text
stringlengths 699
822k
| summary
stringlengths 205
4.34k
|
|---|---|
You are an expert at summarizing long articles. Proceed to summarize the following text:
the different forms of periodontitis are mostly chronic inflammations caused by specific anaerobic infections of the subgingival environment . however , destruction of periodontal tissue contributes to proteolytic and osteolytic components of immunological and inflammatory reactions of the host , induced by persisting bacteria in the periodontium . apart from classic periodontal gram - negative bacteria such as a.a . , porphyromonas gingivalis , tanerella forsythia , prevotella intermedia , and eikenella corodens , mammalian herpetic viruses can be also of importance . in addition , human cytomegalovirus ( cmv ) is indicated as a potential etiological factor in atherosclerosis ( 5 ) . a.a . is one of the dominant periodontal pathogens with virulence factors that cause oral and non - oral infections . was also detected in aneurysms and atheromas of patients with cardiovascular diseases [ 810 ] ; however , in some studies the presence of a.a . in atheromas was not confirmed . systemic infection with a.a . can initiate and accelerate inflammation in atherosclerotic plaque of the aortic sinus in hyperlipidemic mice . endothelial dysfunction can be induced by chronic bacterial infection of the periodontal tissues and is considered not only an initiative subclinical stage of the atherosclerotic process , but also a measurable clinical predictive factor of cardiovascular risk . and especially its lipopolysaccharide endotoxin significantly participates in the stimulation of production of different components of non - specific immune response ( eg , increased aggregation of platelets , activation of b - lymphocytes , monocytes and macrophages , and stimulation of production of proinflammatory cytokines ( il-1 , il-6 , il-8 ) and crp , whose increased serum levels were found to be associated with periodontitis and cardiovascular diseases [ 1419 ] . we randomly selected 38 of 166 outpatients with cvd , of which 21 patients had chronic ischemic heart disease ( ihd ) and only 17 had both ihd and essential hypertension ( ht ) . we thought it would be useful to differentiate the group of patients with ihd + ht from those with ihd only , because other studies showed only a weak association between periodontitis and hypertension . other clinical characteristics for the whole group of patients and in the control group , including age , sex , smoking history , hypercholesterolemia , diabetes mellitus and hypertension , were described in our previous study . a standard calibrated probe was used to measure the depth of periodontal sulci of individual sextants for each tooth , thus evaluating a mean depth of periodontal sulcus of each tooth . from the values obtained , a mean value for each patient and then for the whole group of patients was calculated . determination of community periodontal index of treatment needs ( cpitn ) and peridontal depth ( pd ) were determined by measurement of cpitn probes and williams periodontological probes . detection were collected with the use of sterile paper points from the periodontal pocket of the teeth 11 , 16 , 26 , 36 and 46 of each individual patient . in parallel , blood of patients was collected and buffy coats were examined for the presence of a.a . , cmv and chlamydia pneumoniae . after dna extraction from each sample , pcr analysis was performed using the primers specific for given microorganism . in parallel , detection of il-6 was performed by il-6 elisa kit ( immunotech , france ) with a positive value 3 crp was detected by c - reactive protein elisa kit ( immunodiagnostik , germany ) with a positive value 3 mg / l . cholesterol levels were evaluated by a standard method on biochemical analyser vitros-250 with a positive value 4.5 mmol / l . in statistical analysis , student s test , mann - whitney s test , and chi - square test were employed . all tests were performed at the significance level =0.05 , with the use of statistical software spss 15.02022 for windows . a.a . detection in the gingival sulcus by pcr , along with the age , sex , depth of periodontal pockets , crp and il-6 positivity in relation to the ihd only and ihd+ht is shown in table 1 . of 38 examined patients , the presence of a.a . was confirmed in 17 ( 44.7% ) 6 with ihd only and 11 with ihd+ht . the mean age was similar in both groups of patients , irrespective of whether they were a.a - positive or a.a .- negative . sex of patients was also evenly distributed , except for higher proportion of females in the group of a.a .- positive ihd patients . no significant difference in the indices of the probe depth in relation to the presence of a.a . in the periodontal pockets or cvd presentation was observed ( ie , the mean values of pd and cpitn in a.a .- negative patients were 2.80 and 2.32 mm , respectively , as compared to 2.77 and 2.48 mm in a.a .- positive patients [ p=0.729 for pd and p=0.445 for cpitn ] ) . there was also no significant difference in the cholesterol levels and smoking habits in the followed cvd patients ( data not presented ) . both crp and il-6 occurred in significantly higher proportions of a.a .- positive than a.a - negative cvd patients ( p<0.001 for both crp and il-6 ) , regardless of whether they were recruited from the group of those with ihd only or those with both ihd+ht . using the same dna extraction procedure and pcr analysis , we detected cmv in 6 patients ; 4 were a.a .- positive ( 3 with ihd+ht and 1 with ihd only ) and 2 were a.a .- negative ( both with ihd only ) . the presence of bacterial and viral pathogens in the periodontium induces a whole scale of inflammatory and immunological reactions . several products of gram - negative periodontal pathogens , particularly endotoxin , can lead to an increased inflammatory response of the host , thus representing an important risk factor for atherogenesis . . found an association between an increased level of antibodies directed to a.a . and they concluded that the relationship of the host to periodontal pathogens is an independent predictive factor of cardiovascular disease and that the simultaneous presence of a.a . and p.g . in the periodontal pockets in association with elevated concentrations of crp and il-6 significantly increase the risk of atherosclerosis . in our study , we similarly found significant correlation between the presence of a.a . in the gingival sulcus and increased concentrations of il-6 and crp . similar results were confirmed in another study , in which the presence of 1 bacterial pathogen ( a.a . ) was considered to be a possible risk factor of atherosclerosis . in that study , statistically significant correlation between cpitn values and cardiovascular diseases were detected . in our previous studies on cardiovascular patients , we found a correlation between increased proportion of sera containing antibodies to c. pneumoniae , cmv , crp and il-6 . in the gingival sulcus of patients with cvd can stimulate atherosclerosis due to the increased serum concentrations of il-6 and crp . even though we detected a.a . in the periodontal pockets by pcr , the same technique did not reveal this agent in the buffy coat of patients who were studied . a similar discrepancy between detection of the agent in periodontal pocket and atheromatous plaques the presence of a.a . in patients with cvd was associated with significantly higher serum levels of some proinflammatory markers . these findings support the hypothesis that the presence of a.a . added to other periodontal pathogens of the gingival sulcus ( pocket ) of patients with cvd can initiate and stimulate inflammatory process in atherosclerosis . results of this study support the importance of individual and professional oral hygiene procedures in cardiac patients . however , the results should be interpreted with caution because this was only a pilot study with small sample sizes . larger scale studies of patients are warranted to examine the role of a.a . and other periodontopathic bacteria in etiopathogenesis of atherosclerosis . | summarybackgroundover - replication of periodontal pathogens in the periodontium induces production of proinflammatory cytokines and c - reactive protein that can stimulate systemic inflammatory status and can initiate atherosclerosis and its consequences . in our pilot study we examined whether periodontal status and serum levels of interleukin-6 and c - reactive protein are associated with the presence of aggregatibacter actinomycetemcomitans in the periodontium of patients with cardiovascular diseases ( cvd).material / methodswe randomly selected 38 of 166 outpatients with cvd , of which 21 patients had chronic ischemic heart disease ( ihd ) only and 17 had both ihd and essential hypertension ( ht ) .
the presence of aggregatibacter actinomycetemcomitans ( a.a . ) in the periodontium evaluated by pcr was compared with the values of periodontal indices , namely probe depth ( pd ) and community periodontal index of treatment need ( cpitn ) , as well as with interleukin-6 ( il-6 ) and crp serum levels.resultswhen comparing a.a .- positive and a.a .- negative groups of patients , no statistically significant differences were noticed as to the age and values of pd and cpitn , respectively .
however , the proportion of crp and il-6 positive values was significantly higher ( p0.001 ) among a.a .- positive than in a.a .- negative patients.conclusionsthe presence of a.a . in patients with cvd
may be associated with significantly higher serum levels of some proinflammatory markers . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
high levels of host specificity , combined with taxonomic conservatism in microhabitat utilization , suggest that high species richness among flower - visitors has been the result of diversification and adaptation in response to host plant characteristics . for herbivores on leaves , diversification is thought to be in large part the result of coevolutionary responses between herbivores and host plant defenses . we suggest that this is unlikely to be the case on flowers since they are generally less well defended against herbivores than leaves since flowers also must function to attract pollinators , and high levels of defense may hinder reproductive success . we suggest that high species richness and host specificity among flower - visitors could be the result of the requirement to locate unique hosts embedded in a diverse multitude of non - hosts . in most tropical rainforests local plant diversity is typically very high , and , as a consequence , local densities of individual plant species is often very low . in addition , species diversity of plants may also result in high diversity of olfactory and other signals from plants seeking to attract insect pollinators to flowers . specialising on locating one or a few host plant species may shorten searching and decision times , thus conserving energy and reducing exposure to time - based mortality factors . under this scenario , the degree of specialization among the flower - visitor community will be positively associated with the species richness of the flowering plant community , a pattern typical of the species richness of herbivores on leaves . the diversification and dominance of modern angiosperms has long been thought to be the result of the interaction between flowering plants and insect pollinators , and it has been suggested that pollinating beetles in particular were instrumental in promoting early angiosperm diversification . however , the hypothesis that angiosperm diversification was the result of specialist pollination syndromes remains controversial ( see ) , since generalized insect pollination and wind pollinated systems outnumber specialist systems . while there has been a large focus on the evolutionary role of pollinators , most insects that visit flowers probably do not carry out pollination . flowers represent high quality resources to many insects , and while some species inadvertently benefit the host plant by transporting pollen , flower - visiting insects may utilize flowers for a variety of reasons . independent of whether a species is an active pollinator , flower visitation and the utilization of flowers as a resource in tropical forests may still lead to adaptation , diversification and specialization . for example , pollen feeding is proposed to represent the precursor of foliage feeding in many herbivorous groups . floral herbivory therefore , rather than pollination per se , may have played a substantial role in both the diversification of insects and the radiation of angiosperms during the cretaceous . this is consistent with our hypothesis that specialization among flower - visitors is independent of the role played by flower - visiting species and is instead a function of local plant diversity . as our study is one of the few to examine the fauna attracted to flowers in tropical rainforests , it is impossible to know how they generalize to other locations . it seems , however , that there is prima facie reason to expect high levels of specialization rather than low levels . for one , our conclusions are not counter - intuitive or contradictory to existing evidence , but are instead logically consistent ( e.g. ) . what is perhaps surprising is that it has been assumed that flower - visitors ( or species on other microhabitats ) were not likely to display high levels of host specificity or support high species richness ( see ) . the implications of these results for the evolution and estimation of global biodiversity and food web dynamics will require studies documenting the diversity and specialization of flower - visitors in other rainforest locations . while some information is available for some areas or plant groups , detailed examinations of flower - visiting insects are scarce for tropical rainforests . for example , although the fauna and flora of the australian wet tropics is very well known , the pollination biology of less than 1% of the plant species has been studied , and the australian flora is much better known than most tropical rainforest areas . ultimately , the potential for flower - visitors to significantly alter our current understanding of the extent , influence and generation of biodiversity in tropical rainforests means that flower - visitors , not just pollinators , can no longer be ignored | insect biodiversity peaks in tropical rainforest environments where a large but as yet unknown proportion of species are found in the canopy .
while there has been a proliferation of insect biodiversity research undertaken in the rainforest canopy , most studies focus solely on insects that inhabit the foliage . in a recent paper
, we examined the distribution of canopy insects across five microhabitats ( mature leaves , new leaves , flowers , fruit and suspended dead wood ) in an australian tropical rainforest , showing that the density ( per dry weight gram of microhabitat ) of insects on flowers were ten to ten thousand times higher than on the leaves .
flowers also supported a much higher number of species than expected based on their contribution to total forest biomass .
elsewhere we show that most of these beetle species were specialized to flowers with little overlap in species composition between different canopy microhabitats . here
we expand our discussion of the implications of our results with respect to specialization and the generation of insect biodiversity in the rainforest canopy .
lastly , we identify future directions for research into the biodiversity and specialization of flower - visitors in complex tropical rainforests . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a two - year - old boy presented with a right upper eyelid laceration , two hours after a fall from a table . the child was playing with color pencils with his brother during which he sustained the injury . ophthalmic examination revealed a laceration measuring 1.5 cm x 0.5 cm involving the central part of the right eyelid with minimal edema [ fig . the rest of the ocular examination was normal , except that on testing the extraocular movements of the right eye , the child was uncooperative for elevation due to pain . the patient was taken under general anesthesia for a detailed examination and lid laceration repair . however , on the operation table minimal clear fluid coming out through the wound margins was observed . analysis of fluid revealed a beta - tracer protein value of 33.5 mg / l , suggestive of cerebrospinal fluid ( csf ) . the patient underwent an urgent computed tomography ( ct ) scan of the orbit and brain which revealed a linear hyperdense shadow with surrounding hypodensity measuring 4.2 cm x 0.8 cm , suggestive of a broken pencil [ fig . three - dimensional ( 3d ) reconstruction documented that the pencil had penetrated the right frontal lobe through the orbital roof ending just anterior to the anterior horn of the lateral ventricle [ fig . d ] . a multidisciplinary approach consisting of an orbital surgeon and a neurosurgeon was used to manage this patient . after neurosurgical clearance , the orbital surgeon explored the upper eyelid wound and the pencil was removed from the foreign body tract followed by laceration repair [ fig . a craniotomy was then performed by the neurosurgeon which revealed laceration at the base of the right frontal lobe . the defect in the dura was closed with a pericranial graft from the right frontal bone . the patient was started on intravenous third - generation cephalosporin ( ceftriaxone rocephine ) for seven days and had an uneventful recovery . a clinical photograph of the patient showing the eyelid laceration on the right central upper eyelid measuring 1.5 cm 0.5 cm . b , c , d computed tomography ( axial , coronal and sagittal ) of the brain and orbit showing a linear hyperdense foreign body with hypodensity all around it , measuring 4.2 cm 0.8 cm in the right orbit , piercing the orbital roof and the dura , and entering the right frontal lobe . these features were suggestive of a broken pencil , the hyperdensity was due to the central core of the pencil made of lead and the hypodensity surrounding it was due to the wood a - d three - dimensional computed tomography scan showing the trajectory of the pencil . the pencil had penetrated the right frontal lobe through the orbital roof causing a defect in the dura . the tip of the pencil was just anterior to the anterior horn of the lateral ventricle . there was no disruption of major cerebral blood vessels a the broken pencil measuring about 4.2 cm 0.8 cm . b postoperative photograph of the patient at the time of discharge with minimal ptosis of the right upper lid postoperatively there was minimal ptosis of the right upper lid which resolved in a month [ fig . magnetic resonance imaging of brain showed a cortical and subcortical fibrotic lesion measuring 1 mm at the base of the right frontal lobe corresponding to the laceration . at the last follow - up , two years after surgery the patient had no ocular or neurological abnormality . orbito - cranial injuries by foreign bodies are occult if the presenting injury is deemed minimal and the ophthalmological and neurological evaluation are otherwise within normal limits . the roof of the orbit provides one of the easiest entry routes for a foreign body into the brain as it is relatively thin in this location . trivial - appearing eyelid lacerations may camouflage occult deep penetrations and are frequently sutured without further investigation.[68 ] csf leakage is associated with a 20% risk of life - threatening meningitis hence its detection and management is essential to prevent possible life - threatening infections of the central nervous system . in a review of the literature on occult orbito - cranial injuries complications like frontal lobe abscess , meningitis , encephalomeningocele and beta - tp is a highly specific marker for csf , produced mainly in the epithelial cells of the choroid plexus . it has a sensitivity of 93100% and a specificity of 100% for detecting csf leaks . the bn ii nephelometer and the n latex tp test ( dade behring , marburg germany ) are used . samples ( 5 l ) are diluted to a total volume of 500 l with diluens buffer ( dade behring , marburg , germany ) and measured on the nephelometer . the concentration in normal csf is 5.4 - 23.8 mg / l and for serum it is 0.2 - 0.7 the detection of beta - tp from the fluid around the wound margins in our patient was suggestive of csf leak from an occult penetrating orbito - cranial injury . the reason we took the patient under general anesthesia before a definitive radiological procedure is that firstly it gave us a chance to examine the wound thoroughly as the initial ophthalmic examination did not reveal any suspicion of an intraorbital foreign body and secondly a positive beta - tp intra - operatively gave us a very strong indication for ordering a definitive radiological investigation following which a three - dimensional ct scan and further management were performed in the same sitting . a coordinated team approach between an ophthalmologist and neurosurgeon is essential for managing these injuries . we removed the foreign body through the laceration , as this approach gives a faster , less invasive way to extract the foreign body than a craniotomy , and the recovery time is reduced . the detection of beta - tp is currently been used in the field of neurosurgery and otolaryngology to diagnose csf leaks following head injuries , skull base or paranasal sinus surgeries . an online pubmed search was carried out which revealed that the application of beta - tp has never been reported in ophthalmic literature . the detection of beta - tp is simple , rapid ( within 15 min ) and relatively inexpensive , hence we recommend it to be used as a screening procedure before definitive radiological procedures are planned in cases where csf leaks are suspected . | orbito - cranial foreign bodies present a treacherous situation that can escape detection
. the only evidence of these foreign bodies may be the entry wound in the form of a small lid laceration . a two - year - old boy presented with right upper lid laceration following a fall two hours back .
analysis of the fluid around the wound revealed a beta - tracer protein ( beta - tp ) value of 33.5 mg / l suggestive of cerebrospinal fluid ( csf ) .
three - dimensional computed tomography ( ct ) scan revealed a foreign body measuring 4.2 cm 0.8 cm passing from the orbital roof to the frontal lobe .
the foreign body tract was explored through the eyelid laceration and a broken pencil was removed followed by dural patch graft .
the patient developed no ocular or intracranial complications .
beta - tp , a highly specific marker of csf is routinely used in screening patients of neurosurgery and otolaryngology with csf leaks , however , its use has never been reported in ophthalmic literature based on an online pubmed search . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
fragile histidine triad ( fhit ) gene located at chromosome 3p14.2 is a putative tumour suppressor gene involved in the pathogenesis of breast cancer . both genetic and epigenetic alterations in fhit have been implicated in breast carcinoma [ 13 ] . consistent with its proposed function as a tumour suppressor , homozygous genomic deletions within the fhit gene have been observed in a large number of human cancers and cancer cell lines . fhit is a member of histidine triad ( hit ) proteins , which represent a small family of nucleotide - binding and hydrolyzing proteins . hit proteins received attention of cancer biologists because of their downregulated expression in multiple human malignancies . fhit gene deletion or loss of transcription has been reported in head and neck , gastrointestinal [ 6 , 7 ] , cervical , lung breast , [ 10 , 11 ] , kidney , and hematopoietic tumours . chromosomal region 3p14.2 is a frequent target for genetic and cytogenetic alterations in a wide range of solid tumors , leading to the search for a tumour suppressor gene in this region . the function of fhit is directly linked to intracellular signalling and the dna damage response . fhit is frequently involved in biallelic loss and other chromosome abnormalities in tumours [ 16 , 17 ] . fhit deletions , abnormal transcripts , promoter hypermethylation , and associated loss of expression are common in human malignancies . in cancer cells , these events are often associated with deletions directly within the fra3b region , centering on exon 5 of fhit . a high frequency of heterozygous and homozygous deletions with breakpoints within the fragile site region of fhit has been detected in large number of cancers and cancer cell lines [ 5 , 1821 ] . corbin et al . showed multiple , variable deletions in fra3b , even in cells derived from the same tumour , suggesting ongoing instability in the region . the fhit locus contains the most fragile site in the human genome ; fra3b , the papilloma virus integration site , and a familial - kidney - cancer - associated breakpoint t(3;8 ) ( p14.2;q24 ) [ 16 , 35 ] . fhit gene has 10 small exons extend over ~2 mb dna that make up the 1.1 kb cdna . exons 5 to 9 are the coding exons that encode a small protein of 16.8 kd mass . fhit protein is a typical dinucleoside 5,5-p1 , p3-triphosphate ( ap3a ) hydrolase which is highly homologous to ap4a ( diadenosine tetraphosphate ) hydrolase from schizosaccharomyces pombe . the fhit protein exerts its oncosuppressor activity through induction of an apoptotic mechanism that seems to be fas - associated death domain ( fadd ) dependent , caspase-8 mediated , and independent from mitochondrial amplification . loss of fhit protein in cancer is attributed to different genetic alterations that affect fhit gene structure . in tumour - derived cell lines , homozygous deletions that result from the loss of genomic regions containing or surrounding the relevant fhit exons lead to numerous abnormal transcripts that included the absence of various regions between exon 4 and 9 , while the mrnas of the corresponding normal tissues did not exhibit these alterations . in addition to homozygous deletion , fhit gene structure is also subjected to loss of heterozygosity ( loh ) and promoter hypermethylation . the significant association of fhit mutation and hypermethylation leads to the complete inactivation of fhit gene in patients with breast cancer . silencing of the fhit gene by promoter hypermethylation occurs in breast carcinomas , especially those with the significant amount of mutations in its genomic structure . fhit gene methylation was also reported in serum of sporadic breast cancer in a cpg island methylator phenotype ( cimp ) screening . despite the extensive analysis of fhit gene in cancer cells , we aimed to understand the genetic alterations that affect fhit gene in an egyptian population of primary breast cancer patients . recently , we have reported loss of heterozygosity ( loh ) in fhit gene locus and its flanking region on chromosome 3p in egyptian breast cancer patients . to extend the analysis of fhit gene locus in this population , we investigated the incidence of homozygous deletion that targets the fhit gene exons and the correlation between observed deletions . furthermore , we investigated the association between these deletions and the patients ' clinicopathological data . paired normal and tumour tissues were obtained from 62 patients diagnosed with breast carcinomas prior to therapy at the national cancer institute ( cairo , egypt ) . matched the specimens collected and used in the study were obtained under each patient 's consent along with approval . dna extraction from the tumour and safety margin tissues obtained from patients was performed using qiaamp dna minikit method ( qiagen , germany ) as described in the manufacturer 's protocol . this method depends on degradation of the proteins and cell membranes using proteinase k enzyme , precipitation of dna by ethanol ( 96100% ) followed by purification of dna using qiaamp spin columns . patients dnas were examined for homozygous deletion in fhit exons . in brief , pcrs were performed with 8 different primers corresponding to exons 3 to 9 , and -actin was used as a control . pcr amplification was performed in a 12.5 l reaction volume using 1 pcr buffer ( invitrogen ) , 1.5 mm mgcl2 ( invitrogen ) , 0.2 mm of each dntp , 20 ng of each primer , 0.5 unit taq polymerase ( invitrogen ) , and 100 ng template dna . cycling conditions were 94c for 2 min followed by 30 cycles at 94c for 30 s , 57c for 30 s , and a final extension step at 72c for 7 min . pcr products were then electrophoresed onto 2% agarose gel stained with ethidium bromide and visualized under uv transilluminator . homozygous deletions were evaluated by comparing bands of exons in tumour samples with their matched normals . the results were analysed using graphpad prism computer system ( graphpad software , san diego , ca ) . pearson correlation analysis was used to test the correlation between exons in the context of homozygous deletion . chi - square and fisher exact tests were used to test the association between or hd deletions with each of patients ' clinicopathological parameters . exons 3 , 4 , and 5 are present in close proximity to the familial kidney - tumour - associated t ( 3 ; 8) translocation break , including the hpv16 integration site identified in cervical carcinoma , and the fragile sites in intron 5 . out of 10 exons , the first four exons and the last exon are noncoding exons ; therefore , exon 5 is the first coding exon of the fhit gene which has the initial methionine codon of the fhit open reading frame ( orf ) , that extends to exon 9 and encodes a small protein of 16.8 kd mass . while exon 8 encodes the histidine triad motif . to investigate the incidence of homozygous deletion in fhit gene exons in egyptian patients diagnosed with breast cancer , we performed exon - specific pcrs for coding exons 5 to 9 . additionally , we investigated noncoding exons 3 and 4 . a total of 62 breast cancer patients were investigated for homozygous deletion ( hd ) in fhit exons . tumour dna was compared to its matching normal dna samples isolated from the tumour safety margin . we found that 65% of the cases ( 40 out of 62 ) showed hd in at least one of the seven examined exons . percentage of hd in the examined exons is as follows : exon 3 : 32.3% ( 20/62 ) , exon 4 : 27.4% ( 17/62 ) , exon 5 : 29% ( 18/62 ) , exon 6 : 34% ( 21/62 ) , exon 7 : 29% ( 18/62 ) , exon 8 : 29% ( 18/62 ) , exon 9 : 30.6% ( 19/62 ) . we have observed that the samples which exhibited hd in exon 8 were also positive for hd in exon 9 . furthermore , 95% of samples that showed hd in exon 4 were also positive for hd in exon 3 . moreover , 29% of the total samples exhibited deletions in the exons cluster from 5 to 7 . figure 1(a ) shows representative samples that exhibited hd in the investigated exons . cases no . 7 , 10 , and 12 showed hd in exons 5 and 7 in tumour samples compared to their normal counterparts , while cases 13 and 14 showed intact exons in normal and tumour samples . 30 , 31 , 32 , and 37 exhibited hd in exons 8 and 9 in tumour samples compared with their normal counterparts . 37 exhibited hd in exons 3 and 4 , while exon 6 is intact compared to its matched normal . figure 1(b ) shows the incidence of hd in fhit exons in individual breast cancer patients . a summary of hd percentages in fhit exons is shown in figure 1(c ) . from these data , we conclude that homozygous deletion or hd of fhit gene exons occurs at high frequency in egyptian breast cancer patients . the high deletion rate indicates that fhit gene is subjected to intragenic breaks and rearrangements and homozygous deletion of fhit gene is an important event in breast carcinogenesis . fhit exons deletion in breast cancer samples were compared with patients ' clinicopathological parameters including tumour type , tumour grade , patient 's age at diagnosis , and lymph node status . results were tested for statistical significance difference using chi - square and fisher exact test . in breast cancer set , no significance association was observed between hd in fhit exons and patients clinicopathological data . patients younger than 50 years exhibited hd in 18 out of 29 cases ( 62% ) , while 18 out of 27 cases ( 67% ) showed deletions in patients of ages above 50 years old ( p = 0.7849 ) . among the 50 samples diagnosed with invasive ductal carcinoma type , 32 samples ( 64% ) showed hd , whereas 8 samples out of 12 ( 67% ) of 12 patients diagnosed with invasive lobular carcinoma and other types showed hd ( p = 0.8624 ) . samples ' tumour grades varied from grade ii to iii . out of 35 cases with grade ii , 23 ( 66% ) showed hd while , and 8 out of 14 cases ( 57% ) of grade iii showed hd ( p = 0.57 ) . with lymph node status , 10 out of 17 ( 59% ) showed hd in lymph node negative set , while in lymph node positive cases 24 out of 37 samples ( 65% ) showed hd ( p = 0.6694 ) . taken those data together , we conclude that fhit gene could play an important role in breast carcinogenesis , and its alterations are not restricted with certain features of the disease . this means that the allelic loss in fhit gene structure can occur in breast cancer patients regardless of patient 's age , tumour grade , tumour type , and lymph node involvement . having identified the incidence of hd at each exon in individual patients , we then investigated the pattern of detected deletions . to achieve that , we performed statistical analysis of correlation between all exons and the incidence of hd using pearson and spearman correlation tests . the spearman correlation coefficient and p values among investigated exons are shown in figure 2 . interestingly , a strong positive correlation was detected between the hd incidence in the non - coding exons 3 and 4 ( r = 0.7991 , p < 0.0001 ) , while there was no correlation between hd incidence in any of those exons and exons 5 , 7 , 8 , and 9 . the second deletion cluster involved exons 5 , 6 , and 7 a strong positive correlation was detected between exons 5 and 7 ( r = 0.9564 , p < 0.0001 ) but not 6 . exon 5 deletions were also positively correlated with deletions in exon 8 and exon 9 ( p = 0.02 , p = 0.04 ) . the third exon deletion cluster includes exons 8 and 9 which showed a significant positive correlation in hd incidence ( r = 0.9579 , p < 0.0001 ) . from those data we can classify the observed deletions of fhit exon into three different classes : class i includes exons 3 and 4 , class 2 includes exons 5 and 7 , and class iii includes the distal exons 8 and 9 . in some samples we can see deletions of exons from 5 to 9 . taken all those observations together we conclude that fhit gene exons are targeted by three different mechanisms that cause homozygous deletions in the exon clusters . consistent with its proposed function as a tumour suppressor , homozygous genomic deletions within the fhit gene have been observed in a large number of human cancers and cancer cell lines . fhit is one of the several tumour - suppressor genes on chromosome 3 , when working normally , keeping any potentially cancerous cells from growing out of control . however , when mutations or alterations eliminate one or both copies of the fhit gene , the brakes that control cell growth are released , allowing potentially cancerous lesions to become malignant . although the hypothesis that fhit is a tumour suppressor gene was initially met with some scepticism , data in support of this function have been heavily accumulated . fhit knockout mice developed spontaneous tumours and are more susceptible to cancer than wild - type mice . additionally , fhit suppresses tumourigenicity in cancer cell lines which implies conclusively that fhit is a bona fide tumour suppressor gene . the presence of the most common fragile site fra3b within fhit suggests that the fragility of this gene makes it susceptible to rearrangements induced by a variety of environmental carcinogens and cancer susceptibility reviewed in . in the present study , we aimed to investigate the frequency of exon deletions that affect the fhit gene in a series of primary breast cancer tumours in egyptian population . furthermore , we sought after the association of these alterations with patients ' clinicopathological data . here , we found that 65% of the breast cancer patients investigated showed homozygous deletions ( hds ) in at least one fhit exon ( 40 out of 62 ) . deletions percentages in the coding exons 59 were as follows : exon 5 : 29% ( 18/62 ) , exon 6 : 34% ( 21/62 ) , exon 7 : 29% ( 18/62 ) , exon 8 : 29% ( 18/62 ) , exon 9 : 30.6% ( 19/62 ) . deletions in the noncoding exons were observed as follows ; exon 3 : 32.3% ( 20/62 ) , exon 4 : 27.4% ( 17/62 ) . this means that coding exons were deleted in 63% of the investigated samples while noncoding exons were deleted in about 32% of the cases . the incidence of hd in our samples was relatively higher than what is reported in previous studies . this can be attributed to higher frequency of rearrangements and breaks in the fhit locus in this population . we have noticed that 58% of hd detected in fhit gene exons are discontinuous deletions . simply , deletions in these samples exhibited a specific pattern , for example , in some cases exon 4 , 6 , 8 , and 9 various authors observed this discontinuity of hd in some breast cell lines [ 1 , 32 , 33 ] which is consistent with our results in primary breast cancer . ohta et al . ( 1996 ) and druck et al . ( 1997 ) observed that homozygous deletions can occur in three or four discontinuous segments in fra3b , and frequently involve loss of both copies of specific fhit exons [ 16 , 34 ] . overall , this discontinuity can be explained by the possibility that the mechanism of breakage of the fra3b , frequently allows multiple gaps to form on the same chromosome 3p , which when repaired leave multiple deletions simultaneously . most of the deletions described here are predicted to lead to the truncation of fhit protein . it is not necessary that deletions have to occur in all the fhit exons , but deletions in any of these exons will encode a truncated protein which might be functionless . in the study of campiglio et al . 1999 , alterations in fhit transcripts were detected in 31% of the patients but the reduction or absence of fhit protein occurred in 69% of the breast carcinoma samples . analysis of fhit gene in a series of human primary breast cancer revealed an allelic loss in 25% and abnormal transcripts in approximately 30% of the cases . fhit homozygous deletions in samples with 3p14.2 aberrations were also found in the benign breast lesions of two women with familial tendency to breast cancer . another study of normal breast epithelium , breast preneoplastic lesions , and invasive tumors reported the loss of heterozygosity of the fhit locus in two patients with intraductal hyperplasia . we have studied a series of benign breast lesions and observed a high frequency rate of homozygous deletions in the noncoding exons ( data not shown ) . campiglio et al . analyzed 29 cases of primary breast tumours for normal and abnormal fhit transcripts and for the level of expression of fhit protein in the normal breast epithelia and breast epithelia tumour of the same patient . downmodulation or absence of fhit protein was also evaluated in a series of 156 consecutive patients with primary breast carcinomas . in both groups , fhit protein levels were reduced or absent in almost 70% of the breast cancer samples , whereas aberrant fhit transcripts were detected in only 31% of the samples . moreover , down - regulation of fhit protein expression is associated with highly proliferative and large tumours . yang et al . suggested that fhit gene therapy may potentially be a clinically useful tool for the treatment of breast cancer . carefully observing the deletion patterns of fhit exons in our samples we have also observed that the cluster containing exons 3 , 4 was deleted in 29% of the breast cancer patients . a positive correlation was detected between those two exons ( r = 0.7991 , p < 0.0001 ) this indicates that this cluster is highly subjected to deletions in this population . it was reported that this exon cluster is present in close proximity to the familial - kidney - tumour - associated t ( 3;8 ) translocation break , the cluster of fragile sites identified by aphidicolin - induced chromosome breaks in human - hamster hybrid cells . this also includes the hpv16 integration site identified in cervical carcinoma and the fragile sites in intron 5 in aphidicolin - treated hybrid cells . the deletions we observe could be due to breaks or viral integration in that region . investigation of hpv16 infection incidence in this primary tumour series could explain why this region is subjected to deletions . the second deletion cluster includes exons 5 and 7 which are deleted in 27% of all samples . we observed a strong positive correlation was observed between deletions in exon 5 and exon 7 ( r = 0.9564 , p < 0.0001 ) but not exon 6 . deletions in exon 5 are expected to affect the gene transcription since it has the initial methionine codon of the fhit open reading frame ( orf ) , resulting in the loss of the intact orf . deletions in this region could be attributed to the rearrangements and breaks events that happen due to the presence of the fragile site fra3b . the third deletion cluster includes the distal coding exon 8 and 9 which showed hd in 29% of the total breast cancer samples investigated . interestingly , all samples that showed deletions in exon 8 were also positive for exon 9 deletions ( r = 0.9579 , p < 0.0001 ) . the mechanism of deletion involving both exons together indicates their common importance especially exon 8 which flanks the histidine triad motif . since exon 8 contains the histidine triad domain , it is suggested that this exon deletions could result in a nonfunctional protein . as a target of deletion , the presence of those three distinguishable deletion patterns may reflect the diverse mechanisms that could target the fhit gene exons in tumourigenesis . we also have investigated the association between patients ' clinic pathological parameters and the hd incidence in fhit gene exons . no significant association was between hd in breast cancer patients and their clinicopathological features as age , lymph node involvement , tumour type , and tumour grade . this indicates that the deletions if fhit exons are not restricted to subcategories of those parameters . overall , we show here that fhit genomic structure is subjected to extensive allelic alterations represented by exon homozygous deletion in a series of egyptian primary breast cancer . the presence of homozygous deletion of fhit exons in breast cancer samples implicates that alteration in fhit gene is an important event in breast pathogenenesis in this population . additionally , we have identified three different patterns of homozygous deletion which could reflect different mechanisms that target exon deletion in fhit structure . fhit gene is a crucial tumour suppressor gene whose inactivation may derive clonal expansion of preneoplastic and neoplastic cells in the breast . the present findings highlight the fhit gene as an interesting target for extensive analysis in egyptian breast cancer patients . | fragile histidine triad ( fhit ) gene encodes a putative tumour suppressor protein
. loss of fhit protein in cancer is attributed to different genetic alterations that affect the fhit gene structure . in this study , we investigated the pattern of homozygous deletion that target the fhit gene exons 3 to 9 genomic structure in egyptian breast cancer patients .
we have found that 65% ( 40 out of 62 ) of the cases exhibited homozygous deletion in at least one fhit exon . the incidence of homozygous deletion was not associated with patients ' clinicopathological parameters including patients ' age , tumour grade , tumour type , and lymph node involvement . using correlation analysis ,
we have observed a strong correlation between homozygous deletions of exon 3 and exon 4 ( p < 0.0001 ) .
deletions in exon 5 were positively correlated with deletions in exon 7 ( p < 0.0001 ) , exon 8 ( p < 0.027 ) , and exon 9 ( p = 0.04 ) . additionally , a strong correlation was observed between exons 8 and exon 9 ( p < 0.0001).we conclude that fhit gene exons are homozygously deleted at high frequency in egyptian women population diagnosed with breast cancer .
three different patterns of homozygous deletion were observed in this population indicating different mechanisms of targeting fhit gene genomic structure . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
this study comprises two cohorts , one ( cohort i ) initiated in 1990 and the other ( cohort ii ) initiated in 1993 . 140 420 residents participated in this study , with 61 595 participants in cohort i aged 4059 years identified in the areas supervised by six phcs and 78 825 participants in cohort ii aged 4069 years identified in the areas supervised by five phcs . the study design was reported in detail elsewhere.28 the jphc study was approved by the institutional review board of the national cancer center ( tokyo , japan ) . the present study was approved by the ethical review board of osaka university ( osaka , japan ) . participants from one phc area ( katsushika phc , 7097 participants ) in cohort i were excluded because cancer incidence data was not collected . participants were also excluded for the following reasons : nonjapanese nationality ( n = 51 ) ; late report of relocation out of the study area before the start of followup ( n = 187 ) ; ineligibility owing to an incorrect date of birth ( n = 7 ) ; duplicate registration ( n = 4 ) ; and death , moving out of a study area , or lost to followup before the starting point of the present study ( n = 11 689 ) . after excluding these ineligible participants , 98 636 participants aged 4574 years responded from 1995 to 1999 ( approximately 81.3% response rate ) . the survey consisted of a selfadministered questionnaire asking about a variety of lifestyle factors , including frequency of beverage consumption with the following choices : 0 , 12 , 34 , or 56 times / week and 1 , 23 , 46 , 79 , or 10 cups / day . the survey asked about the two main types of green tea consumed in japan , sencha ( first or second flush of green tea , which is the first seasonal picking ) and bancha ( third or fourth flush of green tea , which is the late seasonal picking)/genmaicha ( blend of bancha and roasted brown rice ) , and two forms of coffee , coffee ( excluding canned coffee ) and canned coffee.29 the total amounts of green tea and coffee consumption were defined as the sum of both types of tea and coffee , respectively . the consumption of each beverage ( ml / day ) was calculated by multiplying the frequency by the portion size ( 120 ml / cup for sencha , bancha / genmaicha , and coffee and 250 ml / can for canned coffee ) . the validity of the total green tea and coffee consumption reported by the cohort was assessed using dietary records for 28 or 14 days . spearman 's correlation coefficients between the dietary record data and the questionnaire were 0.44 in men and 0.53 in women for green tea and 0.75 in men and 0.80 in women for coffee.30
we categorized consumption as follows : 120 , 120360 , 360720 , and > 720 ml / day for total green tea ; no consumption , 090 , 90240 , and > 240 ml / day for coffee so that each category could include as equal number of subjects as possible . for total green tea , we did not set the group of 0 ml / day as a reference because the number was relatively small ( n = 4326 , 4.8% ) . for sencha and bancha / genmaicha , the following category was used to make this align with the category of total green tea ; 1 , 23 , 46 , 7 cups / day . followup was carried out using information about residential status and survival collected from the residential registers from each municipality in the study area . death certificates were coded in accordance with the requirements of the japanese ministry of health , labor , and welfare . of the eligible participants , 5128 moved out of the study area , 198 were lost to followup , seven withdrew from the study , and 12 199 died during the atrisk period . cancer incidence was identified mainly from two data sources : active patient notification from major local hospitals in the study area , and populationbased cancer registries . the site of origin and histological cancer type were coded using the international classification of diseases for oncology , third edition , with the gallbladder as c23.9 , the extrahepatic bile duct as c24.0 , overlapping lesions of the biliary tract as c24.8 , and unspecified as c24.9 ; in the present analysis , btc included all of these subtypes . if a participant was diagnosed with more than one of these btc subtypes , that with the earliest diagnosis date was used for the analysis . the proportion of cases where incidence was ascertained by death certificate only was 15.1% for btc and 6.4% for all types of cancer . the number of personyears of followup was calculated from the date of the 5year followup survey until the end of followup , which was the earliest date of any of the following events : moving out of the study area , lost to followup , withdrawal from the study , death , diagnosis of btc , or the last date of the followup period ( december 31 , 2009 in osaka phc and december 31 , 2010 in all other areas ) . the subjects diagnosed with btc before followup start were excluded ( n = 22 ) . the subjects who were diagnosed with cancer other than btc before followup start were not excluded . hazard ratios , 95% cis , and ptrend for btc in all participants and by sex ( men versus women ) were estimated using the cox proportional hazards model with adjustment for potential confounders . additionally , subanalysis by type of primary tumor ( gbc versus ehbdc ) was carried out . for the analysis of green tea , we further assessed the association of sencha and bancha / genmaicha with btc . this multivariate analysis model was adjusted for age ( continuous ) , study area ( 10 phc areas ) , sex ( not applicable to the analysis stratified by sex ) , body mass index ( < 23 , 2325 , 2527 , 27 kg / m ) , history of cholelithiasis ( no / yes ) , history of diabetes mellitus ( no / yes ) , history of chronic hepatitis or cirrhosis ( no / yes ) , history of smoking ( no , past or current , unknown ) , alcohol drinking frequency ( never or almost never , 13 times / month , 12 times / week , 34 times / week , 5 times / week , unknown ) , physical activity by metabolic equivalents / day ( quartiles , unknown ) , total energy consumption ( quartiles ) , and energyadjusted consumption of fish ( quartiles ) , red meat ( quartiles ) , and fruits and vegetables ( quartiles ) . this was further adjusted by coffee consumption ( no consumption , 090 , 90240 , or > 240 ml , unknown ) when analyzed for green tea and by green tea consumption ( 120 , 120360 , 360720 , or > 720 ml , unknown ) when analyzed for coffee . in the analysis of green tea by sencha and bancha / genmaicha , the model was additionally adjusted by bancha / genmaicha ( 1 , 23 , 46 , 7 cups / day ) when analyzed for sencha and adjusted by sencha ( 1 , 23 , 46 , 7 cups / day ) when analyzed for bancha / genmaicha . we excluded participants for whom both green tea and coffee consumption were unknown ( n = 5607 ) . we used a residual method to carry out energy adjustment31 for consumption of fish , red meat , and fruits and vegetables after excluding participants who consumed < 800 or > 4000 kcal total energy ( n = 3259 ) . all pvalues reported are twosided , and the significance level was set at p < 0.05 . this study comprises two cohorts , one ( cohort i ) initiated in 1990 and the other ( cohort ii ) initiated in 1993 . 140 420 residents participated in this study , with 61 595 participants in cohort i aged 4059 years identified in the areas supervised by six phcs and 78 825 participants in cohort ii aged 4069 years identified in the areas supervised by five phcs . the study design was reported in detail elsewhere.28 the jphc study was approved by the institutional review board of the national cancer center ( tokyo , japan ) . the present study was approved by the ethical review board of osaka university ( osaka , japan ) . participants from one phc area ( katsushika phc , 7097 participants ) in cohort i were excluded because cancer incidence data was not collected . participants were also excluded for the following reasons : nonjapanese nationality ( n = 51 ) ; late report of relocation out of the study area before the start of followup ( n = 187 ) ; ineligibility owing to an incorrect date of birth ( n = 7 ) ; duplicate registration ( n = 4 ) ; and death , moving out of a study area , or lost to followup before the starting point of the present study ( n = 11 689 ) . after excluding these ineligible participants , 98 636 participants aged 4574 years responded from 1995 to 1999 ( approximately 81.3% response rate ) . the survey consisted of a selfadministered questionnaire asking about a variety of lifestyle factors , including frequency of beverage consumption with the following choices : 0 , 12 , 34 , or 56 times / week and 1 , 23 , 46 , 79 , or 10 cups / day . the survey asked about the two main types of green tea consumed in japan , sencha ( first or second flush of green tea , which is the first seasonal picking ) and bancha ( third or fourth flush of green tea , which is the late seasonal picking)/genmaicha ( blend of bancha and roasted brown rice ) , and two forms of coffee , coffee ( excluding canned coffee ) and canned coffee.29 the total amounts of green tea and coffee consumption were defined as the sum of both types of tea and coffee , respectively . the consumption of each beverage ( ml / day ) was calculated by multiplying the frequency by the portion size ( 120 ml / cup for sencha , bancha / genmaicha , and coffee and 250 ml / can for canned coffee ) . the validity of the total green tea and coffee consumption reported by the cohort was assessed using dietary records for 28 or 14 days . spearman 's correlation coefficients between the dietary record data and the questionnaire were 0.44 in men and 0.53 in women for green tea and 0.75 in men and 0.80 in women for coffee.30
we categorized consumption as follows : 120 , 120360 , 360720 , and > 720 ml / day for total green tea ; no consumption , 090 , 90240 , and > 240 ml / day for coffee so that each category could include as equal number of subjects as possible . for total green tea , we did not set the group of 0 ml / day as a reference because the number was relatively small ( n = 4326 , 4.8% ) . for sencha and bancha / genmaicha , the following category was used to make this align with the category of total green tea ; 1 , 23 , 46 , 7 cups / day . followup was carried out using information about residential status and survival collected from the residential registers from each municipality in the study area . death certificates were coded in accordance with the requirements of the japanese ministry of health , labor , and welfare . of the eligible participants , 5128 moved out of the study area , 198 were lost to followup , seven withdrew from the study , and 12 199 died during the atrisk period . cancer incidence was identified mainly from two data sources : active patient notification from major local hospitals in the study area , and populationbased cancer registries . the site of origin and histological cancer type were coded using the international classification of diseases for oncology , third edition , with the gallbladder as c23.9 , the extrahepatic bile duct as c24.0 , overlapping lesions of the biliary tract as c24.8 , and unspecified as c24.9 ; in the present analysis , btc included all of these subtypes . if a participant was diagnosed with more than one of these btc subtypes , that with the earliest diagnosis date was used for the analysis . the proportion of cases where incidence was ascertained by death certificate only was 15.1% for btc and 6.4% for all types of cancer . the number of personyears of followup was calculated from the date of the 5year followup survey until the end of followup , which was the earliest date of any of the following events : moving out of the study area , lost to followup , withdrawal from the study , death , diagnosis of btc , or the last date of the followup period ( december 31 , 2009 in osaka phc and december 31 , 2010 in all other areas ) . the subjects diagnosed with btc before followup start were excluded ( n = 22 ) . the subjects who were diagnosed with cancer other than btc before followup start were not excluded . hazard ratios , 95% cis , and ptrend for btc in all participants and by sex ( men versus women ) were estimated using the cox proportional hazards model with adjustment for potential confounders . additionally , subanalysis by type of primary tumor ( gbc versus ehbdc ) was carried out . for the analysis of green tea , we further assessed the association of sencha and bancha / genmaicha with btc . this multivariate analysis model was adjusted for age ( continuous ) , study area ( 10 phc areas ) , sex ( not applicable to the analysis stratified by sex ) , body mass index ( < 23 , 2325 , 2527 , 27 kg / m ) , history of cholelithiasis ( no / yes ) , history of diabetes mellitus ( no / yes ) , history of chronic hepatitis or cirrhosis ( no / yes ) , history of smoking ( no , past or current , unknown ) , alcohol drinking frequency ( never or almost never , 13 times / month , 12 times / week , 34 times / week , 5 times / week , unknown ) , physical activity by metabolic equivalents / day ( quartiles , unknown ) , total energy consumption ( quartiles ) , and energyadjusted consumption of fish ( quartiles ) , red meat ( quartiles ) , and fruits and vegetables ( quartiles ) . this was further adjusted by coffee consumption ( no consumption , 090 , 90240 , or > 240 ml , unknown ) when analyzed for green tea and by green tea consumption ( 120 , 120360 , 360720 , or > 720 ml , unknown ) when analyzed for coffee . in the analysis of green tea by sencha and bancha / genmaicha , the model was additionally adjusted by bancha / genmaicha ( 1 , 23 , 46 , 7 cups / day ) when analyzed for sencha and adjusted by sencha ( 1 , 23 , 46 , 7 cups / day ) when analyzed for bancha / genmaicha . we excluded participants for whom both green tea and coffee consumption were unknown ( n = 5607 ) . we used a residual method to carry out energy adjustment31 for consumption of fish , red meat , and fruits and vegetables after excluding participants who consumed < 800 or > 4000 kcal total energy ( n = 3259 ) . all pvalues reported are twosided , and the significance level was set at p < 0.05 . all statistical analyses were carried out using stata version 13 ( stata corp . , college station , tx , usa ) . baseline characteristics of the participants are shown in table 1 . a total of 89 555 participants were included and followed up for 1 138 623 personyears . during the followup period , 284 cases of btc ( 121 gbcs , 152 ehbdcs , 11 overlapped lesions , and no case of unknown location ) were identified . participants with a higher consumption of green tea tended to be older and to consume more energy , fish , and fruits and vegetables and less red meat and coffee ; more were women , and fewer were current smokers or regular drinkers . conversely , participants with a higher consumption of coffee tended to be younger and consumed more energy and red meat and less fish , fruits and vegetables , and green tea ; fewer were women , fewer had a history of diabetes mellitus and hepatitis / cirrhosis , and more were current smokers and regular drinkers . characteristics of study participants at baseline green tea consumption was defined as the sum of sencha and bancha / genmaicha consumption ( ml / day ) . the hrs and 95% cis of btc incidence associated with green tea and coffee consumption in all participants and by sex are shown in table 2 . consuming > 720 ml / day of green tea was significantly associated with a decreased risk ( hr = 0.67 ; 95% ci , 0.460.97 ) , and a nonsignificant trend of decreased risk associated with increased consumption was observed ( ptrend = 0.095 ) . a similar trend of decreased risk was observed in both men and women when stratified by sex . for coffee , there was no clear association with consumption volume . hazard ratios ( hr ) and 95% confidence intervals ( ci ) of biliary tract cancer incidence according to volume of green tea and coffee consumption green tea consumption was defined as the sum of sencha and bancha / genmaicha consumption ( ml / day ) . adjusted for age , study area , sex , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by metabolic equivalents ( mets)/day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , and coffee . adjusted for age , study area , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by mets / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , and coffee . adjusted for age , study area , sex , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by mets / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , and green tea . adjusted for age , study area , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by mets / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , and green tea . the hrs and 95% cis of btc incidence associated with green tea and coffee consumption by location of the primary tumor ( gbc versus ehbdc ) are shown in table 3 . for green tea , consumption of 120360 ml / day was significantly associated with a decreased risk of gbc ( hr = 0.56 ; 95% ci , 0.320.97 ) , and the association between consumption of > 720 ml / day and a decreased risk of gbc was marginally significant ( hr = 0.57 ; 95% ci , 0.321.01 ) ; additionally , there was a nonsignificant trend of decreased ehbdc risk associated with increased volume of consumption ( ptrend = 0.160 ) . for coffee , there was no clear association between the volume of consumption and gbc or ehbdc . hazard ratios ( hr ) and 95% confidence intervals ( ci ) of gallbladder cancer and extrahepatic bile duct cancer incidence according to volume of green tea and coffee consumption green tea consumption was defined as the sum of sencha and bancha / genmaicha consumption ( ml / day ) . adjusted for age , study area , sex , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by metabolic equivalents / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , and coffee . adjusted for age , study area , sex , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by metabolic equivalents / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , and green tea . ir , incidence rate . table 4 shows the hrs and 95% cis of btc incidence associated with sencha and bancha / genmaicha consumption in all participants and by sex . a nonsignificant trend of decreased risk associated with sencha consumption was observed in all participants ( ptrend = 0.054 ) , and a similar trend of decreased risk was observed in both men and women after stratification by sex . for bancha / genmaicha , there was no clear association with btc . hazard ratios ( hr ) and 95% confidence intervals ( ci ) of biliary tract cancer incidence according to frequency of sencha and bancha / genmaicha consumption adjusted for age , study area , sex , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by metabolic equivalents ( mets)/day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , coffee , and bancha / genmaicha . adjusted for age , study area , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by mets / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , coffee , and bancha / genmaicha . adjusted for age , study area , sex , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by mets / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , coffee , and sencha . adjusted for age , study area , body mass index , history of cholelithiasis , history of diabetes mellitus , history of chronic hepatitis or cirrhosis , history of smoking , drinking frequency , physical activity by mets / day score , total energy consumption , energyadjusted consumption of fish , red meat , and vegetable and fruit , coffee , and sencha . in this largescale populationbased prospective cohort study covering more than 140 000 people in japan , a significantly decreased risk of btc was associated with high green tea consumption . however , the dose response was not statistically significant , although a trend of decreased risk associated with increased green tea consumption was observed . in the analysis according to the location of the primary tumor , green tea consumption tended to be associated with decreased risk of both gbc and ehbdc . when the associations of sencha and bancha / genmaicha consumption with btc were analyzed separately , we observed a nonsignificant trend of decreased risk associated with sencha consumption but no association with bancha / genmaicha consumption . this result suggests that high green tea consumption may lower the risk of btc , and this effect may be attributable to sencha consumption . the strengths of our study include collecting information on a wide range of consumption frequency ( from no consumption to 10 cups / day ) and the large sample size , which enabled a detailed analysis of the effect by setting multiple consumption levels for green tea and coffee . regarding green tea , the mechanism underlying the observed reduced risk of btc is not clear , but egcg , a polyphenol in green tea , is considered to play a key role because egcg has antioxidative effects and is thought to suppress the inflammatory processes that lead to transformation , hyperproliferation , and initiation of carcinogenesis.32 , 33 in addition , many mechanisms that support egcg 's cancerpreventive effect have been proposed , including cell cycle arrest , apoptosis induction , induction or inhibition of drug metabolism enzymes , modulation of cell signaling , inhibition of dna methylation , and effects on microrna expression , dihydrofolate reductase , proteases , and telomerases.33 it is not clear which mechanisms are relevant to the cancerpreventive effect in btc because of limited data specific to btc , although some laboratory studies showed the protective effect in vitro and in vivo.11 , 12 , 13 another potential mechanism of egcg specific to btc is a potential protective effect against biliary stone formation , a major risk factor for btc . epigallocatechin3gallate was suggested to be protective against biliary stone formation in a laboratory study.34 the effect of tea on biliary stone formation in humans is not clear , but one epidemiological study showed a protective effect in women.17 thus , part of the observed reduced risk of btc may be attributable to protection against biliary stone formation by green tea . it is possible that , in addition to egcg , other nutrients in green tea like vitamin c and folate that potentially have a protective effect on cancer contributed to the observed protective effect . protective effects of vitamin c and folate against cancer have been observed in epidemiological studies.35 , 36 furthermore , two case control studies reported that vitamin c intake was associated with decreased risk of gbc.16 , 37
sencha has a higher vitamin c and folate , as well as catechin , content than bancha / genmaicha
29 , 38 and , in the present study , a nonsignificant trend of decreased risk associated with sencha was observed whereas no clear association with bancha / genmaicha was observed . therefore , these nutrients may contribute to the decreased risk of btc , however , the magnitude would not be so large because the proportions of vitamin c and folate obtained from green tea were just 16.9% ( 13.9% from sencha , 3.0% from bancha / genmaicha ) and 15.9% ( 12.8% from sencha , 3.1% from bancha / genmaicha ) of total vitamin c and folate , respectively , in the present study . our results are not consistent with those of a previous cohort study that reported the association of tea consumption with btc was not statistically significant,21 although a trend of decreased risk was observed the number of cases in the previous study was less than half that of the present study . although consumption categories were never versus current drinker only in the previous study , a wide range of consumption levels was evaluated . regarding the association of green tea consumption with subtypes of btc , the finding of an association with gbc and ehbdc in the present study is consistent with the results of other studies.17 , 18 for ehbdc , our study and a previous study18 showed a trend of decreased risk , although it was not statistically significant . also , a preventive effect of egcg against cholangiocarcinoma was observed in a preclinical study.26 therefore , the nonsignificant finding may result from insufficient statistical power , and further study on a larger scale is needed to clarify the association with ehbdc . the effect of coffee on cancer risk is controversial because both inhibiting and promoting effects have been suggested . the antioxidative effect of chlorogenic acid and the inhibitory effect of dna methylation are considered to contribute to coffee 's protective effect.14 , 39 a protective effect of coffee has been observed in humans for a variety of cancers including liver , kidney , premenopausal breast , and colorectal cancers.14 however , the caffeine in coffee is known to modify the apoptotic response and perturb cell checkpoint integrity,40 , 41 , 42 and a positive association between coffee consumption and bladder cancer has been observed in epidemiological studies.15 , 42 , 43 another potential effect of coffee related to btc is contraction of the gallbladder . coffee is considered to cause pain in gallstone patients , which may be attributable to gallbladder contraction caused by an increase in plasma cholecystokinin concentration induced by coffee.44 therefore , it may be that increased gallbladder stimulation caused by coffee consumption in gallstone patients leads to an increased gbc risk . it is not clear what accounts for our finding of no association , but it may be a complex combination of these inhibitory and promoting effects . some of the previous epidemiological studies showed a statistically significant decreased risk of gbc and ehbdc.18 , 19 , 20 this difference may be attributable to different study designs . first , despite the largescale design with a long followup period , statistical power was limited because of the low incidence rates , and we can not rule out the possibility that the observed association was by chance . therefore , this result should be confirmed by further studies with a larger sample size . second , there could have been some misclassification in the baseline survey because the data collected by selfadministered questionnaires at only a single point were used as baseline data . furthermore , the correlation coefficient of green tea for validity was moderate , which might attenuate the true association . third , there could be some effect of unmeasured variables and residual confounding , although the statistical model was adjusted for as many variables as possible . fourth , we did not obtain information about how tea was prepared , including brewing times . concentration of extracted ingredients including egcg might be decreased when hot water is added into a teapot without adding or exchanging tea leaf . therefore , the effects of high amounts of green tea consumption may be underestimated in terms of extracted ingredients intake if this method of tea preparation was more observed in those who consumed more cups / day . in conclusion , in a populationbased cohort study in japan , high green tea consumption was significantly associated with a decreased risk of btc , and coffee did not show any clear association . this finding suggests that high green tea consumption may lower the risk of btc in japanese people , and the effect may be attributable to sencha consumption . | green tea and coffee consumption may decrease the risk of some types of cancers .
however , their effects on biliary tract cancer ( btc ) have been poorly understood . in this populationbased prospective cohort study in japan , we investigated the association of green tea ( total green tea , sencha , and bancha / genmaicha ) and coffee consumption with the risk for btc and its subtypes , gallbladder cancer , and extrahepatic bile duct cancer . the hazard ratios and 95% confidence intervals
were calculated using the cox proportional hazard model .
a total of 89 555 people aged 4574 years were enrolled between 1995 and 1999 and followed up for 1 138 623 personyears until 2010 , during which 284 cases of btc were identified .
consumption of > 720 ml / day green tea was significantly associated with decreased risk compared with consumption of 120 ml / day ( hazard ratio = 0.67 [ 95% confidence interval , 0.460.97 ] ) , and a nonsignificant trend of decreased risk associated with increased consumption was observed ( ptrend = 0.095 ) . in the analysis according to the location of the primary tumor , consuming > 120 ml green tea tended to be associated with decreased risk of gallbladder cancer and extrahepatic bile duct cancer . when sencha and bancha / genmaicha were analyzed separately , we observed a nonsignificant trend of decreased risk of btc associated with sencha but no association with bancha / genmaicha . for coffee
, there was no clear association with biliary tract , gallbladder , or extrahepatic bile duct cancer .
our findings suggest that high green tea consumption may lower the risk of btc , and the effect may be attributable to sencha consumption . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
stauber showed how occupational stress in man could affect sperm concentration , motility , and morphology , with these effects being reverted after removal of the stress factor . apoptotic germ cell death is an important mechanism in testicular development and elimination of germ cells under normal physiological and pathological conditions [ 4 , 5 ] . it has been show that testicular germ cell apoptosis increases in experimental cryptorchidism , local heat stress , immobilisation stress [ 813 ] , vasectomy , ischemia / reperfusion , chronic cigarette smoking and cisplatin , and chronic alcohol treatment . immobilisation stress decreases the activities of catalase , glutathione peroxidase , glutathione transferase , and glutathione reductase in the interstitium of testes . stress - induced stimulation of the testicular nitric oxide ( no ) signaling a pathway that leads to the inhibition of both steroidogenic and antioxidant enzymes . however , to our the knowledge , there is no study dealing with the relationship between chronic immobilisation stress - induced apoptosis and resveratrol . in this study we aimed to investigate protective effects of resveratrol , a strong antioxidant , against possible negative effects of chronic immobilisation stress on testes of male rats histochemically , immunohistochemically , ultrastructurally , and biochemically male wistar rats , weighing about 200220 g each , were used in this study . we protected the rights of the animals according to guide for the care and use of laboratory animals and received approval from dokuz eylul university local ethics committee for animal experiments for our experiment . all animals were subjected to the same conditions ; they were maintained at constant temperature ( 21 2c ) and humidity ( 50 5% ) on a 12-hour light/12-hour dark cycle ( light on from 07:0019:00 h ) . they were housed in plastic cages ( seven rats per cage ) and fed on standard pellet food and tap water ad - libitum . group i , control group , was not exposed to stress and allowed to move freely . group ii , stress group , was exposed to chronic immobilization stress . in group iii , low dose resveratrol + stress group , rats were given 10 mg / kg / day resveratrol by intragastric route just before the chronic immobilization stress application . in group iv , high dose resveratrol + stress group , rats were given 20 mg / kg / day resveratrol by intragastric route just before the chronic immobilization stress application . the animals were immobilized inside plastic tubes dimensioned to produce stress without promoting pain ( 6 cm in diameter 15 cm long ) for 6 h a day over a period of 32 days . the rats in groups iii and iv were given resveratrol ( cayman chemicals , usa ) 10 mg / kg / day and 20 mg / kg / day , respectively . for group iii 100 mg / kg resveratrol and for group iv 200 mg / kg , resveratrol was dissolved in 100% pure ethanol . all experimental animals were sacrificed 18 hours after the last chronic immobilization stress application by giving ether . left testis was put in 10% formaldehyde for three days to be fixed , dehydrated in alcohol , and embedded in paraffin . the slides were stained with hematoxylin - eosin , masson 's trichrome , periodic acid schiff ( pas ) for histochemical and histometric analysis . the johnson 's testicular biopsy score , basement membrane thickness , and diameter of seminiferous tubule measurements were done for morphometric analysis . for immunohistochemical staining tunel and active caspase 3 a little piece of right testis was fixed with karnofsky solution for an ultrastructural analysis . the level of malondialdehyde ( mda ) and glutathione ( gsh ) was measured by using proper kits . all the samples were collected in the morning in order to minimize the diurnal variation of testosterone hormone levels . all data were analysed by the nonparametric kruskal - wallis test and subsequent individual comparisons by the mann - whitney u - test . in the present study , we observed that body weights of rats in stress group were decreased significantly compared with the control , resveratrol low , and high dose groups ( p = 0.02 ) . in resveratrol low and high dose groups body weights of rats were increased significantly compared with stress group ( p = 0.02 ) ( figure 7(a ) ) . in control group , the seminiferous tubules were bounded together by loose intertubular connective tissue , which contained fibroblasts , collagen fibers , blood vessels , and groups of interstitial cells or leydig cells . the capillaries were infiltrated among the clumps of leydig cells ( figures 1(a ) , 2(a ) , 3(a ) , and 6(a ) ) . in stress group the architecture of the testis was maintained , but the germinal epithelium showed disorganization as well as marked degenerative changes . there was cell debris in the lumen of tubules as a result of infusion of degenerated germ cells . the cell membrane of leydig cells was poorly defined , with cytoplasmic vacuolations in many cells . the nuclei were circular to oval in shape and were smaller as compared to control groups . the capillary network was well defined . fairly a good number of fat cells with large clear spaces and small eccentric nucleus were observed among the clumps of leydig cells . ultrastructural observations showed that in stress group there was a distinct degeneration in seminiferous epithelium . basement membrane was thicker than the control group . also between sertoli and germ cells there was a distinct separation ( figures 1(b ) , 2(b ) , 3(b ) , 6(b ) , 7(c ) , and 7(d ) ) . in resveratrol low and high dose groups , we observed that the shape and diameter of seminiferous tubules were the same as those of control group . the degenerations seen in stress group were disappeared ( figures 1(c ) , 3(c ) , 6(c ) , 1(d ) , 3(d ) , and 6(d ) ) . as a result of the johnson 's testicular biopsy score , there was a significant decrease in stress group compared with the control group ( p = 0.002 ) . in resveratrol low and high dose groups , testicular biopsy score means were increased significantly compared with those of the stress group ( p = 0.002 ) ( figure 7(b ) ) . after immunohistochemical investigations , we observed that apoptotic cell death was increased significantly in stress group compared with control group ( p = 0.001 ) ( figures 4(a)4(d ) and 5(a)5(d ) ) . in low and high dose resveratrol groups , tunel ( + ) cells and active caspase 3 ( + ) cells were decreased significantly compared with stress group , ( p = 0.001 ) . however , there was no significant difference between low and high dose resveratrol groups ( p = 0.3 ) ( figures 7(e ) and 7(f ) ) . there was no a significant difference between the four groups when compared in the way of mda and gsh levels in testicular tissue ( p = 0.89 ) . besides , serum testosterone levels showed no significant difference in stress group when compared with that of control and resveratrol low dose groups ( p = 0.48 ) . in resveratrol high dose group , serum testosterone level showed a significant increase when compared with that of stress group ( p = 0.02 ) . stress can be described as the sum total of all the reactions of the body , which disturb the normal physiological equilibrium and result in a state of threatened homeostasis . stress is an internationally recognized phenomenon fortified by advancement of industrialization and a demanding civilization . thus , every person today faces stressful situations in day - to - day life . stress represents reaction of body to stimuli that tend to disturb its normal physiological equilibrium or homeostasis and has been defined as nonspecific response of the body to any demand imposed on it . stress , depression , and associated mental health problems have increased tremendously in modern times . the effects of stress that have formed on people are examined on animals by applying a variety of methods . immobilization stress method causes both psychological and physiological stress by the restriction of movement , aggression , feeling of distress , and burnout . consequently , the immobilization stress model is considered as an easy and convenient method . as a result of a variety of studies , it has been indicated that stress induces free radical formation and oxidative tissue damages . to reduce the effects of stress , which cause many diseases , substances showing antioxidant properties were carried out on . in this study , we aimed to investigate protective effects of resveratrol , a strong antioxidant , against possible negative effects of chronic immobilization stress on testes of male rats histochemically , immunohistochemically , ultrastructurally , and biochemically . herman et al . have found that weight loss has occurred as a result of stress . the reason of weight loss is explained as a result of reduced feed and water consumption or exhaustion of body reserves as a result of increased metabolic activity . in our study , we observed weight loss in stress group in line with the literature . while there was a statistically significant increase between initial and final weights of the subjects in the c , lrs , and hrs groups , there was a statistically significant decrease between initial and final weights in the s group . we believe that the reason of weight loss is reduced feed and water consumption or exhaustion of body reserves as a result of increased metabolic activity . we think that resveratrol , used as an antioxidant , reduced the excessive metabolic activity caused by stress or increased water and feed consumption in lrs and hrs groups compared to s group . in recent years , the effects of the psychological and physiological stress on male infertility have been researched . as a result it is reported that , stress causes endocrine disorders in testes and damages in testicular morphology . pook et al . showed in their study that psychological stress in humans reduces the movement of the sperm and sperm quality which leads to infertility . rai et al . clearly demonstrated that immobilization stress disturbs spermatogenic and endocrine function of testes . reported that stress influences male reproductive activity and increases the apoptotic index in the seminiferous tubules of the rat testes . apoptotic germ cells , most frequently spermatogonia and primary spermatocytes , were detected in the testes of immobilised rats for 2 h daily on 7 consecutive days . in parallel with these studies , we observed widely tubule damages histochemically and developed apoptosis immunohistochemically in testes of rats exposed to chronic immobilization stress . it is considered that the increase in the level of blood serum cortisol is an indicator of organism 's response to stress [ 13 , 25 ] . andersen et al . have used many different animal models of stress ( physical inactivity , buoyancy , insomnia , and cold application ) , and they have reported that immobilization stress model increases cortisol levels and decreases testosterone levels as the other models . they have showed that this hormonal profile disrupts testicular function . they have reported a significant increase in blood cortisol levels which is an indicator of stress . in stress situations , tilbrook et al . have showed that in prolonged stress gonadotropin secretion is suppressed ; therefore reproduction is inhibited . there are some other studies that show increased glucocorticoid levels in the bloodstream during stress [ 13 , 25 ] . they have observed that there was an increase in serum cortisol levels and a decrease in testosterone levels of stress group . studied the endocrinological response of acute immobilization stress and reported a decrease in plasma testosterone level . akinbami et al . also reported a decrease in plasma testosterone level after acute immobilization stress . as a result of the literature research , we found that acute stress causes a decrease in testosterone levels . he believed that the decreased hepatic clearance of testosterone could be responsible for it . in our study , we observed no significant difference between c and s groups . low testosterone levels , observed in acute stress , could not be observed after chronic stress . in this case we suggest that the subjects showed a physiological adaptation to chronic stress . in lrs group , there was a statistically significant decrease in serum testosterone levels compared with those of the s group . however in hrs group there was a statistically significant increase in serum testosterone levels compared with those of the s group . as a result ; we are of the opinion that high dose resveratrol is more defensive than low dose resveratrol against the chronic stress . used tunel method to show advanced apoptosis in series of spermatogenic cells after chronic stress . in other study , yazawa et al . gave glucocorticoids from the outside to rats and showed the increase in the level of the cortisol in blood . as a result of this , they showed germ cell apoptosis using tunel method again . in our study , in order to show apoptosis in testis as a result of exposure to chronic stress , apoptosis was significantly higher in stress group than in control group . in stress group , the number of tunel ( + ) and caspase 3 ( + ) cells was increased significantly than the cells in control group . , it has been shown that there is a relationship between immobilization stress , lipid peroxidation , and protein oxidation . barabo reported in his study that immobilization stress increases the synthesis of corticosterone , serotonin , and catecholamine hormones which play a role in stress , and these hormones make tissue injury by inducing lipid peroxidation in various organs . liu et al . examined the effect of immobilized stress - induced oxidative stress in lipid , protein , and dna damage of the rat brain . davydov and shvets examined the activity of lipid peroxidation in the hearts of adult and old rats during immobilization stress . studied the effects of stress on the brain , liver , stomach , and red blood cells using a variety of stress models , and the mechanisms of tissue damage . ahin and gml examined the effects of immobilization stress on antioxidants , protein , and lipid peroxidation of various tissues . in our study , we showed the testicular damage , caused by chronic immobilization stress , by measuring the levels of mda ( malondialdehyde ) as a marker of oxidative stress . there is not any data evaluating the level of mda after testicular damage caused by chronic immobilization stress . the decrease in gsh levels in tissues is an important factor that shows the tissue damage and lipid peroxidation . stated that the agents affect the lifestyle adversely and that oxidants under the influence of stress reduces the level of cellular gsh . showed the decrease in the activity of antioxidant enzymes during stress period in their study . ahin and gml reported the increased mda levels and decreased gsh levels in brain and stomach of rats in stress group . in our study , we measured the levels of gsh produced in the testis against the damage of chronic immobilization stress . there is not any data evaluating the level of gsh after testicular damage caused by chronic immobilization stress . showed that transresveratrol has a therapeutic effect on spermatogenesis and testis of the adult rats . they also reported that there is an increase in the production of spermatozoa in rats with oral resveratrol treatment . in parallel with the literature , we observed an increase in the production of spermatozoa in resveratrol groups compared to that of the stress group . in various experimental models , antiapoptotic effect of resveratrol is shown [ 41 , 42 ] . in our study , we observed that in resveratrol groups the number of tunel ( + ) and active caspase-3 ( + ) cells was decreased significantly compared to that of the stress group . showed in their study that resveratrol increases levels of gsh in tissues . in testicular ischemia model uguralp et al . in parallel with the literature , as a result of our study , we did not observe any positive effect of resveratrol on mda and gsh levels in testis . testicular morphology observed in resveratrol groups is similar to that observed in the control group . this study has demonstrated that resveratrol prevented the negative effects of chronic immobilization stress on testes of male rats . | objective .
the aim of this study was to investigate protective effects of resveratrol , a strong antioxidant , against possible negative effects of chronic immobilization stress on testes of male rats histochemically , immunohistochemically , ultrastructurally , and biochemically .
material and methods .
male wistar rats were divided into 4 groups ( n = 7 ) .
group i , control group ( c ) , was not exposed to stress .
group ii , stress group ( s ) , was exposed to chronic immobilization stress . in group iii , low dose resveratrol + stress group ( lrs ) ,
rats were given 10 mg / kg / day resveratrol just before the stress application .
in group iv , high dose resveratrol + stress group ( hrs ) , rats were given 20 mg / kg / day resveratrol just before the stress application .
for chronic immobilization stress application animals were put in the plastic tubes ( 6 cm in diameter , 15 cm in length ) during 32 days for 6 hours .
all animals were sacrificed 18 hours after the last stress application .
results .
histochemical and ultrastructural investigations showed that in stress group there was germ cell deprivation in seminiferous tubules and increase of connective tissue on interstitial area .
no significant changes were seen in low and high dose resveratrol groups .
after immunohistochemical investigations , tunel ( + ) and active caspase-3 ( + ) cells were increased in seminiferous tubules of stress group compared with those control group , but they were decreased in low and high dose resveratrol groups . according to biochemically results , mda , gsh , and testosterone levels in stress group showed no significant difference when compared with those of the other groups .
conclusion .
the chronic immobilization stress increases oxidative stress and apoptosis and causes histological tissue damages ; resveratrol can minimize the histological damage in testes significantly . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
knowledge of the incretin system began to emerge in 1902 , when bayless and starling discovered secretin , which arose from the gut after food ingestion and caused a pancreatic endocrine response that affected disposal of carbohydrates ( 1 ) . gut extracts were first used as a chemical excitant to treat diabetes in 1906 ( 2 ) . several decades later , zunz and la barre prepared an intestinal extract that could cause glucose lowering in dogs , and la barre coined the term incretin to describe this humoral activity of the gut that might enhance endocrine secretion from the pancreas ( 3,4 ) . however , after this initial flurry of successful work , subsequent experiments conducted with intestinal extracts failed to lower glucose in fasting dogs ( 5 ) . although these experiments were likely the first hint of the glucose - dependent aspect of insulin release from the pancreatic -cell under the influence of gut hormones , these unexpected findings were not appreciated , and thus , interest in incretin therapy failed to progress . incretin research lay fallow until the early 1960s , when yalow and berson developed a radioimmunoassay for endogenous insulin in man ( 6 ) . it only took a few years to determine that 50% of circulating insulin was stimulated by glucose passing through the gut ( 7 ) . these findings revived interest in the incretin system , and , in the late 1970s , creutzfeldt proposed a definition of incretins that is still accepted today : substances that are released by nutrients passing through the gut , especially carbohydrates , that stimulate insulin secretion at physiologic levels in the presence of elevated blood glucose concentrations ( 8) . soon , the incretin system emerged as a valid therapeutic target for the management of diabetes , which led to the development of current incretin - based therapies . incretin - based therapies can be divided into two subclasses : dipeptidyl peptidase-4 ( dpp-4 ) inhibitors and glp-1 receptor agonists . oral dpp-4 inhibitors delay destruction of native glp-1 by the dpp-4 enzyme system , which increases native glp-1 levels by two- to threefold ( 9,10 ) . injectable glp-1 receptor agonists raise the level of direct activation of the glp-1 receptor by about tenfold by action of the molecule on the glp-1 receptor ( 9,10 ) . dpp-4 inhibitors cause a glucose - dependent release of insulin from pancreatic -cells and suppress release of glucagon from -cells . glp-1 receptor agonists have this same effect , although quantitatively more so , and some glp-1 receptor agonists decelerate gastric emptying ( 9,10 ) . glp-1 receptor agonists have also been shown to reach a level of receptor activation that causes central satiety ( 11 ) . taken together , these effects of glp-1 receptor agonists can contribute greatly to glucose control . differential clinical effects of glp-1 receptor agonists are summarized in table 1 ( 12 ) . because the glucose - lowering effects of all incretin - based therapies are glucose dependent , they do not typically cause hypoglycemia ( unless given with an insulin secretagogue or insulin ) or weight gain , and glp-1 receptor agonists are usually associated with weight loss ( 12 ) . overall , glp-1 receptor agonists have widely differing half - lives and dosing frequencies , as well as varying degrees of a1c - lowering ability . the current glp-1 receptor agonists differ in the extent to which they control postprandial and fasting plasma glucose ( table 1 ) ( 12 ) . short - acting glp-1 receptor agonists such as exenatide twice daily ( bid ) and lixisenatide qd primarily affect postprandial glycemic excursions , with limited impact on fasting plasma glucose . for this reason , they are often referred to as prandial glp-1 receptor agonists ( 12,13 ) . in contrast , long - acting glp-1 receptor agonists , including liraglutide , exenatide once weekly ( qw ) , albiglutide , and dulaglutide , exert their greatest effect on fasting plasma glucose and can , therefore , be classified as nonprandial or fasting glp-1 receptor agonists ( 12,14,15 ) . the safety profiles of exenatide bid and liraglutide qd are quite similar and are primarily characterized by gastrointestinal ( gi ) adverse events ( aes ) , predominantly nausea and vomiting ( 16 ) . exenatide qw has a markedly reduced incidence of gi aes compared to other glp-1 receptor agonists , particularly liraglutide qd ( 14 ) . all of these incretin drugs are generally safe and effective when used either as monotherapy , as additives to oral antidiabetic agents , or in combination with basal insulin . as a result of these attractive properties , these antidiabetic agents are progressively more studied , better understood , and more often used by pcps ( 17 ) . lixisenatide is a prandial glp-1 receptor agonist that is administered qd and has properties that differentiate it from other agents in its drug class ( 18 ) . in initial dose - finding studies , it was determined that lixisenatide 20 g qd produced the best efficacy - to - tolerability ratio ( 18 ) . this makes lixisenatide unique as the only prandial glp-1 receptor agonist administered qd . despite its seemingly short half - life , lixisenatide also has the capacity to substantially decelerate gastric emptying , a property that may be lacking in several nonprandial glp-1 receptor agonists such as exenatide qw and liraglutide ( 10,12,19 ) . in the multi - trial getgoal program , the efficacy and safety of lixisenatide were investigated in different settings of type 2 diabetes therapy : either as monotherapy ; as add - on therapy to metformin , sulfonylureas , or thiazolidinediones ( tzds ) ; or in combination with basal insulin ( 2029 ) . when lixisenatide qd was compared to exenatide bid as add - on therapy in type 2 diabetes inadequately controlled by metformin monotherapy , lixisenatide demonstrated noninferiority in terms of a1c reduction compared to exenatide , with a similar percentage of patients reaching their glycemic goal . the incidence of aes was similar for lixisenatide ( 70% ) and exenatide ( 72% ) , although lixisenatide had better overall gi tolerability , including a statistically significant reduction in nausea events compared to exenatide ( 25 vs. 35% , p < 0.05 ) ( 24 ) . this finding is clinically significant because nausea is one of the main reasons patients discontinue use a glp-1 receptor agonist . in the same study , the incidence of hypoglycemia was significantly lower ( by sixfold ) with lixisenatide compared to exenatide bid ( 24 ) . it has been widely hypothesized that a key driver for postprandial normalization of glycemia by glp-1 receptor agonists is a marked deceleration of gastric emptying , resulting in delayed entry of glucose into the circulation ( 30 ) . however , there appears to be tachyphylaxis associated with this effect for the long - acting , nonprandial exenatide qw ( 31 ) . studies also show that liraglutide , as well as dpp-4 inhibitors such as sitagliptin , do not demonstrate long - term deceleration of gastric emptying ( 9,32 ) . in contrast , lixisenatide demonstrates significant deceleration of gastric emptying without tachyphylaxis , which may explain why studies in animals ( 33,34 ) and humans ( 19,35 ) show better improvement in postprandial glucose excursions and glucagon suppression with lixisenatide versus liraglutide ( 22,36 ) . thus , deceleration of gastric emptying appears to be a major factor in lixisenatide s ability to control postprandial glucose excursions . glucose excursions depend more on the rate , rather than the amount , of postprandial glucose presentation ( 36,37 ) . although research on the clinical effects of glp-1 receptor agonists has stressed the key contribution of glucose - dependent release of insulin from pancreatic -cells ( 17 ) , patients receiving lixisenatide actually seem to produce significantly less total insulin and c - peptide compared to liraglutide - treated patients . this observation may be explained by the significantly greater effect of prandial lixisenatide on deceleration of gastric emptying , which reduces the need for increased insulin production ( 36 ) . studies of lixisenatide in combination with basal insulin have shown promising results that seem to suggest an important role for lixisenatide in treating postprandial plasma glucose ( 25,26,29,38,39 ) . these studies showed that lixisenatide results in substantial a1c reduction , with a high percentage of patients reaching a1c goals , as well as substantial postprandial plasma glucose control ( table 2 ) ( 25 ) . a study that investigated titrated basal insulin dose in patients with type 2 diabetes insufficiently controlled on metformin with or without a tzd showed consistent improvement in a1c reduction with the addition of lixisenatide ( 26 ) . this may suggest a hidden or residual postprandial plasma control defect , even in patients who are less than optimally titrated on basal insulin . in addition to improvements in a1c , the addition of lixisenatide to basal insulin resulted in weight neutrality and an overall reduction in the insulin dose ( with a single daily injection of a fixed dose of glp-1 receptor agonist ) ( 26,29 ) . improvements in a1c reduction and postprandial glucose control for lixisenatide as add - on therapy to basal insulin ( 25 ) ci , confidence interval ; ls , least squares ; ppg , postprandial glucose . there is growing understanding that type 2 diabetes manifests as a combination of deficits , first in postprandial plasma glucose control , followed by impaired fasting glucose management ( 40 ) . indeed , most therapies in the antidiabetic management landscape have hinged on the control of fasting plasma glucose , and most pcps focus on fixing the fasting first as the correct way to manage glucose with insulin . a study by brown et al . ( 41 ) suggests that it takes clinicians nearly a decade to institute any insulin therapy . ( 42 ) indicates that most pcps believe that insulin should be delayed until nothing else works . clinicians are often reluctant to add mealtime insulin to address postprandial glucose excursions because of fear of multiple daily injections and an increased risk of hypoglycemia . perhaps such attitudes may contribute to overuse of basal insulin with associated weight gain and increased risk of hypoglycemia ( 43 ) . as the impact of postprandial glucose excursions becomes more fully understood , it seems reasonable that future antidiabetic therapy will simultaneously address postprandial and fasting plasma glucose control . the properties of lixisenatide , as demonstrated in the studies reviewed above , make it a suitable addition to basal insulin , after fasting plasma glucose has been addressed , to better control postprandial glucose . lixisenatide is associated with a lower incidence of hypoglycemia and weight gain , which makes it an interesting alternative to rapid - acting mealtime insulin for postprandial glycemic control . given the increasing number of patients with type 2 diabetes and the shrinking cadre of physicians ( both pcps and endocrinologists ) , clinicians will be more pressed to adopt safe , effective , easy - to - deliver treatment strategies that can fully control their patients blood glucose throughout the day . currently available incretin - based drugs have helped to meet the treatment needs of type 2 diabetes , but none fulfill all of the criteria of an optimal prandial glp-1 receptor agonist . lixisenatide offers important benefits , including its delivery as a once - daily , fixed - dose injection and its substantial deceleration of gastric emptying . these benefits lead to pronounced decreases in postprandial glucose and a beneficial effect on body weight , in conjunction with an acceptable safety and tolerability profile and a minimal risk of hypoglycemia compared to exenatide . | in brief in the past decade , various incretin - based therapies have emerged in clinical practice . these drugs , including dipeptidyl peptidase-4 inhibitors and glucagon - like peptide 1 ( glp-1 ) receptor agonists lower a1c with weight - neutral or weight - lowering effects and a relatively lower risk of hypoglycemia .
this article provides a review of lixisenatide , a once - daily glp-1 receptor agonist for the treatment of type 2 diabetes . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the small molecule universe of organic
molecules with molecular weight < 500 da is estimated to contain 10 stable
compounds . this vast number of structures
makes the prospect of mining the smu a daunting but an enticing task .
synthetic chemistry over the last century diversity oriented
synthesis ( dos ) and natural product motifs provide a means to create
libraries with diverse structures of potential value . however , the rate of molecular discovery has not kept pace
with the demand for molecular species that address compelling challenges , and one hopes to develop theoretical approaches
to accelerate the pace of progress . computational efforts are
underway to develop strategies that map and mine molecular space . reymond s group has enumerated organic libraries that contain
hundreds of billions of novel compounds . however , computational considerations limit exhaustive enumeration
to molecules up to 20 heavy atoms - enumeration of gdb-17
required over 11 cpu - years . the size of
the small molecule universe makes its exploration and mining very
challenging indeed . we have devised a chemical space exploration method
called algorithm for chemical space exploration with stochastic search
( acsess ) that allows computationally feasible
surveying of unexplored regions of the small molecule universe without
exhaustive enumeration . while chemical space mapping and exploration
is itself a novel undertaking , it does not guarantee the discovery
of useful structures . some success in identifying valuable structures
was accomplished using the enumerated gdb-11 and gdb-13 libraries , but screening of every member of a
large enumerated library is very demanding . hence , there is a pressing
need for computational approaches that bias molecular searches to
produce useful libraries of compounds drawn from the vastness of molecular
space . here , we describe a method within the acsess framework to mine
chemical space for collections of diverse compounds possessing favorable
values ( defined within a threshold from the global optimum ) of a targeted physical
property . the performance of this approach is tested on
a gdb-9 enumerated space . as an example , we show that the property - optimizing
acsess procedure can be used to construct libraries of diverse , large
dipole moment molecules ( within gdb-9 ) without enumerating all molecules
within the gdb-9 space . we also evaluate the performance of the property - optimizing
acsess method using the nkp fitness landscape . the nkp model landscape
has been used to test the performance of various evolutionary algorithms . this model tunes the ruggedness of the property
landscape by changing the length of a bit string ( specified by the
parameter n ) and the numbers of local hills and valleys
( specified by the parameters k and p ) . to our knowledge , this is the first time that the
nkp landscape model was used to compare strategies for chemical space
search . these studies demonstrate that property - optimizing acsess
maximizes the diversity of useful molecules more efficiently than
popular simple genetic algorithms . the approach presented here can
likely be extended to other molecular design challenges in drug discovery
and materials design . chemical space is defined as an n - dimensional cartesian space
in which compounds can be mapped using cheminformatics descriptors . descriptors describe physical , chemical , and topological properties
of the compounds . in our analysis , each compound is mapped using a
set of 40 autocorrelation descriptors ( which defines our molecular
space ) . for each molecule this descriptor encodes the correlations of atomic properties in
a molecule as a function of the topological distance between atoms
in the molecule . both the molecular structure and the physicochemical
properties of a molecule can be encoded in this way , which is used
successfully to construct structure activity relationships . the autocorrelation descriptor is1wheredij is the shortest bond distance between atoms i and j , and pi , pj are the descriptors
of atoms i and j , respectively . marsili partial charge , atomic polarizability , topological
steric index , and unity ( i.e. , pi = 1 for
all i ) . values of d that represent the topological distance ( bond distance ) ,
ranges from 0 to 7 . the use of the above five listed atomic properties
and topological distance results in a 40 dimensional descriptor . here ,
the molecular descriptors of the generated molecules are mean centered
and normalized to have unit variance . the chemical space
distance between two compounds is defined as the euclidean
distance between compounds based on their descriptors234where dik and djk are the k descriptor of molecules i and j , n is the length of the descriptor vector , dij is the euclidean distance between molecules i and j , dijham is the hamming distance between two bit strings i and j of length n , xor(i , j ) is the count of bit positions that
differ in the two strings , dmin is the
distance of the nearest molecule j from molecule i , i.e. , the nearest - neighbor distance of the molecule i , and m is the number of molecules in
the library . the magnitude of the molecular
dipole moment , or a value drawn from the nkp model , is used in our
analysis . we then describe property calculations
within the enumerated ( gdb-9 ) chemical universe and the enumerated
binary fitness model ( nkp landscape ) . finally , we describe searching
for optimal structures within both fitness landscapes using the property - optimizing
acsess strategy . acsess samples from a chemical space by iteratively optimizing
( maximizing ) the nearest - neighbor distances ( diversity ) of a subset
of compounds in the space of all possible compounds . there are four main steps in the property - optimizing acsess
calculation described here : ( 1 ) initialize a library , ( 2 ) breed new
compounds , ( 3 ) remove compounds that do not have a property value
above a threshold , and ( 4 ) select a maximally diverse subset of property
qualified structures . acsess can be seeded
with a collection of compounds or with a single molecule . the initial library is modified by making mutations
and crossovers . among the generated compounds , a diverse subset is chosen by applying either maximin or cell - based
partitioning algorithms . it does
so by applying an iterative approach where , to start with , a compound
from a library is randomly selected . it then selects the next compound
that is furthest from the initial compound in chemical space
distance ( eq 2 ) . the next compound from the
library it selects will be the furthest from both of the initially
selected compounds . on
the other hand , a cell - based partitioning algorithm effectively partitions
the chemical space into discrete multidimensional grids and picks
a molecule that falls in each grid . the
advantage of cell - based partitioning is that it scales linearly with
large library size . earlier implementations of acsess did not
include an approach to property optimization . as modified here , the
modified acsess now iteratively selects a maximally diverse set of
solutions with property values above a threshold value . in order
to iteratively increase the property value , we increase the property value
cutoff linearly with each iteration until a desired property value
threshold is reached . initially the threshold is set to a low value
to ensure that the population does not collapse to zero size because
of the fitness constraint . property - optimizing acsess made use of openeye oechem tk for molecule generation , openeye molprop tk for filtering , and openeye omega tk for conformer generation . property - optimizing acsess procedure uses
property filter and diversity - biased sampling to construct a diverse
library with properties above a cutoff value . we computed
the boltzmann - averaged dipole moment of all molecules in gdb-9 and
pursued strategies to identify molecules in this set with
large dipole moments . compounds among the 300,000 compounds of gdb-9
with nine of fewer heavy atoms ( allowed atom types include c , n ,
o , s , and cl ) defined the search space . for each molecule , the dipole moment ( d ) was computed
using5where i is the dipole moment of a single conformation , was computed
using boltzmann constant ( kb ) 3.1668
10 hartree per kelvin and temperature ( t ) 298 k , i belonging to a set of conformations c , and ei is the internal energy
of conformation i. conformations for each molecule ,
including stereoisomers , were generated using omega and flipper tools . each conformation was energy minimized , and
the total dipole moment was computed using am1 calculations as implemented
in the gaussian 09 package . dipole moments
were stored in a database and retrieved during acsess exploration
of the chemical space . acsess was used
to create a maximally diverse set of compounds with dipole moments
above a threshold value of 5.5 d ( the 90th percentile of gdb-9 dipole
moments ) . in
addition to the gdb-9 molecular space we chose the nkp model
since it has been widely used to test the performances of genetic algorithms . the nkp fitness landscape maps a binary string to a fitness value
from 0 to 1 . the fitness of a binary string
is the summation of the fitness contribution of each cell scaled
by the length of the string ( eq 6 ) . in this
model , we model a binary string and its nkp fitness value
as representing a molecule and the molecule s property value , respectively
( as in the case of gdb-9 molecules and their dipole moments ) . a binary
string is associated with three parameters : ( 1 ) its length n , ( 2 ) the number k of associations each
bit makes to other bits in a string ( ranges from 0 to n-1 ) , and ( 3 ) the fitness contribution or weight p ( also ranges from 0 to 1 ) of each bit position . by varying the parameters k and p , we constructed a fitness landscape
with multiple optima ( to mimic the multiple optima case in the gdb-9
space ; details presented in the supporting information ) . the fitness ( ) of a bit string ( g ) in the nkp fitness landscape model is6where we computed the fitness of all possible bit strings of 19
bits using the nkp model ( eq 6 ) . we then applied
property - optimizing acsess runs to create a maximally diverse set of bit
strings with an nkp value equal to a threshold value of 0.3
( the global maximum within our enumerated nkp model ) . in this case ,
the property - optimizing acsess library was modified to work with the binary
strings . the mutations were defined as the bit flips , and crossovers
were defined as combinations of two fragments of binary strings by cutting
them both at a randomly chosen position . the maximin algorithm used
the hamming distance ( eq 3 ) measure to compute
the nearest - neighbor distances ( eq 4 ) . we enumerated all possible 19-bit patterns and computed their fitness
with n = 19 , k = 9 , and p = 0.9 ( total of 524,288 bit strings , which is similar to
the number of molecules in the gdb-9 space ) . distribution of molecular
property values for ( a ) the enumerated nkp landscape with n = 19 , k = 9 , p = 0.9
and ( b ) the dipole moments of all molecules in gdb-9 . we used the property - optimizing
acsess method to construct a diverse set of strings in the n = 19 , k = 9 , and p = 0.9 fitness landscape . first , a maximally diverse set of binary strings was generated without
using fitness - based selection ( figure 3a ) . the maximally diverse set was used to seed the property - optimizing
acsess method that maximizes fitness ( figure 3b ) . as shown in figure 3b , the property - optimizing
acsess method finds the fittest solutions after 30 iterations without
exhaustively enumerating and evaluating all possible bit strings . ( a ) diversity
biased sampling and ( b ) fitness - biased sampling . diversity is first
maximized to generate solutions that span a given chemical space .
here , the nearest - neighbor diversity ( eq 4 )
is defined as the average hamming distance ( eq 3 ) to the nearest neighbor . the diverse solutions seed the property - optimizing
acsess method , and the fitness of the diverse set is improved iteratively .
the global optimum in our enumerated nkp model space was found within
30 iterations of our optimization ( data shown are averaged over ten
different runs ) . to judge the
performance of the property - optimizing acsess method relative to a
simple genetic algorithm ( sga ) that uses elitism ( selecting the fittest
molecules at each iteration ) , we implemented
a sga as an extension of acsess for molecular library design . we ensured
fair comparison by 1 ) applying nkp based fitness filters to sga and
acsess in every generation and 2 ) initializing both algorithms with
the same diverse subset sampled using acsess ( figure 3a ) . with the parameters and simulation steps exactly the same
as in acsess , the only difference between acsess and sga is that ,
at each iteration , sga selects an equal number of the fittest solutions
without considering the diversity among the solutions . figure 4a indicates that the sga finds the best solution
( with the largest nkp fitness value ) . however , sga tends to be trapped
in local extrema more often than acsess ( figure 4b , 40% of sga runs failed to find the optimum structures as opposed
to 0% for acsess ) . on average , the solutions that sga finds also , among the fittest solutions ( solutions having the largest
nkp fitness function value , 19 total possibilities binary strings ) ,
the number of fittest solutions found by sga is smaller ( on average
3 fittest solutions ) compared to the number of fittest solutions
found by acsess ( on average 15 fittest solutions ) ( figure 4c ) . comparison of property - optimizing acsess outcomes to the
simple genetic algorithm ( sga ) optimization for generating multiple
solutions with the largest nkp fitness value . ( a ) indicates that sga
finds the fittest solutions ( global maximum in the constructed nkp
model ) after 30 iterations . ( b ) indicates that property - optimizing
acsess runs escapes local optima more effectively than do the sga
runs , i.e. the success rate of finding largest fitness solution of
property - optimizing acsess is 100% compared to 60% for sga ( from 10
runs of each method ) . ( c ) indicates that the property - optimizing acsess
runs also performs better than sga to sample diverse fittest solutions
as it samples a larger number of fittest solutions compared to sga . ( d ) indicates that , on average , the fitness of solutions generated
by property - optimizing acsess is larger than that of sga . property - optimizing
acsess was used to sample diverse molecules in gdb-9 with average
dipole moments 5.5d ( the top 10% of molecules ) . as in the nkp
model space exploration , acsess first generated a maximally diverse
set of compounds , without fitness optimization , spanning the gdb-9
universe ( figure 5a ) . the maximally diverse
set was used to seed the next step , where the fitness of the diverse
set was improved iteratively . figure 5b indicates
that acsess finds diverse molecular structures with dipole moments
above the 90th percentile of compounds in the gdb-9 universe without
exhaustively enumerating and evaluating each molecule . the plots show the mean of the dipole moments from
multiple runs , and the error bars represent one standard deviation
from the mean of either nearest - neighbor distance or dipole moment . ( a ) initially , a maximally diverse set ( measured by nearest - neighbor
distance ) is generated . ( b ) the maximally diverse set is used to maximize
their dipole moments . the minimum dipole moment found after 60 iterations
is the desired dipole moment threshold ( i.e. , the top 10% fittest
molecules ) . we compared the performance of acsess to standard genetic algorithms
( sgas ) to judge the relative performance for property biased library
design . we ensured fair comparison by 1 ) applying dipole moment filtering
in every generation for sgas and property - optimizing acsess and 2 )
initializing all algorithms with the same diverse subset of gdb-9
structures generated using acsess ( figure 5a ) . sgas are
used mainly for fitness optimization , but they can also maintain the
diversity of solutions using techniques such as roulette wheel selection
and tournament selection . we now explore how
well acsess optimizes the fitness and diversity of the library by
comparing to these standard approaches . we compare the performance
of acsess with sgas where each method starts with the same diverse
set constructed using acsess ( figure 5a ) . acsess and sgas runs
that maximize the dipole moments ( fitness ) of diverse molecules . the
two plots track the average fitness of libraries generated by each
design algorithm ( color coded differently ) , and the error bars represent
one standard deviation from the mean for multiple runs . ( a ) compares
the fitness of the library optimized using acsess with three other
genetic algorithms ( colored coded differently ) . ( b ) compares the diversity
of the fit libraries generated by acsess and sgas . as summarized
in table 1 , we found , on average , that acsess
generate molecules with similar or more favorable dipole moments
( fitness ) compared to sgas , but acsess generates a more diverse set
of fit molecules ( dipole moment 5.5d ) compared to sgas . more
specifically , acsess generates molecules with higher dipole moments
( fitness ) than sga with roulette wheel selection , but acsess generates
solutions of similar fitness to sga with tournament selection ( figure 6a ) . sga with elitism ( selecting the fittest solutions
in every generation ) performs marginally better than acsess . however ,
figure 6b indicates that the diversity ( measured
using the nearest - neighbor euclidean distance defined in eq 4 ) of the molecular library for acsess is much larger than
is found with the sgas . in fact , the nearest - neighbor euclidean distance
( euclidean distance of 10 ) of the library generated by acsess
is similar to the nearest - neighbor euclidean distance ( euclidean distance
of 12 ) that is found for the enumerated gdb-9 molecules with
dipole moments 5.5d . these results indicate that the diversity
of the acsess generated library is similar to the diversity of the
enumerated gbd-9 universe that contains only the compounds above a
fitness cutoff . these findings are similar to those from the model
nkp landscape , where acsess generated multiple global optima without
becoming trapped in local optima . in contrast , the sgas became trapped
in local optima in 40% of the runs ( figure 4b ) and produced far fewer fittest solutions ( figure 4c ) . these calculations indicate that the diversity enforcement
in acsess yields sampling of different high fitness regions of the
gdb-9 space favorably compared to sgas . it is important to note that ,
while acsess generates large diversity solutions , the fitness is still
comparable to and better , in some cases , compared to that found with
popular simple genetic algorithms ( figures 4d and 6a ) . additional insight into performance
of property - optimizing acsess and sgas is obtained by visualizing
the sampled molecules with respect to the enumerated molecular space .
for this purpose , we projected the 40 dimension chemical space into
two dimensions using a self - organizing map ( som ) . a 100 100 torroidal grid was used where
each grid point is a neuron . the som in this case
was trained using the enumerated gdb-9 . during the training , each
neuron is randomly assigned a chemical space coordinate , and the neurons
are trained by presenting a descriptor vector for each molecule . neurons compete with each other for the presented descriptor vector
and adjust their coordinates based on the descriptor vector closest
to them . in the resulting two - dimensional representation
after training the structurally similar molecules clumped together
in the same neuron or nearby neurons , and the structurally is similar molecules are assigned to the more distant neurons . ( a ) shows the full gdb-9 with color - bar representing
average dipole moment per neuron from blue ( low ) to red ( high ) . ( b )
shows the acsess designed diverse library ( without maximizing the
dipole moment ) . the filling of the plot in b indicates that the diverse
library from acsess spans the gdb-9 space . the color bar in b indicates
the number of molecules assigned to each neuron . we projected the enumerated gdb-9
on the som and also the maximally diverse subset of gdb-9 sampled
using acsess without maximizing the dipole moments ( figures 7a and 7b ) . comparing figures 7a and 7b we see that by maximizing the diversity of gdb-9 molecules , we are able to
sample various regions of the enumerated gdb-9 . we also projected ,
on the trained som , the libraries designed using property - optimizing
acsess ( figure 8a ) and sga ( using the elitist
selection scheme , figure 8b ) and compared those
with the high - activity regions ( dipole moment 5.5 d ) within
gdb-9 ( figure 8c ) . comparison of the diversity
found in an acsess library and in an sga - elitist library to the fully
enumerated gdb-9 library . the color bars in a and b indicate the number
of compounds per neuron . ( a ) shows the more fit molecules ( molecules
above the fitness cutoff ) generated by acsess , ( b ) shows the more
fit molecules ( molecules above the fitness cutoff ) generated by sga
( elitist ) , and ( c ) shows the fittest regions of gdb-9 ( 5.5d
dipole moment ) where the color bar represents the number of compounds
per neuron . the oval indicates molecules in gdb-9 that are discovered
using acsess but missed by sgas . figure 8 indicates that the high activity
regions of gdb-9 are identified in acsess analysis ( figure 8a in oval ) but overlooked by sga - elitist analysis
( figure 8b oval ) . the medium activity regions
( yellow colored regions in figure 7a ) populated
by the acsess library that lie above the black oval ( figure 8a ) are absent in sga library ( figure 8b ) . the underperformance of sga explains why libraries generated
by sgas have lower diversity compared to the acsess generated libraries . while acsess is able to explore different activity islands of gdb-9 ,
the sgas fail to do so . in this study , we showed
that property - optimizing acsess explorations navigate large chemical
spaces to find compounds with favorable targeted property values . acsess not only samples diverse regions of chemical space but also
samples useful regions without having to enumerate and test every
single molecule . in fact , only 30,000 fitness evaluations
were carried out to locate the different optimal regions of gdb-9
( which contains 300,000 molecules ) . we explored acsess performance
in an nkp landscape and in the gdb-9 for molecular dipole moment .
in these studies , acsess performs favorably in terms of discovering
diverse fit solutions compared to standard genetic algorithms , and
acsess performs much more efficiently than exhaustive enumeration . acsess can also be used to sample astronomically large chemical
spaces , and this represents a research direction . since property - optimized
acsess libraries contains multiple favorable molecules , one can choose
from among the diverse available alternatives . studies presented
here on known landscapes demonstrate that property - optimized acsess
can indeed help to discover diverse useful molecules from the vastness of libraries
chemical space and may assist in successful molecular discovery . | the
small molecule universe ( smu ) is defined as a set of over 1060 synthetically feasible organic molecules with molecular weight less
than 500 da .
exhaustive enumerations and evaluation of all
smu molecules for the purpose of discovering favorable structures
is impossible .
we take a stochastic approach and extend the acsess
framework ( virshup et al . j. am .
chem .
soc.2013 , 135 , 7296730323548177 ) to
develop diversity oriented molecular libraries that can generate
a set of compounds that is representative of the small molecule universe
and that also biases the library toward favorable physical property
values .
we show that the approach is efficient compared to exhaustive
enumeration and to existing evolutionary algorithms for generating
such libraries by testing in the nkp fitness landscape model and in
the fully enumerated gdb-9 chemical universe containing 3 105 molecules . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
radiologically isolated syndrome ( ris ) is defined as magnetic resonance imaging ( mri ) findings suggestive of multiple sclerosis ( ms ) in persons without typical ms symptoms and with normal neurological findings . it was first introduced in 2009 to define a cohort of individuals routinely encountered in clinical practice who are at risk for future demyelinating events . evidence is growing that individuals with ris are more likely to progress to symptomatic ms . approximately , two - third of individuals with ris shows radiological progression , and one - third of individuals with ris develop neurological symptoms during mean follow - up periods of up to 5 years . the conversion rate from ris to ms was 65% after a mean follow - up of 5.3 years and 88% after a mean follow - up of 14.1 years . similarly , the risk of conversion to definite ms after 5 years in the optic neuritis treatment trial was 51% for persons with baseline brain mri scans containing 3 lesions , compared with 16% in patients with no mri lesions . although some studies have estimated conversion rates from ris to definite ms in selected populations , none of them were undertaken in developing countries or in iran . due to the heterogeneity of ms , its recognized polygenic basis and dependence on environmental factors , there is a need for ethnically focused and country- or continent - specific studies of conversion from ris to definite ms . the objective of this study was therefore to estimate the conversion rate from ris to definite ms and to conduct a preliminary investigation of the determinants of conversion to definite ms in a sample of patients in iran . a total of 25 patients ( 17 men and 8 women ) aged 22 - 45 years who fulfilled the barkhof / tintor criteria for ris were evaluated prospectively during a mean ( standard deviation [ sd ] ) follow - up period of 17.4 ( 5.4 ) ( range 8 - 29 ) months at the ms out - patient clinics of isfahan university of medical sciences , iran . after detection of silent mri with lesions suggestive of inflammatory / demyelinating nature , all individuals underwent mri study of the brain and cervical spinal cord that fulfilled dissemination in space ( dis ) criteria for ris . a complete neurologic and medical history was obtained , and physical examination and comprehensive neurologic evaluation were performed . none of the patients had previously experienced remitting clinical symptoms consistent with neurologic dysfunction of the central nervous system . in all cases , mri abnormalities were identified by radiologists and verified by a neurologist ( me ) to ensure dis criteria were met . a qualitative ( i.e. geographical location within the brain or spinal cord , and morphology of lesions ) and quantitative analysis ( i.e. number of t2-foci , presence or absence of gadolinium enhancement ) of the brain and cervical spine imaging studies was performed for all study participants . the csf was analyzed to determine cell count and a protein level , and oligoclonal bands were evaluated with an isoelectrofocusing method . the detection of oligoclonal bands was confirmed if more than one band that was not detected in the serum was present in the csf . patients with ris were evaluated every 6 months after the start of the study to monitor conversion to definite ms , according to the revised mcdonald 's criteria . patients who had at least one new clinical event with documented new symptoms and signs were classified as having definite ms , defined as the development of an acute neurological episode localized to the optic nerve , brainstem , cerebellum , spinal cord , or long sensory or motor tracts , lasting > 24 h followed by a period of symptom improvement or the onset of a clinical symptom ( e.g. leg weakness ) . other disease processes that might have caused the radiological abnormalities were carefully considered and ruled out . individuals with a history of neonatal complications , alcohol or drug abuse , anoxic injury or heritable blood dyscrasias were excluded . the study protocol was approved by the institutional review board of the isfahan university of medical sciences , iran , and all participants provided written informed consent . brain and cervical spinal cord mri with gadolinium were carried out at baseline and 6-month follow - up . we used a standard magnetic field strength of 1.5 t with a 5-min scanning time delay after the injection of a single dose of 0.1 mmol / kg gadolinium ( axial and sagittal t1- , t2-weighted and fluid - attenuated inversion recovery images , 5-mm slice thickness ) . conversion rate was estimated as the number of cases of progression to definite ms per 100 person - months of follow - up beginning on the date of completion of the baseline examination and continuing until the occurrence of definite ms , the date of the last completed follow - up , death , or the end of follow - up on december 31 , 2012 , whichever came first . for ease of interpretability , we report the conversion rates to definite ms as percentages per month . whitney u test , fisher 's exact test , and survival analysis with the cox proportional hazards model and kaplan meier estimates to assess time - dependent variables , in order to obtain hazard ratios ( hrs ) with 95% confidence intervals ( ci ) and p values . the time from ris diagnosis to the definite ms was estimated using kaplan meier survival analysis . cox proportional hazards model was used to assess the independent predictive value of demographic , clinical , and imaging characteristics on the time from the first mri to definite ms . we considered the following covariates in the cox proportional hazards model : age at first brain mri , gender , family history of ms , location of the lesions ( periventricular , corpus callosum , cervical spinal cord ) and gadolinium - enhanced lesions . the association of each covariate with time to the definite ms was quantified by hr along with their 95% ci . all tests for statistical significance were two - tailed and were done assuming a type i error probability of < 0.05 . brain and cervical spinal cord mri with gadolinium were carried out at baseline and 6-month follow - up . we used a standard magnetic field strength of 1.5 t with a 5-min scanning time delay after the injection of a single dose of 0.1 mmol / kg gadolinium ( axial and sagittal t1- , t2-weighted and fluid - attenuated inversion recovery images , 5-mm slice thickness ) . conversion rate was estimated as the number of cases of progression to definite ms per 100 person - months of follow - up beginning on the date of completion of the baseline examination and continuing until the occurrence of definite ms , the date of the last completed follow - up , death , or the end of follow - up on december 31 , 2012 , whichever came first . for ease of interpretability , we report the conversion rates to definite ms as percentages per month . whitney u test , fisher 's exact test , and survival analysis with the cox proportional hazards model and kaplan meier estimates to assess time - dependent variables , in order to obtain hazard ratios ( hrs ) with 95% confidence intervals ( ci ) and p values . the time from ris diagnosis to the definite ms was estimated using kaplan meier survival analysis . cox proportional hazards model was used to assess the independent predictive value of demographic , clinical , and imaging characteristics on the time from the first mri to definite ms . we considered the following covariates in the cox proportional hazards model : age at first brain mri , gender , family history of ms , location of the lesions ( periventricular , corpus callosum , cervical spinal cord ) and gadolinium - enhanced lesions . the association of each covariate with time to the definite ms was quantified by hr along with their 95% ci . all tests for statistical significance were two - tailed and were done assuming a type i error probability of < 0.05 . their mean age ( sd ) was 35.1 ( 6.2 ) years ( range 22 - 45 years ) at first brain mri . the average duration of follow - up was 17.4 ( 5.4 ) months ( range 8 - 29 months ) . most patients ( 23/25 , 92% ) underwent brain mri for the evaluation of migraine and other types of headache . of 25 patients with ris for whom gadolinium was used in the first scan , 9 ( 36% ) had one or more enhancing lesions and 6 ( 24% ) had a cervical spinal cord lesion [ table 1 ] . all patients met the barkhof / tintor criteria for dis on baseline brain mri scans . clinical , radiologic and demographic characteristics of patients with radiologically isolated syndrome the mri studies comprised 25 brain and cervical spinal cord scans . longitudinal mri data were acquired for all 25 patients after the incidental foci were identified , and all patients had two or more mri . radiological progression ( presence of new t2-foci , gadolinium enhancement or enlargement of a preexisting lesion ) was identified in longitudinal mri studies in 84% ( 21/25 ) of patients . during 408 ( 148 men and 260 women ) person - months of follow - up , 6 ( 2 men and 4 women , all relapsing - remitting ) of 25 ( 8 men and 17 women ) the first clinical event occurred 8 months after initial mri in one patient , after 12 months in two patients , after 14 months in one patient , and after 17 months in two patients . one patient developed optic neuritis ; one patient developed diplopia , and four patients developed motor symptoms ( weakness in the lower or upper limbs ) . the mean ( sd ) time between the first brain mri and definite ms was 13.3 ( 3.4 ) months ( median , 13 ; range , 8 - 17 ) . lumbar puncture was performed in 10 of 25 patients , and csf profiles were suggestive of ms in 60% ( 6/10 ) of these cases ( > 1 unique oligoclonal bands not observed in the serum ) . all patients considered as positive for csf based on the detection of > 1 oligoclonal band experienced mri progression and developed clinical events . meier survival curve showing the risk of developing definite multiple sclerosis ( ms ) . at 8 months , 96% of patients did not have ms . at 12 months , 88% of patients did not have ms . at 17 months , 76% of patients did not have ms mean age at development of definite ms was 30.2 ( 5.2 ) years . the overall conversion rate to definite ms was 1.5% ( 95% ci : 0.54 - 3.17 ) per month . conversion rates to definite ms were similar in women ( 1.5% , 95% ci : 0.42 - 3.9 ) per month and men ( 1.4% , 95% ci : 0.17 - 4.79 ) per month . the mean and proportional differences between those who did and did not progress to definite ms during a mean follow - up period of 17.4 months are shown in table 2 . those who progressed to definite ms were younger at first brain mri ( 30.2 vs. 36.6 years , p < 0.05 ) and had lower follow - up period ( 13.3 vs. 18.7 months , p < 0.05 ) and had more gadolinium - enhanced lesions ( 2.2 vs. 1.0 , p < 0.05 ) and csf abnormalities ( 1 vs. 6 persons , p < 0.001 ) . changes in time in patients who did or did not progress to definite multiple sclerosis during a mean follow - up period of 17.4 months the independent predictors associated with conversion to definite ms from ris were also analyzed with a multivariate model . a step - wise cox proportional hazards model was run to test seven predictor variables : age at first brain mri , gender , family history of ms , location of the lesion ( periventricular , corpus callosum , spinal cord ) and gadolinium - enhanced lesions . multivariate analysis showed that the presence of contrast - enhanced lesions on initial mri was marginally significantly associated with ms ( hr 1.83 , 95% ci 0.98 - 3.44 , p = 0.060 ) , indicating a relative increase of 83% in the hr of conversion to definite ms during the mean follow - up period of 17.4 months in patients who had gadolinium - enhanced lesions compared with those without such lesions . women also had a nonsignificantly higher risk of progressing to definite ms ( hr 2.29 , 95% ci 0.65 - 8.05 ) [ table 3 ] . age at first brain mri and periventricular , corpus callosum , brainstem , and cervical lesions were not significant predictors of conversion to definite ms . during 408 ( 148 men and 260 women ) person - months of follow - up , 6 ( 2 men and 4 women , all relapsing - remitting ) of 25 ( 8 men and 17 women ) patients developed definite ms . in all subjects experiencing clinical events the first clinical event occurred 8 months after initial mri in one patient , after 12 months in two patients , after 14 months in one patient , and after 17 months in two patients . one patient developed optic neuritis ; one patient developed diplopia , and four patients developed motor symptoms ( weakness in the lower or upper limbs ) . the mean ( sd ) time between the first brain mri and definite ms was 13.3 ( 3.4 ) months ( median , 13 ; range , 8 - 17 ) . lumbar puncture was performed in 10 of 25 patients , and csf profiles were suggestive of ms in 60% ( 6/10 ) of these cases ( > 1 unique oligoclonal bands not observed in the serum ) . all patients considered as positive for csf based on the detection of > 1 oligoclonal band experienced mri progression and developed clinical events . meier survival curve showing the risk of developing definite multiple sclerosis ( ms ) . at 8 months , 96% of patients did not have ms . at 12 months , 76% of patients did not have ms mean age at development of definite ms was 30.2 ( 5.2 ) years . the overall conversion rate to definite ms was 1.5% ( 95% ci : 0.54 - 3.17 ) per month . conversion rates to definite ms were similar in women ( 1.5% , 95% ci : 0.42 - 3.9 ) per month and men ( 1.4% , 95% ci : 0.17 - 4.79 ) per month . the mean and proportional differences between those who did and did not progress to definite ms during a mean follow - up period of 17.4 months are shown in table 2 . those who progressed to definite ms were younger at first brain mri ( 30.2 vs. 36.6 years , p < 0.05 ) and had lower follow - up period ( 13.3 vs. 18.7 months , p < 0.05 ) and had more gadolinium - enhanced lesions ( 2.2 vs. 1.0 , p < 0.05 ) and csf abnormalities ( 1 vs. 6 persons , p < 0.001 ) . changes in time in patients who did or did not progress to definite multiple sclerosis during a mean follow - up period of 17.4 months the independent predictors associated with conversion to definite ms from ris were also analyzed with a multivariate model . a step - wise cox proportional hazards model was run to test seven predictor variables : age at first brain mri , gender , family history of ms , location of the lesion ( periventricular , corpus callosum , spinal cord ) and gadolinium - enhanced lesions . multivariate analysis showed that the presence of contrast - enhanced lesions on initial mri was marginally significantly associated with ms ( hr 1.83 , 95% ci 0.98 - 3.44 , p = 0.060 ) , indicating a relative increase of 83% in the hr of conversion to definite ms during the mean follow - up period of 17.4 months in patients who had gadolinium - enhanced lesions compared with those without such lesions . women also had a nonsignificantly higher risk of progressing to definite ms ( hr 2.29 , 95% ci 0.65 - 8.05 ) [ table 3 ] . age at first brain mri and periventricular , corpus callosum , brainstem , and cervical lesions were not significant predictors of conversion to definite ms . in this cohort study , the conversion rate to ms in patients with ris at baseline was 1.5%/month ; this finding is evidence that individuals with ris are at increased risk of developing definite ms . to the best of our knowledge , this is the first study to report conversion rates in patient with ris but absence of neurological symptoms or signs in iran . a number of studies , with different results , have assessed conversion rate to ms in patients with ris so far . the differences in the methods used to estimate conversion to clinically definite ms , the duration of undiagnosed ris , the use of different criteria for the diagnosis of cis and definite ms , composition of the sample in terms of age and gender and small sample size and short follow - up period may be the reason for the differences . estimated that 59% of individuals with ris showed radiological progression during a median period of 2.7 years . found that clinically definite ms developed in 88% after a mean of 14.1 years of those with abnormal results on mri at presentation and in 19% of those with normal mri results . in a study of 70 patients with ris during a mean follow - up of 5.2 years , eight patients showed conversion to clinically definite ms . a brazilian study spanning 49 months found that only two of 12 individuals with ris developed symptoms of neurological dysfunction as cis or as recurring symptoms compatible with a diagnosis of definite ms . recently , okuda et al . found that clinical events were identified in 34% of individuals within 5-year period from the first brain mri study . in a study similar to ours of a cohort of 30 patients with unexpected ms , 83% showed progression on imaging criteria alone within the first 2 years ; clinical symptoms occurred in 37% of patients within 5 years . in our study , the median time to definite ms was 13 months and mri progression occurred in 84% of the cases . however , it is not known whether the patients were at risk of developing definite ms . the difference of definition of definite ms in this study ( the 2010 mcdonald criteria ) compared with previous studies might be one reason of high conversion rate from ris to definite ms despite short - term follow - up . in our series , the presence of contrast - enhanced lesions on initial mri was marginally significantly associated with ms ( hr = 1.83 , p = 0.060 ) . other studies also reported that the risk of developing ms was higher in individuals with baseline mri scans demonstrating gadolinium - enhanced lesions than in individuals without such lesions . . noted , this risk of enhancement may be related to the existing burden of disease . the presence of gadolinium - enhanced lesions in patients with ms was identified as a predictor of radiological progression and subsequent clinical relapse , and as the mri parameter that most clearly predicted conversion to definite ms . taken together , these findings confirm the importance of gadolinium - enhanced lesions in patients with ris . in our study , mean age of the patients who progressed to definite ms was younger than in patients with ris who did not progress to ms . this finding is consistent with reports that ms may occur as early as the third decade of life . however , we do not know how long patients who did and did not progress to definite ms may have had undiagnosed ris . the high risk of developing ms in individuals with ris underscores the importance of existing lesions suggestive of demyelinating disease and gadolinium enhancement in the baseline scan regardless of the absence or presence of clinical symptoms . we believe that if the barkhof / tintor criteria are met at the time of the initial brain mri by an individual suspected of having ris , paraclinical screening , clinical evaluation , and follow - up mri should be proposed . recently , okuda et al . have reported their findings in 71 individuals with ris , who had cervical spine mri scans prior to the first clinical event . abnormal signals in the cervical spinal cord highly suggestive of ms were found in 25 patients ( 35% ) , whereas conversion to clinically isolated syndrome , or primary progressive ms was observed in 21 ( 29.6% ) during a median of 1.6 years . only three patients out of 46 who did not have spinal cord lesions subsequently had a clinical event . these observations support the view that asymptomatic individuals with abnormal mri signals in both the brain and cervical spinal cord , in comparison to the brain alone , are at higher risk of developing clinical ms . unlike okuda et al . , we found that the number of baseline cervical spinal cord lesions was not associated with conversion to definite ms . in our study , cervical spinal cord lesions were present in three of patients who progressed and in three patients who did not progress to ms . the mechanisms underlying the increased risk of ms in patients with ris are not clear . persons with ris may have a milder degree of demyelization or a better repair response to insult . by using mri metrics , de stefano et al . found that 13 of 19 patients with ris had a probability 70% of being classified as having ms . interestingly , the predictive factors they identified included abnormal csf , dissemination in time in a new mri scan , and a positive cervical spine mri . none of our patients has subsequently been found to have any disease entity other than ms . nevertheless , a potential limitation of our study is its relatively brief follow - up period of 17.4 ( 5.4 ) months ( range 8 - 29 ) , which may be too short to appreciate the real risk of conversion to ms . assessing the conversion rate after longer follow - up periods is , therefore , warranted . large and long multicenter prospective studies of ris need to be performed to determine the actual risk of conversion to ms , and also to search for different biological mechanisms that explain why some cases with demyelinating lesions appear to remain clinically silent for life , or why some patients develop clinical symptoms late in life . the generalizability of the present study is limited by the insufficient number of patient , short period of observation , and single institutional findings of the sample . despite the above limitations , our findings add to our understanding of the conversion rate to ms in people with ris in iran . furthermore , this study provides new data from iran , a developing country that has been underrepresented in past studies . patients with incidental findings of brain abnormalities in their initial mri studies continue to be at substantial risk for the development of ms . although treatment with disease - modifying therapies is generally not recommended for individuals with ris because many may never develop ms , a recent review noted that about 10% of the reported ris population is treated . it is not known whether early treatment with disease - modifying therapy ( as for patients with confirmed ms ) improves symptom - free survival for individuals with ris . for patients with abnormal brain mri findings , one must balance their risk of developing ms with the potential side - effects and cost of disease - modifying agents . treatment may be appropriate , but the evidence is insufficient , partly because of the lack of controlled trials of treatments and partly because the long - term prognosis is unknown . randomized controlled trials designed to test the efficacy of early initiation of disease - modifying therapies in relapsing ms , and to determine whether such treatment delays the conversion of ris to ms , will aid in defining the role of disease - modifying therapies in the high - risk ris population . the findings of this study expand a still very limited body of evidence supporting the hypothesis that the presence of ris increases the risk of conversion to ms . our findings strongly support regular screening and follow - up for patients with ris . a larger and longer multicenter prospective study of ris is warranted to assess the actual risk of conversion to ms in greater detail . | background : the aim of this study was to estimate the conversion rate from radiologically isolated syndrome ( ris ) to definite multiple sclerosis ( ms).methods : during a mean ( standard deviation [ sd ] ) follow - up period of 17.4 ( 5.4 ) ( range 8 - 29 ) months , 25 subjects with ris and without neurological symptom aged 22 - 45 year from a single - center have been examined for the occurrence of definite ms .
the mean ( sd ) age of participants was 35.1 ( 6.2 ) years at first brain magnetic resonance imaging ( mri ) .
the definite ms were assessed using the revised mcdonald 's criteria ( 2010).results : six of 25 patients developed clinical symptom consistent with criteria for definite ms .
the conversion rate from ris to definite ms was 1.5 ( 95% confidence interval [ ci ] 0.54 , 3.17 ) per 100 person - months based on 480 person - months of follow - up .
multivariate analysis revealed that presence of contrast - enhancing lesions on the initial mri was marginally significantly associated with ms ( hazard ratio 1.83 , 95% ci 0.98 , 3.45 , p = 0.060).conclusions : this is the first estimate of conversion rate from ris to definite ms in iran .
the conversion rates from ris to definite ms in these participants are high and intensive follow - up and intervention strategies are recommended for these high - risk individuals .
a larger study is warranted to assess this risk in greater detail . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mitochondria and chloroplasts represent endosymbiont models of complex organelle development driven by evolutionary modification of permanently enslaved primordial bacteria[14 ] . over diverse eukaryotic phyla mitochondria and chloroplasts either alone or together cellular dysregulation of these two distinct organelles may generate potentially dangerous reactive oxygen species ( ros ) due to compromised complex bioenergetics energy production , systemic oxidative stress and compounded pro - inflammatory processes . importantly , genetically- or biochemically - mediated failure of mitochondrial function in human populations represents a potentially dire factor in the etiology of major disease states that include type ii diabetes , atherosclerosis , rheumatoid arthritis , alzheimer s disease , and cancer progression [ 521 ] . in sum , these compelling mechanistic and clinical data suggest that the extent of mitochondrial / chloroplast regulatory signaling may vary over the lifetime of the eukaryotic cell according to physiological demand and bioenergetics requirements . interestingly , a tumor cell may be viewed as a phenotypic reversion to the last common eukaryotic ancestor of the host cell , i.e. , a facultative anaerobic microbe with unlimited replication potential . for example , anaerobic mitochondria in gill cilia of m. edulis have evolved to utilize the phenotype of a facultative anaerobe , demonstrating that this primitive type of respiration has been evolutionarily conserved . accordingly , anaerobically functioning mitochondria may represent a re - emergence or evolutionary retrofit of primordial metabolic processes . it has become recently apparent that mitochondria have discrete microenvironments composed of complex intracellular membrane structures with distinct functional identities determined by segregated biochemical pathways ( figure 1 ) . given the shared chemical messengers between the two and interrelationships between the common energy processes furthermore , it is no surprise that mitochondria are present in both plants and animals , implying major shared regulatory , bioenergetic , and chemical substrate pathways . commonalities of energy processing in both plants and animals have become even stronger by the finding that chloroplast can be found in animal cells . the discovery of kleptoplasty , a functional chloroplast in cells of a non - photosynthetic host is a remarkable phenomenon [ 2831 ] . it is also found in metazoans , i.e. , the sacoglossan sea slug . of equal importance is the longevity of functional kleptoplasts in the host , suggesting again the common significance of bidirectional communication and the many commonalities in molecules exist so that this phenomenon can take place and work . these sea slugs extract and incorporate functional chloroplasts from ulvophyceae into their gut cells , allowing their derived food to be gained for months . the dependence on specific algae strongly suggests common bidirectional communication is responsible for these phenomena . the ability of a chloroplast to function as a symbiotic bioenergetic organelle within the intracellular milieu of a representative invertebrate , i.e. , the sacoglossan sea slug , was previously identified as a unique phenomenon unlikely to occur in vertebrates [ 2832 ] . recently , the observation of internalized algae within embryonic tissues of the spotted salamander strongly suggest that developmental processes within a vertebrate organism may require photosynthetic endosymbiosis as an internal regulator . accordingly , it appears that green algae and spotted salamander embryos have an intimate endosymbiotic relationship and algae are able to invade the embryonic tissues and cells of the salamander and eventually degrade as the larvae develop over time . although endosymbiotic algal cells go through degradation , the cells can also encyst on the inner capsule wall which is detected through 18s rdna amplification in the reproductive tracts of the adult salamanders , thereby allowing for the transfer of genes from one generation to the next . due to the dense accumulation of algae within the embryo , a distinct green color is exhibited which leads to beneficial effects for the embryo . requisite physiological effects include lowering embryonic mortality , larger embryo size , and earlier hatching times . it is still unclear if the algae and the embryo have a true bidirectional symbiotic relationship because there is evidence that the algae have no increase in oxygen levels , but they may benefit from the embryos when their nitrogenous waste is released . in any event , this phenomenon defines a distinctive relationship between developmental processes in a defined vertebrate organism and eukaryotic algae . a careful examination of the biomedical literature has yielded many examples of existential commonalities between mitochondria and chloroplasts , which include free living bacteria . formally known as the pewy motif in mitochondrial complexes , cyt b displays four tetrapeptide residues ( pdwy , ppwf , pvwy and pewy ) employed in catalytic reactions , which is now identified as the qo motif . pewy , which is present in chloroplasts and mitochondria , and pdwy which is present in gram - positive bacteria both associate with the redox potential of quinone species . these data suggest that when electron transfer occurs from a low - high potential throughout evolution that the cyt bc1 complex with pewy being the qo motif will function best with a high potential and ubiquinone as its substrate . for pdwy as the cyt b complex , a low potential and menaquinone will function the best . in sum , the molecular evolution / retention of the catalytic qo quinol oxidation site of cytochrome b complexes , functionally underlies the common retention of a chemiosmotic proton gradient mechanism for atp synthesis in cellular respiration and photosynthesis . for example , when tomato fruit ripen , their chloroplasts will change into photosynthetically inactive chromoplasts that can produce atp through a respiration process known as chromorespiration . oxygen consumption through chromorespiration can be stimulated by nadh and nadph , and is also sensitive to the plastidial terminal oxidase inhibitor octyl gallate . isolated chromoplasts are also sensitive to multiple molecules such as the cytochrome b6f complex inhibitor 2,5-dibromo-3-methyl-6-isoproply - p - benzoquinone . cytochrome f was identified in the chromoplast as was cytochrome c6 and their expression increases in ripened tomatoes suggesting that they may be acting as electron acceptors for the cytochrome b6f complex . during ripening , mitochondrial numbers significantly decrease in the fruit tissue . in order to compensate for this strong decrease , the number of chromoplasts will functionally increase during the later stages of ripening , thereby demonstrating critical modification of energy processing . importantly , plants require imported oxygen to carry out most of their biochemical reactions such as respiration even though they lack the ability to distribute oxygen to the cells . to compensate for the lack of this distribution mechanism , plants often display steep oxygen gradients that may be impaired due to environmental distress . thus , plants require different physiological responses to manage the variations of oxygen levels available to them and display metabolic adaptations in energy requirements . as a key example , physiological demand is coupled to activation of the cellular glycolytic pathway to generate atp production when oxidative phosphorylation is compromised . cellular oxygen levels have been demonstrated to regulate the expression of group - vii ethylene response factors ( erfs ) , a family of transcription factors involved in the regulation of hypoxia - inducible genes that include hre1 and hre2 . furthermore , the functional integrity of mitochondria and chloroplasts are critically linked to cellular oxygen requirements , as regulated by the n - end rule signaling pathway due to the impacted loss . the n - end rule signaling pathway represents a cellular response mechanism that requires ubiquitin ligation linked to proteasomal degradation via covalent modification of n - terminal amino acids . finally , the array of complex control mechanism by which organellar gene expression ( oge ) promotes respiration , photosynthesis and plant development is actively under investigation . presently , several required components have been identified that have been functionally associated with oge processes . nucleus - encoded proteins have important roles in oge by promoting various required functions such as splicing , transcription , rna processing and regulation of translational processes . normative oge is regulated by the family of mitochondrial transcription termination factors ( mterf ) . mammalian mterfs were originally proposed to specifically terminate transcription , but further biochemical and molecular studies indicate that three out of the four mterfs possess important regulatory activities necessary for ribosomal biogenesis and antisense transcription termination . approximately 30 members of the mterf family have been identified throughout plant evolution , but still little is known about how photosynthetic organisms are using mterfs and oge . in sum , the dual regulatory targeting of mitochondrial and chloroplast gene expression by mterf proteins to promote optimal energy production and oxygen consumption further advances the evolutionary importance of oge processes . it is now established that the same set of functional genes are encoded in both the plastid and mitochondrial genomes , which express the same conserved proteins in the electron transport chain . thus , it is strongly implied that oge processes are critically linked to shared stereo - selective biochemical pathways . the ongoing processes underlying biologically meaningful evolutionary modification of the organellar genome can be partly attributed to regulatory stability of intracellular redox processes . as such , a hypothesis of evolutionary modification of intracellular redox regulation predicts that there is a specific location for the plastids and mitochondria genes that encode for bioenergetics membrane proteins that are functionally related to respiration or photosynthesis . the dual evolution of the plastid and mitochondria genomes will effectively drive the retention of functionally similar sets of ribosomal protein genes which are functionally required for proper ribosomal assembly . it has been recently proposed that archaebacterium and eubacterium precursors led to the origin of eukaryotes . the developmental primacy of photosynthesis was probably due to abundant sunlight and coincident appearance of requisite photovoltaic chemical processes . furthermore , the byproducts of these processes , i.e. , glucose and oxygen , introduced a major change in the biosphere with the associated evolutionary development of complex cellular respiratory processes and with major potential problems involving oxygen toxicity . in light of these changes , both photosynthetic and respiratory processes were driven by the potential for bacteria to further enhance the intracellular membrane microdomains segregated according to functional physiological criteria . accordingly , the respiratory bacterium evolved and remained in place because of its existential brokerage of molecular oxygen and the use of glucose as an initial fuel source in the bioenergetics of atp production . in this regard , photosynthetic priming events promoted evolutionary acceleration of intracellular membrane differentiation , selective for plastid - like structures . this major contention is supported by the observation that many organelles can be found in both plant and animal cells and that their molecular biology / bioenergetics share basic chemical processes . the dual expression of mitochondria and functional chloroplasts within specialized animal cells indicates a high degree of biochemical identity , stereoselectivity , and conformational matching that are the likely keys to their functional presence and essential endosymbiotic activities for over 2.5 billion years [ 3,4244 ] . thus , conformational matching imposes a high degree of rigidity on the systems , allowing for their retention in evolution . another component of the conformational matching hypothesis is that this phenomenon also occurs via a chemical messenger and its receptor with the added fact that both must be expressed simultaneously and appropriately on the right target [ 3,4244 ] . therefore , all the conformational dependent substrates and enzymes impose a rigidity on change in general , which does not favor change . however , change can and does occur because slight changes may be tolerated , giving rise to modified systems , e. g. , the catecholamine pathway . | many commonalities between chloroplasts and mitochondria exist , thereby suggesting a common origin via a bacterial ancestor capable of enhanced atp - dependent energy production functionally linked to cellular respiration and photosynthesis .
accordingly , the molecular evolution / retention of the catalytic qo quinol oxidation site of cytochrome b complexes as the tetrapeptide pewy sequence functionally underlies the common retention of a chemiosmotic proton gradient mechanism for atp synthesis in cellular respiration and photosynthesis .
furthermore , the dual regulatory targeting of mitochondrial and chloroplast gene expression by mitochondrial transcription termination factor ( mterf ) proteins to promote optimal energy production and oxygen consumption further advances these evolutionary contentions . as a functional consequence of enhanced oxygen utilization and production , significant levels of reactive oxygen species ( ros ) may be generated within mitochondria and chloroplasts , which may effectively compromise cellular energy production following prolonged stress / inflammationary conditions .
interestingly , both types of organelles have been identified in selected animal cells , most notably specialized digestive cells lining the gut of several species of sacoglossan sea slugs . termed kleptoplasty or kleptoplastic endosymbiosis , functional chloroplasts from algal food sources
are internalized and stored within digestive cells to provide the host with dual energy sources derived from mitochondrial and photosynthetic processes . recently
, the observation of internalized algae within embryonic tissues of the spotted salamander strongly suggest that developmental processes within a vertebrate organism may require photosynthetic endosymbiosis as an internal regulator .
the dual presence of mitochondria and functional chloroplasts within specialized animal cells indicates a high degree of biochemical identity , stereoselectivity , and conformational matching that are the likely keys to their functional presence and essential endosymbiotic activities for over 2.5 billion years . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
alzheimer 's disease ( ad ) is the most prevalent neurodegenerative condition in individuals over 65 . ad neuropathology is characterized by progressive accumulation of amyloid beta peptide ( brain amyloidosis ) , intraneuronal inclusion of hyperphosphorylated tau ( neurofibrillary tangles ) , and degeneration of various neuronal populations . depletion of cholinergic cell bodies located in the basal forebrain constitutes one of the earliest findings observed in postmortem ad brains . specifically , degeneration of the nucleus basalis of meynert as well as the medial septum severely perturbs cholinergic neurotransmission at the level of the cortex and hippocampus , respectively . in contrast , cholinergic neurotransmission remains mostly unaffected in other brain regions such as the basal ganglia , thalamus , brainstem , and cerebellum . quantification of presynaptic terminals provides significant information regarding numerous biochemical processes related to cholinergic neurotransmission . for example , acetylcholine synthesis and transport into vesicles occur in the presynaptic terminals by the action of choline acetyltransferase ( chat ) and the vesicular acetylcholine transporter ( vacht ) , respectively . vacht availability has been proposed as an excellent indicator of presynaptic integrity , which is decreased in ad . the neurobiological basis of cholinergic vulnerability in ad is unknown ; however , a link between amyloid pathology and cholinergic depletion has been supported in animal models of ad [ 5 , 6 ] . in ad patients , in contrast , upregulation of chat in the hippocampus of populations at risk for ad suggests cholinergic sprouting or acetylcholine synthesis upregulation as a response to cholinergic cell depletion . overall , the degeneration of cholinergic basal forebrain projections has been consistently shown to strongly correlate with clinical symptoms [ 9 , 10 ] . as such , efficient surrogate markers of presynaptic cholinergic integrity are potential tools for the assessment of ad , as well as other neurodegenerative diseases where cholinergic systems are compromised . imaging of cholinergic presynaptic innervation has been made possible by the introduction of molecular probes selective for vacht derived from vesamicol such as [ f]fluoroethoxybenzovesamicol ( [ f]feobv ) . in contrast to previous vacht molecular agents , [ f]feobv has shown desirable kinetic properties , high selectivity for vacht , and low affinity for sigma receptors . positron emission tomography with [ f]feobv has been successfully performed in primates and in rodent models to quantify cholinergic declines secondary to aging or selective immunolesions . quantification of vacht depletion in ad using [ h]vesamicol autoradiography has not been very conclusive [ 15 , 16 ] , most likely due to the low specificity and affinity of that ligand . given that [ f]feobv has a much higher specificity than [ h]vesamicol , we aimed in the current study to assess its potential as a marker of pathological cholinergic degeneration , by comparing brain tissues of ad patients to those of healthy controls using [ f]feobv autoradiography . demonstration of significant differences could constitute useful postmortem evidence in support of future clinical in vivo applications of [ f]feobv . given that both neocortex and hippocampus are the main targets of cholinergic projections known to be compromised in ad , [ f]feobv binding in these regions was hypothesized here to be significantly lower in ad than in control tissues . frozen brain samples from healthy controls and ad - positive brains ( diagnosis confirmed by neuropathological reports ; cerad criterion ) were obtained from the douglas - bell canada brain bank ( douglas mental health university institute , montreal , canada ) . utilization of these samples was approved by both the douglas institute 's research ethics board and the brain bank 's scientific review committee . samples were excluded in cases of psychiatric conditions , epilepsy , non - ad dementia , brain neoplasms , and traumatic brain injuries . in total , 21 samples from the hippocampus ( 13 controls , 8 ad ) and 24 from the prefrontal cortex ( pfc ) ( 13 controls , 11 ad ) were dissected from the left hemispheres . using a freezing sliding microtome ( leica cm3050 s ) at 15c , each block of tissue was cut into serial 20 m - thick sections , which were then thaw - mounted on coated microscope slides . two adjacent sections from each sample were randomly selected and respectively used for [ f]feobv autoradiography and for histological staining , as described below , allowing to precisely localize regions of interest ( rois ) . [ f]feobv was synthesized based on a method described previously [ 17 , 18 ] . since only the ( )-[f]feobv enantiomer shows affinity to vacht , a pure levo precursor ( abx advanced biochemical compounds gmbh ) was used to ensure optimal affinity . labeling with [ f ] the optimal conditions for the in vitro autoradiography binding techniques such as incubation time , washing procedure , and time of exposition to the phosphor imaging plate were obtained after preliminary experiments ( data not shown ) . on the day of synthesis , sections were warmed to room temperature , air - dried , then preincubated in a 0.1 m phosphate - buffered saline solution ( ph = 7.6 ) for 20 minutes in order to remove endogenous ligands . tissue was then air - dried once more and incubated with [ f]feobv at 6.97 after incubation , slides were dipped three times in distilled water ( 4c ) and dried under a stream of cool air . the sections were then exposed on a radioluminographic imaging plate ( fujifilm bas - ms 2025 ) for 20 minutes ( see figure 1 for examples ) . autoradiography calibration was performed using 9 concentrations of [ f]- ranging from 0.03 to 7.72 the concentration used correlated linearly with the measured photostimulated luminescence unit per mm ( r = 0.9991 , p < 0.0001 ) . corrected for time at the end of exposure , 1.32 mbq of [ f]feobv was used ( specific activity of 22.93 tbq / mmol ) in a solution of 3.77 mbq / l , for an effective concentration of 164.41 pm . for histological staining of contiguous slices , a combination of luxol fast blue and cresyl violet staining was used . stained sections were digitized , and a total of five rois were drawn manually by an experimenter blind to group distribution : ca1 , ca3 , dentate gyrus ( dg ) , pfc , and white matter as a baseline level . activity in photostimulated luminescence unit per mm was calculated for each roi using imagegauge 4.0 ( fujifilm ) . to correct for background noise and nonspecific activity , results were normalized by the adjacent white matter values ( e.g. , ) , since immunochemistry studies do not report significant levels of vacht in the white matter [ 21 , 22 ] . group differences were then investigated using a t - test with welch correction for heteroscedasticity between control and ad tissues . there were no significant differences between control and ad groups in terms of sex distribution ( = 0.001 , p = 0.971 ) , age ( t(31 ) = 0.302 , p = 0.765 ) , and postmortem delay ( t(31 ) = 0.203 , p = 0.840 ) . on average , total brain mass was 12.4% lower in the ad group ( t(30 ) = 2.84 , p = 0.008 ) ( see table 1 ) . for [ f]feobv binding parameters , all investigated grey matter rois showed higher binding than in the white matter baseline . in controls , the roi - to - baseline binding ratios reached 1.82 0.3 in the cortex , 1.85 0.25 in ca1 , 2.36 0.64 in ca3 , and was highest in the dg at 3.47 0.55 . in ad tissues , a 33% loss was observed in the pfc ( t(13 ) = 4.2 , p = 0.0005 ) . significantly lower binding was also observed in ca1 and ca3 , with respective losses of 20% ( t(18 ) = 3.93 , p = 0.0005 ) and 25% ( t(15 ) = 2.97 , p = 0.005 ) . neither age nor brain mass significantly predicted [ f]feobv binding in any region for either group . in summary , this study reports for the first time reduced vacht availability in both the nucleus basalis of meynert and medial septum projection areas in ad brain tissues . reduced [ f]feobv binding observed in the ad neocortex as well as most of the hippocampus suggests a comparable degree of denervation between cortical and allocortical brain regions . indeed , these finding mostly reflects the degeneration of these cholinergic pathways in ad [ 2 , 23 ] . a property of the radioligand saturation curve is that very low ( tracer ) concentrations follow a linear relationship with the receptor occupancy percentage at equilibrium . here , 164.41 pm of [ f]feobv was used , which is less than 5% of the kd of 4.1 nm for vesamicol or 4.6 nm for another benzovesamicol analog . consequently , the magnitude of normalized binding differences observed here can be considered to be a direct representation of vacht receptor density alterations in ad . the magnitude of vacht observed here in ad decreases ( 33% in pfc , 20% in ca1 , and 25% in ca3 ) and is modest compared to previous cholinergic quantifications conducted with antibody - based techniques , such as immunohistochemistry or immunoblotting . when measured with western blotting , vacht levels in the pfc of ad patients similarly , chat activity decreases in ad samples were described to range between 49% and 61% in various cortical and hippocampal regions . differences between autoradiography and immunohistochemistry have been frequently described and might reflect multiple factors including changes of radioligand affinity in the clinical population ( e.g. , ) or low radioligand specificity . in contrast to ca1 and ca3 , the dg of the hippocampus appeared spared by cholinergic loss . this preservation of cholinergic terminals may be to do with the observation that the dg seems resistant to the glutamatergic neurodegeneration affecting both ca1 and ca3 in preclinical ad . invariant vacht availability in the dg could thus reflect either sprouting of presynaptic axons or vacht upregulation ( e.g. , [ 30 , 31 ] ) following initial losses . a unique resistance to such losses could also be specific to this region . in terms of roi distribution , the relative concentrations of [ f]feobv binding in the cortex and hippocampus match those found in postmortem studies using cholinergic markers both in humans [ 32 , 33 ] and rodents . interestingly , the variance of [ f]feobv binding is much lower in the ad tissues than in controls both for the pfc and hippocampal rois . for instance , the ca3 coefficient of variance reached 27% in the control group , while it was only 11% in ad tissues . this represents a floor effect in the ad tissues , where most samples have minimal concentrations of vacht terminals left from the affected afferents . control samples , on the other hand , presented more variance , representing a wide spectrum of vacht integrity normal in this age range . in these same regions , 20 to 40% of control subjects have [ f]feobv binding values that overlap with those of ad patients . while this may be seen as a poor [ f]feobv sensitivity to differentiate ad from healthy controls , it remains consistent with the observation that ad pathological hallmarks ( such as subclinical amyloidosis ) are found in a substantial portion of aged asymptomatic individuals . indeed , we have previously observed a significant reduction of hippocampal [ f]feobv binding in a rodent model of normal aging . here , the binding variance in control individuals does not appear to be explained by age , but this is likely due to the lack of younger control subjects in the sample . cortical decreases in vacht activity have been observed in vivo in ad , using single photon emission computed tomography vesamicol analogs such as [ i]iodobenzovesamicol . our results showed that pet radiomarker such as [ f]feobv might be useful also in quantifying such a vacht reduction , while at the same time providing a better imaging resolution and faster kinetics . additionally , while amyloid markers are currently considered the most sensitive for early detection , quantification of cholinergic markers tend to better describe a specific neurodegenerative event which closely correlate with clinical manifestations of ad [ 37 , 38 ] . for instance , utilization of an autoradiography single - concentration protocol , as opposed to a quantitative receptor autoradiography approach , prevents the estimation of more detailed information regarding absolute kinetic properties of [ f]feobv . in addition , sample sizes were relatively small for drawing definitive conclusions , and the ad group was not controlled for neurofibrillary tangles accumulation ( e.g. , braak stages ) . other studies would be necessary to clarify the role of age in the [ f]feobv binding overlap between ad patients and control subject ; younger control subjects would be useful in this respect . moreover , tissues from individuals with mild cognitive impairment would be most useful in providing the complete picture regarding vacht availability in populations at risk . in conclusion , the present results support the notion that central cholinergic projections display discrete sites of specific vulnerability and resistance to ad . furthermore , the present autoradiography study in human supports the use of [ f]feobv as a molecular probe to quantify selective deficits in cholinergic neurotransmission in ad . | rationale .
alzheimer 's disease ( ad ) is a neurodegenerative condition characterized in part by deficits in cholinergic basalocortical and septohippocampal pathways .
[ 18f]fluoroethoxybenzovesamicol ( [ 18f]feobv ) , a positron emission tomography ligand for the vesicular acetylcholine transporter ( vacht ) , is a potential molecular agent to investigate brain diseases associated with presynaptic cholinergic losses .
purpose . to demonstrate this potential
, we carried out an [ 18f]feobv autoradiography study to compare postmortem brain tissues from ad patients to those of age - matched controls . methods .
[ 18f]feobv autoradiography binding , defined as the ratio between regional grey and white matter , was estimated in the hippocampus ( 13 controls , 8 ad ) and prefrontal cortex ( 13 controls , 11 ad ) . results .
[ 18f]feobv binding was decreased by 33% in prefrontal cortex , 25% in ca3 , and 20% in ca1 .
no changes were detected in the dentate gyrus of the hippocampus , possibly because of sprouting or upregulation toward the resilient glutamatergic neurons of the dentate gyrus .
conclusion .
this is the first demonstration of [ 18f]feobv focal binding changes in cholinergic projections to the cortex and hippocampus in ad .
such cholinergic synaptic ( and more specifically vacht ) alterations , in line with the selective basalocortical and septohippocampal cholinergic losses documented in ad , indicate that [ 18f]feobv is indeed a promising ligand to explore cholinergic abnormalities in vivo . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in belgium each year during january june , field veterinarians refer 30 newborn calves per month for necropsy to the university of lige faculty of veterinary medicine ( lige , belgium ) . during january march 2012 , the consequences of sbv infection on bovine fetuses were not yet known , which prompted the staff to look systematically for the new virus in all deformed calves and in calves that died spontaneously without obvious cause . among the 67 animals in these categories , sbv genetic material was detected in 15 calves by reverse transcription quantitative pcr , and igg specific for sbv nucleoprotein was systematically highlighted in their serum by elisa . in addition , all attempts to retrieve the genetic material of bluetongue virus 8 and bovine viral diarrhea virus from the tissues of these 15 seropositive calves failed . these 15 calves , in which both sbv rna and antibodies against sbv were detected , are the subject of this study . detailed information about the methods used to examine the calves is available in technical appendix 1 . a detailed description of the lesions found in sbv - infected calves is provided in technical appendix 2 . sbv - positive animals weighed significantly less than expected ( 32 kg + 15 kg vs. 49 kg + 4 kg , p<0.05 ) . the body mass deficit , severity of deformities in whole - body conformation , and amount of skeletal muscle were obviously correlated ( table 1 ; technical appendix 3 figure 1 . * fifteen newborn calves infected in utero by sbv sbv , schmallenberg virus ; wbd , whole - body deformity score ; na , not applicable . animals with neurologic signs and apparently normal body shape were given a wbd of 0 ; those with altered body shape were scored 1 , 2 , or 3 depending on whether 1 , 2 , or 3 skeletal segments were deformed , respectively ( spine , forelimbs , or hind limbs ) . bodyweight of age - matched belgian blue healthy calves is 49.2 kg + 7.1 kg ( 7 ) . we observed overall permanent deviations of the axial skeleton in all 3 planes ( technical appendix 3 figure 2 ) , the most common being a lateral deviation of the cervical spine ( torticollis ) . in the most distorted animals , most sbv - infected calves displayed joint fixation of 1 or all joints of > 1 limbs ( arthrogryposis ) . tendons spanning fixed joints were shorter than expected , and corresponding muscles displayed decreased mass and altered color . often the animal s head was distorted , having a horse - like or pig - like shape , brachygnathism , prognathism , and/or diverging sagittal axes ( online technical appendix 3 figure 3 ) . we systematically observed major alterations after we opened the skull and spinal canal ( figure 1 ; technical appendix 3 figure 4 ) . these changes involved the spinal cord and the telencephalon , whereas the brainstem and cerebellum were kept intact ( although 1 cerebellum was hypoplastic ) . we consistently observed a decrease in the cross - sectional area of the spinal cord ( figure 2 ) , which correlated positively with the magnitude of axial / appendicular musculoskeletal deformities ( technical appendix 3 figure 5 ) . the neopallial part of the telencephalon was always decreased , giving 3 distinct morphotypes . in some calves , we detected multiple , bilateral , and randomly located cystic cavities , most of which communicated with the ipsilateral ventricle ( porencephaly ) . in other cases , all that remained from the neopallium was a thin , nearly transparent membrane , sometimes with a few floating smooth - surfaced islets resembling cortex ( hydranencephaly ) . finally , in a third subset of calves , the brain appeared normal , but we observed a severe , bilateral , and symmetric dilatation of lateral ventricles after section ( hydrocephaly ) . deformities of the brain in calves naturally infected in utero with schmallenberg virus , belgium , january march 2012 . age- and site - matched spinal cord transversal histologic section at the level of c4 . note atrophy / hypoplasia and prominent deficiency of stainable myelin in ventral and lateral tracts of sbv - infected calf . microscopic examination of the spinal cord revealed a significant decrease in neuron numbers , the magnitude of which correlated positively with the severity of whole - body deformities ( table 2 ) . muscle sections displayed a diffuse pattern of increased fiber size variation with connective tissue and adipocyte infiltrations ( technical appendix 4 table 1 ) . * extent of histologic changes was reported semiquantitatively by using a score of 0 , 1 , 2 , or 3 depending on whether the histologically normal tissue extended over 100% , 75%100% , 25%75% , or < 25% of the area examined and intensity of shading reflects these values . sbv , schmallenberg virus ; wbd , whole - body deformity score ; nt , not tested ; cas , concave side ; ces , convex side . the viral rna was always present in the cns and sometimes in the lungs and colon ( technical appendix 4 table 2 ) . when the entire cohort was considered , sbv was detected in all parts of the cns . when we examined the animals individually , however , the detection rate varied depending on the segment ( technical appendix 4
table 2 ) . the virus was almost always detected in the spinal cord ( 93% ) and the neopallium ( 87% ) ; often in the midbrain ( 83% ) and pons ( 67% ) ; and about half the time in the diencephalon , cerebellum , and paleopallium . the practical implications of these findings for routine diagnosis are highlighted separately ( technical appendix 5 ) . our findings show that natural in utero infection of the bovine fetus by sbv may result in serious damage to the cns and muscles . similar to the situation with akabane virus infection ( 8) , the clinical picture shown by in utero sbv - infected newborn calves is likely to depend largely on the age of the fetus at the time of infection . the infection must be quickly contained if the fetus is infected when immunocompetent ( > 120150 days after conception ) , and we deduce that damages inflicted by the virus consequently have no or little effect on its further development . conversely , the infection probably spreads more easily and lasts much longer if the virus contaminates an immunologically immature fetus . because transplacental infection is possible only when the first placentome is present ( 30 days after conception in cattle ) , the window during which the infection of a bovine fetus might lead to a porencephaly / hydranencephaly - micromyelia - arthrogryposis syndrome ranges from 30 to 150 days after conception . the degree of overall body deformity correlated with a progressively greater reduction in the size of the spinal cord ( as determined by spinal cord : foramen magnum ratio ) and with fewer spinal neurons , suggesting that the lack of movement leading to arthrogryposis results directly from the spinal cord lesions , leading to denervation atrophy of skeletal muscle . this primary role for the spinal cord lesion is further supported by the tendency of forelimbs and hind limbs to be affected bilaterally because muscle involvement might be expected to lead to more randomly distributed lesions . when sbv virus infects the bovine fetus during the risk window mentioned above and causes neuromuscular defects , its genetic material remains detectable at term thus 4 months later at a minimum . the physical form of this persisting virus and the way it persists in the face of the seroconversion are unknown . the hypothesis of the existence of sites of persistence must be addressed , for example , in the cns ( 90% of cases were virus positive at term ) or lungs ( 30% ) . in practice , a priority is to establish whether sbv persists in calves infected in utero but born asymptomatic . materials and methods . gross pathology and histology . definition of whole - body deformity ( wbd ) scores in schmallenberg virus ( sbv)infected newborn calves , belgium , 2012 ; deformities of the axial skeleton ; deformities of the head ; micromyelia ; occipital ratios ( mean sd ) in control and sbv - positive calves ; and end - stage muscles in a typical sbv - infected calf . distribution of microscopic lesions and virus - specific rna in the skeletal mucles of 15 schmallenberg virus infected newborn calves ; distribution of microscopic lesions and virus - specific rna in the central nervous system ; and distribution of microscopic lesions and virus - specific rna in thoraco - abdominal organs . diagnostic considerations . | we surveyed morphologic alterations in calves in belgium that were naturally infected in utero by schmallenberg virus ( sbv ) and born with deformities during january march 2012 .
sbv - specific rna was distributed unevenly in different tissues .
natural intrauterine sbv infection of calves might cause serious damage to the central nervous system and muscles . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
despite extensive combating malaria infection in malarious areas , it is still one of the most serious infectious diseases in the world with much mortality particularly among the children . additionally , malaria causes adverse impact on social and economic development in endemic areas ( 1 , 2 ) . according to annual report of who released in 2014 almost 198 million cases including 584000 deaths although symptomatic malaria suspected patients are supposed to be important for considering due to malaria parasites transmitting , asymptomatic malaria patients play critical role in transmission of the infection as well . for instance in areas with high and moderate burden of malaria transmission , considerable numbers of diagnosed cases have been detected from asymptomatic patients ( 410 ) . indeed , both symptomatic and asymptomatic cases would be included for accurate control and elimination of malaria . to achieve such aims different requirements such as epidemiological studies and active surveillance are needed . in reference to report of iranian center for management of communicable diseases ( cmcd ) malaria cases were recorded including 88.8% , 9.3% and 1.8 % plasmodium vivax , p. falciparum and mixed infection in 2014 , respectively ( 11 ) . malaria elimination program in iran was commenced by cmcd under who technical supervision in 2009 . accurate detection of malaria parasites and prompt treatment of them are vital milestones for successful elimination process . although standard conventional light microscopy is usually used for detection of malaria parasites in laboratory situation , other reliable diagnosing methods such as rapid diagnostic tests ( rdts ) and pcr techniques also would be involved to gain the maximum achievement , particularly when asymptomatic infection and sub - microscopic parasitemia are suspected to be as reservoirs ( 12 , 13 ) . on the other hand , broadness of malaria infection in endemic areas depends on different agents such as anopheles mosquito and plasmodia species , rainfall , temperature , movement of population and even geographical variations of vectors and parasites . therefore , it is necessary that both symptomatic and asymptomatic malaria to be investigated independently in each district of endemic areas . this study was conducted to monitor the situation of asymptomatic malaria among the native population and afghani and pakistani immigrants in kahnooj and ghale - ganj districts from kerman province , southeastern iran . this area has warm weather with annual average temperature of 27 c ( 8.145.4 c ) and maximum amount of rainfall of 12.3 mm and relative humidity of 47% . kahnooj and ghale - ganj districts of kerman province , southeastern iran according to the report of cmcd in iran , the annual parasites incidence ( api ) in kahnooj was 0.57 and 0 in 2009 and 2014 respectively ( 14 ) . anopheles stephensi is the main vector and in the past ten years 96% of cases were diagnosed as p. vivax . ghale - ganj the second studied district with a population of approximately 75,000 people ( fig . 1 ) and annual average temperature of 26c is located besides the kahnooj . the api in the district was 0.08 in 2009 and 0 in 2014 ( 14 ) . malaria was seasonal in the areas with two peaks of transmission per year , the first from april to june and the second in october . the districts include a considerable population of pakistani and afghani immigrants that increases the risk of malaria transmission in the region . a number of 180 and 120 individuals with age of 580 yr old from kahnooj and ghale - ganj respectively were registered and considered based on a cross - sectional surveillance method in 2014 . from 300 registered cases , 200 of them ( 66.7% ) were selected among afghani and pakistani immigrants and the rest ( 33.3% ) were native resident individuals . all enrolled cases were questioned about name , gender , nationality , traveled history , clinical symptoms of malaria and if probable medications taken during last four weeks . they also were requested to sign an informed consent by themselves or their guardians . besides collecting a finger - prick blood sample from each participant to make thick and thin blood films and conducting rdts , a few drops of the blood were deposited onto filter paper ( dna banking card ) for semi - nested multiplex -pcr tests . the blood films were stained and processed for diagnosing malaria parasites according to who standard guideline ( 15 ) . although conventional microscopical examination is golden standard method for detection of malaria parasites in suspected samples , rdts and pcr are complementary methods with valuable advantages that in this study we employed them . briefly , diagnostic tests were performed for all collected samples based on who rdts guideline ( 16 ) . thick and thin smears were air - dried and thin film was fixed by exposing to methanol . then both smears were stained with 5% giemsa stain about 30 minutes and examined with oil immersion objective lens at 1000 magnification . for conducting rdts tests almost five micro - liters of the finger - pricked collected blood was dropped into the relevant well of rdts kit ( first response , premier medical corporation limited , india ) and the sample was run by a drop of buffered water . appearing two or three marked lines including control , parasite lactate dehydrogenase ( pldh ) and histidin rich protein 2 ( hrp 2 ) indicated to either non - falciparum or falciparum plasmodia parasites . to examine more validity , all of the collected samples were examined using semi - nested multiplex pcr technique ( 17 ) . briefly , pcr was designed using two sets primers . in the first step 787bp band obtained , belong to small subunit ribosomal dna related to plasmodium ( genus ) infections . in the second step , 499bp band or 395bp band showed p. vivax or p. falciparum infections respectively . this area has warm weather with annual average temperature of 27 c ( 8.145.4 c ) and maximum amount of rainfall of 12.3 mm and relative humidity of 47% . kahnooj and ghale - ganj districts of kerman province , southeastern iran according to the report of cmcd in iran , the annual parasites incidence ( api ) in kahnooj was 0.57 and 0 in 2009 and 2014 respectively ( 14 ) . anopheles stephensi is the main vector and in the past ten years 96% of cases were diagnosed as p. vivax . ghale - ganj the second studied district with a population of approximately 75,000 people ( fig . 1 ) and annual average temperature of 26c is located besides the kahnooj . the api in the district was 0.08 in 2009 and 0 in 2014 ( 14 ) . malaria was seasonal in the areas with two peaks of transmission per year , the first from april to june and the second in october . the districts include a considerable population of pakistani and afghani immigrants that increases the risk of malaria transmission in the region . a number of 180 and 120 individuals with age of 580 yr old from kahnooj and ghale - ganj respectively were registered and considered based on a cross - sectional surveillance method in 2014 . from 300 registered cases , 200 of them ( 66.7% ) were selected among afghani and pakistani immigrants and the rest ( 33.3% ) were native resident individuals . all enrolled cases were questioned about name , gender , nationality , traveled history , clinical symptoms of malaria and if probable medications taken during last four weeks . besides collecting a finger - prick blood sample from each participant to make thick and thin blood films and conducting rdts , a few drops of the blood were deposited onto filter paper ( dna banking card ) for semi - nested multiplex -pcr tests . the blood films were stained and processed for diagnosing malaria parasites according to who standard guideline ( 15 ) . although conventional microscopical examination is golden standard method for detection of malaria parasites in suspected samples , rdts and pcr are complementary methods with valuable advantages that in this study we employed them . briefly , diagnostic tests were performed for all collected samples based on who rdts guideline ( 16 ) . thick and thin smears were air - dried and thin film was fixed by exposing to methanol . then both smears were stained with 5% giemsa stain about 30 minutes and examined with oil immersion objective lens at 1000 magnification . for conducting rdts tests almost five micro - liters of the finger - pricked collected blood was dropped into the relevant well of rdts kit ( first response , premier medical corporation limited , india ) and the sample was run by a drop of buffered water . appearing two or three marked lines including control , parasite lactate dehydrogenase ( pldh ) and histidin rich protein 2 ( hrp 2 ) indicated to either non - falciparum or falciparum plasmodia parasites . to examine more validity , all of the collected samples were examined using semi - nested multiplex pcr technique ( 17 ) . briefly , pcr was designed using two sets primers . in the first step 787bp band obtained , belong to small subunit ribosomal dna related to plasmodium ( genus ) infections . in the second step , 499bp band or 395bp band showed p. vivax or p. falciparum infections respectively . none of samples , collected from native residents , showed any malaria parasite , but among afghani immigrants one sample examined as p. vivax malaria with parasitemia of 280 parasites per microliter of blood that had been obtained from a 12 yr old girl with asymptomatic malaria ( fig . moreover , one symptomatic vivax malaria was detected from a pakistani immigrant with 47560 parasites per microliter of blood . the asymptomatic malaria positive individual had immigrated to kahnooj district one year before collection of samples without any traveling outside of the district . all results that were obtained via microscopical method confirmed by rdts and pcr techniques . agarose gel electrophoresis of amplification products of first reaction of snm - pcr [ lane m : 100 bp marker dna ladder ; lane 7 : plasmodium infected lanes16 : negative samples ; lane 8 : negative control ; lane 9 : positive control agarose gel electrophoresis of amplification products of second reaction of snm - pcr [ lane m : 100 bp marker dna ladder ; lane 6 : plasmodium vivax ( 499 bp ) ; lanes 15 : negative samples ; lane 7 : negative control ; lane 8 : positive control some prerequisite activities are crucial for successful implementation of malaria elimination program in malarious areas . asymptomatic malaria can occur because of reinfection or prolonged infection among the individuals with low parasitemia . utilizing relevant surveillance method in the context of malaria infection either symptomatic or asymptomatic in malarious areas plays an important role in the field of malaria elimination particularly among the population those who have emigrated from malaria endemic countries into iran . in this study , we have used cross - sectional surveillance method due to stability of the most of immigrants in the time of this study in kahnooj and ghale - ganj districts . elimination program has commenced in iran from 2009 initially with the aim of eliminating p. falciparum . although serious attempts are being employed to achieve the mentioned aim on determined time , some obstacles such as importing malaria cases from eastern malarious neighbor countries , afghanistan and pakistan , may delay the achievement , particularly if some of the imported cases bear asymptomatic malaria infections . according to rollback malaria report afghanistan and pakistan obviously , asymptomatic malaria cases even with very low density of the parasites remain potentially as a source of malaria transmission in a given population . therefore , conducting prompt and precise diagnostic studies among the immigrants from malaria endemic areas is emphatically suggested specially for those new coming immigrants . in a monitoring study conducted among the afghani immigrants in iranshahr district , a malaria endemic area in southeastern iran , out of 446 samples seven ( 1.6% ) none of the sample donor individuals had malaria symptoms ( 19 ) . in another study performed in bashagard district of hormozgan province located in southern iran among native residents , has not been found any asymptomatic malaria among the studied individuals using microscopical either method or nested - pcr techniques ( 20 ) . the results of this study are , more or less , in agreement with those of zoghi and colleagues ( 21 ) . in the study , 1000 native individuals from bashagard and ghale - ganj districts in hormozgan and kerman provinces respectively were enrolled for asymptomatic malaria consideration . in spite of an extensive study using serological and pcr method they did not find any asymptomatic malaria among the considered population , but low sero - positive responses , 1% and 0.2% , against both p. vivax and p. falciparum respectively the data of this study is mostly similar to those reported from kenya ( 22 ) and sri lanka ( 23 ) , but in contrast with those of alvex et al . ( 26 ) that asymptomatic malaria was notably detected from hypo endemic malarious areas . in our study , an asymptomatic vivax malaria infection was detected from 12 yr old pakistani immigrant girl . comparing the above studies stimulates malaria policy makers to pay more attention to the presence of asymptomatic malaria among the afghani and pakistani immigrants in iran . particularly , when we believe that asymptomatic malaria potentially can increase the risk of malaria transmission in endemic and even in non - endemic areas when anopheles vectors are present . to achieve the malaria elimination program different studies are needed . monitoring the asymptomatic malaria in all over the malaria endemic areas especially among the immigrant individuals is the most crucial necessity . | background : this study was proposed to monitor the situation of asymptomatic malaria among the native population and afghani and pakistani immigrants in kahnooj and ghale - ganj districts from kerman province , southeastern iran.methods:a number of 180 and 120 individuals from kahnooj and ghale - ganj respectively were registered and considered based on a cross - sectional surveillance method . from 300 registered cases , 200 individuals ( 66.7% ) were selected among afghani and pakistani immigrants and the rest ( 33.3% ) were native resident individuals .
all samples were processed with employing microscopical examination , rapid diagnostic tests ( rdts ) and semi- nested multiplex pcr techniques.results:none of the samples collected from native residents showed any malaria parasite , but among afghani immigrants , one asymptomatic vivax malaria was detected in a 12 yr old girl with 280 parasites per microliter of blood .
moreover , one symptomatic vivax malaria was detected from a pakistani immigrant with 47560 parasites per microliter of blood .
all results obtained via microscopical method , confirmed by rdts and pcr techniques.conclusion:to achieve the malaria elimination program different studies are needed that to be performed .
monitoring the asymptomatic malaria in all over the malaria endemic areas especially among the immigrant individuals is the most crucial necessity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the importance of adenosine and atp in regulating many biological functions has long been recognized , especially for their effects on the cardiovascular system [ 1 - 5 ] . it is known that adenosine and atp are key factors in the regulation of coronary blood flow , inhibition of platelet aggregation , protection of myocardium , neuro- and immunomodulation [ 4 , 9 - 11 ] , tissue necrosis modulation , ischemic preconditioning [ 5 , 12 - 14 ] , energy metabolism [ 3 , 15 ] , and perhaps other functions ( e.g. pain mediation ) as well which maintain cardiovascular homeostasis in the body . it has been shown that patients with effort angina and essential hypertension have altered adenosine metabolism compared to healthy individuals [ 16 - 18 ] . plasma concentrations of adenosine have been shown to increase in patients with congestive heart failure ( chf ) , which may represent a compensatory physiologic response to heart failure . adenosine is known also to interact with the renin angiotensin system ( ras ) to maintain a homeostatic balance between blood pressure , vascular resistance and blood volume in hypertension and endothelial dysfunction [ 21 - 23 ] . thus it has been postulated that adenosine and atp may be used as sensitive biomarkers to quantify myocardial and endothelial ischemia [ 24 - 26 ] , and for monitoring therapeutic effects of anti - ischemia drugs [ 27 - 29 ] . exercise is known to have cardioprotective effect via a mechanism similar to that of ischemia preconditioning which affects energy metabolism in the body [ 30 , 31 ] . previous studies have shown that exercise preconditioning offered cardioprotective effect against injury induced by isoproterenol in rats [ 32 , 33 ] , and cardiotoxicity induced by doxorubicin . we have recently shown that exercise improved cardio- vascular hemodynamic profiles and increased red blood cell ( rbc ) concentrations of atp in both normotensive sprague dawley rat ( sdr ) and spontaneously hypertensive rats ( shr ) although the post exercise effects were more profound in the shr [ 35 , 36 ] . the increase of atp concentrations in the rbc may be a key contributing factor for the acute effects of post exercise preconditioning and in the long term effects of program of regular exercise in cardiovascular protection . the current study investigates further the potential cardiovascular protective effect of exercise preconditioning against injury induced by isoproterenol using a previously described freely moving rat model in vivo ; and to determine the effect of exercise pre - conditioning on atp metabolism in the rbc and its potential as a drug target for cardiovascular protection or prevention . authentic standards of adenine nucleotides including atp , adenosine 5diphosphate ( adp ) and adenosine 5 monophosphate ( amp ) and other purine nucleotides were purchased from sigma - aldrich chem co. ( st . louis , mo , usa ) . solvents were hplc grade , and all other chemicals were reagent grade ( fisher scientific , on , canada ) . the protocol followed the canadian council on animal care guidelines and was approved by the dalhousie university committee on laboratory animals ( ucla 12 - 008 ) . male sdr weighing between 250 - 300 g with an indwelling carotid artery catheter were purchased directly from charles river laboratories ( wilmington , ma , usa ) . each rat was acclimatized for at least 48 hours in the carleton animal care centre before experiment . the exercise test was performed on a research exercise treadmill ( columbus instruments international corporation , columbus , ohio , u.s.a . ) ( fig . 1 ) . after 2 brief sessions of 3 5 minutes ( min ) each of training to acclimatize the rat with the treadmill on the day before the study , each rat was exercised on the treadmill for 15 min at 10 m / min and 10% grade ( n = 7 ) ( lowex ) , or 15 min at 14 m / min and 22% grade ( n = 8) ( vigex ) . another group of rats without exercise was used as control ( noex , n = 10 ) as described previously [ 35 , 36 ] . two hours after the exercise , each rat received a single dose of isoproterenol ( 30 mg / kg ) by subcutaneous ( sc ) injection . a second control group of rats which received no exercise and no isoproterenol ( only normal saline ) ( noiso , n = 11 ) was used for further comparison . all the rats were housed in the same location and a similar number of blood samples ( n = 10 ) was collected from each rat . blood samples ( 0.3 ml each ) were collected via the indwelling catheter using a stopping solution from each rat at 1 , 1.05 , 1.25 , 2 ( immediately before isoproterenol ) , 2.2 , 2.5 , 3 , 4 , 5 and 6 hr after the exercise for measurement of adenine nucleotide concentrations ( i.e. atp , adp and amp ) in the rbc ( fig . each blood sample withdrawn was replenished with the same volume of saline to avoid volume depletion . hemodynamic recording was interrupted briefly during each blood sample collection , after which the catheter was flushed with heparin saline ( 10 iu / ml ) to maintain patency and the quality of the tracing recorded . at the end of the experiment , the rat was euthanized by cardiac puncture under anaesthesia with isoflurane . the total length of the experiment was about 6 hrs from the start of the final exercise . hemodynamic variables ( sbp , dbp and hr ) were continuously recorded ( except interrupted briefly during each blood sample collection ) via the intra - vascular catheter using a truwave disposable pressure transducer ( model px601 , edwards lifesciences canada , inc . , mississauga , on , canada ) coupled to a siemens hemodynamic monitor ( sirecust 400 ) and chart recorder ( siredoc ) ( erlangen , frg ) as previously described [ 35 , 36 ] . the hemodynamic data presented were averages of 10 15 seconds ( sec ) recording . the rbc samples collected were processed and lysed immediately using an ice cold 10% trichloroacetic acid . the lysate samples were stored at -80c , and concentrations of atp , adp and amp in the rbc determined by a validated hplc assay . maximum concentrations of adenine nucleotides in the rbc ( cmax ) were taken from the observed value , and area under the rbc concentration time curve ( auc ) was calculated using the trapezoid method ( prism 5 , graphpad software inc . , la jolla , ca , usa ) . hemodynamic and biomarker variables were compared between groups using anova followed by multiple comparison , student s unpaired and paired t - tests and considered significant when p < 0.05 . in addition , correlation and regression analyses of the data from rbc concentration of the adenine nucleotides were assessed using pearson correlations ( r ) and linear regressions ( ) , respectively ( minitab inc . , release 17 , state college , pa , usa ) , and differences between treatment groups considered significance at p < 0.05 . there were no significant differences in the baseline hemodynamic parameters ( sbp , dbp and hr ) measured at 1 hr after the final exercise between the four studied groups ( table 1 ) . the rbc concentrations of atp were significantly higher ( p < 0.05 ) in the lowex group compared to vigex group or the controls ( noex and noiso ) . there were no significant differences in the adp or amp concentrations between the study groups before isoproterenol injection ( fig . 3 ) . there was no fatality in the rats which did not receive isoproterenol ( noiso ) . on the other hand , 5 of the 10 rats died from the injury ( 50% mortality ) within 4 hrs after the isoproterenol ( 30 mg / kg ) injection without exercise pre - conditioning ( noex ) ( p < 0.05 ) . the mortality was reduced to < 30% in the exercise groups ( 2 of 7 and 2 of 8 died in lowex and vigex , respectively ) . however due to the small number of rats in each group , the reduction in mortality from the exercise pre - conditioning was not statistically significant ( p > 0.05 ) . immediately after isoproterenol injection ( 30mg / kg ) , sbp and dbp fell sharply in both exercise groups ( lowex and vigex ) and the noex group , in contrary , the heart rate ( hr ) increased in the study groups receiving isoproterenol ( p < 0.05 vs before isoproterenol , paired t - test ) ( table 2 ) . both sbp and dbp rebounded shortly after ( 1 2 hr after isoproterenol ) to near pre - isoproterenol levels in the three groups ( fig . 4 ) . however , the % rebound was significantly less in the vigex than the noex group ( p < 0.05 ) . the % rebound was also blunted in the lowex group , although the decrease did not reach statistical significance ( table 2 ) . hr remained elevated in all three isoproterenol groups until the end of the experiment ( fig . 4 ) . there was a significant increase in the rbc concentrations of atp in the rats without receiving isoproterenol and exercise ( + 0.93 0.80 mm in noiso group ) , and also in the rats receiving isoproterenol after an exercise preconditioning ( + 0.69 0.60 mm and + 0.50 0.55 mm in lowex and vigex groups , respectively ) , but not in the rats without exercise ( + 0.52 0.92 mm in noex group ) ( paired t - test , table 3 ) . on the other hand , there was a significant increase in the adp concentration in the rats receiving isoproterenol with or without exercise ( lowex , vigex and noex groups ) , but not the rats in noiso group ( table 3 ) . in contrast , the amp concentration was significantly higher after isoproterenol injection by 0.28 0.21 mm ( p < 0.05 paired t - test ) only in the noex group , but not in the exercise groups ( lowex and vigex ) or the control noiso group ( table 3 ) . similarly , the cmax and auc of amp concentrations in the rbc were significantly greater in the noex group than the other groups ( p < 0.05 ) , particularly the vigex group ( fig . 5 ) . when the ratios of the auc of the adenine nucleotides in rbc were compared , the ratios of amp / atp and amp / adp were significantly higher in the noex group than all the other groups ( table 3 ) . correlation and regression analyses of the adenine nucleotide concentrations in rbc from each rat showed an inverse ( -ve ) relationships ( both r and ) between atp and adp and also between atp and amp , but a positive ( + ve ) relationship between adp and amp in the noex group ( table 4 ) . a significant difference was found in the correlation ( r ) and regression coefficients ( ) between the noex group and those from the noiso group which did not receive isoproterenol , but there was no difference between the noiso group and those receiving isoproterenol after an exercise pre - conditioning ( lowex and vigex groups ) ( table 4 ) . there were no significant differences in the baseline hemodynamic parameters ( sbp , dbp and hr ) measured at 1 hr after the final exercise between the four studied groups ( table 1 ) . the rbc concentrations of atp were significantly higher ( p < 0.05 ) in the lowex group compared to vigex group or the controls ( noex and noiso ) . there were no significant differences in the adp or amp concentrations between the study groups before isoproterenol injection ( fig . there was no fatality in the rats which did not receive isoproterenol ( noiso ) . on the other hand , 5 of the 10 rats died from the injury ( 50% mortality ) within 4 hrs after the isoproterenol ( 30 mg / kg ) injection without exercise pre - conditioning ( noex ) ( p < 0.05 ) . the mortality was reduced to < 30% in the exercise groups ( 2 of 7 and 2 of 8 died in lowex and vigex , respectively ) . however due to the small number of rats in each group , the reduction in mortality from the exercise pre - conditioning was not statistically significant ( p > 0.05 ) . immediately after isoproterenol injection ( 30mg / kg ) , sbp and dbp fell sharply in both exercise groups ( lowex and vigex ) and the noex group , in contrary , the heart rate ( hr ) increased in the study groups receiving isoproterenol ( p < 0.05 vs before isoproterenol , paired t - test ) ( table 2 ) . both sbp and dbp rebounded shortly after ( 1 2 hr after isoproterenol ) to near pre - isoproterenol levels in the three groups ( fig . 4 ) . however , the % rebound was significantly less in the vigex than the noex group ( p < 0.05 ) . the % rebound was also blunted in the lowex group , although the decrease did not reach statistical significance ( table 2 ) . hr remained elevated in all three isoproterenol groups until the end of the experiment ( fig . 4 ) . there was a significant increase in the rbc concentrations of atp in the rats without receiving isoproterenol and exercise ( + 0.93 0.80 mm in noiso group ) , and also in the rats receiving isoproterenol after an exercise preconditioning ( + 0.69 0.60 mm and + 0.50 0.55 mm in lowex and vigex groups , respectively ) , but not in the rats without exercise ( + 0.52 0.92 mm in noex group ) ( paired t - test , table 3 ) . on the other hand , there was a significant increase in the adp concentration in the rats receiving isoproterenol with or without exercise ( lowex , vigex and noex groups ) , but not the rats in noiso group ( table 3 ) . in contrast , the amp concentration was significantly higher after isoproterenol injection by 0.28 0.21 mm ( p < 0.05 paired t - test ) only in the noex group , but not in the exercise groups ( lowex and vigex ) or the control noiso group ( table 3 ) . similarly , the cmax and auc of amp concentrations in the rbc were significantly greater in the noex group than the other groups ( p < 0.05 ) , particularly the vigex group ( fig . 5 ) . when the ratios of the auc of the adenine nucleotides in rbc were compared , the ratios of amp / atp and amp / adp were significantly higher in the noex group than all the other groups ( table 3 ) . correlation and regression analyses of the adenine nucleotide concentrations in rbc from each rat showed an inverse ( -ve ) relationships ( both r and ) between atp and adp and also between atp and amp , but a positive ( + ve ) relationship between adp and amp in the noex group ( table 4 ) . a significant difference was found in the correlation ( r ) and regression coefficients ( ) between the noex group and those from the noiso group which did not receive isoproterenol , but there was no difference between the noiso group and those receiving isoproterenol after an exercise pre - conditioning ( lowex and vigex groups ) ( table 4 ) . as reported in our previous communication , a modest level of exercise for 15 min at a treadmill speed of 10 m / min and 5% grade can induce a significant post exercise reduction in bp in rats . it also significantly increased rbc concentrations of atp which may contribute to the post exercise bp effects [ 35 , 36 ] . our current study found similar results with significantly higher rbc atp levels in the lowex group more than one hour after the exercise compared to the other groups ( fig . 3 ) . surprisingly , the rats in the vigex group did not have increased rbc atp levels . on the other hand , the adp and amp concentrations in rbc appeared to be lower in the exercise groups although the difference was not statistically significant ( fig . the results suggest that exercise may increase production of atp from adp and amp in the rbc , and the effect was dependent and affected by the level or intensity of the exercise . an increase in atp production in whole blood after exercise has previously been shown in healthy human volunteers suggesting that the exercise effect on atp metabolism in the rbc is not species dependent . however , it is not clear if the difference in atp concentrations in the rbc between the two exercise groups ( lowex and vigex ) was a factor resulted in the significantly greater bp rebound effect seen in the lowex group compared to the vigex group ( table 2 ) . it is also interesting to note that both adp and amp concentrations in the rbc from the surviving rats in the lowex group remained elevated at the end of the experiment ( 4 hr after isoproterenol ) while the concentrations in the other groups ( vigex and noex ) gradually returned to baseline levels ( fig . the difference never the less was not statistically significant ( p > 0.05 ) because of the large variation of the data particularly in the lowex group . thus it remains to be tested if the adp and amp concentrations in lowex group would return to baseline if the experiment was extended further . however , besides the greater rebound in blood pressure and the elevated amp concentrations towards the end of the experiment , there were no other notable differences in the cardiovascular protective effect between the two exercise groups . clinically , it has been suggested that exercise intensity , not frequency or duration , is the most important variable for cardioprotection . thus further study using varying levels of exercise and longer follow up after isoproterenol may provide more mechanistic insights into the relationship between exercise intensity and atp metabolism in the rbc in its role in cardiovascular protection . as reported previously , a single dose of isoproterenol ( 30 mg / kg ) injected subcutaneously can cause significant mortality and profound hemodynamic changes under a similar experimental condition . the high mortality was in part attributed to the serial blood samples taken for measurement of atp metabolism in the rbc . for this reason , the same number and volume of blood samples was taken from each rat in each group for comparison . as all the rats survived in the noiso group , the effect of blood sampling was considered minimal without the isoproterenol injection . the current study also showed similar mortality ( 50% ) and an immediate fall of blood pressure ( both sbp and dbp ) by about 60 mmhg ( 38 102 mmhg for sbp and 18 98 mmhg for dbp ) which was associated with a rapid increase in hr by about 70 bpm ( 18 178 bpm ) after isoproterenol ( fig . 4 and table 2 ) . there was a rebound of blood pressure shortly after , but not the hr as it continued to increase until the end of the experiment ( fig . 4 ) . in addition , a significant increase of rbc atp concentrations was found in the rats with exercise ( lowex and vigex ) and also in those without receiving isoproterenol ( noiso ) ( p < 0.05 paired t - test ) , but not in the noex group ( table 3 ) . we have previously observed an increase in rbc atp concentrations in rats even when they were kept in a restrainer and the increase was greater in shr than in sdr . the mechanism for the increase atp concentrations in the rbc in the noiso group is not currently known . on the other hand , there was a significant increase of rbc amp concentrations in the noex group , but not in the other groups ( lowex , vigex or noiso ) ( table 3 and fig . 5 ) . similarly , the auc ratios of amp to atp and also amp to adp concentrations in rbc were significantly higher in the noex group than the other groups ( table 3 ) suggesting a greater catabolism of atp and adp to amp in the rbc occurred in the rats received isosproterenol without the exercise preconditioning . this was further supported by the correlation and regression analyses that exercise pre - conditioning ( both lowex and vigex groups ) attenuated breakdown of atp in the rbc ( table 4 ) . as has been shown previously , breakdown of atp in the rbc was a strong indicator for serious cardiovascular events including mortality . thus the results support our working hypothesis that exercise preconditioning may reduce mortality , attenuates the rebound in blood pressure , and the breakdown of atp in the rbc induced by isoproterenol . however , it should be noted that manifestation of the post exercise effect is multi - factorial and there are other mechanisms besides an increase of atp concentration in rbc that contribute to post - exercise hypotension . exercise activates nitric oxide synthase activity in the endothelium and the renin angiotensin system [ 41 , 42 ] . blockade of angiotensin ii receptor has been shown also to augment the effect of exercise in reducing post - myocardial infarct ventricular remodeling in rats . recently , exercise has been shown to increase uridine concentrations in systemic blood which may be associated with the post - exercise effect . there are probably other additional mechanisms which contribute to the health benefits associated with cardiovascular exercise [ 46 , 47 ] , and many of these mechanisms may work in tandem to maintain cardiovascular homeostasis in the body . although the clinical significance of atp metabolism in the rbc is not clear , we hypothesize that it may be a measure of energy utilization within the cardiovascular system in vivo . in vitro studies have shown that atp is released from human rbc and myocardium in response to a brief period of hypoxia and is subsequently broken down to adp and amp [ 48 , 49 ] . while there is no direct evidence to indicate a similar response to ischemia or exercise occurs in vivo , the idea of rbc being an oxygen sensor as suggested by other workers is a plausible explanation and warrants further investigation [ 50 , 51 ] . it is known that rbc are capable of releasing increased amounts of atp as oxygen content falls and its haemoglobin becomes desaturated . it was hypothesized that rbc may sense tissue oxygen requirements when they travel through the microcirculation , releasing vasodilatory compounds such as atp that enhance blood flow in hypoxic tissues . the released atp would help to increase blood supply to the tissue and preserve an optimum , tissue - specific balance between oxygen supply and demand , thereby modulating the concentrations of tissue atp within the cardiovascular system . such a mechanism would eliminate the requirement for a diverse network of sensing sites throughout the vasculature , and should provide a more efficient means of appropriately matching oxygen supply with demand , and allow an immediate switch to alternative energy sources under hypoxia condition . thus we advocate the potential cardiovascular protective effects of exercise are mainly attributed to the post exercise effect , which is contributed at least partly by an increase of rbc concentrations of atp . the protection may be measured by a reduction in mortality , attenuating breakdown of atp in the rbc and rebound of blood pressure in response to sympathetic activation and cardiovascular injury induced by isoproterenol . however it should be cautious owing to the small number of rats used in the study ( n = 7 11 in each group ) and the large variation of the adenine nucleotide concentrations in the rbc , the exercise effect on some of the parameters such as reduction in cardiovascular mortality and breakdown of atp to adp ( table 3 ) was not statistically significant . additional study using larger number of rats in each group and including measure of baseline hemodynamic variables and adenine nucleotide concentrations before exercise is warranted . if our working hypothesis is validated , atp metabolism in the rbc may be used as a drug target for anti - ischemia agents , and as surrogate biomarker for management of cardiovascular diseases , which would be an exciting topic with important therapeutic implications for further studies [ 26 , 53 ] . the current study has demonstrated exercise pre - conditioning reduces rebound in blood pressure and breakdown of atp in the rbc in acute mi induced by isoproterenol . the mechanisms may be attributed to post exercise hypotension secondary at least in part to increased atp concentrations in rbc which may be affected by intensity of the exercise . further study probing the potential atp metabolism in rbc as a drug target for cardiovascular protection is warranted . | objective : to study the effect of exercise preconditioning on adenosine 5triphosphate ( atp ) metabolism in red blood cells and cardiovascular protection against injury induced by isoproterenol in vivo .
methods : male sprague dawley rats ( sdr ) were each exercised on a treadmill for 15 minutes at 10 m / min and 10% grade ( n = 7 ) ( lowex ) , or 14 m / min and 22% grade ( n = 8) ( vigex ) .
two hours after the exercise , each rat received a single dose of isoproterenol ( 30 mg / kg ) by subcutaneous ( sc ) injection .
two separate groups of sdr were used as control : one received no exercise ( n = 10 ) ( noex ) and the other received no exercise and no isoproterenol ( n = 11 ) ( noiso ) .
serial blood samples were collected over 5 hours for measurement of atp and its catabolites by a validated hplc .
hemodynamic recording was collected continuously for the duration of the experiment .
data were analysed using anova and t - tests and difference considered significant at p < 0.05 .
results : exercise pre - conditioning ( both lowex and vigex ) reduced mortality after isoproterenol from 50% to < 30% ( p > 0.05 ) .
it attenuated the rebound in blood pressure significantly ( p < 0.05 between noex vs vigex ) , attenuated the increase of rbc adenosine 5-monophosphate ( amp ) concentrations induced by isoproterenol , and also decreased the breakdown of atp to amp in the rbc ( p < 0.05 vs noex ) .
conclusion : exercise pre - conditioning decreased the blood pressure rebound and also breakdown of atp in rbc after isoproterenol which may be exploited further as a drug target for cardiovascular protection and prevention . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a nasogastric tube is utilized routinely by many bariatric surgeons to assist creation of gastrojejunal anastomosis during roux - en - y gastric bypass or duodenojejunal anastomosis during biliopancreatic diversion . however , inadvertent stapling or suturing of the nasogastric tube has been known as a potential complication of this technique . we describe a successful endoscopic removal of an inadvertently sutured nasogastric tube at the level of the duodenojejunal anastomosis in a 30-year - old woman undergoing a robotically assisted laparoscopic biliopancreatic diversion with duodenal switch for super morbid obesity . endoscopic technique is a feasible and safe minimally invasive technique to release a retained nasogastric tube with preservation of the newly created anastomosis . this option gives major advantages of avoiding a re - operation , as well as the potential general anesthetic complications . in many bariatric centers , a nasogastric tube ( ngt ) is utilized routinely when creating the gastrojejunal anastomosis during a roux - en - y gastric bypass or the duodenojejunal anastomosis in a duodenal switch . one potential complication of this technique includes inadvertent stapling or suturing of the ngt depending on the type of anastomosis performed . we describe the successful endoscopic removal of an inadvertently sutured ngt at the level of the duodenojejunal anastomosis during a robotically assisted laparoscopic biliopancreatic diversion with duodenal switch ( r - lbpd / ds ) . a 30-year - old woman with a body mass index ( bmi ) of 44.5 underwent an uneventful r - lbpd / ds . the operation had included the use of a # 16-fr red rubber ngt to guide the creation of the robotically assisted double - layered handsewn duodenojejunal anastomosis . on postoperative day ( pod ) # 1 , the patient complained of significant epigastric pain during attempts to remove the ngt , which appeared to be fixated to a point on the foregut structure . on endoscopic re - evaluation under twilight anesthesia in the operating room , the ngt was found to have been inadvertently sutured at the level of the duodenojejunal anastomosis ( figure 1 ) . an endoscopic cutter was initially introduced via a regular front - view gastroscope , however the challenging degree of angulation resulted in inadequate visualization . we then switched to a sideview ercp scope which provided superior view and more favorable angulation toward the anastomosis ( figure 2 ) . the endoscopic cutter was successfully utilized to cut and release the ngt , leaving the anastomotic suture intact . the anastomosis was carefully inspected , which appeared to be intact and watertight ( figure 3 ) . endoscopic view of an inadvertently sutured nasogastric tube at the level of duodenojejunal anastomosis using a regular front - view gastroscope . progressive effort to cut and release the retained nasogastric tube using an endoscopic cutter guided by a side - view ercp scope . a radiologic evaluation of the anastomosis was obtained with gastrografin upper gi series on pod # 3 , which ruled out anastomotic leak or obstruction . a clear liquid diet was subsequently introduced without problems . the patient continued to make an unremarkable recovery , and she was discharged on pod # 5 . at 1 month postoperatively , an upper gi endoscopy was performed where an intact and patent anastomosis was seen . at 6-month follow - up , the patient has achieved excellent weight loss with complete resolution of her obesity - related comorbidities . regular office visits are scheduled as per bariatric protocol at 9 , 12 , 18 months postoperatively , and yearly thereafter . a gastrografin upper gi series is reserved for clinical signs and symptoms of upper gi obstruction in the future , followed by an upper gi endoscopy with possible balloon dilatation if clinically indicated . in bariatric surgery , a recognized complication of gastric banding is erosion and subsequent intragastric migration of the band causing potentially serious problems such as obstruction , gastric perforation , and intra - abdominal sepsis . endoscopic removal of intragastric foreign body , mainly eroded gastric band or silastic ring from the historically popular vertical band gatroplasty ( vbg ) in the early 1980 's has been described . vbg involves partitioning the stomach with a vertical staple line and restricting the pouch outlet using a gortex band which can erode through the vertical staple line or through the lesser curvature into the gastric pouch . it occurs in 1% to 3% of patients and presents with symptoms of obstruction , weight gain , nausea , pain , and bleeding . utilizing this minimally invasive endoscopic technique , a surgical removal of the bands neto at al reported a 95% success rate of endoscopic removal of eroded gastric bands due to erosion . symptoms occurred at an average of 16.3 months ( range 6 - 36 ) postoperatively and included pain ( 31% ) , port infection ( 27% ) , and weight regain ( 25% ) of the patients . a comparable technical success was reported in 7 patients by regusci et al . in the case described in this report , a flexible endoscopic cutter was used for removal of a retained nasogastric tube that had been inadvertently sutured during creation of a robotically assisted duodenojejunal anastomosis . the patient was taken for an endoscopic exploration in the operating room with plan to proceed with laparoscopic / open exploration redo anastomosis should the endoscopic approach fail or the anastomosis become disrupted . initially , a regular ( front - view ) gastroscope was used , but visualization was poor because of the parallel direction of the nasogastric tube and the gastroscope . an adequate triangulation was later obtained using a side - view endoscopic retrograde cholangiopancreatography ( ercp ) scope in collaboration with a gastrointestinal endoscopist . after the release , the anastomosis was found to be intact endoscopically , and this was subsequently confirmed radiologically . laparoscopic exploration with possible creation of a new anastomosis was able to be avoided . in the report of endoscopic removal of eroded adjustable gastric band by neto at all , three were treated conservatively , one was treated by laparoscopy , and one was treated by abdominal puncture using the veress needle . in the current case , flexible endoscopy is safe , feasible , and effective in retrieving a retained foreign body after upper intestinal surgery . a laparoscopic approach with possible repair / re - creation of the anastomosis should be reserved as the next option only when the endoscopic approach fails . | context : a nasogastric tube is utilized routinely by many bariatric surgeons to assist creation of gastrojejunal anastomosis during roux - en - y gastric bypass or duodenojejunal anastomosis during biliopancreatic diversion . however , inadvertent stapling or suturing of the nasogastric tube has been known as a potential complication of this technique.case report : we describe a successful endoscopic removal of an inadvertently sutured nasogastric tube at the level of the duodenojejunal anastomosis in a 30-year - old woman undergoing a robotically assisted laparoscopic biliopancreatic diversion with duodenal switch for super morbid obesity.conclusions:endoscopic technique is a feasible and safe minimally invasive technique to release a retained nasogastric tube with preservation of the newly created anastomosis .
this option gives major advantages of avoiding a re - operation , as well as the potential general anesthetic complications . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
according to the scoliosis research society , scoliosis is defined as the lateral deviation
of the normal vertical curve of the spine by more than 10 degrees with or without deviation
of the lateral curvature in the sagittal and axial views1 , 2 . it can result from spinal structural pathologies or non - structural
pathologies , such as lower extremity length discrepancy or pelvic imbalance3 . the majority of patients
receive conservative treatment , for example , orthoses , thoracolumbosacral orthoses ( tlso ) ,
or physical therapy , although the rationale for the selection of conservative treatment
types is unclear . biomechanical foot orthoses ( bfos ) are therapeutic custom - made tools , which are placed in
shoes to control foot alignment during gait to allow normal foot motion and inhibit abnormal
motion . from the biomechanical perspective , the body is multi - segmental , and segments
interact strongly with each other . the pelvis is an important segment , and pelvic and lumbar
positions are well - correlated5 . irrespective of the plane of motion , foot alignment influences pelvic alignment6 , 7 ,
and alignment of the lower extremity , which involves the pelvis girdle , can be altered by
forces acting on the feet7 , 8 . in a previous study , postural and spinal adaptations were
established in patients with scoliosis , using shoe lift heights of 5 , 10 , and 15 mm9 . however , these shoe lifts were achieved
using simple heel lifts , whereas bfos are custom - designed for patients . thus , bfos rectify
mal - alignment by stabilizing the foot and correcting mal - alignments of the spine and
pelvis . standing whole spine radiographs are used to diagnose and follow - up spinal curve in
scoliosis10 , and thus , cobb s angle and
other spinal parameters are measured using radiographic images . however , repetitive exposure
to x - rays increases the risk of cancer development , including that of breast cancer11 , 12 . in contrast , surface topography offers a radiation free means of
measuring spinal parameters . in particular , surface topography scanner diers formetric 4d
( diers international gmbh , schlangenbad , germany ) can be used to measure trunk rotation ,
imbalance , and scoliosis angle , and has test - retest reproducibility comparable to that of
radiography13 . the parameters of scoliosis have been previously measured using a diers formetric 4d unit ,
but the effects of bfos on scoliosis have not been previously assessed using this machine . the objective of this study was to confirm the effect of bfos on scoliosis angle , trunk
imbalance , and pelvic obliquity compared with general insoles by using a diers formetric 4d
in patients with scoliosis . inclusion criteria included diagnosis of scoliosis with a cobb angle of 10 to < 45 and
age from 13 to 60 years . exclusion criteria were : ( 1 ) severe scoliosis with a cobb angle
of>45 degrees , ( 2 ) leg length discrepancy of>2 cm , ( 3 ) pain of discal origin of
vas>3 , ( 4 ) any lower extremity trauma or surgery history , ( 5 ) arthritis , ( 6 ) pregnancy ,
( 7 ) spasm or spasticity of any muscle , and ( 8) a vestibular system problem affecting the
regulation of posture . this study was approved by the institutional review board of yeungnam
university hospital and all subjects provided informed consent before participating in the
study . the study subjects were equally and randomly allocated to two groups : the bfo group ( n=13 )
and the control group ( n=13 ) , who used general insoles . in the bfo group , patients used a
custom - made bfo for at least 3 h / day , and were evaluated before wearing a bfo and after 2
and 4 weeks of wearing a bfo . in the control group , general insoles were of the same height
as the bfos ( 3 mm ) , and were used for at least 3 h / day . members of the control group were
also evaluated before wearing a general insole and at 2 and 4 weeks after wearing an insole . all evaluations
were conducted by an independent , skilled examiner using a diers formetric 4d that used a
photogrammetric recording of the back obtained by video raster stereography . measurements were taken with patients
undressed ( to reveal buttocks for detection landmarks ) and standing with both arms alongside
the trunk and feet 20 cm apart . images were obtained in 12 trials for total 6-sec and data
were automatically analyzed . trunk imbalance was defined as lateral deviation of c7 ( the
most prominent vertebra ) from midline of both lumbar dimples ( posterior superior iliac
spine , psis ) . pelvic obliquity was defined as the height difference between the lumbar
dimples in the horizontal plane , and projected line pattern on the back obtained by video raster stereography the analysis was performed using spss ver . 18.00 , and significance was set at p values of
< 0.05 . demographic and clinical characteristic of the 26 study subjects are provided in table 1table 1.baseline patient characteristic and clinical parametersgroupbfo ( n=13)control ( n=13)gender ( m , f)7 , 69 , 4age ( yrs)35.8 17.431.8 9.3height ( cm)167.3 9.0172.8 6.1weight ( kg)64.3 5.4864.1 11.4scoliosis angle ( )17.6 4.719.6 7.9trunk imbalance ( mm)10.7 6.311.9 7.6pelvic obliquity ( mm)10.6 10.45.7 2.3values are presented as numbers or means standard deviations.bfo : biomechanical foot orthosis . mean ( standard deviation ) group ages , heights , body weights , scoliosis
angles , trunk imbalances , and pelvic obliquities were not significantly different between
the groups . mean scoliosis angle was 17.6 4.7 in the bfo group and 19.6 7.9 in the
control group . mean trunk imbalance ( mm ) was 10.7 6.3 in the bfo group and 11.9 7.6 in
the control group , and mean pelvic obliquity was 10.6 10.4 in the bfo group and 5.7 2.3
in the control group . bfo : biomechanical foot orthosis in the bfo group , the scoliosis angle and trunk imbalance at 2 and 4 week follow - ups and
immediately after bfo fitting were significantly lower than at baseline ( p<0.05 ) ( table 2table 2.parameters in the bfo groupinitial barefootinitial bfobfo after 2 weeksbfo after 4 weeksmeansdmeansdmeansdmeansdscoliosis angle ( )17.614.6813.54 * 4.1212.7 * 4.5210.23*3.24trunk imbalance ( mm)10.696.336.62 * 4.495.92 * 3.974.77 * 2.74pelvic obliquity ( mm)10.6210.146.544.395.77 * 3.703.92*3.59vas4.461.274.461.273.42*1.352.00*1.08sd : standard deviation ; bfo : biomechanical foot orthosis ; * p<0.05 , vs. initial
barefoot values ; p<0.05 , compared to initial bfo ; p<0.05 , compared to initial
values ) , and pelvic obliquity and vas scores were significantly lower at 2 and 4
weeks than at baseline in the barefoot state ( p<0.05 ) . in addition , there were
significant reductions in the scoliosis angle , pelvic obliquity , and vas scores in the bfo
group between baseline and 2 weeks , and between 2 and 4 weeks ( p<0.05 ) ( table 2 ) . in contrast , no significant reduction in
these variables was observed at any time in the control group ( table 3table 3.parameters in the control groupinitial barefootinitial insoleinsole after 2 weeksinsole after 4 weeksmeansdmeansdmeansdmeansdscoliosis angle ( )19.627.9319.627.9319.847.8319.157.22trunk imbalance ( mm)11.887.5811.887.5811.697.4111.697.05pelvic obliquity ( mm)5.692.295.692.296.232.245.622.53vas30.7130.7130.7130.71sd : standard deviation ) . sd : standard deviation ; bfo : biomechanical foot orthosis ; * p<0.05 , vs. initial
barefoot values ; p<0.05 , compared to initial bfo ; p<0.05 , compared to initial
values sd : standard deviation the objective of this study was to evaluate the effects of bfo on spinal malalignment in
patients with scoliosis by using a diers formetric 4d . in the bfo group , all parameters were
significantly different during follow - up as compared with the initial barefoot state , but no
significant difference was observed in the control group . furthermore , in the bfo group ,
significant differences were observed in the scoliosis angle and pelvic obliquity when upon
wearing bfos . in a previous study on patients with scoliosis , sacral tilt was decreased by a shoe lift ,
and this was accompanied by reductions in the lumbar and thoracolumbar spine angles9 , 14,15,16 . in addition , systematic postural adaptations have been demonstrated for shoe lifts and a
significant correlation has been reported between the spinal curve reduction and the
correction of leg length discrepancy9 , 17,18,19,20 . damico et al . corrected the pelvic tilt and postural imbalance using an underfoot wedge ,
because they focused on the correction of leg length discrepancy19 . in the present study , we used custom - made foot orthoses
that followed the natural contours of an individual s feet . generally , rear - foot movement
indicates the range of subtalar joint pronation within a foot , and excessive pronation of
the subtalar joint is associated with injuries , and thus , neutral positioning of the
subtalar joint is important for lower extremity function . foot orthoses reduce
the excessive pronation of this joint by reorienting the rear - foot , which may be related to
the realignment of the pelvic obliquity or imbalance21 . coronal correction of the spinal alignment improved the trunk
imbalance , and thus , we considered rear - foot correction , which included the correction of
rear - foot pronation and supination . reducing the differences in pelvic rotation as well as
adjusting both rear feet in neutral position our evaluations were performed immediately after wearing shoe lifts or underfoot wedges and
long - term follow - up tests were not conducted . in the bfo group , the pelvic obliquity and
scoliosis angle significantly reduced with time . scoliosis angles were corrected by reducing
the sacral tilt and interaction or mobility of the musculoskeletal system9 . in the bfo group , these parameters were
significantly reduced at 4 weeks , which suggests that the musculoskeletal systems had
adapted to the bfos . the pelvic obliquity was a meaningful factor for scoliosis curves9 , 22 . although the mechanism is unclear , it may be related to the pelvic stabilization and its
effect on malalignments of adjacent vertebral bodies and changes in the functions of
multiple back and abdominal muscles . eventually , the unbalanced force on the vertebrae was
redistributed9 , 23 . many authors have suggested that increased exposure to ionizing radiation is a risk factor
for cancer , especially for breast cancer24 . repetitive x - ray exposure was reported to result in an overall
increase of 8% in cancer risk , and a 3.9 fold increase in breast cancer risk25 , 26 . accordingly , serial evaluations by plain radiography during follow
up are unadvisable given a suitable alternative . thus , in the present study , we used a diers
formetric 4d , which provides a radiation - free means of obtaining surface topographies . it
has been previously reported that the correlation between cobb angles obtained by
radiography and scoliosis angles obtained topographically is significant24 , 27 , which was also observed in this study ( p<0.05 ) . thus , we measured
the spinal parameters of scoliosis by diers formetric 4d that was persuasive . in addition ,
the strengths of diers formetric 4d were short test time , low cost , and no placement of any
marking component , which reduced inspector measurement error . the present study has some limitations that require consideration . second , the follow - up period was only up to 4 weeks , and no long - term
follow - up was performed , and thus , we can not comment on the long - term effects of bfo use . third , only three spinal parameters were evaluated , and we did not study the changes in pain
scores or daily activities . despite these shortcomings , this is the first study to
investigate the effects of a biomechanical foot orthosis in patients with scoliosis by
radiation - free topography . further large - scale long - term studies are needed to confirm our
results . we believe bfo could be effective in patients with scoliosis , and that diers
formetric 4d provides a useful means for evaluating scoliosis parameters . | [ purpose ] little is known about the effects of biomechanical foot orthoses in scoliosis ,
as determined by raster stereography .
the objective of this study was to investigate the
effect of individually manufactured biomechanical foot orthoses on scoliosis angle , trunk
imbalance , and pelvic obliquity by comparing them with general insoles by using diers
formetric 4 dimensional in patients with scoliosis .
[ subjects and methods ] twenty - six
patients with scoliosis were recruited at yeungnam university hospital and allocated
equally to one of two groups , the biomechanical foot orthoses group or the control group .
parameters , such as , trunk rotation , imbalance , and scoliosis angle , were obtained using a
diers formetric 4d . [ results ] scoliosis angle , pelvic obliquity , and trunk imbalance
were
significantly different between the two groups and improved in the biomechanical foot
orthoses group with time , but no significant improvement in any parameter was observed in
the control group . [ conclusion ] biomechanical foot orthoses could be effective in patients
with scoliosis , and diers formetric 4d provides a useful method for evaluating scoliosis
parameters . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prevention of dental caries is one of the main strategies in contemporary pediatric dental practice . the dental plaque is a structure of vital significance as a contributing factor to at least the initiation of the carious lesion . the major strains of streptococci present in plaque are : streptococcus mutans , streptococcus sanguis , streptococcus mitior , streptococcus milleri and streptococcus salivarius . of these , although mechanical plaque control by tooth brushing is the most dependable and commonly practiced oral hygiene measure , numerous anti - plaque agents have been tried for improving oral health . these agents are capable of preventing bacterial adhesion , colonization and metabolism , and thus affect the bacterial growth . the efficacy of these antimicrobial agents depends on factors like vehicle used , concentration of active agents , substantivity of the agent and duration of the treatment . an ideal anti - plaque agent for regular use in children should not interfere with biologic processes occurring in the mouth , be harmless to oral mucosa , should have low toxicity if accidentally swallowed , and should be both sugar and alcohol free . fluoride is one of the most important and effective components of preventive dental programs in children . sodium fluoride mouth rinses are effective in reducing caries and inhibit carbohydrate utilization of oral microorganisms by blocking enzymes involved in the bacterial gylcolytic pathway . xylitol is a naturally occurring non - cariogenic sugar substitute that can not be metabolized by oral bacteria . xylitol reduces the amount of adherent extracellular polysaccharides , lipoteichoic acids , resulting in the formation of loosely attached bio - films to the tooth surfaces . most in vivo studies have focused on the application of xylitol chewing gums , inextricably combining physicochemical with mechanical effects . although it is incorporated in certain toothpastes , data available on mouth rinses containing triclosan are limited . thus , the aim of this study was to investigate the efficacy of a newly introduced xylitol , sodium fluoride and triclosan containing mouth rinse in reducing the levels of plaque s. mutans and to compare it with that of a 0.12% chlorhexidine mouth rinse . eighty - five normal children aged between 7 and 13 years and residing in an orphanage in bangalore city were screened as part of a routine dental examination . these children had the same dietary pattern and followed similar oral hygiene practices . prior to the study , ethical clearance was obtained from the ethical committee of the institution . to be included in the study , each child had to have a dental caries score ( deft / dmft score ) equal to or greater than 3 . medically compromised childrenchildren with a history of taking antibiotics 3 months prior to and during the study periodchildren undergoing orthodontic treatment or with an intraoral prosthesischildren who could not brush their teeth or rinse on their ownpresence of any intraoral soft tissue pathology
medically compromised children children with a history of taking antibiotics 3 months prior to and during the study period children undergoing orthodontic treatment or with an intraoral prosthesis children who could not brush their teeth or rinse on their own presence of any intraoral soft tissue pathology thirty children formed the study group . the authorities of the orphanage were instructed not to take these children for any dental treatment during the study period . at the onset of the study , each child was given a new soft toothbrush and non - fluoridated toothpaste . demonstration of tooth brushing using scrub technique was given to all children by the investigator . they were instructed to brush before breakfast in the morning and after meals in the night . prior to commencement of the oral rinse regime , autoclaved wooden toothpicks were used to take plaque samples from the buccal surface of a noncarious permanent mandibular first molar or a primary mandibular second molar . the samples were taken to the laboratory within an hour , serial dilutions prepared and vortexed . one milliliter of the dilution was inoculated onto mitis salivarius agar and incubated at 37c for 48 hours . colony forming units ( cfus ) of s. mutans were counted at baseline with the help of a digital colony counter . in this single - blind trial , the children were randomly divided into two groups of 15 children each . group i ( study group ) was given a mouth rinse containing xylitol ( 5% ) , sodium fluoride ( 0.05% ) and triclosan ( 0.03% ) ( kidodent mouthwash , indoco remedies ltd , mumbai , india ) , and group ii ( control group ) was given a chlorhexidine ( 0.12% ) mouth rinse ( nitra hex , micro labs limited , bangalore , india ) . the children were asked to gather in a large room , where each child was given 10 ml of the mouth rinse and asked to rinse for 1 minute . mouth rinsing was carried out twice daily , half an hour after breakfast and half an hour following dinner , for a period of 21 days under the supervision of the investigator . on the 22 day , prior to breakfast , plaque samples were collected , processed and s. mutans counts were assessed and compared with baseline values . data obtained were subjected to statistical analysis using student 's t - test . in order to ascertain preference of mouth rinse , all the children were asked to taste both mouth rinses at the end of the study . medically compromised childrenchildren with a history of taking antibiotics 3 months prior to and during the study periodchildren undergoing orthodontic treatment or with an intraoral prosthesischildren who could not brush their teeth or rinse on their ownpresence of any intraoral soft tissue pathology
medically compromised children children with a history of taking antibiotics 3 months prior to and during the study period children undergoing orthodontic treatment or with an intraoral prosthesis children who could not brush their teeth or rinse on their own presence of any intraoral soft tissue pathology thirty children formed the study group . the authorities of the orphanage were instructed not to take these children for any dental treatment during the study period . at the onset of the study , each child was given a new soft toothbrush and non - fluoridated toothpaste . demonstration of tooth brushing using scrub technique was given to all children by the investigator . they were instructed to brush before breakfast in the morning and after meals in the night . prior to commencement of the oral rinse regime , autoclaved wooden toothpicks were used to take plaque samples from the buccal surface of a noncarious permanent mandibular first molar or a primary mandibular second molar . the samples were taken to the laboratory within an hour , serial dilutions prepared and vortexed . one milliliter of the dilution was inoculated onto mitis salivarius agar and incubated at 37c for 48 hours . colony forming units ( cfus ) of s. mutans were counted at baseline with the help of a digital colony counter . in this single - blind trial , the children were randomly divided into two groups of 15 children each . group i ( study group ) was given a mouth rinse containing xylitol ( 5% ) , sodium fluoride ( 0.05% ) and triclosan ( 0.03% ) ( kidodent mouthwash , indoco remedies ltd , mumbai , india ) , and group ii ( control group ) was given a chlorhexidine ( 0.12% ) mouth rinse ( nitra hex , micro labs limited , bangalore , india ) . the children were asked to gather in a large room , where each child was given 10 ml of the mouth rinse and asked to rinse for 1 minute . mouth rinsing was carried out twice daily , half an hour after breakfast and half an hour following dinner , for a period of 21 days under the supervision of the investigator . on the 22 day , prior to breakfast , plaque samples were collected , processed and s. mutans counts were assessed and compared with baseline values . data obtained were subjected to statistical analysis using student 's t - test . in order to ascertain preference of mouth rinse , all the children were asked to taste both mouth rinses at the end of the study . in both groups , there was a significant reduction in the mean s. mutans count at the end of 21 days ( p < 0.001 ) . of the 30 children , 83.33% preferred the taste of xylitol , sodium fluoride and triclosan containing mouth rinse , while 16.67% preferred the taste of 0.12% chlorhexidine mouth rinse [ figure 1 ] . it is important for these products to be effective and safe for regular use in children . mouth rinses are recommended only for those who have the ability to swish and expectorate without swallowing . most mouth rinses contain alcohol as one of their ingredients and they are also available over the counter . the major side effects of alcohol containing mouth rinses include the presence of oral pain , burning sensation , difficulty of use in patients with oral sensitivity and the risk of accidental alcohol ingestion in children.[1012 ] the extrahepatic metabolism of alcohol has been demonstrated in oral tissue . in the human mouth , aldehyde dehydrogenase ( aldh ) , an enzyme that converts acetaldehyde into a nontoxic acetate compound , occurs less frequently than alcohol dehydrogenase ( adh ) . this imbalance allows for the accumulation in oral tissues of a toxic , reactive and irritating acetaldehyde . due to a point mutation , aldehyde dehydrogenase 2 ( aldh2 ) isoenzyme is deficient in 3050% of asians . these individuals have a genetic inability to remove acetaldehyde and consequently have very high salivary acetaldehyde levels after moderate dose of alcohol . hence , in this study , it was primarily necessary to select two mouth rinses that were alcohol free . in recent times , various polyalcohols , particularly xylitol , have been incorporated in a number of different products for children , including mouth rinses . the nonspecific effect of xylitol is due its non - fermentability , and thus does not encourage bacterial growth . the selective effect on mutans streptococci results in the development of mutant resistant strains which may be less virulent in the oral environment . metabolic cycle in which xylitol is taken into the cell , phosphorylated to xylitol-5-phosphate , split into sugar phosphate phosphatases and the resulting xylitol is expelled from the cell . the ability of plaque to produce acids by the metabolism of sugars is reduced by xylitol . xylitol appears to have a unique effect in reducing adhesion and it is expected that other polyols might not show this clinical effect . the concentrations of ammonia and basic amino acids increase when plaque is exposed to xylitol , resulting in neutralization of plaque acids . the presence of fluoride in this mouth rinse could have also contributed to the reduction of s. mutans in plaque . the effects of fluoride on streptococcal cells are partly ascribed to the inhibition of enolase , one of the series of gylcolytic enzymes . this inhibition decreases the intracellular level of phosphoenolpyruvate ( pep ) , and thus decreases bacterial sugar uptake via pep - dependent phosphotransferase system ( pep - pts ) . in addition , fluoride can directly inhibit bacterial proton - translocating atpase that is considered to partly contribute to the proton excertion out of the cells , leading to acidification of intracellular ph . the dissociation of unionized hydrofluoric acid into h+ and f in the cells also promotes intracellular acidification . analyses of intracellular gylcolytic intermediates revealed that xylitol inhibited the upper part of the gylcolytic pathway , while fluoride inhibited the lower part . this suggests that fluoride and xylitol together have synergistic inhibitory effects on the acid production of mutans streptococci and that xylitol has the potential to enhance inhibitory effects of low concentrations of fluoride . however , fluoride mouth rinses should be reserved for use with children judged to be at moderate or high risk for dental caries . it is also important to select a fluoridated mouth rinse with a fluoride concentration of 0.05% for regular use . the other ingredient present is triclosan , a broad - spectrum antimicrobial , having an anti - plaque potential . triclosan ( 2,4,4-trichloro 2-hydroxydiphenyl ether ) is used to increase the ability of mouthwashes to bind to the oral mucosa , and thus be available for longer periods of time . jenkins et al . compared the magnitude and duration of salivary bacterial count reductions produced by a single rinse of 0.2% triclosan , 1% sodium lauryl sulfate ( sls ) and 0.2% chlorhexidine mouthwashes . they found considerable reductions in bacterial counts which remained significant for 3 hours with triclosan and for 7 hours with sls and chlorhexidine . the use of 0.3% triclosan mouth rinse showed significant reduction in salivary mutans streptococci count . hence , the significant reduction in plaque s. mutans observed in our study could be attributed to the synergistic effect of all three constituents , viz . it is an effective anti - plaque agent and is widely available as a mouth rinse . chlorhexidine is a bis - biguanide which is effective against gram - positive bacteria , gram - negative bacteria and yeast . at relatively high concentration , chlorhexidine is bactericidal ; but at low concentration , it is bacteriostatic . low concentrations of chlorhexidine allow cytoplasmic constituents to leak out , while a high concentration coagulates them . it inhibits the membrane atpase and anaerobic process . in a study on 1214-year - old children with high caries risk , 0.12% chlorhexidine mouth rinse was more efficient in reducing mutans streptococci count in saliva , as compared to other mouth rinses . however , it gave more negative findings when taste sensation and side effects were compared . a recent review concluded that due to the current lack of long - term clinical evidence for caries prevention and reported side effects , chlorhexidine rinses should not be recommended for caries prevention . since we found no significant difference between both the mouth rinses , with regard to their efficacy in reducing s. mutans , the use of a low fluoride xylitol based mouth rinse appears to be a suitable choice for regular use in children . also , children preferred the taste of the bubble gum flavored , xylitol - based mouth rinse . since this study was a brief clinical trial on a newly introduced mouth rinse for children , studies of longer duration further research on individual components and their effect on saliva , teeth and remineralization potential would enable clinicians to select an appropriate mouth rinse for use in children . significant reduction inplaque levels of s. mutans was observed with the use of xylitol , sodium fluoride and triclosan containing mouth rinse . | introduction : prevention of dental caries is one of the main strategies in contemporary pediatric dental practice .
mouth rinses are widely used as an adjunct to maintain oral hygiene .
it is important for these products to be effective and safe for regular use in children.objective:the aim of the study was to investigate the efficacy of a newly introduced xylitol , sodium fluoride and triclosan containing mouth rinse in reducing levels of plaque streptococcus mutans and to compare it with that of a 0.12% chlorhexidine mouth rinse.materials and methods : thirty children were randomly divided into two groups of 15 children each .
group i ( study group ) was given a mouth rinse containing xylitol ( 5% ) , sodium fluoride ( 0.05% ) and triclosan ( 0.03% ) and group ii ( control group ) was given a chlorhexidine ( 0.12% ) mouth rinse .
both mouth rinses were alcohol free .
mouth rinsing was carried out twice daily , half an hour after breakfast and half an hour following dinner , for a period of 21 days under the supervision of the investigator.results:in both groups , there was a significant reduction in the mean s. mutans count at the end of 21 days ( p < 0.001 ) .
no significant difference was observed between the two mouth rinses.conclusion:the use of a low fluoride xylitol based mouth rinse appears to be a suitable choice for regular use in children . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
conventional periodontal treatment such as scaling and root planning and open flap debridement ( ofd ) are highly effective at repairing disease - related defects and halting the progression of periodontitis . while these are important steps , researchers are still challenged to develop more effective techniques that predictably promote the body 's natural ability to regenerate its lost periodontal tissues , particularly periodontal ligament and alveolar bone . many of these include the use of bone grafts , bone replacement materials and more recently use of growth factors . the most extensively evaluated graft material for the treatment of infrabony defects remains demineralized freeze - dried bone allograft ( dfdba ) . many studies have revealed significant and consistently superior gain in bone fill with dfdba compared to ofd procedures . commercially prepared dfdba has been shown to retain active bone matrix proteins such as bone morphogenetic proteins ( bmps ) 2 , 4 , and 7 . part of which , appears to be lost , as a result of tissue processing comported to fresh allograft . there is histological evidence that dfdba supports the formation of a new attachment apparatus in infrabony defects , whereas ofd results in periodontal repair characterized primarily by the formation of a long junctional epithelial attachment . some donor bone has shown no activity at all and had thus acted as source of type i collagen only . these shortfalls in dfdba have let the researchers toward the search of a regenerative material with similar ability to regenerate periodontal tissues with minimum disadvantages in terms of antigenicity and cost . a second - generation platelet concentrate , platelet - rich fibrin ( prf ) prf is in the form of platelet gel and can be used in conjunction with bone grafts , which offers several advantages , including promoting wound healing , bone growth and maturation , graft stabilization , wound sealing , and hemostasis , and improving the handling properties of graft materials . platelet activation in response to tissue damage release several biologically active proteins including ; platelet alpha granules , platelet - derived growth factor ( pgdf ) , transforming growth factors- ( tgf- ) , vascular endothelial growth factor ( vgef ) , and epidermal growth factor . in periodontal infrabony defects , there has not been any study to date comparing the use of prf with dfdba in periodontal infrabony defects . hence , the aim of this study was to evaluate the efficiency of prf for periodontal regeneration in infrabony defects as compared with dfdba . this randomized controlled , split mouth clinical trial , approved by the institutional ethics committee of sumandeep vidyapeeth , comprised of 20 participants ( age range , 20 - 55 years ) with bilaterally similar periodontal infrabony defects . participants were selected from the outpatient department of department of periodontics from k. m. shah dental college and hospital , piparia , vadodara . participants with a probing depth ( pd ) 5 mm at two or more sites , sites exhibiting clinical and radiographic evidence of infrabony defects , and two or three wall infrabony defects at two of more sites were included in the study . participants with known allergy to local anesthetic and chlorhexidine , antibiotic and analgesic ; with habit of smoking and tobacco chewing ; those unable to maintain meticulous oral hygiene after phase i therapy were excluded from the study [ figures 1 and 2 ] . control site relative attachment level test site : relative attachment level at baseline this study was carried on 40 sites . prior to surgery , defects were assigned randomly by a coin flip to receive either prf plug or dfdba following ofd before the start of the surgery . after completion of initial periodontal treatment , including oral hygiene instructions , and scaling and root planing , participants maintaining good oral hygiene and who gave consent were selected in the study . the selected defects were analyzed clinically and radiographically to fulfill the inclusion criteria ; and then the participant was scheduled for surgery . a customized acrylic stent was fabricated for each selected site so that the standard periodontal probe returns to the same position for each successive measurement . clinical parameters like pd , relative attachment level ( ral ) , and gingival marginal level ( gml ) were measured using a unc-15 probe . a single periodontal surgeon carried out a surgical procedure for all participants . each site was treated through reflection of a full - thickness mucoperiosteal flap , attempting to retain all soft tissue . the exposed roots and osseous defects were debrided with hand and ultrasonic instruments . at the test site , the defects received prf plug derived from the participant 's own blood [ figure 3 ] . at the control sites , flap was then positioned back to the original level and sutured using 4 - 0 silk suture . placement of platelet rich fibrin placement of demineralized freeze - dried bone allograft a volume of 10 ml of blood was drawn from each participant through venipuncture of the right arm and placed in sterilized vacuum evacuated vials without an anticoagulant and centrifuged immediately using a tabletop centrifuge for at least 10 min at 3,000 rpm . participants were instructed not to brush their teeth in the treated area , but to rinse with chlorhexidine solution ( 0.2% ) twice daily for 1-min . after this period , the patients were again instructed for mechanical tooth brushing of the treated teeth region using a soft toothbrush . participants were recalled every month for 6 months , and oral hygiene reinforcement , and full mouth supragingival scaling was done . test site : relative attachment level at 6 months control site : relative attachment level at 6 months the changes in pd , ral , and gml were analyzed at baseline and postsurgically after 6 months in each group with paired t - test and between the two groups with unpaired t - test . , defects were assigned randomly by a coin flip to receive either prf plug or dfdba following ofd before the start of the surgery . after completion of initial periodontal treatment , including oral hygiene instructions , and scaling and root planing , participants maintaining good oral hygiene and who gave consent were selected in the study . the selected defects were analyzed clinically and radiographically to fulfill the inclusion criteria ; and then the participant was scheduled for surgery . a customized acrylic stent was fabricated for each selected site so that the standard periodontal probe returns to the same position for each successive measurement . clinical parameters like pd , relative attachment level ( ral ) , and gingival marginal level ( gml ) were measured using a unc-15 probe . a single periodontal surgeon carried out a surgical procedure for all participants . each site was treated through reflection of a full - thickness mucoperiosteal flap , attempting to retain all soft tissue . the exposed roots and osseous defects were debrided with hand and ultrasonic instruments . at the test site , the defects received prf plug derived from the participant 's own blood [ figure 3 ] . at the control sites , flap was then positioned back to the original level and sutured using 4 - 0 silk suture . a volume of 10 ml of blood was drawn from each participant through venipuncture of the right arm and placed in sterilized vacuum evacuated vials without an anticoagulant and centrifuged immediately using a tabletop centrifuge for at least 10 min at 3,000 rpm . participants were instructed not to brush their teeth in the treated area , but to rinse with chlorhexidine solution ( 0.2% ) twice daily for 1-min . after this period , the patients were again instructed for mechanical tooth brushing of the treated teeth region using a soft toothbrush . participants were recalled every month for 6 months , and oral hygiene reinforcement , and full mouth supragingival scaling was done . test site : relative attachment level at 6 months control site : relative attachment level at 6 months the changes in pd , ral , and gml were analyzed at baseline and postsurgically after 6 months in each group with paired t - test and between the two groups with unpaired t - test . baseline characteristics of test and control groups intragroup statistically significant difference was observed from baseline to 6 months for pd and ral for both groups ( p < 0.05 ) . gml did not show statistically significant difference at 6 months for any of the groups ( p > 0.05 ) [ table 2 ] . changes in clinical parameters after 6 months there were no statistically significant differences between the two groups in terms of pd ( p = 0.57 ) , ral ( p = 0.29 ) and gml ( p = 0.14 ) at 6 months [ table 3 ] . six months postsurgery changes in clinical parameters of test and control groups unpaired t - test chronic periodontitis is initiated and sustained by microorganisms living in communities , which are present in supra- and sub - gingival plaque in the form of uncalcified and calcified biofilms . it is followed by a periodontal flap surgery in sites with deeper , nonhealing pockets and persistent inflammation . patients in this study underwent the initial periodontal therapy and further who were to underwent surgical treatment with 1 - 2 wall intrabony defect were included in the study on the basis of inclusion criteria . the clinical outcome is largely dependent on the skill of the operator in removing subgingival plaque and the skill and motivation of the patient in practicing adequate home care . hence , both test and control sites were treated by same periodontist . in his study , dfdba has been compared with prf for the treatment of periodontal infrabony defects . bone graft materials that are needed in periodontics should be osteoinductive , have good handling characteristics , and have physical properties providing appropriate stiffness for the treatment site . bone graft materials commonly used for these procedures are dfdba and freeze - dried bone allograft ( fdba ) . the osteoinductive properties of dfdba have made it the grafting material of choice as compared to fdba , xenografts , and alloplasts . the use of dfdba has been successfully proven in a histologic study wherein 80% of test sites showed complete regeneration . the demineralization process of dfdba exposes its bmp 's that makes it osteoinductive in nature . numerous growth factors , alone or in combination , have been tested for periodontal regeneration in animal experiments . among these are insulin - like growth factors , fibroblast growth factors , epidermal growth factor , pdgfs , vgef , parathyroid hormone , tgf- and bmps . choukroun 's prf , a second - generation platelet concentrate , consists of an intimate assembly of cytokines , glycanic chains , and structural glycoproteins enmeshed within a slowly polymerized fibrin network . beneficial effects of prf have been studied in various procedures , such as facial plastic surgery , a sinus - lift procedure as a sole osteoconductive filling material , periodontal intrabony , furcation defects , and as suitable scaffold for breeding human periosteal cells in vitro , which may be suitable for bone tissue engineering applications . prf induces a significant and continuous stimulation and proliferation of gingival fibroblasts , dermal prekeratinocytes , preadipocytes , and maxillofacial osteoblasts . the results of this study showed that there were significant improvements in pd and ral at the end of 6 months for both groups . as shown in table 2 statistically significant difference was noted in pd and ral at 6 months for both groups ( p < 0.05 ) . no statistically significant difference was seen between the two groups at 6 months for any of the parameters [ table 3 ] . prf has shown promising results for periodontal regeneration in terms of clinical parameters ( pd , ral , and gml ) and is comparable to dfdba . thus , the results of the study indicate that there is no difference in the clinical parameters between the prf group and dfdba group at the end of 6 months . there are several advantages of using prf , like easy and simplified chairside preparation of prf , cost - effectiveness , release of relatively constant concentration of growth factors over a period of 7 days , and rapid and excellent healing of the periodontium . however , the drawbacks of the study were that bone fill was not evaluated , and a relatively smaller sample size was selected . platelet - rich fibrin has shown significant results after 6 months , which are comparable to dfdba for periodontal regeneration in terms of clinical parameters . however , further studies are required to prove the effectiveness of prf as a regenerative material in the treatment of periodontal infrabony defects . | introduction : several bone graft materials have been used in the treatment of infrabony defects . demineralized freeze - dried bone allograft ( dfdba ) has been histologically proven to be the material of choice for regeneration . however , platelet - rich fibrin ( prf ) has been said to have several properties that aid in healing and regeneration .
hence , this study focuses on the regenerative capacity of prf when compared with dfdba.materials and methods : a total of 40 sites with intrabony defects were selected and were assigned to the test group ( open flap debridement [ ofd ] and prf , n = 20 ) and the control group ( ofd + dfdba , n = 20 ) . at the test sites ,
two prf plugs were placed in the intrabony defect after debridement of the site and flap was sutured in place .
the parameters measured were probing depth ( pd ) , relative attachment level ( ral ) , and gingival marginal level ( gml ) .
these parameters were measured just before surgery ( baseline ) and at 6 months postsurgery .
the changes in pd , ral , and gml were analyzed at baseline and postsurgically after 6 months in each group with paired t - test and between the two groups with unpaired t-test.results:the mean reduction in pd after 6 months in the test prf group is 3.67 1.48 mm where in control dfdba group is 3.70 1.78 mm .
gain in ral in the test prf group is 2.97 1.42 mm where in control dfdba group , it is 2.97 1.54 mm .
gingival margin migrated apically in the test prf group by 0.43 1.31 mm where in control dfdba group by 0.72 2.3 mm .
it was seen that the differences in terms of pd ( p = 0.96 ) , ral ( p = 1.00 ) and gml ( p = 0.62 ) were not significant.conclusion:platelet-rich fibrin has shown significant results after 6 months , which is comparable to dfdba for periodontal regeneration in terms of clinical parameters .
hence , it can be used in the treatment of intrabony defects . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
collagens and elastin comprise highly abundant fibrils that are each repetitive in sequence , enriched in polyproline ii conformation , cross - linked , insoluble when assembled , and resistant to most proteolytic enzymes . the monomer unit of type i collagen comprises two extended 1 chains and one 2 chain twisted together into a triple helix . the detailed structural features of collagen , the many types of collagen , and the supramolecular assembly of the fibrils have been reviewed . elastin provides the extraordinary , enduring elasticity of the aorta and lung and is integrated with other proteins from the extracellular matrix in elastic fibrils [ 25 ] . the tropoelastin monomer is boot - shaped and contains the elasticity in the elongated n - terminal coil region . the foot - like c - terminal end can bind cells and was proposed to grasp the next monomer in a head - to - tail manner in the extended polymer . proteolytic fragments of elastin are highly chemotactic and stimulating of inflammation , proliferation , and angiogenesis . collagenolysis and elastolysis by matrix metalloproteinases ( mmps ) occur in development , wound healing , and major inflammatory diseases . the mmps proposed to be elastolytic have been mmp-2 , mmp-7 , mmp-9 , mmp-12 , and mt1-mmp , but with mmp-3 and mmp-10 in doubt . experiments using highly elastolytic human monocyte - derived macrophages ( mdms ) asserted mmp-7 to be the principal elastolytic mmp under the very elastolytic conditions when activated by a urokinase - type plasminogen activator pathway . parallel experiments using the mdms suggested the unlikelihood of direct elastolysis by mmp-9 , and rather that mmp-12 deposited on elastin fibrils is the mmp required for digesting elastin in the absence of plasminogen . the authors proposed that mmp-12 might influence elastolysis indirectly by digesting chemokines and other extracellular proteins . ( chemokines and numerous non - matrix proteins have been identified as physiological substrates of mmp-12 [ 1012 ] ) . degradation of interstitial collagen fibrils , e.g. , types i and iii , to generate the classic 3/4 and 1/4 fragments is catalyzed by mmp-1 , mmp-8 , mmp-13 , mt1-mmp , mt3-mmp , and presumably mt2-mmp . mmp-2 digests solubilized monomers of collagens i , ii , and iii [ 1315 ] . mechanistic insights into mmp binding and hydrolysis of fibrillar collagens and elastin are surveyed below . the specific questions considered regard how do mmps ( i ) move across collagens to sites for attack , ( ii ) interact with and distort the sites of cleavage in collagen , and ( iii ) employ multiple sites of interaction to engage elastin ? the question of how do mmps move to their sites of cleavage in collagen has been answered with great insight by biophysical approaches , though some methods do not recognize arrival at the site of cleavage . mmp-2 and mmp-9 randomly diffuse laterally on intact collagen fibrils . atomic force microscopy visualized mmp-9 diffusion along the mmp-8-generated 3/4 and 1/4 fragments of collagen ii , especially the preferred 3/4 fragments , resulting in mmp-9 accumulation at their termini . the mmp-9 first unwound the termini into an expanded , gelatin - like state prior to proteolysis . bound to collagen this way , mmp-9 itself became more compact with its domains drawing close . the helicase activity of mmp-9 at the termini distinguishes it from mmp-1 , 8 and 13 that unwind and cleave collagen internally at the 3/41/4 site . collagen fibrils first cleaved by mmp-1 , 8 , or 13 may subsequently experience mmp-2 and mmp-9 diffusing across them and then unwinding and digesting the fibrils further [ 1719 ] . the diffusion of mmp-1 and mt1-mmp along collagen is biased into a single direction , requiring the proteolytic activity which burns bridges to prevent regress . the probability of fibril - bound mmp-1 digesting the collagen ( ~5% when mmp-1 is active ) is largely sufficient to model the diffusion . inhibition of the collagenolytic activity of mmp-1 or mt1-mmp converts the diffusion on the collagen fibril to mostly bidirectional and random . in intact collagen fibrils , mmp-1 can not reach the vulnerable sites in the collagen monomer , apparently because they are covered by the c - terminal telopeptide . the paused states are either ( i ) shorter in duration and non - periodic or ( ii ) longer - lasting ( near 1.1 s ) and periodically at 1.3 and 1.5 m intervals along the fibril . after long pauses , wild - type mmp-1 moved faster and farther than did inactivated mmp-1 . the active mmp-1 was propelled in the c - terminal direction along the fibril by the burnt bridges effect . only 5% of the longer pauses of mmp-1 on the periodic hotspots appear to be productively associated with an average of 13 to 15 irreversible steps of escape , attributed to a rapid succession of proteolysis spaced 67 nm apart . removal of the collagen c - terminus was proposed to be necessary to expose the scissile bond en route to digestion of the outer layer of monomers in the collagen fibril . the large size of the thermal activation energy for collagenolysis probably includes disruption of the steric obstacle of the collagen c - terminus impeding collagenolysis . removal of the structural barriers to collagen digestion may be integral to the kinetically hindered , intermittent , and directional behaviors . association of collagen fibrils with cell surfaces and mmps was hypothesized to allow cells to move on collagen , e.g. keratinocyte migration on collagen . also fulfilling this hypothesis are the collagenolytic activities of ( i ) mmp-8 supporting neutrophil migration and ( ii ) mt1-mmp in developing the full force of cells migrating through 3d collagen - based tissue models . since all of the components of the mmp-2/timp-2/mt1-mmp complexes of cell surfaces diffuse readily on collagen fibrils , their complexes were proposed to support cell movement on collagen , together with integrins and the cytoskeleton . the extended shape and mobility between domains of these mmps was likened to dna - binding proteins and restriction enzymes diffusing on dna . the extreme flexibility between the mmp-9 catalytic and hpx domains was proposed to aid interactions between substrates and cells on the move , possibly through inchworm - like extension and retraction between domains . reasons have been sought for collagenolytic mmps cleaving specifically the 3/41/4 locus in interstitial collagen monomers , despite the many non - specific sites of mmp binding imaged . the sequences recognized by mmp-1 , mmp-8 , mmp-13 , and mt1-mmp span about 30 residues from p13 through p17 positions in the sequences tested [ 2933 ] . the n - terminal side of each cleavage site has tightly wound triple helix rich in the imino acids pro and hyp . the c - terminal side of the scissile bond has more loosely wound triple helix that is relatively poor in the imino acids . while pepsin - treated collagen fibrils thermally melt at 42 c , collagen monomers are less stable and melt around body temperature . less thermally stable segments are found at many positions across the long triple helix [ 34,3638 ] and are attributable to imino - poor sequences . among these destabilized loci , mmp cleavage of the 3/41/4 locus could be attributed to burial within the fibril and the proteolytic removal of the c - terminus to expose the 3/41/4 site , plus mmp preferences that restrict the choices in the collagen sequence . the triple helix of monomers of collagens i and iii was simulated to undergo localized separation of one chain from the other two chains near the scissile bond . vulnerable states were proposed to be inherent to the sites of cleavage in collagen and to be recognizable by a collagenolytic mmp . the dynamics of the isoleucine at the scissile peptide linkage in a collagen iii mimic is in accord with the vulnerable states hypothesis but suggests a more localized separation . the infrequency of productive collagen degradation resulting from mmp-1 pausing at hotspots suggested vulnerable states there to be necessary but insufficient for initiating collagenolysis . once the collagenolytic mmp has reached its site of cleavage in the collagen , how does the triple - helical collagen monomer the diameter of the collagen triple helix of ~13 exceeds the ~5 passage through the s1 to s3 subsites of the active site cleft , necessitating separation of a chain from the triple helix in order to fit this narrow channel for proteolysis . how collagenolytic mmps might unwind and digest the triple helix has continued to be intriguing . many possible means of mechanical manipulation that could separate the chains twisted together were imagined . one mmp-1 enzyme molecule , even inactivated , is capable of presenting a collagen triple helix sufficiently unwound to another mmp or non - collagenolytic protease for successful digestion , implying that unwinding by mmp-1 precedes its proteolysis of the susceptible site . instructive is that the greater thermal barrier to unwinding of homotrimeric collagen impedes its digestion by mmp-1 . the unwinding of homotrimeric collagen i preceding proteolysis appears to result not so much from the hypothesized mmp-1 capture of a vulnerable , melted bubble , but rather from mmp-1 shifting the equilibrium to establish a small population of locally unfolded triple helix . supporting this latter interpretation is the weakening of contacts between chains of the triple helix only after binding of mmp-1 . the collagen triple helix binds the -propeller fold of the hpx domain of mmp-1 around ile290 and arg291 of blade i , contributing to the s10 pocket , as well as around val318 and asp338 in blade ii . structural models of mmp-1 based on nmr data in solution or on crystallography place inactivated mmp-1 catalytic and hpx domains side - by - side , with the collagen triple helix bridging between them ( cyan in fig . the triple helix from collagen ii is anchored by inserting leucine at p10 into the s10 subsite in the hpx domain , but is not in a productive position with respect to catalytic domain . the authors proposed a 108 rotation of the triple helix about its longitudinal axis and a shift of one residue to move the triple helix into a productive mode of binding . these authors further suggested that a small bend of the triple helix from the rotation of the domains of mmp-1 combined with the local thermal instability of the collagen monomer could release a chain from the triple helix to insert into the active site cleft . the nmr - based model instead placed the collagen triple - helical peptide ( thp ) in a position already nearly productive for cleaving scissile bond . the high mobility between the domains of mmp-1 in solution has restriction imposed upon it by the binding of the thp , which is thought to draw the catalytic domain closer to the hpx domain . these authors proposed a subsequent rotation of the catalytic and hpx domains to their closed orientation in the crystal structure . this is consistent with the report of a phenylalanine from the hpx domain inserting into a pocket in the catalytic domain . this hugging of catalytic and hpx domains would result in the bending of the triple helix , which could release a chain from the triple helix to enter the catalytic cleft . finally , the mode of binding of the hydrolyzed , exposed chain may be represented by crystallographic snapshots of a cleaved peptide substrate with a collagen - based sequence within the active site of mmp-12 . simulations of the catalytic domain of mmp-2 bound to a collagen v - derived thp substrate predicted the chains of the triple helix to separate around the scissile gly leu linkage , coinciding with the mobile and deformable segment of the unbound thp . though simulations of two alternative thp chains inserted in the active site differed in the bend of the triple helix and occupation of the subsites , the patterns of hydrogen bonding between thp and mmp-2 were shared with each other and with many crystal structures of mmp complexes with peptide inhibitors . a chain drawn out of the triple helix and into the active site cleft is likely to traverse residues found important in digesting triple - helical collagen substrates : tyr210/189 in mmp-1 ; asn188 to tyr189 in mmp-8 ; and phe202 , thr210 , thr239 , and lys241 in mmp-12 . the hpx domain was originally postulated to fold over to sandwich the collagen triple helix between it and the catalytic domain , contrasting the side - by - side orientation observed in the mmp-1 complexes with thps . a very recent nmr solution structural model of a thp substrate bound to the hpx domain of mt1-mmp renews the possibility of the triple helix becoming sandwiched between its catalytic and hpx domains ( pdb i d : 2mqs ) . while the thp ( same sequence used by ) crosses the hpx domains of mt1-mmp and mmp-1 at the same angle , the scissile bond is shifted around 2.5 to 3 nm closer to the hpx domain of mt1-mmp , out of the apparent reach of the catalytic domain when the domains sit side - by - side ( fig . 1 ) . for the scissile bond to reach the active site of mt1-mmp , either of two conformational changes could achieve this : ( i ) the triple helix could slide ~2.5 nm if the domains lie side - by - side or perhaps more likely ( ii ) the catalytic domain could fold over the scissile bond region bound near the hpx to sandwich the triple helix between these domains of mt1-mmp ( fig . mmp-2 and mmp-9 instead rely mainly on their cbd , especially its second and third fibronectin ii - like modules , to support their activities towards soluble collagen monomers , including those from fibrillar collagens v and xi [ 6165 ] . the cbd is inserted in a loop at the primed end of the catalytic channel . the collagen binding sites lie at bowls in the fibronectin - like modules lined by hydrophobic residues [ 6770 ] . cbd binding of collagens may enable bending modes of motion of the triple helix , recently simulated , which may potentially facilitate unwinding of the triple helix . structure - function studies of elastolysis have focused on mmp-12 , mmp-2 , and mmp-9 and have mapped extensive binding sites for elastin . deposition of mmp-12 on elastin fibrils it digests was suggested both by this protease found bound to the damaged elastin fibrils of sections of aorta surgically removed from aneurysms and by experiments in vitro using mdms and elastin fibrils . the 36 sites identified suggest the most frequent sequence around the scissile bond to be : ala / gly at p2 , gly at p1 , leu at p1 , and gly at p2 . structural insights into elastin interactions with the mmp-12 catalytic domain , also known as macrophage elastase or metalloelastase , are the focus below . while solubilized elastin interacts with both catalytic and hpx domains of mmp-12 , the catalytic domain is sufficient for elastolysis by mmp-12 . ten residues on the periphery of the active site cleft were found to contribute to the specific activity of mmp-12 towards an enhanced elastin substrate and to distinguish it from other mmps ( fig . eight of these were located around the primed side of the active site that engages residues on the c - terminal side of the scissile bond , while two map to the unprimed side of the active site . the two residues nearest the catalytic center boost the rate of catalytic turnover of the elastin substrate , whereas the eight residues more distant instead enhance the km or apparent affinity . multiple elastin - derived peptides were proposed to bind the full length of the active site cleft of mmp-12 in an extended conformation . such modes of binding place peptides between the nine residues bordering the cleft implicated in elastolysis ( fig . 2 , green ) . however , ~10-fold longer elastin peptides also protected much more extensive and remote surfaces of the catalytic domain from a paramagnetic nmr probe , including a swath across the -sheet and broad patch most distant from the catalytic cleft . such far more extensive interactions could help explain the embedding of mmp-12 among the degraded fibrils from aneurysms . two patches of residues on either end of the elastin - binding patch on the -sheet were found to enhance elastin degradation : exosite 1 containing four confirmed residues and exosite 2 containing two confirmed residues ( fig . the importance of both exosites was underscored by one mutation in each exosite plus one in the active site combining to drop elastin - degrading activity to the level of mmp-3 considered poorly elastolytic . major achievements have thus been realized regarding the diffusion of mmps on collagen fibrils , the binding of collagen and elastin to exosites of mmps , and the means of mmp - catalyzed opening of collagen for digestion . | most abundant in the extracellular matrix are collagens , joined by elastin that confers elastic recoil to the lung , aorta , and skin .
these fibrils are highly resistant to proteolysis but can succumb to a minority of the matrix metalloproteinases ( mmps ) .
considerable inroads to understanding how such mmps move to the susceptible sites in collagen and then unwind the triple helix of collagen monomers have been gained . the essential role in unwinding of the hemopexin - like domain of interstitial collagenases or the collagen binding domain of gelatinases
is highlighted .
elastolysis is also facilitated by the collagen binding domain in the cases of mmp-2 and mmp-9 , and remote exosites of the catalytic domain in the case of mmp-12 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
comorbidity is conceptualized differently depending on whether the perspective is clinical , epidemiologic , or health policy based . traditionally , comorbidity refers to the total burden of illness other than the index disease of interest , and typically focuses on chronic conditions . this definition excludes complications that are a direct result of the index disease . while both comorbidity and complications may influence outcomes , their etiologies and types of interventions , we focus on comorbidity . for some conditions , such as immune - mediated neurologic disease , it may be difficult to determine whether 2 distinct conditions exist ( that is , ms and another condition ) or not ( that is , the other condition alone or ms alone ) , but such diagnostic decisions are not the focus of this article . we also recognize that for some conditions , such as depression or anxiety , it may be difficult to distinguish between comorbidity and complication or symptom of disease . however , we have chosen to consider these conditions as comorbidities rather than symptoms of ms because in some individuals they appear to occur independent of ms , such as when onset is many years before clinical onset of ms , multiple factors may contribute to depression or anxiety in ms , which may or may not be ms - related , such as genetic factors or psychosocial stressors , and they have specific diagnostic criteria , unlike symptoms such as fatigue . however , behaviors such as smoking and alcohol intake affect the risks of , and outcomes of , chronic diseases , including ms . in other diseases , such as lung cancer , health behaviors such as smoking have independent effects on outcomes . therefore , we considered health behaviors as a type of comorbidity rather than simple confounders when making our recommendations . conditions may co - occur due to chance , or be more likely to be diagnosed because of increased health system contacts due to the presence of a chronic condition . of greater interest is the co - occurrence of disease due to etiologic mechanisms such as direct causation , associated risk factors , heterogeneity , and independence . in direct causation , one condition leads directly to another condition , as observed when idiopathic thrombocytopenic purpura arises from the use of alemtuzumab to treat ms . smoking may underlie the increased prevalence of lung disease in ms as persons with ms smoke more than the general population . in heterogeneity , independent factors such as age may be associated with co - occurrence of disease . finally , 2 conditions may coexist because they are secondary to a third , undiagnosed disease ( independence ) . for example , asthma and peripheral neuropathy might both be due to churg - strauss syndrome . such mechanistic questions are relevant to understanding comorbidity in ms , but were not the focus of our deliberations . comorbidity is one of several patient characteristics , including genetics , age , sex , race , ethnicity , and socioeconomic status , which are relevant to the clinical presentation and management of ms . socioeconomic status appears to account for some of the disparity in disability observed between african americans and caucasian americans with ms . age , for example , is a critical determinant of the degree of disability experienced by persons with ms , suggesting that progressive ms represents an age - related neurodegenerative process . comorbidities such as hypertension , diabetes , and hyperlipidemia also increase in frequency with age , and can be conceptualized to accelerate brain aging , potentially accelerating disability progression in ms . research regarding comorbidity can be grouped into the following areas : the incidence and prevalence of comorbidity ; the effect of comorbidity on the affected individual , health system , and society ; the mechanisms underlying the frequency of comorbidity and its effect ; and evaluation of interventions to prevent comorbidities or to reduce their impact . preparatory to the workshop , we surveyed experts regarding their views of the most relevant comorbidities and health behaviors to evaluate with respect to incidence , prevalence , and their effect on ms outcomes . survey design and results are detailed in appendices e-1 and e-2 on the neurology web site at neurology.org . the top 3 comorbidities deemed to be in greatest need of study with respect to their effect on outcomes were psychiatric disorders , cancer , and autoimmune disease ; the top 3 health behaviors were substance use , alcohol use , and diet . the most important research gaps identified were comorbidity as a prognostic factor for ms outcomes , followed by estimates of the frequency of comorbidity . with respect to health behaviors , the most important research gaps identified were their roles as prognostic factors for ms , followed by their effect on pharmacotherapy . preparatory to the workshop , we reviewed the world ( english - language ) literature regarding the incidence and prevalence of comorbidity in ms . based on meta - analyses of population - based studies , the comorbidities with the highest incidence were hypertension ( 3.73% ; 95% confidence interval [ ci ] 3.434.06% ) , stroke ( 2.73% ; 95% ci 2.512.95% ) , and cancer ( any cancer 4.3% ; 95% ci 2.676.1 ) ; however , population - based studies were lacking for many conditions . the most prevalent comorbidities were depression ( 23.7% ; 95% ci 17.430.0% ) , anxiety ( 21.9% ; 95% ci 8.7635.0% ) , hypertension ( 18.6% ; 95% ci 13.923.2% ) , hyperlipidemia ( 10.9% ; 95% ci 5.616.1% ) , and chronic lung disease ( 10.0% ; 95% ci 020.9% ) . several comorbidities occur more often in the ms population than the general population , including depression , anxiety , bipolar disorder , alcohol abuse , stroke , ischemic heart disease , inflammatory bowel disease , irritable syndrome , seizure disorders , and sleep disorders . valid , reliable estimates of the incidence and prevalence of comorbidity in ms are needed to inform the design of studies assessing the impact of comorbidity , support pharmacovigilance efforts , and direct clinical programs aimed at mitigating the impact of comorbidity . however , we identified gaps in knowledge regarding the epidemiology of comorbidity in ms . first , most studies were conducted in few geographic regions , mainly western europe and north america . given worldwide variation in the burden of many chronic diseases , second , estimates of the incidence and prevalence of comorbidity varied widely , likely due to heterogeneity in study design , bias , and true differences between populations . common limitations included the failure to report diagnostic criteria or validation of the approach used to identify the ms population or the comorbidity , lack of information regarding the time period when the study was conducted , and lack of a population - based design . thus , homogeneous and more rigorous study designs are needed to clarify the true variation in incidence and prevalence of comorbidity across regions and sociodemographic groups . reporting of age , sex , and ethnicity - specific estimates , and standardization of findings to a common population , would also improve comparability of study findings . third , many potentially relevant comorbidities were infrequently evaluated . finally , although many studies evaluated the incidence and prevalence of multiple comorbidities , the relationship of these comorbidities to one another was rarely considered . with increasing age , the prevalence of comorbidity increases in ms , typically when disability is also accumulating . therefore , the effect of comorbidity on ms is likely to be important as ms progresses . preparatory to the workshop , we also systematically reviewed the association of comorbidity with outcomes commonly reported in clinical trials ( relapses , disability , functional status , cognition , mri outcomes , pain , and fatigue ; for methods , see appendix e-3 ) . we chose the same comorbidities as those considered in our systematic review of the incidence and prevalence of comorbidity in ms . we identified 35 publications from 32 unique studies ( table e-1 and appendix e-3 ) . most studies evaluated psychiatric comorbidities ( 17 ) or vascular comorbidities , including diabetes , hypertension , hyperlipidemia , ischemic heart disease , and peripheral vascular disease ( 6 ) . depression , anxiety , and sleep disorders are consistently associated with the presence and severity of fatigue . depression is also associated with impaired cognitive function , but not relapses or disability . the presence of physical comorbidities is associated with greater disability at the time of ms diagnosis ; the effect increased with an increasing number of comorbidities . serum lipid measurements not necessarily meeting criteria for dyslipidemia have been associated with new hyperintense and contrast - enhancing lesions on mri , and with disability progression , but not with relapses . however , most potentially relevant comorbidities have not been studied and we identified few population - based studies . definitions of comorbidities differed across studies , and most studies did not consider the potential confounding effects of treatment of the comorbidities on outcome . many studies were cross - sectional , precluding causal inferences . finally , it was often unclear if outcomes were assessed blind to comorbidity status . future studies should be longitudinal , and need to enroll representative populations , use validated methods to assess comorbidity status and outcome , and assess potential confounding factors . nearly 50% of persons with ms report ever smoking before ms symptom onset , and up to 39% actively smoke at the time of ms symptom onset . the prevalence of definite or probable alcohol abuse or dependence ranges from 3.96% to 18.2% . excessive weight and obesity are highly prevalent in the ms population , affecting nearly 50% of individuals . although some inconsistencies exist , smoking appears to be associated with more rapid disability progression , accumulation of hyperintense lesions on mri , and greater brain atrophy . in a cross - sectional study of 423 persons with ms , those who consumed alcohol for 15 years or less after ms onset had lower disability on the expanded disability status scale ( edss ) and higher brain volume than those who did not consume alcohol or who consumed it for more than 15 years . in a belgian study of 1,372 persons with ms , moderate alcohol consumption was associated with a reduced risk of progression to an edss score of 6.0 ( cane ) . in the north american research committee on multiple sclerosis ( narcoms ) cohort , obesity was associated with an increased likelihood of presenting with a relapsing , rather than progressive , course at onset among women , independent of age . in a cohort of australians , body mass index an important limitation is that most of these studies considered the effect of only one health behavior on outcome , and did not consider the confounding effects of comorbidity . future observational studies would benefit from considering the effects of comorbidities and health behaviors concurrently , and should attempt to disentangle the direction of causation between comorbidity and ms outcomes . another important unknown is whether there are interactions among co - occurring comorbidities and health behaviors leading to additive or synergistic effects on outcomes . metabolic syndrome , for example , is diagnosed when any 3 of the following are present : abdominal obesity , hypertension , elevated fasting glucose , high serum triglycerides , and low high - density lipoprotein level . it is also unknown whether the timing of the development of a comorbidity , its severity , or its treatments are relevant to its effects . preparatory to the workshop , we reviewed the world ( english - language ) literature regarding the incidence and prevalence of comorbidity in ms . based on meta - analyses of population - based studies , the comorbidities with the highest incidence were hypertension ( 3.73% ; 95% confidence interval [ ci ] 3.434.06% ) , stroke ( 2.73% ; 95% ci 2.512.95% ) , and cancer ( any cancer 4.3% ; 95% ci 2.676.1 ) ; however , population - based studies were lacking for many conditions . the most prevalent comorbidities were depression ( 23.7% ; 95% ci 17.430.0% ) , anxiety ( 21.9% ; 95% ci 8.7635.0% ) , hypertension ( 18.6% ; 95% ci 13.923.2% ) , hyperlipidemia ( 10.9% ; 95% ci 5.616.1% ) , and chronic lung disease ( 10.0% ; 95% ci 020.9% ) . several comorbidities occur more often in the ms population than the general population , including depression , anxiety , bipolar disorder , alcohol abuse , stroke , ischemic heart disease , inflammatory bowel disease , irritable syndrome , seizure disorders , and sleep disorders . valid , reliable estimates of the incidence and prevalence of comorbidity in ms are needed to inform the design of studies assessing the impact of comorbidity , support pharmacovigilance efforts , and direct clinical programs aimed at mitigating the impact of comorbidity . however , we identified gaps in knowledge regarding the epidemiology of comorbidity in ms . first , most studies were conducted in few geographic regions , mainly western europe and north america . given worldwide variation in the burden of many chronic diseases , second , estimates of the incidence and prevalence of comorbidity varied widely , likely due to heterogeneity in study design , bias , and true differences between populations . common limitations included the failure to report diagnostic criteria or validation of the approach used to identify the ms population or the comorbidity , lack of information regarding the time period when the study was conducted , and lack of a population - based design . thus , homogeneous and more rigorous study designs are needed to clarify the true variation in incidence and prevalence of comorbidity across regions and sociodemographic groups . reporting of age , sex , and ethnicity - specific estimates , and standardization of findings to a common population , would also improve comparability of study findings . third , many potentially relevant comorbidities were infrequently evaluated . finally , although many studies evaluated the incidence and prevalence of multiple comorbidities , the relationship of these comorbidities to one another was rarely considered . with increasing age , the prevalence of comorbidity increases in ms , typically when disability is also accumulating . therefore , the effect of comorbidity on ms is likely to be important as ms progresses . preparatory to the workshop , we also systematically reviewed the association of comorbidity with outcomes commonly reported in clinical trials ( relapses , disability , functional status , cognition , mri outcomes , pain , and fatigue ; for methods , see appendix e-3 ) . we chose the same comorbidities as those considered in our systematic review of the incidence and prevalence of comorbidity in ms . we identified 35 publications from 32 unique studies ( table e-1 and appendix e-3 ) . most studies evaluated psychiatric comorbidities ( 17 ) or vascular comorbidities , including diabetes , hypertension , hyperlipidemia , ischemic heart disease , and peripheral vascular disease ( 6 ) . depression , anxiety , and sleep disorders are consistently associated with the presence and severity of fatigue . the presence of physical comorbidities is associated with greater disability at the time of ms diagnosis ; the effect increased with an increasing number of comorbidities . serum lipid measurements not necessarily meeting criteria for dyslipidemia have been associated with new hyperintense and contrast - enhancing lesions on mri , and with disability progression , but not with relapses . however , most potentially relevant comorbidities have not been studied and we identified few population - based studies . definitions of comorbidities differed across studies , and most studies did not consider the potential confounding effects of treatment of the comorbidities on outcome . many studies were cross - sectional , precluding causal inferences . finally , it was often unclear if outcomes were assessed blind to comorbidity status . future studies should be longitudinal , and need to enroll representative populations , use validated methods to assess comorbidity status and outcome , and assess potential confounding factors . nearly 50% of persons with ms report ever smoking before ms symptom onset , and up to 39% actively smoke at the time of ms symptom onset . the prevalence of definite or probable alcohol abuse or dependence ranges from 3.96% to 18.2% . excessive weight and obesity are highly prevalent in the ms population , affecting nearly 50% of individuals . although some inconsistencies exist , smoking appears to be associated with more rapid disability progression , accumulation of hyperintense lesions on mri , and greater brain atrophy . in a cross - sectional study of 423 persons with ms , those who consumed alcohol for 15 years or less after ms onset had lower disability on the expanded disability status scale ( edss ) and higher brain volume than those who did not consume alcohol or who consumed it for more than 15 years . in a belgian study of 1,372 persons with ms , moderate alcohol consumption was associated with a reduced risk of progression to an edss score of 6.0 ( cane ) . in the north american research committee on multiple sclerosis ( narcoms ) cohort , obesity was associated with an increased likelihood of presenting with a relapsing , rather than progressive , course at onset among women , independent of age . in a cohort of australians , body mass index an important limitation is that most of these studies considered the effect of only one health behavior on outcome , and did not consider the confounding effects of comorbidity . future observational studies would benefit from considering the effects of comorbidities and health behaviors concurrently , and should attempt to disentangle the direction of causation between comorbidity and ms outcomes . another important unknown is whether there are interactions among co - occurring comorbidities and health behaviors leading to additive or synergistic effects on outcomes . metabolic syndrome , for example , is diagnosed when any 3 of the following are present : abdominal obesity , hypertension , elevated fasting glucose , high serum triglycerides , and low high - density lipoprotein level . it is also unknown whether the timing of the development of a comorbidity , its severity , or its treatments are relevant to its effects . preparatory to the workshop , we reviewed the world ( english - language ) literature regarding the incidence and prevalence of comorbidity in ms . based on meta - analyses of population - based studies , the comorbidities with the highest incidence were hypertension ( 3.73% ; 95% confidence interval [ ci ] 3.434.06% ) , stroke ( 2.73% ; 95% ci 2.512.95% ) , and cancer ( any cancer 4.3% ; 95% ci 2.676.1 ) ; however , population - based studies were lacking for many conditions . the most prevalent comorbidities were depression ( 23.7% ; 95% ci 17.430.0% ) , anxiety ( 21.9% ; 95% ci 8.7635.0% ) , hypertension ( 18.6% ; 95% ci 13.923.2% ) , hyperlipidemia ( 10.9% ; 95% ci 5.616.1% ) , and chronic lung disease ( 10.0% ; 95% ci 020.9% ) . several comorbidities occur more often in the ms population than the general population , including depression , anxiety , bipolar disorder , alcohol abuse , stroke , ischemic heart disease , inflammatory bowel disease , irritable syndrome , seizure disorders , and sleep disorders . valid , reliable estimates of the incidence and prevalence of comorbidity in ms are needed to inform the design of studies assessing the impact of comorbidity , support pharmacovigilance efforts , and direct clinical programs aimed at mitigating the impact of comorbidity . however , we identified gaps in knowledge regarding the epidemiology of comorbidity in ms . first , most studies were conducted in few geographic regions , mainly western europe and north america . given worldwide variation in the burden of many chronic diseases , second , estimates of the incidence and prevalence of comorbidity varied widely , likely due to heterogeneity in study design , bias , and true differences between populations . common limitations included the failure to report diagnostic criteria or validation of the approach used to identify the ms population or the comorbidity , lack of information regarding the time period when the study was conducted , and lack of a population - based design . thus , homogeneous and more rigorous study designs are needed to clarify the true variation in incidence and prevalence of comorbidity across regions and sociodemographic groups . reporting of age , sex , and ethnicity - specific estimates , and standardization of findings to a common population , would also improve comparability of study findings . third , many potentially relevant comorbidities were infrequently evaluated . finally , although many studies evaluated the incidence and prevalence of multiple comorbidities , the relationship of these comorbidities to one another was rarely considered . with increasing age , the prevalence of comorbidity increases in ms , typically when disability is also accumulating . therefore , the effect of comorbidity on ms is likely to be important as ms progresses . preparatory to the workshop , we also systematically reviewed the association of comorbidity with outcomes commonly reported in clinical trials ( relapses , disability , functional status , cognition , mri outcomes , pain , and fatigue ; for methods , see appendix e-3 ) . we chose the same comorbidities as those considered in our systematic review of the incidence and prevalence of comorbidity in ms . we identified 35 publications from 32 unique studies ( table e-1 and appendix e-3 ) . most studies evaluated psychiatric comorbidities ( 17 ) or vascular comorbidities , including diabetes , hypertension , hyperlipidemia , ischemic heart disease , and peripheral vascular disease ( 6 ) . depression , anxiety , and sleep disorders are consistently associated with the presence and severity of fatigue . the presence of physical comorbidities is associated with greater disability at the time of ms diagnosis ; the effect increased with an increasing number of comorbidities . serum lipid measurements not necessarily meeting criteria for dyslipidemia have been associated with new hyperintense and contrast - enhancing lesions on mri , and with disability progression , but not with relapses . however , most potentially relevant comorbidities have not been studied and we identified few population - based studies . definitions of comorbidities differed across studies , and most studies did not consider the potential confounding effects of treatment of the comorbidities on outcome . many studies were cross - sectional , precluding causal inferences . finally , it was often unclear if outcomes were assessed blind to comorbidity status . future studies should be longitudinal , and need to enroll representative populations , use validated methods to assess comorbidity status and outcome , and assess potential confounding factors . nearly 50% of persons with ms report ever smoking before ms symptom onset , and up to 39% actively smoke at the time of ms symptom onset . the prevalence of definite or probable alcohol abuse or dependence ranges from 3.96% to 18.2% . excessive weight and obesity are highly prevalent in the ms population , affecting nearly 50% of individuals . although some inconsistencies exist , smoking appears to be associated with more rapid disability progression , accumulation of hyperintense lesions on mri , and greater brain atrophy . in a cross - sectional study of 423 persons with ms , those who consumed alcohol for 15 years or less after ms onset had lower disability on the expanded disability status scale ( edss ) and higher brain volume than those who did not consume alcohol or who consumed it for more than 15 years . in a belgian study of 1,372 persons with ms , moderate alcohol consumption was associated with a reduced risk of progression to an edss score of 6.0 ( cane ) . in the north american research committee on multiple sclerosis ( narcoms ) cohort , obesity was associated with an increased likelihood of presenting with a relapsing , rather than progressive , course at onset among women , independent of age . in a cohort of australians , body mass index was not associated with relapse risk , but was associated with greater disability . an important limitation is that most of these studies considered the effect of only one health behavior on outcome , and did not consider the confounding effects of comorbidity . future observational studies would benefit from considering the effects of comorbidities and health behaviors concurrently , and should attempt to disentangle the direction of causation between comorbidity and ms outcomes . another important unknown is whether there are interactions among co - occurring comorbidities and health behaviors leading to additive or synergistic effects on outcomes . metabolic syndrome , for example , is diagnosed when any 3 of the following are present : abdominal obesity , hypertension , elevated fasting glucose , high serum triglycerides , and low high - density lipoprotein level . it is also unknown whether the timing of the development of a comorbidity , its severity , or its treatments are relevant to its effects . potential sources of comorbidity data include self - report , medical records , and administrative databases . briefly , the validity and reliability of self - reported comorbidity in ms varies by condition . accuracy is high for chronic conditions that are well - defined , require ongoing care , or cause disability . self - report is less accurate for conditions where diagnostic criteria are less precise , such as arthritis , and may vary in accuracy by sociodemographic characteristics . the medical record offers information about comorbidity and ms , including disability status , and treatments used when multiple health care providers are involved , it may be difficult to access complete information . therefore , medical records reviews are often not feasible for large , population - based studies . depending on the data sources used to construct a clinical database , they may be subject to the aforementioned limitations of self - report , medical records , or both . administrative data are obtained from enrolment into public and commercial health insurance plans as well as through the delivery of , and reimbursement for , health care services . these data generally include demographic characteristics including a personal identification number , date of birth , sex , and region of residence , but race is often lacking . most administrative datasets capture hospital and physician encounters , including the dates of service and diagnostic and procedure codes for the service delivered . widespread use of icd codes may facilitate the conduct of similar comorbidity studies in multiple jurisdictions ; however , the customization of icd-10 in many countries threatens data comparability . in many jurisdictions , administrative claims data are population - based , accessible , and cost - effective as compared to other data sources . however , their validity for research must be assessed , and clinical details are lacking . the potential applications to comorbidity research are broad , including comorbidity surveillance , pharmacovigilance , and evaluation of the effect of comorbidity on health care utilization . appendix e-4 describes potentially useful datasets that include ms - relevant comorbidity and health behavior data , worldwide . while the validity of some of these datasets for ms research is established , further work is necessary to validate others . analytically , comorbidity can be classified as a count of conditions , using an index , or by considering individual comorbidities . a count is the simplest to obtain and is associated with outcomes such as health care utilization , but treats all comorbidities as equal . some indices have been developed for use in specific populations or for specific outcomes ( e.g. , mortality ) ; relative performance varies across populations and outcomes . none has been developed for use in ms , and existing indices may be inappropriate for ms . for example , the elixhauser index captures paraplegia , and other neurologic disorders ( including ms ) , potentially confounding ms severity with comorbidity . consideration of individual comorbidities provides more opportunity to understand interactions between comorbidities , but requires larger samples . analytically , comorbidity can be classified as a count of conditions , using an index , or by considering individual comorbidities . a count is the simplest to obtain and is associated with outcomes such as health care utilization , but treats all comorbidities as equal . some indices have been developed for use in specific populations or for specific outcomes ( e.g. , mortality ) ; relative performance varies across populations and outcomes . none has been developed for use in ms , and existing indices may be inappropriate for ms . for example , the elixhauser index captures paraplegia , and other neurologic disorders ( including ms ) , potentially confounding ms severity with comorbidity . consideration of individual comorbidities provides more opportunity to understand interactions between comorbidities , but requires larger samples . following presentations that reviewed the findings of the international survey , systematic reviews , and issues related to the measurement and analysis of comorbidities , we held small group sessions to reach consensus regarding recommendations for future research . recognizing that there would be challenges in studying all comorbidities in the short term , the charge to the small groups for the first and second recommendations was to prioritize 5 comorbidities , but these recommendations are not intended to discourage work that evaluates other comorbidities.establish age - specific , sex - specific , and ideally race / ethnicity - specific incidence and prevalence estimates for priority comorbidities in the ms population . based on several considerations , we prioritized 5 comorbidities for future studies of their incidence and prevalence in ms , including depression , anxiety , hypertension , diabetes , and hyperlipidemia ( table e-2 ) . first , existing literature or clinical experience suggested they were prevalent in the ms population ( depression , anxiety , hypertension , hyperlipidemia ) . second , little or no information was available regarding their incidence ( all ) , or regarding age- and sex - specific estimates of their incidence and prevalence ( all ) . third , these conditions may affect the risk of ms or differential outcomes in ms , and are potentially treatable ( all ) . given the existence of some population - based data regarding the incidence of autoimmune disease and the low prevalence of many autoimmune diseases in ms , these conditions were given a lower priority.evaluate the effect of priority comorbidities on ms outcomes that are relevant from the perspective of the clinician , affected individual , health system , and society . due to difficulties reaching consensus regarding the top 5 comorbidities , we prioritized 7 comorbidities for observational studies of the effect of comorbidity on ms outcomes , including depression , anxiety , hypertension , diabetes , hyperlipidemia , chronic lung disease , and autoimmune diseases . when selecting these comorbidities , physiologic and biological relevance to ms , existing knowledge regarding their effects on outcomes in ms , and their prevalence in the ms population given its low prevalence , cancer was not prioritized , but was considered highly relevant for clinical trials . smoking , obesity , and physical activity were also considered priorities for both types of studies . however , future investigations should not be limited to these conditions . preferred outcomes are summarized in table e-2.include potential confounders or effect modifiers as covariates in studies of the effect of comorbidity on ms outcomes . key covariates include age , sex , race / ethnicity , socioeconomic status , and disease duration.design observational studies that have strong methodologic features . given the methodologic limitations of the existing literature , we emphasized the importance of sound study design . we recognized that multiple data sources could be used to address these questions , but the validity of the methods used to assess comorbidity and the outcomes of interest are critical , along with inclusion of a representative study population . specific efforts are needed to develop an ms - specific comorbidity index.harmonize measurement of key data elements such as sex , race / ethnicity , clinical course , comorbidity , and ms diagnostic criteria , and use common outcome measures to facilitate pooling and comparison of study findings . such approaches are supported by the national institute of neurological disorders and stroke common data elements project.follow published guidelines when reporting study findings . to be useful , observational studies need to be methodologically sound and be reported well . reporting guidelines aim to improve the quality of reporting in observational studies , which is often poor , as is also true in the ms comorbidity literature . the strengthening the reporting of observational studies in epidemiology statement provides guidelines for observational studies in general , while the standards of reporting of neurologic disorders checklist provides guidelines for reporting incidence and prevalence studies in neurologic disease.conduct observational studies of comorbidity in ms in all world regions . since much of the comorbidity literature has arisen from few world regions and heterogeneity in ms outcomes is well - recognized , it is critical that investigators in areas beyond western europe and north america be supported to conduct studies in their regions.explore the mechanisms of the effects of comorbidity on ms as a means of identifying potential approaches to mitigating their impact . this will require considering direct biological effects such as accelerated neurodegeneration ( as might be assessed using measures of brain atrophy ) or enhanced peripheral immune activation ( as might be assessed by measuring cytokine profiles or immune cell behavior ) , and indirect effects such as diagnostic delays or differences in ms treatment or treatment responses.conduct clinical trials of the effect of comorbidity treatment on ms . in other diseases , there are comorbidity - based differences in disease management . for example , hypertension targets are lower in diabetic patients than in patients without diabetes to reduce the risk of diabetes - associated complications . observational studies of the incidence and prevalence of comorbidity and of the effect of comorbidity on outcomes in ms are needed to inform the design of these trials . establish age - specific , sex - specific , and ideally race / ethnicity - specific incidence and prevalence estimates for priority comorbidities in the ms population . based on several considerations , we prioritized 5 comorbidities for future studies of their incidence and prevalence in ms , including depression , anxiety , hypertension , diabetes , and hyperlipidemia ( table e-2 ) . first , existing literature or clinical experience suggested they were prevalent in the ms population ( depression , anxiety , hypertension , hyperlipidemia ) . second , little or no information was available regarding their incidence ( all ) , or regarding age- and sex - specific estimates of their incidence and prevalence ( all ) . third , these conditions may affect the risk of ms or differential outcomes in ms , and are potentially treatable ( all ) . given the existence of some population - based data regarding the incidence of autoimmune disease and the low prevalence of many autoimmune diseases in ms , these conditions were given a lower priority . evaluate the effect of priority comorbidities on ms outcomes that are relevant from the perspective of the clinician , affected individual , health system , and society . due to difficulties reaching consensus regarding the top 5 comorbidities , we prioritized 7 comorbidities for observational studies of the effect of comorbidity on ms outcomes , including depression , anxiety , hypertension , diabetes , hyperlipidemia , chronic lung disease , and autoimmune diseases . when selecting these comorbidities , physiologic and biological relevance to ms , existing knowledge regarding their effects on outcomes in ms , and their prevalence in the ms population given its low prevalence , cancer was not prioritized , but was considered highly relevant for clinical trials . smoking , obesity , and physical activity were also considered priorities for both types of studies . however , future investigations should not be limited to these conditions include potential confounders or effect modifiers as covariates in studies of the effect of comorbidity on ms outcomes . key covariates include age , sex , race / ethnicity , socioeconomic status , and disease duration . design observational studies that have strong methodologic features . given the methodologic limitations of the existing literature , we emphasized the importance of sound study design . we recognized that multiple data sources could be used to address these questions , but the validity of the methods used to assess comorbidity and the outcomes of interest are critical , along with inclusion of a representative study population . harmonize measurement of key data elements such as sex , race / ethnicity , clinical course , comorbidity , and ms diagnostic criteria , and use common outcome measures to facilitate pooling and comparison of study findings . such approaches are supported by the national institute of neurological disorders and stroke common data elements project . reporting guidelines aim to improve the quality of reporting in observational studies , which is often poor , as is also true in the ms comorbidity literature . the strengthening the reporting of observational studies in epidemiology statement provides guidelines for observational studies in general , while the standards of reporting of neurologic disorders checklist provides guidelines for reporting incidence and prevalence studies in neurologic disease . conduct observational studies of comorbidity in ms in all world regions . since much of the comorbidity literature has arisen from few world regions and heterogeneity in ms outcomes is well - recognized , it is critical that investigators in areas beyond western europe and north america be supported to conduct studies in their regions . explore the mechanisms of the effects of comorbidity on ms as a means of identifying potential approaches to mitigating their impact . this will require considering direct biological effects such as accelerated neurodegeneration ( as might be assessed using measures of brain atrophy ) or enhanced peripheral immune activation ( as might be assessed by measuring cytokine profiles or immune cell behavior ) , and indirect effects such as diagnostic delays or differences in ms treatment or treatment responses . in other diseases , there are comorbidity - based differences in disease management . for example , hypertension targets are lower in diabetic patients than in patients without diabetes to reduce the risk of diabetes - associated complications . observational studies of the incidence and prevalence of comorbidity and of the effect of comorbidity on outcomes in ms are needed to inform the design of these trials . the corresponding author ( r.a.m . ) takes responsibility for the integrity of the data and the accuracy of the data analysis . funded in part by the national multiple sclerosis society , ectrims , a don paty career development award from the ms society of canada ( to r.a.m . ) , and a manitoba research chair from research manitoba ( to r.a.m . ) . the funding sources had no role in the study design , collection , analysis , or interpretation of the data , or in the decision to submit the article for publication . the international workshop on comorbidity in multiple sclerosis was organized under the auspices of the international advisory committee on clinical trials in multiple sclerosis . the conference and the activities of the committee were funded by the european committee for treatment and research in multiple sclerosis and the us national multiple sclerosis society . marrie receives research funding from the canadian institutes of health research , public health agency of canada , manitoba health research council , health sciences centre foundation , multiple sclerosis society of canada , multiple sclerosis scientific foundation , and rx & d health research foundation ; and has conducted clinical trials funded by sanofi - aventis . a. miller has received research support from novartis , genentech , genzyme , sanofi - aventis , biogen idec , roche , and mallinckrodt ( questcor ) ; personal consulting fees from genzyme / sanofi - aventis , biogen idec , glaxo smith kline , emd serono ( merck serono ) , mallinckrodt , novartis , acorda , accordant health services , teva , roche , alkermes , genentech , and caremark ( accordant health care ) ; and speaker honoraria from biogen idec ( unbranded disease awareness programs only ) . m. sormani received consultation fees from biogen , novartis , merck serono , teva , genzyme , roche , and synthon . a. thompson has received honoraria / support for travel for consultancy from biogen idec , medday , eisai , and novartis , and for teaching from excemed , novartis , and teva . he receives an honorarium from sage publications as editor - in - chief of multiple sclerosis journal . e. waubant receives research funding from the nih , the nmss , and the race to erase ms . she has received honorarium or travel support from actrims , ectrims , and the aan . m. trojano has served on scientific advisory boards for biogen idec , novartis , and genzyme ; has received speaker honoraria from biogen - idec , sanofi aventis , merck - serono , teva , novartis , and almirall ; and has received research grants for her institution from biogen - idec , merck - serono , and novartis . p. o'connor , k. fiest , and n. reider report no disclosures relevant to the manuscript . s. reingold reports personal consulting fees from the national multiple sclerosis society ( nmss ) and the european committee for treatment and research in multiple sclerosis ( ectrims ) during the conduct of this work ; and personal consulting fees from bayer healthcare , biogen idec , coronado biosciences inc . , the cleveland clinic foundation , eli lilly & company , emd serono , merck serono , genentech , f. hoffmann - laroche , ironwood pharmaceuticals inc . , , novartis pharmaceuticals corporation , observatoire franais de la sclrosis en plaques , opexa therapeutics , sanofi - aventis , sk biopharmaceuticals , synthon pharmaceuticals inc . , teva pharmaceutical industries , and fondation pour l'aide la recherche sur la sclrosis en plaques , for activities outside of this work . j. cohen reports personal compensation for consulting from emd serono , genentech , genzyme , innate immunotherapeutics , novartis , and vaccinex . cohen receives research support paid to his institution from biogen idec , consortium of ms centers , us department of defense , genzyme , us national institutes of health , national ms society , novartis , receptos , synthon , teva , and vaccinex . | objective : to reach consensus about the most relevant comorbidities to study in multiple sclerosis ( ms ) with respect to incidence , prevalence , and effect on outcomes ; review datasets that may support studies of comorbidity in ms ; and identify ms outcomes that should be prioritized in such studies.methods:we held an international workshop to meet these objectives , informed by a systematic review of the incidence and prevalence of comorbidity in ms , and an international survey regarding research priorities for comorbidity.results:we recommend establishing age- and sex - specific incidence and prevalence estimates for 5 comorbidities ( depression , anxiety , hypertension , hyperlipidemia , and diabetes ) ; evaluating the effect of 7 comorbidities ( depression , anxiety , hypertension , diabetes , hyperlipidemia , chronic lung disease , and autoimmune diseases ) on disability , quality of life , brain atrophy and other imaging parameters , health care utilization , employment , and mortality , including age , sex , race / ethnicity , socioeconomic status , and disease duration as potential confounders ; harmonizing study designs across jurisdictions ; and conducting such studies worldwide .
ultimately , clinical trials of treating comorbidity in ms are needed.conclusion:our recommendations will help address knowledge gaps regarding the incidence , prevalence , and effect of comorbidity on outcomes in ms . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hypertension ( high blood pressure ) is a major risk factor for end organ disease such as stroke and renal failure . risk of end organ disease shows strong heritability that appears to arise independently of genetic factors affecting blood pressure . the recent application of genome wide association studies ( gwas ) to this problem has identified an unexplained gap of missing heritability , some of which may arise in regions of the genome in which extensive duplication has lead to concomitant emergence of both functional diversity and sequence complexity that is inadequately represented in gwas marker sets . one such region of the genome is the immunoglobulin heavy chain ( igh ) locus , a region encompassing approximately 5 mb in the rat . a recent effort to assess the success of high throughput genotyping systems to capture the extent of human igh locus genetic variation demonstrates the extreme degree of genetic diversity in this region and shows that genetic variation in the igh locus has been under - represented in human gwas . regions of the genome that are involved in host resistance to infection by simpler and more rapidly evolving pathogenic organisms may accumulate genetic variation that is subject to selection because it beneficially affects host - pathogen interaction . there are numerous examples of positive selection for alleles that provide important benefits to host - pathogen interaction , yet are potentially deleterious to overall health . for example , alleles at the major histocompatibility complex are associated with inflammatory diseases . the evolution of two distinct variants in human hemoglobin is associated with resistance to malaria infection but also creates susceptibility to sickle cell anemia . variation in and around apol1 is associated with resistance to trypanosome infection , but increases risk of hypertensive renal disease in individuals of african descent . thus , sometimes clearly deleterious health effects can arise in alleles subject to positive selection for host - pathogen resistance . a trigger mechanism may be needed to uncover the deleterious effects of a positively selected disease resistance allele . for example , type 1 diabetes in the rat can be induced by viral infection ( or polynucleotide viral dna mimics ) , but only in the presence of a susceptible genotype in the variable ( v ) genes of t - cell receptor beta gene locus . thus an initiating injury signal elicits disease only when the underlying immune response genotype is permissive . the spontaneously hypertensive rat ( shr ) is an inbred model of hypertension that exists in distinct lines in which susceptibility to hypertensive end organ damage ( stroke and kidney disease ) differs markedly across shr lines . in spite of shr lines arising from the same founder pair and sharing ~87% of the genome identical by descent , susceptibility to stroke and kidney disease are determined by underlying genetic variation . in our recent investigation of shr lines that contrast in end organ injury susceptibility , we mapped the igh locus as linked to large heritable variations in serum immunoglobulin levels . re - sequencing of the igh constant ( c ) gamma ( ighg ) genes across shr lines susceptible and resistant to hypertensive end - organ disease revealed high levels of amino acid substitution , including functional variation affecting interaction with immunoglobulin fc receptors . in studies of the f2 progeny of an shr - a3 x shr - b2 intercross , there is growing evidence for the involvement of immune mechanisms in stroke and renal disease , end organ diseases to which shr - a3 is susceptible , but which are resisted by shr - b2 . our prior targeted resequencing effort at the igh locus was restricted to the ighg genes , and we were unable to fully define the potential of the v , diversity ( d ) , joining ( j ) and ighc genes other than ighg to contribute to differences in disease susceptibility that may be attributable to functional variation in immunoglobulin repertoire across these two shr lines . we have obtained whole genome sequence data for these two shr lines that has allowed us to assemble a more complete view of genetic variation in the igh locus that reveals very high divergence between the two shr lines . illumina hiseq genomic sequencing reads for each shr line were aligned to the rat reference genome ( rn 3.4/rn4 ) . we used this assembly in preference to the rn5 assembly because many of the known brown - norway igh genes located in the rn4 assembly are not mapped in the rn5 assembly . mean aligned sequence coverage depth was 43.6 ( shr - a3 ) and 48.5 aligned reads per base ( shr - b2 ) . this is the highest density coverage yet reported for next generation sequencing of the rat genome . we have previously reported , using a 10k snp panel , that 87% of the genomes of shr - a3 and shr - b2 are descended from a single common ancestor . chromosome 6 contains only two such blocks of divergence , one in each in the telomeric regions . we previously used a high - density genome - wide snp panel to define the distal telomeric block as approximately centered on chr6:143.7 mb with average genome - wide resolution of block boundaries of ~2 mb , indicating an approximate position of chr6:141.3 mb to chr6:146.1 mb . detailed analysis of genetic variation between shr - a3 and shr - b2 using their assembled genome sequences allows this block to be refined with precision and we have determined that it extends between chr6:137,282,300144,673,200 . table 1 indicates the rn4 annotated rat genes located in this block , whether they contain non - synonymous sequence variation across shr - a3 and shr - b2 and whether there is evidence of mrna expression from these genes ( presence of mrna in ncbi gene database ) . of the 19 genes in this block , only 4 , including igh met these criteria . the igh locus was fully contained within this haplotype block and comprised 82% of the block . we examined the genome - wide extent of polymorphism between each of the shr rat lines and the reference genome . shr - a3 had 1 base change every 386 bases ( 2,590 base changes per mb ) while shr - b2 had 1 base change per 377 bases overall ( 2,652 base changes per mb ) . examination of the distribution of sequence divergence across the genome was performed by assessing the cumulative number of base changes per mb in overlapping 5 mb blocks across the genome ( i.e. , block 1 = chr 1:05 mb , block 2 = chr 1:26 mb , block 3 = chr1:37 mb , etc ) . the most divergent region of the genome in shr - b2 ( compared with the reference genome ) was identified as a 5 mb locus on the distal end of chromosome 6 ( 138143 mb ) in which there were 11,763 bases changes per mb . this divergence was 37.3% greater than the next most divergent locus in the shr - b2 genome and more divergent from the reference genome than any locus in shr - a3 . this most highly divergent locus aligns closely with the igh locus and fully contains all igh genes . in shr - a3 the same 5 mb block has 1,954 base changes per mb , making this locus slightly more similar to the rat reference genome than the genome - wide average for this rat line . this variation suggests that divergent evolution of this locus has occurred which may result in differences in the pre - immune immunoglobulin repertoire across these inbred rat lines . all available rattus norvegicus igh genes from igmt ( see methods ) were aligned to the rat reference sequence using the blat alignment tool . we examined the location of each reference gene for the presence of shr - a3 and shr - b2 genome sequence alignments that span the entirety of the gene . the absence of alignment or the presence of gaps in the alignment resulted in the designation of a null allele , likely attributable to structural variation in this highly segmentally duplicated region of the genome . supplemental figure 1 provides examples of the sequence alignment at several ighv genes that were called as null . we also sought the presence of simple sequence variations ( single nucleotide polymorphisms and indels ) . when variations were observed , we reconstructed the specific allele present in each rat line and assembled a table of all allelic variation ( supplemental table 1 ) . figure 1 provides a haplotype map indicating the distribution of alleles across the igh locus . allelic differences are summarized in table 2 , which indicates that 67.1% of igh genes existed as two or more alleles across the three inbred rat strains investigated . shr - a3 differed from the rat reference ( brown - norway , bn ) sequence across 144 genes , while shr - b2 differed from bn in 213 genes . we identified numerous changes in gene sequence that altered amino acid composition of encoded protein . the most marked change was the presence of a large number of null alleles in both shr - a3 and shr - b2 ( table 3 ) . in some instances this allelic loss was unique to either one or other of the two shr lines , in other instances both lines were null . the existence of extensive structural variation in the human igh locus has recently been described and includes haplotypes revealing complex rearrangements , segmental duplications and segmental losses . a complete description of the functional state in shr - a3 and shr - b2 , along with the amino acids affected by sequence change is provided in supplemental table 2 . one of the objectives of our study was to extend our prior descriptions of functional ighg variation across the two shr rat lines to include information regarding changes in the large remaining portion of this locus that we have not previously investigated . the extent of potentially functional sequence differences observed included amino acid alterations in 96 igh genes . this large degree of variation includes not only alleles at which one shr line is null , while the other has a functional allele , but also includes twelve alleles in which one or both of the shr lines possesses a potentially functional gene wherein the allele encoded in the reference bn sequence is a pseudogene . we have examined whether these twelve bn pseudogenes that lack a stop codon in shr - a3 or shr - b2 have retained functional recombination signal ( rs ) sequences necessary for their incorporation into an expressed immunoglobulin . in each case evidence of functionality will need to be extended to include expressed sequence before these genes can be considered with certainty to contribute to the pre - immune repertoire of shr lines . however , the data we have developed supports the identification of several functional alleles in shr - a3 and/or shr - b2 that are pseudogenes in bn . a complete and detailed catalog of the igh locus variation is provided in supplemental table 3 . in general , autoimmune diseases for which genetic susceptibility has been identified show association with three major gene groups : the major histocompatibility ( mh ) locus , t cell receptors ( tr ) and immunoglobulins ( ig ) . there is growing evidence of the involvement of inflammation and immunity in risk of hypertensive end organ disease . gene knockout studies showed that mice deficient in rag1 fail to demonstrate increased blood pressure response to deoxycorticosterone acetate or to angiotensin ii ( aii ) infusion and that renal injury is reduced in aii - dependent hypertension in lymphocyte - deficient mice . adoptive transfer of t regulatory lymphocytes reduces aii - mediated hypertension and renal damage . similarly in stroke , the other major end organ disease of shr - a3 , there is evidence of immune involvement . lymphocyte - deficient mice have much smaller infarcts in response to temporary middle cerebral artery occlusion ( mcao ) and better neurological mcao outcomes than intact controls . treatment with an immunosuppressant fty720 ( fingolimod ) reduced lymphocyte infiltration in mcao and decreased brain injury . the present study was motivated by our observation of remarkable sequence variation in ighg subclasses between two closely - related hypertensive rat lines was associated with susceptibility to cardiovascular end - organ disease . this observation raises the possibility that end - organ injury risk involves an autoimmune mechanism . however , we recognized that the ighg variation we sampled was likely to represent only a fraction of the potential genetic variation in the igh locus and that disease association might be attributable to other variation in this locus . because we lacked insight into the potential for variation across the rest of the igh locus to contribute to disease susceptibility we used whole genome sequencing to uncover additional genetic variation in this locus . one limitation to the use of next generation sequencing ( ngs ) is the reliance on a reference genome for alignment of the genome sequence reads . our observation that both shr - a3 and shr - b2 have substantial regions in the igh locus in which no alignment is observed indicates that structural variation may be an important source of variation in the genomic sequence at this locus . it also indicates that bn , nor any other single inbred rat strain , is likely to possess a complete repertoire of all rat igh coding genes . furthermore , shr - a3 and/or shr - b2 may contain additional igh genes that are absent in bn , and consequently have not emerged in the reference sequence alignment approach employed in these studies . though sequence complexity is an obstacle , it may be possible to identify additional igh genes by de novo sequence assembly from our next generation sequence reads . this possibility is enhanced by the very high density sequence coverage we obtained , though it may be challenged by the structural complexity of this locus . in regions of segmental duplication reliance solely on ngs alignment can reduce the accuracy with which the sequence can be assembled because both the subject and reference sequences may have regions that have been differently affected by segmental duplication and loss events . in some regions of the igh locus we noted that one or both of our rat lines showed assemblies that lacked aligned sequence reads while in other regions read coverage was much greater than the genome - wide average . supplemental figure 2 shows the distribution of sequence read coverage for shr - a3 and shr - b2 across the igh locus . the troughs and peaks in this distribution may reflect deletion and duplication events respectively . in some of the suspected duplicated regions in the igh locus we observed what appeared to be lack of homozygosity . if such duplication is absent in the reference sequence , reads from duplicated regions in the subject sequence may align across the sequence from which the duplicated region arose and apparent heterozygosity may reflect differential mutation across alignments that arise from duplicated segments that have subsequently diverged by mutation . the recent emergence of ngs methods producing long sequence reads may provide greater clarity regarding different duplication events across individual inbred strains . the distribution of coverage depth across the igh locus shares some similarity with the distribution of sequence variation ( supplemental figure 3 ) , notably in the proximal region of the locus . however , in more telomeric regions shr - b2 frequently shows very high levels of sequence divergence in regions while coverage depth does not suggest duplication as the predominant factor leading to divergence . the germline igh genes from the variable ( ighv ) , diversity ( ighd ) and joining ( ighj ) genes assemble by recombination during b cell genesis . this assembly furnishes individuals with immunoglobulin diversity that embodies the initial capacity to recognize antigens . initiation of adaptive immunity in the b cell lineage begins with this genetically determined pre - immune immunoglobulin repertoire . our studies show that the pre - immune repertoire is highly divergent among bn , shr - a3 ad shr - b2 . these differences may influence the initiation and development of antibody production directed at both external and self - antigens . a recent report in an inbred - mouse model of rheumatoid arthritis that involves auto - antibody targeting of collagen epitopes reveals that a haplotype involving two amino acid substitutions in a single ighv gene determines auto - reactive antibody production to antigen exposure , confirming the capacity of germline variation to be determinative of susceptibility in autoimmune disease . advances in high throughput sequencing are now being applied as a tool to characterize individual differences in antibody diversity both in the pre - immune repertoire and as immunity develops . although genetic risk of renal disease in shr is clearly polygenic and any single locus is unlikely to account for more than a part of risk , the association we have shown between hypertensive renal disease and germ - line variation in the igh locus provides a rationale to investigate immune mechanisms of hypertensive end organ disease . the pre - immune immunoglobulin repertoire provides the template for antibody selection that continues through a further process of immunoglobulin somatic mutation during b cell selection and is amplified by proliferation of the most reactive b cell clones . knowledge of the germ - line encoded pre - immune antibody repertoire provides the classification system needed to structure the enormously diverse range of immunoglobulin sequences that are developed in response to antigenic stimulation . examination of the expressed igh repertoire prior to and during the development of end organ disease may also provide a pathway to identify the antigens that provoke immune responses that drive disease . studies were performed on genomic dna isolated from the livers of inbred rats of the injury - prone spontaneously hypertensive line ( shr - a3 , shrsp / bbbutx ) that have been maintained in our facility for 15 years . we also used inbred rats from the injury - resistant shr - b2 line that were bred in our facility from stocks originating from colonies held at kinki university school of medicine , japan ( shr / utx ) . these two lines are derived from a single pair of founders common to both lines . these two inbred lines are ~87% genetically identical by descent ( ibd ) and this identity is partitioned into discrete haplotype blocks in these strains . animals were housed in an aaalac - approved animal facility and provided a standard rodent chow diet and drinking water ad libitum . all animal use was prospectively reviewed and approved by the university s animal welfare committee . genomic dna was extracted from samples of liver tissue obtained from male representatives of each rat line and quantified by uv spectroscopy . dna samples were submitted to a commercial genome sequencing company ( axeq technologies , rockville , md , 20850 , united states ) for sequencing . an average of 1.37 billion reads of 100 bp were obtained from each sample providing an average genome coverage of approximately 45x . we mapped the paired - end reads to the rat assembly [ rgsc3.4 ( ensembl release 69 ) ] using novoalign software ( novocraft.com , version v2.08.01 using default settings . novoalign performs local alignment using the smith - waterman algorithm . the typical default threshold command t a , b is 20,3 where the threshold is calculated using : t = ( la ) * b where l is the read length ( sum of pairs ) , a = log4(reference genome length ) , b < = gap extended penalty ( default = 3 ) , and the default gap opening penalty is 40 and the gap extend penalty is 6 . an average of 95.4% of the total reads were aligned to the rat assembly . after generating bam files , finally , we used the genome analysis tool kit ( gatk version v2.3 - 9-ge5ebf34 ) to perform local realignment , recalibration and variant calling . we removed false positive calls by using a post - calling filter that enforces that each variant has a mapping quality > 30 , a base quality > 20 , and a coverage 10 , and the presence of the variant in reads from both orientations . the resulting variant call format files ( vcf version 4.1 ) were annotated using snpeff software together with the rat genome annotations ( rgsc3.4.69 ) . finally we visually inspected the paired - end read data in the integrative genomics viewer ( igv , v 2.3.25 from broad institute ) . we obtained genomic sequences for verified rat ( rattus norvegicus ) igh genes from the international immunogenetics information system . sequences were obtained for a total of 411 genes including igh v , d and j genes as well as c genes ( igha , ighd , ighe , ighg and ighm ) encoding the constant region of alpha , delta , epsilon , gamma and mu heavy chains of the iga , igd , ige and igm , respectively . the genomic positions and orientation of these genes was identified using the blat tool at the ucsc genome web site to align the gene sequences with the brown norway ( bn ) rat reference ( rn 3.4 , rn4 ) genome . where sequences of igh genes were insufficient in length to obtain blat alignment , we examined , via imgt , the gene - encoding clone sequence via the accession number provided and located the gene sequence and sufficient adjacent sequence to definitively identify the genome location by blat . igv was used to align the rat reference genome sequence with variant call files comparing the shr - a3 and shr - b2 genomes with the rat reference genome . specific base changes were identified from the genome sequence of shr - a3 and shr - b2 , assembled in bam files and loaded into igv . effect of base changes on encoded amino acids was determined by translation using the expasy translate tool . in numerous instances alignments of high throughput sequencing reads to the rat reference assembly resulted in gaps or the complete absence of alignment between shr - a3 or shr - b2 ( or both ) sequences and the bn reference genome . such alignment gaps were considered to reflect likely areas of genomic deletion or the absence of genome duplication events and were considered to be null alleles . studies were performed on genomic dna isolated from the livers of inbred rats of the injury - prone spontaneously hypertensive line ( shr - a3 , shrsp / bbbutx ) that have been maintained in our facility for 15 years . we also used inbred rats from the injury - resistant shr - b2 line that were bred in our facility from stocks originating from colonies held at kinki university school of medicine , japan ( shr / utx ) . these two lines are derived from a single pair of founders common to both lines . these two inbred lines are ~87% genetically identical by descent ( ibd ) and this identity is partitioned into discrete haplotype blocks in these strains . animals were housed in an aaalac - approved animal facility and provided a standard rodent chow diet and drinking water ad libitum . all animal use was prospectively reviewed and approved by the university s animal welfare committee . genomic dna was extracted from samples of liver tissue obtained from male representatives of each rat line and quantified by uv spectroscopy . dna samples were submitted to a commercial genome sequencing company ( axeq technologies , rockville , md , 20850 , united states ) for sequencing . an average of 1.37 billion reads of 100 bp were obtained from each sample providing an average genome coverage of approximately 45x . we mapped the paired - end reads to the rat assembly [ rgsc3.4 ( ensembl release 69 ) ] using novoalign software ( novocraft.com , version v2.08.01 using default settings . novoalign performs local alignment using the smith - waterman algorithm . the typical default threshold command t a , b is 20,3 where the threshold is calculated using : t = ( la ) * b where l is the read length ( sum of pairs ) , a = log4(reference genome length ) , b < = gap extended penalty ( default = 3 ) , and the default gap opening penalty is 40 and the gap extend penalty is 6 . an average of 95.4% of the total reads were aligned to the rat assembly . after generating bam files , finally , we used the genome analysis tool kit ( gatk version v2.3 - 9-ge5ebf34 ) to perform local realignment , recalibration and variant calling . we removed false positive calls by using a post - calling filter that enforces that each variant has a mapping quality > 30 , a base quality > 20 , and a coverage 10 , and the presence of the variant in reads from both orientations . the resulting variant call format files ( vcf version 4.1 ) were annotated using snpeff software together with the rat genome annotations ( rgsc3.4.69 ) . finally we visually inspected the paired - end read data in the integrative genomics viewer ( igv , v 2.3.25 from broad institute ) . we obtained genomic sequences for verified rat ( rattus norvegicus ) igh genes from the international immunogenetics information system . sequences were obtained for a total of 411 genes including igh v , d and j genes as well as c genes ( igha , ighd , ighe , ighg and ighm ) encoding the constant region of alpha , delta , epsilon , gamma and mu heavy chains of the iga , igd , ige and igm , respectively . the genomic positions and orientation of these genes was identified using the blat tool at the ucsc genome web site to align the gene sequences with the brown norway ( bn ) rat reference ( rn 3.4 , rn4 ) genome . where sequences of igh genes were insufficient in length to obtain blat alignment , we examined , via imgt , the gene - encoding clone sequence via the accession number provided and located the gene sequence and sufficient adjacent sequence to definitively identify the genome location by blat . igv was used to align the rat reference genome sequence with variant call files comparing the shr - a3 and shr - b2 genomes with the rat reference genome . specific base changes were identified from the genome sequence of shr - a3 and shr - b2 , assembled in bam files and loaded into igv . effect of base changes on encoded amino acids was determined by translation using the expasy translate tool . in numerous instances alignments of high throughput sequencing reads to the rat reference assembly resulted in gaps or the complete absence of alignment between shr - a3 or shr - b2 ( or both ) sequences and the bn reference genome . such alignment gaps were considered to reflect likely areas of genomic deletion or the absence of genome duplication events and were considered to be null alleles . | we used next - generation sequencing to identify igh genetic variation in two closely related hypertensive rat lines that differ in susceptibility to end - organ disease ( shr - a3 and shr - b2 ) .
the two shr lines differ extensively at the igh locus from the rat reference genome sequence ( rrgs ) and from each other , creating 306 sequence unique igh genes .
compared to igh genes mapped in the rrgs , 98 are null gene alleles ( 31 are null in both shr lines , 45 are null in shr - a3 only , and 23 are null in shr - b2 only ) . of the 306 divergent gene sequences , 126 result in amino acid substitution and , among these ,
shr - a3 and shr - b2 differ from one another at the amino acid level in 96 segments .
twelve pseudogenes in the rrgs had changes displacing the stop codon and creating probable functional genes in either or both shr - a3 and shr - b2 .
a further 5 alleles that encoded functional rrgs genes or open reading frames were converted to pseudogenes in either or both shr - a3 and shr - b2 .
these studies reveal that the pre - immune immunoglobulin repertoire is highly divergent among shr lines differing in end organ injury susceptibility and this may modify immune mechanisms in hypertensive renal injury . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
acute gastroenteritis is a common illness which is debilitating and life - threatening in children younger than five years of age . globally , diarrhoeal diseases claim the lives of 800,000 children under the age of five years every year . noroviruses account for 12% of all cases of sporadic acute gastroenteritis in children under the age of five years worldwide and approximately 200,000 children die from norovirus associated gastroenteritis in developing countries [ 4 , 5 ] . noroviruses are small , single - stranded , positive - sense , rna viruses belonging to the family caliciviridae and the genus norovirus . however , the exact epidemiology and contribution of noroviruses to acute gastroenteritis in children in sub - saharan africa remain largely unclear . therefore , a systematic scientific literature review of studies in africa was carried out to establish the genotypic distribution and prevalence of symptomatic and nonsymptomatic norovirus infections in children in sub - saharan africa . noroviruses have a linear and polyadenylated genome surrounded by nonenveloped , icosahedral capsid of 27 to 40 nm in diameter . the genome of noroviruses that infect humans is organised into three open reading frames ( orfs ) . orf1 is the largest and encodes a polyprotein precursor for the seven nonstructural proteins [ 5 , 6 ] . orf2 and orf3 encode the major and minor structural capsid proteins vp1 and vp2 , respectively . the genus , norovirus , is divided into six genogroups ( gi vi ) based on the amino acid sequence of the major structural protein vp1 [ 5 , 8 ] . there is extensive genetic diversity among norovirus strains and new variants emerge almost every 2 - 3 years [ 5 , 6 ] . the ( human ) norwalk virus is the prototype of the genus and is designated as gi.1 . giii comprises bovine and ovine strains and gv murine noroviruses . swine and canine strains are classified into gii and giv or gvi , respectively . in humans , gii.4 noroviruses predominantly cause the vast majority of gastroenteritis outbreaks worldwide [ 9 , 10 ] . acute norovirus infection is characterised by nonspecific symptoms such as vomiting , nausea , abdominal cramps , myalgias , and intense watery nonbloody diarrhoea that commonly resolves in 2 - 3 days . children and immunocompromised individuals may experience a more prolonged and severe disease course lasting for a few weeks to years [ 11 , 12 ] . sequelae of prolonged norovirus associated gastroenteritis may include irritable bowel syndrome , necrotising enterocolitis , convulsions , and encephalopathy [ 1315 ] . transmission of noroviruses occurs through the faecal - oral route either by direct contact with infected individuals or via contaminated surfaces , food , water , and aerosolised particles from infected vomitus or stool . outbreak control and prevention strategies are limited to the use of disinfectants and hand sanitisers . a systematic scientific literature review of norovirus studies in sub - saharan africa published in peer reviewed journals in electronic databases such as pubmed , medline , scopus , and google scholar from 1993 to june 2015 was performed using keywords such as gastroenteritis , children , norovirus , africa , and name of country alone and in various combinations . to avoid leaving out any studies that were not available in major scientific databases or nonindexed journals , master of science theses whose contents have not been published in any journal were also included in the review . studies outside sub - saharan africa and those involving adult participants alone were excluded . for studies involving both children and adults , all studies describing norovirus infections in symptomatic and asymptomatic children were included . due to the scarcity of information on norovirus infections in children in sub - saharan africa , when reviewing the studies , frequencies of genogroup i and of genogroup ii genotypes were calculated independently . classification of genotypes into polymerase and capsid genotypes was not considered in the analysis due to lack of information . to calculate the approximate prevalence of norovirus infections in sub - saharan africa , only reverse transcription pcr based studies however , a reverse transcription pcr based study by wolfaardt et al . that used calicivirus positive samples only to calculate the prevalence of norwalk virus in south africa was excluded from the calculation . in studies , where the overall prevalence of norovirus infections was not included seasonality of norovirus infections was accepted and included in this review only when the study duration was 12 months . thirty - five studies were identified in africa and only 23 were in sub - saharan africa [ 1739 ] . nineteen studies had sufficient data to determine the total prevalence of norovirus infections but only seventeen studies had sufficient data to allow the determination of the prevalence of genogroups i and ii [ 1734 , 36 ] . relative frequencies of norovirus gi and gii genotypes were determined from 11 studies only due to lack of data from the other studies [ 17 , 19 , 20 , 2225 , 29 , 31 , 33 , 36 ] . only three studies had some information on the hiv status of study participants [ 18 , 22 , 33 ] . four studies reported the presence of norovirus recombinants [ 23 , 28 , 31 , 36 ] and one study investigated the role of genetic factors on the susceptibility to norovirus infections . in sub - saharan africa , hawaii ( gii.1 ) and norwalk ( gi.1 ) strains were identified as causative agents during the two successive outbreaks . subsequent seroepidemiological studies in south africa and in southern africa ( south africa , angola , zimbabwe , mozambique , and namibia ) published in 1996 and 1999 reported higher prevalence of igg antibodies against the prototype norwalk virus ( gi.i ) , 55.5% and 94.4% seropositivity , respectively [ 38 , 39 ] . another study recorded 3% prevalence of norwalk virus in human calicivirus ( hucvs ) positive stool specimens obtained between october 1991 and october 1995 from south african patients with sporadic gastroenteritis . analysis of results from 19 reverse transcriptase - pcr based studies involving 8,399 samples from children ( 17 years ) with symptomatic and nonsymptomatic gastroenteritis revealed 12.6% ( 1,057/8,399 ) prevalence of norovirus infections in sub - saharan africa [ 1834 , 36 ] . the prevalence of norovirus infections was higher in symptomatic children ( 14.2% , 807/5680 ) than asymptomatic children ( 9.2% , 250/2719 ) . however , higher prevalence of norovirus infections in asymptomatic children was reported in botswana ( 31% ) , burkina faso ( 24.8% ) , and cameroon ( 29.6% ) [ 17 , 18 , 28 ] . four studies , from south africa , nigeria , malawi , and gabon , clearly reported the occurrence of noroviruses in diarrhoea samples as single or mixed infections [ 20 , 26 , 33 , 34 ] . in the study from south africa , 77% ( 27/35 ) of the norovirus infections occurred as single virus infections whereas 23% ( 8/35 ) of the norovirus positive specimens were coinfected with rotaviruses , adenoviruses , sapoviruses , and astroviruses . in ife , nigeria , norovirus single infections were found in 64.3% ( 9/14 ) of the norovirus positive diarrhoea samples . a study in gabon had 41.1% of norovirus infections occurring as single infections ; 58.9% of the norovirus diarrhoea samples were coinfected with rotaviruses , adenoviruses , sapoviruses , and astroviruses . studies from tanzania , northern region of ghana , and zanzibar indicated the presence of mixed infections but fell short of mentioning the percentage of norovirus positive diarrhoea samples that had single or mixed infections [ 21 , 25 , 35 ] . the rest of the studies included in this review had no information about the occurrence of single or mixed infections in norovirus positive samples . gii was the most common genogroup accounting for 76.4% ( 730/955 ) of all the reported norovirus infections from 17 studies in sub - saharan africa . two studies had no information on the genogroups and one study from nigeria ( included in the 17 studies ) did not sequence all the norovirus positive samples to determine the genogroups [ 21 , 27 , 30 ] . the rest of the infections were gi ( 21.7% , 207/955 ) and gi / gii ( 1.9% , 18/955 ) . analysis of nine studies that had information on the prevalence of gi and gii genotypes revealed a great diversity of norovirus genotypes in sub - saharan africa [ 17 , 20 , 22 , 23 , 25 , 29 , 31 , 33 , 36 ] . figures 2(a ) and 2(b ) show the relative frequencies of norovirus genotypes in sub - saharan africa . gii.4 ( 65.2% ) was the most prevalent gii genotype associated with acute sporadic gastroenteritis . gi.7 ( 33.3% ) and gi.3 ( 21.3% ) were the most common gi genotypes . norovirus recombinants were only reported in four studies in burkina faso , madagascar , ghana , and south africa [ 23 , 28 , 31 , 36 ] . the reported recombinants included gii-8/gii-14 in ghana in 2006 , gii.7/gii.6 in burkina faso in 2013 , and a potential recombinant ( closer to hu / nov / gii.1/hawaii/1971/us ) in madagascar in 2007 [ 23 , 28 , 31 ] . the most comprehensive study thus far to have reported the presence of several gii intergenotype and two intragenotype gii.4 recombinants was carried out by mans et al . three of the combinations represented novel recombinants , namely , gii.p not assigned ( na)/gii.3 , gii.p4 new orleans 2009/gii.4 na and gii.p16/gii.17 . other recombinants included gii.p21/gii.2 , gii.p21/gii.3 , gii.pe/gii.4 sydney 2012 , gii.pg/gii.12 , gii.pg/gii.1 , and gii.pe/gii.4 osaka 2007 , gii.p4 new orleans 2009/gii.4 sydney 2012 , and gii.p7/gii.6 . norovirus infections were less prevalent in burkinabe children with blood group a ( odds ratio 0.31 ; p = 0.054 ) or secretor - negative phenotype ( odds ratio 0.18 ; p = 0.012 ) . lewis - negative children were more susceptible to gii but were not infected with any gi noroviruses . children with blood group b were infected by gii.4 strains whereas secretor - positive children with blood group o were infected with a wide variety of genotypes . three smaller studies in tanzania , south africa , and cameroon reported the prevalence of norovirus infections in hiv positive people [ 18 , 22 , 33 ] . the study in cameroon involved hiv positive adults only and thus it was excluded from the analysis . in tanzania , moyo et al . found prevalence of 21.2% in hiv positive children compared to 10.3% in hiv negative children . in south africa , a study carried out by mans et al . reported that 42.8% ( 15/35 ) of children with norovirus gastroenteritis were infected with hiv . the seasonal distribution of noroviruses varied between different sub - saharan african countries . in south africa and madagascar , norovirus detection peaked in november and december 2008 while malawi had two peak norovirus seasons , august to november and february to march between 1997 and 2007 [ 20 , 31 , 33 ] . ghana and nigeria experienced high norovirus detection during the dry season , from october to may and october to january , respectively [ 23 , 24 , 26 , 27 ] . data from this review shows that the prevalence ( 12.6% ) of norovirus infections in children in sub - saharan africa is higher than previously thought . in most of the studies included in this review , the prevalence of norovirus was higher in the cases than in the controls [ 20 , 22 , 27 , 32 , 35 ] . some studies in botswana , burkina faso , and cameroon reported higher prevalence in asymptomatic children [ 17 , 18 , 28 ] . it can only be speculated that the findings from such studies were a true reflection of the situation or some of the individuals included in these studies did not have truly asymptomatic infections or their parents / guardians had incomplete recall of diarrhoeal symptoms . persistent shedding of the virus from resolved acute norovirus diarrhoeal infections could also have contributed to these events . on the other hand , the samples sizes for the studies conducted in botswana ( 100 children ) and cameroon ( 54 children ) were too small to draw serious conclusions [ 17 , 18 ] . moreover , the study in cameroon only involved asymptomatic children and thus it is difficult to really know the extent to which norovirus infections contribute to diarrhoea in cameroonian children . generally , most of the studies included in this review had smaller sample sizes . only three studies had sample sizes above 1000 [ 19 , 20 , 22 ] . therefore longitudinal studies with large sample sizes are required to evaluate the exact norovirus prevalence and its contribution to diarrhoeal disease in children in sub - saharan africa . the calculated 12.6% prevalence of norovirus infections came from studies in 12/48 sub - saharan african countries . more studies in all the countries are required in order to come up with a representative figure . additionally , the duration of many of the studies was less than 12 months , and hence results from such studies are but just an eye - opener of the role of noroviruses in childhood diarrhoea in those countries [ 18 , 19 , 21 , 2529 , 31 , 35 ] . consequently , the seasonality of norovirus infections in the country where the studies were carried out could not be established . knowing the season within which norovirus infections frequently occur may help with proper planning for outbreaks and efficient utilisation of health resources . although the prevalence of norovirus infections is approximately 12.6% in sub - saharan africa , the contribution of noroviruses to acute and chronic diarrhoea in this subregion is still obscure . detection of norovirus in a stool sample from a child with gastroenteritis does not always mean that this is the cause ; there may be mixed infections with other bacterial and viral agents . as true as this statement may sound , many studies included in this review did not investigate the occurrence of noroviruses as single or mixed virus infections in norovirus positive diarrhoea samples . for studies , such as those conducted in south africa , nigeria , and malawi , that investigated occurrence of noroviruses as single or mixed infections with other viral pathogens , they did not investigate coinfections with protozoal and bacterial agents [ 20 , 26 , 33 , 34 ] . therefore , it is still largely difficult to pinpoint the exact share of diarrhoea burden caused by noroviruses in sub - saharan africa . out of a total of 19 studies that were included in this review , only 9 had information of the prevalence of gi and gii genotypes , representing a total of 368 gii genotypes and 42 gi genotypes . this , coupled with smaller sample sizes and fewer studies , makes the distribution of norovirus genotypes highlighted in this review unrepresentative of actual norovirus genotypes that may be circulating in sub - saharan africa [ 17 , 20 , 22 , 23 , 25 , 29 , 31 , 33 , 36 ] . however , among the genotyped samples , gii.4 , gi.3 , and gi.7 were most associated with diarrhoea . results from this systematic review indicate that the exact contribution of different norovirus genotypes to diarrhoea in children in sub - saharan africa is far from being established . noroviruses have been shown to cause chronic and persistent gastroenteritis in immunocompromised individuals such as hiv / aids patients , lasting several weeks to years [ 11 , 12 ] . by the end of 2013 , there were approximately 35 million people living with hiv worldwide . sub - saharan africa accounted for 71% ( approximately 24.7 million people ) of the global hiv infections . with such a huge percentage of people infected with hiv , noroviruses may be silently causing undocumented severe and prolonged gastroenteritis in sub - saharan africa . in this review , only two studies reported the prevalence of norovirus infections in hiv positive children [ 22 , 33 ] . in south africa , more than 50% ( 8/15 ) of hiv positive children had chronic norovirus diarrhoea . the results were in agreement with the findings from across the globe that noroviruses tend to cause persistent diarrhoea in immunocompromised individuals . although the results from these two studies may not be adequate to draw conclusions , they point to the potential devastating role of hiv in chronic norovirus gastroenteritis . large scale research in sub - saharan africa is required to correctly understand the impact of hiv / aids in norovirus associated gastroenteritis . whilst all the studies included in this systematic review provided evidence on the prevalence of norovirus infections in children in sub - saharan africa , none of them critically looked at the possible risk factors and transmission dynamics of noroviruses . it would be worthwhile to investigate the transmission dynamics and risk factors associated with norovirus infections in sub - saharan africa . the prevalence of norovirus infections in children with symptomatic and nonsymptomatic gastroenteritis in sub - saharan africa is approximately 12.6% . however , most of the studies from which this figure was derived had small sample sizes and were of a shorter duration . it is therefore prudent that the epidemiology of noroviruses and their contribution to childhood diarrhoea and deaths in sub - saharan africa should be investigated further using large scale longitudinal studies . | noroviruses are a leading cause of acute sporadic gastroenteritis worldwide . in sub - saharan africa ,
information regarding norovirus infections in children is scarce .
a systematic review of studies performed between 1993 and june 2015 was conducted to establish the genotypic distribution and prevalence of norovirus infections in children ( 17 ) in sub - saharan africa .
analysis of data from 19 studies involving 8,399 samples from children with symptomatic and nonsymptomatic gastroenteritis revealed prevalence of 12.6% ( range 4.6% to 32.4% ) .
the prevalence of norovirus infections was higher in symptomatic children ( 14.2% ) than asymptomatic children ( 9.2% ) .
genogroup ii ( gii ) was the most prevalent genogroup accounting for 76.4% of all the reported norovirus infections .
the rest of the infections were gi ( 21.7% ) and gi / gii ( 1.9% ) .
the most common genotypes were gii.4 ( 65.2% ) , gi.7 ( 33.3% ) , and gi.3 ( 21.3% ) .
these statistics were calculated from studies carried out in 12 out of 48 sub - saharan african countries .
therefore , more studies involving several countries are required to determine fully the epidemiology of noroviruses and their contribution to childhood diarrhoea in sub - saharan africa . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the conventional cytogenetic dosimetry , the gold standard chromosomal aberration assay , fails to estimate high radiation dose exposure due to mitotic delay and severe leukopenia . therefore , it is not always possible to make chromosome preparations containing a sufficient number of metaphase cells necessary for the dose estimation . hence , there is a need to establish a reliable , easier , and quicker method for biodosimetry , which depends on interphase chromosomes . techniques have been developed to cause chromatin to condense at earlier stages in the cell cycle ( before mitosis ) and dose estimation can be done by measuring ring frequency . the technique is termed as the premature chromosome condensation ( pcc ) assay . the pcc assay was first reported by johnson and rao in 1970 . the premature condensation was induced by fusing the interphase cells to mitotic cho or hela cells using sendai virus or polyethylene glycol ( peg ) as fusing agents . fusion by means of sendai virus requires cells with membranes , especially receptive to the virus particles . this difficulty was overcome for the purpose of biological dosimetry with the use of peg for pcc induction . however , this fusion method has several disadvantages , such as complicated operation , low pcc index , and the requirement of mitotic and fusing cells . in 1993 , dyban et al . reported that okadaic acid , a specific inhibitor of pp1 and pp2a phosphoprotein phosphatases , induced pcc in mouse embryo cells . furthermore , gotoh et al . reported that pcc was also inducible by the protein phosphatise calyculin a in many types of cells with high efficiency . in addition , kanda et al . reported the dose response relationship of pcc rings in lymphocytes and proposed an easy method of scoring pcc rings in giemsa stained pcc spreads induced by okadaic acid ( oa ) . the present study deals with standardization of calyculina and okadaic acid induced pcc assay , and dose response studies with co gamma rays in the dose range 0 to 20 gy . the study also involves standardization calyculina induced pcc assay for 8 mev pulsed electron beam . phytohaemagglutinin ( pha ) , calyculina , and okadaic acid were purchased from sigma chemicals ( st . roswell park memorial institute medium ( rpmi ) and fetal bovine serum ( fcs ) were purchased from gibco chemicals . the rest of the chemicals were analytical grade and purchased from himedia . in the present study , the dose response studies were carried out using co - gamma radiation and 8 mev pulsed electron beam . the gamma radiation was taken from co - gamma chamber-1200 supplied by the isotope division , bhabha atomic research center , and 8 mev pulsed electron beam from microtron accelerator at mangalore university . the dose rate of the gamma chamber and microtron accelerator was determined by the same method and was found to be 1.5 gy.min and 100 gy.min respectively . peripheral blood samples were collected by venipuncture in heparinized vials from healthy male donors having no pre - history of radiation . immediately after the collection of blood , aliquots of heparinized blood were irradiated to different doses of 0 , 2.5 , 5 , 7.5 , 10 , 15 , 20 gy of gamma radiation and electron beam . pcc assay employed in the present study is a modified technique described by puig et al . the peripheral blood lymphocytes were incubated for 2 h at 37c before and after irradiation for repair . blood lymphocyte cultures were set up with rpmi 1640 medium supplemented with 20% fcs and 0.2 ml of pha ( final concentration of 20 g / ml ) and incubated 37c for 48 h. one hour before harvesting i.e. , after 47 h of incubation , cultures were centrifuged , culture volume was adjusted to 2.5 cm , and calyculin a ( 50 nm ) or okadaic acid ( 500 nm ) was added to the culture . after about 1 h of incubation with the drug , cultures were harvested and centrifuged at 900 rpm for 8 min to get a firm pellet with a clear supernatant . pre - warmed ( 37c ) hypotonic solution ( 0.075 m kcl ) was added to the pellet with constant vortex mixing . the pellets in the hypotonic solution were incubated at 37c for 6 min in a pre - warmed water bath and then centrifuged at 900 rpm for 8 min . the cells were fixed by cold fixative solution with 1 : 3 mixtures of acetic acid and methanol after removing the supernatant and gentle agitation . to prepare the chromosome spread on slides , the cells were mixed thoroughly and dropped on a pre - cleaned frozen slide from a certain height ( ~30 cm ) followed by quick warm and air blow on the slide surface to get better spread of metaphase chromosomes . the slides were stained using giemsa stain for 10 to 12 min by dipping in staining solution and washing 3 to 4 times with a d.d.w . pcc spreads were analyzed at 100x magnification with an olympus bx 51 fluorescent microscope coupled to a jenoptik c5 cooled ccd camera with progres capture pro 2.8 software . two scoring criteria were used ; one as suggested by kanda et al . , which includes all spherical shaped pcc rings , and another suggested by lamadrid et al . , which strictly limits ring evaluation to those which clearly defined open space . extra fragments were recorded as those exceeding 46 pieces in g2/m pcc cells and 92 pieces in case of m / a pcc cells . for each ring , briefly , the mean number of observed rings per cell ( y ) is given for each dose ( d ) along with relative variance ( /y ) and the dispersion index ( u ) . the u values are calculated using the relation ; where , n is the number of cells scored . is the variance calculated by the relation ; where , n0 , n1 , n2 ni refer to the number of cells carrying 0 , 1 , 2 i rings , respectively . the positive and negative ' u ' value indicates overdispersion and underdispersion respectively , as compared to perfect poisson distribution ( u = 0 ) . if the value of u is greater than 1.96 , then the dispersion is significant at 95% confidence level . only a 5% probability exists that the magnitude of u will be greater than 1.96 when the underlying distribution follows poisson statistics . the yield y was calculated using the relation ; the poisson error in yield was calculated using the relation ; phytohaemagglutinin ( pha ) , calyculina , and okadaic acid were purchased from sigma chemicals ( st . roswell park memorial institute medium ( rpmi ) and fetal bovine serum ( fcs ) were purchased from gibco chemicals . in the present study , the dose response studies were carried out using co - gamma radiation and 8 mev pulsed electron beam . the gamma radiation was taken from co - gamma chamber-1200 supplied by the isotope division , bhabha atomic research center , and 8 mev pulsed electron beam from microtron accelerator at mangalore university . the dose rate of the gamma chamber and microtron accelerator was determined by the same method and was found to be 1.5 gy.min and 100 gy.min respectively . peripheral blood samples were collected by venipuncture in heparinized vials from healthy male donors having no pre - history of radiation . immediately after the collection of blood , aliquots of heparinized blood were irradiated to different doses of 0 , 2.5 , 5 , 7.5 , 10 , 15 , 20 gy of gamma radiation and electron beam . pcc assay employed in the present study is a modified technique described by puig et al . the peripheral blood lymphocytes were incubated for 2 h at 37c before and after irradiation for repair . blood lymphocyte cultures were set up with rpmi 1640 medium supplemented with 20% fcs and 0.2 ml of pha ( final concentration of 20 g / ml ) and incubated 37c for 48 h. one hour before harvesting i.e. , after 47 h of incubation , cultures were centrifuged , culture volume was adjusted to 2.5 cm , and calyculin a ( 50 nm ) or okadaic acid ( 500 nm ) was added to the culture . after about 1 h of incubation with the drug , cultures were harvested and centrifuged at 900 rpm for 8 min to get a firm pellet with a clear supernatant . pre - warmed ( 37c ) hypotonic solution ( 0.075 m kcl ) was added to the pellet with constant vortex mixing . the pellets in the hypotonic solution were incubated at 37c for 6 min in a pre - warmed water bath and then centrifuged at 900 rpm for 8 min . the cells were fixed by cold fixative solution with 1 : 3 mixtures of acetic acid and methanol after removing the supernatant and gentle agitation . to prepare the chromosome spread on slides , the cells were mixed thoroughly and dropped on a pre - cleaned frozen slide from a certain height ( ~30 cm ) followed by quick warm and air blow on the slide surface to get better spread of metaphase chromosomes . the slides were stained using giemsa stain for 10 to 12 min by dipping in staining solution and washing 3 to 4 times with a d.d.w . pcc spreads were analyzed at 100x magnification with an olympus bx 51 fluorescent microscope coupled to a jenoptik c5 cooled ccd camera with progres capture pro 2.8 software . two scoring criteria were used ; one as suggested by kanda et al . , which includes all spherical shaped pcc rings , and another suggested by lamadrid et al . , which strictly limits ring evaluation to those which clearly defined open space . extra fragments were recorded as those exceeding 46 pieces in g2/m pcc cells and 92 pieces in case of m / a pcc cells . for each ring , briefly , the mean number of observed rings per cell ( y ) is given for each dose ( d ) along with relative variance ( /y ) and the dispersion index ( u ) . the u values are calculated using the relation ; where , n is the number of cells scored . is the variance calculated by the relation ; where , n0 , n1 , n2 ni refer to the number of cells carrying 0 , 1 , 2 i rings , respectively . the positive and negative ' u ' value indicates overdispersion and underdispersion respectively , as compared to perfect poisson distribution ( u = 0 ) . if the value of u is greater than 1.96 , then the dispersion is significant at 95% confidence level . only a 5% probability exists that the magnitude of u will be greater than 1.96 when the underlying distribution follows poisson statistics . the yield y was calculated using the relation ; the poisson error in yield was calculated using the relation ; the ring frequency and their distribution are summarized in table 1 , 2 after the gamma radiation treatment . cells with attached sister chromatid are g2/m pcc and cells with separate sister chromatid are g2/a pcc . the dose response of the centric rings and excess fragments induction after gamma and electron beam treatment is shown in fig . frequencies and ring distribution after irradiating with gamma radiation in human lymphocytes assessed using calyculin a pcc assay frequencies and ring distribution after irradiating with gamma radiation in human lymphocytes assessed using okadaic acid pcc assay g2/m pcc spread with twocentric rings comparative study between calyculin a centric rings yield ( ) and okadaic acid centric rings yield ( ) after irradiating with the gamma radiation dose response of the fragment yield in calyculin a ( ) and okadaic acid ( ) induced pcc assay after irradiating with the gamma radiation dose response of the centric rings after irradiating with the gamma ( ) and 8 mev electron ( ) radiations dose response of the fragments after irradiating with the gamma ( ) and 8 mev electron ( ) radiations the results show a linear dose dependent increase in centric rings , excess fragments frequency for gamma radiation in calyculin a and okadaic acid induced premature chromosomes . from table 1 , 2 , it may be noted that the u - values for the studied doses are between 1.96 , which confirms that the ring frequency follows a poisson distribution . many investigators have reported perfect poisson distribution of ring frequency for low let radiation in vitro . since ring and fragment yield varies linearly with the dose , results were fit to a linear model and the coefficients of the linear model are shown in table 3 . the obtained value , when rings are considered , were found to be 0.047 0.001 gy from calycalin a pcc and 0.048 0.002 gy form okadaic acid pcc , which are comparable with the reported results . recently , romero et al . obtained an value of 0.044 0.0012 gy from calycalin a pcc , which is comparable with the present results . was 0.027 0.003 gy and 0.021 0.01 gy , respectively , which are lower values compared to the present study . the less value in their case may be because of the combined treatment of colcemid and calyculin a. in the present study , the obtained value from okadaic acid pcc was 0.048 0.002 gy , which is comparable with the value reported by daniela et al . coefficients of the linear model after irradiation of blood lymphocytes with co gamma radiation from fig . 1 and 2 , it is clear that there is no significant difference between calyculin a and okadaic acid pcc curves . the slope of the fragments curve is 0.327 0.006 gyfrom calyculin a and 0.328 0.006 gy from okadaic acid pcc . the fragments curve slopes are slightly less compared to the reported results , 0.41 0.04 gy by puig et al . and 0.45 0.03 gy by balakrishnan et al . the fragments slope may be less because of more g2/m pcc cells observed in this study . the percentage of pcc spreads induced by calyculin a and okadaic acid at various doses of gamma radiation was calculated and presented in table 4 . pcc spreads ( % ) after irradiating with gamma radiation frequency and ring distribution after irradiating with 8 mev electron radiation in human lymphocytes assessed using calyculin a pcc assay the observed pcc spread ( % ) was much higher in calyculin a compared to okadaic acid pcc assay . from table 4 , it may be noted that the increase in g2/m pcc spreads until 7.5 gy followed by a plateau , whereas decrease in m / a pcc spreads with the radiation dose . a similar observation was reported by miura et al . , who observed an increase in g2/m pcc spread until 8 gy and thereafter it attained a plateau and decrease in m / a pcc cells . a higher pcc index was observed for calyculin a compare to okadaic acid , which restricted 8 mev electron studies on calyculin a. the results show a linear dose dependent increase in centric rings and excess fragments frequency , and the ring distribution follows the possion distribution ( figure 4 , 5 ) . the dose response relation can be represented as , ycentric rings = ( 0.054 0.002 ) d ( with r = 0.99 and p < 0.0001 ) and yfragments = ( 0.427 0.009 ) d ( with r = 0.99 and p < 0.0001 ) . from figure 4 , 5 , it is clear that there is a significant difference in ring yield and fragment yield between 8 mev electrons and co - gamma radiation . the obtained value for ring yield is 0.047 0.001 gy for gamma radiation and 0.054 0.002 gy for 8 mev electrons . the values from fragment yield is 0.327 0.006 gy for gamma radiation and 0.427 0.009 gy for 8 mev electrons . the obtained higher values for electron beam may be because of higher rbe value of the radiation . the present study reveals that the calyculina and okadaic acid induces similar ring and fragment yield . but pcc spreads percentage is higher in calyculina pcc assay , which is an important parameter in biodosimetry . dose calibration studies confirm that the ring and fragment yield increases linearly with the doses and slightly higher yields were obtained for 8 mev pulsed electron beam compared to gamma radiation . acknowledgments : the authors are grateful to board of research in nuclear sciences , department of atomic energy , government of india , for the financial support . d.a.r . babu , head , rp & ad , barc , india for technical discussions , support , and help . technical assistance during the experiments by mr . | objective : in the present study an attempt was made to estimate coefficients of dose response curves for pcc aberrations induced by calyculina and okadaic acid , using 60co gamma radiation and 8 mev pulsed electron beam for biodosimetry application.materials and methods : the modified method outlined by puig et al .
2013 was used to conduct calyculin a and okadaic acid induced pcc assay in human blood lymphocytes.chemical treatment was given for the last 1 h of a 48 h culture .
the study was carried out in the dose range 2.5 to 20 gy using 60co gamma rays and 8 mev pulsed electron beam.results and conclusions : results show a linear dose dependent increase with a slope of 0.047 0.001 from calycalin a pcc and 0.048 0.002 form okadaic acid pcc .
the slope of the fragments curve was 0.327 0.006 from calyculin a and 0.328 0.006 from okadaic acid pcc .
further , dose calibration studies were carried out for 8 mev electron using calyculin a pcc assay and the obtained slope from ring yield was 0.054 0.002 and 0.427 0.009 from fragment yield . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
tamoxifen , a selective estrogen receptor modulator ( serm ) is widely used in hormonal therapy for estrogen receptor - positive breast cancer . the side effects of tamoxifen usage include nausea , vomiting , hot flushes , skin rashes , alopecia and rarely thromboembolism . however , there are very few reports of acute pancreatitis due to tamoxifen - induced hypertriglyceridemia in the literature . a 50-year - old diabetic woman presented with stage iii , estrogen receptor - positive adenocarcinoma of the breast . she was on metformin ( 500 mg twice daily ) and her blood sugars and serum lipid levels were within the normal limits . she received three cycles of adriamycin - based neo - adjuvant chemotherapy followed by modified radical mastectomy . this was followed by three cycles of chemotherapy ( with cyclophosphamide , adriamycin and 5-fluorouracil ) and radiotherapy . three months later she presented with spontaneous onset of severe abdominal pain and vomiting of 5 days duration . on examination , her pulse rate was 115/minute , blood pressure 150/90 mmhg , respiratory rate 25/minute and temperature 100.2f . there was marked tenderness and guarding in the epigastric region and a hepatomegaly ( 2 cm below theright costal margin ) . pertinent laboratory values are as follows : serum amylase 778 iu / l , total cholesterol 785 mg / dl , triglycerides 4568 mg / dl , high - density lipoproteins ( hdl ) 12 mg / dl , alanine aminotransferase 35 iu / l , alkaline phosphatase 200iu / l , total bilirubin 0.8 mg / dl , fasting blood sugar ( fbs ) 166 mg / dl , post - lunch blood sugar ( plbs ) 285 mg / dl , hemoglobin 11.6 g / dl , total leukocyte count 16,500/mm with 85% neutrophils and c - reactive protein 15 ultrasonography of the abdomen showed a bulky pancreas and multiple peri - pancreatic and spleno - renal fluid collections . there were peripancreatic and left paracolic space collections communicating with pelvic and retroperitoneal spaces suggestive of acute pancreatitis [ figure 1 ] . contrast - enhanced computed tomography showing diffuse enlargement of the pancreas with heterogeneous enhancement and peripancreatic fluid collections hypertriglyceridemia secondary to tamoxifen usage was suspected as the cause of acute pancreatitis and the patient was treated with prompt withdrawal of the drug , intravenous fluids and analgesics for 5 days . simultaneously atorvastatin ( 10 mg once daily ) was stared to control the lipid levels . she showed a dramatic improvement with the resolution of her symptoms and return of lipid levels to normal by the end of 1month . the patient was started on letrozole ( 2.5 mg once daily ) and was under strict follow up . it can have a paradoxical estrogenic effect on lipid metabolism resulting in elevated triglyceride and chylomicron levels . increased blood levels of triglycerides causes lodging in pancreatic capillaries , resulting in ischemia and necrosis . the resultant release of pancreatic lipases causes release of free fatty acids from triglycerides followed by an inflammatory response . to our knowledge , the dosage of tamoxifen used in these reports was 20 mg / day in all but one case . in most cases , there was an antecedent history of dyslipidaemia which was lacking in the present case . however , it must be borne in mind that type 2 diabetes and dyslipidaemia may have a common genetic predisposition . the levels of triglycerides that precipitated acute pancreatitis ranged from 900 to 7000 mg / dl . the delay in the onset of symptoms in most of these reports was more than 6 months after initiation of therapy with tamoxifen . the outcome was favorable in most of these reports as was with the present case . an extensive overview on drug - induced pancreatitis by trivedi et al . was based on medication re - challenge to confirm association . however , in our patient no re - challenge was tried due to the fear of precipitating severe form of pancreatitis . a causal relationship with tamoxifen use could be established by the fact that there was no hypertriglyceridemia prior to the initiation of tamoxifen and withdrawal of the drug showed a prompt reversal . some clinicians recommend a reduced dose of tamoxifen ( 10 mg a day ) to lower the risk of hypertriglyceridemia . in a recent study , letrozole showed no significant adverse effects on serum lipid levels in women without hyperlipidaemia at baseline . a great deal of caution must be exercised and regular monitoring of lipid levels performed in predisposed individuals . at the first instance of suspicion , the drug should be discontinued and preferably no re - challenge tried due to risk of inducing acute severe pancreatitis . | tamoxifen has both antagonistic and agonistic tissue - specific actions .
it can have a paradoxical estrogenic effect on lipid metabolism resulting in elevated triglyceride and chylomicron levels .
this can cause life - threatening complications like acute pancreatitis . to our knowledge ,
very few cases of tamoxifen - induced pancreatitis have been reported in the literature .
we report a case of severe hypertriglyceridemia and acute pancreatitis following tamoxifen use .
a 50-year - old diabetic lady was on tamoxifen ( 20mg / day ) hormonal therapy for breast cancer . within 3 months of starting therapy , she developed hypertriglyceridemia and acute pancreatitis .
laboratory values include : serum amylase 778 iu / l , total cholesterol 785 mg / dl , triglycerides 4568 mg / dl and high - density lipoproteins ( hdl ) 12 mg / dl .
tamoxifen was substituted with letrozole and atorvastatin started .
there was a prompt reversal of the adverse effects .
effects on lipid profile must be considered while initiating tamoxifen in predisposed individuals as the consequences are life threatening . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
metastasis is a stage in which cancerous cells spread to the whole body through the lymphatic system or bloodstream . it is extremely harmful and can lead to death . despite the great efforts in the areas of prevention , diagnosis , and treatment of cancer , this disease continues to grow and is still a global killer . based on the globocan 2008 estimates the standard set of worldwide estimates of cancer incidence and mortality cancer is the leading cause of death in economically developed countries and the second leading cause of death in economically developing countries . the early diagnosis of cancer is very important in order to make the therapies more effective . the comparison between cancerous patients whose diseases were not diagnosed at early stages and those with early cancer detection with the same age , race , and sex shows that the survival rate increased by 85% between 1999 and 2005 . such published statistics reflect the fact that more research is needed in the area of cancer early diagnosis . for example , this method does not require any tissue damage for detection and can also be a guide for biopsy . ct , pet , spect , and mri are considered as the most important techniques . the majority of clinical imaging systems are based on the interaction of the electromagnetic radiation with body tissues and fluids . among them , mri ( magnetic resonance imaging ) is one of the most useful methods . mri uses nuclear magnetic resonance for the visualization of the hydrogen nucleus in fat and water tissue . in cancer , so , mri is widely used in medicine . in this technique , magnets make the external magnetic field so nuclear spin of the protons can be along with the magnetic field . by applying radio frequency waves and removing them , signals will be received based on the different relaxation times and will convert to an image by a computer . mri contrast agents alter relaxation time of the tissue atom nucleus and thus provide a more intense signal . great efforts have been made to create a stronger , safer , and more efficient contrast agent for mri in recent years . according to the received reports of human death due to gadolinium injection and production of poor quality and low contrast images , one of these contrast agents which approved by the us food and drug administration is dimeglumine gadopentetate ( commercial name magnevist ) . this linear ionic chemical with chemical formulations of c28-h54-gd - n5-o20 is composed of gd , dtpa ( diethylenetriamine pentaacetate ) , and meglumine ( figure 1 ) . this drug is distributed in the extracellular space and does not cross the blood - brain barrier . this compound is the oldest contrast agent in the market world and is still highly functional in mri . nanomedicine is the application of nanotechnology in medicine . among the wide applications of nanomedicine , since nanosized particles are compatible with biological systems and their large surface area to volume ratio makes them capable of drug loading and conjugation , nanoparticle contrast media in mr imaging have been used to enhance the properties of macroscopic counterparts . so far , they have been enabled to create images with desirable contrast in several cases . dendrimers are repetitively branched nanopolymers . these materials are usually symmetrical around a central core and have often three - dimensional spherical morphology . using dendrimer has recently become an increasingly important part of mri contrast agent in pharmaceutical studies . the properties of dendrimers are distinguished by the functional groups on the surface ; however , there are examples of dendrimers with internal functionality which means that the dendrimers incorporate the functional groups in their inner space . unlike most polymers , dendrimers can be water - soluble . they also have some unique features due to their globular shape and the presence of internal cavities [ 10 , 11 ] . one of the most important difficulties in the usage of dendrimer as a contrast media is its high toxicity in the body . to lessen this problem , the first strategy is performed using biodegradable cores or surface units which are intermediates of the metabolic pathways , and the second one is carried out by pegylation , acetylation , and so forth . in synthesis of dendrimer used in this research ( namazi and adeli method ) , both strategies were applied . peg is used as the core of dendrimer and its surrounding groups are citric acids ( the citric acid cycle intermediates ) . as a result , the dendrimer is probably biodegradable and has no significant toxicity . in this research , for the first time dimeglumine gadopentetate was loaded and/or conjugated to the anionic linear globular nanosized dendrimer ( algnd ) in order to create a novel mri contrast agent with greater stability , fewer side effects ( toxicity ) , and enhanced tumor image contrast compared to standard drug magnevist . gadolinium(iii ) chloride ( 99.99% ) , n - hydroxysulfosuccinimide sodium salt ( 98% ) , diethylenetriamine pentaacetic acid ( 97% ) , and amino salicylic acid ( 99% ) were purchased from aldrich co. phosphate - buffered saline ( powder , ph 7.4 ) , adipic acid dihydrazide ( 98% ) , meglumine diatrizoate , diclofenac sodium salt , and mefenamic acid were obtained from sigma co. 1-ethyl-3-(3-dimethylaminopropyl ) carbodiimide , citric acid ( 99% ) , pyridine ( 98% ) , and thionyl chloride were obtained from merck co. the dendrimer was of the first generations of anionic linear globular copolymer type . using the method introduced by namazi and adeli , this dendrimer was synthesized in two steps including esterification and combination with citric acid . the monomer units of ester - liked fragment were citric acid and diacyl halide poly(ethylene glycol ) was used as the dendrimer core . though most of synthetic triblock polymers are nonbiodegradable and have toxic effects on the body , the synthesized dendrimers produced using citric acid and poly(ethylene glycol ) have none of these problems and are suitable to use in contrast media combination . gadopentetate was synthesized using 15 ml water as a solvent , dtpa as the ligand , and gdcl3 . hot - plate and magnetic - stirrer machine was used to complete the reaction . finally , in order to increase the stability of the solution , meglumine combination as a coligand was added . all the amounts were measured using an analytical scale with an accuracy of 0.0001 g. the reaction between dtpa , gdcl3 , and meglumine produced gadopentetate dimeglumine ( gd - dtpa - meglumine complex ) . following the adding of 5 mg edc powder , 1 ml of algnd with a concentration of 20 g / l was inserted to vial of 15 ml gadopentetate dimeglumine ( as mentioned before , this powder was purchased from sigma company ) . edc is a carboxyl group activator and it was used to activate carboxyl end of the complex ( gd - dtpa - meglumine ) . after that , 5 mg of adh ( adipic acid dihydrazide ) and n - sulf - hs ( n - hydroxysulfo - succinimide ) were added to the solution . mechanical severe shake ( sonicator machine ) was used to increase the level of contact surface . using the ultrasound waves , this method is usually used in nanotechnology in order to disperse the nanoparticles in the solution , evenly . in order to purify the obtained product , dialysis bag with a cut - off point of 1000 da and water as the solvent were use . finally , these two compounds ( standard and nanosized magnevist ) were changed into powder for greater stability by freeze - dryer machine . quality control tests of this research include measuring the basic characteristics of the drug such as its gadolinium content , chemical structure , and molecular weight . the spectroscopy studies included liquid chromatography mass spectrometry ( lc - ms ) and fourier transform infrared spectroscopy . for each , lyophilized standard magnevist was applied . to determine and compare the elemental composition of the standard and nanosized magnevist , chn analyzer series ii model manufactured by perkin elmer co. , was used . determination of the zeta potential and size of the drugs was performed using zeta sizer nano zs model manufactured by malvern in england which had the measurement range from 6 nm to 0.6 m , zeta potential measurement range from 120 mv to + 120 mv , and molecular weight measurement range from 10 to 2 10 daltons . microscope imaging of this research includes afm ( atomic force microscope ) . in this study for the cellular studies , hepg2 cells ( human liver hepatocarcinoma cell line ) were used . the culture medium contained 5 ml fbs 10% , 0.5 ml penicillin and streptomycin mixture , 5 ml glutamine amino acid , and 0.5 ml antibiotics . after the proper cells ' growth , they were separated through trypsin enzymes and fbs solution and were centrifuged at 2000 rpm for 5 minutes . having the cells being counted , the required volume for the study was calculated ( 200 thousand cells ) . ( obtained through calculating ) and 4 cc culture medium were added to the wells , 200 of gadopentetate dimeglumine ( magnevist ) was injected to 3 wells while to the 3 other wells 200 gadopentetate dimeglumine - dendrimer ( nanosized magnevist ) was injected ( repeated 3 times ) . the plates were put in 37c incubator for 90 minutes until the drug was properly exposed to cells . the content of each well was transferred to a tube and centrifuged at 1500 rpm from 10 to 15 minutes . as much as 2 ml of culture medium was added to the sediments and cells were decomposed using acid . afterwards , the gadolinium concentration of the tubes was measured through icp - aes technique . this time , in order to determine cytotoxicity of the drugs , 96-well plate was used . 20 cells ( the calculated amount ) and 80 culture medium were added to 21 wells . 3 doses of standard magnevist and nanosized magnevist ( 25 , 50 , and 100 l ) were injected into 18 wells ( repeated for three times ) and no drug was added to the other 3 ( control group ) . after 24 hours , 20 l of mtt solution was added to each well . the plate was covered with an aluminum foil ( reaction in darkness ) and was put in 37c incubator for 3 hours . then , the supernatant was discarded and 100 l of dmso and nacl solution was added to each well . in order to dissolve mtt in the whole solution , the plate was placed on a shaker for a few minutes . finally , their absorption was read by elaisa reader machine at 570 nm . more absorption shows more cell viability . magnetic resonance imaging was performed using 3 t mri machine in in vitro and in vivo environments . 5 doses of synthesized nanosized magnevist ( 0.1 , 0.25 , 0.5 , 0.75 , and 1 molar ) were prepared ( figure 2 ) . 3 t mr imaging was conducted using the following protocol : standard spin echo , # of echoes = 32 , te = 13/26/39/52/66/79/92/105/ 118/145/158/171/184/198/211/237/250/264/ 277/290/303/330/343/356/369/382/396/422 ms , tr = 20/50/100/200/400/2000/3000 ms , matrix = 256 256 , slice thickness = 1/5 mm , fov = 18 18 cm , nex = non . standard spin echo , # of echoes = 32 , te = 13/26/39/52/66/79/92/105/ 118/145/158/171/184/198/211/237/250/264/ 277/290/303/330/343/356/369/382/396/422 ms , tr = 20/50/100/200/400/2000/3000 ms , slice thickness = 1/5 mm , there are two main mechanisms in magnetic resonance imaging : spin - lattice relaxation and spin - spin relaxation . times characterizing these two mechanisms are called spin - lattice relaxation time ( t1 ) and spin - spin relaxation time ( t2 ) . the former time indicates the thermodynamic equilibrium of magnetization , but the latter time shows exponentially signal decay . the signals of the images were obtained using dicomworks software ( 1.3.0.5 version ) in 28 te ( echo delay time ) and 7 tr ( repetition time ) . finally , computing the relaxation times of t1 and t2 was done using matlab ( 1.0.0.1 version ) and microsoft office excel 2007 software . one adult ( 8 weeks old ) male breast cancer model mouse was used for the study . initially , 0.1 ml of anesthetic drug ( mixture of ketamine and xylazine ) was given to the mouse . afterwards , 0.2 ml of nanosized magnevist was injected into the mouse ( iv injection ) . a whole body mr imaging ( at 3 t ) was conducted again to compare the contrast of the image with the previous one . figures 4 and 5 show the chemical reactions between gd , dtpa ( diethylene triamine pentaacetic acid ) , 2 meglumine ( n - methyl glucamine ) , adh ( adipic acid dihydrazide ) , and algnd . then , the coligand ( meglumine ) is conjugated with the complex for greater stability . the result is an amide compound which is known as gadopentetate dimeglumine ( gd - dtpa - meglumine ) . after that , the algnd is loaded and/or conjugated with the compound by the help of edc ( a carboxyl group activator ) , n - sulf - hs ( removal of water effect ) , and adh ( the liker ) . one of them is conjugated with free carboxyl group of dtpa and the other one is conjugated with carboxyl group of citric acid in algnd . besides the conjugation therefore , the final compound will be the new drug ( gd - dtpa - meglumine - dendrimer ) . the gadolinium content of the gadopentetate is shown as mean sd in table 1 . figures 6 and 7 indicate the ft - ir and lc - ms spectrum of standard magnevist . as it can be seen , the ft - ir spectrum of the synthetic magnevist , and standard one is compared . the wide peak in 30004000 cm shows the presence of hydroxyl and carboxyl groups . the observed peak in 27002900 cm is related to the type and nature of aliphatic hydrogen and carbon of the compound . the number reported in lc - ms spectrum ( 938.10000 ) shows the molecular weight of the compound and it is the exact number of the reported molecular weight . determining the c% , h% , and n% of the standard and nanosized gadopentetate by chn analyzer confirms the proper synthesis . as it can be observed in tables 2 and 3 , the numbers calculated from chn analysis data are in accordance with molecular formula . as it was expected , attaching the drug to dendrimer reduces the charge of final compound ( 16.5 to 9.56 mv ) . the algnd has negative charge on its surface , so it can reduce the total drug charge and , as a result , the drug can penetrate a cell ( figure 8) . the size of the nanodrug is 41.93 nm according to the size measurement of zeta sizer ( figure 9 ) . the size differences obtained from zeta sizer and afm can be because of the different conditions of the sample in these 2 methods . in afm , the sample is dry ; however , in zeta sizer , it is a solution , so aggregation is a possibility for this result . the standard magnevist is an extracellular contrast media , so it is not able to enter a cell . attaching the drug to dendrimer makes it an intracellular contrast media . as it can be observed in table 4 and figure 11 the synthetic drug is able to penetrate into the cell probably due to its nanoscale size and total charge reduction ( figure 8) . table 5 and figure 12 show the cytotoxicity of gadopentetate and table 6 and figure 13 show the cytotoxicity of nanosized gadopentetate . table 7 and figure 14 indicate a total comparison between the results . as it can be seen in figure 14 , cytotoxicity ( in hepg2 cell line ) is reduced in nanosized drug compared to standard drug in 50 and 100 doses significantly ( p < 0.05 ) . surprisingly , it was observed that the cell viability is enhanced by increasing the drug dose insignificantly ( p > 0.05 ) . the t1 graph ( signal relative to tr ) the lines show the different doses compared to water . in table 8 , t1 is calculated via ( 1 ) and using matlab software . figure 16 also shows the impact of the synthetic drug on reduction of the t1 value in comparison with water . as it can be observed , the drug can reduce t1 by increasing its doses significantly :
( 1)signal = s0(1etr / t1 ) . the t2 graph ( signal relative to te ) the lines show the different doses compared to water . in table 9 , t2 is calculated via ( 2 ) and microsoft excel software . figure 17 also shows the impact of the synthetic drug on reduction of the t2 value in comparison with water . as it can be observed , the drug can reduce t2 by increasing its doses significantly ( figure 18 ) . so , probably it is a t1 mri contrast agent type :
( 2)signal = s0et2te . as it can be noticed , the relaxivity is enhanced by increasing the drug dose ( linear relation ) . obtaining the linear equation from microsoft excel , the r1 and r2 of magnevist were reported to be 1.5 and 2.9 mms , respectively , so the synthetic drug can increase the relaxivity significantly . as it can be seen clearly , the image contrast is enhanced and the tumor is more recognizable after drug injection . the unique characteristics of the anionic linear globular dendrimer - g1 loaded and/or conjugated on magnevist make it a greater contrast media . the new drug is more stable , more soluble , and biodegradable , has the ability to enter the hepg2 cell line , and has low cytotoxicity . generally , one of the main problems with the conjugation of the drug to dendrimer surface is insolubility of the final solution . the dendrimer used in this research can take a large amount of a drug and be still soluble because of peg in its core . so , without any targeting agent , even though weakly , peg can typically play the role of the targeting agent . so , it does not interact with cell surface and does not destroy the cell membrane . besides , citric acid is one of the intermediates of metabolic pathways and is metabolized in body so quickly that it does not have toxic effects in the body and makes the entire drug biodegradable . even though the results obtained from this research are very promising , further studies are required . if a targeting agent such as monoclonal antibodies , peptides , and aptamers is loaded on the dendrimer surface , more specific contrast media will be created . | despite the great efforts in the areas of early diagnosis and treatment of cancer , this disease continues to grow and is still a global killer .
cancer treatment efficiency is relatively high in the early stages of the disease .
therefore , early diagnosis is a key factor in cancer treatment . among the various diagnostic methods ,
molecular imaging is one of the fastest and safest ones . because of its unique characteristics
, magnetic resonance imaging has a special position in most researches . to increase the contrast of mr images ,
many pharmaceuticals have been known and used so far .
gadopentetate ( with commercial name magnevist ) is the first magnetic resonance imaging contrast media that has been approved by the us food and drug administration . in this study ,
gadopentetate was first synthesized and then attached to a tree - like polymer called dendrimer which is formed by polyethylene glycol core and surrounding citric acid groups .
stability studies of the drug were carried out to ensure proper synthesis .
then , the uptake of the drug into liver hepatocellular cell line and the drug cytotoxicity were evaluated .
finally , in vitro and in vivo mr imaging were performed with the new synthetic drug .
based on the findings of this research , connecting gadopentetate to dendrimer surface produces a stronger , safer , and more efficient contrast media .
gd(iii)-diethylenetriamine pentaacetate - meglumine - dendrimer drug has the ability to enter cells and does not produce significant cytotoxicity .
it also increases the relaxivity of tissue and enhances the mr images contrast .
the obtained results confirm the hypothesis that the binding of gadopentetate to citric acid dendrimer produces a new , biodegradable , stable , and strong version of the old contrast media . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
depression is characterized by a typically chronic course with associated anxiety symptoms as co - morbidity . associated anxiety symptoms may result in greater symptom severity , higher suicidal risk , and poor treatment response than either depression or anxiety alone . a significant overlap exists in the pathophysiologic components of depression and anxiety involving serotonergic , noradrenergic , and gabaergic systems in brain and their treatment . the selective serotonin reuptake inhibitors ( ssri ) and serotonin - norepinephrine reuptake inhibitors ( snri ) are reported to be effective in treating anxiety disorders associated with mdd . desvenlafaxine is a snri that received united states food and drug administration ( us fda ) approval in february 2008 for the treatment of mdd , generalized anxiety disorder ( gad ) , panic disorder , and social anxiety disorders ; in india , central drugs standard control organisation ( cdsco ) approved desvenlafaxine on july 2009 for mdd . desvenlafaxine 's novelty lies in the fact that it inhibits both norepinephrine and serotonin uptake . escitalopram , a ssri is approved for mdd and gad in adults and children over 12 years of age . head - to - head comparison of the two drugs in general population is lacking except one such trial conducted on post - menopausal patients . therefore , this study was undertaken to compare the clinical effectiveness and safety of desvenlafaxine versus the standard antidepressant , escitalopram in patients with mdd associated with symptoms of anxiety . the study was a randomized , controlled , parallel group , open label , phase 4 trial . eligible subjects were adults 18 years and 60 years and of either sex who attended the psychiatry outdoor clinic of a teaching hospital in eastern india with a clinical diagnosis of mdd as per diagnostic and statistical manual of mental disorders , fourth edition , text revision ( dsm - iv - tsr ) . subjects with a baseline hamilton depression rating scale ( ham - d ) score of 7 - 18 ( mild and moderate depression cases ) and a baseline hamilton anxiety rating scale ( ham - a ) score 12 ( vide infra ) were included . exclusion criteria included pregnant , lactating women , suicidal tendencies , catatonic features , patients on antidepressants for last one month , concurrent medical illnesses ( hypertension , uncontrolled diabetes , ischemic heart disease , chronic renal failure , cirrhosis , malignancy ) , subjects with other coexistent psychiatric disorders ( e.g. associated psychotic and maniac features , dementia , low i.q , obsessive compulsive disorders ) or subjects on drugs ( quetiapine , duloxetine , buproprion , cough preparations , aspirin , fluoxetine , sertraline , monoamine oxidase inhibitors , tricyclic antidepressants ) , which are known to interact with the study medications . number iec/1055 ) and written informed consent was obtained from all subjects or their legally acceptable relative ( lar ) as applicable . successive eligible patients were randomized ( unstratified ) using a computer generated random number table with 1:1 allocation ratio to receive either desvenlafaxine ( 50 mg ) or escitalopram ( 10 mg ) once daily for a period of 8 weeks . responder rate was defined as 50% of baseline ham - d score improvement at the 4 and 8 week visit . the study medications were purchased by the department for trial purpose and the entire consignment ( both study drug and comparator ) were of the same manufacturer . the manufacturing company had no role in study design , data collection and analysis , decision to publish , or preparation of the manuscript . the effectiveness outcome measures were changes from baseline to study end of ham - d17 and ham - a . the ham - d scale is a 17 - 21 items observer scale to assess the presence and severity of depressive state in patients , amongst the first 17 items , 9 items are scored 0 - 4 ( 0 = absent , 1 = doubtful or slight , 2 = mild , 3 = moderate , 4 = severe ) whereas the next 8 items are scored 0 - 2 ( 0 = absent , 1 = doubtful or slight , 2 = clearly present ) . the ham - a scale consists of 14 items , each defined by a series of symptoms , and measures both psychic anxiety ( mental agitation and psychological distress ) and somatic anxiety ( physical complaints related to anxiety ) . response to treatment was assessed by 50% decrease in ham - d and ham - a score . safety assessment included changes in vital signs and treatment emergent adverse effects - those reported by the subjects and those elicited by the clinician at every visit . laboratory investigations viz . , hematogram ( hemoglobin , total leucocyte count , differential leucocyte count , and erythrocyte sedimentation rate ) , liver function test , and serum urea and creatinine were done at baseline and at study end visit as a part of safety check . detailed clinical history , drug history , and baseline ham - d and ham - a scores were recorded in a pre - designed case report form . three post - baseline visits were scheduled at 2 weeks , 4 weeks , and 8 weeks after randomization . at each follow - up visit , they were evaluated clinically using ham - d and ham - a rating scores . evaluation of the effectiveness and safety parameters were done in all subsequent follow - up visits as described above . sample size calculation was based on changes in the primary outcome variable ( ham - d score ) . with a 80% power , = 0.05 , standard deviation of ham - d score of 3 , effect size of 2 with equal allocation ratio , the number of evaluable subjects required per group was 36 . however , assuming a 20% dropout rate , we recruited 43 subjects per group in the study . effectiveness analysis was done by modified intention- to - treat basis whereby subjects who had baseline and at least one post - baseline data of ham - d and ham - a were evaluable . missing visit data were substituted by the last observation carried forward strategy . for safety analysis , all randomized subjects who had received at least one dose of the trial medication were considered evaluable . continuous variables ( normal distribution ) were compared between groups by independent sample t - test and within group by paired t - test . for between group comparisons of non - parametric variables , whitney u test and for within group comparison friedman 's anova followed by post - hoc dunn test were used . categorical data were compared using chi - square or fisher 's exact test as appropriate . detailed clinical history , drug history , and baseline ham - d and ham - a scores were recorded in a pre - designed case report form . three post - baseline visits were scheduled at 2 weeks , 4 weeks , and 8 weeks after randomization . at each follow - up visit , they were evaluated clinically using ham - d and ham - a rating scores . evaluation of the effectiveness and safety parameters were done in all subsequent follow - up visits as described above . sample size calculation was based on changes in the primary outcome variable ( ham - d score ) . with a 80% power , = 0.05 , standard deviation of ham - d score of 3 , effect size of 2 with equal allocation ratio , the number of evaluable subjects required per group was 36 . however , assuming a 20% dropout rate , we recruited 43 subjects per group in the study . effectiveness analysis was done by modified intention- to - treat basis whereby subjects who had baseline and at least one post - baseline data of ham - d and ham - a were evaluable . missing visit data were substituted by the last observation carried forward strategy . for safety analysis , all randomized subjects who had received at least one dose of the trial medication were considered evaluable . continuous variables ( normal distribution ) were compared between groups by independent sample t - test and within group by paired t - test . for between group comparisons of non - parametric variables , mann whitney u test and for within group comparison friedman 's anova followed by post - hoc dunn test were used . categorical data were compared using chi - square or fisher 's exact test as appropriate . detailed clinical history , drug history , and baseline ham - d and ham - a scores were recorded in a pre - designed case report form . three post - baseline visits were scheduled at 2 weeks , 4 weeks , and 8 weeks after randomization . at each follow - up visit , they were evaluated clinically using ham - d and ham - a rating scores . evaluation of the effectiveness and safety parameters were done in all subsequent follow - up visits as described above . sample size calculation was based on changes in the primary outcome variable ( ham - d score ) . with a 80% power , = 0.05 , standard deviation of ham - d score of 3 , effect size of 2 with equal allocation ratio , the number of evaluable subjects required per group was 36 . however , assuming a 20% dropout rate , we recruited 43 subjects per group in the study . effectiveness analysis was done by modified intention- to - treat basis whereby subjects who had baseline and at least one post - baseline data of ham - d and ham - a were evaluable . missing visit data were substituted by the last observation carried forward strategy . for safety analysis , all randomized subjects who had received at least one dose of the trial medication were considered evaluable . continuous variables ( normal distribution ) were compared between groups by independent sample t - test and within group by paired t - test . for between group comparisons of non - parametric variables , whitney u test and for within group comparison friedman 's anova followed by post - hoc dunn test were used . categorical data were compared using chi - square or fisher 's exact test as appropriate . the flowchart of study participants is depicted in figure 1 . of the 86 randomized subjects , 77 ( escitalopram group = 39 , desvenlafaxine group = 38 ) were evaluable as per the modified intention - to - treat analysis , since 9 subjects were lost to follow up . the mean age in the escitalopram group was 40 10.6 years and in the desvenlafaxine group was 41.9 8.5 years ; the difference was not statistically significant ( p = 0.27 ) . a total 64.1% were males in the escitalopram group and 60.5% in the desvenlafaxine group . the disease duration at screening were also comparable ( p = 0.19 ) between groups . no concomitant psychiatric medications were used , as elicited during drug history ; however , 5 subjects ( 3 in test and 2 in control ) were on anti - hypertensives and were well - controlled throughout their study period . consort flowchart of study participants baseline ham - d ( p = 0.63 ) were comparable in the two treatment arms . the responder rates defined as 50% improvement in ham - d score from baseline at 8 weeks were 79.48% in the escitalopram group versus 73.68% in the desvenlafaxine group ; the difference was not statistically significant ( p = 0.59 ) . responder rates for ham - a score at 8 weeks were 76.92% and 71.05% in the escitalopram and desvenlafaxine groups , respectively . the difference was not statistically significant ( p = 0.61 ) [ table 1 ] . the responder rates assessed at 8 weeks visit for both ham d and ham a were higher in the escitalopram group compared to the desvenlafaxine group , though the difference was not statistically significant . number of patients responding to 50% decrease in ham - d and ham - a scores ham - d scores showed comparable results at all visits . however , escitalopram faired significantly better in ham - a scores than desvenlafaxine at all visits . comparison of ham - d and ham - a scores are listed in table 2 , 3 , and 4 . between group comparison of ham - d scores between group comparison ham - a scores between group comparison of changes in ham - a score from baseline within group changes of both scores , from baseline to subsequent visits in both treatment arms , were statistically significant ( p < 0.01 ) . between groups comparison of the median ham - d scores showed no significant changes , but there was a statistically significant difference in ham - a scores between the treatment arms both at baseline , subsequent follow - up visits , and at the end of the study . safety data analysis revealed that 10 out of 39 subjects ( 25.64% ) in the escitalopram group and 14 out of 38 ( 36.84% ) in the desvenlafaxine group reported at least one adverse event . the common adverse events were nausea , vomiting , discomfort , insomnia , somnolence , and fatigue . all adverse events were non - serious and mild in severity and did not require treatment interruption or study drug withdrawal . the study results indicate that both escitalopram and desvenlafaxine , which are widely used antidepressants , were also beneficial in reducing anxiety symptoms . the effectiveness of both drugs in controlling anxiety symptoms in mdd subjects appear to be comparable as there was no statistically significant difference in the responder rates . this difference was , however , present since baseline ; therefore , this baseline difference could attribute to the differences in subsequent visits . reduction of median ham - a score was more in the escitalopram group ( baseline 24 - 5 at the end of study ) compared to the desvenlafaxine group ( baseline 26 - 14 at the end of study ) . in clinical practice , a 50% decrease in the scores holds greater relevance than an absolute score decrease . since the 50% responder rate were similar in both the groups in the follow - up visits , escitalopram and desvenlafaxine have comparable effectiveness in controlling symptoms of anxiety with depression . our result findings were in concurrence with a randomized , double blind placebo - controlled , multicenteric , flexible dose trial in adult subjects of generalized anxiety disorder ( gad ) by bose a et al . , where escitalopram was compared with venlafaxine extended release ; the overall efficacy analysis suggested that escitalopram and venlafaxine are both effective treatments for gad , but escitalopram was better tolerated . compared the efficacy and safety of desvenlafaxine and escitalopram in mdd with symptoms of anxiety in postmenopausal women , and the study demonstrated that there was no significant difference in their efficacy as evaluated on ham - d17 scores . desvenlafaxine treatment achieved 50% response in 56 - 58% ( ham - d score ) and 41 - 48% our study achieved a higher response rate , 73.68% in ham - d score and 73.7% in ham - a score . also , a review conducted by ali and lam showed that escitalopram demonstrates better efficacy than other ssris and similar efficacy to snris which is consistent with the results of our study however , a systematic review on the comparative effectiveness of various ssris and snris on mdd accompanied by anxiety or insomnia or pain in 19 head - to - head trials suggested that ssris do not differ in effectiveness , though the evidence was moderate in nature . the current study is consistent with previously reported individual results and adverse events for the study medications . in terms of tolerability , escitalopram was better tolerated than desvenlafaxine , as escitalopram indicated lesser incidence of adverse effects . the study limitations were that we could not undertake a double blind study due to logistic reasons and a longer active duration of treatment would be more informative . over the last two decades , there has been much progress in our understanding of epidemiology , neurology , and treatment of depression and anxiety disorders . whilst ssris are regarded as first - line treatment in most depression and anxiety disorders , snris are receiving increasing considerations and desvenlafaxine received regulatory approval . in conclusion , this study indicates that desvenlafaxine is comparable to escitalopram in patients of depression with symptoms of anxiety , and escitalopram is better tolerated . | aim : selective serotonin reuptake inhibitors ( ssri ) and serotonin - norepinephrine reuptake inhibitors ( snri ) are effective in treating anxiety disorders associated with major depressive disorder ( mdd ) .
this randomized , controlled , parallel - group , open - label , phase 4 trial ( ctri/2012/08/002895 ) was undertaken to compare the effectiveness and safety of desvenlafaxine versus escitalopram , a standard antidepressant.materials and methods : effectiveness was assessed using the hamilton depression rating scale ( ham - d17 ) and hamilton anxiety rating scale ( ham - a ) .
response to treatment was assessed by 50% decrease of baseline scores ( responder rate ) .
safety and tolerability was evaluated by changes in routine laboratory parameters , vital signs , and adverse events reported by the subject and/or observed by the clinician.results:responder rates for both ham - a and ham - d scores at 8 weeks were better in the escitalopram group compared to the desvenlafaxine group ( ham - a 76.92% vs. 71.05% ; ham - d 79.48% vs 73.68% ) but the differences were not statistically significant ( p = 0.59 and p = 0.61 ) . within group changes of both scores , from baseline to subsequent visits in both treatment arms were statistically significant ( p < 0.01).conclusion : the effectiveness of desvenlafaxine was comparable to escitalopram , but escitalopram was better tolerated . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the components evolving pungency in chili peppers have been established as a mixture of acid amides of vanillylamine and c8 to c13 fatty acids , also known as capsaicinoids . capsaicinoids are secondary metabolites and are synthesised by glands at the join of the placenta and the pod wall of pungent peppers . the effect of capsaicinoids on human health has been widely investigated . for instance , it is beneficial in low concentration against gastric injuries , stimulates cation channels ( na , k , and ca ) in sensory receptor membrane , evokes pain , and activates autonomic reflexes . environmental factors and the circumstance of cultivation influence capsaicinoid content of the pods [ 6 , 7 ] , while probably a higher impact on pungency by the genotype is present [ 8 , 9 ] . besides , the amount and proportion of capsaicinoids are changing during the ripening process of the pods [ 1013 ] . flavonoids represent a significant subgroup of polyphenols and naturally occur in high concentration in wild mint and grape while generally pungent peppers have moderate level of polyphenol content . the health protective attributions of them are mainly associated with preventing cancer through inhibiting certain enzymes and suppressing angiogenesis . the polyphenol content in pungent peppers is found to be influenced by genotype and the ripening process [ 1820 ] . ascorbic acid , the main component of vitamin c , is very abundant in fresh capsicum species and has been found to be beneficial in maintaining collagen synthesis and healthy immune - system and also has antitumor properties [ 2123 ] . the content of ascorbic acid is highly varying among cultivars and ripening stages [ 24 , 25 ] ; in addition , the utilised agricultural techniques play significant role in the final amount of ascorbic acid in the pods . numerous cultivars of pungent pepper are nowadays available ; however , many of them have not been analysed for their quality and nutritional components . the objective of the present work is to investigate capsaicinoid , polyphenol , and vitamin c content in six hybrids of chili pepper ( bandai , beibeihong , lolo , chili 3735 , fire flame , and star flame ) using recently developed liquid chromatographic method in the determinations . the plants were cultivated with convention horticultural practices in the experimental field of szent istvn university , gdll , hungary . bandai f1 ( bandai ) and beibeihong 695 f1 ( beibeihong ) which belong to capsicum frutescens and lolo 736 f1 ( lolo ) and chili 3735 f1 ( c3735 ) which belong to capsicum annuum were all purchased from east - west seeds company , from thailand , while star flame and fire flame ( both capsicum annuum ) were purchased from seminis , hungary . the pods of bandai , beibeihong , lolo , c3735 , and fire flame are red when fully ripe , while star flame has vivid yellow pods . peppers with intermediate pungency level were selected for the investigation because those have multiple utilization methods . those peppers involved in the recent study have limited data available for breeders and growers ; thus , it makes them important for research work . star flame and fire flame are commercially available in certain european countries but not yet in hungary . the determination of capsaicinoid content was made following the method of daood et al . . three grams of well - blended pepper sample were crushed in a crucible mortar with quartz sand . to the macerate 50 ml of methanol ( analytical grade ) was added and the mixture was then transferred to a 100 ml erlenmeyer flask . the mixture was subjected to 4 min long ultrasonication ( raypa , turkey ) and then filtered through filter paper ( munktell , germany ) . the filtrate was more purified by passing through a 0.45 mm ptfe syringe filter before injection on the hplc column . after suitable dilution , the extract was injected to nucleodur c18 , cross - linked ( isis , from macherey - nagel , dren , germany ) . the separation was performed with isocratic elution of 50 : 50 water - acetonitrile and a flow rate of 0.8 ml / min . fluorometric detection of capsaicinoid was carried out at ex : 280 nm and em : 320 nm . peaks referring to different capsaicinoids were identified by comparing retention times and mass data ( daood et al . ) of standard material ( purified from pungent red pepper , with 99% purity , by plantakem ltd . , sndorfalva , hungary ) with those appearing on chromatogram of samples . capsaicinoid compounds are referred as follows : nordihydrocapsaicin ( ndc ) , capsaicin ( cap ) , dihydrocapsaicin ( dc ) , homocapsaicin 1 - 2 ( hcap1 - 2 ) , and homodihydrocapsaicin 1 - 2 ( hdc1 - 2 ) . scoville heat unit ( shu ) was calculated by the following algorithm:(1)cap16,1+dc16,1+ndc9,3+hcap1+hcap28,6=scoville heat unit.all variables are expressed in g / g dry weight basis . five grams of well - blended pepper sample were replaced into an erlenmeyer flask and then 10 ml distilled water was added to the sample and subjected to ultrasonication force using ultrasonic bath for 30 sec . then , 15 ml of 2% acetic acid in methanol was added to the mixture which was shaken by a mechanical shaker for 15 min . next day after filtrating the mixtures , a further cleanup of the filtrates was made by passing through the mixture a 0.45 m ptfe hplc syringe filter . that followed by injection on the hplc column for the analysis of phenols . nucleosil c18 , 100 , protect-1 ( macherey - nagel , dren , germany ) , 3 m , 150 4.6 column was used . the gradient elution was done using 1% formic acid ( a ) in water , acetonitrile ( b ) , and flow rate of 0.6 ml / min . gradient elution started with 98% a and 2% b and changed in 10 min to 87% a and 13% b and in 5 min to 75% a and 25% b and then in 15 min to 60% a and 40% b ; finally it turned in 7 min to 98% a and 2% b. the peaks that appeared on the chromatogram were identified by comparing their retention times and spectral characteristics with available standards such as catechin , quercetin-3-glucoside , kaempferol , luteolin - glucoside , and naringenin - glucoside ( sigma - aldrich ltd . , hungary ) . quantitation of phenol components having maxima absorption at 280 nm were quantified as catechin equivalent and flavonoids were quantified as kaempferol - equivalent at 350 nm [ 29 , 30 ] . the standard material was singly injected as external standard as well as being cochromatographed ( spiking ) with the samples . five grams of well - homogenised sample were disrupted in a crucible mortar with quartz sand . to the macerate 50 ml of metaphosphoric acid ( analytical grade ) was gradually added and the mixture was then transferred to a 100 ml erlenmeyer flask closed with stopper and then filtered . the filtrate was purified in addition by passing through a 0.45 mm ptfe syringe filter before injection on hplc column . the analytical determination of ascorbic acid was performed on c18 nautilus , 100 - 5 , 150 4.6 mm ( macherey - nagel , dren , germany ) column with gradient elution of 0.01 m kh2po4 ( a ) and acetonitrile ( b ) . the gradient elution started with 1% b in a and changed to 30% b in a in 15 min ; then ; it turned to 1% a in b in 5 min . the highest absorption maxima of ascorbic acid under these conditions were detected at 265 nm . for quantitative determination of ascorbic stock solutions and then working solutions were prepared for each compound to make the calibration between concentration and peak area . a hitachi chromaster hplc instrument , which consists of a model 5110 pump , a model 5210 auto sampler , a model 5430 diode array detector , and a model 5440 fluorescence detector , was used for the determination of all compounds . since the methods used in the different chromatographic determinations are derived from the literature ( validated protocols ) we dealt with only measuring the limit of detection ( lod ) and quantification ( loq ) and linearity curves of different compounds under the conditions of our laboratories . the lod and loq were calculated from standard solutions and samples as the concentrations of analytes at peak / noise of 3 times and 10 times , respectively . the dry matter content was measured as a proportion of fresh and dried fruit weight . for each independent variable a one - way linear model ( lm ) was fitted , where ripening stage was set as explanatory ( factor ) variable . prior to model fitting assumptions were checked by plot diagnosis . in the analysis of the major compounds ( shu , cap , naringenin - diglucoside , ascorbic acid , and dry matter ) among the six hybrids another lm was made , where hybrid was set as explanatory ( factor ) variable . all statistical analyses were performed in ibm spss 22 software ( ibm co. , usa ) and microsoft excel ( microsoft co. , usa ) . to adapt the applied chromatographic protocols under the conditions of our laboratories , certain parameters such as lod , loq , and linearity curve were studied . the values depicted in table 1 show that the used methods are accurate enough to carry on precise and sensitive determination of polyphenols , capsaicinoids , and ascorbic acid . this statement is based on the low levels of loq , lod found for all tested compounds . the concentration of such compounds in our samples is much higher than the levels of loq and lod . moreover , values obtained for regression coefficient indicated that the methods can be applied at wide range of concentrations for different compounds in chili samples . the major components evolving pungency in our hybrids are ndc , cap , and dc . besides , we could identify the homologues of cap and dc which are hcap1 , hcap2 and hdc1 , hdc2 , respectively ( figure 1 ) . detected the 7 compounds , in addition to nonivamide which is a straight - chain nonoyl vanillylamide analog of cap . in beibeihong advance in ripening did not affect the major capsaicinoids ( cap , ndc , and dc shown in table 2 ) , while it influenced hcap1 and hdc1 ( both p 0.032 ) including a slight decrease from green to colour - break stage and then a low increase at the final stage . in bandai , unlike beibeihong the ripening affected the major and minor capsaicinoids as well ( all p 0.027 ) . the changing of cap included a notable decrease between the initial stage and the colour - break stage . on dc , a straight increasing of hdc1 was observed , while on hpc1 the same tendency like that in hpc1 of beibeihong was observed . focusing on the major compounds of capsaicinoids , bandai hybrid could be characterised with pungency loss , while in beibeihong those compounds did not change during ripening . in the study by gnayfeed cap reached the highest value in f-03 cultivar ( c. annuum ) at the initial green stage , similarly found in bandai , but its content in f-03 did not change significantly with ripening . the obtained results suggest even in the same species ( c. frutescens ) that the hybrids have a different characteristic in ripening regarding capsaicinoid contents . it is in accordance with findings of merken and beecher who also measured the maximal capsaicinoid content in 3 different c. frutescens peppers in 3 variant times after flower budding . in lolo the ripening slightly affected but not significantly cap , while it increased hcap2 ( p = 0.001 ) . after the colour - break stage the amount of hcap1 decreased ( p = 0.008 ) to undetectable level . in c3735 ripening decreased ndc , cap , dc , hdc1 ( all p 0.011 ) , and nonmarginally hdc2 , while hcap1 was absent or under detection limit at all ripening stages . therefore , most of the compounds showed a decreasing tendency during ripening of c3735 , so a remarkable pungency loss was observed . on the contrary , iwai found the peak 40 days after flowering and then a gradual decrease of capsaicinoid content in a c. annuum pepper . because of the different scale used by iwai et al . , it is difficult to compare to our data , but probably the 40 days after flowering is roughly equal to the green stage we used . observed in c. annuum cultivars that capsaicinoids reached maximum level at the colour - break stage and then started declining in hungarian spice pepper ( c. annuum ) , which is a characteristic of pungency change that we did not observe . the change in capsaicin content during ripening of pepper may relate to activity of some enzymes that interfere in the ripening dynamics . the amount of capsaicinoids has been investigated in relation with several enzymes [ 10 , 33 , 34 ] . contreras - padilla and yahia showed that peroxidase activity started increasing , when the amount of capsaicinoid started to decrease in habanero and de arbol , while in piquin it began to increase before the decrease of capsaicinoid . they concluded that peroxidase enzyme is involved in capsaicinoid degradation and that attribution is a genotypic characteristic . . found higher phenylalanine ammonia - lyase activity in green stage than in red stage . in addition , bernal et al . observed that the operation of capsaicinoid synthetase enzyme is more influenced by the availability of precursors and the conditions of forming than its substrate specificity . a study concerning the maturation of habanero ( c. chinense ) proved that green pod contains four times less capsaicin than ripe red ones , while we found less difference and even more capsaicin in green stage ( e.g. , bandai ) ; however , none of our investigated hybrids belong to c. chinense . they also reported that dc content is seven times less in green pods as compared to red ones , while we found only a slight decrease of dc between the green and red stages . since there is no available standard for myricetin and vanillic acid in our laboratory , they were tentatively identified based on comparison of their spectral characteristics and retention behaviour on the hplc column with those found in the literature . due to the high content of vanillic acid - derivative , catechin , and naringenin - diglucoside , those compounds were found to be the dominant polyphenols , which have maxima absorption at 280 nm ( figure 2 ) . the minor compounds were luteolin - rutinoside , quercetin - glucoside , quercetin - glycosides , myricetin , and kaempferol - derivative ; all were detected with maxima absorption at 350 nm and also luteolin - glucoside occurs in higher concentration and is detected at 350 nm ( figure 3 ) . in beibeihong , ripening increased catechin , luteolin - rutinoside , quercetin compounds , myricetin , and kaempferol - derivative ( all p 0.02 shown in table 3 ) , while it decreased vanillic acid content ( p < 0.001 ) . in bandai ripening increased all compounds ( all p 0.002 ) except vanillic acid and luteolin - rutinoside which statistically remained unchanged during ripening stages . in quercetin - glucoside , myricetin , and kaempferol - derivative the highest values were measured in the middle of the ripening . most of the studies regarding polyphenol constitution of pungent pepper focus on the green ( initial ) and red ( final ) ripe stages but omit the intermediate or colour - break stage . howard et al . found that quercetin decreased , while luteolin did not change with ripening of tabasco ( c. frutescens ) . on the contrary , we found an increase of quercetin - related compounds in both c. frutescens hybrids and also an increase of luteolin - rutinoside in beibeihong and of luteolin - glucoside in bandai . in lolo the ripening significantly decreased vanillic acid ( p < 0.001 ) but increased catechin , luteolin - rutinoside , luteolin - glucoside , and myricetin ( all p < 0.001 ) . in c3735 vanillic acid decreased ( p = 0.007 ) while catechin , naringenin - diglucoside , and myricetin increased ( all p 0.019 ) . howard et al . stated that quercetin had either increasing or decreasing tendency depending on cultivar ; also no change was observed during maturity stages of certain cultivars on c. annuum peppers . we could only confirm the last statement that none of the quercetin - related compounds changed when the pods changed from green to red in c. annuum peppers studied . according to materska and perucka the most abundant flavonoid compounds in the green stage were quertecin-3-o - l - rhamnoside and luteolin - related compounds , and with ripening those phytochemicals decreased . in the present work particularly in red stage contained higher amounts of luteolin - related in lolo , while in quercetin - glycoside content no change was detected in both c. annuum hybrids . the disappearances of flavonoids are parallel to capsaicinoids accumulation because the synthesis of flavonoids may converge with the capsaicinoid pathways . the only nonflavonoid phenolic acid detected in our peppers is vanillic acid , and it is the only polyphenol compound which decreased or stayed unchanged during ripening , while the flavonoids mostly increased with advance of ripening . at the same time kawada and iwai found a direct relation between dc and vanillic acid ; they fed rats with dc and then detected vanillic acid in a notable amount in the urine of the rats . this experiment may also support our findings that vanillic acid is certainly related to capsaicinoids and has similar dynamics during ripening in pungent pepper . according to tsao , flavonols ( kaempferol , quercetin , and myricetin ) consist of highly conjugated bindings and a 3-hydroxy group , whose attributions are considered very important in evolving high antioxidant activity . in our hybrids the highest levels of the latter flavonoids were obtained at the orange or red stage that makes the pepper of higher nutritive value . by the applied hplc method only l - ascorbic acid was found in the extract of all hybrids ( figure 4 ) . it was found that ascorbic acid increased during ripening in all hybrids ( p 0.001 shown in table 4 ) . in beibeihong and bandai after green stage a more notable increase was observed than after the colour - break stage where the ascorbic acid gradually increased , while in bandai at the red stage the average of ascorbic acid was less than in orange stage . in lolo the green and colour - break stage did not differ significantly , while the red stage contained the most . in c3735 the increasing tendency in the investigated hybrids is in accordance with that found in previous works [ 12 , 20 , 24 , 25 ] which concluded that the more ripened the pods were , the more ascorbic acid could be measured from them . with ripening the pepper pods store more reducing sugars , which are the precursors of l - ascorbic acid , and that explains the increasing vitamin c content with ripening in all hybrids included in our study . on the contrary , shaha et al . showed a different dynamics of the ascorbic acid accumulation , because they found the highest level in yellow ( intermediate ) stage and the declining level in the red mature stage . that agrees with our finding in bandai , where the highest average values ( 1005.2 100.73 g / g ) were observed in the orange or colour - break stage ( 937.9 78.04 g / g ) , although these are not significantly higher than that determined in red stage ( 787.4 131.21 g / g ) . probably it is also due to the high standard deviation present in the red stage . the recommended daily allowance ( rda ) is 60 g fw ; according to dias 100 g fresh chili provides about 143.7 g vitamin c. focusing on the hybrids of the recent study at the green stage all of them failed to reach this value , while at colour - break stage beibeihong and c3735 reached it and finally at the red stage all of them achieved the rda . the comparison among the hybrids has been done on the main parameters : cap , ascorbic acid , naringenin - diglucoside , scoville heat unit , and dry matter ( shown in table 5 ) , at the final stage of the hybrids , which is generally considered as the most valuable in nutrition and having the most processing possibility . a higher dry matter signifies a better fruit quality and also a higher nutritional concentration when fresh weight basis is used to express nutritional parameters . we measured 2530% dry matter content in c. frutescens , which produces more seeds and smaller pods , while in the peppers belonging to c. annuum this value lessens to 14.115.8% . the cap content was found to be statistically the same in all red coloured c. annuum hybrids , while the yellow hybrid star flame ( 234.3 45.23 g / g ) contained more , and bandai ( 1176.1 112.1 our findings roughly agree with the result of sanatombi and sharma who showed that the cultivars belonging to c. annuum contain less capsaicin than others of capsicum frutescens . beibeihong was an exception , because it statistically contained the same amount as c. annuum hybrids . focusing on the scoville heat units , the highest cap value in bandai corresponds to the highest shu ( 98090.8 9920.74 ) observed among the hybrids investigated . bernal et al . measured 87300276500 shu in ripe c. frutescens peppers , but in bandai hybrid the value found was close to the lower level determined by the authors . among c. annuum hybrids , star flame was found to be a prominent pepper regarding shu ( 66201.2 7132.51 ) comparing to the measurements of topuz and ozdemir 9720 2061.8 and giuffrida et al . beibeihong and bandai have not been investigated by pungency profiles before . comparing to tabasco ( also belonging to c. frutescens ) the shu measured by giuffrida et al . ( 21348 867 ) is below our values of the latter hybrids , although cap content determined by giuffrida et al . ( 917 34 g / g ) is between the values measured in bandai ( 1176.1 112.1 g / g ) and beibeihong ( 311.8 63.25 g / g ) . interestingly , bandai hybrid had the highest cap content at the same time ; it also had the lowest ascorbic acid amount . topuz and ozdemir described in pungent peppers that the content of ascorbic acid and capsaicinoid is positively related , which we could not underline in case of bandai . the highest ascorbic acid was measured in ripe fire flame ( 3689.4 160.61 g / g ) and this value is well above the one measured in hungarian spice pepper where approximately 1800 g / g converted to fresh weight basis , and it is more than the one detected in new mexican - type chili peppers 2766 g / g . naringenin - diglucoside content ranged from 93.5 4.26 to 368.8 30.77 g / g and had higher values in c. frutescens hybrids compared to c. annuum hybrids , probably because of the higher dry matter content of such peppers . naringenin ( belonging to flavanones ) , being an initial compound in the chain of flavonoid synthesis , explains the high content present in our samples . other studies found also naringenin - glucosides as a dominant flavonoid in peel of pungent pepper and in sweet pepper alike . the investigated new hybrids can be regarded to be good sources of phytochemicals for future applications . we recommend using the red coloured hybrid fire flame to produce chili products with high content of vitamin c. on the other hand , when heat principles ( capsaicinoid ) for food and pharmaceutical industries are required , the use of star flame and bandai can be suggested , as they contain a level of capsaicin around 440.8 17.22 g / g and 1610.2 91.46 g / g , respectively . in order to get the maximum level of the bioactive phytochemicals such as vitamin c , capsaicinoid , and polyphenol it is important to characterize the ripening dynamics of each of these new hybrids . for example , the highest level of capsaicin could be found in the green stage of ripening of bandai and c3735 hybrids , while in the other hybrids pungency was similar in all ripening stages . | six hybrids were subjected to chromatographic analyses by hplc for the determination of phytochemicals such as capsaicinoid , polyphenol , and vitamin c. the dynamics of ripening of 4 of the hybrids were also characterised .
seven capsaicinoids could be separated and determined ; the major compounds were nordihydrocapsaicin , capsaicin , and dihydrocapsaicin , while homocapsaicin and homodihydrocapsaicin derivatives were detected as minor constituents .
capsaicin content ranged between 95.5 4.15 and 1610.2 91.46 g / g fw , and the highest value was found in bandai ( c. frutescens ) at the green ripening stage .
the major capsaicinoids had a decreasing tendency in bandai and chili 3735 hybrids , while no change was observed in beibeihong and lolo during ripening .
nine polyphenol compounds were detected including 8 flavonoids and a nonflavonoid compound in the pods of all hybrids .
the major components were naringenin - diglucoside , catechin , and vanillic acid - derivative and luteolin - glucoside .
naringenin - diglucoside ranged from 93.5 4.26 to 368.8 30.77 g / g fw .
except vanillic acid - derivative , dominant polyphenols increased or remained unchanged during ripening .
as for vitamin c , its content tended to increase with the advance in ripening in all hybrids included in this study .
the highest value of 3689.4 39.50 g / g fw was recorded in fire flame hybrid . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
north american agroecosystems are highly manipulated , particularly in the united states . nonetheless , certain key insects persist within these ecosystem , acting as pests ( consumers of or damaging to crops ) , as commensals , and as beneficials . one key beneficial insect found in many u. s. agroecosystems is the lady beetle coleomegilla maculata ( coccinellidae : coleoptera ) . c. maculata is a widely distributed 1 native north american species complex 2 and is generally accepted as an ecological indicator 3 and used in agricultural and ecological research as a representative non - target organism 4 , 5 . given its importance in agricultural ecology , the biology of c. maculata has been well studied . studies of the diet of c. maculata have evaluated nutrition , focusing on pollen 6 , 7 , prey 8 , and aiming at artificial diet development 9 . in the present work , gene expression in otherwise identical inbred specimens of this species of lady beetle are compared after restricted dietary intake , during the imaginal ( adult ) stage , of either pollen or insect eggs . the genetic resources described herein will facilitate further research on diet and digestive function in omnivorous organisms . while c. maculata is accepted as an ecologically important lady beetle , it has not been widely utilized as a biological control agent . some species of the family coccinellidae are used as biological control in the us , such as hippodamia convergens and adalia bipunctata
10 . harmonia axiridis , an introduced but invasive lady beetle in the us , has recently been modified to produce transgenic research organisms , and will be useful as a genetic model 11 . c. maculata has characters that make it a preferred model , including ease of maintenance 12 and visible phenotypic mutant strains ( 13 and unpublished results ) . the genome size of c. maculata is relatively small , estimated at 0.19 pg 14 ; based on standard conversion , assuming a diploid genome : this is roughly equivalent to 186 mbp 15 so sequencing the full genome of this insect should be achieveable . a reference transcriptome of c. maculata has been published to the internet ( http://2ei.univ-perp.fr/?page_id=89 , accessed 22 july 2014 ) . the transcripts provided by the study described herein will facilitate further molecular genetic , biochemical , and physiological investigation . because the insects used for this study were highly inbred and also siblings , the sequences represent a limited number of alleles , and do not represent the wider populations of the species in mississippi or the broader environment . on the other hand , the sequences obtained may be used for a baseline to determine population genetics and identify variability in the species and between subspecies . assemblies of the total rna yielded 33,833 assembled sequences from the pollen fed treatment and 34,167 assembled sequences from the insect egg fed treatment . average sequence lengths were 1403 , 1300 , and 1456 respectively . while many of the treatment group sequences were identical or nearly so , there were representatives of unique sequences as shown in figure 1 . because the assemblies were de novo , many unique and unclassified sequences were expected . to gain an insight on the similarities between the assemblies , sequences were analyzed by ncbi blast ( us national library of medicine ) 16 using the tblastx the resulting blast spreadsheets were sorted and the longer and more similar ( to ncbi accessions ) sequences were examined . the remaining sequences amounted to around 10% of the total assembled sequences : 3,376 from the pollen fed treatment , and 3,358 from the insect egg fed treatment ( table 1a , table 1b ) . the sequences from both treatments were primarily similar to other insect sequences ( 95% , + /- the largest portion of similarities by insect order was to coleoptera , as expected ( 49% ) , as shown by two pie charts , one for each treatment , in figure 2 . the individual insects used for sequencing were inbred siblings , thus many identical sequences from the two samples were expected . the greatest number of similar sequences in genbank came from the two beetle species tribolium castaneum and dendroctonus ponderosae . to validate the baseline similarity of our sequence sets , sixteen sequences that were most closely related to the same genbank sequence , and at similar expect values and similar lengths , were chosen from each treatment and compared pairwise in blast ( blast two sequences option ) . results are shown in table 2 ; all comparisons were at least 99% identical at the nucleotide level . these results support the assumption that the two sets of sequences represent nearly identical specimens , differing primarily in those transcripts of genes responding to diet provided to the adult insects . also as expected , some sequences that were unique to the treatments were associated with the diet 17 . among the pollen fed sequences were hits similar to plant sequences , and among the egg fed sequences were hits similar to the genus of the insect eggs , lygus spp . interestingly , some of the egg diet sequences were nearly identical ( e - value 0 ) to a virus recently described from lygus lineolaris 18 . eggs used as diet were carrying the virus , indicating that the virus was present in the laboratory colony and was able to resist degradation by the digestive system of c. maculata . the implications of this finding may be important for future pest control strategies aimed to utilize genetically modified or pathogenic viruses . while the unique sequences in pollen - fed transcripts appear to be related to carbohydrate cleavage , which seems logical for animals digesting plant materials , the unique sequences from the egg - fed did not appear to match any obvious category of transcript , other than the insect virus 18 mentioned earlier . further analyses of the transcripts reported here will provide insight on genes that are linked to differential metabolism of plant and animal based diets . the sequences identified here , after validation among further representatives of this species , will be used to measure quantitative changes in gene expression between insects utilizing multiple sources of foods , and those that are deprived of specific dietary components . potential projects include varying diet at different stages of insect development ; this species is known to utilize different diet components at different stages of development 19 - 21 . another possibility is to evaluate genetic responses to specific prey , as c. maculata has been shown to utilize prey of specific sizes and species 22 . this will help us understand how to produce high quality generalist predator biological control agents , and assure conservation of beneficial insects in our constantly changing world environment . the details of the genes expressed by this omnivorous insect , and their correlation with diet and nutrition , will provide insights into nutritional health of other omnivores including humans . lady beetles used to establish laboratory colonies were collected from fields surrounding the usda - ars and mississippi state university delta research and extension center in stoneville , ms , 38776 . insect cultures were maintained in the national biological control laboratory at stoneville , ms without wild specimen introgression from august 2010 through the time of rna sample collection in march 2013 . insects were reared as larvae in petri dishes of sizes ranging from 35 to 250 mm with mesh glued into one side of the dish for ventilation , and as adults in 5.25 x 5.25 inch cages 12 . temperature was generally maintained at 24 c for 16 lighted hours and 19 c for 8 dark hours in percival ( perry , ia ) e30b growth chambers . larvae and adults were fed ad libitum a combination of pollen , daphnia , brewer 's yeast , honey , and eggs of laboratory cultures of lygus spp . water was provided in 1.5 ml microcentrifuge tubes with caps removed and plugged with cotton . inbreeding of beetle stock was performed by isolating individual gravid females from the primary wild type colony , collecting and rearing all eggs from individual females , and continuing culture using only offspring of the most fertile and fecund female . from the resulting culture the inbreeding step ( female selection ) was repeated for a total of six isofemale ( i6 ) selection steps . insect specimens from a single egg mass collected from the i6 colony were fed standard diet as larvae . surviving individuals were isolated after pupation and provided either pollen alone or lygus eggs alone upon adult eclosion . specimens were spray washed with reverse osmosis ( ro ) water to remove any food particles . after one hour isolation ( resting from wash and away from food ) specimens were briefly anaesthetized with carbon dioxide . insects were transferred to sample tubes and crushed whole in rna extraction buffer using blue kontes ( kimble chase , thermo fisher scientific , waltham , ma ) pestle . total rna was extracted using usb prepease total rna kit following manufacturer instructions ( affymetrix , santa clara , ca ) . samples were measured using a nanodrop 1000 ( thermo fisher scientific ) spectrophotometer , and the samples with highest final concentration and highest 260/230 ratio were chosen for sequencing . total rna samples were shipped on dry ice to the university of washington high - throughput genomics center , wtc east , suite 600 , 2211 elliott ave . , , san diego , ca , usa ) rna - seq library construction , 36 bp single end multiplex quality control library testing , and 76 bp paired end multiplex 4x sequencing was followed by trinity ( broad institute , ma ) contiguous sequence assembly 23 . sequences were assembled by diet treatment ( eggs only or pollen only ) and as a combined group assembly . assembled sequences were provided to the usda ars genomics and bioinformatics research unit ( gbru ) in stoneville , ms for further analysis . assembled sequences were analyzed by ncbi blast ( us national library of medicine ) 16 using the tblastx blast results were analyzed by diet treatment ( eggs only or pollen only ) and as a combined group . spreadsheet results were sorted by hit score and only those sequences in the two treatment groups meeting the combined criteria of > 500 nucleotide ( nt ) and e ( expect ) score < e-10 were used for further analysis . because the sequenced samples were derived from two individual insects that differed only in their adult diet , the transcriptomes were expected to be nearly identical for those sequences representing genes that were not associated with diet . to verify that assemblies represented genetically similar individuals as expected , sixteen sequences were chosen based on apparent identity by length of assembled sequence and closest tblastx hit . sequences were chosen from the group most similar to tribolium castaneum sequences and from the group most similar to dendroctonus ponderosae sequences , with the assumption that sequences from other beetles would represent conserved transcripts . sequences from pollen - fed ( p ) and insect egg - fed ( ie ) were compared at the nucleotide level using blast . lady beetles used to establish laboratory colonies were collected from fields surrounding the usda - ars and mississippi state university delta research and extension center in stoneville , ms , 38776 . insect cultures were maintained in the national biological control laboratory at stoneville , ms without wild specimen introgression from august 2010 through the time of rna sample collection in march 2013 . insects were reared as larvae in petri dishes of sizes ranging from 35 to 250 mm with mesh glued into one side of the dish for ventilation , and as adults in 5.25 x 5.25 inch cages 12 . temperature was generally maintained at 24 c for 16 lighted hours and 19 c for 8 dark hours in percival ( perry , ia ) e30b growth chambers . larvae and adults were fed ad libitum a combination of pollen , daphnia , brewer 's yeast , honey , and eggs of laboratory cultures of lygus spp . water was provided in 1.5 ml microcentrifuge tubes with caps removed and plugged with cotton . inbreeding of beetle stock was performed by isolating individual gravid females from the primary wild type colony , collecting and rearing all eggs from individual females , and continuing culture using only offspring of the most fertile and fecund female . from the resulting culture the inbreeding step ( female selection ) was repeated for a total of six isofemale ( i6 ) selection steps . insect specimens from a single egg mass collected from the i6 colony were fed standard diet as larvae . surviving individuals were isolated after pupation and provided either pollen alone or lygus eggs alone upon adult eclosion . specimens were spray washed with reverse osmosis ( ro ) water to remove any food particles . after one hour isolation ( resting from wash and away from food ) specimens were briefly anaesthetized with carbon dioxide . insects were transferred to sample tubes and crushed whole in rna extraction buffer using blue kontes ( kimble chase , thermo fisher scientific , waltham , ma ) pestle . total rna was extracted using usb prepease total rna kit following manufacturer instructions ( affymetrix , santa clara , ca ) . samples were measured using a nanodrop 1000 ( thermo fisher scientific ) spectrophotometer , and the samples with highest final concentration and highest 260/230 ratio were chosen for sequencing . total rna samples were shipped on dry ice to the university of washington high - throughput genomics center , wtc east , suite 600 , 2211 elliott ave . , , san diego , ca , usa ) rna - seq library construction , 36 bp single end multiplex quality control library testing , and 76 bp paired end multiplex 4x sequencing was followed by trinity ( broad institute , ma ) contiguous sequence assembly 23 . sequences were assembled by diet treatment ( eggs only or pollen only ) and as a combined group assembly . assembled sequences were provided to the usda ars genomics and bioinformatics research unit ( gbru ) in stoneville , ms for further analysis . assembled sequences were analyzed by ncbi blast ( us national library of medicine ) 16 using the tblastx blast results were analyzed by diet treatment ( eggs only or pollen only ) and as a combined group . spreadsheet results were sorted by hit score and only those sequences in the two treatment groups meeting the combined criteria of > 500 nucleotide ( nt ) and e ( expect ) score < e-10 were used for further analysis . because the sequenced samples were derived from two individual insects that differed only in their adult diet , the transcriptomes were expected to be nearly identical for those sequences representing genes that were not associated with diet . to verify that assemblies represented genetically similar individuals as expected , sixteen sequences were chosen based on apparent identity by length of assembled sequence and closest tblastx hit . sequences were chosen from the group most similar to tribolium castaneum sequences and from the group most similar to dendroctonus ponderosae sequences , with the assumption that sequences from other beetles would represent conserved transcripts . sequences from pollen - fed ( p ) and insect egg - fed ( ie ) were compared at the nucleotide level using blast . | diet , nutrition , and obesity are important topics of current research .
while many insect genome and/or transcriptome models are based on dietary specialists , the lady beetle coleomegilla maculata , a common new world species , is highly omnivorous . c. maculata feeds on plants , fungi , insects and other arthropods ; its diet frequently includes conspecific cannibalism .
this study reports and discusses the first nutritionally based c. maculata transcriptomes .
these transcriptomes were prepared from highly inbred specimens provided limited diets , after adult eclosion , of either pollen only or eggs of a soft bodied hemipteran insect only . selected sequences from the transcriptomes
were compared to verify basic genetic similarity of the sampled individuals .
differentially expressed genes associated with these diets were identified to aid with studies of omnivore diet and nutrition . selected transcriptome sequences described
herein are filed with the national center for biotechnology information ( ncbi ) , genbank bioproject prjna236444 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
a stroke is a neurologic disturbance caused by damage to the blood vessels that supply
blood to the brain ; it is one of the most common diseases in adults1 . many stroke patients have a number of serious disorders
such as hemiplegia , motor disturbance , sensory disability , and cognitive impairment2 . dysfunction of upper and lower extremities
impacts bodily function thereby degrading quality of life3 . due to these post - stroke disabilities , patients are subjected to
long - term rehabilitation such as physical and occupational therapy4 . a bioelectrical impedance analysis ( bia ) , which is non - invasive , whole - body bia measurements
have been increasingly applied within the medical field they have been utilized to diagnose
diseases as well as assess the hydration status and nutritional condition of bodies9 . among impedance data , the indicators for
determining bodily condition are prediction marker ( pm ) , resistance ( r ) , reactance ( xc ) , and
phase angle ( pa ) . the prediction marker ( pm ) is an indicator of body cell health , the
resistance ( r ) is inversely related to fluid volume , the reactance ( xc ) is a measure of cell
membrane integrity and function , and the phase angle ( pa ) is a global indicator of health
and nutritional status10 , 11 . in studies using bia , chumlea et al.12
investigated the distribution of intracellular fluid ( icf ) and extracellular fluid in cell
tissues of the human body . cho et al.13
analyzed the limbs and thoracic impedance of patients with chronic heart failure and
pulmonary edema by using a real - time body impedance measuring system . however , examination of the physical characteristics of affected and non - affected sides of
hemiplegic stroke patients undergoing rehabilitation therapy has yet to be done . analysis of
the affected and non - affected sides of stroke patients with hemiplegia may be applicable to
the rehabilitation therapeutic assessment of stroke patients with hemiplegia , as well as the
correlation between rehabilitation therapy assessments . a group of 20 stroke patients who were diagnosed with stroke hemiplegia participated in
this study . impedance measurements and rehabilitation assessments were conducted in patients
receiving rehabilitation therapy at inje university hospital in korea from october to
november 2015 . the study objectives and methodology were explained to the patients , and
their written consent was obtained . the study was approved by the ethics committee of the
inje university institutional review board for clinical studies . isle of
man , uk ) in accordance with the recommendations in the the national institutes of health
( nih ) technology assessment statement . experimental procedure was as follows : first , bia was measured at 50
frequencies ranging from 5 to 1,000 khz . when a current with a frequency larger than 50 khz
was applied to the body , the bia was significantly decreased . the resistance and the
reactance were also obtained in accordance with the applied frequency . second , the
relationship between reactance ( xc ) and resistance ( r ) was determined , indicating a strong
dependence of phase angle ( pa ) on the applied frequency . for whole - body bia measuring of the participants , the tetrapolar bia measurements of
resistance ( r ) and reactance ( xc ) were taken at 50 frequencies ranging from 5 to 1,000 khz
from the affected and non - affected sides of the subject , between the wrist and ankle , and
while in the supine position on a nonconductive surface by using a multi - frequency
bioelectrical impedance ( multi - scan 5000 , bodystat ltd . , uk ) , which supplies an ac 600-a
current . four cutaneous electrodes , two on the wrist and two on the ankle , were applied with
an inter - electrode distance of at least 5 cm to prevent interaction between electrodes . hand grip power was measured using a jamar hydraulic hand dynamometer . during the maximum
isometric contraction of hand power grip , all subjects were positioned with their shoulder
adducted and neutrally rotated , their elbow flexed at 90 , and their forearm and wrist in
the neutral position . the average value of three measurements was calculated , and expressed
in pounds ( lb)15 . the manual function test ( mft ) , an upper limb function assessment measure for hemiparetic
patients after stroke , developed by sakai rehabilitation instruments , japan , was used in
this study . the time needed for evaluation in this test is short and it can be applied
easily . this assessment of the affected body has a test - retest reliability of r=0.994 and an
inter - rater reliability of r=0.99316 . the ability to perform activities of daily living ( adl ) was measured by using the modified
barthel index ( mbi ) . the mbi is a measure of adl that shows the degree of independence of a
patient . it covers 10 domains of functioning : bladder and bowel control , grooming , toilet
use , feeding , transfers , walking , dressing , climbing stairs , and bathing17 . the paired t - test was used for comparison of differences between the affected and
non - affected sides in each test . the correlations of paretic side bio - impedance , hand grip
power , manual dexterity of hand function , and the ability to perform activities of daily
living were analyzed by using the pearson correlation coefficient . four males and sixteen females with an average age of 75.9 years ( 8.8 years ) , average
height of 161.4 cm ( 5.4 cm ) , and average weight of 53 kg ( 8.1 kg ) participated in this
study . ten patients had left - sided paralysis and ten patients had right - sided paralysis . their average length of stay was 23.4 months ( table
1table 1.clinical characteristic of the study participants ( n=20)characteristicparticipantsgender ( male / female)4 ( 20%)/16 ( 80%)age ( yrs)75.9 8.8*hight ( cm)161.4 5.4*mass ( kg)53.0 8.1*affected side ( right / left)10 ( 50%)/10 ( 50%)onset ( months)23.4 6.6**mean sd ) . after conducting whole - body bia measurements of participants , the prediction markers ,
reactances , and phase angles between non - affected and affected sides were found to be
statistically significant ( p<0.05 ) . however , the resistance results showed no significant
differences ( p>0.05 ) : ( table 2table 2.whole-body scores of bia for the affected side and non - affected side in the
participants ( n=20)affected side(mean sd)non - affected side(mean sd)prediction marker ( pm)0.880 0.0260.862 0.027*resistance ( r)615.5 172.4630 114.8reactance ( xc ) 37.9 11.243.5 9.5*phase angle ( pa)3.7 1.04.2 0.7**mean sd . * significant difference p<0.05 , * * significant difference p<0.01 bioimpedance had a positive correlation with hand grip power , manual dexterity of hand
function , and ability to perform activities of daily living ( p<0.05 ) ( table 3table 3.correlation between bioimpedance ( phase angle ) and hand grip power , manual
dexterity of hand function , and ability to perform activities of daily livingbiahgpmdadlbia0.704 * 0.469 * 0.594*hgp0.704*0.2170.723*md0.469 * 0.2170.638*adl0.594 * 0.723 * 0.638**significant difference p<0.05 . bia : bioimpedance ( phase angle ) ; hgp : hand grip
power ; md : manual dexterity of hand function ; adl : ability to perform activities of
daily living ) . bia : bioimpedance ( phase angle ) ; hgp : hand grip
power ; md : manual dexterity of hand function ; adl : ability to perform activities of
daily living patients with hemiplegia caused by a stroke show decreased limb sense and sensory movement
due to weakening of the muscles ; these problems cause difficulties in posture and tasks such
as wearing clothes , eating and self - management18 . bia is reliable , non - invasive method , has high reproducibility ,
safe and easy - to - use . in this study , prediction marker , resistance , reactance , phase angle of the affected and
non - affected sides of hemiplegic stroke patients undergoing rehabilitation treatment were
measured by using whole - body and segmental bia . these results showed that prediction marker ,
reactance , and phase angle were significantly different when comparing the paralyzed and
non - paralyzed sides of hemiplegic stroke patients . our experimental results agree with gupta
et al.s finding that lower phase angles increase the mortality of cancer patients19 . prediction marker ( pm ) : the prediction
marker ( or impedance ratio ) is the ratio between the impedance measurement at 200 khz and 5
khz . the greater the variance between the two impedance values at 5 khz and 200 khz , the
healthier the body cells . from our bia measurements , the average prediction marker was 0.86
for the non - affected side and 0.88 for the affected side ; the prediction marker of the
affected side is larger than that of the non - affected side . thus , healthy cells in the
non - affected side have significantly lower pm than unhealthy cells in the affected side of
hemiplegic stroke patients ( p<0.05 ) . accordingly , bia results showed that the
non - affected side was significantly healthier than the affected side . reactance : for whole
body bia measurement , the mean reactance was 43.5 for the non - affected side whereas it was
37.9 for the affected side ( p<0.05 ) . the low reactance can be regarded as deteriorated
completion and function of cell membrane . phase angle : the mean phase angle was 4.2 for the
non - affected side whereas it was 3.7 for the affected side . lower phase angles suggest cell
death or decreased cell integrity ; higher phase angles suggest large quantities of intact
cell membranes . phase angle has been found to be a prognostic marker in several clinical
conditions ( p<0.05 ) . the resistances were not significantly different because the amount
of an organism is inconsistent in each patient . it is difficult to evaluate the patient s
characteristics in terms of reactance relating to the total body water . reactance relating
to functionality and integrity of cell membrane is determined to represent significant
differences . for hemiplegic stroke patients , area - hand grip power , manual dexterity of hand function ,
and the ability to perform activities of daily living are used for evaluating rehabilitation
therapy in the clinical setting . for hand grip power , the paralyzed side measured 14.6 ( lb )
on average , and the non - paralyzed side measured 22.9 ( lb ) , and thus the hand grip power
between the paralyzed side and the non - paralyzed sides were significantly different
( p<0.05 ) . for manual dexterity of hand function test , the paralyzed side scored 16.5
points on average , and the non - paralyzed side scored 27.6 points , and thus the manual
function between the paralyzed side and the non - paralyzed side were significantly different
( p<0.05 ) . for the ability to perform activities of daily living test , the average mbi of
the 20 hemiplegic stroke patients was 60.3 . in terms of a correlation between impedance , pa value , hand grip power , manual dexterity of
hand function , and the ability to perform activities of daily living test , a higher pa value
correlated with an increase in hand grip power , manual dexterity of hand function , and the
ability to perform activities of daily living ; the correlation was positive . as the pa
increases , hand grip power , manual dexterity of hand function , and the ability to perform
activities of daily living also increase . from our findings , the non - affected side was healthier than the affected side in hemiplegia
stroke patients . bia research is essential for quantitatively analyzing the
status of rehabilitation of stroke patients with hemiplegia . therefore , it is possible to
use bia as an objective assessment tool for rehabilitation of patients receiving
rehabilitation therapy . our data can be used in preparing evaluation programs for the
physical aspects of rehabilitation therapy . | [ purpose ] the purpose of this study was to demonstrate the use of bioelectrical impedance
analysis as an appropriate rehabilitation therapy evaluation tool for stroke hemiplegic
patients .
[ subjects and methods ] a group of 20 stroke patients diagnosed with stroke
hemiplegia who underwent stroke rehabilitation from october to november 2015 participated
in this study . using bioelectrical impedance analysis , stroke hemiparalysis patients were
examined , and the affected and non - affected sides were compared .
this correlation between
impedance measurement values and rehabilitation therapy as an assessment tool was
determined .
[ results ] according to the whole - body bioimpedance measurements , prediction
markers , reactances , and phase angles , there were significant differences between the
non - affected and affected sides , and bioimpedance had a positive correlation with hand
grip power , manual dexterity of hand function , and ability to perform activities of daily
living .
[ conclusion ] there were significant differences between the impedance values of
the affected and non - affected sides of hemiplegic stroke patients .
these results suggest
that bioelectrical impedance analysis can be used as an assessment during the
rehabilitation of stroke patients . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the previous issue of critical care , pranskunas and colleagues worked on expanding our knowledge of the assessment of the microcirculation from bench to the bedside . the paradox between the macro- and microcirculation is now well known . despite having an apparent macrohemodynamic stability , an important proportion of patients with sepsis experience microcirculatory dys - functions that carry significant morbidity and mortality . if a patient presents with a macrohemodynamic- vascular collapse , we know where to start with our reanimation strategies . the persisting clinical challenge is the macrohemodynamically resuscitated patient who continues to show signs of tissue perfusion failure . since the microcirculation emerges as an important reanimation target , one of the great challenges of the last few years has been to bring to the bedside convenient and effective ways of assessing the patient 's microcirculatory- function . outside of the operating theater , very few vascular beds can be assessed easily and repeatedly . are there surrogate vascular beds that could be used , and what are their relationships to more relevant microcirculatory units like the gut and the brain microcirculations ? the work of pranskunas and colleagues provides some answers to these difficult questions . in a porcine model of septic shock , the authors compared the microvasculature of the sublingual region , the small and large intestines , and the conjunctiva . the authors report a relatively good correlation between the different vascular beds after three hours . however , they observed the loss of this relationship at the end of the experiment , at five hours . does this imply a time - dependent relationship , or could there be factors in the model itself that lead to artifacts over time ? the authors acknowledge that their model differs from the hyperdynamic state that we are used to seeing in reanimated patients with sepsis . in fact , four of the animals died just 15 minutes after the bacterial exposure - a situation that reproduces more the macrohemodynamics that are described in acute endotoxemic models that have been challenged with regard to their clinical relevance . with important decreases in cardiac indices , it might not be surprising to observe a shutdown of most of the downstream vascular beds . one hypothesis is that , during the preparation of the inoculums , a significant amount of dead bacteria and endotoxin accumulated in the preparation ; this could explain the hemodynamic collapse observed in these animals . in a previous study , we had to take extreme care to obtain bacteria in their exponential growing phase and inoculums had to be washed several times to limit the accumulation of endotoxins . technical factors such as the desiccation of the tissues and the surgery also have to be considered . even if the microcirculation of the sham animal remained well perfused during the whole experiment , the effects of these manipulations , like the ones seen in second hit injury models , may be potentiated by the sepsis . accordingly , a rather short recovery period may be insufficient to allow a proper stabilization of the animals . it should be noted that a significant amount of fluid was needed in the sham animals and that , at 5 hours , their cardiac indices were significantly increased ( by almost 40% ) . this suggests a form of inflammatory response and third spacing secondary to the surgical preparation . the authors also suggest a relationship between the microcirculation of the conjunctiva and that of the brain . one could argue that , because the tongue and the gut share similar embryologic origins , the microcirculatory changes that occur in the gut and in the sublingual region during sepsis or in response to vasopressor therapy could be related . it has been postulated that the changes of the conjunctival vasculature would better correlate with the peripheral vessels of the brain . as it is derived from the anterior neural plate , the retina might be a better surrogate of brain perfusion . in addition , it is more likely that the brain microcirculation behaves independently because of important factors such as cerebral autoregulation , specificity of the blood - brain barrier , and the parameters regulating intracranial pressure . the outer surface of the eye , in contrast , could be more prone to local factors and swelling due to a variety of situations that can be encountered in the critically ill patient . in conclusion , pranskunas and colleagues have made an important contribution to the effort to assess the brain microcirculation by monitoring the eye . their results must be validated in further studies using more clinically relevant models that include a simultaneous examination of the brain microcirculation . this will lead to a better understanding of the ' tongue - gut ' and the ' brain - eye ' relationships . | because the microcirculation has emerged as an important reanimation target , appropriate methods to monitor the microcirculatory function are crucial .
several teams have now succeeded in crossing this bridge from bench to bedside , but the choice of the tissues of interest remains a debate .
the potential accessible vascular beds that doctors could use in reanimation strategies and the relationship of these beds to more relevant microcirculatory ones are important issues to address . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the jugular bulb diverticulum ( jbd ) is an irregular outpouching of the jugular bulb that may extend to the superior surface of the petrous bone , middle ear cavity , endolymphatic duct or vestibular aqueduct.1 - 3 ) subjects with jbd may be asymptomatic or have variable symptoms based on its location and size . jbd may cause conductive hearing loss and pulsatile tinnitus by protruding into the middle ear , and also sensorineural hearing loss ( snhl ) , as well as vertigo by encroaching the inner ear or the internal auditory canal ( iac).1 ) jbd is reported rarely , and especially there have been no reported cases involving jbd encroaching the iac in korea . a 54-year - old female with pulsatile tinnitus , vertigo and snhl was diagnosed with jbd invading the posterior wall of the left iac . in this article , we report a unique case that is managed with conservative method for jbd invading the iac . a 54-year - old female presented with acute onset of severe whirling - type vertigo . the vertigo developed abruptly when the patient got out of the car and aggravated with positional change . the vertigo was associated with some mental / physical exhaustion and the patient recovered in several days with no medical treatment . spontaneous horizontal nystagmus was observed toward the left side at first and changed toward the right side on the fifth hospital day . pure - tone audiometry on the third hospital day showed snhl of about 60 dbhl with descending type over 1 khz and speech discrimination was 28% on the left side ( fig . vestibular evoked myogenic potential ( vemp ) testing was performed on the fifth hospital day and showed to be normal . saccade test , pursuit test and optokinetic test presented normal ranges , but caloric test showed the left canal paresis of 21% on the third hospital day and 73% on the eighth hospital day . magnetic resonance imaging ( mri ) was ordered to rule out the possibility of the left cerebellopontine angle ( cpa ) tumor . however , we suspected high jugular bulb encroaching the iac on the left side ( fig . 2 ) . computed tomography ( ct ) of the temporal bone revealed high jugular bulb and jugular bulb diverticulum with the eroded iac on the left side ( fig . when the left high - frequency snhl was found on the third hospital day , we started to administer 5 mg dexamethasone , intravenously , three times a day , in a regimen of management for sudden sensorineural hearing loss ( ssnhl ) . even after jbd was diagnosed by radiologic evaluations , the patient received high - dose steroids with the forementioned method for 9 days and underwent a 5-day oral taper , expecting the anti - inflammatory effect of corticosteroids for the cochlear / vestibular nerve . on the twenty - fifth hospital day , pure - tone audiometry showed high - frequency snhl with partially recovered threshold of 40 dbhl and speech discrimination score was 72% on the left side . in a month after initial presentation , the patient still had positional vertigo and nystagmus , with newly developed benign positional paroxysmal vertigo and recovered completely in several days with repositioning maneuvers . over 21 months after the onset , there has been no recurrence of vertigo , tinnitus or aggravated hearing deterioration . jbd is considered to be a rare venous anomaly , when compared with high - riding jugular bulb that is relatively common venous variation . retrospective studies , which were performed with ct of the temporal bone , reported high - riding jugular bulb and jbd ranged from 6% to 20% and from less than 1% to 7.9% , respectively.4,5 ) however , the rarity of jbd is questionable . because jbd was rarely reported before high resolution ct ( hrct ) and usually discovered at the time of the surgery or as an incidental finding on ct examination of the temporal bone . furthermore , a significant number of this disease is likely to be asymptomatic , and it is considered that jbd is probably underreported.6 ) the etiology of jbd is unrevealed . embryologically , jugular bulb is not present at birth , but once an erect posture is assumed , as opposed to fetal or lying down position in utero and as neonates , the pounding effects of ascending negative pulse waves originating from the right atrium may traverse upward to the jugular sinus hemodynamically , which leads to an expansion and a formation of the jugular bulb.7 ) due to the location of jugular bulb , which is in part , determined by mastoid pneumatization , the distance from the external auditory canal to the sigmoid sinus is relatively shorter in case of little or absent pneumatization . consequently , jugular bulb rides relatively high , which is also a risk factor for jbd.8 ) though venous hypertension and turbulent venous flow have been suggested as an etiologic factor for venous diverticulum with bony erosion , a definitive understanding of the pathophysiology of diverticulum formation remains elusive . depending on the degree of extension of jbd , the cochlear and vestibular aqueducts , the endolymphatic sac , the posterior semicircular canal , the mastoid cavity and iac can be involved.1 - 3 ) therefore , various symptoms , which includes snhl , vertigo , aural fullness and tinnitus , can be produced in accordance with the location and size of jbd . a few cases of jbd encroaching iac have been reported , however most of cases were identified in the retrospective studies.2,3 ) thus , their clinical manifestations were not described in detail . fujimoto , et al.9 ) reported one case of jbd invading iac in detail , however , clinical presentation was much different from our case . in his study , the patient had a conductive hearing loss especially at the low tone and subclinical vestibular dysfunction without vertigo , despite the similarity with our study in regards to the imaging study of the patient . in our case , ct images showed jbd encroaching only the posterior wall of the left iac without the involvement of the endolymphatic sac , the vestibular aqueduct or the posterior semicircular canal . it is considered that the audiologic and vestibular symptoms , such as pulsatile tinnitus , high frequency sensorineural hearing loss and vertigo resulted from the compression and irritation of cochleovestibular nerve , caused by jbd . however , hemifacial spasm did n't develop because the diverticulum eroded the iac from below , as well as from behind , and anatomically the facial nerve was spared . when the symptoms started , spontaneous nystagmus toward the left side had been observed , but in three days , it changed toward the right direction . also , left canal paresis was aggravated from 21% weakness on the third hospital day to 73% weakness on the eighth hospital day , according to the serial caloric tests . it is assumed that the left vestibular nerve was irritated by the diverticulum at the initial state . jbd can be identified mostly by radiologic evaluation , including ct or mri . however , when a patient has unilateral cochlear symptoms , with or without vertigo , different diseases , such as ssnhl , meniere 's disease , superior canal dehiscence syndrome , cpa tumor should be considered , and mri is generally chosen as the imaging method . however , we could not easily detect small venous anomalies , such as jbd without intensive suspicion . hrct is the method of choice when jugular bulb anomalies are suspected.1,6 ) bush , et al.3 ) suggested that the ct venography should be used in the evaluation of asymmetric audiologic symptoms , and vertigo in case of negative mri findings . further , they said that ct venography can be the primary study in patients with pulsatile tinnitus alone . in our case , since the patient had high - frequency hearing loss with poor speech discrimination and vertigo , mri should be checked prior to ruling out cpa tumor . although it is assumed that the functional deficit of inferior vestibular nerve and posterior semicircular canal was little or absent in that time of examination , it does n't exclude subclinical or progressive functional deficit . therefore , periodic and close observation should be followed . because little is known about the natural course of jbd , guidelines for treament are not established in detail . consequently , it is difficult and complicated in a part to decide whether we should treat conservatively or surgically . according to a few literatures , since jbd is not static and enlarges with time , it can gradually aggravate patient 's symptoms.10 ) further , another author said pulsatile tinnitus that is caused by high - riding jugular bulb or jbd can be diminished and even disappear naturally.11,12 ) in our case , pulsatile tinnitus started to diminish in a few days and disappeared in a week , and vertigo improved gradually . therefore , we decided to manage conservatively with medication , expecting anti - inflammatory reaction of corticosteroids . if patients with severe symptoms of vascular origins , such as annoying tinnitus , continuous vertigo and persistent or progressive hearing loss , surgical managements can be considered . but a decision for surgery should be based on careful evaluation of the risks and benefits of each case . | jugular bulb diverticulum ( jbd ) is a rarely reported vascular anomaly , which is an extraluminal outpouching from the jugular bulb .
especially , there exists a lack of reported cases involving jbd encroaching the internal auditory canal ( iac ) in korea .
subjects with jbd may be asymptomatic or have variable symptoms based on its location and size . in this article
, we report a unique case of jbd eroding into the iac that was presented as sudden sensorineural hearing loss with vertigo . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
galvanic vestibular stimulation ( gvs ) activates the afferent vestibular nerve and affects
the vestibular and peripheral areas of the cerebral cortex . like transcranial direct current
stimulation ( tdcs ) , gvs is a non - invasive electrical stimulation method that can stimulate
the brain safely without serious side effects1 . electrostimulation using gvs can be utilized to analyze
electrically induced postural balance response by applying a direct current to the mastoid
process behind the ear and the stimulation of the vestibular nerve2 . the bipolar gvs cathode depolarizes the stimulated region
for excitation , while the anode hyperpolarizes the stimulated region for suppression3 . when these stimuli deliver signals from the
anode and cathode to the vestibular system , the posture starts to sway towards the
anode4 . most studies on gvs were related
to balance control5 , but recent studies on
the effects of gvs on memory or cognitive reactions have been reported . such studies report
gvs has a good effect on memories related to sight6 ,
7 . park8 report gvs has a good effect on cognition related to event - related
potential . furthermore , some studies report tdcs not only enhances exercise function , but
also positively affects cognitive reaction9 therefore ,
how gvs enhances exercise function and the cerebral cortex in relation to exercise requires
further study . therefore , the present study examined the effects of gvs on movement - related
cortical potential ( mrcp ) . this study was approved by the research
ethics committee of kwangju women s university . the subjects were randomly divided into two
equal groups : the gvs and sham groups . the general features of the subjects are presented in
table 1table 1.general characteristics of the subjects ( n = 40)age ( years)height ( cm)weight ( kg)gvs ( n = 20)21.0 0.9160.8 5.053.5 5.4sham ( n = 20)21.4 1.7162.5 6.255.6 8.7 . gvs was conducted using a galvanic vestibular stimulator ( endomed 482 ,
enraf - nonious , netherlands ) . the subjects assumed a comfortable sitting position and closed
their eyes . before attaching a disposable adhesive electrode ( hrtc32 , hurev , south korea ) electrodes were subsequently attached to both
mastoid processes ; the anode and cathode were applied to the right and left mastoid
processes , respectively . the pulse duration was 100 ms , and the inter - pulse duration was
900 ms pulse current ( triangular waveform ) . meanwhile , in the sham group ( no
stimulation ) , the electrodes were attached at the same locations ; the subjects group assumed
a comfortable sitting position and closed their eyes . mrcp was measured by electroencephalography ( eeg ) ( lxe5208 , laxtha , south korea ) and
electromyography ( emg ) ( mp150 , biopac , usa ) . the output signals were measured using the eeg ;
these were input from the mp150 via a cable and analyzed using acqknowledge version 4.0
( biopac , usa ) . the subjects were instructed not to move or talk except while performing the
visual stimulation tasks in a comfortable sitting position . before mrcp measurement , the
attachment points were washed with alcohol swabs to eliminate substances , so that the skin
impedance would be less than under 5 k. for the eeg , an ag / agci electrode was attached to
the fz , c3 , cz , and c4 areas using an international 1020 system ; the ground and reference
electrodes were attached to the left and right mastoid processes , respectively . the
predetermined values for measurement were as follows : 256 hz sampling rate and 1,250 v
gain . an disposable adhesive electrode ( 2223h , 3 m , south korea ) was used for surface emg ; a
recording electrode was attached to the abductor pollicis brevis of the left hand ( i.e. ,
non - dominant side ) , and the ground electrode was attached to the medial epicondyle . the skin
was washed with an alcohol swab beforehand , and the emg sampling rate was set at 1,000 hz . pictures ( i.e. , information on the exercise performance ) were projected on a monitor and
included three kinds of stimuli : flowers , animals , and nature ; all pictures were 400 500
pixels and were alternately projected 50 times using superlab version 4.5 ( cedrus , usa ) . fifty distinguishable flowers , animals , and nature pictures were shown every 5 s. the
subjects were instructed to abduct the thumb of their non - dominant hand every time the
picture was changed . analysis of the signals revealed an average of 50 signals over 4 s : 3-
and 1-s signals before and after the beginning of the activity , respectively , with the
standard being when the muscle activity started on the surface emg . the fz , c3 , cz , and c4
areas as well as the peak - to - peak ratio of each section of bereitschaftspotential ( bp ) ,
negative slope ( ns ) , and motor potential ( mp ) of the mrcp were subsequently analyzed . there were no significant differences in the bp , ns , or mp in the fz or cz area ( table 2table 2.changes in mrcpareagroupbp ( mv)ns ( mv)mp ( mv)prepostprepostprepostfzgvs0.031 0.0340.023 0.0090.100 0.1190.161 0.2230.237 0.1930.27 0.186sham0.024 0.0080.019 0.0080.083 0.1310.064 0.0940.288 0.2610.206 0.187c3gvs0.023 0.010.021 0.0090.054 0.0490.062 0.0440.164 0.1430.181 0.107sham0.024 0.0090.016 0.0060.052 0.0720.04 0.050.156 0.1340.146 0.116czgvs0.022 0.0080.038 0.0760.068 0.050.062 0.0430.154 0.1130.174 0.09sham0.026 0.010.016 0.0070.055 0.0640.043 0.0450.173 0.1220.186 0.178c4gvs0.021 0.0080.038 0.0710.053 0.0550.061 0.0470.148 0.0980.165 0.092sham0.020 0.0080.015 0.0060.057 0.0650.039 0.040.173 0.1330.147 there was no significant difference in fz or cz after gvs . at the c3 area ,
there was a significant difference in the bp with respect to time
( f(1,38 ) = 6.603 , p = 0.014 ) and a significant
interaction effect in the ns ( f(1,38 ) = 4.709 , p = 0.036 ) ;
however , there was no significant difference in the mp . at the c4 area , there was a
significant interaction effect in the ns ( f(1,38 ) = 5.199 ,
p = 0.028 ) and mp ( f(1,38 ) = 5.076 , p = 0.030 ) . ) . in the c3 area , the bp differed significantly with respect to time
( f(1,38 ) = 6.603 , p = 0.014 ) and there was a significant
interaction effect in the ns ( f(1,38 ) = 4.709 , p = 0.036 ) . in
particular , the amplitude of the ns increased greatly in the gvs group , but there was no
significant change in the mp . in the c4 area , there was only a significant interaction
effect in the ns ( f(1,38 ) = 5.199 , p = 0.028 ) and mp
( f(1,38 ) = 5.076 , p = 0.030 ) . meanwhile , the amplitudes of the
ns and mp decreased in the sham group but increased in the gvs group . there was no significant difference in fz or cz after gvs . at the c3 area ,
there was a significant difference in the bp with respect to time
( f(1,38 ) = 6.603 , p = 0.014 ) and a significant
interaction effect in the ns ( f(1,38 ) = 4.709 , p = 0.036 ) ;
however , there was no significant difference in the mp . at the c4 area , there was a
significant interaction effect in the ns ( f(1,38 ) = 5.199 ,
p = 0.028 ) and mp ( f(1,38 ) = 5.076 , p = 0.030 ) . in the c3 and c4 areas , which are the primary motor areas , the amplitude of the ns
increased ; meanwhile , in the c4 area , the amplitudes of the ns and mp increased . wardman et
al.10 reports gvs in a standing
position stabilizes head movement , changing cognitive ability and proprioception . park8 investigated the effects of gvs ( 30 ms pulse
duration and 700 ms inter - pulse duration ) on normal cognitive reaction and found that the
cognitive reaction time decreased . also it was found that n100 and p300 latency decreased ,
n100 and p300 amplitude increased . park8
suggested that gvs stimulates the vestibular system , interacts with the cerebral cognitive
area , and enhances cognitive ability . mrcp consists of negative and positive potential ;
negative potential is divided into the bp and ns11 . the ns appears before the movement , and the cortical activity is
related to the movement activity plans and practices11 . in addition , the ns ( or late bp ) in voluntary movement , and mp can
be used to analyze the cortical activity in accordance with the direct voluntary movement ;
there have been many studies about the factors affecting the cortical activity determined by
analyzing the amplitude and incubation period of the bp , ns , and mp , which are elements of
mrcp14 . on the basis of this paradigm ,
the amplitudes of the bp , ns , and mp were analyzed after gvs in the present study . the
results show there was no difference in the amplitude of the bp section , which is a gradual
negative potential occurring 2 s before movement . on the contrary , the amplitude of the ns ,
which is a rapid negative potential occurring 0.1 s before muscle activity after the bp in
the c3 and c4 areas , increased after gvs . this shows gvs has a greater effect on hand
movement plans and practice immediately before movement . in addition , the amplitude of the
mp , which is the potential occurring after movement , increased only in the c4 area after
gvs . vines el al.15 reported that
stimulating a motor region directly , or indirectly by modulating activity in the homologous
region on the opposite hemisphere , can affect motor skill acquisition , presumably by
facilitating effective synaptic connectivity . the functions of the brain are interconnected
via the commissural fibers of the corpus callosum in the motor cortex . galvanic vestibular
stimulation increases the negative slope and motor potential amplitudes of the homonymous
brain cortex area , which controls hand function and motion - related cortical potential , and
the negative slope amplitude of the opposite cortical area , thus activating the brain areas
for hand function . | [ purpose ] this study examined the effects of galvanic vestibular stimulation on
motion - related cortical potential . [ subjects and methods ] fourty healthy female adult
subjects each received galvanic vestibular stimulation or sham treatment . for galvanic
vestibular stimulation ,
the anode and cathode were applied to the right and left mastoid
processes , respectively , for 10 minutes .
motion - related cortical potential was tested pre-
and post - treatment . to measure motion - related cortical potential , surface electromyography
signals were generated by 50 thumb abductions with electrode application on the abductor
pollicis brevis of the left ( i.e. , non - dominant ) hand .
[ results ] the negative slope
cortical potential on the c3 area ( i.e. , dominant hand ) and cortical negative slope and
motor potential on the c4 area ( i.e. , non - dominant hand ) showed significant interaction
effects .
the galvanic vestibular stimulation group showed an increased negative slope
amplitude in the c3 area , and increased negative slope and motor potential amplitudes in
the c4 area compared to the sham group .
[ conclusion ] galvanic vestibular stimulation
increases the negative slope and motor potential amplitudes of the homonymous brain cortex
area , which controls hand function and motion - related cortical potential , and the negative
slope amplitude of the opposite cortical area , thus activating the brain areas for hand
function . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
alzheimer 's disease ( ad ) is a progressive neurodegenerative disorder characterized by a progressive decline in memory functions , which has become a growing public health concern . this condition of clinical dementia was first described by alois alzheimer in 1907 , and ever since , the incidence of ad has increased exponentially . there are presently 5 million americans affected with ad , and the estimated annual health care cost is almost 100 billion dollars . further , due to the expected increase in the number of individuals 65 years or older , it has been estimated that the total incidence of ad will quadruple by the year 2050 . as there is presently no cure for this devastating condition , there is an urgent need to find a means of preventing , delaying the onset , or reversing the course of ad . recent research has provided evidence that certain dietary lifestyle choices can help to prevent alzheimer 's disease . this area of research has been quite exciting in light of the fact that delaying the onset of ad by just five years could cut its incidence in half . in this paper , we first discuss the major pathological features of ad clinical dementia , followed by an examination of research on certain dietary factors that have been found to influence ad . these dietary factors include calorie , fat , and glucose / sugar intake , in addition to the inclusion of foods like fish , certain fruits and vegetables , plant extracts , spices and red wine , or polyphenol - rich foods in one 's diet . ad is pathologically characterized by the depositions of beta - amyloid aggregates in extracellular spaces and cerebral vasculatures as well as intracellular depositions of aggregated tau protein . the amyloid cascade hypothesis is a popular model of ad pathogenesis and most of the autosomal dominant familial ad cases are caused by mutations in the amyloid precursor protein ( app ) , presenilin 1 , or presenilin 2 , which lead to increased generation of beta - amyloid ( a ) peptides . these risk factors include genetic risk factor such as the apolipoprotein e ( apoe ) genotype , as well as nongenetic and environmentally modifiable factors , including dietary , cardiovascular risk factors , physical and intellectual activities , and environment factors . as such , these factors have been generally considered as potential targets of intervention for ad prevention and therapy . ad is characterized in the brain by accumulated extracellular -amyloid ( a ) plaques and intracellular neurofibrillary tangles composed of abnormally hyperphosphorylated microtubular tau proteins . the manifestation of ad clinically is a progressive loss of cognitive abilities , including deficits in memory and planning . neurotoxic a is known to exist in multiple assembly states , which often result in varying pathophysiological effects . additionally , although a is classically understood to be deposited extracellularly , there is new evidence in mice and humans that a peptides can also accumulate intraneuronally . a species are generated from the ubiquitously expressed amyloid precursor protein ( app ) through sequential proteolysis by - and -secretases [ 46 ] . although the 40-amino acid form of a ( a140 ) is considered to be the major secreted species in ad , the 42-amino acid form of a ( a142 ) , which contains two additional residues at its carboxyl terminus , is thought to initiate ad pathogenesis . in addition , tau proteins in the brain ( most particularly hyperphosphorylated tau ) , which aggregate into paired helical filaments and deposit as intracellular neurofibrillary tangles , [ 8 , 9 ] , are also considered to be a major pathology associated with alzheimer 's disease . researchers posit that abnormal hyperphosphorylation of tau leads to the sequestration of normal and hyperphosphorylated tau in microtubules , leading to alternations in the healthy functioning of tau in the brain ( including changes in axon transport and microtubule stability and polymerization [ 10 , 11 ] ) . as a species and tau neurofibrillary tangles are the major hallmarks of ad neuropathology , research on therapies or preventions for ad are often geared toward attenuating or treating these neuropathologies . in addition to a and tau pathologies , mitochondrial functions also play a major role in ad clinical dementia . mitochondria regulate energy metabolism in cells and contribute largely to cell life or death ( apoptosis ) . in the presence of increased a content in the brain , mitochondria increase the generation of reactive oxygen species ( ros ) , which function as damaging agents and as signaling molecules . highly reactive ros , in fact , unleash a mechanism involving the liberation of cytochrome c , leading to neuronal apoptosis [ 13 , 14 ] . in human ad patients , positron emission tomography ( pet ) imaging assessments have suggested that the ad brain is characterized by impaired mitochondrial glucose metabolism , leading to neuronal hyperglycemic conditions . in light of this evidence , controlling mitochondrial glucose / energy metabolism in the brain has also been of high interest to ad researchers for the prevention and treatment of ad . they have led to a growing incidence of obesity , dyslipidemia , high blood pressure , and hyperglycemic conditions , known collectively to be components of metabolic syndrome . these health conditions are well known to develop along with , or be precursors of , atherosclerosis , cardiovascular disease , and diabetes . recent studies have found that most of these disorders can also be linked to an increased risk of ad . of note , accumulating evidence suggests a mechanistic link between cholesterol metabolism in the brain and the formation of amyloid plaques in ad development [ 17 , 18 ] . epidemiological studies have demonstrated that individuals with obesity and diabetes have a fourfold increased risk for ad . health risks associated with obesity , including evidence that obesity may causally promote the ad degenerative process , are of high concern for public health . by the beginning of the twenty - first century , the fraction of americans considered to be obese reached epidemic levels , according to a study published in . this study , carried out between 1991 and 1998 , observed a steady increase in weight in all 50 states , across genders , age groups , races , and educational levels , and occurring regardless of smoking status . this study found that obesity had increased from 12.0% in 1991 to 17.9% in 1998 . likewise , national survey data has shown that between 19761980 and 19881994 , the age - adjusted prevalence of obesity increased by 8 percentage points , from 14.5% to 22.5% , in the us adult population ages 2074 years . several major studies have been conducted in humans to explore the relationship between obesity and the brain . recently , pannacciulli and colleagues explored the association between body fat and regional alterations in brain structure using voxel - based morphometry ( vbm ) imaging ( based on high - definition 3d magnetic resonance imaging [ mri ] ) . compared to lean subjects , obese individuals were found to have significantly lower gray matter density in the postcentral gyrus , frontal operculum , putamen , and middle frontal gyrus , indicating differences in the brain regulation of taste , reward and behavioral control . additionally , whitmer and colleagues evaluated the possible association between obesity ( as measured by body mass index ( bmi ) and skinfold thickness ) in middle age and risk of dementia in later life in a large scale , multiethnic population - based cohort . findings revealed that obese individuals ( bmi > 30 ) in middle age had a 35% higher risk for dementia compared to normal weight individuals ( 18.6 < bmi < 24.9 ) , independent of other comorbid conditions . additionally , balakrishnan and colleagues investigated the association between blood plasma a levels ( which promote ad development ) , bmi , and fat mass ( fm ) in healthy adults and found significant correlations of bmi and fm with plasma a142 levels and also noted that the presence of certain proteins known to play a role in inflammation , cardiovascular disease , and type 2 diabetes strengthened these correlations . researchers have also investigated the role of leptin , a protein hormone secreted in fat cells associated with obesity ( which regulates appetite and metabolism ) , in ad pathogenesis . in pathological conditions of aging , such as in ad , it has been demonstrated that the transport of leptin across the blood brain barrier ( bbb ) is significantly impaired , in particular , by the downregulation of megalin , a protein to which leptin must bind in order to enter the brain . leptin has also been shown to reduce -secretase activity in neuronal cells , possibly by altering the lipid composition of membrane rafts , and thereby affecting a generation . in fact , chronic administration of leptin actually reduced a load in the brains of ad transgenic mice , suggesting the potential of leptin as a treatment for ad and providing further support for the hypothesized link between obesity and ad . research has demonstrated that caloric intake ( among other nongenetic factors ) influences one 's risk for ad , and , accordingly , that curbing obesity / calorie intake might play an important role in delaying the ad degenerative process . clarifying the mechanisms through which caloric intake may ultimately influence ad neuropathology , and how caloric restriction ( cr ) may exert anti--amyloidogenic activities , may provide new avenues for designing preventive and/or therapeutic lifestyle strategies for ad and other neurodegenerative conditions . the hypothesized preventive effects of cr on the development of mild cognitive impairment ( mci ) or ad are supported by epidemiological evidence indicating that individuals who habitually consume fewer calories have a reduced incidence of ad [ 26 , 27 ] . additionally , studies have demonstrated that cr is one method by which one can mitigate the risk factor presented by elevated plasma homocysteine levels ( which increase with age ) for ad . specifically , as high homocysteine levels render neurons to be more vulnerable by impairing dna repair mechanisms ( and thereby promoting cell death ) , lowering homocysteine levels through cr could potentially help to maintain the brain 's neuroprotective abilities and help prevent against ad . halagappa and colleagues tested the hypothesis that two different dietary energy restriction regimens40% calorie restriction ( cr ) and intermittent fasting ( if)could protect against cognitive decline in a transgenic mouse model of ad and found that both regimens ameliorated age - related cognitive impairments but could not directly link the observed effects to a and tau pathologies . further , wu and colleagues investigated the effects of cr for 4 months on different ad phenotypes in another mouse model , finding that cr diets improved cognitive impairments in treated mice based on improved scores on assessments of novel object recognition and contextual fear conditioning memory . further histological and biochemical analyses revealed that cr actually attenuated ventricle enlargement , caspace-3 activation and astrogliosis and reduced the induction of tau hyperphosphorylation . importantly , dna microarray analysis in this study also demonstrated that cr could increase the expression of neurogenesis - related genes and decrease the expression of inflammation - related genes in the hippocampus of the mice , indicating that cr could induce neuroprotective activity in the brain . in accordance with this line of work , we initiated a series of studies to investigate whether ad pathogenesis can be prevented by reducing calorie intake to levels appropriate for cardiac health . at the beginning of this endeavor , although evidence had supported a possible neuroprotective role of cr in neurodegeneration , there had been no information regarding whether cr could attenuate ad neuropathology until recently . we explored whether a clinically acceptable weight reduction / cr regimen , based on an approximately 30%-reduced carbohydrate intake , could attenuate ad neuropathology and possibly mitigate preexisting amyloid neuritic pathology ( by a reduction in plaque size ) resulting in the recovery of amyloid - associated neuritic dystrophy as a function of time in tg2576 ad - type mice . in this study , 3-month old tg2576 mice , which developed ad - type amyloid neuropathology at 810 months of age , were fed with a daily low - carbohydrate ( low - carb ) diet for 9 months , resulting in 30% lower caloric intake compared to age- and gender - matched control mice fed ad libitum ( al ) with a standard laboratory rodent diet ( dietary content of protein , fat , cholesterol , vitamins , and minerals were identical across both mice groups ) . we found that the low - carb / cr diet in mice resulted in body weight stabilization , 3-fold lower ependymal fat pad weight , and improved glucose tolerance responses compared to the al - fed mice at 9 months of age . this finding was consistent with clinical evidence indication that low - carb / cr diets considerably improve abnormal glucose control and obesity [ 3335 ] , which are risk factors for diabetes and ad [ 27 , 36 ] . moreover , when examined for ad - type neuropathology , we found that the cr intervention almost completely prevented cortical and hippocampal ad - type amyloid plaque ( lower a140 and a142 concentrations ) development relative to the al - fed group . we next proceeded to explore app processing and a peptide generation in the cr- and al - fed mice , and , consistent with our previous evidence , we confirmed decreased levels of a140 and a142 in cr - fed compared to al - fed mice . further investigation revealed that -secretase activity had no involvement in the anti - amyloidogenic activity observed but that -secretase activity ( which promotes the nonamyloidogenic processing of app ) likely played a role in the observed benefits of cr treatment in mice . as -secretase cleavage of app is known to involve the release of a soluble and neuroprotective form of app ( sapp ) , it is possible that cr may not only promote a non - amyloidogenic pathway in the brain , but also may promote brain repair activities as a result of sapp neurotrophic function . current therapeutic approaches to ad are aimed at preventing the generation of amyloidogenic a peptides , and for this reason , - and -secretase activities required for the formation of a peptides are central targets in the development of therapeutic agents in ad . however , it has been difficult for scientists to find safe and selective - and -secretase inhibitors , as these activities are vital in the processing of other cellular substrates . our studies collectively revealed that cr dietary intervention benefitted ad mice by promoting -secretase activity , and thereby inhibiting the generation of high molecular weight a peptides . sirtuins are class iii histone deacetylases ( hdac ) known as silent information regulators , which serve to catalyze deacetylation reactions in an nad(+)-dependent manner . often called longevity genes , sirtuins activation of sirtuins is known to extend lifespan by promoting healthy aging in a variety of species and by protecting crucial tissues in the body , including those in the heart and brain . in mammalian systems , sirtuin activators protect against axonal degeneration , polyglutamine toxicity , and microglia - mediated a toxicity , suggesting the potential therapeutic value of sirtuin activation in patients with ad . sirt1 has been found to protect against microglia - dependent a toxicity by inhibiting nf-b signaling in the brain . in 2006 , we reported for the first time that promotion of sirt1-mediated deacetylase activity may be a mechanism through which cr influences ad - type amyloid neuropathology . cr by 30% reduced carbohydrate intake was found to prevent amyloid neuropathology in young - adult tg2576 mice , which may have been mediated in part through mechanisms involving activation of mammalian sirt1 . consistent with this evidence in tg2576 mice , we confirmed this finding in a new animal model by showing that a similar 30% cr regimen in squirrel monkeys coincided with a significant reduction in a140 and a142 peptide content in the brain , which inversely correlated with the elevation of sirt1 protein concentrations , relative to al - fed monkeys . in view of the fact that several studies in squirrel monkeys have been successfully used to provide important human physiological and biological information at organism , tissue , cellular , and molecular levels , these studies in squirrel monkeys strongly support our hypothesis that clinically applicable cr regimens in humans might be effective in preventing amyloid neuropathology and possibly mci and ad . collectively , our studies on cr in ad mice and in squirrel monkeys revealed that certain experimental cr dietary regimens may promote , attenuate , or even partially reverse features of ad [ 32 , 41 , 42 ] . in our studies , we found that high caloric intake , in particular of saturated fat , promotes ad - type -amyloidosis and that reducing carbohydrate intake may actually prevent it , possibly through sirt1-mediated response mechanisms . insulin and insulin signaling have been suggested to play a role the pathophysiology of ad [ 43 , 44 ] . in population - based studies , individuals with type 2 diabetes mellitus are at an increased risk for cognitive impairment , dementia , and neurodegeneration . mechanisms through which diabetes presents a risk factor include glycemia , insulin resistance , oxidative stress , advanced glycation endproducts , inflammatory cytokines , and microvascular and macrovascular disease . the principal defect in type 2 diabetes is insulin resistance , leading to insulin deficiency . the islet of langerhans ( in the pancreas ) in type 2 diabetes is characterized by -cell loss and islet amyloid derived from islet amyloid polypeptide ( iapp ) [ 4648 ] , a protein co - expressed and secreted with insulin by -cells . as with a peptides , iapp spontaneously forms into amyloid aggregates in an aqueous environment . additionally , as with ad , the incidence of type 2 diabetes strongly increases with age . borderline diabetes is also associated with increased risks of dementia and ad , independent of whether one develops diabetes in later life , and may interact with severe systolic hypertension to multiply one 's risk for alzheimer 's disease . in addition to complications affecting the eyes , kidneys , heart , blood vessels and nerves , diabetes mellitus is associated with damage to the central nervous system ( cns ) and cognitive deficits [ 51 , 52 ] . impairments in learning and memory have been documented in both types 1 and 2 diabetes . cns deficits range from moderate to severe , depending on the quality of glycemic control , and involve mainly verbal memory and complex information processing [ 5355 ] . furthermore , it has been shown that insulin affects several brain functions including cognition and memory , and several studies have established links between insulin resistance , diabetes mellitus and ad . recent evidence indicates that insulin regulates the metabolism of a and tau proteins [ 5759 ] . it has also been suggested that desensitization of neuronal insulin receptors and certain signaling events in ad could lead to reduced acetylcholine levels and cerebral blood flow , resulting in chronic and increasing deficits in oxidative metabolism . additionally , insulin is known to facilitate the hepatic clearance of plasma a140 by intracellular translocation of low - density lipoprotein receptor - related protein 1 ( lrp-1 ) to the plasma membrane in hepatocytes . alzheimer 's disease ( ad ) is associated with major impairments in insulin and insulin - like growth factor ( igf ) gene expression and signaling in the brain , which increase with severity of dementia and deficits in energy metabolism and acetylchoine homeostasis . this coexistence of insulin / igf deficiency and resistance in the brain suggests that ad may represent a brain - specific form of diabetes ( i.e. , type 3 diabetes ) . this hypothesis is supported by findings from de la monte and colleagues in an experimental animal model in which intracerebral streptozotocin ( ic - stz ) was used to deplete brain , and not pancreatic , insulin . the ic - stz treatment produced brain - specific insulin depletion and insulin resistance and was associated with progressive neurodegeneration sharing many features in common with ad . they demonstrated that early treatment with peroxisome - proliferator activated receptor agonists can effectively prevent ic - stz - induced neurodegeneration and its associated deficits in learning and memory and that the observed effects were mediated by increased binding to insulin receptors , reduced levels of oxidative stress and tau phosphorylation , and increased choline acetyltransferase expression in the brain , suggesting potential therapeutic efficacy of insulin sensitizing agents in ad . there is in vitro evidence that insulin itself may significantly promote the generation of extracellular amyloidogenic a peptides through mechanisms that involve accelerated app / a trafficking from the trans - golgi network ( a major cellular site for a generation ) to the plasma membrane . while this evidence tentatively suggests that abnormal carbohydrate metabolism might play an important role in ad through mechanisms that involve a peptide generation , experimental studies also suggest that insulin resistance may promote ad amyloid neuropathology in tg2576 mice , possibly by limiting a degradation via competition with insulin for degradation by the insulin - degrading enzyme ( ide ) , a zincmetallopeptidase that preferentially cleaves proteins with a propensity to form -pleated sheet - rich amyloid fibrils , such as monomeric a peptides . recent evidence suggests a role for insulin even in normal memory function , thereby supporting the hypothesis that insulin by itself affects mechanisms related to neuronal activity and cognitive function . of particular interest to our research group , chronic hyperinsulinemia and insulin resistance , or reduced insulin effectiveness , has been demonstrated to negatively influence memory [ 65 , 66 ] . for example , hoyer proposed that low concentrations in circulating insulin in the cns , along with reduced expression of insulin receptors and subsequent altered downstream signaling in ad , would ultimately lead to reduced levels of acetylcholine and a corresponding decrease in cerebral blood flow . based on this evidence , and the fact that type 2 diabetes appears to be associated with an increased relative risk for ad [ 60 , 63 , 6567 ] , we recently explored in our laboratory the role of experimental type 2 diabetes in a tg2576 mouse model of ad amyloid neuropathology . we found that a diabetogenic diet , resulting in elevated circulating levels of insulin , promoted amyloidogenic a140 and a142 peptide generation and amyloid plaque burden in the brain of tg2576 mice . moreover , the increased ad - type amyloid neuropathology also coincided with increased impairments in spatial memory function . further exploration of this interrelationship between insulin resistance and brain amyloidosis revealed a functional decrease in insulin receptor- ( ir- ) mediated signal transduction in the brain , as suggested by decreased ir -subunit ( ir- y ) autophosphorylation and reduced phosphatidylinositol 3 ( pl3)-kinase / ps - akt / protein kinase- ( pk- ) b in these same brain samples . this study collectively suggests that diet - induced insulin resistance in ad mice may significantly promote ad - type amyloidosis in the brain through mechanisms involving the elevation of -secretase activity as a result of impaired ir signaling and also that type 2 diabetes may contribute to ad amyloid pathology by attenuating the degradation of a peptide pathways associated with ides . interestingly , a later study by li and colleagues explored whether ad - type pathological changes in the brain occur in two experimental rat models which develop type 1 and type 2 diabetes . they found accumulations of -amyloid and phosphor - tau in these mice and that these pathologies were associated with neurite degeneration and neuronal loss . changes in the rat model of type 2 diabetes were more severe and appeared to be associated with insulin resistance and possibly hypercholesterolemia . additionally , huang and colleages found that compared to normal mice , a mouse model of hyperglycemia was more vulnerable to -amyloid oxidative stress . these findings further support the role of insulin and insulin resistance in ad neuropathology and provide evidence that preventing diabetic conditions may in turn help to prevent ad dementia . several studies have demonstrated an association between high blood pressure and ad [ 7173 ] . it has been suggested that hypertension can increase one 's risk for ad by potentially causing cerebrovascular disease or changes in blood vessel walls ( which could lead to hypoperfusion , ischemia , and hypoxia ) , among other conditions , which can potentially initiate the pathological degenerative ad process . additionally , subclinical ad has also been suggested as a risk factor for high blood pressure ; thus , similar biological mechanisms may be involved in the pathogenesis of these two conditions . the relationship between cognitive function and antihypertensive drug therapy has been investigated in several studies of hypertensive elderly human patients . for example , guo and colleagues found that a combination of certain calcium channel and -adrenergic blockers used as antihypertensive agents protected elderly individuals from developing ad . similarly , other studies have demonstrated that certain calcium channel blockers , such as dihydropyricine and nitrendipine , decreased the incidence of ad in hypertensive individuals . further , it has also been found that antihypertensive drugs that are k - sparing diuretics , in particular , reduce the risk of ad in elderly individuals with hypertension . moreover , it was demonstrated that antihypertensive agents that cross the bbb and affect the rennin - angiotensin - aldosterone system ( including perindopril or losartan ) , or brain calcium metabolism ( like nitrendipine ) , provide additional protection against cognitive decline in addition to blood pressure control . all of these studies suggest a neuroprotective effect of certain antihypertensive agents . in light of these findings , animal studies in our laboratory have shown that the application of certain antihypertensive drugs can improve cognition in animal models of ad . we conducted a high - throughput drug screening of 55 commercially available antihypertensive drugs and found 7 candidate agents that significantly reduced ad - type a accumulation in the brains of tg2576 mice . of these 7 drugs , we found that valsartan , an angiotensin receptor blocker , attenuated the oligomerization of a into high - molecular - weight ( hmw ) oligomeric peptides ( known to be involved in cognitive deterioration ) in vitro and reduced the content of soluble hmw oligomeric a in the brain in preventive studies . additionally , we also found that valsartan , delivered at a dose 2-fold lower than the equivalent clinical dosage used in humans for hypertension , significantly attenuated the development of a-mediated cognitive deterioration . another in vitro study in this line of investigation revealed that the antihypertensive drugs furosemide , nitrendipine , and candesartan cilexetil prevented a140 and a142 oligomerization and that furosemide in particular dissociated preaggregated a142 oligomers ; follow - up studies revealed that short - term treatment with furosemide in tg2576 mice resulted in reduced a content in the brain . most recently , we have investigated the potential beneficial effects of carvedilol , a nonselective /-adrenergic receptor blocker used to treat hypertension , on ad pathogenesis and treatment in two ad mouse models . we found that chronic oral treatment with carvedilol significantly attenuated brain contents of oligomeric a and cognitive deterioration in two mouse models of ad ( the tg2576 model of -amyloidosis and tgcrnd8 model of tauopathy ) , which coincided with improvements in neuronal transmission and the maintenance of less stable learning thin dendritic spines ( associated with learning and memory functions ) in the brains of these ad mice . a related study in our laboratory investigated the benefits of carvedilol in ad on an electrophysiological parameter of learning and memory , long - term potentiation ( ltp ) , as assessed in the tgcrnd8 mouse model . in this ex vivo study , hippocampal slices from carvedilol - treated tgcrnd8 mice chronically treated with carvedilol showed improved basal neurotransmission and improved ltp , relative to slices from nontreated tgcrnd8 mice , indicating that carvedilol improves neuroplasticity in this mouse model of ad . collectively , these studies suggest a clear link between hypertensive conditions and ad and , importantly , that antihypertensive agents may benefit ad . in turn , these studies also indicate that taking dietary precautions to prevent hypertension may , in turn , reduce one 's risk for ad . a large area of research in the field of neurodegeneration has been focused on the role of specific foods and food components in the neurodegenerative process . [ 65 , 66 ] posited that taking nutritional supplements alone ( e.g. , carotenoids versus carrots ) might not be as effective as whole foods in providing nutrients , perhaps because the interaction of nutrients within whole foods or certain dietary patterns might contribute largely to any food 's benefit . as an example , one study demonstrated that plant - based low - fat diets might be superior to low - fat diets containing little plant - based food intake ( e.g. , lower consumption of fruits , vegetables , nuts , etc . ) , even if the two diets have identical contents of fat , protein , carbohydrates , and cholesterol . the authors further noted that the beneficial effect of low - density lipoprotein ( ldl ) cholesterol in one 's diet should not be underestimated . for example , researchers have investigated the benefits of certain omega-3 fatty acids found in fish and fish oils , specifically docosohexaenoic acid ( dha ) and eicosapentaenoic acid , which have been shown to affect psychiatric and behavioral symptoms in ad , as demonstrated in animal studies and in human epidemiological studies [ 84 , 85 ] . in this line of research , lim and colleagues demonstrated that dha - enriched diets significantly reduced ad - type amyloid neuropathology by approximately 70% , including a decrease in a142 levels , compared to low - dha or control diets , in a mouse model of ad . moreover , hashimoto and colleagues studied the effects of dha on ad - type pathology following 12 weeks of dha administration and found that dha treatment led to a decreased number of working memory errors in a-infused rats in addition to an increase in corticohippocampal dha levels and in the molar ratio of dha / arachidonic acid , suggesting that dha treatment attenuated impaired spatial cognition and learning abilities . they further demonstrated that dha suppressed increases in levels of lipid peroxide and reactive oxygen species in the cerebral cortex and hippocampus of these a-infused rats , which suggested that dha may also increase antioxidative defenses . another area of interest to researchers has been the benefits of certain plant extracts and spices in ad . in traditional asian medicine , various leaves , fruits , barks , roots , and so forth have been used as agents to improve memory functions . in ayurvedic medicine ( a traditional system of indian medicine ) , for example , bacopa monnieri , centella asiatica , withania somnifera , glycrrhiza glabra , acorus calamus , and emblica officinalis have been considered to enhance one 's memory . based on this notion , various laboratories have tested some of these memory - enhancing compounds in mouse models of ad . mulberry leaf , for example , has been shown to inhibit a142 fibril formation and protect hippocampal neurons from a142-induced cell death in a concentration - dependent manner . additionally , in a screening of 27 herbs for their ability to protect a142-induced neuronal death , curcuma aromatia and zingiber officinale ( ginger ) extracts were found to most effectively protect neurons . several other herbs were also found to be neuroprotective ( such as ginkgo biloba ( ginkgo ) , polygonatum sp . ( king solomon 's seal ) , cinnamum cassia ( chinese cinnamon ) , and rheum coreanum ( korean rhubarb ) ) , but did not exert as potent effects . ginkgo biloba extract in particular has been heavily investigated for its use as a preventive and therapeutic agent in ad . it has been shown to exhibit neuroprotective effects in several mouse models and improve cognitive function in ad patients [ 91 , 92 ] . for example , it has been shown to improve age - related memory deficits and a-peptide burden , act as a nitric oxide scavenger [ 93 , 94 ] , and regulate app metabolism toward the -secretase pathway . ginkgo biloba extract has also been shown to inhibit a-induced free radical generation in a dose - dependent manner . further , yao and colleagues examined a specific ginkgo biloba extract egb761 in relation to cholesterol and amyloidogenesis and found that egb761 treatment reduced app and a generation coincidental with decreased levels of free circulating cholesterol in in vivo ( in rats ) and in vitro studies . moreover , lee and colleagues investigated ginkgolides a and b for their effect on a-modulated acetylcholine release from hippocampal brain slices and found that ginkgolide b may produce antiamnestic effects by mitigating a peptides ' inhibitory effect on cholinergic transmission . another plant extract , curcumin , a polyphenolic yellow pigment in the turmeric spice used in indian curries and in indian herbal medicine , has been investigated for its potential use in ad prevention and therapy . epidemiological studies demonstrated that the prevalence of ad in individuals 7079 years of age is 4.4-fold less in the india compared to the u.s . . the curcumin compound ( 1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6 heptadiene-2,5 dione ) has been shown to be neuroprotective against a toxicity in vitro , antiamyloidogenic [ 101 , 102 ] , and capable of reducing brain amyloid load and plaque burden . spectrophotometric studies have suggested that curcumin binds to the more readily redox - reactive metals cu and fe , but does not bind to zn , and , in turn , acts as an antioxidant by chelating the redox active metal ions in the body . lim and colleagues found that dietary curcumin treatment in ad mice significantly lowered levels of oxidized proteins , interleukin-1 ( a proinflammatory cytokine elevated in these mice ) , and insoluble and soluble a in the brain and reduced amyloid plaque burden by 43%50% . for example , aged garlic extract has been shown in vitro to suppress the generation of reactive oxygen species , which are known to be involved in apoptosis as a result of a-mediated neurotoxicity , suggesting that garlic compounds may enhance antioxidant defenses in the brain . additional in vitro evidence demonstrated that garlic treatment inhibits caspase-3 in a dose - dependent manner , which indicates that garlic may inhibit apoptotic neuronal death in the brain . another spice of interest to researchers as been crocus sativus , or saffron , due to its unusually polar carotenoid components . notable , certain saffron extracts have been shown to inhibit a fibrillogenesis . further research on these extracts may illuminate precise mechanisms of action on ad neuropathology and their potential as preventive or therapeutic agents in ad . polyphenols , the most abundant dietary antioxidants , have been heavily investigated for their ability to provide neuroprotection against oxidative damage in the brain . one study that propagated research on polyphenols in ad , conducted by dai and colleagues , revealed that long - term fruit juice consumption can reduce one 's risk for ad . the investigators suggested that the neuroprotective effects of fruit juices can be enhanced by consuming a combination of juices that are rich in phenolic compounds , which include juices derived from purple grapes , grapefruit , cranberries , and apples . several studies have examined the effects of certain fruit juices and extracts on ad . for example , apple juice was shown to prevent a-induced oxidative damage in vitro , and blueberry treatment has been found to reverse the effects of aging on motor behavior and neuronal signaling in animal models , possibly through mechanisms involving signal transduction , neuronal communication , and enhancement of hippocampal plasticity [ 112 , 113 ] . moreover , treatment with antioxidant - rich pomegranate juice has been shown to reduce a142 content and amyloid deposition in the hippocampus by approximately 50% in mice . a study conducted by mullen and colleagues examined 13 different fruit juices and reported that purple grape juice contained the highest number of individual phenolic compounds in addition to the highest concentration of total phenolics . the main components found in purple grape juice , accounting for 93% of the total phenolic conent , were flavan-3-ols , anthocyanins , and hydroxycinnamates . white grape juice , on the contrary , containing mainly hydroxycinnamates , had the lowest phenolic content of the juices examined . resveratrol is a naturally occurring polyphenol , found in the skin of grapes and red wine as a result of exposure to fungi or bacteria , which has been investigated for its ability to neuroprotect . resveratrol has been demonstrated to maintain cell viability , exert antioxidant activity , exert proteasome - dependent antiamyloidogenic activity , and attenuate a-induced cytotoxicity in pc12 cells in vitro [ 115117 ] . importantly , resveratrol is also understood to activate the expression of sirtuins , often referred to as the longevity gene , in yeast and in mammalian animal models of neurodegeneration [ 119 , 120]this resveratrol - induced sirtuin activation has been shown to promote neuroprotective activities against neuronal apoptosis . however , given recent evidence suggesting that resveratrol may not directly activate sirtuins , it is not quite clear if sirtuin activation plays a role in resveratrol 's observed benefits in ad - type neuropathology . further research will certainly illuminate resveratrol 's bioactivity and the mechanisms through which it benefits ad . several studies have suggested that moderate red wine consumption reduces the incidence of ad clinical dementia [ 65 , 66 , 115 , 122124 ] and may even benefit the course of ad . derived from red grapes , red wine is rich in antioxidants and holds neuroprotective properties . studies in our laboratory , using an ad mouse model , examined whether moderate consumption of the red wine cabernet sauvignon ( the most polyphenol - rich red wine , likely due to increased inclusion of grape skins ) reduces ad - type neuropathology and cognitive deterioration . we found that cabernet sauvignon treatment was capable of attenuating ad - type cognitive deterioration and a neuropathology by mechanisms involving nonamyloidogenic processing of app , ultimately inhibiting a generation [ 126 , 127 ] . another area of investigation of high interest in the ad field has been the potential beneficial role of grape seed polyphenolic extract ( gspe ) in attenuating ad - type neuropathology and cognitive impairments . studies in our laboratory have investigated a specific gspe ( meganatural ) , which is comprised primarily of catechin and epicatechin in monomeric , oligomeric , and polymeric forms , is readily absorbed through the intestinal mucosua due to modification of the constituent polyphenols in its preparation and has been demonstrated to be safe in animal models [ 128131 ] and in humans with pre - hypertensive conditions . in an initial investigation in a mouse model of ad , mice were treated for 5 months with 200 mg / kg / day gspe in drinking water ( equivalent to 1 g / day in humans , according to food and drug administration criteria for converting drug dosages across species ) , after which in vitro and in vitro assessments were conducted at 6 ( for behavior ) and 10 ( for neuropathology ) months . in vitro studies revealed that gspe prevented a peptides from aggregating into high molecular weight ( hmw ) oligomers , and in vivo studies showed that gspe treatment significantly reduced a140 and a142 peptide and hmw a oligomer levels and amyloid plaque burden in the brain , relative to age- and gender - matched water - treated mice . moreover , gspe - treated mice also performed significantly better tests of cognitive function compared to age- and gender - matched water treated mice . a follow - up mechanistic study investigated in vitro gspe 's ability to alter the assembly of a140 and a142 oligomers and a-induced cytotoxicity in a-treated pc12 cells ; these studies revealed that gspe blocked a protofibril formation , preprotofibrillar oligomerization , and the structure transition from initial coil to -helix/-sheet . additionally , gspe exerted protective activities in assays of a-induced cytoxicity ( prior to peptide assembly , following assembly , and just prior to peptide addition in cells ) . these studies collectively suggest a neuroprotective and possibly therapeutic role of gspe in ad - type a neuropathology and cognitive deterioration . to follow this line of work , we also investigated in vitro the potential beneficial role of gspe on ad - type tau neuropathology , another major hallmark of ad . using an in vitro model system , we found that gspe treatment significantly inhibited the aggregation of tau peptides into filaments and was also capable of dissociating preformed tau aggregates . this finding suggests that gspe treatment may attenuate deposits of tau aggregates in the ad brain . in light of our evidence that gspe was capable of attenuating a and tau pathology , we next explored gspe bioavailability to further assess its potential as an ad treatment . we found that acute oral administration of gspe in sprague dawley rats led to detectable contents of catechin , epicatechin and their metabolites in the brain . following repeated gspe exposure , we detected accumulations of catechin , epicatechin , and gallic acid and their metabolites in the blood and similarly , catechin and epicatechin and their metabolites in the brain . these studies , which demonstrate gspe 's ability to attenuate ad - type a pathology in vivo and in vitro and tau pathology in vitro , combined with its demonstrated safety and bioavailability , support the continued development of gspe as a treatment for a- and tau - mediated neurodegeneration and cognitive impairments . collectively , epidemiological and experimental research has demonstrated that dietary choices can play a key role in the prevention of ad and dementia . for example , much of the research described here suggest that preventing and managing conditions such as diabetes , hypertension , obesity , and heart disease may in turn prevent the onset of pathological aging and dementia . research from our laboratory and others has demonstrated that reducing calorie intake can help prevent ad and similarly , given the demonstrated relationship between diabetogenic conditions and ad , that preventing diabetes ( perhaps by limiting one 's glucose intake ) may also decrease one 's risk for ad . moreover , studies have demonstrated that consuming foods that are rich in polyphenols , such as blueberries or grapes , may also prevent ad and cognitive deterioration , perhaps through their antioxidant and antiamyloidogenic activities . based on the evidence described , it seems possible that in the near future , we may be able to utilize our knowledge of ad prevention through dietary changes and work toward intensive dietary intervention(s ) that might be capable of preventing or treating ad . however , when reviewing this body of scientific literature , one must understand that this area of research is still in its infancy , and further research must be conducted before making any dietary recommendations to the general public for preventing neurodegenerative conditions of aging . for example , conditions such as ad are chronic and have a long latency period , and conducting clinical trials for dietary interventions under such circumstances , over long enough periods of time and on large enough samples to draw accurate and repeatable conclusions , would be a highly complex endeavor . moreover , any dietary recommendations made toward this aim must always be incorporated into a general healthy diet . future research on dietary lifestyles and their role in the prevention or treatment of dementia will certainly elucidate which diets and foods are capable of exerting neuroprotective activities , in what quantities , and by what mechanism(s ) of action . the current medical model for preventing and treating neurodegenerative conditions such as ad lacks a whole organism approach . for example , the onset of ad is likely a result of genomic and proteomic factors , but also psychosocial and lifestyle factors , such as nutrient intake or levels of stress . today , medicare and other insurers and individuals will pay billions of dollars for various surgical and medical procedures to treat chronic conditions ( such as heart disease or diabetes ) , and yet they pay very little for integrative and preventive medicine approaches ( such as alterations in diet ) that can prevent or reverse many chronic conditions . by further investigating the role that dietary choices may play in ad and other dementias and diseases of aging , we will work toward the utilization of an integrative approach to medicine , taking into account all aspects of an individual 's lifestyle when working toward the maintenance and curing of chronic diseases . | alzheimer 's disease is a devastating neurodegenerative condition currently affecting over 5 million elderly individuals in the united states .
there is much evidence suggesting that certain dietary lifestyles can help to prevent and possibly treat alzheimer 's disease . in this paper , we discuss how certain cardiovascular and diabetic conditions can induce an increased susceptibility for alzheimer 's disease and the mechanisms through which this occurs .
we further discuss how the consumption of certain foods or food components can help to reduce one 's risk for alzheimer 's disease and may possibly be developed as a therapeutic agent . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the unicuspid aortic valve ( uav ) is a rare form of congenital heart disease , mainly confused with bicuspid aortic valve and presents with aortic stenosis [ figures 14 ] . others may remain hemodynamically stable for several years before they require intervention , especially in the unicommissural form . here , we present a case of uav with moderate aortic stenosis detected by echocardiography in the infant . transthoracic echocardiography at parasternal short axis view shows posteriorly situated eccentric aortic valve orifice in systole transthoracic echocardiography at parasternal short axis view shows the one lateral commissural attachment to the aorta posteriorly in diastole parasternal long axis view shows dome - shaped configuration of aortic valve during systole parasternal long axis view shows dome - shaped configuration of aortic valve during diastole absence of failure to thrive and no signs of congestive heart failure on clinical evaluation . on general examination , the child was afebrile , pallor , no cyanosis or clubbing , and jugular venous pressure was not raised . transthoracic echocardiography revealed a posteriorly situated eccentric aortic valve orifice extending to the annulus in systole . it showed noncalcified , unicuspid unicommissural aortic valve with moderate aortic stenosis ( peak pressure gradient of 50 mmhg ) . the size of the aortic annulus ( 08 mm ) , aortic root ( 13.7 mm ) and ascending aorta ( 12.4 mm ) . no other associated congenital heart disease was noted [ video 12 ] . the aortic valve develops from three tubercles that are converted into thin valve cusps and sinuses of valsalva by a process of excavation . a uav is formed by the fusion of all the three cusps . the free edge of the single leaflet originates from the single attachment . uav may have a central opening ( no true commissure / acommissural ) or an eccentric orifice ( unicommissural ) as in our case . the acommissural type has no lateral attachment to the aorta with a central orifice , and the unicommissural type has one attachment with an eccentric orifice that could be linear ( like an exclamation mark ) , triangular , oval , or tear drop shape . the acommissural form usually causes severe stenosis and is highly symptomatic at a neonatal age . the uav is a rare congenital malformation seen in 0.019% of patients during the echocardiographic evaluation and in 5.59% of patients during aortic valve replacement . severe aortic stenosis or mixed stenosis and regurgitation are the predominant disorder that accompanies patients with a uav . it presents far more often in males than females , often in the third decade of life when aortic stenosis becomes clinically significant . the uav is prone to be associated with dilatation or dissection of the aorta , involving the aortic root , ascending aorta , or aortic arch , which typically requires surgical intervention . other associated disorders include aortic coarctation , an aberrant right subclavian artery , and a single coronary artery and ventricular septal defects ( vsds ) . the importance of an early diagnosis of uav lies in its risk of sudden cardiac death and association with other congenital anomalies , such as patent ductus arteriosus ( pda ) , vsd , anomalous coronary arteries , and coarctation of the aorta . recently , magnetic resonance imaging , cardiac computed tomography , and multislice tomography angiography used as diagnostic tool for uav . whereas , echocardiography remains a useful and reliable method for the diagnosis of a uav . systemically reviewed nine articles with 60 pediatric cases ( age < 15 years ) of uav . he reported the most common presentation of uav was congestive heart failure due to congenital aortic stenosis , and the most common lesion was isolated aortic stenosis , reported in 19 cases ( 32% ) . associated anomalies included 22 cases ( 37% ) of aortic coarctation , 7 ( 12% ) with vsd , 3 ( 5% ) with pda , and 3 ( 5% ) with aortic aneurysm . the preoperative diagnosis of uav was rare , and 33 cases ( 55% ) of pediatric uav were reported at autopsy or at the pathological examination of the surgically excised valves . uav are usually stenotic at birth requiring aortic valve replacement in third decade of life . others may remain hemodynamically stable for several years or decades before they require intervention for calcified stenosis or regurgitation . although stenotic unicuspid valves are treated by valvotomy , regurgitant uavs are commonly aortic valve replaced . aortic valve repair , including bicuspidisation , can be performed with low risk and excellent operative results . conclude that patients with uavs will present for cardiac surgery in their third decade of life . this case demonstrates incidental diagnosis of uav with moderate aortic stenosis in an infant who is asymptomatic and not accompanies any other congenital heart diseases . the surgical intervention had been deferred in this case and closely followed with echocardiography for aortic stenosis severity . | the unicuspid aortic valve ( uav ) is a very rare congenital anomaly , which usually presents as aortic stenosis , incompetence , or a combination of both . here ,
we present a case of uav with moderate aortic stenosis detected by transthoracic echocardiography in the infant . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mucogingival problems form a definitive diagnosis that includes an array of clinical findings , namely gingival recession ( gr ) , shallow vestibule , inadequate width of attached gingiva ( ag ) and aberrant frenulum . surgical endeavor by goldman for the correction of three specific problems , namely periodontal pockets that extend beyond the ag reaching the alveolar mucosa , an abnormal traction of the frenulum that can transmit tension for the gingival margins and cause recessions , and the functional condition of a shallow vestibule that promotes a decrease of the ag levels , initiated the era of mucogingival surgery that has motivated other clinicians to develop numerous refinements . several surgical procedures have then been described in continuation by various clinicians for these aforementioned mucogingival entities . these surgical solutions , although possessing their own merits , posed certain difficulties ; mainly , their inadequacy to treat other problems simultaneously . a single - step solution to mucogingival problems by a surgical intervention , i.e. bridge flap procedure , is the continuation of the same endeavor . the following case series represents a cost - effective single - step entity to correct multiple mucogingival problems at a time with less morbidity to donor tissue and to evaluate the correction gained by this bridge flap procedure . after clearance from local ethical committee , 18 teeth with recession in eight otherwise systemically healthy non - smoker patients in the age group of 2040 years , who came with the chief complaint of poor esthetics in the lower anteriors due to recession and/or hypersensitivity , were selected for the procedure after phase one therapy . clinical examination revealed an inadequate zone of ag ( tension test - positive ) with either shallow vestibule or aberrant frenum attachment in all cases [ figure 1 and 2 ] . clinical parameters recorded using unc-15/who periodontal probe at base line and 9 months after procedure included probing pocket depth ( ppd distance from gingival margin to base of pocket ) , gr ( distance from cementoenamel junction to gingival margin ) , width of ag ( distance from base of pocket to mucogingival junction ) , and clinical attachment level ( cal distance from cementoenamel junction to base of pocket ) , as shown in tables 13 ] . the procedure was well explained to the patient and informed consent was obtained for surgery . pre - operative photograph showing insufficient width of attached gingiva , presence of diastema , pronounced labial inclination , and miller 's class iii recession on teeth 31 and 41 pre - operative photograph showing recession on teeth 31 and 41 along with insufficient attached gingiva and high frenum attachment pre - operative ( at base line ) post - operative ( at 9 months ) change in pre- and post - operative values the surgical procedure included the bridge flap technique as introduced by marggraf and later on modified by romanos . the technique included an arch - shaped incision in the vestibule at approximately 2 gr + 2 mm from the gingival margin . an incision into the perisoteum was placed at its base and the bone was exposed so that scar formation could occur . a spilt - thickness flap was elevated in the apicocoronal direction by making a sulcular incision , connecting it with the first incision so that the whole bridge flap could be elevated and repositioned coronally to cover the denuded root surfaces . the repositioned flap was then pressed for 3 min and independent sling sutures were placed [ figure 3 and 4 ] . written post - operative instructions were given to the patients and they were prescribed analgesic ( ibuprofen 400 mg twice daily ) for 3 days . sutures were removed 10 days after the surgical procedure and patients were asked to maintain meticulous oral hygiene . all surgical procedures were performed by the same clinician and both pre - operative and post - operative measurements were recorded by the same individual . intra - operative photograph showing arc - shaped incision and bridge flap repositioned coronally with independent sling sutures intra - operative photograph showing arc - shaped incision and bridge flap repositioned coronally with independent sling sutures t test . for the purpose of analysis , statistical package for social sciences version 15.0 was used . results showed statistically significant root coverage and significant gain in ag and clinical attachment with average value of 1.778 1.003 mm , 3.527 0.915 mm , and 1.945 0.265 mm , respectively . highest gain in ag was 4.6 mm , whereas the least gain was 1.8 mm , and the highest recession coverage came to an average of 87.5% , whereas the least was 25% . results also showed non - significant changes in periodontal ppd . while reviewing the literature , we came across a number of articles addressing mucogingival problems and their surgical solutions . however , an unresolved controversy still exists in the literature regarding the adequate ag for periodontal health maintenance , and the contemporary opinion suggests that the regions with < 2 mm ag and thin gingival tissue are at increased risk of gr even if it is possible to maintain the gingival health in the areas with insufficient or absent ag . hence , mucogingival therapy should be advocated for gingival augmentation and to create adequate vestibular depth in areas with insufficient ag.[58 ] contrary to the reports of marggraff , romanos et al . , and vijaylaxmi et al . , who all stressed very little on the gain of width of ag by this particular technique , we observed a surprising and highly statistically significant gain . the highest gain of ag width in our study was 4.6-times of the pre - operative , and the least was 1.8-times , with an average gain of 3.5 mm [ figure 5 and 6 ] . we selected our cases regardless of the etiology of gr mainly on the patients complaint of esthetics and hypersensitivity . but , on close survey of our cases selected , anatomical variations for gr , viz . high frenum pull , shallow vestibule , thin gingival tissue or insufficient width of ag , were present in one or the other patient as contributing factors for gr . by achieving such a significant gain in the apico - coronal dimension of ag , we at least could abolish the aforementioned contributing etiologic factors for gr , and the incidence of recurrent recession was also decreased considerably by the simultaneous extension of the vestibule . the mean percentage gain in cal was around 41% in our study , which also re - asserts the gain in width of ag by this surgical endeavour . the mean percentage change in ppd from the mean pre - operative value had been only 14.3% , clinically not much reduction could have been possible as the cases selected were already scaled and root planed thoroughly . post - operative photograph ( 9 months ) . marked increase in width of the attached gingiva can be appreciated post - operative photograph ( 9 months ) the mean root coverage obtained in our study was 55% and , contrary to the study of vijaylakshmi et al . and romanos et al . , we could not achieve any 100% root coverage . this dissimilarity of our results could be because of us being more liberal in our case selections in terms of diastema presence , pronounced labial inclinations , shallow vestibule , or frenum pull at the same time . the least coverage attained in our study was 25% and , therefore , the range of root coverage ( 2587.5% ) is similar to the range of root coverage obtained by any root coverage procedure . the minimum values of root coverage , i.e. 25% , in few cases could be due to the very thin gingiva present , which posed great difficulties in coronally repositioning the bridge flap that is a partial thickness flap . to overcome this difficulty , modifications such as combination of connective tissue grafts along with this bridge flap technique can be advocated . we kept our study cases limited to the lower anteriors to get unbiased results as well as to be able to treat multiple mucogingival problems at the same time . in terms of root coverage , it is highly important to have a proper case selection , e.g. presence of diastema , improper proximal contacts , thinness of gingival , or pronounced labial inclinations , which , otherwise , significantly lowers the outcome of root coverage . the results of our cases where open proximal contacts were present are contrary to the results shown by vijaylakshmi et al . based on our results , we also recommend that a completely preserved interdental septum is a conditio sine qua non as advocated by marggraf . the present case series presents a cost - effective single - step entity to correct multiple mucogingival problems at a time with less morbidity to donor tissue ; however , lack of inclusion control groups are its limitation and , hence , further controlled randomized clinical trials are required . several surgical techniques are described in the literature to correct mucogingival problems . the surgical endeavor , bridge flap procedure , gave a successful solution by attaining root coverage , increasing the width of ag , deepening the vestibule to a desired extent , and simultaneously correcting the problem of high frenum if present , in one step only , along with gain in cal and reduction of ppd . | shallow vestibule , gingival recession , inadequate width of attached gingiva ( ag ) and aberrant frenum pull are an array of mucogingival problems for which several independent and effective surgical solutions are reported in the literature .
this case series reports the effectiveness of the bridge flap technique as a single - step surgical entity for increasing the depth of the vestibule , root coverage , increasing the width of the ag and solving the problem of abnormal frenum pull .
eight patients with 18 teeth altogether having millers class i , ii or iii recession along with problems of shallow vestibule , inadequate width of ag and with or without frenum pull underwent this surgical procedure and were followed - up till 9 months post - operatively .
the mean root coverage obtained was 55% and the mean average gain in width of the ag was 3.5 mm .
the mean percentage gain in clinical attachment level was 41% .
the bridge flap technique can be an effective single - step solution for the aforementioned mucogingival problems if present simultaneously in any case , and offers considerable advantages over other mucogingival surgical techniques in terms of simplicity , limited chair - time for the patient and the operator , single surgical intervention for manifold mucogingival problems and low morbidity because of the absence of palatal donor tissue . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
brachytherapy , owing to the close apposition between the target and the radiation source , is undoubtedly the radiotherapeutic technique that offers maximum conformality . ultrasound ( usg ) makes use of the different echogenicity between different tissues , and serves as an effective tool for delineating tumors and differentiates them from surrounding normal tissues . ultrasonography is attractive as an image guidance modality in brachytherapy , since it is portable , inexpensive , and simple to use , and thus allows for accurate , conformal , reproducible , and adaptive treatments . the newer planning systems for brachytherapy utilize usg as the sole modality for imaging . an imaging based brachytherapy procedure can be divided into four different steps : 1 ) image - assisted provisional treatment planning , 2 ) image - guided application , 3 ) image - assisted definitive treatment planning , 4 ) image - assisted quality control . european society for radiotherapy and oncology ( estro ) has recognized usg as a valuable tool for the first 3 steps . considering the widespread use of usg in prostate cancer brachytherapy and its increasing role in gynecological and breast cancer brachytherapy , we decided to explore the current status of its use in brachytherapy in all sites , recent advances , and future possibilities . english language literature ( till november 2016 ) , illustrating the use of usg for brachytherapy , was queried for the following terms : ultrasound , 3-dimensional ultrasound , image guidance , planning for individual sites of cancer. the available evidences were summarized , including indications from more widespread and routine use in clinical practice to less common sites . the focus was not to give a systematic review , but to include studies that help sensitize the reader about varied uses and development of usg for brachytherapy in different sites . in the 1980s , the use of transperineal needles and transrectal usg ( trus ) guidance brought attention to brachytherapy for prostate cancer . the use of usg gathered momentum with its widespread use in low - dose - rate ( ldr ) pre - planning , ldr seed insertion , and high - dose - rate ( hdr ) needle or catheter insertion . with continual development , usg overtook all imaging modalities through all steps of prostate brachytherapy . after hdr brachytherapy has shown equivalent clinical results to ldr brachytherapy , it has gained ever increasing popularity with lesser number of high - dose fractions . concurrently , the need to accurately deliver the planned treatment with minimal catheter displacement evolution of trus and the availability of sophisticated treatment planning computers have evolved into a reliable system of treating prostate cancer patients by brachytherapy , either in form of boost or monotherapy . a technical note by morton argues in favor of trus - based planning with delivery of a single hdr fraction as an effective and well - tolerated tool for local dose escalation for patients with intermediate and high - risk disease . a trus - guided hdr prostate procedure is easy to perform and convenient for the patient . the procedure takes about 90 minutes and the patient is treated without any displacement . identifying the catheters is not difficult , and a number of usg base planning systems are now commercially available . early results ( median follow - up of 10 months ) of use of hdr single fraction boost brachytherapy with use of usg only for positioning and planning have been published by oliver et al . , with dose planning objectives reached in 90% cases , with none reporting more than grade 2 toxicity , early recovery of baseline urinary function , and promising psa responses . recent advances in the field of contrast - enhanced usg seems to be promising for intraprostatic lesion localization as a support for brachytherapy treatment planning . dose coverage in the intraprostatic lesion could be improved without increasing a dose to organs at risk . the use of real time trans - abdominal ultrasound ( taus ) or trus , increases the probability and safety of accurate placement of the uterine tandem . trans - abdominal ultrasound performed during an insertion of uterine tandem and ovoids , allows accurate 3d measurement of uterine wall thickness at multiple anatomical levels . this information can be used in conjunction with orthogonal radiographs in order to calculate bladder base doses , and allows real - time assessment of surrounding visceral doses . ultrasonography has been successfully used for planning in the intracavitary applications incorporating all these advantages [ 8 , 9 ] . one of the first reported uses of usg for interstitial gynecologic brachytherapy was by stock et al . who demonstrated the usefulness of usg to visualize the target as well as normal tissues in 12 patients . sharma et al . reported on their experience using trus to assist with needle placement in 40 procedures in 25 patients , avoiding any bladder or rectal perforations . other groups have also reported their experience using usg to assist the guidance of brachytherapy catheters with each demonstrating feasibility and safety in a prospective setting . investigators from mumbai have shown a reasonable correlation between taus and mri - based ( magnetic resonance imaging ) planning . the melbourne group has used usg as the sole modality for positioning and planning in intracavitary treatment of cancer cervix . encouraging clinical results in a large cohort of cervical cancer patients ( 292 patients , non - stage iv ) have been reported with a median follow - up period of 4.1 years , a five - year local control of 87.5% , and acceptable toxicity profile . the 5-year failure - free survival and overall survival were 66% and 65% , respectively . have described usg based gynecologic planning to be a 2.5-dimensional approach in the sense that the usg measurements are used to inform the planning , however the prescription is not based on a 3-dimensional volume . currently , usg can not be used as a planning tool for complicated interstitial brachytherapy . it can be used to place the needles and delineate the groupe europen de curiethrapie european society for radiotherapy and oncology ( gec - estro ) defined high - risk clinical target volume ( hr - ctv ) . the vienna group suggests that delineating of hr - ctv from trus may soon be an acceptable modality . a recent proof of concept has been enunciated for use of trans - cervical endosonography ( trace ) in pre - planning , real - time guidance , and treatment planning of cervical cancer image - guided adaptive brachytherapy ( igabt ) , and can serve as an interesting addition to complement existing imaging technologies . interstitial brachytherapy - based accelerated partial breast irradiation ( apbi ) is a relatively recent development in breast radiotherapy that has gained international favor , with recent evidences suggesting that hdr apbi is here to stay . interstitial brachytherapy has also been used as a boost therapy after whole breast external beam radiotherapy ( ebrt ) . the first use of usg for apbi was described as early as 1997 , and it has now become the most ubiquitous modality used for postoperative applicator placement [ 17 , 18 ] . when the applicator is placed in the operating room , usg can also confirm applicator positioning and the lack of air within the lumpectomy cavity . using three - dimensional ultrasound ( 3d - usg ) to image the patient in breast brachytherapy can be effective as a primary treatment planning imaging modality in breast cancer . the images collected with the applicator in situ can provide a means of optimizing the dose delivered , sparing adjacent normal structures along with a fast and efficient way of delivering personalized real - time guidance , and planning for breast hdr brachytherapy treatments [ 20 , 21 ] . 3d endoluminal usg has gained popularity in assessment and interventions for luminal structures such as esophagus and rectum / anal canal . a few centers have extended this application for guiding brachytherapy procedures in anal canal , with the advantages of optimizing implant procedure and better information for dose planning , akin to prostate cancer interstitial brachytherapy . by using an anal obturator or dilator , the dose to the healthy side of the anal canal is limited . under usg control , the needles are implanted directly into the tumor or tumor bed , and real - time treatment planning is possible . imaging allows for control of the dose distribution and ensures that the whole tumor is covered by the reference isodose [ 22 , 23 ] . kiel et al . have described their long term clinical experience with this technique in 104 patients with a 10-year mean follow - up period , showing a local control of 89% and overall survival of 93% . interstitial brachytherapy has shown promising results for inoperable peripheral lung tumors in terms of safety and efficacy in limited reports , and could potentially be an approach for selected curative treatments , as well as an alternative to radiofrequency ablation , sparing major damage to radiosensitive surrounding structures . in a pilot study reported by harms et al . , inoperable peripheral malignant lung lesions were approached by electromagnetic navigation and the position was confirmed by endobronchial usg . have reported on the use of interstitial brachytherapy for treatment of subcutaneous metastatic abdominal wall tumors . they developed a technique utilizing usg - guided insertion of applicator needles to avoid the organs at risk such as intestines , and saline injection into the subcutaneous tissue between the tumor and the skin to decrease the skin dose . long - lasting pain reduction and tumor shrinkage was obtained without significant early or late complications . intraluminal brachytherapy with a transcatheter iridium-192 ( ir ) wire , as a method to deliver a boost to patients with tumors of extrahepatic bile ducts , has been sufficiently discussed in published series . a major limitation of current imaging techniques is the inability to accurately define the proximal , distal , and most importantly , the lateral extent of tumor . minsky et al . were able to utilize the advantage of small diameters of endoluminal usg probes allowing insertion into a biliary duct drainage tube and used it to successfully determine tumor volume in the bile ducts . literature on use of usg for head and neck brachytherapy is relatively sparse , but it can be a valuable companion in locally - advanced primary cancers , as well as in recurrent head and neck cancers . needles can be positioned under continuous usg guidance , and adjacent structures ( e.g. the carotid artery ) are easily localized , thus avoiding violation of large vessels and optimizing exact positioning of needles within the tumor . most technical arguments against the use of brachytherapy list the possibility of needle displacement from the time of insertion to the time of treatment , difficulty in delineation of tumor due to artefacts from metallic needles in computed tomography ( ct)-based planning , and fear of violating major vessels in the vicinity of tumor . use of ct - compatible needles as well as magnetic resonance imaging ( mri ) based planning have been able to avoid the problem of ct artefacts . however , associated increased cost , and limited availability and training requirements are issues that pose hindrances . in the era of intensity modulated radiotherapy and stereotactic body radiotherapy , brachytherapy needs to prove itself as a worthy competitor or alternative to external beam radiotherapy for delivering high fractional dose for radical or boost treatments . this is achievable when employing modern imaging tools for guidance and navigation for brachytherapy implantation , as well as for treatment planning and delivery in the same position . this allows to deliver a high dose inside the tumor , sparing surrounding critical structures with zero geometric uncertainty . the american association of physicists in medicine task group 43 ( aapm tg-43 ) dose calculation formalism for photon - emitting radionuclide sources is the mainstay of brachytherapy dosimetry in clinical practice . the tg-43 adopted universally , provides a standardized method to brachytherapy dose calculation based on the superposition of single - source dosimetry in water medium and is simple to use . the establishment of brachytherapy as the treatment of choice for early organ - confined prostate cancer , where usg imaging for pre- and intraoperative planning and needle insertion along with ct based planning , led to developments in the field of imaging - based brachytherapy treatment planning . conventional usg has been widely used in brachytherapy , mainly to guide needle placement and is useful in planning when combined with other modalities . two - dimensional viewing of 3-dimensional structures , using conventional usg , limits ability to quantify and visualize the anatomy and guide therapy . it needs multiple 2-dimensional images to be integrated mentally , and increased the possibility of inter - observer variability and inaccuracy . the newer developments in usg such as 3d usg , contrast - enhanced usg , and high frequency usg have been introduced with success in diagnostic , interventional , and therapeutic fields . the 3d usg system gives a spatially oriented and standardized view , thereby reducing operator dependence and improving reproducibility . it gives an accurate 3d anatomical display and is valuable in carrying interventional procedures by using multiplanar views . in 3d usg imaging , the inter - plane distance can be as low as 1.0 mm , resulting in accuracy better than 1.0 mm ( ~ 0.5 mm ) for catheter reconstruction . other benefit of usg imaging for the reconstruction of catheters is the possibility to combine 3d volume reconstruction with live 2d imaging . the united states food and drug administration ( us fda ) has not approved a microbubble agent for radiology imaging , but ultrasound contrast agents ( ucas ) are popular and widely used in europe and asia . use of contrast - enhanced ultrasound is cost - effective , can be performed at bedside , uses no ionizing radiation , has no nephrotoxicity , and can provide diagnostic information comparable to ct and mri . with the expanding use and availability of usg , the impression that usg is a subjective assessment may not hold true in the near future . a study focusing on training indian surgery residents in use of abdominal usg for 2 months showed that it was not difficult to learn with achievement of similar proficiency as that of a radiology resident following the training . studies from usa have reported on increasing utilization of usg by anesthetists for regional block procedures , and its use has rapidly entered the field of acute pain medicine and regional anesthesia and interventional pain medicine over the last decade , raring to become the standard of practice in due course of time . ultrasonography training may become progressively easier with reducing cost of machines as well as ease of preparation of low cost phantoms for usg . a summary of the authors understanding comparing ct , mr and usg has been tabulated in table 1 . computed tomography , magnetic resonance imaging and ultrasonography in image - guided brachytherapy ( authors recommendations ) ct computed tomography , mri magnetic resonance imaging , usg morton has pointed on several limitations of the use of usg in prostate brachytherapy , and these apply equally to other sites as well . it needs a shielded operating room or the ability to deliver anesthesia in an hdr bunker . as image quality can be degraded by calcification , bleeding , or the shadowing effects of implanted catheters , it is important to get high - quality usg images . ultrasonography is prone to distortion , sensitive to the temperature , and constitution of the medium , therefore requiring regular calibration . radiation oncologists are unfamiliar with using usg , hence training for the same should be introduced to increase the confidence level of future doctors . the trus probe itself may cause a decreasing space between the vaginal wall or prostate and anterior rectal wall , with a possibility of higher dose in the contact region , and appropriate precautions need to be taken to get around this possibility . in gynecologic brachytherapy , we can try to use real - time guidance to create space between the posterior vaginal wall and anterior rectum . clinical data using 3-dimensional usg in gynecological cancer and its use as a sole modality for volumetric treatment planning in cervical cancer are limited , due to poorer reproducibility and sub - optimal visualization of critical structures . high - dose - rate prostate brachytherapy has circumvented some of these challenges , however further work is clearly needed especially for cervix and other sites . considering the benchmark that usg has attained in prostate brachytherapy and accepting that most of the limitations are technical , scientific advancements in appropriate directions will hopefully solve the issues . ultimately , the ideal treatment process following usg - based catheter insertion would be to perform real - time usg planning and delivery . recent advancements in usg imaging and planning software of brachytherapy will help us obtain a real - time guidance , and estimate the dose delivery to the insertion position with zero geometric uncertainty . | inherently , brachytherapy is the most conformal radiotherapeutic technique . as an aid to brachytherapy , ultrasonography ( usg ) serves as a portable , inexpensive , and simple to use method allowing for accurate , reproducible , and adaptive treatments .
some newer brachytherapy planning systems have incorporated usg as the sole imaging modality .
ultrasonography has been successfully used to place applicator and dose planning for prostate , cervix , and anal canal cancers .
it can guide placement of brachytherapy catheters for all other sites like breast , skin , and head and neck cancers .
traditional usg has a few limitations , but recent advances such as 3-dimensional ( 3d ) usg and contrast usg have enhanced its potential as a dependable guide in high - dose - rate image - guided brachytherapy ( hdr - igbt ) .
the authors in this review have attempted to enumerate various aspects of usg in brachytherapy , highlighting its use across various sites . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
asian dust ( also yellow sand ) is a dominant springtime aerosol in east asia . the dust originates from the deserts of east asia , such as the takla makan and gobi , and is spread by prevailing winds not only locally to china and mongolia but also throughout east asia to countries such as korea , taiwan , and japan . a similar phenomenon originating from the sahara has also been observed in europe and the united states [ 1 , 2 ] , raising concerns throughout the world about the impacts of aeolian dust [ 3 , 4 ] . asian dust not only is responsible for financial loss through crop damage , tree collapse , and flight cancellations due to low visibility , but also it poses a major threat to human health . recent reports have shown that , in addition to harmful chemicals , asian dust particles contain lipopolysaccharides and -glucan , which are components of the bacterial cell membrane and fungal cell wall , respectively , and that bacteria can adhere to the outer surface of the dust particles [ 5 , 6 ] . indeed , morbidity rates for cardiovascular and respiratory diseases in central east asian countries increase during asian dust storms [ 79 ] ; in korea , asian dust storms are correlated with a 2.2% increase in the rate of patients over the age of 65 presenting with respiratory symptoms . the association between asian dust levels and the pathogenesis of childhood asthma has been clearly demonstrated ; asian dust likely triggers the onset of this and other inflammatory conditions through the induction of excessive antigen - specific or nonspecific inflammatory responses . although most of the information regarding asian dust - related health problems is based on epidemiological investigations , some experimental studies have demonstrated the effects of asian dust on allergic respiratory diseases in vivo [ 12 , 13 ] . for example , asian dust particles are reported to enhance both ovalbumin - induced eosinophil recruitment in the alveoli and airway submucosa in mice and nasal allergic reactions in guinea pigs . to further our knowledge on the mechanisms through which asian dust affects human health , it is essential to evaluate the interplay among the physical characteristics and the biological responses it provokes . it is generally accepted that , like bacteria and viruses , particulate matter such as asian dust particles is eliminated from the human body by phagocytes such as macrophages [ 16 , 17 ] . macrophages ingesting exogenous materials produce interleukin-6 ( il-6 ) and tumor necrosis factor- ( tnf- ) and , through the activation of signal pathways such as the mitogen - activated protein kinase ( mapk ) pathways , expedite the elimination of particulate matter by inducing inflammatory responses ; however , excessive or chronic macrophage activation results in inflammatory diseases such as bronchitis or pneumonia . it is therefore important to assess the biological responses of macrophages to asian dust particles , in particular the inflammatory responses . in the present study , we collected samples of suspended asian dust particles from beijing , china , and soil dust from loess plateau , china , which is a source of asian dust , and evaluated their effects on the macrophage inflammatory response . samples of suspended asian dust particles which fell on the top of the building of the beijing inner city were collected each day for three successive days from march 24 , 2010 ( defined as adp1 ) , and once on march 20 , 2010 ( adp2 ) . samples of soil dust were collected on june 30 , 2009 , from three locations at loess plateau , china , as follows : site 1 : lat 35 35 450n , long 109 10 074e ( sdp1 ) ; site 2 : lat 35 42 324n , long 109 25 390e ( sdp2 ) ; and site 3 : lat 35 42 279n , long 109 25 450e ( sdp3 ) . these soil dust particles were the same samples previously used by yamaguchi et al . in . in addition , sample sdp2 was partitioned by using a soundwave vibrating screen ( tsutsui rikagaku kikai co. , ltd . , tokyo ) , and particles 10 m in diameter were collected ( sdp4 ) . lipopolysaccharide ( lps ) , butylated hydroxyanisole ( bha ) , broad - spectrum ros scavenger , and diphenyleneiodonium chloride ( dpi ) , a specific inhibitor of nicotinamide adenine dinucleotide phosphate ( nadph ) oxidase , were purchased from sigma - aldrich ( st . louis , mo ) . u0126 , an extracellular signal - regulated kinase ( erk ) inhibitor , and sp600125 , a c - jun n - terminal kinase ( jnk ) inhibitor , were obtained from merck ( darmstadt , germany ) . sn50 , a nuclear factor-b ( nf-b ) inhibitor , was purchased from calbiochem ( la jolla , ca ) . raw264.7 cells ( mouse monocyte / macrophage cell line ) were obtained from the american type culture collection ( manassas , va ) and cultured at 37c in dulbecco 's modified eagle 's medium ( dmem ; wako pure chemical industries , osaka , japan ) supplemented with 10% fetal bovine serum and antibiotics . the asian dust particles and soil dust samples aliquots ( 50 l ) of each sample were then dried on a hot plate ( cimarec , barnstead thermolyne , dubuque , ia ) and observed under a scanning electron microscope ( jeol , ltd . , tokyo , japan ) . raw264.7 cells ( 1.5 10 cells / well ) were seeded in 96-well plates ( nunc , rochester , ny ) , cultured at 37c for 24 h , and then treated with 6.25 , 25 , or 100 g / ml of a suspension of asian dust particles or soil dust or dmem ( negative control ) or 1.5 g / ml of lps at 37c for 24 h. the cytotoxicity of asian dust was assessed by methylene blue assay . the cells were fixed with glutaraldehyde and stained with 0.05% methylene blue for 15 min . after washing with water , the methylene blue in the wells was eluted using 200 l of 0.33 n hcl for each of the wells and absorbance was measured at 655 nm ( subwave length , 415 nm ) . cell viability was calculated as the ratio of absorbance in the treated cultures compared to the control untreated cultures . enzyme - linked immunosorbent assay ( elisa ) kits were used in accordance with the manufacturer 's instructions to determine the levels of il-6 ( bd pharmingen , san diego , ca ) and tnf- ( ebioscience , san diego , ca ) in the culture supernatants . raw264.7 cells ( 1.5 10 cells / well ) were seeded in 96-well plates ( nunc ) , cultured at 37c for 24 h , and then preincubated for 0.5 h with cytochalasin d ( 5 or 10 m ) , bha ( 250 m ) , dpi ( 1 or 2 m ) , u0126 ( 30 m ) , sp600125 ( 50 m ) , or sn50 ( 50 m ) . the cells were then treated with 100 g / ml of a suspension of asian dust particles , soil dust , or dmem ( negative control ) for 6 h. tnf- in the culture supernatants were assessed by means of an elisa according to the manufacturer 's instructions . raw264.7 cells ( 1.5 10 cells / well ) were seeded in 96-well plates ( nunc ) , cultured at 37c for 24 h , washed three times with phosphate buffered saline , and then incubated in phenol red - free dmem containing 20 m 2,7-dichlorodihydrofluorescein diacetate ( cell biolabs , inc . , san diego , ca ) for 30 min at 37c . after incubation , the cells were treated with 100 g / ml a suspension of asian dust particles , soil dust , or dmem ( for negative control ) for 6 h and fluorescence was measured at 485 nm ( subwave length , 530 nm ) . first , the two asian dust particles samples ( adp1 and adp2 ) and three soil dust samples ( sdp1 , sdp2 , and sdp3 ) were examined under a scanning electron microscope ( figure 1 ) . we used soil dust samples as reference dust because satellite information indicated that the source regions of asian dust are considered to be loess plateau , china . yamaguchi et al . demonstrated that all samples contained particles with a coarse surface texture , that the particles varied in form , and that some particles were condensed by scanning electron microscopic analysis . they also showed that silicon and aluminum were major components of asian dust particles and that significant quantities of iron , calcium , and magnesium were also present . in addition , large numbers of particles with a diameter 100 m were observed in the three soil dust samples ( figures 1(c ) , 1(d ) , and 1(e ) ) but were not observed in the two asian dust particles samples ( figures 1(a ) and 1(b ) ) . previously , yamaguchi et al . showed that the mean particle size of asian dust particles was < 1 m . it represented that the mean size of the asian dust particles in our samples would be 1 m . next , we evaluated the potential of asian dust particles or soil dust to induce an inflammatory response in macrophages . because our previous data show that particle - induced inflammatory responses are dependent on particle size [ 1921 ] , we also investigated whether the induction of an inflammatory response by soil dust was dependent on particle size by partitioning the particles with a diameter 10 m ( sdp4 ) from sdp2 . to evaluate the cytotoxicity of the asian dust particles and soil dust samples , raw264.7 cells were treated with adp1 , adp2 ( asian dust particles ) , sdp1 , sdp2 , sdp3 ( soil dust ) , or sdp4 ( soil dust ; no significant cytotoxicity was observed in any of the experimental groups ( figure 2(a ) ) . next , to examine the macrophage inflammatory response to asian dust particles or soil dust , raw264.7 cells were exposed to 100 g / ml of each sample for 24 h and cytokine production was assessed . the levels of il-6 ( figure 2(b ) ) and tnf- ( figure 2(c ) ) in the culture supernatants after treatment with adp1 or adp2 were markedly higher than those of the control group . moreover , they were equivalent to or higher than those of lipopolysaccharide- ( lps- ) treated group . however , the levels of il-6 after treatment with sdp1 , sdp2 , or sdp3 were almost equal to those of the control group . in addition , the levels of tnf- after treatment with sdp1 or sdp3 were almost equal to those of the control group but treatment with sdp2 could induce elevation of tnf- production . furthermore , the level of tnf- in the culture supernatant after treatment with sdp4 was significantly higher than that after treatment with sdp2 . these results suggest that asian dust particles have greater potential to induce inflammation compared with soil dust and that particle size may affect the soil dust - induced macrophage inflammatory response . materials such as lipopolysaccharides or -glucan and chemicals such as ammonium or nitrates have been previously reported to adhere to asian dust particles [ 5 , 22 ] . since the number of molecules that can adhere to particles per unit weight increases as particle size decreases , this may account for the increased production of il-6 and tnf- in macrophages exposed to smaller soil dust . next , to assess the mechanisms of the asian dust particles - induced macrophage inflammatory response , we evaluated the association between inflammatory response and endocytosis . raw264.7 cells were pretreated for 30 min with cytochalasin d , an inhibitor of phagocytosis , and then treated for 6 h with 100 g / ml of adp1 or adp2 ; tnf- production was assessed . cytochalasin d significantly suppressed the production of tnf- induced by adp1 or adp2 in a dose - dependent manner ( figure 3 ) , suggesting that phagocytosis is a key aspect of the asian dust particles - induced macrophage inflammatory response . ros activate various signal pathways , such as the nf-b signaling pathway and the mapk pathways , involved in the production of inflammatory cytokines [ 23 , 24 ] . to evaluate the involvement of ros in the macrophage inflammatory response to asian dust particles , raw264.7 cells were incubated with asian dust particles ( adp1 or adp2 ) or soil dust ( sdp1 , sdp2 , sdp3 , or sdp4 ) for 6 h and the fluorescence intensity of 2,7-dichlorodihydrofluorescein was measured as an index of ros production . adp1 and adp2 induced significantly higher ros production compared with that induced by sdp1 , sdp2 , or sdp3 . furthermore , although not statistically significant , sdp4 did tend to induce greater ros production than sdp1 , sdp2 , or sdp3 , suggesting that particle size may be an important factor for soil dust - induced ros production . ros are mainly produced by cell membrane , or endosome membrane , bound nadph oxidase or by mitochondria [ 25 , 26 ] ; to investigate the involvement of ros in asian dust particles - induced tnf- production , we measured tnf- production induced by asian dust particles in the presence of bha , a broad - spectrum ros scavenger , or dpi , a specific inhibitor of nadph oxidase . bha significantly suppressed the tnf- production induced by adp1 and adp2 to almost the same level as that of the control group ( figure 4(b ) ) . furthermore , pretreatment with dpi also resulted in a dose - dependent decrease in the tnf- production induced by adp1 and adp2 ( figure 4(c ) ) . these results suggest that the asian dust particles - induced production of inflammatory cytokines was mediated by ros and that asian dust particles - induced ros production is dependent on nadph oxidase . the mapks are a family of proteins that includes the p38 , erk , and jnk , which activate transcription factors involved in the production of inflammatory cytokines in response to external stresses or cytokine stimulation . to investigate the association between the mapks and asian dust particles - induced macrophage activation , raw264.7 cells were incubated with adp1 or adp2 in the presence or absence of an inhibitor of the jnks ( sp600125 ) or erks ( u0126 ) , and the level of tnf- in the cell culture supernatant was measured . both sp600125 ( figure 5(a ) ) and u0126 ( figure 5(b ) ) significantly suppressed the tnf- production induced by adp1 or adp2 , suggesting that mapk activation plays an important role in asian dust particles - induced tnf- production . since the mapks stimulate transcription factors such as nf-b , which in turn regulate the expression of genes encoding cytokines such as il-1 , il-8 , and tnf- , raw264.7 cells were incubated with adp1 or adp2 in the presence or absence of an nf-b inhibitor ( sn50 ) . sn50 significantly , but not completely , suppressed the tnf- production induced by adp1 or adp2 ( figure 5(c ) ) , indicating that nf-b may be partially involved in asian dust particles - induced tnf- production . asian dust particles contain chemical substances such as sulfates or nitrates derived from alkaline soil and microbiological materials that may cause serious respiratory health problems in humans . heat treatment of asian dust particles has been reported to suppress allergic responses , which suggests that these adhered materials contribute to asian dust particles - induced inflammation . our data suggests that as particle size decreases , the amount of chemicals or other materials that adheres to asian dust particles increases , which may account for the different inflammatory responses to soil dust seen in the present study . further data is needed on the attachment of these materials to asian dust particles and on their effects on biological responses . furthermore , it has been recently revealed that aerosols such as diesel exhaust or asian dust particles contain not only microsized particles but also nanosized particles [ 30 , 31 ] . our recent research demonstrates that particles with diameter 100 nm show different biological responses and kinetics both in vivo and in vitro compared with microsized particles [ 3234 ] , suggesting that fine asian dust particles have the potential to induce adverse biological effects . as shown in the present study , tnf- production after treatment with sdp4 ( soil sample ; particle diameter , 10 m ) was significantly higher than that after treatment with the other soil samples ( sdp1 , sdp2 , or sdp3 ) . this implies that particle size contributed to the macrophage inflammatory response to the soil samples ; therefore , it is necessary to evaluate the biological effects of not only fine particles in the environment but also of fine particles with diameters 100 nm . recent studies have shown that crystalline silica disturbs the host immune system by activating the nucleotide - binding oligomerization domain , leucine - rich repeat pyrin domain containing 3 ( nlrp3 ) inflammasome . the nlrp3 inflammasome has been examined for its role in the initial inflammatory response to a diverse range of stimuli [ 3537 ] ; however , the mechanisms of the activation of host immunity by asian dust particles remain poorly understood . therefore , further analyses are necessary to clarify this mechanism . it has been reported that particulate matter with a diameter 1 m reaches the alveoli of the lung when aspirated . however , there is little information on a global scale about the in vivo kinetics of these particles , including whether they infiltrate the body or not . the lack of data on particulate matter has raised concerns on their effect on human health . it is therefore important to clarify not only the in vivo kinetics and biological responses of tissues or cells to particulate matter with a diameter 1 m , but also the specific mechanisms of the biological effects of asian dust particles . our results indicate that asian dust particles have greater potential to induce inflammation compared with soil dust and that the size of soil dust particles affects soil sample - induced inflammatory responses . furthermore , asian dust particles - induced activation of macrophages is dependent on ros production and involves the activation of the mapk signal pathway . | asian dust is a springtime meteorological phenomenon that originates in the deserts of china and mongolia .
the dust is carried by prevailing winds across east asia where it causes serious health problems .
most of the information available on the impact of asian dust on human health is based on epidemiological investigations , so from a biological standpoint little is known of its effects . to clarify the effects of asian dust on human health ,
it is essential to assess inflammatory responses to the dust and to evaluate the involvement of these responses in the pathogenesis or aggravation of disease . here , we investigated the induction of inflammatory responses by asian dust particles in macrophages .
treatment with asian dust particles induced greater production of inflammatory cytokines interleukin-6 and tumor necrosis factor- ( tnf- ) compared with treatment with soil dust .
furthermore , a soil dust sample containing only particles 10 m in diameter provoked a greater inflammatory response than soil dust samples containing particles > 10 m .
in addition , asian dust particles - induced tnf- production was dependent on endocytosis , the production of reactive oxygen species , and the activation of nuclear factor-b and mitogen - activated protein kinases .
together , these results suggest that asian dust particles induce inflammatory disease through the activation of macrophages . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
their main functions include phagocytosis , cytokine production , and the presentation of antigens to naive t cells [ 14 ] . one of the most important functions of mos is their ability to differentiate into various cells , including activated mos , specialized tissue macrophages , inflammatory macrophages , langerhans cells ( lcs ) , and dendritic cells ( dcs ) [ 14 ] . after a seminal experiment by inaba et al . , a reliable source of dcs was discovered in peripheral blood mos . other researchers quickly confirmed the importance of interleukin ( il)4 and granulocyte - macrophage colony - stimulating factor ( gm - csf ) in dc generation [ 68 ] . in today s standard experiments , peripheral blood mos are stimulated with il-4 and gm - csf for 3 to 5 days . during that time , mos differentiate into immature dendritic cells ( idcs ) . idcs are more capable of stimulating t cells ; they also produce il-12 and il-15 and express a specific surface antigen - cd1a . in the next step , maturation factors are added ( lipopolysaccharide , tumor necrosis factor [ tnf]- , il-6 , prostaglandins , cd40 ligation , and others ) with subsequent emergence of matured dcs ( mdcs ) able to fully process and present antigens to naive clone t cells . mdcs are also an excellent source of il-12 and il-15 , and they express cd83 while partially losing cd1a . this is the classic way to generate dcs from mos , although alternative ways exist for mos to become dcs or other cells [ 1214 ] . these monocyte - derived dendritic cells ( modcs ) were described as pivotal in several acute and chronic processes [ 9,1517 ] . in trauma , burn injury , or sepsis , their rapid emergence from precursory mos allows for the successful transformation of nonspecific innate response into acquired immunity . the inability of mos to become dcs ( modc ) is related to unfavorable clinical outcomes secondary to a runaway and poorly controlled inflammatory process [ 1113 ] . the rapid emergence of modcs allows for effective control , since they emerge in a matter of days , in contrast to other dc - like cells . consequently , there is an increasing emphasis on the role of modcs in acute inflammation and its resolution . however , the emergence of dcs is believed to be a highly individual process , resulting in large standard deviations of the control and study groups . however , no study has inquired into the stability of the potential of an individual s mos to convert to idcs over time . here , we tested the hypothesis that mos obtained from a particular individual will have an unchanged ability to differentiate into idcs over a period of 3 months . we enrolled 17 healthy control subjects as a part of a larger study , on the immunologic effects of nonemergent coronary artery bypass grafting , in order to be processed as a positive control . serum was stored , and mononuclear cells were separated out using the ficoll gradient technique , and then using negative selection of mos with dynalbeads ( life technologies , grand island , ny , usa ) , as described previously . we used 2 kits sequentially to isolate all mos from the same production batch . to generate idcs , fresh mos were incubated in x - vivo 15 media with gentamycin and phenol red ( lonza , cohasset , mn , usa ) supplemented with human il-4 ( peprotech , rocky hill , nj , usa ) at 500 iu / ml and human gm - csf ( peprotech ) at 37c 5% co2 in the dark . on day 3 , 50% of the x - vivo 15/10 was replenished with fresh media along with 50% of the initial cytokine concentration . we used previously aliquoted cytokines ( stock solution of 10,000 iu / ml ) from the same production batch dissolved in 1% bovine serum albumin ( bsa ; sigma - aldrich , st louis , mo , usa ) . the same batch of x - vivo 15 media ( lonza ) was used throughout the study experiments . all cells were suspended at 10 cells / ml and total working volume of media was 3 ml for differentiation condition . the cells were incubated on standard nonpyrogenic , individually packed , sterile 6-well plates ( sigma - aldrich ) . the incubator was checked twice a year for accuracy of co2 measurement , and correct humidity was observed throughout . the il-4- and gm - csf - stimulated mos were harvested by a brief incubation in 1 ml of 10 mm edta buffered to ph 7.4 ( gibco , grand island , ny , usa ) on ice , followed by the washout of all cells with phosphate buffered saline without calcium or magnesium ( pbs w / o ca or mg ; gibco ) . the procedure was repeated until fewer than 2 cells were seen under inverted microscope with a magnification of 10 . cells were counted twice with the countess automated cell counter ( life technologies ) , as per the manufacturer s instructions . cells were suspended at 10 live cells / ml in x - vivo 15 for further study . study personnel were kept unaware of what they were running , through the use of simple numerical values for experimental designs / stimulation . only after completion of the experiments were all data combined and analyzed . a total of 10 cells were incubated with facs media ( pbs w / o ca or mg with 0.01% sodium azide and 1% fetal bovine serum [ fbs ] ) enriched with human truestain fcx ( biolegend , san diego , ca , usa ) for 15 minutes at 4c in the dark . then , cells were incubated with the antibodies for 30 minutes at 4c in the dark with additional mixing at 15 minutes . cells were washed twice in facs media and resuspended in 100 l of the 1% flowfix ( polysciences , warrington , pa , usa ) . the following antibodies were employed : cd1a ( hi149 ; biolegend ) , cd14 ( tuk4 ; invitrogen , grand island , ny , usa ) , cd83 ( hb15e ; bd , san jose , ca , usa ) , cd209 , cd86 ( clone it2.2 ; biolegend ) , cd116 ( 4h1 ; biolegend ) , cd124 ( g077f6 ; biolegend ) . h pu.1 ( clone spi-1 ; santa cruz biotechnology , dallas , tx , usa ) antibodies were conjugated with dy488 ( thermofisher , rockford , il , usa ) . cells were analyzed with an lsr ( bd ) or a facscalibur ( bd ) flow cytometer . responder allogeneic t cells were obtained from the human immunology core at the university of pennsylvania , from anonymous donors . to a 96-well plate were added 210 harvested cells ( unstimulated mos or il-4- and gm - csf - stimulated mos , depending on the experiment ; stimulators / antigen - presenting cells [ apcs ] ) . next , 210 t cells were added to the apcs and incubated for 1 hour in the x - vivo 15 media with gentamycin and phenol red ( lonza ) . the working media of 20 l of alamar blue ( lifetechnologies ) was subsequently added . three sets of controls consisted of stimulator cells alone , t cells alone , and media mixed with alamar blue alone . again , we used only 1 batch of alamar blue and x - vivo 15 media for all experiments . after 18 hours of incubation , the level of absorbance was measured using the opsys mr ( thermo laboratories , philadelphia , pa , usa ) with revelation software . the absorbance at 570 nm ( with a reference filter at 630 nm ) was measured . it has been shown previously that the degree of reduction correlates well with t - cell proliferation . next , 210 il-4 and gm - csf - differentiated mos were suspended in 200 l of x - vivo 15 media . cells were stimulated with 1 m ionomycin ( ion ) and 10 ng / ml phorbol-12 myristate 13-acetate ( pma ) . again , we used only 1 batch of x - vivo 15 media for all experiments . the biological agents were dissolved into stock solution using 1% bsa media from 1 batch and added to the cultures . supernatant levels of cytokines ( il-12p70 , il-15 ) were measured using a magnetic multiplex kit ( bio - rad , hercules , ca ) per manufacturer s protocol and analyzed on the biorad platform ( hercules , ca ) . then , 210 isolated mos were incubated in 180 l x - vivo 10 media ( biowhittaker , welkersville , md , usa ) combined with 20 ul of alamar blue ( life technologies ) with lipopolysaccharide ( sigma - aldrich ) at final concentration of 100 g / ml for 18 hours . after incubation , cells were spanned down and supernatant was collected and stored at 80c . the institutional review board at the university of pennsylvania , philadelphia , pa , usa , approved this study . the study has been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments . parametric nature of the data was confirmed by the levene and shapiro - wilk tests . t tests or wilcoxon matched - pair tests were conducted , depending on the characteristics of the data . analysis of variance was conducted for multiple group comparisons with a bonferroni test for post hoc analysis . the data were flagged as significant if the 2-tailed hypothesis test result was 0.05 , unless otherwise specified . we enrolled 17 healthy control subjects as a part of a larger study , on the immunologic effects of nonemergent coronary artery bypass grafting , in order to be processed as a positive control . serum was stored , and mononuclear cells were separated out using the ficoll gradient technique , and then using negative selection of mos with dynalbeads ( life technologies , grand island , ny , usa ) , as described previously . to generate idcs , fresh mos were incubated in x - vivo 15 media with gentamycin and phenol red ( lonza , cohasset , mn , usa ) supplemented with human il-4 ( peprotech , rocky hill , nj , usa ) at 500 iu / ml and human gm - csf ( peprotech ) at 37c 5% co2 in the dark . on day 3 , 50% of the x - vivo 15/10 was replenished with fresh media along with 50% of the initial cytokine concentration . we used previously aliquoted cytokines ( stock solution of 10,000 iu / ml ) from the same production batch dissolved in 1% bovine serum albumin ( bsa ; sigma - aldrich , st louis , mo , usa ) . the same batch of x - vivo 15 media ( lonza ) was used throughout the study experiments . all cells were suspended at 10 cells / ml and total working volume of media was 3 ml for differentiation condition . the cells were incubated on standard nonpyrogenic , individually packed , sterile 6-well plates ( sigma - aldrich ) . the incubator was checked twice a year for accuracy of co2 measurement , and correct humidity was observed throughout . the il-4- and gm - csf - stimulated mos were harvested by a brief incubation in 1 ml of 10 mm edta buffered to ph 7.4 ( gibco , grand island , ny , usa ) on ice , followed by the washout of all cells with phosphate buffered saline without calcium or magnesium ( pbs w / o ca or mg ; gibco ) . the procedure was repeated until fewer than 2 cells were seen under inverted microscope with a magnification of 10 . cells were counted twice with the countess automated cell counter ( life technologies ) , as per the manufacturer s instructions . cells were suspended at 10 live cells / ml in x - vivo 15 for further study . study personnel were kept unaware of what they were running , through the use of simple numerical values for experimental designs / stimulation . only after completion of the experiments were all data combined and analyzed . a total of 10 cells were incubated with facs media ( pbs w / o ca or mg with 0.01% sodium azide and 1% fetal bovine serum [ fbs ] ) enriched with human truestain fcx ( biolegend , san diego , ca , usa ) for 15 minutes at 4c in the dark . then , cells were incubated with the antibodies for 30 minutes at 4c in the dark with additional mixing at 15 minutes . cells were washed twice in facs media and resuspended in 100 l of the 1% flowfix ( polysciences , warrington , pa , usa ) . the following antibodies were employed : cd1a ( hi149 ; biolegend ) , cd14 ( tuk4 ; invitrogen , grand island , ny , usa ) , cd83 ( hb15e ; bd , san jose , ca , usa ) , cd209 , cd86 ( clone it2.2 ; biolegend ) , cd116 ( 4h1 ; biolegend ) , cd124 ( g077f6 ; biolegend ) . h pu.1 ( clone spi-1 ; santa cruz biotechnology , dallas , tx , usa ) antibodies were conjugated with dy488 ( thermofisher , rockford , il , usa ) . cells were analyzed with an lsr ( bd ) or a facscalibur ( bd ) flow cytometer . responder allogeneic t cells were obtained from the human immunology core at the university of pennsylvania , from anonymous donors . to a 96-well plate were added 210 harvested cells ( unstimulated mos or il-4- and gm - csf - stimulated mos , depending on the experiment ; stimulators / antigen - presenting cells [ apcs ] ) . next , 210 t cells were added to the apcs and incubated for 1 hour in the x - vivo 15 media with gentamycin and phenol red ( lonza ) . the working media of 20 l of alamar blue ( lifetechnologies ) was subsequently added . three sets of controls consisted of stimulator cells alone , t cells alone , and media mixed with alamar blue alone . again , we used only 1 batch of alamar blue and x - vivo 15 media for all experiments . after 18 hours of incubation , the level of absorbance was measured using the opsys mr ( thermo laboratories , philadelphia , pa , usa ) with revelation software . the absorbance at 570 nm ( with a reference filter at 630 nm ) was measured . it has been shown previously that the degree of reduction correlates well with t - cell proliferation . next , 210 il-4 and gm - csf - differentiated mos were suspended in 200 l of x - vivo 15 media . cells were stimulated with 1 m ionomycin ( ion ) and 10 ng / ml phorbol-12 myristate 13-acetate ( pma ) . again , we used only 1 batch of x - vivo 15 media for all experiments . the biological agents were dissolved into stock solution using 1% bsa media from 1 batch and added to the cultures . supernatant levels of cytokines ( il-12p70 , il-15 ) were measured using a magnetic multiplex kit ( bio - rad , hercules , ca ) per manufacturer s protocol and analyzed on the biorad platform ( hercules , ca ) . then , 210 isolated mos were incubated in 180 l x - vivo 10 media ( biowhittaker , welkersville , md , usa ) combined with 20 ul of alamar blue ( life technologies ) with lipopolysaccharide ( sigma - aldrich ) at final concentration of 100 g / ml for 18 hours . after incubation , cells were spanned down and supernatant was collected and stored at 80c . the institutional review board at the university of pennsylvania , philadelphia , pa , usa , approved this study . the study has been performed in accordance with the ethical standards laid down in the 1964 declaration of helsinki and its later amendments . parametric nature of the data was confirmed by the levene and shapiro - wilk tests . t tests or wilcoxon matched - pair tests were conducted , depending on the characteristics of the data . analysis of variance was conducted for multiple group comparisons with a bonferroni test for post hoc analysis . the data were flagged as significant if the 2-tailed hypothesis test result was 0.05 , unless otherwise specified . first , we measured the level of cd1a , a specific marker of idc . becoming an idc is the first necessary step for an mo in dc generation . we found a significant variance in the%cd1a positive cells after 5 days of differentiation of mos with il-4 and gm - csf ( figures 1a and 1c ) . however , when the same subjects were retested 2 to 5 months after their baseline estimate , a remarkable replication of the result was observed ( % cd1a baseline vs. after 3 months 66.6417.41 vs. 68.1717.9 ; figure 1a , 1b ) . the variance between 2 time points was < 5% and statistically insignificant . additionally , we measured the production of il-12p70 and il-15 in the same individuals and the variance of the results was within 6% ( table 1 ) . this is the ultimate test judging the ability of modcs , and all dcs , to perform their primary function : regulation of the immune response . here the variance was significantly higher compared with differences in expression of cd1 or secretion of il-12p70 and il-15 by il-4- and gm - csf - stimulated mos , but still below generally expected levels ( % mo mlr 215% ; figure 1c ) . additionally , the correlation between dc mlr and expression of cd1a was high and significant ( r=0.878 ; figure 1d ) since we believed that part of the variance in dc mlr would result from different levels of hla mismatch , we conducted an mlr using different il-4- and gm - csf - stimulated mos with the same responder t cells , and measured the same t cells responding to il-4- and gm - csf - stimulated mos obtained from different individuals [ 1921 ] . we observed some variance with some t cells having very poor proliferative capacity regardless of the origin of the stimulatory il-4- and gm - csf - differentiated mos ( figure 2 ) . we found that significant variation existed in this respect but that all our subjects attained cd1a expression , or lost cd14 expression , by day 5 ( figure 3 ) . this suggested that the ability of mos in individuals to differentiate into idcs is time - contextual . in the last step , we investigated possible reasons for the effective differentiation of mos into idcs under the influence of il-4 and gm - csf . first , we tested whether the preexisting ability of mos to stimulate t cells correlates with positive il-4 and gm - csf differentiation . we found a negative , but statistically nonsignificant , correlation ( r=0.47 ; p=0.257 ; figure 4a ) . in our experimental design , we tested the ability of mo to differentiate using il-4 and gm - csf . both cytokines are critical for successful mo - to - idc differentiation , yet they rely on the respective receptors to induce the process . we found no significant variance in the percentage of positive cells and receptor density among our subjects with respect to il-4 receptors and gm - csf receptors ( 874.88% and 88.304.16% , p = ns ; table 2 ) . other cytokines ( m - csf ) can be secreted by mos , and affect the mo - to - idc differentiation . however , the expression of m - csf receptor was unaltered ( table 2 ) . furthermore , the correlation between percentage of positive cells and emergence of%cd1a cells after il-4 and gm - csf stimulation was receptor density mean fluorescence index ( mfi ) weak and nonsignificant ( data not shown ) . we found a strong correlation between the frequency of mo positive for pu.1 and% of cd1a cells ( r=0.747 ; p=0.013 ) after il-4 and gm - csf differentiation ( figure 4b ) . mo from individuals with higher pu.1 levels had higher propensity to become dc under the influence of the cytokines . first , we measured the level of cd1a , a specific marker of idc . becoming an idc is the first necessary step for an mo in dc generation . we found a significant variance in the%cd1a positive cells after 5 days of differentiation of mos with il-4 and gm - csf ( figures 1a and 1c ) . however , when the same subjects were retested 2 to 5 months after their baseline estimate , a remarkable replication of the result was observed ( % cd1a baseline vs. after 3 months 66.6417.41 vs. 68.1717.9 ; figure 1a , 1b ) . the variance between 2 time points was < 5% and statistically insignificant . additionally , we measured the production of il-12p70 and il-15 in the same individuals and the variance of the results was within 6% ( table 1 ) . this is the ultimate test judging the ability of modcs , and all dcs , to perform their primary function : regulation of the immune response . here the variance was significantly higher compared with differences in expression of cd1 or secretion of il-12p70 and il-15 by il-4- and gm - csf - stimulated mos , but still below generally expected levels ( % mo mlr 215% ; figure 1c ) . additionally , the correlation between dc mlr and expression of cd1a was high and significant ( r=0.878 ; figure 1d ) since we believed that part of the variance in dc mlr would result from different levels of hla mismatch , we conducted an mlr using different il-4- and gm - csf - stimulated mos with the same responder t cells , and measured the same t cells responding to il-4- and gm - csf - stimulated mos obtained from different individuals [ 1921 ] . we observed some variance with some t cells having very poor proliferative capacity regardless of the origin of the stimulatory il-4- and gm - csf - differentiated mos ( figure 2 ) . we found that significant variation existed in this respect but that all our subjects attained cd1a expression , or lost cd14 expression , by day 5 ( figure 3 ) . this suggested that the ability of mos in individuals to differentiate into idcs is time - contextual . in the last step , we investigated possible reasons for the effective differentiation of mos into idcs under the influence of il-4 and gm - csf . first , we tested whether the preexisting ability of mos to stimulate t cells correlates with positive il-4 and gm - csf differentiation . we found a negative , but statistically nonsignificant , correlation ( r=0.47 ; p=0.257 ; figure 4a ) . in our experimental design , we tested the ability of mo to differentiate using il-4 and gm - csf . both cytokines are critical for successful mo - to - idc differentiation , yet they rely on the respective receptors to induce the process . we found no significant variance in the percentage of positive cells and receptor density among our subjects with respect to il-4 receptors and gm - csf receptors ( 874.88% and 88.304.16% , p = ns ; table 2 ) . other cytokines ( m - csf ) can be secreted by mos , and affect the mo - to - idc differentiation . however , the expression of m - csf receptor was unaltered ( table 2 ) . furthermore , the correlation between percentage of positive cells and emergence of%cd1a cells after il-4 and gm - csf stimulation was receptor density mean fluorescence index ( mfi ) weak and nonsignificant ( data not shown ) . we found a strong correlation between the frequency of mo positive for pu.1 and% of cd1a cells ( r=0.747 ; p=0.013 ) after il-4 and gm - csf differentiation ( figure 4b ) . mo from individuals with higher pu.1 levels had higher propensity to become dc under the influence of the cytokines . the ability to generate large numbers of dcs from precursory mos was a breakthrough in the field of immunology . over time , the abnormalities of the process of mo transformation into dcs has been linked to many clinical conditions . thus , the ability of mos to become dcs under the influence of il-4 and gm - csf in vivo has the potential to become a clinical test . therefore , we conducted a study using serial measurements of several markers of idc emergence . we employed flow cytometry ( cd1a , cd209 ) , cytokine secretion ( il-12p70 , il-15 ) , and functional measures ( mlr ) of the dc emergence since potential for mos to differentiate into alternate cells is high . we were able to determine that the ability of mos to acquire the cd1a marker or to produce il-12p70 was individually variable but stable over several weeks . the difference in acquisition of the cd1a marker between t0 and t+1 was small , with p=0.44 . when we calculated confidence limits ( assuming a confidence level of 0.8 ) for this data set , the confidence range was between 0.85 and 1.71 , which is well below significant statistical value . when we performed a power analysis in order to estimate the number of individuals needed to show the difference between 2 time points , it turned out that we would have to study more than 1100 individuals to show the existence of this potential difference in cd1a level on il-4- and gm - csf - stimulated mos over time . this clearly shows there is little , if any , variance between 2 time points in estimating the frequency of cd1a - positive cells in il-4- and gm - csf - differentiated mos . in order to increase the robustness of our findings , we employed a composite measure of dc emergence . flow cytometry evaluated the cd1a marker a gold standard for measuring the frequency of idc . it is a highly selective marker , yet there are other measurements of idc function that we assessed . il-12p70 is critical for stimulation of the clones of the t cells if process selection has been completed . again , when we compared t0 and t+1 , no statistical change was detected in production of il-12p70 between these 2 time points . another marker is the ability of il-4 and gm - csf to stimulate t cells to proliferate . this is a gold standard since mlr mimics the natural process of t cells selection by dc . we found significant variability over time , but that could be attributed to matching between t cells and stimulatory apcs . an mlr depends on the level of mismatch between apc and t cells because we used the allogeneic system . we showed this in practice because some of the t cells were poor responders regardless of the origin of apc . use of the autogeneic system ( both dcs and t cells are from the same individual ) is dependent on time - related variability , and the mlr culture needs additional stimulus . usually , vaccine antigen is used , but in our study we did not know the vaccination status of our donors . despite the high stability of the modc process over time , it is apparent that there is a high degree of interindividual variability in mos ability to become idcs . there was a strong correlation with the emergence of cd1a - positive mos and activity of pu.1 . this correlation is expected because pu.1 is a critical factor in the emergence of dcs from mos . however , pu.1 is a switchboard of several intracellular pathways to pinpoint one that could be responsible for interindividual variability is beyond the scope of this study . in the next step , the expression of critical receptors for il-4 ( cd124 ) and gm - csf ( cd116 ) was not significantly different across subjects and over time . cd115 is a marker of macrophages and can be used to measure the expression of m - csf as both proteins are locked in positive feedback loop . one could hypothesize that in different individuals there are different numbers of macrophage - like cells , but our study did not show this as seen by mo mlr . however , we did not register any significant differences over time or significant correlations between the emergence of cd1a il-4 and gm - csf cells and the expression of receptors for il-6 or m - csf . though this correlation may not represent a cause - and - effect relationship , it is highly suggestive of pu.1 s critical role in idc emergence . our study suggests some interindividual variability in the expression of this transcription factor that is interlocked with an individual s ability to undergo moidc process in vitro . the process of modc is very frequently studied in research , but suggestions were made to use the ability of mos to become dcs in a clinical test [ 11,2427 ] . however , a frequent problem with immunologic testing is significant variability secondary to technical aspects of measurements . in our study , we took a lot of precautions to minimize variability . all the cytokines we used came from 1 lot and were prediluted and stored in silicone - coated vials at 80c until use . the medium used in this project was x - vivo 15/10 a proprietary , commercially available serum - free medium . in the classic experiments , it contains hard - to - predict and highly variable amounts of cytokine and biologically active components ( e.g. , transforming growth factor beta [ tgf- ] ) . routinely , such media are heat inactivated , but some cytokines are still active despite using heat to denaturate them . tgf- is one such heat - resistant cytokine that is present in significant amounts in serum while having a negative influence on the mo;idc process in vitro . therefore , using fbs or fcs introduces hard - to - predict variables because the source , processing , and biologic potency of fbs / fcs vary . however , the process of differentiation does not stop at idc step ; it progresses into maturity . that is why we see a gradual increase in the cd1a in our time - centered experiments . introducing fbs / fcs can trigger the maturation process of the idc , leading to variable cd1a expression . we used il-12p70 secretion , a critical cytokine for t - cell stimulation , as a measure of the acquisition of dc proportion by mo , under the influence of il-4 and gm - csf . in order to elicit this response , we used pma and ion , in contrast to the bacterial pathogens used by others . pma and ion are independent of the expression of parp ( poly[adp - ribose ] polymerase ) receptors on the surface by direct activation of calcium influx and protein kinase c. finally , we used mlr , but , predictably , we were able to establish that the level of t cell proliferation depends on major histocompatibility mismatch between il-4 & gm - csf differentiated mo and t cells . this was a difficult study to conduct since we sought to show a lack of difference between immunological variables at two time points in the same individuals . vast majority of studies attempt to show the existence of a difference between two studied parameters . here , we tried to show that there is no difference . this is a very different goal to achieve hence majority of statistical tests are aimed at showing the difference not providing proof of similarity . our study suggest that ability of mo to idc differentiion under in vitro influence can be used as a clinical test consideringhigh stability of the variable . | backgroundthe ability to generate dendritic cells ( dcs ) from precursory monocytes ( mos ) was a breakthrough in the field of immunology .
however , it is unknown whether the ability of mos to differentiate into immature dcs ( idcs ) differs across subjects or is time dependent . given that the study of immune system function is gaining recognition in the field of clinical medicine , it is important to know how certain immunologic features vary over time.material/methodsthis study investigates how much individuals mo - to - idc differentiation potential changes over time .
we estimated this potential by measuring the expression of an idc marker ( cd1a ) , cytokine secretion ( interleukin [ il]-12p70 ) , and the ability of il-4 and granulocyte macrophage colony - stimulating factor ( gm - csf ) differentiation mos to stimulate t cells .
we collected mos obtained from different subjects ( n=17 ) at least 1 month apart .
furthermore , we investigated several variables ( expression for cytokine receptors , timing , and emergence of dc - related transcriptional factor pu.1).resultsthe ability of mos to become dcs under the influence of il-4 and gm - csf varied greatly between individuals ( range of cd1a expression , 2080% ) but was stable over time ( change of cd1a expression between sampling , ~5% ) .
a similar pattern emerged when production of il-12p70 was analyzed .
the ability to stimulate t cells was variable and depended on the t - cell source .
the ability of mos to become idcs was not linked to the surface expression of receptors for il-4 and gm - csf but rather to the activation of pu.1 in the precursory mo .
it took 5 days for all committed mos to become idcs under in vitro influence of il-4 and gm-csf.conclusionswe concluded that the potential of mo to become idc is an individual feature and depends on activation of pu.1 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
asymptomatic infections are frequent in europe , as borrelia - specific antibodies have been observed in 525% of healthy subjects [ 1 , 2 , 3 , 4 ] . the primary stage is characterized by erythema migrans and can be followed by dissemination of disease , which mainly affects the joints , heart or nervous system [ 4 , 5 , 6 ] , within weeks to months . neuroborreliosis of the central nervous system ( cns ) is rare , and differentiation from other disorders of the cns with concomitant seropositivity for b. burgdorferi can be difficult . herein , we report a case with positive b. burgdorferi serology and 4 episodes of severe cns manifestations with full recovery each time after sufficient antibiotic treatment . we illustrate the diagnostic steps and procedures which were valuable for posing the differential diagnosis in this unusual case , taking into account current state - of - the - art procedures for the diagnosis of lyme borreliosis . a 31-year - old woman presented with a 2-day history of rapidly progressing hypoesthesia of the body below the neck , tetraparesis , gait ataxia , brainstem symptoms , and urinary retention . fifteen years earlier , in 1996 , she had suffered from a mild paraparesis with hypoesthesia of both legs , which remitted completely after treatment with an oral antibiotic and glucocorticoids . details were not remembered and neither cerebrospinal fluid ( csf ) analysis nor mri scans had been performed . the second episode occurred 3 years later , in 1999 , with acute urinary retention and a mild - to - moderate sensomotoric deficit below dermatome t6 . transcranial magnetic motor evoked potentials ( mep ) and somatosensory evoked potentials ( ssep ) were altered . cerebral and spinal mri scans were normal , but csf analysis showed a lymphocytic pleocytosis of 260 leukocytes/l , and a highly elevated b. burgdorferi csf / serum igg antibody index ( ai ) of 8.0 ( normal < 2.0 ) , leading to the diagnosis of neuroborreliosis with transverse myelitis . the patient was subsequently treated intravenously for 14 days with ceftriaxone 2 g / day and prednisolone 80 mg / day and recovered completely . control csf analysis showed a regression of the pleocytosis to 30 leukocytes/l and a reestablishment of the blood - brain barrier ( bbb ) function with an albumin csf / serum quotient of 3.6 compared to 12.8 before treatment . during the third episode in 2008 , the patient developed neck pain , a mild gait ataxia , and paresthesia of both legs . cerebral and spinal mri scans , mep and ssep were normal , but csf analysis revealed 293 leukocytes/l with a positive b. burgdorferi igm ( eia and western blot ) in serum but not in csf . the ai was reported to be normal . treatment consisted of intravenous ceftriaxone 2 g / day , which was later switched to oral doxycycline 100 mg bid and notably no corticosteroids . the patient made a complete clinical recovery , and csf reanalysis after treatment showed a reduction of the pleocytosis to 15 leukocytes/l . the only other remarkable prior condition was an x - type histiocytosis with a strictly dermal manifestation diagnosed in 1982 , which completely remitted and had not caused any further manifestation since treatment with methotrexate and purinethol . notably , the patient did not recall a tick bite or erythema migrans at any time . on admission in march 2011 , the patient presented with a sustained gaze - evoked nystagmus to the left and an incomplete abducens nerve paralysis . the patient was not able to stand or walk , but showed moderate ataxia of all limbs . sensory testing revealed sensory deficits below dermatome c4 , with impaired discrimination of sharp and dull , and essentially no sense of vibration , temperature and position . a spinal mri scan revealed extensive signal alterations especially in the cervical , but also in the thoracic spinal cord . some of these lesions comprised 2 or more segments and involved large parts of the cord 's cross section ( fig . 1a , b ) , in combination with moderate swelling at the cervical level and a faint enhancement after intravenous gadolinium administration ( not shown ) . csf analysis revealed a predominantly lymphocytic pleocytosis of 136 leukocytes/l ; dysfunction of the blood - csf barrier , with an elevated csf / serum albumin quotient of 18.8 ; and an elevated total csf protein of 126 mg / dl . there were no oligoclonal bands , but a reiber diagram suggested intrathecal synthesis of igm ( igm quotient 11.96 , igm index 0.64 ) but not igg ( igg quotient 12.78 , igg index 0.68 ) . measles , rubella , and zoster ais ( mrz reaction < 1.3 ) were negative . csf / serum ais of 52.6 and 18.8 were highly positive for b. burgdorferi igm and igg , respectively , with a b. burgdorferi - specific igm concentration of 18.9 u / ml and an igg concentration of 1.3 u / ml in csf . western blotting was positive in csf and serum for p41- and ospc - specific igm and igg at day 1 , and revealed an additional positive osp17-igm band in serum at days 7 and 17 ( fig . quantitative real - time pcrs amplifying the ospa gene and the p41 gene of b. burgdorferi sensu lato were negative in csf . serology for mycoplasma pneumoniae was positive in serum ( immunohistochemical assay , 1:320 ; enzyme immunoassay , borderline positive ) but not in csf . a pcr for 16s ribosomal dna was positive , and the amplicon was cloned and sequenced but revealed no mycoplasma - specific sequences . four months after the episode , serological controls revealed a non - significant rise in m. pneumoniae titer in serum ( immunohistochemical assay 1:640 ) , with persistent negative results in csf . aquaporin-4 antibodies were negative , as were antinuclear antibodies , antineutrophil cytoplasmic antibodies , anti - dna antibodies , anti - extractable nuclear antigens , hiv- , treponema- , hepatitis b and c serology , and pcr of hsv , cmv , vzv and ebv in the csf . the evoked potentials gave evidence of an affection of the central pyramidal tract and a demyelinating affection of the somatosensory afferents in both legs , while visual and acoustic evoked potentials were normal . the patient was treated with intravenous ceftriaxone 2 g / day , acyclovir 3 750 mg / day and methylprednisolone 1 g / day . the patient 's clinical status ameliorated rapidly ; she started to walk again after 1 week and was out of bed most of the day after 3 weeks . csf analysis after 7 days of treatment revealed a reduction of leukocytes to 26/l along with a reduction of the total protein to 33 mg / dl and a reconstitution of the blood - csf barrier . cytological examination of all 3 spinal csf samples showed lymphocytic pleocytosis but no lymphoblasts or other atypical cells . the csf / serum ai decreased after 7 days of treatment to 34.1 for igm and 12.7 for igg , and after a further 10 days to 17.4 for igm and 15.6 for igg . ais were negative for borrelia - specific igg and further decreased for igm ( igg negative in serum and csf , igm ai 6.5 ) after 4 months . the levels of cxcl13 were only slightly elevated in csf and did not rise in the course of the current episode ( 35 pg / ml at onset , 4.2 pg / ml after 7 days , 4.5 pg / ml after another 10 days and 4.5 pg / ml after 4 months ) , which argues against acute neuroborreliosis during this episode . on admission in march 2011 , the patient presented with a sustained gaze - evoked nystagmus to the left and an incomplete abducens nerve paralysis . the patient was not able to stand or walk , but showed moderate ataxia of all limbs . sensory testing revealed sensory deficits below dermatome c4 , with impaired discrimination of sharp and dull , and essentially no sense of vibration , temperature and position . a spinal mri scan revealed extensive signal alterations especially in the cervical , but also in the thoracic spinal cord . some of these lesions comprised 2 or more segments and involved large parts of the cord 's cross section ( fig . 1a , b ) , in combination with moderate swelling at the cervical level and a faint enhancement after intravenous gadolinium administration ( not shown ) . csf analysis revealed a predominantly lymphocytic pleocytosis of 136 leukocytes/l ; dysfunction of the blood - csf barrier , with an elevated csf / serum albumin quotient of 18.8 ; and an elevated total csf protein of 126 mg / dl . there were no oligoclonal bands , but a reiber diagram suggested intrathecal synthesis of igm ( igm quotient 11.96 , igm index 0.64 ) but not igg ( igg quotient 12.78 , igg index 0.68 ) . measles , rubella , and zoster ais ( mrz reaction < 1.3 ) were negative . csf / serum ais of 52.6 and 18.8 were highly positive for b. burgdorferi igm and igg , respectively , with a b. burgdorferi - specific igm concentration of 18.9 u / ml and an igg concentration of 1.3 u / ml in csf . western blotting was positive in csf and serum for p41- and ospc - specific igm and igg at day 1 , and revealed an additional positive osp17-igm band in serum at days 7 and 17 ( fig . quantitative real - time pcrs amplifying the ospa gene and the p41 gene of b. burgdorferi sensu lato were negative in csf . serology for mycoplasma pneumoniae was positive in serum ( immunohistochemical assay , 1:320 ; enzyme immunoassay , borderline positive ) but not in csf . a pcr for 16s ribosomal dna was positive , and the amplicon was cloned and sequenced but revealed no mycoplasma - specific sequences . four months after the episode , serological controls revealed a non - significant rise in m. pneumoniae titer in serum ( immunohistochemical assay 1:640 ) , with persistent negative results in csf . aquaporin-4 antibodies were negative , as were antinuclear antibodies , antineutrophil cytoplasmic antibodies , anti - dna antibodies , anti - extractable nuclear antigens , hiv- , treponema- , hepatitis b and c serology , and pcr of hsv , cmv , vzv and ebv in the csf . the evoked potentials gave evidence of an affection of the central pyramidal tract and a demyelinating affection of the somatosensory afferents in both legs , while visual and acoustic evoked potentials were normal . the patient was treated with intravenous ceftriaxone 2 g / day , acyclovir 3 750 mg / day and methylprednisolone 1 g / day . the patient 's clinical status ameliorated rapidly ; she started to walk again after 1 week and was out of bed most of the day after 3 weeks . csf analysis after 7 days of treatment revealed a reduction of leukocytes to 26/l along with a reduction of the total protein to 33 mg / dl and a reconstitution of the blood - csf barrier . cytological examination of all 3 spinal csf samples showed lymphocytic pleocytosis but no lymphoblasts or other atypical cells . the csf / serum ai decreased after 7 days of treatment to 34.1 for igm and 12.7 for igg , and after a further 10 days to 17.4 for igm and 15.6 for igg . ais were negative for borrelia - specific igg and further decreased for igm ( igg negative in serum and csf , igm ai 6.5 ) after 4 months . the levels of cxcl13 were only slightly elevated in csf and did not rise in the course of the current episode ( 35 pg / ml at onset , 4.2 pg / ml after 7 days , 4.5 pg / ml after another 10 days and 4.5 pg / ml after 4 months ) , which argues against acute neuroborreliosis during this episode . the differential diagnostic for the relapsing spinal syndromes of our patient comprises spinal lymphoma , a spinal manifestation of x - type histiocytosis , neuromyelitis optica , multiple sclerosis ( ms ) or a systemic autoimmune disease . as our patient presented with only spinal and brainstem symptoms and no supratentorial lesions were detectable in mri , the diagnostic criteria for ms were not fulfilled . the long asymptomatic course between relapses , the absence of atypical cells in csf , the positive response to antibiotic treatment ( even without corticosteroids in 2008 ) and the serological findings argue against lymphoma . a relapse of x - type histiocytosis after 14 years without symptoms seems very improbable as the microscopic analysis of csf revealed no evidence of histiocytes , and myelitis as a manifestation of histiocytosis is an extremely rare event , even though it has been previously reported . the severe pleocytosis and damage to the bbb argue against neuromyelitis optica , ms or vasculitis especially since the visual system was unaffected and aquaporin-4 antibodies , oligoclonal bands , mrz reaction , supratentorial mri and the laboratory screening for vasculitis were negative . the fact that a positive b. burgdorferi csf / serum ai was found in 3 out of 4 episodes and that csf pleocytosis and clinical symptoms ameliorated in response to antibiotic treatment seems to suggest recurrent episodes of neuroborreliosis . however , recurrent episodes of borreliosis and even more so neuroborreliosis after sufficient antibiotic treatment such as in this case , are very uncommon . if relapses occur , they are attributed to reinfections or relapses after inadequate antibiotic therapy . moreover , it needs to be considered that the patient did not recall any previous tick bite or erythema migrans nor does she belong to a part of the population with an increased risk for repeated tick bites . further , it remains unclear why the ai was negative during the third episode while all other signs and symptoms were similar . all 4 episodes manifested with a spinal syndrome despite the fact that b. burgdorferi myelitis represents less than 5% of cases with neuroborreliosis in larger studies [ 9 , 10 , 11 ] . positive csf / serum igg ai can be found after a successfully treated and no longer active neuroborreliosis . but we would expect continuously positive predominantly igg ais in the case of ai persistence after an acute infection or during a persisting or remitting infection involving the cns . however , this was not the case during the episode in 2008 when the ai was normal or in the current episode when ais returned to normal 3 months after the start of the episode . increasing ais are not specific for an acute borreliosis as they can also be the result of an unspecific stimulation of the immune system , e.g. by an autoimmune manifestation or a yet unidentified infection in our patient . ais are calculated as the ratio of specific to total immunoglobulins in csf divided by the ratio of specific to total immunoglobulins in serum . it is therefore possible that low concentrations of total immunoglobulins in csf give rise to positive ais at rather low specific concentrations in csf , like the borrelia - specific igg concentration of 1.3 u / ml observed in our patient . in line with this , therefore , further parameters were needed to resolve the diagnostic dilemma in this case . real - time pcr - based results for b. burgdorferi in csf are often negative , as are cultures , even in the case of active neuroborreliosis ; however , positive results can serve to ascertain the diagnosis . the level of cxcl13 in csf is a very sensitive parameter for neuroborreliosis and can be of great help , especially in complex cases like ours [ 12 , 13 ] . in several studies using the same ready - made elisa from r&d systems as in our patient , untreated neuroborreliosis could be differentiated from other neurological disorders with a high sensitivity of above 90% using cutoff values of cxcl13 concentrations in csf of 250 pg / ml , 100 pg / ml or 142 pg / ml . in a prospective trial , where a self - made elisa with different binding properties was used , a sensitivity of 94.1% and a specificity of 96.1% were obtained with a cutoff of 1,229 pg / ml , and sensitivity even reached 100% at a cutoff of 697 pg / ml . an important finding of this large trial was that the cxcl13 concentration in csf could discriminate neuroborreliosis from ms . the cxcl13 levels found in ms were only moderately elevated , like in our case . a reanalysis of the data of this prospective study revealed a negative predictive value of 99% for acute untreated neuroborreliosis ( a. plate , pers . this large body of evidence clearly indicates a good negative predictive value for the cxcl13 concentration of 35 pg / ml observed in our patient . thus , the recurrence of episodes despite sufficient antibiotic therapy and the fact that she did not recall a tick bite or erythema migrans and did not belong to a risk group for repeated tick bites strongly argue against acute neuroborreliosis as the cause of our patient 's current episode . instead , it seems most probable that our patient had suffered from neuroborreliosis in the past , e.g. when she had her first episodes of neurological symptoms in 1996 and/or 1999 , which was effectively treated and cured back then . we interpret the subsequent episodes in 2008 and 2011 as post - infectious autoimmune - mediated transverse myelitis triggered by the preceding neuroborreliosis . immune responses specific against cns proteins or myelin have been reported in csf of neuroborreliosis patients [ 17 , 18 , 19 , 20 , 21 , 22 ] , and post - infectious autoimmune mechanisms following lyme borreliosis have been discussed for arthritis and autoimmune polyneuropathy [ 23 , 24 ] . so an autoimmune mechanism caused by molecular mimicry seems a plausible explanation for the relapsing events of myelitis observed in our patient . the fact that she recovered in 2008 even without steroid treatment does not argue against an autoimmune transverse myelitis , as these disorders are also known to show spontaneous remissions , albeit with a slower recovery than with steroid treatment . also , the fact that we did not observe more bands in the b. burgdorferi western blot in csf and serum argues against a persistent and relapsing neuroborreliosis , in which we would expect more bands , particularly igg . the findings are in line with our assumption that our patient had contact with b. burgdorferi before , possibly even neuroborreliosis during one of the first episodes . thus , the bands detectable in csf and serum during the fourth episode would have been caused by a persistence of specific b cells , which are stimulated in the context of the presumed autoimmune event . taken together , our case highlights the diagnostic challenges that may occur in patients with inflammatory lesions of the spinal cord and/or positive b. burgdorferi serology . | we report the case of a 31-year - old woman with 4 episodes of myelitis with pleocytosis , a positive borrelia burgdorferi serology with positive antibody indices , and full recovery each time after antibiotic and steroid treatment , suggesting neuroborreliosis .
we nevertheless believe that recurrent neuroborreliosis is improbable based on the levels of the chemokine cxcl13 in cerebrospinal fluid and favor the diagnosis of post - infectious autoimmune - mediated transverse myelitis possibly triggered by an initial neuroborreliosis as the cause of the relapses observed in our patient .
we demonstrate the diagnostic steps and procedures which were important in the differential diagnosis of this unusual and challenging case . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the research reported here is part of a larger in - depth interview study of the experiences of families with a severely brain - injured relative . the research ethics committees at the universities of york and cardiff initially approved the study , and we began recruitment of participants as widely as possible starting with our own social contacts and via brain injury support groups . this was made possible in part because the researchers ( who are sisters ) themselves have a severely brain - injured sister , and said so in the recruitment information : five of the early interviews were with people previously encountered via our personal involvement in the networks connected to brain injury ( eg , via support networks in which we participated , events we attended ) . we also used snowball sampling and contacted people via care homes and contacted some who had spoken publicly about their experience . the study subsequently received nhs approval ( from berkshire research ethics committee , rec reference number : 12/sc/0495 ) , and we were also able to recruit via consultants , although all interviews took place off nhs premises ( generally in people 's homes ) . prospective participants were usually approached via email , and all 51 participants were interviewed by one or other of the two authors , both of whom have extensive experience in interview and focus group research in the field of health and illness , and both of whom teach qualitative methodologies ( including interviewing ) and have published widely on qualitative research methods . interviews were mostly one - to - one , but occasionally in pairs ( eg , a husband and wife asked to be interviewed together , as did a mother and daughter ) . we almost always conducted the interviews without other people present : exceptions were one interview at which a young child was present and another which took place in the same room as the pvs daughter of the interviewee ( who cared for her at home ) . interviewees were mostly parents , siblings , spouses / partners and adult children of the patient . most patients were currently either pvs or mcs ( some had died by the time of interview ; others had emerged from chronic disorders of consciousness with severe neurological deficits ) . the interview guide was deliberately wide - ranging to allow people to tell their stories in their own ways , and we did not impose a uniform structure or set of identical questions . during the course of the interviews , we also answered questions about our own experiences as sisters of a severely brain - injured patient when asked , and occasionally volunteered information when it seemed helpful ( eg , to show that we understood and could empathise with difficult experiences ) . the majority of interviews lasted between 2 and 4 h ( with breaks ) , the shortest was 45 min and the longest was 7 h ( with breaks ) . interviewing started in november 2010 and continued throughout and subsequent to the period that w v m received extensive press coverage ( in july 2011 and again in september / october 2011 ) . interviewees occasionally referred spontaneously to the case , and some ( including two families with relatives in mcs who had already initiated enquiries about anh withdrawal ) were following it closely . interviews were transcribed orthographically ( with care taken to maximise confidentiality ; saunders b et al , unpublished data ) and analysed thematically to identify recurrent patterns ( themes).10 in this article , we focus on those parts of the interviews where participants discuss whether or not they would consider anh withdrawal for their relatives and this was systematically coded by the two authors for the purpose of this paper . after 51 interviews , this was a heavily saturated category ( ie , we were repeatedly hearing the same comments from different participants ) ; however , very few of the interviewees ( at the time of interview ) had witnessed a relative dying from withdrawal of anh and this will be the subject of future work . the family in w v m is not unusual in believing that the patient would have rather been dead than sustained in their current condition : this view was shared by two - thirds of our interviewees . those who believed the person would have wanted to be kept alive were ( with two exceptions , both from the same family ) within the first 2 years of the precipitating event . families generally arrived at the view that the person would rather be dead only after exhausting all the possibilities that their relative could make a recovery to a quality of life that the patient would find acceptable . in the first few years after injury interviewees usually believed it was too early to give up , and that the person might beat the odds to make a recovery to some meaningful ( to them ) quality of life . in some cases , doctors had suggested withdrawing treatment during this earlier period and interviewees resisted this , claiming that their relative had been written off as a one interviewee , for example , felt very threatened by clinicians suggestions that ongoing treatment might be futile and described her alarm that anh might be withdrawn . she had sought legal advice and been reassured that this could not happen if she disagreed at least not without long delays , detailed clinical investigation and her views being taken into account . battle to defend her husband and , throughout the interview , discussed her strategies for not giving the clinical team any almost all of the interviewees who now believed that the person had suffered a fate worse than death had previously opinions then can clearly shift over time with experience and as the prognosis becomes clearer . it was only after several years of exploring all options in the hope that she would recover consciousness ( w v m , para 2 ) that the family ( her mother , partner , sister , nephew and mother - in - law ) came to the view that m would not want to continue to be kept alive . in outlining the background to the case , baker j records that : from an early stage the consensus of medical opinion was that there was no realistic prospect that any improvement could be achieved in m 's condition . for some time , the family members , in particular s [ m 's partner ] fought hard to ensure that every possible attempt was made to identify processes of rehabilitation which might bring about some improvement . ( para 15 ) from an early stage the consensus of medical opinion was that there was no realistic prospect that any improvement could be achieved in m 's condition . for some time , the family members , in particular s [ m 's partner ] fought hard to ensure that every possible attempt was made to identify processes of rehabilitation which might bring about some improvement . ( para 15 ) m 's sister , b , describes how s kept saying we have got to give her every chance . the judgement summarises s 's views : he was determined that m was going to get better - i said : she is all i have got . he said that he felt that they , by which he means the doctors , were giving up on her and he wanted to keep fighting . ( para 119 ) he was determined that m was going to get better - i said : she is all i have got . he said that he felt that they , by which he means the doctors , were giving up on her and he wanted to keep fighting . ( para 119 ) it was only 4 years later , with no significant evidence of improvement , that m 's family gradually came to the view ( para 16 ) that m would not want her life artificially sustained . as we have detailed elsewhere,11 by the time families decide that their relative would not wish to have continued life - sustaining treatment , the patient has usually stabilised and the only remaining artificial means of life support is clinically assisted nutrition and hydration . the window of opportunity for allowing death in any other way ( eg , by withdrawing ventilation ) is closed since the person is no longer dependent on other forms of support . rather than actively seek withdrawal of anh , most families at this point are waiting for a natural death. interviewees reported that patients now had ceilings of care in place , including do not attempt cardiopulmonary resuscitation ( dnacp ) and an agreement not to aggressively treat infections ( eg , with intravenous antibiotics ) . these interviewees often drew a distinction between going along with suggestions from clinicians that aggressive interventions were no longer appropriate ( allowing fate to take its course ) and taking active steps . one woman we interviewed spoke about her husband : i do n't feel it 's my place , as they are doing at the moment with but i do n't think it 's right or fair to actively take steps to prolong this life . ( kate ) i do n't feel it 's my place , as they are doing at the moment with but i do n't think it 's right or fair to actively take steps to prolong this life . ( kate ) another made a similar point about her daughter : when you see she is very ill [ with pneumonia ] you think , in fact it 's a sort of relief in a way , is n't it , to know that there is an end to it . but on the other hand , if it finished i think i 'd be relieved . ( ann ) when you see she is very ill [ with pneumonia ] you think , in fact it 's a sort of relief in a way , is n't it , to know that there is an end to it . but on the other hand , if it finished i think i 'd be relieved . ( ann ) again , m 's family is typical in having reached this position : her sister reported that she could not see the point of giving m antibiotics to bring her round for years of more suffering for this i would rather let nature take its course ( para 116 ) and the family seems to have asked that m should not be given a flu jab ( para 109 ) . what makes m 's family unusual is that they were willing to request anh withdrawal . : i ca n't imagine that she would ever want to live as she is now . [ ] [ and ] even if they agreed to it , it 's too painful , you know . i just do n't understand how anyone can sanction that law ( i.e. the common law established by bland ) . everybody i 've talked to has said , there must be better ways than that in this day and age . i ca n't imagine that she would ever want to live as she is now . [ ] [ and ] even if they agreed to it , it 's too painful , you know . i just do n't understand how anyone can sanction that law ( i.e. the common law established by bland ) . ( bob ) i could n't believe that that [ anh withdrawal ] was the method . everybody i 've talked to has said , there must be better ways than that in this day and age . [ ] what a stupid , stupid way of doing it . ( mark ) failing to feed ( or to provide water ) to a loved one via whatever route ( orally or by tube)even because of the conviction that they would prefer to be dead is a highly emotive issue with deep cultural resonance . one interviewee told us that anh had been withdrawn ( without recourse to the courts ) from her pvs husband after she had expressed the view that he would rather be dead . she intervened to reverse this decision because she found it so deeply disturbing : i just could n't bear that he was starving [ ] i just thought , what a horrible- what a dreadful way to live your last days . ( imogen ) i just could n't bear that he was starving [ ] i just thought , what a horrible- what a dreadful way to live your last days . ( imogen ) she now regrets intervening because her husband 's subsequent existence and eventual death ( from untreated gangrene ) was so terrible she does not think that anh withdrawal could have been worse : the gangrene was horrible . it s like two years earlier he could be starved to death , now he was going to have to die of gangrene . [ ] if i go back to that moment where i said you ca nt starve him to death it s like two years earlier he could be starved to death , now he was going to have to die of gangrene . [ ] if i go back to that moment where i said you ca nt starve him to death , ( imogen ) another interviewee believed she could have tried to enforce her husband 's wishes ( supported by his legally valid advance decision naming her as proxy ) , but found she could n't bring herself to try this route at the point at which it became relevant.i actually got to the stage of not allowing the next [ feeding ] tube down but i decided i could n't do that for christmas . ( shula ) i actually got to the stage of not allowing the next [ feeding ] tube down but i decided i could n't do that for christmas . ( shula ) interviewees were often concerned that , even with a confirmed vs diagnosis , it was possible that their relative would experience pain and suffering and there was a widespread perception that lethal injections would be more humane , compassionate and dignified than death from neglect as a result of treatment withdrawal . but then being kept alive that way is barbaric [ ... ] i mean it [ death following anh withdrawal ] is better than for ever living that way . but the system has to be in place where if [ surgery and rehabilitation ] is a failure , if it hasn't worked , then you can help that person die with dignity . ( rose)i would view it [ a lethal injection ] as a kinder decision [ ] because if you stop feeding them , they are going to die . if you ve made that decision , you might as well do it as humanely as you possibly can . [ ] to starve somebody to death seems a particularly cruel thing to do . but then being kept alive that way is barbaric [ ... ] i mean it [ death following anh withdrawal ] is better than for ever living that way . the system has to be in place where if [ surgery and rehabilitation ] is a failure , if it hasn't worked , then you can help that person die with dignity . ( rose ) i would view it [ a lethal injection ] as a kinder decision [ ] because if you stop feeding them , they are going to die . if you ve made that decision , you might as well do it as humanely as you possibly can . [ ] to starve somebody to death seems a particularly cruel thing to do . ( brendan ) even when families were told by clinicians that the person would receive palliative care , they still found anh withdrawal unacceptable if not for the patient , then for the rest of the family . oh he would be sedated , he would n't feel any pain . but we would have to sit there for up to three weeks to , basically , watch him die . craig [ patient 's brother ] said , but it 's so awful mum [ ] there 's no way i 'd ask for it . no way . oh he would be sedated , he would n't feel any pain . but we would have to sit there for up to three weeks to , basically , watch him die . craig [ patient 's brother ] said , but it 's so awful mum [ ] there 's no way i 'd ask for it . no way . ( tania ) tania adds , i would rather do it [ kill him ] myself . many interviewees had thought about killing the patient themselves with varying levels of seriousness . ( none had actually done so , but we remove pseudonyms from this section to maximise anonymity as this is highly sensitive data , and something some interviewees had , for obvious reasons , not discussed with clinical teams , and sometimes had not revealed to other members of their families . ) one mother referred to another legal case widely covered in the media : that of francis inglis,12 who killed her vegetative son with a heroin overdose . she said : everyone who 's been in our situation can relate to that . another interviewee , who unusually was considering pursuing anh withdrawal for her relative , commented : i would nt say that it had never occurred to me that putting a pillow over his face might be a kinder way . a sister told us that after investigating the possibilities of anh withdrawal for her mcs brother and discovering it was unlikely to be approved , although her family dissuaded her from doing so ( not wanting to lose another family member ) , she had reasoned that : however horrible prison was , however humiliating and frustrating and boring and scary , it would be nothing compared to being trapped within your own body and in pain . so in all the arguments i had with myself , that 's what i 'd come back to all my life my thing has been to protect my family . and protecting him and keeping him alive were in conflict . [ ] every day that nothing happened was harming him . however horrible prison was , however humiliating and frustrating and boring and scary , it would be nothing compared to being trapped within your own body and in pain . so in all the arguments i had with myself , that 's what i 'd come back to all my life my thing has been to protect my family . and protecting him and keeping him alive were in conflict . [ ] every day that nothing happened was harming him . another interviewee commented : there was a moment when i contemplated killing her [ my mother ] [ . ] and now my worst fear is that , in the strange cocooned world with antibiotics on tap where she lives , she may never die . there was a moment when i contemplated killing her [ my mother ] [ . ] and now my worst fear is that , in the strange cocooned world with antibiotics on tap where she lives , she may never die . in yet another family , an interviewee told us how she planned a mercy killing because she felt she had promised her loved one that he would not have to live in a vegetative state . i took the thing off his arms a couple of times just to see how loud the alarm was and what happened you know . because i thought she had chosen a hotel near the hospital in which she planned after making sure she had successfully accomplished the murder to kill herself undisturbed . although , in the end , each of these interviewees had decided that carrying out a mercy killing was not the answer , they were angry that the current system had , they felt , forced them into the position where they were contemplating it , and some felt guilty at their failure to carry through . in sum , some pvs and mcs patients are being administered life - prolonging treatments long after their families have come to believe that the patient would rather be dead . in the view of these interviewees , this compromises patients dignity , violates their prior expressed wishes and may also cause them pain and suffering but as long as an application for anh withdrawal is the only legal assured exit route that might be available , most families are unlikely to advocate for the patient 's death . w v m is the tip of the iceberg in terms of engaging in ethical concerns about the best interests , precedent autonomy and human rights of pvs / mcs patients . whereas previous commentary has focused analysis on the judicial reasoning in w v m , here we have drawn attention to the fact that this case is exceptional insofar as a family has been willing to seek anh withdrawal . our data show that many families are not willing even to consider anh withdrawal , however convinced they are that the person would rather be dead . those who had relatives in mcs also usually believed especially in the wake of w v m that their application was unlikely to succeed.13 philosophical debate about whether or not anh should be withdrawn from pvs / mcs patients will contribute most usefully in applied contexts if this lived reality is taken into account , and other ways of bringing about the death of pvs / mcs patients ( eg , terminal sedation ) are given full ethical consideration . | in w v m , family members made an application to the court of protection for withdrawal of artificial nutrition and hydration from a minimally conscious patient .
subsequent scholarly discussion has centred around the ethical adequacy of the judge 's decision not to authorise withdrawal .
this article brings a different perspective by drawing on interviews with 51 individuals with a relative who is ( or was ) in a vegetative or minimally conscious state ( mcs ) .
most professional medical ethicists have treated the issue as one of life versus death ; by contrast , families including those who believed that their relative would not have wanted to be kept alive focused on the manner of the proposed death and were often horrified at the idea of causing death by starvation and dehydration. the practical consequence of this can be that people in permanent vegetative state ( pvs ) and mcs are being administered life - prolonging treatments long after their families have come to believe that the patient would rather be dead .
we suggest that medical ethicists concerned about the rights of people in pvs / mcs need to take this empirical data into account in seeking to apply ethical theories to medico - legal realities . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
rituximab is a chimeric monoclonal antibody that targets cd-20 antigen expressed in more than 90% of all b cell nhl . it is approved by the us food and drug administration for the treatment of cd20 positive low - grade nhl including follicular lymphomas ( fl ) . the use of rituximab - based chemotherapy regimens in previously untreated advanced stage fl is associated with increased overall response rate ( orr ) , response duration , progression - free survival ( pfs ) and overall survival ( os ) . most common adverse reactions seen with use of rituximab are infusion reactions , tumor lysis syndrome , and adverse skin reactions . a spectrum of extremely rare but potentially lethal rituximab - induced lung diseases including acute respiratory distress syndrome , cryptogenic organizing pneumonia , interstitial lung disease , alveolar hemorrhage has been described in the recent literature mostly in case reports . herein , we report a case of rtx - ild in a young female patient with fl . a 33-year - old non - smoker female patient presented with generalized lymphadenopathy involving neck , axilla , abdomen and inguinal region . she had a history suggestive of b symptoms but there was no prior history of diabetes mellitus , dyslipidemia or occupational exposure to any kind of dusts . her height , weight , and body surface area ( bsa ) were 170 cm , 67 kg , and 1.78 , respectively . routine blood tests including complete blood count , renal and liver function tests were within normal limits . excisional lymph node biopsy showed infiltration by small , medium - sized lymphoid cells which appear to be forming follicles . immunohistochemistry markers were positive for cd-10 , cd-20 , bcl-2 , bcl-6 and ki-67 proliferation index was 22% . she was treated with r - chop 21 regimen consisting of three weekly rituximab ( 375 mg / m of bsa ) , cyclophosphamide ( 750 mg / m of bsa ) , doxorubicin ( 50 mg / m of bsa ) , vincristine ( 1.4 mg / m of bsa ) , and prednisolone ( 100 mg daily ) . after the fourth r - chop chemotherapy her routine blood counts , liver function test , renal function test , urine routine / microscopy and d - dimer were normal . a chest x - ray showed bilateral reticulo - nodular infiltrates [ figure 1 ] and hrct scan of the lung revealed bilateral patchy ground - glass opacities , suggestive of interstitial lung disease ( ild ) [ figure 2 ] . the pulmonary function testing ( pft ) showed a restrictive pattern [ table 1 ] . as it is quite difficult to rule out other causes of ild in cancer patients , various microbiological tests were carried out to rule out respiratory tract infections . sputum examination for gram stain , zn stain for acid - fast bacilli as well as for fungi and pneumocystis carinii did not reveal any abnormality . patient did not have symptoms like persistent or recurrent cough aggravated at night , weight loss , low grade fever ; she was a resident of non - endemic area for filariasis , there was no peripheral eosinophilia , and peripheral blood did not show any presence of abnormal organism . chest x - ray pa view showing bilateral reticulo - nodular infiltrates high - resolution computed tomography ( hrct ) scan of the lung : on axial lung window images , there are patchy ground glass opacities noted in bilateral lung fields , more in upper lobes pft results before and after steroid treatment extrapulmonary symptoms like the skin , joint and eye findings were absent . echocardiography was normal including the ventricular functions . depending on the development of new and progressive pulmonary infiltrates in a previously normal lung a diagnosis of r - ild was made . being hypoxemic at rest , patient was immediately treated with moist o2 inhalation along with intravenous methyl prednisolone ( 1 g daily for 3 days ) in an intensive care unit . she had dramatic symptomatic improvement , so was switched to oral prednisolone at a dose of 1 mg / kg body weight for the first 2 weeks followed by gradual taper by 0.25 mg / kg body weight every two weekly . on follow - up , chest was clear on auscultation , imaging modalities showed near total resolution of ground glass opacities [ figure 3 ] and pulmonary function tests were within normal limits . because of limited safety data and concern regarding possibility of severe second reaction as compared to first one , our patient was not re - challenged with rituximab . she was further treated with two cycles of chop regimen without any evidence of further lung injury during the treatment as well as follow - up . currently the patient is asymptomatic for her fl , ild and is on regular follow - up . chest x - ray pa view after treatment with steroids showing near normal resolution of reticulo - nodular infiltrates rituximab is a chimeric monoclonal antibody that targets cd-20 antigen that is expressed on more than 90% of all b cell nhl but not expressed on early pre - b cells , plasma cells , and normal bone marrow stem cells . rituximab , the very treatment evolution of hematological malignancies was approved by the us food and drug administration in 1997 for the treatment of low - grade non - hodgkin 's lymphoma expressing cd20 , follicular lymphomas and chronic lymphocytic leukemia , and subsequently diffuse large b - cell nhl . besides it is also used in other non - hematological and autoimmune conditions like steroid - resistant itp , rheumatoid arthritis and sle . fl is the most common subtype of indolent nhl , and accounts for about 22% of all newly diagnosed cases of nhl . a multicentre phase ii trial demonstrated the safety and efficacy of r - chop chemotherapy in relapsed and newly diagnosed indolent nhl . the superiority of r - chop to chop as first line therapy was established in a prospective randomized phase iii study conducted by german low grade lymphoma study group ( glsg ) in previously untreated advanced stage fl patients . the addition of rituximab to combination chemotherapy regimens has been associated with increased overall response rate ( orr ) , response duration , progression - free survival ( pfs ) and overall survival ( os ) benefit . single agent rituximab in treatment - naive patients with fl has yielded an orr of 72 - 73% , with a median time to disease progression around 2 years . prima study , and several other studies supports the use of maintenance rituximab , with an improvement in pfs and an os in a pooled analysis . besides an effective therapy most common adverse reactions noted with rituximab are infusion - related symptoms , including fever , chills , urticaria , flushing , headache , bronchospasm , dyspnea , angioedema , hypotension usually occurring within 30 minutes to 2 hours after the start of the infusion that usually resolves upon slowing or interrupting the infusion and incidence decreases with subsequent infusion . other adverse reactions include tumor lysis syndrome ; skin reactions like pemphigus , stevens johnson syndrome ; infusional arrhythmias and chest pain ; rarely myelosuppression . rare respiratory side effects , mostly described in recent literature include transient respiratory symptoms as part of an infusion - related reaction , hypersensitivity pneumonitis , interstitial pneumonitis , organizing pneumonia , pulmonary fibrosis , and alveolar hemorrhage . median age of diagnosis rtx - ild is 65 years ( range from 43 to 80 years ) with male to female ratio of 2:1 and the elderly individuals appear to be at increased risk . few theories that have been proposed are nod - like receptor pyrin domain - containing protein 3 ( nlrp3 ) inflammasome - activated lung injury and dysregulated cellular cytotoxicity . important differential diagnosis includes infection and disease progression where bronchoscopy - guided bal fluid cytology and/or lung biopsy is necessary . if the clinical , radiological or pulmonary function test findings are equivocal , a lung biopsy can be helpful to verify the diagnosis . as the patient was hypoxemic at rest , she was immediately shifted to an intensive care unit . worsened symptomatology and hemodynamic instability did not allow us to attempt a lung biopsy . like our patients scenario , diagnosis can reasonably be based upon compatible clinical features and typical hrct appearances and , in this context ; a surgical biopsy adds no useful information . fdg - pet appears to be a sensitive imaging modality to detect rtx - ild at an early stage . time interval between diagnosis by fdg - pet and first appearance of symptom of rtx - ild may be up to 3 months . modified ats / ers criteria was used for diagnosis in the absence of surgical lung biopsy . our patient meets all the major criteria like exclusion of known causes , restrictive pulmonary function tests , typical hrct findings , negative bal to exclude alternative diagnosis and most of the minor criteria as well such as bibasal velcro crepitations , insidious onset of symptoms . in an attempt to prevent rtx - ild , patient is premedicated with acetaminophen ( paracetamol ) 1 g , an antihistamine ranitidine 50 mg and methylprednisolone 100 mg . risk of the rituximab - induced lung injury is greatest on day 15 and around cycle 4 . in a study by liote et al . , mean time from the first rituximab infusion to onset of the respiratory manifestations was 3 months , with a peak at the fourth cycle and a mean cumulative dosage of 1,600 mg / m . our patient developed rtx - ild after completion of 4 cycle of rituximab , result similar to study done by andreas et al . in which median duration was four cycles of rituximab and average cumulative dose before the onset of symptoms was 1500 mg / m . after the clinical and radiological resolution , rituximab may be rechallenged under the cover of prophylactic steroids ( 0.5 mg / kg body weight ) to be continued for at least 4 weeks after the rituximab infusion . although cyclophosphamide and vincristine may cause drug - induced lung injury , our patient was treated with only chop regimen afterwards without any additional lung injury which is an indirect evidence of rechallenge with these two drugs that turned to be negative . in addition , liu et al . reported that among 107 patients treated with r - chop regimen , nine patients developed ild when compared to none out of the 66 patients treated with chop alone . the following recommendations were put forward by liote et al . in order to prevent and/or manage rtx - ild :
patients detailed counseling regarding the risk of respiratory symptoms that may develop , being greatest 15 days after the last infusion and around the fourth cyclemonitoring of respiratory symptoms during and after each infusionimmediate assessment by chest radiography how mildly symptomatic the patient may beprompt initiation of steroid therapy with the first suspicion of rituximab - induced lung disease . patients detailed counseling regarding the risk of respiratory symptoms that may develop , being greatest 15 days after the last infusion and around the fourth cycle monitoring of respiratory symptoms during and after each infusion immediate assessment by chest radiography how mildly symptomatic the patient may be prompt initiation of steroid therapy with the first suspicion of rituximab - induced lung disease . to conclude , despite being difficult to diagnose , prompt recognition and treatment of a rare but potentially fatal rituximab - induced interstitial lung disease in a patient presenting with respiratory symptoms and/or new onset pulmonary infiltrates is of utmost importance due to increasing use of the drug for treatment of variety of hematological and non - hematological disorders . | rituximab is a chimeric monoclonal antibody that targets cd-20 antigen expressed in more than 90% of all b cell non - hodgkin 's lymphoma ( nhl ) .
we report a case of 33-year - old female without any comorbidities , newly diagnosed with stage iiib follicular lymphoma treated with rituximab - based chemotherapy .
patient developed exertional dyspnea and dry cough after the fourth cycle of rituximab - based chemotherapy .
diagnostic high - resolution computed tomography ( hrct ) of the lungs revealed bilateral patchy ground glass opacities suggestive of interstitial lung disease ( ild ) .
it was managed successfully with supplemental oxygen and corticosteroids with discontinuation of the rituximab .
extensive review of the literature did not reveal ample of material on rituximab - induced ild ( rtx - ild ) . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
falls are common among older adults , and their consequences often devastating and costly [ 24 ] . evidence - based interventions are available to prevent falls [ 57 ] ; however , we have observed that care - seeking by older adults to reduce their likelihood of falling is less than expected . others have also observed that few older adults engage in proven behaviors to reduce fall risk after a fall [ 811 ] . explanations identified through qualitative research with older persons have included an underestimation of personal susceptibility to falling , a sense of fatalism or a belief that falls occur due to bad luck , an attribution of falls to external ( rather than within - person ) causes , a belief that falls are accidental , a belief that falls are an inevitable consequence of aging , and a belief that one already knows what to do to prevent falls . the majority of published research has been conducted with persons from scandinavia , britain , new zealand , and australia [ 10 , 11 , 13 ] , and thus it is unknown whether the explanations for this phenomenon , as observed in these studies , are generalizable to elders residing in the united states . additionally , most research has been conducted with samples that have not been fully characterized in terms of educational level and socioeconomic status [ 1013 ] and with persons who may or may not have experienced a fall [ 10 , 11 ] . thus , it is also unclear whether the findings apply to elders of different ethnic backgrounds , to low - income elders , or to elders at high risk of falls . an understanding of contextual ( personal , environmental ) factors affecting program participation is important , as program participation may ultimately influence an individual 's likelihood of future falls and fall - related injuries , global functioning , and quality of life [ 24 ] . we , therefore , conducted the present study with a diverse , low - income , community - dwelling sample that had experienced a fall to better understand the lower than anticipated uptake of clinical fall prevention services by older americans . we hypothesized that an array of complex factors would affect the decision to participate in a clinically oriented , fall prevention program and that beliefs , attitudes , and knowledge would differ between those who were receptive to a fall prevention service and those who were not . we conducted in - depth qualitative interviews of elders who had experienced a fall to explore differences between fall prevention program we employed a purposeful stratified sampling strategy to ensure an adequate balance of joiners and nonjoiners . interchangeably for those accepting an invitation to receive a fall risk assessment and management recommendations from either of two fall prevention programs . all participants had previously been referred to one of two seattle - based fall prevention programs : harborview medical center 's fall prevention clinic or king county emergency medical services ( ems ) fall prevention program , the harborview program is a hospital - based , outpatient clinic that offers multifactorial assessment and longitudinal management of modifiable fall and fall injury risk factors to persons with a history of falls . the king county ems program is a home - based program in which a physical therapist conducts a home safety assessment and arranges for any recommended adaptive devices to be installed . the therapist also assesses balance , strength , and footwear and reviews medical conditions and medications in order to customize a personal action plan . upon written approval of the participant , the therapist sends a letter to the personal physician explaining the one step ahead program and detailing findings of the evaluation so that the physician may consider if other medical management might also be beneficial to prevent future falls . a representative of each program sent letters to potential participants with information about the study , an invitation to participate , and a phone number to call for further information or to schedule an interview . in addition , each mailing included a stamped postcard for potential participants to return if they preferred the option of receiving a phone call from an interviewer or if they wished to decline participation . a follow - up phone call was made to those potential participants who neither called nor returned a postcard within a few weeks of receiving the mailing . for each program , recruitment targeted an equal number of participants who had accepted and joined the program and those who had either declined to join or otherwise not followed up on an invitation or referral . men and women aged 50 and above were recruited in proportion to their representation in the population . other eligibility criteria included residing in king county , english fluency , and possessing the cognitive ability to clearly understand the decision to participate in the study . the interview guide consisted of a series of open - ended questions designed to facilitate a conversation during which individual motivators and barriers to participation in the specified programs might be identified and discussed . the first half of the interview covered the role of health - related beliefs and behavior in participants ' daily lives , particularly as it related to views on healthy aging and participants ' core values . the second half focused specifically on attitudes and behaviors surrounding fall prevention , including participants ' experiences of their own falls and efforts to prevent falling again . interview questions were developed by the investigators to address the phenomenon of interest ( i.e. , lower than anticipated participation in available clinical services to address fall risk on the part of older adults with a history of having fallen ) . the first author ( eap ) was familiar with the small body of relevant literature on the topic ; however , no particular preconceived hypotheses were explored via the interview questions , nor were the interview questions designed to confirm or disprove findings from other published work . all interviews were conducted by research assistants who received training in conducting semi - structured , in - person interviews . interviewers scheduled appointments by phone and conducted the interviews at participants ' homes or at another location of the participant 's choosing . all interviews were audiotaped , and an incentive to participate was provided in the form of a gift card worth $ 25 . each interview lasted approximately 45 minutes , and upon conclusion , participants completed a paper questionnaire of standard demographic information about themselves and their households . throughout the process all study procedures were approved by the institutional review board at the university of washington . transcripts were then uploaded into atlas ti version 5.2 ( scientific software development gmbh , berlin , germany ) , a computer software program that facilitates qualitative data analysis . non - joiner , as the primary focus of this study was to ascertain differences between these two groups . coding and theme development was guided by the grounded theory approach of strauss and corbin [ 17 , 18 ] . this methodology was chosen because our main purpose was to arrive at an understanding of people 's actions / behaviors with regard to care - seeking for falls / fall risk . all coding was completed by two coders with experience in qualitative coding and analysis , working independently . the two coders and a third research team member read through all interviews prior to coding and theme development to establish initial impressions and to facilitate grounding in the data . an initial start list of codes was developed by identifying a priori areas of interest , such as consequences of falling and barriers to joining , and was included in the interview guide . the second stage of code development consisted of line - by - line reading of the interviews to capture subcodes that emerged from the data . these sub - codes were organized under the start list codes developed in the first stage . in this initial coding stage , an extensive codebook was developed that included definitions for the start list and all related sub - codes . coding discrepancies were reviewed with the full research team until consensus on final codes was reached . because coding was done by consensus , interrater agreement was not calculated . the codebook was then applied to all interviews , which were coded line - by - line . after completion of the coding stage , comparison analysis was conducted to uncover differences and similarities between joiners and nonjoiners . to complete this analysis , we examined a number of important factors to determine if the groups differed on any of these factors . factors examined included : if an injury had accompanied the fall , the stated cause of the fall ( falling due to illness or medication verses falling due to environmental factors , such as slipping ) , aging - related loss , the effect of doctor referral , the emotional response to falling , participant core values , such as the importance of family and social connections , demographic factors , and program type ( clinic versus home - based ) . atlas ti was used to perform both textual searches and visual displays of relationships and patterns emergent in the data . an iterative process was then used to further develop and confirm the resultant themes by a third research team member . for the fall prevention clinic , 35 letters of invitation were mailed to joiners and 40 to nonjoiners to reach our interview target of 20 completed interviews . for the ems fall prevention program , 30 letters were mailed to joiners and 37 to nonjoiners to reach our interview target of 20 completed interviews . there were no significant differences by joiner status on any of the sociodemographic characteristics that we examined . one of the most striking findings in this work was the similarities between joiners and nonjoiners of fall prevention programs . they were similar in their experience of loss associated with aging , in the core values they expressed , and in their emotional response to falling . in addition , we discovered that both groups of interviewees were using common public health terms in ways different from how these terms are typically used and understood by health professionals using the same terminology . the group as a whole expressed significant aging - related loss , both in their own physical abilities and in their familial or social relationships . over 70% of participants expressed diminishing physical function , and over half expressed familial or social loss . hfpc j5 : i used to walk long distances every day , but i can not do that anymore . i regret that i can not do it , but that 's the way it is . ems j2 : i have just dropped out of uw 's courses that i was taking , because of a number of reasons , one of which was that it 's so difficult for me to get around . even though i have the services of dial - a - ride on campus , still in some cases , just getting to the dial - a - ride meeting place was very , very difficult . my husband died on our 25th wedding anniversary so i have been alone ever since . hfpc j6 : because in two - and - a - half years i lost my husband and five close relatives . it just has not left me in very good spirits most of the time , because i was close to all of my relatives . ems nj5 : we have stopped doing lots of things that we did do , because it would take us longer to get to a meeting , for instance , and all of this kind of thing . nearly all participants expressed the importance of independence and of being able to maintain their current level of functioning . interestingly , this value was expressed regardless of their current circumstances and level of physical functioning . the wonderful thing about living here is that this is independent living , and although we have housekeeping and we have a dining room downstairs , we are free to come and go and do whatever we wish to do . ems nj5 : it 's very important , because you just think that at least you can take care of yourself , if you can not do all of these other things . all participants in this study had experienced at least one fall , and many had sought medical attention for their fall . when asked how they felt right after the fall , the participants named emotional responses that were similar across groups , expressing anger at themselves , fear , and embarrassment . hfpc j7 : it was sort of like , boy , how clumsy can you get ? oh , no , i am not going to be able to take care of myself or anything like that . i was sort of annoyed with myself that i had done that , more than anything else . i was mostly scared , because i said , oh , is this what life has for me ? i was falling so hard , and they tell us that you can break a hip . if you break a hip , you are on your way out . that just really was scary . i am an old man , sort of , on the ground on my hands and knees . in addition to the initial emotional response to falling , most participants expressed a heightened fear of falling and subsequent injury . they described trying to be careful to avoid falls and reported being very vigilant to avoid falling again . i mean , i have fallen there before , and i do not want that to happen again . i also watch where i put my feet now more often than i did before . ems nj4 : i am very careful . the rug , i watch because it wrinkles up , but i am very careful well , i do not want to break a hip . as coding was being conducted and themes were developed , it became clear that the participant 's understanding and usage of terms such as independence and physically active were not in line with how public health professionals typically use those terms . for example , participants considered themselves independent and valued that independence even when they were being cared for in a facility or by a caregiver . their view of independence was much broader than the definitions used by health and public health professionals and focused on maintaining their current level of functioning . additionally , physically active was used by participants to refer to the activities of simple daily functioning ; again a broader definition than is usually used in public health . when asked , what first comes to mind when you think about being physically active , or staying physically fit ? a typical response was : well , being able to get out of bed , being able to dress myself , being able to feed myself , and being able to function in the way that most of us do or want to . the analysis of these interviews revealed just one primary difference between those who participated in one of the fall prevention programs and those who did not . those who participated expressed that they needed the program ; those who did not participate expressed a lack of need . transportation was also cited as a barrier , although it was unclear if it was a primary barrier for those who cited it . those who joined a fall prevention program stated their need for the program in very simple terms , giving a sense that they would do everything they could to avoid falling again . when asked why they decided to go to the fall prevention clinic or have the in - home visit from ems , 17 of the 20 interviewees responded with a simple variation of , ems j6 : well , i am most eager to learn anything that would be helpful for me . for those who chose not to participate , half the group stated that they did not need the program because they felt they had not yet reached the point of needing intervention and that they could prevent falling themselves by being more careful . ems nj1 : at this point in time in my life , i do not feel like i need the extensive help that i might need later . others interviewed felt there was no need for the program because they felt beyond help or did not believe that anything could be done to prevent falling . there was also a sense from these respondents that , having multiple health conditions , they felt overwhelmed thinking about one more intervention . ems nj7 : well , i do not think that there 's anything that you can do . hfpc nj1 : yes , i am just not interested because i do not think that they can help me any , frankly . i have been through so many of these evaluations , and it 's just yadda , yadda , yadda . lack of transportation was the one other significant barrier that affected the harborview clinic participants . this barrier was discussed by 5 people who declined to participate in the harborview clinic . this barrier was often mentioned in combination with other reasons for not participating , such as , i just forgot , and i am not sure what they do for me . hfpc nj2 : i hate to ask people that i know to drive me , and so even from here to there , it 's a bitch . the results of our study suggest that the main reasons for older adults accepting an invitation to participate in a fall risk assessment and management program relate to outcome expectations of the program . participants who followed through on a referral to the fall prevention clinic or who received the home - based ems fall risk assessment program believed that such a program would benefit them in helping them reduce their fall risk . falling and its consequences instilled a great deal of anxiety and fear in our participants , and the older adults who chose to join a community fall prevention program in contrast , older adults who turned down the invitation for either program did not perceive a great need , either because they did not think they needed such a program at that particular point in their lives or because they felt they were beyond help . nonjoiners reported relying on their own strategies ( e.g. , being more careful ) for risk reduction . these findings share some similarities with those reported in published studies involving elders in other countries . in a study of accepters and decliners of referral to a falls clinic in denmark , all accepters believed that something could be done about their falls problem , that the time investment was worthwhile , and that they would use the advice received , whereas decliners expressed concerns that the healthcare system would take over their life , that the logistics and time commitment were excessive , and that providers had hidden agendas and might criticize them if they did n't follow advice . yardley et al . found that those they studied underestimated their personal susceptibility to falling and believed that no additional fall prevention measures were necessary . those they interviewed also cited practical factors , such as transportation , effort , and cost as precluding their participation . we did not identify among our sample the perception that fall prevention as a concept threatened personal identity and autonomy , as has been described by others . however , in a departure from other published studies , we did find a prominent belief in self - reliance , that is , the power of the individual him- or herself to use their own methods to control his / her likelihood of falling again in the future . of interest , a recent study of a sample ( n = 36 ) of homebound women in their mid-80 s to mid-90 s who resided in the midwestern u.s . and had a history of falling in their home describes in great detail a variety of strategies that these women articulated as ways that they planned to avoid falling again , such as avoiding quick turns , taking care not to bend over , wearing shoes that will not slip , and using one 's cane or walker more consistently . in addition to perceived need and beliefs about the outcome of joining a fall risk assessment program , our participants highly valued independence . however as mentioned above , participants ' perception of independence was different from and more limited than what is usually presented in the literature . that is , the predominant thoughts around independence , healthy aging , and physical activity were related to the ability to perform daily activities ( i.e. , get dressed by themselves , cook dinner , clean house ) . participants took pride in listing the daily activities they were capable of doing ( no matter how few ) , and their ability to maintain this level of independence was extremely important to them . the results of this qualitative study suggest that , in order to participate , older adults have to perceive a need for a community fall risk assessment program and that this perceived need is related to their assessment of how a program will benefit them in maintaining their current level of function . in portraying the benefits of a fall risk assessment program , it is important to emphasize program benefits that are consistent with the reality of many older adults ' situation . especially for high - risk elderly , who struggle with comorbidities , loss of physical abilities , and shrinking social networks , the emphasis should be on how falls are a major threat to remaining functional and independent [ 2 , 3 ] , and that through reducing the risk of falling by receiving and following recommendations provided by such preventive programs , these programs can help them maintain a level of confidence , mobility , and independence in their daily functioning . in addition , access to such programs needs to be simple . assisting such older adults in getting to a clinic and back , perhaps through a patient navigator or a volunteer transportation program , may be instrumental in getting a high - risk population to a regional center that offers fall risk assessments . engaging family caregiver support for an elder being counseled to undergo a fall risk assessment may also be helpful in encouraging participation . regular , ongoing contact with a supportive health professional , such as a physical therapist , may increase motivation to continue fall prevention activities ( e.g. , doing routine balance and strength exercises ) over time . the results of this study are informative for healthcare practitioners and aging service providers seeking to engage high - risk elderly to participate in a fall risk assessment program . having a history of having fallen did not necessarily lead participants to perceive that they needed to undergo an individualized risk assessment . this finding supports practitioners directly educating older persons about the fact that having experienced a fall suggests that one is highly likely to fall again in the future . for the present generation of elderly , the advice of a personal physician has been shown to facilitate participation in fall prevention activities , and thus educational guidance , along with a recommendation to undergo a risk assessment , delivered by an informed primary care provider , may be invaluable in shaping an older adult 's understanding of the importance of avoiding falls to well - being and the role of individualized risk assessment in this context . with regard to limitations of the present study , one limitation is that only 1 out of every 4 eligible participants agreed to participate in this study , which may have resulted in a selection bias . even so , we believe this selection bias is limited , since the total pool of eligible participants were fairly homogeneous due to the fact they had all been invited to undergo assessment and management by one of two fall prevention programs ( which have their own eligibility criteria ) . a second limitation is that our study sample was not as racially diverse as we had anticipated ; thus , further studies involving non - white persons are warranted . the sample was well - defined in terms of its sociodemographics , inclusive of those of low income , and uniform with respect to all participants being at high fall risk due to having had a history of at least one fall in the past . this latter point is important , in that it allowed us to circumvent the phenomenon of low perceived relevance of fall prevention due to not having experienced a prior fall . in addition , we did not find major differences in attitudes between joiners and nonjoiners according to program . participants who qualify for one program are typically eligible for the other program as well , and so this finding is perhaps not unexpected . the fact that findings for joiners and nonjoiners were similar regardless of program speaks to the external validity of our key results . the study sample consisted of a group of elderly all of whom had experienced a fall . the perception of need was the critical factor in determining participation in the fall prevention programs offered . interventions targeted at this high - risk group will need to address individual beliefs as well as structural and social factors ( i.e. , transportation issues , social networks ) to optimize participation of this group in such programs . | objective . to investigate motivational factors and barriers to participating in fall risk assessment and management programs among diverse , low - income , community - dwelling older adults who had experienced a fall
. methods .
face - to - face interviews with 20 elderly who had accepted and 19 who had not accepted an invitation to an assessment by one of two fall prevention programs .
interviews covered healthy aging , core values , attributions / consequences of the fall , and barriers / benefits of fall prevention strategies and programs .
results . joiners and nonjoiners of fall prevention programs were similar in their experience of loss associated with aging , core values they expressed , and emotional response to falling .
one difference was that those who participated endorsed that they needed the program , while those who did not participate expressed a lack of need . conclusions .
interventions targeted at a high - risk group need to address individual beliefs as well as structural and social factors ( transportation issues , social networks ) to enhance participation . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in 2012 , 21 million people in the usa and 2.9 million people in the uk had been diagnosed with diabetes , of whom 9095% have type 2 diabetes . these rates are expected to increase by over 60% by 2025 [ 2 , 3 ] . diabetes is associated with an increased risk of cardiovascular disease and its risk factors including , hypertension , dyslipidemia ( high blood cholesterol and triglycerides ) , and insulin resistance , all of which can be attenuated by lifestyle change . therefore , it is not surprising that diet and exercise are the cornerstones of the management of type 2 diabetes but these self - management aspects can be challenging for patients . with 95% of type 2 diabetes management requiring self - care , the uk national service framework for diabetes states that structured and ongoing education , and access to monitoring equipment are vital parts of diabetes care which empower people to effectively selfmanage [ sic ] their condition . national guidance recommends that structured education should be an integral part of care planning ; however its provision , particularly provision of tailored education , may be limited by access to trained educators and competing demands on healthcare staff . the uk healthcare commission ( 2007 ) reported that only 11% of people with type 2 diabetes had participated in any form of structured education , with attendance varying between 1% and 53% . opportunities exist to examine innovative approaches for delivery of education to people with diabetes , especially if such approaches can form a useful adjunct to the care offered by health care teams . according to corben and rosen ( 2005 ) , individuals with chronic diseases , including diabetes , are open to innovative health education methods and such individuals have stated that they would like information in as many formats and as early as possible after diagnosis . computer - based tools represent one such approach that may help to support the diabetes education provided by health professionals . there is some evidence that the use of computer - based education can improve knowledge , motivation , and self - care behaviour in people with diabetes [ 1115 ] . modest improvements in blood glucose control are also evident . in terms of priority areas for education , in a study of 245 people attending a diabetes clinic at a general hospital in the uk , the topic that respondents overwhelmingly wanted more information on was diet , followed by long - term complications and living a healthy lifestyle . the aim of this study was to evaluate the effectiveness of a computer - based , dietary , and physical activity self - management program for people recently diagnosed with type 2 diabetes on knowledge , attitudes , skills ( particularly goal setting ) , and behaviour . the program was developed based on existing theoretical frameworks and input from health professionals and the target population ( figure 1 ) ( findings published elsewhere ) . a qualitative study ( structured interviews with health professionals and focus groups with patients ) was conducted to gain insight into the issues that needed to be addressed by the program . overall , the lwd program focused on improving knowledge and addressing misconceptions and encourages self - monitoring of dietary intake and physical activity with goal setting used as a means of facilitating behaviour change . the central theoretical tenet for the development of the program was bandura 's self - efficacy theory . self - efficacy is recognised as one of the strongest predictors of health behaviour changes and is a component of the majority of psychological theories about behaviour change . a lack of knowledge has been identified as a factor limiting diabetes self - management and as a barrier to behaviour change among people with type 2 diabetes . goal setting has shown promise for assisting with dietary and physical activity change [ 21 , 22 ] and has been shown to be an effective behaviour change strategy among people with diabetes . five stand - alone sections of the program were developed : ( 1 ) a food diary allowed the user to record their food and drink intake , receive feedback on the balance of their diet , set goals , and save their data so they could revisit and review their goals . ( 2 ) a tailored activity analyser assessed current level of moderate and vigorous activity and provided feedback according to the users ' stage of behaviour change and encouraged setting goals to help them meet physical activity recommendations . ( 3 ) the fast facts section contained information presented in a dictionary style and covered a range of topics related to type 2 diabetes , diet , and physical activity . ( 4 ) the quick quiz consisted of a series of quizzes each composing of 6 multiple choice questions , with immediate feedback , and was designed to allow individuals to assess their levels of knowledge on a range of topics and to address common misconceptions . ( 5 ) the diabetes stories section included short video clips of three people with type 2 diabetes talking about their experiences of managing their diabetes . a prototype version of each section of the lwd program was developed and each section was then tested ( with exception of the diabetes stories section which was not tested owing to time restrictions ) by 1520 participants who had diabetes and the research team . the individual sections were modified based on the feedback from testing and a complete version of the lwd program was compiled . this complete version was tested with 10 patients in order to examine overall ease of use and navigation . some further minor modifications were made based on feedback from this testing and a full working version was produced for evaluation in the rct described below . ethical approval for the rct was obtained from the office of research ethics committees northern ireland ( orecni ) . participants were invited to participate from primary care settings in the belfast area as well as within the regional centre for endocrinology and diabetes , royal group of hospitals , belfast . inclusion criteria were diagnosis of type 2 diabetes within the previous 24 months , access to a computer , and being stable on medication ( i.e. , no change in medications for the past 2 months ) . the exclusion criteria were being pregnant or lactating and having a medical condition where changes in diet or physical activity would be contraindicated . the computer generated randomisation schedule was implemented using consecutively numbered envelopes and was stratified by recruitment site . the intervention group received the life with diabetes program on an external hard drive ( a usb stick ) in order to allow setting , saving , and reviewing goals . participants received a brief , 10-minute overview of the program and were asked to use the lwd program for 12 weeks . as a minimum level of usage , participants were encouraged to use the two self - monitoring and goal setting aspects of lwd ( i.e. , the food diary and activity analyser ) at least once a week . participants received a 2 - 3-minute phone call from the researcher ( ab ) at around week 4 and week 8 to answer any questions they had about the program and to encourage continued and regular usage . participants were asked to keep a log detailing their usage of the program ( date , length of time , sections used , and additional comments ) throughout the intervention period . the control group received a list of useful web site addresses including diabetes uk and were advised to continue with their usual care , consulting their health care team as they would usually do , for 12 weeks . primary endpoint was between - group differences in diabetes knowledge and setting and achieving goals . secondary endpoint was between - group differences in dietary intake , physical activity levels , anthropometry , markers of cardiovascular risk ( including blood pressure , lipids ( hdl , ldl , triglycerides ) ) , blood glucose control ( hba1c , fasting blood glucose ) , overall self - efficacy , and barriers to the management of diabetes . a baseline questionnaire recorded demographics , frequency and location of computer use , details of diabetes including month / year of diagnosis , current medications , whether participants had attended a group education session after diagnosis , where they received dietary information from , whether they had met with a dietitian , and if they had ever been advised on food intake and/or exercise by a health care provider . the following were assessed at baseline and completion : weight was measured , without shoes and outdoor clothing and after removal of heavy pocket items such as wallets and keys , on a calibrated scales . height was measured without shoes on a stadiometer and was recorded in centimeters to the nearest 0.1 cm . bmi was calculated from weight and height [ weight ( kg)/(height ( m ) ) ] . waist and hip circumference were measured over light clothing using an inelastic but flexible tape measure . blood pressure was measured twice from the right arm , using an automated omron sphygmomanometer with the participant sitting quietly for at least five minutes . a 20 ml fasting blood sample was drawn from the antecubital vein and was processed within 2 hours . all samples were stored at 70c for batch analysis at the end of the study . knowledge of type 2 diabetes was examined using a shortened version of the validated audit of diabetes knowledge questionnaire . self - efficacy was examined using the validated diabetes empowerment scale with three validated subscales ( managing the psychosocial aspects of diabetes , assessing dissatisfaction and readiness to change , and setting and achieving diabetes goals ) ; each question is rated on a 5-point scale from strongly agree to strongly disagree . barriers were assessed using a modified version of the validated diabetes obstacles questionnaire ( doq ) . eleven additional statements were included that covered barriers and beliefs identified during focus group disucssions with the target populations during the development phase of this project . each question is rated on a 5-point scale from diabetes - specific quality of life was measured using the validated audit of diabetes - dependent quality of life . scoring ranges from 9 ( maximum negative impact of diabetes ) to + 3 ( maximum positive impact of diabetes ) . generic quality of life was measured using the validated 36-item short - form health survey ( sf36 ) . scoring ranged from 0 ( lowest level of quality of life ) to 100 ( highest level of quality of life ) . depression was evaluated using the validated , brief , 9-item patient health questionnaire ( phq-9 ) . depression severity was as follows : 04 = none ; 59 = mild depression ; 1014 = moderate depression ; 1519 = moderately severe depression ; 2027 = severe depression . at the end of the study , all participants in the intervention group completed a program evaluation questionnaire and were asked to participate in an optional focus group discussion . the aim of the focus groups was to gain some further in - depth feedback on the program . focus group discussions were tape recorded and transcribed verbatim . statistical analysis was carried out using spss for windows , version 16 ( spss inc . , chicago , il ) . a p value 0.05 was considered to be statistically significant . data was examined for normality of distribution and no transformation of the data was necessary . baseline characteristics between groups were compared using an independent samples t - test for continuous variables and a chi - square test for categorical variables where appropriate . analysis of covariance ( ancova ) was used to examine the effect of the intervention . in such analyses the 2 groups ( intervention or control ) paired samples t - tests were used to examine within - group changes in the study outcomes . wilcoxon signed ranks test assessed movement between physical activity rankings ( e.g. , from low to moderate or high to moderate activity level ) . pearson chi - square assessed differences between groups in change in activity rankings . as an additional analysis , the intervention group was split into high users and low users according to the lwd log books ; those who reported using the program at least 12 times during the 12-week study were classified as high / normal users ; those who reported using the program less than 12 times during the 12-week study and those who did not return a log book were classified as of these , 105 were screened ( 3 were not contactable after a minimum of 6 attempts ) , 92 were eligible to participate , eight individuals declined to participate before randomisation took place , and 84 were randomised ( 41 intervention , 43 control ) . seventy participants ( 84.5% ) completed the 12-week study ( n = 32 out of 41 ( 78% ) intervention group ; n = 38 out of 43 ( 88% ) control group ) . there was no between - group difference in overall adknowl score from baseline to postintervention ( table 2 ) and no statistically significant improvement in the diet and food scale of the adknowl questionnaire in the intervention group compared to the control group ( p = 0.09 ) . there was also no significant between - group difference in the setting and achieving goals subscale of the des5 on completion of the intervention . there was a significant between - group difference in the knowledge and beliefs scale of the doq , with an improvement in the knowledge and beliefs scale in the intervention group , compared to the control group ( mean ( sd ) 3.5 ( 1.0 ) versus 3.3 ( 0.6 ) , resp . ) . there were no significant differences between groups after adjusting for baseline variables , for diabetes - specific quality of life ( addqol ) , depression ( phq-9 ) , or any of the anthropometric measurements or blood parameters shown in table 3 after the intervention . overall there was no significant between - group change in dietary intake during the intervention ( table 4 ) . there was a trend towards a between - group difference in carbohydrate intake , with intake decreasing in the intervention group and increasing in the control group ( mean difference p = 0.058 ) . there was a trend for more people in the intervention group to change their category of physical activity in a positive way ( moving from low to high , low to medium , or medium to high ) during the intervention , with 33% of participants in the control group moving positively between categories compared to 22% of the control group . figures for changing category of physical activity in a negative way ( moving from high level of activity to medium level of activity , high to low , or medium to low ) were 5% for intervention group and 16% for the control group . overall , however , there was no significant difference between groups in change in physical activity over time . for the adknowl treatment subscale , there was a significant difference between the high users ( 62% correct ) and control group ( 42% correct ) at week 12 ( p = 0.032 after adjusting for baseline values ) but no difference between the low users ( 53% ) and control ( 42% ) , p = 0.347 . for the doq , the advice and support scale , there was also a difference between the high users ( 4.1 ( se ) ( 0.5 ) ) and control group ( 3.7 ( 0.6 ) ) ( p < 0.01 after adjusting for baseline values ) , but not between the low users ( 3.5 ( 0.7 ) ) and control group ( 3.7 ( 0.6 ) ; p = 0.98 ) . both the high and low user groups scored higher on the knowledge and beliefs scale of the doq compared to the control group over the 12 weeks ( 3.7 ( 0.8 ) , 3.6 ( 1.1 ) , and 3.3 ( 0.6 ) , p < 0.05 after adjusting for baseline values ) . there were no other statistically significant differences between the high users , low users , and the control group for any of the other parameters . ninety - six percent of participants agreed that the information within the program was clear and easy to understand . some additional free text comments were included in the free text element of the questionnaire : very encouraging , thought it was great , very useful , and very helpful and stated that they felt it would keep them focused and determined and that it was easy to use . they agreed that the format of the program ( memory stick ) was handy because of the sheer ease of access . participants also highlighted that while they find visiting a dietitian to be helpful , they appreciated being able to expand on those sessions by referring back to the program as they wished : you 're aware it 's always with you when your dietitian 's not and sitting for half an hour with the dietitian does n't really help you much as having that food diary . in addition to being the most highly rated section , the food diary was the most frequently discussed section . the food diary appeared to alert participants to healthier eating and areas of their diet they could improve . for example , you think you 're eating very healthily and all of a sudden you realize you 're not , it made me see that i was actually missing out on some things , and it made me very alert to healthier eating . for example , you think next time i 'll have like beans or peas with this , trying to get a better balanced diet , or tying to eat fewer biscuits . however , some admitted that they stuck to their traditional diets out of habit or a lack of motivation : i 'll eat the vegetables . after being asked what they found most enjoyable about the program , the quick quiz section was mentioned by most participants : it was good to have something interactive and i did find the quiz very , very good . they would often challenge themselves to improve on their scores : i got quite competitive until i got good scores . in addition to being enjoyable , they also found it helpful and very informative . they were excellent , certainly that was the section that i really got the most out of , i learnt quite a lot from it , and the explanation of terms was very useful . while the diabetes stories section was rated as the least helpful of the five sections with a score of just above five out of ten , participants expressed in the focus groups a solid appreciation of this section saying they found it very helpful and reassuring . a typical quote was the bit where real people , local people , actually talked you know about having diabetes and how they coped with it . i find that very reassuring and when you 're diabetic everybody has an opinion especially people who have never had it it 's nicer to hear from people from you know that have had it with the experience of having it . finally , while some participants did find the physical activity section helpful ( e.g. , it focused my mind on how i could be more active and i will go back to that section and see if i can improve on it ) , many did not ( e.g. , after a while i just sorta stopped going into it , you take 30 minutes of exercise a day and all this and you know you 're not doing it and there 's no use going back into the activity and doing that again ) . however , some admitted that these may be an excuse for not exercising : not that i take exercise very much [ laughs ] . diabetes education delivered by a team of educators , with some degree of reinforcement of that education at intervals , may provide the best opportunity for improvements in patient outcomes . however , the quality and quantity of self - care education given to each individual are highly dependent on the skills and resources of the healthcare professional delivering that education . in the uk , healthcare providers are increasingly pressurised by government driven targets ; hence access to nursing or dietetic time for diabetes education may be limited . computer - based technology holds promise as an innovative means of supporting the work of health professionals ; it can be used to reinforce and extend the education received in the healthcare setting and is readily accessible therefore facilitating opportunities for use on a regular and frequent basis to enhance knowledge and self - monitor key health - related behaviours . the evaluation of this newly developed tool to aid self - management of diet and physical activity in people with type 2 diabetes indicated that it was highly valued by users and , alongside this , its short - term use was found to significantly improve barriers related to knowledge and beliefs about diabetes . there was also a trend towards a statistically significant improvement in overall health status as measured by sf-36 instrument . a secondary analysis of high users compared to the control group demonstrated small but significant increases in the knowledge and beliefs scale and the advice and support scale of the doq and a trend towards significance for adknowl diet and food score . although there was no significant change between the intervention and control group in self - efficacy , depression , diabetes - specific quality of life , body weight , or metabolic markers , there were indications of positive changes in dietary intake and physical activity between groups , albeit these were not statistically significant . the results , therefore , indicated that this tool did help patients to improve their knowledge , which is one of the key barriers to dietary self - management among people with type 2 diabetes [ 3437 ] . previous research has indicated that people with type 2 diabetes particularly want information on diet and while enhanced knowledge will not necessarily always translate directly into a change in behaviour , it represents one positive step towards empowering people to make better choices [ 3840 ] . it has been reported that knowledge - behaviour correlations are increased among individuals with increased self - efficacy and decreased among those with decreased self - efficacy . however , the improvement in knowledge in this study was not accompanied by changes in self - efficacy , perhaps owing to the time - scale of the study or the level of usage of the program as discussed below . the lwd program was highly rated by participants in feedback obtained from both questionnaires and focus group discussions . this is reassuring given the level of involvement the target group had in terms of the development of the program itself and the extensive usability testing that was undertaken . including members of the target group in the development process is a robust form of program development and has been shown to improve participation and program success [ 42 , 43 ] . the main attribute that participants appreciated most was having the lwd program on - hand so they could access it at their convenience . there is evidence that home - based instruction is a preferred - choice to group / classes in diabetes self - management . home - based instruction allows the individual to schedule educational activities around their existing lifestyle , in their own time , and in the comfort of their own home . in addition to the convenience of home - based instruction , this approach may help with retention and application of information as patients report that information received in face - to - face education sessions , while valuable , is difficult to recall at a later time . having an education tool on - hand , such as the one delivered here , can help to fill this gap in diabetes self - management and could be helpful and reassuring for patients , particularly when check - ups or follow - up appointments are frequently 6 months apart . it was also apparent in the focus group discussions that the participants were enthusiastic towards each individual component of the program , often stating that they found them motivating , reassuring , and helpful and that it kept them focused . some suggested that they did learn new concepts and did attempt to make changes to their diet . study completion rates were good , with only 16% being lost to follow - up ; however only 40% of the intervention group appeared to use the program on at least a weekly basis . future research on this program should assess ways to enhance compliance and regular use of the program as this may result in additional benefits . for example , embedding the program within current care packages alongside regular contact with a health professional , whether it be by email , letter , or phone call , may be of benefit . additional changes might include enhancement of the physical activity component of the tool to focus on self - monitoring and goal setting behaviour which may help to increase engagement with this part of lwd . app platform which would increase ease of access thus enhancing opportunities for engagement and regular use . with regard to dietary intake , based on initial focus group discussions , the lwd program focused predominantly on helping the user to understand how to achieve a balanced diet . the program did not focus on calorie restriction and weight loss and , indeed , although some favourable changes in dietary intake were observed , there was no change in body weight following the intervention . recent guidelines for management of type 2 diabetes emphasise the importance of weight management as the primary goal for people with type 2 diabetes . based on the findings of the trial and the increased emphasis placed on weight loss in clinical guidelines , it is clear that the issue of weight management needs to be enhanced within this educational tool . a lack of desire to engage with technology was one of the main factors that influenced recruitment to the study . however , on a positive note , most of the people who took part in this study had never used a computer before and yet still managed to navigate their way through the program with ease which was reassuring as ease of use was a key priority when the tool was being designed . furthermore , the average age diagnosis for type 2 diabetes is decreasing and computer literacy is increasing [ 46 , 47 ] . since inception of this project , although this tool was originally designed to be delivered via personal computer , the new technologies available open up increased opportunities to modify the tool for use on a number of different platforms thereby increasing accessibility and potentially enhancing reach and effectiveness . conversion to an app format would require a similar process of user involvement as for development of the original program in order to ensure usability is appropriate for the target group who will have specific usability requirements compared to other segments of the population . circumstances compliance was not optimal ; based on usage logs , only approximately half of the intervention group participants used the tool on at least a weekly basis as was recommended at the study outset . the high user group may represent a more highly motivated population and hence may not be as generalisable to the general population . however , despite this , some positive changes in knowledge - related parameters perceived health status , diet , and activity were observed and the trial has highlighted the need to focus attention on strategies that could be used to enhance usage , such as exploring alternative modes of delivery , such as app technology , and how this tool could be incorporated into existing diabetes care packages , as discussed above . with regard to the user feedback , only a quarter of the intervention group participants opted to take part in the focus group discussion at the end of the study . feedback from these sessions was positive ; however , it is possible that only the more motivated or interested participants opted to take part and therefore these discussions may not be representative of everyone who used the program . it was encouraging , however , that the positive attitude towards the program displayed in the focus group discussions was , for the most part , consistent with the findings from the evaluation questionnaire that was completed by all participants who used the program . this short - term evaluation indicated that this newly developed computer - program , focusing on diet and physical activity self - management , was well received by participants and its usage resulted in small but statistically significant improvements in diet - related knowledge , as well as nonsignificant improvements in perceived health status , dietary intake , and physical activity . consideration needs to be given to how the delivery platform can be widened to maximise impact , how this tool could be incorporated into existing diabetes care packages , and what level of health professional support is required to encourage usage and help maximise effectiveness of the tool . this tool may be a viable adjunct to diabetes self - management and could help to fill an important gap in patient care . health professionals are charged with delivering a large volume of information to patients , often within a limited time slot , and human resource issues can also mean there is limited capacity for patient follow - up . self - management tools such as this can be a useful adjunct to hcp patient education and support and can help fill important gaps in the care pathway , such as the period between diagnosis and receiving structured education , or extended time periods between patient follow - up appointments . for hcps to have confidence in the effectiveness of any such tool , however , they should be developed in close consultation with the end users and with hcps and should undergo rigorous usability testing , as was undertaken during this study , before wider dissemination . | aim .
the purpose of this study was to develop and evaluate a computer - based , dietary , and physical activity self - management program for people recently diagnosed with type 2 diabetes .
methods .
the computer - based program was developed in conjunction with the target group and evaluated in a 12-week randomised controlled trial ( rct ) .
participants were randomised to the intervention ( computer - program ) or control group ( usual care ) .
primary outcomes were diabetes knowledge and goal setting ( adknowl questionnaire , diabetes obstacles questionnaire ( doq ) ) measured at baseline and week 12 .
user feedback on the program was obtained via a questionnaire and focus groups .
results .
seventy participants completed the 12-week rct ( 32 intervention , 38 control , mean age 59 ( sd ) years ) .
after completion there was a significant between - group difference in the knowledge and beliefs scale of the doq .
two - thirds of the intervention group rated the program as either good or very good , 92% would recommend the program to others , and 96% agreed that the information within the program was clear and easy to understand .
conclusions .
the computer - program resulted in a small but statistically significant improvement in diet - related knowledge and user satisfaction was high . with some further development , this computer - based educational tool may be a useful adjunct to diabetes self - management .
this trial is registered with clinicaltrials.gov nct number nct00877851 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
astellas pharma inc . was formed in april 2005 by the merger of two research and development ( r&d)-driven companies , namely yamanouchi pharmaceutical co. , ltd , and fujisawa pharmaceutical co. , ltd . astellas expresses the idea of aspired stars and advanced stars based on the latin stella , greek aster and english stellar , which all refer to stars. astellas also sounds like the japanese phrase a - su wo te - ra - su which means to shine on tomorrow ( 1 ) . in this paper , we describe our drug discovery strategy in view of our guiding principles , current research activities and future perspectives , with a particular focus on oncology . at our very start , we clarified our guiding principles as our philosophy , corporate message and vision . our philosophy is to contribute toward improving the health of people around the world through the provision of innovative and reliable pharmaceutical products . our corporate message is that we will be the leading light for life to deliver world - class state - of - the - art pharmaceuticals that promise people from around the world a healthier life ( 2 ) . for patients and their families and for ourselves , we have further condensed our message into the phrase changing tomorrow ( 3 ) . vision 2015 as our management vision in order to show how astellas must look in the year 2015 . in this vision , we constructed our business model , a global category leader ( gcl ) . a gcl shows high competitiveness by providing value - added products globally in several categories where high unmet medical needs exist and a high degree of expertise is required , and thereby takes a leading position in such categories. at the same time , we established our important r&d categories including urology , immunology including transplantation and infectious diseases , neuroscience , diabetes mellitus complications and metabolic diseases , and oncology ( 4 ) . we strongly believe that we need to reinforce our research capabilities by approaching new technologies and new research areas in a timely manner in order to create innovative drugs ( 5 ) . in 2009 , we started operation of an x - ray beam line at the photon factory of the high energy accelerator research organization , tsukuba , purposely built for efficient elucidation of protein structures for use by astellas and academic institutions ( 6 ) ( fig . 1 ) . we also created the bioimaging research laboratories at our tsukuba research center in order to enhance our capability in drug discovery and translational sciences ( 7 ) ( fig . 2 ) . in addition , we are keen to strengthen our capability in other important technology platforms including proteomics ( 8) and bioinformatics ( 9,10 ) .
figure 1.astellas beamline at the high energy accelerator research organization ( kek ) . left : aerial view of the kek campus located 9 km north of the astellas tsukuba research center . bottom right : the ne-3a deck for x - ray diffraction experiments colored in red and gray ( astellas corporate brand color ) . ar - ne3a , an x - ray beamline with a beam energy of 6.5 gev ring , is designed for high - throughput macromolecular crystallography which is applied in a structure - based drug design ( sbdd ) . kek and astellas jointly developed a fully automated data collection and processing system inside the ne-3a deck . this system can collect x - ray diffraction data sets from more than 200 samples per day by optimizing the schedules of sample exchange , centering , data collection and data processing . lower left : positron emission tomography ( pet)/computed tomography scanner for small animal studies ( inveon , siemens ) . lower right : pet scanner for large animal studies ( shr-17000 , co - developed with hamamatsu photonics k.k . ) . astellas beamline at the high energy accelerator research organization ( kek ) . left : aerial view of the kek campus located 9 km north of the astellas tsukuba research center . bottom right : the ne-3a deck for x - ray diffraction experiments colored in red and gray ( astellas corporate brand color ) . ar - ne3a , an x - ray beamline with a beam energy of 6.5 gev ring , is designed for high - throughput macromolecular crystallography which is applied in a structure - based drug design ( sbdd ) . kek and astellas jointly developed a fully automated data collection and processing system inside the ne-3a deck . this system can collect x - ray diffraction data sets from more than 200 samples per day by optimizing the schedules of sample exchange , centering , data collection and data processing . lower left : positron emission tomography ( pet)/computed tomography scanner for small animal studies ( inveon , siemens ) . lower right : pet scanner for large animal studies ( shr-17000 , co - developed with hamamatsu photonics k.k . ) . in view of treatment modality therefore , we in - licensed velocimmune technology from regeneron pharmaceuticals , inc . , in order to efficiently generate fully human monoclonal antibodies ( 11 ) and acquired agensys , inc . , in order to strengthen our drug discovery of antibodies in cancer ( 12 ) . based on our in - house research and introduction from other companies in the past few years , our current oncology r&d programs consist of the following three approaches ( 13 ) :
precision medicinemechanisms of action with application across multiple tumor typesleveraging astellas ' current capabilities in urology and other therapeutic area mechanisms of action with application across multiple tumor types leveraging astellas ' current capabilities in urology and other therapeutic area in the past , we took the second and third approaches in our drug discovery . from the second approach , we created ym155 , a selective survivin suppressant for multiple tumors ( 14,15 ) . from the third approach , we created potential treatments for hormone - dependent cancers including ym511 , an aromatase inhibitor ( 16 ) , and ym580 , a non - steroidal androgen receptor antagonist ( 17 ) . through our experience in these drug discovery programs and subsequent clinical trials , we had fostered the notion that we must deliver novel therapies for improving the health of well - defined populations of patients suffering from a number of cancers . the establishment of our principles on top of the above - mentioned mindset naturally shifted our research approach in a direction in which we can offer highly effective therapeutic options for precisely defined patient populations based on molecular targeting and precise diagnosis . we call it the precision medicine approach ( 5,13,18 ) ( fig . 3 ) astellas would like to realize right drug for right patients by offering medicines targeting pathogenic molecules ( we call it precision medicine ) combined with companion diagnostic tests fitting to such medicines . astellas would like to realize right drug for right patients by offering medicines targeting pathogenic molecules ( we call it precision medicine ) combined with companion diagnostic tests fitting to such medicines . the us food and drug administration ( fda ) published the draft guidance for in vitro companion diagnostic devices ( 19 ) . in august 2011 , the fda approved zelboraf ( vemurafenib ) , a kinase inhibitor , for the treatment of patients with unresectable or metastatic melanoma whose tumors express a gene mutation called braf v600e together with a diagnostic test to detect such mutation in patients ' melanoma cells ( 20 ) . the fda also approved xalkori ( crizotinib ) , a kinase inhibitor , for the treatment of patients with locally advanced or metastatic non - small cell lung cancer who express the abnormal anaplastic lymphoma kinase ( alk ) gene together with a diagnostic test to detect such abnormal gene ( 21 ) tsukuba research center at tsukuba , ibaraki , japan , osi pharmaceuticals , llc at farmingdale , ny , usa , and agensys , inc . at santa monica , ca , usa . the three research sites pursue precision medicine in a diverse manner based on the research platform and research strategy of each site . tsukuba research center focuses on the creation of small molecules that inhibit the function of molecules which are essential for the survival or growth of tumor cells as a result of either genetic or epigenetic alterations to the drug target molecules themselves or in the presence of certain genetic or epigenetic contexts . in order to create drugs to well - defined patient populations , tsukuba research center is placing significant emphasis on efforts to identify and validate novel molecular targets based on in - house research and external collaborations . it should be noted that these target discovery efforts also form the basis of translational research for determination of the right patients . based on this research style , we created asp3026 , an inhibitor of alk tyrosine kinase ( 22,23 ) . osi joined astellas in 2010 ( 24 ) , and it is pursuing small molecule drug discovery with a different style using different precision medicine strategies . during the development of erlotinib , an inhibitor of epidermal growth factor receptor tyrosine kinase , osi completed much research to better understand which patients optimally benefit from this therapy and which patients would become refractory or resistant ( 2527 ) . this research led osi to focus on drug discovery and translational research related to epithelial mesenchymal transition ( 26,28,29 ) and compensatory activation mechanisms in oncogenic signal transduction ( 27,30,31 ) for both publicly known as well as novel oncology targets . in addition , osi is doing extensive translational research to identity novel biomarkers for patient selection based on the characterization of gene and protein signatures in responsive tumor cells ( 32 ) . agensys specializes in drug discovery of antibodies for cancer therapy , focusing on the creation of novel monoclonal antibodies from two aspects . first , agensys invested in identifying novel antigen molecules or epitopes which are selectively expressed on the surface of certain sets of tumor cells . these antigen molecules or epitopes are molecular targets for agensys ' antibodies as well as biomarkers for the selection of the right patients . adc is an antibody covalently attached to a cytotoxic molecule ( such as tubulin inhibitor or dna minor groove binder ) via a linker . once an adc binds to the antigen on a tumor cell , it is internalized into the tumor cell and the cytotoxic molecule is released to cause cell death ( 33 ) . this unique combination of novel molecular targets and adc technology is expected to provide innovative therapeutic options for precision medicine to the patients for whom no effective drug currently exists . agensys has put three adcs into clinical trials so far , with ags-22m6e ( also known as asg-22me ) , an adc targeting nectin-4 , as the latest example ( 34 ) . secondly , agensys is using its panel of patient - derived xenografts ( pdx ) to validate antibody targets in cancers and develop functional antibodies . the panel of over 60 pdx , representing 14 different indications , provides unique preclinical models and allows preclinical evaluation of targets that are required for tumor growth and survival in a particular microenvironment that may not be found or required for growth of xenografts of conventional cell lines . the anti - prostate stem cell antigen antibody ags-1c4d4 completing a phase ii study in pancreatic cancer is the most advanced example of this approach ( 35,36 ) . the chemical compounds and antibodies created by our three research sites , together with in - licensed compounds , form our oncology development pipeline as shown in table 1 . table 1.astellas ' oncology development pipelinecode no . , generic nameclassificationtherapeutic targetphaseoriginremarksasp3550 , degarelixgnrh receptor antagonistprostate cancerfiledferring pharmaceuticalsmdv3100androgen antagonistprostate canceriiimedivationerlotinib ( tarceva)her1/egfr tyrosine kinase inhibitornon - small cell lung cancer ( first line for patients with egfr mutation , adjuvant ) , hepatocellular carcinomaiiiin - house ( osi)new indicationosi-906igf-1r / ir tyrosine kinase inhibitoradrenocortical carcinoma ( acc ) , ovarian cancer , non - small cell lung cancer , hepatocellular carcinomaiii ( acc ) , ii ( others)in - house ( osi)ref . ( 30)asp4130 , tivozanibtriple vegf receptors inhibitorrenal cell carcinoma ( rcc ) , breast cancer , colorectal canceriii ( rcc ) , ii ( others)aveo pharmaceuticals , inc.ym155survivin suppressantbreast cancer , non - hodgkin 's lymphomaiiin - house ( tsukuba)refs ( 14,15)ac220flt3 kinase inhibitoracute myeloid leukemiaiiambit biosciences corporationags-1c4d4antibody ( prostate stem cell antigen)pancreatic canceriiin - house ( agensys)refs ( 34,35)osi-027mtor kinase inhibitorrenal cell carcinomaiiin - house ( osi)ags-16m8fantibody - drug conjugate ( adc)canceriin - house ( agensys)asg-5meadccanceriin - house ( agensys)co - development with seattle geneticsasp1707small moleculeprostate cancer , endometriosisiin - house ( tsukuba)asp3026alk kinase inhibitorcanceriin - house ( tsukuba)refs ( 21,22)asp9521small moleculeprostate canceriin - house ( tsukuba)ags-22m6eadccanceriin - house ( agensys)ref . ( 33 ) , co - development with seattle geneticsgnrh , gonadotropin - releasing hormone ; her1 , human epidermal growth factor receptor 1 ; egfr , epidermal growth factor receptor ; igf-1r , insulin - like growth factor receptor 1 ; ir , insulin receptor ; vegf , vascular endothelial growth factor ; flt3 , fetal liver tyrosine kinase 3.this table is based on the status of november 2011 . astellas is not developing ym511 or ym580 . astellas ' oncology development pipeline gnrh , gonadotropin - releasing hormone ; her1 , human epidermal growth factor receptor 1 ; egfr , epidermal growth factor receptor ; igf-1r , insulin - like growth factor receptor 1 ; ir , insulin receptor ; vegf , vascular endothelial growth factor ; flt3 , fetal liver tyrosine kinase 3 . the three research sites have multiple collaborations that span sites on the basis of research programs as well as platform technologies . the research activities at the sites are coordinated through a team consisting of research leaders , clinical leaders , including medical oncologists , and strategy leaders . this team reviews the research activities of each site and offers ideas for improvement of research programs at each site and to facilitate further collaboration . in concluding this chapter , we would like to describe how we tackle rapidly progressing fields , taking epigenetics as an example . when molecules involved in epigenetic modification of histone emerged as therapeutic targets , both of our parent companies utilized their natural product technology platform to the discover histone deacetylase inhibitors , namely fk228 and ym753 ( 37 ) . since then , a number of epigenetic modification mechanisms have been identified as potential therapeutic targets and biomarkers ( 38 ) , and we now see this progress as an opportunity for novel drug discovery based on our current mindset and technology platforms . we have described our research activities with emphasis on what we are doing in our research sites . however , our research activities are already based on a number of external collaborations ( 39 ) , and we seek further opportunity of such collaborations in order to create and deliver novel treatments to cancer patients . we understand that such opportunity is not only in the accomplishments of basic science , but also in the findings and insights derived from clinical practice . while we understand that the feedback of clinical findings to drug discovery in a timely and appropriate manner is a big challenge , it is our hope that we can take this challenge with the readers of this paper . toichi takenaka , dvm , phd , is a senior scientific advisor and a former chairman of the board of astellas pharma inc . | based on the goal of delivering innovative and reliable pharmaceutical products to cancer patients for whom no effective treatments exist , astellas is focusing its efforts on a strategy of precision medicine in its drug discovery which is carried out at three research sites with diversity in their research platforms and research styles . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
hypertension is a multifactorial condition characterized by high and sustained levels of blood pressure ( bp ) . it is the most common condition in primary care and often associated with functional and/or structural changes in target organs and metabolic disorders , increasing the risk of fatal and nonfatal cardiovascular events [ 1 , 2 ] . among the risk factors for mortality from cardiovascular disease ( cvd ) , hypertension explains 40% and 25% of deaths from stroke and coronary artery disease ( cad ) , respectively . endothelial cells of the vascular system are responsible for many biochemical reactions that maintain vascular homeostasis and consequently the bp levels . endothelium modulates vascular tone , not only by producing vasodilator substances but also by releasing vasoconstrictive substances through prostanoid of endothelin generation , as well as through conversion of angiotensin i ( ai ) in angiotensin ii ( aii ) on the endothelial surface . these vasoconstrictor agents not only act mainly locally but also present some systemic effects , playing an important role in regulating the vascular function and remodeling the arterial wall . in healthy individuals , there is a balance among these substances , tending to vasodilatation when endothelial function is normal . changes in endothelial function precede morphological changes of blood vessels and contribute to the development of clinical complications of cardiovascular diseases . thus , the beginning and the clinical course of adverse cardiovascular events depend directly on changes in vascular biology . the limited no bioavailability is the main mechanism involved in endothelial dysfunction , which is crucial for the development of cvd . in fact , endothelial dysfunction in peripheral and coronary vessels is an independent predictor of cardiovascular events and represents an early stage of cad . as endothelial dysfunction is reversible , early detection and intervention could have critical therapeutic and prognostic implications for patients with risk for , or even with established , cvd [ 7 , 8 ] . therefore , an improvement in the no bioavailability can have a major effect on endothelial function and , consequently , on cvd prevention and treatment [ 9 , 10 ] . metabolic syndrome can be considered a clinical and biochemical expression of insulin resistance , representing a clustering of central obesity , hypertension , hyperglycemia , and dyslipidemia [ 19 , 20 ] . recently , experimental models and clinical studies demonstrated that reductions in the no bioavailability play a central role in the pathophysiology of metabolic dysfunction . endothelial nitric oxide synthase- ( enos- ) deficient mice were able to develop high bp and metabolic dysfunction , and both might be the result of insulin resistance [ 21 , 22 ] . in the same experimental model , the amount of dietary nitrate used for this effect was comparable to those derived from enos under normal conditions , which corresponds to a rich intake of vegetables for humans . besides , dietary nitrate was able to increase tissue and plasma levels of bioactive nitrogen oxides . lastly , chronic nitrate supplementation prevented the prediabetic phenotype in these animals by reducing visceral fat accumulation and circulating levels of triglycerides . in humans , enos polymorphisms have been associated with insulin resistance , type 2 diabetes mellitus , and metabolic syndrome . furthermore , recent evidences have shown that obese subjects present a reduced ability to produce no [ 10 , 24 ] . therefore , the dietary nitrate has been widely studied in clinical trials as an alternative form of the classical pathway of l - arginine to no production . poor eating habits may be considered as risk factors for cvd . in fact , high intake of foods rich in cholesterol , lipids , and saturated fatty acids and low consumption of fiber sources are related to dyslipidemia , obesity , diabetes mellitus , and hypertension . thus , nutritional interventions associated with changes in lifestyle are recognized as important strategies for primary prevention of hypertension and are auxiliary to pharmacological therapies to reduce cardiovascular risk . epidemiological evidences suggest that vegetable consumption reduces bp and risk of cvd [ 2729 ] . dash ( dietary approach to stop hypertension ) eating plan is one of the major effective strategies for prevention and nonpharmacological management of hypertension . this eating proposal highlights the importance of increasing fruit and vegetables intake , and recent research suggests that the beneficial effects of dash plan on bp are related to high inorganic nitrate content of food included in this eating plan ( e.g. , green leaves and root vegetables ) [ 32 , 33 ] . beetroots , lettuce , chard , arugula , and spinach are the vegetables containing the highest amount of nitrate , > 250 mg nitrate/100 g . beetroot is a vegetable , particularly rich in inorganic nitrate , which contains an average of 2056 mg of nitrate in a traditional cultivation . there are some studies using beetroot to test the effects of inorganic nitrate intake on bp . nitrate ( no3 ) and nitrite ( no2 ) , present in beetroot and in other food sources , were recently related to cardiovascular benefits . however , they were previously considered as toxic compounds due to the development of malignancies such as gastric cancer . therefore , strict rules regarding these inorganic anions are regulated in food and in drinking water . beetroot and other vegetables sources of nitrate contain approximately 6080% of the daily nitrate intake in the western population . nitrate content in vegetables may be influenced by factors related to the plant itself , such as variety , species , and maturity , and to the environment , such as temperature , light intensity , lack of some nutrients , and fertilizer use . international organizations indicate that the consumption of dietary nitrate is about 31 to 185 mg / day in europe and 40 to 100 mg / day in usa , and the oral bioavailability of dietary nitrate is 100% . in 1962 , world health organization ( who ) set an upper limit of nitrate consumption in food . an acceptable daily intake is 3.7 mg no3/body weight ( kg ) , which is the same value adopted by the european authority for food safety . this amount is equivalent to 300 mg / day for an adult weighing 80 kg . after intake , dietary nitrate quickly increases in plasma , in about 30 minutes , reaching its peak in 90 minutes . in contrast , nitrite levels are considerably slower in circulation , reaching their peak in 2.5 to 3 hours . most of inorganic nitrate , about 75% of absorbed nitrate , is excreted in urine and 25% of plasma nitrate is excreted in saliva [ 18 , 39 ] . the exact mechanism of salivary concentration is unknown . as a result , there is supply of substrate for nitrate reductase expressed by bacteria that colonize the dorsal surface of the tongue , resulting in reduction of nitrate to nitrite . after nitrite is then swallowed , the stomach and the acid environment reduce it to no . no and nitrite continue through the systemic circulation , and the remaining nitrite is reduced to no in high resistance vessels , promoting vasodilatation and consequently lowering bp ( figure 1 ) . both no3 and no2 from diet and via l - arginine participate in the no synthesis lately , there is a growing body of interest on the role of these two anions in biological function . the improvement in vascular dysfunction and in bp levels after dietary nitrate seems to be mediated by effects on oxidative stress and inflammation [ 42 , 43 ] . after an acute intake of beetroot juice ( 500 ml ) , it is possible to observe reduction of 10 mmhg in systolic bp ( after 2.5 h ) and reduction of 8 mmhg in diastolic bp ( after 3 h ) in healthy individuals . the decrease in bp was sustained after 24 h of juice intake . the highest reduction in bp liu et al . evaluated the effects of a meal rich in nitrate ( based on spinach consumption ) on bp and arterial stiffness in healthy individuals . two hours after a nitrate - rich meal consumption ( 220 mg nitrate ) , there was a larger artery elasticity index , lower pulse pressure , and lower systolic bp compared to the values after a standard meal , low in nitrate . recent experimental studies [ 23 , 45 , 46 ] and clinical trials have shown that nitrate dietary intakes from beetroot juice [ 18 , 47 ] , beet - enriched bread , or inorganic nitrate supplements have a protective effect against cvd because of reducing bp , platelet aggregation inhibition , and prevention of endothelial dysfunction . recently , bondonno et al . have shown that chronic ingestion of beetroot juice ( one week , 420 mg nitrate / day ) did not improve the bp control in treated hypertensive patients . in another study with overweight elderly subjects , jajja et al . showed reduction of 7 mmhg in systolic bp , after three weeks of beetroot juice intake ( 350 mg nitrate / day ) . however , when bp was evaluated for 24 hours by ambulatory blood pressure monitoring ( abpm ) , no significant changes were shown in bp levels . table 2 shows some clinical trials that evaluated the effects of nitrate intake on bp and vascular function . in fact , there is no consensus about the effects of dietary inorganic nitrates on bp and endothelial function , and their effects on cardiovascular health , despite studies with positive results . since the initial investigations in healthy volunteers , studies using inorganic nitrate and formulations with nitrate salt showed promising results reducing bp , with nitrate doses ranging from 155 to 1484 mg / day , between 1 and 15 days , with reductions of 4 mmhg in systolic bp and of 1 mmhg in diastolic bp [ 33 , 50 ] . in hypertensive patients , systolic bp remained significantly reduced in approximately 8 mmhg over 24 hours after the intervention , which is similar to the reduction provided by drug therapy ( 9 mmhg ) . this is important because the ingestion of dietary nitrate in a single dose per day may be sufficient to achieve benefits in lowering bp [ 50 , 51 ] . increasing nitrite levels by nitrate intake appears to have beneficial effects in many physiologic and clinical settings . several clinical trials are being conducted to determine the great therapeutic potential of increasing the bioavailability of nitrite in human health and disease , including studies related to vascular aging . nevertheless , there are many limitations in nitrate studies , such as the type of population enrolled in each trial and the dependent effect of the baseline bp . therefore , the effects are unlikely to be the same among healthy and hypertensive individuals . in addition , when evaluating treated hypertensive patients , use of medications , such as calcium channel antagonists , may affect endothelial function and hence can interfere in some vascular parameters . sample size is also a limiting factor considering the fact that it is small in most of nitrate studies . indeed , large clinical trials are necessary to confirm the potential beneficial effects of inorganic nitrate in patients with cvd . even with these considerations , dietary nitrate seems to represent an inexpensive and a promising complementary therapy to support hypertension treatment with benefits for cardiovascular health . | poor eating habits may represent cardiovascular risk factors since high intake of fat and saturated fatty acids contributes to dyslipidemia , obesity , diabetes mellitus , and hypertension .
thus , nutritional interventions are recognized as important strategies for primary prevention of hypertension and as adjuvants to pharmacological therapies to reduce cardiovascular risk .
the dash ( dietary approach to stop hypertension ) plan is one of the most effective strategies for the prevention and nonpharmacological management of hypertension .
the beneficial effects of dash diet on blood pressure might be related to the high inorganic nitrate content of some food products included in this meal plan .
the beetroot and other food plants considered as nitrate sources account for approximately 6080% of the daily nitrate exposure in the western population .
the increased levels of nitrite by nitrate intake seem to have beneficial effects in many of the physiological and clinical settings .
several clinical trials are being conducted to determine the broad therapeutic potential of increasing the bioavailability of nitrite in human health and disease , including studies related to vascular aging . in conclusion , the dietary inorganic nitrate seems to represent a promising complementary therapy to support hypertension treatment with benefits for cardiovascular health . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the immense and diverse potential of phthalocyanines ( pc ) in a variety of technical
( chemical sensors , liquid crystals , electrocatalysis , and nonlinear
optics ) and medicinal ( primarily photodynamic therapy [ 58 ] ) applications
has generated a great deal of interest in these macrocyclic compounds . this ,
together with the extraordinary stability of these complexes , has resulted in
considerable research being carried out on the phthalocyanine complex upon
incorporation of nearly all metals in the periodic table into the pc core . complexes
with metalloids and nonmetals of groups iva and va are of particular interest
due to the two different valence / oxidation states available to the central
atom . triazatetrabenzcorroles
( tbc ) are phthalocyanine - like compounds which have lost one of the bridging
nitrogen atoms . the
synthesis of ge , si , ga , and al tbc complexes have been reported [ 10 , 11 ] . were the first to report on the synthesis and unusual electronic spectra
of the pcp compared to pcp [ 9 , 13 ] . it became apparent
that upon complexation with the trivalent phosphorous , a bridging nitrogen was
lost to form the phosphorous oxide tetrabenzcorroles ( ptbc ) . since then , a number of octa- and
tetrasubstituted ptbc derivatives have been synthesized [ 1419 ] . high fluorescence quantum
yields and singlet oxygen quantum yields have been reported for the
complexes . the water - soluble tetrasulphonated ptbc showed good photodynamic
therapy towards hela cells . for applications in pdt , high triplet
lifetimes and yields are desired ; however there are no reports on the triplet - state
behavior of the ptbc complexes . in this
work , we report on ptbc complexes tetra- or octasubstituted with chloride and
bromide ring substituents ( see schemes 1 and 2 ) , since the halogens are expected to
enhance intersystem crossing , resulting in high triplet yields due to the heavy
atom effect . a ptbc derivative
containing a mixture of butoxy and chloro ring substituents has been reported
, but no photophysical data has been reported for halogenated ptbcs . dimethylsulfoxide
( dmso ) , methanol ( meoh ) , phosphorous tribromide ( pbr3 ) , deuterated
chloroform ( cdcl3 ) , deuterated dimethylsulfoxide ( dmso - d6 ) , deuterated pyridine
( pyr - d5 ) , 4,5
dichlorophthalonitrile , 1,8-diazabicyclo undec-7-ene ( dbu ) ,
4-nitrophthalonitrile , copper ( i ) bromide , copper ( i ) chloride , hydrobromic
acid , hydrochloric acid , palladium on carbon ( pd / c ) , and dicyanobenzene were
purchased from sigma - aldrich ( miss , usa ) and used as received . pyridine and
1-pentanol were obtained from sigma - aldrich and dried prior to use . ground - state
electronic absorption spectra were recorded on a varian cary 500 uv - vis - nir
spectrophotometer . h and c nmr spectra were obtained using
a bruker amx 400 mhz and a bruker avance ii+ 600 mhz nmr spectrometer . fluorescence emission and excitation spectra were recorded on a varian cary
eclipse spectrofluorimeter , while ft - ir spectra ( kbr pellets ) were recorded on
a perkin - elmer spectrum 2000 ft - ir spectrometer . triplet
absorption and decay kinetics were recorded on a laser flash photolysis system ,
the excitation pulses were produced by an nd : yag laser ( quanta - ray , 1.5 j/90 ns ) pumping a dye laser ( lambda physic fl 3002 , pyridin 1 in methanol ) . the
analyzing beam source was from a thermo oriel xenon arc lamp , and a
photomultiplier tube was used as detector . signals were recorded with a
two - channel digital real - time oscilloscope ( tektronix tds 360 ) where the
kinetic curves were averaged over 256 laser pulses . triplet lifetimes were
determined by exponential fitting of the kinetic curves using originpro 7.5
software . unsubstituted ptbc ( 7 ) was synthesized from unmetallated phthalocyanine ( 6 ) and pbr3 in a 16.4%
yield , and characterized as reported in the literature [ 9 , 13 , 19 ] . 4-aminophthalonitrile
( 2 ) and 4-bromophthalonitrile ( 4 ) were synthesised following literature
procedures [ 20 , 21 ] with some minor modifications . 4-chlorophthalonitrile ( 5 ) was synthesised by modifying the
procedure used for compound 4 . 4-nitrophthalonitrile(1 ) ( 1.00 g , 5.78 mmol ) was placed
in a round bottom flask and 100 ml of ethanol added to obtain a suspension . the
catalyst pd / c ( 55 mg ) was added to the flask , the apparatus evacuated and then
filled with hydrogen and the mixture vigorously stirred at room temperature
until the absorption of hydrogen had completely stopped . the reaction mixture
was subsequently filtered over celite and the solution evaporated in vacuo . h nmr ( 400 mhz , dmso - d6 ) ppm 7.39 ( dd , j = 8.66 , 1.34 hz , 1h ) , 6.93 ( d , j = 2.19 hz , 1h ) , 6.81 ( dd , j = 8.67 , 2.18 hz , 1h ) , 6.36 ( br s , 2h ) . compound 2 ( 500 mg , 3.5 mmol ) was taken up in
a mixture of water ( 4 ml ) and hydrobromic acid ( 4 ml , 48% ) and the solution
cooled to 0c using an ice - salt bath . a solution of sodium nitrite
( 276 mg , 4 mmol ) in water ( 2 ml ) was then added dropwise to the acid mixture to
form the diazonium salt 3a as an
intermediate . copper ( i ) bromide ( 1.00 g , 6.97 mmol ) was dissolved in hbr ( 4 ml , 48% ) and cooled to 0c . the cold diazonium salt solution was
then added dropwise to the cubr reagent and the solution stirred for 1 hr at 0c
after an hour , the solution was left to stand at room temperature overnight . the
aqueous solution was then extracted with ethyl acetate ( 3 15 ml ) , the
combined organic extracts washed with brine , dried over magnesium sulphate and
concentrated to give 248 mg of 4 . h nmr ( 400 mhz , cdcl3 ) ppm 7.96 ( d , j
= 1.78 hz , 1h ) , 7.89 ( dd , j = 8.37 , 1.89 hz , 1h ) , 7.68 ( d , j = 8.37 hz , 1h ) . c nmr ( 75 mhz , cdcl3 )
ppm 136.6 ( d ) , 136.3 ( d ) , 134.4 ( d ) , 128.1 ( s ) , 117.3 ( s ) , 114.7 ( s ) , 114.5
( s ) , 114.0 ( s ) . a
similar procedure to the one above was used to prepare compound 5 . compound 2 ( 500 mg , 3.5 mmol ) was dissolved in a water ( 4 ml)/hydrochloric
acid ( 5 ml , 32% ) mixture , and the sodium nitrite ( 276 mg , 4 mmol ) in water ( 2 ml ) reagent was added to the amine hydrochloride solution to form the diazonium
salt ( 3b ) . copper ( i ) chloride ( 1.00
g , 10.1 mmol ) the
diazonium salt was then added to the cucl reagent and treated in the same
manner as reported above . h nmr ( 400 mhz , cdcl3 ) ppm 7.80 ( d , j
= 1.88 hz , 1h ) , 7.75 ( s , 1h ) , 7.73 ( d , j = 1.87 hz , 1h ) . c nmr ( 75 mhz , cdcl3 )
ppm 140.2 ( s ) , 134.5 ( d ) , 133.7 ( d ) , 133.5 ( d ) , 117.4 ( s ) , 114.6 ( s ) , 114.2
( s ) , 114.1 ( s ) . complex 9 was synthesized from the
unmetallated derivative ( 8) . the first step was the synthesis of 8 ,
following established methods as follows : 4 ( 200 mg , 0.97 mmol ) was
reacted with dbu ( 0.36 ml ) in 1-pentanol under reflux for 12 hours under a
nitrogen atmosphere . the dark green mixture was cooled down to room
temperature , then methanol ( 5 ml ) and water ( 2 ml ) were added and the mixture
precipitated out and centrifuged . this green solid complex 8 , confirmed to be a phthalocyanine
molecule by its uv spectrum , was not purified any further and was
employed as is for the synthesis of complex 9 . complex 9 was synthesized by heating ( under
reflux ) a mixture of complex 8 ( 100 mg , 0.12 mmol ) and pbr3(0.34 ml , 3.60 mmol ) in pyridine at 90 to
100c for 2 hours . the reaction was then allowed to cool to room temperature
and poured carefully into water and allowed to stand overnight . the green
product obtained was then centrifuged and washed with copious amounts of water .
upon drying , the precipitate was chromatographed on a silica gel column using
pyridine as the eluant . the complex was collected as a dark green band , while
the unmetallated pc remained at the top of the column . uv / vis ( dmso ) , maxnm ( log ) ] : 662 ( 4.86 ) , 630 ( 4.56 ) , 602 ( 4.29 ) , 578 ( 3.79 ) , 448
( 5.19 ) , 439 ( 4.94 ) , 418 ( 4.70 ) . [ ( kbr ) vmax/cm ] : 3063 , 1717 , 1608 , 1506 , 1451 , 1396 ,
1326 , 1298 ( p = o ) , 1271 , 1151 , 1109 , 1077 , 1043 , 967 , 956 , 832 , 813 , 758 , 723 , 691 ,
578 . h nmr ( 600 mhz , pyr - d5 )
ppm 10.159.92 ( m , 4h ) , 9.839.57 ( m , 4h ) , 8.598.41
( m , 4h ) . p nmr ( 162 mhz , pyr - d5 )
ppm 198.6 . maldi complex 11 was synthesized as
explained above for 9 , except that complex 5 ( 200 mg , 1.23 mmol ) was reacted with dbu ( 0.24 ml ) in 1-pentanol instead of
compound 4 to obtain the 4-chloro h2pc analogue ( complex 10 ) . the presence of the metal - free pc was again confirmed by its uv spectrum . complex 10 was then employed for the synthesis of complex 11 ( 100 mg ,
0.15 mmol ) by reacting it with pbr3(0.42 ml , 4.50 mmol ) in hot
pyridine . uv / vis ( dmso ) , max/nm ( log ) ] : 661 ( 4.56 ) , 630 ( 4.26 ) , 603 ( 3.99 ) , 447 ( 4.82 ) , 438
( 4.59 ) , 417 ( 4.39 ) . [ ( kbr ) vmax/cm ] : 2922 , 1717 , 1609 , 1505 , 1456 , 1399 ,
1328 , 1297 ( p = o ) , 1143 , 1068 , 973 , 910 , 814 , 769 , 724 , 690 , 580 . h nmr ( 600 mhz , pyr - d5 ) ppm 9.979.66 ( m , 8h ) , 8.458.26 ( m , 4h ) . 682.9 , found 682.0 { cl4(tbc)p(o)}. the first step was the synthesis of metal - free complex 12 , using the same procedure as outlined above
for the synthesis of 8 , except that 4,5-dichlorophthalonitrile ( 300 mg 1.53 mmol ) was reacted with dbu ( 0.12 ml ) instead of complex 4 . confirmation of the formation of the h2pc ( 12 ) was provided by the uv spectrum . complex 13 was then
synthesized as described for complexes 9 and 11 using 12 ( 100 mg , 0.128 mmol ) and pbr3 ( 0.36 ml , 3.84 mmol ) . a paucity of proton
signals was expected and observed in the h nmr spectrum of this octasubstituted
complex . uv / vis ( dmso ) , max/nm ( log ) ] : 667 ( 3.47 ) , 635 ( 3.19 ) , 606 ( 2.94 ) , 452 ( 3.83 ) , 442
( 3.61 ) , 422 ( 3.46 ) , 411 ( 3.42 ) . [ ( kbr ) vmax/cm ] : 2927 , 1726 , 1586 , 1521 , 1349 ,
1298 ( p = o ) , 1248 , 1197 , 1138 , 948 , 908 , 837 , 743 , 602 . h nmr ( 600 mhz , pyr - d5 ) ppm 8.07 ( m , 8h ) . maldi m / z : not observed . the
comparative method was used to determine the fluorescence quantum yields ( f ) according to the following
equation , utilizing unsubstituted znpc in dmso as the standard ( f = 0.18 ) :
( 1)f=f(std ) f astd 2fstd a std2 ,
where f and fstd
are the areas under the fluorescence curve of the
sample and the standard , respectively . similarly , a and astd
are
the absorbance of the compound and the standard at the excitation wavelength ,
and std are the refractive indices of solvents used for the sample
and the standard , respectively . natural or radiative
lifetimes ( n )
were estimated using photochemcad program which uses the strickler - berg
equation . the fluorescence lifetimes ( f ) were evaluated using the following equation :
( 2)f=fn . the rate constants for intersystem crossing from the excited singlet state to the triplet state ( kisc(st ) ) were estimated using the following equation :
( 3)kisc(st)=(1/f)(1/f0 ) ,
where f and f
are the excited
singlet - state lifetimes for the halogenated derivatives and unsubstituted ptbc ,
respectively . similarly , the rate
constants for intersystem crossing from the triplet state to the ground state
( kisc(ts ) ) were estimated using the following equation :
( 4)kisc(ts)=(1/t)(1/t0 ) ,
where t and t0 are the excited
triplet - state lifetime for the halogenated derivatives and unsubstituted ptbc ,
respectively . solutions of the ptbc complexes were bubbled with argon in a 1 cm
pathlength spectrophotometric cell , irradiated at the q band of the respective ptbc complexes , with the triplet quantum yields ( t )
determined by the triplet absorption method . the comparative method was applied
as in the following equation , using znpc in dmso as the standard :
( 5)t=tstdat tstdatstd t . changes
in the triplet - state absorbances of the ptbc derivative and the standard are
represented by at and atstd , respectively ; while t and tstd are the triplet - state
molar extinction coefficients for the ptbc derivative and the standard , respectively ;
while tstd is the triplet quantum
yield for the standard ( t = 0.65 for znpc in dmso ) . triplet
lifetimes ( t ) were determined by
exponential fitting of the kinetic curves using originpro 7.5 software . quantum
yields of internal conversion ( ic ) were obtained from the following
equation , which assumes that only three processes ( fluorescence , intersystem
crossing , and internal conversion ) jointly deactivate the excited singlet state
of ptbc derivatives :
( 6)ic=1(f+t ) . 2(3 ) , 9(10 ) , 16(17 ) , 23(24)-tetrasubstituted
phthalocyanines can be synthesized from 4-substituted phthalonitriles ,
while octasubstituted phthalocyanines can be synthesized from
4,5-dichlorophthalonitrile . in the case of tetrasubstituted derivatives , a
mixture of four possible structural isomers are obtained , which can be designated
by their molecular symmetry as c4h , c2 , cs , and
d2h .
in
this study , synthesized tetrasubstituted a variety of halogenated phosphorous
oxide triazatetrabenzcorroles ( complexes 9 , 11 , and 13 ) were
prepared by treatment of unmetallated phthalocyanines with pbr3 in
pyridine according to literature procedures . the products thus obtained
were then subjected to silica gel column chromatography using pyridine as an
eluant . generally ,
phthalocyanine complexes are insoluble in most organic solvents ; however
introduction of substituents to the ring increases the solubility . the
halogenated complexes ( particularly 9 and 11 ) exhibited excellent solubility in organic solvents
such as pyridine and dmso . for comparative purposes , the unsubstituted ptbc was
synthesized and found to be soluble in dmso , but only sparingly in pyridine . the new
compounds were characterized by uv - vis , ir , mass , and nmr spectroscopies
( including p nmr ) and the analyses were consistent with the
predicted structures as shown in section 2 .
however , mass spectral data proved to be difficult to obtain for complex 13 . the p = o vibrations were observed at ~1295 cm(in accordance
with ) in the ir spectra , confirming the presence of o coordinated to the phosphorous
atom . this was corroborated by the p nmr shifts obtained , that is ,
~ 198 ppm , which is typical of a p = o bond . h nmr
investigations of 9 and 11 gave the characteristic
chemical shifts , with three proton signals integrating for a total of 12 for each
complex . for complex 13 ,
a multiplet due to the nonperipheral protons , was observed in the h
nmr spectrum . tbc complexes have
distinct uv - vis spectra with a sharp peak at ~450 nm [ 1619 ] , which can be
employed in their characterization . the
formation of the tbc complexes occurs when the mpc molecules no longer retains
a pc moiety as they no longer have the fourth azomethine nitrogen ( see schemes 1 and 2 ) . it is believed that in the presence of excess metal halide , the bridge
nitrogen of the pc is eliminated , forming tbc . in this study , the unmetallated pc derivatives
( 8 ,
10 and 12 ) were formed first ,
which , upon reaction with pbr3 , resulted in the formation of ptbc
derivatives . this was judged spectroscopically by the collapse of the sharp q
band in the visible region of unmetallated pcs to three bands ( in the q band
region ) , together with the formation of the sharp soret band at 440 nm ( see figure 1 ) . the spectra of unmetallated pcs 6 , 8 , 10 , and 12 in dmso and pyridine
showed a single q band ( see figure 1 ) which is uncharacteristic of unmetallated
pcs .
typically , unmetallated pcs show a split q band due to lack of
symmetry . solvation in polar aprotic
solvents ( such as dmso and pyridine ) occurs through their unshared
electrons . thus , in dmso ( see figure 1 )
and pyridine , the spectra of 8 , 10 , and 12 did not show the normal splitting of the q
band that is typical of free - base phthalocyanines , showing instead a single
sharp q band . the nonsplit q band is a
result of the basicity of the
solvents . it has been documented that in
strongly basic solvents , the inner pyrrole hydrogens are acidic enough to
dissociate resulting in a charged system ( pc ) which becomes
symmetric and thus possesses an unsplit q band . figure 2 compares the
spectra of the complexes synthesized in this work , while table 1 lists the q
and b band maxima . it is clear in table 1 and figure 2 that the presence of
bromines and chlorines shifts the spectra to the red region . the
red shift of spectra on halogenation has been observed before for znpc
derivatives . aggregation in
phthalocyanines and related complexes is usually depicted as a coplanar
association of rings progressing from monomer to dimer and higher - order
complexes . it is dependent upon the concentration of the complex , the nature of
the solvent , as well as the nature of the substituents and the complexed metal
ions . in this study , the aggregation behavior of the tbc complexes ( 7 , 9 , 11 , and 13 ) was investigated in dmso ( see figure 3 ) . the complexes did not
show aggregation at concentrations less than 8 10 mol dm . the shapes of the excitation spectra for the tbc
complexes were similar to the absorption spectra ( see figure 4 ) . however , these
spectra were not mirror images of the fluorescence spectra for the ptbc
derivatives , in that the emission spectra showed only a single band , while the
q band of the absorption spectra has a split q band . the observation of a single - emission
band in the q band region is typical of unsymmetric phthalocyanine complexes such as
unmetallated derivatives [ 3133 ] . metal - free pcs are known to fluoresce with
only one main peak in
non - aqueous media which has been assigned as the 00 transition of the
fluorescence . the emission spectra were slightly
red - shifted with stokes shifts ranging from 5 to 9 nm , suggesting no change in
nuclear configurations following excitation . the largest shifts were observed for the
pocltbc ( 13 ) and ptbrtbc ( 9 ) , while the smallest shift was
observed for the ptbc derivative ( 7 ) . the fluorescence quantum yields ( f ) of the ptbc
derivatives are given in table 2 . these values are much lower than reported for
mpc complexes , except for the unsubstituted ptbc complex , which gives f values in the range for
mpc complexes . the low values obtained for the halogenated derivatives are
most likely due to the heavy atom effect of the halide functional group , which
encourages intersystem crossing to the triplet state . halogenation of znpc
has been reported to give a remarkable decrease in fluorescence quantum yields
and lifetimes , since incorporation of a halogen into the photosensitizer
increases the level spin - orbit coupling . fluorescence lifetimes ( f , table 3 ) were calculated using
the strickler - berg equation . using this
equation , a good correlation has been found between
experimentally and theoretically determined lifetimes for the unaggregated
molecules as found in this work . thus , we believe that the values obtained
using this equation are a good measure of fluorescence lifetimes . halogenation
is expected to decrease fluorescence quantum yields and lifetimes , increase
triplet - state formation , and shorten triplet lifetime . thus , as expected , the f values of the halogenated
derivatives were lower
than for unsubstituted ptbc and lower than generally observed for mpc complexes . octasubstitution with
chlorines increased the f values compared to tetrasubstituted derivatives when comparing complexes 11 and 13 . it is also interesting to note that a decrease in fluorescence
lifetime was observed upon contraction of the ring in tin tetrasulphonated ,,-tetrabenzcorroles
compared to tin tetrasulphonated phthalocyanines
. the acquisition of f values allowed us to determine the
rate constants for various processes . the rate constant for fluorescence ( kf ) ,
table 3 , was highest for complex 9 ,
which also had the lowest triplet quantum yield as will be discussed below . likewise ,
the rate constants for intersystem crossing from the singlet state to the
triplet state ( kisc ( st ) ) was the highest for complex 9 , table 3 . the transient absorption
spectra were recorded in argon - degassed solutions by exciting the
photosensitizer ( in dmso ) in the q band region and recording the transient absorption
spectra point by point from 400 to 750 nm ( see figure 5 ) . the
q and the soret bands showed a negative absorption ( bleaching ) and the
transient spectra showed a broad positive absorption ~500 nm ( see figure 5 ) . the triplet lifetimes for
the ptbc derivatives , ranging from 256 to 1740 microseconds , are listed in table 2 . the latter value
was observed for the unsubstituted ptbc ( table 2 ) and it is an unusually high
triplet lifetime . values in the millisecond range have been reported
for alpc derivatives , however they are still not as high as the value observed
here for unsubstituted ptbc . the
presence of the halogens was expected to lower the triplet lifetimes ( when
compared to unhalogenated ptbc ( 7 ) ) , as
observed in table 2 ; with the octasubstituted complex , 13 , giving the lowest triplet lifetime . contrary to the heavy atom effect , which results in the decrease in triplet lifetimes
with an increase in the size of the halogen , this work shows an increase
in lifetime on going from the chlorinated ( 11 )
to brominated ( 9 ) ptbc derivatives , with
the octachlorinated ( 13 ) complex showing
the lowest triplet lifetime . the latter
( 13 ) could have a lower triplet
lifetime than the tetrachlorinated derivative ( 11 )
due to the plurality of chlorine atoms and the heavy atom effect . we have recently
shown that upon contraction of the ring in tin tetrasulphonated ,,-tetrabenzcorrole compared to tin tetrasulphonated
phthalocyanine , there was a decrease in t values and the triplet lifetimes . however , the lifetimes reported here for ptbc derivatives are high compared to
mpc complexes in general . in general , there is an
increase in t values upon halogenation with a striking exception of the brominated complex ( 9 ) . the octachlorinated derivatives ( 13 ) gave the highest triplet quantum
yield ( t ) ,
while surprisingly the bromo substituted
complex 9 gave the lowest value . the t value for 9 is almost ten - fold lower
than for 11 . again , the larger value of t for 13 could be due to the plurality of chlorines and the heavy atom
effect . the low t value for the brominated
derivative compared to the chlorinated one contradicts the heavy atom effect . the
increased t value for the chlorinated derivatives 11 and 13 compared to 9 will result in shorter triplet
lifetime for the former , and this is the case in table 2 . quantum yields of
internal conversion ( ic )
were calculated using ( 6 ) and are high
due to low t values . using the triplet lifetimes , the rate constants for intersystem
crossing from the triplet state to the ground state ( kisc ( ts ) ) were
determined and are shown in table 3 . the lowest ( kisc ( ts ) ) value obtained is for complex 9 ( table 3 ) yet this complex has the
lowest triplet quantum yield . in conclusion , we have
synthesized halogenated ptbc derivatives ( complexes 9 , 11 , and 13 ) and
compared their photophysical data with that of the unsubstituted ptbc complex .
the latter complex shows a very high triplet lifetime value , higher than that for
mpc complexes . complexes 11 and 13 show reasonably
high triplet lifetimes and yields , making them possible candidates for pdt . complex 9 having bromine substituents showed
a behavior different from the other halogenated complexes ( 11 and 13 ) in that it
gave a very low triplet quantum yield . | the synthesis of phosphorous oxide triazatetrabenzcorroles ( tbc ) tetra- ( 9 , 11 ) or octa- ( 13 )
substituted on the ring with halogenated functional groups is reported .
the complexes are not aggregated
in dimethylsulfoxide ( dmso ) and show solubility in solvents such as pyridine . the q
band absorption spectra
of the complexes are red - shifted compared to unsubstituted ptbc .
the latter complex shows a large triplet
lifetime ( 1.7 milliseconds ) , higher than for mpc derivatives .
the chlorinated derivatives show good triplet
yields ( t 0.46 and 0.36 ) and relatively long lifetimes ( 256 and 452 microseconds ) , respectively , for 11 and 13 . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
medical practitioners commonly advice their patients who are on antiplatelet therapy to either stop or alter their medications prior to surgical procedures due to fear of excessive and uncontrolled bleeding . it is a proven fact that aspirin causes increased risk of intraoperative as well as postoperative bleeding and also increased risk of thromboembolic events such as myocardial infraction and cerebrovascular accidents if the drug is continued . thrombotic and thromboembolic occlusion of blood vessels is the main cause of ischemic events in heart , lungs , and brain . in case of blood vessel injury , primary mechanism arrests early bleeding as a result of platelet plug formation . the secondary hemostasis phase is mediated by a complex cascade of clotting factors which helps in the formation of fibrin clot . in recent years , lot of research has been done and progress has been made in the field of antiplatelet agents and anticoagulants . even though a number of antiplatelet and anticoagulant agents have been developed , aspirin and warfarin remain the standard drugs of choice . development of aspirin dates back to 1897 and is considered as one of the safest and cheapest drugs worldwide . a general practitioner lawrence craven prescribed low - dose aspirin ( baby aspirin ) to his 400 patients and none of them developed myocardial infraction . this was probably the first time in medical history where aspirin was used to prevent myocardial infarction . the antithrombotic effect of aspirin is mediated by irreversible inhibition of cyclooxygenase activity in platelets . thromboxane a2 is a potent platelet stimulant which leads to degranulation of platelet and platelet aggregation . aspirin inhibits cyclooxygenase enzyme and decreases the level of platelet stimulant thromboxane a2 , thus increasing the bleeding time . this is the important reason for a medical practitioner to stop aspirin 3 - 7 days prior to any invasive surgery . the purpose of this study was to investigate the influence of aspirin on post - extraction bleeding . patients who were on aspirin therapy , aged between 50 and 65 years , and who had to undergo tooth extraction for endodontic reason with no mobility were selected for the study . patients on warfarin , non - steroidal anti - inflammatory drugs , heparin , steroids , or suffering from blood disorders and diabetes were excluded from the study . informed consent was obtained from the patients and the ethical committee clearance was also obtained . two hundred patients including both males and females whose teeth were indicated for extraction were included in the study . group a patients continued to receive aspirin preoperatively , while group b patients were asked to stop aspirin 7 days prior to extraction after consultation with the physician . bleeding time ( white and lee technique ) and clotting time ( ivy 's technique ) were calculated . after atraumatic extraction ( forceps method ) was performed , the bleeding time was recorded . chi - square test was used to evaluate the relative frequencies of patients in both groups . after applying chi - square test , the mean bleeding time was calculated as 2.1 0.52 min in the patients who discontinued baby aspirin ( group b ) 7 days prior to extraction . bleeding time of group a patients who continued aspirin through the entire study was found to be 3.8 0.75 min . this difference was statistically significant ( p = 0.002 ) [ table 1 and graph 1 ] . although there was significant increase in the bleeding time of group a patients , it should be noted that the bleeding time of both the groups was within normal limits . clotting time of group b patients was 3.8 0.75 min and group a patients was 4.7 0.52 min , which were also within the normal limits ( normal range according to ivy 's method : 3 - 5 min ) . mean bleeding time and mean clotting time ( in minutes ) of group a and group b patients historically , aspirin was used as an anti - inflammatory , analgesic , and antipyretic drug for a short period of disease activity . in 1950 , lawrence craven reported for the first time its long - term use to prevent myocardial infarction . antiplatelet activity of aspirin occurs at doses ranging from as low as 40 mg / day to 320 mg / day . doses above 320 mg / day decrease the effectiveness of aspirin as an antiplatelet agent due to inhibition of prostacyclin production . however , recent clinical trial indicates that 160 mg / day is optimal for antiplatelet action . in emergencies where urgent antithrombotic action is required , a loading dose of 300 mg is advocated . usually , in the united states , daily dose of 81 mg , 160 mg , or 325 mg is prescribed , while in europe and other countries , daily dose of 75 mg , 150 mg , or 300 mg is prescribed . risk of continuing aspirin therapy prior to surgery is that with the alteration of platelet function , longer time period is required to stop bleeding from a surgical site . collet et al . stated that in patients on aspirin , the average risk of bleeding increases 1.5-fold . at the same time , there is a risk of stopping aspirin prior to surgery , which leads to a potential risk of rebound of thromboembolic vascular events . on stopping aspirin , thromboxane a2 activity increases to a greater extent with decrease in fibrinolytic activity . anderson et al . showed the existence of biological platelet rebound phenomenon on interruption of aspirin therapy . approximately 20% of these episodes are fatal and another 40% can lead to permanent disability . practitioners who advocate the stoppage of aspirin have been debating among themselves regarding the time limit to stop aspirin . according to literature the effect lasts for 7 - 10 days which is the life span of platelets . sonksen et al . , in their study comprising 52 healthy individuals , reported that it is not recommended to withdraw aspirin for more than 5 days . wahl et al . advocated that aspirin should be discontinued for 3 days only , as after 3 days of interruption of aspirin , sufficient number of newer platelets would be present in the circulation for hemostasis . some studies have shown that there is always an increased risk of bleeding in patients continuing aspirin . however , if the aspirin therapy is discontinued , there is increased risk of thromboembolic events which can be fatal , but none of these have been reported in dental literature . mentioned in their article that there is scarcity of literature regarding dental surgeries involving patients on aspirin medication . little et al . reported that unless the bleeding time is increased above 20 min , aspirin - affected platelets would not cause significant bleeding complication . canigral et al . conducted a research involving surgical extraction in patients on antithrombotic therapy . in 92% cases , gaspar et al . advocated that ambulatory oral surgical procedures can be performed in patients without discontinuing the use of aspirin . a recent recommendation from the american heart association and american college of cardiology is either continuing aspirin or clopidogrel therapy for minor oral surgical procedures in patients with coronary artery stents or delay the treatment until prescribed regimen is complicated . the present study demonstrated that there was significant increase in the bleeding time in both the groups , but it was not difficult to stop the bleeding in any case . although the bleeding time increased in group a patients , it still remained within the normal range , regardless of whether the patients continued or discontinued their aspirin therapy . conducted a study with 17 patients randomized to aspirin and 19 to placebo and found no differences in the bleeding outcomes for patients on aspirin . this finding suggested that there was no need to discontinue aspirin prior to any ambulatory oral surgical procedure . adchariyapetch compared the postoperative bleeding in subjects who stopped taking aspirin and those who continued taking aspirin for 7 days prior to extraction . matocha concluded in his study that the risk of bleeding after dental extraction is minimal in the patients with aspirin therapy and did not exceed 0.2 - 2.3% murphy et al . concluded in their survey that 86% of the dental practitioners who advised patients to stop taking antiplatelet drugs prior to dental extraction did so with the consultation of the patients physicians , and found that the protocol followed by the physicians and dentists was not based on the current recommendations and guidelines . concluded that the risk of stopping antiplatelet therapy and predisposing the patient to thromboembolic events overweighed the minimal risk of bleeding from dental procedures . wahl reported in his study that of 950 patients receiving anticoagulation therapy , only 12 required ( < 1.3% ) more than local measures to stop the bleeding . he concluded that while discontinuation of anticoagulation therapy has been a common practice , bleeding after dental surgery is rarely life threatening . thus , it can be concluded based on dental and medical literature that if a practitioner wishes to discontinue the aspirin therapy , it should not exceed more than 3 days . risk of stopping antiplatelet therapy and predisposing the patient to thromboembolic events overweighs the minimal risk of bleeding from dental procedures . although there was increase in bleeding time in the present study , it was not beyond the normal range . hence , it can be concluded that low dose of aspirin should not be discontinued prior to dental extractions , as it predisposes the patient to unwanted thromboembolic events . | aim : the aim of the study was to evaluate the influence of aspirin on post - extraction bleeding in a clinical setup.materials and methods : two hundred patients aged between 50 and 65 years who were indicated for dental extraction for endodontic reason were selected from the outpatient department of oral and maxillofacial surgery .
the patients were randomly divided into aspirin continuing group ( group a ) and aspirin discontinuing group ( group b ) . after checking all the vital signs ,
the extractions were carried out .
bleeding time and clotting time were recorded for evaluation by chi - square test.results:chi-square test revealed that the bleeding time increased ( 3.8 0.75 ) in group a patients continued with the aspirin therapy where as group b discontinued aspirin .
similarly , the clotting time increased in group b patients and decreased in group a patients .
but in both the groups , bleeding and clotting time remained within normal limits.conclusion:reviewing most of the dental and medical literature , it can be concluded that there is absolutely no need to discontinue antiplatelet therapy for any ambulatory dental procedure , and even if the practitioner wishes to discontinue , it should not be for more than 3 daaq2ys .
this is also stated in the guidelines of the american heart association . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the foundations of lifelong responsibility for the maintenance of personal hygiene are laid down in childhood , which is important for a healthy childhood , for a healthy adulthood and for the development of positive values about health and the use of health services . poor health among school children is resulted from the lack of awareness of the health benefits of personal hygiene . diarrhoeal diseases , skin diseases , worm infestations and dental diseases are most commonly associated with poor personal hygiene . the primary causes of infections are contaminated water and poor sanitation , as well as poor hygienic practices . lack of personal hygiene coupled with poor sanitation favor person - to - person transmission of infection . repeated attacks of infections often compound the existing poor health of children , compromising children 's attendance and performance at school and not uncommonly , can result in death . the condition may even be worse in a slum community with poor socio - economic condition and compromised living situation . the origins of many of the illnesses of adulthood also have their roots in the health behaviors of childhood and adolescence . however , majority of the childhood illnesses are preventable by promotion of hygienic practices among school children through proper health education by their parents and teachers . children in their primary schooling age can learn specific health - promoting behaviors , even if they do not fully understand the connections between illness and behavior . the present inadequate knowledge base hinders the development of improved strategies for enhancing the maintenance of personal hygiene , which is of great importance to decrease the burden of communicable diseases in the developing countries . with the above background , this study was undertaken with the following objectives : to find out the knowledge and practice of personal hygiene among the primary school children living in a slum area ; to identify misconceptions among the study population regarding the maintenance of personal hygiene , if any ; to find out the morbidity pattern of the study population ; to elicit the relationship between practice of personal hygiene among the primary school children and the literacy status of their mother . one purposively selected primary school situated in a slum under the service area of urban health center , chetla , kolkata , india . all primary school children in grades i to v from the selected school , where the students come mainly from the neighboring slum locality . study tool . the questionnaire was drawn up in english , translated in bengali ( local language ) and back translated in english to check the translation . before starting of the study , pre - testing of the questionnaire was done in a different school situated in the same slum locality and accordingly necessary modifications were made and this was finalized . the selected school was visited on a pre - assigned day of each week and one grade was covered every week . the students from each grade who were absent on the specific day of the study were excluded . thus , after excluding 21 absentees , a total of 104 students were finally included in the study . good rapport was built up with the students and informed verbal consent was obtained from them and one of their parents . briefing was done regarding the questionnaire provided to the students and they were asked to mark the responses . the questionnaire consisted of socio - demographic information , e.g. age , grade , sex , religion , literacy status of both mother and father , questions regarding knowledge and practice of personal hygiene , any misconception regarding personal hygiene , and lastly any illness over last 15 days among the primary school children . the questionnaire covered the following indicators of personal hygiene , i.e. combing hair , studying under adequate light , brushing teeth , washing mouth after eating , washing hands before eating , washing hands after visiting toilet , trimming nails , taking bath daily , wearing shoes and wearing clean clothes . each student was also observed thoroughly to assess their status of personal hygiene , i.e. cleanliness of clothes , condition ( clean and trimmed ) of fingernails and toenails , cleanliness of teeth , condition ( clean and combed ) of hair , presence of shoes , etc . it was found that the observations were consistent with the responses of the students regarding personal hygiene practices . the morbidities listed in the questionnaire were fever with or without cough / cold , diarrhoea , passage of worms in stool , head lice , dental caries , scabies and multiple boils . the students were also examined clinically ( general and systemic examinations ) for the presence of signs of any illness , mainly to correlate with their reported illnesses . at the end of the study , the parents were given information about their children 's status of personal hygiene and related health condition and suggested to contact the urban health center if needed . a brief health education session was also conducted for the class teachers , students and their parents after completion of the study . data obtained were collated and analyzed statistically by simple proportions and tests of significance ( z - test and chi - square test ) , as and when necessary . this study shows that the age of primary school children ranged from 5 to 14 years , maximum number ( 84 ) of students ( 80.77% ) being between 7 to 12 years . among 104 students , male and female students were 43 ( 41.35% ) and 61 ( 58.65% ) , respectively . maximum students ( 76 ) were hindus ( 73.08% ) and rests ( 28 ) were muslims ( 26.92% ) . estimates of maternal and paternal literacy were 31.73% ( 33 out of 104 mothers ) and 69.23% ( 72 out of 104 fathers ) , respectively . regarding practices of personal hygiene among primary school children , a score = 0 corresponded to " never practicing / incorrect practice " ; a score = 1 , to " sometimes practicing " ; and a score = 2 , to " practicing most of the times / regularly " . therefore , overall , the maximum and minimum possible scores , based on 10 indicators of personal hygiene as considered in this study , were 20 and 0 , respectively . poor score was considered to be a score < 8 ( i.e. < 40% ) , and other scores categorized were good score 8 - 12 ( i.e. 40 - 60% ) , very good score 13 - 15 ( i.e. 65 - 75% ) and excellent score 16 - 20 ( i.e. 80 - 100% ) . table i shows that 21 ( 48.84% ) male and 28 ( 45.9% ) female students obtained good scores . likewise , 39 ( 51.32% ) hindu and 10 ( 35.71% ) muslim students obtained good scores . the difference between the average scores of male and female students , as well as that of hindu and muslim students were not significant statistically . distribution of students according to practice and knowledge of personal hygiene ( n = 104 ) . figures in the parentheses indicate percentages ; z - tests were done between the respective average scores . a score = 0 corresponded to " do n't know / incorrect knowledge " ; and a score = 1 , to " correct knowledge " . therefore , overall , the maximum and minimum possible scores were 10 and 0 , respectively . poor score was considered to be a score < 4 ( i.e. < 40% ) , and other scores categorized were good score 4 - 6 ( i.e. 40 - 60% ) and very good / excellent score 7 - 10 ( i.e. 70 - 100% ) . it was found that 28 ( 65.12% ) male and 50 ( 81.97% ) female students obtained good scores . the average score obtained by the female students was significantly higher than that of the male students ( p < 0.05 ) . equal proportion ( 75% each ) of hindu ( 57 ) and muslim ( 21 ) students obtained good scores . table ii shows that the proportion of primary school children having correct practices regarding combing hair , studying under adequate light , brushing teeth , washing hands before eating and trimming nails was significantly lower compared to the proportion of primary school children having correct knowledge on each of these indicators ( 48.08% vs. 74.04% , 8.65% vs. 40.38% , 50% vs. 65.38% , 84.62% vs. 96.15% , and 76.92% vs. 98.08% , respectively ) . regarding wearing shoes , the proportion of primary school children having correct practice was significantly higher than the proportion of primary school children having correct knowledge ( 55.77% vs. 25% ) . distribution of students according to correct practice and correct knowledge of personal hygiene ( n = 104 ) . figures in the parentheses indicate percentages ; the proportions of primary school children having misconceptions regarding studying under adequate light ( 59.62% or 62 students ) , wearing shoes ( 75% or 78 students ) and wearing clean clothes ( 85.58% or 89 students ) were much more than the proportions of primary school children having misconceptions on other indicators of personal hygiene ( ranged from 0.96% to 13.46% , or 1 to 14 students ) ( tab . iii ) . distribution of students having misconceptions regarding personal hygiene ( n = 104 ) . almost three - fourth of the primary school children ( 74.04% or 77 students ) were suffering from one or more morbidities related to poor personal hygiene . the most common morbidity reported by them was diarrhoea ( 56.73% or 59 students ) , followed by fever with or without cough / cold ( 54.81% or 57 students ) , passage of worms in stool ( 45.19% or 47 students ) , head lice ( 40.38% or 42 students ) , scabies ( 39.42% or 41 students ) , dental caries ( 9.62% or 10 students ) and multiple boils ( 7.69% or 8 students ) ( tab . distribution of students according to morbidities related to poor personal hygiene ( n = 104 ) . among 71 primary school children with illiterate mothers , 18 students ( 25.35% ) obtained poor score for practices of personal hygiene , whereas 42 students ( 59.15% ) obtained good score and 11 students ( 15.50% ) obtained very good score . among 33 primary school children with maternal education primary and above , only one student obtained poor score , whereas 7 students ( 21.21% ) obtained good score and 16 students ( 48.48% ) obtained very good score . nine primary school children obtained excellent score and their mothers had middle school education and above . statistically significant association was observed between practices of personal hygiene among primary school children and literacy status of their mother ( p < 0.001 ) ( tab . v ) . distribution of students according to practice of personal hygiene and literacy status of mother ( n = 104 ) . figures in the parentheses indicate percentages ; illiterate : those who can not read or write ; primary : grade i to iv . chi - square test was applied after classifying literacy status of mother as illiterate and literate ( with education primary and above ) , and practice of personal hygiene as poor , good and very good / excellent . the children of today will be the adults of tomorrow . by focusing on children today , by giving them tools and knowledge to change behavior , future generations can be stronger and healthier . in the present study , it has been observed that the female students obtained significantly higher average score than the male students regarding the knowledge of personal hygiene . this study shows that 98 ( 94.23% ) primary school children washed their hands after visiting toilet and 88 ( 84.62% ) washed their hands before eating . also , 50 ( 48.08% ) primary school children combed their hair , 52 ( 50% ) brushed their teeth , 80 ( 76.92% ) trimmed their nails , 44 ( 42.31% ) took daily bath , 58 ( 55.77% ) wore shoes and only 13 ( 12.5% ) wore clean clothes . these observations clearly indicate that hygienic practices for all the indicators of personal hygiene were not adequate among the study population . a study conducted in philippines ( 1996 ) indicated that 71.4% school children washed their hands after using toilet and 75.9% washed their hands before eating . also , 65.2% school children took daily bath and 63.8% wore slippers and shoes most of the time . ( 2006 ) among tribal school children in india reported that only 27.6% students ( 6 - 14 years ) had clean and combed hair , 29.7% had clean and cut nails , 42.8% wore clean clothes and 33.8% had clean teeth before implementing the school health education program . ( 2007 ) in rural india documented that 63.6% school going children ( 6 - 14 years ) had practice of hand washing with soap after defecation and 67.8% had clean and cut nails before initiating hygiene education . a study done in rural ethiopia by vivas et al . ( 2010 ) shows that 99% of primary school children ( mean age 10.8 years ) washed their hands before meals , whereas only 15% washed their hands after defecation on the day prior to the interview . therefore , the present study and similar studies from the developing countries show that the practices of personal hygiene are not satisfactory among primary school children in the developing world . the present study also shows that there was a wide gap between practice and knowledge regarding most of the indicators of personal hygiene . this finding corroborates with the study done in philippines ( 1996 ) , as well as with a study by oyibo ( 2012 ) done in nigeria among school children aged 6 - 14 years . it is quite expected that a lesser percentage of students having correct knowledge will be able to translate their knowledge into practice . this has been observed clearly in the present study , and this observation supports the principle of health education that knowledge does not necessarily lead to practice . in addition , lack of proper resources , i.e. soap and water , as well as inadequate sanitation facilities in a slum community with low socio- economic condition may negatively affect personal hygiene practices . moreover , it has been observed that a good fraction of students have adopted to the right practices regarding some of the indicators , e.g. wearing shoes , without having correct knowledge on it . even , misconceptions regarding the maintenance of personal hygiene were not uncommon among the primary school children , as observed in this study . this indicates that enhancement of knowledge is necessary , and the depth to which the knowledge is imparted to the students is not adequate . this calls for immediate attention of measures so that the knowledge is enhanced , as well the depth of knowledge is increased among primary school children . in this regard , the school teachers , parents and other family members could play a vital role . even , children can also be the agents of change subsequently by spreading what they have learned in school to their family and community members . in this connection , the total sanitation campaign ( tsc ) as launched by government of india in 1999 worth acknowledgement . the tsc gave emphasis on personal hygiene , home sanitation , safe water , garbage disposal and wastewater disposal . it emphasized more on health education , human resource development , and capacity development activities to increase awareness and sanitation demand . the tsc also laid strong focus on school sanitation and hygiene promotion . among the main objectives of the tsc , accelerating sanitation coverage and promoting hygiene behavior among students and teachers are worth mentioning . in this study , almost 75% of the primary school children were suffering from one or more morbidities related to poor personal hygiene . the most common morbidity reported by them was diarrhoea ( 56.73% ) , followed by fever with or without cough / cold ( 54.81% ) , passage of worms in stool ( 45.19% ) , head lice ( 40.38% ) , scabies ( 39.42% ) , dental caries ( 9.62% ) and multiple boils ( 7.69% ) . ( 2006 ) among tribal school children in india , where 56.6% students had diarrhoea , fever and upper rti ( respiratory tract infections ) , followed by head lice ( 42.8% ) , scabies ( 36.6% ) , multiple boils ( 8.9% ) , dental caries ( 8.3% ) and history of worm infestation ( 28.9% ) before implementing the school health education program . in the present study , more than half of the primary school children ( 59.15% ) with illiterate mothers obtained good score , followed by poor score ( 25.35% ) . whereas , almost half of the primary school children ( 48.48% ) with maternal education primary and above obtained very good score . nine primary school children ( 8.65% ) obtained excellent score and their mothers had middle school education and above . only one primary school children ( out of 33 ) with maternal education primary and above obtained poor score , whereas no primary school children ( out of 71 ) with illiterate mother obtained excellent score . statistically significant association was observed between practices of personal hygiene among primary school children and literacy status of their mother ( p < 0.001 ) . in this connection , it can be said that maternal education can play a vital role in the practices of hygiene and health among their children . as an illiterate or uneducated mother may be less knowledgeable about teaching her children proper personal hygiene practices . so , continuing health education program directed to the parents with a special emphasis on their role to improve the health habits of their children may hold promise . second , the nutritional status of the children was not studied , which might be related to the state of personal hygiene as well as related morbidities . no attempt was made to perform any laboratory test , e.g. stool examination for parasites to detect the presence of any parasitic infection . this study was undertaken among the primary school children in a slum area of kolkata , india . the findings of the study might not corroborate with similar studies from non - slum areas of kolkata , as the low socio - economic condition and the compromised living situation in a slum community along with inadequate primary health care services do not allow its people to adopt proper hygienic behavior and to observe good health . it can be concluded from the present study that knowledge and practice of personal hygiene among the primary school children in a slum area of kolkata , india is not satisfactory . although , female students appear to be more knowledgeable than the male students . sadly , knowledge and practice on all the indicators of personal hygiene are not commensurate and they are not equally good on all the indicators of personal hygiene among the primary school children . students with poor hygienic practices mostly suffer from diarrhoea , fever with or without cough / cold , passage of worms in stool , head lice , scabies , dental caries and multiple boils . therefore , there is an immediate need for enhancement of knowledge among the primary school children , where teachers and parents can play a pivotal role . schoolbased health education program may be a useful effort in this regard . in this connection , the role of parent - teacher associations in all the schools should be emphasized . maternal education appears to have a direct relation with the practices of personal hygiene among the primary school children . in this regard , not only the formal education , but continuing health education program of the parents by health workers , television and other medias may also hold promise . not only that , infrastructural development for proper maintenance of personal hygiene along with financial upliftment of the parents may go a long way so far educating the students and providing them with necessary resources and facilities are concerned . ngo ( non - governmental organizations ) collaboration may also prove to be effective in achieving these goals . | summaryintroduction and objectives.for children , maintenance of personal hygiene helps to improve the quality of life and longevity .
this is of particular importance in a slum community with compromised living situation .
this study was undertaken to find out the knowledge and practice of personal hygiene among the primary school children living in a slum area , to identify any misconception among them regarding the maintenance of personal hygiene , to find out their morbidity pattern , and also to elicit the relationship between practice of personal hygiene among the children and the literacy status of their mother.methods.a cross - sectional observational study was conducted among 104 primary school children of a primary school situated in the slum area of chetla , kolkata , india with the help of a predesigned , pre - tested and structured questionnaire .
data were analyzed statistically by simple proportions and tests of significance.results.it was found that the female students were more knowledgeable than the male students regarding the maintenance of personal hygiene . there was a wide gap between practice and knowledge of personal hygiene among the primary school children living in the slum area .
even , misconceptions do exist on certain indicators of personal hygiene among the students .
statistically significant association was observed between practices of personal hygiene among the primary school children and the literacy status of their mother.discussion and conclusions.future of a society depends considerably on the health of its children . the parents and the school teachers , as constructive shapers of children 's health behaviors , should play a responsible role in early education of children on personal hygiene . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
with the introduction of newer drugs to treat various skeletal disorders , the adverse effects of these drugs are also challenging to deal with . they are synthetic analogous of pyrophosphate , a natural regulator of bone metabolism found in bone matrix . they inhibit the differentiation of osteoclastic precursors , induce apoptosis of osteoclasts and stimulate release of osteoclastic inhibitory factors to osteoblasts . besides they interfere with cellular metabolism through adenosine triphosphate ( atp ) analogous . despite the various benefits , bp - related osteoradionecrosis of the jaws ( bronj ) these days , oral bps like alendronate are usually prescribed to treat osteoporosis and intravenous bps are extensively used to treat osteolytic bone lesions related to multiple myeloma and bone metastasis of solid cancer , breast cancer or prostate cancer . the initial appearance of the disease is variable and thus , it often comes to the attention of the clinician late , when it has become symptomatic . the goal of this paper is to improve the clinicians understanding of bronj by presentation of a classic case and highlighting current concepts and preventive strategies . a 62-year - old , average built , male with average nutrition status of middle income group reported to oral and maxillofacial surgery clinic with complaint of swelling over left lower jaw since 4 months [ figure 1 ] . the symptoms were acute which subsequently became chronic with foul smelling discharge with a cutaneous fistula and numbness over left lower lip for last 3 months . extraoral initial examination showed moderate edema of the left face his past medical history was significant for multiple myeloma diagnosed 3 years back for which he underwent chemotherapy ( 26 cycles ) and was on monthly doses of zometa . past dental history revealed that he underwent sequestrectomy on the left alveolus 1 year back . the local examination revealed he was partially edentulous with dehiscence in the alveolar mucosa in left body of mandible and exposure of bone looking yellowish - white in the posterior mandibular region [ figure 2 ] . there was mild purulent discharge from the intraoral wound and cutaneous fistula , which was sent for culture sensitivity test . the cultures revealed presence of staphylococcus aureus , moderate growth of streptococcus viridans , gram - negative rods and gram - positive cocci . exposed necrotic bone on left posterior body of mandible orthopantogram showed diffuse osteolytic lesions and erosion of left side body of mandible involving both buccal and lingual cortical plates [ figure 3 ] . the routine hemogram was not very significant except raised erythrocyte sedimentation rate ( esr ) which was- 86 mm first hour . the scintigraphy which is a definite diagnostic tool for osteomyelitis could not be done because of nonavailability . panoramic radiograph showing the diffuse osteolytic lesions and erosions on left posterior body of mandible fine needle aspiration ( fna ) was performed and pieces of bone were sent for histopathology to rule out multiple myeloma lesions . the fna revealed inflammatory cells - predominantly atypical lymphocytes and neutrophils - and also was positive for actinomyces . histopathologically there was anastomizing lamellar bony trabeculae and inflammatory cell infiltration comprising of lymphocytes , plasma cells and histiocytes with congested blood vessels suggestive of chronic osteomyelitis [ figure 4 ] . ( h&e stain , 100 ) correlating history , clinical evaluation and investigations , diagnosis of bronj was derived and sequestrectomy with aggressive debridement under antibiotic coverage was done . as bronj is fairly a new entity in the dental and medical literature , definition by the american association of oral and maxillofacial surgeons ( aaoms ) is used to make the diagnosis . patient may be considered to have bronj if all the following three characteristics are present :
current or previous treatment with bpsexposed bone in the maxillofacial region that has persisted for more than 8 weeks andno history of radiation therapy to jaw . current or previous treatment with bps exposed bone in the maxillofacial region that has persisted for more than 8 weeks and no history of radiation therapy to jaw . in general , intravenous bps shows higher incidence of bronj ( 0.8 - 12% ) as compared to oral forms ( 0.01 - 0.04% ) . intravenous preparation used in treatment of metastatic disease irreversibly inhibit osteoclasts via interrupting the mevalonate pathway and the resulting toxicity causes osteoclast apoptosis . bps are thought to concentrate in jaws owing to greater degree of vascularization and daily remodeling that occurs around periodontal ligament of the teeth . in the present case , patient had history of intravenous nitrogen bps ( zoledronic acid ) for 3 years after being diagnosed of multiple myeloma and presented with swelling and exposed non vital bone in left alveolus region with purulent discharge for past 4 months . in order to direct rational treatment guidelines , the aaoms proposes use of the staging categories and their respective treatments as outlined in table 1 . staging of osteoradionecrosis the patient described was classified to be in stage ii and histology revealed chronic osteomyelitis . given the many unknowns associated with bronj , it would seem prudent to develop a coordinated pretreatment and intratreatment protocol aimed at prevention and patient education . preventative strategies such as establishment of meticulous oral hygiene regimes in conjunction with timely surgical procedures should be undertaken prior to commencing therapy . during therapy , strict review and maintenance of oral hygiene programs it is critical that the dentist and oncologist should be aware of this significant complication which can occur spontaneously or after any dentoalveolar procedure in the population receiving bps and further investigation is needed to completely elucidate this phenomenon . | bisphosphonates ( bps ) are a class of agents used to treat osteoporosis and malignant bone metastasis . despite these benefits , osteonecrosis of the jaws has recently emerged as a significant complication in a subset of patients receiving these drugs.this case presentation focuses on a 62-year - old man with a 3-year history of monthly use of zometa ( zolendronic acid ) for treatment of multiple myeloma , resulting in bp - related osteoradionecrosis of the jaws ( bronj ) .
this new entity remains a challenge with diagnosis as well as treatment .
the goal of this paper is to improve clinicians understanding and provide a guideline for establishing a stage - specific diagnosis and prevention of bronj . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
to present a rare case of retinal pigment epithelium ( rpe ) rupture following yag laser posterior capsulotomy ( yag pc ) in a patient with exudative age - related macular degeneration ( amd ) . an 85-year - old pseudophakic male patient on ranibizumab 0.5 mg/0.05 ml treatment due to exudative amd received yag pc for dense posterior capsule opacification ( pco ) in his right eye . the patient had received his last intravitreal ranibizumab injection 3 months before yag pc ; his macula appeared stable on fundoscopy and optical coherence tomography scans at repeated visits , but his vision deteriorated to counting fingers due to pco . following left eye posterior yag pc , his best - corrected visual acuity ( bcva ) improved to 6/12 ( snellen chart ) . despite satisfactory visual results , the patient developed a parafoveal inferotemporal rpe rupture . a decision for further treatment with ranibizumab ( 0.5 mg/0.05 ml ) intravitreal injections was made . after a total of 7 injections , rpe rupture is a well - known , serious complication in patients with exudative amd , which often has devastating results on patients vision . offering yag pc to those patients could lead to a rupture of the rpe even in cases which appear to be stable and well controlled . rupture of the retinal pigment epithelium ( rpe ) is a well - known complication of exudative age - related macular degeneration ( amd ) . for several decades , the characteristics and prevalence of rpe ruptures have been puzzling ophthalmologists . in 1981 , hoskin et al . had already documented that the ripping of the rpe is a reasonably common complication in patients with rpe detachment and separation of the rpe from its basement membrane , while more recently the height of the rpe detachment and also its features have been implicated as predictive factors for possible rupture . in october 2010 , an 85-year - old male patient presented at the macular clinic with symptoms of metamorphopsia and deterioration of vision in the right eye . the patient was pseudophakic bilaterally and had undergone uncomplicated cataract surgeries almost 1 year before his first visit to the macular clinic . moderate posterior subcapsular opacification ( pco ) was detected in the right eye and minimal pco was seen in the fellow eye as well . on presentation , his best - corrected visual acuity ( bcva ) on a snellen chart was 6/36 in the right eye and 6/9 in the left . clinical examination and ancillary imaging testing by means of fundus fluorescein angiogram and optical coherence tomography ( oct ) led to the diagnosis of exudative amd and the presence of an active vascularized pigment epithelial detachment ( ped ) with an occult choroidal neovascular membrane ( cnvm ) in the right eye and dry amd in the left eye . the patient was offered the standard treatment of 3 monthly intravitreal ranibizumab ( 0.5 mg in 0.05 ml ) injections . following the initial loading dose of ranibizumab , the appearance of the macula on oct improved significantly , but the persisting subretinal fluid on the oct scans led to the decision to offer 2 further intravitreal injections to the patient . following the fifth injection , the disease appeared to go into remission and there was no evidence of fresh bleeding or subretinal fluid in fundoscopy or oct , and only a shallow ped remained ( fig . 1 ) . unfortunately , the patient 's bcva in the right eye deteriorated further to counting fingers due to pco . with the patient stable in repeated monthly visits over a period of 3 months and with no signs of reactivation of the cnvm such as new subretinal fluid or new bleeding , a decision was made to offer the patient yag laser posterior capsulotomy ( yag pc ) for his pco . following yag pc with 20 shots of power between 1.8 and 2.5 mj , the patient 's bcva in the right eye improved dramatically to 6/12 ( snellen chart ) . however , a parafoveal inferotemporal rpe tear with significant bleeding was evident on fundoscopy ( fig . a clinical decision to offer two more ranibizumab ( 0.5 mg in 0.05 ml ) injections in the right eye was made based on oct findings of subretinal fluid and fundoscopy . after the additional 2 injections , and a total of 7 , the patient was clinically stable and his bcva in the right eye remained at 6/18 ( snellen chart ) over a period of 6 months following the rpe tear . the fellow eye also remained clinically stable with a bcva of 6/9 ( snellen chart ) ( fig . 3 ) . in this patient 's last clinic appointment though , some increase of subretinal fluid at the area of the tear , without affecting his bcva , led to the clinical decision of offering 1 more ranibizumab injection . the patient gave his informed consent for all material and medical records presented in this case report . tears of the rpe in patients suffering from exudative amd are a well - known , serious complication which can have a devastating effect on vision . although the overall incidence of rpe tears in large multicenter studies remains relatively low , ranging from 1.6 to 3.0% , there are some characteristics that could help recognize high - risk patients . the incidence of rpe tears seems to be significantly higher amongst patients with large and irregular fibrovascular ped , especially if there is a small ratio of cnvm size to ped size ( < 50% ) [ 2 , 4 ] , and in this subgroup of amd patients rpe tears could affect up to 16.8% . also , tears of the rpe tend to occur much more frequently in patients with occult subfoveal cnvm . furthermore , a strong positive correlation has been documented between the preinjection height of the vascularized ped and the possibility of an rpe tear . chan et al . demonstrated that a ped height of more than 400 m is a significant risk factor , predisposing to rpe tears , especially following intravitreal injections of anti - vegf agents . regarding the possible adverse effect of the anti - vegf injections in the development of rpe tears , current data describe a low risk of such a possibility , and if a tear of the rpe is to occur , it will do so within the first 18 weeks from initiation of treatment probably due to other predisposing factors rather than as an effect of treatment [ 3 , 5 , 6 ] . in our case , the patient had a fibrovascular ped with a preinjection height of less than 400 m . he appeared to respond very well to the ranibizumab ( 0.5 mg in 0.05 ml ) intravitreal injections , and he remained stable without development of new subretinal fluid or bleeding for 3 months following the last injection prior to the yag pc . pco in this patient progressed significantly during the course of treatment and further follow - up , to a point that it was becoming increasingly difficult to clinically assess to patient . unfortunately , despite significant improvement in vision after the yag pc , the patient developed a tear of the rpe . to the best of our knowledge , this is the first case of such a complication of yag pc in the literature . further injections of ranibizumab ( 0.5 mg in 0.05 ml ) managed to confine the adverse results of the rpe tear and preserve a reasonable bcva in the patient 's right eye , as has been suggested elsewhere in the literature . we strongly believe the risk of an rpe tear has to be taken into account when the decision for yag pc is made in patients suffering from amd and on anti - vegf treatment . it is unknown if precautions such as low power and few shots , together with a long period of the disease in remission are of any benefit to the patient undergoing this procedure . the decision to treat should be based on the patient 's clinical condition and the degree of pco . when vision is poor due to primarily dense pco , treatment should be offered ; however , the possibility of an rpe tear should be taken into consideration . | purposeto present a rare case of retinal pigment epithelium ( rpe ) rupture following yag laser posterior capsulotomy ( yag pc ) in a patient with exudative age - related macular degeneration ( amd).materials and methodsan 85-year - old pseudophakic male patient on ranibizumab 0.5 mg/0.05 ml treatment due to exudative amd received yag pc for dense posterior capsule opacification ( pco ) in his right eye . the patient had received his last intravitreal ranibizumab injection 3 months before yag pc ; his macula appeared stable on fundoscopy and optical coherence tomography scans at repeated visits , but his vision deteriorated to counting fingers due to pco.resultsfollowing left eye posterior yag pc , his best - corrected visual acuity ( bcva ) improved to 6/12 ( snellen chart ) . despite satisfactory visual results , the patient developed a parafoveal inferotemporal rpe rupture
.
a decision for further treatment with ranibizumab ( 0.5 mg/0.05 ml ) intravitreal injections was made .
after a total of 7 injections , the patient was clinically stable and his bcva was 6/18 ( snellen chart).conclusionsrpe rupture is a well - known , serious complication in patients with exudative amd , which often has devastating results on patients vision .
offering yag pc to those patients could lead to a rupture of the rpe even in cases which appear to be stable and well controlled .
clinicians should be aware of this complication and inform the patients accordingly . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
primary health care ( phc ) in the islamic republic of iran has experienced three 12-year periods : the first twelve years , i.e. 1972 through 1983 , gaining experiences and period and development of the program , the second 12-year period , i.e. 1984 through1995 , quantitative and qualitative development of the health care network , and during the third one ( 1996 - 2008 ) , the country has witnessed efforts for effecting fundamental reforms in the health care networks which despite its gradual speed , is so important . generally , the importance of human resources management ( hrm ) to the success or failure of health system performance has , until recently , been generally overlooked . in recent years , it has been increasingly recognized that getting hr policy and management right has to be at the core of any sustainable solution to health system performance . today , there is a growing interest in the psychosocial work environment of health care staff since they are at high risk for burnout , role conflict and job dissatisfaction . from many accounts healthcare professionals professional burnout is generally described as prolonged stress that impairs one 's ability to perform his or her job in demanding situations ; because they are exposed to psychological , emotional , and also physical stress . the previous studies generally have been reviewed the job stressors , psychological - behavioral responses to the job stress , organizational support and practices , physical and psychological responses to work , patient relationships and other job content , and other external factors in the nurses . a few studies have been done about factors associated with the burnout and burnout dimensions in the physicians and health workers . very limited studies in the world and iran also have been done about job satisfaction , job stress , and affecting factors on the burnout and its consequences in the primary health staff . according to the recent studies , there are too many limitations and high pressures which indicated the high risk of job stress for the employees in the position of the community health care . furthermore , the frequency , intensity and the effect of job stress in the occurrence of various dimensions of job stress and depression have been studied and reviewed largely on the nurses and in a relatively lower rate on the physicians and health workers . the present study aimed to describe and interpret the experiences of the employees , such as family physician , midwives , and health workers , from their own working condition in the rural health centers three decades after their vast and valuable activities using qualitative approach . the present study conducted in a qualitative research approach and content analysis method through individual and group interviews with 26 employed primary health care providers ( including 7 family physicians , 7 midwives and 12 health workers ) in the rural health centers in isfahan from october 2008 through september 2010 . the inclusion criteria were having at least one year experience and providing full - time services in the health houses and health centers . in order to collect the data , the participants were invited to form the focus group meeting after obtaining permission from the deputy vice chancellor research and cooperation with health deputy of isfahan university of medical sciences and providing introduction letter to provincial health center . explanation and justification about the aims of study was clearly stated and written consent form was received from the participants . the in - depth and semi - structured interviews -suitable for the qualitative studies- conducted in individual and group interviews using open ended questions . analyzing the data was done using content analysis method . then , in order for inductive analysis , organizing data was done using open coding process , creating subcategories and categories and abstraction . in this study , each one of the interviews formed the study analysis unit . the interviews divided into semantic units and then the semantic units were compressed and summarized . the summarized semantic units had been more abstracted and were converted to the codes . at the time of compressing and coding the semantic units , temporary categories were discussed and revised by the researchers . at the end , the basic and infrastructure meaning i.e. the hidden content in the categories were regulated in the form of six themes and these themes ultimately were put into the overall and central theme of the burnout which indicated the main theme and substantial data . trustworthiness of the data was analyzed through revising by the participants and reviewing by the non - participants . credibility of the findings and data quality coverage was evaluated by the categories through showing quotations method from the written text and also searching the coincidence and agreement between other researchers , experts , and the participants . verifiability and auditing the data was done through description of full details of analysis process and obtaining the results so that the readers could have a clear understanding of done analysis method , its strengths , and limitations . conformability or authentication had been strengthened by offering rich and strong results along with appropriate quotations and peer review debriefing by some of the professors and other people who were experienced in qualitative researches . participants profile based on profession , age , sex , work experience and marital status in the first step of the content analysis from analysis of the data obtained from individual interviews and focus group , 991 codes , 55 subcategory , and 21 categories were obtained . in the second step the mentioned themes indicated a main and more important theme called burnout , which are as the following : six central themes associated with the burnout frequent ( and often unexpected ) changes in type of the services and instability in definition of the target population and recipients of the services following the new programs and instructions which every day are sent from the higher centers and authorities with no clear purpose , cause instability , turbulence , and tiredness in the health care providers : in my opinion , changes should be purposeful . it means , in every system , we naturally need changes because the system needs improvement . our processes should be improved too , but these changes are not purposeful[d2 c28 ] ; the number of offices have increased dramatically with too many changes which are not really helpful for people and health . some of them expressed dissatisfaction from lack of awareness from their future obligations and tasks , being unimportant in the system and not being the consultant party to determine the type of the reforms and its procedure as an executor and also a beneficiary person : that means some unnecessary tasks . we really have no idea about what we are supposed to do tomorrow[d2 c314 ] ; they never ask about our opinions in any tasks [ b11 c227 ] . the physicians expressed their dissatisfaction from the coverage population instability and their increase ; the midwives from the frequency of the covered villages and providing services to other villages with unfamiliar people ; and mid - wives and health workers dissatisfied from providing service to the high risk afghan population . the care providers complained about multiple , inappropriate , hindrance and non - beneficial regulations , and had an unpleasant feeling and experience toward them : they waste our useful time and this is the same for doctors and midwives too . we suggested several times , a doctor and a midwife should be incharge and assistants can have a time out , but no one paid attention and the system did nt accept [ d6 c57 ] . they also complained about rigid and inflexible regulations and laws , hindrance instructions and inconsistent laws to the community conditions : in the present situation , the physicians are evaluated based on the statistics and the recorded issues due to the little flexibility of the system . one of the most important factors for their dissatisfaction was increasing their working hours regardless of the actual needs of the people , because all those hours were in the afternoon which was non - beneficial and boring:our work time is too long . we are too exhausted to get home at 5:00 [ b4 c24 ] . unbalanced workload and manpower caused stress and pressure on the care providers due to high population coverage and lack of sufficient manpower : there is too much work and it is too diverse too [ b4 c266 ] ; every year and even everyday , they increase the responsibilities of the health workers [ b3 c28 ] . all of them complained about high number of the clients and providing service to the high population in a limited time : i think each of us should visit at least about 50 or 60 patients , but i think it is not practically possible [ d7 c2 ] . all of them , particularly the health workers , expressed dissatisfaction from paperwork and spending so much time to register the services . they believed so much registration of the cases was one of the time consuming and useless factors in addition to reduction of the care time , failure in the services quality , waiting of the customers and making frequent mistakes : these days our job is just a kind of bureaucracy [ b8 c107 ] . some of them were dissatisfied from repeated and parallel services in the form of new services : another problem is that we have a series of parallel tasks . i say that i had already filled out the health case of this woman why should i do that in a form of professional health care again [ d2 c312 ] . job stress and the current psychological pressures in the work were experienced by all of them and highly affected them : we need our psychological health too . sense of frustration in the duties and unfinished services was one of the most common issues of the provided services , so that all of them expressed dissatisfaction and severe pressure from lack of enough time due to plurality and diversity of the tasks : how much energy does a health worker have ? [ b9 c189 ] ; there are a lot of expectations from family doctors[d7 c24 ] . we do nt have enough time to do all the tasks furthermore , interference of the heterogeneous tasks and also conflict between roles and tasks had caused disorder and confusion in implementing the tasks and also created many problems for them which consequently caused severe work pressure and dissatisfaction in them : because of too much work and different tasks that needs to be done and because of too many patients that we have , we have no time to educate people as we should do [ d6 c5 ] . the participants expressed this feeling due to impossibility of the scientific promotion , lack of suitable conditions to update scientific information , lack of opportunity for acquiring new skills , and lack of opportunity for independent decision - making : according to the project of family doctor , there would be no opportunities for doctors scientific improvement the health workers were worried about lack of the opportunity to promote scientific level and acquiring scientific capabilities and physicians discomfort from lack of enough time to study and access to update scientific resources and references : during the recent years , i really had no time to study at nights , therefore , i had to use my previous knowledge [ d2 c337 ] ; it 's true that one person is doing too many tasks , but maybe he did nt realize some of them completely most of the time in visiting a patient , i should be really careful to diagnose the sickness [ d1 c21 ] . the majority of the care providers expressed dissatisfaction from information resources , improper evaluation methods , underestimation and quantitative attitude in the system , number of the monitoring and observers , unfair judgment of the observers , and ultimately improper evaluation of the feedback . this event , in many of them was manifested as low self - feeling , defenseless , and depressed which were appeared as negative worthlessness feeling , insignificance , and unimportance : the health workers are under too much pressure[b9-c174 ] ; in my opinion , in this system , doctors have no good social level[d5 c31 ] ; in some cases , they really scorned us[b11 the defenseless feeling had been created due to negative experience of the authorities hearken and lack of right to protest : whenever we complain , they say you should nt have chosen this major they were also dissatisfied from focusing on the written evaluation and reports without regard to the quality of the provided work : they they would never accept our performance , even if we had already done that , unless we record our work.[d7 the second analysis and comparison of the mentioned six themes indicated that those themes showed a more inner and more abstract feeling in the participants toward the working condition which was the very burnout . so that the themes of instability , pressure , threat , frustration , deprivation and worthlessness along with emotional exhaustion and depersonalization in all the care providers , and individual failure of the health workers , lack of motivation in the work and extreme fatigue all indicated the inner feeling and event , general and more important called burnout : we are really frustrated with no motivation in our job [ b8 c103 ] . the feeling of individual failure was evident in the health workers and they had experienced all the dimensions of the burnout : there is no internal satisfaction either [ b11 c71 ] . frequent ( and often unexpected ) changes in type of the services and instability in definition of the target population and recipients of the services following the new programs and instructions which every day are sent from the higher centers and authorities with no clear purpose , cause instability , turbulence , and tiredness in the health care providers : in my opinion , changes should be purposeful . it means , in every system , we naturally need changes because the system needs improvement . our processes should be improved too , but these changes are not purposeful[d2 c28 ] ; the number of offices have increased dramatically with too many changes which are not really helpful for people and health . some of them expressed dissatisfaction from lack of awareness from their future obligations and tasks , being unimportant in the system and not being the consultant party to determine the type of the reforms and its procedure as an executor and also a beneficiary person : that means some unnecessary tasks . we really have no idea about what we are supposed to do tomorrow[d2 c314 ] ; they never ask about our opinions in any tasks [ b11 c227 ] . the physicians expressed their dissatisfaction from the coverage population instability and their increase ; the midwives from the frequency of the covered villages and providing services to other villages with unfamiliar people ; and mid - wives and health workers dissatisfied from providing service to the high risk afghan population . the care providers complained about multiple , inappropriate , hindrance and non - beneficial regulations , and had an unpleasant feeling and experience toward them : they waste our useful time and this is the same for doctors and midwives too . we suggested several times , a doctor and a midwife should be incharge and assistants can have a time out , but no one paid attention and the system did nt accept [ d6 c57 ] . they also complained about rigid and inflexible regulations and laws , hindrance instructions and inconsistent laws to the community conditions : in the present situation , the physicians are evaluated based on the statistics and the recorded issues due to the little flexibility of the system . one of the most important factors for their dissatisfaction was increasing their working hours regardless of the actual needs of the people , because all those hours were in the afternoon which was non - beneficial and boring:our work time is too long . we are too exhausted to get home at 5:00 [ b4 c24 ] . unbalanced workload and manpower caused stress and pressure on the care providers due to high population coverage and lack of sufficient manpower : there is too much work and it is too diverse too [ b4 c266 ] ; every year and even everyday , they increase the responsibilities of the health workers [ b3 c28 ] . all of them complained about high number of the clients and providing service to the high population in a limited time : i think each of us should visit at least about 50 or 60 patients , but i think it is not practically possible [ d7 c2 ] . all of them , particularly the health workers , expressed dissatisfaction from paperwork and spending so much time to register the services . they believed so much registration of the cases was one of the time consuming and useless factors in addition to reduction of the care time , failure in the services quality , waiting of the customers and making frequent mistakes : these days our job is just a kind of bureaucracy [ b8 c107 ] . some of them were dissatisfied from repeated and parallel services in the form of new services : another problem is that we have a series of parallel tasks . i say that i had already filled out the health case of this woman why should i do that in a form of professional health care again [ d2 c312 ] . job stress and the current psychological pressures in the work were experienced by all of them and highly affected them : we need our psychological health too . sense of frustration in the duties and unfinished services was one of the most common issues of the provided services , so that all of them expressed dissatisfaction and severe pressure from lack of enough time due to plurality and diversity of the tasks : how much energy does a health worker have ? [ b9 c189 ] ; there are a lot of expectations from family doctors[d7 c24 ] . we do nt have enough time to do all the tasks [ d7 c33 ] . furthermore , interference of the heterogeneous tasks and also conflict between roles and tasks had caused disorder and confusion in implementing the tasks and also created many problems for them which consequently caused severe work pressure and dissatisfaction in them : because of too much work and different tasks that needs to be done and because of too many patients that we have , we have no time to educate people as we should do [ d6 c5 ] . the participants expressed this feeling due to impossibility of the scientific promotion , lack of suitable conditions to update scientific information , lack of opportunity for acquiring new skills , and lack of opportunity for independent decision - making : according to the project of family doctor , there would be no opportunities for doctors scientific improvement the health workers were worried about lack of the opportunity to promote scientific level and acquiring scientific capabilities and physicians discomfort from lack of enough time to study and access to update scientific resources and references : during the recent years , i really had no time to study at nights , therefore , i had to use my previous knowledge [ d2 c337 ] ; it 's true that one person is doing too many tasks , but maybe he did nt realize some of them completely [ b1 c90 ] ; most of the time in visiting a patient , i should be really careful to diagnose the sickness [ d1 c21 ] . the majority of the care providers expressed dissatisfaction from information resources , improper evaluation methods , underestimation and quantitative attitude in the system , number of the monitoring and observers , unfair judgment of the observers , and ultimately improper evaluation of the feedback . low self - feeling , defenseless , and depressed which were appeared as negative worthlessness feeling , insignificance , and unimportance : the health workers are under too much pressure[b9-c174 ] ; in my opinion , in this system , doctors have no good social level[d5 c31 ] ; in some cases , they really scorned us[b11 the defenseless feeling had been created due to negative experience of the authorities hearken and lack of right to protest : whenever we complain , they say you should nt have chosen this major they were also dissatisfied from focusing on the written evaluation and reports without regard to the quality of the provided work : they they would never accept our performance , even if we had already done that , unless we record our work.[d7 the second analysis and comparison of the mentioned six themes indicated that those themes showed a more inner and more abstract feeling in the participants toward the working condition which was the very burnout . so that the themes of instability , pressure , threat , frustration , deprivation and worthlessness along with emotional exhaustion and depersonalization in all the care providers , and individual failure of the health workers , lack of motivation in the work and extreme fatigue all indicated the inner feeling and event , general and more important called burnout : we are really frustrated with no motivation in our job [ b8 c103 ] . sometimes i wish there were no visitors when i get to work [ b2 c284 ] . the feeling of individual failure was evident in the health workers and they had experienced all the dimensions of the burnout : there is no internal satisfaction either [ b11 c71 ] . frequent ( and often unexpected ) changes in type of the services and instability in definition of the target population and recipients of the services following the new programs and instructions which every day are sent from the higher centers and authorities with no clear purpose , cause instability , turbulence , and tiredness in the health care providers : in my opinion , changes should be purposeful . it means , in every system , we naturally need changes because the system needs improvement . our processes should be improved too , but these changes are not purposeful[d2 c28 ] ; the number of offices have increased dramatically with too many changes which are not really helpful for people and health . some of them expressed dissatisfaction from lack of awareness from their future obligations and tasks , being unimportant in the system and not being the consultant party to determine the type of the reforms and its procedure as an executor and also a beneficiary person : that means some unnecessary tasks . we really have no idea about what we are supposed to do tomorrow[d2 c314 ] ; they never ask about our opinions in any tasks [ b11 c227 ] . the physicians expressed their dissatisfaction from the coverage population instability and their increase ; the midwives from the frequency of the covered villages and providing services to other villages with unfamiliar people ; and mid - wives and health workers dissatisfied from providing service to the high risk afghan population . the care providers complained about multiple , inappropriate , hindrance and non - beneficial regulations , and had an unpleasant feeling and experience toward them : they waste our useful time and this is the same for doctors and midwives too . we suggested several times , a doctor and a midwife should be incharge and assistants can have a time out , but no one paid attention and the system did nt accept [ d6 c57 ] . they also complained about rigid and inflexible regulations and laws , hindrance instructions and inconsistent laws to the community conditions : in the present situation , the physicians are evaluated based on the statistics and the recorded issues due to the little flexibility of the system . one of the most important factors for their dissatisfaction was increasing their working hours regardless of the actual needs of the people , because all those hours were in the afternoon which was non - beneficial and boring:our work time is too long . we are too exhausted to get home at 5:00 [ b4 c24 ] . unbalanced workload and manpower caused stress and pressure on the care providers due to high population coverage and lack of sufficient manpower : there is too much work and it is too diverse too [ b4 c266 ] ; every year and even everyday , they increase the responsibilities of the health workers [ b3 c28 ] . all of them complained about high number of the clients and providing service to the high population in a limited time : i think each of us should visit at least about 50 or 60 patients , but i think it is not practically possible all of them , particularly the health workers , expressed dissatisfaction from paperwork and spending so much time to register the services . they believed so much registration of the cases was one of the time consuming and useless factors in addition to reduction of the care time , failure in the services quality , waiting of the customers and making frequent mistakes : these days our job is just a kind of bureaucracy [ b8 c107 ] . some of them were dissatisfied from repeated and parallel services in the form of new services : another problem is that we have a series of parallel tasks . i say that i had already filled out the health case of this woman why should i do that in a form of professional health care again [ d2 c312 ] . job stress and the current psychological pressures in the work were experienced by all of them and highly affected them : we need our psychological health too . sense of frustration in the duties and unfinished services was one of the most common issues of the provided services , so that all of them expressed dissatisfaction and severe pressure from lack of enough time due to plurality and diversity of the tasks : how much energy does a health worker have ? [ b9 c189 ] ; there are a lot of expectations from family doctors[d7 c24 ] . we do nt have enough time to do all the tasks [ d7 c33 ] . furthermore , interference of the heterogeneous tasks and also conflict between roles and tasks had caused disorder and confusion in implementing the tasks and also created many problems for them which consequently caused severe work pressure and dissatisfaction in them : because of too much work and different tasks that needs to be done and because of too many patients that we have , we have no time to educate people as we should do [ d6 c5 ] . the participants expressed this feeling due to impossibility of the scientific promotion , lack of suitable conditions to update scientific information , lack of opportunity for acquiring new skills , and lack of opportunity for independent decision - making : according to the project of family doctor , there would be no opportunities for doctors scientific improvement the health workers were worried about lack of the opportunity to promote scientific level and acquiring scientific capabilities and physicians discomfort from lack of enough time to study and access to update scientific resources and references : during the recent years , i really had no time to study at nights , therefore , i had to use my previous knowledge [ d2 c337 ] ; it 's true that one person is doing too many tasks , but maybe he did nt realize some of them completely [ b1 c90 ] ; most of the time in visiting a patient , i should be really careful to diagnose the sickness [ d1 c21 ] . the majority of the care providers expressed dissatisfaction from information resources , improper evaluation methods , underestimation and quantitative attitude in the system , number of the monitoring and observers , unfair judgment of the observers , and ultimately improper evaluation of the feedback . this event , in many of them was manifested as low self - feeling , defenseless , and depressed which were appeared as negative worthlessness feeling , insignificance , and unimportance : the health workers are under too much pressure[b9-c174 ] ; in my opinion , in this system , doctors have no good social level[d5 c31 ] ; in some cases , they really scorned us[b11 the defenseless feeling had been created due to negative experience of the authorities hearken and lack of right to protest : whenever we complain , they say you should nt have chosen this major they were also dissatisfied from focusing on the written evaluation and reports without regard to the quality of the provided work : they they would never accept our performance , even if we had already done that , unless we record our work.[d7 the second analysis and comparison of the mentioned six themes indicated that those themes showed a more inner and more abstract feeling in the participants toward the working condition which was the very burnout . so that the themes of instability , pressure , threat , frustration , deprivation and worthlessness along with emotional exhaustion and depersonalization in all the care providers , and individual failure of the health workers , lack of motivation in the work and extreme fatigue all indicated the inner feeling and event , general and more important called burnout : we are really frustrated with no motivation in our job [ b8 c103 ] . sometimes i wish there were no visitors when i get to work [ b2 c284 ] . the feeling of individual failure was evident in the health workers and they had experienced all the dimensions of the burnout : there is no internal satisfaction either [ b11 c71 ] . the results of this study indicated that understanding and feeling of the health care providers in the primary rural health centers were as the following : feeling instability and frequent changes with no purpose in the organization ; involved in laws and regulations ; pressure and stress due to unbalanced workload and manpower ; frustrated in performing the tasks ; deprivation of the professional development ; and sense of identity threat and low self - understanding , which these themes can represent the indices of a theme i.e. burnout . reliable sources consider burnout as a syndrome which includes exhausted , fatigue , and overworking which appear as negative attitude and feeling toward people whom work with , toward their own professional roles , and also emotional exhaustion . it also is a syndrome which includes emotional exhaustion , such as fatigue and severe emotional pressure , depersonalization , such as lack of kindness and tenderness toward others , and reduction of the adequacy feeling and personal success e.g. negative assessment from his / her potential abilities for success in the work . this syndrome may be seen more among the professions which directly deal with people than other jobs . the significant note in the study results were job stress and pressure due to frequent changes which was resulted from undesirable nature of the changes structure and not involving the care providers in decision - making about its quality and quantity had caused increase in workload , inconsistencies , and contradictions in the roles and ambiguity and amaze for the care providers and eventually predisposing the incidence of different dimensions of burnout in them . although changing is considered necessary because of the importance of dynamic health care delivery system , however , frequent changes in the services causes instability , turbulence , and turmoil in the services and leads to pressure , dissatisfaction , and finally incompetent and burnout in the care providers . in the present study , the care providers described the frequent changes and instability in the system as a useless and purposeless case . in their opinion , they did not consider the changes motion as monotonous and believed it was fast at the beginning and then gradually slow and boring and they also believed that this was the reason of previous left unfinished services and also imposing repetitive and parallel services to the system in the form of new services , besides they expressed dissatisfaction from lack of participation in decision making about the changes . glasberg et al also mentioned that one of the major sources of burnout was the frequent changes due to budget reduction and instability in the work . all the care providers were dissatisfied from notification of the rules and inflexible and inconsistent instructions with the community condition . they also complained about their useless presence in the afternoon hours and anachronistic increase of working hours . in addition , they expressed dissatisfaction from being unauthorized to plan and regulate inappropriate services to the community under its circumstances and consequently neglect the health of some of the target population groups such as men . according to the study findings of glasberg et al , one of the factors associated with emotional exhaustion in the service providers was lack of enough time for providing the required care and inability to meet the needs of others , besides , one of the factors associated with depersonalization was reduction of the desire to provide optimal services and inadequate support of the partners in addition to the above mentioned cases . according to the majority of the care providers , due to lack of balance and coordination between workload and human power and also the increase of expectation of the system from them , high workload , and increasing the frequency and variety of tasks , the services left unfinished and were not given with an optimal quality with itself caused the disability in conducting the tasks and pressure and stress in them . furthermore , increase the documentations and paperwork caused reduction of the care time , reduction in the services quality and making frequent mistakes and severe anxiety in them . the study of ahmadinia et al indicated that high workload , lack of environmental hygiene observation and commuting problem in the women health workers , insufficient salary and benefits , insufficient life facilities , housing problem and lack of vehicle in the men health workers were the affecting factors on job dissatisfaction . moreover , the health workers were unhap - py from the reaction of the observers and highranking officials . furthermore , in the study of arab , rural population size and coverage satellite villages and provide basic facilities mentioned as the affecting factors on job dissatisfaction of the health workers . the study of weymouth in australia on the employed nurses in the remote distances showed that low information , high stress , inadequate resources , and unrealistic expectations of society and managers led to high workload and the feeling of lack of being understood and support by the managers . the study of grunfeld et al in canada also indicated that increasing the workload had been the main source of job stress in nurses and had caused concern in them due to negative effects resulted from high workload and reduction of the services quality and loss their spirit . the study of gotz in germany showed that general practitioners were dissatisfied from the incoming level , working hours , and mental conditions of the work . in addition to the above mentioned cases , high workload along with the social and demographic factors as well as smoking had been found the affecting factors on physical and mental health of the physicians and nurses . multiplicity of the tasks and difference in their nature caused interference in the tasks and sometimes even conflict in playing the roles and confusion in the service providers caused many problems for them . lu et al in their study showed the organizational factors , factors related to job and patient care , ambiguity and conflict in the role , job stress and organizational commitment as related factors to job satisfaction and also willingness to keep the job . the care providers were dissatisfied from the current evaluation process and recognized resource information of the evaluators and their assessment method as an inappropriate method and believed underestimation and quantitative attitude in the system have been ruled out and judgments were unfair about the quality of their services . lack of professional development opportunities means lack of scientific promotion and lack of updating the information and the care providers complained about lack of opportunity to acquire skills and lack of enough opportunity for independent decision making . while , in the study of buciuniene on reforming in the health care system in lithuania showed that physicians had the most satisfaction from their independence level and relation with the partners and also they had quality of management . however , despite physicians satisfaction from job independency , they were dissatisfied from social status and high workload . the study of kushnir et al showed that continuing medical education had negative correlation with job stress and positive correlation with job satisfaction among the family physicians and the family physicians that had necessary opportunity and possibility for keeping the professional information updated had lower stress and burnout . the present study indicated that after emotional exhaustion with high intensity and after depersonalization with relatively more limited extent were observed in all the care providers , such as family physicians , midwives and health workers , but the important thing is that after individual failure and inability in performing the tasks with high intensity was observed only in the health workers and in addition to the inner sense in the health workers , its outer understanding was done by the physicians and mid - wives and proved this issue . severinsson in his study on burnout in the australian nurses showed that the process of high demand from the nurses caused reduction in control level of the affairs and weakness and inability feeling and led to inability to perform the tasks and job stress and physical problems , such as blood pressure , in them . the feeling of disability in the nurses was revealed in depression , frustrated , and loneliness . suspension between suffering and desire related to the nurses experience was one of the events that led to emotional and mental problems in the nurses . analyzing and discussing the above mentioned findings from the perception of the care providers from their working condition indicated that burnout was their main and central theme from understanding and experience of their working conditions . health service providers in the health centers who are the messengers and life and health guards of the people , due to stressful and challenging working condition , are being suffered from deprivation of something for which they are responsible for the society , therefore , it is worthy that in order for full effectiveness , the policy makers and managers consider the organizational factors affecting on performance method of the staff . the managers should look for the early symptoms and signs of the burnout in order for development the willingness of the employees to keep working and increase their spirit and also consider the improvement of their health and working condition which is like a container for the gift of the health . the services providers need emotional support , besides they also have the right to be principally monitored regularly and their services carefully be controlled and guided and a fair judgment should be done about their services . they should be helped so that they can realize their own capabilities and some effective measures should be done in order to eliminate the defects and solve their working problems . it should be tried to minimize the environmental stressful conditions and regulate the system 's expectations with their capabilities so that stress and pressure of the work , inability , weakness , and depression be minimized in them and subsequently the job satisfaction be increased and thus , the quality of services and health of the coverage community be improved . | objectives : health care providers in the rural centers offer the primary health services in the form of proficiencies and professions to the most required target population in the health system .
these services are provided in certain condition and population with a verity of limitations .
this study aimed to describe and interpret the experiences of the employees from their own working condition in the rural health centers.methods:the present study conducted in a qualitative research approach and content analysis method through individual and group interviews with 26 employed primary health care providers ( including 7 family physicians , 7 midwives , and 12 health workers ) in the rural health centers in isfahan in 2009 .
sampling was done using purposive sampling method .
the data were analyzed using qualitative content analysis as constant comparative basis.results:during the content analysis process , six themes were obtained ; instability and frequent changes
, involved in laws and regulations , pressure and stress due to unbalanced workload and manpower , helplessness in performing the tasks and duties , sense of identity threat and low self - concept , and deprivation of professional development .
the mentioned themes indicate a main and more important theme called
burnout.conclusions:health services providers in the rural health centers are working in stressful and challenging work conditions and are suffered from deprivation of something for which are responsible to the community . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mast cells are normal constituents of the vessel wall and are primarily located in the connective tissue matrices . increasing evidence suggests an important role for mast cells in vascular inflammation and atherosclerosis [ 14 ] , fibrosis , osteoporosis , and host defense . the adventitia of coronary arteries of patients with atherosclerotic plaques contains increased number of mast cells [ 13 , 810 ] . an increase in the number of tissue mast cells is also found to be associated with thrombus formation . mast cell granules have been identified within endothelial cells in vivo and are known to cause proliferation of human microvascular endothelial cells . furthermore , mast cell granule remnants can bind to low - density lipoproteins ( ldl ) and enhance their uptake by macrophages leading to the development of foam cells [ 13 , 14 ] . we have previously shown that granules isolated from rat peritoneal mast cells interact with human endothelial cells in culture and enhance lipopolysaccharide- ( lps- ) induced production of interleukin-6 ( il-6 ) and il-8 [ 1517 ] . these findings suggest that mast cells play an important role in endothelial cell activation and vascular inflammation . however , the interaction of human mast cells with human endothelial cells and its impact on inflammatory responses has not been evaluated . vascular endothelium regulates many aspects of the inflammatory response in addition to its well - recognized function as a protective barrier between blood and tissues . activation of endothelial cells and resultant enhancement in the production of proinflammatory cytokines , prostanoids , and the expression of adhesion molecules are critical factors for the immune response and host defense as well as for the progression of inflammatory diseases . the cascade of endothelial activation can be initiated by both endogenous agonists such as inflammatory cytokines , lipid mediators , histamine , and proteases , and by exogenous agents including microbial agents . we have shown that the cell wall components of both gram - positive and gram - negative bacteria can induce inflammatory responses in human endothelial cells [ 1518 ] suggesting an important role for infectious agents in initiating vascular inflammation . mast cells synthesize and secrete many vasoactive substances and inflammatory mediators including histamine , proteases ( tryptase , chymase , and carboxypeptidase a ) prostaglandin d2 , leukotrienes , heparin , and cytokines [ 1923 ] . the involvement of histamine in vascular disease is suggested by its elevated levels in the coronary circulation of patients with variant angina and an increased expression of histamine h1receptor ( h1r ) in atherosclerotic lesions . previous reports from our laboratory show that histamine induces the expression of cyclooxygenase-2 and il-6 mrna and the production of pgi2 , pge2 , and il-6 [ 18 , 26 , 27 ] . a number of reports have also documented the role of mast cells in the formation of foam cells [ 13 , 14 ] and calcification of plaques [ 9 , 10 ] . bone morphogenetic protein-2 ( bmp-2 ) is a key molecule in the calcification cascade and its expression in endothelial cells is induced by tnf- or by mechanical stimuli [ 28 , 29 ] . although mast cells are involved in atherosclerotic plaque development [ 9 , 10 ] , direct effect of mast cell components on the expression of bmp-2 has not been explored . therefore , the objective of the present study was to evaluate the effect of intact human mast cells and their products on the regulation of inflammatory and calcification responses in nave and lps - activated hcaec . human coronary artery endothelial cells and endothelial cell growth medium ( egm-2mv ) were obtained from cambrex ( san diego , ca ) . human mast cell line , hcaec were grown in egm-2mv containing 1 g / ml hydrocortisone acetate , 50 ng / ml gentamycin , 50 g / ml amphotericin b , and the recommended concentrations of human epidermal growth factor , vascular endothelial growth factor , human fibroblast growth factor , recombinant insulin - like growth factor-1 , ascorbic acid , and 5% fetal bovine serum as described previously [ 15 , 16 ] . at confluence , cells were detached from the culture flasks using trypsin - edta , washed twice , and resuspended in fresh egm-2mv . 5c6 cells were grown in iscove 's modified dulbecco 's medium containing 10% fbs and 50 m of 2-mercaptoethanol at 37c and 5% co2 . when applicable , mast cells were pretreated overnight with protease inhibitor cocktail ( sigma chemical co. , st . louis , mo ) containing 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride 1 mm , bestatin 40 m , e-64 14 m , leupeptin 20 m , pepstatin 15 m , and aprotinin 0.8 m . protease inhibitor - treated mast cells were incubated with hcaec and washed twice with egm-2mv . mast cells treated with egm-2mv containing 1% dmso were used as controls since dmso was used as the vehicle to resuspend the protease inhibitor cocktail . hcaec were seeded onto 96-well cell culture plate ( 1 10cells / well ) and allowed to adhere for 16 to 18 h. following adherence , endothelial cell monolayers were incubated with mast cells or lysates derived from equivalent counts of mast cells in the presence or absence of lps in a final volume of 0.2 ml at 37c under 5% humidified co2 . after the indicated incubation period , culture supernatants were harvested , appropriately diluted , and assayed for il-6 levels by elisa [ 1618 ] . hcaec monolayers were incubated with medium , histamine , cetirizine , histamine + cetirizine , or with lps ( 10 and 100 ng / ml ) for 2 h. following incubation , supernatant was removed and total rna was isolated using rneasy mini kit ( qiagen , valencia , ca ) , according to the manufacturer 's protocol . total rna ( 1 g ) was reverse transcribed into first - strand cdna using high - capacity cdna achieve kit ( applied biosystems , foster city , ca ) following the manufacturer 's procedure . the primers used for sybr green real - time rt - pcr were designed using the primer express software v3.0 ( applied biosystems , foster city , ca ) . the sequences of primers used for real - time pcr analyses of various genes are , human bmp-2 : forward- tgctagtaacttttggccatgatg ; reverse- gcgtttccgctgttt gtgtt , human actin : forward- ccagctcaccatggatgatg ; reverse- atgccggagccgttgtc . hcaec monolayers were incubated with medium , histamine , lps , or histamine + lps for 2 or 24 h. after the incubation , the supernatant was removed and the cells were sonicated in the lysis buffer containing 1% triton x100 , protease , and phosphatase inhibitors , and they were centrifuged . an aliquot of the lysate was transferred to sample wells in 10% mini - protean precast gels ( biorad , hercules , ca , usa ) . sds - page was carried out in tris - glycine buffer at 60 volts for 120 min . separated proteins were transferred to pvdf membranes by electroblotting at 90 volts for 60 min . rabbit - anti - human bmp-2 polyclonal antibody ( 1 : 500 dilution ) was used as the primary antibody ( ab-14933 , abcam , cambridge , ma , usa ) and hrp - conjugated goat - anti - rabbit antibody ( 1 : 3,000 dilution ) as the secondary antibody ( ab-6721 , abcam ) . -actin , the loading control , was detected using anti--actin ac-15 ( a5441 , sigma , 1 : 10,000 dilution ) and hrp - conjugated goat - anti - mouse igg antibody ( 1705047 , biorad , 1 : 5,000 dilution ) as the primary and secondary antibodies , respectively . confluent hcaec were cultured for 24 h in the presence or absence of hmc-1 5c6 cells at a mast cell - endothelial cell ratio of 1 : 2 . washed cells were fixed in 2% glutaraldehyde and processed for scanning electron microscopy . for transmission electron microscopy , hmc-1 5c6 cells were sedimented by centrifugation . the pellet was washed and fixed in 2% glutaraldehyde and processed at the university of kansas medical center electron microscopy core facility . student 's unpaired t - test or two - way anova were adopted for statistical analyses as applicable . in order to examine the effect of human mast cells , we compared the direct and synergistic effects of hmc-1 5c6 on il-6 production by hcaec . the effects of hmc-1 5c6 on il-6 production by unactivated or lps - treated hcaec are presented in figure 1 . however , lps stimulated the production of il-6 by hcaec in a dose - dependent manner which attained a plateau at 100 ng / ml lps . presence of hmc-1 5c6 in the coculture , at an endothelial cell : mast cell ratio of 1 : 1 resulted in a marked potentiation of lps - induced il-6 production at all concentrations of lps tested . it is of interest that mast cells alone induced a small but significant increase in il-6 production by hcaec . the amplification of lps - induced cytokine production by hmc-1 5c6 was evident at lps concentrations as low as 0.1 ng / ml and at higher doses ( 100 and 1000 ng / ml lps ) . once again , increased levels of il-6 can not be attributed to the il-6 production by hmc-1 5c6 because these cells did not generate detectable amounts of il-6 in the presence or absence of lps ( data not shown ) . as shown in figure 2 , addition of increasing counts of hmc-1 5c6 cells to a constant number of hcaec resulted in progressive increase in the production of il-6 both by unactivated and lps - stimulated cells . the potentiating effect of hmc-1 5c6 cells on lps - induced il-6 production by hcaec was linear with the number of mast cells present in the culture . the mast cell - mediated amplification of lps - induced il-6 production was approximately 300% of the control at the hcaec : mast cell ratio 1 : 1 . the ultrastructural assessment of hmc-1 5c6 cells demonstrates the presence of cytoplasmic granules ( figure 3 ) . the subclone hmc-1 5c6 ( figure 3(a ) ) exhibited several electron - dense granules ( arrows ) , indicating maturity of granules in these cells . the scanning electron microscopy following co - culture of hcaec and hmc-1 5c6 ( figure 3(b ) ) demonstrates the interaction between these two cell types in a 24 h coculture . results presented in table 1 demonstrate that coincubation of hcaec with hmc-1 5c6 cells resulted in endothelial cell activation . this finding was consistent with our previous results using rat mast cell granules ( mcg ) [ 16 , 17 ] . as expected , incubation with lps caused significant increase in il-6 production by endothelial cells . the 5c6 subclone - induced cytokine production was markedly enhanced ( 300% ) by the presence of lps ( 100 ng / ml ) indicating synergy between human mast cells and lps on endothelial cell activation . in addition , lysates of hmc-1 5c6 subclone showed synergistic effects with lps on endothelial cell il-6 production . the enhanced levels of il-6 were not derived from the mast cell lines because incubation of hmc-1 5c6 subclone with or without lps did not generate il-6 ( data not shown ) . furthermore , the mast cell lysate did not contain detectable amounts of il-6 ( table 1 ) . the effect of histamine on endothelial cells is primarily mediated through h1r [ 18 , 26 , 27 , 30 ] . therefore , to determine whether histamine derived from hmc-1 5c6 mediates the amplification of the effect of lps on hcaec , studies were conducted in the presence of 10 m diphenhydramine ( h1 receptor antagonist ) or 10 m famotidine ( h2 receptor antagonist ) . as shown in figure 4(a ) , 10 m diphenhydramine significantly inhibited the hmc-1 5c6-induced potentiation of lps effect on il-6 production . in contrast , h2 receptor antagonist , famotidine , did not inhibit the potentiating effect of mast cells on lps response ( figure 4(b ) ) . the fact that exogenous histamine ( 10 m ) was able to synergize the effect of lps on il-6 production by hcaec ( figure 5(a ) ) further confirms the role of mast cell - derived histamine ( figure 4(a ) ) . once again , the histamine - mediated amplification of lps - activation was abrogated by the h1r antagonist and not by the h2r antagonist . neither diphenhydramine nor famotidine alone had any effect on the lps - induced il-6 production by endothelial cells ( figures 4 and 5 ) . the concentrations of histamine and the receptor antagonists used here were selected based on optimum stimulatory and inhibitory effects , respectively [ 18 , 26 , 27 ] . serine proteases are present in the mast cells [ 2023 ] and are known to activate endothelial cells [ 17 , 31 ] . we determined the effect of mast cell - derived protease(s ) on the lps - stimulated production of il-6 by hcaec . first , mast cells ( mc ) were incubated with a cocktail of protease inhibitors ( pi ) for 18 h ( mc + pi ) and washed twice to remove pi . figure 4(c ) shows that addition of untreated mast cells potentiated the effect of lps as anticipated . in contrast , mast cells pretreated with protease inhibitors did not potentiate the lps - stimulated production of il-6 . interestingly , addition of 10 m diphenhydramine to pretreated mast cells resulted in a small but significant ( p < 0.05 ) reduction in the effect of mc + pi ( figure 4(c ) ) . in concordance with these findings we noted that addition of human tryptase ( 50 mu / ml ) potentiated the lps - induced il-6 production by hcaec ( figure 5(c ) ) . bmp-2 is a powerful osteogenic morphogen which belongs to tgf- superfamily and plays a central role in bone remodeling and calcification of atherosclerotic plaques [ 3236 ] . in order to determine whether histamine has a role in the regulation of bmp-2 , hcaec monolayers were treated with histamine ( 10 m ) or lps ( 100 ng / ml ) and the expression of bmp-2 mrna and protein were determined using qrt - pcr and western blot analysis , respectively . as shown in figure 6(a ) , incubation of hcaec with histamine resulted in 4-to 5-fold increase in bmp-2 mrna expression which was completely abrogated by cetirizine , an h1r antagonist . incubation of hcaec with lps also led to increased expression of bmp-2 mrna in a concentration - dependent fashion ( figure 6(b ) ) . western blot analysis of the total protein in cell lysates showed upregulation of bmp-2 expression by histamine within 2 h which sustained up to 24 h. in contrast , lps - induced expression of bmp-2 protein was transient . interestingly , the presence of histamine appears to block the decrease in bmp-2 protein noted with lps alone at 24 h time point . the results obtained in this study demonstrate for the first time that coincubation of hcaec and human mast cell subclone hmc-1 5c6 leads to enhanced production of il-6 by both quiescent and lps - stimulated hcaec . the enhanced levels of il-6 were not derived from mast cells because incubation of hmc-1 5c6 without hcaec did not produce il-6 in the presence or absence of lps ( data not shown ) . furthermore , il-6 was not detected in hmc-1 5c6 lysates confirming that these cells did not contribute to the observed increase in il-6 . additional results revealed that hmc-1 5c6-derived histamine and serine proteases mediate il-6 production directly as well as synergistically with lps . the present study also demonstrates that histamine induces the expression of the osteogenic protein bmp-2 in hcaec suggesting an important role for mast cells in vascular calcification . our laboratory has previously demonstrated synergistic interaction between bacterial products and rat mast cell granules on endothelial cells resulting in amplified production of il-6 and il-8 [ 1517 ] . in agreement with this observation , human mast cell line hmc-1 5c6 at various concentrations corresponding to mast cell - to - endothelial cell ratios of 1 : 8 , 1 : 4 , 1 : 2 , and 1 : 1 stimulated il-6 production by hcaec ( figure 2 ) . in addition , mast cells potentiated the effect of lps at all the concentrations tested confirming a synergy between the mast cell and lps . the ability of this human mast cell line to act in concert with bacterial agent to modulate endothelial cell function has important clinical significance . scanning electron microscopy revealed that hcaec and hmc-1 5c6 adhere to each other in the co - culture ( figure 3 ) . since mast cell lysates also showed a similar effect on hcaec ( table 1 ) , we submit that an adherence between intact mast cells and endothelial cells is not a prerequisite for the mast cell - mediated endothelial activation . whether this cell - to - cell interaction involves selective adhesion molecules or receptors on the endothelial cells is unknown . previous transmission electron micrograph studies have shown that mast cell - released granules ( mcg ) are internalized by cultured human umbilical vein endothelial cells ( huvec ) and remain morphologically intact for at least 24 h . the retention of structurally intact mcg after being internalized by endothelial cells is in contrast to the rapid degradation observed in macrophages . the strategic location of mast cells in the vessel wall and their demonstrated ability to modulate endothelial cell functions emphasize the importance of an active communication between these two cell types . transmission electron microscopy of the hmc-1 5c6 clone exhibited electron - dense particles in the granule compartments ( figure 3 ) . thus , the hmc-1 5c6 clone appears to be functionally mature and suitable for evaluating mast cell functions . among the secreted products of the mast cell , histamine and proteases are the most extensively studied molecules . on a weight and molar basis , tryptase , chymase , and carboxypeptidase a , represent the three major classes of proteases stored in the granules of mast cells [ 2023 ] . present results show that mast cell - induced activation of hcaec was partly due to serine proteases . pretreatment of mast cells with a cocktail of protease inhibitors ( pi ) partially abrogated the stimulation of il-6 production by quiescent and lps - activated hcaec ( figure 4(c ) ) suggesting that proteases released by mast cells participate in endothelial activation . human mast cell tryptase has been shown to induce or potentiate il-8 and icam-1 expression in bronchial epithelial cells , il-8 production in endothelial cells , collagen synthesis and chemotaxis in fibroblasts , and to initiate angiogenesis . mast cell chymase and carboxypeptidase a degrade low - density lipoprotein [ 13 , 14 ] . the mouse mast cell protease-6 , which is homologous to human -tryptase , induces infiltration of neutrophils in vivo and stimulates il-8 production by endothelial cells . evidence also indicates the presence of increased mast cell numbers and extracellular tryptase within the atherosclerotic plaques during early stages of calcification . results presented in figure 5(c ) demonstrate that incubation of hcaec with tryptase results in significant increase in the production of il-6 by hcaec , which was further enhanced by the presence of lps in the cell culture . these results suggest that tryptase and lps can act in concert to amplify inflammatory response in the endothelium . histamine is well recognized for its role in the regulation of vasodilatation [ 44 , 45 ] and endothelial cell functions . a direct relationship between histamine and vascular inflammation is evident from the increased levels of histamine in the coronary arteries of patients with ischemic heart disease and by the elevated levels of histamine in the coronary circulation of patients with variant angina . the ability of mast cell - derived histamine to induce il-6 production by hcaec suggests that it is an important inflammatory mediator in the coronary vasculature . the inflammatory and hypersensitivity responses elicited by histamine are mediated through a family of four distinct g - protein - coupled receptors , h1r , h2r , h3r , and h4r [ 4649 ] . the h1 receptor subtype is highly expressed in endothelial cells and smooth muscle cells . in the present study , il-6 production induced by mast cells or by their synergistic action with lps was partially inhibited by the h1r antagonist , diphenhydramine , but not by the h2r antagonist , famotidine ( figures 4(a ) and 4(b ) ) . furthermore , the direct and synergistic effect of exogenous histamine on il-6 production was significantly abrogated by the h1r antagonist ( figure 5(a ) ) but not by h2r antagonist ( figure 5(b ) ) . however , a complete abrogation of the stimulatory effect of intact mast cells on il-6 production was noted only when both the protease activity and the h1r function were blocked ( figure 4(c ) ) . although recognized as an early phase reactant , the role of histamine in the delayed effects of inflammation on the vasculature is not clear . as discussed above , the direct cellular effect of histamine and its ability to synergize lps - induced il-6 production underscores its role in amplifying the inflammatory responses associated with infection . other pro - inflammatory molecules such as c - reactive protein , oxysterols and tnf- play a role in calcification via calcifying vascular cells , a type of vascular smooth muscle cells [ 3335 ] . calcification involves mechanisms similar to osteogenic mineralization and the bone morphogen bmp-2 is expressed in calcifying atherosclerotic plaques . bmp-2 is a powerful osteogenic morphogen which belongs to the transforming growth factor - beta ( tgf- ) superfamily . activated endothelial cells are known to release osteo / chondrocytic molecules such as bmps [ 50 , 51 ] . bmp-2 is a key participant in calcified atherosclerotic plaques , and its expression is enhanced by tnf- or mechanical stimuli . we have shown that mice deficient in mast cells and histamine are osteoporotic and osteoclast deficient , and they exhibit bone abnormalities indicating a role for mast cells in the regulation of bone formation and calcification . furthermore , a recent study demonstrated communication between bmp-2 and mast cells during heterotopic ossification . our present study demonstrating increased expression of bmp-2 mrna and protein in histamine - treated hcaec supports the idea that mast cell - derived histamine may modulate early events in vascular calcification . in this context , it is noteworthy that histamine has been shown to cause soft tissue calcification . to our knowledge , this is the first study which links the role of histamine in the regulation of bmp-2 and may explain the bone abnormalities in mast cell deficiency . the present study demonstrates that human mast cell line hmc-1 5c6 is capable of inducing the production of il-6 by interacting with quiescent and lps - induced hcaec . the stimulatory effect of hmc-1 5c6 on lps - mediated activation was synergistic in nature and was mediated by histamine and proteases . exogenously added histamine and tryptase mimicked the direct and potentiating effects of lps on il-6 production . another novel finding of this study is that histamine is capable of inducing the expression of the osteogenic protein bmp-2 . collectively , our results suggest that mast cell - derived histamine and proteases play an important role in vascular inflammation and calcification in addition to their well - recognized participation in allergic diseases . | we examined the effect of intact human mast cells ( hmc-1 5c6 ) and their selected mediators on interleukin-6 ( il-6 ) production and bone morphogenetic protein-2 ( bmp-2 ) expression in human coronary artery endothelial cells ( hcaec ) in the presence and absence of lipopolysaccharide ( lps ) .
scanning electron microscopy showed that hmc-1 5c6 cells adhere to hcaec in cocultures .
addition of hmc-1 5c6 cells markedly enhanced the il-6 production by quiescent and lps - activated hcaec even at the maximal concentration of lps .
furthermore , mast cell - derived histamine and proteases accounted for the direct and synergistic effect of mast cells on il-6 production that was completely blocked by the combination of histamine receptor-1 antagonist and protease inhibitors .
another novel finding is that histamine was able to induce bmp-2 expression in hcaec .
collectively , our results suggest that endotoxin and mast cell products synergistically amplify vascular inflammation and that histamine participates in the early events of vascular calcification . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
grisel 's syndrome or " la maladie de grisel " is a rare non - traumatic atlantoaxial subluxation of the c1-c2 joint , characterized by a spontaneously - occurring unilateral or bilateral misalignment of the atlantoaxial joint14 ) . sir charles bell first described a non - traumatic atlantoaxial subluxation in a patient with syphilis , pharyngitis and resultant lethal spinal compression in 1830 . subsequently in 1930 , the syndrome was named after pierre grisel , who reported two cases of pharyngitis and atlantoaxial subluxation . it is a rare condition , usually seen in children with an upper cervical infection or after an otolaryngeal procedure26911 ) . it is rather rare to find reports of grisel 's syndrome caused by mycobacterium tuberculosis . this is the report of a 36-year - old female with grisel 's syndrome , who developed atlantoaxial subluxation following a retropharyngeal abscess , secondary to pulmonary mycobacterium tuberculosis . a 36-year - old female patient was admitted to the outpatient department of this hospital with complaints of neck pain , stiffness , and twisted neck . she could not turn her head to the right , since having a bitter quarrel six months ago . she had been diagnosed as having somatization disorder , neurologically , by consultants after review of several of her radiologic images at the time . a conservative management had not improved her symptoms , and she visited the department of neurosurgery of our hospital after several consultations . she could not stand up by herself without the help of a crutch on her right side ( fig . 1 ) . the range of motion in her neck was completely limited , and the patient suffered severe neck pain and stiffness . there was no fever and the routine blood tests were within normal limits . she had suffered pulmonary tuberculosis , which was completely resolved after she was treated with oral medication about 16 years ago . her left foot cellulitis was also resolved after she was treated with intravenous antibiotics about a year ago . recently , this patient had no signs of retropharyngeal infection , but her body weight decreased about 12 kg during a four month period . 3 ) of the cervical spine revealed a severe atlantoaxial subluxation with c1 rotated to the left on the odontoid process without anterior displacement . these are reliable findings , which correspond to type i in the fielding classification of atlanto - axial rotatory subluxation5 ) . mri verified the ct findings , which demonstrated that the transverse ligament was intact ( fig . 4 ) . however , t2-weighted images revealed hyperintensity of the ligaments and edema of the atlantoaxial joint , and less of the atlanto - occipital joints , with thick peripheral enhancement from c1 to t2 . pulmonary tuberculosis was observed in both upper lobe and left lower lobe from the chest ct . tuberculosis was immunologically confirmed by utilizing tuberculosis polymerase chain reaction and acid - fast bacilli smear . she was treated with antibiotics for tuberculosis ( rifodex , pyridoxin , pyrazinamide , yuhan - zid , and myambutol ) . this patient was asked to wear a philadelphia collar continuously , and was also prescribed a botulinum toxin for muscle relaxant . six months after she was put on an oral antituberculosis regimen , her radiographs and mr images showed improved atlantoaxial alignment and decreased posterior epidural abscess ( fig . 4 ) . then , she underwent anterior cervical discectomy and fusion ( acdf ) in the c4-c5 level for the correction of severe kyphoscoliotic curvature ( fig . her pain completely disappeared , restoring a full range of cervical movement and right ankle movement without pain . grisel 's syndrome involves a subluxation of the atlantoaxial joint and sometimes lead to a partial dislocation of the atlantooccipital joint . it usually affects children between 6 and 12 years of age , but may also occur in adults21114 ) . however , it is a rare disease with an apparently low index of suspicion13 ) . history taking and clinical signs and symptoms are important clues in the diagnosis of grisel 's syndrome14 ) . patients generally seek treatment for progressive throat and neck pain , and pain on attempted motion . one of the outstanding symptoms of grisel 's syndrome is a spontaneously arising , which is the symptomatic manifestation of unilateral or bilateral atlantoaxial subluxation14 ) . neurological complications occur in approximately 15% of these cases and can range from radiculopathy to myelopathy , and may even result in death4 ) . a subluxation may not yet be evident at the onset of the disease . early recognition of the infectious disease and a prompt attempt of appropriate conservative treatment are essential in the prevention of progression from such infectious disease to grisel 's syndrome11 ) . several theories have been proposed to explain the etiology and pathogenesis of atlantoaxial subluxation in grisel 's syndrome . there is general agreement today that the disorder may occur in association with any condition or surgical procedure that results in hyperemia and pathologic laxity of the transverse ligament and of the atlantoaxial joint114 ) . therefore , the prospective pathophysiology of subluxation of the atlantoaxial joint may be inflammatory ligamentous laxity caused by an infection . it is largely associated with an overt or occult head and neck infection , especially , an otolaryngologic infection or cervical lymphadenitis2 ) . furthermore , grisel 's syndrome has been reported postoperatively after tonsillectomy , adenoidectomy , repair of choanal atresia , surgery for the otitis media and surgery for a neck disease9 ) . it is well known that patients with clefts are prone to upperairway infections , even more so after surgery10 ) . it is also postulated that infection may spread directly into the small atlantoaxial joints and thus into the surrounding ligaments . this in turn may explain the gap between the dens and the front arch of atlas8 ) . several authors support these assumptions , but pathogens of grisel 's syndrome are rarely identified . found fusobacterium necrophorum , an anaerobic bacterium , in the blood and ear cultures of a child with grisel 's syndrome after the child had been inflicted with bilateral fulminant otitis media12 ) . clark et al . described a case of infection - related atlantoaxial subluxation without torticollis , from which a retropharyngeal beta - hemolytic streptococcal abscess was found3 ) . those pathogens described by another study included : pseudomonas aeruginosa ( 1 case ) , staphylococcus aureus ( 1 case ) or methicillin - resistant staphylococcus epidermidis ( 1 case ) ( isolated variably from the neck and blood cultures ) , and epstein - barr virus ( of infectious mononucleosis ) . however , there was no case associated with mycobacterium tuberculosis . several authors would consider a conservative treatment for type i ( immobilization , antibiotics , rest and analgesia ) and type ii ( includingcervical traction or muscle relaxants ) while they may utilize a more invasive approach for types iii and iv ( halo immobilization , arthrodesis and c1-c2 cervical fusion ) . nevertheless , these various therapeutic approaches may be applicable in each case , and patients should be individually managed . a proper management of grisel 's syndrome should be based on three aspects : ( 1 ) a specific treatment of the infectious disease , ( 2 ) correction of the bone deformity and ( 3 ) prevention of neurological damage . furthermore , a neurosurgical consultation is essential for all cases , even mild ones7 ) . this case had no anterior displacement and had less than 3 mm of atlantoaxial space , which corresponds to type 1 subluxation in the fielding 's classification . concurring to the recommendations for the management of type 1 subluxation of the fielding 's classification , she was prescribed with a soft collar to wear for cervical immobilization , antibiotics , and botulinum toxin as a supplementary muscle relaxant . in an attempt to correct severe subluxation with a kyphoscoliotic curvature , anterior cervical discectomy and fusion ( acdf ) were performed at the c4 - 5 level in this patient . also , she was put on an oral medication for a long time . furthermore , radiographs and mr images showed an improved atlantoaxial alignment and decreased posterior epidural abscess after administration of oral drugs or after surgery . mild subluxation types ( fielding types i and ii ) are not typically associated with a neurologic impairment . nevertheless , it was reported that cases with fielding type iii and iv lesions were associated with 15% incidence of neurologic impairment , ranging from radiculopathy to paralysis and death10 ) . most of these cases reported in current literature have a successful outcome with a conservative treatment , including this case . without treatment , an atlantoaxial subluxation becomes permanent , and will result in chronic torticollis , with a possibility of facial flattening and neurological complications . | grisel 's syndrome is a non - traumatic subluxation of the atlantoaxial joints , which is caused by an inflammatory process in the upper neck .
it is rare to find literary reports of grisel 's syndrome with an evident pathogen in a lesion .
for the first time in korea , we report a 36-year - old female with grisel 's syndrome having an atlantoaxial subluxation , which was caused by a retropharyngeal abscess secondary to pulmonary mycobacterium tuberculosis .
the patient was treated with an anti - tuberculosis regimen and was prescribed a philadelphia collar for the control of torticollis .
the result of magnetic resonance imaging ( mri ) showed an improved atlantoaxial alignment , after drug treatment and immobilization .
this patient was neurologically intact and free from symptomatic complaints at follow - up visit .
dynamic cervical radiograph confirmed that the atlantoaxial joints had been stable .
the pathophysiology of grisel 's syndrome , along with anatomical attributes , was explained on the basis of the patient 's clinical course . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
neural crest cells constitute a multipotent population from which numerous cellular lineages including melanocytes , craniofacial cartilage and bone , smooth muscle , neurons , and glia as well as tumors such as pheochromocytomas , paragangliomas , and neuroblastomas arise . pheochromocytoma cells differentiate from epinephrine secreting , neural crest - derived , precursor cells of the adrenal medulla . paraganglia cells also originate from the neural crest , but differentiate into sympathetic and parasympathetic subtypes that can give rise to paragangliomas . sympathetic paragangliomas secrete norepinephrine ; parasympathetic paragangliomas are non - secretory and typically occur in the head and neck . pheochromocytomas and paragangliomas are rare tumors with a combined annual incidence of less than 1 in 300,000 . traditionally , pheochromocytomas are described by the rule of 10s where 10% are metastatic , 10% are bilateral , 10% are familial , 10% are extraadrenal ( paragangliomas ) , and 10% are not associated with hypertension . although the rule of 10s is a helpful approximation , current research has stressed the increased importance of genetic predisposition in the development of pheochromocytomas and paragangliomas . furthermore , the rate of metastases varies widely depending on the tumor origin . the diagnosis of pheochromocytoma and paraganglioma depends on the clinical history , the presence of urinary or circulating catecholamines / metabolites , imaging findings , and tissue histopathology . patients can be asymptomatic or symptomatic , presenting with episodic hypertension , tachycardia , palpitations , perspiration , pallor , headache , and nonspecific abdominal or flank pain . although pheochromocytomas and paragangliomas can have similar clinical and radiologic features , these tumors differ in prognosis and likelihood of metastatic spread . this pictorial review demonstrates the common imaging characteristics of pheochromocytomas and paragangliomas using multiple imaging modalities and describes some common genetic syndrome associations . since the anatomic location of the tumor changes the prognosis , on computed tomography ( ct ) , the typical appearance of a pheochromocytoma or paraganglioma is a mass with an unenhanced density greater than 10 hounsfield units ( hu ) , avid contrast enhancement due to a rich capillary network , and delayed washout ( fig . rarely , these masses show low attenuation or minimal enhancement . by comparison , lipid - rich adrenal adenomas tend to have low density on unenhanced ct ( < 10 hu ) and show early washout . the theoretical risk of precipitating a hypertensive crisis has previously prevented intravenous iodinated contrast administration in individuals with suspected or known pheochromocytomas , however no adverse events were reported in a retrospective study of 25 patients with paragangliomas and pheochromocytomas who received nonionic iodinated contrast . 2 ) .
figure 1a 41-year - old woman with a history of von hippel - lindau and breast cancer presented with worsening abdominal and back pain . ( a ) an enhancing right adrenal mass is noted ( black arrow ) on the contrast - enhanced ct . numerous cystic lesions arising from the tail of the pancreas are noted in addition to a microcystic serous cystadenoma ( white arrow ) . ( b ) a heterogeneously enhancing left renal mass was proven on biopsy to represent a renal cell carcinoma ( arrow ) . numerous cysts are seen in the right kidney and pancreas consistent with known history of von hippel - lindau ( arrowhead ) . ( c ) [ i]mibg scan demonstrates intense radiotracer uptake in the right adrenal gland confirming the diagnosis of pheochromocytoma ( arrow ) . figure 2a 45-year - old man undergoing placement of an adjustable gastric band experienced retroperitoneal bleeding during the procedure secondary to an incidentally discovered mass . postoperative tests showed increased levels of plasma metanephrine , 24-h urine catecholamines , vanillylmandelic acid , and metanephrines consistent with a diagnosis of pheochromocytoma . ( a ) contrast - enhanced axial ct image of the abdomen demonstrates a complex left adrenal mass with thick enhancing walls . there is a central , high density component with fluid levels consistent with internal hemorrhage . ( b ) coronal t2-weighted mr image demonstrates a heterogeneous adrenal mass with multiple internal foci of t2 prolongation with septation ( arrow ) . a 41-year - old woman with a history of von hippel - lindau and breast cancer presented with worsening abdominal and back pain . ( a ) an enhancing right adrenal mass is noted ( black arrow ) on the contrast - enhanced ct . numerous cystic lesions arising from the tail of the pancreas are noted in addition to a microcystic serous cystadenoma ( white arrow ) . ( b ) a heterogeneously enhancing left renal mass was proven on biopsy to represent a renal cell carcinoma ( arrow ) . numerous cysts are seen in the right kidney and pancreas consistent with known history of von hippel - lindau ( arrowhead ) . ( c ) [ i]mibg scan demonstrates intense radiotracer uptake in the right adrenal gland confirming the diagnosis of pheochromocytoma ( arrow ) . a 45-year - old man undergoing placement of an adjustable gastric band experienced retroperitoneal bleeding during the procedure secondary to an incidentally discovered mass . postoperative tests showed increased levels of plasma metanephrine , 24-h urine catecholamines , vanillylmandelic acid , and metanephrines consistent with a diagnosis of pheochromocytoma . ( a ) contrast - enhanced axial ct image of the abdomen demonstrates a complex left adrenal mass with thick enhancing walls . there is a central , high density component with fluid levels consistent with internal hemorrhage . ( b ) coronal t2-weighted mr image demonstrates a heterogeneous adrenal mass with multiple internal foci of t2 prolongation with septation ( arrow ) . the improved tissue contrast of magnetic resonance imaging ( mri ) allows further characterization of adrenal lesions . in general , pheochromocytomas demonstrate t2 prolongation and variable , although often intense , contrast enhancement resulting in the light bulb sign ( fig . additional use of opposed phase imaging can be helpful as pheochromocytomas and paragangliomas do not exhibit dropout of signal on opposed phase imaging , but many lipid - rich adenomas do . figure 3a 57-year - old woman initially presented with severe left hip and flank pain without a history of trauma . ( a ) t2-weighted coronal mri of the abdomen shows a heterogeneous mass with cystic components arising from the left adrenal gland ( thick arrow ) . ( b ) axial [ f]fdg - pet image demonstrates fdg uptake in the adrenal mass ( arrow ) . ( c ) [ f]fdg - pet coronal maximal intensity projection ( mip ) again demonstrates the fdg - avid primary left adrenal mass consistent with pheochromocytoma ( arrow ) . a 57-year - old woman initially presented with severe left hip and flank pain without a history of trauma . ( a ) t2-weighted coronal mri of the abdomen shows a heterogeneous mass with cystic components arising from the left adrenal gland ( thick arrow ) . ( b ) axial [ f]fdg - pet image demonstrates fdg uptake in the adrenal mass ( arrow ) . ( c ) [ f]fdg - pet coronal maximal intensity projection ( mip ) again demonstrates the fdg - avid primary left adrenal mass consistent with pheochromocytoma ( arrow ) . however , functional imaging with [ i]metaiodobenzylguanidine ( mibg ) single photon emission - computed tomography ( spect ) , [ in]octreotide spect , and positron emission tomography ( pet ) can be useful to confirm the diagnosis , identify sites of disease , and evaluate metastases . mibg is a guanethidine analog that is taken up and stored in vesicles within cells of the sympathomedullary system . although mibg can be labeled with either i or i , i is preferred because of the shorter half life , lack of beta emission , and lower radiation dose compared with i. [ i]mibg is also preferred over [ i]mibg because the use of spect improves sensitivity and anatomic localization , whereas the low count rate and high energy collimators needed for i makes spect more difficult to perform and yields worse image quality . prior to an [ i]mibg study , the patient must be screened for medications that could interfere with mibg uptake , necessitating discussion with the referring clinician . the patient should also receive supersaturated potassium iodide ( sski ) or lugol solution to block radiotracer uptake in the thyroid . somatostatin analogs such as octreotide bind to cellular hormonal receptors important for inhibition of neuroendocrine hormone synthesis . the extent of uptake of [ in]octreotide is variable and dependent on the profile / subtypes of somatostatin receptors in the tumor . in patients with an incidental mass that is suspected to be a pheochromocytoma or paraganglioma , the choice of initial imaging radiotracer can be difficult . in general , [ i]mibg is thought to be slightly more sensitive than [ in]octreotide for the site of primary disease and is often the radiotracer of choice . [ in]octreotide has high sensitivity for metastatic disease and can be positive in tumors that have no mibg uptake . therefore , if the initial [ i]mibg scan is negative , an [ in]octreotide scan may be helpful . there are several radiotracers that can be used with pet including [ f]fluorodeoxyglucose ( fdg ) , [ f]dihydrozyphenylalanine ( dopa ) and [ f]dopamine . although [ f[fdg - pet has a high sensitivity for metastatic disease , the specificity is generally less than that of [ i]mibg or [ in]octreotide . to date , pet remains in the realm of investigation playing a predominantly complementary role in the evaluation of this patient population . there is no consensus on the order in which radiologic tests should be performed for patients with suspected neural crest tumors . a biochemical diagnosis is key , although anatomic imaging with ct or mri and functional imaging with [ i]mibg spect , [ in]octreotide spect and/or [ f]fdg - pet can be helpful in evaluation and staging . current clinical management relies on a combination of surgical resection , [ i]mibg therapy , and chemotherapy in malignant tumors . pheochromocytomas and paragangliomas can occur either sporadically or due to germline mutations with at least 9 suspect genes identified . von hippel - lindau ( vhl ) is an autosomal dominant disease caused by vhl gene mutations that predisposes individuals to central nervous system hemangioblastomas , renal cysts , renal cell carcinoma , pancreatic cysts , retinal angiomas , and pheochromocytomas ( fig . 1 ) . carney stratakis syndrome is a rare association of familial paraganglioma and gastrointestinal tumor ( fig . other associations include multiple endocrine neoplasia ( men2 ) , neurofibromatosis type i ( nf1 ) , sturge - weber syndrome , and carney syndrome . genetic analysis has also linked mutations in the succinate dehydrogenase ( sdh ) genes to the development of parangangliomas and pheochromocytomas . at least 4 paraganglioma syndromes named paraganglioma syndrome i iv have been linked to mutations in the sdhd , sdh5 , sdhc , and sdhb , respectively . recent research suggests that the current list of associated genetic mutations is not yet complete . figure 4a 77-year - old man had an adrenal mass incidentally discovered on a restaging scan following resection of a gastrointestinal stromal tumor ( gist ) . ( a ) coronal ct image with oral and intravenous contrast demonstrates a homogeneous , hypodense mass ( solid arrow ) adjacent to the surgical bed representing local recurrence of gist . an enhancing retroperitoneal mass adjacent to the aorta corresponded to the location of the sympathetic ganglia and raised the possibility of paraganglioma ( dotted arrow ) . ( b ) [ i]mibg scan demonstrates intense radiotracer uptake to the left of midline in the midabdomen corresponding to the previously noted paraganglioma ( arrow ) . the upper abdominal gist does not demonstrate any radiotracer uptake . physiologic uptake of [ i]mibg is noted in the salivary glands , liver , bladder , and bowel . ( c ) coronal [ f]fdg - pet mip shows intense fdg uptake in both the gist ( dotted arrow ) and pheochromocytoma ( solid arrow ) as both tumors are metabolically active . numerous other foci of fdg uptake within the liver and lymph nodes are consistent with metastatic disease . a 77-year - old man had an adrenal mass incidentally discovered on a restaging scan following resection of a gastrointestinal stromal tumor ( gist ) . ( a ) coronal ct image with oral and intravenous contrast demonstrates a homogeneous , hypodense mass ( solid arrow ) adjacent to the surgical bed representing local recurrence of gist . an enhancing retroperitoneal mass adjacent to the aorta corresponded to the location of the sympathetic ganglia and raised the possibility of paraganglioma ( dotted arrow ) . ( b ) [ i]mibg scan demonstrates intense radiotracer uptake to the left of midline in the midabdomen corresponding to the previously noted paraganglioma ( arrow ) . the upper abdominal gist does not demonstrate any radiotracer uptake . physiologic uptake of [ i]mibg is noted in the salivary glands , liver , bladder , and bowel . ( c ) coronal [ f]fdg - pet mip shows intense fdg uptake in both the gist ( dotted arrow ) and pheochromocytoma ( solid arrow ) as both tumors are metabolically active . numerous other foci of fdg uptake within the liver and lymph nodes are consistent with metastatic disease . extraadrenal paragangliomas behave more aggressively than their adrenal counterparts with metastases occurring in 2070% of cases . retroperitoneal paragangliomas are classically associated with the organ of zuckerandl , the chromaffin paraaortic tissue between the origin of the inferior mesenteric artery and the aortic bifurcation ( fig . the infradiaphragmatic paraaortic region and mediastinum constitute the three most common locations of extraadrenal paragangliomas ( fig . catecholamine - secreting tumors in this location can produce any of the typical sympathetic symptoms such as paroxysmal hypertension , tachycardia , headache , perspiration , palpitations , pallor , weight loss , and hyperglycemia in addition to painless hematuria and micturition syncope ( fig . figure 5a 35-year - old woman with a paternal family history of pheochromocytoma was initially diagnosed with paraganglioma at the base of the bladder causing left hydronephrosis and hypertension for which she underwent partial cystectomy and resection of the mass . ( a ) axial t2-weighted mri demonstrates heterogeneous , hyperintense signal at the base of the bladder to the left of midline ( arrow ) consistent with recurrence . ( b ) coronal t2-weighted mri demonstrates the same mass at the base of the bladder ( thin arrow ) . at the level of the aortic bifurcation , a left of midline mass demonstrates intermediate signal ( thick arrow ) corresponding to an organ of zuckerandl paraganglioma . an enlarged pelvic lymph node is seen on the left ( dotted arrow ) . axial contrast - enhanced ct through the level of the aortic arch demonstrates an intensely enhancing mediastinal mass in the anterioposterior window ( arrow ) . surgical pathology confirmed the diagnosis of paraganglioma . a 35-year - old woman with a paternal family history of pheochromocytoma was initially diagnosed with paraganglioma at the base of the bladder causing left hydronephrosis and hypertension for which she underwent partial cystectomy and resection of the mass . ( a ) axial t2-weighted mri demonstrates heterogeneous , hyperintense signal at the base of the bladder to the left of midline ( arrow ) consistent with recurrence . ( b ) coronal t2-weighted mri demonstrates the same mass at the base of the bladder ( thin arrow ) . at the level of the aortic bifurcation , a left of midline mass demonstrates intermediate signal ( thick arrow ) corresponding to an organ of zuckerandl paraganglioma . axial contrast - enhanced ct through the level of the aortic arch demonstrates an intensely enhancing mediastinal mass in the anterioposterior window ( arrow ) . tumors in the carotid body , for example , are well known clinical entities associated with a lower rate of metastases than their retroperitoneal counterparts and characteristically described as well - defined soft tissue masses within the carotid space splaying the carotid bifurcation ( fig . other locations for paragangliomas include the glomus jugulare , glomus vagale , and glomus tympanicum . glomus jugulare tumors arise from the jugular foramen of the skull base in association with branches from either the vagus or glossopharyngeal nerve . these tumors are locally aggressive with extension into the adjacent bones and intracranial structures but are hormonally silent ( fig . 8) . figure 7a 40-year - old woman recently postpartum presented with right - sided neck pain , minimally relieved with standing . ( a ) coronal contrast - enhanced t1-weighted mri demonstrates enhancing masses adjacent to the bilateral carotid arteries inferior to the jugular foramen on the right ( dashed arrow ) and at the level of the carotid bifurcation on the left ( solid arrow ) . ( b ) [ in]octreotide scan shows radiotracer uptake in the bilateral neck masses confirming the diagnosis of paraganglioma .
figure 8a 61-year - old man with a history of treated right glomus jugulare and right glomus vagale tumors presented with progressive right facial droop , dysphagia , and right eyelid ptosis . ( a ) axial contrast - enhanced t1-weighted mri demonstrates an enhancing right jugular fossa mass involving the right petrous apex ( white arrow ) and clivus . ( b ) coronal [ f]fdg - pet mip demonstrates fdg uptake within a right lower lobe mass ( arrow ) . ( c ) [ in]octreotide scan demonstrates radiotracer uptake in the right lower lobe ( white arrow ) compatible with metastases . uptake was also noted in the mediastinum and bilateral hila consistent with lymphadenopathy ( black arrows ) . a 40-year - old woman recently postpartum presented with right - sided neck pain , minimally relieved with standing . ( a ) coronal contrast - enhanced t1-weighted mri demonstrates enhancing masses adjacent to the bilateral carotid arteries inferior to the jugular foramen on the right ( dashed arrow ) and at the level of the carotid bifurcation on the left ( solid arrow ) . ( b ) [ in]octreotide scan shows radiotracer uptake in the bilateral neck masses confirming the diagnosis of paraganglioma . a 61-year - old man with a history of treated right glomus jugulare and right glomus vagale tumors presented with progressive right facial droop , dysphagia , and right eyelid ptosis . ( a ) axial contrast - enhanced t1-weighted mri demonstrates an enhancing right jugular fossa mass involving the right petrous apex ( white arrow ) and clivus . ( b ) coronal [ f]fdg - pet mip demonstrates fdg uptake within a right lower lobe mass ( arrow ) . ( c ) [ in]octreotide scan demonstrates radiotracer uptake in the right lower lobe ( white arrow ) compatible with metastases . uptake was also noted in the mediastinum and bilateral hila consistent with lymphadenopathy ( black arrows ) . in addition to local recurrence at the site of surgical resection , hematogenous and lymphatic metastases are common . metastatic disease is often diagnosed when tumor foci are identified at sites where chromaffin tissue is absent . common sites of metastatic spread include regional lymph nodes , bone , liver , and lung ( fig . one can evaluate for metastatic disease using multiple imaging modalities including ct , mr , mibg and pet / ct ( figs . 10 and 11 ) . in addition , osseous metastases from pheochromocytomas and paragangliomas may demonstrate radiotracer uptake on bone scans ( fig . figure 9a 70-year - old man with a history of diabetes and hypertension initially presented with upper abdominal pain . coronal contrast enhanced ct 1 year after the initial presentation ( baseline studies not available ) of a paraganglioma demonstrates widely metastatic enhancing mediastinal ( white arrow ) and retroperitoneal ( black arrow ) lymph nodes . figure 10a 52-year - old woman initially presented with a sensation of mid - epigastric fullness . after initial imaging ( not available ) , the patient underwent surgical excision of a 9-cm abdominal mass with the diagnosis of paraganglioma . ( a ) postexcision coronal [ f]fdg - pet mip demonstrates focal fdg uptake within the frontal bone , liver ( solid arrow ) , femur ( dashed arrow ) , and throughout mediastinal and retroperitoneal lymph nodes consistent with metastatic paraganglioma . ( b ) fused axial [ f]fdg - pet / ct illustrates intensely fdg - avid retroperitoneal lymph nodes and a lumbar vertebral body lesion . ( c ) fused coronal [ f]fdg - pet / ct demonstrates an intensely fdg - avid right femoral metastasis ( arrow ) . figure 11a 57-year - old man initially presented with episodic sweating and flushing secondary to a right adrenal pheochromocytoma that was resected . one year later , he noticed enlarged cervical lymph nodes that were found to be metastatic pheochromocytoma on biopsy . ( a ) axial noncontrast ct image of the upper thorax demonstrates a left subpectoral mass that is slightly hypodense to muscle ( arrow ) . ( b ) axial noncontrast ct images show a right middle lobe lung nodule representing metastatic pheochromocytoma ( arrow ) in addition to bilateral pleural effusions . ( a ) axial ct scan with oral and intravenous contrast demonstrates an enhancing retroperitoneal mass with central necrosis ( arrow ) . at pathologic examination , ( b ) [ tc]methylene diphosphonate bone scan performed 2 years after the initial ct demonstrates increased radiotracer uptake in the thoracolumbar spine ( arrows ) . ( c ) sagittal t1-weighted mri with contrast obtained 2 years after the bone scan demonstrates diffuse bone marrow heterogeneity within the vertebral bodies consistent with metastases . an enhancing soft tissue component seen at the level of the t5 vertebral body extends into the right neural foramen and compresses the thecal sac ( arrow ) . a 70-year - old man with a history of diabetes and hypertension initially presented with upper abdominal pain . coronal contrast enhanced ct 1 year after the initial presentation ( baseline studies not available ) of a paraganglioma demonstrates widely metastatic enhancing mediastinal ( white arrow ) and retroperitoneal ( black arrow ) lymph nodes . a 52-year - old woman initially presented with a sensation of mid - epigastric fullness . after initial imaging ( not available ) , the patient underwent surgical excision of a 9-cm abdominal mass with the diagnosis of paraganglioma . ( a ) postexcision coronal [ f]fdg - pet mip demonstrates focal fdg uptake within the frontal bone , liver ( solid arrow ) , femur ( dashed arrow ) , and throughout mediastinal and retroperitoneal lymph nodes consistent with metastatic paraganglioma . ( b ) fused axial [ f]fdg - pet / ct illustrates intensely fdg - avid retroperitoneal lymph nodes and a lumbar vertebral body lesion . ( c ) fused coronal [ f]fdg - pet / ct demonstrates an intensely fdg - avid right femoral metastasis ( arrow ) . a 57-year - old man initially presented with episodic sweating and flushing secondary to a right adrenal pheochromocytoma that was resected . one year later , he noticed enlarged cervical lymph nodes that were found to be metastatic pheochromocytoma on biopsy . ( a ) axial noncontrast ct image of the upper thorax demonstrates a left subpectoral mass that is slightly hypodense to muscle ( arrow ) . ( b ) axial noncontrast ct images show a right middle lobe lung nodule representing metastatic pheochromocytoma ( arrow ) in addition to bilateral pleural effusions . ( a ) axial ct scan with oral and intravenous contrast demonstrates an enhancing retroperitoneal mass with central necrosis ( arrow ) . at pathologic examination , ( b ) [ tc]methylene diphosphonate bone scan performed 2 years after the initial ct demonstrates increased radiotracer uptake in the thoracolumbar spine ( arrows ) . ( c ) sagittal t1-weighted mri with contrast obtained 2 years after the bone scan demonstrates diffuse bone marrow heterogeneity within the vertebral bodies consistent with metastases . an enhancing soft tissue component seen at the level of the t5 vertebral body extends into the right neural foramen and compresses the thecal sac ( arrow ) . clinical suspicion for a pheochromocytoma and paraganglioma often begins with the patient history and is confirmed with biochemical testing . the discovery of a primary enhancing mass in a midline or paramidline location should prompt consideration of neural crest lesions . although contrast - enhanced mri was preferred in the past for anatomic imaging due to fear of inducing an adrenal crisis with iodinated contrast , contrast - enhanced ct ( using nonionic iodinated contrast ) is now considered the best initial anatomic study with mri reserved for problem solving . functional imaging is often performed concurrently with [ i]mibg serving as the preferred agent due to its sensitivity and specificity profile . although these tumors have traditionally been associated with the 10% rule , improved imaging detection and outcome data show that the true story is more complex and prognosis varies depending on the tumor type and location . | abstractthe accurate diagnosis of adult pheochromocytoma and paraganglioma necessitates a multidisciplinary approach that includes clinical history , biochemical testing , and multimodality imaging such as computed tomography , magnetic resonance imaging , and nuclear medicine studies .
this review illustrates the different imaging characteristics of primary adult pheochromocytomas as well as both sympathetic and parasympathetic paragangliomas .
the review also describes known genetic associations and shows common metastatic patterns .
knowledge of the diverse appearance of pheochromocytomas and paragangliomas can result in early initial diagnosis or detection of disease recurrence thereby affecting patient management and prognosis . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
humans have transported other species beyond their natural ranges for thousands of years , both intentionally for agricultural purposes ( diamond 2002 ) and unintentionally as a consequence of human migration ( wichmann et al . other than disease agents , whose effects are apparent once transposed ( mazzaglia et al . 2012 ) , the extent to which humans have manipulated the species ranges of microbes is poorly characterised ( litchman 2010 ) . previous studies suggested that microbes have virtually limitless dispersal abilities ( de wit and bouvier 2006 ) . however , while some microbes , such as marine bacteria , appear globally distributed ( pedrs - ali 2006 ) , others , such as hot spring communities , are certainly not ( martiny et al . 2006 ; valverde , tuffin and cowan 2012 ; almeida et al . 2014 ; 2014 ) , and the forces which give rise to these microbial patterns are not clear ( hanson et al . 2012 ; morrison - whittle and goddard 2015 ) . microbes are key components of both natural and agricultural ecosystems , but we are generally ignorant of the means by which microbes might be dispersed , let alone the degree to which humans influence microbial species ranges ( talbot et al . 2014 ; tripathi et al . phylogeography is the primary method used to study the distributions of organisms in relation to their genetic diversity ( avise et al . 1987 ) , and allows inference of movements and speciation events . phylogenomics follows this approach but utilises large portions of genomes , as opposed to a few markers ( delsuc , brinkmann and philippe 2005 ) . to date , phylogenomic studies have mainly been applied to plant and animal species ( del campo et al . 2014 ) . while a vast array of robust biogeography studies have examined the variance in microbial species distributions ( reviewed in hanson et al . 2012 ) , there are relatively few that have employed a phylogeographic approach , and those that exist have largely used mtdna , microsatellite or single - locus genetic markers which can be biased or lack adequate resolution ( beheregaray 2008 ) . however , recent studies have examined the population genomics of saccharomyces yeast species to infer their origin and signals for domestication ( almeida et al . the saccharomyces genus is composed of seven species and originated 1020 million years ago ( hittinger 2013 ) . all species have complete genomes available and have been used for numerous functional ( skelly et al . 2011 ) , biochemical ( piskur et al . 2006 ) and evolutionary ( novo et al . 2009 ) studies . saccharomyces cerevisiae was the first eukaryote sequenced in its entirety due to its small 12 mb genome . since then , it has become the best annotated eukaryotic genome ( cherry et al . 2011 ) and remains a cornerstone of the genomics community with over well 200 genomes available that are being added to consistently ( cherry et al . 2011 ; skelly et al . 2013 ; bergstrom et al . 2014 ; almeida et al . 2015 ; strope et al . 2015 , reviewed in peter and schacherer 2016 ) , and a further 37 available for its sister species s. paradoxus ( liti et al . 2009 the global distribution of s. cerevisiae is becoming increasingly well characterised , as demonstrated by the recent revelation of major basal clades in china ( wang et al . 2015 ) , the discovery of hybrid populations associated with coffee and coca ( ludlow et al . one pattern consistently found in all studies to date is the close relatedness and short divergence time of a wine / european group ( liti et al . this group includes commercial winemaking strains , strains sampled in vineyards and wineries worldwide , as well as strains from european forests , and the proposed ancestral european group inhabiting mediterranean oak ( almeida et al . it has been suggested that dispersal from europe by humans in association with the global spread of viticulture and winemaking explains this pattern ( legras et al . together this suggests that s. cerevisiae is a species with some clades that are closely associated with and dispersed by humans , but there are other clades present in natural environments and probably dispersed only locally by other means , such as insects ( stefanini et al . a very recent study described genetically distinct populations of s. cerevisiae associated with coffee and cocoa in africa and south america ( ludlow et al . 2016 ) ; intriguingly , these do not contain novel alleles , but are inferred to have been created by the mixing of existing populations associated with european vineyards , american oak trees and the ancestral seat of this species in far east asia . ( 2016 ) reasonably suggest that the movement of these strains , and thus creation of these populations , was facilitated by humans . similarly , the recently discovery of a novel lineage in brazil shows it was formed in part by hybridisation of migrants from the european / wine group with endemic s. paradoxus , which presumably then facilitated the colonisation of native brazilian trees ( barbosa et al . 2016 ) ; it also seems reasonable to infer that humans facilitated this radiation event . new zealand ( nz ) is the last major landmass colonised by humans 1000 years ago ( hurles , matisoo - smith and gray 2003 ) and represents a unique environment to investigate questions concerning species range expansion . mori were the first humans to settle in nz , and europeans did not arrive until captain cook 's voyage of 1769 ( though abel tasman sighted nz in 1642 ) . many of nz 's endemic macroscopic flora and fauna have been studied ( wallis and trewick 2009 ) ; however , extremely limited work has been conducted on the biogeography of microbial species in nz . previous analyses , based on microsatellite profiles and rad - seq , suggest that nz harbours a diverse and globally genetically distinct metapopulation of s. cerevisiae , with some geographically distinct localised populations that are also connected by various levels of gene flow ( goddard et al . strains have been isolated from vineyard and winemaking - associated niches ( goddard et al . 2010 ; knight and goddard 2015 ) , oak trees planted by european migrants ( zhang et al . 2010 ) , and from native nz forests and fruiting trees ( knight and goddard 2015 ; gayevskiy and goddard 2016 ) . while small in terms of global production , the nz wine industry commands a strong position in the premium market and this sector is significant to the nz economy . saccharomyces yeast plays a role in the production of wine , including potentially being part of the process that geographically differentiates wines ( knight et al . ecology and population biology ( goddard and greig 2015 ) , their role in winemaking adds economic interest to understand the origin of s. cerevisiae populations . one recent study suggests the presence of an ancient population of the yeast s. uvarum in australasia , but this species is certainly not endemic to nz , nor is there evidence for an nz - specific population ( almeida et al . another study only recently reported the presence of s. eubayanus and s. arboricola in nz , but the age and origin of these species are uncertain ( gayevskiy and goddard 2016 ) . here we ask why s. cerevisiae is present in nz , and use phylogenomic methods to evaluate its history and range expansion . two extremes present themselves : either ( 1 ) there was an ancient s. cerevisiae population present in nz prior to humans arriving under 1000 years ago or ( 2 ) that this species was transported to nz by humans with winemaking who unwittingly expand this species range along with exotic fruit bearing plants and trees . the k - means clustering algorithm used to identify maximally divergent genotypes was implemented in r ( r development core team 2011 ) . sulphite tolerance was assayed by plating onto ypd with either 10 , 15 or 20 mm sodium metabisulphite in triplicate and scoring the growth of colonies as full , partial or none after 2 days at 28c . each strain was propagated in ypd , and high molecular weight genomic dna was extracted using the qiagen blood & cell culture dna kit . libraries were constructed using the illumina truseq nano dna sample prep kit with 550 bp insert size . sequencing was carried out at the beijing genomics institute ( china ) on a single 150-bp paired - end lane of an illumina hiseq 2000 . fastqc ( v0.10.1 ; andrews 2012 ) was used for quality control of each library and to determine optimal trimming parameters . trailing:3 slidingwindow:3:20 minlen:30. following trimming , fastqc was executed on the trimmed reads for comparison with the initial reports . all trimmed reads were mapped against the saccharomyces cerevisiae reference strain s288c using bowtie2 ( v0.12.7 ; langmead and salzberg 2012 ) . following mapping , samtools ( v0.1.18 ; li et al . a variant call file was produced using the mpileup command within samtools with the -bu parameters . the variant call file was used to create a consensus genome without the reference to allow for indels using the vcf2fq perl script within samtools . putative heterozygous positions were conservatively called as n as the phylogenetics and population genetics methods utilised do not support ambiguous calls . heterozygous positions were quantified with a custom perl script which filtered out positions with a sequencing depth below 10 or above 100 and a genotype quality below 20 . we have made our raw sequence data and consensus genomes aligned to s288c ( goffeau et al . 1996 ; ebi : gca_000146045.2 ) publicly available at sra : srp042301 and bioproject : prjna247448 . in addition to the 52 genomes sequenced here , a further 72 s. cerevisiae and 37 s. paradoxus genomes were obtained from the saccharomyces genome database ( http://yeastgenome.org ) , ncbi , the saccharomyces genome resequencing project ( https://sanger.ac.uk/research/projects/genomeinformatics/sgrp.html ) and from huang , roncoroni and gardner ( 2014 ) in the form of consensus genomes and/or raw data . to obtain an accurate estimation of the relatedness of the genomes , we extracted the well - known set of 106 orthologous loci spread through the genome of s. cerevisiae and present in all saccharomyces species ( rokas et al . the sequences of these 106 loci were extracted by searching the s288c sequence for each locus against each consensus genome using the blast algorithm . only genomes with complete sets of 106 loci were retained for phylogenetic analysis . all sets of 106 loci were subjected to a multiple sequence alignment using clustalw ( v.2.1 ; larkin et al . 2007 ) within geneious ( v6 , http://www.geneious.com ; kearse et al . 2012 ) . alignments were manually curated within geneious due to the frequent homopolymer indels present in some of the genomes due to older sequencing technology . we created a second dataset comprising 13 loci sequenced from 99 s. cerevisiae strains isolated in china ( wang et al . only these loci were sequenced from these chinese strains with no overlap with our main dataset . the consensus sequence for each of these loci was used to search against all available genomes outlined above . we used five s. paradoxus genomes as an outgroup , although four of the loci include intergenic regions and the s. paradoxus genomes did not yield these loci . multiple sequence alignments were carried out in the same way as for the 106 loci dataset . phylogenetic analyses were conducted using beast ( v1.7.5 ; drummond and rambaut 2007 ) on the finalised sequence alignments for both datasets . a number of scenarios were run to explore the relationships between genomes and to determine the stability of inferred relationships by locus and dataset . substitution and clock models were unlinked for all loci in all analyses to facilitate their independent estimation . all substitution model and rate options were left on default due to the large increase in processing time observed when any were changed . a log - normal relaxed clock ( uncorrelated ) was used with an exponential distribution of mean 0.3 . all runs were conducted with 1 billion iterations due to the size of the datasets . we verified mcmc convergence by examining the effective sample sizes of all parameters in each analysis and with visual inspection of the traces . 10% to 40% of each run was discarded as burn - in depending on the convergence of the mcmc trace . separate phylogenetic analyses were conducted for the two clades found housing nz strains in the 106 loci dataset . these used s288c as the outgroup to determine high - resolution structure within these clades . parsimony analyses including permutations of nz and europe terminal taxa status , and calculations of the minimum change of this state over these phylogenies , were conducted in mesquite ( maddison and maddison 2014 ) . we used the published divergence date estimates between s. cerevisiae and its sister species s. paradoxus as a calibration point for the divergences of clades within our phylogenies ( liti , barton and louis 2006 ) . divergences between clades within phylogenies are typically estimated using molecular clocks and/or by calibration time points of established species divergences using fossils . molecular clocks for s. cerevisiae are not in wide use due to the difficulty of estimating clock - like rates of evolution in a species with unknown generation times in its natural environment and high rates of inbreeding . the time of the common ancestor of s. cerevisiae and s. paradoxus has been estimated at 0.43.4 mya ( liti , barton and louis 2006 ) . the molecular substitution rate observed between the split of the s. cerevisiae and s. paradoxus genomes was assumed to correspond to this time period . to estimate the divergence date of a particular clade , the proportional substitution rate for the clade was calculated against the calibration point to give a date estimate . angsd operates on short read alignment bam files that afford statistical robustness in calculating the site frequency spectrum in comparison with traditional tools operating on a set genotype . given this requirement , we could only use genomes with raw data available from illumina sequencing technology . this was aided by the recent resequencing of diverse worldwide strains ( bergstrom et al . we thus created three superset subsets : the nz strains ( 52 ) , the previous and the wine / european strains ( 66 ) and the previous with all remaining strains ( 75 ) . the number of sites and the number of segregating sites for each population were determined from the mean allele frequency calculations in angsd with the minind parameter set to the number of strains per population and the minmaf alternatively set to 0 and 0.01 . only high - quality data were used ( minq = 20 and minmapq = 30 ) . watterson 's estimator ( ) ( watterson 1975 ) , tajima 's pi ( ) ( tajima 1989 ) and tajima 's d ( tajima 1989 ) were calculated by first calculating the site allele frequency likelihood , then the maximum likelihood estimate of the sfs , then the thetas per site and finally summarised with the thetastat utility in angsd . tests for admixture within the s. cerevisiae genomes were conducted with structure ( pritchard , stephens and donnelly 2000 ) due to the haploid nature of some of the genomes in our dataset . we chose to include all strains of s. cerevisiae where a consensus genome consisting of entire chromosomes was available to capture entire genomic diversity . the chromosomes of the 93 strains that met these criteria were aligned using mauve ( v2.3.1 ; darling et al . 2012 ) and any nucleotide positions where either all strains showed no variation or at least one gap was present were removed . the remaining positions were run through structure using the admixture model with 10 000 iterations of burn in followed by 20 000 iterations of analysis . k values between 2 and 20 were used with three replicate chains for each value of k to check for convergence , and the optimal number of subpopulations inferred using the evanno method ( evanno , regnaut and goudet 2005 ) . 2014 ) to determine the extent that geographic origin , niche of isolation and our phylogenomic analysis explains inferred population structure . we collated data from six recent studies that have surveyed for saccharomyces cerevisiae across nz ( table 1 ; serjeant et al . 2008 ; goddard et al . 2010 ; zhang et al . 2010 ; gayevskiy and goddard 2012 ; knight and goddard 2015 ; gayevskiy and goddard 2016 ) . saccharomyces cerevisiae has been isolated from over 99% of spontaneous ferment samples , 10% of vineyard samples and only 1% of forest / tree samples . the order of magnitude difference in recovery of this species is not due to differential sampling effort as most effort was spent sampling native forests , then vineyards and least for spontaneous ferments ( table 1 ) . just six genotypes ( characterised at nine microsatellite loci ; richards , goddard and gardner 2009 ) have been recovered from trees / forests one of these was from an exotic oak tree ( zhang et al . 2010 ) , but microsatellite profiling showed this to be very closely related to dbvpg1106a strain isolated from australian vineyards which clusters with the wine / european group for which whole genome sequence is already available , and is included in this study ( zhang et al . 2010 ) . population genetic analyses of the remaining five genotypes isolated from native nz forests show these to be homogeneous with their regional vineyard and spontaneous ferment populations : there is no evidence for genetic differentiation between strains isolated from native forests and their vineyard counterparts ( knight and goddard 2015 ) . thus , it is clear that s. cerevisiae is very common in nz spontaneous ferments , and at reasonable abundance in vineyard habitats , but rare in nz native forests . this observation , and the fact that s. cerevisiae populations in these three habitats are connected within each region of nz ( knight and goddard 2015 ) , means the most likely explanation is that there is just one s. cerevisiae metapopulation in nz closely associated with vineyards and ferments , but members of this population are transposed to native habitats at some low rate . there is no evidence that nz harbours another genetically distinct s. cerevisiae population that is not primarily associated with ferments and vineyards . the question we ask here concerns the origin of this group . to address this question , we need data from a set of genomes that best reflects the genetic diversity in this population : this is the most pertinent parameter relevant to elucidating the origin of this species in nz . we thus identified a set of 52 maximally divergent s. cerevisiae genotypes from those of 724 in our database using k - means clustering of microsatellite profiles ; these are detailed in table s1 ( supporting information ) . the collated sampling effort and recovery of saccharomyces cerevisiae ( sc ) from six recent studies in nz ( serjeant et al . 2010 ; zhang et al . 2010 ; gayevskiy and goddard 2012 ; knight and goddard 2015 ; gayevskiy and goddard 2016 ) . native forest samples derived from soil , honeydew and fruits of native trees ( serjeant et al . 2008 ; knight and goddard 2015 ; gayevskiy and goddard 2016 ) ; vineyard samples derived from soil , fruit and flowers ( goddard et al . 2010 ; gayevskiy and goddard 2012 ; knight and goddard 2015 ) ; ferment samples derived from spontaneous ferments of sauvignon blanc , chardonnay and syrah ( goddard et al . 2010 ; gayevskiy and goddard 2012 ; knight and goddard 2015 ) . sequencing of genomes derived from clonally expanded diploid populations yielded an average of 5.1 million 150-bp paired - end reads per strain for a total of 39.8 gbp of data . an average mapping rate of 97.16% was obtained for all genomes using the s288c genome as a reference , with an average coverage of 61x , and mapping quality of 38.78 ( phred score ) . an average of 52 421 ( se = 532 ) snps and 4915 ( se = 36 ) indels were obtained for each genome . this number of snps is entirely consistent with other s. cerevisiae strains sequenced on the same platform from a diversity of international locations and niches ( e.g. bergstrom et al . the average number of heterozygous snps per strain was 7274 ( se = 805 ) which is consistent with that found for other vineyard isolates ( magwene et al . 2011 ) , but heterozygosity levels ranged from 3000 to 31 000 ( 6% to 43% of all snps ) across the 52 nz genomes . cursory analyses of large - scale copy number variations indicate that the genome of 6-sol7 - 2 contains three copies of chromosome 4 and 27-wi_s_jasa_13 contains three copies of the first half of chromosome 7 . further , 37 of the 52 nz genomes show large copy numbers ( 1.5 - 50x ) of locus ygr201c ( unknown function ) on chromosome 7 . we stress that the main hypothesis under test is the phylogeography of s. cerevisiae , and thus we do not concentrate on the details of fine - scale differences between genomes any further here . first , we compared the nz - derived genomes with one another and then with 14 previously published genomes that either derived from europe or are associated with winemaking , which form a tight clade , and finally to a further nine genomes derived from a diversity of locations and niches ( table s2 , supporting information ) . only genomes with high - quality data ( illumina sequencing with 30x or greater coverage ) we only included sites that had high - quality read data for all genomes , and thus the number of comparable homologous sites reduced as more genomes were added due to the increase in missing data for some of the existing genomes . the number of segregating sites is proportionately similar between the wine / european group and the nz population , but nearly doubles when the other genomes are added , indicating their relative divergence ( table 2 ) . pi is a measure of nucleotide diversity ( tajima 1989 ) and the nz and wine / europe populations appear identical in terms of nucleotide diversity , but again the inclusion of the non - wine / europe genomes leads to a 30% increase in this statistic . this suggests that the nz - derived genomes are more similar to the genomes deriving from europe or associated with winemaking than to genomes derived from elsewhere . it is tempting to further investigate comparative population genetics , but since the international samples are not random representatives of a population this defies many of the assumptions underlying population genetic calculations , and so we have not pursued this here . sites where all genomes have at least one high - quality read and at least one genome differs from the rest , percentage in brackets is from the total number of sites . first , we employed phylogenomic methods to evaluate long - term within - species population structure . initially , we chose a comprehensive set of 106 orthologous loci compiled by rokas et al . ( 2003 ) for analyses due to their distribution across the genome , presence in all saccharomyces species and their proven capability to provide a robust phylogenetic signal . we did not use the entirety of the genomic data due to potential problems with identifying orthologues and paralogues . of the existing 72 s. cerevisiae and 37 s. paradoxus genomes , 60 and 36 respectively contained these 106 loci ; the remaining genomes had insufficient or low - quality sequencing coverage for at least some of the loci ( table s2 ) . rampant recombination among these genomes , which would be indicated by more of network - like than tree - like relationships , would significantly decrease the validity of using a phylogenetic approach for the analyses of these genomes due to its assumptions regarding bifurcating relationships . s1 , supporting information ) reveals a topology that to a first approximation shows a more tree - like than network - like structure , suggesting little recombination between major groups , and thus lends greater confidence for the use of phylogenetic approaches to evaluate some of the relationships between these genomes . to place the nz population in a global context , we reconstructed a phylogeny using bayesian approaches and included the 36 s. paradoxus genomes for calibration and rooting purposes ( fig . 1 ) . the inclusion of nz genomes reproduces an overall global topology that is comparable to earlier analyses ( liti et al . strikingly , 85% of the nz strains , including the strain isolated from a native forest , are interspersed within the wine / european clade ( fig . the resolution within this clade is extremely poor , suggesting that this comprises a contemporaneous population experiencing gene flow and recombination , and the relatively short branch lengths show little time since divergence . this represents the first piece of evidence that the s. cerevisiae in nz have a significant portion of ancestry , and thus derive from , and are in fact part of , the european population . the remaining 15% of nz strains form a sister clade to the wine / european group , with the inclusion of i14 and y55 , which are two soil isolates from europe . resistance to sulphite is a key defining phenotype of the s. cerevisiae lineage associated with viticulture and winemaking as sulphur is and has been used as an antimicrobial in both vineyards and wineries ( pretorius 2000 ; aa et al . 2006 ) . to evaluate whether this smaller group might represent a population not associated with wine there is no significant difference in resistance to 10 , 15 and 20 mm sulphite between the nz and european groups as determined by plate assays ( f 1.59 , 0.53 , 0.00 respectively and all p < 0.21 ) , but these two groups are significantly more tolerant to 10 , 15 and 20 mm sulphite than the rest of the non - wine - associated strains ( f 54.3 , 20.9 , 8.9 respectively and all p > 0.0002 ) ( fig . 2 ) . rooted phylogeny of 112 s. cerevisiae strains created using the 106 loci dataset with s. paradoxus as the outgroup reconstructed using the bayesian methods implemented in beast ( v1.7.5 ; drummond and rambaut 2007 ) . sulphite tolerance of the wine / europe / nz group ( n = 98 ) , nz / europe group ( n = 9 ) and the remaining non - wine isolates ( n = 25 ) shown in fig . sulphite tolerance was assayed by plating onto ypd with either 10 , 15 or 20 mm sodium metabisulphite in triplicate and scoring the growth of colonies as full ( 2 ) , partial ( 1 ) or none ( 0 ) after 2 days at 28c , and this metric is plotted on the y - axis . anova reveals a significant difference in tolerance between groups at all sulphite concentrations , but tukey 's hsd tests reveal no significant difference in sulphite tolerance between wine / europe / nz and nz / europe groups at any of these three levels . previously identified clades ( liti et al . 2009 ; schacherer et al . 2009 ) are reconstructed and expanded with our analyses due to the inclusion of further recently sequenced genomes . the north american clade includes additional strains sampled from missouri ( t7 ) and bahamas ( uwops83_787_3 ) , the west african clade contains the pw5 strain sampled from nigerian palm wine and the sake clade contains an additional three strains ( uc5 , kyokai7 and ztw1 ) . apart from the sake clade , the ordering of the clades in relation to the s. paradoxus outgroup places strains isolated from non - agricultural niches as basal while agricultural and biotechnological associated strains are relatively derived indicating their more recent formation . strains not residing in these clades are interspersed through the tree and tend to be positioned at the ends of longer branches and could indicate the presence of further undersampled populations or represent chimeric strains with ancestry in multiple clades . recently , a large novel diversity within s. cerevisiae was revealed by the sequencing of 13 loci from 99 strains isolated in china , leading to suggestions that this species originated on the asian continent ( wang et al . we extracted these loci from all available whole genomes , resulting in 214 s. cerevisiae comprising 99 chinese strains , 52 nz strains , 60 strains used in the first analysis and a further three international strains containing these six loci ( table s2 ) . s2 were > 0.92 indicating adequate resolution , but the posterior probabilities for relationships of individuals within these clades , particularly within the wine / european / nz clade , were very poor , likely due to gene tree incongruence . broadly , our analyses agree with earlier findings , and all eight chinese lineages previously identified ( wang et al . the tree features a large split between strains that have been sampled from non - agricultural environments regardless of sampling location , and those that are closely associated with human activity . the exception to this is the sake clade which tends to cluster with non - agricultural strains due to a hypothesised secondary domestication event ( fay and benavides 2005 ) . the genetic diversity ( branch lengths ) within the human - associated clades is significantly lower than for the other clades , which , taken with low posterior probabilities , implies incomplete lineage sorting and/or high rates of admixture for human - associated strains . saccharomyces cerevisiae is a sexual eukaryote , and along with the reasonable rates of heterozygosity revealed here , previous analyses show that while it tends to inbreed , there is clearly a reasonable amount of outcrossed recombination and gene flow between subpopulations occurring in the nz population ( goddard et al . 2010 ; gayevskiy and goddard 2012 ; knight and goddard 2015 ) , and the inference of recombination and hybridisation in global studies suggest that this may well be the case at larger scales ( liti et al . 2009 ; cromie et al . 2013 ; barbosa et al . 2016 ; ludlow et al . the degree to which phylogenomic methods are able to recover any signal when there is diffuse population structure is not clear , i.e. when some population differentiation is present but with reasonable gene flow and recombination between subpopulations . to enable us to analyse a spectrum of possible population structures , from completely homogenised through to highly structured due to ancient divergences , we use complementary bayesian - based population genetic methods capable of inferring finer degrees of population structure that account for recombination implemented in structure ( pritchard , stephens and donnelly 2000 ) , and the subsequent analyses of ancestry profiles by obstruct ( gayevskiy et al . from the 11 059 143 nucleotide positions in the 93 aligned concatenated genomes , any which were uninformative or had missing data were conservatively removed leaving a total 66 316 robustly informative positions for population structure analysis . we employed bayesian population structure approaches that account for and incorporate recombination ( admixture ) between strains . these population genetic approaches infer the presence of four populations using the evanno method ( evanno , regnaut and goudet 2005 ) as implemented in structure harvester ( earl and vonholdt 2011 ) . figure 3 shows the resulting ancestry profiles : each vertical column represents a strain and the colours show the proportion of ancestry of each strain to each of the four inferred populations . strains that have different degrees of ancestry in different subpopulations are a result of mating and recombination between strains ( or their ancestors ) originating from different subpopulations . there is a progressive and gradual increase in ancestry to the orange inferred population as one moves from the assumed natural strains on the left to the increasingly human - associated strains on the right . again , the nz strains fall together and with the european strains , but with varying degrees of ancestry . it is clear that these various populations are not discrete : there are signals for some gene flow and genetic mixing among the species as a whole . ancestry profiles produced by structure showing population structure inference of 66 316 snps from 93 whole genomes of s. cerevisiae . each bar represents an individual strain and colours represent different inferred populations for k = 4 ( optimal ) . the geographic origin and niche of isolation for each strain is labelled with coloured squares and circles , respectively . approximately the orange inferred subpopulation correlates with the european / wine group , the purple with sake and the blue possibly asia / africa ; there are not clear correlations with the yellow inferred subpopulation . 2014 ) to determine whether geographic origin or niche of isolation might correlate most strongly with population structure . this analysis shows that variance in genetic structure in the nz population correlated with niche of isolation ( r = 0.51 , p < 0.0001 ) only marginally more than geographic origin ( r = 0.45 , p < 0.0001 ) . unsurprisingly , the amount of genetic variance explained ( r ) is greater ( r = 0.74 , p < 0.0001 ) when ancestries are compared to those groups revealed from the independent phylogenetic analyses shown in fig . this shows that neither geographic location nor niche/use alone is sufficient to describe the observed population structure , and is exactly in line with the recent conclusion of almeida et al . thus , the most accurate picture is one of the global metapopulation of connected subpopulations inhabiting various places and niches , and recapitulates the picture seen at national levels ( knight and goddard 2015 ) . ( 2016 ) recently reported novel s. cerevisiae lineages in brazil that are related to japanese and north american lineages , but the brazilian populations also contain signals for mating and introgression with the wine / european group , as well as hybridisation and introgression with american s. paradoxus . this hybridisation and subsequent introgression conceivably provided novel genetic combinations better adapted to inhabit brazilian native biomes . ( 2016 ) reported that lineages associated with coffee and cocoa were created by the hybridisation of genomes from the european / wine with north american and chinese populations . might the nz s. cerevisiae have undergone a similar process where hybridisation with an endemic saccharomyces , or some other s. cerevisiae population , provided an opportunity for more effective adaptive radiation in nz ? for the saccharomyces species known to be present in nz , s. paradoxus has been inferred to have recently migrated from europe with oak trees ( zhang et al . the single representative of s. eubayanus is also inferred to have recently arrived from south america ( gayevskiy and goddard 2016 ) . however , there is evidence to suggest that s. uvarum and s. arboricola may have more ancient populations in nz ( almeida et al . 2015 ; gayevskiy and goddard 2016 ) . following gayevskiy and goddard ( 2016 ) , alignment for all 52 nz s. cerevisiae genomes to reference genomes for the other saccharomyces species shows that all align best to s. cerevisiae , with an average of 97.2% , and a minimum of 93.2% ( table s3 , supporting information ) . the two saccharomyces species to which the nz s. cerevisiae align the poorest are the two candidates for potential endemic nz species , with a maximum of just 43% . further , there is no evidence for large blocks of nz s. cerevisiae genomes to be more greatly related to any species other that s. cerevisiae ( table s3 ) . together , this provides no evidence for recent hybridisation or introgression event in the nz s. cerevisiae group from other species . thus , given the data available , it appears the nz s. cerevisiae population derives exclusively from the european / wine group . further , the earlier ancestry profile analysis shows that most of the nz strains have the majority of their ancestry in the wine / european group i.e . how many times might strains have been transferred from one side of the planet to the other , and when did this occur ? we define incursion events as transfers to nz that have become established enough for us to detect strains , or related lineages deriving from such strains , which are thus founder events . the theoretical number of incursion events ranges from just 1 to 2000 as this represents the best estimate for the number of different s. cerevisiae genotypes currently present in nz ( knight and goddard 2015 ) . first , we evaluate whether there is any evidence to support a single founder event versus multiple incursions given these data . a single founder event would mean that all current nz s. cerevisiae would coalesce to a single ancestor . one signal for this would be the presence of shared fixed alleles in the nz but not european population . of the 66 316 snps , none are fixed in the nz genomes , providing no strong evidence for a single founder event . we acknowledge the tentative nature of this analyses given the relatively few strains for which we have sequences , but wished to estimate the likely minimum number of incursion events given our data to provide a lower bound to this rate , and appropriately used a maximum parsimony approach to analyse this . under this minimal change parsimony framework , the best explanation for clades entirely comprised of nz - derived genomes is that the ancestor of this clade was transported to nz from europe . thus , we modelled the minimum possible incursion events into nz by minimising the change from the minimum number of transfer events inferred by this analysis is 10 ( one and nine in each of the two clades where nz isolates are present ) . by comparisons to null distributions , this observed number of incursion events is significantly less than we would expect to see by chance ( p = 0.0116 and p < 0.0001 for each clade given 10 000 permutations of terminal taxa status ) given these phylogenies and proportions of nz and european - derived genomes . as an alternate approach , strains that survived transport to and establishment in nz might tend to sire independent lineages , and this signal might be revealed by the presence of separate subpopulations in nz . to test this , we analysed the population structure in these genomes using structure ( pritchard , stephens and donnelly 2000 ) , and the optimal number of inferred subpopulations is 11 across the two clades that harbour nz - derived genomes . the inferred number of subpopulations is in line with the number of incursion events suggested by parsimony analyses . phylogenies of the ( a ) nz / europe and ( b ) wine / europe / nz clades seen in fig . maximally parsimonious incursion events are shown as red boxes and labelled numerically corresponding to their estimated dates plotted in ( c ) . it appears the movement of s. cerevisiae from europe to nz is thus not only detectable but also constrained . the question under scrutiny here is the extent to which humans have expanded microbial species ranges . just because we infer at least 10 incursion events from europe , this does not necessarily prove that humans were the agents of transfer ; s. cerevisiae might have been moved by other means and been present before humans arrived . humans only arrived in nz about 1000 years ago , and winemaking only in the last 200 years ( hurles , matisoo - smith and gray 2003 ) , so next we attempted to estimate the ages of the nz clades . again , under a parsimony framework , these potentially represent the ages of lineages and populations that have expanded since their ancestors arrived in nz . given our data , the substitution rate between s. paradoxus and s. cerevisiae is 0.3366 . dating microbial phylogenies is difficult , and the time to the common ancestor of s. cerevisiae and s. paradoxus has been estimated between 0.4 and 3.4 mya ( liti , barton and louis 2006 ) . if the molecular substitution rate is assumed to be constant across this time period , then the potential ages of these 10 clades may be simply estimated by calculating the proportional distance of the relevant nodes compared to the node defining the s. paradoxus / s . bound timing estimates of s. cerevisiae incursions into nz from europe spans from 60 to 5000 years ago ( fig . 4 ) . however , we note that large confidence limits around the timing of the s. paradoxus and s. cerevisiae split ( liti , barton and louis 2006 ) clearly translate into large limits around the estimates for incursions into nz . without wanting to overly extrapolate these tentative timings , it is interesting to note that most inferred incursion events are just above or well below the 1000 year cut - off , and just one is substantially older . this one older event is the inferred incursion event from the smaller sister clade to the wine / european group , where eight nz - derived genomes cluster with soil isolates from europe ( fig . 4 ) . given the uncertain nature of the dating of this phylogeny combined with the assumptions of constant substitution rates , apart from one possible exception , there is no compelling evidence to suggest that s. cerevisiae has been in nz significantly longer than humans have . thus , human introduction appears the most likely explanation for s. cerevisiae 's presence in nz . lastly , we estimated the node containing the entire wine / european / nz group to be between 4635 and 39 394 years old . this estimate overlaps with the earliest evidence for humans producing fermented drinks some 9000 years ago in china ( mcgovern et al . 2004 ) , and this places all the s. cerevisiae found in nz in the group that expanded along with the human passion for viticulture and winemaking . it appears that this species has been transported to nz and has become successfully established in vineyards , but that radiation to native forest habitats is rare , but detectable . this may be due to low rates of movement or that this s. cerevisiae population is poorly adapted to nz native forest niches , or both . saccharomyces arboricola inhabits nz native forests , but unlike s. cerevisiae populations in habiting brazilian native forests , which hybridised with endemic s. paradoxus , there is no evidence that the nz s. cerevisiae have hybridised with endemic s. arboricola . due to the very recent arrival of s. cerevisiae to nz , however , analyses estimating the number of incursions might produce an erroneous result not necessarily due to analytical reasons , but mostly due to the unequal number of samples deriving from nz and european populations . recall the nz strains were deliberately chosen to represent the genetic diversity in nz based on surveys from both vineyard and native forest habitats , but it might well be that with increased sampling in the european wine group one finds strains that interdigitate among nz strains in various clades . however , additional data may not show this pattern ; either way , here we estimate the minimum number of incursion events given the data available . under the assumption that the largest nz clade was founded by a single strain , which has then radiated in nz , one can compare metrics that might provide insights into the evolution of s. cerevisiae since arriving in nz . 4 ) has values of = 1909 , w = 2114 and tajima 's d = 0.41 . this compares to = 1155 , w = 1305 and tajima 's d = 0.43 for a set of 10 wine / european genomes , and implies possibly greater genetic diversity , but no more compelling signal for selection , in this nz clade compared to the wine / european group generally . this is due to the problems associated with dating microbial phylogenies in general , owing to the lack of fossils , and then extrapolating the uncertain estimates we have to relatively recent divergence events . while the mutation rate of s. cerevisiae has been estimated ( lang and murray 2008 ) , this has been deduced using a few strains under laboratory conditions . a further complication is that we have very little idea of absolute mitotic and meiotic generation times in nature , making calibrations of absolute timings using mutation rates a fruitless way forward ( goddard and greig 2015 ) . here we make assumptions about the constancy of the rates of molecular evolution . given these caveats , we estimate the likely timings of these incursions , and their lower bounds are not greatly above , and indeed are mostly below 1000 years ago ( fig . another possible reason for an inaccurate inference in terms of transfer timings also stems from a lack of sampling : strains might have migrated only very recently to nz even though their last common ancestor with a european strain occurred thousands of years ago . previous analyses , using repeat regions , showed the nz s. cerevisiae population as internationally genetically distinct ( goddard et al . this discrepancy might be explained by the fact that repeat loci evolve rapidly and thus are capable of resolving finer levels of population differentiation than average signals from whole genomes ( or many loci ) can . significant signals for differentiation revealed by analyses using repeat regions would occur if rates of gene flow ( incursion events ) between europe and nz are relatively low , and less than the rates of evolution at these repeat regions : analysis here suggests the number of incursion events into nz have not been that great , and thus correlates with this idea . the sequencing of diploid genomes here allows rates of heterozygosity to be calculated , and these are on average similar to those previously estimated ( magwene et al . 2011 ) ; however , the variance in rates of heterozygosity in the nz genomes is substantial ( from 6% to 43% of snps ) . such rates of heterozygosity may be explained , at least in the nz group , by the inference that 20% of mating events are outbred combined with reasonable levels of gene flow between subpopulations ( knight and goddard 2015 ) , and that the european/ wine group more generally have elevated outcrossing rates ( peter and schacherer 2016 ) . together , these estimates of origins and timings strongly suggest that humans introduced s. cerevisiae into nz recently , and thus expanded the range of this species . this pattern correlates with the previous observation of s. cerevisiae presence in new oak barrels from europe once arrived in nz ( goddard et al . the signals provided by these phylogenomic analyses are also in line with work showing trends in s. cerevisiae population division that correlates with the expansion of viticulture globally ( legras et al . this extent of human - mediated movement is also consistent with the analyses of cocoa and coffee populations in africa and europe , where approximately three significant movements from europe , north america and asia to africa and south america were inferred , and migration of wine strains to brazil which hybridised with s. paradoxus . however , there were no estimations regarding the timing of either the brazil or cocoa and coffee strain movements ( barbosa et al . in addition , analysis of a handful of s. paradoxus isolates from nz also infers transfer from europe to nz associated with the movement of another plant species by humans : quercus ( oak trees ) ( zhang et al . 2010 ) . it is interesting to note that s. uvarum is inferred to have been present in australasia , and possibly s. arboricola in nz , well before humans might have been , and so it seems that the ranges , modes and ages of dispersal of these sister taxa differ . the earliest evidence for the human use of s. cerevisiae for fermentation has been dated to 9000 years ago and comes from pottery jars in china ( mcgovern et al . the earliest evidence for wine production comes from iran 7400 years ago and seeds of domesticated grapes have been found in georgia and turkey and dated to 8000 years ago ( this , lacombe and thomas 2006 ) . our results show that strains associated with winemaking are closely related to one another regardless of geographic location . the archaeological dates allow another way to calibrate the dating on this phylogeny and indicate that the split between s. cerevisiae and s. paradoxus is closer to the lower bound of 0.4 mya than the upper of 3.4 mya . overall , the analyses conducted here add further support to the concept that humans have facilitated the global transfer of this microbial species through our agricultural activities , and thus have significantly expanded this species range . in doing so , it appears that humans have provided an opportunity for one lineage of s. cerevisiae to radiate to and become established in areas well beyond the ancestral range for this species . not only has the transfer of this species provided an opportunity for it to become established in nz 's agricultural ecosystems , but it is now also found in natural forest ecosystems . whether s. cerevisiae has or may become established in nz native forest ecosystems is debatable as the low rate of recovery may simply reflect rare transposition events , by humans or insects perhaps ( buser et al . 2014 ) , that will perhaps ultimately fail to seed successful lineages in that inhabit . indeed , we do not have a good understanding of the niches to which s. cerevisiae is adapted , if any at all ( goddard and greig 2015 ) . nz has a list of human introduced invasive species that has decimated portions of endemic ecosystems stoats and rats destroying native nz birds as a prime example ( norton 2009 ) . the interesting question is whether s. cerevisiae is classed as an invasive species in nz : while this species has been introduced by humans , at the moment its invasion is primarily restricted to agricultural ecosystems , where it arguably adds value . this work was supported by university of auckland faculty research development fund ( frdf ) ( grant 3700513 ) , plant and food research ltd . , the ministry of business , innovation and employment , and nz winegrowers grants to mrg . conflict of interest . none declared . | humans have acted as vectors for species and expanded their ranges since at least the dawn of agriculture . while relatively well characterised for macrofauna and macroflora , the extent and dynamics of human - aided microbial dispersal is poorly described .
we studied the role which humans have played in manipulating the distribution of saccharomyces cerevisiae , one of the world 's most important microbes , using whole genome sequencing .
we include 52 strains representative of the diversity in new zealand to the global set of genomes for this species .
phylogenomic approaches show an exclusively european origin of the new zealand population , with a minimum of 10 founder events mostly taking place over the last 1000 years .
our results show that humans have expanded the range of s. cerevisiae and transported it to new zealand where it was not previously present , where it has now become established in vineyards , but radiation to native forests appears limited . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the conventional methods of bone repair which commonly are used , including autografts and allografts , have their own shortcomings . autografts are limited in terms of the availability of materials and may result in donor site morbidity . using allografts may be more desirable in some cases but the possible immune reaction and infection transmission limit their application . to overcome these limitations , various synthetic bone substitutes made of metal , ceramics , polymers , etc . , have been introduced to accelerate and improve the process of bone regeneration , though their safety , effectiveness , and efficacy remain uncertain . recently , with the increasing number of invasive surgical procedures especially in the fields of orthopedics and dentistry , the bone repair techniques using new materials are getting more popular . the new materials which are used should help us to reduce the operation time , scar size , postoperation pain , and also improve patient recovery . chitosan is a chitin - derived polymer which is produced by the deacetylation of chitin . these shells which were regarded as garbage in past times are a valuable source of chitin . many biomedical applications , including wound healing , bandage , skin grafting , hemostasis , hemodialysis , drug delivery , preventing dental plaque , hypertension control , calcium absorption , bilirubin absorption and cholesterol control , have been identified for improving by using chitosan.[48 ] several desirable properties have been described for chitosan , including high osteoinductivity , osteointegratability , easy application , and gradual biodegradability that make it a good candidate for bone regeneration . some researchers have studied effects of chitosan compounds on animal bone repair.[911 ] histopathological effects of chitosan on the bone regeneration process in wistar rats are presented in this study . , a chitosan powder was obtained from capsules made by springleaf co. ( sydney , australia ) . the contents of 20 capsules were removed to special plastic bags and sterilized by gamma radiation of 13 - 15 kgy . fifteen adult male wistar rats weighing 300 - 350 g were randomly assigned to one of three study groups : 1- , 2- , and 4-week groups . the rats got anesthetized by a mixture of 2% xylazine hydrochloride and 10% ketamine hydrochloride . their legs were disinfected using the ethanol 70% spray and shaved in the areas over tibias . the tibias were exposed through skin incisions and the periosteum was removed by a fine elevator . a 3 - 4 mm deep microdrill hole was then created in the upper part of each tibia using a microsurgery straight hand piece driven by surgic xt plus micromotor ( nsk , kanuma , japan ) with 3-mm round burs ( xemax surgical product inc . , constant irrigation with cold sterile normal saline was applied to prevent thermal necrosis and wash away bone debris . the defects of right leg tibias were filled in by a sterilized chitosan powder mixed with a drop of rat blood and those of the left ones were left unfilled to serve as controls . the rats then were transferred to a warm room to recover from anesthesia and allowed an unrestrained activity in cages . they received 0.2 ml of ketoprofen via subdermal injection daily for 3 days as an analgesic and also 0.5 ml of floxacine for infection control . at 1 , 2 , and 4 weeks postoperation , the rats in respective groups were sacrificed by putting them into a container of diethyl ether 97% . after fixation was completed , the legs were cut at 5 mm above and under the surgery site including the surrounding tissue and skin . those parts containing the hard tissue ( bone ) need to be decalcified for block preparation and sectioning . this step was performed by placing the samples in nitric acid 10% for 24 hrs . the presence of water in the tissue prevents the penetration of the preparing material ( paraffin ) into the tissue . so in order to dehydrate the tissue , samples were placed in alcohol 50% , 70% , and 90% and absolute alcohol and then were placed in xylol to substitute for alcohol ( dehydration process ) . in the infiltration step , samples were place in molten paraffin ( 50c ) . from the samples embedded in paraffin , serial microscopic sections of 3 - 4 m thick were prepared using a leica microtome ( leica microsystems , wetzlar , germany ) . then the slices from the repaired bone cavity were stained with hematoxylin and eosin for microscopic examination . the slices were studied using an olympus microscope ( olympus optical co. , ltd , tokyo , japan ) in a high - power field ( 400 ) . two slices from each defect were examined and graded by an expert pathologist for bone regeneration ( grades 1 - 3 ) , assessing inflammation ( grades 0 - 3 ) , foreign body reaction ( + / ) , bone vitality ( + / ) , and remained chitosan ( low , medium , high ) . bone regeneration was graded 1 if woven bone was seen , 2 if both woven and lamellar bones were seen , and 3 if just lamellar bone was seen . inflammation was graded as based on the number of infiltrative cells seen in a visual field , from 0 to 3 . the decision on foreign body reaction was made based on the presence of multinuclear giant cells . bone vitality was signed as positive if there were osteocytes inside lacunae . to test the hypothesis that chitosan accelerates bone repair , differences in bone regeneration between the intervention and control specimens were analyzed by the kappa test , among 1- , 2- and 4-week groups using spss version 11 ( spss inc . , chicago , il , usa ) . a p value less than 0.05 was considered as significant . fisher 's exact test was used to determine if the intervention groups were significantly different from the control group in terms of inflammation and bone regeneration against inflammation . the proposal of this study got approved by the ethics committee of shahid sadoughi university of medical sciences . fifteen adult male wistar rats weighing 300 - 350 g were randomly assigned to one of three study groups : 1- , 2- , and 4-week groups . the rats got anesthetized by a mixture of 2% xylazine hydrochloride and 10% ketamine hydrochloride . their legs were disinfected using the ethanol 70% spray and shaved in the areas over tibias . the tibias were exposed through skin incisions and the periosteum was removed by a fine elevator . a 3 - 4 mm deep microdrill hole was then created in the upper part of each tibia using a microsurgery straight hand piece driven by surgic xt plus micromotor ( nsk , kanuma , japan ) with 3-mm round burs ( xemax surgical product inc . , constant irrigation with cold sterile normal saline was applied to prevent thermal necrosis and wash away bone debris . the defects of right leg tibias were filled in by a sterilized chitosan powder mixed with a drop of rat blood and those of the left ones were left unfilled to serve as controls . the rats then were transferred to a warm room to recover from anesthesia and allowed an unrestrained activity in cages . they received 0.2 ml of ketoprofen via subdermal injection daily for 3 days as an analgesic and also 0.5 ml of floxacine for infection control . at 1 , 2 , and 4 weeks postoperation , the rats in respective groups were sacrificed by putting them into a container of diethyl ether 97% . after fixation was completed , the legs were cut at 5 mm above and under the surgery site including the surrounding tissue and skin . those parts containing the hard tissue ( bone ) need to be decalcified for block preparation and sectioning . this step was performed by placing the samples in nitric acid 10% for 24 hrs . the presence of water in the tissue prevents the penetration of the preparing material ( paraffin ) into the tissue . so in order to dehydrate the tissue , samples were placed in alcohol 50% , 70% , and 90% and absolute alcohol and then were placed in xylol to substitute for alcohol ( dehydration process ) . in the infiltration step , samples were place in molten paraffin ( 50c ) . from the samples embedded in paraffin , serial microscopic sections of 3 - 4 m thick were prepared using a leica microtome ( leica microsystems , wetzlar , germany ) . then the slices from the repaired bone cavity were stained with hematoxylin and eosin for microscopic examination . the slices were studied using an olympus microscope ( olympus optical co. , ltd , tokyo , japan ) in a high - power field ( 400 ) . two slices from each defect were examined and graded by an expert pathologist for bone regeneration ( grades 1 - 3 ) , assessing inflammation ( grades 0 - 3 ) , foreign body reaction ( + / ) , bone vitality ( + / ) , and remained chitosan ( low , medium , high ) . bone regeneration was graded 1 if woven bone was seen , 2 if both woven and lamellar bones were seen , and 3 if just lamellar bone was seen . inflammation was graded as based on the number of infiltrative cells seen in a visual field , from 0 to 3 . the decision on foreign body reaction was made based on the presence of multinuclear giant cells . to test the hypothesis that chitosan accelerates bone repair , differences in bone regeneration between the intervention and control specimens were analyzed by the kappa test , among 1- , 2- and 4-week groups using spss version 11 ( spss inc . , chicago , il , usa ) . a p value less than 0.05 was considered as significant . fisher 's exact test was used to determine if the intervention groups were significantly different from the control group in terms of inflammation and bone regeneration against inflammation . the proposal of this study got approved by the ethics committee of shahid sadoughi university of medical sciences . all 30 rat tibias ( 15 with chitosan powder and 15 controls ) in three stages ( 1 , 2 , and 4 weeks after operation ) were blindly studied by a pathologist . the kappa test on both chitosan and control samples indicated that bone defects filled with the chitosan powder showed a significantly faster healing process compared to those of control ones at 1 week ( p = 0.01 ) and 4 weeks ( p = 0.038 ) after operation , whereas this difference was not statistically significant between the two groups after 2 weeks ( p = 0.197 ) . one week after the surgery , no woven bone was seen in either the chitosan or control specimens [ figure 1 ] , but 2 weeks and 4 weeks postoperation , more woven bone was observed in the chitosan specimens compared to that in the control specimens [ figures 2 and 3 , respectively ] . our results indicated that there was fibrosis in 4 specimens in the chitosan group after 1 week , while this number decreased to 2 after 2 weeks , and there was no case of fibrosis in the case group after 4 weeks . there was no fibrosis after 1 week in the controls and this number increased to 4 after 2 weeks , and to 3 after 4 weeks in controls . regarding the observation of the granulation tissue , it was seen in one of the cases in the chitosan group , and in five control cases after 1 week , while there were no cases in both groups after 2 and 4 weeks [ table 1 ; figures 2 and 3 ] . inflammation grading was made on the basis of the number of infiltrative cells in the high - power field of microscopic studies of the specimens . various grades of inflammation were seen in all three stages of the study . statistical analysis using the kappa test interestingly showed no significant difference in inflammation between the chitosan and control specimens [ table 2 ] . just 2 ( out of 15 ) chitosan specimens showed reaction to foreign bodies at 2 and 4 weeks after surgery identified by the presence of multinucleated giant cells , but the other specimens showed no reaction . the amount of chitosan remained in the micro - drilled defects was also assessed visually by a pathologist and was graded as low , moderate , and high . four weeks after surgery , the remained chitosan in four specimens was assessed and found to be low , and just one specimen was graded as moderate in this classification . micrographs of the tibia 1 week after surgery in a case ( left ) and a control ( right ) subject . ( a ) chitosan particles , ( b ) bone marrow , ( c ) microdrilled defect , ( d ) fibrous tissue , ( e ) granulation tissue with inflammatory cells micrograph of the tibia 2 weeks after surgery in case ( left ) and control ( right ) groups . ( a and e ) woven bone , ( b ) tibia bone , ( c ) bone marrow , ( d ) chitosan particles micrograph of tibia 4 weeks after surgery in case ( left ) and control ( right ) groups . ( a ) woven bone and surrounding connective tissue , ( b ) remaining chitosan bone healing status of case ( chitosan ) and control specimens at three different stages comparing inflammation severity between chitosan and control specimens at three different stages an ideal material for bone regeneration , as indicated by prior studies , should be biocompatible , biodegradable , easy to apply , and effective on bone repair . since chitosan has been shown by shin et al . , and other researchers to possess these properties , we studied its effectiveness on bone defect healing in micro - drilled tibias in rats . it is important for bone replacement materials to be highly adaptable to the bone defects . we used chitosan in the form of powder to fill in the bone defects and remain there for local absorption . also to compare the treated bone healing with those of untreated , the defects in the control bones were left unfilled . our study is different from the others in terms of using pure chitosan instead of chitosan compounds and also applying it in a powder form to achieve good adaptation to bone defects . chevrier et al . , showed in their study that chitosan increases vascularization and induces granulation tissue generation . the achieved results at 1 week postoperation showed granulation tissue in all control specimens , while in the chitosan group fibrosis of various degrees was seen . this trend of a faster bone regeneration process could be seen in subsequent stages . at 2 weeks postoperation , a mixture of woven bone and fibrous tissue ( with superiority of the woven bone ) was seen in treated defects , whereas in untreated ones , the fibrous tissue was dominant . , four weeks after surgery , woven bone was seen in all chitosan - treated specimens , whereas just two specimens in the control group developed woven bone . it has been observed that chitosan , a natural biopolymer which is derived from chitin , and some of its derivatives , such as chitosan dihydrochloride , may act as wound healing accelerators , bone substitutes , antimicrobial agents , and may show hemostatic activities . it is documented that these substances are biodegradable and nontoxic.[1619 ] recently , chitosan composites have been widely used in bone tissue engineering due to their unique properties such as low foreign body reactions , biocompatibility , and their moldability.[2026 ] chitosan can act as a hydrating agent and can be processed into different forms such as scaffolds , nanoparticles , and gels . it is also believed that the chitosan composite improves the mechanical strength of the scaffold material . mathews et al . , proposed that chitosan can increase mineralization by upregulating the associated genes as a mechanism for the osteogenesis of this substance . boynueri et al . , in their study found that the chitosan gel combined with the demineralized bone matrix / collagenous membrane or even alone is useful for periodontal regeneration although spin - neto et al . , found that these substances were not able to promote new bone formation in critical size defects which were made in rat 's calvaria . in their study found that chitosan tubes have a favorable compatibility with the bone tissue and promote bone regeneration and may accelerate bone formation stimulated by recombinant human bone morphogenetic protein-2 . in another study , budiraharjo et al . , found that hap - coated cmcs scaffolds can act as osteogenic scaffolds for the stimulation of bone healing . geffre et al . , compared the osteoinductivity of purified chitosan cap and the conventional form and found that the former substance had a lower osteoinductivity potential . inflammation was associated with chitosan group in higher degrees than the control group in all three stages of the study . reaction to the foreign body was seen in two cases of chitosan - treated defects , and both of them were accompanied by sever inflammation . this reaction could be due to the dislocation of the chitosan powder or some other clinical manifestation . the remaining chitosan at 4 weeks postoperation was less than that at 1 and 2 weeks which shows a proper descending trend . this decrease could be mainly due to local absorption by the surrounding tissues , though we could not rule out the probability of physical withdrawal from the filled - in site during the time . . these differences could be due to variation in techniques , animal subjects , or type of the bone selected . we used chitosan in a pure powder form whereas other studies used it as compounds with some other materials like hydroxyapatite and calcium sulfate . bone mass , blood perfusion of the repairing bone , and also the species of the animal used as subjects are important parameters when considering the final results of such studies . this study shows that chitosan is effective in bone regeneration in the micro - drilled rat tibia . considering the osteoinductivity of chitosan , it can be used to promote bone repair in situations where rapid bone regeneration is of high importance or there is a lack of normal osteogenesis due to systemic disorders . some more studies with different animal subjects and techniques are needed to approve safety and long - term effects of this material . | background : chitosan compounds have been shown to be suitable bone replacement materials . to evaluate the accelerating effects of chitosan on the bone regeneration process and assessing its histopathological adverse effects , we conducted this study on rat tibias.materials and methods : in a laboratory experimental study , micro - drilled bone defects were created in the upper tibia of each leg in 15 adult male rats . the defect in the right leg , filled by the chitosan powder , was compared with the untreated defect in the left leg in each rat at 1 , 2 , and 4 weeks after surgery .
bone repair and inflammation in each specimen was blindly graded by a pathologist .
reaction to the foreign body and the amount of the remaining chitosan were studied in chitosan - treated specimens at the three stages of the study.results:bone repair was significantly faster in the chitosan group , 1 week ( p = 0.01 ) and 4 weeks ( p = 0.038 ) after surgery , while the difference was not significant at the 2-week stage ( p = 0.197 ) between chitosan and control groups .
chitosan - induced inflammation was not significant in any stage of the study .
reaction to the foreign body was seen in one case at 2 weeks and one case at 4 weeks postoperation.conclusion:chitosan significantly accelerated the bone regeneration process in rat tibias . regarding its biocompatibility and osteoinductivity , it can be studied as a biomaterial in human bone healing . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the success of restorative dentistry is determined on the basis of functional results and esthetic outcomes . the constant evolution of restorative materials and techniques has made possible the achievement of optimal esthetics . currently , fluoride - releasing esthetic restorative materials have been extensively used due to their caries preventive effect . however , the color stability of these restorative materials has been a challenge to dentistry , as the oral cavity has a dynamic environment . due to the constant presence of oral microflora , saliva and the frequent intake of food , the color stability of an esthetic material like composite resin previous studies have revealed that composite resins are susceptible to various degrees of discolouration which may be attributed to intrinsic or extrinsic factors . intrinsic factors involve alterations or changes in the chemical structure of the composite resins under physical and chemical conditions , while extrinsic factors are mainly due to surface staining from absorption or adsorption of exogenous substances . it is reported that matrix , filler composition and content , minor pigment addition , initiation components and filler coupling agents also affect color of esthetic materials . the visible color alterations in esthetic materials can also be ascribed to the proprietary differences in chemistry that may affect the polymerization , water sorption , and consequently the color stability of the material . in addition , the obvious effect of colorants in beverages and foods leads to extrinsic discoloration of composites . thus , for suitable performance , longevity and good clinical success of esthetic restorations , the material of choice should present adequate inherent characteristics . however , the property of color stability of esthetic dental materials is often ignored over other physical and mechanical properties while making a choice . the ideal composite resin formulations that may permit an optimal esthetic outcome without compromising the mechanical properties essential for a suitable functional outcome are nevertheless under exploration . it is imperative that an ideal anterior restorative material should exhibit adequate esthetics as a function of color stability in addition to other properties such as strength and biocompatibility and at the same time aid in prevention of secondary caries formation . the conventional glass ionomer cement ( gic ) is a fluoride - containing restorative material with non - satisfactory esthetics . thus , different hybrid restorative materials such as high - viscosity gic , polyacid - modified resin composite , giomers , and resin - modified glass ionomer cement ( rmgic ) have been developed to improve some physical properties of the materials , including the esthetics . however , there is limited information regarding the color stability of these hybrid restoratives . thus , the aim of the present study was to evaluate the color stability of two hybrid esthetic restorative materials , when subjected to immersion in various children 's beverages . the test restorative materials used in the study were resin - modified glass ionomer cement ( gc fuji ii lc capsules - gc corporation , tokyo , japan ) and giomer ( beautifil ii - shofu inc , kyoto , japan ) . for preparation of the test specimens , a custom - made teflon ring mould was used . the capsules of rmgic were activated and mixed in amalgamator ( gnatus amalga mix 2 ) for 10 seconds according to manufacturer 's instructions . the specimens were made by placing the respective materials into the mould over a glass slab sandwiched between two mylar strips using gc applier ; the smoothest surfaces were obtained by curing the materials against the mylar strip . the material was light - cured for 40 seconds on each side ( henry schein 's maxima led unit ) . similarly , giomer specimens were prepared by incremental insertion into the mould with plastic instruments followed by sandwiching between two mylar strips and light - curing for 40 seconds on each side . after preparation , the specimens were kept in distilled water for 24 hours to achieve rehydration . after rehydration , the samples were rinsed and dried with filter paper , and the baseline color measurements were performed using spectrophotometer ( gretag macbeth color - eye 7000a ) . color evaluations were made with color parameters based on average daylight ( d65 : 6504 k ) and illuminating view geometry d/10 . individual specimens were placed on aperture , and readings were recorded according to commission internationale de leclairege l*a*b * color space ( cielab ) . after baseline evaluation , the above groups were further divided into 6 experimental subgroups for immersion in 3 children 's beverages , namely , orange juice ( pepsico , india ) , bournvita milk ( kraft foods , cadbury india ) , and coke ( the coca - cola company , atlanta , ga ) . for each subgroup , the bournvita milk was prepared using 15 g of bournvita poured into 500 ml of unsweetened hot milk and filtered after 10 minutes . the specimens were subjected to ph - cycling by daily immersion in demineralizing solution for 7.5 hours and in a remineralizing solution for 16 hours . the demineralizing solution was prepared using 2.2 mm cacl2 , 2.2 mm nah2po4 , and 50 mm acetic acid adjusted to ph 4.8 . the remineralizing solution was prepared using 1.5 mm cacl2 , 0.9 mm nah2po4 , and 0.15 m kcl adjusted to ph 7 . these solutions served as storage medium for the specimens so as to mimic the oral environment . the specimens were removed daily from the ph cycling solutions and immersed in respective beverages for 30 minutes . subsequent to immersion and ph cycling , new color evaluations were carried out after 1 week ( t1 ) and 4 weeks ( t4 ) for all the experimental groups . l*a*b * values of each specimen were measured 3 times by placing each specimen on the measuring head . the values of dl * da * and db * after 3 measurements were automatically calculated by spectrophotometer and recorded . resistance to staining effect was expressed in delta e unit and calculated from the mean dl*da * and db * values for each specimens with the following formula , equation : delta e = [ ( dl*)+ ( da*)+ ( db * ) ] the data generated during the study was processed with the aid of pasw 18.0 software ( formerly known as spss ) . the comparative evaluation of color change ( de ) as a function of different beverages was obtained using one - way analysis of variance ( anova ) . the statistical analysis indicated that the de of bournvita group was significantly ( p < 0.05 ) lesser than that observed with orange juice and coke groups at both time periods , i.e. t1 and t4 with rmgic . the de of orange juice group was significantly ( p < 0.05 ) lesser than that observed with bournvita and coke groups at both time periods , i.e. t1 and t4 with giomer [ tables 1 and 2 ] . mean color change ( de ) recorded as a function of use of different beverages using rmgic after 1 week ( t1 ) and 4 weeks ( t4 ) mean color change ( de ) recorded as a function of use of different beverages using giomer after 1 week ( t1 ) and 4 weeks ( t4 ) in rmgic group , it was observed that there was a significant increase in mean color change after 4 weeks when compared to that observed after 1 week of immersion in orange juice . the maximum color change took place after 1 week of immersion in bournvita and coke . the color change gradually decreased over the period of 4 weeks with bournvita and coke [ table 1 ] . the results for giomer showed that the maximum color change took place after 1 week of immersion in orange juice and bournvita . the color change gradually decreased over the period of 4 weeks with orange juice and bournvita . there was a significant increase in mean color change after 4 weeks when compared to that observed after 1 week of immersion in coke [ table 2 ] . it could be concluded on the basis of statistical analysis of the data that comparatively , giomer indicates a better color stability than that exhibited with material rmgic [ graph 1 ] . comparative assessment of the least mean color change ( de ) obtained with rmgic and giomer according to paired t test the discoloration of tooth - colored , resin - based materials may be caused by intrinsic or extrinsic factors . the use of instrumental methods like spectrophotometers and colorimeters to quantify tooth color could potentially eliminate the subjective aspects of color assessment . the american dental association recommends the use of the cielab color differential system in assessing chromatic differences . in the present study , the color evaluations were made using a reflectance spectrophotometer using the cielab color system . this system is a useful mode that provides information about location of object color in a uniform 3-d color space . it quantifies the color in terms of 3 co - ordinate values l * , a * , and b*. here , l * represents brightness or lightness ( value ) , and a * and b * serve as numeric correlates both for hue and chroma . the a * and b * values represent position on a red / green and yellow / blue axis , respectively . the magnitude of the color difference ( delta e ) perceived between two objects is thus calculated . the higher the delta e , the greater the difference between the two samples being compared . a delta e value of 3.3 or less is considered to be clinically acceptable in dentistry . the results of the present study showed that giomer exhibited greater stain resistance as compared to rmgic at both time periods with respect to all of the tested beverages . this difference in the color stability of the two materials tested could be attributed to the differences in various factors as discussed further . the oral environment is exposed to a variety of media on a daily basis , many of which may stain or alter the surfaces of dental restorations , potentially causing esthetic degradation . staining of oral tissues and restorations is known to be affected by dietary factors . while many studies exist on the staining effects of beverages on tooth - colored restorations , the beverages used in most of these studies were coffee , tea , and wine , which are normally associated with adult tooth stains . a few studies have evaluated the effects of common beverages ingested by children and their staining effects on restorative dental materials , but studies on fluoride - releasing restorative materials have not been previously reported . consumption of soft drinks is known to have increased in recent years , and is especially high among younger individuals . the effect of cola on the color stability of restorative materials has been evaluated ; however , the effects of chocolate milk and orange juice have not been reported . therefore , the present study measured the color stability of rmgic and giomer after exposure to various children 's drinks . also , the choice of the beverages in the present study attempted to represent diverse areas of the color spectrum . there are differences in consistency also as juice is a thin , watery solution , bournvita milk is sugary , and coca - cola is carbonated . additionally , the beverages show varying ph like 3.0 ( cola ) , 3.88 ( orange juice ) , and 6.9 ( bournvita milk ) . in the present study , although color change was observed maximum in 1 week , it gradually increased from 1 week to 4 weeks with cola samples . this could be attributed to low ph of cola , which may lead to increased surface roughness . in the present study , a ph cycling process has been used in order to simulate the oral environment . however , it has been previously reported that fluoride - releasing materials have a greater ion release when submitted to ph variations than when stored in artificial saliva or saline . these facts could lead to lower color stability evident in the present study due to the great amount of ionic changes between the materials and the environmental solutions . staining susceptibility of resin - based materials might be attributed to their degree of water sorption and hydrophilicity of matrix resin , that is , if the resin composite can absorb water , it can also absorb other fluids like tea and coffee . the glass filler particles will not absorb water into the bulk of the material ; however , can absorb water onto the surface . in the literature , hydrophobic materials like resin composites are believed to exhibit greater stain resistance and color stability than hydrophilic materials like glass ionomer cements and compomers . it is reported that most of the water sorption with resin - based materials was observed during the first week . chan et al . investigated the staining potential of coffee , tea , cola , and soy sauce on two different resin composites and reported that staining after 1 week of immersion differed significantly from all succeeding weeks , and the greatest amount of discoloration occurred during the first week , which is in agreement to the results obtained in the present study . the color stability is also related to the resin matrix , dimensions of filler particles , depth of polymerization , and staining agents . among the materials tested , it has been previously reported that glass ionomer cements lack color stability due to the polyacid content of the material and can be explained by the degradation of metal polyacrylate salts . this may be attributed to the amount of resin and filler particles present in the giomer . rmgic is a hybrid material with a mean filler size range of 1.8 m , with filler loading 76 wt.% by volume . giomer is a bridge product ; with filler loading 83.3 wt.% and a particle size of 0.8 m . the composition and size of the filler particles affect the surface smoothness and the susceptibility for extrinsic staining . therefore , it can be expected that giomer , with a smaller particle size , will have a smoother surface and will retain less surface stains than rough surfaces . moreover , it is reported that giomer consists of additional discrete nano - fillers ( 10 - 20 nm ) , which makes it possible to incorporate larger filler content of 68.6 vol% . this may lead to a better polishability and surface finish and subsequently , more resistance to staining with giomer . based on the results of the present color stability evaluation , it can be stated that giomer material showed greater resistance to staining as compared to rmgic at all time periods . | purpose : the present study was aimed to evaluate and compare the color stability of two hybrid tooth - colored restorative materials , namely , resin - modified glass ionomer cement ( gc fuji ii lc capsules - gc corporation , tokyo , japan ) and giomer ( beautifil ii - shofu inc , kyoto , japan ) when subjected to immersion in various children 's beverages.materials and methods : standardized disc specimens were prepared using the test restorative materials .
after preparation and rehydration of the specimens , baseline color evaluations were performed using spectrophotometer .
the readings were recorded according to cielab color space .
the experimental groups were further subdivided for immersion in orange juice , bournvita milk , and coke .
subsequent to immersion and ph cycling , new color evaluations were carried out after 1 week and 4 weeks for all the experimental groups .
the mean color change values were calculated.results:the obtained data was subjected to statistical analysis .
the results indicated that giomer specimens exhibited less color change as compared to rmgic specimens indicating better color stability .
the maximum color changes were found with the use of coke for a period of 4 weeks.conclusion:amongst the two materials , giomer showed less color changes as compared to rmgic indicating a better color stability . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
an 86 year old lady with a past medical history of hypertension , diabetes mellitus , hypothyroidism , bell s palsy , transient ischemic attack , hypercholesterolemia , parkinson s disease , abdominal aortic aneurysm repair , peripheral vascular disease , stage iv chronic kidney disease , renal artery stents , coronary artery disease with a history of drug eluting stents to the right coronary and left circumflex arteries and diastolic heart failure was admitted to our hospital with severe chest pain . she also suffered two non - st segment myocardial infarctions ( nstemi ) in the past three weeks . during all her previous admissions she was considered a high - risk candidate for any invasive therapy due to multiple co - morbidities and hence was managed medically . however , on this occasion the patient agreed to a coronary angiogram . the coronary lesions were as follows : there was a diffuse 60% stenosis of distal third of left main coronary artery . the left anterior descending artery ( lad ) revealed an 80% stenosis at the ostium followed by 70% stenosis of mid portion . the first obtuse marginal showed tubular 70% stenosis in the middle third of the vessel segment . there was also a discrete 70% stenosis in the ostial right coronary artery ( rca ) and 70% stenosis of mid rca . distal abdominal aortography with bilateral run - off revealed no significant aorto - iliac disease . she was deemed a poor candidate for surgery and the only options were high risk pci or medical management . the patient did not agree to surgery or pci and was managed with aggressive medical treatment . she was readmitted within two weeks for another episode of unstable angina and acute nstemi . having failed medical therapy , she agreed to undergo high risk pci . a multi - vessel pci of left main into lad and possibly of ostial right coronary artery and obtuse marginal was planned . the impella recover lp 2.5 lvad was chosen for circulatory support during this high - risk procedure . after obtaining adequate arterial access and insertion of appropriate sheaths , the impella 2.5 device was placed in the left ventricular cavity via the left common femoral artery ( cfa ) sheath , under fluoroscopy and adequate flow ensured . a cine run of the left ilio - femoral system was performed before and after insertion of the sheath . there was some sluggish flow noted in the left superficial femoral artery ( sfa ) . at this time a decision was made to only perform a left main and lad intervention and stage the other lesions . using right cfa access , a balloon angioplasty and bare metal stenting were performed on the left main and mid lad lesions with excellent angiographic appearance and 0% residual stenosis . this revealed extremely sluggish flow in the left sfa with the appearance of multiple thrombi like lesions throughout its course . the 13 french ( fr ) impella device sheath was removed and hemostasis achieved successfully with perclose . a 6 fr multipurpose catheter was placed via the right cfa sheath into left common iliac and a selective angiogram of the left common iliac , external iliac and common femoral arteries was obtained . this confirmed our previous findings with better delineation of the thrombus like lesions along the length of the sfa . two inflations of the cfa at the site of perclose sutures was performed with a 4.0 20 mm fox plus balloon with 10 atmospheres of pressure . the patient had developed an acutely ischemic limb secondary to cessation of antegrade flow down the left superficial femoral artery . the pronto extraction catheter is another device commonly used for thrombus extraction with very little set up time . this was readily available and in our experience has shown tremendous success in thrombus extraction in coronary cases . hence we decided to stop at this point and did not go ahead with use of the angiojet device . her post procedure period was complicated by acute kidney injury in the face of chronic kidney disease , requiring hemodialysis for two sessions three days apart . four months after the procedure , the patient remains angina free and has not been readmitted since . mechanical assist devices have found a growing role in high risk pci due to an increasing patient population with complex co - morbidities , most of whom are not good candidates for surgery . it is inserted via a 13 french sheath and placed under fluoroscopic guidance in the left ventricular cavity . the device is capable of providing 2.5 litres / minute of blood flow and thus ensures a stable cardiac output . successful use of the impella as a circulatory support device in high risk pci was initially reported from europe.1 it has also been used in patients with cardiogenic shock either alone or in combination with other devices like intraaortic balloon pump.2,3 this device can be maintained in situ for five to seven days and was recently approved for use in the usa by fda for partial circulatory support up to six hours . reported complications associated with the impella device include sensor failure , pump displacement , hemolysis and functional mitral stenosis.2,4 it is thought that due to the use of a larger sheath ( 13fr ) , there may be increased incidence of local vascular complications including bleeding and limb ischemia but has not been observed in the published experience . recent large multi - centre registries from europe and previous small feasibility trials have not reported any major local vascular complication especially limb ischemia.57 in our case , the impella device was used in a patient with triple vessel coronary artery disease and left ventricular dysfunction , who was a poor surgical candidate and was undergoing high - risk coronary intervention including left main stenting . our patient had mild peripheral vascular disease noted during angiography , because iliac vessels were found free of the disease , the use of impella device was not contraindicated . after successful pci , when the 13 fr sheath placed for impella device was removed , thrombus formation was noted on the same side in sfa during angiography . as acute thrombosis of sfa can be limb threatening and would required immediate surgery or thrombolytic therapy , successful thrombectomy and recovery of blood flow was achieved with the use of pronto v3 device . the acute thrombosis was likely related to stasis and near complete occlusion of antegrade flow to the sfa secondary to a large sheath in ilio - femoral vasculature . pronto v3 is one of the thrombectomy devices , used with better outcomes in stemi patients for performing thrombectomy before pci.8 it has been used successfully in management of acute stent thrombosis.9 there are a few case reports of utilizing pronto v3 in managing non - coronary vascular thrombosis.1012 ours is the first documented case utilizing pronto v3 thrombectomy device in managing acute superficial femoral artery thrombosis . in summary , vascular complications such as bleeding , pseudo - aneurysm , infections , limb ischemia and av fistulas are always a possibility during pci especially when percutaneous assist devices with bigger sheaths are utilized simultaneously . extra caution has to be adopted in high - risk patients in particular patients with peripheral vascular disease . even though these local vascular complications have not been reported heavily | the impella recover lp 2.5 is a percutaneous left ventricular assist device ( lvad ) recently approved for use in patients undergoing high risk percutaneous coronary intervention ( pci ) and also in cases of cardiogenic shock .
there is limited evidence available in literature about its safety , especially with regards to the incidence of local vascular complications , their management and long - term implications .
we report here the first case of a serious local vascular complication superficial femoral artery thrombus formation during impella recover lp 2.5 use in a high risk pci which was managed successfully with novel aspiration thrombectomy catheter ( pronto v3 ) , which in itself is the first reported use of pronto v3 in such a vascular complication . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
desmoplastic fibroma of bone is a well differentiated , locally aggressive fibrous tumor that histologically resembles the extra abdominal desmoid tumor of soft tissues . it is extremely rare , and less than 200 cases have been reported so far.12 the most common site of affection is the jaw , followed by pelvis and long bones.34 forearm bones are rarely involved.58 the mainstay of treatment is surgical excision . wide excision followed by reconstruction of the bony defect using fibular graft has been widely described in tumor surgery . fibular graft functions well as an intercalary graft ; even , there are reports of reconstruction of the distal radius ( after excision of giant cell tumor ) using fibular graft where the fibular head functions as an articular part of the wrist joint . however , there are no reports of the use of fibular graft in reconstruction of the elbow joint . we report a case of giant desmoplastic fibroma of ulna that has involved the proximal two thirds . the unique technique of reconstruction of the olecranon process with the articular surface of the fibular head has been described . a 15-year - old child presented with a 3-year history of progressively increasing swelling in the right forearm . there was no significant pain or constitutional symptoms . local examination revealed a diffuse swelling over dorsomedial and medial aspects of the forearm , extending from just below the elbow joint to about 8 cm above the wrist . swelling was firm in consistency , with a bosselated surface and was arising from ulna . plain radiograph showed an expansile osteolytic growth involving the proximal ulnar metaphysis and two - third of the diaphysis [ figure 1a ] . there was honeycomb pattern with coarse ridge like trabeculae , and matrix was purely lytic . magnetic resonance imaging showed a large circumferential growth arising from the central medullary canal , expanding the bone [ figure 1b ] . surrounding cortex was intact and there was no soft tissue component . elbow and wrist joints were free of tumor . the tumor appeared iso- to hypointense to muscle on t1-weighted images and the majority of the tumor areas were isointense to surrounding muscle on t2-weighted images . ( a ) preoperative anteroposterior and lateral radiographs showing a well demarcated expansile osteolytic growth involving about two - thirds of ulna . ( b ) magnetic resonance imaging showing a large circumferential growth from the central medullary canal , expanding the bone . surrounding cortex is intact and there is no soft tissue component the tumor was excised including half of the olecranon process and distally up to about 9 cm from the wrist joint . cut surface showed a homogenous grayish white appearance destroying the entire bone with intermittent ballooning of the cortex . the head of fibula was cut transversely to match the remaining half of the olecranon process to recreate the elbow joint . this was fixed with the remainder of the olecranon process with tension band wires and a square nail . the head of the fibula was cut transversely , and the distal part of the head and shaft was used for reconstruction . the transverse cut in the head of fibula was aligned at the articular surface with the remaining proximal olecranon . distally fibular diaphysis was fixed with ulnar shaft with a dynamic compression plate [ figures 2 , 3 ] . the functional attachment of the triceps was that which remained attached to the proximal olecranon . some part of the triceps attachment was also freed from the resected part of the ulna . postoperative radiograph anteroposterior and lateral views of the same patient showing restoration of the proximal ulnar anatomy with fixation hardware in situ 20 microscopic field of the tumor section showing monomorphic cells without any anaplastic changes , interspersed between the strands of collagen , arranged in a parallel fashion histopathology of the tumor revealed a moderately cellular lesion on low - power microscopy , with spindle - shaped cells interspersed between the strands of collagen , arranged in a parallel fashion . on high - power microscopic field , there was clustering of monomorphic cells without any anaplastic changes or mitosis [ figure 3 ] . patient was followed up for 2 years with no evidence of recurrence . the fibular graft united with the olecranon proximally and distally with remaining part of ulna . followup radiographs at 2 years showing union of the fibular graft with proximal ulna and some restoration of the elbow joint ( a , b ) . desmoplastic fibroma of bones is considered to be locally aggressive with a high recurrence rate . radiological differential diagnosis include other lytic lesions such as aneurysmal bone cyst , giant cell tumour , chondromyxoid fibroma , and low - grade fibrosarcoma . treatment of choice is wide local excision through the normal soft tissue.78 recurrence rate is 17% following resection and as high as 55% following curettage.2 various options have been used in literature [ table 1 ] for the reconstruction of bone defects in forearm following tumor resections , such as creation of single bone forearm from radius and ulna and centralizing the carpus over the single bone , free fibular graft , fibular head graft for distal radius , and microvascular fibular graft and allografts . free fibular graft has proved to a good option for reconstruction of bony defects and has been extensively used in tumor surgery . the technique we have used to create the articular surface of the olecranon using the fibular head articular surface has not been previously described . though a normal joint surface can not be expected , this reconstruction is an acceptable option considering the morbidity of the tumor resection for elbow function . elbow is not a weight - bearing joint and some degree of degenerative changes can be tolerated . this will provide a more stable and mobile elbow joint compared to the single bone forearm . review of literature on desmoplastic fibroma arising from bone in forearm proximal half of the olecranon has been preserved during excision based on intraoperative frozen section . thus , the fibular graft functioned as an intercalary graft between the olecranon proximally and distal third ulna distally . firstly , it helped to maintain some integrity of the extensor apparatus of the elbow to have some useful elbow function also to and counterbalance the elbow flexors . secondly , it provided a surface to articulate with the trochlea to provide some stability and mobility of the elbow joint . most of the elbow articulation was made from this segment of the olecranon that was preserved . following principles of olecranon reconstruction from trauma surgery , elbow joint can be reasonably restored even if a large part of olecranon is sacrificed , provided the triceps mechanism is restored.910 this explains the reasonable range of motion achieved in elbow in this case . thus , desmoplastic fibroma is a rare tumor of bone with a benign but locally aggressive behavior . | desmoplastic fibroma is a rare , well differentiated , locally aggressive fibrous tumor usually arising from soft tissues , and rarely from bones .
involvement of forearm bones is extremely unusual .
we present a large desmoplastic fibroma of right ulna in a 15-year - old male .
the tumor was excised with a wide margin , and the bony defect was reconstructed with nonvascular autologous fibular graft .
reconstruction of the olecranon process was attempted using the fibular head and the remaining olecranon . at 2-years followup
, there was no recurrence , flexion extension arc of the elbow joint was 40130 and there was no restriction of activities of daily living . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the worldwide energy
consumption is predicted to double within
the next 40 years requiring a shift toward widespread use of renewable
energy . in this regard , sunlight is one
of the most important energy sources , which can be harvested e.g. ,
via photovoltaics or thermal heating for direct use . one of the challenges
for the development of solar energy technologies are variations in
both energy production and demand over time , which requires the use
of load leveling techniques . while electricity can
be stored using batteries for on - demand power supply , this technology
faces challenges with respect to cost and large - scale implementation . this can in principle be achieved via the conversion
of water to hydrogen or the reduction of carbon dioxide to methanol , which , however , involves gaseous species . energy
storage can instead also be accomplished in closed cycle photo isomer
systems . in these so - called molecular solar thermal ( most ) systems ,
the exposure of a low energy isomer to sunlight leads to its conversion
into a high energy isomer . the metastable high - energy
isomer can be converted back to its low energy counterpart by heating
or catalytic activation to release the stored energy . several molecular
and metal organic systems have been explored in this context ,
notably stilbenes , azobenzenes , anthracenes , ruthenium fulvalene compounds , and norbornadiene - quadricyclane ( n - q ) systems . both experimental
and theoretical aspects of this research field have been reviewed
recently . a material system that is suitable for most
applications must fulfill
a number of conditions in order to be practical : ( i ) the absorption spectrum has to be optimized with respect
to the solar emission spectrum to achieve maximal efficiency ( solar
spectrum match ) . ( ii ) the energy storage density should be
high , which implies a compromise between storage energy and molecular
size . ( iii ) the barrier for the back - conversion from the high - energy
to the low - energy isomer has to be sufficiently high to enable long - term
storage yet be accessible via a catalytic reaction to enable timely
energy release . ( iv ) the quantum yield for the photoconversion from
the low to the high - energy isomer should be close to unity . ( v ) the
price of the synthesized compounds must be competitive . in this study we focus on analyzing conditions i iii with respect to substituted
n - q compounds , for which condition iv is already achieved . systems based on norbornadiene ( n ) and
its high - energy isomer quadricyclane
( q ) have seen a recent resurgence , in part because of advances in
synthetic chemistry that enable the systematic insertion of donor
and acceptor - type substituents . we address the parent n - q system ( 1 ) as well as five diaryl - substituted n - q compounds ( 26 ) , see figure 1 , which have been previously investigated
experimentally . overview of compounds
considered in this work shown in their respective
norbornadiene variant . single and double primed numbers are used to
enumerate the carbon atoms in the first and second aryl ring , respectively . substitution provides a powerful
means for manipulating the energy
landscape , which is schematically shown in figure 2 . here , the ( minimum ) absorption energy h , the storage energy e ,
and the barrier for back - conversion e , respectively , relate to conditions i ,
h directly relates to the
rate of the thermal back - conversion ( q n ) via the eyring
equation . while substitution provides a lot of flexibility for material
optimization , it usually affects several properties simultaneously
and therefore requires a detailed understanding of the effect of individual
substituents as well as the interplay of donor and acceptors . figure 2b illustrates the
differences between the energy landscapes of the unsubstituted ( 1 ) and a diaryl substituted compound ( 2 ) . here ,
the substitution causes simultaneously a red - shift of the spectrum ,
a lower e , and an increase
of the storage energy e . while the first two
observations are in line with recent experimental results , experimental data pertaining to the storage
energies the molecule absorbs a photon with minimum energy h and while in its electronically excited state undergoes an
isomerization , forming the photoisomer . if the activation barrier
( e ) is sufficiently high ,
the photoisomer is trapped over an extended period of time ( i.e. ,
typically months to years ) . the energy difference between the parent
and the photoisomer ( e ) is the amount of energy
stored in the system and is regained as heat when the reversible isomerization
is activated , either catalytically or thermally . ( b ) energy diagram
for a substituted compound ( 2 ) . unlike in part a , the
transition state geometry was not obtained by full relaxation but
constructed following the procedure described in the text . note that
the slices displayed in parts a and b are based on the minimum energy
path on s0 , whence the excited state surface
represents an off - center slice of the conical intersection between s0 and s1 . the present
visualization is based on ( 8,8 ) casscf nudged elastic band calculations
of the singlet ground state ( s0 ) surface
followed by 4-state averaged multistate caspt2 calculations . as the synthesis of a specific
compound is still quite time - consuming ,
a purely experimental screening of donor acceptor combinations
is impractical . it is therefore highly desirable to complement experimental
work with first - principles calculations . because of the orbital structure
of n and q , which will be discussed in detail below , the quantum mechanical
description of these systems , however , poses challenges of its own . the objective of the present study is to establish the predictive
power of several computational techniques at various levels of sophistication
and computational expense with respect to optical , thermodynamic ,
and kinetic properties of a set of prototypical substituted n - q compounds ,
for which experimental data is available . in doing so we gain insight
into the detailed mechanisms that govern the behavior of these compounds
and address open questions pertaining in particular to the back - conversion
barrier . on the basis of our data , one can formulate a strategy for
the computational screening of n - q compounds that balances computational
expense and accuracy requirements , paving the way for a systematic
exploration of substitution strategies . we note that the unsubstituted
n - q system has been previously investigated
using multireference methods both with regard to ground and excited
state landscapes , and several substituted n - q systems
have been explored at the level of density functional theory ( dft ) . the design of most systems with the help of theoretical methods
has also recently been considered by olsen et al . the paper is structured as follows : the following
section provides
an overview of the computational details and codes used in this study . the first three parts of the results and discussion section address in sequence the conditions i iii described
above following the causal logic of the storage - cycle : ( i ) absorption ,
the initialization of the photoreaction ; ( ii ) energy storage , the
harvested energy is stored in quadricyclane form ; and ( iii ) transition
state analysis , the stability of the high - energy isomer ( q ) toward
thermal back - conversion to the low - energy variant ( n ) . the description of the transition states of these compounds requires
multireference calculations due to their biradical character . we analyze
the pitfalls of single reference methods and discuss approximative
means to analyze and calculate these states from single - reference
data . the fourth and final part of the results and
discussion section provides some insight into the enhanced
quantum yield of substituted systems relative to the unsubstituted
compound . in the conclusions section , the
results are discussed with respect to the available experimental data
and a computationally efficient screening approach is outlined . following the lines of recent experimental work , we consider substitutions on the c2c3 double bond
( see figure 1 ) with
an electron - donating aryl and an electron - withdrawing aryl creating
a conjugated push pull system . where necessary , the norbornadiene
and quadricyclane forms are specifically as , e.g. , 1n or 1q . the substituted compounds were created with
the openbabel software package using
the smiles syntax . these structures were refined by subsequent
b3lyp calculations ( see below ) , from which the respective lowest energy
conformation was selected . we then carried out further calculations
using both single - reference methods based on dft , which are suitable
for high - throughput schemes and multireference approaches based on
complete active state ( cas ) techniques , which are computationally
much more expensive but provide a high level of accuracy and predictive
power . density functional theory
( dft ) calculations were carried out using the nwchem suite ( version
6.5 ) . both n and q geometries were investigated
using a number of different exchange - correlation ( xc ) functionals
including the semilocal pbe and m06-l generalized gradient approximation
( gga ) functionals , the b3lyp hybrid functional , the range - separated cam - b3lyp hybrid functional , as well as three hybrid meta - gga functionals ( m06 , m06 - 2x ) . storage energies and geometries were analyzed
for all functionals ; absorption spectra were calculated within the
framework time dependent dft ( td - dft ) for the pbe , b3lyp , and cam - b3lyp
functionals including the first 15 excitations . all of these calculations
were carried out using a 6 - 311+g * basis set ( split - valence triple-
with polarization and diffuse functions for heavy atoms ) . storage energies were found to change by less than 2.5 kj / mol when
adding polarization and diffuse functions also for hydrogen ( 6 - 311++g * * )
whereas excitation energies varied by 0.01 ev or less . the effect
of solvation in toluene , which is the solvent employed in a prior
experimental study , was treated at the
level of the universal solvation model introduced by marenich et al . in addition , we performed single - point
calculations based on b3lyp geometries at the mp2 level using an aug - cc - pvdz
basis set . these calculations were complemented in the case of the
unsubstituted compound by ccsd(t ) single - point calculations based
on relaxed mp2 geometries ( ccsd(t)//mp2 ) to obtain a reference value
for the storage energy . for the latter case , we also studied basis
set convergence ( see the supporting information ) . complementary calculations based on the pbe functional were
conducted
using grid based wave functions as implemented in the gpaw code with a grid spacing of 0.17 and a vacuum
region of 6 as well as the atomic simulation environment ( ase ) . for the td - dft calculations , we used the real - time
propagation of grid wave functions module of gpaw , a grid spacing of 0.2 , a vacuum region of 5 ,
and a poisson solver with multipole corrections up to l = 2 . in order to analyze the role of
van - der - waals ( vdw ) interactions between the aryl rings , we also carried
out calculations using the vdw - df method within gpaw . to benchmark and understand
shortcomings of the single - reference calculations , several higher
level methods were considered . specifically , we performed cas calculations
both of the self - consistent field ( casscf ) and second - order perturbation theory ( caspt2 ) kind as implemented in molcas 8.0 . these multireference
methods provide superior accuracy compared to single - reference methods ,
which under multireference conditions can fail not only quantitatively
but qualitatively . they are , however , computationally much more expensive
and can also require considerably more guidance and knowledge . in
particular , upon diaryl substitution the desired active space increases
dramatically due to -conjugation , rendering a comprehensive
treatment of all compounds of interest prohibitively expensive . however ,
as elaborated in the results and discussion section , we have carefully examined the effect of reducing the active
space using compound 2 as an example in order to obtain
a computationally more efficient scheme . the selection of the active
spaces varies with compound and context , and we describe the chosen
space for each application . unless explicitly mentioned , we use the
ano - s dzp contracted basis set using
the contraction ( 6s4p3d|3s2p1d ) for second
row elements and the contraction ( 4s3p|2s1p ) for h in all multireference
calculations . in single and multi state caspt2 calculations , we use
the standard ionization potential - electron affinity ( ipea shift ) of 0.25 hatree units and an imaginary shift of 2.72 ev ( 0.1 hartree units ) . ( homo ) to a * + * ( lumo ) orbital . the absorption energy
corresponds to h in figure 2 and thus to a vertical transition from the
minimum of the s0 surface to the s1 surface , from which both the unsubstituted
and substituted n - q systems undergo an intrinsic -cycloaddition
reaction . although dipole forbidden in unsubstituted norbornadiene
( 1n ) , this transition is found to be allowed with high
dipole strength for all substituted norbornadienes ( 2n6n ) . this implies that no triplet sensitizer
is required and it is most likely that in the case of the substituted
systems the relevant photocatalytic and thermal transitions occur
exclusively on the singlet surface . figure 3a compares the excitation energies calculated
using various approximations both excluding ( vacuum ) and including
solvent ( toluene ) effects with experimental values . for compound 1 , we compare the dipole forbidden transition to electron
energy loss data , while for 26 recent spectroscopic measurements are employed
as reference data . in the latter case ,
the lowest optical excitation energy was identified with the first
maximum of the absorption spectrum . ( a ) experimental ( horizontal black lines ,
gray et al . ) and computational excitation
energies from
( 8,8 ) 2-sa - ms caspt2 calculations ( both dft - pbe and casscf geometries )
and various dft exchange - correlation functionals . the last block reports
the mean absolute error ( mae ) relative to the experimental reference
data . the solid and dashed horizontal lines
represent experimental and ccsd(t ) values , respectively , for the storage
energy e of 1 . more details regarding
the latter can be found in the supporting information . according to the calculations ,
the homo is localized on the donor
while the lumo is localized on the acceptor ; the localization increases
from 2 to 6 and so does the red - shift of
the absorption spectrum . solvation lowers the first optical excitation
by an amount that ranges from 0.00 to 0.08 ev between 1 and 6 . both the trend and the magnitude of the effect
vary only weakly between the different functionals . as expected ,
dft - pbe ( similar to other nonhybrid single - reference
methods ) underestimates the * excitation and yields a mean
average error ( mae ) of 0.83 ev . ( the mean average error is computed
by comparing the vacuum result for 1 and the solvated
data for 26 with the corresponding
experimental data . ) relative to pbe , the fractional inclusion of the
fock - operator in the b3lyp and cam - b3lyp hybrid functionals shifts
the lumo level upward . the resulting optical gaps are generally in
much better agreement with experiment . in the case of b3lyp , the calculations
systematically underestimate the reference data with a mae of 0.32
ev whereas in the case of cam - b3lyp a systematic overestimation by
about the same magnitude is observed yielding a mae of 0.23 ev . for 1 , casscf
calculations were carried out using 8 orbitals and 8 electrons ( 8,8 )
( + , , + ,
, * * , * + * ,
* * , and * + * ) in the active
space . the active space was chosen to comprise all single and double
bonding and antibonding orbitals between the four relevant carbon
atoms . , and using a 6 - 31 g * basis
set , we were able to reproduce their casscf results for n and q to
all decimals in spite of different codes being used . the geometry
of 1 was relaxed using ( 8,8 ) casscf , which was followed
by two - state averaged ( 2-sa ) caspt2 calculations to obtain the lowest
absorption energy . to test basis set convergence , excitation energies
of 5.32 , 5.31 , 5.17 , and 5.12 ev were obtained with basis sets of
increasing accuracy ( ano - s vdzp , ano - l vdzp , ano - s vtzp , ano - l vqzp ) . this comparison demonstrates that a ano - s vdzp basis set is sufficiently
( < 0.2 ev ) converged for the present purposes , which has thus been
employed in the following . for compounds 26 , including the full -system in the cas is computationally
prohibitively expensive , since already in the case of compound 2 there are 4 relevant -electrons and 16 -electrons . therefore , as a first approximation , we chose to retain the same reaction
center localized ( 8,8)-active space as in the case of 1 and performed geometry relaxations . this choice of active space
allows a complete and balanced description the energetics of norbornadiene ,
quadricyclane , and the thermal back - conversion paths . ( 8,8 )
2-state averaged multistate ( 2-sa - ms ) caspt2 calculations
were subsequently performed on compounds 26 . we find that in these ( 8,8 ) casscf calculations , the
orbital associated with the c2c3 bond is destabilized due
to admixture of aryl -orbitals as illustrated for compound 2 in figure 4 . simultaneously the corresponding * orbital is stabilized
in a very similar manner as in the case of the dft calculations . the s0 s1 excitation
occurs with very large weight ( > 95% ) between these two orbitals
corresponding
to the transition |45 |45 , where the labels refer to the orbital
enumeration in figure 4a . ( a ) ( 8,8 ) active space of a 2-sa - ms - casscf calculation for compound 2 in dft - pbe geometry . the corresponding orbitals in the casscf
geometry are similar , except that the aryl -orbitals do not
hybridize as strongly with the aryl rings . ( b ) ( 16,16 ) active space
of a 2-sa - ms - casscf calculation for compound 2 in casscf
geometry . we find that the geometry of the
compounds has a significant effect
on the absorption properties , especially the orientation of the aryl
p - orbitals with respect to the norbornadiene p - orbitals . in the ( 8,8 )
casscf relaxed geometry , the reaction center localized ( 8,8)-active
space does not conjugate as strongly with the aryl rings as in the
dft - pbe geometry . this effect is also reflected in the orientation
of the aryl rings relative to the active -orbital associated
with the c2c3 bond with a more pronounced alignment obtained
in dft - pbe calculations . to quantify the alignment effect more
systematically , we computed
the angle between the vectors p and a , which specify the orientation of the active
orbital as well as either one of the aryl rings , respectively . the former vector is normal to the plane spanned by the carbon atoms
6 , 2 , and 3 ( or alternatively 2 , 3 , and 5 ) whereas the latter is normal
to the plane defined by the positions of carbon atoms 1 , 2 ,
and 6 for the first and 1 , 2 , and 6
for the second aryl ring . we find that the dft - pbe geometries exhibit
a significantly stronger alignment than the casscf data both on the
donor and acceptor side of the compound ( table 1 ) . here , the dft methods predict conjugation
angles of about 24 on the acceptor and about 68 on the
donor side , while casscf and hf yield values that are about 10
on average larger . the casscf results are based on
a ( 8,8 ) active space with the exception of the values in parentheses ,
which were obtained from ( 16,16)-casscf calculations . columns labeled
a and d report angles referring to the acceptor and donor side of
the compound , respectively . to quantify the effect of the incompleteness of the active space ,
for compound 2 we performed a full ( 16,16)-casscf geometry
relaxation including all -electrons in the system ( but excluding
the system ) . as indicated in table 1 , the geometries obtained from ( 8,8 ) and
( 16,16 ) casscf calculations are similar , which leads to the conclusion
that the features of the casscf geometry alluded to above are intrinsic
to the method and likely the result of the lack of dynamic correlation .
unfortunately , because of their computational expense and the need
for numerical forces , geometry optimizations on the caspt2 landscape
are , however , currently impractical . as a more practical approach ,
in order to approximate the effect
of the geometry , we also calculated ( 8,8 ) 2-sa - ms - caspt2 energies
obtained with dft - pbe geometries , labeled caspt2//pbe in figure 3a . these data exhibit
a noticeable red - shift relative to the caspt2//casscf and ( recalling
the basis set convergence and the absence of solvent effects in the
cas calculations ) are overall in very good agreement with the experimental
data . specifically , for caspt2//casscf and caspt2//pbe maes of 0.42
and 0.22 ev are obtained , respectively . it is noteworthy that cam - b3lyp
results are in very close agreement with caspt2//pbe as both data
sets exhibit an overestimation of the data that increases along the
series 26 . this could suggest that
this deviation is related to more complex vibrational effects that
are not captured by the present calculations . we note that the
coupling between geometry and optical features
was also reported , e.g. , for the case of a 11-cis chromophore , where the rotation of a -iodine ring
was found to have pronounced effects on the absorption ( of order of
0.2 ev ) . the authors of the latter study also find that casscf geometries
exhibited the largest conjugation angles , which limited the coupling
of the systems , while dft yielded the smallest angle . in practical
applications , the key quantity with respect to absorption ( and solar
spectrum match ) is the molar attenuation coefficient , which
can be obtained from a summation over the individual optical excitations
weighted by their respective dipole strengths fk . for the unsubstituted compound 1 , fk for by contrast , for the substituted compounds 26 the first optical transition is allowed and the dipole strength
obtained from td - dft calculations is at least 0.17 ( pbe)/0.22 ( b3lyp)/0.24
( cam - b3lyp ) . to put these numbers in context , note that in order to
achieve full absorption by a 1 m solution with thickness 1 cm , one
requires 1/m cm , which with the appropriate unit
conversions translates to fk 3.5 10 . the comparison
of calculated molar attenuation coefficients with experiment ( figure 5 and supporting information ) reveals that pbe achieves
the best agreement with respect to the magnitude of while
b3lyp and even more so cam - b3lyp overestimate by up to 40% . it is furthermore evident that the experimental spectra exhibit additional
features such as shoulders and double maxima that are not reproduced
by the calculations . as already alluded to above in connection to
the caspt2 results , this suggests that additional vibrational and
solvent effects are likely to be present in the experiment , which
are included in the present calculations . comparison of the molar
attenuation coefficient of compound 6 from experiment and dft calculations . a smearing using a width of 0.25 ev was applied to the latter in order
to mimic the broadening due to vibrations . the calculated spectra
were rigidly shifted by a scissors correction for clarity . the quantity
that dictates energy
storage is the enthalpy difference h between
n and q. the largest contribution to h is
the difference in the electronic energies e . the remaining contribution arises from differences in
the vibrational spectra of n and q ( zero - point vibrations and the
heat capacity term ) . the latter term was evaluated at the b3lyp - dft
level ( vacuum ) , which yielded values between 2.8 and 3.3
kj / mol for compounds 26 and a value
of 1.9 kj / mol for compound 1 . the minor variation
among the set of compounds is expected as the transition from n to
q affects the vibrations of the side groups only indirectly . since
the magnitude of this contribution to the storage enthalpy is small
( 3% ) compared to the electronic energy difference and its
evaluation can be very time - consuming in particular at the cas level
( and virtually impossible at the ccsd(t ) level ) , from here on our
analysis of the calculations is focused on e . compared to optical excitation
energies it is relatively more difficult to obtain storage energies
( or enthalpies ) with good accuracy . as a result , for the substituted
compounds 26 there are currently
no reliable values available . for the unsubstituted molecule ( 1 ) , a value of h = 92 1 kj / mol
has been determined for the storage enthalpy . assuming a vibrational correction as indicated by the calculations
described in the previous paragraph , this yields a reference value
for the electronic part of e = 94 1 kj / mol . we supplemented this value with ccsd(t ) calculations
as described in the supporting information , which yield a value of e = 95.5 kj / mol . the ( 8,8 ) caspt2//pbe calculations reproduce these data closely
[ figure 3b ] , whence
we will consider them as reference data for compounds 26 below . as in the case of the optical excitation energies the ( 8,8 ) caspt2//casscf calculations perform somewhat worse ,
presumably for the same reasons suggested above . the mp2 calculations
yield even smaller storage energies . among the single - reference
methods , the b3lyp and cam - b3lyp values
agree rather closely with the reference data . pbe - dft exhibits a pronounced
underestimation of the storage energy but still performs noticeably
better than the m06-suite functionals . the latter yield values between
40 and 65 kj / mol and thus underestimate e by
30% to 57% . as will be discussed in detail in the transition state section , a key challenge in the description
of the n / q system is related to the exchange of homo / lumo character
between n and q. as a result , the description of e requires an accurate description of both systems . we note that m06
and m06 - 2x yield , for example , smaller gaps for the q than for the
n conformations , which is in qualitatively disagreement with both
experiment and higher level theory ( e.g. , caspt2 ) . the energy storage in the substituted
systems can deviate from the unsubstituted system since the c2c3
bond couples with the aryl -system . as a result , one can expect
a lowering of the energy of the norbornadiene variants due to the
delocalization of aryl -electrons . in the quadricyclane variants ,
in contrast , a direct coupling is not possible since the c2c3
bond has single bond character . this rationale explains why the substituted
systems have a rather constant increase in energy storage relative
to 1 regardless of the method of calculation ( figure 3b ) . comparison
of the dft data with caspt2//pbe values , show that the cam - b3lyp results
are close to caspt2//pbe followed by b3lyp . pbe and m06-suite functionals
underestimate the storage energy , in some cases by as much as 25% . solvation effects at the level of the implicit solvent model employed
here are generally small , yielding a reduction of e by about 34 kj / mol . while in the case of system 2 , mirror symmetry is
at least in principle possible , in practice it is prevented by steric
hindrance . one of the two otherwise identical aryl rings couples more
strongly to the parent -system with a small conjugation angle
between the orbital and aryl ring . the equivalent angle is
considerably larger for the second aryl ring indicating a much weaker
coupling . this effect is quantified in table 1 , which shows a compilation of the conjugation
angles between the aryl and norbornadiene -systems . as in the
case of the absorption spectra , the geometry can have a large effect
due to its impact on the coupling of the -systems . the
electric quadrupole as well as van - der - waals interactions between
aryls can in principle further alter the side group alignment and
thereby affect the electronic coupling . therefore , we also performed
geometry relaxations with an ab initio vdw - df functional . these calculations consistently confirm the near constant storage
energy of compounds 26 and its increase
relative to compound 1 . this provides further evidence
that the increase in energy storage is originating from the breaking
of the conjugation in the quadricyclane variant . finally , it should
be recalled that while the storage energy is very similar for compounds 26 , in applications it is the energy
storage density that matters , which also depends
on the volume of the different compounds in solution . the homo and lumo of the n isomers
have and * + * character , respectively ,
whereas they are of and * + *
type in the case of the q variants , reflecting the transition from
two double ( n ) to four single bonds ( q ) . this implies that an eigenvector
exchange corresponding to the cycloaddition reaction must take place
during the transition from n to q. as shown explicitly below ( figure 6b ) , the system therefore
exhibits multireference character near the transition state . in the
fully interacting system lumo gap is finite at the
transition state ( figure 6a ) due to an avoided crossing of the electronic states . in
order to capture this effect , one requires cas or similar techniques
that can account for the mixing of these states . single - reference
methods such as dft do not yield this effect and rather predict a
crossing of the homo and lumo states with a vanishing gap . ( this shortcoming
is related to the inability of conventional dft methods to describe
biradical systems , in a similar manner as dft can not describe the
dissociation curve of h2-molecule singlet ground state . )
as a result , one obtains a cusp in the energy landscape rather than
a proper saddle point with a finite curvature ( as illustrated by the
pbe data in figure 6a ) . ( a ) energy
landscape between n and q for the unsubstituted compound ( 1 ) from dft - pbe and 2-sa - ms caspt2 ( 8,8 ) calculations as well as homo
and lumo energies from pbe - dft . ( b ) occupation numbers of the natural
orbitals of the s0 state from caspt2 ( 8,8 )
calculations corresponding to homo and lumo levels . in substituted
systems , these correspond to orbitals labeled as 4 and 5 in figure 4a . the transition
corresponds to a crossover ( eigenvector exchange ) of the states forming
homo and lumo in the n and q variants , respectively . the deviation
from integer eigenvalues near the transition point illustrates the
multireference character of the thermal isomerization
process of the unsubstituted n - q system . ( c ) interatomic distances
between carbon atoms involved in the transformation of single and
double bonds during the n q transition . note that the back - conversion
proceeds first by breaking the c2c6 bond , followed by breaking
of the c3c5 bond , which occurs simultaneously with the formation
of the double bonds . unfortunately , multireference methods such as cas techniques
are
computationally too demanding to carry out a full transition path
search for all substituted compounds . ( as a further
complication , recall that it can be argued that casscf geometries
are actually of inferior quality compared to the molecular configurations
obtained from single reference methods ( pbe , b3lyp ) . in the case of
caspt2 , at present one would have to resort to numerical differentiation
to obtain forces , which renders geometry optimizations and vibrational
analyses using this approach impractical , at least for the substituted
compounds . ) in view of these limitations , we resort to the following
approach : initial conversion paths are generated by linear interpolation
of images between n and q. the path is subsequently optimized using
the nudged elastic band ( neb ) method as
implemented in ase using dft - pbe forces . ( in practice it is difficult
to converge the dft wave function near the transition state due to
the crossing of levels near the saddle point in dft - pbe ( figure 6a ) . in the present
calculations , a finite fermi temperature was used in the neb calculations
to overcome this issue . ) finally , caspt2 calculations are carried
out for each image along the path using a ( 8,8 ) active space . the vanishing
homo lumo gap and the crossover between states of
/ * + * and / *
+ * character are apparent in the kohn sham eigenvalues
from dft - pbe ( figure 6a ) . the dft - pbe calculations yield a value of e = 226 kj / mol ( 2.35 ev ) for the thermal
q n conversion barrier for the unsubstituted compound ( 1 ) compared to the experimental value of h = 140 kj / mol ( 1.45 ev ) . this significant overestimation is consistent with a lack of level
repulsion and an avoided crossing . b3lyp - dft calculations produce
barriers that qualitatively show the same behavior with even higher
barriers and were therefore not pursued further . at the cas
level , one observes the opening of a gap due to mixing
of electronic states near the saddle point ( figure 6a ) , which is associated with a reduction
of the barrier for back - conversion . in the case of compound 1 , one obtains a value of 152 kj / mol ( 1.58 ev ) in much better
agreement with the experimental value . the multireference character
of the transition state is also evident from the natural orbital occupation
numbers , which strongly deviate from integer values near the saddle
point ( figure 6b ) . from a structural standpoint , the thermal back - conversion involves
first breaking of one of the four single bonds of the four - member
quadricyclane ring ( c2c6 in figure 6c ) , followed by breaking of the opposing
bond ( c3c5 ) . simultaneously with the latter event , the two
remaining bonds turn into double bonds ( c2c3 and c5c6 ) . we note that a vibrational analysis of the saddle point configuration ,
which is a prerequisite for obtaining h as opposed to only the electronic contribution e , is not possible at the dft level since
the maximum along the n q transition path corresponds to
a cusp in the energy landscape ( figure 6a ) . at the same time , calculating the vibrational spectrum
at the caspt2 level requires numerical differentiation , which is not
only inaccurate but computationally very expensive , in particular
in the case of the substituted compounds to be considered below . the
rather close agreement of the value of e obtained at the caspt2//pbe level and the experimental
value for h for 1 suggests , however , that the difference between e and h is comparably small . here report on mp2//hf calculations of the transition barrier
in the case of positively charged n / q species . the
removal of one electron from the system implies a gap between two
electronically similar states , which are already coupled at the single - reference
level . as a result already single - reference methods yield a smooth
saddle point with a well - defined vibrational spectrum . ) to obtain
an approximative description of the transition state
of the substituted systems ( 26 ) ,
the geometry of carbon and hydrogen atoms in the reaction center ( parent
compound ) were fixed to those corresponding to the minimum energy
path of 1 . these structures were subsequently relaxed
with dft - pbe subject to the specified constraints , followed by single
point ( 8,8 ) caspt2 calculations . the comparison with experiment
is aggravated by difficulties associated with the reliable extraction
of barriers from the experimental data , see the supporting information . here , we compare the calculations
with the barriers extracted in the supporting
information from the data obtained by gray et al . , the dft - pbe
calculations systematically overestimate the experimental barriers
by 5060% . the caspt2 data are in much better agreement , but
the calculated barriers are still 2030% higher than the reference
data , exhibiting a larger error than in the case of 1 . for the substituted compounds , there are in principle two different
back - conversion paths depending on whether bond breaking occurs first
on the donor or the acceptor side . here the reaction
path with the lowest
barrier is underlined and is always located on the acceptor side ( a ) .
the experimental data in the last but one column was obtained as described
in the supporting information . the experimental
data reported in the last column was taken for 1 from
frey and for 26 from gray et al .. tests based on fully relaxed as
well as constrained geometries
suggest that the effect due to the approximate transition path on
the barrier amounts to less than 5 kj / mol . the larger error in the
case of the substituted systems should be increased even
more relative to 1 , which at present is , however , prevented
by the associated computational expense . this view is partially
supported by the observation that the error in the barrier is more
pronounced for the substituted compounds ( 26 ) , which feature aryl rings and were measured in toluene
solution , while the experimental value
for 1 was obtained for the gas phase . the strong coupling between the s0 and s1 states near the transition
state alluded to
above suggests a correlation between the thermal barrier e and the absorption energy h , i.e. , the offset between s0 and s1 for the n isomer . the decrease in the thermal
stability upon red - shifting using auxochromes has been described before . both sets of calculations as well as the experimental data do not
only show this effect ( figure 7 ) but also agree in the relative strength of this effect . this suggests that within the existing systems a compromise must be
sought between a solar spectral match and thermal stability . more
interestingly it suggests that a key to finding new and optimizing
existing compounds involves the development of strategies for breaking
or at least mediating the coupling between e and h. barrier for the thermal
conversion from q to n is correlated with
the first absorption maximum . while the calculations systematically
overestimate the experimental data , they succeed in reproducing the
correlation between the barrier and the absorption energy . we do not explicitly focus on quantum
yield in this work , as it would require taking into account ultra
fast photodynamics along with solvent and thermal ensemble effects . first ,
while the -cycloaddition reaction is symmetry forbidden for the
unsubstituted system , the attachment of aryls reduces the symmetry
of the molecule to c1 , which also renders the two double
bonds of the norbornadiene variant inequivalent . we evaluated
forces on the s1 excited state of 1 and 2 using ( 8,8 ) casscf calculations . this
shows that for 1 the initial forces after a vertical
excitation on the s1 born oppenheimer
surface are symmetric and when followed would induce simultaneous
breaking of both double bonds . by contrast , in the case of 2 , the forces are asymmetric and only directed toward breaking the
c2c3 bond . this can in fact already be observed from the active
orbitals ( figure 4 ) ,
where a s0 s1 excitation turns the c2c3 orbitals from bonding
to antibonding . this mechanism is quite likely to be a deciding factor
for the parent system having such a low quantum yield ( < 0.05 ) , while the substituted compounds reach at least
quantum yields of 50% and more . to truly answer this question , one antol has established a possible explanation for the
low quantum
yield of the unsubstituted system using decay paths via rydberg states
and doubly excited states . rydberg states
were not considered in this work but we point out that the s2 as displayed in figure 2 is a doubly excited state , and its position
does not red - shift upon substitution with aryls . the goal of this study was twofold : first , to gain insight into
the mechanisms that govern the optical , kinetic , and thermodynamical
properties of novel most compounds , and second to identify the level
of computational methods sufficient for describing these properties . the absorption spectrum was found to be crucially dependent on
the geometry and explicitly on the -coupling angle of the aryl
rings . this is likely to also contribute to the broad line shape in
the presence of a solvent and should similarly assist in lowering
the onset of absorption . the storage energy increases only slightly
upon substitution , which
is attributed to enhanced delocalization of -electrons upon
formation of a double bond in the norbornadiene compound . since the
increase is small and the variation of the storage energy between
the substituted compounds 26 is
even smaller , the primary optimization handle with regard to storage density is the molecular mass . the saddle points on
the s0 surface
corresponding to the barriers for the conversion between n and q exhibit
strong multireference character . accordingly single - reference methods
such as dft yield a cusp ( rather than a saddle point ) along the n
q path and overestimate the barrier by more than 50% . cas
approaches on the other hand provide values in much closer agreement
with experiment ; they are still somewhat too high compared to experiment ,
which could be due the omission of vibrational effects . the barrier
calculations furthermore show the q n conversion via the
acceptor side to be energetically preferred for all compounds considered
here , which is thus likely to be solely responsible for the stability
of the quadricyclane variants . the multireference character
is due to an eigenvector exchange
involving homo and lumo states , which implies a pronounced correlation
between the first optical excitation and the barrier for back - conversion
with larger red - shifts tied to a decrease in thermal stability . here ,
the degree of correlation is similar between calculations and experiment .
since optimal compounds ought to combine good solar spectrum match
with long - term stability , strategies ought to be developed to overcome ,
or at least mitigate , this coupling . a key objective of the
present study was to establish the suitability
of different methods for high - throughput screening of most materials . it is found that pbe and even more so functionals from the m06-suite
underestimate the storage energy and yield in the case of pbe a strongly
red - shifted spectrum . dft - b3lyp calculations provide both storage
energies and absorption spectra in good agreement with reference data ,
although the latter are somewhat red - shifted while the magnitude is
overestimated by up to 25% . by contrast cam - b3lyp achieves very good
excitation energies that closely match caspt2 data but considerably
overestimates the dipole strength and thus the magnitude of the attenuation
coefficient . since cam - b3lyp calculations are computationally more
expensive than b3lyp and given offsetting short - comings in either
functional , the b3lyp functional appears slightly superior for screening
purposes . caspt2 calculations provide very accurate results
but are much
more demanding both computationally and with regard to user interference ;
they are therefore ( currently ) not well suited for materials screening .
with regard to certain properties , in particular pertaining to transition
states , which require techniques such as cas for accurate treatment they can , however ,
produce qualitative insight sufficient for discriminating trends and
provide geometries as starting points for more refined computational
techniques . finally , as has been remarked by other authors ,
in general , single - reference
methods appear to yield more plausible geometries than casscf calculations ,
which is probably related to the absence of dynamical correlation
in the latter . | molecular photoswitches that are
capable of storing solar energy ,
so - called molecular solar thermal storage systems , are interesting
candidates for future renewable energy applications . in this context ,
substituted norbornadiene - quadricyclane systems have received renewed
interest due to recent advances in their synthesis .
the optical , thermodynamic ,
and kinetic properties of these systems can vary dramatically depending
on the chosen substituents .
the molecular design of optimal compounds
therefore requires a detailed understanding of the effect of individual
substituents as well as their interplay . here
, we model absorption
spectra , potential energy storage , and thermal barriers for back - conversion
of several substituted systems using both single - reference ( density
functional theory using pbe , b3lyp , cam - b3lyp , m06 , m06 - 2x , and m06-l
functionals as well as mp2 calculations ) and multireference methods
( complete active space techniques ) . already the diaryl substituted
compound displays a strong red - shift compared to the unsubstituted
system , which is shown to result from the extension of the conjugated -system
upon substitution .
using specific donor / acceptor groups gives rise
to a further albeit relatively smaller red - shift .
the calculated storage
energy is found to be rather insensitive to the specific substituents ,
although solvent effects are likely to be important and require further
study .
the barrier for thermal back - conversion exhibits strong multireference
character and as a result is noticeably correlated with the red - shift .
two possible reaction paths for the thermal back - conversion of diaryl
substituted quadricyclane are identified and it is shown that among
the compounds considered the path via the acceptor side is systematically
favored . finally , the present study establishes the basis for high - throughput
screening of norbornadiene - quadricyclane compounds as it provides
guidelines for the level of accuracy that can be expected for key
properties from several different techniques . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
ebola viruses are the causative agents of ebola hemorrhagic fever ( ehf ) , which are highly virulent zoonosis that affect both human and nonhuman primates . since then ebola outbreaks have been reported on average every 1.5 years , with a total of 7 prior outbreaks generated over 100 reported cases . a recent study has estimated 22 million people distributed in areas of central and west africa to be at risk of ebola . ebola virus contains single - stranded negative rna linear genome , about 18 - 19 kb in size and encode seven genes ( np , vp35 , vp40 , vp30 , vp24 , l , and gp ) . five genetically distinct ebola virus species within the genus ebola virus are known ( zaire ebola virus [ zebov ] , sudan ebola virus [ sebov ] , cte d'ivoire ebola virus , bundibugyo ebola virus [ bebov ] , and reston ebola virus [ rebov ] ) . the genomes of the five different ebola viruses ( bebov , zebov , rebov , sebov , and ta forest ebolavirus ) are different in sequence and the number and location of gene overlaps . however , rebov species is reported to cause disease only in nonhuman primates , zebov , sebov , and bebov are responsible for most of the ehf outbreaks but zebov constitutes a particularly serious threat to both human and animals in sub - saharan africa with case fatality rates as high as 90% . the 2014 outbreak of ehf in west africa , caused by zebov is the largest outbreak of ehf in history . fruit bats are believed to be the normal carrier in nature , although the means of local enzootic maintenance and transmission of the virus within bat populations remain unknown . the virus is transmitted from wildlife to people through contact with infected fruit bats , and through intermediate hosts , such as monkeys , apes , or pigs that have themselves become infected through contact with bat saliva or faeces . the prevention of ehf requires improving our understanding of the epidemiology of the disease . in this review , we report important epidemiologic features related to ebola outbreaks in africa based on previous findings during major outbreaks that occurred on the continent . also we elucidate a current status of promising ebola vaccine and drug that is being developed . contacting with the unknown reservoir host , ebola virus has been circulated among wild nonhuman primates . subsequent to outbreak of ebola virus in wild environment , chimpanzee and gorilla population were remarkably reduced . also this have negatively affected to animal , source of food , which resulted in human epidemics . ebola virus is divided into five different species ( the zaire , sudan , ivory coast , bundibugyo , and reston agents ) and they are different in virulence to humans . zaire species , first recognized appearance in 1976 , has overspread in a variety of regions with high mortality rate up to 88% . sudan virus is related to approximate 50% case - fatality rate in four known epidemic cases : two in sudan in the 1970s , one in uganda in 2000 , and another in sudan in 2004 . ivory coast virus case for human has only been known in ethologist who conduct necropsy on a chimpanzee found dead in the tai forest where population of ape were remarkably decreased . the bundibugyo virus causing an outbreak of hemorrhagic fever with lower case - fatality rate ( approximately 30% ) than zaire and sudan viruses , are emerged in uganda in 2007 . sequence analysis has revealed that the agent is most closely related to the ivory coast agent . reston virus is maintained in an animal reservoir in the philippines , which has not been found in africa . ebola reston virus was recognized first when it caused an outbreak of lethal infection in macaques imported into the united states in 1989 . nothing further was heard of the reston virus until 2008 , when the investigation of an outbreak of disease in pigs in the philippines unexpectedly revealed that some of the sick animals were infected both by an arterivirus , porcine reproductive and respiratory disease virus , and by ebola reston virus . however , most previous ebola outbreak occurred in central africa , ebola outbreak has started in the west african nation of guinea which is confirmed by the world health organization ( who ) in late 2013 . this outbreak was spread to liberia , sierra leone , nigeria , senegal , and mali . viral sequence of ebola patients in sierra leone showed that the epidemic was originated from sustained person - to - person transmission without additional introductions from animal reservoirs . leone , the magnitude of the outbreak was not clearly underestimated because of individuals with ebola virus disease being cared for outside the hospital setting . accumulative number of presumable , suspected , and laboratory - confirmed case of ebola virus is 19,065 including 7,388 deaths as of december 17 , 2014 ( table 1 ) . these comprise 564 healthcare workers died approximately 50% . who informed that senegal and nigeria became free from ebola outbreaks by october 17 and 19 , respectively due to the fact that no more case report of ebola virus in both senegal and nigeria from september 5 , 2014 and august 29 , respectively . there were reports of ebola virus diseases case outside of west africa . ebola virus diseases associated with ebola outbreak occurred to healthcare workers who caring for patients suffered from ebola virus disease , as well as a returning traveler . the index case of ebola virus diseases associated with outbreak were reported in the democratic republic of congo in august of 2014 , which a pregnant woman is infected from bushmeat which was killed by her family in wild . a total of 66 cases of ebola virus diseases ( confirmed and suspected ) , including 49 deaths are associated with ebola outbreak as of november 9 , 2014 . although there is no relation with the current epidemic in west africa , sequence of zaire strain of ebola virus causing this outbreak is most closely related to the case that occurred in 1995 outbreak in kikwit . it is difficult to diagnosing ebola virus in advance from infected person owing to nonspecific symptoms which are often seen in patients who is suffering from more common diseases such as malaria and typhoid fever . after symptoms with high levels of circulating virus within the patient 's body appear , seroconversion of ebola virus diseases can be detected in blood . laboratory test conducted in diagnosis such as antigen - capture enzyme - linked immunosorbent assay ( elisa ) testing , igm elisa , and polymerase chain reaction ( pcr ) using specific primers are used within a few days after symptoms begin . immunohistochemistry testing , pcr , and virus isolation for patients who is expired could be tested ( table 2 ) . many national departments of drug including who have researched useful treatments and vaccines , though there are no effective and target vaccine or treatment which are approved by food and drug administration ( fda ) applicable for human use . it is strongly required to focus on clinical management of additive care for complication such as hypovolemia , electrolyte abnormalities , hematologic abnormalities , refractory shock , hypoxia , hemorrhage , septic shock , multi - organ failure , and disseminated intravenous coagulation . for now , whole blood transfusions from convalescent patients are highly recommended for treatment of ehf . although live attenuated vaccine and recombinant protein have been actively studied for ebola virus based on murine model by 1990s , immunogenicity and the biosafety of those ways were not clearly described . dna vaccine synthesizing immune - related genes in host cell or haring viral genes such as nucleoprotein ( np ) , glycoprotein ( gp ) in plasmid vector showed high efficacy to guinea pig and mouse model against various infectious diseases . while it was successful to induce immunization with dna vaccine for ebola virus in mouse model , dna vaccine showed less effect on nonhuman primate and human models . replacement of plasmid dna vector to poxivirus , a viral vector carrying the genes of viral protein , lead out greatly increased antibody titer and cellular immunity . also adenovirus which is impaired in replication for enhancing safety have been used as a priming agents , which show high cellular immune response and humoral immunity in cynomolgus macaques . the animal which is challenged by lethal viral dose , however , it showed complete protection , showing the way to prevent ebola virus on primates against infection . in recent days , vesicular stomatitis virus ( vsvg - zebov ) and chimpanzee adenovirus ( cad3-ebo z ) are being actively studied as a promising vaccine for ebola virus diseases . vsvg - zebov , a candidate vaccine for the ebola filovirus , is a dna vaccine that is developed by newlink genetics and public health agency of canada . the vaccine consists genes for the surface protein of zebov in attenuated vesicular stomatitis virus ( vsv ) , which interfere dna recombination . since vsv is not critical to human , its biosafety and immune response are being estimated in clinical human trials ( phase i ) . in addition , chad3-ebov , a candidate of ebola virus vaccine , is a modified and attenuated chimpanzee adenovirus composed by gp of the ebola virus . it is developed by glaxosmithkline ( gsk ) and national institute of allergy and infectious diseases ( niaid ) . although rescued virus could not easily replicate in humans , it stimulated a protective immune response in humans . niaid and oxford university have studied its effectiveness on clinical trials ( phage i ) for volunteer . above this , mva - bn , developed by bavarian nordic company , is a vaccine of attenuated vaccinia virus and advac , a dna vaccine based on adenovirus , is being developed . and clinical trial will be conducted in 2015 years ( table 3 ) . furthermore , as monoclonal antibodies , rna - based drugs , and small antiviral molecules novel therapeutic drugs are actively being studied to be useful treatment . zmapp , one of the powerful anti therapeutics , is an experimental biopharmaceutical drug with three chimeric monoclonal antibodies under development as a treatment for ebola virus diseases . the drug was first tested in humans during the 2014 west africa ebola virus outbreak , but has not been subjected to a randomized controlled trial to determine whether it works , and whether it is safe enough to allow on the market . it was first used experimentally to treat some people with ebola virus disease during the 2014 west african ebola outbreak , but as of august 2014 it had not yet been tested in a clinical trial to support widespread usage in humans . although zmapp use plant as a production unit , considering an innovative ways to produce antiviral drug , its productivity is too low to provide in time . favipiravir , also known as t-705 or avigan , is an experimental anti - viral drug being developed with activity against many rna viruses : influenza viruses , west nile virus , yellow fever virus , and foot - and - mouth disease virus . it is a pyrazinecarboxamide derivative as like some other experimental antiviral drugs ( t-1105 and t-1106 ) , the mechanism of its actions is related to the selective inhibition of viral rna - dependent rna polymerase while it does not inhibit rna or dna synthesis in mammalian cells . in 2014 , the drug appears to be effective in a mouse model of ebola virus disease , leading for clinical use of favipiravir as a ebola treatment . tkm - ebola , as known as ebola - snalp , which is a combination of small interfering rnas is being studied . it targets three proteins of ebola virus : zaire ebola l polymerase , zaire ebola membrane - associated protein ( vp24 ) , and zaire ebola polymerase complex protein ( vp35 ) . phase i clinical trial of tkm - ebola was assessed for its safety in healthy people . the fda put the trial on clinical hold in july 2014 to assess results , after some subjects had flu - like responses . in august , the fda changed the status to " partial hold , " allowing the drug to be used under expanded access in people infected with ebola but with the phase i trial still suspended ( table 4 ) . ebola virus is dangerous and exotic agent that poses high individual risk of laboratory infections and hospital settings , which are frequently fatal because there are no vaccines or treatments . for these reasons , experiments with ebola virus . currently , there are 21 bsl-4 facilities worldwide , however almost are operated in united states and europe ( fig . 1 ) . in east asia , china and japan are running the bsl-4 centers and developed ebola treatments and detection technologies , while south korea still has not only been equipped the facility yet but also scientists who are trained to work in bsl-4 . it evokes urgent investment on facilities and training researchers for utilizing bsl-4 to keep up advanced defense for ebola outbreak . as the natural history and reservoir of ebola viruses are not perfectly elucidated , there have been no specific methods for avoiding infection from the natural exposure . however , in these days , extensive studies performed to determine the natural reservoir of ebola viruses have identified in common species of fruit bat ( rousettus aegyptiacus ) as a potential and promising candidate . since there have been no officially licensed vaccines or antiviral drugs for the treatment of ebola virus infections although there are effort to develop vaccine and treatment such as zmapp and cad - zebov , early detection and diagnosis of infection from animals and human are very crucial for now . and for the prevention of transmission of the diseases , strict isolation of patient with fever and rigorous use of barrier and quarantine precautions are very important . therefore , for the research of public health and biodefense against ebola viruses , extensive studies of basic research including pathobiology , immune responses after infection should be intensively studied . in addition , additional bsl-4 containments which are only a few facilities exist worldwide are strongly required to study for preventing and treating ebola virus diseases . | the 2014 outbreak of ebola virus disease ( evd ) in west africa , caused by ebola virus ( zaire ebola virus species ) , is the largest outbreak of evd in history .
it cause hemorrhagic fever in human and nonhuman primates with high mortality rate up to 90% and can be transmitted by direct contact with blood , body fluids , skin of evd patients or persons who have died of evd . as of december 17 , 2014 , 450 healthcare personnel are known to have been infected with ebola , of whom 244 died . for development of ebola vaccine and treatment
are highly difficult due to its dangerous and accessibility that requires biosafety level 4 ( bsl-4 ) to conduct experiment .
also there is no specific vaccine and treatment for ebola virus ; however , many candidate vaccines and antiviral - drugs such as zmapp and tkm - ebola are being developed for ebola virus disease . in this review ,
we focus on the epidemiology of 2014 outbreak of ebola virus and candidate agent for preventing and curing from ebola virus . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
an unexpected contaminant in our aquatic and costal environments is artificial sweeteners . due to the human inability to metabolize them naturally the highest concentration of artificial sweetener contaminants is in waste water treatment plants ' reservoirs . artificial sweeteners such as saccharin and cyclamates are detected in lower concentrations and are found 90% degraded by the wastewater treatment process . degradation only occurs to a limited extent during hydrolysis , ozonation , and microbial processes indicating that breakdown of sucralose will likely be slow and incomplete leading to accumulation of sucralose in surface waters . this indicates that conventional waste water treatment is ineffective at degrading sucralose . from wastewater facilities the pollutants are dumped into public waterways , and sucralose has been detected in rivers in north carolina , in the gulf stream , and even in the waters of the florida keys . also for the first time scientists are detecting sucralose in the usa inland surface waters . artificial sweeteners have been considered contaminants by environmental scientists for a short time because artificial sweeteners are water contaminants that are highly specific to wastewater . most artificial sweeteners are either partially or completely broken down due to the waste water treatment process using high temperatures , changes in ph , and constant filtration . it would seem that the exception is sucralose due to its ability to withstand drastic ph and temperature changes ; it is also small enough to pass through the filtration process associated with the treatment . hence , sucralose is being continuously released into our environment in ever increasing concentrations , and due to the human consumers ' inability to metabolize this artificial sweetener , we are dumping it into our water ways and it is collecting over time . as time passes sucralose will spread to other aquatic and costal ecosystems , increasing concentration . the persistent qualities of sucralose may lead to chronic low - dose exposure with largely unknown consequences for human and environmental health . it is also unknown what this increasing concentration of sucralose is doing to environmental microbes . studies of human oral and gut bacteria have shown an inhibition of bacterial growth in the presence of sucralose . in one study the incorporation of 126 mmol / l sucralose into glucose agar medium caused total inhibition of growth of streptococcus sobrinus 6715 - 17 , streptococcus sanguis 10904 , streptococcus sanguis challis , streptococcus salivarius , and actinomyces viscosus wvu627 . in a related study rats were infected with streptococcus sobrinus and given sucrose water diet , and they developed caries lesions . then another group of rats was given the same bacteria but sucralose water instead of sugar water . those rats had a drastic decrease in caries lesions in their teeth , demonstrating that oral bacteria can not grow on the artificial sweetener hence causing less damage , proving that sucralose is noncariogenic . these are good examples of sucralose inhibiting bacterial growth ; however , there have been minimal studies on the inhibitory effects of sucralose on environmental microbes . sucralose is increasing in concentration in our waterways , and it has been shown in previous studies to be harmful to oral and gut bacteria . water samples and soil samples from various test sites around jacksonville florida ( table 1 ) were collected aseptically using autoclaved collection flasks and jars . fluid and soil extracted from samples were serially diluted with sterile 0.89% nacl solution , then spread plated on tryptic soy agar ( tsa ) ( difco laboratories , michigan , usa ) plates infused with 80 mm sucralose , and incubated at 32.7c for 48 h. bacteria were isolated into pure cultures on subsequent tsa slants based on colony morphology ( table 2 ) . isolates of each bacterium were incubated ( 32.7c ) for one day for microbial analysis . the isolates were then analyzed using basic light microscopy to identify individual gram characters and cellular morphology ( table 2 ) . once a list of the isolates with their microbial characters was formed , they were screened for sucralose metabolism . in order to inspect organismal growth in the presence of sucralose , 0.1 ml of isolated cell cultures was diluted with 2.9 ml of 0.89% nacl solution . these samples were streak plated onto m9 agar containing glucose ( technova , nova scotia , canada ) ( positive control ) , m9 agar containing sucrose ( positive control ) , m9 agar containing sucralose and glucose ( experimental ) , m9 agar containing sucralose ( experimental ) , and m9 agar containing no sugars ( negative control ) . isolates which exhibited growth on the m9 agar containing sucralose and glucose were selected for further experimentation ( table 3 ) . this is due to the possibility that they may be resistant to or metabolizing sucralose , which was inspected during the growth testing experiment . genomic dna was extracted from each of the selected bacterial isolates using the ultraclean microbial dna isolation kit in accordance with the manufacturer protocols ( mo bio laboratories , california , usa ) . the 16s rrna gene was amplified using the bacterial consensus primers 8f ( 5 agttgatcctggctcag 3 ) and 1492r ( 5 accttgttacgactt 3 ) . the long polymerase chain reactions ( pcr ) consisted of 41.7 l dh2o , 5.0 l 10x taq buffer , 1.5 l 50 mm mgcl2 , 0.5 l 10 m forward primer 10 m reverse primer 0.4 l 25 mm dntps , 0.4 l 5 u/l taq polymerase , and 1 l genomic dna in a final volume of 50 l . dna amplification was performed with the following thermocycler regime : 2 min at 98c followed by 33 cycles of , 98c for 30 s , 45c for 60 s , 72c for 90 s and a single step at 72c for 10 min . short pcr amplification consisted of 50 l reactions with analogous reagents / concentrations to the long pcr , using the additional primers 760r ( 5 ctaccagggtatctaat 3 ) and 790f ( 5 attagataccctggtag 3 ) with the following thermocycler settings : 25 cycles of 98c for 30 s , 44c for 45 s , and 72c for 90 s. the short pcr products were cleaned up using the qiaquick pcr purification kit following the manufacturer protocols ( qiagen , california , usa ) . the four primers aforementioned were employed for cycle sequencing on a ceq 8000 genetic analysis system ( beckman coulter , california , usa ) using 1 l genomelab dtcs quick start master mix , 2 l primer , 2 l dna , and 7 l dh2o . cycle sequencing consisted of 33 cycles at 96c for 30 s , 3747c for 15 s , and 60c for 4 min . sequencing reactions were performed using each of the amplification primers and internal primers so that each fragment was sequenced in both the forward and reverse directions . products were cleaned and precipitated according to the manufacturer specifications ( beckman coulter , california , usa ) . the obtained sequences were compared to other sequences using the blast function through the ncbi website ( http://www.ncbi.nlm.nih.gov/blast/ ) . individual isolates were then cultured in tryptic soy broth ( tsb ) media ( difco laboratories , michigan , usa ) and incubated at 25f . the control group consisted of 5 ml of tsb , and the experimental groups included 5 ml tsb with 0.5 ml of 10% , 20% , 30% , and 40% sucralose added , respectively . turbidity of the cultures was measured over the next 9 days at the same time each day using a sequoia turner ultraviolet light spectrophotometer set to 620 nm wavelength ( figure 1 ) . individual isolates were cultured in m9 broth media ( technova , nova scotia , canada ) and incubated at 25c . the control group consisted of 5 ml of m9 broth with no carbon source ; the experimental group included a 5 ml of m9 broth with sucralose as the only carbon source . turbidity of the cultures was measured over the next 9 days at the same time each day using a sequoia turner ultraviolet light spectrophotometer set to 620 nm wavelength ( figure 2 ) . each bacterial isolate was spread plated into a lawn of confluent growth onto tsa media . filter disks were prepared by whole punching out whatman grade number 2v filter paper and impregnating the disks with 1.6 m sucralose . the antibiotic sensor disk was placed onto the surface of the media , 3 disks per petri dish . the glucose/100 mm sucralose m9 agar completely inhibited growth for 22 of the 28 isolates ( results not shown ) . the isolates that were chosen for gene sequencing and further experimentation all were able to withstand the m9 sucralose and glucose agar ( table 3 ) . of the 28 isolates extracted from environmental samples , only 6 had growth on the sucralose / glucose media . i_61 , rhizobium borbori , citrobacter murlinlae , ensifer arboris , and streptomyces badius . these 6 isolates had fewer cfus on the sucralose / glucose media than they had on the positive control groups of sucrose and glucose and had no growth on the sucralose only m9 agar ( table 3 ) . six unique bacterial isolates were obtained , of which four were gram and 2 gram+ ( table 2 ) . the isolates were subcultured in triplicate in the presence of 27.8 mm , 55.78 mm , 83.75 mm , and 111.7 mm sucralose to elucidate effects of sucralose on bacterial growth , with controls consisting of isolates emended with an additional volume of growth medium . a growth curve showed a decrease in growth with those strains receiving sucralose addition compared to the control ( figure 1 ) . < 0.001 ) difference between control groups and experimental strains amended with 83.75 mm and 111.7 mm sucralose , with experimental strains showing decreased growth rate ( figures 2 , 3 , 4 , 5 , 6 , and 7 ) . these results indicate that the addition of sucralose is a growth inhibitor for multiple strains of bacteria . we observed that there was no statistically significant ( p > 0.99 ) difference between control groups and 25.7 mm for our isolates ( figures 2 , 3 , 4 , 5 , 6 , and 7 ) . the addition of low concentrations of sucralose ( 25.7 nm and less ) had no significant effect on growth , whereas higher levels ( 83.75 mm and 111.7 mm ) reduced growth drastically and possibly led to cell death . at 111.7 mm significant inhibition of total cell culture growth ( figures 3 , 4 , 6 , and 7 ) . of those 6 bacterial isolates not completely inhibited by sucralose , two showed significantly decreased growth ( p < 0.05 ) response in the presence of 55.78 mm sucralose ( figures 2 and 3 ) . the negative effect that sucralose had on their growth rates was directly proportional to the concentration of sucralose added to the growth media . on average , the 27.8 mm and 55.78 mm sucralose treatments did not significantly inhibit the growth rates of these isolates or minimally inhibit the isolates in their growth rates . the 83.75 mm and 111.7 mm treatments did have a rather drastic inhibitory effect on bacterial growth across the board . the inhibition exhibited on all isolates was similar to that of previous studies , in which sucralose causes total growth inhibition of oral bacteria in lab mice [ 5 , 7 ] . . regrowth from inhibited zones was tested ; regrowth indicated a bacteriostatic inhibition for each bacterial isolate . this study is limited in its scope , as it is an inquiry of pure science . this is due to current environmental concentrations being in the 300 ng / l and below range . the research is meant to investigate the possibility of growth inhibition occurring in environmental isolates in pure culture . the current environmental concentrations of sucralose ( 300 ng / l in waste water and less in fresh waters ) do not seem to have any effect on bacterial growth . sucralose is , however , increasing in its concentration due to its inability to be degraded by ph and temperature changes and its nonmetabolism by microbes ( figure 2 ) . sucralose would at higher concentrations , potentially 55.78 mm , hurt the bacterial community . this type of contamination would take a very long time to accumulate ; however , it is troubling because the bacterial community is the basis for the health of many ecosystems . | sucralose was developed as a low - cost artificial sweetener that is nonmetabolizable and can withstand changes in ph and temperature .
it is not degraded by the wastewater treatment process and thus has been found in waste water , estuaries , rivers and the gulf stream . since the molecule can withstand heat , acidification , and microbial degradation , it is accumulating in the environment .
the highest concentration of environmental sucralose detected to date is 300 ng / l .
our lab has isolated six bacterial species from areas that have been exposed to sucralose .
we then cultured these isolates in the presence of sucralose looking for potential sucralose metabolism or growth acceleration .
instead we found something very interesting , bacteriostatic effects exhibited on all six isolates .
this inhibition was directly proportional to the concentration of sucralose exposure .
the efficiency of the growth inhibition seemed to be species specific , with various concentrations inhibiting each organism differently . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cancer is a heterogeneous genetic disease of somatic cells arising from accumulated genetic changes on cancer genome resulted in alterations of gene expression , unregulated cell growth and triggering formation of malignant neoplasm . systematic genomic approaches have been applied to dissect tumorigenic pathways for diagnostic and prognostic applications and to search for potential cancer genes as therapeutic targets . these technologies revealed a global view of cancer genomic aberrations including loss of heterozygosity ( loh ) and comparative genomic hybridization ( cgh ) analyses to identify chromosome aberrations as well as microarray and proteomic analyses to profile the alteration of cancer gene expression . it has been proposed that there are four to seven somatic aberrations occurred at the rate - limiting steps during epithelial tumor progression including six categories of essential alterations in cell physiology that collectively perturb regulatory circuits of normal cell proliferation and homeostasis leading to malignant growth ( 1 ) . since multiple signaling pathways might be disrupted at different points in different cancers and since aberration of mutator genes could promote the genome instability during cancer development , the patterns of genetic aberrations tend to be non - random but differ between cancers of different tissues and of different subtypes from the same tissue . toward accelerating our understanding of tumorigenesis for better management of cancer patients , genomic approaches for systematically measuring somatic altered cancer genome and gene expression should be critical for clinical applications such as diagnosis , prognosis , classifying cancer subtypes and options of therapeutic treatment ( 2,3 ) . however , identification of putative cancer gene is still hampered by the difficulty of further refining the precise aberrant region owing to the low resolution of chromosome alterations detected by cgh and the large deletions of loh detected by microsatellite markers ( 4 ) . in addition , the noisy data of chromosome aberrations and inconsistent results of altered gene expression detected by microarray and proteomic experiments , further demonstrated an emergent need of integrating qualified cancer genomic and expression data for developing new and effective cancer therapeutic targets . ( 58 ) human hepatocellular carcinoma ( hcc ) is the sixth most common cancer worldwide and the third most common cause of cancer death with prevalent areas in asia and sub - saharan africa . ( 9 ) although recent studies suggested increase of hcc incidence in western countries , > 80% of the hcc cases occurred in above endemic areas are owing to exposure of major risk factors such as hepatitis viruses , mycotoxins and alcohol abuse . ( 10 ) since hcc progression is usually asymptomatic resulted in poor prognosis and low 5-year survival rate ( 1215% ) , comprehensive molecular genetic studies will be important for improving clinical management of hcc . previous studies by our group and others have already conducted experiments of genome - wide loh , cgh , microarray and proteomic analyses ( 1114 ) . comprehensive analysis further allowed us to reveal two major genetic pathways , genome stable and instable pathways , in hcc progression . we therefore selected hcc as a cancer model to construct a public accessible integrated database , oncodb.hcc , with user - friendly and graphically displayed interfaces as useful resources for facilitating researches in hcc tumorigenesis . as indicated in figure 1 , the chromosome view interface demonstrates the main features of the database . the hcc data are constructed based on physical maps of human and rodent genome sequences from ensembl and illustrated in several aspects including cancer genomic aberration data of loh and cgh studies , altered gene expression in transcriptomes and proteomes analyses , genes with experimental data in hcc tissues reported in pubmed articles and the qtls of rodent hcc models . the interactive interface further allows users to display chromosome regions defined by physical position , cytogenetic bands and sequence - tagged site ( sts ) markers . in expression view , a total of 9785 genes can be searched by using gene i d and gene description showing individual gene data including 9162 genes displayed the detail altered expression profiles of individual arrays reprocessed from re - analyzed stanford hcc microarray data and experimental data of the gene extracted from published articles in pubmed . to demonstrate data reliability in our database , aurka , a gene reported to be up - regulated in majority of hcc tissues ( 15 ) , was selected as positive control to perform semi - quantitative rt pcr experiments in 45 pairs of hcc tissues . as indicated in figure 2a , the aurka is highly up - regulated and the expression profiles are almost identical to that of re - analyzed stanford hcc microarray data . the chromosome view of oncodb.hcc : ( a ) indicated the chromosomal region displayed in cytogenetic position ; ( b ) demonstrated the expression intensity of genes along the physical positions of chromosome in terms of patient number by selecting gene expression cut - off value ( default value = 1 ) in re - analyzed stanford hcc microarray data ; ( c ) showed the microarray / proteomic expression results from references ; ( d ) indicated the positions of genes collected from wet - lab experimental results ; ( e ) revealed the comparative maps and the syntenic regions of mouse and rat hcc qtls ; ( f ) displayed the loh frequencies and minimum deletion regions ( mdr ) in positions of microsatellite markers ; and ( g ) the cytogenetic locations of cgh results . all genes and markers were annotated and hyperlinked against physical maps of genomes in ensembl . the up - regulated genes and gain / amplified chromosomal regions were displayed in red series color . in contrast , the down - regulated genes and loss / deleted chromosome regions were displayed in green series color . experimental validation of representative genes in the hcc gene set . for each gene , the semi - quantitative rt pcr results in 45 hcc pairs are presented in gel images ( left ) , in quantified expression profiles after normalization with -actin expression as internal control ( upper right ) and in comparison with expression profiles of the gene in re - analyzed stanford hcc microarray data from expression view of oncodb.hcc ( lower right ) . ( a ) aurka is a positive control for hcc data process ; ( b and c ) genes selected from criteria of significant expression difference in at lease three independent microarray / proteomic studies ; and ( d f ) genes selected with criteria of at least 2-fold expression difference in at least 70% of paired arrays in re - analyzed stanford hcc microarray data . stringent criteria were applied to select a set of 614 hcc genes with significant altered expression in hcc tissues ( supplementary files in oncodb.hcc ) . among them , 446 genes were supported with more than two independent studies in terms of altered expression including 145 concordantly up - regulated , 176 concordantly down - regulated and 125 genes with mixed up-/down - regulated expression in hcc tissues . the concordant expression of hcc genes could serve as potential biomarkers for hcc diagnosis . in addition , there were 234 genes with limited experimental data in hcc and 256 genes located within recurrent chromosome aberration regions . in addition to aurka , we further selected 30 out of 234 genes with limited wet - lab experiments in hcc for experimental validation . the validated results were demonstrated in terms of concordant expression of gene up- or down - regulation in 45 pairs of hcc tissues by rt pcr analysis and in comparison to 57 pairs of hcc samples of re - analyzed stanford hcc microarray data ( figure 2 and supplementary files in oncodb.hcc ) . a near perfect concordant result except ckap2 ( 96.7% , 29/30 genes ) in altered gene expression of hcc was obtained for 12 genes selected based on three independent microarray and/or proteomic reports and for 18 genes selected based on at least 2-fold expression changes within 70% patients in re - analyzed stanford hcc microarray data . to provide additional genetic support and refine the hcc loci for targeting cancer genes , the qtls of rodent hcc models identified via linkage studies were integrated into oncodb.hcc based on comparative maps of rodent genomes in ensembl . the results of 35 rodent hcc qtls were displayed according to the relative positions of human chromosomes ( figure 1e ) . comparative mapping of hcc loci demonstrated that over 45% rodent qtls ( 8 of the 12 mouse hcc qtls and another 8 of the 23 rat hcc qtls ) are located in the major aberrant loci of human hcc ( table 1 ) . among 16 syntenic qtls located in 12 hcc loci , 10 qtls in 6 loci are potentially located in gain / amplified regions and 6 qtls in 6 loci are located in loss / deleted regions . while the critical regions of hcc loci existed in comparative genomes of human and rodents , the hcc loci could be effectively narrowed down due to the scrambled structure of genomes by comparing human and rodent syntenic regions . we narrowed down two human hcc loci to 2 mb and another 6 hcc loci in between 4 and 10 mb . interestingly , the comparative mapping of hcc loci allowed us to split three human major hcc aberration regions 1q , 4q and 8p2123 into two smaller regions and to conclude that at least two putative cancer genes located on the same arm of above three human hcc chromosomes . hcc loci and putative cancer genes by comparative mapping strategy number of references with significant loh in the region defined by original authors . g : cgh gain ; l : cgh loss ; and a : cgh amplification . as indicated in figure 1 , the chromosome view interface demonstrates the main features of the database . the hcc data are constructed based on physical maps of human and rodent genome sequences from ensembl and illustrated in several aspects including cancer genomic aberration data of loh and cgh studies , altered gene expression in transcriptomes and proteomes analyses , genes with experimental data in hcc tissues reported in pubmed articles and the qtls of rodent hcc models . the interactive interface further allows users to display chromosome regions defined by physical position , cytogenetic bands and sequence - tagged site ( sts ) markers . in expression view , a total of 9785 genes can be searched by using gene i d and gene description showing individual gene data including 9162 genes displayed the detail altered expression profiles of individual arrays reprocessed from re - analyzed stanford hcc microarray data and experimental data of the gene extracted from published articles in pubmed . to demonstrate data reliability in our database , aurka , a gene reported to be up - regulated in majority of hcc tissues ( 15 ) , was selected as positive control to perform semi - quantitative rt pcr experiments in 45 pairs of hcc tissues . as indicated in figure 2a , the aurka is highly up - regulated and the expression profiles are almost identical to that of re - analyzed stanford hcc microarray data . the chromosome view of oncodb.hcc : ( a ) indicated the chromosomal region displayed in cytogenetic position ; ( b ) demonstrated the expression intensity of genes along the physical positions of chromosome in terms of patient number by selecting gene expression cut - off value ( default value = 1 ) in re - analyzed stanford hcc microarray data ; ( c ) showed the microarray / proteomic expression results from references ; ( d ) indicated the positions of genes collected from wet - lab experimental results ; ( e ) revealed the comparative maps and the syntenic regions of mouse and rat hcc qtls ; ( f ) displayed the loh frequencies and minimum deletion regions ( mdr ) in positions of microsatellite markers ; and ( g ) the cytogenetic locations of cgh results . all genes and markers were annotated and hyperlinked against physical maps of genomes in ensembl . the up - regulated genes and gain / amplified chromosomal regions were displayed in red series color . in contrast , the down - regulated genes and loss / deleted chromosome regions were displayed in green series color . experimental validation of representative genes in the hcc gene set . for each gene , the semi - quantitative rt pcr results in 45 hcc pairs are presented in gel images ( left ) , in quantified expression profiles after normalization with -actin expression as internal control ( upper right ) and in comparison with expression profiles of the gene in re - analyzed stanford hcc microarray data from expression view of oncodb.hcc ( lower right ) . ( a ) aurka is a positive control for hcc data process ; ( b and c ) genes selected from criteria of significant expression difference in at lease three independent microarray / proteomic studies ; and ( d f ) genes selected with criteria of at least 2-fold expression difference in at least 70% of paired arrays in re - analyzed stanford hcc microarray data . stringent criteria were applied to select a set of 614 hcc genes with significant altered expression in hcc tissues ( supplementary files in oncodb.hcc ) . among them , 446 genes were supported with more than two independent studies in terms of altered expression including 145 concordantly up - regulated , 176 concordantly down - regulated and 125 genes with mixed up-/down - regulated expression in hcc tissues . in addition , there were 234 genes with limited experimental data in hcc and 256 genes located within recurrent chromosome aberration regions . in addition to aurka , we further selected 30 out of 234 genes with limited wet - lab experiments in hcc for experimental validation . the validated results were demonstrated in terms of concordant expression of gene up- or down - regulation in 45 pairs of hcc tissues by rt pcr analysis and in comparison to 57 pairs of hcc samples of re - analyzed stanford hcc microarray data ( figure 2 and supplementary files in oncodb.hcc ) . a near perfect concordant result except ckap2 ( 96.7% , 29/30 genes ) in altered gene expression of hcc was obtained for 12 genes selected based on three independent microarray and/or proteomic reports and for 18 genes selected based on at least 2-fold expression changes within 70% patients in re - analyzed stanford hcc microarray data . to provide additional genetic support and refine the hcc loci for targeting cancer genes , the qtls of rodent hcc models identified via linkage studies were integrated into oncodb.hcc based on comparative maps of rodent genomes in ensembl . the results of 35 rodent hcc qtls were displayed according to the relative positions of human chromosomes ( figure 1e ) . comparative mapping of hcc loci demonstrated that over 45% rodent qtls ( 8 of the 12 mouse hcc qtls and another 8 of the 23 rat hcc qtls ) are located in the major aberrant loci of human hcc ( table 1 ) . among 16 syntenic qtls located in 12 hcc loci , 10 qtls in 6 loci are potentially located in gain / amplified regions and 6 qtls in 6 loci are located in loss / deleted regions . while the critical regions of hcc loci existed in comparative genomes of human and rodents , the hcc loci could be effectively narrowed down due to the scrambled structure of genomes by comparing human and rodent syntenic regions . we narrowed down two human hcc loci to 2 mb and another 6 hcc loci in between 4 and 10 mb . interestingly , the comparative mapping of hcc loci allowed us to split three human major hcc aberration regions 1q , 4q and 8p2123 into two smaller regions and to conclude that at least two putative cancer genes located on the same arm of above three human hcc chromosomes . hcc loci and putative cancer genes by comparative mapping strategy number of references with significant loh in the region defined by original authors . g : cgh gain ; l : cgh loss ; and a : cgh amplification . oncodb.hcc is the first attempt to establish a detail bioinformatic resource of one tumor genome by integrating genomic data of chromosome aberrations , altered gene expression , experimental data of genes in hcc tissues and qtls of rodent hcc models . three important advantages were revealed after data integration in oncodb.hcc : first , data integration from independent studies containing aberrant consequences from levels of dna , rna and protein could avoid possible pitfalls of data inconsistency from a single genomic approach and provide lines of evidence to conclude somatic aberrations . second , due to the heterogeneity nature of hcc tumorigenesis , successful gene validation in oncodb.hcc is critical for revealing significantly altered hcc genes for signatures of somatic aberrations in dissecting tumorigenic pathways and in clinical applications . finally , integrated genomic data in oncodb.hcc could narrow down and prioritize critical cancer genes and regions for positional cloning and molecular studies of cancer genes in hcc . the quality of integrated data in oncodb.hcc was experimentally supported by successful validation of altered expression in selected genes with limited wet - lab experimental studies in hcc . therefore , the open access oncodb.hcc should serve as a valuable resource for hcc research community . the oncodb.hcc is the first comprehensive integration of cancer genomic data in one prevalent cancer with experimental validation and available freely to the research community . the future perspectives for oncodb.hcc are to further integrate other newly emerging tumorigenic factors such as epigenetic modulations , point mutations and microrna alterations in genome - wide aspects . in addition , commercial available 300k or 500k high density snp chips are potentially useful to reveal high density novel genomic alterations in hcc genome . in conclusion , the comprehensive oncodb.hcc is an invaluable resource for better understanding the tumorigenic mechanisms and developing useful information in clinical applications . oncodb.hcc could serve as a bioinformatics resource that is applicable to other prevalent human cancers for dissecting tumorigenic pathways and the foundation of tumor systems biology . | the oncodb.hcc ( ) is based on physical maps of rodent and human genomes containing quantitative trait loci of rodent hcc models and various human hcc somatic aberrations including chromosomal data from loss of heterozygosity and comparative genome hybridization analyses , altered expression of genes from microarray and proteomic studies , and finally experimental data of published hcc genes .
comprehensive integration of hcc genomic aberration data avoids potential pitfalls of data inconsistency from single genomic approach and provides lines of evidence to reveal somatic aberrations from levels of dna , rna to protein .
twenty - nine of 30 ( 96.7% ) novel hcc genes with significant altered expressions in compared between tumor and adjacent normal tissues were validated by rt pcr in 45 pairs of hcc tissues and by matching expression profiles in 57 hcc patients of re - analyzed stanford hcc microarray data .
comparative mapping of hcc loci in between human aberrant chromosomal regions and qtls of rodent hcc models revealed 12 syntenic hcc regions with 2 loci effectively narrowed down to 2 mb .
together , oncodb.hcc graphically presents comprehensive hcc data integration , reveals important hcc genes and loci for positional cloning and functional studies , and discloses potential molecular targets for improving hcc diagnosis and therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
classically , phpt was described as disease of bones , stones , abdominal groans , psychic moan , and fatigue overtones . but nowadays with the use of routine biochemical testing , more and more asymptomatic patients of phpt are being diagnosed . besides hypercalcemia - related complications , phpt is also associated with increased risk of cardiovascular disease , hypercoagulable state , and metabolic syndrome . high prevalence of diabetes mellitus ( dm ) in patients with phpt is well established and higher prevalence of phpt in patients with dm has also been demonstrated . however , the improvement of insulin resistance ( ir ) after curative parathyroidectomy ( cptx ) has not been established yet as the study results are conflicting . there are few studies , which demonstrated the improvement of ir after cptx in patients with phpt . but at the same time , few studies showed that there was no improvement in ir and metabolic risk factors after cptx in patients with phpt . the present study was designed to observe the effect of cptx on peripheral ir in patients with phpt of varying severity . in this prospective interventional study , 20 patients with phpt of varying severity were recruited consecutively , irrespective of their age and gender . ten patients with mild phpt ( group 1 ) were studied at henry ford hospital , detroit , michigan , usa . another ten patients with moderate to severe phpt ( group 2 ) were studied at post graduate institute of medical education and research , chandigarh , a tertiary care center in northern india . patients with mild phpt were asymptomatic , whereas the patients with moderate to severe phpt were symptomatic , had higher pth , calcium level and had evidence of bone disease on x - rays and/or nephrolithiasis . patients with established diagnosis of dm , family history of dm in first - degree relatives and taking medications known to affect carbohydrate metabolism were excluded from the study . the respective institutional review and ethical committee approved the study and written informed consent was obtained from each patient . phpt was diagnosed by the presence of serum albumin - adjusted hypercalcemia along with inappropriately raised or nonsuppressed serum pth level , on at least two occasions . the reference range for calcium and intact pth ( ipth ) the clinical and biochemical diagnosis of phpt was confirmed by surgery , followed by histopathological examination of the parathyroid gland . the ir was assessed by two well - established methods of estimating ir by homeostasis model assessment of ir ( homa - ir ) and insulin sensitivity by quantitative insulin sensitivity check index ( quicki ) . homa - ir and quicki were measured in all patients at baseline and 3 months after cptx . in all patients , fasting serum insulin ( fsi ) and plasma glucose were measured , 7 days prior and 3 months after surgery from the same sample . fasting plasma glucose ( fpg ) was measured by glucose oxidase / glucose hexokinase by dimension vista system ( siemens , usa ) and fsi ( reference value < 14 iu / ml ) was measured by chemiluminiscence assay ( centaur xp , siemens , usa ) . homa - ir was calculated by using following formula , homa - ir= ( fsi [ iu / ml ] fpg [ mmol / l])/22.5 . quicki was calculated by using following formula , quicki = 1/(log [ i0 ] + log [ g0 ] ) , where i0 is the fasting insulin , and g0 is the fasting glucose . the reference normal value for homa - ir and quicki were 2.06 0.14 ( 0.76.5 ) and 0.382 0.007 , respectively . serum ipth , 25(oh ) vitamin d ( vitamin d ) were measured by chemiluminescence assay and serum albumin , calcium ; creatinine was measured in the institute laboratory by standard methods . unfortunately , vitamin d could not be measured after surgery in the indian patients because of the financial constraints . data analysis was performed using statistical package for the social sciences ( spss ) software , version 13 ( ibm ) . the data were checked for skewness . paired t - test , anova followed by post hoc multiple comparisons were used where applicable and a p < 0.05 was set as statistically significant . in this prospective interventional study , 20 patients with phpt of varying severity were recruited consecutively , irrespective of their age and gender . ten patients with mild phpt ( group 1 ) were studied at henry ford hospital , detroit , michigan , usa . another ten patients with moderate to severe phpt ( group 2 ) were studied at post graduate institute of medical education and research , chandigarh , a tertiary care center in northern india . patients with mild phpt were asymptomatic , whereas the patients with moderate to severe phpt were symptomatic , had higher pth , calcium level and had evidence of bone disease on x - rays and/or nephrolithiasis . patients with established diagnosis of dm , family history of dm in first - degree relatives and taking medications known to affect carbohydrate metabolism were excluded from the study . the respective institutional review and ethical committee approved the study and written informed consent was obtained from each patient . phpt was diagnosed by the presence of serum albumin - adjusted hypercalcemia along with inappropriately raised or nonsuppressed serum pth level , on at least two occasions . the reference range for calcium and intact pth ( ipth ) the clinical and biochemical diagnosis of phpt was confirmed by surgery , followed by histopathological examination of the parathyroid gland . the ir was assessed by two well - established methods of estimating ir by homeostasis model assessment of ir ( homa - ir ) and insulin sensitivity by quantitative insulin sensitivity check index ( quicki ) . homa - ir and quicki were measured in all patients at baseline and 3 months after cptx . in all patients , fasting serum insulin ( fsi ) and plasma glucose were measured , 7 days prior and 3 months after surgery from the same sample . fasting plasma glucose ( fpg ) was measured by glucose oxidase / glucose hexokinase by dimension vista system ( siemens , usa ) and fsi ( reference value < 14 iu / ml ) was measured by chemiluminiscence assay ( centaur xp , siemens , usa ) . homa - ir was calculated by using following formula , homa - ir= ( fsi [ iu / ml ] fpg [ mmol / l])/22.5 . quicki was calculated by using following formula , quicki = 1/(log [ i0 ] + log [ g0 ] ) , where i0 is the fasting insulin , and g0 is the fasting glucose . the reference normal value for homa - ir and quicki were 2.06 0.14 ( 0.76.5 ) and 0.382 0.007 , respectively . serum ipth , 25(oh ) vitamin d ( vitamin d ) were measured by chemiluminescence assay and serum albumin , calcium ; creatinine was measured in the institute laboratory by standard methods . unfortunately , vitamin d could not be measured after surgery in the indian patients because of the financial constraints . data analysis was performed using statistical package for the social sciences ( spss ) software , version 13 ( ibm ) . anova followed by post hoc multiple comparisons were used where applicable and a p < 0.05 was set as statistically significant . relevant demographic , biochemical parameter of mild ( group 1 ) and moderate to severe ( group 2 ) phpt groups are compared in table 1 . there were two men in the mild ( 1:4 ) and 4 men in the moderate to severe phpt group ( 2:3 ) . all patients had a single parathyroid adenoma , except one patient in group 2 had a double adenoma . indian patients with moderate to severe phpt were younger ( p = 0.001 ) , had lower body mass index ( p = 0.107 ) and higher ipth level ( p = 0.001 ) as compared to the american patients with mild phpt [ table 1 ] . however , serum calcium ( p = 0.242 ) and vitamin d ( p = 0.049 ) were lower in indian patients as compared to american patients [ table 1 ] . among the patients with moderate to severe phpt , seven patients had nephrolithiasis and two had fracture bone as compared to none of the patients with mild phpt . baseline data of the study population following surgery , serum calcium ( ca ) was normalized in all patients . ipth was normalized in patients with mild phpt and reduced by > 50% in indian patients with moderate to severe phpt ( p < 0.001 ) , but remained higher than normal after 3 months [ table 2 ] . serum vitamin d also improved significantly ( p = 0.012 ) , after cptx in the us patients with mild phpt ( 28.7 10.3 vs. 37 12.21 ng / ml ) . parameters before and after parathyroidectomy fpg was similar before and after surgery in mild and moderate to severe phpt [ table 2 ] . there was no significant difference in fpg between the groups before ( p = 0.59 ) and after ( p = 0.085 ) cptx . there was no significant ( p = 0.683 ) difference in fpg of the combined group before and 3 months after cptx [ table 2 ] . fsi was also similar before and after cptx in mild as well as in moderate to severe phpt [ table 2 ] . fsi was higher preoperatively in moderate to severe phpt as compared to mild phpt ( p = 0.669 ) and increased postoperatively in both the groups ( p = 0.27 ) , but could not reach to statistical significance [ table 2 ] . fsi did not differ significantly ( p = 0.977 ) in the combined group before and after cptx [ table 2 ] . before surgery homa - ir was higher , both in patients with mild phpt ( p = 0.058 ) and with moderate to severe phpt ( p = 0.023 ) as compared to published normal reference mean ( 2.06 0.14 ) , with no significant difference ( p = 0.84 ) between the groups [ table 2 ] . three months after cptx homa - ir increased further in all the groups , with no significant difference within and between the groups [ table 2 ] . consequently , the postoperative homa - ir was also significantly higher than normal reference mean for the mild ( p < 0.001 ) and moderate to severe ( p = 0.004 ) , as well as in the combined phpt group ( p < 0.01 ) [ figure 1 and table 2 ] . although homa - ir was numerically higher in patients with moderate to severe phpt as compared to mild phpt , both before and after cptx , the difference did not reach statistical significance [ table 2 ] . comparison of homeostasis model assessment of insulin resistance of combined group ( primary hyperparathyroidism ) with the normal reference mean ( 2.06 0.14 ) , ( fnx01p < 0.01 ) . there was no significant difference between the pre- and post - operative homeostasis model assessment of insulin resistance ( p = 0.292 ) before surgery quicki was significantly lower both in mild ( p = 0.009 ) and moderate to severe ( p = 0.005 ) phpt groups , as compared to published normal reference mean ( 0.382 0.007 ) , with no significant difference ( p = 0.96 ) between the groups [ table 2 ] . three months after cptx , quicki almost remained unchanged in the mild ( p = 0.082 ) , moderate to severe ( p = 0.56 ) , and combined phpt groups ( p = 0.893 ) [ table 2 ] . postoperative quicki was significantly lower than normal reference mean in the mild ( p < 0.001 ) and combined phpt groups ( p < 0.001 ) but not in the patients with moderate to severe phpt ( p = 0.132 ) [ figure 2 ] . there was no difference in quicki between the mild and moderate to severe phpt group before and after cptx ( p = 0.307 ) . comparison of quantitative insulin sensitivity check index of the combined group ( primary hyperparathyroidism ) with the normal reference mean ( 0.382 0.007 ) , ( fnx01p < 0.01 ) . there was no significant difference between the pre- and post - operative quantitative insulin sensitivity check index ( p = 0.893 ) relevant demographic , biochemical parameter of mild ( group 1 ) and moderate to severe ( group 2 ) phpt groups are compared in table 1 . there were two men in the mild ( 1:4 ) and 4 men in the moderate to severe phpt group ( 2:3 ) . all patients had a single parathyroid adenoma , except one patient in group 2 had a double adenoma . indian patients with moderate to severe phpt were younger ( p = 0.001 ) , had lower body mass index ( p = 0.107 ) and higher ipth level ( p = 0.001 ) as compared to the american patients with mild phpt [ table 1 ] . however , serum calcium ( p = 0.242 ) and vitamin d ( p = 0.049 ) were lower in indian patients as compared to american patients [ table 1 ] . among the patients with moderate to severe phpt , seven patients had nephrolithiasis and two had fracture bone as compared to none of the patients with mild phpt . baseline data of the study population following surgery , serum calcium ( ca ) was normalized in all patients . ipth was normalized in patients with mild phpt and reduced by > 50% in indian patients with moderate to severe phpt ( p < 0.001 ) , but remained higher than normal after 3 months [ table 2 ] . serum vitamin d also improved significantly ( p = 0.012 ) , after cptx in the us patients with mild phpt ( 28.7 10.3 vs. 37 12.21 ng / ml ) . fpg was similar before and after surgery in mild and moderate to severe phpt [ table 2 ] . there was no significant difference in fpg between the groups before ( p = 0.59 ) and after ( p = 0.085 ) cptx . there was no significant ( p = 0.683 ) difference in fpg of the combined group before and 3 months after cptx [ table 2 ] . fsi was also similar before and after cptx in mild as well as in moderate to severe phpt [ table 2 ] . fsi was higher preoperatively in moderate to severe phpt as compared to mild phpt ( p = 0.669 ) and increased postoperatively in both the groups ( p = 0.27 ) , but could not reach to statistical significance [ table 2 ] . fsi did not differ significantly ( p = 0.977 ) in the combined group before and after cptx [ table 2 ] . before surgery homa - ir was higher , both in patients with mild phpt ( p = 0.058 ) and with moderate to severe phpt ( p = 0.023 ) as compared to published normal reference mean ( 2.06 0.14 ) , with no significant difference ( p = 0.84 ) between the groups [ table 2 ] . three months after cptx homa - ir increased further in all the groups , with no significant difference within and between the groups [ table 2 ] . consequently , the postoperative homa - ir was also significantly higher than normal reference mean for the mild ( p < 0.001 ) and moderate to severe ( p = 0.004 ) , as well as in the combined phpt group ( p < 0.01 ) [ figure 1 and table 2 ] . although homa - ir was numerically higher in patients with moderate to severe phpt as compared to mild phpt , both before and after cptx , the difference did not reach statistical significance [ table 2 ] . comparison of homeostasis model assessment of insulin resistance of combined group ( primary hyperparathyroidism ) with the normal reference mean ( 2.06 0.14 ) , ( fnx01p < 0.01 ) . there was no significant difference between the pre- and post - operative homeostasis model assessment of insulin resistance ( p = 0.292 ) before surgery quicki was significantly lower both in mild ( p = 0.009 ) and moderate to severe ( p = 0.005 ) phpt groups , as compared to published normal reference mean ( 0.382 0.007 ) , with no significant difference ( p = 0.96 ) between the groups [ table 2 ] . three months after cptx , quicki almost remained unchanged in the mild ( p = 0.082 ) , moderate to severe ( p = 0.56 ) , and combined phpt groups ( p = 0.893 ) [ table 2 ] . postoperative quicki was significantly lower than normal reference mean in the mild ( p < 0.001 ) and combined phpt groups ( p < 0.001 ) but not in the patients with moderate to severe phpt ( p = 0.132 ) [ figure 2 ] . there was no difference in quicki between the mild and moderate to severe phpt group before and after cptx ( p = 0.307 ) . comparison of quantitative insulin sensitivity check index of the combined group ( primary hyperparathyroidism ) with the normal reference mean ( 0.382 0.007 ) , ( fnx01p < 0.01 ) . there was no significant difference between the pre- and post - operative quantitative insulin sensitivity check index ( p = 0.893 ) the proposed pathogenetic factors and mechanisms responsible for the ir in phpt are hypercalcemia , high pth , low phosphate , and body weight . most likely the disturbance in carbohydrate metabolism is caused by interplay of all these three biochemical abnormalities . in addition , there is also reduced binding of insulin to its peripheral receptors due to receptor downregulation . in animal models , pth administration has been shown to cause a reduction in atp content in pancreatic islets leading to impaired insulin release . hypophosphatemia in phpt is also known to cause impaired peripheral glucose utilization and decreased insulin responsiveness . this study also showed hyperinsulinemia in the presence of hypercalcemia in both group of phpt . postoperatively , serum calcium normalized but serum insulin levels did not change significantly at 3 months . according to our study serum , calcium level did not correlate with homa - ir and quicki , before and after cptx , as observed in previous studies . according to our study , pth level reduced significantly after cptx , but it did not correlate with serum insulin , homa - ir , and quicki , pre- or post - operatively in either group . the studies regarding the effect of pth on hyperinsulinemia and ir are conflicting . in our study however , these did not achieve statistical significance , even though the pht level decreased significantly after cptx . like the previous study , our study also showed that homa - ir was significantly higher in patients with mild and moderate to severe phpt , compared to normal reference mean ( p < 0.01 ) . but at the same time , few study showed that homa - ir remained unchange compared to baseline values even after 18 months without parathyroidectomy . kautzky - willer et al . assessed insulin sensitivity in phpt , before and 3 months after cptx by oral and intravenous glucose tolerance test . . these contrasting results may be due small sample size , degree of hypercalcemia in patients ( mean calcium 12 mg / dl ) and use of intravenous and oral glucose tolerance test to assess insulin sensitivity . few studies revealed the improvement of ir after cptx in patients with phpt . according to this study , there is ir in patients with mild as well as moderate to severe phpt in the absence of dm , as reported previously . in addition , we also demonstrated that there is no significant improvement in homa - ir or quicki following cptx , either in mild or in moderate to severe phpt . according to our study , severity of ir the therapeutic role of cptx in symptomatic patients with moderate to severe phpt is well established but at the same time , there is some doubt regarding role of cptx in asymptomatic patients with mild phpt . at presents , the significant clinical implication of this study is , asymptomatic mild phpt with abnormal glucose metabolism should not be used as criteria for cptx . further study with larger sample size and longer duration of follow - up is needed , for better evaluation of the role of parathyroidectomy for improvement of ir in patients with phpt . the major limitation was , small sample size and short period follow - up . a longer duration of follow - up may be needed for better evaluation of improvement in ir . the major limitation was , small sample size and short period follow - up . a longer duration of follow - up may be needed for better evaluation of improvement in ir . peripheral ir ( homa - ir ) and insulin sensitivity ( quicki ) remained unchanged after cptx in mild as well as moderate to severe phpt . both the homa - ir and quicki do not correlate with the severity of phpt or pth level . asymptomatic mild phpt with abnormal glucose metabolism should not be used as criteria for cptx . however | background : primary hyperparathyroidism ( phpt ) is characterized by inappropriately elevated serum parathyroid hormone ( pth ) level despite elevated serum calcium .
insulin resistant is the basic pathophysiology , behind the higher prevalence of diabetes mellitus in patients with phpt .
however , the improvement in insulin resistance ( ir ) after curative parathyroidectomy ( cptx ) has not been established yet , as the study results are conflicting.materials and methods : in this prospective interventional study , ten patients with mild phpt ( group 1 ) and another ten patients with moderate to severe phpt ( group 2 ) were undergone cptx . the ir was assessed by homeostasis model assessment - ir ( homa - ir ) , quantitative insulin sensitivity check index ( quicki ) , fasting plasma glucose ( fpg ) , and fasting serum insulin ( fsi ) , before and 3 months after cptx.results:there was no significant change of fpg and fsi , before and after cptx in group 1 ( p = 0.179 and p = 0.104 ) and group 2 ( p = 0.376 and p = 0.488 ) . before surgery ,
homa - ir was higher , and quicki was significantly lower , in both group 1 ( p = 0.058 and p = 0.009 ) and group 2 ( p = 0.023 and p = 0.005 ) as compared to published normal reference mean , with no significant difference between the groups .
three months after surgery homa - ir increased further and quicki remained unchanged as compared to baseline , in both group 1 ( p = 0.072 and 0.082 ) and group 2 ( p = 0.54 and 0.56 ) , but statistically insignificant.conclusion:ir remained unchanged after cptx in mild as well as moderate to severe phpt .
asymptomatic phpt with abnormal ir should not be used as criteria for parathyroidectomy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
while adrenal adenomas are quite frequent in the general population , adrenal cortical carcinomas ( accs ) are rare malignancies affecting only 2 per million per year in the world population . a bimodal age distribution has been recognized , with first peak in childhood ( < 5 years of age ) and second peak in 4 - 5 t decade of life . most of the accs are sporadic ; however they may also arise within the context of familial or hereditary diseases . although different studies have been undertaken in order to elucidate the molecular pathogenesis of sporadic accs , to date none of them has been proven to be completely exhaustive . in particular , the genetic alterations characteristic of the adenoma - carcinoma sequence has not clearly established . to date , modification in three main molecular patterns has been identified : insulin - like growth factor ( igf)-2 , the metabolic pathway wnt/-catenin and tp53 . accs can be either functioning ( i.e. producing hormones of the adrenal cortex ) or non - functioning . adrenal malignancies are more likely to be functioning with respect to adenomas and can have different clinical presentations , depending on the type of hormonal secretion . in fact , patients may have symptoms of hypercortisolism , hyperaldosteronism , or sex hormone excess ( either virilization or feminization ) , although mixed clinical features can be observed . feminizing accs , i.e. malignant adrenal tumors causing features of estrogen excess , are an extremely rare cause of abdominal mass . we herein present a case of a young man having a giant feminizing acc with distant metastases , which posed serious management problems principally related to the burden of the primary tumor . a 41-year - old gentleman presented complaining of a 6-month history of bilateral gynecomastia without galactorrhea , and a significant weight loss ( 8 kg in the last three months ) . in the last two months he also noticed abdominal and back pain , dyspepsia , and some episodes of vomiting , bloating and difficult passage of stools . the rest of his medical history was not relevant and he was on no medications . his family history revealed the presence of a 37-year - old sister with an established diagnosis of men1 ( primary hyperparathyroidism , pancreatic gastrinoma , and prolactinoma ) with germline mutation 894 - 9 ga , and a 50-year - old brother affected by an adrenocorticotropic hormone ( acth)-secreting pituitary adenoma causing cushing s disease . as the patient was in good health before the appearance of gynecomastia , he had previously refused to undergo laboratory and genetic testing . laboratory tests showed : i ) extremely high estradiol plasma levels ( e2>500 ) , together with undetectable gonadotropin levels and low testosterone ; ii ) the likely coexistence of cushing s disease ( hypercortisolemia with increased acth levels ) ( table 1 ) . in relation to the latter , an overnight dexamethasone suppression test ( 1 mg at 11.00 p.m. ) was carried out , which failed to show serum cortisol suppression ( 19 g / dl at 08.00 a.m. ) . on abdominal examination , a large , firm mass adherent to the deep layers was palpable in the left quadrants . the total body computed tomographic ( ct ) scan showed a large tumor of the left adrenal ( 25 cm in its maximum diameter ) with colliquative areas infiltrating the left kidney ( figure 1 ) , left renal vein thrombosis , and multiple liver and lung metastases . pelvic ct scan revealed no abnormality , while breast and testicular ultrasound confirmed the presence of gynecomastia and reduced testicular volume . after a multidisciplinary discussion , it was decided to operate on the patient to remove the adrenal tumor , in an attempt to reduce the symptoms related to the mass , principally pain and recurrent subocclusive episodes . before the operation , a medication with ketoconazole was started for hypercortisolemia ; however , replacement of ketaconazole with metyrapone was necessary to normalize the cortisol levels . the patient underwent an exploratory celiotomy where a large encapsulated mass was encountered , displacing the kidney inferiorly and the distal pancreas and spleen superiorly . the right adrenal also appeared increased in size , thus a bilateral adrenalectomy was performed . on gross pathology examination , the left adrenal tumor ( which included approximately half of the left kidney , with diffusely infiltrated areas ) weighed 3.3 kg , and measured 271712 cm ( figure 2 ) . the histological examination revealed an acc with oncocytic changes with a weiss score of 8 ( figure 3 ) . based on the histological finding , the laboratory tests , and the presence of distant metastases , we made the diagnosis of feminizing adrenocortical carcinoma at stage iv according to the american joint committee on cancer ( ajcc ) classification . the postoperative course was uneventful , and the patient was discharged on postoperative day 12 . he was given replacement therapy with hydrocortisone , fludrocortisone , and mitotane therapy without any important side effects . six months after surgery , laboratory tests showed a normalization of cortisol and estrogens levels . gynecomastia was markedly improved , and a mild reduction of the size of liver and lung metastasis was observed . he went on to live 12 months with an acceptable quality of life before dying from metastatic disease . feminizing accs are very rare , accounting for only 1 - 2% of all malignant neoplasms of adrenal cortex . in 1994 , zayed reported fewer than 100 cases described in male sex . clinical features related to steroid excess occur in about 60% of accs , while feminizing symptoms due to estrogen secretion are extremely uncommon . the main presenting signs and symptoms of feminizing acc are gynecomastia , testicular atrophy , decreased libido and impotence . in line with other reported cases , gynecomastia was the presenting symptom of acc in our patient . gynecomastia recognizes various causes , being most commonly due to medications , imbalance between testosterone / estrogen levels , kidney failure , cirrhosis , and much more rarely to pituitary and adrenal tumors . it has been suggested that feminizing symptoms can be linked to aberrant aromatization of adrenal androgens in estrogens , principally e1 . feminization is often combined with hypercortisolism , as we observed in our patient . while aacs are for the most part sporadic , they can occur as part of various familial tumor syndromes , such as men1 , li - fraumeni syndrome , beckwith - wiedemann syndrome , and carney complex . the familiar history of our patient denoted the presence of well - defined endocrine pathologies ( men1 and acth - producing pituitary adenoma ) . adrenal neoplasms are not commonly included in men1 ; however , non - functioning macronodular hyperplasia is observed in up to 40% of patients with men1 and , even rarely , accs can occur . as a consequence , we investigated the existence of men1 syndrome in our patient , but the laboratory and imaging studies prevented us from confirming this hypothesis . in the described case , however , differentiation between benign tumors ( adenomas ) of the adrenal cortex and accs is not always simple to achieve . the likelihood of being malignant is very high for adrenal tumors producing sex hormones ; in particular , feminization is quite consistent with malignancy more often than virilization . as for the histological criteria , the model proposed by weiss in 1984 still remains the most accurate and the one that best correlates with the prognosis of accs . this model includes nine histological features distinguishing benign from malignant tumors . in our patient , one cause for this finding is certainly the fact that many accs are detected at advanced stage . according to the literature , only 25 - 30% of patients present with stage i - ii ( disease confined to the adrenal ) , whereas about 70% present with stage iii - iv ( disease extending beyond the adrenal ) . the two most important prognostic factors have been identified in stage at diagnosis and surgical radicality , though age , mitotic count , and ki67 expression have also been considered . historically , overall 5-year survival rates in patients with accs range between15% and 20% . in a study from the memorial sloan kettering cancer center , patients with stage i - ii disease and with iii - iv disease had 5-year survival of 60% and 10% , respectively . complete surgical resection is the only potentially curative treatment , and nowadays remains the mainstay in the treatment of localized accs ( stage i - iii ) , even in patients with extension to adjacent organs and positive local lymph nodes . even patients who undergo radical surgery bear high risk ( about 80% ) of local relapse and metastases , which typically occur within 2 years . when surgical removal is not achieved with radical intent , although the use of laparoscopic adrenalectomy for malignant aacs has been reported to be safe by some authors , there is a common agreement that open surgery should be preferred in this setting . our patient had stage iv disease because of distant metastases ( lungs and liver ) and invasion of adjacent tissues . in stage surgical resection of metastatic acc remains controversial , although surgery may have a role in metastatic accs providing that greater than 90% of the tumor and metastases can be removed , according to the national comprehensive cancer national guidelines . in the case described herein , the management decision was quite complex , as a result of the patient s young age , the presence of widespread disease and the local extension of the primary tumor . following a multi - disciplinary approach , we decided to operate on the patient because of the local effects of tumor . the intention was obviously not to cure the patient with surgery , but to ameliorate his quality of life , and thus obtain a good palliation for mass effects and hormonal symptoms . to note , he lived with an acceptable quality of life for 12 months after the surgical removal of the adrenal mass . we can reasonably speculate that , in this case , surgery might have prolonged the overall patient survival . mitotane , alone or in combination with other chemiotherapics has historically been the main medicament used in the adjuvant setting following radical surgery as well as in metastatic disease . its use is limited by significant , dose - dependent gastrointestinal and neurologic toxicity ; in our case the mitotane therapy was quite well tolerated . survival rates from acc have not substantially changed over the last 20 years , and systemic treatment , to date , is unsatisfactory . the phase iii firm - act trial comparing two different regimens in metastatic accs ( etoposide , doxorubicin , cisplatin , and mitotane versus streptozotocin and mitotane ) showed no difference between the two regimens in terms of overall survival ( 14.8 vs 12.0 months ; p=0.07 ) . as knowledge of the molecular mechanisms of accs continues to improve , it is likely that targeted therapies will improve survival outcomes in the near future . numerous trials are investigating targeted agents such as epidermal growth factor inhibitors , antiangiogenic agents , tyrosine kinase inhibitors , igf-1 inhibitors , and fibroblast growth factor receptor inhibitors . in our opinion , this report contains two principal points of interest . first , we emphasize the fact that feminizing acc should be taken into account as a possible diagnosis in patients presenting with gynecomastia , especially when the common causes for this disorder have been ruled out . second , surgery may have a role even in patients with functioning accs at stage iv , with the aim of improving quality of life by relieving symptoms of hormonal excess and mass effects . | functioning adrenocortical carcinomas are rare diseases with dismal prognosis . a 41-year - old man presenting with gynecomastia
had a giant feminizing adrenocortical carcinoma at stage iv .
although surgical resection was controversial , we removed the primary tumor to reduce the mass effects .
he lived for 12 months with an acceptable quality of life .
gynecomastia may be the first sign of feminizing adrenal malignancies .
surgery may ameliorate the quality of life in selected patients with metastatic disease . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
prospective studies have clearly established an association of over - weight / obesity with non - communicable diseases . childhood obesity often tracks into adolescence vis - - vis adults and is linked with increased mortality and morbidity . published reports have shown that overweight and obesity are associated with impaired glucose tolerance , hypertension , atherosclerotic risk factors and type ii diabetes among children and adolescents . further overweight / obese children are frequently prone to unhealthy conditions , academically poor performance , social ineptness and laziness . in 1998 , , the prevalence of obesity is 4.8% in developing countries , 17.1% in transitional countries and 20.4% in developed countries . the causes for the precipitation of overweight and obesity are multifactor including genetic , biological , social , and environmental determinants either collectively or independently affecting weight gain by acting through the mediators of energy metabolism and physical activity . the rising prevalence of obesity among genetically stable population groups indicates that the social and environmental determinants might have importance in understanding the overweight and obesity epidemic . a recent workshop on education for childhood obesity prevention : a life - course approach , coordinated by the pan - american health organization and the pan - american health and education foundation , held on 14 june 2012 in aruba , as part of the ii pan - american conference on childhood obesity , suggested life course frame work and education as a social determinant of health to address childhood obesity . towards this end , the indian council of medical research in its taskforce project cautioned to document information on obesity prevalence and its risk factors across the country in view of diverse cultures . in the light of this information the current study was undertaken to asses the prevalence of overweight and obesity and its association with social and environmental determinants from adolescent school children of tirupati , andhra pradesh , india . the present investigation was a cross sectional one , to collect and document the information on anthropometric indicators and social and environmental factors for a population of adolescent school children from tirupati town of andhra pradesh . the study was approved by the departmental ethics committee of sri venkateswara university , tirupati . tirupati is one of the largest cities in rayalaseema regions of andhra pradesh state , india . study population consisted of school children of both genders between the ages of 12 - 16 years . according to the available statistics , a total of 45,998 adolescents in the age range of 12 - 16 years were enrolled in various schools across the town in the academic year 2011 - 12 ( source : district educational office , chittoor ) . eight wards were picked , and two schools from each ward were randomly selected and children were sampled with probability proportionate to the size . the required sample size was estimated to be 2200 subjects . in the current study , the sample used for the analysis was 2258 subjects ( 1097 boys and 1161 girls ) . the parents of the wards were contacted over phone by the school management and were explained the objectives of the study prior to obtaining their consent . on receiving their written consent , the children were included in the study . children with any gross abnormality and irregular in attending to the class work were excluded from the study enrollment . the questionnaire consisted information on the demographics , education , occupation , socioeconomic conditions of the parents . further , children 's sleep patterns , physical activity , video watching and eating habits were procured . information on anthropometry like height , weight , waist circumference , hip circumference and skin fold thickness at biceps , sub scapular and abdomen was obtained as per the standard procedures . weight was measured in light clothing with no shoes , nearest to 10 g. height of the students was measured with their shoes off and measurement was taken to the nearest 1 mm . waist circumference was measured to the nearest 0.1 cm horizontally at the narrowest point between lower end of the rib cage and iliac crest . hip circumference was measured to the nearest 0.1 cm , at the greatest horizontal circumference below the iliac crest at the level of greater trochanter . the triceps skinfold was measured on the back of the right arm over the triceps muscle , midway between the elbow and the acromion process of the scapula . the abdominal skinfold was measured vertically at a site 2 cm to the right side of the umbilicus ( bellybutton ) . all the measurements were taken twice on the subject with a gap of 5 min and the average was taken for the analysis . overweight and obesity were considered as bmi above the 85 and 95 percentiles , respectively , as specified for age and sex by centre for disease control and prevention ( cdc ) 2000 . the three skin fold measurements were summed to calculate sum of the skin fold thickness . the data were coded and statistical analysis was carried out through statistical package for the social sciences software ( spss version 16.0 ) . chi square test , student 's t - test and anova were used to see the test of significance . the effect of socioeconomic and life style measures on the prevalence of overweight and obesity were analyzed by using odds ratios through multinomial logistic regression model after adjusting for age and sex . the variables that have shown significant variation in the prevalence of overweight and obesity were entered in the model . study population consisted of school children of both genders between the ages of 12 - 16 years . according to the available statistics , a total of 45,998 adolescents in the age range of 12 - 16 years were enrolled in various schools across the town in the academic year 2011 - 12 ( source : district educational office , chittoor ) . eight wards were picked , and two schools from each ward were randomly selected and children were sampled with probability proportionate to the size . the required sample size was estimated to be 2200 subjects . in the current study , the sample used for the analysis was 2258 subjects ( 1097 boys and 1161 girls ) . the parents of the wards were contacted over phone by the school management and were explained the objectives of the study prior to obtaining their consent . on receiving their written consent , the children were included in the study . children with any gross abnormality and irregular in attending to the class work were excluded from the study enrollment . the questionnaire consisted information on the demographics , education , occupation , socioeconomic conditions of the parents . further , children 's sleep patterns , physical activity , video watching and eating habits were procured . information on anthropometry like height , weight , waist circumference , hip circumference and skin fold thickness at biceps , sub scapular and abdomen was obtained as per the standard procedures . weight was measured in light clothing with no shoes , nearest to 10 g. height of the students was measured with their shoes off and measurement was taken to the nearest 1 mm . waist circumference was measured to the nearest 0.1 cm horizontally at the narrowest point between lower end of the rib cage and iliac crest . hip circumference was measured to the nearest 0.1 cm , at the greatest horizontal circumference below the iliac crest at the level of greater trochanter . the triceps skinfold was measured on the back of the right arm over the triceps muscle , midway between the elbow and the acromion process of the scapula . the abdominal skinfold was measured vertically at a site 2 cm to the right side of the umbilicus ( bellybutton ) . all the measurements were taken twice on the subject with a gap of 5 min and the average was taken for the analysis . overweight and obesity were considered as bmi above the 85 and 95 percentiles , respectively , as specified for age and sex by centre for disease control and prevention ( cdc ) 2000 . the three skin fold measurements were summed to calculate sum of the skin fold thickness . the data were coded and statistical analysis was carried out through statistical package for the social sciences software ( spss version 16.0 ) . chi square test , student 's t - test and anova were used to see the test of significance . the effect of socioeconomic and life style measures on the prevalence of overweight and obesity were analyzed by using odds ratios through multinomial logistic regression model after adjusting for age and sex . the variables that have shown significant variation in the prevalence of overweight and obesity were entered in the model . a total of 2258 subjects ( 1097 boys and 1161 girls ) were studied to assess the prevalence of overweight and obesity . descriptive statistics for anthropometric measurements in different age groups for adolescent boys and girls were presented in table 1 . anthropometric measurements like bmi , waist hip ratio and sum of the skin fold thickness have shown an increasing trend ( p < 0.05 ) from 12 years to 16 years , in both boys and girls , except waist hip ratio in girls . gender comparisons in different age groups indicate that girls were dominating boys in accumulating skin fold thickness at different sites . waist hip ratio was significantly higher in boys than girls ( p < 0.05 ) except in 16 years of age group . girls have shown higher bmi than boys in 13 and 14 years age groups ( p < 0.05 ) . descriptive statistics and anthropometric measurements according to age among adolescent boys and girls prevalence of overweight and obesity in the sample was shown in table 2 . in the current sample , no significant differences were observed in the prevalence of overweight and obesity across the age groups [ table 3 ] . the prevalence of overweight in 12 year age group of boys and girls were around 10.2 to 10.5 and rose to 9.9 to 13.80 in 16 year age group . similarly , the obesity was 4.9 percent in 12 year age group and rose to 4.5 to 4.9 percent in 16 year age group . prevalence of overweight and obesity among adolescent boys and girls age and sex - wise proportion of overweight and obese among the study sample socioeconomic and life style gradients and its impact on the prevalence of overweight and obesity were shown in table 4 . the prevalence of overweight and obesity was highest in single child and a decreasing trend was seen when number of siblings increased . overweight and obesity prevalence rates were low in subjects whose sleep duration is 9 hrs and above when compared to 7 hrs and below . multinomial logistic regression analysis shows that the magnitude of being an overweight child is 1.6 fold ( 95% ci : 1.048 - 2.354 ) when the mother attained higher education . increased family income raised children 's overweight ( or = 1.529 ; 95% ci : 1.089 - 2.148 ) . children 's sleep duration for < 7 hrs showed 2.0 times ( 95% ci : 1.194 - 3.371 ) association towards overweight when compared to children whose sleep duration was 9 hrs and above per day . age and sex adjusted or and 95% ci for the prevalence of overweight and obesity according to socioeconomic and life style determinants the prevalence of overweight and obesity among the adolescents of the present sample were 10.8% and 4.8% , respectively . the prevalence rates of overweight and obesity were lower when compared to adolescents from germany ( 15% and 6% ) , portugal ( 20.3% and 11.3% ) and higher than brazil ( 9.65% and 2.1% ) etc . , in the indian sample , the prevalence of overweight and obesity among affluent girls aged 10 - 15 years in chennai was 9.6% and 6.2% , respectively . , shows that the prevalence rates of overweight and obesity were 11.75% and 2.2% , respectively . our results were consistent with other studies indicating that obesity is epidemic in 21 century in indian continent . in the given situation , if the trend of overweight and obesity is not managed , it may lead to adult overweight and obesity . the variables associated with overweight , independently seems to be parental education and economy and the child 's sleep duration . parental literacy levels seem to be the most pertinent social problem in india for the observed escalation in overweight and obesity . prospective studies undergone in developed countries have clearly indicated that lower levels of parental education was a risk factor for childhood obesity . in contrary , developing countries like india noticed weight gain with increased parental education . increased economy is negatively correlated with excessive body weight in both adolescents and adults in developed countries . on the contrary , increased economy is associated with increased body weight in developing countries like india as noticed in the present sample . increased economy may provide an opportunity to have choice and preparation of food . in developed countries , it is assumed that children belonging to families of disadvantaged economic status , because of their lower earning power and decreased knowledge of healthy nutrition , were more exposed to high calorie foods and simple carbohydrates , which are cheaper and easier to access . modernization and urbanization offer calorie rich foods for the children being known that it may lead to develop obesity and associated complications . this association appears to be characteristic of a region in an economic transition . in this sample , sleep time found to be one of the significant environmental problem towards accumulating body weight in adolescents . the limitations of the study were lack of data on food consumption patterns . the captured information on adolescents eating behavior of ice creams , chats , chocolates and fast foods failed to show any association . probably both parents and children either may have failed to explain or the techniques were not properly validated by the researchers . in conclusion , the data revealed that the trend of adolescent overweight and obesity is a worrying phenomenon in the national perspective . the findings of the study strongly advocate the need to implement interventional measures for preventing adolescent overweight and obesity . | background : overweight and obesity among children and adolescents is a public health concern.objective:to assess the prevalence of overweight and obesity and its association with social and environmental determinants among the adolescent school children of tirupati town of andhra pradesh , india.materials and methods : data was collected by interviewer - administered method from school children aged between 12 to 16 years .
the sample consisted of 2258 subjects ( 1097 boys and 1161 girls ) .
overweight and obesity were defined by body mass index ( bmi ) based on the current method recommended by the centre for disease control and prevention 2000 .
data on social and environmental determinants were collected by using a pre - tested and validated questionnaire.results:in the present sample , 11.2 percent and 4.8 percent of boys and 10.3 percent and 4.8 percent of girls were overweight and obese . the literacy level of parents , family income and child sleep duration significantly associated with overweight .
parental level of education was a risk factor for overweight ( mother : 1.570 ; 95% ci : 1.048 - 2.354 ) .
similarly increase in family income ( or = 1.529 ; 95% ci : 1.089 - 2.148 ) and child sleep duration < 7 hrs per day ( or = 2.006 ; 95% ci : 1.194 - 3.371 ) raised children 's association in gaining weight.conclusion:our study reinforces the burgeoning prevalence of overweight and obesity among the adolescents .
interventional measures taken should consider family , school and physical environment to check the problem of overweight / obesity . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the vater association was first described in 1973 as the nonrandom co - occurrence of five defects , ie , vertebral anomalies ( v ) , anal atresia ( a ) , esophageal atresia and/or trachea - esophageal fistula ( te ) and radial and renal anomalies ( r ) . subsequently , cardiovascular anomalies ( c ) and limb defects ( l ) were also included defining the acronym vacterl association.1,2 although numerous syndromes associated with vacterl have been identified the etiology remains unknown.3,4 duane s retraction syndrome is a congenital oculomotor anomaly that is accompanied by retraction of the globe and characterized by simultaneous narrowing of the palpebral fissure on attempted adduction , limitation of abduction , slight limitation of adduction , and elevation or depression of the globe during adduction.5 patients with duane s retraction syndrome have a 1020 times greater risk of having other congenital malformations.6 in the present report , we describe the unusual occurrence of type 1 duane s retraction syndrome with multiple congenital abnormalities due to the vacterl association . a 2-year - old child was referred to the strabismus department at the prof dr n reat belger beyoglu education and research eye hospital for evaluation of strabismus . this female infant was the first child of nonconsanguinous parents , and her family history was negative for congenital anomalies . the mother had no history of diabetes or exposure to teratogenic agents , such as lead lovastatin , dibenzepin , or exogenous sex hormones . there was no history of smoking , alcohol , drug abuse , or any infectious disease . the child who had a normal prenatal ultrasound at 14 weeks gestation , was born after an otherwise uncomplicated pregnancy . the infant s weight and length at birth were 2720 g and 44 cm , respectively . her head circumference was not measured at that time . at the pediatric surgery consultation , renal problems included a crossed fused renal ectopic duplicate kidney on the left side , renal agenesis on the right side ( on intravenous pyelogram ) , and grade 2 vesicoureteral reflux ( on voiding cystourethrogram ) . at the neurological consultation , the motor function of the upper extremities was normal , but a motor deficit was determined in the left lower extremity . left ankle plantar flexion and dorsiflexion were 0/5 with an absent achilles reflex . magnetic resonance imaging of the cervical and dorsolumbar spine revealed partial fusion of the d5-d6 vertebrae , hemivertebrae and partial fusion of l4-l5-s1 , scoliosis ( dorsolumbar to right , lumbosacral to left ) , spina bifida at the l4-s1 level , a tethered spinal cord combined with intradural lipoma at the l3-l4 level , and syringomyelia at the l2-l3 level . major limb malformation included shortness of the left lower limb , primarily due to hypoplasia of the stylopod and zeugopod , hypoplasia of muscles , and subcutaneous fatty tissue in these two parts , pes equinovarus on the left side , and impaired movement of the left genu with a 90 flexion contracture of the left knee , and a hypoplastic thumb and fingers on the left side . a radiographic evaluation confirmed the previously identified malformations and also demonstrated a short tibia and femur , malformed carpal bones , and hypoplasia of all skeletal components of the second ray on the left lower limb . dysgenesis of the left hemipelvis and sacrum , dysplasia of the left femur , and hypoplasia of muscles in the front and back of thigh were identified on magnetic resonance imaging of the hip ( figure 1a and b ) . she had low - set microtia on the left side ( figure 1c ) ; furthermore , pure tone audiometry revealed a 60 db hearing level in the left ear and a normal range of hearing in the right ear . the girl had a normal female karyotype ( 46 , xx ) in cultured blood lymphocytes . her chromosomal analysis , based on 400550 bands per haploid karyotype , did not reveal any abnormalities . there was no family history of eye or genetic defects , and her parents karyotypes were normal . she had no chromosomal abnormalities or known genetic disorders , such as fanconi syndrome , feingold syndrome , baller - gerold syndrome , or germline mutation in the pten gene . the ophthalmic examination revealed a corrected visual acuity of 16/20 in the right eye and 20/20 in the left eye . the pupils were equal , round and reactive to light , with no evidence of a relative afferent pupillary defect . the cycloplegic refraction value was + 3.50 , 1.00 15 in the right eye and + 3.75 , 1.00 40 in the left eye . on motility examination the patient had a 2 restriction on right abduction , narrowing of the palpebral fissures , globe retraction , and upshoot on attempted adduction . the ophthalmological examination revealed type 1 duane s retraction syndrome in the right eye ( figure 2a ) . at 5 months of age , the patient had lack of continence which improved after the surgery . at 4 years of age strabismus surgery was performed when the patient was 2 years of age , with no complications . she had no globe retraction or upshoot on attempted adduction and a 1 restriction of right abduction ( figure 2b ) . the vater association describes a rare condition characterized by a sporadic combination of specific birth defects . the vater or vacterl association ( an acronym for vertebral defects , anorectal malformations , cardiac defects , tracheo - esophageal fistulas , renal anomalies , and limb anomalies ) represents a statistically related pattern of associated anomalies . the diagnosis of a vacterl association is made when three or more features of the association are present.3 the most commonly associated anomalies in these patients are anorectal malformations ( 55%90% ) , tracheo - esophageal fistulas ( 50%80% ) , renal anomalies ( 50%80% ) , vertebral anomalies ( 36%80% ) , cardiac anomalies ( 40%80% ) , and limb anomalies ( 40%50%).7,8 lower limb defects do occur in the vater association but are far less frequent than upper limb defects.9 our case displayed four characteristics of the vacterl association , including anorectal , renal , vertebral , and lower limb defects . vertebral anomalies can occur in any segment of the spine and may be associated with neurologic abnormalities.10 our patient had tethered cord syndrome . in this syndrome , neurological deficits are generally irreversible . in children , early surgery is recommended to prevent further neurological deterioration.1113 we determined some neurological deficits early , so we performed tethered cord surgery at 5 months of age . although numerous etiologies are known to be responsible for the vater / vacterl association , the pathogenesis remains unknown in the majority of cases.2 this association has also been described as the result of teratogenic exposures , such as lead , lovastatin , dibenzepin , maternal diabetes , exogenous sex hormones , chromosomal abnormalities such as del(6)q , 9qh+ , supernumerary ring chromosome , and del(13)(q31.1qter ) , and known genetic disorders such as fanconi syndrome , feingold syndrome , baller - gerold syndrome , and germline mutation in the pten gene.1422 a primary developmental field defect resulting from failure of mesodermal cell migration during early blastogenesis ie , during the first 4 weeks of development has been suspected,3,4 as well as a multifactorial origin.23 however , in our case , no teratogenic exposures , chromosomal abnormalities , or known genetic disorders could be recognized . the rare familial occurrence of vater/ vacterl association is in favor of a genetic origin with either autosomal dominant or recessive mode of inheritance.24 moreover , recently , the observation of vater / vacterl association in a gli mutant mouse has suggested that impairment of the sonic hedgehog pathway could also be responsible for this phenotype.25 some authors have reported that the vater / vacterl association has been described as a result of respiratory chain deficiency.2 patients with the vacterl association have eye defects.26 their ophthalmic findings include ptosis , strabismus , myopia , hypermetropia , amblyopia , anisometropia , cloudy corneas , microcornea , congenital corneal anesthesia ( ie , recurrent erosions , keratitis , ulcers , and leukomas ) , anisocoria and heterochromia iridis , cataracts , and lacrimal system abnormalities.2628 the most common associations are coloboma and microphthalmos.27 the retina and posterior segment are seldom involved . a unique case of coats disease combined with the vater association has been reported.29 to our knowledge , there have been no reports of a patient with duane s retraction syndrome and the vacterl association . in the present case study , we report the unusual occurrence of type 1 duane s retraction syndrome in a child with the vacterl association . the pathogenetic mechanism of this syndrome is abnormal rectus innervation of the affected eye by axons that are destined for the medial rectus.5,6 genetic and environmental factors may be responsible for duane s retraction syndrome,6 but these causes had been ruled out in our case . the gene responsible for the gene has been mapped to 8q13.3.30 specification of mammalian motor neurons and mutations in the pax 6 gene may be responsible for the aberrant innervation in duane s retraction syndrome.31 the pax gene family consists of developmental control genes and plays an important role in the development of the vertebral column , genitourinary tract , and central nervous system.32 in our patient , chromosomal analysis did not reveal any aberrations . in the majority of cases of vacterl association , the pathogenesis remains unknown.3,4 in conclusion , our patient presented an unusual combination of duane s retraction syndrome and vacterl association , which has not been previously reported . this case is instructive for reviewing the continuous spectrum of ocular anomalies that accompany the vacterl association . the cause of the association between vater / vacterl and duane syndrome is not clear , but these two syndromes might be the result of defective mesodermal development during embryogenesis . | we report here a patient with type 1 duane s retraction syndrome and multiple congenital abnormalities as a result of the vacterl association .
the presented combination of duane s retraction syndrome and the vacterl association has not been reported in the literature .
the present case was instructive for reviewing the continuous spectrum of ocular anomalies that accompany the vacterl association . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
while there have been many clinical limitations to the placement of implants cited in literature one of the strongest arguments against the willingness of patients towards the placement of dental implants has been the prohibitive cost of these implants . in the past few years however there have been many reports in literature that as the cost of dental implants decrease and their rates of success improve , patients reluctance towards the placement of implants may slowly be changing.[68 ] assessing a patient 's willingness to pay ( wtp ) is one of the most accepted methods to evaluate the acceptability of new treatment modality for the clinician . it has been used to successfully measure patient 's perception in not only in dentistry,[911 ] but in fields such as orthopedics , cardiology and health care service preferences . bidding is the oldest and most accepted tool to assess wtp of a patient and provides both clinicians and third party payment providers with a realistic estimate of how much a patient can spend on a new treatment modality . despite this , it has been stated that data on how much a patient is willing to pay for implant care and how this may influence clinical decision making is scant . although , there is some data on the factors that affect clinicians recommendation of dental implants in the middle east , the concept of wtp for implant treatment and how it influences clinical decisions remain a largely unexplored area . given this background it was decided to evaluate saudi patients wtp for implant treatment and attempt to define the clinical and socio - demographic factors influencing that decision . ethical clearance for the study was obtained from the research center of the riyadh colleges of dentistry and pharmacy ( ugsrp/2011/021).the study was conducted between september 2011 and january 2012 . the power of sample was calculated based on the minimum sample required for a regression analysis with a single dependent variable , with true r value of 0.1 , with alpha set at 0.05 ; which was 50 . a total of 100 patients ( 38 male , 62 female ) who had one or more missing teeth were selected using convenience sampling . the sample comprised of 50 uninsured patients reporting to the outpatient dental departments of a private hospital and 50 patients reporting to a government hospital in riyadh after obtaining an informed consent . data collection was done by four of the authors , ( am , eq , ha , ks ) who were trained in the bidding process and collection of demographic data . given the subjective nature of wtp and differences among patients , the investigators were calibrated against the lead investigator ( bg ) . patients who consented to participate in the study were given a form in arabic asking them to fill in their demographic data . the bidding process was administered to patients in two stage process . in the first stage , the patients were presented with different cost - benefit scenarios and then asked if they were willing to pay the median cost of a single implant in riyadh city , which was 3000 sr ( 1 sr = 3.77 us$ ) . in the second phase , patients were allowed to bid for the price they would be willing to pay . patients who were unwilling to pay the median price had the price progressively reduced by 500 sr until they reached a price they would be willing to pay or the sum reached 0 . patients who were willing to pay the median price for an implant had the price progressively increased by 50 riyals and asked if they would still be willing to pay for the dental implant . the price was progressively increased until the patient was no longer willing to pay for the implant or until they reached the maximum price charged for an implant in riyadh city which was 8500 sr . the factors that could influence the patients wtp were classified into socio - demographic factors and individual patient specific factors . the mean price the patient was willing to pay for an implant was compared between different demographic groups using the one way - anova . the socio - demographic and individual patient factors were then grouped into two binomial logistic regression models , with wtp as the dependent variable . ethical clearance for the study was obtained from the research center of the riyadh colleges of dentistry and pharmacy ( ugsrp/2011/021).the study was conducted between september 2011 and january 2012 . the power of sample was calculated based on the minimum sample required for a regression analysis with a single dependent variable , with true r value of 0.1 , with alpha set at 0.05 ; which was 50 . a total of 100 patients ( 38 male , 62 female ) who had one or more missing teeth were selected using convenience sampling . the sample comprised of 50 uninsured patients reporting to the outpatient dental departments of a private hospital and 50 patients reporting to a government hospital in riyadh after obtaining an informed consent . data collection was done by four of the authors , ( am , eq , ha , ks ) who were trained in the bidding process and collection of demographic data . given the subjective nature of wtp and differences among patients , the investigators were calibrated against the lead investigator ( bg ) . patients who consented to participate in the study were given a form in arabic asking them to fill in their demographic data . the bidding process was administered to patients in two stage process . in the first stage , the patients were presented with different cost - benefit scenarios and then asked if they were willing to pay the median cost of a single implant in riyadh city , which was 3000 sr ( 1 sr = 3.77 us$ ) . in the second phase , patients were allowed to bid for the price they would be willing to pay . patients who were unwilling to pay the median price had the price progressively reduced by 500 sr until they reached a price they would be willing to pay or the sum reached 0 . patients who were willing to pay the median price for an implant had the price progressively increased by 50 riyals and asked if they would still be willing to pay for the dental implant . the price was progressively increased until the patient was no longer willing to pay for the implant or until they reached the maximum price charged for an implant in riyadh city which was 8500 sr . the factors that could influence the patients wtp were classified into socio - demographic factors and individual patient specific factors . the mean price the patient was willing to pay for an implant was compared between different demographic groups using the one way - anova . the socio - demographic and individual patient factors were then grouped into two binomial logistic regression models , with wtp as the dependent variable . of the 100 individuals surveyed 67% said they would be willing to pay ( wtp ) the median price for the placement of an implant . a comparison of socio - demographic factors [ table 1 ] showed that significant differences were found between gender , income groups and setting of the clinic in the mean wtp price of the patients . females had a higher mean wtp price than males ; however , the proportion of females wtp the median price was similar to that of the males surveyed . patients in the government setting had a lower wtp price than those in the private setting ; there were also fewer individuals in the government setting who were wtp the median price for the placement of an implant . the wtp price and the number of individuals wtp the median price increased proportionately with the income of the family . comparison of the income groups among the two centers showed that there was no significant difference in the income of patients attending either the government or private clinic . although students had the highest wtp price , the employment status did not seem to have a significant impact on wtp [ table 1 ] . socio - demographic factors and their impact on willingness to pay price for a dental implant when the patient 's specific factors influencing the patient 's acceptance of an implant were considered , we found that there was a significant difference in the mean wtp price between groups with regard to the area of the missing tooth , the patients perception of their oral health and the their desire to want an implant . no significant difference was found between the time elapsed since extraction or the desire of the patient to replace the missing teeth . patient with an anterior missing tooth or with missing teeth in both anterior and posterior seemed to be willing to pay more for an implant than those with only a posterior tooth missing , however , the difference was not statistically significant . the patients perception of their own oral health had a significant influence on the patients wtp for an implant , with patients who considered their oral hygiene to be good or excellent were willing to pay a significantly higher price than patients who considered their oral hygiene to be poor [ table 2 ] . patient specific factors and their impact on willingness to pay price for a dental implant in order to ascertain the relationship of the multiple variables to the wtp of the patients , the variables were subjected to a binomial logistic regression , with the wtp price as the dependent variable for both the socio - demographic and the patient specific variables . among socio - demographic factors [ table 1 ] , income and hospital setting seemed to have a significant influence on whether a patient was willing to pay for an implant or not . surprisingly gender was not a factor in whether a patient was willing to pay for an implant or not , even though females who were willing to pay for an implant had a significantly higher wtp price than their male counterparts . among the individual patient factors , whether a patient wanted an implant or not was the most important factor that would determine whether a patient would be willing to pay for an implant . the only other factor that seemed to significantly influence the patients wtp seemed to be the patients perception of their oral health [ table 2 ] . the effectiveness of the bidding technique in the assessment of wtp has been documented in literature . the ease of this method was evident in our study as none of the patients we approached refused to participate in the study . usually , bidding for an object starts from the lowest price ; however , this method may result in what has been termed as the as the starting point bias ; which states that a patient who is offered a low price will refuse to bid higher making it difficult to determine the minimum wtp price . the use of the median price is said to be one of the most effective ways to negate any effect of such bias . the fact that a majority of our patients were willing to pay the starting price for a dental implant is a positive sign and is contrary to the findings of leung and mcgrath , who found that most of their subjects were not willing to meet the market price of a dental implant . one of the factors for this difference , however , could be that our study focused on patients who had actually undergone tooth loss rather than the hypothetical situations used by others . in this respect , who in a similar study on overdenture patients suggested that a majority of patients would be willing to meet the price of a dental implant if it meant an increase in oral function and stability of their dentures . the loss of function due to a missing posterior tooth is an important factor in motivating the patient to seek replacement . while the loss of esthetics as a factor in patients seeking implants to replace a missing anterior tooth or prosthesis has been discussed in literature . the role of loss of function in influencing the patients choice of an implant is often overlooked . this was evident in our study when we saw that there was no significant difference in the wtp for an implant between patients who had lost an anterior or a posterior tooth . in fact the wtp price was seen in patients who had lost both anterior and posterior teeth , suggesting that a combination of loss of function and loss of esthetics can greatly influence a patient 's decision to pay for a dental implant . there are conflicting views in literature regarding the relationship between the period of time elapsed since tooth loss and patients desire to replace missing teeth . while some have pointed out that a longer time frame elapsed since the extraction of the tooth indicates the lack of interest on the part of the patient to replace his / her teeth others have stated that a prolonged loss of function could make the patient realize the value of replacing the tooth . interestingly , we found that the number of teeth lost and the time elapsed since the time of extraction were not significant factors in influencing wtp of the patient . however , given the small size of our paper and the several possible confounding factors , this fact should be studied in greater detail . in general , females have been found to be more willing to pay for healthcare services than men . our study found that women who said they were willing to pay for implant had higher mean wtp scores than the men , however , there was no significant difference in the number of men and women willing to pay the median price of a dental implant . this seems to suggest that , although gender is an issue in the wtp for dental implants , other factors perhaps play a greater role . the influence of income on the ability to pay is a debated topic . while our findings agree with investigators who have indicated a positive association between the income group and the wtp;[2628 ] others , including a recent study with methodology very similar to ours have found no such association . a possible explanation for this could be that the studies were carried out in different countries and settings . some of the studies also used hypothetical models rather than real patients , suggesting that although such models may predict general trends , the actual loss of function that a patient who undergoes extraction experiences is difficult to replicate . the fact that patients in a government setup are less likely to be wtp , for care is documented in literature . the fact that there was no significant difference in the distribution of income groups between the private and the government hospital seems to reinforce the fact that while wtp is dependent on income , it is perhaps also influenced by the patients perception of the cost of health care at a particular institution . a positive correlation was found between the perception of oral health and the mean wtp price of the patients . while this is similar to a recent study on patients wtp for implants , it is contrary to the findings of studies on implant overdentures orthognathic surgery , and dental caries where the wtp is usually inversely proportionate to the perception of oral health . this seems to suggest that wtp for implants , especially single implants , may be driven by an understanding of needs rather than symptoms . this also perhaps , explains why the acceptability of the implant was the most significant factor in influencing whether a patient would pay for the implant or not . the acceptance rate of the implant ( patients willing to place an implant after initial interview ) was 87% which is higher than those reported in other countries who reported acceptance rates between 27% and 58% . one of the reasons for this variation could be because our study was conducted in a hospital setting , where people were looking to replace their teeth rather than in the general population . despite this finding , the high acceptance rate is a positive sign and indicates that patients in riyadh city are not only aware of implants , but would also like to have them placed ; and in most cases be willing to pay for them . this study was designed to serve as an initial assessment of factors influencing wtp for dental implants in saudi arabia ; however , the factors highlight trends that in all probability transcend borders . a larger sample using specific patient groups could provide us with greater insight into specific factors and serve as a useful guideline to establish payment modalities for dental implants , especially in countries where the field is relatively new . within the limitations of this study , it can be concluded that despite the cost of treatment , dental implants seem to be an attractive treatment option for the replacement of missing teeth among patients in riyadh city . the income and gender of the patient and the setting of the practice all seem to influence the wtp of the patients . the greatest factor influencing the patient 's wtp is the acceptability of the implant to the patient . | background : one of the factors that dissuade patients needing tooth replacement from choosing dental implants is the prohibitive cost . willingness to pay ( wtp ) is a useful tool to determine the ideal cost of an expensive procedure.aim:the aim of this study was to study the factors that influence the willingness to pay ( wtp ) among patients attending a private clinic and compare them to those attending a government setup.materials and methods : a total of 100 patients ( 38 male , 62 female ) who had one or more missing teeth were presented with different cost - benefit scenarios and then asked if they were willing to pay the median cost of a single implant in riyadh city .
the mean wtp price was compared using the one way - anova , factors which could possibly influence patients wtp were grouped together in a binomial logistic regression model.results:of the 100 individuals surveyed 67% said they would be willing to pay the median price for the placement of an implant .
a comparison of socio - demographic factors showed that significant differences were found between gender , income groups and setting of the clinic in the mean wtp price of the patients ( p < 0.05 ) .
we also found that there was a significant difference in the mean wtp price between groups with regard to the area of the missing tooth , the patients perception of their oral health and the their desire to want an implant ( p < 0.05).conclusion : the majority of the patients surveyed were willing to pay the median price for an implant . willingness to pay ( wtp ) is a multifactorial variable which is significantly influenced by the income of the patient , the setting of the clinic and the gender ; the most significant factor being the acceptability of the implant to the patient . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
type 2 diabetes mellitus is a highly prevailing disease in developing countries of south asia including india . peripheral arterial disease ( pad ) , one of the complications of it , is still remaining under diagnosed and under treated even in western countries owing to its silent asymptomatic progression making it difficult to diagnose in early stage . even in the absence of pad symptoms ankle brachial index ( abi ) is a symptom - independent reliable screening tool for pad that is available since long . it is recommended even at primary health - care level , but yet underused in both communities and hospitals . it can be attributed to its time consuming nature , lack of reimbursement and staff non - availability . however , the use can be optimized by identifying the significant risk factors and those at risk and this primary prevention can be brought out by simple abi screening . by the present study , we tried to use abi to quantify the burden of pad in diabetics in our region and to correlate various risk factors for its relative contribution and to judge how many of them are significant and of them how many are salvageable . this observational transverse field study was carried out from 15 september 2012 to 10 november 2012 on known diabetic patients taking regular treatment ( not insulin ) for a minimum of 6 months . after taking approval for the study , sample size was calculated by software raosoft for population of the city 6 lakhs with 4% national prevalence of diabetes . a size of 110 was sufficient to have 99% confidence level and 5% margin of error . subjects were chosen randomly from ( i ) medicine out - patient department ( opd ) of sir takhtsinhji general hospital ( tertiary care government hospital ) ( ii ) diabetic opd of sir jaswantsinhji hospital ( urban health and training center affiliated to sir t hospital and preventive and social medicine department ) ( iii ) diabetic camp at shree bajarangdas bapa arogyadhaam ( trust multispecialty hospital ) ( iv ) private opd patients . by choosing patients from different set ups belonging to different socio - economic status we tried to have a blend of heterogeneous subjects , which formed a fairly representative sample whose result can be applied to generalized population . subjects taking irregular treatment , newly diagnosed , having previous vascular intervention , having amputated limb were excluded from the study . all recruited subjects underwent personal interview in the form of pre - designed , pre - validated questionnaires that included general features , demographic characteristics , symptom of pad , investigations and treatment taken . specific emphasis was given to identify following 11 risk factors including diabetes itself : ( 1 ) hypertension , ( 2 ) hyperlipidemia , ( 3 ) smoking , ( 4 ) cardiovascular disease ( cvd ) , ( 5 ) family history , ( 6 ) absence of symptom ( asymptomatism ) , ( 7 ) age < 52 years , ( 8) male gender , ( 9 ) fasting blood sugar ( fbs ) > 130 mg / dl , ( 10 ) body mass index ( bmi ) > 25 abi was measured in the supine position by investigators themselves after taking consent using the principle of doppler effect by portable instrument versadop ( table top vascular doppler with 8 mhz of diabetik foot care india limited , chennai , india ) having 12 cm occluding cuff . ankle brachial pressure index was derived by dividing the higher reading of the ankle pressure at dorsalis pedis artery by brachial pressure of the same side . the data was transferred on excel spreadsheet and descriptive analysis was expressed as mean standard deviation . we evaluated the strength of association of individual risk factor for pad by finding the relative risk ( rr ) keeping confidence interval 95% with abi < 0.9 as a positive outcome and abi 0.9 as a negative outcome . five out 11 were modifiable risk factors whose cumulative rr was calculated with aforementioned criteria and difference in mean distribution was calculated by student t - test . this observational transverse field study was carried out from 15 september 2012 to 10 november 2012 on known diabetic patients taking regular treatment ( not insulin ) for a minimum of 6 months . after taking approval for the study , sample size was calculated by software raosoft for population of the city 6 lakhs with 4% national prevalence of diabetes . a size of 110 was sufficient to have 99% confidence level and 5% margin of error . subjects were chosen randomly from ( i ) medicine out - patient department ( opd ) of sir takhtsinhji general hospital ( tertiary care government hospital ) ( ii ) diabetic opd of sir jaswantsinhji hospital ( urban health and training center affiliated to sir t hospital and preventive and social medicine department ) ( iii ) diabetic camp at shree bajarangdas bapa arogyadhaam ( trust multispecialty hospital ) ( iv ) private opd patients . by choosing patients from different set ups belonging to different socio - economic status we tried to have a blend of heterogeneous subjects , which formed a fairly representative sample whose result can be applied to generalized population . subjects taking irregular treatment , newly diagnosed , having previous vascular intervention , having amputated limb were excluded from the study . all recruited subjects underwent personal interview in the form of pre - designed , pre - validated questionnaires that included general features , demographic characteristics , symptom of pad , investigations and treatment taken . specific emphasis was given to identify following 11 risk factors including diabetes itself : ( 1 ) hypertension , ( 2 ) hyperlipidemia , ( 3 ) smoking , ( 4 ) cardiovascular disease ( cvd ) , ( 5 ) family history , ( 6 ) absence of symptom ( asymptomatism ) , ( 7 ) age < 52 years , ( 8) male gender , ( 9 ) fasting blood sugar ( fbs ) > 130 mg / dl , ( 10 ) body mass index ( bmi ) > 25 abi was measured in the supine position by investigators themselves after taking consent using the principle of doppler effect by portable instrument versadop ( table top vascular doppler with 8 mhz of diabetik foot care india limited , chennai , india ) having 12 cm occluding cuff . ankle brachial pressure index was derived by dividing the higher reading of the ankle pressure at dorsalis pedis artery by brachial pressure of the same side . the data was transferred on excel spreadsheet and descriptive analysis was expressed as mean standard deviation . we evaluated the strength of association of individual risk factor for pad by finding the relative risk ( rr ) keeping confidence interval 95% with abi < 0.9 as a positive outcome and abi 0.9 as a negative outcome . five out 11 were modifiable risk factors whose cumulative rr was calculated with aforementioned criteria and difference in mean distribution was calculated by student t - test . table 1 shows general information for the study group highlighting more females than males , high mean bmi high prevalence of pad symptom , high mean fbs level , average duration of diabetes 6.28 years and average of risk factors out of 11 being 5.6 . baseline data of study group table 2 shows the prevalence of all risk factors for pad in diabetes with distribution of subjects with regard to low or normal abi . it clearly indicates ( a ) strong positive and significant correlation with hyperlipidemia , asymptomatism for pad , age < 52 years , bmi > 25 kg / m ; ( b ) weak and insignificant correlation with smoking , cvd , fbs > 130 mg / dl ; ( c ) no correlation with male gender and positive family history and ( d ) negative correlation with hypertension and age > 52 years . effect of individual risk factor for pad on abi results with prevalence and relative risk table 3 shows the cumulative effect of modifiable risk factor five in total in group based on the total number of these risk factors . it shows linear and significant increase in rr for pad with the increase in their total number in diabetic subject . by present community based study , we tried to find the prevalence of pad in diabetics as indicted by low abi and to associate various risk factors for it in a sample of urban population of this region . low abi prevailed in 35% of subjects having type 2 diabetes mellitus reflecting the possible burden of this problem on the health - care system to be faced in the future . it can be attributed to high bmi , high mean age , high mean fbs and female preponderance in our study group and first three can be generalized to overall diabetic population of our region . indians are at higher risk to develop pad and diabetes as compared to other ethnic groups and that is proven true even if they are residing outside india . this fact points toward some genetic susceptibility that remains unaffected by environmental factors . in our study group , hypertension , high fbs , high bmi , asymptomatism , positive family history proved to be highly prevalent out of which first three are modifiable . we observed highest rr with asymptomatism , which can be understood by iceberg nature of the disease . inclusions of asymptomatics with few other risk factors can help in diagnosing presymptomatic atherosclerosis and one can shift secondary prevention to primary prevention that target rigorous treatment . so , one can identify disease early and prevent adverse outcomes like major amputation or mortality due to cardiovascular or cerebrovascular diseases . it is supported by a western study with rr being 1.68 . it can be explained by their effects in the form of oxidized low - density lipoprotein damage , insulin resistance , plaque formation and thrombus formation . dyslipidemia can be treated by statins , but their cost - effectiveness is in question . however , life - style modification such as stoppage of tobacco consumption , exercise and diet therapy are better alternatives perhaps for us , which have been tested successfully , but not implemented successfully . high bmi was given as a cause for high prevalence of pad in indians among various south asian countries . smoking was single most important risk factor for pad in india mainly for males whose cessation can stop disease progression . cvd is established risk factor for pad as proven by few studies . in ellipse study diabetes did not prove a statistically significant risk factor and they explained it by the fact that the study group like ours was having low cvd risk and fewer comorbid conditions . low prevalence of hyperlipidemia and cvd in our sample raises further importance of bmi and hypertension that prevailed in nearly 60% of subjects . in india , about 50% of diabetics have hypertension . tight glycemic control decreases only the risk of microvascular complications such as retinopathy , nephropathy and neuropathy without affecting macrovascular complications like pad . blood pressure regulation gives instantaneous result than glycemic control and is more cost - effective for both patients as well as primary physicians . in the present study this can be explained by the fact that more than 90% of hypertensives were taking angiotensin - converting enzyme inhibitors drugs like enalapril or ramipril regularly as a first line of treatment . this drug keeps in check angiotensin ii and prevents various vascular complications of diabetes as documented by previous studies . we did not find any significant correlation of pad with a positive family history or gender in line with others , who found them inconsistent and insignificant at times . these factors can not be modified so their beneficial preventive role does not exist . with ageing there is atherosclerosis leading to stiffness in arteries that tend to raise abi value , which exactly oppose the decline in abi value by pad due to diabetes . so , one can not ascertain exactly age as a risk factor for this disease and it is definitely impossible to modify it even if it is proven so . in the present study , glycemic control was measured by fbs and not by hemoglobin a1c as later one is costly and not practically possible in all set ups in a developing country like india . a recent study has shown former as a more reliable test than later to correlate glycemic control with abi results . we found controlled sugar level in just one - third of the subjects and it is must to have fbs within normal upper limit . still for pad abi is surely a better tool to correlate than mere blood sugar level , which does not require any specific laboratory and reagent and can be practiced even at primary health - care level . it was seen that more the number of modifiable risk factors in totality more adverse was the abi profile owing to the cumulative effect of them and this observation is in line with previous such attempt . out of 110 subjects only 16 were having no modifiable risk factors out of five and one can easily see the benefit of targeting risk modification after proper risk stratification in all diabetics and timely intervention . as india is heading to be the hub of diabetes by 2025 one can predict necessity of primary preventive measures for pad that is offered by abi . however , this test can not be generalized for the whole diabetic population and it is better to be offered to those who are at risk with certain benefit from screening and intervention . it is always better preventing at primary level rather than treating at secondary and tertiary care level . general practitioners who are the backbone of health - care systems world - wide more so in the context of india can be sensitized about the burden of this modern epidemic and they can play a significant role in risk stratification for vasculopathy in type 2 diabetes as many of patients with the disease are coming for a regular visit at primary health facilitators . more emphasis should be put on modifying the modifiable risk factors by life - style modifications , drug therapy and other interventions that come well within the domain of family medicine and primary care . abi measurement in diabetics revealed a high prevalence of pad in our population with the presence of more than one risk factor in most . we found a high prevalence and positive correlation of modifiable risk factors such as high bmi , uncontrolled blood sugar level , smoking , hypertension and hyperlipidemia . asymptomatic nature of disease progression can be nullified by optimum use of abi as a screening tool preceded by risk factor stratification of diabetic subjects . it can be implemented as a primary preventive measure even at primary health - care level to fight against this modern epidemic of diabetics and its aftermath pad . | background : peripheral arterial disease ( pad ) is an aftermath of type 2 diabetes posing a significant health problem in developing countries .
its silent progression warrants presymptomatic screening by ankle brachial index ( abi ) , which can not be applied to the whole population .
we tried to measure the burden of pad in diabetics of this region correlating various risk factors for it quantitatively and qualitatively.materials and methods : from various out - patient departments , 110 known under treatment type 2 diabetics were recruited .
they underwent thorough assessment for general , symptomatic , medical history and risk factor screening that included 11 well - known risk factors .
abi was measured by versadop instrument using the standard protocol with abi < 0.9 being considered as abnormal.results:there was a high prevalence of asymptomatism , hypertension , positive family history and age < 52 years in the study group .
relative risk was highest for asymptomatism followed by high body mass index , hyperlipidemia , cardiovascular disease and smoking , but less significant for age , gender , fasting sugar level , family history .
more adverse abi profile was noticed with the increase in number of five modifiable risk factors cumulatively.conclusion:there was a high prevalence of low abi in our region that is an evidence of pad mainly affected by risk factors many of which were modifiable . defining those who are at risk to develop pad in diabetes , one can use abi better in early screening and prompt treatment of this complication to stop its further progression and primary prevention can be served as felt the need for health - care effectively . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we show data of a time - resolved searchlight analysis for 12 individual subjects performing a visual motion imagery task . in each searchlight sphere a multi - voxel pattern analysis ( mvpa ) is performed to decode four different directions of imagined motion . this is done for six different but overlapping time windows with respect to the onset of an imagery trial . the resulting volumetric maps show p - values for fdr - corrected chi - square tests of the confusion matrices of each searchlight sphere . 15 healthy fmri - experienced subjects ( six females ; age : 27.46.3 years ) volunteered in the original study . data from 12 subjects were analyzed based on exclusion criteria described in emmerling et al . . the training was designed to practice the experimental task and more specifically a stable visual motion imagery . details on the training procedure [ p. 62 ; 1 ] , the individual used imagery strategies [ table 1 ; 1 ] , and behavioral results from the training sessions [ fig . 5 ; 1 ] are described in emmerling et al . . subjects were pseudo - randomly assigned to one of two groups and had to imagine dots that moved in one of four directions ( group 1 : left , right , up , and down ; group 2 : four diagonal motion directions ) . all subjects filled in the vividness of visual imagery questionnaire [ vviq ; 2 ] and the object - spatial imagery and verbal questionnaire [ osivq ; 3 ] . for procedural details , analyses , and results please see the original publication [ figs . 3 and 4 ; 1 ] . for information on the experimental task , mri acquisition , and imaging data preprocessing please refer to the corresponding sections in the original publication [ p. 6265 ; 1 ] . each experimental run was z - scored to eliminate signal offsets and variance differences between runs . we employed a leave - one - run - out splitting procedure to be able to cross - validate the classification performance . to assess the spatial distribution of brain areas involved in the mental imagery task we performed a searchlight analysis . a sphere with a radius of 4 voxels was moved through the cortical ribbon ( so that the spheres central voxel always lay within 1 mm to + 3 mm from the grey / white matter segmentation border ) and defined a feature set of 257 voxels ( 4 voxel radius ) . for each voxel within each sphere and each trial we extracted the average of 6 s ( 3 trs ) as features . averages were computed in six different but overlapping time windows starting at 2 , 0 , 2 , 4 , 6 , and 8 s ( i.e. 1 , 0 , 1 , 2 , 3 , and 4 trs ) with respect to the trial onset . the extracted features were then used for an one - vs - one 4-class classification ( predicted classes were chosen based on the maximum number of votes in all binary classifications ) using a linear support vector machine [ svm ; libsvm implementation in pymvpa ; 5 ] . the resulting classification accuracies were tested for significance by means of fdr - corrected chi - square tests of the confusion matrix . individual anatomies were transformed to mni - icbm 152 space using brainvoyager 20.0 and the icbm 452 template . the individual significance maps for the six different time windows were resampled to a resolution of 111 mm voxel size and transformed into mni space using the individual transformation matrices obtained in the previous step . the resulting maps were named according to the subject ( s01 through s12 ) and the time window ( _ shift_1 through shift_4 ) and uploaded to neurovault.org ( http://neurovault.org/collections/961/ ) . 15 healthy fmri - experienced subjects ( six females ; age : 27.46.3 years ) volunteered in the original study . data from 12 subjects were analyzed based on exclusion criteria described in emmerling et al . . the training was designed to practice the experimental task and more specifically a stable visual motion imagery . details on the training procedure [ p. 62 ; 1 ] , the individual used imagery strategies [ table 1 ; 1 ] , and behavioral results from the training sessions [ fig . 5 ; 1 ] are described in emmerling et al . . subjects were pseudo - randomly assigned to one of two groups and had to imagine dots that moved in one of four directions ( group 1 : left , right , up , and down ; group 2 : four diagonal motion directions ) . all subjects filled in the vividness of visual imagery questionnaire [ vviq ; 2 ] and the object - spatial imagery and verbal questionnaire [ osivq ; 3 ] . for procedural details , analyses , and results please see the original publication [ figs . 3 and 4 ; 1 ] . for information on the experimental task , mri acquisition , and imaging data preprocessing please refer to the corresponding sections in the original publication [ p. 6265 ; 1 ] . each experimental run was z - scored to eliminate signal offsets and variance differences between runs . we employed a leave - one - run - out splitting procedure to be able to cross - validate the classification performance . to assess the spatial distribution of brain areas involved in the mental imagery task we performed a searchlight analysis . a sphere with a radius of 4 voxels was moved through the cortical ribbon ( so that the spheres central voxel always lay within 1 mm to + 3 mm from the grey / white matter segmentation border ) and defined a feature set of 257 voxels ( 4 voxel radius ) . for each voxel within each sphere and each trial we extracted the average of 6 s ( 3 trs ) as features . averages were computed in six different but overlapping time windows starting at 2 , 0 , 2 , 4 , 6 , and 8 s ( i.e. 1 , 0 , 1 , 2 , 3 , and 4 trs ) with respect to the trial onset . the extracted features were then used for an one - vs - one 4-class classification ( predicted classes were chosen based on the maximum number of votes in all binary classifications ) using a linear support vector machine [ svm ; libsvm implementation in pymvpa ; 5 ] . the resulting classification accuracies were tested for significance by means of fdr - corrected chi - square tests of the confusion matrix . individual anatomies were transformed to mni - icbm 152 space using brainvoyager 20.0 and the icbm 452 template . the individual significance maps for the six different time windows were resampled to a resolution of 111 mm voxel size and transformed into mni space using the individual transformation matrices obtained in the previous step . the resulting maps were named according to the subject ( s01 through s12 ) and the time window ( _ shift_1 through shift_4 ) and uploaded to neurovault.org ( http://neurovault.org/collections/961/ ) . | interindividual differences play a crucial role in research on mental imagery .
the inherently private nature of imagery does not allow for the same experimental control that is possible in perception research .
even when there are precise instructions subjects will differ in their particular imagery strategy and , hence , show different brain activations . here , we show results of a time - resolved searchlight analysis for 12 individual subjects who perform a visual motion imagery task .
the data show the spatial and temporal extent of brain areas and time windows that allow for a successful decoding of the direction of imagined motion out of four options .
accuracy maps for six different time windows are shown for every individual subject and are made freely available on neurovault .
these data accompany the findings in the publication decoding the direction of imagined visual motion using 7 t ultra - high field fmri
( emmerling et al . , 2016 ) [ 1 ] . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we studied 8-week - old male sprague - dawley rats ( charles river breeding laboratories ) . indwelling bilateral catheters ( plastics one , roanoke , va ) were placed into the mediobasal hypothalamus ( mbh ) ( 3.1 mm posterior of bregma , 0.4 mm lateral from midline , and 9.6 mm below skull surface ) 2 weeks before the experiments in vivo ( 20 ) . one week later , catheters were placed in the internal jugular vein and the carotid artery for infusion and sampling during the clamp procedures ( 2 ) . recovery from surgery was monitored by measuring daily food intake and body weight gain in the 34 days preceding the infusion procedure . the study protocols were approved by the institutional animal care and use committee of the university health network in toronto and the albert einstein college of medicine in new york . all the rats were restricted to 20 g of food the night before the experiments to ensure the same nutritional status . mbh infusion of the various study solutions was initiated and maintained at a rate of 0.33 l / h for 6 h. study solutions consisted of 250 mol / l pkc activator 1-oleoyl-2-acetyl - sn - glycerol ( oag ) ( dissolved in 5% dmso ) , 250 mol / l oag plus 60 mol / l bisindolylmaleimide ( bim ) ( general pkc inhibitor ) , 250 mol / l oag plus 60 mol / l rottlerin ( rot ) ( specific pkc- inhibitor ) , 250 mol / l oag plus 100 mol / l katp channel blocker glibenclamide ( dissolved in 5% dmso ) , vehicle ( either saline or 5% dmso ) , 60 mol / l bim , 60 mol / l rot , or 100 mol / l glibenclamide . after 2 h of mbh infusion , a primed continuous intravenous infusion of 3-h - glucose ( 40 ci bolus , 0.4 ci / min ; perkin elmer ) was begun and maintained throughout the study to assess glucose kinetics in vivo . in a different group of rats , intravenous saline or 20% intralipid ( mixed with 20 units / ml of heparin , 0.4 ml / h ; baxter healthcare corporation ) infusion was initiated at 120 min and maintained throughout the experiments . intralipid infused at this rate elevates plasma free fatty acid and hypothalamic lcfa - coa levels by 1.5- to 2.0-fold ( 10 ) . specific activity were obtained at 10-min intervals . for the final 2 h of the infusion study , a pancreatic - euglycemic clamp was performed to evaluate the effect of mbh treatments on glucose metabolism independent of changes in glucoregulatory hormones . this involved continuous infusions of insulin ( 0.8 mu kg min for mbh oag studies and 1.5 mu kg min for intravenous intralipid infusion studies ) and somatostatin ( 3 g kg min ) to inhibit endogenous insulin and glucagon secretions and a variable infusion of a 25% glucose solution that was started and periodically adjusted to maintain the plasma glucose concentration similar to the basal levels ( 210240 min ) . the data for glucose infusion rate , glucose production , and glucose uptake were presented as an average of values obtained from the final 30 min ( 300360 min ) of the clamp studies . mbh rot , bim , and glibenclamide alone did not affect glucose kinetics ( data not shown ) . in a separate set of experiments , we performed clamps infused with a higher dose of insulin ( 1.2 instead of 0.8 mu kg min ) and administered vehicle ( n = 5 ) or oag ( n = 4 ) into the mbh . we found that insulin clamped at 1.2 mu kg min normally suppressed glucose production from 11 to mean sd 7.3 0.4 mg kg min in mbh vehicle treated rats . mbh oag further suppressed glucose production to 2.9 0.9 mg kg min ( p < 0.01 vs. mbh vehicle ) during the clamps infused with the higher dose of insulin . the effects of mbh oag on glucose production suppression was additive to peripheral insulin 's effect on the liver , although the magnitude of the drop ( 4.5 mg kg min ) was similar compared with that observed during the pancreatic basal insulin clamps ( fig . we also performed additional pancreatic basal insulin clamps with intracerebroventricular ( icv ) oag ( n = 4 ) versus vehicle ( n = 5 ) . the data indicated that icv oag suppressed glucose production ( 5.9 0.4 [ icv oag , n = 4 ] vs. 10.8 0.8 mg kg min [ icv vehicle , n = 5 ] , p < 0.01 ) to a similar extent as it was suppressed mbh oag ( fig . at the end of all studies , rats were anesthetized ( ketamine 150 mg / kg ) and tissue samples were freeze - clamped with precooled aluminum tongs in situ . the mbh was sampled by dissecting a wedge of tissue including the entire mediolateral and dorsoventral extent of the arcuate nuclei while minimizing ventromedial nucleus tissue . immediately poststereotaxic surgery , mbh cannulated rats were administered 3 l of adenovirus containing dominant - negative ( dn ) kir6.2 aaa - av ( 21 ) ( 3.1 10 plaque - forming units / ml ) or green fluorescent protein ( gfp ) ( 3.0 10 plaque - forming units / ml ) per side of cannula , as previously described ( 22 ) . five days later , the rats underwent vascular surgeries and clamp studies , with mbh oag administrations performed 4 days later . preliminary studies ( n = 3 ) indicate that mbh oag similarly lowered glucose production in gfp - injected rats compared with noninjected rats ( n = 4 ) . thus , the studies were combined and presented as a single mbh oag group in fig . 1b and c. the plasma translocation of the novel isoforms of pkc was assessed by comparing immunoblots of the cytosolic- and membrane - associated fractions obtained 5 min after the mbh dmso , oag , oag + rot , and rot treatments in vivo . it is important to point out that rot has previously been shown to inhibit pkc- translocation in neuronal cells ( 23 ) . mbh wedges ( 8 mg ) were homogenized using a handheld glass homogenizer in lysis buffer a ( 20 mmol / l 3-(n - morpholino ) propanesulfonic acid [ mops ] , 2 mmol / l edta , 0.32 mmol / l sucrose , 30 mmol / l sodium fluoride , 10 mmol / l sodium pyrophosphate , 2 mmol / l sodium orthovanadate , 1 mmol / l phenylmethylsulfonylfluoride , 3 mmol / l benzamidine , 5 mol / l pepstatin a , and 10 mol / l leupeptin ) . the samples were centrifuged at 500 g to pellet out the nuclear fraction , and the supernatant was then cetrifuged at 100,000 g for 60 min at 4c . the pellet fraction was washed in lysis buffer a and then resuspended in lysis buffer b ( lysis buffer a plus the samples were incubated for 60 min on ice and then centrifuged at 100,000 g for 60 min at 4c . the protein concentration of all samples was determined by detergent - compatible microbicinchoninic acid assay ( microbca , pierce ) using serum albumin as the standard . eight micrograms of protein in all samples were mixed with lds sample loading buffer and sample reducing agent ( invitrogen ) and heated to 70c for 10 min . the mixture was then subjected to electrophoretic separation ( 412% bis - tris ) and transferred to polyvinylidine fluoride membranes . the membranes were incubated for 1 h in li - cor blocking buffer at room temperature and then incubated overnight at a concentration of 1:1,000 with affinity - purified polyclonal antibodies specific for the various novel isoforms of pkc ( santa cruz ) . consistent with previous findings ( 17 ) , no bands for pkc- in the mbh wedges were detected using high or low dilution of the antibody . membranes were washed with tris - buffered saline plus tween and then incubated for 1 h at room temperature with immunoreactive - dye conjugated igg ( rockland ) . the membranes were washed again with tris - buffered saline - tween and then rinsed with pbs and scanned on the odyssey infrared imaging system ( li - cor ) . statistical analysis was done by anova to compare across the groups followed by tukey post hoc test to compare between groups . all the rats were restricted to 20 g of food the night before the experiments to ensure the same nutritional status . mbh infusion of the various study solutions was initiated and maintained at a rate of 0.33 l / h for 6 h. study solutions consisted of 250 mol / l pkc activator 1-oleoyl-2-acetyl - sn - glycerol ( oag ) ( dissolved in 5% dmso ) , 250 mol / l oag plus 60 mol / l bisindolylmaleimide ( bim ) ( general pkc inhibitor ) , 250 mol / l oag plus 60 mol / l rottlerin ( rot ) ( specific pkc- inhibitor ) , 250 mol / l oag plus 100 mol / l katp channel blocker glibenclamide ( dissolved in 5% dmso ) , vehicle ( either saline or 5% dmso ) , 60 mol / l bim , 60 mol / l rot , or 100 mol / l glibenclamide . after 2 h of mbh infusion , a primed continuous intravenous infusion of 3-h - glucose ( 40 ci bolus , 0.4 ci / min ; perkin elmer ) was begun and maintained throughout the study to assess glucose kinetics in vivo . in a different group of rats , intravenous saline or 20% intralipid ( mixed with 20 units / ml of heparin , 0.4 ml / h ; baxter healthcare corporation ) intralipid infused at this rate elevates plasma free fatty acid and hypothalamic lcfa - coa levels by 1.5- to 2.0-fold ( 10 ) . specific activity were obtained at 10-min intervals . for the final 2 h of the infusion study , a pancreatic - euglycemic clamp was performed to evaluate the effect of mbh treatments on glucose metabolism independent of changes in glucoregulatory hormones . this involved continuous infusions of insulin ( 0.8 mu kg min for mbh oag studies and 1.5 mu kg min for intravenous intralipid infusion studies ) and somatostatin ( 3 g kg min ) to inhibit endogenous insulin and glucagon secretions and a variable infusion of a 25% glucose solution that was started and periodically adjusted to maintain the plasma glucose concentration similar to the basal levels ( 210240 min ) . the data for glucose infusion rate , glucose production , and glucose uptake were presented as an average of values obtained from the final 30 min ( 300360 min ) of the clamp studies . mbh rot , bim , and glibenclamide alone did not affect glucose kinetics ( data not shown ) . in a separate set of experiments , we performed clamps infused with a higher dose of insulin ( 1.2 instead of 0.8 mu kg min ) and administered vehicle ( n = 5 ) or oag ( n = 4 ) into the mbh . we found that insulin clamped at 1.2 mu kg min normally suppressed glucose production from 11 to mean sd 7.3 0.4 mg kg min in mbh vehicle treated rats . mbh oag further suppressed glucose production to 2.9 0.9 mg kg min ( p < 0.01 vs. mbh vehicle ) during the clamps infused with the higher dose of insulin . the effects of mbh oag on glucose production suppression was additive to peripheral insulin 's effect on the liver , although the magnitude of the drop ( 4.5 mg kg min ) was similar compared with that observed during the pancreatic basal insulin clamps ( fig . we also performed additional pancreatic basal insulin clamps with intracerebroventricular ( icv ) oag ( n = 4 ) versus vehicle ( n = 5 ) . the data indicated that icv oag suppressed glucose production ( 5.9 0.4 [ icv oag , n = 4 ] vs. 10.8 0.8 mg kg min [ icv vehicle , n = 5 ] , p < 0.01 ) to a similar extent as it was suppressed mbh oag ( fig . at the end of all studies , rats were anesthetized ( ketamine 150 mg / kg ) and tissue samples were freeze - clamped with precooled aluminum tongs in situ . the mbh was sampled by dissecting a wedge of tissue including the entire mediolateral and dorsoventral extent of the arcuate nuclei while minimizing ventromedial nucleus tissue . immediately poststereotaxic surgery , mbh cannulated rats were administered 3 l of adenovirus containing dominant - negative ( dn ) kir6.2 aaa - av ( 21 ) ( 3.1 10 plaque - forming units / ml ) or green fluorescent protein ( gfp ) ( 3.0 10 plaque - forming units / ml ) per side of cannula , as previously described ( 22 ) . five days later , the rats underwent vascular surgeries and clamp studies , with mbh oag administrations performed 4 days later . preliminary studies ( n = 3 ) indicate that mbh oag similarly lowered glucose production in gfp - injected rats compared with noninjected rats ( n = 4 ) . thus , the studies were combined and presented as a single mbh oag group in fig . the plasma translocation of the novel isoforms of pkc was assessed by comparing immunoblots of the cytosolic- and membrane - associated fractions obtained 5 min after the mbh dmso , oag , oag + rot , and rot treatments in vivo . it is important to point out that rot has previously been shown to inhibit pkc- translocation in neuronal cells ( 23 ) . mbh wedges ( 8 mg ) were homogenized using a handheld glass homogenizer in lysis buffer a ( 20 mmol / l 3-(n - morpholino ) propanesulfonic acid [ mops ] , 2 mmol / l edta , 0.32 mmol / l sucrose , 30 mmol / l sodium fluoride , 10 mmol / l sodium pyrophosphate , 2 mmol / l sodium orthovanadate , 1 mmol / l phenylmethylsulfonylfluoride , 3 mmol / l benzamidine , 5 mol / l pepstatin a , and 10 mol / l leupeptin ) . the samples were centrifuged at 500 g to pellet out the nuclear fraction , and the supernatant was then cetrifuged at 100,000 g for 60 min at 4c . the pellet fraction was washed in lysis buffer a and then resuspended in lysis buffer b ( lysis buffer a plus 1% triton x-100 ) . the samples were incubated for 60 min on ice and then centrifuged at 100,000 g for 60 min at 4c . the protein concentration of all samples was determined by detergent - compatible microbicinchoninic acid assay ( microbca , pierce ) using serum albumin as the standard . eight micrograms of protein in all samples were mixed with lds sample loading buffer and sample reducing agent ( invitrogen ) and heated to 70c for 10 min . the mixture was then subjected to electrophoretic separation ( 412% bis - tris ) and transferred to polyvinylidine fluoride membranes . the membranes were incubated for 1 h in li - cor blocking buffer at room temperature and then incubated overnight at a concentration of 1:1,000 with affinity - purified polyclonal antibodies specific for the various novel isoforms of pkc ( santa cruz ) . consistent with previous findings ( 17 ) , no bands for pkc- in the mbh wedges were detected using high or low dilution of the antibody . membranes were washed with tris - buffered saline plus tween and then incubated for 1 h at room temperature with immunoreactive - dye conjugated igg ( rockland ) . the membranes were washed again with tris - buffered saline - tween and then rinsed with pbs and scanned on the odyssey infrared imaging system ( li - cor ) . statistical analysis was done by anova to compare across the groups followed by tukey post hoc test to compare between groups . to examine the glucoregulatory effects of hypothalamic pkc activation , we infused pkc activator oag ( 250 the effects on glucose production and glucose uptake induced by mbh oag administration were assessed by the tracer - dilution methodology and the pancreatic basal insulin clamp technique as previously described ( 2 ) . during the clamps , mbh oag increased exogenous glucose infusion rate by 2.5-fold , compared with mbh vehicle , which maintained euglycemia ( fig . the increase in glucose infusion rate was fully accounted for by an inhibition of glucose production ( fig . we then coinfused mbh oag with the general pkc inhibitor bim ( 60 mol / l ) or with the specific pkc- inhibitor rot ( 60 mol / l ) . we found that inhibition of hypothalamic pkc , or more specifically pkc- , with both inhibitors diminished the ability of mbh oag to increase exogenous infusion rate and to lower glucose production ( fig . we administered oag into the mbh in a different group of rats at the same concentration that was used in the clamp studies , and we found that mbh oag selectively induced hypothalamic pkc- plasma membrane translocation ( an accepted marker for pkc activation ) ( fig . importantly , mbh oag induced pkc- membrane translocation was blocked by the coadministration of pkc- inhibitor rot at the same concentration that blocked the ability of mbh oag to lower glucose production ( fig . mbh oag ( with or without rot ) decreased pkc - content in the cytosolic fraction but with no parallel increase in the membrane fraction ( fig . because we hypothesized that the activation of hypothalamic pkc leads to the activation / phosphorylation of the katp channels that are located in the plasma membrane , we postulate that hypothalamic pkc- but not pkc - regulates glucose production . however given the ability of pkc to phosphorylate and activate the kir6.2-sur1 katp channels ( 18 ) that are expressed in both pancreatic -cells and neurons ( 19 ) , we first tested whether activation of hypothalamic katp channels is required for pkc to lower glucose production with a pharmacological approach . mol / l ) , and this fully reversed the ability of mbh oag to increase glucose infusion rate and lower glucose production ( fig . dn kir6.2 channel expression induced by an adenovirus ( adenovirus - expressing kir6.2 aaa ) disrupts the kir6.2 channel current by more than 90% in cardiac myocytes ( 21 ) . the dn kir6.2 aaa adenovirus expresses an aaa mutant subunit of kir6.2 that co - assembles with endogenous kir6.2 and prevents the fully assembled katp channel complex from conducting potassium current ( 21 ) . we injected the dn kir6.2 aaa adenovirus or gfp previously into the mbh of rats and performed the clamp procedure with mbh oag administration . mbh oag failed to increase glucose infusion rate and lower glucose production in the dn kir6.2 aaa previously rats compared with the gfp adenovirus rats ( fig . these data collectively indicate that the hypothalamic kir6.2/sur1-containing katp channel is required for pkc to lower glucose production . future studies are needed to clarify whether hypothalamic pkc directly phosphorylates / activates the katp channels to regulate glucose production . during the pancreatic basal insulin clamps , an elevation of plasma lcfa increases gluconeogenesis but not glucose production because of an inhibition of glycogenolysis ( 10,26,27 ) . the activation of hypothalamic katp channels by an approximately twofold elevation of circulating lcfa ( induced by intravenous intralipid infusion ) was recently demonstrated to inhibit glycogenolysis and compensate for the induction in gluconeogenesis ( 10 ) . in light of the fact that 1 ) lcfas activate pkc in liver and muscle ( 1116 ) and 2 ) hypothalamic pkc - katp channel activation lowers glucose production ( demonstrated in the current study ) , we tested , using the same intravenous intralipid - infused model ( 10 ) , whether activation of hypothalamic pkc is required for circulating lcfa to lower glucose production . we inhibited hypothalamic pkc activation with either mbh bim ( 60 mol / l ) or rot ( 60 mol / l ) administration to rats that received intravenous intralipid . mbh bim or rot decreased the exogenous glucose infusion rate required to maintain euglycemia in rats that received lipid infusion ( fig . 2c ) . the decrease in glucose infusion rate was fully accounted for by an elevation of glucose production , since glucose uptake was unchanged ( fig . together , these data indicate that hypothalamic pkc activation is required for circulating lipids to lower glucose production . finally , we tested whether activation of hypothalamic pkc lowers glucose production in an early - onset ( 3 days of high - fat feeding ) diet - induced hepatic insulin resistance model ( 2,28,29 ) . we found that during the pancreatic basal insulin clamps , mbh oag suppressed glucose production in high - fat fed rats ( 5.7 + 0.7 mg kg min [ mbh oag ; n = 5 ] vs. 11.5 + 0.5 mg kg min [ mbh vehicle ; n = 5 ] , p < 0.001 ) to a similar extent as that observed in rats given a regular diet ( fig . 1c ) . these data indicate that direct pkc activation bypasses lipid - sensing defect(s ) in the hypothalamus ( 28 ) to lower glucose production in the early onset of diet - induced insulin resistance . our data first support the notion that activation of hypothalamic pkc is sufficient and necessary for cns lipid - sensing mechanisms to lower glucose production through the activation / phosphorylation of hypothalamic kir6.2/sur1-containing katp channels . however , much work is needed to further dissect the mechanisms in the hypothalamus or in other parts of this brain - liver axis that regulates glucose production . second , these data support the working hypothesis that lipid - sensing mechanisms in the brain and liver share biochemical mechanisms but have opposing physiological mechanisms that regulate glucose production ( 1 ) . finally , our findings reveal hypothalamic pkc as a potential therapeutic target for lowering glucose levels in diabetes and obesity . | objective a selective rise in hypothalamic lipid metabolism and the subsequent activation of sur1/kir6.2 atp - sensitive k+ ( katp ) channels inhibit hepatic glucose production . the mechanisms that link the ability of hypothalamic lipid metabolism to the activation of katp channels remain unknown.research design and methods to examine
whether hypothalamic protein kinase c ( pkc ) mediates the ability of central nervous system lipids to activate katp channels and regulate glucose production in normal rodents , we first activated hypothalamic pkc in the absence or presence of katp channel inhibition .
we then inhibited hypothalamic pkc in the presence of lipids .
tracer - dilution methodology in combination with the pancreatic clamp technique was used to assess the effect of hypothalamic administrations on glucose metabolism in vivo.resultswe first reported that direct activation of hypothalamic pkc via direct hypothalamic delivery of pkc activator 1-oleoyl-2-acetyl - sn - glycerol ( oag ) suppressed glucose production .
coadministration of hypothalamic pkc- inhibitor rottlerin with oag prevented the ability of oag to activate pkc- and lower glucose production .
furthermore , hypothalamic dominant - negative kir6.2 expression or the delivery of the katp channel blocker glibenclamide abolished the glucose production - lowering effects of oag . finally ,
inhibition of hypothalamic pkc eliminated the ability of lipids to lower glucose production.conclusionsthese studies indicate that hypothalamic pkc activation is sufficient and necessary for lowering glucose production . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
uterine leiomyomas are the most common benign tumor of the female genital tract in the reproductive age group . leiomyomas exhibit different degenerative changes on histopathological examination such as hyaline degeneration , red degeneration , cystic degeneration , fatty degeneration , and calcified degeneration . however , calcified degeneration of leiomyoma in a postmenopausal woman forming bony hard mass is a rare phenomenon . it also leads some diagnostic confusion with ovarian teratoma or large bladder calculus in the radiological investigation . here , we present a rare case of calcified broad ligament fibroid in a postmenopausal woman treated with hysterectomy without oophorectomy . a 49-year - old postmenopausal woman presented with pain at the lower abdomen for the last 4 months she had no history of irregular menstruation , intake of oral contraceptive , and hormone replacement therapy . she was controlled hypertensive and was on oral antihypertensive medication ( calcium channel blocker ) for the last 2 years . systemic examination revealed the second - degree uterovaginal prolapse , and pervaginal examination revealed retroverted uterus with a palpable mass at the left fornix . on abdominal ultrasound , there was a solid heterogeneous mass measuring 5 cm 4 cm attached with the left broad ligament . radiological diagnosis was calcified mass at the left adnexa , suggestive of broad ligament fibroid . vaginal hysterectomy and repair of pelvic floor she underwent total abdominal hysterectomy and resection of broad ligament tumor without salpingo - oophorectomy and repair of pelvic floor under spinal anesthesia . postoperative period was uneventful and the specimen was sent to histopathology laboratory . in gross examination , the uterus measured 8 cm 4 cm 3 cm with a hard mass at the left broad ligament . the hard mass measured 5 cm 4 cm 4 cm with bony hard feeling during cutting with a saw . the sections revealed fascicles and bundles of smooth muscle cells with extensive calcification . in light microscopy , gross image of hysterectomy specimen ( uterus , cervix with vaginal flap ) with a solid whitish calcified mass at left broad ligament photomicrograph shows histomorphology of calcified leiomyoma deep basophilic staining granular deposition all over the tissue section ( h and e , 10 ) ( a and b ) photomicrograph shows histomorphology of calcified leiomyoma ( a ) deep basophilic staining granular deposition over the tissue section and benign spindle cells in bundles , fascicles , and whorled pattern ( [ a ] h and e , 40 , [ b ] h and e , 10 ) it is a benign tumor of smooth muscle origin and contains varying amount of connective tissue . it is thought to be estrogen - dependent tumor and most of the cases regress after menopause . histopathology of leiomyoma reveals intersecting fascicles of spindle cells with cigar - shaped blunt spindle nuclei and eosinophilic cytoplasm . as the leiomyomas enlarge in size , they outgrow blood supply and various degenerative changes occur . other degenerations occur less frequently , such as myxomatous degeneration ( 13% ) , calcified degeneration ( 8% ) , mucoid degeneration ( 6% ) , cystic degeneration ( 4% ) , red degeneration ( 3% ) , and fatty degeneration ( 3% ) . calcified degeneration has preponderance in the postmenopausal age group , black women , and pedunculated subserous fibroid . however , it has been suggested that estrone , insulin - like growth factor , and epidermal growth factor stimulate the growth of leiomyoma at postmenopausal age group . in obese postmenopausal woman , peripheral conversion of adrenal - derived androstenedione and its conversion to estrone by aromatization stimulate the growth of leiomyoma . however , in our case , the whole leiomyoma was converted into a solid calcified mass . however , extensive calcification of leiomyoma causes diagnostic difficulties in ultrasound , especially a calcified pedunculated subserous leiomyoma or a calcified broad ligament leiomyoma . radiologically , it mimics calcified pedunculated subserous fibroid , ovarian teratoma , calcified fibrous tumor of the ovary , large bladder calculi , and rarely calcified parasite ( coiled guinea worm ) giving an appearance of parasitic leiomyoma . symptomatically , leiomyomas present with irregular heavy menstruation and pain at the lower abdomen and pelvic region . in our case , broad ligament fibroid presented with pain at the lower abdomen . hysterectomy with or without salpingo - oophorectomy is the treatment of choice in broad ligament fibroid in a postmenopausal woman . in conclusion , sometimes , it may lead to diagnostic difficulty with other calcified masses such as teratoma or bladder calculi . hysterectomy is the definitive management , and postoperative histopathology examination of the tumor can give a correct diagnosis . | calcified broad ligament leiomyoma is a rare benign lesion in postmenopausal age group .
it causes diagnostic confusion with solid calcified adnexal mass and large bladder calculi at the pelvic region .
clinical and radiological diagnoses were confirmed by histopathology of the hysterectomy specimen .
we hereby present a case of heavily calcified broad ligament fibroid in a postmenopausal woman . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
mandibular setback surgery is usually performed for aesthetic and functional improvement in patients with skeletal class iii malocclusion . recent studies have reported that mandibular setback is accompanied by changes in the hard and soft tissues in the stomatognathic system and that these changes are related to postoperative stability and recurrence as well as the occurrence of obstructive sleep apnea . as interest in obstructive sleep apnea has recently increased , studies on changes in stomatognathic tissues after orthognathic surgery have become more frequent . in particular , various studies regarding postoperative changes of the tongue and hyoid bone position and the accompanying changes in the airway space have been examined . while several studies have reported no significant changes in the pharyngeal airway space after mandibular setback procedures1234 , other studies reported that , after mandibular setback , a significant decrease in pharyngeal airway space occurred leading to obstructive sleep apnea5678 . in addition , previous research on the correlation between the amount of mandibular setback and the amount of change in the pharyngeal airway space showed inconsistent results , failing to draw a clear conclusion . therefore , an accurate assessment is needed to determine which changes occur in the posterior airway space ( pas ) , particularly regarding the hyoid bone after mandibular setback surgery , and further studies regarding the correlations that the parameters have with the amount of mandibular setback are required . in this study , changes in the hyoid bone position and the amount of airway space in the nasopharynx , oropharynx , and hypopharynx were evaluated after mandibular setback using bilateral sagittal split ramus osteotomy ( bssro ) in patients with skeletal class iii malocclusion . an analysis of the correlation between the amount of mandibular setback and the amount of change in the airway space and hyoid bone was also performed . from january 2010 to february 2013 , 30 patients who were diagnosed with skeletal class iii malocclusion who underwent the same bssro and fixation method by the same operator in the division of oral and maxillofacial surgery , department of dentistry at the ajou university school of medicine ( suwon , korea ) and received over 6 months of follow - ups were selected for this study . patients who underwent other surgeries , including maxillary surgery , genioplasty , and segmental osteotomy that could affect changes in the pharyngeal airway space were excluded . the patients were between 18 and 40 years of age , with an average age of 24 years old , and there were 12 men and 18 women . the study was conducted in accordance with the regulations and guidelines of the ajou university school of medicine 's institutional review board ( ajirb - med - mdb-13 - 236 ) . the amount of mandibular setback was determined by the average of the left and right sides ; this average was 8.4 mm . patients had preoperative , immediate postoperative , and 6 months postoperative ( at least 6 months from the surgery ) lateral cephalograms . the head was in the natural head position ( nhp ) at the time of cephalogram . when they felt comfortable , they were instructed to maintain that posture and to stare at their eyes in the mirror , after which nhp was finally determined . in order to maintain an unchanged head position and to provide bilateral support , ear rods were not placed next to the external acoustic meatus but just touched the bilateral ears . additionally , for anteroposterior support , the nasion positioner was in slight contact with the soft tissue nasion . after positioning the head , lateral cephalograms were obtained . after taking preoperative , immediate postoperative , and 6 months postoperative lateral cephalograms , the airway space and hyoid position of the nasopharynx , oropharynx , and hypopharynx were measured by selecting specific measuring points described below ; they were compared and analyzed during this time period . the preoperative , immediate postoperative , and 6 months postoperative measurements were named t1 , t2 , and t3 , respectively , and the reference lines used in this study were the frankfort horizontal ( fh ) plane and the sella vertical ( sv ) plane , which is a vertical line from the sella ( s ) to the fh and mandibular ( mn ) plane . the measuring points used were s , the most inferior point of the soft palate ( p ) , hyoid bone ( h ) , third cervical vertebra ( c3 ) , anterior nasal spine ( ans ) , posterior nasal spine ( pns ) , and pogonion ( pog).(fig . first , the airway space measurement was classified into three areas : the nasopharynx , oropharynx , and hypopharynx.(fig . 2 ) the hyoid bone position was evaluated in three ways : using the horizontal position , vertical position , and the distance to the mandibular inferior border.(fig . 3 ) the vertical distance from the sv plane to pog was measured to evaluate recurrence . 4 ) the distances were measured up to 0.1 mm using the cephalometric analysis software program ( v - ceph 6.0 ; osstem , seoul , korea ) on lateral cephalograms of the same size . the seven items measured in this study are as follows : nasopharyngeal airway space ( nph ) : the distance from pns to the posterior pharyngeal wall when extending the palate plane that connected the ans to the pns . oropharyngeal airway space ( oph ) : the distance between the anterior pharyngeal wall and posterior pharyngeal wall when drawing a line from the point p parallel to the fh plane . hypopharyngeal airway space ( hph ) : the distance between the anterior pharyngeal wall and posterior pharyngeal wall when drawing a line from the most anterior - inferior point of the c3 parallel to the fh plane . sv - hy : the distance from the sv plane to the most anterior point of the hyoid bone . fh - hy : the distance from the fh plane to the most anterior point of the hyoid bone . mn - hy : the distance from the mn plane to the most anterior point of the hyoid bone . the mean and standard deviation of the measurements were determined for each time period , and to test for significance in the amount changed during the time period , the differences were tested at the 1% and 5% significance levels using a paired t - test . in addition , the correlation between the amount of mandibular setback and the amount of change in the airway space and hyoid bone were analyzed using the pearson 's correlation coefficient . all the statistical analyses were done using ibm spss statistics version 22.0 ( ibm co. , armonk , ny , usa ) . the measurement of the nasopharynx , nph , showed a 1.4 mm decrease immediately postoperatively compared to the preoperative measurement and showed a recovery of 0.7 mm at 6 months after surgery . the measurement of the oropharynx , oph , only showed statistical significance in terms of the airway areas . the oropharynx showed a significant decrease of 4.3 mm from 18.9 mm preoperatively to 14.6 mm immediately postoperatively ( p<0.01 ) . six months after surgery , it was 16.6 mm , which recovered to 2.0 mm , showing a stable state with a decrease of 2.3 mm ( p<0.01 ) compared to the preoperative state . the measurement of the hypopharynx , hph , showed an increase of 0.7 mm immediately postoperatively compared to the preoperative measurement and this state was maintained through the six - month period after surgery , but there was no statistical significance.(tables 1 , 2 ) the horizontal position of the hyoid bone , sv - hy , showed posterior movement of 7.1 mm , from 33.0 mm preoperatively to 25.9 mm immediately postoperatively ( p<0.01 ) , and the position was 27.2 mm 6 months after surgery , which represented a 1.3 mm recovery . the vertical position of the hyoid bone , fh - hy , showed 12.9 mm of significant inferior movement , from 123.9 mm preoperatively to 136.8 mm immediately after surgery ( p<0.01 ) , and it returned to 128.1 mm six months after surgery ( p<0.01 ) . it ultimately stabilized at about 4.2 mm inferiorly compared to the preoperative position ( p<0.01 ) . the distance from the hyoid bone , mn - hy , showed a 12.0 mm increase , from 13.5 mm preoperatively to 25.5 mm immediately after surgery ( p<0.01 ) , and showed a slight return , measuring 20.5 mm at six months after surgery ( p<0.01 ) . it ultimately stabilized at a position about 7.0 mm away from the preoperative position ( p<0.01 ) . eventually , the position of the hyoid bone showed movement toward the posteroinferior position immediately after surgery compared to the preoperative position and a slight return at 6 months after surgery . it ultimately was stabilized in the posteroinferior position , showing that it maintained its position more inferiorly from the mandibular inferior border . ( tables 1 , 2 ) the measurements of sv - pog were 102.7 mm preoperatively , 91.6 mm immediately postoperatively , and 92.5 mm 6 months after surgery during the follow - up period . at the final follow - up , the amount of return was about 0.9 mm compared to the measurement immediately after surgery , but there was no statistical significance . therefore , the results of this study show that the procedure does not result in the recurrence of mandibular setback surgery.(tables 1 , 2 ) by analyzing the correlation between the amount of mandibular setback and the amount of change in the airway space and hyoid bone position with pearson 's correlation , the amount of mandibular setback showed a slightly higher correlation at the horizontal position of the hyoid bone and nasopharyngeal airway space , but overall , there was no statistically significant correlation between them . therefore , the amount of mandibular setback has no correlation with the amount of change in pharyngeal airway space and the hyoid bone.(table 3 ) the measurement of the nasopharynx , nph , showed a 1.4 mm decrease immediately postoperatively compared to the preoperative measurement and showed a recovery of 0.7 mm at 6 months after surgery . the measurement of the oropharynx , oph , only showed statistical significance in terms of the airway areas . the oropharynx showed a significant decrease of 4.3 mm from 18.9 mm preoperatively to 14.6 mm immediately postoperatively ( p<0.01 ) . six months after surgery , it was 16.6 mm , which recovered to 2.0 mm , showing a stable state with a decrease of 2.3 mm ( p<0.01 ) compared to the preoperative state . the measurement of the hypopharynx , hph , showed an increase of 0.7 mm immediately postoperatively compared to the preoperative measurement and this state was maintained through the six - month period after surgery , but there was no statistical significance.(tables 1 , 2 ) the horizontal position of the hyoid bone , sv - hy , showed posterior movement of 7.1 mm , from 33.0 mm preoperatively to 25.9 mm immediately postoperatively ( p<0.01 ) , and the position was 27.2 mm 6 months after surgery , which represented a 1.3 mm recovery . the vertical position of the hyoid bone , fh - hy , showed 12.9 mm of significant inferior movement , from 123.9 mm preoperatively to 136.8 mm immediately after surgery ( p<0.01 ) , and it returned to 128.1 mm six months after surgery ( p<0.01 ) . it ultimately stabilized at about 4.2 mm inferiorly compared to the preoperative position ( p<0.01 ) . the distance from the hyoid bone , mn - hy , showed a 12.0 mm increase , from 13.5 mm preoperatively to 25.5 mm immediately after surgery ( p<0.01 ) , and showed a slight return , measuring 20.5 mm at six months after surgery ( p<0.01 ) . it ultimately stabilized at a position about 7.0 mm away from the preoperative position ( p<0.01 ) . eventually , the position of the hyoid bone showed movement toward the posteroinferior position immediately after surgery compared to the preoperative position and a slight return at 6 months after surgery . it ultimately was stabilized in the posteroinferior position , showing that it maintained its position more inferiorly from the mandibular inferior border . the measurements of sv - pog were 102.7 mm preoperatively , 91.6 mm immediately postoperatively , and 92.5 mm 6 months after surgery during the follow - up period . at the final follow - up , the amount of return was about 0.9 mm compared to the measurement immediately after surgery , but there was no statistical significance . therefore , the results of this study show that the procedure does not result in the recurrence of mandibular setback surgery.(tables 1 , 2 ) by analyzing the correlation between the amount of mandibular setback and the amount of change in the airway space and hyoid bone position with pearson 's correlation , the amount of mandibular setback showed a slightly higher correlation at the horizontal position of the hyoid bone and nasopharyngeal airway space , but overall , there was no statistically significant correlation between them . therefore , the amount of mandibular setback has no correlation with the amount of change in pharyngeal airway space and the hyoid bone.(table 3 ) various measuring points and reference lines have been used in previous studies on mandibular setback and airway changes . this study used radiopaque measuring points that were easy to read from lateral cephalograms , including s , p , c3 , ans , pns , and pog . this study also used reference lines that could be set clearly , including the fh plane and the sv plane , which is the vertical line from the s to the fh and mn plane , in order to minimize the measurement error that can occur with lateral cephalograms . many studies on mandibular setback and changes in the airway space and hyoid bone have reported inconsistent results . for airway changes , athanasiou et al.1 reported that the postoperative airway space was decreased , but that , with the elongation of the angle of the cervical vertebra afterwards , the reduced airway space was compensated for ; at follow - up , the airway space recovered to equal the preoperative volume . according to several studies234 , there was no significant decrease in airway space after mandibular setback . in addition , tselnik and pogrel5 reported that the airway space increased immediately after mandibular setback , and they claimed this was because of anterior displacement of the hyoid bone postoperatively and that the airway space eventually stabilized in the decreased state . greco et al.6 reported that the airway volume of the hypopharynx was significantly decreased immediately after surgery and during long - term follow - up ; enacar et al.7 also reported similar results . since the hypopharynx that they measured was in the same position as the oropharynx in this study , the present study showed the same results . in studies that compared the two - dimensional ( 2d ) area of the pharynx , gven and saraolu8 also reported that the decreased airway space was maintained immediately after surgery and during the long - term follow - up . with respect to studies on the hyoid bone , tongue , and airway space change after mandibular setback , park and kim9 reported a significant decrease in airway space at the oropharynx and hypopharynx immediately after surgery . however , the airway space of the hypopharynx at the follow - ups recovered to the preoperative state while the decreased airway space of the oropharynx did not . in the present study , only decreased oropharyngeal airway space was observed with a statistically significant difference and the decrease was maintained during the long - term follow - up . this is thought to be associated with the finding that the oropharyngeal area is directly affected by the mandibular setback and that posteroinferior movement of the hyoid bone is accompanied by movements of the suprahyoid and infrahyoid muscles . the hyoid bone consists of unstable hard tissues that are wholly supported by soft tissues connecting it to the skull base , mandible , pharynx , and tongue , and it is heavily influenced by surrounding tissues . a positional assessment of the hyoid bone is used to evaluate the physiological equilibrium state of the suprahyoid muscles , infrahyoid muscles , and surrounding tissues of the hyoid bone . according to several studies171011 , the hyoid bone returned to its original preoperative position during the follow - up period , and this was due to compensation reactions of the suprahyoid muscles , infrahyoid muscles , and pharyngeal muscles . eggensperger et al.12 reported posteroinferior movement of the hyoid bone after mandibular setback with bssro , but they assumed that this was due to a skeletal recurrence . choi et al.13 reported that , after mandibular setback , significant posteroinferior displacement of the hyoid bone was shown but the majority recovered vertically over time and there was minimal anterior return . in the present study , the position of the hyoid bone showed significant posteroinferior movement and slight return during long - term follow - up to a degree that was statistically significant . the distance to the mandibular inferior border was farther away postoperatively and such posteroinferior displacement of the hyoid bone is thought to be associated with the decrease in airway space in the oropharynx found after surgery . the measurements used in the studies mentioned above were the anterior and posterior length changes from 2d lateral cephalograms , which fail to fully reproduce the actual airway space compared to three - dimensional analysis methods , including computed tomography and magnetic resonance imaging . however , riley and powell14 demonstrated the effectiveness of 2d studies by reporting the correlation between the airway space measured from 2d lateral cephalograms and the airway space volume calculated from three - dimensional computed tomography . in addition , since the lateral cephalogram is a preoperative examination typically performed in orthognathic surgery patients , it was used in this study because it is not financially burdensome to patients , is noninvasive , and it is easy and quickly applied in preoperative analysis . several previous studies demonstrated that craniocervical angulations at different head postures affected pharyngeal diameters in normal subjects15161718 . muto et al.19 also showed a significant correlation between head posture and pas and reported that a change of 10 in craniocervical inclination altered pas by about 4 mm . therefore , for data collection when the lateral cephalogram is required , cephalometric radiographs should be taken at reproducible head positions in each patient . in a study including 30 patients , malkoc et al.20 demonstrated that airway dimension and tongue and hyoid position measurement were highly reproducible on nhp cephalograms . for that reason , in the present study , lateral cephalograms were performed using the method proposed by solow and tallgren18 . as a result a limitation in this study was the measurement of lengths using lateral cephalograms only ; in addition , polysomnography required to diagnose true actual obstructive sleep apnea was not performed . therefore , it was difficult to confirm whether the oropharyngeal decrease occurring postoperatively changed the quality of sleep or caused actual obstructive sleep apnea . however , after partinen et al.21 defined the distance between the posterior pharyngeal wall and tongue base as the line connecting the point b and gonion as the pas and measured the pas , they confirmed that the length of the pas was less than 5 mm . additionally , they defined the distance from the mn plane to the hyoid bone as mp - h and reported that if this distance was more than 24 mm , the respiratory failure rate would increase . riley et al.22 reported that if the pas was less than 11 mm and mp - h was more than 15.4 mm , obstructive sleep apnea could occur . according to this study , the oropharyngeal decrease necessarily occurred after the mandibular setback surgery , and changes in the surrounding structures were identified with posteroinferior movement of the hyoid bone through long - term follow - up . therefore , when performing mandibular setback surgery , it is essential to consider that obstructive sleep apnea can occur postoperatively through the analysis of lateral cephalograms . in particular , patients who have a tendency to snore and predisposing factors for sleep apnea such as obesity , macroglossia , a short neck , large uvulae , and hypertrophic adenoids should prompt caution ; a change to the treatment plan , if necessary , should be considered . tselnik and pogrel5 evaluated airway volume with 2d areas by setting special measurement points and reported that there was a very strong correlation between the amount of mandibular setback and airway volume decrease during long - term follow - up after mandibular setback surgery . hochban et al.23 also reported that there was a slight correlation between the amount of mandibular setback and airway volume reduction in their study . however , enacar et al.7 reported that they did not find a correlation between the amount of mandibular setback and the hypopharyngeal airway volume change , a result that agreed with that of chung and lee 's study24 . gven and saraolu8 also bolstered these results by reporting that there was no correlation between the amount of mandibular setback and decreased airway volume and position change of the hyoid bone . in the present study , there was no special correlation found with pearson 's correlation , which was used to determine the correlation between the amount of mandibular setback and the amount of change in the airway space and hyoid bone . the reason for this could be that airway space and hyoid bone changes did not occur uniformly according to the amount of mandibular setback due to various environmental differences such as the individual structure of hard and soft tissues , the degree of elasticity of the soft tissues , and the degree of obesity . in this study , a significantly reduced oropharynx , posteroinferior movement of the hyoid bone , and changes to the surrounding structures after mandibular setback surgery were identified through long - term follow - up . the results suggest that it is possible to cause obstructive sleep apnea after mandibular setback surgery , indicating that care is needed when electing to perform mandibular setback surgery , especially for patients who have predisposing factors for sleep apnea such as obesity , macroglossia , a short neck , large uvulae , and hypertrophic adenoids . therefore , evaluation for obstructive sleep apnea that can occur postoperatively is needed and should be considered when establishing the treatment plan . | objectivesthe purpose of this study was to evaluate changes in the pharyngeal airway space and hyoid bone position after mandibular setback surgery with bilateral sagittal split ramus osteotomy ( bssro ) and to analyze the correlation between the amount of mandibular setback and the amount of change in pharyngeal airway space or hyoid bone position.materials and methodsfrom january 2010 to february 2013 , a total of 30 patients who were diagnosed with skeletal class iii malocclusion and underwent the same surgery ( bssro ) and fixation method in the division of oral and maxillofacial surgery , department of dentistry at the ajou university school of medicine ( suwon , korea ) were included in this study .
lateral cephalograms of the 30 patients were assessed preoperatively ( t1 ) , immediately postoperatively ( t2 ) , and 6 months postoperatively ( t3 ) to investigate the significance of changes by time and the correlation between the amount of mandibular setback and the amount of change in the airway space and hyoid bone position.resultsthree regions of the nasopharynx , oropharynx , and hypopharynx were measured and only the oropharynx showed a statistically significant decrease ( p<0.01 ) .
a significant posterior and inferior displacement of the hyoid bone was found 6 months after surgery ( p<0.01 ) .
analysis of the correlation between the amount of mandibular setback and the amount of final change in the airway space and hyoid bone position with pearson 's correlation showed no significant correlation.conclusionin this study , the oropharynx significantly decreased after mandibular setback surgery , and changes in the surrounding structures were identified through posteroinferior movement of the hyoid bone during long - term follow - up .
therefore , postoperative obstructive sleep apnea should be considered in patients who plan to undergo mandibular setback surgery , and necessary modifications to the treatment plan should also be considered . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in its 2010 report , the future of nursing : leading change , advancing health , the institute of medicine recommends the removal of scope of practice ( sop ) barriers for advanced practice registered nurses ( aprns ) such that they can practice to the full extent of their education and training currently , only 16 states and the district of columbia ( dc ) allow aprns to practice independently of physicians ( for this study , we employ the standards of independent practice established by the robert wood johnson foundation center to champion nursing in america , adapted from data collected for the annual pearson report . by this standard , to be considered independent within a given state , aprns must be permitted to diagnose and treat without physician supervision and must be permitted to prescribe medications either without physician supervision or with the signing of a one - time collaboration agreement with a physician or the state board of nursing ( this may be for all prescribing or , in some states , only for prescribing of controlled substances , among which certain drugs may require case - specific consultations with a physician ) . in this way , our inclusion criteria for independent practice capture only states that grant aprns complete or near - complete practice autonomy ) . in response to the iom recommendation , the american medical association and the american academy of family physicians , among others , have expressed their opposition , pointing out that physicians have more extensive education and arguing that nurses are not substitutable with primary care physicians [ 3 , 4 ] . while the question of whether there are economic interests that might be negatively impacted by reforms is rarely discussed openly , the perceived impact of reform , particularly on primary care physicians , undoubtedly has and will continue to play a role in whether and to what extent sop laws are reformed . to the extent that there is a fear that physician income could decline as a result of expanding advanced practice nursing sop , the assumption would be that there is a zero sum situation with regard to supply and demand in primary care and that , because aprns are paid less for their services , payers will seek to substitute nurses in physician roles whenever possible , leading to reduced physician earnings and influence . such assumptions do not account for unmet need , nor do they account for patient preferences , which may prioritize physician services when they are accessible , and sometimes even when care by a nurse is offered at a reduced cost and/or wait time . there is , of course , a theoretical basis for believing that aprn services will increase competition and thus help contain costs . as an example of the effect , this idea has on policy , the texas legislative budget board has recently recommended the removal of the state 's sop barriers as a means of mitigating the state 's substantial primary care shortage , as well as reducing costs to patients . in their comments on two separate bills currently before the texas state senate designed to remove sop barriers for aprns , the u.s . federal trade commission has expressed their support , emphasizing that the resulting increase in competition would serve the interests of health care consumers , and adding that their interpretation of the evidence suggests that that it would not adversely impact quality of care . containing costs through competition among providers is a complex proposition that we do not intend to address in this analysis . as a first attempt to explore whether earnings of employed primary care physicians in states with reforms could be negatively impacted , we compare their earnings to states that have not reformed their sop laws . we also compare the wages of surgeons , a group unlikely to be impacted by expanded practices of aprns , as a way to account for the myriad confounding factors that could affect wages across states . finally , we compare the annual rate of change in wages over ten years ( 1999 to 2009 ) for all three practitioner groups to determine whether physician wages rise faster in states that retain sop barriers . identifying empirical data to support or refute the presumed economic concerns of physicians is a complex task , both because the data is limited and because of the methodological challenge of attributing causality . in a literature review , only two studies focusing on the effect of sop reforms on physician and nurse income were identified [ 9 , 10 ] . used information from the current population survey ( cps ) from 1988 to 2002 for earnings data for aprns , physician assistants ( pas ) , and physicians ( mds ) . variable based on annual rankings published in nurse practitioner and performed a regression analysis using this and the wage data . perry employed a similar methodology , but using different data sources . for data on nurse practitioner ( np , a subset of aprns ) wages , he used the national sample survey of registered nurses ( nssrn ) , for pas , he used the american academy of physician assistants annual census ( aapaac ) , and for mds , he used the cps . prescriptive autonomy and reimbursement autonomy and constructed two additional variables to measure the effect of time since reform on wages ( on the assumption that changes in the labor market due to regulatory change build over time ) . found that higher levels of professional autonomy were associated with a reduction in earnings of aprns of 21% and an increase in pa earnings of 36% , with no statistically significant effect on the earnings of mds . an increase in the supply of aprns led to lower wages and greater practice autonomy through increased political influence of aprns . regulatory changes attracted a greater number of aprns to the state , causing wages to drop in response to increased supply . there was a substitution effect wherein regulatory changes led to physicians hiring fewer aprns and a greater number of pas ( who must work under physician supervision ) for fear that their employing hospital or hmo would then shift some physician functions to aprns . while the available data did not allow the researchers to test these hypotheses directly , the lack of a significant correlation between changes in regulation and changes in wages leads the authors to suggest that the third explanation that changes in physician hiring practices led to lower aprn and higher pa wages is the most likely causal pathway . in the second study , perry found greater np prescriptive autonomy to be associated with an increase in np earnings by an average of 1.6% per year ( for each year after authority was granted ) and a decrease in pa and md earnings of 1.4% and 7.6% per year , respectively . greater np payment authority was associated with a decrease in pa earnings of 0.3% per year , with no change in np or md earnings . greater pa prescriptive authority was associated with a decrease in np earnings of 0.8% per year , an increase in md earnings of 8% per year , and no change in pa earnings . no significant relationship was observed between greater pa payment authority and earnings for any of the three groups . in the case of np prescriptive autonomy , perry suggests that the observed rise in np wages and fall in md and pa wages could be a result of the type of practitioner substitution described above , wherein an increase in the number of nps providing primary care leads to lower md market share , and thus lower wages . interpreting the results on reimbursement autonomy , perry suggests that , to the extent that nps seek greater professional independence , demand for pas rises to meet the demand for nonphysician caregivers within physician - led practices . this coupling between pa and md earnings is also used to explain the observation that greater pa prescriptive autonomy is associated with greater md earnings . specifically , perry suggests that the efficiency gained from allowing pas greater autonomy benefit the practice in which pas are employed , allowing those practices to employ fewer physicians , leading to lower operating costs . at the same time , reduced physician - led practice costs and increased pa practice autonomy lead to reduced demand for nps , exerting downward pressure on np earnings . while only two studies looking at the direct impact of sop laws on practitioner income were found , three additional studies were found that support the hypothesis that sop reforms are associated with a greater supply of nurses in a state [ 1113 ] . . looked at the supply of pas , nps , and certified nurse midwives ( cnms ) and found a positive correlation between less restrictive nurse practice environments and nurse supply , in practitioners per capita . two subsequent studies [ 12 , 13 ] observed a similar correlation between supply of cnms and less restrictive sop laws . a final study found in paper , an unpublished graduate thesis , looked at the growth in the concentration of nps using county - level data across all states from 2001 to 2005 ( without regard to local sop laws ) . using insurance payment data collected by the agency for healthcare research and quality , the author performed regression analyses to investigate the relationship between growth in np concentration and the probability of being seen by a primary care md ( i.e. , a family practitioner or pediatrician ) when seeking primary care and the relationship between growth in np concentration and earnings for both nps and mds . in counties undergoing high growth in np concentration ( defined as those within the top 25th percentile of np growth over the study period ) , the author found that patients had 16.5% lower odds of seeing a family practitioner or pediatrician than in counties with lower np growth . the author also found that high np growth areas were associated with reimbursement rates 4.42% higher for nps and 3.1% lower for primary care mds . the author concludes that higher np concentrations do exert downward pressure on primary care md wages via the substitution effect described above , but with the qualification that the relatively small number of np observations available for analysis ( some 1.59% of patient visits ) and the relatively small magnitude of the impact on md wages preclude this effect as being a driving force behind the recent shift away from primary and towards specialty care . in order to explore whether a simple association exists between primary care physician wages and expanded aprn sop laws at the state level , we used 2009 annual wage data from the bureau of labor statistics ' ( bls ) occupational employment statistics query system to compare three types of physician practitioners across states with and without expanded scope of practice laws . physicians , who under bls definitions were approximately 70% of all practicing physicians in 2001 and 88% in 2008 [ 16 , 17 ] . the percentage of self - employed physicians has been declining at a rate of approximately 2% per year for at least the past 25 years ( different survey methodologies give different results with regard to physician employment . the cps counts a physician as employed if he or she works any number of hours per week and thus includes a large number of physicians working in academic and administrative capacities . surveys by other organizations ( e.g. , the center for studying health system change and the american medical association ) exclude respondents working under a set number of hours or within particular specialties . thus , the proportion of self - employed physicians given by the cps is the lowest reported , as it includes the greatest number of employed physicians . ) in this analysis , we compare the earnings of primary care physicians ( family and general practice physicians and general pediatricians ) to the earnings of surgeons . we assume that because primary care physicians ' practice overlaps with that of aprns , in particular nurse practitioners , whereas surgeons ' practices do not , any effect on earnings from increased nursing autonomy would appear among the former two groups without effecting surgeons ' incomes . it is important to note that while a small number of aprns may be certified as first assistants in surgery , this is not an area of independent aprn practice and , as such , would not be affected by variations in sop laws . there are indeed likely to be a variety of factors that differ between states that have implemented sop reforms and those that have not . by using a comparison group within the profession and within the same state , however , we are able to account for a wide range of factors that might affect both practitioner groups , such as cost of living , insurance coverage rates in the state , physician density , and percent of population residing in rural areas . for the comparison of states , we selected 14 of the 17 states ( including dc ) that instituted full sop reform prior to the collection of the 2009 data and compared them to the remaining states . of the 14 states considered , six had reforms prior to 1989 , three in 1991 , three in 1992 , and two in 1993 ( table 1 ) . the average earnings of all three practitioner types in these states were compared to the remaining states that retain sop barriers . we asked whether in states where nurses can practice independently of physicians , wages for family and general pediatrician physicians would be reduced relative to those of surgeons , as the latter category would not experience increased competition from nurses . additionally , bls data from 1999 ( the earliest date for which wage data was available for these specific categories of practitioners ) was used to calculate the annual rate of change in wages for all three practitioner groups . figures 1 , 2 , and 3 present our principle findings , with average earnings and one standard deviation displayed by specialist type for each category of states in 2009 . for family and general physicians ( figure 1 ) , average earnings in states without sop barriers ( full sop ) were $ 79.36 per hour , and earnings in states with restrictive sop laws were $ 81.15 . for general pediatricians ( figure 2 ) , earnings in full sop states were $ 83.94 per hour , and earnings in restrictive sop states were $ 78.43 per hour . for surgeons ( figure 3 ) , earnings in full sop states were $ 107.23 per hour , and earnings in restrictive sop states were $ 103.85 . in all three practitioner groups , average earnings in full and restrictive sop states fell within one standard deviation of one another , confirming that , for each group , the variation in earnings between the two types of states is not statistically significant . the annual rate of change in physician earnings over ten years is presented in figure 4 . for family and general physicians , wages rose by 5.73% per year in full sop states and 5.11% per year in restrictive sop states . for general pediatricians , wages rose by 5.61% per year in full sop states and 4.34% per year in restrictive sop states . for surgeons , wages rose by 6.39% per year full sop states and 5.61% per year in restrictive sop states . these data again reveal no statistically significant differences between primary care physicians ( family practice and physicians and general pediatricians ) , whose practice might be in competition with nps in states with more liberal sop laws , and that of surgeons , whose practice does not overlap with that of nps . our findings are descriptive and do not establish causality . however , they suggest that , at least among employed primary care physicians , expanded sop laws do not impact their earnings . perry , both of whom observed effects on both nurse and physician wages following the removal of sop laws . these effects , however , could not be demonstrated to be a direct result of changes in sop laws , and both the magnitude and direction of the effect were different between the two studies . in contrast , our analysis found no significant association between earnings in either direction for the physician groups compared . in fact , wages for all three practitioner groups rose at a slightly faster rate between 1999 and 2009 in states with more liberal sop laws in states with restrictive laws . where competition from nps directly affecting the wages of md via a substitution effect , one would expect to see the reverse a slower rate of wage growth in states where nurses are allowed to compete for primary care dollars . this preliminary analysis suggests that md wages are not affected by changes in sop barriers and/or that the removal of sop barriers has a more nuanced effect on md wages than simple economic substitution . for example , it is possible that , as aprns assume a more independent role in primary care , other primary care providers begin to take on more complex and thus more costly cases . however , the fact that the same trends in wage growth were observed among surgeons as well as primary care physicians also suggests that they were due to factors unrelated to differences in sop laws , as surgeon wages are unlikely to be affected by sop laws . this analysis relied on a comparison of wage data at just two points in time and did not control for other factors ( e.g. , np supply changes , physician density , rates of insurance coverage , and local economic conditions ) . it is therefore possible that the true correlation between sop laws and practitioner earnings was masked by confounders . in addition , it only provides data on employed physicians and excludes self - employed physicians . it also includes a number of employed physicians who work in research and academic settings , whose practice would not be future work should identify and control for known confounders , employ additional years of data to further explore possible relationships between aprn sop reform and practitioner wages , and employ more granular data sets to determine whether wages vary based on physician and practice characteristics . | in recent years , states have looked to reforms in advanced practice nursing scope of practice ( sop ) barriers as a potential means to increase access to primary care while reducing costs .
currently , 16 states and the district of columbia permit advanced practice registered nurses to practice independently of physicians , allowing them to perform functions such as diagnosing and prescribing under their own authority within the primary care setting . given the resistance of many physician associations to these reforms , we asked whether the economic interests of primary care physicians might be affected by reforms . using the bureau of labor statistics data on earnings , we compared primary care physicians ' earnings in states that have instituted sop reforms to those that maintain these practice barriers .
we also compared surgeons ' earnings as a control group .
lastly , we compared the rate of growth in the earnings of primary care physicians and surgeons over the last ten years .
this preliminary analysis revealed no evidence of differences in earnings across the two groups of states . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
for anastomoses to target coronary arteries during coronary artery bypass graft ( cabg ) surgery , different continuous suture techniques have been used . a competent anastomotic technique can achieve satisfactory antegrade and retrograde arterial patency in the anastomotic sites of the target coronary arteries and grafts . here , we introduce a simple technique for obtaining satisfactory anastomosis of coronary arteries and grafts in patients who have small coronary arteries ( < 1.2 mm ) or marked size discrepancies between the target coronary arteries and grafts . for distal anastomosis of the graft to the coronary artery , we used a continuous suture technique with two suture materials . for this method , the graft is anchored to the proximal and distal ends of the coronary arteriotomy with three stitches on each end using two 7 - 0 or 8 - 0 polypropylene monofilaments . the length of the coronary arteriotomy should be 20% shorter than the beveled length of the graft , thus leaving a hood . in detail , the first three - stitch continuous suture is placed counterclockwise at the heel of the graft and at the proximal end of the coronary arteriotomy . after the graft is anchored , two ends of the suture are grasped with two silicone - shod clamps ( fig . next , with the second suture material , the toe of the graft is anchored to the distal end of the coronary arteriotomy , again using the same technique ( continuous counterclockwise stitches ) ( fig . the second suture is continued counterclockwise toward the starting point of the first heel suture and tied ( fig . at this time , three lumens of the anastomosed graft and the proximal and distal ends of the coronary arteriotomy may be carefully checked with a 1-mm flexible probe . the opposite suture line is completed counterclockwise with the other arm of the first heel suture ( fig . the arteriotomy length is approximately 1.5 times the arterial diameter and the graft incision should be 20% longer than the arteriotomy . rather than a continuous technique , the interrupted eight - stitch technique in a diamond configuration is used to avoid the purse - string effect ( fig . in detail , three interrupted sutures using 7 - 0 or 8 - 0 polypropylene monofilament are first placed in the proximal side of the coronary arteriotomy , through the graft , and then tied into place . the remaining five interrupted sutures are then placed at even intervals and tied ( fig . this method can result in a large anastomotic opening associated with satisfactory hemostasis ( fig . for this method , an aortic incision < 1 cm for proximal anastomosis is made with a small ( e.g. , no . 15 ) blade in an appropriate direction , and the distal end of the aortic incision is enlarged with a 3.5-mm aortic punch ( fig . the long - axis of the graft opening should be 1.2 to 1.3 times the aortic incision . the suture technique is the same as the two - suture material technique described above for distal anastomosis . first , the heel of the graft is anchored at the distal end ( punch opening ) of the aortic incision by three continuous stitches ( clockwise in images shown in figs . 3b , c ) , and the toe of the graft is anchored at the other end of the aortic incision by three continuous clockwise stitches using a second suture material ( fig . 3d ) . the remaining continuous stitches should be made in one direction , either clockwise or counterclockwise ( fig . when the stitches are tightened , all graft margins inside the stitches should be inverted into the aortic opening to achieve appropriate hemostasis and a smooth internal lumen ( fig . for distal anastomosis of the graft to the coronary artery , we used a continuous suture technique with two suture materials . for this method , the graft is anchored to the proximal and distal ends of the coronary arteriotomy with three stitches on each end using two 7 - 0 or 8 - 0 polypropylene monofilaments . the length of the coronary arteriotomy should be 20% shorter than the beveled length of the graft , thus leaving a hood . in detail , the first three - stitch continuous suture is placed counterclockwise at the heel of the graft and at the proximal end of the coronary arteriotomy . after the graft is anchored , two ends of the suture are grasped with two silicone - shod clamps ( fig . next , with the second suture material , the toe of the graft is anchored to the distal end of the coronary arteriotomy , again using the same technique ( continuous counterclockwise stitches ) ( fig . the second suture is continued counterclockwise toward the starting point of the first heel suture and tied ( fig . at this time , three lumens of the anastomosed graft and the proximal and distal ends of the coronary arteriotomy may be carefully checked with a 1-mm flexible probe . the opposite suture line is completed counterclockwise with the other arm of the first heel suture ( fig . for sequential graft anastomoses to coronary arteries , the arteriotomy length is approximately 1.5 times the arterial diameter and the graft incision should be 20% longer than the arteriotomy . rather than a continuous technique , the interrupted eight - stitch technique in a diamond configuration is used to avoid the purse - string effect ( fig . in detail , three interrupted sutures using 7 - 0 or 8 - 0 polypropylene monofilament are first placed in the proximal side of the coronary arteriotomy , through the graft , and then tied into place . the remaining five interrupted sutures are then placed at even intervals and tied ( fig . this method can result in a large anastomotic opening associated with satisfactory hemostasis ( fig . for this method , an aortic incision < 1 cm for proximal anastomosis is made with a small ( e.g. , no . 15 ) blade in an appropriate direction , and the distal end of the aortic incision is enlarged with a 3.5-mm aortic punch ( fig . 3a ) . the long - axis of the graft opening should be 1.2 to 1.3 times the aortic incision . the suture technique is the same as the two - suture material technique described above for distal anastomosis . first , the heel of the graft is anchored at the distal end ( punch opening ) of the aortic incision by three continuous stitches ( clockwise in images shown in figs . 3b , c ) , and the toe of the graft is anchored at the other end of the aortic incision by three continuous clockwise stitches using a second suture material ( fig . 3d ) . the remaining continuous stitches should be made in one direction , either clockwise or counterclockwise ( fig . when the stitches are tightened , all graft margins inside the stitches should be inverted into the aortic opening to achieve appropriate hemostasis and a smooth internal lumen ( fig . most anastomotic techniques for cabg surgery are continuous sutures using polypropylene monofilaments . for bypass grafting to small coronary arteries , it may be difficult to achieve patency with continuous sutures in anastomotic sites of the target coronary artery and graft . three stitches anchoring the graft at each end of the coronary arteriotomy can guarantee patency of the proximal and distal coronary arterial lumens . additionally , all stitches are performed in - outward in coronary arteries and out - inward on grafts . anchoring both ends of the graft at the arteriotomy can reduce instrument manipulation to the graft during suturing and produce a concise anastomotic line with even spaces . this suture technique can also be used in proximal anastomosis of the graft to aortic opening with the same advantages . with sequential anastomosis , a continuous suture technique in diamond configuration can cause a purse - string effect , leading to a small anastomotic opening . an alternative interrupted eight - stitch technique is not more time - consuming than the continuous technique or the four - stitch technique . for proximal anastomosis of the graft to aortic opening , a round , wide aortic opening made with a 4.5 to 5.0-mm punch may cause a stretched graft in the aortic opening after anastomosis . a small punch opening ( 3.5-mm ) in the distal end of the aortic incision produces a more concise graft hood . the suture techniques described here are not only useful in small target coronary arteries but also a reliable teaching technique of cabg surgery to inexperienced cardiac surgeons . we have now used this technique for 1 year in approximately 40 patients with variable - sized coronary arteries and who require on - pump cabg surgery and confirmed 100% graft patency on postoperative computed tomography angiograms . | different suture techniques have been used for anastomosis in coronary artery bypass graft surgery .
bypass surgery may be difficult for patients who have small coronary arteries or marked size discrepancies between target coronary arteries and grafts .
for proximal and distal anastomoses , three continuous stitches are first placed in the heel and toe of the small coronary arteries ; for sequential anastomosis , an interrupted eight - stitch technique is used .
we applied these anastomotic suture techniques in patients requiring coronary artery bypass graft surgery , achieving an early angiographic patency rate of 100% . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
nonhuman primates ( nhps ) , with their high level of genetic homology to humans , make them invaluable experimental models for biomedical research ( messaoudi et al . , 2011 , zhang et al . , 2014 ) . however , they are also an increasingly important source of emerging zoonotic diseases in humans , including human immunodeficiency virus ( hiv ) , ebola virus , malaria , etc ( poinar , 2009 , miller et al . , several intestinal parasites occur in nhps , causing asymptomatic or only mild disorders ( karim et al . potentially zoonotic protozoans ( including enterocytozoon bieneusi , giardia duodenalis , cryptosporidium spp . , and entamoeba spp . ) could be maintained and transmitted with the attendant risk of human outbreaks originating in such animal reservoirs ( legesse and erko , 2004 , ye et al . , 2012 ) . the health of nhps is therefore important not only in terms of management objectives , but also concerning public health . compared with developed countries in america and europe , china has relatively rich primate resources and is currently a leading producer and major supplier of nhps to the international market ( zhang et al . , 2014 ) . nhps are commonly maintained in zoos , natural reserves , and zoological gardens by different feeding habitats in china ( karim et al . therefore , it is important to understand the epidemiology of such intestinal parasites and their potential transmission from nhps to humans . the molecular characterization of nhp parasites is increasingly being studied ( berrilli et al . , 2011 , , 2012 , betson et al . , 2014 , li et al . , 2015a , li et al . , 2015b ) , but there is a lack of comprehensive studies on the intestinal parasites in nhps . here , the prevalence of parasites in nhps in china has been reported and the molecular characterization of the enterocytozoon bieneusi , giardia duodenalis , cryptosporidium spp . , and entamoeba spp . this study was conducted in accordance with the chinese laboratory animal administration act ( 1988 ) . the research protocol was reviewed and approved by the research ethics committee of henan agricultural university . appropriate permission was obtained from the director of animals and properties before the samples were collected . veterinarians were notified of the parasitic infections identified in nhps as soon as possible to expedite their management . a total of 3349 fresh fecal specimens were collected from 17 districts in two cities ( beijing and shanghai ) , one autonomous region ( guangxi zhuang autonomous region ) , and eight provinces ( hebei , henan , hubei , hunan , guangdong , sichuan , yunnan , and shanxi ) in china during the period between july 2009 to april 2015 ( fig . 1 ) . 912 fecal specimens were subsequently collected from animals in zoos , 1402 from farms , 918 from free - range , and 117 from those in research laboratories ( table 1 ) . fresh fecal samples from captive nhps , which were kept in separate pens during the day , were collected in the early morning . the specimens from free - living animals were immediately collected from the ground after defecation . each specimen ( about 10 g ) was collected into a plastic container and labelled with the number , district , species , and clinical symptoms of the animal . specimens were transported to the laboratory as soon as possible and stored in 2.5% ( w / v ) potassium dichromate solution at 4 c prior to microscopy . the fecal specimens were sieved through a sieve ( 7.62 cm diameter ) with a pore size of 245 m , transferred into a 50 ml centrifuge tube containing water , and precipitated by centrifugation at 5000 rpm for 10 min . a portion of each specimen was microscopically examined to detect protozoan and helminthic parasites with both sheather 's sugar flotation technique and lugol 's iodine staining ( huang et al . , 2014 ) . wet smears were examined with a bright - field microscope at 100 and 400 magnification to determine the shape , size , and colour of the eggs / cysts . for giardia duodenalis , a total of 1882 fecal specimens from nhps were examined and characterized by ssrrna ( appelbee et al . , 2003 ) , triosephosphate isomerase ( tpi ) ( sulaiman et al . , 2003a ) , glutamate dehydrogenase ( gdh ) ( cacci et al . , 2008 ) and beta - giardin ( bg ) gene ( cacci et al . , 2002 ) . 2660 specimens were identified for cryptosporidium spp . by pcr amplification of the 18s rrna ( xiao et al . , 2001 ) , 70 kda heat shock protein ( hsp70 ) ( xiao and ryan , 2008 ) and genotyped by 60 kda glycoprotein ( gp60 ) gene ( alves et al . , 2003 ) . for enterocytozoon bieneusi , there were a total of 1882 fecal specimens from nhps that were screened and genotyped by ssu rrna its gene ( sulaiman et al . , 2003b ) ; for entamoeba spp . , 531 specimens from 1059 entamoeba spp . positive samples by microscopy , were randomly selected for pcr amplification based on ssu rrna , using the specific primers of e. histolytica ( clark and diamond , 1991 ) , e. dispar ( clark and diamond , 1991 ) , e. moshkovskii ( ali et al . , 2003 ) , e. nuttulli ( verweij et al . , 2001 ) , e. coli ( tachibana et al . , 2009 ) and e. chattoni ( tachibana et al . , 2009 ) in order to identify the molecular characterization . the infection rates were compared with a test , and differences were considered significant at p < 0.01 . eleven genera of intestinal parasites ( five protozoan and six helminths genera ) were found in the nhps ( fig . 2 ) . were the most frequently detected species , with an incidence of 36.4% ( 1218/3349 ) , followed by trichuris spp . the ratio of intestinal parasitic infections ranged from 46.0% to 73.0% among the four feeding habitats ( zoos , farms , free - range , and research laboratories ) ( table 1 ) . the highest infection rate was found in those animals that were the free - range ( 73.0% , 670/918 ) , followed by those in research laboratories ( 63.2% , 74/117 ) , with lower infection rates at zoos ( 46.3% , 422/912 ) and farms ( 46.0% , 645/1402 ) ( p < 0.01 ) . the sample prevalence of infection ranged from 32.6% to 64.8% among the 11 sampling locations . the guangxi zhuang autonomous region had the highest rate ( 64.8% , 566/873 ) , and the lowest was found in guangdong province ( 32.6% , 107/328 ) ( table 2 ) . the majority ( 74.3% , 1345/1811 ) of infected nhps carried one parasitic species , 22.2% ( 402/1811 ) carried two parasitic species , and only 3.5% ( 64/1811 ) carried three or more parasite species ( table 2 ) . the parasites most often involved in mixed infections were entamoeba spp . , trichuris spp . , and strongyloides spp . six families , 20 genera , 34 species of nhps , and 3349 individual specimens were detected , and the infections rates ranged from 0% to 100% in different nhp species ( table 1s ) . 6.5% ( 122/1882 ) of specimens tested for giardia duodenalis were positive by pcr analysis . the assemblages a ( n = 4 ) and b ( n = 118 ) were found , both which have zoonotic potential ( table 3 ) . thirty - two assemblage b isolates with data at all three loci yielded 15 multi - locus genotypes ( mlgs ) ( including 2 known and 13 new ) ( karim et al . the occurrence of giardia duodenalis assemblages in different species of nonhuman primate species are shown in table 2s . for cryptosporidium spp . , 0.7% ( 19/2660 ) were positive by pcr amplification ( karim et al . 73.7% ( 14/19 ) of the positive specimens were found to be cryptosporidium hominis , whilst 26.3% ( 5/19 ) were c. muris . the subtypes of the c. hominis were identified as iba12g3 ( 7/14 ) and iia17 ( 1/14 ) by gp60 gene sequence analysis ( table 4 ) . the occurrence of cryptosporidium spp . and subtypes in nonhuman primate species based on pcr analysis are shown in table 3s . for enterocytozoon bieneusi , there were 16.3% ( 306/1882 ) positive specimens detected by pcr analysis . altogether , 34 its genotypes were observed , including 16 known genotypes ( type iv , d , o , henan v , henan - iv , peru8 , pigebits5 , pigebits7 , ebpa , ebpc , ebpd , peru11 , beb4 , beb6 , i , and cs-1 ) and 18 new genotypes ( cm1 to cm18 ) ( table 5 ) . the new genotypes cm1 to cm3 , cm6 , cm 8 , cm 10 to cm 17 belong to the previously described group 1 , which have zoonotic potential . genotypes cm5 , cm7 , and cm9 clustered with group 2 , whereas genotypes cm4 and cm18 formed new cluster ( karim et al . , 2014b , karim et al . the occurrence of enterocytozoon bieneusi and genotypes in different species of nonhuman primate species are shown in table 4s . for entamoeba spp . , the overall amplification efficiency was 87.19% ( 463 ) among the 531 positive specimens but only entamoeba dispar ( 72.69% , 386/531 ) and entamoeba coli ( 54.05% , 287/531 ) were amplified successfully . the mixed infections with e. dispar and e. coli were 27.1% ( 144/531 ) ( unpublished data ) . this study demonstrates a high sample prevalence ( 54.1% , 1811/3349 ) and diversity ( five protozoan genera and six helminths genera ) of intestinal parasites in nhps in china . similar infection ratio was found in pet macaques ( 59.1% , 52/88 ) in indonesia ( jones - engel et al . , 2004 ) , a zoo in malaysia ( 54.5% , 54/99 ) ( lim et al . , 2008 ) , and pet monkeys in cameroon ( 51.1% , 24/47 ) ( pourrut et al . , 2011 ) . a diversity of intestinal parasites is frequently reported to infect nhps ( jones - engel et al . , 2004 , , 2005 , lim et al . , 2008 , pourrut et al . , 2011 ) . greater parasite species diversity was observed in ta national park , cte divoire ( with nine protozoans and 14 helminths in 3142 specimens ) ( kouassi et al . , 2015 ) . several studies had reported entamoeba spp . as the most prevalent intestinal parasites in nhps ( pourrut et al . , 2011 ) , whereas others reported that strongyloides spp . were the most prevalent ( gillespie et al . , 2005 ) . all five genera of protozoans detected by microscopy , as well as enterocytozoon bieneusi , are zoonotic ( mansfield and gajadhar , 2004 , ye et al . , 2012 , giardia duodenalis is a particularly zoonotic parasitic protozoan that infects a wide range of mammals , including nhps ( feng and xiao , 2011 ) . animals are infected when they ingest food or water contaminated with giardia cysts ( graczyk et al . , 2003 ) . the assemblage b were the nhps host - adaptated , in 96.7% ( 118/122 ) of the positive isolates , which were zoonotic assemblage ( karim et al . , 2015a ) . are usually associated with intestinal pathology , resulting in diarrhea in both humans and animals ( ryan and hijjawi , 2015 ) . they are transmitted via the fecal - oral route by either direct contact or the ingestion of contaminated food or water . the protozoan can disperse rapidly because they have a monoxenous life cycle , a low infective dose , and a short prepatent period ( graczyk et al . however , the prevalence rate found in this study is much lower than that found in sri lanka ( 27.2% , 27/125 ) ( ekanayake et al . , 2006 ) and e. bieneusi is a common parasitic pathogen in nhps with high prevalence ( 16.3% ) which difficult to detect by light microscopy . a lower infection rate ( 12.3% ) of e. bieneusi was reported in kenya ( li et al . , 2011 ) , while higher infection rates ( 28.2% and 18.5% ) were found in free - range macaque monkeys in guizhou and cynomolgus monkeys in guangxi , china , respectively ( ye et al . , 2012 , ye et al . , 2014 ) . altogether , 34 e. bieneusi its genotypes were found involving 26 genotypes ( 263/306 , 86.0% ) belonged to group 1 with zoonotic potential ( karim et al . thus , the genotypes in nhps had zoonotic potential , and nhps could act as reservoirs of human microsporidiosis . the entamoeba spp . had the highest infection rate ( 36.4% ) by microscopy , and was observed in the majority of the nhp species ( 25/34 ) examined ( table 1s ) . they are also known to be a highly prevalent intestinal parasite in ethiopia , uganda , senegal , tanzania , italian , cameroon , etc ( legesse and erko , 2004 , gillespie et al . , 2005 , petrov et al . , 2010 , are human pathogens that are transmitted by various forms of contact due to their direct life cycle ( pedersen et al . , 2005 , although , only e. dispar and e. coli were found in this study ( unpublished data ) which were non - pathogenic species with low risk of zoonotic transmission from nhps to human , the zoonotic transmit also should be pay attention . are obligate intracellular parasites that inhabit the bile duct or intestinal mucosal epithelial cells of various vertebrates ( legua and seas , 2013 ) . until now , 1999 , ortega and sanchez , 2010 , li et al . , 2015b ) and one in humans ( zhou et al . , 2011 ) . the highest prevalence of cyclospora spp . were found in ethiopia ( 22.0% , 13/59 ) ( legesse and erko , 2004 ) . and , cyclospora - like organisms were also detected in monkeys ( zhao et al . the helminths , including trichuris spp . , strongyloides spp . , ascaris spp . , , are parasitic with a high potential for transmission to humans because of their simple life cycles . they have been reported in several populations of primates ( ocaido et al . , 2003 , legesse and erko , 2004 , gillespie et al . , 2005 , bezjian et al . , 2008 , ( table 1s ) , in contrast to the colobus monkeys in cte divoire ( kouassi et al . , 2015 ) . unfortunately , it is difficult to identify the helminths ' species only based on morphology of oocysts or eggs . a comprehensive study of their genetic diversity is necessary to confidently distinguish the species and genotypes of these intestinal parasites . in conclusion , this is an investigation of the parasites in nhps in china , which detailed parasites infection status and reviewed of molecular characterization of four intestinal protozoans . this baseline parasitological data provides important information for the elimination of such parasites and monitor the potential transmission of zoonotic infections from nhps . | parasites are a well - known threat to nonhuman primate ( nhp ) populations , and potentially cause zoonotic diseases in humans . in this study ,
the basic data was provided of the parasites in nhps and the molecular characterization of the enterocytozoon bieneusi , giardia duodenalis , cryptosporidium spp . , and entamoeba spp .
were reviewed , which were found in these samples .
a total of 3349 fecal samples were collected from 34 species reared at 17 districts in zoos , farms , free - range , or research laboratories , and examined microscopically .
eleven genera of intestinal parasites were detected : five genera of protozoans ( isospora spp . ,
entamoeba spp .
, giardia sp . , cryptosporidium spp . , and cyclospora spp . ) and six genera of helminths ( trichuris spp . , strongyloides spp . , ascaris spp . , physaloptera spp . , ancylostoma spp . , and enterobius spp . ) .
the overall sample prevalence of parasitic infection was 54.1% ( 1811/3349 ) .
entamoeba spp . was the most prevalent ( 36.4% , 1218/3349 ) .
the infection rate was the highest in free - range animals ( 73.0% , 670/918 ) ( p < 0.01 ) and guangxi zhuang autonomous region ( 64.8% , 566/873 ) .
mixed infections were mostly detected for entamoeba spp .
, trichuris spp . , and strongyloides spp .. molecular characterization was reviewed of enterocytozoon bieneusi , giardia duodenalis , cryptosporidium spp . , and entamoeba spp .
, as these are zoonotic species or genotypes .
this parasitological data for nhps in china , provides important information for veterinarians and public health authorities for the elimination of such parasites and monitor the potential transmission of zoonotic infections from nhps . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
advanced two - dimensional ( 2d ) technology evolved to three - dimensional ( 3d ) imaging , which is now powerful and gaining momentum . for surgical implants and prosthetics however , at this moment , it seems that this technology may also have found its way in the world of cardiology and cardiovascular surgery . the complex anatomy of heart and vessels needs to be studied and visualized in three dimensions . although 3d images can be obtained accurately , 2d flat screens limit the visualization of 3d content . furthermore , cardiac surgeons operate in a 3d world and rely mostly on 2d imaging for preoperative planning of procedure . 3d prototyping became a feasible technique to overcome this missing gap and is gaining ground as a clinical tool . current applications in cardiology imply printing of the left atrial appendage before percutaneous closure , preoperative planning of transcatheter valve replacement , surgical planning in patients with an aberrant cardiac anatomy , and even 3d printing of custom - made heart valves . we started to print pre- and post - operative 3d - models of complex congenital and structural heart defects , scimitar syndrome , compressed bronchial tree by extreme heart enlargement secondary to congenital heart disease , complex fontan circulation with separated systemic venous return to the left- and right - sided pulmonary artery , multiple pulmonary vein stenosis after catheter ablation for atrial fibrillation , stented native coarctation of the aorta and its relationship to the aortic arch branches , and pulmonary arteriovenous fistula . the purpose of these models was first to study anatomical details , to make a surgical or interventional roadmap , and to re - evaluate the post - procedural result . second , these models were used to explain the complexity of the procedure and to discuss the outcome with the patient . finally , a collection of printed models will have an added value to educate trainees . an adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries ( mapca 's ) was referred to our hospital . in childhood , she had undergone a unifocalization of the left- and right - sided mapca 's , which were connected by a left- and right - sided modified blalock taussig shunt to the systemic circulation . later at repair , a pulmonary homograft was implanted on the right ventricle outflow tract and connected to the left- and right - sided unifocalized mapca 's using the previously applied two small blalock redo surgery was now required to combat the increasing repercussion of the pressure load on the right ventricle because of the undersized conduits ( right ventricle systolic pressure estimated on doppler echocardiography = 80 mmhg ) . at referral , the patient carried 2d contrast computer tomography ( ct ) images of the chest [ video 1 ] . since it was very challenging to understand the underlying pulmonary circulation and its relationship with the bronchial tree , a computer 3d - model was created [ video 2 ] . three hundred eighty - three 2d ct slices of 1 mm were uploaded in 3d modeling software ( amira 3d software , fei corporate , oregon , usa ) . as a first step , an isosurface of all ct slices was created , which represents all points of a constant density within a volume . the threshold for preparing the isosurface was chosen in such a way that the pulmonary vasculature was visualized as precise as possible . unnecessary anatomical structures in the isosurface ( mostly bone tissue ) were manually removed . as a next step , a surface was extracted ( extracting triangles from the module displaying the isosurface ) and exported to a stereolithography ( stl ) file . the final step was to upload the stl file in 3d printing software ( symplify3d , cincinnati , oh , usa ) . the 3d model was printed via leapfrog creatr dual extruder printer ( leapfrog , alphen aan den rijn , the netherlands ) . the 3d model itself was printed in a hard plastic ( acrylonitrile butadiene styrene ) . for supportive printing , polylactic acid was used which was later separated from the final hard plastic 3d model . the model was intended to increase the procedural efficiency . to lower the pulmonary vascular resistance , the surgical plan consisted of replacing the pulmonary homograft and the two undersized conduits and inserting two extra conduits from a new homograft to the distal pulmonary vascular tree . a multidisciplinary team used the printed 3d model to discuss the preoperative procedure in detail and afterward with the patient [ video 3 ] . after surgery [ perioperative figure 1 ] , a second 3d model was created [ video 4 ] , and printed [ figure 2 ] to evaluate and discuss the surgical outcome within the team and with the patient . the methodology to print the second 3d model was similar to the first one with the only difference that 84 2d ct slices of 3 mm were used for reconstruction . it was clear that all conduits were well connected to the distal pulmonary circulation , albeit one conduit was inserted to a slightly narrowed distal vessel . however , pressure load on the right heart decreased significantly ( right ventricle systolic pressure estimated on doppler echocardiography = 50 mmhg ) and the patient 's functional capacity improved markedly . adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries requiring redo surgery to correct increasing repercussion of the pressure load on the right ventricle because of the undersized conduits . perioperative image of the ( surgical field ) chest shows two new left - sided conduits and two new right - sided conduits originating from the replaced homograft ( white arrow ) . adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries requiring redo surgery to correct increasing repercussion of the pressure load on the right ventricle because of the undersized conduits . postoperative three - dimensional print of the heart and pulmonary circulation shows two new left - sided conduits and two new right - sided conduits ( black dotted white arrow ) originate from the replaced homograft ( white arrow ) . better understanding of complex heart or vessel anatomy may result in shorter operation time and perhaps overall better treatment . second , a postoperative model allows re - evaluation of the procedural result in a thorough manner . 3d printed models can be used as didactic tools to educate trainees by easier explaining aberrant anatomical heart and vessel structures . finally , further shortening of the software processing and printing time might open the way for the use of 3d printing in widespread clinical practice . adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries requiring redo surgery to correct increasing repercussion of the pressure load on the right ventricle because of the undersized conduits . preoperative scroll through two - dimensional slices of computer tomography scan images of the chest . heart and pulmonary circulation are filled with contrast adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries requiring redo surgery to correct increasing repercussion of the pressure load on the right ventricle because of the undersized conduits . preoperative three - dimensional reconstruction of the heart and pulmonary circulation shows a left and right blalock taussig conduit originating from the pulmonary homograft and respectively cross over the left and right main bronchus . adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries requiring redo surgery to correct increasing repercussion of the pressure load on the right ventricle because of the undersized conduits . preoperative three - dimensional print of the heart and pulmonary circulation shows a left and right blalock taussig conduit originating from the pulmonary homograft , respectively cross over the left and right main bronchus . adult female patient born with a complex tetralogy of fallot consisting of pulmonary atresia and major aortopulmonary collateral arteries requiring redo surgery to correct increasing repercussion of the pressure load on the right ventricle because of the undersized conduits . postoperative three - dimensional reconstruction of the heart and pulmonary circulation shows two new left - sided conduits and two new right - sided conduits originating from the replaced homograft , respectively cross the left and right main bronchus and are inserted distally into the native pulmonary circulation . | medical imaging has changed to a great extent over the past few decades .
it has been revolutionized by three - dimensional ( 3d ) imaging techniques . despite much of modern medicine relying on 3d imaging , which can be obtained accurately , we keep on being limited by visualization of the 3d content on two - dimensional flat screens .
3d - printing of graspable models could become a feasible technique to overcome this gap .
therefore , we printed pre- and postoperative 3d - models of a complex congenital heart defect . with this example , we intend to illustrate that these models hold value in preoperative planning , postoperative evaluation of a complex procedure , communication with the patient , and education of trainees . at this moment
, 3d printing only leaves a small footprint , but makes already a big impression in the domain of cardiology and cardiovascular surgery .
further studies including more patients and more validated applications are needed to streamline 3d printing in the clinical setting of daily practice . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
small bowel disease is inherently difficult to diagnose as the small bowel is the longest section of the gastrointestinal tract ( approximately 3 to 6 m in length ) and is twisted between the stomach and the colon . however , recent advances in endoscopic and imaging systems have enabled systematic investigation of small bowel diseases such as unexplained gastrointestinal bleeding , inflammatory bowel disease , and small bowel tumors and obstruction . these advances have further helped to significantly reduce the use of invasive surgical approaches , which have traditionally been considered the standard approach . in this review , we discuss a systematic approach for patients with suspected small bowel disease based on these advanced endoscopic and imaging systems . obscure gastrointestinal bleeding ( ogib ) is defined as overt or occult bleeding of unknown origin that persists or recurs after initial upper endoscopic and colonoscopic examinations , as well as after imaging work - up for the small bowel . this type of bleeding accounts for approximately 5% of all cases of gastrointestinal bleeding and generally occurs in the small bowel . overt ogib refers to visible bleeding that can manifest as hematemesis , melena , or hematochezia ; whereas occult ogib refers to a positive fecal occult blood test result that may or may not be associated with iron deficiency anemia in the absence of any evidence of visible blood loss . in the past , it has been difficult to assess ogib using diagnostic and therapeutic approaches and in certain cases , surgery or intraoperative enteroscopy have been required . recently , the development of video capsule endoscopy ( vce ) and device - assisted enteroscopy ( dae ) has made detailed observation of the mucosa of the small bowel possible . moreover , the introduction of computed tomography ( ct ) and magnetic resonance ( mr ) enterography has helped improve the accuracy of ogib diagnosis . the first approach for ogib is to perform a second - look upper endoscopy and colonoscopy , with or without push enteroscopy . when studies of initial upper endoscopic and colonoscopic examinations are performed , certain factors ( such as intermittent lesion bleeding , impaired visibility due to insufficient bowel preparation , lack of examiner skill and/or experience , and delayed examination after initial symptoms ) can hinder the identification of lesions . in previous studies , the diagnostic rates of second - look endoscopy and colonoscopy have ranged from 3.5% to 25% . if the results of the second - look investigations are normal , the next step is typically an assessment for small bowel . vce is recommended as a first - line investigation for small bowel bleeding , as this technique allows for noninvasive assessment of the entire small bowel in 79% to 90% of all patients . the european society of gastrointestinal endoscopy guidelines currently recommend that vce could be performed as soon as possible after the first bleeding episode in patients with overt ogib , ideally within 14 days . recent studies have reported a vce diagnostic rate of 60% to 83% , a vce positive predictive value of 94% to 97% , and a vce negative predictive value of 83% to 100% . situations where vce findings lead to endoscopic or surgical intervention or a change in medical management have previously been reported in 37% to 87% of patients . in addition , one study found that 50% to 66% of all patients who underwent vce - directed interventions remained free from recurrent bleeding at follow - up . in patients with positive vce findings , it is helpful to decide on the approach ( oral vs. anal ) prior to performing dae . vce is very well tolerated by patients , with the primary complication of capsule retention occurring in only 1.4% to 3% of patients . one meta - analysis found that the diagnostic yield of vce was comparable to that of dae for small bowel diseases , including ogib . while vce does have some limitations , such as a lack of therapeutic capability and challenges in localizing the lesion , this technique has been proposed as the first - line approach for the evaluation of small bowel bleeding . techmetium-99 m ( tc)-labeled red blood cell scans are useful for assessing recurrent overt bleeding . moreover , meckel scans using tc - pertechnetate are informative for evaluating meckel s diverticulum in young patients with ogib . angiography is useful for detecting and treating active bleeding foci and vascular lesions ; however , this technique can only accurately diagnose the bleeding focus when the bleeding rate exceeds 0.5 ml / min . a meta - analysis of 18 studies found that the diagnostic yield of ct enterography was 40% , whereas that of vce was 53% . a further two studies ( n=63 ) have previously reported a diagnostic rate of ct enterography of 38% , compared with 78% for double - balloon enteroscopy . moreover , three previous studies ( n=49 ) found a diagnostic yield of ct enterography of 64% , compared with 60% for angiography [ 19 - 21 ] . therefore , ct enterography and vce are considered complementary examinations to be performed prior to dae for patients with ogib . vce should always be considered for patients with occult or overt ogib and based on vce findings , dae and surgical approaches may then be considered . however , in patients with strictures or obstructions , ct or mr enterography should be considered as the first - line approach . conversely , in hemodynamically stable patients with evidence of current bleeding , vce and/or dae are recommended . intraoperative enteroscopy is an option during uncontrolled severe bleeding or in cases where the bleeding focus can not be identified by dae . up to 66% of all patients with crohn s disease have small bowel involvement at diagnosis ; moreover , the terminal ileum is involved in approximately 90% of all patients with small bowel crohn s disease . patients with nonsteroidal anti - inflammatory drug - induced enteropathy can generally be evaluated by upper endoscopy ; however , if the lesions are located in the small bowel , diagnostic approaches are difficult and vce , dae , or ct / mr enterography are required . vce is a useful diagnostic modality for crohn s disease in patients with suspected inflammatory bowel disease or intermediate colitis . a recent meta - analysis reported a pooled detection rate of 55.3% in patients with suspected crohn s disease . in a retrospective review of vce performed in patients with crohn s disease , 52 of 134 patients had findings diagnostic of active crohn s disease ( > 3 ulcerations ) , 17 patients had findings suggestive of active crohn s disease ( 3 ulcerations ) , and findings were normal in the remaining 57 patients ( 42% ) . when vce findings are normal , unnecessary examination of the small bowel can be avoided . in the same retrospective review , the distribution of small bowel lesions was as follows : 32% in the duodenum , 53% in the jejunum , 67% in the proximal ileum , and 85% in the distal ileum . vce was found to be comparable to ileoscopy for the detection of ileal ulcerations ( 55% vs. 48% ) , but superior to small bowel follow - through for the detection of crohn s disease lesions . although vce has been shown to have high sensitivity ( 96% to 100% ) , vce should be avoided in patients with suspected crohn s disease in conjunction with stenosis or obstruction , as these patients may have a higher potential for capsule retention . if patients with suspected crohn s disease present with obstructive symptoms or suspected stenosis , ct / mr enterography should be considered as the method of choice . patency capsules can also be helpful in patients with suspected crohn s disease in conjunction with obstruction or stenosis . in summary , the first - line approach in patients with suspected small bowel inflammatory disease is evaluation of the terminal ileum , including investigation and biopsy by colonoscopy . if it is not possible to evaluate the terminal ileum by colonoscopy , the small bowel should be assessed . vce is a useful method for evaluating the small bowel ; however , it is important to examine the small bowel for obstruction or stenosis prior to performing vce . when clinically suspected obstructions are present , the use of ct / mr enterography or patency capsules should be considered . additionally , histologic evaluation can be performed using dae , based on vce or ct / mr enterography findings ( fig . both malignant ( such as adenocarcinoma , carcinoid tumors , lymphoma , and sarcoma ) and benign ( such as adenoma , leiomyoma , fibroma , and lipoma ) tumors can occur in the small bowel . most small bowel tumors are detected during work - up for ogib or iron deficiency ; however , tumors are the cause of these diseases in just 3.5% to 5% of patients . the clinical symptoms of small bowel tumors are generally nonspecific , which can delay diagnosis and optimal treatment . although many advances in radiologic and endoscopic diagnostic tools have been made , an optimal method for detecting small bowel tumors has not yet been established . vce and ct enterography are considered the most appropriate tools for detecting small bowel tumors in their early stages , whereas dae is considered most appropriate for detecting small bowel tumors responsible for ogib and those that are not identified by vce . upper gastrointestinal or small bowel series are not recommended as a first - line approach considering the low sensitivity of these methods for the detection of small bowel tumors . large - scale meta - analyses have concluded that vce is superior to small bowel series , push enteroscopy , and abdominal ct for detecting small bowel tumors in patients with gastrointestinal bleeding . moreover , a recent retrospective study found that ct enterography was superior to vce for the detection of small bowel tumors ( 94.1% vs. 35.3% ) . vce itself does have some limitations , including the potential for misdiagnosis of transient intraluminal protrusions of the small bowel wall as submucosal tumors . the risk of false negative findings in vce should always be considered . when small bowel adenocarcinoma is suspected , dae or intraoperative enteroscopy may be required . vce is unable to differentiate between benign and malignant lesions , especially in patients with inherited polyposis syndrome who have periampullary polyps . when a small bowel tumor is detected using vce , choice of treatment is generally based on the malignancy potential of the tumor . when the potential for malignancy is high , dae or surgery should be performed to diagnose and treat the tumor . if the findings of ct / mr enterography are normal , repeated vce is recommended ( fig . small bowel obstruction is a common clinical condition , the effective treatment of which is dependent on an accurate and prompt diagnosis . this technique is also helpful for determining which patients would benefit most from conservative treatment and close observation or an immediate surgical treatment approach . however , conventional ct is less accurate in cases of low - grade small bowel obstruction , with a sensitivity and specificity of 50% and 95% , respectively . in comparison , ct enteroclysis with positive enteral contrast material has a superior performance , with a sensitivity and specificity of 89% and 100% , respectively . recent advances in vce , dae , and ct / mr enterography have facilitated a systematic approach toward evaluating small bowel disease . both diagnostic and therapeutic approaches are necessary when taking the particular limitations and capabilities of each into consideration ( table 1 ) . in summary , vce is recommended in patients without symptoms of obstruction or stenosis , whereas ct / mr enterography or dae is recommended for patients with suspected small bowel tumors or obstruction . future studies and new diagnostic tools promise to pave the way for even more accurate and sensitive diagnostic approaches . | while the domain of gastrointestinal endoscopy has made great strides over the last several decades , endoscopic assessment of the small bowel continues to be challenging .
recently , with the development of new technology including video capsule endoscopy , device - assisted enteroscopy , and computed tomography / magnetic resonance enterography , a more thorough investigation of the small bowel is possible . in this article
, we review the systematic approach for patients with suspected small bowel disease based on these advanced endoscopic and imaging systems . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
we present a case of a 57-year - old woman patient with a history of mid - aortic syndrome , treated with several vascular procedures , who was referred for investigation of metastatic disease of an undifferentiated sarcoma of unknown origin . positron emission tomography / computed tomography ( pet / ct ) demonstrated multiple fluorodeoxyglucose ( f - fdg ) avid lung , liver , and osseous metastases as well as a focus of increased f - fdg uptake in the area of the stented left renal artery . histologic evaluation of soft tissue from the region of the left renal artery revealed atypical spindle cells , consistent with an intimal sarcoma , and with histopathological characteristics identical to those of lung metastases , indicating the f - fdg avid lesion in the area of the renal artery as the origin of the metastatic disease . this case highlights the capacity of f - fdg pet / ct to detect primary tumors even of small size and in unusual localisations . moreover , it provides further indications regarding the potential association between foreign body reaction on the basis of chronic inflammation and sarcoma development . intimal sarcomas are very rare malignant mesenchymal tumors arising in large arterial blood vessels with a poor prognosis . the association between intimal sarcoma development and chronic foreign body reaction due to vascular prosthesis has been described . fluorodeoxyglucose ( f - fdg ) positron emission tomography / computed tomography ( pet / ct ) is an imaging modality with high negative predictive value and specificity in detecting adult soft tissue sarcoma . however , few reports have indicated the capacity of f - fdg pet / ct to detect intimal sarcoma in different sites . herein , we present a case of an intimal sarcoma arising in the site of a multiple stented renal artery detected with f - fdg pet / ct . a 57-year - old woman patient with a history of mid - aortic syndrome , treated with several vascular procedures of the aorta and the renal arteries underwent chest computed tomography ( ct ) due to dyspnea . histologic evaluation of a lung lesion , excised for diagnostic purposes , showed atypical spindle cells , consistent with metastases of an undifferentiated sarcoma of unknown origin . the patient was then referred to our department for f - fdg pet / ct for further investigation . f - fdg pet / ct demonstrated increased tracer uptake in the lung metastases as well as several f - fdg avid lesions in the liver and the pelvis skeleton compatible with multisystemic involvement of the metastatic disease . no evidence of a definite primary tumor was demonstrated with the exception of a focus of increased f - fdg uptake in the area of the stented left renal artery , higher than expected in a usual foreign body reaction due to vascular prosthesis ( fig . histopathological evaluation of soft tissue from the left renal artery revealed a perivascular area with atypical spindle cells consistent with an intimal sarcoma , and with histopathological characteristics identical to those of the lung metastasis , indicating the f - fdg avid lesion in the area of the stented renal artery as the origin of the metastatic disease ( fig . transaxial f - fdg pet / ct at the level of the abdominal aorta branching in the left renal artery ( a ) , the lungs ( b ) , the liver ( c ) , and the pelvis ( d ) . focally increased f - fdg uptake in the region of the stented left renal artery ( arrow ) , with higher f - fdg accumulation than expected in a usual foreign body reaction , proved to be an intimal sarcoma . physiological , diffuse tracer uptake in the abdominal aortic graft , compatible with foreign - body reaction due to aortic graft replacement 1 year ago on the ground of mid - aortic syndrome ( a ) . f - fdg positive lung metastasis in the left lower lobe ( arrow ) ( b ) . multiple f - fdg avid metastases in the liver ( arrow ) ( c ) . focal f - fdg accumulation in an osseous metastasis in the right post acetabulum ( arrow ) ( d ) . f - fdg = fluorodeoxyglucose , pet / ct = positron emission tomography / computed tomography . histologic image of the tissue in the area of the left renal artery stained with hematoxylin and eosin ( he stain ) , showing an infiltration of atypical spindle cells around a vessel - like structure ( a ) . ( b ) magnification of the atypical spindle cells . histologic image of the lung wedge resection ( he stain ) with a centrally necrotic metastasis of a sarcoma without evidence of a specific lineage differentiation ( c ) . the patient written informed consent was waived due to the retrospective nature of the presented case . intimal sarcomas are very rare , malignant mesenchymal tumors of large arterial blood vessels with an often unspecific clinical presentation and a poor prognosis . intimal sarcomas have been reported to arise in association with vascular prostheses suggesting a tumor inducing effect of foreign material on the endothelium . in this case report the development of an intimal sarcoma in a multiple stented renal artery due to mid - aortic syndrome is presented . to our knowledge , no case from intimal sarcoma in the area of the renal artery with a history of stenting has been described using f - fdg pet / ct . although a direct causal relation can not be proven , this case provides further indications regarding the potential association between sarcoma development and chronic foreign body reaction due to vascular prosthesis . vascular prostheses show physiologically increased f - fdg uptake in the graft material , even years after surgery without having a graft infection , most likely on the basis of a chronic inflammation proven to take place on the surface of such material . this knowledge could erroneously lead us to the assumption that the increased tracer uptake in the area of the stented renal artery is a foreign - body reaction manifestation . therefore , caution is suggested in the interpretation of foreign body reaction in f - fdg pet in patients with cancer of unknown primary origin and a history of repeated vascular prostheses . | abstractbackground : we present a case of a 57-year - old woman patient with a history of mid - aortic syndrome , treated with several vascular procedures , who was referred for investigation of metastatic disease of an undifferentiated sarcoma of unknown origin.methods:positron emission tomography / computed tomography ( pet / ct ) demonstrated multiple fluorodeoxyglucose ( 18f - fdg ) avid lung , liver , and osseous metastases as well as a focus of increased 18f - fdg uptake in the area of the stented left renal artery.result:histologic evaluation of soft tissue from the region of the left renal artery revealed atypical spindle cells , consistent with an intimal sarcoma , and with histopathological characteristics identical to those of lung metastases , indicating the 18f - fdg avid lesion in the area of the renal artery as the origin of the metastatic disease.conclusion:this case highlights the capacity of 18f - fdg pet / ct to detect primary tumors even of small size and in unusual localisations .
moreover , it provides further indications regarding the potential association between foreign body reaction on the basis of chronic inflammation and sarcoma development . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
it typically improves in the weeks and months after stroke , yet about 50% of patients are left with long - term residual deficits . few studies have documented the possibility of treatment - induced improvements in post - stroke language functions after 12 months . traditionally , aphasia interventions utilize compensatory communication strategies to assist the participant in immediate communication needs . multi - modal strategies include gesturing , writing , drawing , and augmentative low- and high - technology systems , with a common expectation that use of the alternative communication techniques will decrease naturally as the language capabilities increase . these interventions improve overall communication abilities , but questions have been asked whether they contribute to the recovery of language function , or whether they actually contribute to a learned non - use phenomenon . to counteract the possibility of learned non - use , therapies utilizing restraint have been developed to mirror constraint - induced motor therapies . while it is relatively easy to restrain an unaffected extremity in motor therapies , restraining attempts to communicate non - verbally can be more difficult . constraint - induced aphasia therapy ( ciat ) encourages intensive verbal practice with supported verbal cuing while excluding the use of previously habitual compensatory strategies . in ciat , the theoretical model of taub s motor system for use - dependent cortical re - organization has been applied to a language - based program . in this model , it has been postulated that the behavior of attempting to speak without success leads to communication frustration . this then results in fewer speaking attempts , more reliance on compensatory strategies , and less cortical stimulation in the language areas . the ciat framework provides a structured supportive environment , with clinician guidance and shaping , positive reinforcement from group members , and social interaction opportunities . the theory is that the supportive environment and speaking opportunities will encourage more verbal attempts and stimulate cortical reorganization . thus , the goal of the present study was to provide evidence for the potential efficacy of ciat when compared to no - intervention in patients with chronic ( > 1 year ) post - stroke aphasia . more specifically , this randomized , controlled , blinded pilot study was conducted in order to estimate effect sizes , allowing the design of an appropriately powered trial . subjects were recruited into this institutional review board - approved study by word of mouth from among the stroke and aphasia clinics at the university of cincinnati and university of alabama at birmingham , and from local aphasia support groups . we also listed the study on www.clinicaltrials.gov ( registered nct00843427 ; pi : szaflarski ) , and several contacts were received directly from patients . after providing consent for screening , the inclusion criteria were chronic aphasia related to a single ischemic stroke in the left middle cerebral artery ( lmca ) distribution ( i.e. , diagnosis of a single lmca stroke was confirmed by medical record review including admission notes for the incident stroke and the results of brain imaging obtained prior to enrollment ) , token test in an impaired range ( score 40 ) , and pre - stroke fluency in english . the exclusion criteria were history of degenerative ( e.g. , dementia or parkinson s disease ) or metabolic disorder ( e.g. , encephalopathy ) or supervening illness ( e.g. , brain tumor or other cancer ) , history of severe depression or other mental illness , and positive pregnancy test in women of childbearing age . five potential participants were excluded after interview . the format and the goals of the ciat program all patients indicated their understanding of the goals of the program prior to signing the informed consent ; they also understood that they may be randomized to a no - intervention group , and that the follow - up testing will need to be performed . of the 27 who were offered participation , 3 were excluded before randomization : 2 had a normal token test and 1 was hospitalized for reasons unrelated to the study . fourteen subjects were randomized to receive ciat ( 34 participants per group ; 4 groups were assembled ) and 10 to receive no - intervention ( figure 1 ) . demographic and clinical data of the participants are provided in table 1 . after obtaining the informed consent , we initially screened the patients for the presence of aphasia with token test ( tt ) and categorized the severity of aphasia as mild ( tt=40 - 37 ) , moderate ( tt=36 - 17 ) or severe ( tt=16 - 0 ) . responders were defined as patients with at least a 20% relative improvement in at least 2 of the 5 primary scores in the 2-week period . retainers were those patients whose 12-week score was not less than the 2-week score on at least 2 of the 5 outcome measures . the 2-week ciat protocol was a closely monitored , individualized program embedded within a larger group activity . to ensure consistency of the intervention training ( approximately 46 hours ) was conducted by alb prior to initiating any intervention session including basic theory of learned non - use , and the procedures for the treatment . clinicians also viewed sample videos that exemplified the nature and set - up of the ciat intervention , and they were taught a hierarchy of cues that ranged from most to least supportive ( e.g. , imitation to verbal reminder ) . during the first day of intervention , clinicians had no information on participants abilities as , by design , they did not participate in the initial evaluations . the measures were administered by coordinators who were blinded to group assignment ( figure 1 ) . to enhance the chance for successful implementation of cues during the ciat sessions , clinicians maintained a cuing tracking form that described the interaction between another clinician and their participant partners . the types of cues provided were tracked with a binary notation of whether the cuing resulted in a successful communication . this technique of behaviorally monitoring another clinician rather than self - monitoring was established in our previous study . clinicians and participants were rotated during each day s session in order to provide a balance in communication partners . at the end of day 1 , alb studied the cuing tracking forms and the videos to create an individual treatment plan for the next day s session . the treatment plan included identifying individual baseline linguistic strengths , suggested hierarchy of most beneficial cues , behaviors to constrain , and specific linguistic targets or goals . the treatment plan was reviewed with the clinicians before the second day of therapy . from the second day onwards , clinicians promoted individualized support with cues at a linguistic level suitable for each person and continued data tracking . each day , clinicians reviewed the individual program and levels and made adjustments as needed . at the beginning of each session day , the clinicians reminded each participant of the goals and constraints that had been established for them . for example , a participant who was strong in producing nouns , but limited in verbs , had a goal to add a verb to create a 2-word phrase . if a participant demonstrated a milder aphasia , then the d - level hierarchy of sentences was implemented . the treatment program for each of the 34 participant groups lasted 2 weeks , with direct therapy for about 4 hours per day for 10 consecutive weekdays . the sessions were organized into 4 45-minute periods , with a 1015 minute break in between each session . socialization between clients and clinicians was encouraged throughout the program , even during the break periods . at the beginning of each session , participants were dealt cards and they were instructed to play a go - fish type game . the cards provided the opportunity for the participants to interact with each other during an ongoing game that engaged participants visual , attention , and memory skills , although these were not specifically targeted . the cards provided visual stimuli of line drawings of nouns ( singular , plural to elicit numbers , and with colors ) and photos of action verbs . clinicians were encouraged to use redirecting phrases such as try again and are you sure ? rather than using negative responses . if the other participants responded positively and the communicative exchange was successful , clinicians were instructed not to correct ; communicative success is more important than the sentence accuracy . whenever clinicians were observed to manage cards for the participant , this was discouraged ; clinicians were trained to be supportive while encouraging independence . consistent with the current standards of care , the no - intervention group did not receive any specific treatment and the participants were asked to continue all previous activities as usual . all participants were asked not to take part in any other intervention during their involvement in the study and all complied . patients were randomized by the study statistician ( cjl ) after the patients received all pre - requisite activities ( consenting , clinical record review , neuropsychological aphasia testing ( nat ) ) . patients were assigned to receive either 2 weeks of ciat , or no - intervention , and then to undergo nat within one week and 3 months of ciat completion ( figure 2 consort diagram ) . we used a simple scheme that randomized each block of patients to either ciat or control . randomization occurred after consent , and with the statistician blinded to participant performance on screening and baseline testing . we did not replace subjects who do not complete the full 2 weeks of therapy . after randomization , sealed study charts containing all pre - intervention testing results ( nat ) were funneled through the study biostatistician ( cjl ) to the therapists . therapists set up the intervention groups so that the coordinators ( cb , anm ) who collected all nat data throughout the study remained blinded to group assignment . participants were asked not to reveal their group assignment to coordinators during the post - treatment interactions . all participants received nat which included : ( 1 ) the boston naming test ( bnt ) , ( 2 ) the controlled oral word association test , ( 3 ) the semantic fluency test ( sft ) , ( 4 ) the complex ideation subtest from the boston diagnostic aphasia examination ( bdae ) , ( 5 ) the peabody picture vocabulary test iii ( ppvt iii ) , and ( 6 ) the mini - communicative activities log ( mini - cal ) which is a subjective measure of communicative abilities . the study coordinators , who were extensively trained in the use of these measures and blinded to group assignment , administered the nat measures within 1 week prior to ciat and again during both the first week the twelfth week following ciat completion . all data were entered into redcap ( research electronic data capture ) for subsequent analysis . one patient did not complete the 12 week visit or testing , and 7 additional patients were missing at least 1 nat score . the primary analysis used independent samples t - tests to examine the differences in nat scores at each time point between the intervention and control groups , and effect sizes and 95% confidence intervals were calculated . the secondary analysis was an ad hoc analysis comparing the characteristics of patients who demonstrated a response or change in nat scores to patients who did not . independent t - tests , the mann - whitney u test , and fisher s exact test were used to compare patient characteristics between patients who demonstrated a response or change and patients who did not . all statistical analyses were conducted using spss 22.0 ( ibm corporation , armonk , ny ) and r 2.15.3 ( base package ) . subjects were recruited into this institutional review board - approved study by word of mouth from among the stroke and aphasia clinics at the university of cincinnati and university of alabama at birmingham , and from local aphasia support groups . we also listed the study on www.clinicaltrials.gov ( registered nct00843427 ; pi : szaflarski ) , and several contacts were received directly from patients . after providing consent for screening , the inclusion criteria were chronic aphasia related to a single ischemic stroke in the left middle cerebral artery ( lmca ) distribution ( i.e. , diagnosis of a single lmca stroke was confirmed by medical record review including admission notes for the incident stroke and the results of brain imaging obtained prior to enrollment ) , token test in an impaired range ( score 40 ) , and pre - stroke fluency in english . the exclusion criteria were history of degenerative ( e.g. , dementia or parkinson s disease ) or metabolic disorder ( e.g. , encephalopathy ) or supervening illness ( e.g. , brain tumor or other cancer ) , history of severe depression or other mental illness , and positive pregnancy test in women of childbearing age . five potential participants were excluded after interview . the format and the goals of the ciat program all patients indicated their understanding of the goals of the program prior to signing the informed consent ; they also understood that they may be randomized to a no - intervention group , and that the follow - up testing will need to be performed . of the 27 who were offered participation , 3 were excluded before randomization : 2 had a normal token test and 1 was hospitalized for reasons unrelated to the study . fourteen subjects were randomized to receive ciat ( 34 participants per group ; 4 groups were assembled ) and 10 to receive no - intervention ( figure 1 ) . after obtaining the informed consent , we initially screened the patients for the presence of aphasia with token test ( tt ) and categorized the severity of aphasia as mild ( tt=40 - 37 ) , moderate ( tt=36 - 17 ) or severe ( tt=16 - 0 ) . responders were defined as patients with at least a 20% relative improvement in at least 2 of the 5 primary scores in the 2-week period . retainers were those patients whose 12-week score was not less than the 2-week score on at least 2 of the 5 outcome measures . the 2-week ciat protocol was a closely monitored , individualized program embedded within a larger group activity . to ensure consistency of the intervention , all clinicians completed a training program . training ( approximately 46 hours ) was conducted by alb prior to initiating any intervention session including basic theory of learned non - use , and the procedures for the treatment . clinicians also viewed sample videos that exemplified the nature and set - up of the ciat intervention , and they were taught a hierarchy of cues that ranged from most to least supportive ( e.g. , imitation to verbal reminder ) . during the first day of intervention , clinicians had no information on participants abilities as , by design , they did not participate in the initial evaluations . the measures were administered by coordinators who were blinded to group assignment ( figure 1 ) . to enhance the chance for successful implementation of cues during the ciat sessions , clinicians maintained a cuing tracking form that described the interaction between another clinician and their participant partners . the types of cues provided were tracked with a binary notation of whether the cuing resulted in a successful communication . this technique of behaviorally monitoring another clinician rather than self - monitoring was established in our previous study . clinicians and participants were rotated during each day s session in order to provide a balance in communication partners . at the end of day 1 , alb studied the cuing tracking forms and the videos to create an individual treatment plan for the next day s session . the treatment plan included identifying individual baseline linguistic strengths , suggested hierarchy of most beneficial cues , behaviors to constrain , and specific linguistic targets or goals . the treatment plan was reviewed with the clinicians before the second day of therapy . from the second day onwards , clinicians promoted individualized support with cues at a linguistic level suitable for each person and continued data tracking . the tracking provided constant reminders to only provide cues that resulted in successful communication . each day , clinicians reviewed the individual program and levels and made adjustments as needed . at the beginning of each session day , the clinicians reminded each participant of the goals and constraints that had been established for them . for example , a participant who was strong in producing nouns , but limited in verbs , had a goal to add a verb to create a 2-word phrase . if a participant demonstrated a milder aphasia , then the d - level hierarchy of sentences was implemented . the treatment program for each of the 34 participant groups lasted 2 weeks , with direct therapy for about 4 hours per day for 10 consecutive weekdays . the sessions were organized into 4 45-minute periods , with a 1015 minute break in between each session . socialization between clients and clinicians was encouraged throughout the program , even during the break periods . at the beginning of each session , participants were dealt cards and they were instructed to play a go - fish type game . the cards provided the opportunity for the participants to interact with each other during an ongoing game that engaged participants visual , attention , and memory skills , although these were not specifically targeted . the cards provided visual stimuli of line drawings of nouns ( singular , plural to elicit numbers , and with colors ) and photos of action verbs . clinicians were encouraged to use redirecting phrases such as try again and are you sure ? rather than using negative responses . if the other participants responded positively and the communicative exchange was successful , clinicians were instructed not to correct ; communicative success is more important than the sentence accuracy . whenever clinicians were observed to manage cards for the participant , this consistent with the current standards of care , the no - intervention group did not receive any specific treatment and the participants were asked to continue all previous activities as usual . all participants were asked not to take part in any other intervention during their involvement in the study and all complied . patients were randomized by the study statistician ( cjl ) after the patients received all pre - requisite activities ( consenting , clinical record review , neuropsychological aphasia testing ( nat ) ) . patients were assigned to receive either 2 weeks of ciat , or no - intervention , and then to undergo nat within one week and 3 months of ciat completion ( figure 2 consort diagram ) . we used a simple scheme that randomized each block of patients to either ciat or control . randomization occurred after consent , and with the statistician blinded to participant performance on screening and baseline testing . we did not replace subjects who do not complete the full 2 weeks of therapy . after randomization , sealed study charts containing all pre - intervention testing results ( nat ) were funneled through the study biostatistician ( cjl ) to the therapists . therapists set up the intervention groups so that the coordinators ( cb , anm ) who collected all nat data throughout the study remained blinded to group assignment . participants were asked not to reveal their group assignment to coordinators during the post - treatment interactions . all participants received nat which included : ( 1 ) the boston naming test ( bnt ) , ( 2 ) the controlled oral word association test , ( 3 ) the semantic fluency test ( sft ) , ( 4 ) the complex ideation subtest from the boston diagnostic aphasia examination ( bdae ) , ( 5 ) the peabody picture vocabulary test iii ( ppvt iii ) , and ( 6 ) the mini - communicative activities log ( mini - cal ) which is a subjective measure of communicative abilities . the study coordinators , who were extensively trained in the use of these measures and blinded to group assignment , administered the nat measures within 1 week prior to ciat and again during both the first week the twelfth week following ciat completion . all data were entered into redcap ( research electronic data capture ) for subsequent analysis . one patient did not complete the 12 week visit or testing , and 7 additional patients were missing at least 1 nat score . missing scores were left missing , and are excluded from analysis . the primary analysis used independent samples t - tests to examine the differences in nat scores at each time point between the intervention and control groups , and effect sizes and 95% confidence intervals the secondary analysis was an ad hoc analysis comparing the characteristics of patients who demonstrated a response or change in nat scores to patients who did not . independent t - tests , the mann - whitney u test , and fisher s exact test were used to compare patient characteristics between patients who demonstrated a response or change and patients who did not . all statistical analyses were conducted using spss 22.0 ( ibm corporation , armonk , ny ) and r 2.15.3 ( base package ) . there were 24 patients enrolled in the study , 14 in the intervention group , and 10 in the control group ( see consort diagram ) . two patients in the intervention group did not complete the study , 1 due to lack of transportation and 1 due to hospitalization with an illness unrelated to the study . overall , there were no significant differences in demographic characteristics and past medical history between the 2 groups ( table 1 ) . the mean age was 57 ( sd11 ) years in the intervention group and 51 ( sd13 ) years in the control group . most patients were caucasian , 10/14 ( 71% ) in the intervention group and 9/10 ( 90% ) in the control group . there were few statistically significant differences in nat scores between the intervention and control groups ( table 2 ) . specifically , differences were observed in subjective communication abilities assessed with the mini - cal . patients who received ciat scored higher on the mini - cal at 12 weeks after intervention compared to the control group ( mean 31 vs. 23 ; difference=8 , 95% ci 1.3 to 13.5 , p=0.019 ) . the sft was marginally higher 2 weeks after intervention in ciat patients than controls ( mean 21 vs. 12 ; difference 9 , 95% ci 0.3 to 17.8 , p=0.058 ) . overall , 5/24 ( 21% ) of participants could be classified as a responders , as defined in the methods section . responders were less likely to have a history of hypertension 0/5 ( 0% ) , compared to non - responders 10/14 ( 53% ) , p=0.053 . of the 5 patients who demonstrated a change in nat scores during the course of the study , only 1 ( 20% ) retained the change at the twelve - week visit . there were 24 patients enrolled in the study , 14 in the intervention group , and 10 in the control group ( see consort diagram ) . two patients in the intervention group did not complete the study , 1 due to lack of transportation and 1 due to hospitalization with an illness unrelated to the study . overall , there were no significant differences in demographic characteristics and past medical history between the 2 groups ( table 1 ) . the mean age was 57 ( sd11 ) years in the intervention group and 51 ( sd13 ) years in the control group . most patients were caucasian , 10/14 ( 71% ) in the intervention group and 9/10 ( 90% ) in the control group . there were few statistically significant differences in nat scores between the intervention and control groups ( table 2 ) . specifically , differences were observed in subjective communication abilities assessed with the mini - cal . patients who received ciat scored higher on the mini - cal at 12 weeks after intervention compared to the control group ( mean 31 vs. 23 ; difference=8 , 95% ci 1.3 to 13.5 , p=0.019 ) . the sft was marginally higher 2 weeks after intervention in ciat patients than controls ( mean 21 vs. 12 ; difference 9 , 95% ci 0.3 to 17.8 , p=0.058 ) . responders were less likely to have a history of hypertension 0/5 ( 0% ) , compared to non - responders 10/14 ( 53% ) , p=0.053 . of the 5 patients who demonstrated a change in nat scores during the course of the study , only 1 ( 20% ) retained the change at the twelve - week visit . in this prospective , preliminary , randomized , blinded study of patients with chronic post - stroke aphasia , we estimated the effect of ciat on linguistic performance . while the results are largely not statistically significant , a few points need to be discussed . first , the study included patients with highly variable levels of post - stroke aphasia , making the comparisons between the groups somewhat difficult . second , the observed effects are consistent with improvement in the ciat group beyond that in the control group , with trends towards statistical significance for some of the variables even in this small sample . defining a responder as a participant with 20% improvement on at least 2 of the 5 tests , then the number needed to show significant between - group differences would be 62 and allows for the design of a more comprehensive trial . finally , a significant improvement was noted in the mini - cal results for the ciat group compared to controls . this indicates that , at least subjectively , the patients in ciat group perceived more improvement over time than participants in the control group . reasons for the participants perception of improvement , as measured by the mini - cal , may be related to the social activity of the therapy sessions . in order to isolate the variable of social interaction from ciat theory , future studies should consider including a study arm involving exposure to social interaction with the same duration and frequency as the ciat group , but without the ciat intervention . social factors may be related to both clinicians and other participants in the group . to date , few reports on the potential efficacy of ciat have been published . five studies in patients with chronic aphasia have included both a treatment group and a control group [ 8,2225 ] . only in the original study were participants randomized to treatment group ; however , unlike the current study , the personnel collecting linguistic data were not blinded to treatment assignment in any of these studies . in the original study , in the other 4 studies ciat was compared to other treatment approaches either model - based aphasia therapy ( training based on functional deficit ) , ciat plus written module , pace , or model - oriented aphasia therapy ( moat ) . in addition to the above studies , a recent study compared modified ciat to conventional aphasia therapy in patients with less than 4 months ( subacute ) since the incident ischemic or hemorrhagic stroke . all these studies showed that while participants receiving treatment improved linguistic performance , between - group differences were minimal , if any . thus , when comparing the results of the original study by pulvermuller et al . and the results of the subsequent studies , including ours , the questions of training intensity and social interactions between participants , and participants and clinicians need to be considered ; both can contribute to improved communicative abilities via increased verbal communication practice . we did not show any statistically significant improvement in objective tests of linguistic performance from before to after treatment . one of the reasons for this lack of statistical significance in our small sample size is the high variability in language scores observed in both groups ( figure 3 ) . a future study enrolling a highly - variable group of participants would require a sample size of only 62 per treatment group to show a significant advantage of ciat over passive observation . but , the effects observed by us are in line with the results of the original study by pulvermuller et al . we identified important considerations for study design that will minimize unnecessary variability and maximize the potential for observing treatment benefit . treatment fidelity needs to be monitored , either via independent reviewers performing video or by direct review of the conducted sessions . a transfer package similar to that offered in motor rehabilitation studies will need to be developed and applied to this group . also , the outcome measures should include measures of pre- and post - intervention discourse and assess changes in the severity of aphasia using , e.g. , the western aphasia battery - revised ; assessing linguistic complexity using mean length of utterances ; or indices of syntactic form . in addition to the above , stratification by severity , education , and socioeconomic status might emphasize the magnitude of improvement relative to the degree of aphasia . finally , other factors , including the effects of lesion size and location on changes in aphasia diagnosis ( type ) during the therapy session , should be assessed . modest improvements were noted in the ciat group on the collected objective tests that were not noted in the control group , forming the basis for estimating effect sizes needed for a comprehensive study . moreover , the ciat group reported significant subjective improvement that confirms the importance of this approach . larger randomized controlled trials that adopt the measures suggested to reduce variability and maximize observable benefit are warranted . | backgroundfew studies have documented the possibility of treatment - induced improvements in language functions 12 months or longer after stroke .
the purpose of the current study was to provide a preliminary estimate of efficacy of constraint - induced aphasia therapy ( ciat ) when compared to no - intervention in patients with chronic ( > 1 year ) post - stroke aphasia in order to provide the data needed to design an appropriately powered trial.material/methodsthis was a randomized , controlled , single - blinded , pilot trial .
we identified 32 patients with chronic post - stroke aphasia .
of these , 27 were offered participation , and 24 were randomized ( consort diagram ) : 14 to ciat and to 10 to no - intervention .
ciat groups received up to 4 hours / day of intervention for 10 consecutive business days ( 40 hours of therapy ) .
outcomes were assessed within 1 week of intervention and at 1 and 12 weeks after intervention and included several linguistic measures and a measure of overall subjective communication abilities ( mini - communicative abilities log ( mini - cal ) ) . to maintain blinding
, clinicians treating patients ( ciat group ) did not communicate with other team members and the testing team members were blinded to treatment group assignment.resultsoverall , the results of this pilot trial support the results of previous observational studies that ciat may lead to improvements in linguistic abilities . at 12 weeks , the treatment group reported better subjective communication abilities ( mini - cal ) than the no - intervention group ( p=0.019 ) .
other measures trended towards better performance in the ciat group.conclusionsin this randomized , controlled , and blinded pilot study , intensive language therapy ( ciat ) led to an improvement in subjective language abilities .
the effects demonstrated allow the design of a definitive trial of ciat in patients with a variety of post - stroke aphasia types .
in addition , our experiences have identified important considerations for designing subsequent trial(s ) of ciat or other interventions for post - stroke aphasia . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the annual incidence is 9.25 per 100000 population . due to advances in screening and treatment , patients with cervical cancer are being diagnosed at a younger age and earlier stage of the disease . radiotherapy , which constitutes almost 80% of all cancer treatment modalities , causes irreversible ovarian damage and leads to premature menopause , which affects the quality of life . young women with cervical cancer who are irradiated often have to suffer the long - term consequences of ovarian failure . in addition to curing those patients , maintaining their quality of life is important for a gynecologist . improved quality of life is significantly associated with improved survival in patients with cervical cancer [ 18 ] . a simple procedure for preventing radiotherapy - induced ovarian damage is laparoscopic ovarian transposition . this procedure has not been implemented widely even though many studies have revealed its benefits and efficacy . this review assesses the use of ovarian transposition as an effective method for preserving ovarian function in young patients with cervical cancer undergoing radiotherapy and compares the benefits of ovarian transposition performed via laparoscopy and via laparotomy [ 913 ] . radiotherapy aims to deliver a precisely measured dose of radiation to a defined tumor volume with minimum possible damage to the surrounding normal tissue . ionizing radiotherapy interacts with dna . the initial dna damage leads to a cascade of biologic events that cause lethality when the cells attempt to divide ( mitotic death ) or programmed cell death ( apoptosis ) , as well as sublethal damage that leads to aging , malformations , and malfunction ( figure 1 ) [ 14 , 15 ] . the human ovary contains a finite number of ovarian follicles , which are vulnerable to dna damage from radiotherapy . the degree and persistence of ovarian damage and the suppression of its function are related to the patient 's age and the dose of radiation delivered to the ovaries . after the ovaries are exposed to ionizing radiation , if the dose of radiation exceeds the lethal dose , most of the primordial follicles and granulose cells will die in microseconds . some of those follicles and cells experience sublethal damage , leading to accelerated functional failure . only a small number would escape the damage , undergo repair , and still have their function . pyknotic granulose cells would be seen soon after irradiation , and with sufficient destruction of the granulose cells , the follicle would become atrophic . there would be a loss of the cortical stromal cells , and in time , the cortical volume would be replaced by collagen [ 6 , 12 , 13 , 15 , 17 , 18 ] . a dose > 8 gy causes permanent ovarian damage in almost all patients older than 40 years . a dose > 20 gy causes permanent sterility in patients of any age , with complete or near complete disappearance of the primordial follicles . radiotherapy used in cervical cancer treatment consists of high - dose external radiotherapy and brachytherapy . the dose of radiotherapy for cervical cancer should be lethal to the cervical tumor tissue . it ranges from 45 gy to as high as 90 gy , exceeding the lethal dose for ovarian follicles , and results in permanent damage and loss of ovarian functions in all patients of any age , unless some interventions are applied . transposing the ovaries is a method of minimizing ovarian follicle exposure to radiation [ 12 , 13 , 19 ] . transposing the ovary away from the radiation field can be done surgically at the time of radical hysterectomy or before radiotherapy . in patients with cervical cancer , the ovaries are transposed or moved to the lateral side of the abdomen above the pelvic inlet to place them far enough from external pelvic radiation exposure or brachytherapy . if the ovaries are transposed laterally , about 3 cm above the pelvic inlet , they will receive only 1%10% of the total radiotherapy dose . if the total radiotherapy dose is 45 gy , then the dose received by the transposed ovaries is only 0.454.5 gy , whereas the retained ovaries could receive 50%70% of the total dose , which is 2032 gy [ 13 , 2024 ] ( figure 2 ) . successfully preserving ovarian function depends on the distance between the transposed ovaries and the edge of the radiation field . therefore , the ovaries should be transposed as laterally and as cranially as possible from the pelvic brim . however , attention should be paid to avoid torsion and extension of the ovarian vessels , which may reduce blood supply to the ovaries [ 26 , 27 ] . lateral ovarian transposition can be performed towards the subcutaneous tissue of the flank or the paracolic gutter . however , attaching the ovary to the flank produces more pain complaints than lateral transposition of the ovaries into the paracolic gutter , which is more widely accepted and results in minimal complications ( table 1 ) . lateral ovarian transposition to the paracolic gutter lateral to the ascending or descending colon is considered a simple standard procedure and can be done laparoscopically [ 23 , 25 , 2832 ] . studies on lateral ovarian transposition show that it is 44%85% effective in preserving ovarian function and that complications such as symptomatic ovarian cyst formation range from 0% to 27% . symptomatic cyst formation occurs more frequently after lateral ovarian transposition to the subcutaneous adipose tissue ( 20%27% ) than after lateral ovarian transposition to the paracolic gutter . ovarian metastasis is rare ( 0%1.2% ) but is reported . a case of abdominal trocar insertion metastasis after laparoscopic lateral ovarian transposition in a patient with cervical cancer , the incidence of trocar insertion metastasis is < 1% . as lateral ovarian transposition to the paracolic gutter is a simple and safe procedure for preserving ovarian function , its benefits outweighs the risks of complications [ 2325 , 2835 ] ( table 1 ) . lateral ovarian transposition is indicated in young patients with cervical cancer after radical hysterectomy , after neoadjuvant chemotherapy , before radiotherapy , or before concurrent chemoradiotherapy . some studies showed that the addition of cisplatin in a low dose of 50 mg / m , used in neoadjuvant chemotherapy or concurrent chemoradiotherapy , did not significantly alter ovarian function . however , adding cisplatin concurrently as radiotherapy functioned as a radiosensitizer and was proven to have better results in some studies . the addition of vincristine and bleomycin in low doses of 1 mg / m and 25 mg / m , respectively , as neoadjuvant chemotherapy did not alter ovarian function either . lateral ovarian transposition is still used in young patients with cervical cancer after they receive chemotherapeutic agents such as cisplatin , vincristine , and bleomycin in low doses as used in neoadjuvant chemotherapy or concurrent chemoradiotherapy [ 24 , 25 , 33 , 3642 ] . besides maintaining ovarian function , ovarian transposition can be used in women who wish to maintain their fertility and reproductive function . for patients with cervical cancer who have undergone radiotherapy that extended to the uterus , and/or hysterectomy , uterine transplantation and surrogacy after ovarian transposition are alternatives . however , uterine transplantation has succeeded only in the animal research setting , and only one failed attempt of human uterus transplantation has been reported . moreover , uterus transplantation and surrogacy are still under ethical debate concerning both the recipient and the donor 's reproductive rights [ 4346 ] . many studies showed that laparoscopic ovarian transposition , like other minimally invasive procedures , produced less risk of adhesion , inflammation , and shortened length of hospital stay in addition to reduced recovery time , resulting in fewer delays in radiotherapy compared with laparotomy . since laparotomy necessitates a longer postoperative recovery time , it significantly delays radiotherapy . in some cases , the transposed ovary has returned to the previous position due to the delay , resulting in failure to preserve the ovaries [ 9 , 10 , 33 ] . laparoscopic ovarian transposition can be performed in a day and the patient is sent for radiotherapy . the minimal postoperative wound will not affect mobility and functional activity , as well as quality of life in cervical cancer patients . studies showed that the risk of adhesion and cyst formation was less with laparoscopic ovarian transposition compared with laparotomy [ 9 , 10 , 28 , 29 , 33 , 34 ] . studies show that steroid hormone production from only one ovary is enough to prevent ovarian function failure . additionally , unilateral ovarian transposition of the right ovary to the paracolic gutter , as high as the subhepatic region , is technically easier , resulting in fewer complications . it is important to measure ovarian reserve in patients with cervical cancer aged 4149 years and in those who have received neoadjuvant chemotherapy before laparoscopic ovarian transposition . to test the ovarian reserve , the menstruation cycle should be assessed and levels of the follicle stimulating hormone ( fsh ) , estradiol , and anti - mllerian hormone ( amh ) should be measured . the amh has an added value since its level is independent of the menstrual cycle , so its assessment can be used in patients who have undergone radical hysterectomy or experienced acute amenorrhea due to neoadjuvant chemotherapy . in some studies , the cutoff value of the amh indicating good ovarian reserve varied , such as 0.3 ng / ml , 0.5 ng / ml , and 1.4 ng / ml [ 4850 ] . laparoscopic ovarian transposition is a simple , safe , effective , but often forgotten , procedure for young premenopausal patients with cervical cancer who are undergoing radiotherapy . we believe this procedure should be offered to all young premenopausal patients with cervical cancer undergoing radiotherapy to preserve their ovarian function . however , further studies to evaluate the efficacy of laparoscopic ovarian transposition in our center are still needed . | maintaining the quality of life by preserving ovarian function in premenopausal patients with cervical cancer undergoing radiation is crucial .
this can be accomplished with a simple and safe laparoscopic ovarian transposition procedure .
this procedure aims to move the ovary out of the irradiation field , protecting it from direct radiation and irreversible damage and preserving its function .
however , this procedure is often forgotten and seldom offered to patients .
this review aims to lay stress on and reconsider the importance of laparoscopic ovarian transposition as a simple , safe , and extremely useful procedure .
the biological effects of radiation are described briefly and several studies are evaluated , which reveal that this procedure has more benefits than risks . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
lung cancer remains the most lethal cancer , with over 160,000 annual deaths in the usa alone.1 over the past decade , the discovery of driver mutations has changed the landscape for the treatment of non - small - cell lung cancer ( nsclc).2 targeted therapies against epidermal growth factor receptor ( egfr ) or anaplastic lymphoma kinase ( alk ) have now been approved by the us food and drug administration as part of the standard first - line treatment of nsclc . despite good initial responses , most patients develop resistance within 812 months and have disease progression . hsp90 is a chaperone protein assisting other cellular proteins to fold properly , and stabilizes them against oxidative and heat stress , as well as helping with protein degradation.3 hsp90 is a weak atpase with a very rapid turnover rate ( 0.1/minute in humans ) . unlike alk and egfr nsclc that is driven by oncogenic mutations , the activity of hsp90 is regulated by the binding of cochaperone molecules that induce conformational change in the hsp90 . to date , over 20 cochaperone molecules have been identified.4 recent insights from the cancer genome atlas revealed that multiple malignancies overexpress or possess mutant kinases that depend on the hsp90chaperone complex.5 hsp90 has been shown to stabilize various signaling molecules , such as pi3k and akt proteins , thus inhibiting cellular apoptosis in cancerous cells ( figure 1).6 it also appears that hsp90 can act as a protector of unstable protein by - products of dna mutations , such as v - src and mutant forms of p53.7 relevant to nsclc , mutant egfr,8
erbb2,9
met,10 mutant braf,11 and the eml4alk translocation product12 are all hsp90-dependent proteins , the degradation of which leads to loss of tumor - cell viability in the corresponding adenocarcinoma subset . expression of hsp90 has thus been shown to correlate with a worse clinical prognosis and to be correlated with resistance to chemo- and radiotherapy.13 the first class of hsp90 inhibitors to be characterized were the benzoquinone ansamycins , including geldanamycin and its derivatives 17-allylamino-17-demethoxygeldanamycin ( 17-aag ) and 17-dimethylaminoethylamino-17-demethoxygeldanamycin ( 17-dmag).14 they were derivatives of geldanamycin , which is an ansamycin antibiotic derived from a streptomyces sp . , and block atp binding to the active site of hsp90 . however , the clinical application of these drugs was limited by their poor pharmacokinetics and dynamics , including poor solubility , formulation problems , and potential multidrug efflux.15 as single agents , these molecules have shown only limited efficacy , thus pointing toward better results in combination therapy.16 in an effort to overcome these limitations , several second - generation synthetic hsp90 inhibitors representing multiple drug classes are currently under development . the goal of this review is to present the data supporting the use of hsp90 inhibitors in nsclc and to give an overview of the ongoing clinical trials involving new - generation hsp90 inhibitors . ganetespib , also known as sta-9090 , is a resorcinol derivative that binds the atp - binding pocket of hsp90 and leads to its inhibition . ganetespib acts by inducing g2/m cell - cycle phase arrest , resulting in apoptosis within 48 hours of treatment . it has also been shown to induce cell arrest in both erlotinib - sensitive and erlotinib - resistant cell lines , including h1975 with the t790 m gatekeeper mutation.17 compared to the older generation 17-aag , ganetespib has greater potency and potential efficacy against several nsclc subsets , including those harboring egfr or erbb2 mutations.18 treatment with ganetespib resulted in decreased downstream signaling through the pi3k akt mtor and raf mek erk pathways . in alk - rearranged nsclc cell lines , ganetespib induced loss of eml4alk expression and depletion of multiple oncogenic signaling proteins in alk - driven nsclc cells , leading to greater in vitro potency , superior antitumor efficacy , and prolonged animal survival compared with crizotinib monotherapy.19,20 ganetespib also overcame multiple forms of crizotinib resistance , including secondary alk mutations . cancer cells driven by alk amplification and oncogenic rearrangements of the ros1 and ret kinase genes were also sensitive to ganetespib exposure . hsp90 inhibition with ganetespib has also resulted in decreased viability of kras - mutated cell lines by impacting downstream signaling through the mtor and mek pathways.21 it was superior to both azd6244 , an mek inhibitor , and bez235 , a pi3k / mtor inhibitor when used as monotherapy , and also helped sensitize kras - mutated cell lines to cisplatin , pemetrexed , gemcitabine , and docetaxel . hsp90 inhibitors have been shown to exert synergistic activity when combined with taxanes ( paclitaxel and docetaxel ) , another g2/m cell - cycle arrest inhibitor . this combination has resulted in synergistic toxicity in both cell lines and animal xenograft models , resulting in more tumor regression than with taxanes alone.22 in the first published multicenter phase ii trial , ganetespib as monotherapy was assessed in previously treated patients with nsclc with specific genotypic subtypes.23 a total of 99 patients were enrolled in three cohorts : cohort a ( n=15 , mutant egfr ) , b ( n=17 , mutant kras ) , and c ( n=66 , no egfr or kras mutations ) . patients were treated with 200 mg / m ganetespib by intravenous infusion once - weekly for 3 weeks followed by 1 week of rest until disease progression . the primary end point of progression - free survival ( pfs ) at 16 weeks was achieved in 13.3% of egfr - mutated patients , 5.9% of kras - mutated patients , and 19.7% of wild - type patients ; 4% of patients achieved partial response , all harboring the alk translocation . eight ( 8.1% ) patients experienced treatment - related serious adverse events , two of which ( cardiac arrest and renal failure ) resulted in death . the most common other adverse effects were diarrhea , fatigue , nausea , and anorexia . given early success in preclinical studies as combination therapy with taxanes , ganetespib was assessed in a phase i trial in combination with docetaxel . the study , with 27 patients , defined the maximum tolerated dose ( mtd ) of ganetespib at 150 mg / m on days 1 and 15 of each 21-day cycle.24 the dose - limiting toxicities were febrile neutropenia and grade 4 neutropenia . this combination was further assessed in the phase ii galaxy-1 trial comparing docetaxel to docetaxel plus ganetespib:25,26 225 patients with advanced nsclc , one prior systemic therapy , and eastern cooperative oncology group performance status of 0/1 were included . docetaxel was given at 75 mg / m on day 1 of a 3-week cycle . in the experimental arm , docetaxel was given on day 1 and ganetespib at 150 mg / m on days 1 and 15 . patients were stratified by performance status , time since advanced disease diagnosis ( 6 months vs > 6 months ) , baseline lactate dehydrogenase ( ldh ) ( elevated or normal ) , or smoking status . the rationale for including patients with elevated ldh was the correlation with tumor hypoxia in these patients attributable to hif-1 , a client protein of hsp90 . after 72 patients were enrolled , nonadenocarcinoma patients were excluded , given the lack of efficacy and excess bleeding risk . for the combination vs the monotherapy arm , the median number of cycles delivered was five vs four , and grade 3/4 adverse events were neutropenia 38% vs 37% , fatigue 4% vs 3% , anemia 7% vs 6% , diarrhea 3% vs 0% , and fever with neutropenia 8% vs 2% . in this study , the overall survival hazard ratio ( hr ) was 0.69 ( 95% confidence interval [ ci ] 0.480.99 , p=0.093 ) , the pfs hr was 0.70 ( 95% ci 0.530.94 , p=0.012 ) , and the overall response rate ( orr ) was 15% vs 11% , all favoring the combination arm . for patients that were enrolled > 6 months after diagnosis of advanced nsclc ( n=175 , 69% ) , a prespecified stratification factor , the overall survival hr was 0.41 ( 95% ci 0.250.67 , p=0.0009 ) , the pfs hr was 0.47 ( 95% ci 0.320.69 , p=0.0005 ) , and the orr was 16% vs 12% . given positive results from this study , multiple phase iii trials are under way to assess the efficacy of ganetespib in other adenocarcinomas , including breast cancer . auy922 is a second - generation nongeldanamycin hsp90 inhibitor that is an isoxazole derivative . in preclinical studies , it has been shown to have clinical activity in lung cancer cells with met- and akl - mediated resistance.27 auy922 treatment effectively suppressed proliferation and induced cell death in both resistant cell lines by downregulating egfr , met , and axl expression , which led to decreased akt - pathway activation . auy922 has also been shown to act as a radiosensitizer to cell lines with acquired resistance to egfr inhibitors.2830 these cell - line studies have been replicated in animals with nsclc xenograft tumors with met- and axl - mediated resistance.27 a total of 101 patients were enrolled in the first - in - human dose - escalation study of auy922 in patients with solid tumors.31 the mtd was not reached ; however , because of concerns regarding visual toxicity , dose escalation beyond 70 mg / m was not attempted . dose - limiting toxicities occurred in eight patients , and included diarrhea , asthenia / fatigue , anorexia , atrial flutter , and visual symptoms . at 70 mg / m , the auy922 concentration achieved was consistent with active concentrations in a range of xenograft models , and that dose was recommended to be taken forward in phase ib and phase ii studies . all 101 patients were evaluable for a clinical response , and of these , none had a complete or partial response by adapted response evaluation criteria in solid tumors criteria . the first phase ii trial evaluated auy922 in 112 patients with nsclc , 61% of which had received at least three lines of therapy.32 patients were stratified in to four groups : egfr - mutated , kras - mutated , alk - rearranged , and wild - type nsclc . mean duration of exposure was 9 weeks . in a preliminary report presented at the american society of clinical oncology 2012 conference , partial responses were seen in 13 out of 101 ( 13% ) patients , two out of eight ( 25% ) alk - rearranged patients , six out of 33 ( 18% ) egfr - mutated patients , four out of 30 ( 13% ) wild - type patients , zero out of 26 ( 0% ) kras - mutated patients , and one out of four ( 25% ) patients of unknown status . in alk - rearranged patients , responses were seen in crizotinib - nave patients , and stable disease was seen with tumor shrinkage in crizotinib - resistant patients . the most frequent adverse events were diarrhea ( 73% ) , visual disturbances ( 71% ) , and nausea ( 43% ) . these data were updated at the 2013 american society of clinical oncology annual meeting , with a focus on egfr - mutated patients . data for 16 patients with acquired egfr tyrosine - kinase inhibitor ( tki ) resistance were presented , seven having tested positive for egfr t790 m at rebiopsy . the orr was two out of 16 ( 13% ) , and both patients with partial responses had the gatekeeper mutation . another phase ii trial looked at using auy922 in patients with acquired resistance to erlotinib;33 25 patients were evaluated , and the median time to tki resistance was 11 months . adverse events reported in 20% of patients were diarrhea , fatigue , myalgia , nausea , mucositis , and night blindness ; 68% ( 17 out of 25 ) experienced night blindness ( grade 12 only ) , and three patients came off the study due to eye - related toxicity . auy922 has also been combined with trastuzumab in patients with her2-amplified or her2-mutated nsclc;34 55 patients with her2 amplification , 34 patients with her2 overexpression , and seven patients with her2 mutation were treated . retaspimycin or ipi-504 is a water - soluble derivate of 17-aag that causes less liver toxicity and has shown activity in nsclc . in preclinical studies , great responses have been obtained with retaspimycin , especially in alk - rearranged cell lines . treatment of h3122 alk - rearranged cell lines with retaspimycin resulted in degradation of the fusion protein in <3 hours , making it a much more sensitive target than egfr or her2.12 the first multicenter phase ii study of retaspimycin enrolled 76 patients with egfr - mutated lung cancer that had progressed on tki therapy.35 the orr was a disappointing five out of 76 ( 7% ) in the overall study population , 10% in patients with egfr wild - type , and 4% in patient with egfr mutations , with a median pfs of 2.86 months . however , among three patients with alk rearrangements , two had partial responses and had prolonged stable disease of over 7 months duration . retaspimycin has also been evaluated in combination with taxanes in patients with metastatic nsclc in an expansion of a phase ib trial;36 23 patients with pathologically confirmed metastatic nsclc , all having received one to two prior chemotherapy regimens without prior docetaxel , were enrolled . docetaxel 75 mg / m iv was given once every 3 weeks , while retaspimycin 300 mg / m was administered intravenously once per week . six out of the 23 ( 26% ) patients had a partial response , including three of seven patients with squamous cell carcinoma . the most common reported adverse effects were fatigue , diarrhea , neutropenia , and anemia . it has been shown to have effect in nsclc cell lines , as well as mouse xenograft models.37 its long duration of action has enabled once - weekly dosing.38 at13387 has also shown clinical efficacy in alk - rearranged cell lines , as well as mouse xenograft models injected with those cells.39 in the first - in - human phase i dose - escalation study , at13387 was evaluated in 62 patients with advanced solid tumors . the drug was administered in both a twice - weekly and once - weekly regimen . one dose - limiting visual disturbance occurred at 120 mg / m twice weekly , thus establishing the mtd for this regimen . for the once - weekly regimen , no formal dose - limiting toxicity occurred ; however , multiple moderately severe toxicities , including diarrhea , nausea , vomiting , fatigue , and systemic infusion reactions , led to selection of 260 mg / m as the recommended phase ii dose . the hsp90 inhibitors are a diverse group of molecules with a wide range of activity in solid tumors , with ongoing trials presented in table 2 . they can also act as chemo- and radiosensitizers , as well as help circumvent acquired resistance to standard targeted therapies . the advantage of using hsp90 inhibitors is their ability to target multiple oncogenes at the same time . the galaxy-2 study ( nct01798485 ) , the first phase iii trial of hsp90 inhibitors in nsclc , is ongoing . a previous study reported single amino acid mutations in the hsp90 molecule associated with in vivo resistance to hsp90 inhibitors.40 further studies are required to identify additional predictive biomarkers of sensitivity and resistance to hsp90 inhibitors in humans . | lung cancer remains the most lethal cancer , with over 160,000 annual deaths in the usa alone . over the past decade
, the discovery of driver mutations has changed the landscape for the treatment of non - small - cell lung cancer ( nsclc ) . targeted therapies against epidermal growth factor receptor ( egfr ) or anaplastic lymphoma kinase ( alk )
have now been approved by the food and drug administration as part of the standard first - line treatment of nsclc . despite good initial responses ,
most patients develop resistance within 812 months and have disease progression . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
most visual disorders occur in the retina , which is a part of the central nervous system ( cns ) and consists of neurons , glia , pigment epithelium ( rpe ) , and blood vessels . currently , diabetic retinopathy ( dr ) , age - related macular degeneration ( amd ) , and glaucoma are the top causes of blindness in the developed countries . these diseases can occur when local or systemic neuronal and vascular homeostasis mechanisms are dysregulated . the highest risk factor for many of these diseases is aging [ 13 ] , and as is the case with other age - related diseases such as alzheimer 's disease , cardiovascular disease , cancer , arthritis , osteoporosis , and hypertension , accumulating evidence suggests that chronic inflammation and oxidative stress can accelerate or promote disease progression [ 46 ] . the renin - angiotensin system ( ras ) is classically known as a systemic blood - pressure - regulating system . independent of systemic ras , tissue intrinsic rass have been identified in various tissues ( including the retina ) and are important for maintaining local homeostasis . elements of the ras pathway are highly conserved in many species including invertebrates and humans demonstrating that its functions are evolutionarily conserved , although spatial expression patterns differ slightly between different species . we have reported that angiotensin ii type 1 receptor blocker ( arb ) suppresses retinal neural dysfunction in animal models of acute inflammation or diabetes . other groups and our own have also reported that arbs can protect retinal vascular inflammation [ 1019 ] and neuronal apoptosis [ 2023 ] . furthermore , it was recently reported by two independent groups that daily oral administration of arb may prevent the progression of diabetic retinopathy in randomized multicenter clinical trials [ 2426 ] . in this paper we will summarize these findings and other studies demonstrating that ras modulation may prevent ocular pathogenesis . lastly , we will describe the potential mechanisms through which ras inhibition may preserve neuronal function and viability while combating ocular diseases . it was later found to induce the release of a vasoconstrictive agent in experimental models of hypertension induced by renal ischemia . two independent groups identified the end product of this hypertensive cascade in 1939 and named it hypertension or the ras pathway as we know it today began to take shape once angiotensin - converting enzyme ( ace ) was identified in 1956 . we now know that once renin is proteolytically processed from its precursor prorenin by proteases and released from the kidney , it converts angiotensinogen to angiotensin i in the liver . angiotensin i is finally converted to angiotensin ii by ace which is predominantly expressed in vascular endothelial cells ( ecs ) and is located in highly vascularized tissues such as the lung ( figure 1 ) . angiotensin ii stimulates vascular smooth muscle cells ( vsmcs ) that line endothelial cells to contract and induce vasoconstriction . there are two primary receptors for angiotensin ii : angiotensin ii type 1 receptor ( at1r ) and at2r ; at1r appears to exert predominant functions in blood vessels . however , the roles of at1r and at2r in pathophysiological conditions are currently under debate [ 3234 ] . at1r is a seven - transmembrane g protein - coupled receptor [ 35 , 36 ] . once stimulated in vsmcs g proteins activate phospholipase c ( plc ) and inositol-1,4,5-triphosphate ( ip3 ) to open calcium channels in the endoplasmic reticulum . as a result , increase of cytosolic calcium induces phosphorylation of myosin light chain , vsmc contraction , and vasoconstriction [ 38 , 39 ] . independent of systemically circulating angiotensin ii ( circulating ras ) , most ras components , including ace , were also found to be locally expressed in many tissues . this observation resulted in the hypothesis that in addition to being converted in particular organs for systemic circulation , angiotensin ii could also be synthesized in peripheral tissues ( tissue ras ) where it would exert its effect locally . tissue ras elements were identified in various organs including heart , kidney , adrenal gland , brain , and retina ( see details below ) . an important molecule involved with tissue ras is ( pro)renin receptor which interacts with prorenin to exert enzymatic activity of renin without the conventional proteolysis of the prorenin prosegment [ 45 , 46 ] . ( pro)renin receptor can be detected in major organs but not in circulation indicating that this molecule may play a critical role in the activation of tissue ras . thus tissue ras may be important for fine - tuning global ras activity or for acting intrinsically to respond to localized insults . however , ( pro)renin receptor may also function independent of renin activation as a member of the wnt receptor complex to regulate wnt / - catenin pathway activity . in addition to its critical physiological functions , ras dysregulation can lead to pathogenesis . in various cardiovascular cell - type rass hyperactivation can induce pathogenic cell migration , hypertrophy , fibrosis , disrupt cell adhesion and ectopic extracellular matrix ( ecm ) deposition . at1r signaling directly activates key signaling pathways for cell growth and hypertrophy including jak / stat ( janus kinase / signal transducer and activator of transcription ) [ 48 , 49 ] , erk ( extracellular - signal - regulated kinase ) 1/2 [ 5052 ] , and p38 mapk ( mitogen - activated protein kinase ) . indeed , angiotensin ii / at1r signaling can potentiate oxidative stresses and inflammatory responses by activation of nad(p)h ( nicotinamide adenine dinucleotide phosphate ) oxidases [ 5457 ] . angiotensin ii can also activate egfr ( epidermal growth factor receptors ) and induces fibronectin synthesis and tgf ( transforming growth factor beta ) activity to promote fibrosis and ecm formation [ 58 , 59 ] . at1r signaling can activate nfb ( nuclear factor kappa - light - chain - enhancer of activated b cells ) [ 6062 ] and ap-1 ( activator protein 1 ) to initiate transcription of multiple proinflammatory genes [ 61 , 63 , 64 ] . at1r also induces accumulation , adhesion , and infiltration of inflammatory cells via activation of pai-1 ( plasminogen activator inhibitor-1 ) and mcp-1 ( monocyte chemotactic protein-1 ) to promote atherosclerosis . taken together , these findings provide strong evidence that ras is not just a regulator of blood pressure , but also regulates an inflammatory cascade . after the first ace inhibitor ( acei ) was developed , many other ras inhibitors including arb [ 68 , 69 ] have been established and approved for commercial use as hypertension drugs ( figure 1 ) . ras inhibition not only prevents hypertension but also protects tissues against injury by limiting the potency of deleterious inflammatory responses . since aging is considered to be , in part , the result of chronic inflammation , it may not be too surprising that the use of ras inhibitors or genetic deletion of at1r has potential to extend the life span in hypertensive [ 7173 ] or normotensive mammals . in addition to regulating vasoconstriction , another important physiological function of ras is osmoregulation in the cns ( e.g. , water and sodium intake , sympathetic activity , and release of vasopressin ) [ 7577 ] . at1r is expressed in brain neurons and mediates osmoregulation by stimulating the release of vasopressin in the pituitary gland and signaling the kidney to conserve water . furthermore angiotensin ii / at1r signaling in the brain forces individuals to stimulate increased thirst and consume more drinking water . since angiotensin ii has a high molecular weight , it does not cross the blood - brain barrier ( bbb ) . additionally , every component of the ras pathway including angiotensinogen , ace , and angiotensin ii receptors is expressed in the brain [ 75 , 76 , 7981 ] . brain ras can also become dysregulated ; this has been shown to induce oxidative stress and inflammation . however , ras inhibitors have neuroprotective effects in brain inflammation and ischemia without inducing antihypertension ( see detail below ) . , prorenin protein and renin activity can be detected in the vitreous fluid [ 8385 ] and prorenin mrna has been detected in muller glia and in the ciliary body ( cb ) cells . ( pro)renin receptor is expressed in ecs , muller glia , and retinal ganglion cells ( rgcs ) [ 88 , 89 ] . ace is synthesized in the neural retina [ 93 , 94 ] and can be detected in rgcs , photoreceptors , and muller glia . angiotensin ii , the final product of ras , can be detected in the vitreous fluid and in the neural retina . interestingly , the normal concentration of angiotensin ii in ocular fluid is higher than in plasma , confirming the existence of tissue ras in the eye . in the retina , angiotensin ii receptors are detected both in ecs and in neuronal cells , which are located outside and inside of the blood - retina barrier ( brb ) , respectively [ 8 , 92 , 99 , 100 ] . at1r is found in the presynaptic terminals of photoreceptors and of interneurons in the retina as well as in neurons of the brain [ 101 , 102 ] ( figure 2 ) . at1r is also expressed in rgcs , although the physiological function of at1r in the neural retina is not fully understood . systemic administration of acei negatively influences cat and human neural functions measured by electroretinograms ( erg ) in both systemic blood - pressure - dependent and -independent manners [ 105 , 106 ] at2r is also expressed in the retina but much less is known how it functions in the eye . polymorphisms in the at2r gene may be linked to glaucoma or diameter of the retinal arterioles . increasing evidence suggests that ras activity and inflammation may be associated with various ocular diseases , and , therefore , ras inhibitors may be effective therapeutic agents . several lines of evidences suggest that ras inhibition is an effective treatment for uveitis [ 8 , 12 , 17 , 18 , 88 ] . endotoxin - induced uveitis ( eiu ) is induced with intraperitoneal injections of lipopolysaccharide ( lps ) ; this results in upregulated expression of proinflammatory and adhesion molecules such as icam-1 ( intercellular adhesion molecule 1 ) , mcp-1 , il-6 ( interleukin 6 ) , and ifn- ( interferon - gamma ) [ 17 , 88 ] . these molecules are also upregulated in experimental autoimmune uveoretinitis ( eau ) models generated by immunizing animals with interphotoreceptor retinoid - binding protein ( irbp ) . the upregulation of these molecules , however , can be inhibited with arb or ( pro)renin receptor blocker ( prrb ) . ras inhibition also suppresses retinal leukocyte stasis , cd4 + t - cell activation [ 17 , 18 , 88 ] . lastly , when the expression levels of ras pathway components are examined in eiu , prorenin , ( pro)renin receptor , angiotensin ii , and at1r levels are elevated in the retina . these findings suggest that heightened inflammatory responses in the eye and ras activation are strongly correlated . besides being correlated with classically acute inflammation cases such as uveitis , one of the largest risk factors for developing prevalent and vision - threatening diseases such as dr , amd , and glaucoma is aging [ 13 ] . these age - related eye diseases [ 109 , 110 ] and others [ 5 , 6 ] are now known to be caused ( at least partially ) by chronic inflammation and oxidative stress . since ras inhibition may prolong the life spans of hypertensive [ 7173 ] or normotensive mammals , it is logical that age - related eye diseases may be prevented or treated by suppressing inflammation and oxidative stress . the main pathological event of dr and amd is abnormal neovascularization and vegf ( vascular endothelial growth factor ) has been known to be a large contributor for them [ 111113 ] . vegf is a potent angiogenic factor and an inflammatory cytokine that induces the accumulation , adhesion , and infiltration of leukocytes [ 114 , 115 ] . inflammatory response in the retina can promote tissue ischemia by inducing vascular regression ( vaso - obliteration ) and also pathological angiogenesis . angiotensin ii can induce upregulation of vegf receptor ( vegfr)-2 and angiopoietin-2 in retinal ecs [ 117 , 118 ] and vegf in retinal pericytes ( figure 3 ) . oxygen - induced retinopathy ( oir ) is an animal model induced by continual aeration with 7580% oxygen in early postnatal stages . oir animals develop stereotypical phenotypes and is useful to evaluate vaso - obliteration and pathological angiogenesis ( tuft formation ) in the developing retina which is largely regulated by vegf . this phenotype can be prevented with ras inhibitors acei [ 122 , 123 ] , arb , or prrb [ 89 , 124 ] that prevent pathological angiogenesis in oir . the use of arb and prrb has the added benefit of suppressing abnormal angiogenesis without suppressing physiological vascular regeneration [ 15 , 124 ] . in animals exposed to oir ras inhibitors infiltration of vegf - expressing inflammatory cells into the vitreous cavity is thought to induce pathological angiogenesis by causing ecs to grow in the wrong direction . it is characterized by vascular loss due to hyperglycemia and inflammation due to oxidative stress and ages ( advanced glycation end products ) accumulation . in severe cases hypoxia induces abnormal neovascularization ( proliferative diabetic retinopathy , pdr ) in addition to hyperpermeability ( diabetic macular edema ; dme ) . prorenin and angiotensin ii [ 125 , 126 ] are found to be increased in the vitreous humor of pdr and dr patients . ras may potentiate the vascular phenotype of dr by upregulating vegf / vegfr-2 signaling ( through angiotensin ii ) [ 118 , 119 ] thereby inducing neovascularization and promoting blood vessel permeability . in fact , vegf was initially named vascular permeability factor ( vpf ) . although in one study acei administration seemed to attenuate retinal hyperpermeability in diabetic patients , interpretations of these studies are still being actively debated [ 129 , 130 ] . however , recently three independent groups showed that arb prevents brb breakdown in animal models [ 131133 ] . in 1998 and 2008 , the results of randomized double - blind placebo - controlled trials using acei or arb to treat dr were released from the euclid ( eurodiab controlled trial of lisinopril in insulin - dependent diabetes ; acei treatment ) and direct ( diabetic retinopathy candesartan trial ; arb treatment ) [ 24 , 25 ] . afterwards , rass ( renin - angiotensin system study ) in which both inhibitors were tested in dr patients was also released . large number of participants were examined in these trials ( 354 ( type 1 diabetes ) for euclid , 1421 ( type 1 ) and 1905 ( type 2 ) for direct , and 285 ( type 1 ) for rass , resp . ) , and the results from all three studies provided strong evidence that ras inhibition delays the onset or prevents the development of human dr symptom . for example , in direct , arbs were not effective with respect to primary endpoints and had differing effects regarding secondary endpoints in different patient groups ( type i or type ii diabetes ) [ 24 , 25 ] . clues for why ras inhibition is effective for treating dr have come from animal studies . streptozotocin ( stz ) injections in rodents induce leukocyte stasis , blood vessel hyperpermeability , and formation of acellular capillaries . importantly , erg recordings are attenuated in rodents after stz injections before vascular phenotypes are observed , indicating that neuronal dysfunction precedes neovascularization in diabetic models [ 9 , 135 ] . the administration of acei [ 137140 ] , arb [ 10 , 13 , 14 , 141 ] , or prrb has been shown to rescue the vascular phenotypes of stz - induced diabetic retinas . to generate another and more severe model of dr , ren-2 transgenic rats ( that have severe hypertension due to genetic knock - in of a mouse ren-2 renin gene ) can be injected with stz . in these rats advanced vascular phenotypes are observed ( including abnormal endothelial proliferation ) . even in this model acei or arb ras inhibitors probably function by suppressing inflammatory cascades [ 10 , 14 ] and by preventing oxidative stress by limiting nfb and nad(p)h activation . ras inhibitors may also function to directly inhibit glucose accumulation into retinal cells by modulating glut-1 ( glucose transporter 1 ) expression . furthermore , arb was reported to influence the expression of glyoxalase i , a key regulator of ages . lastly , even though at1r and at2r are considered to have opposing functions at2r inhibition may also effectively treat dr by suppressing vegf and angiopoietin-2 expression levels in experimental retinopathies [ 33 , 149 ] . the greatest risk factors are aging and smoking , and the central phenotypes are choroidal neovascularization ( cnv ; wet amd ) and atrophy of photoreceptors and rpe cells ( dry amd ) . while no cure exists for dry amd , wet amd is currently treated with vegf inhibitors [ 112 , 113 ] . inflammation exacerbates the wet amd phenotype since infiltrating macrophages promote cnv formation [ 150152 ] . the size of the laser - induced lesions after treatment with acei , arb , and prrb is significantly reduced . ras inhibition may protect against cnv formation by inhibiting ras activity and suppressing erk signaling ( directly with ( pro)renin receptor - mediated intracellular signaling ) . rpe cells are positioned between the choroidal vasculature and photoreceptors and have function to maintain the visual ( retinoid ) cycle and to form a tight seal that prevents choroidal vessel invasion . angiotensin ii signaling in rpe cells increases abnormal production [ 155157 ] and excessive turnover of ecm via mmp ( matrix metalloproteinase)-2 and -14 thereby weakening the seal that prevent choroidal ec invasion . these studies suggest that ras inhibition may be an effective treatment for amd as well as dr . the feature of this disease is neurodegenerative of rgcs , but it can be caused by heterogeneous and complex mechanisms . one direct mechanism to induce rgc death is to increase the intraocular pressure ( iop ) . studies devoted to developing new methods of controlling iop are critical and ongoing . however , a subpopulation of glaucoma patients have normal iop ( normal tension glaucoma , ntg ) . this complicates the development of effective therapies since both forms are induced by seemingly separate mechanisms . some ras components including angiotensin ii receptors are expressed in cb cells [ 90 , 159 , 160 ] that secrete aqueous humor and regulate iop . like other antihypertensive drugs such as calcium channel blockers , acei or arb decreases iop in humans and other primates [ 161165 ] although iop is considered to be regulated independently of systemic blood pressure . in an experimental model of high iop and glaucoma , arb treatments effectively suppress rgc death . these findings suggest that ras inhibition may be effective for treating glaucoma patients with high iop . angiotensin ii receptors are expressed inside and outside of the bbb [ 75 , 76 , 7981 ] and the brb [ 8 , 92 , 99 , 100 ] indicating that both circulating and tissue ras exist in the cns , and if dysregulated , could elicit pathological effects . indeed , ras inhibition can attenuate the degree of inflammation in the brain and the eye [ 166 , 167 ] . inhibiting ras can prevent experimental brain injuries induced by middle cerebral artery occlusion [ 168 , 169 ] by suppressing vascular inflammation , including bbb breakdown , and/or regulating neural apoptosis directly . interestingly , at2r is more highly expressed in developing neuronal tissues in vivo than in adult tissues and at2r stimulation promotes axonal regeneration of optic nerve and minimizes formation of ischemia - induced cerebral lesions . this suggests that arb , which not only blocks at1r but also causes angiotensin ii to bind at2r , may be an ideal drug for treating inflammatory diseases in the cns . inhibition of ras may also prevent stress - induced behaviors including anxiety , depression , and panic by suppressing the release of corticotrophin - releasing factor [ 176178 ] . furthermore , recent studies suggest that brain ras may potentiate alzheimer 's disease progression by stimulating the production of beta amyloid [ 179182 ] . retinal dysfunction as detected in erg recordings can be observed in early diabetic animal models and in humans before vascular changes and neural cell loss are observed . amazingly , these deficits can be prevented by inhibiting ras [ 9 , 183 , 184 ] . we have reported that arb prevents retinal dysfunction ( e.g. , decrease of amplitude and an extension of the implicit time of erg ) in eiu and in stz - induced early diabetic retinas . furthermore , in these inflamed retinas , we determined that angiotensin ii prompted the degradation of the presynaptic protein synaptophysin through the ubiquitin proteasome system ( ups ) [ 8 , 9 ] . ups - mediated degradation of rhodopsin ( part of the light - responsive complex in photoreceptors ) can also be observed in eiu via stat3 activation ( which operates downstream of at1r ) [ 8 , 185 ] . additionally , stat3 signaling serves as a negative regulator of rhodopsin in differentiating photoreceptors during retinal development [ 186 , 187 ] . thus , regulating angiotensin - ii - induced protein degradation could serve as an important neuroprotective measure ( figure 3 ) . another target of inflammation is reactive glia including microglia , astrocytes , and muller glia . microglia are resident cns myeloid - derived cells and mediate critical immune and inflammatory responses . at1r signaling induces activation of microglia via nfb and ap-1 [ 189 , 190 ] . gfap ( glial fibrillary acidic protein ) is a differential and reactive marker of astrocyte and muller glia , respectively , and its transcription is regulated by stat3 activation . the activation of astrocytes and muller glia in experimental retinopathy can be prevented by arb [ 8 , 192 ] ( figure 3 ) , although it is important to consider that the contributions of reactive glia can be context dependent . iop - independent rgc apoptosis can be observed in stz - induced diabetes , after ischemia / reperfusion , after optic nerve crush , and after intraocular nmda ( n - methyl - d - aspartic acid ) injections in animal models . rgc loss in diabetic hypertensive models can be prevented by arb which restores oxidative redox and mitochondrial functions . acei or arb also prevents rgc apoptosis in ischemia / reperfusion models by suppressing toxic oxidative stress . polymorphisms of ras pathway genes are reported to be associated with brain infarction or its early lesion [ 197199 ] and at2r gene polymorphisms are reported to be associated with the risk of ntg . these findings may indicate that ras inhibitors may directly protect retinal neurons from apoptosis and further suggest that ras inhibition may be useful for therapeutic treatments of iop - independent glaucoma . ras , which has been classically known as blood pressure regulator , is becoming widely recognized as a proinflammatory mediator . many age - related ocular diseases may be caused or exacerbated by chronic inflammation . cells in the eye are responsive to circulating and tissue ras and increasing evidence indicates that ras inhibition may prevent various ocular diseases including uveitis , amd , and glaucoma . based on the findings from multiple clinical trials , ras inhibitors are effective therapeutic agents for treating dr although the results of these studies must be examined critically since the inhibitors were not universally beneficial . other groups including our own have shown that ras inhibitors protect neurons from oxidative stress and apoptosis by preventing posttranslational ubiquitination of proteins critical for retinal functions . although not mentioned previously in this paper , another new and exciting ras inhibitor , aliskiren ( a direct renin inhibitor ) , has been developed . therefore , work is underway to characterize existing ras inhibitors and to develop novel inhibitors since they hold great promise for attenuating chronic inflammation and for treating multiple ocular and nonocular diseases . | the renin - angiotensin system ( ras ) is a hormone system that has been classically known as a blood pressure regulator but is becoming well recognized as a proinflammatory mediator . in many diverse tissues ,
ras pathway elements are also produced intrinsically , making it possible for tissues to respond more dynamically to systemic or local cues . while ras is important for controlling normal inflammatory responses , hyperactivation of the pathway can cause neural dysfunction by inducing accelerated degradation of some neuronal proteins such as synaptophysin and by activating pathological glial responses .
chronic inflammation and oxidative stress are risk factors for high incidence vision - threatening diseases such as diabetic retinopathy ( dr ) , age - related macular degeneration ( amd ) , and glaucoma .
in fact , increasing evidence suggests that ras inhibition may actually prevent progression of various ocular diseases including uveitis , dr , amd , and glaucoma .
therefore , ras inhibition may be a promising therapeutic approach to fine - tune inflammatory responses and to prevent or treat certain ocular and neurodegenerative diseases . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
trauma is the most common cause of death in young individuals , and it is the third most common cause of death for individuals of all ages . half of all deaths caused by trauma occur at the scenes of accidents ; the rest occur within the following hours or days [ 2 , 3 ] . thus , early evaluation of such patients and correct determination of trauma severity are crucial . trauma - scoring systems have been developed to manage such patients effectively , but the current systems do not feature biochemical markers despite the fact that several blood markers are associated with trauma severity and mortality . in this prospective work , we sought to identify correlations between the injury severity score ( iss ) , on the one hand , and the mean platelet volume ( mpv ) and levels of c - reactive protein ( crp ) , interleukin ( il)1 , il6 , and tumour necrosis factor - alpha ( tnf ) , on the other . we tried to identify biochemical parameters that could serve as components of a new biochemical parameter - based iss system . this study was performed between 15 march 2014 and 15 july 2015 in the haydarpasa numune training and research hospital , emergency department , after the hospital ethics committee approved the research . a total of 84 patients with multiple traumas , aged 1865 years , were included . age , gender , blood pressure , heart rate , date and time of admission , cause of trauma , types of injuries , glasgow coma score ( gcs ) , and iss were recorded on standardised forms . no patient had any comorbidity or chronic disease . blood samples were collected from all patients at admission to determine the mpv and the levels of crp , il1 , il6 , and tnf. all assays were completed within 15 min in the emergency laboratory . crp levels were first immunoturbidimetrically analysed on an architect - plus ci 4100 instrument ( abbott park , chicago , il , usa ) . blood cell counts were obtained using a cell - dyn 3700 platform ( abbott diagnostics , santa clara , ca , usa ) . serum tnf , il1 , and il6 levels were measured using boster elisa kits ( freemont , ca , usa ) and bio - tek ( winooski , vt , usa ) elx50 and elx800 devices . data were analysed using statistical package for social sciences ( spss ) software , version 20.0 . parametrical values were compared using t - test , and the chi - squared test was employed to compare nonparametrical values . a p value < 0.05 was considered to reflect statistical significance . of the 114 included patients , 33 had isss > 15 , and 51 had isss 15 . the mean heart rate of severely injured patients was 87.73 13.269 beats / min ; that of mildly injured patients was 82.69 11.513 beats / min ; these values did not differ significantly ( p = 0.078 ) . the average systolic blood pressure of patients with isss > 15 was 139.30 20.866 mmhg , which was significantly higher than that of patients with isss 15 ( 127.45 18.010 mmhg ; p = 0.009 ) . however , the mean diastolic pressures did not differ significantly ( p = 0.043 ) , as they were 79.15 13.311 and 72.65 15.406 mmhg in the severely and mildly injured groups , respectively ( table 1 ) . of the 84 study patients , 25 ( 29.7% ) were hit by motor vehicles , 21 ( 25% ) were inside motor vehicles that were in traffic accidents , 18 ( 21.4% ) had motorcycle accidents , 12 ( 14.2% ) had simple falls , and 8 ( 9.5% ) fell from heights . the causes of trauma are listed in table 2 and the injuries suffered are listed in table 3 . the mean mpv of the study group was 7.76 1.11 fl , and that of the control group was 7.55 1.02 fl . pg / ml , and that of the control group was 25.04 10.01 pg / ml . the tnf level was thus significantly higher in the study group ( p = 0.000 ) . the mean il6 level was 70.66 40.05 pg / ml in the study group , and that of the control group was 6.857 5.07 pg / ml . the il6 level was thus significantly higher in the study group ( p = 0.000 ) . the mean il1 value in the study group was 12.66 7.71 pg / ml , and that of the control group was 3.04 0.98 pg / ml . the il1 level was thus significantly higher in the study group ( p = 0.000 ) . the mean mpv value in the 33 patients with isss > 15 was 7.62 1.19 fl ; this value was 7.86 1.06 fl in the 51 patients with isss 15 . the mean tnf level of patients with isss > 15 was 59.98 18.40 pg / ml ; that of patients with isss 15 was 44.43 22.38 patients with isss > 15 had a mean il1 value of 13.10 8.10 pg / ml ; that of mildly injured patients ( isss 15 ) was 12.38 7.52 pg / ml . these values did not differ significantly ( p = 0.682 ) . the mean il6 level in severely injured patients ( isss > 15 ) was 88.43 51.75 pg / ml ; that of patients with milder injuries ( isss 15 ) was 59.16 24.63 pg / ml . the il6 level was significantly higher in patients with severe injuries ( p = 0.004 ) . the comparisons of biochemical markers between the study and control groups are shown in table 4 . although death rates have declined since the 1960s , unintentional injuries remain a major cause of death . the world health association noted that traffic accidents are the most common causes of trauma . we found this to be true , as 64 ( 76.1% ) of our 84 study group patients were injured in traffic accidents ; this proportion was higher than the generally reported because our hospital is a tertiary referral centre located near a major highway . additionally , we excluded alcohol and drug abusers and patients with chronic diseases , which may have decreased the number of injuries caused by falls . after trauma , hypothalamic activation of the sympathetic autonomous nerve system triggers norepinephrine secretion from presynaptic nerve terminals and catecholamine discharge from the adrenal medulla . we found a significant difference in systolic blood pressure between patients with major and minor trauma . although the mpv was previously reported to predict trauma severity , we found no significant difference between those who were mildly or severely injured or between those who were injured and controls . a meta - analysis of the crp levels of 13,374 patients revealed that an increase in that level was associated with trauma . we also found a significant increase in crp levels in injured patients ; however , the isss did not correlate with these levels . a previous study found that crp levels rose 612 h after trauma ; thus , this parameter may not be useful in the initial screening of trauma severity . tnf is a proinflammatory cytokine synthesised by activated macrophages and t lymphocytes ; tnf induces vasodilatation and increases vascular permeability . tnf release is faster than that of cytokines , and the elevated tnf levels after trauma are harmful . the tnf level in the study group was significantly higher than that in the control group . among severely and mildly injured patients , tnf levels were higher in those with isss > 15 , and the tnf level correlated with trauma severity . trauma severity is correlated with isss , mods scores , ards scores , and the incidence of sepsis [ 9 , 10 ] . the il6 level soon after trauma is associated with mortality and treatment response in animals . in another study , higher il6 levels were evident in patients with isss > 15 and were associated with increased mortality . we found that il6 levels were significantly higher in the study group , and patients with isss > 15 had higher il6 levels than patients with isss 15 . release of il1 concomitantly with tnf reduces pain sensations but causes fever , anorexia , polymorphonuclear leukocyte excretion , t lymphocyte proliferation , t lymphocyte transmigration to the area of injury , expression of adhesion molecules in the endothelium , and an increase in cell permeability . one study found that il6 and tnf levels were associated with mortality , and il8 level was associated with the iss . however , the il1 level was not related to the iss in our current work , as the iss was only mildly elevated at high levels of il1. thus , in our study , il1 level did not aid in the determination of trauma severity . moreover , trauma mortality can be reduced by effective resuscitation , fast transport to a hospital , and effective trauma management in the emergency department . such management begins with an accurate assessment of the patient . in the present study , we sought correlations between the levels of biochemical markers and iss scores . the crp level was elevated in all trauma patients , but that level did not correlate with the iss . the il1 level was elevated in all trauma patients , but it was not higher in patients with higher isss compared to those with lower isss . the il6 and tnf levels were higher in the study group and were correlated with isss . il6 and tnf levels can be used to assess trauma severity . however , the mpv and crp and il1 levels are not useful in this regard . | we investigated the associations of injury severity scores ( isss ) with the mean platelet volume , the serum levels of two interleukins ( il1 and il6 ) , and the serum levels of tumour necrosis factor- ( tnf ) and c - reactive protein ( crp ) .
we sought to identify biochemical parameters that could be used as components of a new biochemical parameter - based iss system .
the levels of crp , tnf , il1 , and il6 differed significantly ( all p values < 0.05 ) between severely injured patients and controls .
the mean platelet volume ( mpv ) did not correlate with the isss ( p > 0.05 ) .
the tnf and il6 levels were useful for determining the severity of injury , and the crp level was elevated in all trauma patients but did not correlate with the iss .
the il1 level was higher in the study group but did not increase as the iss increased .
il6 and tnf levels were higher in the study group and increased as the iss increased .
we found no significant difference between the trauma group and healthy individuals in terms of mpv values .
il6 and tnf levels can be used to assess trauma severity . however
, neither the mpv nor the crp or il1 level is useful for this purpose . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
with increasing age , muscular force reduces owing to degeneration of muscular tissue / joint
or neural lesions1 . in terms of lower limb
muscular force , the gluteus maximus [ gma ] , gluteus medius [ gme ] , rectus femoris [ rf ] , and
medial gastrocnemius [ mg ] play important roles in effective movements upon posture
maintenance during standing and walking . in addition , lower limb muscles that are necessary
for desirable walking provide stability to the knee and hip joints2 , 3 . however , walking
speed and balancing ability decrease as well as simultaneous difficulties in posture
maintenance can occur if patients develop lower limb muscle weakness4 , 5 . in order to solve
these problems , the heel rise movement ( hm ) and squat movement ( sm ) using self - weight are
applied as exercises to prevent amyotrophy and enhance muscular force of the lower limb in
clinical practice1 , 6 , 7 . among dance movements
involving stable self - weight , the releve movement ( rm ) and the demi - plie movement ( dm ) in
ballet are basic postures to be maintained by abducting a lower limb and recruiting the gma ,
quadriceps q , hamstrings , and mg that can be used to sufficiently develop the surrounding
muscles including the achilles tendon , foot arch , knee , and thigh , as well as the mg in
particular8 , 9 . consistently and accurately performing rm and dm can develop the
lower limb strength , maintaining body weight with plantar flexion and thus improving body
balance9 , 10 . in addition , some studies have reported that a dance program in
patients with parkinson disease was effective to improve memory , muscular force , and balance
in a large number of patients11 . however ,
most of these studies were limited to ballet majors and patients with parkinson disease , and
there is no study on the scientific evidence for therapeutic exercise movement and muscular
activity in healthy adults . in this regard , this study was conducted to compare and analyze
lower limb muscle activities with ballet movements , the rm and dm vs. general movements ( hm
and sm ) in healthy people in order to suggest new rehabilitation therapeutic exercises
involving dance movements in patients requiring muscular force exercises . among healthy undergraduate students of c university in gyeongsan - si , 30 target subjects ( 8
male and 22 female ) without physical defects and who did not perform any exercises for the
last 6 months and did not have any orthopedic disorder in the lower limb were selected for
this study . the study subjects were fully informed of experimental procedures , and the
subjects provided consent indicating their voluntary participation ; and the study was
approved by the ethics committee . the subjects were 22.21.9 years old , were 166.77.6 cm
tall and weighed 60.79.8 kg . among the 30 subjects , 26 were right lower limb - dominant
whereas 4 were left lower limb - dominant . in this study , 6 types of muscles , i.e. , the gma ,
gme , rf , al , mg , and lg were assessed in order to compare lower limb muscular activities for
4 different movements , i.e. , rm vs. hm and dm vs.sm , in healthy adults . the ready - postures of rm and dm before starting ballet movements are as below : both heels
are in contact each other while holding the foot at 60 at an open - angle , and both knees
face outward while holding external rotation with the knee and ankle joints from the hip
joint12 . the posture assessed is as
below : for rm , the heels are raised as high as possible while holding knee extension at the
ready - posture . for dm , the knee joint faces towards the second toe while holding 45 of knee
flexion at the ready - posture . for the ready - posture for general exercises of hm and sm , the natural standing position is
taken with the feet at shoulder width and the feet parallel forward . ( the ready - posture for
general exercises ( hm and sm ) is taken with the feet at pelvic width and the feet parallel
forward like the natural position . ) for hm , the heels should be raised as high as possible from the natural position . for sm ,
the knee flexion should be held at 45 form the natural position . all movements were
assessed with both hands in contact with the bar while the second finger of both hands was
closed . rm and hm were assigned as into one group because both required raising of the heels
as high as possible against gravity while maintaining knee extension but with different
lower limb array positions . similarly , dm and sm were assigned into one group because both
involved same gravity directional movements but with different lower limb array positions
while maintaining 45 knee flexion13 . the test was conducted 2 times by maintaining the posture for total 10 s with 30-s rest
intervals14 . using surface emg ( lxm5380 , laxtha , korea ) , an emg signal was given for
10 s. the values at the first and the end of 2 second were excluded , and the value at 6 s
was reported for rms ( root mean square ) and the mean value of two measurements was used . the value at 6 s was reported for rms ( root mean
square ) and the mean value of two measurements was used . ) at the signal process of the emg , rms was used to change the contracting muscle15 . differences between the two groups , rm vs. hm and dm vs. sm in 6
muscular activities were verified using a paired t - test with statistical significance at p
< 0.05 . the rm vs. hm group showed significant difference in all of 6 muscle activities , i.e. , gma ,
gme , rf , al , and mg ( p<0.01 * * ) and lg ( p<0.05 * ) ( table 1table 1.comparison of muscle activation between releve movement ( rm ) and heel rise
movement ( hm ) ( meansd ) ( n=30)musclesreleveheel risegluteus maximus 16.1 10.87.8 2.3**gluteus medius 29.3 17.05.6 2.0**rectus femoris 36.9 18.021.1 15.6**adductor longus 24.2 13.59.9 5.9**gastrocnemius medialis 160.1 50.2129.3 50.8**gastrocnemius lateralis63.6 32.173.0 40.2**p<0.05 , * * p<0.01 ( paired t - test ) ) . the rm vs dm group showed significant differences in gma , gme , mg
( p<0.01 * * ) and al activities ( p<0.05 * ) , while no significant difference in rf and lg
activities ( table 2table 2.comparison of muscle activation between demi - plie movement ( dm ) and squat
movement ( sm ) ( meansd ) ( n=30)musclesdemi - plie 45squat 45gluteus maximus 19.6 12.510.7 4.6**gluteus medius 27.2 18.18.7 4.8**rectus femoris 53.0 1.043.8 16.0*adductor longus 14.6 9.213.6 3.7gastrocnemius medialis 13.6 6.99.9 3.7**gastrocnemius lateralis14.3 10.510.7 3.8*p<0.05 , * * p<0.01 ( paired t - test ) ) . * p<0.05 , * * p<0.01 ( paired t - test ) * p<0.05 , * * p<0.01 ( paired t - test ) in this study , the effect of hm vs. rm and sm vs. dm on 6 muscular activities in healthy
adults was examined by using emg . the hm is widely recommended for patients with weak lower
limbs to improve muscular force1 , 7 , and the hm and rm are important for
strengthening the lower limbs to improve medial and lateral mg that are important for ankle
stability7 , 16 , 17 . in addition , the hm and
rm are the same and involve maintaining abduction and extension of the ankle , knee , and hip
joints , while raising heels against gravity . however , in terms of the hip joint , the hm is
performed from the natural posture whereas the rm is performed from the hip abduction
posture ; in this regard , the most effective movement in muscular activation among these was
explored . using emg , muscular force change was observed with ballet movements in dance
majors , and muscular activation of gma , rf , and mg was high and the muscular force of these
muscles was higher than that of the upper limb muscular force12 , 18 , 19 . the statistically significant values of gma , gme , rf , al , mg and
lg activation at rm and dm were similar to those observed in prior studies . the sm is another lower limb exercise that greatly impacted the muscular forces such as the
quadriceps and mg . as the sm and dm involve the same type of closed - kinetic - chain exercises
simultaneously using ankle , knee and hip joint flexion but involve different start
positions , i.e. , the natural posture for sm and the abduction posture for dm , they were
performed to determine differences in muscular activation . the result showed that the
muscular activation of gma , gme , al , mg was higher in dm than in sm . this may be because of
the lower limb abduction posture and the straight hip and waist line - maintaining
movement18 , 20 . the study conducted by dong - cheon21 showed that the hip joint enhancing exercise ( this study is
muscular activation of hip joint movement ( hip adduction and hip abduction ) . ) resulted in
higher activation of gma and gme at hip joint adduction posture rather than at abduction
posture . the higher muscular activation at dm than at sm appeared , because the investigator
instructed the subjects to hold the hip and waist line straight by maintaining a slight
posterior pelvic tilting movement , and the hip joint extensor and the abdomen muscles were
activated owing to posterior pelvic tilting maintenance22 . bennell et al.23 reported improvement in lateral and internal rotator muscles that
are important to the hip and lower limb stability after ballet movement exercise at
abduction . therefore , the rm and dm are considered to have higher effect lower limb
activation due to posterior pelvic tilting movement at hip joint abduction posture whereas
the hm and sm are considered to have a lower effect than the rm and dm due to hip joint
movement performed at the natural position . this study results provide experimental evidence of significantly increased muscular
activation with ballet movements on the basis of a comparison between rm and dm compared to
the general lower limb movements ( hm and sm ) through statistical verification . these suggest
that the rm and dm could be used for rehabilitation for patients requiring improvement in
the force of gma , gme , rf , al , mg , and lg in the future . | [ purpose ] the aim of this study was to demonstrate therapeutic grounds for rehabilitation
exercise approach by comparing and analyzing muscular activities of ballet movements : the
releve movement ( rm ) and the demi - plie movement ( dm ) . [ methods ] four types of movements
such as rm vs. heel rise ( hm ) and dm vs. squat movement ( sm ) were randomized and applied
in 30 healthy male and female individuals while measuring 10-s lower limb muscular
activities ( gluteus maximus [ gma ] , gluteus medius [ gme ] , rectus femoris [ rf ] , adductor
longus [ al ] , medial gastrocnemius [ mg ] , and lateral gastrocnemius [ lg ] ) by using surface
electromyography ( emg ) .
[ results ] significant differences were found in gma , gme , al and
mg activities for dm and in all of the six muscles for rm , in particular when the two
groups were compared ( rm vs hm and dm vs sm ) .
[ conclusion ] the rm and dm have a greater
effect on lower limb muscular force activities compared to hm and sm and could be
recommended as clinical therapeutic exercises for lower limb muscle enhancement . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the prevalence of obesity , a multifactorial disease caused by a complex interplay between genetic predisposition and the environment , is constantly growing posing enormous health burden on societies worldwide . obesity is associated with a variety of metabolic and hormonal dysfunctions such as the development of insulin resistance and type 2 diabetes mellitus , leading to increased morbidity and mortality in the affected subjects . it is now widely accepted that , besides being an important energy depot , white adipose tissue , the predominant type of adipose tissue , is a metabolically active organ that may regulate a variety of systemic processes through the secretion of bioactive substances , collectively known as adipokines . serum adipokines concentrations are closely linked to the degree of obesity , and altered adipokines secretion is hypothesized to mediate the relationship between obesity , inflammation , insulin resistance , and cardiometabolic disease [ 5 , 6 ] . weight loss , through energy restriction and/or exercise , improves metabolic health and reduces morbidity and mortality associated with obesity . more specifically , losing 515% of initial body weight is associated with improved plasma lipid profile , decreased blood pressure , and increased insulin sensitivity . although the mechanisms that link weight loss to disease risk reduction remain uncertain , evidence suggests adipokines may play a role . for example , adiponectin is a fat - cell - derived hormone shown to be inversely related to body weight , visceral fat mass , and insulin resistance . overweight and obese individuals with higher adiponectin levels are more likely to show a favorable metabolic and inflammatory profile and hence less likely to develop cardiovascular obesity related cardiometabolic complications [ 10 , 11 ] . in recent years , it has been reported that the skeletal system also plays a role in the regulation of energy and glucose metabolism . the presumed protective effect of obesity on osteoporosis has urged researchers to think about the presence of hormones that affect both the bones and the energy metabolism . the first rodent studies showed that osteocalcin ( oc ) , which is secreted from osteoblasts , increased insulin secretion as well as insulin sensitivity . it has been shown in experimental animals that recombinant oc administration increases insulin sensitivity and adiponectin levels . demonstrated that oc is involved in glucose metabolism by increasing insulin secretion and cell proliferation in pancreatic -cells and by upregulating the expression of the adiponectin gene in adipocytes , thus improving insulin sensitivity [ 14 , 15 ] . studies in adults and children , although few in number , have shown an association between low oc levels and insulin resistance [ 1618 ] . recently , it has been reported that , in adults , circulating oc levels are associated with improved glucose tolerance and insulin secretion and sensitivity , independent of the plasma adiponectin level [ 19 , 20 ] . clinically , serum oc measurements and other bone makers may help in assessing fracture risk in patients with osteoporosis . they may be useful for monitoring therapy , predicting early response to therapy , and identifying noncompliance and nonresponders . to further understand the complex relationship between oc and circulating adipokines , we sought to study the effect of weight loss on different forms of serum oc and its relation to three of the most widely investigated adipokines , adiponectin , chemerin , and resistin and whether the changes in circulating adipokines are significant and independent predictors of changes in circulating oc levels . to the best of our knowledge , this is the first study investigating the changes in different forms of oc in relation to circulating adipokines following weight loss . a total of 102 consecutive obese nondiabetic male subjects were recruited from the nutrition clinic at king khalid university hospital , king saud university ( ksu ) . subjects with significant liver disease , renal failure , endocrine disorders , and smoking , or taking medications that could affect body weight or vitamin k level were not included in the study . forty - nine participants completed a four - month dietary program and were included in the final analysis . this study was performed at the obesity research center , college of medicine , riyadh , saudi arabia . the institutional review board approved this study and all participants gave informed consent . to evaluate changes in clinical and biochemical parameters in response to weight loss , subjects were given instructions folder listing different combinations of meals and snacks that collectively would provide 1,500 kcal / day . they then used their food lists to self - select three meals and two snacks a day during the duration of the study . subjects were also advised at the first visit to maintain a healthy lifestyle in general , but they did not participate in any organized physical activity programs . selected circulating adipokines , several metabolic parameters , and toc , coc , and uoc were measured before and after intervention . venous blood samples were collected between 8.00 and 10.00 in the morning after an overnight fasting and then centrifuged ( 1000 g , 10 min , 4c ) . anthropometric measures including height and weight were taken while the subject was wearing light clothing , and body mass index ( bmi ) was calculated . the waist circumference ( wc ; in cm ) was obtained , using an anthropometric tape , as the minimum value between the iliac crest and the lateral costal margin . body weight ( in kg ) was measured to the nearest 0.1 kg using a calibrated balance scale . bmi was calculated as body weight divided by height squared ( kg / m ) . serum glucose , triglycerides , total cholesterol , high - density lipoprotein ( hdl ) cholesterol , and bone - specific alkaline phosphatase ( bap ) were determined using dimension xpand plus integrated clinical chemistry autoanalyzer ( siemens healthcare diagnostics , usa ) . high - sensitivity c - reactive protein ( hscrp ) was measured using bn prospec nephelometer ( siemens healthcare diagnostics , usa ) . plasma insulin quantity was determined by electrochemiluminescence using cobas e411 immunoanalyzer ( roche diagnostics , usa ) . insulin resistance was represented using the homeostasis model assessment of insulin resistance ( homa - ir ) , which was determined according to the following equation : homa - ir = fasting plasma glucose ( mmol / l ) fasting plasma insulin ( mu / ml)/22.5 . serum levels of 25-oh vitamin d were determined using cobas e 602 automatic analyzer ( roche diagnostics , usa ) . circulating levels of adiponectin , resistin , and chemerin were determined using elisa kits ( r&d , usa ) . intra- and interassay coefficients of variations ( cvs ) for these parameters were chemerin intraassay cv = 4.3% interassay cv = 7.3% , adiponectin intraassay cv = 7.4% and interassay cv = 8.4% , and resistin intraassay cv = 4.7% and interassay cv = 8.4% . serum toc was measured using n - mid osteocalcin kit ( elecsys , roche diagnostic ltd . , the serum uoc and serum coc were measured using eia kits ( takara bio inc . the undercarboxylated eia kit uses a set of monoclonal antibodies reactive to the uoc and less reactive to coc at the amino acid positions 17 , 21 , and 24 . the carboxylated eia kit uses a set of monoclonal antibodies reactive to coc at the amino acid position 17 . the intraassay and interassay variabilities were , respectively , 5.7% and 6.2% for coc , 10.2% and 9.8% for uoc , and 3.4% and 3.6% for toc . descriptive statistics ( mean and standard deviation ) were used to describe the quantitative study and outcome variables . kolmogorov - smirnov test was used to test the data distribution . before the statistical analysis , a logarithmic transformation of the nonnormally distributed parameters was performed to approximate a normal distribution . student 's paired t - test was used to compare the difference of clinical and metabolic characteristics between baseline and 4-month time period of dietary control program . karl pearson correlation analysis was carried out to observe the correlation between changes in circulating uoc and uoc / toc and changes in selected anthropometric and metabolic variables after weight loss . multiple regression analysis was done by considering serum uoc and uoc / toc levels as outcome variables to observe whether the changes in these variables are explained by the other independent variables ( age , change in bmi , change in bap , and change in serum triglycerides ) . a p value of < 0.05 was considered as statistically significant . the mean age of 49 study subjects was 32.3 8.7 years ( range 2050 years ) . after 4 months on a dietary control program , bmi decreased significantly from 39.7 7.6 to 37.8 7.6 ( p < 0.001 ) . there was significant reduction in waist circumference , fasting blood glucose ( fbg ) , homa - ir , total and ldl - cholesterol , bap , and resistin ( p < 0.001 , except for homa - ir p = 0.02 ) . we found significant increase following the dietary control program in adiponectin , uoc , and uoc / toc ratio ( p < 0.001 ) , whereas hdl - cholesterol , triglycerides , hscrp , vitamin d , chemerin , toc , and coc were unchanged ( table 1 ) . at baseline , serum toc levels correlated negatively with fasting blood glucose ( r = 0.43 , p = 0.00 ) . serum uoc and uoc / toc ratio were positively correlated with ldl cholesterol ( r = 0.35 , p = 0.02 , and r = 0.31 , p = 0.03 , resp . ) . however , these associations disappeared following weight loss . serum triglycerides did not correlate with uoc at baseline but showed a negative correlation with uoc after weight loss ( r = 0.12 , p = 0.44 , and r = 0.29 , p = 0.05 ; figures 1(a ) and 1(b ) , resp . ) . bap was positively correlated with uoc at baseline and after weight loss ( r = 0.36 , p = 0.01 , and r = 0.37 , p = 0.01 ; figures 1(c ) and 1(d ) , resp . ) . in addition , following weight loss , uoc / toc ratio was negatively correlated with serum triglycerides ( r = 0.31 , p = 0.03 ) . we then assessed the relation between changes in circulating uoc and uoc / toc ratio and changes in serum adipokines and selected anthropometric and metabolic variables 4 months after the dietary control program . the changes in serum uoc levels were negatively correlated with changes in serum triglycerides ( r = 0.51 , p < 0.001 , figure 1(e ) ) and positively correlated with changes in bap ( r = 0.52 , p < 0.001 , figure 1(f ) ) . similarly , the changes in the uoc / toc ratio were negatively correlated with changes in serum triglycerides ( r = 0.64 , p < 0.001 ) and positively correlated with changes in bap ( r = 0.45 , p < 0.001 ) ( table 2 ) . in contrast , the changes in serum uoc and uoc / toc ratio were not significantly correlated with changes in bmi , wc , fasting blood glucose , homa - ir , serum cholesterol , hscrp , vitamin d , and circulating adipokines ( table 2 ) . the changes in serum uoc levels after the dietary control program were best explained by changes in serum triglycerides and bap ( r = 0.52 , p < 0.001 ) . similarly , the changes in uoc / toc were best explained by changes in serum triglycerides and bap ( r = 0.58 , p < 0.001 ) . this study showed significant reduction in waist circumference , insulin resistance , and serum resistin following a dietary control program . this finding is similar to other intervention studies showing a beneficial effect of weight loss on central obesity and insulin resistance . furthermore , weight loss resulted in a significant increase in serum adiponectin , uoc , and uoc / toc ratio . results of experimental studies on reciprocal bone - energy metabolism relationships mediated by adipokines and oc are fairly consistent . however , clinical data on the association between circulating adiponectin levels and oc are controversial . previous human studies reported a positive association between serum adiponectin and oc [ 2528 ] , whereas other studies were not able to demonstrate a significant and independent relationship [ 2931 ] . both elevated levels of circulating adiponectin and uoc are associated with an improvement in insulin sensitivity . although we noticed an increase in serum adiponectin and uoc and its ratio to toc after weight loss , we did not find these increments related to each other . our results support recent reports which showed that circulating oc levels are associated with improved glucose tolerance and insulin secretion and sensitivity , independent of the plasma adiponectin level [ 20 , 32 ] . emerging evidence has shown that resistin , a peptide hormone classified as an adipokine although in humans it is mainly produced by mononuclear cells and macrophages , is important in regulating insulin resistance , diabetes , inflammatory processes , immunity , and bone metabolism [ 33 , 34 ] . in older subjects with osteoporotic hip fracture , serum osteocalcin concentration was inversely associated with resistin and positively with leptin , leptin / resistin ratio , and adiponectin / resistin ratio . in multivariate regression models , osteocalcin was an independent predictor of serum leptin , resistin , leptin / resistin , and adiponectin / resistin ratios . we noticed a significant decrease in resistin level following the dietary control program , but this reduction was not associated with the increase in uoc level . therefore , it might be that the mechanism by which elevated uoc would cause an improvement in insulin sensitivity is not linked to circulating resistin levels . it has been previously reported that chemerin , a novel adipokine that is expressed and secreted at the high levels by adipocytes , is also expressed and secreted but at lower level by osteoblasts . secreted chemerin activates chemerin - like receptor 1 ( cmklr1 ) , a g - protein coupled receptor expressed by various cell types including osteoblasts . abrogation or knockdown of cmklr1 expression increased the expression of osteoblast markers , including alkaline phosphatase , and type i collagen . however , similar to other adipokines , the overall significance of chemerin to bone homeostasis and pathophysiology is currently unclear . we did not find any correlation between uoc and circulating chemerin levels at baseline or after weight loss . furthermore , the increase in uoc noticed after weight loss was not associated with a change in circulating chemerin . further studies will be required to investigate the relation between chemerin and bone cell function . for example , it has been shown recently that the increase in the accumulation of adipocytes and their secreted adipokines in bone marrow affects several aspects of bone remodeling . both uoc and uoc / toc ratio increased significantly after weight loss , but there was no increase in toc level . levinger et al . reported that uoc , but not toc , increased significantly following an exercise program in obese nondiabetic men . the discrepancy between the changes in uoc and toc after a dietary or an exercise program is pointing towards the fact that these two measurements might have different biological significance . it is after correcting for age and the change in bmi that 52% of the change in uoc and 58% in the change in uoc / toc ratio were explained by changes in bap and serum triglycerides levels ( p < 0.001 ) . both oc and bap are secreted by osteoblasts and considered as indicators of osteoblast function . the positive correlation between the changes in uoc and the changes in bap could be an indicator of the balance state of bone remodeling during the weight loss program . furthermore , the relation between serum triglycerides and oc is supported by recent human studies which have consistently reported inverse associations between circulating osteocalcin and components of metabolic syndrome in several populations [ 4042 ] , including our own study . in the present study we did not show a significant reduction in serum triglycerides level following the dietary control program . this could be explained by the relatively low triglycerides values in our patients at baseline and the small sample size . however , the modest changes in serum triglycerides level were associated with an increase in circulating uoc . this study would also help in clarifying the relationship between oc and some cardiometabolic risk factors in men . while the large study in australian men showed an inverse association between plasma oc and metabolic syndrome which seemed to be mediated by waist circumference , hyperglycemia , and hypertriglyceridemia ; other studies did not find the same . this contradiction could be partially explained by the reliance on the toc rather than the uoc measurements in these studies . we here confirmed that the uoc and the uoc / toc ratio were closely related to the change in serum triglycerides seen after weight loss and thus would be more useful than toc measurement in assessing the relation between oc and cardiometabolic risk . a limitation of our study is that we recruited only male subjects ; therefore the findings could not be extrapolated to females . second , we did not assess vitamin k intake which could influence oc and bone metabolism . however , we think that this did not affect our conclusions since all study subjects were maintained on a dietary program which is expected to provide the same amount of vitamin k. all participants were maintained on equal daily servings of green vegetables throughout the study period which is considered as the major source of vitamin k in food . furthermore , no subjects were taking medications that could affect vitamin k level . on the other hand , the prospective design of this study and the measurement of all three forms of circulating oc in association with several metabolic components and adipokines provide valuable information that could add significantly to the current literature . in conclusion , we have reported the effect of weight loss on different forms of serum oc and its relation with three adipokines , namely , adiponectin , chemerin , and resistin , in an obese male cohort . the increase in serum uoc and the uoc / toc ratio following weight loss the underlying mechanism by which weight loss causes an alteration in circulating oc level is most likely not related to circulating adipokines levels . | studies have suggested that osteocalcin , a bone formation marker , is related to body metabolism and insulin sensitivity . whether this relation is mediated through an interaction with adipokines
remains unclear .
the aim of this study was to assess the effect of weight loss on serum osteocalcin and its relation with three adipokines , adiponectin , chemerin , and resistin .
forty - nine obese nondiabetic males completed a four - month dietary program .
body mass index ( bmi ) decreased significantly from 39.7 7.6 to 37.8 7.6 ( p < 0.001 ) .
this was associated with significant reduction in waist circumference , fasting blood glucose , homa - ir , total and ldl - cholesterol , bone - specific alkaline phosphatase ( bap ) , and resistin ( p < 0.05 ) .
there was significant increase in serum adiponectin and undercarboxylated osteocalcin ( uoc ) ( p < 0.001 ) . the changes in uoc levels were negatively correlated with changes in serum triglycerides ( r = 0.51 , p < 0.001 ) and positively correlated with changes in bap ( r = 0.52 , p < 0.001 ) . in contrast , the changes in uoc were not correlated with changes in bmi , waist circumference , fasting blood glucose , homa - ir , total and ldl - cholesterol , hscrp , vitamin d , and circulating adipokines .
we concluded that the increase in serum uoc following weight loss is not related to the changes in circulating adipokines levels . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
persons with multiple sclerosis ( ms ) , even when having limited neurological disability , appear to be less physically active when compared to age - matched controls . therefore , they may lack , at least partially , the positive effects of physical activity on general health and ms - related changes in body structure , body functions , activities , and participation . the beneficial effect of exercise training on walking mobility among individuals with ms has been extensively documented and the evidence of improvements in quality of life and fatigue is supportive [ 2 , 4 ] . although the underlying mechanisms remain to be elucidated , vascular comorbidities have been associated with an increased risk of disability progression in ms . taken together , increasing physical activity levels in ms may be important to reduce morbidity and disability progression . unfortunately , the barriers to be physically active are multiple and include illness perceptions that exercise might facilitate ms relapses . meanwhile , it has been shown that intensive physical exercise does not lead to increased relapse rate . fatigue , one of the most prevalent ms symptoms , occurs in up to 80% of persons with ms and is the most disabling symptom in many of them . no consensus on the relationship between fatigue and disease - related variables has been reached . reduced self - efficacy for exercise and lack of appropriate infrastructure were equally perceived as barriers by persons with ms living in the community . in view of the multiplicity of barriers , professional guidance has been proposed to motivate and support persons with ms to be physically active . in the context of an awareness project to promote physical activity and participation in ms , pva initialized an andes trekking for 10 persons with ms , with machu picchu ( peru ) as final destination , http://www.msmachupicchu2012.be/. the opportunity of providing professional coaching and medical support during training , travelling , and expedition was taken to prospectively collect data on disease activity , fatigue , illness perception , walking abilities , and self - efficacy for exercise during a 10-month period . ten candidates were recruited by neurologists and physiotherapists affiliated with the ms center in melsbroek and the fitness center fit up in kontich , belgium . only patients with a mild or moderate degree of neurological disability due to ms and a high potential of motivation were considered . after the first meeting in march 2012 , one woman decided not to continue . among other reasons , she did not want to have her diagnosis to be known in the public domain . nine accompanying persons with a medical or physiotherapeutic background were also involved from the start : 3 physiotherapists , 1 exercise physiologist , 2 coaches , 1 general physician , 1 neurologist , and 1 medical student . the study protocol was approved by the leading ethical committee of the university hospital leuven and the local ethical committee of the ms center , melsbroek , belgium . longitudinal data were collected on medical and ms variables , fatigue , self - efficacy , walking disability , and illness perception . at the first meeting , defined as time point 0 ( t0 , 6 months prior to the expedition ) demographic , medical , and ms variables were collected , including the expanded disability status scale ( edss ) , assessed by the treating neurologist . self - reported medical events , relapses and disability , fatigue , walking ability , and self - efficacy for exercise were registered every 2 months resulting in 5 assessments : 1 at the start of the training ( t1 ) , 2 during the training period ( t2 , t3 ) , and 2 following the expedition ( t4 , t5 ) . illness perceptions were assessed at 3 time points ( t0 , t1 , and t5 ) . we used the self - assessment scale of disability developed for the european study on costs and quality of life in ms [ 14 , 15 ] , which is based on the original validated description in the expanded disability status scale ( edss ) and on the patient determined disease steps instrument ( pdds ) . subjects are asked to select from a series of statements describing limitations and walking disability . the self - assessment scale of disability allows participants to be categorized into 11 steps of disability , from 0 to 10 , corresponding to edds scores . the fatigue scale motor cognition ( fsmc ) was used to assess ms - related cognitive and motor fatigue in ms in 20 items . cut - off values for the composite score and the cognitive and motor components allow patients to be classified as mildly , moderately , or severely fatigued . ( msws 12 ) [ 18 , 19 ] , a reliable and valid patient - reported measure , assesses the impact of ms on walking ability . the exercise self efficacy scale ( eses ) is a 10-item questionnaire that uses a 4-point likert 's scoring system . the eses is reported to be reliable and valid in patients with spinal cord injury and has been used previously in ms patients [ 6 , 21 ] . the brief version of the illness perception questionnaire ( ipq ) assesses the beliefs that individuals construct about their disease . five items assess cognitive illness representations , 2 items assess emotional representations , and 1 item assesses illness comprehensibility . a sum score can be calculated . the scale has a good test - retest reliability and concurrent validity with relevant measures . to improve our understanding of how participants experienced this expedition , potential changes in thoughts , illness beliefs , and self - esteem were asked , as well as the contributing factors and messages for the ms community . for some analyses , a distinction was made between persons with edss 4 at baseline compared to those with a lower score . we used the wilcoxon signed - rank test because measurements of continuous dependent variables were available . five months prior to the expedition , subjects performed a maximal graded exercise test on an electronically braked cycle ergometer ( ebike basic , general electric gmbh , bitz , germany ) . ventilatory parameters and heart rate were continuously monitored by a 12-lead ecg device ( jaeger oxycon , erich jaeger gmbh , germany ) . following a 10 min warm - up at 40 w , subjects were seated on cycle ergometer for three minutes to obtain resting data . next , subjects were instructed to cycle at a rate of minimum 70 rpm , against a starting workload of 40 w. hereafter , workloads were increased every 3 min by 40 w ( ) and 30 w ( ) until voluntary exhaustion . just before workloads were increased , heart rate was registered , and capillary blood lactate ( accutrend plus , roche diagnostics limited , sussex , uk ) , oxygen uptake , and respiratory exchange ratio were measured . based on the results , a personalized training schedule was provided in may 2012 ( t1 ) . the maximal graded exercise test a was repeated 6 weeks after the expedition . on september 20 , 2012 , the group flew from brussels , belgium , to lima , peru . a flight to arequipa ( 2,300 m ) and a trip to the colca canyon valley , getting over 4,900 m , introduced altitude experience . the flight to cusco ( 3,400 m ) and a bus trip on september 27 brought the group to the start of the 5-day salkantay trekking . the estimated altitude at start , altitude meters , walking time , and distance are given in table 1 ( data obtained by garmin gps ) . walking was also measured by accelerometer ( actibelt , sylvia lawry center , munich , germany ) . the performance of participants was monitored by heart rate measurements ( polar ) and regular self - reported rating of walking ability and energy levels , to adapt walking pace and rest breaks when necessary . horse assistance was provided when necessary and feasible ( steepness ) during the first 3 days . because the effort was estimated to be too strenuous , parts of the trail during the last 3 days have been done by bus . the three participants with edss 4 presented with cardiovascular risk factors ( two with smoking and one with obesity ) . training schedules started from low levels in 3 ( group 3 ) , from intermediate levels in 4 ( group 2 ) , and from high levels in 2 participants ( group 1 ) . each group contained one male representative . during run - in ( t0-t1 ) , one subject was treated with steroids for a relapse . another patient experienced increased fatigue and dizziness after having crossed high altitudes ( > 4000 m ) . most subjects got some experience with altitude sickness at altitudes of 3600 m or more . transient sensory complaints were mentioned and increased equilibrium disturbances were observed in several participants , without evidence for a relapse . walking measurement by accelerometer revealed , across 5 days , an average step count of 17409 with an average daily step ratio of 94 , 8% between start and end . in the months following the expedition , four patients reported increased neurological symptoms , suggestive of a relapse . for two subjects , compared to pre , heart rate at 40 w ( pre : 117 14 b / m versus post : 108 12 b / m , p = 0.09 ) and at the aerobic threshold ( pre : 137 8 b / m versus post : 141 9 b / m , p = 0.08 ) tended to be , respectively , lower and higher following the training and expedition period . furthermore , post workloads at the anaerobic threshold ( pre : 123 43 w versus post : 132 41 w , p < 0.05 ) were lower and peak blood lactate concentrations were higher after the training and expedition period ( pre : 8.44 1.0 mmol / l versus post : 9.6 1.3 mmol / l , p < 0.05 ) . although fluctuations in self - reported disease steps were observed in all subjects , only the three participants with edss 4 at baseline reported a sustained increase . in two of them , this increase followed a very low , self - assessed disease step at baseline ( 0 or 1 ) . when using the wilcoxon signed - rank test to compare fatigue scores at the different time points , a statistically significant difference was obtained for motor fatigue when comparing t1 and t5 ( p = 0.007 ) . median values for motor fatigue appeared to be reduced persistently in participants with mild disability ( edss < 4 ) . longitudinal data of the number of patients with their graded fatigue for the sum , cognitive , and motor subscale of the fsmc are shown in figure 2 . when compared with baseline , fewer participants reported severe ms - related fatigue just before the expedition ( t3 ) . overall , self - reported walking abilities and self - efficacy for exercise did not change significantly over time . however , the higher median values of the msws 12 in participants with edss 4 at baseline tended to decline transiently . several subjects reported a less dominant perception of ms as they expressed having a life with ms , to make their own decisions and get respect from family and friends . although most participants reported feeling stronger , some of them also expressed the hard confrontation with limitations due to ms . the experience of wellbeing when being physically active , the support from family , friends , and ms community , and professional coaching were experienced as very helpful and encouraging . the messages to other people with ms included advices to be physically active , to be open for new experiences , and to never give up . in the context of an awareness project to promote physical activity and participation in ms , we obtained prospective information on medical and disease variables , fatigue , illness perception , walking abilities , and self - efficacy for exercise from 6 months before and up to 4 months after the expedition in the 9 selected candidates . three minor medical events ( 3 subjects ) , 7 relapses ( 5 subjects ) , and sustained neurological worsening ( 3 subjects ) were reported in six participants . we found a significant reduction of motor fatigue at the last assessment ( t5 ) when compared with the first ( t1 ) . when stratifying the results based on the degree of disability ( having reached edss 4 or not ) , the persistence of motor fatigue tended to be more evident in participants with mild disability . cognitive fatigue , self - efficacy , and self - reported walking abilities did not change significantly . the perceived illness consequences , identity , and concerns appeared to be declined over time . the relapse rate during the observational study period did not markedly differ from the relapse rate in the year before . steroids were given for 2 of the 3 ms relapses before and for 1 of the 4 relapses after the expedition . the three subjects with self - reported neurological worsening at t3 had reached edss 4 at baseline . because they reported no further worsening at later time points , their estimation at t3 may have been more realistic than initially . remarkably , the three participants , with no cardiovascular risk factors or comorbidities and mild disability at baseline , were event - free . although we have not measured physical activity in the community , the tentative changes in exercise tests before and after the expedition support a training effect . during the trekking , the efforts by participants , as based on heart rate monitoring and step counts , corresponded to highly active walking when compared to habitual community walking . the observation of reduced fatigue in association with training is in line with previous findings . a recent systematic review of interventional studies concluded that physical exercise has the potential to reduce fatigue in ms . however , findings were heterogeneous and only a few studies have evaluated fatigue as the primary outcome measure . the fsmc scale is a new scale and is able to consistently distinguish between motor and cognitive components of fatigue in ms . even though both fatigue components are not completely independent , increased physical activity for several months is a strong candidate to reduce motor fatigue . a treatment effect of natalizumab has been reported over 12 months , with parallel declining scores for motor and cognitive fatigue components . our findings suggest differences in the pattern of changes in motor versus cognitive fatigue in relation to training and disability . the reduction of motor fatigue appeared to be more evident in mildly disabled patients whereas the severity of cognitive fatigue remained rather stable over time in all participants . because of the correlations of the motor fatigue subscale with edss and the start of the progressive phase of ms around edss 4 , changes in subjects with moderate disability may be more difficult to obtain and to maintain . the role of motivation , participation , professional coaching , social support , illness beliefs , reduced anxiety and depression , or a combination of these factors may also have played a role in reducing fatigue before and/or increasing fatigue after the expedition . as stated in the systematic review , the social interaction component , present in many positive studies , may affect the perception of fatigue . participants in our study not only increased their levels of physical activity but also played an ambassador role in informing the ms community . overall , there were no longitudinal changes in the msws-12 and the ses for exercise . however , in the subgroup of subjects with higher disability , the msws-12 scores transiently tended to decline before returning to baseline levels at the final assessment . the validation of the msws-12 in ms patients with , on average , a substantial mobility limitation suggests that the sensitivity to detect changes in mild ms may be limited [ 18 , 25 ] . instead of changes in perceived walking ability , they may have changed overall physical activity levels reflecting habitual performance . the overall high scores on the ses were indicative of a high self - efficacy for exercise . the belief in one 's capabilities to take the necessary actions required for adhering to exercise has been strongly associated with physical activity in a recent longitudinal study of individuals with ms . the significance of the final decline in self - efficacy in subjects with moderate disability remains to be determined . the assessments of cognitive and emotional representations of illness suggest a reduction in the perceived adverse consequences , the signs and symptoms perceived to be part of ms ( identity ) , and the expression of concerns . together with the message for the ms community to be open for new experiences , expressed by several participants , our data suggest a less dominant and less negative perception of ms . when diagnosed with ms , uncertainty and potential functional loss are leading to overall anxiety and threatening health - related quality of life . in an attempt to make sense of this illness experience , individuals construct cognitive models about ms . these beliefs are thought to be important for determining an individual 's response , which is then appraised for efficacy . evidence suggests that illness representations relate to later outcomes in several conditions [ 2830 ] . while cross - sectional studies have reported associations with health - related quality of life , adjustment , depression , self - esteem , and activities of daily life [ 27 , 30 , 31 ] , no longitudinal data have been published in ms . interventions addressing negative illness cognitions may potentially improve health - related outcomes . in the context of our study , participation and professional guidance of persons with ms including information , motivation , and support may have contributed to changing these beliefs . second , individuals were selected on motivation and disability , given that this was the first expedition that focused on feasibility rather than proposing a standard intervention for all . we can not generalize our findings to persons with ms with severe disability , even though we aim to encourage all persons with ms to be physically active and to participate in the community with an active lifestyle . third , the intervention included but was not limited to physical training . in the absence of a control group , we can not exclude random or time - dependent changes in the severity of ms - related fatigue or illness perceptions . fourth , the small sample did not allow us to look for interaction effects in participants with mild and moderate disability ( n = 2 only ) . fifth , the occurrence of medical events , relapses , and neurological worsening was primarily based on judgement by the participant . nevertheless , confirmation by the treating physician was asked and information about ms diagnosis , comorbidities , and edss was obtained from the treating neurologist . this 10-month observational study allows concluding that physical training and participation to a unique expedition has been feasible for the selected individuals with ms . all of them either had moderate disability , cardiovascular risk factors , and/or comorbidities at baseline . further studies in ms are needed to address the role of disability , disease stage , cardiovascular risk factors , and comorbidities in training and the severity of fatigue . distinguishing motor and cognitive fatigue and assessing illness perceptions may help to clarify the underlying mechanisms of ms - related fatigue . | persons with multiple sclerosis ( ms ) are less physically active than nondiseased persons and often report low self - efficacy levels . in the context of an awareness project to promote physical activity and participation in ms
, we addressed the impact of training for and participation in a unique expedition .
medical events , relapses , and self - reported neurological worsening were followed from 6 months before and up to 4 months afterwards . validated patient - reported outcome measures were used to assess fatigue , self - efficacy in exercising , walking abilities , and illness perception .
nine participants completed the training , expedition , and observational study .
minor events , relapses , and/or neurological worsening were reported in six participants .
the three participants with mild disability and no cardiovascular risk factors or comorbidities were free of medical and neurological events .
we found a significant reduction of motor fatigue at last when compared with the first assessment .
the reduction tended to be more evident in participants with mild disability ( expanded disability status scale ( edss ) < 4 at baseline ) .
cognitive fatigue , self - efficacy , and self - reported walking abilities did not change significantly .
illness perceptions tended to be reduced over time in the domains of consequences , identity , and concerns .
overall , no major adverse events occurred . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the most effective treatment to fight cancer is still early diagnosis . on the other hand , it is known that the correct classification of the tumor , coupled to a suitable therapy and to a stringent follow - up , helps to prevent and detect relapses . cancer is a very heterogeneous disease , and , at the diagnostic level , is defined by many indexes such as histological grade , tumor stage , patient age , sex and , more importantly , genetic background and profiles . histological evaluation of tumor specimens obtained from tissue biopsy is the gold standard of diagnosis , but often tumors with the same histopathological features respond differently to the same therapy . new generation diagnostic platforms , previously unavailable , have enabled to better characterize transcriptomic signatures that predict tumor behaviour , helping to define diagnosis , prognosis , and the most appropriate therapies [ 13 ] . tumor biomarker discovery in biological fluids , such as serum , plasma , and urine , is one of the most challenging aspects of proteomic research . many researchers have attempted to identify biomarkers in serum that reflect a particular pathophysiological state . since the expressed proteins , native , fragmented , or posttranslationally modified , quickly change in response to environmental or pathological stimuli , the serum proteome is considered dynamic , oppositely to the stable nature of the genome . proteins and their functions can determine the phenotypic diversity that arises from a set of common genes . the study of the serum proteome highlights differences in protein expression reflecting a specific pathological state and provides useful information to diagnose a disease , to evaluate prognosis or therapy response . single or a small number of serum - based biomarkers indicative of cancer progression , such as prostate - specific antigen ( psa ) , alpha - fetoprotein ( afp ) , ca-125 , ca-15.3 , ca-19 - 9 , or cea for prostate , liver , ovary , breast , pancreas , or colon cancer , are currently used . most of these molecules have been isolated from animals immunized with tumor cells extracts or cell lines , with subsequent screening for monoclonal antibodies against cancer - associated antigens . the above - mentioned proteins increase the accuracy of diagnosis , even though there is an urgent need to isolate and use in clinical practice more specific biomarkers , or groups of biomarkers , to precisely characterize the disease at the diagnostic or prognostic level and to monitor its progression [ 7 , 8 ] . biomarkers could also help to predict the response of the patient to anticancer therapy and thereby to guide physicians in choosing the best treatment . this research is more appealing due to the simplicity of obtaining blood samples , but , at the same time , shows limits due to the complexity of the serum protein mixtures . a plethora of molecules from almost every tissue of the body can be found in human serum / plasma . many of the serum proteins are present at very low concentrations ( less than pg / ml ) , while others are present in very large amounts ( more than mg / ml ) . serum and plasma are very complex mixtures of proteins and exhibit a broad dynamic range of relative abundance ( up to 12 orders of magnitude ) . they contain thousands of proteins , whose some are very abundant ( e.g. , albumin , immunoglobulins , apolipoproteins ) and constitute approximately the 95% of the total protein content , but only the 0.1% of total protein species [ 10 , 11 ] . for these reasons , it is thought that many potentially important proteins and markers , if present at low concentrations , can escape the detection . evidences show that the circulating fragments from unmodified or post - translationally modified proteins generated in the tumor tissue microenvironment can be used as diagnostic or prognostic markers . proteolysis within the tissue or deregulated post - translational events ( e.g. phosphorylation ) generate protein fragments that diffuse into the circulation and could give information about the presence or the progression of the disease , then facilitating the management of the tumor . among these fragments , the fraction with low molecular weight , the peptidome ( < 20 kda , lmw peptides ) , is protected from renal clearance by interaction with abundant serum proteins and , in particular , seems to be an important source of biomarkers . in order to simplify the biomarker discovery process these useful precursors of proteomic analysis include the use of immobilized dyes ( cibacron blue ) [ 13 , 14 ] , immunoaffinity - based techniques [ 15 , 16 ] , solid phase fractionation , liquid chromatography , or low - molecular weight fraction enrichment [ 1921 ] . a promising method under investigation is based on the use of n - isopropylacrylamide ( nipa ) nanoparticles which allow a fast one - step capture and concentration of analytes less than 2025 kda in molecular weight [ 2224 ] . at the same time , the nanoparticles are able to protect the proteins from the degradation due to the ex vivo enzymatic activity of serum proteases , and , when conjugated with suitable chemical baits , show higher capability to sequester and retain many different proteins from whole serum , on the basis of their chemical and physical properties . with this method , the captured analytes can be recovered by a simple electroelution and then analyzed by hplc - ms / ms , western blotting or immunoassays for complete molecular characterization . to reduce the complexity of serum proteome , the analysis of glycosylated proteins ( glycoproteome ) has received great interest , because of the glycoproteic nature of the currently used cancer biomarkers . two major methods have been developed to enrich glycoproteins or glycopeptides , based on chemical capture ( reaction between aldehyde groups and hydrazide ) [ 29 , 30 ] and lectin - affinity capture ( specific recognition of protein glycan moieties by lectins ) . many studies have been focused on the identification of new serum biomarkers by mass spectrometry ( ms ) . this powerful method enables to identify a protein without requiring the knowledge of its amino acid sequence . further improvement of this technology has provided high accuracy to define mass - to - charge ratio ( m / z ) and to generate high - resolution spectra . in addition , the development of tandem mass spectrometry ( ms / ms ) , able to provide de novo protein sequence information , has enhanced the applications of this technology in proteomics [ 32 , 33 ] . different combinations of ionization sources ( e.g. , maldi , esi ) , analysers ( e.g. , time of flight tof , quadrupole , fourier transform and quadrupole ion traps ) , and fragmentation methods ( e.g. , cid collision induced dissociation , etd electron transfer dissociation ) can be used . maldi - tof ( matrix - assisted laser desorption / ionization - time of flight ) is based on a soft ionization method where a laser beam generates evaporation of a crystallized sample - matrix mixture . maldi is used in biochemical areas for the analysis of proteins , peptides and oligonucleotides . surface - enhanced laser desorption / ionization time - of - flight ( seldi - tof ) , a modification of maldi - tof , allows the identification of proteins differentially expressed in serum by applying a small amount of sample directly on an array surface involving various chromatographic models based on classical chemistries ( i.e. , normal phase , hydrophobic , cation- and anion - exchange ) , affinity - coated surfaces ( imac , immobilized metal affinity capture ) , or biomolecular affinity probes [ 5 , 35 , 36 ] , with minimal requirements for purification and separation . the results are shown by a mass spectrum identifying m / z ratios and peak intensities of peptides / proteins . data preprocessing ( i.e. , calibration , baseline correction , normalization , peak detection , and alignment ) , bioinformatic and statistical analyses are performed in order to highlight and characterize any protein differentially expressed . liquid chromatography / electrospray ionization tandem mass spectrometry ( hplc / esi - ms / ms ) technology is an alternative approach for serum biomarker identification . the mixtures of analytes are subjected to hplc then the solution is nebulized under atmospheric pressure and exposed to a high electrical field which generates a charge on the droplets ' surface . due to the evaporation , droplets become much smaller and enter into the analyzer . hplc - esi - ms / ms couples protein fractionation with mass spectrometry , where peptide sequence tags can be produced from peptide fragments . tandem mass spectrometry and data analysis by suitable bioinformatic tools , algorithms and databases , provides a powerful method to characterize peptides at the aminoacidic level , allowing a highly refined analysis . the use of mass spectrometry for serum biomarker discovery is quite simple : spectral peaks ( plots representing on the x - axis the m / z ratios of ions , and on the y - axis the detected ion abundance ) , are identified in a pathological group and compared with those obtained from normal control groups . essentially four strategies have been used in ms biomarker discovery : analysis of polypeptides separated by electrophoresis or chromatography , with or without prior fragmentation ; analysis of enzymatic peptide fragments separated by hplc and then analyzed by esi or maldi ; analysis of proteins adsorbed on a solid surface ; and analysis of specific serum fractions , such as the peptidome or the glycoproteic fraction . due to the lack of effective screening test , these methods have been applied to the serum biomarker discovery in many tumors , including those with high mortality , such as ovary , lung , liver , and pancreatic cancer . here we report the results of studies focused on serum biomarker identification in the above - mentioned types of cancer . several protein profiles and specific proteins ( tables 1 , 2 , 3 , and 4 ) have been characterized and classified as putative biomarkers . despite advances in cancer therapy , mortality due to ovarian cancer is usually diagnosed at a late clinical stage in more than 80% of patients . in this group , by contrast , the 5-year survival for patients with stage i ovarian cancer is more than 90% and surgery alone can be used as elective therapy . cancer antigen 125 ( ca-125 ) is the most widely used biomarker for ovarian cancer . elevated levels of ca-125 are detected in about 80% of patients with advanced - stage disease , but they are increased in only 5060% of patients with early stage ovarian cancer . the calculated positive predictive value for ca-125 , considered as a single marker , is less than 10% , but this value was improved by ultrasound screening methods . analysis of sera by tof - ms provided specific signature patterns which can be compared to distinguish ovarian cancer from benign disease or normal individuals . a training set of 50 sera from unaffected women and 50 from patients with ovarian cancer were analyzed by seldi / tof by using a c16 hydrophobic interaction protein chip . an algorithm identified a proteomic pattern able to distinguish cancer from non - cancer subjects . the pattern was then used to differentiate an independent set of 116 samples ( 50 ovarian cancer , 66 non - malignant disease or unaffected ) , yielding 100% sensitivity and 95% specificity . some of the characteristic ion peaks in the previous signature have been sequenced and described in an independent cohort of ovarian cancer sera . one hundred nine serum samples from ovarian cancer patients , 19 sera from individuals with benign tumors , and 56 from healthy donors were analyzed on strong anion - exchange surface using seldi - tof . three panels of candidate protein biomarkers were obtained ( 1st : 4.4 kda , 15.9 kda , 18.9 kda , 23 kda , 30.1 kda95.7% sensitivity , 82.6% specificity ; 2nd : 3.1 kda , 13.9 kda , 21.0 kda , 79.0 kda , and 106.7 kda81.5% sensitivity , 94.9% specificity ; 3rd : 5.1 kda , 16.9 kda , 28 kda , 93 kda72.8% sensitivity , 94.9% specificity ) . the protein panels correctly diagnosed 41/44 blind test samples : 21/22 malignant ovarian cancers , 6/6 low malignant potential tumors , 5/6 benign tumors , 9/10 normal individuals . a four - peak model ( m / z 6195 , 6311 , 6366 , 11498 ) , performing better than ca-125 , has been identified for diagnosis or monitoring of the therapy in ovarian cancer . this study was conducted on a training ( 31 primary cancer , 16 benign ovarian disease , 25 healthy controls ) and a blind test set ( 23 ovarian cancer , 15 benign , 5 normal ) . the four peak model showed a sensitivity of 90.8% and a specificity of 93.5% in the training set , and a sensitivity of 87% and a specificity of 95% in the blind test set in discriminating cancer from non cancer patients . analyzed mass spectrometry peak differences in 35 ovarian cancer patients and 16 disease - free subjects . proteomic profiles distinguished early - stage from advanced cancer with a sensitivity of 80% and a specificity of 93% . an et al . developed a glycomic approach to identify oligosaccharide markers for ovarian cancer by analyzing ovary cell lines supernatants and then confirming their presence in sera from patients and healthy controls . changes in glycosilation were monitored by maldi - fourier transform ion cyclotron resonance - ms . approximately 15 unique serum glycan markers were detected in all patients and were absent in controls . analyzed glycan markers and ca-125 levels in 48 sera from ovarian cancer women and 24 controls . sixteen unique oligosaccharide signals were identified in most of the cancer patients ( 44/48 ) and just in 1/24 controls ( sensitivity 91.6% , specificity 95.8% ) . several proteins involved in inflammatory processes and acute - phase response have been identified as putative biomarkers for ovarian cancer . in a study by zhang et al . aliquots were bound in triplicate with a randomized chip / spot allocation scheme to imac3-cu , sax2 , h50 , and wcx2 protein chip array . for biomarker identification , proteins were purified , separated by sds - page , and analyzed by ms / ms . three proteins / protein fragments , described as acute - phase reactants ( apolipoprotein a1 , m / z 28043 , a truncated form of transthyretin , m / z 12828 , and a fragment of inter--trypsin inhibitor heavy chain h4 , m / z 3272 ) , were identified as putative biomarkers able to improve the detection of early stage ovarian cancer . . identified by seldi an 11.7 kda peak showing higher intensity in cancer sera . after protein purification and lc - ms / ms analysis , the alpha chain of haptoglobin , an acute phase reactant , was identified and further validated by western blot and elisa as a potential biomarker for ovarian cancer , by using a specific polyclonal antibody against the peptide identified by ms / ms analysis . the marker was 2-fold - expressed in cancer sera and had 64% sensitivity and 90% specificity when used alone , or 91% and 95% sensitivity and specificity , if combined with ca-125 . after high abundance protein removal and two - dimensional gel electrophoresis ( 2-de ) , ahmed et al . performed nanoelectrospray quadrupole - quadrupole time of flight mass spectrometry ( n - esiq-(q)tof - ms ) and maldi / tof analysis on six protein spots over - expressed in cancer sera . protein isoforms of haptoglobin - i precursor ( hapi ) , a liver glycoprotein present in human serum , were identified as putative novel biomarkers and confirmed by 2-de and western blotting on the serum from healthy controls and grade 1 and 3 ovarian cancer patients . bergen iii et al . analyzed by nano - lc - esi - tof - ms or fourier tranform ion cyclotron resonance ( ft - icr ) the low molecular weight serum fraction obtained by ultrafiltration and identified several candidate biomarkers . among these , the fibrinopeptide - a , already described as involved in acute phase reactions and elevated in many cancer including ovary , was detected . two peaks ( 11.7 and 11.5 kda ) were identified by seldi - tof in thermostable plasma fractions from 27 ovarian cancer and 34 control sera . a method involving cysteine modifications , 2-de , and hplc allowed to characterize the peaks corresponding to serum amyloid a1 , an acute phase reactant , and its n - terminal arginine truncated form . . identified by micro - lc - ms / ms four biomarkers for early stage ovarian cancer ( transthyretin , apolipoprotein a1 , transferrin , and beta - hemoglobin ) , corresponding to already described 13.9-ttr- , 12.9-ttr- , 15.9-hb- , 28-apoai- , 79-tf - kda seldi peaks . differential expression of these proteins in sera was also confirmed by western blot and elisa . lopez et al . set - up a workflow using carrier protein - bound affinity enrichment of serum samples directly coupled with maldi / tof . the procedure was able to identify several specific biomarker panels to differentiate stage i ovarian cancer from unaffected and age - matched women . among the peptides identified , proteins involved in inflammatory processes ( complement component 3 precursor , complement component 4a preprotein , inter - alpha globulin inhibitor h4 ) , as well as the glycosyltransferase - like 1b , a peroxisomal oxidation enzyme ( d - amino - acid oxidase ) , two proteins involved in cancerogenesis ( transgelin 2 , casein kinase ii alpha 1 subunit isoform a ) , fibrinogen alpha chain isoform alpha preprotein , and keratin 2a were described as putative biomarkers . in a study on sera from patients with ovarian cancer , compared with sera from patients with benign masses or different type of cancer , it has been shown that the chemokines cc2 motif ligand 18 ( ccl18 ) and cxc motif ligand 1 ( cxcl1 ) , identified by maldi - ms / ms analysis and further validated by elisa , can be considered as novel circulating tumor markers for differential diagnosis between ovarian cancer and benign masses ( sensitivity 92% , specificity 97% ) . a nested case - control study performed on 295 sera from women pre - dating their ovarian cancer diagnosis and 585 matched control samples , showed that two peaks identified by maldi , described as the connective tissue - activating peptide iii ( ctapiii ) and the platelet factor 4 ( pf4 ) , can be associated with ca-125 to improve early diagnosis . studied by seldi - tof 35 sera from ovarian cancer patients in comparison to 10 from normal women . after protein purification and n - terminal sequencing , hemoglobin- and chains were described as corresponding to the most distinctive peaks differentially expressed ( 15.1 and 15.8 kda ) . elisa validation test for intact hemoglobin indicated a sensitivity of 77% in sera from ovarian cancer patients . as above - mentioned , hemoglobin was also described as a putative ovarian cancer biomarker in a study by kozak et al . . liver cancer is often diagnosed at very late stage and is associated to poor prognosis , high recurrence and mortality . hepatocellular carcinoma ( hcc ) , the most frequent liver neoplasm , is the fifth most common cancer , affecting approximately one million people every year , with an incidence almost corresponding to death rate and a 5 year survival ranging from 17% to 50% . some predisposing factors , such as viral infections , diabetes , metabolic syndromes , exposition to aflatoxin , or alcohol consumption , are frequently related to liver tumor initiation . this allows a management of the patients at risk , making it possible in some cases to diagnose the disease earlier . the most important liver cancer serum biomarker is alpha - fetoprotein ( afp ) , an oncofetal glycoprotein with elevated levels in patients affected by cirrhosis and hcc . the sensitivity and specificity of afp range between 6080% and 7090% , respectively . for this reason , many studies have been focused on characterizing differentially expressed proteins in sera from patients affected by liver cancer or predisposing diseases and , similarly to ovarian cancer , proteomic profiles and proteins have been identified . a total number of 117 hcv - positive sera from 39 patients affected by low - grade fibrosis , 44 with cirrhosis without hcc , and 34 with both cirrhosis and hcc were preprocessed by anion - exchange fractionation and analyzed by seldi - tof . a four markers panel ( 7486 , 12843 , 44293 , 53598 da ) identified hcc with a sensitivity of 100% and a specificity of 85% in a two - way comparison of hcv - cirrhosis versus hcv - hcc training set . sensitivity and specificity for the correct identification of hcc were 68% and 80% for random test samples . fibrosis patients were distinguished from cirrhotic using a five marker panel ( 2873 , 6646 , 7775 , 10525 , 67867 da , sensitivity and specificity 100% and 85% , 80% and 67% in the training and random test samples , resp . ) . after purification , ms / ms analysis and immunoassay validation , the 6646 da protein was identified as apolipoprotein c - i and described as a marker to differentiate liver fibrosis from cirrhosis . seldi - tof protein - chip technology was applied to analyze sera from patients affected by hcv - associated chronic liver diseases with ( 64 samples ) or without ( 77 samples ) hcc . samples were randomly split into two analysis groups . six selected protein peaks ( m / z 3444 , 3890 , 4067 , 4435 , 4470 , 7770 ) gave information to perform early diagnosis and to distinguish hcc from chronic liver disease in the absence of hcc ( sensitivity and specificity 83% and 76% ) . the model was also applied to the analysis of sera from 5 subjects hcc - free and from 7 hcc patients collected before the diagnosis by ultrasonography . wu et al . identified serum proteins and peptide profiles to differentiate hbv - related hcc and hbv - related cirrhosis . the most significant seldi 3892 m / z peak showed sensitivity and specificity of 69% and 83% and was identified also in six afp - negative patients . the 3892 peak was considered as a complementary diagnostic marker or a potential marker for positive or negative -fetoprotein hcc . seldi - tof analysis of sera from 120 patients affected by hcc and 120 affected by cirrhosis showed five proteomic peaks ( m / z 3324 , 3994 , 4665 , 4795 , and 5152 ) able to achieve , especially for early stage hcc , a diagnostic value better than serum afp ( 83% sensitivity and 92% specificity in the test set ) . formulated classification trees , based on seldi serum protein profiles , able to distinguish patients affected by chronic hepatitis b , cirrhosis , and hcc from healthy individuals . samples were divided into training and testing groups , each composed by hbv , liver cirrhosis , hcc patients matched with normal controls . decision trees distinguished hcc with 90% sensitivity and 89% specificity , cirrhosis with 100% sensitivity and 86% specificity , and hbv patients with 85% sensitivity and 84% specificity . used a glycomic approach to evaluate the abundance of 83 n - glycans in a total of 202 sera from 73 hcc patients , 52 with chronic liver disease and 77 controls . six glycans were used to differentiate hcc cases from controls and showed sensitivity and specificity of 7390% and 3691% , respectively . a combination of three n - glycans ( m / z 2472.9 , 3241.9 , 4052.2 ) was able to classify hcc with 90% and 89% sensitivity and specificity in an independent validation set of patients with chronic liver disease . two - hundred and three serum samples collected from 73 hcc cases , 52 chronic liver disease , and 78 healthy subjects were treated for n - glycans releasing and then analyzed by maldi . seven glycan peaks achieved good performance in distinguishing hcc from chronic liver disease patients and normal individuals . after depletion of high abundance proteins , liu et al . analyzed 27 sera from early hcc in comparison to 27 cirrhosis patients in order to identify glycoprotein biomarkers . a lectin array of 16 selected lectins was used to define glycan structures showing changes between the two groups of samples . samples were then analyzed by exactag labeling , lectin extraction and lc - ms / ms . complement c3 , ceruloplasmin , histidine rich glycoprotein ( hrg ) , cd14 and hepatocyte growth factor ( hgf ) , as validated by western blot , were considered putative biomarkers in differentiating early hcc from cirrhosis with a sensitivity of 72% and a specificity of 79% . . studied by seldi - tof eighty - two sera from patients with cirrhosis , either without ( 38 samples ) or with ( 44 samples ) hcc . an algorithm showing the six highest scoring peaks allowed the correct classification of patients with or without hcc in 92% of individuals in the test set and in 90% in the validation set . after sera fractionation ( imac - zn spin column ) , analysis on np20 chip array and protein recovery from tricine sds - page , tandem ms was performed and the highest discriminating peak ( 8.9 kda ) was described as the c - terminal part of the v10 fragment of vitronectin , a protein involved in cell adhesion , humoral defense mechanism as well as cell invasion . seldi - tof was used to identify differentially expressed proteins in hepatocarcinoma ( 55 samples in total , 31 hbv - related and 24 hcv - related ) and chronic hepatitis patients ( 18 hbv and 30 hcv ) . after serum fractionation by anionic exchange chromatography , the protein complement c3a ( about 8.9 kda ) , elevated both in chronic hcv and hcv - related hcc patients , was identified as a candidate biomarker and further validated by ps20 chip immunoassay and western blot . used 2-de combined to nano - hplc - esi - ms / ms to identify 14 proteins differentially expressed ( 12 up and 2 down - regulated ) in hcc patients with respect to normal controls . on the other hand , using whole serum trypsin - digested and then analyzed with nano - hplc - esi - ms / ms , twenty - nine proteins were identified with high levels of confidence . six of them ( annexin vi isoform , complement component 9 , ceruloplasmin - ferroxidase- , serum amyloid a4 , serum amyloid a2 , serum amyloid a1 isoform 2 ) , playing a role in immune and acute phase response or in membrane dynamics along endocytosis or exocytosis pathways ( annexin vi ) , were detected only in hcc patients . an 11 peak algorithm , generated by seldi / tof analysis , distinguished patients with hcc ( 41 samples ) from those with hepatitis c cirrhosis ( 51 samples ) better than the currently used biomarkers afp , afp l3 ( lens culinaris agglutinin - reactive afp ) and pivka - ii ( prothrombin induced by vitamin k absence - ii ) . within the 11-protein signature , the 13.4 kda feature was purified , identified as cystatin c by ms / ms analysis and further validated by elisa . the cystatin c , a cysteine protease inhibitor marker of inflammation as well as renal function , resulted overexpressed in hcc samples and was described as a marker to distinguish hcc from hcv - related cirrhosis patients . . performed by seldi - tof serum profiling on 81 patients with hbv - related hcc and 33 normal controls , randomly split into a training and a testing set . six proteomic peaks ( m / z 3157.33 , 4177.02 , 4284.79 , 4300.80 , 7789.87 , 7984.14 ) were considered to construct the best classification tree ( sensitivity 95% , specificity 100% in the testing set ) . protein fraction corresponding to the 7489 m / z peak was isolated and characterized by ms / ms analysis as the inflammatory cytokine neutrophil activating peptide 2 ( nap-2 ) . nap-2 was validated by immunohistochemistry in hcc tissues and resulted specifically associated to hepatitis b - related hcc . sera from eighty - one patients with hbv - related hcc and 80 healthy controls were divided in two sets and analyzed by seldi - tof . two proteins , the thrombin light chain ( m / z 4096 ) and the chemokine growth - related oncogene alpha ( gro - alpha ) ( m / z 7860 ) were selected as putative biomarkers . a clinical validation set composed by 48 hcc , 54 liver cirrhosis , 151 patients with other cancers and 42 healthy donors was analyzed to confirm data by seldi - immunoassay . the proteins , when associated to afp , resulted in a sensitivity of 91.7% and a specificity of 92.7% . sera from cirrhosis and hcc patients were analyzed by cleavable stable isotope labeling ( cicat ) coupled to lc - esi - ms / ms . among 31 proteins differentially expressed , the alpha-1 acid glycoprotein ( agp ) , an acute phase reactant , was chosen for western blot assay and validation in a separate study . agp was useful for discrimination of hcc from cirrhosis in patients with afp less than 500 ng / ml . a study based on 2d - gel electrophoresis and maldi - tof in patients with hepatocarcinoma or liver cirrhosis revealed five proteins differentially expressed ( haptoglobin , hp2 , preprohaptoglobin , sp40 and saa1 ) . western blot analysis showed haptoglobin , the most representative protein , as overexpressed in hcc patients . when used in association to afp , the molecule improved the diagnostic accuracy . several peptides in the serum low molecular weight fraction were identified by maldi and then characterized by lc - ms / ms . differentially expressed peptides were described as truncations of n terminus of complement c3f , a fibrinopeptide , complement c4alpha peptides , a zyxin peptide , a coagulation factor xiii peptide , and a biliverdin diglucuronide . used a strategy based on sonication , albumin and immunoglobulin depletion , 2-de and maldi - tof ms / ms to analyze 20 sera , respectively , from hcc , hepatitis b ( hbv ) patients and normal subjects . the same number of additional sera from corresponding groups was used for the validation test . height proteins , involved in inflammatory processes or classified as acute phase reactants ( alpha-1 antitrypsin , clusterin , ceruloplasmin , haptoglobin alpha2 chain , transferrin , and transthyretin ) as well as alfa - fetoprotein and the heat - shock protein 27 , a stress - inducible protein acting in thermotolerance , cell proliferation , and apoptosis , were differentially expressed in the above - mentioned groups . validation by western blot analysis revealed hsp27 expressed in 90% of hcc , in 10% of hbv and in none of normal sera . eight protein spots differentially expressed were analyzed and four proteins were identified as putative biomarkers ( myh2 protein , mitochondrial atp synthase , sulphated glycoprotein-2-clusterin sgp-2- , and glial fibrillary acidic protein ( gfap ) . sgp-2 , known to be involved in inflammation and in the regulation of cellular proliferation , was also confirmed by immunoblotting in an independent set of samples . lung cancer is one of the leading causes of cancer - related mortality worldwide and is responsible for 1.3 million deaths worldwide annually [ 104 , 105 ] . the poor prognosis is evidenced by the 5-year survival rate which is less than 15% . lung cancers are grouped into small - cell lung cancer ( sclc ) and non - small - cell lung cancer ( nsclc ) , consisting of adenocarcinomas , squamous cell carcinomas , and large - cell carcinomas [ 107 , 108 ] . nsclcs comprise approximately 80% of all lung cancers , with adenocarcinomas and squamous cell lung cancers each accounting for approximately 30% . many serologic biomarkers of lung cancer have emerged recently : these include carcinoembryonic antigen ( cea ) , the cytokeratin 19 fragment cyfra21 - 1 , cancer antigen ca-125 , plasma kallikrein , progastrin - releasing peptide ( progrp ) , and neuron - specific enolase ( nse ) . in a study on 208 sera ( 158 lung cancer , 50 healthy controls ) , yang et al . identified a 5 proteins peak pattern ( 11493 , 6429 , 8245 , 5335 , 2538 da ) which , in a blind test , achieved sensitivity of 86.9% ( 79% for stage i / ii lung cancers ) , specificity of 80% and positive predictive value of 92.4% . in particular , the pattern sensitivity was 91.4% in the detection of nsclc . in a group of sera ( 54 sclc , 24 nsclc , 32 pneumonia patients , and 40 healthy subjects ) , seldi - tof spectra data analyzed by support vector machine ( svm ) gave three patterns able to distinguish sclc from pneumonia , nsclc patients and from healthy individuals better than neuron specific enolase ( nse ) . the sensitivity and specificity ranged from 88% to 83% and from 91% to 75% , respectively . a 17 ms protein signature was identified in a study on 139 lung cancer patients ( stage iii - iv ) , 158 healthy individuals and then validated in two sets of 126 ( 63 lung cancer stage iii - iv , 63 controls ) and 50 ( 25 lung cancer stage i - ii , 25 controls ) individuals . the signature distinguished lung cancer patients from normal subjects and showed sensitivity and specificity of 87.3% and 81.9% in the first validation set , and 90% and 67% in the second one . du et al . captured and concentrated serum peptides by using magnetic beads - based weak cation exchange on the clinprot robotic platform . a 5 protein fingerprint distinguished sclc patients ( 30 samples ) from healthy individuals ( 44 samples ) with a specificity of 97% and a sensitivity of 90% . after immunoaffinity depletion of highly abundant serum proteins , glycoproteins were captured and enriched by hydrazide chemistry , recovered and then analyzed by lc - ms / ms . three of these proteins ( alpha-1-antichymotrypsin act , insulin - like growth factor - binding protein 3 igfbp3 , lipocalin - type prostaglandin d synthase l - pgds ) were verified by elisa , showing correlation with ms results . . identified by maldi - tof a peak ( m / z 11702 ) differentially expressed in lung cancer patients ( 24 subjects ) with respect to individuals with no evidence of cancer ( 17 subjects ) . after purification and peptide mapping , the peak was described as the acute phase reactant serum amyloid protein a and further validated by elisa . analyzed by maldi - tof differentially expressed albumin - depleted serum proteins from sclc patients and controls , recovered from a silver - stained sds - page . haptoglobin -subunit , validated by immunoblot , was considered as a biomarker with its level correlating with the disease stage . in addition , they analyzed by elisa the levels of hepatocyte growth factor ( hgf ) , a multifunctional protein which regulates both cell growth and motility , and described it as a potential sclc biomarker . a study performed on 218 sera from 175 lung cancer patients and 43 controls by seldi - tof showed an 11.6 kda protein peak significantly elevated in cancer sera and increased in association to the clinical stage . serum amyloid a protein was identified by tricine sds - page and maldi - ms / ms analysis as a biomarker to discriminate lung cancer patients from healthy individuals . the marker was validated by immunoprecipitation and elisa in the same samples and showed sensitivity of 84% and specificity of 80% . in a study on 227 sera ( 146 lung cancer , 41 benign lung disease , 40 normal subjects ) three peaks differentially expressed ( m / z 13780 , 13900 , 14070 ) the peaks corresponded to native transthyretin ( negative acute - phase reactant ) and its two variant , as demonstrated by sds - page and esi - ms / ms analysis and further validated by immunoprecipitation and immunoblotting . the transthyretin expression was significantly lower in lung cancer sera compared with sera from normal individuals , but higher compared with those obtained from benign lung disease . subsequent elisa assay indicated that the levels of transthyretin were consistent with those obtained by seldi , showing approximately 6575% sensitivity and specificity . the diagnostic accuracy of maldi in analyzing unfractionated serum was assessed in a study by yildiz et al . performed on 142 sera form lung cancer patients matched with 146 samples from normal controls . a serum proteomic signature of seven features achieved an overall accuracy of 78% and 72.6% in the training and blinded test set , respectively . the peptides around 11500 da were further analyzed by using sds - page separation and lc - ms / ms and described as a cluster of truncated forms of serum amyloid a protein . in a study on 154 sera from pre - treated patients ( 55% early , 45% advanced - stage ) an isoform of serum amyloid a , corresponding to an 11.6 kda seldi peak and characterized by sds - page and tandem ms , was found to be elevated in patients with poor prognosis . in this study , sera were prefractionated in six protein fractions on the basis of their isoelectric points . forty - nine proteins were found to be differentially expressed by lc - esi - ms / ms in pools of sera from nonsmall cell lung cancer ( adenocarcinoma and squamous cell carcinoma ) with respect to healthy controls . multiple reaction monitoring ( mrm ) assay was used to confirm the abundance of four selected proteins ( serum amyloid a ssa and aag 1 and 2 showed higher spectral count in lung cancer serum pool . analysis by seldi - tof of 227 sera showed 5 peaks ( m / z 11530 , 11700 , 13780 , 13900 , 14070 ) identifying native serum amyloid a protein and transthyretin , and some of their variants as lung cancer biomarkers . serum amyloid a1 and a2 proteins were identified by lc - esi - ms / ms in lung cancer pooled sera after sds - page fractionation . the levels were higher in lung cancer patients with respect both to patients affected by other pulmonary diseases or different cancers and to healthy controls . moreover , ssa expression in lung cancer samples was detected by tissue - microarray analysis . ueda et al . described a method based on enrichment of the peptidomic fraction and analysis by nano - lc - ms / ms . after further characterization by mrm - based relative quantification , peptides from apolipoprotein a4 ( apoa4 ) , fibrinogen alpha chain ( fiba ) , and limbin ( lbn ) , a positive regulator of the hedgehog signaling pathway , have been identified as useful biomarkers for early detection and staging of lung tumors . pancreatic cancer is the fourth leading cause of cancer death in both men and women . the high mortality associated with it can be essentially attributed to advanced stage of disease at patient presentation . the overall 5-year survival is about 5% , and only 20% of patients are candidates for surgical resection and possible treatment . for this small percentage of patients undergoing resection , even when followed by multimodal therapy , 5-year survival rates are still less than 25% [ 118120 ] . current methods for diagnosing pancreatic cancer are relatively ineffective to identify small potentially curable lesions . , there are no efficient modalities to early detect pancreatic cancer and strategies to improve survival have focused just on chemotherapy in the neoadjuvant setting or after resection . in a study on 15 healthy controls , 24 cancer and 11 chronic pancreatitis patients prospectively collected , the low molecular serum fraction was enriched and analyzed by maldi - tof . an eight peaks serum signature ( m / z 4470 , 4792 , 8668 , 8704 , 8838 , 9194 , 9713 , 15958 ) differentiated cancer patients from normal individuals ( sensitivity and specificity of 88% and 93% ) , cancer from pancreatitis patients ( sensitivity and specificity of 88% and 30% ) , and cancer from healthy plus pancreatitis - affected individuals ( sensitivity and specificity of 88% and 66% ) . the most significant peak , m / z 9713 , was described by ms / ms analysis as the apolipoprotein ciii . liu et al . used seldi - tof technology to differentiate cancer from different pancreatic conditions , by studying 118 serum samples , split in training and test set . two ms patterns , differentiating pancreatic adenocarcinoma from healthy controls and chronic pancreatitis , yielded in the test set sensitivity and specificity of 91.6% ( cancer versus controls ) and sensitivity of 90.9% , specificity of 80% ( cancer versus chronic pancreatitis ) . an orthotopic nude mouse model of human pancreatic cancer was used to detect serum biomarkers . mice were injected with a human pancreatic cancer cell line and then were divided in groups treated with anti - cancer drugs for some weeks . plasma from 135 pancreatic cancer patients and 113 healthy individuals were at the same time examined . an 11.7 kda protein peak , correlating with tumor weight , was detected in mice sera . after purification and separation by sds - page , the corresponding protein was identified as serum amyloid protein a and confirmed by western blotting . the level of saa detected in plasma of pancreatic cancer patients correlated with the clinical stage . ninety - six sera from pancreatic cancer patients undergoing surgery were fractionated by chromatography and analyzed by seldi in comparison with as many sera from healthy controls . after purification , several proteins were identified by peptide mapping and postsource decay - matrix - assisted laser desorption ionization - tof - ms . down - regulated apolipoprotein a - ii , transthyretin , and apolipoprotein a - i were described as potential markers in pancreatic cancer . studied sera from pancreatic cancer patients by gel electrophoresis in order to highlight protein bands differing quantitatively . three high mass proteins ( -2 macroglobulin , ceruloplasmin , complement 3c ) were elevated in cancer sera with respect to controls . the esi - ms analysis revealed great heterogeneity especially in the low mass region . by statistical analysis , twenty low - mass serum peaks correlating to controls and 20 different peaks correlating to cancer sera were found . a study performed by fiedler et al . on forty sera from patients matched with forty samples from healthy controls was focused on maldi - tof peptidome profile analysis after using magnetic beads for protein fractionation . data were validated by using an additional 20 plus 20 sera set . two significant peaks ( m / z 3884 and 5959 ) showed 86.3% sensitivity and 97.6% specificity for discriminating patients from controls . the 3884 peak was described and further validated by immunoassay as platelet factor 4 ( pf4 ) . pf4 , used in combination with ca-19 - 9 , significantly improved sensitivity and specificity for the identification of pancreatic cancer . used immunoaffinity depletion of highly abundant proteins and 2-de to identify 16 protein spots differentially expressed ( 8 iper- and 8 ipoexpressed in cancer sera ) . mannose - binding lectin 2 and myosin light chain kinase 2 , a serine / threonine kinase , were identified as potential biomarkers for the pancreatic cancer diagnosis and further validated by western blot in an independent set of sera from pancreatic cancer patients and normal controls . low molecular weight ( < 60 kda ) serum proteome from a training set composed by 24 patients with pancreatic cancer and 21 controls was analyzed by hplc - esi - ms / ms . among many peaks identified , a peptide from cxc chemokine ligand 7 ( cxcl7 ) was significantly reduced in cancer sera . data were confirmed by high - density protein microarray in a large cohort of 140 patients affected by pancreatic cancer , 10 patients with chronic pancreatitis and 87 healthy controls . combination of cxcl7 and ca-19 - 9 , improved the discriminatory power for pancreatic cancer . in order to limit the complexity of the plasma proteome , pan et al . a group of differentially expressed proteins was selected and evaluated on a separate cohort of samples from pancreatic cancer , chronic pancreatitis patients , and nonpancreatic disease control . a composite marker of the tissue inhibitor of metalloproteinases timp1 and the adhesion molecule icam1 , as characterized by elisa , showed significant better performance than ca-19 - 9 in distinguishing pancreatic cancer , pancreatitis , non - pancreatic diseases and healthy controls . forty - five samples from patients affected by pancreatic cancer and 20 from healthy controls were analyzed by 2-de and lc - ms / ms . serum isoforms of alpha-1-antitrypsin ( aat ) , also confirmed by western blot , were described as upregulated and potential serum biomarkers for pancreatic cancer . bloomston et al . analyzed by high - resolution 2-de thirty preoperative sera from pancreatic cancer and thirty - two from healthy individuals . differentially expressed spots were recovered and analyzed by maldi - tof and lc - ms / ms . approximately 150 proteins resulted commonly overexpressed in all cancer patients . four proteins discriminated 100% of pancreatic cancer and 94% of normal samples . among them , fibrinogen- was identified as putative biomarker and further validated by enzymatic analysis in sera and immunohistochemistry in tumor tissues . one hundred and twenty - six sera form pancreatic cancer patients ( 84 with diabetes ) were examined by seldi - tof in comparison to 61 sera from chronic pancreatitis ( 32 with diabetes ) , 24 from type 2 diabetes mellitus patients , and 12 from healthy controls . classification algorithms obtained by ms analysis resulted to improve the diagnostic accuracy of ca-19 - 9 in pancreatic cancer diagnosis and to facilitate the differential diagnosis between pancreatic cancer and type 2 diabetes mellitus . among the large number of peptides , that described with the m / z 3519 was identified as a member of the egf - like family . fifty - eight sera from patients with pancreatic cancer were compared with 18 samples from patients affected by benign disease and 51 healthy controls . sera were analyzed using a strong anionic exchange chromatography protein - chip and seldi - tof . sixty - one protein peaks were detected to construct multiple classification trees to distinguish the disease groups , reaching 83% sensitivity and almost 100% specificity in discriminating cancer from controls and benign disease . putative protein biomarkers were identified : one ( m / z 4016 ) showed a downregulated trend in preoperative versus post - operative sera , three ( m / z 4155 , 4791 , 28068 ) were detected in the differential diagnosis of the 3 test groups . c14orf166 , a protein involved in modulation of mrna transcription by polymerase ii , was identified as corresponding to the 28068 peak by proteinchip immunoassay . the molecule showed levels significantly higher in pancreatic cancer patients , as confirmed by immunoenzymatic methods . a seldi - tof protein panel derived from the study of a training set composed by 38 pancreatic cancer sera , 54 disease controls , and 68 healthy volunteers was further validated on a first validation set ( 40 pancreatic cancer , 21 disease controls , 19 healthy volunteers ) and then , by elisa , on a second one ( 33 pancreatic cancer , 28 disease controls , 18 healthy volunteers ) . a simplified diagnostic panel comprising ca-19 - 9 , apolipoprotein c - i , apolipoprotein a - ii , additionally validated by elisa on the second validation set , resulted to improve the diagnostic ability of ca-19 - 9 . potential prognostic markers were initially identified by nano - lc - ms / ms in 4 groups of sera , each from 10 patients , selected on the basis of survival ( long or short ) and therapy ( gemcitabine plus bevacizumab , or gemcitabine plus placebo ) . alpha1-antichymotrypsin ( aact ) was negatively correlated with overall survival and considered as a prognostic marker for pancreatic cancer . advances in screening methods significantly improved early diagnosis with consequent enhancement of prognosis , survival and treatment efficacy . unfortunately , some tumors are difficult to diagnose before the disease is in advanced or metastasizing state . therefore , there is an urgent need to discover novel biomarkers which provide sensitive and specific disease detection . over the past decade , serum biomarkers have been identified in sera from cancer patients by using powerful high - throughput technologies . mass spectrometry allowed the identification of hundreds of proteins within complex biological samples such as tissues , serum , plasma , and urine . ms analytical attributes in biomarker discovery are its high mass accuracy , resolution and ability to characterize the peptides at the level of their aminoacidic sequence . several workflows including methods for serum samples preparation ( e.g. , high abundance protein removal , serum fractionation ) , sds - page and 2d - ge , lc , different ms platforms , and protein chip arrays have been used for biomarker discovery . many differential ms peak profiles were identified and several proteins were characterized and described as potential biomarkers for high mortality tumors ( tables 14 ) , achieving different levels of sensitivity and specificity to diagnose the disease . many of these proteins are involved in fundamental processes such as inflammation , cellular differentiation and proliferation , and apoptosis . among them , positive ( i.e. , serum amyloid a , ceruloplasmin , complement factors , haptoglobin ) and negative acute - phase reactants ( i.e. , transthyretin , transferrin ) were differentially expressed in sera from ovary , lung , liver , and pancreatic cancer patients . some putative ovarian cancer biomarkers described in this paper , such as the keratin 2a , the glycosyltransferase - like 1b , involved in glycosylation processes , and the casein kinase alpha 1 , a serine / threonine kinase involved in cellular differentiation , proliferation and apoptosis , have been associated with processes related to cancer [ 125128 ] . similarly , the mannose binding lectin 2 ( mbl2 ) , a mediator of inflammation which results iperexpressed in pancreatic cancer sera , is involved in cancer processes . genetic alterations of mbl2 can increase colon cancer susceptibility in african americans and a mbl genetic polymorphism , associated to a reduction of vaginal mbl concentration , may be a risk for development of ovarian cancer [ 129 , 130 ] . the chemokine ccl18 , here described as candidate ovarian cancer serum biomarker , was also considered as a urine biomarker for bladder cancer detection . likewise , the hcc biomarker cystatin c , an inhibitor of cystein proteinases , showed significantly higher levels also in sera from lung cancer patients , and the hcc and lung cancer putative biomarker alpha-1 acid glycoprotein 1 , an acute phase protein , was found as well elevated in sera and tumor tissues from patients affected by gastric carcinoma . the here described liver cancer biomarker heat shock protein 27 , a protein with cytoprotective and anti - apoptotic activity , measured by immunoenzymatic assay , was confirmed to be elevated in an independent cohort of sera from hcc patients . despite the great advances in the application of ms in serum biomarker discovery , the identification of differential serum protein profiles and specific molecules able to discriminate normal from diseased subjects requires a technology able to highlight small differences and to process large series of serum samples . although ms is the most powerful approach for biomarker identification , there are some boundaries in the analysis of serum . these can be attributable to the complex nature of serum and its tremendous dynamic range , to diurnal variation in protein expression , instability of proteins due to in vivo or ex vivo protease activity , pre - analytical methods reproducibility as well as to the intrinsic ms sensitivity ( > g / ml ) in detecting analytes which usually range between 50 pg / ml and 10 ng / ml . accurate selection of cases and controls , standardization of sample collection and storage conditions , utilization of adequate and effective methods focused on reducing the complexity of serum / plasma prior ms analysis , use of different protein array with complementary binding conditions , refined bioinformatic and statistical analysis to process data , and suitable validation workflows by immunoassay on larger sets of independent samples are necessary elements to circumvent criticisms and improve the biomarker discovery process . | cancer affects millions of people worldwide .
tumor mortality is substantially due to diagnosis at stages that are too late for therapies to be effective .
advances in screening methods have improved the early diagnosis , prognosis , and survival for some cancers .
several validated biomarkers are currently used to diagnose and monitor the progression of cancer , but none of them shows adequate specificity , sensitivity , and predictive value for population screening .
so , there is an urgent need to isolate novel sensitive , specific biomarkers to detect the disease early and improve prognosis , especially in high - mortality tumors .
proteomic techniques are powerful tools to help in diagnosis and monitoring of treatment and progression of the disease . during the last decade
, mass spectrometry has assumed a key role in most of the proteomic analyses that are focused on identifying cancer biomarkers in human serum , making it possible to identify and characterize at the molecular level many proteins or peptides differentially expressed . in this paper
we summarize the results of mass spectrometry serum profiling and biomarker identification in high mortality tumors , such as ovarian , liver , lung , and pancreatic cancer . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
during the last decades , the prevalence of obesity and type 2 diabetes mellitus has increased dramatically . this epidemic of lifestyle - related disorders is affecting all parts of the world , and 439 million people are estimated to suffer from diabetes mellitus in 2030 . obesity is a strong risk factor for type 2 diabetes with 90% of affected patients being overweight or obese . obesity is also associated with increased risk of various metabolic disorders including insulin resistance , chronic low - grade inflammation , dyslipidemia , nonalcoholic fatty liver disease ( nafld ) , and cardiovascular disease . oxidative stress , inflammatory response , and altered gut microbiota can play a significant role in the development of obesity - related disorders [ 24 ] . type 2 diabetes is a multifactorial disease ; however , it appears clear that prevention is possible by avoiding overeating and a sedentary lifestyle to maintain a healthy body weight . the difficulty for many individuals to comply with dietary and lifestyle changes makes it of great interest to identify new foods with well - established effects on preventing the development of obesity and thereby type 2 diabetes and its associated metabolic complications . dietary patterns with high consumption of polyphenol rich foods ( fruits , vegetables , and berries ) have been associated with reduced risk of type 2 diabetes . in general , berries are rich in polyphenols which are suggested to play a role in health benefits of plant - based diets [ 4 , 68 ] . plant phenolics are a large group of secondary metabolites which provide color and taste in fruits and berries and include flavonoids ( anthocyanins , flavonols , and flavanols ) , tannins , stilbenoids , and phenolic acids . the antioxidant effect of berry anthocyanins has been studied extensively , but still little is known about the biological activities linking berries and polyphenols to the prevention of type 2 diabetes [ 4 , 10 , 11 ] . the aim of the present study was to perform a screening to investigate and compare metabolic effects of different berries in the c57bl/6j mouse . the c57bl/6j is a mouse strain that develops obesity and prediabetes when fed a diet rich in fat , thus mimicking detrimental effects of an energy dense western diet . by supplementing high - fat diets with potentially health - promoting berries , we sought to identify berries capable of ameliorating risk factors from excessive energy intake . here we report that different berries , possibly due to their polyphenol composition , have varying ability to prevent weight gain and metabolic disorders ultimately leading to diabetes . the study was approved by the animal ethics committee in lund , sweden , ( permit number : m185 - 11 ) and is in accordance with the council of europe convention ( ets 123 ) . male c57bl/6jbomtac mice , 6 weeks old , 21.2 1.1 g were obtained from taconic ( skensved , denmark ) . the animals were housed in a controlled environment ( 12 h light / dark cycle , light on 7 a.m. ) . after 9 days of acclimatization the mice were divided into 10 groups of 12 mice each housed in groups of 6 mice per cage . the mice were fed high - fat diets ( 45 kcal% fat ) ( research diets , new brunswick , nj , usa ) supplemented ( 20% w / w ) with eight different freeze dried berries ad libitum for 13 weeks . one group received a low - fat diet ( 10 kcal% fat ) as an internal control to the high - fat diet induced obesity . mice were housed with minimal bedding material and feces was quantitatively collected for two consecutive days at the end of the study and stored at 20c prior to lyophilization , weighing and powdering with a mortar . at the end of the study , 4 h - fasted animals were anesthetized with an intraperitoneal injection of midazolam ( midazolam panpharma 5 mg / ml , panpharma s.a . , luitr , france ) and a mixture of fluanisone 10 mg / ml and fentanyl citrate 0.315 mg / ml ( hypnorm , vetapharma , leeds , uk ) . body composition was determined with dual - energy x - ray absorptiometry ( dexa ) technique using a lunar piximus ( ge lunar , madison , wi , usa ) the animals were sacrificed by cervical dislocation and liver , cecum , spleen , and epididymal fat pads were excised , weighed , and snap frozen in liquid nitrogen . the experimental diets were high - fat diets supplemented with one of eight freeze dried berries ; lingonberry ( vaccinium vitis - idaea ) , blackcurrant ( ribes nigrum ) , raspberry ( rubus idaeus ) , bilberry ( vaccinium myrtillus ) , and blackberry ( rubus fruticosus ) were obtained from molda ag ( dahlenburg , germany ) . crowberries ( empetrum nigrum ) were from olle svenssons partiaffr ab ( olofstrm , sweden ) and prunes ( prunus domestica ) from semper ab ( sundbyberg , sweden ) . freeze dried aai berry powder ( euterpe oleracea ) was purchased from superfruit scandinavia ab ( sweden ) . information about origin and processing of the berries can be found in table s2 ( see supplementary material available online at http://dx.doi.org/10.1155/2014/403041 ) . based on data of macronutrient composition of the berries ( obtained from supplier and/or covance , madison , wi , usa ) the diets were designed to have identical macronutrient composition ( tables 1 and s1 , supporting information ) . after manufacturing , all diets were analyzed for soluble and insoluble dietary fiber content by eurofins ( lidkping , sweden ) ( table 1 ) . glucose , total cholesterol , triacylglycerol , high - density lipoprotein ( hdl ) cholesterol , alanine aminotransferase ( alt ) ( infinity , thermo fisher scientific , waltham , ma , usa ) , and nonesterified fatty acid ( nefa ) ( nefa - hr , wako chemicals , neuss , germany ) concentrations in plasma were measured using kits . insulin was measured using an enzyme - linked immunosorbent assay kit ( mercodia , uppsala , sweden ) . plasma levels of tumor necrosis factor - alpha ( tnf- ) and plasminogen activator inhibitor-1 ( pai-1 ) were analyzed using luminex technology ( lx200 , luminex corporation , austin , tx , usa ) . insulin resistance was assessed by the homeostasis model assessment ( homa ) , a mathematical model describing the degree of insulin resistance from fasting plasma glucose and insulin [ 14 , 15 ] . homeostasis model assessment - estimated insulin resistance ( homa - ir ) was calculated by multiplying fasting plasma insulin ( mu / l ) with fasting plasma glucose ( mmol / l ) divided by 22.5 . lipids were extracted from feces using a modified version of the protocol by hara and radin . in short , around 100 mg lyophilized , grounded feces from each sample were extracted in hexane - isopropanol ( 3 : 2 v / v ) with 0,005% 2,6-di - tert - butyl-4-methylphenol . five ml of the extract was dried under n2 after which the remaining residue was redissolved in 100 l isopropanol containing 1% triton x-100 . the solution was analyzed in triplicates using the triacylglycerol and cholesterol kits used for plasma samples . samples were prepared in duplicates from ten randomly selected livers from each group and subjected to lipid extraction as previously described . for extraction of hepatic lipids , the solution containing redissolved lipids was first analyzed in triplicates for cholesterol . after adding another 90 l isopropanol 1% triton x-100 the solution was analyzed for triacylglycerol . five g of each diet was grounded , weighed , and extracted using 25 ml of heptane , ethyl acetate , and methanol , respectively . samples were stirred during 24 h at room temperature and the extracts were filtered , concentrated , and weighed . finally , 25 ml of methanol : water : acetic acid ( 85 : 15 : 0.5 ; v / v ) was used for polyphenol analysis . ethyl acetate extracts were dissolved in 2 ml methanol and the soluble fraction was filtered through 0.2 m gh polypro membrane to remove insoluble particles and kept at 18c until analysis . the liquid chromatography - tandem mass spectrometry ( lc - ms ) analyses were performed on a lc - ms agilent technologies 1260 infinity equipped with an quaternary pump , autosampler , thermostatted column compartment , diode array detector tandem quadrupole lc / ms . a 250 4.6 mm i.d . zorbax sb - c18 column , 3.5 m particle size , was used at 40c . the method used is described by wu et al . using mobile phase a ( 5% formic acid in water ) and b ( methanol ) . the flow rate was 1 ml / min , the temperature used was 40c , and uv detection was at 520 nm . the gradient used was 5% b , 02 min ; 520% b , 210 min ; 20% b , 1015 min ; 2030% b , 1530 min ; 30% b , 3035 min ; 3045% b , 3550 min ; 45% b , 5055 min , 455% b 5565 min , 5% b. the injection volume was 20 l in all samples . enhanced product ion mass spectrometry ( epi - ms ) analysis was performed in positive mode using a capillary voltage of 3000 v , nebulizer pressure 40 psig , drying gas flow 12 l / min , and drying gas temperature 300c . the uv - vis , reference times , and mass spectra were used for identification of the peaks and compared to anthocyanin data in the literature [ 1719 ] . the lc - ms system together with a 2.1 100 mm i.d . 3 m atlantis c18 column was used for the analysis of the mobile phase a ( 0.1% formic acid in water ) and mobile phase b ( methanol ) . the flow rate was 0.3 ml / min , the temperature used was 30c , and the uv detector was fixed at 360 nm . the injection volume was 20 l . the initial gradient elution was used at 612% b , 20 min ; 1255% b , 2050 min . the conditions for ms were set in both positive and negative mode ( method described in ) . qualitative standards ( resveratrol , apigenin , and quercetin-3-o - glucoside ) as well as comparison of ms data in the literature were used to enable identification of compounds . unless stated otherwise , results were analyzed by one - way analysis of variance ( anova ) in conjunction with dunnett 's multiple comparisons test . in cases where gaussian distribution could not be assumed , groups were compared using kruskal - wallis and dunn 's post test . * p < 0.05 , * * p < 0.01 and * * * p < 0.001 . statistical analyses were performed using graphpad prism versions 5.0 and 6.0 ( graphpad software , san diego , ca , usa ) . the high - fat control diet induced obesity in mice was compared to the low - fat diet group ( figure 1(a ) ) . in week 12 of the experiment , the mean body weight in the low - fat group was 32 0.9 g , whereas the mean weight of the high - fat fed control group was 42 1.2 g. body weight was significantly lower in groups receiving lingonberry ( 33 0.9 g ) , blackcurrant ( 36 0.7 g ) , raspberry ( 37 1.5 g ) , and bilberry ( 38 1.1 g ) compared to the high - fat control . consumption of the aai diet resulted in significantly increased body weight ( 48 0.6 g ) . the dexa scan showed significantly decreased body fat content in the groups receiving lingonberry , blackcurrant , and bilberry compared to the high - fat control . in fact , mice fed the lingonberry - supplemented diet had a body fat content as low as the low - fat diet group . the lean body mass was similar in all groups ( figure 1(c ) ) , except in the group receiving aai where lean mass was increased ( + 15% ) compared to the control . the mass of the epididymal fat pads was expressed per gram lean tissue to take into account differences in body size . the relative size of the fat pad was lower in groups receiving lingonberry and aai , compared to the high - fat control ( figure 1(d ) ) . the accumulated mean energy intake per body weight was similar for all groups , except for mice receiving blackcurrant and bilberry supplementation where a higher food and energy intake was registered ( figure s1 ) . four - hour fasting plasma glucose levels were significantly reduced in groups receiving lingonberry- and blackcurrant - supplemented diets compared to the high - fat control diet ( figure 2(a ) ) . these groups together with the bilberry and raspberry groups had reduced fasting insulin levels ( figure 2(b ) ) . in addition , the lingonberry , blackcurrant , and bilberry supplementation resulted in a lower homa index of insulin resistance ( figure 2(c ) ) . the lingonberry and blackcurrant groups had glucose , insulin , and insulin resistance levels very similar to the group receiving a low - fat diet . a tendency of increased homa - ir , glucose , and insulin was observed in mice consuming aai - supplemented high - fat diet compared to control ; however , the increase was not significant ( p value ; 0.07 , 0.25 and 0.55 , resp . ) . compared to control , the total plasma cholesterol was significantly lower in groups fed lingonberry , blackcurrant , and low - fat diet whereas it tended to be higher in the acai group ( p = 0.05 ) . the lingonberry , blackcurrant , and low - fat groups displayed decreased levels of ldl and hdl cholesterol whereas aai had increased hdl cholesterol . plasma triacylglycerol levels were significantly increased in the group receiving blackcurrant and in the low - fat control . the liver masses ( relative to lean body mass ) were significantly lower in mice fed a diet supplemented with lingonberries compared to control ( p = 0.009 ) , whereas aai supplementation led to significantly increased liver mass ( p < 0.0001 ) ( figure 3(a ) ) . the plasma levels of the enzyme alt , a marker of liver dysfunction , were significantly elevated in the aai group compared to all groups except the blackberry and control groups ( figure 3(b ) ) . compared to the high - fat control , alt levels were significantly reduced in groups receiving lingonberry and blackcurrant as well as bilberry . the liver contents of triacylglycerol ( figure 3(c ) ) were markedly decreased in the mice receiving supplement of lingonberries , blackcurrant , and , to a lower degree , bilberries whereas aai induced an increase in liver triacylglycerol . lingonberries , bilberries , and crowberries diets reduced liver cholesterol content compared to the high - fat control ( figure 3(d ) ) . all the studied liver parameters were decreased in the low - fat diet compared to the high - fat control . the total amount of feces collected over 24 h as well as fecal excretion of triacylglycerol and cholesterol is presented in table 3 . there were no significant differences in total amount of excreted feces , whereas fecal content of cholesterol was elevated in the bilberry , aai , crowberry , blackberry , and low - fat control group . compared to control , the amount of excreted triacylglycerol was significantly higher in all groups except the low - fat control and the group receiving prune . the first part of the large intestine ( cecum ) is a site for bacterial fermentation . the mass of the cecum , including content , was increased in all groups compared to control except in the raspberry group ( table 3 ) . in this study , in order to assess the effects of berry supplementation on low - grade inflammation , plasma levels of the inflammation markers pai-1 ( figure 4(a ) ) and tnf- were measured . the pai-1 concentration was lower in plasma from mice receiving lingonberries , blackcurrants , bilberries , and low - fat diet compared to control . the pai-1 levels in mice receiving aai were elevated compared to other groups , although not significantly compared to control . spleen size is sometimes analyzed as a reflection of inflammatory activity . in this study , the spleen mass relative to lean tissue mass was significantly lower in the lingonberry group compared to high - fat control ( figure 4(b ) ) . anthocyanins were present in extracts from all experimental diets , except the prune diet . however , quercetin-3-o - glucoside and quercetin-3-o - galactoside were identified in both lingonberry and blackcurrant diets and in agreement with the earlier literature quercetin-3-o--rhamnoside ( quercitrin ) , kaempferol - deoxyhexoside , and quercetin-3-o-(4-hmg)--rhamnoside were identified in the lingonberry diet . in this study , we show that intake of certain species of berries can prevent weight gain and counteract the metabolic derangements induced by a high - fat diet . dietary intake of lingonberries prevented adiposity , hepatic lipid accumulation , alleviated hyperglycemia , hyperinsulinemia , and dyslipidemia and decreased plasma pai-1 and alt levels in mice fed a high - fat diet . blackcurrants and , to a lower extent , bilberries and raspberries had similar effects , whereas neither crowberries , prunes , nor blackberries caused any significant improvements of metabolic parameters in this study . the almost complete prevention of body weight gain observed in the group receiving lingonberry - supplemented diet is an effect of reduced adiposity . our finding is in agreement with a study in wistar rats , in which it was shown that lingonberry extracts favorably affected antioxidant defense enzymes , but it was also apparent that the lingonberry extracts reduced weight gain compared to the control . to the best of our knowledge , there are no other publications addressing the antiobesity effect of lingonberries . increased fat excretion is unlikely to entirely explain the protection against adiposity since fecal excretion of triacylglycerol was not elevated in the lingonberry group compared to groups receiving some of the other berries . also , there was no correlation between body weight and dietary intake of soluble , insoluble , or total fiber ( data not shown ) . interestingly , blackcurrant supplementation efficiently prevented weight gain and body fat accumulation despite an increased energy intake . however , the monitoring of caloric intake was based on registered food intake and due to texture , the blackcurrant diet gave rise to a higher spillage than other diets which could be incorrectly interpreted as a higher food intake . the increased excretion of triacylglycerol in bilberries , blackcurrants , and raspberries could be caused by reduced energy absorption and explain some of the beneficial effects on adiposity . this potential mechanism should be further investigated since increased fat excretion also was observed by supplementation with crowberry , acai , and blackberries , without preventing weight gain . polyphenol - rich extracts have been shown to inhibit pancreatic lipase [ 23 , 24 ] although it remains to be established if this mechanism operates also in vivo . approximately 7080% of patients with type 2 diabetes suffer from nonalcoholic fatty liver disease ( nafld ) , which is linked to increased risk of cardiovascular disease [ 25 , 26 ] . fat accumulation in the liver is associated with impaired hepatic insulin sensitivity [ 2729 ] and production of inflammatory markers [ 30 , 31 ] . elevated alt levels in plasma correlate with reduced liver function and steatosis and predicts type 2 diabetes [ 3234 ] . in this study , the significant reduction in liver triacylglycerol and alt levels in the lingonberry , blackcurrant , and bilberry groups implies protection against liver steatosis and subsequent improved liver function . our findings are supported by a 20-week dietary intervention study where a diet rich in berries ( bilberries , sea buckthorns , blackcurrants , and lingonberries ) reduced alt in overweight women . however , in a follow - up study using only bilberries and sea buckthorn no effects on alt - levels were observed ; thus , the authors concluded that either the lingonberries and/or blackcurrants were responsible for modulating hepatic lipid metabolism in a positive direction with lower alt as a result . in contrast to the beneficial effects observed following intake of lingonberry , blackcurrant , or bilberry , livers dissected from mice receiving supplementation with aai were large and visibly more whitish than other groups , indicating liver steatosis . analysis revealed that the livers weighed more and had higher triacylglycerol content , and mice receiving aai had significantly higher plasma alt levels than the rest of the berry groups , but not compared to the control group . . however , lipid accumulation per se may not be causal for the insulin resistance associated with fatty liver . mice fed lingonberries , blackcurrants , and bilberries had lower fasting glucose and/or insulin , resulting in a lower homa - insulin resistance index ( figure 2 ) . thus our data indicate that these three berries protected against high - fat induced insulin resistance . however , in humans , ingestion of lingonberries has been shown to abolish and decrease , respectively , the postprandial hyperglycemic response of ingesting glucose or sucrose in normal - weight healthy subjects [ 38 , 39 ] . a cell - assay based bioactivity screening of plants traditionally used to treat symptoms related to diabetes in a native canadian population identified an extract of lingonberries as having the highest antidiabetic potential . a follow - up study by eid et al . revealed that a lingonberry extract stimulated glucose uptake into muscle cells by activating the amp - activated protein kinase ( ampk ) pathway . also , a bilberry extract fed to diabetic kk - a mice ameliorated hyperglycemia and enhanced insulin sensitivity accompanied by ampk activation . in the polyphenolic characterization of the diets , quercetin-3-o - glucoside and quercetin-3-o - galactoside were found in the lingonberry and the blackcurrant diets . lingonberries and bilberries belong to the vaccinium genus and eid et al . proposed that the traditional use of this genus to treat diabetes is due to the ability of quercetin and some of its glucosides to transiently inhibit atp synthase and activate ampk . in a study by kobori et al . , supplementation with 0.05% quercetin alleviated hepatic fat accumulation and decreased visceral fat deposition , hyperglycemia , hyperinsulinemia , dyslipidemia , and inflammation in c57bl/6j mice fed a high - fat western diet . since lingonberries and blackcurrants had the most beneficial effects in our study , the finding that quercetin glycosides were detected only in the lingonberry and blackcurrant diets is interesting and will be further evaluated . moreover , erlund et al . have shown that daily intake of lingonberries , blackcurrants , and bilberries significantly increase , serum quercetin levels in humans . berries are in general rich in anthocyanins and several anthocyanins were found in the experimental diets . many of the detected anthocyanins and quercetin glycosides are associated with relevant bioactivities [ 11 , 42 , 44 , 45 ] , but our study design does not permit elaboration of causal relationships between specific compounds and health outcomes . the fact that resveratrol was not detected in the diets is somewhat unexpected since its presence in some of the studied berries has been demonstrated . however , contents of polyphenols are known to vary considerably due to different varieties , cultivars , and growing conditions . obesity and type 2 diabetes are associated with a systemic low - grade inflammation , and it has been suggested that an altered gut microbiota could be the underlying cause of this inflammation [ 4850 ] . berries are high in fiber and phenolic compounds which could promote or inhibit growth of certain species of bacteria and thereby alter the microbiota . the finding that all berry diets , except raspberries , increased cecum mass suggests a change in microbial fermentative activity . dietary administration of lingonberries , blackcurrants , and bilberries reduced plasma levels of pai-1 , which indicate an anti - inflammatory effect . in addition , the significantly lower spleen mass observed in the lingonberry - group may reflect a reduced systemic inflammation . many previous studies on berries have focused on the capacity of antioxidative polyphenols to reduce oxidative stress and prevent cardiovascular disease . increased pai-1 concentrations result in reduced fibrinolytic activity and play a key role in atherothrombosis . the reduction of pai-1 in combination with lower plasma cholesterol levels by lingonberry and blackcurrant supplementation suggests that these berries may be useful in preventing cardiovascular events . however , there was no significant effect on ldl / hdl cholesterol ratio and in the blackcurrant group an increase in plasma triacylglycerol was observed . in contrast , mice receiving aai had increased total cholesterol and pai-1 in plasma , further questioning the health aspects of this berry . in conclusion , this study demonstrated that daily supplementation with lingonberries and also blackcurrants and bilberries had pronounced antiobesity and beneficial metabolic effects in high - fat fed c57bl/6j mice . the mechanisms behind the effects should be further evaluated , taking into account lower doses and reproducibility in humans . the capacity of lingonberries to counteract the negative outcomes of an unhealthy diet could be useful in designing dietary intervention strategies aimed at preventing development of obesity and type 2 diabetes . | objective .
the aim of the study was to screen eight species of berries for their ability to prevent obesity and metabolic abnormalities associated with type 2 diabetes .
methods .
c57bl/6j mice were assigned the following diets for 13 weeks : low - fat diet , high - fat diet or high - fat diet supplemented ( 20% ) with lingonberry , blackcurrant , bilberry , raspberry , aai , crowberry , prune or blackberry .
results .
the groups receiving a high - fat diet supplemented with lingonberries , blackcurrants , raspberries or bilberries gained less weight and had lower fasting insulin levels than the control group receiving high - fat diet without berries .
lingonberries , and also blackcurrants and bilberries , significantly decreased body fat content , hepatic lipid accumulation , and plasma levels of the inflammatory marker pai-1 , as well as mediated positive effects on glucose homeostasis .
the group receiving aai displayed increased weight gain and developed large , steatotic livers .
quercetin glycosides were detected in the lingonberry and the blackcurrant diets .
conclusion .
lingonberries were shown to fully or partially prevent the detrimental metabolic effects induced by high - fat diet .
blackcurrants and bilberries had similar properties , but to a lower degree .
we propose that the beneficial metabolic effects of lingonberries could be useful in preventing obesity and related disorders . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
eligible subjects were men or women aged 18 years with moderate to severe bilaterally symmetrical cfl at maximum smile , measured using the 4-grade facial wrinkle scale with photonumeric guide ( fws ; 0 = none , 1 = mild , 2 = moderate , 3 = severe ) . subjects in study 2 were also required to have moderate to severe gl at maximum frown as assessed by the investigator using the fws . in both studies , subjects were excluded if they were currently receiving or had previously received botulinum toxin treatment of any serotype . both studies were approved by independent ethics committees or institutional review boards at each site and were conducted in accordance with good clinical practice guidelines and all relevant local and country privacy requirements . treatment details were previously reported . in study 1 , subjects were assigned ( 1:1 ) to receive onabotulinumtoxina 24 u or placebo ( saline ) , delivered via 3 injections per side into the cfl . injections of either onabotulinumtoxina 4 u or placebo had a volume of 0.1 ml . follow - up visits occurred at weeks 1 and 2 and at days 30 , 60 , 90 , and 120 , with the final study visit at day 150 . in study 2 , subjects were assigned ( 1:1:1 ) to receive onabotulinumtoxina 24 u ( 24 u to cfl ; saline to gl ) , onabotulinumtoxina 44 u ( 24 u to cfl ; 20 u to gl ) , or placebo ( to cfl and gl ) . follow - up visits were on the same schedule as in study 1 , except that subjects received a second treatment with onabotulinumtoxina or placebo on day 120 . this assessment was performed at maximum smile ( i.e. , biggest smile ) to evaluate dynamic lines and at rest ( i.e. , relaxed face ) to evaluate static lines . response to treatment was defined by at least a 1-grade improvement from baseline and was evaluated separately for dynamic and static lines . investigators and subjects were trained in grading the severity of cfl using the fws . at each posttreatment visit , subjects completed the 7-point sga - cfl ( 1 = very much improved , 2 = much improved , 3 = minimally improved , 4 = no change , 5 = minimally worse , 6 = much worse , and 7 = very much worse ) . duration of response , defined as the number of days from injection until the subject returned to nonresponder status , was determined for subjects who had a treatment response at day 30 . an analysis was performed to assess the median duration of response for day 30 responders based on sga - cfl scores at day 30 . efficacy analyses were performed on the intent - to - treat ( itt ) population , which comprised all randomized subjects . missing efficacy data at scheduled visits were imputed using a last - observation - carried - forward approach . the cfl rating at each visit represented the average of both sides of the face . the proportion of responders in each treatment group was compared using the cochran - mantel - haenszel test , stratified by investigator site . the median duration of response was estimated for day 30 responders using kaplan meier methodology . the median duration of response was estimated for day 30 responders stratified by sga - cfl score at day 30 using kaplan meier methodology . sas version 9.2 or higher ( sas institute , cary , nc ) was used for all statistical analyses . treatment details were previously reported . in study 1 , subjects were assigned ( 1:1 ) to receive onabotulinumtoxina 24 u or placebo ( saline ) , delivered via 3 injections per side into the cfl . follow - up visits occurred at weeks 1 and 2 and at days 30 , 60 , 90 , and 120 , with the final study visit at day 150 . in study 2 , subjects were assigned ( 1:1:1 ) to receive onabotulinumtoxina 24 u ( 24 u to cfl ; saline to gl ) , onabotulinumtoxina 44 u ( 24 u to cfl ; 20 u to gl ) , or placebo ( to cfl and gl ) . follow - up visits were on the same schedule as in study 1 , except that subjects received a second treatment with onabotulinumtoxina or placebo on day 120 . this assessment was performed at maximum smile ( i.e. , biggest smile ) to evaluate dynamic lines and at rest ( i.e. , relaxed face ) to evaluate static lines . response to treatment was defined by at least a 1-grade improvement from baseline and was evaluated separately for dynamic and static lines . investigators and subjects were trained in grading the severity of cfl using the fws . at each posttreatment visit , subjects completed the 7-point sga - cfl ( 1 = very much improved , 2 = much improved , 3 = minimally improved , 4 = no change , 5 = minimally worse , 6 = much worse , and 7 = very much worse ) . duration of response , defined as the number of days from injection until the subject returned to nonresponder status , was determined for subjects who had a treatment response at day 30 . an analysis was performed to assess the median duration of response for day 30 responders based on sga - cfl scores at day 30 . efficacy analyses were performed on the intent - to - treat ( itt ) population , which comprised all randomized subjects . missing efficacy data at scheduled visits were imputed using a last - observation - carried - forward approach . the cfl rating at each visit represented the average of both sides of the face . the proportion of responders in each treatment group was compared using the cochran - mantel - haenszel test , stratified by investigator site . the median duration of response was estimated for day 30 responders using kaplan meier methodology . the median duration of response was estimated for day 30 responders stratified by sga - cfl score at day 30 using kaplan meier methodology . sas version 9.2 or higher ( sas institute , cary , nc ) was used for all statistical analyses . in total , 1,362 subjects were enrolled in studies 1 ( n = 445 ) and 2 ( n = 917 ) , of whom 833 subjects ( 61.2% ) received onabotulinumtoxina and 529 ( 38.8% ) received placebo in the crow 's feet region . in study 2 , 305 subjects also received onabotulinumtoxina 20 u in the glabellar region ( total dose , 44 u ) . most subjects completed the studies ( study 1 , 93.3% ; study 2 , 90.4% ) . overall , the most common reasons for early discontinuation were personal decision ( 4.4% ) and lost to follow - up ( 3.0% ) . however , subjects in study 2 were , on average , older than those in study 1 ( table 1 ) . mean age was 46.4 years in study 1 and 49.5 years in study 2 , with a greater percentage of subjects in study 1 versus study 2 aged 50 years ( 67.4% vs 55.4% , respectively ) . onabotulinumtoxina and placebo treatment groups were also well balanced with respect to cfl severity at baseline within each study . however , compared with study 1 , a greater proportion of subjects in study 2 had severe dynamic cfl ( 63.2% vs 50.2% ) at baseline ; these observations are consistent with the greater mean age in study 2 . demographic characteristics and baseline crow 's feet line severity a significantly greater proportion of subjects achieved 1-grade improvement from baseline in dynamic and static cfl with onabotulinumtoxina versus placebo , based on the investigators ' and subjects ' assessments at day 30 ( p < .001 ) ( table 2 ) . in study 1 , day 30 responder rates for dynamic lines with onabotulinumtoxina versus placebo , respectively , were 87.4% versus 12.1% ( p < responder rates achieved with onabotulinumtoxina were somewhat lower for static cfl but were significantly greater than rates in the placebo group ( p < .001 ) . proportion of subjects who achieved 1-grade improvement from baseline in crow 's feet line severity at day 30 similar findings were obtained in study 2 , although responder rates tended to be slightly lower , consistent with the greater proportion of subjects with severe cfl at baseline ( table 2 ) . in study 2 , subjects receiving onabotulinumtoxina for both cfl and gl ( 44 u ) had higher responder rates versus those receiving onabotulinumtoxina only for cfl ( 24 u ) on the investigator 's assessment of dynamic and static cfl ( both p < .001 ) and on the subjects ' assessment of dynamic cfl ( p = .013 ) . the proportion of subjects who maintained treatment responses at maximum smile and at rest declined slowly after day 30 in studies 1 and 2 ( first treatment ) ( figure 1 ) . responder rates remained significantly greater with onabotulinumtoxina versus placebo at all study visits ( p < .001 ) . responder rates ( 1-grade improvement ) at maximum smile ( a ) and at rest ( b ) on the investigator 's fws in study 1 . responder rates ( 1-grade improvement ) at maximum smile ( c ) and at rest ( d ) on the investigator 's fws in study 2 in the first treatment cycle . all differences between the onabotulinumtoxina groups versus the placebo group were statistically significant ( p < .001 ) . only subjects rated at least mild at baseline were included in the analysis performed at rest in both studies . the final visit in study 1 was scheduled for day 150 . on kaplan meier analysis , the estimated median duration of response on the investigators ' and subjects ' assessments were , respectively , 125 and 144 days for dynamic cfl and 137 and 148 days for static cfl ( figure 2 ) . duration of treatment response based on kaplan meier analysis in day 30 responders ( 1-grade improvement ) on the investigator 's fws and subject 's fws in study 1 based on maximum smile ( a ) and at rest ( b ) on the investigator 's fws and at maximum smile ( c ) and at rest ( d ) on the subject 's fws . subjects in study 2 were to receive a second treatment cycle on day 120 , thus creating an earlier boundary for estimating treatment response duration versus study 1 . on kaplan meier analysis , the estimated median duration of response was 119 to 121 days for both dynamic and static cfl on the investigators ' and subjects ' assessments ( figure 3 ) . the median response duration was the same for subjects receiving onabotulinumtoxina for only cfl and for both cfl and gl . duration of treatment response based on kaplan meier analysis in day 30 responders ( 1-grade improvement ) in study 2 based on maximum smile ( a ) and at rest ( b ) on the investigator 's fws and at maximum smile ( c ) and at rest ( d ) on the subject 's fws . fws , facial wrinkle scale with photonumeric guide . using the sga - cfl , a significantly greater proportion of subjects in the onabotulinumtoxina group versus the placebo group classified themselves as very much improved or much improved at day 30 in studies 1 and 2 ( p < .001 ) . the duration of response with onabotulinumtoxina ( based on fws responder analysis ) stratified by the subjects ' sga - cfl ratings at day 30 showed a median duration of 146 days in subjects rating themselves as very much improved ( sga - cfl score of 1 ) in study 1 versus 121 days in subjects rating themselves the median duration of response for subjects with sga - cfl scores of 3 ( minimally improved ) and 4 ( no change ) was 135 days and 93 days , respectively ( figure 4 ) . in study 2 , the median duration of response for subjects with sga - cfl scores of 1 or 2 were 119 and 118 days , respectively , and were longer than the median duration of response for subjects with sga - cfl scores of 3 or 4 in the onabotulinumtoxina 24 u and 44 u groups ( figure 4 ) . in both studies , the proportion of responders with sga - cfl scores of 1 and 2 followed parallel and similar courses and were generally different from the proportion of responders with scores of 3 or 4 . duration of treatment response based on kaplan meier analysis in day 30 responders ( 1-grade improvement ) on the investigator 's fws at maximum smile according to how they rated their improvement at day 30 on the sga - cfl in study 1 with onabotulinumtoxina 24 u ( a ) and for study 2 with onabotulinumtoxina 24 u ( b ) and onabotulinumtoxina 44 u ( c ) . fws , facial wrinkle scale with photonumeric guide ; sga - cfl in crow 's feet lines . a significantly greater proportion of subjects achieved 1-grade improvement from baseline in dynamic and static cfl with onabotulinumtoxina versus placebo , based on the investigators ' and subjects ' assessments at day 30 ( p < .001 ) ( table 2 ) . in study 1 , day 30 responder rates for dynamic lines with onabotulinumtoxina versus placebo , respectively , were 87.4% versus 12.1% ( p < responder rates achieved with onabotulinumtoxina were somewhat lower for static cfl but were significantly greater than rates in the placebo group ( p < .001 ) . proportion of subjects who achieved 1-grade improvement from baseline in crow 's feet line severity at day 30 similar findings were obtained in study 2 , although responder rates tended to be slightly lower , consistent with the greater proportion of subjects with severe cfl at baseline ( table 2 ) . in study 2 , subjects receiving onabotulinumtoxina for both cfl and gl ( 44 u ) had higher responder rates versus those receiving onabotulinumtoxina only for cfl ( 24 u ) on the investigator 's assessment of dynamic and static cfl ( both p < .001 ) and on the subjects ' assessment of dynamic cfl ( p = .013 ) . the proportion of subjects who maintained treatment responses at maximum smile and at rest declined slowly after day 30 in studies 1 and 2 ( first treatment ) ( figure 1 ) . responder rates remained significantly greater with onabotulinumtoxina versus placebo at all study visits ( p < .001 ) . responder rates ( 1-grade improvement ) at maximum smile ( a ) and at rest ( b ) on the investigator 's fws in study 1 . responder rates ( 1-grade improvement ) at maximum smile ( c ) and at rest ( d ) on the investigator 's fws in study 2 in the first treatment cycle . all differences between the onabotulinumtoxina groups versus the placebo group were statistically significant ( p < .001 ) . only subjects rated at least mild at baseline the final visit in study 1 was scheduled for day 150 . on kaplan meier analysis , the estimated median duration of response on the investigators ' and subjects ' assessments were , respectively , 125 and 144 days for dynamic cfl and 137 and 148 days for static cfl ( figure 2 ) . duration of treatment response based on kaplan meier analysis in day 30 responders ( 1-grade improvement ) on the investigator 's fws and subject 's fws in study 1 based on maximum smile ( a ) and at rest ( b ) on the investigator 's fws and at maximum smile ( c ) and at rest ( d ) on the subject 's fws . subjects in study 2 were to receive a second treatment cycle on day 120 , thus creating an earlier boundary for estimating treatment response duration versus study 1 . on kaplan meier analysis , the estimated median duration of response was 119 to 121 days for both dynamic and static cfl on the investigators ' and subjects ' assessments ( figure 3 ) . the median response duration was the same for subjects receiving onabotulinumtoxina for only cfl and for both cfl and gl . duration of treatment response based on kaplan meier analysis in day 30 responders ( 1-grade improvement ) in study 2 based on maximum smile ( a ) and at rest ( b ) on the investigator 's fws and at maximum smile ( c ) and at rest ( d ) on the subject 's fws . using the sga - cfl , a significantly greater proportion of subjects in the onabotulinumtoxina group versus the placebo group classified themselves as very much improved or much improved at day 30 in studies 1 and 2 ( p < .001 ) . the duration of response with onabotulinumtoxina ( based on fws responder analysis ) stratified by the subjects ' sga - cfl ratings at day 30 showed a median duration of 146 days in subjects rating themselves as very much improved ( sga - cfl score of 1 ) in study 1 versus 121 days in subjects rating themselves much improved the median duration of response for subjects with sga - cfl scores of 3 ( minimally improved ) and 4 ( no change ) was 135 days and 93 days , respectively ( figure 4 ) . in study 2 , the median duration of response for subjects with sga - cfl scores of 1 or 2 were 119 and 118 days , respectively , and were longer than the median duration of response for subjects with sga - cfl scores of 3 or 4 in the onabotulinumtoxina 24 u and 44 u groups ( figure 4 ) . in both studies , the proportion of responders with sga - cfl scores of 1 and 2 followed parallel and similar courses and were generally different from the proportion of responders with scores of 3 or 4 . duration of treatment response based on kaplan meier analysis in day 30 responders ( 1-grade improvement ) on the investigator 's fws at maximum smile according to how they rated their improvement at day 30 on the sga - cfl in study 1 with onabotulinumtoxina 24 u ( a ) and for study 2 with onabotulinumtoxina 24 u ( b ) and onabotulinumtoxina 44 u ( c ) . fws , facial wrinkle scale with photonumeric guide ; sga - cfl in crow 's feet lines . responders in the current analysis maintained treatment response for a median duration of 4 months or longer as assessed by investigators and subjects . in addition , subjects who perceived greater improvement in their cfl at day 30 tended to have a greater duration of response to onabotulinumtoxina than did those who reported little or no improvement , suggesting that patients ' perceptions of treatment results may be directly associated with duration of effect . these perceptions may determine whether benefits of treatment translate to improvements in patients ' well - being and may potentially influence patient behaviors , such as returning for follow - up treatments to maintain long - term effects . the estimates of response duration for onabotulinumtoxina were somewhat longer in study 1 versus study 2 , particularly on the subjects ' assessments . the difference in median duration between studies ranged from 6 days in the investigators ' assessments of dynamic cfl to 28 days in the subjects ' assessments of static cfl . first , subjects were followed for 150 days after receiving onabotulinumtoxina in study 1 , whereas those in study 2 received a second treatment on day 120 . thus , duration data for 33% of subjects in study 2 were censored while they were still responding to onabotulinumtoxina , leading to a ceiling effect for response duration in study 2 . in addition , the cohort enrolled in study 2 was generally older and included a greater proportion of subjects with severe cfl at maximum smile at baseline versus study 1 . these differences likely reflect the selection criteria for these studies ; specifically , subjects in study 2 were required to have moderate or severe cfl and gl at maximum smile / frown to qualify for entry , whereas subjects in study 1 were required to have only moderate or severe cfl . it is also notable that subjects in study 2 had more severe resting cfl at baseline compared with those in study 1 ; greater baseline severity of resting cfl has been associated with a shorter duration of response to onabotulinumtoxina . subjects perceived that the duration of response with onabotulinumtoxina was longer than that based on the investigators ' assessments in study 1 , particularly for dynamic cfl ( median duration , 144 and 125 days based on subject and investigator assessments , respectively ) . this difference may reflect how subjects and investigators evaluate cfl : namely , subjects generally observe their cfl area from a frontal perspective in the mirror and may be less able to observe a return of activity to that area , whereas physicians can look directly at the lines , from an oblique or lateral view , when making assessments . this explanation may also account for the lower subject - assessed responder rate at day 30 compared with the investigator - assessed responder rate in study 1 in that subjects may also be less able to observe a loss of activity in their cfl area . a 1-grade change is considered clinically meaningful in that it is the minimum response for observable benefit of treatment effects and is of relevance to clinicians and subjects . in study 2 , subjects did not perceive a difference in treatment response duration versus investigators . again , the shorter 120-day follow - up may have limited sensitivity for detecting any differences in duration perceived by subjects and investigators in the second study . the shorter 120-day follow - up may also explain why the higher response rates in the onabotulinumtoxina 44 u group versus response rates in the onabotulinumtoxina 24 u group did not translate into a longer median response duration . the median duration of 4 months or longer with onabotulinumtoxina in these phase 3 studies is consistent with several smaller studies in subjects treated for cfl . in a multicenter , double - blind , randomized , placebo - controlled , dose - ranging study in 162 subjects with cfl followed for up to 180 days , the median time to return to baseline severity was 120 days for subjects receiving a total dose of onabotulinumtoxina 24 u. notably , in an open - label study involving 25 women who were followed for 9 months after a single treatment with onabotulinumtoxina , improvement in static cfl was maintained through 6 months , based on observations by trained observers and 3-dimensional profilometry skin imaging . response duration for onabotulinumtoxina for cfl is similar to that observed in the treatment of gl . in a meta - analysis of 4 gl registration trials , median duration of response to onabotulinumtoxina in subjects with moderate to severe gl was 125 days for responders , defined by a 1-grade improvement on the fws at maximum contraction . subject follow - up in these studies was 120 days ( with the exception of 1 study for which follow - up was 4 weeks ) , potentially limiting the response duration . furthermore , results of a single - center study of 60 women suggest that , after simultaneous injection of onabotulinumtoxina for treatment of cfl , gl , and forehead lines ( total , 16 injections ) , the median response duration ( defined as 25% improvement from baseline on a 9-point patient global assessment scale ) for subjects receiving 4 u per injection site ( as in the present studies ) was approximately 12 to 16 weeks ( i.e. , 84112 days ) . overall , these findings suggest that onabotulinumtoxina provides a long duration of clinical response when used for treatment of cfl , gl , or multiple upper facial rhytids . subject perception of improvement provides guidance regarding retreatment of cfl and , when considered with duration of response , may influence overall satisfaction with treatment . thus , examining the relationship between patient - reported outcomes and clinical outcomes can lead to a more complete understanding of the benefits of treatment . greater subject - reported improvement on the sga - cfl at day 30 in both studies ( scores 1 and 2 ) was associated with a longer response duration on the investigator 's fws at maximum smile . in study 1 , the relatively longer median duration of response for subjects with an sga - cfl score of 3 compared with subjects with a score of 2 may be due to the small sample size ( n = 44 ) for subjects with a score of 3 . as discussed below , additional limitations in study design may have precluded the detection of a significant relationship between sga - cfl ratings and response duration after treatment of cfl with onabotulinumtoxina 24 u. several factors limit interpretation of the current analyses . as previously discussed , the duration analyses were capped at day 150 in study 1 and day 120 in study 2 , when a significant proportion of subjects were still responding to treatment , thereby potentially underestimating the median response duration . future studies permitting a return to baseline status of all subjects may yield a longer observed duration of efficacy . in addition , differences in baseline cfl severity between trials may confound comparison of results . assessments of responder rates and , subsequently , duration of clinical response were based on assessments at maximum smile and at rest : despite the clear instructions on the desired smile , the magnitude of the dynamic expression may have varied across visits based on each subject 's effort , and static cfl may vary based on factors such as hydration . finally , subjects with deep cfl or gl were not included in these studies , and results therefore can not be extrapolated to those populations . this formulation is not interchangeable with other botulinum toxin products , and units can not be converted using a dose ratio . therefore , the results of this study can not be extrapolated to other formulations of botulinum toxins . onabotulinumtoxina produced treatment responses in most subjects with cfl , and duration of response was 4 months in both studies . the lower responder rate and shorter duration of response in study 2 compared with study 1 is most likely explained by the higher baseline cfl wrinkle severity and shorter follow - up period . patterns were observed suggesting that duration of clinical response to onabotulinumtoxina may be related to subject perceptions of cfl improvement after treatment . further comparisons between clinical efficacy measures and patient - reported outcomes are warranted in assessments of esthetic treatments . | backgroundduration of esthetic treatments may contribute to subject satisfaction.objectivedescribe response duration with onabotulinumtoxina in crow 's feet lines ( cfl ) and the association of duration with perception of improvement.methodssubjects from 2 double - blind , placebo - controlled trials received onabotulinumtoxina 24 u in cfl ; study 2 subjects could also receive 20 u in glabella . at day 30 , responders achieved 1-grade improvement in facial wrinkle scale ( fws ) scores .
median duration of effect for responders and for responders stratified by subject 's global assessment of change in cfl ( sga - cfl ) was determined.resultsof 1,362 subjects , 833 received onabotulinumtoxina . in study 2 , 305 subjects also received 20 u in glabella .
in study 1 ( 150-day follow - up ) , per investigator and subject assessments , respectively , median response duration was 125 and 144 days for dynamic lines and 137 and 148 days for static lines .
median response duration for dynamic and static lines in study 2 ( 120-day follow - up ) was 119 to 121 days per investigator and subject assessments .
subjects reporting greater improvement on the sga - cfl tended to have a longer duration of response on investigator fws scores at maximum smile.conclusionresponse duration with onabotulinumtoxina in cfl was 4 months .
subject perception of cfl improvement may be associated with response duration . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
cage migration interfere with successful fusion in patients undergoing posterior lumbar interbody fusion ( plif ) and causes low back pain or neurologic deficits because the migrated cage compresses neural elements in the lumbar spinal canal . posterior migration of a cage after plif procedures has been reported by several authors2,7 ) . in their reports , the risk factors for cage migration mainly include lack of posterior instrumentation and total facetectomy . although several reports of posterior cage migration after plif or transforaminal lumbar interbody fusion ( tlif ) have been published , no report has been reported on the repeated migration of a fusion cage . here , we report a unique case of repeated posterior migration of a fusion cage after plif in addition to posterior instrumentation . a 54-year man had experienced disabling right leg pain with claudication for 12 months before the surgery . radiological studies , including simple radiographs and magnetic resonance imaging ( mri ) revealed right foraminal stenosis at the l5-s1 level . preoperative laboratory tests and bone marrow densitometry ( bmd ) results were all within normal ranges . he underwent l5-s1 plif using stryker titaniumthreaded cages ( length 25 mm , height 7 mm ) with autogenous local bone chips following posterior instrumentation . however , at 10 days after the surgery , he complained of the sudden onset of pain radiating to right thighs and numbness in right leg . however , radiographs of the lumbar spine showed posterior migration of the right cage causing significant neural root compression ( fig . revision surgery was performed to advance the migrated right cage anteriorly , using the same approach as that used during the initial surgery ( fig . the right leg pain was relieved immediately after the revision surgery , and plain radiographs showed adequate re - positioning of the cage . after removal of a suction drain at third day , he was allowed to ambulate in a brace . however , two weeks after the revision surgery , the right leg pain gradually worsened . 4 ) . during second revision surgery , after removing both cages , larger cages ( length 25 mm , height 9 mm ) were inserted into the disc space , the screws were replaced with larger diameter screws , and compression maneuver of screw system was applied to prevent further cage migration . the remained graft bone and allograft bone chips were packed into the disc space before inserting the fusion cages . a dramatic improvement in the right leg pain was achieved immediately after the secondary revision surgery . at six month follow - up , he was symptom free and plain radiographs showed inevitable positioning of the cage ( fig plif is a reliable treatment option in patients with degenerative lumbar spinal diseases , and provides spinal stabilization in balanced alignment , disc height restoration , and mechanical decompression of neural elements6 ) . furthermore , these cages provide immediate stability to spinal levels , restoration of the disc space and neuroforaminal , and a larger surface area , and thus , better fusion rate3 ) . although current plif procedures are the result of considerable development , some cage - related complications , such as , cage migration or subsidence , may occur . brodke et al.1 ) and lund et al.5 ) in two separate studies , biomechanically tested the initial stability of plif alone and with additional posterior instrumentation . both studies supported the role of additional posterior instrumentation in terms of preventing cage retropulsion , markedly increasing stiffness in axial compression , and more importantly , in flexion - extension torque1,5 ) . uzi et al.7 ) reported 3 cases of cage migration after plif in the absence of posterior instrumentation7 ) . they reported retropulsion occurs during spinal flexion , and suggested that this can be prevented by supplemental posterior instrumentation . however , in our patient , the inserted titanium cage was not a standalone device . kimura et al.4 ) reported that the risk factors of cage retropulsion after plif are ; ( 1 ) a multilevel fusion procedures , ( 2 ) the involvement of l5/s1 , ( 3 ) greater range of motion ( rom ) of the disc space ( > 10 on lateral radiographs ) , and ( 4 ) taller discs ( > 10 mm at the midpoint of end plates on computed tomographic scans ) . in this previous study , no case of cage retropulsion after single - level plif was observed . however , despite single level plif , our patient experienced repeated cage migration at the l5-s1 level , suggesting that the inserted cages did not fit the shape of l5/s1 , which has a greater disc angle than other disc levels . furthermore , pedicle screw fixation at s1 is less rigid than at other spinal locations because of the anatomical nature of the sacrum . another feasible mechanism of cage migration in our patient concerned a pear - shaped disc space , as a wide anterior space makes it difficult to contact the two anterior points of the cage . in our opinion , as much graft bone as possible , in addition to the cages , should be packed into the disc space at initial surgery to reduce cage movement and facilitate bone fusion . in our patient this case cautions care must be taken during cage insertion to avoid the possibility of cage migration , and that when unexpectedly encountered , larger cages should be used and more compressive force be applied by pedicle screws to prevent repeated cage migration . furthermore , it should be noted that repositioning by simply punching cages did not prevent repeated cage migration in our patient . however , more studies about the angle of cages and intraoperative position of the patients are necessary . we report a case of unexpected repeated cage migration after plif . larger cages and more compressive force should be applied to avoid this unexpected complication . | although posterior lumbar interbody fusion ( plif ) is a widely accepted procedure , perioperative and postoperative complications are still encountered . in particular , cage migration can result in severe sequelae , and revision surgery is technically demanded . here , we report a rare case of repeated migration of a fusion cage after plif . to the best of our knowledge , no report has been previously issued on repeated migration of a fusion cage after plif .
the authors discuss the radiological and clinical findings of this unusual complication with a review of the literature . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
in the last half a century , tremendous progress in understanding the genetic and biochemical mechanisms underlying cancer has been achieved . despite these advances , cancer remains a major health problem that is responsible for one in every four adult deaths ( siegel et al . , 2011 ) . high mortality rates indicate that this knowledge is not translating into effective cancer treatments ( lord and ashworth , 2010 ) . chemotherapy was discovered in chemical warfare during world war i ; it was first used to treat cancer in the 1940s when little was understood about the disease ( goodman et al . , 1946 ) , and remains the most common form of treatment for most types of cancers . chemotherapy drugs target rapidly dividing cells ; as a result , normal tissues with high growth rates suffer and patients often experience adverse and sometimes deadly side effects . over the past 15 years , drugs have emerged that target cancer metabolism , either directly through enzymes that facilitate metabolic reactions or indirectly through signaling pathways ( zhukov and tjulandin , 2007 ; heiden , 2011 ) . however , cancer cells are extremely robust for survival and often completely insensitive to perturbations or develop resistance over time . drug resistance occurs when non - targeted genes or proteins kick in to rescue the cancer cell by rerouting growth requirements through alternative mechanisms and pathways . it is becoming apparent that , in order to develop effective targeted therapies that overcome resistance , the drug development paradigm will have to shift from single molecular targets to pathways ( astsaturov et al . , 2010 ; thangue and kerr , 2011 ) . systems biology approaches will play a pivotal role in the development of drugs that do not succumb to resistance . . they can be used as an exploratory tool to complement and guide experimental work . simulations , known as in silico experiments , can be performed with mathematical models to validate hypotheses and make predictions about quantities that are difficult or impossible to measure in vivo . predictions can provide much - needed insight into the pathways driving cancer progression , and the robust compensatory mechanisms that protect cancer cells from drug intervention . model simulations can be used to predict the system - wide effects of molecular targets , e.g. , determine the effects of molecular target(s ) inhibition in specific populations . they can also serve as an important clinical tool , e.g. , classify benign and malignant tumors , predict disease prognosis for individual patients , and predict outcomes of treatments . high - throughput technologies offer the capability to simultaneously measure tens of thousands of molecular targets per sample . as costs steadily decline , the number of omics datasets characterizing the genome , proteome , and metabolome continues to grow . a number of publicly available resources have been developed to house data and functional annotation . these resources can be queried and have enabled scientists to better leverage omics - based research efforts . to illustrate the size of such databases , as of march , 2012 , gene expression omnibus ( geo ) contained data from 9,919 platforms , 710,229 samples , 28,873 series , and 2,720 manually curated datasets ( barrett and edgar , 2006 ) . the progenetix database houses data from comparative genomic hybridization ( cgh ) experiments that focus on copy number abnormalities in human cancer ( baudis and cleary , 2001 ) . the cancer genome atlas ( tcga ) contains the results of subjecting patient samples from a variety of cancer subtypes to a battery of common high - throughput assays such as gene expression , array comparative genomic hybridization ( acgh ) , snp genotyping , methylation profiling , microrna profiling , and some exon sequencing platforms ( collins and barker , 2008 ) . the sanger cancer genome project has generated a cancer gene census ( futreal et al . , 2004 ) , a catalog of somatic mutations in cancer ( forbes et al . , 2010 ) , as well as several bioinformatic resources born out of the interrogation of cancer cell lines . the wealth of publicly available data offers an exciting opportunity to study cancer as a complex network . we are currently in an era where collecting data in a high - throughput fashion is the norm . however , our ability to interpret this data for knowledge and discovery has not kept pace with the data collection efforts . importantly , this message was echoed in nci s recent funding opportunity addressing provocative questions , which pose game - changing scientific questions to drive progress against cancer ( rfa - ca-11 - 01 ; varmus and harlow , 2012 ) . step back from the momentum of these discoveries and make sure we have left no stone unturned and no important but perhaps not obvious question left unexplored . provocative question 17 asks the following : since current methods to assess potential cancer treatments are cumbersome , expensive and often inaccurate , can we develop other methods to rapidly test interventions for cancer treatment or prevention ? mathematical models serve as a link between experimental and computational biology , and can be used to address this question . specifically , they can serve as a tool to drive experimental advances in terms of predication , classification , and hypotheses generation . in this article , we describe two complementary and widely used modeling paradigms : deterministic models of cellular systems and graphical modeling . deterministic models of cellular metabolism are constructed in a bottom - up approach from known stoichiometry , principles of mass balance , and physiological constraints , whereas graphical models are inferred from the data using linear statistical models in a top - down approach . these approaches offer vastly different perspectives on network behavior and have been instrumental for systems biology . we review the fundamentals of these modeling paradigms and highlight applications of models that have been developed to advance cancer systems biology . many drugs that are either available or in the development phase target proteins or enzymes in these pathways in an effort to slow or halt cancer growth ( bates et al . , 2012 ) . however , adjustments in cancer cell signaling enable proliferation independent of exogenous signals , disrupt apoptosis , and elicit tumor angiogenesis and metastasis to surrounding tissues and vessels ( johnstone et al . , 2002 ; martin , 2003 ) . unlike their normal counterparts , cancer cells use aerobic glycolysis instead of oxidative phosphorylation for energy production ( warburg , 1956 ) . glutamine is central to cancer cell protein and nucleotide biosynthesis , and replenishes the tca cycle for anabolic processes ( lu et al . , 2010 ) . fatty acid biosynthesis occurs at high rates and most fatty acids are produced de novo regardless of nutrition . ordinary differential equations ( odes ) represent the most widely used approach for modeling cellular dynamics . the underlying assumption is that reactions occur under well - mixed conditions and that the abundance of reactants is not too low . the differential equations are derived from laws of mass balance and describe the rate of change of a species ( dc / dt ) in terms of production and utilization , i.e. , dc / dt = production utilization ( figure 1a ) . in many cases , the stoichiometry of pathways are well understood , and the topology of the system can be modeled easily with odes ( ogata et al . , 1999 ; . however , the underlying processes , e.g. , reaction fluxes and transport rates , rely on parameters that are often unknown and require challenging underdetermined estimation from time course data ( figure 1b ; erguler and stumpf , 2011 ) . another challenge is that these systems can often exhibit sharp transients on different time scales ( stiffness ) , which requires computationally intensive numerical integration ( shampine et al . , 2003 ; consequently , they are used to investigate small subsets of reactions and pathways . simplified schematic describing mathematical modeling of cellular systems with odes . ( a ) the cellular system is translated into a mathematical model with system of odes reflecting the mass balance of the system . ( b ) dynamic analysis of the system requires specification of fluxes as non - linear functions , which depend on a number of unknown parameters . solving the ode system results in the time course of concentration values as output . ( c ) steady - state analysis of the system requires the specification of an objective function and constraints , but the ode system reduces to a simple linear system . ode models have been used extensively to examine the dynamic properties of cancer signaling pathways . a model of tumor suppressor p53 and oncogene mdm2 revealed high variability in the oscillatory behaviors of cells following dna damage ( geva - zatorsky et al . , nf-b signaling plays a critical role in intracellular signaling , apoptosis , and resistance to chemotherapy . a computational model was used to distinguish the roles of nf-b kinase isoforms , which regulate nf-b through coordinated system dynamics ( hoffmann et al . , 2002 ) . extensions of this model have been used to characterize feedback loops in the system and identify the activation of downstream pathways ( covert et al . , 2005 ; several different mathematical models have been developed for the mapk ( mitogen - activated protein kinase ) pathway ( 35 models between 1960 and 2005 ; orton et al . , 2005 ) . despite differences in detail and complexity , these models are able to explain the data and make insightful system - wide predictions about the pathway dynamics . most of the differences between model outputs can be attributed to model boundaries and simplifications . this has been suggested to be a reflection of the robustness of ode modeling and the biological system at hand ( orton et al . , 2005 ) . advances in high - throughput technologies have spurred the development of comprehensive genome - scale metabolic models ( oberhardt et al . , 2009 ) . the metabolic system is described by hundreds of metabolic reactions , multiple compartments , and highly interconnected pathways . constraint based analysis ( cba ) has been used to investigate the steady - state behavior of these systems under a variety of conditions . in the steady - state , metabolites are stable and exhibit no change in concentration levels . adopting this assumption reduces a complex dynamical system of odes to linear system and eliminates the need for large - scale parameter estimation ( figure 1c ) . the purpose of steady - state analysis is to identify feasible flux values that satisfy the steady - state assumptions and maximize an objective function describing the physiological objectives of the cell ( lee et al . , 2006 ) . the solution space is bounded with system constraints , e.g. , stoichiometric , thermodynamic , and enzyme capacity constraints . in single cell organisms , such as escherichia coli and saccharomyces cerevisiae , the cellular objective is to proliferate , and critical reactions and pathways are included in biomass function which is maximized ( edwards and palsson , 2000 ; frster et al . , 2003 ) . in these cases , optimizing cellular growth is analogous to maximizing the likelihood of survival . defining cellular objectives is less straightforward in mammalian and human systems , which consist of a variety of interacting tissues and cells ( duarte et al . , 2007 ; livnat jerby and ruppin , 2010 ; selvarasu et al . , 2010 ) . however , unlike normal cells , cancer cells want to proliferate and exhibit biomass requirements which can be leveraged in cba modeling approaches . recently , a genome - scale model has been used to characterize the warburg effect in cancerous cells ( shlomi et al . , 2011 ) . the model was validated against the full panel of nci-60 cancer cell lines , and provided novel insights into phases of metabolic behavior through cancer progression . a smaller model centered around a core set of critical enzymes and coding genes was used to predict novel drug targets ( folger et al . , 2011 ) . odes are the most popular modeling technique largely because of their simplicity . several other modeling paradigms that vary in complexity have been applied to study cancer cellular metabolism , signaling , and response to treatment . boolean models have been used to represent reactions as logical gates with two states : on and off ( lhdesmki et al . , 2003 ; morris et al . , 2010 partial differential equations ( pdes ) are significantly more complex than odes with respect to parameter estimation . detailed information about spatial dynamics and interactions between components is required ( sleeman and levine , 2001 ; ribba et al . , 2006 ; friedman et al . , 2007 perturbation - response modeling approaches are based on fundamental linear response rules , which leverage flux conservation . this approach has been used to examine toll like receptor ( tlr ) signaling and tumor necrosis factor related apoptosis inducing ligand ( trail ) resistance ( piras et al . , 2011 ; selvarajoo , 2011 ) . pharmacokinetic modeling has also been used to describe the time - dependent distribution of drugs in the system ( gerlowski and jain , 1983 ; reitz et al . , 1990 ; sanga et al . , probabilistic graphical models ( pgms ) can be used to describe directed and undirected relationships between variables ( koller and friedman , 2009 ) . in this setting , each variable ( e.g. , genes , proteins ) is a node in the network and viewed as a random variable , which is subject to uncertainty . the links in the network convey a relevant measure of association , e.g. , correlation ( undirected ) or causality ( directed ) . the network structure can be decomposed into small regions and translated into a product of conditional probabilities , which represents the joint probability distribution . undirected graphs are known as markov networks and portray symmetric relationships ( figure 2a ) . a link in this model is present if the linked nodes are associated after controlling for the influence of other nodes in the graph ( conditional association ) . in a directed graph , an edge a b implies that independent variable a ( parent node ) is upstream of the dependent variable b ( child node ) in the underlying causal process ( figure 2b ) . furthermore , the directed edge implies a causal effect of a after the influence of the remaining nodes upstream of b ( ancestors of b ) have been controlled for or removed . bayesian networks ( bns ) are directed acyclic graphs ( dags ) , which contain no cycles , and thereby prohibit feedback in the model . . relationships between variables can be expressed using conditional independencies , allowing compact representation of the joint distribution . parameter estimation is for the parameters of the conditional probabilities for a given network structure , and can be carried out using maximum likelihood approaches ( koller and friedman , 2009 ) . in structural learning , the aim is to identify the most likely network topology that came from the observational data . structural learning is especially challenging because the number of possible network topologies is super - exponential with the number of nodes ( chickering et al . , 1994 ) . as a result , enumeration of all possible network topologies is impossible even for small problems , and machine learning and optimization techniques must be utilized ( koller and friedman , 2009 ) . markov networks were used to predict breast cancer survival after patients received different forms of treatments , e.g. , combinations of chemotherapy , radiotherapy , and hormonal therapy ( prez - ocn et al . , 2001 ) . bns were used to integrate clinical and microarray data for the classification of breast cancer patients into good and poor prognosis groups ( gevaert et al . , 2006 ) . kahn et al . developed a bn called mammonet for radiological decision support in distinguishing malignant and benign mammary tumors . the highly accurate classifier ( 88% correct diagnosis in test cases ) was constructed from observational data , patient history , and expert advice from experienced radiologists ( kahn et al . , 1995 ) . this group later developed a similar bn classifier called oncos to differentiate among bone lesions on the appendicular skeleton ( kahn et al . a practical value of these models is to provide a probabilistic guide for a clinician to diagnose and treat different cancers . another use of pgms is to sort out the underlying mutations which put individuals at high - risk . conjunctive bayesian networks ( cbns ; beerenwinkel et al . , 2007 ) , which describe an accumulation of events , have been used to model the accumulation of mutations using cgh mutation data from the progentix database ( gerstung et al . , 2009 ) . the inference problem is to identify cgns , which represent the dependencies among accumulating mutations in renal cell carcinoma , breast , and colorectal cancers . the models identified multiple independent mutations , which triggered downstream complex pathways . a strength of pgm frameworks is the flexibility to integrate across diverse data types . recently , a pgm methodology based on factor graphs known as paradigm ( pathway recognition algorithm using data integration on genomic models ) was proposed , which integrates multiple high - throughput data sets together to identify perturbed molecular pathways ( nigro et al . , 2005 ) . this method was applied to breast cancer using gene expression data , and glioblastoma using gene expression and copy number data , to identify pathways and disease subclasses which correlate with survival . paradigm was recently applied to the same task using a more comprehensive set of breast cancer data in the cga , including , mrna , copy number alterations , micro rnas , and methylation data . the method revealed disease subclasses and specific class signatures , which would not have been identified without leveraging the different data sources . specific perturbations in immune response and interleukin signaling ( il-4 , il-6 , il-12 , and il-23 ) were also shown to be drivers of the classification and to have promising prognostic value . for example , patients with gene signature that favors high - t helper 1 cytotoxic t - lymphocyte response and represses th2 driven humoral immunity , are more likely to have a better survival outcome . expression quantitative trait loci ( eqtl ) , protein qtl , and metabolic qtl combine genotyping and high - throughput phenotyping of a population ( jansen et al . , 2009 ) . genotype - phenotype network inference leverages this data and the natural variation that occurs within a population ( rockman , 2008 ) . eqtl data on skin tumor progression in mice revealed markedly different patterns in the genetic architecture of malignant skin tumors ( quigley et al . , this rich data includes genotypes and gene expression from f2 mice on benign and malignant skin tumors , as well as normal skin samples . eqtl data from a mouse model of breast cancer was used to identify sipa1 , a susceptibility and progression locus in both mice and humans ( crawford et al . , 2007 ) . pgm based algorithms utilize directed graphs to approximate the network of causal relationships among phenotypes and genotypes in segregating populations , but applications to cancer data are yet to be explored ( neto et al . there has been recent progress in sparse genome - scale models for undirected graphs , with applications that include protein signaling , breast cancer gene expression , and the genetics of gene expression ( carvalho et al . , 2008 ; friedman et al . , 2008 ; edwards et al . , 2010 ; yoshida and west , 2010 ) . sparse models can be estimated when the number of variables greatly exceeds the sample size . although sparse modeling deals with the issue of many variables , sufficient sample size is still required for meaningful results . cluster analysis is a class of techniques whose motivation lies in the concept of modularity , which has gained popularity more or less simultaneously in molecular biology , systems biology , developmental biology , and evolutionary biology ( wagner et al . , 2007 ) . clustering ( gordon , 1999 ) can be viewed as a graph partitioning since members of the same cluster are considered to be connected in terms of whichever measure of association is adopted , and different clusters are relatively disconnected from each other . the associations between clusters may be specified in a variety of ways and no attempt is made to specify all the links in the graph . viewing high - throughput data through clusters and modules increases our ability to distinguish subtle signals in tumorigenesis ( segal et al . , 2005 ) . this type of analysis is often easier to interpret than traditional lists of differential expression . clustering methods have been extensively applied to identify and classify different cancer subtypes , and associate clusters with survival , e.g. , ( furey et al . , 2000 ; guyon et al . , 2002 ; vant veer et al . , 2002 ; srlie et al . , 2003 ; rich et al . , weighted correlation network analysis ( wgcna ) was recently developed as a method for identifying co - expression modules , relating modules to one another , relating modules to external phenotypes , and identifying hub genes that are highly connected within the module ( langfelder and horvath , 2008 ) . this method was used to identify a co - expression module in glioblastoma , which was also present in breast cancer . aspm , a hub gene in the module , was experimentally validated as a potential uncharacterized glioblastoma target ( horvath et al . , 2006 ) . data integration remains a major fundamental challenge for the field of systems biology , which has limited our ability to take full advantage of omics data for knowledge and discovery ( kitano , 2002 ; sullivan et al . , 2010 ) . differences exist in sample quality , array processing , the organism under investigation , tissue type , and experimental conditions ( e.g. , diet ) . it is important to understand how these different biological domains connect and give rise to a phenotype or disease . methods that integrate between and across diverse data types are only beginning to emerge ( nigro et al . , 2005 ) . data integration is of particular importance because of the complex interplay between genetics , cell signaling , and metabolic pathways . understanding how molecular traits from different biological domains connect in networks is critical to progressing cancer biology . mathematical and statistical models are capable of integrating biological knowledge that is outside of the observational data . in a number of applications , the use of bayesian methods that integrate a priori knowledge into the model have been shown to improve model behaviors and predictive output . we have described applications of bns which incorporate expert advice from radiologists , which can be viewed as a model prior ( kahn et al . , flexible bayesian priors have been used to guide the parameter estimation process . in this context , priors favor parameter estimates which respect known physiology of the system , e.g. , steady - state , dynamic trends , feasible bounds on concentration levels , and fluxes ( calvetti and somersalo , 2006 ; calvetti et al . , 2006 ) . in graphical models , priors have been developed in the form of energy functions to guide network inference ( imoto et al . , 2004 ) . priors have been used to encode known relational information from databases such as kegg into the network inference process ( werhli and husmeier , 2007 ; mukherjee and speed , 2008 ) . priors have also been used to enforce sparsity in the network structure and prevent over - fitting ( hageman et al . , 2011 ) . developing mathematical models which are consistent with and predictive of the true underlying biological mechanisms is a central goal of systems biology . the experimental design and perturbations have been shown to have major influence on parameter estimation , and subsequently the output and accuracy of the computational model ( apgar et al . , 2010 ) . graphical model network inference can be subject to a large proportion of false positive edges ( li et al . , 2010 ) . environmental and experimental design factors that are not accounted for in the model can further misguide models ( remington , 2009 ) . assessing and improving the utility of mathematical models in the context of systems biology will continue to be an active area of research . a continuous cycle between mathematical modeling and the wet - bench is critical to move systems biology forward . as george box famously stated , all models are wrong , but some are useful ( box and draper , 1987 ) . sensitivity analysis should routinely be performed to assess how sensitive the model output ( predictions ) are to model parameters and input ( data ) . however , this is often not routine . sensitivity analysis can also be used to guide model reductions and expansions , e.g. , marginalizing over quantities that play little to no role in the system dynamics . mathematical models can provide , via model driven predictions and hypotheses generation , a cheap and fast catalyst for experimental advances in systems biology . on the other hand , models which are more useful can lead to the design and execution of experiments and studies which are unlikely to be successful . contrary to in silico studies , this can waste a lot of time and money , and ultimately promote skepticism in the modeling approach . we have described two complementary modeling approaches : deterministic modeling of cellular metabolism and graphical modeling , which offer different insights into biological systems . although they have been used to drive progress in cancer systems biology , they remain far from mainstream . at present , there is an overwhelming need to view cancer as a complex network in order to understand drug resistance , and develop viable targets . it is also critical to better interpret and integrate data to get at the mechanisms which drive the disease , classify cancer subtypes , and predict treatment outcomes . in the coming years , we believe that mathematical and statistical models will be pivotal in advancing our understanding , and that they hold tremendous promise for the future of cancer systems biology . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | cancer is a major health problem with high mortality rates . in the post - genome era , investigators have access to massive amounts of rapidly accumulating high - throughput data in publicly available databases , some of which are exclusively devoted to housing cancer data .
however , data interpretation efforts have not kept pace with data collection , and gained knowledge is not necessarily translating into better diagnoses and treatments .
a fundamental problem is to integrate and interpret data to further our understanding in cancer systems biology .
viewing cancer as a network provides insights into the complex mechanisms underlying the disease .
mathematical and statistical models provide an avenue for cancer network modeling . in this article , we review two widely used modeling paradigms : deterministic metabolic models and statistical graphical models .
the strength of these approaches lies in their flexibility and predictive power .
once a model has been validated , it can be used to make predictions and generate hypotheses .
we describe a number of diverse applications to cancer biology , including , the system - wide effects of drug - treatments , disease prognosis , tumor classification , forecasting treatment outcomes , and survival predictions . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
pape and colleagues discuss the effect of different volume replacements in a previous issue of critical care . in light of the numerous risks associated with allogeneic blood transfusions , many e orts have been made towards blood - sparing management of the perioperative phase . by inducing normovolemic , dilutional anemia , the amount of blood transfusions given throughout surgery can be reduced ; however , an adequate oxygen supply / demand relationship and resulting adequate tissue oxygenation are the limiting factors when applying this technique . when the hemoglobin concentration falls below the level where oxygen delivery does not meet the tissue oxygen demand anymore , a critical hemoglobin level ( hbcrit ) has been reached and outcome is poor without intervention , that is , the administration of red blood cells . recommendations and guidelines for treatment of acute , accidental hemorrhage have changed over the last years and continue to evolve . pape and colleagues add evidence for the ongoing quest for optimal fluid replacement strategies during acute hemorrhage and address the unresolved controversy of crystalloid versus colloid fluid replacement strategies with the help of an established porcine hemorrhage model . in this particular porcine model pape and colleagues simultaneously withdrew blood and replaced the volume with ' plasma - expansion - rate - adjusted ' amounts of ringer 's solution , gelatine , 6% hydroxyethyl starch ( he s ) 130/0.4 or 6% he s 450/0.7 and assessed the hbcrit by repetitively measuring oxygen uptake ( vo2 ) in conjunction with a computed regression analysis to detect deterioration indicating critical hemoglobin values . with this technique the authors could show that the choice of fluid replacement impacts the onset and extent of the hbcrit . in conclusion , the authors propose tetrastarch preparations ( for example , he s 130/0.4 ) as the ' most advantageous regarding maintenance of tissue oxygenation during progressive anemia ' . however , this present study undoubtedly has some limitations that suggest a more careful approach regarding the interpretation of its results . foremost , the induced blood loss was replaced with different solutions at different ratios , with the intention to account for the different plasma expansion effects . however , the stroke volume variation , as indicator for volume responsiveness , decreased more in all but the ringer 's solution group , while intrathoracic blood volume ( itbv ) increased in the colloid groups . consequently , normovolemia seems to have been maintained best in the ringer 's solution group , while hypervolemic anemia was induced in the other three groups . the authors addressed this fact by discussing volume responsiveness and the possibility of having infused ringer 's solution at higher rates of 4:1 or 5:1 . yet , as normovolemic anemia was the goal , the colloidal infusions could have been infused at a lower rate . as rheologic effects and augmentation of regional blood flow during fluid replacements play a major role in acute hemodilution , simply using a fixed blood / fluid exchange rate based on the theoretical plasma expansion effect to address individual fluid demand may not have been the optimal approach . using a goal - directed fluid therapy instead could have been more useful and addressed the actual fluid demands of the individual animals during severe bleeding ( for example , a diff erence in pulse pressure ( dpp)-guided fluid regimen ) . furthermore , even though the critical hemoglobin concentration is the absolute limiting factor of hemodilution , adverse effects could have probably been seen at earlier stages . as the cardiac oxygen extraction can not be augmented like in other tissues , oxygen delivery and cardiac index are the actual limiting factors of hemodilution . in mild hemodilution , coronary oxygen delivery redistribution of blood flow from other organs to the heart accounts for the preservation of cardiac oxygenation during more pronounced hemodilution . during severe hemodilution , exhaustion of subendocardial flow reserves will cause local ischemia and is the main complication of further blood loss . as shown in the study by pape and colleagues , cardiac index did significantly increase in all groups until the hbcrit was reached in the ringer 's solution . however , when looking at the oxygen delivery , an even decrease can be found in all groups , indicating no beneficial effects of any of the solutions at the hbcrit of the ringer 's solution . finally , the oxygen extraction ratio significantly increased from baseline in all but the ringer 's solution group at their respective hbcrit . therefore , as coronar blood flow and cardiac oxygenation were not assessed , the actual limits of hemodilution with the solutions used are still not entirely clear . as the authors stated in their discussion , the animals were terminated after reaching hbcrit and only short - term effects were assessed . thus , the displayed results do not account for local tissue hypoxia and other effects that would have resulted from redistribution of the infused fluids into the extravascular space as these effects would have needed additional time to be detectable . some statistical issues might also be mentioned . even though the authors assessed for normal distribution and thereafter used multiple testing , they did not correct their p - values or their results for this fact . inference from the results could have been drawn more cautiously , considering the extensive multiple testing of all parameters . subsequent trials will be needed to pathophysiologically explain and validate the results of the present study . effects on a microcirculatory level of the different fluids at a hbcrit need to be assessed in more detail and , as mentioned , implementation of a goal - directed regimen might be suggested . in summary , the authors are to be congratulated for adding evidence to the long - running debate on what type of fluid is best to use in hemorrhage . neither of the contributing authors is biased by competing interests , including financial interests related to patents and/or share holdings in corporations involved in the development and/or marketing of the medication evaluated . | the optimal kind of fluid for fluid resuscitation during acute , severe hemorrhage is still discussed controversially . of particular interest in this context is the choice of colloids versus crystalloids and their effect on the critical hemoglobin level . in a previous issue of critical care ,
pape and colleagues describe the effect of four different volume replacement options on the critical hemoglobin concentration , and show marked differences for the different treatments .
even though some important pathophysiological issues remain unsolved , the current manuscript adds interesting evidence to an ongoing quest . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
for analyses of allele frequency differentiation across populations and allele frequency distributions , we used subsets of snps from hapmap ( public release # 21a ) which were ascertained uniformly across the genome so that the data sets are appropriate for population genetic analysis8 . all the snps in our study are therefore uniformly ascertained as divergent sites in exactly two chromosomes of the same ancestry ( two each of either west african , north european or east asian ancestry ) and genotyped in all hapmap samples , including 120 unrelated west african chromosomes from ibadan , nigeria ( yri ) , 120 unrelated european american chromosomes from utah , usa ( of north european ancestry ; ceu ) , and 180 unrelated east asian chromosomes ( 90 han chinese from beijing , china ( chb ) and 90 japanese from tokyo , japan ( jpt ) , which we pooled for most analyses ) . since males carry a single copy of chromosome x , the counts for chromosome x are at most 90 , 90 , and 135 ( our modeling adjusts appropriately for the sample size of every snp used in our analysis8 ) . we removed all sites that were in hypermutable cpg dinucleotides , and determined the ancestral allele by requiring a match to both the chimpanzee and orangutan sequence8 . first , we no longer required snp discovery in two chromosomes from the same individualfsf ; instead , we allow snps to be discovered by comparing two chromosomes , one from each of two individuals of the same ancestry , which we found generates an indistinguishable frequency distribution . second , for the autosomal snps discovered in west africans , we used data from an african american sample ( na17109 ) who we determined had 4% european ancestry on average based on the ancestrymap software28 . we restricted the snps used for analysis to sections of this individual 's genome where we were > 95% confident of african ancestry in both chromosomes based on an analysis with ancestrymap . in supp . note , we present analyses showing that this procedure generates results that are indistinguishable from what is obtained by using two chromosomes from a west african . as the african american sample ( na17109 ) used for mining snps in hapmap was male , we could not use this individual to identify sites that were different between two west african copies of chromosome x. to fill this gap , we used four west african ( yri ) samples ( na18517 , na18507 , na19240 and na19129 ) for which shotgun sequencing data was available in public databases to discover snps . we randomly dropped sequencing reads until we had no more than two unrelated chromosomes at each site , and then used ssahasnp29 to identify 4,884 snps on chromosome x for which we could confidently identify the ancestral allele based on comparison to both chimpanzee and orangutan , for which we were able to successfully design primers , and which passed all the other filters we applied to the snps mined from hapmap . we attempted to genotype a randomly chosen subset of 1,366 of these snps in all hapmap samples using the sequenom iplex method30 . this resulted in 1,087 snps after removing snps with < 85% genotyping completeness , with 4 or more heterozygous genotypes in males , out of hardy - weinberg equilibrium ( p<0.01 in a statistic combined across populations ) , or monomorphic . from the 210 unrelated samples in hapmap , we filtered to 189 after dropping samples that had < 85% genotyping completeness , an excess of heterozygous genotypes in males or a deficiency of heterozygous genotypes in females compared with others from the same population , or that were one of 6 yri samples related to those used in snp discovery . this left us with 77 yri , 82 ceu and 122 chb+jpt x chromosomes for analysis . we obtained dna sequence reads from public databases for 5 individuals of north european ancestry ( european americans ) , 4 of east asian ancestry ( from china , japan and the united states ) , and 5 of west african ancestry ( 4 nigerians and 1 african american , whose genome was only analyzed in sections where we were > 95% confident of two african - origin chromosomes based on the ancestrymap software28 ) ( supp . sequence reads , we aligned them to build 35 of the human reference sequence by ssahasnp29 with the settings qsnp>=40 , qneighbor>=15 , nneighbor=5 , maxneighborhooddiffs=1 , maxsnps / kb=15 . a subset of non - overlapping sequence reads for each individual was selected at random , providing a single mosaic , haploid genome that was not biased according to the strand of dna from which a read derived . within - population sequence diversity was estimated by only analyzing bases where there were two or more individual haploid genomes , and then counting differences by selecting two haploid genomes at random . to similarly compute between - population diversity ( supp . table 2 ) , the individual haploid genomes of each population were combined so that at any base only one individual was represented . to estimate standard errors correcting for correlation between neighboring sites , we used a jackknife analysis , dividing the genome into blocks of 100,000 aligned bases , and removing each block in turn.8 to estimate allele frequency differentiation across populations , we used the fst statistic as formulated in ref . 8 . briefly , when ( i ) a snp is discovered as polymorphic in population a , and ( ii ) population a has been of effectively constant size since the split from population b , the expected value of fst is
e(fstauto)=(1e(a+b))/2 , where a and b are scaled drift times . multiplying i by 4/3 , the equivalent expression for chromosome x is
e(fstx)=(1e4/3(a+b))/2 , thus
q = ln(12e(fstauto))/ln(12e(fstx))=3/4 . to test this expectation , we simulated models of history for each pair of populations and found all values to be close to ( supp . for analyses of allele frequency differentiation across populations and allele frequency distributions , we used subsets of snps from hapmap ( public release # 21a ) which were ascertained uniformly across the genome so that the data sets are appropriate for population genetic analysis8 . all the snps in our study are therefore uniformly ascertained as divergent sites in exactly two chromosomes of the same ancestry ( two each of either west african , north european or east asian ancestry ) and genotyped in all hapmap samples , including 120 unrelated west african chromosomes from ibadan , nigeria ( yri ) , 120 unrelated european american chromosomes from utah , usa ( of north european ancestry ; ceu ) , and 180 unrelated east asian chromosomes ( 90 han chinese from beijing , china ( chb ) and 90 japanese from tokyo , japan ( jpt ) , which we pooled for most analyses ) . since males carry a single copy of chromosome x , the counts for chromosome x are at most 90 , 90 , and 135 ( our modeling adjusts appropriately for the sample size of every snp used in our analysis8 ) . we removed all sites that were in hypermutable cpg dinucleotides , and determined the ancestral allele by requiring a match to both the chimpanzee and orangutan sequence8 . first , we no longer required snp discovery in two chromosomes from the same individualfsf ; instead , we allow snps to be discovered by comparing two chromosomes , one from each of two individuals of the same ancestry , which we found generates an indistinguishable frequency distribution . second , for the autosomal snps discovered in west africans , we used data from an african american sample ( na17109 ) who we determined had 4% european ancestry on average based on the ancestrymap software28 . we restricted the snps used for analysis to sections of this individual 's genome where we were > 95% confident of african ancestry in both chromosomes based on an analysis with ancestrymap . in supp . note , we present analyses showing that this procedure generates results that are indistinguishable from what is obtained by using two chromosomes from a west african . as the african american sample ( na17109 ) used for mining snps in hapmap was male , we could not use this individual to identify sites that were different between two west african copies of chromosome x. to fill this gap , we used four west african ( yri ) samples ( na18517 , na18507 , na19240 and na19129 ) for which shotgun sequencing data was available in public databases to discover snps . we randomly dropped sequencing reads until we had no more than two unrelated chromosomes at each site , and then used ssahasnp29 to identify 4,884 snps on chromosome x for which we could confidently identify the ancestral allele based on comparison to both chimpanzee and orangutan , for which we were able to successfully design primers , and which passed all the other filters we applied to the snps mined from hapmap . we attempted to genotype a randomly chosen subset of 1,366 of these snps in all hapmap samples using the sequenom iplex method30 . this resulted in 1,087 snps after removing snps with < 85% genotyping completeness , with 4 or more heterozygous genotypes in males , out of hardy - weinberg equilibrium ( p<0.01 in a statistic combined across populations ) , or monomorphic . from the 210 unrelated samples in hapmap , we filtered to 189 after dropping samples that had < 85% genotyping completeness , an excess of heterozygous genotypes in males or a deficiency of heterozygous genotypes in females compared with others from the same population , or that were one of 6 yri samples related to those used in snp discovery . this left us with 77 yri , 82 ceu and 122 chb+jpt x chromosomes for analysis . we obtained dna sequence reads from public databases for 5 individuals of north european ancestry ( european americans ) , 4 of east asian ancestry ( from china , japan and the united states ) , and 5 of west african ancestry ( 4 nigerians and 1 african american , whose genome was only analyzed in sections where we were > 95% confident of two african - origin chromosomes based on the ancestrymap software28 ) ( supp . sequence reads , we aligned them to build 35 of the human reference sequence by ssahasnp29 with the settings qsnp>=40 , qneighbor>=15 , nneighbor=5 , maxneighborhooddiffs=1 , maxsnps / kb=15 . a subset of non - overlapping sequence reads for each individual was selected at random , providing a single mosaic , haploid genome that was not biased according to the strand of dna from which a read derived . within - population sequence diversity was estimated by only analyzing bases where there were two or more individual haploid genomes , and then counting differences by selecting two haploid genomes at random . to similarly compute between - population diversity ( supp . table 2 ) , the individual haploid genomes of each population were combined so that at any base only one individual was represented . to estimate standard errors correcting for correlation between neighboring sites , we used a jackknife analysis , dividing the genome into blocks of 100,000 aligned bases , and removing each block in turn.8 to estimate allele frequency differentiation across populations , we used the fst statistic as formulated in ref . briefly , when ( i ) a snp is discovered as polymorphic in population a , and ( ii ) population a has been of effectively constant size since the split from population b , the expected value of fst is
e(fstauto)=(1e(a+b))/2 , where a and b are scaled drift times . multiplying i by 4/3 , the equivalent expression for chromosome x is
e(fstx)=(1e4/3(a+b))/2 , thus
q = ln(12e(fstauto))/ln(12e(fstx))=3/4 . to test this expectation , we simulated models of history for each pair of populations and found all values to be close to ( supp . | comparisons of chromosome x and the autosomes can illuminate differences in the histories of males and females as well as the forces of natural selection .
we compared the patterns of variation in these parts of the genome using two data sets that we assembled for this study that are both genomic in scale .
three independent analyses show that around the time of the dispersal of modern humans out of africa , chromosome x experienced much more genetic drift than is expected from the pattern on the autosomes .
this is not predicted by known episodes of demographic history , and we found no similar patterns associated with the dispersals into east asia and europe . we conclude that a gender - biased process that reduced the female effective population size , or an episode of natural selection unusually affecting chromosome x , was associated with the founding of non - african populations . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the shoulder is one of the joints that we use everyday in our physical activities , and
people can develop various complex problems in the shoulder joint . the shoulder joint has
the biggest range of motion because of its delicate and smooth movement1 , 2 . the glenohumeral has a large range of movement ,
but its excessive mobility causes chronic stress in the tissues around the joint . the
rotator cuff muscle , the long head of the biceps , the negative intra - articular pressure , and
ligament around the shoulder joint support its stability3 . recent research has focused not only on shoulder pain , but also on
the stability of the shoulder , and associated functional and social conditions5 . ultrasonography , computed tomography ( ct ) , magnetic resonance imaging ( mri ) , x - ray , etc . are
examinations that are widely used6 , 7 . however , the cost of these physical
examinations is high , and they do not examine the functional stability of the glenohumeral
joint . the ckcues test scores closed kinetic chain exercise of the upper limbs in an examination
of the stability of shoulder . it does nt require high level technique or clinical
preparation , and it is cheap to conduct . in this test , the subject counts the number of
times he touches his other hand for 15 seconds while doing a push up . this test is
clinically simple to conduct and it is also easy for the subject to understand his physical
condition8 , 9 . therefore , in this research , the reliability of the ckcues test was examined
with healthy adults as subjects , and its validity was examined by comparison with peak
torque of internal / external shoulder rotation and maximum grip strength . the subjects of this study were 40 healthy korean adults , 20 males and 20 females , who
volunteered to participate in the experiment after being given an explanation of its purpose
and method . the subjects had an average age 28.96 3.15 , of an average height of 169.47
8.33 cm , and an average weight of 67 14.24 kg . they also had no pain , instability or limited range of motion in shoulder function . this study obtained the approval of the bioethics committee of catholic university of pusan
( cupirb-2014 - 016 ) . the test was conducted
twice over three days in order to verify the test - retest reliability . in the first round , the testers explained the ckcues test method to the subjects by demonstrating it to them . two strips of athletic
tape with a width of 1.5 inches were placed parallel to each other 36 inches apart , as
measured by a standard tape measure on a tiled floor . the starting position of the test is
one hand on each piece of tape in the pushup position . the subjects were instructed from the
starting position they were to use one hand to reach across their body and touch the piece
of tape lying under the opposing hand . after touching the tape line , touches were counted as every time the hand reached across the subject s body
and touched the tape . each subject performed a
warm up trial followed by three trials of the test with a rest period of 45 seconds between
trials . the average of the three trials was used in the data analysis10 . during the test , subjects had to keep a straight flat back , keep their hands and shoulders
in a perpendicular position so that body weight was sufficiently distributed over the upper
limbs , and the knees must never touch the ground . if a subject complain about pain , he or
she was excluded from the study . a jamar hydraulic hand dynamometer ( pc 5030ji , preston inc , usa ) was used for measurement
of the maximum grip strength of the subjects . according to the recommendation of the
american limb therapist association , the subjects were seated comfortably with the shoulder
abducted and neutrally rotated , the elbow joint at 90 degree flexion , and the wrist in the
neutral position . three measurements were taken and the data were averaged . after each
measurement , 30 seconds of rest was given in order to offset fatigue . in order to measure isokinetic muscle strength , biodex system 3 pro ( bbs , biodex medical
system , inc . , usa ) , an isokinetic measurement equipment , was used to measure the maximum
value of shoulder joint internal / external rotation . the subjects are seated in the biodex
measurement chair with elbow joint flexed out at 90 degrees and the shoulder abducted at 45
degrees . the abdomen and chest areas were fixed with a belt to prevent movement during the
shoulder muscle test . a safety key was used to set up a range of motion around the rotating
axis of the motor system in order to prevent hyperflexion and hyperextension . also , the
length of the forearm and the adjustment axis were adjusted to facilitate exertion of full
muscle strength . the isokinetic angular velocities of the shoulder were set at 60/sec ( 5
times ) , 180/sec ( 15 times ) for concentric exercise . the ckcues
test was conducted four times and the data of the last three measurements were used to
calculate the intraclass correlation coefficient ( icc ) for the reliability of test - retest
and the 95% confidence interval . in order to test validity of the ckcues test pearson
correlation coefficients were calculated for the average values of the ckcues test and the
peak torque of internal / external shoulder rotation , and the maximum grip strength
values . the intraclass correlation coefficient of the test - retest reliability was 0.97 ( table 1table 1.test and retest mean ( and standard deviation ) of ckcues test scores and reference
valuesckcuesmeansdfor testmeansdfor retesticcci13.314.7813.104.720.970.930.99ckcues : closed kinetic chain upper extremity stability ; sd : standard deviation ; icc :
intraclass correlation coefficient ; ci : confidence interval ) . ckcues : closed kinetic chain upper extremity stability ; sd : standard deviation ; icc :
intraclass correlation coefficient ; ci : confidence interval pearson s correlation coefficient showed there was a high positive correlation between the
ckcues test values and maximum grip strength and between the ckcues test values and peak
torque of internal / external rotation ( table
2table 2.correlation between ckcues test , ir / er peak torque and the hand grip testmeanrhand griprt82.9223.130.79lt77.9423.400.7860/secrsir29.7613.320.90rser21.308.180.90lsir29.6112.300.93lser20.708.240.91180/secrsir27.8110.570.94rser20.685.320.82lsir28.349.970.90lser20.304.720.87ckcues : closed kinetic chain upper extremity stability ; rt : right ; lt : left ; rsir :
right shoulder internal rotation ; rser : right shoulder external rotation ; lsir : left
shoulder internal rotation ; lser : left shoulder external rotation ; sd : standard
deviation ; significant correlation , p<0.01 ) . ckcues : closed kinetic chain upper extremity stability ; rt : right ; lt : left ; rsir :
right shoulder internal rotation ; rser : right shoulder external rotation ; lsir : left
shoulder internal rotation ; lser : left shoulder external rotation ; sd : standard
deviation ; significant correlation , p<0.01 research has indicated that
the development of closed kinetic chain exercise for the low limb would be beneficial for
the upper limb9 . closed kinetic chain
exercises have positive effects on muscle activity , stability of the joint , proprioceptive
sense , etc12 . hirashima et al . suggested
that closed kinetic chain exercise with weight bearing is a good test method for isometric
weight bearing and movement13 . goldbeck and davies conducted a test - retest reliability test of the ckcues test using only
male athletes and reported that the icc showed very high reliability ( 0.92)14 . in the present study , the test - retest
result showed high reliability ( 0.97 ) . conducted the ckcues test with baseball
players without injury , and examined the differences was among the plating positions . they
found no significant differences , and concluded the ckcues test could be used for
determining the return of a player to competition and changes in shoulder condition after
shoulder damage15 . after examining
patients who had shoulder damage and healthy persons with the ckcues test , helga concluded
that it has sufficient reliability for checking the shoulder function of athletes and
ordinary patients with subacromial impingement syndrome . even though the reliability of the
ckcues test has been established , its validity has not previously been demonstrated10 . hand grip is closely related to upper extremity function and is an action that facilitates
rotator cuff movements . thus , the validity
of the ckcues test was tested against hand grip in this study and the result showed high
positive correlations for both the right hand ( 0.79 ) and the left hand ( 0.78 ) . thus , a high
ckcues test score indicates the hand grip value will also be high . the isokinetic test for internal / external shoulder rotation is a very objective and
accurate way of measuring shoulder muscle strength . accordingly , this study compared shoulder internal / external peak
torque data at angular speeds of 60/sec and 180/sec with ckcues data , and found high
correlations for all the results . the results showed the ckcues test had high reliability ,
and had high correlations with the results of the hand grip test and isokinetic test , so it
is considered a very useful examination method for clinical use . | [ purpose ] the purpose of this study was to examine the reliability and validity of the
closed kinetic chain upper extremity stability ( ckcues ) test .
[ subjects and methods ] a
sample of 40 subjects ( 20 males , 20 females ) with and without pain in the upper limbs was
recruited .
the subjects were tested twice , three days apart to assess the reliability of
the ckcues test . the ckcues test was performed four times , and the average was calculated
using the data of the last 3 tests . in order to test the validity of the ckcues test
, peak
torque of internal / external shoulder rotation was measured using an isokinetic
dynamometer , and maximum grip strength was measured using a hand dynamometer , and their
pearson correlation coefficients with the average values of the ckcues test were
calculated .
[ results ] the reliability of the ckcues test was very high ( icc=0.97 ) .
the
correlations between the ckcues test and maximum grip strength ( r=0.780.79 ) , and the peak
torque of internal / external shoulder rotation ( r=0.870.94 ) were high indicating its
validity .
[ conclusion ] the reliability and validity of the ckcues test were high .
the
ckcues test is expected to be used for clinical tests on upper limb stability at low
price . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
due to an ageing population and a shortage of hospital beds , it has become a challenge to find new ways to support and care for people with chronic illness living at home . living with chronic illness changes the lives of those affected , who are often in need of support and nursing care in their homes [ 13 ] . ehealth has the potential to become a means of providing good care at home , which is especially challenging with regard to this emerging field . ehealth refers to information and communication technology ( ict ) tools and services for health , whether the tools are used behind the scenes by healthcare professionals or directly by patients and their relatives . ict tools can be used to access a wide variety of technological solutions for communication , including text messaging , gathering and monitoring data , diagnosis and treatment at distances , and retrieving electronic health records [ 5 , 7 ] . according to the world health organization ( who ) , ehealth is used in the healthcare for transmission of digital data , including data stored and retrieved electronically to support healthcare , both at the local site and at a distance . e - health includes the interaction between patients and health service providers or peer - to - peer communication between patients and/or health professionals . interest has primarily focused on the use of ict tools in the care of older and severely chronically ill people . although ict has been increasingly used in healthcare in recent years , efforts across countries have been fragmented and could benefit from improved cross - border coordination . ehealth tools and services have been widely introduced and implemented , and the potential benefits ict can bring people with chronic illness will increase significantly . the aim was to review existing studies describing the use of ict in home care for communication between patients , family members , and healthcare professionals . the particular objectives of the review were the following : to provide an overview of characteristics of studies describing the use of ict in home care , to describe how ict was used for communication in home care , to describe the benefits and drawbacks of the use of ict in home care . to provide an overview of characteristics of studies describing the use of ict in home care , to describe how ict was used for communication in home care , to describe the benefits and drawbacks of the use of ict in home care . , with the following steps taken : for formulating a research question , conducting a literature search , applying inclusion and exclusion criteria , abstracting data , and undertaking an analysis . the inclusion criteria for this literature review were set as follows : ( 1 ) ict interventions ; ( 2 ) communication between any healthcare professionals , patients , and/or family members ; ( 3 ) studies published in scientific journals ; ( 4 ) studies published between 2000 and 2010 ; and ( 5 ) in the english language . criteria for exclusion were ict interventions that included technological systems not involving people ( no active patient acceptance ) such as monitoring by camera , alarm systems , and use of ordinary telephones , noting that telephones can be used complementarily to other techniques . search the following electronic bibliographic databases were used : pubmed , scopus , and cinahl . search limits were set to english language studies published in scientific journals from 2000 to june 2010 . the search terms and search strategy were customized for each database to search completely and exactly . the search strategy included thesaurus terms ( mesh terms and subject headings ) combined with free - text words . examples of main search terms used were telemedicine , information and communication , ict , technology , e - health , home care , home , and nursing . to maximize the search results , multiple sets of search terms were used . all studies retrieved from the search in databases were imported into a reference manager ( endnote ) . the literature searches resulted in 1,276 studies ; after duplicates were discarded by endnote , 923 studies remained . a search alert was created to get the latest published studies , which resulted in 11 additional studies . a first selection was based on titles and abstracts of the 934 studies to identify whether or not they were within the scope of the research question . next , a selection based on inclusion criteria was conducted , with focus on studies of ict applications used in home care . the full - text version of the studies was then read and initially categorized based on type of communication applied in the studies . two authors read all the studies independently . to increase reliability they discussed ambiguities of inclusion criteria until consensus was reached . however , nine relevant studies were unavailable both electronically and in paper form , which thereby were excluded from this study , leaving 130 studies . all eligible studies ( n = 130 ) were evaluated for scientific quality on a three - grade scale : high scientific quality , good scientific quality , and fair scientific quality . the grading system is used by the swedish council on technology assessment in health care ( sbu ) for systematic reviews [ 1214 ] . the quality appraisal was performed in accordance with a previously presented method for quality appraisal [ 1518 ] , which was chosen to be appropriate . in appraising the scientific quality of each study , different protocols were used for studies with a quantitative approach and for studies with a qualitative approach . in the protocol for quantitative studies the items focused mainly on exclusion , sample procedures , intervention , dropouts , randomization , similarity of groups , blinding , outcomes , statistical procedures , ethical considerations , validity and reliability of instruments used , and possibility of generalization of results . in the protocol for qualitative studies the items focused mainly on context , ethical reasoning , procedure of sample , data collection , analysis procedures , saturation , clarity and logic of results , theoretical framework , theory generation , and description of main results . the protocols contained questions to be answered with yes / no / unclear and additional space to comment on the relevance of each item and for the extracted data . the number of questions answered yes was divided by the total number of questions and thereafter converted to percentage . state that the use of percentage makes it possible to weight and compare different study 's methodologies . as recommended the percentage was transformed to high scientific quality ( 80100% ) , good scientific quality ( 7079% ) , and fair scientific quality ( 6069% ) . the studies that scored less than fair were excluded ( n = 23 ) , as they were considered not to be of sufficient scientific quality to be included . the quality appraisal was performed by two of the authors , initially together to obtain an equal assessment , but thereafter independently . when uncertainties arose , the authors discussed the result of the quality appraisal until consensus emerged . after the quality appraisal was undertaken , 107 studies remained . the remaining 107 studies were classified as relevant to the research question and met the inclusion and quality criteria for being included in the data abstraction . each of the included studies was given an indexation and then categorized according to a number of different areas based on the following characteristics : country of origin , year of publication , study approach , journal , communication strategies , type of technology , type of communication , disease diagnosis , and quality appraisal . thereafter , data from each of the included studies were extracted and entered into a matrix . the general results give an overview of characteristics of studies describing the use of ict applications in home care . the results are summarized in areas including study approach , quality appraisal , publications data , terminology used for defining the technology , and disease diagnosis . most of the included studies had a quantitative approach . only about one - fifth had a qualitative approach further , some of the studies used mixed methods , with both qualitative and quantitative approaches ( table 1 ) . twenty - one studies were part of larger projects . in the critical quality appraisal of all 107 studies , just under half were rated as high scientific quality ( n = 48 ) . that number was compared to studies rated as good scientific quality ( n = 23 ) and fair to good scientific quality ( n = 36 ) ( table 1 ) . when comparing the quality appraisal between qualitative and quantitative approaches , differences could be noted . a greater proportion of the qualitative studies were rated as high scientific quality . in comparison , the opposite was the case with qualitative and quantitative studies rated as fair scientific quality . all of the 107 included studies were published between january 2000 and june 2010 , so only part of year 2010 was included . during this period the number of publications increased by time , with about half of the included studies ( n = 53 ) published between 2007 and 2009 . note that 2009 alone represents 23 studies of the total publications ( figure 2 ) . the two most common journals were journal of telemedicine and telecare ( n = 15 ) and telemedicine journal and e - health ( n = 12 ) , together representing almost one - quarter of the total number of studies . the rest of the studies ( n = 80 ) were spread over a variety of other journals ( n = 67 ) . the majority of the studies were performed in north america ( n = 67 ) . about one - third of the studies were done in europe ( n = 34 ) , with united kingdom , sweden , and italy being the most prominent . only a few studies ( n = 6 ) were conducted outside north america and europe ; those were done in asia ( n = 5 ) and australia ( n = 1 ) . three studies were carried out in cooperation between different countries , but only one study was a combined study involving the continents of north america and europe ( table 2 ) . the results show that 13 different terms were used to define the technology utilized to increase accessibility to home care services and home nursing . telehealth and telemedicine together ( n = 59 ) account for more than half of the terms used in the included studies . other terms used three times or more were e - health , ict / it , telehealthcare , telemonitoring , and telenursing . further , in some studies other terms were used as follows : e - rehabilitation , teleassistance , and telerehabilitation ( table 3 ) . the ict applications were used in healthcare for a wide range of different conditions through the life span . in the majority of the studies ( n = 86 ) , the technology was developed specifically for supporting people with chronicle illness living at home . the most frequent diseases studied were heart and lung diseases , chronic wounds , diabetes , cancer , and stroke . other conditions were , for example , infectious diseases , spinal cord injuries , and end - of - life care . a number of studies included did not specify the diagnoses ( figure 3 ) . the specific results describe how ict was used for communication in home care and benefits and drawbacks within the use of ict in home care . the results are summarized in the following main areas : type of technology , communications between participants , and benefits and drawbacks of the use of ict . three fields of applications were found to be prominent in the use of ict in homecare : video technology , text messages and health monitoring . an important result was that a mix of more than one ict applications was used in several studies ( n = 31 ) . a small number of studies included all types of ict applications above . in some of the studies , a mix of text and pictures and/or audio was used . in a few studies digital images the most frequently used type of technology was video technology ( n = 53 ) ; the number includes studies using more than one ict application . in several of those studies ( n = 31 ) , the main focus of the intervention was the use of videophones or videoconferencing . another use of video technology was to complement patient health monitoring ( n = 22 ) . it is notable that web - based video conferencing was used only in a small number of studies ( n = 3 ) . in all studies involving parents of children with chronicle illness examples of use were guiding patients in their use of medical equipment and to improve self - management , via video - based home telecare services . another use was teleadvice given by clinical nurse specialists in different areas to community nurses . videoconferencing was used between patients / family members and healthcare personnel for education and psychosocial or emotional support . consultation via videoconferencing in the patient 's home was used instead of visits to the hospital , which enabled access to experts to a greater extent . virtual nurse visits after , for example , discharge from the hospital , were offered to both patients and family members . as shown in many studies ( n = 30 ) , a common way of communicating was via text messages . for sending text messages , websites or web - based programs handheld platforms , such as mobile phones , laptop computers , or text telephones , were used by patients to both send and receive information as well as to communicate ( n = 12 ) . in other studies ( n = 8) , mobile phones or hand held equipment was used to send text messages . for example , text messages were used for sending messages to patients with self - care advice as a response to symptoms and test results they had reported . another way to use text messages was by electronic diary for home monitoring to improve communication between patients and healthcare professionals . an electronic messaging programme via computers and mobile phones or e - mail and video mail messages was used , enabling nurses and patients to exchange messages to and from anywhere . via a symptom management system , patients can receive messages in their daily management of symptoms .
health monitoring . about half of the total studies ( n = 52 ) included health monitoring , focusing on patients who sent health data to be analyzed by healthcare professionals . in most of the studies that looked at monitoring patient health , text messaging or video technology other forms of communication were also used , including the telephone ( n = 17 ) . health buddy , was the most commonly used device for monitoring patient health ( n = 8) . health buddy , a system that connects patients in their homes with care providers , is a telehealth device that collects and transmits disease management information about a patient 's condition including vital signs , symptoms , and behaviors . types of patient health data collected from health monitoring systems in real time were , for example , weight , blood pressure , heart rate , and pulse . different types of communication via ict were described as being used between participants , who were typically nurses , healthcare professionals , patients , or family members . the most frequent line of communication in the studies was between patients and nurses or other healthcare professionals . the patient was not the focus for communication . instead , it was common for the technology to be used for communication with family members . in five of the studies with a focus on family members , the ict was developed for healthcare personnel giving support to parents . in some studies , the communication was merely between healthcare professionals and neither patients nor family members were part of the communication . the review shows that people living with illnesses at home and healthcare professionals gave positive responses from using different ict applications for healthcare in communication with each other ( table 5 ) . results of the included studies were predominated by positive responses from the use of different ict applications in home care from both people living with chronic illnesses and healthcare professionals . most studies show that communication between healthcare professionals and patients living at home was improved by using various ict applications , as improvement in management of symptoms in daily life . it was revealed that various ict applications can be advantageous to use in follow - up care of patients at home . another benefit of using ict applications in home care was found to be an improved accessibility . results from studies show that using ict in communication in home care can be cost saving but also the opposite . however , the use of ict can not replace a face - to - face encounter but can be used as a complement . the aim of this study was to review existing studies describing the use of ict in home care for communication between patients , family members , and healthcare professionals . this review provides an overview of characteristics of studies describing the use of ict applications in home care . the results show that ict in home care is an expanding field of interest , with a variety of ict tools beginning to be evaluated significantly . this may reflect the increased use of the internet and ict tools for care management with involvement of patients and family members ' participation in care processes . previous research stated that focus has emerged from being technology focused to taking the users ' , that is , the patient , family members , and healthcare professionals , perspective into account . the review shows a trend that most studies were accomplished in north america and europe , where the united kingdom , sweden , and italy were most prominent . this is noticeable since italy is one of the european countries in which less than 30 percent of the population uses the internet on a daily basis . the maturity of the internet use in daily life is an indicator of how far the digitalization of the healthcare sector should have come . for instance , despite sweden being a small country , seven of the studies included in this review were performed there , which might be explained by the fact that 75 percent of the population uses the internet on a daily basis . this review shows that a wide variety of terms were used in the reviewed studies to define ict . this is in line with koch 's review of the current state and future trends in home telehealth . the term telehealth has been broadly defined as the use of telecommunication and information technologies for provision of healthcare to individuals at a geographical distance . telehealth involves a wide variety of specific modalities including telephone - based interactions , internet - based information , still and live imaging , personal digital assistants , and interactive audio - video communication or television . furthermore , ehealth is described as the overall umbrella field that includes both ict and telehealth , combining use of electronic communication and information technology in healthcare . this may explain the results of this review with many different terms used to define the technology . this review describes how ict was used for communication in home care , and an interesting result found was that the most frequent type of communication was between patients and healthcare professionals . this indicates that user focus needs to be shifting from tools for professionals to tools for patients and family members . this is in accordance with koch , describing trends toward tools and services not only for professionals , but also for patients and citizens . however from a nursing perspective , there is a lack of knowledge about how to use ict solutions to meet the needs of people with chronic illness . in specific , by performing qualitative studies people 's needs related to living with chronic illness can be elucidated . a challenge in home care will therefore be to use existing ict tools to meet caring needs of people with chronic illness based on their experiences . from a caring perspective , it is important to understand icts impact on quality of life , quality of care , and medical impact of measureable parameters . this review describes benefits and drawbacks when ict was used for communication in home care . . stated that ict applications used in home care must take into consideration the role technology should play in the use of patient and healthcare professionals . neglecting this aspect may lead to technology that not provide the needed support for communication . according to koch et al . , research and practice of health - enabling and ambient - assistive technologies may significantly contribute to that technical solutions are explored in a social context and in relation to individual needs . telehealth systems in the form of online and mobile tools are already opening up the possibilities for reduced hospitalization and an increased home care . various ict applications will thereby offer healthcare professionals to become more flexible and able to address the differing needs of individual patients , that is , a more person - centred care . the results of this review show that people living with chronic illnesses and healthcare professionals were positive to the use of ict applications , despite that ict can not replace a face - to - face encounter but can be used as a complement . across the literature , outcomes for telehealth - based services are generally comparable to outcomes for services delivered face to face . according to charlton et al . , the style and type of communication the healthcare professional uses influence care outcomes . a literature review shows that patients with possibilities of being cared for and using telecare at home preferred a combination of telecare and traditional healthcare delivery . therefore , ict applications must be used as an adjunct and not as replacements for standard care ; otherwise , the positive results might not be replicated . many patients prefer being involved and participating in decision making regarding the care they will receive . despite this , caring programs will be developed without caregiver 's participation . the strength of this review is the broad literature search that finally resulted in 107 studies . the literature search was systematically conducted using selected databases based on relevant search terms . even though the database search was done with assistance from a librarian expert in that field , it is possible that some study might have been missed . to get the latest published studies , a search alert was created . a limitation of this review may be that relevant studies might have been missed because of the selection of the english language . during the selection process , a quality appraisal was conducted ; thereby , the scientific quality of the included studies could be ensured . therefore , it is not possible to integrate the results and give a more specific summary in this review . however , this was not the intention as the aim was broad ; we wanted to find numerous studies for being able to present the state of the art in this field of research . the use of ict applications in home care is an expanding research area , with a variety of ict applications used to increase access to home care . the result shows that ict in home care is mostly used as a tool for communication between healthcare professionals and patients or family members . healthcare professionals can , based on this result , advantageously use ict applications in home care as a tool to support people living with chronic illnesses gaining control of their illness that promotes self - care . however , a great number of the included studies were performed as pilot studies . for being able to evaluate the effects of ict applications in home care , more extensive longitudinal studies are needed . to understand more about how ict can be adjusted to home care , multidisciplinary and qualitative studies are needed from the perspective of the patient and their close relatives . | introduction . information and communication technology ( ict ) are becoming a natural part in healthcare both for delivering and giving accessibility to healthcare for people with chronic illness living at home .
aim .
the aim was to review existing studies describing the use of ict in home care for communication between patients , family members , and healthcare professionals .
methods .
a review of studies was conducted that identified 1,276 studies .
a selection process and quality appraisal were conducted , which finally resulted in 107 studies .
results .
the general results offer an overview of characteristics of studies describing the use of ict applications in home care and are summarized in areas including study approach , quality appraisal , publications data , terminology used for defining the technology , and disease diagnosis .
the specific results describe how communication with ict was performed in home care and the benefits and drawbacks with the use of ict .
results were predominated by positive responses in the use of ict . conclusion .
the use of ict applications in home care is an expanding research area , with a variety of ict tools used that could increase accessibility to home care .
using ict can lead to people living with chronic illnesses gaining control of their illness that promotes self - care . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
earlier deficit - based social models of scientific citizenship where the public was seen as scientifically ignorant have been replaced with dialogue - based models emphasizing symmetrical and mutualistic conversations between the public , scientists , and sociopolitical institutions ( 7 , 14 , 25 , 35 ) . at the individual - citizen level , scientific citizenship requires that individuals be : knowledgeable in scientific content ; versant in the epistemology and nature of science ( nos ) ; able to employ scientific literacy skills ( such as the ability to critique and filter information , including self - critique ) ; aware and concerned about social and ethical issues related to science ( often termed socioscientific issues or ssis ) ; and self - actualized with respect to those issues ( 1 , 4 , 6 , 17 , 25 ) . at community , national , and international levels , scientific citizenship requires a balance of public competence , participation , and democratic accountability ( 2 , 22 , 23 , 29 ) . university classrooms are underutilized environments for developing scientific citizenship but have great potential to do so ( 8 , 16 , 28 ) . initiatives are needed which expose postsecondary students to , and allow them to practice using , both content and skills associated with scientific citizenship ( 17 ) . ssis provide real - world and oftentimes controversial contexts that pique student interests , allowing them to explore the issues multiple dimensions and practice scientific citizenship skills ( 18 , 29 , 31 ) and can be made accessible to both majors and nonmajors ( 5 ) . beginning spring 2007 , drake university launched a new general education curriculum component titled the engaged citizen ( ec ) initiative . the goal of engaged citizen is to help students explore societal topics that span diverse disciplines ( such as economics , politics , and science ) and develop ways of thinking , content knowledge , and skills helpful in dialogue and democratic decision - making . each year a different campus - wide engaged citizen theme is chosen on topics such as conflict ( war ) , democracy , or poverty . all colleges and departments then have the opportunity to modify existing courses or develop new courses that fit the theme . the engaged citizen initiative provided the drake university biology department an impetus to examine how our curriculum addresses scientific citizenship and implement curricular changes . two potential approaches presented themselves : create a class de novo to address the theme , or implement curricular changes in a pre - existing course . this paper describes how a pre - existing course ( bio 108 infectious diseases , taught alternating spring semesters ) was adapted to address the engaged citizen theme . rather than focusing on specific lesson plans , this paper emphasizes the philosophy underpinning those curricular changes and their implementation , in the hopes that sharing our bio 108 experience might serve as a model for other educators curious about implementing similar changes in their courses . for readers interested in the mechanics of the curricular changes , several supplementary files providing specific strategies or examples are included as appendices and referenced throughout the text . prior to the engaged citizen initiative , bio 108 had been a traditional , didactic course . while the primary goal was to restructure bio 108 so that it taught scientific citizenship topics by bridging traditional course content and ssis ( via the engaged citizen themes ) , several other goals existed . pedagogically , this included many of the original instructional objectives / content matter of bio 108 taught through constructivist and active learning philosophies ; since this was an infectious diseases course , instructional content encompassed basic information about each infectious agent s taxonomy and biology , transmission , symptoms , treatment , prevention and control , and important historical or societal aspects . pragmatically , this included recycling some pre - existing resources to better budget instructor time . second , desirable curricular modifications were identified . knowing that the engaged citizen theme would change annually , it was important to develop a course structure that could be custom - tailored to each year s theme yet have a stable structure that maintained course identity from one semester to the next ( again for both pedagogical and pragmatic reasons ) . cueing off the initiative s name , it was important to involve students ( engaged ) in exploring ssis ( citizen ) via scientific citizenship skill - building versus a straight lecture . finally , it was important to open the course up to a more diverse pool of majors to better capture diverse perspectives . the model that best fit all goals / components wove three elements together : a ) journal article days using papers with ssi aspects , b ) in - class lessons , and c ) a culminating individual student concept map project . the model hinges on instructional design and not content ; for example , it does not stipulate which diseases to include / exclude , how many diseases , or in what order . each year starts with course planning as follows : 1 ) identify the engaged citizen theme ; 2 ) identify infectious disease journal articles that fit the theme ; 3 ) arrange articles in a logical semester sequence ; 4 ) structure individual days ( journal article days or other days ) to meet engaged citizen , scientific citizenship , and/or content objectives ; 5 ) interweave in - class lessons around journal article days ( e.g. , if a journal article on influenza is chosen , then one or more in - class lessons pertaining to influenza can be instituted before , during , or after that journal day ) ; and 6 ) assessment . table 1 shows four engaged citizen themes chosen by drake university during semesters when bio 108 was offered and the different diseases that best fit with each theme using the stepwise planning process described above and in appendix 1 . serendipitously , many of the same diseases fit the engaged citizen theme across years of the 22 diseases that were collectively included over the four semesters , eleven ( 50% ) were used all four years in contrast to eight ( 36% ) that were only used once . specifics on the selection of journal articles and their integration are provided in appendix 2 . modules that could be assembled , broken down , and reassembled from semester to semester in a plug - and - play system . the modular system also allowed the course to rapidly respond to current events a scheduled journal article day and/or in - class lesson module could be unplugged and a module that addresses the current event could be plugged in its stead without interrupting course continuity . four engaged citizen themes and their respective years ( columns ) , and infectious diseases which best fit those themes and around which each year s curriculum was constructed ( rows ) . human immunodeficiency virus is not normally discussed in this class because it s a big focus of another class ( intd 87 and fys ) . when bio 108 was first revamped in 2009 , the scientific citizenship instructional model that best fit its needs was ekborg and colleagues six - faceted socioscientific case model , contextualizing topics by starting point , subject , nature of scientific evidence , social content , use of scientific knowledge , and levels of conflict ( 10 ) . table 2 shows examples of how ekborg and colleagues model was applied to bio 108 using three different types of ssis . dialogue / debate ( 20 ) was a large component of the model ( appendix 3 ) . other models are also available and may be better suited to others courses ( 13 , 17 , 3133 ) , particularly hodson s six criteria for students to be successful in socioscientific issue engagement and four levels of sophistication in engaging with socioscientific issues ( 17 ) . infectious disease examples for bio 108 using ekborg and colleagues ssi model ( 10 ) . all videos were available as of may 2015 outside of class , students prepared a posterboard - sized concept map which focused on a specific infectious disease of their choosing in terms of scientific and social dimensions ( the latter always in relation to the engaged citizen theme ) . later in the semester . some years , depending on schedules , students also presented posters outside of class at a campus - wide engaged citizen showcase where they could share their projects with students and faculty from other engaged citizen courses . specifics on the concept map project , its relation to the course , and examples of student work are provided in appendix 4 . more information on use of concept maps may be found elsewhere ( 3 , 15 , 26 , 27 ) . students completed course evaluations at the end of the each semester . scientific citizenship was not specifically queried because this manuscript was not foreseen at the time the courses were given . however , student responses often contained unprompted references to scientific citizenship associated course elements and may serve as a proxy for assessing students perceptions of those elements . the drake university institutional review board approved the analyses of past course evaluations for this manuscript ( irb id#2014 - 15075 ) . end - of - course evaluations were completely anonymous and did not identify students by major or demographic . nonscience majors included business , education , mathematics , open - enrolled , and political science majors . five questions that might contain relevant responses were identified from all previous course surveys . only those responses that specifically referenced some aspect of scientific citizenship ( the engaged citizen theme or other social / political / economic / etc . dimension of the course , journal article days , in - class activities , concept map , or class discussion ) were included for analysis . one question asked whether students felt the learning modalities ( journal article days , in - class activities including discussions , and concept map ) paired well with the scientific citizenship goals of the course : how did the instructional materials ( notes , in - class activities , journal article days ) integrate with the course and its objectives ? this question elicited a mix of favorable ( good integration ) , unfavorable ( poor integration ) , or neutral ( giving examples of both good and poor integration ) responses . most were favorable ( table 3 , appendix 5 ) with the exception of 2013 , which will be discussed in instructor perspectives below . n = the total number of responses to the question overall ( regardless of whether or not they met inclusion criteria ) ; the numbers in parentheses indicate the number of responses that specifically addressed scientific citizenship components . as an example : for question # 1 2009 , 27 students responded but only 16 of those responses met inclusion criteria . of the 16 responses , 10 were favorable , 4 were neutral , and 2 were unfavorable . na = not available . a separate question read : please comment on the blend of social / science aspects of the course . student responses were analyzed similarly to the previous question , and again were mostly favorable ( table 3 , appendix 5 ) . two questions asked students broadly about what worked well and what could be improved . of the 121 responses to what aspects of this course were most beneficial to you ? 57 ( 47% ) contained a reference to a scientific citizenship aspect of the course . within those 57 responses , 29 students ( 51% ) mentioned the in - class activities , including the discussion ; 26 ( 46% ) mentioned the social theme ; 8 ( 14% ) mentioned the journal club ; and 3 ( 5% ) mentioned the concept map . the number of mentions is greater than the total number of responses because some students discussed more than one element ( this was true for subsequent questions also ) . of the 112 responses to what do you suggest to improve this course ? 35 ( 31% ) contained a reference to a scientific citizenship aspect of the course . within those 35 responses , 17 ( 49% ) mentioned journal article days ; 15 ( 43% ) mentioned the in - class activities , including the discussion ; and 3 ( 9% ) each mentioned the social theme or the concept map . these responses revealed an interesting juxtaposition regarding journal article days : in the first question , students cited journal article days most frequently as integrating with the scientific citizenship theme , yet in the fourth question , they indicate journal article days were what they would improve ( appendix 5 , table 3 ) . the final question was , please comment on what ( if anything ) you feel you accomplished in this course . of the 121 responses , 41 ( 34% ) contained a reference to scientific citizenship . within those 41 responses , the overwhelming majority of students ( 32 , 78% ) mentioned obtaining a better understanding of the interplay between science and social / political / economic factors , 7 ( 17% ) mentioned heightened awareness of ssis , 3 ( 7% ) mentioned using course skills to engage with the world around them , and 2 ( 5% ) each mentioned applying content to their future careers and better scientific literacy skills ( appendix 5 ) . since none of the questions specifically asked about scientific citizenship , and the questions are largely satisfaction questions , results should be interpreted conservatively . although scoring of the open - response questions was standardized as best as possible into favorable , unfavorable , and neutral categories , such classification ( and any subsequent interpretation ) is inherently subjective ; similarly , a different instructor may have picked out different representations of student responses for appendix 5 . the final question represents students self - perceptions of their own learning , so none of these questions can demonstrate whether deep learning occurred in the course . the response rate is lower than what might be expected if students were specifically prompted to consider the scientific citizenship components . even with these shortcomings , responses suggest students received the curricular changes favorably and felt the pedagogical strategies supported the teaching of scientific citizenship . infusing scientific citizenship content into a traditional ( wholly scientific content based ) course initially presented some challenges . when i first offered the modified course in 2009 , there was scant literature on scientific citizenship instruction for the college level specifically , resulting in much trial and error in lesson construction and implementation . thankfully , and as evidenced by the earlier literature review , the scientific citizenship instructional literature has mushroomed in recent years . on a more personal level , one large obstacle was my own tendency to fall back on traditional science content or teaching strategies , likely because the traditional content was more familiar to me . for every course i teach , i complete a qualitative teaching reflection in two parts . before the first day of class , i identify two to three goals and anticipate hurdles or idiosyncratic factors for the upcoming semester . after final grades are submitted , i write what worked well and what could be improved , composing some responses prior to receiving the students course evaluations and then adding to or modifying those responses subsequent to reading students course evaluations . two factors appear to be the most critical for successful scientific citizenship integration with bio 108selection of appropriate journal articles , plus proactive and specific construction of each day s lesson prior to the start of the semester . regarding journal article selection , i found that ssi - based journal articles provided an ideal foundation for the course , but could backfire if they a ) did not represent the theme well , b ) were repetitive in the type of ssis they presented , or c ) were too technical . a combination of these factors may have led to the relatively tepid student reactions towards the journal articles in 2013 compared with other years ( table 3 , appendix 5 ) . one adjustment i made in 2015 was to expressly ask students to identify the connections between each journal article , its ssi ( when applicable ) , and the engaged citizen theme at the start of each journal article day , before beginning any discussion or activity . alternatively , the lower student satisfaction responses in 2013 may simply reflect the fact that some engaged citizen themes worked better in this model than others , or they might be related to students preconceived notions about the theme . regarding course planning , i found that i had to go beyond standard course mapping ( e.g. , solely writing down which diseases or articles will go with which class days , and worrying about the specifics of what we will do each day later ) at the start of the semester and instead expressly identify scientific citizenship or scientific content goals for each day in advance . overall course structure section is the product of trial and error from teaching the course multiple times , each with different engaged citizen themes . i was overwhelmed with the number and complexity of moving parts when i tried this strategy in 2009 ; in fact , when the course was initially modified in 2009 it was called emerging infectious diseases and all selected diseases had to appear on the national institutes of allergy and infectious diseases ( naiad s ) list of emerging and re - emerging infectious diseases . the additional criterion proved to be too difficult to juggle with other curricular elements and the ever - shifting engaged citizen themes ( and frequently excluded historical diseases that fit themes well ) and was dropped in 2014 . each year , as my comfort with teaching scientific citizenship skills grows , i am able to layer in more scientific citizenship elements and balance them better with traditional science content . one strategy that helped me to identify opportunities to expand scientific citizenship content ( and concomitantly helped me organize and sequence the different elements of the class overall ) was to use a notecard for each class day and different colored markers for scientific citizenship goals and traditional content goals , and also for the different class modalities ( journal article days , in - class activities , lecture , etc . ) . laying out the notecards in front of me allowed me to gauge the balance of the class by color comparisons . expectedly , teaching this course has become easier with each course offering , especially once an arsenal of structured discussion and in - class activities was built up , because many could be used interchangeably for different infectious agents or class modalities within or across semesters . plug - and - play system worked well ; for example , there were bird and swine flu outbreaks in 2009 and 2015 , respectively , and i was easily able to remove the planned lessons and swap in discussions and activities that could capture those current events without disrupting the general flow of the course . being aware of the course sequence at finer resolution in advance of the course gave me the added benefit of forewarning and subsequently reminding students about connections between different days or topics , emphasizing the undergirding scientific citizenship themes of the class . this paper has shared one example of how scientific citizenship driven curricular changes were applied to a traditional course on infectious diseases , emphasizing the thought processes and philosophies of the curricular changes rather than the specific lessons themselves to underscore generalizable aspects of the process and resultant model . mythical about the exact model developed for bio 108 , and instructors should take liberty in picking and choosing elements or variations they feel would work best for their classes . for readers from different scientific disciplines , other writers have shown potential applications ( 29 ) of scientific citizenship curricula in biotechnology ( 6 ) , business and economics ( 21 ) , ethics ( 12 ) , food origins and safety ( 14 ) , genetics ( 11 , 12 ) , nanotechnology ( 9 ) , medicine ( 34 ) , philosophy ( 19 ) , politics ( 14 ) , risk regulation ( 24 ) , sustainability ( 31 ) , synthetic biology ( 33 ) , and water fluoridation ( 20 ) . regardless of an instructor s specific field , it is hoped this article will inspire others to begin infusing scientific citizenship curricular changes into science courses across the scientific spectrum , so that students experience multiple exposures in a variety of contexts . appendix 1 : implementation appendix 2 : journal article selection and integration appendix 3 : student debate / dialogue appendix 4 : concept map convention : design , rubric , and examples appendix 5 : example student responses | this article describes philosophies and perspectives underpinning scientific citizenship focused curricular changes implemented into a pre - existing undergraduate infectious diseases course .
impetus for the curricular changes was a novel , campus - wide , multidisciplinary engaged citizen
theme for the general education curriculum . the first half of the article describes the larger contexts from which the curricular changes were borne and the resulting instructional model .
the second half of the article shares both student and instructor perspectives on the curricular changes and potential application of the model to other science courses . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
the presence of platelet - derived growth factor receptors ( pdgfrs ) and their ligands in the prostate were initially described by fudge et al .. more recently , chott et al . reported that primary prostate cancers and their skeletal metastases are positive for pdgfr expression , with pdgfr being most represented . we confirmed this observation by showing that normal prostate expresses low levels of pdgfr , which significantly increase upon malignant transformation . we detected a strong signal for pdgfr in approximately 70% of tissue cores of human prostate and all the samples from skeletal metastases by immunohistochemistry . interestingly , a significant number of specimens showed dishomogeneous distribution of pdgfr on the epithelial compartment , suggesting that cellular phenotypes with different expression patterns for pdgfr co - exist in the same gland , a scenario replicated by the human prostate cancer cell lines commonly available . for instance , we found that pdgfr is detectable only in cells derived from skeletal metastases , such as the widely used pc3 cell line . in contrast , cells obtained from lymph node metastases ( lncap ) or brain metastases ( du-145 ) in prostate cancer patients fail to express either the alpha or beta isoforms of pdgfr . a more direct correlation between pdgfr expression levels and the propensity of prostate cancer cells to colonize the skeleton was derived from experiments that were conducted using two sub - lines originally obtained from the pc3 parental population . employing an in vitro invasion assay , wang et al . these cells were subsequently evaluated for their metastatic potential in immunocompromised scid mice through tail vein inoculation . the invasive cells demonstrated bone - metastatic abilities and are currently named pc3-ml , whereas the non - invasive cells also failed to produce macroscopic bone tumors and are currently named pc3-n . we decided to complement these initial experiments using an animal model of metastasis combining fluorescence stereomicroscopy , histologic analysis and digital imaging . we employed prostate cancer cells engineered to stably express enhanced green fluorescent protein ( egfp ) . the resulting emitted fluorescence facilitated their identification both at the single - cell stage and when growing as metastatic foci of progressively larger size in the skeleton of the inoculated mice . when inoculated into mice via an intracardiac route , pc3-n and du-145 cells were unable to produce macroscopic tumors in the skeleton or any other organ examined , whereas pc3-ml cells produced macroscopic tumors at 4 to 5 weeks post inoculation . however , when earlier time - points were investigated , we established that pc3-n and du-145 cell lines were both capable of spreading to the skeleton through the blood circulation as effectively as the metastatic counterpart pc3-ml cells . however , pc3-n could generally survive no longer than one week in the bone marrow and only a small number of mice showed small skeletal metastases at three weeks post inoculation . du-145 cells could survive only for the first 72 h after arriving into the bone and were never detected at one week post inoculation ( figure 1 ) . thus , the disparity in metastatic potential of these three malignant prostate phenotypes is not related to the extent of their dissemination to bone . instead , it appears to depend on their ability to survive in the bone marrow , in which they lodge after extravasating from the blood circulation . interestingly , we have established that pc3-ml cells express significantly higher levels of pdgfr than do their non - metastatic counterpart , pc3-n cells . if combined with the complete lack of pdgfr expression observed in du-145 cells , these results establish a positive correlation between the expression levels of pdgfr and the progression of malignant prostate phenotypes in the bone marrow , and indicate that the survival of disseminated cells in a foreign microenvironment plays a key role in the overall metastatic potential of a specific prostate cell phenotype . in light of this established correlation between pdgfr expression and bone - metastatic potential , we tested whether the exogenous over - expression of receptor in pc3-n and du-145 cells could sustain initial bone colonization and promote metastatic growth of these two malignant phenotypes . we found that the over - expression of pdgfr in pc3-n cells conferred a bone - metastatic potential indistinguishable from pc3-ml cells in terms of number and size of skeletal tumors detected four weeks after inoculation . interestingly , the ability of du-145 cells to produce bone - metastatic tumors was unaffected by the expression of pdgfr , suggesting that the pre - existing genetic background of a malignant phenotype may ultimately dictate the pro - metastatic role exerted by pdgfr in prostate cancer cells . further studies revealed an unorthodox mechanism by which pdgfr recruits downstream signaling pathways in prostate cancer cells . the experiments that fully epitomize this atypical signaling by pdgfr were conducted by over - expressing a truncated form of the receptor , named rx , in pc3-n cells . kazlauskas and collaborators , lacks the extracellular ligand - binding domain and is therefore unable to bind or be activated by proper pdgf ligand(s ) or other signaling molecules . when pc3 ( rx ) cells were tested for their metastatic potential in our animal model , they fully emulated the bone - metastatic behavior of both pc3-ml cells and pc3-n cells that over - express the full - length form of the receptor . the pc3-ml sub - line expressed higher levels of the receptor and produced macroscopic skeletal metastases in mice inoculated with cancer cells in the hematogenous circulation via the left cardiac ventricle injection . pc3-n cells expressed lower levels of pdgfr than did pc3-ml cells and could only survive two weeks in the bone after their dissemination . du-145 cells were found negative to pdgfr expression and disappeared from the skeleton between 72 h and one week post inoculation . two structurally related forms of the receptor are pdgfr and pdgfr. their extracellular portion contains five immunoglobulin - like domains whereas the intracellular part of the molecule contains a kinase domain . five pdgf ligands , pdgf - aa , -bb , -ab , -cc and -dd , have been identified , which display different binding affinities for the different receptors . since pdgf ligands are dimeric molecules , they bind two receptors simultaneously . upon binding , the two receptors dimerize , triggering reciprocal phosphorylation at tyrosine residues located at specific sites on the intracellular portion of each receptor . this transphosphorylation of pdgfr upon ligand binding serves two important purposes . in addition , the phosphorylation of tyrosine residues outside of the kinase domain creates docking sites for signaling molecules . some of these molecules can function as enzymes , such as phosphatidylinositol 3-kinase ( pi3k ) , phospholipase c ( plc ) , the src family of tyrosine kinases , the tyrosine phosphatase shp-2 , and a gtpase activating protein ( gap ) for ras . other molecules lack enzymatic activity and function as adaptors , such as grb2 , nck , shc and others . the biological functions of some of these signaling molecules have been characterized and are fundamental for cellular homeostasis . pi3k activates the downstream kinase akt , which is richly implicated in promoting cell survival . we initially reported that pdgfr , in addition to its proper pdgf ligands , could activate downstream signaling pathways , such as pi3k / aw , when exposed to the soluble fraction of human bone marrow . interestingly , the phosphorylation of akt in pc3-ml cells exposed to bone marrow could be reduced to less than 40% by ag1296 , a putative specific inhibitor of pdgfrs . more conclusive evidence for a direct activation of pdgfr was obtained from the detection of its tyrosine - phosphorylation upon the bone marrow treatment of pc3-ml cells . considering these results , we decided to measure the concentration of pdgf in the bone marrow aspirates and to identify the isoform(s ) of this growth factor responsible for akt activation in pc3-ml cells . we found that bone marrow aspirates obtained from different donors contained both pdgf - aa and pdgf - bb in concentrations ranging from 400 pg / ml to 2 ng / ml . our experiments were conducted employing bone marrow diluted twenty fold , thus containing pdgf ligands reaching a maximum concentration of 100 pg / ml . when pc3-ml cells were simultaneously exposed to 100 pg / ml ( each ) of pdgf - bb and pdgf - aa , the observed activation of akt was minimal , representing less than 10% of the observed response when exposing these cells to bone marrow . in addition , similar concentrations of pdgf ligands were unable to reproduce tyrosine phosphorylation of the intracellular portion of pdgfr generated by human bone marrow . notably , the phosphorylation of pdgfr induced by bone marrow was of a lesser magnitude than that generated by the exposure of cells to pdgf - aa . however , the extent of akt phosphorylation observed under these two conditions was remarkably similar , implying that the phosphorylation caused by bone marrow must predominantly or exclusively affect tyrosine residues on pdgfr which are responsible for the recruitment and activation of pi3k . collectively , these observations strongly suggest that pdgfr , in addition to being stimulated by pdgf ligands in a widely recognized fashion , , can also be recruited and activated via ligand - independent mechanisms in a phenomenon termed trans - activation that has been reported for several receptors , including pdgfr. accordingly , upon activation by the soluble fraction of bone marrow , the canonical dimerization of pdgfr could not be observed . this leads to hypothesize that the stimulation of other plasma membrane receptors could successively trigger the phosphorylation and signaling of monomeric forms of pdgfr via intracellular mediators . as a role for src family kinases ( sfk ) by intracellular reactive oxygen species ( ros ) observed in other systems the conclusive evidence for pdgfr transactivation was obtained using either du-145 or pc3-n cells stably expressing r x. both cell types responded to human bone marrow with strong akt activation and tyrosine phosphorylation of r x . these results complement the in vivo studies and show that pc3-n acquired a bone - metastatic potential comparable to that of pc3-ml cells when stably transfected with either the full - length or the truncated form of pdgfr. the possibility that the establishment and progression of prostate cancer in the bone could be independently supported by pdgfr of direct ligand stimulation may have important translational implications . it can be inferred that anti - cancer therapeutics designed to block the ligand - binding domain of pdgfr may not fully prevent downstream signaling in cells that have spread to the bone marrow . alternatively , inducing the internalization of pdgfr may provide a mean to prevent ligand - dependent and -independent activation and provide a better therapeutic option to counteract the growth of prostate cancer cells disseminated to the skeleton . pdgfr and pdgfr are involved in organism development , with pdgfr playing a greater role during embryogenesis . in the adult , both receptors cooperate in modulating cellular and physiological processes that largely overlap , including angiogenesis , wound healing and tissue homeostasis , . pdgfr , however , plays a predominant role overall , as demonstrated in mice in which the cytoplasmic domains between pdgfr and pdgfr were swapped . these experiments revealed that the pdgfr intracellular domain could fully substitute for the pdgfr. in contrast , replacement of the pdgfr cytoplasmic domain with that of the -receptor caused abnormalities in vascular smooth muscle cell development and function . the use of the small - molecule inhibitor sti571 ( imatinib mesylate or gleevec ) has been reported to block pdgfrs and reduce the expansion of cancer cells within the bone , . however , the inhibitory and pro - apoptotic effects of sti571 seem to be exerted prevalently on pdgfr expressed in endothelial cells of the tumor vasculature rather than directly affecting prostate cancer cells . alternatively , the toxicity reported in phases i and ii clinical trials , which in most cases had to be interrupted , , may explain the ability of sti571 to comparably block pdgfr and pdgfr. in addition , pre - clinical animal studies investigating the survival role of pdgfrs for cancer cells and the effects exerted by sti571 were almost exclusively conducted using animal models in which bone tumors were produced by directly implanting cancer via an intra - osseous route . while this approach significantly shortens the duration of each experiment , it also bypasses the initial stages of lodging and colonization of the bone marrow . therefore , the peculiar histopathologic features produced by this intra - osseous approach , as compared to naturally established and progressing skeletal metastases , might also explain the disappointing effects of sti571 in clinical trials . it seems plausible that the selective inactivation of pdgfr , employing a monoclonal antibody rather than a broad - range inhibitor such as sti571 , could limit the survival of malignant cells that depend on it while causing limited side effects , due to the largely duplicate role exerted by pdgfr. however , in the event that pdgfr in prostate cancer cells undergoes transactivation when in the bone marrow microenvironment , an antibody that would target the extracellular ligand - binding domain would fail to completely block signaling . conversely , an antibody that could induce the internalization of pdgfr would remove from the plasma membrane an important target for the transactivation of cancer cells exerted by the bone marrow . with this goal in mind , we decided to test imc-3g3 , a humanized monoclonal antibody against pdgfr. this antibody has been extensively characterized both in vitro and in vivo and was shown to block both pdgf - aa and pdgf - bb from binding pdgfr , with a kd of 40 also , the binding kinetic of imc-3g3 to human pdgfr was defined by biacore analysis as well as flow cytometry employing human cells . a significant neutralizing activity of imc-3g3 against pdgfr was also observed in mitogenic and phosphorylation assays and this antibody inhibited subcutaneous xenografts in nude mice . in experiments in which pc3-ml cells were exposed to bone marrow , imc-3g3 was consistently able to reduce downstream akt phosphorylation in a time - dependent manner . interestingly , cell - surface biotinylation experiments showed that the inhibitory effect of imc-3g3 on pdgfr downstream signaling was tightly correlated to the internalization of this receptor . this event affected more than 80% of the initial levels of pdgfr after two hours of imc-3g3 incubation . furthermore , by using experimental conditions that halt receptor internalization while preserving imc-3g3 neutralization of the ligand - binding domain of pdgfr , we could block akt phosphorylation by pdgf - aa but not by bone marrow . hence , evidence strongly suggests that imc-3g3 could be effective in our pre - clinical model of bone metastases to counteract the survival and progression prostate cancer cells disseminated to the skeleton . we initially confirmed the species - specificity of imc-3g3 in vitro , observing that the antibody blocked signaling by human pdgfr while leaving the mouse form of the receptor unaffected . following , we used imc-3g3 according to a prophylactic protocol , in which scid mice were inoculated in the blood circulation with pc3-ml cells and received a first loading dose of imc-3g3 followed by subsequent maintenance doses of the antibody bi - weekly , all administered by intraperitoneal injection . when animals were euthanized four weeks later , the number of bone - tumors per mice as well as the number of animals presenting with skeletal metastases in the imc-3g3-treated groups were significantly lower than those in the saline - treated groups . similar results were obtained when animals were euthanized two weeks post inoculation , in which bone metastases were reduced by 70% as compared to control groups . successively , we employed a curative protocol in which mice were inoculated with pc3-ml cells and left untreated for either 7 or 14 days , thus providing a time interval for metastatic tumor growth . following this first period , treatment with we found that the skeletal lesions in animals administered imc-3g3 were significantly reduced in size than those in the control groups receiving either saline or human immunoglobulins of the igg1 subclass as the imc-3g3 antibody ( figure 2 ) . since it had been previously reported that stromal pdgfr could support tumor growth and local angiogenesis when stimulated by locally produced pdgf ligands ( i.e. pdgf - aa and pdgf - cc ) , we decided to investigate the contribution of pdgfr expressed by stromal cells ( osteoblasts and mesenchymal bone stromal cells ) on the skeletal colonization and metastatic progression of pc3-ml cells . thus , we used imc-1e10 , a humanized monoclonal antibody selected for binding to mouse pdgfr and otherwise sharing an identical structure with imc-3g31 . imc-3g3 , imc-1e10 , or a combination of the two antibodies was used to treat mice that had been inoculated with pc3-ml for 4 weeks . we found that the animals treated with imc-1e10 showed no decrease in tumor size as compared to control , whereas mice treated with imc-3g3 either alone or in combination with imc-1e10 showed a significant reduction in the size of skeletal tumor foci . the current standard of care for patients with advanced metastatic prostate cancer includes the administration of bisphosphonates . these molecules are very effective inhibitors of bone - matrix degradation caused by osteoclasts located in skeletal metastatic lesions . the resorption of mineralized bone and consequent mobilization of growth factors has been shown to support cancer cell growth and survival , while also causing significant pain to patients and increasing the risk for skeletal - related events ( sres ) such as pathological fractures and spinal - cord compression . zoledronic acid ( za ) shows a potent analgesic effect that can significantly delay the time to sres . however , while bisphophonates are credited for a significant palliative role , a recent clinical trial in which za was compared to placebo in 422 advanced prostate cancer patients failed to show significant differences in disease progression , performance status and quality of life among the groups . similar results were provided by pre - clinical studies in which the progression of the bone metastatic disease from breast cancer cells was transiently delayed , and at later stages the total tumor burden per animal became equivalent to that in vehicle - treated animals , . to understand whether the palliative effect exerted by bisphosphonates could be complemented by the anti - metastatic role of imc-3g3 , we investigated whether animals with metastatic bone lesions would respond to the combined administration of za and imc-3g3 with an increase in overall survival . we found that the treatment with imc-3g3 alone and more significantly in combination with za was able to extend survival ( figure 3 ) . after mice were inoculated with prostate cancer cells , treatment was withheld from mice for either one or two weeks , after which treatment of imc-3g3 was maintained for the remainder of the experiment . when mice were euthanized at four weeks , their tibiae and femora showed a significant reduction in the average size of bone tumors as compared to controls . this figure is reprinted with permision from russell et al .
, clinical cancer research , 2010 , 16 ( 2):50025010 . the series of studies presented here strongly support an important role of pdgfr in facilitating the initial lodging and subsequent progression of prostate cancer cells in the bone microenvironment . in addition to an expected stimulation by pdgf ligands , the effect of pdgfr is exerted through transactivation events initiated by activating signaling molecules present in the soluble fraction of human bone marrow . importantly , the selective targeting of pdgfr with monoclonal antibodies such as imc-3g3 , while still allowing pdgfr to exercise its numerous physiological roles , can effectively counteract the growth of prostate cancer cells at the skeletal level . finally , based on the positive results obtained with imc-3g3 in combination with za in animal survival studies , a similar combination therapy approach could be envisioned in the clinic for prostate cancer patients . the kaplan - meier graphs show that targeting pdgfr with imc-3g3 induced a significant extension of overall survival in mice inoculated with prostate cancer cells , either alone or administered in combination with zoledronic acid ( za ) . this figure is reprinted with permision from russell et al . , clinical cancer research , 2010 , 16(2):50025010 . | metastasis represents by far the most feared complication of prostate carcinoma and is the main cause of death for patients .
the skeleton is frequently targeted by disseminated cancer cells and represents the sole site of spread in more than 80% of prostate cancer cases .
compatibility between select malignant phenotypes and the microenvironment of colonized tissues is broadly recognized as the culprit for the organ - tropism of cancer cells . here ,
we review our recent studies showing that the expression of platelet - derived growth factor receptor alpha ( pdgfr ) supports the survival and growth of prostate cancer cells in the skeleton and that the soluble fraction of bone marrow activates pdgfr in a ligand - independent fashion . finally , we offer pre - clinical evidence that this receptor is a viable target for therapy . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
acute respiratory distress syndrome ( ards ) is not an uncommon feature in patients with traumatic brain injury . the management plan for ards requires permissive hypercapnia , whereas , raised intracranial pressure ( icp ) is managed by normocapnia or hypocapnia , which in a way are contradictory to each other . the role of inhaled nitric oxide ( ino ) in ards is well - described , while in raised icp is not yet established . we report a case which showed improvement of raised icp and ards following traumatic brain injury ( tbi ) with ino . a 13-year - old boy was brought to the emergency room with multiple injuries following a motor vehicle accident . pupils were equal and reactive , blood pressure 100/55 mmhg , pulse 110 per min , oxygen saturation 94% on 0.6 fio2 , and respiratory rate 16 per min . trauma x - ray series showed fractures of the left femur and pelvis ( stable fracture ) . patient was sedated with midazolam 4 - 6 mg / h and fentanyl 100 - 150 /h . the ventilator ( drger , infinity c500 , germany ) settings in the icu were as follows ; assist control mode , respiratory rate 14 per min , tidal volume 7 ml / kg ( according to ideal body weight ) , inspiratory flow rate 45 l / min , positive end - expiratory pressure ( peep ) 5 cmh2o , and fio2 0.5 . patient 's weight and height were 60 kg and 160 cm , respectively ( ideal body weight ( ibw ) 57 kg ) . lung mechanics revealed high peak and plateau pressure ( 35 and 30 cmh2o , respectively ) . after 24 h , patient 's pupil became unequal and ct brain showed right temporoparietal epidural hematoma . evacuation of hematoma was done , and patient was transferred back to icu with icp monitoring device . initial icp and cerebral perfusion pressure ( cpp ) were 17 and 60 mmhg , respectively [ figure 1 ] . post - surgery ventilator settings were assist control mode , rate 28 , tidal volume 6 ml / kg , fio2 1.0 , and peep 8 cmh2o . arterial blood gas showed ph 7.32 , paco2 46 , pao2 65 , hco3 19 meq / l , and spo2 was 93% . right temporoparietal acute epidural hematoma noted with maximum depth of 2.2 cm and causing mass effect after 48 h , patient developed features of severe ards [ figure 2 ] . lung protective ventilation strategy was started as follows ; ventilatory rate 32 per min , tidal volume 5 - 6 ml / kg ( 300 - 350 ml ) , fio2 1.0 , and peep 16 . this ventilatory setting led to increase in icp from 17 to 28 and reduction of cpp from 60 to 45 . cisatracurium was used at this stage to paralyze the patient with 0.3 mg / kg / h as maintenance dose after bolus of 0.2 mg / kg . 20% mannitol ( 1 g / kg ) was used 8-hourly for 24 h with monitoring of serum sodium ( target serum sodium : 150 - 155 meq / l ) and serum osmolality ( target osmolality up to 320 mosm ) . norepinephrine was used for 24 h for keeping mean arterial pressure ( map ) above 90 mmhg . blood gases were as follows : ph 7.37 , paco2 40 , and pao2 128 . peep reduced from 16 to 10 and fio2 from 1.0 to 0.6 [ table 1 and figure 3 ] . change in abgs , icp , cpp , fio2 , and peep before and after ino change in abgs , icp , cpp , fio2 , and peep before and after the use of ino . abg = arterial blood gas , icp = intracranial pressure , cpp = cerebral perfusion pressure , peep = positive end - expiratory pressure , ino = inhaled nitric oxide ino was discontinued after 1 week , and patient was weaned off from the ventilator . further stay in icu remained uneventful , and then patient was transferred to the ward . patient remained in hospital for 2 months as he developed an hospital - acquired infection and then shifted home . it can lead to hypoxemia and decreased oxygen supply to the brain that can further worsen brain injury . the management for raised icp requires pao2 around 100 , paco2 between 30 and 35 , and cpp 50 - 70 mmhg . on contrary ino is increasingly used in icus for patient with ards , but its use in traumatic brain injury patients is not yet clear . there are two case reports ( one in adult and other in a child ) ; so far , highlighting the successful use of ino in patient with severe traumatic brain injury complicated with ards . it is a known fact that ischemia is one of the leading causes of secondary brain damage , and worsening of cerebral blood flow ( cbf ) is a dominating feature in the progression of pericontusional ischemic changes . the role of a selective vasodilator with action on hypoxic / ischemic tissue would certainly be a viable strategy for the treatment of pericontusional ischemia ; however , such a therapeutic option is not yet available . terpolilli et al . , observed the protective effect of ino as it selectively dilates cerebral resistant vessels in hypoperfused areas , and thus , improved collateral blood circulation in the brain . it was hypothesized by papadimos that ino could improve metabolic function and prevent death of the ischemic penumbra under conditions of transient reduction of cbf . furthermore , regional vascular protective effects were nicely described by cannon et al . as a selective cerebral vasodilator , it may cause inverse steal or robin hood effect in brain injured tissue that can play as a neuroprotective role . successfully used ino to decrease icp in a patient with severe tbi complicated by ards . this study further elucidated the anti - inflammatory and neuroprotective effect of ino in traumatic brain injury . in our case report , the clinical scenario for using ino was not very much different from the case presented by papadimos et al . , but interestingly in our case the timing of initiation of ino was early with encouraging cerebral outcome . the use of ino showed concomitant reduction of arterial paco2 and icp , which lead to improvement in cpp . this improvement in icp and cpp can be hypothetically correlated to improvement in paco2 and pao2 , but the cerebral protective effect of ino is not new in the literature , though it is still limited to animal studies and case reports . this case report not only emphasized the early use of ino in tbi complicated with severe ards and raised icp , but it also opens the discussion to use ino as one of the cerebral protective measures in future . in conclusion , ino in principle can be considered for improvement of cerebral perfusion in patient with raised icp particularly following tbi . more clinical studies , particularly randomized clinical trials ( rcts ) are needed to validate it further . | patients with traumatic brain injury complicated by acute respiratory distress syndrome ( ards ) are not uncommon in intensive care unit ( icu ) .
the ventilatory management of patients combined with both of these catastrophic conditions is not straightforward .
evidence - based permissive hypercapnia strategy for ards could be fatal in patients with intracranial hypertension .
adjunctive use of inhaled nitric oxide ( ino ) is well - defined as a rescue therapy in severe ards , but its specific role in intracranial hypertension is somewhat uncertain .
we report a case , which following traumatic brain injury developed both intracranial hypertension and ards .
ino was given for ards , but coincidentally it also improved the raised intracranial pressure ( icp ) and patient 's neurological outcome .
the case report will be followed by literature review on the role of ino in raised icp . |
You are an expert at summarizing long articles. Proceed to summarize the following text:
2 mg of dyes were dissolved in organic solvent and added to 10 ml pluronic f127 ( 10% w / v ) and stirred until organic solvent evaporation . after centrifugation to remove aggregates , 100 l of the supernatant was diluted in 3 ml of 20 mm sodium cholate and dialyzed for 24 hours against 20 mm sodium cholate . 2 mg of dye was dissolved in 1 ml dichloromethane and added to an f127 solution as above . to remove unincorporated f127 via cmc switching , the clarified solution was cooled on ice and subjected to centrifugal filtration ( fisher # ufc9 - 100 - 24 ) at 4 c until 200 l of solution was retained . water was added back to the concentrate and the washing procedure was repeated three times . size and zeta potential measurement were carried out with dynamic light scattering using a nano zs90 zetasizer ( malvern instruments ) . transmission electron microscopy was performed using a jem-2010 electron microscope with 1 % uranyl acetate staining . absorbance was measured with a lambda 35 uv / vis spectrophotometer ( perkin elmer ) using cuvettes with 1 cm path lengths , except for the high - concentration spectral shifting analysis which used 10 m path length cuvettes . x - ray diffraction analysis was carried with freeze dried samples on a rigaku ultima iv . scattering and fluorescence properties were assessed using a spectrofluorometer ( photon technology international ) . to assess the stability of nanonaps in sgf and sif , concentrated nanonaps were diluted into the fluids so that the absorbance was close to 1 , then dialyzed at 37 c against sgf ( ricca , # 7108 - 32 ) with added pepsin and pancreatin - containing sif ( ricca # 7109 - 32 ) . 860 nm ctab stabilized gold nanorods and 850 nm thiol - peg - stabilized gold nanorods ( nanorods llc , # c122-ctab and c120-peg ) were dialyzed in the same manner . animal experiments were performed in accordance with the university at buffalo institutional animal care and use committee . 6 weeks female balb / c mice ( harlan ) were held without food overnight with free access to water . after gavaging 100 ods of onc nanonaps or methylene blue , mice were transferred to metabolic cages and faeces and urine were collected separately . for determination of recovery tissues or faeces were dissolved in 2 ml of organic solvent and were disrupted until the dyes were dissolved completely and absorbance was assessed . for acute toxicity , 6 week old male and female balb / c mice were gavaged 1000 od860 of onc nanonaps per 20 g or kept as controls ( n=5 per group ) . behaviour was monitored and mass was measured weekly . after 2 weeks , mice were sacrificed and organs were harvested . organs were immersed in formalin ( vwr # 16004 - 114 ) prior to sectioning and haematoxylin and eosin staining . a custom - built , reflection - mode single - element transducer pat system was used for high resolution scanning imaging . the movement of nanonaps in the digestive system was monitored after gavage of 100 ods of the indicated nanonaps in female balb / c mice . rate of peristaltis was determined by derivative analysis of region - of - interest intensity . for intestinal obstruction , 1214 g female cd-1 mice ( harlan ) the abdomen was opened with a 1 cm transverse incision near the stomach and the duodenum was ligated with nylon sutures ( vwr # 89219 - 096 ) . sham - treated mice had no duodenum ligation performed , but otherwise it was an identical procedure . the abdomen skin was sutured closed again and within a few hours , mice were administered a 100 od860 dose of onc nanonaps by gavage . 1 hour later , the mice were anesthetized and imaged with the vevo lazr system . for labelling , 37 mbq of cucl2 was diluted in 300 l of 0.1 m sodium acetate ( ph 5.5 ) and added to 400 od860 onc nanonaps for 30 minutes at 37 c . the cu - nanonaps were purified by centrifugal filtration and re - suspended in 500 l of pbs for further use . for in vitro stability , one od860 of cu - nanonaps was re - suspended in 1 ml of sgf or sif and incubated at 37 c with stirring . portions of the mixture ( 50 l ) were sampled at different time points and washed by centrifugal filtration for analysis . pet scans were performed using an inveon micropet / microct rodent model scanner ( siemens ) . after overnight fasting , each balb / c mouse was gavaged ~7.4 mbq of cu - nanonaps ( 100 od860 ) . 2 mg of dyes were dissolved in organic solvent and added to 10 ml pluronic f127 ( 10% w / v ) and stirred until organic solvent evaporation . after centrifugation to remove aggregates , 100 l of the supernatant was diluted in 3 ml of 20 mm sodium cholate and dialyzed for 24 hours against 20 mm sodium cholate . 2 mg of dye was dissolved in 1 ml dichloromethane and added to an f127 solution as above . to remove unincorporated f127 via cmc switching , the clarified solution was cooled on ice and subjected to centrifugal filtration ( fisher # ufc9 - 100 - 24 ) at 4 c until 200 l of solution was retained . water was added back to the concentrate and the washing procedure was repeated three times . size and zeta potential measurement were carried out with dynamic light scattering using a nano zs90 zetasizer ( malvern instruments ) . transmission electron microscopy was performed using a jem-2010 electron microscope with 1 % uranyl acetate staining . absorbance was measured with a lambda 35 uv / vis spectrophotometer ( perkin elmer ) using cuvettes with 1 cm path lengths , except for the high - concentration spectral shifting analysis which used 10 m path length cuvettes . x - ray diffraction analysis was carried with freeze dried samples on a rigaku ultima iv . scattering and fluorescence properties were assessed using a spectrofluorometer ( photon technology international ) . to assess the stability of nanonaps in sgf and sif , concentrated nanonaps were diluted into the fluids so that the absorbance was close to 1 , then dialyzed at 37 c against sgf ( ricca , # 7108 - 32 ) with added pepsin and pancreatin - containing sif ( ricca # 7109 - 32 ) . 860 nm ctab stabilized gold nanorods and 850 nm thiol - peg - stabilized gold nanorods ( nanorods llc , # c122-ctab and c120-peg ) were dialyzed in the same manner . animal experiments were performed in accordance with the university at buffalo institutional animal care and use committee . 6 weeks female balb / c mice ( harlan ) were held without food overnight with free access to water . after gavaging 100 ods of onc nanonaps or methylene blue , mice were transferred to metabolic cages and faeces and urine were collected separately . for determination of recovery tissues or faeces were dissolved in 2 ml of organic solvent and were disrupted until the dyes were dissolved completely and absorbance was assessed . for acute toxicity , 6 week old male and female balb / c mice were gavaged 1000 od860 of onc nanonaps per 20 g or kept as controls ( n=5 per group ) . behaviour was monitored and mass was measured weekly . after 2 weeks , mice were sacrificed and organs were harvested . organs were immersed in formalin ( vwr # 16004 - 114 ) prior to sectioning and haematoxylin and eosin staining . a custom - built , reflection - mode single - element transducer pat system was used for high resolution scanning imaging . the movement of nanonaps in the digestive system was monitored after gavage of 100 ods of the indicated nanonaps in female balb / c mice . rate of peristaltis was determined by derivative analysis of region - of - interest intensity . for intestinal obstruction , 1214 g female cd-1 mice ( harlan ) the abdomen was opened with a 1 cm transverse incision near the stomach and the duodenum was ligated with nylon sutures ( vwr # 89219 - 096 ) . sham - treated mice had no duodenum ligation performed , but otherwise it was an identical procedure . the abdomen skin was sutured closed again and within a few hours , mice were administered a 100 od860 dose of onc nanonaps by gavage . 1 hour later , the mice were anesthetized and imaged with the vevo lazr system . for labelling , 37 mbq of cucl2 was diluted in 300 l of 0.1 m sodium acetate ( ph 5.5 ) and added to 400 od860 onc nanonaps for 30 minutes at 37 c . the cu - nanonaps were purified by centrifugal filtration and re - suspended in 500 l of pbs for further use . for in vitro stability , one od860 of cu - nanonaps was re - suspended in 1 ml of sgf or sif and incubated at 37 c with stirring . portions of the mixture ( 50 l ) were sampled at different time points and washed by centrifugal filtration for analysis . pet scans were performed using an inveon micropet / microct rodent model scanner ( siemens ) . after overnight fasting , each balb / c mouse was gavaged ~7.4 mbq of cu - nanonaps ( 100 od860 ) . | overviewthere is a need for safer and improved methods for non - invasive imaging of the gastrointestinal tract .
modalities based on x - ray radiation , magnetic resonance and ultrasound suffer from limitations with respect to safety , accessibility or lack of adequate contrast .
functional intestinal imaging of dynamic gut processes has not been practical using existing approaches . here ,
we report the development of a family of nanoparticles that can withstand the harsh conditions of the stomach and intestine , avoid systemic absorption , and give rise to good optical contrast for photoacoustic imaging .
the hydrophobicity of naphthalocyanine dyes was exploited to generate purified ~20 nm frozen micelles , which we call nanonaps , with tunable and large near - infrared absorption values ( > 1000 ) .
unlike conventional chromophores , nanonaps exhibited non - shifting spectra at ultrahigh optical densities and , following oral administration in mice , passed safely through the gastrointestinal tract .
non - invasive , non - ionizing photoacoustic techniques were used to visualize nanonap intestinal distribution with low background and remarkable resolution with 0.5 cm depth , and enabled real - time intestinal functional imaging with ultrasound co - registration .
positron emission tomography following seamless nanonap radiolabelling allowed complementary whole body imaging . |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.