tMESH:D005334\tfever': 1, 'Fever\tPubTator3\n28056979\tDisease\tMESH:D000071072\tfebrile\tPubTator3\n28056979\tDisease\tMESH:D058070\t\tMESH\n5195979\tDisease\tMESH:D010437\tgastroduodenal ulcer\tPubTator3': 1, 'MESH\n5195979\tDisease\tMESH:D004381\t\tMESH\n5195979\tDisease\tMESH:D011178\t\tMESH\n24699979\tDisease\tMESH:C535724\thip joint stiffness\tPubTator3\n24699979\tDisease\tMESH:D010264\tlower-limb paralysis': 1, 'LLP\tPubTator3\n7946979\tDisease\tMESH:D007414\tPrimary malignant tumors of the small intestine\tPubTator3': 1, 'MESH\n7946979\tDisease\tMESH:D007890\tleiomyosarcoma\tPubTator3': 1, "MESH\n7946979\tDisease\tMESH:D008228\tnon-Hodgkin's lymphoma\tPubTator3\n7946979\tDisease\tMESH:D000230\tadenocarcinomas\tPubTator3": 1, 'MESH\n7946979\tDisease\tMESH:D009369\tsmall bowel neoplasms\tPubTator3\n7946979\tDisease\tMESH:D002276\tcarcinoid tumor\tPubTator3': 1, 'MESH\n7946979\tDisease\tMESH:D016393\t\tMESH\n17604979\tDisease\tMESH:D059350\tchronic painful tendinosis\tPubTator3\n17604979\tDisease\tMESH:D052256\tAchilles tendinosis\tPubTator3': 1, 'MESH\n17604979\tDisease\tMESH:D010146\tpain\tPubTator3\n17604979\tDisease\tMESH:D002908\t\tMESH\n12014979\tDisease\tMESH:D004673\tVaccine Injury\tPubTator3\n37543979\tDisease\tMESH:D003680\tdysphagia': 1, 'Dysphagia\tPubTator3\n37543979\tDisease\tMESH:D003643\tdeath\tPubTator3\n37543979\tDisease\tMESH:D000208\tAcute Physiology and\tPubTator3\n7898979\tDisease\tMESH:D010661\thyperphenylalaninemia': 1, 'phenylalanine hydroxylase\tPubTator3\n7898979\tDisease\tMESH:D012128\trespiratory distress syndrome\tPubTator3\n7898979\tDisease\tMESH:D012127\t\tMESH\n31772979\tDisease\tMESH:D004408\tdysgeusia\tPubTator3\n31772979\tDisease\tMESH:D064420\ttoxicity': 1, 'toxicities': 1, 'Toxicity\tPubTator3\n31772979\tDisease\tMESH:D014987\txerostomia\tPubTator3\n31772979\tDisease\tMESH:D012468\tsalivary gland carcinoma\tPubTator3\n31772979\tDisease\tMESH:D052958\tperineural\tPubTator3\n31772979\tDisease\tMESH:D012512\tEwing sarcoma\tPubTator3\n31772979\tDisease\tMESH:D009369\ttumors\tPubTator3\n31772979\tDisease\tMESH:D010307\tparotid cancers\tPubTator3\n31772979\tDisease\tMESH:D052016\tmucositis': 1, 'Mucosal toxicities': 1, 'mucosal toxicity\tPubTator3\n31772979\tDisease\tMESH:D003680\tdysphagia\tPubTator3\n31772979\tDisease\tMESH:D015431\tweight loss\tPubTator3\n31772979\tDisease\tMESH:D012878\tskin carcinoma\tPubTator3\n32817979\tDisease\tMESH:D012128\tDistress\tPubTator3\n32817979\tDisease\tMESH:D006333\tHeart Failure\tPubTator3\n32817979\tDisease\tMESH:D003324\tCoronary Artery Disease\tPubTator3\n32817979\tDisease\tMESH:D003643\tdeaths': 1, 'mortality': 1, 'Mortality\tPubTator3\n32817979\tDisease\tMESH:D013923\tThromboembolism\tPubTator3\n32817979\tDisease\tMESH:D008107\tLiver Disease\tPubTator3\n32817979\tDisease\tMESH:D009203\tMyocardial Infarction\tPubTator3\n32817979\tDisease\tMESH:D006973\tHypertension\tPubTator3\n32817979\tDisease\tMESH:D002543\tIntracerebral Hemorrhage\tPubTator3\n32817979\tDisease\tMESH:D058186\tacute kidney injury\tPubTator3\n32817979\tDisease\tMESH:D003920\tDiabetes mellitus\tPubTator3\n32817979\tDisease\tMESH:D007859\tML\tPubTator3\n32817979\tDisease\tMESH:D001281\tAtrial Fibrillation\tPubTator3\n32817979\tDisease\tMESH:D000086382\tCOVID-19': 1, 'COVID': 2, 'Coronavirus disease 2019\tPubTator3\n32817979\tDisease\tMESH:D001249\tasthma\tPubTator3\n11622979\tDisease\tMESH:D001943\tbreast cancer\tPubTator3\n11622979\tDisease\tMESH:D009369\t\tMESH\n31479979\tDisease\tMESH:D054198\tacute lymphoblastic leukemias': 1, 'acute lymphoblastic leukemia\tPubTator3': 1, 'MESH\n31479979\tDisease\tMESH:D015208\tsmoking': 1, 'SHS\tPubTator3\n6615979\tDisease\tMESH:D007239\tinfections': 1, 'infection\tPubTator3\n6615979\tDisease\tMESH:D013203\t\tMESH\n19249979\tDisease\tMESH:D010939\tplant disease\tPubTator3\n19249979\tDisease\tMESH:D014901\t\tMESH\n19249979\tDisease\tMESH:D005585\t\tMESH\n15229979\tDisease\tMESH:D011565\tpsoriasis\tPubTator3': 1, 'MESH\n15229979\tDisease\tMESH:D000070676\tachilles tendon enthesopathy\tPubTator3\n15229979\tDisease\tMESH:D052256\t\tMESH\n15229979\tDisease\tMESH:D012216\t\tMESH\n14182979\tDisease\tMESH:D004194\tEFFECT OF IONIZING RADIATION\tPubTator3\n14182979\tDisease\tMESH:D020763\tCONDITIONS\tPubTator3\n14182979\tDisease\tMESH:D009369\t\tMESH\n14182979\tDisease\tMESH:D011832\t\tMESH\n14182979\tDisease\tMESH:D011833\t\tMESH\n14182979\tDisease\tMESH:D010051\t\tMESH\n12364979\tDisease\tMESH:D007248\tmale infertility\tPubTator3': 1, 'MESH\n12364979\tDisease\tMESH:D004195\t\tMESH\n15528979\tDisease\tMESH:D012817\tgastrointestinal symptoms\tPubTator3\n15528979\tDisease\tMESH:D005076\trash\tPubTator3\n15528979\tDisease\tMESH:C569627\tcold symptoms\tPubTator3\n15528979\tDisease\tMESH:D003967\tdiarrhea\tPubTator3\n15528979\tDisease\tMESH:D006261\theadache\tPubTator3\n11574979\tDisease\tMESH:D013927\tThrombosis': 1, 'thrombosis\tPubTator3\n11574979\tDisease\tMESH:D017541\tPseudoaneurysm': 1, 'femoral artery pseudoaneurysm': 1, 'pseudoaneurysm of the femoral artery': 1, 'pseudoaneurysm\tPubTator3': 1, 'MESH\n2331979\tDisease\tMESH:D015208\tSmoking': 1, 'smoking\tPubTator3\n11158979\tDisease\tMESH:D003920\tdiabetics\tPubTator3\n11158979\tDisease\tMESH:D003324\tCoronary artery disease': 1, 'CAD\tPubTator3\n11158979\tDisease\tMESH:D003643\tdeath\tPubTator3\n11158979\tDisease\tMESH:D013585\tintimal thickening\tPubTator3\n22907979\tDisease\tMESH:D003093\tulcerative colitis\tPubTator3\n22907979\tDisease\tMESH:D012002\trectal bleeding': 1, 'Rectal bleeding\tPubTator3\n22907979\tDisease\tMESH:D011127\tjuvenile polyps\tPubTator3\n22907979\tDisease\tMESH:D011350\trectocolitis\tPubTator3\n22907979\tDisease\tMESH:D014648\tsigmoid varices\tPubTator3\n22907979\tDisease\tMESH:D018256\tadenomatous polyps\tPubTator3\n36772979\tDisease\tMESH:D007246\tinfertility\tPubTator3\n36772979\tDisease\tMESH:D002908\tchronic diseases\tPubTator3\n3241979\tDisease\tMESH:D005885\tGingival hyperplasia\tPubTator3': 1, 'MESH\n30458979\tDisease\tMESH:D001862\tbone resorption\tPubTator3\n30458979\tDisease\tMESH:D000070779\ttenosynovial giant cell tumors\tPubTator3\n30458979\tDisease\tMESH:D009362\tmetastases\tPubTator3\n30458979\tDisease\tMESH:D002292\trenal cell carcinoma\tPubTator3\n30458979\tDisease\tMESH:D061325\tprostate, brain, breast, pancreas, ovaries\tPubTator3\n30458979\tDisease\tMESH:D018317\tSheath Tumors\tPubTator3\n30458979\tDisease\tMESH:D020258\tneurotoxicity\tPubTator3\n30458979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n30458979\tDisease\tMESH:D003108\tColon\tPubTator3\n30458979\tDisease\tMESH:D018243\tteratocarcinoma\tPubTator3\n30458979\tDisease\tMESH:D000072716\tTAMs\tPubTator3\n30458979\tDisease\tMESH:D019337\thematologic malignancies\tPubTator3\n30458979\tDisease\tMESH:D008654\tMesothelioma\tPubTator3\n30458979\tDisease\tMESH:D066126\tcardiotoxicity\tPubTator3\n30458979\tDisease\tMESH:D006402\thematologic toxicity\tPubTator3\n30458979\tDisease\tMESH:D001749\trenal and bladder cancers': 1, 'bladder cancer': 1, 'urothelial bladder cancer\tPubTator3\n30458979\tDisease\tMESH:D012509\tsarcomas': 1, 'Sarcoma - 2\tPubTator3\n30458979\tDisease\tMESH:D020914\tTAM\tPubTator3\n30458979\tDisease\tMESH:D009369\tCancer': 1, 'GU malignancies': 1, 'Tumor-': 1, 'neoplastic': 1, 'Solid Tumors\tPubTator3': 1, 'MESH\n30458979\tDisease\tMESH:D011471\tmetastatic prostate cancer': 1, 'prostate cancer\tPubTator3\n30458979\tDisease\tMESH:D028361\tmitochondrial\tPubTator3\n30458979\tDisease\tMESH:D001943\tpancreatic and breast cancers': 1, 'breast and prostate cancer\tPubTator3\n30458979\tDisease\tMESH:D010190\tpancreatic adenocarcinoma': 1, 'pancreatic cancer\tPubTator3\n30458979\tDisease\tMESH:D008545\tMelanoma': 1, 'melanoma\tPubTator3\n30458979\tDisease\tMESH:D010051\tovarian cancer': 1, 'ovarian tumor\tPubTator3\n30458979\tDisease\tMESH:D015179\tpancreas and colon cancers\tPubTator3\n30458979\tDisease\tMESH:D003643\tdeath\tPubTator3\n30458979\tDisease\tMESH:D000505\talopecia\tPubTator3\n30458979\tDisease\tMESH:D005909\tGlioblastoma': 1, 'glioblastoma\tPubTator3\n30458979\tDisease\tMESH:D005870\tDiffuse-Type Giant Cell tumors\tPubTator3\n30458979\tDisease\tMESH:D011472\trenal, bladder, prostate, and testicular\tPubTator3\n30458979\tDisease\tMESH:D014565\tgenitourinary cancers': 1, 'genitourinary malignancies\tPubTator3\n2369979\tDisease\tMESH:D002908\tchronic illness\tPubTator3': 1, 'MESH\n2369979\tDisease\tMESH:D001523\tnon-psychotic psychiatric disturbance\tPubTator3\n2369979\tDisease\tMESH:D010146\tpain\tPubTator3\n2369979\tDisease\tMESH:D008881\tmigraine\tPubTator3': 1, 'MESH\n2369979\tDisease\tMESH:D001172\trheumatoid arthritis\tPubTator3': 1, 'MESH\n19433979\tDisease\tMESH:D001145\tarrhythmia\tPubTator3\n19433979\tDisease\tMESH:D006973\tHypertension': 1, 'hypertension\tPubTator3': 1, 'MESH\n22401979\tDisease\tMESH:D010049\tovarian carcinogenesis\tPubTator3\n22401979\tDisease\tMESH:D010051\tovarian and tumor': 1, 'ovarian tumor\tPubTator3\n22401979\tDisease\tMESH:D009369\ttumor\tPubTator3\n8669979\tDisease\tMESH:D000079262\tMaternal': 1, 'maternal\tPubTator3\n8669979\tDisease\tMESH:D007744\t\tMESH\n34283979\tDisease\tOMIM:612635\tNPDR\tPubTator3\n34283979\tDisease\tMESH:D008269\tDiabetic Macular Edema': 1, 'diabetic macular edema': 1, 'DME\tPubTator3': 1, 'MESH\n34283979\tDisease\tMESH:D003930\tdiabetic retinopathy\tPubTator3': 1, 'MESH\n34283979\tDisease\tMESH:D003920\t\tMESH\n6788979\tDisease\tMESH:D001749\tcarcinoma of urinary bladder\tPubTator3': 1, 'MESH\n14147979\tDisease\tOMIM:300082\tSOCIAL WELFARE\tPubTator3\n13912979\tDisease\tMESH:D007855\tlead poisoning\tPubTator3': 1, 'MESH\n2545979\tDisease\tMESH:D009369\ttumor\tPubTator3\n2545979\tDisease\tMESH:D018288\tsmall cell bronchial carcinomas': 1, 'SCLC': 1, 'small-cell bronchial carcinomas\tPubTator3': 1, 'MESH\n2545979\tDisease\tMESH:D001984\t\tMESH\n26792979\tDisease\tMESH:D003920\tDiabetes': 1, 'diabetes mellitus': 1, 'diabetic': 2, 'Diabetic\tPubTator3\n26792979\tDisease\tMESH:C000721848\thypoglycemic\tPubTator3\n26792979\tDisease\tMESH:D058426\tatherogenic lesion formation\tPubTator3\n26792979\tDisease\tMESH:D003921\texperimental diabetes\tPubTator3': 1, 'MESH\n26792979\tDisease\tMESH:D018149\timpaired glucose tolerance\tPubTator3\n26792979\tDisease\tMESH:D007003\thypoglycemia\tPubTator3\n26792979\tDisease\tMESH:D006943\thyperglycemia\tPubTator3\n26792979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n26792979\tDisease\tMESH:D003924\ttype 2 diabetic\tPubTator3\n26792979\tDisease\tMESH:D015431\tweight loss\tPubTator3\n26792979\tDisease\tMESH:D009223\tDM': 1, 'diabetic DM\tPubTator3\n26792979\tDisease\tMESH:D006944\thyperglycemic\tPubTator3\n26792979\tDisease\tMESH:D050171\tdyslipidemia\tPubTator3\n15242979\tDisease\tMESH:D009203\tmyocardial infarction\tPubTator3': 1, 'MESH\n6148979\tDisease\tMESH:D023921\tcoronary stenosis': 1, 'coronary artery stenosis\tPubTator3\n6148979\tDisease\tMESH:D013610\ttachycardia\tPubTator3\n6148979\tDisease\tMESH:D017682\tischaemic myocardium\tPubTator3\n6148979\tDisease\tMESH:D018917\tischaemic\tPubTator3\n6148979\tDisease\tMESH:D003327\t\tMESH\n7714979\tDisease\tMESH:D011471\tProstate cancer\tPubTator3': 1, 'MESH\n7714979\tDisease\tMESH:D009362\t\tMESH\n19780979\tDisease\tMESH:D014627\tvulvo-vaginal candidosis': 1, 'RVC\tPubTator3\n19780979\tDisease\tMESH:D004342\tallergic disease': 1, 'allergic\tPubTator3\n19780979\tDisease\tMESH:D002181\t\tMESH\n22789979\tDisease\tMESH:D001745\turinary bladder function impairment\tPubTator3\n22789979\tDisease\tMESH:D013118\tmyelopathy\tPubTator3': 1, 'MESH\n22789979\tDisease\tMESH:D012678\tsensory function impairment\tPubTator3\n22789979\tDisease\tMESH:D000068079\tmotor function impairment\tPubTator3\n22789979\tDisease\tMESH:D002575\tcervical spondylotic myelopathy': 1, 'CSM\tPubTator3\n22789979\tDisease\tMESH:D009468\t\tMESH\n22789979\tDisease\tMESH:D055009\t\tMESH\n34158979\tDisease\tMESH:D064752\tventricular electrical remodeling\tPubTator3\n34158979\tDisease\tMESH:D007249\tinflammation': 1, 'Inflammatory': 1, 'inflammatory\tPubTator3\n34158979\tDisease\tMESH:C564288\tdyspnoea on exertion\tPubTator3\n34158979\tDisease\tMESH:D007035\thypothermia\tPubTator3\n34158979\tDisease\tMESH:D017254\tpulmonary infiltrates\tPubTator3\n34158979\tDisease\tMESH:D014693\tventricular fibrillation cardiac arrest\tPubTator3\n34158979\tDisease\tMESH:D000860\thypoxia\tPubTator3\n34158979\tDisease\tMESH:D016171\ttorsades de pointes\tPubTator3\n34158979\tDisease\tMESH:D056486\tabnormal liver function\tPubTator3\n34158979\tDisease\tMESH:D018754\tventricular repolarization abnormality': 1, 'ventricular repolarization disorder\tPubTator3\n34158979\tDisease\tMESH:D008133\tProlonged QTc': 1, 'long QT syndrome': 1, 'congenital prolongation': 1, 'QTc Prolongation': 1, 'prolonged QT': 1, 'prolonged corrected QT interval': 1, 'QT prolongation': 1, 'QTc prolongation\tPubTator3\n34158979\tDisease\tMESH:D006333\theart failure\tPubTator3\n34158979\tDisease\tMESH:D016757\tsudden cardiac death\tPubTator3\n34158979\tDisease\tMESH:D003645\tsudden adult death syndrome\tPubTator3\n34158979\tDisease\tMESH:D001943\tbreast cancer\tPubTator3\n34158979\tDisease\tMESH:D010490\tpericardial effusion\tPubTator3\n34158979\tDisease\tMESH:D004487\tedema\tPubTator3\n34158979\tDisease\tMESH:D000086382\tCOVID-19': 1, 'COVID-': 1, 'COVID Disease': 1, 'coronavirus disease 2019\tPubTator3\n34158979\tDisease\tMESH:D005334\tfevers': 1, 'fever\tPubTator3\n34158979\tDisease\tMESH:D005355\tmyocardial fibrosis\tPubTator3\n34158979\tDisease\tMESH:D003638\tcongenital deafness\tPubTator3\n34158979\tDisease\tMESH:D002637\tchest pain\tPubTator3\n34158979\tDisease\tMESH:D002318\tcardiovascular disease\tPubTator3\n34158979\tDisease\tMESH:D012804\tsinus bradycardia\tPubTator3\n34158979\tDisease\tMESH:D006679\tHIV seropositivity\tPubTator3\n34980979\tDisease\tMESH:D063647\tFetal Alcohol Spectrum Disorder': 1, 'Fetal alcohol spectrum disorder': 1, 'FASD\tPubTator3\n34980979\tDisease\tMESH:D001523\tsocioemotional and behavioral problems\tPubTator3\n34980979\tDisease\tMESH:D019958\toppositional defiant disorder': 1, 'ODD\tPubTator3\n34980979\tDisease\tMESH:D008607\tintellectual disability\tPubTator3\n34980979\tDisease\tMESH:D001289\tattention-deficit/hyperactivity disorder': 1, 'ADHD\tPubTator3\n34980979\tDisease\tMESH:D002658\tneurodevelopmental disorder\tPubTator3\n34980979\tDisease\tMESH:D000082122\tinternalizing and externalizing disorders\tPubTator3\n34980979\tDisease\tMESH:D007859\tneurodevelopmental disabilities\tPubTator3\n34980979\tDisease\tMESH:D006968\tneurodevelopmental delays\tPubTator3\n34980979\tDisease\tMESH:D019964\tDMDD': 1, 'disruptive mood dysregulation disorder\tPubTator3\n34980979\tDisease\tMESH:D003072\tcognitive impairment\tPubTator3\n34980979\tDisease\tMESH:D003866\tdepressive disorder\tPubTator3\n34980979\tDisease\tMESH:D000068376\tsecondary\tPubTator3\n25897979\tDisease\tMESH:C000721848\ttoxic hypoglycemic syndrome': 1, 'hypoglycemic encephalopathy\tPubTator3\n25897979\tDisease\tMESH:D014839\tvomiting': 1, 'emesis': 1, 'vomiting sickness\tPubTator3\n25897979\tDisease\tMESH:D001927\tbrain disorder\tPubTator3\n25897979\tDisease\tMESH:D000071072\tacute encephalitis': 1, 'febrile\tPubTator3\n25897979\tDisease\tMESH:D003866\tdepressed\tPubTator3\n25897979\tDisease\tMESH:D018792\tviral encephalitis': 1, 'lychee-linked viral encephalitis': 1, 'Lychee-Linked Viral Encephalitis\tPubTator3\n25897979\tDisease\tMESH:D020258\tneurotoxic\tPubTator3\n25897979\tDisease\tMESH:D003128\tcoma\tPubTator3\n25897979\tDisease\tMESH:D007003\thypoglycemia\tPubTator3\n25897979\tDisease\tMESH:D012640\tseizures\tPubTator3\n25897979\tDisease\tMESH:D053609\tlethargy\tPubTator3\n25897979\tDisease\tMESH:D013543\tsweating\tPubTator3\n25897979\tDisease\tMESH:D006261\theadache\tPubTator3\n25897979\tDisease\tMESH:D000138\tmetabolic acidosis\tPubTator3\n25897979\tDisease\tMESH:D003643\tdeath\tPubTator3\n25897979\tDisease\tMESH:D004660\t\tMESH\n29449979\tDisease\tMESH:D001249\tasthma\tPubTator3\n29449979\tDisease\tMESH:D020914\tOSCE\tPubTator3\n29449979\tDisease\tMESH:C565484\tSIM\tPubTator3\n29449979\tDisease\tMESH:D002637\tchest pain\tPubTator3\n29449979\tDisease\tMESH:D001007\tanxiety\tPubTator3\n32165979\tDisease\tMESH:C538154\tGMFSC IV and V\tPubTator3\n32165979\tDisease\tMESH:C537613\tpelvic-rib impingement\tPubTator3\n32165979\tDisease\tMESH:C563613\tthoracolumbar or lumbar curves\tPubTator3\n32165979\tDisease\tMESH:C536198\tscoliotic curves\tPubTator3\n32165979\tDisease\tMESH:D002493\tneurologic complications\tPubTator3\n32165979\tDisease\tMESH:D004204\tdislocation\tPubTator3\n32165979\tDisease\tMESH:D012600\ttype 1 scoliosis': 1, 'neuromuscular scoliosis': 1, 'Scoliosis': 1, 'idiopathic scoliosis': 1, 'scoliosis': 1, '1 scoliosis\tPubTator3\n32165979\tDisease\tMESH:D009140\tdeformity': 1, 'musculoskeletal deformities': 1, 'deformities': 1, 'Deformity\tPubTator3\n32165979\tDisease\tMESH:D006617\thip dislocation': 1, 'hip dysplasia\tPubTator3\n32165979\tDisease\tMESH:C536988\tmotor and sensory dysfunction\tPubTator3\n32165979\tDisease\tMESH:D001927\tencephalopathy\tPubTator3\n32165979\tDisease\tMESH:D009468\tneuromuscular\tPubTator3\n32165979\tDisease\tMESH:D008141\tlordosis\tPubTator3\n32165979\tDisease\tMESH:D005530\tknee and foot deformities\tPubTator3\n32165979\tDisease\tMESH:D013530\tpostoperative infection\tPubTator3\n32165979\tDisease\tMESH:D011030\tpneumothorax\tPubTator3\n32165979\tDisease\tMESH:D003286\tcontractures': 1, 'shoulder internal rotation contractures\tPubTator3\n32165979\tDisease\tMESH:D001851\tosteopenia\tPubTator3\n32165979\tDisease\tMESH:D008171\tpulmonary complications\tPubTator3\n32165979\tDisease\tMESH:D011782\tquadriplegic\tPubTator3\n32165979\tDisease\tMESH:D058866\tosteoporotic': 1, 'osteoporotic bone\tPubTator3\n32165979\tDisease\tMESH:D006616\thip and knee contractures': 1, 'hip flexion contractures\tPubTator3\n32165979\tDisease\tMESH:D004827\tseizure disorder\tPubTator3\n32165979\tDisease\tMESH:D034161\tPO\tPubTator3\n32165979\tDisease\tMESH:D009461\tneurological deficit\tPubTator3\n32165979\tDisease\tMESH:D016135\tspine': 1, 'spine deformities\tPubTator3\n32165979\tDisease\tMESH:D002547\tCP': 1, 'cerebral palsy': 1, 'spastic cerebral palsy': 1, 'Cerebral palsy': 1, 'spastic diplegia\tPubTator3\n32165979\tDisease\tMESH:D007738\tthoracic kyphosis': 1, 'junctional kyphosis': 1, 'kyphosis\tPubTator3\n32165979\tDisease\tMESH:C535781\tvertebral curves\tPubTator3\n32165979\tDisease\tMESH:D008107\tComplications\tPubTator3\n32165979\tDisease\tMESH:C535850\tshortening\tPubTator3\n32165979\tDisease\tMESH:D007239\tinfection\tPubTator3\n32165979\tDisease\tMESH:D003668\tpressure sores\tPubTator3\n32165979\tDisease\tMESH:D011542\tpseudarthrosis\tPubTator3\n32165979\tDisease\tMESH:D010146\tpain\tPubTator3\n32165979\tDisease\tMESH:D020968\tcervico\tPubTator3\n32165979\tDisease\tMESH:D010024\tosteoporosis\tPubTator3\n32165979\tDisease\tMESH:D013122\tspinal deformities': 1, 'spinal deformity\tPubTator3\n32165979\tDisease\tMESH:C565711\tkyphoscoliosis of the\tPubTator3\n32165979\tDisease\tMESH:D010386\tpelvis\tPubTator3\n32165979\tDisease\tMESH:D008310\tGMFCS': 1, 'GMFCS types IV and V\tPubTator3\n32165979\tDisease\tMESH:D009069\tMotor disability\tPubTator3\n32165979\tDisease\tMESH:D016063\tblood loss\tPubTator3\n32165979\tDisease\tMESH:D005909\tGMFCS grade IV and V\tPubTator3\n32165979\tDisease\tMESH:D009128\tspasticity\tPubTator3\n23757979\tDisease\tMESH:D053713\tazoospermia\tPubTator3': 1, 'MESH\n23757979\tDisease\tMESH:D000072660\tteratospermia\tPubTator3\n23757979\tDisease\tMESH:D009845\toligospermia\tPubTator3': 1, 'MESH\n23757979\tDisease\tMESH:D007246\tinfertility\tPubTator3\n23757979\tDisease\tMESH:D007248\tmale infertility\tPubTator3\n23757979\tDisease\tMESH:D053627\t\tMESH\n26964979\tDisease\tMESH:D003681\tdehydration\tPubTator3\n1387979\tDisease\tMESH:D012600\tscoliosis': 1, 'idiopathic scoliosis\tPubTator3': 1, 'MESH\n1387979\tDisease\tMESH:D055959\tdisc disease\tPubTator3\n1387979\tDisease\tMESH:D010146\tpain\tPubTator3\n1387979\tDisease\tMESH:D001416\tback pain': 1, 'Back pain': 1, 'Back pain and disability\tPubTator3': 1, 'MESH\n13589979\tDisease\tMESH:D001145\t\tMESH\n33032979\tDisease\tMESH:D005355\tfibrosis': 1, 'cirrhosis\tPubTator3\n33032979\tDisease\tMESH:D002311\tCongestive hepatopathy': 1, 'congestive hepatopathy\tPubTator3\n33032979\tDisease\tMESH:D006940\tvenous congestion\tPubTator3\n33032979\tDisease\tMESH:D006528\thepatocellular carcinoma\tPubTator3': 1, "MESH\n33032979\tDisease\tMESH:D008103\t\tMESH\n33032979\tDisease\tMESH:D008113\t\tMESH\n9178979\tDisease\tMESH:D020786\tCAM\tPubTator3\n3878979\tDisease\tMESH:D005922\tBerger's disease\tPubTator3": 1, 'MESH\n5848979\tDisease\tMESH:D008478\tpneumomediastinum\tPubTator3': 1, 'MESH\n5848979\tDisease\tMESH:D008171\t\tMESH\n5848979\tDisease\tMESH:D007232\t\tMESH\n15953979\tDisease\tMESH:D015208\tsmoking\tPubTator3\n8315979\tDisease\tMESH:D007239\tinfection\tPubTator3\n8315979\tDisease\tMESH:D007565\tjaundice\tPubTator3\n8315979\tDisease\tMESH:D006509\thepatitis B': 1, 'HBV infection': 1, 'infection by HBV\tPubTator3': 1, 'MESH\n28300979\tDisease\tMESH:C000657744\tCF\tPubTator3\n6992979\tDisease\tMESH:D009369\ttumor\tPubTator3\n6992979\tDisease\tMESH:D018288\tbronchogenic small cell anaplastic carcinoma\tPubTator3\n6992979\tDisease\tMESH:D009362\tbrain metastasis\tPubTator3\n6992979\tDisease\tMESH:D008175\t\tMESH\n6992979\tDisease\tMESH:D013921\t\tMESH\n6992979\tDisease\tMESH:D001932\t\tMESH\n6992979\tDisease\tMESH:D002283\t\tMESH\n6992979\tDisease\tMESH:D003680\t\tMESH\n6992979\tDisease\tMESH:D007970\t\tMESH\n24066979\tDisease\tMESH:D001766\tlegally blind': 1, 'vision-legally blind\tPubTator3\n24066979\tDisease\tMESH:D001007\tanxiety\tPubTator3\n24066979\tDisease\tMESH:D001523\tbehavior problems': 1, 'psychiatric conditions': 1, 'repetitive behaviors': 1, 'psychiatric or behavioral problems': 1, 'Mental Disorders': 1, 'behavioral problems': 1, 'behavioral disorder': 1, 'behavioral disturbances\tPubTator3\n24066979\tDisease\tMESH:D000067877\tAutism spectrum disorder': 1, 'ASD': 1, 'autism spectrum disorder\tPubTator3\n24066979\tDisease\tMESH:D011618\tpsychotic disorders\tPubTator3\n24066979\tDisease\tMESH:D004827\tSeizure disorder': 1, 'seizure disorder\tPubTator3\n24066979\tDisease\tMESH:D004314\tDown syndrome\tPubTator3\n24066979\tDisease\tMESH:D002658\tdevelopmental disabilities': 1, 'developmental disability': 1, 'Developmental Disability\tPubTator3\n24066979\tDisease\tMESH:D009461\tdeficits': 1, 'neurological problem': 1, 'social deficits\tPubTator3\n24066979\tDisease\tMESH:D001321\tautistic symptoms': 1, 'autism\tPubTator3\n24066979\tDisease\tMESH:D008607\tintellectual disability': 1, 'Intellectual disability': 1, 'intellectual and/or developmental disability': 1, 'mental retardation': 1, 'ID\tPubTator3\n24066979\tDisease\tMESH:D019958\tdisruptive or': 1, 'disruptive behavior': 1, 'disruptive and destructive behavior': 1, 'disruptive and destructive behaviors\tPubTator3\n24066979\tDisease\tMESH:D010554\taggressive behavior problems\tPubTator3\n24066979\tDisease\tMESH:C565406\tintellectual impairment\tPubTator3\n24066979\tDisease\tMESH:D003704\tdementia\tPubTator3\n24066979\tDisease\tMESH:D034381\thearing problems': 1, 'hearing loss': 1, 'hearing impairment\tPubTator3\n24066979\tDisease\tMESH:D002659\tpervasive developmental disorder': 1, "pervasive developmental disorders\tPubTator3\n24066979\tDisease\tMESH:D004194\tdiseases\tPubTator3\n24066979\tDisease\tMESH:D012652\tself-injury\tPubTator3\n24066979\tDisease\tMESH:C565377\tsocial isolation\tPubTator3\n24066979\tDisease\tMESH:D003072\tfunctional impairment\tPubTator3\n24066979\tDisease\tMESH:D000544\tAlzheimer's disease\tPubTator3\n24066979\tDisease\tMESH:D019964\tmood disorders\tPubTator3\n24066979\tDisease\tMESH:D059445\tphysical disability": 1, "Physical disability\tPubTator3\n24066979\tDisease\tMESH:D019973\tproblems\tPubTator3\n24066979\tDisease\tMESH:D014947\tinjury\tPubTator3\n24066979\tDisease\tMESH:D020512\tNCI\tPubTator3\n24066979\tDisease\tMESH:D054062\tvision or hearing deficits\tPubTator3\n24066979\tDisease\tMESH:D020817\tAsperger's disorder\tPubTator3\n24066979\tDisease\tMESH:C537761\tintellectual deficits\tPubTator3\n22406979\tDisease\tMESH:D000860\thypoxia\tPubTator3\n22406979\tDisease\tMESH:D002534\thypoxic\tPubTator3\n35728979\tDisease\tMESH:D013927\tthrombosis\tPubTator3\n35728979\tDisease\tMESH:D050171\tDyslipidemia": 1, 'dyslipidemia\tPubTator3\n35728979\tDisease\tMESH:D017542\trupture of the aneurysm': 1, 'aneurysm rupture': 1, 'hypophyseal artery aneurysm rupture': 1, 'aneurysm ruptures\tPubTator3\n35728979\tDisease\tMESH:D013923\tthromboembolism': 1, 'thromboembolic\tPubTator3\n35728979\tDisease\tMESH:C536298\tISA\tPubTator3\n35728979\tDisease\tMESH:D009461\tneurologic deficits\tPubTator3\n35728979\tDisease\tMESH:D020766\temboli\tPubTator3\n35728979\tDisease\tMESH:D003643\tdied': 1, 'death\tPubTator3\n35728979\tDisease\tMESH:D010291\themipareses\tPubTator3\n35728979\tDisease\tMESH:D013345\tsubarachnoid hemorrhage\tPubTator3\n35728979\tDisease\tMESH:D017202\tischemic complications\tPubTator3\n35728979\tDisease\tMESH:D017760\tmalposition': 1, 'Trunk malposition\tPubTator3\n35728979\tDisease\tMESH:D020244\tMCA territory infarction\tPubTator3\n35728979\tDisease\tMESH:D012421\trupture of\tPubTator3\n35728979\tDisease\tMESH:D002545\tischemic\tPubTator3\n35728979\tDisease\tMESH:D006987\thypoesthesias\tPubTator3\n35728979\tDisease\tMESH:D012078\tartery\tPubTator3\n35728979\tDisease\tMESH:D002340\tcarotid artery aneurysms': 1, 'carotid artery occlusion': 1, 'ICA aneurysms': 1, 'Carotid Artery Aneurysms': 1, 'internal carotid artery (ICA) aneurysms\tPubTator3\n35728979\tDisease\tMESH:D008310\tmRRC\tPubTator3\n35728979\tDisease\tMESH:D002318\tevents\tPubTator3\n35728979\tDisease\tMESH:D020795\tphotophobias\tPubTator3\n35728979\tDisease\tMESH:D014786\tVisual disturbance': 1, 'LVIS': 1, 'visual disturbances\tPubTator3\n35728979\tDisease\tMESH:D064420\tHemorrhagic adverse events': 1, 'ischemic adverse events': 1, 'IAEs': 1, 'HAEs\tPubTator3\n35728979\tDisease\tMESH:D002543\tcerebral hemorrhage\tPubTator3\n35728979\tDisease\tMESH:D000783\taneurysmal': 1, 'paraclinoid aneurysms': 1, 'aneurysm': 1, 'aneurysmal occlusion': 1, 'paraclinoid aneurysm': 1, 'supraclinoid aneurysm': 1, 'Aneurysm occlusion': 1, 'aneurysms': 1, 'Aneurysm': 1, 'supraclinoid aneurysms': 1, 'aneurysm occlusion': 1, 'aneurysmal complete occlusion\tPubTator3\n35728979\tDisease\tMESH:D001037\taphasia\tPubTator3\n35728979\tDisease\tMESH:D006973\thypertension': 1, 'Hypertension\tPubTator3\n35728979\tDisease\tMESH:D003072\tCognitive impairment\tPubTator3\n35728979\tDisease\tMESH:C537538\tclinoid segment aneurysm\tPubTator3\n35728979\tDisease\tMESH:D006429\tHemiplegia\tPubTator3\n35728979\tDisease\tMESH:D002546\ttransient ischemic attack': 1, 'TIA': 1, 'TIAs\tPubTator3\n35728979\tDisease\tMESH:D010003\tOA\tPubTator3\n35728979\tDisease\tMESH:D002544\tchoroidal artery': 1, 'cerebral infarction': 1, 'anterior choroidal artery aneurysm\tPubTator3\n35728979\tDisease\tMESH:D006258\twide-neck aneurysms\tPubTator3\n35728979\tDisease\tMESH:D007238\tthalamus infarction': 1, 'Thalamus infarction': 1, 'infarction\tPubTator3\n35728979\tDisease\tMESH:D006470\tbleeding': 1, 'hemorrhage\tPubTator3\n35728979\tDisease\tMESH:D057772\tvascular damage\tPubTator3\n35728979\tDisease\tMESH:D005119\tcontrast\tPubTator3\n35728979\tDisease\tMESH:D003251\tDelayed instent stenosis': 1, 'stenoses': 1, 'stenosis\tPubTator3\n35728979\tDisease\tMESH:D003920\tDiabetes mellitus': 1, 'diabetes mellitus\tPubTator3\n4266979\tDisease\tMESH:D009083\tGMS': 1, 'mucopolysaccharidoses\tPubTator3': 1, 'MESH\n4266979\tDisease\tMESH:D008607\t\tMESH\n4266979\tDisease\tMESH:D009085\t\tMESH\n4266979\tDisease\tMESH:D003318\t\tMESH\n4266979\tDisease\tMESH:D012174\t\tMESH\n4266979\tDisease\tMESH:D002239\t\tMESH\n28671979\tDisease\tMESH:C537327\tshort-gastrulation\tPubTator3\n28671979\tDisease\tMESH:D003681\tdehydration\tPubTator3\n28671979\tDisease\tMESH:D008579\twing\tPubTator3\n28671979\tDisease\tMESH:D001768\tblisters\tPubTator3\n28671979\tDisease\tMESH:C536057\tlethality\tPubTator3\n16210979\tDisease\tMESH:D011507\tproteinuria\tPubTator3\n5437979\tDisease\tMESH:D007003\textrapancreatic tumor hypoglycemia\tPubTator3': 1, 'MESH\n5437979\tDisease\tMESH:D000310\t\tMESH\n5437979\tDisease\tMESH:D002277\t\tMESH\n26656979\tDisease\tMESH:D010003\tOA': 1, 'Osteoarthritis': 1, 'osteoarthritis\tPubTator3\n26656979\tDisease\tMESH:D007592\tjoint swelling\tPubTator3\n26656979\tDisease\tMESH:D046788\tKnee pain': 1, 'knee pain\tPubTator3\n26656979\tDisease\tMESH:D014947\ttrauma\tPubTator3\n26656979\tDisease\tMESH:D009521\tNOS\tPubTator3\n26656979\tDisease\tMESH:D005221\tfatigue\tPubTator3\n26656979\tDisease\tMESH:D018205\tadiposity\tPubTator3\n26656979\tDisease\tMESH:D020370\tKnee osteoarthritis': 1, 'Knee OA': 1, 'knee OA': 1, 'knee osteoarthritis\tPubTator3': 1, 'MESH\n26656979\tDisease\tMESH:D001168\tarthritis\tPubTator3\n26656979\tDisease\tMESH:D007718\tknee injury\tPubTator3\n26656979\tDisease\tMESH:D050177\toverweight': 1, 'Overweight\tPubTator3\n26656979\tDisease\tMESH:D019636\tdegenerative disease\tPubTator3\n26656979\tDisease\tMESH:C566112\tstiffness\tPubTator3\n26656979\tDisease\tMESH:D016916\tjoint deformities\tPubTator3\n26656979\tDisease\tMESH:D019310\tbone reactive hyperplasia\tPubTator3\n26656979\tDisease\tMESH:D000013\tjoint congenital abnormalities\tPubTator3\n26656979\tDisease\tMESH:D015208\tsmoking\tPubTator3\n26656979\tDisease\tMESH:D018771\tjoint pain\tPubTator3\n26656979\tDisease\tMESH:D009765\tObesity': 1, 'obese': 3, 'obesity\tPubTator3': 1, 'MESH\n26656979\tDisease\tMESH:D015431\tweight loss\tPubTator3\n26656979\tDisease\tMESH:D063806\ttenderness\tPubTator3\n28531979\tDisease\tMESH:D009369\tcancer\tPubTator3\n28531979\tDisease\tMESH:D064420\tcytotoxicity\tPubTator3\n28531979\tDisease\tMESH:D005334\thyperthermia\tPubTator3\n27650979\tDisease\tMESH:D007239\tinfections\tPubTator3\n36868979\tDisease\tMESH:D009807\todontogenic cyst\tPubTator3\n36868979\tDisease\tMESH:D006319\tneurosensory disturbances\tPubTator3\n36868979\tDisease\tMESH:D008310\tcrowding': 1, 'dental arch crowding': 1, 'malocclusion': 1, 'anterior dental crowding\tPubTator3\n36868979\tDisease\tMESH:D019465\tcraniofacial anomalies\tPubTator3\n36868979\tDisease\tMESH:D010510\tperiodontal lesion\tPubTator3\n36868979\tDisease\tMESH:D015473\tM3 angulation': 1, 'M3': 1, 'M3 eruption\tPubTator3\n36868979\tDisease\tMESH:D000848\ttooth agenesis': 1, 'PE\tPubTator3\n36868979\tDisease\tMESH:D003875\teruption\tPubTator3\n36868979\tDisease\tMESH:C580335\tNE\tPubTator3\n36868979\tDisease\tMESH:D003731\tcaries of\tPubTator3\n36868979\tDisease\tMESH:D000067073\tneurological and psychological\tPubTator3\n18705979\tDisease\tMESH:D020301\tCerebral vasospasm': 1, 'Cerebral Vasospasm\tPubTator3': 1, 'MESH\n33193979\tDisease\tMESH:D004194\tBechet disease\tPubTator3\n33193979\tDisease\tMESH:C536203\tneuro-mucocutaneous syndrome\tPubTator3\n33193979\tDisease\tMESH:D008556\tMelkersson-Rosenthal syndrome': 1, 'MRS\tPubTator3\n33193979\tDisease\tMESH:D005155\trecurrent facial nerve palsy\tPubTator3\n33193979\tDisease\tMESH:D014060\ttongue\tPubTator3\n33193979\tDisease\tMESH:D012507\tsarcoidosis\tPubTator3\n33193979\tDisease\tMESH:D018442\tbuccal mucosa involvement\tPubTator3\n33193979\tDisease\tMESH:D008180\tsystem lupus erythematosus\tPubTator3\n33193979\tDisease\tMESH:D015423\tscleritis\tPubTator3\n33193979\tDisease\tMESH:D018908\tfacial weakness': 1, 'weakness\tPubTator3\n33193979\tDisease\tMESH:D014063\tfissured tongue\tPubTator3\n33193979\tDisease\tMESH:D008047\tswollen lip': 1, 'swelling of the upper lip\tPubTator3\n33193979\tDisease\tMESH:D014826\trecurrent facia nerve palsy\tPubTator3\n33193979\tDisease\tMESH:D003424\tCrohn disease\tPubTator3\n33193979\tDisease\tMESH:D010523\tperipheral facial nerve palsy\tPubTator3\n11405979\tDisease\tMESH:D001249\tAsthma': 1, 'asthma\tPubTator3': 1, 'MESH\n11405979\tDisease\tMESH:D013224\tasthmatics': 1, 'asthmatic\tPubTator3\n16426979\tDisease\tMESH:D019636\tdegenerative spinal instability\tPubTator3\n29725979\tDisease\tMESH:D009765\tObesity\tPubTator3\n29725979\tDisease\tMESH:D011183\t\tMESH\n29725979\tDisease\tMESH:D009767\t\tMESH\n17808979\tDisease\tMESH:C000719205\tDOCTORATES CONFERRED IN THE SCIENCES\tPubTator3\n26786979\tDisease\tMESH:D003643\tdeaths': 1, 'Mortality': 1, 'newborn deaths': 1, 'death\tPubTator3\n26786979\tDisease\tMESH:D048949\tobstetric emergencies\tPubTator3\n26786979\tDisease\tMESH:D047928\tpreterm labour\tPubTator3\n26786979\tDisease\tMESH:D008232\tunder-5\tPubTator3\n26786979\tDisease\tMESH:D014376\ttuberculosis\tPubTator3\n26786979\tDisease\tMESH:D013746\tTetanus\tPubTator3\n26786979\tDisease\tMESH:D014390\tTB\tPubTator3\n26786979\tDisease\tMESH:D018805\tsepsis\tPubTator3\n26786979\tDisease\tMESH:D004461\t-eclampsia\tPubTator3\n26786979\tDisease\tMESH:D063130\tmaternal mortality': 1, 'Maternal Deaths': 1, 'maternal deaths\tPubTator3\n26786979\tDisease\tMESH:D005547\tLiST\tPubTator3\n26786979\tDisease\tMESH:D004194\tdisease\tPubTator3\n26786979\tDisease\tMESH:D003967\tdiarrhea\tPubTator3\n26786979\tDisease\tMESH:D013587\tSyphilis\tPubTator3\n26786979\tDisease\tMESH:D015658\tHIV and': 1, 'HIV/AIDS': 1, 'of HIV\tPubTator3\n26786979\tDisease\tMESH:D007246\tsterility\tPubTator3\n26786979\tDisease\tMESH:D006973\tHypertensive\tPubTator3\n26786979\tDisease\tMESH:D000026\tabortion\tPubTator3\n26786979\tDisease\tMESH:D011014\tpneumonia\tPubTator3\n26786979\tDisease\tMESH:D000079262\tmaternal': 1, 'maternal,': 1, 'maternal and\tPubTator3\n26786979\tDisease\tMESH:D006470\themorrhage\tPubTator3\n26786979\tDisease\tMESH:D066087\tmaternal and neonatal deaths': 1, 'neonatal deaths': 1, 'neonatal and under-5 deaths\tPubTator3\n26786979\tDisease\tMESH:D050497\tstillbirths': 1, 'stillbirth': 1, 'Stillbirths\tPubTator3': 1, 'MESH\n26786979\tDisease\tMESH:D014947\tchildhood injuries\tPubTator3\n175979\tDisease\tMESH:D006949\t\tMESH\n175979\tDisease\tMESH:D006937\t\tMESH\n5106979\tDisease\tMESH:D006259\thead injuries\tPubTator3': 1, 'MESH\n5106979\tDisease\tMESH:D014717\tvertigo\tPubTator3': 1, 'MESH\n5106979\tDisease\tMESH:D014911\t\tMESH\n5106979\tDisease\tMESH:D009759\t\tMESH\n17453979\tDisease\tMESH:D059350\tchronic back pain': 1, 'CBP\tPubTator3\n17453979\tDisease\tMESH:D020773\tloss and limitation in daily life\tPubTator3\n17453979\tDisease\tMESH:D019958\tsleep disruption\tPubTator3\n17453979\tDisease\tMESH:D001416\tback pain\tPubTator3': 1, 'MESH\n17453979\tDisease\tMESH:D010146\tpain\tPubTator3\n17453979\tDisease\tMESH:D019567\tBack-related functional limitations\tPubTator3\n17453979\tDisease\tMESH:D002908\t\tMESH\n17453979\tDisease\tMESH:D012893\t\tMESH\n6844979\tDisease\tMESH:D005547\tcolorectal foreign bodies\tPubTator3': 1, 'MESH\n6844979\tDisease\tMESH:D001005\tanal eroticism': 1, 'Anal eroticism\tPubTator3\n6844979\tDisease\tMESH:D010262\t\tMESH\n4482979\tDisease\tMESH:D011254\tExtra-uterine pregnancy\tPubTator3\n4482979\tDisease\tMESH:D011271\t\tMESH\n18581979\tDisease\tMESH:D000382\t\tMESH\n10114979\tDisease\tMESH:D014947\tinjuries\tPubTator3': 1, 'MESH\n10114979\tDisease\tMESH:D001720\t\tMESH\n10114979\tDisease\tMESH:D007049\t\tMESH\n23267979\tDisease\tMESH:D009362\tliver metastases\tPubTator3\n23267979\tDisease\tMESH:D044584\tinvasive ductal carcinoma\tPubTator3\n23267979\tDisease\tMESH:D017093\tliver dysfunction\tPubTator3\n23267979\tDisease\tMESH:D007565\tjaundice\tPubTator3': 1, 'MESH\n23267979\tDisease\tMESH:D008206\tlymphadenopathies\tPubTator3\n23267979\tDisease\tMESH:D015209\tprimary sclerosing cholangitis\tPubTator3\n23267979\tDisease\tMESH:D008105\tprimary biliary cirrhosis\tPubTator3\n23267979\tDisease\tMESH:D019693\tautoimmune hepatitis\tPubTator3\n23267979\tDisease\tMESH:D001943\tbreast cancer\tPubTator3': 1, 'MESH\n23267979\tDisease\tMESH:D000230\tadenocarcinoma in the lymph duct of the liver\tPubTator3\n23267979\tDisease\tMESH:D008113\t\tMESH\n11955979\tDisease\tMESH:D006948\thyperactivity\tPubTator3\n11955979\tDisease\tMESH:D010468\tdiscrimination\tPubTator3\n11955979\tDisease\tMESH:D020018\tdopaminergic hypoactivity\tPubTator3\n11955979\tDisease\tMESH:D012559\tSZ': 1, 'schizophrenia\tPubTator3': 1, 'MESH\n11955979\tDisease\tMESH:D014717\tCS\tPubTator3\n11955979\tDisease\tMESH:D002908\t\tMESH\n11955979\tDisease\tMESH:D003117\t\tMESH\n36995979\tDisease\tMESH:D004751\tNE': 1, 'necrotic enteritis\tPubTator3\n36995979\tDisease\tMESH:D003015\t\tMESH\n36995979\tDisease\tMESH:D011201\t\tMESH\n29922979\tDisease\tMESH:D012019\tCRPS\tPubTator3\n29922979\tDisease\tMESH:D007239\tinfection\tPubTator3\n29922979\tDisease\tMESH:D017759\tmalunion\tPubTator3\n29922979\tDisease\tMESH:D050723\tfracture\tPubTator3\n29922979\tDisease\tMESH:D057072\tintra-articular fractures\tPubTator3\n29922979\tDisease\tMESH:D000092503\tdistal radius fracture': 1, 'distal radius fractures\tPubTator3\n29922979\tDisease\tMESH:D011183\t\tMESH\n29922979\tDisease\tMESH:D011885\t\tMESH\n29745979\tDisease\tMESH:D012770\tcardiogenic shock\tPubTator3': 1, 'MESH\n29745979\tDisease\tMESH:D054058\tacute coronary syndromes\tPubTator3\n29745979\tDisease\tMESH:D016491\tperipheral vascular disease\tPubTator3\n29745979\tDisease\tMESH:D006333\theart failure\tPubTator3\n29745979\tDisease\tMESH:D029424\tchronic obstructive pulmonary disease\tPubTator3\n29745979\tDisease\tMESH:D002318\t\tMESH\n19972979\tDisease\tMESH:D005350\tFibroma\tPubTator3\n20283979\tDisease\tMESH:D014397\tpulmonary tuberculosis\tPubTator3': 1, 'MESH\n20283979\tDisease\tMESH:D014376\t\tMESH\n21273979\tDisease\tMESH:D010051\tovarian cancer\tPubTator3': 1, 'MESH\n8438979\tDisease\tMESH:D015431\tWeight': 1, 'weight\tPubTator3': 1, 'MESH\n8438979\tDisease\tMESH:D009765\tobesity\tPubTator3\n8438979\tDisease\tMESH:D015208\tsmoking\tPubTator3\n7792979\tDisease\tMESH:D000860\tHypoxemia\tPubTator3': 1, 'MESH\n7792979\tDisease\tMESH:D009203\tacute myocardial infarction\tPubTator3': 1, 'MESH\n7792979\tDisease\tMESH:D001145\tarrhythmia\tPubTator3': 1, 'MESH\n30609979\tDisease\tMESH:D017116\tLow Back Pain\tPubTator3\n7886979\tDisease\tMESH:D006030\tRenal': 1, 'renal\tPubTator3\n7886979\tDisease\tMESH:D005355\tcirrhosis': 1, 'Cirrhosis\tPubTator3\n7886979\tDisease\tMESH:D008106\t\tMESH\n4672979\tDisease\tMESH:D050723\t\tMESH\n4672979\tDisease\tMESH:D013924\t\tMESH\n4672979\tDisease\tMESH:D006973\t\tMESH\n29942979\tDisease\tMESH:D000067877\tautism spectrum disorder': 1, 'ASD\tPubTator3\n29942979\tDisease\tMESH:D001289\tattention disorder\tPubTator3\n29942979\tDisease\tMESH:D001321\tautistic': 1, 'autism\tPubTator3\n29942979\tDisease\tMESH:D002658\tTD': 1, 'of developing\tPubTator3\n29942979\tDisease\tMESH:D019965\tNeurocognitive dysfunction\tPubTator3\n29942979\tDisease\tMESH:D006331\texecutive dysfunction\tPubTator3\n29942979\tDisease\tMESH:C563663\tdifficulties in social interaction\tPubTator3\n29942979\tDisease\tMESH:D002659\tpervasive developmental disorder\tPubTator3\n29942979\tDisease\tMESH:D003072\timpaired executive functions\tPubTator3\n29942979\tDisease\tMESH:D002313\trestricted and repetitive behaviors\tPubTator3\n29942979\tDisease\tMESH:D003147\tcommunication\tPubTator3\n29942979\tDisease\tMESH:D020817\tAS': 1, 'Asperger syndrome\tPubTator3': 1, 'MESH\n29942979\tDisease\tMESH:C537761\tintellectual deficits\tPubTator3\n35326979\tDisease\tMESH:D003643\tdeath\tPubTator3\n35326979\tDisease\tMESH:D000081015\tdrug\tPubTator3\n35326979\tDisease\tMESH:D006973\thypertension\tPubTator3\n37345979\tDisease\tMESH:D015464\tchronic myeloid leukemia': 1, 'CML\tPubTator3': 1, 'MESH\n37345979\tDisease\tMESH:D064420\tcytotoxic\tPubTator3\n37345979\tDisease\tMESH:D009369\ttumors\tPubTator3\n35658979\tDisease\tMESH:D003704\tdementia\tPubTator3\n35658979\tDisease\tMESH:D053201\toveractive bladder syndrome\tPubTator3\n35658979\tDisease\tMESH:D009369\tcancer\tPubTator3\n35658979\tDisease\tMESH:D010146\tpainful': 1, 'pain\tPubTator3\n35658979\tDisease\tMESH:D000168\tdermatological conditions': 1, 'dermatological disease\tPubTator3\n35658979\tDisease\tMESH:D011537\titching\tPubTator3\n35658979\tDisease\tMESH:D011565\tpsoriasis\tPubTator3\n35658979\tDisease\tMESH:D001249\tasthma\tPubTator3\n35658979\tDisease\tMESH:D012871\tskin condition': 1, 'skin irritation': 1, 'skin conditions': 1, 'skin disease': 1, 'skin diseases\tPubTator3\n35658979\tDisease\tOMIM:603663\thealth\tPubTator3\n20146979\tDisease\tMESH:D010538\tPeritonitis': 1, 'peritonitis\tPubTator3': 1, 'MESH\n20146979\tDisease\tMESH:D007676\tchronic kidney failure\tPubTator3\n20146979\tDisease\tMESH:D006973\thypertension\tPubTator3\n20146979\tDisease\tMESH:D000014\tabnormalities\tPubTator3\n20146979\tDisease\tMESH:D013203\t\tMESH\n11769979\tDisease\tMESH:D001523\tpsychiatric disability\tPubTator3': 1, 'MESH\n27000979\tDisease\tMESH:C562568\tcerebellar hypoplasia\tPubTator3\n27000979\tDisease\tMESH:D009134\tspinal muscular atrophy\tPubTator3\n33239979\tDisease\tMESH:D001167\tarterial wall inflammation\tPubTator3\n33239979\tDisease\tMESH:C563618\tLp(a) hyperlipoproteinaemia\tPubTator3\n33239979\tDisease\tMESH:D058729\tperipheral artery disease\tPubTator3\n33239979\tDisease\tMESH:D007249\tinflammatory': 1, 'inflammation\tPubTator3\n33239979\tDisease\tMESH:D054058\tacute coronary syndrome\tPubTator3\n33239979\tDisease\tMESH:D003327\tCHD death': 1, 'coronary heart disease': 1, 'CHD\tPubTator3\n33239979\tDisease\tMESH:D006331\tcardiac\tPubTator3\n33239979\tDisease\tMESH:D006938\tLDL Disorders\tPubTator3\n33239979\tDisease\tMESH:D009203\tMI': 1, 'myocardial infarction\tPubTator3\n33239979\tDisease\tMESH:D002318\tcardiovascular disease': 1, 'CV death': 1, 'MACE': 1, 'CVD\tPubTator3\n33239979\tDisease\tMESH:D050197\tatherosclerosis': 1, 'atherosclerotic CVD': 1, 'atherosclerotic cardiovascular diseases': 1, 'ASCVD\tPubTator3\n33239979\tDisease\tMESH:D024821\tmetabolic syndrome\tPubTator3\n33239979\tDisease\tMESH:C535776\tHeFH\tPubTator3\n33239979\tDisease\tMESH:D000073376\tFH': 1, 'familial hypercholesterolaemia\tPubTator3\n33239979\tDisease\tMESH:D056988\twall\tPubTator3\n33239979\tDisease\tMESH:D002544\tischaemic stroke\tPubTator3\n33239979\tDisease\tMESH:D003920\tdiabetes mellitus\tPubTator3\n26336979\tDisease\tMESH:D007674\trenal disease\tPubTator3\n26336979\tDisease\tMESH:D007676\t\tMESH\n30314979\tDisease\tMESH:D019867\tAnti-GBM Disease\tPubTator3': 1, 'MESH\n30314979\tDisease\tMESH:D013577\t\tMESH\n30314979\tDisease\tMESH:D005921\t\tMESH\n14856979\tDisease\tMESH:D014376\ttuberculosis\tPubTator3': 1, 'MESH\n36923979\tDisease\tMESH:D009214\tuterine myoma\tPubTator3\n36923979\tDisease\tMESH:D003074\tlung nodules\tPubTator3\n36923979\tDisease\tMESH:D000092182\tmetastatic disease\tPubTator3\n36923979\tDisease\tMESH:D013964\tThyroid Cancer': 1, 'thyroid cancer\tPubTator3\n36923979\tDisease\tMESH:D013724\tteratoma\tPubTator3\n36923979\tDisease\tMESH:D008579\tmeningioma\tPubTator3\n36923979\tDisease\tMESH:D006391\thepatic hemangioma\tPubTator3\n36923979\tDisease\tMESH:D000077273\tpapillary thyroid carcinoma\tPubTator3\n36923979\tDisease\tMESH:D001847\tbone disease\tPubTator3\n36923979\tDisease\tMESH:D010307\tparotid tumors\tPubTator3\n36923979\tDisease\tMESH:D064386\tankle lesion\tPubTator3\n36923979\tDisease\tMESH:D010051\tovarian tumors\tPubTator3\n36923979\tDisease\tMESH:D014077\terosions\tPubTator3\n36923979\tDisease\tMESH:D001943\tbreast cancers\tPubTator3\n36923979\tDisease\tMESH:D000072717\tlymph node\tPubTator3\n36923979\tDisease\tMESH:D009369\tthyroid malignancy': 1, 'benign tumor': 1, 'malignancy': 1, 'benign tumors': 1, 'BGCTS tumor\tPubTator3\n36923979\tDisease\tMESH:D004487\tswelling\tPubTator3\n36923979\tDisease\tMESH:D018261\tcystic mesothelioma\tPubTator3\n36923979\tDisease\tMESH:D018249\toncocytoma\tPubTator3\n36923979\tDisease\tMESH:D050031\tstruma cordis\tPubTator3\n36923979\tDisease\tMESH:D008171\tlung and foot lesions': 1, 'pulmonary': 1, "lung metastatic lung lesions\tPubTator3\n36923979\tDisease\tMESH:D000235\tWarthin's tumor\tPubTator3\n36923979\tDisease\tMESH:D013330\tstruma ovarii\tPubTator3\n36923979\tDisease\tMESH:D009059\tlesions": 1, 'lesion\tPubTator3\n36923979\tDisease\tMESH:D001859\tbenign bone neoplasms': 1, 'benign bone tumors\tPubTator3\n36923979\tDisease\tMESH:D061325\tbreast fibroadenoma\tPubTator3\n36923979\tDisease\tMESH:D009362\tmetastasis': 1, 'melanoma metastases': 1, 'lung metastasis': 1, 'metastases\tPubTator3\n36923979\tDisease\tMESH:D000070779\tbenign tenosynovial giant cell tumor': 1, 'BTSGCT': 1, 'Tenosynovial Giant Cell Tumor of\tPubTator3\n36923979\tDisease\tMESH:D006392\tcavernous angioma\tPubTator3\n36923979\tDisease\tMESH:D009383\ttissue lesion\tPubTator3\n36923979\tDisease\tMESH:D009140\tbenign musculoskeletal tumors\tPubTator3\n32329979\tDisease\tMESH:D011024\t\tMESH\n32329979\tDisease\tMESH:D018352\t\tMESH\n13353979\tDisease\tMESH:D007415\tAcute intestinal obstructions\tPubTator3': 1, 'MESH\n13353979\tDisease\tMESH:D000208\t\tMESH\n33921979\tDisease\tMESH:D003866\tdepression\tPubTator3\n33921979\tDisease\tMESH:D006973\televated blood pressure\tPubTator3\n33921979\tDisease\tMESH:D015430\tweight gain\tPubTator3\n33921979\tDisease\tMESH:D050197\tatherosclerotic cardiovascular disease\tPubTator3\n33921979\tDisease\tMESH:D044342\tnutritional deficiencies\tPubTator3\n33921979\tDisease\tMESH:D024821\tmetabolic syndrome\tPubTator3\n33921979\tDisease\tMESH:D018149\tglucose intolerance': 1, 'impaired glucose tolerance\tPubTator3\n33921979\tDisease\tMESH:D002318\tcardiovascular diseases': 1, 'CVD': 1, 'cardiovascular and diabetes': 1, 'cardiovascular disorders': 1, 'cardiovascular disease\tPubTator3\n33921979\tDisease\tMESH:D012640\tseizures\tPubTator3\n33921979\tDisease\tMESH:D007003\thypoglycemia\tPubTator3\n33921979\tDisease\tMESH:D011236\tPrediabetic\tPubTator3\n33921979\tDisease\tMESH:D003920\tdiabetes mellitus': 1, 'Diabetes Mellitus': 1, 'diabetes\tPubTator3\n33921979\tDisease\tMESH:D007333\tinsulin resistance\tPubTator3\n33921979\tDisease\tMESH:D020179\tjet lag\tPubTator3\n33921979\tDisease\tMESH:D004620\tloss of fat': 1, 'fat': 1, 'fat accumulation\tPubTator3\n33921979\tDisease\tMESH:D002544\tischemic stroke\tPubTator3\n33921979\tDisease\tMESH:D008659\tMetabolic Diseases': 1, 'metabolic diseases': 1, 'metabolic disorders': 1, 'metabolic impairments\tPubTator3': 1, 'MESH\n33921979\tDisease\tMESH:D001068\tappetite reduction\tPubTator3\n33921979\tDisease\tMESH:D005764\tgastroesophageal reflux disease\tPubTator3\n33921979\tDisease\tMESH:D019636\tneurodegeneration\tPubTator3\n33921979\tDisease\tMESH:C000719197\tclock disorders\tPubTator3\n33921979\tDisease\tMESH:D009369\tcancer\tPubTator3\n33921979\tDisease\tMESH:D050177\toverweight\tPubTator3\n33921979\tDisease\tMESH:D020521\tstrokes\tPubTator3\n33921979\tDisease\tMESH:D004827\tepilepsy\tPubTator3\n33921979\tDisease\tMESH:D020739\tmetabolic complications\tPubTator3\n33921979\tDisease\tMESH:D013927\tthrombosis\tPubTator3\n33921979\tDisease\tMESH:D006943\thyperglycemia\tPubTator3\n33921979\tDisease\tMESH:D003327\tcoronary heart diseases\tPubTator3\n33921979\tDisease\tMESH:D006331\tcardiac dysfunction\tPubTator3\n33921979\tDisease\tMESH:D044882\tglucose metabolism dysfunction\tPubTator3\n33921979\tDisease\tMESH:D009203\theart attacks': 1, 'myocardial infarction\tPubTator3\n33921979\tDisease\tMESH:D010024\tosteoporosis\tPubTator3\n33921979\tDisease\tMESH:D003924\ttype 2 diabetes\tPubTator3\n33921979\tDisease\tMESH:D015431\tweight loss': 1, 'bodyweight\tPubTator3\n33921979\tDisease\tMESH:D009765\tObesity': 1, 'Obese': 2, 'obesity\tPubTator3\n33921979\tDisease\tMESH:D009202\tcardiomyopathy\tPubTator3\n7014979\tDisease\tMESH:D006973\thypertension': 1, 'hypertensive\tPubTator3': 1, 'MESH\n35851979\tDisease\tMESH:D006333\theart failure\tPubTator3': 1, 'MESH\n16087979\tDisease\tMESH:D007333\tinsulin resistance\tPubTator3': 1, 'MESH\n16087979\tDisease\tMESH:D018205\tadiposity\tPubTator3\n16087979\tDisease\tMESH:D006946\thyperinsulinemia\tPubTator3\n16087979\tDisease\tMESH:D044903\thyperinsulinemic\tPubTator3\n16087979\tDisease\tMESH:D009765\tobesity': 1, 'Obesity\tPubTator3': 1, 'MESH\n4777979\tDisease\tMESH:D012140\trespiratory diseases\tPubTator3': 1, 'MESH\n4777979\tDisease\tMESH:D009784\t\tMESH\n4777979\tDisease\tMESH:D002908\t\tMESH\n19426979\tDisease\tMESH:D003324\tcoronary artery disease\tPubTator3': 1, 'MESH\n19426979\tDisease\tMESH:D060050\tstable angina\tPubTator3\n19426979\tDisease\tMESH:D006973\thypertension\tPubTator3\n19426979\tDisease\tMESH:D001791\tplatelet aggregation\tPubTator3\n19426979\tDisease\tMESH:D003251\tstenosis\tPubTator3\n19426979\tDisease\tMESH:D003920\tdiabetes\tPubTator3\n32697979\tDisease\tMESH:D007249\tinflammation': 1, "inflammatory\tPubTator3\n32697979\tDisease\tMESH:D020295\tLESSONS STEMMING FROM OLD\tPubTator3\n32697979\tDisease\tMESH:D012859\tSjogren's syndrome\tPubTator3\n32697979\tDisease\tMESH:D057108\tcorneal aberrations\tPubTator3\n32697979\tDisease\tMESH:D000092423\tLESC": 1, 'LSCD': 1, 'limbal injury': 1, 'LESC deficiency\tPubTator3\n32697979\tDisease\tMESH:D009375\tepithelial stem cell deficiencies\tPubTator3\n32697979\tDisease\tMESH:D002056\tburns\tPubTator3\n32697979\tDisease\tMESH:C538115\tocular anterior abnormalities\tPubTator3\n32697979\tDisease\tMESH:D010534\tocular surface diseases\tPubTator3\n32697979\tDisease\tMESH:D001766\tblindness\tPubTator3\n32697979\tDisease\tMESH:C536439\tendothelial dystrophy\tPubTator3\n32697979\tDisease\tMESH:D010146\tpain\tPubTator3\n32697979\tDisease\tMESH:D065306\tcorneal trauma\tPubTator3\n32697979\tDisease\tOMIM:115650\tanterior polar cataract\tPubTator3\n32697979\tDisease\tMESH:C536444\tCORNEAL EPITHELIAL': 1, 'corneal epithelial defect': 1, 'corneal epithelial defects\tPubTator3\n32697979\tDisease\tMESH:D002386\tcongenital cataract\tPubTator3\n32697979\tDisease\tMESH:D007499\tiris hypoplasia\tPubTator3\n32697979\tDisease\tMESH:D003920\tdiabetes\tPubTator3\n32697979\tDisease\tOMIM:614303\tEDICT syndrome\tPubTator3\n32697979\tDisease\tMESH:D020795\tphotophobia\tPubTator3\n32697979\tDisease\tMESH:D014786\tvisual loss': 1, 'decreased vision\tPubTator3\n32697979\tDisease\tMESH:D007640\tkeratoconus\tPubTator3\n32697979\tDisease\tMESH:D011625\tpterygium\tPubTator3\n32697979\tDisease\tMESH:D003316\tcorneal blindness\tPubTator3': 1, 'MESH\n17941979\tDisease\tMESH:D010272\tparasites\tPubTator3\n17941979\tDisease\tMESH:D008288\tmalaria\tPubTator3\n17941979\tDisease\tMESH:D009369\tcancer': 1, 'tumors\tPubTator3\n35669979\tDisease\tMESH:D003643\tdeaths': 1, 'death\tPubTator3\n35669979\tDisease\tMESH:D063130\tmaternal death\tPubTator3\n35669979\tDisease\tMESH:D000026\tabortions\tPubTator3\n35669979\tDisease\tMESH:D003866\tdepression\tPubTator3\n35669979\tDisease\tMESH:D000079262\tmaternal\tPubTator3\n35669979\tDisease\tMESH:D000022\tmiscarriage\tPubTator3\n35669979\tDisease\tOMIM:603663\tmental health diseases\tPubTator3\n35669979\tDisease\tMESH:D011254\tunwanted pregnancy': 1, 'unwanted pregnancies': 1, 'Unintended pregnancy': 1, 'Unintended Pregnancy': 1, 'unintended pregnancies': 1, 'Unintended pregnancies': 1, 'unplanned pregnancies': 1, 'unintended pregnancy': 1, 'and pregnancy\tPubTator3\n35669979\tDisease\tMESH:D050497\tstillbirth\tPubTator3\n35669979\tDisease\tMESH:D012030\tII error\tPubTator3\n36004979\tDisease\tMESH:D018352\tMiddle East respiratory syndrome': 1, 'coronavirus': 1, 'MERS-CoV\tPubTator3\n36004979\tDisease\tMESH:D007239\tinfected\tPubTator3\n36004979\tDisease\tMESH:D001943\tbenign breast tumor': 1, 'breast cancer\tPubTator3\n36004979\tDisease\tMESH:D000079426\tmosquito vector-borne disease\tPubTator3\n36004979\tDisease\tMESH:D009369\tbenign tumors': 1, 'cancer\tPubTator3\n36004979\tDisease\tMESH:D008288\tmalaria\tPubTator3\n36004979\tDisease\tMESH:D013964\tthyroid cancer\tPubTator3\n36004979\tDisease\tMESH:D003139\tcommon cold\tPubTator3\n36004979\tDisease\tMESH:D012818\trespiratory problems\tPubTator3\n36004979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n36004979\tDisease\tMESH:D014777\tviral infections\tPubTator3\n36004979\tDisease\tMESH:D003930\tdiabetic retinopathy\tPubTator3\n36004979\tDisease\tMESH:D003141\tinfectious disease': 1, 'Infectious disease': 1, 'infectious diseases\tPubTator3\n36004979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n36004979\tDisease\tMESH:D002318\tcardiovascular diseases\tPubTator3\n36004979\tDisease\tMESH:D016574\tseasonal allergies\tPubTator3\n36004979\tDisease\tMESH:D003920\tdiabetes\tPubTator3\n36004979\tDisease\tMESH:D007333\tinsulin-resistance-associated diseases\tPubTator3\n36004979\tDisease\tMESH:D005334\tfever\tPubTator3\n36004979\tDisease\tMESH:D014947\toral injuries\tPubTator3\n36004979\tDisease\tMESH:D000086382\tCOVID-19': 1, 'SARS-CoV-2\tPubTator3\n36004979\tDisease\tMESH:D003428\tPoC\tPubTator3\n2888979\tDisease\tMESH:D009369\toesophageal cancer\tPubTator3\n2888979\tDisease\tMESH:D004938\t\tMESH\n14193979\tDisease\tMESH:C537150\tLEUCINE-SENSITIVE\tPubTator3\n14193979\tDisease\tMESH:D007003\t\tMESH\n14193979\tDisease\tMESH:D010182\t\tMESH\n24079979\tDisease\tMESH:D015004\tYEL-AVD': 1, 'YF': 1, 'yellow fever vaccine-associated viscerotropic disease': 1, 'yellow fever': 1, 'Yellow fever vaccine-associated viscerotropic disease\tPubTator3\n24079979\tDisease\tMESH:D064420\t\tMESH\n16093979\tDisease\tMESH:D011471\tprostate cancer': 1, 'Prostate Cancer\tPubTator3': 1, 'MESH\n16093979\tDisease\tMESH:D009369\tcancer\tPubTator3\n31885979\tDisease\tMESH:D003884\tdermoid': 1, 'temporal limbal dermoid': 1, 'limbal dermoid\tPubTator3\n31885979\tDisease\tMESH:D013262\tSteven Johnson Syndrome': 1, 'SJS\tPubTator3\n31885979\tDisease\tMESH:C537775\tAnterior Segment Diseases': 1, 'anterior segment disorders\tPubTator3\n31885979\tDisease\tMESH:D005134\tleft eye redness': 1, 'eye redness': 1, 'trauma to right eye': 1, 'eye\tPubTator3\n31885979\tDisease\tMESH:D009336\tnecrosis': 1, 'necrotic\tPubTator3\n31885979\tDisease\tMESH:D007249\tocular inflammatory': 1, 'inflammatory\tPubTator3\n31885979\tDisease\tMESH:D007676\tend stage renal failure': 1, 'ESRF\tPubTator3\n31885979\tDisease\tMESH:D005902\topen angle glaucoma\tPubTator3\n31885979\tDisease\tMESH:D003969\twatery eye\tPubTator3\n31885979\tDisease\tMESH:D001327\tautoimmune disease': 1, 'autoimmune related diseases': 1, "autoimmune or related diseases\tPubTator3\n31885979\tDisease\tMESH:D014456\tMooren's ulcer\tPubTator3\n31885979\tDisease\tMESH:D009375\tcornea epithelial defect": 1, 'epithelial defect\tPubTator3\n31885979\tDisease\tMESH:C562718\tredness\tPubTator3\n31885979\tDisease\tMESH:D010146\tpain\tPubTator3\n31885979\tDisease\tMESH:D001251\tastigmatism\tPubTator3\n31885979\tDisease\tMESH:D065306\tcornea perforation': 1, 'cornea defect': 1, 'cornea': 1, 'Cornea': 1, 'Cornea perforation\tPubTator3\n31885979\tDisease\tMESH:D019591\tpseudophakia\tPubTator3\n31885979\tDisease\tMESH:D010534\tocular surface disorder\tPubTator3\n31885979\tDisease\tMESH:D014947\tocular trauma\tPubTator3\n31885979\tDisease\tMESH:D003922\tdiabetes mellitus (DM) type I\tPubTator3\n31885979\tDisease\tMESH:C564818\tkeratolysis\tPubTator3\n31885979\tDisease\tMESH:D013529\twound dehiscence\tPubTator3\n31885979\tDisease\tMESH:D003920\tDM\tPubTator3\n31885979\tDisease\tMESH:D000550\tamblyopia\tPubTator3\n31885979\tDisease\tMESH:D057112\tperforation': 1, 'corneal perforation\tPubTator3\n31885979\tDisease\tMESH:D014786\tblurring of vision': 1, 'vision loss\tPubTator3\n31885979\tDisease\tMESH:D020795\tphotophobia\tPubTator3\n31885979\tDisease\tMESH:D005901\tglaucoma drainage': 1, 'glaucoma': 1, 'GDD\tPubTator3\n31885979\tDisease\tMESH:D003141\tinfectious keratitis': 1, 'infectious\tPubTator3\n31885979\tDisease\tMESH:D003320\tcorneal ulceration\tPubTator3\n31885979\tDisease\tMESH:D009877\tendophthalmitis\tPubTator3\n31885979\tDisease\tMESH:D003316\tcorneal': 1, 'corneal diseases\tPubTator3\n31885979\tDisease\tMESH:D013851\tcornea thinning': 1, 'thinning\tPubTator3\n31885979\tDisease\tMESH:D006973\thypertension\tPubTator3\n31885979\tDisease\tMESH:D001172\trheumatoid arthritis\tPubTator3\n31885979\tDisease\tMESH:D011625\tpterygium\tPubTator3\n29915979\tDisease\tMESH:D009140\tmusculoskeletal\tPubTator3\n29915979\tDisease\tOMIM:603663\tMental health\tPubTator3\n29915979\tDisease\tMESH:D009369\tcancer\tPubTator3\n8868979\tDisease\tMESH:D006333\theart failure': 1, 'congestive heart failure': 1, 'Heart failure\tPubTator3': 1, 'MESH\n8868979\tDisease\tMESH:D006331\tischaemic heart disease\tPubTator3\n8868979\tDisease\tMESH:D002908\t\tMESH\n13583979\tDisease\tMESH:D009422\thandicapped\tPubTator3\n35835979\tDisease\tMESH:D016757\tsudden cardiac death\tPubTator3\n35835979\tDisease\tMESH:D014693\tventricular fibrillation': 1, 'VF': 1, 'fibrillation\tPubTator3': 1, 'MESH\n35835979\tDisease\tMESH:D013313\tpost-traumatic stress\tPubTator3\n35835979\tDisease\tMESH:D017695\ttissue damage\tPubTator3\n35835979\tDisease\tMESH:D001145\tarrhythmia': 1, 'cardiac arrhythmia\tPubTator3': 1, 'MESH\n35835979\tDisease\tMESH:D000210\tNPS\tPubTator3\n35835979\tDisease\tMESH:D013610\t\tMESH\n3341979\tDisease\tMESH:D007863\tlecithin cholesterol acyltransferase deficiency\tPubTator3': 1, 'MESH\n3341979\tDisease\tMESH:D003316\tcorneal changes': 1, 'corneal haze\tPubTator3\n3341979\tDisease\tMESH:D007009\t\tMESH\n3341979\tDisease\tMESH:D003318\t\tMESH\n8988979\tDisease\tMESH:D019966\tSubstance abuse\tPubTator3\n8988979\tDisease\tMESH:D001289\tADHD\tPubTator3': 1, 'MESH\n8988979\tDisease\tMESH:D014029\t\tMESH\n90979\tDisease\tMESH:D001249\tasthma\tPubTator3': 1, 'MESH\n31835979\tDisease\tMESH:D009360\tFontan Circulation\tPubTator3\n31835979\tDisease\tMESH:D011504\tProtein Losing Enteropathy': 1, 'protein-losing enteropathy': 1, 'PLE\tPubTator3': 1, 'MESH\n31835979\tDisease\tMESH:D006330\t\tMESH\n31835979\tDisease\tMESH:D011183\t\tMESH\n7661979\tDisease\tMESH:D003327\t\tMESH\n7661979\tDisease\tMESH:D006949\t\tMESH\n7661979\tDisease\tMESH:D009203\t\tMESH\n3578979\tDisease\tMESH:D003643\tdied\tPubTator3\n3578979\tDisease\tMESH:D064420\ttoxicities\tPubTator3\n3578979\tDisease\tMESH:D012769\tshock\tPubTator3\n3578979\tDisease\tMESH:D020261\t\tMESH\n3578979\tDisease\tMESH:D058186\t\tMESH\n11167979\tDisease\tMESH:D011230\tcarcinogenic\tPubTator3\n11167979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n11167979\tDisease\tMESH:D009369\t\tMESH\n11167979\tDisease\tMESH:D012878\t\tMESH\n27305979\tDisease\tMESH:D008607\tintellectual disability': 1, 'autosomal-recessive intellectual disability\tPubTator3': 1, 'MESH\n27305979\tDisease\tMESH:C564766\tTDH': 1, 'thyroid dyshormonogenesis\tPubTator3\n27305979\tDisease\tMESH:D003409\t\tMESH\n27605979\tDisease\tMESH:D004415\tulcer dyspepsia\tPubTator3': 1, 'MESH\n27605979\tDisease\tMESH:D010437\tPeptic ulcer disease': 1, 'peptic ulcer disease': 1, 'gastroduodenal disease\tPubTator3\n27605979\tDisease\tMESH:D004378\tgastro-duodenal disease\tPubTator3\n27605979\tDisease\tMESH:D016481\tHelicobacter pylori infection\tPubTator3': 1, 'MESH\n27605979\tDisease\tMESH:D004382\tgastro-duodenal injury\tPubTator3\n27605979\tDisease\tMESH:D013276\tgastric ulcer': 1, 'duodenal and gastric ulcer\tPubTator3': 1, 'MESH\n27605979\tDisease\tMESH:D004381\tduodenal ulcer\tPubTator3': 1, 'MESH\n27605979\tDisease\tMESH:D009369\tcancer\tPubTator3\n27605979\tDisease\tMESH:D007410\t-intestinal symptoms\tPubTator3\n32540979\tDisease\tMESH:D064420\ttoxicity\tPubTator3\n32540979\tDisease\tMESH:D014123\tChronic Toxoplasmosis': 1, 'chronic toxoplasmosis': 1, 'toxoplasmosis\tPubTator3': 1, 'MESH\n32540979\tDisease\tMESH:D007239\tinfection\tPubTator3\n32540979\tDisease\tMESH:D003560\tbrain cyst': 1, 'cyst': 1, 'brain tissue cysts\tPubTator3\n32540979\tDisease\tMESH:D014124\t\tMESH\n109979\tDisease\tMESH:D014390\ttuberculous\tPubTator3\n109979\tDisease\tMESH:D014396\t\tMESH\n19040979\tDisease\tMESH:D006258\thead and neck\tPubTator3\n19040979\tDisease\tMESH:D013959\t\tMESH\n19040979\tDisease\tMESH:D013964\t\tMESH\n22844979\tDisease\tMESH:D059352\tMusculoskeletal pain\tPubTator3\n22844979\tDisease\tMESH:D006930\tmechanical hyperalgesia\tPubTator3': 1, 'MESH\n22844979\tDisease\tMESH:D010146\tpain\tPubTator3\n22844979\tDisease\tMESH:D063806\tmuscle pain': 1, 'muscle soreness\tPubTator3\n33332979\tDisease\tMESH:D012253\trib fractures': 1, 'rib fracture\tPubTator3': 1, 'MESH\n33332979\tDisease\tMESH:D013898\tchest trauma\tPubTator3\n33332979\tDisease\tMESH:D050723\tfractures\tPubTator3\n33670979\tDisease\tMESH:D007249\tinflammatory\tPubTator3\n33670979\tDisease\tMESH:D003324\tcoronary artery diseases\tPubTator3\n33670979\tDisease\tMESH:D009369\tcancer\tPubTator3\n13274979\tDisease\tMESH:D007249\tchronic inflammations\tPubTator3': 1, 'MESH\n13274979\tDisease\tMESH:D013716\tepicondylitis\tPubTator3\n13274979\tDisease\tMESH:D004194\t\tMESH\n14942979\tDisease\tMESH:D000755\tsickle cell anemia\tPubTator3': 1, 'MESH\n14942979\tDisease\tMESH:D010921\tplacenta accreta\tPubTator3': 1, 'MESH\n14942979\tDisease\tMESH:D000740\t\tMESH\n34372979\tDisease\tMESH:D009369\tSolid Tumor': 1, 'cancer\tPubTator3\n34372979\tDisease\tMESH:D014523\turothelial carcinoma': 1, 'Urothelial Carcinoma\tPubTator3\n34372979\tDisease\tMESH:D001749\t\tMESH\n34372979\tDisease\tMESH:D002295\t\tMESH\n14050979\tDisease\tOMIM:300082\tSOCIAL\tPubTator3\n34503979\tDisease\tMESH:D014813\t-K\tPubTator3\n34503979\tDisease\tMESH:D001260\tTu\tPubTator3\n34503979\tDisease\tMESH:C536170\tDD\tPubTator3\n34503979\tDisease\tMESH:C565217\tTEs\tPubTator3\n34503979\tDisease\tMESH:C536747\tdrought\tPubTator3\n22352979\tDisease\tMESH:D004342\tallergy\tPubTator3\n37147979\tDisease\tMESH:D009369\tmalignancies': 1, 'cancer\tPubTator3': 1, 'MESH\n37199979\tDisease\tMESH:D009069\tdisability': 1, "disabilities\tPubTator3\n23302979\tDisease\tMESH:D000079262\tmaternal\tPubTator3\n23302979\tDisease\tMESH:D008382\tMarfan's syndrome\tPubTator3": 1, 'MESH\n23302979\tDisease\tMESH:D000784\ttype 1 aortic dissection': 1, 'aortic dissection\tPubTator3\n23302979\tDisease\tMESH:D003643\tdeaths\tPubTator3\n23302979\tDisease\tMESH:D005313\tintrauterine fetal death\tPubTator3\n23302979\tDisease\tMESH:D011248\t\tMESH\n35168979\tDisease\tMESH:D011014\tpneumonia\tPubTator3\n35168979\tDisease\tMESH:D009102\tmultiorgan dysfunction': 1, 'organ dysfunction\tPubTator3\n35168979\tDisease\tMESH:D009103\tETHICS AND DISSEMINATION\tPubTator3\n35168979\tDisease\tMESH:D001261\tatelectasis\tPubTator3\n35168979\tDisease\tMESH:D011183\tPPCs': 1, 'postoperative pulmonary complications\tPubTator3\n35168979\tDisease\tMESH:D011030\tpneumothorax\tPubTator3\n35168979\tDisease\tMESH:D001523\tmental disorders\tPubTator3\n35168979\tDisease\tMESH:D012128\tacute respiratory distress syndrome\tPubTator3\n35168979\tDisease\tMESH:D000437\talcohol dependency\tPubTator3\n35168979\tDisease\tMESH:D007239\tinfection\tPubTator3\n35168979\tDisease\tMESH:D009369\tcancer': 1, 'malignant tumours': 1, 'lung neoplasia[Title': 1, 'haemangioma of the tibia': 1, 'Tibia Deformity and': 1, 'tibia non-': 1, 'external tibia': 1, 'of the tibias': 1, 'dysmelia of the tibia and fibulaa': 1, 'bilateral absence of the FS': 1, 'tibia epiphyseal fracture': 1, 'tuberositas tibia transposition': 1, 'dislocation of tibia and femur': 1, 'Congenital absence of bilateral ulnar arteries': 1, 'defect tibia': 1, 'tibia epiphyseal fractures': 1}
|
tibia
|
Disease
|
MESH:C535564
|
{'Fibular dimelia': 7, 'fibular dimelia': 17, 'absent tibia': 13, 'thumb dorsal dimelia': 1, 'Fibular dimelia with mirror foot': 1, 'tibia aplasia or hypoplasia': 1, 'ulnar and fibular dimelia': 1, 'absent tibiae': 5, 'Absent tibiae': 1, 'ulnar/fibular dimelia': 1, 'dimelia defect': 1, 'dimelia': 4, 'Tibial hemimelia-polydactyly-triphalangeal thumb syndrome': 1, 'or absent tibia': 1, 'absent of tibia epiphysis': 1, 'tibia absent': 1, 'aplasia/hypoplasia of the tibia': 2, 'Congenital fibular dimelia': 1, 'unilateral fibular dimelia': 1, 'Dorsal dimelia of a thumb': 1}
|
fibular dimelia
|
Disease
|
MESH:C535566
|
{'absent corpus callosum': 111, 'VICIS': 6, 'autosomal recessive Vici syndrome': 2, 'Vici syndrome': 158, 'Absent Corpus Callosum': 1, 'absent/hypoplastic corpus callosum': 5, 'dysplastic or absent corpus callosum': 1, 'or absent corpus callosum': 1, 'absent or thin corpus callosum': 1, 'Absent corpus collosum': 2, 'absent or hypoplastic corpus callosum': 3, 'Vici Syndrome': 23, 'absent corpus callosus': 1, 'hypoplastic/absent corpus callosum': 1, 'hypoplastic or absent corpus callosum': 11, 'Vici': 5, 'Absent corpus callosum': 5, 'autosomal recessive Vici Syndrome': 1, 'Vici syndrome - Vici syndrome': 1, 'dysgenetic or absent corpus callosum': 2, 'multisystem disorder Vici syndrome': 1, 'Vici-syndrome': 1, 'EPG5-related Vici syndrome': 1, '7 Vici syndrome': 1, 'absent or abnormal corpus callosum': 2, 'thin or absent corpus callosum': 1, 'ACC': 4, 'absent or underdevelopment of the corpus callosum': 1, 'absent corpus collosum': 5, 'dysmorphic or absent corpus callosum': 1, 'dysplastic or absent corpus callosa': 1, 'multisystemic Vici syndrome': 1, 'absent callosum': 1, 'Thrombocytopenia absent corpus callosum syndrome': 1, 'Thrombocytopenia absent corpus callosum': 1, 'Vici syndromes': 1, 'Vici-like syndromes': 1, 'Cerebeller degeneration Vici syndrome': 1, 'absent corpus Callosum': 1, 'systemic Vici syndrome': 1, 'absent fetal corpus callosum': 1, 'VS': 2, 'Vici syndrome disease': 1, 'antenatal Vici syndrome': 1, 'absent of Corpus callosum': 1, 'vici syndrome': 1, "Vici's syndrome": 1, 'absent or incomplete corpus callosum': 1, 'Dionisi-Vici-Sabetta-Gambarara syndrome': 1, 'ACC absent corpus callosum': 1, 'vici': 1, 'absent splenium of corpus callosum': 1}
|
Vici syndrome
|
Disease
|
MESH:C535567
|
{'Thera tsunami': 1, 'Thera': 1, 'SD': 2, "Santorini's duct stenosis": 1, 'stenosis of SD': 1, 'SD stenosis': 1, 'SANTORINI-Population': 1, 'SANTORINI': 3, "Santorini's": 3, 'Santorini bleeding': 1, "Santorini's duct": 6, 'SAN': 1, "Santorini's Duct": 2, 'Santorini caldera': 2, 'of Santorini': 1, 'calcification of duct of Santorini and minor papilla': 1, 'Fava Santorinis': 1, 'SD of the pancreas': 1, 'SD - SSPPD Adenocarcinoma': 1, 'SD - PRPD adenocarcinoma': 1, 'SD - DPPHR adenocarcinoma': 1, 'Santorini cele': 1, 'obstruction of the duct of Santorini': 3, 'Santorini duct dilatation': 1, 'obstruction of duct of Santorini': 1, "'s and Santorini's duct": 1, 'Santorini duct': 1, 'Santorini (': 1, 'stenosis of the accessory papilla of Santorini': 1, "obstruction of Wirsung's or Santorini's duct": 1, 'stenosis of the duct of Santorini': 1, 'dilation of Santorini': 1, "stricture of the Santorini's duct": 1, "Santorini's duct stones": 1, 'Santorini cyst': 1, 'Santorini eruption': 1, 'absent thoracic duct': 1, 'Santorini duct dilation': 1, 'Santorini': 1, 'injury to the duct of Santorini': 1, "Injury of Santorini's canal": 1, 'Accessory apophysis absent': 1, 'Fissures of Santorini': 1, 'santorini duct injury': 1, "and Santorini's ducts": 1, 'injury of the duct of Santorini': 1, "Santorini's duct obstruction": 1, 'stenosis of the Santorini duct': 1}
|
Santorini's duct
|
Disease
|
MESH:C535568
|
{'absent or hypoplastic patellae': 14, 'patellae hypoplasia': 5, 'absent patella': 23, 'Congenital absence of patella': 3, 'hypoplastic or absent patellae': 16, 'isolated patella aplasia hypoplasia': 1, 'Ulnar patella absent': 1, 'aplasia or hypoplasia of the patellae': 3, 'absent patellae': 43, 'absence of right patella': 1, 'bilateral absence of fibula and patella': 1, 'patella aplasia-hypoplasia': 4, 'duplication or absence of the patella or meniscus': 1, 'Bilateral congenital absence of the patella': 2, 'absence of the patellae': 5, 'hypoplastic or absent patella': 10, 'agenesis or hypoplasia of the patella': 1, 'absence or hypoplasticity of the patellae': 1, 'aplasia (absence) or hypoplasia (underdeveloped) patella': 1, 'aplasia of the patella and tibia': 1, 'patella hypoplasia': 14, 'absent/hypoplastic patellae': 4, 'hypoplasia of the patella': 12, 'absence of the patella': 15, 'Congenital absence of the patellae': 3, 'absence of patella': 10, 'absent or dysplastic patellas': 1, 'absent or small patellae': 3, 'Absent patella/patellae': 1, 'premature mineralization of patellae': 1, 'absence of the bilateral patella': 1, 'congenital absence of the bilateral patella': 1, 'congenital absence of bilateral patella': 1, 'aplasia of both patellae': 2, 'patella aplasia': 4, 'patella bone hypoplasia': 1, 'hypoplasia of the patellae': 5, 'bilateral absence of patella': 3, 'absence of the patellas': 1, 'absent or hypoplastic patella': 5, 'PAtellae aplasia or hypoplasia': 2, 'hypoplasia or absence of the patella': 2, 'cranial dystopy of the patella with hypoplasia': 1, 'absence of patellas': 1, "patella's bilateral hypoplasia": 1, 'aplasia of the patella': 4, 'Familial aplasia of the trapezius muscle': 1, 'Congenital Absence of the Patellae': 1, 'hypoplasia of patellae': 1, 'hypoplasia or absence of patella': 1, 'absence or marked reduction of the patella': 1, 'familial patella aplasia-hypoplasia': 1, 'PTLAH': 3, 'Patella aplasia-hypoplasia': 2, 'patellae a/hypoplasia': 1, 'absent patella and': 1, 'absence of patella bones': 1, 'Absence of patella': 4, 'hypoplasia or complete absence of the patella': 1, 'congenital patella aplasia': 1, 'hypoplasia of the fibulae and patellae': 1, 'Aplasia/hypoplasia of the patella': 1, 'absence of patellae': 7, 'absent or malformed patellas': 2, 'Congenital Absence of Patellae': 2, 'absent or abnormal patellae': 1, 'PAtella hypoplasia/aplasia': 1, 'patella hypoplasia/aplasia': 1, 'hypoplasia or absence of patellae': 1, 'patella absence': 1, 'hypoplasia or aplasia of the patellae': 1, 'Hypoplasia of the patella': 1, 'hypoplasia or absence of the patellae': 1, 'patella aplasia or hypoplasia': 1, 'patella aplasia hypoplasia': 1, 'Congenital absence of patella and of quadriceps femoris': 1, 'hypoplastic to absent patellae': 1, 'hypoplasia/agenesis of the patella': 1, 'Patella hypoplasia': 1, 'Absent patella': 4, 'patella hypo/aplasia': 2, 'patellae hypo/aplasia': 1, 'absent and/or hypoplastic patellae': 1, 'familial aplasia': 5, 'isolated patella aplasia-hypoplasia': 2, 'Patella hypoplasia/agenesis': 1, 'patella hypoplasia/agenesis': 1, 'Patella aplasia or hypoplasia': 1, 'familial patella aplasia-hypoplasia': 1, 'absence of bilateral patellae': 1, 'Hypoplasia of the patellae': 1, 'hypoplastic or absence patella': 1, 'congenital bilateral absence of patella': 1, 'congenital absence of patella': 3, 'Bilateral absence of the patella': 1, 'Absent patellae': 2, 'Familial aplasia of the inferior rectus muscles': 1, 'aplasia/hypoplasia of the patellae': 3, 'hypoplasia or aplasia of the patella': 1, 'Familial aplasia': 1, 'aplasia of the fibula or patella': 2, 'small or absent patellae': 2, 'PAtellae hypo/aplasia': 1, 'PAtellae hypo-/aplasia': 1, 'congenital aplasia/hypoplasia of the patella': 1, 'aplasia or hypoplasia of the patella': 2, 'absence or hypoplasia of the patella': 2, 'craniad dystopia of the patella with hypoplasia': 1, 'absent/small patellae': 2, 'Bilateral Absent Patella': 1, 'congenital absent patella': 1, 'Bilateral absent patella': 1, 'absent patellas': 1, 'Congenital absent or small patella': 1, 'bilateral absent patella': 1, 'Congenital absence of the patella': 2, 'Congenital aplasia of the patella': 1, 'congenital aplasia of the patella': 1, 'Familial inferior rectus muscle aplasia': 1, 'absence of the patella tendon': 1, 'hypoplastic or absent patellas': 1, 'reduced (hypoplasia), or absent (aplasia) patellae': 1, 'patellae (hypo)aplasia': 1, 'hypoplasic or absent patella': 1, 'aplastic/absent patellae': 1, 'patella hypoplasia/': 1, 'absent thumbs and patellae': 1, 'Congenital Aplasia of the Patella': 1, 'aplasia of patellae': 1, 'Aplasia of the patella': 1, 'PAtellae hypoplasia': 1, 'or absent patellae': 1, 'thumb and patella aplasia': 1, 'patellae aplasia or hypoplasia': 1, 'absence of the two patellas': 1, 'Familial Anosmia Absence': 1, 'familial pituitary aplasia': 1, 'radial subluxation-fingernail defect-absent patella': 1, 'Familial aplasia of the olfactory bulb': 1, 'Familial ridge dissociation-aplasia': 1, 'Patella aplasia': 1, 'patellae aplasia/hypoplasia': 1}
|
absent patellae
|
Disease
|
MESH:C535569
|
{'child abuse': 15157, 'in psychosocial': 11, 'psychosocial dysfunction': 1001, 'psychosocial disorders': 735, 'child abuse and': 41, 'sexual and psychosocial dysfunction': 1, 'child abuse or neglect': 576, 'Child Abuse': 1785, 'psychosocial': 1461, 'aesthetic and psychosocial disorders': 1, 'Child abuse': 2247, 'psychosocial problems': 1405, 'psychosocial disease': 26, 'child abuse and neglect': 2823, 'psychosocial and': 39, 'child sexual abuse': 3665, 'Child sexual abuse': 909, 'child physical abuse': 678, 'psychosocial disorder': 125, 'satanic child abuse': 1, 'child-abuse': 105, 'CSA': 1021, 'functional and psychosocial decline': 1, 'child abusers': 35, 'PSYCHOSOCIAL': 220, 'Child Sexual Abuse': 454, 'Child Abuse Neglect': 8, 'psychosocial functioning': 68, 'Psychosocial short stature': 5, 'psychosocial short stature': 3, 'familial abuse': 48, 'Child abuse and neglect': 485, 'Child abuse & neglect': 7, 'CAN': 193, 'Child Abuse and Neglect': 800, 'partner and child abuse': 4, 'psychosocial difficulties': 253, 'BPI': 6, 'Child Abuse & Neglect': 39, 'Psychosocial': 214, 'parent-to-child abuse': 1, 'parent-to-child abuse and neglect': 1, 'Child physical abuse and neglect': 6, 'psychosocial and sexual problems': 3, 'Child physical abuse': 122, 'child abuses': 27, 'psychosocial maladjustment': 285, 'PSYCHOSOCIAL CARE': 4, 'BCAP': 3, 'TA-CSA': 2, 'Psychosocial problems': 75, 'physical and psychosocial disorders': 9, 'PsS': 7, 'psychosocial dysfunctions': 62, 'physical or sexual child-abuse': 1, 'physical or sexual child abuse': 12, 'child sexual and physical abuse': 15, 'Child abuse Depression': 2, 'physical child abuse': 72, 'child abuse deaths': 9, 'psychosocial adversity': 120, 'Familial abuse': 6, 'physical and sexual child abuse': 23, 'psychosocial dysfunctioning': 11, 'child/adolescent sexual abuse': 5, 'CASA': 4, 'child abuse/neglect': 205, 'child abuse or': 11, 'family abuse': 120, 'child abuse hearing': 1, 'domestic and child abuse': 19, 'Psychosocial trauma': 7, 'Child injuries and abuse': 1, 'child abuse & neglect': 8, 'CPA': 90, 'Psychosocial Problems': 55, 'psychosocial deficiencies': 11, 'psychosocial trauma': 65, 'psychosocial and behavioral problems': 43, 'psychosocial and behavioural problems.12': 1, 'psychosocial and behavioural problems': 7, 'PSAD': 4, 'Psychosocial abnormalities': 4, 'Physical and Sexual Child Abuse': 1, 'child abuse.27': 1, 'Psychosocial disease': 3, 'SIPAT': 14, 'family violence and abuse': 8, 'Girl child abuse': 2, 'C-IPB': 1, 'elder or child abuse': 4, 'PPA': 1, 'child neglect and abuse': 39, 'cCSA': 2, 'sexual child abuse': 78, 'Child and spouse abuse': 1, 'deficits in psychosocial': 4, 'Psychosocial Dysfunction': 23, 'Psychosocial dysfunction': 58, 'PSC': 47, 'psychosocial deficits': 139, 'abnormal psychosocial behavior': 1, 'and psychosocial dysfunction': 2, 'PSN': 1, 'EPSI': 3, 'deficiencies in psychosocial functions': 1, 'EBPIs': 2, 'CEA': 9, 'child emotional/psychological abuse': 1, 'child and adult abuse': 13, 'psychosocial disturbance': 25, 'Medical Child Abuse': 9, 'psychosocial illness': 43, 'SNaP': 1, 'spousal and child abuse': 5, 'PDM': 1, 'prenatal child abuse': 1, 'PSS': 37, 'child abuse and neglect violence': 1, 'behavioral and psychosocial problems': 21, 'behavioral and/or psychosocial problems': 1, 'child abuse-related injuries': 8, 'CHILD ABUSE': 21, 'PSYCHOSOCIAL ISSUES': 10, 'FAMILY PSYCHOSOCIAL ISSUES': 1, 'child maltreatment abuse': 2, 'psychosocial adversities': 20, 'CPAS': 3, 'Psychosocial adversity': 4, 'CAPs': 5, 'psychosocial abnormalities': 43, 'child psychological abuse': 7, 'Psychosocial Maladjustment': 5, 'ABUSED CHILD': 4, 'CAP Abuse': 4, 'CAP': 22, 'child abuse injuries': 26, 'postsexual abuse syndrome': 1, 'CSAM': 18, 'CSAM offenders': 3, 'Child Sexual Abuse Material': 6, 'child sexual abuse material': 4, 'Child sexual abuse material': 3, 'VCSAM': 1, 'CSAM addiction': 1, 'Child abuse, neglect': 6, 'Behavioural consequences of child abuse': 1, 'psychosocial disorders6': 1, 'neurocognitive and psychosocial deficits': 7, 'child abuse und neglect': 1, 'Psychological sequelae of child abuse': 1, 'PSYCHOSOCIAL FACTORS': 17, 'child sexual abuse survivors': 3, 'IPF': 12, 'psychosocial and physical dysfunction': 6, 'child abuse-': 2, 'child and elder abuse': 29, 'child and sexual abuse': 7, 'child-sexual-abuse': 5, 'partner of child abuse': 1, 'CSA myths': 6, 'Psychosocial disorders': 43, 'child abuse and/or neglect': 65, 'MCA': 9, 'Medical child abuse': 10, 'parental-child-abuse': 1, 'psychosocial deprivation dwarfism': 2, 'neurological and psychosocial sequelae': 2, 'child and physical sexual abuse': 1, 'psychosocial self-injury': 1, 'adult and child sexual abuse': 2, 'deficits in psychosocial functioning': 11, 'PAT-': 1, 'PAT': 17, 'PSYCHOSOCIAL EFFECTS': 2, 'CAPI': 7, 'abnormal psychosocial function': 2, 'abnormal neurocognitive and psychosocial function': 1, 'child abuse trauma': 30, 'child and partner abuse': 9, 'Child and Partner Abuse': 1, 'psychosocial behavioural problems': 1, 'PR': 2, 'disrupted psychosocial functioning': 1, 'PSYCHOSOCIAL ASPECTS': 2, 'behavioral, developmental and psychosocial limitations': 1, 'child physical or sexual abuse': 22, 'child neglect or abuse': 10, 'psychosocial disturbances': 104, 'Emotional child abuse': 7, 'neurocognitive and psychosocial problems': 5, 'psychosocial harm': 37, 'Psychosocial maladjustment': 11, 'child sexual abuse and exploitation': 6, 'PPPHM': 3, 'Child Abuse and Maltreatment': 4, 'attention and psychosocial problems': 1, 'child abuse and neglect.1': 1, 'child abuse sequelae': 2, 'psychosocial and emotional disorders': 21, 'Psychosocial Co-morbidities': 1, 'psychosocial loss': 22, 'psychosocial and emotional problems': 12, 'Amineptine abuse syndrome': 1, 'Psychosocial deficits': 4, 'RPC': 1, 'physical or psychosocial health limitations': 1, 'PSO': 4, 'physical and psychosocial problems': 1, 'Child abuse or neglect': 13, 'child-abuse injuries': 3, 'behavioral and psychosocial disorders': 7, 'psychosocial disruption': 4, 'Child Abuse and': 28, 'Child Physical Abuse': 35, 'Psychosocial Disorders': 16, 'psychosocial, and attention problems': 1, 'emotional, psychosocial, and attention problems': 1, 'emotional, psychosocial': 1, 'Physical child abuse': 26, 'child abuse and the eye': 1, 'Child Abuse and the Eye': 1, 'child abuse and the': 1, 'abuse of the child': 5, 'neurological and psychosocial problems': 7, 'psychosocial and aesthetic': 1, 'and emotional child abuse': 1, 'child welfare abuse': 15, 'physical and emotional child abuse': 14, 'CSEA': 5, 'child sexual exploitation and abuse': 8, 'child physical abuse and neglect': 11, 'PSB': 1, 'Child abuse syndrome': 9, 'emotional, psychosocial, and behavioral deficits': 1, 'infant and child sexual abuse': 1, 'CA': 43, 'Child Abuse Negl': 8, 'psychosocial behavioral disorder': 1, 'laxative abuse syndrome': 2, 'CSA myth': 1, 'PPKI': 1, 'emotional and psychosocial developmental problems': 2, 'PR-HAT': 2, 'child/sexual/physical/emotional abuse': 2, 'child abuse and violence': 13, 'Child-Abuse-and-Neglect-': 1, 'psychosocial maladjustments': 18, 'PM': 2, 'psychosocial ill-health': 4, 'Psychosocial Vulnerabilities': 4, 'PSYCHOSOCIAL CHARACTERISTICS': 2, 'child or elder abuse': 29, 'psychosocial comorbidity': 2, 'CARES': 1, 'HAPIEE': 25, 'child sexual abuse symptoms': 1, 'child and adolescent abuse': 26, 'child physical and sexual abuse': 64, 'of psychosocial': 2, 'psychosocial diseases': 37, 'PSYCHOSOCIAL CONSIDERATIONS': 4, 'animal or child abuse': 1, 'Child and adolescent abuse and neglect': 2, 'limitation of psychosocial functions': 1, 'child and domestic abuse': 7, 'child and family abuse': 4, 'bio-psychosocial disorder': 7, 'PSYCHOSOCIAL COVARIATES': 1, 'child maltreatment/abuse': 3, 'Child abuse and maltreatment': 5, 'Psychosocial disorder': 11, 'Neurological sequelae of child abuse': 1, 'child and adolescent physical abuse': 1, 'Child abuse Injury': 1, 'HAPI': 3, 'elderly abuse syndrome': 2, 'PPC': 2, 'psychosocial problems and dysfunction': 1, 'Deterioration of psychosocial functionality': 1, 'PS': 10, 'psychosocial disintegration syndrome': 1, 'Abuse dwarfism': 2, 'physical and/or psychosocial dysfunctions': 1, 'child abuse recidivism': 3, 'child abuse syndrome': 22, 'neurocognitive and psychosocial diseases': 1, 'Neurocognitive and psychosocial disorders': 1, 'neurocognitive and psychosocial disorders': 3, 'decline in psychosocial functioning': 2, 'psychosocial decline': 2, 'OTHER PSYCHOSOCIAL FACTORS': 1, 'PSA': 2, 'psychosocial maladaptation': 4, 'Child abuse or trafficking': 1, 'psychosocial and sexual dysfunction': 3, 'Child Abuse and Trauma': 56, 'child abuse, neglect': 4, 'psychosocial traumas': 5, 'Psychosocial impairments8': 1, 'poor psychosocial functioning': 7, 'child abuse.129': 1, 'physical and psychosocial abuse': 1, 'PSYCHOSOCIAL INTERVENTIONS': 5, 'physical and psychosocial dysfunction': 10, 'visual and psychosocial limitations': 2, 'child and animal abuse': 2, 'neurocognitive and psychosocial difficulties': 2, 'IA': 1, 'PSDs': 14, 'Child maltreatment by physical, emotional or sexual abuse': 1, 'PC)': 1, 'psychosocial violence': 4, 'psycho-emotional and psychosocial disorders': 1, 'neurocognitive, psychological and psychosocial difficulties': 1, 'abuse, child': 1, 'Psychosocial loss': 4, 'CAR': 1, 'child-sexual abuse': 1, 'orthodontic, and psychosocial disorders': 1, 'abuse of childs': 1, 'Child and adolescent sexual abuse': 12, 'CSAM,1': 1, 'SCAN': 23, 'psychosocial disabilityApply': 1, 'child abuse-neglect': 2, 'psychosocial short statue': 1, 'SIPAT-': 1, 'psychosocial and behavioral impairment': 1, 'sexual or physical child abuse': 1, 'Child abuses': 2, 'child abuse or negligence': 1, 'deficits in physical and psychosocial': 2, 'psychosocial delay': 2, 'Sexual child abuse': 15, 'dysfunction-abuse': 1, 'sexual and physical child abuse': 8, 'Sexual and physical child abuse': 2, 'behavioural and psychosocial dysfunction': 1, 'child emotional abuse': 13, 'child sexual abuse': 1, 'CABS-PA-J': 1, 'CABS-PA': 1, 'child abuse and negligence': 4, 'child abuse by thermal injury': 1, 'Child abuse by thermal injury': 1, 'Child maltreatment Abuse': 1, 'psychosocial deprivation': 65, 'psychosocial damage': 20, 'child abuse.1': 2, 'CSA Severitya': 1, 'child and adolescent sexual abuse': 24, 'PSYCHOSOCIAL ASPECTS OF AMPUTATION': 1, 'child physical and psychological abuse': 2, 'trauma of child abuse': 7, 'Child Abuse/Neglect': 6, 'child or spouse abuse': 4, 'domestic child abuse': 8, 'Domestic Child Abuse': 2, 'and sexual child abuse': 5, 'ICAST': 4, 'ICAST-CH.pdf': 1, 'ICAST-C': 5, 'psychosocial or behavioral problems': 3, 'Child abuse and violence': 4, 'Child sexual abuse and exploitation': 2, 'child/adolescent physical abuse': 1, 'Child/adolescent physical abuse': 1, 'child or spousal abuse': 3, 'psychosocial dwarfism': 10, 'U-CARE': 1, 'and psychosocial deficiencies': 1, 'child or adolescent abuse': 6, 'CATEGORY 5 - PSYCHOSOCIAL/SOCIOECONOMIC': 1, 'Child and adolescent abuse': 9, 'child abuser': 21, 'ATTITUDES REGARDING CHILD ABUSE': 1, 'elder and child abuse': 6, 'Child and Adolescent Sexual Abuse': 4, 'SCREENING FOR PSYCHOSOCIAL': 1, 'loss of physical and psychosocial function': 1, 'Blindness to child abuse': 1, 'developmental and psychosocial problems': 2, 'child/abuse neglect': 1, 'psychosocial delays': 4, 'Psychosocial dysfunctions': 2, 'emotional, sexual and physical child abuse': 1, 'physical child abuse or neglect': 1, 'physical and psychosocial': 4, 'child sexual abusers': 7, 'CSA-E': 2, 'CSAE': 2, 'child sexual abuse and exploitation1': 1, 'and psychosocial': 12, 'paternal and maternal child abuse': 1, 'Child Abuse and Violence': 1, 'CA and neglect': 1, 'hormonal, metabolic and psychosocial disorder': 1, 'bio-psychosocial dysfunction': 3, 'human and child rights abuses': 1, 'Child abuse and trauma': 9, 'CSAAS': 3, 'Child Sexual Abuse Accommodation Syndrome': 5, 'Child abuse and': 4, 'Child sexual abuse consequences': 1, 'IICSAG': 1, 'abuse syndrome': 5, 'psychosocial ill-being': 3, 'PSI': 8, 'psychosocial or': 3, 'Child Sexual Exploitation and Abuse': 2, 'child abuse and neglect recidivism': 1, 'psychosocial and social disorders': 1, 'loss of psychosocial functioning': 2, 'child maltreatment and abuse': 11, 'decreased psychosocial functioning': 2, 'CAPO': 2, 'Physical and emotional child abuse': 3, 'emotional child abuse': 22, ', emotional or psychosocial': 1, 'child sexual abuse effects': 1, 'Neurological and psychosocial disorders': 1, 'psychosocial and motoric impairments': 1, 'Psychosocial anomalies': 1, 'logopedic, psychosocial or motoric impairment': 1, 'psychosocial and motoric anomalies': 1, 'psychosocial and motoric impairmenta': 1, 'psychosocial or motoric impairment': 1, 'Child physical and sexual abuse': 10, 'psychosocial suffering': 3, 'child abuse/ neglect': 1, 'APAI': 3, 'Psychosocial Care Deficiency': 1, 'psychosocial care deficiencies': 1, 'Psychosocial Care Deficiencies': 1, 'psychosocial care deficiency': 1, 'psychoneurotic and psychosocial disorders': 1, 'LONGSCAN': 6, 'child/elder abuse': 5, 'deficiencies in psychosocial care': 1, 'physical and psychosocial deficits': 3, 'Child and Adolescent Abuse': 3, 'to Child Abuse': 1, 'IFCSA': 7, 'child and adult sexual abuse': 8, 'psychosocial resources': 1, 'PSYCHOSOCIAL CORRELATES': 4, 'psychosocial health disorders': 8, 'Child sexual abusers': 3, 'abused child syndrome': 7, 'Psychosocial dwarfism': 6, 'intra-familial abuse': 10, 'psychosocial difficulty': 13, 'Child-abuse': 5, 'child abuse acts of omission and commission': 1, 'NCANDS': 10, 'PSYCHOSOCIAL ASSESSMENT': 3, 'BPS': 4, 'and psychosocial functioning': 3, 'child (sexual) abuse': 8, 'Girl Child Abuse': 1, 'girl child abuse': 1, 'Child or Elder Abuse': 1, 'Child and animal abuse': 4, 'physical and psychosocial difficulties': 2, 'Psychosocial Concerns': 2, 'psychosocial concerns': 2, 'loss of psychosocial well-being': 2, 'psychosocial, and emotional': 1, 'Maternal Child Abuse': 2, 'Child Sexual abuse': 2, 'NA': 2, 'Psychosocial Loss': 5, 'UNDERSTANDING PSYCHOSOCIAL': 1, 'child or domestic abuse': 5, 'psychosocial and emotional damages': 1, 'psychosocial abuse': 7, 'ALPHA': 6, 'Child physical or sexual abuse': 2, 'child abuse and trauma': 6, 'PSYCHOSOCIAL DOMAIN': 1, 'psychosocial problem': 6, 'Child abuse/neglect': 18, 'psychosocial or existential': 1, 'endocrine and psychosocial defects': 1, 'Psychosocial Illness': 5, 'bio-psychosocial disorders': 1, 'psychosocial ill health': 7, 'or psychological child abuse and neglect': 1, 'externalizing psychosocial problems': 2, 'psychosocial and somatic illnesses': 1, 'Psychosocial health': 1, 'CABN': 1, 'Psychosocial Dysfunctions': 3, 'psychosocial and behaviour problems': 1, 'PST': 1, 'Psychosocial and Learning Problems': 5, 'Psychosocial Learning Problems': 1, 'psychosocial deficit': 8, 'ICAST-P': 3, 'and psychosocial problems': 21, 'neurological and psychosocial impairment': 1, 'child-physical-abuse': 1, 'psychosocial abnormality': 9, 'physical abuse of the child': 3, 'child abuse and accidents': 1, 'child or sexual abuse': 3, 'PSYCHOSOCIAL FACTORS ASSOCIATED': 3, 'psychosocial incompetence': 4, 'PSH': 3, 'psychosocial and emotional maladjustment': 2, 'Child Abuse Death': 2, 'child or adolescent sexual abuse': 5, 'psychosocial oncology': 2, 'psychosocial abuses': 2, 'Deterioration in psychosocial functioning': 2, 'child-to-mother abuse': 1, 'child neglect/abuse': 4, 'psychological or psychosocial disorders': 1, 'Physical Child Abuse': 5, 'SIPCA': 2, 'psychosocial relationship disorder': 1, 'child labor abuse': 1, 'PS-US': 1, 'Family abuse': 9, 'APS': 1, 'psychosocial deviance': 3, 'physical-emotional child abuse': 3, 'PSP': 9, 'psychosocial, addictive, and psychopathological disorders': 1, 'child or partner abuse': 3, 'child and inter partner violence/abuse': 1, 'PWE': 2, 'and psychosocial disorders': 2, 'Child Abuse and Neglect Syndrome': 1, 'ginseng-abuse syndrome': 1, 'emotional and psychosocial maladjustment': 2, 'child abuse and neglect28': 1, 'physical and psychosocial diseases': 2, 'ginseng abuse syndrome': 5, 'Child abuse and accidents': 1, 'psychosocial illnesses': 12, 'behavioral and psychosocial disturbances': 1, 'child Sexual abuse': 1, 'child-abuse related injuries': 2, 'PCA': 6, 'behavioural, psychosocial or family difficulties': 1, 'psychosocial and emotional damage': 1, 'bio-psychosocial disease': 2, 'psychosocial morbidities': 12, 'PEGS': 1, 'deterioration of psychosocial and physical': 1, 'PSYCHOSOCIAL PROBLEMS': 6, '-affecting psychosocial problems': 1, 'diminished psychosocial well-being': 1, 'psychosocial disability': 1, 'developmental or psychosocial difficulties': 1, 'Psychosocial Condition': 2, 'and psychosocial maladjustment': 2, 'behavioral and psychosocial maladjustment': 3, 'Axis IV psychosocial problems': 5, 'PSYCHOSOCIAL ENVIRONMENTS': 1, 'and child abuse': 4, 'child abuse;Non': 1, 'low psychosocial': 2, 'child abuse by poisoning': 1, 'abnormal psychosocial functioning': 5, 'disturbances of psychosocial function': 1, 'physical and psychological child abuse': 2, 'Psychosocial/': 1, 'child and spouse abuse': 9, 'Psychosocial difficulties': 13, 'child labour abuse': 2, 'adult and child abuse': 6, 'Child neglect and abuse': 6, 'PF': 6, 'child abuse and maltreatment': 6, 'Household Dysfunction and Abused': 1, 'PPH': 1, 'limitations in psychosocial functioning': 1, 'psychosocial dysregulation': 1, 'Child abuse or maltreatment': 4, 'physical and/or emotional child abuse': 1, 'Child Abuse and Neglect-3': 1, 'Child abuse/': 2, 'PSAC': 1, 'psychosocial cultural deprivation': 1, 'child abuse and/neglect': 1, 'Child Abuse Prevention': 1, 'Child abuser': 1, 'and psychosocial difficulties': 7, 'psychosocial deterioration': 9, 'psychosocial function': 5, 'ISPCAN': 2, 'Social and psychosocial disorders': 1, 'extrafamilial child (sexual) abuse': 1, 'physical-psychosocial dysfunctions': 1, 'psychosocial-trauma': 1, 'psychological and psychosocial': 2, 'child physical and/or sexual abuse': 4, 'psychosocial, emotional, and behavioral problems': 1, 'PL': 2, 'sexual and psychosocial problems': 1, 'PNI': 1, 'psychosocial pathological disorder': 1, 'child maltreatment, abuse, and neglect': 1, ', psychosocial, or behavioral problems': 1, 'child abuse and neglect': 1, 'aesthetic, and psychosocial disorders': 1, 'PACT': 2, 'Psychosocial deprivation': 7, 'physical or emotional child abuse': 4, 'Oral injury in child abuse': 1, 'child or elder abuse and neglect': 1, 'physical and psychosocial illness': 2, 'FCSA': 1, 'Child abuse fracture': 1, 'PsD': 1, 'CAPTA': 7, 'PAT-ASD': 1, ', developmental, and psychosocial problems': 1, 'psychosocial and executive deficits': 1, 'child[hood] abuse': 1, 'repeat family abuse': 1, 'domestic and family abuse': 3, 'intellectual and psychosocial deterioration': 1, 'abuse of child labor': 2, 'sexual abuse of child': 1, 'child abuse mimickers': 1, 'Psychosocial disabilities3': 1, 'Child or adolescent abuse': 2, 'Physical-emotional child abuse': 1, 'Family Dysfunction Abuse': 1, 'psychosocial/behavioral disorders': 1, 'abuse of child': 5, 'multiple child abuse': 1, 'Child physical and emotional abuse': 1, 'emotional and sexual child abuse': 1, 'physical, emotional and sexual child abuse': 2, 'PAC': 2, 'physical and psychosocial limitations': 1, 'PRM': 1, 'Child Abuse Trauma': 3, 'psychosocial and behavioral impairments': 3, 'WCN-N': 1, 'behavioral and psychosocial impairment': 2, 'Psychosocial well-being': 1, 'neurological and psychosocial impairments': 2, 'decline in psychosocial': 1, 'Child abuse neglect': 5, 'Child abuse sexual': 1, 'weakness of physical and psychosocial': 1, 'BACA': 1, 'Bikers Against Child Abuse': 1, 'child or adult abuse': 3, 'emotional instability after child abuse': 1, 'PCA injuries': 1, 'OIS': 1, 'psychological and psychosocial difficulties': 1, 'child abuse and partner abuse': 1, 'urinary, sexual, bowel, and psychosocial symptoms': 1, 'CAHCP': 1, 'Neurologic and psychosocial disorders': 2, 'Psychosocial maladjustment problems': 1, 'PCC-II': 2, 'Psychosocial ill health': 2, 'CA/N.': 1, 'CA/N': 6, 'child/domestic abuse': 1, 'Psychosocial and sexual disturbances': 2, 'partner or child abuse': 1, 'PW': 1, 'PD': 3, 'GPD': 3, "child abuse'.163": 1, 'somatic and psychosocial illness': 1, 'psychosocial disabilities7': 1, 'Child abuse by intoxication': 1, 'Child abuse trauma': 1, 'Child Abuse Maltreatment': 1, 'or sexual child abuse': 2, 'Psychosocial Disease': 2, 'Child-to-parent abuse': 1, '-child abuse': 2, 'BIO-PSYCHOSOCIAL MODEL': 1, 'child and spousal abuse': 6, 'cerebral and psychosocial dysfunction': 1, 'child peer sexual abuse': 1, 'Child peer sexual abuse': 1, 'Family Abuse': 4, 'CLA': 1, 'abuse of child labour': 2, 'PSIs': 1, 'child exploitation and abuse corr': 1, 'PTC': 6, 'PTC-UC': 1, 'emotional and psychosocial disorders': 3, 'psychosocial and skin problems': 1, 'Child abuse Depression': 1, 'CSA violence': 1, 'child abuse death': 6, 'family violence or abuse': 2, 'Child abuse by poisoning': 2, 'Maternal child abuse': 5, 'maternal child abuse': 4, 'CPANS': 3, 'or emotional child abuse': 1, 'psychosocial maladies': 4, 'axis IV psychosocial problem': 1, 'neurological and psychosocial disorders': 6, 'Child sexual exploitation and abuse': 4, 'emotional and psychosocial difficulties': 7, 'psychosocial dependency': 3, 'child and intimate partner abuse': 1, 'child nonsexual abuse and neglect': 1, 'psychological and physical child abuse': 2, 'developmental and psychosocial disorders': 4, 'medical child abuse': 7, 'psychosocial, and physical problems': 1, 'Sexual abuse & other CM': 1, 'PROMOTE PSYCHOSOCIAL HEALTH': 1, 'PSYCHOSOCIAL CHALLENGES OF CAREGIVERS': 1, 'Psychosocial disturbance': 1, 'PSYCHOSOCIAL CHALLENGE': 1, 'Psychosocial Functioning': 2, 'psychosocial functioning difficulty': 1, 'psychosocial vulnerabilities': 5, 'developmental, psychosocial disorder': 1, 'psychosocial maldevelopment': 4, 'CAPS': 5, 'CAP abuse': 6, 'domestic, spousal or child abuse': 1, 'psychosocial syndromes': 2, 'Deficits in psychosocial functioning': 6, 'Psychosocial Adversities': 1, 'PSRFs': 5, 'PSR': 10, 'genetic or psychosocial diseases': 1, 'psychosocial worry': 1, 'developmental or psychosocial disorders': 1, 'non-psychotic psychosocial disorders': 1, 'Ketamine Abuse Syndrome': 1, 'psychosocial crisis': 1, 'child and adolescent physical and sexual abuse': 1, 'psychosocial hazard': 1, 'NPH': 1, 'PSYCHOSOCIAL CONCEPT OF SUICIDE AND DELINQUENCY': 1, 'psychosocial and structural problems': 1, 'PSYCHOSOCIAL FACTORS IN THE ADMINISTRATION OF SOCIAL': 1, 'sexually abused child': 1, 'neurocognitive and psychosocial dysfunctions': 1, 'CIPI': 1, 'difficulty in physical and psychosocial functioning': 2, 'eating and psychosocial problems': 1, 'familial emotional abuse': 3, 'social-emotional and psychosocial problems': 2, 'familial child abuse': 1, 'child abuse and neglect syndrome': 1, 'behavioral or psychosocial problems': 1, 'developmental, behavioral and psychosocial problems': 1, 'physical and psychosocial health disorders': 1, 'psychosocial defeat': 2, 'sleep and psychosocial disturbances': 1, 'Intra-familial abuse': 3, 'psychosocial limitation': 4, 'emotional, behavioral, and psychosocial problems': 1, 'Psychosocial sequelae': 1, 'PSYCHOSOCIAL FACTORS FOR ARTERIAL STIFFNESS': 1, 'OPSIC': 3, 'Abuse and Neglect - Child': 1, 'motor and psychosocial delay': 1, 'CSA survivors': 1, 'ergonomic and psychosocial problems': 1, 'psychosocial functioning deficits': 4, 'ANRQ': 1, 'PSYCHOSOCIAL INFERTILITY': 1, 'COMPI': 2, 'child sexual abuse and': 1, 'motor and behavioral/psychosocial abnormalities': 1, 'child abuse:1': 1, 'somatic and psychosocial problems': 2, 'Physical and psychosocial dysfunctions': 1, 'physical, psychosocial dysfunctions': 1, 'child or elderly abuse': 2, 'child abuse and neglect': 1, 'ICSA': 5, 'Intrafamilial Child Sexual Abuse': 1, 'Intrafamilial child sexual abuse': 2, 'psychosocial misconducts': 1, 'child physical/sexual abuse': 1, 'psychosocial, behavioral, or emotional impairments': 1, 'psychosocial and physical limitations': 1, 'emotional child abuse"[All': 1, 'child sexual abuse"[All': 1, 'Child emotional abuse': 6, 'sexual child abuse"[All': 1, 'child/adolescent abuse': 2, 'Child/adolescent abuse': 2, 'sexual abuse child': 1, 'Sexual abuse child': 1, 'PAI': 1, 'CN&A': 2, 'emotional and psychosocial disturbances': 1, 'PSS, type 1': 1, 'type II PSS': 1, 'PSS type I': 1, 'PSS IIb': 1, 'PSY': 1, 'PH*PSY': 1, 'psychological child abuse': 2, 'NPI': 1, 'male child abuse': 2, 'child-abuse fracture': 1, 'GAS': 3, 'Child Abuse Punishment': 1, 'child (sexual or physical) abuse': 1, 'psychosocial hazards': 1, 'Psychosocial Hazards': 1, 'Child sexual and physical abuse': 3, 'felony child abuse': 3, 'PSYCHOSOCIAL MEDIATORS OF': 1, 'emotional or physical child abuse': 1, 'metabolic and psychosocial disorders': 2, 'circadian and psychosocial disorders': 1, 'PSF': 8, 'child-to-parent abuse': 2, 'Sexual Abuse Child': 1, 'child abuse.86': 1, 'CSAs': 2, 'SOMATIC OR PSYCHOSOCIAL': 1, 'PSYCHOSOCIAL REHABILITATION': 2, 'psychological and psychosocial disorders': 5, 'child/sexual abuse': 1, 'psychosocial disequilibrium': 1, 'sexual or child abuse': 2, 'Psychosocial Deprivation': 3, 'psychosocial sequelae': 4, 'Sexual Child Abuse': 4, 'child (sexual) abuse and neglect': 4, 'abuse child': 1, 'Child abusers': 2, 'child-abuse or neglect': 1, 'dependence/abuse syndromes': 1, 'lesions of child abuse': 1, 'child abuse and neglect.27': 1, 'emotional or psychosocial problems': 1, 'in psychosocial functioning': 7, 'CSA offenders': 7, 'emotional and/or psychosocial problems': 1, 'emotional and psychosocial problems': 6, 'emotional and psychosocial': 2, 'IPARAN': 2, 'child Abuse and Neglect': 3, 'child protection/ abuse': 1, 'Child sexual abuse and neglect': 1, 'Substantiated Child Abuse': 1, 'animal/elder/child abuse or neglect': 1, '/elder/child abuse or neglect': 1, 'Child sexual abuse survivors': 1, 'child, domestic, or sexual abuse': 1, 'PWES': 1, 'PRRCs': 3, 'child abuse offenders': 1, 'psychosocial, and financial injuries': 1, 'child sexual abuser': 4, 'emotional, behavioural, and psychosocial problems': 1, 'PSYCHOSOCIAL VARIABLES': 3, 'PsH': 47, 'PCUFT': 1, 'child and adult abuse and neglect': 1, 'behavioral, psychosocial and developmental problems': 1, 'Developmental, behavior and psychosocial problems': 1, 'Child abuse by burning': 1, 'child abuse by burning': 1, 'child/adult abuse': 1, 'Child abuse*trauma': 1, 'child abuse*traumagenic': 1, 'child sexual or physical abuse': 5, 'MCSA': 1, 'psychosocial and learning problems': 2, 'PF deficits': 1, 'child labor and abuse': 1, 'PSC-CL': 1, 'psychosocial health': 5, 'physical, behavioral and psychosocial impairments': 1, 'PSD': 9, 'RPS': 1, 'HCSA': 1, 'physical, psychosocial and neurocognitive deficits': 1, 'abuse and dysfunction': 3, 'Neurological and psychosocial sequelae': 1, 'child sexual abuse offenders': 3, 'psychosocial and developmental problems': 2, 'psychosocial or developmental problems': 1, 'deterioration of psychosocial functions': 1, 'Emotional and Physical Child Abuse': 1, 'SCA': 4, 'PSYCHOSOCIAL PREDICTORS': 3, 'elder, child, and animal abuse': 1, 'child/elderly abuse': 1, 'child abuse:2': 1, ', psychosocial and learning problems': 1, 'COPSOQ III': 1, 'child sexual abuse accommodation syndrome': 4, 'C-CAPS': 1, 'reproductive and child sexual abuse': 1, 'Child Abuse Legend': 1, 'maladaptive psychosocial behaviors': 1, 'sexual and child abuse': 2, 'PSYCHOSOCIAL ASSESSMENT OF INDIVIDUALS': 1, 'PPHA': 1, 'psychosocial, and behavioral problems': 2, 'Loss of family and abuse': 1, 'PFPS': 1, 'PPS': 1, 'BCAP abuse': 1, 'psychosocial and behavioral dysfunction': 1, 'of physical and psychosocial': 1, 'anabolic steroid abuse syndrome': 1, 'psychosocial, behavioral, or psychological disorders': 1, 'PsS.': 1, 'Psychosocial disturbances': 5, 'child abuse,': 1, 'abuse of a child': 2, 'Psychosocial problem': 2, 'deficits in psychosocial and': 1, 'psychosocial, behavioral and physical dysfunction': 2, 'child maltreatment or abuse': 2, 'child physical/emotional abuse': 2, 'child abuse traumas': 1, 'emotional and psychosocial abuse': 1, 'depression': 1, 'psychosocial sequalae': 2, 'trauma related) psychosocial problems': 1, 'HIV.Psychosocial': 1, 'psychosocial and/or physical dysfunction': 1, 'child or adulthood abuse': 1, 'socio-psychosocial disorders': 1, 'female child abuse': 1, 'child and wife abuse': 1, 'child abuse neglect': 7, 'MHP-P': 2, 'Child Abuse and/or Neglect': 1, 'child labor abuses': 1, 'compromised neuropsychological and psychosocial functioning': 1, 'child abuse or violence': 1, 'Child abuse and the eye': 1, 'IPF.There': 1, 'Child Abuse Injury': 2, 'child sexual abuse by infected': 1, 'Psychosocial Disorder': 2, 'physical abuse of child': 1, 'child and elder abuse and neglect': 1, 'child abuse and harm': 1, 'psychological, and psychosocial disorders': 3, 'psychosocial addiction': 2, 'physical child abuse and neglect': 2, 'psychosocial maladjustment disorders': 1, 'Psychosocial Conditions': 2, 'psychosocial conditions': 1, ', Psychosocial and Learning Problems': 3, 'PSYCHOSOCIAL DIMENSIONS': 2, 'PCS': 1, 'PCS-R': 1, 'KCAN': 1, "Bridgend's child abuse": 1, 'Domestic and child abuse': 1, 'child) abuse': 2, 'CPS': 1, '(child) abuse': 3, 'PH': 2, 'Internet child sexual abuse': 1, 'CACRC': 1, 'child abuse.[FG4,6': 1, 'behavioural and psychosocial problems': 2, 'Psychosocial Difficulties': 8, 'Verbal, physical, and sexual child abuse': 1, 'motor and psychosocial dysfunctions': 1, 'child-hood sexual abuse': 2, 'domestic/child/sexual abuse': 1, 'child rights abuses': 3, 'Child Abuse': 2, 'abused child': 5, 'Child maltreatment and abuse': 3, 'psychosocial functioning disorders': 1, 'PGA': 1, 'psychosocial, and behavioral deficits': 1, 'impaired psychosocial behaviors': 2, 'psychosocial disruptions': 5, 'psychosocial and psychopathological imbalances': 1, 'abuse/dependence syndromes': 1, 'Child Neglect and Abuse': 2, 'physical, and psychosocial': 1, 'child abuse and incest': 1, 'psychosocial disturbances in': 1, 'Psychosocial Implication': 1, 'motor and behavioural/psychosocial abnormalities': 1, 'abuse syndromes': 2, 'neuropsychological and psychosocial difficulties': 1, 'psychosocial integration problems': 1, 'PRFs': 1, 'complex psychosocial': 1, 'child abuse.6': 1, 'Abuse and Household Dysfunction': 1, 'ICASTs': 1, 'neurocognitive and psychosocial dysfunction': 2, 'neurological and/or psychosocial problems': 1, "psychosocial disadvantage':comprised": 1, 'psychosocial disadvantage': 3, 'Child abuse CAMH 2': 1, 'elder or familial abuse': 1, 'elder and familial abuse': 1, 'Child and elder abuse': 1, 'Psychosocial addiction': 1, 'eating PD': 1, 'CAS': 2, 'MST-CAN': 7, 'PSYCHOSOCIAL APPROACH': 1, 'PSYCHOSOCIAL HYPOTHESIS': 1, 'child abuse.mp': 1, 'maternal and child abuse': 3, 'behavioural, emotional and psychosocial problems': 1, 'PSYCHOSOCIAL PREDICTORS OF': 1, 'or psychosocial': 2, 'abuse and neglect of the child': 1, 'TOTAL PSYCHOSOCIAL OUTCOME': 1, 'PSYCHOSOCIAL TREATMENT': 3, 'penetrative child sexual abuse': 1, 'Penetrative child sexual abuse': 1, 'spouse and child abuse and neglect': 1, 'child abuse-related fractures': 1, 'PSYCHOSOCIAL TREATMENTS': 5, 'Psychosocial Health': 1, 'Sexual Abuse CPS': 1, 'child sexual and/or physical abuse': 2, 'psychosocial malaise': 3, 'Emotional Child Abuse': 2, 'emotional child abuse and neglect': 1, 'SOCAN': 1, 'ICAST-CH': 2, 'Child Abuse or Neglect': 3, 'PCAN': 1, 'institutionalized child abuse': 1, 'psychosocial incapacity': 3, 'psychosocial profile': 2, 'Psychosocial Losses': 2, 'psychosocial losses': 2, 'child and/or spousal abuse': 1, 'PSYCHOSOCIAL CHANGES FOLLOWING': 1, 'Child/abuse neglect': 1, 'TEENAGE PSYCHOSOCIAL PROBLEMS DURING SOCIAL ISOLATION': 1, 'declines in psychosocial functioning': 3, 'behavioral or psychosocial dysfunction': 2, 'PG': 1, 'LP': 1, 'child harm and abuse': 1, 'child exploitation and abuse': 2, 'child abuse': 1, 'or psychosocial problems': 2, 'adult-child abuse': 1, 'Child abuse and/or neglect': 5, 'behavioral, psychosocial, and': 1, 'psychosocial or sexual problems': 1, 'domestic and or child abuse': 1, 'Psychosocial diseases': 1, 'psychosocial emergencies': 1, 'Laxative Abuse Syndrome': 1, 'Child Abuse and neglect': 2, 'Problems of psychosocial': 1, 'Ehlers-Danlos syndrome with child abuse': 1, 'PT': 2, 'Psychosocial turmoil': 1, 'Lethal child abuse': 1, 'lethal child abuse': 1, 'psychosocial or sexual disturbances': 1, 'PSYCHOSOCIAL COMPONENTS': 1, 'companion animal and child abuse': 1, 'chronic child abuse': 1, 'Chronic child abuse': 1, 'CSA sequelae': 1, 'behavioral and psychosocial dysfunction': 1, 'psychosocial dysfunction, disability': 1, 'psychosocial and emotional behavioral problems': 1, 'child-abuse dwarfism': 2, 'PSYCHOSOCIAL DIFFICULTIES': 1, 'SCREENING PSYCHOSOCIAL': 1, 'CPS Physical Abuse': 1, 'PSYCHOSOCIAL.TI': 2, 'PSYCHOSOCIAL-REHABILITATION#.DE': 2, 'psychosocial limitations': 5, 'child and elderly abuse': 3, 'CM abuse': 3, 'Child and partner abuse': 1, 'child abuse and abuse': 1, 'psychosocial and emotional or behavioural disturbances': 1, 'physical, sexual, and emotional child abuse': 1, 'PSC-4': 2, 'IF abuse': 1, 'child, elder, and spouse abuse': 1, 'ORA': 2, 'child abuse symptoms': 1, 'Deterioration in physical and psychosocial functioning': 1, 'Abuse Neglect CPS': 1, 'PSYCHOSOCIAL QUESTIONNAIRE': 1, 'mood or psychosocial problems': 1, 'child-hood abuse': 3, 'Organised child sexual abuse': 1, 'neurobehavioral, motor and psychosocial deficits': 1, 'neurological or psychosocial sequelae': 1, 'term effects of child abuse': 1, 'OCSA': 2, 'neglect or inflicted injury of child abuse': 1, 'sexual, and child abuse': 1, 'PBS': 1, 'psychosocial hardship': 3, 'developmental, emotional, and psychosocial problems': 1, 'functional and psychosocial disorders': 1, 'child abuse-maltreatment syndrome': 1, 'CAMS': 1, 'felony child sexual abuse': 5, 'loss of psychosocial functions': 1, 'institutional child abuse': 4, 'PSCP': 1, 'MPIS': 1, 'PSS Type 2': 1, 'psychosocial behavioral problems': 1, 'Child Abuse, Neglect': 1, 'child physical, sexual, and emotional abuse': 2, 'Psychosocial morbidities': 2, 'disturbances in psychosocial functioning': 1, 'Psychosocial maltreatment': 1, 'Psychosocial Wellbeing': 1, 'sexual, domestic or child abuse': 1, 'PSMTC': 1, 'child physical and neglect abuse': 1, 'emotional, behavioural and psychosocial problems': 1, 'Unborn child abuse': 2, 'child abuse/maltreatment': 1, 'psychosocial and behavioral difficulties': 4, 'deterioration of psychosocial functioning': 3, 'Children placed in care, child abuse/': 1, 'Psychosocial dislocation': 1, 'child hood sexual abuse': 2, 'PSYCHOSOCIAL CONSIDERATIONS-3': 1, 'difficulties in psychosocial functioning': 2, 'psychosocial and coordination problems': 1, 'Maternal and child abuse': 1, 'psychosocial and behavioral disorders': 4, 'Adult and child abuse': 3, 'adult or child abuse': 1, 'Psychosocial distressare': 1, 'TCSA': 1, 'child sexual exploitation/abuse': 1, 'neurocognitive and psychosocial morbidities': 1, 'child welfare and abuse': 1, 'child abuse symptom': 1, 'neuropsychological and psychosocial problems': 1, 'emotional, psychosocial and behavioral impairments': 1, 'psychosocial health dysfunction': 1, 'Psychosocial and behavioral problems': 3, 'or psychosocial functions': 1, 'Child Sexual Abuse 1': 1, 'ARCAN': 1, 'MPSC': 1, 'Child Abuse & Trauma': 1, 'psychosocial injuries': 3, 'psychosocial ills': 1, 'genetic and psychosocial diseases': 1, 'Child Abuse?:Measurement': 1, 'OFFERING PSYCHOSOCIAL': 1, 'PCHS': 2, 'B-IPF': 2, 'psychosocial/': 2, 'psychosocial/behavior problems': 1, 'PPR': 1, 'child abuse of AIDS': 1, 'psychosocial toxicity': 1, 'Psychosocial toxicity': 1, 'COPES': 4, 'and psychosocial function': 3, 'ICAST-R': 1, 'child abuse/neglect.2': 1, 'child physical and sexual abuse and/or neglect': 1, 'CHILD SEXUAL ABUSE': 1, 'child physical orsexual abuse': 1, 'PSCs': 1, 'Child Abuse And Neglect': 1, 'child abuse and endangerment': 1, 'diminished social and psychosocial functioning': 1, 'Child Abuse Hidden': 1, 'COPSOQ': 2, 'child psychological abuse and neglect': 2, 'Child Psychological Abuse and Neglect': 1, 'Child psychological abuse and neglect': 1, 'CPAN': 2, 'child/spouse abuse': 1, 'HAPIEE-PO': 1, 'family dysfunction or abuse': 1, 'child animal abuse': 1, 'in psychosocial function': 1, 'neuronal or psychosocial damage': 1, 'deficits in psychosocial function': 1, 'losses of psychosocial function': 1, 'Psychosocial and spiritual problems': 1, 'psychosocial and spiritual problems': 1, 'child abuse/trauma': 1, 'child abuse end neglect': 1, 'SIPP': 4, 'child abuse fractures': 2, 'child- abuse': 1, 'Child and adolescent physical abuse': 1, 'Child Abuse &amp;': 1, 'Psychosocial Problems/Dysfunction': 1, 'psychosocial problem/dysfunction': 1, 'physical and psychosocial disease': 1, 'psychosocial behaviour problems': 1, 'child sexual abuse?Are': 1, 'child abuse-related disorders': 1, 'domestic, child, and sexual abuse': 1, 'and psychosocial functions': 3, 'metaphyseal lesion of child abuse': 1, 'child abuse problems': 1, 'reproductive and psychosocial diseases': 1, 'child sexual, physical and emotional abuse': 1, 'psychosocial dysfunction and': 1, 'child abuse accommodation syndrome': 1, 'Child sexual abuse and': 1, 'behavioral and psychosocial dysfunctions': 1, 'child sexual abuse infected': 1, 'Ginseng abuse syndrome': 2, ', emotional, and sexual child abuse': 1, 'child molesters abuse': 1, 'CAPI abuse': 3, 'psychosocial well': 1, 'psychosocial and behavioral dysfunctions': 1, 'Suspected CAN': 1, 'Motor and psychosocial dysfunction': 1, 'child abuse and neglect injuries': 1, 'child sexual abuse and incest': 2, 'child/spousal abuse': 1, 'satanist child abuse': 1, 'PSBP': 1, 'Child maltreatment or abuse': 2, 'IV psychosocial problems': 1, 'CAMPs': 1, 'child abuse suicide': 1, 'Psychosocial harm': 2, 'drug and psychosocial problems': 1, 'familial elder abuse': 1, 'psychosocial health deficits': 1, 'emotional/psychosocial problems': 1, 'PICAS': 1, 'household dysfunction and abuse': 1, 'and psychosocial health limitations': 1, 'Fractures of child abuse': 1, 'disturbance of psychosocial function': 1, 'functional and psychosocial limitation': 1, 'functional and psychosocial deficits': 1, 'and psychosocial deficits': 3, 'internalizing psychosocial and emotional disorders': 1, 'abuse or dysfunction': 2, 'CSA type 0-4b': 1, 'child / sexual abuse': 1, 'Torture versus child abuse': 1, 'abuse or neglect of a child': 1, 'PB': 1, 'psychosocial function disorder': 1, 'Psychosocial and physical health disorders': 1, 'Child sexual abuse D&I': 1, 'child abuse (poly)victimization': 1, 'child sexual abuse and violence': 1, 'physical and emotional child abuse and neglect': 1, 'child sexual abuses': 2, 'Psychosocial/emotional trauma': 1, 'psychosocial anomaly': 1, 'psychosocial crises': 1, 'SCSA': 1, 'deficits in neurocognitive and psychosocial functioning': 1, 'step-child abuse': 1, 'deficits of psychosocial wellbeing': 1, 'PSYCHOSOCIAL CARE INTERVENTION': 1, 'drop in psychosocial functioning': 2, 'Sexual abuse of the child': 2, 'Ophthalmic and psychosocial sequelae': 1, 'MIPT': 2, 'PIPT': 2, 'HIV and child abuse': 1, 'Household dysfunction and abuse': 2, 'household dysfunction-abuse': 2, 'domestic or child abuse': 2, 'limitations to psychosocial functioning': 1, 'Child abuse and incest': 1, "Child's sexual abuse": 1, 'PFI': 1, 'PF problems': 1, 'child (physical) abuse': 1, 'neurological and psychosocial disturbances': 1, 'disturbances of general psychosocial functioning': 1, 'child physical, sexual and emotional abuse': 1, 'Non-recent Child Sexual Abuse': 1, 'Non-recent child sexual abuse': 1, 'Child Abuse"[Mesh': 1, 'intrafamilial child abuse': 1, 'metabolic, hormonal, and psychosocial disorder': 1, 'PET': 1, 'Child Abuse Medicine': 1, 'psychosocial developmental trajectory delays': 1, 'psychosocial developmental problems': 2, 'psychosocial disfunctions': 2, 'detriments in psychosocial functioning': 1, 'Family dysfunction and abuse': 1, 'psychosocial and behavioral abnormalities': 1, 'neurocognitive and psychosocial delay': 1, 'DECCA': 1, 'limitations on psychosocial functioning': 1, 'psychosocial and emotional difficulties': 4, 'family violence abuse': 1, 'Child abuse and neglected': 1, 'child abuse.12': 1, 'Child traumatic physical abuse': 1, 'child and adolescent physical and emotional abuse': 1, 'child, spouse, and elder abuse and neglect': 1, 'OCSEA': 2, 'child physical, sexual, or emotional abuse': 1, 'emotional family abuse': 1, 'abuse of children/child labor': 1, 'malady of child abuse': 1, 'damage to psychosocial function': 1, 'child, elder, and partner abuse': 1, 'psychosocial and behavioural disorders': 2, 'PCC II': 1, 'organic and psychosocial disorders': 1, 'PPSFs': 1, 'CHAIN-ER': 1, 'MIS': 1, 'domestic (and child) abuse': 1, 'PSYCHOSOCIAL MODELS OF SUICIDE': 1, 'psychosocial deformity': 1, 'psychosocial harms': 1, 'Child Sexual Abusers': 1, 'CSA-W': 1, 'with psychosocial functioning': 1, 'Psychosocial functioning': 1, 'of psychosocial functioning': 1, 'Child Sexual Abuse Myth': 1, 'Child sexual abuse myths': 1, 'child sexual abuse myths': 1, 'psychosocial and neuropsychological dysfunction': 1, 'spouse and child abuse': 2, 'Spouse and Child Abuse': 1, 'psychosocial incompatibility': 1, ', hearing, and psychosocial problems': 1, 'neuropsychological and psychosocial deficits': 1, 'pulmonary, gastrointestinal, psychosocial': 1, 'PSYCHOSOCIAL ENVIRONMENT': 1, 'limitations of psychosocial function': 1, 'child abuse and assault': 1, 'Child neglect or abuse': 1, 'child abuse injury': 7, 'Child abuse injuries': 2, 'of psychosocial problems': 1, 'child deprivation and abuse': 1, 'Child abuse or': 1, 'psychosocial disabilities2': 1, 'CSA/E': 1, 'loss of psychosocial function': 1, 'child hood abuse': 2, 'Ginseng Abuse Syndrome': 2, 'Child sexual, emotional abuse': 1, 'psychosocial syndrome': 1, 'Psychosocial Adversity': 3, 'chronic child abuse syndrome': 1, 'Psychosocial ill-health': 1, 'PSYCHOSOCIAL LONG-TERM': 1, 'Child (sexual) abuse': 1, 'psychosocial disordersMulti': 1, 'disruptive psychosocial function': 1, 'girl) child abuse': 1, 'child physical and emotional abuse': 1, 'Psychosocial Crisis': 1, 'dysfunctional psychosocial': 1, 'psychosocial developmental abnormalities': 1, 'neuropsychological and psychosocial deficiencies': 1, 'HANDLING PSYCHOSOCIAL': 1, 'bio-psychosocial diseases': 1, 'abnormalities in psychosocial functioning': 1, 'abuse dwarfism': 3, 'psychosocial functioning problems': 2, 'Child and Elder Abuse': 1, 'RANGE OF AVAILABLE PSYCHOSOCIAL REHABILITATION SERVICES': 1, 'Deficits in psychosocial': 2, 'CAPNET': 1, 'physical or psychosocial disability': 1, 'of Child Abuse': 1, 'Emotional Abuse of Child Abuse': 1, 'domestic abuse or dysfunction': 1, 'Child, abuse neglect': 1, 'Adult and child abuse, neglect': 1, 'PSYCHOSOCIAL EVALUATION': 2, 'PSYCHOSOCIAL WELL-': 1, 'PRIMA': 1, 'child sexual abuse sequelae': 1, 'Child sexual abuse sequelae': 1, 'poor psychosocial function': 1, 'child Abuse': 2, 'Psychosocial Trauma': 1, 'Psychosocial sequelae': 1, 'emotional and physical and sexual child abuse': 1, 'Holistic child abuse': 1, 'PSYCHOSOCIAL MECHANISMS OF': 1, 'PPCs': 2, 'psychosocial, emotional, and behavioral disorders': 1, 'institutional CSA': 1, 'Child psychological/emotional abuse and neglect': 1, 'Psychosocial illness': 1, 'PSYCHOSOCIAL DYSFUNCTION': 3, 'Child hood Abuse': 1, 'Child and adult abuse': 3, 'Violent and sexual child abuse': 1, 'child abuse / neglect': 1, 'physical and/or sexual child abuse': 1, 'child domestic abuse': 1, 'pelvic, sexual and psychosocial disturbances': 1, 'Child abuse mom': 1, 'sexual abuse of the child': 1, 'Child and adolescent physical and emotional abuse': 1, 'child and adolescent physical, emotional, and sexual abuse': 1, 'poor reading and psychosocial difficulties': 1, 'physical and/or psychosocial dysfunction': 1, 'psychosocial and motor dysfunction': 1, 'OA CPS': 1, 'PSC-12': 3, 'adult and child abuse and': 1, 'emotional and psychosocial injury': 1, 'PSYCHOSOCIAL ASPECTS OF': 1, 'CPM': 1, 'Diabetes Child abuse': 1, 'Child abuse in panic disorder': 1, 'Problems in psychosocial functioning': 1, 'HPSI': 1, 'child abuse and death': 1, 'decline in psychosocial function': 1, 'neurologic and psychosocial disorders': 2, 'child sexual abuse and neglect': 2, 'neurological, substance and psychosocial problems': 1, 'RCSA': 1, 'Chronic Child Abuse': 1, 'psychosocial function decline': 1, 'PSCS': 1, 'CSAP': 1, 'CSAPE': 1, 'psychopathological and psychosocial problems': 1, 'child domestic work and abuse': 1, 'CPGHE': 1, 'PSYCHOSOCIAL OPTIMISATION': 1, 'Physical, emotional and sexual child abuse': 1, 'physical, emotional, and sexual child abuse': 1, 'psychosocial and functional decline': 1, 'abuse and household dysfunction': 1, 'and psychosocial disturbances': 2, 'maternal child abuse and neglect': 1, 'Urinary, Psychosocial Dysfunction': 1, 'urinary, psychosocial dysfunction': 1, 'Child Physical abuse': 1, 'child/youth abuse': 1, 'PsSD': 1, ', psychosocial,': 1, 'Deterioration in psychosocial': 1, 'maternal child sexual abuse': 1, 'Maternal Child Sexual Abuse': 1, 'declines in psychosocial': 1, 'PSYCHOSOCIAL INTERVENTION': 1, 'psychosocial and cosmetic disorders': 1, 'PSPs': 2, 'psychosocial ill effects': 1, 'child abuse homicide': 1, 'Homicidal child sexual abuse': 1, 'psychosocial and academic difficulties': 1, 'physical and psychosocial maladjustment': 1, 'child abuse,"55': 1, 'Child Abuse - A': 1, 'LSCSA': 1, 'child physical, emotional, and sexual abuse': 1, 'child injury and abuse': 1, 'child psychological and physical abuse': 1, 'neonatal child abuse': 1, 'psychosocial problem behavior syndrome': 1, 'PSYCHOSOCIAL VARIABLE': 1, 'syndrome of abuse': 2, 'psychosocial and physical disorders': 2, 'intrauterine child abuse': 1, 'psychological and psychosocial disturbances': 1, 'Child Abuse Physical/Emotional abuse': 1, 'psychosocial anomalies': 1, 'psychosocial derangement': 1, 'PSYCHOSOCIAL RISK': 1, 'unwanted child sexual abuse': 1, 'behavioral, emotional, and psychosocial problems': 2, 'Adult sequelae of child sexual abuse': 2, 'PWPD': 1, 'PSYCHOSOCIAL SCALES': 1, 'COMPASS': 1, 'decline of psychosocial and physical function': 1, 'ICAST-CH-M': 1, 'ICAST-CH-M.': 1, 'PCC I, II, III': 1, 'PCC AD': 1, 'PCC': 2, 'psychosocial or behavioural difficulties': 1, 'CNS child abuse': 1, 'adolescent or child sexual abuse': 1, 'child penetrative sexual abuse': 1, 'child and elder abuse or neglect': 2, 'psychosocial discrimination': 1, 'PSYCHOSOCIAL FORUM': 3, 'domestic, sexual, and child abuse': 1, 'HIV psychosocial illness': 1, 'muscular, functional and psychosocial declines': 1, 'psychosoci*.mp': 1, 'CCCAN': 1, 'PPP': 2, 'gendered child abuse': 1, 'medical and psychosocial disorders': 1, 'PRIMES': 1, 'psychosocial, emotional, and behavioural problems': 1, 'Child Abuse Mimic': 1, 'physical/sexual child abuse': 1, 'Child abuse injury': 1, 'PSM': 1, 'PI': 3, 'PRF': 2, 'Child abuse and Trauma': 1, 'behavioural or psychosocial deficits': 1, 'psychosocial damages': 3, 'behavioral and psychosocial impairments': 2, 'emotional, behavioral and psychosocial problems': 1, 'psychosocial burnout': 1, '/behavioural/psychosocial disorders': 1, 'psychosocial and mood abnormalities': 1, 'psychosocial health difficulties': 2, 'loss of psychosocial resources': 1, 'Psychosocial Oncology': 1, 'psychosocial derailment': 1, 'child- or infant abuse': 1, 'psychological and psychosocial deficiencies': 1, 'psychosocial emergency care': 1, 'familial strife and partner abuse': 1, 'Child Abusers': 1, 'psychosocial and behavioral disorder': 1, 'compromised psychosocial functioning': 1, 'PFOS': 1, 'visual or psychosocial deprivation': 1, 'sexual, and emotional child abuse and neglect': 1, 'EBTs': 1, 'PSYCHOSOCIAL LITERATURE RELATED TO': 1, 'sensory-motor and/or psychosocial deficit': 1, 'COPSOQ-III': 1, 'adult/child abuse': 1, 'CHILD PSYCHOSOCIAL': 1, 'psychosocial (': 1, 'psychosocial disfunction': 1, 'ICAT': 1, 'Spousal or partner abuse syndromes': 1, 'partner abuse syndrome': 1, 'child abuse, neglect and harm': 1, 'Ergonomic and psychosocial disorders': 1, 'psychosocial vulnerability': 1, 'neglect or abuse of the child': 2, 'abnormal psychosocial': 1, 'neurovegetative and psychosocial disorders': 1, 'and psychosocial harm': 1, 'CAN violence': 1, 'child abuse and neglect violence': 1, 'child physical or emotional abuse': 2, 'TBPI': 2, 'Psychological abuse of child': 1, 'behavioral and psychosocial deficits': 2, 'behavioral/psychosocial deficits': 2, 'PO': 1, 'child and relationship abuse': 1, 'child or adult sexual abuse': 1, 'Child Emotional Abuse': 1, 'Child abuse and infections': 1, 'PMS': 1, 'PSYCHOSOCIAL BENEFITS': 1, 'Physical Abuse of Child': 1, 'intimate partner and child abuse': 1, 'or psychosocial disorders': 1, 'psychological or psychosocial difficulties': 1, 'physical and psychosocial health deficits': 1, 'NPSP': 1, 'EBIs': 1, 'psychosocial well-being': 2, 'criminal child abuse': 2, 'Familial Emotional Abuse': 2, 'IBCAP': 1, 'child abuse and injuries': 1, 'CAN injuries': 1, 'CAN injury': 1, 'can': 1, 'reduction of psychosocial problems': 1, 'SSCA': 1, 'child stress and abuse': 1, 'child sexual abuse""[Tx': 1, 'child rights abuse': 1, 'Child Abuse Syndrome': 1, 'deterioration in psychosocial functioning': 1, 'disorders of psychosocial functioning': 2, 'PA': 2, 'psychosocial complication': 1, 'psychosocial or physical illness': 1, 'PWF': 1, 'Emotional Abuse and Family Dysfunction': 1, ', and psychosocial problems': 1, 'CSA dissociation': 1, 'Laxative abuse syndrome': 1, 'LAS': 1, 'PSCc': 1, 'Psychosocial/Emotional Disorders': 1, 'Incontinence and psychosocial problems': 1, 'adult and child abuse and assault': 1, 'physical, psychosocial, emotional and behavioural problems': 1, 'neurocognitive or psychosocial difficulties': 1, 'organic, functional and psychosocial diseases': 1, 'emotional and physical child abuse': 1, 'IIA-PRF': 1, 'domestic/child abuse': 1, 'child) sexual abuse': 1, 'child or elder abuse/neglect': 1, 'childhood maltreatment: a qualitative study. Child Abuse and Neglect,37': 1, 'Child Abuse and Neglect,37': 1, 'adolescent and child abuse': 1, 'PCs': 1, 'physical and psychosocial injury': 2, 'child and physical abuse': 1, 'Psychosocial damage': 1, 'sexual CAN': 1, 'CAN 9': 1, 'Psychosocial abuse': 1, 'PSRs': 2, 'deterioration of psychosocial': 1, 'child abuse-related injury': 1, 'psychosocial-': 1, 'psychosocial and emotional harm': 1, ', psychosocial and': 1, 'abuse as child': 1, 'Child sexual and/or physical abuse': 1, 'COMPARISON OF PSYCHOSOCIAL': 1, 'PSYCHOSOCIAL COMPETENCE': 1, 'child abuse or maltreatment': 1, 'child abuse violence1': 1, 'CAUSE OF CHILD SEXUAL ABUSE': 1, 'clinical or psychosocial harm': 1, 'Date and Family Violence Abuse': 1, 'psychosocial alteration': 1, 'or psychosocial deficits': 1, 'child of abuse': 1, 'family and partner abuse': 1, 'postcocaine abuse syndrome': 1, 'emotional, psychosocial and behavioural deficits': 1, 'CHAMP': 1, 'child abuse-related complex': 1, 'Psychosocial functioning deficits': 1, 'POF': 1, 'PSYCHOSOCIAL WELL': 1, 'EBPI': 1, 'behavioral, emotional and psychosocial maladjustment': 1, 'physical and sexual child abuse and neglect': 1, 'child physical abuse recidivism': 1, "child's abuse": 1, "Child's childhood abuse": 1, 'neurological and psychosocial disorder': 1, 'Deterioration of Psychosocial Outcomes': 1, 'Child Abuse and Neglect syndrome': 1, 'Child Abuse Or Neglect': 1, 'psychosocial and financial problems': 1, 'psychosocial disordersc': 1, 'intrafamilial child sexual abuse': 1, 'Psychological child abuse': 1, 'Child abuse*[Title': 1, 'neuromotor and psychosocial abnormalities': 1, 'PSE': 1, 'PSYCHOSOCIAL COUNSELING': 1, 'psychosocial and vocational deficits': 1, 'Child abuse and trauma II': 1, 'Child sexual abuse and incest': 1, 'psychosocial injury': 1, 'psychosocial and behavioral diseases': 1, 'Negative psychosocial functioning': 1, 'psychosocial and emotional': 1, 'child-youth abuse': 1, 'psychosocial sequela': 1, 'Child Abuse and Unintentional Injuries': 1, 'PRS': 1, 'psychosocial and physical problems': 1, 'Child-Abuse and Neglect': 1, 'child-abuse and neglect': 1, 'Child/adult abuse': 1, 'psychosocial adverse effects': 1, 'BDPS': 1, 'Psychosocial Dwarfism': 1, 'PLQ': 1, 'child abuse[tiab': 1, 'homicide by child abuse': 1, 'PsyMRS': 1, 'psychosocial disorder and dysfunction': 1, 'physical, and sexual child abuse': 1, 'animal, elder and child abuse': 1, 'animal, child and elder abuse': 1, 'child and animal sexual abuse': 1, 'psychosocial processing deficits': 1, 'psychosocial-like processing deficit': 1, 'psychosocial behavior deficit': 1, 'elder abuse syndrome': 1, 'child, elder and domestic abuse': 1, 'of child abuse': 2, 'psychosocial and physical difficulties': 1, 'physical, emotional, or sexual child abuse': 1, 'pedophilic child sexual abuse': 1, 'PSYCHOSOCIAL MALADJUSTMENT': 1, 'Child/Adolescent sexual abuse': 1, 'family violence and/or abuse': 1, 'psychosocial functional deficit': 1, 'Spousal and child abuse': 1, 'PiGeOn': 1, 'child and adulthood abuse': 1, 'EBPT': 1, 'PSCE': 1, 'Decreased psychosocial functioning': 1, 'deterioration of psychosocial problems': 1, 'neuropsychological and psychosocial dysfunction': 1, 'psychosocial immaturity': 1, 'behavioural and psychosocial disorders': 1, 'sexual and psychosocial diseases': 1, 'IICSA': 1, 'child, domestic or sexual abuse': 1, 'child welfare abuse/neglect': 1, 'ST': 1, 'Poor psychosocial functioning': 1, 'abuse and family dysfunction': 1, 'Physical and sexual child abuse': 1, 'psychosocial-behavioral problems': 1, 'deterioration of psychosocial function': 1, 'syndrome of psychosocial deprivation': 1, 'Deficits of psychosocial functioning': 1, 'Child maltreatment Physical abuse': 1, 'loss of psychosocial': 1, 'family and psychosocial dysfunction': 1, 'psychological and psychosocial problems': 1, 'child and adult abuse trauma': 1, 'psychosocial developmental disorders': 1, 'Verbal, physical, and psychosocial abuse': 1, 'Child sexual abuse accommodation syndrome': 1, 'academic or psychosocial difficulties': 1, 'CPSS': 1, 'psychological, psychosocial': 1, 'PSNs': 1, 'psychosocial emergency': 1, 'Psychosocial dependency': 1, 'ORA.In': 1, 'Child abuse Influenza infection': 1, 'BPSM': 2, 'psychosocial pathologies': 1, 'PSRF': 1, 'COPSOQ I': 1, 'CPA injuries': 1, 'physical and psychosocial abnormalities': 1, 'psychosocial)': 1, 'externalizing psychosocial disorders': 1, 'APDs': 1, 'psychosocial disadvantages': 1, 'physical, behavioral, and/or psychosocial impairments': 1, 'psychoemotional and psychosocial disorders': 1, 'child sexual abuse': 1, 'Child abuse, maltreatment': 1, 'child abuse[MeSH': 1, 'CSA.Experience': 1, 'CSA.Suicidal ideation': 1, 'CS-child abuse': 1, 'CS-Child Abuse': 1, 'Child Abuse,': 1, 'interference with psychosocial functioning': 1, 'disturbance of psychosocial well-being': 1, 'Child and adult sexual abuse': 1, 'physical or psychosocial diseases': 1, 'neurological or psychosocial disorder': 1, 'Child Abuse America': 1, 'sexual or psychosocial dysfunctions': 1, 'Child sexual abuse I': 1, 'Child abuse"[Mesh': 1, 'SCPT': 1, 'elder or child abuse or neglect': 1, 'CAN trauma': 1, 'child abuse poisoning': 1, 'Child sexual abuse II': 1, 'Familial emotional abuse': 1, 'Behavioral and psychosocial problems': 1, 'psychosocial maladjustement': 1, 'Sexual abuse Loss of child by': 1, 'ED CAN': 1, 'behavioural and psychosocial syndromes': 1, 'Gays and Child Abuse': 1, 'Psychosocial Deficits': 1, 'BPSR': 1, 'disorders of psychosocial functions': 1, 'family dysfunction abuse': 1, 'psychosocial behavioral disorders': 1, 'psychosocial illness impairment': 1, 'Child abuse and Neglect': 1, 'PSEP': 1, 'child maltreatment, abuse': 1, 'Psychosocial Syndromes': 1, 'Child abuse 1': 1, 'child abuse and domestic violence': 1, 'child abuse by': 1, 'Child abuse by': 1, 'behavioral, developmental, and psychosocial problems': 1, 'PWCs': 1, 'Child sexual abuse and the skin': 1, 'Psychosocial health disorders': 1, 'psychosocial health disorder': 1, 'child sexual abuse problems': 1, 'PE': 1, 'psychosocial, behavioral, and developmental problems': 1, 'Child Abuse and Neglect 2019': 1, 'neurologic or psychosocial sequelae': 1, 'psychosocial, and social deficits': 2, 'behavioral/psychosocial abnormalities': 1, 'PNs': 1, 'and psychosocial behavior problems': 1, 'PCP': 1, 'Abuse Household dysfunction': 1, 'Child sexual abuse--II': 1, 'PSYCHOSOCIAL CORRELATES OF': 1, 'child and elderly abuse and neglect': 1, 'PIC': 1, 'CAPI Abuse': 1, 'CAPI-Abuse': 1, 'psychosocial dysfunctionality': 1, 'PRRC': 1, 'disorders of psychosocial health': 1, 'child verbal abuse': 1, 'Child verbal abuse': 1, 'child verbal and emotional abuse': 1, 'verbal and physical child abuse': 1, 'Child Verbal Abuse': 1, 'CAM': 1, 'Psychosocial,': 1, 'psychosocial weakness': 1, 'psychosocial, and': 1, 'PCRW': 1, 'Child physical abuse trauma': 1, 'colicky infant child abuse': 1, 'Child sexual abuser': 1, 'OCSAs': 1, 'child or domestic partner abuse': 1, 'dental and psychosocial problems': 1, 'spiritual and psychosocial disorders': 1, 'Child abuse Abuse': 1, 'PBD': 1, 'psychosocial dysfuction': 1, 'Hypnosis for child sexual abuse': 1, 'psychological, and psychosocial': 1, 'psychosocial and structural dysfunctions': 1, 'psychosocial and social dysfunction': 1, 'Criminal child abuse': 1, 'child violence and abuse': 1}
|
child abuse
|
Disease
|
MESH:C535571
|
{'delayed sexual maturity': 15, 'delayed sexual maturation': 116, 'impaired sexual maturation': 15, 'delay in sexual maturation': 14, 'delay of sexual maturation': 4, 'delay of sexual maturity': 1, 'retardation of sexual maturity': 1, 'retarded sexual maturation': 4, 'retarded sexual maturity': 1, 'delay in sexual maturity': 2, 'premature or delayed sexual maturation': 3, 'delays in sexual maturation': 3, 'loss or delay of sexual maturity': 1, 'impairment of sexual maturation': 3, 'sexual maturation delay': 2, 'Delayed sexual maturation': 7, 'Impaired sexual maturation': 1, 'delays of sexual maturity': 1, 'delayed mental maturation': 1, 'delays in sexual maturity': 3, 'or sexual maturation retardation': 1, 'Fragoso-Cantu syndrome': 1, 'delayed and incomplete sexual maturation': 1, 'retardation of sexual maturation': 3, 'retardation of sexual maturation and': 1, 'delayed skeletal and sexual maturity': 1, 'delayed or absent sexual maturation': 1, 'delayed sexual and bone maturation': 3}
|
delayed sexual maturation
|
Disease
|
MESH:C535572
|
{'hypertrichotic': 35, 'Cantu syndrome': 199, 'cantu-syndrome#definition': 1, 'Cantu Syndrome': 50, 'hypertrichotic osteochondrodysplasia': 21, 'CS': 53, "Cantus's incipit": 1, 'pigmented hypertrichotic dermatosis': 13, "Cantu's syndrome": 1, 'Hypertrichotic Plaque': 1, 'Cantu': 15, "Hypertrichotic Becker's nevi": 1, "hypertrichotic Becker's nevi": 1, 'CS disease': 1, 'hypertrichosis-osteochondrodysplasia-cardiomegaly syndrome': 3, 'hypertrichotic patches': 2, 'Congenital hypertrichotic melanoneurocytoma': 1, 'CANTU': 2, 'cantu syndrome': 3, 'Pigmented hypertrichotic dermatosis': 5, 'Cantu syncrome': 1, 'hypertrichotic skin': 3, 'Cantu craniofaciofronto digital syndrome': 1, 'hypertrichotic disorder': 1, 'hypertrichotic condition': 1, 'hypertrichotic syndrome': 1, 'congenital hypertrichotic syndrome': 1, 'hypertrichotic syndromes': 1, 'congenital megaureter Cantu syndrome': 1, 'CS-associated anomalies': 1, 'CS-related anomalies': 1, 'Hypertrichotic Osteochondrodysplasia': 1, 'CS.Little': 1, 'Cantu disease': 2, 'cantus of the eye': 1, 'cantus of the': 1, "Cantu' syndrome": 3, 'hyperpigmented/hypertrichotic skin': 1, 'hyperpigmented and hypertrichotic skin': 1, 'Cantus WG': 1, 'cantus defect': 1, 'CS abnormalities': 2, 'pigmented hypertrichotic skin lesions': 1, 'hepatic or Cantu-like': 1, 'hypertrichotic skin plaques': 1, 'Hypertrichotic nodule': 1, 'Cantu and Sotos syndromes': 1, "Cantu' Syndrome": 1, 'Type IIa hypertrichotic': 1, 'CS vascular dysfunction': 1, 'CS vasculopathy': 1, 'eye cantus': 1, 'hypertrichotic conditions': 1, 'Father Cantu syndrome': 1, 'Mother Cantu syndrome': 1, 'hypertrichotic lesions': 1, 'CS.8': 1, 'Hypertrichotic Osteochondrodysplasia or Cantu Syndrome': 1, 'Hypertrichotic osteochondrodysplasia': 1, 'hypertrichosis-osteodysplasia-cardiomegaly syndrome': 1, 'hypertrichotic epidermal nevi': 1, 'hypertrichotic cutaneous patches': 1, 'Cantu syndrome 7': 1, '[email protected]': 1, 'hypertrichotic area': 1}
|
Cantu syndrome
|
Disease
|
MESH:C535573
|
{'monoclonal gammopathy-associated idiopathic systemic capillary leak syndrome': 2, 'Periodic systemic capillary leak syndrome': 1, 'U-PRIM': 1, 'Monoclonal gammopathy-associated idiopathic systemic capillary leak syndrome': 1, 'Monoclonal gammopathy-associated systemic capillary-leak syndrome': 1, 'monoclonal gammopathy-associated systemic capillary-leak syndrome': 1, 'Monoclonal Gammopathy-Associated Systemic Capillary-Leak Syndrome': 1, 'PS': 1}
|
monoclonal gammopathy-associated idiopathic systemic capillary leak syndrome
|
Disease
|
MESH:C535576
|
{'cardiac valvular anomalies': 16, 'valvular or congenital heart disease': 181, 'valvular dysplasia': 45, 'X-linked cardiac valvular dysplasia': 6, 'Cardiac Valvular Disorders': 2, 'valvular, pericardial, or congenital heart disease': 5, 'Valvular and congenital heart diseases': 4, 'cardiac valvular vegetation': 8, 'congenital or valvular heart diseases': 6, 'Cardiac valvular impairment': 1, 'congenital valvular disease': 47, 'congenital and valvular heart disease': 27, 'congenital or valvular heart disease': 71, 'cardiac valvular thrombosis': 1, 'cardiac valvular dystrophy': 16, 'cardiac valvular involvement': 40, 'cardiac valvular conditions': 2, 'XMVD': 9, 'congenital valvular heart disease': 43, 'cardiac valvular regurgitation': 28, 'valvular heart disease congenital heart': 1, 'cardiac valvular disorder': 14, 'Cardiac valvular injury': 1, 'cardiac valvular dysfunction': 36, 'congenital valvular conditions': 1, 'congenital valvular abnormalities': 10, 'cardiac valvular manifestations': 1, 'congenital valvular diseases': 5, 'familial cardiac valvular dystrophy': 2, 'cardiac valvular calcification': 59, 'cardiac valvular insufficiency': 31, 'valvular and congenital heart disease': 73, 'cardiac valvular problems': 11, 'congenital or valvular': 3, 'cardiac and valvular calcifications': 3, 'cardiac-valvular': 13, 'coronary, valvular, and congenital heart disease': 1, 'cardiac valvular disease,4': 1, 'congenital valvular anomaly': 2, 'congenital valvular malformation': 8, 'valvular congenital abnormalities': 2, 'valvular and congenital heart diseases': 28, 'valvular or congenital anomalies': 1, 'congenital and valvular heart diseases': 17, 'congenital or valvular disease': 7, 'Extra-Valvular Cardiac Damage': 3, 'valvular or congenital heart diseases': 18, 'Congenital and valvular heart disease': 4, 'cardiac valvular disorders': 21, 'congenital, ischemic, or valvular heart disease': 3, 'congenital valvular deficiency': 1, 'Valvular and Cardiac Dysfunction': 1, 'cardiac valvular calcinosis': 1, 'valvular, or congenital heart disorders': 4, 'Cardiac valvular': 3, 'extra-valvular cardiac damage': 9, 'CVC': 9, 'Cardiac valvular calcification': 19, 'cardiac valvular calcifications': 15, 'congenital or valvular abnormalities': 1, 'cardiac valvular damage': 20, 'cardiac valvular obstructive lesions': 1, 'Cardiac valvular anomalies': 1, 'congenital valvular cardiac anomaly': 1, 'cardiac valvular affection': 2, 'cardiac valvular dysplasia': 17, 'valvular-or congenital heart disease': 1, 'Cardiac valvular regurgitation': 2, 'structural, valvular, and congenital heart diseases': 1, 'Congenital valvular heart disease': 8, 'congenital valvular lesions': 7, 'cardiac valvular fibrosis': 22, 'cardiac valvular, vascular, and renal disease': 1, 'Cardiac valvular anomaly': 1, 'congenital valvular heart diseases': 3, 'cardiac valvular': 29, 'valvular or congenital heart lesion': 1, 'cardiac valvular vegetations': 16, 'Congenital or acquired heart or valvular disease': 1, 'cardiac valvular tissue calcification': 2, 'cardiac valvular pathology': 19, 'Cardiac valvular thickening': 2, 'valvular or congenital heart disorders': 2, 'cardiac valvular injuries': 3, 'valvular congenital heart defect': 3, 'valvular and congenital disorders': 3, 'mitral valvular and congenital heart disease': 1, 'valvular, or congenital heart disease': 4, 'cardiac valvular stenosis': 13, 'congenital heart and valvular heart diseases': 1, 'ischemic, valvular, congenital heart disease': 1, 'cardiac valvular insufficiencies': 2, 'cardiac valvular degeneration': 5, 'congenital valvular heart abnormality': 1, 'pulmonary valvular dysplasia': 5, 'non-valvular cardiac aspergillosis': 1, 'Non-valvular cardiac aspergillosis': 1, 'left cardiac valvular regurgitation': 1, 'valvular dystrophy': 16, 'valvular, or congenital disease': 1, 'cardiac valvular and vascular disorders': 1, 'congenital heart and valvular diseases and dysfunctions': 1, 'and cardiac valvular calcification': 2, 'congenital, valvular, cardiomyopathy': 1, 'congenital valvular malformations': 3, 'cardiac valvular malfunction': 1, 'congenital valvular dysplasia': 4, 'valvular, or cardiac injury': 1, 'Cardiac valvular involvement': 14, 'congenital/valvular heart disease': 3, 'cardiac valvular injury or injuries': 1, 'Cardiac valvular thrombosis': 1, 'valvular or congenital disease': 10, 'valvular and congenital diseases': 4, 'congenital valvular heart defects': 2, 'valvular cardiac anomalies': 2, 'cardiac valvular ulceration': 1, 'congenital or acquired valvular abnormality': 1, 'coronary, valvular, or congenital heart disease': 2, 'valvular, congenital, or ischemic heart disease': 8, 'valvular, congenital,': 1, 'X-linked cardiac valvular disease': 1, 'X-linked myxomatous valvular dystrophy': 13, 'coronary artery, valvular, and congenital heart disease': 1, 'valvular congenital anomaly': 1, 'valvular of congenital heart disease': 1, 'valvular, congenital or ischemic heart disease': 2, 'congenital, structural, or valvular heart diseases': 1, 'cardiac valvular tissue granuloma': 1, 'Congenital and Valvular Heart Disease': 5, 'congenital VHD': 5, 'Congenital VHD': 2, 'Non-Valvular Cardiac Aspergilloma': 1, 'Congenital valvular disease': 6, 'non-valvular congenital heart disease': 1, 'valvular and congenital heart conditions': 1, 'coronary and cardiac valvular disease': 1, 'non-syndromic myxomatous valvular dystrophy': 1, 'myxomatous valvular dystrophy': 11, 'cardiac dystrophic valvular amyloidosis': 1, 'cardiac valvular amyloidosis': 1, 'Valvular or Congenital': 1, 'valvular, or congenital heart diseases': 2, 'cardiac or valvular anomalies': 2, 'congenital valvular disorder': 2, 'Congenital heart valvular disease': 1, 'cardiac valvular and arterial calcification': 2, 'Atrioventricular Valvular Dysplasia': 1, 'atrioventricular valvular dysplasia': 1, 'Valvular, Congenital': 1, 'valvular and cardiac pathology': 1, 'valvular congenital heart disease': 6, 'coronary, congenital, valvular, and pulmonary heart disease': 1, 'cardiac valvular nodule': 1, 'congenital or acquired valvular diseases': 1, 'valvular, congenital, or primary muscle heart disease': 1, 'myocardial or valvular cardiac disease': 1, 'cardiac, valvular, and vascular pathologies': 1, 'cardiac valvular thickening': 20, 'congenital valvular morphology': 1, 'congenital, pulmonary or valvular heart disease': 1, 'valvular dysplasias': 2, 'heart valvular morphology': 1, 'cardiac valvular effects': 2, 'Cardiac valvular dysfunction': 2, 'Cardiac-valvular': 4, 'cardiac and valvular problems': 1, 'cardiac valvular tophi': 1, 'coronary, valvular, congenital or specific myocardial disease': 1, 'dysplasia / absence of pulmonary valvular leaflets': 1, 'Idiopathic,ischaemic,congenital,valvular': 1, 'valvular, and congenital heart diseases': 1, 'impairment of cardiac and valvular function': 1, 'cardiac valvular EDS': 2, 'cvEDS': 1, 'congenital, valvular, or cardiomyopathic heart disease': 3, 'valvular or congenital cardiomyopathy': 1, 'X-linked cardiac valvular dystrophy': 5, 'XCVD': 5, 'cardiac or valvular fibrosis': 1, 'congenital heart or valvular diseases': 2, 'Cardiac valvular dysplasia': 4, 'vascular and cardiac valvular abnormalities': 1, 'cardiac-valvular problems': 7, 'valvular cardiac damage': 2, 'congenital, or valvular heart disease': 2, 'congenital, valvular, or pericardial abnormalities': 2, 'cardiac valvular pathologies': 10, 'congenital valvular pathology': 2, 'cardiac valvular or muscular problems': 1, 'valvular or congenital abnormality': 1, 'valvular morphology and regurgitation': 1, 'congenital valvular anomalies': 3, 'Valvular dysplasia': 5, 'cardiac annular and valvular calcification': 1, 'cardiac annular or valvular calcifications': 1, 'cardiac valvular / annular calcifications': 1, 'cardiac annular and valvular calcifications': 1, 'cardiac annular / valvular calcification': 1, 'cardiac valvular and annular calcifications': 1, 'cardiac annular / valvular calcifications': 1, 'cardiac X-linked myxoid valvular dystrophy': 1, 'cardiac valvular tissue': 1, 'congenital valvular lesion': 1, 'X-linked myxomatous valvular disease': 2, 'Valvular cardiac manifestations': 1, 'Myxomatous Fibroelastic deficiency': 1, 'cardiac valvular thrombi': 1, 'Valvular or coronary cardiac diseases': 1, 'congenital valvular abnormality': 8, 'congenital or acquired valvular disease': 2, 'cardiac valvular or vasculitic involvement': 1, 'cardiac valvular alterations': 1, 'Cardiac valvular injuries': 1, 'ischemic, congenital, or valvular heart disease': 1, 'cardiac aortic valvular diseaseKnown': 1, 'congenital valvular process': 1, 'valvular congenital abnormality': 1, 'cardiac valvular stenosis or regurgitation': 2, 'congenital and valvular diseases': 2, 'ischaemic, congenital, and valvular heart disease': 1, 'valvular, congenital heart diseases': 1, 'coronary, congenital, valvular,': 1, 'valvular and congenital disease': 3, 'congenital and/or valvular heart diseases': 1, 'congenital, ischaemic or valvular disease': 1, 'congenital, valvular or ischaemic heart disease': 1, 'valvular, congenital and arteriosclerotic disease': 1, 'pulmonary valvular dysplasia syndrome': 1, 'cardiac congenital valvular disease': 1, 'valvular and other cardiac anomalies': 1, 'Congenital valvular dysplasia': 1, 'valvular cardiac involvement': 1, 'valvular (and other cardiac) damage': 1, 'valvular, congenital, and ventricular diseases': 1, 'congenital mitral valvular (MV) malformation': 1, 'congenital, valvular, and myocardial diseases': 1, 'cardiac valvular degenerative changes': 1, 'valvular or congenital cardiac malformations': 1, 'cardiac valvular incompetence': 5, 'congenital, rheumatic, or valvular heart disease': 2, 'congenital, valvular': 1, 'congenital or valvular cardiac diseases': 1, 'cardiac valvular destruction': 1, 'valvular, congenital, or hypertensive heart disease': 3, 'ischemic, valvular, and congenital heart disease': 3, 'valvular and ischaemic cardiac pathology': 1, 'congenital or valvular cardiac disease': 1, 'congenital, valvular, and ischemic heart disease': 2, 'cardiac valvular regurgitation and stenosis': 1, 'Cardiac Valvular Dysplasia': 1, 'congenital, rheumatic, valvular and ischemic heart disease': 1, 'Valvular & congenital heart disease': 1, 'ischemic, valvular or congenital heart disease': 1, 'valvular and congenital abnormalities': 4, 'cardiac valvular injury': 4, 'congenital heart and valvular disease': 1, 'congenital and valvular lesions': 1, 'valvular/congenital heart disease': 2, 'cardiac valvular insufficiency or stenosis': 1, 'valvular, congenital': 2, 'cardiac valvular anomaly': 2, 'Valvular or congenital disease': 1, 'rheumatic, valvular, or congenital heart disease': 2, 'congenital, valvular, or pericardial diseases': 1, 'cardiac valvular illness': 1, 'cardiac valvular regurgitations': 2, 'Cardiac and valvular impairment': 1, 'congenital valvular heart defect': 7, 'valvular and/or congenital heart disease': 2, 'Cardiac Valvular Calcification': 3, 'Cardiac Valvular': 4, 'valvular and cardiac function': 1, 'cardiac-valvular,': 2, 'Cardiac valvular pathologies': 2, 'Valvular and congenital heart disease': 1, 'congenital lymphatic valvular incompetence': 2, 'valvular and cardiac pathologies': 1, 'myocardial and cardiac valvular fibrosis': 1, 'cardiac muscle valvular pathologies': 1, 'congenital cardiac valvular anomaly': 1, 'cardiac valvular and vascular diseases': 1, 'cardiac valvular type 0': 1, 'Cardiac Valvular Lesions 2': 1, 'valvular and cardiac dysfunction': 1, 'valvular, and congenital heart disease': 4, 'cardiac valvular, or neurocognitive dysfunction': 1, 'cardiac valvular infection': 2, 'CVD': 2, 'rheumatic, valvular or congenital heart disease': 1, 'to cardiac valvular tissue': 1, 'ischemic, valvular, and congenital heart diseases': 1, 'cardiac valvular (': 1, 'cardiac valvular abnormalitity': 1, 'Cardiac valvular pathology': 2, 'valvular, pericardial or congenital heart disease': 1, 'cardiac valvular deformation': 1, 'coronary/congenital/valvular heart disease': 1, 'valvular, congenital, myocardial, and pericardial disease': 1, 'valvular (mainly stenosis) or congenital heart disease': 1, 'ocular, dental, auditory and valvular cardiac corollaries': 1, 'cardiac valvular and arthrochalasia type': 1, 'valvular, pericardial, or congenital abnormality': 1, 'Congenital Valvular Heart Diseases': 1, 'cardiac valvular type': 1, 'valvular cardiac alterations': 1, 'Cardiac valvular insufficiency': 3, 'cardiac or valvular insufficiencies': 1, 'cardiac and valvular disorders': 1, 'cardiac valvular deformity': 1, 'valvular, ischemic, congenital heart': 1, 'congenital and/or valvular heart disease': 1, 'cardiac valvular infections': 1, 'vascular, valvular, cardiac, or chronic medical illness': 1, 'cardiac (valvular and myocardial damage': 1, 'ischemic, congenital and valvular heart diseases': 1, 'ischemic, valvular, congestive, arrhythmic and congenital disease': 1, 'congenital or 1 valvular disease': 1, 'coronary, valvular, and congenital heart diseases': 2, 'congenital, ischemic, valvular and pulmonary heart diseases': 1, 'cardiac valvular and/or aortic pathologies': 1, 'congenital, valvular)': 1, 'coronary, valvular, myopathic, and congenital heart disease': 1, 'cardiac valvular dystrophic': 1, 'congenital dysplasia of the valvular apparatus': 1, 'valvular, structural, or congenital heart disease': 1, 'valvular or cardiac congenital disease': 1, 'congenital heart/valvular diseases': 1, 'valvular/congenital heart diseases': 1, 'cardiac valvular myxoid thickening': 1, 'congenital, valvular, and/or ischemic heart diseases': 1, 'cardiac valvular emboli': 1, 'valvular, vascular, and congenital heart diseases': 1, 'cardiac valvular abnormalitiesSister': 1, 'Congenital and Acquired Valvular Heart Disease': 1, 'congenital and valvular disease': 1, 'Congenital Valvular Abnormality': 1, 'Cardiac valvular fibrosis': 1, 'x-linked myxomatous valvular dystrophy': 1, 'cardiac valvular condition': 2, 'valvular or congenital': 1, 'valvular, ischemic, congenital': 1, 'myxomatous dystrophy': 1, 'nodular valvular dysplasia': 1, 'cardiac valvular fusion': 1, 'cardiac valvular, respiratory, gastrointestinal, and ophthalmological complications': 2, 'valvular, and congenital disease': 2, 'valvular- or congenital heart disease': 1, 'cardiac valvular and pleuropulmonary fibrosis': 1, 'rheumatic valvular, congenital heart disease': 1, 'coronary artery, valvular and congenital heart disease': 1, 'Valvular and Congenital Heart Disease': 1, 'Cardiac and valvular disorders': 1, 'cardiac valvular malformation': 2, 'valvular, ischemic, and congenital disease': 1, 'congenital or rheumatic valvular disease': 2, 'Valvular dystrophies': 1, 'Myxomatous and Fibroelastic Deficiency': 1, 'cardiac or valvular calcifications': 1, 'Valvular mitral dysplasia': 1, 'cardiac poly-valvular dysplasia': 1, 'congenital and rheumatic valvular heart disease': 4, 'cardiac valvular changes': 2, 'non-valvular cardiac anomaly': 1, 'cardiac valvular motion': 1, 'Congenital Valvular Heart Disease': 1, 'congenital, valvular or degenerative heart disease': 1, 'Cardiac-valvular Vascular Hypermobile': 1, 'cardiac or valvular dysfunction': 1, 'cardiac and valvular damage': 2, 'Congenital pulmonary valvular dysplasia': 1, 'Valvular Cardiac Involvement': 1, 'cardiac valvular development': 2, 'X-linked Cardiac valvular dysplasia': 1, 'valvular or congenital heart defects': 1, 'pericardial, valvular and/or congenital heart disease': 1, 'congenital, valvular, or coronary disease': 1, 'Congenital and acquired valvular diseases': 1, 'cardiac valvular emergencies': 2, 'congenital or valvular heart defects': 1, 'Cutaneous and cardiac valvular pigmentation': 1, 'cardiac valvular pathosis': 1, 'X-linked myxomatous MV dystrophy': 1, 'cardiac valvular surgery': 1, 'congenital and mitral valvular diseases': 1, 'X-linked mitral valvular dystrophy': 1, 'congenital or valvular heart disorder': 1, 'Cardiac valvular vegetations': 1, 'cardiac (valvular) calcification': 2, 'tricuspid valvular dysplasia': 2, 'TVD': 1, 'congenital valvular or vascular abnormalities': 1, 'congenital or valvular heart disorders': 1, 'valvular congenital heart defects': 2, 'cardiac valvular calcification or fibrosis': 1, 'cardiac valvular apparatus damage': 1, 'valvular, congenital or hypertensive heart disease': 1, 'valvular, ischemic, or congenital heart disease': 1, 'coronary, congestive, valvular, and congenital heart disease': 1, 'coronary artery, valvular or congenital heart disease': 1, 'congenital or valvular conditions': 1, 'cardiac and valvular dysfunction': 2, 'Cardiac congenital & valvular disorders': 1, 'Congenital Valvular and Structural Heart Disease': 1, 'valvular cardiac disorders': 3, 'cardiac valvular dysfunctions': 2, 'cardiac valvular and myocardial calcifications': 1, 'congenital valvular changes': 1, 'cardiac, valvular, and vascular inflammatory illnesses': 1, 'ectopic arterial, myocardial and cardiac valvular calcifications': 1, 'X-linked myxomatous valvular distrophy': 1, 'and Congenital Valvular Heart Disease': 1, 'valvular or morphological abnormalities': 1, 'Non-valvular cardiac disease': 1, 'non-syndromic X-linked myxomatous valvular dystrophy': 1, 'valvular and congenital heart pathologies': 1, 'Congenital and acquired valvular disease': 1, 'Cardiac valvular and thoracic aortic calcifications': 1, 'congenital heart valvular disease': 1, 'congenital cardiac valvular malformations': 1, 'Pulmonary valvular dysplasia': 3, 'congenital and acquired valvular heart disease': 1, 'CONGENITAL AND RHEUMATIC VALVULAR HEART DISEASE': 1, 'cardiac valvular or vascular disease': 1, 'myocardial and valvular cardiac diseases and': 1, 'myocardial and cardiac valvular diseases': 1, 'valvular or other cardiac disorders': 1, 'dystrophy valvular': 1, 'cardiac mitral valvular dystrophy': 1, 'Valvular dystrophy': 2, 'valvular, congenital disease': 1, 'cardiac valvular and aortic calcification': 1, 'cardiac valvular calcium': 1, 'CVCS': 2, 'para valvular cardiac leaks': 1, 'cardiac valvular diagnoses': 1, 'Valvular or congenital heart disease': 2, 'congenital and acquired valvular disease': 2, 'valvular cardiac mass': 1, 'atrioventricular (AV) valvular dysplasia': 1, 'congenital or acquired valvular cardiopathies': 1, 'Myxomatous valvular dystrophy': 1, 'valvular congenital anomalies': 1, 'cardiac valvular and pericardial disease': 1, 'Congenital or valvular heart disease': 1, 'cardiac-valvular-cvEDS': 1, 'valvular or obstructive cardiac lesions': 1, 'valvular or congenital malformation': 1, 'cardiac valvular or brain pathology': 1, 'valvular, congenital, or ischemic heart diseases': 1, 'cardiac and valvular fibrosis': 2, 'X-linked myxoid valvular dystrophy': 1, 'Familial Cardiac Valvular Dystrophy': 1, 'valvular or congenital diseases': 1, 'congenital heart, pericardial, valvular heart and pulmonary hypertension diseases': 1, 'cardiac valvular obstruction': 2, 'Non-congenital and valvular heart disease': 1, 'cardiac valvular function': 1, 'valvular and some congenital heart diseases': 1, 'valvular / congenital diseases': 1, 'congenital combined valvular disease': 1, 'cardiac valvular prostheses': 1, 'congenital and adult valvular disease': 1, 'congenital and valvular diseases': 1, 'ischemic, congenital, and valvular heart disease': 1, 'valvular or congenital cardiac anomalies': 1, 'congenital, or valvular heart diseases': 1, 'congenital or acquired valvular abnormalities': 1, 'mitral valvular dysplasia': 1, 'cardiac structural valvular aberrations': 1, 'Congenital Valvular Regurgitation': 1, 'valvular or congenital cardiac diseaseContraindications': 1, 'cardiac valvular perturbations': 1, 'hypertensive congenital and valvular, heart disease': 1, 'congenital cardiac and valvular diseases': 1, 'congenital heart and valvular heart disease': 1, 'valvular and cardiac calcifications': 1, 'congenital, valvular heart disease': 1, 'neurological, ocular, dental, auditory and valvular cardiac corollaries': 1, 'valvular structural or congenital heart disease': 1, 'ventricular deterioration in myocardial, valvular, and congenital heart disease': 1, 'valvular or congenital abnormalities': 1, 'Congenital Valvular Disease': 1, 'congenital and valvular heart disorders': 1, 'Congenital or acquired valvular disease': 1, 'Valvular/congenital heart diseases': 1, 'Valvular cardiac myxoma': 1, 'cardiac valvular prothesis': 1, 'congenital/valvular abnormality': 1, 'valvular or congenital cardiopathy': 1, 'coronary artery, valvular, or congenital heart disease': 1, 'congenital, valvular, or myocardial disease': 1, 'Congenital cardiac and valvular lesions': 1, 'valvular and congenital heart disorders': 1, 'X-linked Cardiac Valvular Dystroph': 1, 'cardiac valvular formation': 1, 'valvular morphological alterations': 1, 'cardiac valvular affectation': 1, 'congenital valvular irregularities': 1, 'Valvular CHD': 1, 'cardiac valvular replacement': 2, 'and valvular morphological alterations': 1, 'ischaemic, valvular, congenital heart disease': 1, 'cardiac-valvular regurgitation': 1, 'ischemic, valvular or congenital or hypertensive heart disease': 1, 'Rheumatic cardiac valvular polystenosis': 1, 'valvular and congenital cardiopathy': 1, 'primary dysplasia of the valvular apparatus': 1, 'valvular or congenital lesion': 2, 'Cardiac valvular residua': 1, 'Cardiac valvular type': 1, 'arterial and cardiac valvular calcification': 1, 'cardiac valvular comorbidities': 1, 'CVDPX': 1, 'cardiac valvular and pulmonary circulatory disease': 1, 'congenital, and valvular heart disease': 1, 'Cardiac valvular stenosis': 1, 'valvular or congenital lesions': 1, 'Myxomatous dystrophy': 1, 'valvular, congenital, coronary or pulmonary vascular disease': 2, 'valvular, congenital and ischaemic heart disease': 1, 'Cardiac valvular masses': 1, 'valvular malformations.2': 1, 'valvular congenital heart diseases': 1, 'valvular cardiac dysfunction': 1, 'valvular, congenital, or pulmonary heart disease': 1, 'valvular to congenital heart disease': 2, 'valvular cardiac condition': 1, 'Cardiac valvular disorders': 1, 'Cardiac Valvular Degeneration': 1, 'pulmonary, coronary artery, valvular, and congenital heart disease': 1, 'valvular and congenital disease of the heart': 1, 'Cardiac valvular and vascular disease': 1, 'extra valvular cardiac damage': 1, 'congenital, ischemic, valvular, cardiomyopathy': 1, 'cardiac valvular disruption': 1, 'valvular and congenital problems': 1, 'Congenital/valvular heart disease': 1, 'ischemic, valvular, or congenital heart diseases': 1, 'cardiac, valvular, and vascular inflammatory disorders': 1, 'Cardiac valvular dystrophy': 1, 'congenital, valvular and ischaemic heart disease': 1, 'valvular or adult congenital heart disease': 1, 'vertebral, and cardiac valvular involvement': 1, 'cardiac ventricular and valvular alterations': 1, 'Multiple Cardiac Valvular Insufficiencies': 1, 'cardiac valvular and vascular disease': 1, 'valvular (13) or congenital (23) heart disease': 1, 'Congenital valvular pulmonary stenosisb': 1, 'cardiac structural and valvular': 1, 'Cardiac valvular disruption': 1, 'valvular and Congenital Heart Disease': 1, 'cardiac, valvular, respiratory, gastrointestinal, and ophthalmic complications': 1, 'Cardiac valvular vegetation': 1, 'pericardial and cardiac valvular involvement': 1, 'valvular morphologic abnormalities': 1, 'congenital, valvular, inflammatory': 1, 'cardiac valvular syndromes': 1, 'valvular, congenital heart disease': 2, 'Cardiac valvular and aortic calcifications': 1, 'congenital, valvular or left heart disease': 1, 'ischemic, valvular, or congenital heart disease': 2, 'Tricuspid valvular dysplasia': 1, 'valvular, congenital, or pericardial heart disease': 1, 'X-Linked Myxomatous Valvular Dystrophy': 1, 'valvular and congenital disease abnormalities': 1, 'cardiac valvular mass': 1, 'congenital, coronary, or valvular heart disease': 1, 'valvular, coronary, or other cardiac diseases': 2, 'cardiac valvular or rhythm disorder': 1, 'cardiac-valvular, vascular,': 1, 'valvular, congenital, and cardiomyopathy disease': 1, 'cardiac VC': 1, 'valvular, cardiac chamber or flow abnormality': 1, 'Coronary artery, valvular and congenital heart disease': 1, 'valvular morphological abnormalities': 1, 'valvular morphological derangement and dysfunction': 1, 'valvular or other cardiac problems': 1, "X-linked 'myxomatous valvular dystrophy": 1}
|
valvular or congenital heart disease
|
Disease
|
MESH:C535577
|
{'Sanchez-Guarnido': 1, 'cardioauditory syndrome': 7, 'cardioauditory or surdocardiac syndrome': 1, 'INECOL': 1, 'Cardioauditory syndrome': 1, 'SL': 2, 'Sanchez-Lengeling': 1, 'cardioauditory disorder': 2, 'cardioauditory': 1, 'recessive cardioauditory disorder': 1, 'CASCO': 1, 'cardioauditory diseases': 1, 'Poa sanchez-vegae': 1, 'Sanchez-Farias': 2, 'Sanchez': 2, 'SLEOS': 1, 'CB': 1, 'Gallego-Sanchez': 1, 'RTS': 1, 'Sanchez-Iglesias': 1}
|
cardioauditory syndrome
|
Disease
|
MESH:C535578
|
{'Singer Duckbill': 1, 'Pfeiffer syndrome type 2': 19, 'Type 2 Pfeiffer syndrome': 2, 'type 2 Pfeiffer syndrome': 4, 'Carnatic singers': 1, 'Carnatic Singers': 1, 'Pfeiffer syndrome, type 2 and 3': 1, 'Pfeiffer syndrome types 1 and 2': 1, "Singer's nodules": 1, "Singer's Nodules": 1, 'PS-2': 1, 'ABS': 1, 'Pfeiffer syndromes types 2 and 3': 1, 'Pfeiffer syndrome types 2 and 3': 3, '2 Pfeiffer': 1, 'types 2 and 3 Pfeiffer syndrome': 1, 'Singer': 2, 'Pfeiffer-type cardiocranial syndrome': 5, 'Pfeiffer syndrome (PS) types 2 and 3': 1, 'PS type 2 and 3': 2, 'PS type 2': 9, 'Cardiocranial syndrome': 1, 'OS': 1, 'Pfeiffer Syndrome Type 2': 2, 'Pfeiffer type cardiocranial syndrome': 2, "SINGER'S ATTITUDE": 1, 'Dysphonic Singers': 1, 'SINGER': 3, 'choir singers': 1, 'Pfeiffer syndrome 2': 1, 'PS types 2 and 3': 2, 'Type A and C singers': 1, 'Type 2 PS': 1, 'Pfeiffer type 2 syndrome': 2, 'Pfeiffer Syndrome type 2': 2, 'Pfeiffer syndrome (PS) type 2': 2, 'PHONIATRIC EXAMINATION OF THE ACTOR AND SINGER': 1, 'Kadison-Singer': 1, 'cardiocranial syndrome': 1, 'Blom-Singer': 2, 'Pfeiffer type 2': 1, 'Pfeiffer types 2 and 3': 2, 'CS': 1, 'REAL SINGER': 1, '2 PS': 1, "singers' nodules": 1, 'FROM SINGER': 1, "Singer's Diseases": 1, 'choral singers': 2, 'Pfeiffer 2': 1, "singer's nodules": 1, 'Type 2 and 3 Pfeiffer syndrome': 1, "singer's nodule": 3, 'PS type 2 or type 3': 1, 'PS (type 2 and 3)': 1, 'Type 2 Pfeiffer Syndrome': 1, 'PS type 2 or 3': 1, 'Pfeiffer syndrome type 2 and 3': 1, 'DOROTHEA WALEY SINGER': 1}
|
Pfeiffer syndrome type 2
|
Disease
|
MESH:C535579
|
{'CFC syndrome': 210, 'cardio-facio-cutaneous (CFC) syndrome': 90, 'cardiofaciocutaneous (CFC) syndrome': 52, 'cardio-facio-cutaneous syndrome': 268, 'Cardio-Facio-Cutaneous syndrome': 10, 'CFC-BC': 1, 'CFC': 449, 'CFCS': 125, 'cardiofaciocutaneous syndrome': 289, 'Cardio-Facio-Cutaneous (CFC) syndrome': 8, 'cardio-facio-cutaneous involvement': 1, 'neuro-cardio-facio-cutaneous syndromes': 15, 'Costello/CFC syndrome': 1, 'Costello, Noonan and cardio-facio-cutaneous (CFC) syndrome': 1, '-CFC': 11, 'A-CFC': 1, 'CFCS syndrome': 3, 'Cranio-facio-cutaneous syndrome': 2, 'Noonan/cardio-facio cutaneous syndrome': 1, 'cardiofaciocutaneous': 35, 'CFC (cardiofaciocutaneous) syndrome': 2, 'Cardiofaciocutaneous syndrome': 130, 'neuro-cardio-facio-cutaneous diseases': 1, 'Cardio-facio-cutaneous syndrome': 110, 'Cardiofaciocutaneous': 12, 'Cardio-Facio-Cutaneous Syndrome': 8, 'facio-brachial movements': 1, "Noonan's and CFC syndrome": 1, 'Noonan and Cardiofaciocutaneous Syndrome': 1, 'Cardiofaciocutaneous (CFC)': 1, 'cardio-facio-cutaneous (': 3, 'Uruguay facio-cardio-musculo-skeletal syndrome': 2, 'CFC disease': 3, 'cardio-facio-cutaneous (CFC) diseases': 1, 'Cardio-facio-cutaneous diseases': 1, 'cardio-facio-cutaneous (CFC) syndromes': 4, 'Cardio-Facio-Cutaneous': 9, 'cardio-facio-cutaneous microdeletion syndrome': 1, 'Cardio-facio-cutaneous syndrome 4': 1, 'naso-facio-orbital cutaneous deficiency': 1, 'facio-brachial': 3, 'Cardio-facio-cutaneous (CFC) syndrome': 46, 'cardiofaciocutaneous syndrome,10': 1, 'Noonan and CFC syndromes': 7, 'Cardio-facio-cutaneous Syndrome': 8, 'Noonan and cardio-facio-cutaneous (CFC) syndromes': 1, 'cardio-facio cutaneous syndrome': 2, 'cardio-facio-cutaneous disorders': 2, 'CFC3 Cardiofaciocutaneous syndrome 3': 1, 'CFC Cardiofaciocutaneous syndrome': 2, 'dn Cardiofaciocutaneous syndrome 1': 1, 'Cardiofaciocutaneous (CFC) syndrome': 25, 'Facio-cutaneous-skeletal syndrome': 2, 'neuro-cardio-facio-cutaneous (NCFC) syndrome': 1, 'NCFC syndrome': 1, 'Noonan, Costello and cardio-facio-cutaneous syndromes': 6, 'autosomal dominant cardio-facio-cutaneous syndrome': 1, 'Cardiofaciocutaneous Syndrome': 27, 'facio-cardio-skeletal defects': 1, 'facio-cardio-skeletal Hadziselimovic type syndrome': 1, 'facio-brachial dystonic movements': 2, 'Noonan, Cardiofaciocutaneous (CFC) syndrome': 1, 'CFCS facies': 1, 'CFC-I': 2, 'CFC-F': 1, 'Cardio-facio-cutaneous and Noonan syndromes': 4, 'Cardio-facio-cutaneous and Costello syndromes': 2, 'cardio-facio-cutaneous and': 2, 'NCFC Syndromes': 1, 'Neuro-cranio-facial cutaneous (NCFC) syndromes': 1, 'NCFC syndromes': 2, 'Neuro-cardio-facio-cutaneous (NCFC) syndromes': 1, 'CFC Syndrome': 3, 'NCFCS': 3, 'Neuro-cardio-facial cutaneous (NCFC) syndromes': 1, 'Costello, Cardio-facio-cutaneous and Noonan Syndromes': 1, 'CFC 3': 1, 'cardio-facio-cutaneous syndrome type 3': 1, 'Rauen CFC syndrome': 1, 'CFC3': 2, 'Cardio-Facio-Cutaneous syndrome 3': 1, 'CFC3 syndrome': 1, 'Cardio-facio-cutaneous syndrome 3': 1, 'Cardio-facio-cutaneous syndrome type 3': 1, 'Cardio-Facio-Cutaneous Syndrome Type 3': 1, 'Costello, cardio-facio-cutaneous syndrome': 1, 'Costello syndrome Cardio-facio-cutaneous syndrome': 1, 'cardio-facio-cutaneous': 19, 'Costello, Noonan, cardio-facio-cutaneous (CFC': 1, 'cardio-facio-cutaneous syndromes': 11, 'cardio-facio-cutaneous-like phenotype': 1, 'CFC-like': 2, 'Neuro-Cardio-Facio-Cutaneous (NCFC) syndromes': 2, 'cardio-facio-cutaneous-like syndrome': 1, 'Cardio-facio-cutaneous': 9, 'cardio-facio-cutaneous syndrome type 3 and 4': 1, 'cardio-facio-cutaneous syndrome 3': 1, 'Costello and cardio-facio-cutaneous syndromes': 7, 'neuro-cardio-facio-cutaneous syndromes group': 1, 'Cardio-Facio-cutaneous syndrome': 1, 'Costelo and Cardiofaciocutaneous syndromes': 1, 'Noonan, Costello or cardio-facio-cutaneous syndromes': 2, 'Noonan, Costello and CFC syndromes': 2, 'Cardiofaciocutaneous (CFC) Syndrome': 1, 'CFC-': 1, 'cardiofaciocutaneous syndromes': 8, 'Noonan, LEOPARD and cardiofaciocutaneous syndromes': 2, 'Costello and CFC Syndromes': 1, 'Costello and Cardio-Facio-Cutaneous Syndromes': 1, 'cardio-facio-cutaneous, Costello, Leopard, and Noonan syndromes': 1, 'M-CFC': 5, 'Costello, Noonan, and CFC syndromes': 1, 'Cardiofaciocutaneous syndrome 1': 2, 'CFC-C': 2, 'Cardiofaciocutaneous Syndrome 3': 1, 'Cardiofaciocutaneous Syndrome 2': 1, 'cardiofaciocutanous syndrome': 2, 'Cardio-Facio-Cutaneous CHS': 1, 'Cardio-Facio-Cutaneous (CFC) Syndrome': 1, 'Facio-lingualfasciculations': 1, 'facio-brachial dystonic seziures': 1, 'cardio-faciocutaneous (CFC) syndrome': 2, 'Facio': 2, 'LPP-CFC': 3, 'Noonan, Cardio-facio-cutaneous, and Costello syndromes': 2, 'inherited CFC syndrome': 1, 'cardio-facio-cutaneous, neurofibromatosis': 1, 'CFC1': 1, 'cardio-facio-cutaneous [CFC] syndrome': 1, 'Noonan and cardiofaciocutaneous syndromes': 3, 'Cardio-Facio-Cutaneus Syndrome': 1, 'Cardio-facio-cutaneous NM_004333.5': 1, 'facio-oral': 1, 'cardiofaciocutaneous and Noonan syndromes': 3, 'ME-CFC': 1, 'CPCFC': 1, 'Noonan or cardio-facio-cutanous (CFC) syndrome': 1, 'CFC-M': 1, 'CFC-E': 1, 'Noonan CFC CFC': 1, 'Noonan or cardio-facio-cutaneous syndromes': 1, 'Cardio-facio-cutaneous and costello syndromes': 1, 'allo-CFC': 1, 'Cardio-facio cutaneous syndrome': 1, 'BDP-CFC': 1, 'Rasopathy cardio-facio-cutaneous (CFC) syndrome': 1, 'L-CFC': 1, 'Noonan, Costello, Leopard, and cardio-facio-cutaneous (CFC) syndromes': 1, 'cranio-facio-cutaneous syndrome': 1, 'Cardiofaciocutaneous syndrome 4': 1, 'CFC (cardio-facio-cutaneous) syndrome': 1, 'facio-cranial defects': 1, 'Cardiofaciocutaneous and LEOPARD Syndromes': 1, 'cardio-facio-cuteneous syndrome': 1, 'Noonan or CFC syndrome': 3, 'Cardio-facio-cutaneous syndorme': 1, 'NCFC': 2, 'neuro-cardio-facio-cutaneous syndrome': 2, 'cardio facio': 1, 'CFC syndromes': 7, 'Costello and CFC syndrome': 2, 'Common Cardiofaciocutaneous Syndrome': 1, 'Cardiofaciocutaneous Syndrome 1': 1, 'Familial cardiofaciocutaneous syndrome': 1, 'Cardio-facio-cutaneous (': 1, 'Noonan, Costello, cardio-facio-cutaneous and autoimmune lymphoproliferative': 1, 'and CFC syndrome': 1, 'cardiofaciocutaneous (CFC': 1, 'CardioFacioCutaneous Syndrome': 1, 'Costello and Cardio-Facio-Cutaneous syndrome': 1, 'cardio-facio-cutaneous cases': 1, 'RASopathy cardio-facio-cutaneous (CFC) syndrome': 1, 'cardio-facio-cutaneous pregnancies': 1, 'cardio-facio-cutaneous and neurofibromatosis-Noonan syndrome': 1, 'CFC-Obs': 1, 'cardiofaciocutaneous (CFC) syndromes': 1, 'Noonan, Costello, and cardio-facio-cutaneous syndromes': 8, 'Noonan/cardio-facio-cutaneous syndrome': 2, 'cardiofaciocutaneous (CFC)-': 1, 'facio-brachial hemianhidrosis': 1, 'Cardiofaciocutaneous syndrome 3': 3, 'Noonan, Leopard, and Cardiofaciocutaneous syndromes': 1, 'facio': 6, 'neuro-cardio-facio-cutaneous disorders': 1, 'Noonan and Cardiofaciocutaneous syndromes': 2, 'CFC-N': 1, 'Cranio-Facio-Cutaneous syndrome': 1, 'Noonan, cardio-facio-cutaneous, and Costello syndromes': 2, 'cardio-facio-cutaneous and Costello syndromes': 2, 'cardio-facio cutaneous (CFC) syndrome': 1, 'congenital cardiofaciocutaneous syndrome 1 (CFC1) disorder': 1, 'and cardiofaciocutaneous (CFC) syndromes': 1, 'cardiofaciocutaneous syndrome 2': 2, 'CFC-syndrome': 1, 'CFC-s': 1, 'CFC-s.': 1, 'facio-cutaneous-skeletal syndromes': 1, 'facio-oral sensory disturbances': 1, 'CFC-iDC': 1, 'Cardiofaciocutaneous 2': 1, 'Cardio-facio-cutaneous (CFC) related syndromes': 1, 'Cardio-facio-cutaneous with': 1, 'Costello and CFC syndromes': 5, 'Cardio-Facio-Cutaneous14,15,18': 1, 'Noonan, cardio-facio-cutaneous, Legius, and Costello syndromes': 1, 'cardio-facio-cutaneous anomalies': 1, 'cardio facio-cutaneous': 1, 'Noonan, cardio-facio-cutaneous': 1, 'Noonan and CFCS syndromes': 1, 'Cardio-facio-cutaneous syndr': 1, 'cardio-facio-cutaneous (CFC': 1, 'inherited cardio-facio-cutaneous syndrome': 1, 'Noonan and cardio-facio-cutaneous syndromes': 3, 'cardiofaciocutaneous features': 1, 'Autosomal dominant Noonan/Cardiofaciocutaneous syndrome': 1, 'Cardo-facio-cutanous': 1, 'Facio-cardio-renal': 1, 'cardiofaciocutaneous syndrome 3': 1, 'CFCS-#115150': 1, 'Costello and CFC-syndrome': 1, 'developmental disorder cardio-facio-cutaneous (CFC) syndrome': 1, 'CFC of the liver': 1, 'hepatic CFC': 1, "Noonan's and cardiofaciocutaneous syndromes": 1, 'Noonan and CFC Syndromes': 1, 'Ma-CFC': 2, 'Noonan, cardio-facio-cutaneous and Costello syndromes': 4, 'Noonan and Cardio-Facio-Cutaneous syndromes': 1, 'facio-cutaneous malformations': 1, 'BL-CFC': 1, 'Familial cardio-facio-cutaneous syndrome': 1, 'AML-CFC': 1, 'CFC of the gallbladder': 2, 'CFC syndrome;18': 1, 'neuro-cardio-facio-cutaneous conditions': 1, 'NCFCs': 2, 'Noonan-CFC': 1, 'cardiofaciocutaneous Syndrome': 1, 'Noonan and cardio-facio-cutaneous (CFC) syndrome': 2, 'FACIO-CUTANEOUS': 1, 'Noonan, Cardio-Facio-Cutaneous or Costello syndromes': 1, 'neuro-cardio-facio-cutaneous developmental syndrome': 2, 'E-CFC': 1, 'De novo Cardiofaciocutaneous syndromeAD': 1, 'cardi-facio-cutaneous syndrome': 1, 'Cranio-facio-cutaneous (CFC) syndrome': 1, 'LEOPARD/Noonan/CFC syndromes': 1, 'Cardio-facio-cutaneous syndrome syndrome 1': 1, 'Neuro-cardio-facio-cutaneous syndromes': 1, 'Noonan and CFC syndrome': 5, 'CFC)': 1, 'Costello or cardio-facio-cutaneous syndrome': 1, 'cardiofaciocutaneous syndrome type 3': 1, 'Cardio-facio-cutaneous 3 Neurofibromatosis Type-1': 1, 'Noonan, Costello, Leopard and cardio-facio-cutaneous (CFC) syndromes': 1, 'VSD Cardio-facio-cutaneous (CFC) syndrome': 1, 'epileptic CFC': 1, 'cardiofaciocutaneous disorders': 1, 'Cardio-Facio-Cutaneous and Neurofibromatosis - type 1': 1, 'Cardiofaciocutaneous sy': 1, 'CR-CFC': 1, 'Cardiofaciocutaneous Syndrome Type 3': 1, 'cardio-facio-cutaneous phenotypes': 1, 'Costello, Noonan, and cardio-facio-cutaneous syndrome': 1, 'cardio facio cutaneous (CFC) syndrome': 1, 'facio-brachio-cruralplegia': 1, 'cardio-facio-cutaneous, Noonan, Costello and LEOPARD syndromes': 1, 'CFC2': 1, 'BK-CFC': 1, 'Legius, Costello, Noonan, and CFC syndrome': 1, 'CFC-1': 1, 'Facio-cardio-renal syndrome': 1, 'CFC1 syndrome': 1, 'neuro-cardio-facio-cutaneous features': 2, 'facio-cutaneous-skeletal involvement': 2, 'facio-cutaneous-skeletal (FCS) syndrome': 1, 'Cardio-Facio-Cutaneous (CFC) syndromes': 1, 'CFC-11': 1, 'RASopathy cardiofaciocutaneous (CFC) syndrome': 1, 'cardio-facio-cutaneous-syndromes': 1, 'facio-scapuloperoneo-': 1, 'CFC-L': 1, 'Noonan, CFC': 2, 'Costello, cardio-facio-cutaneous': 1, 'NCFC) syndromes': 1, 'neuro-cardio-facio-cutaneous': 2, 'Neuro-Cardio-Facio-Cutaneous syndromes': 1, 'RASopathy Cardio-facio-cutaneous (CFC) syndrome': 1, 'cardio-facio-cutaneous (CFC)': 1, 'neuro-cardio-facio-cutaneous (NCFC) syndromes': 1, 'CFC-disease': 1, 'cardio-facio-cutane': 1, 'syndrome cardio-facio-cutane': 1, 'facio-brachial hypaesthesia': 1, 'Cardiofaciocutaneous syndrome 2': 1, 'CFC-MAC': 1, 'NS-CFCS': 1, 'Noonan and Cardio-facio-cutaneous (CFC) syndromes': 1, 'cardio-facio-cutaneous and Legius syndromes': 1, 'Cardio-facio- cutaneous': 1, 'facio-': 1, 'Cardio-Facio-Cutaneous (CFC) diseases': 1, 'Cardio-facio-cutanoeus syndrome': 1, 'Costello, cardio-facio-cutaneous, and Noonan syndromes': 1, 'facio-cerebral deformities': 1, 'Costello versus cardio-facio-cutaneous syndrome': 1, 'multisystemic syndrome of CFC': 1, 'CFCS type 3': 2, 'CFC-Syndrome': 1, 'facio-cutaneous-skeletal syndrome': 1, 'neuro-cardio-facio-cutaneous congenital disorders': 1, 'CFC - Cardia-facio-cutaneous': 1, 'Noonan and cardiofaciocutaneous (CFC) syndromes': 1, 'Costello and cardio-facio-cutaneous (CFC) syndromes': 2, 'gallbladder CFC': 1, 'CFCS IV': 1, 'Costello, and cardio-facio-cutaneous syndromes': 1, 'Noonan, Costello, and cardio-facio-cutaneous syndrome': 1, 'Costello, Noonan, and cardio-facio-cutaneous syndromes': 1, 'Cardio facio cutaneous syndrome': 1, 'HPP-CFC': 1, 'Cardiofaciocutaneous Syndrome 4': 1, 'cardio-facio-cutaneous syndrome;CS': 1, 'Costello, Noonan or cardio-facio-cutaneous syndrome': 1, 'Costello, and CFC syndromes': 1, 'Noonan, Costello, and CFC syndromes': 1, 'CFC-14': 1, 'Noonan, Costello and Cardio-facio-cutaneous syndromes': 1, 'cardio-facio-cutaneous and Noonan syndromes': 1, 'Costello, cardio-facio-cutaneous (': 1, 'Costello, cardio-facio-cutaneous, and Legius syndromes': 1, 'cardiofaciocutaneous syndrome 1': 1, 'Facio-frontal fractures': 1, 'Noonan and Cardiofaciocutaneous syndrome': 1, 'cardiofaciocutaneous and Noonan syndrome': 1, 'cardiofaciocutaneous [CFC] syndrome': 1, 'Noonan or CFC -syndrome': 1, 'Costello or CFC syndromes': 1}
|
CFC
|
Disease
|
MESH:C535581
|
{'Carvajal syndrome': 194, 'Naxos and Carvajal syndromes': 11, 'Carvajal': 4, 'Carvajal-like': 2, 'ACM Carvajal syndrome': 1, 'Dilated left ventricular cardiomyopathyStriate palmoplantar keratoderma': 1, 'Carvajal Syndrome': 19, 'Carvajal-Huerta syndrome': 7, 'Naxos or Carvajal syndromes': 2, 'Carvajal-syndrome': 1, 'CS': 4, 'Carvajal syd': 1, 'Woolly hair and keratoderma Carvajal syndrome': 1, 'Carvajal-like syndrome': 2, 'CS triad': 1, 'carvajal disease': 1, 'Carvajal disease': 16, 'Naxos-Carvajal syndrome': 5, 'Naxos/Carvajal syndrome': 2, 'Naxos-Carvajal syndromes': 1, 'Heart Genetic Carvajal Syndrome': 1, 'Naxos and Carvajal': 2, 'Naxos and Carvajal syndrome': 3, 'cardiocutaneous syndromes of Naxos and Carvajal': 1, 'Carvajal and erythrokeratodermia cardiomyopathy syndromes': 2, 'Carvajal/Naxos syndrome': 7, 'NAXOS-Carvajal': 1, 'NAXOS-Carvajal Syndrome': 1, 'NAXOS-Carvajal syndrome': 1, 'Carvajal syndromes': 1, 'CWH': 2, 'Carvajal and Naxos syndromes': 2, 'autosomal dominant Carvajal syndrome': 1, 'Autosomal Dominant Carvajal Syndrome': 1, 'carvajal syndrome': 1, 'Carvajal phenotype of cardiocutaneous syndrome': 1, 'Carvajal syndrome AR': 1, 'Naxos or Carvajal syndrome': 2, 'CARVAJAL syndrome': 1, 'Gastrotheca elicioi Carvajal-Endara': 1, 'Carvajal plus syndrome': 1, 'Carvajal-phenotype': 1, 'Carvajal Disease': 1, 'DCWHK': 2, 'Carvajal Syndrome- A': 1, 'Carvajal/Naxos-like syndromes': 1, 'Carvajal/Naxos-like syndrome': 1, 'cardiocutaneous Carvajal syndrome': 1, 'CHS': 2, 'Carvajal-Heurta syndrome': 1, 'Carvajal - cardiomyopathy': 1, 'Naxos and Carvajal-Huerta syndromes': 1, 'DCWHKTA': 1, 'Naxos and Carvajal-Huerta Syndromes': 1, 'Carvajal-Huerta Syndromes': 1, 'Carvajal-Huerta Syndrome': 1, 'Naxos or Carvajal-Huerta Syndromes': 1, 'Carvajal syndrome AD': 1, 'Carvajal syndrome with hypo/oligodontia': 1, 'Dilated, with Woolly Hair': 1, 'Dilated cardiomyopathy with woolly hair and keratoderma': 1, 'CS syndrome': 1, 'familial Carvajal syndrome': 1, "Carvajal's syndrome": 1, 'Nethertons, and Carvajal syndromes': 1, 'Naxos-Carvajal': 1, 'autosomal recessive cardiocutaneous Naxos and Carvajal syndromes': 1}
|
Carvajal syndrome
|
Disease
|
MESH:C535584
|
{'xanthomatous or fibrous lesions': 1, 'oncocytic biliary tumors': 1, 'foamy virus': 96, 'oncocytic, medullary': 1, 'oncocytic chromophobe tumor': 13, 'oncocytic lesions': 126, 'Melanotic oncocytic': 2, 'oncocytic': 247, 'melanotic oncocytic metaplasia': 7, 'Melanotic Oncocytic Metaplasia': 2, 'Melanotic oncocytic metaplasia': 5, 'Oncocytic': 75, 'melanotic oncocytic': 1, 'histiocytoid cardiomyopathy': 71, 'oncocytic adenomas': 83, 'oncocytic carcinoma': 279, 'oncocytic tumor': 161, 'oncocytic hyperplasia': 26, '(oncocytic': 1, 'HOCT': 45, 'Oncocytic carcinoma': 87, 'oncocytic neoplasm': 111, 'Oncocytic carcinoid of lung': 1, 'oncocytic of the lung': 1, 'oncocytic tumour': 25, 'oncocytic adenoma': 90, 'oncocytic neoplasms': 172, 'Oncocytic neoplasms': 45, 'adrenocortical oncocytic neoplasms': 11, 'Oncocytic salivary duct neoplasm': 1, 'Hybrid oncocytic chromophobe tumor': 4, 'hybrid oncocytic chromophobe tumor': 2, 'oncocytic tumors': 305, 'Hybrid oncocytic/chromophobe tumor': 8, 'atrium Histiocytoid cardiomyopathy SCA': 1, 'Histiocytoid cardiomyopathy': 47, 'oncocytic cardiomyopathy': 14, 'oncocytic pituicytoma': 6, 'Oncocytic neoplasm': 1, 'Oncocytic neoplasm': 10, 'oncocytic tumours': 47, 'oncocytic cysts': 28, 'Oncocytic cysts': 8, 'Oncocytic lesions': 14, 'Oncocytic metaplasia': 14, 'Oncocytic follicular carcinomas': 1, 'oncocytic medullary carcinoma': 1, 'Oncocytic adenomas': 11, 'oncocytic follicular neoplasm': 7, 'foamy': 57, 'oncocytic FTC': 2, 'thyroid oncocytic tumors': 25, 'oncocytic carcinomas': 97, 'HOCTs': 15, 'hybrid oncocytic/chromophobe tumors': 24, '5-Adrenal Oncocytic Pheochromocytoma': 1, 'Adrenal oncocytic pheochromocytoma': 3, 'Oncocytic pheochromocytoma': 2, 'oncocytic cell tumors': 10, 'hybrid-oncocytic renal tumors': 1, 'foamy degeneration': 4, 'OANs': 5, 'Oncocytic adrenocortical neoplasm': 7, 'Oncocytic adrenocortical neoplasms': 11, 'oncocytic cell tumor': 2, 'oncocytic cyst': 14, 'adrenocortical oncocytic tumors': 4, 'lipid cardiomyopathy': 4, 'benign oncocytic lesion': 4, 'benign oncocytic lesions': 5, 'hybrid-oncocytic tumors': 1, 'oncocytic (renal) tumors': 1, 'hybrid oncocytic tumors': 15, 'oncocytic adenomatoid hyperplasia': 1, 'chromophobe/oncocytic tumors': 1, 'OA': 7, 'OA with': 1, "OA's": 1, 'FVs': 19, 'foamy viruses': 50, 'Oncocytic tumors': 51, 'apocrine (oncocytic) carcinoma': 1, 'oncocytic gonadotroph macroadenoma': 1, 'oncocytic thyroid carcinoma': 42, 'Oncocytic Thyroid Carcinoma': 3, 'oncocytic sinonasal papillomas': 6, 'oncocytic sinonasal papilloma': 10, 'oncocytic hybrid tumors': 5, 'syndromic oncocytic tumours': 1, 'syndromic oncocytic tumorigenesis': 2, 'oncocytic renal tumors': 43, 'oncocytic-chromophobe tumor': 3, 'oncocytoma': 6, 'androgen-secreting adrenal oncocytoma': 1, 'oncocytic metaplasia': 17, 'oncocytic-chromophobe tumors': 3, 'oncocytic renal masses': 4, 'oncocytic Schneiderian papilloma': 13, 'oncocytic Schneiderian tumour': 1, 'Oncocytic Schneiderian Papilloma': 3, 'OP of the sphenoid sinus': 1, 'OP': 6, 'Oncocytic Schneiderian papilloma': 9, 'oncocytic Papilloma': 1, 'oncocytic papilloma of the sphenoid sinus': 1, 'OSP': 16, 'oncocytic proliferation': 2, 'oncocytic thyroid tumor': 8, 'oncocytic thyroid tumors': 45, 'oncocytic tumors of the thyroid gland': 3, 'Oncocytic tumors of the thyroid': 4, 'oncocytic-hydrid tumor': 1, 'oncocytic hydrid renal tumors': 1, 'oncocytic hybrid tumor': 4, 'oncocytic schneiderian papilloma': 8, 'Foamy and Touton giant': 1, 'oncocytic/chromophobe tumor': 12, 'Oncocytic renal tumors': 2, 'oncocytic paraganglioma of the cauda equina': 1, 'Oncocytic paraganglioma of the cauda equina': 1, 'oncocytic paraganglioma': 5, 'oncocytic papilloma': 32, 'Spuma (foamy) viruses': 1, 'laryngeal cystic oncocytic hyperplasia': 1, 'oncocytic papillary cystadenomatosis': 1, 'oncocytic adenomatous hyperplasia': 8, 'oncocytic cysts of the vocal cords': 1, 'oncocytic cystadenoma': 19, 'oncocytic or': 2, 'non-oncocytic thyroid tumors': 1, 'Thyroid Oncocytic Tumors': 1, 'Non-oncocytic follicular carcinoma': 1, 'non-oncocytic tumors': 14, '-oncocytic tumor': 1, 'oncocytic/chromophobe tumours': 3, 'oncocytic lesion': 30, 'oncocytic adrenocortical neoplasm': 13, 'Oncocytic cardiomyopathy': 6, 'intraductal oncocytic neoplasm': 2, 'Oncocytic adenoma': 17, 'oncocytic follicular carcinoma': 15, 'Oncocytic follicular carcinoma': 3, 'Oncocytic Variant': 3, 'Oncocytic biliary cystadenocarcinoma': 2, 'oncocytic MECs': 3, 'oncocytic renal tumor': 24, 'oncocytic adrenocortical tumors': 13, 'oncocytic sialolipoma': 7, 'FM': 1, 'Hybrid Oncocytic/Chromophobe Tumors': 2, 'oncocyte-rich neoplasms': 1, 'foamy gland carcinoma': 18, 'ONCOCYTIC ADENOMATOUS HYPERPLASIA OF': 1, 'oncocytic or myoepithelial carcinoma': 1, 'Foamy virus': 6, 'PFV': 10, 'Prototype foamy virus': 3, 'oncocytic or oxyphillic carcinoma': 1, 'OCA': 6, 'Oncocytic carcinoma of the lacrimal gland': 1, 'xanthomatous alterations': 2, 'Oncocytic Schneiderian papillomas': 6, 'Oncocytic Schneiderian Papillomas': 1, 'oncocytic Schneiderian papillomas': 3, 'sinonasal oncocytic tumors': 1, '-Grade Oncocytic Tumor': 2, 'oncocytic chromophobe tumors': 7, 'Oncocytic 2': 3, 'oncocytic carcinoma of the thyroid': 13, 'NIFV': 1, 'oncocytic cell carcinoma': 9, 'oncocytic cell carcinomas': 4, 'oncocytic neoplasms in salivary': 1, 'renal oncocytic tumors': 13, 'oncocytic masses': 3, 'Foamy': 13, 'Foamy Viruses': 2, 'Foamy Virus': 16, 'FV': 21, 'Oncocytic carcinoid of the nasal cavity': 1, 'oncocytic carcinoid of the nasal cavity': 1, 'oncocytic carcinoids': 3, 'oncocytic carcinoid': 10, 'oncocytic/': 5, 'oncocytic intraductal neoplasms': 1, 'OTC': 15, 'oncocytic and lymphoepithelioma-like carcinomas': 1, 'oncocytic papillary neoplasms': 5, 'eosinophilic or oncocytic': 1, 'ELECTRON MICROSCOPIC STUDIES ON ONCOCYTES OF': 1, 'Oncocytic schneiderian papilloma': 5, 'oncocytic tumors of the thyroid': 5, 'Oncocytic bronchial adenoma': 1, 'hybrid oncocytic-chromophobe tumors': 2, 'oncocytic or benign tumors': 1, 'benign or oncocytic tumors': 1, 'oncocytic/ch lesions': 1, 'OFN': 2, 'oncocytic lipoadenoma': 20, 'oncocytic proliferative lesions': 1, 'Oncocytic meningioma': 9, 'oncocytic papillary': 2, 'Bet-deficient FFV': 1, 'WT': 1, 'benign xanthomatous disease': 1, 'laryngeal oncocytic lesions': 2, 'hybrid oncocytic renal tumors': 1, 'hybrid oncocytic tumours': 3, 'hybrid oncocytic tumor': 14, 'sinonasal oncocytic papilloma': 6, 'SOP': 3, 'SOP lesions': 1, 'Oncocytic adrenocortical tumour': 1, 'oncocytic adrenocortical tumour': 2, 'multiple oncocytic cystadenoma': 1, 'Oncocytic Cystadenoma': 2, 'Multiple oncocytic cystadenoma': 1, 'Oncocytic cystadenoma': 10, 'oncocytic thyroid carcinomas': 22, 'salivary oncocytic lesions': 2, 'adenomatous oncocytic hyperplasia': 9, 'Oncocytic lesions of the': 2, 'benign oncocytic salivary lesions': 1, 'Multifocal oncocytic lesions': 1, 'Oncocytic Carcinoma': 9, 'adrenal oncocytoma': 4, 'heterotopic adrenal oncocytoma': 1, 'adrenal oncocytic carcinomas': 2, 'Oncocytic and gastric-type IPNB': 1, 'Foamy sputum': 1, 'oncocytic lesions of the thyroid gland': 2, 'thyroid oncocytic lesions': 1, 'renal oncocytic lesions': 4, 'thyroid oncocytic transformation': 1, 'oncocytic adrenocortical neoplasms': 13, 'oncocytic/chromophobe tumors': 19, 'pancreato-biliary and oncocytic type neoplasms': 1, 'Oncocytic and oncocytoid tumors': 3, 'Oncocytic lipoadenoma': 9, 'OV': 2, 'Oncocytic variant': 3, 'oncocytic variant': 1, 'MAOH': 1, 'multifocal adenomatous oncocytic hyperplasia': 1, 'Multifocal Adenomatous Oncocytic Hyperplasia': 1, 'Multifocal adenomatous oncocytic hyperplasia': 1, 'follicular and oncocytic carcinomas': 3, 'oncocytic thyroid lesions': 12, 'Oncocytic change in the thyroid': 1, 'Oncocytic Variant of': 3, 'Polygonal oncocytic tumor': 1, 'Oncocytic tumor': 12, 'oncocytic variant of': 1, 'Oncocytic carcinoma 6': 1, 'Aggressive oncocytic neuroendocrine tumour': 1, 'oncocytic neuroendocrine tumour': 1, 'oncocytic hybrid': 4, 'oncocytic and non-oncocytic carcinomas': 1, 'MOM': 2, 'oncocytic type neoplasms': 1, 'cellular oncocytic/oncocytoid neoplasm': 1, 'thyroid oncocytic': 10, 'thyroid oncocytic carcinomas': 2, 'conventional and oncocytic carcinomas': 1, 'thyroid oncocytic carcinoma': 7, 'Thyroid oncocytic tumors': 5, 'oncocytic and sarcomatous neoplastic': 1, 'foamy lesions': 1, 'adrenal oncocytic adenoma': 2, 'oncocytic and chromophobe tumour': 1, 'Oncocytic adenoma-like hyperplasia': 1, 'oncocytic renal mass': 1, 'oncocytic chromophobe tumour': 2, 'hybrid oncocytic chromophobe tumours': 3, 'oncocytic neoplastic': 3, 'follicular or oncocytic neoplasms': 1, 'oncocytic papillomas': 17, 'Oncocytic Papilloma': 2, 'Oncocytic papilloma': 8, 'Adrenocortical oncocytic neoplasms': 13, 'AONs': 4, 'Adrenocortical Oncocytic Neoplasm': 2, 'adrenocortical oncocytic tumours': 3, 'Foamy viruses': 5, 'BOL': 1, 'benign oncocytic/Hurthle lesions': 1, 'OCC': 2, 'thyroid oncocytic tumor': 3, 'oncocytic type tumors': 2, 'Pure oncocytic neoplasms': 1, 'oncocytic meningiomas': 3, 'Oncocytic meningiomas': 3, 'Oncocytic (Hurthle)': 1, 'follicular or oncocytic neoplasm': 8, 'FTC oncocytic type': 1, 'monomorphic oncocytic neoplasms': 1, 'monocytic oncocytic neoplasms': 1, 'Pleomorphic oncocytic neoplasms': 1, 'benign oncocytic renal tumors': 2, 'benign oncocytic tumor': 2, 'OAs': 2, 'OFC': 2, 'thyroid oncocytic cell tumors': 4, 'Oncocytic,': 1, 'sporadic infantile histiocytoid cardiomyopathy': 1, 'Oncocytic Tumors': 8, 'benign oncocytic tumors': 5, 'II.3 oncocytic adenoma': 1, 'I.2 oncocytic adenoma': 1, 'Familial Oncocytic Parathyroid Tumors': 1, 'familial oncocytic tumors': 2, 'oncocytic-type neoplasms': 1, 'oncocytic IPMN': 5, 'and oncocytic': 4, 'benign oncocytic carcinomas': 1, 'follicular or oncocytic tumour': 1, 'OAN': 4, 'oncocytic ACCs': 6, 'myxoid and oncocytic adrenocortical tumors': 1, 'renal oncocytic adenoma': 4, 'Oncocytic FTC': 1, 'oncocytic and FTC': 1, 'multiple oncocytic lesions': 1, 'oncocytic adrenal carcinoma': 4, 'adrenal nonfunctioning oncocytic carcinoma': 1, 'oncocytic poorly differentiated carcinoma': 2, 'oncocytic poorly differentiated thyroid carcinoma': 5, 'oncocytic follicular cell-derived neoplasms': 3, 'Oncocytic carcinoma of the thyroid': 5, 'Oncocytic carcinoid of the lung': 5, 'oncocytic thyroid': 4, 'HcCM': 1, 'oncocytic (Bethesda IV)': 1, 'Oncocytic carcinoma in a': 1, 'oncocytic pituicytomas': 2, 'foamy virus (': 3, 'sporadic HOCT': 4, 'hybrid oncocytic/chromophobe tumor': 17, 'papillary oncocytic neoplasm': 1, 'Oncocytic carcinomas': 24, 'Papillary Oncocytic Neoplasm': 1, 'Encapsulated papillary oncocytic neoplasm': 1, 'EPON': 2, 'oncocytic chromophobe': 1, 'Hybrid Oncocytic/Chromophobe Tumor': 2, 'oncocytic-type IPNB': 2, 'Oncocytic-type IPNB': 2, 'gastric- and oncocytic-type tumors': 1, 'oncocytic follicular carcinomas': 14, 'OC': 23, 'Hybrid oncocytic/chromophobe tumors': 4, 'SHOCT': 1, 'Oncocytic NI-EFVPTCs': 1, 'retroperitoneal oncocytoma': 1, 'oncocytic adrenal lesions': 2, 'Oncocytoma': 1, 'oncocytic lesions within': 1, 'Oncocytic AAC': 1, 'Metastatic oncocytic carcinoma of the thyroid': 1, 'metastatic oncocytic carcinomas to': 1, 'Oncocytic oncocytic carcinoma': 1, 'primary oncocytic carcinoma': 1, 'oncocytic adenomas and carcinomas': 1, 'Histiocytoid (oncocytic) cardiomyopathy': 2, 'Histiocytoid Cardiomyopathy': 5, 'HICMP': 3, 'Hybrid oncocytic/chromophobe tumour': 3, 'hybrid oncocytic/chromophobe tumour': 5, 'Oncocytic ACCs': 1, 'Adrenocortical oncocytic tumours': 1, 'adrenocortical oncocytic tumour': 2, 'Chromophobe-oncocytic hybrid tumor': 1, 'adrenal oncocytic lesions': 1, 'Oncocytic Myxoid': 1, 'oncocytic laryngeal cysts': 2, 'laryngeal oncocytic cysts': 3, 'Oncocytic laryngeal cysts': 1, 'oncocytic IDCs': 1, 'adrenal oncocytic carcinoma': 8, '54 - Follicular 4 - Oncocytic 3 - Tall cell 1': 1, 'HiCM histiocytoid cardiomyopathy': 1, 'oncocytic follicular tumors': 6, 'oncocytic differentiated carcinoma': 1, 'Oncolytic Foamy Virus': 1, 'Oncocytic carcinoma': 1, 'Oncocytic adrenocortical tumours': 2, 'oncocytic adrenocortical tumours': 2, 'OATs': 1, 'benign oncocytic adenomas': 1, 'hybrid oncocytic tumour': 2, 'oncocytic neoplasma': 1, 'oncocytic nodules': 6, 'Oncocytic Nodules': 1, 'O-FN': 1, 'invasive oncocytic carcinoma': 2, 'non-oncocytic sialolipoma': 2, 'HC': 3, 'salivary oncocytic tumors': 2, 'Oncocytic thyroid': 1, 'Oncocytic thyroid tumors': 3, 'Foamy cell syndrome': 1, 'hybrid oncocytic chromophobe tumors': 3, 'Renal Oncocytic Tumors': 3, 'renal oncocytic tumor': 3, '-oncocytic': 2, 'oncocytic FA': 1, 'oncocytic and chromophobe tumours': 1, 'cylindrical/oncocytic papillomas': 1, 'oncocytic ductal cyst of hypopharynx': 1, 'Chromophobic and oncocytic tumors': 1, 'Oncocytic microadenomas': 1, '-like oncocytic carcinoid of lung': 1, 'oncocytic pancreaticobiliary neoplasm': 1, 'oncocytic salivary tumour': 1, 'nasopharyngeal oncocytic cysts': 1, 'Oncocytic Cysts of the': 1, 'Oncocytic Cysts': 1, 'Melanocytic oncocytic metaplasia': 1, 'oncocytic cysts of the': 1, 'Laryngeal oncocytic cystadenomas': 3, 'Laryngeal oncocytic cystadenoma': 2, 'Histiocytoid nodule - oncocytic cardiomyopathy - Purkinje cell tumour': 1, 'Oncocytic tumours': 6, 'oncocytic thyroid neoplasms': 1, 'tubular or oncocytic carcinomas': 1, 'Gastric Pancreatobiliary Oncocytic': 1, 'Oncocytic IPNB': 1, '1 oIPNBs': 1, 'oIPNBs': 1, 'Infantile histiocytoid cardiomyopathy': 3, 'OvFC oncocytic variant of follicular carcinoma': 1, 'oncocytic variant of follicular carcinoma': 2, 'OvFC': 1, 'Oncocytic carcinoma arising': 2, 'oncocyte (': 1, 'Oncocytic tumors of the thyroid gland': 1, 'oncocytic transformation': 4, 'foamy oil': 1, 'Foamy virus (': 2, 'Oncocytic cell tumors of the thyroid': 1, 'OCTs': 2, 'oncocytic lesions of the thyroid': 7, 'oncocytic schneiderian papillomas': 2, 'oncocytic/oxyphilic tumors': 1, 'OTA': 1, 'oncocytic glandular metaplasia': 1, 'OGM': 1, 'Oncocytic ependymoma': 1, 'oncocytic malignancies': 2, 'oncocytic meningioma': 9, 'oncocytic ependymoma': 1, 'oncocytic adrenal tumors': 4, 'renal oncocytes': 2, 'oncocytic or oxyphilic malignancy': 1, 'oncocytic cystadenomas': 2, 'laryngeal oncocytic cystadenomas': 1, 'Thyroid Oncocytic': 1, 'Thyroid oncocytic carcinoma': 3, 'Oncocytic Renal Tumors': 1, 'hypertrophic or histiocytoid cardiomyopathy': 2, 'non-oncocytic follicular carcinomas': 3, 'Oncocytic MECs': 1, 'oncocytic thyroid cell tumors': 1, 'Oncocytic Thyroid Tumors': 3, 'malignant oncocytic thyroid tumors': 2, 'conventional, non-oncocytic carcinomas': 1, 'oncocytic thyroid tumor malignancy': 1, 'Oncocytic cell tumors': 2, 'malignant oncocytic lesion': 1, 'oncocytic cell tumours': 1, 'non-oncocytic cell tumors': 1, 'oncocytic mesothelioma': 1, 'Oncocytic cyst': 4, 'OPs': 1, 'gland OC': 1, 'submandibular OC': 1, 'OC tumors': 1, 'Submandibular oncocytic carcinoma': 1, 'oncocytic subtype carcinomas': 1, 'OC of the': 1, 'OC tumor': 1, 'Hybrid oncocytic tumor': 3, 'DF': 1, 'oncocytic proliferative lesion': 1, 'sebaceous, and oncocytic carcinomas': 1, 'oncocytic-chromophobe spectrum tumours': 1, 'oxyphil/oncocytic lesions': 1, 'HC lesions': 1, 'infantile xanthomatous cardiomyopathy': 1, 'Oncocytic tumours of the lacrimal sac': 1, 'Adenomatous oncocytic hyperplasia': 1, 'Oncocytic lesions of the caruncle': 1, 'EPONs': 1, 'Encapsulated papillary oncocytic neoplasms': 1, 'oncocytic carcinoma lesions': 1, 'hypertrophic and oncocytic cardiomyopathy': 1, 'adrenal oncocytic tumors': 3, 'Prototype Foamy Virus': 2, 'foamy retroviruses': 2, 'thyroid and renal oncocytic tumors': 1, 'renal and 12 thyroid oncocytic tumors': 1, 'Histiocytoid/oncocytic cardiomyopathy': 1, 'HCM': 1, 'oncocytic transformation of': 1, 'OSP tumor': 1, 'OC oncocytic carcinoma': 3, 'Oncocytic lesions of the eye': 1, 'oncocytic tumorigenesis': 3, 'OC of the thyroid and kidney': 1, 'laryngeal oncocytic cystadenoma': 3, 'LIQUID FOAMY FILTERS': 1, 'oncocytic renal carcinomas': 3, 'Neoplastic oncocytic foci': 1, 'Oncocytic variant of': 1, 'oncocytic lesions of thyroid gland': 1, 'cylindrical (oncocytic) sinonasal papillomas': 1, 'OCT': 3, 'ONCOCYTIC': 2, 'Renal oncocytes': 1, 'oncocytes': 2, 'Oncocytic Papillary Neoplasms': 4, 'Laryngeal oncocytic cysts': 1, 'Laryngeal Oncocytic Cystadenoma': 1, 'oncocytic necrosis': 1, 'oncocytic cell lesions': 3, 'oncocytic renal tubular adenoma': 1, 'Oncocytic renal tubular adenoma': 1, 'follicular and oncocytic tumours': 2, 'oncocytic cell': 1, 'OC in': 1, 'primary OC': 1, 'oncocytic cortical carcinoma': 1, 'Sinonasal oncocytic papilloma': 2, 'oncocytic papillary RCCs': 1, 'Oncocytic FTA': 1, 'Oncocytic carcinoma of the ocular adnexa': 1, 'non-oncocytic RCCs': 1, 'non-oncocytic renal tumors': 1, 'syndromic oncocytic tumors': 1, 'oncocyte tumors': 1, 'and oncocytic (': 1, 'Oncocytic adrenocortical tumors': 4, 'oncocytic carcinoma of the kidney': 1, 'Oncocytic thyroid carcinomas': 5, 'oncocytic/chromphobe tumors': 1, 'non-oncocytic tumor': 3, 'Oncocyt': 2, 'follicular/oncocytic neoplasm': 1, 'foamy sputum': 1, 'oncocytic Schneiderian NOS papilloma': 1, 'Oncocytic Tumor': 6, 'Oncocytic Adreno Cortical Tumors': 1, 'Oncocytic Metaplasia': 2, 'oncocytic adrenal tumor': 2, 'oncocytic papillary pattern': 1, 'follicular oncocytic neoplasms': 1, 'follicular oncocytic carcinoma': 3, 'Oncocytic sialolipoma': 3, 'OACTs': 2, 'Oncocytic tumors in the liver': 1, 'adrenocortical oncocytic neoplasm': 11, 'ACONs': 2, 'oncocytic atypia': 2, 'oncocytic-like neoplasms': 1, 'pancreato-biliary oncocytic neoplasms': 1, 'oncocytic carcinoid of the thymus': 1, 'Sporadic HOCT': 2, 'oncocytic lesion FNHCT': 1, 'oncocytic melanocytic tumors': 1, 'cutaneous oncocytic metaplasia': 1, 'follicular (or oncocytic) neoplasm': 1, 'Follicular (or oncocytic) neoplasm': 1, 'hybrid oncocytic-chromophobe tumour': 1, 'oncocytic unclassified tumour': 1, 'Oncocytic unclassified tumour': 1, 'benign renal oncocytic tumors': 1, 'Oncocytic follicular FTC': 1, 'Oncocytic thyroid carcinoma': 6, 'Prototypic foamy virus': 4, 'Oncocytic Lipoadenoma': 2, 'OL': 1, 'oncocytic and myxoid cortical lesions': 1, 'Submandibular Oncocytic Carcinoma': 1, 'Oncocytic sinonasal papillomas': 1, 'OSPs': 2, 'malignant oncocytic tumors': 3, 'oncocytic tumors in the lacrimal gland': 1, 'oncocytic-, and duct Bellini-type tumors': 1, 'oncocytic and non-oncocytic adenomas': 1, 'Malignant oncocytic tumors': 1, 'malignant oncocytic adrenocortical tumors': 2, 'AO': 1, 'AOCs': 1, 'oncocytic left adrenal mass': 1, 'ONs': 2, 'AOC': 2, 'oncocytic neoplasm of uncertain': 1, 'laryngeal oncocytic cyst': 2, 'class III oncocytic carcinoma': 1, 'fibrolamellar oncocytic': 1, 'Oncocytic papillary cystadenomatosis': 1, 'oncocytic lesions of': 1, 'Hybrid oncocytic tumors': 2, 'eosinophilic/oncocytic tumors': 2, 'oncocytic follicular lesions': 3, 'oncocytic-predominant tumors': 1, 'oncocyte lesions': 1, 'oncocyte lesion': 1, 'oncocytic and papillary': 2, 'oncocytic and papillary neoplasms': 1, 'Hybrid Oncocytic Tumor': 1, 'Oncocytic and Papillary': 1, 'HOT': 4, 'undifferentiated and oncocytic tumours': 1, 'CASE OF ONCOCYTIC ADENOMA': 1, 'foamy virus transactivator protein': 1, 'oncocytic laryngeal lesions': 1, 'Oncocytic type 2': 1, 'oncocytic lipoadenoma of the': 2, 'Oncocytic lipoadenoma of the': 1, 'oncocytic lipoadenomas': 5, 'chromophobe and oncocytic tumours': 1, 'mixed oncocytic/chromophobe tumours': 1, 'oncocytic adrenocortical tumor': 3, 'Oncocytic Adrenocortical Neoplasm': 4, 'oncocytic PDTC': 2, 'Oncocytic nodule': 1, 'oncocytic nodule': 4, 'oncocytic-type lesions': 1, 'oncocytic neuroendocrine neoplasms': 2, 'oncocytic thyroid pathology': 1, 'oncocytic tumors in thyroid': 1, 'Oncocytic Poorly': 1, 'Oncocytic carcinoma 1': 1, 'Oncocytic Adrenocortical Neoplasms': 2, 'fibrous xanthomatous tumor of the': 1, 'Adrenocortical oncocytic neoplasm': 3, 'Oncocytic Neoplasm': 4, 'Melanotic Oncocytic Metaplasia of the': 1, 'Oncocytic Eosinophilic': 1, 'OM': 2, 'oncocytic cell lesion': 2, 'Foamy gland carcinoma': 8, 'foamy gland carcinomas': 3, 'hybrid oncocytic/chromophobe tumours': 1, 'foamy carcinoma': 1, 'Oncocytic Tumours': 2, 'Oncocytic hyperplasia': 4, 'oncocytic oligodendrogliopathy': 1, 'pancreatobiliary and oncocytic': 1, 'oncocytic papillary nodule': 1, 'E) and oncocytic': 1, 'oncocytic and': 1, 'histiocytoid cardiomyopathies': 3, 'renal hybrid oncocytic tumors': 1, 'oncocytic, rhabdoid': 1, 'follicular and oncocytic neoplasms': 4, 'Renal oncocytic hyperplasia': 1, 'Oncocytes and oncocytic cell neoplasms': 1, 'oncocytic IDC': 1, 'oncocytic (Hurthle) PDTCs': 1, 'Oncocytic Main': 1, 'oncocytic adenoma of': 1, 'oncocytic adenoma of trachea': 1, 'eosinophilic/oncocytic renal tumors': 1, 'oncocytic/eosinophilic renal tumors': 3, 'sporadic eosinophilic/oncocytic tumors': 1, 'oncocytic tumor of the thyroid': 4, 'Oncocytic Sinonasal Papilloma': 2, 'Oncocytic carcinoma of the accessory lobe': 1, 'laryngeal oncocytic salivary adenomas': 1, 'Laryngeal oncocytic lesions': 1, 'Oncocytic type 1': 1, 'Hybrid Oncocytic Tumours': 1, 'OCAs': 3, 'Oncocytic Polyp': 1, 'oncocytic polyp': 1, 'adenomatous oncocytic hyperplasia of the': 1, 'oncocytic chromophobe tumours': 1, 'Oncocytic papillary neoplasms of the': 1, 'Oncocytic adenomatous hyperplasia': 3, 'Oncocytic Follicular Carcinoma': 1, 'non-oncocytic thyroid carcinoma': 1, 'Rhabdomyoma Histiocytoid cardiomyopathy': 1, 'Oncocytic Carcinomas': 1, 'SNOP': 2, 'SNOP lesions': 1, 'oncocytic tubules': 1, 'Oncocytic tumor of the pancreas': 2, 'oncocytic or tubular carcinoma': 1, 'Malignant oncocytic papilloma': 1, 'Oncocytic scheneiderian papilloma': 1, 'OAT': 1, "OAT's": 1, 'Oncocytic cell carcinoma': 1, 'oncocytic and chromophobe tumors': 1, 'oncocyte adenomas': 1, 'OT': 1, 'metaplastic oncocytic lesion': 1, 'follicular and oncocytic tumors': 3, ', pancreatobiliary- and oncocytic-type tumors': 1, '- and oncocytic-type': 1, 'Lipid Associated-Cardiomyopathy': 1, 'Oncocytic carcinoid type': 1, 'oncocytic carcinoid tumour': 1, 'FN with oncocytic': 1, 'Oncocytic Nodule': 1, 'CYTOCHEMISTRY OF ONCOCYTES': 1, 'oncocytic tumors&#8221': 1, 'oncocytic follicular proliferations': 1, 'non-oncocytic tumours': 4, 'Oncocytic follicular neoplasms': 1, 'oncocytic-type tumors': 2, 'thyroid conventional and oncocytic cell tumors': 1, 'Thyroid oncocytic cell tumors': 1, 'Oncocytic cell tumor of the thyroid': 1, 'oncocytic cell tumors of the thyroid': 3, 'Adrenal oncocytic tumors': 3, 'Benign oncocytic endocrine tumor of the pancreas': 1, 'chromophobe-oncocytic hybrid tumors': 1, 'or oncocytic lesions': 1, 'Oncocytic papillomas': 2, 'xanthomatous cardiomyopathy': 1, 'follicular from oncocytic tumors': 1, 'oncocytic tumors of the human thyroid': 1, 'Intraductal oncocytic papillary and': 1, 'Foamy gland': 3, 'Foamy gland 20': 1, 'and oncocytic-hybrid renal carcinomas': 1, 'oncocytic cell metaplasia': 1, 'Wi-OCA': 1, 'oncocytic cell nodule': 1, '-OCA': 1, 'mi-OCA': 1, 'Thyroid oncocytic': 1, 'wi-OCA': 1, 'Oncocytic tumors in the thyroid': 1, 'Oncocytic change': 1, 'oncocytic change': 3, 'renal oncocytic/eosinophilic tumor': 2, 'oncocytic/eosinophilic renal tumor': 1, 'Oncocytic Variant) of': 1, 'oncocytic/eosinophilic tumors': 1, 'oncocytic sinonasal papilloma-related': 1, 'Laryngeal oncocytic cyst': 1, 'Oncocytic tumors of major salivary': 1, 'Foamy gland alteration': 1, 'oncocytic adenomatoid': 1, 'histiocytoid cardiomyopathy;iCM': 1, 'Oncocytic myoepithelial carcinoma': 1, 'oncocytic and follicular tumors': 1, 'follicular, oncocytic tumors': 1, 'oncocytic carcinoma at the base': 1, 'foamy-virus': 1, 'Oncocytic adrenal carcinomas': 1, 'Oncocytic Lesion': 1, 'thyroid oncocytes': 1, 'oncocytic proliferations': 1, 'oncocytic tumors in': 1, 'Hybrid Oncocytic / Chromophobe Tumor': 2, 'oncocytic tumour (': 1, 'Oncocytic glioblastoma': 1, 'oncocytic glioblastoma': 1, 'Oncocytic lesion': 2, 'Oncocytic 6 (10) 2': 1, 'Multifocal cystadenomatous oncocytic hyperplasia of': 1, 'cystadenomatous oncocytic hyperplasia of the': 1, 'Multifocal cystadenomatous oncocytic hyperplasia': 1, 'multifocal cystadenomatous oncocytic hyperplasia': 1, 'MOAH': 1, 'Multifocal Cystadenomatous Oncocytic Hyperplasia of': 1, 'cystadenomatous oncocytic hyperplasia': 1, 'oncocytic carcinoid of the lung': 2, 'Oncocytic-type IPMN': 2, 'O-IPMN': 1, 'Oncocytic IPMN': 2, 'oncocytic pheochromocytoma': 5, 'metaplastic and neoplastic oncocytic lesions': 1, 'malignant oncocytic lesions': 1, 'oncocytic neuroendocrine neoplasm': 1, 'renal oncocytic': 1, 'oncocytic carcinoma from the thyroid': 1, 'oncocytic hypophyseal adenomas': 1, 'HOTs': 2, 'oncocytic lesions of thyroid': 2, 'Renal oncocytic tumors': 1, 'bloody-foamy diarrhoea': 1, 'Bronchial oncocytic carcinoid': 1, 'Oncocytic tumors of the lacrimal sac': 1, 'lacrimal sac oncocytic lesions': 1, 'Oncocytic cell tumor': 1, 'oncocytic endocrine tumor': 1, 'Oncocytic adrenal tumors': 1, 'Oncocytic Adrenal Tumor': 1, 'Oncocytic adenomatous hyperplasia of the': 1, 'follicular (oncocytic)': 1, 'Plasmacytoid oncocytic': 1, 'Oncocytic carcinoma 1': 1, 'Oncocytic sinonasal papilloma': 1, 'PIC': 1, 'foamy gland': 2, 'Foamy gland and pseudohyperplastic carcinomas': 1, 'salivary oncocytic carcinoma': 1, 'Oncocytic 1': 1, 'Oncocytic lesions of the neuroendocrine system': 2, 'oncocytic hybrid RCCs': 1, 'oncocytic salivary neoplasms': 1, 'oncocytic-type IPMN': 1, 'Oncocytic Carcinoma of the Thyroid': 2, 'oncocytic adenoma of the lung': 1, 'pancreatobiliary and oncocytic papillary': 1, 'Chromophilic-eosinophilic (oncocyte-': 1, 'Oncocytic 20': 1, 'Oncocytic renal tumor': 1, 'mucus-secreting and oncocytic carcinoma of the thyroid': 1, 'oncocytic renal carcinoid': 1, 'Non-oncocytic cystadenoma of the vocal cord': 1, 'oncocytic myoepithelial carcinoma': 1, 'oncocytic RCCs': 2, 'Histiocytoid CM Histiocytoid CM Eye abnormalities': 1, 'Histiocytoid CM': 1, 'histiocytoid CM': 1, 'oncocytic (histiocytoid) cardiomyopathy': 1, 'OCs': 3, 'OCs) of the thyroid': 1, 'OCP': 2, 'oncocytic metastatic': 1, 'Oncocytic Neoplasms': 3, 'Prototypic Foamy Virus': 1, 'oncocytic sinonasal papilloma 16, 17': 1, 'oncocytic renal adenomas': 1, 'oncocytic renal adenoma': 1, 'oncocytic hyperplastic nodule': 2, 'oncocytic poorly differentiated carcinomas of the thyroid': 1, 'oncocytic poorly differentiated carcinoma (': 1, 'oncocytic PDC': 1, 'oncocytic tumor of uncertain malignancy': 1, 'Oncocytic Tumour': 1, 'Oncocytic Papillary Neoplasm': 1, 'FTC 2 Oncocytic 1': 1, 'oncocytic phaeochromocytomas': 1, 'Adrenal oncocytic phaeochromocytoma': 1, 'Oncocytic phaeochromocytomas': 1, 'oncocytic phaeochromocytoma': 2, 'adrenal oncocytic phaeochromocytoma': 1, 'OC and': 1, 'Oncocytic carcinoma of lip': 1, 'OACT': 1, 'Oncocytic adrenocortical tumor': 2, 'oncocytic/chormophobe tumors': 1, 'Infantile xanthomatous cardiomyopathy': 2, 'oncocytic or chromophobe tumors': 1, 'foamy necrosis': 1, 'Oculocutaneous oncocytic tumors': 1, 'OCOTs': 1, 'Oncocytic and oncocytoid lesions': 1, 'foamy fatty degeneration': 2, 'oncocytic papillary phenotype': 1, 'oncocytic or cylindrical papilloma': 1, 'hybrid oncocytic-chromophobe tumor': 1, 'oncocytic or eosinophilic tumors': 1, 'oncocytic FTCs': 1, 'follicular or oncocytic tumors': 2, 'Oncocytic PTCs': 1, 'oncocytic patterned tumors': 2, 'primary lipid cardiomyopathy': 1, 'Primary lipid cardiomyopathy': 1, 'ONC Oncocytic carcinoma': 1, 'oncocytic cortical tumors': 1, 'oncocytic cortical neoplasm': 1, 'Oncocytic cortical tumors': 1, 'non-oncocytic adenoma': 1, 'Oncocytic cystadenomas': 1, 'pancreatobiliary oncocytic neoplasms': 1, 'Oncocytic 5': 1, 'oncocyte neoplasms': 1, 'oncocytic and non-oncocytic tumors': 1, 'Adrenocortical oncocytic tumors': 4, 'ACOT': 1, 'hybrid oncocytic neoplasms': 1, 'oncocytic hyperplasia of': 1, 'Hurthle (oncocytic) tumour': 1, 'Hybrid Oncocytic Tumors': 1, 'oncocytic variant of follicular neoplasm': 1, 'Oncocytic osteolipoadenoma of the submandibular': 1, 'oncocytic cortical cysts': 1, 'lipid-storage cardiomyopathy': 1, 'oncocytic PTCs': 1, 'oncocytic cell nodular lesions': 1, 'oncocytic hyperplastic lesions': 1, 'follicular and oncocytic lesions': 1, 'renal "oncocytic" tumors': 1, 'hybrid-oncocytic" tumors': 1, 'oncocytic (or eosinophilic) tumours': 1, 'renal eosinophilic/oncocytic tumors': 1, 'primary renal oncocytic tumor': 1, 'Papillary oncocytic': 1, 'oncocytic-like carcinoma': 1, 'Sporadic oncocytic tumors': 1, 'sporadic oncocytic tumors': 1, 'Oncocytic type IPMN': 1, 'oncocytic type carcinoma': 1, 'Trabecular and oncocytic cell tumors': 1, 'Oncocytic Diffuse': 1, 'oncocytic nodular hidradenoma': 1, 'Oncocytic hidradenoma': 1, 'cutaneous oncocytic hidradenoma': 1, 'oncocytic/oxyphilic follicular cell tumors': 1, 'non-oncocytic thyroid carcinomas': 3, 'Oncocytic schneiderian papilloma of': 1, 'nonthyroid oncocytic tumors': 1, 'Follicular neoplasm with oncocytic': 1, 'OF carcinoma 53': 1, 'follicular neoplasm with oncocytic': 1, 'OF carcinoma': 1, 'Oncocytic follicular neoplasm': 2, 'OF': 1, 'OHN': 1, 'OF carcinoma 23': 1, 'OF lesions': 1, 'Oncocytic cells of the thyroid': 1, 'oncocytic biphasic tumor': 1, 'epithelioid oncocytic neoplasm': 1, 'oncocytic metaplastic': 1, 'chromophobe/oncocytic RCCs': 1, 'Oncocytic carcinoma Sialoblastoma': 1, 'Oncocytic Thyroid Carcinomas': 1, 'oncocytic gonadotroph adenoma': 1, 'Foamy saliva': 1, 'oncocytic tumors of the adrenal medulla': 1, 'oncocytic pheochromocytomas': 3, 'Oncocytic pheochromocytomas': 1, 'Adrenal Oncocytic Pheochromocytoma': 1, 'adrenal oncocytic pheochromocytoma': 3, 'metastatic oncocytic tumors': 1, 'Hurtle cell (oncocytic) carcinomas': 1, 'oncocytic (2/2) carcinoma': 1, 'OCCs': 2, 'non-oncocytic follicular tumors': 1, 'oncocytic salivary carcinomas': 1, 'ONCOCYTES': 1, 'intestinal, pancreatobiliary, and oncocytic cysts': 1, 'oncocytic endocrine tumors': 1, 'oncocytic cortical tumor': 1, 'Adrenal Oncocytic Carcinoma': 2, 'oncocytic adrenal adenomas': 1, 'benign oncocytic adenoma': 2, 'oncocytic or poorly differentiated carcinoma': 2, 'oncocytic follicular neoplasms': 2, 'oncocytic renal cysts and tumors': 1, 'pedunculated oncocytic carcinoma': 1, 'Pedunculated oncocytic carcinoma': 1, 'Spuma- or foamy viruses': 1, 'Oncocytic adenolipoma': 1, 'oncocytic adenolipoma': 1, 'grade oncocytic tumor': 1, 'Oncocytic 1 ns': 1, 'Foamy degeneration': 2, 'oncocytic malignant thyroid tumors': 1, 'oncocytic and pancreatobiliary-type neoplasms': 1, 'oncocytic tumours of the': 1, 'Oncocytic and nonclear, nonpapillary tumors': 1, 'Oncocytic adenoma1': 1, 'oncocytic and choriocarcinomatous carcinomas': 1, 'papillary and oncocytic-DTC': 1, 'oncocytic Schneiderian': 1, 'oncocytic/chromophobe tumor 6': 1, 'Nasal oncocytic schneiderian papilloma': 1, 'Oncocytic poorly differentiated thyroid carcinoma': 1, 'Oncocytic PDTC': 1, 'Oncocytic Poorly Differentiated Thyroid Carcinomas': 1, 'Oncocytic Poorly Differentiated Thyroid Carcinoma': 1, 'nononcocytic or oncocytic follicular neoplasm': 1, 'Oncocyt.': 1, 'follicular, oncocytic tumor': 1, 'follicular oncocytic tumors': 3, 'oncocytic follicular tumor': 1, 'oncocytic renal carcinoma': 1, 'thyroid, parathyroid and renal oncocytic tumors': 1, 'oncocytic carcinoma': 1, 'FL foamy virus envelope protein': 1, 'oncocytic pancreatobiliary neoplasms': 1, 'oncocytic micro-adenoma': 1, 'oncocytic-chromophobe tumours': 1, 'oncocytic proliferations of the thyroid': 1, 'chromophobe-like/oncocytic neoplasms': 1, 'Bat Foamy Virus': 1, 'Ungulate Foamy Virus': 1, 'foamy Virus': 1, 'oncocytic carcinoma of the naso-orbit': 1, 'oncocytic ductal cysts': 1, 'Oncocytic Thyroid Neoplastic Lesions': 1, 'Oncocytic Schneiderian papilloma of frontal sinus': 1, 'pigmented oncocytoma': 1, 'OCC oncocytic cell carcinoma': 1, 'Oncocytic adrenocorticaladenoma': 1, 'bronchial oncocytic carcinoid': 1, 'Oncocytic Neoplastic': 1, 'oncocytic tumors of thyroid': 1, 'oncocytic benign and malignant tumors': 1, 'oncocytic phenotype': 1, 'pancreatobiliary/ oncocytic': 1, 'OV-PDTC': 1, 'papilar oncocytic carcinoma': 1, 'oncocytic sellar tumor': 1, 'adrenocortical oncocytic lesions': 1, 'Adrenocortical oncocytic lesions': 1, 'oncocytic tumoral': 1, 'oncocytic bilayered tumour': 1, 'endocrine thyroid oncocytic carcinomas': 1, 'benign oncocytoma': 1, 'benign oncocytoma 15': 1, 'adrenal oncocytic tumor': 1, 'oncocytic disease': 1, 'Oncocytic tumors of the adrenal medulla': 1, 'Nodular fasciitis Oncocytic carcinoma': 1, 'oncocytic 7 carcinomas': 1, 'oncocytic cortical neoplasms': 1, 'oncocytic carcinoma of thyroid': 1, 'Oncocytic metaplastic': 1, 'Oncocytic - - Unknown': 1, 'Oncocytic - Unknown': 1, 'Oncocytic lesions of the ocular adnexa': 1, 'periocular oncocytic lesions': 1, 'Congenital "histiocytoid" cardiomyopathy': 1, 'hybrid oncocytic chromophobe tumour': 1, 'Oncocytic hepatocellular carcinoma': 1, 'Oncocytic Pylloid Oncocytic tumor': 1, ', pancreaticobiliary or oncocytic': 1, 'oncocytic-': 1, 'Oncocytic Variant Poorly Differentiated Thyroid Carcinoma': 1, 'papillary oncocytic neoplasms': 1, 'non-oncocytic neoplasms': 1, 'HOCT 2': 1, 'adenoma of oncocytic': 1, 'pulmonary oncocytic carcinoid': 1, 'Pulmonary oncocytic carcinoid': 1, 'Adrenocortical Oncocytic Tumor': 1, 'Oncocytic lesions of': 1, 'oncocytic lesions of the': 1, 'oncocyter carcinoid tumour': 1, 'oncocytic cellular hyperplasia': 1, 'conventional and oncocytic follicular neoplasms': 1, 'oncocytic tumor in': 1, 'Bet-deficient feline foamy virus': 1, 'SNOP.6': 1, 'Sinonasal Oncocytic Papilloma': 1, 'Sinonasal Oncocytic Papilloma-A': 1, 'SFON': 1, 'oncocytic papilloma in nasal ethmoid sinus': 1, 'oncocytic papilloma of nasal ethmoid sinus': 1, 'oncocytic ACT': 1, 'Oncocytic ACT': 1, 'OCA oncocytic thyroid carcinoma': 1, 'Oncocytic parathyroid nodule 1': 1, 'benign oncocytic paraganglioma': 1, 'Oncocytic pituicytes': 1, 'Oncocytic adrenal adenoma': 1, 'adrenocortical oncocytic borderline tumour': 1, 'oncocytic, nonendocrine neoplasm of the anterior hypophysis': 2, 'Oncocytic tumors of the endocrine system': 1, 'oncocytic [': 1, 'Thymic oncocytic carcinoid': 1, 'Hybrid oncocytic-chromophobe tumour': 1, 'oncocytic adrenocortical tumor malignancy': 1, 'renal oncocytic adenomas': 1, 'Renal oncocytic adenoma': 1, 'Oncocytic and oncocyte-like lesions of the head and neck': 1, 'oncocytic and oncocyte-like neoplasms': 1, 'hepatocellular oncocytic transformation': 1, 'oncocytic follicular cell tumour': 1, 'oncocytic cell or follicular neoplasm': 1, 'oncocytic tumors (': 1, 'Oncocytic hybrid tumors': 1, 'familial oxyphilic (oncocytic) thyroid tumors': 1, 'Thyroid Oncocytic Carcinoma': 1, 'TOC': 1, 'Oncocytic Sialolipoma': 1, 'Oncocytic schneiderian papillomas': 1, 'Oncocytic thymic carcinoids': 1, 'Oncocytic sinonasal': 1, 'Oncocytic/eosinophilic tumors': 1, 'Oncocytic Lesions': 1, 'Oncocytic variant 2': 1, 'Follicular Oncocytic Carcinomas': 1, 'oncocytic carcinomas and': 1, 'oncocytic or oxyphilic thyroid tumors': 1, 'Microcarcinoma oncocytic': 1, 'AON': 1, 'Oncocytic Myxoid Sarcomatoid': 1, 'borderline oncocytic tumour': 1, 'Hybrid oncocytic-chromophobe tumours': 1, 'HCOT': 1, 'oncocytic hybrid tumour': 1, 'oncocytic-type lesion': 1, 'non-oncocytic follicular cell-derived neoplasms': 1, 'oncocytic papillary neoplasm': 1, 'Foamy fatty degeneration': 1, 'oncocytic carcinomas of the lacrimal': 1, 'oncocytic / chomophobe tumors': 1, 'Oncocytic tumors arising': 1, 'oncocytic vacuolated carcinomas': 1, 'basaloid and oncocytic neoplasms': 1, 'cranio-orbital oncocytic carcinoma': 1, 'Oncocytic metaplastic changes': 1, 'Oncocytic cardiomyopathy syndrome': 1, 'Sinonasal oncocytic Schneiderian papilloma': 1, 'Oncocytic sialolipoma of the submandibular': 1, 'oncocytic sialolipoma of the submandibular': 1, 'Oncocytic hepatocellular tumour': 1, 'Oncocytic nodular hidradenoma': 1, 'Pure oncocytic tumors': 1, 'Adrenal oncocytic carcinoma': 1, 'myoepithelial and oncocytic adenomas': 1, 'oncocyte tumours': 1, 'foamy cells': 1, 'Oncocytic poorly differentiated (insular) thyroid carcinoma': 1, 'follicular or oncocytic tumor': 1, 'oncocytic carcinoma in submandibular': 1, 'Sporadic Hybrid Oncocytic/Chromophobe Tumor': 1, 'follicular oncocytic carcinomas': 1, 'oncocytic thyroid malignancies': 1, 'Oncocytic carcinoid': 1, 'oncocytic adrenal carcinomas': 1, 'oncocytic lesions in': 1, 'oxyphilic or oncocytic tumors': 1, 'foamy agent': 1, 'oncocytic malignancy': 1, 'Oncocytic 7': 1, 'oncocytic/Hurthle lesions': 1, 'Oncocytic lesions of the thyroid': 1, 'Hurthle/oncocytic lesions': 1, 'Hybrid oncocytic/chromophobe tumours': 1, 'Hybrid oncocytic': 1, 'oncocytic cyst of the': 1}
|
oncocytic tumors
|
Disease
|
MESH:C535586
|
{'OSA': 5623, 'diastasis recti': 306, 'OSA obstructive sleep apnoea': 36, 'diastasis recti abdominis': 104, 'Diastasis Recti': 27, 'DRA': 58, 'Diastasis Recti Abdominis': 29, 'macroconidiis cylindricis utrinque rotundatis rectis': 1, 'macroconidiis cylindricis utrinque rotundatis rectis': 1, 'macroconidiis cylindricis utrinque rotundatis rectis': 1, 'recti diastasis': 9, 'Diastasis recti': 59, 'Diastasis recti abdominis': 51, 'OSA osteosarcoma': 7, 'oculo-skeletal-renal syndromes': 1, 'OSA-18': 46, 'IRD': 18, 'OSA-LD': 1, 'POSA': 1, 'divaricated recti': 1, 'diastasis of the recti': 5, 'OSA symptoms': 16, 'obstructive sleep apnoea (OSA': 1, 'RrOSA': 1, 'RAOM OME OSA': 1, 'brain, cardiac, abdominal, renal, eye, and skeletally related malformations': 1, 'OSA hypoxia': 1, 'OSA-DIC': 1, 'OSA-': 27, 'OSA ERT': 1, '3MC2': 2, 'DR': 15, 'OSA syndrome': 57, 'resectio recti': 1, 'OOH) syndrome': 1, 'OOH syndrome': 1, 'obesity-OSA-hypertension': 1, 'Carnevale syndrome': 7, 'hypercapnic OSA': 1, 'oculo-facial-skeletal myorhythmia': 5, 'OSA hypopnoea syndrome': 1, 'OSAHS': 3, 'OSA Osteosarcoma': 4, 'CCR': 2, 'OSA sleep': 2, 'OSA.Material': 1, 'nonsyndromic diastasis recti': 1, '-recessive Carnevale': 1, 'oculo-skeletal-abdominal (OSA) syndromes': 1, 'corpus cavernosum recti': 1, 'OSA:38': 1, 'oculo-skeletal dysplasia': 5, 'Prolapsus Recti': 1, 'OSA Obstructive Sleep Apnoea': 4, 'OSA Syndrome': 12, 'Oculo-pharyngo-skeletal myopathy': 1, 'OSA 2': 2, 'OSAS': 7, 'OSA obstructive sleep apnoea': 2, 'Ulcus simplex recti': 1, 'syndromic oculo-skeletal dysplasia': 1, 'oculo-skeletal dysplasias': 1, 'oculo-skeletal dysplasia syndrome': 1, 'Carcinoma Recti': 2, 'DRAM': 2, 'Adherence syndrome of the lateral recti and': 1, 'OSA.128': 1, 'OSA.270': 1, 'SI-OSA': 1, "REM-related OSA' disorder": 1, 'REM-related OSA': 2, 'OSA/': 1, 'OSA OH': 1, 'OSA*': 1, 'diastasis recti development': 1, 'diastasis abdominis recti': 1, 'OSA.O.R.95': 1, 'Diverication of recti': 1, 'procidentia recti': 2, 'non-positional OSA': 2, 'NP-OSA': 1, 'Postoperative OSA': 1, 'oculo-skeletal abnormalities': 2, 'of recti': 4, 'OSA-3': 2, 'DRA impairment': 1, 'nssOSA': 1, 'riOSA': 1, 'rpOSA': 1, 'diastasis recti deformity': 2, 'Carnevale and Mingarelli syndrome': 1, 'prolapsus recti': 4, 'Carnevale': 9, 'OSA.There': 1, 'OSA(S': 1, 'oculo-skeletal symptoms': 1, 'recti abdominis': 2, 'OSA tumor': 4, 'OSA disease': 6, 'OSA-SARS': 1, 'diastasis musculi recti': 1, 'REM-OSA': 3, 'Mingarelli and Carnevale syndromes': 1, 'carcinoma recti I': 1, 'Fascia recti': 1, 'recti': 8, 'OSA arrhythmias': 1, 'recti abdomini diastasis': 1, 'OSA-110': 2, 'REM OSA': 1, 'Oculo-skeletal dysplasia': 3, 'post-pregnancy diastasis recti': 1, 'Post-gestational diastasis recti': 1, 'OSA-N': 1, 'OSA-H': 1, 'diastatis recti abdominis': 1, 'OSA.The': 1, 'TR': 1, ', and Carnevale syndromes': 1, 'Hypercapnic OSA': 1, 'oculo-facial skeletal myorhythmia': 1, 'diastasis recti abdominus': 2, 'Obstructive Sleep Apnoea OSA': 1, 'Oculo-skeletal dysplastic': 1, 'OSD': 3, 'abdominal and skeletal abnormalities': 1, 'OSA-hypopnea syndrome': 3, 'LG-OSA': 1, 'OSA)': 1, 'diastasis of recti': 3, 'OSA Overlap Syndrome': 1, 'Recti diastasis': 1, 'Distasis recti': 1, 'haematoma of the recti': 1, 'and Carnevale) embryonic development syndrome': 1, 'type I OSA': 1, 'Type I and II OSA': 1, 'OSA with type IIIa': 1, 'OSA with type IIIb': 1, 'OSA Dysphagia': 1, 'Trisomy 21,OSA': 1, 'DrA': 2, 'DrA.': 1, 'syndrome of ocular, skeletal, and abdominal abnormalities': 1, 'OSA%': 1, 'siOSA': 1, 'OSA) syndrome': 1, 'Carcinoma recti': 2, 'OSA-1': 1, 'OSA-2': 1, 'obstructive (OSA)': 1, 'APOC I': 1, 'OSA[Title': 1, 'recti abdominis diastasis': 1, 'PUL-OSA': 1, 'OSA-DA': 1, 'NREMOSA': 1, 'REMOSA': 1, 'Sparse OSA': 1, 'sparse OSA': 1, 'OSA-TB 9243-3': 1, 'OSA-TB 9244-1': 1, 'OSA-TB 9204-c1': 1, 'OSA-TB 9204-': 1, 'OSA-TB 9204-r1': 1, 'OSA-type': 1, 'OSA symptom': 3, 'obstructive sleep apnoea (OSA) syndrome': 1, 'OSA -': 1, 'oculo-reno-skeletal syndrome': 1, 'Diastasis recti Rhizomelia': 1, 'Diastasis Recti Abdominis-A': 1, 'DRA.Studies': 1, 'Carnevale, Mingarelli': 1, 'OSA complications': 1, 'OSA complication': 1, 'Metastasis OSA': 1, 'Tumorigenesis OSA': 1, 'OSA sludge': 1, 'nocturnal and daytime OSA symptoms': 1, '3MC syndrome type 2': 2, 'OSA overlap syndrome': 2, 'autosomal recessive 3MC syndrome': 1, 'OSA obstruction': 1, 'OSA,': 1, 'OSA.UFPWV': 1, 'OSA-B': 1, 'OSA-A': 1, 'post-sleep OSA': 1, 'OSA-I': 1, 'OSA-F': 1, 'Oculo-Skeletal syndrome': 1, '3MC syndrome 2': 1, 'diastasi recti': 1, 'diastis recti': 1, 'OSA tumors': 2, 'Diastasis Recti Abdominus': 1, 'autosomal recessive Carnevale syndrome': 1, 'hypoplastic superior recti': 1, 'Neoplasma recti': 1, 'CAVERNOSUM RECTI': 1, 'CIOMP-OSA': 1, 'divarication of recti': 1, 'OSA-associated symptoms': 1, 'ADI-OSA-110': 1, 'OSA-5': 1, 'COMISA': 1, 'skeletal and abdominal abnormalities': 1, 'Prolaps Recti': 1, 'DRA diastasis recti abdominis': 1, 'OSA.30': 1, 'OSA 8': 1, 'OSA 31': 1, 'skeletal, thoracic or abdominal lesions': 1, '-OSA': 1, 'ulcus simplex recti': 1, 'diasthesis recti': 1, 'OSA/HS': 1, 'oculo-facial and skeletal abnormalities': 1, 'OSA;restless legs syndrome;insomnia': 1, 'Scirrhus Recti': 1, 'SR': 1, 'abdominal, skeletal, cranial lesions': 1, 'chronic diastasis recti': 1, 'OSA-08': 1, 'OSA-06': 1, 'OSA-03': 1, 'of the Recti': 1, 'OSA Asthma': 1, 'OSA DM': 1, 'rectis': 2, 'NPOSA': 2, 'autosomal recessive Oculo-skeletal Dysplasia': 1, 'Oculo-skeletal Dysplasia': 1, 'isolated diastasis recti': 1, 'OSA hypopnea syndrome': 1, 'OSA.While': 1, 'OSA.Considerable': 1, 'OSA.Degree': 1, 'OSA F20241-2': 1, 'OSA F19351-3': 1, 'OSA F20241-1': 1, 'CIM-OSA': 1, 'OSA-SNa': 1, 'oculo-skeletal involvement': 1, 'oculo-skeletal syndrome': 1, 'OSA-DLS': 1, 'Diastasis-recti': 1, 'and Carnevale) syndrome': 1, 'carcinoma recti': 1, 'Oto-oculo-musculo-skeletal syndrome': 1, 'maternal diastasis recti abdominis': 1, 'OSA-PLMs': 1, 'cardiac, abdominal, and musculo-skeletal diseases': 1, 'OSA_OH': 1, 'OSA_withoutoh': 1, 'OSA_withoutOH': 1, 'appendicular OSA': 1, 'OSA.Sensitivity': 1, 'OSA Obstructive sleep apnoea': 1, 'diastisis recti': 1, 'Irreversible Diastasis Recti': 1, 'myocardial infarction;OSA': 1, 'CSA) or obstructive (OSA': 1, 'obstructive sleep (OSA) syndrome': 1, 'diastasis recti damage': 1, 'Diastasis of the recti': 1, 'diastasis recti separation': 1, 'REPA': 1, 'of diastasis recti': 1, 'cerebero-oculo-facial-skeletal syndrome': 1, 'Carnevale and Mingarelli syndromes': 1, 'Mingarelli and Carnevale syndrome': 1, 'OSA,8': 1, 'rapid eye movement-related OSA': 1, 'OSA snoring': 1, 'OSA osteosarcoma 11': 1, 'OSA N': 1, 'OSA Y': 1, 'OSA,35': 1, 'Cam-deformity OSA': 1, 'recti recession': 1, 'OSA olfactory disorder': 1, 'oculo-skeletal disorders': 1, 'P-OSA': 1, 'OSA snorers': 1, 'Oculo-facial-skeletal myorhythmia': 1, 'Carnevale,': 1, 'SDB OSA': 1}
|
OSA
|
Disease
|
MESH:C535588
|
{'CPT': 901, 'Carnitine palmitoyltransferase deficiency': 18, 'CPT deficiency': 42, 'carnitine palmitoyltransferase deficiency': 61, 'Carnitine palmitoyltransferase deficiency type I': 1, 'CPT1 deficiency': 7, 'carnitine palmitoyltransferase-1 (CPT1) deficiency': 1, 'carnitine palmitoyltransferase 1A deficiency': 14, 'Carnitine palmitoyltransferase I deficiency': 14, 'CPT impairments': 1, 'CPTI': 5, 'CID': 2, 'CPT-11': 5, 'type I and II hepatic': 1, 'CPTID': 1, 'carnitine palmitoyltransferase-I deficiency': 3, 'carnitine palmitoyltransferase I deficiency': 30, 'Carnitine palmitoyltransferase i deficiency': 1, 'Carnitine palmitoyltransferase 1 deficiency': 4, 'CPT I deficiency': 13, 'CPT-IID': 2, 'carnitine palmitoyltransferase I/II deficiency': 1, 'Deficiency of CPT enzyme': 1, 'CPT-RVS': 1, 'CPT-Ia': 1, 'CPT-2 deficiency': 10, 'Crawford type IV CPT': 2, 'PLD': 1, '-LN CELLS STIMULATED WITH 8-CPT': 1, 'EFFECTS OF 8-CPT': 1, '8-CPT TREATMENT OF': 1, '8-CPT-INDUCED INCREASE': 1, 'CPT-P': 3, 'CPTD': 2, 'deficiency of carnitine palmitoyltransferase': 6, 'Deficiency of carnitine palmitoyltransferase': 2, 'VCPT': 1, 'CPT-3': 2, 'CPT1A deficiency': 28, 'carnitine palmitoyltransferase 1A (CPT1A) deficiency': 8, 'carnitine palmitoyltransferase enzyme deficiency': 1, 'CPT-D': 1, 'CPT/C': 1, 'Liver serine palmitoyltransferase activity deficiency': 1, 'deficiency of liver SPT': 1, 'carnitine palmitoyl transferase 1A deficiency': 2, 'carnitine palmitoyl transferase 1A (CPT1A) deficiency': 2, 'CPT-4': 12, 'Hepatic carnitine palmitoyltransferase (CPT I) deficiency': 1, 'Hepatic carnitine palmitoyltransferase I deficiency': 1, '-CPT': 6, 'Carnitine palmitoyltransferase I(CPT1) deficiency': 1, 'carnitine palmitoyltransferase (CPT) deficiency': 6, 'CPT 67320': 1, 'carnitine palmitoyltransferase I (CPT-I) deficiency': 2, 'CPT-I deficiency': 13, 'carnitine palmitoyltransferase deficiency I': 1, 'Type I hepatitis': 1, 'partial deficiencies of carnitine palmitoyltransferase II and mitochondrial complex I': 1, 'carnitine palmitoyltransferase I (CPT I) deficiency': 7, 'hepatic carnitine palmitoyltransferase I deficiency': 1, 'CPT-1 deficiency': 8, 'carnitine palmitoyltransferase deficiency type 1': 5, 'carnitine palmitoyltransferase type 1 deficiency': 5, 'CPT IID': 3, 'Carnitine palmitoyltransferase 1A (CPT1A) deficiency': 6, 'CPT class A&B': 1, 'CPT B/C.': 1, 'deficiency of CPT': 1, 'CPT IA deficiency': 5, 'Carnitine Palmitoyltransferase 1A Deficiency': 2, 'CPT1A dysfunction': 1, 'CPT1A Deficiency': 1, 'M-CPT I': 1, 'mitochondrial CPT I': 1, 'CPT grade III': 1, 'carnitine palmitoyltransferase': 1, 'CPT C': 3, 'CPT class B or C': 1, 'CPT class C': 3, 'CPT class B': 2, 'carnitine palmitoyl transferase 1a (CPT1a) deficiency': 1, 'L-CPT I deficiency': 2, 'deficiency of L-CPT I': 1, 'CPT-A': 5, 'CPT A and B': 2, 'primary carnitine deficiency carnitine palmitoyltransferase I deficiency': 1, 'CPT 1 and CPT 2 deficiencies': 1, 'CPT-P.': 1, 'carnitine palmitoyltransferase type 1 (CPT1A) deficiency': 1, 'Carnitine palmitoyltransferase type 1 deficiency': 2, 'CPT-I': 2, 'Myocardial carnitine and carnitine palmitoyltransferase deficiencies': 1, '-X CPT': 1, 'Hepatic carnitine palmitoyltransferase 1 (CPT1A) deficiency': 1, 'carnitine palmitoyltransferase I or II deficiency': 2, 'CPT 2 muscle deficiency': 1, 'CPT 2 deficiency': 5, 'CPT B.': 1, 'CPT B': 6, 'CPT-IA deficiency': 3, 'Carnitine palmitoyltransferase IA (CPT-IA) deficiency': 1, 'CPT-IA deficient': 1, 'carnitine palmitoyltransferase I and II deficiency': 2, 'OvCa-CPT': 1, 'CPT I deficiency syndromes': 1, 'CPT1A-deficient': 3, 'CPT I': 2, 'CPT class B and C': 1, 'Child-Pugh-Turcotte (CPT)': 1, 'CPT-OX': 2, 'CPT-DS': 1, 'carnitine palmitoyltransferase I deficiencies': 2, 'Carnitine deficiency 1': 1, 'CPT II deficiency': 1, 'Carnitine palmitoyltransferase 1A deficiency': 3, 'carnitine palmitoyltransferase 1A': 1, 'Carnitine palmitoyl transferase 1A deficiency': 1, 'X-CPT': 2, 'CPT-1 and -2 deficiencies': 1, 'CPT dysfunction': 1, 'impaired CPT': 2, 'carnitine palmitoyltransferase 1A (CPT 1A) deficiency': 1, 'carnitine palmitoyltransferase 1a (liver isoform) deficiency': 1, 'CPT1a deficiency': 1, 'CPT-NS': 1, 'Carnitine palmitoyltransferase deficiency type 1 Phenylketonuria': 1, 'carnitine palmitoyltransferase (CPT) I or II deficiency': 2, 'C-CPT': 1, 'CPT and MAD deficiencies': 1, 'CPT II': 1, 'Carnitine Palmitoyltransferase Deficiencies': 1, 'carnitine palmitoyltransferase deficiencies': 4, 'CPT 599.7X': 1, 'Carnitine palmitoyltransferase deficiencies': 3, 'CPD': 1, 'Carnitine palmitoyltransferase (CPT) deficiency': 4, 'carnitine and carnitine palmitoyltransferase deficiency': 2, 'CPT1-deficient': 1, 'Liver carnitine palmitoyltransferase I (CPT I) deficiency': 1, 'CPT I deficient': 1, 'Carnitine palmitoyltransferase I (CPT I) deficiency': 3, 'carnitine palmitoyltransferase (CPT I or CPT II) deficiency': 1, 'Child-Pugh-Turcotte [CPT': 1, 'Child-Pugh-Turcott [CPT]-B': 1, 'KHPE type I': 1, 'Carnitine palmitoyltransferase I (CPTI) deficiency': 1, 'CPT A': 7, 'CPT A or B': 1, 'Deficiency of CPT': 1, 'hypersensitivity to CPT': 1, 'CPT I deficiencies': 1, 'carnitine palmitoyltransferase IA deficiency': 1, 'L-CPT I deficiencies': 1, 'VDS-P CPT': 1, 'CPT I-deficient': 1, 'carnitine palmitoyltransferase type I deficiency': 1, 'carnitine palmitoyltransferase I (L-CPT I) deficiency': 1, 'CPT tumor': 1, 'CPT tumors': 1, 'CPT-2 deficiencies': 3, 'hepatic carnitine palmitoyltransferase (CPT I) deficiency': 1, 'CPT.246 F127': 1, 'CPT-deficiency': 1, 'CPTV': 1, 'CPT violation': 1, 'CPT B or C': 4, 'CPT-B/C': 1, 'CPT-B': 2, 'CPT-B or C': 1, 'CPT-C': 4, 'CPT B/C': 1, 'carnitine palmitoyltransferases deficiency': 1, 'CPT deficiencies': 1, 'muscular carnitine palmitoyltransferase deficiency': 2, 'CPT 1A deficiency': 1, 'CPT ID': 1, 'Carnitine palmitoyltransferase deficiency (I, II': 1, 'PATs': 1, 'CPT lesion': 1, 'Carnitine palmitoyltransferase (CPT) II deficiency': 2, 'Carnitine palmitoyltransferase (CPT) deficiencies': 6, 'carnitine palmitoyltransferase (CPT) II deficiency': 1, 'CPT 27829': 1, 'CPT Ia deficiency': 1, 'carnitine palmitoyltransferase (CPT) Ia deficiency': 1, 'CPT-': 3, 'carnitine palmitoyltransferase I (CPT1) deficiency': 2, 'carnitine palmitoyltransferase-1 deficiency': 1, 'CPT-I-deficient': 1, 'Carnitine palmitoyltransferase-I (CPT-I) deficiency': 1, 'carnitine palmitoyltransferase type I and II deficiency': 1, 'CPT-1-deficient': 1, "CPT's": 1, 'ventricle CPT': 1, 'CPT-11-INDUCED DIARRHEA': 2, 'CPT type IA deficiency': 1, 'CPT-HCPCS': 1, 'deficiency in hepatic form of carnitine-palmitoyltransferase type I': 1, 'carnitine palmitoyltransferase type I': 1, 'Carnitine palmitoyltransferase IA': 1, 'Carnitine palmitoyltransferase IA deficiency': 1, 'CPT-II': 1, 'refracture of CPT': 1, 'carnitine palmitoyltransferase 1 deficiency': 3, 'carnitine-palmitoyltransferase deficiency': 2, 'CPT1A enzyme deficiency': 1, 'CPT-R': 2, 'CPT-S': 1, 'CPT I-deficiency': 1, 'palmitoyltransferase enzymes deficiency': 1, 'CPT I or II deficiency': 1, 'palmitoyltransferase-1 deficiency': 1, 'hepatic CPT deficiency': 1, 'muscular CPT deficiency': 1, 'CPT 11': 1, 'CPT-IA': 1, 'CPT%': 1, 'Carnitine Palmitoyltransferase I Deficiency': 1, 'carnitine palmitoyltransferase I and II (CPT I/II) deficiency': 1, 'CPT-1A deficiency': 1, 'CPT lesions': 1, 'abnormalities of carnitine palmitoyltransferase': 1, 'muscular carnitine (palmitoyltransferase deficiency': 1, 'CPT-IIe': 1, 'I-carnitine deficiency': 1, 'CPT deficiency diseases': 1, 'hepatitis type I': 1, 'carnitine palmitoyltransferase 1C': 1, 'Cpt1a deficiency': 1, 'carnitine palmitoyltransferase I (CPT IA) deficiency': 1, 'CPT class': 1, 'DDM&S.CPT': 1, 'CPT A disease': 1, 'Child-Pugh-Turcotte [CPT] B': 1, 'CPT B and C': 3, 'Carnitine palmitoyltransferase I and II deficiencies': 1, 'Carnitine palmitoyltransferase 1C deficiency': 1, 'FP]:CPT': 1, 'CPT-Deg': 1, 'Deficiency of carnitine palmitoyltransferase I.': 1, 'L-CPT I hereditary deficiency': 1, 'CPT- I deficiency': 1, 'liver type CPT I deficiency': 1, 'Carnitine palmitoyltransferase (CPT) CPT I deficiency': 1, 'muscle-type and brain-type CPT I deficiency': 1, 'CPT-AMA': 1, 'L-CPT I deficiency syndromes': 1, 'carnitine palmitoyltransferase I': 1, 'CPT-Ia deficiency': 1, 'CPT 1a-deficiency': 1, 'CPT1A': 1, 'Deficiency of carnitine palmitoyltransferase 1A': 1, 'CPTI deficiency': 1, 'carnitine palmitoyltransferase-1A deficiency': 1, 'CPT 63': 1, 'carnitine O-palmitoyltransferase deficiencies': 1, 'CPT-ID': 2, 'carnitine palmitoyltransferase I-deficient': 1, 'CPT score': 1, 'Carnitine palmitoyltransferase 1A (CP1A) deficiency': 1, 'CPT 1 deficiency': 1, 'carnitine palmitoyltransferase 1A) deficiency': 1, 'carnitine palmitoyl transferase (CPT) 1A deficiency': 1, 'CPT 211.3': 1, 'carnitine palmitoyltransferase (CPT) I deficiency': 1, 'CPT enzyme defect': 1, 'deficiency of carnitine palmitoyltransferase-A': 1, 'CPT #2': 1, 'carnitine palmitoyltransferase deficiency type I': 1, 'deficiencies of CPT1': 1, 'deficiency of CPT1': 1, 'Oxidation Carnitine Palmitoyltransferase I Deficiency': 1, 'deficiency of CPT1A': 1, 'CPT-4PROCEDURE': 1, 'CPTs': 1, 'CPT-I and II deficiencies': 1, 'CPT-11 NSCLC': 1, 'NSCA-CPT': 1, 'CPT type 2 (CPTII) deficiency': 1, 'carnitine palmitoyltransferase type 1 (CPTI) deficiency': 1, 'FOCUS': 1, 'CPT deficiency disorders': 1, 'deficiency of carnitine palmityltransferase I': 1, 'CPT1AD': 1, 'Carnitine Palmitoyltransferase 1A(CPT1A) Deficiency': 1, 'Carnitine-Palmitoyltransferase I Deficiency': 1}
|
CPT
|
Disease
|
MESH:C535589
|
{'POPE': 82, 'POPC': 518, 'POPG': 80, 'muscle carnitine deficiency': 31, 'CPTs': 71, 'NPCS': 1, 'CPT2 deficiency': 98, 'PPT2 deficiency': 1, 'PPT deficiency': 8, 'carnitine palmitoyl-transferase II deficiency': 4, 'POPS': 93, 'PPT1 deficiency': 34, 'Carnitine palmitoyl transferase II (CPT-II) deficiency': 1, 'carnitine palmitoyltransferase-2 deficiency': 6, 'CPTI-deficiency': 1, 'CPTI-deficient': 1, 'Carnitine Palmitoyl Transferase Deficiency': 1, 'carnitine-palmityl-transferase deficiency': 5, 'carnitine palmitoyl transferase deficiency': 30, 'PPS': 2, 'Carnitine palmityl transferase deficiency': 4, 'deficiency of muscle carnitine palmitoyltransferase': 4, 'palmitoyl-protein thioesterase 1 deficiency': 2, 'CPT-Ia': 2, 'carnitine-palmitoyl-transferase II (CPT II) deficiency': 1, 'muscle type CPT II deficiency': 1, 'Carnitine palmitoyl transferase 2 deficiency': 1, 'carnitine palmitoyltransferase 2 (CPT2) deficiency': 6, 'cardiac and muscle CPT II deficiency': 1, 'muscle CPT II deficiency': 7, 'Muscle Carnitine Palmitoyltransferase II (': 1, 'Carnitine palmitoyltransferase II (CPT-2) deficiency': 2, 'carnitine deficiency of muscle': 1, 'PGPC': 22, 'PALMITOYLATION': 5, 'muscle carnitine palmitoyl transferase 2 (CPT2) deficiency': 1, 'Carnitine palmitoyl transferase deficiency': 12, 'palmitoyl protein thioesterase-1 deficiency': 2, 'CrAT-deficient': 1, 'PC': 16, 'S-PALM': 3, 'PAPS': 1, 'PAPC': 3, 'carnitine palmitoyltransferase-2 (': 1, 'CPT2 deficient': 2, 'carnitine palmitoyltransferase 2 (CPT2)': 1, 'Muscle CPT2 deficiency': 1, 'carnitine palmitoyl transferase deficiencies': 1, 'deficiency of carnitine-palmitoyl-transferase-II': 2, 'carnitine palmitoyl transferase II deficiency': 25, 'carnitine palmitoyl transferase II (CPT II) deficiency': 4, 'CPT II deficiency': 14, 'palmitoyl-protein thioesterase deficiency': 7, 'Carnitine Palmityl Transferase deficiency': 1, 'carnitine palmitoyltransferase 2 deficiency': 16, 'Palmitoyl-protein thioesterase deficiency': 2, 'cPT': 19, 'CPT II (EC 2.3.1.21) deficiency': 1, 'type 2 carnitine-palmitoyl transferase (CPT-2) deficiencies': 2, 'deficiency of muscle carnitine': 2, 'PCM': 3, 'Muscle carnitine deficiency': 19, 'muscle carnitine palmitoyltransferase II deficiency': 1, 'Carnitine palmitoyl deficiency type II': 1, 'Deficiency of CPT2': 1, 'T-PC': 1, 'PAzPC': 2, 'PPT-deficient': 2, 'palmitoyl-protein thioesterase (PPT) deficiency': 1, 'deficiency of carnitine-palmitoyl-transferase': 1, 'deficiency of palmitoyl-protein thioesterase': 3, 'PPT': 6, 'deficiency of PPT': 4, 'deficiency of muscle carnitine palmityl transferase': 1, 'Carnitine Palmitoyl Transferase II Deficiency': 1, 'deficiencies of CPT I': 1, 'carnitine-palmitoyl transferase 1 and 2 deficiencies': 1, 'CPT deficiency': 11, 'PG': 1, 'POPA': 13, 'POPC POPE POPA': 2, 'EPC': 1, 'S-PALMITOYLATION': 1, 'Carnitine Transferase deficiency': 1, 'carnitine palmitoyl transferase 1 deficiency': 4, 'PPT1-deficient': 3, 'pC-NE': 1, 'carnitine palmitoyl transferase type 2 deficiency': 5, 'MPT': 2, '-POPE': 1, 'OxPAPC': 16, '5-PC': 1, 'CPT2 Deficiency': 1, 'PAT': 5, 'Carnitine palmitoyltransferase 2 (CPTII) deficiency': 1, 'carnitine palmityl transferase deficiency': 21, 'deficiencies of carnitine palmitoyl transferase II': 1, 'PEA': 6, 'Carnitine palmitoyl transferase II deficiency': 12, 'muscle form': 2, 'POPA POPC': 1, 'POPS POPC': 1, 'PPCS': 7, 'carnitine palmitoyl transferase type 2 (CPT2) deficiency': 1, 'carnitine palmitoyltransferase type 2 deficiency': 3, 'myopathic CPT2': 1, 'carnitine palmitoyl transferase II (CPT2) deficiency': 1, 'carnitine palmitoyltransferase 2 [CPT2] deficiency': 1, 'Carnitine palmitoyltransferase 2 deficiency': 7, 'PPT-1 deficiency': 1, 'Carnitin-Palmitoyl Transferase type 2 (CPT2) deficiency': 1, 'Carnitin-Palmitoyl Transferase type 2 deficiency': 1, 'muscle carnitine deficiency syndrome': 1, '1 and Type 2 PAT': 1, 'Palmitoylation': 5, 'hepatic carnitine palmitoyl transferase (CPT1 A) deficiency': 1, 'carnitine palmitoyl transferase 1 (': 1, 'POG': 1, 'PE': 2, 'CPT-deficient': 1, 'carnitine palmityl transferase (CPT) deficiency': 2, 'Palmitoylation deficiency': 1, 'carnitine palmitoyl transferase deficiency type 2': 3, 'MCD': 3, 'Metabolic Carnitine palmitoyl transferase deficiency': 1, 'Carnitin palmitoyl transferase deficiency': 1, 'muscle carnitine palmitoyltransferase deficiency': 2, 'deficiency of palmitoyl-protein thioesterase 1': 2, 'deficiency of SPT': 1, 'carnitine palmitoyl transferase 2 deficiency': 4, 'CPT-1 deficient': 1, 'CPT1 deficiency': 4, 'OPPC': 2, 'myopathic CPT2 deficiency': 1, 'POS': 1, 'POPC membrane': 1, 'muscle carnitine palmityl transferase deficiency': 2, 'PDPC': 2, 'carnitine-palmitoyl transferase': 1, 'PalCn': 1, 'CPT2-deficiency': 6, 'POPC-': 1, 'PD': 1, 'hereditary deficiency of carnitine palmitoyltransferase 2': 1, 'CPT2-deficient': 6, 'PPT1': 3, 'carnitine palmitoyltransferase type-2 (CPT2) deficiency': 1, 'Carnitine palmitoyl transferase type 2 (CPT2) deficiency': 1, 'palmitoyl protein thioesterase 1': 1, 'L-CPT1 deficiency': 1, 'deficiency of Carnitine Pamitoyl transferase II': 1, 'Carnitine Pamitoyl transferase II deficiency': 1, 'palmitoyl carnitine transferase deficiency': 2, 'Galactosyl transferase 2': 1, 'Tyrosinemia type 1 Carnitine palmitoyltransferase deficiency type 2': 1, 'carnitine palmitoyltransferase ii deficiency': 1, 'OPC': 1, 'Carnitine palmitoyl transferase I deficiency': 2, 'CPT I deficiency': 3, 'MPP2 deficiency': 1, 'carnitine palmitoyl transferase I and II deficiency': 1, 'carnitine palmotoyl transferase I deficiency': 1, 'CPT I genetic defects': 1, 'carnitine palmitoyl transferase deficiency 2': 1, 'CPT 2': 1, 'carnitine palmitoyltransferase (CPT) 2 deficiency': 1, 'd5-POPG': 1, 'cPTs': 1, 'POVPC': 3, 'carnitine palmitoyl transferase1A deficiency': 1, 'Muscle CPT II deficiency': 4, 'PCAL': 1, 'CPT (carnitine palmitoyltransferase) II muscle deficiency': 1, 'deficiency of carnitine in muscle': 1, 'carnitine palmitoyltransferase deficiency type 2': 3, 'carnitine palmyityl transferase deficiency': 1, 'carnitine palmitoyl transferase deficiency type II': 2, 'OPL': 3, 'carnitine palmitoyl transferase-II deficiency': 1, 'CPT II': 2, 'PoxnoPC': 1, 'PazePC': 2, 'type II carnitine palmitoyl transferase deficiency': 1, 'Carnitine palmitoyl transferase 1/2 deficiency': 1, 'carnitine palmitoyltransferase-II (CPT-2) deficiency': 2, 'muscle palmitoyltransferase CPT II deficiency': 1, 'PPT1-deficiency': 9, 'Carnitine palmitoyl transferase 2 (': 1, 'carnitine palmitoyl transferase II (CPT-2) deficiency': 1, 'Ox-PAPC': 1, 'carnitine palmiotoyltransferase 2 deficiency': 1, 'Carnitine palmityl-transferase (CPT) II deficiency': 1, 'carnitine palmityl-transferase II deficiency': 1, 'deficiency of CPT II': 1, 'carnitine palmitoyl transferase 2 (CPT2) deficiency': 3, 'carnitine-palmitoyl-CoA transferase II (CPT II) deficiency': 1, 'carnitine palmitoyl-2 deficiency': 1, 'Serine C-palmitoyl transferase deficiency': 1, 'Carnitine Palmitoyl Synthase I Deficiency (': 1, 'Carnitine Palmitoyl Synthase Deficiency': 1, 'carnitine palmitoyltransferase 1b (muscle isoform) deficiency': 1, 'SPT': 1, 'carnitine palmityl-transferase deficiency': 1, 'POV-PC': 1, 'Cpt2 deficiency': 1, 'palmityl-carnitine transferase deficiency': 2, 'CPT2D': 7, 'CPT2D.': 3, 'carnitine palmitoyl transferase type II deficiency': 2, 'muscle CPT deficiency': 1, 'deficiency of hepatic carnitine acyl transferase': 1, 'deficiency of palmitoyl-protein thioesterase-1': 2, 'Muscle carnitine deficiency syndrome': 1, 'PLCS': 1, 'carnitine palmitoyltransferase 2 deficiencies': 1, 'Carnitine palmitoyl-transferase II (CPT II) deficiency': 2, 'carnitine palmitoyl-CoA transferase type II (CPT-II) deficiency': 1, 'CPT-II deficiency': 5, 'muscular atrophyAlpha 1 4 glucosidase deficiencyCarnitine palmitoyl transferase II': 1, 'CPT-deficiency diseases': 1, 'Carnitine palmityl transferase (CPT) deficiency': 1, 'carnitine palmitoyl transferase type II/translocase deficiencies': 1, 'carnitine palmitoyltransferase 2 (CPT-2) deficiency': 1, 'oxPAPC': 3, 'deficiency of long chain base 2 of serine palmitoyltransferase': 1, '1 or type 2 PAT': 1, 'Carnitine Palmitoyl Transferase (CPT) deficiency Type I and Type II': 1, 'muscle carnitine deficiencies': 1, 'recessive CPT II deficiency': 1, 'carnitine palmityl transferase II deficiency': 2, '2-PPC': 1, 'Muscle carnitine palmitoyltransferase (CPT) II deficiency': 2, 'carnitine palmitoyltransferase-2 (CPT2) deficiency': 3, 'carnitine O-palmitoyltransferase 2 (CPT2) deficiency': 1, 'muscle carnitine palmitoyltransferase II (CPT II) deficiency': 1, 'DPPs': 1, 'Carnitine palmitoyl transferase (CPT) type 2 deficiency': 1, 'CPT type 2 deficiency': 1, 'Deficiency in palmitoyl protein thioesterase': 1, 'muscle carnitine': 2, 'carnitine palmitoyl transferase-1 deficiency': 2, 'CPT': 6, 'CPT deficiencies': 1, 'PSPC': 5, 'POPI': 3, 'Carnitine deficiency of skeletal muscle': 1, 'Metabolic and mitochondrial disorders of muscle Carnitine palmitoyltransferase II deficiency': 1, 'deficiency of carnitine or carnitine-palmitoyl transferase': 1, 'Carnitine Palmitoyl Transferase 1 Deficiency': 1, 'Carnitine palmitoyl transferase I (CPT I) deficiency': 1, 'carnitine palmitoyl transferase I (CPT I) deficiency': 1, 'CPT-2 deficiency': 4, 'CPT-2 deficiencies': 1, 'Muscle carnitine palmityltransferase deficiency': 3, 'PHVPC': 2, 'PCD': 1, 'carnitine palmitoyl transferase type II (CPT II) deficiencies': 1, 'palmitoyl protein thioesterase-1': 1, 'CPT2 (Carnitine palmitoyltransferase 2) deficiency': 1, 'Deficiency of palmitoyl protein thioesterase 1': 1, 'deficiency of muscle Carnitine': 1, 'POPE-N3': 1, 'carnitine palmitoyl transferase-2 deficiency': 1, 'PAT-deficiency': 1, 'Carnitine palmitoyl transferase (CPT1) deficiency': 1, 'Palmitoylation Disease': 1, 'deficiency of carnitine palmityl transferase': 3, 'CACT deficiency': 1, 'carnitine palmitoyl transferase deficiencies I or II': 1, 'POP-SOS': 1, 'type 2 carnitine palmitoyltransferase deficiency': 2, 'carnitine palmitoyl transferase II (CPTII) deficiency': 1, 'CPTII deficiency': 3, 'CPTII insufficiency': 1, 'PPT1 deficient': 1, 'CPT2': 3, 'Carnitine palmitoyltransferase type 2 deficiency': 2, 'carnitine palmitoyl transferase I deficiency': 2, 'carnitine palmitoyl transferase-': 1, 'deficiency of serine palmitoyltransferase subunit 2': 1, 'carnitine palmitoyl transferase 2 deficiencies': 1, 'CPT2 deficiencies': 3, 'Carnitine palmitoyl transferase (CPT) II deficiency': 2, 'NPPE': 1, 'carnitine palmitoyl transferase (CTP) deficiency': 1, 'CPT1A deficiency': 1, ']-POPC': 1, 'SPTS': 1, 'cPt': 1, 'deficiency of PPT1': 2, 'OxPAPC condition': 1, 'Carnitine palmitoyl-transferase-II deficiency': 1, 'Carnitine palmitoyl-transferase-IA deficiency': 1, 'Palmitoyl-protein thioesterase (PPT) deficiency': 1, 'Carnitine Palmitoyl Transferase (CPT) Deficiency': 1, 'carnitine palmitoyl transferase-1 (CPT-I) deficiency': 1, 'Muscular carnitine-palmityl-transferase deficiency': 1, 'Deficiency in carnitine-palmityl-transferase': 1, 'carnitine palmitoyl-transferase deficiency': 1, 'carnitine transferase II deficiency': 1, 'carnitine palmitoyl, basal transferase I or II deficiency': 1, 'Carnitine palmitoyltransferase 2 (CPT2) deficiency': 4, 'carnitine palmitoyltransferase type 2 (': 1, 'carnitine palmitoyltransferase type 2 (CPT-II)': 1, 'CPTII muscle deficiency': 1, 'muscle CPTII disease': 1, 'Carnitine-palmitoyltransferase 2 deficiency': 1, 'MITOCHONDRIAL CARNITINE PALMITOYL TRANSFERASE I': 1, 'serine palmitoyl-CoA transferase deficiency': 1, 'deficiency in muscle carnitine palmityltransferase': 1, 'deficiency of muscle carnitine palmityltransferase': 1, 'muscle carnitine palmityltransferase deficiency': 1, 'POPC SLB': 1, 'POPE SLB': 1, 'deficiency in palmitoyl protein thioesterase 1': 1, 'CPT-1 deficiency': 1, 'Deficiency of carnitine palmitoyl transferase': 1, 'POPC/': 1, 'POPE Mixture': 1, 'deficiency of palmitoyl protein thioesterase-1': 1, 'deficiency of palmitoyl protein thioesterase': 2, 'deficiency of palmitoyl:protein thioesterase 1': 1, 'carnitine palmitoly-transferase deficiency': 1, 'palmitoyl-carnitine transferase deficiency': 1, 'muscle carnitine deficient': 1, 'Carnitine palmitoyltransferase-2 deficiency': 1, 'Mitochondrial carnitine palmitoyl transferase II deficiency': 1, '7PC': 1, '5PC': 1, 'Carnitine-palmityl-transferase deficiency': 1, 'Carnitine Palmitoyl Transferase 2 (CPT2) deficiency': 2, 'inborn defects in CPT2': 1, 'Carnitine palmitoyl transferase (CPT) deficiencies': 1, 'Type II carnitine palmitoyl transferase deficiency': 1, 'Carnitine palmitoyltransferase 1A (CPT1A, EC# 2.3.1.21) deficiency': 1, 'GPdi-4 POPC POPC': 1, 'Carnitine palmitoyl transferase defect type II': 1, 'muscle LC': 1, 'PAzePC': 1, 'POPC-OOH': 1, 'deficiency of carnitine palmitoyl transferase': 1, 'palmitoyl protein thioesterase 1 deficiency': 1, 'Carnitine Palmitoyl transferase 2 (CPT II) deficiency': 1, 'carnitine palmitoyltransferase type-2 deficiency': 1, 'deficiency of palmitoyl protein thioesterase 1': 1, 'Carnitine palmitoyl transferase II (CPT II) deficiency': 2, 'Carnitine palmitoyl transferase 2 (CPT 2) deficiency': 1, 'palmitoyl protein thioesterase deficiency': 3, 'carnitine palmitoyl-transferase-II (CPT-II) deficiency': 1, 'Carnitine palmitoyl-transferase deficiency': 1, 'CarAT': 1, 'carnitine palmityltransferase 2 (': 1, 'SPT deficiency': 1, 'cPT-A': 1, 'carnitine palmitoyl transferase 2 (CPT-2) deficiency': 1, 'carnitine-palmitoyl transferase II (CPT-II) deficiency': 1, 'Carnitine palmitoyltransferase type 2 (CPT2) deficiency': 1, 'PPT1) disease': 1, 'PA-PC': 1, 'MPD': 1, 'Deficiency of muscle carnitine palmityltransferase': 1, 'Deficiency in palmitoyl-protein thioesterase': 1, 'Muscle carnitine palmitoyltransferase II deficiency': 1, 'PPT1 neuronal deficiency': 1, 'deficiency in palmitoyl protein thioesterase-1': 1, 'congenital deficiency of CPT2': 1, '-DH-MPT-ACP-': 1, 'carnitine-palmitoyl-transferase deficiency': 1, 'liver, platelet, and muscle deficiency of CPT': 1, 'PALMITOYLATION OF MOLECULAR': 1, 'PM': 1, 'neonatal carnitine palmitoyl transferase II deficiency': 1, 'CHIME-Cpt': 1, 'PPKM': 1, 'skeletal muscle carnitine deficiency': 1, 'Carnitine palmitoyl transferase (CPT-II) deficiency': 1, 'CPT-II muscle deficiency': 1, 'Carnitine palmitoyl transferase 2 (CPT II) deficiency': 1, 'Palmitoylation defect': 1, 'carnitine palmitoyltransferase 2': 1, 'carnitine palmitoyl-CoA transferase deficiencies': 1, 'Carnitine Palmitoyl Transferase 2 deficiencies': 1, 'carnitine palmitoyl transferase (CPT) II deficiency': 1, 'carnitine palmitoyltransferase 2 (': 1, 'carnitine-palmitoyl-transferase-II (CPT-II) deficiency': 1, 'muscle carnitine palmitoyltransferase-A deficiency': 1, 'POPC (PC)': 1, 'POEPC': 1, 'Carnitine palmitoyltransferase 1 and 2 deficiencies': 1, 'PPTs': 1, 'PROTEIN PALMITOYLATION': 1, 'carnitine palmitoyl-transferases 2) deficiency': 1, 'ON-PC': 1, 'Carnitine palmitoyl transferase deficiency type 2': 1, 'Carnitine palmitoyl transferase deficiency type 2 (': 1, 'deficiency of CPT2': 1, 'CPT2) deficiencyb': 1, 'carnitine palmitoyl transferase 1 (CPT1) deficiency': 1, '-POPC': 1, 'cpt ii deficiency': 1, 'cpt deficiency, hepatic, type ia': 1, 'cpt deficiency': 1, 'palmitoylation': 2, 'PPs': 1, 'CPT IA': 1, 'carnitine palmitoyl transferase type IA deficiency': 1, 'muscle carnitine palmitoyl transferase II deficiency': 1, 'Muscle Carnitine Palmitoyltransferase II Deficiency': 1, 'Muscle CPT II': 1, 'FUNCTIONAL IMPLICATIONS OF PALMITOYLATION AND ISOPRENYLATION': 1, 'palmitoyl transferase deficiency': 1, 'muscle total carnitine': 1, 'genetic abnormalities of PPT1': 1, 'CRATs': 1, 'carnitine-palmitoyl-transferase-II (CPT) deficiency': 1, 'MP': 1, 'carnitine palmityl transferase II (CPT II) deficiency': 1, 'PAz-PC': 1, 'CLN1 disease': 1, 'Carnitine palmityl transferase I deficiency': 1, 'carnitine palmityl transferase I deficiency': 1, 'PTE': 1, 'Carnitine palmitoyltransferase (CPT) 2 deficiency': 1, 'Deficiency of CPT I': 1, 'deficiencies of palmitoyl-protein thioesterase I': 1, 'PALMITOYL': 1}
|
POPC
|
Disease
|
MESH:C535590
|
{'pneumopathy': 931, 'pneumopathies': 657, 'Bullous pneumopathy': 5, 'chronic eosinophilic pneumonia': 617, 'idiopathic chronic eosinophilic pneumonia': 43, 'CEP': 201, 'Chronic eosinophilic pneumonia': 231, 'interstitial pneumopathy': 140, 'broncho-pneumopathy': 21, 'Interstitial pneumopathies': 12, 'Interstitial pneumopathy': 30, 'Granulomatous pneumopathy': 2, 'pneumopathie': 69, 'pneumopathies bacteriennes': 2, 'idiopathic interstitial pneumopathy': 2, 'autoimmune pneumopathy': 3, 'Bullous pneumopathies': 2, 'dyspneic pneumopathy': 1, 'Chronic Eosinophilic Pneumonia': 31, 'broncho-pneumopathies': 39, "Carrington's disease": 14, 'ICEP': 28, 'Carrington disease': 3, 'Idiopathic chronic eosinophilic pneumonia': 30, 'alveolo-septal diffuse pneumopathy': 1, 'Cytomegalovirus pneumopathies': 1, 'CIP': 3, 'Chronic Pneumopathies': 2, 'chronic pneumopathy': 13, 'chronic pneumopathies': 7, 'chronic interstitial pneumopathy': 4, 'interstitial pneumopathies': 25, 'Chronic interstitial pneumopathy': 4, 'pleuro-pneumopathies': 3, 'Pneumopathies': 65, 'BPCO': 17, 'broncho-pneumopathie chronique obstructive': 12, 'Pneumopathy': 159, 'intrauterine pneumopathies': 1, 'cardiogenic pneumopathies': 1, 'Broncho-Pneumopathie': 2, 'chronic obstructive broncho-pneumopathy': 12, 'PNEUMOPATHIES IN INFANCY': 1, 'idiopathic eosinophilic syndrome': 6, "Carrington's pneumonia": 2, 'chronic obstructive broncho-pneumopathies': 3, 'Chronic pneumopathies': 3, 'Broncho-pneumopathie': 4, 'idiopathic eosinophilic oesophagitis': 5, 'Cadiogenic pneumopathies': 1, 'alveolar-interstitial pneumopathy': 2, 'immunologic pneumopathy': 1, 'tuberculous pneumopathy': 2, 'obstructive chronic broncho-pneumopathy': 2, 'hyaline pneumopathy': 1, 'Pneumopathie': 22, 'radiogenic pneumopathy': 5, 'idiopathic acute/chronic EP': 1, 'obstructive broncho-pneumopathy': 2, 'restrictive pneumopathy': 7, 'alveolo-interstitial pneumopathies': 1, 'lymphatic pneumopathy': 1, 'Adenosinus pneumopathies': 1, 'PNEUMOPATHY': 7, 'Obstructive Chronic Broncho-Pneumopathy': 1, 'Eosinophilic pneumopathy': 1, 'Carrington': 2, 'DYSPNEIC PNEUMOPATHIES IN INFANTS': 1, 'Miliary pneumopathy': 1, 'chronic recurrent eosinophilic pneumonia': 1, 'asthma-CEP': 1, 'osteoplastic pneumopathy': 5, 'Idiopathic eosinophilic meningoencephalomyelitis': 3, 'Sclerodermal pneumopathy': 3, 'gigantocellular pneumopathy': 1, 'phlogotic pneumopathy': 1, 'diabetic pneumopathy': 5, 'chronic inflammatory interstitial pneumopathy': 1, 'eosinophilic pneumopathy': 6, 'idiopathic eosinophilic pneumonia': 33, 'Bacterial Pneumopathies': 1, 'bacterial Pneumopathies': 1, 'hypersensitivity pneumopathies': 4, 'chronic obstructive pneumopathies': 12, 'chronic idiopathic eosinophilic pneumonia': 5, 'idiopathic eosinophilic colitis': 1, 'Chronic Pneumopathy of Eosinophils': 1, 'interstitielle Pneumopathie': 1, 'Pleuro-pneumopathy': 2, 'AEP': 1, 'inflammatory pneumopathy': 1, 'pneumopathie interstitielle': 14, 'Pneumopathie interstitielle': 2, 'chronic eosinophil pneumonia': 1, 'chronic obstructive pneumopathy': 18, 'hypoxemic pneumopathy': 5, 'BPCO)': 1, 'BULLOUS PNEUMOPATHY CAUSED BY KOCH BACILLUS': 1, 'HSP': 1, 'Hypersensitivity pneumopathies': 4, 'Pneumopathie aigue': 1, 'pneumopathie aigue': 2, 'Eosinophilic pneumonia chronic': 1, 'diffuse pneumopathy': 1, 'COBP': 3, 'Sinusbronchial pneumopathy': 1, 'Cavitating pneumopathy': 1, 'Idiopathic Chronic Eosinophilic Pneumonia': 7, 'CEP lesions': 1, 'idiopathic hyper-eosinophilic syndrome': 18, 'IEP': 8, 'chronic idiopathic pneumonia': 3, 'pneumococcal pneumopathy': 1, 'hypoxic pneumopathies': 1, 'Pneumopathies nosocomiales': 1, 'idiopathic acute or chronic eosinophilic pneumonia': 2, 'idiopathic acute and chronic eosinophilic pneumonia': 1, 'PI': 1, 'Idiopathic Hyper-Eosinophilic Syndrome': 1, 'bullous pneumopathy': 13, 'Diffuse interstitial pneumopathies': 2, 'Bilateral excavated nodular pneumopathy': 1, 'pneumopathie infectieuse': 4, 'alveolo-interstitial pneumopathy': 3, 'Rheumatoid pneumopathy': 2, 'primary bullous pneumopathy': 1, 'Diffuse pneumopathy': 1, 'Embolic pneumopathy': 2, 'malignant pneumopathy': 1, 'LEUKEMIC PNEUMOPATHY': 1, 'Idiopathic eosinophilic meningoencephalitis': 2, 'broncho-pneumopathies chroniques obstructives': 1, 'Broncho-pneumopathie A09': 1, 'broncho-pneumopathie': 9, 'febrile pneumopathy': 3, "Carrington's chronic eosinophilic pneumonia": 3, 'Lymphocytic interstitial pneumopathy': 2, 'VARIOUS PNEUMOPATHIES': 1, 'chronic EP': 4, 'chronic obstructive broncho pneumopathy': 3, 'Idiopathic hyper eosinophilic syndrome': 1, 'pleuro-pneumopathy': 8, 'allergic pneumopathy': 1, 'dysreactive pneumopathy': 1, 'interstial pneumopathy': 1, 'inflammatory pneumopathies': 1, 'Toxic pneumopathy': 1, 'Osteoplastic pneumopathy': 8, 'Obstructive diffuse interstitial pneumopathy': 1, 'Chronic pneumopathy': 8, 'pulmonary alveolar pneumopathy': 1, 'Idiopathic eosinophilic pneumonias': 2, 'cytomegalovirus pneumopathy': 4, 'Pleuro-pneumopathies': 2, 'Idiopathic eosinophilic pneumonia': 7, 'Varicellar pneumopathy': 1, 'Uremic pneumopathy': 2, 'Idiopathic HES': 1, 'idiopathic HES': 1, 'CHRONIC BRONCHO-PNEUMOPATHY': 1, 'Broncho-pneumopathies': 4, 'PAN': 1, 'pleuro-pneumopathies bacteriennes': 1, 'pneumopathies massives': 1, 'pneumopathies aigues': 4, 'pneumopathies tuberculeuses': 1, 'hemorrhagic pneumopathy': 3, 'alveolar interstitial pneumopathy': 1, 'NON-TUBERCULOUS PNEUMOPATHIES': 1, 'pleuro-pneumopathie basale': 1, 'Schistosomal pneumopathy': 1, 'P. jiroveci pneumopathy': 1, 'idiopathic eosinophilic meningoencephalomyelitis': 1, 'Pulmonary Interstitial pneumopathy': 1, 'dyspneic pneumopathies': 4, 'diffuse interstitial pneumopathy': 11, 'Alveolar-interstitial pneumopathy': 1, 'Restrictive pneumopathies': 1, 'PNEUMOPATHIES': 6, 'obstructive pneumopathy': 10, 'PID': 6, 'uremic pneumopathy': 2, 'pseudo-tuberculous pneumopathy': 1, 'alveolitic-interstitial pneumopathy': 1, 'pneumopathie interstitielle diffuse': 2, 'Primary interstitial pneumopathies': 1, 'chronic eosinophilic pneumonias': 1, 'Chronic infiltrating eosinophilic pneumonia': 1, 'Diffuse interstitial pneumopathy': 4, 'Chronic eosinophilic pneumonia Pulmonary radiation injury': 1, 'pneumopathie bacterienne': 2, 'chronic obstructive bronco pneumopathy': 1, 'NON-SPECIFIC PNEUMOPATHIES IN CHILDREN': 1, 'Carrington chronic eosinophilic pneumonia': 1, 'Rheumatic pneumopathy': 2, 'idiopathic eosinophilic bronchopneumopathy': 2, 'Primary familial bullous pneumopathy': 1, 'allergic pneumopathies': 2, 'immuno-allergic pneumopathies': 1, 'BOOP': 1, 'ASPECTS OF INTERSTITIAL PNEUMOPATHIES': 1, 'obstructive pneumopathy disease': 1, 'bacterial pneumopathies': 4, 'pneumopathie aigue communautaire': 2, 'PAC': 5, 'Cholesterol pneumopathy': 1, 'diffuse infiltrating pneumopathy': 1, 'Fibrotic interstitial pneumopathies': 1, 'chronic obstructive pneumopathy disease': 4, 'Idiopathic canine eosinophilic bronchopneumopathy': 1, 'INTERSTITIAL PNEUMOPATHY': 1, 'neurogenic pneumopathy': 2, 'Postoperative pneumopathy': 1, 'mycoplasma pneumopathy': 1, 'post-obstructive pneumopathy': 2, 'adenoviral and influenzal pneumopathies': 1, 'pleuro-pneumopathie': 2, 'RACEMOSE OSTEPLASTIC PNEUMOPATHY': 1, 'Hyperergic pneumopathy': 1, 'NSIP': 1, 'idiopathic chronic EP': 2, 'neutropenic pneumopathy': 1, 'Aplastic pneumopathy': 1, 'Pseudosyphilitic pneumopathy': 1, 'Pneumopathie infectieuse': 2, 'idiopathic eosinophilic disorder': 1, 'pneumopathies d hypersensibilite': 1, 'PHS': 1, 'POC': 1, 'PINS': 1, 'pneumopathie infiltrante': 2, 'and recurrent pneumopathies': 1, 'rachitic pneumopathy': 1, 'Carrington rot': 1, 'aspergillary pneumopathies': 1, 'alveolar pneumopathy': 2, 'Allergic interstitial pneumopathy': 1, 'chronic obstructive bronco-pneumopathy': 2, 'autosomal recessive pneumopathy': 1, 'eosinophilic or interstitial pneumopathies': 1, 'CR': 1, 'Chronic eosinophilic Pneumonia': 1, 'Idiopathic CEP': 2, 'CEP with nodules': 1, 'granulomatous pneumopathy': 2, 'and parietoalveolar pneumopathy': 1, 'Chronic obstructive pneumopathies': 1, 'CHRONIC NON-SPECIFIC PNEUMOPATHIES': 1, 'bacterial pneumopathy': 4, 'Bacterial pneumopathies': 2, 'Immuno-allergic pneumopathy': 1, 'Pneumopathie interstitielle inflammatoire': 1, 'Chronic idiopathic eosinophilic pneumopathies': 1, "Carrington's chronic eosinophilia pneumonia": 1, 'eosinophilic pneumopathies': 3, 'PNEUMOPATHIES CAUSED BY': 1, 'Eosinophilic pleuro-pneumopathy': 1, 'Hypoxemic pneumopathy': 2, 'Chronic eosinophilic pneumonia in AIDS': 1, 'metabolic pneumopathy': 1, 'bronco-pneumopathy': 1, 'Chronic idiopathic eosinophilic pneumonia': 2, 'bullous air pneumopathies': 1, 'CEP 1': 1, 'Cavitated chronic eosinophilic pneumonia': 1, 'COP': 1, 'cryptogenic organising pneumopathy': 2, 'post-COVID pneumopathy': 1, 'Neonatal pneumopathy': 1, 'Interstial pneumopathy': 1, 'neutrophilic pneumopathy': 1, 'CHRONIC PNEUMOPATHIES': 2, 'Tuberculous pneumopathy': 1, 'BACTERIAL NONTUBERCULOUS PNEUMOPATHIES': 1, 'Neoplastic-lide chronic pneumopathy': 1, 'hypersensitivity pneumopathy': 3, 'chronic densifying pneumopathy': 1, 'broncho-pleuro-pneumopathies': 1, 'pneumopathy:23': 1, 'Pneumopathie 2': 1, 'lung pneumopathy': 3, 'postactinic pneumopathy': 1, 'Eosinophilic Idiopathic Eosinophilic CRS': 1, 'Idiopathic eosinophilic chronic rhinosinusitis': 1, 'congenital pneumopathy': 1, 'idiopathic eosinophilic pneumonias': 3, 'pneumopathies interstitielles': 1, 'pneumopathie interstitielle fatale': 1, 'chronic interstitial familial pneumopathy': 1, 'granulomatous pleuro-pneumopathy': 1, 'post obstructive pneumopathy': 1, 'Cytomegalovirus pneumopathy': 4, 'Alveolointerstitial pneumopathy': 1, 'PN tardives': 1, 'pneumopathies nosocomiales': 2, 'PN': 1, 'pneumopathie nosocomiale': 2, 'malformative pneumopathies': 1, 'diffuse pneumopathies': 1, 'toxic pneumopathies': 1, 'Chronic broncho-pneumopathies': 1, 'Perfusion pneumopathy': 1, 'pneumopathy dysfunction': 1, 'Gas pneumopathy': 1, 'Idiopathic EME': 1, 'Enzootic pneumopathies': 1, 'Interstitial Pneumopathies': 3, '(chronic) eosinophilic pneumonia': 2, 'DIP': 2, 'Miliary cholesterol pneumopathy': 1, 'pulmonary pneumopathy': 2, 'Intestitial pneumopathy': 1, 'eosinophilic broncho-pneumopathy': 2, 'idiopathic canine eosinophilic pulmonary granulomatosis': 1, 'pneumopathies infectieuses': 1, 'Chronic eosinophilic infiltrating pneumonia': 2, 'sclerodermic pneumopathy': 1, 'X-ray pneumopathy': 1, 'idiopathic eosinophilic lung': 1, 'Bullouscystic pneumopathy': 1, 'non-neoplastic pneumopathy': 1, 'NNP': 1, 'broncho pneumopathie chronique obstructive': 1, 'Chronic eosinophilic pneumonia 2': 1, '(acquired) pneumopathy': 1, 'P. carinii pneumopathy': 1, 'Diabetic Pneumopathy': 3, 'sinus-pneumopathies': 1, 'neuromyelitis Pneumopathy': 1, 'nonfibrosing pneumopathies or bronchopathies': 1, 'ETIOLOGY OF SOME CHRONIC PNEUMOPATHIES': 1, 'chronic-eosinophilic-pneumonia': 1, 'ICEP symptoms': 1, 'of pneumopathy': 1, 'Sclerodermic pneumopathy': 1, 'PNEUMOPATHIES CAUSED BY GASOLINE': 1, 'Allergic pneumopathy of': 1, 'Idiopathic eosinophilic oesophagitis': 2, 'Branching osteoplastic pneumopathy': 1, 'broncho-pneumopathies obstructives': 1, '-pneumopathie': 1, 'Chronic eosinophilic pneumonia Amyloidosis': 1, 'chronic eosinophilic pneumoniae': 1, 'Cytostatic pneumopathy': 1, 'obstructive pneumopathies': 1, 'broncho pneumopathies': 1, 'Bacterial pneumopathy': 1, 'Chronic and rheumatic pneumopathies': 1, 'IEME': 1, 'BRONCHO-PNEUMOPATHIES': 3, 'Broncho-pneumopathy': 2, 'aspergillar pneumopathy': 2, 'interstitial diffuse pneumopathy': 1, 'pneumopathie dyspneisante': 1, 'CEP 3': 1, 'postobstructive pneumopathy': 1, 'Carrington flare': 2, 'CHRONIC PNEUMOPATHY': 2, 'Broncho-pneumopathie Chronique Obstructive': 1, 'idiopathic non-eosinophilic nasal polyposis': 1, 'neonatal pneumopathies': 1, 'vesicular pneumopathy': 1, 'pneumopathie tuberculeuse': 1, 'Chronic pseudo-tumorous pneumopathy': 1, 'idiopathic fibrogenous interstitial pneumopathy': 1, 'Idiopathic fibrogenous interstitial pneumopathy': 1, 'Eosinophilic allergic pneumopathy': 1, 'diabetes Pneumopathy': 1, 'idiopathic eosinophilic pneumopathy': 1, 'PATIENT WITH CHRONIC PNEUMOPATHY': 1, 'Idiopathic eosinophilic pneumopathies': 1, 'pneumopathie aigue infectieuse': 1, 'Fibrosilicotic pneumopathies': 1, 'Chronic idiopathic pneumonia': 1, '-Pneumopathie': 1, 'barotraumatic pneumopathies': 1, 'nodular pneumopathy': 1, 'idiopathic eosinophilic spongiosis': 1, "CEP's": 1, 'broncho- pneumopathy': 1, 'eosinophil pneumopathy': 1, 'localized pneumopathies': 1, 'non-tuberculous pneumopathies': 2, 'Chronic eosinophilic pneumopathy': 1, 'chronic progressive interstitial pneumopathy': 1, 'fibrosing pneumopathy': 1, 'Carrington-Liebow syndrome': 1, 'pneumopathie varicelleuse': 1, 'grippal pneumopathies': 1, 'CMV pneumopathy': 1, 'Pneumopathy Pulmonary disease': 1, 'CEP-': 1, 'bron- cho-pneumopathie pulmonaire obstructive': 1, 'idiopathic eosinophilic CRS': 2, 'Idiopathic eosinophilic endomyocarditis': 1, 'interstitial eosinophilic pneumopathies': 1, 'leukemic pneumopathy': 1, 'Drug pneumopathy': 1, 'idiopathic eosinophilic effusions': 1, 'pneumopathies fulminantes': 1, 'broncho pneumopathy': 2, 'alveolar pneumopathies': 1, 'Fibrosing pneumopathy': 2, 'tracheo-broncho-pneumopathies': 1, 'pneumopathie aigue necrosante': 1, 'pneumopathies aigues communautaires': 1, 'Interstitial fibrosing pneumopathy': 1, 'idiopathic eosinophilic pulmonary disease': 1, 'Alveolar and interstitial pneumopathy': 1, 'Osteoplastic racemose pneumopathy': 1, 'idiopathic non-eosinophilic CRS': 1, 'febrile multifocal pneumopathy': 1, 'fibrotic pneumopathies': 2, 'idiopathic eosinophilic pulmonary syndromes': 1, 'Chronic obstructive pneumopathy disease': 1, 'Diffuse infiltrating pneumopathy': 1, 'lymphocytic interstitial pneumopathy': 1, 'postoperative pneumopathy': 1, 'idiopathic eosinophilic meningoencephalitis': 1, 'Idiopathic Eosinophilic Meningoencephalitis': 1, 'bullous pneumopathies': 1, 'Idiopathic Eosinophilic Pneumonia': 1, 'intersitial pneumopathy': 1, 'Cyanotic pneumopathy': 1, 'diffuse interstitial pneumopathies': 2, 'pneumopathies infiltrantes diffuses': 1, 'pneumopathies infiltrantes': 2, 'idiopathic hyper eosinophilic syndrome': 1, 'influenzal pneumopathy': 1, 'persistant left pneumopathy': 1, 'PNEUMOPATHIES DUE TO ADENOVIRUSES': 1, 'Radiogenic pneumopathy': 2, 'OSTEOPLASTIC PNEUMOPATHY': 1, 'pneumococcal pneumopathies': 1, 'broncho-/pneumopathy': 1, 'spastic broncho-pneumopathies': 1, 'mitral pneumopathy': 1, 'IEGM': 1, 'Oil pneumopathies': 1, 'bronchial involvement CEP': 1, 'Hypersensitivity interstitial pneumopathy': 1, 'Carrington syndrome': 1, 'pneumopathie chronique obstructive': 1, '-pneumopathie chronique obstructive': 1, 'idiopathic eosinophilic syndromes': 2, 'Chronic idiopathic eosinophilic pneumopathy': 1, 'Right lung pneumopathy': 1, 'Myleran-induced pneumopathy': 1, 'Excavated pneumopathy': 1, 'Influenzal pneumopathy': 1, 'CARRINGTON BOLTON': 1, 'broncho-pneumopathie obstructive': 1, 'Necrotizing pneumopathies': 1, 'nocardial pneumopathy': 1, 'varicelloid pneumopathy': 1, 'PSEUDO-TUMORAL FORMS OF INFECTIOUS PNEUMOPATHIES': 1, 'pneumopathy disease': 1, 'chronic eosinophilic pneumopathy': 1, 'PCIE': 1, 'PNEUMOPATHIES WITH': 1, 'CHRONIC NON-TUBERCULOUS PNEUMOPATHIES': 1, 'chronich interstitial pneumopathy': 1, 'Chronic Eosinophilic Pneumonia 10': 1, 'bronchial pneumopathy': 1, 'BACTERIAL BRONCHO-PNEUMOPATHIES': 1, 'oil pneumopathy': 1, 'chronic obstructive broncho-pneumopathy (COPB) disease': 1, 'SCLERODERMIC PNEUMOPATHY': 1, 'post-actinic pneumopathy': 1, 'fibrosing interstitial pneumopathy': 1, 'Diabetic pneumopathy': 1, 'acquired pneumopathy': 1, 'chronic broncho-pneumopathy': 1, 'PAVM': 1, 'Straphylococcal pneumopathy': 1, 'CHRONIC EOSINOPHILIC PNEUMONIA': 1, 'intersticial pneumopathy': 1, "Carrington's eosinophilic pneumonitis": 1, 'basal pneumopathy': 1, 'diffuse infiltrative pneumopathies': 1, 'chronic eosinophilic interstitial pneumonia': 1, 'canine idiopathic eosinophilic bronchopneumopathy': 1, 'idiopathic pulmonary eosinophilic granulomatosis': 1, 'LEUKEMIC PNEUMOPATHIES': 1, 'multifocal alveolar pneumopathy': 1, 'pneumopathie varricelleuse': 1, 'broncho -pneumopathies': 1, 'hemoptic pneumopathy': 1, 'Xanthomatous Interstitial Pneumopathy': 1, 'pleuro pneumopathy': 1, 'rheumatic chronic eosinophilic pneumonia': 1}
|
pneumopathy
|
Disease
|
MESH:C535591
|
{'1p': 201, 'tumors,1p': 1, '1p/19q co-deleted tumours': 2, '1P-T': 16, '1p/19': 3, 'trisomy 1p': 4, '1p deletion': 96, '1P-R': 39, 'Trisomy 1p': 1, 'JEDI-1P.': 1, '1PS': 6, 'monosomy 1p': 8, 'Chromosome 1p deletion': 1, '1p loss': 4, '1p/19q deletion': 7, '1P-': 11, 'Loss of chromosome 1p': 2, 'of 1p': 3, 'chromosome 1p deletion': 4, 'del(1p)': 6, '1p-deletion': 2, '1p abnormalities': 5, '-1P': 3, '1p/': 6, '1P': 9, '1p and 19': 1, 'Chromosome 1p': 1, 'deletion of 1p': 8, '-1p': 1, 'pDEST-del-1p': 1, '1p deleted': 1, '1P_1PSM': 1, '16C/2A/1P': 1, '1p terminal deletion syndrome': 1, 'IPC-1P': 2, '1p/19q deleted tumours': 1, 'deletion 1p': 2, 'Del(1p)': 2, '(1p': 2, 'Del(1p': 1, '1Ps-1Rf-2R': 1, 'CATNON': 1, 'chromosome 1p deletion syndrome': 1, 'del 1p': 2, '1p and 11q abnormalities': 2, 'loss of 1p': 2, 'deletion 1p deletion': 1, '1p del': 1, 'DN 1p _A': 1, 'Hk(1P)': 1, '1p abnormality': 2, 'abnormalities of 1p': 2, '1p and 19q deletion': 1, '1p- syndrome': 1, '1p deficiency': 1, 'Monosomy 1p': 2, '1p,19q deletions': 1, '1p, 19q deletion': 1, '1p-': 2, '1p-deleted tumours': 1, '1p/19q co-deletion': 1, '1P-B': 1, '1P-D': 1, '1P-C': 1, '1p monosomy': 1, '1N-1P': 1, '1p/19q chromosome deletion': 1, '1p deletions': 3, '1p terminal deletion': 1, 'del(1p': 3, 'LA 1P': 1, 'XLPE-1PS': 1, 'deletion of chromosome 1p': 2, '1p deletion syndrome': 3, '1P. simium I': 1, 'abnormalities in 1p': 1, '-deficiency of the 1p': 1, 'genetic abnormalities of chromosome 1p': 1, 'patella 1p': 1, 'OMO 1p': 1, 'NCD-1p': 1, 'NP_001005463.1p': 1, '1B1.1P': 1, 'Loss of 1p': 2, '1p/19q co-deleted': 1}
|
1p
|
Disease
|
MESH:C535593
|
{'BACTERIOPHAGE P22': 1, 'defect of p22': 1, 'p22 defect': 1, 'P22': 9, 'NV p22': 1, 'p22 deletion syndrome': 1, 'EPC': 1, 'LM-P22': 1, '1p31.1 Deletion Syndrome': 1, 'P22 and N20 abnormalities': 1, 'PE': 1, '1p31.3p32.2 deletion syndrome': 1, 'p22 deficiency': 1}
|
P22
|
Disease
|
MESH:C535594
|
{'1p32 chromosomal abnormalities': 1, '1p32': 3, '1p32.3': 1, 'deletion of 1p32.3': 1, 'del(1p32)': 2, 'del(1p32': 1, 'Chromosomal Deletion Syndrome 1p32-': 1, '1p32-': 1, 'del(1p32.3)': 1, '1p32 deletion': 1}
|
1p32
|
Disease
|
MESH:C535595
|
{'OLIGONUCLEOTIDES RANDOMLY LABELED WITH P32': 1, 'p32 deficiency': 2, 'MICE OF P32': 1, 'P32': 13, 'p32cKO': 1, 'WHIM2-P32': 1, 'GAMMA-P32-': 1, 'P32-LABELED PHOSPHOLIPIDS EXTRACTED': 1, 'P32 deficiency': 1, 'P32- EVALUATING': 1, 'P32-LABELED LATRODECTUS TREDECIMGUTTATUS': 1, 'MEANS OF P32': 1, 'DISTRIBUTION OF P32': 1, 'P32 deletion': 1, 'THERAPEUTIC APPLICATIONS OF P32': 1, 'P32-': 1, 'PHOSPHORUS P32': 1, '1p34.2p34.3 deletion syndrome': 1, 'THE DISTRIBUTION OF P32-LABELED STAPHYLOCOCCUS': 1, 'EFFECTS OF P32': 1, 'BETWEEN P32-': 1, 'p32-deficiency': 1, 'LABELED WITH P32': 1, 'PYRIMIDINE NUCLEOTIDES FROM P32-': 1, 'EFFECTS OF INTERNAL IRRADIATION P32': 1}
|
P32
|
Disease
|
MESH:C535597
|
{'hepatic and brain involvement': 1, 'frontal involvement': 14, 'frontal dysexecutive involvement': 1, 'anomalies involving': 3, 'Congenital anomalies involving the craniovertebral junction': 1, 'involving frontal cortex': 1, 'posterior ligamentous complex involvement': 1, 'midline anomalies involving the brain or palate': 1, 'lobe involvement': 26, 'congenital anomalies involving': 3, 'lesions involving': 15, 'Congenital anomalies involving the brain': 1, '-involving lesion': 1, 'cranium anomalies': 1, 'myocardial or brain involvement': 1, 'craniotelencephalic dysplasia': 4, 'anomalies involving the cranium and brain': 1, 'Craniotelencephalic dysplasia': 1, 'involvement of the lesion': 1, 'lesion involving': 2, "Riedel's lobe involvement": 1, 'malformations of the brain and cranium': 2, 'cutaneous lesions involving': 3, 'juvenile lesions involving': 1, 'brain pathologic involvement': 1, 'bony anomaly of the cranium': 1, 'disproportion of the cranium and brain': 1, 'brain and cranium malformations': 1, 'injury involving the transverse tarsal joint complex': 1, 'lytic lesions involving': 1, 'flocculonodular lobe involvement': 1, 'malformation of the brain and cranium': 1, 'anomaly of the anterior cranium and frontal cortex': 1, 'frontal cranium': 1, 'lesions involving the': 4, 'Malformations of the cranium, brain': 1, 'anomalies involving extremities': 1, 'visual cortical lesions involving the 17-18 complex': 1, 'anomalies of the cranium and face,': 1, 'disproportion between the cranium and brain': 1, 'complex brain anomalies': 1, 'malformations of the cranium and the brain': 1, 'anomalies of the cranium': 3, 'Pedunculated lesion involving': 1, 'brain and hepatic involvement': 1, 'brain and skeletal involvement': 1, 'narrow frontal cranium': 1, 'Chondral lesions involving': 1, 'congenital anomalies involving the': 3, 'lymphomatous involvement of the scalp and cranium': 1, 'Developmental defects of the cranium and the brain': 1, 'cranium and brain abnormalities': 1, 'pituitary and brain involvement': 1, 'malformative anomalies involving': 1, 'lesions that involve the': 1, 'involving the amygdala hippocampus complex': 1, 'cranium-facial anomalies': 1, 'defects of the brain and cranium': 1, 'congenital brain anomaly complex': 1, 'malformations of brain and cranium': 1, 'cranium anomaly': 1, 'cranium brain disease': 1, 'cranium and brain': 1, 'brain outside the cranium': 1, 'HABITUS-CRANIUM MORPHOLOGICAL COMPLEX': 1, 'hepatic, renal and brain involvement': 1, 'radiolucent lesions involving': 1, 'LM': 1, "Cohen's craniotelencephalic dysplasia": 1, 'caudate lobe involvement': 1, 'Lytic lesion involving the': 1, 'Congenital anomalies involving': 1, 'brain or multiorgan involvement': 1, 'traumatic lesions of cranium and brain': 1, 'malformations of the brain, cranium, face, skin': 1, 'lesions involving the hippocampus': 1, 'frontal defect of cranium': 1, 'lesions that involved the': 1, 'Lesion Involvement': 1, 'Tumerfective lesions involving': 1, 'congenital complex brain anomaly': 1, 'Cranium and brain': 1, 'anomalies in the cranium': 1, 'anomalies involving brain white matter': 1, 'porokeratotic lesions involving': 1, 'structural anomalies of the cranium': 1, 'lesion involving the': 1, 'brain-cranium-': 1, 'Lobe Involvement': 1, 'CRANIOTELENCEPHALIC DYSPLASIA': 1, '-involved) lesions': 1, 'anomaly complex syndrome': 1, 'frontal nerve involvement': 1}
|
lobe involvement
|
Disease
|
MESH:C535598
|
{'CK': 133, 'creatine deficiency': 140, 'Creatine deficiency': 30, 'Creatine deficiency syndromes': 26, 'SLC6A8 deficiency': 31, 'creatine deficiency syndrome': 40, 'deficiencies of creatine synthesis': 1, 'deficiency of brain creatine': 3, 'creatine transporter deficiency': 100, 'Creatine transporter (CrT) deficiency': 2, 'creatine deficiencies': 20, 'mitochondrial and creatine kinase': 1, 'CK-emia': 1, 'hyper-creatine kinase': 11, 'Cerebral creatine deficiency syndrome type 1': 1, 'cerebral creatine deficiency syndrome type 1': 1, 'Creatine transporter (CRTR) deficiency': 2, 'CRTR deficiency': 13, 'CREATIN': 3, 'Creatine transporter deficiency': 47, 'CrM': 11, 'CPY': 1, 'CTD': 49, 'Disorders of creatine metabolism': 5, 'x-linked creatine transporter defect': 1, 'CK-aemia': 1, 'Transport-related injury': 3, 'MM-creatine kinase deficiency': 1, 'creatine deficiency syndromes': 52, 'CDS': 22, 'cerebral creatine deficiency syndrome1': 1, 'X-linked cerebral creatine deficiency syndrome1': 1, 'CREATINE KINASE': 18, 'Cr deficiency syndromes': 8, 'cerebral creatine deficient syndromes': 1, 'cerebral creatine deficiency': 44, 'Cr deficiency': 35, 'Cerebral creatine deficiency syndromes': 24, 'CN': 2, 'CRM': 1, 'UACR': 1, 'cerebral creatine deficiency syndromes': 33, 'CREATINE BY': 1, 'CT deficiency': 2, 'Creatine transporter (CT) deficiency': 2, 'hyper-CK-emia': 5, 'FCC': 2, 'CREATINE-PHOSPHO-': 1, 'creatine synthesis disorders': 3, 'CREATINE': 17, 'inborn error of creatine biosynthesis': 6, 'creatine kinase': 11, 'CR': 12, 'congenital midface hypoplasia': 2, 'CCDSs': 10, 'deficit of creatine': 1, 'hyper creatine kinase': 1, 'creatine transporter dysfunction': 1, 'PACK': 1, 'X-linked creatine transporter defect': 7, 'Cr deficiencies': 5, 'creatine': 40, 'Cr': 4, 'inborn errors of creatine': 5, 'ACR': 12, 'CrMD': 1, 'ABC TRANSPORTER RELATED': 1, 'cerebral creatine transporter deficiency': 2, 'in CK': 1, 'Creatine': 5, 'deficiency of creatine kinase': 3, 'CK-deficiency': 2, 'CMS': 1, 'CCDS.SIGNIFICANCE': 1, 'Cerebral Creatine Deficiency': 3, 'Cerebral creatine deficiency syndrome': 16, 'CCDS': 33, 'Creatine metabolism disorders': 2, 'creatine transport deficiency': 12, 'disorders of creatine metabolism': 9, 'Creatine Transporter (CrT) deficiency': 1, 'CREATINE-CREATININE EXCRETION': 1, 'CRT deficiency': 4, 'X-linked creatine transporter deficiency': 32, 'creatine kinase deficiency': 7, 'X-linked creatine deficiency syndrome': 5, 'X-linked creatine transporter (SLC6A8) deficiency': 3, 'X-linked recessive cerebral creatine deficiency syndrome-1': 1, 'Creatine Transporter Deficiency': 18, 'CrT deficiency': 11, 'Cr-deficient': 3, 'lack of Cr transporter': 1, 'CM': 10, 'Macro creatine kinase type 1': 1, 'CrM.': 1, 'Cerebral Creatine deficiency syndromes': 1, 'brain creatine deficiency': 9, 'Cr transporter deficiency': 5, 'Cr transporter deficiencies': 2, 'X-linked CRTR deficiency': 1, 'Cerebral Creatine Deficiency Syndromes': 6, 'creatine transporter (CRTR) deficiency': 6, 'creatine biosynthesis disorders': 2, 'cerebral Cr deficiency': 6, 'CrT': 3, 'CCDS1': 6, 'cerebral creatine deficiency syndrome-1': 4, 'Cr deficiency diseases': 1, 'Cr deficient': 4, 'CrT impairment': 1, 'muscle creatine deficiency': 2, 'muscle Cr-deficient': 1, 'brain Cr deficiency': 2, 'X-linked Cr transporter deficiency': 1, 'Cr-deficient brain': 1, 'Creatine deficiency syndrome': 9, 'cerebral creatine deficiency syndrome': 33, 'CRT': 5, 'deficiency in creatine transporter': 1, 'CrEST': 1, 'brain creatine deficiency syndromes': 3, 'Brain creatine deficiency syndromes': 2, 'Hyper-creatine kinase-emia': 1, 'hyper-creatine kinase-emia': 3, 'creatine deficiency in the brain': 2, 'hyper-CK-': 3, 'idiopathic hyper-CK-emia': 2, 'hyper-CK': 15, 'IH': 1, 'Hyper-CK': 2, 'creatine-deficient': 3, 'SLC6A8 deficiencies': 2, 'deficiency of high-energy creatine phosphate': 1, 'CPS': 2, 'CREATINE-PHOSPHOTRANSFERASE': 2, 'Cerebral creatine deficiency': 12, 'Brain creatine defects': 1, 'CREATINE PHOSPHATE': 6, 'CK dysfunction': 2, 'creatine or': 1, 'creatine-deficiency': 6, 'CrT deficient': 3, 'CrT Deficiency': 1, 'creatine disorders': 13, 'Cerebral creatine deficiency syndrome 1': 3, 'creatine transporter deficiency syndrome': 7, 'Mitochondrial creatine kinase abnormalities': 1, 'creatine metabolism disorder': 3, 'CK deficiency': 9, 'primary creatine deficiency syndromes': 2, 'blood rise of CK': 1, 'Brain creatine deficiencies': 1, 'creatine transporter defects': 1, 'Cerebral creatine transporter deficiency': 2, 'CRTR': 2, 'defects in creatine transporter': 1, 'creatine synthesis': 2, 'CREATINE EXCRETION': 1, 'creatine kinases': 1, 'CT1 defect': 2, 'creatine metabolism deficiencies': 1, 'ORALLY ADMINISTERED CREATINE': 1, 'CREATINE-CREATININE STUDIES': 1, 'X-linked creatine transporter disorder': 1, 'inborn disorders of creatine': 1, 'creatine deficiency disorders': 13, 'MCK-I': 1, 'hyper-creatine-kinase': 9, 'CK system abnormalities': 1, 'creatine metabolism disorders': 1, 'macro-CK syndrome': 1, 'Hyper-Creatine-Kinase': 2, 'arginase (and creatine transporter) deficiency': 1, 'Primary creatine deficiency syndromes': 2, 'CTN': 1, 'creatine kinase deficiencies': 1, 'CREA': 6, 'Creatine transporter defect': 1, 'creatine deficient': 5, 'CR abnormalities': 1, 'Creatine transport deficiency': 2, 'Creatine Transport Deficiency': 1, 'CP': 1, 'hyper-creatine-kinaseemia': 1, 'inborn error of Cr deficiency syndromes': 1, 'Cr deficit': 4, 'Cr defects': 2, 'X-linked transmembrane creatine transporter deficiency': 1, 'Hyper Creatine-Kinase Emia': 1, 'creatine transporter (SLC6A8) deficiency': 1, 'Cerebral creatine deficiency syndromesGAMT deficiencyCRTR deficiency': 1, 'Creatine Deficiency Disorders': 3, 'CRTR deficiencies': 4, 'CK type 1': 2, 'Primary creatine deficiency disorders': 1, 'primary creatine deficiencies': 1, 'primary creatine disorder': 1, 'PCD': 1, 'deficiency of the creatine transporter': 2, 'creatine kinase dysfunction': 1, 'mitochondrial creatine kinase': 2, 'Chronic Creatine Deficiency': 1, 'Creatine transporter (CrT; SLC6A8) deficiency': 1, 'bKO': 1, 'CK abnormalities': 3, 'deficiency of creatine': 9, 'Hyper-CK-emia': 1, 'autosomal recessive inborn error of creatine biosynthesis': 1, 'inborn error of creatine': 1, 'Cr disorders': 2, 'Primary creatine disorders': 1, 'Cr loss': 1, 'creatine synthesis deficiency': 1, 'Cr-deficient disorders': 1, 'creatine shuttle': 1, 'tCr': 1, 'IHCK': 2, 'Creatine (Cr) Transporter Deficiency': 1, 'Cr syndromes': 1, 'CREATINE SYNTHESIS': 3, 'CRT-deficiency': 1, 'CS': 2, 'Creatine transporter (SLC6A8) deficiency': 1, 'Creatine Transporter (SLC6A8) Deficiency': 1, 'axonal transport retardation': 1, 'TIs': 1, 'Transport-Related Injuries': 1, 'Transport-related injuries': 2, 'CRE': 9, '-traumatic deformities of the midface': 1, 'hyper creatine-kinase-emia': 1, 'creatine synthesis and transport disorders': 1, 'creatine kinasaemia': 1, 'cytosolic creatine kinase deficiencies': 1, 'CTD cardiac pathology': 1, 'CTD disease': 2, 'CTD cardiac manifestations': 1, 'X-linked Creatine transporter deficiency': 2, 'creatine synthesis deficiencies': 3, 'CTD cognitive abnormalities': 1, 'creatine transport abnormalities': 1, 'CTD cardiac disease': 1, 'cerebral creatine deficiency syndrome 1': 7, 'CREATINE BODIES': 1, 'creatine transport defect': 2, 'Cre deficiency': 1, 'Creatine kinasis': 1, 'Cr transporter': 1, 'renal creatine transporter deficiency': 1, 'Brain creatine deficiency': 2, 'inborn errors in creatine': 1, 'BCr-d': 1, 'Brain creatine (Cr) deficiencies': 2, 'X-linked creatine-deficiency syndrome': 1, 'creatine-deficiency syndrome': 2, 'creatine transporter deficiency disorder': 1, 'Creatine (Cr) transporter deficiency': 1, 'creatine transporter': 4, 'CREATINISM': 2, 'congenital creatine deficiencies': 1, 'congenital creatine deficiency': 2, 'creatine Disease': 1, 'CREATINE KINASE ISOZYMES': 1, 'Creatine deficiency disorders': 3, 'inborn errors of creatine biosynthesis': 1, 'CDD': 1, 'X-linked cerebral creatine deficiency': 5, 'CREATINE-1-C-14': 2, 'Creatine transporter (SLC6A8': 1, 'cerebral creatine syndromes': 1, 'creatine transporter (SLC6A8': 1, 'Creatine Deficiency Syndromes': 4, 'creatine transporter deficiencies': 3, 'cerebral creatine deficiencies': 1, 'hyper-creatine-kinase emia': 1, 'Cerebral Creatine Deficiency Syndrome': 6, 'X-linked creatine transporter': 2, 'X-linked creatine transporter deficiency syndrome': 1, 'Congenital creatine transporter deficiency': 1, 'Cr transporter (Crt; SLC6A8) deficiency': 1, 'Cr transporter (Crt) deficiency': 1, 'cerebral Cr deficiency syndromes': 3, 'myopathic hyper-CK': 1, 'myogenic hyper-CK': 1, 'myopathic hyper-creatine kinase': 1, 'creatine kinase-MB': 2, 'CK-MB': 9, 'congenital creatine deficiency syndromes': 1, 'CTD.[33': 1, 'creatine transporter disorder': 1, 'creatine transporter defect': 4, 'Cerebral CDS': 1, 'cerebral creatine (Cr) deficiency': 3, 'CrCEST': 2, 'of the creatin kinase': 1, 'CK deficiency disease': 1, 'macro-CK type 1': 2, 'Creatine Defects': 1, 'nCr': 1, 'creatine transporter (CT1) deficiency': 1, 'hyper CK-emia': 1, 'CPK-MB': 1, 'inborn error of Cr biosynthesis': 1, 'creatine deficiency syndrome type 1': 1, 'defect of creatine transport': 1, 'CRE abnormalities': 1, 'deficiency of the X-linked creatine transporter': 1, 'X-linked CTD': 2, 'creatine disorder': 2, 'EFFECT OF CREATINE ON': 1, 'x-linked creatine transporter deficiency': 1, 'Creatine transporter (CrT)-deficiency': 1, 'CrT-deficient': 2, 'CrT-deficiency': 1, 'Creatine Energy Substrate Anaplerosis': 1, 'deficiency of CK': 1, 'Psychosis-associated creatine kinase': 1, 'CK)-emia': 1, 'CRTR-D': 4, 'CRTR-D.': 2, 'Brain creatine deficiency syndrome': 1, 'short midface': 1, 'transport-related injury': 2, 'cerebral Cr deficiency syndrome': 1, 'Cr/CrT deficiency': 1, 'Cr abnormalities': 1, 'Creatine Transporter Deficiency (CTD) Syndrome': 1, 'Creatine transporter deficiency syndrome': 1, 'deficiency of both creatine and': 1, 'X-linked Creatine Transporter Deficiency': 2, 'X-linked Creatine Transport Deficiency': 1, 'X-linked creatine deficiency': 2, 'creatine transport disorder': 1, 'brain creatine depletion': 1, 'autosomal recessive transport defect': 1, 'primary creatine disorders': 1, 'Cl- transport defect-related disease': 1, 'CTD.3': 1, 'CDSs': 2, 'CK deficiencies': 1, 'creatine deficits': 5, 'CK ACTIVITY': 1, 'creatine deficiency disorder': 5, 'BONZAI RELATED CREATINE KINASE': 1, 'macro CK type 1': 1, 'x-linked creatine transport deficiency': 1, 'creatine metabolism defects': 1, 'NA/Cr abnormality': 1, 'Creatine disorders': 2, 'hyper-creatine kinase-aemia': 1, 'brain creatine transporter deficiency': 1, 'creatine transport (CRTR)': 1, 'creatine/phosphocreatine deficiency': 1, 'CRT-D': 1, 'Creatine transporter (CRT) deficiency': 1, 'Creatine deficiencies': 2, 'Cerebral creatine deficiencies': 1, 'BEHAVIOR OF CREATINE AND': 1, 'Primary creatine deficiency syndrome': 1, 'PCDSs': 1, 'Macro-creatine kinase': 1, 'macro-CK': 2, 'Cerebral creatine kinase deficiency': 1, 'multisystemic transport defects': 1, 'brain creatine deficiency syndrome': 1, 'CTP': 1, 'CTP deficiency': 1, 'CTP deficient': 1, 'autosomal recessive cholesterol transport defect': 1, 'COMPARATIVE RENAL DISPOSITION OF CREATINE': 1, 'idiopathic hyper-CK': 1, 'of creatine': 1, 'CK deficiency diseases': 1, 'CCD': 1, 'Creatine Transporter Defect': 1, 'X-linked CT deficiency': 1, 'hyper creatine-kinase emia': 1, 'Creatine transport disorders': 1, 'creatine biosynthesis': 1, 'Creatine Deficiency': 1, 'ACC': 1, 'PAPER CHROMATOGRAPHY OF CREATINE AND CREATININE IN PLASMA': 1, 'Creatine depletion': 1, 'creatine depletion': 1, 'creatine (Cr) deficiency': 1, 'FACT': 1, 'CRT deficiencies': 1, 'Creatine biosynthesis disorder': 1, 'Creatine transporter deficiency Down syndrome': 1, 'creatine transporter deficiency (CTD) disorder': 1, 'Creatine-Deficiency': 1, 'CRCL': 1, 'creatine transporter (SLC6A8) deficiency syndrome': 2, 'creatine (Cr) transporter deficiency syndrome': 1, 'inherited CT deficiency syndrome': 1, 'CT': 1, 'motor vehicle and transportation-related injury': 1, 'idiopathic hyper-CK-': 1, 'CREATINE CLEARANCE': 2, 'Episodic Hyper-creatine Kinase': 1, 'Creatine Deficiency Syndrome': 2, 'CREATINE-1-C14': 1, 'CREATINE BIOSYNTHESIS': 1, 'hyper-creatine-phosphokinasemia': 1, 'deficiency of creatine transporter': 1, 'MTC': 1, 'Cerebral Creatine Deficiency Syndrome-1': 1, 'Cerebral creatine deficiency syndrome-1': 1, 'idiopathic hyper-creatine kinase': 2, 'CK-syndrome': 1, 'Creatine transporter disorder': 1, 'TRANSPORT-RELATED ISSUES ENCOUNTERED': 1, 'cerebral creatine deficiency syndrome I': 1, 'CCDSI': 1, 'Creatine (Cr) transporter (CrT) deficiency syndrome': 1, 'CTD disorder': 1, 'Cr deficits': 1, 'Cr-deficiency syndromes': 1, 'creatine (Cr)-deficiency syndrome': 1, 'Cr deficiency syndrome': 3, 'Cr-deficiency': 1, 'Cr-deficiency syndrome': 1, 'Cr-deficiencies': 1, 'creatine metabolism deficiency': 1, 'MM creatine kinase': 2, 'CK-MM': 3, 'PC': 1, 'macro creatine kinase type 1': 1, 'creatine transport (creatine transporter (CRTR) deficiency': 1, 'inborn creatine synthesis deficiencies': 1, 'Mi-CK': 2, 'CREATINE KINASE ACTIVITY': 2, 'deficiency of CA': 1, 'hyper-creatine kinaseemia': 1, 'HCK': 1, 'PCDD': 1, 'primary creatine deficiency disorders': 1, 'creatine-transporter deficiency': 1, 'of creatine kinase': 1, 'of Creatine Kinase': 1, 'Cr transport': 1, 'X-linked Cr deficiency syndrome': 1, 'THE HETEROGENICITY OF CREATINE KINASE': 1, 'Deficiency of creatine kinase': 1, 'creatine metabolic disorders': 1, 'Creatine metabolic disorders': 1, 'Complete brain-type creatine kinase deficiency': 1, 'mitochondrial and cytosolic creatine kinase deficiencies': 1, 'CK disease': 1, 'hyper-creatin-kinase': 1, 'creatin-cinasa': 1, '2-HCT': 1, 'creatine kinase-deficient': 1, 'hyper-creatine-kinase-emia': 1, 'Deficiency of creatine kinase MM': 1, 'hyper-creatine kinasemia': 1, 'LEVEL OF CREATINE KINASE': 1, 'XL creatine transporter deficiency': 1, 'RCVS 1': 1, 'X-linked creatine transport deficiency': 1, 'deficiency of creatine transport': 1, 'X-Linked Creatine Transporter Deficiency': 1, 'Creatine Disorders': 1, 'CDDs': 1, 'inherited creatine deficiency syndromes': 2, 'CT1 deficiency': 1, 'creatine (Cr) transporter deficiency': 1, 'Cerebral creatin deficiency syndrome': 1, 'cerebral creatin deficiency': 1, 'Creatin Related Disorders': 1, 'Cerebral creatin Deficiency syndromes': 1, 'creatine transporter (CT1) deficient': 1, 'CREATINE CONCENTRATIONS UNDER LONG-TERM SOCIAL ISOLATION': 1, 'creatine kinase abnormality': 1, 'creatine abnormalities': 2, 'X-linked creatine transport (CRTR) deficiency': 1, 'X-linked inherited creatine transporter deficiency': 1, 'CREATINE KINASE MB': 1, 'creatine transporter deficit': 1, 'creatine synthesis enzyme deficiencies': 3, 'TRIs': 2, 'X-linked SLC6A8 deficiency': 1, 'the creatine transporter': 1, 'autosomal disorders of creatine biosynthesis': 1, 'cerebral Cr': 1, 'creatine hypometabolism': 1, 'creatine (CT) deficiency': 1, 'creatine (and/or creatine transporter) deficiencies': 1, 'cerebral creatine synthesis deficiencies': 1, 'CRTD': 1, 'transport-related injuries': 1, 'disorder of creatine metabolism': 3, 'CRTR defect': 1, 'X-linked CRTR defect': 1, 'CRTR-deficient': 1, 'ATP-CREATINE SYSTEM AFTER': 1, 'Creatine deficiency in the brain': 1, 'CREATINE AND OF CREATINEMIA': 1, 'CTD neurological phenotype': 1, 'cerebral creatine (Cr) deficit': 1, 'X chromosome-linked creatine deficiency syndrome': 1, 'retardation of slow transport': 1, 'THIN-LAYER CHROMATOGRAPHICAL DEMONSTRATION OF CREATINE': 1, 'Creatine Synthesis Deficiencies': 1, 'Macro-creatine kinase syndrome': 1, 'transport and related': 1, 'creatine shortfall': 1, 'ON CREATINE PHOSPHORYLATION IN MUSCLES': 1, 'X-Linked creatine transporter deficiency': 1, 'Creatine Kinase Deficiency Diseases': 1, 'creatine kinase deficiency diseases': 1, 'hyper-CK-aemia': 1, 'CTD 3-7': 1, 'IPSC-CTD': 1, 'CTD 2-3': 1, 'CTD 1-4': 1, 'creatine (Cr) deficiency syndromes': 1, 'cerebral syndrome.1': 1, 'CMH': 1, 'Creatine Synthesis': 1, 'creatine kinase-': 1, 'Mi-CK deficiency': 1, 'deficiency of mitochondrial creatine kinase': 1, 'CREATIN-CREATININE ASSIMILATION': 1, 'transport and Golgi organisation 2 deficiency': 1, 'creatine kinas': 1, 'creatine transport defects': 1, 'road transport-related injury': 1, 'CREATINE PHOSPHOTRANSFERASE': 1, 'CRDS': 1, 'CRMH': 1, 'transporter-related': 1, 'Dysfunction of the CrT': 1, 'CrT defect': 1, 'X-linked CrT deficiency': 1, 'hyper creatine kinase (CK)-aemia': 1, 'C. CREA': 1, 'CREATINE ABNORMALITIES': 1, 'SLC6A8 creatine transporter deficiency': 1, 'creatine transporter (CRTR) deficiencies': 1, 'Creatine synthesis': 1, 'creatinism': 1, 'defective hepatic anion transport': 1, 'Defective hepatic anion transport': 1, 'creatine-deficiency syndromes': 1}
|
creatine deficiency
|
Disease
|
MESH:C535600
|
{'NE': 730, 'NDRI': 27, 'cutaneous (b)': 1, 'noradrenaline': 29, 'T1a/b': 20, 'NORADRENALINE CONTENT': 4, 'b': 314, 'NE neuron': 4, 'LC-NE dysfunction': 9, 'b-HLHZIP': 1, 'cue-b': 1, 'N2a-b': 2, 'ESBLs': 11, 'v3a/b': 1, 'CHF]b': 1, 'dopamine beta-hydroxylase deficiency': 63, 'INF b': 10, '/b': 11, 'NRIs': 11, 'HQDS.b': 2, '-b': 38, 'T3a-b': 9, 'NET': 390, 'CRF b': 1, 'JM-b': 9, 'norepinephrine': 52, '-NE': 7, 'tumor norepinephrine transporter': 1, 'mesenteroides HL2 (b': 1, 'tonic NE': 1, 'Tonic NE': 1, 'NOREPINEPHRINE': 119, 'cN2a-b': 2, 'NE abnormalities': 2, 'SEBS': 1, 'NDRIs': 11, 'Congenital dopamine-beta-hydroxylase deficiency': 1, 'SIBS': 7, 'nauseated?b': 1, 'norepinephrine deficiency': 25, 'norepinephrine transporter deficiency': 6, 'NORADRENALINE': 118, 'DBH deficiency': 35, 'NE deficiency': 46, 'b.': 17, 'N1a-b': 1, 'POSTNATAL NOREPINEPHRINE': 1, 'n.b': 5, 'INF b.': 2, 'NE dysfunction': 15, 'ESBL': 17, 'noradrenalin deficiency': 1, 'NORADRENALIN': 32, 'Dopamine-beta-hydroxylase deficiency': 4, 'Depressiona,b': 1, 'Jk(a-b': 5, 'b-glicerofosfato sodico': 1, 'labyrinthopathy.b': 1, 'Lu(a-b-)': 10, 'NE-LTD': 1, 'BbF': 5, 'NORADRENALIN IN LOCAL ANESTHESIA': 1, 'NORA': 1, 'noradrenaline deficiencies': 1, 'SNRIs': 23, 'NOREPINEPHRINE BY': 4, 'M1a, b': 1, 'NET deficiency': 7, 'T1a,b': 10, 'DOPAMINE-BETA': 1, 'ArthritisIII.b': 1, 'CVD b': 1, 'Dopamine beta-hydroxylase deficiency': 12, ',b': 3, 'dopamine-beta-hydroxylase deficiency': 30, 'CO-RADS 1': 3, 'Norepinephrine Dysfunction': 1, 'CIN2+b': 1, 'GBMa,b.': 1, 'T4a-b': 2, 'cT4a/b': 6, 'norepinephrine transporter': 4, 'DBM': 4, 'Noradrenaline': 3, 'AN': 1, 'dopamine beta-hydroxylate deficiency': 2, 'MCID b': 1, 'Noradrenergic NET': 1, 'IANonly': 1, 'LC-NE': 23, 'pT3a-b': 5, 'SSNRIs': 2, 'fastidiosa b.': 1, 'NETs': 10, 'ADMINISTRATION OF NORADRENALIN': 2, 'Jk(a-b-)': 10, 'SNRI': 39, 'NET positive tumors': 1, 'noradrenaline deficiency': 20, 'T. b. b.': 2, 'SMA b': 1, 'hep b': 1, 'NBAD': 3, 'b thalassaemia': 3, 'NA deficiency': 9, 'Le (a-b-)': 1, 'Deficiency in noradrenaline': 2, 'Extended-spectrum b-lactamase': 2, 'violence.b': 3, 'hNET': 15, 'abuse#b': 1, 'Detail b': 1, 'pT1a,b': 3, 'UMOM-1-b': 1, 'Cho b.': 1, 'CMT-DA': 1, 'EIV[b': 1, 'tumor NE': 4, 'NMN NE': 1, 'b-HLH': 2, 'hNET tumors': 1, 'GII-b': 2, 'MIPI-b': 1, 'dopamine beta-hydroxylase (DbetaH) deficiency': 2, 'congenital DbetaH deficiency': 1, 'GEP-NET': 1, 'NORADRENALINE SECRETION': 1, 'ARN[b': 1, 'NORADRENALIN CONTENT': 1, 'b.l': 1, 'NORADRENALINE RELEASE': 1, 'T2DM]b': 1, 'noradrenaline-secreting tumours': 2, '-32A3.b': 1, 'NOR': 1, 'DbetaH deficiency': 8, '-spectrum b-lactamase': 2, 'n.s.b': 2, 'NxM1a/b': 2, 'M1a/b': 5, 'b-thalassaemia': 16, 'NORADRENALIN AND': 1, 'NRI': 17, 'luminal b': 4, 'norepinephrine (NE) deficiency': 1, 'dopamine beta-hydroxylase (DBH) deficiency': 5, 'WABM-A-b': 1, '(b': 1, 'cytotoxicitya,b': 1, 'SBEs2.b': 1, 'noradrenaline releasing tumor': 1, 'clause b': 1, 'EFFECTS OF NOREPINEPHRINE': 5, 'H3.b': 2, 'pT3a/b N0M0 carcinoma': 1, 'ABC TBCs': 1, 'norepinephrine-secreting tumor': 2, 'pT1a-b': 12, 'SUPERSCRIPT ITALIC a and b.': 1, 'pN2a-b': 4, 'b carbapenemases': 1, 'NE hyperactivity': 1, 'savollarga javo$b': 1, 'ISA': 4, 'degeneration of cortical NE': 1, '-b-': 1, 'T1a-b-': 1, 'T1a-b': 14, 'PNE': 3, 'NOREPINEPHRINE SYNTHESIS': 4, 'DNRIs': 1, 'DNRIs.[a': 1, 'Jk(a - b-': 1, 'DNRI': 4, 'cT3a/b': 6, 'L-NORADRENALINE ON': 1, 'P-FEC A-b': 1, 'b and f': 1, 'b-CNC': 1, 'Noradrenaline deficiency': 4, 'Deficiency of NE': 1, 'Dementiaa,b,': 1, 'ESBL-KP': 1, 'RESERPINE ON BRAIN NORADRENALINE CONTENT': 1, 'FATE OF H3-NORADRENALINE': 1, 'T1a/b/': 1, 'T1a, b': 3, 'pN1a-b': 3, 'MECP2mutation b': 1, 'b-ACP': 4, 'NE-NET': 1, 'Adeno-Ca.b': 2, 'MI*b': 1, 'L(b)': 1, 'cT1a-b': 5, '3H-NOREPINEPHRINE': 2, "b'tshuva": 1, "hozrim b'tshuvah": 1, 'TDCC2-b': 1, 'Congenital dopamine beta-hydroxylase deficiency': 1, 'DGF?b': 1, 'spectrum b-lactamase': 1, 'the sympathetic neurotransmitter norepinephrine': 1, 'neurotransmitter norepinephrine': 1, 'NTDsa,b': 1, 'NOREPINEPHRINE-7H3': 1, 'SZ.b': 1, 'NE lesion': 3, 'NOREPINEPHRINE-DEPLETION': 1, '-b, or': 1, 'P.b': 5, 'EHM.b': 1, 'NOREPINEPHRINE SHOCK': 1, 'b-HAT': 1, 'b. gambiense HAT': 1, 'SEROTONIN-NOREPINEPHRINE REUPTAKE INHIBITOR': 1, '(M1a-b': 1, 'pT4a/b disease': 1, 'pT1a/b disease': 1, 'NORADRENALINE-INFUSED': 1, 'Oligomers Endocytosis b': 1, 'Hib': 1, 'Hib disease': 1, 'Hib diseases': 1, 'BETA-HYDROXYLASE': 2, 'pT2a and b': 1, 'NET tumor': 1, 'tumor NET': 1, 'SIS': 4, 'AF-b': 1, 'noradrenaline-secreting tumors': 2, 'extended-spectrum b-lactamase-': 1, 'extended-spectrum b-lactamase': 1, 'BD': 1, 'dopamine-B-hydroxylase deficiency': 1, 'dopamine beta hydroxylase deficiency': 6, 'NET dysfunction': 10, 'EFFECT OF NOREPINEPHRINE ON': 1, 'deficiency of dopamine-beta-hydroxylase': 10, 'autosomal recessive norepinephrine deficiency': 2, 'Hodgkinia cicadicola"b': 1, 'epinephrine- and norepinephrine-': 1, 'finn-b': 1, 'CO-1': 1, 'P.fal.b': 1, 'dopamine- or norepinephrine-': 1, 'norepinephrine- or': 1, 'epinephrine- and norepinephrine-producing tumours': 1, 'NE neurotoxicity': 1, 'nob defect': 1, 'eNE': 2, 'EFFECT OF NORADRENALIN': 1, 't-b-rhodesiense': 1, 'brain norepinephrine': 1, 'Delatycki b': 1, 'NA b': 1, 'pT4a/b carcinomas': 1, 'pT3a/b': 10, 'UCLP + b': 1, 'Orthostatic hypotension-1': 1, 'orthostatic hypotension-1': 2, 'T4a/b': 3, 'NORADRENALINE-EVOKED RESTORATION OF': 1, 'APDSa, b': 1, 'Noradrenaline deficit': 1, 'HR-NBL-1': 2, 'Kranzer_b': 1, 'Dopamine Beta Hydroxylase Deficiency': 1, 'deficiency of dopamine beta hydroxylase': 2, 'T1a,b,': 1, 'Cytotoxicity b': 3, 'AS6-b': 1, 'L0': 1, 'G1a/b': 1, 'NED': 5, 'NOREPINEPHRINE REUPTAKE': 4, 'b-globinopathies': 2, '15a-b': 1, 'dopamine-beta hydroxylase deficiency': 2, 'noradrenaline-producing tumours': 2, 'DBH': 4, 'deficiency of DBH': 4, 'guilt.b': 1, 'ACTION OF NORADRENALINE': 1, 'RCP b': 1, 'nob': 2, 'T1a,b)': 1, 'BETA-CAROTENE HYDROXYLASE': 1, 'St. George b': 1, 'pT1a/b carcinomas': 1, 'NE chromaffin': 1, 'b coronaviruses': 1, 'FRC b': 1, 'PND': 1, 'ACSa,b': 1, 'L-NOREPINEPHRINE': 5, 'WAC(b,': 1, 'b thalassaemic': 1, 'DBH-D': 1, 'NE-secreting tumors': 1, 'OtherCancer b': 1, 'EXTENDED SPECTRUM b-LACTAMASE': 1, 'NSRI': 3, 'SAM': 1, 'b-AN': 1, 'IVM1a-b': 1, 'deficiency of DA-alpha-hydroxylase': 1, 'NE-secreting tumours': 1, 'a- b': 1, 'Dopamine beta hydroxylase deficiency': 2, 'dopamine beta hydroxylase (DBH) deficiency': 1, 'EFFECT OF NOREPINEPHRINE': 2, 'renal NET': 1, 'Cassia w. b.': 1, 'NORADRENALINE NEURONS': 1, 'DSAP lesion': 4, 'DSAP': 5, 'NmB.': 1, 'Ne lesions': 1, 'T1a,b carcinomas': 2, 'ESBL+b': 1, 'norepinephrine transporters': 1, 'b\'"': 1, 'and b.': 1, '1 b': 1, 'cT1a,b': 1, 'NA deficit': 3, 'DBH-deficient': 3, 'NA': 13, 'NA loss': 2, 'cT3a-b': 1, 'PNMP-b-PMMA': 1, 'developmental delays b': 1, 'norepinephrine-secreting tumors': 1, 'b-ME': 2, 'NOREPINEPHRINE ADMINISTRATION': 1, 'EFFECTS OF NOREPINEPHRINE UPON LIPID': 1, 'SIA-b.': 1, 'dopamine beta hydoxylase deficiency': 1, 'sausage b': 1, 'L. b. panamensis': 1, 'L-NA': 1, 'NORADRENALINE INTRAVENOUS': 1, 'Dopamine beta hydroxylase enzyme deficiency': 1, 'BSI.b': 1, 'NOREPINEPHRINE-DEPLETING EFFECTS': 1, 'H3-NOREPINEPHRINE': 3, 'b-': 29, 'b-HCAs': 2, 'pM1a/b': 1, 'b/l': 1, 'STORAGE OF NOREPINEPHRINE BY': 1, 'NOREPINEPHRINE RETENTION': 1, 'SBS': 3, 'predominantly norepinephrine) tumors': 1, 'ILP b': 1, 'pT1a/b': 9, 'b-TFE': 3, 'SHH-b': 1, 'EFFECT OF L-NORADRENALINE': 1, 'ADE?b': 1, '5N-b': 1, '2-b': 2, 'b-CFS': 4, 'b-latency abnormalities': 2, 'a, b': 3, 'noradrenaline hypersensitivity': 1, 'INFa/b': 3, 'b.s.n': 1, 'M1a+b': 1, 'Ps b': 1, 'Hyperactivity of brain NE': 1, 'ACO-b': 1, 'DTX1-b': 1, 'cT1a/b': 4, 'pT3a-b disease': 1, 'Immunocompromised b': 1, 'VTS-b': 1, 'NE deficit': 2, '-b.': 2, 'SH-Cr3-b': 1, 'NORADRENALINE AND': 1, 'congenital dopamine beta-hydroxylase deficiency': 1, 'neuronal norepinephrine reuptake': 1, 'orthostatic hypotension.1': 3, 'toxicities.b': 1, 'Lu(a-b-': 1, 'NEP incontinence': 1, 'WELL PAPER FINISH a-GIVE-b.': 1, 'SUE b': 1, 'MARY a-INFORM-b': 1, 'MARY a-INFORM-b b': 1, 'WELL PAPER FINISH b-GIVE-a.': 1, 'DA-beta-hydroxylase deficiency': 1, 'noradrenaline overactivity': 1, 'norepinephrine hyperactivity': 2, 'b-HCA': 6, 'DO,#b': 1, 'cT1-b': 1, 'SNRIS': 1, 'SEROTONIN-NOREPINEPHRINE REUPTAKE INHIBITORS': 1, 'norepinephrine tumours': 1, 'HT Ta-b': 1, 'norepinephrine-producing tumours': 1, 'b-TM': 2, 'spectrum b': 2, 'cT2a-b': 3, 'Orofacial paina;b;f;g': 1, 'JIDLUD[b': 1, 'Dal-4)b': 1, 'PE-b-sPP': 1, 'OF NORADRENALINE': 1, 'LC-NA': 3, 'HMS@C18@PSDMA-b-POEGMA': 1, 'OSCsa,b': 1, 'NHIA (b)': 1, 'pT3a,b': 1, 'NE-': 2, 'NE Deficiency': 1, 'b-NHLs': 2, 'L-a-b': 1, 'SV 1': 1, 'P&b': 1, 'b-IHCA': 2, 'MLSB': 1, 'NE degeneration': 5, 'HIC-b': 1, 'SAP': 1, 'Cab': 1, 'IVM1a/b': 6, 'SF8300 b': 1, 'DL-TBOA': 1, 'LCNE': 1, 'NORADRENALIN IN': 1, 'NOREPINEPHRINE OUTPUT': 1, 'deficiency of noradrenalin': 1, 'deficiency of Noradrenalin': 1, 'of dopamine and noradrenaline': 1, 'L-b LD': 1, 'Extended-spectrum b': 1, 'NET hypofunction': 1, 'diseae?b': 1, 'NE dysregulation': 2, 'b. ypN': 1, 'PV1-b': 1, 'INHIB.b': 1, '-NE neuron loss': 1, 'LOCUS COERULEUS-NOREPINEPHRINE/': 1, 'pT2a/b': 8, 'NorEp': 1, 'NOREPINEPHRINE STORAGE PARTICLES': 1, '1,2-b]IF': 1, 'Del-b': 1, 'P. b. seulensis': 1, 'deficiency of noradrenaline': 3, 'HR (1)': 1, 'ESBL-GNB': 1, 'DBH-related disorders': 1, 'Norepinephrine deficiency': 1, 'DOMON': 2, 'b-IHCAs': 1, 'T1a or b': 1, 'dysf.b': 1, 'noradrenaline-only secreting tumour': 1, 'GII.b': 4, 'T3a/b': 7, 'CIV': 1, "bricks without straw'b": 1, 'IDU b': 1, 'N3a-b': 1, 'SSNRI': 2, 'NA hyperactivity': 2, 'Dysfunction of LC-NE': 1, 'pN2a/b': 2, 'pT2a-b': 2, 'b-PTP': 1, 'b&cLeaf injury': 1, 'NA lesion': 1, 'HPF-b': 1, 'INACTIVATION OF INFUSED NORADRENALINE BY': 1, 'NORADRENALIN-': 1, 'pN1a and b.': 1, 'NE defect': 2, 'ISNb': 6, 'snus"b': 1, 'DL-NORADRENALINE-2-C.': 1, 'NET drugs': 1, 'NA dysfunction': 6, "b'rit shalom": 1, 'NORADRENALIN ON': 1, 'NORADRENALINE ADRENALINE': 1, 'T1a,b,cN0M0': 1, 'NE overactivity': 2, 'NORADRENALINE UPTAKE': 1, 'ISNb defects': 2, 'ADMINISTERED NORADRENALINE': 1, 'HbE/b thalassaemia': 1, 'HbE/b-thalassaemia': 1, 'P.b.': 2, 'CALORIGENIC EFFECT OF NORADRENALINE': 1, 'oligozoosp.b': 1, 'Cytotoxicitya,b': 1, 'tan': 1, 'EFFECT OF NORADRENALIN AND ADRENALIN': 1, 'b. n.a': 1, 'NE-PE': 1, 'emotional maltreatment*,b': 1, 'EFFECT OF NORADRENALINE ON SYSTEMIC': 1, 'NE neurons': 1, 'T3': 1, 'extended spectrum b-': 2, 'MINB': 1, '-b DRs': 1, 'dopamine beta hydroxylase (DBH)-deficiency': 1, 'DBH-deficiency': 1, 'Dopamine beta hydroxylase (DBH) deficiency': 1, 'pNE': 4, 'BAT NET': 1, 'NORADRENALIN CELLS': 1, 'HD-b': 2, 'NORADRENALINE STORES': 1, 'Kadesh A/b': 1, 'N.b': 9, 'PCV2a/b': 1, '-b QPVs': 1, 'cT1a-b cN0': 1, 'In(b': 1, 'serotype b': 2, 'NETO': 3, 'carcinoma.b': 1, 'NORADRENALINE DURING': 2, 'Injury b.': 1, 'T3a/b disease': 2, 'IMP': 1, 'Fy(a-b': 1, 'N1a/b': 3, 'deficit of brain noradrenaline': 1, 'INF-b': 3, 'MOH-1': 1, 'NE plaques': 1, 'GSDIIIa and b': 1, 'noradrenaline transporter deficiency': 1, 'DN]b': 1, 'Nor deficiency': 1, 'Nor': 1, 'NE-deficit': 1, 'Multimorbidity b': 1, 'cardiac NET': 2, 'T1a and b': 1, 'NEE': 1, 'Dopamine-beta-hydroxylase (DbetaH) deficiency': 2, 'Low NET': 1, 'RB': 2, 'Lu(a-b': 4, 'NEP': 2, 'serogruppe-b': 1, 'NMSC]b': 1, 'MCL': 1, 'LC-NA dysfunction': 2, 'b.b.i.': 1, 'pT4a/b': 2, 'NOREPINEPHRINE-INDUCED REFLEX VASODILATION': 1, 'b-OR': 1, 'NE-QVD': 1, 'T1a,b,N0M0': 1, 'MEApd-a,b': 1, 'Congenital - b/': 1, 'b -': 1, 'VS-PEO-b-PMCL': 1, 'HD-b.': 1, 'Fya-b': 1, 'l.f.b': 1, 'nAGHp.b': 1, 'cytotoxic b': 1, 'blasto.b': 1, 'DBH deficit': 1, 'Meningitisa,b': 1, 'Metabolic noradrenaline disorders': 1, 'S-P-S': 1, 'Neat S-P-S': 1, 'H6H.': 1, 'cM1a-b': 1, 'Vo.b': 1, 'deficiency in DBH': 1, 'NEC b': 1, 'EFFECT OF NORADRENALIN ON': 1, 'Briggsia b': 1, 'T3a and b': 1, 'NOREPINEPHRINE TURNOVER': 1, 'NOREPINEPHRINE CONTENT': 3, 'NORADRENALIN UPTAKE': 1, 'JACC -b': 1, 'deficiency of brain norepinephrine': 1, 'the NE': 1, 'NORADRENALINE OXIDATION': 1, 'INF-a/b': 1, '-Bact-0785-b-A-': 1, 'PPCS b': 1, 'NORADRENALINE RESPONSE TO SIMULATED WEIGHTLESS STATE': 1, 'NE system dysfunction': 1, 'multocida b.': 1, 'GT1a/b': 2, 'norepinephrine depression': 1, 'cardiac norepinephrine deficit': 2, 'pN1a/b': 3, 'pN1a/b.': 1, 'PYRIDO[b]ACRIDINES': 1, 'BENZO[b]PHENANTHROLINES': 1, 'cardiac norepinephrine deficiency': 1, 'norepinephrine- and epinephrine-producing tumors': 1, 'and b': 2, 'mul2.b': 1, 'PEO A. 1.b': 1, 'N2a/b': 2, 'FaMDHAR-b': 1, 'Lutheran b': 1, 'M5a/b.': 1, 'b/': 2, 'dre-b.zang': 1, 'Le(a-b': 1, 'NA-': 1, 'ABHD': 1, 'HR-1': 2, 'NOREPINEPHRINE RELEASE': 1, 'Serious b': 3, 'chlorophyll b': 1, 'deficiency of dopamine hydroxylase': 1, 'MFH-b.': 1, 'MFH-b': 1, 'b. majuscula': 1, '129a,b': 1, 'Extended Spectrum b-lactamases': 1, 'INFa/b.': 1, 'NFD': 1, 'GSDIa and b': 1, 'noradrenaline dysfunction': 1, 'CIH': 1, 'NDE4.b': 1, 'b-giardina': 1, 'Lewis (a-b-': 1, 'dopamine (and norepinephrine) receptors': 1, 'tuf-b': 1, 'Deficiency of dopamine-beta-hydroxylase': 1, 'hepatotoxicity.b': 1, 'hepatotocixity.b': 1, 'nor-EPI': 1, 'Omega/b': 1, 'ADMINISTERED NORADRENALIN': 1, 'cN2a-b disease': 1, 'Endophthalmitisa,b': 1, 'Net': 1, 'NE/E deficiency': 1, 'b-Thalassaemia': 2, 'ROLE OF NOREPINEPHRINE': 1, 'OCL': 1, 'NE-related symptoms': 1, 'NN': 1, 'NEPP': 1, 'Usama b.': 1, 'SINB': 1, 'b and': 1, 'b-thal': 7, 'ESBL-Es': 1, 'MRRC3a/b': 1, 'DbetaM': 5, '(b)': 5, 'NE impairment': 1, 'phallus infl.b': 1, '1AGG-b': 1, 'dopamine and noradrenaline deficiency': 1, 'noradrenaline insufficiency': 1, 'dopamine, noradrenaline': 1, 'NA dysfunctions': 1, 'CHD b': 1, 'DHS1a-b': 1, 'NORADRENALINE DEPLETION BY': 1, 'HC (b)': 1, 'NOREPINEPHRINE CORRELATED': 1, 'dopamine beta-hydroxylase deficiency (': 1, 'DbetaH) deficiency': 1, 'Nemastoma b. relictum': 1, 'Nemastoma b.': 1, 'Nemastoma b. sparsum': 1, 'REMOVAL OF INFUSED NOREPINEPHRINE': 1, 'NOREPINEPHRINE FROM': 1, 'T1a/b disease': 1, 'DBHD': 3, 'b thalassaemia hyperunstable': 1, 'Udder lesions b': 1, 'OTM.b': 1, 'AFF (1-b)': 1, 'E/NE': 1, 'or b': 1, 'NE insufficiency': 1, 'mitochondrial and norepinephrine dysfunctions': 1, 'hyperuricosuria.b': 1, 'CHEMICAL NEUROANATOMY OF NE-CONTAINING LC NEURONS': 1, 'NE lesions': 1, 'LC NE NEURONS': 1, 'NE-DA': 1, 'b-PE': 1, 'CHD)b': 1, 'ME': 1, 'PCa': 1, 'deficiency of norepinephrine': 1, 'extended-spectrum b-lactamases': 1, 'NOREPINEPHRINE ON': 3, 'b kConFab': 1, 'apnoeas.b': 1, '-NEQ': 1, 'M-NEQ': 1, 'L-NEQ': 1, 'T2a-b': 3, 'aUSP b': 1, 'b-NP': 1, 'b- lactamase': 1, 'REACTOME NOREPINEPHRINE NEUROTRANSMITTER RELEASE CYCLE': 1, 'pN3a/b': 1, 'A. b. bicolor': 2, 'NE REGULATES INFLAMMATORY ACTIVATION OF MICROGLIA': 1, 'Kurtosis, b': 1, 'NMN': 1, 'NE loss': 2, 'norepinephrine transport protein': 1, 'NOREPINEPHRINE STORES': 1, 'LAPRC b-': 1, 'Pi-b': 1, 'EM-b': 1, 'ANS': 1, 'congenital deficiency of dopamine beta hydroxylase': 1, 'neuronal NET': 1, 'PNMG-b': 1, 'Lea-b': 2, 'Dopamin beta-hydroxylase deficiency': 1, 'NE deficits': 1, 'Crista spinosa synsacri g.b': 1, 'NE-T': 1, 'HTNe?b': 1, 'Papers b': 1, 'absence of norepinephrine': 2, 'CH-b': 1, 'Congenital NE deficiency': 1, 'Hypertonia DBH': 1, 'Hypotonia DBH Eye symptoms': 1, 'Luminal b': 2, 'sNRIs': 1, 'SEPS': 1, 'b-CoVs': 1, 'deficiency of Noradrenaline': 1, 'dopamine, norepinephrine, epinephrine': 1, 'Dopamine B hydroxylase deficiency': 2, 'DB-b': 1, 'C14-NOREPINEPHRINE': 1, 'noradrenalin': 1, 'Triatoma b. macromelasoma': 1, '/b.': 1, 'TSP b': 1, 'SBECD': 1, 'NEpi': 1, 'O14a-b': 1, 'Lu(a-b-) syndrome': 1, 'DbetaH deficient': 1, 'ORIGIN OF NOREPINEPHRINE': 1, 'CHI b': 1, 'b.h.': 2, 'HC10,b': 1, 'of the LC-NE': 1, 'TM-b': 1, 'b.P.': 1, 'Noradrenaline Catabolism': 1, 'LGb': 1, 'NORADRENALIN DECOMPOSITION': 1, 'HPBCD': 1, 'Noradrenalin': 1, 'surrenalic b-hydroxylase deficiency': 1, 'ISOPROPYL-NORADRENALINE AFTER': 1, 'injury.b': 1, 'deficiency of serotonin or noradrenaline': 1, 'b-thalessemia': 1, 'MECHANISM OF NORADRENALINE DEPLETION BY': 1, 'hNET tumor': 1, 'NORADRENALINE REUPTAKE INHIBITORS': 1, 'deficiency of norepinephrine receptors': 1, 'pT4a or b': 1, 'NE disruption': 1, 'a-b': 3, 'NE neuron loss': 1, 'LC-NE degeneration': 1, 'icddr,b': 1, 'NORADRENALINE SYNTHESIS': 2, 'NORADRENALINE BY': 2, 'Hematuriaa,b': 1, 'NE-LC': 2, 'HYPOTHALAMIC NORADRENALINE': 1, 'NaRI': 1, 'NaRIs': 1, 'QSEBS': 1, 'T3a+b': 1, 'SRTX-b': 1, 'Fy (a-b': 1, 'IAEA CO-1': 1, 'Th and Dbh deficiencies': 1, 'Dopamine beta-Hydroxylase Deficiency': 1, 'Dopamine beta-hydroxylase (DBH) deficiency': 3, 'NE-type': 1, 'NEPI': 1, 'homelessness.b': 1, 'MVIIA-b': 1, 'peteri;b': 1, 'REGIONAL NECROSIS FOLLOWING NORADRENALINE ADMINISTRATION': 1, 'NORADRENALINE ON': 2, 'spectrum b-lactamases': 1, 'a,b': 1, 'NE/EPI': 1, 'SRI': 1, 'NET impairment': 1, 'SZa+b': 1, 'Psychosisa b': 1, 'CNVM b.': 1, 'norepinephrine secreting tumors': 1, 'T1a/b.': 1, 'b-Proteobacteria': 1, 'anxietyN.b': 1, 'b. - pallidior': 1, 'and palatal (b': 1, 'b PRRs': 1, 'NORADRENALINE IN': 1, 'T.b.b': 1, 'dopamine-beta-hydroxylase (DBH) deficiency': 1, 'pT1a-b disease': 1, 'SDL-CO-2015-1': 1, 'NORADRENALINE INFUSION': 1, 'NOREPINEPHRINE USED INTRAVENOUSLY': 1, 'cT2a/b': 1, 'HIVAN b': 1, 'SD': 1, 'NORADRENALINE IN SKELETAL MUSCLES': 1, 'Anemiaa, b': 1, 'LC-NE system dysfunction': 1, 'uNE': 1, 'JK(a-b-)': 1, 'pT3 a/b': 1, 'Jk(a-b-': 2, 'Fy (a- b': 1, 'central deficiency of noradrenaline': 1, 'HIVa,b': 2, 'PKH b': 1, 'nau-b': 1, 'norip': 1, 'MALToma b': 1, 'of noradrenaline at alpha adrenergic receptors': 1, 'Noradrenaline-Secreting Pheochromocytoma': 1, 'noradrenaline-secreting pheochromocytoma': 1, 'NB': 1, 'pT1a, b': 2, 'WJLL.b': 1, 'norepinephrine syndrome': 1, 'pT1a,b N0M0': 1, 'N1/M1a-b': 1, 'EFFECT OF L-NOREPINEPHRINE': 1, 'NA system disorder': 1, 'NORADRENALIN DURING PLEASANT': 1, 'DSAP lesions': 1, "b'": 1, 'congenital deficiencies of dopamine ss-hydroxylase': 1, 'Noradrenaline Adenoma': 1, 'NOREPINEPHRINE-SECRETING GLOMIC TISSUE TUMOR': 1, 'cerebral deficiency of NE': 1, 'TNF ROLE OF NE FROM THE LC': 1, 'type C': 1, 'blood type B and C': 1, 'type B blood': 1, 'type B and C': 1, 'norepinephrine system disorders': 1, 'T1a,b carcinoma': 1, 'ECF-b': 1, 'Polypharmacy b': 1, 'f.m.b.': 1, 'EFFECT OF NORADRENALINE': 2, 'Diuresis[b': 1, 'hypoactivity of central NE': 1, 'disorders of E and NE': 1, 'HC_b': 1, 'CAG_b': 1, 'luminal-b': 3, 'LE b': 1, 'sleepiness?b': 1, 'NOREPINEPHRINE INPUTS': 1, 'PLASTICITY OF NOREPINEPHRINE INPUTS': 1, 'NE DC': 1, 'Eb': 1, 'BFC': 1, 'LC/NE': 2, 'MBC': 1, 'PHPI-b.': 1, 'NRFP': 1, 'Lu (a-b-)': 1, 'RESPONSES OF COLD-ACCLIMATIZED MEN TO INFUSED NOREPINEPHRINE': 1, 'CONGENITAL BETA': 1, 'NORADRENALINE-SECRETING CELLS': 1, 'NOREPINEPHRINE-INDUCED CALORIGENESIS': 1, '-NA': 1, 'cT3a, b': 1, 'ARMS-b.': 1, 'NORADRENALINE POSTINFUSIONAL': 1, 'tetuloma b': 1, 'noradrenaline neurons': 2, 'Dopamine ss-hydroxylase deficiency': 1, 'b-TF': 1, 'dopamine and noradrenaline neurons': 2, 'NOREPINEPHRIN': 1, 'BATMAN': 1, 'orthostatic dysfunction,1': 1, 'b-SNHL': 1, 'N2a/b/': 1, 'b.l.': 1, 'b-Aid Virus': 1, 'Climacteric syndromea,b': 1, 'deficiency in dopamine beta-hydroxylase': 1, 'Lu (a-b': 1, 'a.b.': 1, 'NORADRENALINE-REUPTAKE INHIBITORS': 1, 'AN-b': 1, 'INHIBITOR SELECTIVE NOREPINEPHRINE RECAPTURE': 1, 'ISNR': 1, 'NORADRENALINE DURING INDUCED': 1, 'Tumor norepinephrine': 1, 'Tumor NE': 2, 'Toxicity.[b': 1, 'Tc(a-b+)': 1, 'Differentiated dysplasia (b': 2, 'Ps-b': 1, 'NOREPINEPHRINE IN FIBRILLATION': 1, 'ascites NE': 1, 'Lyssavirus b': 1, 'MBDa-b': 1, 'OF NOREPINEPHRINE': 1, 'GBMsa,b.': 1, 'gliomasa,b.': 1, 'Primary cholangiocarcnomas b.': 1, 'op - n.b': 1, 'NDR': 1, 'N. b.': 1, 'bRIL': 1, 'CIN.b': 1, 'Mizumori,,b': 1, 'BRIL': 1, 'GI-b': 1, 'CAB': 1, 'NET deficiency disorders': 1, 'BINDS b': 1, 'aDBH': 1, 'pT2a+b-': 1, 'MYOCARDIAL NORADRENALINE CONTENT': 1, 'CAD-NET': 1, 'inflammationa,b.': 1, 'synthesize norepinephrine': 1, 'SUBCELLULAR DISTRIBUTION OF NORADRENALIN AND ADRENALIN': 1, 'hyporeactivity to noradrenaline': 1, 'VAPa,b': 1, 'BETA-HYDROXYLASE DEFICIENCY': 1, 'Toxicity[b': 1, 'NARIs': 1, 'BWS b': 1, 'T2N2a-b': 1, 'b-adrenergic overstimulation': 1, 'Virulence b': 1, 'Back and Leg Paina,b': 1, 'McCoy b': 1, 'SAEsa,b': 1, 'bag': 1, 'NE Impaired Systolic and Diastolic': 1, 'neuronal NE': 1, 'ANKA fam-b': 1, '+b': 2, 'norepinephrine transporter dysfunction': 1, 'NA-R': 1, 'parabiosis b.': 1, 'congenital deficiency of the dopamine beta-hydroxylase': 1, 'LCNA dysfunction': 1, 'UML b': 1, 'b disease': 1, 'CAD NET': 1, 'Noradrenaline artefacts': 2, 'NPH': 1, '-NE dysfunction': 1, 'b-MFC': 1, 'alveolar echinococcosisa,b': 1, 'DEPLETION OF NOREPINEPHRINE': 2, '-b -': 1, 'b -b': 1, 'noradrenaline-secreting tumour': 1, 'T1 a/b': 1, 'Turtle-b': 1, 'P16a-b': 1, 'BOLERO-4]b': 1, 'JumpIn-NET': 1, 'b-veto': 1, 'L-NORADRENALIN': 1, 'FAO b': 1, 'r&b': 1, 'LZ_b': 1, 'NE or DA dysfunction': 1, 'CIS b': 1, 'noradrenaline secreting tumours': 1, 'dopamine beta-hydroxylase (DHB) deficiency': 1, 'SK-N-BE(2)NET': 1, 'FATE OF NOREPINEPHRINE': 1, 'VMC1a-b': 1, 'BRAIN-STEM NOREPINEPHRINE': 1, 'OV b': 1, 'T1a,b BC': 1, 'diab.b': 1, 'BPND': 2, 'NORADRENALINE ON COLLATERAL': 1, 'PT4a/b': 1, 'a and b.': 1, '-NORADRENALINE': 1, 'Su(b)': 1, 'LIC-b': 1, 'T2a/b': 1, 'Stickleback-b': 1, 'PanINs': 1, 'A.b': 1, 'A.b.': 1, 'HCUa,b': 1, 'NETKO': 1, 'Haem[b': 1, 'pT2a+b': 1, 't.b.s.': 1, 'b or': 1, 'CIN b': 1, 'Elgendy-a Elgendy-b Ju Alrudaini': 1, 'norepinephrine-transporter deficiency': 1, 'basal-b': 1, 'NOREPINEPHRINE IN INTERLEUKIN-1beta': 1, 'p3a-b': 1, 'pN2a/b disease': 1, 'Mucocutaneous b': 1, "b'peh": 1, "metzitzah b'peh": 1, 'anxious.b': 1, 'CIb': 1, 'basal b': 1, 'norepinephrine-and epinephrine-secreting tumors': 1, 'CRVE b': 1, 'SEROTONIN-NORADRENALINE REUPTAKE': 1, 'b-symptoms': 1, 'A. b.': 1, 'riz-b-halib': 1, 'MECHANISM OF NOREPINEPHRINE DEPLETION': 1, 'MASSIVE DOSES OF NORADRENALINE': 1, 'multimorbidity.b': 1, 'DLBCLa/b': 1, 'VasculopathyGranulomas b.': 1, 'PA': 1, 'b-symtoms': 1, 'EFFECTS OF NORADRENALINE': 1, 'UND-b': 1, 'NE palsy': 1, 'diabetesa,b': 1, 'b-BGC': 1, 'STORES OF NORADRENALINE': 1, 'Lu(a-,b-)': 1, 'NA deafferentation': 1, 'Others b': 1, '3LL;b': 1, 'b-MPs': 1, 'cN1a/b': 1, 'deficiency of norepinephrine and serotonin': 1, 'deficiency in NE': 1, 'DbetaH-deficient': 1, 'LCSCs_b': 1, 'luminal a & b': 1, 'I (a and b), III (a and b), IV,': 1, '-BETA-HYDROXYLASE': 1, 'b+': 1, 'DBH deficiency syndrome': 1, 'MECHANISM OF NOREPINEPHRINE DEPLETION BY': 1, '-Bact-0341-b': 1, 'BV': 1, 'NOREPINEPHRINE CONCENTRATION': 1, 'toxicity?"b': 1, 'inherited NET deficiency': 1, 'WDt-b': 1, 'SV-1': 1, 'PTF-b': 1, 'NIC': 1, 'PHYS]b': 1, 'INHIBITION OF DOPAMINE-BETA-HYDROXYLASE BY DISULFIRAM': 1, ')b': 1, 'Lumina b': 1, '(DIAG)b': 1, 'hyporeactivity to NA': 1, 'SDH b': 1, 'b-HCA 5': 1, 'of NE': 1, 'b-f': 1, 'b-DDM': 1, 'Vomitinga,b': 1, 'CO 1': 1, 'Noradrenaline shock': 1, 'b-lactamases': 1, 'aftertaste-b': 1, 'T1/T2a-b': 1, 'Coomassie (b)': 1, 'ITI-b': 1, 'dNE': 1, 'MDN': 1, 'dysfunction of b': 1}
|
NE
|
Disease
|
MESH:C535601
|
{'ROLE OF DOSAGE': 1, 'DAX1 deficiency': 3, 'ADGs': 1, 'gene dosage abnormalities': 7, 'SDL': 47, 'DOSAGE': 14, 'ASSOCIATES_TO_DOSAGE_VatdCH': 1, 'EFFICACY_DOSAGE_VatedCH': 1, 'ASSOCIATES_TO_TOXICITY_ADR_DOSAGE_': 1, 'AP.Dosage': 1, 'LED': 19, 'DSG': 2, 'sensitive sex reversal': 1, 'dosage': 5, 'Dosage': 4, 'dosage abnormalities': 3, 'DOSAGE REGIMENS': 1, 'dosage-': 2, 'GRAD': 2, 'DOSAGE ERROR': 2, 'MRDIS': 1, 'MRDS': 1, 'dosage sex reversal': 1, 'DOSAGE RATIOS': 1, 'SEX-LINKED': 7, 'LEDD': 5, 'AD': 3, 'DOSAGE OF BUTADION': 1, 'DOSAGE OF INTERSTITIAL': 1, 'Dosage-sensitive sex reversal congenital adrenal hypoplasia critical': 1, 'DE': 1, 'DSS': 35, 'X-dosage deficiency': 1, 'iGD': 1, 'DOSAGE PROBLEMS': 3, 'HS': 1, '22q11 dosage anomalies': 2, 'Dosage-sensitive sex reversal - Adrenal hypoplasia congenita': 1, 'AN UNUSUAL DOSAGE-EFFECT RELATION': 1, 'SEX-LINKED LETHALS': 1, 'DOSAGES': 9, 'ODFs': 1, 'MDS': 5, 'DOSAGES OF': 1, 'LRD': 1, 'DOSAGE ERROR CORRECTED': 14, 'Synthetic dosage lethality': 4, 'DOSAGE OF ANTITETANUS SERUM': 1, 'RLT.Dosage': 1, '-DOSAGE FORM OF': 1, 'RMD': 7, 'SEX-LINKED LOCI': 1, 'CANDIDATE SEX-LINKED LOCI': 1, 'Dosage-sensitive sex reversal-Adrenal hypoplasia congenita': 1, 'OSDs': 1, 'OSD': 4, 'ULTRASONIC DOSAGE': 1, 'TD': 2, 'Dosage-sensitive sex reversal': 10, 'HD': 18, 'MD': 2, 'TROMETHAMINE DOSAGE FORMS': 1, 'dosage disorders': 4, 'ODS': 1, 'gene dosage disorders': 4, 'Dosage-': 2, 'SIMPLIFIED DOSAGE CALCULATION IN TELECOBALT THERAPY': 1, 'ADAD': 3, 'RHDO': 6, 'DOSAGES OF ANTIGENS': 1, 'MULTIPLE SEX': 1, 'DOSAGE EXCRETORY': 1, 'TRANSPLANTATION OF SKIN SENSITIVE TO SEX HORMONES': 1, 'sex (DSS) reversal': 2, 'LARGE DOSAGE OF METHYLPHENIDATE HYDROCHLORIDE': 1, 'DLP': 1, 'DOSAGE OF SALURETICS': 1, 'DOSAGE REGIMEN': 2, 'DOSAGE FOLLOWING IRRADIATION': 1, 'IGD': 1, '-dosage abnormalities': 1, 'dosage sensitive sex reversal': 5, 'BHD': 1, 'gene dosage disorder': 5, 'DOSAGE OF ETHIONAMIDE': 1, 'DA': 1, 'RHD': 1, 'DSS syndrome': 1, 'SODF': 8, 'ORAL DOSAGE': 1, 'ASSAY OF DOSAGE FORMS': 1, 'dosage disease': 1, 'LARGE DOSAGES OF': 1, 'RECOMMENDED DOSAGE': 2, 'DF': 6, 'DOSAGE RATES': 1, 'RIH': 1, 'DOSAGE ESTIMATION IN INTRATISSUE ADMINISTRATION OF': 1, 'DOSAGE OF CONTACT RADIUM IRRADIATION OF': 1, 'SDI': 3, 'GDDs': 5, 'MDRT': 2, 'DAX1 defect': 1, 'SDOF': 1, 'FDF': 2, 'MDC': 1, 'HIGH INITIAL DOSAGE OF INSULIN': 1, 'HE': 1, 'HL': 1, 'Dosage Sensitive Sex reversal': 2, 'SODFs': 5, 'SD': 1, 'SDIs': 1, 'FD': 2, 'FINISHED DOSAGE FORM': 1, 'FINISHED DOSAGE FORM OF': 1, 'PKCD': 1, 'IDM': 2, '-DOSAGE IRRADIATION': 1, 'PDSGs': 1, 'gene dosage disease': 3, 'DOSAGE INDICATIONS': 1, 'Dosage Deficiencies': 1, 'Dosage-sensitive sex-reversal': 1, 'AN INDIVIDUAL DOSAGE': 1, 'EFFECT OF DOSAGE FORMS ON': 2, 'DAX-1': 1, 'Gene dosage disorders': 2, 'GDD': 1, 'Gene dosage disorder': 1, 'DEVISING DOSAGE REGIMENS': 1, 'LD': 1, 'gene-dosage abnormalities': 2, 'SCREENING FOR SEX-LINKED LOCI': 1, 'gene dosage abnormality': 1, 'ISD': 1, 'GDE': 1, 'DS': 3, 'OED': 1, 'DED': 1, 'DOSAGE MODIFICATION': 1, 'DOSAGE IN TREATMENT OF': 1, 'DOSAGES MATTER': 1, 'UD': 1, 'ADD': 1, 'dosage deficiency': 1, 'PDSG': 1, 'DSGs': 2, 'DOSAGE CALCULATION': 1, 'ALD': 2, 'HDG': 1, 'DOSAGE OF PRESCHOOL': 1, 'SYSTEMIC ADMINISTRATION--LOCAL ADMINISTRATION--DOSAGE': 1, 'RECOMMENDED DOSAGES': 1, 'DOSAGE FIELD IN': 1, 'DOSAGE RANGE': 1, 'DOSAGE FORMS': 1, 'DFM': 1, 'EVALUATION OF 2 ANTI-ASTHMATICS IN AEROSOL DOSAGE': 1, 'DOSAGE SCHEME': 1, 'DU': 1, 'DC': 1, 'DOSAGE CHEMOTHERAPY': 1, 'TLED': 2, 'X dosage deficiency': 2, 'DOSAGE OF CARONAMIDE': 1, 'DFs': 2, 'dosage disorder': 2, 'DOSAGE OF FOSFOMYCIN': 1, 'GDB': 1, 'NTD': 1, 'EVOLUTION OF MULTIPLE SEX': 1, 'dosage errors': 1, 'EFFECTIVE DOSAGE': 1, 'TAD': 1, 'ED': 1, 'dosage abnormality': 1, 'Tecomella undulata Dosage': 1, 'ROUTE DOSAGE DURATION': 1, 'gene dosage toxicity': 1, 'GDT': 1, 'Dosage-sensitive sex reversal-adrenal hypoplasia congenita critical region on the X chromosome 1': 1, 'DAX1)': 1, 'DAX1-deficient': 1, 'COMPARISON OF HIGH-DOSAGE': 1, 'LOW-DOSAGE-': 1, 'HIGH DOSAGE': 1, 'OROS': 1, 'SENSITIVE TO DOSAGE IMBALANCE': 1, 'AIDA': 1, 'SDF opioid': 1, 'Dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1': 1, 'SDF': 1, "PAEDIATRIC DOSAGE 'NEED OF HOURS": 1, 'DOSAGE LITHIUM THERAPY': 1, 'DDC': 1, 'dosage-sensitive sex reversal': 3, 'LDSD': 1, 'DOSAGE ABNORMALITIES': 1, 'DOSAGE AND ADMINISTRATION': 1, 'DOSAGE OF ANTISERUM': 2, 'HVD': 1, 'gene-dosage abnormality': 1, 'ND': 1, 'HIGH-DOSAGE ROENTGEN-RAY TREATMENT': 1, 'DOSAGE REGIMEN OF': 1, 'ARD': 1, 'BRD': 1, 'nDS': 1, 'gene-dosage diseases': 1, 'DAA': 1, 'synthetic dosage lethality': 1, 'HIGH-DOSAGE AMPICILLIN': 1, 'HORMONAL DOSAGES': 1, 'temperature-sensitive sex reversal': 1, 'MSD': 1, 'SSDC': 1, 'ID': 1, 'REPEATED HIGH-DOSAGE CYTOSTATIC TREATMENT IN SURGERY': 1, 'DOSAGE-RESPONSE': 1, 'DOSAGES OF IRRADIATION UPON': 1, 'DOSAGE RANGE FOR CHALLENGE': 1, 'GDBH': 1, 'DDI': 1, 'DOSAGE ERROR CORRECTED]with': 1, 'DOSAGE CORTICOTROPIN ADMINISTRATION': 1, 'ADE': 1, 'DOSAGE SENSITIVE GENES': 1, 'BAD': 1, 'Wrong dosage': 1, 'DOSAGE ERROR CORRECTED]per': 1, 'DI': 1, 'ADs': 1, 'LINKING SEX DIFFERENCES': 1, 'DOSAGE FREQUENCY': 1, 'MNTD': 1, 'SULFONAMIDE DOSAGE': 1, 'SEMI-SOLID DOSAGE': 1, 'Dosage-sensitive sex reversal, Adrenal hypoplasia congenita, X chromosome': 1, 'SDS': 1, 'DOSAGE-OPERATOR': 1, 'DOSAGE-AMOUNT': 1, 'DDPs': 1, 'NDD': 1, 'DB': 1, 'Dosage sensitive sex-reversal': 1, 'DDL': 1, 'KETAMINE DOSAGE': 1, '(DSS)': 1, 'DOSAGE CONCEPT': 1, 'DOSAGE VARIATION': 1, 'DOSAGE-DEPENDENT REGULATION': 1, 'DIGITALIS DOSAGE PROBLEMS': 1, 'BEDR': 1, 'DOSAGE RATE IN PENDULUM IRRADIATION': 1, 'DOSAGE FORMS THAT': 1}
|
SDL
|
Disease
|
MESH:C535602
|
{'ML': 28, 'Leventinese': 16, 'Malattia Leventinese': 43, 'sintomi della mia malattia mentale': 1, 'ricaduta della mia malattia': 1, 'malattia mentale': 2, 'Doyne honeycomb retinal dystrophy': 68, 'MLVT': 6, 'DHRD': 51, 'malattia leventinese': 33, 'Doyne Honeycomb Retinal Dystrophy': 11, 'malattia spesso e anziana': 1, 'malattia coronarica associata': 1, 'malattia': 97, 'DHD-1': 1, 'malattia invasiva': 2, 'Honeycomb colloid degeneration of the retina': 1, "Doyne's familial honeycomb chorioiditis": 1, 'Doyne honeycomb retinal dystrophy/malattia Leventinese': 1, 'Malattia Leventinese/Doyne honeycomb retinal dystrophy': 4, 'ML/DHRD': 6, 'DHD': 233, 'malattia celiaca': 3, 'Doyne honeycomb dystrophy': 7, 'una malattia respiratoria acuta contagiosa': 1, 'malattia influenzale': 3, 'malattia pneumococcica': 1, 'malattia immuno-mediata': 1, 'legati alla malattia': 1, 'malattia renale cronica e obesita': 1, 'malattia meningococcica': 3, 'malattia respiratoria': 1, 'malattia pericolosa': 1, 'malattia sia piu elevata': 1, "Doyne's honeycomb retinal dystrophy": 9, 'Doyne honeycomb macular dystrophy': 7, 'DHC': 1, 'malattia aterosclerotica': 3, 'malattia aterosclerotica vascolare': 1, 'malattia aterosclerotica coronarica': 1, 'malattia cerebrovascolare': 2, 'malattia multivasale': 1, 'malattia aterosclerotica nativa': 1, 'malattia coronarica': 2, 'della malattia': 13, 'malattia coronarica sintomatica': 1, 'malattia sessualmente trasmissibile': 1, 'malattia invasiva da': 2, 'MST': 1, 'malattia meningococcica sospetta': 1, 'malattia della glandula': 1, 'Doyne honeycomb': 18, 'Doyne Honeycomb': 4, "Malattia Leventinese/Doyne's honeycomb retinal dystrophy": 2, "Doyne's honeycomb retinal degeneration": 1, 'malattia diabetica': 3, "Leventinese/Doyne's honeycomb retinal dystrophy": 1, 'familial dominant drusen': 12, 'Malattia leventinese': 16, 'Doyne': 6, 'retinal dystrophy malattia leventinese': 1, 'Doynes familial honeycomb choroiditis': 1, 'DFHC': 2, 'Doyne honeycomb degeneration': 1, 'DHRD disease': 1, 'Sua malattia': 1, 'malattia basandosi': 1, 'malattia oncologica': 1, 'MALATTIA DIMENTICATA': 1, "Doyne's honeycomb dystrophy": 6, 'Doyne honeycomb retinaldystrophy': 1, 'Doyne Honeycomb Dystrophy': 2, 'malattia Leventinese': 3, 'Malattia': 5, 'Malattia levantinese': 1, "Doyne's honeycomb familial choroiditis": 1, 'malattia asbesto-correlata': 1, 'leventinese': 3, 'Leventinese and Doyne honeycomb retinal dystrophy': 2, 'malattia levantinese': 1, 'Malattia virtualmente sconosciuta alla popolazione': 1, 'ML disease': 3, 'DHD-': 1, 'macular dystrophy malattia leventinese': 2, "Doyne's honeycomb": 2, 'Malattia Leventinese-Doyne honeycomb retinal dystrophy': 1, 'malattia da': 2, 'malattia cronico-degenerativa': 1, 'questa malattia': 1, 'malattia attiva': 2, 'malattia multifattoriale le cui manifestazioni': 1, "sull'attivita della malattia": 1, 'malattia cardiovascolare aterosclerotica accertata': 1, 'malattia,': 1, 'comune malattia cronica immuno-mediata della pelle che': 1, 'Doyne-Honeycomb retinal dystrophy': 1, 'malattia cronica': 4, 'malattia persistente': 1, 'malattia emergente': 1, 'malattia renale cronica': 3, 'severita della malattia provocata': 1, 'fase avanzata della malattia': 1, 'Malattia Leventinese and Doyne honeycomb retinal dystrophy': 4, 'della mortalita della malattia': 1, 'storia naturale della malattia': 1, 'Doyne honeycomb degeneration of the retina': 1, 'malattia CV': 1, 'malattia nella': 1, "Doyne's honeycomb choroiditis": 2, "L'ernia e una malattia meccanica": 1, 'malattia nella ristorazione pubblica': 1, 'Malattia Leventinese/Doyne Honeycomb Retinal Dystrophy': 1, 'malattia genetica': 1, 'malattia polmonare cronica ostruttiva': 1, "Doyne's retinopathy": 1, 'dominant Doyne honeycomb degeneration of retina': 1, "Doyne's": 2, 'malattia multisistemica': 1, 'malattia tali opacita tendono': 1, 'malattia extracardiaca': 1, 'malattia precoce': 1, 'malattia familiare': 1, 'malattia del': 2, 'Doyne honeycomb retinal degeneration': 3, 'Malattia coronarica': 1, "Leventinese/ Doyne's honeycomb retinal dystrophy": 1, 'malattia coronarica multivasale': 1, 'Doyne honey comb dystrophy': 1, 'Gravissima malattia agli occhi': 1, 'malattia respiratoria acuta medicalmente assistita': 1, 'malattia respiratoria ricorrente': 1, 'malattia infettiva': 1, 'MAARI': 1, 'malattia polmonare cronica': 1, 'severita della malattia influenzale': 1, 'una malattia cardiaca': 1, 'malattia cardiaca nei prossimi': 1, 'malattia leventinense': 2, 'DHD.Polling': 1, 'malattia ma alla precisa': 1, 'nella malattia metabolica': 1, 'malattia cardiaca': 1, 'storia della malattia cardiaca': 1, 'doyne honeycomb retinal dystrophy': 1, 'Doyne Honeycomb Retina Dystrophy': 1, 'malattia stessa': 2, 'malattia nelle fasi': 1, 'malattia renale allo stadio terminale': 1, 'malattia tropicale trascurata': 1, 'sua malattia': 1, 'La storia naturale della malattia': 1, 'malattia tubercolare': 1, 'Gravita della malattia': 1, "Doyne's familial honeycomb dystrophy": 1, "Doyne's Honeycomb Dystrophy": 1, 'Malattia mano-piede-bocca': 1, 'DHRD fundus lesions': 1, 'DHRD lesions': 1, 'Doyne dystrophy': 1, "Doyne's macular heredodystrophy": 1, 'malattia-renale-cronica': 1, 'familial radial drusen': 2, "Doyne's familial honeycomb choroiditis": 1, 'Malattia Leventinese/Doyne Honeycomb': 1, '-DHD': 1, 'Doyne Honeycomb Macular Dystrophy': 1, 'malattia disease': 1, 'Malattia leventinese/Doyne honeycomb retinal dystrophy': 1, 'malattia cardiovascolare': 2, 'malattia cardiovascolare rappresenta': 1, 'malattia autoimmune': 1, 'malattia autoimmune senza': 1, "Malattia Leventinese/Doyne's Honeycomb retinal dystrophy": 1, 'Doyne Honeycomb dystrophy': 1, 'Leventinese/Doyne Honeycomb dystrophy': 1, 'Malattia Leventinese retinal dystrophy': 1, 'DHD-003': 1, "Doyne's Honeycomb Retinal Dystrophy": 2, 'mia malattia': 1, 'della mia malattia': 1, "malattia all'attivita": 1, 'La latenza della malattia e appropriata': 1, 'malattia indica': 1, 'malattia sia': 1, 'probabilita che una determinata malattia': 1, 'malattia multifattoriale': 1, 'malattia esacerbata': 1, 'stessa malattia': 2, 'malattia secondaria': 1, 'malattia cronica renale': 1, 'malattia ischemica': 1, 'malattia influenzale confermata': 1, 'malattia simil-influenzale': 1, 'malattia fisica': 1, 'REMAD': 1, 'Dominant Familial Drusen': 1, 'mallatia leventinese': 1, 'Doyne honeycomb retina dystrophy': 2, 'Preoccupazione finanziaria legata alla malattia': 1, 'malattia avanzata': 2, 'malattia tipicamente multifasica': 1, 'sua stessa malattia': 1, 'malattia cronica cerebrale': 1, 'malattia invasiva da meningococco B': 1, 'COSTI ASSOCIATI ALLA MALATTIA': 1, 'malattia invasiva meningococcica confermata': 1, 'malattia negli adolescenti': 1, 'La malattia meningococcica': 1, 'La malattia': 1, 'La malattia invasiva': 1, 'malattia sono variabili': 1, 'malattia invasiva da meningococco riferiti': 1, 'malattia ha due possibilita': 1, 'malattia invasiva da meningococco': 1, 'malattia invasiva meningococcica': 1, 'della malattia invasiva da meningococco': 1, 'malattia batterica': 1, 'della malattia invasiva meningococcica': 1, 'malattia meningococcica severa': 1, 'colpita da questa rara malattia': 1, 'malattia invasiva meningococcica nella fascia pediatrica': 1, 'malattia da meningococco': 1, 'della malattia meningococcica': 1, 'malattia moriva': 1, 'malattia del figlio': 1, 'sospetta malattia invasiva': 1, 'malattia meningococcica invasiva': 1, 'malattia da meningococco B': 1, 'avuto nella fase acuta malattia': 1, 'Letalita della malattia': 1, 'DELLA MALATTIA': 1, "malattia dell'orecchio": 1, 'malattia respiratoria acuta': 1, 'malattia da moderata': 1, 'malattia infiammatoria': 1, 'malattia moderata-': 1, 'malattia dei pazienti': 1, 'Doyne honeycomb degeneration of retina': 1, 'Doyne syndrome': 1, 'malattia cardiovascolare aterosclerotica': 1, 'da malattia cardiovascolare': 1, "malattia dell'arteria periferica": 1, 'malattia autoimmune infiammatoria cronica': 1, 'malattia coronarica asintomatica': 1, 'Malattia Leventinese/': 1, 'FDD 2': 1, 'FDD': 1, 'da malattia': 1, "Doyne's disease": 1, 'DHRD/': 1, 'schede-malattia': 1, 'questo disturbo/malattia': 1, 'Questo disturbo/malattia mi': 1, 'Questo disturbo/malattia mi spaventa': 1, 'malattia cronica e': 1, 'Gestione della malattia': 1, 'malattia cutanea': 1, 'della malattia da utilizzare': 1, 'Severita della malattia': 1, 'severita della malattia': 1, "Doyne's honeycomb degeneration": 1, 'malattia periferica': 1, 'malattia localmente': 1, 'malattia metastatica': 1, 'malattia non': 1, 'Malattia emergente': 1, 'Mallatia Leventinese': 1, 'malattia cronica caratterizzata': 1}
|
DHD
|
Disease
|
MESH:C535607
|
{'Aicardi-Goutieres syndrome': 1888, 'AGS': 1736, 'basal ganglia calcifications': 445, 'calcifications in the basal ganglia': 45, 'calcification in the basal ganglia': 27, 'CSF Lymphocytosis': 2, 'basal ganglia calcification': 767, 'calcification of the basal ganglia': 217, 'TORCH infection': 214, 'Aicardi-Goutieres Syndrome': 336, 'cerebrospinal fluid lymphocytosis': 68, 'cerebrospinal fluid lymphocytosis syndrome': 1, 'TORCHES': 19, 'TORCH': 1144, 'Calcifications in the basal ganglia': 2, 'calcifications of the basal ganglia': 82, 'Basal ganglia calcifications': 71, 'Goutieres syndrome': 9, 'aicardi-Goutieres syndrome': 1, 'Aicardi-Goutieres syndrome (AGS)1': 1, 'Aicardi-goutieres syndrome': 9, 'ToRCH': 27, 'Basal ganglia calcification': 158, 'TORCH infections': 389, 'Aicardi Goutieres Syndrome': 54, 'AGS6': 14, 'Aicardi-Goutieres type 6': 1, 'Torch Syndrome': 1, 'TORCH Syndrome': 11, 'TORCH syndrome': 123, 'AGS.8': 1, 'AGS,13': 1, 'cerebrospinal fluid (CSF) lymphocytosis': 24, 'CSF lymphocytosis': 64, 'AGS-004-001': 1, 'torch infections': 8, 'bilateral calcification of the basal ganglia': 2, 'BGC': 55, 'Bilateral Basal Ganglia Calcification': 2, 'MPT': 1, 'gastric AGS': 11, 'calcification of basal ganglia': 82, 'Cree encephalitis': 14, 'Aicardi Goutieres Syndrome (AGS) type I': 2, 'Calcification of basal ganglia': 7, 'AGS-004': 7, 'calcifications of the cerebral basal ganglia': 1, 'HaNDL syndrome': 10, 'basal ganglia and thalamic calcification': 1, 'basal ganglia and cerebellar calcification': 4, 'AGS type II': 1, 'AGS type I': 1, 'calcification of basal ganglia or': 1, 'bilateral calcification in the basal ganglia': 1, 'torch': 9, 'HaNDL': 20, 'AGS tumours': 2, 'basal ganglia ectopic calcification': 1, 'pseudo-TORCH syndrome': 5, 'calcifications of basal ganglia': 17, 'neurologic deficits with cerebrospinal fluid lymphocytosis (': 1, 'calcification of basal ganglia and cerebral cortex': 1, 'calcification of the basal ganglia of the brain': 3, 'calcifications of the basal ganglia of the brain': 1, 'TORCH infection diseases': 1, 'multiple calcifications in the cortex': 1, 'AGS-like disease': 5, 'calcification in basal ganglia': 12, 'AGS neurological symptoms': 1, 'cerebral pseudo-TORCH syndrome': 1, 'TORCH) infection': 3, 'congenital TORCH': 3, 'ToRCHeS': 2, 'ToRCHeS infections': 1, 'Aicardi-Goutieres syndrome 6': 6, 'Aicardi-Goutieres syndrome X-linked PHEX': 1, 'calcification of basal ganglia and the': 1, 'AGS1': 14, 'autoinflammatory AGS': 1, 'TORCH Infections': 9, 'TORCH congenital infections': 5, 'Aicardi Goutieres syndrome': 91, 'ToRCH infections': 11, 'basal ganglia or cerebral vascular wall calcification': 1, 'basal ganglia and cerebral vascular wall calcification': 1, 'dystrophic calcification of the basal ganglia': 1, "Aicardi-Goutieres' Syndrome": 2, 'autosomal recessive pseudo-TORCH syndrome 2': 1, 'Aicardi-Goutieres syndrome 7': 12, 'Aicardi-Goutieres Syndromes (AGS) 1-7': 1, 'AGS- Aicardi-Goutieres syndrome 1-7': 1, 'AGS-': 5, 'microcephalyAicardi-Goutieres syndrome': 1, "TORCH' infections": 2, 'AGS disease': 17, 'AGS tumors': 8, 'TORCH Infection': 6, 'congenital TORCH infection': 5, 'AGS carcinoma': 5, 'Basal ganglia and thalamus calcification': 1, 'ectopic calcifications of the basal ganglia': 1, 'Aicardi-Goutieres syndrome 2': 4, 'intracranial calcification of the basal ganglia': 2, 'TORCH complex': 7, '-TORCH syndrome 2': 1, 'PTORCH2': 1, 'Pseudo-TORCH syndrome-3': 1, 'pseudo-TORCH syndrome 2': 1, 'Pseudo-TORCH syndrome': 7, 'pseudo-TORCH syndrome-3': 1, 'Pseudo-TORCH Syndrome Type 2': 1, 'PTS': 10, 'PTORCH3': 1, 'Intracranial calcifications of the basal ganglia': 1, 'Calcification in basal ganglia': 1, 'calcification of the basal cerebral ganglia': 1, 'Basal ganglia and thalamic calcification': 3, 'Basal Ganglia Calcifications': 4, 'gastric AGS adenocarcinoma': 3, 'Basal ganglia (BG) calcification': 1, 'Aicardi-Goutier syndrome': 6, 'TORCHS': 19, 'TORCH"': 1, '-atherosclerotic calcification of the basal ganglia': 1, 'calcification of vessels of the basal ganglia': 1, 'calcification of vessels of basal ganglia': 1, 'cerebral, cerebellar and basal ganglia calcification': 1, 'calcification of cerebellum, cerebral cortex, and basal ganglia': 1, 'intracranial basal ganglia calcifications': 2, 'AGS autoimmune disease': 1, 'neurological deficits with cerebrospinal fluid lymphocytosis': 4, 'TORCH-S infection': 1, 'TORCH-S': 2, 'periventricular, thalamic and basal ganglia calcifications': 1, 'basal ganglia or white matter calcifications': 1, 'congenital TORCH infections': 8, 'TORCHES diseases': 1, 'Aicardi-Goutieres': 36, 'basal ganglia calcifications,24': 1, 'Aicardi-Goutieres syndrome 2[MIM': 1, '-TORCH syndrome': 10, 'AGS1-7': 4, 'Cree encephalopathy': 3, 'AGS seizure': 1, 'TORCH) infections': 9, 'AGS7': 12, 'AGS1-6': 1, 'Aicardi-Goutieres syndrome 1-6': 1, 'AGS-like syndrome': 3, 'Aicardi-Goutieres syndrome (type 1-7)': 1, 'TORCH group infections': 6, 'PSEUDO-TORCH': 1, 'TORCH disease': 1, 'Aicardi-Goutieres type 1 syndromes': 1, 'TORCH" infections': 3, 'torch or': 1, 'pseudo-TORCH': 1, 'basal-ganglia calcifications': 3, 'Aicardy-Goutiere syndrome': 1, 'Aicardi-Goutieres syndrome 1': 13, 'Aicardi-Goutieres syndrome type 6': 5, 'TORCHs': 5, 'AGS tumor': 6, 'AGS.CONCLUSIONSIn': 1, 'Aicardi-Goutieres syndrome-like': 1, 'AGS-like': 2, 'TORCH-like syndrome': 3, 'AGS 1-7': 2, 'AGS adenocarcinoma': 4, 'torch infection': 3, 'AGS-R': 1, 'Torch syndrome': 3, 'Goutieres Syndrome': 10, 'Aicardi Goutieres': 4, 'AGS-5': 1, 'AGS2': 9, 'aicardi-goutieres syndrome': 6, 'Aicardi-Goutieres Syndrome type 6': 1, 'Pseudo-TORCH Syndrome': 2, 'TORCHS infections': 9, 'Cerebrospinal Fluid Lymphocytosis': 9, 'TORCH disorders': 1, 'Pseudo-TORCH syndromes': 1, 'TORCH syndromes': 7, 'TORCH Syndrome 2': 1, 'TORCH-2 syndrome': 1, 'Pseudo-TORCH syndrome 2': 2, 'TORCH syndrome 2': 2, 'PTS 2': 1, 'Aicardi-Goutiere Syndrome': 4, 'Headache and Neurological Deficits with cerebrospinal fluid (CSF) Lymphocytosis': 2, 'Headache and Neurological Deficits with cerebrospinal fluid Lymphocytosis': 3, 'Headache and Neurologic Deficits with cerebrospinal fluid Lymphocytosis (HaNDL) syndrome': 1, 'Aicardi- Goutieres disease': 1, 'Aicardi-Goutieres disease': 3, "Cree's encephalopathy": 1, 'calcifications in basal ganglia': 12, 'Calcification of the basal ganglia': 3, 'TORCHes infections': 2, 'ToRCH infection': 5, 'ToRCH infected': 1, 'Cockayne and Aicardi-Goutieres syndromes': 1, 'calcifications of the basal ganglia and deep cerebellar nuclei': 1, 'calcification of basal ganglia and white matter': 2, 'Aicardi-Goutieres Syndrome type 7': 1, 'Aicardi-Goutieres-syndrome': 2, 'woolly torch': 1, 'headache with neurologic deficits and cerebrospinal fluid lymphocytosis': 1, 'TORCH] infections': 1, 'calcification of the bilateral basal ganglia': 5, 'periventricular and basal ganglia calcifications': 4, 'AGS interferonopathy': 1, 'AGS-003': 13, 'cerebral, cerebellar, and basal ganglia calcifications': 1, "Aicardi-Goutiere's syndrome": 8, 'AGS and': 1, 'basal ganglia-thalami (BGT) calcification': 1, 'BGT calcification': 1, 'BGT calcifications': 1, 'Aicardi-Goutieres syndromes': 10, 'food allergy AGS': 1, 'Aicardi-Goutieres syndrome (AGS)2': 2, 'AGS type 6': 4, 'Bilateral and symmetric basal ganglia calcification': 1, 'Aicardi-Goutieres syndrome type 1': 4, 'Aicardi-Goutieres-like interferonopathy': 3, 'ASG': 2, 'cerebral and basal ganglia calcification': 2, 'BGCs': 3, 'basal ganglia and subcortical calcifications': 2, 'calcifications of the basal ganglia and': 1, 'intrauterine (TORCH) infections': 1, 'SCTC': 3, 'calcification of the basal ganglia and coronary artery': 1, 'Basal Ganglia calcification': 4, 'Aicardi Goutiere syndrome': 3, 'AGS type 7': 6, 'periventricular and basal ganglia calcification': 1, 'Aicardi-Goutieres syndrome3': 1, 'Aicardi-Goutieres syndrome2': 1, 'Headache with neurological deficit and cerebrospinal fluid (CSF) lymphocytosis (HaNDL) syndrome': 1, 'Aicardi Goutiere Syndrome': 1, 'Calcifications of the basal ganglia': 2, 'AGS type 2': 2, 'multiple calcifications of the basal ganglia': 1, 'TORCH-infections': 6, 'Aicardi-Goutiere syndrome': 9, 'MCFN': 1, 'AGS types 1-7': 1, 'AGS type 8 and type 9': 1, 'calcification of the basal ganglia and cerebellum': 3, 'calcification of the basal ganglia and': 5, 'Aicardi-Goutieres Syndrome 6': 3, 'TORCH congenital syndrome': 1, 'TORCH Congenital Syndrome Infections': 1, 'AGS syndrome': 12, 'ToRCH syndrome': 1, 'AGS-like diseases': 3, 'Aicardi-Goutieres syndrome-6': 1, 'Aicardi-Goutieres Syndromes': 3, 'Aicardi-Goutieres syndrome 1-7': 2, 'AGS Aicardi-Goutieres syndrome': 7, 'basal ganglia and cerebral cortex calcification': 1, 'Torch': 8, 'Acardi-Goutieres Syndrome': 5, 'Congenital TORCH infection': 3, 'Congenital TORCH': 2, 'Congenital TORCH infections': 4, 'calcifications of basal ganglia, cerebellum': 1, 'calcification of the basal ganglia and thalamus': 1, 'basal ganglia and other subcortical calcifications': 2, 'congenital (TORCH) infection': 1, 'pseudo-TORCH) syndrome': 1, 'Aicardi-Goutieres Syndrome Type-1': 1, 'calcification of thalami and/or basal ganglia': 1, 'Aicardi Goutiers syndrome': 1, 'basal ganglia and carotid calcifications': 1, 'carotid and basal ganglia calcifications': 1, 'basal ganglia and cerebellum calcifications': 1, 'Cree leukodystrophy': 2, 'basal ganglia and cerebellar calcifications': 5, 'Aicairdes-Goutieres syndrome': 1, 'AGS:34.29': 1, 'AGS-1C4D4': 1, 'symmetrical and bilateral calcification of the basal ganglia': 1, 'AGS 2': 1, 'cerebrospinal fluid lymphocytosis (': 6, 'HaNDL) syndrome': 4, 'torch syndrome': 2, 'pseudo-torch syndrome 2': 1, 'Basal Ganglia Calcification': 12, 'basal ganglia (BG) calcification': 2, 'Aiacrdi-Goutieres syndrome': 1, "Aicardi Goutiere's Syndrome": 1, 'Aicardi Goutier syndrome': 3, 'Goutieres': 2, 'TORCHS syndrome': 1, 'Aicardi-Goutieres syn-drome-like disease': 1, 'Aicardi-Goutiere Syndrome 1': 1, 'systeme de goutieres': 1, 'calcification of basal ganglia and': 1, '-Goutieres': 1, 'Aicardi-Goutieres spectrum': 1, 'AGS-NOS': 3, 'Basal ganglia calcifications involving globus pallidus': 1, 'Cheap torches': 1, 'Aicardi-Goutieres-like syndrome': 1, 'Aicardi-Goutieres syndrome type 7': 4, 'Aicardi-Goutieres syndrome (AGS) type 7': 1, 'TORCH-B': 1, 'AGS-1C4D': 1, 'TorCH': 1, 'calcifications at the basal ganglia': 1, 'Aicardi-Goutieres syndrome 4, 6 and 7': 1, 'AGS-related symptoms': 1, 'torch fire': 1, 'calcification of bilateral basal ganglia': 5, 'AGS].{3': 1, 'TORCH INFECTION': 1, 'basal ganglia and thalamic calcifications': 2, 'AGS Beers': 1, "Aicardi Goutiere's disease": 1, 'Aicardi-Goutieres-syndrome-like encephalopathy': 1, 'calcification of the basal ganglia and corpus callosum': 1, 'cortical and basal ganglia calcifications': 1, 'calcification of the basal ganglia, cerebellum': 3, 'basal ganglia and frontal calcification': 1, 'basal ganglia calcification syndrome': 1, 'HaNDL Syndrome': 3, 'AICARDI-GOUTIERES SYNDROME 1': 1, 'Neurological Deficits with cerebrospinal fluid Lymphocytosis': 1, 'calcification of basal ganglia and cerebellar nuclei': 1, 'AGS - Top': 1, 'subcortical and basal ganglia calcification': 1, 'Goutieres Aicardi syndrome': 1, '-TORCH syndrome-3': 1, 'TORCH pathogens': 3, 'Oji-Cree': 2, 'calcification of basal ganglia Muscle disorders': 1, 'pseudo-Torch syndrome': 2, 'dak[torch': 1, 'calcifications within the basal ganglia': 4, 'Aicardi-Goutieres Syndrome 7': 1, 'calcification in basal ganglia and cerebral cortex': 2, 'AGS-RA': 1, 'TORCH infected': 2, 'calcifications in the bilateral basal ganglia': 1, '-TORCH': 1, 'calcification at the basal ganglia': 2, 'TORCHES infection': 1, 'Torch Infections': 1, 'calcifications of thalamus and basal ganglia': 1, 'AGS symptoms': 2, 'Aicardi Goutieres syndromes': 1, 'AGS1-5': 1, 'AGS 1-9': 1, 'calcifications (subcortical, basal ganglia, cerebellum': 1, 'basal ganglia and cerebral cortex calcifications': 1, "Aicardi-Goutieres's syndrome abnormalities": 1, "Aicardi-Goutieres's Syndrome": 1, 'infection of TORCH': 1, 'ToRCHES infections': 1, 'calcification of the right basal ganglia': 1, 'Aicardi Goutieres syndrome 2': 1, 'Aicardi-Goutieres syndrome-7': 2, 'Ganglia Encephalopathy': 1, 'AGS diseases': 1, 'chronic cerebrospinal fluid (CSF) lymphocytosis': 3, 'Aicardi-Goutieres syndrome type-1': 1, 'Aicardi- Goutieres syndrome': 6, 'symmetrical cerebellar and basal ganglia calcification': 1, 'Aicardi-Goutieres syndrome 9': 1, 'Aicardi-Goutieres syndrome type 2': 3, 'Aicardi- Goutieres syndrome-7': 1, 'basal ganglia autoimmune encephalopathies': 1, 'BGE': 1, 'Aicardi-Goutieres-Syndrom': 2, 'TORCHES syndrome': 2, 'brain calcifications in basal ganglia': 1, 'Aicardi-Goutieres (AGS) autoimmunity syndrome': 1, "Aicardi-Goutieres's syndrome": 1, "Aicardi- Goutieres's syndrome": 1, 'Acardi Goutieres Syndrome': 4, 'Aicardi-Goutieres (A-G) syndrome': 2, 'A-G syndrome': 2, 'AGS GENES': 1, 'Aicardi-Goutieres autoimmune syndrome': 2, 'calcifications of basal ganglia and cerebral cortex': 1, 'TORCH-like': 3, 'Aicardi-Goutieres syndrome-2': 1, 'basal-ganglia-calcification': 2, 'Ganglia and Cerebellar Calcification': 1, 'Aicardi - Goutieres syndrome': 1, 'AGS (Type VII)': 1, '-Goutieres Syndrome': 1, 'and basal ganglia calcifications': 2, 'TORCH-': 1, 'TORCH-type': 1, '-AGS': 1, 'neurological deficits with cerebrospinal fluid (CSF) lymphocytosis': 1, 'Headache and Neurologic Deficits with cerebrospinal fluid Lymphocytosis': 1, 'AGS1,2': 1, 'AGS abnormal gait stereotype': 1, 'Aicardi-Goutieres Syndrome disease': 1, 'Aicardi- Goutieres Syndromes': 1, 'Basal-ganglia calcification': 1, 'calcification of the cortex and basal ganglia': 1, 'TORCH" syndrome': 2, 'Aicardi-Goutie`res syndrome 6': 1, 'ectopic and basal ganglia calcifications': 1, 'AGS*Possible': 1, 'headache and neurological deficits with cerebrospinal fluid lymphocytosis': 3, 'calcifications of the basal ganglia and cerebral cortex': 2, 'calcification within basal ganglia': 1, 'Aicardi Goutieres Syndrom': 1, 'AGS 1-6': 1, 'basal ganglia calcification of blood vessels': 1, 'TORCH virus infection': 2, 'Cree leukoencephelophathy': 1, 'AGSAcardi-Goutieres Syndromes': 1, 'TorCH syndrome': 1, 'postanoxic calcification of the basal ganglia': 1, 'basal ganglia calcifications in the CNS': 1, 'gastric AGS carcinoma': 2, 'Aicardi-Goutieres syndrome (AGS) 10, 70': 1, 'brain basal ganglia calcification': 1, 'Aicardi-Goutieres-like syndromes': 1, 'pseudotoxoplasmosis': 1, 'Aicardi-Goutieres-Syndrome': 3, 'torch.cuda': 1, 'Aicardi-Goutieres encephalopathy': 2, 'CSF lymphocytosis syndrome': 1, 'TORCH infection': 1, 'Oji-Cree diabetes': 1, 'Pseudo-TORCH': 1, '-TORCH Syndrome': 1, 'AGS-IV': 1, 'calcification of the basal ganglia,': 2, 'Aicarde-Goutieres Syndrome': 1, 'AGS.W': 1, 'AGS) type I': 1, 'Aicardi-Goutieres syndrome (': 1, 'CSF lymphocytosis (': 1, 'calcification of basal ganglia in the brain': 1, 'cerebrospinal fluid Lymphocytosis': 3, 'Aicardi-Goutieres syndrome autoimmune disease': 1, 'basal ganglia and central nervous system calcifications': 1, 'AGS 6': 1, 'Aicardi-Goutieres Syndrome Type 6': 1, 'Aicardi-Goutieres and Down syndromes': 1, 'bilateral basal ganglia calcification': 3, 'calcification of the basal ganglia and caudate nuclei': 1, 'vessel-associated calcifications in the basal ganglia': 1, 'Torch infections': 3, 'AGS encephalopathy': 1, 'Aicardi-Goutieres syndrome (type 1-7': 1, 'AGS infection': 1, 'AGS-21': 1, 'Aicardi-Goutieres syndrome-like encephalitis': 1, 'of Headache and Neurological Deficits with CSF Lymphocytosis': 1, 'Calcification of Basal Ganglia': 1, 'PTS disorders': 1, 'Familial Aicardi-Goutieres syndrome': 1, 'AGS 2000': 1, 'AGS-1': 1, 'familial autoimmune AGS': 1, 'Basal ganglia calcification Wilson': 1, 'basal ganglia calcification': 1, 'Pseudo-TORCH syndrome': 1, 'Aicardi-Goutieres syndrome': 1, 'Aicardi-Goutieres autoimmune-mediated neurodevelopmental syndrome': 1, 'Aircardi Goutieres Syndrome': 1, 'calcifications of the basal ganglia and cerebellum': 2, 'neurologic deficits with cerebrospinal fluid (CSF) lymphocytosis': 1, "TORCH infections' sequelae": 1, 'Aicardi-Goutieres inflammatory encephalopathy': 1, 'AGS gene defects': 1, 'AGS gene': 1, 'Headache and Neurological Deficits with Cerebrospinal Fluid Lymphocytosis (': 1, 'Cerebrospinal Fluid Lymphocytosis (': 1, 'Aicardi goutieres syndrome': 1, 'Swampy Cree Suicide': 1, 'TORCH series infection': 1, 'AGS.veh': 1, 'Aicardi-Goutieres syndrom': 1, 'neurologic deficits with cerebrospinal fluid lymphocytosis': 1, 'Aicardi Goutieres Syndrome type 2': 1, 'Aicardi Goutieres syndrome (': 1, 'AGS)': 1, "TORCH's infections": 1, 'Aicardi-Goutieres interferonopathy': 1, 'Aicardi-Goutieres Syndrome1': 1, 'TORCH-R': 1, 'ectopic calcification of the cerebellum and basal ganglia': 1, 'Aicardi-Goutieres (AG) syndrome': 2, 'AG syndrome': 2, 'Primary basal ganglia calcification': 1, 'calcification in bilateral basal ganglia': 1, 'TORCH-syndrome': 2, 'Aicardi-Goutieres syndrome (AGS) 1-7': 1, 'Headache and Neurological Deficits with cerebrospinal fluid Lymphocytosis (HaNDL) syndrome': 1, 'transient headache and neurologic deficits with cerebrospinal fluid lymphocytosis': 1, 'TORCH congenital infection': 1, 'calcifications incerebral and basal ganglia': 1, 'cerebral and basal ganglia calcifications': 1, 'basal ganglia and extrabasal ganglia calcification': 1, 'Aicardi-Goutieres (autosomal recessive encephalopathy) syndrome': 1, 'AIcardi-Goutieres syndrome': 1, 'AGS-EBV malignancies': 1, 'AGS - Alagille syndrome': 2, 'Aicardi-Goutieres syndrome Joint contractures': 1, 'AGS V.': 1, 'calcification of basal ganglia and dentate nucleus': 1, 'pseudo-TORCH"': 1, '-TORCH syndromeGene': 1, 'AGS-microangiopathy': 1, 'basal ganglia calcific vasculopathy': 1, 'TORCH infectionsa': 1, 'CSF-lymphocytosis': 1, 'AGS)13': 1, 'ToRCH pathogens': 1, 'AGS1 to 7': 1, 'Punctate calcification of the basal ganglia': 1, 'Aicardi- Goutieres Syndrome': 1, 'CMC': 1, 'Goutieres syndrome 7': 1, 'Chronic cerebrospinal fluid (CSF) lymphocytosis': 1, 'AGS adrenogenitales Syndrom': 1, 'basal ganglia and extrabasal ganglia calcifications': 1, 'autoimmune syndromesAicardi-Goutieres syndromeAutism': 1, 'TORCH infections.22': 1, 'Aicardi-Goutieres autoimmune disease': 1, 'abnormal calcification of the basal ganglia': 1, 'AGS tumour': 2, 'transient headache and neurological deficits with cerebrospinal fluid lymphocytosis': 1, 'TORCH(S)] infections': 1, 'TORCH(S) infections': 1, 'AICARDI-GOUTIERES': 1, 'atherosclerotic calcification of the basal ganglia': 1, 'pseudo-toxoplasmosis, rubella, cytomegalovirus, and herpes simplex virus (TORCH) syndrome': 1, 'Enactive Torch': 1, 'Aircadi-Goutieres syndrome': 1, 'bilateral symmetrical calcification of the basal ganglia': 1, 'BG calcification': 2, 'calcification of bilateral calcification of basal ganglia': 1, 'calcification of BG': 1, 'PWS/AGS': 1, 'Aicardi-Goutieres syndrome-1': 1, 'Cree Indian Encephalopathy': 1, 'Blow-torch': 1, 'Mendelian interferon-opathy Aicardi-Goutieres syndrome': 1, 'calcification of both basal ganglia': 1, 'calcification of basal ganglia and other cerebral regions': 1, "La fonction cree l'organe": 1, "fonction cree l'organe": 1, 'Aicardi-Goutieres (AGS) syndrome': 1, 'TORCH group infection': 1, 'TORCHs syndromes': 1, 'TORCH 2': 1, 'Aicardi-Goutieres syndrome-like symptoms': 1, 'AGS disorder': 1, 'basal ganglia or frontal cortical calcifications': 1, 'calcification in the basal ganglia and thalami': 1, 'torch ginger': 1, 'TORCH (': 1, 'Basal ganglia, periventricular, and cerebellum calcifications': 1, 'Aicardi-Goutieres syndrome disease': 1, 'of Aicardi and Goutieres': 1, 'AGS-7': 1, 'Aircardi-Goutieres syndrome': 2, 'basal ganglia and cerebral calcification': 1, 'basal ganglia and cerebral calcifications': 1, 'extensive basal ganglia and cerebral calcifications': 1, 'Calcification of basal ganglia, dura mater': 1, 'AGS 8': 1, 'subcortical and basal ganglia calcifications': 1, 'Aicardi-Goutieres Goutieres syndrome': 1, 'autoimmune Aicardi-Goutieres syndrome': 2, 'Aicardi-Goutieres syndrome Cockayne syndrome': 1, 'Aicardi- Goutieres syndrome type 6': 1, 'Congenital Torch Diseases': 1, 'TORCH Diseases': 1, 'Aicardi-Goutieres syndrome': 1, 'basal ganglia calcifications': 1, 'AGS spectrum disorders': 1, 'AGS carcinomas': 1, 'BG calcifications': 1, 'ectopic and/or basal ganglia calcifications': 1, 'Pseudo-TORCH syndrome type I': 1, 'Brain calcification of especially the basal ganglia': 1, 'Aicardi-Goutieres syndromes 1-4': 1, 'basal ganglia calcific deposits': 1, "Aicardi Goutieres' syndrome": 1, 'TORCH viruses': 1, 'AGS-003 A.': 1, 'basal ganglia and cerebellar nuclei calcification': 1, 'Basal ganglia and cerebellum calcifications': 1, 'ToRCH complex infections': 1, 'AGS (Type 1-7': 1, 'calcifications in basal ganglia and cerebellum': 1, 'AGS Aicardi-Goutieres': 1, 'headache and neurologic deficits with cerebrospinal fluid lymphocytosis': 1, 'Aicardi-Goutieres syndrome (AGS) 1': 1, 'Aicardi-Goutieres syndrome defects': 1, 'Aicardi-Goutieres Syndrome Defects': 1, 'temporal lobe and basal ganglia calcification': 1, 'Central nervous Calcification of basal ganglia': 1, 'Calcification in the basal ganglia': 1, 'AGS-Like': 1, 'Aicardie-Goutieres': 1, "goutiere de l'anse": 1, 'Aicardi-Goutieres type 1': 1, 'calcification of basal and cerebellar ganglia': 1, 'HANDL': 1, 'CSF) lymphocytosis': 1, 'AGS Type 7': 1, 'AGS visual dysfunction': 1, 'AGS Tumor': 1, 'Headache and Neurologic Deficits with cerebrospinal fluid Lymphocytosis syndrome': 1, 'AGS pathological': 1, 'TORCH infectionsTerminal': 1, 'AGS.To': 1, 'TORCH diseases': 2, 'Aicardi-Goutieres neuroinflammatory disorder': 1, 'Aicardi-Goutieres disorder': 1, 'Acardi-Goutieres syndrome': 1, 'Aicardi-GoutieRes Syndrome': 1, 'basal ganglia and thalamus calcifications': 1, 'congenital AGS': 1, 'calcification of the basal ganglia and cerebellar nuclei': 1, 'cerebellar and basal ganglia calcification': 1, 'Familial chilblain lupus Aicardi-Goutieres syndrome': 1, 'basal ganglia and subcortical calcification': 1, 'Aicaridi-Goutieres syndrome': 1, 'dystrophic basal ganglia calcifications': 1, 'VBGC': 1, 'Bilateral calcification involving the basal ganglia': 1, 'AGS type 1': 1, 'basal-ganglia calcification': 1, 'Aicardi-Goutieres Syndrome n.t.': 1, 'fonction cree': 1, 'calcification mainly of the basal ganglia': 1, 'Aicardi-Goutieres Syndrome Type I Interferonopathy': 1, 'AGS 2019': 1, 'Congenital infections of the TORCH complex': 1, 'AGS1-9': 1, 'Aicardi-Goutiers syndrome': 1, "Aicardi-Goutiere's and Rett syndromes": 1, 'TORCH 5': 1, 'Aicadi-Goutieres Syndrome': 1, 'Intracranial calcification of basal ganglia': 1, 'basal ganglia calcification dysarthria': 1, 'CREES': 1, 'Aicardi-Goutieres syndrome-like AD': 1, 'Nucleic acid processing Aicardi-Goutieres syndromes': 1, 'Aicardia-Goutieres syndrome': 1, 'calcification of basal ganglia (BG': 1, 'Aicardi-Goutieres Syndrome type 1': 1, 'BASAL GANGLIA CALCIFICATION': 1, 'basal ganglia (BG) calcifications': 1, 'Aicardi-Goutieres inflammatory syndrome': 1, 'Kidney and basal ganglia calcifications': 1, 'kidney and cerebral basal ganglia calcifications': 1, 'Headache and Neurological Deficits with Cerebrospinal Fluid Lymphocytosis (HaNDL) syndrome': 1, 'TORCH syndromes 2': 1, 'calcifications of bilateral basal ganglia, cerebellum': 1, 'Basal ganglia and cerebellum calcification': 1, 'AGS- 3': 1, 'AGS-009': 1, 'calcification of the cerebral basal ganglia': 1, 'AGS neurologic': 1, 'AGS autoimmune': 1, 'Aicardi-Goutieres syndrome-related interferonopathy': 1}
|
Aicardi-Goutieres syndrome
|
Disease
|
MESH:C535608
|
{'Aicardi-Goutieres syndrome (AGS) type 5': 1, 'AGS5': 14, 'Aicardi-Goutieres syndrome type 5': 4, 'Aicardi Goutieres syndrome 5': 1, 'Aicardi- Goutieres syndrome type 5': 1, 'AGS type 5': 1, 'Aicardi-Goutieres syndrome 5': 6, 'Aicardi-Goutieres syndrome (AGS) 5': 1, 'Aicardi-Goutieres syndrome-5': 2, 'AGS-5': 2, 'Aicardi-Goutieres syndrome subtype 5': 1}
|
AGS5
|
Disease
|
MESH:C535610
|
{'cutis verticis gyrata': 207, 'CVG': 71, 'Cutis verticis gyrata': 114, 'Treating cutis verticis gyrata': 1, 'cutis verticis gyrate': 25, 'cutis gyrata': 41, 'primary essential cutis verticis gyrata': 3, 'Primary essential cutis verticis gyrata': 7, 'Cutis Verticis Gyrata': 32, 'cutis Verticis Gyrata': 1, 'Cutis Vertcis gyrata': 1, 'Cutis verticis gyrata naevocellularis': 1, 'atrofia gyrata': 1, 'Cutis Verticis Gyrata-Intellectual Disability (CVG-ID) syndrome': 1, 'cutis verticis Gyrata-Intellectual Disability syndrome': 1, 'THYROAPLASIA': 1, 'Cutis gyrata': 2, 'essential cutis verticis gyrata': 4, 'Secondary cutis verticis gyrata': 3, 'Craniosynostosis with cutis gyrata': 1, 'cutis verticus gyrata': 1, 'giant secondary cutis verticis gyrata': 1, 'cutis frontis gyrata': 1, 'Congenital primary cutis verticis gyrata': 2, 'cuticis verticis gyrata': 1, 'secondary cutis verticis gyrata': 8, 'Cutis Verticis Gyrata - A': 1, 'Cutis verticis gyrata -': 1, 'non-essential cutis verticis gyrata': 1, 'essential CVG': 6, 'Cutis verticis gyrate': 7, 'giant cutis verticis gyrata': 2, 'Primary cutis verticis gyrata': 6, 'primary CVG': 3, 'Primary Essential Cutis Verticis Gyrata': 2, 'Congenital Primary Essential Cutis Verticis Gyrata': 1, 'CVG-MR syndrome': 1, 'cutis verticis gyrata and mental retardation (CVG-MR) syndrome': 1, 'Cerebriform cell nevus in cutis verticis gyrata': 1, 'cutis vertices gyrata': 1, 'congenital CVG': 3, 'skin disorder of cutis gyrata': 1, 'cutis verticis gyrata of scalp': 1, 'Congenital cutis verticis gyrata': 2, 'CCVG': 2, 'thyroaplasia': 1, 'cutis verticis': 3, 'cutis verticalis gyrata': 1, '-essential CVG': 1, 'primary cutis verticis gyrata': 5, 'cutis verticis girata': 2, 'hyperostosis with cutis verticis gyrata': 1, 'Essential primary cutis verticis gyrata': 2, 'aplasia cutis verticis': 3, 'cutis verticis gyrata of the scalp': 2, 'cutis verticis plicata': 1, 'paquidermia verticis gyrata': 1, 'familial spastic paraplegia with cutis verticis gyrata': 1, 'primary non-essential cutis verticis gyrata': 1, 'Essential Cutis Verticis Gyrata': 1, 'cutis verticis gyratum': 1, 'primary cutis verticis gyrata of the scalp': 1, 'Pachydermia and cutis verticis gyrate': 1, 'gyrata': 1, 'cutis vertigis gyrata': 2, 'cutis gyrata on': 1, 'cutis veticis gyrata': 1, 'Le cutis verticis gyrata': 1, 'Cutis verticis gyrata of the scalp': 1, 'congenital cutis verticis gyrata': 1, 'cutis verata gyrata': 1, 'naevoid cutis verticis gyrata of the scalp': 1, 'nevoid Cutis verticis gyrata': 1, 'essential primary cutis verticis gyrata': 1, 'craniosynostosis with cutis gyrata': 1, 'Cutis gyrata syndrome': 1, 'Fastigium verticis': 1, 'CVG-ID': 1, 'systemic ossifying periostosis associated with cutis verticis gyrata': 1, 'Cutis verticis': 1, 'thyroid aplasia-cutis verticis gyrata': 1, 'essential primary Cutis verticis gyrata': 1, 'congenital or secondary cutis verticis gyrata': 1, 'pseudo cutis verticis gyrata': 1, 'CVG primary essential': 1, 'sebaceous hyperplasia of cutis verticis gyrata type': 1, 'cutis verticis et frontis gyrata': 1, 'Giant Cutis Verticis Gyrata': 1, 'Idiopathic CVG': 1, 'idiopathic CVG': 1, 'Idiopathic Cutis Verticis Gyrata': 1, 'Primary or idiopathic cutis verticis gyrata': 1, 'pachydermia verticis gyrata': 1, 'facial cutis verticis gyrata': 1, 'cutis verticis gyrata of': 1, 'Congenital Cutis Verticis Gyrata': 1, 'cutis parietalis gyrata': 1, 'verticis gyrata': 1, 'Aplasia cutis verticis': 1, 'aplasia cutis verticis lesions': 1, 'Cutis vertitis gyrata': 1}
|
cutis verticis gyrata
|
Disease
|
MESH:C535611
|
{'renal and branchial defects': 1, 'branchial defects': 21, 'branchial arch diseases': 2, 'branchial arch anomalies': 70, 'posterior arch defect': 20, 'fourth branchial arch anomaly': 4, 'branchial arch defects': 36, 'fourth branchial arch anomalies': 4, 'Fourth branchial arch anomalies': 4, 'Multiple branchial arch anomalies': 1, 'branchial sinus defect': 1, 'congenital hypoplasia of the posterior arch of the atlas': 1, 'Turguen-Aksu': 1, 'arch defects': 30, 'Branchial arch anomalies': 12, 'Arch artery defects': 4, 'arch artery defects': 21, 'branchial arches defects': 1, 'Branchial arch abnormalities': 2, 'branchial arch abnormalities': 19, 'posterior arch defects': 19, 'anterior arch defects': 12, 'malformations of branchial arch derived structures': 1, 'Posterior arch defects': 5, 'anterior arch of atlas defects': 1, 'arch of atlas defect': 1, 'BA defects': 1, 'hyoid arch defect': 1, 'Congenital hypoplasia of the posterior arch of the atlas': 1, 'anterior arch defect': 7, 'arch defect': 12, 'posterior atlas arch defects': 1, 'PAAD': 1, 'branchial arch developmental abnormalities': 1, 'BA1': 2, 'branchial or pharyngeal arch malformations': 1, 'branchial arch defect': 4, 'Branchial Arch Anomalies': 1, 'branchial arch malformations': 10, 'hypoplastic branchial arch': 1, 'Branchial sinus defects': 1, 'atlas arch defects': 5, 'autosomal dominant branchial arch syndrome': 1, 'branchial arches malformations': 1, 'Fourth branchial arch anomaly': 3, 'hypoplastic branchial arches': 3, 'Congenital fistula of the fourth branchial arch': 1, 'type IV branchial arch anomaly': 1, '1st branchial arch abnormalities': 1, 'developmental defect in the upper arch': 1, 'developmental abnormalities of the branchial arches': 1, 'arch artery defect': 4, 'BMDH Branchial defects': 1, 'defect of fourth branchial arch': 1, 'congenital third branchial arch anomalies': 1, 'congenital branchial arch pathologic': 1, 'dental arch defects': 6, 'defects of the posterior arch': 1, 'type III and Riolan arterial arch defects': 1, 'Riolan arch defect': 1, 'BAA': 2, 'Posterior arch defect of the atlas': 1, 'Branchial arch defects': 3, 'atlas posterior arch defects': 1, 'branchial arch anomaly': 13, 'fourth branchial arch abnormalities': 1, 'branchial arches abnormalities': 2, 'developmental defects of the arch arteries': 1, 'arch artery patterning defects': 2, 'fourth branchial arch defects': 1, 'congenital 1st and 2d branchial arch syndrome': 1, 'Congenital malformations of the branchial arches': 2, 'defects of the anterior arch': 1, 'congenital defects of the C-1 arch': 1, 'congenital defects of the posterior arch of C-1': 1, 'PAD': 1, 'AKU': 1, 'branchial arch anomaly complex': 1, 'Arch Defects': 2, 'defects of atlas arch': 1, 'anomaly of the fourth branchial arch': 1, 'branchial arch malformation': 4, 'branchial arch anomaly conditions': 1, 'Branchial Defects': 1, 'branchial-arch defects': 1, '2nd arch defects': 1, 'HdM.BA1': 1, 'Defects in posterior arch of atlas': 1, 'arch defects of the': 1, 'renal and branchial arch anomalies': 1, 'defects of the arch of the atlas': 1, 'Defects of the arch of the atlas': 1, 'craniofacial and branchial arch defects': 1, 'Hereditary branchial arch defects': 1, 'Congenital fourth branchial arch anomalies': 2, 'congenital developmental defects of branchial apparatus': 1, 'congenital branchial pouch anomaly of the fourth arch': 1, 'uterine and branchial defects': 1, 'Branchial arch malformations': 2, 'facial and branchial arch syndrome': 1, 'Posterior Arch Defect': 1, 'anterior atlas arch defects': 1, 'abnormality of the branchial arches': 1, 'branchial arch artery defects': 1, 'Ao arch defects': 1, 'Familial mixed deafness with branchial arch defects': 1, 'thyroglossal and branchial arch anomalies': 1, 'Atlantal arch defects': 1, 'atlantal arch defects': 2, 'branchial arch closure defects': 1, 'posterior arch defects of the atlas': 2, 'posterior arch defects of atlas': 1, 'defects of the posterior arch of the': 1, 'Anterior isolate arch defects': 1, 'atlantal arch defect': 1, 'familial branchial arch malformations': 1, 'defects of the posterior arch of the atlas': 1, 'congenital defects of first branchial arch': 1, 'cervicothoracic posterior arch defects': 1, 'arch defects of the atlas': 1, 'cardiac and branchial arch defects': 1, 'branchial arch abnormality': 1, 'branchial arch derivative defects': 1, 'Anterior arch defects': 1, 'posterior arch defect of the': 1, 'of branchial arch 1': 1, 'congenital fourth branchial arch anomalies': 1, 'posterior atlas arch defect': 1, 'Posterior atlantal arch defects': 1, 'defect of the anterior arch of the atlas': 1, 'Posterior arch defects of the atlas': 2, 'congenital hypoplasia of the arches of the': 1, 'anteroposterior defects of the arch of the atlas': 1, 'cleft defect of posterior arch': 1, 'fourth and sixth branchial arch anomalies': 1, 'branchial apparatus defects': 1, 'jaw/branchial arch defects': 1, 'arch shape defects': 1, 'third and fourth branchial arch abnormalities': 1, 'anterior arch defect of the atlas': 1, 'Arch Defect of the Atlas': 1, 'Posterior arch defect': 2, 'arch defect of the atlas': 1, 'atlas arch defect': 2, 'arch remodelling defects': 1, 'abnormalities of embryonic branchial arch system': 1, '4th arch artery defects': 1, 'palate branchial arch abnormalities': 1, '(unilateral) branchial arch disease': 1, 'branchial (or cutaneous) defect': 1, 'AKS': 1, 'Aksu Apple': 1, '3rd arch artery defects': 1, 'Branchial Arch Anomaly': 1, 'Atlas Arch Defects': 1, 'Arch defects': 1, 'CAD': 1, 'Atlas arch defects': 1, 'anterior and combined arch defects': 1, 'anterior and combined atlas arch defect': 1, 'anterior and combined atlas arch defects': 1, 'alveolar arch defect': 1, 'alveolar arch defects': 1, 'Arch defect': 1, 'malformations of the ears, branchial arches': 1, '1st and 2nd branchial arch malformation': 1, 'autosomal dominant branchial arch disorder': 1, 'Congenital lateral anomalies of the branchial arch': 1, 'branchial arches 3-7': 1, 'Branchial nerve defects': 1, 'and 3rd/4th branchial arch anomaly': 1, 'defect of the arch': 1}
|
branchial arch anomalies
|
Disease
|
MESH:C535612
|
{'RAAs': 60, 'Congenital absence of fibulae': 1, 'rAA': 31, 'AARR': 1, 'Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndrome': 4, 'Absence of the Fibula': 1, 'Al-Awadi': 14, 'Schinzel phocomelia syndrome': 8, 'limb/pelvis hypoplasia/aplasia': 2, 'Limb/pelvis hypoplasia/aplasia with skull defect': 2, 'Raas-Rothschild syndrome': 11, 'Schinzel phocomelia': 6, 'Congenital absence of the fibula': 7, 'pelvis or lower limb fractures': 2, 'pelvis and lower limb fractures': 3, 'pelvis or lower limb fracture': 1, 'Raas-Rothschild/Schinzel Phocomelia syndrome': 1, 'RAAS': 57, 'LPHAs': 6, 'absence of fibulae': 8, 'Congenital Absence of both Ulnae': 1, 'Al-Awadi-Raas-Rothschild syndrome': 8, 'Pelvis hypoplasia': 1, 'hypoplasia of the pelvis': 10, 'AARRS': 13, 'congenital absence of the fibula': 20, 'absence of the fibula': 24, 'partial absence of the fibula': 1, 'RASs': 9, 'Aarre': 1, 'fractures of the limbs or pelvis': 1, 'RAa': 35, 'Schinzel-Phocomelia syndrome': 1, 'malformation or absence of the fibula': 1, 'fractures of the pelvis or lower limbs': 1, 'absence of the ulna': 11, 'Limb/pelvis/uterus-hypoplasia/aplasia syndrome': 1, 'Absence of the ulna': 2, 'pelvis hypoplasia': 4, 'absence of ulna': 3, 'Al-Awadi/Raas-Rothschild syndromes': 1, 'aplasia of pelvis,': 1, 'Raas-Rothschild': 3, 'Raas-Rothschild/Furhmann syndrome': 1, 'Opitz and Al Awadi-Raas-Rothschild syndromes': 1, 'RAAS dysfunction': 3, 'ROTHSCHILD': 3, 'Limb/pelvis-hypoplasia/aplasia syndrome': 3, 'limb/pelvis-hypoplasia/aplasia syndrome': 11, 'limb-pelvis hypoplasia-aplasia': 2, 'of the RAAS': 1, 'absence of digits and fibula': 1, 'LPHAS': 2, 'spine, pelvis and lower limbs diseases': 1, 'limb and pelvis': 1, 'Al-Awadi-Raas-Rothschild (limb/pelvis/uterus-hypoplasia/aplasia) syndrome': 1, 'Al-Awadi-Raas-Rothschild (limb/pelvis/uterus-hypoplasia-aplasia)': 1, 'Rothschild giraffe': 2, 'Raas-Rothschild, Schinzel phocomelia': 1, 'unilateral absence of fibula': 1, 'absence of unilateral fibula': 1, 'unilateral fibula absence': 1, 'AARRS phocomelia': 1, 'Al-Awadi/Raas-Rothschild/Schinzel': 2, 'pelvis hypoplasia of the pubis and ischium': 1, 'Raas-Rothschild/Schinzel phocomelia syndrome': 2, 'Absence of ulna': 1, 'hypoplasia of the pelvis and': 2, 'Al-Awadi/Raas-Rothschild syndrome': 2, 'Congenital absence of ulna': 2, 'Congenital absence of the ulna': 1, 'Ar-Rass': 1, 'Fuhrmann and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndromes': 1, 'hypoplasia of the limbs syndrome': 1, 'Al-Awadi-Raas-Rothscild syndrome': 1, 'RAAS blockade': 4, 'congenital unilateral absence of the fibula': 1, 'bilateral absence of fibulae': 1, 'pelvis and lower limb)': 1, 'limb and pelvis injuries': 1, 'Rothschild syndrome': 1, 'extracutaneous defects hypoplasia of arm, leg, foot, pelvis and skull hypoplasia of upper limb': 1, 'PAPPA syndrome': 1, 'PAPPAS': 1, 'posterior amelia with pelvis and pulmonary hypoplasia syndrome': 1, 'lower limb and/or pelvis injuries': 1, 'fractures to the lower limb and/or pelvis': 1, 'fractures of the limbs and pelvis': 2, 'Pelvis and limb injuries': 2, 'congenital absence of the fibulae': 1, 'Awadi': 2, 'hip, pelvis, or lower-limb disorders': 1, 'Raas-Rothschild Syndrome': 1, 'hypoplasia/aplasia of the pelvis and limbs': 1, 'defects of the limbs and pelvis': 1, 'limb/pelvic hypoplasia/aplasia': 1, 'Al-Awadi/Raas-Rothschild (AARR) syndrome': 1, 'Al-Awadi/Raas-Rothschild and Schinzel phocomelia syndromes': 1, 'AARR syndrome': 1, "Rothschild's giraffes": 2, 'CONGENITAL ABSENCE OF THE FIBULA': 1, 'Congenital Absence of Fibula': 1, 'lower limb and pelvis fractures': 1, 'fractures of the lower limb and pelvis': 1, "Rothschild's giraffe": 1, 'absence of the fibula and ulna': 1, 'Al-Awadi/Rass-Rothschild syndrome': 1, 'Congenital absence of fibula': 1, 'Lower limb and pelvis disorders': 1, 'absence of the left ulna': 1, 'limb/pelvis hypoplasia/aplasia syndrome': 3, 'Bilateral congenital absence of the fibula': 1, 'absence of ulna and fibula': 1, 'pelvis or lower limb disorders': 1, 'rAAs': 1, 'aARR': 3, 'absence of ulna or fibula': 1, 'Bilateral absence of the ulna': 1, 'injuries to the limb and pelvis': 1, 'Awadi/Raas-Rothschild syndrome': 1, 'limbs and pelvis': 1, 'Congenital Absence of the Ulna': 1, 'RaA.': 1, 'Al-Awadi syndrome': 1, 'aplasia or hypoplasia of bones of the limbs': 2, 'RAas': 1, 'Limb-pelvis hypoplasia/aplasia': 1, 'limb-pelvis hypoplasia/aplasia (LPHA) syndrome': 1, 'pelvis, limb, and vertebral injuries': 1, 'shortening or absence of fibula': 1, 'absence of fibula': 4, 'RAAS-': 1, 'Rass': 4, 'absence of limb deficiencies': 1, 'congenital absence of fibula': 1, 'lower limb and lesser pelvis dysfunctions': 1, 'injuries to the pelvis and limbs': 1, 'lower limb, or pelvis fracture': 1, 'congenital total absence of the fibula': 1, 'AARRS) syndrome': 1, 'Al-Awadi/Raas-Rothschild/Schinzel phocomelia': 1, 'limb aplasia/hypoplasia': 1, 'defects of the brain, eye, bill, limb, and pelvis': 1, 'Al-Awadi-Raas-Rothschild disease': 1, 'pelvis hypoplasia of the pubis': 1, 'Injury to the Pelvis and Lower Limbs': 1, 'limb and pelvis fractures': 1, 'Al-Awadi/Raas-Rothschield': 1, 'Schinzel-phocomelia': 1, 'limb, pelvis, and thorax injuries': 1, 'limb-pelvis-genital organ developmental field defects': 1, 'limb-pelvic hypoplasia/aplasia syndromes': 1, 'Al-Awadi/Raas-Rothchild syndrome': 1, 'limb or pelvis fracture': 1, '-Awadi': 1, 'Raas-Rothschild/Schinzel phocomelia and': 1, 'Al-Awadi Raas-Rothschild syndrome': 1, 'SPS': 1, 'Schinzel Phocomelia syndrome': 1, 'Al-Awadi/': 1, '-Rothschild': 2, 'limb and pelvis fracture': 1, 'Al-Awadi-Raas Rothschild syndrome': 1, 'fibula absence': 1, 'congenital fibula absence': 1, 'absence of radii, ulnae, and fibulae': 1, 'Al-Awadi-Fuhrmann syndrome': 1, '-Raas-Rothschild (limb/pelvis/uterus-hypoplasia/aplasia) syndrome': 1, 'Rothschild': 1, 'congenital absence fibulae': 1, 'Holstein-Rasse': 1, 'Pelvis, lower limb and associated genital injury': 1, 'pelvis - marrow aplasia': 1, 'absence of right fibula': 1, 'bilateral absence of the fibula': 1, 'RAAS disorders': 1, 'Absence of fibulae': 1, 'unilateral absence of ulna': 1, 'Absence of fibula and ulna': 1, 'Pelvis, limb and vertebral injuries': 1, 'pelvis/lower limbs fracture': 1, 'unilateral absence of the ulna': 1, 'Congenital Absence of the Fibula': 2, 'fractures to the limbs and pelvis': 1, 'autosomal recessive inherited limb/pelvis-hypoplasia/aplasia syndrome': 1, 'ulnar and fibula absence': 1, 'Congenital absence of both fibulae': 1, 'LIMB SYNDROME': 1, 'Absence of Right Fibula': 1, '(limb/pelvis-hypoplasia/aplasia) syndrome': 1, 'limb aplasia and hypoplasia': 1, 'hypoplasia of the pelvis/lower limbs': 1, 'Furhmann/Al-Awadi/': 1, 'Raas-Rothchild syndromes': 1, 'fracture of the lower limbs and pelvis': 1, 'limb pelvis hypoplasia': 1, 'hypoplasia of the femur and pelvis': 1, 'Pelvis or Lower Limb fractures': 1, 'Congenital Absence of Ulna': 1, 'injuries to upper limbs and pelvis': 1, 'absence of the fibulae': 1, 'hypoplasia of pelvis': 2, 'injuries of pelvis and lower limb,': 1, 'hypoplastic lower limbs and pelvis': 1, 'hypoplasia of the lower extremities and pelvis': 1, 'Schinzel-phocomelia syndrome': 1, 'congenital absences of the fibula': 1, 'lower limb or pelvis fractures': 1, 'Al-Awadi-Raas-Rotschild syndrome': 1, 'limb-pelvis aplasia and hypoplasia syndromes': 1, 'Fuhrmann, Al-Awadi, and Raas-Rothschild syndromes': 1, 'Total fibula absence': 1, 'bilateral absence of fibula': 1, 'hypoplasia/aplasia of one or more limb bones': 1, 'limbs or pelvis': 1}
|
RAAs
|
Disease
|
MESH:C535616
|
{'PREMS': 37, 'PreM': 21, 'PREMs': 74, 'Prem': 4, 'Opti-Prem': 1, 'preM': 3, 'pREM': 2, 'preM-': 1, 'Chandran': 1, 'Khidr': 1, 'Prem+': 1}
|
PREMs
|
Disease
|
MESH:C535617
|
{'Nair 30282': 1, 'legion-naires disease': 1, 'Nair': 4, 'nAIR': 1, 'MPN Nair': 1}
|
Nair
|
Disease
|
MESH:C535618
|
{'Hypertrichosis cubiti': 20, 'cubitis valgus': 2, 'hypertrichosis cubiti': 47, 'cubiti': 8, 'hairy elbow syndrome': 5, 'Hypertrichosis Cubiti': 2, 'Hairy Elbow Syndrome': 1, 'HC': 2, 'cubitis valgus deformity': 1, 'hairy elbows': 16, 'hairy elbow': 2, 'Hairy elbows': 6, 'hairy elbows syndrome': 9, 'patella cubiti': 16, 'Patella cubiti': 11, 'PATELLA CUBITI': 1, 'hypertricosis cubiti': 2, 'HES': 2, 'hipertricosis cubiti': 1, 'Luxatio habitualis cubiti': 1, 'ligamentum collaterale cubiti': 1, 'Patella Cubiti': 1, 'mediana cubitis': 1, 'limitans cubiti': 2, 'Hairy Elbows Syndrome': 2, 'Hairy Elbows syndrome': 1, 'sporadic hypertrichosis cubiti': 1, 'Hairy elbows syndrome': 2, 'dorsale cubiti': 1, 'propatagiale et limitans cubiti': 1, 'limitans cubiti L. lim': 1, 'craniale cubiti L. cran': 1, 'craniale cubiti': 1, 'craniale cubiti and': 1, 'Familial hypertrichosis cubiti': 2, 'familial hypertrichosis cubiti': 1, 'articularis cubiti muscle': 1, 'articularis cubiti': 1, 'patella cubiti 2': 1, 'Vena cubiti media': 1, 'vena cubiti media': 1, 'hypertrichocis cubiti': 1, 'rete articulare cubiti': 1, 'Articulatio cubiti': 1, 'distractio cubiti': 1, 'hairy elbows"': 1, 'Vena mediana cubiti': 1, 'hypertrichosis cubiti or back': 1}
|
hypertrichosis cubiti
|
Disease
|
MESH:C535619
|
{'Necrosis of the nose tip': 1, 'hairy-nosed wombat': 4, 'tip of nose': 2, 'tip nose deformity': 1, 'hairy-nosed wombats': 6, 'Nose tip defect': 1, 'tip of nose lesion': 1, 'Nose Tip': 3, 'Cleft lip nose tip deformity': 1, 'Nose-Tip Metastasis': 1, 'beaked nose tip': 3, 'bulbous nose tip': 3, 'fleshy nose tip': 1, 'depressed tip of the nose': 4, 'Spinocellular epithelioma of the tip of the nose with osseous metastasis': 2, 'nose tip reduction': 1, 'Tip of nose distinct': 1, 'Schwannomas of the nose and nasal tip': 1, 'drooping tip of the long noses': 1, 'drooping tip of a long nose': 1, 'Malignant schwannoma of tip of nose': 1, 'Tip of nose tuberculosis': 1, 'Tip of nose': 2, 'nose tip lesion': 1, 'necrosis of the nose tip and': 1, 'deviation of the tip of the nose': 1, 'epitheliomas of the nose tip and': 1, 'lateral deviation of the nose tip': 1, 'SHN': 2, 'Carcinoma of the tip of the nose': 1, '-tipped nose': 1, 'carcinoma of the tip of the nose': 1, 'Nose tip': 1, 'broad or cleft nose with abnormal nasal tip': 1, 'nose tip': 4, 'nose tip avulsion': 1, 'nasal tip deformity of the nose': 1, 'ptotic nose tip': 2, 'cleft nose tip': 1, 'Hairy-Nosed': 2, 'deviation at the tip of the nose': 1, 'nose tip drop': 3, 'hairy long-nosed armadillo': 1, 'hairy-nosed': 2, 'Necrosis of the tip of the nose': 1, '-RANGING SOUTHERN HAIRY-NOSED WOMBATS': 1, 'TN': 1, 'swelling tip of the nose': 1, 'nose tip collapse': 1, 'deformities of the tip of the nose': 1, 'bulbous tip of the nose': 1, 'epidermoid carcinoma of the tip of the nose': 1, 'tipped nose': 1, 'Carcinomas of the tip of the nose': 1, 'nose tip and upper lip deformations': 1, 'Tip of the nose': 2, 'Hairy-nosed': 2, 'Deformities of the nose tip': 1, 'broad nose tip': 1, 'swelling at the tip of nose': 1, 'nose tip amputation': 1, 'ptosis of tip of the nose': 1, 'nose-tip lesions': 1, 'Gangrene of the tip of the nose': 1, 'Tip of the nose tumors': 1, 'short broad-tipped nose': 1, 'nose tip defects': 1, 'wide nose tip': 1, 'swelling at the nose tip': 1, 'tip-of-the nose': 1, 'erythematous tip of nose': 1, 'HNT': 1, 'Hairy nose tip': 1, 'Telangiectasia of tip of nose': 1, 'hairy nosed wombat': 1, 'SHNWs': 1, 'nose tip deformity': 1, 'tip of the nose': 1}
|
hairy-nosed wombats
|
Disease
|
MESH:C535620
|
{'palm': 162, 'Palm': 69, 'oil palm': 504, 'date palm': 133, 'palm and sole': 8, 'Sugar Palm/Kenaf': 1, 'Kenaf and Sugar Palm Fibers': 1, 'Sugar palm/kenaf': 1, 'UOPF': 1, 'OPF': 13, 'deficiency of both Qi': 6, 'homoplastic dysembryoplasia': 1, 'oil palm disease': 13, 'oil palm diseases': 15, 'deformities of both thumbs and both feet': 1, 'Impairments of Both Hands': 1, 'impairments of both hands': 1, 'dislocation of both': 9, 'absence of face, palm, and sole lesions': 1, 'erythema of the palms and soles': 38, 'erythema of palms and soles': 16, 'impairments in both': 23, 'abnormalities in both': 5, 'malformations of both forelimbs': 1, 'hyperhidrosis of the palms and soles': 20, 'both': 141, 'darkened palms and buccal mucosa': 1, 'lichenification of palms': 1, 'dysembryoplasia': 26, 'or both': 12, 'hyperhidrosis of palms and soles': 12, 'congenital lymphoedema of both legs': 1, 'numbness of palms and soles': 1, 'desquamation of the palms and soles': 21, 'Oil palm': 63, 'palm, sole, and mucous membrane involvement': 1, 'both types 1 and 2': 11, 'Date palm': 54, 'congenital dysembryoplasia': 1, 'hyperhidrosis of the palms or soles': 1, 'bON': 1, 'date palm thorn': 3, 'Date palm thorn injuries': 4, 'loss of both libido': 1, 'itchy palms': 9, 'tingling palms': 2, 'soles': 6, 'underrun soles': 1, 'underrun sole': 1, 'palm and apricot': 1, 'of both the': 4, 'sole abnormality': 1, 'of both': 35, 'delay of both': 1, 'desquamation of the skin of palms and soles': 1, 'palms': 31, 'Palm Warbler': 1, 'palm deformity': 12, 'pits of the palms and soles': 9, 'aquagenic wrinkling of the palms/soles': 1, 'stiffness of both hands': 1, 'Frost injury of both': 1, 'tripe palms': 74, 'poly and sindactily of both': 1, 'Both disorders': 1, 'disorders of both': 3, 'Oil Palm': 108, 'Sole lesion': 3, 'Palm lesion': 2, 'sole': 35, 'infection of skin of palms and soles': 1, 'impairment of both': 22, 'impairment of both neurodevelopment and': 1, 'palm or sole lesions': 1, 'palm and sole lesions': 7, 'Palm and Sole Lesions': 1, 'defect of palm': 2, 'Melanomas of the palm, sole, and': 1, 'oil-palm': 17, 'sweaty palms': 43, 'RPW': 59, 'Doum Palm': 2, 'RPO': 4, 'PKO': 18, 'Fractures of Both': 1, 'palm reversals': 2, 'PaLM': 16, 'Pigmented Bowen disease of the palm and sole': 1, 'and soles': 31, 'OPLE': 1, 'swelling of both hands': 4, 'palms and soles keratoderma': 1, 'CPKO': 3, 'CPO': 2, 'sole lesions': 10, 'SL': 2, 'sole lesion': 11, 'Sole': 7, 'clumsiness of both': 1, 'PODD': 1, 'injury to both': 3, 'PALMS': 9, 'pits of the palm and sole': 1, 'palms and soles rash': 2, 'dysembryoplasias': 8, 'Spiny keratoderma of the palms': 4, 'deficiency of both': 18, 'multiple small punctate keratoses of palms and soles': 1, 'dry, calloused, fissured palms and soles': 1, 'erythema of palms or soles': 16, 'pains of the palms and soles': 3, 'PVD': 1, 'RSPO': 14, 'Sustainable Palm Oil': 21, 'Oil palm mesocarp': 2, 'OPMF': 7, 'wax palm': 2, 'Palm of the hand': 5, 'palm mold': 1, 'palm disease': 5, 'keratoderma of the palms and soles': 22, 'OPFL': 1, 'PKM': 14, 'Lesions on Palms': 1, 'Fist-Edge-Palm': 6, 'Dermatoglyphic sole and palm': 1, 'dermatoglyphic sole and palm': 1, 'Hyperhidrosis of the soles and palms': 1, 'involvement of sole and palm': 1, 'hyperkeratotic lesions of the palms and soles': 1, 'hyperkeratoses of palms and soles': 1, 'palm weevil': 10, 'Buriti palm': 1, 'PK': 3, 'in both': 24, 'deformity of both legs': 3, 'desquamation of palms and soles': 17, 'palm/sole blister': 1, 'palm/sole burns': 1, 'traumatic lesions of the sole': 1, 'Traumatic Lesions of the Sole': 1, 'Traumatic lesions of the sole': 2, 'Peeling of Skin of Palms and Soles': 1, 'axillary and palm PH': 1, 'OP': 16, 'buriti palm': 1, 'NPV': 5, 'malformations of the thumbs and palms': 1, 'malformations of both the': 1, 'damage to both hippocampus': 1, 'decreased sole sensation': 1, 'keratoderma of palms/soles': 1, 'short palm': 4, 'SOLED PLASTER': 1, 'PKE': 10, 'renal dysembryoplasia': 1, 'palm and bug': 1, 'fracture both': 5, 'Fracture both': 1, 'Impairments in both': 5, 'skin metastasis on palm and sole': 1, 'fractures of both femora': 2, 'Keratotic desquamation of palms and soles': 1, 'Peach Palm': 2, 'caespitose palm': 2, 'reddened palms': 1, 'sticky palms': 1, 'wasting of both hands': 1, 'deformations of the palm': 1, 'Tripe palms': 33, 'hyperhidrosis of the palm or soles': 2, 'hyperpigmentation of the skin, palms and soles': 1, 'Congenital ichthyosis Rough palms and soles': 1, 'thickening of the palms and soles': 6, 'sole crease': 2, 'loss of both force and dexterity': 1, 'hematidrosis of the palm': 1, 'date-palm dieback': 1, 'Red Palm Weevil': 10, 'Red palm weevil': 2, 'of both Qi': 1, 'cleft of both': 1, 'disorders of both the': 1, 'thickening of palm and sole skin': 4, 'chela palm': 1, 'velvety palms': 1, 'lesion over the palm and sole': 1, '1 or type 2 or both': 1, 'loss of sole sensation': 1, 'palm deformity in': 1, 'swelling of phalanges of both hands': 1, 'fractures of both': 20, 'Rhizosis of date palms': 1, 'Rt.palm': 1, 'dislocation to both the': 1, 'POL': 3, 'tingling on both legs': 1, 'the palms and': 2, 'Defatted oil palm': 1, 'hyperkeratotic palms and soles': 5, 'slippery palms': 2, 'delay in both': 8, 'Sweaty palms': 5, 'palms and soles edema': 1, 'Date Palm': 19, 'oil palm fruit': 1, 'thumb in palm': 4, 'palms,': 1, 'TP': 9, 'Tripe Palms': 6, 'tripe palms with': 1, 'Dysesthesia of the palms and soles': 1, 'Palm Fruit Juice': 1, 'PFB': 1, 'dysplasia of both the acetabulum': 1, 'finger or palm abnormalities': 1, 'erythematopurpuric lesions of soles': 1, 'pits on the palms and soles': 4, 'PALMs': 5, 'tripe palm': 10, 'hyperkeratotic palms': 3, 'fractures of both the': 9, 'fractured both the': 1, 'telangiectatic lesions in palms and soles': 1, 'Palm Oil': 27, 'dysfunction of both lower': 1, 'short palms': 4, 'raffia palm': 1, 'lesions of the palms': 1, 'abnormalities of both': 8, 'Palm Kernel': 2, 'sensory loss to the sole of': 1, 'hyperpigmentation of the nails, palms and soles': 1, 'felled palm': 2, 'palm weevils': 7, 'cantholysis of both crura': 1, 'hyperlinearity of the palms': 1, 'Palm oil': 2, 'hairy palm': 7, 'red palms': 1, 'Red Palms': 1, 'palm lesion': 5, 'erythema of the oral mucosa, lips, and tongue, palms, and soles': 1, 'sensory disturbance of the sole': 2, 'deficiencies of both': 5, 'hyperhydrosis of both palms and soles': 1, 'areca palm': 2, 'dysplasia of both': 5, 'date palm disease': 3, 'oil palm fresh': 2, 'dislocation of both the': 4, 'erythema on palms and soles': 1, 'hardening of palms and soles': 2, 'PO': 26, 'erythema of the palms and the soles': 1, 'dysphoria in chest-palms-soles': 1, 'Hyperlinearity of palms and soles': 2, 'palms and soles': 18, 'motacu palms': 2, 'motacu palm': 1, 'Both': 17, 'rash of the palms and soles': 1, 'Discoloration of palms and soles': 1, 'Date-palm': 1, 'date-palm': 7, 'radiolucent-radiopaque lesions of both': 2, 'tingling in the sole': 1, 'pits on palms and soles': 3, 'lipstick palm': 1, 'congenital malformation of both hands': 1, 'oedema of the palms and soles': 1, 'sole injuries': 3, 'contractions of the palm': 1, 'palmoplantar keratoderma of palms and soles': 1, 'eruptions in palms or soles': 1, 'EOPM': 1, 'palm-weaving': 1, 'Hyperhidrosis of palms/soles': 1, 'Hyperhidrosis of palms and soles': 4, 'lichenification of palm of right hand': 1, 'sole of': 1, 'BoHA': 3, 'deficiency of both Hex-A': 1, 'subluxation of both hands': 1, 'RPW injury': 1, 'palms creases': 1, 'Oil Palm Disease': 1, 'Hairy cutaneous malformations of palms and soles': 1, 'Hairy cutaneous malformations of the palms and soles': 1, 'Date palm diseases': 1, 'delTyr': 1, 'congenital dislocation of both': 1, 'cutaneous dysembryoplasia': 2, 'non-tenera contaminant palms': 1, 'Palms': 24, 'tenera phenotype palm': 1, 'palm sensitivity': 1, 'hand movement in both': 1, 'back and both legs': 3, 'fractures of both malleoli': 4, 'reduction in both systolic': 4, 'palm and soles erosions': 1, 'the palms and soles': 2, 'PO-H': 1, 'PO-': 1, 'of both VFs': 1, 'malformations of both hands': 1, 'GSB': 1, 'Date Palm Fruits': 1, 'Palm Fruits': 1, 'Date Palm Leaves': 1, 'erythema in the palms and soles': 1, 'sole injury': 8, 'carcinomas in both': 1, 'Fracture of Both': 2, 'moist palms': 2, 'swelling of the palms/soles': 1, 'palm/sole swelling': 1, 'palm and sole desquamation': 6, 'ISPO': 3, 'PF': 1, 'vesicular dermatitis involving palms and soles': 1, 'of palm frond': 1, "Pumpkin carver's palm": 1, 'pits on the palms of the hands or soles': 1, 'Nipa Palm': 2, 'pits in the palms and soles': 1, 'yellow palm or soles': 1, 'non-pigmented lesion of the left sole': 1, 'xerosis of bilateral palms and soles': 1, 'hyperpigmentation of the palms, soles': 1, 'dislocation of both testicles': 1, 'PALMS OF THE HANDS': 1, 'atypical thumb of both hands': 1, 'DPF': 5, 'defects of both': 1, 'itching of palms and soles': 3, 'POFA': 8, 'palm leaf injury': 1, 'palms and': 6, 'Painful erythema of the palms and soles': 1, 'neural abnormalities of both': 1, 'SOLELY CUTANEOUS PLASTIC STEP': 1, 'oedema of the palms/soles': 1, 'palm damage': 3, 'blast': 1, 'paraesthesia of both hands': 1, 'Both Diseases': 3, 'palm reversal error': 1, 'palm reversal': 2, 'PAL': 1, 'fist-hand blade-palm disorder': 1, 'dyskeratosis of the palms and soles': 1, 'dermatoses of the palms and soles': 1, 'injury of the palm': 2, 'palm injury': 3, 'impairment in both': 13, 'dysaudia in both': 1, 'palm deformities': 1, 'HURRICANE PALMS': 1, 'deformities of both': 3, 'pain of the palms and soles': 1, 'deficiencies of both ADAMTS13': 1, 'sclerosis at palm': 1, 'hyperlinear palms': 28, 'swelling of the palms and soles': 3, 'abnormalities in both the cortex': 1, 'Palmyra palm syrup': 1, 'palmyra palm syrup': 1, 'date palm syrup': 1, 'Palmyra Palm': 2, 'Raw palm': 1, 'Tumors of the soles and palms': 1, 'impairments in both motor': 1, 'both disabilities': 1, 'epidermolytic keratoderma of palms and soles': 1, 'keratoderma of palms and soles': 5, 'Date palms': 3, 'palm and palm-axilar hyperhidrosis': 1, "dysfunction of Lejears' sole": 1, 'skin lesions of the palms and soles': 1, 'carcinomas (both of': 1, 'damage to both the LD': 1, 'thumb-to-palm dysfunction': 1, 'pits on palm and soles': 1, 'lichenification of the palms': 1, 'Palme murder': 2, 'maceration of the palm': 1, 'loss of both sight': 1, 'hypoplasia in both the': 1, 'BI': 3, 'dysfunction of both': 6, 'right palm lesion': 1, 'OPA': 1, 'Oil palm ash': 1, 'rash on soles and palms': 1, 'defective palms and soles': 2, 'fracture of both lower extremities': 1, 'hypoplasia of both': 2, 'Abduction impairment both': 1, 'OPM': 1, 'Sugar palm': 4, 'keratoderma on the palms and soles': 3, 'Palm weevil': 4, 'toxic erythema of the palms and soles': 2, 'lumps in the sole': 1, 'sugar palm': 1, 'fracture of both ischial rami': 1, 'erythema of palm and soles': 1, 'O/P': 1, 'oil per palm': 1, 'Sole crease': 1, 'delays in both': 10, 'PEN': 7, 'Both -': 1, 'impairments of both motor and': 1, 'marginal papular keratodermas of the palms and soles': 1, 'deformities on the palms': 1, 'ischaemic lesion of both dorsomedial thalami': 1, 'cleft in both the': 1, 'jelly palm': 2, 'lesions of both': 1, 'date palm thorn injury': 2, 'Date palm thorn injury': 1, 'fracture of both malleoli': 2, 'Numbness in palm and sole': 1, 'tripe palms and soles': 1, 'palms/': 1, 'coconut palm-related injury': 2, 'palm/sole erythema': 3, 'erythematous indurations of the palms and soles': 1, 'Syndrome of deficiency of both Qi': 1, 'Syndrome of disease of both Wei': 1, 'Tripe palm': 6, 'oil palm abnormalities': 1, 'dura palm': 2, 'Oil Palm Germplasm': 1, 'Desquamation of the palms and soles': 4, 'Disability linked to the palm': 1, 'superficial mycosis of the palm and sole': 1, 'vesicular eruptions of palms, soles of the feet and mouth': 1, 'skin disease of the palms and soles': 2, 'Sensory disturbance of the sole': 1, 'arecoid palms': 1, 'Punctate Keratoderma of Palms and Soles': 1, 'reduction in both': 2, 'lesion of the palm': 5, 'injuries to both': 2, 'Keratoderma of the soles': 1, 'transverse palm': 1, 'polydactyly of both hands': 5, 'deformity of both': 1, 'lipoma of the palm': 1, 'both of': 2, 'the sole': 1, 'SPF': 1, 'DBD': 1, 'Cutaneous Foot sole': 1, 'Palm diseases': 1, 'OPP': 3, 'fracture of both': 16, 'Impairments in both prosody identification and': 1, 'depigmentation of palms and soles skin': 1, 'palm-': 2, 'thumb-in-palm': 1, 'thickening of palm and sole': 2, 'ischaemia of both legs': 2, 'dislocation of one or both lenses': 1, 'anomalies of the sole': 1, 'both disorders': 5, 'primary date palm': 1, 'OPL': 5, 'hyperkeratotic rugae of the soles': 2, 'sweaty palm': 1, 'desquamation of the palms or soles': 1, 'date palm Bayoud disease': 3, 'date palm diseases': 1, 'of both sensitivity': 1, 'Nipa Palm leafs': 1, 'hyperlinearity of palms': 2, 'vesicular eruption of the palms and soles': 1, 'Palm Leaf': 1, 'deformities of both legs': 3, 'COMB': 2, 'Palms and soles erythema': 1, 'Palm Fiber': 2, 'Erythematous eruption of the palms and soles': 1, 'palm creases': 4, 'dysfunction in both': 1, 'oil Palm': 1, 'injuries of both': 3, '-Palm': 2, 'HPO': 2, 'sole and palm restricted': 1, 'thickening of palms and soles': 8, 'keratoderma of the palm and soles': 1, 'thickened palm and soles': 1, 'OPs': 1, 'date palm wilting': 1, 'deficiency of both corpus spongiosum and cavernosum': 1, 'pitting of the palms and soles': 1, 'deficiency of both qi': 11, 'edema of the palms and foot soles': 1, 'impaired foot sole cutaneous': 1, 'fractures of both acetabulum and': 1, 'FTCs': 1, 'palm-and-sole syndrome': 1, 'duplication of both the leg and the': 1, 'cleft of the palm': 1, 'palm and/or sole lesions': 1, 'swelling of the sole of the': 1, 'Lipomas of the sole': 1, 'palm lesions': 4, 'pustule on the palm': 1, 'coryphoid palm': 3, 'coryphoid palms': 2, 'Coryphoid palm': 1, 'and sole of the': 1, 'dysembryoplasia of the': 2, 'impairment of both short- and': 2, 'TSM': 1, 'palm loss': 1, 'tingling sensation of palm and sole': 1, 'fibroproliferative disease of the palm': 1, 'itching of her palms and soles': 1, 'of both active': 1, 'abnormalities of both the': 1, 'Pellagrous lesions of the palms &': 1, 'Oil Palm Seedling': 1, 'oil palm seedling': 1, 'finger-in-palm" deformities': 1, 'itchy rashes over palm and soles': 1, 'Chondrolipoma in the palm': 1, 'chondrolipoma in the palm': 1, 'tinea of the palms, soles and': 1, 'palm bunch': 3, 'melanoma of the palms, soles': 1, 'hypoplasia of the radial part of both hands': 1, 'paraesthesia of both legs': 1, 'Palms 2': 1, 'rashes involving palms and soles': 1, 'papular lesions of palms and soles': 1, 'date palm disorders': 1, 'cerebriformcollagenoma of the palm and sole': 1, 'palm involvement': 2, 'sclerosis of both hippocampi': 1, 'both-hand movement': 1, 'diwakkawakka oil palm': 1, 'acai palm': 3, 'multiple pits of palms and soles': 1, 'Keratoderma of soles': 2, 'neuropathy of both legs': 1, 'swelling on the sole of the': 1, 'lipoma on the sole of the': 1, 'swelling at the sole of the': 1, 'dyskeratosis of the soles and palms': 1, 'diseased palm': 1, 'Both Disorders': 6, 'HOP': 1, 'palm and nailbed lesions': 1, 'redness of palms or soles': 1, 'palm thrips': 6, 'Palpable Palms': 1, 'Spiny keratoderma of the palms and soles': 5, 'volume loss of both the cortex': 1, 'blotchy palms': 1, 'benign lipoma to the sole': 1, 'oil palm mesocarp': 1, 'deformities of fingers and palm': 1, 'hyperhidrosis in palms and soles': 1, 'hyperkeratotic lesions of palms and soles': 1, 'deformation of both': 1, 'erythema on the palms and soles': 3, 'physical impairment of both hands': 1, 'Hyperlinear palms': 9, 'Hairy palm sign': 1, 'palm diseases': 5, 'loss of both': 15, 'dislocation of both lenses': 1, 'ASSD;both': 1, 'hyperplasia of the palms and soles': 1, 'both type 1': 2, 'Disorders of Ornamental Palms': 1, 'BH': 3, 'bunches of oil palm': 1, 'pulp-to-palm deficiency': 1, 'Oil palm ripeness': 1, 'or palm': 1, 'palm injuries': 7, 'injuries of both lower': 1, 'sialadenosis of both sumandibular glands': 1, 'cleft hand or both': 1, 'coconut palm': 1, 'palmate palms': 1, 'Keratoderma of the palms and soles': 1, 'date palm wilt disease': 1, 'Sago palm': 2, 'Palm Fibers': 3, 'data palm': 2, 'HPD': 2, 'acuri palm': 1, 'both FM': 1, 'deficiency of both Xin': 1, 'malformations in both': 1, 'pain on the palms and soles': 1, 'reduction of both': 4, 'swelling of palms and soles': 5, 'or Both': 1, 'melanoma of the palm and sole': 1, 'lesions of the soles': 2, 'palm and sole erythema': 4, 'Erythema of palms and soles': 1, 'spiny keratoderma of the palms and soles': 5, 'hyperkeratosis of both': 1, 'skin hyperpigmentation of the palms and soles': 1, 'Synovioblastoma of the palm': 1, 'dysplasias of both hippocampi and amygdalae': 1, 'sole damage': 1, 'Palm kernel chaff': 1, 'PKC': 1, 'Oil palms': 1, 'Coconut palms': 3, 'punctate keratosis of the palms and soles': 1, 'edema of the palms and soles': 1, 'melanoma on palms, soles, and nail bed': 1, 'Hyperhidrosis of the palms and soles': 2, 'Hexadactyly of both hands': 1, 'palm warbler': 1, 'Sole bruise286': 1, 'drooping of both': 2, 'and hand skin thickening': 1, 'Disorders of both': 1, 'abnormalities of both BP': 1, 'Sole abnormality': 1, 'Sole abnormalities': 2, 'sole abnormalities': 5, 'Edible Oils-Oil Palm': 1, 'NMEO-OP': 1, 'erythema of the palms and sole': 1, 'palms & soles': 1, 'motor impairments of both lower extremities': 1, 'thickening of skin on palms and soles': 1, 'Ulrich von Both': 2, 'Raffia palm': 1, 'sole pension': 1, 'Palm Cove': 2, 'in both emotion': 1, 'hyperpigmentation of the palms and soles': 5, 'dysmaturity of one or both fetuses': 1, 'TEAE': 1, 'vesicles on palms and soles': 1, 'loss of sensation of the sole': 1, 'keratoderma of the palms and the soles': 1, 'itching of palms, soles': 1, 'Palms and': 1, 'Keratoderma of the palm creases': 1, 'both type 1 and 2': 11, 'keratoderma of palms': 1, 'fractures of both zygomaticomaxillary complex': 1, 'carcinoma of palm': 1, 'sensory abnormality of palms': 1, 'keratoderma of the soles': 2, 'PE.Both': 1, 'papilloedema of both': 1, 'camptodactyly of both hands': 3, 'loss of both hands': 3, 'desquamation of palm and soles': 1, 'stenotic lesions of both': 1, 'deficiency of both the MLP': 1, 'CAD.Both': 1, 'jaundice in the palms and soles': 1, 'diffuse keratoderma of the palms and soles': 2, 'of-palms': 1, 'coronaviruses of palm civets': 1, 'swelling of the soles': 1, 'Hypoaesthesia of the sole': 1, 'Combined malformation of both hands': 1, 'impairment in both the': 1, 'BCCs to the palm': 1, 'Majhool Date Palm': 1, 'disabilities in both': 1, 'DPS': 1, 'Neutrophilicdermatosis of the palms': 1, 'both diseases': 2, 'of both motor and sensory': 1, 'swelling in both hands': 1, 'Lipoma of the palm': 1, 'edema of palms and soles': 2, 'swollen palms or soles': 1, 'dysfunction of both the': 2, 'loss of both motor and sensory function of the hand': 1, 'to a sole artery': 1, 'Oil Palm Frond Juice': 1, 'Coryphoid palm megafossil': 1, 'Coryphoid palms': 1, 'coryphoid costapalmate palm': 1, 'Coryphoideae palm': 1, 'coryphoid palm leaf': 2, 'palm and sole skin': 3, 'Palm Desert': 2, 'hyperhydrosis of palms and soles': 2, 'reduction of both FEV1 and FVC': 1, 'hyperhidrosis of palm and sole': 1, 'tylosis of the palms and soles': 1, 'SS': 4, 'reduction of both systolic': 2, 'Ungurahui Palm Fruits': 1, 'impairment on both': 1, 'and sole': 5, 'inflight loss of both': 1, 'involvement of palms and soles': 1, 'Gnypeta brincki Palm': 1, 'ulcers or rashes on palms and soles': 1, 'Metamorphic soles': 1, 'palm wilts': 1, 'dieback of palm': 1, 'palm dieback disease': 1, 'palm dieback': 1, 'Palm dieback disease': 1, 'Palm dieback': 1, 'disease of OP': 1, 'AVROS OP': 1, 'pits of the palm and soles': 1, 'hyper- or hypohidrosis of the palms and soles': 1, 'EC.Both': 1, 'RCPO': 1, 'ERCPO': 1, 'hyperhidrosis of the palms and/or soles': 1, 'NSd palm': 1, 'damage to both': 1, 'Impairment of both': 2, 'hyperextensibility of both': 1, 'of the Palms of the Hands': 1, 'erythema of the palms and/or soles': 1, 'developmental delay in both': 1, 'Syndrome of both Weifen and Qifen': 1, 'palm defects': 9, 'erythematous induration of palms and soles': 1, 'Peeling of skin from palms and soles': 1, 'peeling of skin from palms and soles': 1, 'both central': 1, 'Oil-palm': 1, 'HLP': 2, 'Keratosis of the palms and soles': 1, 'red palm weevil': 9, 'neuropathy of both the': 1, 'dysfunction of both hands': 1, 'sOLE': 1, 'P-type sOLE': 1, 'palm pathogens': 1, 'Loss of both hands': 1, 'Oil Palm Leaves': 1, 'tremulousness of both hands': 3, 'hyperkeratotic lesions on palms and': 1, 'PM': 1, 'itchy palms or soles': 1, 'Melanocytic lesions of the palms and soles': 1, 'PHU': 1, 'hyperkeratotic palms and': 1, 'Soles': 2, 'moriche palm': 1, 'twitching of both hands': 1, 'RABBITS INDUCED SOLELY': 1, 'COMBO': 2, 'ANRSD': 1, 'areca palm necrotic ringspot disease': 1, 'disease of the palms and soles': 1, 'palm and sole pits': 1, 'fracture of one or both': 1, 'type 1 or both': 1, 'palm or sole involvement': 1, 'Palm Weevil': 1, 'Circumscribed hypokeratosis of palms and soles': 1, 'chest, palm, and sole dysphoria': 1, 'deficiency of both apoAI': 1, 'of both FVC': 1, 'spiny keratoderma of the palms': 1, 'palm and sole melanoma': 3, 'hypoplastic both 1st': 1, 'melanoma of palms and soles': 1, 'PSS': 1, 'numbness in palms and soles': 1, 'painful condition of palms and soles': 1, 'painful desquamation of both palms of the hands': 1, 'fracture of both acetabuli': 1, 'obstructions of both': 1, 'congenital duplication of the palm deformity': 1, 'fractures of both the scaphoid and': 1, 'clumsiness of both hands': 4, 'deficient in both': 2, 'trisomic for both the X': 1, 'Palming': 1, 'red palm': 2, 'SA': 1, 'sole and palm infection': 1, 'scaling of the palm and sole skin': 1, 'involvement of the face, palms/soles': 1, 'malformation of both hands': 2, 'injuries of the sole': 1, 'nipa palm syrup': 1, 'nipa palm': 1, 'deficiencies of both Qi': 1, 'melanoma of the palms and soles': 1, 'DF date palm': 1, 'thickening of the skin on the palms and soles': 1, 'Erythema of the palms and soles': 4, 'sole ischaemia of the digitus I': 1, 'Keratoderma of palms and/or soles': 1, 'palm increase': 1, 'dysesthesia on the palms and soles': 1, 'rash on the palms and soles': 1, 'Obstruction of both Nostrils': 1, 'sole disorders': 2, 'sole and white-line disorders': 1, 'keratotic lesions of palm and sole': 1, 'injuries of both the': 2, 'Erythema of palms, soles': 2, 'callused palms': 1, 'Peach palm': 1, 'tumour of the palm or sole': 1, 'BL': 3, 'malformation of both thumbs': 1, 'abnormalities of both large': 1, 'erythematous palm': 1, 'skin lesions over palms and soles': 1, 'lesion in the sole': 1, 'itchy palms and soles': 1, 'hyperthickened palms and soles': 1, 'IDs': 1, 'peeling of the palms/soles': 1, 'Palms and soles': 2, 'SO': 1, 'Outback palms': 1, 'palms and soles itch': 1, 'impairment of both ADL and IADL': 1, 'epidermal thickening of palms and soles': 1, 'Tripe Palm': 1, 'palm crease': 3, 'palm extractivism': 1, 'sclerodactyly of both hands': 1, 'erythema in palms and soles': 1, 'Deficiency of both': 2, 'Bayoud disease of date palm': 2, 'tingling of the palms and soles': 1, 'keratoderma of the palms and': 1, 'congenital duplication of the palm': 1, 'Congenital duplication of the palm': 1, 'Canary date palm': 1, 'and palm': 2, 'the palms and/or': 1, 'injuries to both ACLs': 1, 'TEN.Both': 1, 'Palms,': 1, 'both type 1 and 2)': 2, 'lichenification of the palm': 1, 'palm thorn': 3, 'palm and': 3, 'fractured both legs': 1, 'palm fibers': 1, 'Erythema of palms/soles': 1, 'Impairments of both': 1, 'motor disturbance of both legs': 2, 'disability of both': 1, 'sensory disturbance of both hands': 1, 'dermatochalasis of both': 1, 'Palm kernel': 1, 'blight of palms': 1, 'traumatic defect of the palm': 1, ', both central/': 1, 'hypoplasia of both lower extremities': 2, 'keratoderma of soles': 1, 'keratoderma of bilateral soles': 1, 'of sensitivity to the sole': 1, 'loss of sensitivity to the sole': 1, 'impairment, both': 2, 'palm papules': 1, 'oedema of palms and soles': 1, 'Oil Palms': 3, 'feverish palms and soles': 3, 'unripe palm': 1, 'BioID': 1, 'loss of both pinprick': 1, 'edematous palms and soles': 1, 'of both the MTP': 1, 'lesions in the palms and soles': 1, 'sole defects': 2, 'pitting of palms and soles': 2, 'subaponeurotic lipoma of the palm': 1, 'traumatic loss of one or both': 1, 'Fractures of both': 2, 'Oil Palm HD-ZIPs': 1, 'fracture in both': 1, 'SMI': 1, 'giant lipoma of the hand and palm': 1, 'BN': 1, 'damage to the posterior region of both': 1, '(palm)': 1, 'on the palm or sole of your': 1, 'of palms and': 2, 'sole dysplasia': 1, '-EXO.Both': 1, 'erythema of both hands': 1, 'crown disease of oil palm': 2, 'malformation of both': 2, 'loss of breadth of the palm': 1, 'oil palm fruit bunch': 1, 'pruritus of palms and soles': 1, 'phoenix palm disease': 1, 'xantochromia of palms and soles': 1, 'impairments in both strength and balance': 1, 'painful skin lesions on palms or soles': 1, 'fracture of both the': 3, 'Palms and Soles': 2, 'COM': 1, 'rotten palm': 3, 'eczematous palms and soles lesions': 1, 'palms lesions': 1, 'palms and soles lesions': 1, 'painful bullae or ulcerations of the palms and soles': 1, 'malformation of the primary palate solely': 1, 'fracture of both pedicle': 1, 'Oil Palm Lethal Wilt': 1, 'melanomas of palms and soles': 1, 'Both disturbances': 1, 'Fracture of Both Legs': 1, 'PORE': 1, 'thenar hypoplasia of both hands': 1, 'euhidrosis of palms or soles': 1, 'pruritus of the palms and soles': 2, 'deficiencies in both': 2, 'hyperlinearity of palms and soles': 1, 'plams and soles': 1, 'postaxial hexadactyly of the both hands': 1, 'sensory impairment of the sole': 1, 'monosensitisation to tropical sole': 1, 'conjunctival injection erythema of the palms and soles erythematous': 1, 'erythematous palms/soles': 1, 'Palm de husker': 1, 'multilating keratoderma of palms and soles': 1, 'abnormalities of both skin and hair development': 1, 'postaxial hexadactyly of both hands': 2, 'palm- and sole-sparing rash': 1, 'dullness of sole': 1, 'Medullo-tubular dysembryoplasia': 1, 'Reddened palms': 1, 'distal skin defect of palm and dorsum of hand': 1, 'TT 1.Both': 1, 'onto palm': 1, 'erythemas of the palms and soles': 1, 'Dura palm': 1, 'tingling numbness of palms and soles': 1, 'swollen soles': 1, 'Palm Oil Plantation': 1, 'PDS': 1, 'decrease in both': 1, 'PPF': 5, 'erythema of both the palms and soles': 1, 'injury to both thumbs': 2, 'Epidermal cysts of the palms and sole of feet': 1, 'oil palm fruit abnormality': 2, 'loss of function on both hands and legs': 1, 'loss of both hand movement and dexterity': 1, 'nevi of palms and soles': 2, 'HE.Both': 1, 'skin lesions affecting palms and soles': 1, 'palm print': 1, 'deformity of the palm': 1, 'rotatory dislocation of both': 1, 'oedema of both hands and face': 1, 'EP': 2, 'Eliassen-Palm': 3, 'HP': 1, 'OPL herbal': 1, 'pain in the palms and soles': 1, 'Sticky palms': 1, 'injuries of the palm': 1, 'delays in both syntax': 1, 'wrinkled palms/soles': 1, 'of both the glomerulus and': 2, 'duplication of fingers of both hands': 1, 'agenesis of both hands': 1, 'swelling of the palm of the hand': 1, 'weakness of both legs and both hands': 1, 'palm/sole melanomas': 1, 'thickening of the skin of palms and soles': 1, 'AMR': 1, '-Edge-Palm': 1, 'SM': 2, 'Isle of Palms': 1, 'malformations of both bodies': 1, 'both Type 1 and 2': 1, 'erythematous palms and soles': 1, 'perodactylia of both hands': 1, 'abnormalities of the palms, soles and': 1, 'hyperlinearity of palm': 1, 'date palm rachis': 2, 'Deficiency of both Qi': 3, 'INLAY SOLES': 1, 'oil palm orange': 1, 'Oil Palm Diseases': 1, 'Oil palm disease': 1, 'Chela palm': 1, 'Palm Frond': 1, 'impairments on both': 1, 'palm fruits': 1, 'anomalies in both thalami': 1, 'Dysplasia of both': 1, 'edematous palms, and': 1, 'Oil Palm Crops': 2, 'discoloration of palms and soles': 1, 'Palm Creases': 1, 'Pruritic palm and soles swelling': 1, 'palms and soles swellingSkin': 1, 'DP': 2, 'palm vein': 1, 'Palm vein': 1, 'numbness of the palms and soles': 1, 'sole fracture': 1, 'lesions of the palms and soles': 2, 'Hand-palm': 1, 'branch puncture injury to sole': 1, 'developmental delays in both': 1, 'lesions on both': 1, 'disorder of both the': 1, 'perionyxis of both thumbs': 1, 'aequatorialis palms': 1, 'RPW damages': 1, 'loss in both': 1, 'of both motor cortex and': 1, 'malformation of both pedes': 1, 'Location Palm': 1, 'tremulousness of both the hands': 1, 'thickening of the skin of the palms and soles': 1, 'spiny palms': 1, 'palm aponeurosis': 1, 'Carcinoma of the palm of the hand': 1, 'skin lesions of both palms and soles': 1, 'impaired both': 1, 'Palme': 1, 'oral mucosal and palm and sole lesions': 1, 'skin lesions of palms and soles': 1, 'abnormalities of both peristalsis': 1, 'Palm of hand': 1, 'fire-intolerant palms': 1, 'deficiency of both nutrients': 1, 'Palm hyperhydrosis': 1, 'sole hyperhydrosis': 1, 'erythema on the palms or soles': 1, 'thickening of the skin of the palms and the soles': 1, 'deficiency of both vital': 1, 'syn-polydactyly of both hands': 1, 'keratoderma on the palms and': 1, 'palm pustules': 1, 'vesiculopustular lesions of palms and soles': 1, 'Erythematous changes of the palms': 1, 'pigmented macules on palms and/or soles': 1, 'DPL': 1, 'pricked sole': 1, 'fibrolipoma in palm': 1, 'pits of the palms and/or soles': 2, 'or both TMJs': 1, 'Palm Lesions': 1, 'Clumsiness of both hands': 1, 'vEDS.*Both': 1, 'acral lentiginous melanoma of the palms and soles': 1, 'Palm aponeurosis': 1, 'impairment of both the': 1, 'malformations of both vitamin A toxicity and deficiency': 1, 'chronic dermatosis of the palms and soles': 1, 'numbness of soles and palms': 1, 'bullae on palms or soles': 1, 'abnormal thickening of palms and soles': 1, 'Hand Palm': 1, 'Toddy Palm Nectar': 1, 'TPN': 1, 'Oil Palm leave': 1, 'palm and sole rash': 2, 'deformity of both the': 1, 'BO': 2, 'idiopathic tripe palms': 1, 'erythema of both palms': 1, 'Red palms and soles': 1, 'Impairment of both forced vital capacity': 1, 'swelling of palm and sole skin': 1, 'palm bagasse': 1, 'scaling of palms and soles': 3, 'SOLES': 3, 'ALTERATIONS OF PALMS': 1, 'Khmer Palm': 1, 'malformation of both the': 1, 'Combined dislocation of both the subtalar and': 2, 'FEP': 2, 'obstruction of both': 3, 'palm/': 1, 'palm and/or': 1, 'Hyperpigmentation of palms and soles': 2, 'hairy cutaneous malformations of': 1, 'hairy cutaneous malformations of the palms and soles': 1, 'deficiency of both ureagenesis': 1, 'palm and sole keloids': 1, 'choleliths solely within': 1, 'reductions in both': 1, 'tenera palms': 1, 'palm leaf': 1, 'deformity of the palms': 1, 'DPR': 1, 'Date palm rachis': 1, 'Palm Rachis': 1, 'warm palms': 1, 'palm and sole involvement': 1, 'soles Hand-Foot Palms': 1, 'soles Palms': 1, 'CMB.Both': 1, 'pygmy date palms': 1, 'of both Insigs': 1, 'Hyperlinear palm': 1, 'honest palm sign': 1, 'Honest Palm Sign': 1, 'albedinis Date Palm': 1, 'right palm': 1, 'hyperkeratotic soles': 2, 'dysfunctions of both myocardial contraction and': 1, 'and sole defects': 1, 'thickened skin of the palms and': 1, 'epidermal malformation of the palms or': 1, 'common sole': 3, 'hyperhidrosis of palms or soles': 1, 'PSM': 1, 'Wrinkled palms and soles': 1, 'desquamation of palms/soles': 2, 'apraxia of both hands': 1, 'sensibility loss of both': 1, 'POC': 4, 'Eczematous rash of the palms and soles': 1, 'dislocation of the both': 1, 'Date Palm Pneumatophores': 1, 'beta': 1, 'dysplasia of both TMJs': 1, 'vesicular rashes on palms, soles, and mouth': 1, 'date palm scorch disease': 1, 'hyperpigmentation of palms and soles': 2, 'pale palms': 1, 'Pale palm': 1, 'pale palm': 1, 'palm and/or sole erythema': 1, 'BoHM': 1, 'swelling on the palms and soles of the feet': 1, 'palm- ANKA': 1, 'date palms': 2, 'palm heritage': 1, 'Oasis date palms': 1, 'pits in the palm and sole': 1, 'Hemp-palm': 1, 'hemp-palm': 1, 'Palm of left': 1, 'CRPS': 1, 'reddening of palms and soles': 1, 'Eduard Sole Mir': 1, 'Majesty palm': 1, 'Loss of both legs': 1, 'paresia of both': 1, 'melanomas of the palms and soles': 2, 'Distal palm': 1, 'date palm weed': 1, 'palm defect': 2, 'Coconut palm-related injuries': 1, 'coconut palm-related injuries': 1, 'dysfunctions of both': 1, 'the skin of palms and soles': 1, 'date palm inflorescence blight': 1, 'Tetradactyly of both hands': 1, 'itching of the palms and soles': 1, 'to both': 3, 'defect of the palm': 1, 'hand palm': 1, 'Phoenix date palm': 1, 'Phoenix date palm injuries': 1, 'Tamil Palm': 1, 'Tamil Palm Leaves': 1, 'dorsum or palm lesions': 1, 'fracture of both legs': 1, 'deformities of the soles': 1, 'neurogenic deformities of the sole': 1, 'deformities of the sole': 1, 'dura palms': 1, 'Palm stipe': 1, 'palm-sole hyperlinearity': 1, 'EP palm': 1, 'EO palm': 1, 'palm oases': 1, 'palms and soles melanomas': 1, 'defects of both hands': 1, 'oil palm seedlessness': 1, 'Palm flexion': 1, 'Palm hyperextension': 1, 'deficiencies of both ECHS1': 1, 'hyperhidrosis of axillae, palms or soles': 1, 'keratosis of the palms and soles': 3, 'Keratoderma of the palms': 1, 'Oil Palm Pollinating Weevil': 1, 'creases of the palms': 1, 'both) disease': 1, 'anomalies of both the occipitocervical': 1, 'Palm Thorn Injury': 2, 'Felled palms': 1, 'crown palm': 1, 'Oil Palm Fronds': 2, 'palm rachis': 1, 'palm oil': 1, 'impairments of both movement and': 1, 'Dover sole': 1, 'of both legs': 3, 'palm erythematous': 1, 'oil palm estate': 1, 'pain in palms or foot soles': 1, 'injury to both the': 1, 'sydney palm of left hand': 1, 'PT': 1, 'of both functional': 1, 'or both legs or buttocks': 1, 'Acai palm': 1, 'tingling in both': 2, 'disturbance of sensation in the palm': 1, 'distal transverse deficiencies of both': 1, 'Deficiencies in both executive functions and emotional': 1, 'loss of both power and dexterity': 1, ', or both': 1, 'bulge on both groin': 1, 'oil palm boom': 1, 'Puncture of the sole': 1, 'flathead sole': 1, 'Date Palm Treea': 1, 'SI': 1, '-palm': 1, 'both the': 1, 'loss of foot-sole cutaneous sensation': 1, 'PRE-tr': 1, 'dysembryoplasiae': 1, 'Date Palm Fronds': 1, 'date palm fronds': 1, 'Keratoderma of palms': 1, 'keratoderma of palm and soles': 1, 'fractures of both femurs and both tibiae': 1, 'PP': 1, 'Palm-Palm': 1, 'Palm reversal': 1, 'dislocation of both subtalar': 1, 'palm/sole pits': 1, 'Dysfunction of both': 2, 'OP disease': 2, 'melanomas of the soles and palms': 1, 'Melanomas of the soles and palms': 1, 'Oil Palm Fruit': 1, 'thatch palm': 1, 'Thatch palm': 1, 'duplication of the palms': 1, 'melanocytic nevus of the palm/sole': 1, 'diseases of both the': 1, 'disability in both hands': 1, 'loss of both senses': 2, 'thickened palms and soles': 2, 'Palm thorn injuries': 1, 'short palm deformities': 1, 'warts on palms and soles': 1, 'hyperextension of the palms': 1, 'Palm ruff': 2, 'lesions in both': 1, 'hyperkeratotic lesions of the soles': 1, 'Palm Injury': 1, 'vesicular eczema of palms and soles': 2, 'deformities in both': 1, 'painful palms and soles': 2, 'date palm-Foa': 1, 'rash on palms and soles': 1, 'SOS': 1, 'Sweating on the palm and sole': 1, 'of the palms and soles': 2, 'date-palm oasis': 1, 'hyperkeratotic lesions of the palm and sole': 2, 'lesions in both hippocampi': 1, 'PAD': 1, 'erythematous lesions on palms and/or soles': 1, 'salty soles and': 1, 'absence solely of the anterior arch of the atlas': 1, 'white palm': 1, 'of palms or': 1, 'nail, sole and palm infection': 1, 'palm and sole infections': 1, 'Palm leaf disease': 1, 'Palm leaf diseases': 1, 'Palm disease': 1, 'palm leaf disease': 1, 'palm leaf diseases': 1, 'deficiency of both QI': 1, 'fingers-in-palm deformity': 1, 'duplication of the palm': 1, 'Palm lesions': 1, 'Palm fruit bunch': 1, 'twitching of both thighs': 1, 'damage to both the hippocampus and': 1, 'palm jaggery': 1, 'abnormal palms and soles': 1, 'eczematous lesions of the palms and/or soles': 1, 'POCC': 1, 'Med-PaLM': 1, 'Hands and Palms': 1, 'palm and sole hyperhidrosis': 1, 'CPOPC': 1, 'Slender sole': 1, 'sole and palm melanomas': 1, 'deformations of both the forefoot and rearfoot': 1, 'erythema of the soles of feet and palms of hands': 1, 'erythema of the palms or soles': 3, 'deformities of both the legs': 1, 'Itchy palms': 1, 'SB': 2, 'swelling of the fingers of both hands': 1, 'swelling of the palms or soles': 1, 'with both': 2, 'BIVD': 1, 'fibrotic disorder of the palm': 2, 'oil palm plantation disease': 1, 'Injury to both the skin': 1, 'date-palm sensitisation': 1, 'date-palm-': 1, 'redundant skin (neck, palms and soles': 1, 'SPS': 1, 'toxic erythema of palms and soles': 1, 'developmental delay of both': 1, 'overgrowth of both hands and': 1, 'palms and soles itchiness': 1, 'palms and hand itchiness': 1, 'itching to palms and soles': 1, 'SOLELY': 1, 'chronic dermatoses of the palms and soles': 1, 'swelling of the right sole': 1, 'or sole creases': 1, 'thickening of the palms and': 1, 'thickening of hand and facial skin': 1, 'Hyperlinear palms,': 1, 'obstruction of both choanae': 1, 'palm pseudochromhidrosis': 1, 'both type II)': 1, 'Cretan palm': 1, 'hypoplasia of both small fingers': 1, 'Deficiency of both vital': 1, 'ostia of both': 1, 'defaunated palm': 1, 'DPM': 1, 'Palm Addressed': 1, 'Vasculo-osseous dysembryoplasias': 1, 'Avulsion of sole up': 1, 'loss of both strength and': 1, 'PaLM 2': 1, 'Palm-vein': 1, 'swollen red palms and soles': 2, 'traumatism of the palm': 1, 'fracture of both femora': 1, 'Red palm': 1, 'Melanocytic lesions of the palm and sole': 1, 'Palm and': 1, 'punctate depression of the palm and sole': 1, 'both MoCA': 1, 'wasting of one or both hands': 1, 'ajwa fruit palm': 1, 'eczema of the palms and soles': 1, 'pits on the palm and sole': 1, 'Capillaritis of the palms': 1, 'dysesthesias of the palms and soles': 1, 'shaking of both': 1, 'deficiency of both the': 1, 'preaxial polydactyly of both hands': 1, '-NPV': 1, 'loss of skin of palm of the hand': 1, 'lesions of both menisci': 2, 'HPKO': 1, 'peeling of the palms and soles': 1, 'itching palms/soles': 1, 'Sole lesions': 3, 'impairment of both motor and': 1, 'PGF': 1, 'palm and pelma': 1, 'swollen red palms and': 1, 'palm dyshidrosis': 1, 'dyshidrosis of the palms': 1, 'Palm kernel meal': 1, 'FPKM': 1, 'macrodactylia of both big': 1, 'Bayoud disease of date palms': 1, 'CFR for sole syndrome': 1, 'brown sole': 1, 'impairment in both source and': 1, 'erythematous indurations of palm and soles': 2, 'Fractures of both femura': 1, 'sweaty palms and soles': 1, 'both legs': 1, 'erythromelalgia of the palms/soles': 1, 'Melanosarcoma of the palm': 1, 'Oil palm damage': 1, "Palm of One's Hands": 1, 'vasculo-ossal dysembryoplasia': 1, 'POP': 1, 'Print on palm': 1, 'injury to both lower': 1, 'keratosis of palm and sole': 1, 'both type 1 or 2': 1, 'aneurysmatic lesions in both': 1, 'oasis date palm': 1, 'date palm thorn injuries': 1, 'palm date thorn injury': 1, 'hypopigmentation of palms and soles': 1, '-PaLM': 1, 'melanoma of the soles or palms': 1, 'Palmate leaf of palm': 1, 'fracture of both the odontoid': 1, 'impaired abduction of both': 1, 'painful skin lesions of palms and soles': 1, 'Sweaty palm': 1, 'sweaty palm and planta': 1, 'Sweaty palm and planta': 1, 'palm, sole, and oral mucosal lesions': 1, 'Injuries to both': 1, 'hypercalcaemic type of both': 1, 'deficiency of both Sr and Mn': 1, 'Palm crease': 1, 'erythema of palms/soles': 2, 'tingling in both hands': 1, 'palm Oil': 1, 'Carpus of pereiopod II shorter than palm': 1, 'erythema to palms and soles': 1, 'cutaneous lesions in palms and soles': 1, 'Both trunci': 1, 'injury to both trunci': 1, 'Both disabilities': 1, "Lane's red palms": 1, 'Palm Pustules': 1, 'injury to palms': 1, 'in both veins and': 1, 'Palm oilTeh': 1, 'keratoderma of palms & soles': 1, 'palms and soles fever': 1, 'Fist palm': 1, 'Torchane palm': 1, 'HOPO': 1, 'malformations of one or both': 1, 'Sago palm toxicity': 1, 'Bushke-Fisher keratoderma of the palms and soles': 1, 'PALMS OF THE HAND': 1, 'Forage palm': 1, 'numbness in palm-foot sole': 1, 'Purpuric lesion on palms and soles': 1, 'paralyzed in both legs': 1, 'impairments of both hands, or legs': 1, 'impairment of both cerebral and': 1, 'Erythema of palms or soles': 1, 'hyperkeratoses of the palms and soles': 1, 'Fractures of both extremities': 1, "date palm's": 1, 'damage to both the': 1, 'rashes on palm, hand and soles of feet': 1, 'TIP': 1, 'bullae of palms and soles': 1, 'pseudoedema of both': 1, 'palm bract': 1, 'injury of both': 2, 'abnormalities of both hands and forearms': 1, 'Deficiency of both Fei': 1, 'Queen palm': 1, 'Botox palms': 1, 'Dysport palms': 1, 'yellow palms and soles': 2, 'infection on the palms or soles': 1, 'Both Hand Affected': 1, 'SV': 1, 'Sole-Vazquez': 1, 'TLA': 1, "Piarom' palm": 1, 'syndactaly of both hand': 1, 'of both qi': 1, 'thumb-in-palm malformation': 1, 'Palmyra palm': 2, 'regurgitation of both the': 1, 'congenital malformations of both the': 1, 'hyper-keratosis of palms and soles': 1, 'dysesthesia of the palms and soles': 1, 'peeling of palms and soles': 1, 'proximal palm injury': 1, 'desquamation to the palms and soles': 1, 'Stippled palmoplantar keratoderma of palms and soles': 1, 'Pruritus of palms and soles': 1, 'desquamation over palms and soles': 1, 'fibrocontractile disease of the palms': 1, 'Abnormalities in both classical': 1, 'Impaired abduction of both': 1, 'discoloration of eye, palm and sole': 1, 'Sole disorders': 1, 'maculopapular eruptions of palms and soles': 1, 'Feverish palms': 1, 'papular palm and sole rash': 1, 'palm and sole rashes': 1, 'inflammatory dermatosis of the palms and soles': 1, 'lesions of palms and soles': 1, 'swollen both legs': 1, 'ACO': 1, 'deformity in both': 1, 'sole redness': 1, 'Palm redness -': 1, 'palm redness -': 1, 'Med-PaLM 2': 1, 'Swellings in Both Hands': 1, 'tumors of the palms and soles': 1, 'disability of both eyeballs': 1, 'deformity of both pubes and ischia': 1, 'deformity of both pubes': 1, 'palm-sole rash': 1, 'sole-harm': 1, 'palm or sole melanoma': 1, 'OB': 1, 'virescens palms': 1, 'erosions of the palms and soles': 1, 'Cheliceral palm': 1, 'Sugar Palm Fiber': 1, 'burning of palms and soles': 2, 'lesion of palms or soles': 1, 'dysphoria in chest, palms and soles': 1, 'and sparing of soles': 1, 'woody palm': 1, 'Delayed recall of both': 1, 'Palm Coverage': 1, 'NPS': 1, 'Nipa palm syrup': 1, 'malformations of both eyebulbs': 1, 'deformities in both TMJs': 1, 'cespitose palms': 1, 'of palm': 1, 'nodular lesions of the palm and sole': 1, 'palm duplication': 1, 'dermatosis involving the palms and soles': 1, 'fresh palm': 1, 'Palm raceme': 1, 'to palms': 1, 'fracture of both diaphysis': 1, 'to palm distance': 1, 'to Palm Distance': 1, 'erythema of the palm and soles': 1, 'eruptions over the palms and the soles': 1, 'hyperkeratotic skin lesions of the palms and sole': 1, 'albedinis Foca Date palm n.a': 1, 'Bursa of the Palm of the Hand': 1, 'bursa of the palm of the': 1, 'Bursa of the Palm of the': 1, 'Kadary date palm': 1, 'both motor and intellectual': 1, 'palm involvenement': 1, 'palm ruff': 1, 'blistering of palms and soles': 1, 'sclerosis of the palms and soles': 1, 'Sclerosis of palms and soles': 1, 'keratosis of palms and soles': 2, 'Palm thorn': 1, 'deformities of the both': 1, 'Frost-viken, Palm (MHNG': 1, 'impaired movement of both': 1, 'BoMe': 1, 'EFFECTS ON OP': 1, 'skin lesions on palms and soles': 1, 'both intellectual functioning': 1, 'Venous malformation of the palm': 1, 'palm and sole pain': 1, 'sweaty palms and': 1, 'palm / sole redness dyssensitivity syndrome': 1, 'lengthening of both': 1, 'fruit palm': 1, 'fracture of both corpora cavernosa': 1, 'combined deficiency of both vitamins': 1, 'PKS': 1, 'PKL': 1, 'loss of both libido and': 1, 'potted palm': 1, 'palm kernel oil': 1, 'cutaneous loss of the heel or sole': 1, 'palms prickle': 1, 'Solely handicrafts': 1, 'sago palm': 1, 'deficiency of both corpora cavernosa': 1, 'disorder of both neurodevelopment': 1, 'oil palm pathogen': 1, 'HGG.Both': 1, 'painful redness of palms and soles': 1, 'IPT': 1, 'IPS': 1, 'palm oasis': 1, 'swollen palms or': 1, 'Oil Palm disease': 1, 'flexion of both hands': 1, 'PB': 1, 'palm redness': 1, 'Oil Palm Leaf': 1, 'losingHyperkeratosis of the palms and soles': 1, 'flexion anomaly of both hands': 1, '4VO.Both': 1, 'erythematous lesions on palm': 1, 'SET': 1, 'Palm of hands or': 1, 'pruritis in the palm and sole': 1, 'PKOB': 1, 'palm fruit': 1, 'and both': 1, 'impairments of both': 1, 'erythema of the soles of the feet and palms': 1, 'lesion on the sole': 1, 'Oil-Palm': 1, 'dyshidrotic lesions of palms and soles': 1, 'Hyperdominant Palm': 1, 'skin lesions on the palms and the soles': 1, 'Yellowish palms and soles': 1, 'PH': 1, 'RPM-damaged palm': 1, 'Palm sensation': 4, 'hyperlinearity of the palms and soles': 1, 'hyper linearity of the palms and soles': 1, 'damage of both': 1, 'or soles': 1, 'Palm Deformity': 1, 'AP.Both': 1, 'APPS': 1, 'Deglet Nour Date palm': 1, 'Keratoderma of the palms and': 1, 'BMEC': 1, 'DI': 1, 'Sensory impairment of sole': 1, 'date palm wilting disease': 1, 'pain at palms and soles': 1, 'wilt of palm': 1, 'desquamation of the soles and palms': 1, 'tingling of both hands': 2, 'PBC': 1, 'orange palms and': 1, 'phytelephantoid palms': 1, 'Epidermolysis of the soles': 1, 'fractures of both colla': 1, 'malformation of both forelimbs': 1, 'tingling in both legs': 1, 'tumors on the palms and soles': 1, 'BCC': 1, 'motor impairment of both lower extremities': 1, 'disturbance of both': 1, 'damp palm': 1, 'erythematous palms': 1, 'erythematous soles': 1, 'redundant skin of the palms and soles': 1, 'inflammatory skin disease of the palms and/or soles': 1, "Mariam's palm": 1, 'Palm drupes': 1, 'Sugar Palm': 1, 'dysmaturity of both': 1, 'Red Palm': 1, 'Palm (': 1, 'T1-Palm': 1, 'disease of palms': 1, 'palm/sole disease': 1, 'insensate sole': 1, 'congenital absence of both eyes and both auricles': 1, 'thickening palms and soles': 1, 'Red Palm Weevils': 1, 'red palm weevils': 1, 'dystrophy of both': 1, 'thickened skin of the palm or soles': 1, 'benign and malignant tumours of the palms and soles': 1, 'Swelling of the Palm of the Hand': 1, 'injury to the sole': 1, 'swelling of soles': 1, 'lymphoedema in both legs': 1, 'melanoma on palms, soles and nail bed': 1, 'palm lipomas': 1, 'tenera palm': 1, 'DSB.Both': 1, 'Push Palms': 1, 'palm oil clinker': 1, 'cycad palm': 1, 'Palm syrup': 1, 'Palm fruit bunch Cucumber': 1, 'Both Disorder': 1, 'spasm of both hands': 1, 'cracking of skin of palm and sole': 1, 'palm weaving': 1, 'Dysfunction in both': 1, 'abnormalities of both clotting': 1, 'SC': 1, 'icthyosiform hyperkerotosis of palms and sole': 1, 'primary hyperhidrosis of palms and soles': 1, 'nodular melanoma on palm or sole': 1, 'obstruction of both nostrils': 1, 'keloid of the palms and soles': 1, 'DISMISSED SOLELY': 1, 'deterioration in both': 1, 'oil palm thorn injury': 1, 'Extramarital Both': 1, 'cutaneous lesions of the palms': 1, 'Pruritic palm and sole swelling': 1, 'Pruritic palms and soles swelling': 1, 'Short palm': 1, 'Palm creases': 1}
|
oil palm
|
Disease
|
MESH:C535621
|
{'Wang': 26, 'Liang-Wang syndrome': 15, 'LIWAS': 4, 'Liang-Wang Syndrome': 3, 'Wang syndrome': 3, 'wang-ta': 2, 'fu Wang': 1, 'Wang-QTM': 1, 'WM': 1, 'Menghui Wang': 1, 'WJP': 1, 'Wang bis sp': 1, 'haiyan wang': 1, "ADOC Wang's syndrome": 1, 'TWOD': 1, 'Wang 2015': 1, 'Wang Qi': 1, '-Wang-Bu-': 1, 'WA': 1, 'liang wang cha': 1, "Wang's disease": 1, 'Tian-wang-bu-xin-dan': 1, 'Liang-wang syndrome': 1, 'Wang 2019b': 1, 'WBT': 2, "Wang's": 1, 'luweidihuang-wang': 1, '-Wang-Bu-Xin': 1, 'Fang-wang Fu': 1, 'TWBXD': 1, 'THC': 1, 'WB': 3, 'Fannia nudifemorata Wang & Zhang': 1, 'Wang Jiliang': 1, 'Wang-Colburn': 1, 'Wang Type II': 1, 'Qi hui nai wang': 1, 'Wang Bi': 1, 'wang-tta': 1, 'Wang-tta': 1, 'PH Wang': 1, "Wang's cluster Lo": 1, 'SW': 1, 'wang-dda': 1, 'Yao-wang-cha': 1, 'HLH Wang': 1, "Wang's Krait": 1, "Wang's Jiaji": 1, "Wang's jiaji": 1, 'WPA': 1}
|
Wang
|
Disease
|
MESH:C535622
|
{'Halal': 81, 'halal': 74, 'Halal SC': 1, 'halal haram': 1, 'and halal': 1, 'LEVEL OF HALAL FOOD': 1, 'HALAL FOOD': 1, 'halal-haram': 2, 'halal meat': 4, 'halal meat fraud': 1, 'HALAL': 2, 'HCP A2': 1, 'HAS': 1, 'HCP': 1, 'Halal-haram': 1, 'AD P': 2, 'Cleft palate Microcephaly': 1, 'halal-tayyib': 1, 'Halal Pork': 1, 'Halal-food cart': 1, 'HCBs': 1, 'Halal Specialty': 1, 'Halal tourism': 1, 'halal tourism': 1, 'Halal cuisine': 1, 'Halal Digital hypoplasias': 1, 'halal salami': 1, 'halal eating': 2, 'halal stunning': 1, 'Halal meat': 1, 'Mito-RNAse P and Z dysfunctions': 1, 'halal health': 1, 'and Halal': 1, 'Halal and Kosher': 1, 'Halal SME': 1, 'halal foods': 1, 'halal logo': 1, 'halal butchery': 1, 'halal agitation': 1, 'halal stamp': 1, 'Halal dietary taboo': 1, 'halal lamb': 1, 'halal beef': 2, 'halal and tayyib': 2, 'Halal-Haram': 1}
|
Halal
|
Disease
|
MESH:C535623
|
{'Riggs type': 1, 'Riggs': 8, "Riggs' Disease": 3, 'Riggs-type CSNB': 1, 'Riggs-': 3, 'Hall-Riggs syndrome': 2, "Riggs's Disease": 3, 'Rigg': 1, "Rigg's Disease": 4, "Riggs' disease": 2, "Rigg's disease": 1, 'Riggs disease': 2, 'Riggs Disease': 2, 'PRISM-WHM': 1, 'RIGGS': 1, 'McBain-Rigg': 1}
|
Riggs
|
Disease
|
MESH:C535627
|
{'hand-foot-genital syndrome': 90, 'HFU': 15, 'HFGS': 32, 'Hand-foot-genital syndrome': 35, 'HFG': 29, 'HFUS': 2, 'hand-foot-uterus syndrome': 13, 'Hand foot genital syndrome': 1, 'Hand-food-genital syndrome': 1, 'Hand-Foot-Genital-': 3, 'hand-foot-uterus': 4, 'hand-foot genital syndrome': 6, 'Hand-Foot-Genital syndrome': 8, 'Hand-Foot-Genital Syndrome': 6, 'HFG syndrome': 2, 'Hand-Foot-Uterus Syndrome': 1, 'HFGS syndrome': 1, 'HFG-like syndrome': 1, 'HFG syndromes': 1, 'Hand-Foot-Genital': 2, 'hand-food-uterus syndrome': 1, 'hand - foot - genital syndrome': 1, 'hand-foot-genital/Guttmacher syndrome': 1, 'Hand-foot-genital)': 1, 'hand foot genital syndrome': 1, 'Hand-foot-uterus syndrome': 4, 'hand-foot-genital and Guttmacher syndrome': 1, 'hand, genital and foot eczema': 1, 'hand-foot-genital (hand-foot-uterus) syndrome': 1, 'Hand-Foot-Genital (Hand-Foot-Uterus) syndrome': 1, 'Hand-Foot-Uterus': 1, 'Hand- foot-genital syndrome': 1, 'hand foot uterus syndrome': 1, 'hand-foot-genital (HFG) syndrome': 2, 'Hand-foot-genital" syndrome': 1, 'HFG-syndrome': 1, 'Hand-foot-uterus-(HFU) syndrome': 1, 'HFU-syndrome': 1, 'hand-foot-genital- (HFG) syndrome': 1, 'hand-foot-genital': 2, 'hamd-foot-uterus syndrome': 1, 'Hand-foot-genital (HFG) syndrome': 1, 'Hand-Foot-Uterus syndrome': 1, 'hand-foot-genital syndrome and preaxial deficiency': 1, 'hand-foot-uterus-syndrome': 1, 'Gorlin-Goltz and hand-foot-uterus syndrome': 1, 'Hand-Foot-Genital,': 1, 'autosomal dominant hand-foot-genital syndrome': 1, 'hand, foot, scalp, nail, or genital involvement': 1, 'hand and genital lesions': 1, 'hand-foot-genital-syndrome': 1, 'Hand-foot genital syndrome': 1}
|
hand-foot-genital syndrome
|
Disease
|
MESH:C535629
|
{'Hanhart syndrome': 27, 'Oromandibular-limb hypogenesis': 4, 'oromandibular-limb hypogenesis sequence': 1, 'oromandibular-limb hypogenesis syndrome type 1': 2, 'Oromandibular-limb hypogenesis syndrome': 3, 'oromandibular-limb hypogenesis syndrome': 6, 'OMLH-Mobius syndrome': 1, 'Oromandibular-Limb Hypogenesis': 1, 'Oromandibular-limb hypogenesis-Mobius syndrome': 1, 'OMLH': 2, 'OMLH-Mobius complex': 1, 'Oromandibular limb hypogenesis syndrome': 6, 'oromandibular limb hypogenesis syndrome': 14, "Hanhart's syndrome": 15, 'oromandibular limb hypogenesis syndromes': 10, 'OLHS': 12, 'oromandibular-limb hypogenesis syndromes': 4, 'oromandibular-limb hypogenesis': 10, 'Oromandibular Limb Hypogenesis Syndrome': 2, 'congenital limb hypogenesis ectrodactyly sequence': 1, 'Oromandibular Limb Hypogenesis Syndrome Type I B.': 1, 'Oromandibular Limb Hypogenesis Syndrome Type I B': 1, 'Hanhart syndrome B': 1, "Hanhart's dwarfs": 1, 'Hanhart anomaly': 1, 'oromandibular limb hypogenesis syndrome type 1': 2, 'oromandibular-limb hypogenesis syndrome, Type II A': 1, 'oromandibular-digital hypogenesis syndrome': 1, 'fetal oromandibular limb hypogenesis syndrome': 1, 'Fetal oromandibular limb hypogenesis syndrome': 1, 'Oromandibular and limb hypogenesis syndrome': 1, 'oromandibular and limb hypogenesis syndrome': 1, 'Hanhart syndrome B': 1, 'Oromandibular-limb hypogenesis syndromes': 3, 'oromandibular-limb hypogenesis syndrome Type II C.': 1, 'Oromandibular-limb Hypogenesis Syndrome Type II C': 1, 'Hanhart': 5, 'Oromandibular limb hypogenesis syndrome, type IIA': 1, 'oromandibular limb hypogenesis syndrome, type IIA': 1, "Hanhart's syndrome II": 1, 'OLHS type IIB': 1, 'Oromandibular Limb Hypogenesis Syndrome Type IIB': 1, 'oromandibular limb hypogenesis syndrome type IIB': 1, 'OLHS type IIC': 1, 'oromandibular limb hypogenesis syndrome type I B': 1, 'OLHS type I B.': 1, 'OLHS) type I B.': 1, 'oromandibular limb hypogenesis syndrome type I B.': 1, 'Oromandibular Limb Hypogenesis Syndromes': 2, 'oromandibular hypogenesis syndrome': 2, 'limb hypogenesis': 2, 'Hanhart-syndrome': 1, 'oromandibular limb hypogenesis': 4, 'Oromandibular and limb hypogenesis syndromes': 1, 'oromandibular and limb hypogenesis syndromes': 1, 'oromandibular-limb-hypogenesis syndrome': 1, 'oromandibular-limb hypogenesis type 1': 1, 'oromandibular-limb hypogenesis (Hanhart) syndrome': 1, 'Facial-limb hypogenesis syndromes': 1, 'Hanhart syndrome II': 1, 'oromandibular-limb hypogenesis syndrome type I': 1, 'Oromandibular-Limb Hypogenesis Syndrome': 1, 'limb hypogenesis syndrome type 1': 1, 'Oromandibular limb hypogenesis complex': 1, 'HANHART': 1, 'Oromandibular limb hypogenesis syndromes': 1, 'oromandibular limb hypogenesis syndrome type I A': 1, 'Oromandibular Limb Hypogenesis Syndrome Type I A': 1, 'Oromandibular limb hypogenesis': 2, '(Chicarilli)/ V (Hall) OLHS malformation': 1, 'Richer-Hanhart Syndrome': 1, 'Hanhart Syndrome': 2, 'oromandibular limb hypogenesis syndrome type III': 1, 'OMLHS) 16, 17': 1, 'oromandibular limb hypogenesis syndrome (OMLHS) 4': 1, 'OMLHS': 1, 'oromandibular limb hypogenesis syndrome (': 1, 'Hanhart syndrome 19': 1, 'OMLHS 18': 1, 'oromandibular hypogenesis': 1, 'oromandibulofacial limb hypogenesis (OMFL) syndrome': 1, 'OMLHC': 1, 'oro-mandibular-limb hypogenesis complex': 1, 'oromandibular/limb hypogenesis': 1, 'oromandibular limb hypogenesis syndrome type I': 1, 'COMD': 1, 'oromandibulofacial limb hypogenesis syndrome': 1}
|
Hanhart syndrome
|
Disease
|
MESH:C535630
|
{'Hantavirus illnesses': 1, 'hantavirus-associated illnesses': 1, 'hantavirus hemorrhagic fever': 6, 'Hantavirus hemorrhagic fever': 5, 'Q fever Hantavirus pulmonary syndrome': 1, 'Hantavirosis': 7, 'hantavirus fever': 8, 'Hantavirus-related illness': 1, 'hantavirosis': 18, 'Hantavirus fever': 4, 'HTVF infection': 1, 'New York hantavirus': 3, 'Hantavirus illness': 1, 'hantavirus-associated illness': 2, 'HFRS': 2, 'Hantavirus Fever with Renal Syndrome': 1, 'Hantavirus Fever': 1, 'Hantavirus-associated virus hemorrhagic fever': 1, 'HF': 3, 'HV Fever': 1, 'hantavirus illness': 2, 'Hantavirus fever renal syndrome': 2, 'Hantavirus-associated illness': 1, 'hantavirus illnesses': 2, 'HTV-illness': 1, 'hantavirus fever with renal syndrome': 1, 'hantavirus fever with pulmonary and cardiovascular syndrome': 1}
|
hantavirosis
|
Disease
|
MESH:C535632
|
{'Hardikar syndrome': 19, 'Hardikar Syndrome': 2, 'HS': 4, 'Hardikar': 1}
|
Hardikar syndrome
|
Disease
|
MESH:C535634
|
{'contralateral': 344, 'contralateral carcinoma': 28, 'contralateral sensory loss': 5, 'bilateral harlequin syndrome': 1, 'Bilateral harlequin syndrome': 1, 'hypoplasia of contralateral thumb': 1, 'contralateral carcinomas': 21, 'contralateral extremity movement': 2, 'contralateral disease': 172, 'contralateral hypotropia': 1, 'contralateral injury': 100, 'Harlequin syndrome': 246, 'Harlequin': 68, 'Harlequin Syndrome': 46, 'CL': 83, 'Contralateral lesion': 8, 'harlequin syndrome': 65, 'contralateral anhidrosis': 5, 'NIC': 1, 'contralateral dislocation of the right testicle': 1, 'contralateral occipitalgia': 1, 'the contralateral cortex': 1, 'contralateral fracture': 21, 'Contralateral lesions': 15, 'contralateral lesions': 16, 'contralateral injuries': 33, 'of the contralateral': 1, 'contralateral ischaemia': 1, 'contralateral hemianesthesia': 2, 'HB': 3, 'CS': 5, 'contralateral suppression': 5, 'HS': 10, 'North South or Harlequin syndrome': 1, 'CR': 3, 'CH': 4, 'CC': 4, 'Contralateral': 45, 'harlequin': 74, 'Harlequin icthyosis': 6, 'contralateral impairment of motor function': 1, 'Contralateral abnormalities': 13, 'Contralateral abnormality': 3, 'contralateral cortical dysfunction': 1, 'contralateral associated movements': 2, 'CAMs': 5, 'Contralateral Carcinomas': 1, 'Contralateral injuries': 4, 'contralateral hypometabolism': 4, 'harlequin eye deformity': 1, 'harlequin eye" deformity': 2, 'Contralateral eye 18': 1, 'contralateral patent processus vaginalis': 30, 'CPPV': 51, 'contralateral processes vaginalis': 1, 'contralateral abnormalities': 38, 'CT': 3, 'Contralateral disease': 25, 'Harlequin armor': 1, 'contralateral obstruction': 3, 'Contralateral thermosensory deficiencies': 1, 'contralateral malformation': 1, 'CoS': 1, 'CoS.': 1, 'CLS OAE': 1, 'contralateral delay': 20, 'contralateral deficiency of muscular strength': 1, 'Contralateral deficiency': 1, 'contralateral deficiency': 2, 'Contralateral muscular deficiency': 1, 'contralateral strength deficiency': 1, 'contralateral hemiplesia': 1, 'N2pc': 16, 'decrease of contralateral': 1, 'Contralateral hemimicrencephaly': 2, 'contralateral dermatochalasia': 1, 'harlequin icthyosis': 4, 'contralateral lesion': 10, 'CONTRALATERAL': 22, 'Harlequin orbit': 2, 'Harlequin and Horner syndrome': 1, 'Harlequin and Horner syndromes': 3, 'harlequin and Horner syndrome': 1, 'Contralateral injury': 5, 'PCP': 2, 'CONTRALATERAL ELICITOR EFFECTS ON': 1, 'CONTRALATERAL SUPPRESSION': 1, 'CONTRALATERAL LIMB': 1, 'harlequin colour': 1, 'Contralateral defects': 9, 'contralateral epilepsy': 5, 'Contralateral acromioclavicular injury': 1, 'Harlequin phenomenon': 7, 'contralateral dislocation of the': 1, 'Idiopathic harlequin syndrome': 2, 'Harlequin sign': 3, 'contralateral nerve': 1, 'Contralateral carcinoma': 5, 'contralateral sclerosis': 3, 'CDA': 50, 'of contralateral': 1, 'contralateral cerebral abnormality': 1, 'contralateral fractures': 14, 'Contralateral fracture': 2, 'Contralateral lower extremity': 1, 'contralateral dislocation': 15, 'Contralateral epiphyseodesis': 2, 'contralateral reduction': 2, 'Harlequin color': 1, 'in contralateral': 2, "Harlequin's syndrome": 7, 'contralateral hemisyndrome': 1, 'harlequin ichthyosis5': 1, 'contralateral BC': 3, 'lesion in the contralateral': 1, 'hq': 1, 'contralateral impairment': 7, 'contralateral duct anomalies': 1, 'EITHER CONTRALATERAL': 1, 'harlequin deformity': 7, 'contralateral Harlequin syndrome': 1, 'or contralateral injuries': 1, 'Injury to the contralateral cerebral peduncle': 1, 'impairment of contralateral motor function': 1, 'contralateral monorchism': 1, 'contralateral epiphysiodesis': 2, 'contralateral hypoplasia': 9, 'CLP': 3, 'contralateral loss': 4, 'contralateral arterial abnormality': 1, 'homo- or contralateral arterial disorders': 1, 'contralateral hearing disturbance': 1, 'Contralateral hearing disturbance': 2, 'Contralateral processus vaginalis': 2, 'Contralateral hemineglect': 1, 'CSA': 2, 'harlequin sign': 2, 'Harlequin Sign': 2, 'contralateral hand movements': 1, 'contralateral extremity disease': 1, 'Contralateral fractures': 6, 'Fractured Contralateral': 1, 'Contralateral Limb': 1, 'hypoplasia of the contralateral vein': 1, 'contralateral lobe abnormalities': 2, 'contralateral tissue loss': 1, 'contralateral hemihypesthesia': 4, 'Contralateral lobe': 1, 'Contralateral Hypotropia': 1, 'contralateral rotationIV': 1, 'contralateral turning': 18, 'Contralateral to Fracture': 1, 'pedicle and contralateral fractures': 1, 'Contralateral nerve symptoms': 1, 'contralateral nerve symptoms': 1, 'Contralateral Carcinoma': 1, 'Contralateral Leg': 1, 'Hq satellite cell deficiency': 1, 'Harlequin color change': 6, 'harlequin color change': 2, 'contralateral epiphysiodesis of': 1, 'contralateral hemibody': 3, 'HARLEQUIN FOETUS': 1, 'Contralateral rhinorrhea': 1, 'CLH': 3, 'contralateral hemidystonia': 8, 'contralateral dyschromatopsia': 1, 'contralateral frontal dysplasia': 1, 'Hq': 7, 'PCPV': 1, 'Patent contralateral processus vaginalis': 1, 'contralateral leg problems': 1, 'contralateral limb obstruction': 1, ', contralateral, or': 1, 'and contralateral lesions': 1, 'contralateral hand disability': 1, 'Harlequin or': 1, 'contralateral disorder of algesthesia': 1, 'Idiopathic Harlequin Syndrome': 2, 'idiopathic Harlequin syndrome': 2, 'Idiopathic Harlequin syndrome': 1, 'Injury of the contralateral extremity': 1, 'Contralateral joint involvement': 1, 'contralateral nerve alterations': 1, 'or contralateral injury': 1, 'contralateral eyes': 1, 'Contralateral eyes': 2, 'cLC': 1, 'Contralateral hand tremorb': 1, 'contralateral limb dysfunction': 8, 'contralateral hemiparesthesiae': 1, 'contralateral limb abnormalities': 1, 'contralateral hemidefects': 1, 'contralateral hypoacusia': 1, 'contralateral abnormality': 11, 'contralateral exophthalmus': 1, 'CPV': 2, 'contralateral processus vaginalis': 4, 'Harlequin deformity': 4, 'Harlequin eye': 2, 'harlequin abnormalities': 1, 'lateral or contralateral': 1, 'contralateral movement': 3, 'Contralateral chylothoraces': 1, 'Harlequin)': 1, 'contralateral limb symptoms': 1, 'contralateral limb ballism': 2, 'contralateral limb shaking': 1, 'CL-N3': 1, 'SURVEILLANCE OF CONTRALATERAL': 1, 'and contralateral': 5, 'Hidden Harlequin syndrome': 1, 'Harlequin syndrome discoloration': 1, 'cPPV': 7, 'harlequin foetus': 6, 'CLAT': 1, 'Contralateral Injury': 6, 'contralateral regional': 2, 'and Harlequin': 1, 'or contralateral': 5, 'contralateral flexion': 1, 'contralateral frontal bossing': 1, 'harlequin orbital deformity': 1, 'contralateral transverse megacrest': 1, 'contralateral) injury': 1, '(contralateral) injury': 1, 'Contralateral Disease': 5, 'contralateral forelimb impairments': 1, 'AND CONTRALATERAL': 1, 'contralateral defect': 2, 'contralateral gaze impairment': 1, '(Harlequin) syndrome': 2, 'Harlequin (north/south) syndrome': 1, 'North-South (Harlequin) Syndrome': 2, 'Harlequin nail': 3, 'harlequin nail': 2, 'contralateral hemiparesia': 4, 'contralateral dysplasia': 5, 'contralateral neuropathy': 5, 'hemiparesia contralateral tardia': 1, 'contralateral rhinorrhea': 1, 'contralateral aponeurosis': 1, 'contralateral hemidysesthesia': 2, 'contralateral haematoma': 1, 'Contralateral cranial fracture': 1, 'Contralateral haematoma': 1, 'contralateral or': 1, 'CHL': 2, 'Contralateral hernial defects': 1, 'microphthalmic or contralateral eye': 1, 'deficitul motor contralateral leziunii': 1, 'hemicorpului contralateral': 1, 'upshoot of the contralateral eye': 1, 'contralateral malformations': 3, 'Contralateral leg ischaemia': 1, 'Contralateral stenosisa': 1, 'Contralateral suppression': 1, 'contralateral extremity': 1, 'contralateral facial enlargement': 1, 'Contralateral patent processus vaginalis': 6, 'contralateral hemianaesthesia': 2, 'Lymphatic distension Harlequin': 1, 'Contralateral eye': 5, 'harlequin frog': 2, 'contralateral bias': 1, 'Harlequin, or North-South, syndrome': 1, 'Contralateral epiphysiodesis': 4, 'harlequin and Horner syndromes': 1, 'contralateral hypoplasia of labia minora': 1, 'CNL': 1, 'CHT': 1, 'contralateral multifidus': 1, 'Con': 1, 'CON': 2, 'Harlequin foetus': 11, 'contralateral damage': 7, 'CONTRALATERAL LOWER': 1, 'salpingooforectomia contralateral': 1, 'contralateral extremity injury': 2, 'contralateral lateropulsion': 1, 'contralateral adrenal abnormalities': 2, 'CL lesioned': 1, 'carcinoma in the contralateral lobe': 2, 'contralateral epiphyseodisis': 1, 'contralateral anomalies': 10, 'Harlequin face': 2, 'contralateral lobe carcinoma': 1, 'Rerupture Contralateral Injury': 1, 'contralateral eyes emmetropia': 1, 'contralateral limb fractures': 2, 'Contralateral carcinomas': 4, 'harlequin merle': 2, 'contralateral striatopathy': 1, 'contralateral limb fracture': 1, 'congenital harlequin syndrome': 3, 'ispilateral and contralateral diseases': 1, 'contralateral astereognosis': 1, 'contralateral sensitization': 2, 'CN': 2, 'contralateral PcoA hypoplasia': 1, 'contralateral hemiparkinsonism': 4, 'harlequin-like syndrome': 1, 'contralateral hemichorea syndrome': 1, 'Contralateral reaction': 1, 'Contralateral delay activity': 1, 'contralateral delay activity': 5, 'contralateral orchiopathy': 1, 'Contralateral delay': 7, 'contralateral mamma carcinoma': 1, 'contralateral epiphyseodesis': 2, 'Harlequinism': 2, 'CAT': 2, 'contralateral pulmonary anomalies': 1, 'MCR': 1, 'contralateral pseudoretraction': 2, 'contralateral footedness': 1, 'CHA': 1, 'the contralateral': 2, 'contralateral hemithorax': 1, 'Contralateral anomalies': 1, 'Contralateral fastigial atonia': 1, 'contralateral mesonephric duct anomaly': 1, 'contralateral hernial': 1, 'Contralateral hyperinflation': 2, 'contralateral hyperinflation': 2, 'Contralateral orchialgia': 1, 'Harlequin complex I-': 1, 'contralateral syndrome': 2, 'harlequin face': 1, 'CONTRALATERAL EXTREMITY': 1, 'Contralateral nodal disease': 1, 'Harlequin"': 1, 'HARLEQUIN-FLY': 1, 'CAM': 2, 'contralateral chorioretinitis': 2, 'Contralateral chorioretinitis': 2, 'cont': 1, 'contralateral hemihyperhidrosis': 2, 'Contralateral obstructions': 1, 'contralateral obstructions': 1, 'CLT': 1, 'CO': 1, 'contralateral motor disease': 1, "Harlequin's": 1, 'loss of a contralateral extremity': 1, 'contralateral eye': 2, 'contralateral artery': 1, 'Congenital harlequin syndrome': 1, 'unilateral sudden hearingloss': 1, 'impaired contralateral': 1, 'Contralateral eyeball involvement': 1, 'contralateral dysfunction': 2, 'patent contralateral processus vaginalis': 8, 'contralateral orchialgia': 1, 'HCC': 6, 'harlequin phenomenon': 2, 'Harlequin-like syndrome': 1, 'injury to the contralateral extremity': 1, 'contralateral procession': 1, 'CBCs': 1, 'contralateral thermosensory deficiencies': 1, 'CA': 1, 'deficiency of contralateral motor cortex': 1, 'CE': 1, 'HARLEQUIN BEETLE-RIDING PSEUDOSCORPION POPULATIONS': 1, 'Idiopathic HS': 1, 'Congenital HS': 1, 'idiopathic HS': 1, 'contralateral motor impairments': 2, 'horner and harlequin syndromes': 1, 'CG': 1, 'fracture of the contralateral facet': 2, 'Contralateral Defect': 1, 'contralateral motor impairment': 8, 'contralateral automatisms': 1, 'Contralateral attacks': 1, 'contralateral reduction of N1': 1, 'Contralateral hemidystonia': 1, 'Dislocation in contralateral': 1, 'CD': 1, 'Harlequin syndromes': 1, 'ROLE OF CONTRALATERAL': 1, 'contralateral nodal disease': 2, 'contralateral nerve loss': 1, 'contralateral hemichorea': 3, 'cNAWM': 1, 'contralateral microemboli': 2, 'Contralateral microemboli': 1, 'contralateral hemiagenesis': 1, 'contralateral reamputation': 1, 'Harlequine phenomenon': 1, 'contralateral joint problems': 1, 'contralateral rotatory movements': 1, 'contralateral facial deficit': 1, 'contralateral hump': 3, 'Contralateral extremity Loss': 1, 'contralateral glossoplegia': 2, 'contralateral deformity': 3, 'contralateral hemihypalgesia': 1, 'contralateral facial hemihypalgesia': 1, 'contralateral hemibody hemihypalgesia': 1, 'Harlequin sign and': 1, 'contralateral nephrectomy injury': 1, 'idiopathic harlequin syndrome': 2, 'Contralateral damage': 1, 'contralateral dislocations': 3, 'contralateral branch': 1, 'ischaemic contralateral lesions': 1, 'contralateral hemineglect syndrome': 1, 'loss of contralateral hand function': 1, 'contralateral motor and sensory dysfunction': 1, 'contralateral frontal damage': 1, 'Contralateral limb faults': 1, 'CBC': 1, 'Harlequin testicle': 1, 'Contralateral Nodal Disease': 1, 'Contralaterality': 2, 'congenital contralateral hyronephrosis': 1, 'Harlequin (North-South) syndrome': 1, 'mastectomia profilactica contralateral': 1, 'MPC': 1, 'mama contralateral descartaron lesiones sospechosas': 1, 'MPC sola': 1, 'HARLEQUIN': 3, 'Contralateral Patent Processus Vaginalis': 1, 'Contralateral pedicular fracture': 1, 'contralateral pedicular fracture': 1, 'Sweating of Contralateral Face': 1, 'contralateral axilla': 1, 'Contralateral malformations': 1, 'contralateral hypometria': 2, 'or contralateral fractures': 1, 'cCPP': 1, 'CLS': 1, 'fracture of the contralateral ZMC': 1, 'Contralateral occlusio': 1, 'patent contralateral artery': 2, 'contralateral disorders': 1, 'contralateral defect in': 1, 'CLF': 1, 'contralateral limb impairment': 3, 'unilateral type II and contralateral type III defects': 1, 'MIS contralateral': 1, 'lesions to the contralateral extremity': 1, 'contralateral limb involvement': 1, 'contralateral hypoperfusion': 2, 'impaired contralateral kinesthesia': 1, 'contralateral benign nephromegaly': 1, 'Contralateral hemithorax': 1, 'contralateral IOOA': 1, ', harlequin': 1, 'contralateral limb': 2, 'obstruction of the contralateral mainstem bronchus': 1, 'Harlequin, or': 1, 'CCM': 2, 'CI': 2, 'harlequin eyes': 1, 'contralateral sustained handgrip': 1, 'contralateral thumb duplication': 1, 'contralateral thumb hypoplasia': 1, 'impaired contralateral motor function': 1, 'contralateral hypernefroid carcinoma': 1, 'contralateral nerve involvement': 1, 'synkinetic contralateral movements': 1, 'CLN': 1, 'CLTR': 1, 'Postoperative Harlequin Syndrome': 1, 'Contralateral glossoplegia': 1, 'contralateral subcondylar fracture': 1, 'THE CONTRALATERAL': 1, 'harlequin disease': 1, 'harlequin dappling': 1, 'cFDS': 1, 'ischaemia in the contralateral cortex': 1, 'harlequin eye': 4, "Harlequin' syndrome": 1, 'Contralateral leg agility': 1, 'contralateral cortex impairment': 1, 'Harlequin syndrome 9': 1, 'contralateral lower extremity involvement': 1, 'contralateral facial or limb contractions': 1, 'CL suppression': 1, 'contralateral hemineglect': 1, 'contralateral gland suppression': 1, 'contralateral turning behaviour': 2, 'contralateral defects': 3, 'patent contralateral': 1, 'contralateral motor syndrome': 1, 'contralateral motor pathway injury': 1, 'contralaterality': 1, 'anomaly of the contralateral': 1, 'contralateral neurapraxia': 1, 'contralateral patent processus': 1, 'CPP': 2, 'contralateral motor/sensory loss': 1, 'cHL': 1, 'contralateral nystagmuses': 1, 'contralateral impairment of facial muscle movements': 1, 'Contralateral lateropulsion': 1, 'Contralateral epilepsy': 1, 'contralateral ischaemic handgripping': 1, 'contralateral collateral ligament': 1, 'Contralateral Delay': 1, 'Harlequin colour change': 2, 'Harlequin Colour Change': 1, 'Contralateral sensibility disorders': 1, 'contralateral alveolar syndrome': 1, 'contralateral upper quadrantoanopsia': 1, 'harlequin (North/South) syndrome': 1, 'harlequin poison frogs': 1, 'Harlequin and Horner Syndromes': 1, 'Horner and Harlequin syndromes': 1, 'Contralateral joint replacement': 1, 'contralateral sensation loss': 1, 'contralateral extremity fractures': 1, 'contralateral hemiparalysis': 1, 'Contralateral Epilepsy': 1, 'CL-RBE': 2, 'loss of contralateral menace': 1, 'injury of the contralateral lower extremity': 1, 'Harlequin Icthyosis': 1, 'contralateral forelimb impairment': 1, 'Contralateral pulmonary involvement': 1, 'contralateral transverse': 1, 'CoEye': 1, 'CDH': 1, 'contralateral serious extremity injury': 1, 'Harlequin Color Change': 1, 'contralateral hemimicrencephaly': 1, 'Contralateral hemihypesthesia': 1, 'CND': 1, 'Contralateral Associated Movements': 1, 'Contralateral associated movements': 1, 'contralateral suppression of OAEs': 1, 'CSOAEs': 1, 'injury to the contralateral acetabulum': 1, 'contralateral loss of cold sensation': 1, 'CDA abnormalities': 1, 'contralateral regional disease': 1, 'lesion contralateral': 1, 'cGM': 1, 'and contralateral arteries': 1, 'lost contralateral hearing': 1, 'harlequin deformity of': 1, 'hypoplasia of the contralateral jugular vein': 1, 'loss of contralateral motor function': 1, 'AIF + CONTRALATERAL PATCH': 1, 'contralateral agenesis': 1, 'contralateral motor cortex dysplasia': 1, 'harlequin bugs': 1, 'contralateral alpha suppression': 1, 'CONTRALATERAL ALTERATION': 1, 'Contralateral Reaches': 1, 'Contralateral stifle': 1, 'contralateral stifles': 1, 'contralateral stifle': 1, 'Contralateral stifles': 1, 'NCI': 1, 'Contralateral Injurya': 1, 'CSD': 1, 'I-C': 1, 'N-cont': 1, 'contralateral limb injury or abnormality': 1, 'contralateral complete': 1, 'cHC': 1, 'Contralateral Hearing Aid': 1, 'HARLEQUIN MINIATURE POODLES': 1, 'hypertrophic contralateral facet': 1, 'Idiopathic Contralateral eye': 1, 'contralateral malformation of the mesencephalon': 1, 'anomaly contralateral to symptoms': 1, 'Harlequin-Ichtyose Hyperkeratose': 1, "'Harlequin' syndrome": 1, ', Contralateral Disease': 1, 'contralateral upper and lower': 1, 'Contralateral metastasesmetastases': 1, 'contralateral leg blockade': 1, 'Hq disease': 1, 'contralateral hand anomalies': 1, 'coLF': 1, 'CAS': 1, 'contralateral sensory abnormalities': 1, 'cPM': 1, 'CES': 1, 'contralateral venous hypoplasia': 1, 'hypoplasia of contralateral venous': 1, 'contralateral hyperhydrosis': 1, 'CLL-': 1, 'Contralateral ureteropyeloanastomosis': 1, 'spasticity of contralateral limb': 1, 'Iatrogenic Harlequin Syndrome': 1, 'contralateral hemithyroid': 1, 'contralateral ballism': 1, 'contralateral loss of the': 1, 'hypoplastic contralateral artery': 1, 'contralateral limb sensory loss': 1, 'contralateral synkinetic movements': 1, 'C/L': 1, 'Harlequin Ladybird': 2, 'harlequin ladybird': 1, 'harlequin ladybirds': 1, 'contralateral duplicated thumb': 1, 'impaired facial and contralateral limb/body sensation': 1, 'Harlequin effect': 1, 'contralateral delayed activity': 1, 'Contralateral hypoacousia': 1, 'Contralateral retinoma': 1, 'contralateral sensory symptoms': 1, 'Contralateral motor impairement': 1, 'somatomotor lesion on contralateral movement': 1, 'Contralateral monoarthritis': 1, 'Overshoot of the contralateral': 1, 'CPM': 1, 'contralateral bruit': 1, 'contralateral duplication': 1, 'Congenital Harlequin syndrome': 1, 'contralateral involvement': 1, 'contralateral hypoalgesia': 1, 'SYNDROME OF CONTRALATERAL': 1, 'contralateral adrenal abnormality': 1, 'Contralateral adrenal abnormalities': 1, 'Painted contralateral eye': 1, 'harlequin orbit': 1, 'CONTRALATERAL PROPHYLACTIC SYMPATHECTOMY': 1}
|
contralateral
|
Disease
|
MESH:C535635
|
{'keel fractures': 41, 'craniofacial, and digital anomalies': 1, 'keel deformities': 4, 'deformities of keel': 1, 'Keel-': 1, 'keel trauma': 1, 'facial, cardiac, digital, and genital anomalies': 1, 'BD': 1, 'calcification of the keel': 1, 'Keel Fractures': 1, 'KL': 3, 'keel radiolucencies': 1, 'craniofacial and digital fractures': 2, 'craniofacial or digit defects': 1, 'Keeling syndrome': 1, 'vocal keel': 1, 'craniofacial, digital, and genital anomalies': 1, 'auditory, ocular, craniofacial, otolaryngological, limb and digital anomalies': 1, 'ocular, craniofacial, cardiac, and digital developmental defects': 1, 'craniofacial and digit dysmorphologies': 1, 'Domane': 4, 'Keel': 17, 'keel damage': 15, 'spinal, craniofacial, cardiac or renal anomalies': 1, 'keel fracture': 21, 'Keel condition': 1, 'keel condition': 1, 'keel deformity': 1, 'craniofacial, hand, and digital anomalies': 1, 'craniofacial and digital defects': 6, 'craniofacial and digital anomalies': 9, 'facial, digital and genital anomalies': 3, 'keel scours': 1, 'digital and genital anomalies': 2, 'keel lesions': 2, 'keel': 28, 'craniofacial and digit anomalies': 2, 'digital and genital (shawl scrotum) anomalies': 1, 'facial, digital, and genital anomalies': 3, 'craniofacial and digital dysmorphism': 1, 'ocular, craniofacial, and digital anomalies': 1, 'limb, digit, and craniofacial/eye malformations': 1, 'craniofacial, digital, skeletal, and cardiac anomalies': 2, 'Keel crookedness': 1, 'Keel damage': 4, 'Keeling': 5, 'craniofacial and digital malformations': 4, 'Keel fracture': 8, 'NK': 3, 'keel damages': 1, 'FK': 4, 'Keel Fracture': 2, 'Silastic Keel': 1, 'keel deformations': 2, 'Keel deformations': 1, 'Keel petal': 1, 'Keel fractures': 5, 'RBD': 3, 'digit and genital anomalies': 1, 'keel abnormalities': 3, 'craniofacial, toe, and digit fractures': 1, 'Alary keel': 1, 'alary keel': 1, 'keel-damage': 1, 'keel injury': 2, 'keel malformations': 1, 'keel blubber': 1, 'craniofacial, limb, and digit dysmorphisms': 1, 'craniofacial and digital dysmorphisms': 2, 'KFs': 1, 'KF': 1, 'Domane 2': 1, 'cardiac, digit, and craniofacial anomalies': 2, 'digit, craniofacial, and CNS anomalies': 2, 'craniofacial, limb, and digit anomalies': 1, 'keel and furculum damage': 1, 'craniofacial-digital syndromes': 1, 'craniofacial, skeletal, digital, and cardiac anomalies': 1, 'craniofacial and digital changes': 1, 'keel deformation': 1, 'keel fractures and': 1, "Keel's": 1, 'without keel': 1, 'genital and digital defects': 1, 'Footpad and Keel Injuries': 1, 'anomalies of digital, craniofacial, skeletal and extremities,': 1, 'craniofacial, eye, and digital anomalies': 1, 'craniofacial, ocular, dental, and digital anomalies': 2, 'keel injuries': 1, 'KN': 1, 'digital and genital deformities': 1, 'Keel muscle': 1, 'cratonic keel': 1, 'Cratonic keel': 1, 'digital and genital': 1, 'fractured keel': 2, 'craniofacial, digital dysmorphic features': 1, 'keel calcification': 1, 'digit and craniofacial defects': 1, 'and keel lesions': 1, 'keels': 1, 'Keels': 1, 'craniofacial and digit dysmorphism': 1, 'Keel Damage': 1, 'keeling disease': 2, 'Keel and Maritime': 1, 'craniofacial, developmental, digital, skeletal, and cardiac involvement': 1, 'Keeling and Myers': 1, 'droog-my-keel': 1, 'cardiovascular, craniofacial, digital and skeletal anomalies': 1, 'Chalk-Harrod': 1, 'Doman-Delecato': 1, 'Abnormality of the keel': 1, 'keel type C-ADR': 1, 'craniofacial, digital, genital or limb defects': 1, 'genital, cardiac, and craniofacial developmental anomalies': 1}
|
keel fractures
|
Disease
|
MESH:C535636
|
{'infraction': 67, 'myocardial infraction': 2350, 'Myocardial Infraction': 70, 'Myocardial infraction': 186, 'acute myocardial infraction': 272, "Freiberg's disease": 78, 'cerebral infraction': 231, 'AMI': 80, 'Acute Myocardial infraction': 2, 'MI': 188, 'acute MI': 15, 'infractions': 3, "Kohler's disease": 54, 'brain infraction': 28, 'Acute myocardial infraction': 28, 'cardiac infraction': 30, 'Second metatarsal osteomyelitis': 2, 'Stress fractures of the second metatarsal': 4, 'MI myocardial infraction': 11, 'ischemic cerebral infract': 2, 'myocardial Infraction': 4, 'second, third, and fourth metatarsal neck fractures': 1, 'Cerebral infraction': 41, 'Freiberg disease': 51, 'osteochondrosis of the second metatarsal head': 3, 'Freiberg Disease': 9, 'myocardial infractions': 93, 'Kohler disease': 19, 'Kohler Disease': 1, 'thrombolysis in myocardial infraction': 8, 'myocardial infract': 50, 'Osteochondral second metatarsal head fractures': 1, 'second metatarsal head fracture': 4, 'osteochondral fracture of the second metatarsal head': 1, 'Thrombolysis in Myocardial Infraction': 8, 'Acute MI': 1, 'cerebral infractions': 12, 'fracture of the second metatarsal': 9, 'Cerebral Infraction': 7, 'Focal Cerebral Infraction': 1, 'focal cerebral infraction': 1, 'cerebellar and occipital infraction': 1, 'ischemic or hemorrhagic infracts': 1, 'Acute Myocardial Infraction': 11, "Freiberg's infraction": 45, 'Osteochondral disruption of the second metatarsal': 1, "Freiberg's Infraction of the second metatarsal": 1, "Freiberg's Infraction": 4, 'osteochondrosis of the lesser metatarsal head': 2, "Kohler's disease of the patella": 2, 'splenic infract': 1, 'displacement of the second metatarsal': 1, 'ischemic infracts': 1, 'HypertensionHeart failure Myocardial infraction': 1, 'infract': 12, 'pituitary infraction': 1, 'anterior MI': 5, 'Freiberg diseases': 1, 'venous infraction': 4, "Kohler's disease of the tarsal navicula": 1, 'infraction in heart': 1, 'hepatic infraction': 1, "Freiberg's deformity": 1, 'Myocardial infraction Stroke': 1, 'Post-MI': 2, 'post-MI': 8, 'Freiberg-Kohler type (II)': 1, 'second metatarsal fracture': 17, 'lobe infraction': 1, 'Cerebellar infraction': 1, 'cerebral infract or bleeding': 1, 'second metatarsal pain': 1, 'pain under the second metatarsal': 2, 'idiopathic renal infraction': 1, 'cerebral infract': 7, 'osteochondrosis of the IInd metatarsal head': 1, 'and splenic infraction': 1, 'osteochondrosis of the metatarsal head': 4, 'stage IV osteochondrosis of the second metatarsal head - Freiberg infraction': 1, 'osteochondrosis of the second metatarsal head - Freiberg infraction': 1, 'Freiberg Infraction': 3, 'Freiberg infraction': 10, 'Freiberg infraction of the second metatarsal': 1, 'sexual infraction': 1, 'myocardia infraction': 10, 'periventricular venous infract': 1, 'myocardial infracted': 19, 'chronic myocardial infraction': 2, 'atrial myocardial infraction': 1, 'brain infract': 8, 'second metatarsal dislocation': 1, 'Second Metatarsal Fracture': 2, 'corneal infractions': 2, 'Thrombolysis in Cerebral Infraction': 3, 'Pseudoarthrosis of second metatarsal fracture': 1, 'second or fourth metatarsal fractures': 1, 'second and third metatarsal fractures': 2, "Freiburg's infraction": 1, 'myocardial infraction MI': 1, 'Tuberculous osteomyelitis of the second metatarsal bone': 1, 'second metatarsal shaft fracture': 2, 'simple fracture of the second metatarsal': 1, 'fracture of the second metatarsal shaft': 3, 'postoperative myocardial infraction': 4, 'hypertrophy of the second metatarsal': 2, 'second metatarsal hypertrophy': 1, '-Kohler': 3, 'myocardiac infraction': 2, 'MYOCARDIAL INFRACTION': 2, 'vasoocclusive occlusion infraction': 1, 'myocardial infraction injury': 2, "Freiberg's Disease": 8, 'Infractions': 1, 'cerebrovascular infracts': 2, 'cerebrovascular (infract & hemorrhage': 1, 'MIs': 2, 'PMI': 2, 'Cerebral infract': 2, 'acute myocardial infractions': 3, '[email protected]': 1, 'myocardium infraction': 9, 'second metatarsal stress fracture': 4, "Kohler's Disease": 14, 'heart infract': 2, "Freiberg's syndrome": 1, 'Osteochondrosis of the metatarsal head': 1, 'Freiberg`s disease': 2, 'cerebral massive infraction': 1, 'delayed cerebral infraction': 2, 'fractures of the second and third metatarsals': 1, 'Type 2 myocardial infraction': 1, 'Freiberg infraction of the metatarsal head': 1, 'post-myocardial infraction': 6, "Freiberg's Infarction": 2, "Freiberg's infarction": 10, 'Infracted myocardium': 1, "Freiberg's infraction of the metatarsal": 1, '-infraction': 1, 'hemorrhagic infraction': 5, "Kohler's 2d disease": 1, 'Thrombosis and infraction': 1, 'Thrombolysis In Myocardial Infraction': 4, 'ischaemic brain infraction': 1, 'medial cuneiform (C1)-second metatarsal (M2) diastasis': 1, 'TIMI': 8, 'stress fracture of the second metatarsal': 9, 'pulmonary infraction': 17, "Kohler's second disease": 3, 'Cardiac infraction': 5, 'stress fractures of the second metatarsal': 3, "Kohler's disease of the tarsal navicular": 1, 'infracts': 8, 'miocardial infraction': 1, 'cerebrovascular infraction': 1, 'diaphyseal fracture of the second metatarsal': 1, 'SMI': 1, 'ischemic cerebral infraction': 5, 'bone infraction': 3, "Frieberg-Kohler's disease": 1, 'Frieberg-Kohler disease': 1, 'cerebral infracts': 6, 'Kohler line disruption': 1, 'FI': 1, 'periventricular hemorrhagic infractions': 1, 'periventricular hemorrhagic infraction': 1, 'Myocardial infraction': 1, 'CAMI': 1, 'abnormalities of the second, third, and fourth metatarsals': 1, 'stroke infraction': 1, "Kohler's disease of the patellae": 1, 'renal infraction': 10, "KOHLER'S DISEASE": 1, 'Occlusion Myocardial Infraction': 1, 'post myocardial infraction': 3, 'ischemic infraction': 14, 'allograft infraction': 1, 'middle cuneiform-second metatarsal synostosis': 1, "Freiberg's disease of 3rd metatarsal head": 1, 'posterior cord infraction': 1, 'lacuna infraction': 2, 'renal infract': 2, 'hepatic infract': 1, 'Myocardial infraction associated symptom': 1, 'Stress fracture of the second metatarsal': 4, 'KD': 2, 'Thrombosis in Myocardial Infraction': 1, 'splenic infraction': 4, 'Osteonecrosis of the second metatarsal head': 1, 'osteonecrosis of the second metatarsal head': 7, "Kohler's chimps": 1, 'shortening of the second metatarsal': 1, 'myocardial infracts': 2, 'Freiberg symptom': 1, 'myocardial-infraction': 1, 'Freiberg': 3, 'deformity of the second metatarsal': 1, 'IS': 1, 'floating second metatarsal': 1, 'cerebellar infraction': 4, 'Kohler syndrome': 2, 'infraction angina': 1, 'heart post-infraction': 1, 'infraction of the second metatarsal': 1, "Freiberg's infraction of the second metatarsal": 2, 'instability between the first and second metatarsals': 1, 'Acute Myocardial Infractions': 1, 'Kohler--II,': 1, 'mental infraction': 1, 'Idiopathic mental infraction': 1, 'idiopathic mental infraction': 1, 'gastric infract/perforation': 1, "Freiberg's disease of the metatarsal head": 1, 'Cerebral Relieve infraction': 1, 'ischemic infract': 4, "Freiberg-Kohler's osteonecrosis": 1, "Freiberg-Kohler's disease": 3, 'avascular osteonecrosis of the second metatarsal head': 1, "Freiberg-Kohler's Osteonecrosis": 1, 'cerebral ischemic infraction': 2, 'Idiopathic segmental infraction of the greater omentum': 1, 'cardiac infract': 2, 'Cerebral infracts': 1, 'Osteochondrosis of the second or third metatarsal head': 1, 'TIMI 3': 1, 'collapse of second metatarsal head': 1, 'Spinal infraction': 1, 'stress fracture of the second or third metatarsal': 1, 'reMI': 1, 'ventricular infraction': 1, 'second metatarsal malalignment': 1, 'hypoplastic second metatarsal': 1, 'PIM': 1, 'second metatarsal deviation': 1, 'neuronal infraction': 1, 'Infractable Diseases': 5, 'acute myocardial infract': 4, 'cerebral ischemic infract': 1, 'hypoplasia of the second metatarsal bone': 1, 'Chorizagrotis forasmicans Kohler, n. comb': 1, 'Second metatarsal stress fracture': 1, 'posterior myocardial infraction': 1, "Freiberg-Koehler's disease": 3, 'osteochondrosis of the epiphysis of the 5th metatarsal bone': 1, 'Osteoblastoma of the second metatarsal': 1, "Freiberg's infraction of the second metatarsal head": 1, 'Renal infraction': 1, 'toothpick of the second metatarsal': 1, 'myocardial ischemia and infraction': 1, 'maladie de Freiberg': 1, 'de Kohler': 1, 'deformity of second and third metatarsals': 1, "Kohler's bone disease": 4, 'necrosis of the second metatarsal head': 1, 'Fracture of the second metatarsal': 2, 'myocardial and cerebral infraction': 3, 'Interim myocardial infraction': 1, 'fracture of the second, third and fourth metatarsal bases': 1, "Kohler's syndrome": 2, "Kohler's disorder": 1, 'brain infracts': 4, 'mycocardial infraction': 1, 'occlusive MI thrombi': 1, 'MI thrombi': 1, 'brachymetatarsia of the second metatarsal': 1, ':second metatarsal bone': 1, 'mitral infraction': 1, 'second metatarsal base fractures': 1, 'right parietal lobe infraction': 1, 'choroidal infraction': 1, 'conduct infractions': 1, 'Myocardial infract': 3, 'anterior myocardial infraction': 5, 'Tooth infraction': 1, 'Osteochondritis of the second metatarsal head': 1, 'Myocardium infraction': 1, 'Kohler-Freiberg': 1, "Kohler-Freiberg's diseases": 1, 'Second metatarsal fracture': 1, 'Myocardial infracts': 1, 'nail fold infracts': 1, 'behavioural infractions': 1, "Tarsal Scaphoid-Kohler's Disease": 1, 'myocardial infraction.22': 1, "Kohler's II Disease": 1, 'Myocardial Infract': 3, 'Occipital infraction': 1, 'cerebral infract at': 1, 'organ ischemic infraction': 1, 'postoperative MI': 2, 'Postoperative myocardial infraction': 1, 'type 5 MI': 1, 'Postoperative MI': 2, 'MI Myocardial infraction': 3, 'CI': 2, 'mmyocardial infraction': 1, 'Artery of Percheron (AOP) infract': 1, 'AOP infract': 1, 'Brain infraction': 2, "Kohler's osteochondrosis": 2, 'myocardial infraction/injury': 1, 'Tubercular osteomyelitis of the second metatarsal': 1, 'of the second metatarsal': 2, 'posterior cerebral lobe infraction': 1, 'periventricular venous infraction': 1, 'osteochondrosis of a metatarsal head': 1, 'Myocardial infraction Malignancy': 1, 'stress fracture of the second metatarsal base': 2, 'fracture of the second metatarsal head': 1, 'osteochondral fracture of second metatarsal head': 1, 'hemorrhagic infract': 1, 'Post Myocardial Infraction': 1, 'Myocardial infraction MI': 1, "Kohler's disease II": 2, 'Thrombosis/infraction': 1, 'AMI acute myocardial infraction': 1, 'Acute-Myocardial Infraction': 1, 'second to fourth metatarsal dislocations': 1, 'second and third metatarsal dislocation': 1, 'second to fifth metatarsal dislocations': 1, 'Pontine Infraction': 1, 'Distal fractures of the second metatarsal': 1, 'MI injury': 1, 'Kohler-Mouchet disease': 1, 'renal infractions': 1, 'pseudoaneurysm of the second dorsal metatarsal artery': 1, 'second metatarsal artery pseudoaneurysm': 1, "Kohler's": 1, "Freiberg-Kohler's epiphyseonecrosis": 1, 'Osteomyelitis of second metatarsal head': 1, 'cardiac infractions': 1, 'Splenic infraction': 2, 'aMI': 1, 'osteonecrosis of most commonly the second metatarsal head': 1, 'microtraumas of the second metatarsal head': 1, 'infraction injury': 1, 'Q-wave myocardial infraction': 1, 'brain infractions': 1, 'myorardial infraction': 1, "Kohler's disease of patella": 1, 'cerebellar infract': 2, 'second metatarsal metastasis': 1, 'Calcaneal apophysis Kohler disease': 1, 'second metatarsal subluxation': 1, 'postoperative acute myocardial infraction': 1, 'long second metatarsal': 1, 'Acute myocardial Infraction': 2, 'Osteochondrosis dissecans of the head of the first metatarsal': 1, 'Infraction': 1, 'aggressive infractions': 1, 'postoperative cerebral infraction': 1, "Kohler's disease of the tarsal scaphoid": 1, 'postmyocardial infraction': 1, 'osteochondrosis of the metatarsal heads': 2, 'wall myocardial infraction': 1, 'Myocardial Infraction condition': 1, 'Thrombolysis In Cerebral Infraction': 1, 'cerebral infracted': 1, 'multiple cerebral infraction': 1, 'Infracted Heart': 1, 'myocardial infract ion': 1, 'Polydactyly of the Second Metatarsal': 1, 'Renal infract': 1, 'fractures of the base of the second metatarsal': 3, 'freiberg disease': 1, 'long second metatarsals': 2, "Bilateral Kohler's disease": 1, 'Kohler I and II': 1, 'osteonecrosis of second metatarsal head': 1, 'fractures of the second, third, and fourth metatarsals': 3, 'second, third, and fourth metatarsal head fracture': 1, 'dislocation of the second metatarsal phalangeal joint': 1, "Kohler's disease of the scaphoid": 1, 'type 1 (T1) MI': 1, 'Type 2 MI': 1, 'T2MI': 2, 'T1MI': 1, 'type 1 MI': 1, 'type 2 MI': 1, 'Post MI': 1, 'Kohler': 2, 'chondroblastic osteosarcoma of the second metatarsal': 1, 'fracture of second metatarsal base': 1, "Kohler's first bone disease": 1, "Kohler's second bone disease": 1, 'Kohler II disease': 3, 'Freiberg-Kohler disease': 3, 'elevated myocardial infraction': 1, 'spinal infraction': 1, 'infraction of left femur': 1, "Freiberg's disease of": 1, 'infraction injuries': 1, 'TV-MI': 1, 'Second metatarsal head fracture': 1, "Kohler's disease of": 1, 'myocardiol infraction': 1, 'trauma or infraction': 1, 'Kohler II': 2, 'atherothrombotic infraction': 2, 'Multiple cerebral infraction': 1, 'venous infracts': 1, 'transverse fracture of the second metatarsal': 1, 'Fracture of the second metatarsal base': 1, 'splenic infractions': 1, 'KHL': 1, 'postoperative infraction': 1, 'osteochondrosis of tarsal and metatarsal bones': 1, 'elevation myocardial infraction': 2, 'dorsal dislocation of the first and second metatarsals': 1, 'strategic infraction dementia': 1, 'SCI': 2, 'type I myocardial infraction': 1, "patellar Kohler's disease": 1, 'cerebellar infractions': 1, "Freiberg's diseasediagnoses": 1, "Freiberg's osteochondrosis": 1, 'avulsion fracture of the second metatarsal base': 1, 'displacement of the second to fourth metatarsal': 1, "Freiberg's infraction or disease": 1, "Freiberg's": 1, 'CVI infract': 1, 'thrombotic MI': 1, 'Bischof-Kohler': 1, 'left renal infraction': 1, 'second and third metatarsal destruction': 1, 'Idiopathic osteonecrosis of the second metatarsal head': 1, 'idiopathic osteonecrosis of the second metatarsal head': 1, 'Idiopathic necrosis of the second metatarsal head': 1, 'myocardial infraction.mp.': 1, 'Freiberg`s disease of the': 1, 'Freiberg`s disease of lesser metatarsals': 1, 'PIPA': 1, 'Post-infraction pseudo aneurysms': 1, 'second metatarsal shaft fractures': 1, 'second metatarsal fractures': 3, 'Postmyocardial infraction cardiosclerosis': 1, 'Ischemic infraction of': 1, 'postmyocardial infraction cardiosclerosis': 1, 'fracture of the first and second metatarsals': 1, 'MINFs': 1, 'multiple cerebral infractions': 2, 'tarsal navicular bone Freiberg disease': 1, 'comminution of the second metatarsal base': 1, 'Comminution Of The Second Metatarsal Base': 1, 'myocardial re-infraction': 2, 'subcortical infracts and': 1, 'metatarsal head osteochondrosis': 1, 'MI.**P': 1, 'MI,**p': 1, 'osteonecrosis of the second or third metatarsal head': 1, 'cardial infraction': 1, 'arterial infraction': 1, 'adrenal infraction': 1, 'type 2 myocardial infraction': 1, 'Brain Infract': 1, '4a myocardial infraction': 1, 'Elevation Myocardial Infraction': 1, 'Freiberg lesion': 1, 'deformity of the head of the second metatarsal': 1, 'MCI': 1, 'massive cerebral infraction': 2, 'myocardium infract': 1, 'cardiocerebral" infraction': 1, 'Freiberg disease of the second metatarsal head': 1, "Koehler-Freiberg's disease": 1, 'liver and kidney infraction': 1, 'Q-wave MI': 1, 'heart infraction': 6, 'mTICI': 1, 'mTICI greater than 2b': 1, 'artery of Percheron infraction': 1, 'Freiberger': 1, 'callosal infraction': 1, 'Myocardial re-infraction': 1, 'orbital infraction syndrome': 1, "Freiberg's infraction of the": 1, 'Pulmonary infraction': 1, 'Multiple cerebral infracts': 1, 'renal infracts': 1, 'Subendocardial infraction': 1, 'Myocardial infractions': 1, 'Pedicle infraction': 1, 'Kohler disease found': 1, "Freiberg's disease affecting the": 1, 'Infract': 1, "Freiberg's disease of the metatarsal": 1, 'Thrombolysis in Myocardial Infraction-3': 1, 'Freiberg infractions': 1, 'aggressive and violent infractions': 1, "Freiberg's infraction of the metatarsal head": 1, 'second metatarsal (MT)': 1, 'Stroke type Infraction': 1, "Kohler's maluma": 1, 'fractures of the second metatarsals': 2, 'cerebellar infracts': 1, 'MI/R) injury': 1, 'MI/R': 1, 'MI/R injury': 1, 'Second metatarsal Casualty': 1, 'thrombolysis in cerebral infraction': 1, 'Second metatarsal R': 1, 'Second metatarsal L': 1, 'Freiberg-Kohler osteochondrosis': 1, "Kohler's primary sterno-costo-clavicular hyperostosis": 1, 'displacement of second metatarsals': 1, 'myocardial infraction disease': 1, 'vascular infraction': 1, "Kohler's tear drop": 1, 'cardiocerebral infraction': 1, "Thompson and Hamilton type IV Freiberg's disease": 1, 'Cerebral, splenic infractions': 1, 'cerebral infraction disease': 1, 'Venous infract': 1, 'venous infract': 1, 'Freiberg-Kohler syndrome': 1, 'acute Myocardial Infraction': 1, 'type I MI': 1, 'MI type I': 1, 'type II MI': 1, 'MI type II': 1, 'old and acute myocardial infraction': 1, 'old cerebral infraction': 1, 'Myocardial infraction Stroke': 1, 'second metatarsal lesions': 1, 'second metatarsal transfer lesion': 1, 'Second Metatarsal Transfer Lesions': 1, 'Second metatarsal transfer lesions': 1, 'second metatarsal transfer lesions': 1, 'second - fourth metatarsal fractures': 1, 'ischemia myocardial infraction': 1, "Frieberg's infraction of the second metatarsophalangeal joint": 1, 'subluxation of the second metatarsal head': 1, 'Kohler disease II': 1, 'Freiberg Group 1a': 1, 'Acute myocardial infract': 1, 'Female Cerebral infraction': 1, 'CNS infraction': 1, 'Bowel infraction': 1, 'fractures of the second to fourth metatarsal': 1, 'arterial mesenteric infraction': 1, 'Mid-tibial infraction': 1, "Kohler's metatarsal disease": 1, 'osteochondrosis of a lesser metatarsal head': 1, 'brainstem infraction': 1, 'visceral infractions': 1, 'Kohler III disease': 1, 'second metatarsal defect': 2, 'Fracture Crown infraction': 1, 'posterior circulation infraction': 1, 'fracture of the base of the second metatarsal': 1, 'cerebral ischemic infraction or': 1, 'mayocardial infraction': 1, 'Freiberg-Kohler': 1, 'Freiberg-s infraction': 1, "Kohler's second syndrome": 1, 'wall MI': 1, 'ischemic injury and infraction': 1, 'osteoarthritis of the second tarso-metatarsal joint': 1, 'osteoarthrosis of the second tarso-metatarsal joint': 1, 'Thrombolysis in myocardial infraction': 1, 'brain ischemic infract': 1, 'osteochondrosis of the head of the first metatarsal': 1, 'coronary and cerebral infraction': 1, 'medullary Infraction': 1, 'second metatarsal and ankle fracture dislocation': 1, 'Medical infraction': 1, 'Myocardial infraction 5': 1, 'Acute myocardial infraction 1': 1, 'osteochondrosis of the metatarsal': 1, 'ATBI': 1, 'infraction of': 1, '2 AMI': 1, 'IHMI': 1, 'cardiac and brain infracts': 1, 'Postmyocardial infraction': 1, 'medial cuneiform (C1)-second metatarsal (M2)': 1, 'Striatocapsular infraction': 1, 'metatarsal osteochondrosis': 1, 'dislocation of the second metatarsal joint of the tarsus': 1, "Freiberg's disease of the second metatarsal": 1, 'second metatarsal head': 1, 'second metatarsal shortening': 1, 'cerebral infraction 3': 1, 'cardiac myocardial infraction': 1, 'fractures of the second metatarsal': 1, 'Fractures of the second and third metatarsal': 1, 'hemorrhagic infractions': 1, 'visceral infraction': 1, 'dislocation of the second, third, and fourth metatarsal bases': 1, 'osteochondritis of the second metatarsal head': 1, 'malunion of the second metatarsal': 1, 'coronary infraction': 1}
|
myocardial infraction
|
Disease
|
MESH:C535637
|
{'Freire-Maia': 2, 'Maia': 4, 'maia': 3, 'MAIA': 1, 'ZeM': 1, 'Zuma e Maia': 1, 'Odontotrichomelic hypohidrotic dysplasia': 1, 'MAIAs': 1, 'Els-maia': 1, 'mAIA': 1}
|
Maia
|
Disease
|
MESH:C535638
|
{'PF': 4, 'Frenkel defect': 3, 'Frenkel': 7, 'RETINAL TELANGIECTASIA ASSOCIATED': 1, 'FHH': 5, 'FD': 1, 'FR': 3, 'RUSs': 1, 'FE': 2, 'Matti-Russe spongioplasty': 1, 'Frenkel defects': 1, 'Li Frenkel': 1, 'Frenkel disorder': 4, 'Frenkel and Schottky type disorders': 1, '-Russe': 1, 'Schottky by anti-Frenkel disorder': 1, 'FP': 4, "Frenkel's traumatic syndrome": 1, 'AIFDEM': 1, '-Frenkel disorder': 1, 'Frenkel or Schottky disorder': 1, 'Frenkel-Toledo': 1, 'Frenkel-': 1, 'Frenkel and Schottky disorders': 1, 'FL': 2, '-Lom, -Russe': 1, 'Frenkel, and Schottky disorders': 1, 'Frenkel D.': 1, 'or Frenkel defects': 1, 'Frenkel C': 1, 'Frenkel D': 1, 'Frenkel E': 1, 'Hypogammaglobulinemia T and B': 1, 'Frenkel-type disorder': 1, 'Schottky and Frenkel disorders': 1, 'RP': 1}
|
Frenkel
|
Disease
|
MESH:C535639
|
{'Frias': 72, 'developmental and facial anomalies': 1, 'Asymmetric facial skeletal growth': 1, 'facial developmental anomalies': 3, 'facial growth deficiency': 4, 'Jaime-Frias': 1, 'congenital foetal growth-associated anomalies': 1, 'Frias syndrome': 6, 'Dixon and de Frias': 1, 'Costa e Frias': 1, 'isquemia fria': 2, 'TIF': 1, 'deficient facial growth': 1, 'Hannon and Frias': 1, 'Developmental anomalies of the facial region': 1, 'Chavez Frias': 1, 'Las Frias': 1, 'congenital growth anomalies': 2, ', hearing and facial growth difficulties': 1, 'Mario Frias': 1, 'Papiliotrema frias': 1, 'non-facial anomalies': 2, 'Facial growth anomalies': 2, 'Frias-De-Leon': 2, 'Vazquez-Frias': 1, 'Growth and Congenital Anomalies': 1, 'Liesbeth Frias': 1, 'facial, multiple anomalies': 1, 'Guadalupe Frias-De': 1, 'MLMartinez-Frias': 1, 'facial growth anomalies': 2, 'Frias 2021': 1, 'Frias 2018': 1, 'auditory and facial developmental anomalies': 1, 'multiple facial anomalies': 4, 'facial growth deficiencies': 1, 'Frias JL': 1, 'Facial anomalies and developmental delay': 1, 'Martin-Frias': 1, 'Rodriguez-Frias': 3, 'Facial anomaly and growth deficit': 1, 'Frias-De-': 1, 'maxillo-facial growth anomalies': 1, 'Facial anomalies 1': 1, 'anomalies in growth and facial structure': 1, 'Frias-': 2, 'Garcia-Frias': 1, 'Frias glacier': 1, 'Boia-Fria': 1, 'Opits-Frias syndrome': 1, 'Optiz-Frias': 1, 'fria': 1, 'deficiency in facial growth': 1, 'Rodriguez Frias': 1, 'congenital and growth anomalies': 1, 'Oscar Frias': 1, 'AF': 2, 'Banuelos-Frias': 1, 'De Frias': 1, 'Bianchi-Frias': 1, 'Cernuschi-Frias': 1, 'facial-type anomalies': 1, 'mid-facial growth deficiency': 1, 'Lopez-Frias': 1, 'mid facial growth deficiency': 1, 'sudorese fria': 1, 'deficient mid-facial growth': 1, 'Frias-Zepeda': 1, 'anomalies of facial growth': 1, 'Boias-Frias': 1, 'Catia P Frias': 1, 'Gamez Frias': 1, 'FRIAS': 1, 'Boia-Frias': 1, 'facial and growth affection': 1, 'developmental facial anomalies': 1, 'Mesa-Frias': 1, 'Frias 2018a': 1, 'Frias 2018b': 1, 'Perez-Frias': 1, 'facial high anomaly': 1, 'congenital or growth and development anomalies': 1, 'Martines-Frias syndrome': 1, 'Frias-Lopez': 1, 'anomalies in facial growth': 1}
|
Frias
|
Disease
|
MESH:C535642
|
{'pseudoanodontia': 45, 'Gapo syndrome': 4, 'Pseudoanodontia': 7, 'odontotrichomelic syndrome': 3, 'Odontotrichomelic syndrome': 1, 'GAPO syndrome': 4, 'Growth retardation, alopecia, pseudoanodontia, optic atrophy (GAPO) syndrome': 1, 'GAPO': 2, 'optic atrophy (GAPO) syndrome': 2, 'eye, ear and other central nervous system abnormalities': 1, 'odontotrichomelic syndromes': 1, 'Growth retardation, Alopecia, Pseudoanodontia and Optic atrophy (GAPO) syndrome': 1, 'alopecia-pseudoanodontia-optic atrophy': 1, 'Pseudoanodontia, and Optic atrophy (GAPO) syndrome': 1, 'growth retardation-alopecia-pseudoanodontia-optic atrophy syndrome': 1, 'Growth retardation-alopecia-pseudoanodontia-optic atrophy (GAPO) syndrome': 1, 'GAPO) syndrome': 1, 'Gapo Syndrome': 1, 'Odontotrichomelic tetramelic ectodermal dysplasia': 1}
|
pseudoanodontia
|
Disease
|
MESH:C535645
|
{'Diamond': 93, 'DIAMOND': 483, 'DP': 4, 'diamond': 306, 'jaggy diamonds': 1, 'psychogenic purpura': 57, 'Gardner-Diamond syndrome': 92, 'Gardner-Diamond Syndrome': 12, 'Schwachman-Diamond syndrome': 110, 'DT': 1, 'NCD': 62, 'Schwachman-Diamond Syndrome': 18, 'Psychogenic purpura': 29, 'Autoerythrocyte sensitization': 7, 'autoerythrocyte sensitization syndrome': 34, 'AES': 7, 'GDS': 11, 'Autoerythrocyte sensitization syndrome': 27, 'Diamonds': 31, 'HD': 4, 'H-UNCD': 1, 'UNCD': 18, 'DIAMOnD': 14, 'Schwachman-Diamond': 1, 'turquoise diamond': 1, 'BDD': 81, 'gardner-diamond syndrome': 2, 'Venus Diamond': 1, 'diamond defect': 1, '-diamond': 6, 'dazzling-diamond': 1, 'creepy-diamond': 2, 'ND': 11, 'SDS': 32, 'Diamond-Blackfananemia': 3, 'diamonds': 54, 'DIAMONDS': 12, 'Kingsolver and Diamond': 1, 'DIAMOND MI': 1, 'PCD': 26, "Gardner-Diamond's purpura": 1, 'psychogenic reaction': 16, 'DND': 2, 'Diamond cruise': 1, 'Diamond-Gardner syndrome': 2, 'Diamond Gardner syndrome': 1, 'Schwachman Diamond Syndrome': 8, 'CVD diamond': 10, 'Swhachman-Diamond': 1, 'AEST': 2, 'Gardner Diamond syndrome': 5, 'psychogenic purpuras': 2, 'DBP': 1, 'Psychogenic Purpura': 4, 'Gardner Diamond Syndrome': 5, 'PP': 4, 'DIAMOND-AF': 1, 'Diamond syndrome': 3, 'radioactive diamonds': 1, 'psychogenic reactions': 2, 'Schwachman Diamond syndrome': 9, 'DIAMOND-MI': 1, 'DIAMOND-': 2, 'DS': 3, 'Psychogenic reaction': 2, 'Swachman-Diamond Syndrome': 2, 'NDs': 6, 'Kankan diamond': 1, 'Swachman-Diamond syndrome': 5, 'Schwachman-diamond syndrome': 2, 'DIAMonDs': 1, 'Schwachmann-Diamond Syndrome': 3, 'Diamond INC': 2, 'Shwachmann-Diamond syndrome': 4, '-Diamond': 6, 'nanocrystalline diamond': 2, 'CHARACTERIZATION OF FLUORESCENT DIAMOND PARTICLES': 1, 'APPLICATIONS OF FLUORESCENT DIAMOND PARTICLES': 1, 'DIAMOND PRINCESS': 2, 'CVD diamonds': 1, 'Scwachman-Diamond syndrome': 3, 'GD': 1, 'Autoerythrocyte sensitization (Gardner-Diamond) syndrome': 2, 'autoerythrocyte sensitization (Gardner-Diamond) syndrome': 1, 'CHARACTERIZING DIAMOND': 3, 'DSPL': 2, 'DiaMOND': 1, 'CD': 6, 'Swachman Diamond syndrome': 1, 'diamond rush': 3, 'Autoerythrocyte Sensitization Syndrome': 4, 'DME': 1, 'orange diamonds': 1, 'NSD': 5, 'nanostructured diamond': 1, 'UDD': 2, "Gardner-Diamond's syndrome": 3, 'rn-PCD': 1, 'DO': 3, '-diamonds': 1, 'DB': 4, 'Schwachmann-Diamond syndrome': 1, 'diamond mine': 3, 'Charisma Diamond': 1, 'DIAMOND COMPANY OF ANGOLA': 1, 'superdeep diamonds': 2, 'DSD': 2, 'DF': 7, 'DNPs': 1, 'SiC-NCD': 1, 'Binderless Diamond Sintering': 1, 'Gardner and Diamond syndrome': 2, 'p-PCD': 1, 'diamond stingray': 2, 'Diamond stingray': 1, 'DNWs': 1, 'LADT': 1, 'DN': 5, 'DNTs': 2, 'autoerythrocyte sensitization': 4, 'Diamond Rattlesnake': 1, 'QEDJT': 1, 'DiAMoND': 1, 'Shwachmann-Diamond Syndrome': 1, "Diamond's thesis": 1, 'II diamonds': 1, 'DiAMOND': 2, 'Psychogenic purpura syndrome': 1, 'Gardner-diamond syndrome': 1, 'Autoerythrocyte purpura': 1, 'Diamond frost': 1, 'MAGNETISM OF DIAMOND': 1, 'TKKD diamond': 1, 'ALLUVIAL DIAMONDS': 1, 'Schwackman Diamond syndrome': 1, 'turquois diamonds': 1, 'ODM': 1, 'D-F': 2, 'Autoerythrocyte sensitization purpura': 1, 'diamond fraud': 1, 'NCD-SCD': 1, 'diamond theft': 1, 'fMCD': 1, 'ASS': 2, 'lethal diamond': 1, 'UND': 1, 'Gardner diamond syndrome': 1, 'stray diamond': 1, 'Diamond scribe': 1, 'diamond mining': 1, 'DN GN': 1, 'Schwann-Diamond syndrome': 1, 'DIAMOND-MAGNETIC-MICROSCOPY': 1, 'NDF': 1, 'DIAMOND CUTTING': 1, 'FDP-NV': 1, 'DD': 1, 'PD': 1, 'Gardner-Diamond disease': 1, 'DM': 3, 'baseball diamond': 1, 'NAVIGATING DIAMOND': 1, 'NCDs': 2, 'Barneyback and Diamond': 1, 'nanocrystalline diamonds': 1, 'DNS': 1, 'PSYCHOGENIC REACTIONS TO SIMULATED IRRADIATION OF CHILDREN': 1, '-Diamond Syndrome': 2, 'Diamond Syndrome': 2, 'VD': 1, 'FNDPs': 1, 'BORON-DOPED DIAMOND': 1, 'DIAMoND': 1, 'AIOC IJO DIAMOND': 1, 'Diamond defect': 1, 'Schwachman diamond syndrome': 1, "Gardner and Diamond's syndrome": 1, 'NHDShwachman-Diamond syndrome': 1, 'Nano-diamonds': 2, 'Schwachman-Bodium-Diamond syndrome': 1, 'autoerythrocyte sensitization disorder': 1, 'DP-A': 2, 'DI': 2, 'DIAMOnD.': 1, 'MCD': 4, 'PSYCHOGENIC REACTIONS': 1, 'DC': 1, 'Schwachmann-Diamond': 1, 'Gardner-Diamond vascular purpura': 1, 'CVD': 1, 'DIAMOND SYNDROME': 1, 'Schwachman-Diamond syndromes': 1, 'Gardner-Diamond-syndrome': 1, 'NPDs': 1, 'NPD': 3, 'conflict diamonds': 1, 'Polycrystalline Diamonds': 1, 'DIAMOND DETECTOR': 1, 'Gold-Diamond Permutation': 1, 'ASS lesions': 1, 'Shwachmann Diamond Syndrome': 2, 'ETHICS OF THE DIAMOND': 1, 'nD': 1, 'nD.': 1, 'of diamond': 1, 'Diamond-BlackfanAnemia': 3, 'NTD': 1, 'Diamond Blackfananemia': 1, 'autoerythrocyte-sensitization syndrome': 1, 'GDS lesions': 1, 'Marian Diamond': 1, 'Diamond Dove': 1, 'Diamond s': 1, 'Colour diamonds': 1, 'UDFM': 1, 'Diamond-NOM': 1, 'Hyperpolarized Diamond': 1, 'Diamond CDC': 1, 'Bore Doped Diamond': 1, '-Diamond syndrome': 1, 'DIAMONDS IN METEORITES': 1, 'Archean diamonds': 1, 'Diamond Princess cruise': 2, 'Shrestha and Diamond': 2, 'NCD SUBSTRATES': 1, 'NCD FABRICATION': 1, 'NCD FILMS': 1, 'BD': 1, "Gardner and Diamond's purpura": 1, 'AO-BDD': 1, 'diamond anvil': 2, 'square-diamond': 1, '-DIAMONDS': 1, 'Diamond python': 1, 'FNDs': 1, 'GSDIBWHIMShwachman Diamond diseaseCohen diseaseHermansky': 1, 'Diamond-': 1, 'DNT': 1, 'diamond defects': 1, 'Diamond Nanofilm': 1, 'toracica Diamond': 1, 'Diamond-Blakcfan syndrom': 1, 'Oropharyngeal psychogenic purpura': 1, 'SCHIZOPHRENOSIMILAR PSYCHOGENIC REACTIONS': 1, 'BDDs': 1, 'congenitalAmegakaryocytic thrombocytopeniaShwachman-Diamond syndrome': 1, 'AES syndrome': 1, 'Blackan-Diamond syndrome': 1}
|
DIAMOND
|
Disease
|
MESH:C535646
|
{'GT': 1, 'Seborrhoeic diseases': 1, 'Garret': 4, 'TRIPP': 3, 'Seborrhoeic and': 1, 'SEBORRHOEIC': 1, 'seborrhoeic basset hounds': 1, 'seborrhoic ceratosis': 1, 'seborrhoeic disease': 3, 'seborrhoeic lesions': 6, 'Seborrhoeic lesions': 1, 'TRIPP ANTI-FRICTION ROLLER-BEARING': 1, 'seborrhoeic': 15, 'Seborrhoeic': 1, 'seborrhoeic hyperplasia2': 1, 'seborrhoe': 4, 'seborrhoeic dermatiis': 1, 'Seborrhoeic keratosisNumber': 1, 'Seborrhoeic eczeman': 1, 'seborrhoeic keralosis': 1, 'seborrhoeic dermatitic features': 1, 'Tripp': 3, 'seborrhoeic dematitis': 1, 'seborrhoic diseases': 1, 'Garret,1': 1, 'seborrhoeic diseases': 1, 'seborrhoeic dermitis': 1, 'Seborrhoe bei': 1, 'Seborrhoe': 1, 'seborrhoeic disorders': 1, 'seborrhoeic keratosisdata': 1, 'Yu & Garret Illnesses Condition': 1}
|
seborrhoeic
|
Disease
|
MESH:C535647
|
{'bloating': 14802, 'Bloating': 1328, 'gas bloat syndrome': 93, 'post-fundoplication symptoms': 3, 'bloated': 272, 'bloating symptoms': 109, 'postoperative gas or bloating': 1, 'gas and bloating': 35, 'gas-bloating': 8, '/bloating': 14, 'bloating sensation': 30, 'Bloating and distension': 7, 'LNF': 67, 'postprandial fullness and bloating': 9, 'bloating symptom': 19, 'FB': 12, 'bloat': 346, 'nauseous or bloated feelings': 1, 'functional bloating': 36, 'Postoperative gas-bloating': 1, 'LTF': 10, 'TIF': 72, 'gas-bloat': 35, 'ONF': 3, 'gas bloating': 75, 'postprandial bloating symptoms': 1, 'postprandial bloating': 144, 'Bloating Syndrome': 1, 'bloating syndrome': 15, 'bloating and distension': 15, 'gas bloat': 93, 'drowsy or bloated': 1, 'rumen frothy bloat': 1, 'post-fundoplication': 5, 'gas-bloat syndrome': 71, 'reduced bloating': 1, 'fundoplication': 11, 'pain, gas, or bloating': 1, 'bloating incontinence': 1, 'PMS-bloat': 1, 'bloating reduction': 5, 'Cognitive Bloat': 2, 'bloated feeling': 39, 'Perimortem bloating': 1, 'Bloating symptom': 2, 'excessive bloating': 1, 'abomasum bloating': 1, 'epigastric bloating': 61, 'bloat symptoms': 3, "Dor's fundoplication": 1, 'HM-DF': 1, 'excess bloating': 1, 'bloating complaint': 1, 'bloating and gas': 6, 'pasture bloat': 5, 'Bloating Symptoms': 2, 'postoperative bloating': 12, 'frothy bloat': 25, 'onion bloat': 1, 'Bloating sensation': 2, 'LMAH': 1, 'LF': 24, 'Fundoplication': 3, 'Nissen fundoplication': 25, 'Bloating Reflux symptom': 1, 'Bloat': 61, 'gas bloat"': 2, 'belly bloating': 1, 'bloating/gas': 13, 'chronic bloating': 6, 'bloating Wheat': 1, 'bloating sense': 1, 'excessive gas or bloating': 1, 'bloating problems': 2, 'bloating or discomfort': 2, 'bloating in the': 5, 'bloated face': 4, 'Toupet fundoplication': 3, 'Gas Bloat Syndrome': 2, 'gas-bloat-symptoms': 1, 'gastrointestinal bloating': 35, 'bloating pain': 4, 'Belly Bloating': 1, 'gas/bloating': 30, 'bloating or cramping': 1, 'and bloating': 11, 'abdominal bloating or gas': 2, 'postprandial epigastric bloating': 1, 'NF': 17, 'DF': 2, 'TF': 9, 'bloating bowel symptom': 1, 'bloating diseases': 3, 'BSF': 1, 'BSFs': 1, 'abdominal gas and bloating': 3, 'Nissen fundoplications': 4, 'abdominal (bloating, discomfort) symptoms': 1, 'bowel bloating': 9, 'eye bloating': 2, 'Postoperative gas bloating': 2, 'feeling bloated': 2, 'bloat syndrome': 5, 'post fundoplication bloating syndrome': 1, 'gas bloating syndrome': 7, 'gass bloat syndrome': 1, 'Nissen and Toupet fundoplications': 1, 'prolonged gas bloat': 1, 'bloated rumen': 2, 'bloating and distention': 4, 'postoperative gas and bloat': 1, 'SOFY': 1, 'distension/bloating': 3, 'abomasal bloating': 5, 'postoperative bloating and urgency': 1, 'chronic bloat': 3, '-fundoplication': 1, 'bloating and gas in the': 1, 'abdominal bloating symptoms': 9, 'Bloating symptoms': 8, 'bloated gut': 1, 'Frothy bloat': 10, 'Gas bloating syndrome -': 1, 'uterine bloating': 1, 'gas/bloat': 4, 'Gastrointestinal Bloating': 1, 'submandibular or facial bloating': 1, 'Post-fundoplication': 3, 'bloating and': 11, 'rumen bloat': 4, 'Gas bloat': 12, 'note bloat': 2, 'abomasal bloat': 25, 'GI bloating': 5, 'bloating of': 3, "bloat'.6": 1, 'gas bloat" syndrome': 4, 'gas-bloat" syndrome': 3, 'post-fundoplication syndrome': 4, 'bloating or gas': 9, 'BL': 1, 'distention or bloating': 1, 'bloating or distension': 10, 'bloat/': 2, 'bloated belly': 4, 'pulmonary bloating': 3, 'Bloating Symptom': 1, 'reflux and distention/bloating': 1, 'bloated or painful belly': 1, 'Bloating or swelling': 1, 'bloated or gassy': 1, 'bloated,"I': 1, "bloated'I": 1, 'postprandial gas bloating': 1, 'Bloating/': 1, 'bloating or distention': 4, 'gas/bloat symptoms': 1, 'Pasture bloat': 2, 'bloating*time': 1, 'BLOAT': 2, 'bloating/distension': 18, 'bloated sensation': 4, 'recurrent bloat': 1, 'Gas bloating': 9, 'gas-bloating syndrome': 9, 'Bloating and distention': 2, 'bloating taste change': 1, 'esophageal and abdominal bloating/distension symptoms': 1, 'abnormal bloating': 1, 'Gas and bloating': 2, 'Gastrointestinal Gas and Bloating': 1, 'Post-fundoplication symptoms': 3, 'Gas bloat syndrome': 7, 'bloated or': 1, 'gas-bloat"': 1, 'globus and bloating': 1, 'OF': 2, 'Anal bloating': 1, 'bloating complications': 1, 'postoperative gas bloating': 1, 'Bloating Occasional': 1, 'bloating and swelling': 1, 'BD': 1, 'bloating or': 2, 'bloating and/or gaseousness': 1, 'Reduced bloating': 2, 'bloating or fullness': 2, 'bloating-pain-gas': 1, 'post-fundoplication dyspepsia': 2, 'bloated chest': 1, 'gas/bloat syndrome': 2, 'foamy bloat': 1, 'epigastric symptoms bloating': 1, 'LPF': 1, 'TIF 2.0': 3, 'Epigastric bloating': 3, 'bloating-type symptoms': 2, 'bloating and wind': 1, 'bloating and satiety': 1, 'epigastric fullness and bloating': 2, 'postprandial bloating discomfort': 1, 'bloating and/or distension': 2, 'FABD': 1, 'functional bloating and distension': 1, 'RHMD': 1, 'LHMD': 1, 'Bloating syndrome': 3, 'Postoperative gas/bloating': 1, 'G/B symptoms': 1, 'G/B': 1, 'nissen fundoplication': 2, 'chest coerces bloated': 1, 'bloating and discomfort': 1, 'bloat-': 1, 'postprandial bloating and fullness': 1, 'rumenal bloat': 1, 'FP': 2, 'post-FP': 2, "'Gas bloat' syndrome": 1, 'bloating/discomfort': 1, 'gut bloating': 4, 'Bloating &': 1, 'testicular bloating': 1, 'postprandial fullness/bloating': 5, 'or bloating': 3, 'Gas-bloat': 4, 'PCF': 1, 'bloating of the': 3, 'hypothalamic, syndromic) bloating': 1, 'bloating with': 1, 'Bloat/gas': 2, 'bloat/gas': 4, 'gastrointestinal bloat': 2, 'mSOFY': 1, 'excessive fullness/bloating': 1, 'bloating,': 4, 'functional bloating disorder': 1, 'Chronic bloating': 2, 'RF': 2, 'Bloating and': 9, 'Gas-bloat" syndrome': 1, 'bloating:4': 1, 'LF or': 1, 'cognitive bloat': 2, 'epigastric bloating and': 1, 'bloating reflux': 1, 'intestinal gas/bloating': 1, 'Gas/bloating': 2, 'swelling and bloat': 1, 'gas-bloat symptoms': 9, 'bloating C4': 1, 'Insufficiency of the fundoplication': 2, 'Bloated tummy': 1, 'Bloating - A': 1, 'Abdominal bloating symptom': 1, 'postprandial bloating and satiety': 1, 'Bloating Impairs Disease': 1, 'bloats': 4, 'c-TIF': 2, 'bloating complaints': 2, 'Bloating complaints': 1, 'Bloating bloated abdomen': 1, 'PLF': 1, 'fullness or bloating': 1, 'TCM clinical bloat disease': 1, 'bloat disease': 1, 'sLF': 1, 'fullness/bloating': 1, 'PPF': 2, 'gas /bloating': 2, 'Bloating - 4': 1, 'Functional bloating': 6, 'dysphagia gas bloat symptoms': 1, 'Abdominal bloating or gas': 2, 'wind and bloating': 1, 'bloated/swollen': 1, 'postprandial epigastric bloating': 3, 'Nissen or Toupet fundoplication': 2, 'Bloating Haemorrhoids': 1, 'bloating spoilage': 1, 'post-TIF': 3, 'PF': 1, 'AF': 1, "Nissen's fundoplication": 1, 'fundoplication incompetence': 1, 'cramps or bloating': 2, 'bloating.1': 3, 'bladder or rectal bloating': 1, 'post-fundoplication abnormalities': 2, 'LFP abnormalities': 1, 'fundoplication abnormalities': 2, 'Disrupted fundoplication': 1, 'LFP': 1, 'ENDOSCOPIC EVALUATION OF POST-FUNDOPLICATION ANATOMY': 1, 'bloated big toe': 1, 'Gas and Bloating': 5, 'TEMPO': 2, 'legume bloat': 3, 'postfundoplication bloating': 1, 'anal bloating': 1, 'Bloating Occasional diarrhea': 1, 'post-Nissen gas-bloat syndrome': 1, 'gas bloating symptoms': 2, 'Bloating episodes': 1, 'and Bloating': 2, "Gas-bloat' syndrome": 1, 'bloating/swelling': 1, 'bloat-ing': 2, 'postoperative gas-bloating syndrome': 1, 'distension or bloating': 3, 'bloating and gas-related symptoms': 1, 'bladder bloating': 1, 'gas bloat symptoms': 10, 'AB symptoms': 3, 'Gas-Bloat': 1, 'bothersome bloating symptoms': 1, 'Gas-Bloat Syndrome': 2, 'Post-Fundoplication': 1, 'Gas-bloat syndrome': 5, 'Bloating Pain': 2, 'bloating without': 1, 'and bloated': 1, 'pasture bloat disease': 1, 'post-Nissen LF': 1, 'post-LF': 1, 'Nissen LF': 1, 'BLOATING': 2, 'BLOATING SUBSCALE SCORE TO': 1, 'Bloating and/or distension': 1, 'bloating discomfort': 2, 'Gastrointestinal- bloat': 1, 'bloating/distention': 1, 'bloating and peristalsis disorders': 1, 'bloating/': 2, 'menstrual bloating': 1, 'hepatocyte bloating': 1, 'bloated feelings': 1, 'bleeding and bloating': 1, 'bloated-ness': 1, 'bloating"': 1, 'Rumen bloating': 1, 'FUNDOPLICATION ALONE': 1, 'FUNDOPLICATION': 1, 'Post-LNF complications': 1, 'post-LNF': 1, 'post-LNF complications': 1, 'painFeeling bloated': 1, 'gas or bloating': 7, 'Bloating 23': 1, 'Abomasal bloat': 4, 'D/B': 1, 'distension and bloating': 2, 'bloating sores': 1, 'Hill-fundoplications': 1, '/bloat': 1, 'bloating problem': 1, 'Pain Bloating Diarrhoea': 1, 'bloating like symptoms': 1, 'B/D': 1, 'bloating of viscera': 1, 'Bloating Cramping': 1, 'Feeling bloated 15': 1, 'bloating and tympani symptoms': 1, 'Bloating or distension': 2, 'Bloating and pain': 2, 'gastrointestinal (bloating': 1, 'Bloating, cramps': 1, 'SYM Bloating': 1, 'menstrual cramps""Bloating': 1, 'Bloating, ailments': 1, 'cramping or bloating': 1, 'post-fundoplication complications': 1, 'bloating and rumbling': 1, 'Nissen Fundoplication': 1, 'bloated]a': 1, 'post-prandial bloating': 8, 'pressure and bloating': 1, 'air bloat': 1, 'trouble with bloating': 1, 'bloating.7': 1, 'Bloating$': 1, 'Gastrointestinal bloating': 1, 'Bloating Bloating': 1, 'Bloating cluster': 1, 'Bloating 1': 1, 'Bloating,': 1, 'bloating or urinary symptoms': 1, 'bloating or swelling': 3, 'FGID-related bloating': 1, 'gas - bloating syndrome': 1, 'Pelvic bloating': 1, 'post-fundoplication obstruction': 1, 'Post-fundoplication dyspepsia': 1, 'Nissen Bloating': 1, '-Fundoplication': 1, 'Nissen Bloating PDS': 1, 'multi-fundoplication': 1, 'abdominal bloating symptom': 1, 'bloated sensations': 1, 'postprandial epigastric fullness/ bloating': 1, 'postprandial epigastric fullness/ bloating symptoms': 1, 'gas, bloating': 1, 'LSGFD': 1, 'bloating gas': 1, 'Postprandial bloating': 5, 'bloating related symptoms': 1, 'Sleeve-F': 1, 'bloating;1': 1, 'bloating of the arm': 1, 'pickle bloating': 1, 'Chronic bloat': 1, 'abdominal gas bloating': 1, 'gas & bloating': 1, 'DnB': 1, 'diarrhoea and bloat': 1, 'bloated pain': 1, 'HMF': 1, 'hypochondriac bloating': 1, 'bloating and gasses': 1, 'bloating/gas symptom': 1, 'abdominal bloating/gas': 1, 'bloat condition': 1, 'pain and bloating': 1, 'Dor fundoplication': 1, 'MNF.Conclusion': 1, 'gas bloating syndromes': 1, '-bloat': 3, 'bloating sensations': 1, 'Bloating or distention': 1, 'gall-bloat syndrome': 1, 'HMD': 2, 'Feel bloated': 3, 'psychogenic bloating': 1, 'bloated state': 1, 'bloating and cramping': 1, 'Bloated feeling': 2, 'Abdominal Symptoms of Bloating': 1, 'abdominal symptoms of bloating': 1, 'bloating and fullness': 2, 'GF': 1, 'Nissen, Heller and Dor and Toupet fundoplications': 1, 'Nissen, Dor and Toupet fundoplications': 1, 'frothy rumen bloat': 1, 'Frothy Bloat': 1, "'gas bloat' syndrome": 1, 'Bloating Sigmoid': 1, 'NF.A': 1, 'bloating in': 2, 'bloat-syndrome': 1, 'Bloating-related symptoms': 2, 'LF%': 1, 'gassy or bloated': 1, 'Bloating, upper quadrant pain': 1, 'bloated foot': 2, 'CLF': 1, 'bloating/fullness': 1, 'bloated nose': 1, 'postprandial bloating and': 1, 'facial bloating': 2, 'Dyspeptic fundoplication': 1, 'dyspeptic fundoplication': 1, 'bloating of bowel': 1, 'Feeling bloated': 4, 'bloating after': 1, 'Post-TIF': 1, 'bloating bloating': 1, 'Bloating Diabetes': 1, 'bloating disorder': 1, 'vacuole bloating': 1, 'bloating-symptoms': 1, 'stomach pain and bloating': 1, 'Fatigue Bloating Gastrointestinal': 1, 'bloat block': 1, 'bloating after eating': 1, 'bloating disorders': 1, 'ESF': 1, 'Bloating and cramping': 1, 'bloated and gassy': 1, 'bloated and': 1, '-Rossetti FP': 1, 'post prandial bloating': 1, 'bloated body': 1, 'rumen bloating': 1, 'Rumen bloat': 1, 'epigastric bloat symptoms': 2, 'bloated feeling in the': 1, 'abdominal gas or bloating': 1, 'Bloating 3': 1, 'sheep bloat': 1, 'Bloating and postprandial distress syndrome': 1, 'NRF': 1, 'bloating diarrhea': 1, 'gas bloat syndromeThe': 1, 'Bloating 7': 1, 'bloating satiety': 1, 'ELF': 1, 'nissen fundoplication".mp': 1, 'bloated symptoms': 1, 'Bloating Diarrhea': 1, 'Bloating-related symptom': 1, 'Bloating/Distension related': 1, 'clinical bloat': 1, "bloating'.1": 1, 'POEM-TIF': 1, "bloating':a": 1, 'Bloating pain Cramps': 1, 'Bloating Pain Cramps': 1, 'Post-FP': 1, 'bloating"[tiab': 1, 'Bloating Bowel problems': 1, 'Bloating and Gas': 1, 'pasture bloating disease': 1, 'gas or bloating of the stomach': 1, 'bloating cramps': 1, 'Gassiness and/or bloating': 1, 'acid bloating': 1, 'Gas and bloating symptoms': 1, 'gastrointestinal (GI) bloating': 1, 'Bloating and Diarrhea': 1, 'FUNDO': 1, 'GI + Bloat': 1, 'Nissen-type fundoplication': 1, 'FeverAbdominal bloating': 1, 'bloating-related symptoms': 1, 'pain/bloating': 1, 'hunger bloating': 1, 'distention bloating': 1, 'LM-PF': 1, 'bloating, discomfort': 1, 'Livestock bloating': 1, 'post-eating bloating': 1, 'bloating/cramping': 1, 'bloat-salivation': 1, 'feeling of bloating': 1, 'bloating.14': 1, 'functional bloating (': 1, 'FB) symptoms': 1, 'FB symptoms': 1, 'FB)': 1, 'bloatings': 1, 'Blue and Bloated syndrome': 1, 'LARS': 1, 'cTIF': 1, 'Bloating MID': 1, 'bloated feeling of': 1, 'bloated legs': 1, 'postoperative gas-bloat syndrome': 1, 'bloating and urgency': 1, 'LAPF': 1, 'thoracic bloating': 1, 'I NF': 1, 'PANF': 1, 'cramping and bloating': 1, 'postoperative gas bloat syndrome': 1, 'bloat complications': 1, 'RTF': 1}
|
bloating
|
Disease
|
MESH:C535648
|
{'Primary familial and congenitalpolycythemia': 1, 'PCP': 1, 'primary familial disease': 1, 'Primary or familial haemophagocytic;': 2, 'Familial primary amylosis': 1, 'primary or familial HLH': 1, 'PFCs': 2, 'primary familial hypomagnesaemia': 2, 'familial, multiple primary': 1, 'familial or primary HLH': 1, 'primary and familial lymphomas': 1, 'primary and familial dyslipoproteinaemias': 1, 'primary familial polycythaemia': 1, 'FMPC': 4, 'PFC': 2, 'FHpMD': 1, 'on the PFC': 1, 'Primary familial polycythaemia': 1, 'primary/familial HLH': 1, 'Familial or primary HLH': 1, 'Familial primary failureof': 1, 'primary familial hyperglyceridemia': 1, 'Primary or genetic Familial': 1, 'primary familial syndrome': 1, 'primary and familial hypertrigyceridemia': 1, 'familial primary hypoalphalipoproteinaemia': 1, 'FBT-PC': 1, 'Familial Primary Angle': 1, 'familial (primary': 1, 'primary non-familial hypercholesterolaemia': 1, 'primary familial hypercholesterolaemia': 1}
|
FMPC
|
Disease
|
MESH:C535650
|
{'GEP-NETs': 920, 'GEP-NET': 626, 'gastroenteropancreatic neuroendocrine tumors': 1021, 'GEP tumors': 69, 'GEP tumor': 11, 'gastroenteropancreatic (GEP) neuroendocrine tumors': 35, 'Gastroenteropancreatic Neuroendocrine Tumor': 14, 'GEP': 441, 'gastroenteropancreatic NECs': 13, 'gastroenteropancreatic (GEP) NETs': 70, 'gastroenteropancreatic NETs': 359, 'gastroenteropancreatic neuroendocrine neoplasms': 324, 'GEP-NEN': 263, 'GEP-NENs': 345, 'gastroenteropancreatic (GEP)-NETs': 38, 'gastroenteropancreatic neuroendrocrine tumors': 2, 'gastroenteropancreatic (GEP) neuroendocrine neoplasms': 20, 'gastroenteropancreatic (GEP) NET': 13, 'GEP NETs': 174, 'GEP NEN': 30, 'GEP NET tumors': 8, 'GEP NEC': 25, 'gastroenteropancreatic neuroendocrine neoplasm': 50, 'GEP NET': 137, 'GEP NECs': 24, 'GEP NENs': 54, 'gastroenteropancreatic tumors': 134, 'enteropancreatic NETs': 42, 'gastroenteropancreatic (GEP) NENs': 10, 'GEP-NET tumors': 11, 'Gastroenteropancreatic neuroendocrine tumors': 283, 'enteropancreatic disorders': 2, 'gastroenteropancreatic and bronchopulmonary neuroendocrine neoplasms': 1, 'GEP-NEC': 90, '3-GEP PLA': 1, 'pulmonary and gastroenteropancreatic neuroendocrine tumor': 1, 'P/GEP-NET': 1, 'lung and gastroenteropancreatic NET': 1, 'GEP/NETs': 1, 'gastroenteropancreatic neuroendocrine tumor diseases': 1, 'gastroenteropancreatic': 62, 'gastroenteropancreatic neuroendocrine': 8, 'GEP-NECs': 77, 'Gastroenteropancreatic neuroendocrine tumours': 49, 'gastroenteropancreatic neuroendocrine tumour': 19, 'GEPCs': 1, 'gastroenteropancreatic carcinomas': 5, 'Gastroenteropancreatic (GEP) neuroendocrine neoplasms': 12, 'gastroenteropancreatic neuroendocrine carcinomas': 44, 'gastroenteropancreatic (GEP)-NET': 16, 'gastroenteropancreatic, bronchopulmonary, or CUP-NET': 1, 'gastroenteropancreatic NET': 120, 'GEP-NETS': 41, 'gastroenteropancreatic (GEP)-NENs': 5, 'Gastroenteropancreatic Neuroendocrine Tumor Metastases': 1, 'gastroenteropancreatic (GEP) tumors': 27, 'Gastroenteropancreatic neuroendocrine (GEP-NET) tumors': 2, 'neuroendocrine neoplasms of the gastroenteropancreatic': 1, 'gastroenteropancreatic hormone': 1, 'gastroenteropancreatic and neuroendocrine tumors': 4, 'gastroenteropancreatic NENs': 37, 'enteropancreatic neuroendocrine tumors': 38, 'Gastroenteropancreatic Neuroendocrine Tumors': 159, 'gastroenteropancreatic neuroendocrine tumours': 180, 'Gastroenteropancreatic Neuroendocrine Tumours': 10, 'gastroenteropancreatic neuroendocrine tumor': 155, 'gastroenteropancreatic endocrine tumors': 40, 'Gastroenteropancreatic Endocrine Tumors': 1, 'Gastroenteropancreatic endocrine tumors': 10, 'GEP-ETs': 1, 'GEP ETs': 2, 'gastroenteropancreatic-neuroendocrine tumors': 18, 'GEP- and bronchial NETs': 1, 'GEP-tumors': 3, 'Gastroenteropancreatic tumors': 9, 'gastroenteropancreatic nuroendocrine tumors': 1, 'GEP neuroendocrine tumors': 12, 'enteropancreatic tumors': 25, 'Gastroenteropancreatic NEN': 2, 'bronchial and GEP-NETs': 2, 'GEP NETS': 6, 'gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic-NET': 4, 'gastroenteropancreatic and bronchial neuroendocrine tumors': 4, 'gastro-enteropancreatic neuroendocrine tumor': 4, 'Gastroenteropancreatic (GEP) endocrine tumors': 2, 'GEP-NET tumor': 12, 'enteropancreatic endocrine tumors': 9, 'gastroenteropancreatic neuroendocrine neoplasia': 15, 'gastroenteropancreatic neuroendocrine carcinoma': 33, 'GEP ET': 1, 'GEP-NEN disease': 4, 'gastroenteropancreatic or bronchopulmonary NETs': 1, 'GEP-NEN G-3': 3, 'GEPNETs': 49, 'GEP carcinomas': 3, 'Gastroenteropancreatic neuroendocrine neoplasms': 133, 'GEP-NENs tumor': 1, 'GEP-NENs tumors': 2, 'gastroenteropancreatic (GEP)-NEC': 2, 'enteropancreatic NET': 16, 'bronchial and gastroenteropancreatic NETs': 2, 'gastroenteropancreatic diseases': 4, 'GEP neuroendocrine neoplasms': 8, 'gastroenteropancreatic (GEP) neuroendocrine tumours': 4, 'gastroenteropancreatic tumor': 10, 'Gastroenteropancreatic neuroendocrine tumor': 23, 'GEP-A': 1, 'gastroenteropancreatic neuroendocrine neoplasms/tumors': 2, 'lung and GEP-NENs': 1, 'gastroenteropancreatic and lung NEN': 1, 'GEP-NEN lesions': 2, 'Gastroenteropancreatic Neuroendocrine Neoplasms': 77, 'Gastroenteropancreatic (GEP) NECs': 1, 'gastroenteropancreatic and lung NEC': 1, 'stage IV enteropancreatic NETs': 1, 'Enteropancreatic Neuroendocrine Tumors': 9, 'GEP-': 29, 'gastroenteropancreatic (': 5, 'GEP) NETS': 1, 'neuroendocrine gastroenteropancreatic (GEP) tumors': 5, 'GEP)': 2, '(GEP)-NENs': 4, 'GEP)-NENs': 1, 'gastroenteropancreatic (GEP) and': 1, 'neuroendocrine tumours of the gastroenteropancreatic system': 1, 'gastroenteropancreatic tract neuroendocrine tumors': 1, 'GEP endocrine tumors': 13, 'Gastroenteropancreatic (GEP) neuroendocrine tumors': 15, 'renal, colorectal, gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic (GEP)-NEN': 2, 'Gastroenteropancreatic neuroendocrine tumour': 2, 'gastroenteropancreatic neuroendocrine (including carcinoid) tumours': 2, 'Gastroenteropancreatic NETs': 30, 'GEP primary NET': 1, 'GEP primary NETs': 1, 'Gastroenteropancreatic neuroendocrine carcinomas': 10, 'enteropancreatic endocrine tumor': 2, 'Enteropancreatic tumors': 3, 'endocrine gastroenteropancreatic tumors': 3, 'gastroenteropancreatic NEC': 16, 'gastroenteropancreatic MiNEN tumors': 1, 'gastro-enteropancreatic neuroendocrine tumors': 11, 'gastroenteropancreatic disturbances': 1, 'gastroenteropancreatic (GEP) neuroendocrine tumor': 5, 'Gastroenteropancreatic (GEP) NETs': 14, 'Gastroenteropancreatic tumor': 3, 'Gastroenteropancreatic (GEP)-NET': 3, 'Enteropancreatic NET': 2, 'gastroenteropancreatic neuroendocrine neoplasias': 3, 'gastro-enteropancreatic NETs': 2, 'Neuroendocrine gastroenteropancreatic tumours': 4, 'lung NETs': 1, 'gastric and rectal NETs': 1, 'GEP-neuroendocrine tumors': 4, 'NETs': 3, 'midgut NETs': 1, 'enteropancreatic neuroendocrine': 3, 'gastroenteropancreatic [GEP]-NETs': 1, 'Neuroendocrine gastro-enteropancreatic tumors': 1, 'neuroendocrine gastroenteropancreatic tumors': 32, 'gastroenteropancreatic or lung NETs': 1, 'gastroenteropancreatic neuroendocrine (carcinoid) tumors': 2, 'hereditary gastroenteropancreatic neuroendocrine tumors': 1, 'pituitary and gastroenteropancreatic neuroendocrine tumors': 4, 'Gastroenteropancreatic Neuroendocrine Neoplasm': 5, 'GEPNEN': 4, 'Gastroenteropancreatic neuroendocrine neoplasia': 9, 'gastroenteropancreatic neuroendocrine tumors with liver metastasis': 1, 'GEP-NETLM': 1, 'GEP-NETLMs': 1, 'GEP-NENLM': 1, 'gastroenteropancreatic neuroendocrine tumors of the liver': 1, 'GNs': 1, 'GPET': 1, 'Gastroenteropancreatic neuro-endocrine tumors': 1, 'midgut Gastroenteropancreatic Neuroendocrine Tumours': 1, 'mGEP-NETs': 1, 'EGPT': 1, 'endocrine-gastroenteropancreatic tumors': 1, 'GEP Class-2': 1, 'gastroenteropancreatic and bronchopulmonary malignancies': 1, 'gastroenteropancreatic [GEP] NETs': 2, 'GEPNET': 18, 'GEP) NENs': 3, 'bronchial and gastroenteropancreatic neuroendocrine tumours': 2, 'gastroenteropancreatic (GEP) NECs': 5, 'gastroenteropancreatic neuroendocrine tumour disease': 1, 'NET G3 GEP': 1, 'GASTROENTEROPANCREATIC NEUROENDOCRINE TUMOR': 1, 'GEP class 1 tumors': 1, 'Neuroendocrine gastroenteropancreatic tumors': 7, 'enteropancreatic neuroendocrine tumours': 7, 'gastroenteropancreatic NET tumor': 2, 'lung carcinoid tumors;Gastroenteropancreatic and lung neuroendocrine tumors': 1, 'GEP-NETs of pancreas': 1, 'GEP- NETs': 6, 'gastrointestinal stromal and gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic and hepatobiliary neuroendocrine carcinoma': 1, 'gastro-enteropancreatic tumours': 3, 'gastro-enteropancreatic neuroendocrine tumours': 7, 'GEP neuroendocrine tumours': 4, 'Nonfunctioning Gastroenteropancreatic Neuroendocrine Tumors': 1, 'nonfunctioning gastroenteropancreatic neuroendocrine tumors': 1, 'neuroendocrine gastroenteropancreatic tumours': 6, 'gastro-enteropancreatic (GEP) NETs': 3, 'Hereditary neuroendocrine gastroenteropancreatic tumors': 2, 'gastroenteropancreatic and hepatobiliary neuroendocrine neoplasms': 1, 'neuroendocrine gastroenteropancreatic neoplasms': 1, 'Gastroenteropancreatic neuroendocrine (NET) cancers': 1, 'midgut and gastroenteropancreatic NETs': 4, 'Bronchopulmonary and Gastroenteropancreatic Neuroendocrine Neoplasms': 3, 'bronchopulmonary and gastroenteropancreatic neuroendocrine neoplasms': 4, 'bronchopulmonary and gastroenteropancreatic neuroendocrine tumour': 3, 'gastroenteropancreatic NE tumors': 1, 'Gastroenteropancreatic Large-Cell Neuroendocrine Carcinoma': 1, 'gastroenteropancreatic large-cell neuroendocrine carcinoma': 1, 'Gastroenteropancreatic (GEP)-NETs': 2, 'GEP neuroendocrine neoplasm': 2, 'neuroendocrine gastroenteropancreatic carcinomas': 2, 'mGEP-NEC': 1, 'GEP- and pulmonary NECs': 1, 'NECs of the GEP-tract': 1, 'gastroenteropancreatic G3 NET': 1, 'thyroid or gastroenteropancreatic neuroendocrine tumours': 1, 'GEPNENs': 5, 'gastroenteropancreatic-NETs': 10, 'WDGEPNET': 1, 'GEP-NETs tumor': 2, 'gastroenteropancreatic (GEP) endocrine tumors': 6, 'lung and gastroenteropancreatic neuroendocrine tumours': 1, 'neuroendocrine tumours of the gastroenteropancreatic tract': 2, 'GEP-Net': 1, 'GEP-Nets': 1, 'gastro-enteropancreatic (GEP) neuroendocrine carcinomas': 1, 'Gastroenteropancreatic neuroendocrine neoplam': 1, 'GEP-NT': 1, 'gastrointestinal, gastroenteropancreatic neuroendocrine tumors': 1, 'GEP-NETs of': 1, 'Gastroenteropancreatic Tumors': 1, 'pulmonary/gastro-enteropancreatic NETs': 1, 'gastroenteropancreatic and lung': 1, 'gastroenteropancreatic (GEP) neuroendocrine neoplasia': 2, 'enteropancreatic': 5, 'GEP lesions': 1, 'gastroenteropancreatic and lung neuroendocrine tumors': 2, 'gastroenteropancreatic neuroendocrine tumor (': 1, 'gastroenteropancreatic or bronchial neuroendocrine tumors': 3, 'GEP-NET) cancer': 1, 'lung and gastroenteropancreatic NETs': 5, 'Gastroenteropancreatic and lung NETs': 1, 'Sp-GEP-NEN': 1, 'gastroenteropancreatic, bronchopulmonary NET': 1, 'gastro-entero-pancreatic NET': 1, 'Gastroenteropancreatic and Bronchial Neuroendocrine Tumors': 1, 'Bronchial and gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic tract neuroendocrine neoplasms': 1, 'gastroenteropancreatic NE tumours': 1, 'Gastroenteropancreatic NET': 9, 'Gastroenteropancreatic (GEP) and bronchopulmonary (BP) neuroendocrine neoplasms': 1, 'GEP-NETin': 1, 'gastroenteropancreatic and bronchopulmonary tumors': 1, 'GEP-MENs': 1, 'GEP-NET of the': 1, 'NET) of the gastroenteropancreatic tract': 1, 'lung and gastroenteropancreatic (GEP) NEC': 1, 'gastroenteropancreatic (GEP) NEC': 2, 'GEP/NET': 3, 'GEP malignancies': 2, 'GEP-NENs metastases': 1, 'GEP- NENs': 2, 'GEP-NENS': 10, 'Nonfunctioning enteropancreatic NETs': 1, 'P-GEP': 1, 'gastroenteropancreatic and bronchopulmonary NETs': 2, 'gastroenteropancreatic-neuroendocrine neoplasms': 5, 'GEP-NENS BASED': 1, 'GEP-NENS WITH': 1, 'enteropancreatic G1/2 NETs': 1, 'GEP-NEN tumor': 10, 'bronchial and GEP NETs': 1, 'gastroenteropancreatic (GEP) carcinoma': 1, 'metastasized gastroenteropancreatic tumors': 2, 'endocrine enteropancreatic tumors': 2, 'gastro-enteropancreatic neuroendocrine neoplasms': 4, 'neuroendocrine tumors of the gastroenteropancreatic system': 2, 'bronchopulmonary and gastroenteropancreatic NET': 1, 'enteropancreatic neuroendocrine tumor': 6, 'gastroenteropancreatic Neuroendocrine tumors': 1, 'gastroenteropancreatic (GEP) neuroendocrine carcinomas': 3, 'gastroenteropancreatic (GEP': 4, 'gastroenteropancreatic NETS': 2, 'WD gastroenteropancreatic (GEP) NETs': 1, 'Gastroenteropancreatic neuroendocrine neoplasm': 10, 'GEP-NETs tumors': 2, 'GEP-NETs Tumors': 1, 'stage IV gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic well-differentiated neuroendocrine tumors': 2, 'GEP NETs liver metastases': 1, 'Rectal gastroenteropancreatic neuroendocrine tumors': 1, 'GEP-NET tumors in the': 1, 'GEP NET tumors in the': 1, 'gastroenteropancreatic and lung NETs': 5, 'NGEP-NENs': 1, 'NGEP': 1, 'non-gastroenteropancreatic tumors': 1, 'GEP and NGEP tumor': 1, 'NGEP-NEN': 1, 'tumors of gastroenteropancreatic neuroendocrine cells': 1, 'GEP-NEN G3': 3, 'gastroenteropancreatic or pulmonary NETs': 2, 'enteropancreatic tumor': 12, 'GEP neuroendocrine carcinomas': 7, 'pituitary, enteropancreatic neuroendocrine, and parathyroid tumors': 1, 'GEP-NEN neoplastic': 1, 'gastroenteropancreatic neuroendocrine tumor disease': 4, 'Neuroendocrine neoplasms of the gastroenteropancreatic system': 2, 'gastro-enteropancreatic neuroendocrine neoplasm': 1, 'GEP- NET': 2, 'bronchial and gastroenteropancreatic neuroendocrine tumors': 1, 'tumors of the gastroenteropancreatic tract': 1, 'Gastroenteropancreatic Neuroendocrine Carcinomas': 4, 'GEP Neuroendocrine Carcinomas': 1, 'Gastroenteropancreatic (GEP) Neuroendocrine Tumors': 2, 'Gastroenteropancreatic neuroendocrine carcinoma': 9, 'gastroenteropancreatic and lung neuroendocrine neoplasms': 2, 'mGEP-NEN': 1, 'Metastatic gastroenteropancreatic neuroendocrine neoplasms': 1, 'Neuroendocrine tumors of the gastroenteropancreatic system': 1, 'GEP) and bronchopulmonary tumors': 1, 'gastroenteropancreatic NEN': 17, 'gastro-enteropancreatic neuro-endocrine tumours': 1, 'gastroenteropancreatic-neuroendocrine tumours': 5, 'gastro-enteropancreatic': 2, 'bronchial neuroendocrine and gastroenteropancreatic tumors': 1, 'GEP-NET Tumors': 1, 'thoracic and gastroenteropancreatic NETs': 4, 'GEP-tumor': 1, 'Gastroenteropancreatic neuroendocrine neoplasias': 3, 'GEP 19': 1, 'GEP G3 NET': 1, 'GEP +': 1, 'Gastroenteropancreatic and Unknown Primary Neuroendocrine Tumors': 1, 'Gastroenteropancreatic and Unknown Primary NETs': 1, 'gastroenteropancreatic neuroendocrine and gastrointestinal stromal tumors': 1, 'GEP-NEN tumors': 4, 'gastroenteropancreatic (GEP)': 2, 'GastroEnteroPancreatic NeuroEndocrine Neoplasias': 1, 'gastroenteropancreatic (GEP)-MiNEN': 1, 'Gastroenteropancreatic-origin neuroendocrine carcinomas': 1, 'Gastroenteropancreatic- (GEP-) NET': 1, 'gastroenteropancreatic- (GEP-) NET': 1, 'GEPNETS': 3, 'neuroendocrine gastroenteropancreatic tumors': 1, 'gastroenteropancreatic malignancy': 1, 'Gastroenteropancreatic neuroendocrine Tumours': 1, 'Phaeochromocytoma Gastroenteropancreatic NET': 1, 'gastroenteropancreatic or bronchopulmonary (BP) NETs': 1, 'GEPNET neoplasms': 1, 'non-gastroenteropancreatic neuroendocrine tumors': 1, 'GEPNET tumors': 1, 'GEP-neuroendocrine carcinomas': 3, 'GEP-NEC.': 1, 'gastroenteropancreatic (GEP)-NETs tumors': 1, 'GEP-CUP-other-NET': 1, 'GEP-CUP-NET': 1, 'gastroenteropancreatic and lung NENs': 3, 'enteropancreatic lesions': 1, 'gastroenteropancreatic neuroblastic tumors': 1, 'gastro-enteropancreatic endocrine tumors': 2, 'Gastroenteropancreatic-neuroendocrine tumors': 2, 'gastroenteropancreatic tumor syndrome': 1, 'pituitary and gastroenteropancreatic neuroendocrine tumours': 1, 'GEP-NEN malignant disease': 1, 'neuroendocrine gastroenteropancreatic and bronchial tumors': 2, 'gastroeneteropancreatic (GEP) NENs': 1, 'gastroenteropancreatic, neuroendocrine neoplasms': 1, 'enteropancreatic (EP) neuroendocrine tumors': 1, 'thoracic and/or gastroenteropancreatic NETs': 1, 'Thoracic and/or Gastroenteropancreatic NETs': 1, 'Cutaneous metastasis of gastroenteropancreatic neuroendocrine tumors': 1, 'Cutaneous Metastasis of Gastroenteropancreatic Neuroendocrine Tumors': 1, 'Gastroenteropancreatic (GEP) tumors': 2, 'Gastroenteropancreatic Neuroendocrine tumor disease': 1, 'GEP G1 NET': 1, 'GEP-NET Malignancy': 1, 'Gastroenteropancreatic Neuroendocrine Neoplasia': 6, 'gastroenteropancreatic neuroendocrine lesions': 1, 'Gastroenteropancreatic Neuroendocrine Neoplasias': 1, 'GEP-NETs30': 1, 'Gastroenteropancreatic NENs': 7, 'Lung and gastroenteropancreatic (GEP) neuroendocrine tumours': 1, 'gastroenteropancreatic neuroendocrine (GEP) neoplasms': 1, 'enteropancreatic,': 1, 'neuroendocrine gastroenteropancreatic tumor': 1, 'GEP) NEN': 2, 'Gastroenteropancreatic Neuroendocrine Neoplasms1': 1, 'enteropancreatic neuroendocrine neoplasms': 1, 'Gastroenteropancreatic Neuroendocrine tumors': 2, 'gastro-enteropancreatic and pulmonary neuroendocrine tumors': 2, '-GEP': 3, 'GPNTs': 1, 'gastroenteropancreatic (GEP)-neuroendocrine tumors': 1, 'Gastroenteropancreatic neuroendocrine (carcinoid) tumors': 1, 'primary gastroenteropancreatic tumors': 1, 'GEP-nETs': 1, 'GEP- nETs': 1, 'tumors of the gastroenteropancreatic': 1, 'gastroenteropancreatic neuroendocrine tumors/carcinomas': 1, 'GEP- and bronchopulmonary NETs': 3, 'WDGEP ET': 1, 'gastroenteropancreatic endocrine tumor': 3, 'gastroenteropancreatic, lung, thymus,': 1, 'Gastroenteropancreatic NECs': 1, 'metastatic gastroenteropancreatic neuroendocrine tumours': 2, 'Gastroenteropancreatic NeuroEndocrine Tumors': 1, 'GEP)-NET': 2, 'pituitary and gastroenteropancreatic NETs': 1, 'GEP- neuroendocrine neoplasia': 1, 'gastroenteropancreatic NET disease': 2, 'GEP NEC 3': 1, 'GEP neuroendocrine carcinoma': 2, 'gastroenteropancreatic and bronchial NETs': 4, 'gastroenteropancreatic [GEP] NET': 1, 'GASTROENTEROPANCREATIC': 1, 'neuroendocrine tumors of the gastroenteropancreatic': 1, 'Neuroendocrine tumors of the gastroenteropancreatic': 2, 'GEP 79 T': 1, 'gastroenteropancreatic (GEP) lesions': 1, 'Extrahepatic gastroenteropancreatic NET': 1, 'GEP neoplasms1, 2': 1, 'GEP NET G3': 1, 'Neuroendocrine (NE) gastroenteropancreatic tumors': 1, 'NE gastroenteropancreatic tumors': 1, 'gastro-enteropancreatic neuroendocrine carcinomas': 1, 'metastases of gastroenteropancreatic tumors': 1, '3 gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic G3 NETs': 1, 'G3 NETs': 1, 'Neuroendocrine enteropancreatic tumors': 2, 'gastroenteropancreatic-neuroendocrine tumor': 2, 'Non-Functional Gastroenteropancreatic Neuroendocrine Tumors': 1, 'gastro-enteropancreatic NET': 3, 'GEP-NET G1': 1, 'Gastroenteropancreatic Neuroendocrine tumours': 1, 'neuroendocrine carcinomas of the gastroenteropancreatic and bronchial system': 1, 'Gastroenteropancreatic (GEP) neuroendocrine carcinomas': 2, 'gastroenteropancreatic neuroendocrine cell system': 1, 'gastroenteropancreatic (GEP) tumor': 2, 'gastroenteropancreatic tumor metastases': 1, 'GEP tumor metastases': 1, 'NEN of the gastroenteropancreatic': 1, 'gastroenteropancreatic neuroendocrine (GEP NET) tumors': 1, 'gastroenteropancreatic (GEP) NEN': 2, 'colorectal, hepatocellular and gastroenteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic and thoracic neuroendocrine tumors': 3, 'GEP-NET malignancies': 1, 'gastroenteropancreatic (GEP)-neuroendocrine tumours': 1, 'gastroenteropancreatic and bronchopulmonary neuroendocrine tumor': 1, 'gastro-enteropancreatic neuroendocrine (NET)': 1, 'Gastro-enteropancreatic neuroendocrine tumor': 2, 'gastroenteropancreatic (GEP) NETS': 1, 'gastroenteropancreatic neuroendocrine and pituitary tumors': 1, 'parathyroid and gastroenteropancreatic neuroendocrine tumors': 1, 'Neuroendocrine gastroenteropancreatic (GEP) tumors': 1, 'neuroendocrine GEP tumors': 2, 'gastroenteropancreatic and adrenomedullary neuroendocrine tumours': 1, 'gastroenteropancreatic neuroendocrine cancers': 6, 'GEP neuroendocrine tumor': 2, 'endocrine-active gastroenteropancreatic tumors': 1, 'MgC-GEP': 1, 'tumors of the gastroenteropancreatic endocrine': 1, 'GEP malignancy': 1, 'GEPNECs': 2, 'Gastroenteropancreatic Neuroendocrine Carcinoma': 8, 'GEP-MiNENs': 1, 'gastroenteropancreatic-NECs': 1, 'gastroenteropancreatic-NENs': 1, 'gastroenteropancreatic-MiNENs': 1, 'F-GEP-NENs': 1, 'GEP-/GI-NETs': 1, 'NF-GEP-NENs': 1, 'Enteropancreatic NETs': 2, 'gastroenteropancreatic or lung NEN': 1, 'metastases of gastroenteropancreatic neuroendocrine neoplasms': 1, 'Gastroenteropancreatic': 8, 'GEP- and BP-NETs': 1, 'lung and gastroenteropancreatic [GEP] NETs': 1, 'Primary gastroenteropancreatic NETs': 1, 'GEP-NETs metastases': 2, 'Gastroenteropancreatic (GEP) NENs': 1, 'Gastrointestinal Stromal and Gastroenteropancreatic Neuroendocrine Tumors': 1, 'gastroenteropancreatic lesions': 1, 'GEP Tumors': 1, 'pulmonary and gastroenteropancreatic neuroendocrine tumours': 1, 'GASTROENTEROPANCREATIC NEUROENDOCRINE TUMORS': 1, 'neuroendocrine gastro-enteropancreatic tumours': 3, 'gastro-enteropancreatic (GEP) tumours': 3, 'GEP tumours': 3, 'gastroenteropancreatic and thoracic NETs': 2, 'GEPs': 1, 'gastro-enteropancreatic endocrine tumours': 3, 'GEP-NETsSI-NETs': 1, 'GEP-NEC tumor': 2, 'endocrine GEP tumours': 1, 'malignant gastro-enteropancreatic (GEP) tumours': 1, 'NEN of GEP': 1, 'GEPET': 1, 'gastroenteropancreatic neuroendocrine foregut and midgut tumors': 1, 'lung and gastroenteropancreatic (GEP) neuroendocrine tumors': 1, 'gastro-enteropancreatic (GEP) neoplasms': 1, 'gastroenteropancreatic mixed neuroendocrine-non-neuroendocrine neoplasms': 2, 'endocrine gastro-enteropancreatic (GEP) tumours': 1, 'neuroendocrine GEP tumor': 1, 'bronchial and GEP NET': 1, 'GEP- and lung (large cell neuroendocrine carcinoma) NETs': 1, 'GEP- and lung NETs': 1, 'gastroenteropancreatic-(GEP-)NETs': 1, 'Gastro-Enteropancreatic Neuroendocrine Tumor': 1, 'Gastro-enteropancreatic neuroendocrine tumors': 1, 'gastroenteropancreatic neuroendocrine tumors;GFR': 1, 'gastroenteropancreatic and': 1, 'GEP) NETs': 1, 'gastroenteropancreatic well-differentiated neuroendocrine (carcinoid) tumors': 1, 'Gastroenteropancreatic well-differentiated neuroendocrine tumors': 1, 'Gastroenteropancreatic Well-Differentiated Neuroendocrine (Carcinoid) Tumors': 1, 'gastroenteropancreatic endocrine carcinoma': 2, 'gastroenteropancreatic and pulmonary NEN-G3 tumors': 1, 'gastroenteropancreatic and pulmonary NEN': 1, 'GENTs': 1, 'gastroenteropancreatic neuroendocrine liver metastasis': 1, 'Gastroenteropancreatic neuroendocrine liver metastasis': 1, 'Gastroenteropancreatic Neuroendocrine Diffuse Liver Metastasis': 1, 'GEP-PDNEC': 1, 'GEP-NEC tumors': 3, 'gastro-enteropancreatic neuro-endocrine': 1, 'gastroenteropancreatic (GEP)-NECs': 1, 'gastroenteropancreatic located neuroendocrine neoplasms': 1, 'Neuroendocrine Gastroenteropancreatic Tumors': 2, 'lung and gastroenteropancreatic neuroendocrine neoplasms': 2, 'lung and gastroenteropancreatic neuroendocrine tumors': 3, 'lung or gastroenteropancreatic NET': 1, 'metastases of gastroenteropancreatic (GEP) NET': 1, 'WDET': 1, 'gastroenteropancreatic, bronchopulmonary': 1, 'enteropancreatic lesion': 1, 'Gastroenteropancreatic Neuroendocrine neoplasms': 1, 'H-NENs': 1, 'gastroenteropancreatic and bronchopulmonary NET': 1, 'Gastroenteropancreatic (GEP) neuroendocrine tumours': 2, 'parathyroid, pituitary, adrenocortical, gastroenteropancreatic neuroendocrine': 1, 'gastroenteropancreatic neuroendocrine tumors': 1, 'GEP/P-NENs': 1, 'GastroEnteroPancreatic neuroendocrine tumor': 1, 'Gastroenteropancreatic- (GEP-) NENs': 1, 'gastro-enteropancreatic-neuroendocrine tumors': 1, 'Gastro-enteropancreatic neuroendocrine neoplasms': 2, 'GEPNET metastasis': 1, 'GEP-NENs tumorigenesis': 1, 'gastro-enteropan-creatic (GEP)-NET': 1, 'gastro-enteropancreatic (GEP) neuroendocrine tumors': 1, '-enteropancreatic': 1, 'gastro-enteropancreatic (GEP)': 1, 'GEP-neuroendocrine tumours': 1, 'malignant enteropancreatic tumor': 1, 'Gastroenteropancreatic and pulmonary neuroendocrine tumours': 1, 'non-neuroendocrine gastroenteropancreatic (GEP) cancer': 1, 'gastroenteropancreatic and pulmonary neuroendocrine tumors': 3, 'WD-NEC': 1, 'gastroenteropancreatic-neuroendocrine neoplasia': 1, 'Neuroendocrine tumours of the gastroenteropancreatic system': 1, 'G3-GEP-NECs': 1, 'Gastro-enteropancreatic neuroendocrine neoplasm': 1, 'Gastro-enteropancreatic Neuroendocrine neoplasm': 1, 'gastroenteropancreatic/rectal neuroendocrine tumor': 1, 'GEPNEC': 2, 'GEP- NECs': 2, 'GEP-NET-': 1, 'gastroenteropancreatic and bronchial neuroendocrine neoplasms': 2, 'Gastroenteropancreatic and Bronchopulmonary Neuroendocrine Tumors': 1, 'Enteropancreatic endocrine tumors': 1, 'Gastroenteropancreatic grade 3 neuroendocrine tumors': 1, 'GEP-NET disease': 3, 'gastroenteropancreatic and pulmonary neuroendocrine carcinomas': 1, 'GEP NEN G3': 2, 'GEP) NEC': 1, 'GEP WDNETs': 1, 'NETest': 1, 'GEP system tumors': 1, 'gastroenteropancreatic NETs.1': 1, 'thymic, bronchial and enteropancreatic neuroendocrine tumors': 1, 'thymic, bronchial, and enteropancreatic neuroendocrine tumors': 1, 'Gastro-enteropancreatic neuroendocrine tumours': 1, 'gastroenteropancreatic, bronchopulmonary, or genitourinary NETs': 1, 'gastroenteropancreatic neuroendocrine (carcinoid) tumours': 1, 'NECs': 1, 'Gastroenteropancreatic neuroendocrine carcinoma tumor': 1, 'Gastroenteropancreatic-NETs': 2, 'gastroenteropancreatic endocrine carcinomas': 3, 'GEP tract tumors': 2, 'gastroenteropancreatic malignancies': 3, 'Bronchopulmonary and Gastroenteropancreatic Neuroendocrine Tumours': 2, 'bronchopulmonary and gastroenteropancreatic neuroendocrine tumours': 2, 'GEP- and': 1, 'gep-nens': 1, 'gastro-enteropancreatic (GEP)-NENs': 1, 'gastroenteropancreatic and neuroendocrine neoplasm': 1, 'extra-GEP-NET': 1, 'Gastroenteropancreatic and Pulmonary Diseases': 1, 'gastro-enteropancreatic diseases': 1, 'gastroenteropancreatic endocrine system and related tumors': 1, 'gastroenteropancreatic and other neuroendocrine tumors': 1, 'GEP NET Gastroenteropancreatic neuroendocrine tumor': 1, 'gastroentero-pancreatic (GEP-NETs': 1, 'gastroenteropancreatic (GEP) malignancies': 1, 'sporadic thoracic and GEP-NETs': 1, 'GEP class 2 tumors': 1, 'Gastroenteropancreatic neuroendocrine tumor cancer': 1, 'gastroenteropancreatic neuroendocrine cancer': 3, 'gastroenteropancreatic-(GEP)-NENs': 1, 'enteropancreatic neuroendocrine carcinomas': 1, 'EP NECs': 1, 'Enteropancreatic (EP) neuroendocrine carcinomas': 1, 'GEP-NECs28': 1, 'GEP-NETs14': 1, 'GEP-NETs5': 1, 'GEP-NECs5': 1, 'GEP-NETs3': 1, 'GEP-NETs21': 1, 'gastroenteropancreatic (GEP) neuroendocrine carcinoma': 1, 'METASTATIC GEP-NEN': 1, 'GEP-NEN LMs': 1, '3 GEP-NENs': 1, 'neuroendocrine gastro-enteropancreatic tumors': 1, 'GEP infection': 1, 'NET of the gastroenteropancreatic system': 1, 'sporadic endocrine gastroenteropancreatic tumors': 1, 'Gastroenteropancreatic or Lung': 1, 'Neuroendocrine Neoplasms of Gastroenteropancreatic or Lung Origin': 1, 'gastroenteropancreatic region neuroendocrine neoplasms': 1, 'gastroenteropancreatic and thoracic neuroendocrine neoplasms': 1, 'GEP and bronchopulmonary (BP) NETs': 1, 'malignancies of the gastroenteropancreatic': 1, 'or gastroenteropancreatic system': 2, 'gastroenteropancreatic and thoracic (carcinoid) neuroendocrine neoplasms': 1, 'GEP/UK-NENs': 1, 'Gastroenteropancreatic neuroendocrine malignancies': 1, 'GEP-NEPs': 1, 'gastrointestinal enteropancreatic neuroendocrine tumors': 1, 'GastroEnteropancreatic Neuroendocrine Tumors': 1, 'metastatic gastroenteropancreatic (': 1, 'GEPNET)': 1, 'neuroendocrine (NE) gastroenteropancreatic (GEP) tumors': 1, 'thoracic and/or gastroenteropancreatic (GEP) NETs': 1, 'thoracic and gastroenteropancreatic neuroendocrine tumours': 1, 'gastroenteropancreatic (GEP) and bronchopulmonary (BP) tumors': 1, 'gastroenteropancreatic-neuroendocrine': 1, '-GEP-NET': 1, 'Gastro-enteropancreatic metastaticNeuroendocrine Tumor': 1, 'Gastro-enteropancreatic Neuroendocrine Tumor': 1, 'gastroenteropancreatic neuroendocrine carcinoma 19': 1, '(GEP) NENs': 5, 'Gastroenteropancreatic Neuroendocrine Tumor Disease': 2, 'pituitary and gastroenteropancreatic (GEP) NETs': 1, 'gastroenteropancreatic neuroendocrine (GEP-NENs) tumor': 1, 'GEP-18': 1, 'Gastroenteropancreatic (GEP) Tumors': 1, 'Gastroenteropancreatic GEP-NETs': 1, 'GEP neuroendocrine (well- and poorly-differentiated) neoplasms': 1, 'GEP- or lung-NETs': 1, 'gastroenteropancreatic (GEP)- or lung-NETs': 1, 'gastroenteropancreatic (GEP)- and lung-NETs': 1, 'GEP- and lung-NETs': 1, 'gastro-enteropancreatic system': 1, 'gastroenteropancreatic (GEP) or pulmonary NETs': 1, 'Gastroenteropancreatic-neuroendocrine carcinomas': 1, 'GEP)-': 1, 'neuroendocrine enteropancreatic tumors': 1, 'NEEPTs': 1, 'neuroendocrine GEP tumours': 1, 'neuroendocrine GEP-tumors': 1, 'Neuroendocrine tumours of the gastroenteropancreatic tract': 2, 'GEP -NET': 1, 'Gastroenteropancreatic tract': 1, 'NELM': 1, 'Gastroenteropancreatic and Neuroendocrine Liver Metastases': 1, 'SI-NET': 1, 'EP-NETs': 1, 'GEP or lung NETs': 1, 'lung, gastroenteropancreatic (GEP) NETs': 1, 'GEP-NET metastases': 4, 'Gastroenteropancreatic and Bronchopulmonary Neuroendocrine Neoplasia': 1, 'gastroenteropancreatic, bronchopulmonary and other neuroendocrine tumors': 1, 'non-functioning neuro-endocrine gastro-enteropancreatic tumours': 1, 'Non-functioning neuro-endocrine gastro-enteropancreatic tumours': 1, 'GEP-NET malignancy': 1, 'gastroenteropancreatic (GEP) -NETs': 1, 'GEP-NET carcinomas': 2, 'Gastroenteropancreatic endocrine (GEP) tumors': 1, 'gastroenteropancreatic and biliary tract NETs': 1, 'gastroenteropancreatic and pulmonary NETs': 3, 'GEP-NEN cancerogenesis': 1, 'gastroenteropancreatic neuroendocrine tumors and carcinomas': 1, 'gastroenteropancreatic (GP) NETs': 1, 'GP NETs': 1, 'esophageal or gastroenteropancreatic NEC': 1, 'GEP endocrine tumours': 2, 'gastro-enteropancreatic (GEP) endocrine tumours': 1, 'GEP-NEC.23': 1, 'Gastroenteropancreatic neuroendocrine/endocrine tumors': 1, 'Gastroenteropancreatic endocrine or neuroendocrine tumors': 1, 'pulmonary and gastroenteropancreatic NETs': 1, 'GEP-NET aggressiveness': 1, 'sporadic gastroenteropancreatic neuroendocrine tumours': 1, 'gastroenteropancreatic and bronchopulmonary NENs': 1, 'GEP-NET lesion': 2, 'Metastatic Gastroenteropancreatic Neuroendocrine Tumours': 1, 'adrenal, gastroenteropancreatic, and parathyroid tumors': 1, 'Pancreatic and gastrointestinal tract (GEP)-NENs': 1, 'GEP-NENs liver metastases': 1, 'pancreatic NETs': 1, 'lung and gastroenteropancreatic (GEP) NETs': 1, 'Gastroenteropancreatic Neuroendocrine Neoplasms 2019': 1, 'gastroenteropancreatic mixed neuroendocrine-non-neuroendocrine neoplasm': 1, 'gastroenteropancreatic (GEP) and L-NETs': 1, 'GEP- and lung-NET': 1, 'gastro-enteropancreatic (GEP) tumors': 1, 'GEP-neuroendocrine neoplasm': 1, 'gastroenteropancreatic (GEP)-neuroendocrine neoplasm': 1, 'GEP-neuroendocrine neoplasms': 1, 'enteropancreatic neuro-endocrine tumors': 1, 'GEP gastroenteropancreatic': 2, 'gastroenteropancreatic NET lesions': 1, 'gastrointestinal tract - gastroenteropancreatic (GEP) neuroendocrine neoplasms': 1, 'adrenal, and enteropancreatic tumors': 1, 'Gastroenteropancreatic (GEP)-NENs': 2, 'GASTROENTEROPANCREATIC NETS': 1, 'non-gastroenteropancreatic NETs': 1, 'midgut or GEP-NETs': 1, 'neuroendocrine tumors of gastroenteropancreatic tract': 1, 'GEP tract tumor': 1, 'GEP G3 NETs': 1, 'GEP NELMs': 1, 'GEP NELM': 1, 'neuroendocrine gastroenteropancreatic and bronchial tumours': 1, 'Gastroenteropancreatic Neuroendocrine Tumor Metastasis': 1, 'Gastroenteropancreatic neuroendocrine': 1, 'Gastroenteropancreatic-Neuroendocrine Neoplasms': 2, 'thoracic/GEP NETs': 1, 'GEP-malignancies': 1, 'gastroenteropancreatic and pulmonary endocrine tumors': 1, 'GEP-NETs in the pancreas': 1, 'gastroenteropancreatic-neuroendocrine (GEP-NE) cancer': 1, 'GEP-NE tumors': 1, 'gastroenteropancreatic and bronchial NET': 1, 'gastroenteropancreatic-neuroendocrine neoplasm': 2, 'Gastroenteropancreatic and Lung Neuroendocrine Tumors': 1, 'GEP-)NETs': 1, 'gastroenteropancreatic-(': 1, 'GEP NEC tumor': 1, 'GEP NEN tumor': 1, 'NET': 1, 'gastroenteropancreatic and pulmonary neuroendocrine tumours': 1, 'Gastroenteropancreatic and Pulmonary Neuroendocrine Tumors': 1, 'gastroenteropancreatic) NETs': 1, 'tumors of the parathyroid, pituitary, and GEP-NENs': 1, 'gastroenteropancreatic tumors.38': 1, 'GEP -': 1, 'gastroenteropancreatic, bronchopulmonary NETs': 1, 'bronchopulmonary and gastroenteropancreatic neuroendocrine tumor': 1, '-differentiated gastroenteropancreatic (GEP) neuroendocrine tumors': 1, 'gastroenteropancreatic, lung and other NETs': 1, 'GEP-NEC tumours': 1, 'mGEP-NET': 1, 'gastroenteropancreatic MiNEN': 1, 'GEP-MiNEN tumors': 1, 'GEP-MiNEN': 1, 'Gastro-enteropancreatic': 1, 'GEP-NETs metastasis': 1, 'GEP NENS': 1, 'GEP NETLM': 1, 'gastroenteropancreatic (GEP) neuroendocrine tumors with liver metastases': 1, 'thoracic or gastroenteropancreatic neuroendocrine tumors': 1, 'GPNETs': 1, 'Gastroenteropancreatic (GEP) neuroendocrine neoplasm': 1, 'pancreatic GEP-NETs': 1, 'Pediatric gastroenteropancreatic neuroendocrine tumor': 1, 'Metastatic gastroenteropancreatic neuroendocrine tumours': 1, 'neuroendocrine gastroenteropancreatic and intrathoracic tumors': 1, 'Gastroenteropancreatic neuroendocrine tumor G3': 1, 'GEP-NET G3': 1, 'bronchial or GEP NETs': 1, 'pulmonary or gastroenteropancreatic NET': 1, 'pulmonary or gastroenteropancreatic (GEP) neuroendocrine tumors': 1, 'Pulmonary and Gastroenteropancreatic Neuroendocrine Tumors': 1, 'pulmonary and gastroenteropancreatic neuroendocrine neoplasms': 1, 'pulmonary or gastroenteropancreatic neuroendocrine tumors': 1, 'pulmonary and gastroenteropancreatic neuroendocrine tumors': 2, 'enteropancreatic heterotopia': 1, 'GEP-NEN metastases': 2, 'GEP endocrine carcinomas': 1, 'GEPNTs': 1, '(GEP': 1, 'NEN-GEP': 1, 'enteropancreatic neuroendocrine neoplasia': 1, 'GEP- NEN': 1, 'WD-GEP-NEN': 1, 'gastro-enteropancreatic tumors': 1, 'gastroenteropancreatic (GEP) and pulmonary neuroendocrine tumors': 1, 'gastroenteropancreatic endocrine (GEP) tumors': 1, 'LM-NET': 1, 'gastroenteropancreatic/GEP tumors': 1, 'Gastroenteropancreatic Neuroendocrine Malignancies': 1, 'gastroenteropancreatic (GEP) neuroendocrine tumors (NET) tumors': 1, 'GEP neuroendocrine carcinomas (NEC) tumors': 1, 'lung and GEP NENs': 1, 'GEP NET': 1, 'lung and gastroenteropancreatic (GEP) NENs': 1, 'Gastroenteropancreatic neuroendocrine neoplasms grade 3': 2, 'GEP-NEC G3 tumor': 1, 'gastroenteropancreatic neuroendocrine neoplasms grade 3': 2, 'gastroenteropancreatic neuroendocrine neoplasms1': 1, 'Gastroenteropancreatic neuroendocrine neosplasms': 1, 'gastroenteropancreatic or lung NET': 1, 'GEP/NEN neoplasms': 1, 'Neuroendocrine gastroenteropancreatic tumor': 1, 'gastroenteropancreatic low-': 1, 'benign gastroenteropancreatic tumors': 1, 'gastroenteropancreatic or thoracic NETs': 1, 'GepNETs': 1, 'gastroenteropancreatic and hepatobiliary tumors': 2, 'gastroenteropancreatic and bronchopulmonary neuroendocrine tumors': 1, 'GEP- or pulmonary NETs': 1, 'GEP-HG-NEC': 1, 'GEP-neuroendocrine cancers': 1, 'gastroenteropancreatic high grade neuroendocrine carcinoma) of rectum': 1, 'gastroenteropancreatic neuroendocrine tumor G3': 1, 'GEP carcinoma': 1, 'Gastroenteropancreatic (GEP) neuroendocrine neoplasia': 1, 'GEP-NEN liver metastases': 1, 'gastroenteropancreatic NET liver metastasis': 1, 'gastroenteropancreatic (GEP-) NETs': 1, 'GEP-NET G-3': 1, 'gastroenteropancreatic and pulmonal NET': 1, "GEP-NET's": 1, 'GEP - NET': 1, 'GastroEnteroPancreatic NeuroEndocrine Tumors': 1, 'gastroenteropancreatic, thyroid, and bronchopulmonary NETs': 1, 'Gastroenteropancreatic-Neuroendocrine Tumor': 1, 'gastroenteropancreatic NETs.177Lu dotatate': 1, 'gastroenteropancreatic and gynecologic neuroendocrine neoplasms': 1, 'Tumors of the gastroenteropancreatic (GEP) tract': 1, 'Gastroenteropancreatic neuro-endocrine carcinomas': 1, 'GEP- NETS': 1, 'thyroid, gastroenteropancreatic and hepatobiliary tumors': 1, 'GEP-PDNECA': 1, 'gastroenteropancreatic -poorly differentiated neuroendocrine carcinoma': 1, 'gastroenteropancreatic neuroendocrine tumors/neoplasms': 1, 'GEP class 2 tumor': 1, 'GEP class 1 tumor': 1, 'Primary Gastroenteropancreatic Neuroendocrine Tumors and Metastases': 1, 'GEP (gastroenteropancreatic)-NET': 1, 'Non-gastroenteropancreatic NETs': 1, 'Gastroenteropancreatic (GEP)-NECs': 1, 'GEP-NETs of the midgut': 1}
|
gastroenteropancreatic neuroendocrine tumors
|
Disease
|
MESH:C535651
|
{'gastrocutaneous fistula': 258, 'GCF': 26, 'Gastrocutaneous fistula': 42, 'gastrocutaneous fistulas': 45, 'gastrocutaneous and duodenocutaneous fistula': 1, 'Gastrocutaneous fistulas': 17, 'gastrocutaneous fistulae': 17, 'gastrocutaneous': 4, 'Gastrocutaneous Fistula': 14, 'gastrointestinal or gastrocutaneous fistulas': 1, 'GC fistulas': 2, 'gastrocutaneous (GC) fistulas': 2, 'gastrocutaneous (GC) fistula': 2, 'gastrocutaneous fistulation': 1, 'GCFs': 3, 'colo-gastrocutaneous fistula': 2, 'GC fistula': 2, 'gastrocutanous fistula': 2, 'gastrocutaneous and jejunocutaneous fistulas': 1, 'Gastrocutaneous reflux': 1, 'Chronic gastrocutaneous fistula': 2, '- and gastrocutaneous fistulas': 1, 'Gastrocutaneous fistulae': 4, 'gastrocutaneous or esophageal fistulas': 1, 'Gastrocutaneous and/or duodenocutaneous fistulas': 1, 'gastrocutaneous or colocutaneous fistulas': 1, 'gastrocutaneous leak': 1, 'pGCF': 1, 'gastrocutaneous (GC) fistulae': 1, 'GC fistulae': 1, 'Gastrocutaneous Fistulae': 1, 'LGCF': 1, 'gastrocutaneous/duodenocutaneous fistula': 1, 'thoracic gastrocutaneous fistula': 1, 'TGCF': 1, 'esophagopleural and gastrocutaneous fistulas': 1, 'pancreatico-gastrocutaneous fistulae': 1, 'pancreatico-gastrocutaneous fistula': 1, '-gastrocutaneous fistula': 1, 'postoperative gastrocutaneous fistula': 1, 'infected gastrocutaneous fistulas': 1}
|
gastrocutaneous fistula
|
Disease
|
MESH:C535652
|
{'Bellini': 4, "Bellini's carcinoma": 8, 'Bellini carcinoma': 13, 'Bellini duct carcnoma': 1, 'BD': 6, 'Bellini duct carcinomaIHC': 1, 'Bellini carcinomas': 4, "Bellini's opera": 1, 'Rimoldi': 1, 'Ductus Bellini carcinoma': 1, 'Carcinoma of Bellini': 1, 'carcinoma of Bellini': 1, 'BELLINI III': 1, 'BELLINI': 2, 'Bellini Carcinoma': 2, 'Bellini duct': 1, 'of Bellini deposits': 1, 'duct of Bellini': 2, "Bellini's": 1, "Bellini's duct lesions": 1, 'ductus Bellini carcinomas': 1, "Bellini's)": 1, 'Verdi and Bellini operas': 1, 'Bellini disease': 1, 'CB': 1, 'Bellini Duct': 1, 'bellini carcinoma': 1, "Bellini's carcinomas": 2, 'Ductus-Bellini carcinoma': 1}
|
Bellini carcinoma
|
Disease
|
MESH:C535653
|
{'COSTA RICA': 41, 'CoSta': 1, 'Costa': 58, 'DCC': 1, 'Acrokeratoelastoidosis': 46, 'AKE': 15, 'degenerative collagenous plaques of the': 3, 'Degenerative collagenous plaques of the': 2, 'ANGELO DA COSTA LIMA': 1, 'acrokeratoelastoidosis lichenoides': 3, "Costa's syndrome": 4, 'Plaque Psoriasis of the Hands and Feet': 2, 'Costa fracture': 2, 'Degenerative Collagenous Plaque': 1, 'acrokeratoelastoidosis Costa': 2, 'collagenous plaques': 7, 'Moreau-Costa- Bartani': 1, 'Degenerative collagenous plaques': 5, 'acrokeratoelastoidosis': 58, 'Costa Rica': 52, 'COSTA': 53, 'CR': 14, 'costa fractures': 9, 'costa rica': 19, 'CRD': 3, 'collagenous plaques of hands': 1, 'CRELES': 1, 'degenerative collagenous plaques of the hands': 2, 'acrokeratoelastoidosis of Costa': 3, 'collageneous plaques of the hand': 1, 'costae': 1, 'Richier-Costa-Periera syndrome': 1, 'UMBILICALIS DA COSTA': 1, 'costa': 14, 'Degenerative collagenous plaques of the hands': 1, 'COSTA ROMANTICA': 1, 'COSTAS': 1, 'costa deformity': 1, 'the costae and': 1, 'costa deformities': 1, '-rape-in-costa-blanca': 1, 'costa brava': 1, 'Costa_Rica': 1, 'acrokeratoelastoidosis lesions of the': 1, 'CEMPH': 4, 'and elastotic marginal plaques of the hands': 1, 'Costae': 2, "Costa's acrokeratoelastoidosis": 3, 'CRI': 1, 'CRCC': 1, 'COSTA SYNDROME': 2, 'unilateral acrokeratoelastoidosis': 1, 'transverse costa': 1, 'AK': 1, 'Costas': 12, 'Collagenous Plaques': 1, 'Costa-Bartani': 2, 'Costa rica': 9, 'Costa-rica': 1, 'collagenous fibrous plaques': 1, 'CRC': 1, 'Collagenous and elastotic plaques': 1, 'Unilateral acrokeratoelastoidosis': 1, 'fractures of costa 1 or 2': 1, 'costa atlantica': 1, 'Costa Concordia wreck': 1, 'Acrokeratoelastoidosis of the Foot': 1, 'plaque psoriasis of the hands and feet': 1, 'Chronic plaque psoriasis of the Hands and feet': 1, 'Costa AN': 1, "costa rica's": 1, 'acrokeratoelastoidosis-like lesions': 1, 'Costas Charitidis': 1, 'Richeiri-Costa Syndrome': 1, 'costae fracture': 1, 'Costa-Paz type 2': 1, 'Costa-Paz II-III': 1, 'Costa-Paz type 1 of the': 1, 'Acrokeratoelastoidosis marginalis': 1, 'acrokeratoelastoidosis marginalis': 1, 'Costa acrokeratoelastoidosis syndrome': 1, 'Costa acrokeratoelastoidosis': 1, 'INBIOCRI COSTA': 1, 'Elytral costae': 1, 'INBIOCRI COSTA RICA': 3, 'nas cirurgias desencadeia dores nas costas': 1, 'CCSS': 2, 'Costae spuriae': 1, 'Caput costae': 1, 'CRA': 1, 'swelling of the costa': 1, 'Swelling of costa': 1, 'of the costa': 1, 'CO - costa': 1, 'guarda costa': 1, 'collagen plaques': 2, 'Moreau-Costa-Bartani': 1, 'Costa and McRae': 2, 'punctate palmoplantar keratoderma type 3': 2, 'Costa Concordia disaster': 1, 'Costa Concordia': 1, 'angulus costae': 1, 'COSTAS STEFANIS': 2, 'nas costas Cirurgico': 1, 'fractures of costae': 1, 'collagenous plaque': 1, 'DA COSTA': 1, 'CA-A': 1, 'CA': 1, 'rachis-costa': 1, '-costa': 1, 'COSTA-H': 1, 'Costa Filho LC': 1, 'collum costae': 1, 'costa cervicalis': 2, 'Costas Stefanis': 1, 'Epicardial collagen plaques': 1, 'costa defect': 1, 'spinose costa': 1, "Costa's Syndrome": 3, 'Acrokeratoelastoidosis of Costa': 2, 'Costas acrokeratoelastoidosis': 1, 'collagenous and elastotic marginal plaques': 1, 'Collagenous and elastotic marginal plaques': 1, 'dor nas costas': 1, 'CoSTA': 1, 'atripes Costa, 1884': 1, 'Punctate PPK type 3': 1, 'collagenous plaques of the hands': 1, 'Costa cervicalis': 1, 'Costa MAC': 1, 'COSTA COUNTIES': 1, "Costa's acrokeratoelastosis": 1, 'collagen fibrous plaque': 1, 'Forewing costa': 1, 'CP': 1, 'acrokeratoelastoidosis lichenoides of Costa': 1, 'degenerative collagenous plaques': 2, 'nas costas': 1, 'Collagenous and elastotic marginal plaques of the hands': 2, 'COSTA COUNTY': 1, 'Collagenous and elastotic marginal plaques of the hand': 1, 'Castro-costa': 1, 'Costa Viola': 1, 'Costae colpi': 1, 'Costa SS': 1, 'Fibrous collagenous plaque': 1, 'costa fracture': 1, 'COSTa': 1, 'Palmoplantar 3': 1, 'Costa CH': 1, 'costa rica pentatomid stinkbugs': 1, 'APHYTIS COSTA-LIMAI': 1, 'CR-2': 1, 'CCD': 1, 'Plaque of the Hand': 1, 'dor cronica nas costas': 1, 'Claudia Costa': 1, 'fracture of right costae': 1, 'Degenerative collagenous plaque': 1}
|
Costa
|
Disease
|
MESH:C535655
|
{'acromegaloid': 144, 'SWAP': 3, 'FULL-THICKNESS MYOTOMY': 1, 'TF': 2, 'APPEARANCE': 19, 'mGCIPLT': 1, 'thickness tissue loss': 2, 'BF': 38, 'appearance': 66, 'CT': 402, 'mCT': 2, 'LCT': 10, 'injuries that appear in the': 1, 'acromegaloidism': 21, 'Acromegaloid': 38, 'Acromegaloidism': 8, 'acromegaloidism"': 1, 'dysmorphic facial appearance': 91, 'TD': 3, 'lip mucosa': 28, 'glaucomatous appearance': 15, 'fibroxanthoma of the lip mucosa': 1, 'FT': 40, 'DPT': 12, 'Glaucomatous-appearing': 1, 'glaucomatous-appearing': 4, 'AP': 3, 'abnormalities for cortical thickness': 1, 'impaired facial appearance': 3, 'abnormalities of CT': 1, 'appear': 1, 'thick': 38, '-thickness': 6, 'DT': 1, 'erythema of the lips and oral mucosa': 43, 'SFT': 1, 'oral mucosa/lip abnormalities': 1, 'full-thickness injury': 1, 'FT injuries': 1, 'FT injury': 3, 'Cushingoid appearance': 12, 'atrophic facial appearance': 1, 'GT': 14, 'thickness reduction': 8, 'ET': 7, 'PT': 12, 'AT': 7, 'thick palate': 6, 'BFT': 22, 'ROUTINE STAINS FOR THICK': 1, 'thick-billed murre': 13, 'KT': 6, 'decreased cortical thickness': 2, 'NAWM': 8, 'APPEARING AFTER': 2, 'UCT': 3, 'CST': 32, 'MxT': 1, 'Thick': 32, 'thick bile syndromes': 1, 'conditions of the oral mucosa': 3, 'reduction in cortical thickness': 2, 'abnormal facial appearance': 13, 'MCT': 8, 'Thickness': 54, 'CT abnormalities': 18, 'Thickness Abnormalities': 1, 'APPEAR': 4, 'acromegaloid facial appearance syndrome': 6, 'Thick-billed murres': 6, 'BF-EBV': 1, 'the thick': 1, 'thickness abnormalities': 19, 'unhappy with appearance': 1, 'Unhappy with appearance': 2, 'CTh abnormalities': 7, 'thickness': 59, 'appearance defect': 2, 'abnormal cortical thickness': 4, 'partial-thickness Injury': 1, 'LTH': 1, 'Retention cysts of the lip mucosa': 1, 'VT': 6, 'TC': 2, 'WALL THICKNESS': 6, 'thick hyperkeratosis': 2, 'Oral mucosa of upper lip': 1, '-thickness defect of': 1, 'LT': 13, 'ATC': 1, 'CSFT': 3, 'appearance in': 1, 'OA': 9, 'Orofacial appearance': 3, 'IUCT': 2, 'THICKNESS': 47, 'altered facial appearance': 2, 'NORMAL-APPEARING': 1, 'FAT': 1, 'cortical thickness': 6, 'Cortical Thickness': 9, 'CT alterations': 1, 'thickness (': 2, 'CT) abnormalities': 2, 'THK': 3, 'defects in facial appearance': 1, 'disturbances in facial appearance': 1, 'popeyed appearence': 1, 'BT': 21, 'thick gruel': 1, 'anxious appearance': 8, 'HAM': 1, 'ST': 9, 'thick lower lip': 3, 'pigmentary disorder of the lips, oral mucosa, and fingers': 1, 'lips and oral mucosa': 1, 'ABFT': 1, 'Abnormal facial appearance': 2, 'acromegaloid facial appearance': 10, 'acromegaloid facial': 1, 'FT SSP': 1, 'facial appearance': 7, 'A-C': 1, 'BFT ware': 1, 'appearance concerns': 2, 'appearance defects': 4, 'APPEARING': 6, '-thickness (FT)': 1, 'Thickness swelling': 10, 'TS': 41, 'THICK': 3, 'appearing': 8, 'melanotic pigmentation of lips and oral mucosa': 1, 'thick sauce': 3, 'thick bile syndrome': 2, 'TM': 1, 'abnormal cortical thickness and': 1, 'Steel Thickness': 1, 'acromegaloid facial features': 6, 'AFF': 1, 'the lower lip mucosa': 1, 'dysmorphic facial appearances': 9, 'SST': 4, 'FL': 1, 'Thick filum terminale': 1, 'glaucomatous appearing': 2, 'Glaucomatous appearing': 1, 'II Thick': 1, 'HISTOPATHOLOGICAL APPEARANCE': 5, 'Lentiginosis of the lips and oral mucosa': 1, 'dry lip and mucosa': 1, 'lip and mucosa': 1, 'C.Th': 1, 'ThC': 1, 'AC': 6, 'TNU': 1, 'NIT': 4, 'tox': 1, 'thick-billed murres': 17, 'syndromic facial appearance': 1, 'cortical thickness abnormalities': 17, 'MT': 11, 'Erythema of the lips and oral mucosa': 1, 'SSSF': 1, 'thick salivation': 1, 'CT reduction': 8, 'abnormalities of cortical thickness': 6, 'Jugal mucosa Palate Lip': 1, 'acromegaloid fascies': 1, 'TFM': 5, 'CPT': 7, 'FULL-THICKNESS': 2, 'CTh loss': 3, 'CV Thickness': 1, 'appearance and appearance': 1, 'TCK': 1, 'HT': 8, 'pigmented macules on the lips and buccal mucosa': 1, 'Thick n': 1, 'TA': 4, 'CMT': 11, 'THICKNESSES': 2, 'TH': 12, 'swelling of the buccal mucosa of the lower lip': 1, 'Elevated facial appearance concern': 1, 'MPT': 1, '-thickness (FT) burns': 2, 'LT defects': 1, 'LT defect': 1, 'FTE': 1, 'ASI-R': 2, 'ASI-R.': 1, 'APPEARED': 2, 'disorder of the thick': 1, 'NT': 2, 'Th': 1, 'compromised facial appearance': 1, 'Appearance': 9, 'Te': 1, 'MNT': 1, 'shame with appearance': 2, 'shame of appearance': 2, 'SAQ': 5, 'PCD injury': 1, 'PCD': 1, 'thick chart syndrome': 3, 'lip and oral mucosa': 3, 'TRANSVERSE THICKNESS CALCULATION': 1, 'ILLNESS APPEARING': 1, 'BRAND': 2, 'NTL': 1, 'erythema of oral mucosa and lips': 3, 'appearance dissatisfaction': 3, 'IMT': 3, 'appearance damage': 1, 'GYNAECOMASTIA APPEARED': 1, 'CORTICAL THICKNESS': 5, 'premalignant condition of oral mucosa': 1, 'premalignant conditions of oral mucosa': 2, 'APPEAR TO': 2, 'CTH': 8, 'thick philtrum': 1, 'erythema of the oral mucosa, lips, and tongue': 5, 'pigmentation of lip and buccal mucosa': 1, 'PMT': 2, 'BGT': 1, 'Thick-billed murre': 3, 'hypoplastic appearance': 2, 'SS': 2, 'hyperpigmentation of oral mucosa and lips': 2, 'thick lips': 7, 'thick saliva': 9, 'Thick saliva': 1, '-thickness and': 1, 'CAPTIVE FLOCK OF THICK-BILLED PARROTS': 1, "Mucosa of lower lip','C00.5": 1, 'Mucosa of lip': 1, 'appeared in': 1, 'POST-MORTEM APPEARANCE': 1, 'lip or oral mucosa': 1, 'TTAI': 1, 'pain of the lips and oral mucosa': 1, 'acromegaloid facial appearance (AFA) syndrome': 5, 'AFA': 8, 'thicking': 1, 'GA': 3, 'UBFT': 1, 'IVST': 1, 'Cavitation appearence': 1, 'Buccal mucosa and lip': 1, 'anomalies of cortical thickness': 1, 'supraspinatus partial-thickness': 1, 'thick-': 5, 'erythematous appearing lesion': 1, 'BKFT': 1, 'Appear': 1, 'loss of CT': 1, 'abnormalities in cortical thickness': 5, 'Pigmentation of lips and buccal mucosa': 1, 'thickeness': 3, 'Subfield Thickness': 1, 'Backfat Thickness': 2, 'backfat thickness': 2, 'Lip mucosa': 7, 'PFT': 2, 'inflammatory condition of the oral mucosa': 3, 'SKIN THICKNESS': 2, 'erythema of lips and oral mucosa': 7, 'oral mucosa and lip': 2, '-appearing lesions': 4, 'Anxious Appearance': 2, 'Anxious appearance': 1, 'WA': 2, 'CI': 1, 'FAMILIAL APPEARANCE': 1, 'appear disability': 1, 'FTM': 1, 'SFTM': 2, 'Impairment of appearance': 1, 'acromegalic appearance': 2, 'STAN': 1, 'LAD': 8, 'WALL-THICKNESS': 1, 'AI': 6, 'Carcinoma of the oral mucosa or lip': 1, 'Thick smog': 2, 'LBT': 1, 'swelling of the lip mucosa': 1, 'Thick fur': 2, 'Appearance intolerance': 2, 'partial-thickness (cutaneous) defects': 1, 'acromegaloid syndrome': 3, 'Orofacial Appearance': 1, 'ALVEOLAR BONE THICKNESS': 1, 'reduction of cortical thickness': 5, 'diseases of the oral mucosa & lips': 1, 'Appearance Bias': 1, 'erythema of the oral mucosa and/or lips': 1, 'AGED APPEARANCE': 1, 'Dysmorphic facial appearance': 3, 'pigmentation of lips and mucosae': 1, 'disease of lip and oral mucosa': 1, 'FAD LAD': 1, 'Thickness abnormalities': 1, 'dental, lip, mucosa trauma': 1, 'carcinoma of buccal mucosa and lip': 1, 'Toxic appearance': 1, 'APPEARANCE OF DISTANT': 1, 'thick groundcover': 1, 'short, thick fingers': 1, 'diseases of lip and oral mucosa': 6, 'Thick rogues': 1, 'Thick secretion': 1, 'pigmented macules of the lips and buccal mucosa': 2, 'PCT': 1, 'pigmentation of lips, nails, and oral mucosa': 1, 'volume reduction of cortical thickness abnormalities': 1, 'TMT': 1, 'ZGM': 1, 'injury to the lip and buccal mucosa': 1, 'EST': 5, 'thick sputum': 4, 'Condition of the oral mucosa': 1, 'ERT': 1, 'thick and': 1, 'bad general appearance': 1, '(partial-thickness) defect': 1, 'carcinoma of the oral mucosa and lips': 1, 'TTV': 3, 'oral mucosa of lower': 1, 'FT-': 1, 'Thickness Swelling': 5, '-thickness defect': 1, 'hyperpigmentation of the lips and oral mucosa': 2, '-THICKNESS': 1, 'deformity of facial appearance': 1, 'Mucosa Lips': 1, 'swelling of buccal mucosa and lips': 1, 'CHARACTERIZATION OF MYOFIBROBLASTS APPEARING': 1, 'thick-billed': 5, '-thickness tissue loss': 4, 'TISSUE THICKNESS': 1, 'TPC': 1, 'Condition of oral mucosa and': 1, 'loss of cortical thickness': 4, 'Mucosa of lip NOS': 1, 'Cortical thickness': 2, 'oral mucosa and lip malignant tumors': 1, 'ta': 1, 'SYNDROME APPEARING': 2, 'Short thick': 1, 'pigmentations of the lips and oral mucosa': 1, 'alveolar septal thickeness': 1, 'Acromegaloid facial appearance syndrome': 5, 'AOR': 1, 'Thick-Billed Murre': 1, 'Tkv-CA': 1, 'CT/': 1, 'Thick legs': 4, 'SFTI': 1, 'thick-billed longspurs': 1, 'in appearance': 1, 'ARTIFACTS APPEARING': 1, 'Thick-veins': 1, 'Tkv': 1, 'CTI': 7, 'BF loss': 1, '-appearance': 1, 'dystrophic appearance': 2, 'oral mucosa of the lip': 1, 'CT loss': 3, 'Cushingoid Appearance': 1, 'VENTRICULAR WALL THICKNESS': 1, 'MMT': 1, 'MUCT': 1, 'PTI': 1, 'thick phlegm': 4, 'Chorioretinal Thickness': 2, 'RVPT': 1, 'Thick Cotton Yarn': 1, 'CT abnormality': 5, 'ULTRASONIC ESTIMATES OF FAT THICKNESS': 1, 'ACIDS ON APPEARANCE': 1, 'PTF': 4, 'EFTP': 2, 'Deep partial thickness': 1, 'ulcer of the mucosa of the lower lip': 1, 'AST': 1, 'OBSERVATION OF THICK SECTIONS': 1, 'thickness dystrophies': 1, 'ZAP': 1, 'lip, mucosa,': 1, 'appearance disorders': 1, 'Appearance concerns': 1, 'Acromegaloid phenotype': 1, 'thick leg syndrome': 1, 'thickness injuries': 2, 'CONTRIBUTION TO APPEARANCE OF': 1, 'CL': 1, 'Thickness Dependence': 2, 'Oral mucosa condition': 1, 'oral mucosa condition': 3, 'thickness defect of the': 1, 'Cortical Thickness Abnormalities': 1, 'hemiretinal thickness abnormalities': 1, 'diseases of the lip and oral mucosa': 4, 'abnormalities in CT': 2, 'ECT': 4, 'C-CII': 1, 'Thick squamae': 1, 'APPEARS': 2, 'appearance intolerance': 2, 'thick legs': 3, 'lip mucosa involvement': 1, 'in cortical thickness': 2, 'facial appearance abnormalities': 1, 'ACT': 3, 'Thick lip': 1, 'and appearance': 3, 'SSFT': 3, 'Cushingoid appearence': 1, 'FT)': 1, 'FT defects': 1, '-thickness (DPT) burns': 1, 'C. Th': 1, 'FTD': 4, 'FTD-': 1, 'MVT': 1, 'pigmentation of lips and oral mucosa': 1, 'intraoral lip mucosa': 1, 'BEECHER ARTICLE APPEARS': 1, 'short and thick fingers': 2, 'NTI': 2, 'oral mucosa/lip ulcerations': 1, 'CA': 4, 'condition of the oral mucosa': 1, 'EVOLUTION OF MYOTOMY THICKNESS': 1, 'Thick-billed murreb': 1, 'and appearance dissatisfaction': 2, 'A/R': 1, 'dry lips or mucosa': 2, 'thick backfat': 1, 'reductions in cortical thickness': 1, 'SCT': 1, 'GENITAL APPEARANCE': 1, 'sept': 1, 'chorioretinal thickness': 3, 'HBFT': 1, 'CST reduction': 1, 'acromegaloid facial swelling': 1, 'ABT': 2, 'TT': 7, 'appearance of the': 1, 'LADs': 1, 'mmIMT': 1, 'PARACARDIAL FAT THICKNESS': 1, 'lobe CT': 1, 'lip mucosa necrosis': 1, 'DELAYED APPEARANCE': 5, 'sclerodermatous appearance': 1, 'dry lips and oral mucosa': 1, 'epileptic appearance': 1, 'acromegaloid facial changes': 1, 'bad feeling of appearance': 1, 'SM': 1, 'SR': 1, 'MS': 1, 'FTH': 1, 'erosions of lips and oral mucosa': 1, 'SARs': 1, 'Appearance Concern': 2, 'lip, buccal mucosa': 1, 'Facial appearance': 1, 'dysfunction to problems of appearance': 1, 'lips, oral mucosa, tongue': 1, 'OC': 1, 'injury to lips, oral mucosa or dentition': 1, 'APPEARING OUTSIDE': 1, 'AN': 1, 'thick film parasitaemia': 1, 'facial appearance and bone disorders': 1, 'A-RT': 1, 'porokeratosis of lip and oral mucosa': 1, 'lip and mucosa defects': 1, 'of CT': 1, 'TKV': 1, 'Thick vein': 1, 'glaucomatous appearance of': 2, 'CMTMAX': 1, 'TCS': 1, 'Thick lips': 3, 'cleft appearance': 1, 'lip/oral mucosa erythema': 1, 'AFA syndrome': 2, 'Acromegaloid Facial Appearance (AFA) syndrome': 1, 'Erythema of lips & oral mucosa': 1, 'CT-A': 1, 'Buccal mucosa-lip': 1, 'inflammatory conditions of the oral mucosa': 2, 'precancer of the lip and oral mucosa': 1, 'Social appearance concerns': 1, 'Lip labial mucosa': 1, 'lip and buccal mucosa carcinomas': 1, 'PROTEIN METHYLATION APPEARED': 1, 'DVTDR': 1, 'Buccal/lip mucosa': 1, 'PTT': 4, 'NAAC': 1, 'SOL': 1, 'OBITUARIES APPEARED': 1, 'APPEARANCE OF RUTIN': 1, 'ALKALOIDS APPEARING IN LEAVES': 1, 'ST-elevation': 1, 'supraspinatus partial thickness': 1, 'Hands with short and thick': 1, '-Thickness Defect': 1, 'myxedematous appearance': 1, 'CLFT': 1, 'LLFT': 1, 'APPEARANCE OF SPEED': 1, 'FLA': 1, 'trauma to lip or oral mucosa': 1, 'Thick bark': 1, 'thick bark': 1, 'RMST': 1, 'edematous appearance': 1, 'lip mucosa hemangiomas': 1, 'BFTS': 1, 'NAC': 1, 'APPEARANCES': 1, '-Thickness Defect of': 1, 'thickeness of the': 1, 'hypertrichosis with acromegaloid facial appearance': 2, 'aphthous changes in lips and/or oral mucosa': 3, 'Mucosa of the lip': 1, 'abnormal facial or body appearance': 1, 'TiS': 1, 'chondrodysplastic TiS': 1, 'CORTICAL THICKNESS ESTIMATION STEPS': 1, 'hyper Thick': 1, 'MYELOGRAPHIC APPEARANCE': 1, 'pale appearance': 1, 'Hyper pigmentation lip oral mucosa': 1, 'swelling of the lips, oral mucosa or throat': 1, 'TEM': 1, 'GAI': 1, 'erythema of the oral mucosa and lips': 2, 'thickness loss': 2, 'CoTks loss': 1, 'facial appearance and': 1, 'hyperpigmentation on the lips and oral mucosa': 1, 'FTB': 1, 'Impairment to appearance': 1, 'thick lower lip vermilion': 1, 'WALL THICKNESS OF EUGENOL MICROCAPSULES': 1, 'appearence': 1, 'Lip Mucosa': 4, 'thick vernix caseosa': 1, 'loss of thick': 1, 'NAM': 1, 'lip, oral and/or palate mucosa itching': 1, 'RT': 1, 'DELAYED APPEARANCE OF LABELED PROTEIN': 1, 'ER.Appearance': 1, 'DELAYED APPEARANCE OF': 1, 'appearance imperfection': 1, 'Appearance Perfectionism': 1, 'TSSL': 1, 'PA': 2, 'Coarsened facial appearance': 1, 'ASI': 1, 'Lip and Oral Mucosa': 1, 'THE APPEARANCE': 1, 'erosions of lips and buccal mucosa': 1, 'Thickness Injury': 1, 'of lip or oral mucosa': 1, 'oral mucosa conditions': 1, 'appearance delay': 1, 'FA': 1, 'decreased cortical volume and thickness': 1, 'Thick-short filum terminale': 1, 'thick-short filum terminale': 1, 'necrotic appearance': 1, 'cortical thickness abnormality': 2, 'L-BFT': 1, '-BFT': 1, 'H-BFT': 1, 'LOM': 1, 'melanoplakia of lips, oral mucosa & fingers': 1, 'thick fur': 1, 'full-thickness defects': 1, 'ARTH': 1, 'deficiencies of appearance and function': 1, 'Prolapse of the lip mucosa': 1, 'Thick veins': 1, 'Abnormalities of Cortical Thickness': 1, 'DIFFERING APPEARANCE': 1, 'Cosmetic Appearance': 1, 'BFT-ap': 1, 'Appearance Issues': 1, 'FACTORS APPEARING': 1, 'cortical thickness (': 1, 'of lip and oral mucosa': 1, 'cutaneous thickness': 1, 'CAT': 3, '-thickness (PT) tears': 1, 'cortical thickness reduction': 1, 'AM': 1, 'orofacial appearance': 2, 'cleft affected oral mucosa': 1, 'dry lips and mucosae': 1, 'Erythema of lips/oral mucosa': 1, 'appearing lesions': 2, 'facial acromegaloid': 1, 'Acromegaloid facial appearance (AFA) syndrome': 1, 'Thick Stripes': 1, 'facial dysmorphic appearance': 2, 'thickness fractures': 1, 'lentigines on the lips and oral mucosa': 1, 'thl': 1, 'thick leaf': 1, 'Thick-billed': 2, 'Thickness disturbances': 1, 'thick lip': 1, 'full-thickness and partial-thickness tears': 1, 'acromegaloid facial syndrome': 1, 'Thick-': 1, 'NORMAL-APPEARING FRONTAL': 1, 'carcinomas of the oral mucosa and lips': 1, 'Thick surfArea': 1, 'NSs': 1, 'swelling of the lips and oral mucosa': 1, 'FULL THICKNESS PLICATION': 1, 'FUNCTION OF SECTION THICKNESS': 1, 'Cutaneous appear': 1, 'myocardial thickness': 1, 'sightly abnormal facial appearance': 1, 'Thick soups': 1, 'ALLC': 1, 'TLM': 1, 'APPEARING ON': 2, 'Lip and Buccal Mucosa': 1, 'full-thickness defect': 1, 'LFT': 1, 'LFT injury': 1, 'PTD': 1, 'Thick Red': 1, 'AMT': 1, 'APPEARANCE OF': 2, 'THICK-SECTION TECHNIQUE': 1, 'CAMBIUM THICKNESS': 1, 'SCC of the lip mucosa': 1, 'CoTh': 1, 'AR': 2, 'appearance impairment': 2, 'FT-HSE': 1, 'Thickness disorder': 1, 'appearance disorder': 1, 'Muscular appearance intolerance': 1, 'muscular appearance': 2, 'Muscular appearance': 1, 'muscular appearance intolerance': 1, 'lip or oral mucosa damage': 1, 'dystonic-appearing': 1, 'Dystonic-appearing movements': 1, 'dystonic-appearing movements': 1, 'acromegaloide': 2, 'Thick keratoderma': 1, 'impaired appearance': 1, 'AFAT': 2, 'Facial appearance of II-1': 1, 'THICKNESS DIMENSIONS': 1, 'Tc': 1, 'lips, buccal mucosa and palate injuries': 1, 'ARCTIC': 1, 'APPEARANCE OF MOTORICITY': 1, 'APPEAR ALONGSIDE': 1, '-appearance dissatisfaction': 1, 'papillomatous to verrucous lesions of the lips and buccal oral mucosa': 1, 'Facial Appearance': 2, 'short thick finger': 1, 'Paraffinoma of lips and oral mucosa': 1, 'partial-thickness injuries': 1, 'erythema of the oral mucosa, lips and tongue': 1, 'EM': 1, 'erythema of the oral mucosa, lips': 1, 'lip mucosa ulcers': 1, 'NORMAL APPEARANCE': 1, 'TBMU': 1, 'Thick-billed Murres': 1, 'Thick Lips': 1, 'HTA': 1, 'ETV': 1, 'CThick abnormalities': 1, 'erosions of the lips and buccal mucosa': 1, 'lip/oral mucosa erosion': 1, 'partial thickness and full thickness skin burns': 1, 'dissatisfaction with appearance': 1, 'Dissatisfaction with Appearance': 1, 'abnormalities of cortical volume and thickness': 1, 'erosion of the lips and oral mucosa': 1, 'thick face': 1, 'ENDOSCOPIC APPEARANCE OF': 1, 'RVH': 1, 'SATAQ-4R': 1, 'SYNDROME APPEARING AFTER': 1, 'ulcerations of lips, mucosa': 1, 'CT (': 1, 'of the lip and oral mucosa': 1, 'COA': 1, 'Erosions of mucosa (eye/lip/genital': 1, 'Dry lip mucosa': 1, 'Cutaneous reactions appearing': 1, 'pigmentation of lips, oral mucosa': 1, 'dysfunction of appearance': 1, 'and lip mucosa erosion': 1, 'thickness defects': 1, 'Leaf Thickness': 1, 'Thick Leaves': 1, 'damage of the normal-appearing': 1, 'thick-testa': 1, 'SKF': 2, 'to lip or oral mucosa': 1, 'Lip, oral mucosa': 1, 'CHANGES APPEARING': 1, 'ITEM APPEARANCE': 1, 'THICKNESS n.s': 1, 'Appearance and Hygiene': 1, '-appearing': 1, 'cracking of lips& oral mucosa': 1, 'EC': 1, 'APPEARANCE-': 1, 'Appearance Impairment': 1, 'acromegaloid face': 1, 'RICINUS APPEARING': 1, 'TuM': 1, 'TTT': 1, 'hypotonic appearance': 1, 'pigmentation of the lips and oral mucosa': 1, 'CTM': 1, 'reduction of CC in thickness': 1, 'alteration of facial appearance': 1, 'Defects in appearance': 1, 'MES': 1, 'Septal thickeness': 1, 'OT': 1, 'thickness) defect': 1, 'thick mint leaf': 1, 'Thick haze': 1, 'malignant tumor of oral mucosa and lips': 1, 'chlorotic appearance': 1, 'Appearance Dissatisfaction': 1, 'COLPOSCOPIC APPEARANCES': 1, 'poor facial appearance': 1, 'deformities in facial appearance': 1, 'ulcers of the lips and oral mucosa': 1, 'RCT': 1, 'appearance of a': 1, 'STM': 1, 'hypoplastic thick and short epiphyses': 1, 'Pigmentation of the buccal mucosa, lip or palate': 1, 'Acromegaloid facial appearance': 1, 'appearance perfectionism': 1, 'papillomatosis of the lips and oral mucosa': 1, 'Rhabdomyosarcomatous appearance': 1, 'CT dysmaturation': 2, '-Thickness Defects': 1, 'AFA Syndrome': 1, 'Hypertrichosis with acromegaloid facial appearance': 1, 'oral mucosa lips erythema': 1, 'psychotic appearance': 1, 'LARGE FULL-THICKNESS': 1, 'cachectic appear-ance': 1, 'obstructive apnea': 1, 'apnea': 1, 'malignancy of oral mucosa and lip': 1, '-thickness defects': 1, 'BFAT': 2, 'RULM': 1, 'RLLM': 1, 'TRT': 1, 'MAST': 2, 'CTh': 1, 'ORDER OF APPEARANCE': 1, 'APCC': 1, 'thick pterygia': 1, 'LTC': 1, 'pseudo-acromegaloid': 1, 'CT increase': 1, 'HTC': 1, 'COMBINING THICKNESS PROFILE': 1, 'Appearance shamea - 2': 1, 'FTN': 1, 'macular hyperpigmentation of oral mucosa and lips': 2, 'NORM': 2, 'of BLAT': 1, 'CVA': 1, 'MTS': 1, 'Thick TNT': 1, 'LUPOID APPEARANCE': 1, 'thickness swelling': 1, 'PTS': 1, 'Necrotic-Appearing': 1, 'necrotic-appearing': 1, 'Insular Thickness': 1, 'insular thickness': 1, 'Negligence of appearance': 1, 'Thick-leaf Frutescens': 1, 'UBM': 1, 'Crouzonoid appearance': 1, 'Appears': 1, 'NORMAL-APPEARING PALATES': 1, 'swelling of the lips, oral mucosa, and throat': 1, 'tumors of the lips and oral mucosa': 1, 'Hyperpigmentation of the lips and oral mucosa': 1, 'Condition of the Oral Mucosa': 1, 'DIFFERENTIAL STAINING OF THICK': 1, 'OF APPEARANCE': 1, 'Insular Cortical Thickness': 1, 'AH': 1, 'Lip buccal mucosa': 1, 'lip buccal mucosa': 1, 'SUBFIELD THICKNESS': 1, 'ACC': 1, 'TMD': 1, 'ABF': 1, 'and thick': 1, 'not appear at risk for suicide': 1, 'abnormalities of lip or oral mucosa': 1, 'Thick-Billed Vireo': 1, 'PTh': 1, 'partial-thickness (PTh) tears': 1, 'Thickness and Ductility': 1, 'dNAWM': 1, 'Fibrotic appearance': 1, 'Strip Thickness': 1, 'deep partial-thickness': 1, 'Deep Partial-Thickness': 1, 'Thick-bile syndrome': 1, 'plate epithelium carcinomas of the lips and oral mucosa': 1, 'carcinoma of lips and oral mucosa': 2, 'Disabilities appear in the legs': 1, 'ARTI': 1, 'ulcerations of lips and oral mucosa': 1, 'BFTB': 1, 'Buccal mucosa - Lower lip': 1, 'Co.Th': 1, 'MACROSCOPIC APPEARANCES': 1, 'CHRONOLOGIC APPEARANCE': 1, 'impairment of facial appearance': 1, 'atrophy of the lip mucosa': 1, 'hyperaemia of lip and oral mucosa': 1, 'An acromegaloid': 1, 'thick panniculus adiposus': 1, '-thickness injury': 1, 'BFH': 1, 'PH': 1, 'pigmented macules of the lips and oral mucosa': 1, 'Cortical thickness abnormalities': 1, 'cysts of the lip and cheek mucosa': 1, 'THICK-BILLED PARROT': 1, 'osteolytic appearance': 1, 'healthy lip mucosa': 1, 'HLM': 1, 'Aged facial appearance': 1, 'abnormalities of cortical thickness and gyrification': 1}
|
CT
|
Disease
|
MESH:C535656
|
{'enlarged acromegaloid features': 1, 'acromegaloid features': 6, 'Overgrowth Feature': 1, 'acromegaloid overgrowth': 1, 'cortical overgrowth': 1}
|
acromegaloid features
|
Disease
|
MESH:C535657
|
{'acromelic dysplasia': 46, 'Acromelic dysplasias': 12, 'short rhizo- and acromelic': 1, 'acromelic dysplasias': 37, 'acromelic chondrodysplasias': 1, 'acromelic group': 1, 'acromelic skeletal dysplasia': 3, 'acromelic defects': 1, 'acromelic': 5, 'Acromelic dysplasia': 7, 'facial, and acromelic dysmorphic features': 1, 'acromelic dysplasia syndromes': 2, 'acromelic malformations': 3, 'rotect Acromelic Dysplasias': 1, 'ophthalmo-acromelic': 1, 'short stature acromelic dysplasia': 1, 'autosomal dominant acromelic dysplasia': 1, 'autosomal acromelic dysplasia': 1, 'acromelic frontonasal dysplasia': 2, 'Acromelic Dysplasias': 3, 'acromelic short stature': 6, 'Acromelic dysplasias 16': 1, 'acromelic and': 2, 'acromelic shortening': 3, 'acromelic shortness syndrome': 1, 'acromelic brachymelia': 1, 'Acromelic dwarfism': 1, 'acromelic disorder': 1, 'acromelic shortening of the extremities': 1, 'acromelic dwarfism': 4, 'meso-acromelic shortening of the': 1, 'Ophthalmo-acromelic (': 1, 'ophthalmo-acromelic-like': 1, 'Ophthalmo-Acromelic (': 1, 'acromelic dysmorphic features': 1, 'facial and acromelic dysmorphic features': 1, 'acromelic deviations': 1, 'acromelic metaphyseal chondrodysplasia': 1, 'acromelic deformities': 1, 'acromelic syndrome': 1, 'Acromelic disorders': 1, 'facial and acromelic dysmorohic feature': 1, 'acromelic shortness': 2, 'acromelic frontonasal dystois': 1, 'acromelic)': 1, 'Acromelic frontonasal dysotosis': 1, 'acromelic bone and joint destructions': 1, 'short stature acromelic dysplasias': 1, 'Acromelic shortening of the leg': 1, 'acromelic malformation': 1, 'acromelic disorders': 1, 'acromelic limb malformations': 1, 'acromelic:': 1, 'acromelic dysplasia complex': 1, 'oculo-vertebro-acromelic malformations': 1}
|
acromelic dysplasia
|
Disease
|
MESH:C535658
|
{'St. stercoralis': 1, 'St Gallen': 8, 'St. Apollonia': 5, 'St. Leger': 2, 'St. Legers': 1, 'St': 107, 'St. Lawrence': 6, 'St_Paul': 1, 'Sts-2PGM': 1, 'SJYC07': 1, 'acromesomelic dysplasia': 132, 'St. Pancras': 3, 'IDC-st': 1, 'St. Augustinegrass': 7, 'St.': 46, 'St. Lucia': 5, 'acromesomelic limb shortness': 1, 'Hunter-Thompson': 14, 'acromesomelic chondrodysplasia': 17, 'CHTT': 1, 'Hunter-Thompson type': 5, 'Hunter- Thompson type': 1, 'Hunter-Thompson type chondrodysplasia': 3, 'Acromesomelic dysplasia': 48, 'St.Cova': 1, 'A.St': 5, 'Xylopia sericea A. St.-Hil': 1, 'SJLIFE': 73, 'St. George': 8, 'St. Helens': 8, 'St.p': 1, 'Hunter-Thompson chondrodysplasias': 1, 'A-St-JF': 1, 'SCCVII/St': 3, 'acromesomelic dysplasias': 11, 'Acromelic and Acromesomelic Dysplasias and Dysostoses': 1, 'st stemmata': 2, 'STs': 86, 'sT': 23, 'St. Gallen': 10, 'st': 32, 'St. Hyacinthe': 3, 'St. salivarius': 1, 'St Jude': 11, 'SLE': 13, 'SLE beluga': 5, 'St. Jude': 41, 'Sattar-khan st': 1, 'St. Ottilia': 1, 'Hunter-Thompson syndrome': 8, 'acromesomelic dwarfism': 15, 'Grebe and Hunter-Thompson syndromes': 2, 'ED-st': 1, 'St-T1': 1, 'St.dev': 2, 'St George disease': 2, 'JS': 1, 'SBHF': 1, 'St-Stomata': 1, 'Hunter-Thompson dysplasia': 1, 'acromesomelic shortening of the': 1, 'acromesomelic chondrodysplasias': 7, 'ACD': 1, 'SCA': 1, 'HS': 1, 'St. Patrick': 1, 'IDpar st': 1, 'acromesomelic': 5, 'St. herpestis': 1, 'AMDP': 2, 'St-A': 1, 'St. George Disease': 2, 'HH': 1, 'St George': 7, 'MECII-st': 1, 'St. Zoilus': 1, 'St. Julien': 1, 'St. Birgitta': 1, 'St Paul': 2, 'Strychnos pseudoquina St. Hil': 3, 'St-H': 1, 'St-L': 1, 'ins-St. Lucia': 1, '-St': 8, 'I/St': 19, 'St. Augustine': 1, 'St. diff': 1, '(st': 1, 'St Leonards Shoreditch': 1, 'St Clement': 1, 'Acromesomelic dysplasias': 7, 'St. George disease': 8, 'St. intersepta': 1, 'St. papillosus': 1, 'SPB': 1, 'St. Damian relics': 1, 'Hunter-Thompson-type': 2, 'sTS': 1, 'sts': 2, 'St. Joachimstal disease': 1, 'St II': 3, 'St. Mary boot': 1, 'acromesomelic shortening': 6, 'St-JS': 1, 'St. novella': 1, 'St. Petersburg': 2, 'St. Rita': 1, 'St. Aerius': 1, 'St. Epidermidis': 1, 'St. Vlas': 1, 'SG': 2, 'St. Clair': 3, 'St. Ausustinegrass': 1, 'MSP': 3, 'Helena': 3, 'Hunter-Thompson-type acromesomelic dysplasia': 2, 'I/st': 1, 'St. Nectaire': 3, 'Strychnos pseudoquina St. Hil.': 1, 'St. Cyr': 1, 'H.St': 9, '-st-maarten': 1, 'St. Croix': 6, 'St. Anne-Mayo': 1, 'SJ': 1, 'St. I': 3, 'St. III,': 1, 'St. Paul': 4, 'St. Paul fracture': 1, 'A-St.': 1, 'SPSPA': 3, 'AMDM': 2, 'acromesomelic dysplasia, type Marteaux': 1, 'St - stomata': 1, 'St. agalactiae': 3, 'ZIM-SP': 1, '/St': 5, 'St. Theresa': 1, 'St Columcille': 1, 'St luc': 1, 'Duguetia lanceolata A.St.-': 1, 'St. Stefan': 1, 'St. Agatha': 1, 'St-4': 1, 'St. George II': 1, 'St. Austell': 1, '-st': 5, 'St. meld': 4, 'St I': 3, 'StS': 8, 'St Lucia': 5, 'L-St': 1, 'autosomal recessive acromesomelic dysplasia': 5, 'St. Kitts': 5, 'St disease': 1, 'St-I': 1, 'St. Helens disorders': 1, 'N0-N2b St': 1, 'N0-N2c St': 1, 'acromesomelic hypomineralization': 1, 'SCNSR': 1, 'Acromesomelic dwarfism': 11, 'acromesomelic chondrodysplasia Hunter-Thompson': 1, 'acromesomelic dysplasia-': 2, 'St. Maries': 1, 'TAM': 1, 'St. Dev': 4, 'Genlisea pygmaea A. St.-Hil.': 1, 'SE': 1, 'Acromesomelic Dysplasia': 6, 'SJLIFE SJLIFE': 1, 'Strychnos pseudoquina A. St.-Hil': 3, 'acromesomelic short limbed dwarfism': 1, 'St Luc': 1, 'St-Tx': 1, 'Utricularia praelonga A.St-Hil': 1, 'st-IPN': 1, 'St-IPN': 1, 'St. III': 5, 'St. II': 4, 'tasa st': 1, 'St LouisEncephalitis': 1, 'Cataglyphis bicolor st': 1, 'st-': 1, 'St. pyramidale': 2, 'st sternite t': 1, "Barter'st Syndrome": 1, 'St. Egidi': 1, 'St. Tropez': 1, 'SAM': 1, 'St stelidia': 1, 'Hunter-Thompson type dwarfism': 1, 'JS-St': 1, 'Hunter-Thompson-type AMD': 1, 'AMDs': 2, 'LHM-st': 1, 'SLC': 1, 'TA3-St': 2, 'St. Luc': 2, '-Sp-St': 1, 'AMD': 3, 'Preslaea stenostachya A. St.-': 1, 'Preslaea stenostachya A.St': 1, 'stenostachya A.St': 1, 'St.III-': 1, 'St. Sugar': 1, 'SJG': 1, 'SJG Weert': 1, 'St Jude PeCan': 1, 'biliary st one': 1, 'St.) scutellaris': 1, 'SG-BCC': 1, 'SG-BCC-': 1, 'St. venezuelensis': 1, 'H/St': 1, 'Viciae st': 1, 'St(III)': 1, 'STS': 1, "St'iudenta": 2, 'STC': 3, 'Acromesomelic dysplasias 17': 1, 'St.Dev.': 1, 'Acromesomelic chondrodysplasia': 5, 'Acromesomelic chondrodysplasia Hunter-Thomson type': 1, 'Peltodon longipes A.St': 1, 'St. agalactia': 1, 'St-Hil': 1, 'ACDs': 1, 'Acromesomelic chondrodysplasias': 1, 'St.Diff.': 1, 'St. dev': 4, 'St. stamen': 1, 'St. spinosum': 1, 'Hunter-Thompson chondrodysplasia': 2, 'DS-St': 1, 'st -stomata': 1, 'St Jude Dysplasia': 1, 'St Lawrence': 2, 'St Luke': 1, 'acromesomelic dysplasia Hunter-Thompson': 2, 'St. Eufemia': 1, 'StM': 1, 'St-P': 1, 'St Petersburg apparent anomaly': 1, 'Duguetia lanceolata St. Hil': 2, 'mo st': 1, 'Acromesomelic dysplasia type': 1, 'SM': 1, 'P.st': 1, 'recessive acromesomelic chondrodysplasia': 1, 'Sts-': 1, 'St. WM': 1, 'type II STs': 1, 'globulus St.': 1, 'St.Venant-Kirchhoff': 1, 'I-st': 3, 'St. Cornelius': 1, 'St. Coef': 2, 'facio-renal-acromesomelic syndrome': 1, 'CHUM St-Luc': 1, 'St. Wenceslas': 2, 'acromesomelic dysplasia Hunter-Thompson type': 1, 'St. Bartelemy': 1, 'SVVs': 1, 'St. Stefano': 1, "'St Jude": 1, 'MOT': 1, '(Rhyacophylax) helenae': 1, 'St. Pete Reef': 1, 'TA3/St': 1, 'Helena syndromes': 1, 'hurricane-dean-in-jamaica-st-lucia-and-': 1, 'St, P': 1, 'St. Jude BT': 1, 'Hunter-Thompson type acromesomelic dysplasia': 1, 'St. mediocidicus': 1, 'Val-Try st': 1, 'St Franics': 1, 'St-': 3, 'A.St.-': 2, 'A.St.': 2, 'SAH': 1, 'St Dev': 1, 'St. dv': 1, 'St Georg': 1, 'St. Niklausen': 1, 'St. BarthElemy': 1, 'acromesomelic-like skeletal dysplasia': 1, 'acromesomelic and spondylar skeletal dysplasia': 1, 'acromesomelic shortening of forelimbs': 1, 'acromesomelic skeletal dysplasia': 1, 'I st': 1, 'I st.': 1, 'SLEB': 1, 'St. Spiridon': 1, 'St.Gallen FHZ': 1, 'StP': 1, 'St. Luke': 1, 'St. Paul Wilt Disease': 1, 'ACREB-St': 1, 'SBF': 1, 'Moroteaux acromesomelic dysplasia': 1, 'helena': 1, 'Hunter-Thompson and Grebe type chondrodysplasias': 1, 'L-sT': 5, 'st cu e': 1, 'St Paulia': 1, 'Urenoideae A. St.-Hil': 1, 'St. Venant-Kirchhoff': 1, 'St-1': 1, 'Grebe-type and Hunter-Thompson chondrodysplasia': 1, 'St. Kilda': 2, 'st - stipes': 2, 'St.mat': 1, 'St Kitts': 2, 'STs type 1 and 2': 1, 'Crotoncampestris A.St': 1, 'St Croix disaster': 1, 'n. st': 1, 'St,': 1, 'St. George or Marree disease': 2, 'St - Stroma': 1, 'St(a+': 1, 'St Philibert': 1, 'SLI': 1, 'Acromesomelic short stature': 1, 'Hedyotis theesifolia A.St.-': 1, 'Hunter Thompson': 1, 'St.:': 1, 'SMA': 1, 'St.calidus': 1, 'Duguetia A.St.': 1, 'skeletal dysplasia acromesomelic dysplasia': 1, 'Genliseapygmaea A.St': 1, 'St Hyacinthe': 1, 'Strongyloides Stercoralis (St St': 1, 'Ilexparaguariensis A.St.': 1, 'Biache-St-Vaast': 1, 'St.Pr': 1, 'st.': 1, 'STX': 1, 'St. Jude cafeteria': 1, 'St- stoma': 1, 'C21 st': 1, 'Sts': 1, 'Pont St Esprit': 1, 'Lafoensia pacari A. St.': 1, 'St. Paul wilt disease phytoplasma': 1, 'aortic st': 1, 'Acromesomelic-spondyloepiphyseal dysplasia': 1, 'Strychnospseudoquina A. St.-': 1, 'St-MHDC': 1, 'st lucia': 2, 'St. calcitrans': 1, 'A. defulvii st': 1, 'St. oenanthes.': 1, 'St, notochord stan': 1, 'St Diester': 1, 'OM-St': 1, 'KSA': 1, 'Xilopia sericea A.St': 1, 'acromesomelic displasia': 1, 'St Ann': 1, 'CUSL': 1, 'St Marie': 1, 'Chorisia speciosa A.St.-': 1, 'St. MRSA 25923': 1, 'st.pdf': 1, 'HELENA': 1, 'LSLE': 1, 'St. n.': 1, 'Hunter-Thompson and Grebe type dysplasia': 1, 'P. aylmer-robinsonii H.St': 1, 'Scytonema crispum st': 1, 'SAIlex paraguariensis A. St.-Hil': 1, 'SB': 1, 'St. Pk': 1, 'Kloeckera apis st': 1, 'ESC': 1, 'st enosis': 1, 'St-Cl': 1, 'LSC': 1, 'Erie St.': 1, 'KSSG': 1, 'St-Hyacinthe': 1, 'StJ': 1, 'St. Err': 1, 'SLR': 1, 'St Ambrose': 1, 'Aortic St enosis': 1, 'St. III-': 1, 'St Parascheva': 1, 'St. Barthelemy': 1, 'of St. Kilda': 1, 'Erythroxylum suberosum St. Hil': 1, 'Acromesomelic dysplasia Hunter-Thompson': 1, 'St. Diff': 1, 'SLE.Multilevel': 1, 'st-roke': 1, 'SAB': 1, 'acromesomelic brachymelia': 1, 'St. Lucie': 1, 'Leopold St': 1, 'St Helena dysplasia': 1}
|
acromesomelic dysplasia
|
Disease
|
MESH:C535661
|
{'AMD1': 13, 'AMDM': 56, 'Acromesomelic dysplasia-Maroteaux type': 1, 'Maroteaux type acromesomelic dysplasia': 2, 'acromesomelic dysplasia type Maroteaux': 14, 'acromesomelic dysplasia, type Maroteaux': 7, 'acromesomelic dysplasia Maroteaux-type': 5, 'acromesomelic dysplasia Maroteaux type': 9, 'Acromesomelic Dysplasia Maroteaux': 1, 'skeletal dysplasia Acromesomelic Dysplasia Maroteaux type': 1, 'Acromesomelic dysplasia, type maroteaux': 1, 'acromesomelic dysplasia type Maroteux': 2, 'Acromesomelic dysplasia type Maroteaux': 3, 'Acromesomelic dysplasia Maroteaux type': 6, 'acromesomelic dysplasia Maroteaux type (': 1, 'ACROMESOMELIC DYSPLASIA, MAROTEAUX TYPE': 1, 'Acromesomelic dysplasia, Maroteaux type': 2, 'Maroteaux-type acromesomelic dysplasia': 1, 'acromesomelic dysplasia, Maroteaux': 1, 'acromesomelic dysplasia of Maroteaux': 1, 'acromesomelic dysplasia Maroteaux-type (AMDM-type) dwarfism': 1, 'Maroteaux Type Acromesomelic Dysplasia': 1, 'Acromesomelic dysplasia, type Maroteaux': 1, 'type Maroteaux (AMDM) dwarfism': 1, 'AMDM acromesomelic dysplasia': 1, 'Acromesomelic dysplasia Maroteaux-type': 3, 'acromesomelic dysplasia maroteaux type': 1, 'AMD1-4': 1, 'acromesomelic dysplasia-type Maroteaux': 3, 'Acromesomelic Dysplasia, Type Maroteaux': 1, 'Acromesomelic Dysplasia, type Maroteaux': 1, 'neovascular AMD1': 1, 'Acromesomelic Dysplasia Maroteaux Type': 1, 'Acromesomelic Dysplasia, Maroteaux Type': 1, 'Acromesomelic dysplasias 1': 1, 'acromesomelic dysplasia, Maroteaux type': 1, 'acromesomelic dysplasia type maroteaux': 1, 'Maroteaux (AMDM': 1, 'AMDM dwarfism': 1}
|
AMDM
|
Disease
|
MESH:C535662
|
{'acromicric dysplasia': 72, 'Geleophysic Dysplasia': 7, 'geleophysic dysplasia': 116, 'GD': 49, 'AD': 27, 'Geleophysic dwarfism': 2, 'Geleophysic dysplasia': 62, 'geleophysic': 2, 'acromicric and geleophysic dysplasia': 3, 'acromicria': 59, 'acromicric and geleophysic dysplasias': 7, 'Acromicric dysplasia': 27, 'Acromicric Dysplasia': 5, 'geleophysic andacrophysic dysplasia': 1, 'Acromicria': 8, 'Geleophysics dysplasia': 1, 'GD1': 1, 'GD type 1': 2, 'CONGENITAL ACROMICRIA AND': 1, 'acromesomelic and geleophysic dysplasias': 1, 'geleophysic epiphyseal dysplasia': 1, 'GPHYSD1': 2, 'geleophysic dysplasia 1': 4, 'GPHYSD-2': 1, 'GPHYSD-1': 1, 'GPHYSD': 2, 'geleophysic dysplasia 2': 9, 'acromeric and geleophysic dysplasia': 1, 'ACMICD': 4, 'GD2': 1, 'Geleophysic dysplasia 1 and 2': 1, 'geleophysic dysplasia-1': 2, 'GPHYSD3': 1, 'geleophysic dysplasia 3': 4, 'geleophysic dysplasia a syndrome': 1, 'Geleophysic dysplasia 2': 5, 'autosomal dominant geleophysic dysplasia': 2, 'geleophysic and acromicric dysplasias': 3, 'acromicric dysplasia-associated': 1, 'geleophysic dysplasia-associated': 1, 'geleophysic dysplasia type 1': 4, 'Acromeric and geleophysic dysplasia': 1, 'acromicric dysplasias': 1, 'congenital acromicria': 1, 'geleophysic and acromicric dysplasia': 2, 'acromicric dwarfism': 1, 'Geleophysic': 1, 'Congenital acromicria syndrome': 1, 'congenital acromicria syndrome': 1, 'geleophysic/acromicric dysplasias': 1, 'Geleophysic dysplasia Hypermobility': 1, 'Geleophysic Dysplasias': 2, 'acromicric': 2, 'geleophysic dysplasias': 2, 'acromicric or geleophysic dysplasias': 1, 'acromicric dysplasia': 1, 'Acromicric and Geleophysicdysplasias': 1, 'Acromicric/Geleophysic Dysplasia': 1, 'Acromicric and Geleophysic dysplasia': 1, 'geleophysic dwarfism': 2, 'acromicria syndrome': 1, 'familial, Geleophysic dysplasia 2': 1, 'bone geleophysic dysplasia': 1, 'Geleophysic and acromicric dysplasias': 1, 'dominant geleophysic dysplasia': 1, 'Geleophysic dysplasia 1': 3, 'acromicric dysplasia with stiff skin syndrome': 1, 'AD)': 1, 'acromicric (AD) and geleophysic (GD) dysplasias': 1, 'geleophysic (GD) dysplasias': 1, 'Geleophysic dysplasia type 1': 1, 'Geleophysic dysplasia type 2': 2, 'autosomal dominant Acromicric Dysplasia': 1, 'Acromicric and Geleophysic Dysplasias': 1, 'Acromicric (': 1, 'geleophysic dysplasia type I.': 1, 'Geleophysic Dysplasia 2': 1, 'Autosomal Recessive Geleophysic Dysplasia': 1, 'geleophysic dysplasia type 2': 1, 'Acromicric nanism': 1, 'Geleophysic dysplasia 3': 1, 'acromicric/geleophysic dysplasia': 1, 'Geleophysic" dysplasia': 1, 'autosomal-recessive geleophysic dysplasia (GD) type 1.4, 5': 1, 'achondroplasia-acromicric dysplasia': 1, 'family acromicria': 1, 'musculoskeletal disorder Geleophysic Dysplasia': 1, 'GD 4': 1}
|
geleophysic dysplasia
|
Disease
|
MESH:C535664
|
{'ACRP': 8, 'Acropectoral syndrome': 1, 'Preaxial polydactyly Syndactyly': 1, 'ACRP-30': 1, 'ACRPs': 1, 'aCRPS': 2, 'aCRP': 3, 'ACRP 13': 1, 'ACRP 19': 1, 'ACRP 11': 1, 'ACRP 21': 1, 'ACRP 16': 1, 'ACRP 15': 1, 'ACRP 14': 1, 'ACRP 20': 1, 'ACRP 17': 1, 'aCRPS II': 1, 'acropectoral syndrome': 1, 'acrp acromion process': 1, 'Acropectoral Syndrome': 1}
|
ACRP
|
Disease
|
MESH:C535665
|
{'Acrorenal Mandibular Syndrome': 2, 'acro-renal-ocular syndrome': 26, 'Acro-mandibular dysplasia': 1, 'Acro-Mandibular Dysplasia': 1, 'MAD': 1, 'Acro-renal-ocular syndrome': 8, 'acro-mandibular dysplasia': 1, 'acro-renal-mandibular syndrome': 4, 'transverse split injuries': 1, 'Acro-pectoro-renal field defect': 2, 'acro-pectoro-renal field defect': 2, 'Acro-renal-mandibular syndrome': 4, 'hypoplasia and split': 1, 'Acro-renal ocular syndrome': 1, 'ARO syndrome': 1, 'ARO': 1, 'Acro-renal ocular': 1, 'Acro-renal-ocular syndromes': 1, 'burst-split type injury': 1, 'acro-renal syndromes': 2, 'acro-renal field defect': 1, 'AROS': 6, 'Auriculo-acro-renal Syndrome': 1, 'Auriculo-acro-renal syndrome': 1, 'split injury': 3, 'acro-renal-intrauterine-mandibular syndrome': 1, 'Acro-Renal-Ocular syndrome': 1, 'acro-renal syndrome': 5, 'acro-renal ocular syndrome': 1, 'acrorenal mandibular syndrome': 1, '(acro-renal) developmental field defect': 1, 'uterine, renal, mandibular, and maxillary': 1, 'Split injury': 2, 'acro-renal-uterine-mandibular syndrome': 2, 'Acro-renal syndrome': 2, 'burst-split-type injury': 1, 'acro-renal disorders': 2, 'acro-renal-ocular': 1, 'acro-renal syndrome of Siegler': 1, 'acro-renal patterns': 1, 'acro-renal anomalies': 1, "Dieker's type acro-renal syndrome": 1, 'acro-renal defects': 1, 'acro-renal defect': 1, 'acro-renal polytopic field defect': 1, 'Acro-renal polytopic defect': 1, 'midline splitting injuries': 1, 'acro-renal "syndrome': 1, 'acro-renal-ocular syndromes': 1}
|
acro-renal-ocular syndrome
|
Disease
|
MESH:C535668
|
{'adrenocorticotropic hormone deficiency': 209, 'adrenocorticotropic hormone deficiencies': 6, 'ACTH deficiency': 326, 'adrenocorticotropic hormone (ACTH) deficiency': 176, 'production of ACTH': 1, 'ACTH deficiencies': 17, 'Adrenocorticotropic Hormone Deficiency': 22, 'adrenocorticotropic hormone-deficiency': 2, 'ACTH': 41, 'adrenocorticotropic hormone': 44, 'adrenocorticotropic dysfunction': 1, 'Adrenocorticotropic hormone (ACTH) deficiency': 19, 'deficiency of Adrenocorticotropic Hormone': 1, 'ACTH deficiencyTSH deficiencyHyperprolactinemia': 1, 'ACTH deficit': 5, 'hyper-adrenocorticotropic hormone': 1, 'adrenocorticotropic hormone (ACTH) adenomas': 1, 'ACTH abnormalities': 1, 'adrenocorticotropic hormone (ACTH)': 1, 'ACTH-': 10, 'deficiency of adrenocorticotropic hormone': 14, 'ACTH dependent syndrome': 1, 'ACTHD': 7, 'ectopia adrenocorticotropic hormone (ACTH) syndrome': 1, 'Adrenocorticotropic hormone deficiency': 12, 'ACTH macroadenoma': 3, 'ADRENOCORTICOTROPIC': 6, 'adrenocorticotropic hormone (ADH) deficiency': 1, 'ACTH Syndrome': 1, 'adrenocorticotropic hormone-': 4, 'ACTHR deficiencies': 1, 'AdrenoCorticoTropic Hormone deficiency': 1, 'exACTH': 1, 'ACTH-deficient': 4, 'ACTH macroadenomas': 3, 'adrenocorticotropic hormone deficit': 2, 'Adrenocorticotropic hormone': 7, 'ACTH syndrome': 5, 'ACTH Deficiency': 10, 'ACTH-CA': 2, 'ACTH microadenoma': 3, 'autoimmune adrenocorticotropic hormone deficiency': 2, 'Adrenocorticotropic Hormone': 1, 'adrenocorticotropic': 6, 'adrenocorticotropic hormone (ACTH) deficit': 1, 'ACTH deficits': 1, 'adrenocorticotropic hormone (ACTH) deficient': 3, 'ACTH PitNETs': 1, 'adrenocorticotropic syndrome': 1, 'ACTH-deficiency': 3, 'ACTH-dependent syndrome': 4, 'ACTH deficient': 5, 'adrenocorticotropic hormone-deficient': 1, 'RADIOPROTECTIVE QUALITIES OF THE ADRENOCORTICOTROPIC HORMONE': 1, 'adrenocorticotropic hormone (ACTH)-secreting adenomas': 1, 'adrenocorticotropic hormone (ACTH) adenoma': 1, 'adrenocorticotropic hormone [': 1, 'ACTH-Carcinoma': 1, 'ACTH-specific deficiency': 1, 'deficiency of ACTH': 4, 'ACTH dysfunction': 1, 'EFFECT OF ADRENOCORTICOTROPIC HORMONE ON': 1, 'Adrenocorticotropic': 1, 'ADRENOCORTICOTROPIC HORMONE': 3, 'EFFECT OF ADRENOCORTICOTROPIC HORMONE': 2, 'adrenocorticotropic hormone (ACTH) insensitivity syndrome': 1, 'ACTH CHALLENGE TEST': 1, 'Ectopic Adrenocorticotropic hormone (ACTH) syndrome': 1, 'to adrenocorticotropic hormone': 2, 'adrenocorticotropic hormone hyperactivity': 1, 'hyperproduction of adrenocorticotropic hormone': 1, 'adrenocorticotropic impairment': 1, 'Adrenocorticotropic (ACTH)-producing neuroendocrine tumours': 1, 'of adrenocorticotropic hormone': 2, 'Adrenocorticotropic Hormone-': 1, 'adrenocorticotropic hormone dysfunction': 1, 'adrenocorticotropic- hormone': 1, 'ectopic adrenocorticotropic hormone (ACTH) syndrome': 1, 'ACTH) Syndrome': 1, 'ACTH paucity': 1, 'EFFECT OF THE ADRENOCORTICOTROPIC HORMONE': 1, 'ACTH anomalies': 1, 'ACTH disorders': 1, 'ACTH allergy': 1, 'ACTH microadenomas': 1, 'PAC': 1, 'PAC/EAC': 1, 'ACTH DEFICIENCY': 1, 'ACTH carcinoma': 1, 'ACTH+ microadenomas': 1, 'ACTH carcinomas': 1, 'adrenocorticotropic hormone (ACTH)-deficiency': 1, 'adrenocorticotropic hormone (': 2, 'ACTH-dependent disease': 1, 'ACTH Mimicry': 1, 'ACTH)': 2, 'ACTH hyper': 1, 'adrenocorticotropic hormone deficient': 1, 'pituitary adrenocorticotropic hormone (ACTH) deficiency': 1, 'ATCH-': 1, 'Adrenocorticotropic hormone (ACTH) deficient': 1, 'corticotropin (adrenocorticotropic hormone) deficiencies': 1, 'adrenocorticotropic hormone- and': 1, 'adrenocorticotropic hormone deficiencyx4': 1, 'adrenocorticotropic hormone, deficiency': 1, 'adrenocorticotropic hormone (ACTH) deficiencies': 1, 'adrenocorticotropic hormone (ACTH) syndrome': 1, 'adrenocorticotropic hormone-dependent disease': 1, 'adrenocorticotropic hormone (ACTH) microadenoma': 1, 'adrenocorticotropic hormone (ACTH) dysfunction': 1, 'ACTH deficiencya': 1, 'ACTH suppression': 1, 'deficiencies of adrenocorticotropic hormone': 1, 'production of adrenocorticotropic hormone': 1, 'ACT': 1, 'ACTH Syndrome,': 1, 'Adrenocorticotropic-': 1, 'ACTH) and': 1, 'ACTH-nemia': 1, 'ACTH-only deficiency': 1, 'adrenocorticotropic hormone (ACTH)-deficient': 1, 'deficiency in adrenocorticotropic hormone': 2, 'ATCH': 1, 'ACTH deficiency disease': 1, 'Adrenocorticotropic hormone (ACTH) deficiency disease': 1, 'abnormal adrenocorticotropic hormone': 1, 'ACTH and': 2, 'ACTH deficiency syndrome': 1, 'nonsynthetic adrenocorticotropic hormone': 1}
|
ACTH deficiency
|
Disease
|
MESH:C535669
|
{'actinic cheilitis': 561, 'AC': 149, 'angular cheilosis': 36, 'cheilosis': 113, 'Actinic cheilitis': 187, 'Actinic Cheilitis': 38, 'actinic cheilosis': 21, 'Chronic actinic cheilitis': 5, 'Candidal cheilosis': 1, 'Cheilosis': 12, 'AC lesions': 16, 'Actinic chronic cheilitis': 1, 'chronic actinic cheilitis': 6, 'actinic cheilitis of the lip': 1, 'actinic cheilitis angiofibroma': 1, 'solar cheilosis': 11, 'Solar Cheilosis': 1, 'Angular cheilosis': 10, 'D- actinic cheilitis': 1, 'angular, cheilosis': 1, 'CHEILOSIS': 1, 'ALLERGIC cheilosis': 1, 'ACUTE cheilosis': 1, 'Actinic cheilitis 1': 3, 'AC lesion': 3, 'Actinic cheilitis Lower lip': 1, 'actinic AC': 1, 'actinic cheilitis[Title': 1, 'solar cheilosis[Title': 1, 'actinic cheilosis[Title': 1, 'dysplasia AC': 1, 'AC of the': 1, 'cheilosis KS': 1, 'actinic cheilitis with epithelial dysplasia': 1, 'AC and': 1, 'actinic cheilitis (AC) lesions': 1, 'AC with no epithelial dysplasia': 1, 'AC with': 1, 'AC with mild epithelial dysplasia': 1, 'ACTINIC CHEILITIS': 1, 'actinic cheilitis: erratum': 1, 'Actinic cheilitis of': 1, 'actinic-related cheilitis': 1, 'Actinic cheilitis photophobia': 1, 'Actinic cheilitis Pale': 1, 'candidal cheilosis': 1, 'actinic cheilitis lesions': 2, 'non-actinic cheilitis': 2, 'lower lip Actinic cheilitis': 1, 'MDAC': 1, 'lip AC and': 1, 'AC with mild dysplasia': 1, 'AC dysplasia': 1, 'actinic or solar cheilosis': 1, 'actinic cheilitis of the lower lip': 2, 'Chronic actinic cheilitis of the lower lip': 1, 'AC of the lower lip': 1, 'actinic cheilitis of the lower': 2, 'Actinic cheilosis': 4, 'gastric AC': 1, 'Solar cheilosis': 4, 'SC': 3, 'Actinic cheilitis of lower lip': 2, 'CIAC': 1, 'Actinic (solar) cheilitis': 1, 'actinic cheilitis of the': 1, 'precancerous actinic cheilitis': 1, 'actinic cheilitis of': 1, 'lower-lip AC': 1, 'actinic cheilitis (': 1, 'AC)': 1, 'lower-lip AC lesions': 1, '-lip AC': 1, 'Actinic cheilitis Premalignant disorder of the lip': 1, 'CHRONIC ACTINIC CHEILITIS': 1, 'actinic-cheilitis': 1, 'Actinic cheilitis grade IV': 1, 'solar cheilosis:75': 1, 'Actinic cheilosis Malnutrition': 1, 'Actinic Cheilosis': 1, 'AC.3': 1, 'AC.16': 1, 'Chronic recurrent actinic cheilitis': 1, 'pigmented actinic cheilitis': 1, 'actinic cheilitis - AC': 1, 'oral cheilosis': 1, 'cheilosis and': 1}
|
actinic cheilitis
|
Disease
|
MESH:C535670
|
{'AEP': 51, 'PNF': 1, 'Agg-E': 2, 'exposed': 25, 'TE': 17, 'Exposed': 7, 'ESNs': 3, 'Accutane Related Teratogenicity': 1, 'ETOH': 1, 'isotretinoin': 92, 'ENI': 1, 'UKRAINIAN CHILDREN EXPOSED': 1, 'DOGS EXPOSED': 1, 'SEDI': 1, 'USE OF ISOTRETINOIN': 1, 'PiSCES': 1, 'ESN': 12, 'TLC': 7, 'ES': 4, 'isotretinoin embryopathy': 20, 'PO': 1, 'IE': 6, 'EEVIH': 1, 'EXPOSE-E': 2, 'EXPOSE-R': 2, 'TECs': 5, 'EXPOSED': 23, 'EXPOSED MARROW': 1, 'bone exposed': 2, 'PE': 19, 'Exposed fractures': 5, 'Exposed joint': 1, 'HREU': 1, 'HE': 38, 'ISE': 1, 'DEW': 1, 'DEWs': 3, 'FECC': 1, 'FECCs': 1, 'TCEM': 6, 'NE': 16, 'EG': 6, 'Exposing Deficiencies': 1, 'MEI': 2, 'MEI MEU': 1, 'MEU': 4, 'TEHCs': 3, 'TEHC': 12, 'EI': 2, 'GBE-ENT': 1, 'HESN': 18, 'ENA': 1, 'RATS EXPOSED': 6, 'SUPERVISION OF WORKERS EXPOSED': 1, 'EPs': 1, 'EIRD': 1, 'nonsyndromic HE': 1, 'ESA': 1, 'NEG': 4, 'MEBO': 21, 'exposed fractures': 4, 'III exposed fractures': 1, 'UE': 1, 'AE': 7, 'nPE': 2, 'MICE EXPOSED': 4, 'Accutane dysmorphic syndrome': 1, 'TCEMs': 5, 'UTERO EXPOSED': 1, 'CIS': 1, 'BACILLI EXPOSED': 1, 'EXS': 1, 'LS': 1, 'CE': 4, 'Exposed fractures of the tibia': 1, 'Accutane Related Teratogenicity': 3, 'CYREAICA EXPOSED': 1, 'SSET': 1, 'cutaneous substance loss exposing': 1, 'ME': 6, 'exposed infants': 1, 'AEPs': 7, 'AmpN': 1, 'AHEU': 2, 'TEC': 24, 'Exposed to Disease or': 1, 'SE': 7, 'MYCOBACTERIUM BOVIS-EXPOSED': 1, 'CHEU': 1, '-EXPOSED': 3, 'NP': 2, 'VEH': 1, 'NE-BRONJ': 1, 'Isotretinoin embryopathy': 6, 'UFPE': 1, 'Brain exposed': 1, 'ED': 2, 'NCE': 2, 'Exposed, Dysmorphic': 1, 'Accutane-Related Teratogenicity': 4, 'Exposed nerve': 1, 'NON-EXPOSED': 2, 'WEA': 1, 'NoVR': 1, 'RE': 4, 'Exposed bone': 4, 'AECs': 2, 'LE': 2, 'EE': 4, 'EAF': 1, 'Exposed breath': 1, 'Exposed temporalis muscle': 2, 'MAA': 1, 'BMX': 1, 'Exposed Defect': 1, 'Sul-Ds': 1, 'Alcohol Exposed Pregnancy': 1, 'ITN': 3, 'OE': 5, '-exposed lesions of the face': 1, 'Exposed Pregnancies': 2, 'AOeV': 1, 'accutane': 1, 'NEN': 2, 'LN': 1, 'ENZYME-EXPOSED RHO': 1, 'intermittent exposive disorder': 1, 'EITE': 2, 'alcohol-exposed pregnancy': 5, 'NTE': 3, 'Exposed ptosis': 1, 'VACUOLES EXPOSE CELLULAR GLYCANS THAT': 1, 'EP': 5, 'HEa': 1, 'NPC': 1, 'MEG': 2, 'LEG': 2, 'CHRONICALLY-EXPOSED': 1, 'DCE': 1, 'EXP': 4, 'HEPS': 4, 'ePS': 3, 'BE': 2, 'ISOTRETINOIN': 1, 'Accutane embryopathy': 1, 'ISO': 2, 'TC': 11, 'NEC': 1, 'HEI': 1, 'BEI': 1, 'NEI': 1, 'OF MICE EXPOSED': 1, 'Alcohol-Exposed Pregnancy': 3, 'ETV': 1, 'ENP': 1, 'SMART': 4, 'PERSONS OCCUPATIONALLY EXPOSED TO': 1, 'DEFINITION OF EXPOSED': 1, '-exposed skin': 1, 'INN': 3, 'TE-HC': 2, 'degeneration of the exposed brain': 1, 'SKULL EXPOSED': 1, 'OLD': 1, 'CHILDREN EXPOSED': 1, 'nonsyndromal HE': 2, 'OC': 1, 'isotretinoin syndrome': 3, 'ZEG': 1, 'ZNG': 1, 'GEM': 1, 'TCEM IIb': 1, 'TCEM IIa': 1, 'SPUTUM COLLECTED FROM EXPOSED': 1, 'CYTOKINE-EXPOSED': 1, 'DEC': 1, 'Mixedtrauma TC': 1, 'Mixedtrauma NTC': 1, 'Mixedtrauma NTC 7': 1, 'PAS': 1, 'Post-Accutane Syndrome': 1, 'TEIs': 1, 'AEx': 4, 'SRS': 1, 'ERYTHROCYTES EXPOSED': 1, 'RA': 1, 'HET': 1, 'isotretinoin birth defects': 1, 'Isotretinoin': 2, 'SPECIFIC INACTIVATION OF VIRUS BY SERA FROM PERSONS EXPOSED': 1, 'NT': 1, 'LCGSEC': 1, 'EAC': 1, 'E-MIST': 1, 'Exposed Disease': 1, 'exposed pregnancy': 1, 'TENC': 1, 'CHRONICALLY EXPOSED': 2, 'IOE': 1, 'nonsyndromal heavily exposed': 2, 'PPE': 1, 'EFFECTS OF FATS EXPOSED': 1, 'ASB': 1, 'NC': 3, '-exposed lesions': 1, 'OI': 2, "OI's": 1, 'Exposed wrinkled skin': 1, 'LEAVES CHILDREN EXPOSED': 1, 'HEU': 1, 'exPS': 1, 'MEx': 1, 'INDIVIDUALS EXPOSED': 1, 'Trauma': 1, 'bEBA': 1, 'sexually exposed infection': 1, 'overdose': 1, 'pterygium-E.': 1, 'pterygium-E': 1, 'isotretinoin extraocular myopathy': 1, 'PERSONS EXPOSED': 2, 'AEPRG': 1, 'QUARANTINE OF EXPOSED': 1, 'TRAUMA-EXPOSED': 2, 'EYS': 1, 'ACCUTANE-': 1, 'exposed injuries': 1, 'exposed infected': 1, 'HEU-P': 1, 'HBTI': 1, 'VAPOR CONT': 1, 'MED': 1, 'HIGH-DOSE ISOTRETINOIN': 1, 'EC': 1, 'Accutane': 1, 'DE': 2, 'accutane embryopathy': 1, 'NG': 1, 'eIPV': 1, 'TEJI': 1, 'MIM': 1, 'CIM': 1, 'Exposed sarcoma': 1, 'PATIENTS EXPOSED': 2, 'EdU': 1, 'POPULATION EXPOSED': 1, 'DIATOM EXPOSED': 1, 'MANAGEMENT OF CHILDREN EXPOSED': 1, 'Exposed brain': 1, 'Alcohol-exposed pregnancy': 1, 'exposed brain matter': 1, 'SEPs': 2, 'SKIN EXPOSED': 1, 'SMP': 1, 'NPE': 3, 'AsF': 1, 'TCs': 2, 'NEPs': 1, 'exposed skull': 1, 'NDE': 5, 'MEU DU': 1, 'TEPG': 1, 'gastric exposed aneurysm': 1, 'CE-IPV': 1, 'SEGs': 1, 'NonET lesions': 1, 'TEHC veterans': 1, 'EIU': 1, 'Isotretinoin Embryopathy': 1, 'abdominale exposant au syndrome metabolique': 1, 'IUDEI': 1, 'RATS EXPOSED REPEATEDLY': 1, 'PHEP': 1, 'TEP': 1, 'HUMANS EXPOSED': 1, 'CRP': 1, 'MYOCARDIUM EXPOSED': 1, 'PSPs': 1, 'Exposed malleus': 1, 'MEG-R': 1, 'NTC': 1, 'ASSESSMENTS OF THE EXPOSED': 1, 'H2O2 EXPOSED': 1, 'HEC': 1, 'SEI': 1, 'EIR': 1, 'EH': 1, 'RABBITS EXPOSED': 1, 'FEP': 1, 'ESN infection': 1, 'NN': 1, 'TRAUMA-EXPOSED INDIVIDUALS': 1, 'ATRIA EXPOSED': 1, 'PDET': 1, 'exposed brain malformation': 1, 'ATP-BD': 1, 'HE nonsyndromal': 1, 'EKyn': 1, 'TE Arousal': 1, 'TE Avoidance': 1, 'CE disease': 1, 'AIRMEN EXPOSED': 1, 'ET': 1, 'OIL': 1, 'DEFU': 1, 'skin exposed': 1, 'EXPO': 1, 'HCNE': 1, 'trauma exposed': 1, 'ASEP': 1, 'non-dysmorphic HE': 1, 'INVESTIGATION OF INDIVIDUALS EXPOSED': 1, 'ACE': 1, 'CTE': 1, 'H-PSCs': 1, 'AEC': 1, 'LDEN': 1, 'SPECIFICALLY EXPOSED': 1, 'PALUDOSA EXPOSED': 1, 'TEPs': 1, 'Exposed Fractures': 1, 'ONC': 1, 'CEP': 1, 'OEMs': 1, 'HEua': 1, 'isotretinoin overdosage': 1}
|
isotretinoin
|
Disease
|
MESH:C535672
|
{'cholinergic deficiencies': 36, 'cholinergic deficits': 367, 'cholinergic': 3597, 'cholinergic deficit': 608, 'Cholinergic': 324, 'CAP': 145, 'cholinergic deficiency': 379, 'cholinergic impairment': 101, 'cholinergic dysfunction': 1418, 'cholinergic hypofunction': 251, 'cholinergic system deficit': 4, 'CU': 16, 'cholinergic urticaria': 154, 'cholinergic damage': 35, 'cholinergic syndrome': 150, 'and cholinergic': 6, 'Cholinergic deficits': 27, 'cholinergic dysfunctions': 59, 'cholinergic hyperactivity': 118, 'cholinergic degeneration': 322, 'Cholinergic hypofunction': 36, 'Cholinergic urticaria': 35, 'dopaminergic and cholinergic cortical dysfunction': 1, 'cholinergic system abnormalities': 4, 'cholinergic abnormalities': 79, 'cholinergic crisis': 85, 'cholinergic urticaria syndrome': 1, 'cholinergic symptoms': 20, 'cholinergic parietal lesions': 1, 'Cholinergic hyperactivity': 6, 'CHOLINERGIC': 50, 'dopaminergic and cholinergic receptors': 1, 'cholinergic hypersensitivity': 44, 'CINs': 62, 'CIN': 22, 'cholinergic anti-inflammatory': 87, 'cholinergic neurodegeneration': 17, 'cholinergic lesion': 53, 'Cholinergic dysfunction': 188, 'cholinergic terminal deficits': 2, 'cholinergic neurons of the nucleus basalis of Meynert': 1, 'ChIs': 53, 'Cholinergic deficiency': 50, 'Adrenergic-cholinergic': 1, 'CAIP': 23, 'cholinergic toxicity': 79, 'cholinergic loss': 13, 'Cholinergic deficit': 28, 'cholinergic crises': 11, 'cholinergic dysautonomia': 15, 'incomplete postganglionic cholinergic dysautonomia': 1, 'cholinergic system degeneration': 13, 'cholinergic system impairment': 4, 'Cholinergic Dysfunction': 45, 'cholinergic deficiency syndromes': 1, 'cholinergic overstimulation': 7, 'CHOLINERGIC MODULATION': 2, 'of cholinergic': 8, 'cholinergic neuron': 16, 'injury to the MCP': 1, 'neuronal loss of the MCP': 1, 'CENTRAL CHOLINERGIC': 2, 'CHIPS': 8, 'Serotoninergic and cholinergic syndromes': 1, 'serotoninergic and cholinergic syndrome': 1, 'cholinergic syndromes': 4, 'serotoninergic and cholinergic syndromes': 1, 'cholinergic disorders': 30, 'Cholinergic Disorders': 1, 'cholinergic poisoning': 18, 'cholinergic neuron loss': 34, 'cholinergic immunotoxic': 1, 'ChIs dysfunction': 1, 'cholinergic excess': 2, 'adrenergic non-cholinergic': 4, 'dopaminergic or cholinergic degenerations': 1, 'cholinergic degenerations': 7, 'cholinergic hyperreactivity': 3, 'non-cholinergic': 9, 'THE DISTRIBUTION OF CHOLINERGIC': 1, 'of the cholinergic': 5, 'Cholinergic Degeneration': 6, 'cholinergic block': 2, 'MPCh dysfunction': 1, 'CHOLINERGIC SYNAPSES': 1, 'degeneration of cholinergic nucleus basalis': 1, 'cholinergic deficiency syndrome': 8, 'cholinergic neuron death': 5, 'Impairment of ChIs': 1, 'Pure cholinergic dysautonomia Multi-system atrophy': 1, 'dysfunction of the cholinergic system': 2, 'cholinergic system dysfunction': 39, 'cholinergic neurons': 77, 'of cholinergic nervous system': 1, 'CAIS': 1, 'Cholinergic impairment': 6, 'CGINs': 1, 'cholinergic neuronal deficits': 2, 'cholinergic hypoactivity': 18, 'CUTANEOUS CHOLINERGIC SYSTEM': 1, 'central cholinergic deficiency syndrome': 2, 'CDS': 2, 'ChI': 9, 'cholinergic disturbances': 2, 'anti-cholinergic syndrome': 3, 'dysfunction of cholinergic synapses': 1, 'Cholinergic deficiency syndrome': 1, 'cholinergic system': 13, 'cortical cholinergic': 2, 'cholinergic neuron abnormalities': 2, 'cholinergic injury': 16, 'cholinergic decline': 5, 'cholinergic-like syndrome': 4, '-cholinergic toxicity': 1, 'Cholinergic syndrome': 34, 'cholinergic lesions': 73, 'Cholinergic lesions': 6, 'Cholinergic System Dysfunction': 4, 'cholinergic atrophy': 6, 'CHOL': 1, 'PCS': 2, 'cholinergic neuron atrophy': 3, ', non-cholinergic': 8, 'Cholinergic abnormalities': 13, 'cholinergic impairments': 12, 'cholinergic neurodeath': 1, 'Impairments of the cholinergic': 1, 'dopaminergic/cholinergic degeneration': 1, 'impaired cholinergic neurotransmission': 1, 'ACS': 5, 'acute cholinergic syndrome': 6, 'cholinergic neuron damage': 18, 'cholinergic urticariaor': 1, 'VAGAL CHOLINERGIC': 1, 'CholU': 28, 'of the nicotinic cholinergic': 1, 'CHRNE': 1, 'cholinergic fiber loss': 2, 'SCI': 2, 'cholinergic system disorders': 2, 'Dysfunction of Central Cholinergic': 1, 'cholinergic transmission deficiency': 1, 'of central cholinergic neurotransmitters': 1, 'neuronal cholinergic': 1, 'cholinergic terminal dysfunction': 1, 'cholinergic interneuron': 2, 'ChI)': 1, 'cholinergic abnormality': 11, 'impairment of the CAP': 1, 'CHOLINERGIC DISTURBANCES': 1, 'cholinergic disorder': 14, 'cholinergic overactivity': 16, 'cholinergic neuritic dystrophy': 4, 'Cholinergic Urticaria': 10, 'degeneration of cholinergic': 4, 'CholU.': 15, '-cholinergic': 4, 'cholinergic and': 2, 'CS': 5, 'Cholinergic degeneration': 24, 'cholinergic neural deficiency': 1, 'cholinergic and dopaminergic deficiency': 1, 'CHRN': 2, 'CIN-d': 1, 'deficits of cholinergic neurotransmission': 1, 'cholinergic hyper-': 2, 'cholinergic dyshomeostasis': 1, 'cholinergic hyper-stimulation': 1, 'cholinergic neuron disease': 1, 'cholinergic neuron diseases': 1, 'cholinergic hypofunctions': 3, 'cholinergic receptors': 1, 'and cholinergic autonomic': 1, 'cholinergic contraction': 1, 'cholinergic toxidrome': 6, 'gastrointestinal and cholinergic': 1, 'muscarinic cholinergic symptoms': 1, 'Cholinergic Syndrome': 4, 'degeneration of cholinergic nuclei': 4, 'neuronal cholinergic deficit': 2, 'cholinergic cell loss': 2, 'hippocampal cholinergic deficiency': 1, 'cholinergic synaptic atrophy': 1, 'Ac': 1, 'ELN': 1, 'atrophy of cholinergic neurons': 9, 'PHARMACOLOGICAL CHOLINERGIC MODALITIES': 1, 'cholinergic defects': 8, 'CHOLINERGIC SUBSTANCES': 1, 'Dysfunction of Cholinergic Neurotransmission': 1, 'autonomic cholinergic hyperactivity': 1, 'corticopetal cholinergic': 2, 'cholinergic neuronal deficit': 1, 'autonomic cardiac (cholinergic) dysregulation': 1, 'cholinergic hypofunctions in': 1, 'Cholinergic system impairment': 1, 'brain cholinergic system': 1, 'EFFECT OF CHOLINERGIC': 1, 'degeneration of cholinergic system': 2, 'excitotoxic lesion of cholinergic': 1, 'cholinergic systems': 1, 'and cholinergic degeneration': 1, 'Cholinergic Abnormalities': 2, 'cholinergic-deficit': 2, 'cholinergic encephalopathies': 11, 'Immunotoxic cholinergic': 1, 'cholinergic neurotransmission impairment': 2, 'NNCS': 9, 'ChU': 6, 'ChU.': 3, 'Ch4 degeneration': 2, 'Ch4) degeneration': 1, 'Cholinergic nucleus 4': 1, 'Cholinergic nucleus 4 (': 1, 'Cholinergic rebound syndrome': 1, 'cholinergic rebound syndrome': 3, 'Rebound cholinergic syndrome': 1, 'rebound cholinergic syndrome': 1, 'cholinergic rebound': 1, 'hyperactivity of CHNs': 1, 'cholinergic disease': 6, 'sympathetic and cholinergic system degeneration': 1, 'DF-chN': 1, 'cholinergic nerve disorders': 2, 'Cholinergic lesion': 2, 'NGSN': 1, 'Alzheimer-like synaptic and cholinergic deficits': 1, 'Cholinergic System Dysfunctions': 1, 'impairment of cholinergic functions': 2, 'cholinergic toxicities': 2, 'Cholinergic crisis': 20, 'cholinergic neuronal decline': 1, 'cholinergic nerve hyperactivity': 2, 'cholinergic neuronal loss': 6, 'Cholinergic system dysfunction': 5, 'abnormalities of central cholinergic': 1, 'CHRNAs': 1, 'cholinergic impairment-related': 1, 'myasthenic and cholinergic crises': 2, 'n-cholinergic EPSP': 1, 'cholinergic system disorder': 3, 'cholinergic hypo-function': 2, 'PERIPHERAL CHOLINERGIC': 2, 'AFFECTED CHOLINERGIC': 1, 'cholinergic gamma': 1, 'cholinergic nerve dysfunction': 4, 'cholinergic toxicosis': 5, 'cholinergic hyperintensities': 1, 'Cholinergic Hyperintensities': 1, 'cholinergic receptor degeneration': 1, 'Cholinergic synapse': 2, 'Cholinergic energy deficiency': 1, 'Cholinergic and non-cholinergic dysfunctions': 1, 'central cholinergic nucleus': 1, 'SCS': 2, 'Cholinergic Discontinuation': 1, 'Cholinergic symptoms': 4, 'myasthenic and cholinergic crisis': 1, 'Cholinergic Anti-Inflammatory': 3, 'cholinergic malfunction': 3, 'cholinergic cortical deficits19': 1, 'Cholinergic neurodegeneration': 1, 'ChIN': 3, 'cholinergic neuron deficiency': 2, 'NON-CHOLINERGIC': 4, 'cholinergic hyperexcitation': 2, 'impairment of the cholinergic': 1, 'cholinergic hyper-responsiveness': 1, 'dysfunction of cholinergic system': 1, 'dopaminergic and cholinergic degeneration': 1, 'cholinergic and dopaminergic degeneration': 1, 'cholinergic deficits of the basal': 1, 'abnormality of cholinergic': 1, 'cholinergic enzyme deficiency': 1, '-Cholinergic': 2, 'frontal cholinergic deficits': 1, 'CNS cholinergic': 1, 'SChI dysfunction': 1, 'hyperactivity of the cholinergic': 2, 'frontal cholinergic dysfunction': 1, 'cholinergic deficit dementia': 2, 'Cholinergic anti-inflammatory': 2, 'CHOLINERGIC INTERNEURONES': 1, 'degeneration of the cholinergic nucleus basalis of Meynert': 1, 'cholinergic nucleus basalis': 2, 'cholinergic toxic syndrome': 4, 'CINs lesions': 1, 'AUTONOMIC CHOLINERGIC': 1, 'cholinergic motor neuron hyperactivity': 1, 'ChINs': 10, 'cholinergic overdose': 3, 'CHRM': 1, 'Cholinergic Neuron Lesion': 1, 'Cholinergic dysfunctions': 3, 'Dysfunction of the CAP': 2, 'CAP malfunction': 1, 'cholinergic activity deficit': 1, 'CHOLINERGIC NEUROTRANSMISSION': 1, 'Sympathetic cholinergic': 2, 'muscarinic cholinergic': 5, 'deficiency in the CAP': 1, 'cholinergic denervation hypersensitivity': 1, 'acute dysautonomia': 1, 'abnormalities of central cholinergic transmission': 1, 'Cholinergic Deficiency': 3, 'dysfunction of CAP': 2, 'Dysfunction of CAP': 1, 'adrenergic, non-cholinergic': 2, 'Impairment of cholinergic neurotransmission': 1, 'cholinergic neurotransmitter': 2, 'cholinergic transmission disorders': 2, 'cholinergic seizures': 2, 'STRIATAL NICOTINIC CHOLINERGIC': 1, 'cholinergic neuron injury': 4, 'presynaptic cholinergic deficiency': 1, 'NEURODEGENERATION OF CHOLINERGIC': 1, 'ChoU': 1, 'cholinergic nucleus basalis of Meynert': 1, 'cholinergic cell degeneration': 3, 'cholinergic and N-type calcium channel': 1, 'CHOLINERGIC NERVOUS SYSTEM': 1, 'corticopetal cholinergic lesions': 1, 'degeneration of the cholinergic nervous system': 1, 'cholinergic neuron dysfunction': 10, 'cholinergic systems degenerations': 1, 'cholinergic hyposensitivity': 1, 'Muscarinic cholinergic hyperactivity': 1, 'cholinergic neurochemical abnormalities': 1, 'cholinergic motor neuron loss': 1, 'atrophy of central cholinergic neurons': 1, 'DL': 1, 'cholinergic-': 1, 'degeneration of the cholinergic': 1, 'cholinergic and noradrenergic degeneration': 1, 'N-CE': 2, 'N-cholinergic': 1, 'deficiency of cholinergic neurons': 2, 'A-MNs': 2, 'cortex cholinergic dysfunction': 1, 'cholinergic or adrenergic dysfunction': 1, 'impairment of cholinergic': 4, 'cholinergic neuropathology': 1, 'cholinergic synaptic impairment': 1, 'cholinergic neuron deficits': 1, 'cholinergic nucleus': 2, 'CHOLINERGIC SYSTEM': 4, 'Cholinergic disorder': 4, 'cholinergic hyper-excitability': 1, 'atrophy of the cholinergic': 4, 'dopaminergic and cholinergic': 1, 'postganglionic cholinergic dysautonomia': 2, 'Postganglionic Cholinergic Dysautonomia': 1, 'Postganglionic cholinergic dysautonomia': 1, 'PCD': 2, 'cholinergic hypothisis': 1, 'Cholinergic Symptoms': 2, 'Central cholinergic dysfunction': 1, 'degeneration of the cholinergic nucleus of': 1, 'hippocampal cholinergic impairment': 1, 'SCF': 1, 'cholinergic deficit-related dementia': 1, 'of cholinergic neuronal': 2, 'cholinergic diseases': 2, 'Cholinergic deficiencies': 1, 'cholinergic deficiency disorders': 1, 'cholinergic and adrenergic syndrome': 1, 'CHIs': 3, 'muscarinic type cholinergic hyperactivity': 1, 'cholinergic and noradrenergic neurons': 2, 'SHC degeneration': 1, 'SHC)': 1, 'SHC lesion': 1, 'SHC': 1, 'cholinergic anti-inflammatory deficiency': 2, 'cholinergic blockade': 5, 'deficiency of central cholinergic neurotransmitter': 1, 'dopaminergic and cholinergic degenerations': 2, 'degeneration of cholinergic functions': 1, 'cholinergic memory': 1, 'Cholinergic depression': 1, 'cholinergic depression': 6, 'myasthenic or cholinergic crisis': 1, 'ACR': 1, 'cholinergic axonal degeneration': 1, 'ACh neuron loss': 1, '-cholinergic synapse dysfunction': 1, 'Cholinergic crises': 2, 'CIP': 1, 'CHRONIC CHOLINERGIC': 1, 'cholinergic neuritis': 6, 'ChI.': 2, 'ADMINISTERED CHOLINERGIC': 1, 'cholinergic lesions of the MS': 1, 'cholinergic-like symptoms': 1, 'MUSCARINIC CHOLINERGIC': 1, 'cholinergic neurotransmission': 5, 'Cholinergic Injury': 2, 'Cholinergic Deficits': 3, 'cholinergic neurotransmission abnormalities': 1, 'CF': 1, 'cholinergic neuronal': 2, 'dysfunction of the cholinergic': 4, 'Cholinergic neurons': 1, 'Myasthenic or cholinergic crisis': 1, 'cholinergic lesions of the': 1, 'cholinergic adverse effects': 6, 'ACB': 3, 'cholinergic neurotransmission deficiency': 2, 'cholinergic weakness': 3, 'damage to cholinergic neurons': 1, 'cholinergic lesion of the MS': 1, 'cholinergic lesion of the hippocampus': 1, 'Central Cholinergic Dysfunction': 1, 'cholinergic neuron disorders': 1, 'cholinergic terminal damage': 2, 'Sympathetic noradrenergic and cholinergic abnormalities': 1, 'alpha-adrenergic and cholinergic hypersensitivity': 2, 'PPN cholinergic': 1, 'ACh': 1, 'Cholinergic system degeneration': 3, 'immunotoxic cholinergic lesion': 1, 'and cholinergic-loss': 1, 'NNCS dysfunction': 1, 'NCS impairment': 1, 'NCS dysfunction': 1, 'NCS': 4, 'NNCS depression': 1, 'cholinergic overdrive': 7, 'Cholinergic dysautonomia': 2, 'cholinergic neurotransmission deficiencies': 1, 'Cholinergic disorders': 2, 'cholinergic fiber dystrophy': 1, 'cholinergic neuropathy': 7, 'Cholinergic dementia': 1, 'cholinergic dementias': 1, 'Cholinergic dementias': 1, 'cholinergic dementia': 2, 'cholinergic dysregulation': 5, 'Acute cholinergic syndrome': 2, 'cholinergic fiber neuropathy': 1, 'Cholinergic enzyme deficiency': 2, 'CholU-PA': 2, 'adrenergic and cholinergic hyperreactivity': 1, 'degeneration of cholinergic axons': 1, 'CholNeuro': 1, 'THE CHOLINERGIC': 1, 'cholinergic receptor nicotinic delta': 1, 'THE CHOLINERGIC ANTI-INFLAMMATORY': 1, 'cholinergic lesions of the nucleus': 1, 'endosomal and cholinergic abnormalities': 1, 'EFFECTS OF CHOLINERGIC': 4, 'post-ganglionic cholinergic dysautonomia': 1, 'Post-ganglionic cholinergic dysautonomia': 1, 'Cholinergic toxicity': 1, 'hyper-cholinergic': 1, 'of cholinergic neurons': 1, 'deficiency of the central cholinergic system': 1, 'CHOLINERGIC REGULATION OF': 1, 'necrosis of cholinergic neurons': 1, 'cerebral cholinergic dysfunction': 3, 'cholinergic neuromuscular hyperactivity': 3, 'cholinergic degenerative': 1, '-adrenergic non-cholinergic': 4, 'APROPOS OF CHOLINERGIC CHANGES': 1, 'septohippocampal cholinergic degeneration': 2, 'cholinergic neuronal dysfunction': 4, 'atrophy of the cholinergic basal': 1, 'PPN': 1, 'cholinergic synaptic transmission deficiency': 1, 'impairment of CCP': 1, 'CCP impairment': 2, 'CCP hyperintensities': 1, 'CCP': 2, 'brain cholinergic': 1, 'CIU symptoms': 1, 'CIU': 1, 'cholinergic dys-autonomy': 1, 'ChoIU': 1, 'cholinergic neuronal death': 3, 'nicotinic cholinergic abnormality': 1, 'FEATURES OF THE CHOLINERGIC REACTION IN THE HEART OF ANODONTA': 1, 'cholinergic neurotransmitter deficiencies': 1, 'CHN': 1, 'cholinergic hypofunction in the brain': 1, 'cholinergic dysfunction or degeneration': 1, 'cholinergic terminal degeneration': 1, 'peripheral and cerebral cholinergic': 1, 'learning and cholinergic deficiencies': 1, 'Cholinergic Deficit': 2, 'cholinergic nerve reduction': 1, 'cholinergic neuron deficiencies': 1, 'degeneration in the cholinergic': 1, 'of the central cholinergic neurons': 1, 'Cholinergic impairments': 2, 'LCIs': 2, 'cholinergic fibre degeneration': 1, 'cholinergic system deficiency': 3, 'Dysfunction of central cholinergic neurons': 1, 'neurologic anti-cholinergic': 1, 'Deficiency of cholinergic reserve': 1, 'NCS dysregulation': 2, 'Dysfunction in cholinergic': 1, 'gastrointestinal cholinergic': 1, 'impairment of cholinergic neurotransmission': 1, 'CC': 1, 'CHOLINERGIC DRUGS': 1, 'CHOLINERGIC MECHANISM OF SYNAPTIC TRANSMISSION': 1, 'impaired cholinergic': 1, 'Atrophy of cholinergic': 1, 'atrophy of cholinergic': 1, 'CH': 2, 'Cholinergic nerve dysfunction': 1, 'NNCCS': 1, 'cholinergic lesions in the nucleus basalis magnocellularis': 1, 'cholinergic deterioration ailments': 1, 'CHOLINERGIC PROCESSES': 1, 'Cholinergic System Deficiency': 1, 'cholinergic deficit in': 1, 'insufficiency of cholinergic function': 1, ', and Cholinergic Dysfunction': 1, 'cholinergic AE': 1, 'cholinergic TEAEs': 1, 'acute cholinergic-like syndrome': 1, 'CHOLINERGIC MECHANISMS': 2, 'cholinergic hypo-': 1, 'pupillary cholinergic denervation hypersensitivity': 1, 'cholinergic system dysfunctions': 1, 'neuronal cholinergic deficits': 1, 'deficit of cholinergic neuron': 1, 'Cholinergic toxic syndrome': 1, 'toxic cholinergic syndrome': 2, 'cholinergic-monoaminergic hypofunction': 1, 'CGL': 2, 'dysfunction of cholinergic': 1, 'cholinergic nerve system dysfunction': 1, 'cerebral cholinergic deficiency': 1, 'LOCAL CHOLINERGIC-': 1, 'cholinergic disfunction': 4, 'CAP deficiency': 1, 'BRAIN CHOLINERGIC': 1, 'CHOLINERGIC SIGNALING': 4, 'cholinergic neurotransmitter deficit': 3, 'CHOLINERGIC MECHANISM': 1, 'degeneration of the cholinergic brain': 1, 'cholinergic degeneration in the brain': 1, 'CHI': 1, 'cholinerger Urtikaria': 1, 'CAP disruption': 1, 'DUAL CHOLINERGIC': 1, 'cortical cholinergic lesion': 1, 'LINKING CHOLINERGIC': 1, 'ANTI-CHOLINERGIC': 1, 'NON-NEURONAL CHOLINERGIC': 1, 'ROLE OF CHOLINERGIC': 1, 'cholinergic, degeneration syndrome': 1, 'CDF': 1, 'cholinergic autonomic blockade': 1, 'Dopaminergic and cholinergic deficit': 1, 'cholinergic functional impairment': 1, 'cholinergic disfunctions': 1, 'Impairment of performance Cholinergic system': 1, 'cholinergic dysconnection': 1, 'CN': 1, 'damage to cholinergic function,52': 1, 'cholinergic or noradrenergic dysfunction': 1, 'CHOLINERGIC HYPOTHESIS': 1, 'CHOLINERGIC TREATMENTS': 1, 'noradrenergic and cholinergic neurotransmitter dysfunction': 1, 'cerebral cholinergic deficit': 1, 'SC': 1, 'NB injury cholinergic': 1, 'NANC dysfunction': 1, 'sympathetic cholinergic': 2, 'cholinergic fiber lesions': 1, 'cholinergic interneuron degeneration': 1, 'cholinergic neuromodulation disorder': 1, 'cholinergic hyperactivity in the': 1, 'cholinergic nerve': 2, 'Cholinergic Atrophy': 1, 'cardio-depressive cholinergic': 1, 'CholU symptom': 1, 'CholU-QoL': 1, 'Cholinergic anti-inflammatorypathway': 1, 'PTCNs': 1, 'cholinergic mnemonic impairments': 1, 'CHO': 1, 'cardiac cholinergic': 1, 'hyperactivity of cholinergic': 2, 'CholNS': 1, 'cholinergic interneuron hypofunction': 1, 'cholinergic neural dysfunctions': 1, 'of the NCS': 1, 'cholinergic neurotoxicity': 2, 'Cholinergic Anti-inflammatory': 3, 'cholinergic-dopaminergic lesions': 1, 'PERIPHERAL CHOLINERGIC AUTONOMIC ORGAN CHANGES': 1, 'cholinergic disfunctions in': 1, 'ILG': 1, 'neurotoxic cholinergic lesion': 1, 'neurotoxic cholinergic': 1, 'immunotoxic cholinergic lesions': 3, 'cholinergic nerve injury': 4, 'nNCS': 1, 'LAIs': 1, 'CCP lesions': 1, 'Impairment of cortical cholinergic pathways': 1, 'cholinergic, dopaminergic, and noradrenergic deficiencies': 1, 'Ach': 1, 'systemic cholinergic urticarial': 1, 'ACTION OF CHOLINERGIC': 1, 'cholinergic presynaptic deficits': 1, 'LAAC': 1, 'CHINs': 1, 'Alzheimer-like cholinergic deficiency': 1, 'mitochondrial and cholinergic deficits': 1, 'cholinergic neuron lesions': 1, 'myasthenic or cholinergic crises': 1, 'cholinergic system defect': 1, 'cholinergic neurodeficit disorder': 1, 'SCINs': 2, 'cholinergic fiber degeneration': 2, 'cholinergic hypometabolism': 1, 'striatal cholinergic': 1, ') cholinergic adverse': 1, 'autoimmune lesion of cholinergic receptors': 1, 'of the neurological cholinergic': 1, "cholinergic urticaria'10": 1, 'Acute Cholinergic Syndrome': 1, 'cholinergic nerve hypoactivity': 1, 'myasthenic or cholinergic': 1, 'Acb CINs': 1, 'neuronal nicotinic cholinergic': 1, 'Cholinergic nerve': 1, 'cholinergic dysfunction-': 1, 'CHOLINERGIC TRANSMISSION': 2, 'cholinergic deficit in the cerebral cortex': 1, 'of cholinergic neuron': 1, 'CIN-SPN': 1, 'cholinergic neuronal deterioration': 1, 'cholinergic and nicotinic symptoms': 1, 'cholinergic dystrophy': 1, 'and Cholinergic': 2, 'cholinergic (Ach) syndrome': 1, 'central cholinergic syndrome': 3, 'Sympathetic cholinergic dysfunction': 1, 'cholinergic-related disease': 1, 'LCI abnormalities': 1, 'developmental abnormality of LCI': 1, 'LCI': 1, 'cortical cholinergic impairment': 1, 'disorder of cholinergic function': 1, 'dopaminergic-cholinergic lesions': 1, 'dopaminergic-cholinergic deficits': 1, 'dopaminergic and cholinergic deficiencies': 1, 'depressed cholinergic': 2, 'NICOTINIC CHOLINERGIC': 1, 'neuropsychiatric cholinergic disturbances': 1, 'muscarinic cholinergic dysfunction': 1, 'cholinergic nerve disease': 1, 'impairment of cholinergic function': 1, 'cholinergic neuronal lesions': 2, 'cholinergic nucleus basalis deficits': 1, 'cortical cholinergic deficiency': 1, 'cholinergic nerve dependence': 1, 'SCIN': 2, 'SCIN dysfunction': 1, 'cerebellar cholinergic disorders': 1, 'cMPT lesion': 1, 'hyperactivity of cholinergic receptors': 2, 'SCIs': 2, 'cholinergic dysfunction-associated disorders': 1, 'cholinergic and noradrenergic deficits': 1, 'Cholinergic blockade': 1, 'the CAP': 1, 'cholinergic transmission': 1, 'cholinergic (overdosage) crisis': 1, 'CDS symptoms': 1, 'Cholinergic Deficiency Syndrome': 1, 'dopaminergic and cholinergic dysfunction': 1, 'Cholinergic degeneration in': 1, 'cholinergic dysfunctionBlocked': 1, 'paralysis of cholinergic synaptic': 1, 'deficiency in cholinergic': 1, 'cholinergic agitation': 1, 'deficit of cholinergic': 2, 'CCCs': 1, 'deficiency of cholinergic neurotransmission': 2, 'CCC': 1, 'tracheal CCC': 1, 'NON-CHOLINERGIC NEURONS': 1, 'Impairment of central cholinergic function': 1, 'Cholinergic Toxicity': 2, 'CINs hyperactivity': 1, 'deficit of cholinergic function': 1, 'impaired cholinergic function': 2, 'cholinergic nerve injuries': 1, 'of the Ch': 1, 'Ch deficits': 1, 'Ch': 1, 'Ch blockade': 1, 'Impairments to the Ch': 1, 'noradrenergic and cholinergic dysfunction': 1, 'Cholinergic system degeneration or dysfunction': 1, 'Central cholinergic deficiency': 2, 'gastrointestinal CAP': 1, 'Cholinergic Interneuron Dysfunction': 1, 'Cholinergic hyperexcitation': 1, 'anti-cholinergic': 2, 'cholinergic disruption': 1, 'cholinergic injuries': 1, 'hippocampal cholinergic neurons': 1, 'Impairment of the Cholinergic': 1, 'cholinergic nervous system degeneration': 1, 'cholinergic nervous system': 1, 'cholinergic neuronal lesion': 1, 'cholinergic neuropathologies': 1, 'Cholinergic Dysfunctions': 1, 'disturbances of cholinergic': 1, 'cholinergic transmission deficits': 1, 'Cholinergic Encephalopathies': 1, 'Cerebral cholinergic deficits': 1, 'noradrenergic and cholinergic hypofunction': 1, 'neuronal cholinergic dysfunction': 1, 'Dysfunction of cholinergic': 1, 'ChIs hyperactivity': 1, 'ChIs abnormality': 1, 'glutamatergic and cholinergic': 2, 'cholinergic neuronal impairment': 1, 'ROLE OF CHOLINERGIC NEURONS': 1, 'cholinergic deformities': 1, 'cholinergic nerve terminal loss': 1, 'deprivation of cholinergic functions': 1, 'muscarinic and cholinergic syndrome': 1, 'cholinergic terminal loss': 1, 'ChEIs': 1, 'CSI': 1, 'NC': 1, 'ChI abnormalities': 1, 'ChI degeneration': 1, 'ChI neurodegeneration': 1, 'SAT-CholU': 1, 'CholU-Anhd': 1, 'cholinergic urticarial': 1, 'cholinergic synaptic disorder': 1, 'cholinergic nuclei degeneration': 1, 'CHOLINERGIC NEURONS': 2, 'OF CHOLINERGIC': 1, 'cholinergic (muscarinic) symptoms': 1, 'cholinergic-dysfunction': 1, 'cholinergic-clysfunction': 1, 'cholinergic neurodedegeneration': 1, 'CHOLINERGIC-SPECIFIC ANTIGEN': 1, 'atrophy of cholinergic nuclei': 1, 'and cholinergic disturbances': 1, 'cholinergic hypofunctioning': 1, 'CAP dysfunction': 2, 'CFD': 1, 'cholinergic axonopathy': 1, 'CASs': 1, 'cholinergic, non-adrenergic': 1, 'cholinergic transmitter-related enzyme deficiency': 1, 'deficiency of the cholinergic nervous function': 1, 'Cholinergic Impairments': 1, 'hyperactivity of cholinergic nerves': 1, 'anti-cholinerg syndrome': 1, 'cholinergic deficient': 1, 'cholinergic nerve impairment': 1, 'cholinergic fiber abnormalities': 2, 'impairment of the CAIP': 1, 'Nicotinic Cholinergic': 1, 'MECHANISM FOR CHOLINERGIC MODULATION': 1, 'cortical and subcortical cholinergic deficits': 1, 'cholinergic autonomic dysfunction': 2, 'CHRNs': 2, 'CAP detriment': 1, 'Cholinergic Hypofunction': 1, 'cholinergic cortical': 1, 'EFFECT OF SOME CHOLINERGIC': 1, 'CHIPS WMHs': 1, 'glutamatergic and cholinergic dysfunction': 1, 'THE CHOLINERGIC HYPOTHESIS': 1, 'cholinergic degeneration and dysfunction': 1, 'CHOLINERGIC NERVES': 1, 'of the Cholinergic': 3, 'the cholinergic neuromuscular': 1, 'degeneration of the cholinergic nucleus basalis': 1, 'Autonomic cholinergic dysfunction': 1, 'THE CHOLINERGIC RECEPTORS': 1, 'gastrointestinal, cholinergic, and hepatic adverse reactions': 1, 'cholinergic excitation syndrome': 1, 'SCS overactivity': 1, 'sympathetic cholinergic system': 1, 'Cholinergic neuronal defect': 1, 'sympathetic cholinergic neuropathy': 1, 'cholinergic transmission deficiency diseases': 1, 'THE CHOLINERGIC NERVE ENDINGS': 1, 'Cholinergic neurotoxicity': 1, 'neurotoxic Cholinergic': 1, 'pathological lesion of cholinergic neuron': 1, 'cognitive and cholinergic deterioration': 1, 'paralysis of cholinergic': 1, 'Cholinergic Crisis': 2, 'atrophy of cholinergic regions': 1, 'Myasthenic or cholinergic': 1, 'CHOLINERGIC DIFFERENTIATION': 1, 'degeneration of central cholinergic systems': 1, 'cholinergic adverse': 2, 'muscarinic cholinergic overactivity': 1, 'cholinergic-related diseases': 1, 'cholinergic axonal dystrophy': 1, 'Cholinergic axonal dystrophy': 1, 'Impairments in the cerebral cholinergic': 1, 'cholinergic-deficiency': 1, 'cholinergic neurotransmitter deficiency': 1, 'cholinergic reduction': 1, 'Cholinergic Hyperactivity': 1, 'Cholinergic Dysautonomia': 1, 'CND': 1, 'mesopontine cholinergic deficiency': 1, 'OTHER CHOLINERGIC': 1, 'cholinergic miosisa': 1, 'central cholinergic nervous': 1, 'Cholinergic system': 1, 'CHOLINERGIC SYNAPSE': 1, 'cholinergic function deficit': 1, 'POTENTIAL OF CAP': 1, 'type 2 and 3 ChIs': 1, 'degeneration of cortical cholinergic': 1, 'MUSCARINIC CHOLINERGIC SYSTEM': 1, 'cholinergic neuron system dysfunction': 1, 'Central anti-cholinergic syndrome': 1, 'central anti-cholinergic syndrome': 1, 'cholinergic neuron defects': 1, 'and type-II cholinergic': 1, 'CINs SVs': 1, 'hypohidrotic cholinergic urticaria': 1, 'hyperplasia of adrenergic and cholinergic nerve fibres': 1, 'cholinergic nerve involvement': 1, 'cholinergic receptor dysfunction': 1, 'Ch4': 1, 'CHU': 1, 'CIN-dysfunction': 1, 'cholinergic underactivity': 1, 'cholinergic hypo': 1, 'ChS': 1, 'CHRNG': 1, 'Dysfunction of the cholinergic basal': 1, 'Cholinergic System and Dysfunction': 1, 'cholinergic fasciculus retroflexus': 1, 'motor deficit': 1, 'motor disorder': 1, 'motor impairment': 1, 'motor disturbances': 1, 'motor deficits': 1, 'motor disorder disease': 1, 'cholinergic neuronal hybridoma': 1, 'muscarinic cholinergic lesion': 1, 'ChKO': 1, 'cholinergic degeneration of': 1, 'cholinergic degeneration dementia': 1, 'Cholinergic neurotransmission impairment': 1}
|
cholinergic
|
Disease
|
MESH:C535673
|
{'FAB': 1542, 'FAB M2': 49, 'CMS': 444, 'AML FAB': 45, 'luminal A subtype carcinoma': 2, 'acute erythroleukemia': 94, 'Hamilton subtypes III-V': 1, 'EAC': 1, 'SUE': 1, 'DMGs': 2, 'luminal subtype': 34, 'CMS1': 23, 'Consensus Molecular Subtype 1': 1, 'M6-C': 10, 'FAB-': 17, 'CMS.1': 1, 'FAB-M2': 45, 'luminal subtype A': 6, 'LumA': 2, 'CMS-2': 6, 'CMS-2 CRCs': 1, 'Miltenberger subtype III': 6, 'Mi.III': 4, 'subtype': 22, 'SUBTYPES': 33, 'M6': 120, 'AML-M6': 43, 'm6A REGULATORS': 1, "Bokhman's subtype 2": 1, 'AML M6': 16, 'CMS2': 9, 'consensus molecular subtype 2': 5, 'subtype carcinomas': 1, 'subtype III lesion': 1, 'ST': 13, 'LS': 2, 'LS and': 1, 'LGG_m6A': 1, 'CMS4': 55, 'Acute erythroleukemia': 33, 'AEL': 26, 'neuronal subtype dysfunction or loss': 1, 'FAB M4Eo': 9, 'consensus molecular subtypes 4': 4, 'subtype 1': 3, 'CMS 1': 14, 'FAB-M4Eo': 2, "O'Driscoll subtype 2": 2, 'subtypes': 3, 'MCIc_m6': 1, 'FAB type': 4, 'PBS': 1, 'CMS 1 to 4': 1, 'GT1b': 1, 'consensus molecular subtype-': 1, 'FAB M5b': 6, 'molecular subtype 1': 1, 'CMS I-III': 1, 'Acute Erythroleukemia': 7, 'FAB-M0': 10, 'FAB M0': 13, 'IM': 5, 'FAB AML': 7, 'm6A deficiency': 7, 'FAB M6': 20, 'LAR': 1, 'CMSs': 33, 'left arch atresia subtype 2': 1, 'M6A METHYLATION DYSREGULATION PROMOTES': 1, 'M6A REGULATION': 1, 'IS': 6, 'luminal subtype carcinomas': 1, 'Subtype 4': 3, 'FAB-M6': 9, 'M6-L': 3, 'NNS': 1, 'ST-M6': 1, 'SE-M6': 1, 'AMA-M6': 1, 'consensus molecular subtype': 1, 'Mono.M6.prog': 1, 'Macro.M6.prog': 1, 'PP': 1, 'consensus molecular subtype 4': 26, 'CMS4)': 2, 'CB': 2, 'MINES': 1, 'M6-L.': 1, 'PrSC': 1, 'VIRMA': 1, 'SSTs': 1, 'trichoid sensilla subtype': 1, 'Trichoid sensillum subtype II': 1, 'Primary rhinarium subtype I': 1, 'Trichoid sensillum subtype I': 1, 'PR II': 1, 'TS I': 1, 'primary rhinaria subtype I': 1, 'Primary rhinarium subtype II': 1, 'rhinarium subtype I': 1, 'PR I': 1, 'TS II': 1, 'rhinarium subtype II': 1, 'IMS': 3, 'CONSENSUS MOLECULAR SUBTYPES': 2, 'Subtyp': 2, 'MACOM': 7, 'FAB M1-M6': 1, 'basal-like subtype': 3, 'm6A': 6, 'luminal molecular subtype': 1, 'basal subtype': 6, 'IDU subtype A': 1, 'MOLECULAR SUBTYPES': 10, 'DIFFERENT SUBTYPES OF': 1, 'MSN subtype': 1, 'myxovirus subtype 1': 1, 'epitheloiden Subtyp': 1, 'vorherrschend epitheloide Subtyp': 1, 'ABC subtype': 2, 'MS': 10, 'FAB M5a': 2, 'FAB-M5b': 4, 'Subtype': 2, 'FAB type M4Eo': 1, 'FAB M4eo': 7, '-FAB': 6, 'M6 AML': 1, 'MACOM Complex': 1, 'SUBTYPES OF': 5, 'TGE Miller M6': 1, 'Cuproptosis subtype': 1, 'CYLINDRUS FAB': 1, 's. chaetica subtype 2': 1, 'Sphenopetroclival subtype I': 1, 'sphenopetroclival subtype I': 1, 'Sphenopetroclival subtype II': 1, 'fHLH subtype 4 and 5': 1, 'FAB M5A': 1, 'CMS-1': 4, 'CMS-4': 7, 'TRANSCRIPTOMIC SUBTYPES': 1, 'FAB subtype': 5, 'M6b': 9, 'ISs': 15, 'ykkC subtype-2': 1, 'Cosmopolitan subtype A': 1, 'aMCI': 1, 'MPSs': 1, 'cleft subtypes': 1, 'consensus molecular subtype 1': 12, 'AML FAB M6': 1, 'Numano subtype V': 2, 'M6a': 6, 'AO/OTA subtype-31-': 1, 'RTSs': 1, "O'Driscoll type 2 subtype": 1, 'FAB non-M2': 1, 'SEM': 1, 'Hypermutated or consensus molecular subtype 1': 1, 'immunoglobulin subtype': 1, 'FAB subtype M2': 7, 'Lepidic subtype': 1, 'M6-P2': 1, 'acute erythroleukemias': 2, 'M6 tumors': 4, 'lesion subtypes': 1, 'subtype 2': 1, 'CMS4-': 1, 'Consensus molecular subtype 4': 3, 'FAB disease': 1, 'CMV-M6': 1, 'LAR MES': 1, 'PEL M6': 1, 'M6a-AELs': 2, 'M6a-': 1, 'AL FAB': 1, 'luminal subtypes A and': 2, 'Congenital haemangioma subtype': 1, 'CL': 2, 'MST': 2, 'fibroblast subtype 2': 1, 'PRS': 1, 'Myoclonic subtype': 1, 'subtype 4': 8, 'P1-1': 1, 'P1-2': 1, 'MAC': 3, 'CAD Rv1-M6': 1, 'TRANSCRIPTOMIC SUBTYPING': 1, 'SF': 1, 'M6 tumor': 2, 'FAB type M4eo': 1, 'M6A': 1, 'm6A MODIFICATION': 2, 'FAB L(3)': 1, 'FAB M2/': 1, 'M6-LN': 1, 'FAB-type': 1, 'AML FAB-type': 1, 'IMMSs': 1, 'IMMS': 1, 'SCLE': 1, 'm6A GUIDES HISTONE MODIFICATION IN ACTIVE CHROMATIN REGIONS': 1, 'm6A REGULATES REPRESSIVE CHROMATIN ENVIRONMENT OF TRANSPOSABLE': 1, 'm6A MODIFIED': 1, 'TGCA subtype II': 1, 'microgranular FAB': 2, 'MORPHOLOGIC SUBTYPE': 1, 'M6-T1': 1, 'Mes': 1, 'SHH subtype': 2, 'AML FAB subtype 4': 1, 'DMS': 1, 'MOLECULAR SUBTYPE': 4, 'subtypes 2': 1, 'immune subtype 1-4': 1, 'IS1-4': 1, 'MPRGs': 1, '-M6': 1, 'FAB-Q': 2, 'FAB type M0': 1, 'AML type M6': 1, 'luminal subtype A.': 2, 'COMMENTS&subType': 1, 'FAB AML M5B': 1, 'AML-M6 8': 1, 'FAB_M2': 1, 'FAB_M0': 1, 'FAB_M6': 1, 'FAB_': 1, 'NGSP': 2, 'GSP': 2, 'M6-A/C': 1, 'M6-D': 1, 'TDP-subtype A.': 1, 'MMAS-2': 1, 'MMAS': 1, 'Osteoblastic subtype': 1, 'M0-FAB': 1, 'neuropathic subtype': 2, 'HS': 1, 'm5C': 4, 'EL;FAB': 1, 'HOCUS': 1, 'FTDL-TDP subtype': 1, 'MOLECULAR PATHOGENESIS OF VARIOUS SUBTYPES OF': 1, 'M6A Demethylases': 1, 'MRGs': 1, 'MRMRPI': 1, 'FAB class M3v': 1, 'MDA.subtype': 1, 'CIT.subtype': 1, 'Bronchoalveolar subtype 5': 1, 'NIS': 2, 'CMS 4': 5, 'subtype (CMS)1': 1, 'FAB M4E0': 1, 'Borrmann subtype III': 1, 'Friend acute erythroleukemia': 2, 'FAB-M2b': 1, 'm6A disorder': 2, 'RPS-5': 1, 'Rao subtype I or II': 1, 'Rao subtype III': 1, 'IDH.codel.subtype': 1, 'TRPM6 syndrome': 1, 'MOLECULAR SUBTYPES OF': 2, 'Pustular subtype': 1, 'Hyperactive subtype': 1, 'MSTs': 1, "O'Driscoll type II subtype 2": 1, 'M6.2': 2, 'SSI': 1, 'MO-M6': 1, 'meningioma M6': 1, 'Micro-T': 1, 'PG': 1, 'Macro-T': 1, 'Macro-T/': 1, 'FAB subtype 5': 1, 'HQ&M6': 1, 'CMS type 1': 1, 'erythroid/myeloid acute erythroleukemia': 1, '[FAB': 1, 'M6B': 1, 'Diff_RNC-m6A': 1, 'CIN subtype': 1, 'M6 disease': 1, 'SERSM': 1, 'selective estrogen receptor subtype modulator': 1, 'FAB M2': 1, 'SUBTYPE 1': 1, 'molecular subtype 4': 1, 'FAB reduction': 1, 'EACH CMS': 1, 'MOLECULAR SUBTYPING': 1, 'JIA subtype': 1, 'adamantinomatous subtype': 2, 'subtype III-A': 3, 'm6A Dysfunctions': 1, 'cuprotosis subtype': 1, 'Cuprotosis subtype A': 1, 'SBT': 1, 'Consensus Molecular Subtype 4': 2, 'M6 leukemias': 1, 'M3 and M6 leukemias': 1, 'luminal-subtype-': 2, 'luminal-subtype': 2, 'luminal subtypes A': 1, 'Bokham subtype': 1, 'Bokhman subtype': 1, 'Bokhman subtype I': 1, 'M6A MODIFICATION': 2, 'cleft subtype': 1, '-Subtype Carcinoma': 1, 'AML-FAB': 3, 'FAB-M5a': 1, 'M6 infection': 4, 'FAB M0-': 1, 'FAB M2': 1, 'FAB Type M0 2': 1, 'M6.6': 2, 'SCCmec subtype': 1, 'subtype III amidohydrolases': 1, 'M6 sarcoma': 1, 'myCAF': 1, 'Myomatous subtype lesions': 1, 'myomatous subtype lesions': 1, 'FAB:M2': 1, 'AN-BP': 1, 'M6 1': 1, 'FAB M5, M6': 1, 'M6 c': 1, 'FAB type M6': 2, 'PMSRPS': 1, 'subC-LP': 1, 'Zaire-Subtyps': 1, 'FAB-0/1/2': 1, 'M6.5': 2, 'AML FAB M0/1': 1, 'HOX-SI': 1, 'HOX-SII': 1, 'AML-M6 IA': 1, 'sensilla chaetica subtype 2': 1, 'ChS-2': 1, 'IMSs': 1, 'FAB:': 1, 'M6 infections': 1, 'sRP m6': 1, 'CMS type 2': 1, 'M6 8HD': 1, '-subtype': 3, 'HR-T.': 1, 'HR-T': 1, 'M6.4': 1, 'FAB-type M0': 1, 'CSRGs': 1, 'acute erythroleukemia, erythroid/myeloid': 1, 'RAEB1 FAB': 1, 'M0, M6, and M7': 1, 'Bokhman subtype I': 1, 'AML]-M6': 1, 'FAB subtype M6': 2, 'HyperV': 1, 'Cosmopolitan subtype 1a': 2, 'MASig': 1, 'FAB-M6 disease': 1, 'Cholangioblastic subtype': 1, 'CD-FAB': 1, 'FAB M2': 1, 'EPS-PDS': 1, 'subtype A': 1, 'acute erythroleukemia virus': 1, 'Luminal subtype': 1, 'AIMs': 1, 'MOGHE subtype II': 1, 'DMs': 1, 'FAB/LMB': 1, 'M1-M6': 1, '(FAB': 1, 'immune-CMS': 1, 'I-E': 1, 'I subtype E': 1, 'MRIGs': 1, 'ALM_M6_rev CCCCACGATCGCCGCCGCGATCACACC 21': 1, 'FAB-R9.4': 1, 'WHO type IIa of NPC': 1, 'WHO type IIa': 1, 'm6A-disease': 1, 'M6ADD': 1, 'VEM-R': 1, '4EXS-M6': 1, 'PCH subtypes 2 and 4': 2, 'mesenchymal consensus molecular subtype 4': 1, 'FAB 5': 1, 'FAB type M5b': 1, 'subtypes Leg': 1, 'HNSC Subtype 1': 1, 'HNSC subtype 1': 1, 'GC subtype': 1, 'm6A disorder.;Depletion': 1, 'FAB ME': 1, 'M4-M6': 1, 'consensus molecular subtypes': 1, 'consensus molecular subtype 2 (': 1, 'TRANSCRIPTOMICSTUDIES TRANSCRIPTOMIC SUBTYPE': 1, 'Kluth type-1 subtype-2': 1, 'M6/M7': 1, 'Molecular Subtype-': 1, 'CMS II': 1, 'CMS III': 1, 'FAB-M3': 1, 'M3 FAB': 1, 'FAB M3': 1, 'HM': 1, 'SCCs': 1, 'Basal-like SCCs': 1, 'MS type': 1, 'unST': 1, 'FAB group': 1, 'CMS2)': 2, 'Consensus molecular subtype 2': 1, 'PitNET subtype': 1, 'FSS': 1, 'CMS 2': 3, 'micropapillary subtype': 1, 'P1SC subtype': 1, 'DIF': 2, 'CMS) 4': 1, 'SD': 1, 'spastic subtype': 1, 'FAB CMMoL': 1, 'Cavernous and venous subtype': 1, 'CMS 2 and 4': 1, 'Friend acute erythroleukemias': 1, 'IDA subtype I1/': 1, 'erythroid (M6) leukemia': 1, 'type II and subtype': 1, 'PSYCHOTIC SUBTYPE': 1, 'MM2C': 1, 'trichoid subtype I': 1, 'Trichoid subtype II': 1, 'FAB-AML M6': 1, '-MILs': 1, 'MILs': 1, 'X-linked subtype of neurodegeneration with': 1, 'X-linked subtype of neurodegeneration': 1, 'FAB: M2': 2, 'UNUSUAL SUBTYPES': 1, 'CK-M6': 1, 'CAE subtype 19': 1, 'ALV': 1, 'T7SS subtype II': 1, 'AML FAB M5a': 1, 'meningotheliomatosen Subtyp': 1, "Yasagil's subtype": 1, 'M6 acute erythroleukemia': 1, 'FAB-AML': 1, 'ANBP': 1, 'Basal-like subtype': 2, "O'Driscoll anteromedial subtype 2 fracture of the coronoid": 1, 'FAB subtype MI': 1, 'serotype III-4': 1, 'Sensilla chaetica subtype 1': 1, 'CCS3 subtype': 1, 'SM+': 1, 'SM': 1, 'MeRIP': 1, 'Cosmopolitan subtype': 1, 'DEL subtype': 1, 'myokinetic subtype receptor': 1, 'M6 vem': 1, 'SI-HypoN': 1, 'SD-DMinNB': 1, 'SD-HypoB': 1, 'CMS 1-4': 1, 'fibrotischen Subtyps': 1, 'luminal A': 1, 'Luminal subtype A': 1, 'MLTs': 2, 'FAB M2 or 1': 1, 'SUBTYPE DIVERSIFICATION': 1, 'FAB M6b': 1, 'COSP': 1, 'FAB -80 C': 1, 'CS-II': 1, 'THERAPEUTIC POTENTIAL OF TARGETING m6A REGULATORS': 1, 'CK': 1, 'STs': 1, 'luminal B': 1, 'M6 glioma': 1, 'M6-2': 1, 'M6-': 3, 'FAB AML-M3v': 1, 'M6 - Acute erythroleukemia': 1, 'CRS': 1, 'FAB type M5A': 1, 'deficiency of neuronal subtypes': 1, 'NM': 1, 'PRO': 1, 'A-IS': 1, 'N-IS': 1, 'IHS': 1, 'SU': 1, 'FAB difficulty': 1, 'neuropsychiatric subtypes': 1, 'LA': 1, 'M6 leukemia': 2, 'NS': 1, 'ImA': 1, 'MS1b': 1, 'MS1a': 1, 'GC': 1, 'RAB subtype-2': 1, 'FAB MO': 1, 'M6.4x': 1, 'IPS': 1, 'NIPS': 1, 'CC': 1, "O'Driscoll type 2-subtype III coronoid fractures": 2, 'SCC-M6-1308': 1, 'Hepatitis C Virus Subtypes 1a, 1b, and 3a': 1, "O'Driscoll anteromedial subtype 2 fractures": 1, "O'Driscoll anteromedial subtype 2 fractures of the coronoid": 1, 'HPS': 1, 'Hadley type IIA odontoid fractures': 1, 'DSM-5 subtype N': 1, 'consensus molecular subtypes 1': 1, 'm6A-deficiency': 1, 'FAB/D': 1, 'M5/M6': 1, 'SF-M6': 1, 'ChS1': 1, 'chaetica subtype 1': 1, 'Basal subtype': 1, 'vAML-M6': 1, 'AML FAB M4E': 1, 'THERAPEUTIC VALUE OF M6A': 1, 'M6-AG': 1, 'm6AMS': 1, 'M5-M6': 1, 'NE': 1, 'neural subtype': 1, 'PN': 1, 'PS2': 1, 'FAB M6 or M7': 1, 'PTPR subtype': 1, 'CL subtypes': 1, 'MS luminal A.': 1, 'ED subtype': 2, 'SCCmec subtype IVd': 1, 'SUBTYPE-': 1, 'FAB-M3V': 1, 'subtypes (CMS) type 1': 1, 'IM1': 1, 'M6-Er': 1, 'FAB - M6': 1, 'ASIC subtypes': 1, 'IS1': 1, 'H1': 1, 'FACTORS FOR DISABILITY SUBTYPES': 1, 'DISCOVERING SUBTYPES': 1, 'AAF/I': 1, 'subtype VI-2': 1, 'SHH subtype 1 and 2': 1, 'Fibroblast subtype 1-4': 1, 'A/H7': 1, 'XLPE M6': 1, 'psychotic subtype': 1, 'MT': 1, 'subtypes 1, 2': 1, 'FMS 1': 1, 'FMS': 1, 'HER2E': 1, 'S+ LAC': 1, 'luminal subtypes': 1, 'vWD subtype III': 1, 'Vancouver subtype': 1, 'luminal A subtype': 1, 'FAB/': 1, 'basal subtype-': 1, 'Koos-Subtyp': 1, 'Mesenchymal Consensus Molecular Subtype 4': 1, 'M6 4': 1, 'M6-AML': 1, 'CHARACTERIZATION OF DIFFERENT SUBTYPES OF': 1, 'DIFFERENTIATION OF DIFFERENT SUBTYPES OF': 1, 'AEL-like leukemia': 1, 'SUBTYPE IDENTIFICATION': 1, 'Consensus molecular subtype 1': 1, 'WHO subtype III': 1, 'M6 stroke': 1, 'SUBTYPE': 1, '1B-SUBTYPE': 1, 'ALISs': 1, 'IMS1': 1, 'pectus subtypes': 1, 'CMS4 CRCs': 1, 'subtype type 1': 1, 'S1': 1, 'SK': 1, 'AML FAB M0': 1, 'consensus molecular subtype (': 1, 'M6 and M7': 1, 'MSBC': 1, 'subtype (CMS) 4': 1, 'M5A-FAB': 1, 'SUBTYPES 1B AND 1C': 1, 'DETAILED SUBTYPING': 1, 'M6A-': 1, 'FAB associated': 1, 'MS-': 1, 'muscle M6': 1, 'M6 3': 1}
|
FAB
|
Disease
|
MESH:C535674
|
{'Richard III': 15, 'neuropsychiatric or other related': 1, 'OTHER ACTIVITIES OF': 1, 'RICHARD': 34, 'Richards-Rundle syndrome': 5, 'neuropsychiatric and other': 2, 'Deficiencies in other': 1, 'RICHARD WATSON MIDDLETON': 2, 'Familial hypogonadism': 3, 'RICHARD DIENER': 1, 'OTHER CO-ACTIVATORS': 1, 'neuropsychiatric or other diseases': 11, 'Deficiency Other Syndromes': 1, 'Richards Rundle syndrome': 1, 'RICHARD EISER': 1, 'Richards fractures': 1, 'mental and other illnesses': 5, 'neurological or other mental illnesses': 1, 'RICHARD WARREN': 1, 'AOPC': 1, 'RICHARD BULCKLEY': 1, 'Richard Bing': 1, 'OA N': 1, 'OA': 2, 'deficiencies of the other': 1, 'other immunodeficiency': 1, 'mental and other': 3, 'RICHARD SWANN': 1, 'RICHARDS': 2, 'neuropsychiatric and other diseases': 13, 'AIDS': 1, 'Richard': 13, 'familial hypogonadism': 5, "Richard's": 3, 'Rundle and Nosil': 4, 'RICHARD WISEMAN': 1, 'immunodeficiency Other': 1, "Richard's deformities": 1, 'FRANCIS RICHARD': 1, 'deficiency of the other': 1, 'RICHARD STANISLAUS': 1, 'OM': 1, 'Richards type II PFJR': 1, 'OMI': 3, 'impairment in activities other than': 1, 'Richard Lewontin': 2, "Rundle's LUM": 1, 'RICHARD HIGGINS': 1, 'CIRI': 3, 'deficiencies of other micronutrients': 1, 'OTHER ACTIVES': 1, 'impairment of other activities': 1, "Richard's illness": 1, 'other immunodeficiencies': 1, 'MEMORIAM RICHARD SIEBECK': 1, 'Richard Cathomas': 3, 'RICHARD DOUTY': 1, 'Richard-Toll': 3, 'RICHARD HEYER': 1, 'deficiency of other': 4, 'deficiencies in other': 3, 'mental and other illness': 2, 'Familial hypogonadal infantilism': 1, 'ataxia-hypogonadism syndrome': 1, 'neuropsychiatric or other': 3, 'RICHARD AVENARIUS': 1, 'deficiency of other nutrients': 1, 'Richard disease': 3, 'Richard Gatti': 1, 'neuropsychiatric or other adverse': 1, 'RICHARD GILL': 1, 'decline in other mental abilities': 1, 'other mental': 2, 'Other mental': 1, 'Richard Krause': 1, 'neurological or other mental diseases': 5, 'RICHARD VILLAR TRAINEES': 1, 'RICHARD DEWITT': 1, 'Richard Niles': 1, 'Richard Agitation': 1, 'Ataxia-hypogonadism syndrome': 1, 'RICHARD WHYTOCK': 1, 'OSA': 2, 'RICHARD MASSINGHAM': 1, 'OTHER ACTIVITIES': 3, 'neuropsychiatric and other human diseases': 1, 'emotional and other mental problems': 2, 'RRS': 1, 'oMI': 1, 'Ataxia Hypogonadism Choroidal Dystrophy': 1, 'RICHARDS INSTITUTE': 1, 'OTHER NUTRIENT DEFICIENCIES': 1, 'Richards type II': 2, 'other deficiencies': 1, 'mental, sexual, oral, and other': 1, 'Richards Type 4 Fracture': 1, 'Other-Related Mentalization': 1, 'familial ataxia with atrophy': 1, 'neuropsychiatric and other non-motor symptoms': 1, 'Richard Toll': 2, 'impairment in other activities': 1, 'mental, auditory or other significant problems': 1, 'mental and other ailments': 1, 'OTHER PSEUDOSCIENCE CLASSROOM ACTIVITIES': 1, 'Familial IHH': 1, 'mental, developmental, neurological and other syndromes': 1, 'ORF': 1, "Shakespeare's Richard III": 1, 'and other dysmorphic features': 1, 'deficiency in other': 1, 'Deficiency of other': 1, 'loss of interest in other activities': 1, 'RICHARD FIBICH': 1, 'FAMILIAL SYNDROME COMBINING ATAXIA': 1, 'ACMG CRITERIA[Richards': 1, 'CRITERIA[Richards': 1, 'AR Other': 1, 'familial idiopathic hypogonadotrophic hypogonadism': 1, 'Familial idiopathic hypogonadotrophic hypogonadism': 1, 'Other immunodeficiencies': 1, 'FREDERICK RICHARD': 1, "Richard III's disfigurement": 1, 'OND': 1, 'mental and/or other': 1, 'immunodeficiency other': 1, 'RICHARD K.': 1, 'OTHER TRADITIONAL ACTIVE': 1, 'familial hypogonadotrophic hypogonadism': 1, 'deficiencies of "other': 1, 'Richards-Rundle syndromes': 1, 'Richards type 3 fracture': 1, 'RICHARD SORENSON': 1, 'OT': 2, 'Richard Strauss operas': 1, 'OMD other': 1, "Richard's back": 1, 'RICHARD OLDING BEARD': 1, 'OTHER ACTIVATORS': 1, 'loss of other mental judgment': 1, "Richard's seizures": 1, 'Richard Hofstadter': 1, 'RICHARD EWALT': 1, 'RICHARD MAINWARING': 1, 'Impairment of other activities': 1, 'Familial ataxia with atrophy': 1, 'other mental illness': 1, 'Richard Toll infections': 1, 'RICHARD MILLS': 1, 'GoActive': 1, 'RT': 1, 'OTHER FEATURES': 1, 'AHCR': 1, 'familial central hypogonadism': 1, 'OD': 1, 'RB': 1, 'EWAN RICHARDS': 1, 'Richard I.': 1, 'Mental Illness Other': 1, 'reduction in other activities': 1, 'Richards Tumors': 1, "Rundle's curve": 1, 'RICHARD A.': 1, "Richards's difficult": 1, "Richard's behavioral and weight problems": 1, 'EULOGY OF PROFESSOR RICHARD': 1, 'deficiency of other axes': 1, 'Familial hypogonadism with anosmia': 1, 'deficiency of other apoproteins': 1}
|
RICHARD
|
Disease
|
MESH:C535675
|
{'Silva': 28, 'da doenca': 133, 'Caracteristicas gerais da amostra': 4, 'da doenca venosa cronica': 3, 'BMP': 1, 'muscular da panturrilha': 1, 'Anurina Das': 1, 'dAS': 8, 'evolucao da doenca': 2, 'dA': 110, 'pseudoaneurisma da parede': 1, 'FI da doenca': 1, 'GOLD Da': 1, 'da tarefa': 7, 'Espinosa da Silva1': 1, 'Da': 99, 'da': 285, 'das escalas de dor': 1, 'MRPA': 7, 'papulas climaticas da orelha': 1, 'PAS': 3, 'ME': 1, 'Morro da': 1, 'alteracoes da': 1, 'da Gripe': 1, 'TMI': 1, 'valor da pressao inspiratoria maxima': 1, 'da funcao cardiaca': 2, 'podem ocorrer nesta fase da vida': 1, 'da utilizacao': 1, 'OMS': 112, 'CC': 22, 'pela OMS': 2, 'Estrutura das variaveis': 1, 'das variaveis': 22, "Da Costa's syndrome": 17, 'da computacao': 1, 'da osteotomia olecraniana': 1, 'da ossificacao heterotopica': 1, 'das possiveis': 1, 'luxacao completa da patela': 1, 'luxacao aguda da patela foi': 1, 'DCXF': 2, 'da populacao': 15, 'sindrome da resposta inflamatoria sistemica': 4, 'clinicas da populacao estudada': 2, 'SRIS': 1, 'da resposta inflamatoria sistemica': 1, 'da valvula aortica': 2, 'SE': 2, 'Serra da Estrela': 3, 'VPI ao longo da vida': 1, 'Histomorfometria da espessura': 1, 'tratamento da': 1, 'da ovaio': 1, 'da atividade fisica': 1, 'das mulheres': 2, 'VHA': 1, 'amostra da crianca': 1, 'funcional da cirurgia': 1, 'da cirurgia': 51, 'usuariosIdade da maioria': 1, 'aplicacao da ferramenta': 1, 'retirada da amiodarona ainda': 1, 'Deterioracao rapida da funcao cardiaca': 1, 'profilaxia da morte': 1, 'tamanho da amostra': 6, 'da vida': 16, 'Da Zhen Tong': 1, 'correcao cirurgica da coarctacao': 1, 'cronica da infancia': 1, 'da crianca': 18, 'atraso da linguagem': 1, 'Revisao da literatura': 3, 'Aparecida da Silva': 5, 'da costela': 1, 'da costela respectiva': 1, 'da amostra': 18, 'oriundas da': 1, 'da doenca arterial coronariana': 6, 'consolidacao da fratura': 3, 'Bunionectomia da cabeca': 1, 'Purtroppo da migliorare': 1, 'da doenca pelo': 1, 'da pele': 11, 'MR da amostra': 1, 'Perfil das': 1, 'calculo do tamanho da': 1, 'Das': 36, 'Das steuerungspolitische': 1, 'das': 24, 'PEIC': 1, 'calculo da respectiva': 1, 'carcinoma da glandula parotida': 1, 'Da mesma': 10, 'Rama Das': 1, 'da cabeca': 6, 'CEAF': 2, 'MS': 27, 'DAEDs': 1, 'da doenca adquirida': 1, 'Wania da Silva': 2, 'alecrim-da-areia': 1, 'corte de maior diametro da cabeca': 1, 'extrusao da cabeca': 1, 'Caracterizacao demografica da amostra': 1, 'ESF': 41, 'Caracterizacao da familia': 1, 'Caracterizacao da': 1, 'aneurisma da arteria subclavia': 2, 'da clavicula': 3, 'fratura da': 5, 'Fratura cominutiva da clavicula direita': 1, 'da attivita agrozootecniche': 1, 'das variaveis estudadas': 2, 'calcificacao da parede aortica': 1, 'Calcificacao da parede aortica e coronaria': 1, 'da indicacao': 1, 'Calcificacao da parede aortica': 1, 'diminuicao das coberturas vacinais': 1, 'DAs': 138, 'tratamento das complicacoes': 1, 'brasileira da escala': 1, 'Calculo do tamanho da amostra': 6, 'Por meio da estatistica de varredura': 1, 'pela alta letalidade da doenca': 1, 'pele da mae': 1, 'cartao da crianca': 2, 'malattie infiammatorie croniche e sindromi da malassorbimento intestinale': 1, 'elevata accompagnata da brividi': 1, 'colpiti da': 1, 'da qualsiasi ceppo circolante': 1, 'da pesquisa': 8, 'Da Costa syndrome': 7, 'CHADEFAUD EX SILVA': 1, 'secundaria da': 3, 'profilaxia da forma congenita': 1, 'da biomecanica': 2, 'da arteria ileocolica': 1, 'da mulher': 2, 'da Vinci': 106, 'da metilxantina': 1, 'Shu da ge-4': 1, 'da asma': 3, 'da-chonou': 1, 'da politica': 2, 'Da mesma forma': 4, 'Teoria da resposta': 1, 'SAOS': 10, 'Caracteristicas da amostra estudada': 1, 'progressao da doenca': 7, 'cajarana da mata': 1, 'dAs': 37, 'Das ist aussichtslos': 1, 'Mason-Piraja Da Silva Disease': 1, 'maioria da amostra': 4, 'IECA': 12, 'importancia prognostica da': 1, 'Academia da Cidade': 2, 'da Vinci SP': 3, 'PIC': 1, 'Da Cruz': 1, 'maioria das': 6, 'aterosclerotica da': 1, 'Da Vinci': 25, 'FAPESB': 1, 'da hemodinamica venosa': 1, 'tardia da doenca': 2, 'Silva-Ferrada': 1, 'da arquitetura retiniana': 1, 'roturas iatrogenicas da': 1, 'Houve melhora da metamorfopsia': 1, 'da coronaria esquerda': 4, 'SILVA': 19, 'administrativa da escola': 1, 'diminuicao da VM': 1, 'da forca': 3, 'CP': 4, 'curvatura da panturrilha': 1, 'atividades da vida diaria nessa populacao': 1, 'da fome': 1, 'Thanady da malla': 1, 'da fala': 7, 'motoras neurais da fala': 1, 'fluencia da fala': 2, 'Coleta das amostras de fala': 1, 'microestruturais da': 1, 'da ultima': 1, 'fase sintomatica da doenca aterosclerotica': 1, 'da variavel avaliada': 1, 'da veia': 1, 'da veia iliaca esquerda': 1, 'da veia iliaca': 5, 'sintoma da': 1, 'Eficacia da terapia complexa descongestiva para linfedema': 1, 'TdC': 5, 'TdC.': 3, 'TdC ( 2)': 1, 'ICSRC': 1, 'da ferida cirurgica': 2, 'cirurgica das feridas infectadas': 1, 'progresso da ciencia': 1, 'Caracteristicas clinicas da populacao envolvida': 1, 'vasculares da': 1, 'da aparencia': 1, 'musculatura da panturrilha': 1, 'cenario da emergencia': 1, 'Papel da': 1, 'da neovascularizacao': 1, 'ostiais da': 2, 'da cintura estatura': 1, 'da cintura': 12, 'PCin': 1, 'sociais da saude': 2, 'DSS': 6, 'da doenca coronariana': 2, 'da eficacia': 1, 'caracterizacao da': 1, 'Tristan da Cunha': 1, 'VIH': 1, 'da concordancia': 1, 'aneis da': 1, 'Os quadros da parede': 1, 'da arteria do infarto': 1, '- Saude da Mulher': 1, 'PSM': 1, 'Costa da Morte ataxia': 3, 'da van ci': 1, 'da adequacao da profilaxia': 1, 'melhoria da adequacao da profilaxia': 1, 'Composicao da amostra': 1, 'capa da': 1, 'maioria das doencas ortopedicas': 1, 'da Doenca': 1, 'VFC': 18, 'das fibras musculares': 3, 'secundaria da morte subita cardiaca': 1, 'primaria da morte subita cardiaca': 1, 'ruptura da arteria carotida': 1, 'saude da pessoa idosa': 6, 'Caracteristicas demograficas da amostra': 3, 'Leucemia da Infancia': 1, 'ocasiao da': 1, 'aneurisma da arteria esplenica': 1, 'Da alergam': 1, 'ICP primaria da arteria': 1, 'distribuicoes das variaveis': 1, 'HHDJY': 1, 'espinha da escapula': 1, 'fibrogenese da': 1, 'eficacia da embolizacao': 1, 'Embolizacao da arteria uterina': 1, 'EAU': 1, 'Amostra da': 1, 'embolizacao da arteria uterina': 1, 'eficacia da embolizacao da arteria uterina': 1, 'toxicidade cardiaca da': 1, 'progressao da doenca miocardica': 1, 'da frequencia cardiaca': 10, 'Kalidutta Das': 1, 'A3D;Da': 1, 'cirurgica da articulacao pode ser indicada': 1, 'Resolucao completa da oclusao da': 1, 'calculo da espessura relativa de parede': 1, 'da proliferacao': 1, 'anomalias da arteria coronaria': 1, 'respiratoria ou diminuicao da atividade fisica': 1, 'curvatura da': 1, 'Complicacoes da': 1, 'sindrome hipertensiva da gravidez': 1, 'SHG': 1, 'atraso da cirurgia': 1, 'Perfil demografico da amostra': 1, 'deformidade acentuada da cabeca': 1, 'fala da crianca': 1, 'da linguagem infantil': 1, 'chumbo da tinta': 1, 'ACoLI': 1, 'PBB': 1, 'Painho da Beira': 1, 'Painho da Beira Baixa': 1, 'da agua': 1, 'da Doenca por': 1, 'aneurismas da': 1, 'sindrome da fissura orbitaria': 1, 'regioes da palpebra superior': 1, 'da sobrancelha': 1, 'da palpebra esquerda': 1, 'IVP-CB': 1, 'IVP': 2, 'visualizacao da rede': 1, 'fratura da cabeca': 1, 'IEVP': 1, 'da gorulebilir': 1, 'da boca': 5, 'duracao da moratoria': 1, 'descricao cirurgica e da ressonancia magnetica': 1, 'PAPF': 1, 'da espessura da': 1, 'da arteria radial': 1, 'cirurgica da': 2, 'clinica da doenca': 3, 'sintomas da doenca': 9, 'Hipoplasia da hemiface direita': 1, 'das situacoes e esporadica': 1, 'hipoplasia da hemiface direita': 1, 'calculo da amostra': 3, 'Das apallischen Syndrom': 1, 'SIDA': 1, 'da tendinopatia': 2, 'suscetibilidade da doenca': 1, 'importancia biologica das variaveis estudadas': 1, 'Senhora da Gloria': 1, 'Nossa Senhora da Gloria': 1, 'da literatura': 5, 'pandemia da': 6, 'da vascularizacao retiniana': 1, 'Estrategia saude da familia': 1, 'chefe da': 1, 'da nutricao do lactente': 1, 'aneurisma da': 5, 'da ciencia': 4, 'Calculo da amostra': 2, 'mae da crianca': 1, 'da fratura': 1, 'ruptura da cicatriz uterina': 1, 'da fadiga cronica': 1, 'da pontuacao': 1, 'da saude': 5, 'da ye cai': 1, 'Lenke-Silva V and VI': 1, 'Lenke-Silva': 5, 'sistematica da literatura': 2, 'da doenca ossea no mieloma multiplo': 1, 'fisiopatologia da doenca': 4, 'Variaveis da Atividade Fisica': 1, 'OMS I-II': 1, 'silva': 1, 'decorrencia da doenca': 1, 'da marcha': 1, 'da obliquidade pelvica': 1, 'da-uniao-para-tratar-paraense-com-doenca-rara.html': 1, 'Cronicidade da infeccao': 1, 'da-pandemia-': 1, 'Angiotomografia das arterias coronarias': 1, 'espessura da gordura epicardica': 1, 'avaliacao estatistica da assimetria': 1, 'da ortopedia': 1, 'da-taset': 3, 'dVXi': 1, 'Da-': 2, 'Da-Huang': 2, 'da crianca e risco': 1, 'antropometria da crianca': 1, 'fisica da crianca': 1, 'AD': 1, 'Das tertium': 1, 'maioria das acoes foi': 1, 'tratamentos sintomaticos da dor': 1, 'Fisiopatogenia da osteoartrite pos-traumatica': 1, 'PPCP': 4, 'PPV': 4, 'Transferencia da Evidencia': 1, 'da rotatoria': 1, 'da panturrilha': 4, 'circunferencia da cintura': 3, 'Pantanal da Nhecolandia': 1, 'eletromiografica da': 1, 'Das Impingement': 1, 'atrofia da musculatura': 2, 'VFD': 1, 'videofluoroscopia da degluticao': 1, 'da tecnica cirurgica': 5, 'nitida melhora da coartacao': 1, 'Caracterizacao das respostas obtidas': 1, 'sal da terra': 1, 'basica da': 1, 'acentuada elevacao da creatina quinase': 1, 'estroma da cuspide': 1, 'da valvopatia': 1, 'da safenectomia': 1, 'da coleta de dados': 1, 'causa da dor': 1, 'Das verruciforme': 1, 'da glenoide': 1, 'POG': 1, 'ossea da glenoide': 1, 'das doencas vasculares': 1, 'acerca da plausibilidade biologica desta ocorrencia': 1, 'da ji': 1, 'paralisa da corda vocal esquerda': 1, 'hormonio da paratireoide': 2, 'da vida diaria': 6, 'substituicao da patela como rotina': 1, 'da patela': 4, 'Huang-Da-Cha': 1, 'tratamento da doenca': 3, 'Lesao da musculatura adutora': 1, 'DA SILVA-GRIGOLETTO': 1, 'VOP': 5, 'da PPc esta': 1, 'Das diabetische': 1, 'deficiencia da subunidade catalitica SP': 1, 'da borda da': 1, 'falha ossea da glenoide': 1, 'Perda ossea por erosao da glenoide': 1, 'perimetro da cintura': 6, 'PC': 12, 'calculo da relacao cintura-estatura': 1, 'estigma da doenca': 1, 'da oficina': 1, 'da reabilitacao cardiaca': 2, 'peca da prostatectomia': 1, 'valor prognostico da ressonancia magnetica cardiaca': 1, 'cirurgia da': 1, 'radiografica da consolidacao da fratura': 1, 'Reducao da Fratura': 1, 'da Vida Diaria': 1, 'da versao pelvica': 1, 'Graduacao da Doenca Degenerativa': 1, 'radiografica da doenca degenerativa lombar': 1, 'das distancias AB': 1, 'atraves da distancia AB': 1, 'da analise estatistica esta descrito': 1, 'dAED': 2, 'potencialidades da teoria': 1, 'da fascia lata': 1, 'Descricao da amostra': 3, 'da forca muscular': 1, 'cavie da laboratorio': 1, 'SAOS estava': 2, 'viola da gamba': 2, 'fisiopatogenese da doenca': 1, 'das variaveis funcionais': 1, 'Caracterizacao da amostra': 20, 'forca muscular das': 1, 'tratamento cirurgico da': 1, 'da deficiencia': 2, 'traumatismos da mao/cirurgia': 1, 'da interferencia': 1, 'eficacia da terapia': 2, 'da Desnutricao Cronica': 1, 'da cintura escafoide': 1, 'Da-Ae': 2, 'primaria da': 1, 'da atencao basica': 1, 'CobAB': 1, '-da-Silva': 7, 'progressao abrupta da doenca': 1, 'da funcao sistolica': 1, 'detrimento da dobutamina': 1, 'fase cronica da doenca': 3, 'condicao ameacadora da vida': 1, 'terapia tripla - IECA': 1, 'vasculares da doenca': 1, 'Caracteristicas da amostra': 7, 'Da das Virus': 1, 'da arteriorrafia': 1, 'Das Apallische Syndrome': 1, 'exposicao persistente da falange': 1, 'cicatrizacao da ferida': 1, 'da variancia': 12, 'Silva pattern A': 3, 'Das pulmorenale Syndrom': 2, 'normal das variaveis': 1, 'depois da tabela 1': 1, 'Lesoes da rampa': 1, 'SCM': 1, 'Tamanho da amostra': 6, 'ocasiao da cirurgia': 1, 'OMS - 1': 1, 'da amostra quanto': 1, 'cirurgia da mao': 5, 'Complicacoes da incisao cirurgica': 1, 'da incisao cirurgica': 2, 'joia da coroa': 1, 'da confiabilidade': 1, 'da bainha': 2, 'da osteotomia': 2, 'patologica da mandibula': 1, 'da laringe': 1, 'da mandibula': 3, 'Fotomicrografia da regiao corporal do estomago em': 1, 'mortalidade da doenca': 4, 'da apneia obstrutiva do sono': 4, 'celulares da doenca': 1, 'da trombose venosa': 2, 'extensao da doenca': 3, 'espessura da patela': 1, 'Fomos excluidos da lista Qualis': 1, 'TE da mudanca': 1, 'IC da mudanca': 1, 'Das capitais': 1, 'das variaveis individuais': 1, 'para evitar complicacoes da': 1, 'oferta calorica da': 1, 'terapeutica da': 1, 'Atualizacao da diretriz brasileira': 1, 'da huang': 2, 'pressao sistolica da arteria pulmonar': 4, 'da curva escoliotica': 2, 'ruptura da parede': 1, 'acerca da imprecisao das guias para varios niveis': 1, 'da parede': 3, "Da Costa's Syndrome": 5, 'DALY da populacao': 1, 'da forca isometrica do': 1, 'sintomas da doenca venosa': 1, 'acuracia diagnostica da puncao aspirativa': 1, 'Obstrucao das': 3, 'distribuicao das variaveis': 2, 'espessura relativa da': 2, 'Citta da salvare': 1, 'tamanho da': 3, 'da nicotina': 5, "Kretschmer's das apallischen syndrome": 1, 'da scoprire': 1, 'da divisa': 1, 'temperatura da agua': 1, 'da arteria pulmonar': 2, 'da coleta': 1, 'achados da literatura': 2, 'Poluicao da agua': 1, 'Costa da Morte': 1, 'congestao difusa da mucosa': 1, 'descoberta da doenca cronica': 1, 'encosta da serra': 1, 'das Virus': 7, 'Das Virus': 23, 'Tristan da Cunha Hotspot': 1, 'DHXSD': 1, 'da mama direita induzida': 1, 'Silva-Lenke': 1, 'DF': 1, 'da mama': 1, 'da fadiga': 1, 'da Fadiga': 1, 'EICF': 1, 'sintomas da doenca?Como': 1, 'doencas benignas da prostata': 1, 'Das Damage': 1, 'ZUEC': 1, 'acerca da doenca existente': 1, 'saude da populacao masculina': 1, 'alecrim-da-chapada': 2, 'serica da': 1, 'PMTI': 1, 'da anticoagulacao com varfarina': 1, 'da faixa terapeutica': 1, 'amostra da': 1, 'SCPD': 1, 'terciaria das complicacoes': 1, 'da ulcera venosa': 2, 'Corda Aberrante da Valva': 1, 'da atencao primaria a saude': 1, 'distancia interquartilica da cobertura para': 1, 'rotineiro da tecnica': 1, 'cronograma da pesquisa': 1, 'neurologica acima da': 1, 'Sintomas da disfuncao neurogenica': 1, 'da medula espinhal': 1, 'DN': 1, 'calorica das frutas': 1, "Cova da Beira's cherry": 1, "Cova da Beira's cherries": 1, 'ocorrencia da violencia': 1, 'Coleta da literatura': 1, 'Avaliacao da elasticidade aortica': 1, 'leucemias da infancia': 1, 'da angiografia': 2, 'da circulacao espontanea': 2, 'Silva Junior': 3, 'Da Hua cotton': 1, 'da populacao obesa': 1, 'soggetti affetti da': 1, 'da obesita': 1, 'psicologicas da': 1, 'HI': 1, 'hiperplasia da intima': 1, 'cobertura da atencao basica': 1, 'malattie da disturbi psichici': 1, 'OIL.Da': 1, 'Leonardo da Vinci': 6, '-Americana da Saude': 1, 'Foi realizada substituicao da': 1, 'Das Neves': 1, 'PSAP': 4, 'Tendencia da mortalidade infantil': 1, 'Correlacao das variaveis qualitativas e': 1, 'poucos dados acerca da populacao latino-americana': 1, 'cicatrizacao da osteotomia do trocanter maior': 1, 'da musculatura trocanterica': 1, 'da doenca coronaria': 1, 'cura da doenca': 5, 'da doenca pode': 2, 'da borda': 1, 'da infancia caracterizado': 1, 'Atividade antifungica do oleo essencial da Calendula officinalis cultivada': 1, 'sequelas da hanseniase': 1, 'Da-Neng': 2, 'da espinha iliaca': 1, 'Obstrucao da via': 1, 'DH': 3, 'variaveis clinicas da amostra estudada': 1, 'da suficiencia de servicos': 1, 'da doenca, necessitando melhor': 1, 'da discopatia degenerativa': 1, 'DS': 1, 'valor da amostra': 1, 'valor da clavicula direita': 1, 'valor da esquerda': 1, 'da curva': 3, 'das variaveis primarias': 1, 'das variaveis secundarias': 1, 'rotulos das cinco marcas': 1, 'DeCS': 4, 'doenca da coronaria esquerda estava': 1, 'da menopausa': 2, 'THM normotensas': 1, 'THM vaginais': 1, 'sintomas da menopausa': 1, 'THM': 2, 'extensao da doenca coronaria': 1, 'revascularizacao apenas da': 1, 'calculos da': 1, 'da ferida operatoria': 2, 'END': 2, 'Silva Pattern': 1, 'relativa da parede': 1, 'da funcao diastolica': 3, 'ICP apenas da': 1, 'da radioterapia': 1, 'abertura da musculatura': 1, 'Depois da anestesia': 1, 'Fratura da Diafise': 1, 'da Costa syndrome': 1, 'SIASI': 2, 'eficacia da transferencia': 1, 'eficaz da parada cardiaca': 1, 'pseudoartrose infectada da': 1, 'cefalica da cabeca': 1, 'desinserida da': 1, 'vista do tamanho da retracao': 1, 'da escoliose': 1, 'atrofia da estria vascular': 1, 'LRF': 2, 'da-federacao-somente-roraima-teve-crescimento-do-pib': 1, 'pela ESF': 1, 'da Familia': 2, 'Saude da Familia': 3, 'classificacao da maturacao somatica': 1, 'da Vinci Xi': 2, 'da alimentacao': 2, 'tardias da cirurgia': 1, 'da artrodese': 1, 'traumatismos da mao': 1, 'Nenhuma das atletas': 1, 'da mulher atleta': 1, 'Terapia da rigidez aortica': 1, 'VOP foi': 1, 'vida da crianca': 1, 'calculo da concentracao': 1, 'inicio da doenca': 2, 'APA': 3, 'acuracia da analise': 1, 'obstetricos da amostra': 1, 'SUS': 2, 'borda da glenoide': 1, 'Cirurgia da mao': 1, 'da escala parametrica': 1, 'Retardo da radioterapia': 1, 'da radioterapia adjuvante': 1, 'mecanismo da injuria miocardica': 1, 'profilaxia da': 2, 'sjuk da exempelvis': 1, 'melhora da': 1, 'das analises sanguineas venosas perifericas': 1, 'da bradicardia': 1, 'eficacia da telereabilitacao': 1, 'da telereabilitacao e escassa': 1, 'viola da braccio': 1, 'da mortalidade infantil nas capitais brasileiras': 1, 'dentro da faixa': 1, 'das variaveis intraoperatorias': 1, 'da hemipelve': 1, 'idosos longevos da amostra': 1, 'Da Fugui': 1, 'eficacia da': 3, 'bifasica da fetuina-A': 1, 'no curso da doenca arterial coronariana': 1, 'calcificacao da': 1, 'RCE': 3, 'da parada cardiaca': 3, 'artroscopia da articulacao metatarsofalangiana': 1, 'artroscopia das articulacoes': 1, 'avaliacao quantitativa da doenca': 1, 'da fasciite plantar': 1, 'da fixacao': 1, 'tibial hemimelia split hand/foot syndrome': 1, 'tibial hemimelia-split hand/foot syndrome': 2, 'da cintilografia ossea': 2, 'estrutura das unidades basicas de saude': 1, 'risco da falacia ecologica': 1, '-dAS': 1, 'paralisia da musculatura': 1, 'etapa da cirurgia': 1, 'PNASPI': 1, 'atraves da estatistica descritiva': 1, 'endolaser da veia safena parva': 1, 'da safena parva': 1, 'estatistica das variaveis': 1, 'das perfuracoes': 1, 'sindrome compressiva da medula espinhal': 1, 'GACL - MEC': 1, 'escopia da': 1, 'alteracoes degenerativas da': 1, 'longo da vida': 1, 'no inicio da vida': 1, 'Variedade da dieta': 1, 'Goncalves da Silva': 3, 'mecanismo da': 2, 'dentro da curva foi utilizado': 1, 'DECS': 1, 'da funcao': 1, 'da hipotermia e suas complicacoes': 1, 'cicatrizacao da ferida operatoria': 1, 'da Saude': 1, 'malva-da-chapada': 1, 'da mecanica respiratoria': 2, 'da artroplastia primaria': 1, 'das rodovias': 1, 'manifestacoes tipicas da doenca': 1, 'Lenke Silva': 1, 'negligencia da equipe': 1, 'aneurisma da porcao cavernosa da': 1, 'da seguranca': 3, 'Das Patientenkollektiv': 3, 'da Ortopedia': 1, 'Histologia microscopica da cicatrizacao muscular - Avaliacao inflamatoria': 1, 'Avaliacao qualitativa da': 1, 'CM': 1, 'da terapeutica': 1, 'da varfarina': 3, 'DOACs': 1, 'acima da emergencia da veia hepatica': 1, 'pecado da ovelha e': 1, 'da vida cotidiana': 1, 'Biblioteca da Ajuda': 1, 'luxacao da': 1, 'Condicionada da Dor': 1, 'Cuidar da saude': 1, 'Heredograma da familia': 1, 'muito acima da': 1, 'da cirurgia robotica estudadas': 1, 'eficacia da cirurgia robotica': 1, 'da robotica': 1, 'adequacao da indicacao': 1, 'Caracterizacao clinica da amostra': 1, 'Caracteristicas da populacao estudada': 2, 'DRP': 1, 'da Vinci RP': 1, 'Da Hood': 1, 'Houve aumento da distancia acromioumeral': 1, 'cuticula da': 1, 'osteotomia da tuberosidade anterior da tibia': 1, 'das arterias carotidas': 1, 'CAT': 1, 'da carotida direita': 1, 'profilaxia da nefropatia': 1, 'da vacina contra FA': 1, 'Saude da crianca': 4, 'da doenca neurotropica': 1, 'tendinopatia da cabeca longa': 1, 'haldi da doodh': 1, 'atrofia da': 1, 'direta ou indireta da doenca': 1, 'da claudicacao': 3, 'distancia total da caminhada': 1, 'Vitoria da Conquista': 6, 'pela ausencia da doenca': 1, 'Manoel da Cunha': 2, 'da estatistica descritiva': 1, 'Da-Fu-Fang': 1, 'DFF': 1, 'Abertura da capsula com': 1, 'carcinoma da': 1, 'sintomas da inflamacao': 1, 'tardio da transfusao': 1, 'MCPA': 3, 'da pandemia': 5, 'Da-Cheng-Qi decoction': 1, 'tardias da vida': 3, 'da bradicardia sintomatica': 1, 'Musculos da coxa': 1, 'atraves das variaveis': 2, 'da rotacao': 2, 'Caracterizacao das variaveis': 2, 'caracterizacao clinicodemografica da populacao estudada': 1, 'Careiro da Varzea': 2, 'eficacia da droga pode': 1, 'melhoria da tecnica cirurgica': 1, 'Das Still-Syndrom': 1, 'fotografias da': 1, 'Fotografias da': 1, 'Da Nang dioxin': 1, 'ROP': 1, 'retinopatia da prematuridade': 1, 'Avaliacao das variaveis': 1, 'Felipe-Silva': 1, 'calculo da cobertura alcancada': 1, 'escolha da terapia': 1, 'inexistencia da doenca': 1, 'avancadas da doenca': 1, 'das Fibrilas Amiloides': 1, 'AISET': 1, 'eficacia da hidratacao': 1, '-Da': 2, 'fratura iatrogenica da parede': 1, 'fraturas iatrogenicas da parede lateral': 1, 'espessura da parede lateral': 1, 'tinham conhecimento da doenca': 1, 'da utilizacao profilatica': 1, 'Infeccao da ferida cirurgica': 1, 'sujeitos da pesquisa': 1, 'funcionais da': 1, 'Da Costas Syndrome': 1, 'Prevalencia da deficiencia': 1, 'deficiencia da': 1, 'Metanalise da mortalidade geral': 1, 'acometimento da regiao diafisaria': 1, 'occhiali da vista': 1, 'CD': 1, 'DCQD': 6, 'da biomecanica da anca': 1, 'artrodese da anca': 1, 'da danno ossidativo dei principi attivi': 1, 'tomografia computadorizada da variante anatomica': 1, 'medial rompido da patela': 1, 'quatro meses da cirurgia': 1, 'FMABC': 1, 'Acustica da Fala': 2, 'Silva LL': 1, 'Silva CLC': 1, 'Variacoes da': 1, 'Lesao da aponeurose comum': 1, 'urgencia das arterias cerebrais': 1, 'Eu tenho vergonha da minha aparencia': 1, 'gosto da minha aparencia': 1, 'Eu sinto vergonha da': 1, 'causa da minha aparencia': 1, "Amerika'da": 1, 'cirurgica da pele': 1, 'Silva-Carmona': 1, 'nenhuma das variaveis': 2, 'Sistolica da': 1, 'da busca': 1, 'da rota critica': 1, 'da chegada': 1, 'maioria da': 3, 'PHS': 1, 'PMN': 1, 'subluxacao da articulacao metatarsossesamoide': 1, 'alteracoes degenerativas da articulacao metatarsossesamoide': 1, 'Silva-Filho & Menolli': 1, 'da ultrassonografia': 1, 'estetica da': 1, 'da China ocidental': 1, 'da tecnica': 4, 'biomecanica da articulacao': 1, 'displasia da troclea': 1, 'MCTES': 1, 'Das stumpfe Abdominaltrauma': 1, 'OVAC': 1, 'araca-da-mata': 1, 'quadrado da altura': 1, 'da funcao respiratoria': 1, 'Rva': 2, 'aguda da doenca': 3, 'Braz-Silva': 1, 'tamanho da cabeca umeral': 1, 'da hiper-hidrose': 1, 'Construcao da escala': 1, 'FIV': 1, 'Da Qing legacy': 1, 'Nenhuma das variaveis': 2, '-na-reducao-da-mortalidade-materna': 1, '-da-mortalidade': 1, 'da saude reprodutiva': 1, 'da ancora de sutura': 1, 'tambem por conta da falta': 1, 'Tamanho das': 1, 'Parodontitis erhohte das': 1, 'BSE': 1, 'da raggiungere': 1, 'muscular da': 1, 'Das fortgeschrittene': 1, 'da cirurgia de obesidade': 1, 'Morro da Providencia': 1, 'da artrodese seja': 1, 'IPSM': 1, 'saude da mulher': 1, 'SILVA WEBSITE': 1, 'Fratura da ceramica': 1, 'fratura da ceramica': 1, 'da margem da cabeca': 1, 'nocciolo_da_erysiphe_corylacearum.pdf': 1, 'da troponina': 2, 'dA-AL-II': 1, 'Doenca da arteria coronariana': 1, 'ICFT': 2, 'maioria das pessoas': 1, 'anonimato da pesquisa': 1, 'persistencia da': 2, 'persistencia da IUE': 1, 'drenagem pelo mesmo espaco intercostal da toracotomia': 1, 'intercostal da toracotomia': 1, 'prognostico da doenca': 1, 'saude da crianca': 3, 'disturbios da fala': 1, 'incivilidade na cultura da saude tem sido': 1, 'ISRS': 3, 'CLT': 1, 'Economia da saude': 2, 'Variabilidade da Frequencia Cardiaca': 1, 'ostectomia parcial da cabeca da fibula foi': 1, 'ostectomia parcial da': 1, 'calculo da FAI': 1, 'dA&E': 3, 'Sindrome da fragilidade fisica': 1, 'futuro da pesquisa clinica': 1, 'da linguagem': 1, 'Perfil da': 2, 'postura anteriorizada da cabeca': 1, 'danca da cobra': 1, 'termofilica da maquina metabolica': 1, 'da linha foi sempre': 1, 'proliferacao da doenca': 1, 'da pele no casamento branco-': 1, 'da eugenia': 1, 'da especie': 3, 'filosofia da': 1, 'da cor da pele no casamento branco-preto': 1, 'da Educacao': 1, 'da arteria uterina': 1, 'da doenca miomatosa': 1, 'Da Qing': 2, 'Elevada acuracia no estudo da medula ossea': 1, 'da imunodeficiencia humana': 3, 'da endotelina': 1, 'DUM': 1, 'ajuste robusto da variancia': 1, 'da pseudartrose foi simulada': 1, 'urgencia da cirurgia': 1, 'Caderneta de saude da pessoa idosa': 1, 'transmissao da doenca': 1, 'fenotipo da doenca': 1, 'da Hipercolesterolemia': 1, 'da doenca aterosclerotica': 4, 'da arteria': 5, 'influenzato da': 1, 'Sindrome da veia cava': 1, 'Sindrome da': 3, 'piora da funcao sistolica': 1, 'Pressao sistolica da arteria pulmonar': 1, 'da espessura do pericardio': 1, 'atraves da': 1, 'Posicao impropria da ponta': 1, 'calculo da razao cintura': 1, 'Da Shu Tea': 1, 'da radiacao gama': 1, 'Fotografia intraoperatoria da': 1, 'artroplastia da primeira articulacao': 1, 'doenca degenerativa da primeira articulacao metatarsofalangica': 1, 'placche da moderata': 1, 'da moderata': 1, 'cienciometrica da pesquisa': 1, 'Osteotomia da tuberosidade': 1, 'traumatica da patela': 1, 'luxacoes da patela': 1, 'luxacao primaria da patela': 1, 'variaveis da': 1, 'da analise estatistica': 3, 'CMB': 1, 'das baleias': 1, 'da espessura do': 1, 'fraturas da': 1, 'da/dN': 7, 'Edoc-I': 1, 'Edoc-A': 1, 'da ruptura': 2, 'tamanho da ruptura': 1, 'da doenca subclinica': 1, 'dA-AL-I': 1, 'desmame da crianca': 1, 'cientifica dentro da ciencia mundial': 1, 'da gamba': 4, 'algumas das variaveis': 1, 'DaS': 2, 'plataforma da balanca': 1, 'fratura da tuberosidade menor': 1, 'tratamento cirurgico da tuberosidade maior': 1, 'do braco acima da cabeca': 1, 'fratura da tuberosidade maior': 1, 'FTM': 1, 'ECAC': 1, 'da distancia': 2, 'Glomerulonefriti da tossici e farmaci': 1, '-materiais-da-reuniao-extraordinaria-da-dicol': 1, 'cirurgica primaria da fissura labiopalatina': 1, 'As variacoes anatomicas congenitas da': 1, 'das variacoes pelvicas nas anomalias': 1, 'Cateterizacao seletiva da veia interiliaca': 1, 'sindrome metabolica da': 1, 'Da-huang': 3, 'dA.': 1, 'Da-Dd': 1, 'da mediana': 1, 'miscigenacao etnica da populacao brasileira': 1, 'da estatistica descritiva e analitica': 1, 'da tu feng': 1, 'da Immunodeficiencia': 1, 'correcao cirurgica da EI ativa': 1, 'DA': 1, 'avaliacao clinica da maturacao': 1, 'da ventilacao mecanica invasiva': 1, 'malformacao da estrutura esofagiana(1)': 1, 'artrite septica da sinfise pubica': 1, 'Artrite septica da sinfise pubiana': 1, 'profilaxia da trombose venosa': 3, 'impactos das intoxicacoes': 1, 'causador da doenca Vassoura-de-bruxa': 1, 'limitada da amostra': 1, 'espessura da parede': 1, 'da Vinci X': 2, 'coleta da etapa': 1, 'da excrecao': 1, 'DHEG': 1, 'comprometimento da populacao estudada': 1, 'obstetricas da amostra': 1, 'maioria das cirurgias': 2, 'EMIc': 1, '-intimal da carotida': 1, 'aneurismas das': 1, 'AAC': 2, 'aneurismas das arterias coronarias': 1, 'Doencas da Laringe': 1, 'os preceitos da laserterapia': 1, 'interferencia da': 1, 'LSN': 1, 'Das Syndrom': 1, 'folego da vida': 1, 'SSA': 1, 'ser responsaveis pela instalacao da doenca': 1, 'Estenose da Arteria': 1, 'recidiva da doenca': 2, 'Seccao da arteria': 1, 'Observar irregularidades parietais da': 1, 'cistica adventicial da arteria poplitea': 1, 'cistica da adventicia': 2, 'da urna': 1, 'ostriche da': 1, 'Da huang': 2, 'Manson-Piraja da Silva schistosomiasis': 1, 'da cheng qi': 1, 'sintomas da hipertensao venosa': 1, 'oclusao da veia cava': 1, 'Arteriografia da arteria mesenterica': 1, 'Remendo da arteria mesenterica': 1, 'disfagia orale e faringea in pazienti affetti da sclerosi sistemica': 1, 'das anomalias vasculares': 1, 'Os pseudoaneurismas da': 2, 'da arteria esplenica': 1, 'Vasco da Gama Movement': 1, 'Da An': 1, 'Estrategias para o cuidado da pessoa com doenca cronica': 1, 'Silva Filipe': 1, 'da-pandemia': 1, 'da-pandemia-em-musicos-da-grande-bh': 1, 'da-ufmg-aponta': 1, '-da-pandemia-': 1, 'Mapa da violencia': 1, 'da tabela': 2, 'variaveis da vida reprodutiva': 1, 'huoki da': 1, 'tamanho das minhas': 1, 'Doencas da vesicula biliar': 1, 'tamanho da prostata': 1, 'tipica da': 2, 'SQM': 1, 'Sindrome da Quilomicronemia Multifatorial 8': 1, 'SQF': 1, 'aprovacao da agencia europeia': 1, 'Vale da Couda': 1, 'da Couda': 1, 'ocorrencia da doenca': 2, 'papel das rodovias': 1, 'da leishmaniose': 1, 'geral ponderada da brucelose foi': 1, 'da populacao idosa': 4, 'da-galaxia': 1, '-estariam-se-aproximando-da-lactea.html': 1, '-da-odisseia': 1, 'das Ding': 1, 'Das Ding': 1, 'Onthophilus_silvae': 1, 'Da-PI': 1, 'SINA': 1, 'atividades basicas da vida diaria': 1, 'AVD': 2, 'ABVD': 1, 'atividades instrumentais da vida diaria': 1, 'salarios minimos da epoca': 1, 'ACR': 1, 'Jurema-malicia-da-serra': 1, 'bucal da crianca': 1, 'saude bucal da crianca': 1, 'PNCV': 1, 'das crimen laesae humanitatis': 1, 'I DAs': 1, 'type III DAs': 1, 'II DAs': 1, 'I, II and III DAs': 1, 'tronco da coronaria esquerda': 1, 'Doencas da laringe': 1, 'Calculo da': 1, 'Calculo das contagens': 1, 'A. silvae str': 1, 'em amostra probabilistica da populacao brasileira': 2, 'da voz': 1, 'traumatica da': 2, 'CAC': 5, 'calcificacao da arteria coronaria': 2, 'calcio da arteria coronaria': 4, 'Calcificacao da': 1, 'Da and Ri': 1, 'CC foram constatadas': 1, 'da tontura': 1, 'impartite da acidi grassi': 1, 'nella messa a fuoco da vicino': 1, 'difficolta nella messa a fuoco da vicino': 1, 'da pessoa com': 1, 'angiotomografia das coronariasnos': 1, 'AdS-dA': 1, 'curso da doenca': 6, 'da estatistica': 1, 'da escola': 4, 'angiografia tomografica computadorizada das coronarias': 1, 'potencia da': 1, 'cha-da-india': 1, 'Estatisticas da saude': 1, 'DAC': 1, 'Da Vinc': 1, 'depois da cirurgia': 3, 'correcao cirurgica da': 1, 'DQL': 1, 'depois da cirurgia foi': 1, 'da varie fonti': 1, 'capsulotomia volar da articulacao': 1, 'da ferida': 1, 'da fascia': 1, 'MUM': 3, 'diafise da clavicula': 1, 'osteossintese da clavicula': 1, 'os beneficios da': 1, 'fratura da clavicula': 1, 'multifragmentadas da clavicula': 1, 'diminuicao da espessura': 1, 'processo estiloide da': 1, 'da artroplastia': 2, 'tecnica da': 1, 'por meio da pergunta': 1, 'da arteria mesenterica superior': 1, 'SAMS': 1, 'Das benigne Prostatasyndrom': 1, 'Bata das arvores': 1, 'traumatica isolada da articulacao': 1, 'Ze da Costa': 1, 'Acupoint da': 1, 'Da-fu-shui': 1, 'das costelas': 1, 'calculo da estatistica': 1, 'Saude das Minorias': 1, 'Caracterizacao das praticas': 1, 'transtornos desintegrativos da': 1, 'Barbosa-Silva': 1, 'da potencia e': 1, 'da fibra': 1, 'Diametro da veia': 1, 'sistematica da producao cientifica': 1, 'emocional das vitimas': 1, 'da propria vitima ou do agressor': 1, 'dA-AAI': 1, 'da-amazonia': 1, 'Da and': 1, 'otoacusticas transientes da segunda': 1, 'Da Costa Syndrome': 1, 'das variaveis analisadas': 2, 'categorizacao das variaveis': 1, 'interferencia da agua branca': 1, 'impacto da tontura': 1, 'e Silva FC': 1, 'CCF': 1, 'da-ta': 2, 'da regiao orofaringea': 1, 'PRO-AIM': 1, 'vascular - alteracoes estruturais das': 1, 'espessura da': 2, 'Bawa-da-talab': 1, 'da esperanca': 1, 'TCA': 1, 'EAC': 1, 'endarterectomia da carotida': 1, 'ACS': 1, 'angioplastia da carotida com': 1, 'Oclusao da carotida': 1, 'doenca da carotida extracraniana': 1, 'ateroma da carotida': 1, 'atrofia da musculatura tenar': 1, 'celulas da musculatura lisa vascular': 1, 'CMLV': 1, 'eficacia da reducao': 1, 'efeitos maternos e neonatais da': 1, 'topografica das manifestacoes': 1, 'topografica das manifestacoes isquemicas': 1, 'cirurgia das amigdalas': 1, 'dilatacao da arteria coronaria': 1, 'Jaca-da-baixa': 1, 'calculo da amostra necessaria': 1, 'da mudanca': 1, 'da lunghi': 1, 'hipertermia da': 1, 'da respectiva articulacao': 1, 'da cirurgia e outro fator importante': 1, 'da doenca rara': 1, 'da artroplastia reversa': 1, 'da hemiartroplastia': 1, 'da cirurgia vascular': 1, 'iatrogenica da carotida comum direita': 1, 'diminuicao da dor': 1, 'da pseudoartrose': 2, 'Erva da memoria': 1, 'Na maioria das cirurgias': 1, 'PNSL': 1, 'radiografias da amostra analisada': 1, 'da esfera': 1, 'Traumatologia da': 1, 'pseudoartrose da clavicula direita': 1, 'efeitos tardios da exposicao a': 1, 'efeitos da': 1, 'nenhuma das variaveis analisadas': 1, 'dados da analise estatistica': 1, 'associacao das variaveis': 2, 'Para caracterizacao da amostra': 1, 'gordurosa da': 1, 'SLD': 1, 'radioterapia da populacao': 1, 'livre da doenca': 2, 'maioria das infeccoes ocorreu': 1, 'das manifestacoes neurologicas das vasculitides': 1, 'sintomas da ceratoconjuntivite': 1, 'da populacao estudada': 2, 'Silva Neves': 1, 'da citogenetica classica': 1, 'da atencao': 1, 'da reabilitacao': 2, 'da tuberosidade radial': 1, 'ao diminuto tamanho da amostra': 1, 'Informacoes da sua doenca': 1, 'da taquicardia ventricular': 1, 'da fibrocartilagem': 1, 'atividades da vida diaria': 5, 'das lesoes ligamentares': 1, 'da transferencia do tuberculo maior': 1, 'EIA foi': 1, 'escoliose idiopatica da adolescencia': 2, 'EIA': 2, 'da arteria poplitea': 1, 'EIA por 4 modelos': 1, 'escoliose idiopatica da': 1, 'borda da floresta': 3, 'Itapecerica da': 2, 'pratica da ciencia': 1, 'caracteristicas adicionais da amostra': 1, 'Da amostra avaliada': 1, 'busca da pergunta': 1, 'da regiao citricola paulista': 1, 'SIAB': 1, 'MV-dA': 1, 'glicemia foi mensurada pelo metodo da hexoquinase': 1, 'da abrangencia desta': 1, 'da fundoplicatura': 1, 'IBPS': 1, 'Zunachst breitete sich das Virus': 1, 'mortalita da mesotelioma': 1, 'da latte': 1, 'da taglio': 1, 'VdGM': 1, 'Rossa da Inverno sel': 1, 'Rossa da inverno sel': 1, 'hortela-da-folha-miuda': 1, 'RDC': 1, 'veia da arteria': 1, 'da bicicleta': 1, 'alcune malattie da amianto': 1, 'SILVA A': 1, 'Silva A': 3, 'variacao da altura': 1, 'da largura da fovea': 1, 'da curva quadratica': 1, 'da largura': 1, 'da gordura': 2, 'angulo das curvaturas': 1, 'epoca da pesquisa': 1, 'CISDESTE': 1, 'ITRNN': 1, 'falha da terapia ARV': 1, 'fraturas diafisarias da clavicula': 1, 'da dilatacao mediada por': 1, 'da coronariana': 1, 'artriticas da articulacao': 1, 'antibiotico-resistenza da ceppi': 1, 'CT': 1, 'calculo da distancia ponta-apice': 1, 'CFMA': 1, 'PS': 1, 'deficiencia da atividade de dihidropirimidina desidrogenase': 1, 'da terapia': 3, 'das orientacoes': 1, 'Fechamento da abertura mesenterica': 1, 'da cascata inflamatoria': 1, 'Da-Huang-Xiao-Shi': 1, 'eficacia da ceramica': 1, 'Castanha-da-india E': 1, 'Silva s': 1, 'Carvalho-Silva': 1, 'Costa da Morte Ataxia': 1, 'SILVA - FORMER PRESIDENT': 1, 'prevencao da doenca': 1, 'calculo da gravidade': 1, 'Das De': 4, 'da cardiomiopatia hipertrofica': 1, '- Altura da bancada': 1, 'estatistica descritiva das variaveis qualitativas': 1, 'sair da cama': 1, 'da sifilis': 2, 'Da Hua': 1, 'da insulina': 1, 'arteria coronaria esquerda da': 1, 'ACACs': 1, 'origem anomala da': 2, 'arteria coronaria direita da arteria pulmonar': 1, 'anomalias congenitas das arterias coronarias': 1, 'coarctacao da': 1, 'ARCAPA': 1, 'Circunflexa da': 1, 'staminali tumorali da': 2, 'destruicao da glandula': 1, 'da glandula': 1, 'OMS acreditava': 1, 'da urgencia': 2, 'origem anomala da coronaria esquerda': 1, 'da Doenca Arterial Coronariana': 1, 'QF': 3, 'peixinho-da-horta': 1, 'hortela-da-folha-grossa': 1, 'FALANTIL': 1, 'frequencia da terapia': 1, 'cardiotoxicidade da': 1, 'da espera': 1, 'Azevedo e Silva': 1, 'mal das cadeiras': 2, 'acerca das condicoes': 1, 'amostra da etapa 1': 1, 'uveira-da-serra': 1, 'ASF': 1, 'BZDD': 1, 'da- chapada': 1, 'da-chapada': 1, 'Apelido da crianca': 1, 'Idade da crianca': 2, 'Duracao da sessao': 1, 'Da-chang': 1, 'Leonardo da Vinci Dyslexic': 1, 'da limpida': 1, 'Da Silva': 1, 'vigilancia da doenca': 1, 'VPA': 1, 'melhoria da acuracia diagnostica': 1, 'Td[Da': 1, 'canario-da-terra': 2, 'mecanica da marcha humana': 1, 'das variaveis menopausa': 1, '-da-': 1, '-dA': 1, 'da doenca sistemica': 1, 'da degluticao direta': 1, 'atrofia da coxa direita': 1, 'disfagia': 1, 'da cama': 1, '-da-costa': 1, 'aspectos fisiologicos da laringe': 1, 'Vertreter sind das': 1, 'riscos de complicacao da doenca': 1, 'Pittella-Silva': 1, '-da-india aphrodisiac': 1, 'Da Nang': 1, 'Prevencao das carencias nutricionais': 1, 'da doenca carotidea': 1, 'eficacia da prevencao': 1, 'Aranha-nomada-das-estalactites': 1, 'da equipe cirurgica': 1, 'das variaveis pos': 1, 'e consolidacao da': 1, 'Academias da Cidade': 1, 'Academias da': 1, 'da doenca venosa': 3, 'PMP': 1, 'da Noiva': 1, 'da propria da saude': 1, 'pseudoaneurisma da arteria esplenica': 1, 'PSAE': 1, 'da sequencia aleatoria': 1, 'arteriografia seletiva da carotida comum direita': 1, 'da boca melhorou': 1, 'da musculatura mastigatoria e amplitude de abertura da boca': 1, 'aneurismas da arteria pancreatoduodenal': 1, 'DRS': 2, 'Tapada da': 2, 'AAP': 2, 'dor muscular tipica da': 1, 'dama-da-noite': 1, 'da derme': 1, 'Revisao da Literatura': 1, 'das forcas musculares respiratorias foi acima': 1, 'polpa da fruta': 1, 'primaria da doenca': 3, 'angulo de emergencia da': 2, 'Duracao da amamentacao': 1, 'Variavel Duracao da amamentacao': 1, 'rotura completa da': 1, 'indice de Gini da renda': 1, 'da ultraestrutura': 1, 'Fisiopatologia da doenca nas': 1, 'calculo da amostra tomou': 1, 'risco da autonomia': 1, 'ciencia da hierarquia': 1, 'habitos de higiene da populacao': 1, 'vetores da doenca': 1, 'Exposicao cirurgica da bifurcacao iliaca direita': 1, 'emergencia alta da mesma': 1, 'Tendencia das mortes evitaveis': 1, 'consolidacao da artrodese': 1, 'Anestesia da Articulacao Radiocarpal': 1, 'Caracterizacao sociodemografica da': 1, 'das Lezirias': 1, 'piora subita da dispneia': 1, 'angiografia da tomografia': 1, 'isquemica da cabeca': 1, 'da altura e largura da epifise': 1, 'da vitima': 1, 'das informacoes coletadas': 1, 'Fisiopatologia da trombose': 1, 'da-aldeia-murutinga-am-estao': 1, 'deficiencia da fibrinolise': 1, 'benigna da doenca': 1, 'doenca da tireoide': 1, 'DRAS': 1, 'da pele branca': 1, 'Morfologia das membranas': 1, 'resultado da terapia': 1, 'PI': 1, 'da desmoplaquina': 1, 'escala numerica da dor': 1, 'da populacao brasileira': 1, 'LdP': 1, 'uve da tavola': 1, 'resseccao da costela': 1, 'aderencias da arteria subclavia direita': 1, 'da circulacao': 1, 'AC-P.': 1, 'Vasco da': 1, 'das doencas': 4, 'dilatacao aneurismatica da': 1, '-da': 2, '-da-epatitedelta': 1, 'presenca da sindrome metabolica': 1, 'das variaveis classicas': 1, 'da doenca nesta faixa etaria': 1, 'Coelho-e-Silva': 1, 'dependencia da': 1, 'dependencia da nicotina': 1, 'prevencao da': 1, 'CC foi medida': 1, 'variaveis da operacao': 1, 'da ventilacao mecanica': 4, 'da meningomielocele': 1, 'da coroide estavam': 1, 'Das Buch': 1, 'da Aterosclerose': 1, 'estrategia preventiva da': 1, 'diminuicao da amilasuria': 1, 'da medicina esportiva': 1, 'degenerativa da espessura': 1, 'das Handeln 2': 1, 'da-Silva syndrome': 2, 'Fotomicrografias da cartilagem': 1, 'Espessura da': 1, 'amostra da pesquisa': 1, 'da pandemia indicavam': 1, 'coleta das respectivas variaveis': 1, 'da literatura americana': 1, 'Duracao da cirurgia': 2, 'Reforco da saude atrelado ao sistema reprodutor': 1, 'da doenca litiasica': 1, 'da zhuan': 1, 'da terapia oncologica': 1, 'braco da crianca': 1, 'dieta da crianca': 1, '-zhu-Ge-da': 1, 'anestesia da pele escrotal foi realizada com': 1, 'DY': 1, 'EPAL': 1, 'CC eutrofica': 1, 'CC maior foi': 1, 'CC alterada': 1, 'PL': 1, 'protuberancia da membrana timpanica': 1, 'Cineangiografia da': 1, 'das variaveis ecocardiograficas': 1, 'CS': 2, 'TDC': 1, 'aterosclerotica da parede': 1, 'salina agitada da direita': 1, 'cirurgica da cardiopatia congenita': 1, 'Candi da parapsilosis': 1, 'da amiloidose sistemica': 1, 'disturbios da voz': 1, 'da propria vida': 1, 'os calculos estatisticos das variaveis': 1, 'hiperplasia da musculatura': 1, 'da urgencia e emergencia': 1, 'graviola da mata': 1, 'da calcificacao coronaria': 1, 'da embolizacao': 1, 'da pratica': 2, 'atresia da veia inominada esquerda': 1, 'relativa da': 1, 'ERP': 1, 'espessura diastolica da parede': 1, 'Atraves da palpacao': 1, 'da dor': 1, 'da taset': 1, 'ba-da': 1, 'da arteria coronaria': 2, 'diminuicao da acuracia': 1, 'eletrocardiografica da': 1, 'da classificacao da estimulacao cardiaca fisiologica direta e': 1, 'eletrocardiografica da variancia': 1, 'maioria das variaveis': 5, 'caracterizacao da populacao': 1, 'da valva aortica': 3, 'da cirurgia bariatrica': 1, 'cirurgico da obesidade morbida': 1, '-ouro da estimulacao cardiaca': 1, 'da profilaxia correta': 1, "Da Vinci's": 1, 'Das Ich': 1, 'Avaliacao da espessura muscular': 1, 'calculo da': 3, 'cobertura da': 1, 'das capitais': 1, 'da tumescencia': 1, 'situacao da maioria das indicacoes de cirurgia oncologica': 1, 'da pele parda': 1, 'Caracterizacao da amostra de adolescentes brasileiros': 1, 'da idade adulta': 1, 'das coronarias': 1, 'DEAC foi caracterizado': 1, 'DEAC': 1, 'Espontanea da': 1, "Da Costa's (or Effort) Syndrome": 1, 'tardias da': 1, 'da regiao': 1, 'da estrutura fundiaria': 1, 'doenca cistica da adventicia e extremamente rara': 1, 'teoria da doenca sistemica': 1, 'adventicia da veia basilica': 1, 'doenca cistica da adventicia': 1, 'induzido por ligacao da arteria coronaria': 1, 'Ligacao da arteria coronaria': 1, 'necrotico da': 1, 'PD': 1, 'MAC': 1, 'SAAP': 1, 'atrofia das fibras musculares': 1, 'FSG': 1, 'da circunstancia': 1, 'Manifestacao eletrografica da': 1, 'dentro da substancia cerebral': 1, 'diminuicao da saude': 1, 'dSG': 1, 'AIDS': 1, 'CSC tinham': 1, 'nutricional da crianca': 1, 'PSF': 1, 'caderneta de saude da crianca': 1, 'CSC': 2, 'caderneta da crianca': 1, 'PROFIP': 2, 'BVS': 1, 'da pele nao': 1, 'da articulacao': 3, 'em nenhuma das variaveis': 1, 'pela delicadeza das estruturas': 1, 'acai-da-mata': 1, 'da Neve': 2, 'tendencias globais da populacao brasileira': 1, 'Entoloma silvae-frondosae': 1, 'das fibrilas amiloides': 1, 'Monitorizacao invasiva remota da': 1, 'da abertura valva aortica': 1, 'saude da': 1, 'angiotomografia das coronarias': 1, 'da fase aguda da doenca': 1, 'acinesia da parede livre': 1, 'resolucao da doenca': 1, 'surto da doenca': 1, 'Das Zinner-Syndrom': 1, 'calculo da distancia': 1, 'da ferramenta': 2, 'interrupcao diaria da sedacao': 1, 'intraoperatoria da intervencao cirurgica conduzida': 1, 'cirurgica parcial das paratireoides': 1, 'Necton e risorse da pesca': 1, 'da doenca hipertensiva': 1, 'eficacia da epinefrina': 1, 'tratamento da parada cardiorrespiratoria': 1, 'tratamento da parada cardiorrespiratoria pediatrica': 1, 'efeitos indesejaveis dificilmente levam a suspensao da droga': 1, 'da placa aterosclerotica': 1, 'DCS': 1, 'terco da amostra': 1, 'muscular da ponte miocardica': 1, 'terco da amostra tinha apenas': 1, 'e laboratoriais da amostra': 1, 'Manson-Piraja da Silva disease': 1, 'da- tenosis': 1, 'Das amputacoes maiores': 1, 'Da.': 1, 'das camaras cardiacas': 1, 'anormal pode indicar elevacao cronica das pressoes pulmonares': 1, 'Caso houvesse diminuicao da oximetria cerebral': 1, 'Importancia das variaveis': 1, 'importancia das variaveis': 1, 'TT Silva': 1, 'destruicao da parede venosa': 1, 'SAVR': 1, 'cirurgica da valva aortica': 1, 'angioplastia da': 2, 'da terapia trombolitica': 1, 'isquemia da': 1, 'eficaz da doenca': 1, 'sintomas da': 4, 'caracteristica da doenca ou atipica': 1, 'tinha diagnostico tardio da doenca': 1, 'pescaria da baleia': 1, 'da deficiencia foi pequena': 1, 'amostras da duplicata': 1, 'das complicacoes': 1, 'BZDDD': 1, '-Da-De-Dah': 1, 'da VLP': 1, 'Serra da Formosa': 1, 'Silva system pattern A': 1, 'da penitenciaria': 1, 'dentro das penitenciarias estudadas foi alta': 1, 'causa da asma': 2, 'SAOS-VAS-asma': 1, 'SAOS-RGE-asma': 1, 'SAOS-obesidade-asma': 1, 'SAOS-inflamacao sistemica': 1, 'ocorrencia da complicacao': 1, 'diminuicao das complicacoes dessa doenca': 1, 'Da-De': 1, 'Revisao sistematica da literatura': 1, 'tardios da angioplastia': 1, 'Estenose das arterias': 1, 'EAR': 1, 'Atencao primaria e promocao da saude': 1, 'fase aguda da doenca': 1, 'histologia tipica das paratireoides': 1, 'de inflacao da variancia': 1, 'da validacao cruzada': 1, 'MPU': 1, 'Heranca das doencas': 1, 'da arteriografia': 1, 'hipotrofia da musculatura': 1, 'DHW': 1, 'falha da terapia': 1, 'IMDL': 1, 'muscular da coxa': 1, 'valor da': 1, 'CHUFPB': 1, 'Prescricao da profilaxia': 1, 'das contagens diferenciais': 1, 'acao farmacologica da nicotina': 1, 'da valva aortica transcateter': 1, 'sistolica da arteria pulmonar': 1, 'da Imunodeficiencia Humana': 1, 'da significancia estatistica': 1, 'da sifilis congenita': 1, 'da sifilis congenita na': 1, 'aparecimento da doenca': 1, 'da camara direita': 1, 'VPF': 1, 'MDV': 1, 'estagios da doenca': 1, 'das variaveis medidas': 1, 'calculo da CV': 1, 'MS mexicano': 1, 'Das femoroazetabulare Impingement': 1, 'da rotura': 1, 'resseccao distal da clavicula': 1, 'cicatrizacao da': 2, 'das veias varicosas': 1, 'da tecnica intercensitaria': 1, 'da vida humana': 1, 'da Ardencia': 1, 'da cirurgia tardia': 1, 'da competencia': 1, 'Foi feita analise estatistica descritiva da amostra': 1, 'CC da crianca ainda sao incertas': 1, 'faixa etaria das criancas': 1, 'Prevalencia das': 1, 'melhor visualizacao da protese valvar': 1, 'cronica da doenca': 1, 'das pessoas': 1, 'da falsa luz': 1, 'aneurismatica da falsa luz': 1, 'degeneracao aneurismatica da disseccao aortica': 1, 'soma das pontuacoes': 1, 'Da luo': 1, 'Pseudartrose da cintura': 1, 'da cintura foram': 1, 'tratamento da pseudartrose': 1, 'SEAL': 3, 'tamanho da agulha': 1, 'da silaba': 1, 'da infancia': 2, 'Jose Silva': 1, 'VED': 1, 'Serra da Neve': 1, 'depois da artroplastia': 1, 'calculo da eficacia migratoria': 1, 'selecao da amostra foi feita': 1, 'resultados da': 1, 'perfil da': 1, '-das-pesquisas-': 1, 'da huang gua': 1, 'geral da crianca': 1, 'crianca nessa fase da': 1, 'Encefalite da zecca': 1, 'atresia da valva aortica': 1, 'luxacao cronica da patela': 1, 'planta da vida': 1, 'Acai da Mata Atlantica': 1, 'de limpeza da': 1, 'etapas da pesquisa': 1, 'Calcificacao da Arteria Coronaria': 1, 'maioria das residencias brasileiras': 1, 'EIVE': 1, 'da arteria carotida': 2, '-intimal da arteria carotida': 1, 'da outras providencias': 2, 'Da.steatopyga': 1, 'sindrome da hipersensibilidade laringea': 1, 'CLARICE SILVA CESARIO4': 1, 'clinica da doenca venosa': 1, 'papel carcinogenico da radiacao': 1, 'Aneurismas da': 1, 'aneurisma da arteria braquial': 1, 'aneurisma da arteria axilar': 1, 'da pessoa obesa': 1, 'Aplicacao da subluxacao de mandibula': 1, 'SM foi trazida': 1, 'SM': 1, 'angulo da mandibula': 1, 'subluxacao da mandibula': 1, 'topografia da': 1, 'aterosclerotica das': 1, 'crossa da safena e': 1, 'Isolamento da crossa da safena': 1, 'recidiva da crossa': 1, 'Angiografia seletiva da arteria mesenterica': 1, 'atrofia da fibra muscular tipo II': 1, 'Reenchimento da': 1, 'ACLF': 1, 'ACLF-': 1, 'Fluxograma da coorte estudada': 1, 'das trema': 1, 'dA fracture': 1, 'da impedancia': 1, 'CA': 1, 'das vias aereas': 1, 'cronicas da miocardite': 1, 'da dimensao do aneurisma': 1, 'AAPD': 1, 'ECA': 1, 'selecao das variaveis explanatorias foi': 1, 'das variaveis explanatorias': 1, 'realizacao da cirurgia': 1, 'profilaxia da trombose venosa profunda': 1, 'aSDT': 1, 'perfil da cirurgia': 1, 'aneurismas da arteria poplitea': 1, 'Os aneurismas da': 1, 'no tratamento do aneurisma da': 1, 'carcinoma e irradiacao da regiao do pescoco': 1, 'persistencia da arteria isquiatica e': 1, 'da arteria isquiatica com': 1, 'persistencia da arteria isquiatica pode': 1, 'aneurisma da AIP': 1, 'persistencia da arteria isquiatica': 1, 'da arteria isquiatica': 1, 'aneurisma da arteria isquiatica': 1, 'persistencia completa da': 1, 'Aneurisma da arteria isquiatica': 1, 'dor da sua cicatriz': 1, 'acerca da doenca': 2, 'geralmente ha reincidencia da doenca': 1, 'descontinuidade da parede do': 1, 'da pele amarela': 1, 'situacao epidemiologica da populacao brasileira': 1, 'da Esquistossomose': 1, 'Silva eukarotic': 1, 'Pseudoaneurisma da arteria': 1, 'pseudoaneurisma da arteria': 1, 'da mielopatia degenerativa': 1, 'Silva Sandy': 1, 'dimensao biologica da especie humana': 1, 'da solucao': 1, 'Da-huang in pinyin': 1, 'bMinisterio da Cidadania': 1, 'FESF': 1, 'Silva FC': 1, 'Tardias da': 1, 'Carga da FA': 1, 'tamanho das fibras musculares': 1, 'ao longo da vida adulta': 1, 'da carne': 1, 'da pergunta': 1, 'NASF': 3, 'SIMIPS': 1, 'vantagem acentuada da orelha direita': 1, "Da'ish": 1, 'DL': 1, 'atrofia da mucosa': 1, 'neurologicas da': 1, 'complicacoes da doenca': 1, 'Descricao das variaveis': 2, 'Estatistica descritiva das variaveis': 1, 'Fracao atribuivel da doenca': 1, 'USF': 1, 'da reconstrucao foi': 1, 'da complicacao neurologica': 1, 'cuidar da doenca de': 1, 'nome da crianca': 1, 'Cuidar da doenca de': 1, 'ARPA': 1, 'da Vinci Xi': 1, 'risco modificaveis da': 1, 'Descricao detalhada da': 1, 'PAB': 1, 'biomecanicos da doenca': 1, 'quadril da': 1, 'proeminencia da regiao transicao colo-cabeca': 1, 'da versao pelvica foi de': 1, 'artroplastia da': 1, 'artroplastia da anca e manter': 1, 'Radiografias da anca esquerda': 1, 'artroplastia da anca': 1, 'protese da anca': 1, 'fisiopatologia molecular da doenca': 1, 'das epitheloide Hamangiom': 1, 'Das epitheloide Hamangiom': 1, 'cura da lepra': 1, 'curado da': 1, 'da lepra': 1, 'curas da doenca': 1, 'e das ciencias acessorias': 1, 'da morfeia': 1, 'da elefancia': 1, 'ARDS': 1, 'tardia da': 1, 'da carotida': 2, 'Das einzelne': 1, 'aterosclerotico da arteria carotida': 1, 'Prevalencia das fraturas faciais': 1, 'Descricao das cinco tarefas': 1, 'da rigidez pos-traumatica': 1, 'artroplastia da cabeca': 1, 'calculo da estratificacao': 1, 'da cabeca longa': 1, 'artrose da': 1, 'perda ossea da glenoide': 1, "Leonardo da Vinci's Syndrome": 1, "Leonardo da Vinci's syndrome": 1, 'stecco ducale Tu da che parte stai': 1, 'alteracao abrupta da obliquidade pelvica': 1, 'angulo da bascula da bacia': 1, 'da coluna': 1, 'da bascula': 1, 'Desigualdades na tendencia da': 1, 'Tibial hemimelia-split hand/foot syndrome': 1, 'Da DKMD': 1, 'diminuicao da forca da garra': 1, 'Forca da garra': 1, 'Das haufigste Symptom': 2, 'da auriculoterapia': 1, 'angulo da faceta': 1, 'Angulo da faceta': 1, 'da faceta': 2, 'de encurtamento da': 1, 'luxacao da articulacao sacroiliaca': 1, 'da angulacao': 1, 'da capsula facetaria': 1, 'distancia da faceta': 1, 'Angulo das facetas': 1, 'FAP': 1, 'da musculatura': 2, 'papel das terapias neoadjuvantes': 1, 'cleft DAs': 1, 'sistolica da': 1, 'aneurisma da arteria isquiatica direita': 1, 'persistencia da arteria isquiatica pode ser sintomatica': 1, 'ateroscleroticas da': 1, 'da Fadiga Cronica': 1, 'sindrome da': 1, 'sustentada da frequencia cardiaca': 1, 'da tecnica cirurgica atual': 1, 'da Pseudoartrose': 1, 'Duracao da pseudoartrose': 1, 'das pseudoartroses': 1, 'estroma da': 1, 'cardiodigestiva da': 1, 'Ke Da Cheng': 1, 'COST': 1, 'Oficina da Lembranca': 1, 'da espessura intima-media da carotida': 1, 'ciclo da vida': 1, 'erva-das-sete-': 1, 'da quitina por': 1, 'Jabuti da varzea': 1, 'pinha da Caatinga': 1, 'intraoperatoria da falha ossea': 1, 'margens da peca cirurgica': 1, 'Variacao da angulacao na': 1, 'dentro da ortopedia': 1, 'da geometria': 1, 'Convergencia da malha': 1, 'Virus da Gripe': 1, 'da doenca baseia-se': 1, 'topografia da arteria carotida direita': 1, 'alecrim da serra': 1, 'lipia da serra': 1, 'Gingenga da mata': 1, 'da acuracia': 2, 'das variaveis fisiologicas': 1, 'braco da alavanca foi': 1, 'acima da patela': 1, 'da regurgitacao': 1, 'BRA': 1, 'da eficacia dessa estrategia': 1, 'MEC': 1, 'FNDE': 2, 'da rede publica': 1, 'Toca das Oncas': 1, 'calculo da forca': 1, 'Porcentagens de notificacoes da': 1, 'Da Ri': 1, 'acuracia da medida': 1, 'Caracteristicas gerais da amostra.a': 1, 'das doencas venosas': 1, 'Perfil da fluencia': 1, 'mal da cabeca': 1, 'cimento - ponta da pinca': 1, 'da autonomia': 1, "Anche l'attivita antinfortunistica poteva essere gravata da simili problemi": 1, 'sanitaria da especie': 1, 'rotulo da': 1, 'intraoperatoria da veia': 1, 'da poeira domestica': 1, 'Das variaveis de': 1, 'da xue teng': 1, 'Caracteristicas da amostra.a': 1, 'um terco da distancia': 1, 'analise estatistica da': 1, 'profilaxia das endemias rurais': 1, 'obstrucao completa da luz': 1, 'programacao motora da fala': 1, 'da faixa': 1, 'da psicologa': 1, 'Avaliacao da alimentacao': 1, 'virus da imunodeficiencia humana': 2, 'Das variaveis respiratorias': 1, 'sarcomerica da cardiomiopatia': 1, 'pela maioria das adolescentes': 1, 'da migranea': 1, 'OMS.Um': 1, 'infarto previo no territorio da': 1, 'sindrome da apneia obstrutiva do sono': 2, 'respiracao unica das variaveis': 1, 'unica das variaveis': 1, 'da vertebroplastia': 1, 'ruptura da parede livre': 1, 'RPL VE': 1, 'RPL incompleta': 1, 'da perfusao periferica': 1, 'RPL': 1, 'da cirurgia corretiva': 1, 'da amostra desta pesquisa': 1, 'da distancia percorrida': 1, 'pontos acima da': 1, 'diagnostico da doenca': 1, 'gerais da amostra': 1, 'da indagini nazionali': 1, 'da valvoplastia': 1, 'progressao da doenca cardiaca valvar': 1, 'da altura foi': 1, 'abordagem da doenca': 1, 'diminuicao da altura da patela no': 1, 'da altura patelar': 1, 'idosa das capitais brasileiras': 1, 'carcinoma papilar da tireoide': 1, 'HCFMUSP': 1, 'toracoscopia DIH': 1, 'DIH pos': 1, 'DIH': 1, 'das amostras': 1, 'campo das hortensias': 1, 'Aterosclerose da': 1, 'aterosclerose da': 1, 'tardia da sifilis': 1, 'secundaria da infeccao': 1, 'multivariada das variaveis': 1, 'da compressao com': 1, 'da hipertensao': 3, 'da espera por': 1, 'mecanismos fisiopatologicos da hipertensao': 1, 'degeneracao da parede venosa': 1, 'SCP': 1, 'L da FC': 1, 'dAP': 1, 'mecanica da coronaria epicardica': 1, 'inverso da variancia': 1, 'tardio da doenca': 1, 'neuritica pura da': 1, 'ortopedica em decorrencia da hanseniase': 1, 'os tipos de deficiencia da populacao estudada': 1, 'GSDPF': 1, 'SDPF': 1, 'da amostra esta': 1, 'Etiologia da valvula aortica': 1, 'da raiz aortica': 1, 'SVA': 1, 'cirurgia de SVA': 1, 'da valvula': 1, 'tracos da doenca': 1, 'da sforzo': 1, 'descontinuidade da': 1, 'tamanho e espessura da': 1, 'fisiopatologicas da doenca': 1, 'ppCVF': 1, 'forca da associacao': 1, 'vat hoang da': 1, 'prognostico da doenca oncologica': 1, 'causa basica da morte foi utilizada': 1, 'Angiografia da coronaria direita': 1, 'Angiografia da coronaria esquerda': 1, 'Das variaveis': 1, 'da hanseniase': 1, 'implantacao da': 1, 'cirurgia da mama': 1, 'da amostra foi': 1, 'clinica da hanseniase': 1, 'PDSD': 2, 'da cobertura': 1, 'retinopatia da': 1, 'RP': 1, 'rota da seda': 1, 'introdutorios da doenca': 1, 'da contratilidade miocardica': 1, 'compressao da veia iliaca comum esquerda': 1, 'da doenca por': 1, 'progressao da': 1, 'MB': 1, 'UF': 2, 'escores das variaveis': 1, 'mama da dian hua': 1, 'eficacia da terapia antioxidante': 1, 'hiperextensao congenita da': 1, 'calculo do tamanho da amostra foi realizado': 2, 'Avaliacao da eficacia': 1, 'da MDCI': 1, 'ventricular da valvula': 1, 'MC': 1, 'eleicao da': 1, 'da espessura medio-intimal da carotida': 1, 'IMT': 1, 'da progressao do espessura carotidea': 1, 'da dilatacao braquial': 1, 'progressao da senescencia': 1, 'Efeito da': 1, 'reconstrucao da esfera publica': 1, 'split-hand/foot malformation associated with tibial hemimelia': 1, 'Braga-Silva': 1, 'aneurisma das arterias popliteas': 1, 'Aneurismas da arteria esplenica': 1, 'da xue fu dao yuan': 1, 'da doenca pela equipe': 1, 'TS': 1, 'da acqua ozonizzata': 1, 'ICP da arteria': 1, 'patogenia da doenca': 1, 'da parceria': 1, 'MISAU': 1, 'Fisiopatologia da obesidade': 1, 'CC poderia': 1, 'paradoxo da obesidade': 1, 'PRONAF': 1, 'da politica nacional': 1, 'Da Costas syndrome': 1, 'algumas fases da vida': 1, 'canario-da-capoura': 1, 'da amostra por regiao demografica': 1, 'tratamento da artropatia': 1, 'da sua aparencia': 1, 'rigidez da dietoterapia': 1, 'funcionais da amostra': 1, 'caracteristicas gerais da populacao': 1, 'da Toxicodependencia': 1, 'da empresa': 1, 'Descricao das operacoes patrimoniais': 1, 'da contaminacao': 1, 'da ciencia ortodontica': 1, 'da corsa': 1, 'IVFG': 1, 'geral da': 1, 'da demanda': 1, 'ED': 1, 'ED 8-': 1, 'ED 14- A crianca aceita alimentacao': 1, 'ED 2': 1, 'olhar da mae': 1, 'ED 4- A': 1, 'silenciosa da crianca': 1, 'alteracoes mecanicas cronicas da': 1, 'disturbios da diferenciacao do sexo': 1, 'os disturbios da diferenciacao': 1, 'LILACS': 1, 'causadora da doenca': 1, 'Arteriografia mostrando oclusao da arteria': 1, 'trattamento selettivo della bovina da latte alla messa': 1, 'Da-ming-der-shing Tree': 1, 'muscular das panturrilhas': 1, 'atrofia da substancia cinzenta': 1, 'da temperatura': 1, 'abordagem da hipotensao ortostatica': 1, 'neurogenico da hipotensao ortostatica': 1, 'Angiotomografia das': 1, 'da funghi': 1, 'AFA': 1, 'da pressao sanguinea': 1, 'RLA': 1, 'dAdV dA': 1, 'da dor cronica': 1, 'DLM': 1, 'Mecanismos da ICFEsn': 1, 'substancia da': 1, '-da-india': 1, 'causa da baba': 1, 'crianca parecia estar por causa da baba': 1, 'altura da abobada': 1, 'Das and Chandrasena': 1, 'Retirada da ventilacao mecanica': 2, 'da complacencia': 2, 'da cama cinetica': 1, 'fase aguda da': 2, 'da ventilacao': 1, 'da falha': 1, 'retirada da ventilacao mecanica': 1, 'Diminuicao da albumina esta associada': 1, 'falencia da retirada VM': 1, 'diminuicao da': 1, 'Lenke-silva': 1, "Da Costa's disease": 1, 'da doenca nas atividades': 1, 'aguda da DPOC': 1, 'EADPOC': 1, 'da alta': 1, 'da Silva': 1, 'myoclonic Das': 1, 'da camisa': 1, '-Silva': 1, 'Saudades da terra': 1, 'maioria das capitais brasileiras': 1, 'epoca da cirurgia': 1, 'PFTNA': 1, 'PFT': 1, 'VEPP': 1, 'da curva comprimento-': 1, 'e extensao da doenca': 1, 'Nenhuma das caracteristicas': 1, 'Da De': 1, 'da necropsia': 1, 'ACD': 1, 'clinica da degluticao': 1, 'Silva & Cavalc': 1, 'Uso da adrenalina com': 1, 'da doenca podem': 1, '-tah-da': 1, 'aceitabilidade da': 1, 'extraccao da catarata': 1, 'conhecimento da existencia do CE': 1, 'expansao rapida da maxila': 1, 'os calculos no periodo da': 1, 'da coronariopatia obstrutiva': 1, 'da escola medica': 1, 'potencialidades das': 1, 'das novas escolas medicas': 1, 'PCD': 1, 'calculo da cobertura': 2, 'Ribeiro-Silva': 1, 'Das tecnicas utilizadas': 1, 'catarro da bexiga': 1, 'dVSP': 1, 'Jardim da Estrela': 1, 'condicoes nutricionais da crianca': 1, 'DFH': 1, 'APS': 1, 'infarto da cortical': 1, 'Estrategia de coleta da literatura': 1, 'formas proliferativas da': 1, 'luxacao traumatica aguda da patela': 1, 'PFO': 1, 'escore da dor': 1, 'tipico da doenca': 1, 'da pandemia da': 1, 'MDPA': 1, 'da PA noturna': 1, 'inflamatoria sistemica da circulacao': 1, 'OPAS': 1, 'cirurgia e da circulacao': 1, 'efeitos da epigenetica': 1, 'da doenca cardiaca': 1, 'das variaveis utilizadas': 1, 'AIVD': 1, 'variaveis da amostra': 1, 'Das Inka-Korn': 1, 'etapas da coleta': 1, 'Organizacao da Coleta': 1, 'pela diminuicao das interferencias': 1, 'variavel da funcao diastolica': 1, 'ACP': 1, 'da costa syndrome': 1, 'musculatura da fala': 1, 'eficacia das terapias intensivas': 1, 'TSF': 1, 'tibial hemimelia-split hand and foot syndrome': 1, 'PNPD': 1, 'da perda': 1, 'valle da pesca': 1, 'valli da pesca': 1, '31 valli da pesca': 1, '-intimal da carotida comum': 1, 'CMI da carotida': 1, 'Silva pattern': 1, 'paradoxo da obesidade ja foi': 1, 'Braccio da gamba': 1, 'SILVA PATTERN-': 1, 'da obesidade': 1, 'FARMUSP': 1, 'estresse cronico da': 1, 'da eventuali audit esterni': 1, 'organizacao da informacao': 1, 'malattie da meningococco': 1, 'da diversi': 1, 'da encefalite severa': 1, 'setticemia da meningococco': 1, 'PMM': 1, 'da evangelica': 1, 'da espirita/kardecista': 1, 'escala das variaveis': 1, 'TAVR': 1, 'da degluticao diagnosticada': 1, 'PMAQ-AB': 1, 'SARA': 2, 'canfora-da-horta': 1, 'Delta T': 1, 'Liguria da Lampedusa': 1, 'sequencia da fala': 1, 'conhecimento acerca da': 1, 'e variaveis da PPG': 1, 'Analise estatistica e justificativa do tamanho da amostra': 1, 'da congestao pelvica': 1, 'pulmonar da': 1, 'da patela foram': 1, 'originaria da': 1, 'os impactos da deficiencia auditiva': 1, 'Das periampullare': 1, 'da olfacao': 1, 'inflamacao pulmonar da': 1, 'incomodo da hiperacusia': 1, 'Ling-Nan-Da-Mei': 1, 'Perfil das coagulopatias hereditarias': 1, 'TdC Fracture': 1, 'TdC edifice': 1, 'da maioria': 1, 'TH-SHFM': 1, 'Angioplastia da arteria mesenterica superior': 1, 'Os sintomas da': 1, 'progressao da curva e falha do': 1, 'geral da disfonia': 1, 'da artrose facetaria': 1, 'Degeneracao da articulacao facetaria com': 1, 'esta dentro da veia pulmonar': 1, 'da complacencia dinamica': 1, 'duracao da parada cardiaca': 1, 'musculatura da': 1, 'sindrome da angustia respiratoria aguda': 1, 'da troponina I': 1, 'cicatrizacao da fratura': 1, 'CRT-Da': 1, 'TAVI': 1, 'cirurgica da valvula aortica': 1, 'PAAS': 1, 'Os sintomas desta doenca degenerativa da': 1, 'torax da vitima': 1, 'dA-': 1, 'Das Angiosarkom': 1, 'sintomas da doenca na interne16': 1, 'Da-ye-ku-ding-cha': 1, 'parestesia da': 1, 'M2FA-dA': 1, 'sintomas respiratorios da doenca': 1, 'da tipoia': 1, 'EAD': 1, 'da retinopatia diabetica': 2, 'da morte': 1, 'Composicao aminoacidica da sericina': 1, 'hidrofilica da sericina': 1, 'radioscopica da osteossintese transtrocanterica': 1, 'tamanho da incisao necessaria': 1, 'traumatismos da medula espinhal': 1, 'Medida da dimensao': 1, 'da folha verde do tabaco': 1, 'FACISA': 1, 'da pessoa': 2, 'Aparecida da': 1, 'da crociera': 1, 'da-crociera-a': 1, 'calculo da amostra utilizou': 1, 'Varzea da Volta': 1, 'Da-Vinci': 1, 'da espessura da lingua': 1, 'vergonha da': 1, 'Da-cheng Hao': 1, 'da mucosa bronquica': 1, 'mecanismos da taquicardia': 1, 'da taquicardia': 1, 'da hipoxia intermitente cronica': 1, 'PEC da terapia': 1, 'Poco das Antas': 1, 'da pratica clinica': 1, 'das informacoes colhidas': 1, 'da degeneracao do': 1, 'da mesma faixa etaria': 1, 'da emergencia hipertensiva': 1, 'havido concordancia da chefia do servico de emergencia': 1, 'da valvula aortica transcateter': 1, 'Prevalencia da automedicacao': 1, 'Perfil da automedicacao': 1, 'Lar das Vovozinhas': 1, 'melhorias da': 1, 'Distancia da': 1, 'Manaca da Serra': 1, 'da Crianca': 1, 'Oclusao aguda da': 1, 'dentro da categoria': 1, 'da pessoa idosa': 1, 'Das criancas': 1, 'da tarde': 1, 'da prova': 1, 'Donatoni da Silva': 1, 'eficacia da estrategia proposta': 1, 'TA': 1, 'da febre varia': 1, 'Das Verhaltnis des': 1, 'questionario da pesquisa qualitativa': 1, 'cicatrizacao da ulcera no': 1, 'da cicatrizacao': 1, 'da coxa direita': 1, "Da-eun's Story": 1, 'da pia': 1, 'da canula': 1, 'gestao da incerteza': 1, 'filosofo da': 1, 'calculo da complacencia': 1, 'Monitorizacao da ventilacao mecanica': 1, 'diminuicao da complacencia da parede toracica': 1, 'algumas das etapas analisadas': 1, 'da angustia respiratoria aguda': 1, 'dA. insuavis': 1, 'Estatistica descritiva das': 1, 'Pseudoaneurisma da arteria glutea': 1, 'Houve melhora imediata da dor no': 1, 'da xia xie': 1, 'Das verursachende Virus': 1, 'TDL': 1, 'da bu becerileri': 1, '-intimal da': 1, 'doenca da arteria carotida': 1, 'cobertura da pulverizacao intradomiciliar': 1, 'sequelas da doenca pos-aguda': 1, 'sequelas da doenca': 1, 'da doenca pos-aguda': 1, 'mecanica da respiracao atraves da frequencia respiratoria': 1, 'Aparecida Silva': 1, 'mulungu-da-caatinga': 1, 'mulungu-da-varzea': 1, 'mulungu-da-flor-amarela': 1, 'asma da sua crianca': 1, 'CAC.In': 1, 'MMCD': 1, 'dA-P': 1, 'descritiva das variaveis': 1, 'decorrencia da monocrotalina': 1, 'espessura da intima-media da arteria carotida': 1, 'da linea': 1, 'idade da crianca +': 1, '-morbilita da': 1, 'tamanho da amostra pode': 1, 'piora da dispneia': 1, 'terapia da dignidade': 1, 'Revisao sistematica da': 1, 'da azaltabildigi': 1, 'HD': 1, 'Nigga ware da': 1, 'sindrome da attivazione macrofagica': 1, 'fotografia da peca cirurgica': 1, 'maioria das vezes': 1, 'da pele ou raca': 1, 'etnico-raciais da populacao': 1, 'da licenca': 1, 'Silva-Islas': 1, 'Organizacao das fibras colagenas em': 1, '-N6-dA': 1, 'sozel ya da motor davranis': 1, 'da Frequencia Cardiaca': 1, 'Resumo da orientacao': 1, 'da funcao sintetica': 1, 'da doenca diarreica': 1, 'erva-da-': 1, 'erva-da-pontada': 1, 'forca muscular da cinesiologia': 1, 'Verificacao da musculatura': 1, 'disfuncao da articulacao sacroiliaca': 1, 'DASI': 1, 'da hipertensao com': 1, 'cirurgia da coluna': 1, 'Das Impfduell': 1, 'Da persona sorda': 1, 'AMAN': 1, 'achados da ressonancia magnetica': 1, 'da ressonancia magnetica': 1, 'borda da': 1, "Da'irat": 1, 'Posicao da esfera': 1, 'calculo da acuracia': 1, 'das doencas cronicas': 1, 'calorias da': 1, 'mecanica da funcao': 1, 'estatistica nas comparacoes das variaveis': 1, 'Silva A,': 1, 'Perfil das internacoes': 1, 'confiancas das variaveis analisadas': 1, 'fisiopatologico da doenca': 1, 'OA RC': 1, 'da Fibrocartilagem': 1, 'TAD': 1, 'teoria da autodeterminacao': 1, 'CL': 1, 'tamanho da ulcera': 1, 'fisiopatologia da': 1, 'secundaria da doenca': 1, 'dA lesions': 1, 'MM-dA': 1, 'split-hand/foot associated with tibial hemimelia': 1, 'C19-DAs': 1, 'C20-DAs': 1, 'VC': 1, 'Achados da angiografia': 1, 'isquemia da glandula pituitaria': 1, 'quan-shui-da-huang': 1, 'Quan-shui-da-huang': 1, 'Datta-Das': 1, 'metafora da guerra': 1, 'Caracterizacao da pesquisa': 1, 'Angiografia da arteria pulmonar': 1, 'Angiografia da': 1, 'estatistica da dependencia': 1, 'coletivo da doenca': 1, 'da fluencia': 1, 'fluencia da': 1, 'VdT': 1, 'dolore cronico da patologia ortopedica': 1, 'TT-DV': 1, 'impacto da atencao primaria em saude': 1, 'periferia da': 1}
|
da
|
Disease
|
MESH:C535676
|
{'acrofacial dysostosis Guion-Almeida type': 2, 'AFDGA': 3, 'pre-axial acrofacial dysostosis, Guion Almeida type': 1, 'Richieri-Costa/Guion-Almeida syndrome': 2, 'RCGAS1 and 2': 1, 'Richieri-Costa/Guion-Almeida syndrome type 2': 1, 'Richieri-Costa/Guion-Almeida syndrome type 1': 1, 'RCGAS1': 1, 'acrofacial dysostoses Guion-Almeida type': 1, 'Acrofacial Dysostosis Guion-Almeida': 1, 'acrofacial dysostosis type Guion-Almeida': 1}
|
AFDGA
|
Disease
|
MESH:C535677
|
{'cleft mandible': 30, 'Richieri-Costa and Pereira syndrome': 4, 'Robin type clefts': 1, 'RCPS': 20, 'clefting of the mandible': 2, 'cleft mandibles': 2, 'Robin cleft': 2, 'clefting of the mandible and vertebrae': 1, 'Richieri-Costa-Pereira syndrome': 40, 'Cleft mandible': 3, 'cleft of the mandible': 19, 'cleft of the mandible and lower': 1, 'Cleft of the Mandible and Lower': 1, '-Costa-Pereira syndrome': 1, 'clefts of the mandible': 2, 'cleft mandible and limb anomalies': 5, '-Pereira calc': 1, 'malformations in the limb buds and mandible': 1, 'Richieri-Costa Pereira syndrome': 4, 'Mandible cleft': 1, 'cleft of mandible': 4, 'PEREIRA': 2, 'Richieri-Costa-Pereira Syndrome': 6, 'Richieri-costa and Pereira syndrome': 1, 'Richieri Costa and Pereira syndrome': 1, 'Richieri-Costa-Pereira': 1, 'Richieri Costa Pereira syndrome': 1, 'Plurispermiopsis Pereira-Carv': 1, 'Richeri-Costa-Pereira syndrome': 1, 'RCPS disease': 1, 'mandible cleft': 2, 'Congenital clefts of the mandible': 1, 'foot or ankle RCPS': 1, 'FDS RCPS': 1, 'Clefting of the mandible': 1, 'CHPR': 2, 'Richieri-Costa Pereira Syndrome': 2, 'Craniofacial cleft Short mandible': 1, 'Robin-type clefts': 1, 'cleft in the mandible': 1, 'Richieri-Costa-Pereira (RCP) syndrome': 2, 'RCP syndrome': 2, 'Richieri-Costa-Pereira and': 1, 'limb or mandible malformations': 1, 'malformations of the limbs and mandible': 1, 'RCP': 1, 'Richieri-Costa-Pereira acrofacial dysostosis': 1, 'Costa Pereira syndrome': 1, 'cleft of the mandible and the': 1, 'Congenital cleft mandible': 1, 'Engle-Pereira-Rovelli-Livine': 1, 'EPRL': 1, 'cleft in mandible': 1, 'mandible lacinia mobilis cleft': 1, 'INHABITANTS OF VILA PEREIRA': 1, 'Richieri Costa-Pereira syndrome': 1, 'MOMS RCPS': 1, 'clefting deformity of the mandible': 1, 'mandible symphysis cleft': 1, 'MP': 1, 'Clefts involving the mandible and': 1, 'clefts of the maxilla and mandible': 1}
|
Richieri-Costa-Pereira syndrome
|
Disease
|
MESH:C535679
|
{'anterior cleavage syndrome': 5, 'anterior chamber': 875, 'chambers': 437, 'anterior chamber angle pigmentation': 2, 'Rieger anomaly': 138, 'Axenfield-Rieger syndrome': 2, 'Axenfeld-Rieger syndrome': 572, 'anterior chamber flare': 253, 'ACA': 59, 'AC': 581, 'ACD': 638, 'chamber deformity': 3, 'ARS': 205, 'Axenfeld-Rieger Syndrome': 103, 'anterior chamber hypopyon': 32, 'anterior chamber hemorrhage': 117, 'chamber': 836, 'anterior chamber stenosis': 1, 'Axenfeld anomaly': 59, 'anterior chamber eye defects': 6, 'ISAC': 1, 'CPSF': 44, 'ACAID': 369, 'anterior chamber-associated immune deviation': 250, 'anterior chamber reaction': 322, 'AC tumors': 7, 'TARGET CLEAVAGE': 1, "Rieger's syndrome": 73, 'Anterior chamber flare': 55, 'anterior chamber irritation': 7, 'ACIOL': 40, 'double anterior chamber': 39, 'Anterior Chamber': 30, 'anterior eye chamber abnormalities': 5, 'anterior chamber worm': 1, 'anterior chamber filariasis': 1, 'developmental anomalies in the anterior chamber': 1, 'diseases of the anterior chamber of the eye': 5, 'of the anterior eye chamber': 1, 'SCAP': 55, 'CCD': 30, 'Anterior chamber nodules': 1, 'conjunctival and anterior chamber granulomas': 1, 'chamber reaction': 23, 'posterior corneal and anterior chamber abscess': 1, 'somatic anomalies': 87, 'PP-ACD': 1, 'anterior chamber bleeding': 66, 'LATE OBLITERATION OF THE ANTERIOR CHAMBER': 1, 'C/P.': 1, 'Axenfeld and Rieger anomalies': 7, 'AC mass': 1, 'anterior-chamber infection': 1, 'cleavage fractures': 21, 'Cleavage fracture': 5, "Rieger's anomaly": 56, 'Rieger syndrome': 187, 'anterior chamber abnormalities': 40, 'anterior chamber angle': 76, 'chamber abnormalities': 8, "Axenfeld's syndrome": 12, 'torture chambers': 1, 'cleavage fracture': 82, 'AR malformations': 4, 'Axenfeld-Rieger (AR) malformations': 5, 'anterior chamber shallowing': 80, 'anterior chamber and vitreous': 2, 'AC shallowing': 2, 'CLEAVAGE DIOXYGENASE 8': 2, 'anterior chamber tumor': 5, 'cardiac chamber abnormalities': 6, 'Ocular Axenfeld-Rieger Syndrome': 1, 'anterior chamber diseases': 5, 'anterior chamber disorders': 1, '-chamber injuries': 1, 'anterior chamber fluctuation': 1, 'Anterior chamber fluctuation': 1, 'ocular surface and anterior chamber disorders': 1, 'anterior chamber inflammatory reaction': 22, "Riegers' anomaly": 1, 'anterior chamber and/': 2, 'anterior chamber collapse': 63, 'anterior chamber cyst': 13, 'ACP': 13, 'angle of anterior chamber': 1, 'Axenfeld Rieger syndrome': 22, 'anterior chamber induced immune deviation': 1, 'RIEG abnormalities': 1, 'anomalies of the anterior chamber of the eye': 2, 'RIEG': 2, 'Axel-Riegers Syndrome': 1, 'anterior chamber hemorrhagic hypopyon': 1, 'Double anterior chamber': 5, 'anterior eye chamber cysts': 1, 'corneal or anterior chamber abnormality': 1, 'anterior chamber 2': 1, 'abnormalities of the anterior chamber': 4, 'Anterior chamber Hypopyon': 1, 'anterior chamber angle obstruction': 5, 'hemorrhage of the AC': 1, 'AC tamponade': 2, 'anterior chamber inflammationAND2': 1, 'Anterior chamber-associated immune deviation': 41, 'anterior chamber associated immune deviation': 66, 'perforation of the anterior chamber': 4, 'Axenfeld-Rieger anomaly': 125, 'anterior chamber intraocular lens (': 1, 'ACIOL) complications': 1, 'ACIOL complications': 1, 'defects of the anterior chamber of the eye': 3, 'atrial chambers': 1, 'anterior chamber perforation': 15, 'contralateral Rieger anomaly': 1, 'CLEAVAGE': 53, 'Axenfeld-Rieger syndrome, type 1': 3, 'LRSC': 2, 'Chambers': 3, 'chamber-': 1, 'anterior chamber complications in eye': 1, 'AC bleeding': 3, 'of the AC': 1, 'autosomal dominant Rieger syndrome': 1, 'narrow anterior chamber': 9, 'shallow anterior chamber': 61, 'anterior chamber malformation': 11, 'anterior chamber hypoxia': 7, 'anterior chamber fibroization': 2, 'anterior chamber fibrosis': 5, 'cysts of the iris or anterior chamber': 1, 'occlusion of the anterior chamber angle': 3, 'ARA': 24, 'damage of anterior chamber angle': 1, 'Euthanasia chamber': 4, 'ACS': 2, 'Anterior Chamber Shallowing': 1, "Axenfeld's anomaly": 26, 'AC cleavage syndrome': 1, 'anterior chamber cholesterolosis': 15, 'Cysticercosis in anterior chamber': 1, 'cysticercosis in anterior chamber of eye': 1, 'anterior chamber cleavage defect': 1, 'SRC': 1, 'transverse cleavage fracture': 1, 'anterior chamber cysticercosis': 5, 'anterior chamber contamination': 5, 'Anterior chamber contamination': 3, 'Chamber stiffness': 1, 'anterior-chamber defects': 2, 'Axenfeld-Rieger malformation': 12, 'Axenfeld-Rieger syndrome type 3': 11, 'of atrial chambers': 1, 'nerve cleavage': 1, 'EG': 1, 'QC fracture': 1, 'Axenfeld-Rieger anomaly and': 1, 'anterior chamber tube occlusion': 1, 'anterior chamber empyema': 11, 'anterior chamber and/or angle anomalies': 1, 'Rieger Syndrome': 12, 'CHAMBER': 29, 'anterior chamber injuries': 3, 'anterior chamber flares': 10, 'anterior chamber cell and flare': 8, 'Nectary chamber': 1, 'nectary chamber': 1, 'Axenfeld-Rieger anomalies': 7, 'SMALL PATIENT CHAMBER': 1, 'LC': 3, 'of the anterior chamber': 7, 'anterior chamber malformations': 15, 'malformations of the anterior and posterior chambers of the eye': 1, 'Malformations of the anterior chamber of the eye': 1, 'Rieger type I syndrome': 1, 'abnormalities in the anterior chamber angle': 1, 'anterior chambers': 21, 'anterior chamber pseudohypopyon': 6, 'anterior chamber exudates': 15, 'Chamber': 43, 'Axenfeld embryontoxon posterius': 1, 'open anterior chamber angle': 27, 'Anterior chamber hemorrhage': 16, 'MFCs': 7, 'Rieger eye malformation': 4, 'anterior chamber open angle': 1, 'ulnar somatic anomalies': 1, 'anterior chamber depth': 14, 'CLEAVAGE OF LYCOPENE': 1, 'Anterior chamber reaction': 16, 'CPA': 32, 'cleavage': 29, 'Cleavage': 2, 'Anterior chamber': 22, 'AC tumor': 4, 'anterior chamber opacity': 7, 'AC exudates': 3, 'anterior chamber reactionStandard': 1, 'MCs': 1, 'anterior-chamber infections': 1, 'CLEAVAGE ACTIVITY': 1, 'CLEAVAGE AND INITIATION OF GASTRULATION': 1, 'anterior-chamber defects of the eye': 3, 'chamber disproportion': 4, 'AC-associated immune deviation': 12, 'anterior chamber invasion': 8, 'TCC': 1, 'anterior chamber deepening': 24, 'ANC': 1, 'ANTERIOR CHAMBER': 10, 'corneal (and anterior chamber) abnormalities': 1, 'ring melanoma of the anterior chamber angle': 2, 'Ring melanoma of the anterior chamber angle': 2, 'ring melanoma of anterior chamber angle': 1, 'MYOC Rieger syndrome': 1, 'Anterior chamber neovascularization': 2, 'hemorrhage in the anterior chamber': 4, 'malformation of the anterior chamber angle': 4, 'ACV': 9, 'Anterior Chamber Depth': 14, 'anterior chamber syndrome': 3, 'corneal and anterior chamber alterations': 2, 'adhesions in the anterior chamber': 1, "CASE OF RIEGER'S DISEASE": 1, 'CCDs': 15, 'anterior chamber cysts': 13, 'AC chamber inflammation': 1, 'anterior chamber inflammatory': 38, 'Anterior chamber inflammatory': 5, 'chamber angle injury': 2, 'anterior chamber collapse syndrome': 1, 'Anterior chamber collapse syndrome': 1, 'anterior chamber (AC) shallowing': 1, 'CLEAVAGE SITE': 3, 'developmental abnormality of the anterior chamber angle': 2, 'hemorrhage of the anterior chamber': 6, 'Axenfield-Rieger anomaly': 2, 'anterior chamber angle synechia': 1, 'RC': 6, 'Axenfeld-Rieger anomaly of the anterior eye chamber': 1, 'BDCs': 1, 'malformation of the anterior chamber of the eye': 3, 'Axenfeld-Reiger Syndrome': 6, 'Axenfield - Rieger syndrome': 1, 'AC) flare': 1, 'cleavage anomalies': 9, 'nuclear and cleavage anomalies': 1, 'malformations in the anterior chamber of the eye': 1, 'posterior synechiae of the anterior chamber': 1, 'anterior chamber abnormality': 5, 'ACC': 24, 'anterior chamber defects': 34, 'congenital anterior chamber defects': 1, 'anterior chamber defects of the eye': 2, 'anterior chamber flattening': 16, 'Axenfeld-Rieger': 43, 'cleavage defects': 3, 'EYELASHES IN THE ANTERIOR CHAMBER': 1, 'CoM': 1, 'somatic and visceral anomalies': 1, 'chamber dysfunction': 23, 'Anterior chamber cysts': 2, 'chamber defects': 6, 'chamber and anterior vitreous': 1, 'defect of the anterior chamber of the eye': 1, 'Eye Chambers': 1, 'ACA reduction': 1, 'of anterior chamber': 4, 'shallow anterior chamber with low intraocular pressure': 1, 'Anterior chamber deepening': 3, 'Axenfeld-Rieger malformations': 11, 'Cholesterolosis of the anterior chamber': 3, 'flat anterior chamber': 13, 'loss of anterior chamber depth': 1, 'CP': 4, 'anterior chamber I.O.L.': 1, 'microcornea with shallow anterior chamber': 1, 'congenital anomalies of the anterior chamber': 7, 'open anterior chamber': 3, 'AC inflammatory': 3, 'HCC': 7, 'anterior chamber cell': 15, 'CLEAVAGE AND POLYADENYLATION': 1, 'Anterior chamber-': 1, 'anterior chamber crowding': 6, 'MC': 5, 'Axenfeld-Rieger syndrom': 1, 'EC-CC': 1, 'NEC-CC': 1, 'Axenfeld/Rieger': 1, 'Developmental anomalies of anterior chamber angle': 1, 'Anterior chamber cysticercosis': 3, 'chamber injury': 4, 'Axenfeld-type anomalies': 1, 'DCIC': 1, 'absence of the anterior chamber': 4, 'the anterior chamber angle': 1, 'ACW': 2, 'Enlarged anterior chamber': 1, 'ophthalmological malformations of the anterior chamber': 1, 'anterior chamber toxicity': 8, 'chamber angle anomalies': 4, 'chamber angle anomaly': 1, 'cleavage tears': 7, 'ACF': 12, 'anterior-chamber anomalies': 1, 'anterior chamber lens': 2, 'Anterior chamber leukaemic hypopyon': 1, 'anterior chamber anomalies': 30, 'axenfeld-rieger syndrome': 6, 'Axenfeld Reiger malformations': 1, 'Axenfeld-Rieger Malformations': 1, 'Axenfeld-Rieger spectrum': 6, 'anterior chamber depht': 1, 'chamber hypopyon': 2, 'DNA CLEAVAGE': 1, 'shallowing of the anterior chamber': 7, "Axenfeld Rieger's anomaly": 2, 'ACR': 5, 'abnormality of the anterior chamber angle': 1, 'anterior chamber damage': 1, 'ocular surface and anterior chamber diseases': 1, 'anterior chamber developmental anomalies': 7, 'Chamber Flightn': 1, 'abnormal cardiac chamber dimensions': 1, 'PC-AHM': 1, 'Shallow AC': 3, 'CT': 4, 'anterior chamber exudation': 17, 'anterior chamber hemorrhages': 7, "Axenfeld's Anomaly": 4, 'chamber injuries': 2, 'PCC': 7, 'anterior-chamber-associated immune deviation': 5, 'Anterior chamber angle synechiae': 1, 'anterior chamber angle synechiae': 1, 'postoperative shallow anterior chamber': 2, 'anterior chamber deposits': 1, 'anterior chamber relapse': 1, 'worm in the anterior chamber': 1, 'CULTURE CHAMBER': 1, 'anterior-chamber cleavage syndrome': 1, 'cleavage abnormalities': 11, 'Axenfeld-Rieger anomaly or syndrome': 3, 'AD': 2, 'Axenfeldt anomaly': 2, 'anterior chamber virus infections': 1, 'Rieger abnormality': 9, 'PC tear': 1, 'anterior chamber angle abnormalities': 6, 'chamber remodelling': 13, "Axenfeld-Rieger's syndrome": 11, 'CF': 3, 'Corneal and other anterior chamber anomalies': 2, 'Axenfeld-Reiger syndrome': 18, 'anterior chamber developmental defects': 1, 'anterior chamber anomaliesOcular and eyelid colobomaCalcification': 1, 'anterior chamber scarring': 1, 'Anterior chamber angle tears': 1, 'absence of the anterior chamber of the': 1, 'abnormalities of the cornea and anterior chamber': 1, 'absence of anterior chamber': 2, 'agenesis of the anterior chamber': 2, 'AC flare': 41, 'CLV': 3, 'asymmetric anterior chamber depth': 1, 'axenfeld anomaly': 1, 'pigmentation of the anterior chamber angle': 1, 'Anterior chamber-associated immunity deviation': 1, 'anterior chamber and pupillary obstruction': 1, 'chamber (AC': 2, '4CH': 1, 'somatic anomaly': 7, 'congenital defect of the anterior chamber of the eye': 3, 'TNP anterior chamber-associated immune deviation': 1, 'CLEAVAGE IN BOTH EUKARYOTIC': 1, 'Rieger': 9, 'hypoplastic chamber': 2, 'Axenfeld-Reiger': 1, 'Pigmentation of the anterior chamber angle': 2, 'Anterior chamber anomalies': 3, 'Anterior chamber disorder': 2, 'Rieger anomaly, Rieger Syndrome': 1, 'Axenfeld Rieger': 4, 'PIC': 1, 'AC collapse': 5, 'Axenfeld- Rieger syndrome': 3, 'chamber malformations': 3, 'CHAIN CLEAVAGE': 1, 'malformation of the anterior chamber': 4, 'the anterior chamber': 3, 'anterior chamber lesions': 7, 'Anterior chamber bleeding': 8, 'Posterior chamber diseases': 1, 'ARS syndrome': 3, 'glaucomatous 1-chamber eyes': 1, 'anterior chamber infection': 17, 'EC': 11, 'anterior chamber (AC) flare': 14, 'prosencephalic cleavage': 2, 'Anterior chamber accumulation': 1, 'CLEAVAGE OF': 12, 'chamber (AC)': 1, 'double anterior chambers': 1, 'anterior chamber membrane formation': 1, 'AC developmental anomalies': 1, 'Anterior chamber (AC) anomalies': 1, 'bilateral shallow anterior chambers': 1, 'chamber dysmorphogenesis': 2, 'CPAi': 1, 'MFC': 4, 'cleavage disorders of the': 1, 'Axenfeld-Reiger Syndroma': 1, 'chamber deformities': 2, 'Axenfeld-Rieger syndrome, type': 2, 'Axenfeld-Reiger Anomaly': 2, 'PCPA': 8, 'Axenfeld-': 1, 'anterior chamber formation': 5, 'cleavage arrest': 1, 'perforations of the anterior chamber': 1, 'shallowing of anterior chamber': 2, 'atrial chamber': 5, 'Axenfeld Reigen syndrome type 3': 1, 'cleavage syndrome': 2, 'Axenfeld-Rieger Malformation': 4, 'FAC': 4, 'anterior chamber division syndrome': 1, 'anterior chamber complications': 10, 'Anterior Chamber Paracentesis': 7, 'Anterior chamber cholesterolosis': 8, 'IC': 3, 'anterior chamber disease': 15, 'anterior chamber infiltration': 4, 'Axenfeld-Rieger syndrome and anomaly': 2, 'anterior chamber angle crowding': 3, 'CLEAVAGE REACTION OF NUCIFERINE': 1, 'PC': 22, 'Loss of anterior chamber': 1, 'cleavage malformations': 1, 'anterior chamber anomaliesOcular': 1, 'AC pigmentation': 1, 'pigmented anterior chamber': 1, "Axenfeld-Reiger's syndrome": 2, 'anterior chamber defect': 11, 'anterior chamber reactions': 13, 'CStF': 2, 'Chamber fires': 1, 'chamber fires': 1, 'Axenfeld Rieger Syndrome': 7, 'anterior chamber infections': 7, 'Anterior chamber intra ocular lene': 1, 'anterior chamber-': 6, 'Axenfeld-Rieger (AR) syndrome': 4, 'anterior chamber instability': 17, 'myocardial chambers': 1, 'anterior chamber angle compromise': 1, 'Axenfeld syndrome': 17, 'cleavage delay': 1, 'CPF': 7, 'CAN': 2, 'inclusion cyst of the anterior chamber': 1, 'Rieger malformation': 4, 'anterior chamber vitreous prolapse': 3, 'Rieger syndrome Dental hypoplasia': 1, 'anterior chamber precipitates': 1, 'anterior chamber tamponade': 8, 'Anterior chamber hemorrhages': 2, 'MSICs': 1, 'Rieger malformation of the iris': 1, 'TEC': 11, 'Pseudoanterior chamber': 2, 'CDs': 1, 'CPs': 1, 'CoTC': 1, 'inflammatory anterior chamber reaction': 2, 'anterior chamber angle open': 2, 'anterior chamber scroll': 1, 'Anterior chamber scroll': 1, 'CLEAVAGES': 2, 'CLEAVAGES OF MET': 1, 'MRNA ENDONUCLEOLYTIC CLEAVAGE INDUCED': 1, 'common-chamber anomaly': 1, 'anterior eye chamber anomalies': 3, 'Anterior chamber involvement': 2, 'anterior chamber hyperintensity': 1, 'ocular anterior chamber anomalies': 2, 'anterior chamber eye anomalies': 6, 'anterior chamber angle anomalies': 10, 'instability of anterior chamber': 1, 'abnormalities of the cornea, anterior chamber angle,': 1, 'ICP': 1, 'anterior chamber cell (ACC)': 2, 'REC': 1, 'anterior-chamber': 3, 'AC angle cyst': 1, "Axenfeld's": 1, "Axenfeld's dystrophy": 1, 'anterior chamber, dental and umbilical anomalies': 1, 'anterior chamber immune deviation': 6, 'CLEAVAGE ON': 1, 'anterior chamber migration': 6, 'anterior chamber dislocation': 10, 'ocular anterior chamber defects': 1, 'ARS type 1': 3, 'Type 1 ARS': 1, 'ARS type I': 2, 'ARS type III': 2, 'type I ARS': 1, 'ARS type II': 2, 'chamber angle defects': 1, 'collapse of the anterior chamber': 3, 'AN': 1, 'anterior chamber angle occlusion': 3, 'Axenfeld-Rieger syndromes': 2, 'shallow anterior chamber learning difficulty': 1, 'anterior chamber luxation': 1, 'Developmental anomaly of the anterior chamber angle': 1, 'anterior chamber exudate': 3, 'open angle of the anterior chamber of the': 1, 'traumatic angle cleavage': 2, 'Axenfeld Rieger anomaly': 5, 'chamber angle': 15, 'ARS ophthalmopathy': 1, "Peters-Rieger's syndrome": 2, 'ARS-related anomalies': 1, 'abnormalities of the anterior chamber of the eye': 6, 'anterior chamber dislocations': 1, 'RS': 2, 'RA': 6, 'AA': 6, 'AS': 2, 'NOCs': 1, 'Anterior chamber infiltration': 2, 'anterior chamber flash': 1, 'CLR': 1, 'PPCC': 1, 'Axenfeld-Rieger syndrome type 1': 5, 'CLEAVAGE DIOXYGENASES 8': 1, 'anterior chamber angle of the': 1, 'anterior chamber angle of the eye': 1, 'anterior chamber (': 1, 'AC)': 5, 'TOP1CCs': 1, 'Axenfeld Reiger anomaly': 1, 'chamber hypoplasia': 6, 'AC cell': 3, 'Anterior chamber angle': 2, 'anterior chamber cleavage syndrome': 12, 'somatic developmental anomalies': 1, 'ARS Chandler Syndrome': 1, 'Axenfeld-Reiger anomaly - A': 1, 'Axenfeld-Reiger anomaly': 8, 'Anterior chamber dislocation': 2, 'Anterior chamber dislocation of Ozurdex': 1, 'chamber dislocation': 1, 'anterior chamber and iris abnormalities': 1, 'developmental abnormalities of the anterior chamber angle': 2, 'chamber reduction': 1, 'facial or somatic anomalies': 1, 'ACA structural abnormalities': 2, 'anterior eye chamber defects': 6, 'defects in the anterior eye chamber': 1, 'Somatic anomalies': 6, 'ac': 1, 'ACAID) 7': 1, 'ACAID 15 16': 1, 'IIA TOPcc': 1, 'AECM': 1, 'malformed anterior chamber': 1, 'anterior chamber intraocular lenses dislocation': 1, 'anterior chamber hyphemia': 1, 'infection of the anterior chamber': 3, 'Anterior Chamber Associated Immune Deviation': 5, 'Axenfeld nerve loop': 2, 'Anterior chamber angle invasion': 1, 'anterior chamber fibrin': 6, 'anterior chamber (AC) or': 1, 'anterior chamber shallowness': 4, 'anterior chamber loss': 6, 'anterior chamber iris granuloma': 1, '-chamber recession': 1, 'Anterior-chamber damage': 1, 'Rieger anomaly 5': 1, 'Anterior Chamber Cell': 1, 'Anterior chamber fibrinoid syndrome': 1, 'anterior chamber fibrinoid syndrome': 2, 'chamber deepening': 2, 'of anterior chamber angle': 1, 'CAROTENOID CLEAVAGE DIOXYGENASE': 2, 'malformations of the anterior chamber of the eye': 4, 'anterior chamber or': 2, 'congenital abnormalities of the anterior chamber': 3, 'anterior chamber oil': 2, 'rupture of the anterior chamber': 1, 'AC angle': 3, 'Crowded anterior chamber': 1, 'CE': 1, 'anterior chamber collapsed': 1, 'anterior chamber (AC) collapse': 1, 'anterior chamber cell or flare': 3, 'Shallow anterior chamber': 5, 'cleavage lesion': 2, 'AC Flare': 1, 'postoperative anterior chamber cell': 1, 'anterior chamber bleed': 3, 'Anterior chamber cleavage disorder': 1, 'malformations of the anterior chamber angle': 3, 'anterior chamber and angle anomalies': 1, 'Congenital Axenfeld-Rieger anomaly': 1, 'congenital Axenfeld-Rieger anomaly': 1, 'Familial Axenfeld-Rieger anomaly': 2, 'anterior chambers flattening': 1, 'ANTERIOR CHAMBER FLARE': 1, 'syndrome of Rieger': 1, 'of Axenfeld': 1, "Axenfeld Rieger's Syndrome": 1, 'QC fractures': 1, 'cysts of the anterior chamber': 2, 'anterior chamber leakage': 8, 'anterior chamber involvement': 11, 'C/P': 3, 'HACD': 2, 'anterior chamber cleavage disorder': 3, 'chamber,': 2, 'anomalies in the anterior chamber of the': 1, 'Rieger anomalies': 2, 'anomaly of the anterior chamber angle': 2, 'Anterior chamber SO': 1, 'CMC': 1, 'CCDM': 1, 'ACR anterior chamber reaction': 1, 'Atrial Chamber': 3, 'anterior chamber and skeletal anomalies': 1, 'CPFs': 1, 'infections of the anterior chamber': 1, 'Foetal cleft anomalies of the anterior chamber': 1, 'anterior chamber anomaly': 3, 'anterior chamber cloudiness': 2, 'OBLITERATION OF THE ANTERIOR CHAMBER': 1, 'bleeding of the anterior eye chamber': 1, 'Hydronephrosis - Axenfeld anomaly - 2': 1, 'anterior chamber effusion': 2, 'SSA': 1, 'CH': 3, 'anterior chamber granuloma': 7, 'anterior chamber granulomas': 3, 'Anterior chamber and': 1, 'BC': 4, 'chambers remodelling': 1, 'anterior chamber fibrous exudation': 1, 'CLEAVAGE STIMULATION': 1, 'anterior chamber agenesia-microphakia syndrome': 1, 'corneal staphyloma- anterior chamber agenesia- microphakia syndrome': 1, 'HYP': 1, 'cleavage anomaly': 1, 'SPECIFIC CLEAVAGE': 1, 'Anterior chamber angle dysplasia': 1, 'anterior chamber (AC) tumours': 1, 'FC': 3, 'TREC': 2, 'CHAMBER CREATION': 1, 'Posterior chamber disease': 1, 'Anterior chamber disease': 2, 'posterior chamber disease': 3, 'anterior and posterior chamber abnormalities': 1, 'hemorrhages of the anterior chamber': 1, 'Anterior chamber abnormalities': 2, 'Axenfeld-Rieger ocular dysgenesis': 1, 'Axenfeld-Rieger phenotype': 1, 'Axenfeld-Rieger Syndrome disease': 1, 'collapse of anterior chamber': 3, 'Congenital somatic anomalies': 1, 'TECs': 2, 'anterior chamber alterations': 1, 'chamber or ciliary': 1, 'CHAMBERS': 3, "Axenfeld-Rieger's anomaly": 6, 'prolonged anterior chamber reaction': 1, 'anterior chamber angle stenosis': 3, 'ARS, type 3': 1, 'Axenfeld-Rieger syndrome (ARS), type 1': 1, 'CLEAVAGE-DEPENDENT': 1, 'Anterior chamber shallowing': 7, 'anterior chamber angle damages': 1, 'Rieger Anomaly': 5, 'anterior chamber inflammatory exudation': 1, 'anterior chamber volume': 1, 'Aging Chamber': 1, 'anterior chamber angle injury': 3, 'abnormalities in cardiac chamber': 2, 'anterior chamber inflammationClinical': 1, 'postoperative loss of the anterior chamber': 1, 'type 1 ARS': 1, 'AR': 6, 'anterior chamber gas tamponade': 2, 'hemorrhages in the anterior chamber': 1, 'ARS with': 1, 'Developmental abnormalities of the anterior chamber': 1, 'BCRs': 1, 'anterior chamber (AC) cell': 2, 'chamber anomalies': 1, 'anterior chambre cleavage malformations': 1, 'chamber remodeling': 13, 'right chambers': 1, 'HISTONE CLEAVAGE': 1, 'alterations of the anterior chamber': 1, 'anterior chamber angle damage': 3, 'AC nodule': 1, 'AC nodules': 1, 'AC granulomas': 3, 'AC granuloma': 4, 'pACD': 1, 'Anterior chamber cleavagesyndrome': 1, 'anterior chamber hemorrhaging': 3, 'Anterior Chamber Angle': 2, 'ISOFORM CLEAVAGE': 1, 'chamber angle abnormalities': 1, 'NTC': 2, 'abnormality of the anterior chamber': 2, 'anterior chamber disorder': 1, 'anterior chamber synechiae': 2, 'vitreous hernia into anterior chamber': 1, 'Anterior chamber of eye abnormalities': 2, 'Traumatic cysts of the anterior chamber': 1, 'TC': 4, 'Irrigation of Anterior Chamber': 1, 'glaucomatous AC enlargement': 1, 'AC enlargement': 1, 'anterior chamber (AC) exudates': 1, 'blockage of the anterior chamber': 1, 'Riegers': 1, 'glaucomatous chamber angle': 1, 'anterior chamber changes': 1, 'axenfeld': 1, 'Axenfeld': 3, 'AC associated immune deviation': 1, 'CLEAVAGE WITH': 2, 'abnormalities of the anterior chamber angle': 2, 'Axenfeld-Rieger Anomaly': 9, 'RGS': 1, 'Anterior Chamber Hemorrhage': 2, 'Anterior Chamber Injury': 1, 'traumatic anterior chamber hemorrhage': 1, 'Anterior Chamber Injury to the': 1, 'anterior chamber injury': 1, 'CCRM': 1, '12 Rieger syndrome': 1, 'CAF': 1, 'ACAID.ACAID': 1, 'obstruction of heart chambers': 2, 'Axenfeld-Rieger (A-R) syndrome': 4, 'A-R syndrome': 4, 'Anterior chamber malformation': 1, 'Rieger disease': 1, 'NEC': 3, 'CA-II': 1, 'DC': 2, 'Anterior chamber instability': 2, 'anterior chamber angles': 3, 'Axenfeld-Rieger anomaly Defects in iris and pupil': 1, 'DNA cleavage deficiency': 1, 'Cleavage disorder': 1, 'Dinaledi Chamber': 1, 'anterior chamber tube extrusion': 1, 'posterior chamber ocular abnormalities': 1, 'Posterior Chamber Abnormalities': 1, 'posterior chamber abnormalities': 3, 'anterior chamber glare': 1, ', corneal, anterior chamber, iris or lenticular abnormalities': 1, 'congenital cleavage of pons': 1, 'anterior chamber glaucoma': 2, 'AR anomaly': 2, 'Axenfeld-Rieger ocular anomaly': 2, 'anterior chamber with vision blue': 1, 'Developmental abnormalities in the anterior chamber': 1, 'ARS (type 3)': 2, 'Axenfeld-Rieger anomaly/syndrome': 3, 'Axenfeld-Rieger Syndrome Spectrum': 1, 'ARS types 1 or 3': 1, 'Axenfeld-Rieger (AR) malformations of the anterior chamber': 1, 'Axenfeld abnormality': 2, "Rieger's abnormality": 2, 'ophthalmic granulomas of the anterior chamber': 1, 'anterior eye chamber': 2, 'CHAMBER PREPARATION': 1, 'Anterior chamber defect': 2, 'anterior chamber Corneal endothelium malformation': 1, 'mass of the anterior chamber': 1, 'anterior chamber pathology': 2, "Rieger's disease": 5, 'CCMB': 1, 'CLEAVAGE OF HEVIN BY': 1, 'malformations of the anterior chamber': 4, 'malformation of anterior chamber structures': 1, 'anterior chamber or fundus abnormalities': 1, 'Anterior chamber-induced immune deviation': 1, 'cardiac chamber alterations': 2, 'AC melanoma': 1, 'increase of anterior chamber': 1, 'anomalies of anterior eye chamber': 1, 'CC': 6, 'CLEAVAGE ASSAY': 1, 'ARM': 3, 'Premature CPA': 1, 'and chamber': 1, 'anterior chamber lens rotation': 1, 'chamber deformation': 1, 'anterior-chamber synovitis': 1, 'embryonic cleavage abnormalities': 2, 'CLEAVAGE DIVISION IN THE AXOLOTL': 1, 'posterior chamber': 6, 'anterior chamber cleavage disorders': 1, 'AC toxicities': 1, 'SUBSTRATE CLEAVAGE': 1, 'anterior chamber deformation': 1, 'RECID': 1, 'herpetic infection of the anterior chamber': 1, 'anterior chamber (AC) perforations': 1, 'Infection of the anterior chamber': 1, 'CLEAVAGE BY': 6, 'anterior chamber dysfunction': 1, 'Axenfeld-Rieger disease': 2, 'CLEAVAGE PRODUCT': 1, "Rieger's": 4, 'anterior chamber pseudophakic eye': 1, 'absent anterior chamber': 4, 'anterior chamber angle dysplasia': 3, 'abnormalities of the cardiac chambers': 3, 'anterior chamber absence': 1, 'pigment cyst of the anterior chamber': 1, 'Anterior Chamber-Associated Immune Deviation': 5, 'somatic tissue anomalies': 1, 'developmental anomaly of the anterior chamber angle': 3, 'Anterior chamber oil': 1, 'anterior chamber decompensation': 1, 'Axenfeld Rieger Anomaly': 2, 'cardiac chamber abnormality': 1, 'ITS TRANSLATIONAL CLEAVAGE': 1, 'Anterior chamber cell': 3, 'Anterior chamber invasion': 2, 'anterior and posterior chamber': 3, 'corneal or AC FB': 1, 'AC FB': 1, '4CV abnormalities': 1, 'NDV impairmentAxenfield-Rieger syndrome': 1, 'developmental abnormality of the anterior chamber of the eye': 2, 'Anterior chamber complications': 2, 'Axenfeld-Rieger and Stickler syndromes': 1, 'Axenfeld Anomaly': 3, 'Axenfeld-Rieger and Stickler Syndrome': 1, 'ACD enlargement': 1, 'Axenfeld-Rieger-szindroma': 1, 'anterior chamber obstruction': 2, 'Rieger anomaly27, 28': 1, 'CACD': 10, 'anterior chamber angle adhesion': 1, 'AC bleeds': 1, 'Axenfeld-Rieger syndrome with': 1, 'Rieger anomaly of the iris': 1, 'Cleavage and Ductile Fractures': 1, 'malformed chambers': 1, 'LIGAND CLEAVAGE BY': 1, 'hypoplasia of the chambers of the': 1, 'ocular anterior chamber associated immune deviation': 1, 'CIN': 1, 'ophthalmomyiasis of the anterior chamber': 1, 'cACD': 1, 'anterior chamber anomalies of the eye': 1, 'anterior chamber and iris anomalies': 1, 'anterior chamber 20': 1, 'DISCOVERY OF SCAP': 1, 'SCAP MOVES': 1, 'DOMAINS OF SCAP': 1, 'CPA abnormalities': 1, 'axial shallowing of the anterior chamber': 1, 'collapsed anterior chamber': 2, "Axenfeld's or Rieger's anomaly": 1, "Axenfeld's and Rieger's anomalies": 2, 'maldevelopment of the anterior chamber': 1, 'chamber malformation': 3, 'defects of the anterior chamber of the': 2, 'OCVs': 1, 'OCV': 1, 'Rieger anomaly with Axenfeld syndrome': 1, 'Anterior Chamber Tamponade': 1, 'Anterior chamber angiostrogyliasis': 1, 'TPC': 1, 'CAPS': 3, 'anterior chamber inflammatory mass': 1, 'EC-1': 1, 'EC-2': 1, 'non-EC': 1, 'axial shallow anterior chamber': 1, 'Posterior chamber implants': 1, 'CHAMBER SUPPLIES': 1, 'posterior chamber lesion': 1, 'aIOP': 1, 'chamber lenses': 2, 'Axenfeld-Rieger Syndrome Type III': 1, 'enlargement of the anterior chamber': 1, 'disappear of anterior chamber': 1, 'anterior chamber (AC) abnormality': 1, 'AC abnormality': 1, 'VC': 4, 'abnormalities of anterior chamber': 1, 'CLEAVAGE DIOXYGENASE': 1, 'inflammatory diseases of the anterior chamber of the': 1, 'corneal, anterior chamber, iris, and lens disorders': 1, 'congenital corneal and anterior chamber dysmorphia': 1, 'extremely shallow anterior chamber': 1, 'Axenfeld-Rieger syndrome, type 3': 3, 'disease of the anterior eye chamber': 1, 'of the cornea, anterior chamber, iris': 1, 'Anterior chamber (AC) inflammation': 1, 'Hemorrhage of the anterior chamber': 1, 'Anterior cleavage syndrome': 3, 'atrial chamber defects': 1, 'Anterior chamber angle recession': 2, 'CLEAVAGE OF SULFATES': 1, 'dislocation to the anterior chamber': 2, 'Anterior chamber exudate': 1, 'anterior chamber deformities': 2, 'anterior chamber melanoma': 1, 'Anterior chamber cleavage syndrome': 4, 'retardation of cleavage': 1, 'Infections of the anterior chamber': 1, 'UC': 3, 'Axenfeld-Reiger Spectrum malformations': 1, 'Developmental abnormalities of the anterior chamber angle': 1, 'neovascularization of the anterior chamber angle': 1, 'loss of ACAID': 1, 'vitreous loss into the anterior chamber': 1, 'Axenfeld anomalies': 2, 'EDNRB Rieger': 1, 'Anterior chamber angle anomalies': 2, 'tumors of the anterior chamber': 1, 'anterior chamber angle and glaucoma': 1, 'CHAMBER ANGLE': 1, 'developmental anomalies of the anterior chamber of the eye': 1, 'anterior chamber eye anomaly': 1, 'Xenfeld-Rieger syndrome': 1, 'Rieger and ARS anomaly': 1, 'anterior chamber lesion of the eye': 1, 'PROTOCATECHUATE-ORTHO-CLEAVAGE': 1, "Axenfeld's anomaly OU": 1, 'anterior-chamber eye anomalies': 1, 'dislocation of anterior chamber phakic': 1, 'SCAPs': 1, 'anterior chamber cholesterol': 1, 'anterior chamber opacification': 1, 'anterior chamber cholesterolosis bulbi': 1, 'anterior chamber cholesterolsis': 1, 'Anterior Chamber Cholesterolosis': 1, 'defect in the anterior chamber of the eye': 1, 'Chamber Angle': 2, 'anterior chamber displacement': 3, 'Anterior chamber migration': 1, 'ACAF': 1, 'anterior chamber aqueous flare': 1, 'Anterior chamber aqueous flare': 1, 'Anterior chamber associated immune deviation': 11, 'Cleavage and polyadenylation': 1, 'InDA-C': 1, 'ACD asymmetry': 1, 'SA': 1, 'elevated anterior chamber': 1, 'CLEAVAGE DIVISON': 1, 'chamber disorders': 1, 'Obstruction of a heart chamber': 1, 'Anterior chamber (AC) flare': 1, 'developmental defects of the anterior chamber of the eye': 1, 'Developmental defects of the anterior chamber': 1, 'dysplasia of the anterior chamber angle': 3, 'shallowing of the AC': 1, 'anterior chamber eye relapse': 1, 'CL': 4, 'anterior chamber cleavage anomalies': 4, 'anterior eye-chamber abnormalities': 3, 'dislocation to the anterior chamber of': 1, 'anterior ocular chamber anomalies': 2, 'TNP-ACAID': 1, 'lenticular dislocation into the anterior chamber': 1, 'chamber angle, and': 1, 'abnormalities of the cornea, anterior chamber angle, and': 1, 'A/C': 4, 'anterior and posterior chamber hemorrhages': 1, 'anterior chamber alterations': 2, 'Shallow anterior chamber 2': 1, 'flat anterior chamber with': 1, 'CLEAVAGE OF 19 S ISOAGGLUTININS': 1, 'defect of the anterior chamber of the': 1, 'FCD': 2, 'anterior chamber and tumor hemorrhages': 1, 'anterior chamber or corneal abnormalities': 1, 'dysplasia of the cornea and anterior chamber': 2, 'ACE': 8, 'Anterior Chamber Flare': 1, 'ACD III': 2, 'ACD I': 1, 'long ACD': 1, 'ACD:0.3243': 1, 'Axenfeld-Rieger mesodermal dysgenesis': 1, 'akinetic apical chamber': 1, 'carotenoid cleavage': 2, 'Rieger syndrome type I.': 1, 'THEIR HYDROLYTICALLY-FORMED CLEAVAGE PRODUCTS': 1, 'SUCTION CHAMBER': 1, 'NAL': 1, 'PCP': 2, "Axenfeld's abnormality": 1, 'Axenfeld-rieger syndrome': 1, 'Axenfeld-Rienger syndrome': 1, 'Anxenfeld-Rieger syndrome': 1, 'Axenfeldt Rieger syndrome': 1, '-CLEAVAGE SITE': 1, 'gamma-CLEAVAGE': 1, 'epsilon-CLEAVAGE SITE': 1, 'USE OF CLEAVAGE PRODUCTS': 1, 'ACM': 5, 'anterior chamber (AC) inflammatory reaction': 1, 'anterior chamber neovascularization': 3, 'and anterior chamber angle neovascularization': 1, 'iris and anterior chamber angle neovascularization': 2, 'Anterior-cleavage-syndrome': 1, 'tuberculosis of the anterior chamber': 1, 'anterior chamber inf lammation': 1, 'ANTERIOR CHAMBER LENS': 1, "'s chambers": 1, 'CHAMBERED SOCIAL PREFERENCE': 1, 'Anterior chamber (AC) inflammatory': 1, 'Posterior chamber': 2, 'CLEAVAGE OF ACTIVATED VCPs': 1, 'BOND CLEAVAGE OF NON-ACTIVATED VCPs': 1, 'Anterior Chamber Intraocular Lenses': 1, 'Axenfeld-Rieger syndromeOther': 1, 'anterior chamber nodule': 1, 'inflammatory disorders of anterior chamber of the eye': 1, 'CPMC': 1, 'corneal and anterior chamber diseases': 1, 'chamber-defect': 1, "Rieger's Anomaly": 2, 'anterior chamber angle melanocytoma': 1, 'anterior-chamber migration': 1, 'prolapse of the anterior chamber': 3, 'axial anterior chamber': 1, 'infiltration of the anterior chamber': 1, 'Axenfeld-Rieger syndrome 1': 1, 'Axenfeld-Rieger syndrome 3': 1, 'Vitreous in anterior chamber': 2, 'anterior chamber and visual axis opacifications': 1, 'Flat Anterior Chamber': 1, 'anterior chamber structure abnormalities': 1, 'bleeding into the anterior chamber': 3, 'atrioventricular chambers': 1, 'Axenfeld or Rieger eye malformation': 1, 'CAC': 2, 'loss of anterior chamber': 3, 'developmental impairment of the anterior chamber angle': 1, 'anterior chamber inflamation': 1, 'Axenfeld-Rieger (ARS) malformation': 1, 'anomalies of the anterior chamber': 1, 'anterior chamber cleavage syndromes': 1, 'anomalies of the ocular anterior chamber': 1, 'axenfeld-rieger-syndrome': 1, 'CHAMBER-ANGLE SURGERY': 1, 'Open angle of anterior chamber': 1, 'dysmorphic chamber': 2, 'Open anterior chamber angle': 1, 'myocardial chamber dysfunction': 1, 'corneal and anterior chamber abnormalities': 1, 'anterior chamber angle blockage': 4, 'anterior chamber mass lesions': 1, 'congenital and developmental anomalies of the anterior chamber': 1, 'developmental anomalies of the anterior chamber': 1, 'malformations of the lens and anterior chamber': 1, 'ACDs': 1, 'ACD II': 1, 'anterior chamber mass': 5, 'deep anterior chamber': 1, 'anterior chamber lesion': 2, 'atrial chamber malformations': 1, 'Anterior chamber IOFB': 1, 'ACFB': 1, 'anterior chamber IOFB': 1, 'COL17 CLEAVAGE': 1, 'Axenfeld- Rieger anomaly': 2, 'DNA cleavage': 1, 'anterior chamber (AC) granuloma': 5, 'hyperdeep anterior chambers': 1, 'CLEAVAGE STEP OF': 1, 'CF IA': 1, 'tumour in the anterior chamber': 1, 'MORAX-AXENFELD DIPLOBACILLUS': 1, 'fertilization and cleavage abnormalities': 1, 'anterior chamber angle deformities': 1, 'chamber angle deformation': 1, 'Axenfeld-Rieger (anomaly and syndrome': 1, 'somatic and cerebral anomalies': 1, 'anterior chamber hemorrhage;3': 1, 'OCP': 1, 'Anterior Chamber bleeding': 1, 'pigment cysts of the anterior chamber': 1, 'anterior chamber inflammatory membranes': 1, 'Anterior chamber inflammatory membranes': 1, 'Anterior chamber iridocorneal angle recession': 1, 'chamber changes': 1, 'ARA/Rieger syndrome': 1, 'anterior chamber angle recession': 8, 'iris and anterior chamber nodules': 1, 'and anterior chamber spherules': 1, 'anterior chamber amyloidosis': 1, 'multiple iris and anterior chamber cysts': 1, 'DAC': 1, 'anterior chamber angle mass': 2, 'granuloma of anterior chamber angle': 1, 'Anterior chamber angle granuloma': 1, '-Rieger': 3, 'anterior chamber intraocular lens': 1, 'anterior chamber ocular disease': 1, 'CELL CLEAVAGE': 1, 'PHOTOACTIVATED CLEAVAGE OF': 1, 'ONCL': 1, 'dislocation into the anterior chamber': 1, 'anterior angle chamber glaucoma': 1, 'AC infection': 1, 'anterior chamber (AC) infection': 2, 'Anterior chamber lesion of the right eye': 1, 'Axenfeld-Rieger malformations of the anterior segment of the eye': 1, 'anterior chamber perforations': 1, 'blockage of the anterior chamber angle': 1, 'anterior or posterior chamber ocular anomalies': 1, 'hypoplastic chamber syndromes': 1, 'AC bleed': 1, 'CLEAVAGE DIOXYGENASE8': 1, 'ARS types 1, 2, and 3': 1, 'anterior chamber and iris defects': 1, 'Axenfled-Rieger anomaly': 1, 'anterior chamber angle trauma': 1, 'Rieger anomaly of the anterior chamber of the eyes': 1, 'anterior chamber cleavage anomaly': 1, 'enlarged ACD': 1, 'abnormalities of the anterior chamber with glaucoma': 1, 'right chambers remodelling': 1, 'axenfeld-rieger': 1, 'eye anterior chamber-associated immune deviation': 2, 'Fractured Anterior Chamber Intraocular Lens': 1, 'golden chamber': 2, ', chamber': 1, 'chamber cholesterolosis': 1, 'Axenfeld-Rieger syndrome/ anomaly': 1, 'Anterior chamber shallowing or collapse': 1, 'Anterior chamber collapse': 3, 'TRYPSIN CLEAVAGE': 1, 'CYANOGEN BROMIDE CLEAVAGE OF PROTEIN': 1, 'Leja chambers': 1, 'Anterior chamber asymmetry': 1, 'asymmetry of anterior chamber': 1, 'anterior chamber paracentesis': 2, 'double anterior chamber formation': 4, 'AC loss': 1, 'AC leak': 2, 'dysplasia of the anterior chamber': 1, 'congenital malformation of the anterior chamber angle': 2, 'anterior chamber (AC) inflammatory': 1, 'prosencephalic cleavage disorder': 1, 'multi-chamber dysfunction': 1, 'Anterior-chamber-associated immune deviation': 1, '-chamber': 3, 'bleeding to the anterior chamber of the eye': 1, 'posterior chamber lesions': 1, 'anterior and posterior chamber eye malformations': 1, 'anterior chamber parasitic cysts': 1, 'hypoplastic chambers': 5, 'developmental anomaly of the angle of anterior chamber': 1, 'ICA': 1, 'anterior chamber coagulum': 1, 'anterior chamber surge': 1, 'congenital cleavage of the face and palate': 1, 'genetic or somatic anomalies': 1, 'chamber of the eye': 1, 'diseases of anterior chamber of the eye': 1, 'Carpel chambers maythus': 1, 'somatic and visceral congenital anomalies': 1, 'Axenfeld-Rieger malformations of the anterior segment': 2, 'Anterior chamber (AC)-associated immune deviation': 1, 'Anterior chamber neovascular membrane': 1, 'Ocular (Axenfeld-Rieger anomaly) abnormalities': 1, 'atrial chamber abnormalities': 1, 'somatic overgrowth anomalies': 1, 'SFC': 1, 'anterior chamber flare reaction': 1, 'anterior chamber precipitation': 2, 'anterior chamber opacities': 2, 'anterior chamber exudative syndrome': 1, 'LACD': 3, 'anomalous vascular chambers': 1, 'ACFM': 1, 'CLEAVAGE OF PECTIN': 1, 'anterior eye chamber deepening': 1, 'anterior-chamber flare': 2, 'chamber shallowing': 2, 'Axenfelds anomaly': 1, 'Congenital abnormalities in anterior chamber development': 1, 'Axenfeld- Rieger- Syndroms': 1, 'anterior chamber disappearance': 1, 'anterior chamber tumors': 2, 'PACD': 3, 'anterior chamber traumatic': 1, 'anterior-chamber hemorrhage': 2, "Peters/Rieger's syndrome": 1, 'Rieger-Axenfeld syndrome': 1, 'anterior chamber thinning': 1, 'Anterior chamber cleavage syndromes': 1, 'anterior chamber abscess': 4, 'ACC and flare': 1, 'small leg fascia chamber syndrome': 1, 'Axenfeld or Rieger anomaly': 1, 'ARS type I and type III': 1, 'type I and type III ARS': 1, 'Type II ARS': 1, 'anterior chamber BGI': 1, 'Axenfeld-anomaly': 1, 'Flare in anterior chamber': 1, 'Alkaline burns of the anterior chamber': 1, 'AR syndrome': 2, 'CLEAVAGE ENZYME': 2, 'disease of the anterior chamber': 1, 'anterior chamber infiltrates': 1, 'anterior-chamber-angle disease': 1, 'ACTINOMYCIN INDUCED CLEAVAGE DELAY': 1, 'somatic and CNS anomalies': 1, 'palate cleavage': 1, 'Axenfeld/Rieger syndrome': 1, 'double anterior chamber and visual acuity': 1, 'AC cells': 1, 'AGPC': 1, 'HYDROLYTIC CLEAVAGE OF THIODIONE': 1, 'anterior chamber developmental abnormalities': 1, 'anterior chamber or posterior pole malformations': 1, 'congenital anterior chamber vascular malformations': 1, 'anterior chamber prolapse': 3, 'defects in the anterior chamber of': 1, 'chamber inflammationf': 1, 'chamber cellc': 1, 'anterior chamber angle reduction': 1, 'Chamber angle anomalies': 2, 'anterior chamber implantation cyst': 1, 'Axenfeld-Rieger type anomaly': 1, 'abnormalities of cardiac chambers': 2, "Peters', Rieger, and Axenfeld anomalies": 1, 'anterior chamber fistula': 1, 'formation of anterior chamber': 1, 'CHAMBERS OF VARIOUS MODIFICATIONS': 1, 'type 1 Axenfeld-Rieger syndrome': 1, 'anterior chamber and vitreous bleeding': 1, 'Anomalies of iris and anterior-chamber angle': 1, 'developmental anomaly of the anterior chamber': 1, 'ACC-I': 1, 'ACC-II': 1, 'Pneumatic chamber': 1, 'anterior chamber (AC) angle': 1, 'anterior chamber hematocele': 1, 'chamber angle obstruction': 1, 'MICROFLUIDIC CHAMBER': 1, 'BIANCHA': 1, 'Bistatic ANechoic CHAmber': 1, 'cloudy anterior chamber': 1, 'anterior chamber implants': 1, 'Anterior chamber paracentesis': 1, 'cleavage fracture of the': 1, 'reverse chamber remodelling': 1, 'Reverse chamber remodelling': 1, 'CLEAVAGE OF FUNCTIONALIZED SCAFFOLD': 1, 'anterior chamber cytomegalovirus': 1, 'chamber deficiency': 1, 'anterior chamber cell flare': 1, 'enlarged anterior chamber': 1, 'anterior chamber enlargement': 4, 'Anterior chamber gas entrapment': 1, 'Axenfeld-Rieger eye anomaly': 1, 'axenfeld syndrome': 2, 'Anterior chamber defects': 2, 'ARS type 3': 4, 'chamber obstruction': 5, 'chamber canals': 1, 'chamber angle dysplasia': 1, 'anterior chamber angle (ACA) obstruction': 1, 'corneal and anterior chamber disorders': 1, 'anterior chamber turbidity': 1, 'CPAC': 2, 'Narrow anterior chamber': 1, 'chamber^': 1, 'anterior chamber narrowing': 7, 'anterior chamber ischemia': 2, 'Anterior chamber Hypopyon': 1, 'chamber Hypopyon': 1, 'anterior chamber-cleavage disorder': 1, 'Axenfeld-Rieger syndrome (ARS) type 3': 1, '4C': 1, 'CLEAVAGE OF S-': 1, 'TCF': 1, 'anterior chamber pressure loss': 1, 'CAROTENOIDS CLEAVAGE ENZYMES': 1, 'abnormalities in cardiac chambers': 1, 'anterior and posterior chamber toxicities': 1, 'malformation of the chambers': 1, 'CHAMBER STUDIES': 1, 'AC leaks': 1, 'anterior chamber pathologies': 1, 'Fibrosis of the anterior chamber': 1, 'LMP-ACD': 1, 'Axenfeld-Rieger anomaly and Hurler syndrome': 1, 'Anterior chamber hypertension': 1, 'anterior-chamber cysts': 1, 'anterior chamber reaction or flare': 1, 'cleavage fracture of the lower': 1, 'AXENFELD': 2, 'OC': 1, 'CLEAVAGE SITE ANALYSIS OF TRANSCRIPTOMES': 1, 'malformation of the AC angle': 1, 'Cleavage fractures': 1, 'anterior chamber cytosis': 1, 'PACTS': 1, 'developmental abnormalities of the anterior chamber': 1, 'PAPAIN CLEAVAGE': 1, 'anterior chamber air tamponade': 1, 'anterior chamber (AC)': 4, 'Fibrinoid anterior chamber': 1, 'Axenfeld-Rieger Syndrome type I': 3, 'prosencephalon cleavage': 1, 'anterior chamber edema': 1, 'PAC': 3, 'HIACD': 1, 'Anterior chamber tumor': 2, 'anterior chamber and lens defects': 1, 'anterior chamber of the eye malformations': 1, 'SLEC': 1, 'ACAID)a': 1, 'PBC': 1, 'Axenfield Rieger anomaly': 1, 'Cysts of the anterior chamber': 1, '(AC)': 2, 'anterior rudimentary chamber': 1, 'anterior chamber and vitreous infections': 1, 'corneal or anterior chamber abnormalities': 3, 'anterior-chamber associated immune deviation': 1, 'Axenfeld-Rieger and': 1, 'Axenfeld-Rieger syndrome Type I': 1, 'anterior chamber-associated immune deviation-': 1, 'midline cleavage': 1, 'anterior chamber of the eye': 1, 'anterior chamber angle opening': 1, 'chamber oil': 2, 'Axenfeld Rieger anomalies': 1, 'CLEAVAGE PRODUCTS': 2, 'anterior-chamber eye defects': 3, 'Axenfeld Reiger (AR) syndrome': 1, 'Ductile-cleavage fracture': 1, 'FREE IRINIC FORMATION IN THE ANTERIOR CHAMBER': 1, 'ocular anterior chamber abnormalities': 1, 'Axenfeld and/or Rieger anomaly': 1, 'Axenfeld-Rieger ocular': 1, 'Axenfeld / Rieger anomaly': 1, 'dysmorphic chambers': 3, 'corneal, anterior chamber angle, and iridociliary diseases': 1, 'CM': 1, 'Axenfeld-Rieger eye malformations': 1, 'chamber Hypopyon': 1, 'Anterior chamber Vitreous opacification': 1, 'ACAs': 1, 'chamber angles': 1, 'Axenfeld-Rieger and Peters anomalies': 1, 'anterior chamber and': 3, 'defects in the posterior chamber': 1, 'anterior chamber associated-immune deviation': 1, '-angle and anterior-chamber alterations': 1, 'congenital anterior chamber abnormalities': 2, 'anterior chamber metastasis': 3, 'LRC': 1, 'Anterior chamber exudation': 2, 'grade III FAC': 1, 'cleavage disorders of': 1, 'diseases of the anterior chamber angle,': 1, 'anterior chamber and anterior chamber haemorrhage': 1, 'floating cyst in anterior chamber': 1, 'structural abnormalities of the anterior chamber': 1, 'anterior chamber,': 1, 'anterior eye-chamber defects': 1, 'anterior chamber iris cyst': 1, 'atrial chamber disease': 1, 'anterior chamber neovascular membranes': 1, 'anterior chamber eye diseases': 1, 'venous chamber': 1, 'ventricle chamber': 1, 'Axenfield-Rieger syndromes': 1, 'deepening of anterior chamber': 1, 'shallow anterior chamber of the eye': 1, 'ARS glaucoma': 1, 'silicotic granuloma of the anterior chamber of': 1, "Unilateral Rieger's anomaly": 1, "unilateral Rieger's anomaly": 1, 'trigeminofacialis chamber': 1, 'chamber stiffness': 2, 'Shallow chamber': 2, 'Axenfeld Riegers anomaly': 1, 'Atrial chambers': 1, 'Axenfeld-Rieger anomaly 99': 1, 'Sturge-Weber or Axenfeld-Rieger syndrome': 1, 'anterior chamber nodules': 1, 'anterior chamber': 1, 'anterior chamber or iris/posterior capsule trauma': 1, 'LICs': 1, 'anterior chamber (A/C) opacity': 1, 'A/C opacity': 1, 'A/C mass': 1, 'anterior chamber 1': 1, 'Riegers Anomaly': 1, 'RCC': 1, 'MPC': 1, 'subluxation into the anterior chamber': 1, 'shallow anterior chambers': 2, 'developmental anomalies of the anterior chamber angle': 1, 'Axenfeld Rieger malformations': 1, 'LRSCs': 1, 'anterior chamber hematoma': 1, 'Axenfeld-Reiger-, Larsen-, and Ritscher-Sinzel/3-C syndromes': 1, 'anterior chamber problems': 1, 'chamber IOL': 1, 'rieger anomaly': 2, 'Congenital anomalies of anterior chamber': 1, 'ARS dental anomalies': 1, 'Anterior chamber perforation': 1, 'disease of the anterior chamber angle': 1, 'CS': 1, 'anterior chamber and iris stroma abnormalities': 1, 'anterior-chamber hypoxia': 1, 'Anterior-chamber hypoxia': 1, 'CLEAVAGE PROTOCOL': 1, 'anterior chamber cells': 2, 'Anterior chamber hyphaema': 1, 'Obliteration of anterior chamber': 1, 'cyst in the anterior chamber': 1, 'anterior chamber, iris and lens abnormalities': 1, 'ocular chamber': 1, 'Double Anterior Chamber Formation': 1, 'anterior chamber dilatation': 1, 'deficient anterior chamber associated immune deviation': 1, 'AC inflamation': 1, "Rieger's syndrome (type 3": 1, 'Golden Chamber': 1, 'CTF': 1, 'anterior chamber segment syndrome': 1, 'CA-X': 1, 'PITX2 Rieger syndrome,': 1, 'chamber inflammationVitreous cavity inflammationVasculitis': 1, 'deformity of the anterior eye chamber': 1, 'pigmentation of the AC angle': 1, 'chamber angle adhesion': 1, 'chamber involvement': 1, 'ACL': 2, 'hypopyon of anterior chamber of': 1, 'chamber contamination': 1, 'Axenfeld Reiger syndrome': 2, 'Anterior chamber angle pigmentation': 1, 'abnormal cardiac chambers': 1, 'Anterior chamber iris cysts': 1, 'Axenfeld syndrome syndrome': 1, 'congenital defect of the anterior eye chamber': 1, 'anterior chamber (AC) instability': 1, 'AC instability': 1, 'CLEAVAGE OF alpha1C': 1, 'JUVENILE GLAUCOMA WITH AXENFELD': 1, 'anterior chamber tap': 1, 'Aenfeld-Rieger syndrome': 1, 'anterior chamber plaque': 1, 'damage to the anterior chamber': 1, 'anterior eye chamber disorders': 1, 'Axenfeld-Rieger anomaly and syndrome': 1, 'embryonic cleavage defects': 1, 'CLEAVAGE PATTERNS': 1, 'anterior chamber conditions': 1, 'Anterior chamber angle recess': 1, 'AC reaction': 2, 'anterior chamber (AC) reaction': 2, 'damage to the anterior chamber (AC) angle': 1, 'malformations of the anterior eye chamber': 1, 'chamber Acuity': 1, 'anterior chamber deformity': 1, 'CLEAVAGE INHIBITOR': 1, 'Chamber deformities': 1, 'posterior chamber (PC)': 1, 'ACH': 1, 'dysplasia of the eye anterior chamber angle': 1, 'ARS1': 1, 'CLEAVAGE OF CERTAIN HEMIPTERA': 1, 'hematocele of the AC': 1, 'SCD': 2, 'iris and anterior chamber abnormalities': 1, 'developmental anomaly of anterior chamber angle': 1, 'Anterior chamber tap': 1, 'toxic anterior chamber syndrome': 1, 'hyperdeep anterior chamber': 1, 'lack of the anterior chamber': 1, 'PCM': 1, 'anterior-chamber trauma': 1, 'CLEAVAGE OF ONE': 1, 'anterior chamber depth asymmetry': 1, "Rieger's Syndrome": 3, 'chamber damages': 1, 'DCD': 1, 'Axenfeld-Riegersyndrome': 1, "Rieger's anomaly and syndrome": 1, 'anterior chamber of eye glaucoma': 1, 'cleavage disorder': 1, 'anterior chamber dimension loss': 1, 'anterior chamber (AC) abnormalities': 1, 'LCD': 1, 'AC hypopyon': 1, "Axenfeld-Schurenberg's syndrome": 1, 'Flattened anterior chamber': 3, "Axenfeld-Rieger's Syndrome": 1, 'Axenfeld & Rieger anomalies': 1, 'CLEAVAGE-SITE IDENTIFICATION': 1, 'AR disease': 1, 'Axenfeld - Rieger': 1, 'Axenfeld-Rieger (AR) disease': 1, 'Chamber Associated': 1, 'CLEAVAGE OF TRIBUTYRIN SOLUTIONS': 1, 'shallow of anterior chamber': 1, 'ANOMALIES OF SOMATIC': 1, 'anterior chamber occlusion': 1, 'CLEAVAGE OF PROTEINS': 1, 'anterior chamber pathological changes': 1, 'anomalies of the chamber': 1, 'RIEG disorder': 1, 'autosomal dominant disorder Rieger syndrome': 1, 'Axenfeld Rieger-syndrome': 1, 'disruption of the anterior chamber associated immune deviation': 1, 'tuberculosis of the eye anterior chamber': 1, 'mCF': 1, 'anterior chamber recurrence': 1, 'PCT': 1, "Axenfeld's emissaria": 1, 'anterior chamber angle mal-development': 1, 'corneal and anterior chamber lesions': 1, 'corneal or anterior chamber deformities': 1, 'anterior-chamber flashing': 1, 'CSEC': 1, 'anterior chamber recession': 1, 'CPSF complex': 1, 'Onodi chamber': 1, 'VCs': 1, 'Chamber angle impair': 1, 'anterior chamber pseudocysts': 1, 'sternum cleavage': 1, 'anterior chamber infammation': 1, 'atrial chamber obstruction': 1, 'LIC': 1, 'anterior chamber or hypotony': 1, 'Axenfeld-Rieger anomalies of both eyes': 1, 'anterior chamber compromise': 1, 'CPSF30': 1, 'CLEAVAGE AND POLYADENYLATION SPECIFICITY FACTOR30': 1, 'anterior chamber (AC) tumor': 1, 'anterior chamber pigmentation': 2, 'anterior chamber implantation cysts': 3, 'chamber shallowness': 1, 'atrial chamber abnormality': 1, 'anterior-chamber empyema': 1, 'Axenfeld Syndrome': 1, 'abnormalities of the anterior chamber and iris': 1, 'Anterior chamber hypopyon': 2, 'developmental malformation of the anterior chamber of the eye': 1, 'ACD reduction': 1, 'anterior chamber angle lesion': 1, 'Axenfeld-Rieger isolated eye anomalies': 1, 'Rieger and Axenfeld anomaly': 1, 'ACIOLs': 3, 'congenital abnormalities of the anterior chamber or angle': 1, 'anterior chamber depth loss': 1, 'Collapse of Anterior Chamber': 1, 'optic chiasmal cleavage syndrome': 1, 'abnormality of the anterior chamber of the eye': 1, 'anomalies of the anterior chamber of eye': 1, 'RIBOSOME-GUIDED ENDONUCLEOLYTIC CLEAVAGE OF': 1, "Axenfeld Rieger's syndrome": 1, 'anterior chamber eyes': 1, 'CHAMBERED': 2, 'Deepening of anterior chamber': 1, 'Anterior displacement of posterior chamber lenses': 1, 'posterior chamber abnormality': 1, 'Double Anterior Chamber': 1, 'Chamber Dysfunction': 1, '4-chamber dysfunction': 1, 'Axenfeld anomaly with synechia': 1, 'Axenfeld Rieger syndromes': 1, 'Chamber angle': 1, 'Ozurdex anterior chamber migration': 1, 'ESAC': 1, 'SAC': 1, 'anterior chamber contraction syndrome': 1, 'AC abnormalities': 3, 'Magma chamber': 1, 'hypoplastic anterior chambers': 1, 'CCA': 1, 'DiGeorge and Axenfeld-Rieger syndrome': 1, 'AC inflammationOCT': 1, 'IOC': 1, 'anterior and posterior chamber injuries': 1, 'Axenfeld-Rieger syndrome type 3 in': 1, 'axenfeld loop': 1, 'Axenfeld loop': 1, 'anterior chamber width': 1, 'Anterior chamber width': 1, 'REACTIVE BEHAVIOR OF ANTERIOR EYE CHAMBER IMPLANTATES': 1, 'anterior chamber malformation of the eye': 1, 'OPC': 1, 'CHAMBER DISINFECTION OF CLOTHING CONTAMINATED': 1, 'anterior chamber visualisation': 1, 'PC-': 1, 'cysts in the anterior chamber': 1, 'anterior-chamber collapse': 1, 'Anterior chamber angle hypoplasia': 1, 'chamber bleed': 1, 'multi-chamber impairment': 1, 'anterior chamber maintainer': 1, 'anterior chamber cleavage malformation': 1, 'anomaly of Rieger': 1, 'iris fibrils in anterior chamber': 1, 'IC-ACIOL': 1, '-ACIOLs': 1, 'IC-ACIOLs': 1, 'Axenfeld-Reigers anomaly': 1, 'multiple somatic anomalies': 1, 'right chamber remodelling': 1, 'chamber bleeding': 2, 'AC-tumors': 1, 'Anterior chamber-Associated Immune Deviation': 1, 'inflammatory disease of the anterior chamber': 1, 'anterior chamber and vitreoretinal involvement': 1, 'Anterior Chamber Reaction': 1, 'Anterior chamber flares': 1, 'HAC': 1, 'acAGV': 1, 'Anterior Chamber Maintainer': 1, 'Rieger Syndrome type 1': 1, 'Axenfeld Rieger syndrome type 3': 1, 'anterior chamber eye malformations': 1, 'Acrylic Chamber': 1, 'CITRATE CLEAVAGE': 1, 'sloping eye chambers': 1, 'TRANSCRIPTOME-WIDE IDENTIFICATION OF CLEAVAGE TARGETS': 1, 'rubeosis of the anterior chamber angle': 1, 'Axenfeld-Rieger syndrome type I': 1, 'anterior chamber condition': 1, 'anterior chamber oil-prolapse': 1, 'to the anterior chamber angle': 1, 'chamber dilaation': 1, 'Pigmentation on the anterior chamber': 1, 'pigmentation on the anterior chamber': 1, 'anterior chamber and elevated intraocular pressure': 1, 'TRC': 1, 'anterior chamber neovascular membrane': 1, 'anterior chamber neovascular membrane': 2, 'VAC': 1, 'chambers abnormalities': 1, 'SOMATIC ANOMALIES OF THE UMBILICUS': 1, 'injury of the anterior chamber of the eye': 1, 'Axenfeld-Rieger anomaly type 3': 1, 'Anterior chamber leakage': 1, 'abnormality of hemispheric cleavage': 1, 'Anterior chamber alterations': 1, 'Anterior chamber eye anomalies': 1, 'disorders of the anterior chamber': 1, 'Axenfeld-Riger anomaly': 1, 'ARA of the eye': 1, 'double AC': 2, 'embryological cleavage defects': 1, 'anterior chamber eye defectsb': 1, 'anomalies of the anterior chamber of eyes': 1, 'Anterior-chamber eye defects': 1, 'AXA': 1, 'RGA': 1, 'Axenfeld-Schurenberg syndrome': 1, 'the AC': 1, 'AOC': 1, 'anterior chamber angle hypoplasia': 1, 'UNILATERAL CLEAVAGE': 1, 'ACs': 1, 'Rieger syndrome I': 1, "anterior chamber's": 1, '1.Axenfeld-Rieger syndrome': 1, 'ARS disease': 1, 'type 3 ARS': 1, 'ARS (Type 3)': 1, 'Chamber abnormalities': 1, 'PCS': 1, 'anterior chamber coagulation': 1, 'ARAS': 1, 'in ACD': 1, 'angle cleavage abnormality': 1, 'Traumatic deformity of the anterior chamber angle': 1, 'akinetic chamber': 1, 'involvement of the posterior chamber of the eye': 1, 'bleedings into the anterior chamber': 1, 'anterior double-chamber': 1, 'Axenfeldt/Rieger syndrome': 1, 'systemic venous chamber': 1, 'anterior chamber blockade': 1, 'anterior chamber flashing': 1, 'anterior chamber eyelash': 1, 'AC-hemorrhage': 1, 'AC hemorrhage': 1, 'PXC': 1, 'ICD': 1, 'AL ACD': 1, 'posterior chamber injuries': 1, 'posterior chamber injury': 1, 'anterior chamber bacterial contamination': 1, 'pPA': 1, '-Rieger syndrome': 1, 'Anterior chamber blood reflux': 1, 'Pigmentation on anterior chamber angle': 1, 'anterior chamber-angle': 1, 'anterior chamber angle defects': 2, 'ARS malformations': 1, 'autosomal dominant Axenfeld-Rieger syndrome': 1, 'FCM': 1, 'anterior chamber angle abnormality': 1, 'GCAF': 1, 'PCC-SR': 1, 'CLEAVAGE OF METHYLENEBIS': 1, 'Anterior chamber depth asymmetry': 1, 'Anterior chamber depth': 1, 'developmental abnormality of the anterior chamber drainage': 1, 'CHAMBER DISINFECTION OF SYNTHETIC FUR ARTICLES': 1, 'CCE': 1, 'malformations to the anterior chamber': 1, 'CHAMBER QUANTIFICATION': 1, 'Rieger (or Axenfeld-Rieger) anomaly': 1, 'cardiac chamber or chambers dilation': 1, 'dislocation of the anterior eye chamber': 1, 'infections of the anterior chamber of the eye': 1, 'dysmorphic heart chambers': 1, "Axenfeld's defect": 1, 'abnormalities of the anterior and posterior chambers of the eyes': 1, 'HC': 2, 'anterior chamber-associated immune deviations': 1, 'anterior chamber (AC) involvement': 1, 'anterior eye chamber defect': 1, 'eye chamber': 1, 'somatic and mental anomalies': 1, 'anterior chamber anomalies in the eye': 1, 'axenfeld-rieger anomaly': 1, 'pseudoanterior chamber': 1, 'MCP Hydrolases': 1, 'AC shunts': 1, 'Multiple Somatic Anomalies': 1, 'collapse of the AC': 1, 'CRC': 1, 'anterior chamber dysgenic syndromes': 1, 'Injury of the anterior chamber of the eye and': 1, 'Axenfeld Rieger and Peters Anomaly': 1, 'defects in angle of anterior chamber': 1, 'CUTAC': 2, 'traumatic cysts of the iris and anterior chamber': 1, 'anterior chamber 1': 1, "Rieger's malformation": 1, 'anterior chamber cystic lesions': 1, 'anterior chamber angle and outflow': 1, 'Lens matter in anterior chamber': 1, 'Flat anterior chamber': 2, 'ARS syndromes': 1, 'anterior chamber ACP': 1, 'anterior chamber OVD': 1, 'ARS.Nevertheless': 1, 'Anterior chamber granuloma': 1, 'malformation of the anterior eye chamber': 1, 'ANEROBIC CHAMBER': 1, 'SCC': 1, 'open angle of the anterior chamber': 1, 'anterior chamber punction': 1, 'anterior chamber lesionsEvaluate': 1, 'ocular anterior chamber abnormality': 1, 'prosencephalic cleavage disorders': 1, 'open angle of anterior chamber': 1, 'syndrome of closed anterior chamber': 1, 'Axenfield Rieger syndrome': 1, 'anterior chamber (AC) granulomas': 1, 'and anterior chamber enlargement': 1, 'Anterior Chamber Relapse': 1, 'anterior chamber metastasis to the eye': 1, 'anterior chamber cholesterosis': 1, 'Anterior chamber (AC) granulomas': 1, 'anterior chamber angle shallowing': 1, 'Anterior chamber synechiae': 1, 'ACPC': 1, 'anterior chamber defectsChoanal atresiaOral': 1, 'Axenfeld--Rieger Syndrome': 1, 'Axenfeld-Reiger spectrum disorder': 1, 'hemorrhage into the anterior chamber': 1, 'cholesterolosis of the anterior chamber': 1, 'inflammatory of anterior chamber': 1, 'anterior chamber pigmentary disease': 1, 'flattening of the anterior chamber': 1, 'implantation cyst in anterior chamber': 1, 'chamber of the': 1, 'CLEAVAGE WITHOUT NUCLEI': 1, 'ANTERIOR CHAMBER ANGLE': 1, 'ACD Diseased eye': 1, 'anterior chamber or vitreous prolapse': 1, 'Axenfeld-Rieger Syndrome type 3': 1, 'Axenfeld,': 1, 'anterior chamber rubeosis': 1, 'Anterior chamber pseudohypopyon': 1, 'Chamber remodeling': 1, 'anterior chamber response': 1, 'cleavage lesions': 1, 'Chamber Paracentesis': 1, 'fracture cleavage': 1, 'dysplasia of anterior chamber of eyes': 1, 'dysplasia of the anterior chamber of eyes': 1, 'TIC': 1, 'perforations into the AC': 1, 'AC perforation': 2, 'Axenfeld- Rieger Syndrome': 1, 'ACCC': 1, 'reduction of anterior chamber depth': 1, 'underdeveloped anterior chamber of the eye': 1, 'biventricular chamber dysfunction': 1, 'RCM': 1, 'renal, somatic, and cardiac anomalies': 1, 'anterior chamber activity': 1, 'Rieger syndrome EDVI': 1, 'Rieger and ED syndromes': 1, 'Rieger (or Axenfeld-Rieger) syndrome': 1, 'Rieger and Ehlers-Danlos Syndromes': 1, 'TE': 1, 'aqueous chamber reaction': 1, "Axenfeld-Rieger and Peter's anomalies": 1, 'Anterior chamber inflammatory reaction': 1, 'chamber reactions': 1, 'anterior chamber congestion': 1, 'anterior chamber angle maldevelopment': 1, 'Axenfeld-Rieger phenotypes': 1, 'CPAFs': 1, 'anterior chamber asymmetry': 1, 'anterior chamber haziness': 1, 'anterior chamber defects in the eye': 1, 'Anterior chamber eye defects': 1, 'disorder of the anterior ocular chamber': 1, 'ROLES OF CORE HISTONE CLEAVAGE': 1}
|
anterior chamber
|
Disease
|
MESH:C535681
|
{'Anomalous pulmonary arteries': 2, 'anomalous pulmonary artery': 16, 'absent or anomalous right pulmonary artery': 1, 'anomalous aortic origin of the right coronary artery': 8, 'AAORCA': 13, 'anomalous origin of right coronary artery from the': 1, 'anomalous right subclavian artery from pulmonary trunk': 1, 'AORSA': 1, 'ductal anomalous origin of the left pulmonary artery': 1, 'ductal anomalous origin of the pulmonary artery': 1, 'right anomalous pulmonary venous connection': 3, 'anomalous pulmonary arteries': 2, 'anomalous origin of the renal artery': 1, 'anomalous origin of the right pulmonary artery': 6, 'Anomalous origin of the right pulmonary artery': 1, 'AORPA': 8, 'ORIGIN OF PULMONARY': 1, 'PNEr': 1, 'AOPA': 8, 'anomalous origin of unilateral pulmonary artery': 3, 'anomalous aortic origin': 2, 'ARCA': 2, 'ARPA-E': 1, 'ARPA-H': 3, 'ARPA': 12, 'FOV': 3, 'family of origin violence': 1, 'anomalous origin of the right coronary artery from the pulmonary': 1, 'Anomalous origin of coronary artery from pulmonary artery': 1, 'anomalous origin of coronary artery from pulmonary artery': 2, 'ANOMALOUS ORIGIN OF': 2, 'origin of the right pulmonary': 1, 'origin of the right pulmonary artery': 3, 'anomalous origin of any of coronary artery from pulmonary artery': 1, 'Family of Origin': 1, 'AOLCX': 1, 'BAAO': 1, 'AORCA': 9, 'anomalous origin of the right coronary artery': 6, 'anomalous origin of the RCA': 1, 'II APVB': 1, 'II and type III APVB': 1, 'type III APVB': 1, 'anomalous origin of left pulmonary artery': 1, 'anomalous origin of pulmonary arteries from the ascending aorta': 2, 'anomalous origin of the left pulmonary artery': 7, 'AOLPA': 6, ', anomalous origin of the right pulmonary artery': 1, 'anomalous right coronary artery origin from the pulmonary artery': 1, 'origin of the right': 1, 'pulmonary artery AOCA': 1, 'PULMONARY ORIGIN': 3, 'bronchial anomalous origin': 1, 'Anomalous aortic origin of the right coronary artery': 2, 'anomalous origin of right pulmonary artery': 5, 'partial anomalous right pulmonary veins': 2, 'LPA) origin': 1, 'Anomalous origin of the right coronary artery from pulmonary artery': 2, 'anomalous origin of the right coronary artery from pulmonary artery': 1, 'ARHA': 1, 'FAMILY-OF-ORIGIN': 1, 'FOV violence': 1, 'anomalous muscularised pulmonary arteries': 1, 'FOOV': 1, 'anomalous origin': 5, 'Anomalous origin': 2, 'LPA origin': 1, 'anomalous origin of left anterior descending artery from the pulmonary artery': 1, 'partial anomalous right pulmonary venous drainage': 1, 'PAPVD': 1, 'anomalous origin of right coronary artery': 4, 'ANOMALOUS ORIGIN': 1, 'origin of the right coronary': 2, 'partial anomalous pulmonary artery': 1, 'anomalous right pulmonary venous connection': 1, 'anomalous right hepatic artery': 2, 'Anomalous origin of': 1, 'anomalous origin of': 3, 'anomalous origin of the coronary artery from the pulmonary artery': 3, 'Anomalous origin of the right coronary artery from the pulmonary artery': 3, 'anomalous origin of the LCA from the pulmonary artery': 2, 'anomalous right pulmonary artery': 9, 'anomalous origin of the right pulmonary artery from the ascending aorta': 1, 'anomalous origin of the left coronary artery from the right pulmonary artery': 1, 'anomalous origin of the right coronary artery from the main pulmonary artery': 1, 'anomalous origin of the right coronary artery from the pulmonary artery': 7, 'congenital anomalous aortic origin': 1, 'right coronary arteries with anomalous origin': 1, 'Right coronary arteries with anomalous origin': 1, 'origin of a right': 1, 'anomalous aortic origin of a right coronary artery': 1, 'Anomalous pulmonary artery': 4, 'congenital anomalous pulmonary arteries': 1, 'anomalous right': 1, 'Anomalous pulmonary artery 1': 1, 'anomalous origin of the right pulmonary artery from aorta': 1, 'anomalous origin of the right-coronary artery': 1, 'right anomalous pulmonary venous': 1, 'congenital anomalous pulmonary arterial branch': 1, 'anomalous origin of right pulmonary artery from': 1, 'anomalous right pulmonary veins': 2, 'pulmonary artery anomalously': 1, 'anomalous origin of the pulmonary artery': 3, 'Isolated anomalous right coronary artery originating from the pulmonary artery': 1, 'anomalous RCA originating from the pulmonary': 1, 'anomalous right vertebral artery': 1, 'FAMILY OF IRAQI ORIGIN': 1, 'Anomalous Origin of the Right Coronary Artery from the Pulmonary Artery': 1, 'unilateral anomalous pulmonary artery origin': 1, 'congenitally anomalous pulmonary artery': 1, 'UCAPA': 1, 'anomalous origin of the RCA from the pulmonary artery': 1, 'anomalous origin of one pulmonary artery from the ascending aorta': 3, 'Anomalous origin of the left pulmonary artery': 2, 'Anomalous origin of the': 1, 'anomalous origin of the': 3, 'anomalous origin of right pulmonary artery from the': 1, 'origin of the left circumflex artery from the pulmonary': 1, 'anomalous origin of the left circumflex artery from the pulmonary': 1, 'Anomalous Aortic Origin of the Right Coronary Artery': 2, 'Pulmonary Origin': 1, 'pulmonary origin': 1, 'anomalous origin of the fetal pulmonary artery': 1, 'AOFPA': 1, 'anomalous origin of the unilateral pulmonary artery': 1, 'Anomalous origin of the fetal pulmonary artery': 1, 'AOUPA': 2, 'origin of a branch pulmonary artery': 1, 'Anomalous aortic origin of right coronary artery': 1, 'Anomalous Aortic Origin of Right Coronary Artery': 1, 'anomalous origin of the coronary arteries from the pulmonary arteries': 1, 'anomalous origin of the right coronary artery from the': 2, 'isolated anomalous origin of the RCA': 1, 'Total anomalous origin of the coronary arteries from the pulmonary artery': 2, 'total anomalous origin of the coronary arteries from the pulmonary artery': 2, 'RO': 1, 'anomalous right upper pulmonary veins': 2, 'FOO': 2, 'anomalous origin of LAD from pulmonary artery': 1, 'anomalous origin of pulmonary artery branch': 1, 'anomalous pulmonary artery connection': 1, 'Congenital anomalous origin': 1, 'unilateral anomalous origin of': 1, 'Aortic Origin of the Right Coronary': 1, 'aortic origin of the right coronary': 2, 'unilateral absence and anomalous origin of the pulmonary artery': 1, 'anomalous origin of one pulmonary artery from aorta': 1, 'Anomalous origin of one pulmonary artery from aorta': 1, 'Isolated anomalous origin of the right coronary artery from the main pulmonary artery': 1, 'right anomalous aortic origin of a coronary artery': 1, 'anomalous origin of pulmonary artery': 1, 'ORIGIN OF ONE PULMONARY ARTERY': 1, 'branch of right pulmonary artery': 1, 'anomalous origin of a coronary artery from the pulmonary artery': 1, 'stenosis of the right coronary artery of anomalous origin': 1, 'pulmonary anomalous systemic artery': 1, 'anomalous origin of coronary artery from the pulmonary artery': 1, 'anomalous right renal vein': 1, 'Family-of-origin violence': 1, 'Family-of-Origin Violence': 1, 'truncus arteriosus with anomalous origin of the right coronary artery from the pulmonary artery': 1, 'anomalous aortic origin of': 2, 'anomalous right coronary artery originating from the pulmonary artery': 1, 'R-AAOCA': 1, 'Anomalous right coronary artery originating from the pulmonary artery': 1, 'anomalous origin of right coronary artery from pulmonary artery': 1, 'developmental abnormalities of arteries originating': 1, 'branch of the right pulmonary artery': 1, 'anomalous pulmonary artery development': 1, 'anomalous origin of pulmonary artery from the aorta': 1, 'anomalous origin of the right pulmonary': 1, 'anomalous origin of a branch pulmonary artery from the aorta': 2, 'hypoplastic anomalous right pulmonary vein': 1, 'anomalous origin of right coronary': 1, 'anomalous right coronary artery originating from the pulmonary artery (ARCAPA) anomaly': 1, 'UAOPA': 1, 'unilateral anomalous origin of pulmonary artery': 1, 'Anomalous origin of the right coronary artery': 1, 'anomalous PA': 1, 'anomalous pulmonary artery circulation': 1, 'Anomalous origin of right coronary artery': 1, 'congenital anomalous origin': 1, 'Anomalous right coronary artery originating from the aorta': 1, 'anomalous right coronary artery originating from the aorta': 1, 'anomalous origin of one pulmonary artery from the aorta': 1, 'congenital anomalous origin of pulmonary artery': 1, 'anomalous origin of the right pulmonary artery from': 1, 'anomalous origin of the right coronary artery from': 1, 'AOCAPA': 1, 'Anomalous origin of the coronary artery from the pulmonary artery': 1, 'anomalous (right) pulmonary vein drainage': 1, 'Anomalous pulmonary artery arising': 1}
|
anomalous pulmonary artery
|
Disease
|
MESH:C535682
|
{'right': 1374, 'of right': 6, 'dilated right ventricle': 497, 'Primary sarcomas of the pulmonary artery and right ventricle': 1, 'right ventricle (RV) hypokinesis': 4, 'rhabdomyoma of the right ventricle': 3, 'Right ventricle': 59, 'RIGHTS': 1590, 'right ventricle systolic dysfunction': 27, 'RV': 1329, 'RV dilatation': 363, 'RV dysfunction': 1391, 'human rights violation': 346, 'RV lesions': 16, 'right ventricle': 895, 'right hemisity': 1, 'Right hemisity': 1, 'RUQ': 88, 'hypertrophic RV': 16, 'RH': 50, 'human rights violations': 1166, 'right ventriculus hypoplasia': 1, 'rights': 10, 'Decompression of the RV': 1, 'RV hypoplasia': 65, 'Right Ventricle': 54, 'RV dilation': 366, 'RV collapse': 25, 'RA': 50, 'Right Ventricle Myocardial Infarction': 2, 'dysfunction of the right ventricle': 115, 'right ventricle myocardial infarction': 13, 'Right ventricle myocardial infarction': 3, 'Human rights violations': 105, 'RIGHTS COMMISSION': 2, 'right ventricle dysfunction': 469, 'RV tear': 2, 'RV rupture': 11, 'RVD': 39, 'Right Ventricle Dysfunction': 8, 'dilated systemic right ventricle': 1, 'RVSP': 421, 'RV insufficiency': 6, 'RV ischemia': 58, 'RV function': 44, 'RV diastolic dysfunction': 92, 'RV enlargement': 218, 'hypoplastic right ventricle': 491, 'hypoplasia of the right ventricle': 93, 'RV Fibrosis': 5, 'RV fibrosis': 71, 'human rights': 541, 'HRC': 8, 'RV inflammatory cardiomyopathy': 1, 'RV scar lesion': 1, 'maldevelopment of RV myocardium': 1, 'RV aneurysms': 15, 'RV bipolar EVS': 1, 'absence of the myocardium of the RV': 1, 'right hemihypalgesia': 1, 'enlarged right ventricle': 30, 'systemic right ventricle': 31, 'SRV': 15, 'Systemic Right Ventricle': 6, 'RV systolic dysfunction': 222, 'dysfunction of RV': 5, 'dRV': 1, 'deterioration of RV function': 10, 'cRV': 1, 'ventricular hypoplasia': 274, 'RV tachypacing': 3, 'structural and functional abnormality of right ventricle': 1, 'dilation of the right ventricle': 179, 'RV systole': 12, 'Pressure overload of the right ventricle': 4, 'right ventricle anomalies': 24, 'ischemia of the right ventricle': 8, 'RUL': 163, 'enlargement of right ventricle': 12, 'Congenital diverticulum of the right ventricle': 11, 'Diverticula of the right ventricle': 1, 'hypoplastic right ventricles': 19, 'right ventricle cavity hypoplasia': 1, 'RIGHT': 599, 'RVPAC': 1, 'LV RV Myo ME': 1, 'LV RV Myo HD': 1, 'Right': 150, 'right ventricle (RV) dysfunction': 188, 'RV cardiomyopathy': 19, 'right-ventricle thrombus': 1, 'Obstruction syndrome of the right ventricle': 1, 'obstructive malformations in the right ventricle': 1, 'right upper quadrant': 37, 'LV-RA communications': 1, 'right lateral geniculata': 1, 'insufficiency of the right ventricle': 4, 'right ventricle lesions': 5, 'RVPAS': 29, 'right ventricle (RV) disfunction': 2, 'RV disfunction': 7, 'BOTT of the right': 1, 'RV edema': 3, 'right hemianosmia': 1, 'RV or left ventricle dysfunction': 1, 'impaired right ventricle function': 9, 'impaired RV function': 26, 'RV involvement': 52, 'hypokinesis of RV': 2, 'fracture of the right cavernosum': 1, 'loss of righting': 95, 'RV injury': 41, 'RV dysf': 1, 'Hypoplasia of the right ventricle and tricuspid valve': 1, 'right ventricle hypertension': 4, 'hypertrophic right ventricle': 60, 'hypokinetic right ventricle': 25, 'RV dysplasia': 8, 'OHCHR': 10, 'dilated RV': 29, 'sRV': 18, 'fracture of the right acetabulum': 6, 'right ventricle fibrosis': 4, 'arrhythmogenic right ventricle': 11, 'or right': 6, 'the RV': 13, 'RV volume overload': 74, 'chamber right ventricle': 4, 'PRR': 11, 'Hypoplastic right ventricle': 19, 'occlusion of the right ventricle': 2, 'right ventricular hypoplasia': 203, 'dilation of the RV': 25, 'right ventricle (RV) overload': 13, 'RHF': 1, 'right ventricle dilation': 108, 'RVMIP': 1, 'RV MI': 7, 'giant fibroma of the right ventricle': 1, 'Giant fibroma of the right ventricle': 1, 'Isolated double-chambered right ventricle': 2, 'isolated fourth ventricle': 29, 'IFV': 24, 'RIGHT VENTRICLE': 24, 'diminution in the right': 1, 'systolic dysfunction of the right ventricle': 16, 'right ventricular systole': 7, 'ischaemic involvement of the right ventricle': 1, 'papilloedema of right': 1, 'rIPS': 1, 'OCR': 22, 'dilatation of right ventricle': 21, 'LA or RV': 1, 'right ventricle dysplasia': 6, 'Myxoma of the right ventricle of the heart': 2, 'RLL': 141, 'hypoplasia of the ventricle': 6, 'dislocation of the right testicle': 1, 'dilatation and aneurysms of the right ventricle': 2, 'right leg fracture': 5, 'RV stroke': 59, 'RV wall': 4, 'Dilatation of the RV': 1, 'RV over-dilation': 1, 'RV ischaemia': 8, '-overloaded right ventricle': 1, 'right-ventricle dysfunction': 3, 'lesion of the right': 1, 'right eight-and-a-half syndrome': 1, 'of their right ventricle': 1, 'hypoplastic right or left ventricle': 6, 'eRVSP': 9, 'right ventricle cardiomyopathy': 5, 'Non-compaction of the right ventricle': 1, 'RV overload': 136, 'Enlarged right ventricle': 3, 'aorto-RV fistula': 1, 'RV functional abnormalities': 4, 'RV hypokinesis': 39, 'diastolic collapse of the right ventricle': 45, 'right ventricle (RV) in situ thrombus': 1, 'right ventricle overload': 56, 'JAR': 4, 'RV aneurysmCardiac': 1, 'RV-EMF': 1, 'right ventricle aneurysm': 6, 'diverticulum of the right ventricle': 6, 'Caterpillar right ventricle': 1, 'myxoma of the right ventricle': 11, 'right ventricle (RV) dilatation': 28, 'right hemiparalysis': 6, 'failing right ventricle': 33, 'right ventricle thrombus': 20, 'right ventricle pressure overload': 3, 'RV damage': 25, 'papyraceous right ventricle': 1, 'of RV function': 7, 'Right ventricle dysfunction': 51, 'and civil rights violations': 1, 'right ventricle volume overload': 20, 'right lower': 8, 'RV defects': 6, 'RV)': 26, 'hypoplastic left or right ventricle': 8, 'of the right': 15, 'anomalies of the right ventricle': 1, 'diastolic collapse of right ventricle': 9, 'Seattle Right Ventricle': 3, 'IPR': 18, 'right ventricle (RV) enlargement': 20, 'RV abnormalities': 56, 'disease of the right ventricle': 5, 'right ventricle impairment': 15, 'akynesis of the right ventricle': 1, 'RA and RV injuries': 1, 'right ventricle (RV) injury': 1, 'obstruction of the right ventricle': 9, 'dilatation of the right ventricle': 175, 'RLE': 10, 'right or': 7, 'loss of right eyesight': 1, 'congenital defect of the RV myocardial development': 1, 'impairment of RV function': 13, 'RV pressure overload': 60, 'RV, LV or biventricular dysfunction': 1, 'RV impairment': 64, 'RV aneurysm': 10, 'RV and LV involvement': 1, 'right ventricle hypokinesia': 4, 'IRV': 1, 'isolated IV ventricle': 1, 'Human Rights': 29, 'right ventricle MI': 2, 'right ventricle (RV) lesions': 3, 'hypoplasia of one ventricle': 11, 'hypoplasia of one of the two ventricles': 2, 'left and right ventricular hypoplasia': 2, 'Right ventricle systolic impairment': 1, 'restrictive right ventricle': 2, 'right pelvicaliectasis': 1, 'isolated right atrial enlargement': 1, 'right ventricle insufficiency': 13, 'RTT': 9, 'Dilated right ventricle': 22, 'dilated right atrium and ventricle': 12, 'akinesis of the right ventricle': 2, 'myocardial echinococcosis of the right ventricle': 1, 'fibro-fatty replacement of the right ventricle': 4, 'isolated IV ventricle syndrome': 1, 'RVAs': 1, 'hypoplastic systemic right ventricle': 2, 'discomfort of right hypochondrium': 1, 'right ventricle (RV)': 8, 'enlargement of the left or right ventricle': 2, 'right hemichorea': 7, 'right brachialgia': 1, 'Thrombosis of the right ventricle': 3, 'right ventricle (RV) branch occlusion': 1, 'right ventricle branch occlusion': 1, 'infringement of civil rights': 1, 'enlargement of the right ventricle': 81, 'abnormal right ventricle': 24, 'left ventricle (LV) and right ventricle (RV) hypertrophy': 1, 'Ischaemia of right hemipons': 1, 'overload of right ventricle': 1, 'Right Hypotropia': 1, 'Abnormalities of right ventricle': 1, 'abnormalities in the right ventricle': 6, 'dilation in the RV': 1, 'hyperdynamic right ventricle': 1, 'RBI': 3, 'RBI)': 1, 'fistula to right ventricle': 4, 'Congenital diverticulum of the right ventricle apropos': 1, 'right phrenic nerve': 1, 'developmental anomaly of the right ventricle': 1, 'RPS': 9, 'diverticula of the right ventricle': 2, 'diverticula of the RV': 1, 'violation of human rights': 8, 'Right ventricle (RV) failure': 3, 'loss of the righting': 2, 'right upper quadrant syndrome': 8, 'RV diastolic collapse': 7, 'RTPJ': 4, 'right epididymis': 1, 'rupture of the right ventricle': 39, '-Right ventricle': 1, 'the right ventricle': 25, 'lesions of the right': 3, 'LV and right ventricle impairment': 1, 'LV and RV': 9, 'obstructive lesions of the right ventricle': 2, 'right and': 19, 'RVH': 5, 'sinus of valsalva-right ventricle fistula': 1, 'sinus of Valsalva-right ventricle fistula': 2, 'Sinus of Valsalva-right ventricle fistula': 1, 'Sinus of Valsalva-Right Ventricle Fistula': 1, 'right ventricle and atrium dilatation': 2, 'RV dyssynchrony': 17, 'compression of right ventricle': 2, 'right ventricle fistula': 19, 'RV pressure overload and dysfunction': 1, 'RV overload or dysfunction': 3, 'right leg hypoplasia': 3, 'RIGHT LOCATION': 1, 'PHR': 27, 'PRC': 4, 'RV diseases': 7, 'RV disease': 58, 'RV function abnormalities': 1, 'Cavitation of the right upper lobe': 1, 'right lateral ventricle tumor': 2, 'atrial and ventricular hypoplasia': 1, 'right ventricle perforation': 25, 'RV-only dysfunction': 1, 'RV myocyte dysfunction': 1, 'RMSB': 3, 'hypoplasia of ventricle or atrioventricular valve': 1, 'BART': 1, 'Right hemicol': 1, 'impairment of right ventricle (RV) systolic': 1, 'right nostril hypoplasia with pit and tag': 1, 'RV dysynchrony': 1, 'right ventricle stroke': 5, 'idiopathic right and left ventricle tachycardia': 1, 'arrhythmiogenic right ventricle dysplasia': 1, 'RV thrombus': 20, 'right hemifield defects': 1, 'right ventricle dilatation': 84, 'dilatation of the right lateral ventricle': 9, 'RVMIs': 1, 'Right ventricle myocardial infarctions': 1, 'artery to right ventricle fistula': 1, 'RIGHT MAIN': 1, 'and right ventricle compression': 1, 'RV-PV dysfunction': 1, 'LV and RV failure': 4, 'right ventricle tumor': 7, 'RIMP': 3, 'RVF': 6, 'developmental abnormality of the right ventricle': 2, 'hypoplasia of the right hepatic lobe': 12, 'right ventricle enlargement': 91, 'dilation of the right atrium or right ventricle': 1, 'Impaired LV and RV deformation': 1, 'RIGHT-': 2, 'hypoplastic anterior right ventricle': 1, 'right upper and lower extremity hypoplasia': 1, 'LV or RV': 4, 'RV strain': 30, 'right ventricle (RV) impairment': 8, 'maladaptation of the right ventricle': 2, 'dilated and hypertrophic right ventricle': 3, 'tumors of the right ventricle': 1, 'right ventricle-abdominal fistula': 1, 'loss of the righting response': 1, 'loss of righting response': 1, 'LORR': 9, 'and hypertrophic RV': 1, 'Right upper quadrant': 2, 'dilatation of right ventricle and': 2, 'cysts in the right ventricle': 1, 'myopathy of the right ventricle': 3, 'abnormal right ventricle performance': 1, 'right ventricle (RV) diastolic collapse': 2, 'RV-DE': 1, 'RV DE': 1, 'hydrocephalus of the right ventricle': 1, 'Right upper': 1, 'enlargement of the right lateral ventricle': 6, 'RIGHT PANEL': 6, 'asymmetry of the right lateral ventricle': 2, 'Perforation of the right ventricle': 13, 'RV pathology.10': 1, 'ERH': 5, 'hypoplasia of the right clavicle': 7, 'hypertrophic right ventricles': 4, 'Hypertrophic right ventricle': 1, 'RC': 13, 'FRA': 4, 'right ventricle strain': 3, 'SERPS': 2, 'right lower quadrant': 13, 'hypoplastic cavity of the right ventricle': 1, 'stenosis of the RV': 1, 'RD': 17, 'KYR': 1, 'and right ventricle dilation': 1, 'Arrhythmogenic right ventricle': 6, 'RTC': 3, 'or right ventricle compression': 1, 'Cardiac chamber compression of right ventricle': 1, 'RHC': 29, 'right ventricle (RV) fistula': 2, 'LRPS': 4, 'RV compression': 11, 'RV compression and dysfunction': 1, 'fracture of the right': 9, 'right ventricle collapse': 18, 'right upper': 29, 'RV lipotoxicity': 1, 'hypoplasia of the right upper limb': 3, 'Small right ventricle': 1, 'right ventricle filling deficit': 1, 'RSVP': 1, 'radiation damage of the right ventricle': 1, 'right ventricular (RV) remodeling': 2, 'right and left ventricular hypoplasia': 1, 'RARL': 1, 'civil rights violations': 16, 'SRV dysfunction': 7, 'Right ventricle outflow abnormal': 1, 'isolated double-chambered right ventricle': 1, 'ischaemia of the left and right ventricle': 1, 'of the right ventricle': 45, 'RVLS': 6, 'hypokinesis of right ventricle': 1, 'annulus dilation of the right ventricle': 1, 'anulus dilation of the right ventricle': 1, 'right ventricular (RV) hypoplasia': 12, 'crampy right-': 1, 'fibrosis of the right ventricle': 2, 'right and left ventricles dysfunction': 1, 'SR': 4, 'RCP': 17, 'right eyedness': 1, 'dyskinesia of RV': 1, 'RIGHT HEPATECTOMY': 4, 'hypoplasia of the myocardium of the right ventricle': 1, 'RV mass': 23, 'right ventricle (RV) pressure overload': 3, 'right hemiparesia': 11, 'hypoplasia of the corresponding ventricle': 1, 'LRH': 18, 'RV and right atrial abnormalities': 1, 'right whale': 14, 'hemodynamic dysfunction of the right ventricle': 1, 'RV perforation': 38, 'Diverticulum of the right ventricle': 4, 'collapse of right atrium and ventricle': 2, 'RV failurea': 1, 'RV systolic': 9, 'right hemipelvis': 2, 'dilatation of RV': 6, 'dysfunction of the right ventricle (RV)': 2, 'RIGHT HEMICOLECTOMY': 6, 'right defects': 1, 'Metastatic tumor of the right ventricle': 1, 'SRV ischemia': 1, 'RSL': 2, 'compression of the right ventricle': 20, 'RV chamber dilatation and': 1, 'RV IVRT': 1, 'impaired RV filling': 1, 'enlargement of the RV, RA': 1, 'RVID': 7, 'Congenital absence of myocardium of right ventricle': 1, 'right renal hypoplasia': 6, 'of right ventricle': 10, 'right ventricle mass': 6, 'Right ventricle mass': 2, 'right ventricle (RV) anomalies': 5, 'RV anomalies': 7, 'arrhythmogenic RV and LV cardiomyopathy': 1, 'RV and/or LV arrhythmia': 2, 'RV wall motion abnormalities': 8, 'RV obstruction': 17, 'right ventricle hypoplasia': 31, 'diastolic right ventricle dysfunction': 1, 'dislocated right': 1, 'right ventricle thrombosis': 5, 'right atrial systolic or right ventricular diastolic collapse': 1, 'right ventricle (LV) pressure-overload': 1, 'hypoplasia of the right acetabulum': 1, 'right ventricular systolic': 8, 'right ventricular (RV) and': 1, '2 right ventricle': 1, '3 right ventricle': 1, 'type 2 right ventricle': 1, '1 right ventricle': 1, 'right-ventricular hypoplasia': 5, 'RV coronary dependence': 1, 'RV PVCs': 1, 'and hypoplasia of the right and left': 1, 'right ventricle arrhythmic syndromes': 1, 'hypertrophic left or right ventricles': 1, 'LV hypertrophy': 1, 'and right': 5, 'LV, RV, or biventricular failure': 1, 'Cardiomyopathy of the right ventricle': 2, 'loss of righting ability': 6, 'LV and RV dysfunction': 20, 'RV Subclinical Impairment': 1, 'RVGLS impairment': 1, 'RV subclinical dysfunction': 4, 'perforations of the right ventricle': 2, 'perforations of the RV': 1, 'RLMT': 1, 'right ventricle anomaly': 12, 'dysplastic right ventricle': 5, 'RV DD': 5, 'diastolic collapse of the right atrium or ventricle': 2, 'Congenital hypoplasia of the right ventricular myocardium': 3, 'RVSWI': 1, 'Right ventricular hypoplasia': 13, 'fistula to the right ventricle': 7, 'collapse of the right and/or left ventricle': 1, 'right-ventricle injuries': 1, 'RV-PA conduit dysfunction': 1, 'RV hypertension': 16, 'Right Ventricle dysfunction': 1, 'Right Ventricle (RV) dysfunction': 1, 'Papyraceous right ventricle': 2, 'RMT': 4, 'right ventricle (RV) ischemia': 2, 'ARV': 15, 'RV malfunction': 1, 'right arm and right leg weakness': 2, 'RV deformation': 4, 'reduced right ventricle': 2, 'atrialized right ventricle': 5, 'Human Rights Violations': 4, 'RIGHT HALF': 4, 'cardiomiopathy of the right ventricle': 1, 'RH lesions': 3, 'RH lesion': 2, 'Septation of the right ventricle': 1, 'dilation of right ventricle': 19, 'RLDH': 2, 'Right ventricle (RV) impairment': 2, 'Right ventricle enlargement': 13, 'the right': 14, 'dysfunction of LV and RV': 1, 'diastolic and systolic dysfunction of the RV': 1, 'dysfunction of the RV': 17, 'dilation of RV': 6, 'Right ventricle dilatation': 16, 'RPMA': 1, 'hypokinesis of the right ventricle': 9, 'right ventricular apical hypoplasia': 2, 'RV volume overloading and dysfunction': 1, 'RV dyskinesia': 9, 'dislocation of the right': 2, 'right atriomegaly': 1, 'transposition of the aorta to the right ventricle': 1, 'hypertophy of the right ventricle': 1, 'Dysfunction of the right ventricle': 17, 'Intramural haematoma of the right ventricle': 1, 'hypokinesia of the right ventricle': 7, 'Right ventricle systolic dysfunction': 5, 'right ventricle necrosis': 1, 'hypoplastic RV': 52, 'hypoplastic and hypertensive right ventricle': 1, 'dislocation of the right trapezoid': 1, 'of Righting': 1, 'right to die': 4, 'ischemia of right ventricle': 1, 'Dilated Right Ventricle': 5, 'right ventricle (RV) dilation': 35, 'RV systolic overload': 3, 'volume overload of the right ventricle': 9, 'RV interstitial derangement': 1, 'RVEDV': 7, 'Right Handedness': 14, 'hypoplasia of the right vertebral': 1, 'ventricle (RV)': 6, 'RV dysfunctions': 9, 'RV Damage': 1, 'collapse of the right ventricle and atrium': 1, 'Human rights': 14, 'hypoplasia of the right thumb': 7, 'right-': 11, 'ACT RIGHT': 1, '-right': 13, 'failing left or right ventricle': 1, 'Syndrome of hypoplasia of the right cardiac ventricle': 1, 'ventricle (RV) enlargement': 3, 'RV and LV dysfunction': 7, 'RV and LV dilatation/dysfunction': 1, 'CR tabloids': 1, 'CR': 4, 'right ventricular hypoplasia syndrome': 2, 'motion abnormalities of the right ventricle': 2, 'right ventricular malfunction or hypoplasia': 1, 'deformity of the right ventricle': 1, 'right ventricular hypoplasia defect': 1, 'Hypoplasia of the right ventricle': 7, 'RVESVI': 8, 'dilatation of right atrium and ventricle': 3, 'diastolic compression of right ventricle': 1, 'RVA': 1, 'RV abnormality': 12, 'Bill of Rights': 3, 'embolism of the right ventricle': 1, 'embolism to the right ventricle': 1, 'Right ventricle dysfunction and abnormalities': 2, 'functional abnormality of the right ventricle': 1, 'functional abnormalities of the right ventricle': 3, 'ventricular conduction system hypoplasia': 2, 'hypoplasia of the VCS': 3, 'hypoplasia of the ventricular conduction system': 1, 'RV or biventricular dysfunction': 4, 'right ventricle (RV) disease': 1, 'Right ventricle Left ventricle 1': 1, 'structural abnormalities of both the RV and the LV': 1, 'RV or LV distension': 1, 'right hemineglect': 3, 'pressure overload of the right ventricle': 22, 'RV VO': 2, 'RSP lesions': 1, 'right hemiweakness': 1, 'RM': 4, 'Cardiac myxoma of right ventricle': 1, 'atrium and right ventricle': 2, 'Equal Rights Amendment': 1, 'ERA': 1, 'RV tachycardia': 1, 'diastolic dysfunction of the right ventricle': 14, 'right hemihypoplasia': 3, 'diastolic dysfunction of right ventricle': 6, 'RV overload and dysfunction': 3, 'RV contractile impairment': 1, 'right HF': 4, 'violations of human rights': 9, 'RV-dilatation': 2, 'Right or left ventricular hypoplasia': 1, 'hypoplastic right or left ventricles': 3, 'RV functional impairment': 7, 'Right ventricle (RV) abnormalities': 1, 'fibro-fatty degeneration of the right ventricle': 2, 'RV dyskinetic': 1, 'right ventricle (RV) volume overload': 10, 'RIGHT SAFETY PROFILE': 1, 'RIGHT PATIENT': 4, 'right ventricle to aorta fistula': 1, 'RV arrhythmia': 5, 'RV C': 1, 'injury to the right ventricle': 7, 'right and left ventricle injury': 1, 'RV myopathy': 5, 'ventricular myocardial hypoplasia': 2, 'TRIPS': 3, 'RV systolic dysfunctiona': 4, 'trauma of the right ventricle': 1, 'Right ventricle insufficiency': 2, 'RIGHTNESS': 1, 'hypoplastic or small right ventricle': 1, 'RV right ventricle': 6, 'Right ventricle stroke': 10, 'Hypertrophic and dilated right ventricle': 2, 'RF': 16, 'arrhythmia RV cardiomyopathy': 1, 'right ventricle (RV) cardiomyopathy': 1, 'right ventricle abnormalities': 9, 'CIVIL RIGHTS': 4, 'dilated right-ventricle': 1, 'right one-and-a-half syndrome': 3, 'perforation of right ventricle': 5, 'perforation of the right ventricle': 30, 'Perivisceritis of the right hypochondrium': 1, 'akinesis of the right': 1, 'and right leg fracture': 1, 'CCHR': 1, 'systolic overload of RV': 1, 'cyst of the right ventricle': 1, 'Watery cyst of the right ventricle': 1, 'watery cyst of the right ventricle': 1, 'RV disorders': 1, 'RV than LV dysfunction': 1, 'loss of the right eyeball': 1, 'hypoplasia of the right cochlea': 1, 'high right hemipelvis': 1, 'rudimentary right ventricle': 17, 'right pulmonary hypoplasia': 8, 'Right ventricle pressure overload': 1, 'pressure-overloaded RV': 1, 'enlargements of RA and RV': 2, 'RV dilates': 2, 'obstruction of the right ventricle output': 1, 'right ankylotia': 1, 'Myxoma of the right ventricle': 13, 'RV perforations': 4, 'dysfunction of right ventricle': 12, 'RV hypokinesia': 17, 'underdeveloped right ventricle': 7, 'PR': 1, 'rights violations': 14, 'RV dysfunction4': 1, 'RV stunning': 2, 'RV contractile dysfunction': 7, 'RV and right atrial (RA) enlargement': 1, 'righting loss': 3, 'right hypoplasia': 4, 'ventricle (RV) dysfunction': 1, 'right ventricle(RV) dysfunction': 1, 'right hemiparetic attacks': 1, 'right ventricle malformations': 5, 'dilation of the main right ventricle': 1, 'SRHC': 1, 'to the RV': 2, 'motor deficiency of the right lower body': 1, 'RV-penetrating injury': 1, 'right ventricle (RV) injuries': 2, 'RV alterations': 4, 'Diastolic dysfunction of the right ventricle': 4, 'enlarged right ventricles': 2, 'mass and dysfunction of the right ventricle': 1, 'RVEDD': 2, 'right-handedness': 10, 'volume overload of RV': 1, 'depressed right ventricular motion': 1, 'RRPs': 1, 'injury of the right ventricle': 6, 'right ventricle injury': 13, 'RLQ': 35, 'RVD dysfunction': 1, 'diastolic dysfunction of the RV': 9, 'right ventricle diastolic (RVD) dysfunction': 1, 'Decompensated right ventricle': 1, 'Right ventricle dilation': 13, 'RV damages': 1, 'right leg fractures': 2, 'Right ventricle hypertension': 1, 'RV hypoplasticity': 1, 'LV-RA defect': 3, 'civil and political rights violations': 2, 'dilation of the right ventricle and': 3, 'hypoplasia of right hemimandible': 1, 'left or right ventricle dysfunction': 5, 'right ventricle (RV) damage': 3, 'RRC': 10, 'right ventricle fibroma': 3, 'RV deficits': 2, 'myocardial of the right ventricle': 1, 'Dysplastic RV': 1, 'aneurysms of the right ventricle': 1, 'aneurysm of the right ventricle': 6, 'Collapse of the right ventricle': 2, 'HRE': 1, 'right ventricle dysfunction and': 1, 'RVET': 1, 'LRC': 17, 'rhabdomyosarcoma of the right ventricle': 3, 'RVMI': 8, 'ischemic RV': 4, 'RVEDP': 2, 'right ventricle strain dysfunction': 1, 'RV strain dysfunction': 1, 'LV and RV strain dysfunction': 1, 'RV or LV dysfunction': 5, 'RVDCC': 13, 'Fracture of right superior orbitCT': 1, 'RV and tricuspid valve (TV) hypoplasia': 1, 'Ventricular hypoplasia': 14, 'CPHR': 1, 'CHR': 1, 'deformity of the right globe': 1, 'right ventricle (RV) dysfunction and': 1, 'AR': 5, 'Lesion of the right heart ventricle': 1, 'RV global dysfunction': 2, 'RV Dysfunction': 18, 'RV Global Dysfunction': 1, 'Right ventricle (RV) dysfunction': 23, 'RV longitudinal dysfunction': 3, 'in RV systolic': 1, 'loss of right': 3, 'loss of right menace reaction': 1, 'decreased right': 2, 'human rights atrocities': 4, 'right ventricle tamponade': 1, 'dysfunction of the left or right ventricle': 1, 'right ventricle diastolic dysfunction': 10, 'SITOIGANAP RTT': 1, 'RVIDs': 1, 'right lateral ventricle enlargement': 1, 'RIGHT PNEUMONECTOMY': 1, 'LV or RV function impairment': 1, 'wall motion abnormalities of the right ventricle': 1, 'ischemic right ventricle': 8, '+ rights defender': 1, 'abnormalities of the right ventricle,': 1, 'right ventricle perforations': 1, 'Dysfunction in both right and left ventricles': 1, 'ischaemia of the RV': 1, 'ischaemia of RV': 1, 'Right whale': 3, 'right ventricle (RV) decompensation': 1, '(RT)': 1, 'hypoplasia of the right maxilla': 1, 'hypoplasia of the RV and TV': 1, 'HRN': 1, 'hypokinetic RV': 6, 'ventricular (RV) myocardial infarction': 1, 'Right Ventricle Involvement': 1, 'right ventricle disturbances': 1, 'RV muscle impairment': 1, 'RV systolic and diastolic dysfunction': 10, 'RV early': 1, 'Obliterated right ventricle': 1, 'Right ventricle tumour': 1, 'LV-RA': 5, 'Dysfunction of the sRV': 1, 'sRV dysfunction': 11, 'obstruction of RV': 1, 'bicuspid right ventricle': 2, 'right-ventricle (RV) dysfunction': 2, 'MCR': 2, 'inlet right ventricle': 4, 'RIGHT NOW': 3, 'ventricular (RV) pressure overload': 1, 'HRCP': 1, 'noncompaction of right ventricle': 1, 'of RV': 8, 'noncompaction of the right ventricle': 3, 'RV noncompaction': 1, 'morphological abnormalities of the RV': 2, 'RPF': 1, 'RV decompensation': 32, 'RV enlargement and dysfunction': 16, 'ischaemia of the right ventricle': 4, 'pressure anomalies in the right ventricle': 1, 'congenital malformations of the right ventricle': 1, 'congenital hypoplasia of the right ventricle': 2, 'right thumb hypoplasia': 4, 'Fracture of the right': 2, 'right ventriclular hypoplasia': 1, 'right hemibody': 3, 'hypoplasia of the RV': 8, 'hypertrophic left and hypoplastic right ventricles': 1, 'injuries to the right ventricle': 2, 'injuries to the right cardiac ventricle': 1, 'human rights injustice': 1, 'ventricle (RV) systolic dysfunction': 3, 'RVDD': 4, 'hypoplasia of the systemic ventricle': 1, 'Impaired RV function': 2, 'right ventricle (RV) maladaptation': 1, 'arrhythmogenic RV CM': 1, 'ischaemia of right ventricle': 1, 'abnormality of RV contractility': 1, 'RV myocardial infarction': 4, 'dilatation of the RV': 12, 'Loss of the righting': 3, 'damage of RV': 1, 'LV and RV systolic dysfunction': 4, 'in RV function': 1, 'RV cardiomyopathies': 7, 'RV/RA': 1, 'right atrium/right ventricle': 1, 'pressure and volume overloaded right ventricle': 1, 'impairment of right ventricle function': 2, 'RV- systolic': 1, 'Hypoplasia of right ventricular myocardium': 2, 'RLS': 3, 'RV mechanical abnormalities': 3, 'ROW': 5, 'Arrhythmic Right Ventricle Cardiomyopathy': 1, 'of rights and': 1, 'of righting': 3, 'right aldosteronoma': 1, 'pressure-overloaded right ventricle': 5, 'Left coronary to right ventricle fistula': 1, 'of the left or right ventricle': 1, 'LRPH': 2, 'volume overloaded RV': 2, 'intraventricular (RV) dyssynchrony': 1, 'PA': 4, 'right ventricle-pulmonary artery uncoupling': 1, 'Dysfunction of RV': 2, 'enlarged right lateral ventricle': 4, 'RHs': 1, 'ventricular (right ventricle': 1, 'mRV': 2, 'hypoplasia of right carotid canal': 1, 'Valsalva- right ventricle fistula': 1, 'dysfunction of the right or left ventricle': 2, 'RV diverticulum': 4, 'RV diverticulum lesion': 1, 'dilatation of right lateral ventricle': 3, 'impairment of the right ventricle': 7, 'Doubleoutlet right ventricle': 1, 'abnormalities of right atrial or right ventricle': 1, 'LR': 5, 'diastolic collapse of the right atrium and ventricle': 3, 'widened right ventricle': 1, 'aplasia or hypoplasia of the RV wall': 1, 'right ventricle enlargement and non': 1, 'HR': 8, 'human rights (HR)': 2, 'univentricular right ventricle': 1, 'occlusion of the RV and right atrium': 1, 'congenital fistula of the Valsalva sinus to the right ventricle': 1, 'right-frontal deficiencies': 1, 'right upper lobe consolidation': 4, 'right hemiparesthesias': 2, 'right ventricle compression': 5, 'collapsed right ventricle': 2, 'myxomas of the right ventricle of the heart': 1, 'Right lateral ventricle': 5, 'left and right ventricles dysfunction': 1, 'Dilatation of right ventricle': 1, 'Hypoplasia of the right hepatic lobe': 5, 'SRV systolic impairment': 1, 'SRV Dysfunction': 1, 'dysfunction of the SRV': 1, 'SRV dilatation': 1, 'impairment of RV morphology and function': 1, 'right ventricle (RV) pathology': 1, 'left and right ventricle hypokinesis': 1, 'RV depolarisation': 1, 'Papulonodular lesion of the right': 1, '-thin right ventricle': 1, 'right ventricle syndrome': 1, 'dilation of the right lateral ventricle': 3, 'stenosis of the right ventricle': 3, 'fracture of right leg': 2, 'abnormal right ventricles': 1, 'right ventricle and atrial thrombosis': 1, 'Ventricular myocardial hypoplasia': 1, 'RV hypoplasias': 1, 'RV inflow obstruction': 3, 'Enlarged Right Ventricle': 1, 'Right ventricle systolic/diastolic dysfunction': 1, 'Myocardial dysfunction of the right ventricle': 1, 'right ventricle obstruction': 12, 'overloading of the right ventricle': 1, 'HRV': 3, 'right colectasia': 1, 'diastolic collapse of the RV': 1, 'loss of rights': 2, 'anomaly of right': 1, 'right ventricle enlargement and dysfunction': 7, 'LV and RV dysfunctions': 2, 'RV contactility': 1, 'malformations of the right ventricle': 3, 'Right-': 2, 'right atrium and ventricle dilation': 3, 'Abnormal muscle bundle of the right ventricle': 1, 'Primary tumors of the right ventricle': 4, 'Loss of righting': 7, 'LOR': 3, 'right lower leg fracture': 1, 'Hypokinesia in the right ventricle': 1, 'chamber of right ventricle': 1, 'right ventricle (RV) enlargement and dysfunction': 2, 'Congenital aplasia of the myocardium of the right ventricle': 1, 'RV systolic abnormalities': 2, 'right hemitruncus arteriosus': 2, 'RV regurgitation': 2, 'coronary to RV fistula': 1, 'atrial and right ventricle enlargement': 3, 'RV-related arrhythmias': 1, 'malformation of the right ventricle': 9, 'Aortic-to-right ventricle fistula': 1, 'aortic-to-right ventricle fistula': 1, 'LV-RA shunts': 3, 'loss of the right leg': 1, 'overload of the right ventricle': 19, 'right Ventricle': 1, 'human-rights violations': 3, 'ventricle (RV': 1, 'RV dilations': 1, 'RBDs': 1, 'right-brain-damaged right-handers': 1, 'Perforation of right ventricle': 2, 'impaired functionality of the right ventricle': 1, 'right ventricular (RV) pressure overload': 2, 'Fracture of the Right Leg': 2, 'right ventricle rupture': 15, 'right upper lobe (': 2, 'VPD human rights violations': 1, 'lesions of the right crus II': 1, 'rights extremism': 1, 'non-right-handedness': 4, 'Non-right-Handedness': 1, 'Giant cavernous haemangioma of the right ventricle': 1, 'right ventricle lesion': 3, 'right ventricle metastasis': 5, 'TLRC': 3, 'dilated right ventricles': 6, 'VCS hypoplasia': 6, 'Dilation of Right Ventricle': 1, 'Atrialization of the RV': 1, 'RLSNHL': 1, 'Congenital isolated hypoplasia of the right ventricle': 2, 'TLDRH': 1, 'civil rights violation': 3, 'right ventricle myopathy': 1, 'LV or RV myopathy': 1, 'left atrium and right ventricle myopathy': 1, 'delay in righting': 1, 'right ventricle out flow tract (RVOT) obstruction': 1, 'lesion in the right': 3, 'dilation of right ventricles': 1, 'right ventricular end systole': 1, 'RE-A': 1, 'Aorta-right ventricle fistula': 1, 'right dislocation': 5, 'RIGHT SIDE': 3, 'Myocardial infarction of the right ventricle': 3, 'hypoplasia of right thumb': 2, 'RV-PA conduit obstruction': 1, 'right ventricle to': 1, 'fracture of the right ilium': 1, 'structural abnormalities of both the RV': 1, 'right ventricle-to-pulmonary artery conduit aneurysm': 1, 'RV and LV failure': 2, 'damage of the RV': 1, 'malformation of right ventricle': 1, 'RR': 3, 'right ventricular systolic function': 7, 'fracture of the right zygoma': 1, 'enlargement of RV': 1, 'functional impairment of the right ventricle': 4, 'ERL': 2, 'RVAD': 6, 'RIGHT HAND': 6, 'dilatation of the right atrium and ventricle': 7, 'Dilatated right ventricle': 1, 'RV outflow': 1, 'Dilated right atrium and ventricle': 1, 'RUQ)': 1, 'Dilatation of the right ventricle': 7, 'hypofunction of the right ventricle': 2, 'diastolic overload of the right ventricle': 4, 'collapse of the right ventricle': 19, 'systolic dysfunction of the RV': 5, 'myxoma of the right heart ventricle': 2, 'dilatation of RV and right atrium': 1, 'Right ventricle (RV) hypertrophy': 3, 'Aorto-RV fistula': 1, 'Aorto-RV Fistula': 1, '-RV Fistula': 1, 'Ao-RV fistula': 2, 'Ao- RV fistula': 1, 'Ao-RV Fistula': 1, 'neoplasm of the right ventricle': 1, 'deformed right palpus': 1, 'impaired left and right ventricle': 1, 'human rights harm': 3, 'and human rights violation': 2, 'dysplasia of the right ventricle': 11, 'right ventricle function': 5, 'LV/RV dilation/dysfunction': 1, 'deformity of the right thigh': 2, 'RV systolic dusfunction': 1, 'RV scar': 4, 'abnormalities in RV functions': 1, 'degeneration of the right ventricle': 2, 'LV and/or RV failure': 1, 'right heart ventricle dysfunction': 1, 'RV motion abnormalities': 1, 'myopathy of the RV': 2, 'DRM': 1, 'dilating RV': 1, 'RV dilated': 5, 'LARHC': 1, 'RIGHT ARM': 1, 'LV and RV stroke': 1, 'RV laceration': 4, 'right ventricle (RV) laceration': 1, 'Roma rights violations': 1, 'Congenital hypoplasia of the right ventricle': 1, 'right frontal': 1, 'right ventricle osteosarcoma': 1, 'HRO': 1, 'Cantonese RD': 1, 'Right dislocation': 2, 'pressure overloaded RV': 6, 'right platysma': 1, 'HRS': 1, 'RV (right ventricle) dysfunction': 1, 'Right ventricle metastasis': 2, 'RV congestion': 3, 'RV myocardial dysfunction': 5, 'gun injury to the right ventricle': 1, 'labour rights violation': 1, 'obstruction of the RV': 2, 'Right motor and sensory syndrome': 1, 'RV function and dysfunction': 1, 'LV-RA connection': 1, 'LV-RA defects': 1, 'coronary-right ventricle fistula': 2, 'Right of Way': 1, 'RV malformations': 2, 'Right ventricle perforation': 9, 'RV lesion': 4, 'RV enlargement or dysfunction': 5, 'RV dysfunctionSevere': 2, 'RV akinesia': 6, 'UDHR': 2, 'myxomatous tumour of the right ventricle': 1, 'RV and': 6, "Human rights'": 1, 'hypoplasia of the tricuspid valve or right ventricle': 1, 'right ventricle systolic impairment': 2, 'hypoplasia of the morphologically right ventricle': 3, 'right ventricle diastolic collapse': 3, 'Right ventricle ischemia': 1, 'RV ischemic damage': 1, 'right lower quadrant syndrome': 3, 'RIGHT NUMBER': 1, 'RV dysfunction.21': 1, 'RV failure34': 1, 'LV) or right ventricle (RV) dilatation': 1, 'RVPA': 6, 'RBI lesion': 2, 'RLL consolidation': 3, 'Atrialized right ventricle': 7, 'aRV': 3, 'RV neoplasm': 1, 'CHRAJ': 3, 'right lobe': 3, 'volume-overload of the right ventricle': 2, 'disfunction of the RV': 1, 'intellectual property rights': 4, 'right upper quadrant disease': 2, 'ROWs': 1, 'right atrium and ventricle': 1, '(RV)': 3, 'of the rOFC': 1, 'RV diastolic impairment': 2, 'RV-MD': 1, 'isolated right coronary artery to left ventricle fistula': 1, 'right hemihypsarrhythmia': 1, 'RV defect': 2, 'RV and endothelial': 1, 'ARVIP': 1, 'IRVIP': 1, 'right ventricle fistulas': 3, 'RV fistula': 8, 'LV or RV obstructive': 1, 'Fracture of the right acetabulum': 2, 'right upper quadrant discomfort': 3, 'right ventricle and atrial dilatation': 1, 'Right ventricle tumor': 3, 'HRDD': 2, 'RULs': 1, 'sick right ventricle': 1, 'Right-to-': 2, 'structural abnormality of the right ventricle': 2, 'NHRC': 1, 'CPR': 2, 'NHRCA': 1, 'diseases of the right ventricle': 2, 'hypoplasia of ventricular myocytes': 1, 'of human rights': 4, 'right ventricle (RV) dilatation and': 1, 'RV or LV disease': 1, 'Myocardium of the Right Ventricle': 1, 'Right in': 1, 'Rhabdomyosarcoma of the right ventricle': 3, 'hypoplasia of one of the ventricles': 7, 'LV or RV thrombus': 1, 'damage to the right ventricle': 1, 'right hemiparkinsonism': 1, 'RPN': 9, 'hypertrophic and hypokinetic right ventricle': 1, 'RV-CM': 1, 'right hemiscrotum': 2, 'right ventricle to pulmonary artery': 1, 'fracture of the right pedicula of L5': 1, 'right ventricle anterior papillary muscle rupture': 1, 'and right ventricles': 1, 'ventricular hypoplasias': 1, 'hypoplasia of the heart ventricles': 2, 'depressed right ventricle': 3, 'RVEDA': 3, 'L-RHH': 1, 'RHH': 2, 'LV and right ventricle (RV) dysfunction': 2, 'to the right': 3, 'oedema of the right ventricle': 1, 'hypoplasia of the right ventricle or aortic arch': 1, 'left ventricle-to-right atrium fistula': 2, 'overload of right atrium and right ventricle': 1, 'right hypochondrial': 1, 'PHR-I': 1, 'right leg paraesthesia': 1, 'RVsf': 1, 'of Human Rights': 1, 'FR': 8, 'hypoplasia of right ventricular inflow': 2, 'iRVNC': 4, 'Right lower lobe (RLL) tumors': 1, 'right/left ventricular hypoplasia,': 1, 'RV/LV enlargement': 1, 'right or left hypoplasia': 1, 'dilated akinetic right ventricle': 2, 'right ventricle hypokinesis': 7, 'fatty infiltration of the right ventricle': 5, 'rRV': 1, 'TR': 8, 'RV sarcoidosis': 2, 'RV WT': 1, 'right radialis': 1, 'RV-PA': 14, 'volume overload of right ventricle': 5, 'hypoplasia of the contralateral ventricle': 1, 'Dilated right atrium and right ventricle': 1, 'RV or LV failure': 4, 'right ventricles': 4, 'RV Disfunction': 1, 'right ventricle syndromeAcute': 1, 'right-ventricle (RV) dysfunction and failure': 1, 'Thrombus in the right ventricle': 1, 'thrombus in the right ventricle': 1, 'Right ventricle thrombus': 2, 'thrombosis in the right ventricle': 1, 'Distal atrialized right ventricle': 1, 'ATRV': 1, 'RCrusI': 1, 'right and/or left ventricle lesions': 1, 'dilatation at right ventricle': 1, 'RML': 2, 'mass of the right ventricle': 2, 'Civil and political rights violations': 1, 'Tayshaneta right': 1, 'hypotrophy of the right': 1, 'Volume-Overloaded Right Ventricle': 1, 'volume-overloaded right ventricle': 3, 'coronary aortic sinus of Valsalva to the right ventricle': 1, 'RCAS-RV) fistula': 1, 'ESCR': 1, 'Asymmetric hypoplasia of right facial structures': 1, 'RLH': 1, 'right ventricle myxoma': 8, 'right ventricle myxomas': 1, 'myxoma of right ventricle': 1, 'RV dysfunction': 1, 'intrinsic disease of the right ventricle': 1, 'WMA of the right ventricle': 1, 'Sarcoidosis of the right ventricle': 1, 'Human rights violation': 3, 'diverticulum of right ventricle': 1, 'depressed right ventricle function': 1, 'dilation of the right atrium and ventricle': 6, 'chambered right ventricle': 4, 'CREATES CIVIL RIGHTS': 1, 'NRH': 10, 'Systemic right ventricle (sRV) dysfunction': 1, '(RV) pressure overload': 2, 'Rhabdomyolipoma of the right ventricle': 1, 'ARVC': 4, 'dyskinesia of the right ventricle': 7, 'enlargement of the left and right ventricle': 1, 'RBS': 1, 'left and right ventricle dysfunctions': 1, 'impaired function of the right ventricle': 1, 'RRR loss': 1, 'electrical dysfunction of the right ventricle': 1, 'RIGHT PREMOTOR AREA': 1, 'right hemibody clonus': 1, 'anomalous muscle bundle of the right ventricle': 3, 'LV or RV outflow tract obstructions': 1, 'dysfunction of right ventricle (RV)': 1, 'RV) pressure overload': 1, 'RV systolic impairment': 6, 'RV systolic function impairment': 3, 'Impaired right ventricle function': 1, 'right hemiparetic': 4, 'right ventricle disease': 6, 'right/': 1, 'right-ventricle dilatation': 2, 'ischemic damage to the right ventricle': 1, 'right and left ventricle dysfunction': 5, 'leiomyosarcoma of the right ventricle': 3, 'Leiomyosarcoma of the right ventricle': 3, 'right ventricle (RV) systolic dysfunction': 13, 'loss of pension rights': 1, 'RV muscle disease': 4, 'RV, LV, or biventricular dysfunction': 2, 'dilation/dysfunction of RV, left ventricle': 2, 'RV BC': 1, 'right lateral ventricle compression': 1, 'deformities in the right': 1, 'LV and RV (biventricular) dilatation': 1, 'Rupture of the right ventricle': 2, 'TRANSGENDER RIGHTS': 1, 'serpentine right ventricle thrombus': 1, 'IRVNC': 1, 'isolated right ventricular noncompaction with': 1, 'pygmy right whales': 1, 'RHL': 2, 'right hemiliver': 2, 'right ventricle-dependent coronary circulation': 3, 'NRVD': 1, 'intracavitary liposarcoma of the right ventricle': 1, 'LADRH': 3, 'Right ventricle compromise': 1, 'RV deterioration': 11, 'hyperkinetic right ventricle': 2, 'right ventricle systolic overload': 1, 'PRR welfare chauvinism': 1, 'abnormalities of the right ventricle': 19, 'right ventricle heart disease': 1, 'hypoplasia of the ipsilateral ventricle': 1, 'RPC': 3, 'isolated PRUV': 1, 'iPRUV': 1, '-chambered right ventricle': 6, 'erythematous right thigh lesion': 1, 'RVSD': 3, 'Right ventricle (RV) dilation': 2, 'defect of the right ventricle': 2, 'TRRH': 1, 'RARH': 2, 'RV strain impairment': 2, 'dysfunction of the LV or RV': 1, 'laceration of right ventricle': 1, 'right upper quadrant (': 1, 'akinetic right ventricle': 6, 'RV chamber enlargement': 4, 'right thoracic hypoplasia': 1, 'RV death': 2, 'right ventricle myocardial dysfunction': 1, 'right ventricle dysfunctionCoronary': 1, 'RV damage/dysfunction': 1, 'RV functional impairment/damage': 1, 'congenital right pulmonary hypoplasia': 2, 'Isolated fourth ventricle': 9, 'RV increased volume': 1, 'haematoma of the right': 1, 'right ventricle contraction': 1, 'aneurysmal right ventricle': 2, 'hypoplasia of the right femur': 2, 'Dysfunction of the right ventricle (RV)': 1, 'Right ventricle (RV) dilatation': 6, 'hypokinesia of right ventricle': 2, 'hypoplasia of right femur': 2, 'hypoplasia (right ear and right thumb)': 1, 'RIGHT VENTRICULOTOMY': 1, 'right ventricle output tract obstruction': 1, 'or dysfunctional right ventricle': 1, 'enlargement and hypokinesis of the right ventricle': 1, 'dysfunction of the systemic right ventricle': 11, 'ACRI': 1, 'Arrhythmic cardiomyopathy of the right ventricle': 1, 'right lateral': 2, 'right ventricle (RT) dysfunction': 1, 'fractured right carpal scaphoid': 1, 'right ventricle cardiac myxoma': 1, 'Property rights violations': 1, 'property rights violations': 3, 'coronary to right ventricle fistula': 2, 'RV derangement': 4, 'RL': 7, 'RVVO': 1, 'RV pressure': 6, 'hypoplasia of right testicle': 1, 'volume of the right': 1, 'right ventricle ischemia and dysfunction': 1, 'RV - PA': 1, 'right-ventricle (RV) diverticula': 1, 'RV diverticula': 1, 'right-ventricular (RV) diverticulum': 1, 'ARVD': 2, 'Arrythmogenic Right Ventricle Dysplasia': 1, 'aneurysmally dilated right ventricle': 1, 'aneurysmatically dilated right ventricle': 1, 'enlargement of the right lateral ventricle and third ventricle': 1, 'Right Ventricles': 2, 'ectasis of the IV right ventricle': 1, 'mRV dysfunction': 2, 'RV shock': 2, 'Right ventricle thrombosis': 3, 'pulmonary artery and right ventricle thrombosis': 1, 'Isolated right ventricular hypoplasia': 6, 'Ventricular Hypoplasia': 4, 'Right Ventricular Hypoplasia': 2, 'IRVH': 4, 'Right ventricular (RV) hypoplasia': 2, 'Parched right ventricle': 1, 'Abnormal Right Ventricle': 1, 'RV damage,18': 1, 'hypoplasia ventricle': 1, 'RV dilation,': 1, 'multiple myxoma of the right ventricle': 1, 'Multiple myxoma of the right ventricle': 1, 'RIGHT TO BOTH SUCCESS': 1, 'or dysfunction of the right ventricle': 1, 'right ventricle decompensation': 2, 'RV diastolic and systolic dysfunction': 1, 'intracranial extra-skeletal myxoid chondrosarcoma of right lateral ventricle': 1, 'Right hemiparesia': 1, 'arrhythmogenic displasy of the right ventricle': 1, 'stab injury of the right ventricle': 1, 'Hypoplasia of the systemic ventricle': 1, 'RV) enlargement': 4, 'Right ventricle fibrosis': 2, 'right ventricle (RV) hyperthrophy': 1, 'RSCAA': 1, 'Epigastric congenital diverticulum of the right ventricle': 1, 'RA/RV thrombi': 1, 'fatty right ventricle': 2, 'ROLE OF TRIPS': 1, 'right ventricle fistulae': 1, 'pressure overload for the right ventricle': 1, 'Isolated Fourth Ventricle': 2, 'human rights breaches': 2, 'Right ventricle Dysfunction': 1, 'LV & RV dysfunction': 1, 'right ventricle hypotrophy': 1, 'right quadrant': 2, 'RV non-compaction': 4, 'RV trabeculation': 2, 'ventricle (RV) non-compaction': 1, 'right hemichoreoathetosis': 1, 'Right ventricle (RV) ischemia': 1, 'RV compromise': 8, 'Primary rhabdomyosarcoma of the right ventricle': 1, 'Right handiness': 1, 'GR': 2, 'ARVS': 1, 'RV SD': 1, 'Bill of Right': 1, 'Cardiac perforation of the right ventricle': 4, 'volume loss of the right': 1, 'RIGHT-SIDE': 1, 'IPRs': 1, 'Intellectual property rights': 1, 'right ventricular hypoplasias': 1, 'Giant rhabdomyoma of the right ventricle': 1, 'right proximal ureterostenosis': 1, 'Right to suicide': 1, 'right to suicide': 1, 'RN': 4, 'right hepatic lobe hypoplasia': 1, 'RV structural and functional abnormalities': 3, 'hypoplasia of the right ventricular myocardium': 2, 'ventricle (RV) hypertrophy': 1, 'human rights injustices': 1, 'underdevelopment of the right ventricle': 2, 'RRLDH': 1, 'tract of the right ventricle': 1, 'left and right ventricle impairment': 2, 'RV or LV systolic dysfunctionSevere': 1, 'RV and PA': 1, 'reduction of the right ventricle': 1, 'RV GLS impairment': 1, 'diastolic compression of the right ventricle': 3, 'hypoplasia of the pulmonary arteries and RV': 1, 'RBV': 2, 'RBV and': 1, 'hypoperfusion of the RV': 1, 'coronary-to-right ventricle fistula': 2, 'ventricle (RV) dilatation': 7, 'right ventricle fibrillation': 1, 'to the right ventricle of the heart': 1, 'Microinfarction in the right ventricle': 1, 'RV hypertrabeculation': 3, 'right ventricle (RV) MI': 1, 'RV metastasis of': 1, "'s rights": 2, 'RIGHT FOCUS': 1, 'Divided right ventricle': 1, 'Hypoplasia of right ventricle and tricuspid valve': 1, 'TGA-RV': 1, 'RV-TGA': 1, 'Insufficiency of the right ventricle, the left ventricle': 1, 'righting ability': 4, 'RV chamber dilation': 5, 'dilation of the RA and RV': 3, 'Hypoplasia of right ventricle': 3, 'rD': 1, 'RV wall motion abnormalities or': 1, 'RV structural abnormalities': 6, 'RV and LV function': 1, 'Muscular anomaly in the right heart ventricle': 1, 'LV or RV dysfunction': 6, 'dysfunction of the functional right ventricle': 1, 'fRV': 1, 'dilation of the left and/or right ventricles': 1, 'dilation of the right and left ventricle': 2, 'right ventricle functional abnormalities': 1, 'myxoma in the right ventricle': 1, 'tumor of the right ventricle': 5, 'dilation of both the right and left ventricle': 1, 'impaired performance of the left and right ventricles': 1, 'failing RV syndrome': 1, 'RVADs': 1, 'ischaemic RV injury': 1, 'of the RV': 4, 'nictitans of the right': 1, 'RV and valves abnormalities': 1, 'to the right ventricle': 3, 'abscess of right ventricle': 1, '-right-handedness': 1, 'dilation of right atrium and right ventricle': 1, 'Fibroma of the right ventricle': 4, 'Venous bullet embolism to the right ventricle': 1, 'right fornix lesion': 1, 'right atrial (RA) and right ventricle': 1, 'hypertrophic left and right ventricles': 1, 'RV dominant': 1, 'RV thrombosis': 4, 'RV hypotrophy': 3, 'stenosis of the mid-right ventricle': 1, 'RV stenosis': 1, 'human rights defenders': 1, 'RV EF': 1, 'right dactylus': 1, 'dilated RVID': 1, 'RVID dilation': 1, 'right upper lobe (RUL) consolidation': 1, 'fatigue of the right ventricle': 1, 'atrium and right ventricle (RV) dilation': 1, 'in right': 2, 'RV Fibroadiposis': 1, 'SCC of the right mandibulargingiva': 1, 'sporadic myxoma of the right ventricle': 1, 'dilation of the right atrium and right ventricle': 2, 'hypoplasia of right ventricle': 8, 'Morphological abnormalities of the right ventricle': 2, 'right cleithrum': 1, 'right ventricle hyperplasia': 3, 'right ventricle diverticulum': 3, 'right ventricle systolic and diastolic dysfunction': 1, 'PRRPs': 1, 'diverticular dilatations of the RV': 1, 'right ventricle anomalies and': 1, 'of right ventricular systolic': 1, 'dilatation of right atrium and right ventricle': 1, 'restrictive RV physiology': 1, 'abnormalities of the RV': 1, 'Hypoplasia of RV': 1, 'short right thumb': 2, 'right hemiparkinsonians': 1, 'enlargement of right atrium and right ventricle': 1, 'RV-pulmonary vascular dysfunction': 1, 'Defense of values and rights': 4, 'RIGHT ECC': 1, 'hypoplasia of the right external nucleus arcuatus': 1, 'right trochleitis': 1, 'collapse of the RV': 1, 'of RGEV': 1, 'functional disorders of the right ventricle': 1, 'in the right': 2, 'compression of the right lateral ventricle': 3, 'Right Ventricle Systolic Dysfunction': 1, 'unilateral dilatation of the right lateral ventricle': 1, 'fibroma of the right ventricle': 1, 'Civil Rights': 3, 'Aorta to the right ventricle fistula': 1, 'RV maladaptation': 4, 'RHC-EC': 1, 'Right MYO': 1, 'Aneurysm of the right ventricle': 3, 'of the right cardiac ventricle': 1, 'RVEDVI': 2, 'and volume overload of the right ventricle': 1, 'Right lobe': 1, 'Right Lobe': 1, 'Right Ventricular Apical Hypoplasia': 1, 'left ventricle to right atrial communication': 1, 'hypertrophic/dilated right ventricle': 1, 'depressed RV function': 7, 'RV outflow stenosis': 1, 'dysfunction of right and/or left ventricle': 1, 'right hemiparaplegia': 1, 'hypoplasia of the ventricles': 3, 'aorta to right ventricle fistulas': 1, 'RV dysfunctionSymptoms': 1, 'RV volume overloadRHF': 1, 'RV muscle resection': 1, 'dilations of the RV': 1, 'RV persistent impairment': 1, 'thrombi of the right ventricle': 1, 'pseudo aneurysm of the right ventricle': 1, 'RV metastasis': 4, 'RIGHTS OF BELIEF': 1, 'hypoplasia of both the ventricles': 1, 'right or left ventricle': 1, 'RRCIA': 1, 'civil and human rights violations': 3, 'Echinococcus cyst of the right ventricle': 1, 'LV diastolic and RV dysfunction': 1, 'Loss of Righting': 2, 'Coronary fistulae-right ventricle': 1, 'hypoplastic morphologic right ventricle': 1, 'right ventricle (RV) outflow defects': 1, 'overloaded RV': 1, 'RV hypertrophic': 4, 'right ventricle (RV) collapse': 5, 'anomaly of the right': 1, 'fibrosis of right ventricle': 1, 'CAU.R': 1, 'RV Disease': 1, 'NHRI': 1, 'Systolic dysfunction of the systemic right ventricle': 1, 'RCC': 6, 'impaired right ventricle systolic function': 1, 'hypoplasia of the right inferior colliculus': 1, 'SV dysfunction': 1, 'right hemiparesthesia': 1, 'right hippocampus': 1, 'Ventricle (RV) Hypertrophy': 1, 'RIGHT CENSORING': 1, 'right ventricle (SRV) failure': 1, 'Sympathetic dysfunction of systemic right ventricle': 1, 'SRV cardiomyopathy': 1, 'Right hypochrondrium syndromes': 1, 'hypoplasia of either the right or left ventricle': 1, 'Right Ventricle Hypoplasia': 1, 'Left atrial and right ventricle dilatation': 1, 'right ventricle deficiency': 1, 'Rights': 2, 'property rights': 1, 'right ventricular (RV) enlargement': 3, 'ERC': 2, 'fibrous diverticulum of the right ventricle': 2, 'RIGHT CONTEXT': 2, 'right ventricle outflow abnormalities': 1, 'RV volume overloading': 2, 'right carpal scaphoid fracture': 1, 'RLDN': 2, 'dilatation of the left atrium and right ventricle': 1, 'RV structural defect': 1, 'RV aneurysmal development': 1, 'right ventricle ischaemia': 2, 'right trapezium hypotrophy': 1, 'right hemianacousia': 2, 'fracture of the right scaphoid': 4, 'Right hemipenis': 4, 'Adipose dysplasia of the right ventricle': 1, 'right ventricle function impairment': 1, 'RFP': 1, 'abnormalities in right ventricle': 1, 'Dysfunctional Right Ventricle': 1, 'right and left ventricle necrosis': 1, 'hypoplasia of the right carotid canal': 2, 'hyperplasia of the right ventricle': 1, 'RV physiology': 6, 'tricuspid valve and RV hypoplasia': 1, 'RV hypoplasia and hypertrophy': 1, 'hypoplastic and hypertrophic RV': 1, 'mRVP': 1, 'LARGE RIGHT VENTRICLE': 1, 'right ventricle (RV) hypoplasia': 5, 'LL-RL[N': 1, 'LL-RL': 1, 'structural abnormalities of the right ventricle': 16, 'wall lesion of the right ventricle': 1, 'right hemisyndrome': 3, 'dislocation to the right ventricle': 1, 'hypoplasia of right hepatic lobe': 1, 'abnormalities in RV function': 2, 'right frontomesial lesion': 1, 'in the right ventricle': 1, 'morphological abnormalities in the right ventricle': 1, 'of the right lateral ventricle': 1, 'RV diastolic': 1, 'stenosis in the right ventricle': 1, 'RIGHT SUPPLIES': 1, 'right hand hypoplasia': 1, 'developmental defect of the right': 1, 'Dilation of the right ventricle': 2, 'left ventricle (LV) systolic/diastolic and right ventricle (RV) dysfunction': 1, 'RIGHT-HANDEDNESS': 4, '-right ventricle fistula': 3, 'akinetic RV': 2, 'akinesis of the RV': 2, 'RVS': 1, 'RV and LV disease': 1, 'Undercounted human rights violations': 1, '-inlet right ventricle': 1, 'RV contractile': 1, 'LRHC': 2, 'Hypokinetic RV': 1, 'RHA': 1, 'Myxoma of right ventricle': 1, 'ventriculocoronary (RV-coronary) fistulas': 1, 'RRV': 1, 'Postinfarct refractory right ventricle': 1, 'RV and LV dysfunctions': 1, 'tamponade of the right ventricle': 1, 'right ventricle (RV) abnormalities': 7, 'Ventricle Right Disease': 1, 'Dysfunction of right ventricle': 1, 'PHRI': 2, 'right leg': 11, 'aneurysm of the RV': 1, 'Right HF': 2, 'RV stressed': 1, 'right ventricle disfunction': 4, 'RV fibroelastoma': 2, 'dilation of the right atrium and/or ventricle': 1, 'fRV enlargement': 1, 'fRV dysfunction': 1, 'Diastolic dysfunction of the RV': 2, 'righting': 3, 'depressed RV': 1, 'isolated right ventricle hypoplasia': 1, 'isolated right ventricular hypoplasia': 2, 'hypoplasia of right ventricle apex': 1, 'Hypo-plastic right ventricle': 1, 'Isolated right ventricle hypoplasia': 3, 'CONGENITAL PAPYRACEOUS RIGHT VENTRICLE': 1, 'MYOCARDIUM OF THE RIGHT VENTRICLE': 1, 'RIGHT TRANSPERITONEAL APPROACH': 1, 'RV Subclinical Dysfunction': 1, 'RUL) consolidation': 1, 'Isolated Right Ventricular Hypoplasia': 1, 'Isolated right ventricular (RV) hypoplasia': 2, 'TLRH': 1, "left ventricle-right atrium (Gerbode's) defect": 1, 'right ventricle (RV) condition': 1, 'PRITS': 1, 'impairment of systolic right ventricle function': 1, 'RV myxoma': 7, 'IVC': 1, 'patent IVC': 1, 'RPL': 5, 'right ventricular (RV) overload': 1, 'RV torsion': 1, 'systolic overloading of the right ventricle': 2, 'RTP': 2, 'RV failurewith': 1, 'RV failureenhanced': 1, 'LV and RV hypertrophy': 2, 'RGC': 1, 'left ventricle-right atrium defect': 1, 'right ventricle abnormality': 7, 'RVD right ventricle abnormality': 1, 'abnormal RV systolic': 1, 'right microopthalmia': 1, 'Right ventricle (RV) strain': 1, 'RV decline': 1, 'individual rights': 1, 'SRVs': 1, 'RIGHT CHOICE': 4, 'structural abnormalities in the right ventricle': 3, 'hypoplasia of the right hand': 2, 'ventricle (RV) pressure overload': 5, 'left ventricle (LV) < right ventricle (RV) disproportion': 1, 'alt-right': 1, 'Alt-right': 1, 'RV distension': 6, 'right ventricle (RV) dysplasia': 1, 'sRLL': 1, 'sRUL': 1, 'RAA': 1, 'RV replacement': 1, 'loss right eara': 1, 'RHS': 2, 'fracture of the right naviculum': 1, 'right-ventricle endocarditis': 1, 'Right ventricle lipoma': 1, 'RV-LV dysfunctions': 1, 'right ventricular cavity hypoplasia': 2, 'weakness of the right ventricle': 1, 'right ventricle': 1, 'Right ventricle': 2, 'fracture of right': 2, 'hypoplasia of the right arteria pulmonalis': 1, 'dysfunction in the right ventricle': 1, 'right-ventricle (RV) lesions': 1, 'right-ventricle hypoplasia or dysfunction': 1, 'arrhythmic dysplasia of the right ventricle': 1, 'RV-Dys': 1, "RLLD's": 1, 'swollen right leg': 1, 'dilation of right atrium and ventricle': 2, 'AHRC': 2, 'ruptures of the right atrium and left ventricle': 1, 'familial RV cardiomyopathy': 1, 'RV noncompaction cardiomyopathy': 1, 'idiopathic RV cardiomyopathy': 1, 'volume loss of right hemithorax': 1, 'right quadranopia': 1, 'RPM': 2, 'right ventricle damage': 5, 'RV function deterioration': 4, 'RV to abdomen fistula': 1, 'Suppression of the Right Ventricle': 1, 'Functional impairment of the right ventricle': 1, 'hypoplasia of right lower limb': 1, 'non-right-footedness': 1, 'Non-right-': 1, 'right-footedness': 3, 'RV or LV': 1, 'rPT': 1, 'right hypochondrium': 1, 'RV Right': 1, 'RV disease.3': 1, 'RV systolic function': 2, 'Defence of rights': 1, 'of Right': 1, 'Right ventricle (RV) enlargement': 1, 'RT': 2, 'fracture of the right lib': 1, 'Rhabdomyoma of the right ventricle': 2, 'Right ventricle toxicity': 1, 'dilated right ventricle': 1, 'ventricle hypoplasia': 7, 'RV amyloid infiltration': 1, 'RV amyloidosis': 1, 'hypoplasia of the right lobe of the thyroid': 1, 'Desmosomal Disease of the Right Ventricle': 1, 'morphologic disease of the right ventricle': 1, 'RV desmosomal disease': 1, 'reduction of LV and RV': 1, 'right hemiparestesia': 1, 'Right ventricle apical diverticulum': 1, 'economic rights violations': 1, 'Social/civil rights violations': 1, 'RV pressure-overload': 1, 'apical obstruction of the right ventricle': 1, 'right ventricle abnormal function': 1, 'left ventricle (LV) and/or right ventricle (RV) dysfunction': 1, '-compaction of the right ventricle': 1, '-chambered right ventricles': 1, 'hypoplasia of either ventricle': 1, 'right arm and right handgrip weakness': 1, 'right hemidystonia': 3, 'kinetic abnormalities of the right ventricle': 1, 'violence of human rights': 1, 'RV end-diastolic enlargement': 1, 'RV occlusion': 1, 'Primary neuroendocrine tumour of the right ventricle': 1, 'RMS of the right ventricle': 1, 'human rights violence': 1, 'ventricle right ventricle': 1, 'Human rights breaches': 1, 'Cavernoma of the Right Lateral Ventricle': 1, 'RV hemodynamic dysfunction': 1, 'right radial hypoplasia': 1, 'RV-AP impairment': 1, 'anomalies in the right or left ventricle': 1, 'RV fibroelastosis': 1, 'right-ventricle insufficiency': 1, 'condition of the right ventricle': 1, 'R-NC': 2, 'functional overload of the right ventricle': 1, 'RMB': 5, 'right ventricle (': 2, 'RV dysfunction and insufficiency': 1, 'LV and RV contraction': 1, 'right hypochondrium syndrome': 5, 'right ventricle ischemia': 4, 'infundibular obstruction of the right ventricle': 1, 'enlargement of right atrium and ventricle': 1, 'Right Ventricle Mechanical Dysfunction': 1, 'RV tachycardias': 3, 'compression of the right ventricle and pulmonary artery': 1, 'obstructions of the right ventricle': 1, 'rtGM': 1, 'Right ventricle injury': 3, 'LV and RV pathologies': 1, 'myocardial damage of the right ventricle': 1, 'atrium, and right ventricle': 1, 'RH and': 1, 'of right ventricle and pericard': 1, 'impairment of RV systolic': 1, 'human rights crime': 3, 'right-leg fracture': 1, 'obstructive bundle of the right ventricle': 1, 'RV myocardial deformation': 1, 'RV derangements': 1, 'RV and left ventricle (LV) dysfunction': 2, 'hypertensive right ventricle': 4, 'hypertensive RV': 4, 'ERHC': 2, 'Right ventricle collapse': 6, 'right ventricle dilatation and/': 2, 'rv': 2, 'infection of the septum or the right ventricle': 1, 'injury of the heart right ventricle': 1, 'distension of right ventricle': 1, 'distension of the right ventricle': 1, 'DRV': 2, 'Non-compaction of the right atrium and left ventricle': 1, 'hypoplasia of ventricle': 2, 'RV (right ventricle) systolic dysfunction': 1, 'Right ventricular (RV) remodeling': 1, 'anomalous muscle bundle in the right ventricle': 1, 'SSMR': 1, 'atrial or RV enlargement': 2, 'Dysfunction of the systemic right ventricle': 2, 'aorto-right atrium and ventricle fistula': 1, 'hypertrabeculated right ventricle': 1, 'RV and LV': 1, 'Handedness - right': 1, 'Left ventricle to right ventricle size': 1, 'RV arrhythmias': 8, 'hemodynamic impairment of RV': 1, 'malfunction of the right ventricle': 1, ', rights': 1, 'RLA': 1, 'RV complications': 1, 'Compression of the right ventricle': 1, 'hepatolithiasis of the right': 1, 'RPSD': 1, 'RVEF': 1, 'right upper lobe': 5, 'right ventricle dysfunction and injury': 1, 'RV dilation or': 1, 'deformity of right tragus': 1, 'Hypoplasia of both right ventricles': 1, 'fatty replacement of the right ventricle': 1, 'Fatty replacement of the right ventricle': 1, 'civil rights': 2, 'Fibroelastosis of the right ventricle': 1, 'systolic and diastolic dysfunction of RV': 1, 'systolic and diastolic dysfunction of the right ventricle': 2, 'right ventricle conduction delay (Brugada) syndrome': 1, 'RIGHT HEART VENTRICLE': 1, 'left ventricle-to-right ventricle disproportion': 1, 'LV/RV disproportion': 1, 'left ventricle-to-right ventricle (LV/RV) disproportion': 1, 'hypoplastic right ventricle Developmental delay': 1, 'Right Ventricle (RV) impairment': 1, 'right frontal ischaemia': 1, 'swelling of the right palate': 1, 'Congenital marked hypoplasia of the right atrial and ventricular myocardium': 1, 'left and right ventricle dysfunction': 8, 'hypoplasia of the right': 5, 'RV fibrosis and dysfunction': 2, '-right ventricle anomalies': 1, 'right ventricle (sRV) failure': 1, 'Right atrium and ventricle dilatation': 1, 'Congenital hypoplasia of right ventricular myocardium': 1, 'right hemipalsy': 1, 'intracardiac (in both the right ventricle and right atrium) thrombosis': 1, 'Defence of such rights': 1, 'right or left ventricular hypoplasia': 4, 'right ventricle dysfunction or injury': 1, 'abnormalities of RV, valve': 1, 'RV dependent coronary circulation': 1, 'contractile dysfunction of right ventricle': 1, 'systole-diastolic dysfunction of right ventricle': 1, 'xanthogranuloma of the right lateral ventricle': 1, 'right motor deficiency': 1, 'RV overdistension': 1, 'RV myocardial function': 1, 'Right Ventricle Impairment': 1, 'RV epi': 1, 'Dysfunction of the right (systemic) ventricle': 1, 'hypoplasia of the ventricular changer': 1, 'Right ventricular systolic hypokinesis': 1, 'hypoplasia of heart ventricle': 2, 'RVMDs': 1, 'right ventricular mechanical delay in systole': 1, 'LDRH': 6, 'right upper quadrant painBilirubin': 1, 'rupture of right ventricle': 6, 'Conus arteriosus of the right heart ventricle': 1, 'Systolic dysfunction of the right ventricle': 2, 'RV myocardial involvement': 3, 'right-dislocations': 1, 'right-dislocation': 3, 'right dislocations': 1, 'right ventricle myocardial chronic dysfunction': 1, 'Ischemia of right ventricle': 1, 'left ventricle-right atrium shunts': 1, 'compression in the right ventricle': 1, 'Right ACAOS': 1, 'right ACAOS': 1, 'egregious rights violations': 1, 'right ventricle to right atrium': 1, 'LV and RV dilation': 2, 'RV/LV dysfunction': 4, 'dilation of RA/RV': 1, 'RV/LV insufficiency': 1, 'RV diastolic injury': 1, 'RV-PA obstruction': 1, 'CCAM right': 1, 'Congenital diverticula of the right ventricle of the heart': 1, 'dilated right lateral ventricle': 2, 'right heart ventricle': 2, 'clot in right ventricle': 1, 'RV clot': 2, 'thrombosis in right ventricle': 1, 'RV hemodynamic collapse': 1, 'Myxomas of the right ventricle': 2, 'left ventricle (LV) and right ventricle (RV) dysfunction': 1, 'RIGHTS ISSUE': 1, 'aneurysma of right': 1, 'Defects of the right ventricle': 1, 'RGEV': 6, 'to right posterior': 1, 'RV mechanical systole': 1, 'RV) dilatation': 2, 'functional impairment of right ventricle': 1, 'right lateral ventricle': 4, 'laceration of the right ventricle': 5, 'right hemiachromatopsia': 1, 'endocardial endothelioma of the right ventricle': 1, 'Indigenous rights violations': 1, 'Right Ventricle Thrombus': 3, 'RV myocardial injury': 1, 'impairment of RV contractility': 1, 'systolic dysfunction of RV': 1, 'STENOSIS OF THE INFUNDIBULUM OF THE RIGHT VENTRICLS': 1, 'RVLSS': 2, 'hypoplastic diminutive right ventricle': 1, '-of-righting': 1, 'Right Babinski (+). Right pyramidal motor syndrome': 1, 'breach of human rights': 1, 'thrombus in the right atrium and ventricle of the heart': 1, 'RV dysfunction.6': 1, 'deformity of right thigh': 1, 'human-rights violation': 2, 'auricularisation of the right ventricle': 1, 'MRV': 1, 'cutaneous type Right': 1, 'IR': 1, 'RV Impairment': 1, 'RV Dilatation': 1, 'LV-RA shunt': 2, 'traumatic injury to the right ventricle': 1, 'Right ventricular systolic dysfunction19': 1, 'RP': 9, 'hypoplasia of either of the ventricles': 1, 'RSLF': 1, 'RACR': 1, 'IRM': 1, 'Systemic right ventricle': 4, 'RV and LV cardiac abnormalities': 1, 'right ventricle (RV) thrombus': 1, 'RIGHT OF THE ACCUSED': 2, 'Dilated right heart ventricle': 1, 'Right ventricle abnormalities': 1, 'systolic and diastolic dysfunction to the right ventricle': 1, 'RV-dyskinesis': 1, 'Dysfunction of the RV': 3, 'Right Ventricle Stroke': 2, 'RVFAC': 5, 'human rights transgressions': 1, 'of Right Ventricle': 1, 'right ventricular (RV) diastolic collapse': 1, 'RV syndromes': 1, 'right eye hypoplasia': 1, 'hypertrophic and dilated right ventricle': 1, 'human rights violations': 1, 'Right hemipelvis': 1, 'Hypoplastic Right Ventricle': 4, 'RV Right Ventricle': 1, 'hypoxia of the right ventricle': 1, 'dyskinetic right ventricle': 2, 'RIC': 1, 'not just right" (NJR) obsessions': 1, 'Right-Handedness': 2, 'rIPL lesions': 1, 'Pulmonary embolismSplenic artery and left atrium and right ventricle thrombosisAortic thrombosis': 1, 'right ventricle (RV) involvement': 1, 'dilated heart right ventricle': 1, 'LRA': 2, 'RVIP': 1, 'hypoplasia of one of the ventricular cavities': 1, 'RV disruption': 1, 'hypoplasia of the right sinus': 1, 'hypoplasia of the right mandible': 1, 'CRL': 2, 'disease of right ventricle': 1, 'fibrofatty degeneration of right ventricle': 1, 'right ventricle obstructive disorders': 1, 'pectus on the right ventricle of the': 1, 'RHCPD': 2, 'RV heart dysfunction': 1, 'RV dysfunction and': 3, 'right lateral ventricle collapse': 1, 'RIGHT KIND OF HELP': 1, 'RIGHT SPIRIT': 1, 'VT Right ventricle': 1, 'Right ventricle vegetation': 1, 'right ventricular and tricuspid hypoplasia': 1, 'systolic overload of the right ventricle': 2, 'RV FAC': 1, 'HRVs': 11, 'structural abnormalities of right ventricle': 1, 'right upper lobe syndrome': 2, 'Cardiac hemangioma of the right ventricle': 1, 'RV-': 4, 'right hemianesthesia': 1, 'right ventricle tumour': 1, 'LGE RV': 1, 'Intramyocardial hemangioma of the right ventricle': 1, 'Swollen right extremity': 1, 'Bleeding from the right ventricle': 1, 'hypoplasia of the right lobe': 2, 'right frontal sulcus': 1, 'RV cavity dilation': 2, 'RLF': 3, 'right limping': 1, 'Disorders of the right ventricle': 1, 'Hypertrophic RV': 1, 'RV-CMP': 1, 'compression of the RV': 1, 'right ventricle dilatation and': 1, 'right hemihypesthesia': 1, 'hypoplasia of the right internal jugular vein': 1, 'functional impairment of the left and right ventricle': 1, 'Right ventricle (RV) outflow tract obstruction': 1, 'RV masses': 1, '(RV) mass': 1, 'the pulmonary valve and right ventricle': 1, 'RV-LV asymmetry': 1, 'RV functional damage': 1, 'RV injuries': 1, 'aorto-right ventricle fistula': 1, 'right arteria lusoria': 1, 'arrhythmogenic cardiopathies of the right ventricle': 1, 'dislocation of the right eyeball and': 1, 'muscular obstruction of the right ventricle': 1, 'RPD': 4, 'Right ventricle (RV) thrombus': 2, 'DRVS': 1, 'RVNC': 1, 'right ventricle limitation': 1, 'stunning of the RV': 1, 'Right ventricle diastolic dysfunction': 3, 'hypoplasia of the right iliofemoral system': 1, 'SRH&HR': 1, 'dilated left or right ventricle': 1, 'Fibrosis of right ventricle': 1, 'cRH': 1, 'NcRH': 1, 'RIGHTS CONSIDERATIONS': 1, 'pressure overloaded right ventricle': 5, 'arrhythmic right ventricle cardiomyopathy': 2, 'SCC right upper': 1, 'PC': 1, 'righting imperfection': 1, 'sRV dyssynchrony': 1, 'sRV systolic dysfunction': 1, 'LV and sRV dysfunction': 1, 'sRV dilatation': 1, 'RPMC': 1, 'human rights disaster': 1, 'RV myxomas': 1, 'right and/': 1, 'ventricular and myocardial hypoplasia': 1, 'eRHC': 1, 'RV transient dysfunction': 1, 'RV myocardium': 2, 'CFR': 2, 'necrosis of the right ventricle': 1, 'ischaemic dysfunction of the right ventricle': 1, 'tumour of the right lateral ventricle': 1, 'aneurysms of the RV': 1, 'Right ventricle (RV) systolic dysfunction': 2, 'Cavitation at the right upper lobe': 1, 'right ventricle (sRV) dilatation': 1, 'tract stenosis of the right ventricle': 1, 'RV cardiomiopathy': 1, 'ANT': 1, 'akinesis of left and right ventricle': 1, 'hypoplasia of the right lower pulmonary lobe': 1, 'RV reactive fibrosis': 1, 'RV stiffness': 4, 'RV stiffness and dysfunction': 1, 'RV overloaded': 1, 'LV or RV enlargement': 1, 'RV and LV diseases': 1, 'right-lateral thoracalgia': 1, 'PBR': 1, 'Stenosis of the right ventricle': 3, 'HRs': 1, 'HRW': 1, 'UHRC': 1, 'RV or LV hypoplasia': 3, 'Rt': 1, 'impairment of the RV function': 1, 'Postero-lateral Right': 1, 'RV anomaly': 3, 'Aneurysms of the right ventricle': 1, 'dysfunctional right ventricle': 4, 'right upper quadrant painof': 1, 'RIGHT PULMONARY HYPOPLASIA': 1, 'and mixed overloads of the right ventricle': 1, 'TCPC': 1, 'RIGHT DATA': 1, 'PD-RC': 1, 'RV impaired function': 1, 'Congenital right coronary fistula to right ventricle': 1, 'Dysfunction of the Right Ventricle': 2, 'right face hypoplasia': 1, 'right hemilingual hypoplasia': 1, 'hypofunction of right ventricle': 1, 'right fasciculus': 1, 'Dilated left and right ventricles': 1, 'Lesion of the Right Amygdala': 1, 'Loss-Of-Righting-': 1, 'right axillaryarrhythmia': 1, 'RV ectopy': 1, 'RV (systemic ventricle) dysfunction': 1, 'lesion of the right ventricle': 1, 'malacia of the right bronchus': 1, 'RE': 1, 'right ventriclemultiple': 1, 'right ventricleright': 1, 'right upper lobe (RUL)': 2, 'right ventricle (SRV) dysfunction': 1, 'pressure overload of right ventricle': 1, 'right groin lipoma': 1, 'RV injury to the': 1, 'Dilatation of right atrium and ventricle': 1, 'enlargement of the right ventricle and pulmonary artery': 1, 'Isolated right ventricular noncompaction': 1, 'thrombosis of the left or right ventricle': 1, 'SE;Right': 1, 'HDD{rv': 1, 'fibro-fatty replacement of RV': 2, 'right-upper': 1, 'RV - right ventricle': 2, 'ruptures of the right ventricle': 1, 'myxofibrosarcoma of the right ventricle': 1, 'myxofibrosarcoma of the RV': 1, 'RV function impairment': 5, 'RV midcavitary obstruction': 1, 'dilation of IFV': 1, 'Right atrium or Right ventricle (RV) collapse': 1, 'fracture of right raidus': 1, 'valve and ventricle hypoplasia': 1, 'RV tumor': 3, 'Right ventricle (RV) metastasis': 1, 'right lower quadrant (': 1, 'RV structural abnormalities and': 1, 'LV-RV dyssynchrony': 1, 'left ventricle or right ventricle outflow tract obstruction': 1, 'Diastolic right ventricle collapse': 2, 'RA or RV diastole collapse': 1, 'aorta-right ventricle fistula': 1, 'anomalous right ventricle muscle bundle': 1, 'deformity of the right thump': 1, 'human rights-': 1, 'ILPs': 1, 'RV restrictive': 1, 'RV restrictive physiology': 1, 'aorta-to-RV fistula': 1, ', electrical, and pathological abnormalities of the right ventricle': 1, 'structural and functional abnormalities of the right ventricle': 4, 'Right Bias': 1, 'right eyeball': 1, 'right atrium and ventricle diastolic collapse': 1, 'RV tumour': 2, 'Right and left pulmonary hypoplasia': 1, 'right hemithyroid': 1, 'duration loss of righting': 1, 'Myocardial dissection in infarction of the right ventricle': 1, 'pRHC': 1, 'Right sensory-motor syndrome': 1, 'RAC': 2, 'RV wall perforation': 1, 'right ventricle (RV) perforation': 3, 'RV function abnormal': 1, 'RV volume overload enlargement': 1, 'right atrium or right ventricle tumour': 1, 'right lateral ventricle entrapment hydrocephalus': 1, 'RUQ (': 1, 'right ventricle/left ventricle disproportion': 1, 'right lower extremity': 1, 'right hemiagenesis': 1, 'and functional abnormalities of the right ventricle': 2, 'RLL involvement': 1, 'right hemiplasia': 1, 'small right ventricle': 1, 'abnormalities of RV function': 3, 'tRVAD': 1, 'myocardial infarction of the right ventricle': 1, 'Right ventricle regional dysfunction': 1, 'RV branch occlusion': 1, 'Right ventricular (RV) ischemia': 1, 'RVO': 1, 'RV opacification': 1, 'Dysplasia of the right ventricle': 1, 'righting syndrome': 1, 'cleft of the right nostril': 1, 'of the right atrium and ventricle': 1, 'ruptures of ventricular septum, right ventricle': 3, 'Impairment of RV systolic function': 1, 'hypoplasia of the right or left ventricular apex': 1, 'Isolated ventricular apical hypoplasia': 1, 'IVAH': 1, 'orifice right ventricle': 1, 'atrialised right ventricle': 1, 'dilated left and right ventricle': 1, 'hyperplastic right ventricle': 1, 'right ventricle (RV) arrhythmias': 1, 'AF of the right': 1, 'fracture of the right hemimandible': 1, '(RV) systole': 1, 'pygmy right whale': 2, '-right-ventricle fistulae': 1, 'ROF': 1, 'RST': 1, 'deformity of the right eyeball': 1, 'ADRMS': 1, 'LV or RV edema': 1, 'enlargement of the RV': 5, 'RTD': 2, 'Right Bowhunter syndrome': 1, 'isolated right ventricular (RV) hypoplasia': 1, 'fracture of the right ischiopubic ramus': 1, 'RIGHT PRECORDIUM': 2, 'Hypoplasia of the Right Limbs': 1, 'Chronic overload of the right ventricle': 1, 'dilation of the left and right ventricles': 2, 'dilation of RA, right ventricle': 1, 'hypoplasia of the left and right ventricles': 1, 'right ventricular (RV) infarction': 1, 'right ventricle enlargementwas': 1, 'right ventricle straining': 1, 'fracture right': 1, 'absence or hypoplasia of right A1': 1, 'Right Ventricle Dependent Coronary Circulation': 1, 'Right ventricle dependent coronary circulation': 1, 'RV-pulmonary vasculature dysfunction': 2, 'RV diastolic disturbances': 1, 'impairment of RV performance': 1, 'PASP': 2, 'obstruction to RV': 1, 'systolic dysfunction of the systemic right ventricle': 2, 'Civil rights': 1, 'RTLE': 2, 'right TLE': 1, 'right ventricle (RV) chronic overload': 1, 'right phrenic nerve (': 1, 'right-ACAOS': 1, 'Right-ACAOS': 1, 'right ventricle with dysfunction or enlargement': 1, 'osteodural right tegmenal defect': 1, 'malformations of the left or right ventricle': 1, 'right atrium (RA) and right ventricle (RV) myxoma': 1, 'Right ventricularhypertrophy': 1, 'primary liposarcoma of the right ventricle and pulmonary artery': 1, 'Primary liposarcoma of the right ventricle and pulmonary artery': 1, 'Dilated right ventricle of the heart': 1, 'right lobe hypoplasia': 1, 'NHRCT': 1, 'RV volume and pressure overload': 1, 'hypoplasia of right fourth metacarpal': 1, 'RV or LV outflow obstructions': 1, 'RV overloading': 3, 'pressure overload to the right ventricle': 1, 'aneurysmal dilatation of the RV': 2, 'aneurysmal dilatation of RV': 1, 'RVSF': 1, 'Right ventricle hypoplasia': 3, 'RV global systolic dysfunction': 1, 'two-chambered right ventricle': 2, 'TCRV': 2, 'RV-FS': 1, 'Hypoplasia of right lower limb Joints': 1, 'atrial and RV dilation': 1, 'RV volume load': 1, 'right ventricle akinesis': 1, 'overload of the right atrium and ventricle': 1, 'RV dysfunctiona': 1, 'tricuspid and RV hypoplasia': 1, 'RV and LV Hypoplasia': 1, 'hypoplasia of RV': 2, 'loss of the right eyesight': 1, 'Right phrenic nerve (': 1, 'Mechanical alternans of the right ventricle': 1, 'LV- and right ventricle (RV)-insufficiency': 1, 'Intracardiac thrombosis of the right cardiac ventricle': 2, 'malformation of the right or left ventricle': 1, 'right and left ventricle': 1, 'RIMA': 2, 'RVP': 3, 'fracture of the right calcaneum': 1, 'Just Right': 1, 'Congenital hypoplasia of the right pelvis': 1, 'RV infiltration': 2, 'RIGHT INTERACTOME': 1, 'RVM': 2, 'right-ventricle (RV)': 1, 'of right atrium and ventricle': 1, 'CIRV': 1, 'dual-outflow right ventricle': 1, 'DORV': 1, 'ruptured right ventricle': 1, 'RV image': 1, 'RV or': 1, 'hypoxic RV': 1, 'Hypoxic right ventricle': 1, 'right ventricle pressure (RVP) overload': 1, 'RHRT': 1, 'hypertrabeculation of the right ventricle': 1, 'right-hemiparetic': 3, 'LV-RV aneurysm': 1, 'RV systolic dysfunctionRV': 2, 'ventricular (RV) strain': 1, 'abnormalities of RV size,': 1, 'right ventricle (RV) abnormality': 2, 'RIGHTS MOVEMENT': 1, 'RVIDD': 1, 'rhabdomyoma right ventricle': 1, 'Opened right ventricle': 1, 'ventricle) and RV (right ventricle) dilation': 1, 'compression of the right atrium and ventricle': 1, 'human rights utopia': 1, 'ventricular (RV) enlargement': 1, 'right ventricle (sRV) dysfunction': 2, 'rTPJ': 3, 'rTPJ ToM': 1, 'social and human rights violation': 1, 'Dilated RV': 1, 'RIGHT COLECTOMY': 3, 'AWCR': 2, 'pseudotumor of the right ventricle': 1, 'RV and LV dilations': 1, 'ventricular (RV and LV) dilations': 1, 'systemic right ventricles': 1, 'anomalies of the RV myocardium': 1, 'RIGHT EXTRAPLEURAL LAPARO-PHRENO-THORACOTOMY': 1, 'atrial and right ventricle dilatation': 1, 'SRV systolic dysfunction': 1, 'of right ventricle and LV': 1, 'heterotopias of the right ventricle': 1, 'RIGHT NUMBER OF VARIANTS': 1, 'RV diastolic chamber enlargement': 1, 'hypokinesia at right ventricle': 1, 'left atrium and right ventricle thromboses': 1, 'Hemangioma of the right ventricle': 2, 'dysfunction of the left ventricle and right ventricle': 1, 'dyskinesia of right ventricle': 1, 'Hypoplasia of right frontal sinus': 1, 'and diastolic dysfunction of the right ventricle': 1, 'RLP': 1, '(RUL)': 1, 'human rights exploitation': 1, 'LLDRH': 1, 'hypoplasia of the first right metacarpal': 1, 'RVCMs': 1, 'RV Arrhythmogenesis': 1, 'RV structure abnormalities and dysfunction': 1, 'RPWD': 1, 'type III HRV': 1, 'type I HRV': 1, 'atrial right ventricle thrombus': 1, 'right atrium and ventricle enlargement': 2, 'left ventricle (LV)/right ventricle (RV) dysfunction': 1, 'RV aneurysms and': 1, 'hypoplasia of the RV outflow': 1, 'Dysfunction of either the right or left ventricle': 1, 'Dysfunction of the right or left ventricle': 1, 'atrophy of the RV myocardium': 1, 'Myxofibrosarcoma of the right': 1, 'RV-S': 1, 'Myocardial infarct of the right ventricle': 5, 'RLQ lipoma': 1, 'RUQ lipoma': 1, 'RLDRH': 2, 'RNTK': 1, 'amorphous tumour of right ventricle': 1, 'occlusion of right ventricle outflow': 1, 'right atrium/right ventricle (RA/RV) dilatation': 1, 'RV myocardial abnormalities': 1, 'right ventricle defects': 2, 'dilatation of RV, right atrium': 1, 'right ventricle OMI': 1, 'Right ventricle aneurysm': 2, 'Hypo-plastic Right Ventricle': 1, 'hypo-plastic right ventricle': 1, 'defect of the right': 1, 'right-ventricle cardiomyopathy': 1, 'ME RIGHT': 2, 'Right ventricle restriction': 1, 'right lobe syndrome': 1, 'fistulae to the right ventricle': 1, 'left or right ventricular hypoplasia': 2, 'RIGHT HEMICOLECTOMY IN': 1, 'or right ventricle dilatation': 1, 'left or right ventricle function': 1, 'right ventricle hyposystoly': 1, 'peck right': 2, 'MR': 2, 'developmental anomalies of the right cardiac ventricle': 1, 'RV and TV hypoplasia': 2, 'right ventricle (RV) rupture': 1, 'LRC-': 1, 'RRC-': 1, 'right circumflex': 1, 'hypoplasia of the right branch of the pulmonary artery': 1, 'volume-overloaded right ventricles': 1, 'fatty replacement in the right ventricle': 2, 'ruptures of right ventricle': 1, 'FRCP': 1, 'Arythmogenic displasia of the right ventricle': 1, 'right extremity': 1, 'isolated right ventricle noncompaction': 1, 'dysmorphic right lateral ventricle': 1, 'Righting': 1, 'overgrowth of right ventricle': 1, 'RPPM': 1, 'Resynchronizing Right and Left Ventricles': 1, 'RV lead fracture': 1, 'RRH': 3, 'impairment of right ventricle functions': 1, 'hypoplasia of the right hepatoportal system': 1, 'RV annulus dilation': 1, 'RV and pulmonary vascular': 1, 'RV radial dysfunction': 2, 'right ventricle dysfunctionCongenital': 1, 'RIGHT SYNDROME CAUSED BY': 1, 'right WASP': 1, 'hypoplastic right ventricle syndrome': 4, 'HRVS': 1, 'lateral dislocation of the right': 1, 'Right hemiliver': 1, 'eRL': 1, 'RSPV': 1, 'dyschromia of right': 1, 'right periorbita': 1, 'Isolated fourth ventricle syndrome': 1, 'RV volume deficit': 1, 'right ventricle microaneurysm': 1, 'RV pathologic disease': 1, 'Right ventricle strain': 1, 'Price Is Right': 1, 'Intellectual property rights violations': 1, 'isolated right ventricle (RV) cardiomyopathy': 1, 'RIGHT SENSORS': 1, 'RMLE': 2, 'RIGhT': 1, 'RV failure2': 1, 'Right renal hypoplasia': 2, 'dilated and hypertrophic right ventricles': 1, 'right ventricle outflow defects.3': 1, 'right ventricle outflow': 3, 'fracture of the right astragalus': 1, 'RLL and': 1, 'Right Ventricle Function': 1, 'TRP': 1, 'Righting deficiencies': 1, 'right ventricle pathology': 1, 'LV dilation': 1, 'to right': 2, 'RVPSP': 2, '(and right': 1, 'right lateral ventricle schwannoma': 1, 'right radius hypoplasia': 1, 'mononeurits of right': 1, 'iRVNC 2': 1, 'isolated right ventricular noncompaction': 1, 'hypoplastic left/right ventricles': 1, 'JRP': 1, 'MI right': 1, 'Ventricular hypoplasia of the mRV': 1, 'right ventricular (mRV) hypoplasia': 1, 'mRV hypoplasia': 1, 'LV/RV aneurysms': 1, 'right ventricle (RV) aneurysms': 1, 'hypoplasia of the right internal auditory canal': 2, 'FORs': 1, 'DRL': 1, 'Right ventricle structural and functional abnormalities': 1, 'RIGHT POSTERIOR': 1, 'L-RC': 2, 'dysfunction of the systemic morphologically right ventricle': 1, 'dilation of right ventricle and left atrium': 1, 'diastolic impairment of the RV': 1, 'right ventricle (RV) dysfunction and death': 1, 'dilation of right and left atria and ventricles': 1, 'LV': 2, 'hypoplastic LV volume': 1, 'RV.RRT': 1, 'atresia with hypoplasia of the right ventricle': 1, 'Right ventricle Dyspnea': 1, 'right ventricle (RV) deterioration': 1, 'RIGHT TO TRY': 1, 'Right hemisyndrome': 1, 'right ventricular (RV) fibrosis': 1, 'abnormalities in RV and LV': 1, 'RV myocardial disease': 1, 'abnormalities of RV functions': 1, 'RV (Right Ventricle) ischemia': 1, 'sRV dilation': 1, 'sRVd': 1, 'sRV dilation and': 1, 'right-leg lymphoedema': 1, 'loss of RR': 1, 'PRs': 1, 'upper right lobe': 1, 'right scaptula': 1, 'stenosis of the inlet of the right ventricle': 1, 'right lower lobe (RLL': 1, 'Dyspnea Right ventricle': 1, 'Right ventricle diastolic collapse': 1, 'Right ventricle organized thrombus': 1, 'Idiopathic aneurysm of the right ventricle': 1, 'or right ventricle underdevelopment': 1, 'right atrium and right ventricle dilation': 1, 'right atrium and right ventricle enlargement': 1, 'Muscle dysfunction of the right or left ventricle': 1, 'impairment of LV and RV function': 1, 'right ventricle tear': 1, '-RPS': 1, 'L-RPS': 2, 'R-RPS': 1, 'Intracardiac thrombosis of the right ventricle': 1, 'right to commit suicide': 1, 'WRA': 1, 'Non-right handedness': 1, 'Non-right Handedness': 1, 'hypoplasia of both ventricles': 1, 'RVC': 2, 'RIGHT CENSORED': 1, 'masses in right ventricle': 1, 'right ventricular myocardial hypoplasia': 2, 'hypoplasia of right half of mandible': 1, 'Right ventricle overload': 2, 'dislocation of the right eyeball': 1, 'systolic dysfunction of right and left ventricle': 1, 'systolic dysfunction of right ventricle': 1, 'right-ventricle disease': 1, 'right-ventricle impairment': 2, 'right-ventricle function': 1, 'right ventricular systolic collapse': 1, 'Dysfunction of the right and left ventricles': 1, 'hypoplasia of the right atrium and right ventricle': 1, 'hypoplasia of RA and RV': 1, 'right-lobe hypoplasia': 1, 'traumatic dislocation of right testicle': 1, 'RHP': 1, 'RV4LS': 1, 'grimace;right': 1, 'Pressure overload of the RV': 2, 'obstruction of the left or right ventricle': 1, 'hypoplasia of the right foot': 3, 'Angiofibrosarcoma of the right heart ventricle': 1, 'violation of intellectual property rights': 1, 'RV chamber abnormalities': 1, 'diseased right ventricle': 2, 'systolic impairment of the right ventricle': 1, 'stenosis of the right ventricle, outflow': 1, 'of the right nerve': 1, 'upper right': 1, 'hypoplasia of the right pinna': 1, 'ventricular hypoplasia syndrome': 1, 'hypoplasia of the right ventricular muscle': 1, 'Hypoplastic left or right ventricle': 1, 'developmental defects in the right ventricle': 1, 'LV-RA fistula': 1, 'NR': 1, 'RMS': 2, 'RV systolic and diastolic dysfunctions': 1, 'Right hemichorea': 1, 'RV and pulmonary vasculature dysfunction': 1, 'right ventricle (RV) fibrofatty': 1, 'Hypoplasia of the right': 1, 'ventricle; RVH:Right ventricle hypertrophy': 1, 'Intracardiac [right atrium/right ventricle]': 1, 'MYOCARDIAL RIGHT': 1, 'agenesis/hypoplasia of the right pectoral muscle': 1, 'right ventricle non-compaction': 1, 'BHR': 1, "'s human rights": 1, 'LV and RV enlargement': 2, 'RIGHT SECTION': 1, 'isolated ventricle syndrome': 1, 'enlargement of the right atrium and ventricle': 1, 'loss of righting due': 1, 'RVN': 1, 'defective right ventricle': 1, 'right ventricle (RV) function impairment': 1, 'right hemitrigone': 1, 'Ischemia right ventricle': 1, 'right leg paraesthesias': 1, 'right ventricle (RV) depression': 1, 'Right hemicolon': 2, 'Myxomatosis of the right ventricle': 1, 'rupture of the right ventricle and diaphragm': 1, 'RIGHT VENTRICLE ASSIST DEVICE': 1, 'decreases in RV function and cardiac': 1, 'right/left ventricle hypoplasia': 1, 'dilatation of right ventricle (RV) and': 1, 'hypoplasia of the right ventricle of the heart': 2, 'pleomorphic sarcoma of the right ventricle': 1, 'RV dilation and': 1, 'fibro-fatty infiltration of right ventricle': 1, 'ARV-NOR': 1, 'abnormal RV': 1, 'RV dilatation RV hypertrophy': 1, 'fracture of right clavicula': 1, 'righting defects': 1, 'right ventricle dependent coronary circulation': 2, 'RQ': 3, 'RV failure5': 1, 'Right leg': 1, 'RV stunning and dysfunction': 1, 'damage of RV myocardium': 1, 'ischaemic dysfunction of the RV': 1, 'RV I/R': 1, 'Impairment of both right and left ventricle functions': 1, 'anterosuperior diverticula of the right ventricle': 1, 'Anterosuperior diverticula of the right ventricle': 1, 'right upper quadrat': 1, 'right lower quandrant': 1, 'LRRC': 1, 'hypoplastic morphologically right ventricle': 1, 'Right ventricle-pulmonary circulation dysfunction': 1, 'metastasis of the right ventricle': 1, 'stunning of the right ventricle': 1, 'Right ventricle dysplasia': 2, 'right ventricle morphofunctional abnormalities': 1, 'morphological abnormalities in RV': 1, 'Right ventricle - Metastasis': 1, 'RIGHT TO': 1, 'empty right ventricle syndrome': 1, 'right sensory hemisyndrome': 1, 'or RV dilation': 1, 'right ventricle metastases': 1, 'RV blockage': 1, 'hypoplasia of frontal horns of lateral ventricles': 1, 'congenital diverticulum of the right ventricle': 1, 'diverticula of the right ventricle of the heart': 1, 'hypoplasia of the right eyeball': 1, 'dilatation (right or left ventricles': 1, 'RV +': 1, 'Biventricular LV/RV failure': 1, 'LV/RV failure': 2, 'Dilated Obstructed Right Ventricle': 1, 'ischemia of the RV': 2, 'RV ischemia and': 1, 'RIGHT ADRENALECTOMY': 1, 'Obstruction to the right ventricle': 1, 'RV-related disease': 1, 'RV dysfunction-related disease': 1, 'right-ventricular hypoplasia syndrome': 1, 'dilation of the left atrium and right ventricle': 1, 'right ventricle physiology': 1, 'right quadrantopsia': 2, 'SCC Right': 1, 'Hypokinesia of the right ventricle': 1, 'left and right ventricle systolic dysfunction': 1, 'RV restriction': 2, 'RV branch disease': 1, 'hypoplasia of either the right or the left ventricle': 1, 'abnormalities, predominantly of the right ventricle': 1, '(RV)C': 1, 'sclerosis of the right ventricle': 1, 'dysplasia of the RV': 1, 'idiopathic tachycardia of the RV': 1, 'thrombosis of the RV': 1, 'Right atrium and right ventricle enlargement': 1, 'and functional anomalies of the right ventricle': 1, 'acute dysfunction of the right ventricle': 1, 'RVIDd': 1, 'Right hemiparesisApraxiaAphasiaHemianopiaAgraphiaAnosmiaIntroversion': 1, 'Right hemiparesisLimited': 1, 'RV gallop': 1, 'restrictive physiology of the right ventricle': 1, '-RH': 1, 'L-RH': 1, 'RIGHTS-HOLDERS': 1, 'of the right superior colliculus': 1, 'hypokinesia of RV': 1, 'RV and RA dilatation': 1, 'congenital hypoplasia of the right ventricular myocardium': 3, 'Hypoplasia of the right ventricular myocardium': 2, 'myocardial ventricular hypoplasia': 1, 'impaired RV systolic': 1, 'dilated right atrium and ventricle of the heart': 1, 'fatty infiltration of the RV': 1, 'malformed large right ventricle': 1, 'RV ischemic injury': 1, 'volume and pressure overloading of the right ventricle': 1, 'RV injury and dysfunction': 1, 'RVMD': 1, 'right ventricle aorta': 1, 'isolated hypoplasia of the right ventricle': 2, 'pseudohypoplasia of the right ventricle': 1, 'isolated hypoplasia of the RV': 1, 'hypoplastic RV disease': 1, 'defect of the RV': 1, 'LARC': 1, 'right ventricle dysfunction fibrosis and': 1, 'Metastatic liposarcoma of the right ventricle': 1, 'Right HTN': 1, 'RV fatigue': 1, 'right frontopolar lesion': 1, 'Right upper palate': 1, 'pulmonary vascular and RV dysfunction': 1, 'Getting it Right': 1, 'myocardial metastasis in the right ventricle': 1, 'Myocardial metastasis in the right ventricle': 1, 'collapse of the right lateral ventricle': 1, 'LV or RV hypertrophy': 1, 'RV disease.35': 1, 'dilated right lateral ventricles': 1, 'RPS AP': 1, 'CM;RV dysfunction': 1, 'Left ventricle Right ventricle': 1, 'right fabella fracture': 1, 'human rights litigation': 1, 'social and economic rights violations': 1, 'political and civil rights violations': 1, 'Aortic root-to-right ventricle (ARV) fistula': 1, 'ARV fistula': 1, 'ARV fistulas': 1, 'Aortic-to-right ventricle (ARV) fistula': 1, 'Aortic-to-right ventricle fistulas': 1, 'RV STRAIN ANALYSIS': 1, 'RV global and regional dysfunction': 2, 'RV STRAIN': 1, 'RV focal dyskinesia': 1, 'SV to RV': 1, 'H-RT': 1, 'damage of the right ventricle': 1, 'Hypoplasia of the ventricular conduction system': 1, 'right tarsometatarsus': 1, 'right-ventricle damage': 1, 'RMxRT': 1, 'TECHNIQUE OF RIGHT': 1, 'RVMES': 1, 'Congenital coronary fistula to right ventricle': 1, 'Right ventricle impairment': 1, 'and/or right ventricle damage': 1, 'volume overload of Right ventricle': 1, 'Right ventricle (RV)': 1, 'right ventricle neoplasm': 1, 'developmental defect of the right ventricle': 2, 'isolated ventricles': 1, 'fibrosis of RV': 1, 'right leg clonus': 1, 'RV scarring': 2, 'right atrium/ventricle dilation': 1, 'Handedness right': 1, 'hypoplasia of right radial artery': 1, 'Right ventricle (RV) overload': 1, 'RV ischemic dysfunction': 1, 'RV pathological': 1, 'Right and Left Ventricle Dysfunction': 1, 'right ventricle dyskinesia': 1, 'right ventricle (RV) dyskinesia': 1, 'inverted right ventricle': 1, 'RV hyperdilation': 1, 'Isolated LV apical hypoplasia': 1, 'right ventricle non compaction': 1, 'right ventricular (RV) myopathy': 1, 'RV-PAC dysfunction': 1, 'RV-PAC': 1, 'right ventricle-pulmonary artery conduit': 1, 'RV-PAC calcification': 1, 'cardiac lipoma of the right ventricle': 1, 'RV lipomas': 2, 'RV lipoma': 2, 'Myxoma of the right atrium and left ventricle': 1, 'RV Systolic Function': 1, 'RVSB': 1, 'ventricular (RV) volume overload defects': 1, 'CRA': 1, 'Right ventricle (RV) collapse': 1, 'dilation of the right ventricle or pulmonary artery': 1, 'arrhythmia generating syndrome of the right ventricle': 1, 'dysfunction of morphological right systemic ventricle': 1, 'right panplexopathy': 1, 'RV arrhythmic': 1, 'chamber dilation of right atrium and ventricle': 1, 'RV muscle overgrowth': 1, 'RVURI': 1, 'ventricular (RV) volume overload': 1, 'RV regional abnormalities': 1, 'RVL': 1, 'Pipeline Right-': 1, 'defects in the right ventricle': 1, 'dilatation of RA and RV': 1, 'left and right ventricle': 1, 'abnormal right ventricle development': 1, 'Congenital anomaly - fistula to right ventricle': 1, 'atrial and ventricle (RA/RV) dilatation': 1, 'CSR': 1, 'OTT': 1, 'congenital defects of the right ventricle': 1, 'right thigh': 1, 'RV pressure overloading': 1, 'RVPO': 1, 'deterioration of right ventricular systolic function': 1, 'RCaud': 1, 'dilated right atrium and right ventricle': 1, 'RV wall rupture': 2, 'right upper quadrate (': 1, 'RV patch aneurysm': 1, 'and functional abnormalities of the RV': 1, 'arhythmogenic dysplasia of the right ventricle': 1, 'cardiomyopathy of the right ventricle': 1, 'hypoplastic or absent right or left ventricle': 1, 'dilation of the isolated ventricle': 1, 'PORV': 1, 'pressure overloaded right ventricles': 1, 'VORV': 1, 'traumatic rupture of the right ventricle': 1, 'ROP': 1, 'RV progressive dysfunction': 1, 'chronic injury of the (RV)': 1, 'right ventricle with impaired function. Right atrial enlargement': 1, 'lesion in right brachium pontis': 1, 'KHRC': 1, 'SRHR human rights': 1, 'dilated Right atrium and ventricle': 1, 'thrombosis of the right ventricle': 1, 'deterioration of right ventricle function': 1, 'RFT': 1, 'Injury of the right ventricle of the heart': 1, 'voltage abnormalities of the right ventricle': 1, 'rupture of the right or left ventricle': 1, 'Oligometastasis to the right ventricle': 1, 'dilation of the posterior right lateral ventricle': 1, 'Atrialized Right Ventricle': 2, 'right-ventricle anomalies': 1, 'right ventricle malformation': 1, 'morpho-functional anomalies of the right ventricle': 1, 'structural dysplasia of the right ventricle': 1, 'arrhythmiogenic RV dysplasia': 1, 'Otobasioninferius right': 1, 'Arrhythmogenic hyperplasia of the right ventricle': 1, 'RIGHTFUL': 1, 'RV scars': 1, 'hypoplastic right ventricle to': 1, 'OC/OCR': 1, 'congenital myopathy of the right cardiac ventricle': 1, 'involved right or left ventricle': 1, 'Right ventricle lipomas': 1, 'right ventricle lipoma': 1, 'Ischemic RV': 1, 'LV or RV hypokinesia': 1, 'delay right': 1, 'LV or RV distension': 2, 'RV deformations': 1, 'insufficiency of the right and left ventricles': 1, 'RIGHT TARGETS': 1, 'sarcoma of the right ventricle': 2, 'RIGHT THORACOLAPAROTOMY': 1, 'right acromion fracture': 1, 'Right acromion fracture': 1, 'RIGHT FRONTAL OPERCULUM': 1, 'Right ventricular (RV) remodelling': 1, 'RV cavity': 1, 'Thrombus of the right ventricle': 1, 'in situ thrombosis in the right ventricle': 2, 'RV Myo LV': 1, 'RV volume overload and dysfunction': 1, 'fibro-fatty replacement of RV myocardium': 1, 'RV strain and dysfunction': 1, 'fracture of the right trochanter': 1, 'right ventricle defect': 2, 'criminal human rights violation': 1, 'Primary hypoplasia of the right ventricle': 1, 'atrophy of the right ventricle': 1, 'Left ventricle-to-right ventricle disproportion': 1, 'ventricle-to-right ventricle disproportion': 1, 'RV abnormal': 1, 'right handedness': 1, 'RMC': 1, 'isolated fourth ventricle syndrome': 1, 'diminution of the right ventricle': 1, 'calcific mass of RV': 1, 'right ventricle ectopy': 1, 'obstruction of the right ventricle and pulmonary artery': 1, 'Right Ventricle (RV) dilation': 1, 'Systemic RV': 1, 'RV dysfunctionRBBBTOF': 1, 'paresia of the right': 1, 'right ventricle (RV) hypertophy': 1, 'enlargement of the right ventricle and': 1, 'hypoplastic right or LV': 1, 'right ventricle (RV) structural abnormalities': 2, 'structural and functional anomalies of the right ventricle': 1, 'right upper quadrant painAscites': 1, 'RV chronic overload': 1, 'Atrial and RV myocardial dysfunction': 1, 'left ventricle to right atrium defect': 1, 'and right ventricle dysfunctions': 1, 'hypoplasia of the right mandible and maxilla': 1, 'collapse of right ventricle': 3, 'Getting Right': 1, 'dilation of the pulmonary arteries and right ventricle': 1, 'right ventricle dysmorphogenesis': 1, '-occupying lesion in the right ventricle': 1, 'diastolic dysfunction of the systemic right ventricle': 1, 'FOR': 2, 'Rudimentary right ventricle': 1, 'Thrombus in the right atrium or ventricle': 1, 'insufficiency of the right ventricle (RV)': 1, 'Right ventricle and arterial hypertension': 1, 'systolic overload of the RV': 1, 'right ventricle prolapse': 1, 'overloading of the right ventricle by': 1, 'PPR TF': 1, 'PPR': 1, 'right peduncular syndrome': 1, 'mass attached to the right ventricle': 1, 'RV dilation and hypokinesis': 1, 'right ventricle structural abnormalities': 1, 'primary rhabdomyosarcoma of the right ventricle': 1, 'right and left ventricle perforation': 1, 'Primary right ventricular hypoplasia': 1, 'right axillary': 1, 'abnormality of the right ventricle': 2, 'loss of human rights and': 1, 'syndrome of the isolated fourth ventricle': 1, 'overload of RV': 1, 'RV pathologies': 1, 'dysfunction of the heart right ventricle': 1, 'systolic and pump dysfunction of the right ventricle': 1, 'Insufficiency of the right ventricle': 2, 'RV Myo': 1, 'arrhythmogenic cardiopathy of the right ventricle': 1, 'right pansinusitis': 2, 'LV and RV thrombi': 1, 'Structural and functional disorders of the right ventricle': 1, 'Ischemia of the right ventricle': 1, 'RV lead perforation': 1, 'patent right processus vaginalis': 2, 'right frontal hypoperfusion': 1, 'OFFICE OF CIVIL RIGHTS': 1, 'infringement of human rights': 1, 'RV thrombi': 1, 'Lipoma of the right ventricle': 1, 'RCV': 1, 'RV Systolic Dysfunction': 1, 'HF RV': 1, 'dilated right cerebral ventricle': 1, 'Systolic and diastolic dysfunction of the systemic right ventricle': 1, 'Dilated right lateral ventricle': 1, '-ventricle (RV)': 1, 'fracture of the right lower leg': 1, 'Human rights-related': 1, 'RV electrical disorder': 1, 'hypoplasia of the right gluteus minimus': 1, 'hypoplasia of the right ilium': 1, 'hypoplasia of the right gluteus minimus muscle': 1, 'feeling of rightness': 1, 'Feeling of Rightness': 1, 'electrical, and pathological abnormalities of the right ventricle': 1, 'dysfunction of the morphologic systemic right ventricle': 1, 'Dysfunction of the morphologic systemic right ventricle': 1, 'right ventricle overload and dysfunction': 1, 'hypotrophy of the right amygdala': 1, 'Isolated hypoplasia of the right ventricle': 1, 'fistula to RV': 2, 'right ventriccualr cardiomypathy': 1, 'RIGHT TIME': 1, 'RV/LV failure': 1, 'osseous arrosion of the right ventricle': 1, 'dry right ventricle': 1, 'right and left ventricle dilation': 1, 'to right ventricle': 1, 'ruptured sinus of valsalva into right ventricle': 1, 'lower right extremity fracture': 1, 'right extremity fracture': 1, 'Right leg fractures': 1, 'Congenital fistula of right coronary artery to right ventricle': 1, 'right ventricle cyst': 1, 'RVES': 1, 'RV end-systole': 2, 'congenital systemic right ventricle': 1, 'VENTRICULAR MYOCYTE ISOLATION': 1, 'diastolic disturbances of the right ventricle': 1, 'and depressed right ventricle': 1, 'rupture of the right atrium and left ventricle': 1, 'Ischemia of the RV': 1, 'RV maldapatation': 1, 'RVP overload': 1, 'structural deterioration of the right ventricle': 1, 'LV and RV dilatation': 2, 'of the systemic right ventricle': 1, 'hypoplasia of the right superior limb': 1, 'posterior right duct syndrome': 1, 'RV diastolic (and systolic) dysfunction': 1, 'right ventricle dislocation': 1, 'RTS': 1, 'Pressure overloaded right ventricles': 1, 'Right ventricle intra-cavitary cyst': 1, 'cardiac hydatic cyst of the right ventricle': 1, 'of right extremities': 1, 'VOTING RIGHTS': 1, 'abnormalities of RV': 1, 'pressure-overload of the right ventricle': 1, 'Anomalous muscle band of the right ventricle': 1, 'anomalous muscle band of the right ventricle': 1, 'Pulmonary embolismSplenic artery and left atrium and right ventricle thrombosisAortic': 1, 'Right lateral epicondylitiss': 1, 'obstruction of the right or left ventricle': 1, 'RV Dys': 3, 'ventricle (RV) dilatation and dysfunction': 1, 'giant right': 1, 'fracture of right acetabulum': 1, 'Arrhythmogenic right ventricle disease': 2, 'RV structural disease': 1, 'Sub-Aortic Right Ventricle': 1, 'sub-aortic right ventricle': 1, 'right ventricular (RV) thrombus': 1, 'Apical right ventricle': 1, 'RIGHT BRONCHUS': 2, 'right ventricular (RV) volume overload': 1, 'right ventricle (RV) hypertrophy': 1, 'RV chamber dilatation': 2, 'right ventricle injury of the myocardium': 1, 'LV/RV hypertrophy': 1, 'volume (RV) overloads': 1, 'myopathic RV': 1, 'RPL-RPD': 1, 'RPD-RPL': 1, 'RV metastases': 1, 'right hemitruncus': 1, 'Right ventricle cysts': 1, 'and human rights': 1, ', right ventricle dilatation': 1, 'heart right ventricle': 2, 'RV functional deterioration': 1, 'sRV-': 1, 'sRV-biV': 1, 'RV-Abn': 1, 'dilation of the RV ventricle': 1, 'RV pump dysfunction': 2, 'left ventricle-right auricle fistula': 1, 'arrhythmogenic disease of the right ventricle': 1, 'right ventricle ( RV ) dysfunction': 1, 'and dysfunctional right ventricle': 1, 'systolic and diastolic right ventricle dysfunction': 1, 'FEMALE RATIO RIGHT': 1, 'Hypoplastic RV 3': 1, 'right ventricle cardiomyopathies': 1, '-right defects': 1, 'LV-RA shunt type I': 1, 'RIGHT PARADIGM': 1, 'Diastolic collapse of the right ventricle': 2, 'contusive lesion of the right ventricle': 1, 'enlargement and dysfunction of the right ventricle': 1, 'compression on right lateral ventricle': 1, 'Right foot hypoplasia': 1, 'Right Right Ptosis': 1, 'end-diastolic dilation of the right ventricle': 1, '-RC': 1, 'ectopic base RV': 1, 'Enlargement and dysfunction of the right ventricle': 1, 'Right ventricle wall motion abnormalities': 1, 'Traumatic injury to either the right or left ventricle': 1, 'electrical disorder of the right ventricle': 1, 'RV Mass': 1, 'RV Mass.': 1, 'anomalies of the right heart ventricle': 1, 'Right ventricle restrictive physiology': 2, 'restriction of the right ventricle': 1, 'Acute dysfunction of the RV': 1, 'RV afterload reduction': 1, 'congenital fistula between aorta and right ventricle': 1, 'R.CAL': 1, 'Right Ventricle Compression': 1, 'Hyperthrophic right ventricle': 1, 'LV or RV hypertrophy or dilation': 1, 'Handedness-right': 1, 'dilated failing right ventricle': 1, 'right leg anomalies': 1, 'right eyesight loss': 1, 'Tumour in the right ventricle': 1, 'RV diastolic dysfunctions': 1, 'volume overloading of the right ventricle': 1, 'Blood cyst of the right ventricle': 1, 'blood cyst of the right ventricle': 1, 'RV-pressure overload': 1, 'Dysfunction in RV': 1, 'RV morphological abnormalities': 2, 'RV contractility abnormalities': 1, 'right lateral ventricle entrapment': 1, 'right lateral canalithiasis': 1, 'Right ventricular hypoplasia syndrome': 1, 'human rights, rights abuse': 1, 'SRER': 1, 'RV pressure/volume overload': 1, 'RV pressure/volume overload disease': 1, 'RV wall movement abnormalities': 1, 'RV lipomatosis': 1, 'collapse of the right atrium and ventricle': 3, 'haemangioma of the right ventricle': 1, 'volume overloaded right ventricle': 1, 'ventricular (RV and LV) enlargement and dysfunction': 1, 'hypokinesia of LV and RV': 1, 'right parietooccipital lesion': 1, 'Hypotrophy of the right lobe': 1, 'RVOTO': 1, 'right ventricle out-flow tract obstructions': 1, 'right ventricle output tract (RVOT) obstruction': 1, 'RVOT obstruction': 1, 'right ventricle to pulmonary artery (RV-PA) conduit': 1, 'volume reduction in the right hippocampus': 1, 'right ventricle wall rupture': 1, 'hypoplastic right (systemic) ventricle': 1, 'RIGHTS CRITIQUES': 1, 'failing systemic right ventricle': 1, 'RV pathology': 3, 'ventricular and corpus callosus hypoplasia': 1, 'Broncholithiasis of the upper right lobe': 1, 'malignant tumor of the right ventricle': 1, 'Right strephenopodia': 1, 'dilatation of the RA and RV': 1, 'LV and/or RV systolic dysfunction': 1, 'LV and RV abnormalities': 1, 'Left ventricle (LV) and/or right ventricle (RV) systolic dysfunction': 1, 'Thrombus in right ventricle': 1, 'RV myolysis': 1, 'RV necrosis': 1, 'hypoplasia of the left or right ventricles': 1, 'left ventricle to right atrium (Gerbode) defect': 1, 'loss of the right': 1, 'pressure overloading of the right ventricle': 1, 'RV pressure overload damage': 1, 'Impairment of the RV': 1, 'hypoplasia of the left or right ventricle': 1, 'right ventricular inflow hypoplasia': 1, 'Hypoplasia of the Right Ventricle': 1, 'RHOT': 1, 'hypoplasia of right upper': 1, 'RV wall dysfunction': 1, 'RV-PA-C': 1, 'RV regional dysfunction': 1, 'right ventricle (RV) occult dysfunction': 1, 'stricture of the right ventricle': 2, 'malformation of RV': 1, 'RV kinetic abnormalities': 1, 'LV and/or RV dilatation': 1, 'drooping of the right': 1, 'right or left atrium and ventricle anomaly': 1, 'hypoplasia of both the right ventricle and': 1, 'right lobar hypoplasia': 1, 'benign haemangioma of the right ventricle': 1, 'RIGHT ARTICLE': 1, 'hypoplasia of the ventricular': 1, 'RRDN': 1, 'RIGHT CUPOLA': 1, 'Right upper quadrant syndrome': 1, 'right tibiotarsal fracture': 1, 'RVPAC obstruction': 1, 'RVPAC IE': 1, 'Hypoplasia of Ventricular Conduction System': 1, 'swellings of the right great toe and right elbow': 1, 'RV under': 1, 'RARC': 1, 'hypoplasia of the right clavicle and right vertebral artery': 1, 'morphological abnormalities of the right ventricle': 1, 'RIGHTS ISSUES': 1, 'left ventricle-to-right atrial fistula': 1, 'right ventricular (RV)-PA conduit stenosis': 1, 'than right': 1, 'RMLC': 1, 'hypoplasia of both the right ventricle and the': 1, 'claudication of the right ventricle': 1, 'right hemiapresis': 1, 'metamorphosia in the right': 1, 'Right Ventricle Dysfunction.ti': 1, 'hyperactivity of the right ventricle': 1, 'right ventricle cysts': 1, 'right ventricle hypoplasia syndrome': 1, 'Ebsteinoid right': 1, 'RIGHTS AT WORK': 1, 'hypoplastia of the right ventricle': 1, 'NMRI': 1, 'RFD': 1, 'dilation of the RA and ventricle': 1, 'Diastolic dysfunction of right ventricle': 1, 'left atrium-right ventricle': 1, 'right IIIAA': 1, 'RV to pulmonary artery conduit dysfunction': 1, 'hypokinesia of the RV': 1, 'Civil Rights movement': 1, 'hypoplasia of the right ilium and gluteus minimus': 1, 'calcification of the right ventricle': 1, 'right ventricle (RV) hypokinesia': 1, 'Volume overload of the RV': 1, 'erythematous right hemiscrotum': 1, 'RIV': 2, 'RIGHT TO INFOMATION': 1, 'right whale imperilment': 1, 'non-compaction of the right ventricle': 1, 'right ventricle and atrial enlargement': 1, 'Dysfunction of right ventricle 1': 1, 'Right ventricle bleeding': 1, 'Right thumb hypoplasia': 2, 'Human rights atrocities': 1, 'varicosis of the right labium majus': 1, 'right ventricle injuries': 2, 'DHR': 2, 'hypoplasia of 1 atrioventricular valve and/or ventricle': 1, 'right quadranopsia': 1, 'cardiac right ventricle': 2, 'RV structural dysfunction': 1, 'RVGLS': 1, 'dilatated right ventricle': 1, 'RV volume- and pressure overload': 1, 'hypoplasia of right hemiscrotum': 1, 'to right hippocampus': 1, 'hypoplasia of the right index': 1, 'pressure or volume overload of the right ventricle': 1, 'RV diastolic abnormalities': 1, 'fatty-acid metabolism disorder of the right ventricle': 1, 'Apex of the Right': 1, 'RV and/or left ventricle collapses': 1, 'hypoplasic right ventricle': 2, 'and right ventricle': 2, 'Myocardial dysplasia of the right ventricle': 1, 'right ventricle (RV) inflow tract obstruction': 1, 'RV Dyspnea': 1, 'perforation of the RV': 2, 'hypoplasia of the right ventricle complex': 1, 'Right hemiparkinsonian syndrome': 1, 'dilated right ventricle and atrium': 1, 'LV and RV chamber dilatation': 1, 'unprotected human rights': 1, 'porencephalic dilation of the right ventricle': 1, 'porencephalic dilation of right frontal lateral ventricle': 1, 'overdistention of the right ventricle': 1, 'atrial, and right ventricle': 1, 'hypoplasia of the right lung and right pulmonary artery': 1, 'Hypoplasia of right renal vein': 1, 'Right ventricle laceration': 1, 'dilated right ventricle and pulmonary artery': 1, 'Right hypoplasia syndrome': 1, 'ventricular hyper- and hypoplasia': 1, 'tricuspid and right ventricle hypoplasia': 1, 'Right and': 1, 'RV end systole': 2, 'human rights infringement': 1, 'systolic-diastolic dysfunction of the right ventricle': 1, 'RV contractility dysfunction': 1, 'right ventricle overload and damage': 1, 'fatty involvement of the right ventricle': 1, 'LCM-RCF': 1, 'RCF': 1, 'pressure overload of RV': 1, 'RV overload/dysfunction': 1, 'civil rights and tort': 1, 'hypokinesia of enlarged right ventricle': 1, 'FRAM': 1, 'rightful choice': 1, 'Rightful Choice': 1, 'right atrium and ventricle tumor': 1, 'Defense of Rights': 1, 'civil rights folks': 1, 'RV dysregulation': 1, 'LV or RV failure': 1, 'robRHC': 1, 'lapRHC': 1, 'right ventricularcardiomyopathy': 1, 'hypoplasia of the sinus portion of the right ventricle': 1, 'hypoplasie of the right ventricle': 1, 'defects of right ventricle': 1, 'Angiosarcoma of the right atrium and right ventricle': 1, 'right ventricle and': 1, 'TRAUMATIC RIGHT': 1, 'RV pressure overload/dysfunction': 1, 'and RV': 1, 'pulmonary artery and RV': 1, 'RV and LV systolic dysfunction': 2, 'right ventricle (RV)dysfunction': 1, 'Right apex syndrome': 1, 'traumatic rupture of right ventricle and pericardium': 1, 'idiopathic right VT': 1, 'right ventricle to pulmonary artery (PA) obstruction': 1, 'right ventricle non-': 1, 'Right Dislocation': 1, 'right ventricle restrictive physiology': 1, 'or pressure overload of the right ventricle': 1, 'right ventricle [RV] dysfunction': 1, 'right ventricular systolic disfunction': 1, 'RV hypertrophyPapillary muscle abnormalitiesBasal': 1, 'right ventricle-left ventricle asymmetry': 1, 'right extremity fractures': 1, 'RV output': 1, '-rights violations': 1, 'fracture of the right tuberculum majus': 1, 'Pressure overload of left and right ventricle': 1, 'divided right ventricle': 1, 'right parietalgia': 1, 'right (systemic) ventricle': 1, 'concentric hyperthrophy of the right ventricle': 1, 'hypoplastic functional RV': 1, 'VOL-RV': 1, 'LAD-RV fistula': 1, 'the right ventricle (RV) fistula': 1, 'INALIENABLE RIGHT': 1, 'Rsiph': 1, 'rFPC': 1, 'loculation syndrome of the right': 1, 'right temporalgia': 1, 'hypoplasia and dysfunction of the right ventricle': 1, 'RV) involvement': 1, 'right ventricle alignment': 1, 'Left ventricle and right ventricle failure': 1, 'RV lead malfunction': 1, 'Right lateral ventricle mass': 1, 'ganglioglioma of the right lateral ventricle': 1, 'Ganglioglioma of the right lateral ventricle': 1, 'RV dilatation and': 2, 'RV enlargement or compression': 1, 'right-ventricle dilation': 2, 'left-right asymmetry of the ventricles': 1, 'RV dyskinesis': 1, 'tumor of the right atrium and ventricle': 1, 'RTB': 1, 'thrombosis of the right ventricle and atrium': 1, 'RVI': 1, 'Vectorcardiographic syndrome of the right ventricle': 1, 'nRH': 1, 'RV pathologic': 1, 'RV-dependent coronary': 1, 'PIFV': 1, 'muscle bundle of the right ventricle': 1, 'ventricular isolation': 1, 'sRV thrombus': 1, 'right ventricle complications': 1, 'systemic right ventricle (sRV) dysfunction': 2, 'RA dilation': 1, 'violations of the rights of': 1, 'right hemiphyosethesia': 1, 'right-ventricle and -atrium enlargement': 1, 'hypoplasia of the right ventricular sinus': 1, 'Hypoplasia of the right ventricular sinus': 1, 'dilated right ventricle of the': 1, 'Fibrosis of the right ventricle': 1, 'RV-HT': 1, 'RV-NT': 1, 'hypertrabeculation of the RV': 1, 'NT': 1, 'Right ventricle enlargement and dysfunction': 1, 'choroid cyst of the right ventricle': 1, 'right motor disturbance': 1, '-RV': 1, 'NF-RV': 1, 'RCA-RV fistula': 1, 'RCA to right ventricle (RV) fistula': 1, 'RV and/': 2, 'PRM': 1, 'RBCV': 1, 'infected RV': 1, 'LV or RV insufficiency': 1, 'LV or RV contractions': 1, 'RV and TA dilatations': 1, 'enlargement of the right ventricle and atrium': 1, 'RAMG': 1, 'hypoplasia or agenesis of the right internal jugular vein': 1, 'LV and RV damage': 1, 'right handiness': 2, 'dilation of isolated ventricles': 1, 'RV tumors': 1, 'right ventricle (RV) lipoma': 1, 'infiltrating lipoma of the RV': 1, 'Right ventricle decompensation': 1, 'developmental impairment of the right ventricle and': 1, 'RHL lesion': 1, 'of right ventricle and': 1, 'Smilodon right': 1, 'RV wall motion abnormality': 1, 'congenital trabecular hypoplasia of the right ventricle': 1, 'ductopenia of the right': 1, 'and right ventricle enlargement': 1, 'Right hemiasomatognosia': 1, 'RV pseudonormal filling': 1, 'diastolic RV dysfunction': 2, 'isolated left-right ventricular disproportion': 1, 'RV contractility': 1, 'or right ventricle': 1, 'Right ventricle (RV) perforation': 1, 'LV mass': 1, 'LV disease': 1, 'TAH-RSO': 1, 'RSO': 1, 'anomalous muscle of the right ventricle': 1, 'RV stiffening': 1, 'congenital hypoplasia of the right ventricular (RV) myocardium': 1, 'RIGHTS HAVE': 1, 'LV or RV dysfunction or failure': 1, 'dilatation of right heart ventricle': 1, 'right ventricular (RV) NC': 1, 'RV NC': 1, 'Right ventricle (RV) NC': 1, 'Injury to the right ventricle': 1, 'right ventricular (RV) collapse': 1, 'RV Obstruction Myocardial infiltraion': 1, 'diastolic restriction of the right ventricle': 1, 'Echinococcal cyst of the right ventricle': 1, 'compression of RV': 1, 'compression deformities affecting the RV': 1, 'NONHUMAN RIGHTS': 1, 'Papillary muscle dysplasia of the right ventricle': 1, 'Anomalous muscle bundle of the right ventricle': 1, 'RPs': 1, 'RD+': 1, 'Impaired RV physiology': 1, 'RV-injury': 1, 'Civil rights Property': 1, 'RV takotsubu cardiomyopathy': 1, 'RV takotsubu': 1, 'RV insertion': 1, 'loss of righting relax': 1, 'blockade of the right': 1, 'right-ventricle thrombosis': 1, 'RV and RA dilation': 1, 'civil rights and equality': 1, 'LV and or RV dysfunction': 1, 'dilatation of the left or right ventricle': 1, 'LV and RV (right ventricle) systolic dysfunction': 1, 'right humps': 1, 'RV/LV outflow obstruction': 1, 'Ependymoma of the right lateral ventricle': 1, 'Right ventricle in arterial hypertension': 1, 'left ventricular compression by the RV': 1, 'LV and RV diastolic dysfunction': 1, 'left ventricle to right atrium fistula': 2, 'Functional impairment of RV function': 1, 'fracture of the right palate': 1, 'Sporadic right ventricle rhabdomyoma': 1, 'RA-': 1, 'RTI': 1, 'right ventricle (RV) strain': 1, 'Volume overload of the right ventricle': 1, 'ventricle (RV) diastolic collapse': 1, 'mass in the right ventricle': 1, 'RFLs': 1, 'cardiac schwannoma of the right ventricle': 1, 'Right Whale': 1, 'right forelimb deformity': 1, 'hypoplasia or absence of one ventricle': 1, 'hypoplasia of right extracranial VA': 1, "Hypoplasia of the thyroid's right lobe": 1, 'RV overgrowth': 1, 'RV volume reduction': 1, 'RV alteration': 1, 'right hemianopsy': 1, 'primary hypoplasia of the right upper lobe': 1, 'RV-dominant disease': 1, 'dilation of the right atrium/ventricle': 1, 'FEELING OF RIGHTNESS': 1, 'sinus of Valsalva to right ventricle fistula': 1, 'of right ventricle function': 1, 'dilatation of the right ventricle of the': 1, 'Isolated hypoplasia of right ventricle': 1, 'isolated hypoplasia of right ventricle': 1, 'mass effect on the right lateral ventricle': 1, 'RUB': 1, 'Right hemianacousia': 1, 'depressed RV systolic function': 1, 'left ventricle (LV) or right ventricle (RV) dysfunction': 1, 'to the RPH': 1, 'to the RH': 1, 'RPH': 1, 'the RPH': 1, 'impaired right ventricle systolic': 1, 'RV sequelae': 1, 'aorta-to-right ventricle fistula': 2, 'RIGHT REASONS': 1, 'RIGHT ENVIRONMENT': 1, 'right ventricle [RV] avulsions': 1, 'Hyperechoic mass of the right ventricle': 1, 'right-hemipsheric lesion': 1, 'RB': 1, 'hypoplasia of the RV and': 1, 'right ventricle hypertrophic': 2, 'reduction of right and left ventricle': 1, 'RV systolic disfunction': 1, 'RVG': 1, 'liposarcoma of the right ventricle': 1, 'Right atrial (RA) systolic and right ventricle (RV) diastolic collapse': 1, 'RA or RV collapse': 1, 'RHRN': 1, 'dilation of right atria and ventricles': 1, 'Brugada right ventricle': 1, 'RMCL': 1, 'thin right ventricle': 1, 'human rights and violence': 1, 'Right Lateral (RL) lesions': 1, 'right ventricle hypoplasia or dysfunction': 1, 'R-N': 1, 'RV systolic and diastolic impairment': 1, 'Coronary fistula to the right ventricle': 1, 'Felt rightness': 1, 'felt rightness': 1, 'right ventricle (or ventricular)': 1, 'RLL)': 1, 'right lower lobe': 2, 'right laryngeal ventricle': 1, 'Auricularization syndrome of the right ventricle': 1, 'right ventricle- or left ventricle-dependent coronary circulation': 1, 'right ventricle output': 1, 'fracture of right 5th MCB': 1, 'RV-to': 1, 'RV steal': 1, 'left ventricular strain': 1, 'RIGHT VENTRICLE THROUGH VALSALVA': 1, 'right ventricle restriction': 1, 'Laceration of the right ventricle': 1, 'coronary to right ventricle fistulas': 1, 'hypoplasia of the right ventricular chamber': 1, 'Hairpin-right bulges': 1, 'LV dilatation': 1, 'fibrofatty degeneration of the right ventricle': 1, 'cystic right lesion of the right eye': 1, '(RLQ)': 1, 'right puborectalis': 1, 'right ventricle (RV) defects': 1, 'rTLE': 1, 'Diverticula and aneurysms of the right ventricle': 1, 'RLE fracture': 1, 'Right Ventricle Hypokinesis': 1, 'hypoplasia of the right pulmonary lobe and': 1, 'Right pulmonary lobe hypoplasia': 1, 'RV protrusion': 1, 'Right Ventricle (RV) Systolic Dysfunction': 1, 'anomalous communication between right ventricle and aorta': 1, 'hypoplasia of the right muscles': 1, 'right ventricle (RV) compression': 1, 'RIGHT PATIENTS': 1, 'R-TPJ': 1, 'blurring of the right': 1, 'dilatation of right lateral and III ventricle': 1, 'right 1 ventricle': 1, 'RVPAC dysfunction': 1, 'dilation of right ventricle and': 1, 'Bicameral right ventricle': 1, 'inlet left or right ventricle': 1, 'LV or right ventricle (RV) dilatation': 1, 'RV-lead perforation': 1, 'Right Ventricle Fistula': 1, 'Dilatation of RV': 1, 'disorder of the right ventricle': 1, 'Myocardial hypoplasia of the right heart ventricle': 1, 'dilation of RV and LV': 1, 'RV structural or functional abnormalities': 1, 'right-lobe haematoma': 1, 'injury to the RV': 1, 'RV Dilat': 1, 'Liponeurocytoma of right lateral ventricle': 1, 'IRP': 1, 'ROC': 1, 'arrest of the right ventricle': 1, 'right ventricle muscle dysfunction': 1, 'LV, and RV hypertrophy': 1, 'RVESP': 1, 'Right hypochondralgia': 1, 'Right ventricle cardiomyopathy': 1, 'impaired RV myocardial functions': 1, 'RV) and atrium': 1, 'impaired RV myocardial function': 1, 'RV myocardial': 1, 'ventricular (RV) physiology': 1, 'isolated ventricular noncompactison': 1, "hypoplasia of the thyroid's right lobe": 1, 'compromised function of the right ventricle': 1, 'Primary cardiac fibroma of the right ventricle': 1, 'right ventricle atresia': 1, 'obstruction in the right ventricle': 1}
|
RIGHTS
|
Disease
|
MESH:C535683
|
{'rigid spine syndrome': 184, 'SELENON-RM': 4, 'SEPN1-RM': 22, 'SEPN1-Related Myopathy': 2, 'Rigid spine syndrome': 59, 'dystrophic lesions of the spine': 1, 'hyperextension injury of the rigid cervical spine': 1, 'RSS': 26, 'rigid spine': 137, 'rigidity of cervical spine': 2, 'rigid spine muscular dystrophy': 38, 'rigidity of the spine': 79, 'Rigid spine': 23, 'congenital rigid spine muscular dystrophy': 2, 'RSMD1': 29, 'and/or body-related concerns': 1, 'E-PAtS': 3, 'Mallory-Denk bodies': 17, 'MDBs': 56, 'spine rigidity': 47, 'rigid cervical spine': 7, 'congenital muscular dystrophy with rigidity of the spine': 1, 'rigid-spine syndrome': 5, 'cervical spine rigidity': 19, 'Rigid coronal deformity of the spine': 1, 'SEPN1-related myopathy': 23, 'spine loss and dystrophies': 1, 'SEPN1 deficiency': 7, 'Rigid structural spine scoliosis': 1, 'Spine Muscular Dystrophy 1': 1, 'Rigid spine with muscular dystrophy': 1, 'rigidity of the cervical spine': 3, 'Cervical rigid spine': 1, 'Mallory Bodies': 1, 'rigid spine bone deformity': 1, 'rigid spines': 4, 'Spine rigidity': 5, 'Rigid Spine': 1, 'MDB': 46, 'Mallory bodies': 9, 'rigid deformities of the spine': 3, 'rigid deformity of the spine': 3, 'congenital muscular dystrophy with rigid spine syndrome': 3, 'Mallory-Denk body': 5, 'rigid spine deformity': 2, 'congenital muscular dystrophy with rigid spine': 2, 'NM with rigid neck and/or spine': 1, 'SEPN1-related myopathies': 7, 'SEPN1-related-myopathies': 1, 'Desmin-Related Myopathy with Mallory Body-like Inclusions': 1, 'Rigid Spine Muscular Dystrophy': 3, 'rigid spine myopathy': 2, 'rigidity of the neck and spine': 1, 'rigidity of the osteoporotic spine': 1, 'MBs': 4, 'Rigid Spine Syndrome': 7, 'Rigid spine MD1': 1, 'rigidity of the cervical spine and short neck': 1, 'Rigid spine muscular dystrophy': 9, 'rigid-spine': 1, 'Mallory Denk Bodies': 1, 'rigid spine and scoliosis': 1, 'Mallory-Denk Bodies': 4, 'weakness with rigid spine': 1, 'rigidity of spine': 5, 'spine dystrophy': 2, 'rigid spine muscular dystrophy-1': 2, 'ClF': 1, 'RSD-1': 1, 'dystrophic changes of the spine': 2, 'rigid spine muscular dystrophy 1': 8, 'SEPN-RM': 2, 'Rigid spine muscular dystrophy-1': 2, 'SEPN1 defects': 1, 'rigid spine congenital muscular dystrophy': 3, 'a rigid spine': 1, 'Sepn1 deficiency': 1, 'Rigidity of spine': 1, 'rigid spine syndromes': 4, 'SEPN1 related myopathy': 3, 'dendritic spine dystrophy': 4, 'Mallory body myopathy': 2, 'neck/spine rigidity': 1, 'Rigid Spine Muscular Dystrophy 1': 2, 'Rigid Spine muscular dystrophy': 1, 'RSMD': 2, 'hepatic Mallory bodies': 1, 'Rigid spine muscular dystrophy 1': 3, 'SEPN1 dysfunction': 1, 'rigid spine sign': 1, 'myopathic rigid spine and rigid spine syndrome': 1, 'Myopathic rigid spine': 1, 'cervical and lumbar spine rigidity': 1, 'SELENON (SEPN1)-related myopathy': 1, 'spine muscular dystrophy': 2, 'thoracic spine rigidity': 2, 'rigid spine muscular dystrophies': 1, 'rigidity of the spine and joints': 1, 'Rigid spine muscular dystrophy Myopathic': 1, 'CMD with rigidity of the spine': 1, 'NC': 2, 'rigid deformity of spine': 1, 'lumbar spine rigidity': 1, 'rigid spine kyphotic deformity': 1, 'centronuclear myopathy with rigid spine': 1, 'type 2 MBs': 1, '3 MBs': 1, 'dystrophic dendritic spine': 1, 'rigid spine with muscular dystrophy type 1': 3, 'Congenital muscular dystrophy with rigid spine syndrome': 1, 'Rigid Spine MD': 1, 'SEPN1-related disease': 1, 'Rigid spine Diaphragmatic weakness': 1, 'fatty MB': 1, 'Fatty MB': 1, 'MB': 5, 'Desmin bodies': 1, 'rigidity of cervical and lumbar spine': 1, 'EP': 1, "Mallory's bodies": 1, 'Rigid low spine': 1, 'rigid low spine': 1, 'Rigidity of the spine': 5, 'Mallory or Councilman bodies': 1, 'rigidity of spine and thoracic cage': 1, 'SEPN1 RM': 1, 'rigid spine muscular dystrophy1': 1, 'Mallory body': 2, 'primary RSS': 1, 'Spine Muscular Dystrophy Type 1': 1, 'hepatic mallory body': 1, 'CLASSICAL FORMS': 1, 'pulmonary 5 and spine 1': 1, 'rigidity of the thoracic spine': 2, 'rigid spine movements': 1, 'rigid-spine muscular dystrophy': 1, 'muscular dystrophy with rigid spine': 1, 'body-related': 1, 'Scapuloperoneal amyotrophy with rigid spine': 1, 'EPP': 1, 'rigid spine phenomenon': 1, 'Rigid deformities of the cervical spine': 1, 'rigid spine"': 1, 'Rigidity of Spine': 1, 'Mallory-denk bodies': 1, 'Congenital muscular dystrophy with early rigid spine': 1, 'Rigid Spine With Muscular Dystrophy Type 1': 1, 'degenerative-dystrophic processes of the spine': 1, 'Dystrophic thoracic spine dislocation': 1, 'dystrophic thoracic spine dislocation': 1, 'rigid spine phenotype': 1, "Dubowitz's rigid spine syndrome": 1, 'Rigid-spine syndrome': 1, 'spine rigidity and deformity': 1, 'extramuscular abnormalities of SEPN1-RM': 1, 'rigide spine': 1, 'Scoliosis rigide spine': 1, 'Rigide spine': 1, 'autosomal recessive rigid spine syndrome': 1, 'neurogenic facio-scapulo-peroneal and rigid spine syndrome': 1, 'CLF': 1, 'NCF': 1, 'SELENON(SEPN1)-Related Myopathy': 1, 'muscular disorder rigid spine syndrome': 1, 'SELENON(SEPN1)-related myopathy': 1, 'SELENON(SEPN1': 1, 'Rigid Spine CMD': 2, 'neck and spine rigidity': 1, 'congenital rigid-spine muscular dystrophy 1': 1, 'Rigid spine with limited cervical': 1, 'rigid kyphosis of the spine': 1, 'stiff neck rigid spine': 1, 'Rigid Spine Syndrome Tachyarrhythmia': 1, 'pathologic fracture of the rigid spine': 1, 'body movement-related': 1, 'spine rigidity': 2, 'CMD with rigid spine': 1, 'syndrome of the rigid spine': 1, 'HER2-POSITIVE EARLY': 1, 'rigid spine and joints': 1, 'rigid spine nor': 1, 'dystrophic diseases of the spine': 1, 'muscular imbalance around the spine': 1, 'NA rigid spine': 1, 'rigidity of cervical and thoracic spine': 1, '-dystrophic lesions of the spine': 1, 'BRSC': 1, 'dystrophic changes in the spine': 1, 'Ulrich and rigid spine congenital muscular dystrophy': 1, 'rigid spine or axial weakness': 1, 'rigid spine syndrome linked to chromosome 1p': 1, 'rigid spine CMD': 1, 'rigid spine myopathies': 1, 'Mallory Denk bodies': 1, 'rigid spine deformities': 1, 'muscular misbalance of spine': 1, 'Rigid spine congenital muscular dystrophy': 1, 'dystrophic spine': 1, '-related body dissatisfaction': 1, 'Spine Muscular Dystrophy': 1, 'Rigidity of the Spine': 1, 'SELENON rigid spine syndrome': 1, 'Rigidity of the cervical spine': 1}
|
rigid spine syndrome
|
Disease
|
MESH:C535684
|
{'RDC': 1505, 'conjunctival, limbal, or corneal abnormalities': 1, 'EDS-RDC': 4, 'RDC%20No%2067': 1, 'RDC/': 26, 'Kayser-Fleischer ring of the cornea': 3, 'embryonic ring of cornea': 1, 'RDC-': 3, 'RDC-TMD': 13, 'SADS-RDC': 1, 'Pain RDC': 1, 'RDC-PA': 3, 'ring dermoid of the cornea': 9, 'ring ulcer of the cornea': 1, 'ring dermoid': 2, 'RDC-TD': 1, 'RDC disorder': 2, 'RDC/TMDs': 1, 'RDC_302': 1, 'conjunctival, limbal, and corneal lesions': 2, 'RDC/TMD': 11, 'Ring dermoid of cornea': 2, 'EDS-RDC II': 2, 'ring abscess of cornea': 1, 'ring dermoid of cornea': 6, 'Ring Ulcer of the Cornea': 1, 'Dep RDC': 1, 'ring dermoid syndrome': 2, 'RDC affective episode': 1, 'RDC type III TMJ Arthralgia': 1, 'RDC schizophrenia': 5, 'en RDC': 1, 'RDC group IIb': 1, 'RDC/TMD groups IIIb and IIIc': 1, 'RDC /': 1, 'FH- RDC': 1, 'arthralgia of TMJ-RDC': 1, 'Arthralgia of TMJ-RDC': 1, 'conjunctival, limbal, and corneal abnormalities': 1, 'ring dermoid of the cornea syndrome': 2, 'DSM-IV & RDC': 1, 'RDC bipolar I': 1, 'Ring dermoid syndrome': 2, 'lr-CLAL': 1, 'FH-RDC': 1, 'RDC mania': 1, 'RDC n': 1, 'ring dermoid" of the cornea': 1, 'AN-RDC': 1, 'Kayser-Fleischer rings of cornea': 1, 'IIIC RDC': 1, 'RDC disorders': 1, 'NSPC RDC': 1, 'ring dermoid of cornea Arrythmia': 1, 'Ring abscess of the cornea': 1, 'RDC 2': 1, 'RDC N': 1, 'RDC minor depression': 1, 'RDC&D': 1, 'MEL RDC 26': 1, 'MoRDC': 1, 'RDC-O': 1, 'CLAU 1': 1, '-RDC': 2, 'RDC/ TMD': 1, 'conjunctival, limbal and corneal lesions': 1, 'RDC bipolar I and II': 1, 'Ring opacity of the cornea': 1, 'Necrotizing ring ulcer of the cornea': 1, 'conjunctival, corneal, and limbal lesions': 1, 'conjunctival-limbal-corneal lesions': 1, 'corneal-limbal-conjunctival tumors': 1, 'corneal ring dermoid': 1, '- RDC': 1, 'RDC bipolar 1 and II': 1, 'RDC-TMD Group I': 1, 'RDC schizoaffective disorder': 1, 'RDC SABP': 1, 'Ring dermoid of Cornea': 1, 'corneal, conjunctival and limbal lesions': 1, 'RDC-I': 1, 'RDC-II': 1, '25C3%2583O-RDC%2BN': 1, 'RDC-MAN-3': 1, 'RDC-Man-3': 1, 'FROM RDC': 1}
|
RDC
|
Disease
|
MESH:C535686
|
{'RMD': 537, 'Inflammatory RMD': 1, 'RMD disease': 7, 'rippling muscle disease': 123, 'muscle rippling': 9, 'FRs': 12, 'IRN': 25, 'RN': 2, 'inherited rippling muscle disease': 2, 'Rippling muscle disease': 43, 'rippling myopathy': 1, 'ripples': 50, 'Ripples': 25, 'Rippling': 26, 'Muscle Disease-2': 1, 'RMD2': 4, 'RMD-2 disease': 1, 'Rippling Muscle Disease-2': 1, 'RMD-2 type muscular dystrophy': 1, 'Rippling Muscle Disease': 12, "'rippling-muscle' disease": 1, 'Ripple': 69, 'ripple': 17, 'rippled sebaceoma': 1, 'rippling muscles and cramps': 1, '-RMD 2 and 3': 1, 'Ripple and taco folds': 1, 'involuntary muscle rippling': 1, 'FR MI': 2, 'FR': 24, 'autosomal dominant rippling muscle disease': 4, 'ripple oscillation': 4, 'SRD': 9, 'rippling': 12, 'rippling disease': 3, 'Rippling Disease': 1, 'RMD-2': 1, 'p-ripples': 2, 'Ripple Effect': 4, 'Schelleng ripples': 1, 'Rippling muscle syndrome': 3, 'Epileptic brain ripples': 1, 'MR': 1, 'Ripple artifact': 1, 'Rippled skin': 1, 'myoclonus and rippling': 1, 'epileptiform ripples': 2, 'iRMD': 5, 'Immune-mediated rippling muscle disease': 3, 'immune-mediated rippling muscle disease': 3, 'Fast-Ripple': 1, 'RCA': 4, 'RIPPLE MAPPING': 1, 'acquired rippling muscle syndrome': 2, 'rippling muscle movement': 1, 'Ripple oscillations': 4, 'RMD flare': 2, 'RMD-like illnesses': 1, 'TORC': 4, 'Ripple Deformation': 1, 'RMD condition': 2, 'fast ripples': 4, 'hRFM': 1, 'RMCC': 1, 'autoimmune forms of RMD': 1, 'RIP muscle': 1, 'RIP': 2, 'RMD-': 2, 'congenital generalized lipodystrophy with muscle rippling': 2, 'Muscle Rippling': 1, 'slow ripples': 1, 'Song ripples': 1, 'song ripples': 1, 'rippling deformities': 1, 'Rippling deformities': 1, 'rippling deformity': 2, 'RIPPLE DISRUPTION': 1, 'RPS': 1, 'Torque ripple reduction': 1, 'dominant rippling muscle disease': 2, 'Ripple disruption': 1, 'RPN': 1, 'Ripple Pond': 1, 'rippled-pattern sebaceoma': 2, 'Rippled-pattern sebaceoma': 2, 'Rippling disease': 2, 'SRN': 1, 'I-RMD': 3, 'Rippling Back to': 1, 'HD-RMD': 1, 'Ripple event': 1, 'REM': 7, 'rippling muscle syndrome': 4, 'Ripple effect': 4, 'ripple effect': 1, 'RIPPLE': 5, 'Eye-opening Ripple': 1, 'epileptic ripples': 1, '-ripples': 2, 'Epileptic Ripples': 1, 'ADCY5-RMD': 1, 'RMD metastasis': 1, 'TORO': 1, 'autoimmune rippling muscle disease': 4, 'muscular dystrophy Rippling Muscle Disease 2': 1, 'Autoimmune rippling muscle': 1, 'inherited rippling muscle disease-2': 1, 'rippling muscle disease-2': 2, 'Autoimmune rippling muscle disease': 1, 'ARMD': 2, 'muscle rippling movements': 1, 'Rippled Noises': 1, 'idiopathic Rippling muscle syndrome': 1, 'RD': 2, 'RPO': 3, 'autoimmune rippling muscles': 1, 'ripple complexes': 1, 'AcHA-RMD': 1, 'Skin Rippling': 1, 'RSK-RMD conditions': 1, 'rippled': 1, 'Ripple Noise': 1, 'RRL': 1, 'LD & RMD': 1, 'Ripple effect of': 1, 'reduction of RR': 1, 'autosomal dominant RMD': 1, 'and ripple': 1, 'muscle damage.2': 2, 'Rippled Noise': 1, 'HPC': 1, 'hippocampal ripple disruption': 1, 'HPC Disruption': 1, 'HPC-R': 1, 'Ripple-MCI': 1, 'Rippling muscle disease 1': 1, 'Rippling muscle disease 3': 1, 'IRNo': 1, 'Autoimmune acquired rippling muscle disease': 1, 'RTF': 1, 'ripple oscillations': 2, 'AD-RMD': 2, 'RMD-MG': 1, 'Rippling Muscle disease': 1, 'Ripple oscillation': 2, 'RMD rheumatic disease': 1, 'Ripple Carry Adders': 1, 'Orange Ripple': 1, 'Serendipitous ripples': 1, 'serendipitous ripples': 1, 'RCA-RMD': 1, 'Disordered ripples': 1, 'rippling muscles and': 1, 'Ripple Distortion': 1, 'inflammatory RMD': 4, 'SPW-ripples': 1, 'RPs': 1, 'RP': 1, 'scalp ripples': 1, 'Congenital Generalized Lipodystrophy with Muscle Rippling': 1, 'RMD rheumatic and musculoskeletal disease': 2, 'Ripple-AT': 2, 'degenerative RMD': 1, 'RMD]and': 1, 'RMD) condition': 1, 'RMD symptoms': 3, 'Ripple Reduction': 1, 'TR': 1, 'C_INTER_RMD': 1, 'INTRA_RMD': 2, 'INTER_RMD': 2, 'C_INTRA_RMD': 1, 'DISRUPTED_M_INTER_RMD': 1, 'C_INRA_RMD': 1, 'C_DISRUPTED_M_INTER_RMD': 1, 'C_INTER_RMD_M_DISRUPTED': 1, 'INTER_RMD_M_': 1, 'M_INTER_RMD': 1, "RMD'S": 1, 'RMD arthritis': 1, 'Ripple Carry Adder': 1, 'AFD-RMD': 1, 'RIPPLES': 2, 'gamma and ripple oscillations': 1, 'MECHANISMS OF RIPPLE': 1, 'P-ripples': 1, 'Ripple Development': 1, 'Lilac Ripple': 1, 'rheumatic and musculoskeletal (RMD': 1, 'ultra-fast ripples': 1, 'CAV3 Rippling muscle disease': 1, 'RE': 1, 'RCC': 1, '-wave ripples': 1, 'IIRN': 1, 'Ripples of consciousness': 1, 'wave ripples': 2, 'RPR': 1, 'ripples of prematurity': 2, '-ripple PAC': 1, 'RSDs': 1, 'RCIs': 1, 'ripple and fast gamma oscillations': 1, 'Rippling Muscle Syndromes': 1, 'wave ripple': 1, 'hRMD': 1, 'PRE': 1, 'IID-ripples': 1, 'TB RMD': 1, 'TB-RMD': 1, 'Ripple ribs': 1, 'RMD - rheumatic and musculoskeletal disease': 1, 'autosomal recessive rippling muscle disease': 1, 'Autosomal recessive rippling muscle disease': 1, 'Inherited rippling muscle disease': 1, 'LRs': 1, 'Ripple effects': 1}
|
RMD
|
Disease
|
MESH:C535687
|
{'DFSCs': 1, 'Roberts syndrome': 331, 'M.Sc': 81, 'RMDH': 2, 'Robert': 8, 'RBS': 166, 'B.Sc': 58, '-sC': 1, 'ROBERT': 26, 'SCs': 112, "Robert's plight": 1, 'sc': 57, 'Sc': 270, 'Roberts-SC': 3, 'Roberts-SC (': 1, 'Roberts-SC Syndrome': 1, 'Pseudothalidomide) syndrome': 1, 'ASSOCIATION OF P-DIOXANE': 1, 'Sc.': 4, 'R-Sc.': 1, 'H-sC': 1, 'postoperative long lip': 1, 'long lip': 7, 'Postoperative Long Lip': 1, 'cystic sc hi': 1, 'sc-RMS': 1, 'Sc -': 1, 'Robert Frost': 1, 'Robert syndrome': 15, "Robert's syndrome": 23, "Roberts's syndrome": 4, 'sc scape': 1, "Robert's uterus": 37, 'Hurwitz-Roberts class A': 1, 'Hurwitz-Roberts': 1, 'Sc carcinoma': 1, "Robert's Syndrome": 6, 'Pseudothalidomide syndrome': 2, 'Embriopathy Roberts Syndrome': 1, 'Roberts Syndrome': 61, 'PrP(Sc)': 15, 'cleft-associated syndromes': 4, 'Roberts/SC phocomelia syndrome': 6, 'Robert pelvis': 1, 'Non-Sc': 1, 'TDAP-sc': 2, 'B.Sc.': 7, 'Roberts-SC phocomelia syndrome': 27, 'B. Sc': 12, 'F. Sc': 1, 'Sg': 1, 'ROBERT THATCHER': 2, 'SCs of the lung': 1, 'Mc/Sc': 1, 'sCS': 12, 'CHLORAMPHENICOL-P-HYDROXYPHENYLBUTAZONE ASSOCIATION': 1, 'BEH.Sc': 2, 'HG-SCs': 2, 'Sc-Sclerenchyma': 1, 'type VI SCs': 1, 'long upper lip': 13, "Roberts' syndrome": 9, 'Co.V.A.Sc': 1, 'V.A.Sc': 1, 'Robert KUDICKE': 1, 'Roberts-SC phocomelia': 5, 'Roberts': 23, 'RWJF': 4, 'sc tumors': 2, 'Robert Desoille': 1, 'Extraocular SCs': 1, 'ROBERT TENNENT': 1, 'sc-': 3, 'RMS': 1, 'Roberts-SC-phocomelia syndrome': 1, 'Pseudothalidomide Syndrome': 1, 'Sc. M.': 1, 'CL-associated blood stream infections': 1, 'CLABSI': 1, 'pSCs': 1, 'MR': 1, 'sc-108047': 1, 'sc-eFS': 1, 'sc-mFS': 1, 'levucell_sc': 1, 'ROBERTS': 2, 'sc calcifications': 4, 'Tetraphocomelia--cleft palatee syndrome': 1, 'Pseudothalidomide': 2, "Roberts's": 1, 'BRIT': 1, 'clefts of lip, alveolar bone and palate': 2, 'clefts of the lip, alveolar bone and palate': 2, 'Robert antigen': 1, 'Robert Chote': 1, 'TR': 1, 'RD': 1, 'sc ossifications': 3, 'HIV sc': 1, 'cleft associated with a': 1, 'RBS disorder': 2, 'hypomelia': 9, "Roberts' Syndrome": 3, 'MS': 1, "Roberts'-SC phocomelia syndrome": 1, 'Sc Sc': 1, 'RBS envenomation': 1, 'RBS bite': 2, 'weight Sc': 1, 'Sc scape': 4, 'long CL': 1, 'RBS/SC': 5, 'ROBERT KOCH': 3, 'RBS-SC': 1, 'RBS cohesinopathy': 1, 'Roberts and': 1, 'RBS malformations': 1, 'FRC': 1, 'eccrine SCs': 1, 'ScS': 11, 'Hurwitz and Roberts': 2, 'Sc scapus': 1, 'Robert Syndrome': 2, 'Sc-TdP': 1, 'EXON-sc': 1, 'Roberts-SC syndrome': 4, 'GSCs': 1, 'Roberts/pseudothalidomide syndrome': 1, 'pseudothalidomide syndrome': 15, 'RBS-A': 2, '-Roberts syndrome': 1, 'lumtm1Sc': 1, 'non-melanoma SCs': 1, "Hurwitz and Roberts' type A/Nakamura type I": 1, 'sc-1616-R': 1, 'ROBERT SCHERTZER': 1, 'B. Sc.': 2, 'Sc-150': 1, 'Sc-RMS': 2, 'Sc-RMSs': 1, 'Shirani-Roberts': 1, 'Robert-Gnansia': 1, "Robert's pain": 1, 'pseudothalidomide disease': 1, 'GBM sc': 1, 'Sc-EMF': 1, 'psycho-urinary SCs': 1, 'c-sc': 1, 'lung_sc': 1, 'Sc sclerocornea': 1, 'Hypomelia-hypotrichosis-facial hemangioma syndrome': 1, 'pseudothalidomide': 4, 'Adam Robert Wright Syndrome': 1, 'Adam Robert Wright syndrome': 1, 'Apert, Carpenter, Larsen, and Roberts syndromes': 1, 'Roberts tetraphocomelia syndrome': 1, 'SC phocomelia/pseudothalidomide syndrome': 1, 'Roberts SC syndrome': 1, 'Robert-SC syndrome': 1, 'Robert SC Syndrome': 1, 'cleft-associated syndrome': 1, 'STLL-Scs': 1, 'SC-Roberts/pseudothalidamide syndrome': 1, 'RBS developmental abnormalities': 1, 'DENNIS ROBERT HOAGLAND': 1, 'sc ossifications andhypocalcaemia15': 1, 'D.Sc': 2, "Robert's uterus anomaly": 2, 'Roberts syndrome anomalies': 1, 'SINGLE Sc': 1, 'Shirani-Roberts type IIA': 1, 'pain sc-ore': 1, 'RBS disease': 1, "Robert's pelvis": 2, 'Sc@B28': 1, 'ROBERT DONALDSON': 1, 'RBS OMIM #268300': 1, 'PAS sc': 1, "sc'ahal": 1, 'ROBERT LANGER': 1, 'Sc Scoliosis': 1, 'PHMA': 1, 'Roberts syndromes': 5, 'Roberts breakage syndrome': 1, 'RBS.54': 1, 'Rob': 1, 'skin Sc': 1, '3 and 4 IgG4-SCs': 1, 'C.sC.t': 1, 'Roberts/': 2, 'WALTER ROBERT': 1, 'Robert DeMars': 1, 'robert': 1, '-Sc': 2, 'NS-Sc': 1, 'TP Sc': 1, 'taeniopterus TP 6 - Sc': 1, 'taeniopterus TP 4 - Sc': 1, 'sc str': 1, 'RMS EC': 1, 'sc-FOP-9': 1, 'Sc-j': 1, 'sc fat': 1, 'sc-MIs': 1, 'Robert Pooley': 1, 'injury associated long bone': 1, '-SCs': 6, 'LSCs': 3, 'Sc/NE-like tumors': 1, 'Sc/NE tumors': 1, 'Sc/NE': 1, 'RS defect': 1, 'Sc-SBOs': 1, 'KV-Sc': 1, 'ROBERT LISTER HORTON': 1, "Robert's": 6, "Robert's uterine malformation": 1, 'RBS-As': 1, 'M. Sc': 8, 'sc-CNV': 1, 'ROBERT B.': 1, 'Fraser and Robert syndrome': 1, 'ARMC': 1, '-MSCs': 1, 'UC-MSCs': 1, '19_z-sc': 1, 'RBS bites': 2, "Asperger'sC": 1, 'Roberts-Sc Phocomalia syndrome': 1, 'Sc/': 1, 'Robert uterus': 3, "Robert's Uterus": 5, 'Sc-FUM': 1, 'sc-SWNTs': 1, 'RBS birth defects': 2, 'Meckel and Roberts syndrome': 1, 'erosion of the SCs': 1, 'RBS-SAB': 1, 'M&Sc': 1, 'RHF-DSP': 1, 'RHF': 2, 'Sc (3) St (4) CM (6) 1': 1, 'long lip deformities': 1, 'ROBERT FLUDD': 1, 'Sc-GDH': 1, 'sc tumours': 1, 'LG-SCs': 2, 'anomalies associated with the lip, palate, and': 1, 'sc disease': 1, 'sc diseases': 1, 'GRAHAM ROBERTS': 1, 'Robert-Sc phocomelia syndrome': 1, 'MRB': 1, 'Maureen roberts': 1, 'robert bradlaw': 1, 'CL-associated infections': 1, 'Sc-19': 1, 'sc-TCMR': 1, 'M.Sc.': 5, 'RWJMS': 5, 'long upper lip philtrum': 1, 'Phocomelia and Roberts Syndrome': 1, 'Robert Coffey': 1, 'nonmelanoma SCs': 1, 'NMSCs': 1, 'cleft associated syndrome': 1, 'RS': 3, 'AR': 2, 'H.Sc': 1, 'SCs of the scalp': 1, 'sc-hizophrenia': 1, 'long lip deformity': 2, 'RBS-B': 1, 'VA sc': 1, 'Sc-Hypo': 1, 'sc ore': 1, 'Roberts-syndrome': 1, 'F-SCs': 1, 'sc-ImmuCC': 1, 'Cochlear Hydrops Sc': 1, "Hurwitz and Robert's type F": 1, "and Robert's": 1, 'OOM-SCs': 1, "P. asteris'-associated diseases": 1, 'sc scutellum': 1, 'scs': 2, 'RN-Sc': 1, 'SC pseudothalidomide syndrome': 1, 'Roberts sydrome': 1, 'Roberts/SC phocomelia': 2, 'P-extramedullary and P-bone': 1, 'TC': 1, 'RRCCH': 1, 'Acanthellorhiza P. Roberts': 1, 'I. Sc': 1, 'SCs metastasize': 1, 'SKP-SCs': 2, 'Pseudothalidomide Syndromes': 1, "Crohn'sc": 1, 'Robert Fontana': 1, 'RBS/SC syndrome': 1, 'ROBERT DAVIES-COLLEY': 1, '-sc': 1, 'skull, palate, sternum, and long bones': 1, 'Roberts syndrome-like abnormalities': 1, 'uni- and bilateral clefts of lip, alveolar bone and palate': 1, 'Roberts phocomelia syndrome': 2, 'sc lesion': 1, 'CHC-SCs': 1, 'Y-BOCS&RBS': 1, "Robert's lesion": 1, 'PrP(Sc) infection': 1, 'RBS Roberts syndrome': 1, 'Pierre-Robert sequence craniofacial disorder': 1, 'Hy-Sc': 1, 'Robert- Syndrome': 1, 'Robert fire': 1, 'Sc/NE tumours': 1, 'NMSC': 1, 'Low Roberts syndrome': 1, 'R-Sc': 1, 'L-Sc': 1, 'FA and Roberts syndrome': 1, 'Robert skin': 1, 'Roberts-SC phocomelia (RBS) syndrome': 1, 'Veneto Sc': 1, 'sc emphysema': 1, 'sc infection': 1, 'Robert Long': 1, 'long upper lip groove': 1, '(sc) fractures': 1, 'II-VI SCs': 1, 'RE': 1, 'RE infected': 1, 'ScS.': 1, 'SeP-associated diseases': 1, 'ROBERT GAMARD': 1, ',Sc)': 1, 'leukemic SCs': 1, 'Roberts Cove': 1, 'RBS cohesinopathies': 1, 'ROBERT JANKER': 1, 'long lip length': 1, 'sc-ASCAs': 1, 'Robert Bradstone': 1, 'RBS aplasia': 1, 'LNS Sc': 1, 'ROBERT FLETCHER MOORSHEAD': 1, 'PNH-sc': 1, 'Roberts Syndromes': 1, 'sC': 4, 'Roberts-SC phocomelia syndromes': 1, 'ROBERT WELSH': 1, 'Sc bifid': 2, 'MM.Sc': 1, '2-Sc': 1, '1-Sc': 2, 'RLTB': 1, 'Sc-4': 1, 'Robert Gates syndrome': 1, 'Robert Reid': 1, 'HIRRC': 2, 'Robert-hyperpronation': 1, 'B.sc': 2, 'ROBERT BRUDENELL': 1, "Roberts'": 1, 'Roberts uterus': 1, 'UMAP': 1, 'Lung sc': 1, 'GBS-RBS': 1, 'B.N.Sc': 1, 'Roberts Lecture': 1, 'dehiscence of the SCs': 1, 'Dehiscence of the SCs': 1, "Robert's syndromeESCO2": 1, 'Terminalia albida Sc': 1, 'MRJB': 1, 'ROBERT MORANT': 1, 'sc nodules': 1, 'hypomelia-hypotrichosis-facial hemangioma syndrome': 1, 'Roberts pseudothalidomide syndrome': 1, 'RBS restricted behavior': 1, 'PP.Sc.13 - 19': 1, 'pseudothalidomid syndrome': 1, 'P-LsP': 1, 'Robert`s uterus': 1, 'Robert`s': 1, 'Syndrome of hypomelia': 1, 'pseudothalidomide S.': 1, "Robert's Syndromes cohesinopathies": 1, 'Robert Bittman': 1, 'MR.Sc': 1, 'Bilogical Sc': 1, 'sc ossification': 1, 'Flip Sc': 1, 'P 1798(sc) lymphoma': 1, 'Sc-ura': 1, 'Roberts SC phocomelia': 1, 'Sc infection': 1, 'ASpC-Sc': 1, 'clefts of lip, alveolar bone, and palate': 1, 'Clefts of Lip, Alveolar Bone, and Palate': 1, 'Lingnan Sc': 1, 'Roberts syndrome Say syndrome': 1, 'TPSC': 1, 'autosomal recessive cohesinopathy Roberts syndrome': 1, 'RBS-1 and -4': 1, 'RBS-3': 1, 'roberts': 1, 'sc-PA': 1, '[email protected]': 1, 'sc-PDSI': 1, 'autosomal recessive Roberts syndrome': 1, 'Roberts/SC syndrome': 1, 'facial cleft with short long bones': 1, 'Robert Curteis': 1, 'tetraphocomelia-cleft palate syndrome': 1, 'RIMGC': 1, 'I sc': 1, 'Artabotrysvelutinus Sc': 1, "AA2HBart'sCS": 1, 'Td sc': 1, 'subcutaneous (sc': 1, 'ROBERT LESLIE': 1, 'sC-Hypo': 1, 'C & Sc': 1, 'ROBERTS SYNDROME': 1, 'SC-Roberts syndrome': 1, 'cSCs': 1, 'Robert SC syndrome': 1, 'Roberts syndrome': 1, 'cleft associated with': 1, '-Sc-': 1, 'Robert Halsey': 1, 'robert halsey': 1, 'C-sC': 1}
|
Roberts syndrome
|
Disease
|
MESH:C535688
|
{'oligodactyly': 365, 'oligodactyly of the': 5, 'oligodactyly of': 6, 'unilateral oligodactyly': 3, 'Oligodactyly': 45, 'oligodactyly in': 1, 'Hand oligodactyly': 9, 'foot oligodactyly': 3, 'hand oligodactyly': 8, 'oligodactyly type': 1, 'bilateral hand oligodactyly': 1, 'poly-oligodactyly': 1, 'congenital oligodactyly': 1, 'poly- and oligodactyly': 5, 'poly-, syn-, and oligodactyly': 3, 'oligodactyly with': 1, 'oligodactyly of both': 2, 'oligodactyly of right': 1, 'bilateral foot oligodactyly': 1, 'Unilateral hand oligodactyly': 1, 'preaxial oligodactyly': 3, 'poly- or oligodactyly': 2, 'oligodactyly on': 1, 'Oligodactyly of left': 1, 'bilateral oligodactyly': 1, 'Bilateral oligodactyly': 1, 'oligodactylies': 1, 'oligodactyly of the right foot': 1, 'poly-, syn- and oligodactyly': 1, 'oligodactyly F1': 1, 'oligodactyly of the thumb': 1, '1st digit oligodactyly': 1, 'oligodactyly in the hands': 1, 'Phalanges Oligodactyly': 1, 'poly/oligodactyly': 1, 'asymmetrical oligodactyly': 1, 'Tetra-oligodactyly': 1, 'tetra-oligodactyly': 1, 'Left hand oligodactyly': 1, 'hindlimb oligodactyly': 1, 'oligodactyly of the left foot': 2, 'preaxial hand oligodactyly': 1, 'symmetrical and bilateral hand oligodactyly': 1, 'lateral oligodactyly': 1, 'Oligodactyly typeNarrow': 1, 'oligodactyly of the hindlimbs': 1, 'oligodactyly of the left hand': 1, 'oligodactyly of the left': 1, 'oligodactyly of the hand': 1, 'digit oligodactyly': 1, 'Oligodactyly with Thumb': 1, 'hand oligodactyly with thumb': 1, 'oligodactyly with thumb': 1, 'Oligodactyly of the hand': 1, 'isolated oligodactyly': 1, 'Foot oligodactyly': 1, 'Foot Oligodactyly': 1, 'isolated foot oligodactyly': 1}
|
oligodactyly
|
Disease
|
MESH:C535689
|
{'LSS': 400, 'tibia/fibula': 22, 'Mirror image dextrocardia': 4, 'mirror feet': 7, 'MIP': 381, 'tibia and fibula': 69, 'tibia, fibula, and talus': 1, 'deformation of tibia and fibula': 1, 'Mirror-image pain': 7, 'Mirror-Image Pain': 4, 'tibia or fibula': 3, 'HBMCD': 1, 'Mirror-image dextrocardia': 19, 'mirror hand deformity': 7, 'mirror hand': 13, 'Mirror hand': 4, 'Mirror Hand': 1, 'Lytic lesions in the tibia, fibula, and': 1, 'MP': 2, 'radius-ulna and tibia-fibula fractures': 1, 'mirror-image dextrocardia': 47, 'deformities in tibia and fibula': 3, 'mirror-image pain': 16, 'Mirror Image Sensory Dysfunction': 1, 'Mirror image sensory dysfunction': 1, 'MISD': 3, 'mirror image pain': 7, 'mirror image sensory dysfunction': 2, ', the tibia and fibula': 1, 'pelvis, tibia and fibula': 1, 'mirror polydactyly': 3, 'MIRAA': 1, 'mirror-image polydactyly': 8, 'd-LSS': 1, 'deformity of the ulna, radius, tibia and fibula': 1, 'Laurin-Sandrow syndrome': 33, 'Mirror hands and feet': 3, 'mirror hands and feet': 3, 'tibia/fibula shortening': 1, 'Mirror hand deformity': 2, 'MIP dysfunction': 1, 'mirror-image': 3, 'MPM': 3, 'ulnar duplication with absence of radius': 1, 'Lauren Sandrow syndrome': 1, 'pre-axial mirror polydactyly': 4, 'Mirror feet': 3, 'tibia and fibula nonunion': 4, 'absence of the radius or ulna': 1, 'Mirroring of Hands': 1, 'mirror polydactyly of the foot': 2, 'the tibia or fibula': 1, 'Laurin-Sandlow syndrome': 1, 'shortness of tibiae and fibulae': 1, 'MIP-': 4, 'mirror image-dextrocardia': 1, 'of tibia and fibula': 3, 'tibia and fibula varus': 1, 'MI': 5, "LSS's": 1, 'MIP-1A': 4, 'mirror foot polydactyly': 3, 'mirror-image amblyopia': 1, 'Mirror image anisometropia': 1, 'MS': 1, 'mirror-image polydactyly 1': 2, 'posttraumatic multidimensional deformity in tibia and fibula': 1, 'short malformed tibias and fibulas': 1, 'degenerative LSS': 1, 'Degenerative LSS': 1, 'lower extremity mirror image polydactyly': 1, 'MIP mania': 1, 'tibia or fibula reduction defect': 1, 'CVd-I-LSS': 3, 'defect of tibia and fibula': 1, 'mirror- neuron abnormalities': 1, 'tibia and fibula valgus': 1, 'hypoplasia of radius, ulna, and tibia': 1, 'MINP': 1, 'mirror-image type D interrupted aortic arch': 1, 'Mirror-image type D interrupted aortic arch': 1, '[MIP-2]SEAP': 1, 'mirror image agnosia': 7, 'Preaxial mirror polydactyly': 2, 'preaxial mirror polydactyly': 3, 'Preaxial mirror polydactyly of the foot': 2, 'nonunion of tibia and fibula': 2, 'agenesis of the right tibia and fibula': 2, 'mirror image polydactyly 1': 1, 'MIP-17': 3, 'S-MIP-19-22': 1, 'femur-tibia-radius anomalies': 2, "LSS's deficit": 1, 'tibia and fibula lesions': 2, 'of the tibia-fibula': 1, 'DLS-I-LSS': 1, 'MPM MIP': 1, '/MIP': 1, 'MIA': 3, 'Mirror image artifact': 1, 'deformities of the tibia and fibula': 2, 'LSS defects': 2, 'radius, ulna, tibia and fibula fractures': 1, 'duplication of the radius and tibia': 1, 'MIP/SOL': 2, 'LSS _7': 1, 'tibia, fibula': 5, 'vestibular mirror image nystagmus': 1, 'Mirror hand-ulnar dimelia': 1, 'MHUD': 1, 'mirror image dextrocardia': 16, 'Mirror Image Dextrocardia': 1, 'distal tibia and fibula infection': 1, 'mirror- image dextrocardia': 1, 'MIP/SOL tumors': 1, 'Covid-MIP': 1, 'myocardial infarction MIP': 1, 'MIP disease': 1, 'radius, tibia or femur deformity': 1, 'Sandrow syndrome of mirror hands and feet': 1, 'MIP-MDSPE': 1, 'tibia-fibula': 6, 'MIME': 2, 'Laurin Sandrow syndrome': 1, 'the tibia and fibula': 1, 'tibia-fibula diastasis': 3, 'mirror-image asymmetry': 1, 'Mirror-image asymmetry': 1, 'S-MIP-19-41': 1, 'LSS limited systemic sclerosis': 1, 'distal tibia and fibula fracture3': 1, 'LSS -4': 1, 'rTSE MIP': 1, 'MIS': 6, 'tibia and fibula Inj': 1, 'tetramelic mirror-image polydactyly': 2, 'Tetramelic mirror-image polydactyly': 1, 'MIP-DILI': 2, 'Mirror-image polydactyly': 3, 'Mirror image polydactyly': 3, 'mirror hand or ulnar dimelia': 1, 'AAV-MIP': 1, 'Mirror hand syndrome': 1, 'MIP-MAP': 1, 'fracture of the radius/ulna, tibia/fibula, or humerus': 1, 'mirror image disorders': 1, 'Mirror hand or ulnar dimelia': 2, 'tibia and fibula deformities': 1, 'PNE': 1, 'MIP_SOL': 1, 'FPT': 1, 'MIB-MIP': 1, 'mirror-image channelopathies': 1, 'MIH hypersensitivity': 2, 'MIH) hypersensitivity': 1, 'mirror-image heat': 2, 'short tibia and fibula': 4, 'Hand-mirror cell': 1, 'mRAA': 1, 'LSS Lewis Sumner syndrome': 1, 'Mirror-image sensory dysfunction': 1, 'mirror-image sensory dysfunction': 1, 'fibula and tibia': 1, 'MIP-OES': 1, 'MIP anomaly': 1, 'mirror image anomalies': 1, 'Mirror image pain': 3, 'Mirror Image Pain': 1, 'mirror image duplication of hands and feet': 1, 'Laurin-Sandrow Syndrome': 6, 'mirror hand and leg': 1, 'mirror neuron abnormalities': 3, 'MIT phenomenon': 1, 'dilation of the fibula and tibia': 1, 'Mirror-Image Polydactyly 1': 1, 'hypoplastic tibia and fibula': 3, 'shortened tibia-fibula': 2, 'absence of the radius/ulna and': 1, 'MI-Sync': 1, 'MI-': 1, 'mirror image lung syndrome': 2, ', tibia and fibula': 1, 'mirror hand anomaly': 2, 'MIL@MIP': 1, 'MIPD': 2, 'Mirror image agnosia': 2, 'Sandrow syndrome': 1, 'mirror image duplication of the': 1, 'mirror image foot polydactyly': 1, 'fractures of the radius, ulna, tibia, or fibula': 1, 'Mirror-image Dextrocardia': 1, 'MIP-C': 1, 'deformities of the distal tibia and fibula': 1, 'Mirror Image Agnosia': 1, 'the tibia, fibula, humerus,': 1, 'mirror-image polydactyly of the hands and feet': 1, 'absence of the radius and ulna': 1, 'mirror-image allodynia': 1, 'Mirror-image allodynia': 2, 'Fibula pro tibia': 2, 'tibia and/or fibula': 1, 'tibia and fibula deficiency': 1, 'agenesis of tibia and fibula': 1, 'LSS calcification': 1, 'left mirror hand anomaly': 1, 'RERF-LSS': 1, 'tibia and fibula defect': 1, 'S-MIP-19-63': 1, 'nonunions of the tibia and fibula': 1, 'Defect of LSS Disrupts Lens Development': 1, 'Defect of LSS Disrupts Lens': 1, 'absence of the radius and fibula': 1, 'tibia and fibula)': 1, 'TFS': 1, 'tibia/fibula nonunion': 1, 'MM MBD': 1, 'MM': 2, 'radius/ulna or tibia/fibula fractures': 1, 'Martin or Laurin-Sandrow syndrome': 1, 'MIEA': 1, 'tibia fibula': 3, 'UCMPs@MIL-100@MIP': 1, 'axial mirror polydactyly of the foot': 1, 'mirror image movements': 2, 'Mirror hand anomaly': 2, 'neuropathic mirror-image pain': 1, 'fractures of the tibia, humerus, fibula, radius, ulna': 1, 'FIBULA TO TIBIA TRANSPOSITION': 1, 'MIP-Rea': 1, 'pre-axial mirror polydactyly of the foot': 2, 'Pre-axial mirror polydactyly': 1, 'MIP+': 1, 'mirror-image eye anomalies': 1, 'Erlenmeyer flask deformity of distal tibia and fibula': 1, 'LSS lesions': 1, 'mirror image liver': 1, 'Periostosis of the tibia and fibula': 1, 'deformity of the tibia or fibula': 2, 'of the tibia and fibula': 2, 'MIP ( C': 1, 'MDA': 1, 'mirror-image polydactyly of hands and feet': 1, 'Mirror-image polydactyly of hands and feet': 1, 'long lesion of the tibia and fibula': 1, 'mirror hand and seven fingers': 1, 'S-MIP-17-54': 1, 'LOCALIZATION LSS': 1, 'MIH': 1, 'deformity of the tibia and fibula': 1, 'mirror feet and nose anomalies': 1, 'fracture at the tibia, fibula, humerus, radius, or ulna': 1, 'DNMS-LSS': 1, 'tibia and fibula fusions': 1, 'malformations of the tibia and fibula': 1, 'Diastasis of the distal tibia and fibula': 1, 'MVFDH': 1, 'S-MIP-17-19': 1, 'LSS SSc': 1, 'mirror-image lung syndrome': 2, 'MIP-MOD': 1, 'Mirror-image': 1, 'fracture of the ulna, radius, tibia, or fibula': 1, 'RUFT': 1, 'radial, ulnar, tibia, and fibula': 1, 'radius, ulna, tibia, and fibula fractures': 1, 'Fractures of the ulna, radius, tibia, or fibula': 1, 'LSS.METHODSThe': 1, 'tibia/fibula and': 1, 'Mirror hand (ulnar dimelia': 1, 'fibula/tibia deficiencies': 1, 'tibia and ulna nonunions': 1, 'MIP TB': 1, 'Cerebral mirror-imaging': 1, 'HMC': 2, 'Hand mirror cell': 1, 'MIP P': 1, 'patella, tibia, fibula': 1, 'Mirror-image errors': 1, 'swelling of the tibia or fibula': 1, 'Hand mirror': 1, 'ulna, humerus and tibia': 1, 'MIRROR IMAGE OLIGONUCLEOTIDES': 1, 'postoperative LSS': 1, 'fibula, tibia': 1, 'Laurin-Sandrow': 1, 'ML': 1, 'mirror-image malrotation': 1, 'left mirror hand and ulnar duplication': 1, 'MPM tumors': 1, 'mirror-image polydactyly-1': 1, 'tibia and fibula epiphyseal displacement': 1, 'epiphyseal displacement of distal tibia and fibula': 1, 'MA': 1, 'MIP-MY': 1, 'open fracture of radius, ulna, tibia and fibula': 1, 'Mirror image polydactyly 1': 1, 'absence, hypoplasia or dysplasia of the radius': 1, 'Mirror image lung syndrome': 1, 'impairment of mirror image discrimination': 1, 'Mirror polydactyly': 1, 'Lauren Sandrow': 1, 'proximal skeletal anomalies of the fibula or tibia': 1, 'anomalies of fibula and tibia': 1, 'tibia/ fibula': 1, 'involuntary mirror': 1, 'mirror image polydactyly': 3, 'pre-axial mirror polydactyly of': 1, 'mirror image syndrome': 1, 'P-MIP-17-37': 1, 'MIP-SOL': 1, 'Impaired mirror-image imitation': 1, 'TMIP': 3, 'Deformity of the tibia and fibula': 1, 'tibia and fibula shortening': 1, 'shortened tibia and fibula': 1, 'Mirror-Image Polydactyly': 1, 'distal tibia and fibula diastasis': 1, 'Distal tibia-fibula diastasis': 1, 'tibia and fibula diastasis': 1, 'Distal tibia and fibula diastasis': 1, 'tumors in the tibia/fibula': 1, 'aseptic nonunion of the tibia and/or fibula': 1, 'positional abnormality of the ipsilateral tibia and fibula': 1, 'or tibia/fibula': 1, 'tibia-fibula synostosisand': 1, 'hand-mirror cell': 1, 'LSS Lewis-Sumner syndrome': 1, 'sclerosis of tibia and fibula': 1, 'MIP.1': 1, 'tibiae and fibulae': 1, 'mirror image Berry syndrome': 1, 'Mirror image Berry syndrome': 1, '-LSS': 1, 'diastasis of the distal tibia and fibula': 1, 'duplication of the ulna in radius defect': 1, 'mirror hand or polydactyly': 1, 'polydactyly d - mirror hand IV': 1, 'Mirror-image confusions': 1, 'Mirror-image confusion': 1, 'Preaxial mirror polydactyly of foot': 1, 'Hand-mirror': 1, 'MIP adenocarcinoma': 1, 'humerus, radius, ulnar, femur, or tibia': 1, 'Sandrow': 1, 'Laurin': 1, 'FAATL': 1, 'refracture of the tibia or fibula': 1, 'Mirror-Image Dextrocardia': 1, 'mirror image disorder': 1, 'mirror hand abnormality': 1, 'erosion of tibia and fibula': 1, 'necrosis of both the tibia and fibula': 1, '-MIP': 2, 'LSS-A': 1, 'mirror image polydactyly of toes': 1, 'MIO': 1, 'HEAD-MIP': 2, 'Fused tibia-fibula': 1, 'Mirror neuron abnormalities': 1, 'fracture of the radius, ulna, tibia, or fibula': 1, 'dysmelia of the tibia and fibula': 1, 'NOD.MIP': 1}
|
LSS
|
Disease
|
MESH:C535690
|
{'long-chain acyl CoA dehydrogenase deficiency': 3, 'Long-chain acyl CoA dehydrogenase deficiency': 1, 'deficient in LCAD': 1, 'LCAD-deficient': 6, 'long-chain acyl-CoA dehydrogenase deficiency': 57, 'LCAD deficiency': 20, 'Long-chain acyl-CoA dehydrogenase (LCAD) deficiency': 5, '-Long Chain Acyl-Coa Dehydrogenase Deficiency': 1, 'long-chain Acyl-CoA dehydrogenase deficiency': 1, 'LCAD': 40, 'long-chain L3-hydroxyl-CoA dehydrogenase deficiency': 1, 'long-chain L3-hydroxyl-COA dehydrogenase deficiency': 1, 'deficiency of long-chain acyl-CoA synthetase (ACSL)1': 1, 'Long-chain acylcarnitine deficiency': 1, 'long chain acyl CoA dehydrogenase deficiency': 4, 'LACSs': 5, 'long-chain acyl dehydrogenase deficiency': 4, 'long chain acyl-CoA dehydrogenase deficiency': 5, 'Lcad': 1, 'long chain acyl-coa dehydrogenase deficiency': 1, 'Long chain hydroxyacylCoA dehydrogenase deficiency': 1, 'long-chain hydroxyacylCoA dehydrogenase deficiency': 1, 'long-chain acyl-CoA dehydrogenase-deficient': 4, 'deficiency of long-chain acyl-CoA dehydrogenase': 2, 'long chain acyl-CoA deficiency': 1, 'Long-chain acyl dehydrogenase deficiency': 5, 'Myeloid-Specific Deficiency of Long-Chain Acyl CoA Synthetase 4': 2, 'Long-Chain Acyl-CoA Dehydrogenase (LCAD) deficiency': 1, 'ACSL': 3, 'long-chain acyl CoA dehydrogenase': 1, 'LCAD(-/-)': 1, 'long-chain acyl-CoA dehydrogenase (LCAD) deficiency': 3, 'LCAD deficient': 4, 'LCAD-/-': 2, 'deficiency of LCAD': 3, 'long-chain acyl-CoA dehydrogenase and trifunctional protein deficiencies': 1, 'deficiencies of LCAD': 1, 'long-chain AcylCoA dehydrogenase deficiency': 1, 'long chain acyl-CoA dehydrogenase (LCAD) deficiency': 2, 'long-chain hydroxyl-acyl-CoA dehydrogenase deficiency': 1, 'LCCoA': 1, 'CESLAC': 2, 'LCAD-like': 1, 'long-chain acyl-CoA dehydrogenase (ACD) deficiency': 1, 'ULC': 1, 'LCAD dehydrogenase deficiency': 1, 'long-chain acid dehydrogenase deficiency': 1, 'long-chain acyl-CoA dehydrogenase (LCHAD) deficiency': 1, 'long-chain PUFA deficiency': 1, 'long-chain acyl-CoA': 1, 'long chain acyl CoA dehydrogenase': 2, 'LC-CoA': 1, 'LCACs': 2, 'LCHADD': 3, 'deficiency of long chain acyl-CoA dehydrogenase': 1, 'long ACLs': 1, 'long-chain acyl-CoA dehydrogenase': 3, 'Long chain acyl dehydrogenase deficiency': 1, 'Long-chain acyl CoA Dehydrogenase deficiency': 1, 'LCC': 1, 'isolated long-chain keto acyl-CoA (LCKAT) deficiency': 1, 'ACSLs': 1, 'long-chain acetyl-CoA dehydrogenase deficiency': 1, 'Long-chain acyl-CoA dehydrogenase deficiency': 5, 'long-chain acyl-coA dehydrogenase deficiency': 1, 'long chain Acyl-CoA Dehydrogenase deficiency': 1, 'Long-chain PUFA (LCP) deficiency': 1, 'LCHAD-5': 1, 'LCHAD deficiencies': 1, 'LCHAD deficiency': 2, 'LCHAD': 2, 'LCHAD (2': 1, 'Long Chain Acyl CoA Dehydrogenase Deficiency': 1, 'LCAD deficiencies': 1, 'Long-chain fatty-acyl CoA dehydrogenase deficiency': 2, 'long chain dehydrogenase deficiency': 1, 'LCAD-deficiency': 2, 'Long Chain Acyl-CoA Dehydrogenase Deficiency': 1, 'CESLAC ASD': 1, 'mitochondrial long-chain ACSs': 1, 'Ac-LCAD': 1, 'long-chain cyl-CoA dehydrogenase deficiency': 1, 'Long chain acyl-CoA dehydrogenase deficiency': 1, 'HT-LCHAD': 1, 'Long chain Acyl-CoA dehydrogenase defect': 1, 'long chain acyl coa deficiency': 1, 'PSLDR': 1, 'long-chain L-3hydroxyacyl-CoA dehydrogenase deficiency': 1, 'long-chain ACAD deficiencies': 1, 'long-chain acylcarnitine dehydrogenase deficiency': 1, 'Long-chain acyl-CoA dehydrogenase (LACD) deficiencies': 1, 'LACD deficiency': 1, 'cardiac long acyl chain PL remodelling': 1, 'LCAs': 1, 'ACADL deficiency': 1, 'LCAD- deficient': 1, 'Long-Chain Acyl-CoA Dehydrogenase Deficiency': 1, 'long-chain acyl-CoA dehydrogenase [LCAD] deficiencies': 1, 'or long chain acyl-CoA dehydrogenase': 1, 'Muscle long-chain acyl CoA esters': 1, 'LCAD-': 1, 'long-chain acyl-CoA dehydrogenase deficient': 1, 'long-chain FAO deficiency': 1, 'Short chain and long chain acyl-CoA dehydrogenase deficiencies': 1, '-long-chain acyl-CoA dehydrogenase': 1, 'LACS': 2, 'Long Chain Hydroxyl Acyl CoA Dehydrogenase Deficiency': 1, 'long chain acyl-carnitine abnormalities': 1, 'long-chain 3-hydroxyl acyl-CoA dehydrogenase deficiency': 1, 'LCHAD Deficiency': 1, 'long-chain Acyl-CoA dehydrogenase': 1, 'long chain acyl CoA dehydrogenase deficiency36': 1, 'Long Chain acyl-CoA Dehydrogenase Deficiency': 1, 'long chain acyl CoA 377': 1}
|
long-chain acyl-CoA dehydrogenase deficiency
|
Disease
|
MESH:C535692
|
{'tubular injury molecule-1': 1, 'SALMs': 9, 'SALM': 3, 'JAMs': 73, 'BIVALENT MOLECULES': 1, 'MOLECULES': 90, 'ANTIBODY MOLECULE': 1, 'MTi': 1, 'SENSOR MOLECULES': 1, 'ANTIANGIOGENEIC MOLECULES': 1, 'SMALL MOLECULES': 71, 'SMALL MOLECULE': 51, 'CELL ADHESION MOLECULES CAMS': 12, 'RELM': 13, 'RELMs': 4, 'RRMs': 4, 'A-D-A SMAs': 1, 'ROLE OF CELL-ADHESION MOLECULES': 1, 'ADHESION MOLECULES AT INHIBITORY SYNAPSES': 1, 'OTHER CELL ADHESION MOLECULES': 1, 'LARGE MOLECULES': 4, 'DAMP': 23, 'POLYATOMIC MOLECULES': 1, 'MOLECULE': 35, 'Molecule Disease': 9, 'CAMs': 34, 'MAS': 3, 'AMOG deficiency': 1, 'PROTAC': 7, 'LIKE MOLECULES': 1, 'CLIM': 4, 'OTHER BONE REGULATORY MOLECULES': 1, 'SMALL MOLECULE LIGAND': 1, 'POST': 2, 'Molecules Diseases': 6, 'SMALL-MOLECULE': 21, 'CAM defects': 1, 'proinflammatory adhesion molecules': 2, 'ICMs': 15, 'UNDERLIE SMALL-MOLECULE': 1, 'EMM': 1, 'NSMs': 1, 'SMM': 17, 'DUAL FACED MOLECULE': 1, 'S-SCAM': 2, 'MOLECULES FROM L': 1, 'PIPERAZINE MOLECULE': 1, 'SM': 20, 'AMCSMMA': 1, 'ICM': 15, 'inflammatory adhesion molecules': 24, 'JAML': 6, 'SMMs': 2, 'HVM': 1, 'STIM': 1, 'QTAIM': 35, 'HALF-MOLECULES OF': 1, 'inflammatory molecules': 45, 'TM': 4, 'adhesion molecules': 3, 'PURINERGIC MOLECULES': 1, 'DANGER MOLECULES': 1, 'HDMs': 9, 'JMs': 17, 'THIAZOLIDE SMALL MOLECULE MODULATORS': 1, 'JM': 21, 'AM': 7, 'CBM': 1, 'CHROMATOGRAPHY OF SMALL MOLECULES': 1, 'SMALL MOLECULE AGENTS': 1, 'ISOLATED MOLECULES': 1, 'BDM': 1, 'COMBINING SMALL MOLECULE INHIBITORS': 1, 'ALLERGEN MOLECULES': 1, 'VALUABLE MOLECULE': 1, 'ARMs': 1, 'ITMN': 1, 'EPIGENETIC MODIFICATIONS OF INFLAMMATORY MOLECULES': 1, 'Defense Molecules': 1, 'SMALL MOLECULE ACTIVATION': 1, 'DAM': 1, 'DAMPs': 15, 'TARGETED SMALL-MOLECULE INHIBITORS': 1, 'ADHESION MOLECULES': 11, 'DNAM': 2, 'MFs': 2, 'SMALL MOLECULE THERAPEUTIC STRATEGIES': 1, 'inflammatory adhesion molecule': 8, 'Neuroactive Molecules': 1, 'SMP': 2, 'LYMPHOCYTIC ACTIVATION MOLECULES': 1, 'SMI': 14, 'SMIs': 6, 'CM': 8, 'OBTAINING SAPONIN MOLECULES': 1, 'CELL_ADHESION_MOLECULES_CAMS': 3, 'RIGHT MOLECULE': 1, 'SMOL': 1, 'NAEs': 1, 'A-D-A SMA': 1, 'SMALL MOLECULE APELIN MIMETIC': 1, 'NEN': 1, 'BEYOND MOLECULES': 1, 'ADHESION MOLECULE ANTAGONISTS': 1, 'GLUTAMATERGIC MOLECULES': 1, 'RRM': 2, 'CMs': 2, 'BIOCHEMICAL MOLECULE': 1, 'CSMM': 1, 'CELL ADHESION MOLECULES': 6, 'CRUCIAL MOLECULES': 1, 'SMALL-MOLECULE TREATMENTS': 1, 'MOLECULES ISOLATED': 1, 'RESPONSES OF INDIVIDUAL BIOLOGICAL MOLECULES TO STIMULI': 1, 'CLMs': 1, 'RIM-I': 1, 'TSS': 1, 'IMMUNE MOLECULES': 2, 'RIAM': 3, 'RIAM deficiency': 5, 'STIM deficiency': 1, 'SMID': 2, 'SMALL MOLECULE SCREENS': 1, 'BIOACTIVE SMALL MOLECULES': 1, 'SMKIs': 18, 'SMC': 4, 'SMASh': 3, 'RIMs': 5, 'IGAIM': 1, 'ION-MOLECULE': 1, 'ION-MOLECULE REACTION': 1, 'MPM': 8, 'neuropathic molecules': 1, 'cytotoxic molecules': 9, 'SMCypIs': 1, 'LC': 1, 'SPM': 1, 'FROM MOLECULES': 3, 'ICOS': 8, 'UMI': 12, 'SMALL MOLECULE INHIBITORS': 17, 'PENETRATION OF NON-ELECTROLYTE MOLECULES': 1, 'NMSM': 1, 'ICPs': 3, '-CUE MOLECULES': 1, 'psychotic molecules': 1, 'TRAM': 12, 'proinflammatory molecules': 7, 'IM': 2, 'MM': 3, 'TME': 1, 'UNCHARGED MOLECULES': 1, 'adhesion molecule deficiency': 2, 'nCM': 1, 'Molecules': 13, 'EAM': 1, 'AMs': 3, 'SM-': 1, 'SMirN': 1, 'MESSENGER MOLECULE': 1, 'RSLs': 1, 'adhesion-molecule deficiencies': 1, 'CELL ADHESION MOLECULE': 1, 'SMALL MOLECULE HDP': 1, 'inflammatory Molecule': 1, 'TMA': 1, 'RIAM-deficient': 1, 'ACID MOLECULE': 1, 'NoremE': 2, 'jin': 1, 'MG': 2, 'OTHER MEDICINAL MOLECULES EXTRACTED FROM': 1, 'stromal interaction molecule 1 deficiency': 2, 'SMALL MOLECULE DISCOVERY': 1, 'SMALL MOLECULE CALCEIN': 1, 'DI': 1, 'SMALL MOLECULE STUDIES': 1, 'HDM': 6, 'IH JMs': 1, 'SMALL-MOLECULE MODULATORS OF': 1, 'JAM-A deficiency': 2, 'JAM-A-deficiency': 2, 'CPRMs': 1, 'cuproptosis-related molecules': 1, 'AROMATIC MOLECULES': 1, 'CONFIGURATION OF NUCLEIC ACID MOLECULES': 1, '10X_RESCUED_MOLECULE': 1, 'COSTIMULATORY MOLECULES': 2, 'CSMs': 2, 'NEIBM': 1, 'CMRGs': 1, 'renal injury molecule-1': 3, 'carcinogenic molecule': 1, 'SMS': 5, 'CAM': 8, 'CO-STIMULATORY MOLECULES': 2, 'ADHESION MOLECULES PROVIDING': 1, 'CO-INHIBITORY MOLECULES': 1, 'PM': 1, 'SMIDs': 1, 'IRMs': 1, 'IRM': 2, 'RIM': 13, 'MIT': 2, 'NUCLEIC ACID MOLECULE': 1, 'ELECTRON SPIN RESONANCE EXAMINATION OF MOLECULES': 1, '-molecule': 1, 'POTENTIAL MOLECULE TARGET FOR': 1, 'MAMs': 1, 'RELM-beta deficiency': 1, 'carcinogenic molecules': 3, 'WM': 2, 'RIM-BP': 3, 'ARRANGEMENT OF FILIFORM MOLECULES': 1, 'SHAPE OF PROTEIN MOLECULES': 1, 'Deficiency of adhesion molecules': 1, 'SMALL MOLECULE MULTI-CYCLIN': 1, 'L-MBE': 1, 'IMMUNOMODULATORY MOLECULES': 1, 'Damage Associated Molecular Pattern molecule': 1, 'leishmanial Molecule': 1, 'PIM': 4, 'TROPONIN MOLECULES': 1, 'MMs': 1, 'RESCUED_MOLECULE': 1, 'BSAB MOLECULES': 1, 'ANNOTATION OF SMALL MOLECULES': 1, 'renal adhesion molecules': 1, 'CMS': 3, 'BIOACTIVE MOLECULES IN': 1, 'mcJM': 1, 'QSM': 2, 'hepatotoxic and carcinogenic molecules': 1, 'SYNTHETIC CIRCULAR RNAs AS THERAPEUTIC MOLECULES': 1, 'SMIR': 1, 'MOLECULES REGULATING': 2, 'QTAIM deficiencies': 1, 'MPH': 1, 'TTM': 4, 'OSMs': 3, 'OSM': 4, 'NECTIN-LIKE MOLECULES': 1, 'Molecule': 6, 'SMALL MOLECULE NONKINASE': 1, 'SMALL MOLECULE KINASE INHIBITORS': 1, 'MULTIKINASE SMALL MOLECULE': 1, 'FM': 4, 'RAM': 1, 'CHECKPOINT MOLECULES': 5, 'SMALL-MOLECULE INHIBITORS': 9, 'MOLECULES INVOLVED': 1, 'STIM1 deficiency': 1, 'SMMR': 1, 'LPAM': 1, 'Retnla deficiency': 1, 'TARGET MOLECULES': 2, 'DELIVERY OF SMALL MOLECULES': 1, 'FROM PRO-INFLAMMATORY MOLECULES TO': 1, 'ALPHA-AMYLASE MOLECULE': 1, 'HALF-MOLECULES': 2, 'PHOTOACTIVE MOLECULES': 1, 'BIOACTIVE MOLECULES': 4, 'ABC TRANSPORTERS THAT EXPORT REGULATORY MOLECULES': 1, 'COSMIC': 1, 'Helminth Defense Molecules': 1, 'PROTACs': 5, 'UNDISSOCIATED MOLECULES': 1, 'SMALL MOLECULE INTERACTIONS': 1, 'mtDNA duplication': 1, 'FROM MOLECULES TO INFINITY': 1, 'NME': 1, 'BAMP': 1, 'MOMA': 1, 'CM-positive type 1 disease': 1, 'Dial-a-Molecule': 2, 'PROTECTIVE ACTIVITY OF SOME ANTIPROTEOLYTIC MOLECULES': 1, 'NEUROPROTECTIVE MOLECULES': 1, 'SMALL MOLECULE DELIVERY': 2, 'AIM': 2, 'ICPMs': 1, 'leucocyte adhesion molecule deficiency': 2, 'SMALL REGULATORY MOLECULES': 1, 'MOLECULE WITH COMPLEX FUNCTIONS': 1, 'HALF-MOLECULE': 1, 'MML': 1, 'COL@PLA': 1, 'SMALL MOLECULE REGULATORS': 1, 'AD': 1, 'adhesion molecule deficiencies': 1, 'SHAPES OF MOLECULES WITH COVALENT BONDS': 1, 'BIOLOGICAL MOLECULES': 1, 'BSMs': 1, 'LEM-deficient': 1, 'CAMS': 1, 'cHA': 1, 'deficiency of adhesion molecules': 1, 'SCREENING ON SMM BY': 1, '-MOLECULE': 1, 'SMALL MOLECULE PHENOTYPIC SCREENING': 1, 'MICAL-MO': 1, 'TFM': 1, 'AEM': 1, 'PHARAMCOLOGICAL VALUE OF SOME 4-CARBON MOLECULES': 1, 'ANAMs': 1, 'SECRETED MOLECULES': 1, 'phytotoxic molecules': 2, 'IMR': 1, 'TARGETING COSTIMULATORY MOLECULES': 1, 'UCM': 2, 'nodal CM': 2, 'SMALL MOLECULE INHIBITOR': 1, '-SMALL MOLECULE': 1, 'COMPLEX MOLECULES': 1, 'MICAL': 4, 'Molecules carcinoma': 1, 'BIOACTIVE MOLECULES IN ORCHESTRATING CELL DIFFERENTIATION': 1, 'SMALL MOLECULE ANTI-AGGREGATES': 1, 'JAM-A': 2, 'Disorders of neuromodulators and small molecules': 1, 'NOMS': 1, 'hepatic inflammatory molecules': 1, 'LOMO': 1, 'IIM': 1, 'INVOLVEMENT OF DIVERSE MOLECULES': 1, 'CAG-tTS': 1, 'tTS': 1, 'NMC': 1, 'CMLs': 1, 'SMALL MOLECULES TARGETING HUMAN': 1, 'PPR': 1, 'SSMs': 1, 'THE ROLE OF PRO-RESOLVING MOLECULES': 1, 'SMKI': 7, 'APPROVED MOLECULE-': 1, 'JAMS': 1, 'Fibrotic Molecule': 1, 'RGMs': 5, 'S4 LMS': 1, 'LMS': 1, 'MMS': 1, 'CANDIDATE MOLECULE': 1, 'ESSENTIAL MOLECULE': 1, 'SMALL UNCHARGED MOLECULES': 1, 'necrosis-related molecules': 1, 'SMALL MOLECULE AGENT': 1, 'MOLECULES THAT': 2, 'OTHER SMALL MOLECULES': 1, 'MTSM': 1, 'UNIQUE MICROBIOTA-ASSOCIATED MOLECULES': 1, 'THERAPEUTIC MOLECULES': 1, 'FL': 1, 'PPM': 1, 'MOL': 1, 'CAD-SOAR': 1, 'SMALL-MOLECULE APPROACH': 1, 'DISCOVERING SMALL MOLECULE THERAPEUTICS': 1, 'PD': 1, 'RGM-A-deficient': 1, 'RGM-A+/-': 1, 'SMALL MOLECULE THERAPEUTICS': 1, 'SMALL-MOLECULE ACTIVATORS': 1, 'lipotoxic molecules': 2, 'LINKING HALF-MOLECULES': 1, 'Necls': 1, 'PASS': 1, 'EME': 1, 'INTERCELLULAR ADHESION MOLECULE': 1, 'MOI': 1, 'MotM': 1, 'of adhesion molecules': 1, 'SMALL-MOLECULE beta-SECRETASE INHIBITORS': 1, 'SMRT': 1, 'MoD': 1, 'TWO-MOLECULE': 1, 'MOLECULES ESSENTIAL': 1, 'NGM': 1, 'NGMs': 2, 'SULFANILAMIDE MOLECULE': 1, 'TARGETING ADHESION MOLECULES': 1, 'SMALL MOLECULE P75': 1, 'CARGO MOLECULES': 1, 'VIgLs': 1, 'radioactive molecules': 1, 'COMPARED TO SMALL MOLECULE': 1, 'MOVEMENT OF MOLECULES': 1, 'SMALL MOLECULE MODULATORS': 1, 'ALN-PCS': 1, 'S-SCAM deficiency': 1, 'SMD': 1, 'ANTIANGIOGENIC MOLECULES': 1, 'SLMs': 2, 'NMLSMR': 1, 'CONFIGURATION OF PHOTOCHROMIC MOLECULES AND': 1, 'ADHESION MOLECULE': 2, 'SMAC': 1, 'OTHER LARGE MOLECULES': 1, 'CHARACTERIZED MOLECULES': 1, 'QSMs': 1, 'HYDROGEN MOLECULE': 2, 'GENERIS MOLECULE': 1, 'MULTIFUNCTIONAL MOLECULES': 1, 'MOLECULES IN EVOLUTION': 1, 'MOLECULES WITH': 1, 'TARGETING SMALL MOLECULE ACTIVATORS OF': 1, 'SALICYLATE MOLECULE': 1, 'BDMs': 1, 'AN INFAMOUS MOLECULE': 1, 'MB': 1, 'PHOTORESPONSIVE MOLECULES': 1, 'Retnla': 1, 'SMALL MOLECULES WITH': 1, 'EFFECTS OF ADHESION MOLECULES': 1, 'PHICS': 3, 'ALPHA-CHYMOTRYPSIN MOLECULES': 1, 'THE MOLECULES INVOLVED': 1, 'DAMPS': 2, 'proinflammatory damage associated molecular pattern molecules': 1, 'FAIM defects': 1, 'SMSD': 2, 'MMiN': 1, 'MOLECULE 1': 1, 'renal injury molecule 1': 3, 'A-D-A-type SMs': 1, 'TPM': 1, 'OAA': 1, 'CM-': 1, 'SMs': 3, 'A-D-A type SMAs': 1, 'SMAs': 2, 'TARGET MOLECULE': 2, 'ADHESION MOLECULES CAMS': 2, 'AGMs': 3, 'MAXWELLIAN MOLECULES': 1, 'Molecule Disorders': 1, 'Small Molecule Disorders': 2, 'TO MOLECULES': 1, 'scFOS': 1, 'SMALL MOLECULE MODULATORS OF KATS AS': 1, 'SCREENING OF SMALL-MOLECULE INHIBITORS': 1, 'RDM': 1, 'SUPPRESIVE MOLECULES': 1, 'NRM': 2, 'UMIs': 2, 'NFSMs': 1, 'SMA': 3, 'DISCOVERING SMALL MOLECULES': 1, 'CHAIN MOLECULES': 1, 'NAMs': 1, 'SMALL-MOLECULE CREATION': 1, 'SMMM': 1, 'FMD': 1, 'TROPOCOLLAGEN MOLECULE': 1, 'MOLECULE FOR': 1, 'HTIO-O1,2': 1, 'Molecules Diseases': 1, 'CYTOTOXIC MOLECULES': 1, 'helminth defence molecule': 1, 'ANTIMICROBIAL MOLECULES': 4, 'MIC': 2, 'mcJMs': 1, 'NHCs': 1, 'JUNCTIONAL ADHESION MOLECULE': 1, 'ATP MOLECULES': 1, 'IPC': 1, 'SMALL MOLECULE CHEMOTYPES': 1, 'GLYCOGENIC MOLECULE': 1, 'Inflammatory Molecules': 1, '-Inflammatory Molecules': 1, 'mc-JMs': 1, 'TSMs': 1, 'SMTs': 2, 'GAMMA-MOLECULES': 1, 'ADHESION MOLECULES THAT': 1, 'SMALL MOLECULES TARGETING': 3, 'Complex molecules defects': 1, 'DAMs': 1, 'adhesion molecules disease': 1, 'ANTI-ANGIOGENIC MOLECULES': 1, 'VAMs': 1, 'CSML': 1, 'SMLs': 1, 'MACRO-MOLECULE': 1, 'SAM': 1, 'TRAM deficiency': 1, 'SMALL-MOLECULE INHIBITORS OF': 2, 'MNF-MOLECULE': 1, 'MOLECULE VINTAGE': 1, 'NEC': 1, 'CMGs': 4, 'IDENTIFICATION OF MECHANOSENSITIVE MOLECULES': 1, 'OF MOLECULES': 1, 'BIORECOGNITION MOLECULES': 1, 'SMALL-MOLECULE THERAPEUTICS': 1, 'CHLOROPHYLL MOLECULE': 1, 'MOTM': 1, 'RELMalpha deficiency': 1, 'RGM dysfunction': 1, 'MAM': 4, 'MF': 2, 'SQD': 1, 'HALF MOLECULES': 2, 'EM': 2, 'TARGET MOLECULE IN': 1, 'SM-TF': 1, 'inflammatory homeostasis-associated molecular pattern molecules': 1, 'HAMPs': 1, 'NEUROACTIVE MOLECULES': 1, 'CANDIDATE MOLECULES OF THERAPEUTIC TARGETS': 1, 'GLYCOSPHINGOLIPIDS AS FUNCTIONAL MOLECULES': 1, 'SMALL MOLECULE CANDIDATES': 1, 'ITS ACTIVE MOLECULES': 1, 'EFFECTS OF ACTIVE MOLECULES': 1, 'ACTIVE MOLECULES': 1, 'SHAPE OF MOLECULES TO': 1, 'PRPC MOLECULE PRODUCE': 1, 'THEIR CAUSATIVE MOLECULES': 1, 'DBP': 1, 'SMALL MOLECULE LF INHIBITORS': 1, 'deficiency of GPI-linked molecules': 1, 'DAMP MOLECULES': 1, 'MLSMR-GDB': 1, 'SMALL MOLECULE TARGET': 1, 'PRECLINICAL SMALL MOLECULES': 1, 'MOLER': 1, 'MATRIX-ASSOCIATED MOLECULES': 1, 'Nodal CM': 1, 'PHARMACOLOGICALLY POTENT MOLECULE': 1, 'SET MOLECULES': 1, 'TWO-FACED MOLECULES': 1, 'DIFFERENT FROM THAT OF GAS MOLECULES': 1, 'SMALL MOLECULE ANTAGONIST': 1, 'ERM': 1, 'MASMs': 1, 'DMs': 3, 'SMALL MOLECULE MMP': 1, 'SENESCENCE-RELATED MOLECULES': 1, 'SATELLITE MOLECULES': 1, 'ASAM': 1, 'S-SCAM KD': 1, 'LOCALIZATION OF MOLECULES': 1, 'TSs': 1, 'MIs': 1, 'ADHESION_MOLECULES_CAMS': 1, 'SUBSET OF MOLECULES THAT MODULATES PACLITAXEL': 1, 'NEURAL CELL ADHESION MOLECULE': 1, 'MO': 1, 'SMALL-MOLECULE KINASE INHIBITORS': 1, 'SMALL MOLECULE LIBRARY': 2, 'THERAPEUTIC MOLECULE DELIVERY': 1, 'AT-1976': 1, 'SOME NITRATED HETEROCYCLIC MOLECULES': 1, 'CARBOHYDRATES IN PROTEIN MOLECULES': 1, 'N-RGMa': 1, 'SMPDB': 1, "SMPDB's disease": 1, 'IMs': 1, 'MRM': 1, 'MDF': 1, 'JOINT MOLECULES': 1, 'ACCESSORY MOLECULES': 1, 'BMGs': 1, 'COMPLEX MOLECULE ACCUMULATION DEFECTS': 1, 'COMPLEX MOLECULE SYNTHESIS': 1, 'CENTRAL MOLECULE': 1, 'SMALL MOLECULES AS REGULATORS OF BONE MASSParathyroid hormone': 1, 'GLOBULAR PORTION OF HA MOLECULE': 1, 'HA MOLECULE': 1, 'SYNAPTOGENIC MOLECULES': 1, 'OF CIRCULAR MOLECULES': 1, 'MOLECULE INHIBITOR': 1, 'CM+': 1, 'dHJ-JM': 1, 'OTHER AXON GUIDANCE MOLECULES INVOLVED': 1, 'AXON GUIDANCE MOLECULES': 1, 'Molecules Organismal Injury and Abnormalities': 1, 'TRANSFORM STEROID MOLECULES': 1, 'SMASH': 1, 'vascular adhesion molecule abnormalities': 1, 'GMT-ALL': 1, 'ALL': 1, 'carcinogenic aromatic molecules': 1, 'TARGETED DELIVERY OF PROANGIOGENIC MOLECULES': 1, 'OTHER MOLECULES': 1, 'SMALL-MOLECULE PROTEIN': 1, 'SMTAs': 1, 'MAT': 2, 'TARGETING MOLECULE': 1, 'MOLECULES ARE': 1, 'SMALL-MOLECULE DEPICTION': 1, 'SMKI IFI': 1, 'NMs': 1, 'proinflammatory adhesion molecule': 1, 'LM-Ab': 1, 'IMMUNOREGULATORY MOLECULES': 1, 'CHANNEL MOLECULE': 1, 'IMMUNOGLOBULIN MOLECULES': 1, 'PDM': 1, 'Molecules Disease': 1, 'HM': 1, 'AHL': 1, 'THERAPEUTICS TARGETING HEPCIDIN AND RELEVANT MOLECULES': 1, 'SMMDB': 1, 'SEX-BIASED MOLECULES': 1, 'Small Molecule disorders': 1, 'Small Molecule disordersa': 1, 'MOLECULES OF SOCIAL BEHAVIOR': 1, 'SMALL MOLECULE EVALUTION': 1, 'RELATED MOLECULES': 1, 'ACAM': 1, 'SUM': 1, 'Molecule-2': 1, 'Molecule-1': 1, 'MULTI-TARGET MOLECULE TO': 1, 'AF': 1, 'SCREENING FOR MOLECULES THAT PROMOTE': 1, 'NEUROIMMUNE MOLECULES': 1, 'INFLAMMASOME INHIBITORY MOLECULES': 1, 'complement (related molecule) abnormalities': 1, 'MoM': 1, 'SMALL MOLECULES REGULATE': 1, 'BISPECIFIC MOLECULES': 1, 'MANY-ELECTRON THEORY OF ATOMS AND MOLECULES': 1, 'LAD': 1, 'OBM': 1, 'SMALL MOLECULE REGULATION': 1, 'I-CAM': 1, 'ADHESION_MOLECULES': 1, 'adhesion molecule': 1, 'POPULATION OF ANTIDEXTRAN MOLECULES': 1, 'DIFFERENTIATION MOLECULES': 1, 'SLM': 1, 'NECROSIS-TARGETING MOLECULE': 1, 'SMALL MOLECULE CONPOUNDS': 1, 'aJMs': 1, 'TaCMs': 1, 'ORM': 1, 'Pro-Inflammatory Molecules': 1, 'MOLECULE PROMOTING POSITIVE GROUP': 1, 'SMALL MOLECULES CONTAINING': 1, 'HOMONUCLEAR DIATOMIC MOLECULES': 1, 'OTHER MOLECULES THAT': 1, 'psychoactive molecules': 1, 'COVALENT IMMOBILIZATION BIOACTIVE MOLECULES': 1, 'SMALL MOLECULE SMO ANTAGONISTS': 1, 'AN ANCIENT COMPLEMENT REGULATORY MOLECULE': 1, 'INCORPORATION OF SMALL MOLECULES': 1, 'DONOR MOLECULES': 1, 'MOLECULES IMPLICATED': 1, 'CMOLD': 1, 'CIMs': 1, 'UPSTREAM MOLECULES': 1, 'WITH SMALL MOLECULES': 1, 'SMALL MOLECULES THAT': 1, 'TARGET OF SMALL MOLECULES': 1, 'MARS': 1, 'MENU OF MOLECULES': 1, 'ZCMs': 1, 'TREATMENT OF MULTISTRANDED POLYNUCLEOTIDE MOLECULES': 1, 'MARKED MOLECULES': 1, 'MOLECULE_TYPE': 1, 'nodal CTM': 1, 'Stim': 1, 'Inflammatory Molecule': 1, 'LARGE MOLECULE BIOLOGICS': 1, 'MOLECULES OF INTEREST': 1, 'ISX': 1, 'Tz-RM': 1, 'molecules Diseases': 1, 'OPTIMIZED SMALL MOLECULE': 1, 'N-TERMINI OF ABRI MOLECULES': 1, 'SVLMs': 1, 'PAM': 1, 'HISTOCOMPATIBILITY COMPLEX MOLECULES': 1, 'IMMUNOSUPPRESSIVE MOLECULES INVOLVED': 1, 'SANS FROM BIOLOGICAL MOLECULES IN SOLUTION': 1, 'MULTIPLE MOLECULES': 1, 'MOLECULE TYPE': 1, 'MOLECULES DIFFERING': 1, 'SRMs': 1, 'SMALL-MOLECULE SURROGATES OF alpha-CtxMII': 1, 'DOWNSTREAM MOLECULES': 1, 'renal injury molecules-1': 1, 'inflammatory molecule': 1, 'ADAPTOR MOLECULE': 1, 'SMALL MOLECULES AS DIFFICULTIES': 1}
|
MOLECULES
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.