id
large_string | text
large_string | added
large_string | created
large_string | source
large_string | metadata
dict |
|---|---|---|---|---|---|
US-73554847-A | Dye pigment
Patented Jan. 3, 1950 DYE PIGDIENT Warren B. Blumenthal, Niagara Falls,N. Y., as-
signor, by mesne assignments, to National Lead Company, New York, N. Y.,a corporation of New Jersey No Drawing. Application March 18, 1947,Serial No. 735,548
4 Claims. (Cl. 260-429) The present invention relates to the preparationof pigments from basic dyestuffs and particularly combinations of suchdyestuffs with zirconia hydrosols and hydrogels.
Pigments derived from dyes are usually thought of as inorganic materialscarrying a dyestuff. However, basic dyes are precipitated from aqueoussolution by acids, and pigment products may be prepared for suchsolutions by the organic acid, tannic acid; the usual precipitants inaddition to tannic acid are complex phospho acids such asphosphotungstic acids and phosphomolybdic acid. These threeprecipitating agents find wide use in the preparation from solutions ofbasic dyes of pigments of high quality and utility. However, the tannicacid pigments are relatively poor imtheir quality of fastness to light,while the other pigments are relatively expensive by reason of the highcost of the rarer metals, particularly tungsten.
The present invention provides new and novel pigments of basic dyes anda method of precipitating such dyes from solution.
In accordance with the present invention, color compositions ofexcellent pigment properties can be prepared at moderate cost by thecontrolled interaction in aqueous solution of a basic dye with ahydrogel of zirconia in an environment rendering the latterelectronegatively charged; Under such conditions, the basic dyestuficombines with the electronegatively charged zirconeate micelles to forma water-insoluble pigment of a large proportion of dye, pigments of hightinctorial strength, soft texture and brilliant hues. The pigments ofthe present invention are particularly suitable for use in printing inksas they print with an unusually intense and brilliant tone.
The zirconia hydrogelis formed as a waterinsoluble hydrous oxide withsuitable alkali, such as ammonia or caustic, or as a phosphate withalkaline phosphate, pyrophosphate or metaphosphate and the environmentof the solution changed so that the. hydrous zirconia hydrogel acquiresan electronegative charge. This is effected by adding suificient of ananion of a particular type, such as tartaric acid, to impart the desiredelectronegative character to the zirconia hydrogel. In general, the pHof the solution should be in the neighborhood of pH5 and within therange pH 3.5 to pH 6.5.
In accordance with the principles of the present invention, it has beendiscovered that when a water-soluble zirconium salt, such as theoxychloride, is precipitated as an hydroxide. hydrated 1 oxide orhydrous oxide, whatever its condition may be, a basic dye will reactionically therewith and when the charge upon the hydrogel of zirconia ischanged from positive to negative, will form an insoluble pigment. Thiscondition of the hydrogel can be determined microscopically in acataphoretlc cell provided with oppositely charged plates or electrodesand is apparent when the hydrogel migrates to the positive plate.
The normally positively charged hydrogel of hydrous zirconia is changedto a negatively charged hydrous zirconia in the presence of certainacidic materials. Thus, the precipitated zirconia is present in thehydrous condition, 1. e., in combination. with an undetermined amount ofwater molecules as, for instance, ZrO(OH) a-nHzO. When an organic acidsuch as a tartaric acid is added to such solution in an amountinsuiiicient to dissolve the zirconia, the hydrous zirconia isnegatively charged due to displacement of a molecul of water accordingto the following equation where HA represents an acid capable ofchanging the charge:
This change of charge is readily followed by examination in a cell wherethe phenomenon of cataphoresis will be readily apparent. Whatever theexact mechanism may be, there is a selective combination by the hydrouszirconia with the anions resulting in an ultimate change of charge ofthe zirconia.
Basic dyes being considered as a positively I charged ion of highmolecular weight combined with a negative acid ion, the basic dye can beprecipitated by reaction with the negatively charged hydrous zirconiaobtained as above, with almost instantaneous precipitation of a pigment.This reaction is then as follows:
Example I Dissolve 18.17 $111.01 ZrOC1z.8H2O in cold water, then bringto a volume of 90 cc. at 25 C. While stirring vigorously add 25%solution of NH4OH until a pH of 7.0 has been attained. At this point allthe zirconium has been precipitated. Stir minutes, filter theprecipitate and wash with cold water until the wash eilluent has only aslight chloride content. The precipitate is ZrO(OH)z.2HzO and will bereferred to hereafter as zirconia hydrate."
Disperse the zirconia hydrate pulp in cold water, bringing to a volume01' 200 cc. and a temperature of 25 C. While stirring this suspension,run in slowly a solution containing 5.69 gm. Crystal Violet in 100 cc.water at 25 C. Then run in slowly 200 cc. of a solution containing 6.67
gm. citric acid and enough sodium hydroxide to neutralize the solution(-pH'7.0) Stir the slurry 10 minutes. The pH should be 5.0 Filter, washwith two 250 cc. portions of cold water. Dry the pulp at 550 C. A strongviolet pigment is ob- 'tained.
Example I] Dissolve 74.1 gm. of NMHPO4.12H2O in 2000 cc. water at 25 C.Add 15.0 gm. Methyl Violet dissolved in 300 cc. water, then add slowly400 cc. of a solution containing 50.0 gm. of ZrOClz.8H2O. As theZrOC12.8H2O solution is running in, add simultaneously a solution ofNaOH in a thin, continuous stream at such a rateas to maintain a pH of7.0 throughout the addition of the ZIOC12.8H2O. Then add HCl until a pHof 5.5 is obtained. Stir the slurry 10 minutes, filter it, wash withthree 250 cc. portions of cold water and then dry at 55 C. A strongviolet pigment is obtained.
Example III Prepare a dispersion of washed zirconia hydrate as inExample I and bring to a volume of 400 cc. at 25 C. Add slowly thereto160 cc. of a solution which contains 16.0 gm. salicylic acid and enoughsodium hydroxide to dissolve the salicylic acid and yield a pH of8.0-10.0. Adjust the pH of the slurry to 5.0 with HCl, then add slowly asolution of 11.2 gm. Methyl Violet in 225, cc. water at 25 C. Stir 10minutes, filter, wash with two 250 cc. portions of cold water and dry at55 C. A strong violet pigment is obtained, with soft texture and goodprinting properties.
Example IV Prepare an aqueous dispersion of washed zirconia hydrate asin Example I and adjust the volume to 400 cc. at 25 C. Pour into thedispersion 32 cc. of an aqueous solution of sodium salicyl-atecontaining 16.0 gm. salicylic acid. Adjust the pH of the suspension to4.5 with'I-ICl, then add slowly a solution of 11.2 gm. Rhodamine B in225 cc. water. Hold the pH of the reacting mixture at 4.5 withhydrochloric acid while the Rhodamine B is being added. When all is in,lower the pH to 4.0 with HCl. Approximately 99.98% of the dye isprecipitated under these conditions. Filter off the precipitate, andwash it with two 250 cc. portions of cold water and dry at 55 C. Astrong cerise pigment is obtained of good quality for printing inks.
Example V Table I gs? Pro rtion Dye Used Anion Used Precipie mad notPre- Phgse clpitaied Per cent Per cent Aurammc salicylate.. 43.9 0.5Bismarck Brown citrate 36.8 0.1 0.. sallcylate. 66.8 2.6 Crystal Violetcitrate 39.5 0.2 22 N zgIg 31a 4 .3 35 3 3% 4 cipitate is a strong,brick red pigment which can be used to prepare a brilliant printing ink01 very good iastness to light.
Example VI Dissolve 18.17 gm. ZrOClz.2H-:O in cc. water at 25 C. andwhile stirring vigorously add NHlOH until the pH is 3.0. Adjust to avolume of 400 cc. at 25 C. Add slowly 32 cc. or a solution of sodium.salicylate containing 16.0 g-m. sa1icylicacid, then add slowly 11.2 gm.Methyl Violet as a 5% aqueous solution. Adjust the pH to 5.0 with HCland stir 10 minutes. Filter on the precipitate, wash with two 250 cc.portions of cold water and dry at 55' C. A brilliant violet pigment isobtained.
A series of experiments were run to determine the relative amount or thedye precipitated by the hydrous zirconia precipitate, the charge 01'which had been changed from positive to negative, and the dye content ofthe solid precipitated phase determined with results set forth in TableI.
From the above table it will be noted that the basic dyes containingtertiary amine type residues are precipitated with somewhat morethoroughness than either secondary amine or primary amine types, CrystalViolet, for instance, being completely precipitated while Bismarck Brownremains unprecipitated to the extent of about 2.5% under the influenceor salicylate ion in both instances.
The possibility that an anion will induce a cataphoretic effect upon thehydrous zirconia must be determined empirically in the case of.
any anion. It has been found that the following anions are effective;salicylate, benzoate, blchromate, citrate, glycollate, lactate, malate,dihydrogen phosphate, tartrate, mucate and others, while no efiectiveaction is obtained with chloride, formate, acetate, B-hydroxybutrate,monochloracetate, oxalate, propionate, fluoride and sulfate, andothers.'
What is claimed is:
1. The method of producing a pigment which comprises reacting a basicdye in an aqueous solution within the pH range pH 3.5 to 6.5 with ahydrous zirconia hydrogel, the usual positive charge of which has beenchanged to a negative charge by selective combination of an anion whichinduces cataphoretic movement of the re-- sulting negative micelle tothe positive electrode of a cataphoretic cell.
2. The method of producing a pigment which comprises reacting a basicdye in an aqueous solution having a. pH in the neighborhood of pH 5 witha hydrous zirconia hydrogel, the usual positive charge of which has beenchanged to a negative charge by selective combination of an anion whichinduces cataphoretic movement of the re- 5 suiting negative micelle tothe positive electrode of a cataphoretic cell.
3. The method of producing a pigment which 1 comprises reacting a basicdye in an aqueous solution within the pH range pH 3.5 to 6.5 with ahydrous zirconia hydrogel, the usual positive charge of which has beenchanged to a negative charge by salicylic acid.
4. The method of producing a pigment which comprises reacting a basicdye in an aqueous 10 solution within the pH range pH 3.5 to 6.5 with ahydrous zirconia hydrogel, the usual positive charge of which has beenchanged to a negative charge by citric acid.
WARREN B. mum-rm. 15
6 REFERENCES crmn The following references are of record in the file ofthis patent: I
um'rm STATES PATENTS OTHER REFERENCES Bancroft et al.: J. Phys. Chem,vol. 34 (1930) pa es 1767-1776.
1. THE METHOD OF PRODUCING A PIGMENT WHICH COMPRISES REACTING A BASICDYE IN AN AQUEOUS SOLUTION WITHIN THE PH RANGE PH 3.5 TO 6.5 WITH AHYDROUS ZIRCONIA HYDROGEL, THE USUAL POSITIVE CHARGE OF WHICH HAS BEENCHANGED TO A NEGATIVE CHARGE BY SELECTIVE COMBINATION OF AN ANION WHICHINDUCES CATAPHORETIC MOVEMENT OF THE RESULTING NEGATIVE MICELLE TO THEPOSITIVE ELECTRODE OF A CATAPHORETIC CELL. | 2024-03-22 | 1947-03-18 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1950-01-03"
} |
US-4224893-A | Transmission for adjustable sashes in door-or window frames
ABSTRACT
One stile of the sash in a door or window frame has an elongated channel for an elongated trough-shaped gear case rotatably receiving a first gear in mesh with the toothed rack of a reciprocable carrier in the gear case. A bifurcated end portion of the carrier mounts a second gear which meshes with a fixed rack of the gear case and with an elongated rack which is slidable along and overlies an open side of the gear case. The first gear can be rotated by a handle to move the carrier whereby the second gear rolls along the fixed rack and causes the elongated rack to perform a movement greater than the carrier. The elongated rack is coupled to motion receiving bars in the channel of the stile.
BACKGROUND OF THE INVENTION
The invention relates to transmissions in general, and more particularlyto improvements in transmissions which can be utilized with advantage inwindows and/or doors, for example, in windows or doors employing sasheswhich are pivotable about pairs of mutually inclined axes.
Commonly owned German Utility Model No. 88 14 754.1 (published Feb. 16,1989) discloses a transmission in a housing which occupies a rathersubstantial amount of space so that it cannot be readily installed in astile of a standard door- or window sash. Such stiles are normallymass-produced in extruding machines. In order to install a housing and atransmission of the type disclosed in the German Utility Model in astandard stile, it is necessary to provide in the deepmost portion of achannel in the stile a separately machined groove to thus provide roomfor certain motion receiving parts which are coupled to or are otherwiseactuatable by the transmission. The housing confines a pinion which canbe rotated by a handle to shift a toothed rack which, in turn, ismounted to actuate the aforementioned motion receiving parts.
U.S. Pat. No. 3,994,093 granted Nov. 30, 1976 to Meyer et al. disclosesa window with a sash which is installed to perform pivotal movementsabout two mutually inclined axes, namely about a horizontal axisadjacent the lower rail of the sash or about a vertical axis adjacentone stile of the sash. As a rule, the handle which must be actuated tolock or pivot a sash of the just outlined character is mounted forangular movement through an angle of 180°. The sash is locked in one endposition of the handle, the sash is pivotable about one of the axesafter the handle is moved from the one end position through an angle of90°, and the sash can be pivoted about the other axis upon movement ofthe handle to the other end position. The disclosure of the patent toMeyer et al. is incorporated herein by reference.
The extent of movement of the toothed rack which receives motion fromthe pinion of a conventional transmission for use in window or doorsashes depends upon the diameter of the pinion. Therefore, if the pinionis to be directly rotated by a handle, a stile of a door or window sashmust afford sufficient room for installation of a toothed rack and apinion having a diameter which suffices to move the rack back and forththrough distances of required length, i.e., to shift the motionreceiving member or members to an extent which is necessary to lock thesash, to prepare the sash for pivotal movement about one of the twoaxes, or to prepare the sash for pivotal movement about the other axis.
OBJECTS OF THE INVENTION
An object of the invention is to provide a compact transmission whichcan be installed in existing sashes or in new sashes having standarddimensions.
Another object of the invention is to provide a transmission which canbe installed in an existing sash without necessitating any modificationsof the component parts of such sash.
A further object of the invention is to provide a transmission which canemploy a small-diameter pinion but is still capable of shifting one ormore motion receiving parts through considerable distances.
An additional object of the invention is to provide a novel and improvedgear transmission which employs a plurality of toothed racks andpinions.
Still another object of the invention is to provide a novel and improvedcombination of toothed racks and pinions for use in a transmission,particularly in a transmission which can be installed in a door orwindow sash.
A further object of the invention is to provide a door or window sashwhich embodies a transmission of the above outlined character.
Another object of the invention is to provide a door or window whichembodies a sash with a transmission of the above outlined character.
An additional object of the invention is to provide the above outlinedtransmission with novel and improved means for guiding its moving partsin a sash and/or in a gear case.
Still another object of the invention is to provide a novel and improvedgear case for use in the above outlined gear transmission.
A further object of the invention is to provide the transmission withnovel and improved means for increasing the extent of movability of theoutput element of the transmission.
Another object of the invention is to provide the transmission withnovel and improved means for increasing the extent of movability of theoutput element of the transmission without contributing to the bulk ofthe transmission.
An additional object of the invention is to provide a novel and improvedmethod of increasing the extent of movability of the output element of agear transmission which employs pinions and toothed racks.
SUMMARY OF THE INVENTION
The invention is embodied in a transmission which can be utilized withparticular advantage for moving a door sash or a window sash relative toa door or window frame. The improved transmission comprises a supportwhich can constitute a gear case and is receivable in a sash, anelongated carrier at the support (for example, within the confines ofthe support), means for moving the carrier longitudinally relative tothe support, a first gear which is rotatably mounted on the carrier andmates with a first toothed rack which is provided on the support and ispreferably at least substantially parallel to the elongated carrier, anda second toothed rack which mates with and is movable (preferably in atleast substantial parallelism with the elongated carrier) in response torotation of the first gear as a result of longitudinal movement of thecarrier, i.e., as a result of rolling of the first gear along the firstrack.
The carrier can include or can constitute a third toothed rack, and themoving means can comprise a second gear which is rotatably journalled inthe support and mates with the third rack. The moving means can furthercomprise a handle which is arranged to be carried by the sash and hasmeans for rotating the second gear.
At least one reciprocable motion receiving element can be received inthe sash and is then coupled to and receives motion from the secondrack.
The first toothed rack can be rigid (e.g., of one piece) with thesupport. The latter can comprise a plurality of elongated walls and alongitudinally extending groove provided in at least one of the wallsand serving to receive a tongue of the sash. Such walls can include twosidewalls and a third wall. The groove is provided in one of thesidewalls and the third wall can be moved to a position adjacent abottom wall in an elongated channel of the sash.
The carrier can include or constitute an elongated pusher having aforked end portion with two prongs, and the first gear can be disposedbetween and can be rotatably journalled in the prongs. The third rackcan form part of the pusher.
The second rack can have a substantially U-shaped cross-sectionaloutline and can overlie an open side of the support. The support and thesecond rack can be provided with cooperating first and second guidemeans which confine the second rack to reciprocatory movements relativeto the support. The guide means can comprise at least one elongatedtrack in the support and at least one follower which is provided on thesecond rack and engages the at least one track. The support and/or thesecond rack can comprise a plurality of elongated sections. For example,at least one of these parts can be assembled of two sections which areor which can be mirror images of each other.
The second gear can be provided with a polygonal (or any otherwiseconfigurated non-circular) socket which registers with an opening of thesash, and the moving means can further comprise the aforementionedhandle which is then provided with a polygonal working end insertablethrough the opening and into the socket to rotate the second gear. Thesecond gear can be installed in a substantially cylindrical recess ofthe support. The diameter of the recess can approximate the outsidediameter of the second gear and the latter can comprise at least oneaxial extension having an outer diameter which approximates the rootdiameter of the second gear and is journalled in the support.
The carrier and the second rack can be provided with cooperating guidemeans which permit longitudinal movements of the second rack and thecarrier relative to each other. It is further possible to providecooperating guide means on the support and on the carrier so as topermit longitudinal movements of the carrier relative to the support.
The novel features which are considered as characteristic of theinvention are set forth in particular in the appended claims. Theimproved transmission itself, however, both as to its construction andits mode of operation, together with additional features and advantagesthereof, will be best understood upon perusal of the following detaileddescription of certain presently preferred specific embodiments withreference to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a longitudinal sectional view of a transmission which embodiesone form of the invention, with the handle removed;
FIG. 2 is a similar sectional view and further shows the distances whichare covered by the second toothed rack in response to rotation of thesecond gear;
FIG. 3 is an enlarged view of a detail in the transmission of FIG. 1;
FIG. 4 is a transverse sectional view as seen in the direction of arrowsfrom the line IV--IV in FIG. 3;
FIG. 5 is an enlarged view of another detail in the transmission of FIG.1;
FIG. 6 is a transverse sectional view as seen in the direction of arrowsfrom the line VI--VI in FIG. 5, and further shows a portion of a handlewhich can be utilized to rotate the second gear; and
FIG. 7 illustrates the transmission upon installation in a door orwindow sash, and further showing a portion of the door or window frame.
DESCRIPTION OF PREFERRED EMBODIMENTS
The transmission which is shown in the drawings comprises an elongatednarrow support 1 which constitutes a gear case or housing and has asubstantially U-shaped cross-sectional outline (see FIG. 4). Thissupport is assembled of two elongated sections 1A, 1B and includes twospaced apart sidewalls 1a, 1b and a third wall 1c between the twosidewalls. The outer sides of the sidewalls 1a and 1b are respectivelyprovided with longitudinally extending grooves 2 and 3 for reception oftongues 6 (FIG. 6) forming part of a stile 5 which, in turn, forms partof a door or window sash. The stile 5 has a longitudinally extendingchannel 4 adjacent a bottom wall 19. When the support 1 is properlyinstalled in the channel 4, its third wall 1c is adjacent the bottomwall 19 (this can be seen in FIG. 6).
The support 1 accommodates an elongated carrier 11 having a first endportion provided with or constituting a toothed rack 10a and a secondend portion 12 with two prongs 25 (FIG. 4) for the shaft 26 of a gear orpinion 13. The latter mates (a) with a toothed rack 14, which is of onepiece with the support 1, and (b) with a toothed rack 15 which can besaid to constitute the output element of the transmission and overliesan open side of the support 1. As can be seen in FIG. 4, the rack 15 isalso assembled of two elongated sections 15A, 15B which can but need notbe exact mirror images of each other and each of which has an inwardlyextending follower 18 received in a longitudinally extending track 2a,3a provided in the respective sidewall 1a or 1b of the support 1. Therack 15 has a substantially U-shaped cross-sectional outline. Thefollowers 18 of the rack 15 and the tracks 2a, 3a of the support 1respectively constitute cooperating first and second guide means whichconfine the rack 15 to reciprocatory movements in the longitudinaldirection of the support 1, i.e., in the longitudinal direction of thecarrier 11 and its rack 10a as well as in the longitudinal direction ofthe rack 14.
The carrier 11 and the rack 15 preferably also comprise cooperatingguide means for confining these parts to reciprocatory movementsrelative to each other in the longitudinal direction of the carrier. Theaforementioned prongs 25 (FIG. 4) can constitute one component and theadjacent internal surfaces of the rack 15 can constitute the othercomponent of such guide means.
The means for moving the carrier 11 longitudinally of the support 1 andracks 14, 15 comprises the aforementioned rack 10a on the carrier 11, apinion or gear 8 which is rotatably journalled in the support 1 andmates with the rack 10a, and a preferably detachable handle or actuator7 (FIG. 6) having a non-circular (e.g., square) working end 10 which canbe caused to pass through an opening 22 of the stile 5 forming part of adoor or window sash and into a complementary socket 9 of the gear 8.
The outside diameter of the gear 8 is only slightly smaller than thediameter of a substantially cylindrical recess 1d of the support 1. Theend portions of the gear 8 have extensions 21 with an outer diameterapproximating the root diameter of the gear 8, and these extensions 21are rotatably journalled in the support 1. Such journalling of the gear8 ensures that the gear is not likely to be tilted and/or to jam in thesupport 1 when the socket 9 receives the working end 10 of the handle 7and the latter is rotated to move the carrier longitudinally of thesupport 1 and racks 14, 15. The support 1 is configurated in such a waythat its internal surfaces have suitably dimensioned recesses or socketsfor the extensions 21; thus, it is not necessary to provide any discreteparts for the express purpose of ensuring adequate mounting of the gear8 in the support 1. When the two sections 1A and 1B of the support 1 areproperly secured (e.g., welded or glued) to each other, the gear 8 isautomatically journalled between such sections.
The end portions of the rack 15 are provided with motion transmittingprojections 16, 17 which enter complementary holes in motion receivingbars 27, 28, respectively. Such bars are installed in the channel 4 ofthe stile 5 forming part of a door or window sash (see FIG. 7) which isadjacent a door or window frame F (also shown in FIG. 7) when the sashis maintained in closed position.
The profile of the stile 5 which is shown in FIG. 6 can be said to be astandard profile, and this stile can readily receive the improvedtransmission without any changes, i.e., without the provision of anyadditional grooves or recesses which are necessary to permit theinstallation of a transmission of the type described and shown in theaforementioned German Utility Model. FIGS. 4 and 6 further show that therack 15 need not extend all the way to the tongues 6 of the stile 5. Thefollowers 18 are spaced apart from the tongues 6.
The mode of operation of the improved transmission will be describedwith reference to FIG. 2.
When the gear 13 assumes the neutral or median angular position of FIG.2, its axis is located in a plane B. The axis of the gear 8 is alwayslocated in a plane A which is parallel to and is spaced apart from theplane B. If the gear 8 is turned through 90° in a counterclockwisedirection, the teeth of this gear cooperate with the teeth of the rack10a to move the axis of the gear 13 into a plane B₂ through a distancex. If the gear 8 is rotated through 90° in a clockwise direction, asviewed in FIG. 2, the axis of the gear 13 is again moved through adistance x but in the opposite direction, namely into the plane B₁.Since the gear 13 rolls along and mates with the fixedly mounted rack 14during movement of the carrier 11 in response to rotation of the gear 8from the illustrated position to the one or the other end position, thegear 13 causes the projection 17 of the rack 15 (output element) tocover a distance x+y from a neutral position C to a position C₁ or C₂,depending on the direction of rotation of the gears 8 and 13. Thus, therack 15, and hence its projections 16, 17 (as well as the motionreceiving bars 27, 28) will cover a distance x+y which is greater thanthe distance x. If the gear 13 were omitted and the rack 15 were to meshdirectly with the gear 8, the projection 17 would move only through adistance y from the plane C into the plane C₁ or C₂. The bars 27 and 28perform those movements which are necessary to lock the sash in closedposition, to prepare the sash for pivotal movement about a horizontalaxis, or to prepare the sash for pivotal movement about a vertical axis.The exact manner in which the sash is to be locked or prepared forpivoting about a horizontal or vertical axis forms no part of thepresent invention.
The opening 22 can be provided at the outer side or at the inner side ofthe stile 5.
An important advantage of the improved transmission is that the gears 8and 13 need not be maintained in direct mesh with each other. Instead,these gears are operatively connected to each other by the carrier 11whose end portion 12 mounts the gear 13 and whose rack 10a meshes withthe gear 8. Nearly the full width of the transmission can be utilized toinstall gears of substantial axial length. This enhances the stabilityof the gears and of the entire transmission and reduces the extent ofwear upon the teeth of such gears. Moreover, it is possible to installeach of these gears in an optimum position for engagement of the gear 8by the working end 10 of a handle 7 and for mating of the gear 13 withthe racks 14 and 15. Since each of the gears 8 and 13 can have aconsiderable axial length, the diameters of these gears can be small sothat the transverse dimensions of the support 1, rack 15 andparticularly the stile 5 need not be increased for the express purposeof installing gears whose stability suffices to ensure that thetransmission will stand long periods of frequent use.
Another important advantage of the improved transmission is that theextent of movability of the projections 16, 17 and motion receiving bars27, 28 longitudinally of the racks 14, 15 and support 1 can be variedwithin a wide range as well as that the initial or neutral positions ofthe projections 16 and 17 can be selected practically at will withoutnecessitating the utilization of a specially designed sash.
A further important advantage of the improved transmission is that allof its reciprocable parts (such as the carrier 11 and its rack 10a, therack 14 and the rack 15) can be readily confined to linear movements ina simple and space-saving manner. The extent of linear movability of therack 15 can greatly exceed the extent of linear movability of thecarrier 11 because the latter causes the gear 13 to rotate about theaxis of the shaft 26 as well as to roll along (i.e., to perform atranslatory movement relative to) the rack 14 so that the extent oflongitudinal movements of the rack 15 can considerably exceed the extentof longitudinal movements of the carrier.
Without further analysis, the foregoing will so fully reveal the gist ofthe present invention that others can, by applying current knowledge,readily adapt it for various applications without omitting featuresthat, from the standpoint of prior art, fairly constitute essentialcharacteristics of the generic and specific aspects of my contributionto the art and, therefore, such adaptations should and are intended tobe comprehended within the meaning and range of equivalence of theappended claims.
I claim:
1. A transmission, particularly for moving a sash relative to aframe, comprising a support receivable in a sash; an elongated carriermovably connected to said support; means for moving said carrierlongitudinally relative to said support; a gear rotatably mounted onsaid carrier and mating with a first toothed rack provided on saidsupport; and a second toothed rack, mating with said gear, being movablyconnected to said support and being movable in response to rotation ofsaid gear as a result of longitudinal movement of said carrier; andwherein said carrier includes a third toothed rack and said moving meanscomprises a second gear rotatably journalled in said support and matingwith said third rack.
2. The transmission of claim 1, wherein saidmoving means further comprises a handle arranged to be carried by thesash and having means for rotating said second gear.
3. The transmissionof claim 1, further comprising at least one reciprocable motionreceiving element arranged to be received in the sash and being coupledto said second toothed rack.
4. The transmission of claim 1, whereinsaid first toothed rack is rigid with said support.
5. The transmissionof claim 1, wherein said support includes an elongated case having aplurality of elongated walls and a longitudinally extending grooveprovided in at least one of said walls and arranged to receive a tongueof the sash.
6. The transmission of claim 5, wherein said walls includetwo sidewalls and a third wall, said groove being provided in one ofsaid sidewalls and said third wall being movable to a position adjacenta bottom wall in an elongated channel of the sash.
7. The transmissionof claim 1, wherein said carrier includes an elongated pusher having aforked portion with two prongs, said gear being disposed between andbeing rotatably journalled in said prongs.
8. The transmission of claim7, wherein said moving means comprises a toothed rack on said pusher. 9.The transmission of claim 1, wherein said support has an open side andsaid second toothed rack has a substantially U-shaped cross-sectionaloutline and overlies the open side of said support, said support andsaid second rack having cooperating first and second guide meansconfining said second rack to reciprocatory movements relative to saidsupport.
10. The transmission of claim 9, wherein said guide meanscomprises at least one elongated track in said support and at least onefollower provided on said second rack and engaging said at least onetrack.
11. The transmission of claim 9, wherein at least one of saidsupport and said second rack comprises a plurality of elongatedsections.
12. The transmission of claim 1, wherein said moving meanscomprises a second gear rotatably mounted in said support and matingwith a toothed rack of said carrier, said second gear having a polygonalsocket arranged to register with an opening of the sash and said movingmeans further comprising a handle having a polygonal working endinsertable through the opening and into said socket to rotate saidsecond gear.
13. The transmission of claim 1, wherein said moving meanscomprises a second gear rotatably installed in a substantiallycylindrical recess of said support and mating with a toothed rack ofsaid carrier.
14. The transmission of claim 13, wherein said second gearhas an outside diameter and a root diameter, said recess having adiameter approximating said outside diameter and said second gearcomprising at least one axial extension having an outer diameterapproximating said root diameter and being journalled in said support.15. The transmission of claim 1, wherein said carrier and said secondrack comprise cooperating guide means permitting longitudinal movementsof said second rack and said carrier relative to each other.
16. Thetransmission of claim 1, wherein said support and said carrier comprisecooperating guide means permitting longitudinal movements of saidcarrier relative to said support. | 2024-03-22 | 1993-04-02 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1995-02-14"
} |
US-11899598-A | Strip sewing apparatus and method
ABSTRACT
A sewing machine for attaching tapes to a web includes a web feed station, a sewing station and a transfer mechanism to transfer the web from the sewing station to a collection zone. The sewing station includes a sewing head that moves across the web to sew the tape. The tape has hooks periodically spaced along the tape and movement of the sewing head is initiated by sensing one of the hooks at a predetermined locator. Successive tapes may then be sewn with the hooks aligned.
FIELD OF THE INVENTION
This invention relates generally to a method and apparatus for attachingfittings at known locations to a large sheet or web.
BACKGROUND OF THE INVENTION
It is well known to suspend a cover over a crop to prevent damage byfrost, to control sunlight or for other reasons. These coverings orcurtains may be in the form of long sheets, or webs, which are suspendedby rows of hooks from suspension wires. The hooks in each row areattached to a continuous band, and a series of bands are sewn in spacedparallel relationship to an underlying sheet material which forms thebody of the cover.
At present these covers may be made by sewing the bands in place by handand subsequently inserting the suspension hooks, a laborious task whenproducing a cover, or series of covers, for thousands of square feet offields. As a suspension wire is eventually to pass through a series ofhooks, each band must be sewn in a straight line. Moreover since thecurtain cannot be held taught when deployed it will inevitably sag andform troughs between adjacent hooks. If the cover is to hang evenly andstraight without twists or uneven stress, the spacing between successivehooks must be uniform and the hooks in adjacent rows must be aligned ina direction normal to the bands. Thus it is advantageous to be able tofasten the hooks to the cover not only quickly, so that covers ofreasonable size can be made efficiently, but also with the requisitealignment.
It is therefore an object of the present invention to provide anapparatus and method in which the above desideratum are attained.
SUMMARY OF THE INVENTION
In the present invention sewing a machine apparatus to sew a tape havingattachments located periodically therealong to a web, said apparatuscomprising a web feed station to feed a web of material along with apredetermined path, a sewing station having a sewing head and a drive tomove said sewing head in a direction transverse to said predeterminedpath, a tape dispenser associated with said sewing head to deliver atape to said sewing head for attachment to said web, a transfermechanism to transfer said web from said sewing station to a collectionzone and a control to control operation of said drive, said controlincluding a sensor disposed between said tape dispenser and said sewinghead to sense the passage of an attachment and initiate operation ofsaid drive.
According to a further aspect of the present invention there is provideda sewing apparatus for sewing a tape to a web of material, saidapparatus including a web feed station to feed a web of material along apredetermined path, a sewing station including a sewing head to attachsaid tape to said web and a drive to move said head transverse to saidpredetermined path, a transfer station to move said web from said sewingstation to a collection zone, said web feed station including a firstsupport for a first roll of web material and a second support for asecond roll of web material, each of said rolls delivering a respectivestrip of web material with said supports arranged to deliver said webmaterial to said sewing station in side by side relationship, saidsewing head traversing each of said strips to secure said tape theretoand form a unitary web.
According to a still further aspect there is provided a sewing apparatusto sew a tape to a web, said apparatus comprising a web feed station tofeed said web of material along a predetermined path, a sewing stationhaving a sewing head and a drive to move said head in a directiontransverse to said predetermined path, a tape dispenser associated withsaid sewing head to deliver a tape to said sewing head for attachment tosaid web, and a transfer mechanism to transfer said web from said sewingstation to a collection zone, said sewing head carrying a supplementarymechanism to perform supplementary operations on said web as said headtraverses said web.
In an additional aspect there is provided a sewing apparatus to sew atape to a web, said apparatus including a web feed station to feed a webof material along a predetermined path, a sewing station having a sewinghead and a drive to move said sewing head in a direction transverse tosaid predefined path, a tape dispenser to deliver a tape to said sewinghead to attachment to said web, and a transfer mechanism to transfersaid web from said sewing station to a collection zone, said sewingstation including a pair of rails extending transversely to saidpredetermined path, a carriage supported on said rails by a pair ofwheel assemblies, and a pedestal to mount said sewing head, said drivebeing operable to move said carriage along said rails to sew said tapeto said web.
As a further aspect there is provided sewing apparatus for sewing a tapehaving attachments located periodically therealong to a web of material,said apparatus including a web feed station to feed a web of materialalong a predetermined path, a sewing station including a sewing head toattach said tape to said web and a drive to move said head transverse tosaid predetermined path, and a transfer station to move said web fromsaid sewing station to a collection station, said collection stationincluding a roll forming device to receive one end of said web and formit to a roll. In a still further aspect there is provided a method ofsecuring a tape having hooks disposed periodically along said tape to aweb, said method comprising the steps of securing said hooks to saidtape, advancing said tape with said hooks through a sewing head disposedadjacent said web, and advancing said sewing head across said web whileperforming a sewing operation between said tape and web to secure saidtape to said web.
DESCRIPTION OF THE DRAWINGS
Embodiments of the present invention will now be described by way ofexample only with reference to the accompanying drawings in which:
FIG. 1 is a general arrangement an embodiment of a machine for attachinghooks to a cover.
FIG. 2 is a side elevation of the machine shown in FIG. 1.
FIG. 3 is an end view of a sewing head used in the machine of FIG. 1.
FIG. 4 is a view on the line 4--4.
FIG. 5 is a side view in the direction of arrow V of FIG. 3.
FIG. 6 is a schematic illustration of the sequence of operationsperformed by the machine of FIG. 1.
FIG. 7 is a perspective view of a further embodiment of the machineshown in FIG. 1.
FIG. 8 is a front elevation of the machine shown in FIG. 7.
FIG. 9 is a rear view of a portion of the machine shown in FIG. 7.
FIG. 10 is an end view of the portion of the machine shown in FIG. 9.
FIG. 11 is a side elevation of a further portion of the machine shown inFIG. 7.
FIG. 12 is a front view in the direction of arrow A of FIG. 11.
FIG. 13 is an enlarged view in the direction of arrow B of FIG. 12.
FIG. 14 is a detailed view of components of the machine shown in FIG. 7.
FIG. 15 is a view on the line XV--XV of FIG. 14.
FIG. 16 is a perspective view of a collection station used with themachine of FIG. 7.
FIG. 17 is a side elevation of a further embodiment of machine.
A PREFERRED EMBODIMENT OF THE INVENTION
In the description which follows, like parts are marked throughout thespecification and the drawings with the same respective referencenumerals. The drawings are not necessarily to scale and in someinstances proportions may have been exaggerated in order more clearly todepict certain features of the invention.
Referring therefore to FIG. 1 a machine 10 attaches a tape 12 havinghooks 14 located at spaced intervals to a web 24. The curtain producedis indicated generally as 20 and may be used in combination with asupport structure as more fully shown in U.S. Pat. No. 5,581,954. Themachine 10 includes a web feed system 22 for dispensing a web 24 from aroll 38, a tape dispenser 18 and a sewing apparatus 26 which attaches atape 12 to the web 24.
Web feed system 22 has an in-feed, generally indicated as 39, having apair of parallel support rollers 32 mounted on a suitable stand 34 anddriven by a roller drive 36. The web 24 is constituted by a single stripof fabric wound into a roll indicated as 38 placed upon and betweenrollers 32 such that web 24 is unwound as rollers 32 are rotated. Web 24is entrained over a first fixed fabric support 40, a floating dancer 42,and then over a second fixed fabric support 44 before being delivered tosewing apparatus 26, more fully described below. Dancer 42 maintains anominal tension in the web 24 as it is dispensed. Having passed sewingapparatus 26, web 24 is transferred by a transfer station 45 to acollection zone 47.
Transfer station 49 moves the web across a support table 46 by a pullbar 51 whose operation is more fully described below. Primary andsecondary hold bars 48 and 50 are movable in the vertical direction bypneumatic cylinders 49 and 51. Cylinders 52,54 may be extended to forcethe bars 49,51 downward and clamp web 24 against table 46 to hold web 24stationary. Retraction of the cylinders 48,50 moves the bars upward torelease web 24 and allow it to slide along the table 46.
Similarly, pull bar 52 is provided with a pair of pneumatic cylinders 56by which it can be driven downwardly to engage web 24, or upwardly torelease it. Pull bar 52 is connected to a pair of lead screws 53 thatare supported above the table 46 and conjointly rotatable by motor 55.As the screws rotate, the bar 52 is moved along the table either towardthe in-feed station or away from it depending on the direction ofrotation of the screws. By coordinating the operation of the bars48,50,52 and the lead screws 53 the web 24 may be advanced in acontrolled manner along a predetermined path.
The sewing apparatus 26 is supported on a wheeled carriage 64 that maymove along rails 68 in a direction transverse to the feed of the web. Acarriage drive 66 operating on a toothed belt 67 secured to the carriage64 controls movement along the rails 68 from a home, or datum position,as indicated in solid lines in FIG. 1. A pedestal 70 and a pillar 72 arelocated on the front and rear portions of carriage 64 respectively formovement with the carriage 64. A cantilevered arm 74 extends forwardlyfrom pillar 72 and carries an upper sewing machine head assembly,indicated generally as 76 at the distal end. A lower sewing machine headassembly, indicated generally as 78 mounted on the pedestal 70 oppositethe assembly 76 so that they cooperate to perform a sewing operation onmaterial located between them. The upper and lower sewing machine headassemblies are industrial sewing machine mechanisms of suitable knownconstruction.
The lower assembly 78 has a plate 80 for supporting web 24 as it isdeployed from the roll 38. As will be noted, the bight bounded bycantilevered arm 74, pillar 72 and carriage 64 accommodates rollers 32and roll 38 such that as web 24 is paid out it can pass over platen 80and between sewing head assemblies 76 and 78.
Tape dispenser 18 is mounted to the distal end of cantilevered arm 74,and includes a tape reel 84, idlers 86,88 and an in-feed guide 90 asbest seen in FIG. 4. The idlers 86,88 and guide 90 are constructed topermit the hooks on the tape to pass between them and the tape laid flaton the web 24.
Referring to FIG. 3 in-feed guide 90 presents the tape to a cavity 92located centrally within a foot 93. The foot 93 has a pair of laterallyspaced holes 96 positioned on opposite edges of the tape 12, Needles94,98 reciprocate in respective holes relative to the foot 92 in knownmanner to sew a seam and attach a respective edge of pre-hooked tape 12to web 24. As shown in FIG. 3, the cavity 92 is of sufficient size topermit passage of hooks 14 folded flat against the tape 12 so that thetape complete with hooks may be sewn to the web.
The initial position of the carriage 64 is controlled by a sensing head100 shown in FIG. 5 and carried by sewing machine head assembly 76.Sensing head 100 includes a shoe 102 extending parallel to the platen 80with three infrared transducers 104 at spaced locations along the shoe102. Pickups 106 are mounted in the platen 80 in alignment withrespective ones of the transducers 104. The web 24 covers the pickups106 during transverse movement of platen 80 with the sewing station 26.Upon reaching an edge of the web, the pickups are exposed and controlmovement of the carriage as described below.
Referring again to FIG. 4, an optical sensor 108 is adjustably mountedto upper sewing head assembly 76, and is used to control the operationof carriage drive 66. As hooks 14 proceed from idler 88 to in-feed guide90 they extend outwardly from pre-hooked tape 12 sufficiently far toeclipse optical sensor 108, thus changing its output state. The changein state initiates operation of the motor and moves assembly 26 alongthe rails 68. The path length from sensor 108 to the needles 94 and 98is constant for a given web, as is the spacing of the hooks along thetape. Accordingly, the position of a hook relative to the needles 94,98and thus relative to the datum position of the sewing apparatus, isknown when the hook passes the sensor 108. By controlling thetranslation of the heads from the hook, a consistent placement of thefirst and subsequent hooks relative to the edge of the tape is obtained.The position of the sensor 108 may be adjusted so that the first hook isat the desired location relative to the edge of the tape.
The operation of machine 20 will now be described, assuming a web ofchosen width `W`, a desired hook pitch along the web of `P`, an initialhook inset distance of `D`, and a span S between adjacent parallel bandsof pre-hooked tape 12. As shown in FIG. 1, two bands *110 and *112 oftape 12 have already been sewn to web 24, which is stationary, beingheld in tension between second fixed fabric support 44 and one ofholders 48 or 50, as the case may be. Carriage 64 is in its home, ordatum position relative to the known position of one edge of web 24. Thesensing head 100 positions the needles 94,98 outboard of the edge of theweb 24 so that the central sensor 104 is uncovered. In this position theneedles 94,98 are free to reciprocate without engaging the web 24.
The operation is initiated by activating the sewing head, causing tape12 to be fed between upper and lower sewing head assemblies 76 and 78.Needles 94 and 98 reciprocate, merely sewing in tape 12. As can be seenin FIG. 1, a spring 114 is connected at one end to a stationary frameand at the opposite end to a barb 116 engaged in the tape 12. Spring 114applies tension to the tape 12 to advance it past the needles 94,98. Oneof hooks 14 passes sensor 108, initiating carriage drive 66 to drivecarriage 64 along the rails 68 and traverse to the web 24. As it does sopre-hooked tape 12 is sewn along both seams by needles 94,98 locatinghooks 14 in place.
Prior to operation, the location of the first hook at initial distance"D" is assured by adjusting the position of optical sensor 108 upward ordownward as desired. Given the known distance to the edge of web 24, thefixed pitch "P" of hooks 14 and the fixed geometry of the path length tobe traveled by tape 12, the setting of optical sensor 108 will yield arepeatable placement of the first hook in each successive row. When thefar edge of web 24 is approached the first sensor 104 is uncovered. Thecarriage 64 is decelerated and the sewing continues a short distanceuntil the intermediate sensor is uncovered. At that time, carriage 64 isstopped clear of web 24, sewing stops, and tape 12 is cut. The sensingof the edge of the web 24 by the head 100 is used to stop the needles94, 98 in a retracted position clear of the web 24. An encoder on thedrive to the needles indicates the retracted position and thereby allowsthe sewing heads to be returned to the opposite edge.
The web 24 is now ready to be advanced as shown in FIG. 6. Duringsewing, one of the bars 48,50 engages the web and inhibits movement ofthe web 24. A pair of bars are provided so that different pitches oftape placements may be accommodated without the risk of the bar 48,50engaging the hooks. Similarly, the pull bar 52 is engaged with the web24. When the sewing is complete, the bar 48,50 is raised as shown inFIG. 6b and pull bar 52 is advanced through span distance `S` to itsdestination, or furthest position away from secondary hold bar 50 byrotation of lead screws 53. As the contact between pull bar 52 and web24 is non-sliding and the contact between web 24 and surface 58 is oneof sliding contact, the advance of pull bar 52 necessarily causes acorresponding advance of web 24. If this advance causes weight member 42to rise sufficiently, upper limit switch 60 will activate feed rollerdrive 36 causing the web 24 to be dispensed. The drive 36 will continueto dispense the web 24 until the weight member 42 activates lower switch62. In this way, web 24 may be dispensed as it is moved across thetable. When pull bar 52 reaches its second end, or destination positionand stops, one of the hold bars 48,50 is lowered to engage web 24 innon-sliding contact, holding it in place. If a row of hooks 14 liesdirectly beneath primary hold bar 48 then it will not be lowered butrather secondary hold bar 50 will be used to engage web 24 as shown inFIG. 6c. With web 24 thus held, pull bar 52 can be raised and returnedto either its home or alternate home position. Again if a row of hooks14 lies in the home position, then pull bar 52 will be moved to thealternate home position before engaging web 24 thus avoiding crushingany hooks.
Once web 24 has advanced, carriage 64 is returned to its home positionas sensed by the intermediate sensor 104. While it is preferred toreturn carriage 64 to its home position after web 24 has advanced,carriage 64 could also be returned either before or during the advanceof web 24. Once carriage 64 has returned, the cycle may recommence. Withweb 24 held still, carriage 64 will stand stationary as tape 14 is fedbetween assemblies 76 and 78 until such time as optical sensor 108experiences a change of state from which it can be inferred that thefirst of hooks 14 is in the chosen position relative to web 24. It willthen repeat the operation described above.
Operation of the machine embodiment described in the manner describedwill sew parallel rows of hooks 14 to web 24 with known placement suchthat the hooks of adjacent rows will be in substantial alignment. Itwill be noted that web 24 is maintained in substantially uniform.Tension in the direction of advance under the influence of dancer 42between second fixed fabric support 44 and one of holders 48 or 50, orpull bar 52 throughout the cycle. Although each of hold bars 48 or 50 orpull bar 52 engages web 24 along a continuous line of contact, andyields, optimally, a modest uniform stress field in web 24, a number ofdiscrete contact pads, or multi-contact arrangement could also yield asubstantially uniform stress field. Further, while linear contact isindicated perpendicular to the direction of advance, the shape of thecontact need not traverse the web in a straight line, nor need the linebe perpendicular, provided web 24 remains evenly spread. Similarly, itwould not appear that table 46 need be flat, or continuous, providedthat suitable support is provided by presenting web 24 in a mannersuitable for mating with tape 12 and for permitting a fastening head,such as the combination of assemblies 76 and 78 to fasten hooks 14 inknown position to web 24. Equally so, while tensioning under a constantweight has been found simple and convenient, other web tensioningdevices may be employed.
In the case of primary and secondary hold bars 48 and 50, it is notnecessary to have two such hold bars to avoid crushing hooks. Forexample, primary hold bar 48 could be permitted to move to an alternatehome position just as pull bar 52 is already permitted to do. Further, apair of pull bars, or more as desired, without any hold bars, could beused provided that web 24 remains adequately spread for relativelyconsistent and accurate fastening.
The above embodiment has described the operation of sewing paralleltapes to a web dispensed from a single roll. However, as shown in FIGS.7-16 the apparatus may be adapted to handle multiple webs of materialand perform supplementary operations on the web as sewing is performed.
In the further embodiment shown in FIGS. 7-16 like reference numeralswill be used to denote like components with a suffix `a` added forclarity. The general arrangement of machine 10a is similar to that shownin FIGS. 1 to 6 with a web feed system 22a, tape dispenser 18a andsewing apparatus 26a. Web 24a is transferred by transfer station 45a toa collection zone 47a. To the extent that the embodiment of FIGS. 7-16is essentially identical to the embodiments of FIGS. 1-6, furtherdescription will not be provided.
Web feed station 22a includes a pair of rollers 32a supporting a firstroll 38a of web material to deliver a first strip of material to thetransfer table 46a as described above.
As can be seen in FIG. 8, second roll 120 is supported above and to oneside of the first roll 38a. The second roll 120 dispenses a second strip122 of material to the transfer table 46a by passing it over fixedfabric supports 40a, 44a and a respective dancer 42¹ a. Second roll 120is supported on a cantilevered roller assembly 124 pivotally connectedto a mast 126.
Roller assembly 124 includes a housing 125 that is laterally adjustableon a pair of rails 127. The housing 125 includes a motor 128 thatrotates a support shaft 129. A pair of clamps 130, 131 act between theshaft 129 and second roll 120 to locate it axially and cause it torotate with the shaft 129.
The rolls 38a, 120 are positioned so the adjacent edges overlap and thedegree of overlap may be adjusted by movement of the housing 125relative to rails 127. This may be achieved by a worm drive or servooperated chain drive as convenient. As shown in FIGS. 9 and 10, theposition of the edge of roll 38a is maintained by a guide plate 135.
Guide plate 135 is attached to an arm 136 that is slidably supported onthe leading edge of the table 46a so as to be laterally adjustable. Theguide plate is tear shaped to project in to the nip of the rolls 32a andmaintains the edge of the roll 38a in a preset location. Variations inthe width of the roll 38a are accommodated by the sensing head 100aassociated with the sewing head 26a so that the first hook 14 on thetape 12 remains accurately positioned. The overlap between the webs issensed by an optical sensor offset from the plate 135 and operating toadjust the lateral position to roll 120 via the housing 125.
The roller assembly 124 is located within the bight of arm 74a, pillar72a and carriage 64a to permit the sewing station to traverse both rolls38a, 120 as it moves along the rails 68a. The tape 12a is sewnsuccessively to the strips to join them in a side by side relationshipand form a unitary web. Movement along the rails 68a is facilitated bythe mounting of the carriage 64a as shown in FIG. 12. One pair of wheelsassociated with one of the rails 68a are directly mounted to thecarriage 64a but the other pair is mounted to a beam 140. The beam 140is pivotally connected to a pin 142 for movement about an axisperpendicular to the rail 68a. Any unevenness in the rails is thusaccommodated by relative movement between the beam 140 and carriage 64ato inhibit torsional loading of the carriage 64a, as it traverses theweb 24a to attach the tape 12a.
The movement of the sewing station 26a is utilized to performsupplementary operations on the web 24a as the tape is attached. Asshown in U.S. Pat. No. 5,581,954 certain applications of curtain requirea drainage aperture at periodic locations on the curtain. Theseapertures are located in a valley of a pitched roof and allow water todrain through the roof into a gutter. The sewing station 26a is adaptedto form these openings as the tape is sewn to the web 24.
As can be seen in FIGS. 7 and 13 a pneumatic cylinder assembly 150 ismounted on the sewing head assembly 76a. Cylinder assembly 150 includesa cylinder 152 and a piston 154 secured to piston rod 156. A cutterassembly 157 is mounted at the lower end of the piston rod 156 andincludes four blades 158 disposed at 90° to one another.
An aperture 160 is formed in the platen 80a in alignment with the cutterassembly 157. Extension of the piston 154 by admission of air throughport 162 forces the cutter assembly through the web 24a to form slits inthe web 24a. Of course alternative shapes of aperture could be formed inthe web as required or alternative operations could be undertaken.
The cylinder assembly 150 is secured to the sewing head assembly 76a bya bracket 164, which maintains a predetermined offset from needles 96a,98a. The offset in the direction of movement of the web 24a is selectedfor this particular application to be one half the spacing between thetapes 12a so that the apertures are centrally located between the tapes.The offset transverse to the direction of movement of web 24a is onehalf the spacing of the hooks on the tape 12a and the cylinder assemblyis activated by sensing the displacement of the sewing station 26a alongthe rails.
Accordingly, as the sewing station traverses the web 24a, the cylinderassembly is activated periodically to pierce the web. Of course, this isonly performed on those runs corresponding to a valley location on thecurtain and the operation of the cylinder is inhibited at other times.
As shown in FIG. 14, the clamps 48a and pull bars 52a are modified tofacilitate different spacing of hooks 14a.
The arrangement of bars 48a, 52a is similar and therefore only one willbe described. The bar 48a is provided with shoes 170 having upstandingears 172 to fit on opposite sides of bar 48a. Set screws 174 secure theshoes 170 to the bars 48a so that they may be adjusted along the beam tosuit the spacing of the hooks 14a.
In either embodiment, an automated collection station may be utilized asshown schematically in FIGS. 2 and 16. Collection station 200 includes atable 202 aligned with table 46. A pair of driven rollers 201 at therear of the table 202 receive the web 24 and roll it as it is delivered.Shoes 204 are located at the throat of the roll to lay the hooks 14 flaton the web prior to rolling. The underside of shoes 24 are curvedprogressively in the lateral and longitudinal directions to lay thehooks flat as the web 24 is advanced. Operation of the driver rollers iscontrolled by a dancer 206 similar to that on the web feed station sothat it operated conjointly with the transfer mechanism.
A cutter 210 may be incorporated in the collection station and may becontrolled by a transducer temporarily attached to the web 24 as itmoves along the transfer station. A sensor senses the passage of thetransducer and initiates the cutter whilst the web 24 is held stationaryby a clamp bar 212. The completed roll may then be removed and the freeend of the web may then be wound on the rollers to start a new roll.
In each embodiment therefore, the hooked tape 12 is sewn automaticallyto the web and the combination of the edge sensor and hook sensorensures that the hooks in successive tapes are aligned. Webs may beformed from two overlapping strips as shown in FIG. 7 with the tape 12acting to secure the strips to one another to form a unitary web.Additional components may be added to the web as the tape is sewn byusing the sewing station as a transport for additional processor andintegrating the operation of the sewing head with the processor.
The transfer mechanism provides control of the web as it is delivered tothe collection zone where it may be automatically wound into a roll fordispatch.
If preferred, a driven shaft may be utilized at the collection stationto control winding of the web 24 on to a core. In this case, operationof the shaft is controlled by a dancer, similar to the webfeed system22.
An alternative embodiment is shown in FIG. 17 where a controlled webfeed and web collections is used as a transfer mechanism in place of thebeams 48, 56.
In the embodiment of FIG. 17, a roll 238 is supported on a driven shaft239. The web 224 passes over an idler rollers 240, 244 and dancer 242and between a pair of sewing machine head assemblies 276, 278. The web224 passes over an idler roller 241 and dancer 243 for collection on adriven collection shaft 245. The web 224 is advanced by a pair of pinchrollers 247 that are grooved to allow passage of the hooks on tape 212.
The head assemblies 276, 278 are mounted on I beam 290 and driven byrespective drives 292, 294, through servo motors 296, 298. The relativemovement between the head assemblies is monitored and the servo motorsadjusted to maintain the heads in alignment. Pre-hooked tape 212 is fedfrom a dispenser (not shown) associated with the head 276. The dispensermay be mounted on the head if preferred or may be remote from it.
In operation, the web 224 is fed by driving shaft 239 to advance webover the roller 240. Tension is maintained by dancer 242 and the lengthof web advanced is monitored by a shaft encoder associated with roller240. The heads 276, 278 may then be advanced to sew a tape 212 asdescribed above with the servo motors maintaining the heads 276, 278aligned.
Upon completion of the sewing operation, the heads are returned and theweb 224 advanced by pinch rollers 245. The collection shaft 243 isoperated upon dancer 243 reaching a limit of travel to form a roll ofweb at the collection station.
In this embodiment, the transfer mechanism to advance the web isobtained through selective rotation of the roll on shaft 239 andcorresponding take up at the collection station. If necessary a clampbar may be incorporated in the roller 240 to maintain the tension in web24 for sewing but it is believed that adequate control can be obtainedfrom the driven shaft 239. The pinch rollers 245 may be used asnecessary to assist in advancing the web.
What is claimed is:
1. A sewing apparatus to sew a tape havingattachments located periodically therealong to a web, said apparatuscomprising a web feed station to feed a web of material along apredetermined path, a sewing station having a sewing head and a drive tomove said sewing head in a direction transverse to said predeterminedpath, a tape dispenser associated with said sewing head to deliver atape to said sewing head for attachment to said web, a transfermechanism to transfer said web from said sewing station to a collectionzone and a control to control operation of said drive, said controlincluding a sensor disposed between said tape dispenser and said sewinghead to sense the passage of an attachment and initiate operation ofsaid drive.
2. Apparatus according to claim 1 wherein said controlincludes an edge sensor responsive to detecting an edge of said web toposition said sewing head at a predetermined location relative to anedge of said web.
3. Apparatus according to claim 1 wherein saidtransfer mechanism includes a clamp to inhibit movement of said webduring transverse movement of said sewing head to attach said tape. 4.Apparatus according to claim 3 wherein said transfer mechanism includesa gripping device to engage said web and move it along saidpredetermined path.
5. Apparatus according to claim 4 wherein saidgripping device translates along said path to move said web. 6.Apparatus according to claim 4 wherein said web feed station includes aselectively operable drive mechanism to supply said web during operationof said gripping device.
7. Apparatus according to claim 6 wherein saidweb feed station includes a pair of spaced parallel rollers to support aroll of said web, said drive mechanism rotating at least one of saidrolls to dispense said web.
8. Sewing apparatus for sewing a tape to aweb of material, said apparatus including a web feed station to feed aweb of material along a predetermined path, a sewing station including asewing head to attach said tape to said web and a drive to move saidhead transverse to said predetermined path, a transfer station to movesaid web from said sewing station to a collection zone, said web feedstation including a first support for a first roll of web material and asecond support for a second roll of web material, said supports beingspaced apart in a direction transverse to said predetermined path, eachof said rolls delivering a respective strip of web material with thespacing of said supports delivering said web material to said sewingstation in side by side relationship, said sewing head traversing eachof said strips to secure said tape thereto and form a unitary web. 9.Apparatus according to claim 8 wherein said supports are arranged tooverlap adjacent edges of said strips.
10. Apparatus according to claim9 wherein a guide is located on one of said supports to position one ofsaid adjacent edges.
11. Apparatus according to claim 10 wherein theother of said supports is adjustable in a direction transverse to saidpath to vary the juxtaposition of said adjacent edges.
12. Apparatusaccording to claim 10 wherein said sewing head includes an edge sensorto determine the location of a lateral edge of said web, said edgesensor positioning said sewing head in a predetermined location relativeto one of said edges prior to traversing said web.
13. Apparatusaccording to claim 8 wherein said transfer station includes a clampingmember to inhibit movement of said strips when said sewing headtraverses said web.
14. A sewing apparatus to sew a tape to a web, saidapparatus comprising a web feed station to feed said web of materialalong a predetermined path, a sewing station having a sewing head and adrive to move said head in a direction transverse to said predeterminedpath, a tape dispenser associated with said sewing head to deliver atape to said sewing head for attachment to said web, and a transfermechanism to transfer said web from said sewing station to a collectionzone, said sewing head carrying a supplementary mechanism to performsupplementary operations on said web as said head traverses said web.15. Apparatus according to claim 14 wherein said supplementary mechanismincludes a cutter and a drive to reciprocate said cutter in a directionnormal to said web to pierce said web.
16. Apparatus according to claim15 wherein said cutter is offset from said tape to pierce said web at alocation spaced from said tape.
17. A sewing apparatus to sew a tape toa web, said apparatus including a web feed station to feed a web ofmaterial along a predetermined path, a sewing station having a sewinghead and a drive to move said sewing head in a direction transverse tosaid predefined path, a tape dispenser to deliver a tape to said sewinghead for attachment to said web, and a transfer mechanism to transfersaid web from said sewing station to a collection zone, said sewingstation including a pair of rails extending transversely to saidpredetermined path, a carriage supported on said rails by a pair ofwheel assemblies, and a pedestal to mount said sewing head, said drivebeing operable to move said carriage along said rails to sew said tapeto said web.
18. Apparatus according to claim 17 wherein said pedestalis formed, as a U and said web feed station is located in said U. 19.Apparatus according to claim 18 wherein one of said wheel assemblies ispivotally connected to said carriage for movement about an axisperpendicular to said rails.
20. Sewing apparatus for sewing a tapehaving attachments located periodically therealong to a web of material,said apparatus including a web feed station to feed a web of materialalong a predetermined path, a sewing station including a sewing head toattach said tape to said web and a drive to move said head transverse tosaid predetermined path, and a transfer station to move said web fromsaid sewing station to a collection station, said collection stationincluding a rolling device to receive one end of said web and form itinto a roll and a cutter assembly to sever said web in a directiontransverse to said predetermined path.
21. Sewing apparatus according toclaim 20 including a plurality of shoes laterally spaced across said weband progressively converging therewith to lie said attachments parallelto said web.
22. A method of sewing a tape having attachments locatedperiodically therealong to a web, said method including the steps ofadvancing said tape through a sensing head, sensing an attachment at apredetermined location and advancing said sewing head across said web tosecure said tape to said web.
23. A method according to claim 22including the step of positioning said head to one side of said web andmoving said head over said web upon sensing said attachment.
24. Amethod according to claim 22 including the step of sensing an oppositeedge of said web and terminating sewing.
25. A method according to claim24 including the step of retracting needles in said sewing head upontermination of said sewing and returning said head across said web. 26.A method according to claim 22 including the step of advancing said webbetween successive passes of said head.
27. A method according to claim22 including the step of rolling said web at a collection station.
28. Amethod according to claim 22 wherein said web is formed by a pair ofpartially overlapping strips and said method includes the step ofadjusting said overlap as said web is advanced.
29. A method accordingto claim 22 including the step of performing auxiliary operations onsaid web as said sewing head advances across said web.
30. A methodaccording to claim 29 wherein said auxiliary operation includes piercingsaid web.
31. A method of securing a tape having hooks disposedperiodically along said tape to a web, said method comprising the stepsof positioning a tape having hooks secured thereto adjacent to said web,advancing said tape with said hooks through a sewing head disposedadjacent said web, and advancing said sewing head across said web whileperforming a sewing operation between said tape and web to secure saidtape to said web.
32. A method according to claim 31 including the stepof advancing said web in a direction transverse to movement of saidsewing head upon completion of a sewing operation.
33. A methodaccording to claim 31 including the step of rolling said web at acollection station after said web is advanced.
34. A method according toclaim 33 including the step of flattening said hooks against said webprior to rolling at said collection station.
35. A method according toclaim 31 including the step of initiating movement of said sewing headacross said web upon detection of a hook at a predetermined location. | 2024-03-22 | 1998-07-20 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "2000-10-03"
} |
US-89935092-A | Container
ABSTRACT
An improved container includes a main section and a cover section which are interconnected by a hinge assembly. The hinge assembly allows the cover section to move toward and away from the main section along a linear path so that a seal is uniformly compressed completely around an opening in the main section. In addition, the hinge assembly allows the cover section to pivot relative to the main section. The hinge assembly includes a base portion which is fixedly secured to the main section of the container. A connector portion of the hinge assembly has a pair of hinge plates which are pivotally interconnected. A lower hinge plate is slidably received between the base portion of the hinge assembly and the main section of the container to accommodate linear movement of the cover section relative to the main section of the container. Stop surfaces on the lower hinge plate and the base portion of the hinge assembly limit the extent of linear movement of the cover section relative to the main section of the container. An upper hinge plate is pivotally connected to the lower hinge plate and cover section to accommodate pivotal movement of the cover section.
BACKGROUND OF THE INVENTION
The present invention relates to an improved container. Morespecifically, the invention relates to a container which holdselectrical circuitry and which has a hinge assembly interconnecting mainand cover sections of the container.
A known container for electrical circuitry has a cover section and amain section. A seal between the cover and main sections preventscontaminants from entering the container. In order to obtain uniformcompression of the seal when the container is closed, the cover sectionis attached to the main section by four screws, that is, one screw ateach of the four corners of the rectangular container. Upondisconnection of the screws, the cover section is completelydisconnected from and is freely movable relative to the main section ofthe container.
SUMMARY OF THE INVENTION
The present invention provides a new and improved container having acover section which is connected with a main section of the container bya hinge assembly. The hinge assembly includes a base portion and a pairof hinge plates which are pivotally interconnected. A first one of thehinge plates is slidable along a linear path relative to the baseportion of the hinge assembly. This allows the cover section to movealong a linear path relative to the main section of the container.Linear movement of the cover section enables a seal between the coversection and main section of the container to be uniformly compressedupon closing of the container.
The two hinge plates are pivotally interconnected. This enables thecover section to be pivoted to an open position offset to one side of anopening in the main section of the container. When the cover section hasbeen pivoted to the open position, electrical circuitry or other itemswithin the container are readily accessible through the opening in themain section of the container.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing and other features of the invention will become moreapparent upon a consideration of the following description taken inconnection with the accompanying drawings, wherein:
FIG. 1 is a simplified pictorial illustration of a controller having acontainer constructed in accordance with the present invention;
FIG. 2 is an exploded pictorial illustration of the container used inthe controller of FIG. 1 with portions of the controller removed;
FIG. 3 is simplified schematic sectional view, taken generally along theline 3--3 of FIG. 1, with the container in a closed condition andillustrating the relationship of a hinge assembly to a main section anda cover section of the container with electrical circuitry in thecontainer;
FIG. 4 is an enlarged fragmentary sectional view of a portion of FIG. 3and illustrating the relationship of a seal and the hinge assembly tothe main and cover sections of the container;
FIG. 5 is an enlarged side elevational view of the hinge assembly, thehinge assembly being shown in a retracted condition in which thecontainer is closed;
FIG. 6 is an elevational view, taken generally along the line 6--6 ofFIG. 5, further illustrating the hinge assembly;
FIG. 7 is a fragmentary sectional view of the container in a partiallyopen condition in which the hinge assembly has been extended to move thecover section upwardly from the main section of the container;
FIG. 8 is a fragmentary sectional view, generally similar to FIG. 7,illustrating the relationship between the hinge assembly, main sectionand cover section of the container when the container is in a fully opencondition;
FIG. 9 is an enlarged side view of the hinge assembly in the extendedcondition of FIG. 7;
FIG. 10 is a front elevational view, taken generally along the line10--10 of FIG. 9, further illustrating the hinge assembly in theextended condition; and
FIG. 11 is a sectional view, taken generally along the line 11--11 ofFIG. 10, illustrating the manner in which a lower hinge plate of aconnector portion of the hinge assembly is received in a channel whichis partially formed by a base portion of the hinge assembly.
DESCRIPTION OF ONE SPECIFIC PREFERRED EMBODIMENT OF THE INVENTION
A controller 20 (FIG. 1) includes an improved container 22 to whichconductors or cables 23 are attached by cable glands 24. The cables 23conduct electrical signals to and/or from electrical circuitry in thecontainer 22. A display panel 25 is mounted on a cover section 26 of thecontainer 22. The display panel 25 has a window 28 over an alpha-numericdisplay. The display panel 25 also has light-emitting diodes 30 toprovide information to an operator of the controller 20. A plurality ofmembrane switches 32 are built into the display panel 25 to enableinformation to be input to the electrical circuitry in the container 22.
The cover section 26 is secured to a rectangular main section 34 of thecontainer 22 by a plurality of screws 36 (FIG. 1). Thus, a screw 36 isprovided at each of the four corners of the container 22. The externallythreaded screws 36 extend through the cover section 26 into internallythreaded openings in the main section 34 to secure the cover section tothe main section of the container 22.
Although it is contemplated that the improved container 22 could beutilized in many different controllers or in association with othertypes of devices, in the illustrated embodiment of the invention, thecontainer 22 is used in a controller 20 for a color sensor. The colorsensor provides a high speed on-line method of color quality assessment.A known color sensor controller is commercially available under thedesignation 220A-6501 R G B Color Sensor from Eaton, Cutler-Hammer,having a place of business at Milwaukee, Wis. However, it should beunderstood that the invention is not limited to any specific controller.
The cover section 26 closes a rectangular opening 40 (FIG. 2) formed inthe upper end portion of the main section 34 of the container. A hingeassembly 44 (FIGS. 2 and 3) secures the cover section 26 to the mainsection 34 of the container 22. The hinge assembly 44 includes a baseportion 46 which is fixedly secured to the main section 34 of thecontainer 22 and a connector portion 48 which interconnects the coversection 26 and main section 34 of the container.
The connector portion 48 of the hinge assembly 44 includes upper andlower hinge plates or leaves 50 and 52 which are interconnected by apivot connection 54. The lower hinge plate 50 is slidably connected withthe main section 34 of the container 22 by the base portion 46 (FIG. 3).The upper hinge plate 52 is fixedly secured with the cover section 26.
CONTAINER
The screws 36 (FIG. 1) at the four corners of the container 22 press thecover section 26 and main section 34 firmly together when the container22 is in the closed condition shown in FIGS. 1 and 3. When the container22 is closed, a seal 58 (FIGS. 3 and 4) blocks entry of contaminantsinto a rectangular chamber 60 (FIGS. 2 and 3) in the container 22. Theseal 58 provides an NEMA Class 4X seal against contaminants, such asdust and water.
By urging the cover section 26 and main section 34 together under theinfluence of the screws 36 at each of the corners of the container 22(FIG. 1), uniform compression of the seal 58 is obtained completelyaround the opening 40 (FIG. 2) to the chamber 60. In the illustratedembodiment of the invention, the seal 58 is mounted in a recess 62 (FIG.4) formed in the cover section 26. A rib 64 extends upwardly from themain section 34 and extends around the opening 40 to press the seal 58in the recess 62 when the screws 36 are tightened.
The obtaining of a uniform seal completely around the opening 40 isfacilitated by the fact that the hinge assembly 44 accommodates limitedlinear movement (FIGS. 3 and 7), as well as pivotal movement (FIGS. 7and 8), of the cover section 26 relative to the main section 34 of thecontainer 22. Therefore, when the screws 36 are tightened, the coversection 26 can be moved straight downwardly (as viewed in FIG. 3). Thisenables a uniform clamping action to be obtained against the seal 58throughout the extent of the seal.
The seal 58 protects electrical circuitry 70 (FIG. 3) disposed in themain section 34 and electrical circuitry 72 disposed in the coversection 26 of the container 22. The electrical circuitry 70 includes alower printed circuit board 76 upon which circuit components 78 aremounted. The cables 23 (FIG. 1) are connected with the lower printedcircuit board 76 by electrical connectors (not shown).
The lower circuit board 76 is mounted on bosses or ledges 80 and 82(FIG. 3) formed in the lower side wall 84 of the main section 34 of thecontainer 22. The bosses 80 and 82 are disposed adjacent to opposite endwalls 86 and 88 of the main section 34 of the container 22. The bosses80 and 82 support the printed circuit board 76 in a spaced apartrelationship with the bottom wall 84. The left (as viewed in FIG. 3) endportion of the printed circuit board has a recess which enables the baseportion 46 of the hinge assembly 44 to be fixedly secured directly tothe boss 80.
The electrical circuitry 72 in the cover section 26 contains the alphanumeric display covered by the window 28 connected with the displaypanel 25. The electrical circuitry 72 includes a rectangular upperprinted circuit board 92 upon which electrical circuit components 94 aremounted. The upper printed circuit board 92 is mounted in a rectangularrecess formed in the cover 26 and is electrically connected with thedisplay panel 25. The upper printed circuit board 92 is supported by aplurality of bolts which engage the corners of the printed circuitboard. The bolts extend through spacers 98 which hold the upper printedcircuit board 92 in a spaced apart relationship with an upper wall 102of the cover section 26.
A rectangular protector board 104 (FIG. 3) is mounted on the cover wall102 by the same bolts which connect the printed circuit board 92 withthe cover. The protector board 104 is spaced from and is coextensivewith the printed circuit board 92. The protector board 104 prevents theprinted circuit board 92 from being accidently damaged when the coversection 26 is in the open position.
A flexible electrical conductor 108 conducts electrical energy betweenthe lower and upper printed circuit boards 76 and 92. In the illustratedembodiment of the invention, the electrical conductor 108 is a ribboncable having a flat, flexible base formed of electrically insulatingmaterial in which conductor elements are embedded. A lower end portion110 of the flexible electrical conductor 108 is connected with the lowerprinted circuit board 76. An upper end portion 112 of the flexibleelectrical conductor 108 is connected with the upper printed circuitboard 92. The electrical conductor 108 is offset to one side of thehinge assembly 44.
Sufficient slack is provided in the flexible conductor 108 to enable thecover section 26 to move between the closed condition illustrated inFIG. 3, a partially open condition illustrated in FIG. 7, and a fullyopen condition illustrated in FIG. 8. As the cover section 26 is movedrelative to the main section 34 from the closed condition to thepartially open condition, the upper end portion 112 of the conductor 108moves away from the lower end portion 110 of the conductor. As the coversection 26 is pivoted to the fully open condition, the upper end portionof the electrical conductor 108 moves still further away from the lowerend portion 110 of the conductor. The slack in the electrical conductor108 is sufficient to accommodate the relative movement between the coversection 26 and main section 34 of the container 22.
When the cover section 26 is in the partially open condition (FIG. 7),the left end portion of the cover section 26 is disposed above the mainsection 34 of the container. At this time, the cover section 26 may behorizontal (as shown in FIG. 7) or may be tilted downwardly so that theright (as viewed in FIG. 3) end portion of the cover section 26 engagesor is closely adjacent to the main section 34 of the container 22. Oncethe cover section 26 has been moved to the partially open condition, thecover section is pivoted in a counterclockwise direction (as viewed inFIG. 7) to the fully open condition (FIG. 8). When the cover section 26is in the fully open condition, the rectangular opening 40 is exposed tofacilitate access to the chamber 60 in the lower section 34 of thecontainer 22.
When the cover section 26 is in the fully open condition, the center ofgravity of the cover section is disposed on the opposite side of thepivot connection 54 from the main section 34 of the container 22. Thus,the cover section 26 slopes upwardly and leftwardly, as viewed in FIG.8, from the pivot connection 54 at an angle of approximately 5° from thevertical. Therefore, the cover section 26 is stable in the fully openposition and remains fully open until it is moved toward the closedposition.
When the fully open container 22 is to be returned to the closedcondition, the cover section 26 is pivoted in a clockwise direction fromthe fully open position shown in FIG. 8 to the partially open positionshown in FIG. 7. The cover section 26 is then moved verticallydownwardly along a linear path toward the main section 34 of thecontainer 22. As the cover section 26 moves straight downwardly, theseal 58 (FIG. 4) moves into engagement with the rib 64 on the mainsection 34 of the container.
As the screws 36 (FIG. 1) at the corners of the cover section 26 aretightened, the seal 58 is compressed by the rib 64 throughout the extentof the seal. Compressing the seal 58 provides a firm fluid tight sealbetween the cover section 26 and main section 34 of the container 22.Since the cover section 26 can be moved straight downwardly toward themain section 34 of the container 22, uniform compression of the seal 58is obtained completely around the opening 40. Therefore, contaminantscan not leak into the closed container 22.
HINGE ASSEMBLY
The hinge assembly 44 maintains the cover section 26 in a desiredspatial relationship with the main section 34 of the container 22 duringmovement of the cover section between the fully open and closedconditions. The hinge assembly 44 also maintains the cover section 26 ina desired spatial relationship with the main section 34 when the coversection is in the fully open condition. The hinge assembly 44 allows thecover section 26 to be moved along a linear path relative to the mainsection 34 between the closed and partially open conditions of FIGS. 3and 7. In addition, the hinge assembly 44 allows the cover section 26 tobe pivoted along an arcuate path between the partially open and fullyopen conditions of FIGS. 7 and 8. During tightening of the retainingscrews 36 at the corners of the container 22 (FIG. 1), the hingeassembly 44 allows straight downward movement of the cover section 26 sothat the seal 58 is compressed in a uniform manner throughout the extentof the seal.
The one-piece base portion 46 of the hinge assembly 44 (FIGS. 5, 6, 9,and 10) is fixedly connected to the boss 80 (FIG. 3) by suitablefasteners 116. The base portion 46 cooperates with the lower hinge plate50 to guide linear movement of the connector portion 48 of the hingeassembly relative to the main section 34 of the container 22 duringmovement of the cover section 26 between the partially open condition(FIG. 7) and closed condition (FIG. 3) and during tightening of thefasteners 36 (FIG. 1).
The base portion 46 includes a horizontal support section 120 which isconnected to the boss 80 by the fasteners 116 (FIGS. 2 and 3). Anupstanding body section 122 is disposed along the end wall 86 of themain section 34 of the container 22 (FIG. 3). The body section 122 ofthe base portion 46 cooperates with the end wall 86 of the main section34 of the container 22 to form a channel 124 (FIGS. 4, 7 and 11) inwhich the lower hinge plate 50 is slidably received.
An outwardly facing major side surface 126 (FIG. 4) on the body section122 extends parallel to and cooperates with an inwardly facing majorside surface 128 on the container end wall 86 to at least partially formthe channel 124. A flat inner major side surface 130 on the lower hingeplate 50 is disposed in flat abutting engagement with the outwardlyfacing major side surface 126 on the body section 122 of the baseportion 46. Similarly, a flat outwardly facing major side surface 134(FIGS. 4 and 5) on the lower hinge plate 54 is disposed in flat abuttingengagement with the inwardly facing major side surface 128 (FIGS. 2 and4) of the end wall 86.
During movement of the lower hinge plate 50 between the retractedposition of FIGS. 3-6 and the extended position of FIGS. 7, 9 and 10 asthe cover section 26 moves between the closed condition and thepartially open condition, the major side surfaces 130 and 134 (FIGS. 7and 9) on the lower hinge plate 50 cooperate with the base portion 46and container end wall 86 (FIG. 7) to guide movement of the connectorportion 48 of the hinge assembly 44. Thus, the inwardly facing majorside surface 130 on the lower hinge plate 50 slides along the outwardlyfacing major side surface 126 on the base portion 46. Similarly, theoutwardly facing major side surface 134 on the lower hinge plate 50slides along the inwardly facing side surface 128 on the end wall 86 ofthe main section 34 of the container 22.
As the lower hinge plate 50 moves upwardly from the retracted positionof FIGS. 3-6 to the extended position of FIGS. 7-10, a pair of stopsurfaces 140 and 142 (FIG. 6) on the lower hinge plate 50 move upwardlytoward a pair of stop surfaces 144 and 146 on the base portion 46. Whenthe cover 26 has been moved to the partially open position shown in FIG.7, the stop surfaces 140 and 142 on the lower hinge plate 50 aredisposed in abutting engagement with the stop surfaces 144 and 146 onthe base portion 46 (FIG. 10). This blocks further upward movement ofthe connector portion 48 of the hinge assembly 44 relative to the baseportion 46 of the hinge assembly.
The stop surfaces 140 and 142 (FIG. 6) on the lower hinge plate 50 areformed on a pair of outwardly extending projections 150 and 152. Thestop surfaces 140 and 142 are disposed in a horizontal plane whichextends perpendicular to the path of sliding movement of the lower hingeplate 50 between the retracted position of FIGS. 5 and 6 and theextended position of FIGS. 9 and 10.
The stop surfaces 144 and 146 (FIG. 6) on the base portion 46 aredisposed on a pair of stop tabs 154 and 156 (FIGS. 6 and 11) formed onthe base portion 46. The stop tabs 154 and 156 (FIG. 11) extendperpendicular to the outwardly facing major side surface 126 on the bodysection 122 of the base portion 46. Each surface 158 and 160 on the stoptabs 154 and 156 engage the inner side surface 128 (FIGS. 7 and 8) onthe end wall 86 of the main section 34 of the container 22
The stop tabs 154 and 156 retain the lower hinge plate 50 againstsideward movement in the channel 124 (FIG. 11). In addition, the stoptabs 154 and 156 guide the lower hinge plate 50 during movement of thelower hinge plate between the retracted position of FIGS. 5 and 6 andthe extended position of FIGS. 9 and 10. Although the stop tabs 154 and156 have a relatively short vertical extent, it is contemplated that thevertical extent of the stop tabs 154 and 156 could be increased toprovide greater areas of engagement between the stop tabs and theopposite sides of the lower hinge plate 50.
It is contemplated that during assembly of the container 22, it may bedesired to first mount the base portion 46 of the hinge assembly 44 inthe main section 34 of the container. Thereafter, the lower hinge plate50 would be positioned in the channel 124. To enable this to beaccomplished, the projections 150 and 152 (FIG. 10) on the lower hingeplate 50 are disposed on flexible sections 164 and 166 of the lowerhinge plate 50.
Cam surfaces 170 and 172 are formed on the flexible sections 164. Thecam surfaces 170 and 172 engage the stop tabs 154 and 156 andresiliently compress the flexible sections 164 and 166 of the lowerhinge plate 50 inwardly as the lower hinge plate is pressed downwardlyagainst the stop tabs 154 and 156. After the lower hinge plate has beenmoved downwardly past the stop tabs 154 and 156, the resilient sections164 and 166 spring outwardly to the position shown in FIG. 10.
The upper hinge plate 52 is connected with the lower hinge plate 50 bythe pivot connection 54. The upper hinge plate 48 has a mounting section176 which is fixedly connected to the cover section 26. The mountingsection 176 extends perpendicular to a connector section 178 of theupper hinge plate 48. When the cover section 26 is in the closedcondition of FIG. 3, the mounting section 176 is horizontal and theconnector section 178 extends vertically. If desired, the mountingsection 176 could be eliminated and the connector section 178 fixedlysecured directly to the cover section 26.
The pivot connection 54 between the upper hinge plate 48 and lower hingeplate 50 includes a plurality of knuckles 184, 186 and 188 (FIG. 10)which are integrally formed with the upper hinge plate 52 and aplurality of knuckles 190 and 192 which are integrally formed with thelower hinge plate 50. A hinge pin 194 extends through the knuckles184-192 to interconnect the upper and lower hinge plates 50 and 52 in awell known manner.
CONCLUSION
The present invention provides a new and improved container 22 having acover section 26 which is connected with a main section 34 of thecontainer by a hinge assembly 44. The hinge assembly 44 includes a baseportion 46 and a pair of hinge plates 50 and 52 which are pivotallyinterconnected. A first one of the hinge plates 50 is slidable along alinear path relative to the base portion 46 of the hinge assembly 44.This allows the cover section 26 to move along a linear path relative tothe main section 34 of the container 22. Linear movement of the coversection 26 enables a seal 58 between the cover section and main section34 of the container 22 to be uniformly compressed upon closing of thecontainer.
The two hinge plates 50 and 52 are pivotally interconnected. Thisenables the cover section 26 to be pivoted to an open position offset toone side of an opening 40 in the main section 34 of the container 22.When the cover section 26 has been pivoted to the open position,electrical circuitry 70 or other items within the container 22 arereadily accessible through the opening 40 in the main section 34 of thecontainer.
Having described the invention, the following is claimed:
1. A containercomprising a main section having surfaces for defining an opening, acover section for blocking the opening in said main section, a hingeassembly interconnection said main and cover sections, said hingeassembly including a base portion fixedly connected with a first one ofsaid main and cover sections, and a connector portion connected with asecond one of said main and cover sections, said connector portion ofsaid hinge assembly including first and second hinge plates and meansfor pivotally interconnecting said first and second hinge plates, saidfirst hinge plate and said base portion being slidable relative to eachother along a linear path from a retracted condition in which said coversection blocks the opening in said main section to an extended conditionin which said cover and main sections are at least partially spacedapart from each other, said first and second hinge plates beingpivotally movable relative to each other along an arcuate path about thepivot connection from a first condition to a second condition when saidfirst hinge plate and base portion are in the extended condition, saidcover section being disposed adjacent to and at least partially blockingthe opening in said main section when said first and second hinge platesare in the first condition, said cover section being offset to one sideof the opening in said main section when said first and second hingeplates are in the second condition to provide access to said mainsection through the opening, a first electrical circuit board mounted onsaid cover section, a second electrical circuit board mounted on saidmain section, and flexible conductor means for conducting electricalenergy between said first and second electrical circuit boards, saidflexible conductor means for conducting electrical energy between saidfirst electrical circuit board adjacent to said hinge assembly and asecond end portion connected with said second electrical circuit boardadjacent to said hinge assembly, said first and second end portions ofsaid flexible conductor means being spaced a first distance apart whensaid first hinge plate and base portion of said hinge assembly are inthe retracted condition, said first and second end portions of saidflexible conductor means being spaced a second distance apart when saidfirst hinge plate and base portion of said hinge assembly are in theextended condition, said second distance being greater than said firstdistance, said first and second end portions of said flexible conductormeans being spaced a third distance apart when said first and secondhinge plates have been pivoted relative to each other about the pivotconnection to the second condition, said third distance being greaterthan said second distance.
2. A container as set forth in claim 1wherein said first hinge plate has a first major side surface which isdisposed in abutting engagement with an inner surface of said mainsection and a second major side surface which is disposed in abuttingengagement with a surface on said base portion which faces toward theinner surface of said main section, said first major side surface onsaid first hinge plate being slidable along the inner surface of saidmain section and said second major side surface on said first hingeplate being slidable along the surface on said base portion which facestoward the inner surface of said main section during movement betweensaid first hinge plate and base portion from the retracted condition tothe extended condition.
3. A container as set forth in claim 1 furtherincluding seal means for sealing a joint between said cover section andsaid main section when said first hinge plate and base portion of saidhinge assembly are in the retracted condition to prevent exposure ofsaid first and second electrical circuit boards to contaminants, andmeans for interconnecting said cover section and said main section tocompress said seal means between said cover section and said mainsection when said first hinge plate and base portion of said hingeassembly are in the retracted condition.
4. A container as set forth inclaim 3 wherein said means for interconnecting said cover section andsaid main section includes a plurality of externally threaded fastenerswhich extend through openings in said cover section into engagement withinternal threads connected with said main section when said first hingeplate and base portion of said hinge assembly are in the retracedcondition.
5. A container as set forth in claim 1 further includingdisplay means mounted on said cover section and electrically connectedwith said first electrical circuit board for providing a visuallyreadable output when said first hinge plate and base portion of saidhinge assembly are in the retracted condition.
6. A container as setforth in claim 5 further including electrical connector means mounted onsaid main section and electrically connected with said second electricalcircuit board for conducting electrical energy between said secondelectrical circuit board and conductors connected with said electricalconnector means.
7. A container as set forth in claim 1 wherein saidbase portion and first hinge plate have stop surfaces which areengageable to limit movement of said connector portion of said hingeassembly relative to the first one of said base and cover sections uponmovement of said first hinge plate and said base portion to the extendedcondition.
8. A container as set forth in claim 1 wherein said firsthinge plate includes a first stop surface disposed on a first endportion of said first hinge plate, said first hinge plate having asecond end portion opposite from said first end portion and pivotallyconnected with said second hinge plate, said base portion of said hingeassembly having a second stop surface which is spaced apart from saidfirst stop surface when said first hinge plate and said base portion arein the retracted condition, said first and second stop surfaces beingdisposed in abutting engagement when said first hinge plate and saidbase portion are in the extended condition.
9. A container as set forthin claim 8 wherein said first hinge plate has a first major side surfacewhich is disposed in abutting engagement with an inner surface of saidfirst one of said main and cover sections and a second major sidesurface which is disposed in abutting engagement with a surface on saidbase portion which faces toward the inner surface of said first one ofsaid main and cover sections, said first major side surface on saidfirst hinge plate being slidable along the inner surface of said firstone of said main and cover sections and said second major side surfaceon said first hinge plate being slidable along the surface on said baseportion which faces toward the inner surface of said first one of saidmain and cover sections during relative movement between said firsthinge plate and said base portion from the retracted condition towardthe extended condition.
10. A container as set forth in claim 9 whereinsaid first stop surface on said first hinge plate extends between saidfirst and second major side surfaces on said first hinge plate.
11. Acontainer as set forth in claim 10 wherein said base portion includes astop tab which extends away from the surface of said base portion whichfaces toward the inner surface of said first one of said main and coversections, said stop tab having an end surface which extends transverselyto said second stop surface and abuttingly engages the inner surface ofsaid first one of said main and cover sections, said stop tab, innersurface of said first one of said main and cover sections and surface ofsaid base portion which faces toward the inner surface of said first oneof said main and cover sections cooperating to at least partially definea channel in which said first hinge plate is slidably received, saidsecond stop surface being disposed on said stop tab and extendingtransversely to said end surface of said stop tab.
12. A container asset forth in claim 11 wherein said base portion includes a body sectionwhich extends along the inner surface of said first one of said main andcover sections, said stop tab being connected with and extending in afirst direction from said body section, said base portion including asupport section which extends in a second direction from said bodysection opposite to said first direction, said hinge assembly furtherincluding fastener means for connecting said support section with saidfirst one of said main and cover sections.
13. A container as set forthin claim 12 wherein said second hinge plate includes a first sectionhaving a first end portion which is connected with said first hingeplate by said means for pivotally interconnecting said first and secondhinge plates, said second hinge plate having a second section whichextends transversely outwardly from a second end portion of said firstsection of said second hinge plate.
14. A container as set forth inclaim 1 wherein said means for pivotally interconnecting said first andsecond hinge plates includes a hinge pin having a longitudinal centralaxis which extends perpendicular to the linear path along which saidfirst hinge plate and said base portion are slidable relative to eachother from the retracted condition to the extended condition.
15. Acontainer as set forth in claim 1 wherein said base portion has a flatmajor side surface, said first hinge plate having a flat major sidesurface which is disposed in abutting engagement with the flat majorside surface of said base portion, said flat major side surfaces of saidbase portion and said first hinge plate being slidable relative to eachother during relative movement of said first hinge plate and baseportion between the retracted and extended conditions.
16. A containeras set forth in claim 15 wherein said main section has a flat sidesurface which faces toward the flat major side surface on said baseportion, said flat side surface on said main section cooperating withthe flat major side surface of said base portion to at least partiallydefine a channel in which said first hinge plate is slidably received.17. A container as set forth in claim 1 wherein said means for pivotallyinterconnecting said first and second hinge plates moves from a positionadjacent to said first one of said main and cover sections to a secondposition spaced from said first one of said main and cover sections uponrelative movement of said first hinge plate and base portion from theretracted condition to the extended condition.
18. A containercomprising a main section having walls for defining an opening, a coversection for blocking the opening in said main section, said coversection being movable relative to said main section between a closedcondition in which said cover section blocks the opening in said mainsection and an open condition in which said cover section is ineffectiveto block the opening in said main section, seal means extending aroundsaid opening for sealing a joint between said cover section and mainsection when said cover section is in the closed condition, and a hingeassembly interconnecting said cover and main sections for enabling atleast a portion of said cover section to move toward and away from saidmain section along a path having a linear portion and an arcuate portionduring movement of said cover section between the open and closedconditions, said cover section being movable along the linear portion ofthe path to compress said seal means between said cover and mainsections during a final portion of movement of said cover section fromthe open condition to the closed condition, said hinge assemblyincluding a base portion fixedly connected with said main section and aconnector portion connected with said cover section, said connectorportion of said hinge assembly including first and second hinge platesand means for pivotally interconnecting said first and second hingeplates, said first hinge plate having a first major side surface whichis disposed in abutting engagement with an inner surface of said mainsection and a second major side surface which is disposed in abuttingengagement with a surface on said base portion which faces toward theinner surface of said main section, said first major side surface onsaid first hinge plate being slidable along the inner surface of saidmain section and said second major side surface on said first hingeplate being slidable along the surface on said base portion which facestoward the inner surface of said main section during movement of atleast a portion of said cover section along the linear portion of thepath, further including a first electrical circuit board mounted on saidcover section, a second electrical circuit board mounted on said mainsection, and flexible conductor means for conducting electrical energybetween said first and second electrical circuit boards, said flexibleconductor means having a first end portion connected with said firstelectrical circuit board adjacent to said hinge assembly and a secondend portion connected with said second electrical circuit board adjacentto said hinge assembly.
19. A container as set forth in claim 18 furtherincluding fastener means for interconnecting said cover section and saidmain section when said cover section is in the closed condition, saidfastener means including a plurality of externally threaded fastenerswhich extend through openings in said cover section into engagement withinternal threads connected with said main section.
20. A container asset forth in claim 18 wherein said base portion and first hinge platehave stop surfaces which are engageable to limit movement of saidconnector portion of said hinge assembly relative to said base sectionupon movement of said cover section along the linear portion of the pathin a direction away from said main section.
21. A container as set forthin claim 18 wherein said first hinge plate includes a first stop surfacedisposed on a first end portion of said first hinge plate, said firsthinge plate having a second end portion opposite from said first endportion and pivotally connected with said second hinge plate, said baseportion of said hinge assembly having a second stop surface which isspaced apart from said first stop surface when said cover section is inthe closed condition, said first and second stop surfaces being disposedin abutting engagement when said cover section is in the open condition.22. A container as set forth in claim 21 wherein said first stop surfaceon said first hinge plate extends between said first and second majorside surfaces on said first hinge plate.
23. A container as set forth inclaim 22 wherein said base portion includes a stop tab which extendsaway from the surface of said base portion which faces toward the innersurface of said main section, said stop tab having an end surface whichextends transversely to said second stop surface and abuttingly engagesthe inner surface of said main section, said stop tab, inner surface ofsaid main section and surface of said base portion which faces towardthe inner surface of said main section cooperating to at least partiallydefine a channel in which said first hinge plate is slidably received,said second stop surface being disposed on said stop tab and extendingtransversely to said end surface of said stop tab.
24. A container asset forth in claim 23 wherein said base portion includes a body sectionwhich extends along the inner surface of said main section, said stoptab being connected with and extending in a first direction from saidbody section, said base portion including a support section whichextends in a second direction from said body section opposite to saidfirst direction, said hinge assembly further including fastener meansfor connecting said support section with said main section.
25. Acontainer as set forth in claim 24 wherein said second hinge plateincludes a first section having a first end portion which is connectedwith said first hinge plate by said means for pivotally interconnectingsaid first and second hinge plates, said second hinge plate having asecond section which extends transversely outwardly from a second endportion of said first section of said second hinge plate.
26. Acontainer as set forth in claim 1 further including display meansmounted on said cover section and electrically connected with said firstelectrical circuit board for providing a visually readable output. | 2024-03-22 | 1992-06-16 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1993-10-26"
} |
US-44943389-A | Teething rail for shopping cart
ABSTRACT
A teething rail which can be snapped on and off of the handle of a shopping cart and can be chewed safely by a teething baby when riding in the seat of the shopping cart. The teething rail is a split tube which preferably has a center portion with raised elements on which the baby can chew pleasantly.
This application is a continuation of application Ser. No. 07/240143,filed 8/26/88, abandoned.
BACKGROUND OF THE INVENTION
This invention relates to a teething rail for use on the handle of ashopping cart.
Teething rings for babies are well-known. They usually consist of a ringof soft rubber which the baby can chew to relieve the sensationsassociated with teething. However, when a baby accompanies its mother ona grocery shopping trip, the baby is often carried in a seat in ashopping cart facing the cart's handle. The baby often leans over andchews on the handle, especially if it is teething, and this can beunsanitary. Covers for shopping cart handles are known, for example inU. S. Pat. No. 3,866,649--Bringmann, but such covers do not have specialprovisions for a teething baby and are typically fastened by means of azipper.
SUMMARY OF THE INVENTION
The present teething rail for use on the handle of a shopping cart is asoft, resilient split tube which can be snapped on and off of theshopping cart handle and which has a central portion with raisedelements constituting teething means on which a baby can easily chew torelieve the sensations of teething. The teething rail can beconveniently carried in a small bag to keep it sanitary before use, andit can also be cleaned easily with soap and water between uses. It ispreferably made of soft rubber similar to the material of a teethingring so that it will not injure the gums of the baby and so that it willbe resilient enough to snap easily on and off of the shopping carthandle and will grip the shopping cart handle to keep it in place whenin position on the handle of the shopping cart.
Accordingly, it is an object of the present invention to provide a softand safe, snap-on, baby's teething rail for use on the handle of ashopping cart.
Another object of the invention is to make the teething rail such thatit can be easily sanitized and kept in a sanitized condition betweenuses.
Other objects of this invention will appear from the followingdescription and appended claims, reference being had to the accompanyingdrawings forming a part of this specification wherein like referencecharacters designate corresponding parts in the several views.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a perspective view of a typical shopping cart having a seatfacing a horizontal handle and having a teething rail in accordance withthe preferred embodiment of the invention on the handle;
FIG. 2 is a perspective view of the teething rail of FIG. 1;
FIG. 3 is a cross-sectional view taken across the center of the teethingrail as viewed along line 3--3 of FIG. 1;
FIG. 4 is a sectional view similar to FIG. 3 illustrating how theteething rail can be snapped onto and off of the shopping cart handle;and
FIG. 5 is a perspective view showing a teething rail enclosed in a bagfor carrying purposes.
Before explaining the disclosed embodiment of the present invention indetail, it is to be understood that the invention is not limited in itsapplication to the details of the particular arrangement shown, sincethe invention is capable of other embodiments. Also, the terminologyused herein is for the purpose of description and not of limitation.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
The shopping cart 10 shown in FIG. 1 is a standard shopping cart havinga seat 12 at the upper rear of the cart in which a baby can sit facingthe horizontal handle 14 of the cart. The seat has a back 16 and a front18 with openings 20 through which the baby's legs can project. As can beseen, it is very easy for the baby, when seated in the seat 12, to leanover and chew on the handle 14, and this happens frequently if the babyis teething.
The teething rail 22 is shown on the handle 14 in FIG. 1 and is shown inan enlarged view on FIG. 2. The teething rail 22 is a soft, veryresilient split tube which has an enlarged center portion 24 andopposite end portions 26 and 28. The rail 22 extends almost but notquite a complete circle and it has longitudinal edges 30 and 32 whichflare outwardly slightly from the circle. When the rail 22 is snappedonto the handle 14 in the manner shown in FIG. 4, the edges 30 and 32spread slightly to allow the rail to pass over the handle and seatfirmly in place in the manner shown in FIG. 3 where the rail grips thehandle to hold it firmly in place. The flared edges 30 and 32 make iteasy for the rail to spread as it is positioned over the handle whenslipping it on. The edges 30 and 32 are spaced apart less than thediameter of the tubular handle 14 and the inside diameter of the splittube is less than the diameter of the handle 14.
The enlarged central portion 24 has a plurality of semi-spherical raisedelements 34 on which the baby can chew for helping to ease the itchingsensations of teething. The entire teething rail 22 is preferably moldedin one piece from a soft rubber of the type that is typically used inteething rings. When not in use, the teething rail 22 can beconveniently carried in a small bag or pouch 36 with a drawstring 38 forhelping to keep it sanitary. The teething rail can be sanitized betweenuses by washing it with soap and water. All edges and corners arerounded to help keep the baby safe.
We claim:
1. A teething rail for use on the tubular handle of a shoppingcart comprising:a resilient split tube having a circular circumferencegreater than 180 degrees and less than 360 degrees such that the splittube has longitudinal edges spaced apart a distance less than thediameter of the handle of the shopping cart; said split tube being madeof soft rubber and having an inner diameter slightly smaller than thediameter of the tubular handle of the shopping cart so that the teethingrail can snap onto and off of the handle and will grip the handle; saidsplit tube having integral smooth, semi-spherical, rounded convexprotrusions on the outside for a baby to chew on; said protrusionshaving a height less than the diameter thereof for safety purposes. 2.The teething rail of claim 1 wherein said longitudinal edges are flaredoutwardly from the circumference of said split tube. | 2024-03-22 | 1989-12-11 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1990-09-11"
} |
US-985698-A | Sealing cap for a vacuum seal container
ABSTRACT
A sealing cap fastened to a vacuum seal container and controlled to extract air out of vacuum seal container, the sealing cap including a cap body unit fastened to the vacuum seal container, and an extracting unit mounted in the cap body and controlled to extract air out of the vacuum seal container by reciprocating a control cap of the extracting unit with the hand, the air passage being automatically sealed by a flap, which is forced into the close position by atmospheric pressure, the vacuum status of the vacuum seal container being released when a control cap of the air extracting unit is turned in one direction and pressed down, the cap body having a bottom side covered with a rubber disk which fits different spout sizes and shapes, the rubber disk being secured to the cap body by a T-cap and a sponge between the T-cap and the rubber disk, the rubber disk having a convex flange of V-shaped cross section around the periphery, which prohibits the rubber disk from being forced to curve inwards and to escape out of position, the T-cap being adapted to prevent the rubber disk from being forced inwards by atmospheric pressure and to enable air to get into the inside of the container in all directions when releasing the vacuum status of the container, the T-cap and the sponge filtering and buffering air passes through to prevent powdered material from being adhered to the rubber disk in order to maintain its function of vacuum preservation.
BACKGROUND OF THE INVENTION
The present invention relates to a sealing cap for vacuum sealcontainers which fits container mouths of different sizes and shapes,and more particularly to such a sealing cap which automatically extractsair out of the vacuum seal container when reciprocating a control cap.The sealing cap is equipped with a rubber disk which fits differentcontainer spouts. A sponge and a T-cap are fastened to the cap body ofthe sealing cap to secure the rubber disk in place, and to filter andbuffer air passing through.
FIG. 1 shows a sealing cap fastened to a vacuum seal container 300, andoperated to extract air out of the vacuum seal container 300. Thesealing cap comprises a cap body 100, a gasket 101 retained between thecap body 106 and the container 300, and a valve 102 mounted on thegasket 101. When in use, an extracting pump 200 is attached to the capbody 100, and operated to extract air out of the container 300 throughthe valve 102. When releasing the vacuum status of the container 300,the valve 102 must be opened by pulling. This structure of sealing capis not durable in use because the gasket 101 wears quickly with use andtends to be forced inwards by atmospheric pressure, causing an airleakage . Another drawback of this structure of sealing cap is that thecap body fits only circular container mouths. Furthermore, When openingthe valve 102, powdered material which is contained in the container 300is forced to splash by a rush flow of air.
SUMMARY OF THE INVENTION
The present invention provides a sealing cap for a vacuum seal containerwhich automatically extracts air out of the vacuum seal container whenreciprocating a control cap of the extracting unit with the hand.According to one aspect of the present invention, the sealing capcomprises a cap body unit fastened to the vacuum seal container, and anextracting unit mounted in the cap body and controlled to extract airout of the vacuum seal container. The cap body unit is comprised of acap body, a rubber disk, a sponge, a T-cap, a flap, a pressure member,and a ring cap. The air extracting unit is comprised of a piston, aspring, and a control cap. When reciprocating the control cap with thehand the piston is moved up and down to extract air out of the vacuumseal container. The air passage is opened, enabling outside air to passto the inside of the vacuum seal container when the control cap isturned in one direction and then pressed down. According to anotheraspect of the present invention, a rubber disk is attached to the capbody at the bottom side. The rubber disk has a flange curved downwardsalong its border for positioning, which prohibits the rubber disk frombeing forced to curve inwards and to escape out of position. Accordingto still another aspect of the present invention, The T-cap is adaptedto prevent the rubber disk from dropping down and to enable air to getinto the inside of the container in all directions without causing thestorage items to be forced to scatter by a rush flow of air when it isopened. Furthermore, the T-cap and the sponge filter air passing throughand buffer its pressure to prevent powdered material from being adheredto the rubber disk in order to maintain its function of vacuumpreservation.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a sectional view showing a sealing cap fastened to a vacuumseal container according to the prior art.
FIG. 2 is an elevational view of a sealing cap according to the presentinvention.
FIG. 3 is an exploded view of the sealing cap shown in FIG. 2.
FIG. 3A is a sectional view of a part of the sealing cap shown in FIG.2.
FIG. 4 is a sectional view of the present invention, showing the sealingcap fastened to a vacuum seal container.
FIGS. from 5A to 5C show the operation of the present invention.
FIG. 6 shows an alternate form of the present invention.
DESCRIPTION OF THE REFERENCE CODES
______________________________________ 1 cap body unit 11 outer upright tube 111 inner upright tube 112 seat 112a flap 112b pressure member 113 coupling flange 114 gap 115 ring cap 115a coupling rod 115b locating notch 12 cap body 121a convex flange 12' coupling flange 121 rubber disk 122 sponge 123 T-cap 2 air extracting unit 21 control cap 22 piston 23 spring 22a bottom flange 22b upper flange 123' neck 22c rubber seal ring 221;222;223;224; air gaps 225 top notch 226 annular groove 21a inside coupling flange 21b inside locating rod 400 container ______________________________________
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
Referring to FIGS. 2, 3, 3A and 4, a sealing cap for a vacuum sealcontainer in accordance with the present invention is generallycomprised of a cap body unit 1, and an air extracting unit 2.
cap body unit 1 is comprised of a cap body 12. The cap body 12 comprisesan inner upright tube 111 perpendicularly raised from the top, an outerupright tube 11 perpendicularly raised from the top around the innerupright tube 111, a seat 112 defined within the inner upright tube 111,a split coupling flange 113 raised around the outer upright tube 11 nearthe top, two gaps 114 defined at the split coupling flange 113 at twoopposite sides, a center air hole 121a at the center of the seat 112,and a downward coupling flange 12' raised from the bottom side near theborder. A flap 112a and a pressure member 112b are mounted in the seat112 inside the inner upright tube 111 of the cap body 12. A ring cap 115is covered on the outer upright tube 11 and supported on the splitcoupling flange 113, having two locating notches 115b bilaterallydisposed on the inside, and two downward coupling rods 115a respectivelyengaged into the gaps 114 in the split coupling flange 113 of the capbody 12. A rubber disk 121 is mounted within the downward couplingflange 12' at the bottom side of the cap body 12, having a neck 123' atthe center inserted into the center air hole 121a on the seat 112 of thecap body 12, and a convex flange 121a around the periphery. A T-cap 123which has a crossed stem raised from the center of a disk-like bodythereof is fastened to the neck 123' of the rubber disk 121 at thebottom. A sponge 122 is mounted around the crossed stem of the T-cap 123and retained between the rubber disk 121 and the disk-like body of theT-cap 123.
The air extracting unit 2 comprises a control cap 21, a piston 22, and aspring 23. The piston 22 is mounted within the outer upright tube 11 ofthe cap body 12, comprising an outward bottom flange 22a raised aroundthe periphery at the bottom, an outward upper flange 22b raised aroundthe periphery above the outward bottom flange 22a, a rubber seal ring22c mounted around the periphery between the outward upper flange 22aand the outward upper flange 22b, two top notches 225 bilaterallydisposed at the top, an inside annular groove 226 formed at the insidewall near the top, and a plurality of air gaps 221;222;223;224equiangularly spaced at the outward upper flange 22b. The spring 23 ismounted around the piston 22 within the outer upright tube 11 of the capbody 12, and stopped between the ring cap 115 and the outward upperflange 22b of the piston 22. The control cap 21 is covered on the piston22 above the ring cap 115, comprising an inside coupling flange 21aforced into engagement with the inside annular groove 226 on the piston22, and two inside locating rods 21b.
Referring to FIG. 5, after the sealing cap has been fastened to acontainer 400, the control cap 21 is reciprocated with the hand, causingthe piston 22 to be moved up and down within the outer upright tube 11of the cap body 12, and therefore air is extracted from the container400 and carried out of the sealing cap through the air gaps221;222;223;224 (see FIG. 5A). It indicates that the vacuum status hasbeen obtained when pumping repeatedly until strong resistance is felt.When releasing the vacuum status of the container 400, the control cap21 is turned in one direction to move the inside locating rods 21b intoalignment with the locating notches 115b on the ring cap 115, permittingthe control cap 21 to be forced downwards. When the control cap 21 isforced downwards, the spring 23 is forced to impart further downwardpressure to the bottom of the piston 22, which consequently force downthe pressure member 112b, causing the pressure member 112b to tilt theflap 112a (the pressure member 112b has a downward rod raised from thebottom near the border and stopped at the flap 112a) for letting outsideair pass to the inside of the container 400.
FIG. 6 shows an alternate form of the sealing cap. This alternate formis designed to match with an extraction pump.
It is to be understood that the drawings are designed for purposes ofillustration only, and are not intended as a definition of the limitsand scope of the invention disclosed.
What the invention claimed is:
1. A sealing cap fastened to a vacuumseal container and controlled to extract air out of said vacuum sealcontainer, the sealing cap comprising:a cap body fastened to the vacuumseal container, said cap body comprising an inner upright tubeperpendicularly raised from a top side thereof, an outer upright tubeperpendicularly raised from the top side around said inner upright tube,a seat defined within said inner upright tube at a bottom side, a splitcoupling flange raised around the periphery of said outer upright tubenear the topmost edge of said outer upright tube, two gaps defined atsaid split coupling flange at two opposite sides, a center air hole atthe center of said seat, and a downward coupling flange raised from abottom side thereof near the border; a flap mounted in said seat insidesaid inner upright tube of said cap body; a pressure member mountedinside said inner upright tube and forced to press on said flap, causingsaid flap to close said center air hole; a ring cap covered on saidouter upright tube and supported on said split coupling flange, saidring cap having two locating notches bilaterally disposed on the inside,and two downward coupling rods respectively engaged into the gaps in thesplit coupling flange of said cap body; a rubber disk mounted within thedownward coupling flange of said cap body and retained between said capbody and said vacuum seal container, said rubber disk having a neckinserted into the center air hole on the seat of said cap body; a T-capfastened to the neck of said rubber disk at a bottom side, said T-caphaving a crossed stem raised from the center of a disk-like body thereofand inserted through the neck of said rubber disk; a sponge mountedaround the crossed stem of said T-cap and retained between said rubberdisk and the disk-like body of said T-cap; a piston mounted within theouter upright tube of said cap body, said piston comprising an outwardbottom flange raised around the periphery at a bottom side, an outwardupper flange raised around the periphery above said outward bottomflange, a rubber seal ring mounted around the periphery between saidoutward upper flange and said outward upper flange and disposed incontact with an inside wall of said outer upright tube of said cap body,two top notches bilaterally disposed at a top end thereof, an insideannular groove the top end, and a plurality of air gaps equiangularlyspaced at said outward upper flange; a spring mounted around said pistonwithin said outer upright tube of said cap body, and stopped betweensaid ring cap and said outward upper flange of said piston, said springimparting a downward pressure to said piston, causing said piston toforce down said pressure member; and a control cap covered on saidpiston above said ring cap, said control cap comprising an insidecoupling flange forced into engagement with the inside annular groove onsaid piston, and two inside locating rods; wherein air is extracted outof said vacuum seat container when said control cap is moved with thehand reciprocate said piston in between said outer upright tube andinner upright tube of said cap body; outside air is allowed to passthrough said center air hole on said cap body into said vacuum sealcontainer when said control cap is turned in one direction to move saidinside locating rods into alignment with the locating notches on saidring cap and then pressed down to force said pressure member againstsaid flap in causing said flap to be tilted in on direction. | 2024-03-22 | 1998-01-21 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1999-11-30"
} |
US-38644382-A | Coating of artificially colored cherries
ABSTRACT
A process for coating artificially colored real cherries in which they are contacted firstly with an aqueous solution of an edible calcium salt, then with a warm aqueous solution of a low-methoxy pectin and finally with another aqueous solution of an edible calcium salt.
The present invention relates to a method of coating artificiallycoloured cherries to prevent the migration of the colour therefrom.
Some kinds of cherries, e.g., Bigarreaux Napoleon, do not possess theusual cherry red colour and when they are used in such commodities ascanned fruits they are usually artificially coloured with erythrosine.However, a problem with such artificially coloured cherries is that thecolour tends to migrate out of the cherries and this is particularlyunsatisfactory when the cherries are used in admixture with palecoloured fruits such as peaches and pears because the colour migratesout and colours the peaches and pears, which renders the canned fruitmixture undesirable in appearance to the consumer.
In order to try to prevent this migration of the artificial colour fromthe cherries one method used has been to fix the artificial colour tothe cherry by means of metallic fixing agents. Unfortunately, the use ofa metallic salt requires a complicated chemical process involvingseveral acid and alkaline washes in hot water to remove any colourantnot bound to the cherries. In addition, the colour fixation depends onthe cherry quality (ripeness, origin, etc.) and there is still a littlecolour migration which is especially noticeable during the sterilisationof a fruit cocktail mixture containing cherries together withpale-coloured fruits such as peaches and pears. Another method forpreventing migration has been tried which involves coating the cherrieswith an alginate. However, such a film does not prevent migration of thecolourant.
We have now unexpectedly found that a pectin "film" can be used toprevent the migration of colour from artificially coloured real cherriesby a process which is not only surprisingly simple but also extremelyeasy to manipulate. In our process, the cherries are coated with a gelformed by the reaction of an edible calcium salt and a low-methoxypectin.
Accordingly, the present invention provides a process for coatingartificially coloured real cherries characterised in that they arecontacted firstly with an aqueous solution of an edible calcium salt,then with a warm aqueous solution of a low-methoxy pectin and finallywith another aqueous solution of an edible calcium salt.
The cherries used in the process are those cherries, e.g., BigarreauxNapoleon, which do not have the normal cherry red colouration and have avery pale natural colour. Advantageously, they are cut into two halvesbefore they are artificially coloured. In order to maintain cherrytexture and to avoid cherry disfigurement due to osmotic pressure, theartificially coloured cherries are generally immersed in a sugarsolution for some time prior to coating. Thus, the creating pressureacting against the film in the storage syrup is counterbalanced.
The initial contact of the cherries with the edible calcium salt isconveniently carried out at ambient temperature, for example, by soakingthem in a bath containing an aqueous solution of the calcium salt. Theconcentration of the calcium salt in the aqueous solution may be from2.5% to 30% by weight, preferably from 5% to 25% by weight, andespecially from 7.5% to 20% by weight based on the weight of the water.The time of contact of the cherries with the calcium salt mayconveniently be from 0.5 to 15 minutes and preferably from 0.75 to 5minutes.
After contact with the edible calcium salt, the cherries are contactedwith the aqueous solution of the low-methoxy pectin, for instance byimmersion therein, conveniently at a temperature from 20° C. to 100° C.,preferably from 50° to 75° C. and especially from 60° C. to 70° C. Thecontact with the low-methoxy pectin may be carried out in acidconditions for instance at a pH of from 2.0 to 4.0, preferably from 2.5to 3.5 and preferably from 2.8 to 3.3. The desired pH is convenientlyobtained by adding the appropriate proportion of a food-acceptable acidsuch as citric acid. The concentration of the low-methoxy pectin in theaqueous solution may be from 1% to 10% by weight, preferably from 2.5%to 7.5% by weight and especially from 4% to 6% by weight based on theweight of the water. The time of contact of the cherries with thelow-methoxy pectin may suitably be from 10 seconds to 5 minutes.
The length of time that the cherries are contacted with the pectinsolution influences the thickness of the film, thicker films beingformed with longer contact times. Since thin films are desirable, thepreferred time of contact is from 10 seconds to 1 minute. The time ofcontact of pectin and calcium ions which is necessary to form a firmfilm decreases with increasing concentration of the calcium ions insolution and a uniform thin film is generally formed by a rapidreaction. Preferably, the concentration of the calcium ions in solutionis from 1.5 to 4 and especially from 2 to 3 times greater than theconcentration of the pectin in solution.
Finally, the cherries, which are covered by a layer of liquid pectin,are contacted once more with an aqueous solution of an edible calciumsalt, for instance, by allowing them to fall into a bath containing thecalcium salt solution. The solution of the calcium salt may convenientlybe at ambient temperature. The pectin on the surface of the cherriesbegins to harden on contact with the calcium salt. The concentration ofthe calcium salt is suitably the same as that used for the initialcontact with the cherries.
The contact of the cherries with a solution containing calcium ionsbefore coating with pectin is essential for good adhesion of the pectinfilm on the cherry surface. The contact of the cherries with a solutioncontaining calcium ions after coating with pectin ensures a firm gelformation both inside and outside of the pectin.
The edible calcium salt may be a salt of an edible organic acid such aslactic, gluconic, malic, citric or fumaric acid, or a salt of an edibleinorganic acid. Preferably, the salt is calcium chloride.
The low-methoxy pectin has a degree of esterification of less than 50%.Any low-methoxy pectin which reacts with calcium may be used and it mayconveniently be employed as the powder, suitable powders being soldcommercially by Obipektin under the name "Purple Ribbon."
The coating formed is strong, resistant, transparent, edible, insoluble,almost invisible and modifies neither the appearance nor the shape andstructure of the cherries. The colouration of these cherries is uniformand independent of the ripeness or origin of the cherries. The coatedcherries may be used in canned fruits.
The following Examples further illustrate the present invention:
EXAMPLE 1
Cherry halves artificially coloured with erythrosine were treated inthree stages as follows:
(1) They were soaked for 1 minute at ambient temperature in a bathcontaining an aqueous solution of calcium chloride having a dissolvedcalcium chloride concentration of 10% by weight;
(2) they were then removed from the bath and immersed for 1 minute in anaqueous solution of a low-methoxy pectin, sold by Obipektin under thename "Purple Ribbon" having a pectin concentration of 5% by weight, at70° C. with sufficient citric acid to produce a pH of <3.5;
(3) finally the cherries, covered with a layer of liquid pectin wereallowed to fall into another bath containing an aqueous solution ofcalcium chloride having a dissolved calcium chloride concentration of10% by weight. The pectin began to harden almost immediately on contactwith the calcium to form a strong and resistant film.
MIGRATION TEST
12 of the cherry halves coated by the above method were placed togetherwith 100 grams of pears (cut in cubes) in a glass vessel filled with asyrup containing 20% sugar. The vessel was closed and immersed inboiling water for 60 minutes. The coated cherries retained their colourentirely, no migration having occurred either into the syrup or thepears.
EXAMPLE 2
By following a similar procedure to that described in Example 1 but inwhich, in each bath of calcium chloride solution, the concentration ofdissolved calcium chloride was 20% by weight, a strong and resistantskin was quickly formed on the cherries.
The migration test as described in Example 1 was carried out on thecoated cherries of this Example and again no migration occurred eitherinto the syrup or the pears.
COMPARATIVE EXAMPLES A, B, C AND D
Cherry halves artificially coloured with erythrosine were treated in thefollowing way.
Comparative Example A--Treated as in stage 1 of Example 1.
Comparative Example B--Treated as in stage 1 and then stage 2 of Example1.
Comparative Example C--Treated as in stage 2 of Example 1.
Comparative Example D--Treated as in stage 2 and then stage 3 of Example1.
The migration test described in Example 1 was carried out on the treatedcherries of these Comparative Examples and both the syrup and pears werecoloured red in each case, showing that migration had occurred.
COMPARATIVE EXAMPLE E
By following a similar procedure to that described in Example 1 but inwhich the concentration of pectin in the aqueous solution was 1% byweight, the film formed was fragile, and considerable migration occurredwhen the migration test described in Example 1 was carried out.
COMPARATIVE EXAMPLE F
By following a similar procedure to that described in Example 1 butusing, instead of the low-methoxy pectin solution, an aqueous solutionof sodium alginate sold by Fluka AG, the film formed did not prevent themigration of colour when the migration test described in Example 1 wascarried out.
We claim:
1. A process for coating artificially coloured real cherriesto prevent the migration of the colour therefrom which comprisescontacting said cherries with (i) an aqueous solution of an ediblecalcium salt, then (ii) with a warm aqueous solution consistingessentially of a low-methoxy pectin having a concentration of from 2.5to 10% by weight based on the weight of water, and then finally (iii)again with an aqueous solution of an edible calcium salt.
2. A processaccording to claim 1, wherein the concentration of the calcium salt isfrom 5% to 25% by weight based on the weight of the water.
3. A processaccording to claim 1, wherein the cherries are contacted with theaqueous solution of the low-methoxy pectin at a temperature from 50° C.to 75° C.
4. A process according to claim 1, wherein the aqueoussolution of the low-methoxy pectin has a pH from 2.5 to 3.5.
5. Aprocess according to claim 1, wherein the concentration of thelow-methoxy pectin in the aqueous solution is from 2.5% to 7.5% byweight based on the weight of the water.
6. A process according to claim1, wherein the edible calcium salt is calcium chloride. | 2024-03-22 | 1982-06-09 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1984-05-15"
} |
US-17181598-A | Faucet cartridge having a plane shutter member
ABSTRACT
A cartridge for a one-way hydraulic faucet of the type having a plane shutter member includes a cartridge body having a bottom portion with a hollowed cylindrical seat housing a sleeve packing provided with elastic pushing elements; the plane shutter member is formed by a slide which is guided within the cartridge body for diametrical movement with respect to the body, is kept in operative contact with the sleeve packing, and shows an opening suitable for registering, in a position of the slide, to the passage of the sleeve packing, whereas the slide, in another position, closes that passage; and the slide is kinematically coupled to an inner arm of the lever, which is pivoted in the cartridge body and whose outer arm forms the control member of the faucet. The slide is manufactured of plastics and it may be provided with a thin sheet having a high resistance, in order to prevent its erosion.
BACKGROUND OF THE INVENTION
This invention refers to a cartridge for a one-way hydraulic faucet ofthe type having a plane shutter member.
DESCRIPTION OF THE PRIOR ART
The cartridges of the type taken into consideration have, in most cases,a rotary shutter member with an excentrical passage opening, whichco-operates with a fixed seal packing and, under action of a rotarycontrol member, is made to rotate between a position of complete openingand a position of complete closure, through intermediate positions ofregulation of the delivery rate. The main drawback of this structureresides in that the travel from the complete opening and the completeclosure covers a very limited angular field, whereby the control of thedelivery rate is difficult for the user and is little sensitive, becauseit needs to be done by means of very limited angular displacements.
There are also known cartridges of the type taken into consideration,wherein two plates of ceramic material are installed, the one,unmovable, being provided with an inlet opening and an outlet opening,and the other being movable in translation under action of a tiltingcontrol lever, and being provided with a channel intended to connect thepassage openings of the unmovable plate. In this case, by choosing asuitable ratio between the arms of the control member, it is possible torender the control sensitive enough. However a drawback of thesecartridges, which are of the closed type, resides in that the presenceof two passage openings in the unmovable plate needs that these openingsare disposed in an eccentric manner, and this involves providingcomplicated passageways in the faucet body for which the cartridge isintended. Moreover, the manufacture of such a cartridge is expensive dueto the use of plates of ceramic material.
SUMMARY OF THE INVENTION
Therefore, the object of this invention is to find a remedy for all or apart of these drawbacks of the known cartridges, though preserving therespective advantages. More particularly, it is intended that thecartridge should afford an easy and sensitive control, that itsmanufacture cost should be limited, that its duration in use should besatisfactory, and that no complicate shape should be needed for thefaucet body in order to allow installing the cartridge.
This object is attained, according to the present invention, in acartridge for a one-way hydraulic faucet of the type having a planeshutter member, in that: the cartridge includes a cartridge body havinga bottom portion wherein there is hollowed a cylindrical seat housing asleeve packing provided with elastic pushing means; the plane shuttermember is formed by a slide which is guided within the cartridge bodyfor diametrical movement with respect to said body, is kept in operativecontact with said sleeve packing, and shows an opening suitable forregistering, in a position of the slide, to the passage of said sleevepacking, whereas the slide, in another position, closes said passage;and said slide is kinematically coupled to an inner arm of a lever,which is pivoted in the cartridge body and whose outer arm forms thecontrol member of the faucet.
Preferably, said slide is manufactured of a suitable plastic material.
Preferably, said sleeve packing is installed in the bottom portion ofthe cartridge body in a central position.
Thanks to these features, the control of the faucet may be rendered easyand sensitive by means of a suitable choice of the ratio between the twolever arms. Because the closure of the faucet is ensured by the sleevepacking, the slide does not need to be manufactured of an expensivematerial such the ceramics, on the contrary it may be made of a suitableplastics, whereby the manufacture of the cartridge is easy and cheap.Because such a cartridge is of the open type, the bottom of the cavityof the faucet body, intended to house the cartridge, only needs to havea passageway for water inlet, which moreover may be central, wherebythere is no need for a complicated structure of the faucet body.
Preferably, said slide includes a thin protective sheet applied to itssurface which co-operates with the sleeve packing. Said thin protectivesheet may be of metal or it may be made of a synthetic material havinghigh characteristics.
This way, the slide may be made of a particularly cheap plastics which,in view of its scarce characteristics, could not resist on the long timeto the erosive action due to the water flow in the conditions ofconsiderable throttle, but it is protected with respect to said erosiveaction by the thin protective sheet, which is made of a more expensivematerial but in view of its very little quantity does not have aconsiderable influence on the cartridge cost.
Preferably, the control lever is pivoted in the cartridge body by meansof a spherical shape of an intermediate portion of the lever and acomplementary shape of a seat in the cartridge body, a suitable packingbeing provided, preferably shaped as a so-called quadring.
BRIEF DESCRIPTION OF THE DRAWINGS
These and other features, objects and advantages of the subject of thepresent invention will appear more clearly from the followingdescription of an embodiment being a non-limiting example, withreference to the appended drawings, wherein:
FIG. 1 shows the cartridge according to the invention in the closureposition and in an axial cross section, transversal with respect to thedirection of the slide movement, namely a section taken along line I--Iof FIG. 2;
FIG. 2 shows the same cartridge in an axial cross section, longitudinalwith respect to the direction of the slide movement, namely a sectiontaken along line II--II of FIG. 1;
FIG. 3 shows the cartridge in a cross section corresponding to that ofFIG. 2, but in the position of complete opening; and
FIG. 4 shows a transversal cross section of the cartridge, taken alongline IV--IV of FIG. 3.
DESCRIPTION OF THE PREFERRED EMBODIMENT
The cartridge comprises a body 1 which, in this case, is made of asingle piece with a bottom portion 2, and wherein are made openings 3for the delivery of the water controlled by the cartridge; thiscartridge is, therefore, of an open type. The bottom portion 2 isprovided with a packing 5 intended to seal with respect to a water inletchannel, and in the shown embodiment it has some pins 4 intended forestablishing the position of the cartridge when it is inserted in afaucet body (not shown). Different positioning means may be foreseen indifferent embodiments of the cartridge. In the bottom portion 2 there ishollowed a cylindrical seat 6, wherein is installed a sleeve packing 7,made of an elastomeric material and pushed by a spring 8.
In the cartridge body 1 is housed a plane shutter member having theshape of a slide, comprising a bottom part 9 with a passageway 11 and atop part 10 with a coupling seat 12. The passageway 11 is so disposedand sized that, in a position of the slide (FIG. 3: opening position)the passageway 11 registers with the passageway of the sleeve packing 7,whereas in another position of the slide (FIG. 2: closing position) thepassageway 11 does not communicate with the passageway of the sleevepacking 7, whereby this latter is closed. As it may be understood, inthe intermediate positions between the two described and shown, thepassageway 11 registers only in part with the passageway of the sleevepacking 7, which therefore is not closed but is more or less throttled.
The slide 9-10 is axially kept in its position within the cartridge body1 by means of an inner member 13, inserted in the body 1 and havingtongues 14 which prevent its rotation. The inner member 13 is providedwith projecting portions 15, and between these latter is mounted the toppart 10 of the slide 9-10, which in this way is guided for a diametricalmovement with respect to the body 1. Moreover the inner member 13 has,opposite the projections 15, a partially spherical seat 16.
On its turn, the inner member 13 is kept in its position within body 1by a cover 17, which is mounted on body 1 in any way (for example bymeans of elastically snapping teeth, not shown, or by sticking orwelding), which at its inner portion forms a partially spherical seat18.
Between the partially spherical seats 16 and 18 there is seated thepartially spherical intermediate portion 19 of a two-arm lever, whoseinner arm 20 is coupled with the coupling seat 12 of the slide 9-10,whereas the outer arm 21 (usually provided with a lever, cap or handle,not shown) forms the control member for the faucet. A seal packing 22,for example of the type called "quadring", seals among the sphericalportion 19 of the control lever and the spherical portions of the cover17 and the inner member 13, respectively. In the shown embodiment,packing 22 is mounted in equatorial position with respect to the partialsphere 19, but in other embodiments it could be situated in differentmanners. As it may be understood, by causing the control member 21 totilt, the slide 9-10 is caused to displace diametrically and thereforethe flow traversing the faucet is controlled.
When the passageway 11 of the slide 9-10 closes in an about completemanner the passageway of the sleeve packing 7, the water flow is highlythrottled and it assumes a great speed and erosive capacity, which isapplied to the rims of passageway 11. In order that these rims are notdamaged, the slide 9-10 may be manufactured of a high quality plastics,such as those based on polysulfones. However such plastics are somewhatexpensive. Therefore, in certain cases it is preferable to use for theslide 9-10 a cheap plastics, and provide its surface intended toco-operate with the sleeve packing 7 with a thin sheet of a material 23suitable for resisting to the erosion, fixed to the slide. This thinsheet may be made of a high quality plastics or, preferably, by a thinsheet of metal, for example stainless steel.
As it may be understood from the above, the cartridge according to thepresent invention collects together substantially all the advantages ofthe different types of known cartridges, by obviating most of theirdrawbacks; it is easy to use, has a considerable control sensitivity, isrelatively cheap in manufacture and does not raise particularinstallation problems. Moreover it is easy to design the same in orderto satisfy different installation requirements.
An advantage afforded by the cartridge according to the inventionresides in that, particularly when its inlet opening is in a centralposition, it may be mounted in a body of simple shape, which may replacethe usual screwed upper part of an existing faucet.
It should be realized that the invention is not limited to theembodiment which has been described and shown as an example. Somepossible changes have been described, and other are within the skill ofany technician. For example, the bottom part 2 of body 1 could beapplied to the body instead of being integral therewith; the sleevepacking 7 may be mounted, when needed, in a non-central position; it maybe pushed by an elastic member different from a spring, or even by itsown elasticity; the shape of slide 9-10 may be chosen in variousmanners; its diametrical guidance within the cartridge body may beobtained in different manners; and the control lever may be pivoted inany manner different from a partially spherical intermediate portion.
These and other changes and any replacement by technically equivalentmeans may be introduced without departing from the spirit of theinvention and the scope of this Patent.
I claim:
1. A cartridge for a one-way hydraulic faucet, comprising acartridge body having a bottom portion;a single cylindrical seathollowed in a central position in said bottom portion of said cartridgebody; a sleeve packing having a passage; and an elastic pushing meansfor said sleeve packing, both said sleeve packing and said elasticpushing means inserted in said cylindrical seat; a plane shutter memberin the form of a slide, mounted and guided within said cartridge bodyfor only diametrical movement with respect to said cartridge body, saidslide being kept in operative contact with said sleeve packing andhaving a single opening suitable for registering, in a position of theslide, with said passage of the sleeve packing, whereas the slide, inanother position, closes said passage; and a two-arm lever pivoted insaid cartridge body, said lever having a first inner arm kinematicallycoupled to said slide, and a second outer arm forming a control member.2. A faucet cartridge as set forth in claim 1, wherein said slide ismanufactured of a plastic material and includes a thin protective sheetapplied to the surface thereof for co-operating with said sleevepacking, said protective sheet being made of metal.
3. A faucetcartridge as set forth in claim 2, wherein said metal is stainlesssteel.
4. A faucet cartridge as set forth in claim 1, further comprisinga cover, and wherein said control lever has a partially sphericallyshaped intermediate portion, said cartridge body has a seat whose shapeis complementary to the shape of said intermediate portion of the lever,said intermediate portion of the lever being housed in said seat of thecartridge body, and a seal packing having a substantially square crosssection being housed in said seat of the cartridge body and co-operatingwith said intermediate portion of the lever and with said cover.
5. Afaucet cartridge as set forth in claim 1, wherein said cartridge bodycomprises an inner member mounted so as not to be allowed to rotate,said inner member having projecting portions forming a guide for saidslide, and said cartridge body having a cover adapted to keep in theirpositions all parts of the cartridge, said seat for the intermediateportion of the control lever being formed in part by said inner memberand in part by said cover. | 2024-03-22 | 1998-03-09 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "2000-04-04"
} |
US-61785975-A | Method and apparatus for processing seismic signals from low energy sources
ABSTRACT
A system and method for carrying out seismic operations with low energy sources, which involves operating the source at spaced points along a seismic spread, the source points are spaced far enough apart so that their seismic waves originate at different points and travel by different paths to the geophones. The geophone outputs cannot be time stacked. The geophone signals are amplified at constant gain and digitized to 1 bit. If the low energy source is a vibratory source, the 1 bit signals are correlated with a 1 bit version of the sweep signal. The resulting correlograms are digitized to 1 bit and then C.D.P. stacked and displayed. If the low energy source is impulsive, the 1 bit amplified signals are C.D.P. stacked and displayed.
BACKGROUND OF THE INVENTION
This invention lies in the field of seismic geophysical prospecting.More particularly it relates to the processing of seismic signals. Stillmore particularly it relates to the processing of seismic signalsderived from low energy sources, both impulsive sources of relativelyshort time duration, and low energy oscillatory sources of long timeduration. Still more particularly it relates to the digital processingof seismic signals from low energy sources.
In the early days of seismic exploration, the type of source used forinitiation of seismic waves in the earth was an explosive material, suchas dynamite. In reflection seismic operations, the dynamite charges werealmost exclusively detonated in the bottom of a shallow bore hole, orshot hole, commonly of depth in the range of 50-100 feet, although attimes as great at 500 feet or more. The shothole was generally filledwith water to tamp the charge, that is, to couple the explosive moretightly to the earth.
The geophysicists early discovered that the surface layers of the earthwere anomalous, in that they had a very low seismic propagationvelocity. This led to errors in determining the travel time of thevertically travelling seismic wave through the surface layers, which wasgenerally called the "weathered layer".
It was found that setting off a dynamite charge at the surface of theearth failed to give as much energy to a deep horizon, than if the samecharge was detonated in a borehole at the base of the weathered layer.Therefore, in spite of the extra cost and time of drilling shot holes,and providing the water necessary to drill the holes, and for tampingthe charges, this type of operation continued because of the need forinformation regarding the characteristics of the weathered layer.
This continued for many years until experiments were carried out todevelop seismic sources for use on the surface of the earth. The firstof these was called the "weight drop". This involved the use of a largemetal block that was lifted to a selected distance above the ground(about 8-12 feet), and suddenly released, permitting it to fall andimpact the earth. This impulse on the ground surface did indeed send outa seismic wave which was reflected back from subsurface geologicalinterfaces. However, the geophone signals recorded were extremely noisy,and by the customary process of visually examining seismic records,there was no evidence of the "reflections" that were easily perceived onrecords recorded from high energy charges in the shot holes.
It quickly became clear, that if any use was to be made of such lowenergy sources as the weight drop, there must be some way to add a largenumber of such noisy records so as to relatively increase the signalstrength and reduce the noise. Saying this in another way, the signal tonoise ratio of a single record from a low energy source is very low, toolow to be used by conventional visual interpretational methods.
As a result of the need to add repetitive records, a magnetic recordingsystem was devised, which was an analog recording system. Such systemscontinued in general use in the industry for recording records from lowenergy sources. To do this, the source and geophone positions weremaintained the same and the signals from successive repetitions of thesource were added in time synchronism. The successive records wererecorded magnetically for the same position of the source and thegeophones. The name given to the process was "adding", "stacking", "timestacking", "compositing" etc. This was used with all types of weaksources, such as the weight drop, the "Vibroseis", and the "Dynoseis",and others, which subsequently came into general use.
The early stacking systems were analog magnetic recording, and remainedin general use for many years. Then about 1965, there was a generalchange to ditigal magnetic recording of seismic signals. Such digitalrecording systems involved amplifiers of high gain and variable gain,until today, the latest systems involve binary-gain-ranging amplifiersthat can record digitally the amplitudes of seismic signals to 16 bits.
Although the present low energy systems are applied to the surface ofthe earth, other means have been devised for overcoming the lack ofprecise velocity information in the weathered layer.
Also, about 15 years ago, there came into general use a different typeof trace stacking or compositing. The stacking system previouslydescribed involved adding signals derived from the repetition of asource, where the two signals, or traces were added with theirinitiation times superimposed. That is, they were added in timealignment.
The new method of stacking, based on U.S. Pat. No. 2,732,906 and others,was called "Common Depth Point" or "Common Reflection Point" stacking.These are generally referred to as C.D.P. and C.R.P. stacking. In addingtraces in C.D.P., the traces must be from different sources andgeophones. The important criterion is that all stacked traces must bereflected from the same depth point, or subsurface reflection point. Allother portions of the travel paths of the traces are different.
While both time stacking and C.D.P. stacking improved the signal tonoise ratio (S/N R) by partially cancelling random noise and addingsignal, C.D.P. stacking had many other advantages not possessed by timestacking. Consequently, C.D.P. stacking came into wide use withconventional high energy sources, that is, large explosive charges,where high amplitude traces were recorded. Thus it became generalpractice to record seismic traces to 16 bits and then to C.D.P. stack.
In C.D.P. stacking, the "fold" of the stack, that is the number ofseparate traces stacked to arrive at the final trace (such as two-fold,4 fold, 12 fold etc) is very important. The larger the fold number, thebetter the S/N R. C.D.P. stacking is not as simple to perform as is timestacking. In the latter simple synchronous adding of successive tracesis sufficient. In C.D.P. stacking a great multiplicity of separatetraces, each with different source point and geophone, must be storeddigitally in a computer, and recalled in selected order. Consideringthat each trace is digitized at successive intervals of 0.001, 0.002, or0.004 seconds, etc. with amplitudes recorded to 16 bits, great volumesof memory are required. For example, in Vibroseis operations, there maybe 100-250 traces, or more for each record, and each record may berecorded for 10-30 seconds, digitized at say 0.004 seconds to 16 bits.This adds up, conservatively to 20 million bits per record trace. So if20 fold operations are to be carried out, more than 400 million bitsmust be stored.
Therefore, while high C.D.P. fold is desirable, because of the 16 bitsignals and the large storage required, it has become common practice totime stack the traces (say up to 20 times) and then process by C.D.P.stacking, it being felt that the 16 bit digitizing is important, even inview of the poorer stack obtained.
Or, to put it another way, the time stacking of the weak signals wascarried over from analog operations to digital processing. The C.D.P.stacking was carried over from high energy source work, where it wasstandard practice to digitize to 16 bits. So now it is standardpractice, with low energy sources to time stack to bring the signalamplitude up to where 16 bits is meaningful, and then to C.D.P. stack.
In the case of Vibroseis operations it has always been standard practicewith digital processing to correlate the trace signals digitized to 16bits with the sweep digitized to 16 bits.
SUMMARY OF THE INVENTION
It is a primary object of this invention in processing seismic recordsfrom low energy sources, to overcome the need for very large memorystorage in high fold C.D.P. stacking, by digitizing individual traces to1 bit, thus cutting the memory size to store 1 trace by a factor ofabout 1/16, thus making it possible to multiply the C.D.P. fold by afactor of about 16 for the same total size of memory required.
It is a further object of this invention to process seismic records fromlow energy sources such as Vibroseis, by;
a. initiating each seismic wave at a different spaced source point;
b. recording seismic traces to 1 bit;
c. correlating the 1 bit trace with a 1 bit digitization of the sweep,to obtain a multi-bit correlated trace, digitizing the correlogram to 1bit, and
d. C.D.P. stacking the 1 bit correlated traces.
These and other objects are realized and the limitations of the priorart are overcome in this invention by eliminating the time stacking ofthe low energy signals, and digitizing the detected signals to 1 bit, toprovide multi-bit correlated traces, which are then digitized to 1 bit,stored, and C.D.P. stacked.
BRIEF DESCRIPTION OF THE DRAWINGS
These and other objects and advantages of this invention and a betterunderstanding of the principles and details of the invention will beevident from the following description taken in conjunction with theappended drawings, in which;
FIG. 1 illustrates the prior art normal seismic field system.
FIG. 2 illustrates the prior art time stacking.
FIG. 3 illustrates the prior art C.D.P. stacking.
FIG. 4 illustrates the prior art seismic recording and processingsystems.
FIG. 5 illustrates the preferred embodiment of the seismic recording andprocessing system of this invention.
FIG. 6 illustrates a combination of prior art 16 bit recording andcorrelation with 1 bit C.D.P. stacking.
DESCRIPTION OF THE PREFERRED EMBODIMENT
Referring now to the drawings, there is shown in FIG. 1 a conventionalprior art seismic system involving a low energy source, such as a weightdrop, Dynoseis, Vibroseis, or other suitable low energy source,including a low energy explosive shot on the surface of the earth.
While this invention can be used with both impulsive sources of shorttime duration and oscillatory sources of relatively long time duration,it is most valuable for the latter systems, such as Vibroseis,particularly because of the large memory storage required in theacquisition of multi-bit composited uncorrelated data.
There is a seismic source 10, which will, for convenience be consideredto be a vibrator source, controlled by an oscillatory sweep signal, ofselected frequency band width, and selected time duration. The vibrator10 is applied to the surface 12 of the earth 14 in the customary manner.Generally a plurality of vibrators, generally 3 or 4 or more are used,although only one is shown. All the vibrators are driven in synchronismby the same sweep signal, the purpose being to multiply the seismicenergy imparted to the earth, in proportion to the number of vibrators.Since the vibrators are driven as a single source, they are placed inclose proximity to each other, and together represent a single sourcepoint.
A plurality of spaced geophones, or other vibration detectors arepositioned at or near the surface 12 of the earth. They are connected bycables 18 to a corresponding plurality of variable gain amplifiers 20,as is well known in the art.
The art of seismic amplifiers has developed over the past 40 years orso, in the direction of higher gain and higher fidelity. More recentlythey have included binary-gain-ranging amplifiers, to provide a highamplitude of signal, of known binary gain at all times. Generally theseamplifiers are digitized to 16 or more bits.
The outputs of the amplifiers go to apparatus, indicated for simplicityas analog to digital converter 22, for converting the analog outputsignal to a digital signal. Generally this apparatus will involvemultiplexing and analog to digital conversion as is well known in theart. The signals then go to a summer 24, which is a magnetic recordingdevice, available on the market for adding, or compositing, or stackingseismic traces. Generally 10-20 or more repetitions of the vibratorsweeps are carried out, and the corresponding trace signals are added inthe summer. At any one time, the signal stored in the summer is the sumof all repetitions of the sweep for the particular position of thevibrators. While the vibrators do move a short distance (such as 10-20feet) between repetitions, this is mainly to have a fresh earth surfacefor each sweep, so that successive seismic waves generated will be thesame. However, the distance travelled between sweeps is small comparedto the spacing between geophone groups, or traces on the ground. Thesummed record is then recorded on magnetic tape for further processing.
To summarize the description of FIG. 1;
1. the multiple vibrators are driven in synchronism with the same sweepsignal,
2. the vibrators are closely spaced, and move between successive sweepsonly a short distance, so that all sweeps can be considered asoriginating at a single source point,
3. the geophone signals are amplified with a variable gain amplifier,and the amplitudes are digitized at successive digitizing intervals to16 bits,
4. the geophone signals from successive sweeps from the same sourcepoint are stacked in time synchronization.
The summing action in the time stacking process is indicated in FIG. 2.There are a plurality of separate traces indicated as A, B, C, . . . N.These are shown as analog traces, for convenience. Although timestacking was originally done in analog form, today, the conventionalpractice is to use the digital summer, after the traces are digitized.
Because of the weak (low energy) source, the detected traces A, B, C, .. . N are of poor signal to noise ratio, and the noise masks whateversignal (reflection events) may be present. However, by adding the tracesa sum, or stacked trace S is derived, in which the random noise has beenreduced and the signal enhanced. Thus in the sum trace S, the individualreflection events at times T1 T2, and T3 are now obvious over the noise.It will be clear that in time stacking, the traces are added at eachvalue of time after the time reference To.
Referring to FIG. 3, there is shown another method of stacking traces.IT is called common reflection point, or common depth point stacking.Shown are a plurality of geophone groups 41A, 41B, . . . 41P arrayedalong a survey line on the surface 44 of the earth 46. A reflectionhorizon 48 is shown. A vibrator (or group of vibrators) operatessuccessively along the survey line at positions every third geophonegroup, for example. With the vibrator at position 42A, which coincideswith geophone position 41A, seismic wave energy may go by path 50A toreflecting area or depth point 50, and then be reflected upward togeophone 41M. Also energy may go by path 52A to depth point 52, and thenbe reflected upward to geophone group 41P, etc. Similarly, when thevibrator 42B is at geophone position 41D, it will send seismic waveenergy to depth point 50 by path 50B, and point 52 by path 52B etc. andthe reflected energy wil go by paths 50D to geophone 41J, and path 52Eto geophone 41M, etc.
It will be seen that the path 42B, 50B, 50, 50D, and 41J, and the path42A, 50A, 50, 50 and 41M have something in common; they are bothreflected at a common depth point 50. By adding the signals or tracestravelling by these two paths, they are C.D.P. stacked. This kind ofstacking not only cancels out random noise, it cancels out other typesof unwanted signals, such as multiple reflections, etc. Therefore, whereit can be done, C.D.P. stacking is much preferable to time stacking.
Consider FIG. 4, which is a block diagram of a conventional vibroseistype of seismic recording and processing system. The geophone group 60is connected by cable 61 to its gain ranging amplifier 62 and to ananalog/digital converter 64, and, as a 16 bit word, it goes to a digitalsummer, or time stacker 66, and to a recorder 68. This is generally amagnetic tape, which then is carried to a processing computer, by dashedpath 70 to a tape playback 72. The summed, or added, or stacked, signalsare then correlated in a 16 bit × 16 bit correlator 74, against a 16 bitsweep signal from lead 75. The correlated signals of 16 bits are thenC.D.P. stacked in stacker 76, and displayed 78.
In reviewing the prior art status of the seismic prospecting industryabove, the process can be simply stated as:
a. gain ranging amplification,
b. digitization to 16 bits,
c. time stacking successive repetitions;
d. correlation to 16 × 16 bits,
e. C.D.P. stacking, and
f. display.
We have found that by detecting the original geophone signals anddigitizing them to 1 bit, and correlating the 1 bit signals with a 1 bitversion of the sweep signal, and digitizing the resulting correlogram to1 bit, a 1 bit correlation trace is provided. Now, by C.D.P. stackingthe successive correlation traces, a stacked record is provided whichcan achieve a signal to noise ratio higher than that provided by theprior art systems, due to the potential for higher fold C.D.P. stacking.
Our improved system is illustrated in FIG. 5. The geophone group 60signal on lead 61 goes to a constant gain amplifier 80. The output ofthe amplifier 80 goes to a 1 bit digitizer in the A/D box 82. The 1 bitdigitized signal is correlated in 84 against a 1 bit version of thesweep on lead 85, to provide a multi bit correlated trace on lead 87.This multi bit trace is then digitized to 1 bit in 86. The 1 bitcorrelated traces are then C.D.P. stacked in 88 and displayed 90. If thesource is impulsive, the 1 bit signal then by-passes the correlator 84,and goes by way of 65,85, and 87 to the C.D.P. stack.
Shown in FIG. 6 is a combination of FIGS. 4 and 5. This provides for thegeophones 60 to transmit their signals 61 to a conventional multibit(GRA) amplifier 62. The signals are then digitized to multi bits (16bits) in 64.
If the source is impulsive, the signals then pass by way of 65 dashedline 73, and 75 to 86 where they are digitized to 1 bit.
If the source is vibratory, the 16 bit signals from 64 go by way of 65to a 16 × 16 bit correlator 74, and by way of 75 to 86 to be digitizedto 1 bit. The 1 bit signals are C.D.P. stacked in 88 and then displayed90, in a conventional manner.
In important part of this invention is the reduction (to zero ifpossible) of straight stacking, and the increase to high fold C.D.P.stacking. By high fold we mean, in the range of 40 to 50 or more up tomany hundreds. To handle this high fold C.D.P, it becomes essential toto reduce the multi-bit signals to 1 bit for storage and gather.
Since the signals are to be digitized to 1 bit before C.D.P. stack, itseems to be more logical to follow FIG. 5 rather than FIG. 6, for bothimpulsive and vibratory signals. The digitizer 86 is required, since inthe correlation process, even though 1 bit signals are correlated, thesumming action provides multibit correlograms. For conventionalcomputers which handle 16 bit words, there is no speed advantage incorrelating 1 bit words, since they must be filled out to 16 bits.However, with special equipment, the 1 bit signals could be correlatedmore rapidly than the 16 bit signals.
Why wasn't this system discovered earlier? The reason, we believe, isthat the seismic industry believed too strongly that the best amplifiersystem, for use in seismic recording was one that had the widest rangeof recording without distortion, and a true amplitude measurement at alltimes. This concept was carried over even to the records recorded fromlow energy sources, even though the records contained very low signalamplitude.
It was not until Fort et al (U.S. Pat. No. 3,883,725) discovered that itwas possible to record seismic records to 1 bit and by stacking aselected number of repetitions, that it was possible to provide a finalrecord undistinguishable from the conventional record using 16 bitrecording. Also, the seismic industry believed and still believes thatthe correlation of seismic records must be made between two 16 bitsignals.
We have discovered that it is possible to correlate the 1 bit recordtrace with a 1 bit sweep, to get the same final records, provided thatthere are the same number of repetitions or stacks.
This 1 bit × 1 bit correlation and the storage of all traces as 1 bitsignals makes it possible to do all the stacking in the C.D.P. mode, andthereby to obtain a greater benefit in S/N R, reduction of interferencefrom multiple reflections, and other benefits, without any greater costin apparatus or time, than in the conventional system.
Of course, our system, as shown in FIG. 5 permits great simplificationin the field data gathering system, such as elimination of the gainranging amplifier and digitizer. However, this forms no part of ourinvention, and was discovered by Fort et al.
Our system also eliminates the summer as conventionally used. Also, thesimplification taught by Fort et al permits inclusion in the fieldrecording instruments of a minicomputer and peripheral equipment so thatthe recorder and playback 68,72 can, in effect, be eliminated. Thispermits the correlations to be made on line, as the traces are recorded,because the 1 bit × 1 bit correlation is so fast.
However, the main improvement is the high fold of C.D.P. stackingpermitted with no greater memory required, because of the 1 bitcorrelated signals handled. This high fold C.D.P. stacking providesgreat improvement in the record quality.
In review, this invention is based primarily on two facts, on ourdiscovery that correlation of seismic signals can be made with 1 bitsignal and 1 bit sweep, and the resulting correlograms can be digitizedto 1 bit, to provide equal or better final records, provided that thesame number of repetitions of the source are provided. This then leadsto the second point, namely, that by operating the source in a C.D.P.stacking format, that is, by moving the source to spaced positionsbetween sweeps, the high fold of C.D.P. stacking can be provided.
While this method is ideal for Vibroseis type of operation, it isequally useful to impulsive source operations, and even with high energysources.
In current high energy source operations, it is customary to do C.D.P.stacking on the received signals. However, because of the 16 bitdigitization of the signals, the practical limitations of storage, andthe expense of computer operations in performing the C.D.P. stacking,the number of fold is usually quite limited, such as for example, 6fold, 12 fold, or as much as 24 fold. However, in this invention, withthe handling of signals digitized to one bit, it should be possible tohandle of the order of 15 or 16 times as many fold. Thus, in thisinvention we envision using as many as 50 to 500 fold C.D.P. stacking,without any larger computer or storage capacity, and at less cost.
While we have described the operation of C.D.P. stacking in terms of alinear array of geophones, this was only for the purpose of illustrationand convenience. It is well known that C.D.P. stacking can be done with2-dimensional arrays of geophones and/or sources, and the principles ofthis invention are applicable to C.D.P. stacking in seismic operationsfor all possible arrays.
While our invention has been described with a certain degree ofparticularity, it is manifest that many changes may be made in thedetails of construction and the arrangement of components and details ofoperation, It is understood that the invention is not to be limited tothe specific language used or the specific embodiments set forth hereinby way of exemplification of the invention, but the invention is to belimited only by the scope of the attached claim or claims, including thefull range of equivalence to which each element or step thereof isentitled.
What is claimed is:
1. In a seismic prospecting system, having;a. a lowenergy seismic source; b. a plurality of geophones at spaced positionsdistant from said source; c. means to amplify and digitize the geophonesignals; the method of operation and processing the seismic datacomprising;1. operating said source in C.D.P. format, whereby eachsource operation is at a different spaced-apart independent position; 2.amplifying and digitizing the geophone signals to 1 bit;
3. C.D.P.stacking said 1 bit digitized signals; and wherein
4. the C.D.P. fold isat least
40. 2. The method as in claim 1 in which said source is avibratory source, and including the steps between steps (2) and (3) ofcorrelating said 1 bit digitized signals with a 1 bit digitized versionof the reference signal that drives the vibrator; and digitizing theresulting correlograms to 1 bit, to form 1 bit digitized signals.
3. Themethod as in claim 1 in which said low energy source is a vibratorysource driven by an oscillatory sweep signal of selected frequency bandwidth and time duration.
4. The method as in claim 1 in which said lowenergy source is a weight drop source.
5. The method as in claim 1 inwhich said source is a gas exploder type of source.
6. The method as inclaim 1 in which said source is a small explosive charge detonated nearthe surface of the earth.
7. The method as in claim 1 in which saidsource comprises a plurality of low energy sources, positioned at thesame source point, and synchronized in time.
8. The method as in claim 1including the steps of repeating said source at least a second time ateach of the C.D.P. source positions, straight stacking the 1 bitdigitized geophone signals resulting from the first and said repeatedsource, and digitizing said stacked signals to 1 bit to form 1 bitdigitized signals.
9. The method as in claim 1 in which the C.D.P. foldnumber is at least
100. 10. The method as in claim 1 in which the C.D.P.fold number of the C.D.P. stack is at least
50. 11. The method as inclaim 1 in which said geophones and sources are in a linear array. 12.The method as in claim 1 in which said geophones and said sources are ina 2-dimensional array.
13. In a seismic prospecting system having;a. avibratory source driven by a reference sweep signal; b. a plurality ofgeophones at spaced positions distant from said source; c. and means toamplify and digitize the geophone signals; the method of operation andprocessing the seismic data, comprising;1. operating said source inC.D.P. format, whereby each source operation is at a differentspaced-apart independent position;
2. amplifying and digitizing saidreceived signals to form a 1 bit received signal;
3. digitizing saidreference sweep signal;
4. correlating each 1 bit received signal withsaid digitized reference sweep signal to form multi bit correlograms; 5.digitizing said correlograms to 1 bit; and
6. C.D.P. stacking said 1 bitdigitized correlograms; and wherein
7. the C.D.P. fold is at least 40.14. The method as in claim 13 in which said steps (2), (3) and (4)comprise;digitizing said received signal to multi bit words; digitizingsaid reference sweep signal to multi bit words; correlating said multibit signal and reference sweep.
15. The method as in claim 13 in whichsaid steps (2), (3) and (4) comprise;digitizing said received signal to1 bit; digitizing said reference sweep signal to 1 bit; correlating said1 bit signal and reference sweep signal.
16. The method as in claim 13including the additional steps, at each C.D.P. source point, ofrepeating said source at least once, and straight stacking the at leasttwo received signals to form a straight stacked trace, and digitizingsaid stacked trace to 1 bit, to form a 1 bit received signal.
17. Themethod as in claim 13 in which the C.D.P. fold number is at least 50.18. The method as in claim 10 in which the number of separate channelsis at least
100. 19. In a seismic prospecting system, having;a. a strongseismic source; b. a plurality of geophones at spaced positions distantfrom said source; c. and means to amplify and digitize the geophonesignals; the method of operation and processing the seismic datacomprising;1. operating said source in C.D.P. format, whereby eachsource operation is at a different spaced-apart independent position; 2.amplifyng and digitizing the geophone signals to 1 bit;
3. C.D.P.stacking said 1 bit digitized signals; and wherein
4. the C.D.P. fold isat least 40, and
5. the number of channels is at least 80. | 2024-03-22 | 1975-09-29 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1977-11-15"
} |
US-3731421D-A | Device for scattering light objects
ABSTRACT
A device for scattering light objects such as confetti, in which the objects fall through an aperture from a container into a housing and are blown out through one or more forwardly projecting barrels by a fan located behind a screen located rearwardly of the aperture.
Uiied tates Patet Frattolillo et al.
DEVICE FOR SCATTERING LIGHT OBJECTS Inventors: Domenico Frattolillo;Anthony Frattolillo, both of 1555 Jane St., Apt.
1015, Weston-Toronto, Ontario,
Canada Filed: Apr. 12, 1971 Appl. No.: 133,335
US. Cl. ..46/l0, 46/243 R Int. Cl. ..A63h 33/26 Field of Search ..46/l0[56] References Cited UNITED STATES PATENTS 3,225,486 12/1965 Levy..46/10 3,435,554 4/1969 Philips ..46/10 Primary Examiner-Russell RKinsey Assistant Examiner-Robert F. Cutting Attorney-Lewis Edward Hanley[57] ABSTRACT A device for scattering light objects such as confetti, inwhich the objects fall through an aperture from a container into ahousing and are blown out through one or more forwardly projectingbarrels by a fan located behind a screen located rearwardly of theaperture.
10 Claims, 10 Drawing Figures PATENTEB MY 8 I375 SHEET 1 [1F 5 MEDOEPATENTEDHLY 81975 SHEET 2 OF 5 v MKDOE m MEDQE PATENTEU 81973 3.731.421
SHEET 3 BF 5 FIGURE 5 FIGURE 6 PATENTED 8|973 3,731,421
SHEET 0F 5 FIGURE 7 PATENTEWY 819B 3.731.421
SHEET 5 OF 5 FIGURE lO DEVICE FOR SCATTNG LIGHT OECTS This inventionrelates to a device for scattering small light objects such as confetti.
Confetti and similar material is usually scattered by hand althoughdevices have been conceived from time to time to facilitate that method.It is an object of the present invention to provide an improved devicefor scattering such material.
An example embodiment of the invention is shown in the accompanyingdrawings, in which:
FIG. 1 is a side elevation of a scatterer;
FIG. 2 is a perspective view, partly broken away, of the main bodyportion of the device of FIG. 1;
FIG. 3 is an exploded perspective view of the container of the device ofFIG. 1;
FIG. 4 is a cross-sectional view taken along line 44l of FIG. 2;
FIG. 5 is a perspective view of the internal mechanism of the device ofFIG. 1;
FIG. 6 is a perspective view of the motor mount of FIG. 5;
FIG. 7 is an exploded perspective view of the handle of the device ofFIG. 1;
FIG. 8 is a cross-sectional view, taken along line 1-1 of FIG. 2, of thehousing of the device;
FIG. 9 is a cross-sectional view, taken along line 22 of FIG. 2, of thehousing of the device; and
FIG. 10 is a cross-sectional view taken along line 3- -3 of FIG. 2, ofthe housing of the device.
As seen particularly in FIGS. 1-3, the embodiment shown in the drawingsconsists of a housing 1 of frustoconical shape having three nozzles orbarrels 79, 80 and 81 projecting from the smaller, forward end of thehousing and diverging at narrow angles from the axis of the housing.
A direct current motor is mounted in housing ll towards the largerrearward end of the housing which carries a cap or cover 52 withapertures 50 and 51. Motor 5 is fixed in housing 1 by lugs 83 and 84with threaded holes 85 and 86 to receive screws, passing through thehousing wall and the motor rests on a saddle 87 having legs 88, 89 withthreaded holes 90, 91 receiving screws passing through the housing wall.A tooth 92 on saddle 87 is received in a recess 93 in wall 82 of motor5. A pair of fans 47 and 48 are fixed by screws 49 on drive shaft 38 ofmotor 5 one fan at each end of the motor. The ends 39 and 40 of driveshaft 38 are journalled in sockets 41 and 42 in a pair of mounts orbrackets 43 and 44 fixed in housing 1 by screws en gagable with threadedholes 45 and 46 in mounts 43 and 44 respectively.
A grill or screen 53 is fixed in housing 1 between one fan 48 of motor 5and the base of barrels 79, 30 and 81. Screen 53 consists of an openmesh grid 54 mounted on a circular flame 55 which is fixed to housing 1by screws engaging threaded holes 56, 57, 58 in the frame.
An aperture or opening 71 is located in the wall of housing 1 betweenscreen 53 and the base of barrels 79, 80 and 81 and opens downwardlyinto an area 78 in front of screen 53. Aperture 71 has an outwardlyprojecting, threaded flange 77. A tank or container 72 is mounted onhousing 1 and consists of a pair of opposed, shallow, dished members 73and 75 forming a chamber, lower member 75 having an internally threadedopening 75a engagable with flange 77 on the housing, and upper memberhaving a removable cover 74 with a gripping fin 76.
Within housing 1 a gear 59 fixed to drive shaft 38 of motor 5 mesheswith a gear which is fixed on a shaft 64 journalled at each end 65, 66in a pair of brackets 67, fixed to the housing by screws in threadedholes 69, 76 in the brackets. Shaft 64 passes through screen 53 andcarries fixed to that shaft on the side of the screen opposite gear 60,a rotor 63 having a pair of fins 61 each with an aperture 62. Rotor 63is located to pass the free outer edge of each fin 61 across opening 71of housing 1.
A handle 1a is fixed to housing 1 diametrically opposite opening 71 ofthe housing. As seen in FIG. 7, handle lla consists of a contoured shell2 carrying a push-button ball 3 projecting outwardly through an aperture4 in the shell. Ball 3 bears against a leaf spring 7 fixed at one end toa block 8 which is fixed through an aperture 9 by a screw 10 to shell 2and at the other end to a contact 6 spaced from a pole 16 of anelectrical battery 15 located in the shell. The other pole 14 of battery15 bears against a contact 17 fixed on shell 2. Leads 13 from motor 5pass through holes 36 (see FIG. 5), 35 and 37 of housing 1 (see FIG. 4)and are connected to terminals 12 and 19 in holes 11 and 18 of contacts6 and 17 respectively. Grooves 20 and 22 in ends 21 and 23 of battery 15receive projections 27 and 24 on housing 1 and on base 30 of handle larespectively.
Battery 15 is preferably constructed to have flattened side walls, 15aand 15b, pole 14 projecting from one rounded edge of the batteryadjacent end 21 and pole l6 projecting from the other rounded edge 15dof the battery adjacent end 23. Base 30 is removably fixed on handle laby screws passing through holes 31 and 32 in the base and engagingthreaded holes 33 and 34 in shell 2. Battery 15 is further secured inshell 2 by a bracket 25 fixed to the shell by screws 10 engagingthreaded holes 28 and 29 in the bracket which also has an aperture 26 topass pole 16 of the battery.
In the operation of the device small pieces of light material such asconfetti-like discs of paper are charged into container 72 aftertemporarily removing cover 74. Grasping handle 1a and aiming barrels 79,8t), 81, ball 3 is pressed to move contact 6 against pole 16 to completethe circuit between battery 15 and motor 5, causing fans 47 and 48 torotate drawing air through 'apertured cover 52 and blowing the airthrough screen 53. Gears 59 and 64) cause rotor 63 to rotate also,agitating the discs in opening 71 and scattering them in front of screen53. The air from fans 47 and 48 passing through screen 53 blows thediscs out of the device through barrels 79, 80, 81. Screen 53 preventsany of the discs from coming into contact with gears 59, 60 or fans 47,48 as they drop from opening 71.
We claim:
1. A device for scattering small light objects of paper or the likecomprising:
a housing having a forward portion and a rearward portion, the housingbeing perforated in the rearward portion thereof;
a fan mounted in the housing, the fan being constructed and arranged todirect air forwardly therein;
a screen fixed in the housing forwardly of the fan;
at least one barrel projecting from the housing forwardly of the screen;
a container mounted on the housing and connected downwardly with anaperture to open into the housing between the screen and the barrel; and
motor means mounted in the housing and connected with the fan forrotation thereof.
2. A device as claimed in claim 1 including rotatable means mounted inthe housing below the aperture from the container, and means to connectthe rotatable means with the motor means through the screen.
3. A device as claimed in claim 2 in which the rotatable means comprisesa motor having a pair of diametrically opposed fins movable through thearea of the aperture from the container.
4. A device as claimed in claim 1 in which the motor means comprises anelectric motor fixed to the housing rearwardly of the fan, a handlefixed on the housing, battery means mounted in the handle and connectedelectrically with the electric motor, and switch means mounted in thehandle for connecting and disconnecting the battery means and theelectric motor.
5. A device as claimed in claim 4 including a further fan mounted in thehousing rearwardly of the motor and connected therewith, the further fanbeing constructed and arranged to direct air forwardly in the housing.
6. A device as claimed in claim 1 in which the housing is frusto-conicaland the barrel projects from the smaller end thereof.
7. A device as claimed in claim 1 in which the container comprises apair of shallow, dished members threaded together in opposed upper andlower relationship, an aperture centrally located in each member and aremovable cover on the aperture of the upper member.
8. A device as claimed in claim 4 in which the battery means comprises abattery body having flat upper and lower end walls, a pair of opposed,flattened side walls and a pair of opposed, rounded edges.
9. A device as claimed in claim 8 in which the battery has a pair ofpoles, one pole projecting from the upper portion of one of the roundededges of the battery body and the other pole projecting from the lowerportion of the other rounded edge of the battery body.
10. A device as claimed in claim 8 in which each end of the batterycarries a groove, and the housing and handle each carries a projectionreceivable in said grooves.
1. A device for scattering small light objects of paper or the likecomprising: a housing having a forward portion and a rearward portion,the housing being perforated in the rearward portion thereof; a fanmounted in the housing, the fan being constructed and arranged to directair forwardly therein; a screen fixed in the housing forwardly of thefan; at least one barrel projecting from the housing forwardly of thescreen; a container mounted on the housing and connected downwardly withan aperture to open into the housing between the screen and the barrel;and motor means mounted in the housing and connected with the fan forrotation thereof.
2. A device as claimed in claim 1 including rotatablemeans mounted in the housing below the aperture from the container, andmeans to connect the rotatable means with the motor means through thescreen.
3. A device as claimed in claim 2 in which the rotatable meanscomprises a motor having a pair of diametrically opposed fins movablethrough the area of the aperture from the container.
4. A device asclaimed in claim 1 in which the motor means Comprises an electric motorfixed to the housing rearwardly of the fan, a handle fixed on thehousing, battery means mounted in the handle and connected electricallywith the electric motor, and switch means mounted in the handle forconnecting and disconnecting the battery means and the electric motor.5. A device as claimed in claim 4 including a further fan mounted in thehousing rearwardly of the motor and connected therewith, the further fanbeing constructed and arranged to direct air forwardly in the housing.6. A device as claimed in claim 1 in which the housing is frusto-conicaland the barrel projects from the smaller end thereof.
7. A device asclaimed in claim 1 in which the container comprises a pair of shallow,dished members threaded together in opposed upper and lowerrelationship, an aperture centrally located in each member and aremovable cover on the aperture of the upper member.
8. A device asclaimed in claim 4 in which the battery means comprises a battery bodyhaving flat upper and lower end walls, a pair of opposed, flattened sidewalls and a pair of opposed, rounded edges.
9. A device as claimed inclaim 8 in which the battery has a pair of poles, one pole projectingfrom the upper portion of one of the rounded edges of the battery bodyand the other pole projecting from the lower portion of the otherrounded edge of the battery body.
10. A device as claimed in claim 8 inwhich each end of the battery carries a groove, and the housing andhandle each carries a projection receivable in said grooves. | 2024-03-22 | 1971-04-12 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1973-05-08"
} |
US-92073292-A | Biocompatible ventricular assist and arrhythmia control device including cardiac compression band-stay-pad assembly
ABSTRACT
A ventricular assist device for a heart includes a compression band-stay-pad assembly for encircling substantially the entire heart perimeter and comprising an elongated band member or chain disposed in a sealed protective structure filled with a lubricating medium. The band member may be fixed at one end and wound upon, or unwound from, a rotatable spool by a drive motor through a speed reducer. Force-transmitting support or stay assemblies are disposed in the protective structure between the band member and a resilient pad assembly for encircling the heart and promoting heart tissue ingrowth therein. The force-transmitting stay assemblies are biased circumferentially, and thus radially outward, by compression return springs disposed therebetween. The resilient pad assembly includes a corrugated surface provided with vertical coil springs, which help prevent damage to heart tissue and facilitate return of the pad assembly to an initial condition, embedded defibrillator electrodes and relatively soft portions to prevent damage to coronary arteries. The device may be constructed so that it can be surgically removed, except for a sealing film and an ingrown pad of the resilient pad assembly, which remain in situ on the heart. A net structure suspended below the device supports the apical portion of the heart.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a biocompatible ventricular assist andarrhythmia control device, and more particularly to a biocompatibleventricular assist and arrhythmia control device comprising a cardiacventricular compression band-stay-pad assembly, for compressing andassisting in the contraction and expansion of one or both heartventricles, without damaging the ventricle.
2. Description of the Prior Art
U.S. Pat. No. 4,925,443, issued May 15, 1990, to Marlin S. Heilman andSteve A. Kolenik, entitled "Biocompatible Ventricular Assist andArrhythmia Control Device", discloses an implantable ventricular assistdevice which includes (1) one or more movable compression assemblies forengaging a ventricle of the heart; (2) an operating mechanism forcyclically actuating the movable compression assemblies and therebyalternately ejecting blood from the ventricle and permitting theventricle to refill; (3) a sensing means to detect adequacy ofventricular stroke volume and/or pressure; (4) a control mechanism toassure adequate ventricular stroke volume by regulating the compressiveforce of the compression assemblies, and also to control pacemaker,cardioverter/defibrillator, and recorder subsystems; and (5) anelectrical power source.
In that patent, each compression assembly includes a contoured pressureplate and a soft contact pad mounted on the interior plate surface forsuturing and/or gluing the compression assembly to the ventricle. Tominimize mechanical stress on the myocardial surface, including thecoronary arteries, the contact pad consists of an elastomer, such assilicone rubber, or a thermoplastic material (Shore A durometer range30-50). To avoid edge stress, the thickness of each contact pad isprogressively reduced toward its periphery. To further reduce stresseson the myocardium, bearings and axles are used to mount the pressureplates on the compression assembly's driving arm; if the contractingheart produces a torquing force, the joint will permit the pressureplate, within specified limits, to follow the natural movement of theheart.
Similarly, to help prevent the edges of the compression assemblypressure plates from creating pressure points which might cause possibledamage to the heart, a related continuation-in-part U.S. patentapplication Ser. No. 07/019,701, filed May 14, 1990, in the names ofMarlin S. Heilman, et al., entitled "Biocompatible Ventricular Assistand Arrhythmia Control Device Including Cardiac Compression Pad andCompression Pad Assembly", now U.S. Pat. No. 5,098,369, disclosesreplacing the contact pad of each compression assembly with a gel-filledcontact pad of special construction which compresses the heart ventriclemore uniformly without damaging the ventricle.
Other previous attempts to provide ventricular assistance have rangedfrom artificial hearts (e.g., the Jarvik-7), to devices which directlypump the blood via an artificial pathway inserted through theventricular wall, to devices which exert pressure on the outside of theheart. Most frequently, these latter pressure-exerting devices involvesome form of flexible bladder within a support structure such thatexpansion of the bladder presses on the ventricle and facilitatesexpulsion of blood. See, for example, U.S. Pat. Nos. 3,233,607 to Bolie;3,279,464 to Kline; 3,587,567 to Schiff; 3,371,662 to Heid et al.;4,048,990 to Goetz; 4,192,293 to Asrican; 3,455,298 to Anstadt;4,690,134 to Snyder; 4,731,076 to Noon et al.; and 4,957,477 toLundback. Another structurally related device (U.S. Pat. No. 4,506,658to Casile) envisions a truncated conical structure of sac-lined rigidpanels separated by contractible and expandable sections, and anotherdevice (U.S. Pat. No. 4,621,617 to Sharma), which is electromagneticallycontrolled, comprises a pair of hinged compression members. Further,U.S. Pat. No. 4,536,893 to Parravicini envisions using two segmentedsacs, selectively fed by a pumping fluid to compress the right and leftventricles separately.
In general, bladder systems usually have various shortcomings. Theseinclude the possibility of catastrophic bladder fluid leakage (as aresult of the fluid pressures involved), a propensity for damaging theheart surface due to poor fixation and/or rubbing of the bladder againstthe heart's surface, and the unnatural convex form presented to theheart's surface during systolic bladder expansion.
Another type of cardiac assist system is designed to compress all orpart of the heart by alternately tightening and releasing a compressionband. For example, one proposed system for body organs (U.S. Pat. No.4,304,225 to Freeman), such as the heart, involves a flexible strapwhich is fixed to a contoured plastic block and passes across the backof the heart. In response to electrical pulses, a motor assemblyalternately reels in and releases the flexible strap, thereby tending toflatten and force fluid from the heart.
The above-mentioned Freeman patent also discloses the use of a tubularcompression sleeve which substantially encircles the heart and whichcomprises a series of interconnected expandable elliptical chambers. Inuse, a liquid solution is pumped into the sleeve from a supply chamber,causing the elliptical chambers to expand radially inward to compressthe heart in its systolic phase. The solution then is released from thesleeve back to a supply chamber, permitting the heart to expand in itsdiastolic phase.
U.S. Pat. No. 4,583,523 to Kleinke and Freeman illustrates a heartassist mechanism which compresses the aorta, rather than a ventricle,and it compresses during the diastolic phase of cardiac contractioninstead of the systolic phase. Other known prior art of interestincludes U.S. Pat. Nos. 3,668,708 to Tindal, 4,167,046 to Portner,4,092,742 to Kantrowitz et al. and 4,291,707 to Heilman, German PatentDocument No. DE-A-2,557,475, British Patent Document No. GB-A-2,060,174and U.S.S.R. Patent Document No. SU-1572646-A1.
SUMMARY OF THE INVENTION
In general, this invention relates to an implantable ventricular assistdevice which may include (1) one or more motor mechanisms for convertingelectrical and/or hydraulic energy to a mechanical motion forconstricting the perimeter about the heart; (2) movable support or"stay" assemblies for transmitting the motor-induced mechanical motioninto a compressive action on the heart's surface; and (3) a pad orinterface assembly between the movable stay assemblies and the surfaceof the heart, the pad assembly serving a number of purposes includingthe minimization of various mechanical stresses that might otherwisedamage the heart and/or coronary arteries.
A presently preferred embodiment of the invention includes aband-stay-pad assembly positionable about at least one heart ventricleand comprising an elongated band member or chain that activates stayassemblies housed in a fluid lubricant-filled chamber. Included is amechanism for fixing one end of the band member essentially againstmovement. Additionally, there is a rotatable support for winding atleast a portion of the band member thereon relative to thelubricant-filled chamber housing the stay assemblies, as a result of theband member having an opposite end connected to the rotatable support,and a reversible drive mechanism for rotating the rotatable support inone direction to wind up the portion of the band member and therebycompress the heart ventricle during a systolic phase thereof, androtating the rotatable support in a reverse direction to unwind theportion of the band member from the rotatable support, to release theheart ventricle during a diastolic phase thereof.
More specifically, the drive mechanism may include a drive motor and aplanetary gear-type speed reducer connected to the rotatable support.The band member, together with the supports or stays, and stay links, aswell as longitudinally extending and circumferentially arranged returnsprings, is encased in a compressible and expandable protectivestructure, which defines the above-mentioned lubricant-filled chamberand which may comprise a partially corrugated and inner foam-surfacedpad or interface assembly that contacts the heart's surface and iscontinuous, for fluid sealing purposes, with a flexible membranedefining an outside surface of the structure. The stay assembliescomprise: (1) the stay links that are slotted for receiving portions ofthe movable band and which are interleaved with band portions so as toprovide an aligned path for the band; (2) the stays, which may pivot andare connected to inner sides of respective ones of the stay links,typically by means of rocking joints; (3) a series of thecircumferentially extending springs that return the band-stay-padassembly to its beginning (end-diastolic) position; and (4)longitudinally and vertically extending force-transmitting springs thatare supported on the pad assembly and respective ones of the pivotingstays, and have opposite end portions which flex outward as theband-stay-pad assembly compresses into the heart's surface. The returnsprings bias the compression band-stay-pad assembly circumferentially,and thus also radially outward, with the pad assembly being preferablysecured to the heart's surface by suturing and/or ingrowth, so thatoutward expansion of the heart, or diastolic filling, is assisted by thesprings.
In other embodiments, the motor-driven chain is replaced by a pluralityof other types of motor mechanisms provided between selected ones of thestays to assist in contraction and expansion of the heart. Theband-stay-pad assembly also may be formed initially with an adjustableportion by which the assembly can be fitted around a patient's heart in"customized" close-fitting relationship, and multiple compression bandsor chains movable in opposite directions may be utilized.
The present invention, as above described, overcomes a number ofobstacles and complications inherent in state-of-the-art devices and asdisclosed in previously issued patents. For example, U.S. Pat. Nos.4,925,443 and 5,098,369 (Heilman et al.) disclose devices which havediscrete compression plates that, although effective for pumpingpurposes, could under certain circumstances pinch the surface of theheart between the edges of the compression plates. The present inventionrepresents an improvement over these devices because it produces a morecomplete enclosure of the heart's surface, obviating the risk ofpinching.
In other known prior art which utilizes a compression band extendingabout only a portion of the heart, the action of the band is to flattenthe heart and either slide on the heart's surface or splint, i.e.,prevent the surface from undergoing a natural shortening or contractionaction. Flattening the heart produces an unnatural bending of theheart's muscle, and the sliding action of the band on the heart'ssurface is abrasive. The band-stay-pad invention described herein alsois advantageous over these type devices in that it eliminates hardsurfaces or edges being in contact with the heart so as to avoidpinching, while also avoiding flattening or shearing of the hearttissue.
Further, with the subject invention, the bottom or apical portion of theheart is supported by a collapsible net structure having limitedexpansion ability. Should an infarct (death) of the heart's muscle occurfrom a blockage of a coronary artery, the band-stay-pad assembly withits attached net then will provide support and thus avoid or limit anyaneurysmal ballooning or rupture of the heart that otherwise mightoccur.
Many patients suffer from a form of heart failure caused by fibrousreplacement of heart muscle tissue resulting in muscle stiffening. Thepresent invention also is advantageous in this regard in that it has thecapability to both increase heart filling by a slight returnspring-induced stretch during diastole, and increase the depth ofcontraction during systole, and therefore heart emptying, thusovercoming the effects of the abnormal heart muscle stiffness.
From the standpoint of space requirements in the patient's body, theventricular assist device of the present invention also is advantageousin that it has the form of a flexible envelope that fits in the naturalcleavage plane about the heart, with the envelope's attached motor drivefitting, for example, in the natural cleavage plane between thediaphragm and the lower lobe surface of the left lung. Because of thesedesirable fit properties and the relatively small size of the device,surgical complications also are expected to be less than with otherknown assist devices.
The pad assembly, which defines an inner lining of the invention,comprises an inner foam pad having a sealing film on an outer corrugatedsurface, and has a number of other unique features. For example, it isformed in a fashion and will be acted upon by the stay assemblies so asto shrink in the circumferential dimension much the same as the heartsurface does naturally. This action, together with the porosity of itsfoam surface, will promote tissue ingrowth and adhesion of the pad tothe heart's surface, thus avoiding shear stress at the pad-heart surfaceinterface. The foam pad also can be made to possess a degree ofhardness, Shore A 30-50, that is similar to that of heart muscle, thusfurther avoiding unnecessary stress.
By embedding metallic cables constructed of numerous small diameterwires in the corrugated porous foam pad, it also is possible toeffectively create large surface area defibrillating electrodes sincethe foam porosity will allow electric current to flow and the small wirediameters will resist flex-fracturing. The corrugated sealing film onthe stay assembly side of the pad assembly also is sufficiently thin(less than 20 mils) to avoid fatigue fracture from millions ofcompression cycles and may be constructed of multiple layers securedtogether along their upper and lower edges, with only the innermostlayer bonded to the foam pad, and only the outermost layer adjacent tothe stay assemblies sealed to edges of the outside surface membrane forretaining the fluid lubricant. Then, should it be necessary tosurgically replace the band-stay portion of the device, it also is anoption to leave in place the innermost film and the foam pad, which hasbecome connected to the heart by tissue ingrowth. A replacement devicethen would have its own fluid-sealing layer of corrugated film thatwould mate with and be suitably attached to the in situ film layersecured to the foam pad. The compression band-stay-pad assembly and ahousing of the drive mechanism may be filled with a biocompatiblemedium, such as mineral oil, which functions as the above-mentionedfluid lubricant and also prevents body fluids from seeping into thedevice.
BRIEF DESCRIPTION OF DRAWINGS
FIG. 1 is a schematic block diagram of a ventricular assist device inaccordance with a first embodiment of the invention;.
FIG. 2 is a schematic general front elevational view of the upperportion of a patient's body showing the ventricular assist deviceimplanted on the heart, with the heart shown in its diastolic phase;
FIG. 3 is a schematic view showing the patient's heart and theventricular assist device during a systolic phase of the heart;
FIG. 4A is an enlarged elevational view, partially in cross section,illustrating in greater detail the ventricular assist device attached tothe patient's heart;
FIG. 4B is an exploded view of a plurality of parts of the ventricularassist device;
FIG. 4C is a schematic elevational view of certain parts as shown inFIG. 4B, as seen in the direction of the arrows 4C--4C;
FIG. 4D is a cross-sectional view of one of the parts shown in FIG. 4C,taken along the line 4D--4D;
FIG. 4E is a cross-sectional view of another of the parts shown in FIG.4C, taken along the line 4E--4E;
FIG. 4F is a cross-sectional view of the parts shown in FIGS. 4D and 4Ein assembled relationship;
FIG. 5 is a schematic cross-sectional view, with certain parts omitted,taken essentially along the line 5--5 in FIG. 4A;
FIG. 6 is an enlarged cross-sectional view of a portion of FIG. 5;
FIG. 7A is a cross-sectional view taken essentially along the line7A--7A in FIG. 6;
FIGS. 7B and 7C are schematic views illustrating removal and securingsteps in a device replacement procedure;
FIG. 8A is a partial top view of a second embodiment of the invention,partially in cross-section;
FIG. 8B is an enlarged, elevational view as seen essentially along theline 8B--8B in FIG. 8A;
FIG. 8C is a cross-sectional view taken along the line 8C--8C in FIG.8B;
FIG. 9 is a partial elevational and cross-sectional view of a thirdembodiment of the invention;
FIG. 10 is a schematic, elevational and cross-sectional view of acompression band operating mechanism of the ventricular assist deviceshown in FIGS. 1-7;
FIG. 11 is a cross-sectional view of the compression band operatingmechanism taken essentially along the line 11--11 in FIG. 10;
FIG. 12A is a partial elevational view, partially in cross-section, ofan end portion of an operating chain for a ventricular assist device inaccordance with the invention shown in FIGS. 1-7;
FIG. 12B is a plan view of the end portion of the operating chain shownin FIG. 12A;
FIG. 13A is a schematic, partial cross-sectional view of a fourthembodiment of the invention, taken essentially along the line 13A--13Ain FIG. 13B;
FIG. 13B is a schematic, partial cross-sectional view, with certainparts omitted, taken essentially along the line 13B-13B in FIG. 13A;
FIG. 14A is a schematic, partial cross-sectional view of a fifthembodiment of the invention, taken essentially along the line 14A--14Ain FIG. 14B;
FIG. 14B is a schematic view, partially in cross-section, takenessentially along the line 14B--14B in FIG. 14A;
FIG. 14C is a schematic elevational view as seen essentially along theline 14C--14C in FIG. 14A; and
FIG. 15 is a schematic cross-sectional view illustrating a sixthembodiment of the invention.
DETAILED DESCRIPTION
FIG. 1 discloses a block diagram of a biocompatible ventricular assistand arrhythmia control device 20 in accordance with a first embodimentof the invention, hereinafter referred to as the ventricular assistdevice, it being understood that numerous other variations of theinvention are, of course, possible. As disclosed in FIG. 1, theventricular assist device 20, which operates in synchronism with a heart22, comprises an implantable subsystem 24 and a subsystem 26 externalto, and without penetrating, a patient user's skin 28. The implantablesubsystem 24 includes a direct cardiac energy converter and cardiacpumping mechanism 30 which includes a heart compression band-stay-padassembly 32, and a drive mechanism 34 comprising a rotatable supportspool 36 for winding a band member or chain 38 of the band-stay-padassembly thereon, and unwinding the band member therefrom, a drive motor40, a speed reducer 42 connected between the drive motor and therotatable support spool, and a housing 44 in which the rotatable supportspool, drive motor and speed reducer are mounted. The drive motor 40,through the speed reducer 42 and the rotatable support spool 36,mechanically initiates radially inward ventricle-assist motion of thecompression band-stay-pad assembly 32 when the heart 22 begins tocontract, limits and controls the degree of mechanical compression, andterminates the degree of compression so that the compressionband-stay-pad assembly may return to its original radially outwardposition as the heart refills. The housing 44 is at least partiallyencapsulated in a casing 46 of a suitable biocompatible material, suchas titanium, SILASTIC® silicone elastomer (Dow Corning Corp., Midland,Mich.) or DURAFLEX™ polyurethane (Vascor, Inc., Pittsburgh, Pa.). Theenergy converter and cardiac pumping mechanism 30 also includes sensors(not shown) which provide input to a microcomputer based systemcontroller 48, within an electronic control system module 50 implantablein the patient's body remote from the energy converter and cardiacpumping mechanism, as illustrated in FIG. 2.
The electronic control system module 50, in addition to themicrocomputer based system controller 48, includes a telemetrycontroller 52, an internal transcutaneous energy transmission (TET)controller 54, internal batteries 56, a switching power supply 58, apower monitor 60 and an audible alarm 62. The electronic control systemmodule 50 further includes a cardiac pacer system 64 comprising anautomatic gain controlled (AGC) R-wave or QRS complex (electrocardiogramwaveform just prior to systolic contraction) detector circuit 66, and aprogrammable pacer 68 connected to an electrocardiogram (ECG)/pacer lead70 positionable upon the patient's heart 22 in a known manner. Acardioversion/defibrillation pulse generator 72 also is connected to oneor more defibrillation electrodes 74 also mountable upon the patient'sheart as subsequently discussed with reference to FIGS. 4A and 5. Thecontroller 48 may be connected to the energy converter-and-cardiacpumping mechanism 30 by a system including a preload force interface 76connected to a dedicated force transducer 77 of the compressionband-stay-pad assembly 32, an absolute motor position sensor 78, and apulse width modulated (PWM) motor drive interface 80.
Power is transmitted from the external subsystem 26 to the electroniccontrol system 50 by a patient-worn TET controller 86 and the internalTET controller 54. External power is provided by either a patient-wornbattery pack 88 or a stationary power supply 90. When the battery pack88 is expended, it may be recharged with a battery charger 91. Inaddition, a system programmer 92 may be selectively connected to thepatient-worn TET controller 86 for programming and interrogation.
The programmer 92 may comprise a programmed personal computer system ofa known type, the details of which are not shown, which includes a smallprinter/plotter, a transtelephonic data transmission device and an ACpower supply, with battery backup. A series of menus, displayed on acomputer screen, prompt the operator to select the desired systemcontrol parameters at a keyboard. All selected programming options areautomatically logged at the printer and stored on a 3.5 inch floppydisk. Additionally, when commanded, the programmer 92 will display,record and plot two selected real-time signals (ECG, refractory pulse,motor torque, compression band position, or band velocity) for aselectable time period, such as 2.5 or 5.0 seconds.
FIG. 2 shows the ventricular assist device 20, essentially asrepresented by the block diagram of FIG. 1, with the internal subsystem30 implanted in an upper portion of a patient's body for assisting theheart 22 in the pumping of blood from the heart, through its majorartery (aorta) 94, and to the arterial system. In the disclosedarrangement the energy converter and cardiac pumping mechanism 30 islocated adjacent a heart left ventricle 96, between the patient'sdiaphragm or inside the chest wall of the patient, and the lower lobesurface of the left lung, with the compression band-stay-pad assembly 32fitting in a natural cleavage plane about the heart, and encircling theheart. The electronic control system module 50 is implanted adjacent thewaist of the patient user and is connected to the energy converter andcardiac pump mechanism 30 via a communications and power supply link 98.The external patient-worn TET controller 86 and battery pack 88 aredisposed in a belt 100 which may be worn around the patient user's waistinside or externally of the patient user's clothing and which may beremovably secured by a quick-releasable material of a known type atopposite ends of the belt. The TET controller 86 and battery pack 88preferably are distributed in the belt 100 around a substantial portionof the belt for the patient's comfort. The above-mentioned programmingof the implanted electronic control system 50 can be accomplished fromthe programming device 92 (FIG. 1), by connecting the programming deviceto the patient-worn TET controller 86 via a cord and plug assembly (notshown) insertable into a plug receptacle 102 (FIG. 2) on the belt 100.The recharging of the patient-worn battery pack 88 may be accomplishedby removing the battery pack or the belt 100 for a recharging operationby the battery charger 91, and replacing the battery pack with a fullycharged battery pack, or replacing the belt with a belt having a fullycharged battery pack, to provide continuous, tether-free operation.
Referring to FIGS. 4A, B and C, and FIG. 5, the compressionband-stay-pad assembly 32 comprises the elongated band member or chain38, which may be in the form of a pivoted link chain of a suitablematerial, such as a composite plastic compound like carbon reinforcedpolyphenylene sulfide (PPS), or carbon reinforced polyether ketone. Forexample, the carbon reinforced polyphenylene sulfide (PPS) may be aninjection molded plastic composite including polyphenylene sulfide,TEFLON®, carbon fibers and silicone, available from LNP EngineeringPlastics of Exton, Pa. The chain material also may be a metal, e.g., acobalt based alloy such as that available from SPS Technologies, Inc.,of Jenkingtown, Pa. under the trademark MP35N, or that available fromEligloy Limited Partnership of Elgin, Ill., under the trademark ELIGLOY,a stainless steel (316L), titanium, or a composite of PPS and metal. Theelongated band member or chain 38 also is encased in a protectivestructure 106 of the band-stay-pad assembly 32 for preventing damage tothe heart 22 and/or surrounding tissue.
The compression band-stay-pad assembly 32 further comprises a pluralityof C-shaped rigid support or "stay" members 108, preferably supportedcentrally for rocking movement on respective alternating channel-shapedstay link members 110 and 111, by bearing portions 108b, 110b and 111b(FIG. 4B), respectively, and associated hinge or pivot pins 112. Thestays 108 have enlarged relatively wide end portions 108w (best shown inFIGS. 5 and 6) each provided with a pair of apertures 108a for receivingrespective ends of circumferentially extending, compression-return coilsprings 114, and also have relatively narrow force-transmitting portions108n. Alternatively, the return springs 114 may be mounted on enlargedportions of the stay links 110 and 111. The stays 108, and the staylinks 110 and 111, may be formed of a biocompatible metal, such ascommercially pure titanium or a titanium alloy (e.g., Ti-6AL-4V), or theabovementioned injection molded plastic composite used for the chain 38.
The stay links 110 and 111 provide a mechanism by which the stay members108 and the link chain 38 are supported in adjacent relationship. Forthis purpose, vertically spaced, horizontal legs 110h (FIGS. 4B, C andD) of each stay link 110 are formed with elongated slots 110s (bestshown in FIG. 4D) disposed at an angle 110a on the order of 61/3° to alongitudinal axis of the legs. Each of the stay links 111 includeshorizontal legs 111h having opposite end portions which receive adjacentend portions of the stay links 110 therebetween. The legs 111h includeapertures 111a by which these legs are connected to the legs 110h of thestay links 110 by suitable pins 115 having cylindrical portions 115c(FIG. 4F) fixedly mounted in the apertures and also having rectangularportions 115r disposed for sliding movement in the slots 110s foralignment control. In operation, with reference to FIG. 4F, the staylinks 110 and 111 move between solid line positions (diastole) andbroken line positions (systole).
Referring to FIG. 4C, the legs 110h and 111h of the stay links 110 and111 are disposed on upper and lower sides of the chain 38, whichcomprises chain members 116 having horizontal legs 116h and centralportions 116c received between respective ones of the horizontal legs,with the chain riding on arcuate bearing surfaces 117 (FIG. 4B) of thestay links. As is also shown in FIGS. 12A and 12B, the chain members 116are pivotally interconnected by pins 118 having opposite ends fixed inapertures 120 in the horizontal legs 116h, and intermediate portionsjournaled in suitable bearings 122 in the central portions 116c. Thechain members 116 may be formed of a suitable plastic composite or ametal, as noted previously. Other chain configurations also may be used,such as miniaturized bicycle-type chains, but to minimize wear at thechain-engaging surfaces 117 of the stay links 110 and 111, the stay linksurfaces should be plastic if the surfaces of the chain 38 are metal ormetal if the chain surfaces are plastic.
With further reference to FIGS. 4A and 5, the structure comprising thestays 108, the stay links 110 and 111, and the associated portion of thechain 38, is encased by a sheath assembly 124 comprising an inner pad orinterface assembly 126 and an outer membrane 128. To prevent excessivepressure on main heart coronary arteries 129a and 129b (see FIGS. 2, 3,4A and 5) during the systole phase of the heart 22, a pressure pad 130of the inner pad assembly 126 preferably is formed in two essentiallysemi-circular segments having opposed ends separated by first and secondtubular portions 132 and 134, respectively, as shown in FIG. 5, whichare formed of a relatively softer foam material, and which are suitablysealed closed at their upper and lower ends by plug portions 136 (seeFIG. 4A). When the band-stay-pad assembly 32 is positioned on the heart22, the first tubular portion 132 is located over the main coronaryartery 129a (left anterior descending) and the second tubular portion134 is located on the opposite side of the heart 22 over the rightcoronary main artery 129b. Thus, in compression of the heart 22 by theband-stay-pad assembly 32 during the heart's systole phase, therelatively soft tubular portions 132 and 134 cooperate to reduce therelative pressure applied on the main coronary arteries 129a and 129b.
As is shown in FIG. 4A, the bottom or apical portion of the heart 22 issupported by a collapsible, but essentially non-expandable net structure138 having its upper periphery bonded to the underside of the sheathassembly 124 around its perimeter, with the net structure being movableradially inward and outward therewith. Thus, should an infarct (death)of the heart's muscle occur from a blockage of a coronary artery, thenet 138 will provide support and avoid or limit any aneurysmalballooning or rupture of the heart 22 that may otherwise occur. By wayof example, the net structure 138 may be formed from a polyester fiberbundle 138f having a diameter in a range on the order of 0.6 to 2.6 mm,with elongated net openings 138o having short and long dimensions on theorder of 3 mm and 8 mm, respectively.
The pressure pad 130 is formed of a relatively soft material and has asmooth inner surface 130s which is engageable with the heart 22 withoutcausing damage to the heart tissue. The pad material also is of a typewhich can be sutured to the heart 22 and also preferably is relativelyporous in nature to enhance tissue ingrowth and bonding of the pad tothe heart, so that radial expansion of the band-stay-pad assembly 32assists in expansion of the heart during its diastole phase. Forexample, a suitable material for this purpose is polyurethane foam, atleast the inner heart-contacting surface 130s of which has been treatedwith an anti-microbial agent, such as cephalosporin.
As is shown in FIG. 6, an outwardly facing surface of the compressionpad 130 is of corrugated construction and has a fluid sealing film layer140, such as of polyurethane, bonded thereto by a suitable adhesive,such as also polyurethane, with the resultant corrugations formingalternating ridges 142 and valleys 144. Preferably, as is best shown inFIGS. 6 and 7A, a second fluid sealing polyurethane film layer 146 alsooverlays the first sealing film layer 140 in corrugated form, withadjacent upper and lower edge portions 140e and 146e of the film layersadhesively bonded together at upper and lower bond joints 148 and 150,respectively, and with the intervening portions of the layers unbondedto enable subsequent removal of the second layer from the first layer,for replacement of the compression band-stay-pad assembly 32. The upperand lower edge portions 146e of the outer film layer 146 also are bondedto adjacent upper and lower edge portions 128e of the outer membrane 128(which also may be formed of polyurethane), to form a fluid-tightenclosure. The resultant enclosure 128, 146, together with the drivemechanism housing 44, may be filled (such as through a suitable openingin the housing) with an inert lubricating medium 151, such as mineraloil, which also prevents body fluids from entering the ventricularassist device 20.
Referring to FIG. 6, the narrow portions 108n of the stay members 108,which have arcuate inner surfaces 108i, as shown in FIG. 7A, aredisposed in respective ones of the valleys 144 formed by the corrugatedpad assembly 126, for applying radially inward pressure on the padassembly, and thus the heart 22, during its systole phase. Further, formore precise pressure control and to provide force transmission so as tofurther reduce the possibility of damage to the heart tissue or the padassembly 126 by sharp edges or corners of the stays 108, as is bestshown in FIG. 7A, a longitudinally and vertically extending coil spring152 of circular cross-section and relatively small diameter, such as0.16"±0.080", is disposed between each stay 108 and the outermost filmlayer 146 of the pad assembly 126, with the spring being adhesivelybonded adjacent its center to the stay and along its length to the filmlayer.
Thus, as the stay 108 and the spring 152 move radially inward during aheart compression operation, in which the stay tends to move radiallyinward from a solid line position in FIG. 7A, the stay also tends torotate slightly counterclockwise into a position as illustrated bybroken lines in that figure as a result of the taper of the heart 22.Accordingly, the opposite end portions of the spring 152 tend to flexoutwardly, from a slightly concave solid line position, to a convexposition, as also shown by broken lines in FIG. 7A, with the padassembly 126 adapting to this movement without damage to the padassembly and/or the heart 22. Subsequently, when the stay 108 returns toits initial solid line position in FIG. 7A, during the diastole phase ofthe heart 22, the tendency of the spring 152 to return to its initialposition facilitates restoration of the pad assembly 126, and thus theheart, to which it is secured, to their initial (diastole) conditions.
With further reference to FIGS. 4A and 5, the abovementioneddefibrillation electrodes 74 may be in the form of a plurality of smallmetallic cables 74c of numerous small diameter wires embedded in thefoam pad 130 between the valleys 144 (FIG. 5) of the pad assembly 126,with lower ends of the cables being connected by lead wires of a smallconnector cable 153 (FIG. 4A) to the defibrillation pulse generator 72(FIG. 1). The embedded cables 74c thus function effectively as largesurface area defibrillating electrodes since the porosity of the foampad 130 allows electric current to flow through to the heart 22 whilethe flexibility and strength of the small diameter wires of the cableseffectively resist flex-fracturing.
As is best shown in FIG. 5, one end of the chain 38 is fixedly connectedto the housing 44 of the energy converter and cardiac pumping mechanism30, such as by a pin 153. The other end of the chain 38 is secured tothe rotatable support spool 36, such as by a suitable lug-and-pinconnection 154, so that the chain 38 can be wound thereon, or unwoundtherefrom. Opposite end ones of the stay links 111 also are pivotallyconnected to lug portions of the motor housing 44 by respectiveconnector pins 155 and 156. Thus, during winding of the chain 38 uponthe rotatable support spool 36, and unwinding of the chain therefrom, tocause alternate contraction and expansion of the compressionband-stay-pad assembly 32, the chain or band moves longitudinally tocause radially inward and outward movement of the stays 108, springs 152and the compression pad assembly 126, as previously described.
As is apparent from FIGS. 2, 3, 4A and 5, the band-stay-pad assembly 32,including the motor housing 44, encircles the heart 22 so as to beessentially independent of any other parts of the patient's body forsupport. Further, as is also shown in FIG. 6, the stays 108 are mountedon the chain 38 by the stay links 110 and 111, and are biased apartcircumferentially by their associated return springs 114 so that thecompression band-stay-pad assembly 32, including the motor housing 44,is constantly biased toward a radially outward position. When the chain38 is wound on the support spool 36, however, the diameter of theassembly 32 (including the motor housing) encircling the heart 22, isreduced so that the stays 108 and the stay links 110 and 111 move towardone another circumferentially, compressing the springs 114, with thestays also moving radially inward about the perimeter of the heart toheart-compressing positions. Thus, during the systolic phase of theheart 22, substantially the entire perimeter of the heart (except for asmall portion adjacent the motor housing 44) can be compressedessentially uniformly radially inward, and during the diastolic phase ofthe heart, the heart can expand in a similar manner radially outward.Further, during the latter movement, as a result of the foam pad 130being secured to the heart 22 by suturing and/or ingrowth of the hearttissue, the springs 114, and also the springs 152, assist the heart inreturning to its expanded condition.
FIGS. 7A, 7B and 7C illustrate an above-mentioned feature of theinvention by which essentially the entire compression band-stay-padassembly 32 may be replaced during surgery, leaving the inner foam pad130, which has become ingrown with heart tissue, in situ on the heart.For this purpose, as is illustrated schematically in FIG. 7B, to removethe band-stay-pad assembly 32 while leaving the foam pad 130 in situ, asurgeon may cut the innermost film layer 140, which is bonded to thefoam pad, from the outermost film layer 146 and thus the outer membrane128 in a suitable manner. For example, the surgeon may cut the innermostfilm layer 140 from the outermost film layer 146 along cut lines 157adjacent (but slightly spaced from) the bond joints 148 and 150 (FIG.7A) for the layer edge portions 140e and 146e, whereupon the entirecompression band-stay-pad assembly 32, except for the foam pad 130 andthe innermost film layer 140 bonded thereto, can be removed from theheart 22. Referring to FIG. 7C, remaining opposite end portions 140er ofthe innermost film layer 140 then can be attached to opposite edgeportions 146eR of a replacement compression band-stay-pad assembly (notshown), by suitable bonding and suturing, as illustrated schematicallyin this figure.
FIGS. 8A, B and C illustrate a second embodiment of the invention inwhich the motor-driven compression band-stay-pad assembly 32, includingthe circumferentially extending return springs 114, is replaced by astay-pad assembly 32' comprising a plurality of motor or power assistdevices 158 for respective sets of stays 108'. For example, one of thepower assist devices 158 may be provided for each set of every five ofthe stays 108', as is shown in FIG. 8A.
For this purpose, every fifth or "corner" stay 108' is in the form of atapered, wedge-shaped block member having facing sides of the staysparallel to one another. The next adjacent intermediate stays 108' havea modified C-shape, as is best shown in FIG. 8C, with relatively narrowinner portions and relatively wide outer portions, as is best shown inFIG. 8A. A central stay 108' also is of the modified C-shape, but ofuniform width, as also best shown in FIG. 8A.
In this instance, each power assist device 158 is a double-actinghydraulic actuator or motor having a cylinder member 160 fixed, such asby welding, to one of the corner stays 108', and a piston rod 162similarly secured by welding to the other corner stay of the set. Thus,by selective operation of the actuator 158, the corner stays 108' of theset can forcibly be pulled toward one another to assist in compressionof a heart 22' in its systole phase, and forcibly moved apart during theheart's diastole phase.
Each set of the stays 108' also includes upper and lower guide pins 164extending horizontally through apertures in upper and lower portions ofthe corner stays, intermediate stays and central stays, with the guidepins 164 fixed to the central stays by suitable welding 166, andslidably received in the intermediate stays and the corner stays of theset. Relative movement between the intermediate stays 108' and thecorner stays 108' is limited by retaining members 168 having first endssecured (e.g., welded) to the corner stays and having lost motion slots170 (FIG. 8B) at their opposite ends for receiving projecting pins 172on the intermediate stays. In adjacent sets of the stays 108', as isbest illustrated in FIG. 8B, similar guide pins 174 and retainingmembers 175 also are provided, but are located at different levels thanthe guide pins 164 and retaining members 172, to prevent interferencetherebetween.
As is shown in FIG. 8C, in this embodiment of the invention, each staymember 108' has an innermost inclined planar surface 108i', instead of acurved surface such as the curved surface 108i in the embodiment of theinvention shown in FIGS. 1-7. Thus, a force transmitting small coilspring 152' is, in this instance, of relatively straight construction,and remains essentially so during heart systolic and compression phases,rather than moving between concave and convex positions, as in the caseof the spring 152 of that embodiment. In other respects, the function ofthe spring 152', and an associated pressure pad assembly 126', includinga foam pad 130' and edge-bonded sealing film layers 140' and 146', withthe latter film layer also bonded to an outer membrane 128', isessentially the same as in the previous embodiment.
FIG. 9 discloses a third embodiment of the invention similar to thatdisclosed in FIGS. 8A, B and C, in which each of a plurality of motor orpower assist devices 176 (only one shown) includes a main solenoid 178comprising a cylindrical coil assembly 180 fixedly mounted on one of twocorner stays 108" and a T-shaped actuator mechanism 182, including anarmature portion 184, slidably disposed in the cylindrical coilassembly. The coil assembly 180 also carries a first latching mechanism186 and a projecting outer end of the actuator mechanism 182 includes asecond latching mechanism 188. Upper and lower guide pins 190 also arefixedly mounted in central stays 108" by welding 166", and slidablymounted in both of the corner stays 108" and intermediate stays 108" asin the embodiment of the invention shown in FIGS. 8A, B and C, withguide pins 191 for adjacent sets of the stays similarly mounted atdifferent levels.
The first latching mechanism 186 comprises vertically movable upper andlower latch members 192 slidably mounted for vertical movement on thecoil assembly 180 and having respective upper and lower ends formed withteeth which are selectively engageable in notches of upper and lower barracks 194, respectively. As viewed in FIG. 9, the bar racks 194 arefixed to the right-hand corner stay 108" and slidably received in theleft-hand corner stay 108". The latch members 192 are movable into andout of engagement with the bar racks 194 by respective springs 196 andassociated first small solenoids 198. The second latching mechanism 188similarly comprises upper and lower latch members 200 which are biasedto latching positions by a single return spring 202, and movable out oftheir latching positions by second small operating solenoids 204.
More specifically, at the beginning of a systole phase of a heart (notshown), with the stays 108" in their open positions, the first latchmembers 192 are disengaged from the racks 194 and the second latchmembers 200 are engaged therewith. The main solenoid 178 then isoperated momentarily so that the second latch members 200 move the racks194 and the right-hand corner stay 108" to the left (as viewed in FIG.9) one increment, at which time the first small solenoids 198 aredeenergized so that the springs 196 move the first latch members 192into holding engagement with the racks, whereupon the second smallsolenoids 204 are energized to retract the second latch members 200. Themain solenoid 178 then is deenergized so that a coil return spring 206extends the second latching mechanism 188 for advancing the bar racks194 another increment. Next, the second latch members 200 are releasedby their solenoids 204 so that their return spring 202 moves the latchmembers back into engagement with the racks 194, whereupon the firstlatch members 192 are retracted from rack engagement by their solenoids198. The incrementing process then is repeated until a desired closureof the stays 108" has been achieved, with the process being repeated inreverse for a heart diastole phase.
Referring again to the first embodiment of the invention and FIG. 10,the motor 40 of the energy converter and cardiac pumping mechanism 30includes a fixed stator 208 and a drive shaft 210 extending from a rotor212 coaxial with and partially located within a hollow cylindrical drivemember 214 of the speed reducing mechanism 42. Further, an upper end ofthe motor drive shaft 210 is connected to the speed reducer drive member214 via a planetary gear system 216. The rotatable support spool 36 isfixedly mounted on a lower portion of the speed reducer drive member 214in a suitable manner, also not shown.
Referring to FIGS. 10 and 11, an upper end of the drive motor shaft 210includes a gear 218 which forms a sun gear of a lower planetary gearsystem 220, with the sun gear being drivingly engaged with threeplanetary gears 222 (see FIG. 11), in turn engaged with a ring gear 224fixedly mounted to the interior of the hollow speed reducer drive member214. The planetary gears 222 are mounted for rotation on vertical shafts226 secured at their upper ends to respective arms 228 of a supportmember 230 having at its center a vertical shaft 232 upon which a secondsun gear 234 of an upper planetary gear system 236 is fixedly mounted.As is shown in FIG. 10, the second sun gear 234 also is drivinglyengaged with three planetary gears 238, in turn engaged with a secondring gear 240 fixedly mounted to the interior of the hollow speedreducer drive member 214. The second planetary gears 238 also arerotatably supported on depending shafts 242 mounted at their upper endsin a top wall of the housing 44. Thus, operation of the motor 40 in onedirection causes winding of the compression band or chain 38 on therotatable support spool 36 to wind the band thereon and cause inwardradial movement of the compression band-stay-pad assembly 32 to assistthe heart 22 in its systole phase, and operation of the motor in thereverse direction permits unwinding of the band from the rotatablesupport member to permit the abovementioned radially outward expansionof the compression band-stay-pad assembly during the diastole phase ofthe heart.
FIGS. 12A and B illustrate the construction of the end wrapping portionof the link chain 38 which is secured to the rotatable support spool 36and wound upon the support spool to contract the compressionband-stay-pad assembly 32 during a heart systolic phase, and thenunwound from the support spool to permit the compression assembly toretract outward in a heart diastolic phase. In this connection, thisportion of the chain 38 is of essentially the same construction as thecompression portion of the chain previously described, comprising aseries of chain link members 116 interconnected by pivot pins 118 fixedat upper and lower ends in the apertures 120 in the link member legs116h, and having intermediate portions journaled in the wear-resistantcylindrical bearings 122 in the link member central portions 116c,except that the end link member is adapted to be connected to therotatable support spool by the pin 154. Further, inner surface portions116s of the chain members 116 which engage against the support spool 36are formed with a curved radius, such as one inch, to facilitate thewinding of the chain members on the support spool.
A fourth embodiment of the invention, as disclosed in FIGS. 13A and 13B,is of similar construction to the first embodiment of the invention, asdisclosed in FIGS. 2-7C. In this connection, this embodiment includes acompression band-stay-pad assembly 32-4, comprising a series of arcuatestay members 108-4 mounted for pivoted rocking movement on alternatingstay link members 110-4 and 111-4 by pivoted connections 110b-4 and111b-4, with the stay members being provided with curved coil springs152-4. An end one of the stay link members 111-4 is pivotally connectedto a fixed member 246 on a housing 44-4 of a drive mechanism 34-4, by aconnector pin 155-4, and an opposite end one of the stay link members issimilarly connected to the fixed member 246 by a connector pin 156-4. Acompression band, in the form of a chain 38-4, encircles the stay linkmembers 110-4 and 111-4, with the chain being fixedly connected at oneend on the fixed member 246 by a connector 153-4, and connected at itsopposite end, by a connector 154-4, to a rotatable support spool 36-4 ofthe drive mechanism 34-4. The foregoing assembly is encased in aprotective structure 106-4 filled with a lubricating medium andcomprising a pad assembly 126-4 and an outer membrane 128-4, with thehousing 44-4 also encased in a suitable biocompatible casing 46-4.
The embodiment of FIGS. 13A and 13B differs from the embodiment of FIGS.2-7C in that the stay members 108-4 are of circular cross-section,rather than of a relatively complex configuration as disclosed in thatembodiment. Further, rather than the compression band-stay-pad assembly32-4 being circumferentially biased by the springs 114 between the staymembers 108, this biasing is achieved by springs 114-4 disposed in slots110s-4 in the stay link members 110-4, with the springs being locatedbetween end portions of hinge pins 112-4, for interconnecting these staylink members with the stay link members 111-4, and opposite ends of theslots. To retain the springs 114-4 in the slots 110s-4, the upper andlower legs 110h of the stay link members 110-4 are provided with covermembers 248, secured thereon in a suitable manner, such as by welding orsmall screws (not shown). Further, since in this embodiment the staylink members 110-4 and 111-4 tend to close together to a greater degreeduring a heart contraction-assist operation, than the stay link members110 and 111 in the embodiment of FIGS. 2-7C, if all of the stay linkmembers were provided with the arcuate bearing surfaces 117, thesurfaces would interfere with one another during a closing operation;accordingly, in this embodiment only the stay link members 111-4 areprovided with arcuate bearing surfaces 117-4 for supporting the chain38-4 during its movement relative to the stay link members, with thestay link members 110-4 being of a modified construction as shown. Inother respects, the structure and operation of the embodiment of FIGS.13A and 13B is essentially identical to the embodiment of the inventiondisclosed in FIGS. 2-7C.
FIGS. 14A, B and C disclose a fifth embodiment of the invention in whicha compression band-stay-pad assembly 32-5 is constructed in the form oftwo essentially arc-shaped portions 250 each connected to a drivemechanism 34-5 at one end (right-hand in FIGS. 14A and B) and initiallyunconnected at an opposite end (left-hand in FIGS. 14A and B) andseparated so as to provide an adjustable portion 32-5A, so that thecompression band-stay-pad assembly can be adjusted to size as it isfitted to a patient's heart 22-5, and thus "customized" depending uponsize of the heart. Further, in this embodiment, rather than being movedinto a heart contracting-assist condition (systole) by a single chainsecured at one end and wound up at its opposite end, the compressionband-stay-pad assembly 32-5 is contracted by multiple chains being woundup in opposite directions simultaneously.
For this purpose, as is best shown in FIG. 14C, a net structure 138-5for supporting an apical portion of the heart 22-5 is provided on thecompression band-stay-pad assembly 32-5, as disclosed in the firstembodiment of the invention in FIGS. 3 and 4A, with parts 252 of the netbeing extended upward between the adjacent initially unconnected ends ofthe compression band-stay-pad assembly, suitably secured to the adjacentinitially unconnected ends, and having partially overlapping portions252-0. The parts 252 of the net 32-5 then may be used by a surgeon topull the compression band-stay-pad assembly 32-5 into tight-fittingrelationship with respect to the heart 22-5 when it is in its diastolicphase, whereupon the overlapped portions 252-0 may be suitably securedtogether. Thus, the compression band-stay-pad assembly 32-5 can be"custom-fit" to the heart 22-5, as noted previously.
Further, to contract the thus "customized" compression band-stay-padassembly 32-5 about the heart 22-5 in its systolic phase, a pair ofupper and lower chains 38-5A and an intermediate chain 38-5B movabletherebetween adjacent a drive mechanism 34-5, are provided. In thisinstance, the drive mechanism 34-5 is of a hydraulic type and comprisesupper and lower housing members 254 and an intermediate housing member256 capable of free rotation in a casing 46-5 which is filled withlubricant as a result of being in fluid communication with the adjacentends of the compression band-stay-pad assembly 32-5. A vertical shaft258 extends downwardly through the housing members 254 and 256, with theupper and lower housings 254 being fixedly mounted to upper and lowerend portions of the shaft, respectively. Fixed to an intermediateportion of the shaft 258 is a vane member 260 which is movable in anarcuate inner chamber 262 within the intermediate housing 256, with theintermediate housing being rotatably mounted on the shaft by suitablebearings 264, and with the arcuate inner chamber 262 being ofliquid-tight construction as a result of suitable seals 266 encirclingthe shaft at upper and lower ends of the chamber.
A liquid inlet line 268 and a liquid outlet line 270 also are suitablyconnected to the upper end of the shaft 258, with the inlet line feedingvertically downward through the shaft and opening into the inner chamber262 of the intermediate housing 256 between the vane 260 and an adjacentchamber wall 272. Similarly, the outlet line 270 extends downwardthrough the shaft 258 and opens into the inner chamber 262 on anopposite side of the vane 260. The upper and lower chains 38-5A aresecured to respective ones of the upper and lower housings 254 byconnectors 154-5A (one shown in FIG. 14A for the upper chain), and theintermediate chain 38-5B is similarly secured by a connector 154-5B(FIG. 14A) to the intermediate housing 256. The inlet and outlet lines268 and 270 also are connected to a liquid source, comprising a pump anda storage chamber, not shown.
Thus, in operation, when liquid is introduced through the inlet line 268into the inner chamber 262 of the intermediate housing 256 between thevane 260 and the adjacent inner wall 272, opposing thrust forces arecreated on the vane and the inner wall causing the vane and the shaft258 to which it is secured, to rotate clockwise as viewed in FIG. 14A,while at the same time the intermediate housing is caused to rotate inan opposite direction counterclockwise in this figure. Further, sincethe upper and lower housings 254 are fixed to the vertical shaft 258,these housings also tend to rotate clockwise in FIG. 14A. Thus, theupper and lower chains 38-5A are wrapped upon their respective upper andlower housings 254 in a clockwise direction, while the intermediatechain 38-5B is wrapped upon the intermediate housing 256 in acounterclockwise direction, to cause contraction of the band-stay-padassembly 32-5 about the heart 22-5 during its systolic phase.
FIG. 15 discloses a sixth embodiment of the invention, which, like theembodiment of the invention shown in FIGS. 14A, B and C, can be"custom-fit" to a patient's heart 22-6. In this instance, however, acompression band-stay-pad assembly 32-6 extends essentially around theentire periphery of the heart 22-6, with an adjustable portion 32-6A ofthe assembly being provided between a drive mechanism 34-6 at one end ofthe assembly, and an opposite end thereof. Thus, in this embodiment, asin the embodiment of the invention of FIGS. 14A, B and C, the"custom-fitting" of the compression band-stay-pad assembly 32-6 to theheart 22-6 can be accomplished by utilizing upwardly extending portions274 of a net structure (not shown) for supporting an apical portion ofthe heart as disclosed in those figures. In this embodiment, however,only a single chain 38-6 is provided with the chain being wound up bythe drive mechanism 34-6 in a clockwise direction, as indicated by thesolid-line arrow in this figure. In the alternative, an adjustableportion 32-6A of the compression band-stay-pad assembly 32-6 may beprovided adjacent the opposite side of the drive mechanism 34-6, asillustrated by broken lines, with the aforementioned chain then beingwound up in a counter clockwise direction, as indicated by the brokenline arrow in this figure.
In general, referring again to FIG. 1, in operation, the energyconverter and cardiac pumping mechanism 30 converts electrical powersignals, received from the electronic control system 50, to directmechanical cardiac assist by the compression band-stay-pad assembly 32.Typically, data and power are transcutaneously transferred from theexternal controller 86 and battery pack 88 to the implanted electroniccontrol system 50. The external battery pack 88 also can be selectivelyrecharged by the battery charger 91, and periodic system programming canbe accomplished by temporarily connecting the external controller 86 tothe programmer 92. The internal batteries 56, contained in theelectronic control system 50, provide system power for periods when thebelt 100 (FIG. 2) containing the external controller/battery pack 86, 88is temporarily removed by the patient user. In the alternative, thepower line-operated stationary power supply 90 may be used in place ofthe patient-worn battery pack 88.
With further reference to FIG. 1, the electronic control system 50regulates fundamental cardiac assist, pacer andcardioverter/defibrillation functions. In the normal operating mode, theelectronic control system 50 monitors the electrocardiogram (ECG) signalreceived by the detector 66 from the ECG/pacer lead 70. Upon thedetector circuit 66 detecting a ventricular contraction initiation(R-wave or QRS complex), a programmable delay period is initiated afterwhich the motor 40 is driven forward causing the compressionband-stay-pad assembly 32 to compress the myocardium of the heart 22.When the systolic cycle is complete, the motor 40 is returned to its enddiastolic position, causing and/or permitting the compressionband-stay-pad assembly 32 to expand radially outward.
In a pre-systolic phase, approximately 30 milliseconds before the nextanticipated QRS complex (predicted by analyzing previous R to Rintervals) a light preload pressure (programmable) is applied to theheart 22. This pressure minimizes mechanical shock loading andmyocardial impact during the initial phase of the impending systolicassist cycle. At the same time, the electronic control system 50 alsocontrols the pacer 68 and the defibrillator pulse generator 72.
With further reference to the pre-systolic phase, approximately 30milliseconds prior to the next anticipated systolic cycle, the motor 40is driven forward a programmed fixed amount. The arrival time of systoleis predicted by storing the four most recent cycle periods with theshortest of the four periods being used to predict the onset of theimpending cycle. If the current end diastolic position was setcorrectly, the compression band-stay-pad assembly 32 then should begincompressing the myocardium during the second half of the pre-systolicmotor travel. A corresponding increase in the drive current of the motor40 then will be required to finish the motor's travel in thepre-systolic phase and motor current may be monitored by the PWM motordrive circuit 80. However, if an increase in current is not observed bythe controller 54, the end diastolic position of the compressionband-stay-pad assembly 32 then will subsequently be modified (increased)to provide a "tighter" (more radially inward) end diastolic position, inpreparation for the next systolic phase. Similarly, if a high motordrive current is observed by the controller 54 throughout thepre-systolic travel period of the motor 40, the end diastolic positionwill subsequently be modified (decreased) to provide a "looser" (moreradially outward) end diastolic position of the compressionband-stay-pad assembly 32. As an alternative, or in addition tomonitoring motor current, the preload force interface 76 and the forcetransducer 77 may be used to directly measure the cardiac force exertedby the compression band-stay-pad assembly 32, and modify the enddiastolic position accordingly. Other force-indicative parameters alsomay be measured and used for this purpose.
Typically, while as previously discussed, the systolic assist phaseshown in FIG. 3 is triggered when a QRS complex is detected, an assistescape interval, such as 833 milliseconds, may also be programmed andenabled. The assist escape interval triggers the systolic assist phase(and a pacer pulse is output if the pacer 68 is enabled) if a QRS signalis not detected within a preselected time interval, or if there iscontinuous sensing of noise during the interval such that the QRS signalcannot be detected, thus effectively providing asynchronous assist ifQRS sensing is lost. Alternately, the electronic control system 50 maybe programmed to operate asynchronously at a selected rate (possiblyused during ventricular fibrillation). Again, once the systolic phase istriggered, the programmable delay period is initiated, as previouslydescribed. When the delay period is complete, the motor 40 then isdriven forward causing the compression band-stay-pad assembly 32 tocompress the myocardium of the heart 22.
In summary, a new and improved biocompatible ventricular assist andarrhythmia control device 20 has been disclosed. For example,essentially the entire device 20 can be completely and readily implantedin the body of a patient user, and can operate independently of anexternal source from the battery pack 88 in the belt 100 being wornaround the patient user's waist. The energy converter and cardiacpumping mechanism 30, including the compression band-stay-pad assembly32, which can be secured directly to the patient user's heart 22, alsoprovides a system which helps ensure positive compression and expansionassistance to the heart during its systolic and diastolic phases,respectively. During the systolic phase, the heart-engaging foam pad130, film layers 140 and 146 and the force-transmitting vertical springs152 cooperate to prevent damage to the heart. Further, theheart-engaging foam pad 130, the stay members 108, the circumferentiallyextending return springs 114 and the force-transmitting vertical springs152, cooperate to facilitate the heart's expansion during the diastolicphase. As is illustrated in FIGS. 7A, B and C, the provision of theinner and outer film layers 140 and 146 on the foam pad 130 also enablesremoval of the compression band-stay-pad assembly 32, except for theinner film layer 140 and the foam pad 130 to which it is bonded, whichremain in situ on the heart 22, and then replacing the removed assemblystructure with a new compression band-stay-pad assembly structure.Further, in the invention embodiments of FIGS. 8A, B and C, and FIG. 9,respectively, the hydraulic actuator mechanism 158 and thesolenoid-latch mechanism 176 provide alternative modes of producingheart contraction and expansion assistance, while the embodiments ofFIGS. 13A-15 provide other advantageous features.
It is to be understood that the foregoing description and accompanyingdrawings set forth the preferred embodiments of the invention at thepresent time. Various modifications, additions and alternative designswill, of course, become apparent to those skilled in the art in light ofthe foregoing teachings without departing from the spirit and scope ofthe disclosed invention. Therefore, it should be appreciated that theinvention is not limited to the disclosed embodiments but may bepracticed within the full scope of the appendant claims.
We claim:
1. A ventricular direct mechanical assist device, whichcomprises:a series of force-transmitting linked members for arrangementaround a perimeter of a portion of a heart; and means for actuating saidmembers to apply compression to the heart; wherein said members receivemechanical energy acting on said members and transmit mechanical energyto the heart.
2. The device as recited in claim 1, furthercomprising:means for moving said force-transmitting linked members inradial directions; and compression return springs interconnecting saidforce-transmitting linked members.
3. The device as recited in claim 2,which further comprises means for maintaining said compression returnsprings aligned with each other.
4. The device as recited in claim 1,further comprising a circumferentially movable band mechanism;whereinsaid force-transmitting linked members receive mechanical energy fromsaid band mechanism through circumferential movement about the perimeterof the heart, thereby exerting force perpendicular to said heartperimeter.
5. The device as recited in claim 1, wherein at least aportion of said force-transmitting members are interconnected by a powermechanism for exerting at least a closure force perpendicular to andbetween said interconnected members.
6. The device as recited in claim5, wherein said power mechanism includes a hydraulic cylinder andpiston.
7. The device as recited in claim 5, wherein said powermechanism is a solenoid actuator.
8. The device as recited in claim 7,which further comprises latching means for capturing stroke motionsproduced by said solenoid actuator.
9. The device as recited in claim 1,which further comprises a resilient pad assembly having an outermostcorrugated surface defining alternating ridges and valleys, and whereineach force-transmitting member further includes a longitudinallyextending spring that supports said pad assembly and is received in arespective one of the valleys in the corrugated surface of said padassembly.
10. The device as recited in claim 9, comprising means forflexing said pad assembly-supporting spring progressively towardsopposite ends thereof during a force-transmitting operation, from adiastolic concave form to a systolic convex form.
11. A ventricularassist device which can be implanted in a patient user exterior to theheart adjacent at least one ventricle, and which comprises:compressionband means for surrounding the perimeter of the heart and having apreselected perimeter length when the heart is in a diastolic phase;means for shortening the perimeter length when the heart is in asystolic phase; and force-transmitting means for receiving mechanicalenergy from said band means as its perimeter length is shortened andtransmitting said energy to compress the heart in its diastolic phase.12. A ventricular assist device which can be implanted in a patientuser, which comprises:means for actively compressing the patient'sheart; and a collapsible netting structure supporting an apical portionof the heart and connected to said compressing means.
13. The device asrecited in claim 12, wherein the collapsible netting structure is a netcapable of passive surface area contraction yet incapable of stretchingbeyond a preselected limit.
14. The device as recited in claim 13,wherein said net is formed from a fiber bundle having a diameter in arange on the order of 0.6 to 2.6 mm in diameter, and has openings havingdimensions of approximately 3 by 8 mm.
15. The device as recited inclaim 14, wherein said fiber bundle is constructed of polyester.
16. Aventricular assist device which can be implanted in a patient user,which comprises:a contact surface for contacting the heart; means forcontracting and expanding the contact surface of the assist device; andan electrically-driven motor attached to said means for contracting andexpanding for causing contraction and expansion of said contact surface,said motor further including means for fitting in a natural cleavageplane between the left lung and diaphragm or the left lung and an insidechest wall of the patient.
17. A ventricular assist device which can beimplanted in a patient user exterior to the heart, comprising:elongatedband means positionable around the entire perimeter of the heart;rotatable support means for winding at least a portion of the band meansthereon and unwinding the portion of the band means therefrom, the bandmeans being connected to the rotatable support means; resilient padmeans for engaging the heart and applying pressure thereto in responseto movement of said band means; means for sensing the systolic anddiastolic phases of the heart; and reversible drive means for rotatingthe rotatable support means in one direction to wind the portion of theband means thereon and thereby compressing the heart ventricle during asystolic phase thereof, and for rotating the rotatable support means ina reverse direction to unwind the portion of the band means from therotatable support means, to release the heart during a diastolic phasethereof.
18. The ventricular assist device as recited in claim 17,wherein the drive means includes a drive motor and a speed reducerconnected to the rotatable support means.
19. The ventricular assistdevice as recited in claim 18, wherein the speed reducer includes atleast one planetary gear system connected between the drive motor andthe rotatable support means.
20. The ventricular assist device asrecited in claim 19, wherein the planetary gear system includes a sungear mounted on a drive shaft of the drive means.
21. The ventricularassist device as recited in claim 17, wherein the resilient pad means isat least partially of corrugated construction.
22. The ventricularassist device as recited in claim 17, which further comprises protectivemeans for encasing the band means, the protective means including theresilient pad means.
23. The ventricular assist device as recited inclaim 22, which further comprises lubricating medium contained in theprotective means.
24. The ventricular assist device as recited in claim23, wherein the resilient pad means includes a porous member having aheart-engaging surface on an inner side thereof and a sealing film on anouter side thereof.
25. The ventricular assist device as recited inclaim 24, which further comprises:a second sealing film having oppositeedge portions secured to respective opposite edge portions of saidfirst-mentioned film, with intermediate portions of said films beingunsecured to one another; and a sealing membrane forming part of saidprotective structure and having opposite edge portions also secured tosaid edge portions of said sealing films and cooperating with said filmsto encase said band means.
26. The ventricular assist device as recitedin claim 25, wherein the resilient pad means includes spring means forreturning the resilient pad means from an end systolic condition to anend diastolic condition.
27. The ventricular assist device as recited inclaim 26, wherein said spring means are elongated coil springs bonded tosaid resilient pad means.
28. The ventricular assist device as recitedin claim 17, wherein the resilient pad means includes spring means forreturning the resilient pad means from an end systolic condition to anend diastolic condition.
29. The ventricular assist device as recited inclaim 17, which further comprises means for slidably supporting saidband means, said support means being formed of plastic when said bandmeans is formed of metal, and being formed of metal when said band meansis formed of plastic.
30. The ventricular assist device as recited inclaim 17, wherein the band means is a chain.
31. The ventricular assistdevice as recited in claim 17, which furthercomprises:force-transmitting members disposed between said band meansand said resilient pad means.
32. The ventricular assist device asrecited in claim 31, which further comprises compression return springsdisposed between respective ones of said force-transmitting members. 33.The ventricular assist device as recited in claim 31, wherein saidforce-transmitting members are each comprised of a plurality of supportmembers, at least some of which have surface means for supporting saidband means for movement relative to said support members.
34. Theventricular assist device as recited in claim 33, further comprisingpin-and-slot connections, wherein said support members areinterconnected by said pin-and-slot connections so as to be contractibleand expandable circumferentially.
35. The ventricular assist device asrecited in claim 34, wherein said compression return springs aredisposed in said pin-and-slot connections.
36. The ventricular assistdevice as recited in claim 17, wherein the band means includes biasingmeans for biasing the band means outward in the diastolic phase of theheart ventricle.
37. The ventricular assist device as recited in claim36, which further comprises means for securing the band means to theheart ventricle.
38. The ventricular assist device as recited in claim17, wherein the resilient pad means is formed, at least in part, of asoft porous foam material for engaging the heart.
39. The ventricularassist device as recited in claim 17, which further comprises:externalcontrol means for controlling the reversible drive meanstranscutaneously; an external battery pack connected to said controlmeans; and a belt adapted to be worn externally by the patient user,said belt housing said control means and said battery pack.
40. Theventricular assist device as recited in claim 39, which furthercomprises a contractible net means secured to said band means forsupporting the apical portion of the heart, said band length adjustmentmeans comprising portions of said net means extending between opposedportions of said band means and being adapted to be secured together inoverlapped relationship.
41. The ventricular assist device as recited inclaim 17, which further comprises means for adjusting the length of saidband means.
42. The ventricular assist device as recited in claim 17,which further comprises means for immovably fixing one end of saidelongated band means, with an opposite end of said band means beingconnected to said reversible drive means.
43. The ventricular assistdevice as recited in claim 17, wherein:said elongated band meansincludes first compression band means positionable about a portion ofthe heart for heart-contracting movement in a first direction; saidelongated band means further includes second compression band meanspositionable about another portion of the heart for heart-contractingmovement in a second direction; and said reversible drive means includesfirst and second reversible drive means for moving said first and secondcompression band means in their respective directions.
44. Theventricular assist device as recited in claim 43, wherein one of saidcompression band means comprises a pair of spaced band members and theother of said compression band means comprises a single band membermovable between said spaced band members adjacent said reversible drivemeans.
45. The ventricular assist device as recited in claim 43, whichfurther comprises means for adjusting the combined circumferentiallength of said first and second compression band means.
46. Aventricular assist device for direct mechanical assistance to a heart,which comprises:means for sensing systolic and diastolic phases of theheart; means for encircling and contracting the perimeter of a surfaceportion of the heart when the heart is in a diastolic phase; andresilient means for cyclically shortening and lengthening saidencircling means in a perimeter direction during systolic and diastolicphases of the heart, respectively, and for receiving and transmittingmechanical compression force to the surface portion of the heart. | 2024-03-22 | 1992-07-28 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1995-01-24"
} |
US-60614496-A | Oxidation of glycolic acid to glyoxylic acid using a microbial cell transformant as catalyst
ABSTRACT
An improved process for preparing glyoxylic acid comprising using the enzyme glycolate oxidase in the form of permeabilized microbial cell transformants selected from Aspergillus nidulans, Hansenula polymorpha, Pichia pastoris and Escherichia coli to oxidize glycolic acid with oxygen in an aqueous solution that includes an amine.
This is a continuation-in-part of U.S. Ser. No. 08/256,086 filed Jun.30, 1994 which is a continuation-in-part of U.S. Ser. No. 07/817,165filed Jan. 6, 1992 now abandoned.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to an improved process for the production ofglyoxylic acid by the enzyme catalyzed oxidation of glycolic acid. Morespecifically, the present invention relates to the use of whole cells ofa genetically-engineered microbial transformant, which expresses theenzyme glycolate oxidase (S)-2-hydroxy-acid oxidase, EC 1.1.3.15!, and,optionally, catalase (EC 1.11.1.6).
2. Description of the Related Art
Glycolate oxidase, an enzyme commonly found in leafy green plants andmammalian cells, catalyzes the oxidation of glycolic acid to glyoxylicacid, with the concomitant production of hydrogen peroxide. N. E.Tolbert et al., J. Biol. Chem., Vol. 181, 905-914 (1949) first reportedan enzyme, extracted from tobacco leaves, which catalyzed the oxidationof glycolic acid to formic acid and CO₂ via the intermediate formationof glyoxylic acid. The addition of certain compounds, such asethylenediamine, limited the further oxidation of the intermediateglyoxylic acid. The oxidations were carried out at a pH of about 8,typically using glycolic acid concentrations of about 3-40 mM(millimolar). The optimum pH for the glycolate oxidation was reported tobe 8.9. Oxalic acid (100 mM) was reported to inhibit the catalyticaction of the glycolate oxidase. Similarly, K. E. Richardson and N. E.Tolbert, J. Biol. Chem., vol. 236, 1280-1284 (1961) showed that bufferscontaining tris(hydroxymethyl)-aminomethane inhibited the formation ofoxalic acid in the glycolate oxidase catalyzed oxidation of glycolicacid. C. O. Clagett, N. E. Tolbert and R. H. Burris, J. Biol. Chem.,Vol. 178, 977-987 (1949) reported that the optimum pH for the glycolateoxidase catalyzed oxidation of glycolic acid with oxygen was about7.8-8.6, and the optimum temperature was 35°-40° C.
I. Zelitch and S. Ochoa, J. Biol. Chem., Vol. 201, 707-718 (1953), andJ. C. Robinson et al., J. Biol. Chem., Vol. 237, 2001-2009 (1962),reported that the formation of formic acid and CO₂ in the spinachglycolate oxidase-catalyzed oxidation of glycolic acid resulted from thenonenzymatic reaction of H₂ O₂ with glyoxylic acid. They observed thataddition of catalase, an enzyme that catalyzes the decomposition of H₂O₂, greatly improved the yields of glyoxylic acid by suppressing theformation of formic acid and CO₂. The addition of flavin mononucleotide(FMN) was also found to greatly increase the stability of the glycolateoxidase.
N. A. Frigerio and H. A. Harbury, J. Biol. Chem., Vol. 231, 135-157(1958) have reported on the preparation and properties of glycolic acidoxidase isolated from spinach. The purified enzyme was found to be veryunstable in solution; this instability was ascribed to the relativelyweak binding of flavin mononucleotide (FMN) to the enzyme active site,and to the dissociation of enzymatically active tetramers and/oroctamers of the enzyme to enzymatically-inactive monomers and dimers,which irreversibly aggregate and precipitate. The addition of flavinmononucleotide (FMN) to solutions of the enzyme greatly increased itsstability, and high protein concentrations or high ionic strengthmaintained the enzyme as octamers or tetramers.
There are numerous other references to the oxidation of glycolic acidcatalyzed by glycolic acid oxidase, for example:
Isolation of the enzyme (usually includes an assay method):
I. Zelitch in Methods of Enzymology, Vol. 1, Academic Press, New York,1955, p. 528-532, from spinach and tobacco leaves.
M. Nishimura et al., Arch. Biochem. Biophys., Vol. 222, 397-402 (1983),from pumpkin cotyledons.
H. Asker and D. Davies, Biochim. Biophys. Acta, Vol. 761, 103-108(1983), from rat liver.
M. J. Emes and K. H. Erismann, Int. J. Biochem., Vol. 16, 1373-1378(1984), from Lemna Minor L.--Structure of the enzyme:
E. Cederlund et al., Eur. J. Biochem., Vol. 173, 523-530 (1988).
Y. Lindquist and C. Branden, J. Biol. Chem. Vol. 264, 3624-3628, (1989).
SUMMARY OF THE INVENTION
This invention relates to a process for the production of glyoxylic acid(OCHCOOH), where glycolic acid (HOCH₂ COOH) (200 to about 2500 mM) andoxygen are reacted in an aqueous solution (pH 7 to 10) in the presenceof whole cells of a genetically-engineered microbial transformant, whichexpresses the enzyme glycolate oxidase (S)-2-hydroxy-acid oxidase, EC1.1.3.15!, and, optionally, catalase (EC 1.11.1.6). Under optimumconditions, very high yields of glyoxylic acid are obtained at highconversion of glycolic acid, and the genetically-engineered microbialtransformant can be recovered and reused.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 illustrates the amino acid sequence of spinach glycolate oxidase(SEQ. ID NO.; 1).
FIG. 2 illustrates the steps taken to amplify glycolate oxidase-encodingcDNA by polymerase chain reaction.
FIG. 3 illustrates schematically the steps in constructing a recombinantDNA expression construct to achieve production of glycolate oxidase inan Aspergillus host.
FIG. 4 illustrates the plasmid pFPMT130 expression vector indicating therespective components and restriction sites.
FIG. 5 illustrates the plasmid pRB expression vector indicating therespective components and restriction sites.
FIG. 6 illustrates the plasmid PFMDGO expression vector indicating therespective components and restriction sites.
FIG. 7 illustrates the plasmid pRBGO expression vector indicating therespective components and restriction sites.
FIG. 8 illustrates the creation of plasmid pMP1 from plasmids pHIL-D4and pDA-PCR#1.
FIG. 9 is a gel electrophoresis of PCR detection of the glycolateoxidase gene from strains GS115-MSP10 and MSP12.
FIG. 10 is a Western blot analysis of glycolate oxidase proteinproduction from transformed strains GS115-MSP10 and MSP12.
FIG. 11 is a graphic representation illustrating glycolate oxidaseactivity from induced cultures of transformed strains GS115-MSP10 andMSP12.
DETAILED DESCRIPTION OF THE INVENTION
This invention describes the use of whole cells of a microbialtransformant (e.g., Aspergillus nidulans, Pichia pastoris, Hansenulapolymorpha and Escherichia coli) which co-expresses glycolate oxidaseand catalase for the manufacture of glyoxylic acid from glycolic acid(hydroxyacetic acid). Although the enzyme-catalyzed reaction of glycolicacid with oxygen has been known for many years, high selectivities(>99%) to glyoxylic acid have not been previously obtained, nor has theoxidation of glycolic acid been performed at concentrations of 0.20M to2.5M. A previous, commonly assigned patent, U.S. Pat. No. 5,219,745(Jun. 15, 1993), "Production of Glyoxylic Acid from Glycolic Acid",described a process for the enzymatic conversion of glycolic acid toglyoxylic acid in the presence of oxygen, an amine buffer, and thesoluble enzymes glycolate oxidase and catalase. This processdemonstrated the unexpected synergistic effect of using both catalase(to destroy by-product hydrogen peroxide) and an amine buffer capable offorming a chemical adduct with the glyoxylic acid produced (limiting itsfurther oxidation) and is herein incorporated by reference for suchpurpose. Neither the separate addition of catalase or an amine bufferwere found to produce the high selectivity observed when both werepresent, and the almost quantitative yields of glyoxylic acid obtainedwere more than expected from a simple additive effect of using catalaseor amine buffer alone. The instant invention is viewed as an improvementto the above process in that the present invention uses a wholemicrobial cell as a catalyst, in place of the soluble enzymes.
The previously-reported use of soluble enzymes as catalysts posesseveral problems: catalyst recovery for reuse is not easily performed,catalyst stability is not as good as can be obtained with immobilizedenzyme or whole cell microbial catalysts, and soluble enzymes are notstable to the sparging of the reaction mixture with oxygen (required toincrease the rate of oxygen dissolution and, thus, reaction rate).Several transformants of Aspergillus nidulans, Pichia pastoris,Hansenula polymorpha and Escherichia coli have now been constructed,using genetic engineering techniques commonly known to those skilled inthe art, which express the glycolate oxidase from spinach as well as anendogenous catalase. Several advantages are offered by the use of thesewhole cell catalysts in the previously described process: 1) the wholecell catalysts are easily recovered from the reaction mixture at theconclusion of the reaction for reuse, whereas the soluble enzyme is onlyrecovered with great difficulty and loss of activity, 2) the whole cellcatalysts are more stable than the soluble enzyme, both for the numberof catalyst turnovers obtained versus the soluble enzyme, as well as forrecovered enzyme activity at the conclusion of a reaction, and 3) mostimportantly, the whole cell catalyst is stable to reaction conditionswhere oxygen is sparged into the reaction mixture to increase the rateof oxygen dissolution and reaction rate, where under similar reactionconditions the soluble glycolate oxidase is rapidly denatured.
The transformants are required to be permeable to the passage ofcarboxylic acids under the reaction conditions described herein;transformants of Escherichia coli and Aspergillus nidulans becomepermeabilized when used as catalysts in the present process, whiletransformants of Hansenula polymorpha and Pichia pastoris requirepermeabilization prior to use as catalysts in the present process(described hereinafter). It was discovered that these permeabilizedtransformant catalysts were stable to the reaction conditions of thepresent process; that is, the integrity of the cell was maintained underthe present reaction conditions which include high sparge rates, highshear forces generated by rapid stirring, and high concentrations ofglycolic or glyoxylic acids and organic amines. It is critical to thesuccessful operation of this process that the transformant cells do notlyse (do not break apart) and release the contents of the cells(including the glycolate oxidase and catalase enzymes) into the reactionmixture, where rapid loss of glycolate oxidase enzymatic activity wouldoccur.
The glycolate oxidase expressed in a microbial transformant may have astructure corresponding to any naturally occurring form of the enzyme,or may have a genetically engineered variant structure, provided howeverthat enzymatically-active glycolate oxidase, as defined above, isretained. Naturally occurring forms of glycolate oxidase include, forexample, spinach-produced glycolate oxidase. As shown in FIG. 1 herein,spinach glycolate oxidase consists, in its mature form, of 369 aminoacids arranged in the indicated sequence (SEQ. ID NO.: 1). According toa preferred embodiment of the present invention, the glycolate oxidaseis spinach glycolate oxidase or an enzymatically-active variant ofspinach glycolate oxidase, e.g., a enzymatically-active fragment of theenzyme, or an analogue in which one or more amino acids is replacedusing conservative amino acid replacements, or a variant in which theregion of the enzyme which directs its peroxisomal accumulation isdeleted (see Macheroux et al., Biochem., vol. 30, 4612 (1991),incorporated herein by reference).
The Aspergillus nidulans transformants were prepared by first cloningthe spinach gene which codes for glycolate oxidase and then introducingthis gene into a strain of Aspergillus nidulans which already producedacceptable levels of the endogenous catalase. A variety of geneticconstructs, adapted to receive heterologous DNA and to controlexpression thereof, have been developed for use with Aspergillus hostsand any of these may be employed for the purpose of producing glycolateoxidase in the Aspergillus host. Such genetic constructs, conventionallyreferred to as expression cassettes, comprise a region 5' of theheterologous DNA insert which harbours transcriptional and translationalinitiation controls, and a region 3' of the DNA insert which controlstranslational termination and, optionally, transcriptional termination.Both control regions are derived typically from genes homologous toAspergillus, although it is to be understood that such control regionsneed not be derived from the genes native to the specific species chosenas glycolate oxidase production host, and need not be derived from thesame Aspergillus gene.
Initiation control regions, more commonly referred to as promoters,which are useful to drive expression of glycolate oxidase-encoding DNAinclude those derived from genes in the ethanol utilization pathway ofAspergillus nidulans, including the alcohol dehydrogenase genes alcA,aldA and ADH3 gene. Suitable initiation controls also include thosederived from the triose phosphate isomerase genes of Aspergillus nigerand Aspergillus nidulans, the trpc gene of Aspergillus nidulans, theamds gene of Aspergillus nidulans, the pectin lyase gene of variousAspergillus species as well as the glucoamylase gene of Aspergillusniger, and certain amylase genes of Aspergillus oryzae.
Termination control regions, which include a polyadenylation site fortranslational termination and regions functional to terminatetranscription, may also be derived from various genes native toAspergillus hosts, or optionally other filamentous fungal hosts. Suchregions may be derived, for example, from the Aspergillus nigerglucoamylase gene, the Aspergillus nidulans trpC gene and the Mucormiehei genes. It has been found that transcriptional termination regionsare dispensible, but these may be included if desired. Moreover, anAspergillus-derived polyadenylation site can be unnecessary, providedthat the polyadenylation site native to the chosen glycolateoxidase-encoding DNA is incorporated within the expression cassette.
For intracellular production of glycolate oxidase, DNA coding thereforeis linked operably, and through its initiation codon, methionine, to theselected expression control region, such that expression results in theformation of glycolate oxidase-encoding messenger RNA. Alternatively, ifproduction of a glycolate oxidase fusion protein is desired, DNA codingfor glycolate oxidase is linked at its 5' end, and via the initiatingmethionine codon, to the 3' end of the gene encoding the carrierprotein. Also, if desired, DNA coding for an enzyme-cleavable linker isincorporated without reading frame disruption, between theoxidase-encoding DNA and the carrier-encoding DNA, so that expressionyields a fusion protein from which glycolate oxidase can be liberated byenzyme cleavage. A suitable carrier protein is Aspergillus glucoamylase,and suitable cleavable peptide linkers are those cleavable by ubiquitinhydrolase, kex, factor Xa and the like. An example of the fusion proteinapproach to protein production is provided by Contreras et al.,Bio/Technology, vol. 9, 378 (1991).
A genetically-engineered microbial transformant Aspergillus nidulansT17, harboring multiple copies of the spinach glycolate oxidase-encodingDNA under expression control of the A. nidulans alcA promoter, andmultiple copies of the A. nidulans alkR gene, the product of whichregulates function of the alcA promoter, was deposited under the termsof the Budapest Treaty with the Northern Regional Research Center,Peoria, Ill., U.S.A. on Sep. 24, 1992, under NRRL No. 21000. Theresulting transformants were cultured in various media (minimal or SYGrich media) in shaker flasks or fermenters, and additionally, differentagents such as oleic acid (OL), hydroxyacetic acid (HA), or corn steepliquor (CSL) were added to the media to increase levels of expression ofglycolate oxidase and/or catalase. The different transformants were thenscreened by assaying the Aspergillus nidulans whole cells (untreated)for catalase and glycolate oxidase activity, and by running reactionswith the cells as catalysts for the oxidation of glycolic acid toglyoxylic acid. When used as catalysts for the oxidation of glycolicacid to glyoxylic acid, the whole cells were not pre-treated orpermeabilized to increase accessibility of the reaction mixture to theenzymes in the interior of the cells; some permeabilization of the cellsmay take place, either from exposure to the reaction mixture or any ofits components, or by freezing and thawing, which was used to store thewhole cell catalysts until needed.
Many of the deficiencies of the soluble enzymes were eliminated byemploying whole cells of A. nidulans as catalyst. Recovery and reuse ofthe whole-cell catalyst was easily performed by centrifugation or byfiltering the catalyst away from the reaction mixture and recycling itto fresh reaction mixture; in this manner, turnover numbers forglycolate oxidase of as high as 10⁶ have been obtained. The ability tobubble oxygen through the reaction mixture without denaturing the enzymecatalyst (as is observed when using the soluble enzyme) resulted inincreases in the reaction rate of at least ten-fold over reactions wherethe reaction mixture is not bubbled, and this increase in ratesignificantly reduces the cost of manufacture for this process.
Several additional microbial transformants which express glycolateoxidase activity as well as endogenous catalase activity have beenprepared, and their use as a microbial catalyst in the present inventiondemonstrated. A second microbial cell catalyst which has been utilizedin the present invention is a transformant of Hansenula polymorpha (amethylotrophic yeast). The methylotrophic yeast Hansenula polymorpha hasbeen developed as an expression system for heterologous proteins(Roggenkamp et al., Mol. Gen. Genetics, vol. 202, 302 (1986); Hollenbergand Janowicz, EPA No. 0299108 (1987)). As a facultative methylotrophthis yeast species is able to use methanol as sole energy and carbonsource; other possible carbon sources are glucose or glycerol. Uponaddition of methanol into culture media, key enzymes of the methanolmetabolism are strongly expressed. The expression is regulated at atranscriptional level. The genes for these key enzymes dihydroxyacetonesynthase (DHAS), formate dehydrogenase (FMD; i.e., FMDH) and methanoloxidase (MOX) have been cloned and characterized (Ledeboer et al.,Nucleic Acids Res., vol. 13, 3060 (1985); Janowicz et al., Nucleic AcidsRes., vol. 13, 2043 (1985); Hollenberg and Janowicz, 1987). Thepromoters of these key enzymes are repressed using glucose, derepressedusing glycerol and induced using methanol as carbon source.
The promoter elements of these genes can be used for heterologous geneexpression. Accordingly, they are components of expression vectors forthe generation of recombinant Hansenula polymorpha strains. A standardexpression vector harbors the coding sequence of a foreign geneintegrated between the promoter, for example but not by way oflimitation, an FMD-promoter, a MOX-promoter or the like, and generallyany terminator, again by way of example but not by way of limitation, aMOX-terminator sequence or the like. In addition, the vectors containselection markers and a HARS1 (Hansenula autonomously replicatingsequence) for selection and propagation in suitable H. polymorpha hostsand a bacterial origin of replication (ori) and an ampicillin-resistance(amp) gene for propagation and selection in E. coli (Gellissen et al.,Biotech Adv., vol. 10, 179 (1992); Gellissen et al., Tibtech, vol. 10,413 (1992)).
After uptake the heterologous DNA is stably integrated into the host'sgenome. Transformations result in a variety of strains harboring avarying copy number of the integrated DNA in a head-to-tail arrangement.This stable multimeric integration of expression cassettes makesHansenula polymorpha an ideal host for the co-expression of severalproteins in a fixed ratio (Janowicz et al., Yeast, vol. 7, 431 (1991)).
The construction of an expression cassette for the expression ofglycolate oxidase or catalase in Hansenula may be accomplished by meanswell known to those skilled in the art. The source of the glycolateoxidase gene (or the catalase gene) may either be chromosomal DNA or apreviously constructed vector containing the gene. Generally it is mostpreferred to isolate the glycolate oxidase gene from an already existingvector. It is also preferred that the glycolate oxidase gene be boundedon both the 5' and 3' ends by convenient restrictions sites. Any vectoror plasmid containing a suitable glycolate oxidase gene may be used,however, for the purpose of the present invention the plasmid pDA-PCR#1is most preferred. pDA-PCR#1 is derived from the Aspergillustransformation plasmid pTAwtS-GOD. More specifically, pTAwtS-GODcontains a spinach glycolate oxidase gene under the control of anAspergillus nidulans alcA promoter and bounded at the 5' end by a BglIIsite and at the 3' end by an EcoRI site. The glycolate oxidase gene inpTAwtS-GOD is amplified by conventional PCR protocols using primerswhich incorporated an XbaI site at one end and an EcoRI site at theopposite end. The PCR fragment is ligated between the XbaI and EcoRIsites in the Bluescript plasmid (Stratagene, La Jolla, Calif.) to givethe plasmid pDA-PCR#1.
Isolated DNA encoding the glycolate oxidase protein is optionallyamplified by techniques well known in the art for the purpose of cloninginto a suitable Hansenula transformation vector. Any method ofamplification may be used including Polymerase Chain Reaction (PCR) orLigase Chain Reaction (LCR) where PCR is most preferred. Amplifiedglycolate oxidase DNA is then cloned into a suitable Hansenulatransformation vector. A number of transformation vectors are suitablewhere the vector contains a promoter capable of driving the glycolateoxidase gene and where the promoter contains, downstream, a restrictionsite compatible with the restriction sites flanking the glycolateoxidase gene. Any suitable transformation vector may be used, includingpFPMT130 or pRB described in detail in FIGS. 4 and 5. The restrictedfragment is cloned into the multiple cloning site of the basic vectorpFPMT130 (see FIG. 4) using the EcoRI and the BamHI site for insertion.A second series is constructed in the pRB vector harboring achloramphenicol resistance sequence as a selection marker (FIG. 5).Restriction, ligation, propagation, and isolation of the newly generatedplasmid DNA follows standard procedures as described by Maniatis et al.,1982, Molecular Cloning: a laboratory manual, Cold Spring HarbourLaboratory Press. The insertion of the cDNA sequence results in theexpression vectors PFMDGO and pRBGO (FIGS. 6 and 7).
The vectors described above are used to transform competent H.polymorpha cells of strain RB11, deficient in orotidine 5' phosphatedehydrogenase (ura⁻). The auxotrophic strain RB11 is generated basicallyas described by Roggenkamp et al., 1986. Competent cells of this strainare generated according to established protocols (Dohmen et al., Yeast,7, 691, (1991)) as follows: 10 mL yeast medium (YPD; i.e., yeast,peptone, and glucose) are inoculated with cells and cultured at 37° C.overnight. This culture is subsequently used to inoculate 200 mL of YPD.Cell are cultured at 37° C. until the OD₆₀₀ is between 0.6 and 1.0.Cells are harvested by centrifugation, washed at room temperature with100 mL of a solution A (1M sorbitol, 10 mM bicine pH 8.35, 3% ethyleneglycol) and then resuspended in 4 mL of this solution A; 11 L ofdimethylsulfoxide (DMSO) is added and the competent cells are stored at-70° C.
For transformation, 10 g of plasmid DNA and 100 l of cold 0.1M CaCl₂ areadded to the frozen cell aliquots; after fast thawing 1.0 mL of asolution B (40% PEG 3350, 200 mM bicine pH 8.35) is added, and thetransformation mixtures are incubated at 37° C. for 1 hour.Subsequently, cells are washed in 1 mL of a solution C (150 mM NaCl, 10mM bicine pH 8.35) and resuspended in 200 mL. This suspension is platedon selective agar plates (yeast nitrogen base (YNB)-glucose). Plates areincubated at 37° C. for 3 to 5 days.
Generation of mitotically stable strains with multimeric copies of theheterologous DNA is performed in the following manner. Colonies fromdeveloped plates are used to inoculate 3 mL of YNB glucose and culturedat 37° C. A 50 L aliquot of the fully grown culture is used to inoculateanother 3 mL culture. This procedure is repeated for some 40 generationsof growth. During this passaging plasmid DNA is integrated into thegenome. Subsequently 3 mL of YPD (non-selective medium) is inoculatedand cultured at 37° C. Plating of a diluted aliquot should result in anidentical number of colonies when plated on selective and non-selectiveagar plates.
Identification of recombinant strains expressing glycolate oxidase (GO)is performed in the following manner. For expression of the recombinantGO the cells have to be cultured under derepressive or inductiveconditions. The passaged transformants were used to inoculate 3 mL ofYNB supplemented with 1% glycerol. After two days of growth the cellswere transferred to 3 mL YNB supplemented with 1% methanol. After afurther day of induction cells were harvested by centrifugation (5 min800× g) and GO activity was determined in samples prepared from crudeextracts. Preparation of crude extract is performed by resuspension ofharvested cells in 600 mL of extraction buffer (1 mM dithiothreitol(DTT), 0.1 mM flavin mononucleotide (FMN), 10 mM phenol methylsulfonylfluoride (PMSF), 10% DMSO in 0.1M sodium phosphate buffer pH 8.3). Cellsare broken with glass beads (0.45-0.5 mm diameter) for 5 minutes,cooling with solid CO₂ every 30 seconds. Cell debris is removed bycentrifugation (15 minutes at 15000× g at 4° C.). 5-20 mL of the crudeextracts were analyzed for GO content by quantifying the generation ofglyoxylic acid by spectrophotometric assay modified after Soda et al.,1973, Agr. Biol. Chem., 37(6):1393.
The copy number of the integrated heterologous DNA in GO-expressingstrains is determined as outlined by Gellissen et al., 1992. For DNAdetermination, DNA is isolated from various transformants and from theuntransformed host strain RB11. The isolated DNA is restricted withAsp718/SalI, transferred to nitrocellulose and hybridized to a ³²P-labeled EcoRI/Asp718 fragment. This results in two signals in similarelectrophoretic positions for the genuine single copy FMD/GO gene fusionand the heterologous FMD promoter/GO gene fusion. In DNA dilutions thecopy number is estimated comparing the signal intensity of theheterologous fragments with that of the intrinsic single copy control.
Transformed strains were passaged and analyzed for GO content asdescribed below. The screening results reported in the Examples wereobtained using PFMDGO and pRBGO for transformation. Glycolate oxidaseprotein may be detected by Western blot analysis or glycolate oxidaseactivity may be detected by means of a spectrophotometric assay. Mostpreferred is the method described by Soda, et al., Agr. Biol. Chem.,vol. 37, 1393 (1973), herein incorporated by reference. This assaymeasures the glyoxylate produced by the glycolate oxidase-catalyzedoxidation of glycolate by reacting said glyoxylate with glycine ando-aminobenzaldehyde to form a yellow complex having an absorbancemaximum at 440 nm. A genetically-engineered transformant of Hansenulapolymorpha which produces high levels of glycolate oxidase was selectedand designated H. polymorpha GO1, and was deposited under the terms ofthe Budapest Treaty with the Northern Regional Research Center, Peoria,Ill., U.S.A. on Mar. 30, 1993, under NRRL No. Y-21065.
The Hansenula strains were also evaluated for their ability to produceendogenous catalase. For the evaluation of catalase production,transformed Hansenula polymorpha was grown according to the proceduredescribed above and analyzed for enzymatically active catalase (i.e.,any disproportionation of hydrogen peroxide as determined by assays ofconventional design). Several methods of determining catalase activityare available, such as the method of Beers et al., J. Biol. Chem., vol.195, 133 (1952).
H. polymorpha cell catalysts were typically prepared by first growing aninoculum of an H. polymorpha transformant in 500 mL of YPD (Difco), pH4.4. This culture was then inoculated into a fermenter containing 10 Lof Yeast Nitrogen Base (YNB, Difco) without amino acids (14 g), ammoniumsulfate (50 g) and methanol (100 g), at pH 5.0. The fermenter wasoperated for 42.5 h at 37° C., an agitation rate of 400 rpm, constant pHof 5.0, 40% dissolved oxygen (controlled), and 14 psig of air. At theconclusion of the fermentation, 1.0 kg of glycerol was added and thecells harvested by centrifugation, frozen in liquid nitrogen, and storedat -80° C.
A third microbial cell catalyst which has been utilized in the presentinvention is a transformant of Pichia pastoris (a methylotrophic yeast)which expresses the glycolate oxidase enzyme from spinach, as well as anendogenous catalase. One class of useful Pichia hosts are auxotrophicmutants, i.e., mutant strains which require supplementation with one ormore amino acids, vitamins or other nutrients in order to grow.Transformation of such mutants can be readily selected by employing, aspart of the recombinant DNA material used to transform the mutant host,DNA sequences which code for the production of the missing gene product.Most preferred is the host yeast strain mutant Pichia pastoris GTS115(his4), which is a mutant defective in the ability to produce histidine,and has been identified as having the mutant genotype his4. Pichiapastoris GTS115 (his4), has been deposited with the Northern RegionalResearch Laboratories, (NRRL) under the terms of the Budapest Treaty andwill be hereinafter referred to by its NRRL accession number NRRLY-15851. It is of course recognized by those of skill in the art thatmutants in many other genes important in Pichia metabolism also exist orcan be isolated and therefore virtually any other auxotrophic Pichiahost would be suitable for the purpose of the present invention.
A variety of genetic constructs, adapted to receive heterologous DNA andto control expression thereof, have been developed for use with Pichiahosts and any of these may be employed for the purpose of producingglycolate oxidase in the Pichia host. Such genetic constructs,conventionally referred to as expression cassettes, comprise a region 5'of the heterologous DNA insert which harbors transcriptional initiationcontrols, and a region 3' of the DNA insert which controlstranscriptional termination. It is most preferred when both controlregions are derived from genes homologous to Pichia although it is to beunderstood that such control regions need not be derived from the genesnative to the specific species chosen as glycolate oxidase productionhost, and need not be derived from the same Pichia gene.
Initiation control regions, more commonly referred to as promoters,which are useful to drive expression of glycolate oxidase-encoding DNAinclude those derived from genes in the methanol utilization pathway ofPichia. Virtually any Pichia promoter capable of driving the spinachglycolate oxidase gene is suitable for the present invention includingglyceraldyhyde-3-phosphate dehydrogenase and dihydroxy acetone synthasehowever the most preferred are the alcohol oxidase genes, AOX1.
Termination control regions, which may include a polyadenylation siteand regions functional to terminate transcription, may also be derivedfrom various genes native to Pichia hosts, or optionally other yeasthosts or even from spinach. Optionally a Pichia polyadenylationtermination site may be unnecessary, however, it is most preferred ifthey are included.
For intracellular production of glycolate oxidase, DNA encodingglycolate oxidase is linked operably through its initiation codon to theselected expression control region, such that expression results in theformation of glycolate oxidase-encoding messenger RNA. Alternatively, ifproduction of a glycolate oxidase fusion protein is desired, DNAencoding for glycolate oxidase is linked at its 5' end to the 3' end ofthe gene encoding the carrier protein. Optionally the reverseorientation could be constructed where DNA encoding the carrier proteinis linked at its 5' end to the 3' end of the DNA encoding glycolateoxidase. Also, if desired, DNA coding for an enzyme cleavable linker isincorporated without reading frame disruption, between theoxidase-encoding DNA and the carrier-encoding DNA, so that expressionyields a fusion protein from which glycolate oxidase can be liberated byenzyme cleavage. An example of the fusion protein approach to proteinproduction is provided by Contreras et al., Bio/Technology, vol. 9, 378(1991).
The construction of an expression cassette for the expression ofglycolate oxidase in Pichia may be accomplished by means well known tothose skilled in the art. The source of the glycolate oxidase gene mayeither be chromosomal DNA or a previously constructed vector containingthe gene. Generally it is most preferred to isolate the glycolateoxidase gene from an already existing vector. It is also preferred thatthe glycolate oxidase gene be bounded on both the 5' and 3' ends byconvenient restrictions sites. Any vector or plasmid containing asuitable glycolate oxidase gene may be used, however, for the purpose ofthe present invention the plasmid pDA-PCR#1 is most preferred. pDA-PCR#1is derived from the Aspergillus transformation plasmid pTAwtS-GOD whichis fully described in U.S. Ser. No. 07/817,170, herein incorporated byreference. Briefly, pTAwtS-GOD contains a spinach glycolate oxidase geneunder the control of a Aspergillus nidulans alcA promoter and bounded atthe 5' end by a BglII site and at the 3' end by an EcoRI site, (FIG. 8).The glycolate oxidase gene in pTAwtS-GOD was amplified by conventionalPCR protocols using primers which incorporated an XbaI site at one endand an EcoRI site at the opposite end. The PCR fragment was ligatedbetween the XbaI and EcoRI sites in the Bluescript plasmid (Stratagene,La Jolla, Calif.) to give the plasmid pDA-PCR#1.
Isolated DNA encoding the glycolate oxidase protein is optionallyamplified by techniques well known in the art for the purpose of cloninginto a suitable Pichia transformation vector. Any method ofamplification may be used including Polymerase Chain Reaction (PCR) orLigase Chain Reaction (LCR) where PCR is most preferred. Amplifiedglycolate oxidase DNA is then cloned into a suitable Pichiatransformation vector. A number of transformation vectors are suitablewhere the vector contains a promoter capable of driving the glycolateoxidase gene and where the promoter contains, downstream, a restrictionsite compatible with the restriction sites flanking the glycolateoxidase gene. Any suitable transformation vector may be used, includingpHIL-A1, pHIL-D1, pHIL-D2, pHIL-D3, pHIL-D5, pHIL-S1, pRK20, and pT76H4,however plasmid pHIL-D4 is most preferred. pHIL-D4 is commerciallyavailable from Phillips Corp. (Phillips Petroleum Company, Bartlesville,Okla.) and is described in detail in FIG. 6. Briefly, pHIL-D4 includesthe following features (i) Pichia pastoris methanol inducible promoterAOX1 linked through an EcoRI site to (ii) AOX1 transcriptionaltermination element, (iii) a P. pastoris selectable marker HIS4; (iv) akanamycin resistance gene; (v) a 3' AOX1 flanking fragment; (vi) andpBR322 elements enabling propagation and selection in E. coli hosts. TheHIS4 marker is useful in selecting for positively transformed hosts andthe kanamycin resistance gene is useful for selecting high copy numbertransformants. Cloning of the glycolate oxidase DNA is accomplished byrestriction enzyme digestion of the vector and the glycolate oxidasecontaining DNA fragment with compatible restriction endonucleases,followed by a ligation according to protocols well known to thoseskilled in the art. Typically the result of such ligation is thecreation of a vector in which the spinach glycolate oxidase gene isinserted between the AOX1 promoter and the AOX1 termination region. Theresulting vector is capable of transforming any suitable Pichia sp. andeffecting the expression of enzymatically-active glycolate oxidase andhas been labeled pMP1.
Because the plasmid pMP1 lacks an origin of replication for Pichia, alltransformants arise from chromosomal integration of the plasmid. Theroutiner will recognize, however, that a suitable transforming plasmidcould also be constructed so as to be autonomously replicating withinthe transformed host. For the purpose of the present inventionchromosomal integration of the plasmid is preferred, as it provides amore stable transformed host.
Transformation of a suitable Pichia sp. may be accomplished by a varietyof protocols well known in the art. As previously mentioned, preferredPichia hosts comprise Pichia auxotrophic mutants and most preferred isthe his- mutant, GTS115 (his4) (NRRL Y-15851). Briefly, spheroplasts ofthe host strain GTS115 (his4) are first prepared using a yeast cell walldegrading enzyme followed by incubation with the transformation vector,pMP1. After plating on selective media, His+ transformants are isolated.His+ transformants may be further screened for specific replacement ofchromosomal alcohol oxidase gene by glycolate oxidase gene by selectingfor a slow growing phenotype on methanol Mut-. For the purpose ofproducing commercially useful quantities of glycolate oxidase it isadvantageous to select clones with the highest possible copy number ofthe transforming plasmid. This is accomplished by growing the now Kan+transformants in the presence of ever increasing levels of kanamycin andselecting the clones with the greatest tolerance to kanamycin.
Transformants, containing multiple copies of the glycolate oxidase geneunder the control of the Pichia alcohol oxidase promoter are thenevaluated for the production of enzymatically-active glycolate oxidase.Transformants are grown to an A₆₀₀ of 2-10 in MGY medium with shaking at30° C. Cells are then pelleted and shifted to MM medium containing 0.5%methanol for induction and incubated with shaking at 30° C. for 1-4days. Glycolate oxidase protein may be detected by Western blot analysisor glycolate oxidase activity may be detected by means of aspectrophotometric assay. Most preferred is the method described bySoda, et al., (1973) supra. This assay measures the glyoxylate producedby the glycolate oxidase-catalyzed oxidation of glycolate by reactingsaid glyoxylate with glycine and o-aminobenzaldehyde to form a yellowcomplex having an absorbance maximum at 440 nm. High copy numbertransformants designated Pichia pastoris strains GS115-MSP10 and MSP12harboring multiple copies of the spinach glycolate oxidase-encoding DNAunder expression control of the AOX1 promoter, have been deposited underthe terms of the Budapest Treaty with the Northern Regional ResearchLaboratories and are designated by the accession numbers NRRL Y-21001(deposited Sep. 24, 1992), and NRRL Y-21040 (deposited Dec. 28, 1992),respectively.
P. pastoris cells were typically prepared by growing an inoculum in 100mL of YNB containing 1% glycerol. After 48 h growth at 30° C., the cellswere transferred into a fermenter containing 10 L of media composed ofyeast nitrogen base (YNB) without amino acids (134 g), glycerol (100 g),and biotin (20 mg). The fermentation was operated at pH 5.0 (controlledwith NH₄ OH), 30° C., agitation rate of 200 rpm, aeration of 5 slpm, 5psig of air, and dissolved oxygen maintained at no lower than 50%saturation. When glycerol was depleted, the cells were induced toexpress glycolate oxidase by growth in the same media except thatmethanol (50 g) was substituted for glycerol. Glycolate oxidase activityduring induction was followed by enzyme assay. After 24 h of inductionthe cells were harvested following treatment with glycerol (1 kg).Following harvest the cells were frozen in liquid nitrogen and stored at-80° C.
Unlike A. nidulans, H. polymorpha and P. pastoris cell transformantsrequired permeabilization prior to use as catalyst for the oxidation ofglycolic acid to glyoxylic acid. A variety of known methods ofpermeabilization were useful for preparing cells with sufficientglycolate oxidase activity (see Felix, H. Anal. Biochemistry, Vol. 120,211-234, (1982)). Typically, a suspension of 10 wt % wet cells in 0.1%(v/v) "TRITON" X-100/20 mM phosphate buffer (pH 7.0) was mixed for 15minutes, then frozen in liquid nitrogen, thawed, and washed with 20 mMphosphate/0.1 mM FMN buffer (pH 7.0). A second method ofpermeabilization was performed by mixing a suspension of 10 wt % wetcells in 0.1% (w/v) benzalkonium chloride (Sigma)/20 mM phosphate buffer(pH 7.0) for 60 minutes, then washing the permeabilized cells with 20 mMphosphate/0.1 mM FMN buffer (pH 7.0).
A fourth microbial cell catalyst which has been utilized in the presentinvention is a transformant of Escherichia coli (a bacteria) whichexpresses the glycolate oxidase enzyme from spinach, as well as anendogenous catalase. Such an E. coli transformant was prepared asdescribed in Macheroux et. al, Biochem. Biophys. Acta, Vol. 1132, 11-16(1992), and is additionally described in Example 5.
The glycolate oxidase (added as Aspergillus nidulans, Pichia pastoris,Hansenula polymorpha or Escherichia coli whole cells) used in thereaction should be present in an effective concentration, preferablyabout 0.1 to about 10 IU/mL. An IU (International Unit) is defined asthe amount of enzyme that will catalyze the transformation of onemicromole of substrate per minute.
The pH of the reaction solution should be between 7 and 10, preferablybetween 8.0 and 9.5. The pH can be maintained by a buffer, since enzymeactivity varies with pH. The pH of the reaction decreases slightly asthe reaction proceeds, so it is often useful to start the reaction nearthe high end of the maximum enzyme activity pH range, about 9.0-9.5, andallow it to drop during the reaction. As has been previously describedin U.S. Pat. No. 5,219,745 (Jun. 15, 1993), an amine buffer capable ofcomplexing the glyoxylic acid (by forming an amine which is more stableto chemical or enzymatic oxidation) is employed along with catalase tomaximize product selectivity. Ethylenediamine, or less preferably,tris(hydroxymethyl)aminomethane (hereinafter TRIS), piperazine, orglycylglycine improved the yield of glyoxylic acid. These amines areused in a molar ratio of amine/glycolic acid (starting amount) of 1.0 to3.0, preferably 1.0 to 1.33. Within this range, the exact value may beadjusted to obtain the desired pH. With very basic amines used at highamine to glycolic acid ratios, it may be necessary to adjust the pH, asby adding acid, for example hydrochloric or sulfuric acids. With lessbasic amines such as TRIS, it may be necessary to add a base to maintainthe desired pH.
The concentration of accessible catalase (added as Aspergillus nidulans,Pichia pastoris, Hansenula polymorpha or Escherichia coli whole cells)should be 50 to 100,000 IU/mL of reaction mixture, preferably 350 to14,000 IU/mL. It is preferred that both the glycolate oxidase andcatalase enzymes be present within the same microbial cell (in thiscase, a transformant of A. nidulans, P. pastoris, H. polymorpha or E.coli), but an additional source of microbial catalase (for example, butnot by way of limitation, Saccharomyces cerevisiae or the like) may beadded to supplement the catalase present. Additionally, the catalase andglycolate oxidase concentrations should be adjusted within the aboveranges so that the ratio (measured in IU for each) of catalase:glycolateoxidase is at least about 250:1. Flavin mononucleotide (FMN) is anoptional added ingredient, used at a concentration of 0.0 to 2.0 mM,preferably 0.01 to 0.2 mM.
The reaction rate is at least partially controlled by the rate at whichoxygen can be dissolved into the aqueous medium. Oxygen can be added tothe reaction as the oxygen in air, but it is preferred to use arelatively pure form of oxygen, and to use elevated pressures. Althoughno upper limit of oxygen pressure is known, oxygen pressures up to 50atmospheres may be used, and an upper limit of 15 atmospheres ispreferred. Sparging (bubbling) oxygen through the reaction mixture isnecessary to maintain a high oxygen dissolution (and hence reaction)rate. Oxygen is sparged through the reaction mixture at a rate of 0.05to 5 volumes of oxygen (measured at atmospheric pressure) per volume ofreaction mixture per minute (vol/vol min), and preferably between 0.2and 2 vol/vol/min. Additionally, a convenient form of agitation isuseful, such as stirring.
The reaction temperature is an important variable, in that it affectsreaction rate and the stability of the enzymes. A reaction temperatureof 0° C. to 40° C. may be used, but the preferred reaction temperaturerange is from 5° C. to 15° C. The reaction temperature should not be solow as to cause the reaction mixture to freeze. Operating in thepreferred temperature range maximizes recovered enzyme activity at theend of the reaction.
Upon completion of the reaction and removal of the microbial celltransformant catalyst by filtration or centrifugation, the amine bufferis most conveniently removed by use of an ion exchange resin. Suitableacidic cationic exchange resins include "AMBERLITE" CG120 or "AMBERLITE"IR120 (Rohm & Haas Co.), and "DOWEX" 50 (Dow Chemical Co.). The aminemay then be recovered and subsequently recycled by treatment of theresin with strong base.
The product glyoxylic acid is useful in the preparation of vanillin andethylvanillin, as well as being used in ion exchange resins and as anacid catalyst in the pharmaceutical industry (Ullmanns). It is usuallysold as a 50% (weight percent) aqueous solution. It is also to beunderstood that reference to glyoxylic acid in this application can alsomean the glyoxylate anion, especially when the glyoxylic acid is presentin a solution whose pH is greater than about 2.3.
Media for Microbial Cell Transformants Cultured in Shaker Flask orFermenter
The minimal media (MIN) used for culturing the microbial celltransformants consisted of fructose (1%, 1.0 g/L), threonine (100 mM,11.9 g/L), ammonium tartrate (6.0 g/L), trace elements (1 mL/L), andsalt solution (10 mL/L); the pH of this minimal media was adjusted to6.5 with sodium hydroxide.
The rich (SYG) media used for culturing the microbial cell transformantsconsisted of yeast extract (0.5%, 5.0 g/L), ammonium nitrate (100 mM,8.0 g/L), potassium phosphate (monobasic, 33 mM, 4.5 g/L), magnesiumsulfate heptahydrate (2 mM, 0.5 g/L), trace elements (1.0 mL/L); afteradjusting the pH to 5.5 and autoclaving, glucose was added to 2% (w/v).
Glycolate Oxidase and Catalase Assays for Whole Cells
Microbial cell transformants were assayed for glycolate oxidase activityby accurately weighing ca. 5-10 mg of the wet cells (blotted on filterpaper to remove excess moisture) into a 3-mL quartz cuvette containing amagnetic stirring bar and 2.0 mL of a solution which was 0.12 mM in2,6-dichlorophenolindophenol (DCIP) and 80 mM in TRIS buffer (pH 8.3).The cuvette was capped with a rubber septum and the solutiondeoxygenated by bubbling with nitrogen for 5 min. To the cuvette wasthen added by syringe 40 μL of 1.0M glycolic acid/1.0M TRIS (pH 8.3),and the mixture stirred while measuring the change in absorption withtime at 605 nm (ε=22,000).
Catalase activity was assayed by accurately weighing ca. 2-5 mg of thewet cells into a 3-mL quartz cuvette containing a magnetic stirring barand 2.0 mL of a distilled water, then adding 1.0 mL of 50 mM hydrogenperoxide in 50 mM phosphate buffer (pH 7.0) and measuring the change inabsorption with time at 240 nm (ε=39.4). Glycolate oxidase and catalaseactivities of the Aspergillus nidulans wet cells cultured in differentmedia ranged from 0.5-2.0 DCIP IU/gram for glycolate oxidase and500-7000 IU/gram for catalase. Glycolate oxidase and catalase activitiesof the E. coli wet cells (unpermeabilized) cultured in different mediaranged from 0.8-4.0 DCIP IU/gram wet cells for glycolate oxidase and1000-2000 IU/gram wet cells for endogenous catalase. Glycolate oxidaseand catalase activities of the H. polymorpha or P. pastoris wet cells(permeabilized) cultured in different media ranged from 20-120 DCIPIU/gram wet cells for glycolate oxidase and 30,000-200,000 IU/gram forendogenous catalase.
HPLC Analysis for Glycolic, Glyoxylic, Oxalic, and Formic Acid
Samples for analysis were first filtered through a Millipore UltrafreeMC filter unit (10,000 mw cutoff). Analyses for glycolic acid, glyoxylicacid, oxalic acid and formic acid were performed by high performanceliquid chromatography (HPLC) on a Bio-Rad Aminex HPX-87H column (300×7.8mm) at 40° C., using as solvent an aqueous solution of H₂ SO₄ (0.01N)and 1-hydroxyethane-1,1-diphosphonic acid (0.1 mM) at 1.0 mL/minute. UVanalysis was performed at 210 nm. The retention times of oxalic acid,glyoxylic acid, glycolic acid, formic acid, and propionic acid (internalstandard) or isobutyric acid (internal standard) were 4.29, 6.09, 7.77,8.79, 11.41, and 13.05 minutes, respectively.
EXAMPLE 1 Aspergillus Host Strain Selection
As a preliminary step in the construction of a glycolateoxidase-producing Aspergillus strain, available host strains wereexamined for endogenous levels of catalase activity, and the strainexhibiting highest catalase activity was selected to serve as expressionhost.
In particular, catalase activity was examined in both an argBAspergillus niger strain 350.52 (ATCC 20739), and an Aspergillusnidulans strain T580, which is pyr⁻ and harbors multiple copies of thealcR gene. Cultures of each host strain were grown at the 10 liter scalefor 48 hours in either minimal medium or rich (SYG) medium (salts, yeastextract, glucose) under inducing conditions. For the A. nidulans strainsT580, this entailed growth in 3% SYG (with 3% glucose) until glucoselevels were minimal, after which the medium was supplemented with theinducer methylethylketone. Mycelia (500-700 g) was harvested 16-20 hoursafter induction. The A. niger strain was grown in SY medium (salts,yeast extract) containing 2% corn starch for 40 hours.
An aliquot (100 mL) of each sample was disrupted with glass beads (0.5mm) in a DyanoMill vessl for 120 sec, and the refrigerated disruptatewas then assayed for catalase activity, using an assay of conventionaldesign, Beers et al., J. Biol. Chem., vol. 195, 133 (1952). Resultsrevealed that the catalase levels in the A. nidulans host strain T580were 110 IU/mg. Catalase levels in the A. niger strain were found to be90 IU/mg. On this basis, the A. nidulans strain was selected to serve asglycolate oxidase production host.
EXAMPLE 2 Isolation of cDNA Coding for Spinach Glycolate Oxidase
For expression in an Aspergillus species host, DNA coding for spinachglycolate oxidase was first isolated from a library of spinach cDNA.More particularly, poly(A)-containing mRNA was collected from fresh,young spinach leaves using the phenol extraction method and protocolsconventional thereto. Complementary DNA was then prepared against themRNA using the reverse transcriptase-based method and standardprotocols.
Based on knowledge of the cDNA sequence coding for spinach glycolateoxidase, as reported by Volokita and Somerville, J. Biol. Chem., vol.262, 15825 (1987), the polymerase chain reaction (PCR) approach was usedto amplify selectively the glycolate oxidase-encoding DNA resident inthe library. In particular, and as shown schematically in FIG. 2,glycolate oxidase-encoding cDNA was amplified in three ligatablesections, using oligonucleotide primers specific for the followingregions of the target cDNA; (1) a 203 bp N-terminal region encompassingthe ATG initiation codon and including the BglII site 203 bp 3' thereof;(2) a 565 bp central region encompassing the BglII site and includingthe SacI site; and (3) a 342 bp C-terminal region encompassing the SacIsite and the stop codon TAA. As will be noted in FIG. 2, cloning andassembly of the intact coding region was facilitated by the use ofprimers having non-hybridizing 5' flanks which incorporated a selectedrestriction site (denoted using the conventional single letter,restriction site designation). Protocols conventional to polymerasechain reaction were employed.
PCR-amplified regions of the cDNA were sequence-verified and assembledinto the vector pTZ19R, using the strategy shown in FIG. 2. The correctsequence in the assembled construct was also confirmed.
For Aspergillus strain construction, cDNA coding for spinach glycolateoxidase, obtained as just described, was linked operably with theexpression controlling region of the alcohol dehydrogenase I (alcA) geneof Aspergillus nidulans, using the strategy illustrated schematically inFIG. 3. The particular vector chosen, designated pTAwtS, is described byGwynne et al., Biochem. Soc. Transactions, vol. 17, 338 (1989), which isincorporated herein by reference. Briefly, this vector incorporates, ina pUC8 background, a 2.2 kb HindIII fragment of the A. nidulans alcAgene which incorporates all DNA elements required for proper translationand regulated transcription of protein-encoding DNA linked downstreamthereof. The particular vector pTAwtS incorporates an engineered NcoIsite precisely at the initiation codon downstream of the expressioncontrolling region, to accept in proper translational reading frame aDNA molecule coding for the protein of interest. The vector pTAwtS wasfurther modified by incorporation at a site downstream of the cloningsite, a transcriptional terminator derived from the Aspergillus nigerglucoamylase gene (gla), in the form of a 2.2 kb EcoRI/EcoRI DNAfragment. Thus, as shown in FIG. 3, the intact cDNA clone coding forspinach glycolate oxidase, was incorporated as a BglII/EcoRI fragmentinto NcoI/EcoRI-cleaved pTAwtS to form pTAwtS-GOD. The transcriptionalterminator was then introduced into the EcoRI site 3' of the stop codonresident in the glycolate oxidase coding region to yield pTAwtS-GOD-T.Sequencing across restriction site junctions confirmed that theconstruct contained the desired functional components in the properrelationship.
For expression, there was selected as host a strain of Aspergillusnidulans designated T580, which is pyr⁻ and harbors multiple copies ofthe gene alcR, the expression product of which co-regulates expressionfrom the alcA promoter. Construction of the T580 host, from the pyr⁻ A.nidulans strain was achieved as described by Felenbok et al., Gene, vol.73, 385 (1988), which is incorporated herein by reference. The plasmidpTAwtS-GOD-T was introduced into T580 using now conventionalDNA-mediated transformation protocols, described for example by Yeltonet al., Proc. Natl. Acad. Sci., vol. 81, 1470 (1984). Briefly,spheroplasts of the host strain T580 were first prepared using the cellwall degrading enzyme Novozyme 234. Spheroplasts were then incubated inthe presence of calcium/polyethylene glycol, with about 10 ug ofpTAwtS-GOD-T and 2 ug of a marker plasmid carrying the pyr4 gene ofNeurospora crassa. After plating on medium lacking uridine,transformants (about 20 in all) were selected and then subjected toSouthern blot analysis by probing with radiolabelled glycolateoxidase-encoding DNA, to confirm the presence of genomically integratedDNA coding for glycolate oxidase. Southern blot analysis revealed thatabout 80% of the transformants harboured multiple copies of the spinachglycolate oxidase encoding gene.
Transformants harboring multiple copies of the glycolate oxidase genewere then evaluated individually for glycolate oxidase activity. Thiswas done by introducing conidial inoculum prepared from individualtransformants into 50 mL of minimal fungal medium which contains saltsand 0.2% fructose/1% threonine (as inducer) combination. After culturingat 30° C. for 48 hours, cell extracts were analyzed for glycolateoxidase activity, using the o-aminobenzaldehyde assay (Soda et al.; seeabove). In this assay, with absorbance monitoring at 440 nm, several ofthe transformants tested positive for glycolate oxidase activity, andone transformant, designated Aspergillus nidulans strain T17 wasselected.
A sample of Aspergillus nidulans strain T17, harboring multiple copiesof the spinach glycolate oxidase-encoding DNA under expression controlof the A. nidulans alcA promoter, and multiple copies of the A. nidulansalkR gene, the product of which regulates function of the alcA promoter,was deposited under the terms of the Budapest Treaty with the NorthernRegional Research Center, Peoria, Ill., U.S.A. on Sep. 24, 1992, underNRRL No. 21000.
EXAMPLE 3 Preparation of Hansenula polymorpha Transformants
Construction of Expression Vector pFMDGO.
The GO gene as found in pDA-PCR#1, which is derived from the Aspergillustransformation plasmid pTAwtS-GOD, was excised using EcoRI and BamHI.More specifically, pTAwtS-GOD contains a spinach glycolate oxidase geneunder the control of a Aspergillus nidulans alcA promoter and bounded atthe 5' end by a BglII site and at the 3' end by an EcoRI site. Theglycolate oxidase gene in pTAwtS-GOD is amplified by conventional PCRprotocols using primers which incorporated an XbaI site at one end andan EcoRI site at the opposite end. The PCR fragment is ligated betweenthe XbaI and EcoRI sites in the Bluescript plasmid (Stratagene, LaJolla, Calif.) to give the plasmid pDA-PCR#1. For a more detaileddescription of this procedure see International Patent Application WO95/01444 (publication date: 12 Jan., 1995), herein incorporated byreference for such purpose.
The restricted fragment was cloned into the multiple cloning site of thebasic vector pFPMT130 (see FIG. 4) using the EcoRI and the BamHI sitefor insertion. Restriction and ligations, propagation and isolation ofthe newly generated plasmid DNA followed standard procedures asdescribed by Maniatis et al. 1982. The insertion of the cDNA sequenceresulted in the expression vectors pFMDGO (FIG. 6).
Construction of Expression Vector PRBGO.
A second series was constructed in the pRB vector harboring anchloramphenicol resistance sequence as a selection marker (FIG. 5). TheGO gene as found in pDA-PCR#1 was excised using EcoRI and BamHI. Therestricted fragment was cloned into the multiple cloning site of thevector pRB (FIG. 5) using the EcoRI and the BamHI site for insertion.Restriction and ligations, propagation and isolation of the newlygenerated plasmid DNA followed standard procedures as described byManiatis et al., 1982. The insertion of the cDNA sequence resulted inthe expression vector pRBGO (FIG. 7).
Transformation of H. polymorpha with pFMDGO.
The vector pFMDGO was used to transform competent H. polymorpha cells ofstrain RB11, deficient in ortidin 5' phosphate dehydrogenase (ura⁻). Theauxotrophic strain RB11 was generated basically as described byRoggenkamp et al., 1986. Competent cells of this strain are generatedaccording to established protocols (Dohmen et al., 1991) as follows: 10mL yeast medium (YPD) were inoculated with cells and cultured at 37° C.overnight. This culture was subsequently used to inoculate 200 mL ofYPD. Cells were grown at 37° C. to an OD₆₀₀ of 0.6 to 1.0. Cells wereharvested by centrifugation, washed at room temperature in 100 mL of asolution A (1M sorbitol, 10 mM bicine pH 8.35 3% ethylene glycol) andthen resuspended in 4 mL of solution A; 11 L DMSO were added and thecompetent cells were stored at -70° C.
For transformation 10 g of plasmid DNA and 100 mL of cold 0.1M CaCl₂were added to the frozen cell aliquots; after fast thawing 1.0 mL of asolution B (40% PEG 3350, 200 mM bicine pH 8.35) was added, thetransformation mixtures was incubated at 37° C. for 1 hour. Subsequentlycells were washed in 1 mL of a solution C (150 mM NaCl, 10 mM bicine pH8.35) and resuspended in 200 L. This suspension was plated on selectiveagar plates (YNB-glucose). Plates were incubated at 37° C. for 3 to 5days.
Mitotically stable strains with multimeric copies of the heterologousDNA were generated by passage stabilization. Colonies from developedplates were used to inoculate 3 mL of YNB glucose and cultured at 37° C.A 50 L aliquot of the fully grown culture was used to inoculate another3 mL culture. This procedure was repeated for some 40 generations ofgrowth. During this passaging plasmid DNA was integrated into thegenome. Subsequently 3 mL of YPD (non-selective medium) was inoculatedand cultured at 37° C. Diluted aliquots of passage stabilized cellsresulted in an identical number of colonies when plated on selective andnon-selective agar plates.
The passaged transformants were used to inoculate 3 mL of YNBsupplemented with 1% glycerol. After two day of growth the cells weretransferred to 3 mL YNB supplemented with 1% methanol. After a furtherday of induction cells were harvested by centrifugation (5 min. at 800×g). Harvest cells were resuspended in 600 mL of extraction buffer (1 mMDTT, 0.1 mM FMN, 10 mM PMSF, 10% DMSO in 0.1 sodium phosphate buffer pH8.3). Cells were broken with glass beads (0.45-0.5 mn diameter for 5minutes cooling with CO₂ every 30 seconds. Cell debris was removed bycentrifugation (15 minutes at 15000× g at 4° C.). Glycolate oxidaseactivity was measured from cell lysates using a spectrophotometric assay(with absorbance monitoring at 440 nm) for GO enzyme activity employingo-aminobenzaldehyde and glycine (Soda et al., 1973). Results aresummarized in Table 3 with activities being reported per mg of protein.
TABLE 3 ______________________________________ pFMDGo transformed RB11 GO activity strain No. mU/mg ______________________________________ 11.2.01 1042 11.2.02 709 11.2.08 772 11.2.12 124 11.2.14 2047 11.2.16 1855 11.2.17 2910 11.2.18 1504 11.2.21 945 11.2.23 467 11.2.24 281 11.2.26 270 ______________________________________
Transformation of H. polymorpha with pRBGO.
The vector pRBGO was used to transform competent H. polymorpha cells ofstrain RB11, essentially as described for pFMDGO, above. After passagestabilization and assay for glycolate oxidase activity the followingclones were selected:
TABLE 4 ______________________________________ pRBGO transformed RB11 GO activity strain No. mU/mg ______________________________________ 11.11.80 5958 11.11.89 3055 11.11.95 4281 11.11.109 3771 11.11.126 7524 11.11.165 3583 11.11.177 4480 11.11.178 4492 11.11.179 3689 ______________________________________
One strain 11.11.126 was selected for further subcloning, and theresults are shown in Table 5.
TABLE 5 ______________________________________ Subclones of 11.11.126 GO activity strain No. mU/mg ______________________________________ 11.11.126.1 4111 11.11.126.2 71 11.11.126.3 3495 11.11.126.4 0 11.11.126.5 2266 11.11.126.6 5092 11.11.126.7 7026 11.11.126.8 4187 11.11.126.9 3274 11.11.126.10 4232 ______________________________________
The best strain from this subcloning, 11.11.126.7, was selected anddesignated Hansenula polymorpha GO1 and deposited on Mar. 30, 1993 underthe terms of the Budapest Treaty with U.S. Department of Agriculture,Northern Regional Research Laboratories, located in Peoria, Ill., and isdesignated by the accession number NRRL No. Y-21065. The copy number ofthe integrated heterologous DNA was determined for Hansenula polymorphaGO1 as outlined by Gellissen et al., 1992. DNA was isolated from thetransformant and from the untransformed host strain RB11. The isolatedDNA was restricted with Asp718/SalI, transferred to nitrocellulose andhybridized to a ³² P-labeled EcoRI/Asp718 fragment. This results in twosignals in similar electrophoretic positions for the genuine single copyFMD gene and the heterologous FMD promoter/GO fusion. In DNA dilutionsthe copy number was estimated comparing the signal intensity of theheterologous fragments with that of the intrinsic single copy control.This determination revealed that the Hansenula polymorpha GO1 containsapproximately 30 copies of the integrated plasmid. This recombinantstrain is mitotically stable and remains unchanged during fermentation.
EXAMPLE 4 Preparation of Pichia pastoris Transformants
Materials and methods.
The plasmids pHIL-D4 and pHIL-S1 were obtained from the Phillips Company(Phillips Petroleum Company, Bartlesville, Okla.). PCR reagents wereobtained from and used according to Perkin-Elmer Cetus. Protocolsconventional to PCR were employed as described in Innis, M. et al., PCRProtocols 1990. Academic Press. Restriction enzyme digestions, ligationstransformations and plasmid preparations were done as described inSambrook, J., et al., Molecular Cloning: a laboratory manual. 1989. ColdSpring Harbor Laboratory Press.
Construction of plasmid pMP1 containing spinach alycolate oxidase gene.
For the construction of a vector capable of transforming Pichia sp. forthe expression of glycolate oxidase, the glycolate oxidase (GO) genelocated in the vector pDA-PCR#1 (FIG. 8) was used. pDA-PCR#1 is derivedfrom the Aspergillus transformation plasmid pTAwtS-GOD which is fullydescribed in International Patent Application WO 95/01444 (publicationdate: 12 Jan., 1995), herein incorporated by reference for such purpose.Briefly, pTAwtS-GOD contains a spinach glycolate oxidase gene under thecontrol of a Aspergillus nidulans alcA promoter and bounded at the 5'end by a BglII site and at the 3' end by an EcoRI site, (FIG. 8). Theglycolate oxidase gene in pTAwtS-GOD was amplified by conventional PCRprotocols using primers which incorporated an XbaI site at one end andan EcoRI site at the opposite end. The PCR fragment was ligated betweenthe XbaI and EcoRI sites in the Bluescript plasmid (Stratagene, LaJolla, Calif.) to give the plasmid pDA-PCR#1. (FIG. 8)
The GO gene as found in pDA-PCR#1 was amplified by polymerase chainreaction (PCR) using primers incorporating EcoRI restriction sites(MP18: 5' TAC CGA ATT CAT GGA GAT CAC AAA TGT G 3' (SEQ. ID NO.: 2) andMP19: 5' AAC AGA ATT CTT ATA ATC TGG CAA CAG A 3' (SEQ. ID NO.; 3)).
Plasmid pHIL-D4 is commercially available from Phillips Co. (PhillipsPetroleum Company, Bartlesville, Okla.) and is a shuttle vector designedfor integration in Pichia pastoris. Briefly, this vector incorporates a1100 bp methanol inducible promoter AOX1 which is connected through anEcoRI site to a 300 bp AOX1 transcriptional termination element. Also onthe plasmid are a P. pastoris selectable marker HIS4, a kanamycinresistance gene, a 3' AOX1 flanking fragment and elements allowingpropagation and selection in E. coli hosts. (FIG. 8). The amplified GOgene was digested with EcoRI and subcloned into pHIL-D4 at the EcoRIsite (between AOX1 promoter and AOX1 termination) in the forwardorientation to produce plasmid pMP1 (FIG. 8). pMP1 was then use totransform Pichia pastoris.
Transformation of Pichia pastoris with pMP1.
A host strain of Pichia pastoris designated GTS115 (his4), (PhillipsPetroleum Company, Bartlesville, Okla.) was selected for transformationby pMP1. pMP1 was introduced into GTS115 (his4) using conventionalDNA-mediated transformation protocols described by Phillips. (Cregg etal., Mol. and Cell. Biol., vol. 5, 3376-3385, (1985)).
Briefly, spheroplasts of the host strain GTS115 were first preparedusing the cell wall degrading enzyme zymolase (Sigma Chemical, St.Louis, Mo.). Spheroplasts were then incubated in the presence ofsorbitol/polyethylene glycol, with about 1-2 ug of linearized pMP1.Transformants were allowed to regenerate on media selective for His+prototrophs. His+ clones were screened for chromosomal AOX1 displacementby replica plating on media with or without 0.5% methanol and selectingclones with a slow growing phenotype on methanol (Mut-). Mut- cloneswere further screened for expression cassette copy number by selectivegrowth in media containing increasing levels of kanamycin (from 100ug/ml to 1000 ug/ml). Two clones exhibiting the greatest resistance tokanamycin were selected and labeled GS115-MSP10 and MSP12. GS115-MSP10and MSP12 tolerated >1000 ug/ml kanamycin whereas 15 other His+/Mut-clones did not grow in kanamycin >100 ug/ml. PCR with primers MP18 (SEQID #2) and MP19 (SEQ ID #3) of chromosomal DNA isolated from GS115-MSP10and MSP12 resulted in a 1.1 kb fragment indicating the presence of GOgene in these recombinant strains and indicated in FIG. 9.
Expression of active glycolate oxidase from MSP10 and MSP12.
Strains GS115-MSP10 and MSP12 harboring multiple copies of the glycolateoxidase gene were evaluated individually for glycolate oxidase activity.This was done by growing GS115-MSP10 and MSP12 in appropriate mediafollowed by induction with 0.5% methanol. Briefly, cells are grown to anA₆₀₀ of 2-10 in MGY medium (1.34% yeast nitrogen base without aminoacids, 0.00004% biotin, 1% glycerol) with shaking at 30° C. Cells arethen pelleted and shifted to MM medium (1.34% yeast nitrogen basewithout amino acids, 0.00004% biotin, 0.5% methanol) and incubated withshaking at 30° C. for 1-4 days. Cells were harvested at 0, 3.5 and 24hrs post induction and lysed by vortexing with an equal volume of 0.5 mmglass beads in 50 mM sodium phosphate pH 7.4, 1 mM PMSF, 1 mM EDTA, 5%glycerol and 0.01 mM FMN for a total of 4 min in increments of 30 secfollowed by 30 sec on ice. Detection of GO enzyme by Western blotanalysis of these lysates confirmed the expression of GO gene in thesestrains. (FIG. 10)
Additionally, glycolate oxidase activity was measured from cell lysatesusing a spectrophotometric assay (with absorbance monitoring at 440 nm)for GO enzyme activity employing o-aminobenzaldehyde and glycine (Soda,K., 1973) which demonstrated activities of 100-300 IU/g blotted cells.FIG. 11 illustrates a typical time course of glycolate oxidase activityafter induction by methanol.
A sample of Pichia pastoris strains GS115-MSP10 and MSP12 harboringmultiple copies of the spinach glycolate oxidase-encoding DNA underexpression control of the AOX1 promoter, have been deposited under theterms of the Budapest Treaty with the Northern Regional ResearchLaboratories and are designated by the accession numbers NRRL Y-21001and NRRL Y-21040 (deposited on Dec. 28, 1992), respectively.
Expression of endogenous catalase from MSP12 and GS115-MSP10.
Transformants GS115-MSP10 and MSP12 harboring multiple copies of theglycolate oxidase gene were evaluated individually for the ability toco-express endogenous catalase with enzymatically active glycolateoxidase. Briefly, cells were grown in shaker flasks for about 48 hrs toan A₆₀₀ of 2-10 in YNB medium with 1% glycerol at 30° C. Cells were thenpelleted and shifted to fresh YNB medium containing 0.5% methanol (forinduction) and incubated at 30° C. for an additional 16-24 hrs. Foranalysis, extracts of cells were prepared by transferring 100 mg of wetcells (blotted to remove excess moisture) to 1 ml of 50 mM sodiumphosphate pH 7.4, 1 mM PMSF, 1 mM EDTA, 5% glycerol and 0.01 mM FNM andvortex mixing at high speed for 2 min in the presence of 1 g of 0.5 mmglass beads. Lysate was assayed for the presence of both catalase andglycolate oxidase.
Optionally, cultures were grown in 10 L fermenters with agitators forabout 48 hrs. to an A₆₀₀ of 2-10 in YNB with 1% glycerol at 30° C. Cellswere exposed to fresh medium containing 0.5% methanol (for induction)and allowed to incubate for an additional 6 hrs. Cells were thenharvested and lysed as described above and the lysate assayed for thepresence of both glycolate oxidase and endogenous catalase.
Glycolate oxidase was measured according to the method of Soda et al. asdescribed above. Catalase activity was measured according to the methodof Beers et al., J. Biol. Chem., 195, 133 (1952). In this method samplessuspected of containing catalase are mixed with an excess of hydrogenperoxide and absorbance is measure on an ultraviolet spectrophotometerat a wavelength of 240 nm. Table 6 illustrates co-expressed catalase andglycolate oxidase activities.
TABLE 6 ______________________________________ G.O. activity Catalase activity Hours IU/g IU/mg IU/g IU/g Post- Blotted Total Blotted Total Strain induction cells Protein cells Protein ______________________________________ MSP10 22 158 7.3 91147 4220 MSP12 22 180 5.7 123761 3904 ______________________________________
As can be seen in Table 6, both catalase and glycolate oxidase can beeffectively co-expressed by the strains MSP10 and MSP12.
EXAMPLE 5 Preparation of Escherichia coli Transformant Materials
Restriction enzymes.
NcoI and PstI were from Bethesda Research Laboratories, Gaithersburg,Md. (BRL). BamHI and EcoRI were from Toyobo, Japan and BclI was fromBoehringer, Indianapolis, Ind.
Antibiotics.
Ampicillin, kanamycin and chloramphenicol were from Sigma, St. Louis,Mo.
Growth media.
Yeast extract and bacto-tryptone were from Difco, Detroit, Mich.,Glycerol (NB grade) was from Boehringer.
Other enzymes.
T4 DNA ligase was from BR1, and horseradish peroxidase was from Sigma.Sequenase was obtained from US Biochemicals, Cleveland, Ohio.
Chemicals,
o-Dianisidine, flavin mononucleotide (FMN),isopropal-β-D-thiogalactopyranoside (1PTG) and phneylmethanesulfonylfluoride (PMSF) were from Sigma. Glycolic acid was from Aldrich, St.Louis, Mo.
Methods
Construction of the expression plasmid.
All restriction enzyme digestions, ligations and other common DNAmanipulations, unless otherwise stated, were performed by standardprocedures. The cDNA clone of glycolate oxidase (GAO) contained inplasmid PGAO was recovered by digestion with EcoRI and subsequentisolation of the small 1400 bp fragment by agarose electrophoresis (1%)and electroblotting on DEAL cellulose (Schleicher & Schult, NA 45. TheGAO gene was then cloned into the EcoRI site of plasmid (+) pBluescript(Stratagene, La Jolla, Calif.) and the orientation of the inserted genewas checked by digestion with PsiI. In order to clone the GAO gene intothe expression plasmid pET-3d it was necessary to introduce NcoI andBclI restriction sites at the 5' and 3' ends, respectively. Themutagenesis was performed with the Amersham mutagenesis system, version2 (Amersham Corporation, Arlington Heights, Ill.) and all steps werecarried out as described in the protocol. The two silent mutations wereintroduced in two consecutive mutagensis experiments. The sequence ofthe entire gene was then verified by single-strand dideoxy sequencingusing the Sequenase sequencing system (USB, Cleveland, Ohio). Theplasmid, isolated by E. coli strain GM119, was then digested with BclIand partially with NcoI; the 1150 bp fragment, containing the fulllength sequence of the GAO gene, was isolated as described above.Plasmid pET-3d was digested with NcoI and BamHI and the large fragmentwas isolated and purified in the same way. The silently mutated GAO genewas now inserted into the NcoI-BamHI restriction fragment of theexpression vector using T4 DNA ligase.
Microbiological manipulations.
TB-medium was used for all bacterial cultures. Where required ampicillin(100 μg/ml) and chloramphenicol (50 μg/ml) were added. PlasmidpBluescript was propagated in E. coli strain XL1:blue or strain GM119.Strain IIMS174 was used to propagate plasmid pPM1 and strain BL21(DE3)/pLsyS was used for expression of the spinach glycolate oxidase.All necessary transformations were carried out with the calcium chloridemethod as described in the literature. Single-strand DNA for sequencingand the mutagenesis experiments was produced by infecting XL1:bluetransformants with the helper phage M13KO7 using standard procedures.
Purification of GAO derived from E. coli.
Cells from a 1 l growth were harvested by centrifugation at 20000× g for20 min and the pellet was resuspended in 30 ml 0.1M Tris buffer (pH 8),containing 1 mM EDTA, 0.5 mM FMN and 0.5 mM PMSF. The cells wereimmediately frozen and stored at -20° C. for at least 15 h and thenthawed. Due to the presence of lysozyme in the cells, freezing andthawing was an efficient method of achieving complete lysis. Theviscosity of the resulting lysate, owing to the presence of uncleavedDNA, was reduced by adding DNase to a final concentration of 3 μg/ml andincubated for 60 min at 25° C. This crude extract was centrifuged at40000× g for 30 min and the supernatent decanted and dialyzed againstthree changes of 115 mM Tris buffer (pH 8.3), containing 1 mM EDTA. Theenzyme was then purified on hydroxyapatide and Q-sepharose as describedpreviously. Details of a typical preparation are summarized in Table 7.
TABLE 7 ______________________________________ Purification of spinach glycolate oxidase expressed in Escherichia coli Specific Protein Activity.sup.c activity Purifi- Purification Volume content.sup.b (.increment.OD/ (.increment./min × Yield cation step (ml) (mg/ml) min) OD.sub.280) (%) (n-fold) ______________________________________ Crude 35 27.5 0.18 0.007 100 1 extract.sup.a Dialysis 40 24 0.15 0.00625 95 0.9 Hydroxy- 18 3.36 0.234 0.066 67 10 apatite (pool) O sepharose 1.5 0.73 2.2 3 52 430 (pool) ______________________________________ .sup.a Crude extract was prepared from 14 g of sells, Expression of GAO was induced at OD.sub.600.sup.-1 and cells were harvested after 4 h. .sup.b Protein concentration was estimated by assuming that an OD.sub.280 of 1 equals 1 mg/ml protein. .sup.c Activity was determined by using the enzyme coupled assay describe in Example 5
Enzyme assay.
Glycolate oxidase activity was measured in an enzyme-coupled assay usinghorseradish peroxidase and o-dianisidine to utilize hydrogen peroxidegenerated during oxidation of glycolate. A typical assay mixturecontained 10 μl of horseradish peroxidase (1 mg/ml), 50 μl ofo-dianisidine solution (8 mM, 20% Triton X-1000, 10 μl of 1M sodiumglycolate, and 930 μl of 0.1M potassium phosphate buffer (pH 8.3). Thereaction was started by adding 10 μl of the glycolate oxidase sample.Formation of the o-dianisidine radical cation (F₄₄₀ -11600M⁻¹ cm⁻¹),which reflects the catalytic activity of glycolate oxidase, wasmonitored at 440 nm and at 25° C.
EXAMPLE 6
Into a 20-mL pressure reaction bottle (Lab Glass #LG-3921-100) wasplaced 1.0 mL of a solution containing glycolic acid (0.750M),ethylenediamine (0.866M), propionic acid (0.075M), and flavinmononucleotide (0.01 mM); the pH of this solution (ca. 9.2) was notadjusted. The solution was cooled to 5° C., then 200 mg of frozenAspergillus nidulans T17 cells grown in different media were added tothe bottle. The bottle was fitted with a crown cap and septum (Lab Glass#LG-3922-100), and then pressurized to 70 psig and vented five times at5° C. with pure oxygen using a 22 gauge needle, then pressurized to 70psig (483 kPa) with oxygen and the needle removed. The cap was checkedfor leaks by briefly submerging the tube in cold water and looking forgas bubbles, then wiped dry and placed upright in a test tube rackattached to the top of a rotary shaker. The contents of the bottle wereshaken at 300 rpm for 6 hours at 5° C., then the bottle was vented, thecap removed, and the contents of the bottle transferred to a 1.5 mLmicrocentrifuge tube. The cells were briefly spun down, and a 100 μlaliquot of the supernatant analyzed by HPLC. The cell pellet was thenassayed for recovered glycolate oxidase and catalase activity;recoveries of enzyme activities were based on the initial enzymeactivities of the whole cells, and recoveries of greater than 100% areattributed to permeabilization of the cells over the course of thereaction.
______________________________________ G.O. Catalase time glyoxylate recovery recovery catalyst (h) (%) (%) (%) ______________________________________ ST17SYG 6 45 134 119 ST17SYG/OL 6 65 309 316 ST17SYG/OL2 6 51 847 254 ST17SYG/OLHA 6 24 219 180 ST17SYCSL/OL 6 53 102 60 FT17SYG/OL 6 47 164 79 ST17MIN 6 25 66 346 ST18MIN 6 14 13 390 ST17SYG/OL 23 100 0 597 ST17SYCSL/OL 23 100 0 64 FT17SYG/OL 23 100 144 157 ______________________________________
EXAMPLE 7
A 300-mL EZE-Seal stirred autoclave reactor (Autoclave Engineers) wascharged with 75 mL of a solution containing glycolic acid (0.75M),ethylenediamine (0.86M, pH 9.2), propionic acid (0.075M, HPLC internalstandard), and flavin mononucleotide (0.01 mM), and the solution cooledto 15° C. To the reactor was then added 14 g of frozen (-80° C.)Aspergillus nidulans ST17SYG/OL (25.2 IU glycolate oxidase and 20,400 IUcatalase), and the cells were allowed to thaw at 15° C. The resultingmixture was stirred at 400 rpm and 15° C. under 70 psig (483 kPa) ofoxygen, while bubbling oxygen through the mixture at 20 mL/min. Thereaction was monitored by taking a 100 μL aliquot of the reactionmixture at regular intervals, mixing the aliquot with 300 μL of 0.1Nsulfuric acid to quench the reaction, filtering the aliquot andanalyzing by HPLC. After 7 hours, the yields of glyoxylic acid, oxalicacid, and formic acid were 79%, 0%, and 0%, respectively, with 2.7%recovery of glycolic acid. The final activities of glycolate oxidase andcatalase were 55% and 80% of their initial values.
EXAMPLE 8
A 300-mL EZE-Seal stirred autoclave reactor (Autoclave Engineers) wascharged with 100 mL of a solution containing glycolic acid (0.75M),ethylenediamine (0.86M, pH 9.2), propionic acid (0.075M, HPLC internalstandard), and flavin mononucleotide (0.01 mM), and the solution cooledto 5° C. To the reactor was then added 32 g of frozen (-80° C.)Aspergillus nidulans FT17SYG/OL (28.2 IU glycolate oxidase and 157,000IU catalase), and the cells were allowed to thaw at 15° C. The resultingmixture was stirred at 400 rpm and 5° C. under 70 psig (483 kPa) ofoxygen, while bubbling oxygen through the mixture at 30 mL/min. Thereaction was monitored by taking a 100 μL aliquot of the reactionmixture at regular intervals, mixing the aliquot with 300 μL of 0.1Nsulfuric acid to quench the reaction, filtering the aliquot andanalyzing by HPLC. After 21 hours, the yields of glyoxylic acid, oxalicacid, and formic acid were 88.2%, 0%, and 0%, respectively, with 10.0%recovery of glycolic acid. The final activities of glycolate oxidase andcatalase were 0% and 75% of their initial values.
EXAMPLE 9
A 300-mL EZE-Seal stirred autoclave reactor (Autoclave Engineers) wascharged with 100 mL of a solution containing glycolic acid (0.75M),ethylenediamine (0.86M, pH 9.0), propionic acid (0.075M, HPLC internalstandard), and flavin mononucleotide (0.01 mM), and the solution cooledto 5° C. To the reactor was then added 26 g of frozen (-80° C.)Aspergillus nidulans FT17SYG/OL (29.9 IU glycolate oxidase and 177,000IU catalase), and the cells were allowed to thaw at 5° C. The resultingmixture was stirred at 400 rpm and 5° C. under 70 psig (483 kPa) ofoxygen, while bubbling oxygen through the mixture at 50 mL/min. Thereaction was monitored by taking a 100 μL aliquot of the reactionmixture at regular intervals, mixing the aliquot with 300 μL of 0.1Nsulfuric acid to quench the reaction, filtering the aliquot andanalyzing by HPLC. After 23 hours, the yields of glyoxylic acid, oxalicacid, and formic acid were 95%, 0%, and 0%, respectively, with completeconversion of glycolic acid. The final activities of glycolate oxidaseand catalase were 12% and 76% of their initial values.
EXAMPLE 10
A 300-mL EZE-Seal stirred autoclave reactor (Autoclave Engineers) wascharged with 100 mL of a solution containing glycolic acid (0.75M),ethylenediamine (0.86M, pH 9.0), propionic acid (0.075M, HPLC internalstandard), and flavin mononucleotide (0.01 mM), and the solution cooledto 5° C. To the reactor was then added 26 g of frozen (-80° C.)Aspergillus nidulans FT17SYG/OL (24 IU glycolate oxidase and 192,000 IUcatalase), and the cells were allowed to thaw at 5° C. The resultingmixture was stirred at 400 rpm and 5° C. under 120 psig of oxygen, whilebubbling oxygen through the mixture at 50 mL/min. The reaction wasmonitored by taking a 100 μL aliquot of the reaction mixture at regularintervals, mixing the aliquot with 300 μL of 0.1N sulfuric acid toquench the reaction, filtering the aliquot and analyzing by HPLC. After11.5 hours, the yields of glyoxylic acid, oxalic acid, and formic acidwere 98%, 0%, and 0%, respectively, with complete conversion of glycolicacid. The final activities of glycolate oxidase and catalase were 100%and 62% of their initial values.
At the completion of the reaction, the reaction mixture was centrifugedat 5° C. and the supernatant decanted. The resulting pellet ofAspergillus nidulans cells was resuspended in 100 mL of fresh reactionmixture at 5° C., and the reaction repeated under conditions identicalto those described above. After 16 hours, the yields of glyoxylic acid,oxalic acid, and formic acid were 47%, 0%, and 0%, respectively, with a54% recovery of glycolic acid. The recovered activities of glycolateoxidase and catalase at 16 hours were 91% and 100% of their initialvalues.
EXAMPLE 11
Into a 3 oz. Fischer-Porter glass aerosol reaction vessel was placed amagnetic stirring bar and 10 mL of an aqueous solution containingglycolic acid (0.750M), ethylenediamine (0.863M), isobutyric acid(0.100M, HPLC internal standard), and flavin mononucleotide (0.01 mM) atpH 9.0, and the solution cooled to 5° C. To the vessel was then added0.75 g of Pichia pastoris transformant strain GS115-MSP10 (31 IUglycolate oxidase and 38,100 IU catalase) which had been permeabilizedby treatment with 0.1% "TRITON" X-100/1 freeze-thaw, and the reactionvessel sealed and the reaction mixture was cooled to 5° C. The vesselwas flushed with oxygen by pressuring to 70 psig and venting toatmospheric pressure five times with stirring, then the vessel waspressurized to 70 psig of oxygen and the mixture stirred at 5° C.Aliquots (0.20 mL) were removed by syringe through a sampling port(without loss of pressure in the vessel) at regular intervals foranalysis by HPLC to monitor the progress of the reaction. After 6 h, theHPLC yields of glyoxylate, formate, and oxalate were 98.2%, 0%, and 0%respectively, and no glycolate remained. The remainingpermeabilized-cell glycolate oxidase and catalase activity were 85% and117% respectively, of their initial values.
The microbial cell catalyst was recovered from the reaction mixturedescribed above by centrifugation. Without further treatment the cellpellet was mixed with 10 mL of fresh reaction mixture, and the reactionrepeated. This catalyst recycle procedure was performed for tenconsecutive batch reactions, and the reaction time, the recovery ofcatalase and glycolate oxidase activity (based on the initial activityof the permeabilized cells), and yields of glyoxylic, formic, oxalic,and glycolic acid are listed in the table below:
______________________________________ glycolate run time catalase oxidase glyoxylic formic oxalic glycolic # (h) (%) (%) acid(%) acid(%) acid(%) acid(%) ______________________________________ 1 6.0 117 85 98.2 0 0 0 2 4.0 78 78 99.6 0 0 0 3 4.0 68 68 97.1 0 1.3 0 4 4.0 72 73 99.5 0 0.5 0 5 3.0 77 74 99.2 0 0.5 0 6 4.5 71 71 99.0 0 0.5 0 7 5.5 70 74 98.0 0 2.0 0 8 5.0 72 61 99.5 0 0.5 0 9 5.5 60 48 98.6 0 1.4 0 10 5.5 56 42 99.1 0 0.2 0 ______________________________________
EXAMPLE 12
A 300-mL EZE-Seal stirred autoclave reactor equipped with DispersimaxImpeller (Autoclave Engineers) was charged with 100 mL of a solutioncontaining glycolic acid (0.750M), ethylenediamine (0.863M), isobutyricacid (0.100M, HPLC internal standard), and flavin mononucleotide (0.01mM), at pH 9.25, and the solution cooled to 5° C. To the reactor wasthen added 5.0 g of Pichia pastoris transformant strain GS115-MSP10 (423IU glycolate oxidase and 869,000 IU catalase) which had beenpermeabilized by treatment with 0.1% benzalkonium chloride (Sigma), andthe reactor purged with oxygen. The mixture was then stirred at 1000rpm, which bubbled oxygen through the mixture via the action of theturbine impeller, and at 5° C. under 120 psig of oxygen. The reactionwas monitored by taking a 0.4 mL aliquot of the reaction mixture atregular intervals, filtering the aliquot using a Millipore Ultrafree-MC10,000 NMWL Filter Unit, and analyzing the filtrate by HPLC. After 1.0h, the yields of glyoxylic acid, oxalic acid, and formic acid were98.7%, 1.3%, and 0%, respectively, with no remaining glycolic acid. Therecovered activities of permeabilized-cell glycolate oxidase andcatalase were 87% and 84% of their initial values, respectively.
The microbial cell catalyst was recovered from the reaction mixturedescribed above by centrifugation. Without further treatment the cellpellet was mixed with 100 mL of fresh reaction mixture, and the reactionrepeated. This catalyst recycle procedure was performed for twentyconsecutive batch reactions, and the reaction time, the recovery ofcatalase and glycolate oxidase activity (based on the initial activityof the permeabilized cells), and yields of glyoxylic, formic, oxalic,and glycolic acid are listed in the table below:
______________________________________ glycolate run time catalase oxidase glyoxylic formic oxalic glycolic # (h) (%) (%) acid(%) acid(%) acid(%) acid(%) ______________________________________ 1 1.0 84 87 98.7 0 1.3 0 2 1.0 88 104 98.7 0 1.3 0 3 1.0 85 107 98.8 0 1.2 0 4 1.0 79 126 98.7 0 1.3 0 5 1.0 69 104 98.8 0 1.2 0 6 1.0 79 109 98.9 0 1.1 0 7 1.0 71 110 99.3 0 0.7 0 8 1.0 64 113 99.2 0 0.8 0 9 1.0 61 106 99.4 0 0.6 0 10 1.0 61 101 99.1 0 0.9 0 11 1.0 72 104 99.5 0 0.5 0 12 1.0 68 99 99.4 0 0.6 0 13 1.5 70 101 99.3 0 0.7 0 14 1.5 59 96 99.6 0 0.4 0 15 1.5 58 86 99.6 0 0.4 0 16 1.75 58 83 99.6 0 0.4 0 17 2.0 56 77 97.2 0 2.8 0 18 2.0 37 91 99.7 0 0.3 0 19 2.5 50 73 99.7 0 0.3 0 20 3.5 46 72 99.9 0 0.1 0 ______________________________________
EXAMPLE 13
A 300-mL EZE-Seal stirred autoclave reactor equipped with DispersimaxImpeller (Autoclave Engineers) was charged with 100 mL of a solutioncontaining glycolic acid (0.750M), ethylenediamine (0.863M), isobutyricacid (0.100M, HPLC internal standard), and flavin mononucleotide (0.01mM), at pH 9.25, and the solution cooled to 5° C. To the reactor wasthen added 2.0 g of Pichia pastoris transformant strain GS115-MSP10(2763 IU glycolate oxidase and 494,000 IU catalase) which had beenpermeabilized by treatment with 0.1% Triton X-100/6 freeze-thaws, andthe reactor purged with oxygen. The mixture was then stirred at 1000rpm, which bubbled oxygen through the mixture via the action of theturbine impeller, and at 5° C. under 120 psig of oxygen. The reactionwas monitored by taking a 0.4 mL aliquot of the reaction mixture atregular intervals, filtering the aliquot using a Millipore Ultrafree-MC10,000 NMWL Filter Unit, and analyzing the filtrate by HPLC. After 0.75h, the yields of glyoxylic acid, oxalic acid, and formic acid were99.1%, 0.3%, and 0%, respectively, with 0.6% glycolic acid remaining.The recovered activities of permeabilized-cell glycolate oxidase andcatalase were 104% and 105% of their initial values, respectively.
The microbial cell catalyst was recovered from the reaction mixturedescribed above by centrifugation. Without further treatment the cellpellet was mixed with 100 mL of fresh reaction mixture, and the reactionrepeated. After 1.0 h, the yields of glyoxylic acid, oxalic acid, andformic acid were 99.7%, 0.3%, and 0%, respectively, with no glycolicacid remaining. The recovered activities of permeabilized-cell glycolateoxidase and catalase were 101% and 85% of their initial values. Thiscatalyst recycle procedure was performed for five consecutive batchreactions, and the reaction time, the recovery of catalase and glycolateoxidase activity (based on the initial activity of the permeabilizedcells), and yields of glyoxylic, formic, oxalic, and glycolic acid arelisted in the table below:
______________________________________ glycolate run time catalase oxidase glyoxylic formic oxalic glycolic # (h) (%) (%) acid(%) acid(%) acid(%) acid(%) ______________________________________ 1 0.75 105 104 99.1 0 0.3 0.6 2 1.0 85 101 99.7 0 0.3 0 3 1.5 82 97 99.6 0 0.4 0 4 1.5 67 96 99.8 0 0.2 0 5 2.0 92 93 99.7 0 0.3 0 ______________________________________
EXAMPLE 14
A 300-mL EZE-Seal stirred autoclave reactor equipped with DispersimaxImpeller (Autoclave Engineers) was charged with 100 mL of a solutioncontaining glycolic acid (1.500M), ethylenediamine (1.575M), isobutyricacid (0.300M, HPLC internal standard), and flavin mononucleotide (0.01mM), at pH 9.25, and the solution cooled to 5° C. To the reactor wasthen added 2.0 g of Pichia pastoris transformant strain GS115-MSP10 (114IU glycolate oxidase and 148,000 IU catalase) which had beenpermeabilized by treatment with 0.1% Triton X-100/1 freeze-thaw, and thereactor purged with oxygen. The mixture was then stirred at 1000 rpm,which bubbled oxygen through the mixture via the action of the turbineimpeller, and at 5° C. under 120 psig of oxygen. The reaction wasmonitored by taking a 0.4 mL aliquot of the reaction mixture at regularintervals, filtering the aliquot using a Millipore Ultrafree-MC 10,000NMWL Filter Unit, and analyzing the filtrate by HPLC. After 4.5 h, theyields of glyoxylic acid, oxalic acid, and formic acid were 98.0%, 0.4%,and 0%, respectively, with no glycolic acid remaining. The finalactivities of permeabilized-cell glycolate oxidase and catalase were136% and 113% of their initial values, respectively.
EXAMPLE 15
Into a 3 oz. Fischer-Porter glass aerosol reaction vessel was placed amagnetic stirring bar and 10 mL of an aqueous solution containingglycolic acid (0.750M), ethylenediamine (0.863M), isobutyric acid(0.100M, HPLC internal standard), and flavin mononucleotide (0.01 mM) atpH 9.0, and the solution cooled to 5° C. To the vessel was then added0.475 g of Hansenula polymorpha transformant GO1 (10.0 IU glycolateoxidase and 22,100 IU catalase) which had been permeabilized bytreatment with 0.1% "TRITON" X-100/1 freeze-thaw, and the reactionvessel sealed and the reaction mixture was cooled to 5° C. The vesselwas flushed with oxygen by pressuring to 70 psig and venting toatmospheric pressure five times with stirring, then the vessel waspressurized to 70 psig of oxygen and the mixture stirred at 5° C.Aliquots (0.20 mL) were removed by syringe through a sampling port(without loss of pressure in the vessel) at regular intervals foranalysis by HPLC to monitor the progress of the reaction. After 16 h,the HPLC yields of glyoxylate, formate, and oxalate were 97.1%, 2.9%,and 0% respectively, and no glycolate remained. The remainingpermeabilized-cell glycolate oxidase and catalase activity were 107% and231% respectively, of their initial values.
EXAMPLE 16
A 300-mL EZE-Seal stirred autoclave reactor equipped with DispersimaxImpeller (Autoclave Engineers) was charged with 100 mL of a solutioncontaining glycolic acid (0.750M), ethylenediamine (0.863M), isobutyricacid (0.100M, HPLC internal standard), and flavin mononucleotide (0.01mM), at pH 9.3, and the solution cooled to 5° C. To the reactor was thenadded 11.9 g of Hansenula polymorpha transformant strain GO1 (100 IUglycolate oxidase and 998,000 IU catalase) which had been permeabilizedby treatment with 0.1% Triton X-100/1 freeze-thaw, and the reactorpurged with oxygen. The mixture was then stirred at 500 rpm, and oxygenwas bubbled through the mixture at 100 mL/min using a sparge tubelocated below the surface of the reaction mixture. The reaction wasmonitored by taking a 0.40 mL aliquot of the reaction mixture at regularintervals, filtering the aliquot using a Millipore Ultrafree-MC 10,000NMWL Filter Unit, and analyzing the filtrate by HPLC. After 2.25 h, theyields of glyoxylic acid, oxalic acid, and formic acid were 100%, 0%,and 0%, respectively, with no glycolic acid remaining. The recoveredactivities of permeabilized-cell glycolate oxidase and catalase were158% and 82% of their initial values, respectively.
EXAMPLE 17
The reaction in Example 16 was repeated using 15.0 g of Hansenulapolymorpha transformant GO1 (109 IU glycolate oxidase and 530,000 IUcatalase) which had been permeabilized by treatment with 0.1% TritonX-100/1 freeze-thaw. The mixture was then stirred at 500 rpm and at 5°C. under 120 psig of oxygen, and oxygen was bubbled through the mixtureat 50 mL/min using a sparge tube located below the surface of thereaction mixture. After 3.75 h, the yields of glyoxylic acid, oxalicacid, and formic acid were 100%, 0%, and 0%, respectively, with noglycolic acid remaining. The recovered activities of permeabilized-cellglycolate oxidase and catalase were 85% and 166% of their initialvalues, respectively.
EXAMPLE 18
The reaction in Example 16 was repeated using 15.0 g of Hansenulapolymorpha transformant GO1 (51 IU glycolate oxidase and 730,000 IUcatalase) which had been permeabilized by treatment with 0.1% TritonX-100/1 freeze-thaw. The mixture was stirred at 1250 rpm, which bubbledoxygen through the mixture via the action of the Dispersimax turbineimpeller, and at 5° C. under 120 psig of oxygen. After 4.0 h, the yieldsof glyoxylic acid, oxalic acid, and formic acid were 97.5%, 0%, and 0%,respectively, with 0.6% glycolic acid remaining. The recoveredactivities of permeabilized-cell glycolate oxidase and catalase were132% and 129% of their initial values, respectively.
EXAMPLE 19
A 300-mL EZE-Seal stirred autoclave reactor equipped with DispersimaxImpeller (Autoclave Engineers) was charged with 100 mL of a solutioncontaining glycolic acid (0.750M), ethylenediamine (0.863M), isobutyricacid (0.100M, HPLC internal standard), and flavin mononucleotide (0.01mM), at pH 9.3, and the solution cooled to 5° C. To the reactor was thenadded 15.0 g of Hansenula polymorpha transformant strain GO1 (262 IUglycolate oxidase and 1.135×10⁶ IU catalase) which had beenpermeabilized by treatment with 0.1% Triton X-100/1 freeze-thaw, and thereactor purged with oxygen. The mixture was then stirred at 1000 rpm,which bubbled oxygen through the mixture via the action of the turbineimpeller, and at 5° C. under 250 psig of oxygen. The reaction wasmonitored by taking a 0.40 mL aliquot of the reaction mixture at regularintervals, filtering the aliquot using a Millipore Ultrafree-MC 10,000NMWL Filter Unit, and analyzing the filtrate by HPLC. After 1.0 h, theyields of glyoxylic acid, oxalic acid, and formic acid were 96.9%, 0.3%,and 0%, respectively, with no remaining glycolic acid. The recoveredactivities of permeabilized-cell glycolate oxidase and catalase were 98%and 124% of their initial values, respectively.
The microbial cell catalyst was recovered from the reaction mixturedescribed above by centrifugation. Without further treatment the cellpellet was mixed with 100 mL of fresh reaction mixture, and the reactionrepeated. This catalyst recycle procedure was performed for eightconsecutive batch reactions, and the reaction time, the recovery ofcatalase and glycolate oxidase activity (based on the initial activityof the permeabilized cells), and yields of glyoxylic, formic, oxalic,and glycolic acid are listed in the table below:
______________________________________ glycolate run time catalase oxidase glyoxylic formic oxalic glycolic # (h) (%) (%) acid(%) acid(%) acid(%) acid(%) ______________________________________ 1 1.0 124 98 96.9 0 0.3 0.6 2 1.5 145 84 99.6 0 0.4 0 3 2.0 162 77 97.4 0 0.3 0 4 2.0 117 57 94.6 0 1.0 0 5 2.5 128 44 97.7 0 0.7 0 6 3.0 133 40 96.6 0 0.1 0 7 5.0 111 23 99.1 0 0.2 0 8 16.5 116 19 95.2 0 0.3 0 ______________________________________
EXAMPLE 20
The reaction in Example 19 was repeated except that FMN was not added tothe reaction mixture. The catalyst was 5.0 g of Hansenula polymorphatransformant GO1 (880 IU glycolate oxidase and 453,000 IU catalase)which had been permeabilized by treatment with 0.1% Triton X-100/1freeze-thaw. The catalyst recycle procedure was performed for twentyconsecutive batch reactions with no added FMN, and the reaction time,the recovery of catalase and glycolate oxidase activity (based on theinitial activity of the permeabilized cells), and yields of glyoxylic,formic, oxalic, and glycolic acid are listed in the table below:
______________________________________ glycolate run time catalase oxidase glyoxylic formic oxalic glycolic # (h) (%) (%) acid(%) acid(%) acid(%) acid(%) ______________________________________ 1 1.0 100 100 96.9 0.1 1.1 1.2 2 1.0 88 109 98.4 0.1 1.2 1.4 3 1.0 102 110 98.2 0.1 1.0 0.9 4 1.0 103 107 98.0 0.1 1.0 0.9 5 1.0 86 90 97.8 0.2 1.1 1.1 6 1.0 85 95 98.4 0.1 0.9 1.1 7 1.0 89 116 97.9 0.1 0.9 1.1 8 1.3 89 116 99.1 0.1 1.1 1.0 9 1.0 87 103 98.0 0.1 1.0 1.0 10 1.0 106 116 98.3 0.1 0.8 0.8 11 1.0 85 104 97.9 0.1 0.8 0.9 12 1.5 99 101 96.6 0.1 0.8 1.0 13 1.5 98 105 98.1 0.1 0.7 1.0 14 1.0 78 85 98.5 0.1 0.6 1.8 15 1.0 88 82 98.3 0.2 0.5 1.1 16 1.0 90 82 99.6 0.1 0.5 0.8 17 1.0 59 56 98.8 0 0.5 1.0 18 1.0 48 60 97.7 0.6 0.4 1.5 19 1.0 54 63 98.6 0.1 0.6 1.7 20 1.5 86 61 98.0 0.1 0.7 1.3 ______________________________________
EXAMPLE 21
A 300-mL EZE-Seal stirred autoclave reactor equipped with DispersimaxImpeller (Autoclave Engineers) was charged with 100 mL of a solutioncontaining glycolic acid (0.750M), ethylenediamine (0.863M), isobutyricacid (0.100M, HPLC internal standard), and flavin mononucleotide (0.01mM), at pH 9.2, and the solution cooled to 5° C. To the reactor was thenadded 30 g of E. coli transformant d01 (72 IU glycolate oxidase and29,600 IU catalase), and the mixture stirred at 1000 rpm, which bubbledoxygen through the mixture via the action of the turbine impeller, andat 5° C. under 120 psig of oxygen. The reaction was monitored by takinga 0.40 mL aliquot of the reaction mixture at regular intervals,filtering the aliquot using a Millipore Ultrafree-MC 10,000 NMWL FilterUnit, and analyzing the filtrate by HPLC. After 23 h, the yields ofglyoxylic acid, oxalic acid, and formic acid were 74.4%, 1.1%, and 5.6%,respectively, with 6.3% glycolic acid remaining. The recoveredactivities of microbial glycolate oxidase and catalase were 30% and 199%of their initial values, respectively.
Having thus described and exemplified the invention with a certaindegree of particularity, it should be appreciated that the followingclaims are not to be so limited but are to be afforded a scopecommensurate with the wording of each element of the claim andequivalents thereof.
__________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 3 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 369 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: unknown (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: MetGluIleThrAsnValAsnGluTyrGluAlaIleAlaLysGlnLys 151015 LeuProLysMetValTyrAspTyrTyrAlaSerGlyAlaGluAspGln 202530 TrpThrLeuAlaGluAsnArgAsnAlaPheSerArgIleLeuPheArg 354045 ProArgIleLeuIleAspValThrAsnIleAspMetThrThrThrIle 505560 LeuGlyPheLysIleSerMetProIleMetIleAlaProThrAlaMet 65707580 GlnLysMetAlaHisProGluGlyGluTyrAlaThrAlaArgAlaAla 859095 SerAlaAlaGlyThrIleMetThrLeuSerSerTrpAlaThrSerSer 100105110 ValGluGluValAlaSerThrGlyProGlyIleArgPhePheGlnLeu 115120125 TyrValTyrLysAspArgAsnValValAlaGlnLeuValArgArgAla 130135140 GluArgAlaGlyPheLysAlaIleAlaLeuThrValAspThrProArg 145150155160 LeuGlyArgArgGluAlaAspIleLysAsnArgPheValLeuProPro 165170175 PheLeuThrLeuLysAsnPheGluGlyIleAspLeuGlyLysMetAsp 180185190 LysAlaAsnAspSerGlyLeuSerSerTyrValAlaGlyGlnIleAsp 195200205 ArgSerLeuSerTrpLysAspValAlaTrpLeuGlnThrIleThrSer 210215220 LeuProIleLeuValLysGlyValIleThrAlaGluAspAlaArgLeu 225230235240 AlaValGlnHisGlyAlaAlaGlyIleIleValSerAsnHisGlyAla 245250255 ArgGlnLeuAspTyrValProAlaThrIleMetAlaLeuGluGluVal 260265270 ValLysAlaAlaGlnGlyArgIleProValPheLeuAspGlyGlyVal 275280285 ArgArgGlyThrAspValPheLysAlaLeuAlaLeuGlyAlaAlaGly 290295300 ValPheIleGlyArgProValValPheSerLeuAlaAlaGluGlyGlu 305310315320 AlaGlyValLysLysValLeuGlnMetMetArgAspGluPheGluLeu 325330335 ThrMetAlaLeuSerGlyCysArgSerLeuLysGluIleSerArgSer 340345350 HisIleAlaAlaAspTrpAspGlyProSerSerArgAlaValAlaArg 355360365 Leu (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: TACCGAATTCATGGAGATCACAAATGTG28 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 bases (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: AACAGAATTCTTATAATCTGGCAACAGA28 __________________________________________________________________________
What is claimed is:
1. In a process for preparing glyoxylic acidcomprising the step of oxidizing glycolic acid with oxygen in aqueoussolution of glycolic acid, an amine and the enzymes glycolate oxidaseand catalase, the improvement comprising:(a) using the enzyme glycolateoxidase in the form of a microbial cell transformant thatintracellularly expresses and retains in the cytoplasm or peroxisomesglycolate oxidase selected from the group consisting of transformants ofAspergillus nidulans, Hansenula polymorpha, Pichia pastoris, andEscherichia coli, under conditions where the transformants arepermeabilized to the passage of carboxylic acids, (b) sparging oxygeninto the resulting aqueous mixture, and (c) selecting the amine from thegroup consisting of ethylenediamine, tris(hydroxymethyl)aminomethane,piperazine, glycylglycine, and mixtures thereof.
2. The process of claim1 wherein said microbial cell transformant also expresses endogenouscatalase.
3. The process of claim 1, further comprising adding solublecatalase to the mixture.
4. The process of claim 1 wherein saidmicrobial cell transformant is Aspergillus nidulans T17 designated NRRL21000.
5. The process of claim 1 wherein said microbial celltransformant is Pichia pastoris GS115-MSP10 designated NRRL Y-21001. 6.The process of claim 1 wherein said microbial cell transformant isPichia pastoris MSP12 designated NRRL Y-21040.
7. The process of claim 1wherein said microbial cell transformant is Hansenula polymorpha GO1designated NRRL Y-21065.
8. The process of claim 1 wherein the amine isethylenediamine.
9. The process of claim 1 wherein the amine istris(hydroxymethyl)aminomethane.
10. The process of claim 1 wherein theamine is piperazine.
11. The process of claim 1 wherein the amine isglycylglycine. | 2024-03-22 | 1996-02-23 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1998-11-10"
} |
US-72787485-A | Surface flaw detecting method and apparatus
ABSTRACT
A method for detecting flaws in a surface of an inspected object can moderate the requirements for inspection condition accuracy, particular for adjustment of spatial relationships among a laser unit, the surface and an laser detector unit. The method includes the step of transmitting a laser beam in a known configurationonto a specular surface of the inspected object, projecting the laser beam reflected by the surface onto a light-scattering screen and forming an image of the surface on the screen, and detecting the image of the surface in the known configuration in relation to a predetermined portion of the screen. An apparatus carrying out the method includes a sensor for detecting positional deviation of the image of the surface from a fixed monitored portion of the screen, a adjuster for adjusting the angle subtended by the axes of a transmitter of the laser slit beam and a flaw-detecting image sensor and an adjuster for adjusting the inclination of a plane defined by the axes of the transmitted and the flaw-detecting image sensor relative the surface, both adjusters operating in accordance with the output of the deviation detecting sensor.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a surface flaw detecting method and apparatusfor inspection of specified surfaces, e.g. painted surfaces ofautomotive vehicle parts or specular surfaces of mechanical devices.
2. Description of the Prior Art
Recently, laser beam surface inspection in search of flaws such as smallprotuberances and stains has started to replace visual inspection byworkers, which is less efficient and of variable quality among workers.
FIG. 1 illustrates a prior art automatic laser surface flaw detectionsystem. This prior art surface flaw detecting system comprises a laserunit 1, and a laser detector unit 3 including a condenser lens 4 and alaser photodiode 5. The laser unit 1 transmits a laser spot beam LS ontoa flat inspection surface 2. The laser photodiode 5 receives the laserspot beam specularly reflected from the inspection surface 2 through thecondenser lens 4 and outputs a corresponding electrical signal.
Since laser beams are highly collimated, scattering of the laser spotbeam LS from the laser unit 1 by flaws and/or small proturberances willbe very conspicuous and will show up readily in the electrical output ofthe laser photodiode 5. Variations in the electrical output indicateflaws on the inspection surface 2.
However, this prior art automatic laser surface flaw detection systemrequires very accurate coincidence between the optical axes of the laserunit 1 and the condenser lens 4 in 3 dimensions on the inspectionsurface 2 (e.g. at a tolerance on the order of plus-minus 15' (minutes)and that this accurate 3-dimensional relationship among the laser unit1, the inspection surface 2 and the laser detector unit 3 be maintainedthroughout the surface inspection operation. Thus, this method requiresa surface flaw detecting apparatus with a complicated 3-dimensionalpositioning mechanism in order to meet the above-described conditionsbut even so is not suitable for methods in which a moving surface flawdetecting apparatus scans the inspection surface 2. In particular, thislatter detection technique requires accurate focussing of the condenserlens 4 at every point across the inspection surface 2, so that the focusof the condenser lens 4 must be adjusted each time the inspectionsurface 2 moves.
Laser surface flaw detection systems employing a laser slit beam and aline sensor, e.g. consisting of CCD's and PDA, entails similardrawbacks.
This prior art automatic laser surface flaw detection technique can beapplied only to flat cylindrical surfaces.
In addition, No. JP-A-58219441 discloses a convex-object-surfaceflaw-detecting apparatus comprising a device transmitting a beam ofvisible light onto a convex inspection surface of an object, aprojecting screen onto which the beam of visible light is reflected bythe convex inspection surface, the screen projecting a correspondingimage, and an image sensor picking up the image on the screen andsignalling the presence or absence of flaws in the convex inspectionsurface.
Since this apparatus employs collimated beam of visible light producedby a combination of a lamp and a convex lens, the reflectivity of theconvex inspection surface must be rather high in order for the screen toproject a clear image. In addition, this apparatus is not capable ofaccurate surface inspection.
SUMMARY OF THE INVENTION
An object of this invention is to provide a surface flaw detectingmethod by which inspection conditions, specifically the relationshipsamong the optical axes of a laser unit, a laser detector unit and thesurface of an inspected object, can be adjusted during operation, apositioning mechanism for the laser unit and the laser detector unit canbe simpler and a moving surface-flaw-detecting apparatus can accuratelydetect surface flaws.
In order to achieve this object, a method of this invention comprisesthe steps of transmitting laser beams onto a reflective surface of aninspected object, projecting laser beams reflected from the surface ontoa light-scattering screen so as to form an image of the surface at afixed position on the screen, detecting the position of the image oflaser beams scattered by the surface on the screen and correction of thedetected position to match the fixed position.
Another object of this invention is to provide a surface flaw detectingapparatus which can obviate the need for complicated focus adjustmentsand handle moving surface-flaw detection. In order to achieve thisinvention, this inventive apparatus comprises means for transmittinglaser slit beams onto a reflective surface of an inspected object, alight-scattering screen onto which the laser slit beams are reflected bythe surface thus forming an image of the surface on the screen, a flawdetecting image sensor disposed in a fixed relation to the screen andcapable of monitoring a predetermined portion of the screen, means,disposed in a fixed relation of the screen, for detecting thedisposition of the image of the surface relative to the predeterminedportion of the screen, means for adjusting the angular displacementbetween the axes of said laser slit beams transmitting means and theflaw detecting image sensor in accordance with the output of saidposition detecting means, and means for adjusting the inclination of theplane of the incident and reflected laser slit beam relative to thesurface in response to the output of said position detecting means.
BRIEF DESCRIPTION OF THE INVENTION
FIG. 1 is a schematic diagram of a prior art laser surface flawdetecting system;
FIG. 2 is a front elevation of a laser surface flaw detecting apparatusaccording to a first embodiment of this invention;
FIG. 3 is a side elevation of the laser surface flaw detecting apparatusof FIG. 2;
FIG. 4 is a schematic illustration of the operation of a principal partof the laser surface flaw detecting apparatus of FIG. 2;
FIG. 5 is a chart of an output of a line sensor;
FIG. 6 is a diagram illustrating the operating concepts of the lasersurface flaw detecting apparatus of FIG. 2;
FIG. 7 is a perspective view of a laser surface flaw detecting apparatusaccording to a second embodiment of this invention, from which view acontrol system is omitted;
FIG. 8 is a front elevation of the laser surface flaw detectingapparatus of FIG. 7, from which a flaw marker is omitted;
FIG. 9 is a side elevation of the laser surface flaw detecting apparatusof FIG. 7;
FIG. 10 is an enlarged front view of an axis-rotation adjuster shown inFIG. 7;
FIG. 11 is an enlarged front view of an inclination adjuster shown inFIG. 7;
FIG. 12 is a diagram of the interior of a laser detector unit of thisinvention;
FIG. 13 is a diagram of the 2-dimensional displacement of a slit imageon a scattering screen effected by 3-dimensional displacement of apainted outer surface;
FIG. 14 is a diagram showing how position detection of the slit image isperformed by position detecting line sensors;
FIG. 15A is a diagram of parallel 2-dimensional displacements of theslit image when an inclination ε is fixed as axis rotation δ varies;
FIG. 15B is a diagram of the angular 2-dimensional displacements of theslit image when the axis rotation δ is fixed as the inclination εvaries;
FIG. 16 is a diagram showing how a curved slit image of a curved paintedouter surface under inspection is formed on the screen;
FIG. 17 is a diagram showing how the position of the curved slit imageshown in FIG. 16 is detected by position detecting line sensors;
FIG. 18 is a diagram showing the disposition of the slit image within amonitored reference strip on the screen 13;
FIG. 19 is a block diagram of a control system of the laser surface flawdetecting apparatus of FIG. 7;
FIGS. 20 A-C are a timing chart of the outputs of first, second andthird sensor drive circuits;
FIG. 21 is a main program flowchart of a position control unit shown inFIG. 19;
FIG. 22 is a subroutine flowchart of the position control unit shown inFIG. 19;
FIG. 23 is a program flowchart of a laser surface flaw detection controlunit shown in FIG. 19;
FIG. 24 is a perspective illustration of the interior of a laserdetector unit according to a third embodiment of this invention; and
FIG. 25 is a diagram showing how the position of a slit image isdetected by position detecting line sensors according to the thirdembodiment of this invention.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
The preferred embodiments of this invention will be described in detailwith reference to FIGS. 2 to 25.
FIRST EMBODIMENT
A laser surface flaw detecting apparatus according to a first embodimentof this invention comprises a support beam 6 with a mount disc 6a forattachment to a fixed or moving device (not shown), a laser unit 7mounted at one end of the support beam 6, and a laser detector unit 8mounted at the other end of the support beam 6. The angle between theoptical axes L₁ of the laser unit 7 and the optical axis L₂ of the laserdetector unit 8 is labelled δ. The respective optical axes L₁ and L₂ ofthe laser unit 7 and the laser detector unit 8 are each inclined at anangle of δ/2 to a plane 9 normal to the inspected surface 10 which is anearly specular surface, e.g. a painted outer surface of an automotivevehicle door.
The laser unit 7 includes, for example, a He-Ne laser (not shown) and alens system 7a ending in a slit (not shown) capable of converting thelaser beam from the He-Ne laser into laser slit beams LST. The slitwidens in the direction of propagation. Alternatively, the laser beammay be a spot beam scanned back and forth to simulate a time-constantslit by a rotating polygonal mirror.
The laser detector unit 8 includes a camera 11 and an opaque cylinder12. The camera 11 includes a condenser lens 11a and a line sensor 11bcomposed of an array of photoelectric sensors, e.g. CCD's. The opaquecylinder 12 is mounted on the front of the camera 11 and has alight-transmissive projection screen 13 at its lower end.
The line sensor 11b is fixed to a predetermined location within thecamera 11 in order to continuously monitor a fixed reference strip onthe screen 13 onto which the laser slit beams LST from the laser unit 7,reflected by the inspected surface 10 are expected to fall.
The screen 13 lies in the one focal plane of the condenser lens 11a. Thescreen 13 is made of light-scattering material, e.g. a frosted glass ormatte plate commonly used as a focal plate in cameras. It is best to usea completely light-scattering material.
The operation of the laser surface flaw detecting apparatus of thisembodiment is as follows. As illustrated in FIG. 4, if the inspectedsurface 10 has any surface flaws 10a, e.g. recesses or smallprotuberances, the laser light LST from the laser unit 7 incident on theinspected surface 10 will be scattered by the flaw 10a and fall onto thescreen 13, thereby projecting onto the screen 13 an expanded slit imageSL(S) with a discontinuity at a point 13a corresponding to the flaw 10a.The line sensor 11b, picking up the slit image SL(S) made up of laserlight SC scattered by the screen 13 as illustrated in FIG. 6, outputs atrain of electrical pulses in which the surface flaw 10a is reflectedwith a low-level output 14, as illustrated in FIG. 5. The condenser lens11a requires no focal adjustments relative to the inspected surface 10.The expanded slit image SL(S) projected onto the screen 13 enhances theresolving power of the laser detector unit 8 relative to the surfaceflaw 10a. Since the line sensor 11b receives the scattered laser beam SCthrough the condenser lens 11a, the laser detector unit 8 can detectsurface flaws 10a in the inspected surface 10 within the capacity of thecondenser lens 11a even if the optical paths of reflected laser beamfalling onto the screen 13 vary within the range delimitted by paths S₁to S₄, as shown in FIG. 6, due to changes in the directionalrelationships among the laser unit 7, the laser detector unit 8 and theinspected surface 10. This moderates the need for accurate adjustment ofthe optical axes of the laser unit 7 and the laser detector unit 8relative to the inspected surface 10 and replaces biaxial alignmentbetween the 2-dimensional slit image SL(S) and the line sensor 11b forthe prior art triaxial alignment among the inspection point, a laserunit and a laser detector unit.
The laser surface flaw detecting apparatus of this invention moderatesthe tolerances in inspection conditions as well as specifications ofauxiliary equipment for the optical-axis adjustment or alignment. Thus,this apparatus, mounted on a moving apparatus, e.g. a moving industrialrobot, facilitates accurate inspection of the inspected surface 10 andcan extend its field of application.
SECOND EMBODIMENT
FIGS. 7-12 show a laser surface flaw-detecting apparatus 20 according toa second embodiment of this invention with a control unit omitted fromthe drawings. The apparatus 20 is attached to a mounting disc 21 at thefree end of a movable arm 18 of an industrial robot by means of amatching mounting disc 6a.
The apparatus 20 comprises a body 22 fixed to the mounting disc 6a, aninclination adjuster 23 in the body 22 for both the laser unit 7 and thelaser detector unit 8A, a flat support beam 6 fixed to the ends of apair of brackets 25 in turn movably supported by the body 22, thesupport beam 6 being pivotable about an axis θ_(y) parallel to itslongitudinal axis, an axis-rotation adjuster 26 for the laser unit 7mounted on the backside of the support beam 6 and pivotable in a plane Aparallel to the support beam 6, the laser unit 7 mounted at one end ofthe front surface of the support beam 6 via a movable shaft 7b pivotableabout an axis θ_(x) perpendicular to the plane A, a laser detector unit8A fixed to the outer end of the front surface of the support beam 6,and a flaw marker 27 fixed to the center of the lower face of thesupport beam 6.
The inclination adjuster 23, as shown in FIG. 11, comprises a firstelectronically controlled motor 28 with a tachogenerator or tachometer29, a drive spur gear 30 driven by the first motor 28 through atransmission 31, a driven spur gear 32 meshing with the drive spur gear30 and capable of rotating a shaft 33 journalled in the body 22 aboutthe axis θ_(y), the pair of the brackets 25 fixed to the shaft 33, andan electronic control system for the first motor 28, described later.The first motor 28 is capable of adjusting the angular position of thesupport beam 6. The pivot operation performed by the inclinationadjuster 23 will be described later.
The axis-rotation adjuster 26, as shown in FIG. 10, comprises a supportframe 34 with a bracket 35, a second electronically controlled motor 36fixed to a lower end of the support frame 34 and having a tachogeneratoror tachometer 37, a ball screw 38 extending the entire length of thesupport frame 34 and driven by the second motor 36, a nut member 39driven in the direction of the double-arrow B by the ball screw 38, apivotable lever 40, one end of which is fixed to the shaft 7b fixed inturn to the laser unit 7 and the other end of which is pivotablyconnected to the nut member 39 by way of a pivot pin 41. A shaft 42fixed to the bracket 35 is capable of swinging the support frame 34 inthe plane A, as shown in FIG. 10. The second motor 36 is capable ofadjusting the position of the lever 40 and therefore the angularposition of the shaft 7b and the laser unit 7. The positional adjustmentperformed by the second motor 36 will also be described later.
The laser detector unit 8A includes a light-transmissive projectingscreen 13, an opaque cylinder 12 and a camera 45. As illustrated in FIG.12, the camera 45 includes a flaw-detecting line sensor 46 and first andsecond position-detecting line sensors 47 and 48, the axes of theposition detecting line sensors 47 and 48 being, in this case,perpendicular to the axis of the flaw-detecting line sensor 46. Theflaw-detecting line sensor 46 continuously monitors a fixed linearreference strip 13R on the screen 13. The first and secondposition-detecting line sensors 47 and 48 continuously monitor theposition of the slit image SL(S) on the screen 13 even if the slit imageSL(S) falls outside of the monitored reference strip 13R.
The flaw marker 27 sprays indelible paint near a detected surface flawso as to mark the surface flaw without interfering with the laser lightLS from the laser unit 7 when the laser detector unit 8A detects arecess or small protuberance in the surface, e.g. the painted outersurface 43 of the automotive vehicle door 44, under inspection.
The two positional control operations above-mentioned are described indetail below.
As shown in FIGS. 9 and 11, the first motor 28 of the inclinationadjuster 23, controlled in accordance with the outputs of theposition-detecting line sensors 47 and 48, drives the drive spur gear30, the driven spur gear 32, the shaft 33 and the pair of the brackets25 in one direction about the axis θ_(y), thereby inclining the supportbeam 6, i.e. adjusting the inclination ε of the plane defined by theoptical axes L₁ and L₂ to be normal to the painted outer surface 43.That is, the rotational amount of the first motor 28 is controlled sothat the plane in which the optical axes L₁ and L₂ lie is perpendicularto the plane tangent to the point under inspection on the painted outersurface 43. Details of the control of the first motor 28 will bedescribed later.
As shown in FIGS. 8 and 10, the second motor 36 of the axis-rotationadjuster 26, controlled in accordance with the outputs of theposition-detecting line sensors 47 and 48, drives the ball screw 38,thereby moving the nut member 39 in one direction along the double-arrowB. The nut member 39 concurrently pivots the support frame 34 in onecorresponding direction about the shaft 42 and moves the lever 40 andthe laser unit 7 in the corresponding direction about the axis θ_(x) ofthe shaft 7b journalled on a pair of brackets 49 fixed to thebacksurface of the support beam 6 and fixed to a laser unit holder 49a.That is, the controlled operation of the second motor 36 determines theorientation of the optical axis L₁ of the laser unit 7, i.e. the angleof incidence δ. Details of the control of the second motor 36 will bedescribed later.
The detailed internal arrangement of the laser detector unit 8A will bedescribed with reference to FIG. 12. A beam splitter 50 disposed withinthe camera 45 is capable of dividing scattered laser light from the slitimage SL(S) received through the condenser lens 11a approximately evenlybetween a first split direction U₁ and a second split direction U₂perpendicular to the first split direction U₁.
The flaw-detecting line sensor 46 lies in the focal plane of thecondenser lens 11a and is fixed to a first sensor mount surface 51normal to the first split direction U₁ and behind the beam splitter 50.The flaw-detecting line sensor 46 may consist of 2048 picture elementsmade up of CCD's or a MOS-PDA, i.e. MOS Photo Diode Array, alignedparallel to the slit image from the beam splitter 50.
The position-detecting line sensors 47 and 48 are mounted in the focalplane of the condenser lens 11a on a second sensor mount surface 52perpendicular to the first sensor mount surface 51 and to the secondsplit direction U₂, disposed to one side (to the right in FIG. 12) ofthe beam splitter 50. The position-detecting line sensors 47 and 48 mayconsist of 2048 picture elements made up of CCD's or a MOS-PDA. Theposition-detecting line sensors 47 and 48 may be arranged parallel toeach other. The axes of the position-detecting line sensors 47 and 48are oblique to, or in the second embodiment, perpendicular to the slitimage projected in direction U₂ by the beam splitter 50. Theposition-detecting line sensors 47 and 48 monitor the position andorientation of the slit image relative to the flaw-detecting line sensor46. The optical axis L₂ of the laser detector unit 8A is common to thecondenser lens 11a and passes through the center of the flaw-detectingline sensor 46.
When the slit image SL₂ (F) lies in the same plane as the photosensitiveelement of the flaw-detecting line sensors 46, the split slit image SL₂(P) falls on the central picture element (1024th) of theposition-detecting sensor 47 and 48.
The spacing between the position-detecting line sensors 47 and and 48 ischosen in correspondance to the maximum expected curvature of thepainted outer surface 43 of the automotive vehicle door 44 so that theslit image SL₂ (P) will impinge on both position-detecting line sensors47 and 48 regardless of its curvature or orientation; the greater themaximum expected curvature, the smaller the spacing.
The operation of the above-described laser detector unit 8A will bedescribed in detail below.
As previously described, when the slit image SL(S) is formed within themonitored reference strip 13R, the flaw-detecting line sensor 46 candetect the presence of flaws 13a, as shown in FIG. 4.
As shown in FIG. 13, when the laser unit 7 transmits a laser slit beamLS₁ onto the painted outer surface 43 indicated by the solid lines, acorresponding slit image SL₁ (S) is formed within the monitoredreference strip. If the laser unit 7 transmits a laser slit beam LS₂onto the painted outer surface 43 indicated by the broken lines, whichis 3-dimensionally angularly displaced from the original position of thepainted outer surface 43 through angles α and β, the slit image SL₂ (S)will be 2-dimensionally displaced from the original slit image SL₁ (S).
This 2-dimensional displacement of the slit image SL₂ (S) with respectto the slit image SL₁ (S) consists of a translational offsetperpendicular to the length of the slit image SL₁ (S) and an angulardisplacement with respect to the slit image SL₁ (S).
In this case, any changes in the length of the slit image accompanyingthe 2-dimensional displacement can be ingnored.
As shown in FIG. 14, the respective position detecting line sensors 47and 48 detect intersection image-forming points Q₁ and Q₂ onto which theslit image SL₂ (P) transmitted in the second split direction U₂ falls,thereby detecting the deviation (i.e. position) of the slit image SL₂(S) from the monitored reference strip 13R.
As shown in FIG. 15A, when the axis-rotation adjuster 26 changes anoriginal angle δ₀ to an angle δ₁ or δ₂ while holding the inclination εbetween the optical plane and surface 43 at 90°, the slit image SL(S) isdisplaced in a direction of the double-arrow G1 perpendicular to themajor axis of the monitored reference strip 13R to an extent determinedby the angular deviation δ₀ -δ.
As shown in FIG. 15B, when the inclination adjuster 23 changes theinclination ε from 90° to an angle ε1 while holding the axis-rotationangle δ fixed, the axis of the slit image SL(S) shown in phantom line onthe screen 13 shown in broken line, depending on the change in theinclination ε, shifts angularly from the monitored reference strip 13Rshown in solid line on the screen 13 shown in solid line.
In summary, when changes in the spatial relationships among the laserunit 7, the laser detector unit 8A and the painted outer surface 43effect the position and/or orientation of the slit image SL(S) relativeto the monitored reference strip 13R, the rotational and translationaldisplacements serve as exact indices for the required extent ofoperation of the first motor 28 of the inclination adjuster 23 and thesecond motor 36 of the axis-rotation adjuster 26 respectively, thusadjusting the inclination ε and the angle of incidence δ/2 so as toreturn the displaced slit image SL(S) to the monitored reference strip13R.
As illustrated in FIG. 14, the expressions {1024-(Q₁ +Q₂)/2} and (Q₁-Q₂) respectively represent the translational and rotationaldisplacements of the slit image SL₂ (S) from the monitored referencestrip 13R. Evaluating the expression {1024-(Q₁ +Q₂)/2} yields thedesired orientation about axis θ_(x) of the laser unit 7, and the amountand direction of rotation of the second motor 36 of the axis-rotationadjuster 26, needed to produced the required change Δδ. Evaluating theexpression (Q₁ -Q.sub. 2) determines the desired orientation of thesupport beam 6 and the amount and direction of movement of the firstmotor 28 or the inclination adjuster 23 needed to produced the requiredchange Δε. These two adjustments can return the displaced slit imageSL(S) to coincidence with monitored reference strip 13R.
If the laser unit 7 projects a laser slit beam LS₃ onto a curved paintedouter surface 43, the slit image SL₃ (S) will also be curved as shown inFIG. 16 so as to intersect the position-detecting line sensors 47 and 48at the intersection image-forming points Q₁ and Q₂. As previouslydescribed, the inclination adjuster 23 and the axis-rotation adjuster26, in accordance with the values of the expressions {1024-(Q₁ +Q₂ /2}and (Q₁ -Q₂) shown in FIG. 17, return the curved slit image SL₃ (S) tothe straight monitored reference strip 13R with the points of the curvecoincident with the points Q₁, Q₂ being centered on the flaw detectingline sensor 40, as shown in FIG. 18.
The control system for the surface flaw detecting apparatus 20 will bedescribed in detail with reference to FIGS. 19 to 23. In this controlsystem, a first sensor drive circuit 53, which drives the firstposition-detecting line sensor 47 in response to a monitor instructionsignal SA from a position control unit 55 of a control section 56,receives a train of first video signals outputted from the firstposition-detecting line sensor 47. The first sensor drive circuit 53samples the outputs of all the sensor pixels and sends the positioncontrol unit 55 the address corresponding to the intersectionimage-forming point Q₁ shown in FIG. 25, i.e. the pixel receiving thegreatest intensity.
In more detail, the first sensor drive circuit 53 recognizes thegreatest pixel intensity in a single sample frame by using the analogintensity levels as a floating binary reference system, thus outputtinga single binary signal pulse Q₁ representing the detected intersectionimage-forming point Q₁, as shown in FIG. 20(A). The first sensor drivecircuit 53 detects the leading or trailing edge of the video signalpulse Q₁, or the average of the leading and trailing edges of the videosignal pulse Q₁ and outputs the corresponding address value Q₁.
A second sensor drive circuit 54 drives the second position-detectingline sensor 48 and outputs a address value Q₂ shown in FIG. 21(B),similarly to the first sensor drive circuit 53.
A third sensor drive circuit 57, which drives the flaw-detecting sensor46 while in the presence of a monitor instruction signal SB from aflaw-detection control unit 58 of the control section 56, receives atrain of third video signals from the flaw-detecting line sensor 46. Thethird sensor drive circuit 57 processes the pixel outputs of theflaw-detecting line sensor 46 and sends the flaw-detection control unit58 a flaw-evaluation signal W (if there is no flaw, the signal value Wis 0) as shown in FIG. 20(C).
The third drive circuit 57 employs the same floating binary system usedin the first drive circuit 53 to output a single binary video signalpulse W indicating a detected surface flaw, if any, in an inspectionstrip area 43 on the painted outer surface 43. The third sensor drivecircuit 53 responds to the trailing edge and the width of the videosignal pulse W and outputs the flaw-evaluation signal in accordance withthe dimensions of the surface flaw.
As shown in FIG. 19, a servo-amplifier 59 receives as a plus or minusvoltage-adjustment signal V_(x) derived by a D-A converter 60 from anaxis-rotation-adjustment value D_(x) generated by the position controlunit 55. The axis-rotation-adjustment value D_(x) represents the desiredangular correction (a vector quantity) of the laser unit 7 about itsaxis θ_(x). The servo-amplifier 59 also receives a velocity feedbacksignal from the tachogenerator 37 and drives the second motor 36 of theaxis-rotation adjuster 26.
Similarly, a servo-amplifier 61 receives a plus or minusvoltage-adjustment signal V_(y) derived by a D-A converter 62 from aninclination-adjustment value D_(y) generated by the position controlunit 55. The inclination-adjustment value D_(y) represents the desiredangular correction (a vector quantity) of the support beam 6 about itsaxis θ_(y). The servo-amplifier 61 also receives a velocity feedbacksignal from the tachogenerator 29 and drives the first motor 28 of theinclination adjuster 23.
A power circuit 63, in response to a laser excitation instruction signalSL from the position control unit 55, energizes the laser unit 7.
A marker driver 64, in response to a marker instruction signal SM fromthe flaw detection control unit 58, drives an electromagnetic valve 65to supply a spring-loaded working cylinder 27a of the flaw market 27with compressed air. Thus, the flaw marker 27 ejects atomized paint ontothe painted outer surface 43.
As shown in FIG. 19, the control unit 56 comprises the position controlunit 55, the flaw detection control unit 58, and the D-A converters 60and 62.
The position control unit 55 may be a microprocessor and receives andsequentially processes the address values Q₁ and Q₂, a start instructionsignal SS, a stop-instruction signal ST and a pause instruction signalSE and outputs the monitor instruction signal SA, the laser excitationinstruction signal SL, a robot-operating instruction signal SR, theaxis-rotation-adjustment value D_(x), the inclination-adjustment valueD_(y) and a flaw-detection enable signal SOK in accordance with aprogram described below with reference to FIGS. 21 and 22.
When the robot arm 18 reaches a pre-programmed point matching aflaw-detection start point F₀ over the painted outer surface 43, thestart instruction signal SS is outputted. When the robot arm 18 reachesanother pre-programmed point matching a flaw-detection finish pointF_(n) over the painted outer surface 43, the stop instruction ST isoutputted. As the robot arm 18 follows an inspection path across thepainted outer surface 43, at each turning or return-scan point, on suchas between points F_(m) and F_(m+1) in FIG. 7, the pause instructionsignal SE is outputted.
Similarly, the flaw-detection control unit 58 may be a microprocessorand receives and sequentially processes the flaw evaluation signal W, aninspection start instruction signal SSS and an inspection stopinstruction signal SST from a robot control panel (not shown), aflaw-detection reference value signal l from a controller (not shown) ofthe surface-flaw-detecting apparatus 20, and the flaw detection enablesignal SOK and outputs the monitor instruction signal SB and the markerinstruction signal SM, in accordance with a program described below withreference to FIG. 23.
The robot control section outputs the inspection start instructionsignal SSS and the inspection stop instruction signal SST at the sametiming of the starting instruction signal SS and the stop instructionsignal ST.
The operation of the position control unit 55 and the flaw-detectioncontrol unit 58 will be described with reference to FIGS. 21 to 23.
Suppose that the robot of FIG. 7 follows the path drawn indouble-dot-and-dash lines from the flaw-detection start point F₀ to theflaw-detection finish point F_(n).
As shown in FIG. 21, at STEP 1, a CPU (not shown) of the positioncontrol unit 55 checks for a reception of the start instruction signalSS from the robot control panel and, upon confirmation of reception ofthe start instruction signal SS, advances to STEP 2. In other words, theposition control unit 55 cannot advance to STEP 2 until it receives thestart instruction signal SS.
At STEP 2, the position control unit 55 sends the first and secondsensor drive circuits 53 and 54 the monitor instruction signal SA andthe power circuit 63 the laser-excitation instruction signal SL. Thus,the laser unit 7 transmits the laser slit beam LS onto the painted outersurface 43 and the first and second sensor drive circuits 53 and 54drive the respective position-detecting line sensors 47 and 48 to outputthe address values Q₁ and Q₂.
At STEP 3, the position control unit 55 executes a subroutine consistingof STEPS 4 to 9 shown in FIG. 22. At STEP 4, the position control unit55 receives the latest address values Q₁ and Q₂. At STEP 5, the positioncontrol unit 55 evaluates the translational displacement expression{1024-(Q₁ +Q₂)/2} to derive the axis-rotation-adjustment value D_(x). AtSTEP 6, the position control unit 55 evaluates the angular displacementexpression (Q₁ -Q₂) to derive the inclination-adjustment value D_(y).When the slit image SL(S) coincides with the monitored reference strip13R, the address values Q₁ and Q₂ are both 1024, and theaxis-rotation-adjustment value D_(x) and the inclination-adjustementvalue D_(y) are both 0. At STEP 7, the position control unit 55concurrently sends the axis-rotation-adjustment value D_(x) and theinclination-adjustment value D_(y) to the respective D-A converters 60and 62. At STEP 8, the position control unit 55 receives new addressvalue Q₁ and Q₂. At STEP 9, the position control unit 55 checks whetheror not the new address values Q₁ and Q₂ both equal 1024. If both the newaddress values Q₁ and Q₂ are 1024, the position control unit 55 ends thesubroutine and advances to STEP 10 of the main program. On the otherhand, if the new address values Q₁ and Q₂ are not both equal to 1024,the subroutine returns to STEP 4. STEPS 1 to 9 initialize thesurface-flaw-detecting apparatus 20 after the robot arm 18 has reachedthe flaw-detection start point F₀.
At STEP 10, the position control unit 55 sends the robot control sectionthe robot-operation instruction signal SR so that the robot can starttracking the pre-programmed surface scan. At STEP 11, the positioncontrol unit 55 repeats the subroutine shown in FIG. 22.
At STEP 12, the position control unit 55 checks for receipt of thepause-instruction signal SE from the robot control section and advancesto STEP 13 in the absence of the pause-instruction signal SE. On theother hand, the control unit 55, upon receipt of the pause-instructionsignal SE, returns to STEP 11 and repeats the subroutine of FIG. 22.
At STEP 13, the position control unit 55 outputs the flaw-detectionenable signal SOK to the fault-detection unit 58 to enable use of theflaw-detecting line sensor 46. Thus, STEP 12 has the effect oftemporarily disabling surface flaw recognition while allowing laser slitimage positioning by the positioning line sensors 47, 48 when the robotarm reaches the end of each leg of the surface scan path across theinspected surface.
At STEP 14, the position control unit 55 checks for receipt of the stopinstruction signal ST from the robot control unit. Upon receipt of thestop instruction signal ST, the position control unit 55 advances toSTEP 15. The control unit 55 returns to STEP 11 in the absence of thestop instruction signal ST.
At STEP 15, the position control unit 55 stops outputting the monitorinstruction signal SA and the laser-excitation instruction signal SL andends the program.
The effect of the control program shown in FIGS. 21 and 22 is that theimage of the laser slit beam LS reflected by the painted outer surface43 will be held continuously within the monitored reference strip on thescreen 13 even as the relationships between the laser unit 7, the laserdetector unit 8A and the painted outer surface 43 change due to variousfactors such as the curvature of the painted outer surface 43, so thatthe inventive surface-flaw-detecting apparatus 20 is applicable tovarious kinds of reflective surfaces.
As shown in FIG. 23, at STEP 16, a CPU (not shown) of the flaw detectingcontrol unti 58 checks for receipt of the inspection start instructionsignal SSS and upon receipt advances to STEP 17. In other word, the flawdetecting control unit 58 simply waits for the reception of theinspection start instruction signal SSS.
At STEP 17, the flaw detecting control unti 58 sends the third sensordrive circuit 46 the monitor instruction signal SB to enabletransmission of the flaw-evaluation signal W.
At STEP 18, the flaw-detecting control unit 58 waits for theflaw-detection enable signal SOK from the position control unit 55. Uponreceipt of this signal SOK, the flaw-detecting control unit 58 advancesto STEP 19.
At STEP 19, the flaw-detecting control unit 58 receives theflaw-evaluation signal W from the third sensor drive circuit 46.
At STEP 20, the flaw-detecting control unit 58 compares the flawevaluation signal value W with the flaw reference value l. Theflaw-detecting control unit 58, advances to STEP 21 when W≧l and on theother hand, returns to STEP 18 when W<l.
At STEP 21, the flaw-detecting control unit 58 sends the markerinstruction signal SM to the marker driver 64. Thus, the flaw marker 27marks the position of the surface flaw.
At STEP 22, the flaw-detecting control unit 58 checks for receipt of theinspection stop instruction signal SST from the robot control section.The flaw-detecting control unit 58, advances to STEP 23 upon receipt ofthe signal SST and on the other hand, in the absence of the inspectionstop instruction signal SST, returns to STEP 18.
At STEP 23, the flaw detecting control unit 58 stops outputting themonitor instruction signal SB and ends the program of FIG. 23.
THIRD EMBODIMENT
FIGS. 24 and 25 illustrate an arrangement of a flaw-detecting sensor 46and position-detecting sensors 47 and 48 according to a third embodimentof this invention. The position detecting sensors 47 and 48 are disposedto either side of the flaw detecting sensor 46 and are alignedperpendicular to the flaw detecting sensor 46. The reference axis R ofthe flaw detecting sensor 46 crosses the central picture elements, i.e.1024th picture elements of the position detecting sensors 47 and 48. Asshown in FIG. 25, the expression {1024-(Q₁ +Q₂)/2} represents thetranslational displacement of the slit image SL₃ (S) from the monitoredreference strip and the expression (Q₁ -Q₂) represents the angulardisplacement of the slit image SL₃ (S) from the monitored referencestrip, as in the second embodiment. The third embodiment obviates theneed for the beam splitter.
Another embodiment of this invention may employ a reflective butscattering screen in place of the scattering, transmissive screen 13.Still another embodiment may employ a laser spot beam. Still anotherembodiment may employ an area sensor instead of the line sensorregardless of the type of laser beam used in order to further moderatethe requirements for accurately controlled inspection conditions.
In another embodiment, the surface flaw detecting apparatus is fixed andthe automotive vehicle door 44 is movable.
In another embodiment, the optical axis of the laser detector unit ismovable in order to adjust the axis-rotation offset δ and the opticalaxis of the laser unit is fixed. Alternatively, both optical axes may beadjustable.
In another embodiment, a device mounted pivotably on the shaft 7bcomprises only a lens system used to convert the laser beam to a laserslit. The laser beam is conducted to the lens system through an opticalfiber, so that a more compact surface-flaw-detecting apparatus can beobtained.
This invention is applicable to surfaces of a vehicle body which havebeen painted, or to various specular surfaces.
In addition, the inclination adjuster and the axis-rotation adjuster arenot limited to the structures shown in the drawings. Any devices capableof adjusting the inclination ε and the angular axis offset δ wouldserve.
What is claimed is:
1. A method for detecting flaws in the surface of anobject to be inspected, comprising the steps of:transmitting a laserbeam in a slit configuration onto a surface of the object; projectingthe laser beam reflected by the surface of the object onto a part of alight-scattering plane sceen; forming an image of the surface of theobject on the part of the screen, the image having a first configurationin the form of a continuous slit when the surface of the object has noflaw and having a second configuration in the form of a slit with acorresponding discontinuity when the surface of the object has a flaw;detecting both the first and second configurations of the image of thesurface on said part of said screen; and producing a train of pulses inresponse to said first and second configurations of the image in which apossible surface flaw is indicated by a particular output level.
2. Anapparatus for detecting surface flaws, comprising:means for transmittinga laser slit beam onto a specular surface of an object to be inspected;a light-scattering screen onto which the laser slit beam is reflected bythe surface so as to form an image of the surface on the screen; aflaw-detecting means for detecting the image of the surface at apredetermined portion of the screen; means for detecting the position ofthe image of the surface relative to the predetermined portion of thescreen; means for adjusting the angle subtended by the optical axes ofsaid laser slit beam transmitting means and of the flaw detecting meansin accordance with the output of said position detecting means; andmeans for adjusting the inclination of the plane defined by the opticalaxes of said laser slit beam transmitting means and the flaw-detectingmeans relative to the surface in accordance with the output of saidposition detecting means.
3. An apparatus as recited in claim 2, whereinsaid flaw-detecting means comprises a flaw-detecting line sensor capableof monitoring a reference strip of the screen and said positiondetecting means comprises two position-detecting line sensors, the axisof the flaw-detecting line sensor lying oblique to the axes of theposition-detecting line sensors.
4. An apparatus as recited in claim 3,wherein the position-detecting line sensor are disposed in the sameplane as the flaw-detecting line sensor and at opposite ends of theflaw-detecting line sensor.
5. An apparatus as recited in claim 3,further comprising:a beam splitter splitting the scattered laser beamtransmitted from the screen into two different directions, a first splitlaser beam being directed onto the flaw-detecting line sensor and asecond split laser beam being directed onto the position-detecting linesensors.
6. An apparatus as recited in claim 5, wherein theposition-detecting line sensors lie in a plane oblique to the plane ofthe flaw detecting line sensor and wherein the spacing between theposition-detecting line sensors is determined by the maximum curvatureof the surface.
7. An apparatus as recited in claim 2, wherein saidscreen is substantially 2-dimensional.
8. An apparatus as recited inclaim 2, wherein said screen is made of a light-transmissive material.9. An apparatus as recited in claim 4, wherein both theposition-detecting line sensors consist of a plurality of pictureelements each converting an incident light intensity to a correspondingelectrical signal, the axis of the flaw-detecting line sensor lying in aplane including the central picture elements of both position-detectingline sensors and wherein said angle adjusting means determines theaxes-angle based on the average distance of the image from the centralpicture elements and said inclination adjusting means determines theinclination based on the average slope of the image relative to theflaw-detecting line sensor.
10. An apparatus as recited in claim 9,further comprising:a first sensor drive circuit means for samplingoutputs of all of the picture elements of a first position-detectingline sensor, identifying the pixel with the most intense incident lightand outputting a corresponding address value representing the locationof a first point of the image; a second sensor drive circuit means forsampling the outputs of all of the picture elements of the otherposition-detecting line sensor, identifying the pixel with the mostintense incident light and outputting a corresponding address valuerepresenting a second point of the image; and a position control meansconsisting of a microprocessor responsive to said address valuesrepresenting the locations of said first and second image points forderiving said average distance and average slope values.
11. Anapparatus as recited in claim 4, wherein the flaw detecting means isdisposed in a fixed spatial relationship with the screen, and theposition detecting means is disposed in a fixed spatial relationshipwith the screen. | 2024-03-22 | 1985-04-26 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1987-12-29"
} |
US-14335388-A | Rotary compressor with capacity regulation valve
ABSTRACT
A rotary compressor being provided with a capacity regulation valve (16) at the outlet of the compressor. The valve is movable between a first position (18) in sealing cooperation with an end face (19) of the compressor rotor and a second position (20) creating a leakage path between the outlet opening (15) and the inlet opening (14) of the compressor.
The present invention relates to a rotary compressor particularly to arotary compressor provided with a simple and efficient valve forcapacity regulation of the compressor. The valve also allows unloadedstart of the compressor.
According to one prior art capacity regulation of a screw compressor theinlet channel is throttled so as to allow only a part of the fullcapacity gas flow to be delivered by the compressor. This is a simpleway of obtaining capacity regulation. However, the power required todrive the compressor at part load is rather close to the power requiredwhen the compressor runs at full capacity.
Another prior art solution provides for the returning of uncompressedgas to the inlet. This is accomplished by means of either a slide valvemovable in the wall of the compression chamber or a turn valve arrangedin the housing and communicating with the compression chamber. This ideaprovides for lower power requirement at a part load than the abovementioned prior art. However, the compressor becomes considerably morecomplicated.
According to a further prior art solution, U.S. Pat. No. 3,527,548,partly compressed gas is conducted back to the inlet through the rotorshaft. This solution results in a rather complicated rotor shaft whichfurthermore becomes less stiff so that rotor deflections increase. Thisresults in sealing problems.
The present invention, which is defined in the appended claims, aims atcreating a rotary compressor having a simple capacity regulation valvewhich provides for a part load power requirement which is substantiallylower than the power requirement of the throttled inlet capacityregulation.
An embodiment of the invention is described below with reference to theaccompanying drawings in which:
FIGS. 1a and 1b illustrate sections through one end of a screwcompressor in which FIG. 1a shows a valve in a sealing position, whileFIG. 1b is similar to FIG. 1a but shows the valve in an open position.
FIGS. 2 and 3 schematically show how the regulation valve operates.
FIG. 4 shows a view of the valve elements.
The rotary compressor shown in the drawings is a screw compressor andcomprises a housing 11 provided with two intersecting bores in which tworotors 12,13 are rotatable. Each rotor is provided with a number oflobes and intervening grooves. The rotors are provided with shafts 17which are journalled in bearings 25. The rotors convey compressiblefluid from an inlet opening 14 to an outlet opening 15 while compressingthe fluid. A valve element 16 is longitudinally slidable in housing 11along rotor shaft 17 which is provided with a sleeve 23 held in place bya nut 24. A valve element is provided for each rotor. A bushing 26containing a number of seals 27 is arranged in housing 11. Valve element16, provided with a seal 29, is movable between a first position 18,shown in FIG. 1a, in sealing cooperation with an end face 19 of rotor 13and a second position 20, shown in FIG. 1b, creating a leakage path,illustrated by arrows 21, between outlet opening 15 and inlet opening 14along the outer surface of the rotor. Valve element 16 is provided witha cut-out 22 so as not to unduly restrict the fluid flow at the outlet15. The valve is also slidable along a pin 30 inserted in ring 26 sothat valve 16 cannot turn in the housing 11. Valve element 16 is pushedtoward second position 20 by the gas pressure at the outlet end of thecompressor. In the illustrated embodiment of the invention valve element16 is pushed toward first position 18 by gas pressure applied throughchannel 28. It is also possible to use hydraulic pressure or mechanicalactuation of the valve element. The valve element can be positionedanywhere between the fully open position 20 and the closed position 18by controlling the pressure of the gas supplied through channel 28 viachamber 31.
I claim:
1. A rotary compressor comprising a housing (11) provided withtwo intersecting bores, one rotor (12, 13) journalled for rotation ineach of said bores for conveying compressible fluid from an inletopening (14) to an outlet opening (15), each rotor comprising a numberof lobes and intervening grooves, characterized by a valve element (16)slideable in said housing (11) along at least one rotor shaft (17) of atleast one of said rotors between a first position (18) in sealingcooperation with an end face (19) of said at least one rotor and asecond position (20) creating a leakage path (21) between the outletopening (15) and the inlet opening (14) along the outer surface of saidat least one rotor, said valve element (16) comprising an annular ringguided by a pin (30) being immobile relative to the housing (11).
2. Arotary compressor as claimed in claim 1, wherein said valve element (16)is partially disposed in said outlet opening and is provided with acut-out (22) to reduce flow losses at the outlet opening (15) of thecompressor.
3. A rotary compressor comprising a housing (11) providedwith two intersecting bores, one rotor (12,13) journalled for rotationin each of said bores for conveying compressible fluid from an inletopening (14) to an outlet opening (15), each rotor comprising a numberof lobes and intervening grooves, characterized by a valve element (16)slidable in said housing (11) along a rotor shaft (17) of said rotorsbetween a first position (18) in sealing cooperation with an end face(19) of said rotors and a second position (20) creating a leakage path(21) between the outlet opening (15) and the inlet opening (14) alongthe outer surface of the rotors, said valve element (16) comprising anannular ring guided by a pin (30) being immobile relative to the housing(11).
4. A rotary compressor comprising a housing (11) provided with twointersecting bores, one rotor (12,13) journalled for rotation in each ofsaid bores for conveying compressible fluid from an inlet opening (14)to an outlet opening (15), each rotor comprising a number of lobes andintervening grooves, characterized by a valve element (16) slidable insaid housing (11) along a rotor shaft (17) of said rotors between afirst position (18) in sealing cooperation with an end face (19) of saidrotors and a second position (20) creating a leakage path (21) betweenthe outlet opening (15) and the inlet opening (14) along the outersurface of the rotors, said valve element (16) comprising an annularring guided by a pin (30) being immobile relative to the housing (11),said valve element (16) being partially disposed in said outlet openingand being provided with a cut-out (22) to reduce flow losses at theoutlet opening (15) of the compressor. | 2024-03-22 | 1988-01-12 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1991-02-19"
} |
US-6415493-A | Method and apparatus for clarifying green liquor
ABSTRACT
In a chemicals recovery plant in a sulphate pulp mill, in order to provide green liquor with improved sedimentation and filtration properties, there is passed, from a flow (10) of slaked lime and green liquor between a lime slaker (9) and a causticizing tank (1 1), a partial flow (32, 35) to a soda dissolver (2) or to a container (26) for unclarified green liquor provided after the soda dissolver. For this purpose there is provided, in a line (10) between the lime slaker (9) and the causticizing tank (11), a branch line (32, 35) which passes to the soda dissolver (2) or to a container (26) for unclarified green liquor provided after the soda dissolver.
BACKGROUND OF THE INVENTION
The present invention relates to a process and a device in a chemicalsrecovery plant in a sulphate pulp mill.
From SE-B-8700549-2 there is known a process for treating green liquor,more particularly in such a way that the green liquor's content ofparticularly inorganic impurities and soot obtains better sedimentationand filtration properties and, owing to that, can be separated from thegreen liquor and accordingly removed from the chemicals cycle in asimpler and more effective way than before. This is achieved by addingto the non-clarified green liquor, while stirring quick lime comprisingfrom 0.5 to 10%, preferably from 1 to 3% of the amount of quick limenecessary for complete causticizing of the green liquor.
According to SE-B-8700549-2 the quick lime is added either to a sodadissolver, in which melt from a soda recovery unit is dissolved in weakliquor, and from this to a mixing tank or directly to the mixing tank.From the mixing tank the green liquor formed is passed to a filter, fromwhich solid particles are removed for dumping whereas clarified greenliquor is passed to a lame slaker. From the lime slaker the mixture oflime and green liquor is passed to a causticizing tank from which themixture of liquor and lime sludge formed is passed to a filter. Thefiltrate formed therein, white liquor, is passed to the digester housewhereas the material filtered off, the lime sludge, is passed to a limesludge silo. From this the lime sludge is passed to a washing filterfrom which the weak liquor formed is added to the above-mentioned sodadissolver whereas the lime sludge is passed into a lime kiln where it isburnt to lime. The quick lime is passed to the lime slaker as well as,according to the above, to either the soda dissolver or the mixing tank.
SUMMARY OF THE INVENTION
The object of the present invention is to simplify and cheapen the knownprocess and owing to that also make a simplified and considerable morecheap device possible. The invention is based upon the understandingthat it is the slaked lime formed in the soda dissolver and in themixing tank, respectively, that is active in the process in order toobtain the desired result. According to the present invention it istherefore suggested that the addition of lime is in the form of alreadyslaked lime, that is the slaked lime that is already present in theprocess and that is formed in the lime slaker. Thus, from the flow oflime and green liquor to the causticizing tank there is taken a partialflow which is passed to the mixing tank or alternatively to the sodadissolver. This is done before the causticizing process has beencompleted, i.e. that uncausticized liquor (lime milk) is passed into themixing tank.
By using in this way slaked lime that is already present in the plant,the expensive and long conveyors, which, in plants according toSE-B-87005492, are required to convey slaked lime to the soda dissolverand the mixing tank respectively, are avoided. Instead there is obtaineda closed system for lime circulation from the lime slaker through aline, provided for this purpose, to the mixing tank, alternatively thesoda dissolver, from the mixing tank to the green liquor filter and thenback to the lime slaker.
On the apparatus side there is required for this only that there isprovided, from the existing line between the lime dissolver and thecausticizing tank, a branch line to the mixing tank and the sodadissolver, respectively, optionally together with a pump, a pump vesseland means for regulating the partial flow withdrawn.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is explained in more detail in the following withreference to the enclosed schematic drawing showing an example of achemicals recovery plant in a sulphate pulp mill set up to carry out theprocess of the invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
In the drawing 1 designates a running shute which passes, from a sodarecovery unit not shown, melt to a soda dissolver 2 in which there is astirrer 3. In the soda dissolver 2 also a line 4 for weak liquorconcludes. From the soda dissolver 2 a line for green liquor passes to agreen liquor clarifier 6, from the bottom of which sediment can beremoved through a line 7. From the green liquor clarifier 6 a line 8 forclarified green liquor passes to a lime slaker 9, from which a line 10for slaked lime and green liquor passes to a causticizing tank 11. Aline 12 connects the causticizing tank 11 with a white liquor filter 13,from which on one hand a line 14 passes carrying filtered white liquorto a digester house not shown and, on the other hand, a line 15 carryingfiltered-off material (lime sludge) to a lime sludge silo 16. From thisa line 17 passes to a washing filter 18, in which the lime sludge iswashed with hot water entering the washing filter through a line 19. Inthe washing filter the weak liquor formed is passed through the line 4previously mentioned to the green liquor clarifier 6 whereas the limesludge is passed, through a path 20, into a lime kiln 21 for burning toquick lime. The quick lime is passed through a line or conveyor 22 to alime silo 23, from which quick lime is withdrawn to the lime slaker 9.For so-called draining of the lime cycle the lime slaker 9 is providedwith a drainage 24 for inert substances. All lines mentioned above areshown in the drawing with solid lines.
As an alternative to passing, through line 5, the green liquor from thesoda dissolver 2 to the green liquor clarifier 6, the green liquor maybe passed, through a line 25, to a mixing tank 26 provided with astirrer 27 and from this through a line 28 to a green liquor filter 29,from which filtered-off material (sludge)is passed for dumping through aline 30, whereas filtered green liquor is passed, through a line 31connected to line 8, to the lime slaker 9. The alternative lines 25, 28and 3i are shown with dash dotted lines.
The plant described above is a conventional one. According to the priorart of SE-B-8700549-2 the conventional plant has been supplemented inthat alternative lines or conveyors pass from the line or conveyor 4 inorder to introduce quick lime into to the soda dissolver 2,alternatively the mixing tank 26.
In order to save the considerable plane and operation costs for theselines or conveyors, it is suggested according to the present invention,as mentioned above, that slaked lime (lime milk) is taken from the flowin line 10 from the line slaker 9 to the causticizing tank 11. For thispurpose there is provided in line 10 a branch line 32, which passes,through an optional pump jar 33 with the subsequent pump 34 and a line35, the lime milk to the soda dissolver 2--in case a green liquorclarifier 6 is used--or through a line 36 to the mixing tank 26--in casesuch a one is used. In case any pump is not required to transport thelime milk, the line 32 may be connected directly to line 35 through aline 37.
Means, which are not shown, for regulating the partial flow withdrawnfrom line 10, e.g. 3% of the total flow, are of course provided in lines32 and 37 (comprising control means for the pump 34) and in line 37,respectively, such as valves and other metering means making sure thatthe addition of slaked lime to the soda dissolver and the mixing tank,respectively, will be as intended.
Through the invention there has been provided an "inner" cycle in theform of a completely closed system which differs from the conventional"outer" lime cycle as well as from the lime cycle known fromSE-B-8700549-2 with drainage to the soda dissolver or the mixing tankand which as such does not require any replenishment of lime because ofdrainage, since the necessary amount of lime in the form of slaked limeis continuously taken from the outer lime cycle through line 32.
We claim:
1. A process for producing green liquor with improvedsedimentation and filtration properties in a chemicals recovery plan ofa sulphate pulp mill comprising:introducing weak liquor and melt into asoda dissolver in order to form unclarified green liquor; directing aflow of unclarified green liquor from the soda dissolver to a clarifierto remove solid particles from the unclarified green liquor so as toproduce clarified green liquor; directing a flow of clarified greenliquor from the clarifier to a lime slaker; introducing a supply of limeinto the lime slaker along with the clarified green liquor from theclarifier; directing a flow of slaked lime from the lime slaker to acausticizing tank; and re-directing a partial portion of the flow ofslaked lime, prior to the causticizing tank, to one of the sodadissolver and a mixing tank interposed in the flow path of green liquorfrom the soda dissolver to the lime slaker to improve the removal ofsolid particles from the unclarified green liquor, wherein the partialportion of the flow of slaked lime corresponds to approximately 3% ofthe total flow from the lime slaker to the causticizing tank.
2. Achemical recovery system in a sulphate pulp mill for producing greenliquor with improved sedimentation and filtration propertiescomprising:a soda dissolver into which weak liquor and melt areintroduced and processed so as to form green liquor; a green liquorclarifier; a lime slaker; a first flow line in flow communication fromsaid soda dissolver through said green liquor clarifier to said limeslaker; means for introducing lime into said lime slaker; a causticizingtank; a second flow line in flow communication from said lime slaker tosaid causticizing tank; and a branch line means for re-directing apartial portion of the flow of slaked lime, prior to said causticizingtank, to said soda dissolver.
3. The system according to claim 2,wherein said branch line means comprises a pump.
4. The system accordingto claim 3, wherein said branch line means comprises a pump jar.
5. Achemical recovery system in a sulphate pulp mill for producing greenliquor with improved sedimentation and filtration propertiescomprising:a soda dissolver into which weak liquor and melt areintroduced and processed so as to form green liquor; a green liquorfilter; a lime slaker; a first flow line in flow communication from saidsoda dissolver through said green liquor filter to said lime slaker; amixing tank provided in said first flow line between said soda dissolverand said green liquor filter; means for introducing lime into said limeslaker; a causticizing tank; second flow line in flow communication fromsaid lime slaker to said causticizing tank; and a branch line means forre-directing a partial portion of the flow of slaked lime, prior to saidcausticizing tank, to said mixing tank.
6. The system according to claim5, wherein said branch line means comprises a pump.
7. The systemaccording to claim 6, wherein said branch line means comprises a pumpjar. | 2024-03-22 | 1991-11-20 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1996-04-23"
} |
US-55548695-A | Milling cutter for a wheel set milling machine
ABSTRACT
A milling cutter for truing railroad wheels has a milling drive shaft (10) with at least two, preferably three, cutter sections (3, 4, 5). One fixed cutter section (4) is rigidly connected to the shaft (10). At least one, preferably two, cutter sections (3, 5) are axially shiftable along the shaft (10) and receive their torque drive through the fixed cutter section through a releasable coupling such as a claw clutch (9, 30). One axially shiftable section (3, 5) is positioned on each side of the fixed section (4), with a gap (22) therebetween. Preferably, the shiftable sections (3, 5) are interconnected (at 21) so that an axial adjustment of one section is synchronously transmitted to the other section and vice versa.
FIELD OF THE INVENTION
The invention relates to a milling cutter for milling or machining ofrailroad wheel sets on a milling machine tool. Such milling cutterscomprise a plurality of cutting elements arranged on a carrier body anddistributed around the carrier body in the circumferential direction ofthe carrier body and in accordance with the railroad profile to bemilled. The carrier body is rotatable by a respective rotational drivesuch as a milling drive shaft. The carrier body is substantiallysymmetric in a rotational sense relative to a rotation axis of themilling drive shaft.
BACKGROUND INFORMATION
Milling cutters of the type described above are known in the art andhave basically proven themselves for reprofiling of worn railroad wheelsets. Conventional milling tools or cutters are constructed to conformas a unit to the entire profile of the wheel to be milled. As a result,conventional milling cutters make it possible to finish the milling ofthe wheel in a single step provided the wheel profile is shiftedexclusively radially toward the rotational axis of the wheel, wherebydifferent milling tools are not necessary. However, such exclusivelyradial shifting of the wheel set is frequently not sufficient as will beexplained in more detail below.
German Patent 489,786 (Schneider et al.) published on Jan. 20, 1930discloses a divided milling cutter having two half sections that aredisplaceable in the axial direction. The two cutter half sections (W)are mounted on a drive shaft for rotation with the drive shaft, butpermitting an axial displacement of both sections within a limited axialrange. The axial displacement is accomplished by a threaded thorn (E)having a conical tip engaging two conical surfaces of cones (K) that inturn engage respective conical surfaces of the two half sections (W).These conical surfaces displace the half sections (W) away from eachother against the force of springs (F) which push the two half sectionstoward each other when the adjustment thorn (E) is moved back.
German Patent Publication 1,179,080 (Fohrer et al.) published on Oct. 1,1964 discloses a two section milling cutter (42, 46) mounted on abushing (12) which in turn is mounted on a milling drive shaft (10). Themilling width can be axially adjusted by an adjustment screw, whereby aBelleville spring (4) tends to separate the two cutter sections (42, 44)against the adjustment force.
Austrian Patent 167,889 (Kralowetz) published on Mar. 10, 1951 disclosesa milling machine tool for round milling of profiled rotational bodies,especially of railroad wheel sets. The cutter has a carrier body (a)that is undivided and driven by a drive shaft (e) operating a worm gear(c, d).
Werkstatt Blatt 462, Carl Hanser Verlag, Munich 1968 discloses variousprofile milling cutters in FIGS. 21, 22, and 23. FIG. 21 shows fourseparate milling cutters (2, 3, 4 and 5) mounted on a common drive shaft(6). FIG. 22 shows schematically a gear clutch of a circumferentialmilling cutter. In FIG. 23 two milling cutter sections are coupled witheach other at a slant.
The above described prior art leaves room for improvement, especially ifone takes into account the characteristic wear and tear image ofrailroad wheel sets that require an overhaul. Such characteristic wearand tear image shows that the main wear and tear, namely where most ofthe wheel material has been removed occurs on the wheel flange flank andin the area of the tread surface next to the wheel flange flank. If sucha worn wheel is reprofiled with a profiling milling cutter having arated profile contour, the reworked wheel circumferential surface orprofile contour has merely been displaced radially inwardly relative tothe original wheel contour. The radial direction in this context refersto a direction perpendicularly to the rotational axis of the wheel setto be overhauled. As a result, substantial material volumes must beremoved even though large wear and tear depths occur only in spotsaround the wheel circumferential surface and not in the entire wheelsurface. The deepest wear and depth thus conventionally controls themilling depth in order to form the rated contour.
Where the cross-section to be milled is smaller in its radial depth thanthe deepest wear it would appear to be possible to achieve the ratedprofile at least in the area of the tread and the wheel flange flank bydisplacing the milling cutter in a direction toward the inner side orface of the wheel parallel to the rotational axis or parallel to theslightly conical tread surface of the wheels of a set. The inner side orface or back face of the wheel is the one that faces the other wheel ofa set.
The outer wheel face or front face is facing axially away from the otherwheel of a set. Such displacement enables the positioning of the newlyto be formed wheel flange "higher" meaning further radially outwardly inthe area of the remaining wheel flange of a worn profile. As a result,it would be possible to achieve substantial savings or reductions in thevolume of material that has to be machined or milled and thus in themilling time by a relatively small axial shifting or displacement of theprofile in the direction of the inner wheel face. Such shifting ordisplacement within certain limits may be viewed as not being criticalfor the running characteristic of the wheel set on the rail.
However, a substantial disadvantage is involved with a milling operationbased on the just described axial profile shifting of the profilingcutter. This disadvantage is based on the fact that the end portions ofthe profile contours which do not extend in parallel to the wheel setaxis necessarily cause an erroneous milling of the new profile contourof the wheels. Such errors are due to the above mentioned shifting ofthe milling cutter axially or tangentially to the tread surface of thewheel. The error results in a diameter that is too large on the insideareas of the wheel tread and too small on the outside areas of the wheeltread in which the inner cutting elements of the milling cutter nolonger engage the wheel material. It is even possible that a small stepis formed along the transition between the inner and outer wheel treadsurfaces. If this occurs, a substantial disadvantage results because inorder to now achieve the correct transitions of the wheel profile to theside surfaces of the wheel, a further milling operation must beperformed with a different milling tool, whereby the overhaul time andrespective costs are substantially increased. As a result of thisfurther milling operation, it is also unavoidable to apply a finishingoperation to the back face of the wheel flange.
OBJECTS OF THE INVENTION
In view of the above it is the aim of the invention to achieve thefollowing objects singly or in combination:
to provide a milling cutter or tool that will avoid the abovedisadvantages in a reprofiling operation of railroad wheel sets, morespecifically to permit an axial profile change of the tool and thus ofthe wheel whereby a single milling pass will be sufficient withoutexchanging milling tools;
generally to reduce the time and respective costs for overhaulingrailroad wheel sets;
to interconnect a plurality of milling cutter sections in a torquetransmitting manner;
to provide for a milling width adjustment by making at least one cuttersection axially adjustable relative to a fixed cutter section which isrigidly, for example integrally connected to the torque applying millingshaft;
to assure a more precise adjustment of at least one, preferably two,movable cutter sections relative to a fixed cutter section axially alonga milling drive shaft; and
to simplify the required adjustments so that the set-up time is reducedwhile a precision adjustment of the milling width and cutter contour isassured.
SUMMARY OF THE INVENTION
The above objects have been achieved according to the invention by amilling cutter having a carrier body for the cutting elements whichcarrier body is divided into a plurality of support body sections ofwhich at least one section is axially movable and adjustable relative toa fixed carrier body section, whereby the fixed section can provide aplane of reference for the adjustment of one or more adjustablesections. The adjustment is performed when the cutter is not performinga milling operation.
The movable mounting of at least one cutter section in combination witha fixed mounting of one cutter section has the advantage that the axialadjustment of the movable cutter section prior to a milling operationcan take into account any wheel profile displacement that resulted fromwear and tear. Normally, such displacement extends inwardly. The amountof displacement of the surface is ascertained and the movable cuttersection is adjusted accordingly. Preferably, the adjusted section isthat cutter section which mills the back face of the wheel flange. As aresult, a single milling run provides a finished overhauled wheel setand a finishing milling operation with a different cutter or tool is nolonger necessary according to the invention.
Where the cutter according to the invention is divided in threesections, the adjustable sections are positioned on opposite sides ofthe fixed section, whereby the respective adjustments can take intoaccount the worn profile condition of the back face and of the frontface of the wheel profile. As a result, a single milling operation willprovide an overhauled wheel set even if the worn condition of theprofile contour requires a milling operation with an axial profiledisplacement, whereby again time and costs are saved.
According to the invention the milling torque is preferably transmittedfrom the milling drive shaft directly to the fixed cutter section andthrough the fixed cutter section indirectly to the adjustable cuttersections either by a friction connection or by an interlocking form-fitor positive connection. These connections for the transmission of themilling torque to the adjustable cutter sections makes it possible toavoid a direct connection between the adjustable cutter sections and themilling drive shaft while permitting the axial adjustment of one or morecutter sections.
BRIEF DESCRIPTION OF THE DRAWINGS
In order that the invention may be clearly understood, it will now bedescribed, by way of example, with reference to the accompanyingdrawings, wherein:
FIG. 1 is a schematic side view, partially in section of a millingcutter according to the invention having three sections located in amilling position relative to a wheel to be overhauled;
FIG. 2 is a schematic sectional view through a milling cutter accordingto the invention, whereby the sectional plane passes through a millingcutter section near a neighboring section;
FIG. 3 shows a schematic development providing a top plan view onto twoneighboring milling cutter sections coupled to each other by a clawclutch, whereby the view direction is indicated by an arrow III in FIG.2; and
FIG. 4 is a schematic view of an elongated cutting element having astraight cutting contour or edge.
DETAILED DESCRIPTION OF PREFERRED EXAMPLE EMBODIMENTS AND OF THE BESTMODE OF THE INVENTION
FIG. 1 shows a milling cutter 1 according to the invention mounted on amilling drive shaft 10 which in turn is rotatably mounted in bearings 19of a mounting buck 20 with a buck base 20A slidably supported on guidetracks 34. The mounting buck 20 and the milling cutter 1 form astructural unit that is axially adjustable as indicated by the arrow A5in the direction of the rotation axis A of the milling drive shaft 10. Aconventional adjustment drive 33 such as a power driven spindle 33Apermits positioning the structural unit 1, 20 relative to a wheel 28 tobe overhauled by a milling operation of the wheel surfaces 11, 12, 13and 14 of the wheel 28. The milling cutter 1 comprises a carrier body 2for cutter elements 6 and 7.
According to the invention the carrier body 2 is divided into threecarrier body sections 3, 4 and 5 which form respective cutter sections.The cutting elements 6 and 7 are secured to and distributed around thesesections in accordance with a rated wheel profile. The milling driveshaft 10 has a power input end 24 that is, for example fluted forcoupling to a respective power take-off not shown. The fluted shaft end24 permits, within certain limits, an axial adjustment in the directionof the arrow A5 as described above. A torque moment 8 applied to themilling drive shaft 10 is directly introduced into the central millingcutter carrier body section 4 which is rigidly connected to the shaft10. This rigid connection causes the section 4 to rotate with the shaft10 and prevents any relative displacement between the section 4 and theshaft 10 in the axial direction A5. For this purpose it is preferablebut not necessary to construct the section 4 and the shaft 10 as anintegral, single piece unit. Instead of an integral construction, alocation fit, a form fit, or any other connection suitable for securingthe cutter section 4 in a force transmitting manner to the drive shaft10 may be used. Thus, the torque moment 8 is directly introduced intothe section 4 through the shaft 10. However, the separate carrier bodysections 3 and 5 are axially displaceable on the shaft 10 relative tothe center section 4 as indicated by the arrows A1 and A2, whereby theaxially facing end faces of the section 4 provide reference planes forthe axial adjustment of the sections 3 and 5 to thereby leave a definedwidth for a gap 22 after adjusting the axial position of the sections 3and 5 toward and away from the section 4. An axial adjustment device 31for axially displacing the carrier sections 3 and 5 as indicated by thearrows A1 and A2 will be described in more detail below. The torquemoment 8 is transmitted from the central section 4 to the adjustablesections 3 and 5 through a respective coupling, for example, a clawclutch 9, 30 or any suitable drive coupling such as a friction coupling,a form-locking coupling, or the like. Further details of the clawcoupling will be described below with reference to FIG. 3.
FIG. 1 further shows a wheel guide roller 26 rotatably mounted on avertical axle 26A for contacting an outer wheel face 13 to therebyproperly position the structural unit 1, 20 axially relative to thewheel 28. The roller 26 with its axle 26A is mounted on a block 26Bwhich can be moved e.g. by means of a hydraulic cyclinder to either aretracted position or to the position where the block 26B contacts anaxially facing surface of the carrier body section 3 when the cutterdoes not rotate. In this latter position the positioning of the cutterrelative to the wheel to be milled will take place. Instead ofpositioning the guide roller 26 on the right-hand side as shown, it mayalso be positioned on the left hand side to thereby contact the innerwheel face 29 of the wheel 28. In that case the block 26B would beadjustably mounted on the cutter section 5.
Alternatively, the unit 1, 20 may be mechanically coupled to wheelsupport and/or wheel drive rollers which guide the wheel 28 in theradial as well as in the axial direction. Such a coupling between theunit 1, 20 end the just mentioned guide and/or drive rollers for thewheel 28 also permits an exact axial positioning or locating of themilling cutter 1 relative to the wheel 28 that is to be overhauled, forexample by the above mentioned axial adjustment drive 33.
In both possible adjustments of the cutter 1 relative to the wheel 28,the adjustment will be made prior to a milling operation depending onthe worn profile contour of the wheel to be overhauled in such a waythat material volume to be milled off is minimized. This minimalmaterial volume must, however, be sufficient for restoring a ratedprofile in the area of the tread surface 11 and in the area of the wheelflange flank 12. The axial displacement of the cutter 1 for thispurpose, namely to reduce the volume of material to be removed, isfurther limited by the requirements that must be met by the restoredwheels, namely to have the required good running characteristics and therequired high operational safety. For example, if the cutter section 4,the cutting elements 6 of which mill the tread surface 11, is broughtinto a position that corresponds to the maximally tolerable amount ofprofile displacement radially inwardly, it is then necessary that thesections 3 and 5 are displaced outwardly by a respective value in orderto achieve a required configuration of the transitions of the profilefrom the tread surface 11 into the wheel side surfaces 13 and 29including the wheel flange flank faces 12 and 14.
The sections 3 and 4 are coupled to each other through, for example fourpush/pull rods 21 passing through bores 27 in the central fixed section4. The milling operation of the section 3 mills the outer face 13 of thewheel 28. The section 5 mills the back flank face 14 that merges intothe back side or face 29 of the wheel flange 29A of the wheel 28. Due tothe coupling by the push/pull rods 21 rigidly connected to both sections3 and 5, it is merely necessary to adjust one of the segments 3 or 5 inthe axial direction A5, whereby the respective other section follows theadjustment in synchronism.
FIG. 1 shows, for example how the section 3 is adjusted by an adjustmentsleeve 31 having an inner threading 31A engaging an outer threading 3Aof the section 3. A gap G between the sleeve 31 and the section 3provide the required adjustment range. The rotatably mounted adjustmentsleeve 31 can itself not move axially due to a ring disk 32 rigidlysecured to the milling drive shaft 10, for example, by a shrink fit. Theadjustment sleeve 31 is preferably provided with a gear rim 35Acooperating with a gear drive 35 for the axial adjustment indicated bythe arrows A1 and A2 by the engagement of the threads 31A and 3A. Thegear drive 35 may be manually operated by a crank or it may beautomatically driven by a respective motor not shown. The crank or motorwould be connected to the drive stub 35B. In both instances the rotationof the stub 35B in one direction will narrow the gap 22 and rotation inthe opposite direction will widen the gap 22 and a stepless adjustmentof the gap G is achieved due to said threadings 3A, 31A cooperating witheach other.
Referring further to FIG. 1, three milling ranges 15, 16 and 17 areshown symbolically. These milling ranges correspond to the respectivesections 3, 4 and 5 of the cutter 1. Overlap ranges OR are providedbetween the axially adjustable sections 3 and 5 on the one hand and thefixed section 4 on the other hand. Cutting elements 6 are secured to thesurfaces of the carrier body sections, whereby in the entire millingrange 16 the cutting elements are preferably circular cutting plates.The milling range 16 covers the tread surface 11 and the outwardlyfacing face 12 of the wheel flange 29A. These cutting plates forcircular cutting assure the highest milling quality. Further cuttingelements 7 are secured in the transition areas across gaps 22 betweenthe flange flank surfaces 12 and 14 and between tread surfaces 11 and13. These cutting elements 7 have a straight or linear cutting edge 18as shown in FIG. 4. With the help of these linear cutting elements 7 alarger adjustment range may be realized since these cutting elementsbridge the gap 22 between the sections 4 and 5 as well as between thesections 4 and 3.
FIG. 2 shows the arrangement of the cutting elements 6 and 7 on thecarrier body section 4. The elements 7 are positioned where the claws 30of the claw clutch 9 are connected to the section 4, for example four ofsuch claws 30 are spaced at 90° intervals. The cutting elements 6 arepreferably round cutting plates facing in the cutting directionindicated by the arrow 8 representing the torque applied to the shaft10.
Referring further to FIG. 1, a duct 25 for cooling fluid passescoaxially with the longitudinal rotational axis A of the milling driveshaft 10 through the shaft 10 to such an extent that branching channels23 connect the duct 25 to fluid discharge ports 23A, visible in FIG. 3,for feeding cooling and chip removing fluid A3 into the gaps 22. Asshown, the duct 25 has an inlet opening 23' at the power input end 24 ofthe shaft 10. However, the duct 25 could similarly have its input end atthe opposite end of the shaft 10. Compressed air or other fluid may bepumped through the duct 25 and its branching channels 23. Such fluidsupply has the advantage that the areas being milled are kept free ofmilling chips which are removed by the fluid out of the gaps 22 so thatan axial adjustment of the sections 3 and 5 is not hampered by anymilling chips in the gaps 22. Additionally, a certain cooling effect isachieved. By keeping the gaps 22 free of milling chips, the adjustmentof the sections 3 and 5 for another wheel can be made without anyintermediate cleaning operation.
FIG. 3 shows the engagement of the claws 30 of the carrier body section3 into meshing recesses 9 of the central carrier body section 4 to formthe above mentioned claw clutch 9, 30. When the torque moment 8 isapplied to the central section 4 a recess edge 9A engages a claw edge30A to thereby entrain the section 3 with the rotation of the section 4.A meshing engagement is also provided between the edges 30B and 9B. Thecutting element 7 with its straight edge 18 overlaps the gap 22 andreaches to the end of the claw 30 as shown in FIG. 3. The side channelopenings 23A open in the gap 22 as mentioned above. A gap is providedbetween the downwardly facing edge of the claw 30 and the upwardlyfacing wall of the meshing recess 9 in sections 3 and 5 to permit theaxial adjustment of the sections 3 and 5 relative to the section 4 whichprovides a reference plane for the axial adjustment in the direction ofthe arrows A1 and A2 shown in FIG. 1. This arrangement of the claw 30and the cutting element 7 provides for a substantial adjustment range ofthe sections 3 and 5 relative to fixed section 4.
Referring to FIGS. 2 and 3 in conjunction, the arrangement of theelongated cutting elements 7 on the claws 30 provides straight cuttingedges 18 in the transition area between the axially adjustable sections3 and 5 on the one hand and the fixed section 4 on the other hand,whereby the cutting elements 7 bridge the gaps 22. This arrangement ofthe cutting elements 7 in the transition areas provides a high millingprecision in these transition areas between the tread surface 11 and thewheel flange flank 12 and between tread surface 11 and end surface 13,even though the spacing angularly in the circumferential directionbetween the cutting edges 18 is larger than a respective spacing betweencutting edges of cutting elements 6.
The transmission of the torque 8 from the central section 4 to thesections 3 and 5 can be performed by any suitable coupling. However, theclaw clutch with its recesses 9 and claws 30 is preferred because it isa simple, yet very efficient coupling that has the required small playto assure the precision milling while transmitting the required torquemoments without any problems.
The preferred embodiment in which the milling drive shaft 10 and thecentral cutter section 4 form an integral component, has the advantagethat large torque moments can be transmitted without the danger of anoverload. Further, any deformations caused by the torque loadtransmission are minimal, whereby highest precision milling operationscan be performed in order to restore or mill a railroad wheel surface tothe required rated contour.
The embodiment with three cutting sections 3, 4 and 5 in which thecentral section 4 is rigidly secured to the milling drive shaft 10between the two other axially shiftable elements 3 and 5 has theadvantage that a high milling precision is assured in the transitionareas between the tread surface 11 and the flank surface 12 where thatprecision is necessary for the running qualities of the wheel. In areaswhere the precision requirement is not quite as high, namely on the backflank surface 14 and the front flank surface 13, these last mentionedsurface areas 14 and 13 can be milled by an axial displacement of thesections 3 and 5. These axial displacements permit milling the entirewheel with a single tool in a single milling pass, without any finishingmilling operation with different tools. Nevertheless, a correctly formedor restored profile is achieved on the inwardly toward the outer wheelfacing side or flank 14 and on the outwardly facing side or flanksurface 13, including rated profile transitions between these surfacesand the tread surface 11.
By coupling the outer sections 3 and 5 to each other through a push-pullrod 21, the invention achieves the advantage that a synchronizedadjustment of these sections in the axial direction is achieved byrotating one or the other section 3 or 5. As a result, the properposition of both sections 3 and 5 relative to the central section 4 isautomatically assured. The use of, for example, four coupling rods 21that pass through bores 27 in the section 4 parallel to the longitudinalaxis A provides a practical and robust coupling of the two lateralsections 3 and 5 which are separated by the central section 4 and thegaps 22.
By mounting the cutting elements 7 in such a way that the cutting rangeof the cutting element 7 partially overlaps the cutting range of theother cutting elements 6 as shown at OR for the cutting ranges 15, 16,and 17 in FIG. 1, the invention achieves the advantage that at least oneor two of the axially movable sections 3, 5 can be adjusted without theneed for inserting additional cutting elements if the gap 22 isenlarged. Similarly, when the gap 22 is made smaller, it is also notnecessary to remove cutting elements. As a result, the set-up time issubstantially reduced. By providing the overlapping cutting element 7with a straight cutting edge 18 as compared to a circular or curvedcutting edge for the cutting element 6, the invention achieves arelatively large axial adjustment range for the two sections 3 and 5while nevertheless assuring a milling without any transition marksbetween neighboring milling ranges or areas 15, 16 and 17 and theoverlapping range OR may be rather substantial.
By mounting the milling drive shaft 10 with its bearings 19 in a bearingbuck 20, the invention provides an easily exchangeable structuralcutting unit that may be quickly replaced in the milling machine by acorresponding structural unit so that servicing of one structuralcutting unit can be performed while the milling machine continues towork with an other cutting unit. Actual down times are therebyminimized. Another advantage of mounting the milling shaft with itscutters as taught herein at both ends relatively close to the cuttersections 3, 5, assures a mounting of the cutter head 1 in a bendingstiff manner, whereby vibrations are minimized and a precision millingoperation is assured.
Further, by making the entire structural unit 1, 10, 20 axiallydisplaceable, for example on slide guide rails 34, an axial adjustmentis possible in combination with a compact construction of the bearingunit. This feature also has the advantage that an axial adjustment ofthe bearings themselves is no longer necessary.
The provision of the flow channel or duct 25 coaxially inside themilling drive shaft 10 in combination with the radially extending ducts23, permits an efficient supply of cleaning and cooling fluid into thegaps 22 between neighboring sections 3, 4 and 4, 5. The fluid is, forexample, compressed air which makes sure that any cutting chips areremoved from the gaps 22 and the adjustment of the sections 3 and 5relative to the section 4 can be performed at any time without a specialseparate cleaning operation. This feature further reduces the set-uptime.
Further, the guide roller 26 makes sure that a safe and exact guiding ofthe milling cutter 1 relative to a reference plane is achieved formilling the wheel surfaces 11, 12, 13 and 14.
The embodiment of the invention wherein the structural unit 1, 10 and 20is mechanically coupled with support and/or drive rollers for the wheel28 to be trued, permits an adjustment of the structural unit relative tothe wheel 28 independently of the coupling. In this embodiment it isadvantageous that the support and/or drive rollers of the wheel 28 to betrued provide reference points, whereby such points at one wheel of aset are sufficient to precisely mill both wheels of a set. Thus, theguide function of the guide and/or drive wheels for the wheel to betrued is advantageously also used for the positioning of the structuralunit 1, 10, and 20.
Although the invention has been described with reference to specificexample embodiments, it will be appreciated that it is intended to coverall modifications and equivalents within the scope of the appendedclaims.
What is claimed is:
1. A rail wheel milling cutter comprising a millingdrive shaft (10), a plurality of carrier body sections (3, 4, 5)connected to said milling drive shaft (10) so as to be rotatable by saidmilling drive shaft (10), cutting elements (6, 7) secured to saidcarrier body sections for said milling, wherein at least one firstcarrier body section (4) of said carrier body sections is directly andrigidly connected with said milling drive shaft (10) for a direct torqueapplication to said first carrier body section (4), wherein at least onesecond carrier body section (3 or 5) is mounted for axial displacementrelative to said milling drive shaft (10) and relative to said firstcarrier body section (4) whereby a gap (22) is formed between said firstend second carrier body sections, and wherein an adjustment member (31,31A, 3A) is connected to said second carrier body section (3 or 5) for astepless axial displacement of said second carrier body section (3 or 5)relative to said first carrier body section (4) into a fixed cuttingposition along said drive shaft (10) by adjusting a width of said gap(22) when said drive shaft is not operating, further comprising a guideroller coupled to said milling cutter in a position for engaging a sideface of a wheel to be milled, and a drive connected to said guide rollerfor positioning said guide roller against a reference face of a wheel tobe milled when the milling cutter does not rotate.
2. The milling cutterof claim 1, further comprising a torque transmitting coupling (9, 30)between two neighboring carrier body sections of said plurality ofcarrier body sections.
3. The milling cutter of claim 2, wherein saidtorque transmitting coupling comprises a claw clutch (9, 30) operativelyinterposed between said first carrier body section (4) and said secondcarrier body section (3 or 5) forming said neighboring carrier bodysections so that said second carrier body section is driven through saidfirst carrier body section and said first carrier body section isdirectly driven by said milling drive shaft (10).
4. The milling cutterof claim 1, comprising at least three carrier body sections (3, 4, 5),wherein said first carrier body section (4) forms an integral one piececomponent with said milling drive shaft (10) and is positioned betweentwo axially displaceable second carrier body sections (3 and 5) mountedon said milling drive shaft (10) for said axial displacement toward andaway from said first carrier body section (4).
5. The milling cutter ofclaim 4, further comprising an axial displacement transmitting coupling(21) between said two second carrier body sections (3, 5) so that anaxial adjustment of one (3) of said two second carrier body sections istransmitted to the other second carrier body section (5) and vice versa,whereby both second carrier body sections (3, 5) are axially displacedin synchronism with each other.
6. The milling cutter of claim 5,wherein said axial displacement transmitting coupling is a push-pull rod(21) rigidly connected to both second carrier body sections.
7. Themilling cutter of claim 1, wherein said cutting elements (7) have anoverlapping cutting range comprising a linear or straight cuttingcontour (18).
8. The milling cutter of claim 1, further comprising amounting buck (20) with at least two bearings (19), said milling driveshaft (10) carrying said carrier body sections (3, 4, 5) being rotatablymounted in said bearings (19) of said mounting buck (20) so that saidcarrier body sections are positioned between said at least two bearings.9. The milling cutter of claim 8, further comprising a positioningdevice (33, 34) cooperating with said mounting buck (20) for axiallymoving and adjusting said mounting buck (20) with its milling cutter (1)relative to a position of a rail wheel set to be milled.
10. The millingcutter of claim 8, wherein said mounting buck (20) with said millingdrive shaft (10) and said carrier body sections (3, 4, 5) mounted onsaid milling drive shaft form a structural component that isexchangeable as a unit.
11. The milling cutter of claim 1, wherein saidmilling drive shaft (10) comprises a fluid duct (23, 23', 25) leadingfrom an end of said milling shaft into said gap (22) for feeding acooling fluid into said gap (22).
12. The milling cutter of claim 11,wherein said end of said milling drive shaft (10) is a torque powerinput end with a fluted shaft end (24).
13. The milling cutter of claim1, further comprising a mounting buck (20) with bearings (19) rotatablysupporting said milling cutter (1) to form a structural unit adapted tobe mechanically coupled to at least one wheel set guide roller (26), andwherein said structural unit is position adjustable relative to said atleast one wheel set guide roller.
14. The milling cutter of claim 13,wherein said at least one wheel set guide roller (26) is also a driverroller.
15. The milling cutter of claim 1, wherein said cutting elements(6, 7) are secured to said carrier body sections so that at least aportion of at least one cutting element (7) has an overlapping cuttingrange that overlaps at least partly a cutting range of other cuttingelements (6) on its carrier body (3) and extends across said gap (22)and at least partly into a cutting range of cutting elements (6) securedto a neighboring carrier body section (4), wherein cutting ranges (15,16 17) of neighboring carrier body sections overlap (OR) each other atleast partly in different axial positions of said neighboring carrierbody sections (3, 4, 5).
16. A milling cutter for milling rail wheelsets, comprising a milling drive shaft (10), a plurality of carrier bodysections (3, 4, 5) connected to said milling drive shaft (10) so as tobe rotatable by said milling drive shaft (10), cutting elements (6, 7)secured to said carrier body sections for said milling, wherein at leastone first carrier body section (4) of said carrier body sections isdirectly and rigidly connected with said milling drive shaft (10) for adirect torque application to said first carrier body section (4),wherein at least two second carrier body sections (3 and 5) are mountedfor axial displacement relative to said milling drive shaft (10) andrelative to said first carrier body section (4) whereby a gap (22) isformed between said first and second carrier body sections, and whereinan adjustment member (31, 31A, 3A) is connected to one of said secondcarrier body sections (3 or 5) for an axial displacement of said secondcarrier body sections (3 and 5) relative to said first carrier bodysection (4) into a fixed position for cutting by adjusting a width ofsaid gap (22), said milling cutter further comprising an axialdisplacement transmitting coupling (21) between said two second carrierbody sections (3 and 5) so that an axial adjustment of one (3) of saidtwo second carrier body sections is transmitted to the other secondcarrier body section (5) and vice versa, whereby both second carrierbody sections (3, 5) are axially displaced in synchronism with eachother.
17. A milling cutter for milling rail wheel sets, comprising amilling drive shaft (10), a plurality of carrier body sections (3, 4, 5)connected to said milling drive shaft (10) so as to be rotatable by saidmilling drive shaft (10), cutting elements (6, 7) secured to saidcarrier body sections for said milling, wherein at least one firstcarrier body section (4) of said carrier body sections is directly andrigidly connected with said milling drive shaft (10) for a direct torqueapplication to said first carrier body section (4), wherein at least onesecond carrier body section (3 or 5) is mounted for axial displacementrelative to said milling drive shaft (10) and relative to said firstcarrier body section (4) whereby a gap (22) is formed between said firstand second carrier body sections, and wherein an adjustment member (31,31A, 3A) is connected to said second carrier body section (3 or 5) foran axial displacement of said second carrier body section (3 or 5)relative to said first carrier body section (4) into a fixed positionfor cutting by adjusting a width of said gap (22), further comprising aguide roller (26) coupled to said milling cutter (1) in a position forengaging a side face (13 or 29) of a wheel (28) of said wheel set to bemilled, and a hydraulic drive connected to said guide roller (26) forhydraulically positioning said guide roller against a reference face ofa wheel (28) to be milled when the milling cutter does not rotate. | 2024-03-22 | 1995-11-08 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1997-10-21"
} |
US-30057681-A | Redox battery including a bromine positive electrode and a chromium ion negative electrode, and method
ABSTRACT
A redox flow battery with a positive half-cell compartment containing bromide ion, bromine and a complexing organic liquid for bromine, and a negative electrode half-cell compartment containing chromium ion, and including electrolyte fluid communication therebetween.
BACKGROUND OF THE INVENTION
The invention relates to a redox battery, specifically including abromine positive electrode and a chromium negative electrode.
Conceptually, redox batteries are attractive for utility bulk energystorage because there are no morphology changes in the electrodes.However, none of the known redox couples combine all of the propertiesdesirable for bulk energy storage.
A number of halogen-type cells have been suggested. One such cell is azinc-bromine battery, as described in U.S. Pat. No. 4,162,351. This is aso-called hybrid form of battery because the zinc half-cell involvesplating, while the bromine half-cell is a redox type (i.e., totallysoluble). In the described system, the amount of bromine in theelectrolyte on the bromine side is maintained at a minimum by using acomplexing agent for bromine. As described therein, a preferred form ofcomplexing agent is a tetraalkylammonium salt, referred to as a bromineoil. One disadvantage of this type of cell is that the zinc half-cellincludes the inherent problems of plating.
SUMMARY OF THE INVENTION AND OBJECTS
In accordance with the present invention, a totally redox battery flowsystem is provided, including a bromine-bromide half-cell and a chromiumredox half-cell. Bromine content is minimized in the electrolyte of thepositive electrode by the use of a bromine-complexing organic liquid.
It is a general object of the invention to provide a practical battery,particularly one suitable for bulk energy applications.
It is a particular object to provide a practical, totally redox battery.
Further objects and features of the invention will be apparent from thefollowing description, taken in conjunction with the appendant drawing.
BRIEF DESCRIPTION OF THE DRAWING
The single FIGURE is a schematic representation of an electrochemicalcell in accordance with the present invention.
DETAILED DESCRIPTION OF THE INVENTION
Referring to the drawing, a schematic representation of a cell usefulfor the present invention is illustrated. This cell 10 includes abromine-bromide positive electrode 12, a redox chromium negativeelectrode 14, and a separator 16 therebetween.
The positive side aqueous phase electrolyte is circulated in line 18past an oil phase chamber 20 via a pump 22. The negative sideelectrolyte is circulated in line 24 through a reservoir 26 via pump 28.As illustrated, the transfer of Br₂ between the aqueous phase(electrolyte) and the oil phase occurs at oil chamber 20. The redoxbattery of the present invention is based upon one or both of thefollowing reactions at the positive electrode half-cell: ##EQU1## At thenegative electrode half-cell, the following redox reaction occurs:##EQU2## It is important to minimize the amount of bromine at thepositive half-cell from being transferred to the negative half-cell,because it would result in self-discharge. To accomplish thisminimization, the bromine produced in the positive electrolyte can betied up in a complexing organic liquid, such as a tetraalkylammoniumsalt. Suitable characteristics of the organic liquid and suitablehandling of the electrolyte loop of the positive electrode are describedin detail in U.S. Pat. No. 4,162,351, incorporated herein by reference.Organic complexation of the bromine allows independent control of itsaqueous phase concentration. The electrolyte loop of the positiveelectrode contains little aqueous electrolyte. During charge, theelectrolyte flows from half-cell 12 thrugh line 18 to chamber 20, wherethe organic liquid-bromine complex, in essence, subtracts the brominefrom the electrolyte before the electrolyte is returned to the positiveelectrode. In contrast, the negative electrode loop includes arelatively large reservoir 26 for the chromium salts. This reservoir issufficiently large to store enough aqueous chromium salt electrolyte tosatisfy the capacity requirements of the cell.
The reactant may be supplied in a number of convenient forms. Forexample, for economics, the chromium may be supplied in the chromouschloride, or sulfate, form. As the bromine discharges to bromide, thechromous ion converts to the chromic ion. The chromic ion and bromideions thus produced can associate with each other, together with twochloride ions, or one sulfate ion. It is preferable that in the fullydischarged state all of the negative and positive reactants are storedin the large negative electrolyte tank 26, in the form of an aqueoussolution of [Cr.sub.(aq.) ] BrCl₂ (or [Cr.sub.(aq.) ] BrSO₄). There is avery small volume of positive electrolyte which in the fully dischargedstate consists of a solution of CrBr₃ and CrCl₃ (or CrBr₃ and Cr₂(SO₄)₃) and/or HCl and H₂ SO₄.
In the fully charged state the negative electrolyte in reservoir 26 willbecome predominantly CrCl₂ (or CrSO₄), while the bromine produced in thepositive electrolyte will be stored in the complexing organic liquid.Additional electrolyte such as NaCl, HCl, Na₂ SO₄ or H₂ SO₄ can be addedto both the positive and negative electrolytes. Ionic conduction occursby bromide transfer, with possible contribution of Cl⁻ (or SO₄ ²⁻).Chloride or sulfate are electrochemically inactive in comparison to thebromide, based upon the difference in their respective redox potentials,and so contribute to conductivity but do not change valence states toany significant extent during charging or discharging.
As set forth above, it is important to minimize the transfer of brominefrom the positive half-cell to the negative half-cell. One mode ofaccomplishing this is the use of a suitable separator, while another isto use a low bromine concentration or small volume of positiveelectrolyte, storing the bromine formed in a complexing organic liquid.
Separator 16 assists to separate the bromine from the chromous ion. Itmay be formed of an anion permselective membrane of the type describedin S. A. Alexander, et al, "Anion Permselective Membrane", Ionics, Inc.,under NASA Contract DEN 3-1, March (1979). The anion membrane alsoprevents transfer of chromium cations to the positive half-cell. As setout above, ionic conduction can occur by chloride (or sulfate) andbromide transfer. Another type of membrane which may be employed is amicroporous membrane (or separator) in which the transfer of thechromous ion from the negative half-cell to the positive half-cell mayalso be minimized by providing for a high degree of conversion ofchromous to chromic ion throughout the negative electrode.
Referring to the positive electrode, the standard potential of the Br₃ ⁻/Br⁻ electrode is 1.085 volts vs. SHE (Standard Hydrogen Electrode). Thepotential is relatively invarient with pH, but it may be affectedsomewhat by the presence of chromic ion in the positive half-cell. Thebromine-bromide half-cell is known to operate at high current densitywith relatively low polarization.
Referring to the negative electrode, the potential of thechromous/chromic electrode (0.5M CrCl₃, 0.5M CrCl₂) in 1M HCl at 25° C.is about -400 mV vs. SHE.
This chromium-bromine system is advantageous in using fully solublereactants based on relatively inexpensive chemicals.
Referring to the positive electrode, suitable concentrations of bromineand suitable electrolytes are set forth in U.S. Pat. No. 4,162,351.
Referring to the negative electrode, suitable concentrations of chromiumare from 1 to 3 molar.
In another embodiment of the flow system, not shown, instead of using asingle reservoir/mixing chamber (20), an additional positive side loopfrom the illustrated reservoir 20 may be used to pass the oil phase to aspecial contacting column such as that disclosed in FIG. 17 of thepublication "Assessment of Technical and Economic Feasibility ofZn/Bromine Batteries for Utility Load-Leveling", EPRI Project 635-1,Final Report, May 1979, prepared by Gould, Inc.
In a third embodiment of the flow system, not shown, the bromine istransferred between the complexing oil and electrolyte by circulatingthe oil directly through the positive half-cell containing electrolyte.The following examples are intended to be illustrative of the use of thepresent invention.
EXAMPLE 1
The system of the type set forth in FIG. 1 is formed in the fullycharged state with electrolyte compositions as follows:
Negative electrolyte: 50 ml of 1 molar CrCl₂, 0.1 molar HCl.
Positive electrolyte: 5 ml of 1 molar CrCl₃, 0.1 molar HCl.
0.025 moles of Br₂ is initially placed in the oil phase. The Br₂ in oilbecomes equilibrated with the aqueous phase so that a small essentiallyconstant amount of aqueous Br₂ becomes available for reaction at thepositive electrode. The equilibration is effected as shown in the figureusing a single reservoir/mixing chamber. A cell with electrodes ofgeometric area 14.5 cm² (11/2"×11/2") when charged at 30 mA/cm² or 0.435amps requires an electrolyte flow in the negative half-cell of 0.5ml/min in order to obtain 50% reactant conversion in a path (two timesstoichiometric flow). A higher rate of flow is desirable at the positivehalf-cell to minimize concentration polarization. The concentrationpolarization can also be lowered by using as positive electrode a poroustype structure of sufficiently high real area. The data presented abovecan be extrapolated to a full size system taking into consideration thatthe experimental cell has a capacity of 0.8 Ah at 60% reactantutilization.
EXAMPLE 2
The procedure and apparatus of Example 1 are followed except that theelectrolyte compositions are as follows:
Negative electrolyte: 50 ml of 1 molar CrBr₂, 0.1 molar HCl.
Positive electrode: 5 ml of 1 molar CrBr₃, 0.1 molar HCl.
What is claimed is:
1. A redox flow battery comprising the combinationof a redox reaction type of positive electrode half-cell compartment anda redox type of negative electrode half-cell compartment, withelectrolyte fluid communication therebetween, said positive electrodeand negative electrode half-cell compartments being separated from eachother by an anionic permselective membrane, said positive half-cellcompartment containing an aqueous electrolyte including bromide ion,bromine, and a complexing organic liquid for bromine, and said negativeelectrode half-cell compartment containing an aqueous solution ofchromium ion capable of the following redox reaction: ##EQU3##
2. Thebattery of claim 1 together with storage means for saidbromine-containing complexing organic liquid and means to transfer thebromine between the complexing organic liquid and the positive half-cellaqueous electrolyte for reaction at the electrode of said positivehalf-cell.
3. The battery of claim 1 in which said positive half-cell iscapable of the following reaction: ##EQU4##
4. The battery of claim 1 inwhich said positive half-cell is capable of the following reaction:##EQU5##
5. In a battery comprising a redox positive half-cellcontaining an aqueous solution containing bromide ion, bromine and abromine complexing organic liquid and a redox negative half-cellcontaining chromium ion, said positive and negative half-cell beingseparated from each other by an anionic permselective membrane, thesteps of(a) periodically charging and discharging the positive half-cellcompartment according to the following redox reaction: ##EQU6## (b)periodically charging and discharging the negative half-cell compartmentaccording to the following redox reaction: ##EQU7##
6. In a batterycomprising a redox positive half-cell containing an aqueous solutionwith bromide ion, bromine and a bromine complexing organic liquid and aredox negative half-cell containing chromium ion, said positive andnegative half-cell being separated from each other by an anionicpermselective membrane, the steps of(a) periodically charging anddischarging the positive half-cell compartment according to thefollowing redox reaction: ##EQU8## (b) periodically charging anddischarging the negative half-cell compartment according to thefollowing redox reaction: ##EQU9## | 2024-03-22 | 1981-09-08 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1984-09-04"
} |
US-65996996-A | Real-time image data access from virtual memory in a digital printing system
ABSTRACT
In a real-time printing system, in which large blocks of digital data corresponding to page images must be located in a memory via a translation table and accessed from the memory within a very narrow time frame, the memory-management internal program of an operating system is overridden by external instructions which lock the translation table in memory.
FIELD OF THE INVENTION
The present invention relates to a technique for accessing data, such asimage data for a digital printing system, from virtual addresses in acomputer memory. More specifically, the present invention relates tocontrolling a UNIX® operating system with special commands to avoiddelays in the transference of data from a memory.
BACKGROUND OF THE INVENTION
In computer science, high speed digital printing presents uniquerequirements to data-processing equipment. To operate a printingapparatus which is designed to output over 100 page-size images perminute, the ability to make the desired image data available to printinghardware requires very close tolerances in the management of the"overhead" when data is transferred from memory to printing hardware. Atypical 600 spi letter-size page image, in a format suitable to besubmitted to printing hardware, is typically of a size of about 4 MB;when the printing hardware demands the image data to print theparticular page, this 4 MB of image data must be accessed from realmemory within a time frame of approximately 300 milliseconds.
It has been found, with standard implementation of the UNIX operatingsystem which is common in the art, that the various protocols and othersteps necessary to locate and initiate transfer of image data from areal memory, and in particular from a virtual address within a realmemory, often require more time than is available once the image data isdemanded by the hardware. If the image data does not reach the hardwarein time, typically a blank sheet will be output from the hardware, whichin turn will interfere with a large printing job. There is therefore aneed for a technique by which a standard operating system, such as UNIX,can be specially adapted for real-time access of image data located at avirtual address in real memory, so that the image data can be madeavailable to printing hardware precisely when it is needed.
SUMMARY OF THE INVENTION
According to the present invention, there is provided a method ofaccessing data stored in a memory having real addresses and virtualaddresses associated therewith. The memory is controlled by an operatingsystem, the operating system responding to external commands and havinginternal commands associated therewith. The operating system generates atranslation table showing relationships between real addresses andvirtual addresses in the memory. Provision is made to the operatingsystem to accept an external command directly causing the operatingsystem to begin executing an internal command to lock a portion of thetranslation table in the memory.
BRIEF DESCRIPTION OF THE DRAWINGS
In the drawings:
FIG. 1 is a simplified systems view showing elements of a prior-artreal-time digital printing system, relevant to the present invention;
FIG. 2 is a systems view of relevant elements of a real-time printingsystem, illustrating a prior-art technique of accessing page image datafrom a real memory; and
FIG. 3 is a systems view of relevant elements of a real-time printingsystem, illustrating a technique of accessing page image data from areal memory according to the present invention.
DETAILED DESCRIPTION OF THE INVENTION
FIG. 1 is a systems view showing the various elements of a high-speed(such as from 50 to 180 prints per minute) digital printing system, asrelevant to the present invention. As is well known in the art, currentdigital printing systems typically rely on one or more decomposers totranslate image data in a PDL (page description language, such asHP-PCL, or Adobe® PostScript™) or other format (such as TIFF) into aformat immediately usable by printing hardware, such as a modulatinglaser in an electrophotographic printer. A very high-end printing systemmay have several decomposers available to it, but for purposes of thepresent invention, any particular decomposer, such as indicated by 10,will output streams of uncompressed digital data into a real memoryindicated as 12. The image data, in a form ready to be applied toprinting hardware, is retained in real memory 12 until requested at agiven time by the printing hardware.
The printing hardware, which is here generally referred to as an imageoutput terminal (IOT) and indicated as 14 in FIG. 1, is controlled byprinting interface hardware, which in one embodiment of the presentinvention is in the form of an IOT interface card 16. The card 16carries out a direct memory access, or DMA, of a particular quantity ofimage data to be sent to the IOT 14, in a manner known in the art. ThisDMA causes the image data being accessed from memory to operate the IOT14 in real time to create an image, such as by causing the modulation ofa laser in a laser printer, or activating ejectors in a printhead in anink-jet printer. The exact identity of the image data requested by card16 will of course depend on what individual page image is desired to beprinted at a particular time. In a typical context of real-time digitalprinting, the IOT 14 requests a particular set of data to be deliveredto it at a specific time, such as 4 seconds into the future. In order toobtain this specific quantity of image data to print a specific pageimage, the card 16 forms a connection between the correct addressesholding the desired image data within real memory 12 and IOT 14. In acommon practical context of real-time printing, this access to thedesired data in real memory 12 must be obtained within approximately 300milliseconds.
As is known in the art of computer science, there is an importantdifference between "real memory" and "virtual memory." In the exampleshown in FIG. 1, real memory 12 is typically in the form of a randomaccess memory (RAM) from which data is accessible at high speed. Atypical size of a real memory 12 in a real-time printing context is 128MB. However, also common in any large data-processing context is theconcept of "virtual memory." A typical real-time printing system willinclude 128 MB of real memory, but as much as 4 gigabytes (4 G) ofvirtual memory. In brief, the dichotomy between real memory and virtualmemory is that, whereas real memory represents specific physicallocations in a RAM, a virtual memory is a set of addresses that can besuperimposed on the real memory addresses as needed for particularpurposes. If data is entered into real memory 12, but is not used for aparticular length of time, this data which resides in real memory 12 canbe "swapped out" from real memory 12 to another memory, such as a harddisk shown as 20. When data in real memory 12 gets swapped out elsewherein the system, it retains its virtual address, even though it hasvacated the real addresses within real memory 12. When that particularswapped-out data is be retrieved, however, the data migrates from disk20 back into real memory 12; although it may likely end up in adifferent location within real memory 12 than where it had originallybeen placed, the data is accessed from real memory 12 using its virtual,not its real, address.
It will therefore be seen that some control system must constantly keeptrack of virtual memory locations of particular data and map the virtualaddresses to real addresses within real memory 12, so that, for example,image data can be rapidly accessed by card 16. In the UNIX environment,management of real and virtual addresses of different quantities of data(such as page image data) is controlled by the UNIX operating system, or"kernel," indicated as 30. It is a built-in function of the UNIXoperating system to manage a real memory 12, decide when to write overdata or swap out quantities of data to an external memory such as 20,and also maintain a "translation table" so that the kernel 30 will knowwhat virtual addresses correspond to real addresses within real memory12 at any given time. This translation table is generated and updated asnecessary by the kernel 30 and retained in real memory 12. Thistranslation table, indicated as 32 in FIG. 1, is needed by card 16 sothat, when it is desired to retrieve a particular set of page image datahaving a certain virtual address, the card 16, working through thekernel 30, can look at translation table 32 to find the real address inreal memory 12 which corresponds to the virtual address of a particularimage data desired at a given time for sending to IOT 14. In otherwords, the card 16 must quickly identify the location of and access adesired quantity of data (such as shown as 34) in real memory 12, byconsulting the translation table 32 and transferring the data 34 to IOT14 within the necessary time constraints.
With conventional operation of a UNIX operating system such as kernel30, entries for translation table 32 are generated as needed, and placedwithin real memory 12, where they are retained only as long as needed.As mentioned above, the kernel 30, because of its ownresource-management systems, will occasionally decide to write overportions of such a translation table 32, or "swap out" certainquantities of data to an external memory such as disk 20. While it maybe desirable from the standpoint of resource management to have theoperating system kernel 30 have total control over the contents of realmemory 12, the fact that the kernel 30 could at any time write over allor a portion of the translation table 32 (or, possibly, swap it to disk20) presents a major practical problem in a real-time printing systemwhen it is necessary to access the translation table 32 within a verynarrow time constraint. Although UNIX will lock in the translation table32 prior to DMA, this automatic operation cannot always be completed inreal time. It is therefore desirable to override the basic resourcemanagement systems of the kernel 30 so that translation table 32 is"locked in" to the real memory 12. By so locking in the translationtable 32 to real memory 12, the card 16 will not be delayed when it isdesired to retrieve a quantity of data, such as 34, very quickly.
The following is a discussion of how, in the UNIX context, entries for atranslation table such as 32 can be locked in to real memory 12 and notoverwritten or swapped out to disk 20. Although, in the illustratedembodiment, translation table 32 is shown as a single entity, in certainoperating systems such as UNIX, the translation table 32 can in fact berelatively amorphous within memory 12; that is, individual entries of atranslation table 32 may be placed at various noncontiguous locationswithin memory 12.
The kernel 30 (here speaking of a UNIX system, although equivalent termsand commands may be found in other operating systems) relies on externalinstructions from, for example, driver 18, and also has its own internalcommands, invisible and customarily inaccessible to the external user,by which the kernel 30 manipulates data within real memory 12, as wellas performs any number of other functions. An important consideration isthat, in UNIX, many of these internal commands are invisible to externalusers and are generally not intended to be manipulated externally.
FIG. 2 is a simplified schematic diagram showing the relevant elementssuch as shown in FIG. 1 in the prior-art case when driver 18 commandsthe UNIX operating system to locate (through translation table 32) andultimately retrieve a desired set of image data 34 from real memory 12;FIG. 3 shows the equivalent operation according to the technique of thepresent invention. First, with reference to FIG. 2, when driver 18commands identification and retrieval of image data from real memory 12,driver 18 sends to the kernel 30 a command known as "physio", along withother identifying information. Once kernel 30 receives the physioinstruction, UNIX effectively remains "in control" of the directmanipulation of data within real memory 12. Thus, in the prior art, itis the internal programs of the kernel 30 that decide exactly when thetranslation table 32 will be consulted to identify the real memorylocation of the image data desired to be retrieved. The internalinstruction in UNIX, which is typically invisible to an external user,is "as₋₋ fault(in)." The as₋₋ fault(in) internal instruction has thespecific function of either looking for an existing translation tableentry within real memory 12, or if the entry is not available in thememory (either because it never existed, or it has been written over orswapped out) to re-generate a new translation table. In effect, the as₋₋fault(in) instruction in UNIX is an indication that a particular set ofdata in real memory 12, such as translation table 32, has been labeled"do not write over." In this specific context, the as₋₋ fault(in)instruction locks the translation table 32 at a known place in realmemory 12 and secures it at that location so it will not be overwrittenby new data entering real memory 12, swapped out to memory 20, orotherwise invalidated.
Another internal instruction in the UNIX operating system is "as₋₋fault(out)." The specific function of this command is to "free" thetranslation table 32 within real memory 12 so that it may be swapped outto an external memory, or otherwise made available to new data enteringreal memory 12: in brief, this instruction can be construed as anindication that a particular space in real memory 12 is "OK to writeover." (In current versions of UNIX, the more precise function of as₋₋fault(out) is to return the particular data to the state it was inbefore the as₋₋ fault(in) instruction. If the data in question wasalready locked for some other reason than the as₋₋ fault(in)instruction, the data will remain locked after the as₋₋ fault(out)instruction.) This as₋₋ fault(out) external instruction is typically the"last chapter" of internal instructions made in response to the physioexternal instruction used in the general case.
In currently-available versions of UNIX, there exists an instructioncalled "mlock," which is an external instruction which can be designatedin reference to a particular set of data in memory, such as a set ofdata corresponding to a page image to be printed. The function of mlockis to prevent swapping of the particular designated data set. There isalso an "munlock" command, which is an external command which "frees up"the designated data for swapping. While the mlock and munlock commandsare suitable for locking specifically designated sets of data into realmemory, these commands cannot be applied to internally-generated data inmemory, such as translation table 32. Thus, although the translationtable 32 is necessary for the DMA of image data from a particular spacein memory, the sudden loss of a relevant entry in translation table 32to overwriting will have a serious impact on the availability ofparticular image data at a particular desired time. It is thus onefunction of the present invention to provide a system whereby thetranslation table remains intact (that is, the relevant entry thereindoes not get written over) until the DMA of the particular image datadesired is complete.
If all or a portion of the translation table 32 has been overwritten,swapped out, or otherwise invalidated in real memory 12, the kernel 30must re-generate the translation table, which will require even moretime. This time of locating or re-generating a translation table 32 thusrepresents an intolerable delay in the context of real-time printing. Itis thus necessary that the translation table 32 (or at least a relevantentry therein) be locked in memory sufficiently in advance of when theimage data it relates to is required by IOT 14.
Further, with both the as₋₋ fault(in) and the as₋₋ fault(out)instructions, the time of execution for both the as₋₋ fault(in) and as₋₋fault(out) instructions is nondeterministic, i.e., the time consumed forcarrying out the instruction cannot be predicted in advance. The as₋₋fault(in) and as₋₋ fault(out) instructions each require sharedresources, often relating to other threads, within the kernel 30, andwaiting for these various resources to become available will depend onother functions taking place within the kernel 30 at the same time.Because of this nondeterministic nature of the time consumed by the as₋₋fault(in) instruction, the as₋₋ fault(in) instruction cannot be reliedupon for real-time operation at high speed.
FIG. 3 illustrates the technique according to the present invention.According to the present invention, when it is desired to command thekernel 30 to lock data in memory 12, instead of submitting the usualmlock instruction, there is implemented a special instruction herecalled "softlock." Regardless of the name of the instruction, thepurpose of this instruction is to be an external command submitted toUNIX, in response to which the UNIX operating system generates an as₋₋fault(in) internal instruction a predetermined time later. In this way,the softlock instruction effectively overrides the internalmemory-management programs of the kernel 30 itself and ensures that therelevant entry in translation table 32 is located at a known locationwithin memory 12 when needed.
A key aspect of the claimed invention is that submission of the externalsoftlock instruction causes a start of execution of the as₋₋ fault(in)instruction. With the present invention, beginning of execution of theas₋₋ fault(in) instruction is always, if not effectively instantaneous,executed at a predictable time in the future and not executed in realtime. In this way, the as₋₋ fault(in) instruction relevant to retrieve aparticular page image can be executed well in advance of a particularset of data being needed for printing, such that the as₋₋ fault(in)instruction for the relevant entry in the translation table 32 iscompleted before the entry must be consulted for a DMA of the imagedata, well in advance of the precise "window" when the image data isrequired by the IOT 14. While the system of the present invention maynot affect the absolute duration of time required to fully execute anas₋₋ fault(in) instruction, the present invention effectively removesthe as₋₋ fault(in) instruction from real-time operation. It is alsonecessary to remove the as₋₋ fault(out) instruction to make physio adeterministic procedure.
According to one preferred embodiment of the present invention, thebasic physio instruction, which in the basic case of UNIX causes aroutine including the as₋₋ fault(in) and as₋₋ fault(out) instructions tobe automatically executed, is replaced with a modified instruction, herecalled physio₋₋ rt. The physio₋₋ rt instruction works within UNIX tosuppress both an as₋₋ fault(in) instruction and an as₋₋ fault(out)instruction from being automatically executed by the operating system.It has been found that, even if the special softlock instruction is usedto lock in the translation table 32 beforehand, a subsequent regularphysio instruction will cause an automatic execution of another as₋₋fault(in) instruction. This extra as₋₋ fault(in) instruction issuperfluous because the translation table has already been locked in;nonetheless, this extra as₋₋ fault(in) instruction consumes anindeterminate amount of time even though this instruction has nothing todo. Thus, according to a preferred embodiment of the present invention,when the softlock instruction, which forces the creation of an as₋₋fault(in) instruction in response thereto, is used, a physio₋₋ rtinstruction is sent to the kernel 30 at the precise time when the DMA isto be executed, which will avoid automatic execution of a superfluousas₋₋ fault(in) instruction.
Also according to a preferred embodiment of the present invention, theremay be provided in the kernel 30 an ability to execute an "unsoftlock"instruction, "unsoftlock" being an external instruction which, whensubmitted to the kernel, causes an immediate (or within a fixedpredetermined time) start of execution of an as₋₋ fault(out)instruction, which frees the translation table 32 for writing over. Thismay be useful for allowing updates of the translation table 32 assuccessive sets of page image data enter real memory 12 or disk memory20.
In the context of digital printing, one key practical advantage of thesystem of the present invention is that the printing of a particularimage can be aborted, if necessary, if it happens that a particulardesired page image is not available in real memory 12. With a prior-artsystem, because of the narrow time constraint between physically pullingoff a sheet from a stack of paper in the printing machine and bringingthat sheet within range of IOT 14, a sudden discovery that theparticular image data is not available is likely to be noted only afterthe sheet has been drawn from the stack; when this happens, theretypically is no choice for the printing system but simply to passthrough the blank sheet past IOT 14, because IOT 14 has no image data towork with. With the present invention, however, the system can ensurethat the necessary image data to print a particular page is available inreal memory 12 (and, in effect, the pipeline can be set up) byconfirming the availability of the image data before a sheet is drawnfrom the paper supply stack.
While the invention has been described with reference to the structuredisclosed, it is not confined to the details set forth, but is intendedto cover such modifications or changes as may come within the scope ofthe following claims.
We claim:
1. A method of accessing data stored in a memory, the memoryhaving real addresses and virtual addresses associated therewith, thememory being controlled by an operating system, the operating systemresponding to external commands and having internal commands associatedtherewith, comprising the steps of:generating a translation tableshowing relationships between real addresses and virtual addresses inthe memory; causing the translation table to be retained in the memory;and providing to the operating system an external command causing theoperating system to begin executing an internal command to lock aportion of the translation table in the memory; wherein the operatingsystem is a UNIX operating system and the external command causes theoperating system to begin executing an "as₋₋ fault(in)" internal commandthe external command prevents an "as₋₋ fault(in)" internal command frombeing automatically executed by the operating system.
2. A method ofaccessing data stored in a memory, the memory having real addresses andvirtual addresses associated therewith, the memory being controlled byan operating system, the operating system responding to externalcommands and having internal commands associated therewith, comprisingthe steps of:generating a translation table showing relationshipsbetween real addresses and virtual addresses in the memory; causing thetranslation table to be retained in the memory; and providing to theoperating system an external command causing the operating system tobegin executing an internal command to lock a portion of the translationtable in the memory; wherein the external command causes the operatingsystem not to permit over-writing a portion of the translation tablewithout a further external command and the operating system is a UNIXoperating system and the external command prevents an "as₋₋ fault(out)"internal command from being automatically executed by the operatingsystem. | 2024-03-22 | 1996-06-03 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1999-01-12"
} |
US-99182392-A | Plate driver head
ABSTRACT
The disclosure relates to a plate driver head and more specifically to a plate driver head for use with a power impact tool. The plate driver head includes a steel head portion and a shank portion which can be received in most commercially available power impact tools. The drive head is provided with supporting gussets on opposite sides of the shank which extend to the upper surface of the head to provide uniform pressure distribution over the entire head work surface. The head is magnetized to hold the workpiece steady while being inserted into a surface. Several embodiments are disclosed, one of which is a flat uninterrupted work driving surface while another embodiment includes a recess in the driving surface to accommodate different configured workpieces without damaging them during the insertion procedure.
CROSS-REFERENCE TO RELATED APPLICATION
The subject matter of the instant application is related to BuildingEnclosure Assemblies, of the type disclosed in commonly-ownedapplication Ser. No. 07/904598, filed Jun. 26, 1992.
BACKGROUND OF THE INVENTION
There is presently considerable interest in the commercial buildingindustry in demountable wall systems wherein after a wall system hasbeen installed it may, after a given period of time, be desired torelocate or completely remove the wall system which has been installedwithout destroying the materials used in the wall system. There is alsoconsiderable interest in a gypsum-fiber wallboard which is made ofground, shredded, waste paper with a gypsum binder and produced into theusual four foot by eight foot or four foot by twelve foot sheets.
The related above-identified co-pending application is directed to sucha demountable wall system using either traditional wallboard material orthe gypsum fiber wallboard just described. Additionally, instead of thetypical metal "C - studs" frequently used, a specialized stud shape inthe general configuration of two hollow isosceles triangles joined by aweb member is utilized in this type of wall system. This "hourglass"shaped stud member includes slots to receive clips which are required inthis type of construction.
In order to securely attach these clips to the wallboard members,pronged nail plates are required to be securely fastened atpredetermined locations to the back sides of the wallboard sectionswhich make up the wall system. It is this particular use for which theinstant invention has been developed. However, it may find use in manyother areas of the construction industry as well.
SUMMARY OF THE INVENTION
The present invention relates to a plate driver head which includes ashank portion that can readily be received in a conventionalcommercially available power impact tool. As indicated above, the platedriver head finds particular use in a demountable wall system wherepronged nail plates are required to be inserted into the rear face ofwallboard at predetermined locations to facilitate attachment of clipsthereon. The plate driver head comprises a rectangular steel headportion and a shank portion extending perpendicularly therefrom.Reinforcing gussets are provided on each side of the shank portion andsecurely welded to the head and shank portion to provide stability andsupport when in use. The head portion is magnetized to enable the userto merely grasp a pronged plate with the prongs facing away from him,place the flat portion of the pronged plate against the magnetized headand then, using both hands, grasp the impact tool securely and pull thetrigger and hold it back until the pronged plate is driven flush withthe wallboard surface.
One embodiment of the plate driver head is flat over the entire surfacewhile another embodiment has a central raised portion therein toaccommodate different configurations of pronged plates.
OBJECTS OF THE INVENTION
An object of the invention is to provide a tool which facilitates theinsertion of pronged plates into wallboard.
Another object of the invention is to provide a tool having a standardshank size permitting its use with commercially available power impacttools.
A further object of the invention is to provide a plate driver headwhich applies uniform pressure over the entire surface of the drivenobject without damaging the wallboard.
Yet another object of the invention is to provide a plate driver headwhich is magnetized to hold the driven object thus freeing the user'shand.
Another object of the invention is to provide a plate driver head whichwhen used with a power impact tool permits the fast and efficientinstallation of pronged nail plates.
A still further object of the invention is to provide a plate driverhead which can accommodate pronged plates having raised portions withoutdamaging the raised portions thereon.
These and other objects of the invention will become more apparenthereinafter. The instant invention will now be described with particularreference to the accompanying drawings which form a part of thisspecification wherein like reference characters designate thecorresponding parts in the several views.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a perspective view illustrating the manner of using the novelplate driver head.
FIG. 2 is a perspective view of the novel plate driver head per se.
FIG. 3 is a plan view of the underside of another embodiment of theplate driver head.
DETAILED DESCRIPTION OF THE DRAWINGS
Referring now to FIG. 1, there is shown a perspective view of the impacttool 10 which is a standard commercially available tool of the powerimpact type. As illustrated, the novel plate driver head has beeninserted into the holder of impact tool 10.
Plate driver head 20 includes a flat driving plate portion 19 which hasa shank 18 extending upwardly therefrom at a right angle. A pair oftriangular gussets 17 are used to provide lateral support to shank 18relative to driving plate portion 19. The base of gussets 17 serves todistribute the impact over driving plate portion 19 thus ensuringuniform force distribution over pronged nail plate 25. In order to allowthe user to place both hands on impact tool 10 during the drivingoperation, plate driving portion 19 is magnetized to securely hold nailplate 25 in contact with driving plate portion 19 once so placed. Weldbeads 16 are used to interconnect gussets 17 with shank 18 and drivingplate 19.
As illustrated in FIG. 1, pronged nail plate 25 has been placed intocontact with driving plate portion 19 in preparation for driving prongednail plate 25 into wallboard 30. Driving plate portion 19 conforms tothe dimensions of pronged nail plate 25 providing full contact with theentire surface of pronged nail plate 25 and uniform pressuredistribution, resulting in a smooth insertion of pronged nail plate 25into wallboard 30.
Turning now to FIG. 2, there is shown an illustration of the platedriver head 20 and a closer view of pronged nail plate 25. As indicatedabove, driving plate portion 19 is magnetized and the illustration isprior to pronged nail plate 25 being brought into contact with drivingplate portion 19. Although not shown in this view, the bottom surface ofdriving plate portion 19 is an uninterrupted flat surface which permitsfull surface contact with pronged nail plate 25. Pronged nail plate 25is a commercially available steel nailing plate wherein prongs 26 havebeen punched out in the manufacturing process. Prongs 26 serve as theanchoring means for pronged nail plates 25 after it has been driven intowallboard 30.
Referring now to FIG. 3, there is illustrated a bottom view of anotherembodiment designated 20A. The structure of plate driver heads 20 and20A is identical except for the contour of the bottom driving surface.As shown in FIG. 3, bottom surface 21 is discontinuous to provide acentral raised portion 22 which begins with two tapered surfaces 23which taper inwardly at an angle of forty five degrees toward thecenterline of shank 18 with a flat horizontal surface 22 interconnectingthe lower ends of said tapered surfaces 23.
The embodiment of FIG. 3 is provided to accommodate pronged nail plateswhich have a raised central portion which is received in raised centralportion 22 of plate driver head 20A. Driver plate head 20A is also madeof steel and is magnetized for use in the same manner as set forth inthe description of FIGS. 1 and 2.
It can readily be seen that applicant's novel plate driver heads 20 and20A provide a means whereby a workman can with a minimum amount of timeand effort quickly and efficiently install a number of pronged nailplates 25 without damage to the wallboard or the pronged nail plates 25.
While the invention has been described in its preferred embodiments, itis to be understood that the words which have been used are words ofdescription rather than limitation and that changes may be made withinthe puriew of the appended claims without departing from the full scopeor spirit of the invention.
Having thus described my invention, I claim:
1. An apparatus for drivinga plate comprisinga hand held power impact tool, a plate driver head foruse with said hand held power impact tool wherein said plate driver headcomprises a driving means having an upper surface and a lower surface; ashank portion centrally positioned on said upper surface and extendingperpendicularly therefrom; pressure distribution and support meanssecurely attached to said upper surface of said driving means and saidshank portion, and holding means for holding a workpiece in placerelative to said plate driver head; said holding means defined by a pairof oppositely disposed planar surfaces in a first plane separated by acentrally located intermediate planar portion in a second plane havingtransition portions connecting said three planar surfaces whereby afterinserting said shank portion into a power impact tool and placing aworkpiece against the lower surface of said driving portion means anoperator can hold a workpiece and by depressing the actuating means ofsaid power impact tool drive said workpiece into a wallboard panel. 2.An apparatus for driving a plate as defined in claim 1 wherein said twooppositely disposed planar surfaces are on the same plane and saidintermediate planar portion is parallel thereto.
3. An apparatus fordriving a plate as defined in claim 1 wherein said pressure distributionand support means includes gusset means which are welded to said shankportion and said upper surface of said driving means thereby providing auniform distribution of force to said flat driving head means.
4. Anapparatus for driving a plate as defined in claim 3 wherein said gussettmeans comprises a plurality of triangular members, each having a baseand a side portion interconnected by a hypotenuse portion; said baseportion securely attached to said upper surface of said driving meansand said side portion securely attached to said shank portion byweldments along points of contact.
5. An apparatus for driving a plateas defined in claim 4 wherein the number of said plurality of triangularmembers is two with each of said triangular members oppositely disposedrelative to said shank portion.
6. An apparatus for driving a plate asdefined in claim 1 wherein said holding means is made of steel and hasbeen magnetized to attract and securely hold metallic objects which havebeen brought into contact therewith.
7. An apparatus for driving a plateas defined in claim 1 wherein said pressure distribution and supportmeans includes gusset means which are welded to said shank portion andsaid upper surface of said driving means thereby providing a uniformdistribution of force to said driving means.
8. An apparatus for drivinga plate as defined in claim 7 wherein said gussett means comprises aplurality of triangular members, each having a base and a side portioninterconnected by a hypotenuse portion; said base portion securelyattached to said upper surface of said driving means and said sideportion securely attached to said shank portion by weldments alongpoints of contact.
9. An apparatus for driving a plate as defined inclaim 8 wherein the number of said plurality of triangular members istwo with each of said triangular members oppositely disposed relative tosaid shank portion.
10. An apparatus for driving a plate as defined inclaim 1 wherein said holding means is made of steel and has beenmagnetized to attract and securely hold metallic objects which have beenbrought into contact therewith. | 2024-03-22 | 1992-12-16 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1994-03-08"
} |
US-16800062-A | Grinding machine and wheel dresser therefor
April 1963 o. CARLSEN ETAL 3,086,508
GRINDING MACHINE AND WHEEL DRESSER THEREFOR Original Filed 001:. 18,1960 4 Sheets-Sheet 1 FIG. I
INVENTORS LEONARD 0-. CARLSEN y THOMAS A. DEPREZ ATTORNEY April 3, 1963L. o. CAYRLSEN ETAL 3,086,508
GRINDING MACHINE AND WHEEL DRESSER THEREFOR Original Filed Oct. 18, 19604 Sheets-Sheet 2 FIG. 2
M5 T W! I g2 u Hm! 40 II I ul 38 4 I l 44..
'H"" r M8 8 April 1963 1.. o. CARLSEN ETAL 3,086,508-
GRINDING MACHINE AND WHEEL DRESSER THEREFOR Original Filed Oct; 18',1960 4 Sheets-Sheet 3 FIG. 5 am April 1963 L. o. CARLSEN ETAL 3,086,508
GRINDING MACHINE AND WHEEL DRESSER THEREFOR Original Filed Oct. 18, 19604 Sheets-Sheet 4 .FIG. 6
FIG. 7
2 & on 7 241 no: 7A-25o 2' F|G.8 I f 2 5a- 2 4 243 234 23s in. W 232 253I United States Patent Ofiice 3,086,508 Patented Apr. 23, 1963 11Claims. (Cl. 12511) The present invention relates to a cutter sharpeningmachine or like machine employing a grinding wheel and a wheel dressertherefor, and is a division of our copending application Serial No.63,414, filed October 18,1960.
A machine according to the invention has a grinding wheel with a conicalface, a dresser wheel whose axis is approximately parallel to a coneelement of said conical face, said dresser wheel having a cylindricalsurface for dressing said conical face and a surface of decreasingradius and concave profile for dressing an edge radius on the grindingwheel, means for guiding the dresser wheel for motion (a) in a radialdirection toward and away from said cone element to dress said edgeradius with said surface to concave profile and return, and for motion(b) approximately in the direction of the axis of the dresser wheel todress said conical face with said cylindrical surface.
In the preferred embodiment of the invention shown in the accompanyingdrawings:
FIGS. 1 and 2 are respectively side and front views of the machine;
FIG. 3 is a section in plane 3'3 of FIG. 4;
FIGS. 4 and 5 are vertical sections respectively in planes 4--4 and 5-5of FIG. -1;
FIG. 6 is a front view of the wheel dresser mechanism, parts of whichappear on a smaller scale in FIGS. 1 and 2;
FIGS. 7 and 8 are sectional views taken respectively in planes 77 and 88of FIG. 6.
Referring to FIGS. 1 and 2, the machine comprises a frame 30 on which agrinding wheel W is mounted for reciprocation longitudinally, asindicated by arrow 31, to cause its conical face 32 to traversesharpening plane 33 of a cutter C to be sharpened, which is alsosupported by the frame. The mounting of the wheel includes a column 36adjustable laterally of the frame, as indicated by arrow 37, and abracket 39 movable vertically on the column, as indicated by arrow 38. Awheel head 43 .is adjustable as indicated by arrow 45 in a directionperpendicular to both axis 42 and the wheel rotation axis, designated44. The wheel is driven by motor 40 carried by the head 43.
A cutter head bracket 46 is mounted on the frame, beneath the grindingwheel, for adjustment about transverse axis 47. On this bracket a cutterhead 48 is pivotally adjustable about an axis 49 which is perpendicularto axis 47. A housing 51, for spindle 52 which supports the cutter C, isadjustable in the head 48 in the direction of the spindle axis 53 andalso angularly about that axis.
The machine is adapted to sharpen either right or left hand cutters bymounting the grinding wheel either in the position shown at W in fulllines or at W in broken lines in FIG. 2, and by adjusting the wheel headand support, 43, 41, about axis 42 so that the wheel axis is in position44 or 44. In these respective positions the conical face 32 of the wheeltraverses sharpening planes 54 and 54' as the wheel strokes back andforth in direction 31, these planes being parallel to axis 42. In bothcases the periphery of the wheel traverses a two nuts to urge themapart.
plane, designated 55, which is perpendicular to planes 54, 5 4 andparallel to axis 42.
FIGS. 3 and 4 show the mechanism by which the wheel feed and returnmotions 45, FIG. 2, are accomplished. In the wheel head 43 is journaledthe spindle 171 on either end of which the wheel W may be mounted. Thewheel head is supported on ball-sleeve bearing 172 for motion in wheelhead support 41 in direction 45, perpendicular to axis 44 of thespindle. Prior to each wheel dressing operation a ratchet mechanism isoperated to lower the wheel in direction 45 by a predetermined distance.This ratchet mechanism comprises a piston 173 movable in one directionin a cylinder in the wheel head support by hydraulic pressure applied tocylinder chamber 174, and in the return direction by a spring 175 whenthis pressure is released. A pawl 176 pivoted at 177 to the piston isurged by a spring 178 into engagement with a ratchet wheel 179. Uponreturn motion the pawl engages a stud 181 and is thereby pivoted out ofengagement with the wheel 17-9. The latter has secured thereto a nut 182which is threaded onto a screw 183 secured to the wheel head 43. Toeliminate backlash between the nut and screw, and to frictionallyprevent unintentional retrograde motion of the ratchet wheel when thepawl is released, a nut 184 also threaded to the screw is keyed to thenut 182 for axial motion relative thereto, and a spring washer 185 isdisposed between the When the limit of downward wheel feed has beenreached, and the wheel W is to be replaced, upward return motion of thewheel head 43 may be effected by manually turning the ratchet wheel andnut assembly by means of a wrench applied to socket 186 of the ratchetwheel.
FIG. 5 illustrates the mechanism for effecting the motions 38, FIG. 2,for vertical adjustment of the grinding wheel W and for elevating it topermit indexing the cutter, mounting and removal of the cutter, anddressing of the wheel. A cylinder member 191 is secured to the column 36and slidable in the cylinder bore there is a piston 192 having at itsupper end a flanged nut 193 adapted to seat on a ring 194 supported bycylinder head 195. The nut is threaded to a screw 196 journaled forrotation in a radial and axial thrust bearing 197 secured to the bracket39. On screw 196 is a bevel gear 198 meshing with a pinion 199 rotatablein the bracket. By manual rotation of the pinion, by means of a suitablewrench, the bracket may be raised or lowered to bring the periphery ofthe wheel into tangency with reference plane 55, FIGS. 1 and -2. A cover201 which telescopes over the column 36, is movable as a unit with thebracket. An annular piston 202 in the cylinder is slidable on the piston192 and is adapted for abutment by shoulder 203 of the latter. Slidablein the piston 192 is a tappet 204 urged downwardly relative to thepiston by a spring 205, the bottom of the tappet being adapted to rideon a cam or ring on a shaft 206 which is rotatable and also axiallyshiftable in the column 36. The tappet is shown as seating on a ring 207concentric with shaft 206, but by manually-effected axial shifting ofthe shaft, to the left, a cam 208 secured on the shaft may be broughtbeneath the tappet. Also secured to the shaft is a ratchet wheel 209.
By application of hydraulic pressure through lines 210 and 211 tocylinder chambers 212 and 213, piston 202 is held in its down limitposition shown, and piston 192 is elevated until its shoulder 203 abutspiston 202. This elevates the bracket 39 to indexing position, whereinthe wheel W is clear of the cutter being sharpened. By release ofpressure from line 210, pressure in chamber 213 will further raise thepiston 192 and cause it to lift the piston 202 into abutment withcylinder head 195. This elevates the bracket 39 to the position whereina a cutter may be loaded or unloaded and wherein the wheel W is dressed.From either elevated position the piston 192 is lowered by placing line211 on exhaust and applying pressure through line 214 to chamber 215.Lowering is rapid throughout most of the stroke because spring 205 haslowered the tappet 204 relative to the piston, so that land 216 of thetappet allows fluid exhaust through port 217 in the piston and passage218 to line 211, but is slowed when the tappet abuts and is arrested byring 207 (or cam 208). This shifts the piston relative to the land, toclose off port 217 and cause the exhaust from chamber 213 to be througha flow restrictor 219. A check valve 221 is closed throughout loweringof the piston but is open while the piston is being elevated.
Ring 2117 is utilized to limit the down motion of the grinding wheel inthe case of cutters to be sharpened toa constant depth. In otherinstances, where different blades around the cutter are to be ground todifferent depth, a cam 298 especially designed for such cutter isutilized. By means of ratchet wheel 209 and an actuator for it operatingin time with the index means for the cutter spindle, the rotation of thecam 208 is correlated with indexing rotation of the cutter. The ratchetwheel actuator may be generally similar to that shown in FIG. 3, and behydraulically connected to the actuating piston of the cutter spindleindex mechanism, described hereinafter.
The dressing mechanism for the grinding wheel appears only partially inFIGS. 1 and 2, and is shown in detail in FIGS. 6 to 8. It comprises adiamond-impregnated dresser wheel 231 having a cylindrical surface 232for dressing the conical face 32 of wheel W as shown in full lines inFIG. 6 and a concavely radiused surface 233 for dressing a convex edgeradius on the wheel as shown in broken lines in the same view. Thedresser wheel is journaled for rotation in a dresser arm 234, and isdriven by a motor 235 mounted on bracket 39, the drive being through aflexible cable 236 encased in a flexible sheath 237, a bevel pinion 238journaled in arm 234, and bevel gear 239 rotatable as a unit with thewheel. Arm 234 is secured to a piston rod 241 journaled on ballsleevebearings 242 for both angular and axial motion in a cylinder housing243. A piston 244 afiixed to the rod is movable axially by means ofhydraulic pressure alternately applied to chambers 245 and 246. Thismotion is limited by abutment of end flange 247 of the piston rod withstop 248 and cylinder head 249.
An internal gear segment 251 secured to the piston rod 241 meshes with apinion 252 rotatable on a stub shaft 253 affixed to the cylinder housing243. Also meshing with the pinion is a rack 254 on the rod of a piston255. The latter is reciprocated by alternate application of hydraulicpressure to chambers 250 and 257 to respectively swing the arm 234 upand down about axis 256 of piston rod 241, the limit positions beingdetermined by abutment of the piston 255 with cylinder heads 25S and259.
The dressing is accomplished by the two wheels W and 231 being motordriven, at different peripheral speeds. To begin dressing the wheelstroking mechanism is operated to move the wheel W in direction 31, FIG.1, into the same vertical plane as the dressing wheel 231 and the wheelW is raised as a unit with bracket 39 to dressing position by hydraulicpressure applied through lines 210 and 211, FIG. 5. By application ofpressure to chamber 257, FIG. 7, the dresser wheel 231 is lowered.Ratchet wheel 179, FIG. 3, is advanced one pitch by application ofpressure to chamber 174, to feed the Wheel downwardly in direction 45,FIGS. 2 and 4; and the dresser wheel 231, in its lower, broken lineposition in FIGS. 6 and 7, is shifted to the left in FIGS. 6 and 8 bypressure applied to chamber 246, to thereby dress the edge radius of thewheel W. This motion is such that the dresser wheel axis 261 as viewedin FIG. 6 shifts from the right side of the vertical plane through axis42 to position 261 to the left of said plane. The dresser wheel is thenreturned, to the right, by pressure applied to chamber 245, and then israised, by pressure applied to chamber 259, to dress the conical surface32 of wheel W. Pressure is released from chamber 174, FIG. 3, causingreset motion of pawl 176, and the bracket 39 is lowered by piston 192 tobring the wheel W to the reference plane 55, FIG. 1. When the wheel isin position W, FIGS. 2 and 6 for sharpening a left hand cutter, thedressing action is the same, except that application of pressure tochambers 245 and 246, FIG. 8, is reversed, so that the edge radius ofthe grinding wheel is dressed by motion of the dresser wheel to theright. That is, as viewed in FIG. 6, the dresser wheel axis shifts fromposition 261 to position 261.
At the conclusion of dressing the bracket 39 and wheel W are lowered togrinding position, wherein the wheel periphery touches plane 55, bypiston 192, FIG. 5.
Having now described our improved machine, and its operation, we claimas our invention:
1. A machine adapted to support a substantially frusto-conical grindingwheel in either of two positions, with the wheel axis in one positionintersecting the line of the wheel axis in the other position, and withthe conical surface of the wheel in said two positions intersecting inparallel lines the common plane of the lines of the wheel axis in saidtwo positions, the machine supporting a dresser wheel with its axis in aplane parallel to and between said lines, said dresser wheel having acylindrical surface for dressing the conical face of the grinding wheeland a surface of decreasing radius and concave profile for dressing anedge radius on the grinding wheel, means for guiding the dresser wheelfor motion (a) of its axis substantially in said common plane andperpendicular to the dresser wheel axis to dress the edge of thegrinding wheel, in either position of the latter, with said surface ofconcave profile and to bring said cylindrical surface substantially toeither one of said parallel lines of intersection, and for motion (b)approximately in the direction of the axis of the dresser wheel to dressthe conical surface of the grinding wheel with said cylindrical surface.
2. A machine according to claim 1 in which there are means to limit thestroke of motion (a) in both directions, the dresser wheel at one limitbeing positioned to dress the edge radius of the grinding wheel in oneposition of the latter and the conical face of the grinding Wheel in theother position thereof, and the dresser wheel at the opposite limitbeing positioned to dress the edge radius of the grinding wheel in saidother position and the conical face of the grinding wheel in said oneposition.
3. A machine adapted to support a substantially frustoconical grindingwheel in either of two positions, with the wheel axis in one positionintersecting the line of the wheel axis in the other position, and withthe conical surface of the wheel in said two positions intersecting inparallel lines the common plane of the lines of the wheel axis in saidtwo positions, the machine supporting a dresser wheel with its axis in aplane parallel to and between said lines, means for guiding the dresserwheel for motion (a) of its axis substantially in said common plane andperpendicular to the dresser wheel axis to bring the periphery of thewheel to either one of said lines, and for motion (b) approximately inthe direction of the axis of the dresser wheel to dress the conicalsurface of the grinding wheel.
4. A machine according to claim 3 in which there are means to limit thestroke of motion (a) in both directions, the periphery of the dresserwheel at one limit being positioned to dress the grinding wheel in oneposition of the latter and at the other limit being positioned to dressthe grinding wheel in the other position thereof.
5. A dresser for a grinding wheel comprising a housing having twocylinders with their axes at right angles, a first piston reciprocabieand angular movable in one cylinder, said piston having an arm thereoncarrying a dresser tool, a second piston reciprocable in the secondcylinder, and gearing connecting said pistons to cause the first pistonto be oscillated angularly by and upon reciprocation of the secondpiston.
6. A dresser according to claim 5 in which said gearing comprises a rackcarried by the second piston, a pinion meshing with the rack andsupported for rotation in the housing, and a gear meshing with thepinion and carried by the first piston.
7. A machine having a grinding wheel with a conical face, a dresserwheel whose axis is approximately parallel to a cone element of saidconical face, said dresser wheel having a cylindrical surface fordressing said conical face and a surface of decreasing radius andconcave profile for dressing an edge radius on the grinding wheel, meansfor guiding the dresser wheel for motion (a) in a radial directiontoward and away from said cone element to dress said edge radius withsaid surface of concave profile and return, and for motion (b)approximately in the direction of the axis of the dresser wheel to dresssaid conical face with said cylindrical surface.
8. A machine according to claim 7 in which said motion (b) is in an arctangent to the axis of the dresser wheel about a pivot axis remote fromthe dresser wheel and perpendicular to said cone element and to therotation axis of the dresser wheel.
9. A machine according to claim 8 in which the means for guiding thedresser wheel comprise a housing, an arm movable angularly on thehousing about said pivot axis for efiecting said motion (b), and saidarm being movable relative to said housing along said pivot axis forefiecting said motion (a).
10. A machine according to claim 9 in which there is a fluid actuatedpiston which carries said arm and is reciprocable in a cylinder in thehousing for effecting said motion (a), the axis of said cylinderconstituting the pivot axis of the arm, and there is a second fluidactuated piston reciprocable in said housing and connected to the firstpiston for oscillating it about said pivot axis for effecting saidmotion (b).
11. A machine according to claim 10 in which the connection between thepistons comprises a rack carried by the second piston, a pinion meshingwith the rack and supported for rotation 'by the housing, and a gearmeshing with the pinion and carried by the first piston.
References Cited in the file of this patent UNITED STATES PATENTS1,467,985 Schuvr Sept. 11, 1923 2,067,531 Indge Jan. 12, 1937 2,086,750.Tanner July 13, 1937 2,171,902 1 Wood Sept. 5, 1939 2,323,401 JohnsonJuly 6, 1943 2,565,013 Bargren Aug. 21, 1951 2,697,426 Price et al. Dec.21, 1954 2,792,672 Carlsen et al. May 21, 1957 2,826,008 Dunn Mar. 11,1958 2,963,017 Norel et al. Dec. 6, 1960 2,972,343 Dunn Feb. 21, 1961
7. A MACHINE HAVING A GRINDING WHEEL WITH A CONICAL FACE, A DRESSERWHEEL WHOSE AXIS IS APPROXIMATELY PARALLEL TO A CONE ELEMENT OF SAIDCONICAL FACE, SAID DRESSER WHEEL HAVING A CYLINDRICAL SURFACE FORDRESSING SAID CONICAL FACE AND A SURFACE OF DECREASING RADIUS ANDCONCAVE PROFILE FOR DRESSING AN EDGE RADIUS ON THE GRINDING WHEEL, MEANSFOR GUIDING THE DRESSER WHEEL FOR MOTION (A) IN A RADIAL DIRECTIONTOWARD AND AWAY FROM SAID CONE ELEMENT TO DRESS SAID EDGE RADIUS WITHSAID SURFACE OF CONCAVE PROFILE AND RETURN, AND FOR MOTION (B)APPROXIMATELY IN THE DIRECTION OF THE AXIS OF THE DRESSER WHEEL TO DRESSSAID CONICAL FACE WITH SAID CYLINDRICAL SURFACE. | 2024-03-22 | 1962-01-09 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1963-04-23"
} |
US-82716792-A | Centrifugal type acceleration measuring device
ABSTRACT
An acceleration measuring system wherein acceleration transducers are mounted on a turntable supported by an air bearing and directly driven by a brushless motor. The output signals generated by the acceleration transducers are amplified by amplifiers mounted on the turntable and the output signals are converted to digital signals by an analog-to-digital converter also mounted on the turntable. The digital signals are modulated into AC signals by a modulator also mounted on the table and then transmitted to a demodulator on a fixed portion of the system through a rotary transformer. The output of the demodulator representing the acceleration signal is applied to digital-to-analog converters and also to a binary coded decimal converter. In an alternative embodiment, the acceleration transducers are mounted on individual separate turntables which in turn are mounted on a primary turntable. The individual turntables are each separately and individually driven by brushless motors and the primary turntable is also directly driven by a brushless motor.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a centrifugal type acceleration measuringdevice, and more particularly a centrifugal type acceleration measuringdevice in which a turn-table having a measured acceleration transducermounted thereon is rotationally driven by a motor to apply anacceleration to the acceleration transducer, an output of theacceleration transducer is properly processed for its signal and thenthe signal is transmitted to a fixed part to perform a measurement ofthe acceleration in a highly accurate manner.
2. Description of the Related Art
A centrifugal type acceleration measuring device in the prior art isoperated such that a turn-table is rotated in a horizontal plane, ameasured acceleration transducer (hereinafter called as "an accelerationtransducer") is fixed to an outer circumference of the turn-table, theturn-table is rotated, a centrifugal acceleration is given to theacceleration transducer on the turn-table, an output characteristics atthis time is inspected and measured.
In such a centrifugal type acceleration measuring device as describedabove, an induction electric motor is used as a motor for rotationallydriving the turn-table, its rotating power is transmitted through abelt, a multi-stage gear box and a clutch or the like and in case ofstopping the rotation of the turn-table, a braking action is applied tothe motor through a brake.
In addition, a control over the rate of rotation of the motor is alsocarried out under an open-loop system.
In turn, rotational supporting of the turn-table is also carried outmechanically by a ball bearing.
As the turn-table is rotated, the acceleration transducer detects acentrifugal acceleration. This detected output is transmitted to ameasuring system through a signal transmitting system. In this signaltransmitting system, an analogue transmitting system performed by meansof mechanical contact between a slip ring and a brush due to the factthat the turn-table is being rotated and the measuring system is mountedat a stationary location.
The detected output passed through this transmitting system is inputtedinto the measuring system in its analogue signal form and converted intoa digital signal; thereafter the converted signal passes through aninput/output circuit and is inputted to a central processing unit(hereinafter called as "CPU").
After a predetermined analyzing process is carried out at the CPU, aresult of analyzing action is displayed at a display device or printedout in a printer.
In addition, electrical power is normally supplied the accelerationtransducer disposed on the turn-table through a slip-ring system.
In view of the foregoing, as a calibration method for the accelerationtransducer, a comparing calibration system and an absolute calibrationsystem are employed by an official in inspection organization.
The comparing calibration system is operated such that a referenceacceleration transducer and a calibrated acceleration transducer areintegrally fixed on the same reciprocating vibrator device so as toapply a vibration and the calibrated acceleration transducer iscalibrated at a vibration acceleration calculated in response to anoutput from the reference acceleration transducer.
In addition, the aforesaid absolute calibration system is operated suchthat a calibrated acceleration transducer is fixed on a reciprocatingtype vibrator so as to apply a vibration, a displacement amplitude atthat vibration is accurately measured by a laser interferometer, avibration acceleration or the like is calculated in reference to avibration frequency (number of vibration oscillations per unit time) andthen the calculated acceleration is applied as a reference acceleration.
As an additional calibration method of the acceleration transducer, theaforesaid centrifugal type is proposed and this process is notofficially acknowledged as a calibration method.
In the prior art centrifugal type acceleration measuring device, atfirst, an induction motor or the like is used in the rotary drivingsystem for the turn-table, resulting in that a sliding noise of thebrush may occur and has a disadvantage that it is mixed in the detectedoutput. In addition, driving transmission is carried out through a belt,a multi-stage gear box and a clutch or the like, resulting in that itssize is increased, its vibration is added to the turn-table and then anaccurate acceleration is hardly given to the acceleration transducer.
In addition, since the transmitting system for the detected output isalso constructed as a mechanical analogue type transmitting systemhaving a slip-ring or a brush, it is not avoidable to have frictionalwear at the sliding part, poor contact at the sliding part andoverlapping of noise accompanied by the contact on the detected output.
Further, supplying of an electrical power to the measuring system isalso carried out by means of sliding system using the slip-ring or abrush, so that its wear is not avoidable.
In turn, in the case the of the acceleration measuring device of theaforesaid comparing type, it has a disadvantage that its calibrationaccuracy is 2% within a frequency range of 0.5 Hz to 5 KHz and it showsa quite low value of 5% within a frequency range of 5 Hz to 10 KHz.
In addition, the aforesaid absolute calibration system accelerationmeasuring device has a disadvantage that its calibration accuracy is ahigh value of about 1% within a frequency range of 20 Hz to 5 KHz andits use can not be carried out at a frequency range of lower than 20 Hzand a desired accuracy may not be satisfactory.
That is, as the device for calibrating the value, it is desirable thatits accuracy is high, but in view of its mechanical configuration and acircuit configuration, there is a certain limitation. At present, sincean accuracy less than 0.5% is required, it must be said that theaforesaid comparing calibration system measuring device is not adoptedas a calibrating device and in turn, in the case of the absolutecalibration system measuring device, although this is adopted in afrequency range of 20 Hz to 5 KHz of the calibrating device, aconfiguration of the calibration system requires a vibrator; asynthesizer and a power amplifier for driving the vibrator; a lasergenerating device, two fixed mirrors, one vibrating mirror, one beamsplitter, an opto-electrical converter, a counter, a filter, a voltmeterfor use in detecting a displacement amplitude of vibration; a loadamplifier and a voltmeter for measuring an output from a calibratedacceleration transducer; and a computer for controlling in drive ofthese systems as well as for its calculation and a displaying control orthe like, so that it becomes quite complex, large in size and it isexpensive and further it has a disadvantage that its measuring operationis complex.
In addition, this absolute calibration system device also has a fataldisadvantage for calibration at a frequency range of 20 Hz or less and 5KHz or more.
SUMMARY OF THE INVENTION
This invention has been completed in view of the foregoingcircumstances, and it is an object of the present invention to provide acentrifugal type acceleration measuring device in which a uselessvibration is not generated at or given to the turn-table and so apredetermined acceleration can be accurately given to the measuredacceleration transducer.
It is another object of the present invention to provide a centrifugaltype acceleration measuring device in which a detected output of arotating acceleration transducer can be accurately transmitted to afixed side without generating any noise in the signal transmittingsystem when the output is transmitted to the fixed side.
It is a still further object of the present invention to provide acentrifugal type acceleration measuring device in which a measuredacceleration transducer can perform not only a static accelerationmeasurement but also a dynamic acceleration measurement (a calibration)and further a high precision measurement at a wide frequency rangeincluding a low frequency of 0 to 20 Hz which is assumed to beimpossible in the prior art and its configuration is simple and itsoperation is also facilitated.
The invention is characterized in that there are provided a turn-tabledirectly driven by a brushless motor and having an accelerationtransducer mounting part for use in fixing the measured accelerationtransducer formed at a location displaced from a center of rotation, anair bearing for rotatably supporting the turn-table, a stored amplifierfor respectively amplifying an output of the acceleration transducerfixed to the acceleration transducer mounting part of the turn-table anda rotary transformer for transmitting each of signals outputted from thestored amplifier to the fixed side in order to accomplish the aforesaidfirst and second objects, wherein the rate of revolution of thebrushless motor is varied to apply a predetermined acceleration to themeasured acceleration transducer and an output from the measuredacceleration transducer is fed out to the fixed side through the rotarytransformer.
The invention is further is characterized in that there are provided aturn-table directly driven by a brushless motor and having anacceleration transducer mounting part for fixing the measuredacceleration transducer displaced from a center of rotation, an airbearing for rotatably supporting the turn-table, a signal adjustingmeans for amplifying at least an output from the acceleration transducermounting part, the first signal processing means for performing amodulation after converting a parallel signal having a signal outputtedfrom the signal adjusting means digitally converted into a serialsignal, a rotary transformer rotated together with the measuredacceleration transducer and transmitting an output of the first signalprocessing means from the rotary side to the fixed side and the secondsignal processing means for demodulating a signal transmitted to thefixed side of the rotary transformer and converting it into the serialsignal in order to accomplish the aforesaid first and second objects.
In addition, the invention is further characterized in that there areprovided a turn-table directly driven by a brushless motor and having anacceleration transducer mounting part for fixing the measuredacceleration transducer formed at a location displaced from a center ofrotation, an air bearing for rotatably supporting the turn-table, asignal adjusting means having the function to receive a detected outputof the acceleration transducer fixed to the acceleration transducermounting part of the turn-table and amplify it, the function foroutputting a calibration value signal and the function for removing anon-balanced component of a bridge circuit, the first signal processingmeans for performing a demodulating process after converting a parallelsignal converted in a digital form outputted from the signal adjustingmeans into a serial signal, a rotary transformer rotated together withthe measured item and for transmitting an output of the first signalprocessing means from the rotary part to the fixed part, the secondsignal processing means for demodulating a signal transmitted to thefixed side of the rotary transformer and converting it into a serialsignal, an instruction signal generating means for producing instructionsignals such as the calibration value signal outputting instruction foruse in controlling the signal adjusting means and a balance adjustinginstruction in the bridge circuit or the like, the third signalprocessing means for modulating a parallel instruction signal outputtedfrom the instruction signal generating means after its conversion into aserial instruction signal, a changing-over means for transmitting anoutput signal of the first signal processing means under no occurrenceof the instruction signal to the second signal processing means throughthe rotary transformer, preventing a transmittance of an output signalof the first signal processing means toward the second signal processingmeans and transmitting an output signal of the third signal processingmeans from the fixed part of the rotary transformer toward the rotatingpart, and the fourth signal processing means for demodulating an outputsignal of the third signal processing means transmitted from the fixedpart of the rotary transformer toward the rotary part, converting it inparallel and outputting it to the signal adjusting means so as toaccomplish similarly the first and second objects.
The invention is further is characterized in that there are provided thefirst turn-table directly connected to and rotationally driven by thefirst brushless motor and having an acceleration transducer mountingpart for fixing the measured acceleration transducer so as to cause acenter of sensing part of the measured acceleration transducer to becomea center of rotation, the first bearing for rotationally supporting thefirst turn-table, the second turn-table directly connected to androtationally driven by the second brushless motor and having the firstturn-table disposed at a location displaced from a center of rotationthrough the first bearing, the second bearing of an air bearing forrotationally supporting the second turn-table, a stored amplifier forindividually amplifying an output of the acceleration transducer fixedto the acceleration transducer mounting part of the first turn-table,the first rotary transformer for transmitting a signal outputted fromthe stored amplifier toward the second turn-table, and the second rotarytransformer for transmitting a transmitting signal of the first rotarytransformer from the second turn-table to the fixed part so as toaccomplish the first, second and third objects, wherein the rate ofrevolution of the second brushless motor is varied to apply apredetermined acceleration to the first turn-table, the first brushlessmotor is rotated to cause the sensing shaft to be rotated around thesensing part of the measured acceleration transducer mounted on thefirst turn-table so as to apply a frequency modulating component and theoutput of the measured acceleration transducer is fed out to the fixedpart in sequence through the first and second rotary transformers.
The centrifugal type acceleration measuring device made as describedabove is operated such that the turn-table is directly driven by thebrushless motor and the rotated turn-table is rotatably supported by theair bearing in a non-contacted state, so that a non-required vibrationis not added to the turn-table.
A plurality of acceleration transducers are arranged at the turn-tabledetect each of the accelerations accompanied by the rotation of theturn-table in the horizontal direction, the detected outputs are appliedto their respective stored amplifiers, and each of the stored amplifiersproperly amplifies the detected outputs and converts them into digitalsignals as required.
The rotary transformer arranged at the rotary part transmits theconverted outputs to the measuring system disposed at the location ofthe fixed part other than the turn-table.
Action for transmitting the detected output of the measured accelerationtransducer to the fixed part will be described more practically, whereinthe detected output is properly amplified by a signal adjusting meansand then transmitted to the first signal processing means. The firstsignal processing means converts the amplified detected output into adigital signal, thereafter converts a serial signal into a parallelsignal, modulates the parallel signal and inputs it into the rotarytransformer rotating together with the measured item. The rotarytransformer transmits the detected output from its rotary part to thefixed part.
The second signal processing means demodulates the signal transmittedfrom the rotary part of the rotary transformer to the fixed part,converts the parallel signal into the serial signal and takes out asignal corresponding to the acceleration detected by the accelerationtransducer at the fixed part.
The changing-over means of the acceleration measuring device constructedas described above transmits an output signal of the first signalprocessing means to the signal processing means (at the fixed side)through the rotary transformer when an instruction signal is nottransmitted from the fixed side of the rotary transformer rotationallydriven by the brushless motor or the like to the signal adjusting means.
In addition, if a predetermined instruction signal is sent from theinstruction signal generating means at the fixed part to the thirdsignal processing means, the changing-over means prevents the outputsignal of the first signal processing means from being transmitted fromthe rotary part of the rotary transformer to the fixed part and changesover to transmit the instruction signal from the fixed part of therotary transformer to the rotary part.
The third signal processing means converts the instruction signal of theparallel signal into the serial signal and then modulates it, outputs itto the rotary transformer. The fourth signal processing meansdemodulates an instruction signal sent from the fixed part of the rotarytransformer to the fixed part converts the serial signal into theparallel signal and outputs it to the signal adjusting means.
Although the foregoing is caused by a static measurement (a calibration)of the centrifugal acceleration measuring device, the turn-table is of atwo-stage configuration so as to enable its dynamic measurement (acalibration) to be carried out and this is realized by the foregoingsystem.
That is, the first turn-table of small-size is rotatably supported at alocation displaced by a specified distance from the center of rotationof the second turn-table of large size through the first bearing, andthe turn-tables are rotated by the first and second brushless motorsdirectly connected under a condition in which the second turn-table isrotatably supported at the fixed part through the air bearing. Then, themeasured acceleration sensor mounted on the first turn-table while acenter of the sensing part coincides with a center of rotation of thefirst turn-table and receives a specified centrifugal forcecorresponding to the eccentric distance and the rate of revolution ofthe second turn-table.
At this time, the measured acceleration transducer is operated such thatwhen its sensing shaft coincides with a radiation axis of the secondturn-table and a positive direction of the sensing shaft is directedtoward the center of rotation, a positive sensing output correspondingto the centrifugal acceleration is attained; when a positive directionof the sensing shaft is directed in a direction opposite to the centerof rotation, a negative sensing output is attained, and when the sensingshaft is displaced from 0° to 90° with respect to the radiation axis ofthe second turn-table, the sensing output is varied from the maximumvalue to 0; when the sensing shaft is displaced from 90° to 180°, thesensing output is varied from 0 to the negative maximum value; and whenthe sensing shaft is displaced form 180° to 270° and from 270° to 360°,the sensing output is varied from the negative maximum value to 0 andfrom 0 to the positive maximum value.
Accordingly, the first turn-table is rotated at any rate of revolutionto enable an alternative output corresponding to the rate of revolutionto be attained from the measured acceleration transducer mounted on thefirst turn-table, resulting in that a dynamic measurement of theacceleration (a calibration) can be carried out over a wide range offrequency.
As described above in detail, the turn-tables are directly driven by thebrushless motor, so that at first, the clutch or the gear reducermechanism is eliminated, an entire device of small size can be realized,the occurrence of noise is restricted to cause the multi-stage settingof the acceleration to be facilitated and an automatic programmedacceleration measurement can be realized.
In addition, since rotational supporting of the turn-tables are carriedout under a non-contact state with an air bearing, a high precisionrotational supporting can be realized for both thrust and radialdirections and further no noise is produced, the S/N ratio is high andtheir a high precision acceleration measurement can be carried out.
Further, since an output of the acceleration detection of each of theacceleration transducers is amplified by the stored amplifier,thereafter the output is transmitted through the rotary transformer, anon-contact state is maintained and the occurrence of noise can berestricted in the same manner as described above and at the same time itis possible to provide a centrifugal type acceleration measuring devicehaving no mechanical wearing part and eliminating any maintenance workand thus its range of application as a calibration device acting as areference of occurrence of the acceleration.
According to the invention, it is possible to provide a centrifugal typeacceleration measuring device in which a calibration operation or anautomatic balancing or the like can be remotely controlled at the fixedside for each of a plurality of signal adjusting means, a measuringoperation can be efficiently carried out, resulting in that anacceleration on the turn-tables can be accurately detected.
According to the invention it is possible to provide a centrifugal typeacceleration measuring device which has a higher accuracy than that ofan absolute calibration system having the highest accuracy incalibration in a frequency range of 20 Hz to 5 kHz and further either ameasurement or a calibration of the dynamic acceleration can be carriedout over a wide frequency range including a range of 0 to 20 Hz.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a front elevational view for showing a partly broken entireconfiguration of one preferred embodiment of the centrifugal typeacceleration measuring device of the present invention.
FIG. 2 is a block diagram for showing an entire schematic configurationof the preferred embodiment shown in FIG. 1.
FIG. 3 is an enlarged sectional view for showing a related part betweenthe turn-table and the air bearing of the preferred embodiment shown inFIG. 1.
FIG. 4 is a block diagram for showing portions in a signal transmittingsystem and a rotary driving system of the preferred embodiment shown inFIG. 1.
FIG. 5 is an illustrative view for showing a relation of arrangement inan analyzing processing system in the preferred embodiment shown in FIG.1.
FIG. 6 is a characteristic view for showing a relation of an instructionvoltage vs the number of revolution of the motor of the preferredembodiment of FIG. 1.
FIG. 7 illustrates a characteristic diagram for indicating the relationbetween the jitter and the rate of revolution.
FIG. 8 is a characteristic view for showing a relation of an instructionvoltage vs a rotational speed of the motor of the preferred embodimentshown in FIG. 1.
FIG. 9 is a block diagram for showing a circuit configuration of thesecond preferred embodiment of a centrifugal type acceleration measuringdevice differing from that of the preferred embodiment shown in FIG. 4.
FIG. 10 is a block diagram for showing a circuit configuration of thethird preferred embodiment of a centrifugal type acceleration measuringdevice further differing from the preferred embodiment shown in FIGS. 4and 9.
FIG. 11 is a front elevational view for showing a partly broken-awayconfiguration of an outer appearance of the third preferred embodiment.
FIG. 12 is a schematic top plan view for illustrating a relation ofarrangement and operation of the first turn-tables and the secondturn-table of the third preferred embodiment.
FIG. 13 is a waveform view for illustrating an operation of the thirdpreferred embodiment.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Referring now to the accompanying drawings, the first preferredembodiment of the present invention will be described more practically.
FIG. 1 is a front elevational view for showing an entire configurationof a centrifugal type acceleration measuring device of the presentinvention.
In FIG. 1, 1 denotes a stone surface plate formed in a disk shape. Alower surface of the stone surface plate 1 is fixed to supportingcolumns 3 through vibration-proof devices 2 such as an oil damper or anair damper or the like. The supporting columns 3 and the vibration-proofdevices 2 are plural in number (4 pieces in this example). The lowerends of the supporting columns 3 are fixed to a flat floor surface.
A through-pass motor storing part is arranged at a central part of thestone surface plate 1, and a brushless motor (hereinafter merely calledas "a motor") is stored in the motor storing part. The motor 4 directlyrotates a turn-table 5 with out using any belt or a gear reduction boxor the like. A rotary supporting shaft 5a suspended downwardly at thelower surface at the central part of the turn-table 5 and a rotary shaftof the motor 4 are directly connected to each other.
Between the motor 4 and the turn-table 5 is placed an air bearing 6. Arotary shaft supporting part 5a of the turn-table 5 is fitted to andconnected to a rotary cylinder disposed at the central part of the airbearing 6 and then the rotary cylinder is rotatably supported at thefixed cylinder under an action of pneumatic pressure.
A pneumatic pressure supplying part 6a is arranged at an outercircumferential surface of the air bearing 6. To the pneumatic pressuresupplying part 6a is supplied compression air from an air cleaner 7shown in FIG. 2; thereby the rotary cylinder having the rotary shaftsupporting part 5a of the turn-table 5 fitted therein is rotatablysupported in its non-contacted condition.
FIG. 2 is a block diagram for schematically showing an entireconfiguration of the present invention.
As apparent from FIG. 2, to the air cleaner 7 is connected an air source8. Air to be supplied from the air source 8 is adjusted in its pressureby an air regulator (not shown) (for example, adjusted to apredetermined pressure of 3 to 10 kg/cm²) after dust particles or thelike in the air are removed by the air cleaner 7.
The pressure adjusted air is supplied to the pneumatic pressuresupplying part 6a of the aforesaid air bearing 6 and as shown in FIG. 2,the air passes the supporting columns 3 and is supplied to thevibration-proof devices 2.
Detailed configuration of the aforesaid air bearing 6 and the rotaryshaft supporting part 5a of the turn-table 5 is shown in an enlargedsectional view of FIG. 3.
In FIG. 3, at the first, a configuration of the turn-table 5 will bedescribed. The rotary shaft supporting part 5a of the turn-table 5 isformed with a hollow barrel 5a1. Within the hollow barrel are stored amultiplexer 31, a controller 32, an A/D converter 33, a P-S converter 34and a modulator 35 or the like which are components of the storedamplifier. As to the multiplexer 31 and the controller 32 or the like,they will be described in detail in reference to FIG. 4 later. An upperend of the hollow barrel 5a1 is fixed with a cover 10 to close it.
At the upper of the rotary shaft supporting part 5a is disposed astoring part 5a2 for use in storing cord or the like. An outercircumference of the storing part 5a2 is formed with accelerationtransducer mounting parts 5a3 of which diameters are larger than that ofthe storing part 5a2.
In this preferred embodiment, four acceleration transducer mountingparts 5a3 are formed in a short cylindrical spacing having a bottom partand equally spaced apart around a center of rotation of the turn-table5. As shown in a block diagram of FIG. 4, the acceleration transducers12a to 12d are stored in the four acceleration transducer storing parts5a3 one by one and a total number of four acceleration transducers areentirely stored for the turn-table 5.
The turn-table 5 is integrally connected such that at first an annularconcave groove of the connecting block 5b and an outer circumference ofthe rotary cylinder 6b of the air bearing 6 are fitted to each other,then a plurality of bolts 5b2 are inserted from the upper surface of theconnecting block 5b at a predetermined angular spacing and threadedlyengaged with the female thread holes formed in the rotary cylinder 6b.
In addition, under a condition in which the upper surface of theconnecting block 5b is being abutted against the lower surface of therotary shaft supporting part 5a of the turn-table 5, the connectingblock 5b is connected to the rotary shaft supporting part 5a with aplurality of bolts 5b1 from the upper surface of the rotary shaftsupporting part 5a.
With such an arrangement, the fixed shaft supporting part 5a isconnected to the rotary cylinder 6b of the air bearing 6 through theconnecting block 5b. The rotary cylinder 6b is rotatably supported bypneumatic air against the fixed cylinder of the air bearing 6 with aminimum clearance, resulting in that the turn-table 5 is rotatablysupported in a horizontal direction against the air bearing 6.
Now, the description will be returned from FIG. 3 back to FIG. 1. Asshown in FIG. 1, a safety cover 11 is fixed onto the stone surface plate1 so as to enclose the air bearing 6 and the turn-table 5 therein.
This safety cover 11 is applied for preventing the accelerationtransducer from being dispersed outwardly under a centrifugal force evenif the acceleration transducer is removed from the turn-table 5 duringits testing operation and for preventing an operator from touching theturn-table 5 during an operation.
Then, referring to FIGS. 2 and 4, a transmitting system and a processingsystem for the detected output will be described.
As shown in FIG. 4, in this preferred embodiment, it is made such thatthe four acceleration transducers, i.e. the first accelerationtransducer 12a to the fourth acceleration transducer 12d can beconcurrently measured.
Each of these first acceleration transducer 12a to the fourthacceleration transducer 12d is stored and mounted one by one in the fouracceleration transducer mounting parts 5a3 of the turn-table 5 shown inFIGS. 1 and 3.
In this preferred embodiment, these first acceleration transducer 12a tothe fourth acceleration transducer 12d are strain gauge typeacceleration transducers. Each of the acceleration transducers 12a to12d is operated to detect a rotational speed of the turn-table 5, i.e. astrain corresponding to the acceleration and to get an accelerationdetected output. When a rotational speed of the motor 4 is increased ordecreased in a stepwise manner, an acceleration varying in a stepwisemanner is enabled to be attained.
Detected outputs of the first acceleration transducer 12a to the fourthacceleration transducer 12d are inputted to the multiplexer 31 stored inthe storing part 5a2.
The multiplexer 31 is operated such that the outputs of the firstacceleration transducer 12a to the fourth acceleration transducer 12dare changed over individually in sequence by an output signal of thecontroller having a sequence counter (not shown) stored therein, thatis, by inputting the data of four channels channel by channel, and thenoutputted to an analogue/digital (hereinafter called as "A/D") converter33 of 12 bits.
The A/D converter 33 convert the outputs of the first accelerationtransducer 12a to the fourth acceleration transducer 12d outputted fromthe multiplexer 31 into digital signals in response to a control signalof the controller 32 and outputs them to a parallel-serial (hereinaftercalled as "P-S") converter 34.
The P-S converter 34 converts the digital signal of 12 bits outputtedfrom the A/D converter 33 into a serial signal in response to a controlsignal of the controller 32 and outputs it to the modulator 35.
An oscillator, although not shown, is stored in the modulator 35 andmodulates a signal in response to an output signal of the controller 32for every "1" and "0" of data inputted from the P-S converter 34 andconverted into a serial signal.
In this preferred embodiment, "1" of the serial data is modulated to 2fHz, for example, 50 KHz and "0" is modulated to fHz, for example 25 KHzso as to modulate an output signal (a pulse signal) of the oscillatorand then the output signal is outputted to a primary side of the rotarytransformer 36.
In FIG. 1, the rotary transformer 36 is disposed at a location below therotary main shaft of the motor 4. In FIG. 4, a primary winding 36P and asecondary winding 36S of the rotary transformer 36 are synchronous witha rotation of the motor 4 and further electromagnetically coupled toeach other.
Signals of 2 fHz and fHz corresponding to "1" and "0" induced at thesecondary winding 36S of the rotary transformer 36 are inputted to thedemodulator 37.
To this demodulator 37 is inputted a control signal from the controller38. With this control signal, the demodulator 37 demodulates aninduction signal of the secondary winding 36S of the rotary transformer36 to digital measured data and outputs it to a serial-parallel(hereinafter called as "S-P") converter 39.
To this S-P conveter 39 is also inputted a control signal from thecontroller 38. The digital serial data outputted from the demodulator 37is converted into a parallel data of 12 bits in response to the controlsignal.
The parallel data is latched to four latch circuits 40a to 40d for everychannel in response to the output signal from the controller 38, thatis, in correspondence with the outputs of the first accelerationtransducer 12a to the fourth acceleration transducer 12d.
Each of the outputs of these four latch circuits 40a to 40d is inputtedto corresponding digital/analogue (hereinafter called as "D/A")converters 41a to 41d and outputted to a binary-coded-decimal converter(hereinafter called as a "BCD converter") 42.
The BCD converter 42 is operated such that it inputs an output from eachof the latch circuits 40a to 40d, converts it into a decimal numberthrough a binary coded decimal method and outputs it to the displaydevice 43. As the display device 43, a CRT display device or the like ispreferable.
Although not shown in FIG. 4, an output of the S-P converter 39 may beoutputted to the CPU 15 as shown in FIG. 5, a key-board 16 and a printer18 or the like are connected to the CPU 15, acceleration detectedoutputs detected by the first acceleration transducer 12a to the fourthacceleration transducer 12d are analyzed by the CPU 15, various dataprocessings are carried out under an operation of the key-board 16 by anoperator, and the result of analization, i.e. the measured value datamay also be printed out by a printer 18.
Each of the members in FIG. 4 ranging from the first accelerationtransducer 12a to the fourth acceleration transducer 12d to the rotarytransformer 36 is disposed at the rotary side and the components rangingthe demodulator 37 to the display device 43 are disposed at the fixedside.
FIG. 5 illustrates one example of the arrangement of the analysisprocessing system, wherein the key-board 16 and the CPU 15 are arrangedon a desk 19 having casters. The display device 43 illustrated in FIG. 5is disposed above the CPU 15 and the printer 18 is mounted on a shelf.
In FIG. 4, a clock pulse from a pulse generator 20 is outputted to themotor controller 21.
To the motor controller 21 is inputted an output from the encoder 22.The encoder 22 is one for measuring the rate of revolution (a rotationalangular velocity) and encoding it. The motor controller 21 may comparein phase with an output from the encoder 22 in reference to a pulse fromthe pulse generator 20 and control a rotational speed of the motor 4 insuch a way as it becomes a predetermined set speed.
As shown in FIG. 1, this encoder 22 is disposed below the motor 4.
Reference numeral 23 denotes an external power supply set at the fixedside, wherein an output of the external power supply 23 is supplied tothe regulator 24 through the rotary transformer 13. Electrical supply ofthe external power supply 23 to the regulator 24 can be carried outunder a non-contact condition without using any slip ring or a brushthrough the rotary transformer 13.
The regulator 24 regulates an AC voltage supplied from the externalpower supply 23 to a DC voltage, thereafter supplies it as apredetermined rated voltage to the multiplexer 31 and the controller 32or the like.
As shown in FIG. 2, the pulse generator 20, motor controller 21 andexternal power supply 23 or the like are assembled in the rack 25 havingcasters. A noise filter 26 or a shield transformer 27 or the like arestored at the bottom part of the rack 25 and the rate of revolution ofthe motor controller 21 can be set by changing-over operation of theswitch 28.
A set rotational speed for every operation of this switch 28 is onedisplayed at the display device 43.
Operation of the first preferred embodiment constructed as describedabove will be described.
At first, electrical power is supplied from the external power supply 23to the regulator 24 through the rotary transformer 13, the AC voltagesupplied from the external power supply 23 is rectified to a DC voltageby the regulator 24, thereafter the voltage is made as a constantvoltage and an operating power supply is supplied to the multiplexer 31and the controller 32 or the like.
Under an operation of the switch 28 shown in FIG. 2, a rotational speedof the motor 4, i.e. an acceleration of it is set, thereby the setrotational speed is displayed at the display device 43.
As the motor 4 is rotated at the set rotational speed, a practicalrotational speed of the motor is measured by the encoder 22 so as toencode the measured value and then an output of the encoder 22 is sentto the motor controller 21.
The motor controller 21 compares a pulse inputted from the pulsegenerator 20 with a phase of output of the encoder 22 and controls therotational speed in such a way as the rate of revolution of the motor 4may become the set rate of revolution.
This motor 4 is a brushless motor and rotationally drives the turn-table5 directly, so that the turn-table 5 can be rotated at a high coredisplacement accuracy and with less jitter.
FIG. 6 is a characteristic diagram for indicating an instruction voltagevs the rate of revolution of the motor 4 and as apparent from FIG. 6,the rate of revolution has a substantial linear relation with theinstruction voltage. FIG. 7 is a characteristic diagram for indicating arelation between the jitter and the rate of revolution and it isapparent that the jitter is quite small in its magnitude.
In addition, FIG. 6 indicates a rising characteristic and a descendingcharacteristic of the motor 4 and it is apparent that the rising anddescending are symmetrical to each other and no disturbance is found inthem.
As shown in FIGS. 6 to 8, it is apparent that the brushless motor has asuperior characteristics. Accordingly, there is no rotationaldisplacement in center of the turn-table 5 directly driven by the motor4, 80 that a quite stable rotation of the table is attained and furthera quite accurate acceleration can be given to the first accelerationtransducer 12a to the fourth acceleration transducer 12d.
The rotational shaft supporting part 5a of the turn-table 5 rotated bythe motor 4 is integrally formed with the rotating cylinder 6b of theair bearing 6 and rotatably supported at the fixed cylinder of the airbearing 6 under a non-contact condition, so that no mechanical vibrationis generated. In addition, no wear or seizure is generated and noisecaused by the brush of the prior art is not generated from the motor 4or the rotary transformers 13a to 13d, so that noise is not overlappedto the detected outputs of the first acceleration transducers 12a to thefourth acceleration transducer 12d and further an acceleration detectioncan be carried out in a more accurate manner.
In this way, the turn-table 5 is rotated and rotationally supported toenable an acceleration corresponding to a rotational speed of theturn-table 5 to be given accurately to the first acceleration transducer12a to the fourth acceleration transducer 12d stored in and fixed toeach of the acceleration transducer mounting portions 5a3 of theturn-table 5.
Each of the detection outputs of the first acceleration transducer 12ato the fourth acceleration transducer 12d is individually inputted tothe multiplexer 31. The multiplexer 31 may select the detection outputsof the first acceleration transducer 12a to the fourth accelerationtransducer 12d for every output of the first acceleration transducer 12ato the fourth acceleration transducer 12d in response to a controlsignal of the controller 32, in other words, for every channel 1 tochannel 4 corresponding to these first acceleration transducer 12a tothe fourth acceleration transducer 12d and output them to the A/Dconverter 33.
The A/D converter 33 converts the detection outputs of the firstacceleration transducer 12a to the fourth acceleration transducer 12doutputted from the multiplexer 31 into the digital signals of 12 bits inresponse to the output signal from the controller 32 and then outputs itto the P-S converter 34.
The P-S converter 34 converts the parallel data of the detection outputsof the first acceleration transducer 12a to the fourth accelerationtransducer 12d of 12 bits outputted from the A/D converter 33 into aserial data in response to an output signal from the controller 32 andthen outputs the data to the modulator 35.
The modulator 35 modulates an output signal of an oscillator stored inthe modulator 35 to 50 KHz and 25 KHz, respectively, in correspondencewith "1" and "0" of the serial data sent from the P-S converter 34 inresponse to the output signal of the controller 32 and then applies thesignal to the primary winding 36P of the rotary transformer 36.
The modulation signal of serial data induced at the secondary winding36S of the rotary transformer 36 is inputted to the demodulator 37. Thedemodulator 37 demodulates the modulation signal in response to theoutput signal of the controller 38, outputs the serial data of "1" and"0" and feeds them to S-P converter 39.
The S-P converter 39 converts the demodulation signal of the serial datasent from the demodulator 37 into the parallel data in response to theoutput signal from the controller 38 and latches them to the latchcircuits 40a to 40d for every detected outputs of the first accelerationtransducer 12a to the fourth acceleration transducer 12d in response tothe control signal of the controller 38.
The parallel data latched to each of the latch circuits 40a to 40d issent to the D/A converters 41a to 41d, and its detected output isconverted into an analogue signal for every first accelerationtransducer 12a to the fourth acceleration transducer 12d by the D/Aconverters 41a to 41d and outputted.
Each of the outputs of the latch circuits 40a to 40d is converted into adecimal number by a binary coded decimal method, outputted to thedisplay device 43 and displayed to the display device 43.
In turn, the parallel data outputted from the S-P converter 39 is sentto the CPU 15 shown in FIG. 5, thereby it is also possible to perform ananalyzing process of the detected outputs of the first accelerationtransducers 12a to the fourth acceleration transducer 12d, and theresults of the analyzing method can be displayed in the display device43 or printed out at the printer 18 under an operation of the keyboard16.
It is also possible to apply functions of supervising a history of theproduct or a statistic processing function by using a general-purposepersonal computer in such an analyzing processing system.
Of course it is apparent that in place of the personal computer, anexclusive micro-computer may also be used.
Then if the setting of the rotational speed of the motor 4 is changedover in a stepwise manner under an operation of the switch 28, astepwise acceleration is applied to the first acceleration converter 12ato the fourth acceleration converter 12d in response to a stepwisechanging-over of rotation, each of the outputs of the accelerationconverter can be fed out and accordingly it is possible to realize amulti-stage program for setting the acceleration.
In this way, according to the preferred embodiment, the turn-table 5 isdirectly driven to rotate by the brushless motor 4 and at the same timethe rotating shaft supporting part 5a of the turn-table 5 is rotatablysupported by the air bearing 6 under a non-contact condition, theacceleration detected outputs of a plurality of acceleration transducersmounted on and fixed to the turn-table 5 are inputted to the multiplexer31 for every channel of the first acceleration transducer 12ato thefourth acceleration transducer 12d, selected for every detected outputof each of the acceleration transducers and the signals are convertedinto digital signals by the A/D converter 33, and thereafter the data isconverted into a serial data by the P-S converter 34. Each of "1" and"0" of the serial data is modulated into 50 KHz and 25 KHz by themodulator 35, and thereby the modulated signal is transmitted to thedemodulator 37 mounted at the fixed side under a no-contact conditionthrough the rotary transformer 36, so that this has an advantage thatnoise of the motor 4 or wear of the motor 4 is eliminated, a lowconsumption power is available and a noise is not overlapped to thedetected outputs and an entire system can be made in a small size.
In addition, since the shaft is rotatably supported by the air bearing6, a rotational accuracy in either the thrust or radial direction can beimproved up to about 0.05 μm and thus correspondingly an accurateacceleration can be generated.
Then, the configuration of the second preferred embodiment of thepresent invention will be described mainly in reference to FIG. 9.
The second preferred embodiment is constructed such that a transmittingsystem of the detected output of the measured acceleration transducer ispartially modified, a predetermined instruction signal is transmittedwithout noise to the signal adjusting means arranged on the rotatingturn-table from the fixed side and a predetermined instruction operationcan be accurately carried out.
Reference numerals 12a to 12d in FIG. 9 denote the first accelerationtransducer to the fourth acceleration transducer acting as a physicalamount--electrical amount converter for detecting a physical amount andconverting it into an electrical signal.
These first acceleration transducer 12a to fourth accelerationtransducer 12d are similar to those of FIG. 4, wherein an accelerationof the turn-table during its rotation at a predetermined position isdetected and converted into an electrical signal.
As to the configuration of the centrifugal type acceleration measuringdevice in the second preferred embodiment, it has a similarity to thatshown in FIGS. 1, 2 and 3 and its description will be eliminated inorder to avoid its dual expression.
The block diagram shown in FIG. 9 is also partly in common with theblock diagram shown in FIG. 4, so that its differing configuration Willbe mainly described.
At first, in reference to FIGS. 2 and 9, the transmitting system and theprocessing system for the detected outputs in the second preferredembodiment will be described.
As shown in FIG. 9, in the second preferred embodiment, this isconstructed such that the four our acceleration transducers of the firstacceleration transducer 12a to the fourth acceleration transducer 12dcan be measured concurrently.
Each of these first acceleration transducer 12a to the fourthacceleration transducer 12d is stored and mounted at each of the fouracceleration transducer mounting parts 5a3 of the turn-table 5 shown inFIGS. 1 and 3, respectively.
The detected outputs of the first acceleration transducer 12a to thefourth acceleration transducer 12d are inputted to the first signalconditioner 50a to the fourth signal conditioner 50d stored in thestoring part 5a2.
The signal conditioner 50 has some functions such as a function toproperly amplify a minute signal outputted from the accelerationtransducer and output it, a function to output a predetermined or anyoptional calibration, a filtering function for passing only a signalhaving a predetermined range of frequency and an auto-balancing functionfor removing a resistance unbalanced component and/or capacitanceunbalanced component of a bridge circuit included in the strain gaugetype physical amount--electrical amount converter and for automaticallygetting a balanced condition or the like.
The four signal conditioners 50a to 50d are connected to each other by acontrol signal line and constructed such that each of their outputs canbe made effective under a predetermined order by the controller 32 orother control circuits and further the detected output of the signalconditioner 50 specified by the remote control can be controlled and anoutput of the calibration value signal can be controlled.
Accordingly, the detected outputs corresponding to the accelerations ofthe first acceleration transducer 12a to the fourth accelerationtransducer 12d are respectively amplified by each of the first signalconditioner 50a to the fourth signal conditioner 50d so as to process awave-form formation. or the like.
The first signal conditioner 50a to the fourth signal conditioner 50dare controlled by a stored control circuit and operated so as to outputthe output signals under a predetermined order to the analogue/digital(herinafter called as "A/D") converter 33 of 12-bits, for example.
This A/D converter 33 converts each of the outputs of the firstacceleration transducer 12a to the fourth acceleration transducer 12doutputted from each of the signal conditioners 50a to 50d into a digitalsignal in response to a control signal of the controller 32 and outputsit to the aforesaid parallel-serial (hereinafter "P-S") converter 34through a changing-over unit 101a.
This P-S converter 34 converts a digital signal of 12-bits outputtedfrom the A/D converter 33 into a serial signal by a control signal ofthe controller 32 and outputs it to the aforesaid modulator 35.
Although not shown, an oscillator is stored in the modulator 35 and amodulation is applied for every "1" and "0" of the serial converted datainputted from the P-S conveter 34 in response to the output signal ofthe controller 32.
In this preferred embodiment, the output signals (pulse signals) of theoscillator are modulated, for example, "1" of the serial data ismodulated to 2 fHz and "0" is modulated to fHz and then it is outputtedto the primary side of the rotary transformer 36, i.e. the rotating partthrough the changing-over unit 101b.
The output signals of the oscillator are made such that a setting rangeunder a certain frequency range about 2 fHz and fHz corresponding to "1"and "0" of the serial data be made variable in response to materialquality, the number of windings and the characteristics of the rotarytransformer, and thereby the most suitable transmitting efficiency canbe selected. For example, a value of f=10 KHz can be set in response tothe rotary transformer and a higher frequency can be selected.
The first signal processing means is constructed as its essentialcomponents the controller 32, A/D converter 33, P-S converter 34 andmodulator 35.
In FIG. 1, the rotary transformer 36 is disposed below the rotating mainshaft of the motor 4. In FIG. 9, the primary winding 36P and thesecondary winding 36S (that is, the winding at the fixed side) of therotary transformer 36 are electromagnetically coupled to each other.
Signals of 2 fHz and fHz corresponding to "1" and "0" induced at thesecondary winding 36S of the rotary transformer are inputted to theaforesaid demodulator 37 through the changing-over unit 101c.
To this demodulator 37 is inputted a control signal from the controller38. The demodulator 37 demodulates an induction signal in the secondarywinding 36S of the rotary transformer 36 to the digital measured data inresponse to the control signal and outputs it to the aforesaidserial-parallel (hereinafter called as "S-P") converter 39.
Also to this S-P converter 39 is inputted the control signal from thecontroller 38. The digital serial data outputted from the demodulator 37is converted into a parallel data of 12-bits in response to the controlsignal.
As the essential components of the demodulator 37, controller 38 and S-Pconverter 39, the second signal processing means is constructed. Thesecond signal processing means becomes the signal processing means atthe fixed side.
The S-P converter 39 of the second signal processing means is made suchthat a digital signal is outputted to the digital output terminal D asit is and the signal is outputted to the digital/analogue (hereinaftercalled as "D/A") converters 41a to 41d.
Each of the D/A converters 41a to 41d corresponds a different one of thefirst acceleration transducers 12a to fourth acceleration transducer 12da different one of the first signal conditioner 50a to the fourth signalconditioner 50d. Each of the digital signals of the S-P converter 39corresponding to each of the output signals of the first accelerationtransducer 12a to the fourth acceleration transducer 12d is convertedinto an analogue signal, and is outputted to the analogue outputterminals Aa to Ad.
The digital signal of the S-P converter 39 sent to the digital outputterminal D is taken out as a digital signal corresponding to each of theoutputs of the first acceleration transducer 12a to the fourthacceleration transducer 12d; for example, the digital signal istransmitted to the CPU 15 (refer to FIG. 5) and applied as an analyzingprocess for the detected outputs of the first acceleration transducer12a to the fourth acceleration transducer 12d.
Analogue signals appearing at the analogue output terminals Aa to Adcorrespond to the outputs of the first acceleration transducer 12a tothe fourth acceleration transducer 12d, and the signal can be displayedat the display device not shown or recorded in a magnetic recording andreproducing means or measured by a measuring device.
In turn, each of the channel specifying switches Ca to Cd is a switchfor outputting a specifying signal for specifying what signalconditioner 50 is to be specified when the instructions such ascalibration, zero-adjustment and auto-balance adjustment or the like areoutputted to the first signal conditioner 50a to the fourth signalconditioner 50d. Each of these channel specifying switches Ca to Cdcorrespond to a different one of the first acceleration transducer 12ato the fourth acceleration transducer 12d.
Switches Ta and Tb are calibration instruction switches, wherein theymay output an instruction signal when each of the (+) calibration valueand (-) calibration value against the first signal conditioner 50a tothe fourth signal conditioner 50d, respectively.
A zero adjusting instruction switch Tc is a switch for use in outputtingthe instruction signal when a DC zero for the signal conditioner 50 orthe like is taken.
In addition, the auto-balance instruction switch Td is a terminal to usein outputting an signal for instructing that a balance in each of thebridge circuits is set to the first signal conditioner 50a to the fourthsignal conditioner 50d.
In addition, the instruction signal generating means is constructed bythe channel specifying switches Ca to Cd, compensation instructionswitches Ta, Tb, a zero adjustment instruction switch Tc and anauto-balance instruction switch Td or the like.
Channel instruction signals outputted from the channel specifyingswitches Ca to Cd and the instruction signals outputted from each of theinstruction switches Ta to Td are digital signals of plural bits,inputted to the P-S converter 51, where the instruction signals areconverted into the serial signals, and are inputted to the modulator 52.
The modulator 52 modulates the digital instruction signals in responseto the control signal from the controller 38 and applies the modulatedsignal to the secondary winding 36S of the rotary transformer 36.
In this way, the third signal processing means is constructed with theP-S converter 51, modulator 52 and controller 38 being applied asessential components. The controller 38 is commonly used in the secondand third signal processing means.
The changing-over units 101a to 101c may constitute the changing-overmeans, wherein when the specifying signals from the channel specifyingswitches Ca to Cd and the instruction signals from the calibrationswitches Ta to Td are outputted, the changing-over units may prevent anoutput signal of the A/D converter 33 from being transmitted from theprimary winding 36P of the rotary transformer 36 toward the secondarywinding 36S and the changing-over units are changed over in such a wayas the these channel specifying signals and the instruction signals aretransmitted from the secondary winding 36S of the rotary transformer 36toward the primary winding 36P.
In turn, when the channel specifying signal and each of the instructionsignals are not outputted, each of the changing-over units 101a to 101cis changed over in such a way as an output of the A/D converter 33 maybe transmitted from the primary winding 36P of the rotary transformer 36toward the secondary winding 36S.
A channel specifying signal and each of the instruction signalstransmitted from the secondary winding 36S of the rotary transformer 36toward the primary winding 36P are demodulated by the demodulator 53through the changing-over unit 101b, thereafter they are converted intoparallel signals by the S-P converter 54.
Outputs of the S-P converter 54 are added to the changing-over unit 101aand the first signal conditioner 50a to the fourth signal conditioner50d.
An output signal of the S-P converter 54 is added to the changing-overunit 101a, thereby as described above, an output signal of the A/Dconverter 33 is prevented from being inputted to the P-S converter 34and further prevented from being transmitted from the primary winding36P of the rotary transformer 36 to the secondary winding 36S. Alongwith this operation, the output signals of the first signal conditioner50a to the fourth signal conditioner 50d, a channel specifying signaland an instruction signal can be prevented from interfering with eachother.
As shown in FIG. 5, an output of the S-P converter 39 appearing on thedigital output terminal D is outputted to the CPU 15, the accelerationdetecting outputs detected by the first acceleration transducer 12a tothe fourth acceleration transducer 12d are analyzed by the CPU 15,various data processings are carried out under an operation of anoperator through the key-board 16 and the results of analyzingprocessing can be printed out by the printer 18 as measured value data.
The first acceleration transducer 12a to the fourth accelerationtransducer 12d and the rotary transformer 36 in each of the componentsin FIG. 9 and the demodulator 53 and the S-P converter 54 are disposedat the rotary side and then the components of the demodulator 37 to thedemodulator 52 are disposed at the fixed side.
Although not shown in FIG. 9, it is assumed that the rotary transformer13, pulse generator 20 to regulator 24, BCD converter 42 and the displaydevice 43 may also be provided in the second preferred embodiment.
Operation of the second preferred embodiment constructed as above willbe described as follows.
At first, an electrical power is supplied from the external power supplyto the regulator through rotary transformer, the AC voltage suppliedfrom the external power supply is rectified into a DC voltage by thisregulator, thereafter the voltage is changed into a constant voltage andthen an operating power supply is fed to the signal conditioner 50 andthe controller 32 or the like.
A rotational speed of the motor 4, i.e. an acceleration of the motor 4is set under an operation of the switch 28 shown in FIG. 2, thereby itsset rotational speed is displayed at the display device 43.
A controlling operation for the motor 4 is similar to that of the firstpreferred embodiment, so that its description will be eliminated.
The detected outputs from the first acceleration transducer 12a to thefourth acceleration transducer 12d rotated on the turn-table at apredetermined rotational speed are inputted individually to the firstsignal conditioner 50a to the fourth signal conditioner 50d. This signalconditioner 50 is operated such that the detected outputs of the firstsignal conditioner 50a to the fourth signal conditioner 50d for everyoutput of the first signal conditioner 50a to the fourth signalconditioner 50d, in other words, for every channel 1 to 4 correspondingto the first acceleration transducer 12a to the fourth accelerationtransducer 12d are selected in response to the control signal of thecontrol circuit or the controller 32 and outputted to the A/D converter33.
The A/D converter 33 converts the analogue detected outputs for everyfirst acceleration transducer 12s to the fourth acceleration transducer12d outputted from the first signal conditioner 50a to the fourth signalconditioner 50d into the digital signals of 12-bits in response to theoutput signals of the controller 32 and then outputs the signals to theP-S converter 34 through the changing-over unit 101a.
At this time, the channel specifying signal is not inputted by thechannel specifying switches Ca to Cd and the instruction signal is notinputted through the calibration instruction switches Ta to Td.Accordingly, all the changing-over units 101a to 101c can transmit thedetected outputs of the first acceleration transducer 12a to the fourthacceleration transducer 12d from the rotary side to the fixed side. Withsuch an arrangement, as described above, the output signal of the A/Dconverter 33 is transmitted to the P-S converter 34 through thechanging-over unit 101a.
The P-S converter 34 converts the parallel data of the detected outputsfor every first acceleration transducer 12a to the fourth accelerationtransducer 12d of 12-bits outputted from the A/D converter 33 into theserial data in response to the control signal from the controller 32 andoutputs it to the modulator 35.
The modulator 35 modulates the output signal of the oscillator stored inthe modulator 35 to frequencies of 2 fHz and fHz in response to "1" and"0" of the serial data sent from the P-S converter 34 in reference tothe control signal of the controller 32 and then applies it to theprimary winding 36P of the rotary transformer 36 through thechanging-over unit 101b.
The modulation signal of serial data induced at the secondary winding36S of the rotary transformer 36 is inputted to the demodulator 37through the changing-over unit 101c. The demodulator 37 demodulates themodulation signal in response to the output signal of the controller 38and sends the serial data of "1" and "0" to the S-P converter 39.
The S-P converter 39 converts the demodulation signal of the serial datasent from the demodulator 37 into a parallel data in response to anoutput signal from the controller 38, outputs it to the D/A converters41a to 41d in response to the control signal of the controller 38 forevery detected output of the first acceleration transducers 12a to thefourth acceleration transducer 12d and then outputs it to the digitaloutput terminal D.
The parallel data outputted from the S-P converter 39 outputted to thedigital output terminal D is sent to the CPU 15 shown in FIG. 5; therebythe detected outputs of the first acceleration transducer 12a to thefourth acceleration transducer 12d can be analyzed, and the results ofthis analyzing process can be displayed in the display device 45 orprinted out in the printer 18 under an operator's operation at thekeyboard 16.
Then, if the setting of the rotational speed of the motor 4 is changedover in a stepwise manner under an operation of the switch 28, thestepwise acceleration is applied to the first acceleration transducer12a to the fourth acceleration transducer 12d in response to thechanging-over of the stepwise rotation, so that each of the outputs ofthe acceleration ration transducer at that time can be fed out andaccordingly a multi-stage programming for setting the acceleration canbe realized.
Then, the operation in the case that the instruction signals from thecalibration instruction switches Ta to Td and the channel specifyingsignals from the channel specifying switches Ca to Cd are sent towardthe first signal conditioner 50a to the fourth signal conditioner 50dwill be described.
For the sake of this description, it is typically described that thechannel specifying signals and the instruction signals are sent to thefirst signal conditioner 50a of the first channel of the first signalconditioner 50a to the fourth signal conditioner 50d.
It is of course apparent that the instruction signals and the channelspecifying signals can be similarly sent to the second signalconditioner 50b to the fourth signal conditioner 50d and in this caseeach of the channel specifying signals may be sent from each of thechannel specifying switches Cb to Cd.
As described above, in the event that the first channel specifyingsignal is sent to the first signal conditioner 50a of the first channeland a predetermined (+) calibration value signal is outputted to thesignal conditioner 50a, the calibration instruction switch Ta of thecalibration instruction switches Ta to Td is operated to send theinstruction signal to be calibrated to (+). In the event that apredetermined (-) calibration value signal is outputted, the calibrationinstruction switch Tb is operated.
In addition, in the event that a zero adjustment (an offset adjustment)is carried out, a zero-adjusting instruction signal is inputted from thezero adjustment switch Tc and when an auto-balance adjustment is carriedout, an auto-balance instruction signal is inputted from theauto-balance instruction switch Td.
Such an instruction signal and the channel specifying signal are sent tothe P-S converter 51, where the parallel signal is converted into aserial signal, thereafter the serial signal is outputted to themodulator 52. The modulator 52 modulates it in response to the controlsignal from the controller 38 and outputs it to the changing-over unit101c.
When all the aforesaid channel specifying signals and instructionsignals are outputted, the changing-over units 101a to 101c are changedover through a controller not shown so as to prevent a signal from beingtransmitted from the rotating part toward the fixed part and to enable asignal to be transmitted from the fixed side to the rotating part inturn.
Accordingly, the output signal of the modulator 52 is applied to thesecondary winding 36S of the rotary transformer 36 via changing-overunit 101c, and an output signal of the modulator 52 induced at theprimary winding 36P of the rotary transformer 36 is inputted to thedemodulator 53 through the changing-over unit 10lb. The demodulator 53demodulates the modulated signal, converts it into the serial data of"1" and "0", respectively, and feeds it to the S-P converter 54.
This S-P converter 54 converts the demodulated signal sent from thedemodulator 53 into the parallel data and sends the channel specifyingsignal and the instruction signal to the first signal conditioner 50a ofthe first channel.
With such an arrangement, the first signal conditioner 50a performseither one of the calibration, zero-adjustment and an auto-balancing inaccordance with either one of the instruction signals, i.e. (+), (-)calibration instructions, zero adjustment instruction and auto-balanceinstruction.
In the case of the second preferred embodiment of the present invention,the acceleration detected outputs of the first acceleration transducer12a to the fourth acceleration transducer 12d are inputted for each ofthe channels of the first signal conditioner 50a to the fourth signalconditioner 50d corresponding to these detected outputs, only one of thesignal conditioners 50a to 50d of four channels is selected in sequencein time-series, converted into a digital signal with the A/D converter33, thereafter the output is converted into a serial data with the P-Sconverter 34, each of "1" and "0" of the serial data is modulated into 2fHz and fHz with the modulator 35, the modulation signal is transmittedto the demodulator 37 disposed at the fixed side under a non-contactcondition through the rotary transformer 36 and then its output isconverted into the parallel data with the S-P converter 39.
Due to this fact, also in this preferred embodiment, the detectedoutputs of the first acceleration transducer 12a to the fourthacceleration transducer 12d can be transmitted from the rotary side tothe fixed side under a non-contact condition, no wear loss such as onefound in the prior art slip ring system occurs, and not only themaintenance can be eliminated, but also no occurrence of sliding noiseis found and then an S/N ratio can be improved and an accuratetransmittance of the data can be attained.
The system is constructed such that the channels can be specified foreach of the signal conditioners 50a to 50d and various instructionsignals can be transmitted and in this case the changing-over units 101ato 101c are changed over to the transmitting state from the fixed sideto the rotary side and the transmittance at the opposite side can beprohibited, so that the calibration operation for each of the signalconditioners 50a to 50d and an auto-balancing operation can be remotecontrolled at the fixed side and then a more convenient use can beattained and an accurate detecting output may always be attained.
In the second preferred embodiment, for a sake of description, the casein which an acceleration of the turn-table applied as a measured item isdetected by the first acceleration transducer 12a to the fourthacceleration transducer 12d has been described. However, the presentinvention can be applied for an overall system of a physicalamount--electrical amount transducer capable of detecting a physicalamount and converting it into an electrical signal, wherein for example,physical amounts such as torque, load, displacement, pressure,temperature, humidity or tile like in the rotary member are detectedusing a torque transducer, a load transducer, a displacement transducer,a pressure transducer, a temperature sensor and a humidity sensor or thelike.
Outputs of each of the physical amount-electrical amount transducers maybe directly connected to the multiplexer without any signal conditionerand in this case the outputs of each of the transducers are individuallychanged over in sequence by an output signal of the controller storingthe sequence counter therein and sent to the A/D converter 33.
Then, a configuration of the third preferred embodiment of the presentinvention will be described in detail mainly in reference to FIGS. 10 to13.
FIG. 10 is a block diagram for showing a circuit configuration of thecentrifugal type acceleration measuring device of the third preferredembodiment of the present invention. FIG. 11 is a front elevational viewfor showing an entire configuration of the third preferred embodiment ofthe present invention with a part being broken away. FIG. 12 is a topplan view for schematically indicating a state where the firstturn-tables having the measured acceleration transducer disposed thereonare rotatably arranged on the second turn-table. FIG. 13 is a wave-formdiagram for illustrating an operation of the third preferred embodiment.
In the third preferred embodiment, since it is in common with theaforesaid first and second preferred embodiments in many aspects, itsdual description is avoided as much as possible and its different partswill be described.
That is, in the first preferred embodiment shown in FIG. 1, theturn-table 5 (hereinafter sometimes called as "the second turn-table")supported by the air bearing 6 is rotationally driven by the motor 4 soas to apply a specified acceleration to the acceleration transducers 12ato 12d and a measurement (a calibration) of a so-called staticacceleration is carried out.
However, in case of the third preferred embodiment shown in FIGS. 11 to13, the turn-tables 60a to 60d (hereinafter sometimes called as "thefirst turn-table") supported by the air bearings 64a to 64d areconcurrently driven to rotate by motors 46a to 46d (46b and 46d are notshown) so as to perform a measurement (a calibration) of so-calleddynamic acceleration of each of the acceleration transducers 12a to 12d.
This system will be described in reference to FIGS. 11 and 12, whereinthe component parts rotationally. driving the second turn-table aresimilar to those shown in FIG. 1. However, tile component partsrotationally driving the first four turn-tables 60a to 60d in thepreferred embodiment rotatably supported on the second turn-table 5 aresubstantially similar to those of FIG. 1 except that their sizes aredifferent.
The first turn-tables 60a to 60d are rotatably supported under anon-contact condition by the air bearings 64a to 64d acting as the firstbearings in which the fixed supporting part is fixed to the high rigiddisk (a member corresponding to the stone surface plate 1) of the secondturn-table 5.
That is, the outer circumferential surfaces of the air bearings 64a to64d are provided with the air supplying part (not shown). To the airsupplying part is supplied either a part of air generated by an airsource shown in FIG. 2 and forcedly fed from an air cleaner 7 through anair supplying part 6a of the air bearing 6 or a compressed air fed to acentral part of the second turn-table 5 through a compressed air feedingpassage formed between the rotary side and the fixed side of the airbearing 6 via a proper supplying passage, thereby the rotary cylinder towhich the rotating shaft supporting parts 63a to 63d of the firstturn-tables 60a t to 60d is rotatably supported under a non-contactedcondition.
Since each of the rotary transformers T1a to T1b, encoders 47a to 47d,brushless motors 46a to 46d (hereinafter abbreviated as "motor"), airbearings 64a to 64d and rotating shaft supporting parts 63a to 63d has asimilar configuration as that of the aforesaid rotary transformers 13,36, encoder 22, motor 4, air bearing 6 and rotary shaft supporting part5, their further description will be eliminated.
As indicated by T1a to T1b, 47a to 47d . . . , for a sake ofdescription, affixes "a", "b", "c" and "d" are provided. However, all ofthem are partly illustrated in the drawings and some of them areeliminated. This is to avoid a complex illustration in the drawings andtotally speaking, "a" of "a to d" denotes component members related tothe first acceleration transducer 12a, "b" denotes the secondacceleration transducer 12b, "c" denotes the third accelerationtransducer, and "d" denotes the fourth acceleration transducer 12d,respective
On the first turn-tables 60a to 60d are disposed the accelerationtransducer mounting parts 61a to 61d for removably mounting and fixingeach of them. Under the mounted conditions, in particular, theacceleration transducer mounting parts 61ato 61d are constructed in sucha way as the centers of the sensitive parts of the accelerationtransducers 12a to 12d coincide with the rotational centers of the firstturn-tables 60a to 60d.
With such an arrangement, the acceleration transducers 12a to 12d areconstructed such that the sensitive shafts are rotated around thecenters thereof as the first turn-tables 60a to 60d are rotated.
In addition, at the central parts of the first turn-tables 60a to 60dare formed the hollow barrels 62a to 62d. In the hollow barrels arestored the signal conditioners 50a to 50d, A/D converters 33a to 33d,P-S transducers 35a to 35d and controllers 32a to 32d or the like in thesame manner as that described in reference to FIG. 3.
In this preferred embodiment, the first turn-tables 60a to 60d aredisposed in four positions in equally-spaced apart relation in 90°spacing and at positions spaced at a distance of R from a rotary centerof the second turn-table 5. The acceleration transducers 12a to 12d aremounted one-by-one and fixed on each of the acceleration transducermounting parts 61a to 61d.
A transmitting system and a processing system for the detecting methodin the third preferred embodiment will be described mainly in referenceto FIG. 10.
This preferred embodiment is constructed such that each of theaccelerations of the four acceleration transducers 12a to 12d can bemeasured, respectively and for a sake of avoidance of complexity indescription, the measurement of one acceleration transducer 12a will bedescribed.
The acceleration transducer 12a receives a specified accelerationcorresponding to a rotational speed and a rotating radius of the secondturn-table 5.
At this time, the acceleration transducer 12a is made such that when itssensitive shaft coincides with a radiation axis passing through therotational center O of the second turn-table 5 and a positive (+)direction of the sensitive shaft is directed toward the rotationalcenter O, a detection output of positive (+) corresponding to thespecified centrifugal acceleration and in turn the direction directs ina direction opposite to that of the rotational center O, the detectionoutput corresponding to the specified centrifugal acceleration ofnegative (-) can be attained.
To the contrary, as the sensitive shaft is displaced from 0° to 90° inrespect to the radial axis of the second turn-table, the accelerationcomponent acting against the sensitive part of the accelerationtransducer 12a is decreased due to the reason described below and thedetected output is decreased from the positive maximum value to 0.
In addition, as the sensitive shaft is displaced from 90° to 180° inrespect to the radial axis of the second turn-table, an accelerationcomponent acting against the sensitive part of the accelerationtransducer 12a is gradually increased in a negative direction, thedetected output is varied from 0 to the negative maximum value andsubsequently as the sensitive shaft is displaced from 180° to 270° and270° to 360° in the same manner, the detected output is varied from thenegative maximum value to 0 and from 0 to the positive maximum value.
This phenomenon is expressed by the following general equation. Atfirst, a distance from the rotational center of the first turn-table 60ato the rotational center O of the second turn-table 5 (an eccentricdistance) is defined as R, an angular velocity of the second turn-table5 is ω₁ (rate of the revolution: N₁ rpm), an angular velocity of thesecond turn-table 5 is ω₂ (number of revolution: N₂ rpm), anacceleration α₁ indicated in the following equation may act against thefirst turn-table 60a and the acceleration transducer 13a mounted at thesame position as that of the first turn-table 60a.
α.sub.1 =R·ω.sub.1.sup.2 =R·(2·π·N.sub.1 /60).sup.2 (1)
To the sensitive part of the acceleration transducer 12a disposed on thefirst turn-table 60a is acted an acceleration corresponding to adisplacement angle θ of the sensitive shaft against the radial axis,wherein θ=0° (360°) is attained, an acceleration +α₂ of the positivepeak value may act and in turn when θ=180° is attained, an acceleration-α₂ of a negative peak value may act.
A relation between the acceleration α₂ and the displacement angle θ isexpressed as follows. ##EQU1##
If it is assumed that the first turn-table 60a is rotated at a specifiedrate of revolution N₂ (rpm) from an angular position of θ=0°, theacceleration α₂ acting against the sensitive part after a second of (t)is expressed by
α.sub.2 =R·(2·π·N.sub.1 /60).sup.2 ·cos (2·π·N.sub.2 /60)t (3)
due to a relation of
θ=(2·π·N.sub.2 /60)·t
FIG.13 indicates a relation of the displacement angle θ of the sensitiveshaft of the acceleration transducer 60a in respect to the radiationaxis, time and variation of the acceleration.
The circuit configurations of the third preferred embodiment differingfrom those of the aforesaid first preferred embodiment or the secondpreferred embodiment will be described in reference to the block diagramshown in FIG. 10.
Although the basic configurations of the acceleration transducer 12a,signal conditioner 50a, A/D converter 33a, P-S converter 34a, modulator35a and controller 32aare the same as those shown in FIGS. 4 and 9, theA/D converter 33a to modulator 35a and the controller 32a are common toeach of the acceleration transducers 12a to 12d as shown in FIG. 4 andthey are different in view of the fact that they are exclusive in theacceleration transducer 12a, so that the multiplexer or thechanging-over unit is not used.
Each of the controllers 32a to 32d may receive a control signal of themain controller 38 through the rotary transformers T5 and T3a to T3d,instruct an A/D conversion against the A/D converters 33a to 33d under apredetermined order, execute a modulating operation against themodulators 35a to 35d and at the same time overlap the discriminatingsignal for specifying each of the measurement channels against each ofthe modulators 35a to 35d before or after the measured data.
A regulator 48 is applied for supplying a predetermined operatingvoltage to the acceleration transducer 12a and the signal conditioner50a or the like, wherein it receives a power generated at the externalpower supply 23 disposed at the fixed part C through a rotarytransformer T4 disposed between the fixed part C and the secondturn-table 5, and through a rotary transformer T1a disposed between thesecond turn-table 5 and the first turn-table 60a in sequence and adjustsit to a predetermined voltage.
In this way, a part enclosed by a broken line in FIG. 10 mounted in thefirst turn-table 60a is defined as the first rotary measuring part Aaand similarly the parts mounted on the second, third and fourthturn-tables 60b, 60c and 60d are defined as the second, third and fourthrotary measuring portions Ab, Ac and Ad, respectively.
Modulation outputs outputted from each of the modulators 35a to 35d areinputted to the mixer 45 through each of the rotary transformers T2a toT2d.
The mixer 45 is comprised of a plurality of OR circuits or buffers so asto transmit any one of the modulation signals inputted in sequence fromeach of the rotary transformers T2a to T2d to the rear stage demodulator37 through the rotary transformer T6.
The demodulator 37 receiving the modulation signal demodulate themeasured data of the induction signal of the secondary winding of therotary. transformer T6 into the digital signal by the control signaloutputted from the main controller 38 and outputs it to the aforesaidS-P converter 39, and at the same time the demodulator demodulates thediscrimination data of the induction signal overlapped to the modulationsignal to the digital signal and outputs it to the main controller 38.
As described above, the S-P converter 39 converts a digital serial dataoutputted from the demodulator 37 into a parallel data of 12-bits, forexample.
The parallel data is made such that a discriminating signal overlappedby the modulators 35a to 35d in the four latch circuits 40a to 40d isinterpreted in response to an instruction signal from the maincontroller 38, and the main controller 38 selects the correspondinglatch circuits 40a to 40d in response to the result of interpretationand latches them.
Subsequent D/A converters 41a to 41d, BCD converter 42 and displaydevice 43 or the like are similar to those described in reference toFIG. 4.
The signal processing circuit 44 is operated such that the measured datainputted from the D/A converters 41a to 41d are applied for analyzingthe detected outputs of acceleration in response to the controlinstruction of the main controller 38 forming a part of the CPU andfurther performs various data processings under an operator's operationof the keyboard 16, and results of processing are displayed at thedisplay device 43.
Motor 4, encoder 22, pulse generator 20 and motor controller 1 aresimilar to those shown in FIG. 4.
The motor controller 21 is constructed such it performs not only arotational control over the motor 4 for rotating the second turn-table5, but also performs a rotational control of the motors 46a to 46d forrotationally driving the first four turn-tables 60a to 60d.
That is, the driving outputs M1 to M4 are supplied from the motorcontroller 21 to each of the motors 46a to 46d through the rotarytransformers T7a to T7d, the number of revolution (a rotational angularvelocity) of each of the motors 46a to 46d is measured, and the outputsC1 to C4 of the encoders 47a to 47d encoded are inputted to the motorcontroller 21 through the rotary transformers T8a to T8d.
The aforesaid rotary transformers T4, T5, T6, T7a to T7d, and T8a to T8dare disposed between the fixed side C and the rotary side B on thesecond turn-table 5, and the transformers T1a to T1d, T2a to T2d and T3ato T3d are disposed between the rotary side B and each of the rotationmeasuring parts Aa to Ad on the first turn-tables 60a to 60d,respectively.
The switch 28 is used for specifying the rotational speeds of the motor4 and the motors 46a to 46d to the motor controller 21, the rate ofrevolution of the motor 4 is specified, thereby the acceleration to begiven to the acceleration transducers 12a to 12d is set, a rotationalspeed of each of the motors 46a to 46d is specified and then an outputof modulation component of a desired frequency can be taken out of theacceleration transducers 12a to 12d and thus a characteristic offrequency of each of the acceleration transducers 12a to 12d can bemeasured.
Operation of the third preferred embodiment constructed as above will bedescribed.
At first, electrical power is supplied from the external power supply 23to the regulator 24 through the rotary transformer T4, an AC voltagesupplied from the external power supply 23 is rectified into a DCvoltage with this regulator 24, thereafter the voltage is changed to aspecified voltage and an operating power supply is supplied to theencoders 47a to 47d and the mixer 45 or the like.
The electrical power received by the rotary transformer T4 is suppliedto the regulators 48a to 48d disposed at each of the rotation measuringparts Aa to Ad through the rotary transformers T1a to T1d. A specifiedDC voltage is attained by the regulators 48a to 48d in the same manneras described above and then an operating power supply is fed to theacceleration transducers 12a to 12d, signal conditioners 50a to 50d andthe controller 32 or the like.
Rotational speeds of the motors 4, 46a to 46d are set under an operationof the switch 28 shown in FIGS. 2 and 10, thereby a value ofacceleration given to each of the acceleration transducers 12a to 12dand a frequency of modulated frequency component of the accelerationtransducers are set. The set rotational speeds and the frequencies aredisplayed in the display device 43.
Controlling operations for the motor 4 and motors 46a to 46d aresubstantially similar to those of the first preferred embodiment exceptthe set rotational speed, so that their description will be eliminated.
The acceleration transducers 12a to 12d may receive the acceleration α₁based on the above equation (1) through the second turn-table 5 rotatedat the set rate of revolution N₁, and its sensitive part may receive acomponent of force (cosθ) of α₁ corresponding to the displacement angleθ and receive an acceleration α₂ based on the above equations (2) or(3).
The detected outputs from each of the acceleration transducers 12a to12d corresponding to the acceleration α₂ are processed under a controlof the controller 32a in the same manner as that of the aforesaid firstpreferred embodiment under an arrangement of the signal conditioners 50ato 50d, A/D converters 33a to 33d, P-S converter 34a and modulators 35ato 35d included in each of the first to fourth rotation measuring partsAa to Ad, respectively. Finally, the frequencies of the outputs aremodulated from the modulators 35a to 35d and then outputted as thedetected data D1 to D6 to the rotary transformers T2a to T2d.
At this time, as described above, the discrimination signal is alsomodulated in its frequency and outputted from each of the modulators 35ato 35d.
The detected data D1 to D4 and discrimination data transmitted to therotary side B through the rotary transformers T2a to T2d are inputted tothe mixer 21.
The mixer 45 passes the detected data D1 to D4 one by one selectivelyoutputted in sequence on the basis of a time-sharing process from thefour modulators 35a to 35d under a control of each of the controllers32a to 32d and transmits the data to the demodulator 37 through therotary transformer T6.
Modulated signals of the serial detected data D1 to D4 inputted to thedemodulator 37 in this way are processed in the same manner as that ofthe first preferred embodiment under a control of the main controller 38by the S-P converter 39, latch circuits 40a to 40d, D/A converters 41ato 41d and BCD converter 42 and further displayed in the displayingdevice 43 under a control of the signal processing circuit 44.
Parallel data outputted from the S-P converter 39 is sent to the CPU 15shown in FIG. 5 to enable the detected outputs of the first accelerationtransducer 12a to the fourth acceleration transducer 12d to be analyzedand the results of analyzation can be displayed in the display device asdescribed above by giving an input signal K under an operation of theoperator at the keyboard 16 or printed out at the printer 18 by giving aprinting signal P.
According to the third preferred embodiment, since the system isconstructed as above, an occurrence of noise or wear at the motors 4 and46a to 46d is eliminated in the same manner as those of the first andsecond preferred embodiments, and maintenance work is eliminated and atthe same time a low consumption power can be realized, sliding noise isnot overlapped on the detected outputs, an S/N ratio can be improved andan entire small size can be realized.
Since the first turn-tables 60a to 60d and the second turn-table 5 arerotatably supported by the air bearings 64a to 64d under a non-contactstate, rotational accuracy in any direction of thrust or radial can beincreased up to about 0.05 μm, and not only a static acceleration butalso a dynamic acceleration added with a frequency modulation componentcan be given to the sensitive parts of the acceleration transducers 12ato 12d and it is possible to measure the outputs of the accelerationtransducers 12a to 12d in a wide range of frequency region and tomeasure (or calibrate) a characteristic in a low frequency range of 0 to20 Hz which was impossible in the prior art with an accuracy of 0.3% orless.
Accordingly, if the third preferred embodiment of the present inventionis used as the acceleration calibration device, it is possible toperform a calibration over a wide frequency range including a lowfrequency range at an accuracy of calibration more than 10 times ascompared to the prior art comparing calibration system and further it ispossible to get an accuracy in calibration less than 0.3% over about 1%in calibration accuracy of the prior art absolute system. In addition, acalibration at the frequency range of 0 to 20 Hz which was impossible inthe absolute system can be accomplished at an accuracy less than 0.3 %.
A gist of the third preferred embodiment of the present invention is notlimited to that described above and illustrated in the drawings andvarious modifications can be attained without departing from the scopeof its gist.
For example, the number of the first turn-tables is not limited to four,but two, three or more than four turn-tables can be disposed. Providedthat it is preferable that their arranging angles are equally spacedapart in order to keep their rotational balance (a dynamic balance).
Rotational directions of a plurality of first turn-tables may be in thesame directions or opposite directions and in order to keep the dynamicbalance, it is preferable that they are rotated in the oppositedirections to each other.
Although as material quality of the air bearings at the fixed side androtary side, stainless steel, ceramics, and carbonic material, aluminumor the like are used, it is preferable that the ceramics are combined toeach other and a stainless steel material and a carbonic material arecombined to each other so as not to make any seizure when the supplyingof air is terminated.
What is claimed is:
1. A centrifugal type acceleration measuring devicecomprising a turn-table directly driven by a brushless motor and havingan acceleration transducer mounting part for fixing a measuredacceleration transducer formed at a location displaced from a rotationalcenter thereof; an air bearing rotatably supporting the turn-table; anamplifier for individually amplifying outputs of the accelerationtransducer fixed to said acceleration transducer mounting part of saidturn-table; and a rotary transformer for transmitting a signal outputtedfrom the amplifier characterized in that the rate of revolution of saidbrushless motor is varied to apply a predetermined acceleration to saidmeasured acceleration transducer and the output of said measuredacceleration transducer at that time is fed to the fixed side of saidrotary transformer through said rotary transformer.
2. A centrifugaltype acceleration measuring device comprising a turn-table directlydriven by a brushless motor and having an acceleration transducermounting part for fixing a measured acceleration transducer formed at alocation displaced from a rotational center thereof; an air bearing forrotatably supporting the turn-table; signal adjusting means for at leastamplifying an output of the acceleration transducer fixed to saidacceleration transducer mounting part of said turn-table; a first signalprocessing means for converting a parallel signal outputted from thesignal adjusting means into a digital serial signal, thereafterperforming a modulating process on said serial signal; a rotarytransformer having its rotary side rotated together with said measuredacceleration transducer and for transmitting an output of said firstsignal processing means from the rotary side to the fixed side of saidrotary transformer; and a second signal processing means fordemodulating a signal transmitted to the fixed side of the rotarytransformer and performing a converting process of the signal into aserial signal.
3. A centrifugal type measuring device comprising aturn-table directly driven by a brushless motor and having anacceleration transducer mounting part for fixing a measured accelerationtransducer formed at a location displaced from a rotational center; anair bearing for rotatably supporting the turn-table; signal adjustingmeans for performing a function for receiving a detected output of theacceleration transducer fixed to said acceleration transducer mountingpart of said turn-table and amplifying it, a function for outputting acalibration value signal and a function for removing a non-balancedcomponent in a bridge circuit or the like; a first signal processingmeans for converting a parallel signal having a signal outputted fromthe signal adjusting means into a serial digital signal, and forthereafter modulating it; a rotary transformer having its rotary siderotated together with said measured acceleration transducer and fortransmitting an output of said first signal processing means from therotary side to the fixed side of said rotary transformer; a secondsignal processing means for demodulating a signal transmitted to thefixed side of the rotary transformer and converting it into a serialsignal; instruction signal generating means for generating aninstruction signal such as said calibration value signal outputinstruction for controlling said signal adjusting means and a balanceadjusting instruction in said bridge circuit or the like from said fixedside; a third signal processing means for converting a parallelinstruction signal outputted from the instruction signal generatingmeans into a serial signal, and thereafter modulating it; changing-overmeans for transmitting an output signal of said first signal processingmeans to said second signal processing means through said rotarytransformer when said instruction signal is not generated, preventing asignal outputted from said first signal processing means from beingtransmitted to said second signal processing means when said instructionsignal is generated, and transmitting an output of said third signalprocessing means from the fixed side of said rotary transformer to therotary side; and a fourth signal processing means for demodulating anoutput signal of said third signal processing means transmitted from thefixed side to the rotary side of said rotary transformer, converting itinto a parallel signal and outputting it to said signal adjusting means.4. A centrifugal type acceleration comprising first turn-tables eachdirectly connected to and rotationally driving by a first brushlessmotor and having an acceleration transducer mounting part for fixing ameasured acceleration transducer in such a way as a center of thesensitive part of a measured acceleration transducer may become arotational center; a first bearing for rotatably supporting each of thefirst turn-tables; a second turn-table directly connected to androtationally driven by a second brushless motor and having said firstturn-tables disposed thereon at locations displaced from the rotationalcenter thereof on each said first bearing; a second bearing composed ofan air bearing for rotatably supporting the second turn-table; anamplifier for individually amplifying an output of the acceleratingtransducer fixed to each of the acceleration transducer mounting part onsaid first turn-tables; a first rotary transformer for each said firstturn-tables for transmitting a signal outputted from the correspondingamplifier to said second turn-table; and a second rotary transformer fortransmitting a signal transmitted by each first rotary transformer fromsaid second turn-table to the fixed part of said second rotarytransformer characterized in that a predetermined acceleration is givento said first turn-tables by varying the rate of revolution of saidsecond brushless motor, each said first brushless motor is rotated tocause the sensitive shaft of the corresponding measured accelerationtransducer to be rotated around said sensitive part of such measuredacceleration transducer mounted on each of said first turn-tables toapply a frequency modulating component to the output of such measuredacceleration transducer, and the outputs of measured accelerationtransducers are fed out in sequence through said first and second rotarytransformers to the fixed side of each second rotary transformer. | 2024-03-22 | 1992-01-28 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1994-10-11"
} |
US-73010796-A | Enhanced breast imaging/biopsy system employing targeted ultrasound
ABSTRACT
The present invention provides for x-ray imaging and ultrasound imaging of a body region of interest in a spatially correlatable manner. The resultant x-ray and ultrasound images may be combinatively employed to provide three-dimensional information regarding a location of interest within the body, and is particularly apt for use in the analysis/biopsy of potential lesions and suspicious masses in a female breast. The invention provides for direct body contact by an ultrasound imaging head, as well as targeted ultrasound imaging of a selected portion of the region from which x-ray images are obtained.
FIELD OF THE INVENTION
The present invention relates to medical imaging/biopsy systems, andmore particularly, to an enhanced system that employs x-ray imaging andtargeted ultrasound imaging in a combinative, spatially correlatablemanner that is particularly apt for breast imaging/biopsy procedures.
BACKGROUND OF THE INVENTION
The benefits of early detection and tissue diagnosis of potentiallesions and/or suspicious masses within the body is now wellestablished. Indeed, as medical practice and managed care plans continueto evolve, the role of early detection and tissue diagnosis isever-increasing. With such emphasis, both efficacy and efficiency are ata premium. Specifically, reduction of the time requirements of highlytrained medical personnel, patient office visits and medical equipmentcosts (e.g., via use of multiple-purpose equipment) are primaryobjectives for procedures utilized in the early detection and tissuediagnosis of potential lesions and otherwise suspicious masses.
Of particular ongoing interest is the area of mammography and breastbiopsy. Currently, it is common for patients to receive regularscreening mammograms, wherein two x-ray images are generated for eachbreast in order to identify potential lesions or masses suspicious formalignancy. In the event of equivocal screening mammograms, furtherx-ray or ultrasound imaging/exams may be performed to obtain additionalinformation. The obtainment of a diagnostic mammogram and/or anultrasound exam requires another patient office visit and additionalmedical personnel time. For example, if the presence of a suspiciousmass is confirmed, an ultrasound procedure is performed in order tofurther characterize the mass. Specifically, a free-hand procedure isperformed in which a hand-held ultrasound probe is manipulated on thebreast while viewing a display to obtain depth-profile information. Ascan be appreciated, location of a potential lesion/suspicious mass canbe difficult, and the ultrasound images obtained are frequentlydifficult to mentally associate with the x-ray images. As such, theability to utilize ultrasound technologists as opposed to experiencedphysician specialists to perform most breast ultrasound procedures islimited.
Should a breast lesion show signs of malignancy pursuant to diagnosticmammography or ultrasound, a breast biopsy is typically performed.Needle localized surgical biopsy means have recently been giving way tostereotactic x-ray biopsy with automated core needles and tissue removalsystems. A patient is typically positioned prone (e.g., on a solidtable) with the breast immobilized within a predetermined frame ofreference (e.g., the breast passes through an opening in the table andis immobilized between opposing compression plates). Stereotactic X-rayimages are then generated (e.g., via x-ray film or digital imaging) forreview by medical personnel to identify a specific location of interest(e.g., corresponding with a potential lesion or suspicious mass) withinthe predetermined frame of reference. A puncture instrument, mounted inpredetermined relation to the predetermined frame of reference, is thenpositioned/utilized to obtain a sample of tissue from the location ofinterest. Of note, current state-of-the-art breast biopsy systemsinclude the MAMMOTEST® and MAMMOVISION® products offered by FischerImaging Corporation of Denver, Colo. Such system is further described inU.S. Pat. Nos. 5,078,142, 5,240,011 and 5,415,169, hereby incorporatedby reference in their entirety.
While all breast lesions may typically be biopsied utilizingstereotactic x-ray imaging, only recently have technical improvements inultrasound allowed certain lesions to be biopsied under ultrasoundguidance (i.e., with hand-held ultrasound probe and/or biopsy means). Inthis regard, ultrasound may be preferred due to the lack of ionizingradiation and the availability of real time imaging to reduce proceduretime.
Recent developments in tissue removal systems have resulted in larger,heavier devices that are difficult for a physician to use in conjunctionwith free-hand ultrasound guidance. As an example, the MAMMOTOME® fromBiopsys Medical, Inc. of Irvine, Calif. allows rapid removal of breasttissue through a small puncture hole in the breast. Due to the weightand size of the device, physicians are performing more stereotacticx-ray procedures with the MAMMOTOME® due to the solid support of thedevice by prone stereotactic tables.
In the event that analysis of tissue by histopathologic techniquesindicates that a lesion or undesirable mass should be removed from abreast, the surgeon will typically review the various breast imagespreviously obtained to develop a therapeutic surgical strategy, with thegoal of removing the entire potential lesion and/or suspicious masswhile achieving acceptable cosmetic results.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide an enhancedimaging/biopsy system that can reduce trained medical personnel timerequirements in diagnostic and biopsy procedures for tissue diagnosis.It is a related objective to provide such a system in a cost-effectivemanner; namely through the provision of a system having relativelyexpensive components that can be utilized for multiple medicalprocedures combinatively employed in a single system.
A further objective of the present invention is to provide an enhancedimaging/biopsy system for obtaining spatially correlatedthree-dimensional image information regarding a location of interest inthe body, such system being apt for the obtainment of three-dimensionalimage information regarding a potential lesion or suspicious mass in afemale patient's breast. It is a further objective to provide suchinformation in a manner allowing for enhanced use of tissue removalsystems used for obtaining tissue samples from the body, includingspecifically, tissue from a potential lesion or suspicious mass within afemale patient's breast.
These and additional objectives are met by the present invention throughcombinative use of x-ray imaging and targeted ultrasound imaging. Moreparticularly, the present invention provides for the transmission ofx-ray radiation through a selected body region-of-interest within apredetermined, three-dimensional frame of reference to obtain x-rayimage data corresponding with one or more x-ray images. Additionally, anultrasound signal is directed into a limited, selectively targetedportion of the x-rayed body region of interest to provide ultrasoundimage data corresponding with one or more ultrasound images of thetargeted portion of the selected body region. The x-ray and ultrasoundimage data are acquired in spatial co-relation by utilizing x-rayimaging means and ultrasound imaging means each supportably positionedin known co-relation to the predetermined, three-dimensional frame ofreference. This arrangement allows the x-ray and ultrasound image datato combinatively provide correlated, three-dimensional image datacorresponding with the body region of interest. In turn, the spatiallycorrelated information allows for an enhanced medical diagnosis of agiven location of interest within the body region (e.g., potentiallesion or suspicious mass in a breast application) and enhanced biopsyoptions in relation thereto.
In one aspect of the present invention, the ultrasound imaging means isadvantageously positionable in direct contact with the body region ofinterest for optimal ultrasound image acquisition. More particularly, inbreast imaging applications, opposing compression plates may be employedto immobilize a patient's breast within the predetermined,three-dimensional frame of reference, wherein an opening is provided inone of the compression plates for selectively positioning an ultrasoundimaging head (e.g., comprising a linear ultrasound transducer array)therethrough in contact with the patient's breast for imaging.
In another aspect of the present invention, a locating means (e.g., animage data processor with display/user interface) is provided for usingthe x-ray and ultrasound image data to identify a particular location ofinterest within the body region of interest; and a biopsy means isprovided for obtaining a sample from the identified location ofinterest. In this regard, the biopsy means may include positioning meansfor selectively and supportably positioning an elongated punctureinstrument or other tissue removal system relative to the predetermined,three-dimensional frame of reference, including for example positioningat a desired entry angle.
In a further related aspect of the present invention, the ultrasoundimaging means may also comprise a means for selectively positioning anelongated ultrasound imaging head in a known position relative to thepredetermined, three-dimensional frame of reference, includingangulation of the ultrasound imaging head relative to the predeterminedframe of reference. In the latter regard, the imaging head may be angledto image a layer, or "slice," of the body region of interest from adirection orthogonal to a direction from which an angled punctureinstrument or other tissue-removal system may be advanced within suchlayer (i.e., the longitudinal axes of the imaging head and punctureinstrument are parallel). Such ultrasound imaging allows for processorsimulation/display of a biopsy procedure using a tissue-removal systemfrom a given biopsy position, as well as real-time imaging/control of abiopsy device as it is actually advanced into the body region ofinterest.
As indicated above, the acquired x-ray images may be employed to selecta limited, or targeted, portion of the x-rayed body region of interestto be imaged utilizing the ultrasound signal. Such targeted ultrasoundimaging avoids the acquisition, storage and processing of unneededimaging data, and otherwise facilitates efficient use of medicalpersonnel time, and otherwise advantageously accommodates direct contactwith the body portion to be imaged.
Additional features and advantages of the present invention will becomeapparent upon consideration of the further description provided herein.
DESCRIPTION OF THE DRAWINGS
FIG. 1 is a top view of a stereotactic x-ray imaging system withintegrated ultrasound imaging and biopsy components combinativelydefining one embodiment of the present invention with a centralpatient/table portion cutaway to show key components.
FIG. 2 is a partial end cross-sectional view of the embodiment of FIG. 1cut along AA.
FIG. 3 is a partial side cross-sectional view of the embodiment of FIG.1 cut along BB.
FIG. 4 is a perspective view of the immobilization, ultrasound imagingand biopsy assemblies of the embodiment of FIG. 1.
FIG. 5 is a perspective view of an ultrasound imaging head employable inthe present invention.
FIG. 6 illustrates spatially correlated x-ray and ultrasound images of apotential breast lesion/suspicious mass obtainable with the presentinvention.
DETAILED DESCRIPTION
FIGS. 1-6 illustrate a diagnostic ultrasound/x-ray biopsy systemembodiment of the present invention, as adapted for mammography/breastbiopsy use.
Generally, the system comprises a support assembly 10 having a patienttable 12 with breast-opening 14 therethrough, an immobilization assembly30 for immobilizing a patient's breast within a predetermined XYZ frameof reference under the opening 14 of table 12, an x-ray imaging assembly40 for providing two-dimensional x-ray images (e.g., X-Y images) of thepatient's immobilized breast in correlated spatial relation to thepredetermined XYZ frame of reference, and an ultrasound imaging assembly100 for providing orthogonal depth-profile images (e.g., X-Z, Y-Z and/orX,Y-Z images) of the immobilized breast in correlated spatial relationto the predetermined XYZ frame of reference. A biopsy assembly 50 havingpuncture instrument 52 is also provided for obtaining samples from apatient's breast while the breast is immobilized in the predeterminedXYZ frame of reference. A display/processor assembly 60 is provided forrecording/displaying the various images obtained/generated, fordetermining the coordinates of a user-identified location of interestwithin the breast and for monitoring/controlling/simulating the positionof the various positionable assembly components.
As will be appreciated, the illustrated embodiment may utilize thex-ray, automated biopsy and other functionalities embodied in thecurrent MAMMOTEST® and MAMMOVISION® products of Fischer Imaging Corp. ofDenver, Colo., U.S.A. In this regard, the present invention allows forthe integration and effective use of ultrasound imaging with suchproducts, thereby allowing medical equipment cost efficiencies to berealized. As noted previously, the MAMMOTEST® and MAMMOVISION® productsinclude features corresponding with the disclosures in U.S. Pat. Nos.5,078,142, 5,240,011 and 5,415,169, which are incorporated by referencein their entirety.
Support assembly 10 further includes pedestal 16 and cantilevered firstand second support arms 20 and 22, respectively, for supportablyinterfacing the breast immobilization assembly 30, x-ray imagingassembly 40, ultrasound imaging assembly 100 and biopsy assembly 50 in apredetermined spatially correlated manner. First and second supportsarms 20 and 22 can be jointly pivoted relative to pedestal 16, therebyproviding imaging/biopsy access to the breast from different directions(e.g., 0°, +90° and -90° relative to the table longitudinal axis).Additionally, second support arm 22 can be selectively pivoted relativeto first support arm 20, to provide for stereotactic x-ray imaging(e.g., +15° and -15° relative to the first support arm longitudinalaxis).
Breast immobilization assembly 30 is supported on first support arm 20and includes a stationary face plate 32 and opposing compression paddle34 for immobilizing a patient's breast therebetween. Compression paddle34 is x-ray transmittent and further includes a window 36 for directbreast access by the ultrasound imaging assembly 100 and/or biopsyassembly 50. Compression paddle 34 is selectively positionable alongfirst support arm 20 (e.g., via motorized and position sensor systems)for controlled, registered movement toward/away from face plate 32 toaccommodate breast positioning/removal and differing breast sizes.Compression paddle 34 can be readily removed from/interconnected to thefirst support arm 20 to accommodate the selective use of compressionpaddles of differing sizes, shapes, window positions, etc. As shown inFIG. 1, compression assembly 30 may further include selectivelyadvanceable/retractable auxiliary side paddles 38, each having optionalopenings for breast access (e.g., by a puncture instrument or anultrasound imaging head) for further compression/breast immobilizationwithin the predetermined XYZ frame of reference, and particularly duringuse of biopsy assembly 50. In this regard, compression paddle 34 andface plate 32 are intended to define a breast imaging area ofsubstantially common thickness and to immobilize such area duringimaging/biopsy procedures, and to otherwise provide direct access to thebreast for targeted ultrasound imaging/biopsy procedures.
X-ray imaging assembly 40 includes x-ray tube source 42 mounted on theend of second support arm 22 and x-ray receiver/imager 44 mounted onfirst support arm 20. As will be appreciated, x-ray tube source 42provides x-ray radiation having a center axis C substantiallyperpendicular to the fronts of face plate 34 and x-ray receiver/imager44, such x-ray radiation having a focal point positioned along thecenter axis C at a determinable location between the face plate 32 andcompression paddle 34 during use. In this regard, and by way of exampleonly, the predetermined XYZ frame of reference can be defined in theillustrated embodiment in relation to an X-Y plane corresponding withthe front surface of the face plate 32 and/or parallel back surface ofcompression paddle 34, together with orthogonal X-Z and Y-Z planeswithin which the x-ray radiation center axis passes (i.e., all threeplanes being orthogonal). X-ray opaque markings (not shown) can beprovided on compression paddle 34 and/or face plate 32 to facilitatespatial correlation of the radiation center axes and x-rayreceiver/imager.
In the illustrated embodiment, the x-ray receiver/imager 44 is disposedin abutting relation with the face plate 32. X-ray receiver/imager 44may comprise an image receptor consisting of a removable radiographicfilm cassette (e.g., for full-field breast imaging) and/or digitalcamera (e.g., for partial field, real-time imaging/display). In thelatter regard, a partial field, digital CCD camera 46 (e.g., having a 5mm×10 mm or 5 mm×5 mm imaging area) may be disposed for selective,driven XY movement (e.g., via a servo-drive arrangement) in registeredrelation to the predetermined XYZ frame of reference.
In the illustrated embodiment, ultrasound imaging assembly 100 andbiopsy assembly 50 are selectively and alternatively connectable toopposing sides of first support arm 20 via connection/locking handles102 and 55, respectively. Additionally, biopsy assembly 50 may bemounted in an axially aligned manner on first support arm 20 for breastaccess through window 36. A reference, or "home," position for eachassembly in a given mounted location is known relative to thepredetermine XYZ frame of reference. Further, positioning of the variouscomponents of each assembly during use is automatically determinable viaposition sensor/control systems. As will be appreciated, suchpositioning can be automated via corresponding processor-controlled,servo motors.
Biopsy assembly 50 comprises a punction sub-assembly 54, which includespuncture instrument 52, and positioner sub-assembly 56. Positionersub-assembly 56 includes horizontal axis and vertical control motors 58and 60, respectively, for selective sideward movement and upwardangulation of the punction instrument 52. By way of example, punctionsub-assembly 56 may comprise the AUTOGUIDE™ assembly of Fischer ImagingCorporation. As will become appreciated, the illustrated embodiment maybe particularly apt for use with punction subassemblies for obtainingsamples having relatively large cross-sections, including, for example,the MAMMOTOME® from Biopsys Medical, Inc. of Irvine, Calif.
Ultrasound imaging assembly 100 comprises an ultrasound imaging head, orprobe, 110 interconnected to arm assembly 130 and, in turn, to XYZultrasound positioning assembly 140. As will be further explained, XYZultrasound positioning assembly 140 is employed to selectively positionultrasound imaging head 110 through the window 36 of compression paddle34 to establish direct breast contact for targeted ultrasound imaging indeterminable spatial relation to the predetermined XYZ frame ofreference.
As shown in FIG. 5, ultrasound probe 110 may include an elongatedhousing 112 with an elongated ultrasound transducer module 114positioned therein. Ultrasound transducer module 114 provides anultrasound signal having a focal point on a signal center axis at alocation between compression paddle 34 and face plate 32. Ultrasoundtransducer module 114 may include, for example, a phased linear array ofultrasound transducers positioned along a longitudinal axis of theultrasound probe 110. The ultrasound probe 110 emits signal pulses anddetects corresponding echo pulses to generate the depth-profile images.More particularly, and as will be appreciated by those skilled in theart, detected echo pulses will result from ultrasound transmissivitydifferences (i.e., ultrasound impedance mismatches) at tissue-typetransition areas (e.g., transitions between healthy tissue and apotential lesion/suspicious mass) and at structural obstructions (e.g.,the front surface of face plate 32). The housing 112 of ultrasound probe110 may include a recess 118 (exaggerated in FIG. 5) for receiving acold-pack 120 for orthogonal application to a biopsy site after a biopsyprocedure. Applying pressure and a cold medium directly over a biopsysite in the breast has been shown to reduce hematoma bleeding andbruising.
XYZ ultrasound positioning assembly 140 includes X, Y and Z platforms142, 146 and 148, respectively, mounted for selective, registeredmovement on corresponding support members 152, 156 and 158 relative tothe predetermined XYZ frame of reference. In this regard, XYZpositioning assembly 140 may include internal X, Y and Z opticalposition encoders. XYZ positioning assembly 140 can further include X, Yand Z motor drives for automatic, selective positioning of ultrasoundimaging head 110 in registered XYZ relation to the predetermined XYZframe of reference. The XYZ positioning assembly 140 may also includecounterbalance and electro-lock components to accommodate ready manualpositioning and to maintain a selected ultrasound imaging/biopsyposition, respectively.
Arm assembly 130 is provided to allow the ultrasound imaging probe 110to be rotated about one or more of selected X, Y and Z axes to obtain adesired pitch, roll and/or yaw orientation). For example, arm assembly130 can be controlled to selectively rotate the longitudinal axis, orpitch, of probe 110 so that the ultrasound signal may be employed toobtain depth-profile image in a plane, or "slice," within which anupwardly angled punction instrument 52 of biopsy assembly 50 may beorthogonally advanced, as will be further discussed.
In the illustrated embodiment, arm assembly 130 includes pivot arm 132pivotally interconnected to XYZ ultrasound positioning assembly 140 viaa lock/release mechanism (not shown) for selective, centered rotation ofprobe 116 about axis YY. Arm assembly 130 further includes arm 134rotably interconnected to arm 132 via a lock/release mechanism (notshown) for selective, centered rotation of probe 116 about axis XX, andarm 136 rotably interconnected to arm 134 via a lock/release mechanism(not shown) for selective, centered rotation of probe 116 about axis ZZ.Internal optical encoders (not shown) may be provided at the various arminterconnections, wherein the pitch, roll and/or yaw of probe 110 isautomatically determinable in relation to the predetermined XYZ frame ofreference. In this regard, internal automated micro-positioners may alsobe utilized under processor control.
As will be appreciated, the ultrasound signal may be scanned to obtaindepth-profile information for a predetermined layer, or "slice," withinthe region of interest. By way of primary example, such scanning may beprovided electrically by driving a phased linear array of transducerscomprising probe 110 in a known manner and/or via manual orautomatic-driven control of XYZ positioning assembly 140 to mechanicallymove ultrasound imaging head 110.
As shown in FIG. 6, display/processor 60 includes a display screen 62for displaying the acquired x-ray images on a first portion 62a anddisplaying corresponding depth-profile ultrasound images on a secondportion 62b, each in registered co-relation to the predetermined XYZframe of reference. Display/processor 60 may further include a userinterface means 64, e.g., keyboard 65 and mouse 66 and screen pointcursor 68 (e.g., on both display portions 62a, 62b), wherein a user mayidentify (e.g., click upon) a specific location-of-interest within bothan x-ray image and corresponding ultrasound image (e.g., correspondingwith a potential lesion or suspicious mass), e.g, for automaticprocessor determination of the three-dimensional coordinates of thelocation within the predetermined XYZ frame of reference. User interfacemeans may further allow for user selection/display of a particulardesired ultrasound depth-profile image, e.g., via mouse 66 and screen"slice" cursor 70 on the x-ray image display portion 62a. Moreparticularly, screen "slice" cursor 70 may be employed to identify aparticular slice, or layer, of an X-Y x-ray image for which acorresponding ultrasound depth-profile image is to be obtained (e.g.,thereby resulting in processor-assisted positioning and imaging usingprobe 110) and/or accessed and displayed (e.g., where such ultrasounddepth-profile image has been previously obtained/stored for selectivesubsequent review).
As indicated, display/processor 60 may be operatively interconnected(e.g., via electrical lines 80) to the various positionable assemblycomponents for monitoring/controlling their respective positionsrelative to the predetermined XYZ frame of reference, including thepositionable components of immobilization assembly 30, x-ray imagingassembly 40, ultrasound imaging assembly 110 and biopsy assembly 50. Byway of primary example, display/processor 60 may determine thethree-dimensional coordinates of a specific location of interest, asdescribed above, and in turn assist/control the positioning of biopsyassembly 50 so as to position the assembly for obtainment of a tissuesample from the location of interest. In this regard, thedisplay/processor 60 may also be employable to visually project, orsimulate, the entry of a punction instrument 52 into a given location ofinterest, thereby allowing physicians the opportunity to insure anoptimal positioning for biopsy entry prior to an actual biopsyprocedure. Since three-dimensional visualization of a potentiallesion/suspicious mass can be provided by the present invention, andsince the disclosed arrangement allows for breast access by biopsyassembly 50 from a plurality of aspects (e.g., by selective mounting oneither side of or coaxial along support arm 20), such simulated biopsymodeling may prone to be of particular advantage.
The present invention allows for spatial correlation of the x-ray andultrasound images utilizing various techniques. By way of primaryexample, it can be appreciated that the X-Y x-ray images obtained can bereadily correlated to the predetermined XYZ frame of reference since theposition and attributes of x-ray source 42 and x-ray receiver/imager 44are each known in relation to the predetermined XYZ frame of reference.Additionally, in stereotactic imaging procedures, the two X-Ystereotactic x-ray images can be employed to obtain a Z location forparticular location of interest relative to the predetermined XYZ frameof reference utilizing known triangulation techniques, as will beappreciated by those skilled in the art. Further, the XYZ positioning ofultrasound imaging head 110 is determinable relative to thepredetermined XYZ frame of reference, as noted above. Relatedly, in theembodiment described above, the ultrasound imaging head 110 willemit/detect ultrasound signals in substantially the same plane as thesurface of compression paddle 34 contacting the imaged breast. Theposition of such surface relative to the predetermined XYZ frame ofreference (e.g., the Z distance to face plate 32) is also determinable.In view of the foregoing, it can be seen that utilizing known ultrasoundpulse/echo techniques a depth profile comprising a potentiallesion/suspicious mass can be spatially related in a reliable manner tothe acquired x-ray images.
In use, a patient can be positioned on the table 12 with a breastpositioned through opening 14. Compression paddle 34 is then advancedalong first support arm 20 to compress the breast to define across-sectional imaging area having a common thickness and to otherwiseimmobilize the breast in a set position within the predetermined XYZframe of reference. X-ray imaging assembly 40 is then selectivelypositioned to obtain the desired x-ray images. Such x-ray images arethen reviewed using display/processor 60, to identify, analyze and orotherwise confirm the presence and location of a potential lesion orsuspicious mass for ultrasound imaging. Alternatively, the generallocation of a potential lesion or suspicious mass may already be knowndue to prior x-ray screening.
In either case, to proceed with ultrasound imaging, the patient shouldbe positioned/repositioned so that the potential lesion or suspiciousmass is positioned within the accessible field of view of ultrasoundimaging head 110 when it is maneuvered through the window 36 ofcompression paddle 34 in direct contact with the imaged breast. As canbe appreciated, in order for the present invention to yield spatiallycorrelatable image information with respect to a potential lesion orsuspicious mass, new x-ray and corresponding ultrasound images should begenerated for each position in which a breast is immobilized within thepredetermined XYZ frame of reference. As such, the benefit of utilizinga digital camera 46 in x-ray receiver 44 for partial field, real-timeimaging via display/processor 60 can be readily understood.
Once it is verified that the area of interest is positioned adjacent tothe window 36, ultrasound imaging probe 110 is positioned through thewindow 36 and a series of ultrasound images are obtained and displayedon display/processor 60. Cursor 66 control of the ultrasound imagestaken across the area of interest provides additional, valuableinformation as to the type of potential lesion/suspicious massoriginally noted on an original mammogram. For example, with propertraining of ultrasound and x-ray imaging techniques, physicians may ruleout the possibility of a solid mass in favor of a fluid-filled cyst. Or,additional ultrasound characteristics may aid the physician in making adefinitive diagnosis.
If it is determined that a biopsy is desired, the specific location fromwhich tissue is to be obtained can be identified using mouse 66 toposition screen point cursor 68 on both the x-ray image and correlatedultrasound depth-profile image on display/processor 60.Three-dimensional coordinates can then be determined and utilized bydisplay/processor 60 to control positioning of biopsy assembly 50. Inthis regard, it will be appreciated that specific attributes of theparticular punction subassembly 54 utilized will have been previouslyentered into by display/processor 60. Further, and as noted above, givensuch previous input information, display/processor 60 may be employed tosimulate the advancement of punction instrument 52 into the breast froma given potential position, thereby allowing the physician to determineif breast biopsy access from a different position may be more desirable.
After the biopsy subassembly 50 is positioned as desired, biopsyprocedures may be completed. In conjunction with such procedures, theultrasound imaging head 110 may be utilized to provide continuous,successive depth profile images, thereby allowing for real-timemonitoring and user control of the advancement of the punctioninstrument 52 into the breast. More particularly, when the punctioninstrument is positioned at an angle θ as illustrated in FIG. 2,ultrasound imaging head 110 may be similarly angled at θ (e.g., relativeto horizontal) so as to yield real-time ultrasound depth-profile imagesof the layer into which punction instrument 52 is advanced. After biopsyprocedures are completed, ultrasound imaging head 110 may berepositioned so as to allow for pressure application of a cold pack 120.
While the present invention has been described in relation to oneembodiment, it will be appreciated that the invention may be utilized innumerous additional embodiments and procedures. Such additionalembodiments and procedures are within the scope of the presentinvention, as defined by the claims which follow.
What is claimed:
1. A medical apparatus, comprising:x-ray imaging meansfor transmitting x-ray radiation through a body region of interestpositioned within a predetermined, three-dimensional frame of reference,and for providing two-dimensional x-ray image data corresponding witheach of one or more x-ray images of the body region of interest;ultrasound imaging means, positionable in direct contact with said bodyregion of interest, for directing an ultrasound signal into said bodyregion of interest positioned within said predetermined,three-dimensional frame of reference, and for providing ultrasound imagedata corresponding with one or more ultrasound images of the body regionof interest in spatial co-relation to said x-ray images, said ultrasoundimage data including third-dimensional information regarding the bodyregion of interest, wherein said two-dimensional x-ray image data andsaid ultrasound image data including said third-dimensional informationcombinatively provide correlated, three-dimensional image datacorresponding with the body region of interest.
2. A medical apparatus,as recited in claim 1, further comprising:means for using said x-ray andultrasound image data to identify a location of interest within saidbody region of interest; and biopsy means, positionable in predeterminedrelation relative to said predetermined, three-dimensional frame ofreference, for obtaining a sample from said location of interest.
3. Amedical apparatus, as recited in claim 2, wherein:said biopsy meansincludes:a puncture instrument; and positioning means for selectivelypositioning said puncture instrument at an entry angle relative to saidpredetermined, three-dimensional frame of reference; and said ultrasoundimaging means comprises:an ultrasound imaging probe; and means forselectively positioning said imaging probe relative to saidpredetermined, three-dimensional frame of reference, wherein thelongitudinal axis of the ultrasound probe is aligned with the entryangle of the puncture instrument such that the puncture instrument isimaged in real time as it is entered into the breast.
4. A medicalapparatus as recited in claim 1, wherein said body region of interest isa female breast, and the apparatus further comprises:an immobilizationmeans for immobilizing said breast between first and second compressionmembers, said first compression member having an opening therethrough,wherein said ultrasound imaging means is selectively positionablethrough said opening to directly contact the breast.
5. A medicalapparatus as recited in claim 4, said x-ray imaging means comprising:anx-ray source for providing said x-ray radiation; and an x-ray receiverfor receiving x-ray radiation passing through said breast, said x-rayreceiver being positionable immediately adjacent to said secondcompression member.
6. A medical apparatus as recited in claim 5, saidx-ray receiver comprising:a digital camera selectively moveable andpositionable within a plane substantially to perpendicular to a centeraxis of said x-ray radiation; and user display and interface means foruser identification, using an acquired and displayed x-ray image, of anacquired ultrasound image to be displayed.
7. A medical apparatus asrecited in claim 1, comprising:display means for displaying said x-rayand ultrasound images in registered correlation.
8. A method for use inperforming a medical procedure, comprising:positioning a body region ofinterest within a predetermined frame of reference; x-ray imaging saidbody region of interest with x-ray radiation to obtain two-dimensionalx-ray image data corresponding with each of one or more x-ray images;using said one or more x-ray images to identify a location of interestwithin a selected, limited portion of said body region of interest, saidselected limited portion being smaller than said imaged body region; andultrasound imaging only said selected, limited portion of said bodyregion of interest with an ultrasound signal to obtain targetedultrasound image data corresponding with one or more ultrasound images,said ultrasound image data including third-dimensional informationregarding the body region of interest, wherein said two-dimensionalx-ray image data and said ultrasound image data including saidthird-dimensional information combinatively provide correlatedthree-dimensional image data corresponding with the selected, limitedportion.
9. The method as recited in claim 8, said ultrasound imagingstep comprising:contacting said selected, limited portion of said bodyregion of interest with an ultrasound imaging means.
10. The method asrecited in claim 9, said ultrasound imaging step furthercomprising:scanning said ultrasound signal across said selected, limitedportion of said body region of interest.
11. The method as recited inclaim 8, said using step comprising:displaying said one or more x-rayimages for visual review.
12. The method as recited in claim 8, furthercomprising:employing said x-ray image data and ultrasound image data toposition a punction instrument for obtainment of a sample from saidlocation of interest.
13. The method as recited in claim 12, saidemploying step comprising:using said ultrasound image data whileinserting said punction instrument into said breast.
14. The method asrecited in claim 8, further comprising:generating a three-dimensionalmodel of said location of interest utilizing said x-ray image data andultrasound image data.
15. A method for use in performing a medicalprocedure, comprising:positioning a body region of interest within apredetermined frame of reference; supportably mounting a biopsy devicein known spatial relation relating to and on a first side of saidpredetermined frame of reference; ultrasound imaging at least a portionof said body region of interest to obtain ultrasound image data bysupportably mounting an ultrasound imaging probe in known spatialrelation to and on a second side of said predetermined frame ofreference, the second side being adjacent to said first side andcontacting said ultrasound imaging probe with said body region ofinterest; x-ray imaging said body region of interest from said secondside of said predetermined frame of reference by supportably mounting anx-ray imaging source and an x-ray image receiver in known spatialrelation to and on opposing sides of said predetermined frame ofreference; employing said ultrasound image data to selectively positionsaid biopsy device relative to said predetermined frame of reference,and obtaining a sample from said portion of said body region of interestwith said biopsy device.
16. The method as recited in claim 15, wherein:said ultrasound imaging step comprises:displaying in real-timeultrasound images of said portion of said body region of interest;andsaid obtaining step comprises: advancing said biopsy device into saidbody region of interest while contemporaneously viewing said real-timeultrasound images.
17. The method as recited in claim 15, furthercomprising:immobilizing said body region of interest between first andsecond plates defining said opposing sides of said predetermined frameof reference.
18. The method as recited in claim 17, said ultrasoundimaging step further comprising:positioning said ultrasound imagingprobe through said first plate and in direct contact with said bodyregion of interest. | 2024-03-22 | 1996-10-15 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1998-07-07"
} |
US-7905560-A | Process for the continuous manufacture of high grade acrylic fibers
3 PROCESS FOR THE CONTINUOUS MANUFACTURE OF HIGH 5 W4WW Y0 ax azmmiMASAKAZU TANIYAMA ETAL GRADE ACRYLIC FIBERS Filed Dec. 28, 1960 June 2,1964 .29. am WWW &4wan f%) 3 2 I 0 m QSEEQ u. 3 z I Q 3. .h 1w Qfi-m$1.. M M. m m a J M 5 M M I W WW SQ m .11
32;.6. m rs. 5% Mi United States Patent O 3,135,812 PROCESS FOR THECONTINUOUS MANUFAC- TURE F l-HGH GRADE ACRYLIC FIBERS Masakazu Taniyamaand Masahiko Hatano, Bane-gun,
Japan, assignors to T0110 Rayon Kabushiiri Keisha,
Tokyo, Japan, a corporation of Japan Filed Dec. 23, 196%), Ser. No.79,955 9 Claims. (Cl. 264-182) The present invention relates to aprocess for continuous manufacturing high grade acrylic fibers at lowcost by polymerizing acrylonitrile with other comonomers of specificcomposition in a concentrated aqueous salt solution containing zincchloride under a specified polymerization system and by spinningdirectly the resulting copolymer solution. Hitherto it has been thoughtdifficult to manufacture usable fibers by using a coagulating bath oflow concentration and normal temperature in the case where aconcentrated aqueous solution of zinc chloride is used as the solvent.This invention not only enables same but also produces such fibershaving excellent characteristics in knot strength, thermal stability andelasticity.
Solvents for acrylonitrile polymers have hitherto been organic solvents,such as dimethyl-formamide, dimethylacetoamide, dimethyl sulfom'de andethylene carbonate; inorganic acids, such as sulphuric and nitric acids;and concentrated aqueous solution of inorganic salts, such as sodiumrhodanate and zinc chloride. However, the organic solvents are generallyexpensive, while the inorganic acids tend to hydrolyze acrylonitrilepolymer. The inorganic solvents are available at moderate prices, butthere have been many technical disadvantages in the case of using them.
In the ordinary preparation of spinning solution, many unit procedureshave usually been assembled in one process wherein monomers aresubjected to suspension polymerization in water and the polymerprecipitated is washed, dried, pulverized and then dissolved in solvent.In these cases, the technique is too complicated to produce polymerswith uniform quality and moreover, a large sum of expenses are needed inthe drying and pulverization of the polymer. On the other hand, ifmonomer mixture is continuously polymerized in a solvent which candissolve the polymer formed, and if thus resulting polymer solution canbe directly spun to form fiber, a strikingly simplified process may beattained for the manufacture of fibers. Such an idea of performingsolution-polymerization has long been present. However, no such actualexamples have been heard of in connection with the manufacture of fibersin the industry. The reasons for this are that, in the case of organicsolvents, such as dimethyl formamide and dimethyl acetoamide, if used aspolymerization medium, it is hard to obtain polymers of sufficientlyhigh molecular weight and high relative conversions and that it isdifficult to recover the solvent at high purity which can be useful forrepeating polymerization process. However, there has been no catalystsuitable for polymerization in concentrated inorganic acid solutions. Onthe other hand, in the case of zinc chloride solvent, it has beenclarified from exhaustive investigations that, thesolution-polymerization can easily be carried out with usual catalystssuch as persulphates or organic peroxides.
It has been known hitherto that acrylonitrile is polymerizedhomogeneously in a concentrated aqueous zinc chloride solution. However,since viscosity of the polymer solution thus obtained is too high tospin and the coagulated tow tends to have numerous voids, it is veryhard to obtain practically useful fibers. In order to eliminate abovedisadvantages, other inorganic salts such as CaCl MgCl etc. or anorganic peptiizer such as DMF 3,135,812 Patented June 2, 1964 or DMA hasbeen tried to be mixed in the polymer solution (vid. US. Patents No.2,648,647 and No. 2,648,648), and also the other processes, forinstance, cooling the coagulating bath below the ordinary temperature orkeeping the coagulating bath at a high concentration have been applied(vid. US. Patent No. 2,790,700). Those processes are, however,unfavorable to be adopted from the economical and technical point ofview. Moreover, even under such conditions, it has been difiicult tomanufacture substantially useful fiber in an industrial scale in aneasily reproducible manner.
Based on the comprehensive investigations on the solution-polymerizationas Well as spinning, the present inventors have attained a knowledgethat the composition of polymers is a key to solve those problems, andhave reached to the present invention on the continuous manufacture ofacrylic fibers through the solution-polymerizing and spinning process.
The stretching and relaxation of the coagulated tow spun out in thecoagulating bath must be carried out under special conditions necessaryfor manufacturing good fibers. Said degrees of stretching and relaxationdepend on the molecular structure of the polymer and also on theinteraction between the solvent and the polymer. The acrylonitrilepolymer, which has strong polar radicals (nitrile radical), has aremarkably strong molecular cohesive force and forms a compactcoagulate'd structure, concurrent with the solidification in coagulatingbath. Therefore, in order to avoid the above-mentioned behavior thatmight make the subsequent stretching and relaxation dilficult,co-polymers of various compositions have been prepared and a detailedstudy has been carried out with respect to the conditions ofcoagulation, stretching and relaxation.
FIG. 1 represents in solid line A results of X-ray investigation onair-dried coagulant in the case of acrylamide used as a component of thecopolymer and, in broken line B, those of the stretched and relaxedfiber. In this figure, 13%. showing half height width at 20=17 relatesto the crystallinity of the coagulant and means that the polymerstructure is more amorphous as B /2 becomes larger. As shown in FIG. 1,until the component of copolymer reaches 67%, a compact structure isformed, but the more component gives evidently the more random structureFIG. 2 represents that, in parallel with this phenomenon, the stretchingability of the coagulant shows a rapid increase after the component ofcopolymer has exceeded 67%. In the figure, A, B, C and D represent thecomponents of copolymer respectively. It is natural that when comonomercontent of the polymer is increased, the structure of the polymerbecomes more random and results in an increased ability of stretching.The most important problem is that the fiber structure is fixed afterstretching and relaxation, that is one of the necessary conditions forgetting useful fibers. Generally, as the copolymer component increases,the stretching and relaxation abilities increase, while the mechanicalproperties and thermal stabilities, which are important for fibers,become deteriorated. The mechanical properties and thermal resistanceare likewise dependent on the manner of coagulation. From this point ofview, the stretched and relaxed fiber structure is shown in broken lineB of FIG. 1, and a stable crystalline structure is held until thecornonomer component of the polymer is increased to 12 weight percent.Above the 12 weight percent of comonomer component, the crystallinity offiber becomes worse and the elongation of fiber becomes too large andthe thermal stability becomes remarkably decreased.
FIG. 3 illustrates, as an example, the mechanical properties of thefibers obtained when methyl acrylate is used as a copolymer component.It is also evident from this,
u that no fibers having useful mechanical properties can be obtainedbelow 6 to 7% of co-polymer component. In this figures E shows drystrength and F knot strength. Namely, the present inventors have foundan important technique that useful fibers can be manufactured easilyonly when the copolymer component ranges from 8 to 12% for using a zincchloride solution as the solvent. In a such a specific copolymerization,there is no need of a cooling at coagulating bath below roomtemperature, and
the good spinning can easily be carried out at room temperature in'water or in a bath of aqueous zinc chloride solution at lowconcentrations below Since residual salts in fibers exert harmfulinfluences upon fiber properties such as whiteness and dyeability,removal of the salts is quite an important problem. Table 1 shows therelationship between salt concentration of the coagulating bath andresidual salts under the same condition as to water washing. A bathhaving a lower salt concentration makes less residual salt and has theadvantages that-the washing process may be more simplified and therequired time more shortened.
1n the case of solvents such as dimethyl formamide,
ethylene carbonate and sodium rhodanate, the manufacv ture of fibers ispossible even below 8% of comonomer component because the small amountof residual'solvent in fibers has plasticizer effect. But in the case ofzinc .chloride, the 8 to 12% comonomer components must be an inevitableand necessary condition for the manufacture of useful fibers from theinformation of characteristic behavior of the solvent. Furthermore, theimportant problem for making an excellent fiber is not only that ourpolymers contain 8 to 12% comonomer but that it is positively necessaryto give stretching over 8 times of its original length after coagulationand successive relaxation over 20%. In the wet spinning using a zincchloride solution as the solvent, the stretching of spun tow is possiweonly inv the said appropriate composition of copolymer. The fiberstretched in such a manner has an extremely large amount of internalstrain. The knot strength is exceedingly small and the resistanceagainst folding is also weak. Those disadvantages are improved bysubjecting to the relaxation treatment after the stretching.
FIG. 4 represents a relationship between stretching ratio and fiberstrength, wherein 0 shows stretching in boiling water, A in steam and Xby dry heating. As seen in said figure, thermal stretching may maketensile strength of coagulated tows increase,- but .can not produceenough knot strength for practical fibers. The present inventors havefound that knot strength may be increased, as seen i in FIG. 5, byrelaxing under heating after stretching treatment of fibers andrelaxation over 20% may give enough knot strength for practical use.Thus relaxation not only increases knot strength but also remarkablyimproves fiber properties such as knot strength, thermal stability etcIas seen in FIG. 6. Furthermore, it has been also'found that degreeoffibrilization may be advantageously lowered by the relaxation, oneexample of which is shown by a following table.
4, TABLE 2 Fibrilization Degree (percent) Relaxation (percent)Relaxation over 20% after stretching over 8 timesof its original lengthis an indispensible condition for obtain-:
ing excellent and characteristic properties of fibers.
Gf course, in order to improve the dyeing property of the fiber, aspecial kind of monomer can be used as one component of copolymer. Ithasalso been known that as a basic monomer suitable for zinc chlorideseries sol vent particularly vinyl imidazol derivative such'as N-vinyl-4-,8-hydroxyethyl imidazol, 'N-vinyl-2-B-hydroxyethyl imidazol, etc. andas an acidic monomer vinyl sulfonic acid, acrylic acid or allylsulfonic' acid give the most satisfactory results into improvingdyeability.
Further, a detailed study on those copolymer structure has shown that acombination of a vinyl monomer such as methyl acrylate or acrylamidewith said basic or acidic monomers is the most suitable comonomercomponents, where the total comonomer content must be 812 weight percentof the copolymer.
The present inventors have succeeded to carry out stretching over 8times and relaxation over 20% for manufacturing useful fibers easilyonly by copolymerizing 8 to 12% of comonom'er with acrylonitrile whenaconcentrated aqueous solution of zinc chloride is used as the solvent,based upon the fundamental knowledge described above. Thus it has beenfound to manufacture excellent acrylic fibers by selecting the.particular range of copolymer composition and conditions for stretchingand relaxation. In order to economically carry out same and to obtainexcellent spinning solution suitable therefore, it is possible tocombine a particular solution polymerization process to be describedhereinafter so that continuous.
spinning using an aqueous solution of zinc chloride may beindustrialized.
The polymer solution obtained usually by solution polymerization in anordinary apparatus of polymerization includes a large quantity of airfoams and therefore it must be defoamed before spinning operation.However, the zinc chloride series solvent is very hard to be defoameddue to its special property of interfacial chemistry, and this point isa large disturbance in an industrial scale. Relationship betweenpolymerization conditions shown according to our experiment;
and required time for defoarning will be rexernplarily that ahomogeneous spinning solution by performing continuously polymerizationfilling up the polymerization apparatus with reaction mixture andapplying pressure of 1 to 5 kg./cm. gauge to reacting liquid in thereaction vessel by means of a reciprocating pump or other suitabledevice.
It will be understood from the foregoing that the present inventionprovides a process for continuous manufacturing of high grade acrylicfibers at low cost characterized in that, in concentrated aqueous zincchloride solution, acrylonitrile is added with 8 to 12% copolymer to thewhole monomers to be subjected to continuous solution polymerizationunder pressure of 1 to 5 kg./cm. gauge in a reaction vessel eliminatingany gas space formed, thus obtained polymer solution is instantly spunout in a coagulating bath at room temperature and of 20% or lowerconcentration salt and thus obtained coagulated tow is subjected tostretching over 8 times of its original length and then to relaxationover 20%, essential features of which lie in the indivisible combinationof the series of steps.
It has been found that the concentration of aqueous zinc-chloridesolution to be used in embodying the present invention is preferably 52to 58% The preferable range of the concentration is based on the factthat the lower it becomes the lower the viscosity of the obtainedpolymer solution. It is known that acrylonitrile polymer is apt tochange chemically in aqueous zinc chloride solution. The tendencybecomes remarkable as the concentration of zinc chloride increases. Thechemical change causes the fibers easily to be colored and deterioratesthe thermal stability thereof. Thus, in order to obtain a polymersolution suitable for spinning a relatively lower concentration ofaqueous zinc chloride solution has to be used.
The above-referred to invention does not lose its characteristicfeatures in any case follows when the solvent is consisted of justsingle component of zinc chloride, and also when consisted of zincchloride and sodium chloride, and more over, when a small amount of anyalcohol is added for controlling molecular weight of polymers or whenacetic acid is added to make desalting from coagulated gel-tow easy andimprove the thermal stability of the original polymer solution.
The practical examples of the continuous process for manufacturingacrylic series fibers of excellent quality:
Example 1 A monomer solution comprising 650 parts of 58% aqueous zincchloride solution, 65 parts of acrylonitrile and 7 parts of methylacrylate, which are uniformly mixed together, and a catalyser solutioncomprising 0.6 part ammonium persulfate dissolved in 30 parts of 58%aqueous zinc chloride solution are continuously introduced into apolymerization apparatus kept at 60 C. under pressure of 3 kg./cm.without permitting any empty space, and the mixture is continuouslypolymerized to produce uniform, toamless and transparent solution ofpolymers in three hours. The resulting solution is directly spun througha spinnerlet of 2500 holes (=0.14 mm.) into a coagulating bath of 10%aqueous zinc chloride solution at C., the thus obtained gel-tow isstretched to 2 times or" the original length in water at 60 0, dried bymeans of 120 C. heated rollers, then stretched to 5 times at 180 C. andsubsequently relaxed by 30% in superheated steam at 250 C. The fiberthus obtained shows a dry strength of 3.5 g./d., a dry elongation 30%,and a knot strength of 2.8 g./ d. and shrinkage in boiling water isbelow 1.0%.
According to this process, since the processes of drying, pulverizing,dissolving polymer and of defoaming polymer solution are not required,excellent fibers can be manufactured continuously at low cost in only 4hours after the solution of monomers being charged.
Further, in this case, the relative conversion polymerization was 97%,molecular weight was 785x10 and the 6 falling ball viscosity of thespinning solution measured at C. was 48 seconds.
Example 2 600 parts of mixed aqueous salt solution comprising 52% zincchloride and 4% sodium chloride are mixed with 57 parts acrylonitrile,2.5 parts N-vinyl-4-(B-hydroxyethyl)-imidazol, 3.5 parts methyl acrylateand 0.6 part ammonium persulphate, which are dissolved and continuouslyfed into a pressure-resistant vessel equipped with a stirrer anddirectly connected, with the spinning apparatus in. a completely closedcondition, and heated at 55 C. under the pressure 4 kg./cm.
The said solution is subjected to polymerization passing through thevessel in 3 hours, and thus formed polymer solution is directlyintroduced to the spinning device to be spun as shown in Example 1. Thusobtained fibers showed the dry strength of 40 g./d., dry elongation of25% and knot strength of 3.2 g./d. and showed excellent instantaneousrecovery of elasticity, and can be dyed to deep colour with an acidicdyestuif.
Example 3 50 parts of acrylonitrile and 4 parts acrylamide and 1 partsodium allyl sulfonate are dissolved in a mixed aqueous solutioncomprising 200 parts zinc chloride, parts sodium chloride, 15 partsisopropyl alcohol and 300 parts water to which is added 0.5 partpotassium persulfate and can be continuously polymerized as shown inExample 2. Thus obtained solution is directly spun out in 5% aqueoussolution of the mixture of salt described above. After Washing withwater, the spun tow is stretched to 12 times the original length withheating rollers and then subsequently it is given relaxation of 28% insuperheated steam of 200 C. Thus obtained fibers showed a dry strengthof 3.1 g./d., dry elongation of 28% and knot strength of 2.3 g./d. Thefiber obtained can be dyed deeply with cationic dyestufi.
Example 4 Monomer mixture comprising 70 parts acrylonitrile, 4 partsmethyl acrylate and 4 parts acrylic acid, which is dissolved in 650parts of the solvent composed of 54% zinc chloride, 3% acetic acid andwater, and the catalyst solution comprising ammonium persulfate in thesame solvent are introduced continuously to the apparatus under pressureof 4 kg./cm. and the polymer solution continuously obtained is spundirectly in said 10% solvent aqueous solution at room temperature andthe fibers obtained by stretching to 10 times the original length andgiving 30% relaxation at 200 C. have high degree of whiteness, drystrength of 3.6 g./d. (dry elongation 28%), wet strength of 3.4 g./d.(31%), and knot strength of 2.8 g./d. 21%
Example 5 Monomer mixture comprising 70 parts acrylonitrile, 5 partsmethyl acrylate and 2 parts vinyl sulfonate, which are dissolved in 600parts of 57% aqueous zinc chloride solution, and catalyst solution of0.3 part hydrogen peroxide dissolved in 57% aqueous zinc chloridesolution are introduced in an apparatus as shown in Example 2, andpolymerized at 65 C. and a transparent polymer solution can be obtainedin 4 hours. The said polymer solution thus obtained is directly spun asshown in Example 4. Thus obtained fibers can be dyed to a deep colorwith a cationic dyestufl', having excellent mechanical properties.
Example 6 Monomer mixture comprising 70 parts acrylonitrile and 7 partsmethyl acrylate, which is dissolved in 650 parts of mixed aqueous saltsolution containing 52% zinc chloride and 4% sodium chloride, andcatalyst solution comprising 0.5 part ammonium persulfate and 1 partsodium thiosulfate dissolved respectively in 20 parts of as shown inExample 3 and polymerized continuously;
A transparent polymer solution without any foams can be obtained in 90minutes, where the relative conversion is 96% and the molecular weightis 7.25 X10 When this polymer solution is directly subjected to spinningoperation as in Example 4, excellent fibers with good mechanicalproperties having splendid dyeability with cationic dyestufl? can beobtained.
What we claim: 7
l. A process for the continuous manufacture of acrylic fibers comprisingadding a 52 to 58% concentration of aqueous Zinc chloride solution to amonomer mixture 7 consisting of acrylonitrile and a comonomer of 8 to12% by weight of said monomer mixture to form a solution of said monomermixture in said aqueous zinc chloride solution, solution polymerizing byforcing the solution into a closed reaction vessel so that said solutionhas a range of pressure of 1 to kg./crn. by gauge whereby the resultingpolymer solution contains no foam and gel substance, spinning saidpolymer solution'into a coagulating bath of 20% or lower saltconcentration at a temperature of 10 to 25 C.,' and subjecting theresulting V tow to stretching over 8 times its original length and thenrelaxation over 2. A process as set forth in claim 1, wherein said 8 to12 weight percent comonomer comprises a first component of a neutralvinyl comonomer and a second component selected from the groupconsisting of an acidic and basic vinyl comonomer for impartingdyeability.
,3. A process set forth in claim 2, wherein said neutral vinyl comonomeris selected from the group consisting of methyl acrylate and acrylamide.
4. A process as set forth in claim 2 wherein said basic vinyl comonomeris selected from the group consisting of N-vinyl 4 (B-hydroxyethyl)imadazole, N-vinyl-Z- methyl-4-(B-hydroxyethyl)-imidazole,N-vinyl-4-(B-acetoxyethyl) -lmidazo1e, and N-vinyl-4-(B-methoxyethyl)-imidazole.
5. A process'as set vforth in claim 2, wherein :acidic' vinyl comonomeris selected from the group consisting of vinyl sulfonic acid, acrylicacid, allyl sulfonic acid, meta allyl sulfonic acid, styrene sulfonicacid, andttheir soluble metal salts.
6. A process as set forth'in claim 1, wherein an aqueous solutioncontaining zinc chloride only is used as the polymerization medium andcoagulating bath.
7. A process as set forth in claim 1, wherein a concentrated aqueoussolution of zinc chloride with sodium chloride is used as thepolymerization medium in which the zinc chloride is 52% and the sodiumchloride is 4%.
8. A process as set forth in claim 1, wherein a mixture of concentratedaqueous zinc chloride solution with isopropyl alcohol is used 'as thepolymerization medium in which the zinc chloride is 33% and the alcoholis 3%.
9. A process as set forth in claim 1, wherein a mixture of concentratedaqueous zinc chloride solution with acetic acid is used as thepolymerization medium in which the zinc chloride is 54% and the aceticacid is 3%.
References Cited in the file of this patent UNITED STATES PATENTS
1. A PROCESS FOR THE CONTINUOUS MANUFACTURE OF ACRYLIC FIBERS COMPRISINGADDING A 52 TO 58% CONCENTRATION OF AQUEOUS ZINC CHLORIDE SOLUTION TO AMONOMER MIXTURE CONSISTING OF ACRYLONITRILE AND A COMONOMER OF 8 TO 12%BY WEIGHT OF SAID MONOMER MIXTURE TO FORM A SOLUTION OF SAID MONOMERMIXTURE IN SAID AQUEOUS ZINC CHLORIDE SOLUTION, SOLUTION POLYMERIZING BYFORCING THE SOLUTION INTO A CLOSED REACTION VESSEL SO THAT SAID SOLUTIONHAS A RANGE OF PRESSURE OF 1 TO 5 KG./CM.2 BY GAUGE WHEREBY THERESULTING POLYMER SOLUTION CONTAINS NO FOAM AND GEL SUBSTANCE, SPINNINGSAID POLYMER SOLUTION INTO A COAGULATING BATH OF 20% OR LOWER SALTCONCENTRATION AT A TEMPERATURE OF 10* TO 25*C., AND SUBJECTING THERESULTING TOW TO STRETCHING OVER 8 TIMES ITS ORIGINAL LENGTH AND THENRELAXATION OVER 20%. | 2024-03-22 | 1960-12-28 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1964-06-02"
} |
US-82197686-A | Current transformer for direct and alternating current
ABSTRACT
Two ferromagnetic cores (11, 12) are provided for a transformer, only one of the cores (11) exhibits an air gap (13) in which a Hall effect element (3) is housed. The current flowing in a conductor (10) can be direct or alternating current and induces in the core (11) a corresponding magnetic field which makes it possible to obtain a signal on the element (3). This signal is amplified by an amplifier (8). The output current from amplifier (8) is applied to a winding wound around both cores (11, 12). For direct current and low frequency current, the winding current is proportional to the current in conductor (10). When the frequency of the current flowing through conductor (10) exceeds a certain value (several kHz), the gain of the amplifier (8) diminishes. A linear relationship between the conductor current and the current in the winding is maintained, however, because the high frequency is transmitted to the winding by the core (12).
Current transformers for direct and alternating currents are alreadyknown comprising a magnetic circuit consisting of a core having an airgap and carrying two windings, an element sensitive to the magneticfield prevailing in the air gap, this element providing an electricsignal dependent on the magnetic field, an amplifier controlled by saidsignal, this amplifier feeding one of the two windings in such adirection that it tends to cancel the magnetic field which gives rise tosaid electric signal, a current measuring device being connected inseries with the winding fed by the amplifier.
Transformers of this type provide complete satisfaction for measuringdirect currents and for alternating currents of relatively lowfrequency. However, when the frequency of the alternating currentsincrease, the response of the system diminishes mainly because of theleakage flux due to the air gap, on the one hand, and as a function ofthe frequency response of the amplifier, on the other hand.
This invention has its object to improve the dynamic performances ofcurrent transformers of said type. This result is obtained thanks to thefact that the magnetic circuit comprises a second ferromagnetic core nothaving an air gap, this second core being coupled magnetically to thefirst core by said windings.
The accompanying drawing shows a known device and, by way of example, anembodiment of the device that is the object of the invention.
FIG. 1 represents the known device.
FIG. 2 represents said embodiment.
FIG. 3 is a diagram of the response curve of the transformer of FIG. 1.
FIG. 4 is a diagram of the response curve of the transformer of FIG. 2.
In the known device, illustrated in FIG. 1, a transformer consists of arectangular-shaped ferromagnetic core 1. This core 1 exhibits an air gap2 in which an element 3 sensitive to the magnetic field prevailing inthis air gap is placed. This element 3 can particularly consist of aHall-effect cell. This cell is fed by a current supplied by twobatteries 4 and 5 mounted in series and whose connection point isgrounded. When cell 3 is placed in a magnetic field crosswise to itsplane, it gives rise to a voltage between two electrodes 6 and 7 placedperpendicular in relation to the current which goes through it. Thisvoltage is applied to an amplifier 8 whose gain is very high and whoseoutput feeds a secondary winding 9 which surrounds core 1. In thedrawing, this winding 9 has been represented on a branch different fromthe one containing cell 3 for more clarity, but as a rule, thissecondary winding is placed on the branch in which cell 3 is found.
As soon as a magnetic field acts on cell 3, the amplifier causes theflow, in winding 9, of a current which must cancel its magnetic fieldproducing said voltage and due to the flowing of the current in aprimary winding 10 which consists more often of a simple rectilinearconductor. The current flowing in secordary winding 9 is measured by anammeter A, which gives an indication proportional to the current flowingin primary winding 10.
Three operating states can be distinguished. They are showndiagrammatically by FIG. 3.
(a) Static or slightly dynamic state, from f0 to f1:
In this case the amplifier calls for the fundamental relation of perfecttransformers, applicable even for direct currents. The flux in themagnetic core is zero, the ampere-turns going through the secondarywinding are equal to the ampere-turns of the primary winding.
(b) Transition state, from f1 to f3, delimited by poles p1 and p2:
Zone f1 to f2 is due to the frequency gain transfer characteristic ofthe amplifier. Zone f2 to f3 is characterized by the weakening of thesecondary signal at low frequencies due to the presence of the air gap.
(c) Dynamic state from f3 to fx1:
The unit behaves like a current transformer.
FIG. 2 illustrates diagrammatically an embodiment of the transformerthat makes possible much higher dynamic performances. For this purpose,the transformer comprises two ring-shaped magnetic cores 11 and 12placed side by side. Core 11 exhibits an air gap 13 in which aHall-effect cell is placed, such as element 3 of FIG. 1. This cell isfed by batteries 4 and 5 and its output drives a high-gain amplifier 8.Core 12 is separated form core 11 by a value sufficient to prevent itfrom magnetically short-circuiting the magnetic field in air gap 2.
Ferromagnetic core 12 does not have an air gap and it is dimensioned toprovide a correct response from a frequency lower than f1 and up to afrequency fx2.
In summary, pole p2, corresponding to the lower cutoff frequency of thecurrent transformer itself, formed by ferromagnetic core 12 and thewindings, is located at a frequency lower than pole p1, corresponding tothe cutoff frequency of the amplifier. Thus, the cutoff frequency of theunit is linear from f0 to fx2 which is greater than the frequency fx1 ofthe known device.
Of course, numerous variant embodiments can be provided. Actually, theferromagnetic cores do not necessarily have to be ring shaped or beplaced side by side. According to a variant, one of the cores could beplaced inside the other, which gives a compact design. It is alsopossible to provide that magnetic circuit 12 can consist of twoferromagnetic cores placed coaxially and on both sides of core 11 withair gap.
I claim:
1. A current transformer for measuring direct and alternatingcurrents in a conductor, comprising:a magnetic circuit including a firstferromagnetic core and a second ferromagnetic core magnetically coupledto said first core, said cores being disposed about the conductor sothat a magnetic field is induced in said cores by the current in saidconductor, only said first core having an air gap and a Hall effectelement positioned within said air gap for producing an electric signaldependent on the magnetic field induced in said first core, a windingwound about at least said first core, an amplifier connected to receivesaid electric signal as an input, said amplifier producing an outputsignal, means for applying said output signal to said winding in adirection tending to cancel the magnetic field induced in said cores bythe conductor, and a current measuring device connected in series withsaid winding for measuring the current in said winding, which isproportional to the current in the conductor.
2. The transformer asclaimed in claim 1, wherein said cores are ring-shaped and positioned incoaxially alignment with respect to one another.
3. The transformer asclaimed in claim 2, wherein said cores each have inner and outerdimensions that are approximately equal to each other and said cores arepositioned side by side, and said winding being a coil wound around bothsaid cores to magnetically couple said cores together. | 2024-03-22 | 1986-01-24 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1987-07-21"
} |
US-77295185-A | Address assignment system for image memory
ABSTRACT
According to an image memory address assignment system, a frame memory is divided into a plurality of blocks. Upper bits of the address of the frame memory constitute a block address, and lower bits constitute an intrablock address. The block address is supplied to an address converter. The address converter has a conversion pattern ROM. The conversion pattern ROM stores conversion patterns each converting the input write address signal block address to a block address for a completely read block area so as to perform simultaneous read and write access even if the data read direction (order) of the frame memory is different from the data write direction. The address converter supplies the write block address to the frame memory. As a result, the data can be written in the completely read block.
BACKGROUND OF THE INVENTION
The present invention relates to an address assignment system for animage memory (e.g., a frame memory of a page printer) for processingimage data in page units.
A conventional page printer prints character data in units of one page.When image data is transferred to a conventional page printer, the imagedata is temporarily stored in a frame memory. When the frame memorystores one-page image data, the one-page image data is supplied to thepage printer.
A conventional page printer must deal with a large number of image datain page units, and the frame memory must therefore have a large memorycapacity. For this reason, in a conventional system, a one-page framememory is prepared, and an input from the host computer to the framememory and an output from the frame memory to the page printer arealternately repeated. More specifically, one-page image data istransferred from the host system to the frame memory, and after thetransferred data is supplied to the printer, the next one-page imagedata is transferred from the host system to the frame memory again. Thisone-page image data is transferred to the printer, and the next one-pageimage data is supplied from the host system to the frame memory.
In such a conventional printing control means, the next one-page imagedata cannot be written in the frame memory while the current one-pageimage data is being printed. Therefore, the next one-page image datacannot be written until the current one-page image data is completelyprinted. As a result, printing time is prolonged and high-speed,high-efficiency printing cannot be performed.
As shown in FIG. 1A, if a data write direction (CW) from the host systemis always the same as the data output direction (Pout) to the pageprinter, the next one-page image data can be sequentially written in thedata memory area while the current one-page image data is beingtransferred to the page printer. However, as shown in FIG. 1B, when thewrite direction (CW) is different from the read direction (Pout), thenext one-page image data must be written after the current one-pageimage data is completely transferred to the page printer. Therefore, theoverall printing time is prolonged.
In order to solve this problem, a double frame memory configuration hasbeen proposed. Data is written in one frame memory, while the data isbeing transferred from the other frame memory to the page printer.However, two expensive large-capacity frame memories must be used,greatly increasing the product cost, and leading to an impracticalconfiguration.
SUMMARY OF THE INVENTION
It is an object of the present invention to provide an addressassignment system of an image memory for a page printer for processingimage data in units of one page, wherein the next one-page image datacan be written in a read end area while the current one-page image datais being transferred to the page printer even when the image data writedirection is different from the image data read direction, therebyeffectively utilizing the one-page image memory so as to performhigh-speed printing with a simple configuration.
In order to achieve the above object of the present invention, there isprovided an image memory address assignment system comprising:
page data storage means divided into a plurality of block areas each ofwhich is accessed such that upper bits of an address signal designate ablock address and lower bits thereof designate an intrablock address,the page data storage means being arranged to store at least one-pagedata;
means for generating read address signals so as to read out the one-pagedata from the page data storage means;
means for generating write address signals to write the one-page data,the write address signals being generated in an order different fromthat of the read address signals;
block address converting means, arranged between said page data storagemeans, said read address signal generating means and said write addresssignal generating means, for receiving as a block address upper bits ofthe read and write address signals and generating a block address inaccordance with a conversion pattern for converting the block address ofthe input write address signal to a block address of a completely readblock area;
write conversion pattern designating means, connected to said blockaddress converting means, for designating a conversion pattern forconverting the block address of the write address signal to the blockaddress of the completely read block area;
read conversion pattern designating means, connected to the blockaddress converting means, for designating another conversion pattern forconverting the block address of the read address signal to another blockaddress; and
means for printing the data read out from the page data storage means.
BRIEF DESCRIPTION OF THE DRAWINGS
Other objects and features of the present invention will be apparentfrom the following description taken in connection with the accompanyingdrawings, in which:
FIGS. 1A and 1B are illustrative representations for explainingconventional printing formats;
FIG. 2 is a block diagram showing a page memory address assignmentsystem according to an embodiment of the present invention;
FIGS. 3 and 4 are block diagrams showing a frame memory of FIG. 2;
FIG. 5 is a block diagram showing an address converter 20 of FIG. 2;
FIGS. 6A through 6H are tables showing each page block conversionpattern in a block address conversion ROM 70 of FIG. 5;
FIG. 7 is a diagram showing various registers used for frame memoryaccess control in a main RAM of FIG. 2;
FIGS. 8A through 8C are flowcharts for explaining the CPU operation forframe memory write area control of the system shown in FIG. 2;
FIG. 9 is a diagram showing the state of a possible write area in thesystem of FIG. 2;
FIG. 10 is a table in a main ROM 14 for checking the possible write areain the system of FIG. 2;
FIGS. 11 and 12 are respectively flowcharts for explaining image datatransfer operations at the CPU and DMA controller in the system of FIG.2;
FIG. 13 is a block diagram showing an address converter according toanother embodiment of the present invention; and
FIGS. 14 and 15 are tables showing output data values in the conversionROM of FIG. 13.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
An address assignment system according to an embodiment will bedescribed with reference to the accompanying drawings. FIG. 2 is a blockdiagram showing a hardware configuration when a pattern data writecontrol system is applied to a page printer control system.
A central processing unit (CPU) 10 controls the printer control systemas a whole. A CPU bus (CPU-BUS) 11 controls data transfer between theCPU 10 and the respective units connected to the bus 11. A DMA bus(DMA-CONBUS) 12 is used for data transfer using a direct memory access(DMA) unit 19. A main random-access-memory (RAM) (M·RAM) 13 is connectedto the CPU 10 through the bus 11 and stores various types of data. Amain read only memory (ROM) (M·ROM) 14 is connected to the CPU 10through the bus 11 and stores control programs shown in flowcharts ofFIGS. 8A through 8C, 11 and 12. An interface (I/F) 15 is connected tothe CPU 10 through the bus 11 and controls transfer of printing data andprinting control data between the CPU 10 and a host computer (HOST).
A frame memory (F·RAM) 16 has a 1-Mbyte memory capacity and storesone-page image data. The memory 16 is segmented into k×i blocks eachhaving a predetermined unit memory capacity (to be described in detaillater). A frame memory bus (F·BUS) 17 has a 2-byte data width, and imagedata are transferred to/from the memory 16 through the bus 17. A pageprinter 18 prints the data read out from the memory 16 in page units. ADMA controller (DMAC) 19 accesses the memory 16 when data is transferredto the printer 18. An address converter (A·CON) 20 receives a readaddress (DMA address) from the controller 19 and a write address (CPUaddress) from the CPU 10, and transforms these addresses into units ofdivision blocks of the memory 16. The converter 20 will be described indetail later.
A data latch (DI·L) 21 latches one-character code or image data ofinterest through the interface 15. A character generator (CG·ROM) 22generates a character pattern corresponding to the character codelatched by the latch 21.
A pattern extracting/combining circuit 23 extracts or combines the dotpattern data generated from the generator 22 or the image data latchedby the latch 21.
An input/output controller (IO·CONT) 26 exchanges various controlsignals such as an initial set end signal (I·END) with the CPU 10 andthe controller 19, and controls pattern conversion and patterndevelopment into the memory 16.
A pattern conversion circuit 30 performs conversion operations (e.g.,4/3 times elongation conversion, 90° conversion, 180° conversion, 2y(double longitudinal length) conversion) of a dot pattern supplied fromthe circuit 23.
A pattern conversion control circuit 40 controls the timing and theaddresses for the circuit 30 when the circuit 30 performs conversionoperations such as 4/3 elongation conversion, 90° conversion, 180°conversion and 2y (double longitudinal length) conversion.
A conversion parameter storage circuit 50 stores conversion parameterssupplied to the circuit 40 which can control conversion operations suchas 4/3 elongation conversion, 90° conversion, 180° conversion and 2yconversion.
The image memory address assignment system of this embodiment will bedescribed in detail with reference to FIGS. 3 through FIG. 12. FIG. 3shows the detailed block configuration of the frame memory 16, and FIG.4 shows a one-block format. The memory 16 has a total dot memory patternarea of X·Y=2304×3584 dots, and each block (Bi-j) has an area ofX·Y=256×512 dots, so that the memory 16 is divided into X·Y=9×7 blocks.
FIG. 5 shows the detailed arrangement of the address converter 20. Ablock address conversion ROM 70 stores 8-page (page 0 through page 7)block conversion patterns. A one-page block conversion pattern is shownin FIGS. 6A through 6H in detail. A Y write address register (Y·WR) 71and a write page designation register (WP·R) 73 store addresses forwrite image data in the memory 16.
A Y read address register (Y·RR) 72 and a read page designation register(RP·R) 74 store the addresses for reading out the image data from thememory 16. A flip-flop (F/F) 75 is set in response to a read startsignal (RS) which represents frame memory read access and which issupplied from the controller 19. The flip-flop 75 is reset in responseto a read end signal (RE) representing an end of one-line data transferto the printer 18. A page address selector (P·SEL) 76 selects an outputfrom the register 74 when the flip-flop 75 is set. However, when theflip-flop 75 is reset, the selector 76 selects the output from theregister 73. A 3-bit page designation address (P0 through P2) generatedfrom the selector (P·SEL) 76, a 3-bit Y block designation address (Y9through Y11) for designating a block along the Y direction, and a 4-bitX block designation address (X4 through X7) for designating a blockalong the X direction are used to read-access the ROM 70. The read orwrite block address is updated in accordance with the read or write modeof the memory 16.
FIGS. 7 through 12 are views for explaining write area control and dataread/write of the memory 16. Referring to FIG. 7, registers XWD and YWDshow possible write areas of the memory 16. A print flag PF is set atlogic 37 1" during printing. Registers XWS and YWS indicate a currentwrite start position of the memory 16. A register RY indicates a readposition (Y dot position) of the memory 16. Registers WP and RP indicatethe write and read pages, respectively. A signal X indicates a printingformat in which a character string direction is parallel to the printingdirection. A signal Y indicates a printing format in which the characterstring direction is perpendicular to the printing direction. Referencesymbol X2 denotes an X address counter in the controller 19.
The memory 16 has 9×7 blocks each with 256×512 dots. When the order ofread addresses for reading out the data of the memory 16 is differentfrom that of write addresses in a given relationship under the controlof the CPU 10, the converter 20 supplies the corresponding read andwrite addresses in corresponding orders to the memory 16. The givenrelationship indicates that the data read direction in the memory 16 isgiven by an arrow Pout and the data write direction is given by an arrowCW, or that the read direction is given by the arrow CW and the writedirection is given by the arrow Pout. It is essential that the data readdirection be different from the data write direction. When pattern datais written in the memory 16 in units of one character, a possible writearea is determined. When a data read end area from which data istransferred to the printer 18 exceeds a given area, the next page datais written in the possible write area. Write area control and read/writeaccess of the memory 16 are shown in FIGS. 7 through 12 in detail. FIGS.8A through 8C show the CPU operation for write area control. The CPU 10uses the working registers (XWD, YWD, PF, XWS, YWS, RY, WP, RP, X/Y,etc.) of the ROM 14 and a table shown in FIG. 10 to identify thepossible write area (a hatched area in FIG. 9).
As shown in FIG. 8A, the CPU 10 checks in step A1 whether a direction(i.e., an order) of data read from the memory 16 is the same (X) as thatof data write therein or perpendicular (Y) thereto (FIGS. 1A and 1B). Ifthe order of the data read from memory 16 is determined to be X (thesame as shown in FIG. 1A), the CPU 10 clears ("0") the register RYrepresenting the read position of the memory 16 in step A2. In step A3,the CPU 10 clears ("0") the register WP representing the write page andthe register RP representing the read page. In step A6, the CPU 10clears the flag PF. The CPU 10 then checks in step A7 whether or not thewrite data is stored in the RAM 13. On the other hand, when the CPU 10determines that the read direction is perpendicular to the direction (Y)of the write data, as shown in FIG. 1B, the CPU 10 sets an initial value(2303 dots which represent a maximum area) in the registers XWD and YWDrepresenting the possible write area in step A4. In step A5, theregister WP is set at logic "0", and the register RP is set at logic"0". Thereafter, the operations in steps A6 and A7 are performed. Whenthe CPU 10 determines in step 7 that the data is stored in the RAM 13,its write position is set in the registers XWS and YWS in step A8. TheCPU 10 checks in step A9 whether the direction of data read from thememory 16 is the same (X) as that of data write therein or perpendicular(Y) thereto. When the CPU 10 determines that the read direction is thesame (X) as the write direction, the value of the register YWS iscompared with that of the register RY in step A10 so as to check whetheror not the write position exceeds the read position. If NO in step A10,the write data stored in the RAM 13 is transferred to the patternconversion mechanism. The converted pattern data is written in thememory 16. More specifically, the data stored in the RAM 13 is latchedby the latch 21, the conversion mode information is stored in thecircuit 50, and the I·END signal is supplied to the controller 26 whichmanages the subsequent control. The controller 26 converts theone-character data stored in the latch 21 in accordance with theconversion mode information stored in the circuit 50. In this manner,the controller 26 controls the writing of the one-character pattern datain the memory 16. When the CPU 10 determines in step A9 that the writedirection is perpendicular (Y) to the read direction, the value of theregister XWS is compared with that of the register XWD. The CPU 10compares the value of the register YWS with that of the register YWD instep A12. Furthermore, the CPU 10 compares the value of the register XWSwith the value (XWD-256) (the number of dots of one block along the Xdirection; 16 words) in step A13. In this manner, the CPU 10 checkswhether or not the write position falls within the possible write area.If YES in steps A11 and A12 or A13, the data is written in the memory 16in step A14. If NO, the control returns to step A11 and the CPU 10 waitsuntil the write operation is enabled.
When a one-character pattern is written, the write address is updated inaccordance with the designated format in step A15. The CPU 10 checks instep A16 whether or not one-character data is written in the memory 16.The CPU 10 checks in step A17 whether or not the content of the flag PFrepresents in-printing (i.e., PF="1"). If NO in step A17, the flag PF isset at logic "1" in step A18. In step A19, the content of the registerRY is cleared ("0"). The content of the register RY is set in theregister (Y·PR) 72 in step A20. The CPU 10 checks in step A21 whetherthe read direction of data from the memory 16 is the same (X) as that ofthe data write therein or perpendicular (Y) thereto. When the CPU 10determines that the write direction is the same (X) as the readdirection, the controller 19 is initialized in step A29, and DMAprocessing is started. However, when the CPU 10 determines that thewrite direction is perpendicular (Y) to the read direction, the contentof the register WP is incremented by one in step A22. The CPU 10 thenchecks in step A23 whether or not the updated content of the register WPhas reached the 8th page. If YES in step A23, the content of theregister WP is reset to "0"(page 0) in step A24. The content of theregister RP is incremented by one in step A25. The CPU 10 then checks instep A26 whether or not the content of the register RP has reached the8th page. If YES in step A26, the content of the register RP is reset to"0"(page 0) in step A27. The content of the register WP is set in theregister (WP·R) 73 and the content of the register RP is set in theregister (RP·R) 74 in step A28. The controller 19 is initialized in stepA29. The operation for transferring the image data (dot pattern data)from the memory 16 to the printer 18 will be described in detail withreference to FIGS. 11 and 12. The CPU 10 performs the printing datatransfer operation of FIG. 11 until one-line (144 words) data is printedat the printer 18. When the CPU 10 receives a print end interrupt signalfrom the printer 18 upon completion of one-line printing, the content ofthe register RY representing the read position of the memory 16 isincremented by one in step B1. The CPU 10 then checks in step B2 whetheror not the updated content of the register RY has reached a one-pageline number (3584 dots as shown in FIG. 3). If NO in step B2, thecontent of the register RY is set in the register (Y·RR) 72 in step B3.The CPU 10 checks the designated direction (X/Y direction) of datawritten in the memory 16 in step B4. When the CPU 10 determines that thewrite direction is perpendicular (Y) to the read direction, the areadata corresponding to the value of the register RY is set in theregisters XWD and YWD representing the possible write area (FIG. 10) instep B5. In step B6, the DMA controller 19 is initialized (FIG. 12). Instep B7, the CPU 10 checks the logic state of the flag RF and waitsuntil the flag RF is reset to logic "0". However, if YES in step B2, theflag RF is set to logic "0"in step B8. The CPU 10 checks the writedirection (X/Y direction) in step B9. When the CPU 10 determines thatthe write direction is the same (X) as the read direction, the contentof the register RY is reset to "0"in step B10. However, when the CPU 10determines that the write direction is perpendicular (Y) to the readdirection, the maximum possible write area is set in the registers XWDand YWD in step B11. The DMA controller 19 is initialized by the CPU 10every time one-line printing is completed. As a result, one-line datatransfer shown in FIG. 12 is executed. Upon reception of a DMACinstruction from the CPU 10, transfer operation is started. In step C1,the flag RF is set at logic "1". In step C2, the read start signal (RS)is supplied to the address converter 20. In step C3, the data istransferred from the memory 16 to the buffer of the printer 18. In stepC4, the content of the counter X2 is incremented by one. The DMAcontroller 19 checks in step C5 whether or not the updated count of thecounter X2 has reached a one-line data transfer word (144 words). If YES(i.e., X2=144) in step C5, the read end signal (RE) is generated by theDMA controller 19 in step C6. The flag RF is reset ("0") in step C7. Instep C8, the DMA controller 19 supplies a print start designation signalto the printer 18. The printer 18 prints out the data every timeone-line image data (dot pattern data) is received by the line buffertherein.
The next page image data can be written in the read area while thecurrent one-page image data is transferred from the memory 16 to theprinter 18. Although the frame memory has only a one-page memorycapacity, the frame memory can be effectively utilized to performhigh-speed printing without idle time at low cost.
FIG. 13 shows an address converter according to another embodiment ofthe present invention. Although the page address conversion mechanism ofthe first embodiment comprises one address conversion ROM 70, the pageaddress conversion mechanism of this embodiment comprises an X pageaddress conversion ROM 80X, a Y page address conversion ROM 80Y and anadder 87 so as to reduce the ROM capacity. The input/output patterns ofthe ROM 80X are illustrated in FIG. 14, and input/output patterns of theROM 80Y are illustrated in FIG. 15. Components 81 through 86 of FIG. 13correspond to the address converter 20 of FIG. 5. Reference numeral 81denotes a Y write address register (Y·WR); 82, a Y read address register(Y·RR); 83, a write page designation register (WP·P); 84, a read pagedesignation register (RP·R); 85, a flip-flop; and 86, a page addressselector (P·SEL). In this embodiment, the values of the respectivepatterns shown in FIGS. 6A through 6H are shown in the X·ROM and Y·ROMtables of FIGS. 14 and 15. A value for x=1 and y=1 of conversion pattern1 is "0C". In the embodiment shown in FIGS. 13 through 15, the value"0C" is combined in the following manner. In the X·ROM table of FIG. 14,a value for P0-2 and X4-7 is "07". In the Y·ROM table of FIG. 15, avalue for P0-2 and Y9-11 is "05". The values "07" and "05" are added bythe adder 87 of FIG. 13, and the sum is given as "0C".
What is claimed is:
1. An image memory address assignment system havinga printer and operated such that a block address is accessed by upperbits of an address signal and an intrablock address is accessed by lowerbits thereof, comprising:page data memory means having a plurality ofblock areas for storing at least one-page data; means for supplying aread address to said page data storage means and readout data to saidprinter; means for detecting whether or not data read access of eachblock in said page data storage means is completed and supplying thedata and a write address to completely read block areas so as to writethe data therein; and block address converting means for receiving as ablock address the upper bits of the read and write addresses, convertingblock addresses to different block addresses, respectively, andsupplying said different block addresses to said page data storagemeans; read address conversion designating means, coupled to said blockaddress converting means, for designating the conversion of the readaddress signals during a period in which the read out data is suppliedto said printer; and write address conversion designating means, coupledto said block address converting means, for designating the conversionof the write address signals during a period different from a period inwhich the read out data is supplied to said printer.
2. An image memoryaddress assignment system with printing means, comprising:page datastorage means for storing at least one-page data, said page data storagemeans being divided into a plurality of block areas; means forgenerating a read address so as to read out the data from said page datastorage means and for supplying readout data to said printing means;data writing means for generating write addresses in a specific orderdifferent from that of the read addresses and writing the data incompletely read blocks of said page data storage means; and blockaddress converting means for converting a current write address blockdesignation order to an immediately preceding read address blockdesignation order, and a current read address block designation order toa specific order with respect to an immediately preceding write addressblock designation order.
3. A system according to claim 2, wherein saidblock address converting means comprises: means for storing conversionpatterns of the write address block designation order; and means forstoring conversion patterns of the read address block designation order.4. A method of assigning addresses of an image memory in a system havingstorage means for storing at least one-page data and operated such thata read address designation order upon reading of the data from saidstorage means is different in a specific relationship from a writeaddress designation order upon writing of the data in said storagemeans, comprising the steps of:(a) sequentially reading out the datafrom said storage means in response to the read address designationorder; (b) converting the write address designation order to be the sameas the read address designation order; (c) writing the data in acompletely read area in said storage means in response to a convertedwrite address and repeating the writing until one-page data is writtenin said storage means; (d) converting the read address designation orderin accordance with the specific relationship to the write addressdesignation order when one-page data is completely written in saidstorage means; and (e) repeating the steps (a) through (d).
5. An imagememory assignment system, comprising:page data storage means dividedinto a plurality of block areas each of which is accessed so that upperbits of an address signal designate a block address and lower bits ofthe signal designate an intrablock address, said page data storage meansbeing arranged to store at least one-page data; means for printing thepage data when read out from said page data storage means; means forgenerating, in accordance with a printing operation of the printingmeans, read address signals in specific order for reading data, during aplurality of transfer operation periods in which the one-page data insaid page data storage means are divided into a plurality of sectionsand then sequentially transferred to the printing means; means forgenerating write address signals in a period different from the transferoperation periods, in order to write data in a block area in said pagedata storage means for which a read operation is completed, the writeaddress signals being generated in an order different from that of theread address signals; block address converting means, arranged betweensaid page data storage means, said read address signal generating meansand said write address signal generating means, for converting a blockaddress of address signals which are output from said read addresssignal generating means and said write address signal generating meansin different predetermined orders, so that the block address of a readaddress signal is converted into a block address for sequentiallyspecifying block areas for which a write operation has been completed,and the block address of a write address signal is converted into ablock address for sequentially specifying block areas for which a readoperation has been completed; read address conversion designating means,coupled to said block address converting means, for designating theconversion of the read address signals during the transfer period; andwrite address conversion designating means, coupled to said blockaddress converting means, for designating the conversion of the writeaddress signals during a period different from said transfer periods. 6.A system according to claim 5, wherein said block address convertingmeans further comprises block address storing means for storing a blockaddress conversion pattern as a plurality of patterns each representinga series of block address for sequentially accessing a respective blockarea of said page data storage means, the block address corresponding toone of different conversion patterns which are designated by said writeand said read address conversion designating means.
7. A systemaccording to claim 5, wherein said block address converting meansfurther comprises:basic block address storage means for storing a basicblock address for each block address conversion pattern, said basicblock address storage means being accessed by said write conversionpattern designating means and said read conversion pattern designatingmeans; and block address calculating means for calculating the blockaddress in accordance with the basic block address read out from saidbasic block address storage means, the readout basic block addresscorresponding to the block address conversion patterns which aredesignated by said write address conversion designating means and saidread address conversion designating means.
8. A system according toclaim 5, further comprising:means for detecting whether or not readaccess of data of a given area of said page data storage means which isaccessed by each block address is completed and for supplying write datato be written in a completely read area; and selector means forselecting one of said write address conversion pattern designating meansand said read address conversion pattern designating means, coupling aselected one thereof to said block address converting means, anddesignating a conversion pattern from a read address signal during datareading. | 2024-03-22 | 1985-09-05 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1988-05-17"
} |
US-78312097-A | Anti-theft device for framed door
ABSTRACT
A device for preventing unauthorized prying of a door outward or forcing it inward from the plane of the door wherein the door is pivotally mounted on hinges in a door frame, the door and door frame each having interior surfaces, including a first member, including a base, for mounting to the interior surface of the door frame and having formed thereon a protrusion facing outward from the base toward the door, and a second member for mounting to the interior surface of the door, the second member, defined by a base, for attachment to the interior surface, and a body extending upward and away from the base having formed therein a recess facing outward toward the protrusion and arranged to pivot with the door away from and toward the protrusion as the door is opened and closed, wherein the first and second members are arranged for pivotal movement away from each other when the door is opened and into interlocking association when the door is closed in the frame to resist attempts to pry the door outward from the frame.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention pertains to the field of anti-theft devices used in safesand restricted-entry cabinets to resist the act of prying the door fromthe safe or cabinet during attempts to gain unauthorized entrythereinto. More particularly, this invention pertains to a simple buteffective placement of small members about the frame of the door andabout the perimeter of the door itself that interact in unique ways toresist these unauthorized entries without unduly interfering with theact of entering or withdrawing items of value therefrom.
2. Description of the Prior Art
It seems that no matter how much effort one expends to lock something inprivate, there are those persons who spend an inordinate amount of timeattempting to gain entrance to it. This seems to be significantlynoticeable in the area of automatic teller machines or ATMs and safes.
ATMs are machines accessible by the public for the purpose of makingdeposits of cash into and withdrawing cash from bank accounts when thebank is either not opened or when the user is geographically dislocatedfrom the bank building. In order to be able to dispense cash into thehands of the account holder, on demand, it is first necessary to loadthe machine with cash. This has had the effect of exciting the criminalmind and enticing certain individuals to attempt to remove the cash fromthe machine without authorization.
The attempts have followed along three general paths. The first is tosteal the authorization code from a user by trickery and then use thiscode to enter the account and falsely obtain money from the machine. Thesecond is just to hold up the account holder with a weapon after theholder has legitimately obtained money from the ATM machine. The thirdis to pry open the door of the ATM machine and reach in and take cashthat has been loaded therein for legitimate dispensing to accountholders.
The door covering over entrance ways into ATM machines are of a generaldesign where a door frame is formed comprising a top door sill orlintel, a bottom door sill and opposed, spaced-apart vertical doorjambs, where the sills and jambs are joined together at their respectiveterminal ends to form a rectangular frame. The frame surrounds theportal or entrance into the interior of the ATM machine where cash iskept, deposits are stored, and where the controls or drive engines ofthe machine may be accessed. The door is mounted in the frame andpivotally held in place by hinges placed along one vertical jamb. A lockand/or security handle is located opposite the hinges and is used topull the door open and push it closed and locked.
The frame, door, hinges and handle are generally made very strong sothat access through them is clearly denied. Accordingly, unauthorizedaccess usually takes place at locations on the door or around itsperimeter adjacent the door frame. A popular access point on ATM doorsis between the dead bolt under the lock handle where it slides into arecess in the frame. This is breached by prying the door with a pry barplaced between the outer edge of the door and the inner edge of the doorframe to spread open the space between the bolt and the receptacle sothat the door springs loose when the dead bolt is released fromreception in the opening in the door frame.
Another popular access point is along the door jamb on which the hingesare attached. Mere spreading of this distance with a pry bar is oftensufficient to produce an opening in between the door and framesufficient for one to insert their hand and arm to grab cash interiorthe machine and pull it out. Actually, any way to pry the door from theframe, either inward toward the center of the door in the plane of theframe or inward or outward from the plane of the door frame, will oftenresult in creating an opening sufficiently large to gain unauthorizedaccess to the interior of the ATM machine.
One rather obvious answer to this dilemma is to thicken the door and thejamb or make them of stronger and heavier metal. While such a cure iswithin the grasp of today's manufacturers, it represents a significantincrease in material cost and in fabrication time, while at the sametime making the machine heavier, more difficult to install and requiringa heavier support base.
What is needed is a light weight device for installation at points ofprobable entry into the ATM machine that will use some of the featuresalready a part of the machine, such as the stiffness of members alreadyin place and cabinet locking systems. This way the amount of materialincrease will be modest, the machine will remain at its present weightor, at least, not become more severely overweight, and the invention canbe retrofitted on existing ATM machines without having to modify thesupport base or otherwise alter the present design of the machine.
SUMMARY OF THE INVENTION
This invention comprises devices which may be built into or retrofittedinto existing ATM machines or safes or the like that significantlyresist unauthorized entry through the door or between the door and theframe of the machine. The devices are unique geometrical designs of mildsteel that are made to maximize their strength without interfering withthe use of the machine, the opening or closing of the doors or withaccess to the interior of the machine.
The invention comprises a device for preventing unauthorized prying of adoor outward or forcing it inward from the plane of the door wherein thedoor is pivotally mounted on hinges in a door frame, the door and thedoor frame each having interior surfaces, comprising a first member,including a base, for mounting to the interior surface of the door frameand having formed thereon a protrusion facing outward from the basetoward the door and, a second member for mounting to the interiorsurface of the door, the second member, defined by a base, forattachment to the interior surface, and a body extending upward and awayfrom the base having formed therein a recess facing outward toward theprotrusion and arranged to pivot with the door away from and toward theprotrusion as the door is opened and closed wherein the first and secondmembers are arranged for pivotal movement away from each other when thedoor is opened and into interlocking association when the door is closedin the frame to resist attempts to pry the door outward from the frame.
The invention also includes a device for preventing unauthorized pryingof a door outward or forcing it inward from the plane of the doorwherein it is pivotally mounted on hinges including a central hinge pinin a door frame and for preventing unauthorized prying of the door awayfrom the door jamb, the door frame including spaced-apart top and bottomdoor sills, and opposed spaced-apart door frame jambs, attached togetherat their terminal ends and the door and the door frame each havinginterior surfaces, comprising a first member including a base formounting to the interior surface of the door frame and having formedthereon a protrusion facing outward from the base toward the door and, asecond member for mounting to the door, defined by a base and a bodyextending upward away from the base and having formed therein a recessfacing outward toward the protrusion, arranged to pivot with the dooraway from and toward the protrusion as the door is opened and closed,the second member further including a rear surface, and a bar attachedto the interior surface of the door frame against each the top andbottom door frame sills, each bar terminating in at least one surfaceconforming to and closely spaced from the rear curved surface of thesecond member as the door is closed, wherein the first and secondmembers are arranged for pivotal movement away from each other when thedoor is opened and into interlocking association and wherein the rearcurved surface is moved into close proximity with the bar terminatingsurface when the door is closed in the frame to resisted attempts to prythe door outward from the frame or sideways away from the door jamb.
The invention also comprises a device for preventing unauthorized pryingof a door away from the door jamb wherein it is pivotally mounted onhinges including a central hinge pin in a door frame the door frameincluding spaced-apart top and bottom door sills, and opposedspaced-apart door frame jambs, attached together at their terminal endsand the door and the door frame each having interior surfaces,comprising a member for mounting to the door, defined by a base forattachment to the interior door surface and a body extending upward awayfrom the base and terminating at a surface closely spaced to the doorjamb interior surface when the door is closed in said frame, a barattached to the interior surface of the door frame against each the topand bottom door frame sills, each bar terminating in at least onesurface conforming to and closely spaced from the rear curved surface ofthe member as the door is closed, wherein the member and the bar arearranged to reside in close proximity to each other when the door isopened and closed to resisted attempts to pry the door outward from theframe or sideways away from the door jamb.
Accordingly, the main object of this invention is a device thatsignificantly strengthens the door to an ATM machine, a safe or the likeusing small members of strong metal, such as mild steel, in unique waysto thwart the existing practice of prying the perimeter of the door fromthe door frame, either outward or inward from the plane of the doorframe, or inward toward the center of the door in the plane of theframe.
Other objects of the invention include devices that prevent or severelyresist the prying of the safe door from the door jamb so that an openingis not made allowing unauthorized access to the interior of the machine;a device that renders the machine safe from unauthorized entry withoutadding significant amounts of metal such as thickening of the door aboutits perimeter or shoring up the door frame; a device that will causeother locking devices already on the door and frame to bind and/or jamand prevent opening of the door from the frame, a device that may beretrofitted onto existing ATM machines, safes and the like by simplewelding that may be performed on the premises by only moderately skilledwork persons thus reducing installation and other labor costs; a devicethat is wholly contained on the interior surfaces of the door and doorframe of the machine so as to be totally out of sight and not accessibleby those seeking unauthorized entry into the ATM machine or safe fromoutside; and, a device that does not detract from the clean lines andaesthetic design of existing ATM machines nor destroys the easyutilization design of existing ATM machines, or destroys the existingutilization of features already in place on the machines.
These and other objects of the invention will become more apparent uponreading the following description of the preferred embodiment takentogether with the drawings appended hereto. The scope of protectionsought by the inventors may be gleaned from a fair reading of the Claimsthat conclude this Specification.
DESCRIPTION OF THE DRAWINGS
FIG. 1 is an isometric view of a typical ATM cabinet in which thisinvention can be installed;
FIG. 2 is an illustrative view of the bottom sill of the door frame anddoor shown in FIG. 1;
FIG. 3 is an illustrative view of one of the embodiments of theinvention that can be used with a hinge in the location shown alonglines 3--3 in FIG. 1;
FIG. 4 is another illustrative view of a modification of the inventionshown in FIG. 3;
FIG. 5 is still another illustrative view of a modification of theinvention shown in FIG. 3; and,
FIG. 6 is an illustrative view of one of the embodiments of theinvention that can be used in the location shown along lines 6--6 inFIG. 1.
DESCRIPTION OF THE PREFERRED EMBODIMENT
Turning now to the drawings wherein like members are identified by likenumerals throughout the six figures, FIG. 1 shows a typical cabinet thatis part of an ATM machine, a safe or the like and shows a door 1 definedby spaced-apart top and bottom edges 3 and 5, respectively, and a pairof spaced-apart side edges, 7 and 9, forming a perimeter 13, whereinsaid door 1 is matched to a door frame 15.
Door frame 15 is planar in overall shape, having plane coordinates x-yas shown and is typically comprised of a top sill or lintel 17, held inspaced-apart arrangement from a bottom sill 19 by a pair of side jambs21 and 25 respectively that are all joined at their terminal ends toform a rectangular entrance to a portal or opening into a typicalcabinet. Door 1 is held in pivotal engagement to side jamb 21 by a pairof door hinges 27 that generally comprise two hinge halves 29 and 31held in pivotal engagement by a hinge pin 33 lying along a verticalaxis.
Door 1 and door frame 15 are generally made of strong metal such as mildsteel and have a wall thickness ranging from about 1/8 inch to about one(1) inch. The inside surface 37 of door frame 15 and the inside surface39 of door 1 are generally treated for rust resistance. Hinge halves 29and 31 are generally fixed in place on door 1 and door frame 15 bywelding in order to prevent dismantling thereof by those with a criminalbent.
A locking-bolt device 41 is shown outlined behind a broken away piece ofdoor 1 and comprises a mechanism 41a, with moveable locking bolts 41bextending outward therefrom for reciprocal motion behind a bar 41clocated on door jamb 25. A lock 43 and door handle 45 round out thehardware making up the entry way into the ATM machine. While thisspecification is set forth in terms applicable to an ATM machine, it isspecifically to be noted that the invention is applicable to a widerange of doors, to prevent unauthorized access to the interior ofcabinets, suit cases, computer terminals, rooms, chambers, cubicals, andthe like.
FIG. 2 shows the bottom sill 19 of door frame 15 and shows that piecesof the invention, such a bar 77 of strong metal, can be mounted againstsill 19 and held there by welding or some other strong fastening means.More will be explained about bottom sill 19 and bar 77 later in thisspecification.
FIG. 3 discloses the first embodiment of this invention and shows it tobe used where door 1 is pivotally mounted by hinges 27 to door frame 15.This embodiment of the device of this invention comprises a first member47, preferably made of mild steel, having a broad base 49, for mountingto inside door frame surface 37 by welding or other such fasteningmeans, that has formed thereon, above base 49, a protrusion 51 thatfaces upward and away from base 49 and toward door 1. Base 49 ispreferably wider than protrusion 51 to provide greater strength where itis needed.
A second member 53 is provided and defined by a base 55 and a body 57that extends upward and away from base 55 toward first member 47. Body57 terminates in an end surface 61 wherein is formed a recess 63,preferably in the shape similar or identical to that of protrusion 51,that faces outward toward protrusion 51 and moves away from and towardsaid protrusion when door 1 is opened and closed as shown in dottedoutline in FIG. 3. The design of protrusion 51 is such that its base 49,along with base 55 of second member 53, are sufficiently broad as to actas wedges and provide the maximum amount of metal adjacent the interiorsurfaces 37 and 39 of frame 15 and door 1 respectively. This allows formore welding and greater contact area for first and second members 47and 53 so that these relatively small parts provide a maximum ofprotection. In addition, the outline of protrusion 51 and recess 63 ispreferably "V" shaped or "U" shaped to provide greater amounts of metalat the bottom of the recess for safety reasons.
When first member 47 and second member 53 engage upon door 1 closinginto door frame 15, and protrusion 51 enters recess 63, there isproduced at least one co-acting set of surfaces, namely surfaces 65 and67 respectively on protrusion 51 and on recess 63, that come togetherand prevent someone from prying door 1 out of plane x-y of door frame15. Usually door frame plane x-y is the same as the door plane and, inmost cases, the planes can be considered as superimposed on each other.A double-ended arrow 69 is shown on FIG. 3 passing in the direction ofthe "z" axis with an "x" through it showing that this embodiment of theinvention prevents prying of door 1 outward or inward from plane x-y(termed "translational movement") which are the planes of door frame 15and of door 1. This would be attempted by the criminal inserting a prybar into space 73, between door 1 and the front edge of door frame 15,and prying door 1 outward from plane x-y. While the pry bar is not shownin FIG. 3, it is easy to see that broad base 49 of first member 47co-acts with base 55 of second member 53 to provide a substantial amountof metal that, together, resists this prying motion. In this embodiment,the shape or dimension of the rear surface 75 of second member 53 is notimportant and does not enter into operation during opening and closingof door 1. Base 49 is preferably wider than protrusion 51 to providegreater strength where it is needed. This embodiment also causes lockingbolts 41b to become jammed behind bars 41c so that existing locking boltdevice 41 is caused to become bound up (see FIG. 1). This augments theaction of this invention and provides for more resistance againstunauthorized entry into the ATM machine or safe.
As shown in FIG. 4, this invention can be modified to perform doubleduty, namely to prevent door 1 from being pried out of the plane x-y offrame 15 (and door 1) as well as prevent door 1 from being priedsideways away from door jamb 21 or 25 in the plane of door 1. As shown,first member 47 and broad base 49 are mounted as shown in FIG. 3 bywelding or other such fastening means and includes protrusion 51 thatfaces upward and away from base 49 and toward door 1.
Second member 53 is also provided, defined by base 55 and body 57, thatextends or curves up and away from base 55 toward first member 47. Body57 terminates in end surface 61 wherein is formed recess 63, preferablyconcave, that faces outward toward protrusion 51 and moves away from andtoward said protrusion when door 1 is opened and closed as shown indotted outline in FIG. 3. The design of protrusion 51 is the same,namely, that its base 55 is sufficiently broad as to act as a wedge andprovide the maximum amount of metal adjacent interior surfaces 37 and 39of frame 15 and door 1.
When first member 47 and second member 53 engage upon door 1 closinginto door frame 15, and protrusion 51 enters recess 63, there isproduced at least one co-acting set of surfaces, namely surfaces 65 and67 respectively, that come together and prevent someone from prying door1 out of plane x-y of door frame 15. Usually door frame plane x-y is thesame as the door plane and, in most cases, the planes can be consideredas superimposed on each other. A double-ended arrow 69, in the directionof axis "z", is shown on FIG. 4 with an "x" through it showing that thisembodiment of the invention prevents prying of door 1 outward or inwardfrom plane x-y (termed "translational movement") which is the plane ofdoor frame 15 and of door 1. Also another arrow 71, in the direction ofaxis y--y, is shown with an "x" through it showing that this embodimentof the invention prevents prying of door 1 away from near side door jamb21. This would be attempted by the criminal inserting a pry bar intospace 73, between door 1 and the front edge of door frame 15, and pryingdoor 1 outward from plane x-y. While the pry bar is not shown in FIG. 4,it is easy to see that broad base 49 of first member 47 co-acts withbase 55 of second member 53 to provide a substantial amount of metalthat, together, resist this prying motion. Again, this embodiment alsocauses locking bolts 41b to become jammed in holes 41c so that existinglocking bolt device 41 is caused to become bound up. This augments theaction of this invention and provides for more resistance againstunauthorized entry into the ATM machine or safe.
In this embodiment however, the shape or dimension of the rear surface75 of second member 53 is important and does enter into operation duringopening and closing of door 1. FIG. 4 shows a bar 77 mounted againstsill 19 and held there by welding or some other strong fastening means.Bar 77 terminates at an end 79 in a curved surface, as shown, that isclosely spaced to second member rear surface 75. This closeness ismaintained during opening and closing of door 1 in frame 15 as shown indotted outline in FIG. 4 because rear surface 75 is made on a radialfrom hinge pin 33 and thus remains at the same distance from pin 33throughout opening and closing of door 1.
This is the second line of protection, namely that while the co-actingof first and second members 47 and 53 prevent door 1 from being priedout of plane x-y of door 1, the interaction of bar 77 on rear surface 75of second member 53 prevents door 1 from being pried sideways, away fromdoor jamb 21 in the plane of door 1. Bar 77 prevents second member 53from moving to the right or the inside of door 1 and away from door jamb21. In addition, this embodiment also causes locking bolts 41b to becomejammed in holes 41c so that existing locking bolt device 41 is caused tobecome bound up. This augments the action of this invention and providesfor more resistance against unauthorized entry into the ATM machine orsafe.
FIG. 5 shows the same members of FIG. 4 without the use of first member47 with its protrusion 51 and second member 53 with its recess 63. Itdoes utilize bar 77 with its curved end 79 that co-acts with secondmember rear surface 73.
FIG. 6 shows still another embodiment of the invention for use in thearea of the door that is located on the opposite side near door sidejamb 25. This is the side of door 1 that is not pivotally attached tojamb 25 and door 1 swings outward, away from the plane of jamb 25, whenthe door is opened.
As shown in FIG. 6, a first member 47 is provided, including a broadbase 49, for mounting to interior surface 39 of said door 1 and havingformed thereon a protrusion 51 extending upward from base 49 and facingrearward toward the interior of the ATM machine or safe when door 1 isclosed. A second member 53 is provided, including a base 55 for mountingagainst interior surface 37 of door jamb 25, second member 53 havingformed therein a recess 63 facing outward toward door 1. First member 47and second member 53 are arranged for movement away from each other whendoor 1 is opened, as shown by dotted lines in FIG. 6, and intointerlocking association when door 1 is closed in frame 15. When firstmember 47 and second member 53 engage upon door 1 closing into doorframe 15, and protrusion 51 enters recess 63, there is produced at leastone co-acting set of surfaces, namely surfaces 65 and 67 respectively,that come together and prevent someone from prying door 1 away from doorjamb 25. Base 49 is preferably wider than protrusion 51 to providegreater strength where it is needed. In addition, the outline of recess63 is preferably "V" shaped or "U" shaped to provide greater amounts ofmetal at the top of the recess for security reasons. Additionally, thisembodiment also causes locking bolts 41b to become jammed in holes 41cso that existing locking bolt device 41 is caused to become bound up.This augments the action of this invention and provides for moreresistance against unauthorized entry into the ATM machine or safe.
While the invention has been described with reference to a particularembodiment thereof, those skilled in the art will be able to makevarious modifications to the described embodiment of the inventionwithout departing from the true spirit and scope thereof. It is intendedthat all combinations of members and steps which perform substantiallythe same function in substantially the way to achieve substantially thesame result are within the scope of this invention.
What is claimed is:
1. In an apparatus having a door for opening andclosing access thereto, said door hingedly mounted in a door frame, saidframe including top and bottom door sills held in spaced-apartarrangement by a pair of spaced-apart frame side jambs, said sills andjambs interconnected at their respective distal ends and lying in acommon plane with said door, a device for preventing unauthorized pryingof said door out of said common plane and away from said door frame sidejambs, comprising:a) a first member including a first base for mountingto said door frame and having one of a protrusion and recess facingoutward from said first base toward said door; and, b) a second memberfor mounting to said door, defined by a second base and a body extendingupward away from said second base and having the other of saidprotrusion and said recess, said second member facing outward towardsaid first part, said second member arranged to pivot with said dooraway from and into interlocking engagement with said first member assaid door is opened and closed; c) said second member further includinga rear surface; and, d) a bar attached to said door frame, one againsteach said top and bottom door frame sills, each said bar terminating ina surface conforming to and closely spaced from said rear surface ofsaid second member when said door is closed to resist attempts to prysaid door sideways away from said frame side jamb.
2. The device ofclaim 1 wherein said base of said first member is wider than saidprotrusion.
3. The device of claim 1 wherein said recess is formed onsaid first member and said protrusion of said protrusion/recessconnector is formed on said second member.
4. The device of claim 1wherein said protrusion is "V" shaped.
5. The device of claim 1 whereinsaid recess is "U" shaped.
6. The device of claim 1 wherein said rearsurface of said second member is curved and said terminating surface ofsaid bar is arranged to remain close to said curved rear surface of saidsecond member when said door is opened and closed.
7. In an apparatushaving a door closing over its interior, for opening and closing accessthereto, said door including exterior and interior surfaces and hingedlymounted in a door frame, said frame including top and bottom door sillsheld in spaced-apart arrangement by a pair of spaced-apart frame sidejambs, said sills and jambs interconnected at their respective distalends and lying in a common plane with said door, a device for preventingunauthorized prying of said door out of said common plane and away fromsaid door frame side jambs, comprising:a) a first member including afirst base for mounting to said door frame and having one of aprotrusion and recess facing outward from said first base toward saiddoor; and, b) a second member for mounting to said door, defined by asecond base and a body extending upward away from said second base andhaving the other of said protrusion and said recess, said second memberfacing outward toward said first member, said second member arranged topivot with said door away from and into interlocking engagement withsaid first member as said door is opened and closed; c) a third member,including a third base, for mounting to said interior surface of saiddoor and having one of said protrusion and said recess facing outwardfrom said third base toward said interior of said apparatus when saiddoor is closed; and, d) a fourth member, including a fourth base formounting against said door side jamb, and having the other of saidprotrusion and said recess from said third member facing outward towardsaid third member, said fourth member arranged to move with said dooraway from and into interlocking engagement with said third member assaid door is opened and closed.
8. The device of claim 7 wherein saidbase of said first member is wider than said protrusion.
9. The deviceof claim 7 wherein said recess is formed on said first member and saidprotrusion of said first protrusion/recess connector is formed on saidsecond member.
10. The device of claim 7 wherein said protrusion is "V"shaped.
11. The device of claim 7 wherein said recess is "U" shaped. | 2024-03-22 | 1997-01-14 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1998-12-08"
} |
US-79921785-A | Television cabinet having snap-together assembly
ABSTRACT
A snap-together latch mechanism for a television cabinet consists of at least one pair of oppositely-disposed, flexible latch fingers secured to the cabinet front and a corresponding number of oppositely-disposed, rigid stops disposed on the back cover. To attach the back cover, it is simply aligned with the cabinet front and inserted to lock it in place.
This invention relates to a snap-type latch mechanism for releasablysecuring the two halves of a television cabinet.
BACKGROUND
Typically, the cabinet of a portable television receiver is made up of apair of injection molded halves--the cabinet front and the back cover,which are molded from a suitable thermoplastic material (e.g.,polystyrene). The picture tube and the chassis carrying the electronicsare mounted to the cabinet front. The back cover is then secured to thefront cover to complete the instrument assembly.
The fastening means used for attaching the back cover to the frontcabinet must fulfill a number of basic requirements. The fastening meansmust withstand shock and vibration encountered during handling andshipping. The fastening means must allow disengagement of the back coverfrom the cabinet front to permit servicing of the television instrument,and it must allow subsequent re-assembly of the back cover. Moreover,the fastening means must not permit inadvertent opening of the backcover to reduce safety hazards.
Traditionally, the television cabinet halves have been joined togetherwith screw type fasteners, since they meet the above-mentioned basicrequirements. However, a disadvantage of the screw type fasteners isthat they are not amenable to automatic assembly of the televisioninstrument. The assembly time required to install the screws isrelatively large. Furthermore, relatively sophisticated equipment isrequired for automatic installation of the screws.
In the television industry, substantial efforts have been directedtoward automation of the instrument assembly line. The pressures forautomation have intensified recently due to increased competition.Efforts are under way to design a product that lends itself to automaticassembly. Accordingly, it is desirable to provide a fastening means forjoining the back cover to the cabinet front, which not only satisfiesthe aforesaid basic requirements, but is also conducive to automation(e.g., robotic assembly).
SUMMARY OF THE INVENTION
In accordance with this invention, the cabinet halves are releasablyheld together by a snap-type latch mechanism instead of screws. Thesubject latch mechanism consists of at least one pair ofoppositely-disposed and relatively flexible latch fingers secured sideby side to one of the cabinet halves such that the latch fingers areencompassed within the closure defined by the cabinet halves uponassembly. Each of the latch fingers is provided with a major surfacedisposed substantially parallel to a path along which the two cabinethalves are inserted into each other to form the cabinet enclosure.Further disposed on each of the latch fingers, toward the free endthereof, is a protruding edge that extends away from the respective oneof the major surfaces, and substantially at right angles thereto. Thetwo latch fingers are mounted such that the protruding edges areoppositely disposed with respect to the insertion path.
The subject latch mechanism further includes a corresponding number ofoppositely-disposed, relatively rigid stops secured side by side to theother of the cabinet halves such that the stops are also encompassedwithin the enclosure when the cabinet halves are assembled together.Each of the cabinet halves are equipped with a protruding edge that isdisposed substantially perpendicularly to the insertion path. The stopsare mounted on the other member such that they engage and displace theflexible latch fingers in opposite directions as the cabinet halves areassembled together until the respective protruding edges of the stopscapture the associated protruding edges of the latching fingers toreleasably secure the cabinet halves to each other.
The cabinet enclosure is additionally equipped with a window forproviding a limited access to the latch fingers when the cabinet halvesare assembled to each other. The limited access window is dimensionedsuch that the entry of human fingers into the window is precluded, whilepermitting the introduction of a parting tool (e.g., a screwdriver) intothe window to cause deflection of the latch fingers in a manner causingdisengagement thereof from the stops.
In accordance with a further feature of the subject invention, the latchfingers and stops are integrally molded with the respective ones of thecabinet halves from a suitable, substantially rigid thermoplasticmaterial (e.g., polystyrene).
Pursuant to still another aspect of the invention, the latch fingers andstops are each provided with slanting exterior surfaces to facilitatethe assembly of the back cover to the cabinet front.
Although this invention is described in the context of a cabinet for atelevision receiver, it is equally applicable to the cabinets for otherproducts--such as video display terminals (VDT's), video cassetterecorders (VCR's), and so on.
IN THE DRAWINGS
FIG. 1 is a rear perspective view of a television receiver incorporatingthe snap-together latch mechanism for releasably securing the back coverto the cabinet front in accordance with the subject invention;
FIG. 2 depicts a partial cross-sectional view of the FIG. 1 televisionreceiver showing the details of the instant latch mechanism; and
FIGS. 3 and 4 are enlarged perspective views illustrating the sujectlatch mechanism before and after instrument assembly respectively.
DETAILED DESCRIPTION
As shown in FIGS. 1 and 2, a television receiver 10 includes a cabinet12, which defines an enclosure 14 for housing a picture tube 16 and achassis 18 of the television receiver. The television cabinet 12consists of a pair of cabinet halves--the cabinet front 20 and the backcover 22. The picture tube 16 and the chassis 18 are mounted to thecabinet front 20. The back cover 22 is then releasably attached to thefront cover 20 by means of a snap-together latch mechanism 30 pursuantto the present invention.
The cabinet front 20 and the back cover 22 are both injection moldedfrom a suitable, substantially rigid thermoplastic material--such aspolystyrene, in this particular embodiment of the present invention.
The enlarged perspective views of FIGS. 3 and 4 illustrate thecomponents of the latch mechanism 30. As indicated therein, the latchmechanism 30 includes (1) at least one pair of oppositely-disposed andrelatively flexible latch fingers 32 and 34 secured side by side to thecabinet front 20, and (2) a corresponding plurality ofoppositely-disposed, relatively rigid stops 36 and 38 mounted side byside on the back cover. Any suitable number of paired latch fingers andstops may be utilized to secure together the cabinet halves. In FIG. 1,two sets of paired latch fingers and stops are indicated for thepurposes of illustration.
The latch fingers 32, 34 and the stops 36, 38 are disposed on therespective cabinet halves 20, 22 such that they are totally encompassedwithin the confines of the cabinet enclosure 14 when the two halves areassembled to each other, as can be seen more clearly in FIG. 2. Thelatch mechanism 30 further includes a window 40 for providing a limitedaccess to the latch fingers 32 and 34. The limited access window 40 isdimensioned such that, on the one hand, it prohibits entry of humanfingers into the window, and, on the other hand, it allows introductionof an implement (e.g., a screwdriver) into the window to permitmanipulation of the latch fingers 32 and 34 to disassemble the backcover 22 from the cabinet front 20.
The encompassment of the latch fingers 32, 34 and the stops 36, 38within the enclosure 14 upon cabinet assembly prevents inadvertentopening of the back cover 22, thereby reducing the safety hazard. At thesame time, the access window 40 allows insertion of a screwdriver intothe enclosure 14 for releasing the back cover, for example, for thepurposes of servicing.
The latch fingers 32 and 34 are each provided with respective majorsurfaces 42 and 44 which are arranged substantially parallel to a path,indicated by a double-headed arrow 46, along which the two cabinethalves 20 and 22 are inserted into each other to form the cabinetassembly. Further disposed on the latch fingers 32 and 34 are respectiveprotruding edges 48 and 50 which extend away from, and substantially atright angles to, the corresponding major surfaces 42 and 44. At therespective free ends thereof, the protruding edges 48 and 50 areprovided with beveled outer surfaces 52 and 54 to facilitate thedeflection of the latch fingers 32 and 34 as the back cover 22 isinstalled to the cabinet front 20.
The latch fingers 32 and 34 are elongated and planar as can be seen inFIGS. 3 and 4. They are secured side by side to the cabinet front 20 attheir respective supported ends in a cantilever fashion such that theirassociated protruding edges 48 and 50 are oppositely disposed withrespect to the insertion path 46. This configuration of the latchfingers 32 and 34 allows them to be relatively flexible in the verticaldirection 62 perpendicular to the insertion path 46.
The beveled surfaces 52 and 54 of the latch fingers 32 and 34 areprovided with recessed areas 56 and 58. The recessed areas 56 and 58cooperate with each other to form a channel along which a screwdrivercan be inserted through the access window 40 for the purposes ofdisengaging the latch fingers 32 and 34 from the respective stops 36 and38.
The latch fingers 32 and 34 are offset with respect to each other in thehorizontal direction 60 and the vertical direction 62, so that ascrewdriver can be simply inserted between the latch fingers and twistedin order ti simultaneously release both the latch fingers from theirassociated stops 36 and 38.
The stops 36 and 38 are each provided with the respective protrudingedges 66 and 68, which are disposed substantially orthogonally withrespect to the insertion path 46. Further arranged n the respectiveprotruding edges 66 and 68 are inclined exterior surfaces 70 and 72along which the associated latch fingers 32 and 34 are guided duringassembly of the back cover 22 to the cabinet front 20.
The back cover 22 is equipped with a pair of reinforcing ribs 74 and 76for the purpose of lending rigidity to the stops 36 and 38. Asassociated pair of extension members 78 and 80 are provided on thecabinet front 20 for guiding the respective ribs 74 and 76 disposed onthe back cover 22 to ensure proper alignment during assembly.
It will be seen from FIGS. 3 and 4 that the oppositely-disposedprotruding edges 66 and 68 of the respective stops 36 and 38 are locatedsuch that they engage and deflect the corresponding protruding edges 48and 50 disposed on the respective latch fingers 32 and 34, as the backcover 22 is inserted into the front cabinet 20 during assembly. As theprotruding edges 66 and 68 of the stops 36 and 38 clear thecorresponding protruding edges 52 and 54 of the latch fingers 32 and 34,the resilient latch fingers snap back to capture the stops to secure theback cover 22 to the cabinet front 20.
The latch fingers 32 and 34 are slightly offset relative to therespective stops 36 and 38 in the vertical direction, so that when theback cover 22 is fully assembled to the cabinet front 20, the latchfingers occupy a slightly deflected position to assure a positiveengagement between the latch fingers and the associated stops. Thevertical offset between the latch fingers 32 and 34 and the respectivestops 36 and 38 is sufficient to maintain good engagement duringhandling and shipping and to accommodate manufacturing variations.
The inverted relationship between the latch fingers 32, 34 and the stops36, 38 makes the latch mechanism 30 resistant to shock and vibrationsduring shipping and handling of the television set 10. The forces thattend to release one of the latch fingers 32 and 34 from its engagementwith the associated stop also serve to reinforce the engagement betweenthe other of the latch fingers and the respective stop, therebypreventing accidental opening of the television cabinet 12 due to shockand vibration.
To unlock the back cover 22, a screwdriver is inserted through theaccess window 40 between the latch fingers 32 and 34. As previouslyindicated, the channel defined by the recessed areas 56 and 58 guidesthe insertion of the screw driver. After the screwdriver is sufficientlyinserted into the enclosure 14, it is twisted in a manner simultaneouslyreleasing the latch fingers 32 and 34 from the interlocking engagementwith the respective stops 36 and 38, whereby the rear cover 22 is freedfrom the cabinet front 20.
the latch fingers 32, 34 and the stops 36, 38 are preferably integrallymolded with the respective cabinet halves 20, 22 from a suitablethermoplastic material. Alternatively, the latch fingers 32, 34 and thestops 36, 38 may be disposed on associated injection-molded bases, and,in turn, glued to the respective ones of the cabinet halves 20, 22.
It will be seen that the snap-together latch mechanism 30 not only meetsall the basic requirements mentioned above, but lends itself to roboticassembly of the back cover 22 to the cabinet front 20. To install theback cover 22, a robot simply aligns the back cover 22 with the cabinetfront 20, and inserts it to lock it in place. The assembly time requiredfor the snap-together latch mechanism 30 is much less than that requiredwhen screws are used to attach the back cover 22.
A further advantage of the subject snap-together latch mechanism 30 isthat the latch fingers 32, 34 and the stops 36, 38 can be integrallymolded with the respective cabinet members at very little or no extracost, thereby eliminating the material costs associated with the screws.
What is claimed is:
1. A television cabinet comprising:a pair of cabinethalves defining an enclosure when said halves are inserted into eachother along a path; a pair of oppositely-disposed, relatively flexiblelatch fingers secured side-by-side to one of said cabinet halves suchthat said latch fingers are encompassed within said enclosure when saidcabinet halves are assembled together; each of said latch fingers havinga major surface disposed substantially parallel to said insertion path;each of said latch fingers further having, toward the free end thereof,a protruding edge that extends away from the respective one of saidmajor surfaces and substantially at right angles thereto; said latchfingers being mounted such that said latch fingers are offset withrespect to each other in a direction parallel to said major surfacesthereof, and such that said protruding edges are oppositely disposedwith respect to said insertion path; a pair of oppositely-disposed,relatively rigid stops secured side-by-side to the other of said cabinethalves such that said stops are encompassed within the confines of saidenclosure when said cabinet halves are assembled together; each of saidstops having a protruding edge which is disposed substantiallyorthogonally to said insertion path; said stops being mounted on saidother member such that they engage and deflect said flexible latchfingers in opposite directions as said cabinet halves are assembledtogether until said protruding edges of said stops capture therespective ones of said protruding edges of said latch fingers toreleasably secure said cabinet halves to each other; and said cabinetenclosure being additionally equipped with a window for providing alimited access to said latch fingers when said cabinet halves areassembled to each other; said limited access window being dimensionedsuch that entry of human fingers into said window is precluded, whileallowing introduction of an implement into said window to causedeflection of said latch fingers in opposite directions in a mannercausing disengagement thereof from said stops.
2. The cabinet as definedin claim 1 wherein said limited access window is disposed on said othercabinet half provided with said rigid stops.
3. The cabinet as definedin claim 1 wherein said limited access window provides access to saidlatch fingers in a direction parallel to said insertion path.
4. Thecabinet as defined in claim 1 wherein said flexible latch fingers areadditionally offset with respect to each other in a directionperpendicular to said major surfaces thereof.
5. The cabinet as definedin claim 1 wherein each of said flexible latch fingers is furtherprovided with a beveled outer surface which extends from said protrudingedge thereof to said free end thereof in order to facilitate saiddeflection of said latch fingers during said assembly.
6. The cabinet asdefined in claim 1 wherein said latch fingers are dimensioned such thattheir free ends extend beyond the respective ones of said protrudingedges of said stops in order to further facilitate manipulation of saidlatch fingers with said implement to cause said disengagement.
7. Thecabinet as defined in claim 1 wherein each of said rigid stops isadditionally provided with an inclined outer surface extending from saidprotruding edge thereof to the terminal end thereof in order tofacilitate said deflection of said latch fingers during said assembly.8. The cabinet as defined in claim 1 wherein said cabinet halves areinjection molded from a thermoplastic material; wherein said flexiblelatch fingers are integrally molded with respect to said one cabinethalf.
9. The cabinet as defined in claim 1 wherein said flexible latchfingers are disposed on a base, which is glued to said one cabinet half.10. The display device cabinet as defined in claim 1 wherein saidcabinet halves are injection molded from a thermoplastic material;wherein said rigid stops are integrally molded with respect to saidother cabinet half.
11. The cabinet as defined in claim 1 furtherincluding a second pair of flexible latch fingers and rigid stops havingsubstantially the same configuration as said first mentioned latchfingers and stops; said second pair of latch fingers and stops beingsecured to the respective ones of said cabinet halves in substantiallythe same manner as said first mentioned latch fingers and stops; saidenclosure being provided with a second limited access window ofsubstantially the same configuration as said first mentioned window. | 2024-03-22 | 1985-11-18 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1987-01-13"
} |
US-15080850-A | Spirocyclohexanes and methods of preparation thereof
Patented Feb. 19, 1952 SPIROCYCLOHEXANES AND METHODS OF PREPARATIONTHEREOF Louis H. Schwartzman and Gilbert Forrest Woods, Jr., SilverSpring, Md., assignors to Chemectron Corporation, Washington, D. C., a
corporation of Delaware No Drawing. Application March 20, 1950, SerialNo. 150,808
4 Claims. (Cl. 260576) This invention relates to compounds of thespirocyclohexane type and methods of preparation thereof.
More particularly, the invention relates to the synthesis of compoundsof the spirocyclohexane type, particularly those having analgesicproperties such as possessed by morphine and other opiates derived fromnatural sources.
Considerable effort has been directed in the past toward the synthesisof suitable analgesics as substitutes for morphine and the like,particularly in view of the fact that the principal source of supply ofmorphine and related compounds is dependent upon natural sources, mostof which are presently located in the Orient. In an effort to producechemically synthesized analgesics domestically on an economicallypracticable basis, and to provide a source of analgesics independent ofnatural supplies of raw materials, many attempts have been made tosynthesize various analgesics as substitutes for morphine and the like,some of the more recently developed compounds being COOEt Demerol etc.
Among other things, it has been found that many synthetic compoundsproduced heretofore, although having some of the analgesic properties ofmorphine and the like, are not satisfactory from the standpoint ofmanufacturing costs, and even in some cases are unsuitable for use byhuman beings because of their high toxicity or side-effects and otherundesirable properties.
It is found that compounds of the present invention are not onlyrelatively simple and inexpensive to manufacture from readily availableraw materials but, in addition, have satisfactory analgesic propertiesand are of sufiiciently. low toxicity to permit safe use by humanbeings.
In its more specific aspects the present invention pertains to thesynthesis of analgesic compositions of the spirocyclohexane type byemploying cyclohexanone as a starting material and producing therefrom alarge number of new, novel and useful analgesic compounds containing aquaternary carbon atom in the molecule and, in addition, either aprimary, secondary, or tertiary amine group.
The invention also provides new and novel methods of preparing thecompounds described herein, such methods being particularly advantageousin view of the simplicity of the procedures, economic practicability andcomparatively high yields of the intermediates'and the end productswithout the use of complicated or expensive starting materials,apparatus, or processes.
The intermediates required for synthesis of the compounds of the presentinvention may be prepared, for example, in the manner described incopending application Serial No. 150,806, filed of even date herewith,by using cyclohexanone as a starting material, treating it with amixture of calcium carbide and potassium hydroxide to yield anacetyienic glycol such as 1,1-ethynylenebis-cyclohexanol according tothe reaction:
OH OH A 050 CaG; KOH
(I) (II) This glycol (It) is then dehydrated to the dieneyne (III) by,for instance, heating the above glycol under reflux conditions withdilute sulfuric acid as follows:
acid, thus producing as intermediates, cyclic ketones such asspire[cyclohexane-Ll-A -tetrahy 3 droindanone-3'] (IV) and its isomerspirolcyclohexane-1,1-A '-tetrahydroindanone-3'l (V) in accordance withthe following reaction:
To produce the analgesic compounds of the present invention, the cyclicketones (IV) and/or (V) are converted to the aromatic ketone (VI) andsubsequently to its oxime (VII) in the well known manner according tothe reactions:
and thereafter the oxime (VII) is hydrogenated in the presence of acatalyst to produce an analgestic spiroindane in accordance with thereaction:
(VII) Another spiroindane coming within the scope of the presentinvention may be prepared by further treatment of the spiroindane.(VIII) according to the following reaction:
Instead of preparing the oxime as indicated above, the ketones (IV)and/or (V) can be aromatized according to the method described incopending application Serial No. 150,806, filed of even date herewith,to produce an aromatic ketone from which there may be prepared a seriesof aromatized compounds such as aromatic spirocyclohexanes orspirocyclohexylquinolines, depending upon the desired end products. The
following reaction illustrates the aromatization step set forth in thatapplication:
Catalyst Instead of converting the non-aromatic ketones (IV) and/or (V)into the aromatic ketone (VI), a series of valuable analgesic compoundsmay be prepared from said non-aromatized ketones as described incopending application Serial No. 150,807, filed of even date herewith.
Various other series of analgesic compounds, in addition to the seriesof the present invention, may be prepared as set forth in copendingapplications Serial Nos. 150,809, and 150,810, each filed of even dateherewith.
In accordance with the present invention the cyclic ketone is aromatizedin the manner described in copending application a Serial No. 150,806,filed of even date herewith, and a series of analgesic aromaticspiroindanes is produced from the aromatic ketone. v
It is an object of the present invention, therefore, to provide a seriesof aromatic spiroindanes having analgesic properties. It is a furtherobject of the present invention to provide a'series of aromaticspiroindanes having a quaternary carbon atom and, in addition, aprimary, secondary, or tertiary amine group. It is a still furtherobject of the invention to provide aromatic aminospiroindanes of thetype:
\C/ /Ri 11 \N\ wherein R1 and R2 are selected from the group consistingof hydrogen and lower alkyl groups.
It is a still further object of the present invention to provide methodsof preparation of the foregoing compounds.
For purposes of illustration, but without limiting the scope of thepatent thereto, representative compounds of the present invention andmethods of preparation thereof are described in detail in the followingexamples:
Example I 15 grams of the aromatic ketone spiro[cyclohexane-1,1'-indanone-3'l as described hereinbefore is added to amixture of hydroxylamine hydrochloride (17.5 grams), pyridine (32 ml.)and anhydrous alcohol (81 m1.) and the solution is refluxed for 3 hours.Thereafter, the solvent is removed and the crystalline massis'recryst'allized from an alcohol-water mixture to yield 14.1
grams of the oxime of the aromatic 'ketone which melts at 1'38-13'9.This oxime (17.5 grams), in turn, is hydrogenated at room temperature"and atmospheric pressure in 100 ml. of glacial acetic acid solutioncontaining 1 gram of platinum oxide catalyst. The catalyst is removed byfiltration and the solvent is removed by distillation under reducedpressure. The residue, the acetylated amine, is hydrolyzed by refluxingfor three hours in 100 ml. of 20% sodium hydroxide. The amine isisolated from the cooled solution by acid-base extraction and the driedether solution is distilled in a nitrogen atmosphere under reducedpressure to yield grams of the aromatic aminospiroindane: spiro[cyclohexane-1,1'-3'- aminoindane] which boils at 115-l17/1 mm., n=1.5512. This compound has the formula:
H NH:
This compound possesses the analgesic effect on white mice described inthe chart below:
M. E. D. L. D50
30 ring/kg. body wght. 275 mgJkg. body wght.
Example II To a solution of 3 grams of the amine,spiro[cyclohexane-1,l'-3'-aminoindane] and 3.5 grams of 90% formic acid,3.5 grams of ai36% aqueous solution of formaldehyde was added. Uponwarming this mixture to room temperature a vigorous evolution of carbondioxide ensued and lasted for one hour, after which the mixture wasrefluxed on a steam bath overnight. Isolation of the amine wasaccomplished in the usual manner. This product was then treated with 30ml. of 20% sodium hydroxide and 8 m1. of acetic anhydride. The tertiaryamine (2.5 grams or 73% spiro[cyclohexane-1,1'-3'-dimethy1-aminoindane], isolated from this mixture in the usual manner, boiled atl23-124 (0.8 mm). n =l.5400. This compound has the formula:
This compound possesses the analgesic effect on white mice described inthe chart below:
M. E. D. L. Duo
30 mg./kg. body wght. 100 mgJkg. body wght.
Example III The compound spirolcyclohexane- 1,1.- 3'- methylaminoindane]may also be prepared in the manner described in Example "II by employingequimolar quantities of the spirolcyclohexane- 1,1-3'-aminoindane] .andformaldehyde. This compound has the formula:
In the foregoing examples it will be understood that in lieu of themethyl group other lower alkyl groups such as ethyl, propyl, etc., maybe incorporated in the molecule by proper selection of the reactingmaterials in the manner obvious to those skilled in the art. Likewise,it will be understood that the alkoxy group may be methoxy, ethoxy,propoxy, etc., the acyl group may be acetyl, propionyl, butyryl, etc.,and the halogen may be the chloride, bromide, iodide, fluoride, etc.
The term M. E. D. is used herein as an abbreviation for the minimaleffective dosage for 50% of the animals tested. The term L. D50 is usedherein as an abbreviation for the lethal dosage for 50% of the animalstested.
It will be understood that other modifications may be made in theforegoing examples without departing from the scope of the invention. Itis intended, therefore, that the patent shall cover by suitableexpression in the appended claims the features of patentable noveltyresiding in the invention.
We claim:
1. Spirocyclohexanes of the type:
wherein R1 and R2 are selected from the group consisting of hydrogen andlower alkyl groups.
2. Spiro[cyclohexane-1,1'-3'-aminoindane] of the formula:
H N H:
3. Spirolcyclohexane 1,1 3' methylaminoindane] of the formula:
7 4. SpiroEcyclohexane 1,1 3' --d1methy1- REFERENCES CITED amimmdane] ofthe formula: The following references are of record in the file of thispatent:
6 Schwartzman, J. Org. Chem., v01. 15, pages H NCH: 10
LOUIS H. SCHWARTZMAN. GILBERT FORREST WOODSI JR.
1. SPIROCYCLOHEXANES OF THE TYPE: | 2024-03-22 | 1950-03-20 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1952-02-19"
} |
US-86953292-A | Method of manufacturing seamless capsules and apparatus therefor
ABSTRACT
A method of manufacturing seamless capsules, wherein multi-layer liquid flow is blown out of a multiple nozzle to form multi-layer droplets which are brought into contact with hardening liquid to be solidified to thereby manufacture the seamless capsules SC and an apparatus therefor. A groove having U-shaped section for supplying the hardening liquid and the multi-layer droplets is orientated in a direction tangent to a circular section of a hardening vessel in the hardening vessel and a helical flow is formed in the hardening liquid in the hardening vessel, whereby the multi-layer droplets are fallen, moving helically in the hardening vessel.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a technique of manufacturing seamlesscapsules, and particularly to a method of manufacturing seamlesscapsules manufactured by use of droplets formed by blowing a liquid flowout of a nozzle, and an apparatus therefor.
2. Related Art Statements
Out of the techniques of manufacturing capsules with no seams in coatinglayers thereof, i.e., seamless capsules, particularly as a techniquesuitable for manufacturing capsules smaller in size than an ordinarysoft capsule and larger in size than a microcapsule, such a method iswidely known that a multi-layer liquid flow is blown out into air orliquid from a multiple nozzle such as a double nozzle and a triplenozzle to form multi-layer droplets, and the outermost layer liquid ofthe multi-layer droplets is caused to react with hardening liquid, tothereby obtain a seamless capsule, in which liquid in an layer isenclosed.
Furthermore, there has been used such a method that outer portions ofsingle layer droplets, which are formed by use of a single nozzle, aresolidified in hardening liquid, to thereby manufacture a seamlesscapsule of a single layer.
In the techniques of manufacturing the seamless capsules as describedabove, the outermost layer liquid of the multi-layer droplets forforming the seamless capsules is solidified, namely, hardened, bychemical reaction with a hardening liquid or by cooling with a hardeningliquid. In either one of solidifying mechanisms, the droplets solidifygradually as the time for contacting the hardening liquid elapses.
Then, particles of the multi-layer droplets thus solidified aredelivered to the following processes where they are separated from thehardening liquid and dried. However, if the solidifying is insufficient,then such unfavorable phenomena occur that the particles are deformed,the particles adhere to each other to agglomerate or solidifiedmembranes are broken.
Accordingly, in order to obviate the above-described disadvantages, thetime of contact between the hardening liquid for solidifying theparticles and the multi-layer droplets should be satisfactorilylengthened. Particularly, in the case of the solidifying mechanism wheresolidifying is effected by cooling, the solidifying velocity is slow, sothat the time of contact for solidifying should be extended.
Then, it is conceived that, in order to lengthen the above-describedcontact time, the flow velocity of the hardening liquid should be sloweddown.
However, because of the following problems (A) and (B), it is difficultto adopt the lengthening of the time of contact by slowing down the flowvelocity of the hardening liquid.
(A) In order to prevent the breakage and deformation of the droplets, arelative velocity between the multi-layer droplets blown out of thenozzle and the flow of the hardening liquid should be reduced as much aspossible. As the velocity of the hardening liquid is slowed down, theblow-out speed of the droplets should be reduced accordingly, thuslowering the producing efficiency.
(B) Even when the above-described problem (A) is solved by some method,the density of the droplet particles in the hardening liquid isincreased, and thus adhesion of unsolidified droplets tends to occureasily.
Therefore, it has heretofore been conceived that the length of a coursefor conveying the droplets from the contact of the multi-layer dropletswith the hardening liquid to the reach of the droplets to a separatingdevice is satisfactorily lengthened structurally, thus securing thecontact time.
However, this conventional structure has the disadvantage that theapparatus is largely increased in size, particularly, in the case wherethe capsules is solidified with cooling liquid, thus presenting one ofthe difficult problems of the apparatus for manufacturing seamlesscapsules under the method of solidifying the multi-layer droplets.
SUMMARY OF THE INVENTION
One object or the present invention is to provide a technique ofmanufacturing seamless capsules, in which the contact time between thedroplets and the hardening liquid can be lengthened satisfactorily.
Another object of the present invention is to provide a technique ofmanufacturing seamless capsules, in which a substantially long length ofa flow course can be provided in a small-sized apparatus.
The above and other objects and novel characteristics of the presentinvention will become apparatus when referred to the followingdescriptions given in conjunction with accompanying drawings.
Out of the inventions disclosed in the present application, outlines oftypical ones will be described briefly in the following.
That is, with the method of manufacturing seamless capsules according tothe present invention, in manufacturing the seamless capsules in such amanner that at least the outermost portions of the droplets are broughtinto contact with the hardening liquid to be solidified, the dropletsare fallen, moving helically in at least a part of the hardening liquid.
One of the apparatuses of manufacturing seamless capsules according tothe present invention is an apparatus for manufacturing seamlesscapsules, in which at least the outermost portions of the droplets aresolidified in contact with the hardening liquid, said apparatus beingconstructed such that said apparatus comprises: a nozzle for blowing outthe droplets in the air; a hardening vessel, at least a part of which isformed into a straightly erected cylindrical shape; and a dropletconveying means orientated in a direction tangent to the hardeningvessel, for conveying the droplets blown out of the nozzle; to therebysupply the hardening liquid, which accompanies the droplets, in thedirection tangent to the hardening vessel so that the droplets can behelically fallen in the hardening vessel.
Further, another apparatus of manufacturing seamless capsules accordingto the present invention is an apparatus, in which at least theoutermost portions of the droplets are solidified in contact with thehardening liquid, said apparatus comprising: a hardening vessel, atleast a part of which is formed into a straightly erected cylindricalshape; a hardening liquid supply means, a supply part of which isorientated in a direction tangent to the hardening vessel, for supplyingthe hardening liquid in the direction tangent to the hardening vessel;and a nozzle for blowing out the droplets into the hardening liquid ofthe hardening liquid supply means or the hardening vessel; so that thedroplets blown out into the hardening liquid can be helically fallen inthe hardening liquid.
Furthermore, another apparatus of manufacturing seamless capsulesaccording to the present invention is an apparatus in which at least theoutermost portions of the droplets are solidified in contact with thehardening liquid, said apparatus comprising: a hardening vessel, atleast a part of which is formed into a straightly erected cylindricalshape; a hardening liquid supply means rotatably provided in thehardening vessel; a rotatably driving means for rotating the hardeningliquid supply means; and a nozzle for blowing out the droplets into thehardening liquid in the hardening liquid supply means or the hardeningvessel.
With the method of manufacturing seamless capsules and the apparatustherefor according to the present invention, when the droplets arefallen through the part of the hardening liquid, the droplets move todraw a helical locus, whereby the length of the flow course of thedroplets during falling becomes very long, thus substantially amountingto several times larger than the length of the hardening vessel.
Further, the hardening vessel in the apparatus according to the presentinvention is formed of the cylinder having an inner diameter severaltimes larger than one of a flow course of the droplet conveying means ora piping of the hardening liquid supply means, whereby a linear velocityof the hardening liquid in this part is by far slower than a linearvelocity in the flow course of the droplet conveying means or the pipingof the hardening liquid supply means, so that the time of contact isfurther lengthened for the substantial length of the flow course of thedroplets.
In this case, if the length of the droplet conveying means or thehardening liquid supply means is selected such that the solidifying isprogressed to some extent before the droplets reach the hardeningvessel, then the problem of mutual adhesion between the droplets can beavoided.
Thus, according to the present invention, the time of contact betweenthe droplets and the hardening liquid becomes satisfactorily long, sothat desirable seamless capsules of high quality can be obtained.
Furthermore, according to the present invention, the apparatus issmall-sized and simple in construction.
Further, according to the present invention, the helical flow of thehardening liquid for moving the droplets helically can be obtained by asimplified construction.
The present invention will hereunder be described with reference toembodiments shown in the drawings.
In the drawings, same reference characters designate same or similarelements.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic explanatory view showing one embodiment in whichthe present invention is applied to the apparatus for manufacturingseamless capsules of an in-air nozzle type;
FIG. 2 is an enlarged partially longitudinally sectional view showingone embodiment of the hardening vessel in the embodiment shown in FIG.1;
FIG. 3 is a schematically enlarged plan view showing the hardeningvessel shown in FIG. 2;
FIG. 4 is a schematic explanatory view showing one embodiment in whichthe present invention is applied to the apparatus for manufacturingseamless capsules of an in-liquid nozzle type;
FIG. 5 is an enlarged partially longitudinally sectional view showingone embodiment of the hardening vessel in the embodiment shown in FIG.4;
FIG. 6 is a schematically enlarged horizontally sectional view showingthe hardening vessel shown in FIG. 5;
FIG. 7 is a schematic explanatory view showing another embodiment inwhich the present invention is applied to the apparatus formanufacturing seamless capsules of the in-liquid nozzle type;
FIG. 8 is an enlarged partially longitudinally sectional view showingthe hardening vessel in the embodiment shown in FIG. 7; and
FIG. 9 is a schematically enlarged horizontally sectional view showingthe hardening vessel shown in FIG. 8.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Referring to the drawings, FIGS. 1 to 3 shown one embodiment in whichthe present invention is applied to the in-air nozzle type apparatus formanufacturing seamless capsules of the, FIG. 1 is the schematicexplanatory view of the apparatus, FIG. 2 is the enlarged partiallylongitudinally sectional view of the hardening vessel in the embodimentshown in FIG. 1, and FIG. 3 is the schematically enlarged plan view ofthe hardening vessel.
In the apparatus for manufacturing seamless capsules of the in-airnozzle type as shown in FIG. 1, core liquid (inner layer liquid) 1 forforming seamless capsules is stored in a core liquid tank 2, andencapsulating liquid (outer layer liquid) 3 for covering the core liquid1 is stored in a coating liquid tank 4.
The core liquid 1 is delivered under pressure from the core liquid tank2 to a multiple nozzle 7 through a piping 6, while the encapsulatingliquid 3 is delivered under pressure from the coating liquid tank 4 tothe multiple nozzle 7 by a pump 8 through a piping 9.
The multiple nozzle 7 is constructed to be vibrated by an vibrator 7A.The core liquid 1 and the encapsulating liquid 3 are blown out in theair from this multiple nozzle 7 and fallen into hardening liquid whichwill be described hereunder and formed into seamless capsules SC of amulti-layer droplet type.
Furthermore, hardening liquid 10, for solidifying multi-layer dropletsblown out of the multiple nozzle 7 during processes of manufacturing theseamless capsules SC, is stored in a hardening liquid tank 11, caused toflow out into an inclined groove 13 having U-shaped section (a dropletconveying means, i.e., a flow course for the hardening liquid) through avalve 12, and further, adapted to flow down into a hardening vessel 14.
This hardening vessel 14 has a section of a cylindrical shape in whichdroplets are cooled and solidified. At an opening on the top thereof, adischarging end (bottom end) of the groove 13 having U-shaped section isinserted obliquely into the hardening vessel 14 in a direction,preferably, tangent to the cylindrical section of the hardening vessel14.
Accordingly, as shown in FIGS. 2 and 3, the hardening liquid 10 flowinginto the hardening vessel 14 from the groove 13 having U-shaped sectionflows down along an inner wall of the hardening vessel 14, while forminga helical flow 10A, and also, the multi-layer droplets accompanied bythe hardening liquid 10 is fallen, moving along a helical locus in thehardening vessel 14.
Such an arrangement is adopted that a pipe 15 is connected to the centerof the bottom, having a substantially inverted circular cone shape, ofthe hardening vessel 14, and the seamless capsules SC cooled andsolidified in the hardening vessel 14 flow down into a separating tank16 together with the hardening liquid 10 from the bottom of thehardening vessel 14 through the pipe 15.
A slant perforated member 17 is provided on the top of the separatingtank 16 and this slant perforated member 17 is of a construction havingmultiple pores each having a size not permitting the seamless capsulesSC flowing out of the pipe 15 to pass therethrough, so that the seamlesscapsules SC flowing down onto the slant perforated member 17 move alongan inclined surface of the slant perforated member 17, turning aroundforwardly, and are recovered into a product recovering vessel 18.
On the other hand, the hardening liquid 10 flowing down onto the slantperforated member 17 from the pipe 15 passes through the multiple poresof the slant perforated member 17 and flows down into the separatingtank 16.
The hardening liquid 10 in the separating tank 16 is delivered underpressure by a pump 19 into a cooling tank 21 through a piping 20. Thehardening liquid 10 in the cooling tank 21 is cooled to a predeterminedtemperature by a cooler 22, and thereafter, returned by a pump 23 intothe hardening liquid tank 11 through a piping 24.
Action of this embodiment will hereunder be described.
First, the core liquid 1 and the encapsulating liquid 3 respectivelysupplied from the core liquid tank 2 and the coating liquid tank 4 areblown out into the air from the multiple nozzle 7 vibrated by thevibrator 7A and formed into the multi-layer droplets.
The multi-layer droplets are dropped into the groove 13 having U-shapedsection, accompanied by the flow of the hardening liquid 10 flowingthrough the groove 13 and flow down into the hardening vessel 14 alongthe slant of the groove 13.
The groove 13 having U-shaped section is orientated in a directiontangent to the circular sectional shape of the hardening vessel 14, sothat the flow of the hardening liquid 10 from the groove 13 havingU-shaped section is fallen in the hardening vessel 14, forming thehelical flow 10A while flowing into the hardening vessel 14 as shown inFIGS. 2 and 3.
Accordingly, the multi-layer droplets flowing into the hardening vessel14 together with the hardening liquid 10 are fallen, moving helicallyalong a locus of the helical flow 10A of the hardening liquid 10.
As a result, the length of flow course of the multi-layer droplets inthe hardening vessel 14 is very much lengthened as compared with arectilinear flow course, so that the time of contact between themulti-layer droplets and the hardening liquid 10 can be satisfactorilylengthened.
In this embodiment, with this arrangement, the solidifying of themulti-layer droplets is satisfactorily carried out and the disadvantagesof deformation of the particles of droplets, mutual adhesion between theparticles and agglomeration, breakage of solidified membranes and thelike can be avoided, so that the seamless capsules of high quality canbe obtained.
Further, a hardening vessel 14 in the apparatus of this embodiment isformed of a cylinder having an inner diameter several times larger thanthat of the flow course of the groove 13 having U-shaped section asbeing a droplet conveying means, whereby a linear velocity of thehardening liquid in this part becomes by far slower than the linearvelocity in the flow course of the groove 13 having U-shaped section, sothat the time of contact can be further lengthened as for thesubstantial length of the flow course of the droplets.
In this case, if the length of the groove 13 having U-shaped section isselected such that the solidifying proceeds to some extent before thedroplets reach the hardening vessel 14, then the problem of mutualadhesion between the droplets can be obviated.
The multi-layer droplets which have completed the solidifying passedthrough the hardening vessel 14 and the pipe 15, are separated on theslant perforated member 17 of the separating tank 16 and recovered intothe product recovering tank 18.
Subsequently, FIG. 4 is the schematic explanatory view showing anotherembodiment in which the present invention is applied to the apparatusfor manufacturing seamless capsules of the in-liquid nozzle type, FIG. 5is the enlarged partially longitudinally sectional view showing oneembodiment of the hardening vessel in the embodiment shown in FIG. 4,and FIG. 6 is the schematically enlarged horizontally sectional viewshowing the hardening vessel shown in FIG. 5.
In the embodiments shown in FIGS. 4 to 6, portions corresponding to theembodiments shown in FIGS. 1 to 3 are designated by the same referencecharacters, thereby avoiding repeated descriptions.
Since the apparatus for manufacturing seamless capsules in theembodiment shown in FIGS. 4 to 6 is of the construction of the in-liquidnozzle type, such an arrangement is adopted that the multiple nozzle 7is inserted into a hardening liquid supply tube 27 as being thehardening liquid supply means for cooling and solidifying themulti-layer droplets by use of the hardening liquid 10, and the coreliquid 1 and the encapsulating liquid 3 are blown out into the hardeningliquid 10 in this hardening liquid supply tube 27 such that theencapsulating liquid 13 covers the whole periphery of the core liquid 1.
In this embodiment, the hardening liquid supply tube 27 is inserted intothe hardening vessel 25 from above.
The top portion of this hardening liquid supply tube 27 is connected tothe piping 24, while the bottom portion thereof has an outwardly andslightly downwardly bent supply port portion 27A which is orientated ina direction, preferably, tangent to the circularly sectional shape ofthe hardening vessel 25.
With this arrangement, when the hardening liquid 10 passes through theouter periphery of the multiple nozzle 7 in the hardening liquid supplytube 27 and is discharged from the supply port portion 27A, thehardening liquid 10 forms the helical flow 10A in the hardening vessel25, accompanying the multi-layer droplets in the helical flow 10A.
Accordingly, in this embodiment, the core liquid 1 and the encapsulatingliquid 3 which are blown out of the multiple nozzle 7 are formed intothe multi-layer droplets in the hardening liquid 10 in the hardeningliquid supply tube 27, thereafter, blown out of the supply port portion27A of the hardening liquid supply tube 27 in a direction tangent to thehardening vessel 25 thereinto, being accompanied by the hardening liquid10, and are solidified through the agency of the hardening liquid 10 asthey are helically fallen together with the helical flow 10A of thehardening liquid 10 in the hardening vessel 25, thus forming theseamless capsules SC.
The seamless capsules SC thus formed move from an outlet end of thehardening vessel 25, pass a pipe 26, flow down together with thehardening liquid 10 onto the slant perforated member 17 of theseparating tank 16, separated from the hardening liquid 10 on the slantperforated member 17, and turn around on the inclined surface of theslant perforated member 17 to be recovered into the product recoveringvessel 18.
In this second embodiment, the hardening liquid 10 discharged from thesupply port portion 27A of the hardening liquid supply tube 27 isdischarged in the direction tangent to a cylindrical inner wall surfaceof the hardening vessel 25, thereby forming the helical flow 10A in thehardening vessel 25.
Then, the multi-layer droplets blown out into and formed in thehardening liquid 10 in the hardening liquid supply tube 27, after beingbrought into contact with the hardening liquid 10 in the hardeningliquid supply tube 27, are fallen downwardly in a substantiallyrectilinear direction in the hardening liquid supply tube 27. However,after discharged from the supply port portion 27A, the multi-layerdroplets are fallen along the helical flow 10A of the hardening liquid10 in the hardening vessel 25, moving in the helical flow, and contactthe hardening liquid 10 for a long period of time.
Accordingly, in this embodiment also, the multi-layer droplets are incontact with the hardening liquid 10 for the satisfactorily long time,so that the satisfactory seamless capsules SC with no deformation,adhesion and agglomeration of the droplets can be obtained.
Further, the hardening vessel 25 in the apparatus of this embodiment hasthe inner diameter having the diameter of several times larger than thatof the piping of the hardening liquid supply tube 27 as being thehardening liquid supply means, whereby, the linear velocity of thehardening liquid in this part is by far slower than the linear velocityin the piping of the hardening liquid supply tube 27, so that the timeof contact can be further lengthened as for the substantial length ofthe flow course of the droplets.
In this case, if the length of the hardening liquid supply tube 27 orthe droplet conveying means is selected such that the solidifying isprogressed to some extent before the droplets reach the hardening vessel25, then the problem of the mutual adhesion between the droplets can beavoided.
Incidentally, as indicated by a two-dot chain line in FIG. 6, themultiple nozzle 7 may be provided in a non-coaxial manner as formedseparately of the hardening liquid supply tube 27 at the outside thereofin the hardening vessel 25.
FIG. 7 is the schematic explanatory view showing another embodiment inwhich the present invention is applied to the apparatus formanufacturing seamless capsules of the in-liquid nozzle type, FIG. 8 isthe enlarged partially longitudinally sectional view showing oneembodiment of the hardening vessel in the embodiment shown in FIG. 7,and FIG. 9 is the schematically enlarged horizontally sectional viewshowing the hardening vessel shown in FIG. 8.
This third embodiment is similar to the second embodiment, however, thetwo embodiments are different from each other in that, differing fromthe hardening liquid supply tube 27 in the second embodiment, ahardening liquid supply tube 28 in this embodiment is provided rotatablyabout a vertical axis.
That is, the hardening liquid supply tube 28 in this embodiment isdisposed at a position of an axis of the hardening vessel 25 at theoutside thereof, and has a tubular construction including a fixed upperportion 28A connected thereto with the piping 24 for supplying thehardening liquid 10 and a lower portion 28B, a bottom end portion ofwhich is inserted into the hardening liquid 10 in the hardening vessel25, rotatably by a rotatably driving source 29 such as a motor.
The top of the lower portion 28B of this hardening liquid supply tube 28is rotatable with respect to a top wall of the hardening vessel 25through a bearing 30.
Furthermore, the end portion of the lower portion 28B is formed into abent shape as a supply port portion 28C orientated outwardly andslightly downwardly so as to produce a spinning flow, i.e., helical flowin the hardening vessel 25.
Further, the rotatably driving source 29 is transmittably connected to asprocket 32 of the lower portion 28B of the hardening liquid supply tube28 through a belt 31.
Accordingly, in this embodiment also, in the hardening liquid supplytube 28, the droplets are blown out of the multiple nozzle 7 into andformed in the hardening liquid 10, and are fallen downwardly in thesubstantially rectilinear direction. However, the hardening liquid 10blown out of the supply port portion 28C of the lower portion 28B of thehardening liquid supply tube 28 rotatable coaxially with the hardeningvessel 25 by the rotatably driving source 29 is spun in the hardeningliquid 10 in the hardening vessel 25 and forms the helical flow 10A. Themulti-layer droplets are fallen, moving helically as accompanied by thishelical flow 10A.
As a result, the length of the flow course of the multi-layer dropletsis very much lengthened, whereby the multi-layer droplets are in contactwith the hardening liquid 10 for the satisfactorily long time, so thatthe satisfactory seamless capsules SC can be manufactured.
Furthermore, in this embodiment, even if the linear velocity of thehardening liquid in the hardening vessel 25 is slow, the intervalsbetween the droplets are made larger by the rotation of the supply portportion 28C, so that a risk of the mutual adhesion between the dropletscan be advantageously avoided.
Incidentally, in this embodiment also, except that the multiple nozzle 7is provided in the hardening liquid supply tube 28, the multiple nozzle7 may be provided on the non-coaxial manner as a member formedseparately of the hardening liquid supply tube at the outside thereof.
The invention by the present inventors has been described in detail withreference to the embodiments as explained above, however, the presentinvention should not be limited to the above embodiments, and, needlessto say, the present invention can be variously modified within the scopeof the invention.
For example, as the multiple nozzle, a triple nozzle may be adoptedexcept for the double nozzle, and various vibration types can beutilized for producing the multi-layer droplets. Of course, in place ofthe multiple nozzle, a single nozzle for blowing out only the dropletsof a single layer may be adopted.
Furthermore, the various ingredients of the inner layer and the outerlayer of the multi-layer droplets of the seamless capsule may bedesirably adopted.
Further, as the constructions of the hardening liquid supply tube, anyconstruction other than those shown in the above embodiments may beadopted.
The followings are brief explanations of the effects attained by thetypical ones out of the inventions disclosed in the present application.
(1) The hardening liquid in the hardening vessel produces the helicalflow and the droplets are accompanied by the helical flow, whereby thedroplets are fallen along the helical locus in the hardening vessel.
Accordingly, the length of the flow course of the droplets becomes verylong and the time of contact between the droplets and the hardeningliquid is satisfactorily lengthened, so that the satisfactory seamlesscapsules can be obtained without the disadvantages of the deformation ofthe droplets, mutual adhesion between the droplets and agglomeration andthe breakage of the droplets.
(2) Despite that the length of the flow course of the droplets becomesvery long due to the falling helical locus, small dimensions of thedevices such as the hardening vessel suffice and the construction issimplified.
(3) The droplet conveying means and the hardening liquid supply meansare orientated in the direction tangent to the hardening vessel, so thatthe forming of the spinning helical flow can be formed satisfactorily.
(4) The hardening liquid supply means is rotatably provided in thehardening vessel, so that the spinning helical flow for solidifying canbe reliably formed.
(5) The present invention can be widely applied to the cases in which atleast the outermost portions of the droplets are brought into contactwith the hardening liquid to thereby manufacture the seamless capsules.Particularly, when the outermost portions of the droplets are solidifiedwith cooling liquid, such a particularly high effect that the apparatuscan be made small-sized and so forth can be obtained.
What is claimed is:
1. A method of manufacturing seamless capsules,wherein, in manufacturing the seamless capsules by bringing at least theoutermost portions of droplets into contact with a hardening liquid tosolidify the droplets, said droplets are fallen moving helically in atleast a part of the hardening liquid.
2. The method of manufacturingseamless capsules as set forth in claim 1, wherein said hardening liquidfor conveying said droplets is supplied in a direction tangent to acircular section of a hardening vessel.
3. The method of manufacturingseamless capsules as set forth in claim 1, wherein said hardening liquidfor conveying said droplets is blown out in a hardening vessel while ahardening liquid supply tube is rotated.
4. The method of manufacturingseamless capsules as set forth in claim 1, wherein solidifying of saiddroplets is carried out by cooling solidifying with said hardeningliquid.
5. An apparatus for manufacturing seamless capsules, wherein atleast outermost portions of droplets are brought into contact with ahardening liquid to be solidified to thereby manufacture the seamlesscapsules, characterized in that said apparatus comprises: a nozzle forblowing out said droplets in air; a hardening vessel, at least a part ofwhich is formed into a straightly erected cylindrical shape; and adroplet conveying means orientated in a direction tangent to saidhardening vessel, for conveying said droplets blown out of said nozzle,being accompanied by said hardening liquid; and is constructed such thatsaid hardening liquid is supplied in the direction tangent to saidhardening vessel so that said droplets can be fallen in a helical mannerin said hardening vessel.
6. The apparatus for manufacturing seamlesscapsules as set forth in claim 5, wherein said droplet conveying meansis formed of a hardening liquid flow course orientated in a directiontangent to an upper portion of said hardening vessel such that saiddroplets blown out into the air from said nozzle is supplied in thedirection tangent to said hardening vessel thereinto together with theflow of said hardening liquid.
7. The apparatus for manufacturingseamless capsules as set forth in claim 5, further comprising coolingmeans for cooling said hardening liquid to a predetermined temperatureso that solidifying of said droplets is carried out by coolingsolidifying with said hardening liquid.
8. An apparatus formanufacturing seamless capsules, wherein at least outermost portions ofdroplets are brought into contact with a hardening liquid to besolidified to thereby manufacture the seamless capsules, characterizedin that said apparatus comprises: a hardening vessel, at least a part ofwhich is formed into a straightly erected cylindrical shape; a hardeningliquid supply means, a supply port of which is orientated in a directiontangent to said hardening vessel, for supplying said hardening liquid inthe direction tangent to said hardening vessel; and a nozzle for blowingout said droplets into said hardening liquid in said hardening liquidsupply means or said hardening vessel; and is constructed such that saiddroplets blown out of said nozzle into said hardening liquid are fallenin a helical manner in said hardening vessel.
9. The apparatus formanufacturing seamless capsules as set forth in claim 8, wherein saidnozzle is inserted into said hardening liquid supply means.
10. Theapparatus for manufacturing seamless capsules as set forth in claim 8,wherein said nozzle is provided as a member formed separately of saidhardening liquid supply means in said hardening vessel.
11. Theapparatus for manufacturing seamless capsules as set forth in claim 8,further comprising cooling means for cooling said hardening liquid to apredetermined temperature so that solidifying of said droplets iscarried out by cooling solidifying with said hardening liquid.
12. Anapparatus for manufacturing seamless capsules, wherein at leastoutermost portions of droplets are brought into contact with a hardeningliquid to be solidified to thereby manufacture the seamless capsules,characterized in that said apparatus comprises: a hardening vessel, atleast a part of which is formed into a straightly erected cylindricalshape; a hardening liquid supply means rotatably provided in saidhardening vessel; a rotatably driving means for rotating said hardeningliquid supply means; and a nozzle for blowing out said droplets intosaid hardening liquid in said hardening liquid supply means or saidhardening vessel.
13. The apparatus for manufacturing seamless capsulesas set forth in claim 12, wherein said hardening liquid supply means isconstituted by a fixed upper portion connected thereto with a piping forsupplying said hardening liquid and a lower portion rotatably by saidrotatably driving means independently of said upper portion, and adischarging end portion of said lower portion is bent outwardly.
14. Theapparatus for manufacturing seamless capsules as set forth in claim 12,wherein said nozzle is inserted into said hardening liquid supply means.15. The apparatus for manufacturing seamless capsules as set forth inclaim 12, wherein said nozzle is provided on a non-coaxial manner as amember formed separately of said hardening liquid supply means. | 2024-03-22 | 1992-04-15 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1993-06-29"
} |
US-74685596-A | Short turn around time mask ROM process
ABSTRACT
A mask ROM stores information by selecting the work function of the gates of each FET in an array of FETs at a late stage in the manufacture of the ROM. The polysilicon gates of some of the FETs are doped N-type and the gates of the other FETs are doped P-type to form gates having different work functions, thereby forming FETs having different threshold voltages. The ROM consists of a parallel array of buried N + bit lines formed in the substrate, a gate oxide layer deposited over the bit lines and a layer of polysilicon deposited on the gate oxide. The polysilicon is blanket doped N-type, gate electrodes are defined by photolithography, and then self-aligned silicide layers are formed on the gate electrodes. An insulating layer is then formed over the gate electrodes. Programming of the ROM is accomplished by forming a mask on the insulating layer and then implanting ions through openings in the mask, through the insulating layer and the silicide layer, and into the polysilicon layer. The implantation converts individual gate electrodes from N-type to P-type to alter the threshold voltage of the selected transistors. Relatively few additional processing steps are needed after the programming to complete the ROM.
This application claims priority from provisional application Ser. No.60/013,934, filed Mar. 22, 1996.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to the storage of information by alteringthe operational characteristics of a transistor within an array ofmemory transistors and, more particularly, to a non-volatile memory suchas a read only memory (ROM).
2. Description of the Related Art
Conventional read only memories (ROMs) consist of an array of fieldeffect transistors, with each memory cell including a single fieldeffect device. Each of the field effect transistors can be formed so asto have one of two predetermined values of a particular characteristicof the transistor. The selectable transistor characteristic might, forexample, be the threshold voltage of the transistor. Implantingimpurities into the channel region of the transistor might cause thetransistor to have a low threshold voltage so that the transistor isturned on by application of V_(CC) to the gate of the transistor.Transistors formed without implanting impurities into the channel mighthave a high threshold voltage and the transistor is not turned on byapplication of V_(CC) to the gate of the transistor. Alternately,transistors formed without implanting impurities into the channel regionmay have a low threshold voltage, and transistors having implantedchannel regions may have high threshold voltages. Binary data can thenbe stored in the memory by selectively implanting impurities into thechannels of the transistors, with transistors having impuritiesimplanted into the channel region storing a logical zero and transistorshaving no impurities implanted into the channel region storing a logicalone. Of course, the opposite assignment of logical values is also known.
There is a constant need to provide non-volatile memories which can berapidly programmed to provide quick turn around time memories for avariety of applications. ROMs programmed by implanting impurities intothe channel of memory transistors are programmed early in themanufacturing process and must undergo a number of further processingsteps before the ROM is ready to be shipped. Such ROMs have undesirablylong turn around times. Non-volatile memories such as flash memories canbe programmed after all processing is done on the device and so haveshort turn around times. Flash memories, however, are unacceptablyexpensive in comparison to mask ROMs. It is thus desirable to provide aninexpensive non-volatile memory having a shorter turn around time.
Recent memory designs are near the limits of semiconductor processingtechnology in that further reductions in the size of devices in memorieswill require significant improvements in processing technology. Forexample, programming ROMs by the selective implantation of impuritiesinto the channels of transistors relies on a careful mask alignment todefine the implantation mask. For 0.5 μm design rules, such as areimplemented in some current memory designs, alignment of theimplantation mask is a time consuming and error prone process whichincreases the cost of the ROM and undesirably reduces yield. Devicedesign considerations also limit the extent to which the informationstorage density of conventional ROMs can be increased. For example,conventional ROMs contact the source and drain regions of a row oftransistors using buried N⁺ lines. For reduced design rules in whichthese lines are made smaller, the resistance of these buried N⁺ linesinevitably increases because it is not possible to adopt higher dopinglevels without increasing dopant diffusion into the channel regions andinto adjacent device regions. As the resistance of the buried N⁺ linesincreases, the RC time constant of the lines increases and increases thetime required to read information out of the ROM.
Accordingly, it is desirable to provide an inexpensive non-volatilememory compatible with reduced dimension design rules that is readilymanufacturable and which provides improved memory storage density.
SUMMARY OF THE PREFERRED EMBODIMENTS
An aspect of the present invention provides a method of programming amask ROM comprising forming an encoding mask on an insulating layerformed over a structure consisting of memory transistors each having agate, wherein the encoding mask provides a plurality of openingscorresponding to possible memory locations within the mask ROM.Programming is accomplished by implanting impurities through theopenings in the encoding mask and through the insulating layer into thegates of the memory transistors and then removing the encoding mask.
A more specific aspect of this invention includes steps of blanketdoping a layer of polysilicon with a first dopant of a firstconductivity type, wherein the step of programming locally alters thepolysilicon to a second conductivity type by adding to the polysiliconlayer second dopants of the second conductivity type.
Another aspect of the present invention provides a method of programminga mask ROM by providing a substrate covered with a gate oxide and anarray of memory transistors each having a gate electrode formed on thegate oxide, each of the gate electrodes having a layer of polysiliconadjacent the substrate and a layer of conductive material formed overthe layer of polysilicon. Impurities are implanted into select ones ofthe gate electrodes into the layer of polysilicon through the layer ofconductive material.
BRIEF DESCRIPTION OF THE DRAWINGS
FIGS. 1-8 are partial cross-sectional views of a mask ROM in accordancewith the present invention at different stages in the manufacture of themask ROM.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
An aspect of the present invention provides a mask ROM in whichinformation is encoded by selectively programming the level of thethreshold voltage of each transistor in an array of transistors to oneof two or more predetermined levels at a late stage in the manufacturingprocess. In particularly preferred embodiments of the present invention,ROM programming is performed after the deposition of an insulation layerover completed transistors and wiring lines. Programming the ROM at thislate stage in the manufacturing process provides a much improved turnaround time for preferred embodiments of the present invention ascompared to conventional ROM programming strategies.
Preferred embodiments of the present invention program memorytransistors by selectively implanting ions into the gate electrodes ofthe transistors, selecting the work function of the gate electrodes andthereby setting the threshold voltage of the transistors. As describedbelow, particularly preferred embodiments of the present inventionprovide gate electrodes of either P-type polysilicon or N-typepolysilicon to form memory transistors having either relatively high orlow threshold voltages. This programming may be simply accomplished. Forexample, polysilicon gate material may be blanket implanted with oneconductivity type dopant when the memory transistors are formed.Processing continues to complete the transistors and wiring lines. Alayer of metal or metal silicide is provided over all of the gateelectrodes. An insulating layer is formed over the device and the ROMcan be stored until ready for programming. When the ROM is to beprogrammed, a mask is formed over the insulating layer having openingsprovided in accordance with the desired programming. Dopants of thesecond conductivity type are implanted through openings in the mask andthe insulating layer, through the metal or metal silicide layer and intothe polysilicon gate electrode to locally dope regions of the gateelectrodes to the second conductivity type. The metal or metal silicidelayers overlying the gate electrodes ensure conduction along the gateelectrodes despite the formation of P/N junctions along the gateelectrode lines.
A ROM encoded by selective doping of a polysilicon gate electrode isbriefly described with reference to FIG. 8, which shows a ROM inaccordance with the present invention at a late stage of processing. TheFIG. 8 ROM is formed on a P-type substrate 10 having an array of buriedN⁺ bit lines 24 formed within the cell region of the ROM and N-wellregions 20 formed as required in the peripheral circuitry sections ofthe ROM. Field oxide regions 22 or other isolation structures are formedto define the cell region of the ROM and as necessary to provideisolation between the devices within the peripheral circuitry of theROM. Gate oxide 26 covers the channel regions of the memory transistorsand the buried N⁺ bit lines 24. N-type polysilicon lines 70 are formedon the gate oxide 26 as gate electrodes for some of the memorytransistors and P-type polysilicon lines 72 are formed as gateelectrodes for the other memory transistors. The threshold voltage ofthe memory transistors having N-type polysilicon gates 70 may beapproximately 0.9-1.0 V, and the threshold voltage of the memorytransistors having P-type polysilicon gates 72 may be approximately 1.9V. A threshold voltage difference of approximately one volt may bereadily obtained using conventional doping levels for forming P-type orN-type polysilicon. The difference in programming states can be detectedeither by sensing the impedance of the memory transistor or by sensingwhich transistors turn on upon the application of a reference voltage ofan appropriate level to the gates of the memory transistors. The lattermethod is facilitated when the FIG. 8 ROM is formed using design rulesof less than one half micron, in which operating voltages are desirablychosen to be low, and might be approximately 1.5 V.
P/N junctions 74 are formed at the interface between the N-type andP-type portions of the polysilicon gate electrode lines, which makes thegate electrodes non-conductive. Accordingly, a layer of conductivematerial 40 which makes ohmic contact to both N-type and P-typepolysilicon overlies the N-type polysilicon gate electrodes 70 and theP-type polysilicon gate electrodes 72. The layered structure of N-typeand P-type polysilicon and conductive material 40 allows the gateelectrodes of the memory transistors to be used as word lines in themanner typical for ROMs. Peripheral circuitry typically includes bothNMOS transistors 32 and PMOS transistors 36 which may be coupled to forminverters and buffer circuitry.
ROMs in accordance with preferred aspects of the present invention canbe manufactured and programmed late in the manufacturing cycle in amanner that is inexpensive and sufficiently reproducible to allow wellcontrolled definition of the different threshold voltage states. Auniformly thin gate oxide 26 is formed over the array of buried N⁺ bitlines 24 and then a polysilicon layer 28 is deposited over the gateoxide. The polysilicon layer is uniformly doped to one conductivity type(e.g., N-type) and the polysilicon layer is etched to define the gateelectrodes which conventionally serve as word lines for the ROM. Then, alayer of a metal or a silicide of a metal is formed over the polysiliconlines, preferably using a self-aligned silicide process. An insulatinglayer is formed over the ROM, preferably enclosing the integratedcircuit in such a way that it can be left in atmosphere withoutdegrading the integrated circuit. No programming of the ROM has beenperformed at this late stage in the manufacturing process. When the ROMis to be programmed, an encoding mask is formed over the insulatinglayer of the ROM and ions are implanted through the openings in themask, through the insulating layer and the metal or metal silicidelayer, and into the polysilicon gate electrode to locally dope portionsof the gate electrode. In this way, preferred embodiments convert theconductivity type of gate electrodes of selected transistors from N-typeto P-type, increasing the threshold voltage of the selected transistorsto store, for example, a logical one. Little further processing isnecessary to complete the ROM so that aspects of the present inventionprovide quick turn around time ROMs. Encoding ROMs in this mannerprovides more forgiving tolerances than conventional programmingmethods, including channel implantation techniques. Moreover, becausefewer dopants are provided to the substrate, there is less diffusion andfewer of the many problems associated with the unwanted diffusion ofimpurities within the substrate.
A method for producing a mask ROM in accordance with the presentinvention will now be described with reference to FIGS. 1-8. Referringfirst to FIG. 1, a P-type substrate 10 is prepared by forming an N-wellregion 20 and field oxidations 22 for the PMOS and NMOS peripheralcircuitry of the ROM. A parallel array of buried N⁺ regions 24 is formedwhich serve both as bit lines for the ROM and as source and drainregions for the FETs of the ROM. Next, a thin gate oxide layer 26 isformed over the entire device by thermal oxidation process in an oxygen(O₂) ambient at a temperature of about 900° C., forming a gate oxidelayer 26 approximately 135 Å thick. Preferably, this thin oxide layer isalso formed over the channel regions of the transistors in peripheralcircuitry sections (shown on the right of FIG. 8). A layer ofpolysilicon 28 is deposited over the gate oxide layer 26 to a thicknessof, for example, 1000-4000 Å and more preferably about 3000 Å. The layerof polysilicon may be deposited by, for example, low pressure chemicalvapor deposition from silane source gas at a temperature of about 620°C., as is well known in the art.
Preferably, the selective definition of N-type and P-type polysilicongate electrodes is made late in the manufacturing process using a singlemask. This may be accomplished by first uniformly doping the entirepolysilicon layer, using diffusion or blanket ion implantation, to afirst conductivity type. Processing continues to nearly complete the ROMdevice, preferably including patterning to define gate electrodes,forming salicide (self-aligned silicide) structures on the gateelectrodes, and depositing an insulating layer over the device. Then, ata late stage of the manufacturing process, a mask is formed withopenings above the regions of the polysilicon where material of oneconductivity type is to be converted to material of the oppositeconductivity type. Dopants of the opposite conductivity type are thenselectively implanted into the polysilicon to convert select polysilicongate electrodes to the opposite conductivity type. Preferably, thisimplantation is made through the insulating layer and through the layerof conductive material covering the gate electrodes. Referring again toFIG. 1, the polysilicon layer 28 may be subjected to a blanketimplantation of arsenic (As) to a dosage of about 4×10¹⁵ atoms/cm² withan energy of about 80 KeV. The polysilicon layer 28 is thus doped to auniform N-type level. The amount of impurity implanted is preferablysufficient to produce a transistor having a threshold voltage valuesufficiently different from the other threshold voltage values that canbe programmed to allow the programmed data to be written and read withreliability.
After the blanket implantation, a layer of photoresist is deposited overthe polysilicon layer 28 and photolithographic patterning and etchingare performed to define the N-type polysilicon gate electrodes for theROM. Preferably, this photolithography step is also used to define thegate electrodes for the peripheral circuits, as shown in FIG. 2.Referring now to FIG. 3, LDD (lightly doped drain) source and drainregions for the peripheral circuits are preferably formed byconventional ion implantation techniques. The peripheral circuitryincludes buffers and sense amplifiers incorporating both NMOS devices 32and PMOS devices 36. N-type LDD source/drain regions 30 are formed forthe NMOS devices 32 and P-type LDD source/drain regions 34 arepreferably formed for the PMOS devices 36.
Because portions of the polysilicon gate electrodes 28 will be dopedN-type and others will be doped P-type, P/N junctions will be formedalong the gate electrodes in preferred embodiments of the presentdevice. As such, it is preferred to provide an additional conductivelayer overlying the gate electrodes to provide a continuous conductionpath along the entire length of the gate electrodes. Preferably, theadditional conductive layer is formed of a material that readily formsohmic contacts to either N-type or P-type polysilicon. Appropriatematerials include refractory metals, other metals and metals suicides.Self-aligned silicides formed from materials such as titanium, cobalt,nickel, platinum and palladium are particularly preferred. For example,a layer of titanium silicide may be formed by first sputtering a layerof titanium over the surface of the device, including over the gateelectrodes to a thickness of, for example, 500 Å. This titanium layer isconverted into titanium silicide at the surface of the polysilicon gateelectrodes 28 and at the exposed portions of the substrate, includingthe source/drain regions 30, 34, in a two step process. In the firstprocess step, the device is subjected to a rapid thermal anneal (RTA) byheating the device to a temperature of up to about 700° C. for tenseconds, converting the titanium layer into titanium silicide (nominallyTiSi₂) where the titanium layer is in contact with a silicon(crystalline or polycrystalline) surface. The device is then etchedusing a wet etch consisting of H₂ O₂ and NH₄ OH diluted in water,removing unreacted titanium from the surface of the device, exposing theoxide regions of the device. Layers of titanium silicide 40 (FIG. 4, inexaggerated proportion) are left over the polysilicon gate electrodes 28and titanium silicide regions 42 are formed over the source/drainregions 30, 34. Such titanium silicide regions 42 provide lower sheetresistance over the source/drain regions and provide better contacts tothe source/drain regions 30, 34. Titanium silicide contacts on thesource/drain regions are thus preferred so long as the amount of siliconconsumed in the silicidation process does not result in excessivejunction leakage at the source/drain regions.
After the unreacted titanium is etched from the device, furtherprocessing is necessary to provide suitable self-aligned silicide(salicide) structures for the gate electrodes and wiring lines of thedevice. The process steps described to this point form a relatively highresistivity phase of titanium silicide on the silicon surfaces, so thatthe illustrated salicide structure does not have as low of resistivityas is desirable. It is accordingly necessary to expose the device to asecond rapid thermal anneal at a temperature in excess of 800° C. for atleast ten seconds to convert the titanium silicide on the surface of thesalicide to the lower resistivity phase of titanium silicide.
A salicide layer 40 of between about 200-800 Å is typically formed overthe polysilicon gate electrodes 28. Next, referring to FIG. 5, aninsulating layer 50 of boron-phosphorus TEOS (BPTEOS) or ozone TEOS(TEOS-O₃) is formed over the ROM at a substrate temperature of about700° C. to a depth of approximately 4500 Å. Most preferably, theinsulating layer 50 provides a planarized surface over the ROM. At thisstage, the ROM has not been specialized or programmed in any way and theROM has been enclosed in a way that allows further processing to bepostponed. Programming preferably occurs by ion implantation through theinsulating layer 50, through the salicide structure 40, and into thepolysilicon layer 28. A photoresist mask 60 is formed over theinsulating layer 50 having openings 62 aligned over the gate electrodesof the memory transistors that are to be programmed to a differentthreshold value than the default value corresponding to an N-typepolysilicon gate electrode to which the unprogrammed transistors havebeen set. Most preferably, programming consists of a boron ions 64implanted at a high energy of about 280 KeV to a dosage of approximately6×10¹⁵ ions/cm². The photoresist mask 60 is then removed and the heavyboron implantation is annealed at a temperature of about 900° C. in anitrogen (N₂) ambient. This annealing step also causes the insulatinglayer 50 to reflow.
As is shown in FIG. 7, the polysilicon layer includes local regions ofN-type doped polysilicon 70 and local regions of P-type dopedpolysilicon 72. P/N junctions 74 are formed between the adjacent P-typeand N-type regions in the polysilicon layer so that little or noconduction proceeds along the polysilicon layer of the polysilicon gateelectrodes. Thus, the layer of salicide 40, or another layer ofconductive material, is most preferred for the ROM to be used in theconventional manner with the gate electrodes operating as the word linesof the ROM.
Contact vias 76 are opened to the source/drain regions and other contactpoints within the peripheral circuits of the ROM. As shown in FIG. 8,metal contacts 80 formed from for example, aluminum, are formed in theconventional manner and other conventional processing continues tocomplete the ROM. These relatively few processing steps afterprogramming can be completed quickly, allowing a rapid turn around timefor preferred embodiments of the invention.
Although the present invention has been described in terms of certainpreferred embodiments, the description of particular embodiments is notintended to limit the scope of the present invention. Rather, the scopeof the present invention is represented by the following claims.
What is claimed is:
1. A method of programming a mask ROM,comprising:providing an unprogrammed ROM structure, comprisingasubstrate, a gate oxide layer disposed over the substrate, a continuouspolysilicon layer that is doped to a first conductivity-type anddisposed over the gate oxide layer, a continuous layer of conductivematerial disposed directly on the polysilicon layer, and an insulatinglayer covering the layer of conductive material; forming a mask layerover the insulating layer, wherein the mask layer includes openingsexposing portions of the insulating layer; and implanting impuritiesinto the polysilicon layer through the openings in the mask layer, andthrough the underlying insulating layer and layer of conductivematerial, such that portions of the polysilicon layer disposed below theopenings in the mask layer are doped to a second conductivity-type. 2.The method of claim 1, wherein the impurities comprise boron.
3. Themethod of claim 1, wherein the conductive material forms an ohmiccontact with both P-type polysilicon and N-type polysilicon.
4. Themethod of claim 3, wherein the conductive material comprises a metal ora metal silicide.
5. The method of claim 1, wherein the unprogrammed ROMstructure includes an array of memory transistors, wherein at least someof adjacent ones of the memory transistors physically abut each other.6. The method of claim 5, wherein the insulating layer covers all of thememory transistors of the array.
7. The method of claim 5, whereinprogramming the mask ROM includes simultaneously programming all of thememory transistors of the array disposed under openings in the encodingmask.
8. The method of claim 1, wherein each said gate of the memorytransistors is programmed to one of only two threshold levels.
9. Themethod of claim 1, wherein the portions of the polysilicon layer thatare doped to the second conductivity-type by the selective implanting,and contiguous portions of the polysilicon layer that remain doped tothe first conductivity-type, have p-n junctions formed therebetween. 10.The method of claim 1, further comprising storing the unprogrammed ROMstructure before the implanting, until programming of the mask ROM isrequired.
11. The method of claim 1, wherein contiguous portions of thecontinuous polysilicon layer form gate electrodes after selectivelyimplanting impurities is performed.
12. A method of programming a maskROM, comprising:providing an unprogrammed ROM structure, comprisingasubstrate, a gate oxide layer disposed over the substrate, a continuouspolysilicon layer that is doped to a first conductivity-type anddisposed over the gate oxide layer, and a continuous layer of conductivematerial disposed directly on the polysilicon layer; and selectivelyimplanting impurities into portions of the polysilicon layer through thelayer of conductive material, such that the portions of the polysiliconlayer subjected to the selective implanting are doped to a secondconductivity-type.
13. The method of claim 12, wherein the layer ofconductive material is a metal silicide.
14. The method of claim 12,wherein the unprogrammed ROM structure includes a layer of oxidecovering the layer of conductive material, and the implanting takesplace through the layer of oxide.
15. The method of claim 12, whereinthe impurities comprise boron.
16. The method of claim 15, wherein theimpurities are implanted at an energy of greater than 200 KeV.
17. Themethod of claim 12, wherein the unprogrammed ROM structure includes anarray of memory transistors, wherein at least some of adjacent ones ofthe memory transistors of the array physically abut each other.
18. Themethod of claim 12, wherein contiguous portions of the continuouspolysilicon layer form gate electrodes after selectively implantingimpurities is performed.
19. The method of claim 18, wherein selectivelyimplanting impurities into portions of the polysilicon layer includessimultaneously implanting impurities into all portions of thepolysilicon layer that are selected to be gate electrodes of a firsttype.
20. The method of claim 18, wherein selectively implantingimpurities into portions of the polysilicon layer programs the resultinggate electrodes to one of only two threshold levels. | 2024-03-22 | 1996-11-18 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "2000-04-25"
} |
US-23659288-A | Spray caps
ABSTRACT
The disclosed spray cap comprises a manual trigger connected by a living hinge to a hollow main body; a joint-free member of plastic comprises a pump-chamber bellows and a discharge tube in the main body, and a projecting dip tube; a nozzle is threaded on the discharge tube; an outlet check valve body and resilient supporting arms in the nozzle form integral portions of the nozzle; and the discharge tube has a sealing flange engaging an internal cylindrical surface of the nozzle.
The present invention relates to what are commonly called "spray caps".A spray cap is attached to a container of liquid to dispense bursts whena manual actuator or "trigger" is operated.
Spray caps have long been known that meet some or all of a range ofrequirements. In one respect, a spray cap is to provide a spraydischarge in one adjustment of its nozzle and to be positively shut offin another nozzle adjustment. As an additional alternative, the nozzleof some spray caps is adjustable to provide "stream" or "jet" bursts ofdischarge in addition to the shut-off and "spray" choices.
Nozzles of spray cans that are adjustable to varied settings may beleaky; and a variety of relatively complicated forms of constructionhave been proposed aimed at preventing such leakage.
Still further, it has long been known that air should be admitted to theliquid supply container to replace the volume of liquid that isdischarged progressively, to avoid developing a vacuum in the container,such as would impair or disable the spray cap; and it has been proposedthat the vent passage that avoids the vacuum should be shut when thespray cap is not in use (as during shipment) to avoid leakage of liquidby way of said vent passage.
Spray caps meeting these requirements have been available but they tendto be complicated, and their cost in parts and the expense of assemblytend to be high.
The present invention provides a spray cap that is distinctively novelin several respects. The new construction is vastly simpler, uses fewerparts and is easier to assemble than available spray caps capable ofmeeting all of the foregoing requirements.
In one respect, a novel nozzle-and-check valve structure is providedthat is essentially one part that cooperates with the outlet end of adischarge tube, providing shut-off, spray and jet modes of operation. Inanother respect, a leak-preventing mount for the adjustable nozzle of aspray cap is provided, without resort to the complications of 0-ringsthat are usually found in such spray caps.
Still further, a spray cap is provided in which the entireliquid-containing portion that supplies the discharge nozzle is a singlepart. A dip tube and a bellows which constitutes a pump chamber, and adischarge tube are all combined into a continuous-wall unitary devicethat replaces many parts heretofore found in any single spray capmeeting the same combined requirements.
The nature of the invention and its novel aspects will be bestunderstood and appreciated by reviewing the following detaileddescription of a novel spray cap that is shown in the accompanyingdrawings.
In the drawings:
FIG. 1 is a perspective of a novel spray cap as an illustrativeembodiment of the invention in its various aspects;
FIG. 2 is an exploded perspective showing the components of the spraycap in FIG. 1, in their as-made conditions;
FIG. 3 is an enlarged cross-section of the spray cap of FIG. 1, thenozzle being tightened to provide a positive shutoff at that region andwith the trigger in its extended at-rest or released position;
FIG. 4 is a cross-section like FIG. 3 with the nozzle set fordischarging liquid and the trigger stroke being complete;
FIG. 5 is a greatly enlarged perspective view of the nozzle of the spraycap in FIG. 1, and FIG. 6 is perspective view, partly in cross-section,of the nozzle in its as-molded condition; and
FIG. 7 is a right-hand end view of the nozzle of FIGS. 5 and 6 with itshinged cover removed.
The illustrative spray cap in FIG. 1 includes a threaded closure 10 fora bottle or other container of liquid to be dispensed and a dip tube 12extending downward from closure 10. A main body 14 is mounted rotatablyon closure 10, for example by means of a circular rib 16 (FIG. 4)extending radially inward at the lower edge of main body 10. This rib isreceived in circular groove 18 around closure 10. The spray cap furtherincludes a finger-operated trigger or lever 20 hinged to body 14, and anozzle 22 on body 14. Trigger 20 and main body 14 in this spray cap aremolded of a suitable plastic as a single unit connected by a thinnedportion or living hinge 24 of the molded unit. A leaf spring 26 (FIG. 1;see also FIGS. 2-4) is an integral portion of the molded plastictrigger, thus being a portion of the molded unit.
Further details of the spray cap are shown in FIGS. 3 and 4. Dip tube 12has a sliding and rotary fit in a tubular portion 28 of closure 10; aventing passage 28a is formed by a groove extending from end-to-end ofportion 28 along its inner surface.
Component 30 is a single part that may be produced in an injectionblow-molding machine. Unit 30 comprises dip tube 12, bellows 32 anddischarge tube 34 extending in a straight line as shown in FIG. 2.Component 30 may be molded of various materials, provided that bellows32 is resilient (not merely yielding). For example, component 30 may bemade of selected grades of polyethylene, polypropylene, or polyvinylchloride. Dip tube 12, bellows 32 and discharge tube 34 (with its heador discharge end portion, detailed below) constitute the entire liquidcontainer of the spray cap except for nozzle 22; it constitutes acontinuous-wall passage for the liquid.
The lower end of the bellows 32 is a projecting conical wall 36 that hasa complementary fit in concave conical seat 38 at the upper end oftubular portion 28 of the closure 10. The juncture of dip tube 12 andconical wall 38 has formations for loosely retaining ball 40a. The upperend of dip tube 12 internally provides a circular valve seat for ball40a. That valve seat and ball 40a constitute the inlet check valve.
In FIGS. 2-4, the discharge end of discharge tube 34 includes anintegral resilient thinned sealing flange 42 and a male thread 44. Theouter diameter of flange 42 in the form shown is at least as large asthe outer diameter of male threads 44. Main body 14 has a transversewall 46 in which there is a slot that opens downward; and discharge tube34 is received transversely in that slot, so that the formation thatprovides flange 42 is disposed against the surface of wall 46. Nozzle 22is screwed onto the male thread 44 of component 30. Nozzle 22 has aninternal cylindrical surface 22a against which flange 42 forms a seal.Main body 14 also includes two wall portions 14a and 14b which (FIGS. 3and 4) coact with discharge tube 34 for securely locating that tube,holding the formation of flange 42 securely against wall 46. These wallsalso establish the position of the upper end of bellows 32. In itsextended condition represented in FIG. 3, bellows 32 is slightlycompressed so that its conical end portion 36 is biased against valveseat 38.
Nozzle 22 is best shown in FIGS. 5-7. Internal or female threads 48 ofthe nozzle cooperate with male threads 44 of component 30. Valve body 50is an integral portion of nozzle 22. Valve body 50 is supported by threearms 52 that extend homogeneously from both body 50 and the side wall ofnozzle 22. The opposite ends of each arm 52 are displaced arcuately fromeach other. The arms accommodate bodily movement of member 50 along thenozzle's axis. Nozzle 22 includes a front wall 56 that is connected tothe body of the nozzle by an integral hinge 58. Front wall 56 has anannular edge formation that interlocks in a leak-proof manner with acomplementary annular formation in the body of the nozzle when its frontor end wall is snapped into place, the completed state of the nozzlebeing represented in FIG. 5. The nozzle is of molded plastic. Theadvantage of hinging wall 56 to the rest of the nozzle is that the hingeprovides automatic alignment of the front wall with the space that is toreceive it. The front wall can be molded as a separate part ifpreferred. Nozzle 22 including its integral portions 50, 52 and 56 maybe made of suitably resilient grades of polyethylene, polyvinylchlorideor polypropylene, for example.
When nozzle 22 is threaded onto the head or discharge end of dischargetube 34 to the extent represented in FIG. 4 (there being a smallclearance between nozzle 22 and wall 46) valve member 50 bears againstthe very end of tube 34. That end of tube 34 is shaped as a valve seatfor valve member 50. Member 50 and its cooperating valve seat constitutea discharge check valve.
Arms 52 normally hold the valve closed in the adjustment of nozzle 22 asrepresented in FIG. 4. When liquid is forced into delivery tube 34 (seebelow) the liquid pressure lifts valve member 50 away from its valveseat and shifts member 50 toward the inner surface of end wall 56.
It may be considered that nozzle 22 is adjusted so that there is only asmall clearance between end wall 56 of the nozzle and the surface ofvalve body 50 facing that end wall. Arms 52 press body 50 against itsvalve seat. Operation of trigger 20 develops pressure that lifts body 50against wall 56. Liquid passes the circumferal edge of check valve body50 and travels radially inward along slots 59 in body 50, and leaves thenozzle by way of a small orifice 60 through front wall 56. In thiscondition of the nozzle, a fine atomized spray results. This effect canbe varied, as by shaping the grooves to swirl the liquid that enters thenozzle's orifice.
Nozzle 22 can be adjusted so that outlet check-valve body 50 bearsagainst its valve seat at rest--as shown in FIG. 4--but with end wall 56spaced away from body 50 far enough so that, when trigger 20 is operatedand liquid pressure lifts body 50 away from its valve seat, a clearancespace still remains between body 50 and end wall 56. In that adjustmentthe liquid that crosses the circumferential edge of body 50 flows acrossthe entire common area of body 50 and wall 56; and as a result, a jet orstream of liquid leaves the orifice.
Nozzle 22 can be screwed onto threads 44 far enough so that end wall 56of the nozzle drives valve member 50 firmly against its seat (FIG. 3),providing a positive shut-off. This guards against leakage via thenozzle without depending on resilient bias to hold the outlet checkvalve closed, as when the spray cap is mounted on a container filledwith liquid, and the container with the spray cap in place is to beshipped.
It was mentioned above that trigger 20 is connected to the main body 14of the spray cap by a living hinge 44. FIG. 2 shows the condition ofmain body 14 and trigger 20 as that composite unit leaves a moldingpress. Trigger 20 projects to one side of main body 14. Integralleaf-spring portion 26 in FIG. 2 is flanked by two trigger arms 62 whichhave in-turned spaced-apart buttons 62a. The longitudinal edges of theleaf spring are separated slightly from arms 63, allowing the leafspring to become deflected in operation. Main body 14 contains a stop 64that is directed downward, extending from an upper mounting portionwhich is integral with opposite walls of main body 14. Stop member 64 iswidest where it extends integrally from the opposite walls of main body14. Much of the downward-extending part of stop member 64 is narrower,providing clearance spaces between the walls of main body 14 and theopposite long edges of that part of the stop. Arms 62 of the trigger arereceived in those clearance spaces.
The at-rest operative condition of main body 14 and trigger 20 isrepresented in FIG. 3. Trigger 20 extends downward at a slight slantaway from the rest of the spray cap. Integral leaf spring 26 of thetrigger engages fixed stop 64 in the main body. The ends of spring 26and stop 64, as shown in FIG. 2, have advantageously interlockingtongue-and-notch formations as assurance that their alignment andcooperation will be maintained. Arms 62 of the trigger (FIG. 3) aredisposed at opposite sides of depending stop 64. Buttons 62a of thetrigger are received under lifting shoulders 66 (FIG. 2) formed near thebottom of bellows 32 at the opposite sides of the bellows. Arms 62 ofthe trigger 20 sweep along opposite side edges of leaf spring 26 andalong opposite side edges of stop 64 when the trigger is squeezed,ending in the position represented in FIG. 4.
The parts shown in FIG. 2 are quickly and easily assembled to form thespray cap of FIG. 1. First ball 40a is pressed into its detentedposition at the juncture of bellows 32 and dip tube 12. Then unit 30 isinserted into main body 14 in its position represented in FIG. 3,deflecting discharge tube 34 as necessary. Trigger 20 is swung intoplace so that buttons 62a are received in groove formations 66 at thebottom of the bellows. Finally, the closure 10 is forced into assemblywith main body 14, tubular portion 28 of the closure sliding along thedip tube in this step of assembly.
The operation of the spray cap briefly restated. With nozzle 22 in itsadjustment represented in FIG. 3, the nozzle is sealed against leakage.Its end wall 56 forces body 50 against the seat of the outlet ordischarge check valve at the end of discharge tube 34. Vent passage 28ais sealed by the cooperation of complementary conical parts 36 and 38 ofthe bellows 32 and the closure 10.
When nozzle 22 is unscrewed somewhat to provide a small clearancebetween end wall 56 of the nozzle and the movable body 50 of the outletcheck valve, body 50 at first remains biased against the outlet valveseat formed by the very end of the outlet tube 34. Squeezing trigger 20from the position in FIG. 3 to that in FIG. 4 develops pressure thatcloses valve 40 and shifts member 50 against end wall 56 of the nozzle.Liquid is forced across the circumferal edge of body 50 and alongchannels 59, becoming a fine spray as the discharge leaves orifice 60.
Yet a further adjustment of nozzle 22 holds body 50 of the outlet checkvalve against its valve seat while trigger 20 remains extended, but alarger clearance space is established between body 50 and end wall 56such that, with ordinary squeeze effort applied to the trigger, body 50does not reach end wall 56. The liquid fills the clearance space betweenbody 50 and wall 56 and leaves orifice 60 as a stream.
Each operation of the trigger produces a discharge burst, whether as aspray or as a stream. The extent that body 50 is lifted toward end wall56 is adjusted by screwing the nozzle in or out; but the described modesof operation are realized by suitable design of arms 52 and choice ofthe material used in molding the nozzle.
After each discharge operation, trigger 20 is released and, due to thebias of its integral leaf spring 26, it returns to its startingposition. Bellows 32 is operated by its resilience to return to itsextended position (FIG. 3). The outlet check valve became closed whenthe internal pressure dropped. Therefore the negative pressure thatdevelops in bellows 32, as it starts to become extended, opens the inletcheck valve 40 and draws liquid up the dip tube to replace thedischarged liquid.
The composite dip tube 12, pump-chamber bellows 32 and discharge tube 34constitute a joint-free unit of plastic. That unit, with nozzle 22 andits check-valve body 50, represent virtually all of the spray-capmaterial that is exposed to the liquid to be dispensed. Ideally, ball40a is of an inert material such as stainless steel. Accordingly, all ofthe material that is exposed to the contained liquid is--or can be--madeimmune to attack by or interaction with common liquids to be dispensed.
The spray cap described above is naturally amenable to modification andvaried application by those skilled in the art. Consequently, theinvention should be construed in accordance with its true spirit andscope.
What is claimed is:
1. A manually operable spray cap including a mainbody having a closure for mounting the spray cap on a supply containerof liquid to be dispensed, a nozzle having a discharge orifice, meansforming a liquid passage from the supply container to the nozzle,including a bellows, a dip tube extending through the closure, and adischarge tube extending to the nozzle, said bellows having a movableend portion carrying the dip tube and a stationary end portion fromwhich the discharge tube extends, said movable end portion and saidstationary end portion constituting passage-constricting transitionsbetween the bellows and the respective tubes, said bellows includingsaid transitions and said discharge-passage tube and at least a portionof the dip tube extending from said movable end portion constituting acontinuous-wall one-piece component formed of resilient plastic, saidbellows having a corrugated lengthwise-compressible self-extending sidewall, intake and discharge check valves for limiting the liquid to flowtoward the nozzle, and a trigger carried by said main body for operatingsaid movable end portion of the bellows and the dip tube therewith inbellows-compressing strokes.
2. A spray cap as in claim 1, wherein thedischarge end portion of said discharge tube comprises a peripherallycircular sealing flange and said nozzle has an internal cylindricalsurface in sealing engagement with said sealing flange.
3. A spray capas in claim 1, wherein said discharge end portion of said discharge tubeand said nozzle have cooperating threads.
4. A spray cap as in claim 3,wherein said cooperating threads are between said flange and saidorifice.
5. A spray cap as in claim 1, wherein said nozzle has an endwall providing said orifice and wherein the discharge end of saiddischarge tube is opposite to said end wall and forms a valve seat ofsaid discharge check valve, and wherein said discharge check valve has avalve body movably supported between the nozzle's end wall and thedischarge check-valve's valve seat and normally biased to rest againstthe discharge check valve's valve seat but being movable toward thenozzle's end wall by liquid pressure for producing discharge bursts inresponse to operation of the manual trigger.
6. A spray cap as in claim5, wherein said nozzle is adjustable for driving its end wall againstthe discharge check-valve's valve body while the latter is against itsvalve seat for thereby sealing the discharge tube.
7. A spray cap as inclaim 1 wherein the movable end portion of said one-piece componentcomprises a vent-valve body and said closure comprises a vent-valve seatthat coacts with said vent-valve body to provide a vent passage to thecontainer when the bellows is compressed and to seal the vent passagewhen the bellows is extended.
8. A spray cap including a nozzle havingan end wall in which there is a discharge orifice and having a sidewall, a discharge tube having an open end spaced from but opposite tosaid end wall, a manually operable pump for delivering successivecharges of liquid under pressure to said discharge tube, said open endof the discharge tube constituting the valve seat of a discharge checkvalve, a valve body disposed opposite to and normally spaced from saidend wall of the nozzle, resilient arms movably and resilientlysupporting said valve body against said valve seat, said valve body andsaid arms and at least the side wall of said nozzle being a one-piecemolded plastic part for enabling the valve body to shift away from itsvalve seat and open the end of the discharge tube when liquid pressureis developed in the discharge passage, thereby to produce dischargebursts in response to operations of said pump.
9. A spray cap as inclaim 8, wherein the nozzle's side wall has an internal cylindricalsurface and said discharge tube has a flange integral therewith forforming a seal to said cylindrical surface, for thereby preventingleakage when the liquid pressure is developed inside the nozzle.
10. Aspray cap as in claim 8, wherein said discharge tube has a male threadspaced from said valve seat and said side wall has a female threadcooperating with said male thread for adjustably positioning the nozzleso that said end wall is selectively spaced from said valve body forproviding discharge bursts or forced against said valve body, thereby tohold said discharge check valve closed.
11. A spray cap as in claim 8,wherein the nozzle's side wall has an internal cylindrical surface andsaid discharge tube has a flange integral therewith for forming a sealto said cylindrical surface, for thereby preventing leakage when liquidpressure is developed inside the nozzle, and wherein said discharge tubehas a male thread spaced from said valve seat and said side wall has afemale thread cooperating with said male thread for adjustablypositioning the nozzle so that said end wall is selectively spaced fromsaid valve body thereby to allow discharge bursts or thereby pressingsaid end wall against said valve body and thus holding said dischargecheck valve closed.
12. A spray cap as in claim 11, wherein the outerdiameter of said flange is at least as large as the outer diameter ofsaid male thread and said flange is spaced further than said male threadfrom the open end of the discharge tube.
13. A spray cap as in claim 8,wherein said discharge tube and said nozzle have cooperating adjustmentthreads and wherein said valve body is biased by said supportingelements against said valve seat in an adjustment of the nozzle on thedischarge tube, the resilience of said resilient arms allowing saidvalve body to be shifted away from said check-valve seat by saiddischarge bursts.
14. A spray cap as in claim 13 wherein, in anotheradjustment of the nozzle, the nozzle's end wall drives said valve bodyagainst its seat to constitute a positive closure.
15. A spray cap as inclaim 13, said end wall and said valve body having mutually opposedsurfaces, at least one of said surfaces having swirling formationstherein, adjustment of the nozzle on the conduit enabling those surfacesto be separated variably to vary the character of the discharges fromthe orifice.
16. A spray cap as in claim 8, wherein said side wall ofthe nozzle in its as-molded condition has an end opening that exposessaid valve body and said arms, and wherein said end wall is joined tosaid side wall across said opening.
17. A manually operable spray cap,including a generally hollow main body having a closure for mounting thespray cap on a supply container of liquid to be dispensed, a nozzlehaving a discharge orifice, and means for conveying liquid from thecontainer through the closure to the nozzle, and intake and dischargecheck valves limiting the flow of liquid toward the nozzle, said liquidconveying means including a component formed as a single piece ofplastic comprising a bellows portion having a corrugatedlengthwise-compressible resiliently self-extending side wall, first andsecond opposite-end portions of said component having openings thereinwhose cross-section is small compared to that of the bellows, and saidliquid conveying means having tubular supply and discharge passageportions extending from said first and second end portions,respectively, said second end portion and said discharge passage portionbeing fixed in said main body, and a trigger carried by said main body,said first end portion of the bellows and said supply tubular portionforming a movable unit that is operable by said trigger for compressingsaid bellows portion.
18. A spray cap as in claim 17 wherein saidtubular discharge portion has a sealing enlargement and said nozzle isrotatable about said sealing enlargement and has a sealing surface thatmaintains sealing engagement with said enlargement despite rotation ofthe nozzle.
19. A spray cap as in claim 17 wherein said closure has aformation constituting a vent-valve seat and said movable unit operableby the trigger has a formation constituting a vent-valve body havingsealing cooperation with said vent-valve seat when the bellows portionis extended and which allows venting of the supply container when thetrigger is operated in a bellows-compressing stroke.
20. A manuallyoperable spray cap, including a generally hollow main body having aclosure for mounting the spray cap on a supply container of liquid to bedispensed, a trigger, an orifice, a liquid-container for conveyingliquid from the supply container to the orifice, said liquid containerbeing largely enclosed in said hollow main body, said liquid containerincluding an inlet check valve disposed within a free end of a liquidpassageway of the liquid container and an outlet valve for limiting theflow of liquid toward the orifice and including a bellows shaped pumpchamber operable by the trigger from a starting position of the triggerand the pump chamber wherein the pump chamber is extended for drivingliquid to the orifice upon compression of the pump chamber, andresilient means for extending the pump chamber, said trigger and saidmain body being portions of a single molded member that includes aflexible hinge interconnecting the main body and the trigger, saidmolded member further including a leaf-spring formation integral withthe trigger for biasing the trigger to its starting position. | 2024-03-22 | 1988-08-25 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1990-02-06"
} |
US-33391494-A | Method and apparatus for segmentation and reassembly of ATM packets using only dynamic ram as local memory for the reassembly process
ABSTRACT
An Asynchronous Transfer Mode (ATM) network adapter having a receiver portion, the receiver portion capable of receiving a first plurality of ATM cells and assembling the first plurality of ATM cells into a first plurality of packets, and a transmitter portion, the transmitter receiving a second plurality of packets and segmenting the second plurality of packets into a second plurality of ATM cells, the receiving portion having a local memory for segmentation, while the transmitter portion having no local memory.
FILED OF THE INVENTION
This invention relates generally to the field of computer networks, andmore particularly to a method and apparatus for segmentation andreassembly of Asynchronous Transfer Mode (ATM) packets using onlydynamic random access memory (DRAM) as local memory for the reassemblyof packets.
BACKGROUND OF THE INVENTION
In general terms, a computer network is a collection of end systems(also known as nodes) interconnected through one or more communicationlinks. Generally, the end systems both send data to other end systems onthe network and receive data sent by other end systems on the network.When an end system is a sender of data, it is referred to as a sourcefor that data; when it is a receiver of data, it is referred to as adestination for the data. Typically, end systems act as both sources anddestinations depending on whether they are sending or receiving data.When acting as a source, the system typically sends data in the form ofmessages over a communication link. Messages can flow back and forth toother communication links and end systems within the network throughbridges or routers, which are used to interconnect multiplecommunication links.
Each message comprises a sequence of bits. Typically, messages sent overa network are divided up into smaller blocks of information calledpackets. The flow of packets in the network is usually referred to astraffic. An important design objective in networks is controllingtraffic so that individual packets will not be transmitted at a fasterrate than they can be processed by the communication links, orintermediate systems such as bridges or routers, through which thepackets will pass, or by the destinations.
Asynchronous Transfer Mode (ATM) is one of the general class of digitalswitching technologies that relay and route traffic by means of avirtual circuit identifier (VCI) contained within the cell. Unlikecommon packet technologies, such as X.25 or frame relay, ATM uses veryshort, fixed length units of information, called cells. In applicationsutilizing ATM, packets at a source are first broken up into these fixedlength packets (ATM cells), transmitted, and then reassembled at adestination. ATM cells are 53 bytes long. They consist of a 5-byteheader (containing an identifier of data flow which implicitlyidentifies the source address and the destination address) and a 48-byteinformation field. The header of an ATM cell contains all theinformation the network needs to relay the cell from one node to thenext over a pre-established route. User data is contained in theremaining 48 bytes.
ATM uses a concept of virtual networking (or channels) to pass trafficbetween two locations, establishing virtual connections between a pairof ATM end-systems which are needed to connect a source with adestination. These connections are termed "virtual" to distinguish themfrom dedicated circuits. ATM cells always traverse the same path fromsource to destination. However, ATM does not have to reserve the pathfor one user exclusively. Any time a given user is not occupying a link,another user is free to use it.
ATM connections exist only as sets of routing tables held in eachnetwork node, switch, or other intermediate system, based on the virtualcircuit identifier (VCI) and virtual path identifier (VPI) contained inthe cell header. When a virtual path is established, each node (orswitch) is provided with a set of lookup tables that identify anincoming cell by header address, route it through the node to the properoutput port, and overwrite the incoming VCI/VPI with a new one that thenext node along the route will recognize as an entry in its routingtable.
The cell is thus passed from switch to switch over a prescribed route,but the route is "virtual" since the facility carrying the cell isdedicated to it only while the cell traverses it. Two cells that areultimately headed for different destinations may be carried, one afterthe other, over the same physical wire for a common portion of theirjourney.
With current implementations of ATM, adapters use local memory in avariety of ways. A first implementation uses two local memories in theATM adapter. One ATM adapter local memory is used for ATM cellreassembly, while another ATM adapter local memory is used to segmentpackets in ATM cells. With such an arrangement, an extra ATM adapterlocal memory is necessary for segmentation.
In another current ATM implementation, one local memory in an ATMadapter is used for both ATM cell reassembly and packet segmentation. Insuch an implementation, the operations of segmentation and reassemblyare done concurrently in the one local memory. The available bandwidthfrom the local memory is the maximum number of bytes (or bits) one canread or write from or to at a unit of time. This bandwidth is a functionof the local memory speed and its data width. With such an arrangement,as an example, in order to support a serial line input/output rate of155.52 Mbps, a bandwidth of 155.52 times 4 is needed. The 4 Mbps comesfrom the fact that when a packet is reassembled it is written first,cell after cell, then read at 155.52 times 2 when reassembly iscomplete. In addition, when a packet is segmented it is first writteninto the local memory and then read, cell by cell, each time fortransmission on the serial line (i.e., 155.52 Mbps times 2). Thus, thebandwidth requirements from the local memory is bigger when the localmemory is used for both segmentation and reassembly. the segmentation isaccomplished by first preforming a direct memory access (DMA) of thewhole packet into the ATM adapter local memory and then starting tosegment the packet by sending an ATM cell one at a time.
In still another ATM implementation, a local memory of an ATM adapterwill only be used to store a number of control variables. In such animplementation, segmentation and reassembly are accomplished in a hostmemory. With such an implementation, bursts of 48-bytes are not optimalto use the maximum available system bus bandwidth because (1) the longerthe DMA transfer bursts are, the higher bandwidth from the system bus isobtained (this is also true for the local memory since DRAM also usesbursts, and the longer the bursts are, the more bandwidth one can getout of the local memory); and (2) "48" is not a binary number; sincemost cache lines are in length of 2 to the X power, if a write operationfinishes in the middle of a CPU cache line, the next burst will resultin one additional update because writing in the middle of the CPU cacheline causes the CPU to update the CPU cache line again in its mainmemory.
A method of handling the reassembly process in one ATM adapter localmemory is needed where segmentation may be done by utilizing arelatively small buffer on a chip.
SUMMARY OF THE INVENTION
In accordance with the present invention, an Asynchronous Transfer Mode(ATM) network adapter having a receiver portion, the receiver portioncapable of receiving a first plurality of ATM cells and assembling thefirst plurality of ATM cells into a first plurality of packets, and atransmitter portion, the transmitted portion having a means forprocessing a second plurality of transmit host memory packets andsegmenting the second plurality of packets into a second plurality ofATM cells. Furthermore, the receiver portion contains a local memorywhile the transmitter portion contains no such local memory. With suchan arrangement, one local memory is used for the reassembly processwhile segmentation is accomplished by a relatively small buffer on achip.
BRIEF DESCRIPTION OF THE DRAWINGS
The novel features believed characteristic of the invention are setforth in the appended claims. The invention itself, however, as well asfeatures and advantages thereof, will be best understood by reference tothe detailed description of specific embodiments which follows, whenread in conjunction with the accompanying drawings, wherein:
FIG. 1 is a block diagram showing an exemplary Asynchronous TransferMode (ATM) local area network (LAN);
FIG. 2 is a block diagram showing an exemplary ATM cell;
FIG. 3 is a block diagram showing an exemplary ATM cell which includes acredit field;
FIG. 4 is a block diagram of an exemplary network station on a computernetwork, including an exemplary ATM adapter; and
FIG. 5 is block diagram of an ATM adapter in accordance with the presentinvention.
DETAILED DESCRIPTION
Referring to FIG. 1, an exemplary Asynchronous Transfer Mode (ATM) localarea network (LAN) 10 is shown to include four stations labeled as 12,14, 16, and 18, respectively. The ATM network 10 is also shown toinclude two ATM switches labeled as 20 and 22, respectively. An ATMadapter resides in each of the stations 12, 14, 16, and 18. By way ofexample, if station 12 is transmitting packets for station 16, the ATMadapter in station 12 is involved in segmenting the packets into cells,and affixing the appropriate fields in a cell header (of FIG. 2 and FIG.3). The ATM adapter in station 16 is involved in reassembling the cellsreceived into a complete packet and delivering the packet to station 16.Control of the ATM network 10 resides in the ATM switches 20 and 22,which route messages between stations. For example, the station 12 maysend a cell over a line 24 to ATM switch 20 through port 26. ATM switch20 will route the cell to a destination, Station 16, for example,according to a VCI/VPI in an ATM cell header.
Because each port 26 is dedicated to one station 12, other stations (14for example) do not have to contend for access to the ATM switch 20.Thus, the station 12 has full access to the line 24 regardless of theactivity of other stations with other such connections. For example, ifa 5 Mb file is being transmitted from station 12 to station 16, it canmove to the ATM switch 20 in a continuous burst at the full channelrate, instead of sharing the communication link with the other stationsand having intervening frames from other stations as with other LANs,such as Ethernet, Token Ring, and Fiber Distributed Data Interface(FDDI) LANs.
Each message in the ATM network 10 is comprised of one or more fixedlength units of data called ATM cells. Referring to FIG. 2, an ATM cell30 is shown to be 53 bytes long. The ATM cell 30 is typically dividedinto a 5-byte header 32 and a 48-byte information field 34. The 5-byteheader 32 contains several fields 36. Specifically, a first bytecontains a generic flow control (GFC) field 38 and part of a virtualpath identifier (VPI) field 40. A second byte contains another part ofthe VPI field 42 and part of a virtual channel identifier (VCI) field44. A third byte contains another part of the VCI field 46. A fourthbyte contains the remaining part of the VCI field 48, a payload typeidentifier (PTI) field 50, and a cell loss priority field (CLP) 52. Afifth byte contains a header error check 54.
The address of the ATM cell 30 is contained in the fields labeled VPI(40 and 42) and VCI (44, 46, and 48). This two-part identificationallows the ATM network 10 (of FIG. 1) to route data contained in theinformation field 34 between locations while maintaining the identity ofindividual circuits within a trunk.
Referring to FIG. 3, an alternative header 62 of an ATM cell 60 isshown. The header 62 is 5 bytes long and contains several fields 64.Specifically, a first byte contains a GFC field 66 and a part of creditvirtual circuit identifier (credit VCI) 68. A second byte containsanother part of the credit VCI 70. A third byte contains part of adestination VCI 72. A fourth byte contains a remaining part of thedestination VCI 74, a PTI field 76, and a CLP field 78. A fifth bytecontains a header error check field 80.
Referring to FIG. 4, a diagram of a network station 100 is shown coupledto a network 102 via a communications link 103. The network station 100shown in FIG. 4 is an exemplary embodiment of any one of network station12, network station 14, network station 16, or network station 18, asshown in FIG. 1. The network station 100 includes a network adapter 104coupled to a system bus 106, a central processing unit (CPU) 108 coupledto the system bus 106, and a host memory 110 coupled to the system bus106. For purposes of example, the network adapter 104 is an ATM networkadapter, and the network 102 is an ATM network.
By way of example, ATM cells received by network station 100 via thecommunications link 103 are reassembled into packets in ATM adapter 104and sent via the system bus 106 in the host memory 106. On the otherhand, packets which are transmitted from the network station 100 aresent from host memory 110 via the system bus 106 to ATM adapter 104.While in ATM adapter 104, packets are segmented into ATM cells and sentout to ATM network 102 via the communications link 103.
Referring to FIG. 5, the ATM adapter 104 of FIG. 4 is shown to include asystem bus interface unit 120 for communication with the system bus 106(of FIG. 4) and a PHY interface 122 for communication with a PHY chip124. In addition, the exemplary ATM adapter 104 is shown to contain ascheduler 121, a transmit DMA prefetch 126, a transmit packet memory128, a transmit FSM (transmit state machine) 130, a store machine 132, apacket assembly machine 134, and a local memory 136. In FIG. 5, forconvenience, thin lines represent control lines, while thick linesrepresent data flow lines.
The exemplary ATM adapter 104 operates in the following manner whenreceiving ATM cells. Incoming ATM cells are received by the PHY chip 124via the PHY interface 122 and into the packet assembly machine 134. Thepacket assembly machine 134 assembles the ATM cells into a packet in thelocal memory 136 attached to it. Once the assembly of the packet fromreceived ATM cells is complete, the packet assembly machine 134 signalspacket assembly completion to the store machine 132. The store machinethen reads the assembled packet from the local memory 136 and sends into the host memory 110 (of FIG. 4) via the system bus 106 by way of thesystem bus interface unit 120.
The exemplary ATM adapter 104 operates in the following manner whentransmitting packets. A packet is received from the system bus 106 viathe system bus interface unit 120. A scheduler 121 decides which packetdata will be DMA into the ATM adapter 104. The scheduler 121 also pacesthe transmissions on a set of different virtual circuits. The transmitDMA prefetch 126 reads chunks of the packet data from the system businterface unit 120 and stores them in the transmit packet memory 128.The transmit FSM 130 contracts fifty-three byte ATM cells out of thedata chunks in the transmit packet memory 128, thus accomplishing asegmentation process. The transmit FSM 130 then sends the fifty-threebyte ATM cells through the PHY interface 122 to the PHY chip 124. Thetransmit FSM 130 will start its operation as soon as it detects enoughbytes in the transmit packet memory 128 to construct at least onefifty-three byte ATM cell.
Having described a preferred embodiment of the invention, it will nowbecome apparent to those skilled in the art that other embodimentsincorporating its concepts may be provided. It is felt therefore, thatthis invention should not be limited to the disclosed invention, butshould be limited only by the spirit and scope of the appended claims.
What is claimed is:
1. An Asynchronous Transfer Mode (ATM) adapter forreceiving a plurality of ATM cells from a physical interface unitcomprising:a packet assembly machine connected to the physical interfaceunit, the packet assembly machine assembling the plurality of ATM cellsinto a first packet in only a dynamic random access local memory; astore machine; means, in the packet assembly machine, for signaling thestore machine that the first packet is assembled; means, in the storemachine, for reading the first packet from the dynamic random accesslocal memory and sending the first packet to a host memory via a systembus interface unit.
2. An Asynchronous Transfer Mode (ATM) networkadapter comprising:a receiver portion, the receiver portion capable ofreceiving a first plurality of ATM cells and assembling the firstplurality of ATM cells into a first plurality of packets the receiverportion including:a physical interface unit, the physical interface unitcapable of receiving the first plurality of ATM cells; a packet assemblymachine connected to the physical interface unit, the packet assemblymachine assembling the first plurality of ATM cells into a first packetonly in a dynamic random access local memory; a store machine; means, inthe packet assembly machine, for signaling the store machine that thefirst packet is assembled; means, in the store machine, for reading thefirst packet from the dynamic random access local memory and sending thefirst packet to a host memory via a system bus interface unit; and atransmitter portion, the transmitted portion having a means forreceiving a second plurality of packets and segmenting the secondplurality of packets into a second plurality of ATM cells.
3. TheAsynchronous Transfer Mode (ATM) network adapter according to claim 2wherein the transmitter portion further comprises:a system bus; a systembus interface unit, the system bus receiving the second plurality ofpackets from the system bus; a transmit DMA prefetch, the transmit DMAprefetch having means for reading the second plurality of packets; atransmit packet memory connected to the transmit DMA fetch, the transmitpacket memory having storing means to store a chunk of the secondplurality of packets; a transmit FSM connected to the transmit packetmemory, the transmit FSM having means for segmenting the chunk of thesecond plurality of packets into the second plurality of 53-byte ATMlong cells; and the transmit FSM having means for sending the secondplurality of 53-byte long ATM cells to a PHY chip via a physicalinterface unit.
4. A method of receiving a plurality of ATM cells from aphysical interface unit in an Asynchronous Transfer Mode (ATM) adaptercomprising the steps of:providing a packet assembly machine connected tosaid physical interface unit; assembling said plurality of ATM cellsinto a first packet in only a dynamic random access local memory of thepacket assembly machine; storing said first packet in a store machine;signaling the store machine that the first packet is assembled; readingthe first packet from the dynamic random access local memory; andsending the first packet to a host memory via a system bus interfaceunit. | 2024-03-22 | 1994-11-03 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1997-02-11"
} |
US-46831499-A | Dynamic random access memory
ABSTRACT
A dynamic random access memory includes a dynamic memory cell having a transfer N-channel MOS transistor and a capacitive element for storing data which is connected to the transfer N-channel MOS transistor, a word line connected to a gate of the transfer N-channel transistor, of the dynamic memory cell, and a word line driving voltage source, to which power voltage is input for raising the input power voltage to generate a word line driving voltage. Also, the dynamic random access memory includes an address circuit for generating internal address signals in accordance with externally input address signals, a word line selecting circuit for decoding the internal address signals and outputting a word line selecting signal which varies within a range between the word line driving voltage and a ground potential, and a word line driving circuit for driving a corresponding word line in accordance with the word line selecting signal, the word line driving circuit being provided in correspondence with the word line and having a P-channel MOS transistor which has a source connected to a first node having the word line driving voltage, a drain connected to the word line and a gate to which the word line selecting signal is applied.
The present application is a divisional of application Ser. No.08/907,019 (filed Aug. 6, 1997); which is a continuation of applicationSer. No. 08/612,759 (filed Mar. 8, 1996), now U.S. Pat. No. 5,673,229;which is a continuation application of U.S. application Ser. No.08/340,471 (filed Nov. 14, 1994), now abandoned; which is a continuationof application Ser. No. 08/160,840 (filed Dec. 3, 1993), now abandoned;which is a continuation of application Ser. No. 07/813,492 (filed Dec.26, 1991), now U.S. Pat. No. 5,287,312.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a dynamic random access memory (DRAM)and, more particularly, to stress applying means for applying voltagestress to word line groups more acceleratedly than a normal use at thetime of screening defectiveness in a wafer state.
2. Description of the Related Art
A screening is generally performed to expose latent defects insemiconductor devices and remove from finished batches those deviceshaving defects. This screening process prevents defect-free devices frombeing adversely affected by defective devices and ensures thereliability of the finished semiconductor devices when they are put onthe market. As one screening method, a burn-in capable of acceleratingan electric field and a temperature at the same time is frequentlyemployed. In this burn-in, semiconductor devices are operated using avoltage higher than the actual working voltage and a temperature higherthan the actual working temperature, and voltage stress is applied tothe semiconductor devices for a short period of time longer than theinitial failure period under actual working conditions. Thesemiconductor devices are then screened and those which are consideredlikely to malfunction in initial operation are removed. This type ofscreening is an efficient method of removing defective devices, therebyenhancing the reliability of finished semiconductor devices.
In recent DRAMs, a potential (for example, approximately 1.5×Vcc)boosted when a transfer gate (hereinafter referred to as celltransistor) of a selected memory cell is applied to a gate oxide film ofthe memory cell transistor. Even though the gate oxide film is thick, astrong electric field is applied thereto and thus the reliability of theDRAMs may be lowered. It is thus necessary to actively screen celltransistors having gates to which a boosted potential is applied whenthe burn-in of DRAMs is performed.
To screen the memory cells when the burn-in of the DRAMs is performed, amethod of scanning an address so as to sequentially access word linesconnected to the gates of the cell transistors was conventionally used.In this method, voltage stress is applied to the cell transistors lessfrequently than to transistors of a peripheral circuit and a time periodfor which the greatest electric field is actually applied to the celltransistors is short; accordingly, a long time is needed for the burn-inof DRAMs.
In order to eliminate the above drawback wherein the voltage stress isapplied to the cell transistors less frequently, one of the inventors ofthe present invention proposed a semiconductor memory capable ofimproving in efficiency with which voltage stress is applied to celltransistors, as disclosed in Published Unexamined Japanese PatentApplication (kokai) No. 3-35491 which corresponds to U.S. patent.application Ser. No. 07/544,614. The semiconductor memory is so formedthat voltage stress can be applied to all word lines or word lines morethan those selected in a normal operation mode when a defective celltransistor is screened.
If the above proposal is applied to a DRAM, defective cell transistorscan considerably be reduced and 1M or 4M DRAMs having bit defects can bedecreased at high speed by the screening. Therefore, the screening canbe greatly improved in efficiency.
It is desirable to materialize a means for applying voltage stress toall word lines or word lines more than those selected in the normaloperation mode when a operation power is supplied to the DRAMs.
SUMMARY OF THE INVENTION
The present invention has been made in consideration of the abovesituation and its object is to provide a dynamic random access memory(DRAM) capable of greatly improving the efficiency of a screening whichis performed when operation power is supplied to the DRAM.
To attain the above object, a dynamic random access memory according tothe present invention comprises: a plurality of dynamic memory cellsarranged in rows and columns; a word line connected to the memory cellson the same row; a bit line connected to the memory cells on the samecolumn; a word line selecting circuit having a word line selectingfunction of selecting an arbitrary one of the rows in response to aninternal address signal; a word line driving voltage source; a word linedriving circuit having at least one driving MOS transistor connectedbetween the word line driving voltage source and word line, for drivingthe word line in response to an output signal of the word line selectingcircuit; and a control circuit for, in response to a voltage stress testcontrol signal input from outside, controlling the word line drivingcircuit so that the word line driving circuit drives word lines morethan those selected in a normal operation mode upon receiving anexternal address signal.
According to an aspect of the present invention, when operation power issupplied to the dynamic random access memory to perform a screening,voltage stress can be applied to all word lines or word lines more thanselected in the normal operation mode through the word line drivingcircuit in response to the voltage stress test control signal. It isthus possible to screen cell transistors with high efficiency.
If the cell transistors are N-channel type MOS transistors, a P-channeltype MOS transistor is used as a word line driving transistor connectedbetween the word line driving voltage source and word line, and the gateof the P-channel type MOS transistor is fixed to the ground potential tostabilize the gate node. It is thus possible to stably apply the voltagestress to the word line through the P-channel type MOS transistor.
The control circuit has a relatively simple arrangement, and the DRAMchip need not increase in the area for the control circuit.
Additional objects and advantages of the invention will be set forth inthe description which follows, and in part will be obvious from thedescription, or may be learned by practice of the invention. The objectsand advantages of the invention may be realized and obtained by means ofthe instrumentalities and combinations particularly pointed out in theappended claims.
BRIEF DESCRIPTION OF THE DRAWINGS
The accompanying drawings, which are incorporated in and constitute apart of the specification, illustrate presently preferred embodiments ofthe invention, and together with the general description given above andthe detailed description of the preferred embodiments given below, serveto explain the principles of the invention.
FIG. 1 is a circuit diagram showing part of a DRAM according to a firstembodiment of the present invention;
FIG. 2 is a circuit diagram showing an example of a word line drivingvoltage source in the DRAM shown in FIG. 1;
FIG. 3 is a circuit diagram showing a modification to the DRAM shown inFIG. 1;
FIG. 4 is a circuit diagram showing part of a DRAM according to a secondembodiment of the present invention;
FIG. 5 is a circuit diagram showing part of a DRAM according to a thirdembodiment of the present invention;
FIG. 6 is a circuit diagram showing an example of a switching circuit inthe DRAM shown in FIG. 5;
FIG. 7 is a circuit diagram showing a modification to the DRAM shown inFIG. 5;
FIG. 8 is a circuit diagram showing part of a DRAM according to a fourthembodiment of the present invention; and
FIG. 9 is a circuit diagram showing a modification to the DRAM shown inFIG. 7.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Embodiments of the present invention will be described in detail whentaken in conjunction with the accompanying drawings. The descriptions ofthe elements denoted by the same numerals in the drawings are omitted.
FIG. 1 is a circuit diagram showing part of a DRAM according to a firstembodiment of the present invention. In FIG. 1, reference numeral 31indicates bonding pads for receiving address signals from outside asemiconductor chip; 32 denotes a pad, which is not used in a normaloperation mode, for receiving a voltage stress test control signal fromoutside when a voltage stress test is carried out; 33 shows addressamplifying circuits for receiving the address signals and generatinginternal address signals which are complementary to each other; and 34represents a control circuit having gate circuit groups connected to theoutputs of the address amplifying circuits 33, for outputting theinternal address signals from the address amplifying circuits 33 in thenormal operation mode and controlling the internal address signals so asto select lines more than those selected in the normal operation mode inaccordance with the external address signals when the voltage stresstest is carried out.
The control circuit 34 includes inverter groups 35 and 36 for receivingthe internal address signals from the address amplifying circuits 33,inverter groups 37 for receiving a signal from the pad 32, and two-inputNAND gate groups 38 and 39 for receiving outputs of the inverter groups37 and those of the inverter groups 35 and 36.
In FIG. 1, reference numeral 40 indicates word line selecting circuitsincluding NAND gate groups for outputting word line selecting signals inaccordance with the internal address signals supplied from the controlcircuit 34, and reference numeral 41 denotes a word line drivingcircuit, including at least one driving MOS transistor 43 connectedbetween a word line driving voltage source 42, described later, and aword line WLi (i=1, 2, 3, . . .), for driving the word line WLi inresponse to the signals output from the word line selecting circuits 40.
The word line driving circuit 41 includes an NMOS transistor 44 whoseone end is connected to an output terminal of each of the word lineselecting circuits 40 and whose gate is supplied with power supplypotential Vcc, a word line driving PMOS transistor 43 whose gate isconnected to the other end of the NMOS transistor 44, whose source andsubstrate are connected to each other, and which is connected betweenthe word line driving voltage source 42 and the word line WLi, apull-down NMOS transistor 45 connected between the word line WLi andground potential Vss, and a pull-up PMOS transistor 46 whose gate isconnected to the word line WLi, whose source and substrate are connectedto each other, and which is connected between the word line drivingvoltage source 42 and the gate of the PMOS transistor 43.
In the first embodiment, the word line driving voltage source 42 isformed on a DRAM chip and includes a booster circuit for boosting thepower supply voltage vcc externally supplied and applying the boostedvoltage to the word line driving circuit 41.
FIG. 2 is a circuit diagram showing an example of the booster circuit ofthe word line driving voltage source 42. The booster circuit comprises aclock signal generating circuit 20, an inverter circuit 21, a firstbootstrap capacitor 22 whose one end is supplied with a first clocksignal, a first MOS transistor 23 which is connected between a Vcc nodeand the first bootstrap capacitor 22 and whose gate is supplied with asecond clock signal, a MOS transistor 24 whose drain and gate areconnected to a connection node of the first MOS transistor 23 and thefirst bootstrap capacitor 22 and whose source is connected to a boostedvoltage output node 28, a second bootstrap capacitor 25 whose one end issupplied with a second clock signal, a second MOS transistor 26 which isconnected between the Vcc node and the second bootstrap capacitor 25 andwhose gate is supplied with the first clock signal, and a MOS transistor27 whose drain and gate are connected to the connection node of thesecond MOS transistor 26 and the second bootstrap capacitor 25 and whosesource is connected to the boosted voltage output node 28.
The DRAM as shown in FIG. 1 usually includes a plurality of dynamicmemory cells MC (one of which is shown in FIG. 4) arranged in rows andcolumns. A single word line WL is connected to the memory cells MC onthe same row, and a single bit line BL is connected to the memory cellsMC on the same column. In these memory cells MC, the gate of an NMOStransistor 15 is connected to the word line WL, the drain thereof isconnected to the bit line BL, and the source thereof is connected to oneend of a capacitive element 16 for storing information. The other end ofthe capacitive element 16 is connected to a capacitor plate potentialVPL.
An operation of the DRAM shown in FIG. 1 will be described.
In the normal operation of the DRAM, when an address signal is suppliedto the address amplifying circuits 33 from outside, internal addresssignals, which are complementary to each other, are generated, and wordline selecting signals for an arbitrary number of word lines are outputin accordance with a combination of logic levels of the internal addresssignals, thereby selecting word lines WLi.
In the word line driving circuit 41 to which a word line selectingsignal having an activation level of "L" is input, the NMOS transistor45 is turned off and the NMOS transistor 44 is turned on. The PMOStransistor 43, whose gate is fixed to the ground potential vss, isturned on to set the word line WLi to a high level. The PMOS transistor46 is turned off since its gate (word line) is high in level. In theword line driving circuit 41 to which a word line selecting signalhaving an inactivation level of "H" is input, the NMOS transistor 45 isturned on and the NMOS transistor 44 is turned off. The PMOS transistor46 is turned on since its gate (word line) is low in level, and the PMOStransistor 43 is turned off since its gate is high in level.
When the burn-in of a wafer is performed, operation power is supplied tothe DRAM to allow it to operate, and a voltage stress test controlsignal of high level is input to the pad 32. The control circuit 34 setsall the internal address signals, which are complementary to each other,high in level and sets all the output signals of the word line selectingcircuits 40 low in level. All the word lines WLi are therefore driven.
According to the DRAM shown in FIG. 1, the control circuit 34 controlsthe internal address signals so as to select rows more than thoseselected in response to the external address signals in the normaloperation mode based on the voltage stress test control signalexternally supplied through the pad 32 which is not used in the normaloperation mode. The word line driving circuit 41 thus drives rows morethan those selected in response to the external address signals suppliedin the normal operation mode.
As a result, a direct-current voltage stress can be applied at once toall the word lines WLi or word lines WLi more than those selected in thenormal operation mode through the word line driving circuit 41 in theburn-in, and the efficiency of the burn-in can remarkably be improved.
Since the cell transistors 15 are N-channel type (first conductive type)MOS transistor, P-channel type (second conductive type opposite to thefirst conductive type) MOS transistor 43 is used as a word line drivingtransistor, and the gate and node of the PMOS transistor 43 are fixed tothe ground voltage Vss to stabilize the gate node when the voltagestress test is carried out. A drop in the potential of the word line dueto a current leak of the gate node of the PMOS transistor 43 can beprevented, and a direct-current voltage stress can stably be applied tothe word lines WLi through the PMOS transistor 43. Since the controlcircuit 34 has a relatively simple arrangement, the area of the controlcircuit 34 is small on the DRAM chip.
FIG. 3 is a circuit diagram showing a modification to the DRAM shown inFIG. 1.
The DRAM of FIG. 3 differs from that of FIG. 1 in the use of a word lineselecting circuit 50 of a precharge NAND gate and a word line drivingcircuit 51 of a CMOS inverter.
In the word line selecting circuit (precharge NAND gate) 50, aprecharging PMOS transistor 52 and an NMOS transistor group 53 fordecoding an internal address signal are connected in series between theword line driving voltage source 42 and ground potential vss. Aconnection point of the PMOS transistor 52 and NMOS transistor group 53is an output node 54.
In the word line selecting circuit 50, a precharge signal is renderedlow in active level and the output node 54 is precharged to a highlevel. When all of internal address signals supplied from the controlcircuit 34 are rendered high in level, a signal (word line selectingsignal) from the output node 54 becomes low in level.
The word line driving circuit (CMOS inverter) 51 includes a PMOStransistor 43 and an NMOS transistor 45. The transistor 43 is turned onwhen the level of the word line selecting signal becomes low, and thetransistor 45 is turned on when the level of the word line selectingsignal becomes high.
The DRAM of FIG. 3 is basically able to perform the same operation asthat of FIG. 1 and the same advantage can be obtained from the DRAMSshown in FIGS. 1 and 3.
FIG. 4 is a circuit diagram showing part of a DRAM according to a secondembodiment of the present invention. The DRAM of FIG. 4 differs fromthat of FIG. 1 in the use of a bit line potential control means forconnecting each of the bit lines to a desired fixed potential in thevoltage stress test, a pad 61 for applying a word line driving voltage,and a switching circuit 62. The operations of the pad 61 and switchingcircuit 62 will be described later with reference to FIG. 5.
For example, the bit line potential control means is so constructed thata switching NMOS transistor 47 is connected to one end of each bit lineBL and a bit line voltage application circuit 48 for applying a desiredvoltage is connected to one end of the NMOS transistor 47 to turn on theNMOS transistor 47 when a signal is supplied from the pad 32.
The bit line voltage application circuit 48 includes a precharge voltagegenerating circuit 55 for applying bit line precharge potential VBL(potential between power supply potential Vcc and ground potential Vss,usually represented by Vcc/2) to the bit lines BL in the normaloperation mode. The circuit 48 also includes a switching circuit 56which is so controlled as to switch an output of the precharge voltagegenerating circuit 55 to a desired voltage (e.g., ground potential Vss)in response to the voltage stress test control signal and a controlcircuit (not shown) for controlling the switching circuit 56.
The DRAM of FIG. 4 includes a logic circuit 49 in order to use theswitching transistor 47 as a bit line precharging transistor used in thenormal operation mode. The logic circuit 49 is so constructed that alogical OR is carried out between a signal input from the pad 32 and abit line precharging/equalizing signal EQL and the logical OR is appliedto the gate of the switching transistor 47.
The DRAM of FIG. 4 is basically able to perform the same operation asthat of FIG. 1 and the same advantage can be obtained from the DRAMs ofFIGS. 1 and 4. Since each of bit lines BL can be set to the groundpotential Vss by means of the switching transistor 47, a great voltagestress can be applied between the gate and drain of the cell transistor15 in the voltage stress test.
FIG. 5 is a circuit diagram showing part of a DRAM according to a thirdembodiment of the present invention. The DRAM of FIG. 5 differs fromthat of FIG. 1 in the use of a pad 61 for applying a word line drivingvoltage which is not used in the normal operation mode and a switchingcircuit 62.
FIG. 6 is a circuit diagram showing an example of the switching circuit62 of the DRAM shown in FIG. 5. The switching circuit 62 includes aresistor R connected between the pad 61 and the output node of word linedriving voltage source 42.
In the normal operation mode, the switching circuit selects an outputvoltage of the word line driving voltage source 42 and supplies it as aword line driving voltage. In the voltage stress test, if an outputimpedance of an external voltage source (not shown) connected to the pad61 is considerably lower than that of the word line driving voltagesource 42, the switching circuit 62 selects a desired stress voltageapplied from the external voltage source through the pad 61 and suppliesit as a word line driving voltage. In addition, a boost operation of theword line driving voltage source 42 can be stopped when the voltagestress test is carried out.
The DRAM of FIG. 5 is basically able to perform the same operation asthat of FIG. 1 and the same advantage can be obtained from the DRAMshown in FIG. 1. The DRAM of FIG. 5 has the advantage of transitionallypreventing a voltage drop from occurring when all the word lines WLi aredriven even though the word line driving voltage source 42 has only thecapability of driving the word lines selected in the normal operationmode. It is thus possible to directly apply stress to the word lines WLithrough the word line driving circuit 41.
Even though the switching circuit 62 is eliminated from the DRAM of FIG.5, the pad 61 is connected to the output node of the word line drivingvoltage source 42, and the word line driving voltage is supplied fromthe external voltage source through the pad 61 during the voltage stresstest, the same advantage can be obtained.
FIG. 7 is a circuit diagram showing a modification of the DRAM shown inFIG. 5. The DRAM of FIG. 7 differs from that of FIG. 5 in the use of theword line selecting circuit 50 and word line driving circuit 51. TheDRAM of FIG. 7 is basically able to perform the same operation as thatof FIG. 5 and the same advantage can be obtained from the DRAMs shown inFIGS. 5 and 7.
FIG. 8 is a circuit diagram showing part of a DRAM according to a fourthembodiment of the present invention. In the DRAM of FIG. 8, controlcircuits 70 are arranged on the output side of the word line selectingcircuit 50, in place of the control circuit 34 of FIG. 3.
The control circuits 70 each have a gate circuit connected to the outputof the word line selecting circuit 50. Each of the control circuits 70outputs a word line selecting signal from the word line selectingcircuit 50 in the normal operation mode and controls the word lineselecting signal in the voltage stress test so as to select more rowsthan selected in response to the external address signal in the normaloperation mode.
The control circuit 70 includes an NMOS transistor 71, connected to theoutput of the word line selecting circuit 50, for rendering the wordline selecting signal in a selecting state (low level) in response to astress test control signal of high level from the pad 32.
In the normal operation mode, the NMOS transistor 71 is turned off, andthe control circuit 70 outputs the word line selecting signal. If avoltage stress test control signal of high level is input to the pad 32,the NMOS transistor 71 is turned on, and the word line selecting signalis set to "L" in level.
The DRAM of FIG. 8 is basically able to perform the same operation asthat of FIG. 3, and the same advantage can be obtained from the DRAM ofFIG. 3.
FIG. 9 is a circuit diagram showing a modification of the DRAM shown inFIG. 7. The DRAM of FIG. 9 differs from that of FIG. 7 in that thecontrol circuits 70 are arranged on the output side of the word lineselecting circuit 50. The DRAM of FIG. 9 is basically able to performthe same operation as that of FIG. 7, and the same advantage can beobtained from the DRAM of FIG. 3.
The bit line potential control means (such as the switching NMOStransistor 47 and the bit line voltage application circuit 48) as shownin FIG. 4, can be applied to the DRAMs shown in FIGS. 3, 5, and 7-9.
In the above embodiments, the pad 32 for receiving a voltage stress testcontrol signal and the pad 61 for applying a word line driving voltagecan constitute a bonding pad. However, when a wafer is burned in, thesepads can be so constructed that they are brought into contact with aprobe of a probe card of a tester to apply a voltage. When a packagedchip is burned in, the pads 32 and 61 can be so constructed that theycan be connected with a wiring layer outside the chip when the chip ispackaged.
When the DRAMs of the above embodiments are burned in, at least one ofthe pads 32 and 61 is used for a plurality of chips, and a wiring layerfor connecting the one pad and the chips can be formed on the wafer(e.g., on a dicing line region).
There are following five methods of supplying the voltage stress testcontrol signal.
(a) The signal is input from outside through the pads 32 and 61 when theDRAM is in the form of wafer.
(b) The signal is input from outside through a dedicated terminal, whichis not used in the normal operation mode, after a DRAM chip is packaged.
(c) The signal is generated on the chip, based on an input address keycode, as an option of modes in which the device goes to a test mode if awrite enable (WE) signal and a column address strobe (CAS) signal areactivated in a WE and CAS before RAS (WCBR) mode standardized by theJoint Electron Devices Engineering Council (JEDEC), that is, when theRAS signal is activated.
(d) The signal is supplied by applying a voltage, which is not used inthe normal operation mode, from outside to an arbitrary terminal (whichcan be used in the normal operation mode). For example, when the powersupply potential Vcc is 5V, a voltage of 7V is applied.
(e) The signal is supplied to a plurality of terminals used in thenormal operation mode in the order which is not used in the normaloperation mode.
In the above embodiments, a voltage stress test for the burn-in isperformed. However, the present invention is effective in performing thevoltage stress test irrespective of increase in temperature.
The present invention is not limited to the above embodiments. variouschanges and modifications can be made without departing from the scopeand spirit of the claimed invention.
Additional advantages and modifications will readily occur to thoseskilled in the art. Therefore, the invention in its broader aspects isnot limited to the specific details, and representative devices, shownand described herein. Accordingly, various modifications may be withoutdeparting from the spirit or scope of the general inventive concept asdefined by the appended claims and their equivalents.
What is claimed is:
1. A semiconductor memory device, comprising:dynamicmemory cells arranged in a row and column array, each of said dynamicmemory cells comprising a transfer MOS transistor of a firstconductivity type and a capacitive element coupled to said transfer MOStransistor for storing data; word lines each connecting the dynamicmemory cells in one row of said array; bit lines each connecting thedynamic memory cells in one column of said array; pads to whichreceiving external address signals are applied; address amplifyingcircuits responsive to the external address signals applied to the padsfor generating first internal address signals selecting a first numberof said word lines in a normal operation mode; a control circuitresponsive to a voltage stress test control signal for generating secondinternal address signals for selecting a second number of said wordlines in a voltage stress test operation mode, the second number beinggreater than the first number; word line selecting circuits responsiveto the first and second internal address signals for outputting wordline selecting signals; a word line driving voltage source; and wordline driving circuits each coupled between corresponding ones of saidword lines and said word line selecting circuits and responsive to theword line selecting signals for driving selected word lines, each ofsaid word line driving circuits including:a first MOS transistor of thefirst conductivity type having a first current terminal coupled to thecorresponding one of said word line selecting circuits, and a controlterminal coupled to a power supply potential; a second MOS transistor ofa second conductivity type opposite the first conductivity type having afirst current terminal coupled to said word line driving voltage source,a second current terminal coupled to the corresponding one of said wordlines, and a control terminal coupled to a second current terminal ofsaid first transistor; a third MOS transistor of the first conductivitytype having a first current terminal coupled to the corresponding onesof said word lines, a second current terminal coupled to a groundpotential, and a control terminal coupled to the corresponding one ofsaid word line selecting circuits; and a fourth MOS transistor of thesecond conductivity type having a first current terminal coupled to saidword line driving voltage source, a second current terminal coupled tosaid control terminal of said second transistor, and a control terminalcoupled to the corresponding one of said word lines.
2. Thesemiconductor memory device according to claim 1, wherein said word linedriving voltage source comprises:a word line driving voltage sourceoutput terminal for outputting the word line driving voltage; a clocksignal generating circuit having first and second outputs; an inverterhaving a first terminal coupled to the first output of said clock signalgenerating circuit, and a second terminal; a first capacitor having afirst terminal coupled to said second terminal of said inverter, and asecond terminal; a second capacitor having a first terminal coupled tothe second output of said clock signal generating circuit, and a secondterminal; a fifth MOS transistor having a first current terminal coupledto said second terminal of said first capacitor, a second currentterminal coupled to receive the power supply voltage, and a controlterminal coupled to said second output of said clock signal generatingcircuit; a sixth MOS transistor having a first current terminal coupledto said second terminal of said first capacitor, a second currentterminal coupled to receive the power supply voltage, and a controlterminal coupled to said second terminal of said inverter; a seventh MOStransistor having a first current terminal coupled to a connection nodebetween said second terminal of said first capacitor and said firstcurrent terminal of said fifth MOS transistor, a second current terminalcoupled to said word line driving voltage source output terminal, and acontrol terminal coupled to said connection node between said secondterminal of said first capacitor and said first current terminal of saidfifth MOS transistor; and an eighth MOS transistor having a firstcurrent terminal coupled to a connection node between said secondterminal of said second capacitor and said first current terminal ofsaid sixth MOS transistor, a second current terminal coupled to saidword line driving voltage source output terminal, and a control terminalcoupled to said connection node between said second terminal of saidfirst capacitor and said first current terminal of said sixth MOStransistor.
3. The semiconductor memory device according to claim 1,further comprising:a bit line voltage application circuit, said bit linevoltage application circuit including a bit line voltage applicationcircuit output terminal, a voltage generating circuit for generating afirst voltage, a terminal coupled to the ground voltage, and a switchfor selectively coupling said bit line voltage application circuitoutput terminal to one of the first voltage and the ground voltage;switching transistors each having a first current terminal coupled to acorresponding one of said bit lines, a second current terminal coupledto said bit line voltage application circuit output terminal, and acontrol terminal coupled to receive a switching signal for selectivelycoupling said bit lines to said bit line voltage application circuitoutput terminal.
4. The semiconductor memory device according to claim1, further comprising:a pad for receiving an externally supplied wordline driving voltage during the voltage stress test mode; a switchingcircuit having a first input terminal coupled to said word line drivingvoltage source, a second input terminal coupled to said pad, and anoutput terminal coupled to said first current terminal of said secondMOS transistor, said switching circuit supplying a voltage output bysaid word line driving voltage source during the normal operation modeand supplying a voltage received at said pad during the voltage stresstest mode. | 2024-03-22 | 1999-12-21 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "2000-12-26"
} |
US-62282796-A | Method for producing semiconductor device
ABSTRACT
In producing a semiconductor device using silicon semiconductor, thermal processing is performed in an atmosphere containing hydrogen. At this time, active hydrogen is generated by contacting the hydrogen to a heated nickel material. For example, a pipe which an inner surface thereof is covered with the nickel material is heated by a heater and a hydrogen gas is introduced into the pipe, in order to generate the active hydrogen, so that a semiconductor device formed on a resin substrate having a low heat resistance is annealed using the active hydrogen while maintaining at 150° C. ±20° C. for a desired period of time.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a technique for improving reliabilityof a semiconductor device.
2. Description of the Related Art
In a process for producing a MOS (metal oxide semiconductor) typesemiconductor device, a technique for improving reliability of asemiconductor device to be produced by thermal processing in anatmosphere containing hydrogen has been known. In particular, in asemiconductor device using amorphous silicon and polycrystal silicon,its effect is large. This is because there is a cause in a crystal statesuch as amorphous or polycrystal. That is, in the crystal state, sincedangling bonds are present at a high density, these form a trap leveland thus there is a large effect with respect to termination due tohydrogen.
On the other hand, a semiconductor device using a thin filmsemiconductor, in particular, a thin film transistor (TFT) using apolycrystal silicon thin film has been concerned. An application fieldof the TFT using the polycrystal silicon thin film is mainly an activematrix type liquid crystal display device.
In a process for producing the TFT using the polycrystalline siliconthin film in order to improve characteristic and reliability of the TFT,thermal processing in an atmosphere containing hydrogen is performed ina final process. This technique is disclosed in Japanese PatentApplication Open No. 4-355924. According to this technique, it isdescribed that thermal processing at 250° C. to 350° C. in an atmospherecontaining hydrogen is effective in order to decrease a level in aninterface between a gate insulating film and a channel forming region ina MOS type TFT. In particular, it is shown in FIG. 5 that hydrogenthermal processing at 300° C. to 350° C. is most effective.
In an active matrix type liquid crystal display device, since an areathereof is large, it is effective to use a material containing aluminumor mainly aluminum as a wiring in order to suppress influence due to aresistance of the wiring. However, the aluminum has no high heatresistance. If a semiconductor device in which a wiring is formed usingthe aluminum is left in an atmosphere of 300° C. or higher, the aluminumis diffused into an insulating film and a semiconductor, and thusreliability of the device is reduced remarkably.
To solve this problem, after forming the wiring, processing in anatmosphere of preferably 200° C. or lower may be performed withoutexposing the wiring in an atmosphere of 300° C. or higher. However, asdescribed above, it is effective to perform thermal processing at about300° C. to 350° C. Also, a hydrogen thermal processing method for asemiconductor device using a material such as a resin substrate whichcannot be resist thermal processing at a temperature higher than 200° C.is desired.
A technique for performing hydrogen thermal processing at a lowtemperature using a hydrogen active species without producing plasma isdisclosed in Japanese Patent Application Open No. 5-144804. However, itis not disclosed that a semiconductor device such as a TFT disposed on aresin substrate having a low heat resistance is subjected to hydrogenthermal processing.
As described above, hydrogen thermal processing performed as a finalprocess in a semiconductor device producing process is effective toimprove its characteristic and reliability. However, when aluminum isused as a wiring material and an electrode material, thermal processingat a high temperature cannot be performed. That is, a thermal processingtemperature cannot be set to 300° C. or higher. As a result, an effectdue to hydrogen thermal processing cannot be obtained sufficiently.
SUMMARY OF THE INVENTION
The object of the present invention disclosed in the specification is toprovide an effective hydrogen thermal technique under a temperature thata wiring and an electrode each containing aluminum or mainly aluminumcan resist.
The present invention disclosed in the specification is characterized inthat a sample temperature is maintained at 150° C. ±20° C. in asemiconductor device producing process.
Also, the present invention disclosed in the specification ischaracterized in that a hydrogen active species is generated bycontacting hydrogen or a gas containing hydrogen to heated nickel or aheated material containing nickel, and a semiconductor device disposedon a resin substrate is annealed using the hydrogen active species.
In the above structure, it is effective to construct at least a part ofthe wiring in the semiconductor device by using nickel or nickel alloy.
The material containing nickel or the nickel alloy in the presentinvention disclosed in the specification is a multilayer film of Ni andanother material, Ni--Mo system alloy and Ni--W system alloy.
By contacting a hydrogen gas to the heated nickel, a hydrogen activespecies can be generated at a low temperature. A semiconductor materialdisposed on a substrate such as a resin substrate having a low heatresistance can be subjected to hydrogen thermal processing.
According to the present invention, there is provided a method forproducing a semiconductor device comprising the steps of: forming asemiconductor film comprising silicon on a substrate in a chamber;forming an insulating film on the semiconductor film; forming a wiringcomprising aluminum on the insulating film; generating a hydrogen activespecies in the chamber; and performing annealing using the hydrogenactive species.
Also, according to the present invention, there is provided asemiconductor device producing method comprising the steps of: placing asemiconductor device in a chamber; generating a hydrogen active speciesin the chamber; and annealing the semiconductor device using thehydrogen active species at 150° C.±20° C.
Further, according to the present invention, there is provided a methodfor producing a semiconductor device comprising the steps of: placing asemiconductor device in a chamber; forming a material including nickelon an inner surface of a pipe connected to the chamber; heating thepipe; introducing a gas including hydrogen inside the pipe, to generatea hydrogen active species by contacting the heated material includingnickel to the gas including hydrogen; and thermal-processing thesemiconductor device using the hydrogen active species.
Furthermore, according to the present invention, there is provided amethod for producing a liquid crystal display device comprising thesteps of: placing a semiconductor integrated circuit in a chamber;generating a hydrogen active species in the chamber; and annealing thesemiconductor integrated circuit using the hydrogen active species at150° C. ±20° C.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a schematic view of an apparatus for performing hydrogenthermal processing;
FIGS. 2A to 2D show a producing process for a thin film transistor; and
FIGS. 3A to 3G show a producing process for a substrate constructing aliquid crystal display device.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
Embodiment 1!
In the embodiment, a technique for utilizing the present inventiondisclosed in the specification in a producing process for a MOS (metaloxide insulator) type thin film transistor (TFT) formed on a glasssubstrate will be explained. FIGS. 2A to 2D show a producing process fora TFT according to the embodiment.
A silicon oxide film 202 having a thickness of 3000 Å is formed as abase film on a glass substrate 201 by sputtering. An amorphous siliconfilm having a thickness of 500 Å is formed by plasma chemical vapordeposition (plasma CVD) or low pressure thermal CVD, and then irradiatedwith a laser light to obtain a crystalline silicon film. The obtainedcrystalline silicon film has a substantially polycrystal structure.
The obtained crystalline silicon film is patterned to form an activelayer 203 of a TFT. A silicon oxide film 204 used as a gate insulatingfilm is formed at a thickness of 1000 Å by plasma CVD. Thus, a state ofFIG. 2A is obtained.
A film containing mainly aluminum is formed by electron beam evaporationor sputtering. In the embodiment, an aluminum film containing scandiumat 0.2 weight % is formed at a thickness of 5000 Å by electron beamevaporation. Further, patterning is performed to form a gate electrode205.
By an anodization process, an oxide layer 206 is formed around the gateelectrode 205, so that offset gate regions can be formed in an impurityion implantation process to be performed later.
Anodization process is performed using the gate electrode 205 as ananode in an electrolytic solution. In this process, the anodic oxidelayer 206 having a thickness of about 2000 Å is formed on an exposedsurface of the gate electrode 205. (FIG. 2B)
An impurity ion is implanted to form source and drain regions. In theembodiment, phosphorus (P) ion is implanted to form an N-channel typeTFT. At this time, since the gate electrode 205 and the surroundinganodic oxide layer 206 are used as masks, the source region 207 and thedrain region 210 are formed in a self-alignment. Also, offset gateregions 208 are formed by using the anodic oxide layer 206 as a mask. Achannel forming region 209 is formed under the gate electrode 205. Afterthe ion implantation, a laser is irradiated to anneal a region in whichthe ion is implanted and to activate the implanted ion. (FIG. 2C)
A silicon oxide film 211 having a thickness of 6000 Å is formed as aninterlayer insulating film by plasma CVD. Then, contact holes are formedto form a source electrode 212 and a drain electrode 213. Although notshown, the gate electrode wiring is formed at the same time. In theembodiment, these electrodes are constructed by a multilayer of atitanium film (1000 Å in thickness) and an aluminum film (4000 Å inthickness) containing silicon at 1 weight %.
Thermal processing in an atmosphere containing hydrogen is performed toneutralize dangling bonds in a region including mainly an interfacebetween the active layer and the gate insulating film. In theembodiment, the hydrogen thermal processing is formed by using anapparatus as shown in FIG. 1 for 1 hour in an atmosphere of 150° C.
The apparatus of FIG. 1 includes a processing chamber 101 which is madeof stainless and covered with nickel metal at a surface thereof, a pipe102 for introducing a hydrogen gas into the processing chamber 101wherein an inner surface thereof is covered with nickel metal, a valve103 for controlling a quantity of the hydrogen gas to be introduced fromthe pipe 102 to the processing chamber 101, heaters 104 for heating thepipe 102, heaters 108 for heating the processing chamber 101 itself, aholder 106 on which samples (substrates) 107 are disposed wherein thesamples are subjected to hydrogen thermal processing, and a pipe 105 forexhausting an unnecessary gas in the processing chamber 101.
A hydrogen gas introduced into the pipe 102 becomes active hydrogen in aportion of the pipe 102 heated by the heaters 104. That is, the activehydrogen is generated by reacting the hydrogen gas with nickel in aninner surface of the heated pipe 102. At this time, it is preferablethat a heating temperature by the heaters 104 is 150° C.±20° C.
The hydrogen gas in the pipe 102 is introduced into the processingchamber 101. The processing chamber 101 is also heated at 150° C.±20° C.by the heaters 108, so that active hydrogen is filled in the processingchamber 101. Hydrogen thermal processing is performed by maintainingthis state for a desired period of time.
Embodiment 2!
In the embodiment, when a semiconductor integrated circuit required fora liquid crystal display device is formed on a substrate different froma substrate constructing the liquid crystal display device and then itis adhered to the substrate constructing the liquid crystal displaydevice, an example that the present invention disclosed in thespecification is applied thereto is shown.
FIGS. 3A to 3G shows a schematic producing order of a passive matrixtype display device. A large number of semiconductor integrated circuits(peripheral driver circuits) 22 for driving an active matrix circuit areformed on a supporting substrate 21 through a peeling layer made ofsilicon oxide. (FIG. 3A)
As the supporting substrate 21, a single crystal wafer or a glasssubstrate can be used. In particular, when the single crystal wafer isused, a semiconductor integrated circuit having a high characteristiccan be formed.
The supporting substrate 21 is divided to obtain stick crystals (sticksubstrates) 23 and 24. Electrical characteristics in the obtained stickcrystals 23 and 24 are tested before performing next process, to selecta good product. (FIG. 3B)
Surfaces of the stick crystals 23 and 24 in which circuits are formedare adhered on surfaces 26 and 28 of another substrates 25 and 27 inwhich patterns of wirings made of a transparent conductive film areformed, to perform electrical connection. (FIGS. 3C and 3D)
The substrates 25 and 27 are a transparent resin substrate and used as apair of substrates constructing a liquid crystal display device. As suchresin substrate, polyether sulfate (PES) can be used.
By using a gas containing halogen, the peeling layer is etched to peelthe supporting substrate 21 from the stick crystals 23 and 24, so thatonly the semiconductor integrated circuits 29 and 30 remain on thesurfaces 26 and 28 of the substrates 25 and 27. (FIGS. 3E and 3F)
The obtained substrates are opposed to one another, so that a passivematrix type display device is obtained. A surface 26 is a reversesurface of the surface 26, i.e., a surface on which a wiring pattern isnot formed. (FIG. 3G)
In the above case, a row stick crystal (a stick crystal for a drivercircuit for driving a row wiring) and a column stick crystal (a stickcrystal for a driver circuit for driving a column wiring) are dividedfrom the same substrate 21. However, these stick crystals may be dividedfrom another substrate. Although the passive matrix type display deviceis shown in FIGS. 3A to 3G, the same process may be performed for anactive matrix type display device.
When a wiring is completed, hydrogen thermal processing disclosed in thespecification is performed as described in Embodiment 1. In thisprocess, although a resin substrate having an extremely low heatresistance is used, it can resist thermal processing at about 150° C.That is, even if the resin substrate is used, hydrogen thermalprocessing can be performed by using the present invention disclosed inthe specification, so that characteristic and reliability of asemiconductor device can be improved.
What is claimed is:
1. A method for producing a semiconductor devicecomprising the steps of:forming a semiconductor film comprising siliconon a substrate in a chamber; forming an insulating film on thesemiconductor film; forming a wiring comprising aluminum on theinsulating film; generating a hydrogen active species in the chamber byreacting a heated material including nickel with a gas includinghydrogen; and performing annealing using the hydrogen active species ata temperature of 150°+20° C.
2. A method according to claim 1 whereinthe substrate comprises a glass substrate.
3. The method of claim 1wherein the substrate comprises a resin substrate.
4. A method accordingto claim 1 wherein the annealing is performed at a temperature that thealuminum is not diffused into the insulating film.
5. A method accordingto claim 1 wherein the wiring further comprises nickel.
6. Asemiconductor device producing method comprising the steps of:placing asemiconductor device in a chamber, said semiconductor device comprisinga wiring including aluminum; generating a hydrogen active species in thechamber by reacting a heated material including nickel with a gasincluding hydrogen; and annealing the semiconductor device using thehydrogen active species at 150° C.±20° C.
7. A method according to claim6 wherein the wiring further comprises nickel.
8. A method for producinga semiconductor device comprising the steps of:placing a semiconductordevice in a chamber, said semiconductor device comprising a wiringincluding aluminum; forming a material including nickel on an innersurface of a pipe connected to the chamber; heating the pipe;introducing a gas including hydrogen inside the pipe, to generate ahydrogen active species by contacting the heated material includingnickel to the gas including hydrogen; and thermal-processing thesemiconductor device using the hydrogen active species at a temperatureof 150+20 C.
9. A method according to claim 8 wherein the wiring furthercomprises nickel.
10. A method for producing a liquid crystal displaydevice comprising the steps of:placing a semiconductor integratedcircuit in a chamber, said semiconductor integrated circuit comprising awiring including aluminum; generating a hydrogen active species in thechamber by reacting a heated material including nickel with a gasincluding hydrogen; and annealing the semiconductor integrated circuitusing the hydrogen active species at 150 C.±20 C.
11. A method accordingto claim 10 wherein the wiring further comprises nickel. | 2024-03-22 | 1996-03-27 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1998-06-16"
} |
US-52692583-A | Servicing system for reproduction machines
ABSTRACT
To facilitate servicing of xerographic type reproduction machines or printers, diagnostic routines are used (1) to operate the machine in a predetermined copy run while recording the clock count on a global counter on the arrival of a copy sheet at a first selected jam station in the paper path and the count on arrival of the same copy sheet at the next jam station, and then display the clock count difference on the machine display console for comparison by the Tech Rep with a master clock count; (2) to operate the machine in a present copy run while fetching the current timing parameter of a machine subassembly from memory, displaying the timing parameter to the Tech Rep on the machine display console, and permitting the Tech Rep to use the machine control panel keyboard to reset the timing parameter while watching the effect of the timing change on the copies as they are produced; and (3) to delay the arrival of the copy sheet at the machine image transfer station so that the normally unprinted interdocument area wherein process control images are formed is printed out to enable the process control images to be visually examined.
The invention relates to a reproduction machine, and more particularly,to a system for diagnosing, servicing, and adjusting the variousoperating components, sub-assemblies, and modules of a reproductionmachine.
The high degree of complexity attending modern day reproductionmachines, copiers, printers, and the like, particularly in the case ofhigh speed full featured versions of these machines, complicates thedetection and identification of problems and repair and service. This isparticularly true where machine timing is under scrutiny for the purposeof detecting timing errors and making the requisite adjustments to bringthe machine operating timing into design specifications. For as can beunderstood, the various operating components and subassemblies of themachine must be timed to within extremely close tolerances if themachine is to operate as designed, or even to operate at all. In thiscontext, matters are complicated even further by the fact that anyslight deviation in or adjustment to the timing parameter of onecomponent or subassembly can have a ripple effect in the sense that thetiming of other components and subassemblies are affected and hence mayrequire compensating adjustment if proper machine operation is to bemaintained. For example, in many machines, the paper path is effectivelysegregated into a succession of sections, an arrangement which the arthas found useful for paper jam detecting purposes particularly. However,this necessitates that the timing of a copy sheet as it moves from onepaper path section to another be held within close tolerances if anoperative paper path is to be established without causing the paper jamdetectors to perceive the presence of a jam due to premature or delayedarrival of the copy sheet at one detector.
As a further aspect, machines of the type alluded to usually incorporateinternal controls, many of which are highly sophisticated, to monitorthe operating state of different machine components and subassemblies.Controls of this type serve to automatically adjust the operatingparameters of the components or subassemblies being monitored tomaintain copy quality without the need to invoke a service call withconsequent machine down time.
One control for example responds to the operating state of the machinexerographic processing system such as the toner dispenser forresupplying toner as it is used up. Typically, a control of this typeutilizes a series of test images, which are produced from time to timeon the machine photoconductor as determinative of the operating state ofthe machine's xerographic processing system. Of course, to avoidcontaminating the copies being produced, the test images are produced onunused areas of the machine photoconductor. This means however that thetest images cannot be seen and examined by the machine service personneleither since the test images are not printed out. Yet, it would beadvantageous to nevertheless make the actual test images available forinspection by the service personnel; this on the basis that if the testimages themselves are deficient, the true problem may not be recognizedbut instead the machine control will think erroneously that the fault isdue to misadjustment or malfunction of the xerographic processingcomponents and will make unneeded and potentially harmful adjustments tothe xerographic processing components.
The present invention seeks to alleviate the foregoing problems anddeficiencies by providing a servicing/diagnostic process for areproduction machine, comprising the steps of: operating the machinecopy programming means to program the machine for a predeterminedservice routine for determining the time interval between two selectedpoints along the path followed by the copy sheets or document originalsduring a copy run; actuating the machine; recording the count on themachine clock on detection of a copy sheet or document original at thefirst of the two points along the path; recording the count on the clockon detection of the copy sheet or document original at the second of thetwo points along the path; differencing the clock counts obtained fromone another; and displaying the clock count difference on the machinecopy run display panel to enable comparison with a standard controlcount.
The invention further provides a method for timing the discreteoperating elements of a reproduction machine to provide optimum copyquality, comprising the steps of: using the machine copy run programmer,inputting a preset service routine for displaying on the machine copyrun display panel the current timing parameter of a selected one of themachine operating elements while concurrently programming the machinefor a preset copy test run; operating the machine to produce testcopies; viewing the test copies produced by the machine and adjustingthe timing parameter of the selected operating element; and repeatingthe above until the timing parameter of the selected operating elementis adjusted to provide the desired copy quality.
IN THE DRAWINGS
FIG. 1 is an isometric view of an electrographic reproduction machine ofthe type adapted for use with the present invention;
FIG. 2 is a schematic side view in partial cross section showingconstruction details of the machine shown in FIG. 1;
FIG. 3 is a schematic illustration of the paper path with attendant jamdetection stations for the machine shown in FIG. 1;
FIG. 4 is a schematic view illustrating the control subdivisions andcommunication channel for the machine shown in FIG. 1;
FIG. 5 is a view of the copy information byte for providing controlinstructions to the copy processing components on a step by step basisas each copy sheet progresses along the paper path shown in FIG. 3;
FIG. 6 is an enlarged schematic view of a segment of the machinephotoconductive belt illustrating the disposition of images thereon;
FIG. 7 is an enlarged isometric view showing details of the adjustableedge fade out shutter assembly for the machine shown in FIG. 1;
FIG. 8 is an enlarged schematic view showing a segment of the machinephotoconductive belt illustrating the relation between copy images andtest images;
FIG. 9 is a flow chart showing the operating sequence for determiningmachine timing;
FIG. 10 is an isometric view illustrating details of the test patchtransfer operation enabled during the servicing routine;
FIG. 11 is a flow chart depicting entry and programming of the machinetiming routines and reproduction machine copy runs; and
FIG. 12 is a flow chart depicting the servicing routine selectionprocess.
While the present invention will hereinafter be described in connectionwith a preferred embodiment thereof, it wll be understood that it is notintended to limit the invention to that embodiment. On the contrary, itis intended to cover all alternatives, modifications and equivalents asmay be included within the spirit and scope of the invention as definedby the appended claims.
For a general understanding of the features of the present invention,reference is had to the drawings. In the drawings, like referencenumerals have been used throughout to designate identical elements.FIGS. 1-4 schematically depict the various components of an illustrativeelectrophotographic reproduction or printing machine 5 incorporating theservicing system of the present invention therein. As will appear,machine 5 includes an automatic document handler, referred to herein asRDHR 17, and a sorter output module referred to herein as SOR 9. It willbecome evident from the following discussion that the invention isequally well suited for use in a wide variety of printing machines andis not necessarily limited in its application to the particularembodiment shown herein.
A control panel 6 allows the use or operator to select copy size, copycontrast, number of copies to be made, the manner (duplex, for example)in which the copies are to be made, etc. Panel 6 includes programmingmeans in the form of a numeric keyboard 100 ordinarily used by theoperator for programming in the number of copies to be made, a pluralityof additional selection buttons 102 for programming in various operatingfeatures such as duplex copying, auxiliary paper tray, etc., and amulti-digit (i.e. eight) numeric display array 104 for displaying to theoperator or user, and as will appear, to the machine service personnel,the number programmed by keyboard 100. A Start/Print button 105 isprovided on control panel 6 for starting up the machine and a jobinterrupt (VIP) button 108 to permit the operator or user to interruptthe job or copy run in progress to run a different job and thereafterreturn to the interrupted job. Actuation of job interrupt button 108changes the operating state of reproduction machine from "Level 1" to"Level 2".
A display panel 8 informs the user of the status of the reproductionmachine 5 and can be used to prompt the operator to take correctiveaction in the event of a machine fault. In the example shown, displaypanel 8 includes a flip chart 106, a Liquid Crystal Display (LCD) 107,an alphanumeric display 109, and a "Power On" button 110. As may beunderstood, LCD display 107 cooperates with alphanumeric display 109 toinform the user of the machine operating status, to identify faults asthey occur, and to refer the operator to flip chart 106 in the event theinstructions to be given are more complex than can be convenientlydisplayed by the LCD and alphanumeric displays 107, 109.
In addition, and as will appear more fully hereinafter, the machineservice man, commonly referred to as the Tech Rep, uses both controlpanel 6 and display panel 8 to input various diagnostic programs forchecking the operating condition of the different machine components.
Inasmuch as the art of electrophotographic printing is well known, thevarious processing stations employed in the printing machine 5 will beshown hereinafter schematically and their operation described brieflywith reference thereto.
The illustrative electrophotographic printing machine 5 employs a belt10 having a photoconductive surface thereon. Preferably, thephotoconductive surface is made from a selenium alloy. Belt 10 is drivenby main drive motor 29 and moves in the direction of arrow 12 to advancesuccessive portions of the photoconductive surface through the variousprocessing stations disposed about the path of movement thereof. In theexample shown, the ends of belt 10 are butted together at seam 10' toprovide an endless belt.
Initially, a portion of the photoconductive surface passes throughcharging station A. At charging station A, a corona generating device,indicated generally by the reference numeral 14, charges thephotoconductive surface to a relatively high substantially uniformpotential.
Next, the charged portion of the photoconductive surface is advancedthrough imaging station B. At imaging station B, a document handlingunit, (referred to herein as recirculating document handler remote orRDHR 17), positions original documents 16 facedown over exposure system23. The exposure system, indicated generally by reference numeral 23includes an exposure means in the form of flash lamp 20 whichilluminates the document 16 positioned on transparent platen 18. Thelight rays reflected from document 16 are transmitted through lens 22.Lens 22 focuses the light image of original document 16 onto the chargedportion of the photoconductive surface of belt 10 to selectivelydissipate the charge thereof. This records an electrostatic latent imageon the photoconductive surface which corresponds to the informationalareas contained within the original document. Thereafter, belt 10advances the electrostatic latent image recorded on the photoconductivesurface to development station C. Platen 18 is mounted movably andarranged to move in the direction of arrows 24 to adjust themagnification of the original document being reproduced. Lens 22 movesin synchronism therewith so as to focus the light image of originaldocument 16 onto the charged portion of the photoconductive surface ofbelt 10. While a light/lens type exposure system is illustrated herein,other exposure systems such as scanning laser may be envisioned.
RDHR 17 sequentially feeds documents 16 from a stack of documents placedby the operator in a normal forward collated order in a documentstacking and holding tray 17' to platen 18. Following copying, RDHR 17recirculates the documents back to the stack supported on the tray 17'.For this purpose, suitable document guides 120 and cooperating transportrollers and belts 124 cooperate to form a document path 122 leading fromtray 17' to platen 18 and from platen 18 back to tray 17'. Suitabledocument sensors 125 are provided at discrete points along the documentpath 122 for detecting the presence or absence of a document atpredetermined times during the document feeding cycle. Preferably, RDHR17 is adapted to feed documents of various sizes and weights of paper orplastic containing the information to be copied. Preferably,magnification of the imaging system is adjusted to insure that theindicia or information contained on the original document is reproducedwithin the space of the copy sheet.
While a recirculating document handling unit has been described, oneskilled in the art will appreciate that other document handler types maybe used instead or that the original document may be manually placed onthe platen rather than by the document handling unit. This is requiredfor a printing machine which does not include a document handling unit.
A plurality of sheet transports comprising a vertical transport 31, aregistration transport 32, prefuser transport 33, decurler 34, postfuser transport 35, output transport 36, bypass transport 37, andinverter roll 38, cooperate with suitable sheet guides 39 to form apaper path through which the copy sheets 21 being processed pass fromeither main paper supply tray 27, or auxiliary paper supply tray 27', orduplex paper supply tray 60 through the machine 5 to either top tray 54or discharge path 58. Transports 31, 32, 33, 34, 35, 36, 37, 38 aresuitably driven by main drive motor 29. Suitable sheet sensorsdesignated here by the numeral 41, are provided at the output of eachpaper tray 27, 27' and duplex tray 60 to detect feeding of a sheettherefrom.
In the exemplary arrangement shown, discharge path 58 communicates witha sorter module (SOR) 9 which provides, as will be understood by thoseskilled in the art, a paper path 127 leading to a plurality of bins 128.Suitable copy sheet sensors 129 are provided at discrete points alongthe paper path 127 to detect the presence or absence of a copy sheet atpredetermined times during sorting. While a sorter is illustrated as theoutput module herein, other output modules such as a stitcher may becontemplated. Further, the output module may be dispensed with an outputtray used instead.
With continued reference to FIGS. 1-4, at development station C, a pairof magnetic brush developer rollers, indicated generally by thereference numerals 26 and 28, advance a developer material into contactwith the electrostatic latent image. The latent image attracts tonerparticles from the carrier granules of the developer material to form atoner powder image on the photoconductive surface of belt 10.
After the electrostatic latent image recorded on the photoconductivesurface of belt 10 is developed, belt 10 advances the toner powder imageto transfer station D. At transfer station D, a copy sheet is moved intotransfer relation with the toner powder image. Transfer station Dincludes a corona generating device 30 which sprays ions onto thebackside of the copy sheet. This attracts the toner powder image fromthe photoconductive surface of belt 10 to the sheet. After transfer,prefuser transport 33 advances the sheet to fusing station E.
Fusing station E includes a fuser assembly, indicated generally by thereference numeral 40, which permanently affixes the transferred powderimage to the copy sheet. Preferably, fuser assembly 40 includes a heatedfuser roller 42 and backup roller 44. The sheet passes between fuserroller 42 and backup roller 44 with the powder image contacting fuserroller 42. In this manner, the powder image is permanently affixed tothe sheet.
After fusing, decurler 34 and post fuser transport 35 carry the sheetsto inverter gate 48 which functions as an inverter selector. Whenenergized or pulled, gate 48 directs the copy sheets into a sheetinverter 50. When inoperative, gate 48 bypasses sheet inverter 50 andthe sheets are fed directly to bypass gate 52. Thus, copy sheets whichbypass inverter 50 turn a 90° corner in the paper path before reachinggate 52. Bypass gate 52 directs the sheets into top tray 54 so that theimaged side which has been transferred and fused is faceup. If inverter50 is selected, the opposite is true, i.e. the last printed face isfacedown. Bypass gate 52 normally directs the sheet into top tray 54 or,when energized, to bypass transport 37 which carries the sheet to duplexgate 56. Gate 56 either directs the sheets without inversion to thedischarge path 58 and SOR 9 or, when energized, to duplex inverter roll38. Inverter roll 38 inverts and directs the sheets to be duplexed intoduplex tray 60. Duplex tray 60 provides intermediate or buffer storagefor those sheets which have been printed on one side and on which animage will be subsequently printed on the side opposed thereto, i.e. thecopy sheets being duplexed. Due to the sheet inverting action ofinverter roll 38, the buffer set of sheets are stacked in duplex tray 60facedown in the order in which the sheets have been copied.
In order to complete duplex copying, the previously simplexed sheets intray 60 are fed seriatim by bottom feeder 62 back via vertical transport31 and registration transport 32 to transfer station D for transfer ofthe toner powder image to the opposed side of the sheet. Inasmuch as thebottommost sheet is fed from duplex tray 60, the proper or clean side ofthe copy sheet is positioned in contact with belt 10 at transfer stationD so that the toner powder image thereon is transferred thereto. Theduplex sheets are then fed through the same path as the previouslysimplexed sheets to the selected output for subsequent removal by theprinting machine operator.
Referring particularly to FIGS. 1 and 4, reproduction machine 5 issegregated into a series of independent modules (termed remotes herein),and identified as sorter output remote (SOR) 9, paper handling remote(PHR) 11, marking and imaging remote (MIR) 13, xerographic remote (XER)15, recirculating document handler remote (RDHR) 17, and centralprocessing master (CPM) 19. SOR 9, PHR 11, MIR 13, XER 15, RDHR 17, andCPM 19 are communicated with one another by means of a sharedcommunication line (SCL) 25 through which controlled instructions andsynchronizing clock pulse signals from and to the machine remotes pass.
A suitable machine clock pulse generator 45, which is drivingly coupledto the output shaft of main drive motor 29, generates a succession ofclock pulses whenever driver motor 29 is energized. The clock pulseoutput of clock generator 45 serves to provide timing signals forvarious components of reproduction machine 5 and for operating a globalcounter 43. As will be understood, to enhance copy throughout, severalcopy sheets may be in process at various locations along the paper pathat any one time. To accommodate this and permit individual copies to betracked and processed in the particular manner desired, timing controlover the copy processing functions is divided into pitches, each pitchbeing further subdivided into a number of machine clock pulses. Forexample, the paper path may be separated into eleven pitches with eachpitch being composed of approximately 850 machine clock pulses.
Pitch reset signals, which serve in effect to determine the length ofthe pitch and the number of machine clock pulses within the pitch, arederived from copy sheet registration finger 46 on registration transport32. For this purpose, a sensor such as switch 47 is disposed in the pathof movement of copy sheet registration fingers 46 such that on eachcycle of finger 46 past switch 47, switch 47 outputs a reset signal. Theoutput of machine clock pulses by generator 45 are input through CPM 19to PHR 11 while the pitch reset signals generated by switch 47 are inputdirectly to PHR 11.
To monitor and control movement and processing of the copy sheets movingalong the paper path, a series of sensors which may for example compriseswitches, are disposed at predetermined jam detection stations along thepaper path. More specifically, a pretransfer jam detection station 49 isprovided upstream of transfer station D having sheet sensor 49', apre-fuser jam detection station 51 is provided upstream of fusingstation E having sheet sensor 51', a post-fuser jam detection station 53is provided on the downstream side of fusing station E having sheetsensor 53', an output transport jam detection station 55 is provided atthe inlet to output transport 36 having sheet sensor 55', and a bypassjam detection station 57 is provided in the bypass transport 37 upstreamof duplex inverter roll 38 having sheet sensor 57'.
CPM 19 includes a scheduler 59 for scheduling processing of each copy,the copy run instructions programmed through control panel 6 being inputto scheduler 59. As will be understood by those skilled in the art,there is also provided a suitable memory section, exemplified herein byMain Memory Band (MMB) 7 (shown in FIG. 3). MMB 7 normally includes bothRead Only Memory (ROM) and Random Access Memory (RAM), and nonvolatilememory or NVM 61 wherein data representing the particular machineconfiguration parameters (i.e. document handler type) and operatingparameters (i.e. exposure timing) is stored. Additionally, CPM 19includes on-board memory such as RAM memory 63. Scheduler 59 responds tothe copy run information input by the operator through control panel 6and the machine configuration and operating parameters input from NVM 61to generate a copy information byte 64 (shown in FIG. 5) for each copyto be made.
In the exemplary arrangement shown, copy information byte 64 containsdata identifying the copy sheet source (i.e. tray 27, 27' or 60), thecopy destination (i.e. top tray 54, SOR 9, or duplex tray 60), whetherthe copy is to be inverted or not (i.e. by inverter 50), whether thecopy represents the end of the set (i.e. the last copy of a batch), ifthe sheet is a clearing or purge sheet (normally as a result of a paperjam), and image information related to the particular copy being made(i.e. feed or not feed a sheet). The copy information byte is entered inRAM 63 and held in a suitable memory location or variable, the latterbeing defined herein as a location in memory where information isstored. The copy information byte 64 is moved from memory variable tomemory variable in synchronism with movement of the copy sheet along thepaper path from jam detection station to jam detection station (i.e.from pretransfer jam detection station 49 to prefuser jam detectionstation 51, from prefuser jam detection station 51 to post fuser jamdetection station 53, etc.). In effect, jam detection stations 49, 51,53, 55 and 57 serve to pass the copy information byte 64 from memoryvariable to memory variable. At each memory variable, corresponding to ajam detection station, the copy information byte is read to provideoperating instructions for the copier components up to the next jamdetection station.
Referring now to FIG. 6, it will be understood that where for examplemultiple copies of a document page are being made, a series of spacedlatent electrostatic images 70 are created through exposure of thedocument 16 on platen 18 to the moving photoreceptor belt 10.Preferably, RDHR 17 registers the document 16 in predetermined positionon platen 18, normally in one corner thereof. Where RDHR 17 is not used,the operator or user is instructed to place the document in registeredposition on platen 18. In the exemplary arrangement shown, this resultsin one edge (identified herein for convenience as the top 71 of thelatent electrostatic image 70) being fixed in position on photoreceptorbelt 10 whatever the image size. Accordingly, an undischarged non-imagearea, referred to as photoreceptor top edge 73 herein, exists betweenimage top 71 and the edge of belt 10 as well as a second undischargednon-image area, referred to as photoreceptor bottom edge 74 herein,between the bottom 75 of the maximum size image 70 and the opposite edgeof belt 10. Further, where the document page being copied is smaller inwidth than platen 18 (the example shown in FIG. 6), an additionalnon-image area 76 occurs between the photoreceptor bottom edge 74 andthe bottom 75 of the latent image 70.
Additionally, there are undischarged non-image areas before the firstimage, between successive images, and after the last image. Forexplanation purposes, these areas are collectively referred to andidentified herein as interdocument areas 78. Top and bottom edges 73, 74and any nonimage area 76 are discharged to prevent unwanted developmentthereof. The interdocument areas 78 are similarly discharged except forthe area where test or control patches are made as will appear.
Referring to FIGS. 2 and 7, to erase or discharge the interdocument area78, top and bottom edges 73, 74, and in certain cases the nonimage area76, interdocument and edge erase lamps 80, 81 are provided in theinterior of the photoconductive belt 10. Interdocument erase lamp 80,the axial length of which is at least equal to the width of belt 10, ismounted at right angles to the direction of movement of the belt 10facing the inside surface of belt 10. As will be understood by thoseskilled in the xerographic arts, operation of interdocument erase lamp80 is synchronized with movement of belt 10, lamp 80 being energizedduring periods when there is no image present on belt 10 and beingdeenergized when an image is present.
Edge erase lamp 81 is suitably supported within belt 10 with the axis oflamp 81 at right angles to the direction of movement of belt 10. Theaxial length of edge erase lamp 81 is at least equal to the width ofbelt 10. A plate-like light pipe 83 having a generally U-shape isoptically coupled between edge erase lamp 81 and the interior surface ofphotoreceptor belt 10. The light discharge end of light pipe 83 facingbelt 10 has top and bottom edge erase segments 84, 85 and a centralnon-erase segment 86. Top edge erase segment 84 of light pipe 83 has anaxial length equal to the width of the photoreceptor top edge 73 which,where a fixed registration point for document 61 is provided as in theexample discussed, remains substantially constant whatever the sizeimage 70 being reproduced. Bottom edge erase segment 85 of light pipe 83has an axial length equal to the sum of the photoreceptor bottom edge 74plus the width of the largest size non-image area 76 to be erased.
To enable the effective size of the bottom edge erase segment 85 oflight pipe 83 to be adjusted in accordance with the size of thenon-image area 76 (it is understood that the size of the non-image area76 changes with changes in the size of the image 70), an adjustableshutter 88 is interposed between the discharge side of light pipe 83 andbelt 10. Shutter 88 is supported in housing 89 with a drive screw 90coupled thereto to move shutter 88 back and forth upon rotation of drivescrew 90. A suitable driving motor such as servo motor 91 is provided torotate screw 90 and move shutter 88. A shutter locating switch 94defines a predetermined home or park position for shutter 88 which inthe example shown, comprises the shutter closed position.
Referring to FIGS. 2, 8 and 10, in order to monitor the effectiveness ofcertain ones of the xerographic processing components such as coronacharging device 14, mag brush rollers 26, 28, etc., a test patch orimage 95 is created from time to time in the interdocument area 78 ofphotoconductive belt 10. For this purpose, a suitable exposure devicesuch as a Light Emitting Diode (LED) 96 is provided opposite belt 10downstream of exposure station B. LED 96, when energized, exposes thepreviously charged belt 10 in the interdocument area 78 thereby creatingthe test image 95. Following exposure, the test image is developed bymag brush rollers 26, 28, and the image density checked. In one examplean infra-red densitometer 115 is positioned between developer station Cand transfer station D, densitometer 115 generating electrical signalsproportional to the developed toner mass of the test image 95. Wheretest images are being generated for analysis, the operation timing ofthe interdocument erase lamp 80 is changed to avoid erasing the image95.
To aid the Tech Rep in diagnosing and servicing reproduction machine 5,a plurality of diagnostic programs (shown in Tables V-X) may be summonedthrough the expediency of coded numbers input through keyboard 100 ofcontrol panel 6 on entry into a Service Mode. Typically, the ServiceMode is entered by the Tech Rep by means of a special key, or codednumber known to the Tech Rep.
For example, where numerical coding is used, a certain diagnosticprogram stored in NVM 61 may bear the code number "×23". The Tech Rep,on entering the Service Mode, uses the keyboard 100 to enter the codenumber "×23" which is displayed on numeric display 104 of control panel8 as entered by the Tech Rep.
One series diagnostic programs that may be entered by the Tech Rep areprograms for displaying the time required for a copy sheet 21 to travelfrom one jam detection station to the next (Tables V, VI). In thesediagnostic programs, the information is displayed on numerical display104 of control panel 6 in clock counts which may then be compared by theTech Rep with a reference clock span or clock window reflecting theaccepted time interval. If the displayed clock count is not within theclock window, adjustment, or repair or replacement of the relatedmachine components are made to bring the time interval into theacceptable limit.
As will appear more fully herein, where for example the Tech Rep wantsto determine the time interval required for a copy sheet 21 to traversefrom pretransfer jam detection station 49 to the fuser jam detectionstation 51, the Tech Rep keys in the appropriate program number (i.e."×23") using the keyboard 100. The Tech Rep then actuates start/printbutton 105 on control panel 6 to actuate reproduction machine 5 and feeda copy paper forward from the paper tray 27 or 27' selected.
As shown in FIG. 9 where for example the Tech Rep has keyed in theaforementioned routine for determining the time interval required for acopy sheet to travel from pretransfer jam detection station 49,identified by sensor 49' on sensing the leading edge of the copy sheet,to the prefuser jam detection station 51, identified by sensor 51' inresponse to detection of the leading edge of the copy sheet, the clockcount on global counter 43 is read into RAM memory 63 in response to theleading edge of the copy sheet reaching jam detection sensor 49'.Subsequently, when the copy sheet leading edge is sensed by sensor 51'of prefuser jam detection station 51, the clock count on counter 43 isread into RAM memory 63. The counts are then differenced and the result,which is representative of the time required for the copy sheet to passfrom pretransfer jam detection station 49 to prefuser jam detectionstation 51 displayed on numeric display 104 of control panel 6. Thedisplayed number is then compared by the Tech Rep with the clock windowfor that particular portion of the copy sheet path to see if the numberfalls within the window. If not, adjustments/repairs/replacements aremade to the affected components to bring the time interval within thedesired operating time interval.
In a similar manner, the time required for a copy sheet to pass betweenselected points in reproduction machine 5 including the other jamdetection stations and other points along the paper path and within anyoutput module, i.e. SOR 9, as well as the time required for documents 16to pass between selected points in the input module, i.e. RDHR 17, maybe determined and compared with the specific clock window therefor bythe Tech Rep keying in the diagnostic code number on control panel 6 andstarting the machine 5.
In addition, routines (Tables I-IV, XI) are provided to enable the TechRep to change or adjust, either permanently, or temporarily whileservicing the machine, the operating parameters of various machinecomponents. During this process, the machine 5 is automaticallyprogrammed to operate through a predetermined copying cycle to permitthe Tech Rep to view the effect of any change made on the copy output ofthe machine. This additionally permits the Tech Rep to observe theinterplay between changes in operating parameter of one component onother components immediately so that compensating adjustments in theoperating parameters of any related components can be made and observed.
In this connection, routines are provided to enable the Tech Rep tochange the operational timing of the exposure means, i.e. flash lamp 20,the on/off timing of patch generator 96, the on/off timing of thenon-image erase means, i.e. interdocument fadeout lamp 80, the operatinglocations of edge fadeout shutter 88, and adjustment for the belt seam10'. Routines for changing other machine operating parameters may bereadily envisioned. Inasmuch as the operating parameters for theaforementioned components are, when once set, constant, the individualparameters are stored in NVM 61.
To provide access to NVM 61, and the operating parameters storedtherein, certain combinations of numbers address or access theparticular location in NVM 61 (i.e. Tables XIII, XIV) for the variousmachine operating parameters such as those described above. Usingkeyboard 100 of control panel 6, the Tech Rep enters the appropriatecode for the operating parameter to be looked at, which when addressedis displayed on numeric display 104. Following fetching of the desiredoperating parameter, the Tech Rep pushes Start/Print button 105 tooperate reproduction machine 5, the machine automatically beingprogrammed by the diagnostic routine or class of routines being run tooperate through a predetermined copy cycle, i.e. a 5 copy run.
As the reproduction machine 5 operates, the Tech Rep views the copies asthey are produced. Where a change in the operating parameter currentlybrought up is desired, predetermined ones of the selection buttons onkeyboard 100 may be actuated to selectively increment or decrement thecurrent operating parameter. This may be done while reproduction machine5 makes copies to enble the Tech Rep to continuously examine andappraise the effect of the changes in the parameter on the copy outputof machine 5.
As described, one or more test images or patches 95 are generated fromtime to time, the test image or images being read by densitometer 115 todetermine the operating effectiveness of various components of MIR 13and XER 15. Since the test images rest within the interdocument area 78,these images do not appear on the copies produced by machine 5.
A routine (Table XII) is provided to enable the Tech Rep to view thetest images 95 to determine if the test images are being generated anddeveloped properly, the routine in effect changing the timing at whichcopy sheets are fed to transfer station C so that the test images appearon the copy sheet. For this routine, the Tech Rep using keyboard 100,programs in the access code for printing the test image 95. Followingkeying in of the access code, the Tech Rep depresses Start/Print button105 to operate the machine and process a single copy. During the copyprocess, the selected routine delays timing of the feeding of the copysheet to transfer station C by approximately one-half a cycle. Whilesuch a delay in feeding the copy sheet mis-registers the copy sheetrelative to the normal image, the test image 95 in the interdocumentarea 78, which was previously developed by mag brush rolls 26, 28, istransferred to the copy sheet where it may be examined by the Tech Rep.
In this context, the interdocument erase lamp 80 is operated normally todischarge areas of belt 10 on each side of test image 95. And flash lamp20 is also triggered normally even though no document is present onplaten 18, the light from lamp 20 serving to expose the remainingnonimage areas of belt 10.
To facilitate servicing and trouble shooting of auxiliary modules suchas RDHR 17, a routine is provided for exercising the reproductionmachine 5 in the same manner as if copies were being made but withoutactually producing copies. At the same time, the auxiliary module beingchecked operates in a normal manner as if copies were being made,thereby permitting the Tech Rep to study and evaluate the auxiliarymodule's performance without actually running the basic machine.
For this routine, the Tech Rep keys in the appropriate access code viakeyboard 100 on control panel 6. When fetched, the routine disablescertain of the operating components of reproduction machine 5 includingthe paper feeders 62, interdocument erase lamp 80, flash lamp 20, andthe drive connection between main drive motor 29 and mag brush rolls 26,28 so that no copies will be produced. The machine main drive motor 29,belt 10, machine clock 45, and pitch reset signal generator 47 areoperated in the normal manner.
The Tech Rep loads the documents into the RDHR 17 as if a copy run wereto be made and depresses the Start/Print button 105. Upon startup, theRDHR 17 operates to feed one document at a time into registered positionon platen 18 as if copies were being made while the reproduction machineis exercised as if copies were being processed. During theaforementioned psuedo operation, the Tech Rep checks operation of theRDHR for proper timing, jams, document mis-registering etc.
OPERATION
Referring particularly to FIG. 11, where the Tech Rep wishes to checkand/or adjust machine 5, the Tech Rep enters, using keyboard 100, theidentifying code number (i.e. "×23") for the particular machineoperating/parameter to be checked (Tables I-III). As shown by theMachine Timing routine of Table I, the first digit ("×") of the codenumber chosen by the Tech Rep serves to pre-program the machine 5 toeither make a copy run of a preset number of copies or no copies at allon subsequent actuation of Start/Print button 105 by the Tech Rep. Withentry into the Machine Timing routine (Table I), the Set Up MachineControl routine (Table II) is entered to ready reproduction machine 5for operation. Concurrently, the code number of the Machine Timingroutine by the Tech Rep is displayed by the first 3 digits (left side)of numeric display 104 through the program routines of Tables III (SHIFT3 DIGITS LEFT) and IV (DISPLAY NUMBERS ENTERED).
Where the first digit of the code number entered by the Tech Rep is not"9" (IF DIAGNOSTIC @ LEFT=9 . . . ELSE BEGIN; Table I) and the secondtwo digits are less than 85 (IF PORT @ BIT<85), then if the first digitis "3", a copy run of 1 is pre-programmed, if the first digit is "1"(which is used for setting up or adjusting machine timing), a copy runof 5 is pre-programmed, and if the first digit is "9", no copies areproduced. For all other first digit selections, a copy run of 50 ispre-programmed.
Referring to FIG. 12 and the Machine Timing routine of Table V, wherethe reproduction machine 5 is at level 1 (STATE @ ARRAY [VIP]STATE≠LEVEL2) and the code number input by the Tech Rep is less than"11" (CASE<11), one of the RDH Timing routines (Table VI) is entered toprovide the time interval required for a document to move through aselected portion of the document path 122 in RDHR 17. For example, wherethe code number is "×13", the time interval required for a document tomove from the exit of platen 16 to the inlet of document tray 17' willbe determined and displayed in clock counts on numeric display 104 uponactuation of Start/Print button 105.
Where the code number input by the Tech Rep is between "11" and "33"(CASE<33), the Base Timing routine of Table VII is entered. This routineidentifies the time interval for a copy sheet to move through a selectedportion of the paper path, with the time interval displayed as a clockcount on numeric display 104. For example, if it were desired todetermine the time interval required for a copy sheet to move frompretransfer jam detection densor 49' to prefuser jam detection sensor51', the code number "×23" is input via keyboard 100. In thisconnection, it is understood that the "×" digit is used to pre-programreproduction machine for a preset copy run.
Similarly, where the code number input by the Tech Rep is between "33"and "41" (CASE<41), or between "41" and "60" (CASE<60), or between "60"and "84" (CASE<84), the Base to Output Timing (Table VIII), or theSorter Timing (Table IX), or the Special Base Timing (Table X) routineis entered.
Having selected the desired machine operating parameter to be checked byinput of the requisite code number, the Tech Rep next actuatesStart/Print button 105 to operate reproduction machine 5 through thepreprogrammed copy run determined by the first digit ("×") of the codenumber as described. With operation of reproduction machine 5, the timeinterval for the specific machine portion selected is calculated bydifferencing the counts on global counter 43 (See FIG. 9) with theresulting count displayed in clock counts on numeric display 104 ofcontrol panel 6.
Where the Tech Rep desires to change or adjust the current operatingparameter of the machine component or sub-assembly being examined whichis held in NVM 61 (i.e. the operating locations of shutter 88), the TechRep inputs the requisite code number, the first digit of which is a "1".The Machine Timing routine (Table V) calls the Timing Set Up routine(Table XI). This routine enables the Tech Rep, by actuating in selectivefashion, either the #3 or #1 digit of keyboard 100 to adjust theoperating parameter in NVM 61, actuation digit #3 incrementing, in stepsof 1, the selected parameter stored in NVM 61 while actuation of digit#1 decrements the selected parameter in steps of 1. During adjustment,the count which represents the operating parameter is continuouslydisplayed on numeric display 104.
It will be understood that during adjustment of a particular operatingparameter in NVM 61, reproduction machine 5 is pre-programmed to make arun of 5 copies. This permits the Tech Rep to observe the effect of thechanges as they are being made on the copies.
Referring to FIG. 11, where the Tech Rep desires to visually observetest patch 95, the code number (i.e. "×85") for the Patch Printer (TableXII) is entered through keyboard 100. The Machine Timing routine (TableI), where the code number is "85" (IF PORT @ BIT<85, THEN), calls thePatch Print routine which offsets the operational timing of reproductionmachine 5 by a predetermined degree (ADDED @ VALUE 255-FLASH @ 5 @PITCH) such that on subsequent actuation of Start/Print button 105 andoperation of reproduction machine 5, the test patch 95 is transferred tothe copy sheet or sheets for examination by the Tech Rep as shown inFIG. 10.
Where the Tech Rep wishes to access NVM 61 to view a current operatingparameter stored therein, job interrupt (VIP) button 108 on controlpanel 6 is actuated to switch reproduction machine 5 to a secondoperating level (IF STATE @ ARRAY=LEVEL 2, Table V) and bring up theroutine Monitor NVM of Table XIII. The Tech Rep inputs the requisiteidentifying code number for the memory location desired through keyboard100 and the routine Display Result of Table XIV is called to display theselected parameter in NVM 61 on numeric display 104.
While the invention has been described with reference to the structuredisclosed, it is not confined to the details set forth, but is intendedto cover such modifications or changes as may come within the scope ofthe following claims.
______________________________________ LEGEND FOR TABLES I-XIV ______________________________________ = Equal != Not equal PORT@BIT Number entered by Tech Rep FLT Fault BPASS Bypass DIAG Diagnose PROC Process CTRL Control PWR Power CONVER Conversion ID Identification DSP Display ZBIN To binary MC Machine Clock (#45) RT Real time TYPE IN NUMBER Insert program number via key- board 100 TEMP DEVICE Identifies SW to be reused JO@CONFIG & INPMASK Refers to machine configuration identification, i.e. if Not = to 0, then machine includes RDHR 21. PHR #11 MIR #13 DIFF Difference SKIP@DISPLAY Omit display GLOBAL CLOCK #43 SHUTTER #88 NVM #61 KEYBD Keyboard 100 CNV2B-2DSP Convert 2 byte to display format VIPSTATE Interrupt state ______________________________________
TABLE I ______________________________________ DC26 MACHINE TIMING ______________________________________ DESCRIPTION: THIS IS THE CONTROLL ROUTINE FOR DC26 : MACHINE TIMING SET UP AND DISPLAY. DEPENDING ON THE NUMBER ENTERED, THIS ROUTINE WILL PROGRAM FOR 1 COPY RUN, 5 COPIES RUN, OR 50 COPIES RUN 1 COPY RUN FOR ANY NUMBER BEGIN WITH 3XX 5 COPIES RUN FOR ALL MACHINE TIMING SET UP BEGIN WITH 1XX 0 COPY (INHIBIT FEED) FOR ALL NUMBERS BEGIN WITH 9XX 50 COPIES RUN OTHERWISE. FOR MACHINE TIMING SET UP THE KEY BOARD NUMBER 3 AND 1 ARE MONITORED, 3 TO INCREMENT BY 1 IN THE NVM LOCATION & 1 TO DECREMENT BY 1 THE DISPLAYED NVM LOCATION IN 1 COPY RUN FOR MACHINE TIMING MEASUREMENT, IF THE DESTINA- TION SWITCH IS NOT MADE WITHIN 6 SECOND, A LETTER E WILL BE FLASHING. ALL NUMBERS CAN BE CHANGED DURING RUN OR STANBY. ALL COPY-RUN MODE CAN ONLY CHANGE IN STANDBY MODE ______________________________________ LOCAL PROCEDURE MACHINE -TIMING; ENTER; PATCH@PRINTER ← CLEAR; SET -UP -MACHINE -CONTROLL; DISP LOOP FOREVER; SHIFT -3DIGITS -LEFT; DISPLAY -NUMBERS -ENTER; TIMING@VALUE ← 0; CONTR LOOP FOREVER; IF STATE@ARRAY(MACHINESTATE) != PRINTSTATE THEN BEGIN; IF STATE@ARRAY(VIPSTATE) != LEVEL2 THEN BEGIN: IF DIAGNOSTIC@LEFT(3) = 9 THEN BEGIN; DIAG@SETUP@INHIBITS ← "FC"; PROC@CTRL@SWITCH ← 1; END; ELSE BEGIN; DIAG@SETUP@INHIBITS ← 0; IF PORT@BIT < 85 THEN ##STR1## IF (PORT@BIT = 85) & (PATCH@PRINTER = CLEAR) THEN BEGIN; PATCH -PRINTER; PATCH@PRINTER ← SET; END; END; IF DIAGNOSTIC@LEFT(3) < 3 THEN BEGIN; IF DIAGNOSTIC@LEFT(3) = 2 THEN QUANTITY@SELECTED ← 1; ELSE QUANTITY@SELECTED ← 5; END; ELSE BEGIN; IF PORT@BIT > 85 THEN QUANTITY@SELECTED ← 1; ELSE QUANTITY@SELECTED ← 50; END; END; ELSE BEGIN; DIAG@SETUP@INHIBITS ← 0; QUANTITY@SELECTED ← 50; ##STR2## END; END; RACE; CASE NEXTIME KEYBD#CL = PUSHED; CANCEL MC -RT -MEASUREMENTS; IF ((STATE@ARRAY(MACHINESTATE) != PRINTSTATE) (PROC@CTRL@ SWITCH != 1)) THEN ##STR3## EXIT CONTR; CASE NEXTIME KEYBD#3 = PUSHED; TIMING@VALUE ← 1; CASE NEXTIME KEYBD#1 = PUSHED; TIMING@VALUE ← MINUSONE; CASE NEXTIME KEYBD#0 = PUSHED; DIAGNOSTIC -PRINTER; CASE 5 SEC; IF DIAGNOSTIC@LEFT(3) = 2 THEN BEGIN; IF SWITCH@COUNT = 1 THEN BEGIN; MONITOR@FLAG ← CLEAR; WAIT 5 SEC; IF MONITOR@FLAG = CLEAR THEN BEGIN; DIAGNOSTIC@RIGHT ← BLANK; DIAGNOSTIC@RIGHT(0) ← ALPHAE; START UPDATE -DISPLAY(TECHREPRIGHT,BLINKRATE); END; END; END; END; RELOOP CONTR; RELOOP DISP; RETURN; END; ______________________________________
TABLE II ______________________________________ BEGINNING FOR DC26 SET UP MACHINE CONTROLL ______________________________________ DESCRIPTION: THIS IS AN INTERFACE PROCEDURE BETWEEN APPS AND DIAG. FOR THE PROCEDURES IN DIAGNOSTIC WHICH REQUIRED TO FEED PAPER. THIS PROCEDURE PASS ALL MACHINE CONTROLL BACK TO APPS. LIKE NORMAL RUN CALLED BY: DC26,DC29,DC28 ______________________________________ LOCAL PROCEDURE SET -UP -MACHINE -CONTROLL: ENTER; DIAG@FLT@BPASS,DIAG@SETUP@INHIBITS ← 0; START FAULT -MANAGER (0,0,6); ##STR4## CANCEL MONITOR -INTERLOCKS; START MONITOR -INTERLOCKS; START CONSOLE -INPUT; RETURN; END; ______________________________________
TABLE III ______________________________________ SHIFT 3DIGITS LEFT ______________________________________ DESCRIPTION: THIS ROUTINE IS ASKING FOR THREE NUMBERS TO BE ENTER BY THE TECH REP. THESE THREE NUMBERS WILL BE STORED IN DIAGNOSTIC@LEFT ARRAY FOR DISPLAYING IN THE LEFT LATER CALLED BY: DC26 ______________________________________ LOCAL PROCEDURE SHIFT -3DIGITS -LEFT; ENTER; DIAGNOSTIC -ID -DISPLAY (DIGIT3); ##STR5## ##STR6## ##STR7## KEYBOARD@DISPLAY@ARRAY(2) ← 0; RETURN; END; ______________________________________
TABLE IV ______________________________________ DISPLAY NUMBERS ENTER ______________________________________ DESCRIPTION: THIS ROUTINE WILL TAKE THE NUMBER ENTERED BY THE TECH REP AND DISPLAY IT IN THE LEFT CONTROLL CONSOLE. THE RIGHT DISPLAY WILL BE BLANK. THE NUMBER ENTERED WILL BE USED AS POINTER LATER AND 50 COPIES RUN WILL BE ASSIGNED AUTOMATICALLY. CALLED BY: DC26,DC29,DC40,DC28 ______________________________________ LOCAL PROCEDURE DISPLAY -NUMBERS -ENTER; ENTER; DIAGNOSTIC@LEFT(0) ← BLANK; DIAGNOSTIC@RIGHT ← BLANK; CNV -DSP2BIN (KEYBOARD@DISPLAY@ARRAY) RE- TURNS RESULT@WORD; PORT@BIT ← LSB(RESULT@WORD) - 10; START UPDATE -DISPLAY (TECHREPRIGHT,NONBLINK); START UPDATE -DISPLAY (TECHREPLEFT,NONBLINK); START MC -RT -MEASUREMENTS (0); RETURN; END; ______________________________________
TABLE V __________________________________________________________________________ DC26 MACHINE TIMING __________________________________________________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO AID THE TECH REP IN MACHINE TIMING SET UP AND ALSO TO DISPLAY THE TIMING BETWEEN TWO SWITCHES OR SENSORS IN THE MACHINE. THE VALID NUMBERS FOR THIS ROUTINE ARE: FOR MACHINE TIMING SET UP 115 FLASH TIMING SET UP 116 PATCH GENERATOR ON TIME SET UP 117 PITCH FADEOUT LEAD EDGE SET UP 118 PATCH GENERATOR OFF TIME SET UP 119 PITCH FADEOUT TRAIL EDGE SET UP 120 FLASH TIMING SET UP FOR FOUR PITCH MODE 121 PATCH GENERATOR ON TIME SET UP FOR 4 PITCH MODE 122 PITCH FADEOUT LEAD EDGE SET UP FOR 4 PITCH MODE 123 PATCH GENERATOR OFF TIME SET UP FOR 4 PITCH MODE 124 PITCH FADEOUT TRAIL EDGE SET UP FOR 4 PITCH MODE 125 EDGE FADEOUT SHUTTER SET UP 132&3 BELT SEAM SET UP FOR 5 PITCH MODE 134&5 BELT SEAM SET UP FOR 4 PITCH MODE FOR MACHINE TIMING MEASUREMENTS RDH TIMING X00 PLAT#ENT ACTUATION TO CAM#POS ACTUATION X01 CAM#POS ACTUATION TO CAM#POS DEACTUATION X02 CAM#POS DEACTUATION TO PLAT#XIT ACTUATION X03 PLAT#XIT ACTUATION TO TRAY#ENT ACTUATION X04 TRAY#ENT ACTUATION TO TRAY#ENT DEACTUATION X06 TRAY#XIT ACTUATION TO PLAT#ENT ACTUATION X07 PLAT#ENT ACTUATION TO PLAT#ENT DEACTUATION X09 TRAY#XIT ACTUATION TO TRAY#XIT DEACTUATION BASE MACHINE TIMING X11 DUP$FEED$CL ON TO DUP#WT DEACTUATION X13 MAIN$TAR$CL ON TO MAIN#WT DEACTUATION X15 AUX$TAR$CL ON TO AUX#WT DEACTUATION X17 DUP#WT DEACTUATION TO PRE#XFER DEACTUATION X19 MAIN#WT DEACTUATION TO PRE#XFER DEACTUATION X21 AUX#WT DEACTUATION TO PRE#XFER DEACTUATION X23 PRE#XFER ACTUATION TO PRE#FUS ACTUATION X24 PRE#FUS ACTUATION TO PRE#FUS DEACTUATION X26 PRE#FUS ACTUATION TO POST#FUS ACTUATION X27 POST#FUS ACTUATION TO POST#FUS DEACTUATION X29 POST#FUS ACTUATION TO COPY#OUT ACTUATION X30 COPY#OUT ACTUATION TO COPY#OUT DEACTUATION X31 COPY#OUT DEACTUATION TO BYPASS#T DEACTUATION BASE TO OUTPUT TIMING (IN REAL TIME) X33 BYPASS#T ACTUATION TO SOR1#INSW ACTUATION X34 BYPASS#T ACTUATION TO SOR2#INSW ACTUATION X35 BYPASS#T ACTUATION TO STTCH#IN ACTUATION X36 BYPASS#T ACTUATION TO STACK#IN ACTUATION X38 HOME#POS ACTUATION TO HOME#POS DEACTUATION X39 HOME#POS DEACTUATION TO WIRE#FEED ACTUATION SORTER TIMING X41 TO X80 SOR#IN DEACTUATION TO BIN#ENT DEACTUATION SPECIAL BASE TIMING X81 NUMBER OF MACHINE CLOCK PER PITCH RESET X82 NUMBER OF MACHINE CLOCK PER BELT HOLE X83 NUMBER OF MACHINE CLOCK PER SECOND X84 SET UP THE INVERTER GATE X85 PATCH PRINTER OTHERWISE X- CLEAN BELT UPDATE CYCLE WHERE X = ANY NUMBER GREATER THAN 1 = ANY NUMBER GREATER THAN 85 OTHERWISE TIME BEGIN: SKIP@DISPLAY,SWITCH@COUNT,LSB(TIME@DIFF),MSR(TIME@DIFF) ← 0; PORT@BIT ← PORT@BIT + 10: IF STATE@ARRAY(VIPSTATE) = LEVEL2 THEN MONITOR -NVM; DISP LOOP FOREVER; TYPEIN@NUMBER ← PORT@BIT; IF DIAGNOSTIC@LEFT(3) = 1 THEN BEGIN; IF (PORT@BIT- 15<11) (PORT@BIT - 32 < 4) THEN TIMING -SETUP; ELSE RETURN; END; ELSE BEGIN; TEST PORT@BIT; CASE < 81; LOOP SWITCH@COUNT ← 0 TO 1; IF TYPEIN@NUMBER < 41 THEN BEGIN; TEMP@DEVICE ← BYTE@TB(TYPEIN@NUMBER); SENSE@ ← BITSEN@TB(TYPEIN@NUMBER); END; TEST TYPEIN@NUMBER ; CASE < 11; IF (TO@CONFIG & INPMASK) != 0 THEN RDH -TIMING; ELSE RETURN; CASE < 33; BASE -TIMING; CASE < 41; CONTROL@ ← OUTPUT@MASK (PORT@BIT - 33): IF (TO@CONFIG & CONTROL@) = 0 THEN RETURN; ELSE BASE -TO -OUTPUT -TIMING; OTHERWISE BEGIN: IF PORT@BIT > 60 THEN BEGIN: IF (IO@CONFIG & SOR2MASK) = 0 THEN RETURN; END; ELSE IF (IO@CONFIG&SOR1MASK) = 0 THEN RETURN; IF STATE@ARRAY(MACHINESTATE) != PRINTSTATE THEN BEGIN; SELECT -FEATURE(OUTPUTSELECTION,UNCOLLATED); START OUTPUT -INTERFACE(SORVARIABLE,CLEAR); START OUTPUT -INTERFACE(MACHINETIMING,PORT@BIT-40); END; SORTER -TIMING; END; END; IF SWITCH@COUNT = 0 THEN STOP@TIMER ← TIME@DIFF; ELSE TIME@DIFF ← TIME@DIFF - STOP@TIMER; TYPEIN@NUMBER ← TYPEIN@NUMBER + 1; RELOOP; CASE < 84; SPECIAL -BASE -TIMING; CASE = 84; INVERTER@GATE,SKIP@DISPLAY ← FIRSTSKIP; CASE = 85; LSB(TIME@DIFF) ← ADDED@VALUE; OTHERWISE BEGIN; IF DIAGNOSTIC@LEFT(3) = 9 THEN RETURN; LSB(TIME@DIFF),PROC#CTRL@SWITCH ← 129; IF SKIP@DISPLAY = 0 THEN BEGIN; CLEAN@BLT@CNTR ← 0; DELAY#DEADCYCLE ← 1; WAIT 250 MS; START SELECT -FEATURE(4,1); WAIT 1 PR 0; START REQUEST -DEADCYCLE(XEROGRAPHICSSTATE,50); END; ELSE RETURN; END; END; END; IF SKIP@DISPLAY != FIRSTSKIP THEN DISPLAY -RESULT; SKIP@DISPLAY,MONITOR@FLAG ← NOTFIRST; RELOOP DISP; END TIME; END; END; __________________________________________________________________________
TABLE VI __________________________________________________________________________ RDH TIMING __________________________________________________________________________ DESCRIPTION: THIS ROUTINE IS USED BY DC28 (RDH EXERCISER) AND DC26 (MACHINE TIMING) PROGRAM. THIS ROUTINE IS MEASURED THE TIMING BETWEEN TWO SWITCHES OR SENSORS IN THE RDH AND DISPLAYED TO THE CONTROL PANNEL. VALID NUMBERS FOR THIS ROUTINE ARE: X10 PLAT#ENT ACTUATION TO CAM#POS ACTUATION X12 CAM#POS DEACTUATION TO PLAT#XIT ACTUATION X13 PLAT#XIT ACTUATION TO TRAY#ENT ACTUATION X14 TRAY#ENT ACTUATION TO TRAY#ENT DEACTUATION X16 TRAY#XIT ACTUATION TO PLAT#ENT ACTUATION X17 PLAT#ENT ACTUATION TO PLAT#ENT DEACTUATION X19 TRAY#XIT ACTUATION TO TRAY#XIT DEACTUATION __________________________________________________________________________ LOCAL PROCEDURE RDH -TIMING; ENTER; IF (TO@CONFIG & RDHMASK) = 0 THEN BEGIN; IF TYPEIN@NUMBER > 5 THEN TEMP@DEVICE ← TEMP@DEVICE + 1; IF TYPEIN@NUMBER = 6 THEN SENSE@ ← BITOSENSE0; END; OPTIMIZE 1; INPUT -RT -COUNT(TEMP@DEVICE,SENSER) RETURNS LSB(TIME@DIFF),MSR(TIME@DIFF) OPTIMIZE 3; TIME@DIFF ← TIME@DIFF + TIME@DIFF; IF (TO@CONFIG & RDHMASK) = 0 THEN; BEGIN; IF (PORT@BIT = 5) × (S@FIG#6COUNT = 1) THEN OMIT 1 SEC; END; RETURN; END; __________________________________________________________________________
TABLE VII ______________________________________ BASE TIMING ______________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO MEASURED AND DISPLAYED THE TIMING BETWEEN TWO SWITCHES OR SENSORS OF THE BASE MACHINE. THIS ROUTINE WILL RECORDED THE TIME WHEN THE SWITCH IS TOGGLE, AND THE DISTANCE WILL BE COMPUTED BY MAIN ROUTINE AND DISPLAYED IN CONTROL PANNEL. THE ROUTINE DELAY WILL BE: 2400 MC FOR TIMING FROM DUP#WT TO PRE#XFER 2000 MC FOR TIMING FROM MAIN#WT TO PRE#XFER 1660 MC FOR TIMING FROM AUX#WT TO PRE#XFER 600 MC FOR TIMING FROM PRE#FUS TO POST#FUS 600 MC FOR TIMING FROM POST#FUS TO COPY#OUT MOD@FEED@TM MC FOR MODIFIED FEED NUMBER ______________________________________ LOCAL PROCEDURE BASE -TIMING; ENTER; IF SENSE@ = PHRINPUT THEN PHR -DIGITAL -MC(TEMP@DEVICE) RETURNS MSR(TIME@DIFF),LSB(TIME@DIFF); ELSE MIR -DIGITAL -MC(TEMP@DEVICE) RETURNS MSB(TIME@DIFF),LSB(TIME@DIFF); IF SWITCH@COUNT = 0 THEN BEGIN; IF (PORT@BIT = 17) THEN WAIT 2400 MC; IF (PORT@BIT = 21) THEN WAIT 1660 MC; IF (PORT@BIT = 26) (PORT@BIT = 29) THEN WAIT 600 MC; IF (PORT@BIT = 11) < 6 THEN BEGIN; TIME@DIFF ← TIME@DIFF + RHD@FEED@TR; IF SKIP@DISPLAY = 0 THEN SKIP@DISPLAY ← FIRSTSKIP; WAIT MOD@FEED@TM MC; END; IF PORT@BIT = 10 THEN WAIT 2000 MC; END; ELSE IF PORT@BIT = 15 THEN WAIT 100 MC; ______________________________________
TABLE VIII ______________________________________ BASE TO OUTPUT TIMING ______________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO MEASURE THE TIMING FROM BYPASS TRANSPORT SWITCH OF BASE MACHINE TO OUTPUT REMOTES SWITCHES (SORTER INPUT SWITCH, STITCHER OR STACKER INPUT SWITCH). THE TIMING IN THIS ROUTINE WILL BE MADE IN REAL TIME ______________________________________ LOCAL PROCEDURE BASE -TO -OUTPUT -TIMING; ENTER; IF PORT@BIT < 33 THEN RETURN; OPTIMIZE 1; IF (SWITCH@COUNT = 0) & (PORT@BIT < 38) THEN BEGIN; RACE; CASE NEXTIME BYPASS#T = PAPER; END; END; ELSE BEGIN; IF PORT@BIT = 34 THEN WAIT 750 MS; 12SOR -2FINISH(TEMP@DEVICE,SENSER,255) RETURNS LSB(TIME@DIFF),MSB(TIME@DIFF); END; READ -GLOBAL -CLOCK(REALTIME,TIME@DIFF); OPTIMIZE 3; RETURN; END; ______________________________________
TABLE IX ______________________________________ SORTER TIMING ______________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO MEASURE THE TIMING FROM SORTER INPUT SWITCH TO ANY BIN ENTER SENSOR. THE TIMING IS DISPLAY IN REAL TIME ______________________________________ LOCAL PROCEDURE SORTER -TIMING; ENTER; IF PORT@BIT > 60 THEN TEMP@DEVICE ← BINENTER2; ELSE TEMP@DEVICE ← BINENTER1; TEMP@DEVICE ← TEMP@DEVICE SWITCH@COUNT; OPTIMIZE 1; T2SOR -2FINISH (TEMP@DEVICE,0,255) RETURNS LSB(TIME@DIFF),MSB(TIME@DIFF); OPTIMIZE 3; TIME@DIFF ← TIME@DIFF + TIME@DIFF; RETURN; END; ______________________________________
TABLE X ______________________________________ SPECIAL BASE TIMING ______________________________________ DESCRIPTION: THIS ROUTINE IS USED TO MEASURE THE TIMING FROM PITCH RESET TO PITCH RESET,BELT HOLE TO BELT HOLE AND NUMBER OF MILLISECONDS PER PITCH RESET ______________________________________ LOCAL PROCEDURE SPECIAL -BASE -TIMING; ENTER; TEST PORT@BIT; CASE = 81; PHR -DIGITAL -MC(PIT#RESET1) RETURNS MSB(OUTPUT@VALUE),LSB(OUTPUT@VALUE); CASE = 82; PHR -DIGITAL -MC(BELT#H1) RETURNS MSB(OUTPUT@VALUE),LSB(OUTPUT@VALUE); OTHERWISE BEGIN; WAIT 1 PR 0; OUTPUT@VALUE ← RTC -AT -PITCH -RESET ; END; END; TIME@DIFF ← OUTPUT@VALUE - STOP@TIMER; STOP@TIMER ← OUTPUT@VALUE; IF SKIP@DISPLAY = 0 THEN SKIP@DISPLAY ← FIRSTSKIP; RETURN; END; ______________________________________
TABLE XI ______________________________________ TIMING SETUP ______________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO AID THE TECH REP IN SETTING UP THE MACHINE TIMING. THE MACHINE TIMING CAN BE SET UP THROUGH THIS ROUTINE ARE FLASH TIMING,PATCH GENERA- TOR,PITCH FADEOUT,SHUTTER AND BELT SEAM. THIS ROUTINE WILL DISPLAY THE CONTENT OF NVM LOCATION FOR THESE TIMING. FIVE COPIES RUN IS PROGRAM FOR THIS, AND NVM CAN BE CHANGE BY PUSHING KEYBOARD NUMBER 3 AND 1. ______________________________________ LOCAL PROCEDURE TIMING -SETUP; ENTER; IF TIMING@VALUE != 0 THEN BEGIN; ##STR8## IF PORT@BIT = 25 THEN BEGIN; CANCEL SHUTTER -RELAY; START SHUTTER -RELAY(64); END; IF (PORT@BIT - 32) < 4 THEN PO@ERROR ← 0; TIMING@VALUE ← 0; END; LSB(TIME@DIFF) ← NVM@ARRAY1(PORT@BIT); RETURN; END; ______________________________________
TABLE XII ______________________________________ PATCH PRINTER ______________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO ADD FOR THE TECH REP A TOOL TO PRINT OUT THE PATCHES IN A NORMAL COPY RUN. PATCHES ARE PRINTING OUT BY OFFSETTING THE FLASH TIMING, PATCH GENERATOR, PITCH FADEOUT AND BELT SEAM BY THE AMOUNT OF 255 - FLASH TIMING (ASSUME THAT THE FLASH TIMING IS THE BIGGEST NUMBER). ALL MODES IN DC26 COULD BE USED FOR THIS, AND THE PATCH PRINT OUT WILL BE: COPY 1 : SEAM PATCH COPY 2 : CLEAN BELT PATCH COPY 3,4,5 : CURRENT PATCH COPY 6 : SEAM PATCH COPY 7 : TONER PATCH COPY 8,9,10 : CURRENT PATCH WHEN EXIT DC26, ALL ORIGINAL WILL BE RESTORED. NOTE: IF MACHINE CRASH IN DC26, THESE NUMBER MAY NOT BE RESTORED TO THE RIGHT VALUE. ______________________________________ LOCAL PROCEDURE PATCH -PRINTER; ENTER; IF PATCH@PRINTER = CLEAR THEN ADDED@VALUE ← 255 - FLASH@5@PITCH; ADDED@VALUE;ALUE ← POWER@HP ← 0; LOOP RANGE@INDEX ← 15 TO 19; NVM@ARRAY1(RANGE@INDEX) ← NVM@AR- RAY1(RANGE@INDEX) + ADDED@VALUE; RELOOP; LSB(FIVE@DELAY) ← LSB(FIVE@DE- LAY) - ADDED@VALUE; RETURN; END; ______________________________________
TABLE XIII ______________________________________ MONITOR NVM ______________________________________ DESCRIPTION: THIS ROUTINE IS USED TO DISPLAY NVM LOCATION ENTER BY THE TECH. REP. ______________________________________ LOCAL PROCEDURE MONITOR -NVM; ENTER; MULTIPLY -WORD(0,DIAGNOSTIC@LEFT(3)-1,0,100) RE- TURNS MSB(STOP@TIMER), LSB(STOP@TIMER); RACE; CASE NEXTIME KEYBD#1 = PUSHED: CONTROL@ ← 1 ; CASE NEXTIME KEYBD#2 = PUSHED: CONTROL@ ← 2 ; CASE NEXTIME KEYBD#3 = PUSHED: CONTROL@ ← 3 ; CASE NEXTIME KEYBD#4 = PUSHED: CONTROL@ ← 4 ; CASE NEXTIME KEYBD#5 = PUSHED: CONTROL@ ← 5 ; CASE NEXTIME KEYBD#6 = PUSHED: CONTROL@ ← 6 ; CASE NEXTIME KEYBD#7 = PUSHED: CONTROL@ ← 7 ; CASE NEXTIME KEYBD#8 = PUSHED: CONTROL@ ← 8 ; CASE 4 SEC; CONTROL@ ←0 ; END; TEMP@1 ← MSB@PAGE(CONTROL@); STOP@TIMER ← STOP@TIMER + PACKWORD(TEMP@1,PORT@BIT); LOOP FOREVER; LOOPHOLE; LHLD STOP@TIMER MDV A,@ STA TIME@DIFF END; WAIT 200 MS; DISPLAY -RESULT; RELOOP; RETURN; END; ______________________________________
TABLE XIV ______________________________________ DISPLAY RESULT ______________________________________ DESCRIPTION: THE PURPOSE OF THIS ROUTINE IS TO CONVERT A BINARY WORD TIME@DIFF TO RCD FORMAT AND DISPLAY THIS NUMBER TO THE CONTROL PANNEL. FOR DC26, FOUR DIGITS NUMBER WILL BE DISPLAYED. OTHERWISE 3 DIGITS NUMBER WILL BE DISPLAYED. ______________________________________ LOCAL PROCEDURE DISPLAY -RESULT; ENTER; CNV2R -2DSP (TIME@DIFF) RETURNS TEMP@, DIAGNOSTIC@RIGHT(3),DIAGNOSTIC@RIGHT(2), DIAGNOSTIC@RIGHT(1),DIAGNOSTIC@RIGHT(0); IF STATE@ARRAY(VIPSTATE)=LEVEL2 THEN DIAGNOSTIC@RIGHT(3) ← CONTROL@; START UPDATE -DISPLAY (TECHREPRIGHT,NONBLINK); RETURN; END; ______________________________________
I claim:
1. A method for adjusting the timing of the exposure lamp meansin a reproduction machine to provide optimum copy quality, said machineincluding programming means for programming said machine for copy runs,display means for displaying the copy program, and memory means forstoring the operating timing parameter of said exposure lamp means,comprising the steps of:(a) using said programming means, inputting apreset machine servicing routine for accessing and displaying on saiddisplay means the current operating timing parameter for said exposurelamp means, said servicing routine automatically programming saidmachine to make a predetermined number of test copies; (b) actuatingsaid machine; (c) viewing the test copies produced by said machine whileadjusting the operating timing parameter for said exposure lamp means;and (d) repeating step c until the operating timing parameter for saidexposure lamp means is adjusted so that said machine makes test copieshaving the desired copy quality.
2. The method according to claim 1including the steps of:(a) during said preset machine servicing routineand while said machine is making said test copies, addressing thelocation in said memory means where the current operating timingparameter for said exposure lamp means is stored; and (b) replacing thecurrent operating timing parameter for said exposure lamp means with theadjusted timing parameter for said exposure lamp means in said memorymeans.
3. A method for timing the non-image erase means of areproduction machine to provide optimum copy quality, said machineincluding programming means for programming said machine for copy runs,display means for displaying the copy program, and memory means forstoring the operating timing parameter of said non-image erase means,comprising the steps of:(a) using said programming means, inputting apreset machine servicing routine for accessing and displaying on saiddisplay means the current operating timing parameter for said non-imageerase means, said servicing routine automatically programming saidmachine to make a predetermined number of test copies; (b) actuatingsaid machine; (c) viewing the test copies produced by said machine whileadjusting the operating timing parameter for said non-image erase means;and (d) repeating step c until the operating timing parameter for saidnon-image erase means is adjusted so that said machine makes test copieshaving the desired copy quality.
4. The method according to claim 3including the steps of:(a) during said preset machine servicing routineand while said machine is making said test copies, addressing thelocation in said memory means where the current operating timingparameter for said non-image erase means is stored; and (b) replacingthe current operating timing parameter for said non-image erase meanswith; the adjusted timing parameter for said non-image erase means insaid memory means.
5. A method for adjusting the location data for theedge fadeout shutter in a reproduction machine to provide optimum copyquality, said machine including programming means for programming saidmachine for copy runs, display means for displaying the copy program,and memory means for storing the location data for said edge fadeoutshutter, comprising the steps of:(a) using said programming means,inputting a preset machine servicing routine for accessing anddisplaying on said display means the current location data for said edgefadeout shutter, said servicing routine automatically programming saidmachine to make a predetermined number of test copies; (b) actuatingsaid machine; (c) viewing the test copies produced by said machine whileadjusting the location data for said edge fadeout shutter; and (d)repeating step c until the location data for said edge fadeout shutteris adjusted so that said machine makes test copies having the desiredcopy quality.
6. The method according to claim 5 including the stepsof:(a) during said preset machine servicing routine and while saidmachine is making said test copies, addressing the location in saidmemory means where the current location data for said edge fadeoutshutter is stored; and (b) replacing the current location data for saidedge fadeout shutter with the adjusted location data for said edgefadeout shutter in said memory means. | 2024-03-22 | 1983-08-26 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1985-11-19"
} |
US-1668898-A | Assembly using an abrasive strip to machine a cylindrical bearing surface of a workpiece
ABSTRACT
A machining assembly consisting of first and second pivotal jaws opposing each other. A clamping arrangement is provided for clamping the jaws and to apply a flexible strip of abrasive material against the machined surface. The first jaw containing a shoe element having a rigid pressure surface. The second jaw carries two reaction members. The second jaw presses the strip of abrasive material against the bearing surface. The second jaw carries two measuring tips movably mounted thereon for measuring the bearing surface. A displacement arrangement for separating the measuring tips apart when said jaws are unclamped and bringing these tips together when said jaws are clamped.
BACKGROUND OF THE INVENTION
The present invention relates to an assembly using an abrasive strip tomachine a cylindrical bearing surface of a workpiece, especially ajournal and/or wrist pin of a crankshaft, of the type comprising twoopposed jaws which can be clamped against the bearing surface to bemachined in order to apply an abrasive strip against the latter whilethe workpiece is rotated.
Assemblies of this type are known, for example, from Utility Model DE 8601 817. According to this document, each jaw carries two shoes forapplying the abrasive strip, which are mounted elastically on the jawand each extending over an angle of between 15 and 45° of thecircumference of the bearing surface to be machined. This machiningassembly has numerous drawbacks among which mention may be made, inparticular, of the poor distribution of pressure over the four shoes,the limited angle of contact of the shoes, and therefore of the abrasivestrip, with the bearing surface to be machined, and hence the fact thatit is impossible to carry out machining which yields not only a goodsurface finish but also compensates for any defects in the shape of thebearing surface, and the absence of built-in means of checking thediameter of the bearing surface during machining.
Document FR-A-2 702 693 (=U.S. Pat. No. 5,522,762) discloses a machiningassembly that involves three shoes for applying the abrasive strip, eachextending over an angle of between 60° and 120° and arranged more orless at the three vertices of an equilateral triangle. This machiningassembly, despite the advantages it yields over an assembly with fourapplication shoes, is still not satisfactory as regards compensation fordefects in the shape of the bearing surface to be machined.
Document FR-A-2 719 516 (=U.S. Pat. No. 5,651,719) relates to amachining assembly which employs the overall structure of the assemblyaccording to the previous document, but is equipped with means ofchecking the diameter of the bearing surface while it is being machined.
Nevertheless, these known machining assemblies are unable fully to meetall the requirements imposed at the present time as regards inparticular the machining of the journals and wrist pins of motor vehicleengine crank shafts.
The present invention is aimed at an assembly that uses an abrasivestrip to machine a cylindrical bearing surface of a workpiece,especially a journal and/or a wrist pin of a crankshaft, which assembly,while being of a simple structure, optimally meets the requirementsimposed in this field, from the machining precision point of view andthat of compensating for defects in shape. The invention is also aimedat an assembly that uses abrasive strip to machine a cylindrical part ofa workpiece, incorporating built-in means for checking the diameter ofthe bearing surface during machining.
The machining assembly in accordance with the invention that uses anabrasive strip to machine a cylindrical bearing surface of a workpiece,especially a journal or wrist pin of a crankshaft, comprises two opposedjaws which can be clamped against the bearing surface to be machined inorder to press an abrasive strip against the latter as the workpiece isrotated. A first one of said jaws carries a shoe which has a rigidconcave bearing surface in the shape of a sector of a cylinder of ashape that matches that of the bearing surface to be machined, withmeans for immobilizing an abrasive strip relative to said bearingsurface during machining. The second jaw carries two reaction surfacesor pads spaced apart in the circumferential direction of the bearingsurface to be machined and directed parallel to the bearing surface tobe machined. The layout of the shoe of the first jaw and of the tworeaction pads of the second jaw is such that when the jaws are clampedon the bearing surface to be machined, the shoe presses the abrasivestrip against the bearing surface to be machined over a circumferentialangle which is preferably between 120° and less than 180° and the tworeaction pads are pressed directly against the bearing surface to bemachined along two generatrices of the latter which are spaced apart bya circumferential angle which is preferably between 60° and 120°.
Within the context of the invention, the abrasive strip may beimmobilized with respect to the bearing surface of the shoe by adhesive,the strip being stuck to the bearing surface, or preferably bycontrolled clamping means arranged on either side of the shoe, as closeas possible thereto, which allows the abrasive to be renewed simply bymoving the strip on between two machining operations.
The two reaction pads may be shoes, but in order to reduce the frictionof the reaction pads on the bearing surface to be machined, it isadvantageous for use to be made of two rollers mounted on the second jawso that the axes of the rollers are parallel to the axis of the bearingsurface to be machined.
Still with a view to reducing the friction of the reaction pads on thebearing surface to be machined, the reaction pads may have axialmobility with respect to their jaw. Thus, the reaction pads may, byfriction, participate in the oscillatory movement in terms of axialtranslation that the bearing surface undergoes, in a way known per se,in addition to its rotation, while it is being machined by abrasivestrip.
The machining assembly according to the invention may further comprisebuilt-in means of checking the diameter of the bearing surface while itis being machined. In this case, in addition to the two reaction pads,the second jaw carries two measuring pads mounted so that they can moveon the second jaw in such a way that they can be moved apart and broughtcloser together so as to be pressed, in the machining position, indiametrically opposed positions, against the bearing surface to bemachined. The second jaw further advantageously comprises means formoving the two measuring pads apart when the jaws are not clamped andfor bringing them closer together when the jaws are clamped.
Within the context of the invention, said means for moving the twomeasuring pads apart and bringing them closer together may be actuateddirectly by the opening and closing movement of the jaws, oralternatively be controlled as a function of this movement for partingthem and bringing them closer together.
Two illustrative and nonlimiting embodiments of an assembly inaccordance with the invention for machining using an abrasive strip willbe described in greater detail below with reference to the appendeddiagrammatic drawing; in the drawing:
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows a first embodiment of an assembly of the invention adaptedfor use on a workpiece having substantially horizontal orientation; and
FIG. 2 shows a second embodiment of the invention adapted for use on aworkpiece having substantially vertical orientation;
FIG. 3 is a view according to the directional arrow III of FIG. 2.
DESCRIPTION OF THE PREFERRED EMBODIMENT
As illustrated in FIG. 1, a cylindrical bearing surface 1 of a workpieceis machined using an abrasive strip by means of a machining assemblywhich may form part of a machine tool comprising a number of assembliesfor simultaneously machining a number of bearing surfaces on the sameworkpiece, for example a number of journals and/or wrist pins of acrankshaft. For further details regarding the overall structure andfunction of a machine of this kind, it is possible to refer, forexample, to document FR-A-2 636 877 (U.S. Pat. No. 5,058,325).
The assembly essentially comprises a first jaw 3 which is mounted sothat it can pivot about an axle 2, and a second jaw 5 which is mountedso that it can pivot about a horizontal axis 6 on the first jaw 3, theassembly being balanced by a balancing ram 4. It is illustrated in FIG.1 that a ram or cylinder 7 clamps the jaws by raising the lower jaw 5about its pivotal area 6. Upon clamping of the jaws, the ram or cylinder9 acts on a wedge-shaped ramp 8. In turn, the ram 8 engages awedge-shaped upper portion of the lower jaw 5. Such engagement preventslowering or unclamping the lower jaw 5 until machining of the bearingsurface is completed. This in particular makes it possible to improvethe geometry of the bearing surface, it being impossible for the jaws topart in order to "negotiate" defects in the shape of the bearing surfaceduring machining.
The first jaw 3 carries a shoe 10 which, on the side facing toward thebearing surface 1 to be machined, has a rigid concave bearing surface 11in the shape of a sector of a cylinder of a shape that matches that ofthe bearing surface 1 to be machined, the axial length of the bearingsurface 11 being shorter than the axial length of the bearing surface 1to be machined. By way of example, the shoe 10 may be made of steel, thebearing surface 11 being precision ground. In the example depicted, thebearing surface 11 in the shape of a sector of a cylinder extends over acircumferential angle of about 130°.
On either side of the shoe 10, the jaw 3 carries a device 12 forclamping an abrasive strip 13 which, paid out from a supply 14 passesvia the first clamping device 12, over the bearing surface 11 of theshoe 10, via the second clamping device 12 and from there onto awinding-on device 15.
The second jaw 5 carries a reaction support 16 which has a shape thatmore or less corresponds to that of the shoe 10 of the first jaw 3, butcomprises two reaction rollers 17 mounted so that they can rotate on thesupport 16, their axes being parallel to the axis of the bearing surface1 to be machined, so that the two rollers 17 protrude somewhat from theconcave surface in the shape of a sector of a cylinder exhibited by thesupport 16 on the side facing toward the bearing surface 1. In theexample depicted, the two rollers 17 have a diameter smaller than thediameter of the bearing surface 1 and are mounted on the support 16 insuch a way that when the two jaws 3 and 5 are clamped against thebearing surface 1, the two rollers 17 are applied directly against thebearing surface 1 along two generatrices of the latter which are spacedapart by a circumferential angle of the order of 90°.
The jaw 5 further carries two measuring pads 18 which are fixed, oneither side of the reaction support 16, on axles 19 parallel to the axisof the bearing surface so that they can be moved apart and broughttogether in order to be pressed, in diametrically opposed positions,against the bearing surface 1 to be machined.
The machining assembly as illustrated in FIGS. 2 and 3 has an overallstructure which corresponds to that of the machining assemblies of themachine according to document FR-A-2 636 877 (=U.S. Pat. No. 5,058,25).
Two jaws 103 and 105 are mounted so that they can pivot about axes 101and 102 on a common support 100, the assembly being balanced by a ram104. The layout is chosen so that the jaws 103 and 105 can be movedapart and brought together with a view to clamping against the bearingsurface 1 to be machined by movement of the jaws 103 and 105 in a planesubstantially perpendicular to the vertical orientation of theworkpiece. In the embodiment of FIG. 1, the jaws 3 and 5 are moved in aplane substantially perpendicular to the horizontal orientation of theworkpiece. These movements are controlled by a ram 107 acting on the jaw103, the two jaws 103 and 105 being coupled by pinions 106. A lockingsystem comprising a ramp 108 which interacts with the jaw 105 under theaction of a ram 109 is provided for locking the two jaws 103 and 105irreversibly in the clamped position.
The first jaw 103 carries a shoe 110 which, on the side facing thebearing surface 1 to be machined, has a rigid concave bearing surface111 in the shape of a sector of a cylinder of a shape that matches thatof the bearing surface 1 to be machined.
On either side of the shoe 110, the jaw 103 carries a device 112 forclamping an abrasive strip 113 which, paid out from a supply, notdepicted, passes via the first clamping device 112, over the bearingsurface 111 of the shoe 110, via the second clamping device 112 and isthen rewound onto a winding-on device, not depicted.
The second jaw 105 consists of two part jaws 105a and 105b juxtaposed(see, in particular, FIG. 3). The part jaw 105a is coupled (pinions 106)to the jaw 103, while the part jaw 105b is driven by the jaw 105a,passing via a spring 114.
The part jaw 105a carries a reaction support 116 comprising two reactionrollers 117 mounted so that they can rotate on the support 116, theiraxes being parallel to the axis of the bearing surface 1 to be machined.The two rollers 117 are spaced apart in such a way as to be pressedagainst the bearing surface 1 to be machined along two generatricesthereof which are spaced apart by a circumferential angle smaller than90°, in this case an angle of the order of 75°.
The part jaw 105b carries two measuring pads 118 mounted so that theycan be pivoted about axes 119 parallel to the axis of the bearingsurface 1 so as to be parted from one another and brought closertogether with a view to them being applied, in diametrically opposedpositions, against the bearing surface 1 to be machined. The movementsof parting the reaction pads 118 and bringing them closer together againare produced by actuating means 120 controlled as a function of theclamping and unclamping movement of the jaws 103, 105. A similaractuating means is provided for the embodiment of FIG. 1. This actuatingmeans is provided for separation of the pads or measuring tips 18 bypivoting about the axles 19 when the jaws 3 and 5 are not clamped andbringing the pads 18 closer together when the jaws are clamped. Theactuating means can be activated directly by the opening and closingmovement of the jaws.
Furthermore, the support 100 caries a stop 121 against which the partjaw 105b, driven by the part jaw 105a, will bear when the two jaws 103,105 are clamped, the stop 121 thus defining the position in which thetwo measuring pads 110 will press against the bearing surface 1 to bemachined.
This ensures that the measuring pads 118 carried by the part jaw 105bare independent of the reaction support 116 carried by the part jaw105a, and makes it possible accurately to adjust the position of themeasuring pads 118 in such a way that the latter lie exactly across thediameter of the bearing surface 1 to be machined, when they are incontact therewith.
It goes without saying that the embodiments depicted and described havebeen given merely by way of illustrative examples and that numerousmodifications and alternative versions are possible within the scope ofthe invention. This goes not only for the overall structure of themachining assembly, but also, for example, for the angle over which theabrasive strip 13, 113 is pressed against the bearing surface 1 by theshoe 10, 110 of the first jaw 3, 103, which angle is advantageouslybetween about 120° and less than 180°, and for the angle separating thetwo generatrices along which the reaction rollers 17, 117 contact thebearing surface 1, it being possible for this angle preferably to bebetween about 60° and 120°.
Furthermore, the rollers 17, 117 could be replaced by bearing surfacesor non-rotating pads, in the form of shoes, although rollers do make itpossible to reduce the friction with the bearing surface 1 duringrotation.
It should also be pointed out that the reaction rollers 17, 117 (or thenon-rotating reaction pads) may be able to move in terms of axialtranslation relative to the jaw 5, 105, this being in order to allowthem to follow the oscillatory movement in terms of axial translationexperienced by the bearing surface 1 as it is machined by the abrasivestrip 13, 113, in addition to its rotation, as is well known in abrasivemachining, particularly superfinishing. Another possibility would be tomake it possible for the jaw 5, 105 to move axially relative to the jaw3, 103, and to contrive for it to "dig into" the crankshaft, between thetwo parts that delimit the bearing surface 1 to be machined, so that therollers 17, 117 would be driven directly by the workpiece to be machinedin its oscillatory movement of axial translation.
Finally, the abrasive strip 13, as depicted in FIG. 1, instead of beingpaid out from a supply 14 and immobilized by the clamping devices 12 onthe bearing surface 11 of the shoe 10, could just as easily, forexample, be an abrasive strip with one adhesive face so that it can beimmobilized by sticking to the bearing surface 11.
We claim:
1. A machining assembly utilizing a strip of an abrasivematerial for machining cylindrical bearing surfaces, comprising:firstand second pivotal jaws opposing each other; a flexible strip of anabrasive material; clamping means for clamping said jaws at a bearingsurface to be machined, so as to apply said strip of the abrasivematerial against said bearing surface while said bearing surface isrotated about its longitudinal axis; said first jaw containing a shoeelement with a substantially rigid pressure surface, said pressuresurface having a concave configuration substantially repeating a sectorof the bearing surface to be machined; said second jaw carrying tworeaction members extending substantially parallel to the axis of saidbearing surface to be machined, said reaction members are spaced apartin the circumferential direction from said bearing surface in such amanner that said first and second jaws are clamped on said bearingsurface; said shoe element presses said strip of abrasive materialagainst said bearing surface, said reaction members are pressed againstsaid bearing surface; two measuring tips for measuring said bearingsurface movably mounted on said second jaw in such a manner that saidmeasuring tips are moved apart and brought closer together to be appliedat diametrically opposed positions against said bearing surface; anddisplacement means for moving said two measuring tips in such a mannerthat said tips are spaced from said bearing surface when said jaws areunclamped and are brought together and applied against said bearingsurface when said jaws are clamped.
2. The assembly according to claim1, wherein said reaction members are rollers each having an axis ofrotation substantially parallel to the axis of said bearing surface. 3.The assembly according to claim 2, wherein said reaction rollers have adiameter smaller than the diameter of said bearing surface.
4. Theassembly according to claim 2, wherein said reaction rollers are movablealong their axes with respect to said second jaw.
5. The assemblyaccording to claim 2, wherein said second jaw comprises a first portioncarrying said reaction members and a second portion carrying saidmeasuring tips, said second portion is driven by said first portion bymeans of a spring in the direction of clamping of said jaws, theassembly further comprising a stop member for said second portiondefining with respect to the bearing surface to be machined a positionin which the measuring tips when brought closer together are appliedagainst the bearing surface in the clamped position of the jaws.
6. Theassembly according to claim 1, comprising a locking device adapted forlocking the first and second jaws in the clamped position.
7. Theassembly according to claim 1, wherein said concave pressure surface ofthe shoe element is in the shape of a sector of a cylinder extendingover a circumferential angle between 120° and 180°.
8. The assemblyaccording to claim 1, wherein said reaction members are pressed directlyagainst said bearing surface along two sides of a sector, said sides arespaced apart by a circumferential angle extending between 60° and 120°. | 2024-03-22 | 1998-01-30 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1999-11-16"
} |
US-14968761-A | Apparatus for freeze concentration
Nov. 24, 1964 s. KLENCKE 3,153,004
APPARATUS FOR FREEZE CONCENTRATION Filed Nov. 2, 1961 3 Sheets-Sheet lEVAPORATOR J3 FRESHWATER COMPRESSOR wkewra/P B MW Ahomeys Nov. 24, 1964s. KLENCKE 3,158,004 APPARATUS FOR FREEZE CONCENTRATION Filed Nov. 2,1961 3 Sheets-Sheet 2 3 Sheets-Sheet 3 Filed Nov. 2, 1961 United StatesPatent 3,158,004 APPARATUS FUR FREEZE CGNQENTRATKEN Siegfried Kiencke,33 Stuclrenhorstel uher Rotenhurg, Hannover, Germany Filed Nov. 2, 1961,Ser. No. 149,687 7 Claims. (Cl. 62-424} The present invention relates tothe freeze concentration of aqueous liquids containing solids, moreparticularly, to an apparatus for the freeze concentration of liquidscontaining solids wherein the liquids are circulated through anevaporator under the action of centrifugal force produced by rotation ofthe evaporator.
In the freeze concentration of liquids containing solids the water inthe liquids is frozen into ice crystals and subsequently removedtherefrom. The removal of the water in the form of ice crystals resultsin a greater percentage of solids in the liquid and accordingly aconcentration thereof. In most such processes the freezing of the waterinto ice crystals comprises one phase and the removal of the icecrystals from the liquid by suitable means comprises a second phase.Since these two phases must generally be carried out in sequence andwith difierent forms of apparatus, the above-described processes havethe great disadvantage that they must be conducted in two separateoperations.
It is therefore the principal object of the present invention to providea novel and improved apparatus for the continuous freeze concentrationof liquids containing solids.
It is a further object of the present invention to provide an apparatusfor the freeze concentration of liquids containing solids wherein thewater can be frozen into ice crystals and the ice crystals removed fromthe liquid concurrently.
The present invention discloses an apparatus which is suitable for usewith many different forms of liquids containing solids such as fruitjuices, vegetable juices, milk, beer, wine, drugs, chemicals, and seawater.
The apparatus of the present invention essentially comprises a casingwhich is rotatable about a vertical axis and has a refrigerating systemincluding a compressor mounted on the bottom thereof. Verticallyarranged within the casing is a plurality of hollow annular bodies whichdefine therebetween a plurality of vertically positioned annular spaces.The hollow annular bodies are connected to the refrigerating system insuch a manner that the inner portions of the hollow bodies function ascondensers and the outer portions of the hollow bodies function asevaporators. The portions of the hollow bodies defining the evaporatorscomprise the freezing surfaces of the freezing zones of the apparatus.
A plurality of vertical tubes connects the outer ends of the condenserswith a vertical tube in the center of the assembly for withdrawingmelted ice crystals from the condensers.
The liquid concentrate is withdrawn from the outer ends of theevaporators through a plurality of vertical tubes connected thereto.
A plurality of vertical tubes is connected to the inner ends of theevaporators for introducing the liquid into the freezing chambers. Theincoming liquid is passed in heat-exchange relationship with the meltedice crystals so that the liquid is precooled prior to entering theevaporator.
A freely rotating vane assembly may be positioned adjacent the freezingsurfaces of the evaporators so as to scrape accumulations of icecrystals therefrom. The accumulation of ice crystals from these freezingsurfaces can be periodically removed in other ways as will be presentlydescribed.
In this invention the incoming liquid is introduced into the inner endsof the evaporators after having been precooled by passing in counterfiowto the melted ice crystals being withdrawn from the unit. As the liquidflows outwardly through the annular spaces comprising the evaporators,the water in the liquid is frozen into ice crystals. The resultingliquid concentrate which is of a greater density than the ice crystalsis pushed radially outwardly under the action of centrifugal force. Thismovement outwardly of the heavier liquid concentrate tends to force theice crystals radially inwardly. The ice crystals move radially inwardlyuntil they reach the condensers wherein they are melted. The waterresulting from the melting of the ice crystals is then withdrawn fromthe outer edges of the condensers. 7
Some of the water will flow radially outwardly from the condensers intothe evaporators where it will be refrozen into ice crystals. The sameprocedure will then be followed and the ice crystals will returnradially inwardly to be melted and subsequently withdrawn from theassembly. The water flowing radially outwardly from the condensers willserve to wash some of the liquid which has adhered to the ice crystals.This washing will occur since the water will be moving radiallyoutwardly while the ice crystals will be moving radially inwardly.
Other objects and advantages of this invention will be apparent uponreference to the accompanying description when taken in conjunction withthe following drawings, wherein FIGURE 1 is a vertical sectional view ofthe apparatus of the present invention;
FIGURE 2a is a transverse sectional view of the apparatus as shown inFIGURE 1, taken through the hollow annular members;
FIGURE 2b is a transverse sectional view of the apparatus of FIGURE 1,taken through the annular spaces; and
FIGURE 3 is a transverse sectional view of the apparatus shown in FIGURE1, taken through the heat exchanger in the upper portion of theapparatus.
A specific embodiment of the apparatus of this invention and a specificexample of the process of this invention will next be described indetail with reference to the drawings wherein like reference symbolsindicate the same parts throughout the various views.
Proceeding next to FIGURE 1 there is illustrated an assembly of hollowannular members 1 which are positioned vertically with respect to eachother so as to define a plurality of vertically arranged spaces. Eachplate 1 comprises an inner portion 2 and an outer portion 3 separated bya heat-insulating portion 4.
The inner portions 2 of adjacent annular plates form condensers 5 andadjacent outer portions 3 form evaporators 6. The condensers andevaporators 5 and 6 are connected to a compressor 7 mounted on thebottom of the plate assembly. The pistons for the compressor 8 aremounted on a crank 9 which is either stationary or rotates in adirection opposite to the direction of rotation of a V-pulley 10 whichis connected by a V-driving belt to a motor. This V-belt connectionprovides for a rapid rotation of the assembly of annular plates with therotary speed depending on the liquid which is to be treated by theapparatus.
A stufiing box 11 may be positioned below the pulley 8.
In the center of the assembly there is a vertical tube 12 which receivesrefrigerant from the compressor. The tube 12 communicates with the innerends of the hollow members so as to deliver a refrigerant to thecondensers. The refrigerant flows through the condensers and through therestricted openings 13' to the evaporators and is returned to thecompressor through the return line 13.
A stationary frame member 14 supports a supply line "greases throughwhich the liquid which is to be treated is introduced into theapparatus. A plurality of vertical tubes 16 have their upper endsconnected to a chamber 17 into which the incoming liquid is received.The tubes 16 have openings 18 into the inner ends of each of theevaporator spaces.
At the outer ends of each of the evaporator spaces 6 are vertical tubes19 which communicate with the outer ends of the evaporators throughopenings 20. The vertical tubes 19 are connected to an annular chamber21 from which liquid is picked up by a stationary arm 22 from openings23 in the chamber 21. The hollow arm 22 is then mounted on the framemember 14 and opens into a reservoir 24. This arrangement provides forthe passage of liquid into the hollow arm 22 when the assembly of platesis rotating.
There is another plurality of vertical tubes 25 located at the outerends of each of the condensers 5 and communicating therewith throughopenings 26. The vertical tubes 25 are connected to chambers 27 whichare positioned in heat-exchange relationship with the chamber 16' so asto form a heat exchanger whose function will be presently described. Thechambers 27 then communicate with an annular member 28 having aplurality of openings 29 on the inner face thereof. The openings 29communicate with a fixedly mounted hollow arm 30 which is positioned onthe frame member 14. The hollow arm 30 communicates with a vertical tube31 mounted in the center of the assembly. Liquid passing down throughthe tube 31 then flows radially outwardly through tubes 32 and isdischarged at 33.
Due to centrifugal force brought about by rotating the assembly, a layerof liquid builds up on the inner side of the wall having the opening 29.This layer of liquid is picked up by the hollow arm 30. Likewise, alayer of liquid builds up on the inner side of the wall having theopenings 23, and is picked up and carried away by the hollow arm 22.
While not illustrated in the drawings, which are primarily schematic, afreely rotating vane assembly is provided adjacent the surfaces 3 in theevaporators 6. These vanes are closely adjacent to the surfaces in orderto scrape accumulations of ice crystals therefrom.
As an alternative to this ice-removing structure ultrasonic vibrationsmay also be applied to the freezing surfaces in order to prevent theformation of ice thereon. This can be done in a known manner.
In carrying out the process of the present invention the refrigerant iscompressed in the compressor 7 and then passed through the verticaltubes 12 into the condensers 2 where it is condensed. Suitable controlvalves may be provided in the portions 4 to regulate the flow ofrefrigerant into the evaporators 6 where the refrigerant is evaporatedand extracts heat from the surrounding area. The refrigerant is thenreturned to the compressor through the return line 13.
The liquid which is to be concentrated is introduced into the apparatusthrough the supply line 15, passes through the heat exchanger 17 anddownwardly into the vertical tube 16 where it enters the inner ends ofthe evaporators 6. As the liquid flows radially outwardly through theevaporators 6 under the action of centrifugal force, the water in theliquid is frozen into ice crystals because of the evaporation of therefrigerant in the annular pla.e portions 3. As described above,suitable means are provided to prevent the accumulation of ice crystalson the freezing surfaces.
As ice crystals are formed in, the liquid, the water is removedtherefrom and the remaining liquid concentrate has a heavier densitythan the ice crystals. Accordingly, the liquid concentrate is urgedradially outwardly through the evaporators and this movement forces theice crystals radially inwardly.
The ice crystals pass radially inwardly into the condenser areas 5 wherethe ice crystals are remelted. The
water resulting from melted ice crystals, together with some icecrystals, is then urged radially outwardly into the openings 26, upthrough the vertical tubes 25 and into the spaces 27 where it passes inheat-exchange relationship with the incoming liquid. This heat-exchangerelationship provides for a precooling of the incoming liquid by the icewater and ice crystals removed from the condenser.
A small portion of the water resulting from the melted ice crystals willagain flow into the evaporators. This water will be refrozen into icecrystals and will be circulated inwardly as described above.
In addition, the water from the ice crystals which does flow into theevaporators functions to wash the liquid clinging to the ice crystalswhich are being urged radially inwardly into the condenser. Accordingly,the ice crystals entering the condenser 5 have very little liquid.adhering thereto.
The liquid concentrate which flows radially outwardly through theevaporator 61 is gathered into the vertical pipes 19 where it flowsupwardly and then radially inwardly to the annular chamber 21 where itis picked up by the hollow arm 22 and delivered into a reservoir 24.
The centrifugal force of the liquid contained in the condensers 5 andevaporators 6 will be forcing the liquid concentrate upwardly throughthe tubes 19 and radially inwardly to the chamber 21. Since the chamber21 is spaced further from the center of the assembly of annular platesthan the inner ends of the condensers 5, it will be apparent that thecentrifugal force of the liquids in the evaporators and condensers willbe sufficient to urge the liquid concentrate to flow radially inwardlyto the annular chamber 21.
If the above-described apparatus and process is applied to the desaltingof sea water, then the process is carried out in the same manner but theconcentrate which would be received in the reservoir 24 would representsalt and other minerals in the sea water while the water discharged at33 would represent the purified sea water.
it is also possible to avoid the accumulation of ice crystals on thefreezing surfaces of the evaporators by recirculating a small portion ofthe liquid concentrate onto the freezing surfaces. Accordingly, therotation of the annular members will form a thin film of the concentrateon the freezing surfaces which thin film will comprise a separatinglayer between the entering unconcentrated liquid and the freezingsurfaces.
In addition, the concentrate may be recirculated into the centerportions of the evaporators so as to precool the liquid entering theevaporators. Thus, portions of water in the entering liquid will befrozen into ice crystals before the liquid actually contacts thefreezing surfaces of the evaporators.
In addition, an oil which is neutral to the liquid being concentratedmay be used as a heat-transmitting medium. Thus, the freezing in theliquid could be initiated in the center portion thereof, thus preventingice crystals from accumulating along the freezing surfaces of theevaporators.
It is pointed out that while a piston compressor has been illustrated,other compressors such as turbocompressors may readily be used in thisinvention.
The above-described apparatus is operated without any special provisionbeing made for a coolant. The condensers 5 are cooled by the melted iceand the remaining solvent water after concentration of the liquid.However, in certain applications the apparatus can be supplied withcooling water which can be conducted into the melted ice and solventwater which is being removed before this melted ice and solvent waterabsorbs the latent heat of the freezing mixture in condensers 5.
A specific example of the process of the present invention will next bedescribed. It should be borne in mind that this example is forillustrative purposes only and in no way is to be construed as limitingthe invention.
EXAMPLE I Apple juice having a solids content of 13% and at atemperature of C. is concentrated at the rate of 3000 liters per hour.The apple juice is introduced through the supply line 15 into the heatexchanger 17 wherein it is.
precooled to 04 C. The apple juice then flows through the vertical tube16 and the openings 18 into the evaporators and enters the evaporatorsat this temperature of 0.4 C.
The liquid initially entering the evaporators 6 contacts ice crystals incounterfiow thereto. Thus, the initial zones of the evaporators 6 aremaintained at a temperature of -2 C. at with 30% of the water is frozenout according to the Mollier diagram for fruit and vegetable juices(German Association of Cold Technology Work Sheet 8-02 according to L.Riedel, Cold Technology 2 (1950), No. 8, page 201).
As the apple juice flows radially outwardly through the evaporator 6,the temperature progressively decreases to C. At this point, the solidscontent is 64% as compared with the initial solids content of 13% whichcomprises a reduction of 1:5.
A uniform temperature of 2S C. is maintained in the evaporators.
Reference to the accompanying table will show the percentages of solidsremaining and the portion of Water being removed in the form of ice inthe various temperature zones of the evaporators. I
The concentrate emerges from the evaporators 6 at a temperature of 20 C.and is passed in counterfiow with the incoming apple juice so that thetemperature of the concentrate is increased to 13 C. and the incomingapple juice is cooled from 15 C. to 8.4 C. In this heat-exchange about20,000 kcal. are available for cooling the incoming juice.
At the same time, 2400 liters of ice Water are flowing through the heatexchanger 17 in counterflow with the incoming apple juice so that thetemperature of this water is increased from 0 C. to 10 C. while theincoming apple juice is further reduced in temperature from 8.4 C. to 04C. About 24,000 kcal. are available at this point for this furthercooling of the apple juice. The apple juice then enters the freezingchambers or evaporators through the tubes 16 at a temperature of 04 C.
Additional cooling water can be introduced into the axial tube 18 inorder to prevent the temperature of the cooling water from increasing tosuch a degree as described above. The added cooling water would have atemperature of 10 C. and an outlet temperature of C. so that the 51,600kcal. of equivalent heat would have to be discharged with an additional1,000 liters of water.
The assembly of annular plates is rotated at 120 revolutions per minuteso that the value for g in the peripheral zone of the evaporators is 10times. Accordingly, the difference of the specific gravity between theconcentrate and the ice is increased from 0.4 to 4.0. The concentratehas a specific gravity of 1.3 and the ice has a specific gravity of 0.9so that the difference therebetween would be 0.4.
The propulsion output is 60 kwh. which is based on the difference intemperature between 25 C. in the evaporator and the temperature of thecooling water of 31 C. to-
gether with the melting of 2,400 kg. of ice. The computation is carriedout by using the Carnot cycle at an efficiency of about 75% It is alsopointed out that the water which is gathered by the hollow arm has anexcess heat of 51,600 kcal. which equals 60 kwh. The temperature of thiswater increases from 10 C. to 31 C.
The outer diameter ofthe annular plates is about 1.2 meters and thereare ten annular plates so that twenty freezing surfaces are provided inthe evaporator 5. The
area of this freezing surface is 10 m.
Based on the uniform temperature of 25 C. main tained in theevaporators, the various temperature differences (d,) as set forth inthe accompanying table, will be present at the various temperature zonesin the evaporator. m. -k represents the freezing surface multiplied bythe coefiicient of heat transmission. This can be computed from thequantity of ice frozen out in any temperature zone multiplied by theheat of fusion or the heat of fusion of solidification respectively,divided by the difference in temperature in the respective temperaturezone. The total required freezing surface for the evaporators is the sumof all of the above-mentioned values at the various temperature zonesdivided by the coefiicient of heat transmission in rotatingheat-exchanging surfaces. Addition of the m. 'k values gives 9991 whichmust be divided by :the k value of 1,000 kcal. per h. per m? per C.Using an approximation of 10,000, division by the k value of 1,000 willresult in a required freezing area of about 10 mf Table I Per- Tcmpera-Concen- Per- Water cent of Ice ture In trate cent (liters) Ice (liters)d mfi-l Evap. (liters) solids and water Total. 9, 991
Thus it can be seen that the present invention has provided a simple andefficient apparatus for the continuous freeze concentration of liquidscontaining solids.
It will be understood that this invention is susceptible to modificationin order to adapt it to different usages and conditions and,accordingly, it is desired to comprehend such modifications within thisinvention as may fall within the scope of the appended claims.
What is claimed as this invention is:
1. An apparatus for the freeze concentration of aqueous liquidscontaining solids, and comprising an assembly of hollow annular membersspaced vertically above each other to define a plurality of verticallyarranged annular spaces and a refrigerating system connected to saidhollow annular members for circulating a refrigerant therethrough sothat the inner portions of said annular spaces define condensers and theouter portions thereof define evaporators, a vertical tube in the centerof said assembly of annular members, means on the outer ends of saidcondensers and connected to said vertical tube for withdrawing icecrystals and melted ice crystals from said annular spaces, a pluralityof tubes in said vertical tube and connected with said refrigeratingsystem, means connected to said plurality of tubes for circulating arefrigerant through said condensers and evaporators and returning therefrigerant to the refrigerating system, means for introducing anaqueous liquid containing solids into the inner ends of saidevaporators, means on the outer ends of said evaporators for withdrawingliquid concentrate therefrom, and means for rotating said assembly ofannular members. p
2. An apparatus for the freeze concentration of aqueous liquidscontaining solids, and comprising an assembly of hollow disks spacedvertically above each other to define a plurality of vertically arrangedannular spaces alternating disks defining refrigerant circuit andaqueous liquid paths, respectively, a casing enclosing said assembly of7 disks, and a refrigerating system including a compressor mounted onthe bottom surface of said casing and connected to the inner and outeredges of said disks in the refrigerant circuit by vertical tubes forcirculating a refrigerant therethrough so that the inner portions ofsaid annular spaces define condensers and the outer portions thereofdefine evaporators, and means for rotating said assembly of disksandvertical tubes intermediate the center and outer extremity of theaqueous liquid disks for admitting sea water and removing pure water.
3. An apparatus for the freeze concentration of aqueous liquidscontaining solids, and comprising an assembly of hollow annular membersspaced vertically above each other to define a plurality of verticallyarranged annular spaces, a refrigerating system connected to said hollowannular members for circulating a refrigerant therethrough so that theinner portions of said annular spaces define condensers and the outerportions thereof define evaporators, control valves in said annularmembers between said condensers and evaporators to control the flow ofrefrigerant from said condensers to said evaporators, a vertical tube inthe center of said assembly of annular members, means on the outer endsof said condensers and connected to said vertical tube for withdrawingice crystals and melted ice crystals from said annular spaces, aplurality of tubes in said vertical tube and connected with saidrefirgerating system, means connected to said plurality of tubes forcirculating a refrigerant through said condensers and evaporators andreturning the refrigerant to the refrigerating system, means forintroducing an aqueous liquid containing solids into the inner ends ofsaid evaporators, means on the outer ends of said evaporators forwithdrawing liquid concentrate therefrom, and means for rotating saidassembly of annular members.
4. An apparatus for the freeze concentration of aqueous liquidscontaining solids, and comprising an assembly of hollow annular membersspaced vertically above each other to define a plurality of verticallyarranged annular spaces, a refrigerating system connected to said hollowannular members for circulating a refrigerant therethrough so that theinner portions of said annular spaces define condensers and the outerportions thereof define evaporators, a vertical tube in the center ofsaid assembly of annular members, means on the outer ends of saidcondensers and connected to said vertical tube for withdrawing icecrystals and melted ice crystals from said annular spaces, a pluralityof tubes in said vertical tube and connected with said refrigeratingsystem, means connected to said plurality of tubes for circulating arefrigerant through said condensers and evaporators and returning therefrigerant to the refrigerating system, a plurality of vertical tubesconnected to the inner ends of said evaporators to introduce an aqueousliquid containing solids therein, a plurality of vertical tubesconnected to the outer ends of said evaporators to withdraw the liquidconcentrate therefrom, and means for rotating said assembly of annularmembers.
5. An apparatus for the freeze concentration of aqueous liquidscontaining solids, and comprising an assembly of hollow annular membersspaced vertically above each other to define a plurality of verticallyarranged annular spaces, a refrigerating system connected to said hollowannular members for circulating a refrigerant therethrough so that theinner portions of said annular spaces define condensers and the outerportions thereof define evaporators, means for rotating said assembly ofannular members, a vertical tube in the center of st id assembly ofannular members, a plurality of vertical tubes connected to the outerends of said condensers, a plurality of tubes in said vertical tube andconnected to said refrigerating system, means connected to saidplurality of tubes in said vertical'tube for circulating a refrigerantthrough said condensers and evaporators and returning the refrigerant tothe refrigerating system, means for introducing a liquid containingsolids into the inner ends of said evaporators, means on the outer endsof said evaporators for withdrawing liquid concentrate therefrom, andmeans connected between said vertical tubes and said vertical tube forWithdrawing ice crystals and for passing said melted ice inheat-exchange relationship with the liquid prior to introducing theliquid into the evaporators to precool the liquid.
6. An apparatus for the freeze concentration of aqueous liquidscontaining solids, and comprising an assembly of hollow annular membersspaced vertically above each other to define a plurality of verticallyarranged annular spaces and a refrigerating system connected to saidhollow annular members for circulating a refrigerant therethrough sothat the inner portions of said annular spaces define condensers and theouter portions thereof define evaporators, a vertical tube in the centerof said assembly of annular members, means on the outer ends of saidcondensers and connected to said vertical tube for withdrawing icecrystals and melted ice crystals from said annular spaces, a pluralityof tubes in said vertical tube and connected with said refrigeratingsystem, means connected to said plurality of tubes for circulating arefrigerant through said condensers and evaporators and returning therefrigerant to the refrigerating system, means for introducing anaqueous liquid containing solids into the inner ends of saidevaporators, means on the outer ends of said evaporators for withdrawingliquid concentrate therefrom, means for rotating said assembly ofannular members, and means in said annular spaces between saidevaporators and said condensers for regulating the flow of melted icecrystals from said condensers to said evaporators whereby the liquidconcentrate adhering to said ice crystals is washed therefrom.
7. An apparatus for the freeze concentration of aqueous liquidcontaining solids, and comprising an assembly of hollow annular membersspaced vertically above each other to define a plurality of verticallyarranged annular spaces and a refrigerating system connected to saidhollow annular members for circulating a refrigerant therethrough sothat the inner portions of said annular spaces define condensers and theouter portions thereof define evaporators, a vertical tube in the centerof said assembly of annular members, means on the outer ends of saidcondensers and connected to said vertical tube for withdrawing icecrystals and melted ice crystals from said annular spaces, a pluralityof tubes in said vertical tube and connected with said refrigeratingsystem, means connected to said plurality of tubes for circulating arefrigerant through said condensers and evaporators and returning therefrigerant to the refrigerating system, means for introducing anaqueous liquid containing solids into the inner ends of saidevaporators, means on the outer ends of said evaporators for withdrawingliquid concentrate therefrom, means for rotating said assembly ofannular members, a freely rotating vane assembly immediately adjacentthe surfaces of said evaporators to scrape ice crystals accumulating onthese freezing surfaces.
References Cited by the Examiner UNITED STATES PATENTS 1,999,712 4/35Zorn et al. 6258 2,419,881 4/47 Borgerd et al. 62-124 2,705,407 4/55Colouna 6267 2,946,204 7/60 Justice 62--499 NORMAN YUDKOFF, PrimaryExaminer.
ROBERT A. OLEARY, Examiner.
1. AN APPARATUS FOR THE FREEZE CONCENTRATION OF AQUEOUS LIQUIDSCONTAINING SOLIDS, AND COMPRISING AN ASSEMBLY OF HOLLOW ANNULAR MEMBERSSPACED VERTICALLY ABOVE EACH OTHER TO DEFINE A PLURALITY OF VERTICALLYARRANGED ANNULAR SPACES AND A REFRIGERATING SYSTEM CONNECTED TO SAIDHOLLOW ANNULAR MEMBERS FOR CIRCULATING A REFRIGERANT THERETHROUGH SOTHAT THE INNER PORTIONS OF SAID ANNULAR SPACES DEFINE CONDENSERS AND THEOUTER PORTIONS THEREOF DEFINE EVAPORATORS, A VERTICAL TUBE IN THE CENTEROF SAID ASSEMBLY OF ANNULAR MEMBERS, MEANS ON THE OUTER ENDS OF SAIDCONDENSER AND CONNECTED TO SAID VERTICAL TUBE FOR WITHDRAWING ICECRYSTAL AND MELTED ICE CRYSTALS FROM SAID ANNULAR SPACES, A PLURALITY OFTUBES IN SAID VERTICAL TUBE AND CONNECTED WITH SAID REFRIGERATINGSYSTEM, MEANS CONNECTED TO SAID PLURALITY OF TUBES FOR CIRCULATING AREFRIGERANT THROUGH SAID CONDENSERS AND EVAPORATORS AND RETURNING THEREFRIGERANT TO THE REFRIGERATING SYSTEM, MEANS FOR INTRODUCING ANAQUEOUS LIQUID CONTAINING SOLIDS INTO THE INNER ENDS OF SAIDEVAPORATORS, MEANS ON THE OUTER ENDS OF SAID EVAPORATORS FOR WITHDRAWINGLIQUID CONCENTRATE THEREFROM, AND MEANS FOR ROTATING SAID ASSEMBLY OFANNULAR MEMBERS. | 2024-03-22 | 1961-11-02 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1964-11-24"
} |
US-25330388-A | Portable rotary power tool
ABSTRACT
A gasoline engine driven flexible line trimmer is provided with a modularly constructed power head section which significantly facilitates the original manufacturing assembly, and subsequent service disassembly, of the power head. In a clutch drive embodiment thereof, the power head has four readily separable modules--an engine module comprising a main engine shroud to which the engine is internally secured; a fan housing module; a starter module comprising a starter housing and a recoil starter mechanism retained therein; and a coupling module comprising a clutch housing carrying therein structure for operatively interconnecting the engine's clutch to the flexible drive shaft disposed within the trimmer shaft. In a direct drive version thereof, the power head has two separable modules--the engine module and a combined fan housing, starter and coupling module defined by a single housing within which the starter and coupling structure is carried. Pull rope installation in the starter mechanism is facilitated and made safer by pulley locking and retaining structure incorporated in the starter module, and improved air filter element sealing is provided by virtue of a specially designed air filter housing and choke plate assembly associated with the carburetor. Shaft vibration transmitted to the trimmer user through the supporting shoulder strap structure is significantly reduced by a specially designed resilient strap connector assembly securable to the trimmer shaft.
This application is a continuation, of application Ser. No. 134,245,filed 12/17/87, now abandoned.
BACKGROUND OF THE INVENTION
The present invention relates generally to power tools, and moreparticularly provides a substantially improved power head assembly, andvibration reducing apparatus, for a portable rotary power tool such as aflexible line trimmer.
Portable, gasoline engine driven rotary power tools such as brushcutters, lawn edgers, flexible line trimmers and the like typicallycomprise an elongated hollow shaft to one end of which a rotary cuttingassembly is operatively mounted. A power head assembly, including theengine, is mounted on the opposite end of the shaft and typicallycomprises a protective shroud structure which envelops all or part ofthe engine, a gas tank, and a recoil starting mechanism incorporatingthe usual starter rope and pull handle components. The engine drives thecutting assembly, either directly or through a clutch mechanism, via aflexible drive shaft structure extending through the hollow shaft. Toassist in properly guiding the cutting element during tool use, a pairof operator handle elements are typically secured to the tool inappropriate locations thereon. Additionally, a shoulder strap is oftenused to support the weight of the tool, the strap having an outer endportion which is releasably connectable to a small rigid clamp member orthe like secured to the shaft.
While gasoline driven tools of this general type and configuration haveproven to be quite useful, and immensely popular, a variety of problems,limitations and disadvantages may still be found in many of themrelating to, among other things, structure, operation, safety,fabrication cost effectiveness, operating comfort, and maintenance andservice accessability.
For example, because of the need to design the power head assembly to beat the same time light in weight, compact, and cost effective frommaterial and fabrication standpoint, the resulting power head assemblycan be frustratingly difficult and laborious for the average consumer towork on. Even minor engine adjustments, such as resetting the carburetoridle and operating speed adjustment screws, is often annoyingly hinderedby the need to disassemble and remove various other power headcomponents to even reach the carburetor. At the other end of themaintenance spectrum, major engine teardown and removal is often simplybeyond the capabilities of the average tool user due to the sheercomplexity and intricacy with which many conventional power heads ofthis general type are of necessity assembled.
Conventional attempts to alleviate to some degree this component accessproblem have, in many instances, left certain engine components exposedin a manner, though increasing their accessability, increasing thelikelihood that such exposed components will be accidentally bumped anddamaged during tool use, and giving the overall power head a somewhatungainly and "jury rigged" exterior appearance. As but one example ofthis problem, the engine's carburetor and associated air filterstructure are often allowed to protrude outwardly of the engine's shroudstructure for accessability purposes, thereby rendering these componentshighly vulnerable to damage.
Another example, relating both the component accessability and safety,arises in conjunction with the recoil starter mechanism which istypically difficult to remove and, when the need arises to replace itsstarter rope, difficult, awkward and sometimes unsafe to work on. As iswell known, the problem here lies with the conventional necessity ofhand winding the starter pulley against the biasing force of itsassociated torsion spring, and then holding the wound-up pulley with onehand, to keep the torsion spring from flying off, while attempting torethread and knot a new starter rope onto the pulley with the otherhand.
Apart from these and numerous other problems typically associated withconventional power head sections of tools of this general type, it hasbeen found that a surprisingly high amount of shaft vibration is oftentransmitted to the tool operator's body through the shoulder strapsecured to the tool shaft despite the flexibility of the strap. Thistransmitted vibration can be both annoying and tiring, and it would bequite desirable to eliminate or at least substantially reduce it in asimple, inexpensive manner.
In view of the foregoing, it is accordingly an object of the presentinvention to provide improvements which eliminate or minimizeabove-mentioned and other problems, limitations and disadvantagescommonly associated with conventional portable rotary power tools ofthis general type.
SUMMARY OF THE INVENTION
In carrying out principles of the present invention, in accordance withpreferred embodiments thereof, a representative internal combustionengine driven portable rotary power tool, in the form of a flexible linetrimmer, is provided with a modular power head assembly mounted on oneend of the hollow trimmer shaft and utilized to rotationally drive acutting head assembly mounted on the opposite end of the shaft.
In one embodiment thereof, the power head assembly is formed, proceedingfrom back to front along the assembly, from four releasablyinterconnected modules--an engine module, a fan housing module, astarter module, and a coupling module.
The engine module comprises a specially designed shroud having an openfront end, a top wall, a bottom wall, a pair of opposite side walls, athickened upper rear support wall section which is forwardly inset andextends downwardly from a central portion of the top wall, and avertically intermediate wall which extends rearwardly from the bottom ofthe support wall and defines with rear portions of the bottom and sidewalls a muffler chamber having an open back end over which a suitablemuffler guard may be connected.
The top wall of the shroud is downwardly inset to form a top wellportion of the shroud, and the open bottom end of a shell member issealingly secured to the periphery of the well portion to definetherewith a fuel tank portion of the engine module.
A rear portion of the top wall defines with the intermediate wall andthe support wall a back end recess in the shroud. A carburetor and anassociated air filter housing are disposed within this recess to protectthese components from damage, while at the same time providing easyaccess thereto. The carburetor is secured to the outer surface of thesupport wall over a fuel-air mixture passage extending inwardlytherethrough, a reed valve member being operatively mounted on theinterior surface of the support wall over the inner end of the fuel-airmixture passage.
The engine module also comprises a small single cylinder, air cooled,two stroke cycle gasoline engine having a crankcase with an open rearend portion, a piston and cylinder assembly secured to and dependingfrom the crankcase, and a muffler operatively supported on the cylinderand projecting rearwardly therefrom. The crankcase, cylinder and mufflerportions of the engine are disposed within the shroud and are removablethrough its open front end. The open rear end of the crankcase is boltedto the interior surface of the thickened support wall, over the reedvalve thereon, so that such support wall supports the engine and definesa rear closure wall of the crankcase. The cylinder extends below theintermediate shroud wall, with the muffler projecting rearwardly intothe muffler chamber. The engine's crankshaft projects forwardly throughand beyond the open front end of the shroud, and is provided at itsforward outer end with a centrifugal clutch assembly captively retainedon the crankshaft by a nut threaded onto the outer crankshaft end.
The fan housing module comprises a fan housing section removably securedto the shroud around its open front end and enclosing the engine'sflywheel which coaxially circumscribes and is rotationally locked to thecrankshaft forwardly of the crankcase. The flywheel is provided with acircumferentially spaced series of axially extending cooling impellerblades which, during engine operation, flows a supply of ambient coolingair rearwardly across the cylinder and outwardly through the mufflerchamber, the ambient cooling air mixing with exhaust gas discharged fromthe muffler to cool the exhaust gas. The exhaust gas-cooling air mixturebeing discharged rearwardly through perforations in the muffler guard.
The starter module comprises a starter housing having a front wall, aside wall section extending rearwardly from the periphery of the frontwall, and an open back end portion, the starter housing being releasablyconnected to the open front end of the fan housing. A tubular supportpost projects rearwardly from the front wall of the starter housing andcircumscribes a portion of the engine's crankshaft between the clutchassembly and the flywheel. Carried within the starter housing is amanual, recoil type starting system which includes a starter pulleyrotatably carried on the support post and having front and rear flangesbetween which a starter rope is wound, an outer end portion of thestarter rope extending outwardly through a grommeted opening in thestarter housing and being operatively connected to a starter pullhandle.
A hollow cylindrical drive hub projects rearwardly from a centralportion of the rear flange and is provided with drive teeth operativelyengageable with spring biased starter dogs mounted on a forward portionof the flywheel. An annular torsion spring circumscribes the supportpost, is operatively connected to the starter pulley, and is retainedbetween the starter housing front wall and the front pulley flange. Thestarter pulley is received within a generally annular guide channeldefined by guide members projecting rearwardly from the front starterhousing wall. The pulley is captively retained on the support post by asmall retaining tab member secured to a thickened portion of the starterhousing by a small screw member. Accordingly, when the starter module isremoved from the balance of the power head assembly, both the starterpulley and its associated torsion spring are retained within the starterhousing.
The installation of a starter rope on the starter pulley is madesignificantly easier and safer by the pulley and spring retainingoperation of the tab member in conjunction with circumferentiallyalignable notches formed in the periphery of the rear pulley flange andone of the pulley guide members. To install a starter rope on thepulley, the pulley is wound up against the biasing force of the torsionspring and then backed off approximately one turn until these twonotches are brought into alignment. A small pin member or the like maythen be inserted between the aligned notches to lock the pulley againstrotation caused by the wound up spring. Both of the operator's hands arethen freed to easily and safely install the starter rope. After the ropehas been installed, the locking pin member may be removed to allow thespring to unwind and automatically wind the new rope onto the starterpulley.
The coupling module, which is releasably connectable to the front sideof the starter module, comprises a clutch housing which envelops theengine's centrifugal clutch assembly and is provided at its front endwith an internal, rearwardly projecting support shaft portion into whichis molded a bearing structure including an annular bearing and anannular bearing spacer. This bearing structure coaxially receives androtatably supports a cylindrical coupling member which is rotationallylocked at a front end thereof disposed within the support shaft portionto an end of the flexible drive shaft which extends through the tubulartrimmer shaft and is used to drive the trimmer's cutting head assembly.A clutch drum is fixedly secured to the rear end of the coupling memberand outwardly circumscribes the centrifugal clutch assembly. When therotational speed of the engine reaches a predetermined level, frictionportions of the clutch assembly are moved radially outwardly therefromto frictionally engage the interior surface of the clutch drum tothereby rotate the flexible drive shaft.
This modular power head assembly greatly simplifies, in a very costeffective manner, the access to and servicability of the internal powerhead components. For example, simply by removing the coupling module,the centrifugal clutch assembly is readily accessible, yet isconveniently held on the balance of the power head assembly by theretaining nut on the outer end of the crankshaft. The exposed clutchassembly also captively retains the starter and fan housing modules onthe shroud. By removing the clutch assembly, the starter assembly maysimply be pulled outwardly off the front end of the crankshaft.Additionally, by then removing the fan housing screws and the fanhousing, both the flywheel and its associated ignition module areexposed for inspection and service. The entire engine may then beremoved simply by disconnecting it from the shroud support wall andpulling it outwardly through the open front end of the shroud. Thecarburetor and its associated air filter structure, which are disposedin the protective shroud recess and accessible therethrough, may also besimply disconnected from the shroud's specially designed supportingwall.
In a direct drive embodiment of the power head assembly the centrifugalclutch assembly is eliminated, and a single fan housing and startermodule is removably secured to the open front end of the shroud. Thissingle, forwardly disposed module comprises a unitary housing section inwhich the recoil starter system is captively retained, and a couplingmember is carried to drivingly interconnect the inner end of theflexible drive shaft and the outer end of the crankshaft.
In another version of the power head assembly, the shroud is modified byeliminating the upper shroud well portion and a rear portion of theshroud's upper wall. A separate fuel tank is suitably secured atop afront upper portion of the shroud and has a rear portion which extendsrearwardly of the shroud support wall and is spaced upwardly from theintermediate shroud wall to define therewith the protective recesswithin which the carburetor and its associated air filter structure aredisposed. In yet another version of the power head assembly, the shroudis modified in essentially this same manner, and an operator handle issecured to and positioned above the power head assembly. The operatorhandle has a front end portion which is connected to the housingstructure disposed forwardly of the shroud, and a rear portion definedby a fuel tank which is suitably secured to an upper portion of theshroud and overhangs the carburetor and its associated air filterstructure.
According to a feature of the present invention, a specially designedcarburetor choke plate and air filter assembly is provided whichcomprises a choke plate that is positioned against the back end of thecarburetor and is secured to the shroud support wall in a mannerclamping the carburetor thereto over the fuel-air mixture passageextending through the support wall. The choke plate is secured withinthe open front end of an air filter housing and is provided with a chokelever pivoted to its rear side and having an inner end portion movableover a central choke opening in the plate to selectively block andunblock the same. A detent projection is formed on the choke lever andcooperates with complementarily configured detent depressions formed onthe back side of the choke plate to releasably hold the lever in aselected one of three available choke positions.
The air filter housing has a side wall portion with a series of airinlet openings formed therein, and internally supports a bent strip offoam type air filter material. An outer end portion of the choke leverprojects outwardly through a notch in the filter housing and issealingly engaged by a front side edge portion of the bent filtermaterial strip. As the lever is pivoted relative to the choke plate, theside edge portion of the filter element strip is deformed to provide adust seal around the outer end portion of the choke lever in its newpivoted position.
According to another aspect of the present invention, a speciallydesigned connector assembly is provided to connect an operator shoulderstrap to the trimmer shaft, and functions to substantially reduce shaftvibration transmitted to the operator through the strap. The connectorassembly comprises a first essentially rigid member adjustably securableto the trimmer shaft; a second essentially rigid member to which theshoulder strap may be secured; a hollow, resiliently flexible vibrationdamping member; and connecting means for connecting the first and secondmembers to opposite ends of the hollow damping manner in a mannerisolating the first and second members from contact with one another andcausing shaft vibration transmitted through the first member to thedamping member to cause flexure of the damping member and to be absorbedthereby.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a perspective view of a gasoline engine powered flexible linetrimmer that incorporates a variety of structural, operational,maintenance and service accessibility, cost reducing, and otherimprovements embodying principles of the present invention;
FIG. 2 is an enlarged scale perspective view of the power head sectionof the trimmer;
FIG. 3 is an enlarged scale, partially cross-sectional, and partiallyelevational view taken through the power head section along line 3--3 ofFIG. 2, with certain engine components within the power head beingschematically depicted;
FIG. 4 is a somewhat simplified exploded side elevational view of thepower head section, with certain portions thereof being omitted forillustrative purposes;
FIG. 5 is a fragmentary side elevational view of a rear portion of thepower head section taken generally along line 5--5 of FIG. 2;
FIGS. 6A and 6B are rear side elevational views of the starter housingportion of the power head section, taken along line 6--6 of FIG. 4,illustrating certain structural and operational features of the recoilstarting mechanism disposed therein;
FIG. 7 is an enlarged scale perspective view of a choke plate and airfilter subassembly portion of the power head section;
FIG. 8 is an exploded perspective view of the subassembly of FIG. 7;
FIG. 9 is an enlarged scale fragmentary cross-sectional view through thesubassembly of FIG. 7, taken along line 9--9 thereof;
FIG. 10 is an enlarged scale perspective view of a vibration isolatingshoulder strap connecting member secured to a portion of the trimmershaft which is illustrated in phantom;
FIG. 11 is a cross-sectional view through the connecting member takenalong line 11--11 of FIG. 10;
FIG. 12 is a side elevational view of an alternate embodiment of thepower head section;
FIG. 13 is a side elevational view of a further alternate embodiment ofthe power head section; and
FIG. 14 is an enlarged scale partial cross-sectional view through afront end portion of the power head section of FIG. 13.
DETAILED DESCRIPTION
In a preferred embodiment thereof, the present invention provides aportable rotary power tool, in the form of a flexible line trimmer 10perspectively illustrated in FIG. 1, in which a variety of uniquestructural, operational, maintenance and service accessibility, costreducing, and other improvements are provided. Trimmer 10 has anelongated hollow shaft 12 which has operatively mounted on its left orforward end a rotationally drivable cutting head assembly 14 which isrotated at a high speed to spin an outwardly projecting flexibletrimming line segment 16 in a cutting plane which is essentiallytransverse to the rotational axis of the head 14, and is utilized totrim various types of vegetation into which the cutting plane is moved.To protect the trimmer operator from the rapidly whirling line segment16, a protective shield member 18 is also secured to the outer end ofshaft 12, the shield member 18 being positioned generally above thecutting plane and projecting rearwardly toward the operator. To transmitrotational power to the cutting head assembly 14, a uniquely configuredand operative power head assembly 20 is mounted on the right or innerend of the shaft 12. A small, single cylinder internal combustion engine22 (FIG. 3) is disposed within a multi-section molded plastic shroud andhousing structure which, as also illustrated in FIG. 2, comprises a mainshroud 24, positioned at the rear of the powerhead assembly 20; a fanhousing 26 removably secured to a front side portion of the shroud 24 bymounting screws 28; a starter housing 30 positioned at the front side ofthe fan housing; and a clutch housing 32 projecting forwardly from thestarter housing and secured to an inner end portion of the shaft 12 in amanner subsequently described. Elongated mounting screws 34 are extendedthrough a rear portion of the clutch housing 32, through the starterhousing 30 and into a front portion of the fan housing 26 to therebyremovably mount the housings 30, 32 on the fan housing 26.
Coaxially circumscribing the shaft 12 immediately adjacent the outer endof the clutch housing 32 is a hollow cylindrical rear operator handgrip36 which is formed from a suitable resilient material. At the forwardend of the handgrip 36 a molded plastic throttle lever housing 38 whichis removably clamped to the shaft 12, and is provided with a pivotallymounted throttle lever 40 operatively connected, via a cable element 42,to the pivotally mounted throttle arm portion 44 (FIG. 5) of theengine's externally mounted carburetor 46. The cable 42, as bestillustrated in FIG. 1, is extended through an axial passage (notillustrated) formed in the handgrip 36, and then enters the fan housing26 at location 48. As best illustrated in FIG. 5, the cable 42 exits therear shroud 24, adjacent the carburetor 46, and is connected at an endportion thereof to the throttle arm 44.
Clamped to the shaft forwardly of the throttle lever housing 38 is aforward operator handle 50 which is used by the trimmer operator inconjunction with the rear handgrip 36 to precisely control the movementof the trimmer cutting plane. Also clamped to the shaft 12, between thehousing 38 and the control handle 50, is a specially designed, vibrationreducing shoulder strap connector assembly 52 which, in a mannersubsequently described is connectable to an operator shoulder strap 54,the strap 54 being used by the operator in a conventional manner toassist in comfortably supporting the weight of the trimmer 10.
Referring now to FIGS. 2-4, it can be seen that the shroud and housingportions 24, 26, 30 and 32 are "stacked" in a front-to-rear directionalong the rear end of the shaft 12 and, as previously mentioned, areeasily separable from one another by removing the mounting screws orbolts 28 and 34. In side elevation, the main shroud 24 has a generallyrectangular configuration, while an upper portion of the fan housing 26combines with the fan and clutch housings 30, 32 to provide the overallhousing structure with a generally frustroconically-shaped forward noseportion that gives the multi-section housing structure a pleasing,streamlined configuration.
The main shroud 24 has an open front end 56, and a vertically elongated,generally rectangular cross-section defined by an upper wall 58, a lowerwall 60, and a pair of side walls 62 and 64. Extending downwardly fromthe upper shroud wall 58 is a substantially thickened upper rear wallsection 68 that is connected at its lower side to a rearwardly extendingvertically intermediate wall 70.
The interior of the main shroud 24 opens outwardly through the openfront end 56 thereof, and additionally opens outwardly through a lowerrear end opening 72 defined by lower side portions of the side walls 62and 64, the intermediate wall 70, and a rear portion of the lower wall60, these particular wall portions defining in the shroud 28 a lowerrear internal cavity 74. Additionally, an upper rear recess 76 is formedin the shroud 24 by the wall section 68, the vertically spaced walls 58and 70, and sloping rear tab portions 78 of the side walls which arespaced vertically apart from one another and project inwardly beyond thewalls 58 and 70. As illustrated, the upper rear recess 76 is accessiblefrom the back of the shroud 24, and from the opposite sides thereofbetween opposed pairs of the side wall tab portions, and is bounded atits inner end by the thickened upper rear wall section 68.
The fan housing 26 which is secured as previously described to the frontend 56 of the main shroud 24, has an open front end 80, and an open rearend 82. The starter housing 30 has an open rear end 84 and a front wall86 from a central portion of which a hollow cylindrical support postmember 88 rearwardly extends. The forwardly and laterally inwardlytapered clutch housing 32 has an open rear end 90, and an open front end92 from which a hollow cylindrical support shaft portion 94 rearwardlyextends.
Referring now primarily to FIGS. 3 and 4, the engine 22 is a singlecylinder, air cooled, two stroke cycle engine, which, with the exceptionof certain components subsequently described is disposed within themulti-section shroud and housing structure described above. The primarycomponents of the engine 22 comprise a finned cylinder 100; a piston 102received in the cylinder for reciprocation therein along a vertical axisas viewed in FIGS. 3 and 4; a crankshaft assembly 104; a crankcase 106;a flywheel 108 having a circumferentially spaced series of axiallyextending cooling impeller blades 110 thereon; a centrifugal clutchassembly 112; an ignition module 114; a spark plug 116; a muffler 118;the carburetor 46; and an air filter housing and choke plate assembly120. Crankcase 106 has a hollow rear portion 122 with an open back end124, an open lower side 126, and a forwardly projecting, hollowcylindrical bearing support portion 128.
As will be seen, the main shroud 24, in addition to enveloping andprotecting a rear portion of the engine 22, uniquely performs a varietyof functions in the powerhead assembly 20. One of these importantfunctions, performed by the shroud's thickened wall section 68 is tomount and support the engine 22 as will now be described. The open backend portion 124 of the crankcase 106 is bolted, over a gasket 130, tothe inner side surface of the thickened wall section 68, around aninwardly projecting boss portion 132 thereof, by means of four mountingbolts 134 (only two of which are visible in FIG. 4) which are positionedin the rear shroud notched area 76 and are extended forwardly throughthe wall section 68 and fastened into the crankcase end portion 124.
The thickened wall section 68 also serves to externally mount, withinthe notched area 76, the carburetor 46 and the filter and choke plateassembly 120, in a manner subsequently described, the carburetor 46abutting a rearwardly projecting end portion 135 of boss 132 as bestillustrated in FIG. 3. It can be seen in FIG. 3 that this thickened wallsection 68 defines a rear closure wall of the rear portion 122 ofcrankcase 106, while a suitably configured boss opening 136 also definesa fuel-air mixture passage which interconnects the carburetor outletwith the interior of the rear crankcase portion 122. The boss 132 alsois conveniently used to mount, over the inner end of the passage 136 aschematically depicted crankcase reed valve 138. Before describingvarious other functions performed and advantages provided by the mainshroud 24, a detailed description of the interconnection and relativepositioning of the previously mentioned engine components will now begiven.
The upper end of the finned cylinder 100 is suitably bolted, over asealing gasket 140, to the open lower side 126 of the crankcase 106,with the bottom-mounted spark plug 116 projecting downwardly through asuitable opening 142 formed in the lower shroud wall 60. Spark plug 116is operatively connected to the ignition module 114 by suitable wiring144, the ignition module being positioned generally within a lowerportion of the fan housing 26, and being secured to a forwardlyprojecting connecting block portion 146 of the cylinder 100 by anelongated mounting screw 148.
Cylinder 100 is provided in a right side portion thereof with a suitablyconfigured exhaust gas discharge opening 150 which receives the inletend 152 of the muffler 118. Exhaust gas discharged from the cylinder 100is flowed through the outlet opening 150 into a perforated cylindricalmuffler liner 154 into the interior of the muffler body. The mufflerbody is formed from two partially nested horizontal sections 118_(a) and118_(b), the section 118_(a) having outwardly deformed portions whichdefine side outlets 156 in the muffler body. Exhaust gas entering theinterior of the muffler body through the liner 154 is dischargedrearwardly through these side outlets 156 and then flowed rearwardlythrough rear wall perforations 158 formed in a hollow molded plasticmuffler guard 160 secured to the shroud 24 over its lower rear endopening 72.
The filter and choke plate assembly 120 includes a metal choke plate 162positioned rearwardly of the carburetor 46, and an air filter housing164 positioned rearwardly of the choke plate. The plate 162 is securedto the thickened shroud wall section 68 by a pair of elongated mountingscrews 166 which draw the plate 162 against the back end of thecarburetor 46 to clamp it into operative engagement with the rearwardlyprojecting boss portion 134 so that the fuel-air mixture produced by thecarburetor flows into the crankcase via the boss opening 136 and acrossthe reed valve 138. The filter housing 164 is secured to the choke plate162 by means of a pair of mounting screws 168 extended through thefilter housing 164 and fastened into the choke plate 162. Fuel issupplied to the carburetor 46, in a manner subsequently described,through a flexible fuel line 170.
Crankshaft assembly 104 has a relatively large diameter innerlongitudinal shaft section 172 which extends coaxially through thecrankcase bearing support portion 128 and is rotatably supported thereinby a bearing structure that includes an inner crank bearing 174 carriedby the shaft section 172, and an outer crank bearing 176 retained withinan outer end portion of the bearing support portion 128 which projectsforwardly into the fan housing 26. The left end of the inner shaftsection 172 tapers, as at 178, to a smaller diameter outer longitudinalshaft section 180 which extends centrally through the starter housing 30and into the clutch housing 32, and is provided with an externallythreaded outer end portion 182.
The flywheel 108 is positioned within the fan housing 26 and coaxiallycircumscribes a longitudinally central portion of the crankshaftincluding its tapered portion 178. The flywheel is keyed or otherwiserotationally locked to the crankshaft for rotation therewith, and itsimpeller blades 110 function during flywheel rotation by the crankshaftto draw ambient cooling air 184 into the interior of the power headassembly 20 through a series of side wall slots 186 formed in thestarter housing 30. The air 184 entering the powerhead assembly interioris forced rightwardly across the finned cylinder 100 and the muffler118, through the lower rear shroud cavity 74, to cool the same. Coolingair 184 rightwardly traversing the muffler 118 mixes with exhaust gas186 being discharged therefrom to cool such exhaust gas. The coolingair-exhaust gas mixture 184, 186 is then discharged rearwardly from themuffer guard 160, through the rear end wall perforations 158 therein, asillustrated in FIG. 3. This conveniently directs the cooled exhaustgas-cooling air mixture rearwardly away from the trimmer operator.
Affixed to the inner end of the crankshaft section 172 is a crankshaftcounterweight member 188 which is disposed within the rear portion 122of the crankcase 106. This counterweight section of the crankshaftassembly 104 is provided with a crank pin 190 which is operativelyinterconnected with the piston 102 by a connecting rod 192.
The clutch assembly 112 is coaxially mounted on an outer end portion ofthe crankshaft section 180 and is retained thereon by a nut 194 fastenedonto the threaded crankshaft end portion 182. An annular clutch washer196 is also coaxially mounted on the shaft section 180 and bears againstthe rear side surface of the clutch assembly 112. An inner end portionof an elongated flywheel counterweight member 198 is slidably retainedon the shaft section 180 and bears against a central from side surfaceportion 200 of the flywheel 108. Counterweight 198 is captively retainedon the shaft section 180, and held in abutment with the flywheel surface200, by a tubular retainer sleeve 203 mounted on the shaft section 180and bearing at its opposite ends against the clutch washer 196 and thecounterweight 198.
The counterweight member 198 functions to substantially reduce enginevibration attributable to linear inertia and reactive forces of thepiston 102, the connecting rod 192, and their associated connectingstructure, imposed upon the right end of the crankshaft when the piston102 is adjacent its top dead center and bottom dead center positions.Counterweight 198 is aligned on the flywheel 108 in a manner such thatwhen the piston is adjacent these positions, the longitudinal axis ofthe counterweight is swung through a parallel relationship with thepiston axis and exerts an appropriately directed counterforce on thecrankshaft to offset the rocking torque imposed on the right crankshaftend by these linear inertial and reactive forces. To maintain thecounterweight member 198 in appropriate alignment with the flywheel 108,an outer end portion of the counterweight 198 is received and retainedbetween an appropriate adjacent pair of the flywheel impeller blades110.
In a conventional fashion, the flywheel 108 has a magnet (notillustrated) imbedded in a circumferential portion thereof which israpidly driven past the ignition module 114 to transmit an electricalspark, via the wiring 144, to the spark plug 116. A snap-actionelectrical kill switch 201 (FIGS. 1 and 2) is mounted on the top of thefan housing 26 and is suitably interconnected to the wiring 144 (in amanner not illustrated) to selectively and rapidly terminate engineoperation. As illustrated in FIG. 3, the downwardly projecting sparkplug 116 is rearwardly adjacent a downwardly projecting front guard andsupport section 202 of the main shroud 24. The section 202 functionsboth as a support for the powerhead assembly 20 when it is rested uponthe ground, and further shields the outwardly projecting spark plug fromdamage.
The starter housing 30 defines a portion of a manual starter assembly204 which includes a starter pulley 206 rotatably mounted on the starterhousing support post 88. Pulley 206 is operatively connected to aschematically depicted annular torsion spring element 208 whichcircumscribes the starter housing post 88 and is captively retainedbetween the inner pulley flange 210 and the front wall 86 of the starterhousing 30. Extending rearwardly from the outer pulley flange 212 is acentral cylindrical drive hub 214 having formed around its periphery aseries of ratchet drive teeth 216.
A starter rope 218 is operatively wrapped around the pulley 206 and hasan outer end portion 220 which is passed outwardly through a grommetedopening 222 in the starter housing 30 and secured to a generallyT-shaped starter pull handle. An inner end portion 226 of the rope isextended outwardly through a pulley threading opening 228 formed in theflange 212 and is knotted around or otherwise secured to the pulleydrive hub 214.
In a conventional manner, as the handle 224 is pulled upwardly as viewedin FIG. 3, the resulting extension of the starter rope 218 rapidlyrotates the pulley 206, thereby winding up the torsion spring 208. Thedrive hub teeth 216 simultaneously engage spring-loaded starter dogs 230on the flywheel 108 to rotationally drive the flywheel, and thus thecrankshaft, to start the engine. Upon engine startup, the dogs 230 arecentrifugally swung out of engagement with the starter teeth 216 tothereby disconnect the starter assembly from the balance of the engine.When the handle 224 is released, the tightened torsion spring 208operates to rewind the starter rope 218 on the pulley 206 as illustratedin FIG. 3.
The clutch housing 32 defines a portion of a drive and coupling assembly232 which functions in cooperation with the clutch assembly 112 totransmit rotational power from the engine 22 to the trimmer cutting head14 (FIG. 1) through a flexible drive shaft 234 disposed within thetrimmer shaft 12 within a liner structure 238. This flexible drivesystem, which forms no part of the present invention, is similar to thatillustrated and described in U.S. Pat. No. 4,451,983.
Drive and coupling assembly 232 includes a clutch drum 240 which, asillustrated in FIG. 3, is disposed within a rear portion of the clutchhousing 32, has an open rear end, and outwardly circumscribes the clutchassembly 112. A radially reduced front side wall 242 of the clutch drum240 is rotationally locked to a flanged portion 244 of a hollow tubularconnector member 246 which projects axially inwardly into the supportshaft 94 and into an inner end portion 12_(a) of the trimmer shaft 12which is also received within such support shaft 94. The connectormember 246 is rotatably supported within the hollow support shaftportion 94 of the clutch housing 32 by means of an annular bearing 248which, like an adjacent annular bearing washer 250 is convenientlymolded-in with an inner end portion of the support shaft 94. Themolded-in bearing and washer 248, 250 are captively retained within aninner end portion of the support section 94 by a pair of annular lipflanges 252, 254 formed therein.
The tubular connector member 246 is captively retained on the supportelement 94 by means of the shoulder portion 244 positioned on one sideof the bearing 248, and a suitable snap ring member 256 secured to themember 246 and positioned on the opposite side of such bearing. Theinner end portion 256 of the flexible drive shaft 234 is slidablyreceived within a complementarily configured axial opening within theforward end of the connector member 246 to thereby rotationally lock theshaft 234 and the connector member 246.
An inner end portion 12_(a) of the trimmer shaft 12 is keyed orotherwise rotationally locked within the cylindrical support portion 94of the clutch housing 32 to prevent relative rotation therebetween. Asbest illustrated in FIG. 2, the outer end of the clutch housing 32,which removably receives the inner end portion 12a of the trimmer shaft12, is axially slit, as at 258, along a central portion thereof. Theinner trimmer shaft end portion 12_(a) is releasably clamped within theouter end portion of the clutch housing 32 by means of two clamp screws260 which are extended through upper and lower front portions 262 and264 of the clutch housing 32, disposed on opposite sides of the slit258, to draw such portions together around the trimmer shaft end portion12_(a).
The clutch assembly 112 is of a generally conventional construction andincludes a central hub portion 266 and a pair of friction elements 268which are normally biased to their radially inwardly retracted positionsdepicted in FIG. 3 by clutch spring means 270 which circumscribe the hub266 and operatively engage the friction elements 268. When the engine 22reaches a predetermined rotational speed, the friction elements 268 areforced centrifugally outwardly from the hub 266 into frictionalengagement with the interior surface of the clutch drum 240 to rotatethe drum and, via the locked interconnection between the connectormember 246 and the flexible shaft end portion 256, to transmitrotational power from the engine 22 through the flexible drive shaft 234to the trimmer head 214. When the engine speed falls below thispredetermined level, the clutch spring means 270 overcome thecentrifugal force on the friction elements 268 to thereby withdraw themfrom frictional engagement with the clutch drum 240 and decouple theflexible drive shaft 234 from the engine 22.
Returning now to the discussion of the various advantages provided bythe uniquely configured shroud 24, it can be seen in FIGS. 1, 2 and 5that the carburetor 46 and its associated filter and choke plateassembly 120 are conveniently disposed and protected within the rearshroud recess 76 defined by vertically opposed rear sections of theshroud. Disposed in recess 76 in this manner, these components are quitewell protected by outer surface portions of the shroud 24 from damage.They remain, however, quickly and easily accessible for service andmaintenance. For example, as previously described, both the carburetor46 and the filter and choke assembly 120 may be quickly removed from theshroud simply by removing the two screws 166 and the two screws 168 (seeFIGS. 4 and 8) which are easily accessible from the rear of the shroud.Additionally, while the carburetor 46 is securely protected within theshroud recess 76, its idle, high speed and low speed adjustment screws272, 274 and 276 (FIG. 5) may be easily screwdriver-adjusted from theside of the shroud 24 without the necessity of removing any associatedcomponents, cover plates or the like.
The shroud 24, as best illustrated in FIG. 3, also conveniently forms abottom portion of a top-mounted gas tank 278 which holds a supply ofgasoline for delivery to the carburetor 46 via the flexible fuel line170. The upper shroud wall 58 is provided around its periphery with anupstanding flange portion 280 which defines with the wall 58 adownwardly inset well portion 282 positioned at the top 284 of theshroud 24. To form with the well 282 the balance of the top-mounted gastank 278, a molded plastic tank cover element 286, provided with ascrewed on gas cap 288, is vibratory welded at its open lower end 290 tothe upper end of the well flange portion 280. The flexible fuel line 170is passed upwardly through a suitably sealed opening (not shown) formedin the lower tank wall 58, and is provided at its upper end with aweighted fuel inlet filter element 292.
It can be seen from the foregoing that the uniquely configured mainshroud portion 24 of the power head assembly 20 forms a convenient andmulti-functional "base" to which the other power head assemblycomponents, including the "stacked" housing sections 26, 30 and 32, areconnected and supported from. These stacked housing structure elementsuniquely cooperate with the main shroud 24 to provide substantiallyimproved maintenance, service and replacement access to the engine 22disposed within and supported on the shroud in a manner which will nowbe described.
Rapid access to the clutch assembly 112 is achieved simply by removingthe four mounting screws 34 (FIG. 2) and pulling the drive and couplingassembly 232 leftwardly away from the balance of the power headassembly, thereby exposing the clutch assembly 112 which is convenientlyheld in place by the nut 194. The friction elements 268 of the clutchmay then be inspected, and serviced or replaced as necessary. At thesame time, the clutch drum 240 may be easily inspected. If it isnecessary to remove the drive and coupling assembly 232 from the trimmershaft to which it is still clamped, the clamping screws 260 (FIG. 2) maybe simply loosened to permit the drive and coupling assembly 232 to besimply pulled rightwardly off the trimmer shaft end portion 12_(a).
It will be noted that when the drive and coupling assembly 232 has beenremoved from the starter housing 30, the exposed clutch assembly 112conveniently retains the starter assembly 204 on the crankshaft. If itis required to inspect the interior of the assembly 204, all that isnecessary is to remove the crankshaft end nut 194, slide the clutchassembly leftwardly off the crankshaft, and then similarly slide thestarter assembly 204 leftwardly off the crankshaft.
Access to the entire flywheel 108, and the ignition module 114, may thenbe provided simply by removing the screws 28 (FIG. 2) and then removingthe fan housing 26. After the fan housing 26 has been removed in thismanner, the entire assembled balance of the engine 22 may be removedsimply by removing the four engine mounting bolts 134 (FIG. 4), and thespark plug 116, and then pulling the disconnected engine outwardlythrough the open front end 56 of the shroud 24. In a similarly rapidfashion, the carburetor 46 and the filter and choke plate assembly 120may also be removed by removing the screws 166 and 168 (FIG. 4).Reassembly of the power head 20 is easily achieved simply by essentiallyreversing these steps.
Referring now to FIGS. 6A and 6B, the previously described starterassembly 204 is of a unique design which substantially facilitates andrenders a great deal safer the initial or subsequent repair installationof a starter rope 218. The starter rope pulley 206 coaxially mounted onthe pulley drive hub 214 is received within arcuate guide structuredefined in part by axially extending, curved guide moldings 294, 296which are positioned radially inwardly of four circumferentially spacedmolded boss sections 298, each of the bosses 298 having a circularopening 34a formed axially therethrough for receiving one of the fourmounting screws 34 (FIG. 2).
Formed on a left end portion of the guide molding 296 is a radiallyoutwardly projecting, generally V-shaped groove 100, the right end ofthe molding 296 being used to retain the radially outermost end of thetorsion spring 208. A thickened portion 302 (FIG. 3) of the starterhousing 30 is positioned radially outwardly of the guide molding 296 andhas secured thereto, by means of a small screw 304, an elongated pulleyretaining tab member 306. As illustrated in FIGS. 6A and 6B, a radiallyinner end portion of the tab 306 overlies a radially outer surfaceportion of the outer pulley flange 212, thereby precluding axialdislodgment of the pulley 206 from the drive hub 214. For purposes laterdescribed, a small semicircular notch 308 is formed in the outerperiphery of the outer pulley flange 212.
With the manual starter assembly 204 removed from the power headassembly 20 as previously described, the starter rope 218 may bereplaced in the following safe, rapid and convenient manner. Forpurposes of describing this procedure, it will be assumed that thestarter rope 218 depicted in FIG. 6A has become worn and needs to bereplaced. To accomplish this replacement, the worn rope 218 is firstremoved from the pulley and discarded. Next, the pulley 206 is handwound to fully tighten the torsion spring 208 and then backed offapproximately one turn until the pulley flange edge notch 308 is broughtinto alignment with the guide molded V-groove 300 as illustrated in FIG.6B. During this manual winding of the pulley 208, and thereafter, thetab 306 functions to hold the pulley 206 on the hub 214 to prevent thespring 208, when under torsion from flying off and injuring theinstaller of the new starter rope.
When the groove 300 and the notch 308 are brought into alignment asdepicted in FIG. 6B, a suitable pin element 310 is axially inserted intothe space between the groove and notch 300 and 308 to thereby lock thepulley against rotation caused by the wound up torsion spring 208. Withthe pin element 310 inserted in this manner, the pulley may be released,thereby freeing both hands of the rope installer to install a newstarter rope.
When the pulley is temporarily locked in this manner, the pulleythreading hole 228 is brought into circumferential alignment with thegrommeted rope opening 222. The outer end of a new starter rope is thensecured to the starter pull handle 224, and the inner end of the rope isthreaded inwardly through the grommeted opening 222, into the spacebetween the pulley flanges, outwardly through the threading opening 228and then secured around the drive hub 214 as depicted in FIG. 6A. It isimportant to note that during this threading and attachment procedure,both of the operator's hands are free due to the locking action of thepin element 310, and the wound up spring 208 is safely prevented fromescape by the action of the retaining tab 306.
All that is necessary now is to hold a section of the new rope, and aportion of the housing 30 adjacent the grommeted opening 222 with onehand while removing the pin elements 310 with the outer. The section ofthe new rope disposed outwardly of the housing may then be allowed toslide through the fingers while the torsion spring 208 unwinds toautomatically rewind the new rope 218 onto the pulley 206 and pull thehandle 224 back against the housing 30 as illustrated in FIG. 6A. It canreadily be seen that the significant safety and maintenance improvementachieved in the improved starter assembly 204 is provided by the presentinvention at a very low cost--namely, the cost of providing the groove300, the notch 308, the screw 304 and the retainer tab 306.
Another of the various improvements incorporated in the trimmer 10 bythe present invention relates to the structure and operation of thefilter and choke plate assembly 120 depicted in FIGS. 7-9. The filterhousing 164 has an elongated, generally rectangular configuration; anopen front end; a back wall 312; a side wall portion 314 having a seriesof air inlet openings 316 formed therein; a peripheral, forwardlyprojecting flange 318 bordering the open front end; and a rearwardlyinset peripheral ledge 320 inwardly adjacent the flange 318. Projectingforwardly from the back wall 312 is an arcuately disposed series ofspaced apart support pins 322 around which a strip of foam type airfilter material 324, disposed within the filter housing 164, is bent. Aforward right end portion of the housing 164 has a notch 326 formedtherein, the notch extending rearwardly of the ledge 320.
The choke plate 162 is closely received within the flange 318 and drawninto abutment with the ledge 320 by the screws 168, an end tab portion328 of the plate 162 being received in a forward side portion of thenotch 326. A central portion of an elongated, plate-like choke lever 330is pivoted to the rear surface of the choke plate 162 by one of themounting screws 166 so that an inner end portion 332 of the lever 330can be selectively pivoted over all or a portion of a central circularchoke opening 334, formed through the plate 162, to selectively chokethe engine 22.
The choke lever 330 has an outer end portion 336 which projectsoutwardly beyond the end tab portion 328 of the plate, and is providedat its outer end with a forwardly bent end tab portion 338 which may beeasily manipulated by a finger to selectively pivot the lever 330. Thepivotal motion of the lever 330 is limited by rearwardly projecting stoppin portions 340 and 342 on the plate 162, while suitable detentdepressions 344, 346 and 348 are formed in the rear surface of the plate162. These detent depressions cooperate with a complementarilyconfigured detent projection 350 on the outer choke lever end portion336 to conveniently hold the lever in one of three selected chokepositions.
With the choke plate 162 firmly secured to the filter housing 164 aspreviously described, a front side edge portion 324_(a) of the foamfilter strip 324, adjacent the filter housing notch 326, is pressedagainst the inner side surface 162_(a) of the plate 162 and is alsopressed around the outwardly projecting end portion 336 of the chokelever 330 (see FIG. 9) to maintain a movable dust seal 352 around theoutwardly projecting choke lever portion 336. As illustrated in FIG. 9,when the lever portion 336 is moved downwardly from its solid lineposition to its dotted line position, the seal 352 moves with the leverportion, so that the portion of the filter element side surface 324_(a)previously depressed by the lever portion 336 in its solid line positionmoves back into engagement with the inner side surface 162_(a) of theplate 162. The cooperation in this manner between the foam filterelement 324 and the lever 330 substantially reduces the amount ofunfiltered air which eventually reaches the carburetor 46.
Yet another aspect of the present invention resides in the structure andoperation of the shoulder strap connector assembly 52 which will now bedescribed with reference to FIGS. 10 and 11. While it might be assumedthat, due to the inherent flexibility of the shoulder strap 54, thatshaft vibration transmitted to the trimmer user therethrough would berather minimal, a surprisingly high amount of shaft vibration isactually transmitted to the user through such strap 54 when it isconnected to the conventional rigid clamp member typically used toconnect an outer end portion of the strap to the shaft. A substantialamount of this annoying and sometimes tiring shaft vibration transmittedthrough the strap 54 is, however, eliminated by the resilient connectorassembly 52 which comprises a generally U-shaped molded plastic clampportion 354 whose depending arms 356, 358 project below the trimmershaft 12 and are drawn together by a clamp screw and locking nutassembly 360, 362 to draw the curved base portion 364 of the clampmember 354 tightly against the shaft 12. The projecting base portion 366of a molded plastic connector member 368 is anchored to the closed topof base portion 364 by means of a radially extending screw 370 whichextends upwardly through aligned bores formed in the base portions 364and 366, has a head 372 received in a radially inner surface depression374 in the base portion 364, and is threaded into a lock nut 376 whichis positioned along a longitudinally intermediate portion of the screw376 and is received in a recess 378 formed in the base portion 366 asillustrated. Alternatively, of course, the clamp portion 354 and theconnector member 368 could be molded integrally with one another ifdesired.
The connector member 368 has an annular upper end portion 380 having aradially inner portion captively retained in an annular, exteriorsurface channel 382 formed around the side surface of a hollow,generally barrel shaped vibration isolator member 384. Isolator member384 is formed from a suitable resilient elastomeric material and hastapered opposite ends 386, 388 which are respectively received ingenerally dish-shaped isolator support members 390 and 392 that areinwardly adjacent the lower ends 394, 396 of a U-shaped metal snapconnector member 398.
Member 398 is secured to the resilient isolator member 384 by means of aconnecting bolt 400 which extends through the onnector member ends 394and 396, the dish-shaped members 390 and 392, the tapered ends 386 and388 of the isolator 384, and axially through the interior of theisolator. The outer end of the bolt 400 is threaded into a suitableretaining nut 402. Instead of the bolt 400, another suitable type offastening member, such as a rivet, could be utilized if desired.
A tubular metal spacer member 404 is positioned within the interior ofthe isolator 384, coaxially circumscribes a longitudinally centralportion of the bolt 400, and bears at its opposite ends against theinterior surfaces of the outer ends 386, 388 of the isolator 384. Theillustrated looped outer end portion of the shoulder strap 54 is passedthrough the rectangular slide loop end portion 406 of a small clipmember 408 which may be clipped directly onto the snap connector member398 or, as illustrated, be clipped onto a split ring adapter member 410which is in turn connected to the member 398.
It can be seen that the snap connector member 398 is completely isolatedfrom the base portion 366 of the connector member 368 by means of thehollow vibration isolator member 384 which, due to its hollowconfiguration, may be flexed axially and/or radially. Accordingly, asubstantial portion of the shaft vibration which would otherwise betransmitted from the clamp member 354 through the connecting structureto the shoulder strap 54 is absorbed and damped by the isolator member384.
Illustrated in FIG. 12 is an alternate embodiment 20_(a) of thepreviously described power head assembly 20. For ease of comparison,components in the assembly 20_(a) similar to those in the assembly 20have been given identical reference numerals, but with the subscript"a". The engine and clutch components disposed within the shroud andhousing structure 24_(a), 26_(a), 30_(a) and 32_(a) are identical tothose in the powerhead assembly 20, and the engine is provided with anexternally mounted filter housing and choke plate assembly 120_(a) andan associated carburetor 46_(a) mounted to the thickened shroud supportwall section 68_(a).
However, in the assembly 20_(a) the protective recess 76_(a) at the backend of the main shroud 24_(a) is not defined entirely by the shrouditself. Instead, the shroud 24_(a) is provided with a forwardly andupwardly sloping upper rear wall portion 412 which extends between theinner end of the intermediate wall 70_(a) and an essentially flat,forwardly disposed top wall portion 414 which is immediately adjacent aflat upper top wall portion 416 of the fan housing 26_(a). Additionally,the modified shroud 24_(a) does not integrally define a portion of thegas tank section of the powerhead assembly. Instead, a separate moldedplastic gas tank 418 is provided and sits atop the shroud and fanhousing top wall portions 414, 416. Tank 418 has a rear portion 420which projects rearwardly of and extends downwardly along the shroudwall 412. The rear tank portion 420 has a rearwardly and upwardly slopedrear bottom wall portion 422 which, with the shroud walls 68_(a) 70_(a)defines the protective recess 76_(a). Tank 418 has a front side portion424 which is secured to a rear shoulder portion 426 of the fan housing26_(a) by a suitable connecting bracket structure 428. The rear tankportion 420 may be additionally secured to the sloping shroud wall 412by suitable interlocking lip means (not illustrated) if desired.
A further alternate embodiment 20_(b) of the power head assembly 20 isdepicted in FIG. 13. The power head assembly 20_(b) is a direct drive(i.e., non-clutch) version of the assembly 20 and has a variety of othermodifications made thereto. The shroud 24_(b) is substantially identicalto the shroud 24_(a) described in conjunction with FIG. 12, but insteadof having separate fan, starter and clutch housings removably securedthereto in a "stacked" fashion, the shroud 24_(b) has forwardly securedthereto a single housing structure 430 having, from front-to-rear,coupling, starter and fan sections 432, 434 and 436 molded integrallywith one another. The unitary housing structure 430 is similar inappearance to the stacked separate housings 26_(a), 30_(a) and 32_(a) ofFIG. 12, but the coupling section 432 is shorter, in a front-to-reardirection, due to the absence of a clutch in the power head assembly20_(b).
Referring now to FIG. 14, it can be seen that the flywheel 108_(b) isdisposed within the fan section 436, and the starter pulley 206_(b), andits associated torsion spring 208_(b) are disposed within the startersection 434 of the unitary housing structure 430. In this non-clutchversion of the power head assembly, the outer end portion 180_(b) of thecrankshaft is considerably shortened, and projects outwardly a shortdistance from the central flywheel surface 200_(b) against which theflywheel counterweight 198_(b) is disposed. The crankshaft end portion180_(b) is rotationally locked within a right end portion of a hollowtubular coupling member 438 which extends coaxially into the inner endof the support shaft portion 94_(b) of the coupling section 432. Theleft end of the coupling member 438 nonrotatably receives the square end256 of the flexible drive shaft 234, the trimmer shaft 12 being clampedwithin the coupling section 432 as previously described in conjunctionwith the clutch housing 32 of power head assembly 20. In this embodimentof the power head assembly, the flywheel counterweight 198_(b) iscaptively retained against the flywheel surface 200_(b) by the right endof the coupling member 438.
The starter pulley 206_(b) is mounted on a reduced diameter inner endportion 440 of the support shaft 94_(b) (which replaces the support post88 described in conjunction with FIG. 3) and is held in abutment alongits forward end with a shoulder portion 442 of the shaft 94_(b) by awasher 444 or other suitable retaining member fastened to a thickenedhousing wall portion 446 by a small screw 448. The torsion spring208_(b) is captively retained between the pulley flange 210_(b) on oneside, and the shoulder 442 and an internal housing shoulder 450 on theother side. It can be seen in FIG. 14 that very rapid access to both thestarter assembly, the flywheel, and the balance of the engine may beachieved simply by removing the unitary housing structure 430 from themain shroud 24_(b). Starter rope replacement may be easily and safelyaccomplished in the manner previously described in conjunction withFIGS. 6A and 6B.
Another modification made to the power head assembly 20_(b) is that (asin the case of the assembly 20_(a)) the shroud 24_(b) is not utilized tointegrally define a portion of the gas tank section of the powerheadassembly 20_(b). Instead, a separate molded plastic gas tank 452 isprovided and suitably secured to the rear end of a generally L-shapedoperator handle 454 which is spaced upwardly from the shroud and housingwall portions 414_(b) and 416_(b). The tank 452 is suitably secured tothe shroud wall portion 412_(b) and overlies the filter and choke plateassembly 120_(b) and the carburetor 46_(b) to thereby partially definethe protective recess 76_(b) in which such components are received. Adownwardly bent forward end portion 456 of the handle 454 is suitablysecured, as at 458, to a support web 460 molded integrally with thehousing structure 430, and projecting forwardly and upwardly therefromat an upper end portion of its starter and fan sections 434 and 436.
The handle 454 is provided with a pivotally mounted throttle trigger 460adjacent the forward handle end 456, the trigger 460 being operativelyinterconnected (in a mnnner not illustrated) to the carburetor throttlearm via suitable cable means. It will be appreciated that when thisparticular embodiment of the power head assembly is utilized, the handle454 functions as a rear operator control handle so that the cylindricalhandgrip 36, and its associated throttle control structure depicted inFIG. 1, could be eliminated when this power head assembly embodiment isincorporated into the trimmer 10.
By comparing the previously described power head assemblies 20, 20_(a)and 20_(b), it can readily be seen that each is constructed in a unique"modular" fashion which is both very cost effective and significantlyenhances the ease with which it may be initially fabricated andassembled, and subsequently disassembled, either partially or totally,for maintenance, inspection and repair purposes. Because of this uniquemodular construction, access to the internal components of the powerhead is also greatly improved so that the tool purchaser can much moreeasily perform most of the ordinary maintenance, repair, and componentreplacement tasks.
Referring again to FIGS. 3 and 4, the readily separable "modules" ofpower head assembly 20 (which, from a modularity standpoint, isidentical to the assembly 20_(a) of FIG. 12) include: an engine modulecomprising the shroud 24 and the engine 22 secured thereto; a fanhousing module comprising the fan housing 26; a starter module definedby the starter assembly 204; and a coupling module defined by the driveand coupling assembly 232.
In the direct drive version 20_(b) of the power head assembly depictedin FIG. 13, there are two readily separable modules--the engine moduledefined by the somewhat modified shroud 24_(b) and the engine securedthereto, and a combined fan housing, starter and coupling module definedby the integral front housing structure 430 and the previously describedstarter and coupling structure carried therein and removable therewith.In comparing the power head assemblies 20 and 20_(b), the fan housing,starter and coupling modules of assembly 20 may be conceptuallycharacterized as submodular counterparts of the single fan housing,starter and coupling module of assembly 20_(b) provided in part, toaccomodate the presence of the clutch assembly 112.
From the foregoing it can be seen that the present invention, in thedescribed illustrative embodiments thereof, provides a portable rotarypower tool which is substantially improved in a variety of mannersrelating to structure, operation, maintenance and service accessibility,cost reduction and overall operating convenience and comfort. It will beappreciated, however, that the principles of the present invention arenot limited to the particular type of power tool depicted herein, andcould be employed in a wide variety of alternate applications.
The foregoing detailed description is to be clearly understood as beinggiven by way of illustration and example only, the spirit and scope ofthe present invention being limited solely by the appended claims.
What is claimed is:
1. An internal combustion engine driven power toolcomprising working means drivable to perform a predetermined workfunction; power transmitting means for receiving rotational power from asource thereof and responsively transmitting the received power to saidworking means to drive the same; and a power head assembly including:ashroud member having an open front end, an engine support wall sectionspaced rearwardly from said open front end, a fuel-air mixture passageextending through said support wall section from an exterior surfacethereof to an interior surface thereof, a reed valve operatively securedto said inner surface of said support wall section over said fuel-airmixture passage, and a chamber extending rearwardly of said support wallsection, said chamber communicating with the interior of said shroudmember and having a rear end opening; an internal combustion engine forgenerating rotational power, said engine being partially enveloped bysaid shroud member and having a crankcase with an open rear end portioninteriorly secured to said support wall section over said reed valve sothat said support wall section defines a rear closure wall of saidcrankcase, the balance of said engine being supported from saidcrankcase, said engine further having a cylinder connected to a sideportion of said crankcase within said shroud member, a muffler securedto said cylinder and positioned within said chamber, and a carburetorexternally secured to said support wall section and operativelypositioned over said fuel-air mixture passage; housing means removablyconnectable to said shroud member over said open front end thereof;coupling means, positioned within said housing means, for rotationallycoupling said engine to said power transmitting means; and manuallyoperable starter means, internally carried by a portion of said housingmeans for removal therewith from said shroud member, for starting saidengine.
2. The power tool of claim 1 wherein:said shroud member has aninset exterior wall portion, and said power tool further comprises ashell member having an open end portion secured to and sealed around theperiphery of said inset exterior wall portion to define therewith a fueltank portion of said power head assembly.
3. The power tool of claim 1wherein:said shroud member has a pair of spaced apart exterior wallportions which, with said support wall section, define in said shroudmember an exterior recess in which said carburetor is received, saidexterior wall portions laterally and rearwardly overhanging saidcarburetor in a manner protecting it from damage yet permitting accessthereto from the exterior of said shroud member.
4. The power tool ofclaim 3 further comprising:air filter means carried by said carburetorwithin said recess for filtering air received by said carburetor.
5. Thepower tool of claim 1 wherein:said housing means comprise a singlehousing member, said engine has a crankshaft having an outer enddisposed within said single housing member, said single housing memberhas a tubular support shaft portion therein which is axially alignedwith said outer crankshaft end and positioned forwardly thereof, saidcoupling means include a coupling member disposed within said supportshaft portion and rotationally coupling said outer crankshaft end andsaid power transmitting means, and said starter means include a starterrope pulley coaxially retained on said support shaft portion forrotation relative thereto.
6. The power tool of claim 1 wherein:saidhousing means comprise first, second and third housing sectionsreleasably connected to each other and to said front end of said shroudmember, said first housing section being forwardly contiguous with saidfront end of said shroud member, said second housing section beingforwardly contiguous with said first housing section, said third housingsection being forwardly contiguous with said second housing section,said engine has a crankshaft extending forwardly from said crankcasethrough said first and second housing sections and having an outer endportion disposed in said third housing section and having a centrifugalclutch assembly captively and releasably retained thereon, and aflywheel rotationally locked on said crankshaft and disposed within saidfirst housing section, said starter means include a starter rope pulleycoaxially circumscribing said crankshaft and rotatably retained withinsaid second housing section for removal therewith, and said couplingmeans include clutch drum means, rotatably carried within said thirdhousing section for removal therewith, for being frictionally engagedand rotationally driven by said centrifugal clutch assembly when therotational speed of said engine reaches a predetermined magnitude.
7. Aninternal combustion engine driven power tool comprising working meansdrivable to perform a predetermined work function; power transmittingmeans for receiving rotational power from a source thereof andresponsively transmitting the received power to said working means todrive the same; and modular power head means for supplying rotationalpower to said power transmitting means, said modular power head meansincluding:an engine module comprising a shroud member having an openfront end, and an internal combustion engine secured to and supported bya wall section of said member, said engine having crankcase and cylinderportions disposed within said shroud member and removable through saidopen front end thereof, a crankshaft having a front longitudinal portionprojecting forwardly from said open front end of said shroud member andhaving an outer end portion, and a flywheel coaxially carried on androtationally locked to said front longitudinal portion of saidcrankshaft; a housing section removably connected to said open front endof said shroud member and enclosing said flywheel and said frontlongitudinal portion of said crankshaft; coupling means, positionedwithin said housing section, for rotationally coupling said engine tosaid power transmitting means; and manually operable starter means,carried by said housing section for removal therewith from said shroudmember, for starting said engine.
8. The power tool of claim 7wherein:said housing section, said starter means, and said couplingmeans are associated to define a fan housing, starter and couplingmodules which are releasably connected to one another in aforwardly-to-rearwardly stacked assembly releasably secured to said openend of said shroud member,said fan housing module comprising a firstportion of said housing section which is forwardly contiguous with saidopen front end of said shroud member and circumscribes said flywheel,said starter module comprising said second portion of said housingsection carrying said starter means for removal therewith and beingforwardly contiguous with said first housing section portion, saidcoupling module comprising a third portion of said housing sectioninternally carrying said coupling means for removal therewith and beingforwardly contiguous with said second housing section portion.
9. Thepower tool of claim 8 wherein:said engine has a centrifugal clutchassembly disposed within said coupling module and captively retained onsaid outer end portion of said crankshaft, said clutch assemblycaptively retaining said fan housing and starter modules on said shroudmember and being removable from said outer crankshaft end portion topermit removal of said fan housing and starter modules from said shroudmember, said third housing section has a tubular support shaft disposedtherein, said support shaft portion having bearing means coaxiallycarried therein, and said coupling means include a coupling membercaptively retained in said support shaft portion, rotatably supported bysaid bearing means, and rotationally coupled to said power transmittingmeans, and clutch drum means, carried by said coupling member forrotation therewith and outwardly circumscribing said centrifugal clutchassembly, for being frictionally engaged and rotationally driven by saidclutch assembly when the rotational speed of said engine reaches apredetermined level.
10. The power tool of claim 9 wherein:said powertransmitting means include an elongated tubular shaft connected at itsopposite ends to said working means and said powerhead means, and aflexible drive shaft extending through said tubular shaft andinterconnecting said working means and said coupling member.
11. Thepower tool of claim 9 wherein:said support shaft portion is of a moldedmaterial, and said bearing means are molded into a portion of saidsupport shaft portion.
12. The power tool of claim 11 wherein:saidsupport shaft portion has a rear end portion with a pair of axiallyspaced, radially inwardly directed annular flanges thereon, and saidbearing means are captively retained between said flanges and comprisean annular bearing and an annular bearing spacer.
13. The power tool ofclaim 8 wherein:said flywheel has spring biased centrifugal starter dogsoperatively mounted on a forwardly disposed portion thereof, said secondhousing section portion has a front wall circumscribing said crankshaft,a tubular support post circumscribing said crankshaft and projectingrearwardly from a central portion of said front wall, and a generallyannular support section outwardly circumscribing said crankshaft andsaid support post and projecting rearwardly from said front wall, andsaid starter means include a starter pulley coaxially and rotatablycarried on said support post within said support section and havingfront and rear flanges between which a starter rope may be wound, atorsion spring circumscribing said support post, operatively connectedto said pulley and disposed between said front wall and said frontflange, and a drive hub projecting rearwardly from said rear flange andhaving drive teeth adapted to operatively engage said flywheel starterdogs, and a retaining member removably secured to said second housingsection portion and rearwardly overlying said rear flange in a mannercaptively retaining said pulley and said spring on said support post.14. The power tool of claim 13 wherein said starter means furthercomprise:alignable first and second depressions respectively formed in aperipheral portion of said rear pulley flange and in said supportsection, said depressions being relatively configured so that, when theyare brought into circumferential alignment, a pin member or the like maybe inserted therebetween to rotationally lock said pulley against thebiasing force of said torsion spring to thereby facilitate theinstallation of a starter rope on said pulley.
15. The power tool ofclaim 7 wherein:said housing section is a unitary housing member havingan interior tubular support shaft portion projecting rearwardly from afront end thereof, and said coupling means include a coupling memberprojecting into the inner end of said support shaft portion androtationally coupling said outer crankshaft end portion and said powertransmitting means.
16. The power tool of claim 15 wherein:said powertransmitting means include an elongated tubular shaft connected at itsopposite ends to said working means and said power head means, and aflexible drive shaft extending through said tubular shaft andinterconnecting said working means and said coupling member.
17. Thepower tool of claim 15 wherein:said flywheel has spring biasedcentrifugal starter dogs operatively mounted on a forwardly disposedportion thereof, said support shaft portion has a longitudinallycentral, annular, rearwardly facing exterior shoulder thereon, saidhousing member has an interior shoulder spaced laterally outwardly fromand axially aligned with said support shaft portion shoulder, and saidstarter means include a starter pulley coaxially and rotatably mountedon a rear end portion of said support shaft portion, said pulley havingfront and rear flanges between which a starter rope may be wound, and arearwardly projecting drive hub having teeth thereon adapted tooperatively engage said starter dogs, a torsion spring circumscribingsaid support shaft portion, operatively connected to said pulley andcaptively retained between said shoulders and said front pulley flange,and a retaining member removably connected to said housing member andrearwardly overlying said rear flange in a manner captively retainingsaid pulley and said spring on said support shaft portion.
18. The powertool of claim 17 wherein:said starter means further comprisecircumferentially alignable depressions formed in said housing memberand a peripheral portion of said rear pulley flange, and operative, whenaligned, to have a pin member or the like inserted therebetween torotationally lock said pulley against the biasing force of said springto facilitate the installation of a starter rope on said pulley.
19. Thepower tool of claim 7 wherein:said shroud member has a rear end recessformed therein, and said engine has an externally mounted carburetorprotectively disposed within said recess.
20. The power tool of claim 19wherein:said engine has an air filter housing secured to said carburetorand also disposed within said recess.
21. The power tool of claim 7wherein:said shroud member has an external surface depression therein,and said power tool further comprises a shell member secured to saidshroud member to define with said depression a fuel tank portion of saidpower tool.
22. The power tool of claim 7 wherein:said shroud member hasa front upper portion rearwardly bounded by an upper rear wall portionof said shroud member, and a lower rear portion projecting rearwardlyfrom said upper rear wall portion, and said engine further includes acarburetor externally mounted on said upper rear wall portion, and afuel tank mounted atop said front upper shroud portion and having a rearportion which overlies and protects said carburetor.
23. The power toolof claim 7 wherein:said power head means further include an operatorhandle structure positioned above and interconnected between said shroudmember and said housing section.
24. The power tool of claim 23wherein:said operator handle structure has a front end portion connectedto said housing section, and a rear end portion defined by a fuel tanksecured to said shroud member.
25. The power tool of claim 24wherein:said shroud member has a front upper portion rearwardly boundedby an upper rear wall portion of said shroud member, and a lower rearportion projecting rearwardly from said upper rear wall portion, saidengine further includes a carburetor externally mounted on said upperrear wall portion, and said fuel tank is spaced upwardly from said lowerrear shroud member portion and defines therewith a protective recess inwhich said carburetor is disposed.
26. The power tool of claim 25wherein:said engine further includes an air filter housing connected toa rear portion of said carburetor and disposed within said protectiverecess. | 2024-03-22 | 1988-09-30 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1989-06-27"
} |
US-13383787-A | Thin film forming apparatus
ABSTRACT
A thin film forming apparatus of the present invention comprises: a reaction chamber for receiving therein a substrate and a thin film forming gas; an ultraviolet laser beam oscillator for generating an ultraviolet laser beam for causing dissociation of the thin film forming gas to thereby form a thin film over the surface of the substrate; and a plasma generator for generating ions for controlling growth of a thin film.
BACKGROUND OF THE INVENTION
The present invention relates to a thin-film forming apparatus utilizinglaser beam and more aparticularly to a thin-film forming apparatuscapable of forming thin diamond films, cubic system boron nitride andthe like having thermal conductivity, electrical insulation propertiesand a high degree of purity at a high rate over the surfaces ofsubstrates which are substantially maintained at room temperature as anaverage temperature while controlling the qualities of thin films beingformed
In order to carry out the thin film forming techniques in practice, ithas been desired that a thin film forming process be carried out at lowtemperatures so that the adverse thermal effects on the substrates canbe avoided and concurrently that the thin film formation can be carriedout at a high growth or deposition rate in order to reduce the thin-filmformation costs.
In order to attain the above-mentioned conditions, there has beenproposed a novel thin-film forming technique called a laser CVD processin which thin-film-forming gases are optically dissociated byhigh-energy photons released from a ultraviolet laser beam. According tothis process, gases can be dissociated only by the high-energy photonsso that the process has a feature that the reaction products can bedeposited on the substrate at a high deposition rate at lowtemperatures. However, it has been difficult to form high-quality thinfilms in a stable manner, since there is not provided a mechanism forcontrolling the composition of the reaction products resulting from thereaction between the photons and the thin-film-forming gases or forcontrolling the process for forming a thin film of a reaction product ona substrate.
FIG. 1 is a sectional view of a conventional laser beam CVD apparatusutilizing a laser beam which is disclosed, for instance, in AppliedPhysics Letter, Vol 43, No. 5, pp 454-456.
In FIG. 1, reference numeral 1 represents an ultraviolet laser beamoscillator; 2, an ultraviolet laser beam; 3, a cylindrical telescope forattaining an energy density of the laser beam required for dissociationof thin-film-forming gases; 4, a window adapted to isolate thethin-film-forming gas atmosphere from the surrounding atmosphere and tointroduce the ultraviolet laser beam 2 into a reaction chamber 5; 51, aninlet port for introducing the thin-film-forming gas mixture into thereaction chamber 5; 52, an output port for discharging thethin-film-forming gas mixture to the surrounding atmosphere; 6, asubstrate; 7, a suceptor incorporating therein a heater for heating thesubstrate 6.
The ultraviolet laser beam 2 emitted from the ultraviolet laseroscillator 1 is concentrated by the cylindrical telescope 3 so as tohave an energy density sufficient to cause the dissociation of thethin-film-forming gases and then is introduced through the window 4 intothe reaction chamber 5 having the thin-film-forming gas atmosphere. Theultraviolet laser beam 2 passes in parallel with the substrate 6 alongthe path spaced apart therefrom by a few millimeters, thereby causingthe dissociation of the thin-film-forming gases. The reaction product isdeposited over the surface of the substrate 6 by diffusion.
However, there is a problem in that a thin film formed by the reactionproduct resulting from the dissociation of the thin-film-forming gasesby the high-energy photons includes impurities depending upon the kindsof thin-film-formation gases in that a desired crystal structure may notbe obtained as expected. In view of the above, the conventional CVDapparatus shown in FIG. 1 employs a process wherein the surface of thesubstrate is heated to temperature of hundreds of degrees (° C) by theheater incorporated in the suceptor, thereby controlling the quality ofa thin film being deposited on the substrate.
As described above, it has been difficult to obtain thin films havingdesired properties or quality by the conventional laser beam thin-filmforming apparatus, since they have no mechanism for controlling thereaction products. In addition, in order to control the quality of athin film, only the process of heating the surface of the substrate tohundreds of degrees (° C) has been used in the conventional apparatus Inother words, it is impossible to control the quality of the thin filmsat low temperatures.
SUMMARY OF THE INVENTION
The present invention is made to overcome the above and other problemsencountered in the conventional thin-film forming apparatus, andtherefore an object of the present invention is to provide a thin filmforming apparatus in which a thin film is formed at a low temperatureand at a high deposition rate by utilizing the dissociation ofthin-film-forming gases by the high-energy photons, with the step forforming a thin film being controlled so that the thin film having thequality as desired can be obtained.
Therefore, according to one aspect of the present invention, a thin filmforming apparatus comprises: a a reaction chamber for receiving thereina substrate and a thin film forming gas; an ultraviolet laser beamoscillator for generating an ultraviolet laser beam for causingdissociation of the thin-film-forming gas to thereby form a thin filmover the surface of the substrate; and a plasma generator for generatingions for controlling growth of a thin film.
According to the present invention, the thin-film-forming gases and thethin-film-forming controlling gas are supplied by independent systems,respectively, and the thin-film-forming gases are subjected to theultraviolet laser beam while the control gas is subjected to the plasmageneration process by the electron-cyclotron-resonance plasma generator(to be referred to as "the ECR plasma generator" in this specificationhereinafter). The plasma thus generated acts on the dissociatedthin-film-forming gases and the surface of the substrate, whereby thethin film having the desired quality can be obtained.
Furthermore, the present invention has another object to provide athin-film-forming apparatus in which a thin film is formed at a lowtemperature and at a high formation or deposition rate by utilizing thedissociation of the thin-film-forming gases due to the high energyphotons, with the plasma generator generating a plasma concurrently tocontrol the steps of forming a thin film so that the thin film havingdesired quality can be obtained in an efficient manner.
To achieve the above and other objects, according to another aspect ofthe present invention, a thin film forming apparatus comprises a firstchamber which is filled with thin-film-forming gases, a second chambercommunicated with the first chamber through a communication passage, asuceptor disposed in the communication passage for supporting asubstrate upon which is to be formed a thin film, an ultraviolet laserbeam oscillator for emitting an ultraviolet laser beam into the firstchamber thereby dissociating the thin-film-forming gases to form a thinfilm over the surface of the substrate, a plasma generator for emittingthe thin-film-formation control ions into the second chamber and adriving means for causing the alternate displacement of the substratesupported by the suceptor in relation to the first and second chambers.
According to the present invention, the first and second chambers aredefined and intercommunicated with each other through the communicationpassage so that there exists a pressure difference between them. Whenthe substrate is reciprocatedly transferred between the first and secondchambers, a thin film is deposited in the first chamber while the thinfilm formation is controlled in the second chamber by the plasmasupplied from the plasma generator.
The above and other objects, effects and features of the presentinvention will become more apparent from the following description ofthe preferred embodiments of the present invention in conjunction withthe accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a sectional view illustrating a conventional laser beamthin-film forming apparatus;
FIG. 2 is a sectional view of a first preferred embodiment of a laserbeam thin-film-forming apparatus in accordance with the presentinvention;
FIG. 3 is a sectional view of a second preferred embodiment of a laserbeam thin-film-forming apparatus in accordance with the presentinvention; and
FIG. 4 is a sectional view of the apparatus shown in FIG. 3.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
A thin film forming apparatus of the first preferred embodiment of thepresent invention will be described, with reference to FIG. 2. FIG. 2shows, especially, a thin diamond film forming apparatus to which isapplied the first embodiment of the present invention. In FIG. 2,reference numeral 1 designates an ultraviolet laser beam oscillator. 2designates an ultraviolet laser beam. 3 designates a cylindricaltelescope, and 4 designates a window. 5 designates a reaction or processchamber. 6 designates a substrate, and 70 designates a suceptor forsupporting the substrate 6. 8 designates an ECR plasma generator.Reference numeral 8a designates a plasma generation chamber. 8bdesignates an air-core coil for generating a magnetic field forconfining the plasma generated by the plasma generating chamber 8a, and8c designates a microwave (at a frequency of 2.45 GHz). The ECR plasmagenerator 8 comprises the plasma generation chamber 8b, a microwavesource (not shown) for generating numeral 11 denotes a hydrogen plasma.12 denotes an ion-accelerating mesh electrode. 51 designates an inletport through which is supplied a thin-film-forming gas CH₄. 52designates a discharge port on the side of a vacuum pump. 53 designatesan inlet port through which is introduced an ECR plasma source gas H₂.54 designates an outlet port on the side cf a vacuum pump (not shown).
The thin-film-forming gas of methane (CH₄) (at tens of Torr) in thereaction chamber 5 is optically dissociated by the two-photon absorptionof the ultraviolet laser beam 2 (having a peak output of 10 μm/cm² )such as a ArF exima laser which has been shaped by the cylindricaltelescope 3 to have a desired energy density. On the other hand, thehydrogen plasma or hydrogen ions in the plasma generation chamber 8a aresuitably accelerated by the ion acceleration mesh electrode 12 andimpinge on the surface of the substrate 6 in the chamber 5. During theinitial stage of the formation of a thin film, the hydrogen ions impingethe surface of the substrate 6 to form crystal deformations so that thecore required for the growth of a diamond crystal can be easily formed.In the step after the formation of the core, when the energy of abouthundreds of electron volts (eV) is provided to the hydrogen ion, theetching process is accelerated so that the growth of a graphite crystalwhich occurs simultaneously with the growth of a diamond crystal can besuppressed. As a result, a thin diamond film having desired qualitiesand containing no impurity at all can be obtained. Furthermore, the ECRplasma generator (Electron-Cyclotron-Resonance plasma generator) has theability of increasing the plasma density 10 or more times as high asthat of the plasma density attained by other types of plasma generatorsso that the growth of a thin film is carried out at a high depositionrate and is satisfactorily controlled. Furthermore, according to thepresent invention, it is possible to achieve the film formation withkeeping the substrate at room temperature without heating.
Although the formation of the thin diamond film is described above, itis to be understood that the first embodiment of the present inventioncan be equally used to form other various films. For instance, when amixture of N₂ and H₂ is supplied from the plasma source while B₂ H₆ isintroduced into the reaction chamber 5 as film forming gas, acubic-system boron nitride film having a high degree of quality can beobtained at a low temperature substantially equal to room temperatureand at a high deposition rate in the same manner as described above.
In the film forming apparatus of the first embodiment shown in FIG. 2,the ECR plasma generating device 8 may be replaced with anothergeneral-type microwave discharge plasma generating device using amagnetic field. In this case, the microwave 8c has a frequency in arange of from hundreds of MHz to tens of GHz. In such a microwavedischarge plasma generating device, the pressure of the generatedhydrogen plasma can be selected or changed in a range cf from 10⁵ totens of torr. Therefore, in order to form a film on a substrate, themicrowave discharge plasma generating device can be coupled with thereaction chamber 5 by maintaining the pressure of the hydrogen plasmaequal to the pressure of the film-forming gas in the reaction chamber 5,through selecting the pressure of the hydrogen plasma in the range offrom 10⁻⁵ to tens of torr. As a result, it becomes possible to selectthe pressure condition in accordance with the purpose or aim ofoperating the film forming apparatus. For example, in order to form afilm with uniform thickness, a low pressure (about 10⁻⁵ torr) may beselected. In this case, however, the film forming rate is low. In orderto form a film with high rate or speed, a high pressure (about tenstorr) can be selected. Particularly, the preferable pressure of thehydrogen plasma gas and the film-forming gas for practical use of thefilm forming device may be in a range a of few torr to tens of torr. Forexample, the film forming device shown in FIG. 2 with the plasmagenerating device 8 comprising the microwave discharge plasma generatingdevice may be operated with the pressure of the plasma gas and thefilm-forming gas being about 10 torr.
As described above, the film formation apparatus of the first embodimentof the present invention comprises the reaction chamber in which isplaced the substrate, the ultraviolet laser oscillator for emitting theultraviolet laser beam which causes the dissociation of the thin-filmforming gas to thereby form a thin film over the surface of thesubstrate, and the microwave-used discharge plasma generating deviceusing a magnetic field, such as an electron-cyclotron-resonance typeplasma generator, for generating ions for controlling the growth of athin film. As a result, the growth of desired crystal cores are enhancedwhile the growth of undesired crystal cores are suppressed. Therefore,the present invention can provide a thin-film-forming apparatus in whichthe control of the qualities of thin films can be easily carried out andit becomes possible to grow a thin film having a high degree of qualityat a low temperature substantially equal to room temperature but at ahigh deposition rate.
A thin film forming apparatus of a second preferred embodiment of thepresent invention will be described hereinafter with reference to FIGS.3 and 4. FIG. 3 shows, especially, a thin diamond film forming apparatusto which is applied the second embodiment of the present invention. FIG.4 is a perspective view of the apparatus shown in FIG. 3. In FIG. 3,reference numeral 5a represents a first chamber which receives through awindow 4 an ultraviolet laser beam 2 emitted from an ultraviolet laseroscillator 1 and shaped by a cylindrical telescope 3 into a laser beamhaving a desired energy density. A thin-film-forming gas is introducedthrough an inlet port 51 into the first chamber 5a. Reference numeral 5bis a second chamber which is communicated with the first chamber 5bthrough a communication passage 5c. 13 designates a driving device forrotating a suceptor 70 sc that a substrate 6 alternately passes throughthe first and second chambers 5a and 5b. 8 designates anelectron-cyclotron-resonance plasma generator (ECR plasma generator).Except the above-mentioned reference numerals, the same referencenumerals are used to designate similar parts shown in FIG. 2. In FIG. 3,the ultraviolet laser beam 2 is shown as traveling from the left side tothe right side, but it is noted that the ultraviolet laser beam 2actually travels from a window behind the first chamber 5a to the frontwindow, as shown in FIG. 4.
Next, the mode of operation of the apparatus of the second preferredembodiment with the above-mentioned construction will be described Athin-film-forming gas of methane (CH₄) (at tens of Torr) is introducedthrough the inlet port 51 into the first chamber 52 and is opticallydissociated by the two-photon absorption of the ultraviolet laser beam 2(having a peak output of 10 μm/cm²) such as the ArF exima laser shapedby the cylindrical telescope 3 to have a suitable level of energydensity.
Meanwhile, the hydrogen ions generated by the ECR plasma generator 8 areaccelerated to a suitable velocity by the ion-acceleration meshelectrode 12 and impinge upon the surface of the substrate 6 within thesecond chamber 5b to form crystal deformations on the surface of thesubstrate 6 so that the formation of a core for the growth of thediamond crystal is facilitated. When the hydrogen ion is given hundredsof electron volts (eV) after the formation of the core, the etchingprocess is enhanced so that the growth of graphite crystals which occurssimultaneously with the formation of the growth of diamond crystals issuppressed. As a result, a diamond thin film having a high degree ofquality and containing no impurity can be obtained. The ECR plasmagenerator 8 can increase the plasma energy 10 or more times higher thanthe energy obtained by other general types of plasma generators so thatthe process for forming a thin film can be accomplished at a high growthrate and can be satisfactorily controlled. In addition, during thegrowth of a thin film, the substrate can be maintained at a lowtemperature substantially equal to room temperature so that it is notrequired to heat the substrate.
According to the second embodiment, the reaction chamber is divided intothe first chamber 5a in which a thin film is formed and the secondchamber 5b in which the thin film being formed is subjected to thebombardment of the plasma ions and the first and second chambers 5a and5b are intercommunicated with each other through a communication passage5c in which is disposed the substrate 6. Therefore, according to thesecond embodiment, in the case where there exists a difference betweenpreferable pressures for thin film forming gas and for plasma gas, it ispossible to maintain a pressure difference between the first and secondchambers 5a and 5b. In other words, even where a preferable pressure ofthe thin film forming gas atmosphere is in a range of 10⁰ to tens ofTorr but the ion atmosphere pressure for plasma is in a range of 10⁻⁵ to10⁻³ Torr, it is possible to maintain pressure difference between thefirst and second chambers 5a and 5b. Furthermore, in order to ensure theabove-mentioned pressure difference, the sizes of the communicationpassage 5c and the outlet ports 52 and 55 are suitably selected and thegas discharge rate is suitably controlled. For instance, it ispreferable that the substrate 6 and the wall 5d are spaced apart fromeach other by a few millimeters.
Under these conditions, the suceptor 7 upon which is mounted thesubstrate 6 is rotated or moved in translation by the suceptor drivingdevice 13, so that the surface of the substrate 6 is alternatelytransferred into the plasma-ion atmosphere and the thin-film-formingatmosphere. More particularly, in the second chamber 5b, the core forthe crystal growth is formed on the surface of the substrate 6. Then,the substrate is moved into the first chamber 5a due to the displacementof the suceptor 7 sO that a thin film is formed on the surface of thesubstrate 6 with methane gas dissociated by the laser beam. After thethickness of the thin film is increased of the order on tens ofangstrom, the substrate is returned into the second chamber 5b so thatgraphite which has grown simultaneously with the growth of diamondcrystals is removed by the hydrogen ions. In this manner, the filmformation (that is, the growth of diamond crystals) and the removal ofgraphite are repeated so that it becomes possible to obtain a thindiamond film having a satisfactory degree of quality.
In this case, it may be considered that it is sufficient to only rotatethe suceptor 7, but when the rotary motion of the suceptor 7 is combinedwith the translation motion (parallel displacement), a thin film can beformed more uniformly.
Although the above description of the second preferred embodiment of thepresent invention is related to an apparatus of formation of a thindiamond film, it is to be understood that as in the case of the firstembodiment, the second preferred embodiment is not limited to theformation of thin diamond films and that it can be equally used forforming various thin films. For instance, when the mixtured gas of N₂and H₂ is a plasma source gas while B₂ H₆ is made to flow through thereaction chamber, a high quality cubic-system boron nitride can beformed in the same manner as described above at a high growth rate whilethe substrate is maintained at a relatively low temperaturesubstantially equal to room temperature.
As described above, the film forming apparatus of the second preferredembodiment of the present invention comprises the first chamber filledwith a thin-film-forming gas or mixture, the second chamberintercommunicated with the first chamber through the communicationpassage, a suceptor disposed in the communication passage for supportingthe substrate, an ultraviolet laser beam oscillator for emitting theultraviolet laser beam into the first chamber so as to cause thedissociation of the thin-film-forming gas to thereby form a thin filmover the substrate, the plasma generator for generating a plasma whichin turn supplies the thin-film-forming controlling ions into the secondchamber, and the driving device capable of alternately moving thesubstrate on the suceptor between the first and second chamber.Therefore, the present invention has the effects that the quality of athin film can be easily controlled and that the thin film can beuniformly formed at a high growth rate while the substrate is maintainedat a relatively low temperature substantially equal to room temperature.
In addition, various modifications and variations can be effectedwithout departing from the scope of the present invention.
What is claimed is:
1. A thin forming apparatus, comprising:a reactionchamber for receiving therein a substrate and a thin film forming gas;an ultraviolet laser beam oscillator for generating an ultraviolet laserbeam which passes in parallel with said substrate along a path spacedapart therefrom for causing dissociation of said thin film forming gasto thereby form a thin film over the surface of said substrate; and aplasma generator for generating ions for controlling growth of a thinfilm, wherein said reaction chamber comprises: a first chamber forreceiving therein a thin film forming gas, said first chamber receivingsaid laser beam from said laser beam oscillator; a communication passageportion communicated with said first chamber; a second chambercommunicated with said communication passage portion, said secondchamber receiving said ions generated in said plasma generator; asuceptor disposed in said communication passage portion for supportingsaid substrate thereon; and a driving means for alternately moving saidsuceptor between said first and second chambers.
2. A thin film formingapparatus, comprising:a first chamber for receiving a thin film forminggas; a second chamber intercommunicated with said first chamber througha communication passage; a suceptor disposed in said communicationpassage for supporting a substrate upon which is to be formed a thinfilm; an ultraviolet laser beam oscillator for generating and emittingan ultraviolet laser beam into said first chamber so as to causedissociation of said thin-film forming gas, thereby forming a thin filmover said substrate; a plasma generator for feeding into said secondchamber ions for controlling the growth of a thin film; and a drivingmeans for alternately moving said suceptor between said first and secondchambers. | 2024-03-22 | 1987-12-16 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1991-01-22"
} |
US-46417265-A | Apparatus for refloating submerged bodies
May 30, 1967 (U0 R D ET AL APPARATUS FOR REFLOATING SUBMERGED BODIESFiled June 15, 1965 2 Sheets-Sheet 1 y 1967 'IKUO HARADA ET AL 3,322,088
APPARATUS FOR REFLOATING SUBMERGED BODIES Filed June 15, 1965 2Sheets-Sheet 2 United States Patent Ofiice Patented May 30, 19673,322,088 APPARATUS FOR REFLOATING SUBMERGED BODIES limo Harada,Tokorozawa-shi, and Talreshi Ishirnoto,
Oita-ken, Japan, assignors to Asahi Kasei Kogyo Kabushiiti Kaisha,Osaka, Japan, a corporation of Japan Filed June 15, 1965, Ser. No.464,172 Claims priority, application Japan, Nov. 7, 1964, 39/ 86,339 2Claims. (Cl. 11454) This invention relates to apparatus for refioatingsubmerged bodies and more particularly to a novel apparatus of this kindin which combustion gas generated by the combustion of propellants iscollected in a gas vessel to provide required buoyancy to refioat asubmerged body.
It is an object of the present invention to provide a novel refioatingapparatus adapted for connection with a sunken ship or freight to makeit buoyant by the utilization of buoyancy provided by combustion gas ofpropellants collected in a gas vessel.
Another object of the present invention is to provide a self-buoyantunderwater apparatus which can be integrally coupled to a submersiblecamera, a rocket type instrument for collecting matter existing at thesea bottom, any other oceanographic surveying instrument or any otherunderwater instrument for refioating such instrument after theinstrument has completed its duty.
A further object of the present invention is to provide a refioatingapparatus of the kind described which can be obtained at low cost, canbe handled in a simple and easy manner and can safely be operated.
According to the present invention, there is provided an apparatus forrefloating a submerged body comprising gas generator means containingpropellants therein so as to generate gas by the combustion or pyrolysisof the propellants, a gas vessel for collecting therein the gasgenerated in said gas generator means, and connecting means forproviding connection with the submerged body. The above and otherobjects, advantages and features of the present invention will becomeobvious from the following description with reference to theaccompanying drawings, in which:
FIG. 1 is a vertical sectional view of an embodiment of the refioatingapparatus of the present invention which can conveniently be used forthe reflotation of a heavy submerged body;
FIG. 2 is a vertical sectional view of another embodiment of therefloating apparatus of the present invention;
FIG. 3 is a front elevational view, partly in section and cut away, ofstill another embodiment of the refloating apparatus of the presentinvention; and
FIG. 4 is a vertical sectional view of a self-buoyant underwaterapparatus comprising the combination of an underwater measuringinstrument and the refioating apparatus according to the presentinvention.
At first an outline of principal components of the apparatus embodyingthe present invention will be described. According to the presentinvention, the buoyancy generating section which is common to all of theembodiments as will be described later comprises (a) a combustioncylinder or gas generator having therein propellants and an igniter; (b)a gas vessel which may be provided with a gas cooler as the case may be;and (c) connecting means for providing connection with a body to berefloated.
The combustion cylinder is a closed pressure vessel having a gasdischarge port and contains therein propellants and an igniter meanstherefor. Combustion of the propellants in the combustion cylinder takesplaces by the actuation of a switch means associated with a source ofcurrent supply. A battery is ordinarily used as the source of currentsupply and a manual or automatic switch of any known structure may beused as the switch means. The gas discharge port is generally closedwatertight by a Waterproof plug means to prevent intrusion of water intothe combustion cylinder, but the structure is such that the plug meansis easily removed from the port by the internal pressure in thecombustion cylinder as soon as the combustion takes place. However, theplug means may be dispensed with when the gas vessel is of closedstructure.
The propellant and priming material may be any of the so-calledcomposite propellants recently employed for the rocket propulsion orsuch materials as smokeless powder and black powder which gasify througha chemical reaction commonly called combustion. It is to be understoodthat the propellant and priming material employed in the inventiveapparatus do not include high explosives such as dynamite which is usedfor the purpose of blasting operation by so-called detonation.
The gas vessel employed in the invention is a closed or a semi-closedvessel which is capable of expansion and contraction in its volume andmay be made of an organic soft material such as rubber or of a metal inthe form, for example, of bellows. In one embodiment of the invention,the gas vessel is a rigid hollow semi-closed vessel. The gas vessel mayhave any suitable shape, depending on the type of service intended,including a spherical, cylindrical, boat-like and doughnut-like shape.
The connecting means in the inventive apparatus may have any suitableknown structure depending on the type of body to be refioated, but mayobviously be dispensed with When such connecting means is fittedintegrally to a submerged body to be refioated.
The manner of collecting gas in the gas vessel from the combustioncylinder can broadly be classified into two methods, that is, (i) amethod for collecting gas in a rigid hollow vessel in a manner toreplace water therein by the gas, and (ii) a method for directlycollecting gas in an expansible closed vessel. In addition to the abovetwo methods, there may be a case in which a gas cooler is associatedwith the gas vessel in order to cool the gas being collected into thegas vessel.
In FIG. 1, there is shown one form of the refloating apparatus of thisinvention. The apparatus of FIG. 1 is of the type in which water ispreliminarily suitably filled in a rigid hollow gas vessel of a materialsuch as iron and the pressure of the combustion gas obtained bycombustion of the propellant is utilized to force the water out of thegas vessel so that the gas can be collected therein in water replacingrelation. As shown in FIG. 1, the refioating apparatus comprises ahollow rigid gas vessel 6 made of iron, and a combustion cylinder or gasgenerator 4 mounted in watertight relation in the top end of the gasvessel 6. A connecting member 9 consisting of an iron chain and anengaging hook depends from the lower end of the gas vessel 6. Anignition switch 3 is suitably mounted on the combustion cylinder 4 so asto cooperate with an ignition means 2 to cause the combustion ofpropellant l in the cylinder 4. The combustion cylinder 4 has aplurality of gas discharge apertures 5 at its bottom which are normallyclosed by a waterproof film. The gas vessel 6 is provided with aplurality of communication openings 8 which are normally closed by meanssuch as pressure regulating check valves. Thus the communicationopenings 8 function to discharge the water preliminarily admitted intothe gas vessel 6 and at the same time to discharge an excess of thecombustion gas and that portion of the combustion gas which may gain inits volume due to reduced water pressure resulting from the floatingmovement of the gas vessel so that the acceleration during the floatingmovement can thereby be maintained constant. The refioating apparatus ofFIG. 1 operates in the following manner.
At first, a suitable amount of Water is admitted into the rigid hollowgas vessel 6, which is then gravitated to the sea bottom. After theapparatus is connected with a body to be refloated (not shown) by theconnecting member 9, the ignition switch 3 is suitably depressed toactuate the ignition means 2 so that combustion of the propellant 1within the combustion cylinder 4 takes placefThe combustion gas, as itgains in its pressure, forces through the waterproof film hermeticallysealing the discharge apertures 5 into an air space 7 in the gas vessel6 and, as the pressure further increases, forces the water within thegas vessel 6 outwardly through the communication openings 8. Whileforcing the water outwardly, the combustion gas fills within the vessel6 to generate buoyancy, which is transmitted to the submerged body to berefioated by way of the connecting member 9 so that the submerged bodycan be refioated by the refloating movement of the refloating apparatus.
Another embodiment of the refioating apparatus of this invention asshown in FIG. 2 is provided with a collapsible or expansible sphericalclosed gas vessel 6 of soft flexible material such as rubber-coatednylon cloth. A gas cooler 10 is disposed intermediate a combustioncylinder 4 and the gas vessel 6 in order to prevent the gas vessel frommelting due to the high temperature of the combustion gas. The gascooler 10 consists of a cooling coil of copper or the like which opensat one end into the gas vessel 6 as at 11 and at the other end into thecombustion cylinder 4 as at 5. A plurality of supports 12 connect thegas vessel 6 with the combustion cylinder 4. The refioating apparatus ofFIG. 2 operates in the following manner. Unlike the apparatus of FIG. 1,the apparatus presently described is at first in its collapsed orcontracted state and ton collector, mud collecting apparatus,terrestrial magnetism meter, and may other known measuring and surveyinginstruments employed for the oceanographic surveying. The apparatus ofFIG 4 differs from the apparatus of FIGS. 1, 2, and 3 in that the formeris thrown into sea in a state that the refloating apparatus ispreliminarily unitarily coupled to the measuring instrument, whereas thelatter are led towards a submerged body and connection therebetween iseffected at the sea bottom. .It will be understood that the merit ofself-buoyancy can thus be derived.
By way of an example of such underwater measuring apparatus, there isshown in FIG. 4 a self-buoyant, ropeless, sea bottom sample collectingapparatus which comprises a rocket type sea-bottom sample collectorunitarily coupled to a refioating apparatus as described previously. Theapparatus of FIG. 4 consists of a mud collecting member D of tubularshape, a rocket section A for generating thrust for driving the mudcollecting member D into the sea bottom, a rocket section B forgenerating thrust for is brought towards the sea bottom in the collapsedstate as it generates no buoyancy. After the apparatus is connected witha submerged body (not shown) by a connecting member 9, ignition switch 3is suitably depressed to actuate ignition means 2 so that combustion ofpropellant retracting the mud collecting member D away from the seabottom, and a refioating section C'utilizing the buoyancy provided bycombustion of propellant. The rocket sections A and B have thereincomposite propellants 21 and 22 and ignition means 21' and 22',respectively, and delay means is provided so that combustion of thepropellant 22 by the ignition means 22 takes place in 0 5 seconds afterthe ignition of the propellant 21 by the ignition means 21 is etfected.A plurality of rocket nozzles 24 and 25 are provided at the respectiverocket sections A and B at suitable angle with respect to the axis 1 inthe combustion cylinder 4 takes place. Combustion gas thereby producedis led through the gas discharge aperture 5, the cooling coil 10 and theentrance aperture 11 into the gas vessel 6 while being suitably cooledby water W surrounding the cooling coil 10 to expand the collapsed gasvessel 6 into a spherical shape as shown by reference numeral 7.Buoyancy thus provided by the expanded gas vessel 6 can sufiicientlyrefioat the submerged body.
Still another embodiment of the refioating apparatus of the presentinvention as shown in FIG. 3 is provided with a collapsible semi-closedgas vessel 6 of metallic or soft material and is so arranged thatcombusition gas from a combustion cylinder 4 is directly discharged intowater for being cooled by the surrounding water and then collected inthe semi-closed vessel 6 through an entrance opening disposedimmediately above the combustion cylinder 4. The semi-closed vessel 6 ofthis embodiment is shown as a bellows 6a of aluminum. The gas vessel 6is supported on the combustion cylinder 4 by a plurality of supports 13and the combustion cylinder 4 is provided with a plurality of gasdischarge apertures 5 normally closed by a waterproof film 5a of rubberor like material. The refloating apparatus of this embodiment operatesin a manner generally similar to the previously described embodiments.After the apparatus is connected with a submerged body (not shown) onthe sea bottom by a connecting member 9, ignition switch 3 is suitablydepressed to cause combustion of propellant 1 in the combustion cylinder4. Combustion gas, as it gains in pressure, breaks the waterproof film5a closing the discharge apertures 5 and enters into Water. Thecombustion gas passes upwardly in the form of bubbles while beingsuitably cooled by the water and is collected in the semi-closed gasvessel 6 through the, opening disposed immediately above the dischargeapertures 5. The combustion gas progressively filling the gas vessel 6causes the vessel 6 to expand and buoyancy can thereby be provided.
of the apparatus so that a downwardly-driving force and rotating powerare imparted by the rocket nozzles 24 while an upwardly driving'forceand rotating power are imparted by the rocket nozzles 25. The mudcollecting member D may be of any known structure and'may consist of asample collecting tube of polyvinyl chloride covered by an iron pipe,and a check valve may be mounted at the lower end of the samplecollecting tube to prevent a backward flow of the sample mud during theretraction of the mud collecting member D from the sea bottom. Therefioating or buoyancy generating section C contains in its lowerportion a battery 21" of 12 volts, a suitable amount of compositeporpellant 23 and an ignition means 23 which is associated with a delaymeans so that combustion of the propellant 23 takes place about 30seconds after the ignition of the propellant 21 by the ignition means21'. A pressure sensitive switch means 22" is provided to actuate theignition means 21', 22 and 23' when the apparatus engages the seabottom. A plurality of gas discharge apertures 26 are provided in theupper portion of the buoyancy generating section C and are normallycovered by a waterproof film 26 of material such as rubber to preventintrusion of water into the propellant 23 through these apertures 26. Acollapsible semi-closed gas vessel 27 of material such as rubber-coatednylon cloth having a bottom opening is accommodated in its collapsedstate in a cylinder 28 and a cap 29 and is connected to the cylinder 28by a chain 27 of metallic material. During the downward movement of theapparatus towards the sea bottom, water intrudes into the cylinder 28 sothat the discharge apertures 26 are submerged in the water. A parachute30 is fitted to the top end of the cap 29 in order to cause theapparatus to move towards the sea bottom in its upright posture.
The apparatus of FIG. 4 operates in the following manner. When theapparatus after having been entirely assembled is thrown into sea, thedownward movement of the apparatus is restricted by the parachute 30 sothat the apparatus gravitates towards the sea bottom in its uprightposition. As soon as the tip of the mud collecting member D engages thesea bottom, shock imparted to the apparatus actuates the pressuresensitive switch means 22" which in turn places in operation theignition means 21', 22 and 23 for the respective sections A, B and C. Atfirst the ignition means 21 operates instantaneously to cause thecombustion of propellant 21 and a rocket effect resulting from theforcing of the combustion gas through the rocket nozzles 24 generates adownwardly driving force and rotating power so that the mud collectingmember D is driven into the sea bottom and a sample of mud is collectedtherein. 5 seconds thereafter, the delay means causes the ignition means22 to operate and combustion of the propellant 22 generates an upwardlydriving force and rotating power so that the mud collecting member D ispulled out of the sea bottom. About 30 seconds thereafter, the delaymeans places the ignition means 23 in operation and combustion of thepropellant 23 thereby takes place. Combustion gas breaks through thewaterproof film 26' and is discharged through the discharge apertures 26to force the collapsed gas vessel 27 and the cap 29 outwardly. Thecombustion gas is then collected in the gas vessel 27 through its bottomopening while being cooled by water within the cylinder 28 and theentire apparatus can be refloated to the surface of .the sea by thebuoyancy generated by the gas collected in the gas vessel.
From the foregoing detailed description it will be understood that animportant feature of the present invention is that combustion gas ofpropellants is utilized to provide buoyancy for the reflotation ofsubmerged weighty bodies, thus eliminating the use of prior refioatingmeans such as wire ropes and compressed air provided by air compressors.Advantages derivable from the invention by virtue of such unique featureinclude compactness in the structure of the apparatus, low manufacturingcost, excellant mobility, ease of handling and ability to make automaticoperation, as will be readily understood.
What is claimed is:
1. An apparatus for refloating a submerged body com prising gasgenerator means containing propellants therein so as to generate gas bythe combustion or pyrolysis of the propellants, a collapsible gas vesselspaced above said gas generator means and having a bottom opening forcollecting therethrough the gas generated in said gas generator means,means connecting said gas vessel with said gas generator means in spacedapart relation from each other, and conduit means defining an indirecttortuous path for the flow of gases from the generator means to the gasvessel, said conduit means being in heat exchange relation with theambient fluid whereby the generated gas can directly be cooled bysurrounding water during its upward movement into said gas vessel.
2. An apparatus as claimed in claim 1 wherein said conduit means is acoil.
References Cited UNITED STATES PATENTS 557,396 3/1896 Kindt 114-54605,231 6/1898 Matignon v11454 3,080,844 3/1963 Lehmann 11454 MILTONBUCHLER, Primary Examiner. ANDREW H. FARRELL, Examiner.
1. AN APPARATUS FOR REFLOATING A SUBMERGED BODY COMPRISING GAS GENERATORMEANS CONTAINING PROPELLANTS THEREIN SO AS TO GENERATE GAS BY THECOMBUSTION OR PYROLYSIS OF THE PROPELLANTS, A COLLAPSIBLE GAS VESSELSPACED ABOVE SAID GAS GENERATOR MEANS AND HAVING A BOTTOM OPENING FORCOLLECTING THERETHROUGH THE GAS GENERATED IN SAID GAS GENERATOR MEANS,MEANS CONNECTING SAID GAS VESSEL WITH SAID GAS GENERATOR MEANS IN SPACEDAPART RELATION FROM EACH OTHER, AND CONDUIT MEANS DEFINING AND INDIRECTTORTUOUS PATH FOR THE FLOW GASES FROM THE GENERATOR MEANS TO THE GASVESSEL, SAID CONDUIT MEANS BEING IN HEAT EXCHANGE RELATION WITH THEAMBIENT FLUID WHEREBY THE GENERATED GAS CAN DIRECTLY BE COOLED BYSURROUNDING WATER DURING ITS UPWARD MOVEMENT INTO SAID GAS VESSEL. | 2024-03-22 | 1965-06-15 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1967-05-30"
} |
US-79513791-A | Moisture-responsive valve
ABSTRACT
A moisture-responsive valve includes a water-swellable body within a housing adjacent a moisture-permeable wall thereof for controlling the movements of a valve member with respect to a valve seat in response to the moisture passing through the moisture-permeable wall. The valve member is floatingly mounted between a first spring interposed between the valve member and the housing and urging the valve member away from the valve seat, and a second spring interposed between the valve member and the water-swellable body and urging the valve member towards the valve seat.
FIELD AND BACKGROUND OF THE INVENTION
The present invention relates to a moisture-responsive valve, andparticularly to such a valve for use in controlling the supply of waterto plants in accordance with the moisture content of the soil in whichthe plants are grown.
Many moisture-responsive valves have been developed for use in waterirrigation systems in order to control the supply of water to the plantsin accordance with the moisture content of the soil. Such valves arewidely used in irrigation systems wherein the water is supplied to thewater irrigation devices periodically (e.g., water sprinklers), orcontinuously (e.g., water drippers), until the water content of the soilreaches a predetermined level, whereupon the supply of water isautomatically terminated. Examples of known valves of this type aredescribed in U.S. Pat. Nos. 4,648,555 and 4,696,319.
Such known moisture-responsive valves commonly include amoisture-swellable body which controls the flow. However, the knownconstructions generally do not permit the moisture-swellable body toexpand to its limit. As a result, the moisture-swellable body may besubjected to a large force which can seriously degrade the body andsubstantially shorten its useful life.
OBJECT AND BRIEF SUMMARY OF THE INVENTION
An object of the present invention is to provide a moisture-responsivevalve having advantages in the above respects. Another object of theinvention is to provide a moisture-responsive valve which can beproduced in volume and at low cost.
According to the present invention, there is provided amoisture-responsive valve, comprising: a housing formed with an internalchamber, an inlet fitting connectible to a source of water for inlettingwater into the chamber via a valve seat within the chamber, and anoutlet opening for outletting water from the chamber; a valve assemblyin the chamber including a valve member movable towards and away fromthe valve seat for controlling the flow of water through the valve seatinto the chamber and out through the outlet opening; and awater-swellable body within the housing adjacent a moisture-permeablewall thereof for controlling the movements of the valve member inresponse to the moisture passing through the moisture-permeable wall;characterized in that the valve member is floatingly mounted between afirst spring interposed between the valve member and the housing andurging the valve member away from the valve seat, and a second springinterposed between the valve member and the water-swellable body andurging the valve member towards the valve seat.
According to further features in the preferred embodiments of theinvention described below, the housing includes a cylindrical sectionguiding the movement of the valve assembly towards and away from thevalve seat. More particularly, the housing cylinder is open at one endfacing the valve seat and is closed at its opposite end; and the valvemember is movable within the open end of the housing cylinder betweenthe first and second springs. The valve assembly further includes a basemember movable within the closed end of the housing cylinder between thewater-swellable body and the second spring.
Two embodiments of the invention are described below for purposes ofexample. In one described embodiment, the valve member is formed with aplurality of outer fingers engageable with the lower surface of thehousing, which is in the form of a cap, for keep the valve memberparallel to the valve seat; whereas in a second described embodiment,the outer diameter of the valve member is substantially the same as theinner diameter of the housing for guiding the movements of the valvemember.
Further features and advantages of the invention will be apparent fromthe description below.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is herein described, by way of example only, withreference to the accompanying drawings, wherein:
FIG. 1 is a longitudinal sectional view illustrating one form ofmoisture-responsive valve constructed in accordance with the invention;and
FIG. 2 is a longitudinal sectional view illustrating a second form ofmoisture-responsive valve constructed in accordance with the invention.
DESCRIPTION OF PREFERRED EMBODIMENTS
The moisture-responsive valve illustrated in FIGS. 1 and 1a is intendedfor embedding in the soil for controlling the supply of water to a plantautomatically in response to the moisture content of the soil in whichthe plant is grown. Thus, the valve comprises a housing, generallydesignated 2, secured to a ground stake 4 for embedding the housing inthe soil; an inlet fitting 6 for connecting the valve to a source ofwater; an outlet opening 8 for feeding the water to the soil; and avalve assembly, generally designated 10, for controlling the feeding ofthe water to the soil in response to the moisture condition of the soil.
The inlet fitting 6 is in the form of a cap removably attached to thehousing 2 by threads, shown at 12, to provide access into the interiorof the housing. It includes an annular barb 14 for attachment to a watersupply pipe (not shown), and a passageway 16 leading to a valve seat 18cooperable with valve assembly 10.
Housing 2 includes an outer cylinder 19, an inner cylinder 20, and anannular skirt 21, all integrally formed with the ground stake 4. The twohousing cylinders 19, 20 and the inlet fitting 6, define between them aninternal chamber 22 containing the valve assembly 10. The annular skirt21 is interrupted at one side to define the outlet opening 8 leadingfrom chamber 22.
The housing inner cylinder 20 includes an upper section 20a ofrelatively large diameter, and a lower section 20b of smaller diameterwater-swellable body 24 which swells when absorbing moisture from thesoil. For this purpose, the lower section 20b of housing cylinder 20 iswater-permeable to permit body 24 to absorb moisture from the soil.Valve assembly 10 carried at the upper section 20a of the inner housingcylinder 20 is cooperable with valve seat 18 of the inlet fitting 6 forcontrolling the inletting of water into chamber 22, in response to theheight of the moisture-swellable body 24, and thereby through the outletopening 8 to the soil.
Valve assembly 10 includes a valve member 30 adjacent the open end ofthe housing inner cylinder 20, and a base member, generally designatd40, adjacent the closed end thereof. Valve member 30 carries anelastomeric sealing element 31 cooperable with valve seat 18 of theinlet fitting 6 to control the flow of water from the inlet fitting intochamber 22 and out through the outlet opening 8. The movements of valvemember 30 towards and away from valve seat 18 are guided by a plurality(e.g., three) of outer fingers 32 engageable with the inner face of theouter housing cylinder 19.
Valve member 30 is floatingly mounted by a first coiled spring 34interposed between the upper face of the valve member and inlet fitting6 of the housing, and a second spring 35 interposed between the oppositeface of the valve member and the base member 40 of the valve assembly.For this purpose, inlet fitting 6 is formed with a conical projection 6acircumscribing valve seat 18 and receiving one end of the spring 34; andthe upper face of the valve member 30 is formed with a similar conicalprojection 36, circumscribed by an annular recess 37, for receiving theopposite end of spring 34. Similarly, the lower face of valve member 30is formed with a conical recess 38 circumscribing the respective end ofsealing element 31 for receiving one end of spring 35; and the upperface of base member 40 is formed with a conical projection 41 forreceiving the opposite end of spring 35.
Base member 40 includes a section 42 of circular configuration having anouter diameter substantially equal to the inner diameter of the uppersection 20a of housing cylinder 20, and at its opposite end anothersection 43 of circular configuration having a diameter substantiallyequal to the inner diameter of the lower section 20b of housing cylinder20 containing the water-swellable body 24. Base member 40 furtherincludes a rigid stem 44 integrally joining the two sections 42, 43together.
The moisture-responsive valve illustrated in FIGS. 1 and 1a is used inthe following manner:
The stake 4 of housing 2 is embedded in the soil so that the bottom ofskirt 21 sits on the surface of the soil.
As the moisture content of the soil decreases, the water-swellable body24, communicating with the soil via its moisture-permeable wall 20b,will shrink in volume, thereby lowering base member 40 of the valveassembly 10. Spring 34 will therefore lower the valve member 30 to movesealing element 31 away from valve seat 18, whereby water will flow fromthe inlet fitting 6, and valve seat 18, into chamber 22, and out throughthe outlet opening 8 to wet the soil.
As the soil moisture content increases, the volume of thewater-swellable body 24 likewise increases, thereby moving base member40 and valve member 30 towards the valve seat 18, until sealing element31 of valve member 30 engages the valve seat to terminate the flow ofwater into chamber 22 and out through the outlet opening 8. However,because of the reaction time delay, body 24 still continues to increasein volume for a short interval, thereby continuing to raise base member40, which firmly presses the sealing element 31 of valve member 30against valve seat 18.
After a time, the moisture content of the soil decreases, causing thewater-swellable body 24 also to decrease in volume. Initially, thisdecrease in volume merely releases the closing pressure applied by basemember 40 against the valve member 30; but when the soil moisturecontent decreases sufficiently, the force applied by base member 40 andits coiled spring 35 is not sufficient to overcome spring 34, whereuponthe latter spring moves the valve member 30 downwardly to cause itssealing element 31 to disengage from valve seat 18, thereby reopeningthe valve to the flow of water from inlet 6 into chamber 22 and outthrough the outlet opening 8.
It has been found that by floatingly mounting the valve member 30between the two coiled springs 34 and 35, the water-swellable body 24,e.g., a gel, is permitted to expand without creating excessive pressurewhich degrades the gel and shortens its useful life.
The moisture-responsive valve illustrated in FIG. 2 is of similarconstruction and operates in a similar maner as described above withrespect to FIG. 1, with the following exceptions:
In the FIG. 2 construction, the valve member, therein designated 130, ofthe valve assembly, includes a cylindrical section 133 having an outerdiameter substantially equal to the inner diameter of the upper section120a of housing cylinder 120 so as to guide the movements of the valvemember. In this case, the base member 140 is constituted of a circulardisc of an outer diameter substantially equal to the inner
diameter of the lower housing section 120b containing thewater-swellable body 124, and is formed centrally of its upper surfacewith a conical projection 141 for receiving one end of the lower coiledspring 135. The opposite end of the coiled spring 135 is received withina conical recess 138 formed in the lower end of section 133 of the valvemember 130.
In addition, the sealing element 131 of valve member 130, cooperablewith valve seat 118 of the inlet fitting 106, is in the form of a solidwasher fixed to the upper face of the valve member, particularly to itsconical projection 136 centrally of an annular recess 137. Recess 137receives one end of the upper coiled spring 134, the opposite end of thecoiled spring being received around a conical projection 106a formedwith the valve seat 118.
A still further modification in the valve illustrated in FIG. 2, ascompared to that of FIG. 1, is that the inlet fitting 106 is formed withan annular rib 114 adapted to be snap-fitted into an annular recessformed in the housing cylinder 119.
In all other respects, the construction and operation of themoisture-responsive valve illustrated in FIG. 2 are substantially thesame as described above with respect to FIG. 1.
While the invention has been described with respect to two preferredembodiments, it will be appreciated that many variations, modificationsand other applications of the invention may be made.
What is claimed is:
1. A moisture-responsive valve, comprising:a housingformed with an internal chamber, an inlet fitting connectible to asource of water for inletting water into the chamber via a valve seatwithin the chamber, and an outlet opening for outletting water from thechamber; a valve assembly in said chamber including a valve membermovable towards and away from said valve seat for controlling the flowof water through the valve seat into said chamber and out through saidoutlet opening; and a water-swellable body within said housing adjacenta moisture-permeable wall thereof for controlling the movements of saidvalve member in response to the moisture passing through saidmoisture-permeable wall; characterized in that said valve member isfloatingly mounted between a first spring interposed between the valvemember and the housing and urging the valve member away from said valveseat, and a second spring interposed between the valve member and thewater-swellable body and urging the valve member towards said valveseat.
2. The valve according to claim 1, wherein said housing includes acylinder guiding the movements of said valve assembly towards and awayfrom the valve seat.
3. The valve according to claim 2, wherein saidhousing cylinder is open at one end facing the valve seat and is closedat its opposite end; said valve member being movable within the open endof the housing cylinder between said first and second springs; saidvalve assembly further including a base member movable within the closedend of the housing cylinder between said water-swellable body and saidsecond spring.
4. The valve according to claim 3, wherein said valvemember is formed with an annular flange of larger diameter than, andcircumscribing, the open end of the housing cylinder.
5. The valveaccording to claim 3, wherein said valve member includes a sealingelement centrally thereof engageable with said valve seat in the closedposition of the valve member.
6. The valve according to claim 3, whereinthe surface of the valve member facing the base member is formed with aconical recess centrally thereof for receiving one end of the secondspring, and the surface of the base member facing the valve member isformed with a conical projection centrally thereof for receiving theopposite end of the second spring.
7. The valve according to claim 3,wherein said inlet fitting including the valve seat, and thevalve memberfacing the valve seat, are both formed with conical projections forreceiving the opposite ends of said first spring.
8. The valve accordingto claim 3, wherein the housing cylinder is formed with a large-diametersection at its open end, and with a smaller-diameter section at itsclosed end, the latter section being formed with said moisture-permeablewall and containing said water-swellable body.
9. The valve according toclaim 8, wherein said base member includes a section of circularconfiguration having an outer diameter substantially equal to the innerdiameter of the large-diameter section of the housing cylinder such thatthe movements of the base member are guided thereby.
10. The valveaccording to claim 9, wherein said base member of the valve assemblyincludes a second section of circular configuration and having an outerdiameter substantially equal to the inner diameter of thesmaller-diameter section of the housing cylinder.
11. The valveaccording to claim 10, wherein the two sections of the base member areinterconnected by a stem integrally formed with said two sections. 12.The valve according to claim 3, wherein said valve member is formed witha plurality of outer fingers engageable with the lower surface of a capattached to the housing for guiding the movements of the valve memberparallel to said valve seat.
13. The valve according to claim 3, whereinsaid valve member has a cylindrical section of an outer diametersubstantially equal to the inner diameter of the open end of the housingcylinder; and the base member has a circular section of an outerdiameter substantially equal to the inner diameter of the closed end ofthe housing cylinder.
14. The valve according to claim 1, wherein saidinlet fitting is formed in a cap removably attachable to said housing.15. The valve according to claim 1, wherein said housing is integrallyformed with a ground stake for embedding same in the soil whose moistureis to be sensed for operation of the valve.
16. A moisture-responsivevalve, comprising:a housing formed with an internal chamber, an inletfitting connectible to a source of water for inletting water into thechamber via a valve seat within the chamber, and an outlet opening foroutletting water from the chamber; a valve assembly in said chamberincluding a valve member movable towards and away from said valve seatfor controlling the flow of water through the valve seat into saidchamber and out through said outlet opening; a water-swellable bodywithin said housing adjacent a moisture-permeable wall thereof forcontrolling the movements of said valve member in response to themoisture passing through said moisture-permeable wall; end facing thevalve seat and closed at its opposite end; said valve member beingmovable within the open end of the cylinder between a first springinterposed between the valve member and the housing and urging the valvemember away from said valve seat, and a second spring interposed betweenthe valve member and the water-swellable body and urging the valvemember towards said valve seat; and a base member movable within theclosed end of the housing cylinder between said water-swellable body andsaid second spring.
17. The valve according to claim 16, wherein saidvalve member includes a sealing element centrally thereof engageablewith said valve seat in the closed position of the valve member.
18. Thevalve according to claim 16, wherein the surface of the valve memberfacing the base member is formed with a conical recess centrally thereoffor receiving one end of the second spring, and the surface of the basemember facing the valve member is formed with a conical projectioncentrally thereof for receiving the opposite end of the second spring.19. The valve according to claim 16, wherein the housing cylinder isformed with a large-diameter section at its open end, and with asmaller-diameter section at its closed end, the latter section beingformed with said moisture-permeable wall and containing saidwater-swellable body.
20. The valve according to claim 19, wherein saidbase member includes a section of circular configuration having an outerdiameter substantially equal to the inner diameter of the large-diametersection of the housing cylinder such that the movements of the basemember are guided thereby. | 2024-03-22 | 1991-11-20 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1992-09-22"
} |
US-7752593-A | Filter element and manufacture method thereof
ABSTRACT
A method for manufacturing filter elements, in which sealant does not get onto the rolling claw and rolling of the roll filter paper is made easy.
A long roll filter paper having laterally oriented filter parts for filtering, the filter parts being open on the inflow side of the roll filter paper and closed on the outflow side of the roll filter paper, is rolled. During rolling, a sealant is applied to the surface of the roll filter paper in a narrow longitudinal strip, in such a way that the sealant does not make contact with the rolling claw. The roll-start end of the roll filter paper is gripped with the rolling claw during rolling. The rolling claw is made up of 2 or 4 rolling bars having the shape of the parts produced when a cylinder is split into two halves along its axis.
BACKGROUND OF THE INVENTION
1. Field of the Invention
This invention relates to a manufacturing method for manufacturingfilter elements for use in oil filters and air cleaners, etc., and moreparticularly relates to a method for rolling a roll filter paper.
2. Description of the Related Art
Cars are fitted with fuel filters for removing dirt from the fuelsupplied to the engine.
The fuel filter is disposed, as shown in FIG. 22, in the fuel supplyline 90 which supplies the fuel 6 to the engine. The fuel filter 9 ismade up of a filter case 91, a cover 92 fitted to the top part of thefilter case 91, and a filter element 1 contained inside the filter case91. The fuel 6 enters the fuel filter 9 through an entry opening 920centrally located in the cover 92, is filtered by the filter element 1,exits through an exit opening 930 centrally located in the base of thefilter case 91, and is supplied to the engine (not shown in thedrawings).
One example of a type of filter element used for the filter element 1consists of a porous roll filter paper 10 of corrugated constructionwhich has been rolled into a cylindrical shape, as shown in FIGS. 24-26(Japanese Laid-Open Patent Publication No.H.4-131106).
The roll filter paper 10 is made up of two layers; a flat sheet 15 and acorrugated sheet 13. Hollow filter parts 14 are formed between theridges 139 of the corrugated sheet 13 and the flat sheet 15. The troughs131 of the corrugated sheet 13 are bonded to the flat sheet 15 by asealant 2. The cavities formed by the corrugated sheet 13 other than thefilter parts 14, in other words the cavities on the opposite side of thecorrugated sheet 13 from the filter parts 14, are clean parts 16.
In each of the filter parts 14, as shown in FIGS. 22,23 & 26, the inflowend 71 is open. The outflow end 79, however, is closed off by the ridges139 of the corrugated sheet 13 being squeezed together with and joinedto the flat sheet 15.
In each of the clean parts 16, on the other hand, the inflow end 71 isclosed off by the sealant 2, and the outflow end 79 is open.
In this filter element 1, the fuel 6 enters the filter parts 14 throughthe inflow end 71 and passes through the porous roll filter paper 10from the filter parts 14 into the clean parts 16. The dirt contained inthe fuel 6 is trapped on the surface of the roll filter paper 10 on thefilter part 14 side.
Filters similar to the filter element 1 discussed above are used inother filters, such as air filters and the like, as well as automobilefuel filters.
The method by which the filter element discussed above is manufacturedwill now be explained, with reference to FIG. 27.
First, the troughs 131 of a corrugated sheet 13 are bonded to a flatsheet 15, the ridges 139 of the corrugated sheet 13 at the outflow end79 are squashed, and a long corrugated roll filter paper 10 is obtained.Then, the sealant 2 is applied to the inner surface of the roll filterpaper 10 at the inflow end 71 side of the roll filter paper 10, in anarrow strip extending along the length of the roll filter paper 10 fromthe roll-start end 17. The roll filter paper 10 is then rolled up alongits length, from the roll-start end 17 to the roll-finish end 19.
Conventionally this rolling operation is carried out by hand or using arolling claw.
However, rolling by hand requires a lot of manpower and istime-consuming, and considerable practice is necessary in order tomaster the rolling operation.
When a rolling claw 30 is used to roll up the roll paper filter 10, theroll-start end of the roll paper filter 10 is gripped in the rollingclaw 30, the sealant 2 is applied in a narrow strip along the inflowside 71, and after that the rolling claw 30 is rotated and the rollpaper filter is rolled up. However, in the process, as shown in FIG. 28,the sealant 2 gets onto the rolling claw 30, and this can result in itbeing impossible to remove the rolling claw 30 from the roll filterpaper 10 on completion of rolling.
SUMMARY OF THE INVENTION
This invention was devised in response to these problems associated withconventional methods, and offers a method of manufacturing filterelements in which the sealant does not get onto the member used as therolling core and in which rolling of the roll filter paper is made easy.
In this invention a manufacturing method for manufacturing filterelements obtained by rolling a roll filter paper which has latitudinallyoriented filter parts, open at one end and closed at the other, forfiltering, is characterized by the steps of gripping the roll filterpaper near the roll-start end, applying a sealant to the surface of theroll filter paper in a narrow strip along the length of the roll filterpaper, rolling the roll filter paper with the rolling claw, and removingthe rolling claw after rolling is completed.
The above-mentioned roll filter paper is long; the direction of thelonger dimension will hereinafter be referred to as the longitudinaldirection, and the direction of the shorter dimension will hereinafterbe referred to as the latitudinal direction. The roll filter paper isprovided with latitudinally oriented filter parts into which a fluidflows.
In this invention, for the rolling claw, for example a cylinder splitalong its axis into two rolling bars is used. The rolling bars each havea gripping face for gripping the roll filter paper. Several differenttypes of rolling claw exist, for example: full grip types which grip thewhole roll-start end of the roll filter paper, from the inflow side tothe outflow side; outflow side grip types which grip the roll-start endwithout gripping the inflow side; and side grip types which grip bothsides but do not grip the middle part of the roll filter paper.
It is desirable that the above-mentioned sealant be applied from theroll-start end to the roll-finish end continuously in one pass, withoutany stoppages. This allows the roll filter paper to be rolled up in ashort time, without any stoppages.
An adhesive such as a hot melt adhesive or an epoxy adhesive may be usedas the sealant. The roll filter paper is a porous filtering materialwhich may be any suitable material such as a filter paper, a non-wovenmaterial, or a woven synthetic fiber material.
A filter element made according to this invention is fitted into avehicle fuel filter, an air cleaner or the like, and functions as afluid filter. The fluid being cleaned by the filter element is either aliquid, such as fuel, or a gas, such as air.
In this invention the roll-start end of the roll filter paper is grippedby a rolling claw, and also the sealant is applied and positioned insuch a way that the sealant does not make contact with the rolling clawduring rolling of the roll filter paper. As a result of this, thesealant does not get onto the rolling claw during rolling of the rollfilter paper. This facilitates the rolling operation and improvesproduction efficiency.
As described above, this invention provides a method for manufacturingfilter elements in which sealant does not get onto the rolling claw androlling of the roll filter paper is easy.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a view illustrating a method for rolling roll filter paperaccording to a 1st preferred embodiment of the present invention;
FIG. 2 is a perspective view of the rolling claw used in the 1stpreferred embodiment;
FIG. 3 is a view illustrating the continuation of the roll filter paperrolling method of FIG. 1;
FIG. 4 is a perspective view of a filter element made according to the1st preferred embodiment;
FIG. 5 is a view illustrating a roll filter paper rolling methodaccording to a 2nd preferred embodiment;
FIG. 6 is a view illustrating a roll filter paper rolling methodaccording to a 3rd preferred embodiment;
FIG. 7 is a view illustrating the continuation of the roll filterrolling method of FIG. 6;
FIG. 8 is a view illustrating the continuation of the roll filterrolling method of FIG. 7;
FIG. 9 is a cross-sectional view of a representative part of a filterelement made according to the 3rd preferred embodiment;
FIG. 10 is a view illustrating a roll filter paper rolling methodaccording to a 4th preferred embodiment;
FIG. 11 is a view illustrating a roll filter paper rolling methodaccording to a 5th preferred embodiment;
FIG. 12 is a perspective view of a representative part of the rollfilter paper used in the 5th preferred embodiment;
FIG. 13 is a perspective view of a filter element made according to the5th preferred embodiment;
FIG. 14 is a view illustrating a roll filter paper rolling methodaccording to a 6th preferred embodiment;
FIG. 15 is a view illustrating the continuation of the roll filterrolling method of FIG. 14;
FIG. 16 is a view illustrating the continuation of the roll filterrolling method of FIG. 15;
FIG. 17 is a perspective view of a filter element made according to the6th preferred embodiment;
FIG. 18 is a view illustrating a roll filter paper rolling methodaccording to a 7th preferred embodiment;
FIG. 19 is a view illustrating a roll filter paper rolling methodaccording to an 8th preferred embodiment;
FIG. 20 is a view illustrating the continuation of the roll filterrolling method of FIG. 19;
FIG. 21 is a view illustrating a roll filter paper rolling methodaccording to a 9th preferred embodiment;
FIG. 22 is a semi-cross-sectional view of a fuel filter containing aconventional filter element;
FIG. 23 is a view illustrating the operation of a conventional filterelement;
FIG. 24 is a plan view of the inflow end of a conventional filterelement;
FIG. 25 is an enlarged view of a representative part of the inflow endof a conventional filter element;
FIG. 26 is a perspective view of a representative part of a conventionalroll filter paper;
FIG. 27 is a view illustrating a first conventional roll filter rollingmethod; and
FIG. 28 is a view illustrating a second conventional roll filter rollingmethod.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS 1st Embodiment
A first preferred embodiment of this invention will now be described,with reference to FIGS. 1-4. This preferred embodiment is a method formanufacturing a filter element 1 by rolling a roll filter paper 10 intoa scroll.
A roll filter paper 10, as shown in FIG. 1, is made up of two layers: aflat sheet 15 and a corrugated sheet 13. Hollow filter parts 14 areformed between the ridges 139 of the corrugated sheet 13 and the flatsheet 15. Clean parts 16 are formed on the opposite side of thecorrugated sheet 13 from the filter parts 14 (see FIG. 25).
As shown in FIG.4, the filter element 1 is cylindrical in shape, withone end of the cylinder being the fluid inflow end 71 and the other endof the cylinder being the fluid outflow end 79.
At the inflow end 71, the filter parts 14 are open, and the clean parts16 are closed off by a non-porous sealant (see FIG. 25). At the outflowend 79, the filter parts 14 are closed off, and the cleaning parts 16are open (see FIG. 26).
A non-porous hot melt adhesive is used for the sealant 2. Porous filterpaper is used for the roll filter paper 10.
Next, the manufacturing method for manufacturing the filter elementdiscussed above will be described, with reference to FIGS. 1-4.
First, as shown in FIG. 1, a roll filter paper 10 of corrugatedconstruction is obtained by bonding the troughs 131 of a corrugatedsheet 13 to a flat sheet 15. Next, the ridges 139 on the outflow side 79of the corrugated sheet 13 are squashed against the surface of the flatsheet 15. Then, the roll-start end 17 of the roll filter paper 10 isgripped with a rolling claw 30.
As shown in FIG. 2, the rolling claw 30 is a full grip type which gripsthe roll-start end across the entire width of the roll filter paper 10.The rolling claw is made up of two rolling bars 31 and 32. The rollingbars 31 and 32 have flat gripping surfaces 310 and 320, and have theform of a cylindrical bar split axially into two halves. In gripping theroll filter paper 10 with this rolling claw 30, the gripping faces310,320 grip the roll-start end 17 of the roll filter paper 10.
Next, as shown in FIGS. 1 & 3, while sealant 2 is applied to the innersurface of the roll filter paper in a narrow strip extendinglongitudinally along the roll filter paper 10 from a point at which itdoes not make contact with the rolling claw 30, the roll filter paper 10is rolled up using the rolling claw 30.
After that, as shown in FIG. 4, the rolling claw 30 is removed from theroll filter paper 10, and a sealant 20 is applied at the inflow end 71to the cylindrical cavity created by the removal of the rolling claw 30.In this way the filter element 1 is formed.
Next, the operating effects of this embodiment will be explained. Inthis embodiment, as shown in FIG. 1, the roll-start end portion 17 ofthe roll filter paper 10 is gripped by the rolling claw 30, and also,during rolling of the roll filter paper 10, the sealant 2 is applied insuch a position that it does not make contact with the rolling claw 30.As a result of this, during rolling of the roll filter paper 10, thesealant 2 does not get onto the rolling claw 30. Because of this,production efficiency is good, and costs can be reduced.
Also, in this embodiment, all the clean parts 16 on the inflow side 17can be blocked off by the sealant 2 and the sealant 20. This makes itpossible for the fluid to be efficiently filtered by the whole surfaceof the roll filter paper 10.
2nd Embodiment
In this embodiment, as shown in FIG. 5, an outflow side grip typerolling claw 33 which grips the roll-start portion 17 without grippingthe inflow side 71 of the roll filter paper 10 is used.
The rolling claw 33 is made up of two rolling bars 34 and 35 in the sameway as in the 1st embodiment.
In manufacturing a filter element according to this embodiment, all butthe inflow side 71 of the roll-start end 17 of the roll filter paper 10is gripped by the rolling claw 33.
In gripping the roll filter paper 10 with the rolling claw 33, thegripping faces 340 and 350 are faced toward each other and approximatelyhalf of the roll-start end 17 of the roll filter paper 10 is grippedwith the rolling bars 34 and 35.
Next, while sealant 2 is applied, in a narrow strip, from the roll-startend 17 to the roll-finish end 19, rolling is performed using the rollingclaw 33.
After that, the rolling claw 33 is removed from the roll filter paper10.
The rest of the manufacturing process is as per the 1st embodiment.
In this preferred embodiment, because all but the inflow side 71 of theroll-start end 17 of the roll filter paper 10 is gripped by the outflowside grip type rolling claw 33, it is possible to apply the sealant 2 tothe whole length of the inflow side 71, from the roll-start end 17 tothe roll-finish end 19. As a result of this, it is not necessary toapply the sealant 20 as in the 1st embodiment, a filter in which thefilter parts and the clean parts are in contact throughout can be made,and the cleaning efficiency can be further increased.
This embodiment also offers the benefits provided by the 1st embodiment.
3rd Embodiment
In this embodiment, as shown in FIGS. 6-9, side grip type rolling claws36 which grip the sides of the roll filter paper 10 but do not grip thecenter are used. The rolling claws 36 are made up of four rolling bars37,38,39,40.
In making the above-mentioned filter element, first, the rolling bars37,38, with opposing gripping surfaces 370,380, are used to grip theoutflow side 79 of the roll-start end 17, and the rolling bars 39,40,with gripping faces 390,400, are used to grip the inflow side 71 of theroll-start end 17.
Then, as shown in FIG. 6, the sealant 2 is applied in a narrow striplongitudinally along the center of the inner surface of the roll-startend 17 of the roll filter paper 10, without any sealant making contactwith the rolling claws 36. The length of the strip of the sealant 2 thatis applied at this stage is such that when the roll-start end 17 of theroll filter paper has been rolled by the rolling claws 36 through half arevolution, a small portion of the sealant will be exposed.
Next, as shown in FIG. 7, the roll filter paper 10 is rolled by therolling claws 36 through half a revolution, longitudinally from theroll-start end 17. This leaves a small portion of the sealant 2 exposed,projecting out from under the rolled portion of the roll-start end 17.
Then, as shown in FIG. 8, the sealant 20 is applied between the twoclaws 36 and over the above-mentioned projecting portion of the sealant2. And, while the sealant 20 is laid so that it forms a curve runningover to the inflow side 71 and then a straight line running along theinflow side 71 to the roll-finish end 19, the roll filter paper isrolled in the same way as in the 1st embodiment, and the rolling clawsare removed from the roll filter paper 10.
In this way, a filter element 1 as shown in FIG. 9 is formed. In theregion near the roll-start end 17, the sealant 2 is positionedcentrally. Everywhere else, the sealant 2 is positioned as in the 1stembodiment.
In this preferred embodiment, side grip type rolling claws 36 are usedto grip the sides of the roll-start end 17 of the roll filter paper 10without gripping the central part, the part of the roll filter paper 10that lies between the rolling bars 37,39 is sealed by the sealant 2, andthe part between the rolling bars 38,40 is blocked of by the sealant 20(see FIG. 9). As a result, there is no need to apply sealant after therolling claw is removed from the roll filter paper 10, as is necessaryin the 1st embodiment.
Also, in the 2nd preferred embodiment, because the rolling claw has tobe made long enough to grip about half of the roll-start end 17 of theroll filter paper 10, the strength of the rolling claw has to beincreased accordingly. This results in the thickness of the rolling clawitself being greater. In the 3rd embodiment, however, because the rollfilter paper 10 is held by the rolling claws on both sides, the rollingclaws can be short. Because the rolling claws can be short, they do nothave to be as strong, and the thickness of the rolling claws can bereduced to substantially below the thickness required of the rollingclaw of the 2nd embodiment. As a result, rolling of the roll filterpaper 10 can be carried out better than with the 2nd embodiment.
Furthermore, this 3rd embodiment also offers the benefits of the 1stembodiment.
4th Embodiment
In this embodiment, as shown in FIG. 0, the roll filter paper is grippedat both sides, but not in the middle, by the rolling claws 36. And, withthe roll filter paper 10 held in this way, the sealant 2 is applied insuch a way that it forms a curve running gradually from the central partof the roll-start end 17 over to the inflow side 71, and then runs alongthe inflow side to the roll-finish end 19. The length L1 of the strip ofsealant applied to the central part corresponds to approximately onerotation of the rolling claws 36.
Then, the rolling claws 36 are rotated until the roll filter paper iscompletely rolled. After that, the rolling claws 36 are removed from theroll filter paper 10.
Other details of this embodiment are as per the 1st embodiment.
In this embodiment, the sealant 2 is applied in one continuous pass,without stopping, from the roll-start end 17 to the roll-finish end 19.As a result, it is not necessary, as it is in the 3rd embodiment, tochange the sealant application position mid-way through the rollingprocess. This makes it possible for the roll filter paper 10 to berolled from the roll-start end 17 all the way to the roll-finish endwithout stopping.
Therefore, in this embodiment, a filter element can be made in a shortspace of time.
This embodiment also provides the same benefits as those of the 3rdembodiment.
5th Embodiment
In this embodiment, as shown in FIGS. 11-13, a roll filter paper 10which has an unseparated part 5, positioned longitudinally near thecenterline of the roll filter paper, is used. The unseparated part 5, asshown in FIG. 2, is a region in which parts of the troughs 131 of thecorrugated sheet 13 are not adhered to the flat sheet 15.
In rolling the roll filter paper 10, as shown in FIG. 11, a full griptype rolling claw 30 as used in the 1st embodiment is used.
In making the filter element, the roll-start end 17 of the roll filterpaper 10 is gripped, and the roll filter paper 10 is rolled through halfa revolution using the rolling claw 30.
Next, the unseparated region 5 at the roll-start end 17 is blocked usingthe sealant 2, and the sealant 2 is applied so that it curves toward theinflow side 71. And, without stopping, while the sealant 2 is appliedalong the inflow side 71 all the way to the roll-finish end 19, the rollfilter paper 10 is rolled up to the roll-finish end 19.
After that, the rolling claw 30 is removed from the roll filter paper10, and, as shown in FIG. 3, the gaps created by the removal of therolling claw 30 are filled in with the sealant 20 on the inflow side 71.Also, the sealant 200 is applied to the entire length of the roll-finishend 19, including the unseparated region 5. This completes the filterelement 1.
Other details of this embodiment are as per the 1st embodiment.
In this embodiment, the roll filter paper 10 is provided with anunseparated region 5. As a result, during filtering of a fluid, thefluid can move freely from one part of the filter part 14 to another.This prevents the occurrence of blockages caused by dirt contained inthe fluid. Also, this unseparated region 5 connects the multiple filterparts of the filter element 1. As a result, even if one of the filterparts becomes blocked with dirt and the airflow resistance suddenlyincreases, some of this dirt will move through the unseparated regioninto other filter parts. Thus, the provision of the unseparated regionmakes it possible for the airflow resistance of all the filter parts tobe equalized.
Furthermore, the filtering surface area is increased by the area of thesurfaces in the unseparated region 5 that would have been stuck togetherhad the unseparated region 5 not been provided.
Also, the sealant 200 is used to block the unseparated region 5 at theroll-finish end 19. This prevents fluid escaping from the unseparatedregion 5.
This embodiment also offers the same benefits as the 1st embodiment.
6th Embodiment
The roll filter paper 10 used in this embodiment, as shown in FIGS.14-17, has an unseparated region 5 similar to that of the 5thembodiment. In rolling the roll filter paper 10, an outflow side griptype rolling claw 33 similar to that used in the 2nd embodiment is used.
In making the filter element, as shown in FIG. 4, the roll-start end 17of the roll filter paper 10 is gripped with the rolling claw 33. Next,the sealant 2 is applied so that it forms a strip, runninglongitudinally from the roll-start end 17, of a length corresponding tohalf a revolution of the rolling claw 33. The sealant 2 is then furtherapplied so that it curves over to the center of the roll filter paper10, until it is directly over the unseparated region 5.
Then, as shown in FIG. 5, the roll filter paper 10 is rolled throughhalf a revolution by the rolling claw 33. In this way, the sealant 2lying directly over the unseparated region 5 is left exposed, projectingout from under the roll-start end 17. Then, as shown in FIG. 6, thesealant 20 is applied longitudinally from the inflow side 71 of the endformed by the fold of the roll filter paper 10 to the roll-start end 17.Then, the sealant 20 is laid in a curve running over to the center ofthe roll filter paper 10, the sealant is laid directly over theunseparated region 5, and then the sealant is made to form a curverunning back to the inflow side 71.
Then, while the sealant 20 is applied longitudinally along the inflowside 71 all the way to the roll-finish end 19, the roll filter paper 10is rolled with the rolling claw 33.
After that, the rolling claw 33 is removed from the roll filter paper10, and, as shown in FIG. 7, the sealant 200 is applied to the entirelength of the roll-finish end 19, including the unseparated region 5.This completes the filter element 1.
Other details of this embodiment are as per the 5th embodiment.
In this embodiment also, the benefits offered by the 5th embodiment canbe obtained.
7th Embodiment
In this embodiment, as shown in FIG. 18, an output side grip typerolling claw 33 of the kind used in the 2nd embodiment is used to gripthe roll-start end 17 of the roll filter paper 10. The sealant 2 isapplied along the inflow side 71 of the roll filter paper 10,longitudinally from the roll-start end 17 to a length corresponding tohalf a revolution of the rolling claw 33.
Then, the sealant 2 is laid in a curve running over to the center of theroll filter paper 10, until it is laid directly over the unseparatedregion 5.
Next, without stopping, the sealant 2 is laid in a curve running back tothe inflow side 71, and is applied along the inflow side 71 to theroll-finish end 19.
Other details of this embodiment are as per the 6th embodiment.
In this embodiment, the sealant 2 is laid from the roll-start end 17 tothe roll-finish end continuously, without stopping. Therefore, the rollfilter paper 10 can be rolled from the roll-start end 17 to theroll-finish end without changing the sealant 2 application positionmid-way through rolling as in the 6th embodiment. Thus, a filter elementcan be made in a short space of time.
This embodiment also offers the same benefits as the 6th embodiment.
8th Embodiment
In the filter element 1 of this embodiment, as shown in FIGS. 19 & 20,the roll filter paper 10 has an unseparated region 5 as in the 5thembodiment. Side grip type rolling claws 36 of the kind used in the 3rdembodiment are used to roll the roll filter paper 10 in this embodiment.
In making the filter element 1, as shown in FIG. 9, the roll-start end17 of the roll filter paper 10 is gripped with the rolling claws 36.Then, the sealant 2 is applied longitudinally and centrally from theroll-start end 17 to the length corresponding to half a revolution ofthe rolling claw 36.
Next, as shown in FIG. 20, the roll filter paper 10 is rolled throughhalf a revolution using the rolling claws 36. This leaves a small areaof the sealant 2 directly over the unseparated region 15 exposed,projecting out from under the folded roll-start end 17.
Then, the sealant 20 is applied to the outer surface of the roll filterpaper 10 between the rolling claws 36, and laid over the exposed portionof the sealant 2. Then, while the sealant 20 is continuously laid in acurve running over to the inflow side 71, and is laid along the inflowside 71 to the roll-finish 19, the roll filter paper 10 is rolled up bythe rolling claws 36.
After that, the rolling claws 36 are removed from the roll filter paper10, and the sealant 200 is applied to the entire length of theroll-finish end 19, including the unseparated region 5 (see FIG. 17).This completes the filter element 1.
Other details of this embodiment are as per the 5th embodiment.
This embodiment offers the same benefits as the 5th embodiment.
9th Embodiment
In this embodiment, as shown in FIG. 21, the rolling claws 36 are usedto grip the sides of the roll filter paper 10 without gripping theunseparated region 5. With the roll filter paper gripped in this way,the sealant 2 is laid along the unseparated region 5, starting from theroll-start end 17, and from a mid-way point is gradually led over to theinflow side 71 of the roll filter paper 10, and is laid along the inflowside 71 to the roll-finish end.
The length of the strip of the sealant 2 that is laid over theunseparated region 5 corresponds to about 1 revolution of the rollingclaws 36.
Next, the rolling claws 36 are rotated and the roll filter paper 10 iscompletely rolled up. After that, the rolling claws are removed from theroll filter paper 10.
Other details are as per the 8th embodiment.
In this embodiment, the sealant 2 is laid from the roll-start end 17 tothe roll-finish end continuously, without stopping. As a result, theroll filter paper 10 can be rolled from the roll-start end 17 to theroll-finish end continuously, without stopping.
Therefore, in this embodiment, a filter element can be made in a shortspace of time.
This embodiment also provides the same benefits as those of the 8thembodiment.
What is claimed is:
1. A manufacturing method for manufacturing a filterelement by rolling a roll filter paper having a latitudinally orientedfilter part for filtering, one end of said filter part being open andthe other end being sealed, said manufacturing method comprising thesteps of: gripping both sides of said roll filter paper part with arolling claw near the roll-start end in such a way that a centralportion of predetermined size is not gripped by said rollingclaw;applying a sealant in a narrow longitudinal strip starting fromsaid ungripped portion near said roll-start end of said roll filterpaper, and, after applying said sealant in the longitudinal directionover a predetermined length, applying said sealant in a narrowlongitudinal strip along the side of said roll filter papercorresponding to said open end of said filter part; rolling up said rollfilter paper using said rolling claw; and after rolling up said rollfilter paper, removing said rolling claw.
2. A method for manufacturinga filter element according to claim 1, in which said sealant is appliedin a continuous process.
3. A method for manufacturing a filter elementaccording to claim 1, in which said filter part of said roll filterpaper comprises multiple filter parts formed by a corrugated sheet and aflat sheet, and said multiple filter parts are separate and independentof each other.
4. A method for manufacturing a filter element accordingto claim 1, in which said filter part of said roll filter papercomprises multiple filter parts formed by a corrugated sheet and a flatsheet, and an unseparated region is provided between adjacent multiplefilter parts, said unseparated regions connecting each multiple filterpart to the multiple filter parts adjacent to it.
5. A method formanufacturing a filter element according to claim 1, in which multiplepassages are formed in the filter element that is manufactured, saidpassages including first passages open at one end and closed at theother end and second passages, adjacent to said first passages, closedat the end at which the first passages are open and open at the end atwhich the first passages are closed. | 2024-03-22 | 1993-06-16 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1995-07-25"
} |
US-24299462-A | Tuning gage for drums
Dec. 29, 1964 F. M. TOPERZER, JR
TUNING GAGE FOR DRUMS Filed Dec. '7, 1962 2 Sheets-Sheet 1 3a '14 1' $0o 38 as r 36 4% o O o '16 64 INVENTOR,
Few/(M ra izzae. dz.
BY imw x ATTORNEY 1964 F. M. TOPERZER, JR 3,163,075
TUNING GAGE FOR DRUMS Filed Dec. 7, 1962 2 Sheets-Sheet 2 INVENTOR,FAWN/(M Ta aezae; J2.
ATTORNEY United States Patent Ofiice 3,163,075 Patented Dec. 29, 19643,163,075 TUNING GAGE FOR DRUMS Frank M. Toperzer, In, 7106 ClardenRoad, Bethesda 14, Md. Filed Dec. 7, 1962, Ser. No. 242,994 9 Claims.(Cl. 84-419) This invention relates generally to musical instruments,and more particularly to an improved tuning gauge mechanism for thetympani or velum of kettle drums.
The different tones of the tympanum are obtained by varying the drumhead tension through the medium of a foot pedal actuated drum headtension control mechanism.
The drum is generally tuned manually by hand operated drum head tensioncontrol means for orienting the control ring of the instrument.
The experienced musician plays the drum by operating a foot pedal,controlling tension variations on the drum head by means of a verticallydisplaceable head ring, and a considerable amount of skill andexperience is required in order to become proficient in playing drums ofthis character.
Additionally, although the musician tunes the instrument before acomposition is played, due to various reasons, temperature changes in anempty auditorium as compared with one that later fills, for example, thecompetent musician is constantly tuning or adjusting the drum headtension.
Tuning gages, per se, are not novel; see, for example, U.S. LettersPatent to William F. Ludwig, 2,568,504.
A primary object of the present invention is to provide a novel tuninggage attachment for kettle drums which can be used to readily modifyexisting kettle drums or comprise initial equipment thereon.
Another object of the present invention is to provide a novel tuninggage attachment of the character mentioned, including means associatedwith the foot pedal control linkages whereby position changes of thehead tension control ring are directly reflected on a tone gage.
A further object of the present invention is to provide a novel tonegage or tuning indicator for tympanum in which means are provided toimmediately compensate for tension or tone changes in the tympani ofdrum head velum of the instrument to maintain a basic tuning note.
A still further object of the present invention is to provide a noveltone or tuning gage which includes readily positionable note identifyingelements oriented with respect to an indicator moved in relation to headtension control mechanism.
Other and more specific objects of the present invention will becomeapparent from a consideration of the FIGURE 4 is an elevation takensubstantially from the plane of line 4-4 of FIGURE 2;
FIGURE 5 is a further enlarged, fragmentary top plan view of theindicating portion of the tone gage showing the note identifying lugsand indicator alignable therewith;
FIGURE 6 is a vertical section taken on the plane of line 6-6 of FIGURE5; and
FIGURE 7 is a view similar to FIGURE 2 showing a modification of thenovel tone gage.
Referring to the drawings in detail, and first considering FIGURE 1, atympanum or kettle drum of any size or shape is indicated generally at10 and comprises a kettle 12 supported by a stand indicated generally at14 which includes a pedal control mechanism indicated generally at 16.
The pedal control mechanism 16 includes a vertically extending forcetransmitting rod 18 which projects through an aperture 20 in the base ofthe kettle 12. The rod 18 can be maintained in an adjusted verticalposition by means of a conventional brake mechanism 22, and a foot pedallever 24 is connected to the rod 18 by a suitable linkage 26.
The kettle 12 includes at the upper edge thereof an arcuate, inturnedconventional flange 28 upon which a drum skin 30 of natural or syntheticmaterial engages. The skin is mounted in a conventional flesh hoop 32and is engaged by an annularly flanged pressure ring or hoop 34.
The ring 34 has secured in circumferentially spaced relation a pluralityof vertically disposed, mounting brackets 36 which include a threadedsleeve receiving therein hand screws 38. The kettle 12 has securedthereon circumferentially spaced brackets 40 beneath each of the screws38 and upon which are pivotally mounted at 44 bellcrank levers 46. Thelevers 46 include a transverse shaft 45 into which the lower threadedends of the screws 38 engage and the levers 46 are pivotally connectedat 48 below the shaft 45 to the terminal ends 49 of radial rods 50, therods extending through suitable slots 52 in the kettle and beingconnected at their inner ends 54 to the force transmitting rod 18 by asuitable mounting hub 56.
In the absence of additional structure, tension on the drum skin isinitially adjusted by the hand screws 38 and is maintained by constantchecking and readjusting by the musician. The tone is changed byoperation of the foot pedal lever 24 and an adjusted position for aparticular tone is maintained by the brake mechanism 22.
The structure and operation just described is of a general character andis conventional, and will be readily recognized by those skilled in theart. However, it will be noted that the movement of the bellcranks 46are displaced angularly about the pivotal mountings 44 in directrelation to vertical movement of the rod 18 and radial rods 50.
A tone gage attachment is indicated generally at 58 and comprises asector plate 60 having an outwardly turned, arcuate flange 62 having anundercut lip portion 64. The plate 60 is mounted on the outer surface ofthe kettle 12 by means of a lower flange 66 and spaced sleeves andscrews 68 at the upper ends thereof.
Mounted on a transverse pivot shaft 70 coinciding with the radius ofsector plate 61) is an indicator lever 72 which includes a lateralpointed end 74 which overlies the flange 62 of the sector plate 60.
The undercut lip 64 of the sector plate flange 62 has displaceablyreceived thereon note indicating lug elements '76; see FIGURES 5 and 6,including a lock screw 78 extending through the lower edge thereof andengageable with the undersurface of lip 64 to retain the lug elements ina predetermined position. The lug elements 76 may include on the uppersurface thereof letters 80 indicating different notes and differentcolors may be used to permit ready recognition by the musician whenadjusting different head tensions for different tones or notes during anarrangement. An indicating line 82 may also be provided on the note lugs74.
The sector plate will be mounted in the position most convenient on thekettle, i.e.,- so it can be observed with a minimum of head turning withrespect to his music stand and the conductor. p
The most convenient bellcrank 46 will have pivotally mounted at one sidethereof at 84 an elongated lever 86 which is pivotal about the pivot 44with the bellcrank 46 upon which it is mounted; see FIGURES 1 and 2.
The bellcrank 46 has extending laterally therefrom a mounting rod 88which includes an internally threaded transverse aperture adjustablyreceiving therein an abutment screw 90 which terminally engages thelever 86 at one side of the pivot 84. The screw 90 includes an enlargedhead 92; see FIGURE 4, to permit ready manual rotation.
The other end of lever 86 is apertured at 4, and has hired thereto oneend of a flexible cable 96 which extends laterally through a slot 98 inthe kettle 12; see FIGURES 3 and 4. The kettle has mounted on the innersurface thereof a bracket element 109 which includes an idler sheave 102over which the cable 96 is entrained; the sheave facilitating changingdirection of the cable.
The shaft 70 has fixed on the end Within the kettle 12 a diametricallydisposed lever 164 apertured at 1% and having the other end of the cable96 anchored thereat. The lever 104 is apertured at 108 at the endopposite aperture 106 and has secured thereat one end of a tensionspring 110, the other end of the spring being conveniently secured to ananchor screw 112 of the bracket Operation The spring 1 10 normally urgesthe lever 164 in a clockwise direction as viewed in FIGURE 3, or towardthe left hand portion of the sector plate 60 when looking at FIG- URE 2.When the head tension is initially adjusted, i.e., a reference note isdetermined and a note lug oriented accordingly, the spring 110 will beplaced under sufficient tension to move the indicator lever 72 throughthe entire angular range of the plate flange 62. Other notes of a scaleare determined and corresponding lug elements 76 are positionedaccordingly. The position of the pedal lever 24 will be such to obtainthe desired head tension through the entire scale, and as the rod 18 israised or lowered, the be'llcranks 46 will be pivoted to causecorresponding movement to the bellcrank 46 upon which the lever 86 ismounted.
In the event the drum head stretches or expands due to temperature orhumidity changes, for example, the screw 92 will be rotated, thiscausing the lever 86 to pivot independently on the bellcrank 46,accordingly causing movement of the lever 72 to pivot on shaft 70 andcausing realignment of the indicator portion 74 thereof with respect otthe previously positioned note lugs 76.
It will be observed that although drum head expansion has occurred,which accordingly causes tone changes, this can be readily compensatedfor on the tone gage without any complicated changes and returning bymeans of screw 38. With the note lugs properly oriented, the kettle drumcan be actually played, i.e., each note can be selected immediately,expeditiously and accurately.
Considering FIGURE 7, a slightly modified embodiment of the tone gageattachment is indicated generally at 58, and reference characterssimilar to those previously used identify similar parts, and similarprimed reference numerals are used to identify similarly functioningparts.
The kettle 12 has mounted thereon on the exterior thereof a sector plate60" including an upper flange 62' upon which note indicating lugelements 76 are adjustably mounted. The plate 60' is mounted on theexterior of the kettle 12 by upper spacer sleeves and screws 68, and alower screw 68' and shaft 70'.
Pivotally mounted on shaft 70' is an indicator lever the pper endportion of which (not shown) com- 4 prising a lateral pointed endoverlying flange 62 and alignable With note lug elements '76 as in thepreviously described embodiment.
The bellcrank 46 has pivotally mounted at 84' one end of a lever 86',the other end of the lever being apertured at 94' and having anchoredthereto a flexible cable 96. The kettle 12 has fixed to the outersurface thereof a mounting bracket 1% including a sheave 102' aroundwhich the cable 96 is entrained. The cable 96' is an chored at 106 tothe lower end of lever 72'. The lever 72' includes a second aperture 108to which one end of a tension spring 110 is anchored, the other end ofthe spring being conveniently anchored beneath one of the sleeves andscrews 68 at the right hand side of FIG- URE 7. p
The lever 86 includes a projection 88 thereon through which anadjustable abutment screw extends, the lower end of the screw 90 beingengaged with a lateral flange 46 integral with the bellcrank.
The screw 90' may be rotated to move the lever 86 about the pivot 84- toadjust the indicator lever 72' with respect to the note lugs 76 as inthe previously described embodiment.
Each of the described embodiments provide accuracy not heretoforeobtained in previous tone gages, i.e., via adjusting screws 90, 90' andlevers 86, 86', providing means for accurately compensating for tonechanges after the drum has been tuned, provide means for readilyadjusting the drum head tension and locating note lugs in relation to adesired scale, and provide means whereby the movement of the noteindicator is in direct relation to the movement of the head ringcontrolling bellcranks which effect difi erent tone changes of the drum.
Although one type of radial force transmitting rod 50 is disclosed inthe exemplary embodiment, the novel tuning gage is equally adapted foruse on drums in which the rods 59 or the equivalent thereof extendexteriorly of the kettle.
Further, the use of the term bellcrank is to be considered in itsbroadest context, and it is intended that this term be considered to bethe equivalent of other types of lever means affording a similar orequivalent function.
It will be obvious to those skilled in the art that various changes maybe made Without departing from the spirit of the invention and,therefore, the invention is not limited to what is shown in the drawingsand described in the specification, but only as indicated in theappended claims.
What is claimed is:
1. A tone indicating attachment for use on an adjustable drum head ringfor tensioning a drum head, comprising in combination pivotal levermeans manually movable to cause drum head ring movement, said pivotallever means comprising at least one vertically pivotal bell crankelement, a sector plate having an upper, arcuate edge, note-idicia meanson the upper arcuate edge of said sector plate, an indicator leverpivotally mounted on said sector plate and including an indicatingportion aligned with the not'e-indicia means on the upper edge thereof,the improvement comprising force transmitting means connected betweensaid bell crank element and said indicator lever for moving the same inrelation to the movement of said pivotal bell crank element, said bellcrank element including thereon independently-adjustable lever means,said independently-adjustable lever means being connected between saidbell crank element and said force transmitting means for adjusting saidindicator lever with respect to said sector plate edge independently ofmovement of said bell crank element.
2. The structure of claim 1 including spring means connected to saidindicator lever urging it through the arc defined by the arcuate edge ofsaid sector plate.
3. The structure of claim 1 in which said force transmitting meanscomprises a flexible cable connected between said pivotal lever meansand eccentrically of the pivot axis of said indicator lever.
4. The structure of claim 3 including spring means connected to saidindicator lever in opposition to force applied by said flexible cable.
5. The structure of claim 1 in which said independently adjustable levermeans is pivotally mounted on said pivotal bell crank element andcomprises a manually adjustable abutment screw for orienting saidindependentlyadjustable lever means to a predetermined position withrespect to said bell crank element.
6. In a drum including an adjustable head, adjustable lever meansoperatively connected to said head and comprising a plurality ofvertically pivotal bell crank elements, the improvement comprising atone gage including a sector plate mounted on said drum, said plateincluding a tone indicating means along an arc concentric to the axisthereof, an indicator pivoted on the radius of said plate and includinga pointer portion alignable with said tone indicating means, a levermounted on one of said bell crank elements for simultaneous movementtherewith, and a force transmitting element extending between said onebell crank element and said indicator lever for pivoting said leveralong said sector plate edge in relation to pivoting of said one bellcrank element.
7. The structure of claim 6 including an independent lever pivoted onsaid one bell crank element, and adjustable abutment rneans engaged withsaid independent lever for orienting the same with respect to said onebell crank element, said force transmitting element being connected tosaid independent lever and said indicator lever.
8. The structure of claim 7 in which said force transmitting elementcomprises a flexible cable.
9. The structure of claim 6 including a spring operatively connected tosaid indicator lever and normally urging said lever toward one end ofthe arc of said se'ctor plate.
References Cited in the file of this patent UNITED STATES PATENTS2,568,504 Ludwig Sept. 18, 1951
1. A TONE INDICATING ATTACHMENT FOR USE ON AN ADJUSTABLE DRUM HEAD RINGFOR TENSIONING A DRUM HEAD, COMPRISING IN COMBINATION PIVOTAL LEVERMEANS MANUALLY MOVABLE TO CAUSE DRUM HEAD RING MOVEMENT, SAID PIVOTALLEVER MEANS COMPRISING AT LEAST ONE VERTICALLY PIVOTAL BELL CRANKELEMENT, A SECTOR PLATE HAVING AN UPPER, ARCUATE EDGE, NOTE-INDICIAMEANS ON THE UPPER ARCUATE EDGE OF SAID SECTOR PLATE, AN INDICATOR LEVERPIVOTALLY MOUNTED ON SAID SECTOR PLATE AND INCLUDING AN INDICATINGPORTION ALIGNED WITH THE NOTE-INDICIA MEANS ON THE UPPER EDGE THEREOF,THE IMPROVEMENT COMPRISING FORCE TRANSMITTING MEANS CONNECTED BETWEENSAID BELL CRANK ELEMENT AND SAID INDICATOR LEVER FOR MOVING THE SAME INRELATION TO THE MOVEMENT OF SAID PIVOTAL BELL CRANK ELEMENT, SAID BELLCRANK ELEMENT INCLUDING THEREON INDEPENDENTLY-ADJUSTABLE LEVER MEANS,SAID INDEPENDENTLY-ADJUSTABLE LEVER MEANS BEING CONNECTED BETWEEN SAIDBELL CRANK ELEMENT AND SAID FORCE TRANSMITTING MEANS FOR ADJUSTING SAIDINDICATOR LEVER WITH RESPECT TO SAID SECTOR PLATE EDGE INDEPENDENTLY OFMOVEMENT OF SAID BELL CRANK ELEMENT. | 2024-03-22 | 1962-12-07 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1964-12-29"
} |
US-26385088-A | Alternating current generator
ABSTRACT
An alternating current generator for supplying the electrical loads on a motor vehicle. The generator has a stator core that carries a three-phase stator or output winding. The rotor of the generator has two claw pole members that are so oriented that the fingers of the pole members are aligned. Disposed between the two pole members is a third pole member having projections disposed between the aligned fingers of the claw pole members. The rotor has two field coils which are so arranged and energized that the magnetic polarity of the two claw pole members is the same and opposite the magnetic polarity of the third pole member. One of the field coils can be replaced by a permanent magnet and when this is done the generator is provided with a magnetic circuit that can divert permanent magnet flux away from the stator core. Flux diversion is controlled by supplying unidirectional current to the field winding under the control of a voltage regulator.
This application is a continuation-in-part of copending application Ser.No. 201,717, filed on June 3, 1988.
This invention relates to alternating current generators and moreparticularly to alternating current generators for supplying electricalpower to the electrical loads on a motor vehicle including charging thevehicle storage battery.
Alternating current generators for supplying power to the electricalloads on a motor vehicle are well known, an example of which is thealternating current generator shown in the U.S. patent to Merrill et al.4,604,538. The generator disclosed in that patent is a Lundell typemachine and it has a claw-pole type of rotor.
One drawback of a Lundell machine is that geometrical constraints limitthe operating efficiency. Essentially, distributing flux from a commoncore to the multiple claw pole fingers place a practical limit on thestator core lamination stack length to stator bore diameter ratio. Thisin turn causes the stator winding end connections to be typically 1.5times longer than the active winding length which results in high copperlosses and poor efficiency.
Because motor vehicles have ever increasing power demands, an alternatorwith greater electrical output, higher power to weight ratio and betterconversion efficiency is needed.
In order to provide greater electrical output, alternators have beenused that have a double claw pole type of rotor assembly. Such analternator is disclosed in an advertising brochure that relates to a41-DN SERIES/TYPE 250 Generator of the Delco Remy Division of GeneralMotors Corporation (Dec. 1965). That alternator has four claw tooth polemembers and two field coils, all carried by a common shaft. A pair ofpole members and one field coil form one rotor and the other pair ofpole members and the other field coil form another rotor. Both rotorsare disposed within a stator coil so that the voltage generated in thestator coil is a function of the sum of fluxes developed by the twofield coils.
This invention, like the above-mentioned Delco Remy alternator, uses adouble rotor construction. This invention differs from the Delco Remyalternator in that, among other things, one of the field coils isreplaced by a permanent magnet. Further, this invention utilizes anarrangement of rotor parts that enables air gap flux reduction bydiversion of the flux developed by the permanent magnet. The arrangementof rotor parts is such that air gap flux and iron losses can be reducedby diverting the permanent magnet flux within the rotor magneticcircuit.
It accordingly is an object of this invention to provide a new andimproved alternating current generator wherein the rotor of thegenerator has a field coil and a permanent magnet and herein themagnetic parts of the rotor are arranged such that air gap flux betweenthe rotor and stator can be controlled by variably diverting the fluxdeveloped by the permanent magnet away from the air gap between therotor and stator. More specifically, the rotor of an alternator made inaccordance with this invention is comprised of iron rotor parts that arearranged such that they form a closed iron path magnetic circuit thathas no air gaps. This magnetic circuit is magnetically connected toopposite faces or ends of the permanent magnet and it bypasses the airgap between the rotor and stator. Further, the magneto-motive-force(mmf) developed by the ampere turns of the field coil and thearrangement of the magnetic parts of the rotor is such that the mmfdeveloped by the field coil controls the amount of flux developed by thepermanent magnet that is diverted through the closed iron path and,thus, controls the net air gap flux. By way of example, if no mmf isdeveloped by the field coil (zero field current) the closed iron pathmagnetic circuit diverts substantially all of the flux developed by thepermanent magnet away from the stator winding of the alternator with theresult that substantially no voltage is induced in the stator winding.As field current is varied, the amount of flux developed by thepermanent magnet that is diverted will vary. In accordance with thisinvention, unidirectional current of a varying magnitude is applied tothe field coil by a voltage regulator that responds to the magnitude ofthe output voltage of the generator. The voltage regulator can be of aconventional type that is used with conventional alternating currentgenerators that have a single field coil that forms the sole source offlux for the generator. Thus, I have discovered that by using agenerator that has the flux diverting capability of the type that hasbeen described, the output voltage of the generator can be regulated bya simple voltage regulator that supplies a variable magnitudeunidirectional current to the field coil. Therefore, it is not necessaryto reverse the field current through the field coil to provide generatorvoltage regulation.
IN THE DRAWINGS
FIG. 1 is a sectional view of an alternating current generator;
FIG. 2 is a developed view of the rotor of the generator shown in FIG.1;
FIG. 3 is an end view of a claw pole member that is a component of therotor of the generator shown in FIG. 1;
FIG. 4 is a view of the central pole member that is a component of therotor of the generator shown in FIG. 1 looking in the direction of arrow4--4 of FIG. 5;
FIG. 5 is a plan view of the central pole member;
FIGS. 6 and 7 illustrate electrical connections for the field coils ofthe rotor of the generator shown in FIG. 1;
FIG. 8 is a sectional view of an alternating current generator where therotor has one field coil and one permanent magnet;
FIG. 9 is a perspective view of a rotor that is used in the generatorshown in FIG. 8;
FIG. 10 is a circuit diagram of a voltage regulating arrangement forcontrolling the field current of the single field winding of thegenerator shown in FIG. 8; and
FIG. 11 is a perspective view of a modified rotor that can be used inthe generator shown in FIG. 8.
Referring now to the drawings and more particularly to FIG. 1, thealternating current generator of this invention comprises metallic endframes 10 and 12 that support a stator assembly 14. These end frames aretypically formed of aluminum. A plurality of through-bolts (notillustrated) are used in a known manner to secure the end framestogether. The stator assembly 14 is comprised of a slotted stator core16 formed of a stack of steel laminations that carries a three-phasestator or output winding 18. Portions of the stator winding 18 arelocated in the slots of stator core 16 as is well known to those skilledin the art.
The alternating current generator has a rotor generally designated byreference numeral 20. This rotor is comprised of a shaft 22 that issupported for rotation by bearings 24 and 26. A pulley 28 is connectedto shaft 22 and a cooling fan 29 is secured to the shaft.
The rotor 20 further comprises claw pole members 30 and 32 and a centralpole member 34 all of which are secured to shaft 22 to rotate therewithby key 35. Pole members 30, 32 and 34 are all formed of a magneticmaterial such as steel. Disposed between and engaging pole members 32and 34 is an annular steel core member 36 that is secured to shaft 22 bykey 35. The rotor has another steel core member 38 that is disposedbetween and in engagement with pole members 30 and 34 that is likewisesecured to shaft 22 by key 35.
The core members 36 and 38 respectively support field coils 40 and 42that are carried by spools 44 and 46 that are formed of insulatingmaterial. Alternatively, the spools may be of magnetic material such assteel suitably insulated as is well known to those skilled in the art.The field coils 40 and 42 have the same number of turns. The spools andfield coils form parts of the rotor and rotate relative to the statorwhenever the rotor is rotated.
The rotor shaft 22 carries metallic slip rings 48 and 50 that areelectrically insulated from each other and from shaft 22. The slip ringsare engaged by brushes 52 and 54 that are supported by brush holder 56.
The rotor pole members 30 and 32 are identical and an end view of rotorclaw pole member 30 is shown in FIG. 3. As shown in FIG. 3, pole member30 comprises a disk portion 30A and six circumferentially spaced andaxially extending pole fingers 30B. Each pole finger 30B has an endsurface 30C, an inner surface 30D and slanted side surfaces 30E. Thesurfaces 30E taper radially and axially inwardly. The pole fingers 30Bare separated by notches 30F. It will be appreciated that more or lessthan six pole fingers could be used.
As previously mentioned, rotor claw pole member 32 is identical withclaw pole member 30. It has a disk portion 32A and six pole fingers 32B.Each pole finger 32B has an end surface 32C, an inner surface 32D andslanted side surfaces 32E. The pole fingers 32B are separated by notches32F.
The center pole member 34, as shown in FIGS. 1, 4 and 5, has a diskportion 34A and six circumferentially spaced pole projections, eachdesignated as 34B. The pole projections 34B are separated by notches34C. Each projection 34B has oppositely directed portions 34D and 34Ewhich are shaped to fit between pole fingers 30B and 32B of claw polemembers 30 and 32.
It can be seen in FIG. 2 that claw pole members 30 and 32 are soarranged relative to shaft 22 that pole fingers 30B and 32B are in exactalignment. In FIG. 2, there is a slight space shown between the endsurfaces of pole fingers 30B and 32B; that is, end surfaces 30C areslightly spaced from corresponding end surfaces 32C of pole fingers 32B.If desired, these end surfaces may be engaged and in general any spacebetween these end surfaces will depend on the axial stack-up of theparts that form the rotor. If the parts are all properly dimensioned,the end surfaces of pole fingers 30B and 32B will be engaged after theparts of the rotor are assembled.
It can be seen that the pole fingers 30B and 32B extend through thenotches 34C of center pole member 34.
FIG. 6 illustrates one manner of electrically connecting the field coils40 and 42 to each other and to a source of direct voltage. In FIG. 6,the same reference numerals have been used as were used in FIG. 1 toidentify corresponding parts. The slip ring 48 is connected to one sideof field coil 40 by conductor 60. The opposite side or end of field coil40 is connected to one side or end of field coil 42 by a conductor 62.The opposite end or side of field coil 42 is connected to conductor 64which in turn is connected to slip ring 50. The conductor 62 has notbeen illustrated in FIG. 1 nor has the entire extent of conductor 64been illustrated. These conductors may pass through suitable bores orslots formed in the rotor parts.
In FIG. 6, brush 54 is shown connected to the positive terminal of adirect voltage source 66 which is shown as a battery. Brush 52 isconnected to ground as is the negative terminal of battery 66. In amotor vehicle application the generator of this invention would beconnected to a bridge rectifier which in turn would supply chargingcurrent to the battery. Moreover, the current supplied to the seriesconnected field coils 40 and 42 would be controlled by a voltageregulator in a known manner.
When field coils 40 and 42 are energized with direct current they willdevelop magnetic flux which links the stator core 16 and the activeconductors of the stator winding 18 located in the slots of the statorcore to cause a voltage to be induced in winding 18. The field coils 40and 42 are so wound and so connected to each other that when they areenergized with direct current the flux developed by the field coilscauses claw pole members 30 and 32 to have one magnetic polarity andcentral pole member 34 to have an opposite magnetic polarity. By way ofexample, if claw pole members 30 and 32 have a north magnetic polarity,central pole member 34 would have a south magnetic polarity. If clawpole members 30 and 32 had a south magnetic polarity, central polemember 34 would have a north magnetic polarity.
The operation of the alternating current generator of this inventionwill now be described. Let it be assumed that the rotor 20 is beingdriven and that field coils 40 and 42 are energized with direct current.Let it further be assumed that claw pole members 30 and 32 have a northpolarity and the central pole member 34 has a south polarity. The fluxgenerated by field coil 42 will flow through a path or magnetic circuitthat includes core member 38, the disk portion 30A of claw pole member30 to pole fingers 30B, through the air gap between pole fingers 30B andstator core 16 radially and then circumferentially through stator core16, radially through core 16 and then through the air gap between statorcore 16 and pole projections 34B and then through disk portion 34A ofpole member 34 to core member 38. In a similar fashion, the fluxdeveloped by field coil 40 flows through core 36, the disk portion 32Aof pole member 32 to pole fingers 32B, through the air gap between polefingers 32B and stator core 16, radially and then circumferentiallythrough stator core 16, radially through core 16 and then through theair gap between stator core 16 and pole projections 34B and then throughdisk portion 34A of pole member 34 to core member 36.
From the description of the flux paths it will be apparent that the fluxgenerated by field coils 40 and 42 flows in the same direction throughstator core 16. Accordingly, the voltage induced or generated in theconductors of stator winding 18 that are located in the slots of statorcore 16 will be a function of the magnitude of the flux developed byfield coil 40 added to the magnitude of the flux developed by field coil42.
FIG. 7 illustrates a modified arrangement for energizing field coils 40and 42 to produce the same relative magnetic polarities for the rotor 20that have been described. In Figure 7, field coils 40 and 42 areconnected in parallel and are energized by direct voltage source 66. Thefield coils 40 and 42 are so wound that they produce magnetic fieldsthat will cause the magnetic polarity of claw pole members 30 and 32 tobe the same but different from the magnetic polarity of central polemember 34.
In summary, it will be appreciated that when rotor 20 is being drivenand when field coils 40 and 42 are energized with direct current, analternating voltage will be induced in stator winding 18. The magnitudeof this voltage will be a function of the speed of rotation of rotor 20and the amount of flux developed by field coil 40 added to the amount offlux developed by field coil 42.
Referring now to FIG. 8, a modified alternating current generator isillustrated. This generator differs from the generator shown in FIG. 1in that, among other things, one of the field coils has been replaced bya permanent magnet. The generator of FIG. 8 uses similar parts as thegenerator shown in FIG. 1 and corresponding parts in FIGS. 1 and 8 havebeen identified by the same reference numeral.
The rotor of the generator shown in FIG. 8 comprises steel pole members70 and 72 which are also shown in FIG. 9. The pole member 70 has sixaxially extending and circumferentially spaced pole fingers 74 and thepole member 72 has six axially extending and circumferentially spacedpole fingers 76. The pole fingers 74 and 76 are exactly aligned witheach other and the end faces 74A of fingers 74 tightly engage the endfaces 76A of pole fingers 76. It is important that the end faces 74A and76A be tightly engaged with no air gap between these end faces.
The rotor further comprises steel pole members 78 and 80. Pole member 78has a disk portion 82 and six axially extending and circumferentiallyspaced pole fingers 84. Pole member 80 has a disk portion 86 and sixaxially extending and circumferentially spaced pole fingers 88. The diskportions 82 and 86 are tightly engaged, as shown in FIG. 8. The polefingers 84 and 88 are exactly aligned with each other. Pole fingers 84are disposed between pole fingers 74 and pole fingers 88 are disposedbetween pole fingers 76.
The rotor of the generator, shown in FIG. 8, has a field coil 90 that isdisposed about steel core 92. This field coil is located between polemember 70 and disk portion 82 of pole member 78. An annular permanentmagnet 94 is located between pole member 72 and disk portion 86 of polemember 80. The permanent magnet 94 is magnetized such that opposite endfaces 94A and 94B have opposite magnetic polarities. For the purpose ofexplaining this invention it will be assumed that end face 94A is anorth pole N and that end face 94B is a south pole S. One side of fieldcoil 90 is connected to slip ring 50 by conductor 95 and the oppositeside of field coil 90 is connected to slip ring 48 by conductor 97.
Disposed within pole member 72 and permanent magnet 94 is a nonmagneticsleeve 96 that may be formed of a plastic material or a nonmagneticstainless steel. This nonmagnetic sleeve prevents magnetic shortcircuiting of permanent magnet 94 by shaft 22 and disk portion 86 ofpole member 80.
The various rotor parts are connected to shaft 22 by a key 98.
The field coil 90 is energized with unidirectional current by a voltageregulating arrangement that is shown in FIG. 10. In FIG. 10, outputwinding 18 is shown as being Delta-connected but it could be Y-connectedif so desired. The stator or output winding 18 is connected to athree-phase, full-wave bridge rectifier 100 having a positive directvoltage output terminal 102 and a grounded negative direct voltageoutput terminal 104. The positive terminal 102 is connected to thepositive terminal of storage battery 106 by line 108.
Unidirectional current is supplied to field winding 90 by line 110 and afield effect transistor 112 which forms a part of a conventionalgenerator voltage regulator. The drain of transistor 112 is connected toline 110 and its source is connected to one side of field winding 90through slip ring 50. The opposite side of field winding 90 is groundedthrough slip ring 48 and a field discharge diode 114 is connected acrossfield winding 90. The gate of transistor 112 is connected to a voltagesensing circuit identified as VS. The voltage sensing circuit isconnected between the positive side of battery 106 and ground and itaccordingly senses the voltage across battery 106. The voltage regulatoris of the type disclosed in the United States patent to Bowman et al.4,636,706. When the voltage between conductor 108 and ground is abovethe desired regulated value, the voltage sensing circuit VS causestransistor 112 to be shut-off or nonconductive to out-off field currentto field winding 90. When the voltage between line 108 and ground isbelow the desired regulated value, the transistor 112 is pulse-widthmodulated on and off that provides a field current that tends toincrease the voltage on line 108 toward the desired regulated value.When the voltage on line 108 increases to a level where it exceeds thedesired regulated value, transistor 112 shuts off. The pulse-widthmodulated control of field current is explained in above-referencedpatent 4,636,706.
The field coil 90 is so wound and the direction of the current flowtherethrough is such that disk portion 82 has a south S magneticpolarity and the pole member 70 has a north N magnetic polarity. This isunder the assumption that permanent magnet 94 has the magnetic polaritydescribed above. It accordingly is seen that pole members 70 and 72 havea magnetic polarity (north) that is opposite to the magnetic polarity ofpole members 78 and 80 (south).
When no current is supplied to field coil 90, the flux developed bypermanent magnet 94 will flow from its north pole (face 94A) to itssouth pole (face 94B) in a path that is made up entirely of steel oriron with no air gaps in this path. This path is from face 94A of magnet94 to pole fingers 76, through abutting pole fingers 76 and 74 to polecore 92 and then through pole core 92 and disk portions 82 and 86 toface 94B of magnet 94. Thus, the flux developed by the permanent magnetis retained within the rotor and does not link the output winding 18except for a small quantity of magnetic leakage flux. Accordingly, thevoltage induced in stator winding 18 is small. The flux path that hasbeen described can be considered as diverting or shunting the permanentmagnet flux away from the air gap between the rotor and stator core 16.In this regard, only leakage flux exists between pole fingers 76 and 88via stator core 16 because this path has been in effect magneticallyshort-circuited or shunted. Since pole fingers 76 and 74 form a shuntmagnetic path, their cross-sectional areas are sized such that they arelarge enough to carry the permanent magnet flux.
Assume now that field coil 90 is energized. With the polarities of thepermanent magnet and field coil, as has been described, abutting polefingers 76 and 74 have the same magnetic polarity (north). Accordingly,the flow of permanent magnet flux through abutting pole fingers 76 and74 is determined by the mmf developed by field coil 90. In regard to thedevelopment of an mmf by field coil 90, it will be appreciated that themmf between pole fingers 74 and 84 varies as field current is varied andis zero with no field current. This said mmf determines the flux thatflows through a path that includes pole fingers 74 through the air gapto stator core 16, through the air gap between stator core 16 and polefingers 84 and then from pole fingers 84 through disk portion 82 andpole core 92. Permanent magnet flux flows in two paths: one path, whichdiverts flux from the air gap between the rotor and stator is throughabutted pole fingers 76 and 74. The other path is from pole fingers 76to stator core 16, through stator core 16 to pole fingers 88 and thenthrough disk portion 86. From what has been described, it will beapparent that fluxes developed by the permanent magnet and by the fieldcoil both link stator output winding 18 so that both fluxes now serve tocause a voltage to be induced in winding 18. The amount of permanentmagnet flux that is diverted away from the stator core 16 depends on theamount of mmf developed by field coil 90. When there is no currentsupplied to field coil 90 all of the permanent magnet flux except forleakage is diverted away from stator core 16 because it flows throughthe previously described closed iron path, including abutting polefingers 76 and 74. As field coil 90 is energized, less permanent magnetflux is diverted away from stator core 16. The amount of permanentmagnet flux that is diverted away from stator core 16 will depend uponthe magnitude of the mmf developed by field coil 90 which in turndepends upon the magnitude of field current supplied to field coil 90.At some intermediate level of field coil mmf none of the flux developedby permanent magnet 94 is diverted away from stator core 16. As fieldcoil mmf is further increased, all the permanent magnet flux plus fieldcoil flux, less leakage, is delivered to stator core 16. Thus, the totalair gap flux can be controlled from some near zero minimum to somemaximum design value. In a practical application, the system may beconfigured such that at maximum field current, the total useful fluxthat links output winding 18 can be made up of 40% permanent magnet fluxand 60% field coil flux.
It will be appreciated that the output voltage of output winding 18 canbe maintained at a desired regulated value by the simple voltageregulating arrangement shown in FIG. 10 which supplies unidirectionalcurrent to field winding 90. Thus, when the output voltage of outputwinding 18 is below the desired regulated value, field current isincreased. A field current increase has a two-fold effect in increasinggenerator output voltage; that is, it causes less permanent flux to bediverted away from stator core 16 and it causes an increased field coilflux to link output winding 18 due to increased field current. When theoutput voltage of output winding 18 exceeds the desired regulated value,field current is reduced which reduces air gap flux. By using thegenerator structure of FIG. 8, which is capable of variably divertingpermanent flux away from stator core 16 the simple voltage regulatingarrangement shown in FIG. 10, can regulate the output voltage of thegenerator. There is no need to reverse the direction of current flowthrough field coil 90 to regulate the output voltage of the generator.Regulation is accomplished by supplying a variable unidirectionalcurrent to field winding 90. The shape of the pole fingers 76 and 74differs to some extent from the shape of the pole fingers of polemembers 30 and 32 which are used in the generator shown in FIG. 1. Polemembers, like pole members 30 and 32, can be used to form the rotorshown in FIG. 8. The ends of the pole fingers must be tightly engagedand the cross-sectional area of the pole fingers that are engaged mustbe large enough to carry the permanent magnet flux that passes betweenengaged pairs of pole fingers.
Pole members 78 and 80 form, in effect, a single central pole member.Accordingly, instead of using two pole members 78 and 80, a single polemember, like pole member 34 (FIG. 4), could be used as part of the rotorof the FIG. 8 generator.
FIG. 11 illustrates the outer configuration of a rotor that could beused in place of the rotors of the generators shown in FIGS. 1 and 8.The FIG. 11 rotor has identical disk-shaped steel end members 120 and122. These members are connected by six one-piece steel pole fingers,each designated as 124. The ends of the pole fingers 124 are located indovetail slots 126 formed respectively in disks 120 and 122. The ends ofpole fingers 124 are either press fit or welded respectively to disks120 and 122.
The rotor of FIG. 11 has a central pole member 128 which is the same asthe central pole member 34 shown in FIG. 4.
The FIG. 11 rotor configuration can be used with two field coils, likethe rotor of the FIG. 1 generator, or can be used with one permanentmagnet and one field coil, like the rotor of the FIG. 8 generator. Whenused with one permanent magnet and one field coil, the pole fingers 124perform the same function as the abutted pole fingers 76 and 74 of thegenerator shown in FIG. 8.
The rotor shown in FIGS. 8 and 9 uses one permanent magnet and one fieldcoil. To increase output power, two axially spaced rotors can be mountedon a common shaft, where each rotor is like the rotor shown in FIGS. 8and 9. This requires two permanent magnets and two field coils and eightclaw pole members.
The embodiments of the invention in which an exclusive property orprivilege is claimed are defined as follows:
1. A voltage regulatedalternating current generator comprising, frame means, a statorsupported by said frame means comprising a stator core formed ofmagnetic material that has slots, an output winding carried by saidstator core including conductors disposed within said slots, a rotorsupported for rotation by said frame means disposed within said statorcore, said rotor comprising a shaft, first and second claw pole membersformed of magnetic material carried by said shaft, each pole memberhaving a plurality of circumferentially spaced and axially extendingpole fingers, the number of fingers of said first pole member beingequal to the number of fingers of said second pole member, said firstand second pole members being so oriented on said shaft that the polefingers of said first and second pole members are aligned with eachother, said first and second pole fingers being connected in such amanner that they magnetically connect said first and second pole membersthrough the magnetic material of said first and second pole fingers, theouter periphery of the pole fingers of said first and second polemembers being aligned with portions of the inner surface of said statorcore, a third pole member means formed of magnetic material carried bysaid shaft having circumferentially spaced pole projections, said thirdpole means having disk portion means disposed between said first andsecond pole members, the projections of said third pole member meansbeing disposed between the fingers of said first and second polemembers, a field coil located between said first pole member and saidthird pole member means, a permanent magnet having opposed end faces ofopposite magnetic polarity located between said third pole member meansand said second pole member, said field coil being so wound andelectrically connected and the end faces of said permanent magnet beingso magnetically poled that when said field coil is energized with directcurrent the pole fingers of said first and second pole members have thesame magnetic polarity and the pole projections of said third polemember means has an opposite magnetic polarity whereby the fluxesdeveloped respectively by said field coil and permanent magnet thattraverses said stator core is additive, means including said diskportion means and said connected first and second pole fingers defininga closed magnetic circuit formed entirely of magnetic material thatmagnetically connects said opposed end faces of said permanent magnet,said magnetic circuit shunting the air gap between said rotor and statorcore whereby the flux developed by said permanent magnet is divertedfrom said air gap by said magnetic circuit and only leakage fluxdeveloped by said permanent magnet traverses said stator core when saidfield coil is not energized, the magneto-motive-force developed by saidfield coil when energized causing the flux developed by said permanentmagnet that is diverted through said magnetic circuit to be reducedwhereby flux developed by said permanent magnet that traverses the airgap between said rotor and stator increases, and voltage regulatingmeans for maintaining the output voltage of said generator at a desiredregulated value, said regulating means applying direct field current tosaid field winding in only one direction through said field winding,said regulating means including means for varying the magnitude of saiddirect field current as an inverse function of the output voltage ofsaid generator, the amount of flux developed by said permanent magnetthat is diverted through said magnetic circuit decreasing as said fieldcurrent increases and increasing as said field current decreases.
2. Thealternating current generator according to claim 1 where said third polemember means is comprised of a pair of pole members having engaged diskportions, each pole member having pole projections that extend inopposite directions.
3. The alternating current generator according toclaim 1 where the connection between said first and second pole fingersis accomplished by engaged end faces of said first and second polefingers.
4. The alternating current generator according to claim 1 wheresaid first and second pole fingers are defined by a one-piece partformed of magnetic material that is connected between said first andsecond pole members. | 2024-03-22 | 1988-10-28 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1989-11-21"
} |
US-72856076-A | Device for cutting yarn
ABSTRACT
Device for cutting yarn which comprises a drum having a plurality of narrow grooves in the outer surface, means for holding the yarn in place on the outer surface of the drum and base support means for holding the drum.
This invention relates to the needlecraft art, and more particularly tothe art of making rugs, wall hangings, pillows and the like utilizingthe latchet hook technique.
In the making of rugs and the like those skilled in the art willappreciate the utility of a device with which yarn can be cut rapidlyand simply to appropriate length with clean-cut, unfrayed ends andwithout untwisting and tangling the yarn. They will also appreciate thefreedom, 1) from dependence upon expensive, small-package, pre-cutyarns, and 2) to select a broad range of natural and synthetic yarns forcraft projects not otherwise available as conventional, pre-cut items.
My invention relates, more particularly, to a device for receiving andholding yarn whereby short sections of yarn, natural or synthetic, maybe easily and readily cut for use by a craftsperson who is hooking a rugor the like using the latchet-hook technique. It is the purpose of myinvention to provide to a craftsperson an inexpensive device for easilyand readily preparing large numbers of uniform, untangled and clean-cutsections of yarn for use in the latchet-hooking of rugs, and the like.
Briefly, the device of my invention comprises a drum having a pluralityof narrow grooves in the outer surface thereof which are adapted toreceive and serve as a guide for a sharp cutting instrument suitable forcutting yarn such as scissors, means for holding the yarn in place onthe surface of the drum, and base support means for holding the drum. Ingreater detail, the drum is a cylinderical core or tube-like body intothe outer surface of which are incised a plurality of axially aligned,uniformly spaced grooves. The yarn is wound helically and uniformlyabout the drum. When the drum is wound full, the yarn is secured byplacing a plurality of holding means over it. The holding means, whichmay be an elastic band, is placed parallel to and mid-way between eachpair of grooves and is removably secured at one end or both ends of thedrum. The holding means maintains the yarn in position during thecutting of the yarn so as to retain the severed yarn pieces on the drumand to insure that pieces of uniform length will be obtained. The firstcut is made by inserting the pointed blade of a sharp pair of scissorsin the end of a groove and cutting the yarn along the length of thatgroove. The drum is then rotated 180° and a second cut made along asecond groove which is opposite the first groove. Ideally, yarn shouldbe wound on the drum without tension, but inevitably some minimaltension will be applied. The need to relieve such tension as uniformlyas possible is important in order to obtain yarn pieces of uniformlength with clean-cut ends and which is the reason for making successivecuts along grooves on opposite faces of the drum, which is also thereason for having grooves in pairs which are diametrically opposed. Allsubsequent cuts are made along grooves half-way between previously usedgrooves. Basically, a drum of uniform circumference having twodiametrically opposed grooves would suffice, and would fall within thescope of this invention. However, ease of production of yarn pieces isincreased in proportion to the increased circumference of the drum andas the number of grooves is increased. The number of grooves in the drumis a function of 2^(n) wherein n is an integer of one to four, and thus,the number of grooves is, two, four, eight or sixteen. Most frequently,the number of grooves is four or eight, which is appropriate for adevice of a size convenient for the use of the home craftsperson. Thedrum is mounted on a base support means which allows for rotation of thedrum. The drum may be removably mounted on the base support means or maybe mounted without provision for removal.
I have thus described my invention generally in order that its operationand utility may be better understood by those skilled in the art. WhileI shall illustrate below a preferred embodiment of my invention, itshould be understood that my basic contribution may be utilized in otherphysical forms. Moreover, while I have for convenience described myinvention as relating to the needlecraft art, and particularly to thelatchet hooking art, it is readily understandable that my contributionmay be useful in other arts, and I therefore do not wish the scopethereof to be limited to the preparation of yarn lengths for the latchethooking art.
Referring now to the drawing,
FIG. 1 is a perspective view of my device for cutting yarn.
FIG. 2 shows an end view of my device.
FIG. 3 is a partial cross-section showing a cutting instrument inposition for cutting the yarn.
FIG. 4 is a cross-section along the axis of the drum showing the yarn inplace.
Referring now even more particularly to the drawing, reference numeral 2designates the drum, numeral 4 designates the base support means, andnumeral 6 designates the holding means. In the embodiment shown in theFigures, the drum 2 is a wound and glued paperboard cylinder or corewith two pairs of diametrically opposed grooves 8 and 10 and 12 and 14incised axially in the outer surface with sufficient depth and shape toreceive the cutting edge of a pair of scissors or the like. The drum maybe formed from metal such as aluminum or plastic such as apolypropylene, polystyrene or polyvinyl chloride, or turned from woodand be quite as effective as in its preferred form. The outer surface ofthe drum can be provided with a very slightly roughened surface to aidin winding the yarn.
The distances between the centers of each of the grooves 8, 10, 12 and14 are all 2.5 inches, the standard length for pieces of yarn ascommonly used for latch hooking, and the circumference of the drum istherefore 10 inches. Flexibility in rug design and execution can beobtained by providing drums with larger or smaller circumferences,longer or shorter distances between the grooves and varying pairs ofgrooves. The depth and width of the grooves 8, 10, 12, and 14 may bevariable but must be large enough to accept the pointed blade of thecutting instrument but yet small enough to insure that the yarn will becut in even lengths. In the embodiment shown, grooves 1/8 inch wide and1/8 inch deep are provided, which cooperate well with scissors ofaverage size. The drum 2 can be of varying length; however, a length ofabout 81/2 inches is convenient for ease of handling. One or more radialstruts 16 are secured flush with each end of the drum 2. These strutsmay be of variable composition and design but in the embodiment shownthey are wood. An axle 18 is provided axially with respect to the drumand secured to the struts 16 so that the drum rotates on turning thecrank 20 which, as shown, may be an integral part of the axle. The axle18 may be of variable composition but in the embodiment shown is a roundmetal rod. The crank 20 could be replaced by any suitable axle-turningdevice such as a wooden or plastic wheel or knob firmly affixed to theaxle 18 of appropriate size. A washer or bushing 22 is inserted overeach end of the axle 18 and between the struts 16 and upright supports24. The washers or bushings 22 must be sufficiently thick to permit theholding pins 26 to clear the supports 24 when the drum is rotated. Itemsknown as 1/2 inch wooden macrame beads have been found to be eminentlysatisfactory. The pins 26 are mounted equidistant between adjacentgrooves in each end of the drum 2. Each pin protrudes 1/4 inch from eachend surface of the drum. The elastic band retaining means 26 may be ofvariable design. Items known in the hardware art as No. 18, 1 inch wirebrads are suitable. The holding means 6 for retaining the yarn on thedrum, in the embodiment shown, is completed by use of an elastic member28 which is stretched with very moderate tension axially along the drumby removable attachment to a pair of pins 26. The base support means, inthe embodiment shown, FIGS. 1 and 2, includes a flat base 30 and uprightsupport member 24 which is adapted to rotatably receive the axle 18. Thesupport means in another embodiment can have a notch in the top part ofthe upright support member 24 -- to in effect cradle the axle and thusprovide for ready removal of the drum.
In the operation of my yarn cutting device, the yarn 32 is wound aroundthe drum 2 by securing the loose end of the yarn in a notch or othercatch means such as Velcro ® stick tape 34 embedded at one end of thedrum and turning the drum by means of crank 20 while applying only mildtension on the yarn.
Once the yarn 32 has been wound fully about the drum 2, it is retainedin place for cutting by emplacement of yarn holding means 26 and 28. Theelastic yarn holding member 28 can be of various designs and materials,but in the embodiment shown is a rubber band, with those of 21/2 inchlength being eminently satisfactory for a drum of 81/2 inch length. Whensecured in the manner described, the yarn 32 is ready for cutting.Cutting is accomplished by following with a suitable cutting instrument36 along the entire length of say, groove 8. This operation is repeatedserially next along groove 10, then groove 12, and finally along groove14, or in other words, first cutting the yarn to a length equivalent tothat of one revolution, next cutting that length in half, and thencutting each of these halves in half. Cutting instruments of varioustypes and designs could be employed, but the most satisfactory hasproved to be a sharp scissors with one pointed blade tip which enhancesfollowing along the several grooves.
The yarn pieces are made available for use by releasing the severalelastic members 28 in turn and manually removing the cut yarn from thedrum.
From the foregoing, it is believed that those familiar with this artwill readily recognize and appreciate the novel features and advantagesof the present invention which marks it apart from and as a noveladvancement over previously known devices for producing yarn pieces inthis art. Also, it is to be understood that while the features of thepresent invention have been described and illustrated in relation to aparticular embodiment thereof as set forth in the accompanying drawings,nevertheless numerous changes, modifications, and substitutions ofequivalents may be made therein without departing from the spirit andscope of its inventive features.
What I claim is:
1. A device for cutting elongated material whichcomprises a drum having a plurality of axially disposed uniformly andequidistantly spaced, narrow grooves; said grooves being at least fourin number; said material being disposed on said drum's surface, meansfor securing the material thereon, and comprising elastic band meansmounted at opposite ends of the drum and spaced equidistant betweenadjacent grooves; base support means for rotatably supporting the drum,and including a pair of upright members rotatably receiving the drum,and said grooves being selected that when the material is cut by cuttingmeans placed in selected ones of said grooves the material will besubstantially equal in length.
2. The device according to claim 1wherein said drum in removably mounted on said base support means. 3.The device of claim 1 further including a shaft centrally disposedwithin the drum, means on the ends of the drum connected to the shaft,and handle means secured to the shaft for rotating the same with respectto the base support beams.
4. The device of claim 3 wherein the shaft issupported on the base support means.
5. The device of claim 3 whereinthe means on the ends of the drums are radial struts and bushings aredisposed at the inner ends with said shaft extending therethrough. 6.The device of claim 3 wherein pin means extend outwardly from each endof the drum and elastic means removably connected thereto for holdingthe yarn to be cut in place.
7. The device of claim 6 wherein yarnengaging means are secured on the drum for maintaining one end of theyarn thereon.
8. The device of claim 7 wherein the yarn engaging meansis Velcro.®™
9. The device of claim 6 wherein the pin means areequidistantally disposed between the grooves. | 2024-03-22 | 1976-10-01 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1978-06-06"
} |
US-50125590-A | Convertible car body structure
ABSTRACT
A convertible car body structure which includes a pair of side structures, a front windshield structure and a rear structure, the body structure having a top opening and a back window opening. A roof panel and a back window panel are provided for covering the top opening and the back window opening of the car body structure, respectively. The roof panel is connected at the rear end portion swingably with the front end portion of the back window panel so that the roof panel can be folded on the back window panel. The back window panel is connected at the rear end portion swingably with the rear body structure. The rear body structure is formed with a concave space for receiving the roof panel and the back window panel after the roof panel has been folded on the back window panel. A concealing cover panel is provided on the rear body structure for covering the concave space. The cover panel is swingably connected at a rear end portion with the rear body structure adjacent to a rear end portion of the concave space in the rear body structure. A locking mechanism is provided for retaining the concave cover panel on the rear structure so that fluttering of the cover panel is prevented. The locking mechanism includes a striker provided on the cover panel, a latch member provided on the rear structure for engagement with the striker and a driving mechanism for the latch member.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a roof structure of a convertible typecar structure. More specifically, the present invention pertains to alocking device for a retractable roof structure of a convertible typecar.
2. Description of the Prior Art
In a convertible type car body structure, a retractable roof structureis known. In this type, the roof panel is swingably connected at therear end with the top edge portion of the back window panel through ahinge structure. The back window panel is swingably connected with therear structure of the car body. The roof panel and the rear window panelcan be swingably moved so that they are folded and retracted into therear body structure. The roof and rear window panels thus retracted intothe rear body structure are then covered by a concealing cover panel.
In this type of retractable roof structure, problems have beenexperienced in that the roof panels and the back window panel producefluttering in operation. Similar fluttering is also produced in theconcealing cover panel.
SUMMARY OF THE INVENTION
It is therefore an object of the present invention is to provide aretractable roof structure for a convertible car body in which theaforementioned fluttering can effectively be prevented.
Another object of the present invention is to provide locking mechanismsfor the retractable roof structure and the concealing cover panel whichis effective to prevent the aforementioned fluttering.
According to one aspect of the present invention, the above and otherobjects can be accomplished by a concealing cover panel provided withstriker means which is adapted to cooperate with latch means provided onthe car body structure. The latch means is connected with driving meanswhich may include motor means and a gear mechanism. The driving means isoperated to bring the latch means into engagement with the striker meansso that the concealing cover panel is firmly held on the car body tothereby prevent the possibility of fluttering.
According to another aspect of the present invention, locking means isprovided between the roof panel and the car body. The locking meanscomprises catch means provided on the roof panel and manually actuatablehook means provided on the car body. The hook means is provided withhandle means and adapted to be manually actuated into engagement withthe catch means on the roof panel. The hook means may be provided on theside structure of the car body. By providing the locking means asdescribed, it is possible to firmly retain the roof panel on the carbody so that the fluttering can be prevented.
According to a further aspect of the present invention, locking means isprovided between the back window panel and the car body. The lockingmeans comprises base means provided on the car body and catch meansprovided on the back window panel. The catch on the back window panel isprovided with manually actuatable handle means which is adapted to beactuated to bring the catch means into engagement with the base means.With this locking means, the back window panel can be firmly retained sothat the fluttering can be effectively prevented.
The above and other objects and features of the present invention willbecome apparent from the following description of a preferred embodimenttaking reference to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a perspective view of a car roof structure in accordance withone embodiment of the present invention;
FIG. 2 is a side view showing the roof panel locking mechanism;
FIG. 3 is a sectional view of the locking mechanism shown in FIG. 2;
FIG. 4 is an exploded perspective view of the locking mechanism shown inFIG. 2;
FIG. 4A is a side view of the catch used in the locking mechanism shownin FIG. 2;
FIG. 5 is a side view showing the back window panel locking mechanism;
FIG. 6 is a sectional view of the locking mechanism shown in FIG. 5;
FIG. 7 is an exploded perspective view of the locking mechanism shown inFIG. 5;
FIG. 8 is a side view of the concealing cover panel locking mechanism;
FIG. 9 is a cross-sectional view of the locking mechanism shown in FIG.8;
FIG. 10 is a longitudinal sectional view of the locking mechanism shownin FIG. 8;
FIG. 11 is an exploded perspective view of the locking mechanism shownin FIG. 8;
FIG. 12 is a plan view showing the locking mechanism of FIG. 8 in thelocking position; and,
FIG. 13 is a plan view similar to FIG. 12 but showing the lock releaseposition.
DESCRIPTION OF THE PREFERRED EMBODIMENT
Referring to the drawings, particularly to FIG. 1, there is shown a carbody 1 which has a pair of side structures 1a, a front windshieldstructure 1b and a rear body structure 1c. The car body 1 is formed atthe top portion with a roof opening 2 and at the rear upper portion witha back window opening 3. The side structures 1a are provided along sideedge portions of the roof opening 2 and the back window opening 3 withguide rails 4.
The car body includes a roof structure comprising a roof panel 6 forclosing the roof opening 2. The roof panel 6 is provided at the oppositesides of a front end portion with links 5 through which the roof panel 6is engaged with the rails 4 on the side structures 1a. There is provideda back window panel 8 for closing the back window opening 3. The roofpanel 6 is connected at a rear end portion with an upper end portion ofthe back window panel 8 through hinges 7 so that the roof panel 6 isswingable with respect to the back window panel 8. The back window panel8 is connected at a lower end portion with the rear body structure 1c inthe vicinity of the lower end portion of the back window opening 3through hinges 9.
The rear body structure 1c formed with a concave space 10 for receivingthe roof panel 6 and the back window panel 8. The roof panel 6 isconnected with the back window panel 8 for swingable movement aspreviously described. The back window opening 8 is swingable towardrearwards with respect to the car body structure due to theaforementioned hinge connection. Thus, the roof panel 6 can be folded onthe back window panel 8 by swingably moving the back window panel 8rearwards. The roof panel 6 and the back window panel 8 can thus beretracted into the concave space 10 in the rear body structure.
There is provided a panel driving mechanism 13 which is located in therear body structure 1c beneath the lower end portion of the back windowopening 3. The driving mechanism 13 includes a motor having an outputshaft connected with driving shafts 14. The driving shafts 14 areconnected through reduction gear mechanisms 15 with hinge pins in thehinge mechanisms 9. The hinge pins of the hinge mechanisms 9 are securedto hinge members which are attached to the back window panel 8. It willtherefore be understood that an operation of the driving mechanism 13will cause a swingable movement of the back window panel 8 into and outof the concave space 10 in the rear body structure 1c. Although notshown in the drawing, cables are arranged along the guide rails 4 andconnected on one hand with the links 5 and on the other hand with thedriving mechanism 13. Thus, the operation of the driving mechanism 13will also cause movement of the front end portion of the roof panel 6into and out of the concave space 10. Thus, the roof panel 6 and theback window panel 8 can be moved between an extended or closed positionand a retracted position, the extended position being a position whereinthe roof panel 6 covers the roof opening 2 and the back window panel 8covers the back window opening 3, the retracted position being aposition wherein the panels 6 and 8 are completely retracted into theconcave space 10. The rear body structure 1c is further provided withconcealing cover panel 11 for covering the concave space. The coverpanel 11 is connected with the rear body structure 1c at the rear endportion of the concave space 10 through hinges 12. A cover drivingmechanism 16 is provided in the rear body structure 1c for driving theconcealing cover 11 between a closed position in which the cover 11closes the concave space 10 and an open position in which the cover 11opens the space 10. The cover driving mechanism 16 drives the cover 11through cables 17, reduction gear mechanisms 18 and linkages 19 to placethe panel 11 in the closed position both in the extended and retractedpositions of the panels 6 and 8 and to open the panel 11 when the panels6 and 8 are being moved.
The roof panel 6 is provided at the opposite sides of the front endportion with roof panel locking mechanisms 20 for firmly retaining theroof panel 6 on the car body 1. On an intermediate portion of the frontupper end portion of the back window panel 8, there is provided backwindow locking mechanism 40 for firmly retaining the back window panel 8on the transverse beam 1d of the car body structure 1. The rear bodystructure 1c is provided at the opposite sides of the concave space 10with concealing cover panel locking mechanisms 60 for firmly retainingthe side edge portions of the concealing cover panel 11 on the rear bodystructure 1c. The locking mechanisms 20 and 40 function to preventfluttering of the panels 6 and 8 when the panels are in the closed orextended positions. The locking mechanism 60 functions to preventfluttering of the concealing cover panel 11 both in the extended andretracted positions of the panels 6 and 8.
Referring now to FIGS. 2 through 4, each of the roof panel lockingmechanism 20, provided at each side of the front end portion of the roofpanel 6, includes a case 21 which is of an inverted channel-shapedcross-sectional shape having a bottom 21a and a pair of side walls 21b.A lug 21c is formed on the bottom 21a to extend in parallel with theside walls 21b. As shown in FIGS. 2 and 4, a handle 22 is carried by thecase 21. The handle 22 is swingably supported by the side walls 21b andthe lug 21c through 1 pin 23. A T-shaped member 25 is carried by thehandle 22 by means of a pin 26 which is parallel with but offset fromthe pin 23 for mounting the handle 22 on the case 21. The T-shapedmember 25 has a hook member 27 which is secured thereto by means of aretaining screw 28. The hook member 27 has a tip end formed withsemi-spherical hook portion 27a.
The front windshield structure 1b is provided with a catch 29 forcooperation with the locking mechanism 20, specifically with the hookmember 27 carried by the handle 22 of each locking mechanism 20. Thecatch 29 has a ridge 29a which is formed with a cutout 29b. A reliefgroove 30 is formed behind the ridge 29a. Referring to FIG. 2, in whichthe locking mechanism is shown in a locked condition, it will be notedthat a counter-clockwise swinging movement of the handle 22 about thepin 23, from the position shown, will cause movement of the pin 26 whichsupports the T-shaped member 25 through an arcuate path about the pin23, so that the hook member 27 and the hook portion 27a on the T-shapedmember 25 will ultimately be moved left. At the end of such arcuate paththe T-shaped member 25 is moved so that the hook portion 27a of the hookmember 27 is disengaged from the ridge 29a of the catch 29 to releasethe latch 20. Thus in unlocking the latch 20, the handle 22 is swingablymoved counter-clockwise to move the pin 26 and the T-shaped member tothe left. Then, the engagement between the hook member 27 and the catch29 is loosened so that the hook member can be removed from the catch 29.To lock the latch 20, the hook portion 27a of the T-shaped member 27 isreceived in the relief groove 30 of the catch 29 and the shaft portionof the hook member 27 passes through the cutout 29c in the ridge 29a.Then, the handle 22 is swingably moved clockwise to the position shownin FIG. 2 to move the pin 26 back through the aforementioned arcuatepath and ultimately to the toward right in the plane of FIG. 2. Thus,the roof panel 6 is pulled toward the front windshield structure 1b tobe securely retained thereon.
The case 21 is formed with a projection 31 on which a rubber stopper 32is mounted. The catch 29 is formed with a groove 33 which is adapted tobe engaged with the rubber stopper 32 on the case 21 in the lockingposition of the mechanism. Thus, the roof panel 6 is retained in apredetermined position with respect to the side body structure 1a. Asshown in FIGS. 2 and 3, a retaining member 34 of an invertedchannel-shaped cross-sectional configuration is attached to the bottom21a of the case 21. The handle 22 is of a channel-shaped cross-sectionalconfiguration and has a pair of side walls 22a as shown in FIG. 3. Theretaining member 34 has a pair of leg portions 34a which extend alongthe side walls 22a of the handle 22. The leg portions 34a of theretaining member 34 are formed with recesses 35. The side walls 22a ofthe handle 22 are provided with projections 36 which are adapted to beengaged with the recesses 35 in the leg portions 34a of the retainingmember 34 when the handle 22 is in the position shown in FIG. 2. Thus,the handle 22 is firmly retained in the case 21.
Referring now to FIGS. 5 through 7, there are shown details of the backwindow panel locking mechanism 40. The mechanism 40 includes a base 41mounted on the transverse beam 1d. The base 41 is of an invertedchannel-shaped cross-sectional configuration having a bottom 41a and apair of side walls 41b. A link 42 is pivotably connected at one end tothe side walls 41b of the base 41 by means of a pin 44. A handle 43 isprovided and has lugs 43a. The other end of the link 42 is pivotablyconnected with the lugs 43a of the handle 43 by means of a pin 45.
As shown in FIG. 6, the handle 43 is of a channel-shaped cross-sectionalconfiguration and has a pair of side walls 43b. At a rearward endportion of the handle 43, there is a pin 47 which extends between theside walls 43b. The back window panel 8 has a catch 48 which is securedthereto and formed at a free end with a hook 49 for engagement with thepin 47 on the handle 43. A plate 55 is attached to the hook 49 and has aguide portion 56. The guide portion 56 serves to hit the pin 47 on thehandle 43 when the back window panel 8 is being moved toward the closedposition to thereby guide the pin 47 toward the hook 49.
At a front end portion of the handle 43, there is provided a retainingmember 50 of a channel-shaped cross-sectional configuration having apair of legs 50a. The retaining member 50 is made of a resilientmaterial and secured to the handle 43 through a retaining plate 54 and ascrew. The legs 50a of the retaining member 50 are formed with sidewardprojections 51. The side walls 41b of the base 41 are formed withrecesses 52 which are adapted for engagement with the projections 51 onthe retaining member 50. Through this engagement between the projections51 on the retaining member 50 and the recesses 52 in the side walls 41bof the base 41, the handle 43 can be retained in the position shown inFIG. 5. The base 41 is further provided with a click retaining spring 53which is adapted for engagement alternately with flattened edges 42a and42b. In the position shown in FIG. 5, the spring 53 engages theflattened edge 42b but when the handle 43 is swingably movedcounter-clockwise in the plane of FIG. 5 the flattened edge 42a engagesthe spring 53.
FIG. 5 shows the handle 43 in the locking position. For unlocking, thehandle 43 is swingably moved counterclockwise by holding the left handend portion of the handle 43. The handle 43 is then swung about the pin47 simultaneously producing a counter-clockwise swinging movement of thelink 42. The engagement between the pin 47 and the hook 49 is thenloosened so that the pin can be removed from the hook 49. For locking,the pin 47 is first engaged with the hook 49 and the handle 43 isswingably moved clockwise. This movement of the handle 43 causes acounterclockwise swinging movement of the link 42 so that the link 42 ismoved to the position shown in FIG. 5. The position of the pin 45 isthen moved leftwards so that the back window panel 8 is pulled towardthe transverse beam 1d. The back window panel 8 is thus firmly retainedon the car body structure 1.
Referring to FIGS. 8 through 13 showing the concealing cover panellocking mechanism 60, it will be noted that the mechanism 60 includes acase 61 which is mounted on a side wall (not shown) of the rear bodystructure 1c defining the concave space 10. In the case, there is amotor 62 having an output shaft 62a connected with a worm gear 62b. Afirst gear 64 is mounted on the case 61 through a pin 63 which extendsperpendicularly to the axis of the output shaft 62a of the motor 62 forrotation about the axis of the pin 63. The gear 64 has a small gear 64awhich is in meshing engagement with a second gear 66 which is mounted onthe case 61 by means of a pin 65 extending in parallel with the pin 63.The second gear 66 has a small gear 66a which is in meshing engagementwith an idler gear 75. The idler gear 75 is engaged with a latch gear 68mounted on the case 61 through a shaft 67. The shaft 67 is secured tothe gear 68 so that they rotate together. As shown in FIGS. 10 and 11,the gear 68 is provided with a pin 69 which is inserted into an arcuateslot 70 formed in the case 61 to thereby limit the extent of rotation ofthe latch gear 68.
The shaft 67 has one end extending through the case 61 and a latchmember 72 is mounted on the end of the shaft 67. A spacer 71 is disposedbetween the case 61 and the latch member 72. As shown in FIGS. 8 and 11,the latch member 72 is formed with an arcuate slot 72a and a finger 72b.A striker 73 is mounted on the concealing cover panel 11 and adapted forengagement with the latch member 72. The case 61 is provided with acover 74 for covering the parts mounted on the case 61.
For locking, the concealing cover panel 11 is brought into the closedposition wherein the striker 73 is located in the slot 72a of the latchmember 72. The motor 62 is then energized to drive the latch gear 68clockwise as seen in the plane of FIG. 8. The latch is therefore drivenuntil the finger 72b is engaged with the striker 73 An operation of themotor 62 in the opposite direction will unlock the mechanism 60.
The idler gear 75 is mounted on the case 61 through an eccentric shaft76. As shown in FIG. 9, the eccentric shaft 76 has a pin portion 77which in mounted on the case 61 and an eccentric portion 76a whichcarries the idler gear 75. An actuating lever 78 is attached to the pinportion 77 and extends outside the case 61. In the position shown inFIG. 8, the idler gear 75 is engaged with the small gear on the secondgear 66 and the latch gear 68. When the lever 78 is moved clockwise inthe plane of FIG. 8, the idler gear 75 is moved about the axis of thepin portion 77 away from the latch gear 68. Thus, the idler gear 75 isdisengaged from the latch gear 68. In this position, the latch member 72can be rotated manually.
In the structures described above, when it is desired to move the roofstructure from the extended position to the retracted position, the roofpanel locking mechanism 20 and the back window locking mechanism 40 areat first manually unlocked. Then, the motor 62 for the concealing coverpanel locking mechanism 60 is operated to unlock the locking mechanism60. The concealing cover panel driving mechanism 16 is then operated todrive the linkage 19 to move the cover panel 11 to the open position.Thereafter, the driving mechanism 13 is operated to thereby drive thelink mechanisms 5 and the hinge mechanisms 9. The roof panel 6 istherefore folded on the back window panel 8 and the panels 6 and 8 areretracted into the concave space 10. Thus, the openings 2 and 3 areexposed. The concealing cover panel 11 is then moved to the closedposition through an operation of the cover driving mechanism 16.Thereafter, the motor 62 for the concealing cover locking mechanism 60is operated to move the locking mechanism 60 into the locking position.The panels 6 and 8 can be brought into the closed positions by revertingthe operations described above.
The invention have thus been described with reference to a specificembodiment, however, it should be noted that the invention is in no waylimited to the details of the illustrated structures but changes andmodifications may be made without departing from the scope of theappended claims.
We claim
1. A convertible car body structure including a pair of sidestructures, a front windshield structure and a rear structure, said bodystructure having a top opening and a back window opening, a roof panelfor covering said top opening of the car body structure, a back windowpanel for covering said back window opening of the car body structure,said roof panel having a rear end portion swingably connected with afront end portion of said back window panel so that said roof panel canbe folded on said back window panel, said back window panel having arear end portion swingably connected with said rear structure, said rearstructure being formed with a concave space for receiving said roofpanel and said back window panel after said roof panel has been foldedon said back window panel, a concealing cover panel provided on saidrear structure for covering said concave space, said cover panel beingswingably connected at a rear end portion with said rear structureadjacent to a rear end portion of said concave space in said rearstructure, locking means for retaining said concave cover panel on saidrear structure, said locking means including a striker provided on saidcover panel, a latch member provided on said rear structure forengagement with said striker, driving means for said latch memberincluding motor means and gear means for transmitting rotation of saidmotor means to said latch member.
2. A car body structure in accordancewith claim 1 in which said gear means includes a latch gear connectedwith said latch member for rotation with said latch member, a drivengear adapted to be driven by said motor means, an idler gear betweensaid driven gear and said latch gear for transmitting a rotation fromsaid driven gear to said latch gear, and means for manually moving saididler gear into and out of engagement with at least one of said latchgear.
3. A car body structure in accordance with claim 2 in which saidmanually moving means includes eccentric shaft means carrying said idlergear.
4. A car body structure in accordance with claim 1 which furtherincludes roof panel locking means for retaining said roof panel on saidbody structure in a position wherein said roof panel closes said topopening, said roof panel locking means including a catch mounted on saidbody structure, manually actuatable handle mounted on said roof panelfor swinging movement, said handle has hook means mounted on said handlefor a swinging movement about an axis offset from an axis of theswinging movement of said handle and adapted for engagement with saidcatch, means provided on said roof panel for holding said handle in alocking position.
5. A car body structure in accordance with claim 4 inwhich said catch is formed with a ridge and a relief groove behind saidridge and said hook means has spherical end portion for engagement withsaid ridge of said catch.
6. A car body structure in accordance withclaim 4 in which said catch is formed with a ridge and a relief groovebehind said ridge and said hook means is formed with a shaped endportion adapted to be engaged with said ridge on said catch, said catchbeing further formed with recess means adapted for engagement withrubber stopper means provided on said roof panel.
7. A car bodystructure in accordance with claim 4 in which said holding means on saidroof panel includes recess and projection means provided between saidhandle and said roof panel.
8. A car body structure in accordance withclaim 1 which further includes back window locking means for retainingsaid back window panel on said car body structure in a position whereinsaid back window panel closes said back window opening, said back windowlocking means including a second catch mounted on said rear structure ofsaid car body structure, a second handle mounted on said back windowpanel through a link, retaining means provided on said second handle andadapted for engagement with said second catch, means for holding saidsecond handle in a locking position.
9. A car body structure inaccordance with claim 8 in which said retaining means includes a pin,said second catch includes a hook adapted for engagement with said pinon said second handle and guide means provided adjacent to said hook forguiding said pin toward said hook when said back window panel is beingmoved into said position wherein said back window panel closes said backwindow opening.
10. A car body structure in accordance with claim 8 inwhich click stop means is provided between said link and said car bodystructure, said click stop means includes resilient spring meansprovided on said car body structure and a plurality of flattened edgesformed on said link and adapted for alternate engagement with saidspring means on said car body structure.
11. A car body structure inaccordance with claim 8 in which said holding means for holding saidsecond handle in said locking position includes recess and projectionmeans provided between said second handle and said car body structure. | 2024-03-22 | 1990-03-29 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1991-07-23"
} |
US-59956490-A | Naphthyloxazolidone derivatives
ABSTRACT
A naphthyloxazolidone derivative of the formula: <CHEM> wherein R<1> is hydrogen atom, hydroxy group, nitro group, amino group, sulfo group, aminosulfonyl group, a lower alkenyloxy group, a lower alkynyloxy group, a mono or di(lower alkyl)aminocarbonyloxy group, a lower alkanoyloxy group or a lower alkoxy group which may have a substituent selected from an aryl group, a cycloalkyl group, an oxygen-containing heteromonocyclic group, hydroxy group, a lower alkoxy group, cyano group, a di(lower alkyl)amino group, aminocarbonyl group, a lower alkoxycarbonyl group, a lower alkanoyloxy group, a lower alkylthio group, a lower alkylsulfinyl group and a lower alkylsulfonyl group; R<2> is hydroxy group, a lower alkoxy group, a lower alkylsulfonyloxy group, triazo group or an amino group which may have a substituent selected from a lower alkyl group and a lower alkanoyl group, and a pharmaceutically acceptable salt thereof are disclosed. Said derivative and a pharmaceutically acceptable salt thereof lare useful as an antidepressant.
This invention relates to novel naphthyloxazolidone derivatives whichare useful as an antidepressant and processes for preparing the same.
Monoamine oxidase (MAO), which catalyzes oxidative deamination ofmonoamines to produce aldehydes, is classified into two groups (i.e.,MAO-A and MAO-B) according to its substrate specificity. MAO-A catalyzesoxidative deamination of neurotransmitters such as serotonin,noradrenaline and the like, whereas MAO-B catalyzes oxidativedeamination of phenethylamine, and the like.
Known MAO inhibitors which have been used as an antidepressant have noselective inhibitory activity against MAO-A or MAO-B and showirreversible and long-lasting inhibitory activity. Therefore, the knownMAO inhibitors are disadvantageous in that they have side effects suchas hepatic injuries, migraine and hypertensive crises after theingestion of tyramine-containing food, i.e., cheese effect.
An object of the present invention is to provide novelnaphthyloxazolidone derivatives which have potent reversible andselective inhibitory activity against MAO-A and are useful as anantidepressant.
Another object of the present invention is to provide processes forpreparing said naphthyloxazolidone derivatives.
Another object of the present invention is to provide novelintermediates of said naphthyloxazolidone derivatives.
The present invention relates to a naphthyloxazolidone derivative of theformula: ##STR2## wherein R¹ is hydrogen atom, hydroxy group, nitrogroup, amino group, sulfo group, aminosulfonyl group, a lower alkenyloxygroup, a lower alkynyloxy group, a mono or di(loweralkyl)aminocarbonyloxy group, a lower alkanoyloxy group or a loweralkoxy group which may have a substituent selected from an aryl group, acycloalkyl group, an oxygen-containing heteromonocyclic group, hydroxygroup, a lower alkoxy group, cyano group, a di(lower alkyl)amino group,aminocarbonyl group, a lower alkoxycarbonyl group, a lower alkanoyloxygroup, a lower alkylthio group, a lower alkylsulfinyl group and a loweralkylsulfonyl group; R² is hydroxy group, a lower alkoxy group, a loweralkylsulfonyloxy group, triazo group or an amino group which may have asubstituent selected from a lower alkyl group and a lower alkanoylgroup, or a pharmaceutically acceptable salt thereof.
Examples of the naphthyloxazolidone derivative (I) of the presentinvention include those of the formula (I) in which an aryl group isphenyl group, a cycloalkyl group is a cycloalkyl group of 3 to 6 carbonatoms, and an oxygen-containing heteromonocyclic group is atetrahydrofuryl group. Among them, preferred compounds include those ofthe formula (I) in which R¹ is a lower alkenyloxy group, a loweralkanoyloxy group or a lower alkoxy group which may have a substituentselected from cyclopropyl group, hydroxy group and cyano group; R² is alower alkoxy group. More preferred compounds are those of the formula(I) in which R¹ is a lower alkoxy group which may have a substituentselected from cyclopropyl group and cyano group. Another preferredcompounds are those of the formula (I) in which R¹ is at the 6-positionof naphthalene ring and the 5-substituted-2-oxazolidon-3-yl group is atthe 2-position of naphthalene ring.
According to the present invention, the naphthyloxazolidone derivatives(I) can be prepared either by
[A] reacting a lower alkyl naphthylcarbamate compound of the formula:##STR3## wherein R³ is a lower alkyl group and R¹ is the same as definedabove, or a salt thereof with an oxirane compound of the formula:##STR4## wherein R² is the same as defined above, or a salt thereof, orby
[B] reacting a naphthalene compound of the formula: ##STR5## wherein X¹is a reactive residue, R¹ is the same as defined above, or a saltthereof with a 2-oxazolidone compound of the formula: ##STR6## whereinR² is the same as defined above, or a salt thereof.
The naphthyloxazolidone derivative of the formula: ##STR7## wherein R¹is the same as defined above, can also be prepared by
[C] condensing a propanediol compound of the formula: ##STR8## whereinR¹ is the same as defined above, or a salt thereof with a carbonylcompound of the formula:
CO(X.sup.2).sub.2 (VII)
wherein X² is a reactive residue.
The naphthyloxazolidone derivative of the formula: ##STR9## wherein R⁴is a lower alkyl group or a lower alkylsulfonyl group, and R¹ is thesame as defined above, can also be prepared by
[D] condensing the compound (I-a) with the compound of the formula:
R.sup.4 --X.sup.3 (VIII)
wherein X³ is a reactive residue and R⁴ is the same as defined above.
The naphthyloxazolidone derivative of the formula: ##STR10## wherein R²is the same as defined above, can also be prepared by
[E] reducing the compound of the formula: ##STR11## wherein R⁵ is anaryl-lower alkyl group, R² is the same as defined above, or a saltthereof.
Further, the naphthyloxazolidone derivative of the formula: ##STR12##wherein R⁶ is a lower alkenyl group, a lower alkynyl group, a mono ordi(lower alkyl)aminocarbonyl group, a lower alkanoyl group or a loweralkyl group which may have a substituent selected from an aryl group, acycloalkyl group, an oxygen-containing heteromonocyclic group, hydroxygroup, a lower alkoxy group, cyano group, a di(lower alkyl)amino group,aminocarbonyl group, a lower alkoxycarbonyl group, a lower alkanoyloxygroup, a lower alkylthio group, a lower alkylsulfinyl group and a loweralkylsulfonyl group, R² is the same as defined above, can also beprepared by
[F] condensing the compound (I-c) or a salt thereof with a compound ofthe formula:
R.sup.6 --X.sup.4 (IX)
wherein X⁴ is a reactive residue, R⁶ is the same as defined above, or asalt thereof.
Among the naphthyloxazolidone derivative (I-e), a compound of theformula: ##STR13## wherein R⁷ is cyano group or a lower alkoxycarbonylgroup, and R² is the same as defined above, can also be prepared by
[G] reacting a compound (I-c) or a salt thereof with a compound of theformula:
R.sup.7 --CH═CH.sub.2 (X)
wherein R⁷ is the same as defined above.
Further, among the naphthyloxazolidone derivative (I-e), a compound ofthe formula; ##STR14## wherein R⁸ is a lower alkyl group, and R² is thesame as defined above, can also be prepared by
[H] reacting the compound (I-c) or a salt thereof with a lower alkylisocyanate.
The reaction of the compound (II) with the compound (III) (i.e., Step[A]) can be carried out in the presence of a base. Any conventional basemay be used for this reaction. Preferred examples of the base include atri(lower alkyl)amine, a 4-di(lower alkyl)aminopyridine, an alkali matalhydroxide, an alkali metal alkoxide and the like. The reaction may becarried out in the presence or absence of a solvent such asdimethylformanide, dimethylacetamide, dimethylsulfoxide, xylene or thelike. It is preferred to carry out the reaction under heating, forexample, at a temperature between 50° and 150° C., preferably at atemperature between 90° and 110° C.
The reaction of the compound (IV) with the compound (V) (i.e., Step [B])can be carried out in the presence of an acid acceptor. Examples of theacid acceptor include conventional organic or inorganic bases such as analkali metal bicarbonate, an alkali metal carbonate, an alkali metalhydride, a tri(lower alkyl)amine and so forth. Examples of the reactiveresidue (X¹) of the compound (IV) include a conventional reactiveresidue such as a halogen atom and the like. The reaction may be carriedout in the presence or absence of a solvent such as dimethylformanide,dimethylacetamide, dimethylsulfoxide, xylene or the like. It ispreferred to carry out the reaction under heating, for example, at atemperature between 150° and 220° C. In particular, said reactionprefelably proceeds by adding copper power to the reaction system.
The condensation reaction of the compound (VI) with the compound (VII)(i.e., Step [C]) can be carried out in the presence of a base. The samebases as mentional in Step [A] are preferably used for the reaction.Examples of the reactive residue (X²) of the compound (VII) include anlower alkoxy group, imidazolyl group, halogen atom and the like. It ispreferred to carry out the reaction in a solvent such as toluene,xylene, methylen chloride, chloroform, tetrahydrofuran and so forth andat room temperature or under heating, for example, at a temperaturebetween 10° and 150° C.
The condensation reaction of the compound (I-a) with the compound (VIII)(i.e., Step [D]) can be carried out in the presence or absence of anacid acceptor. The same bases as mentioned in Step [B] are preferablyused for the reaction as the acid acceptor. Examples of the reactiveresidue (X³) of the compound (VIII) include a halogen atom, a loweralkanoyloxy group, a (lower alkyl) sulfonyloxy group, arylsulfonyloxygroup and the like. It is preferred to carry out the reaction in asolvent such as acetone, ethyl acetate, N,N-dimethylformamide,tetrahydrofuran, methylene chloride, diethyl ether, dioxane or the like.Said reaction preferably proceeds at room temperature or under heating,for example, at a temperature between 30° and 120° C.
The reduction of the compound (I-d) (i.e., Step [E]) can be conducted ina conventional manner. For example, said reduction is carried out bysubjecting the compound (I-d) to catalytic hydrogenation in the presenceof palladium-carbon, Raney nickel, Raney cobalt, platinum, rhodium, orthe like. The catalytic hydrogenation preferably proceeds in a solventsuch as tetrahydrofuran, dioxane, a lower alkanol or the like, underatmospheric pressure or increased pressure and at room temperature orunder warming, for example, at a temperature between 10° and 50° C.
The condensation reaction of compound (I-c) with the compound (IX)(i.e., Step [F]) can be carried out in the presence or absence of anacid acceptor. The same organic or inorganic bases as mentioned in Step[B] are prefelably used for the reaction as the acid acceptor. Examplesof the reactive residue (X⁴) includes the same as the reactive residue(X³). It is preferred to carry out the reaction in a solvent such asacetone, ethyl acetate, dimethylformamide, dimethylsulfoxide or the likeand at room temperature or heating, for example, at a temperaturebetween 30° and 120° C.
The reaction of the compound (I-c) with the compound (X) (i.e., Step[G]) and the reaction of the compound (I-c) with the lower alkylisocyanate (i.e., Step [H]) can be carried out in the presence of abase. The same bases as mentioned in Step [A] are prefelably used forthe reaction, and in addition, benzyltri(lower alkyl)ammonium hydroxide,tetra(lower alkyl)ammonium hydroxide and the like can also be used. Thereaction preferably proceeds in a solvent such as tetrahydrofuran,methylene chloride, dimethylformamide, dimethylsulfoxide or the like andat room temperature or under heating, for example, at a temperaturebetween 20° and 80° C.
In the above-mentioned reactions, the starting compounds of the presentinvention may be used either in a free form or in the form of a salt.For example, the compounds (VI), (I-a) and (I-c), and the compounds (II)to (V), (IX) and (I-d) which have hydroxy group are, if required, usedin the form of an alkali metal salt, an alkali earth metal salt, anammonium salt and the like. On the other hand, the compounds (V) and(VI), and the compounds (II) to (IV), (IX), (I-a), (I-c) and (I-d) whichhave amino group or mono or di(lower alkyl)amino group are, if required,used in the form of an organic or inorganic acid addition salt.
Concomitantly, some of the naphthyloxazolidone derivative (I) of thepresent invention can, if required, be converted into anothernaphthyloxazolidone derivative (I) in a conventional manner. Forexample, when R¹ is nitro group and/or R² is triazo group, said group(s)may be converted into amino group(s) by catalytic hydrogenation. Ifrequired, the resulting amino group(s) may be converted into a loweralkanoylamino group(s), or may be converted into hydroxy group(s) or alower alkoxy group(s) after diazotization of said amino group(s). WhenR¹ is sulfo group, said group may be converted into aminosulfo group bya conventional amination. Further, when R¹ is a (loweralkyl)thio-substituted-lower alkoxy group, said group may be convertedinto a (lower alkyl)sulfinyl-substituted-lower alkoxy group or a (loweralkyl)sulfonyl-substituted-lower alkoxy group by oxidation therof. Onthe other hand, when R² is a lower alkoxy group, said group may beconverted into hydroxy group by hydrolysis thereof, and if required, beconverted into a lower alkylsulfonyloxy group in a conventional manner,and if necessary, further converted into a lower alkylamino group or atriazo group.
The naphthyloxazolidone derivatives (I) of the present invention includewithin its scope either one of optically active isomers and the mixturesthereof. Since the reactions of the present invention as mentioned aboveproceed without accompanying racemization, the compound (I) can beobtained as an optically active compound by using an optically activestarting materials.
Further, when the naphthyloxazolidone derivative (I) is in the form of aracemic modification, it can be separated into each of two opticallyactive isomers thereof in a conventional manner, for example, by thesteps of:
(1) treating said compound (I) with an alkali metal hydroxide (e.g.,potassium hydroxide),
(2) protecting the amino group of the resultant compound with a loweralkoxycarbonyl group,
(3) reacting the resultant compound with an optically active1-(2-naphthylsulfonyl)pyrrolidin-2-carbonyl chloride,
(4) separating each of two kinds of resulting diastereomers by takingadvantage of difference in solubilities thereof or columnchromatography,
(5) hydrolyzing each of the diastereomers with an alkali metal hydroxide(e.g., sodium hydroxide), and then,
(6) reacting the resultant compound with compound (VII) in the samemanner as described in Step [C].
The naphthyloxazolidone derivatives (I) can be used for pharmaceuticaluse either in a free form or in the form of a pharmaceuticallyacceptable salt. Examples of the pharmaceutically acceptable saltsinclude salts with an organic or inorganic base such as alkali metalsalts (e.g., sodium salt, potassium salt), alkaline earth metal salts(e.g., calcium salt, magnesium salt), ammonium salt and the like, andorganic or inorganic acid addition salts such as hydrochloride, sulfate,acetate, benzensulfonate and the like.
The naphthyloxazolidone derivative (I) or a pharmaceutically acceptablesalt thereof has excellent reversible and selective MAO-A inhibitoryactivity. Accordingly, the compound (I) or a pharmaceutically acceptablesalt thereof is useful as a therapeutic or prophylactic agent fordepressive conditions such as depression, senile depression, abulia,axiety, insomnia, anorexia and the like in warm-blood animals includinghuman beings. In particular, the compound (I) or a pharmaceuticallyacceptable salt thereof is characterized in that it shows short durationof inhibitory activity and has no side effect such as hepatic injuries,migraine, cheese effect or the like. Moreover, the compound (I) or apharmaceutically acceptable salt thereof is low in toxicity and havehigh safety as a pharmaceuticals. For example, when3-(6-cyanoethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone wasadministered orally to mice at a dose of 2 g/kg, no mice died during 2week-observation period.
The naphthyloxazolidone derivative (I) or a pharmaceutically acceptablesalt thereof may be administered either orally or parenterally. They mayalso be used in the form of pharmaceutical preparations such as tablets,capsules, powders, granules, injections and the like, if necessary, inadmixture with a pharmaceutically acceptable carrier, diluent ordisintegrant.
The dose of the naphthyloxazolidone derivative (I) or a pharmaceuticallyacceptable salt thereof may vary depending on the age, body weight andcondition of patients, the kind and severity of diseases to be treated,administration route, etc, but it may usually be in the range of about0.01 to about 250 mg per kg, preferably about 0.1 to about 30 mg per kg,per day.
Among the starting compounds of the present invention, the compounds(II), (V) and (VI) are novel. The compound (II) may be prepared, forexample, by reacting a naphthylamine compound of the formula: ##STR15##wherein R¹ is the same as defined above, with a compound of the formula:
X.sup.5 --COOR.sup.3 (XII)
wherein X⁵ is halogen atom and R³ is the same as defined above in thepresence of an acid acceptor (e.g., sodium bicarbonate) and in a solvent(e.g., methylene chloride). The compound (V) may be prepared, forexample, by reacting an aminopropanol compound of the formula: ##STR16##wherein R² is the same as defined above, with a benzyloxycarbonyl halideor a lower alkoxy-carbonyl halide in the presence of an acid acceptor(e.g., triethylamine) and in a solvent (e.g., tetrahydrofuran), andthen, subjecting the resultant compound to intermolecular cyclization inthe presence of a base (e.g., sodium hydride). Furthermore, the compound(VI) may be prepared, for example, by reacting the naphthylaminecompound (XI) with 2,2-dimethyl-4-tosyloxy-1,3-dioxolane, and then,hydrolyzing the resultant compound in the presence of an acid (e.g.,hydrochloric acid).
In this specification and Claims, the terms "a lower alkyl group", "alower alkoxy group", "a lower alkanoyl group", "a lower alkenyl group"and "a lower alkynyl group" represent an alkyl group of one to 6 carbonatoms, an alkoxy group of one to 6 carbon atoms, an alkanoyl group of 2to 6 carbon atoms, an alkenyl group of 2 to 6 carbon atoms and analkynyl group of 2 to 6 carbon atoms, respectively.
EXPERIMENT 1 Inhibitory effect against MAO-A activity of cerebralmitochondorian fraction from rat (in vitro) Method
A suspension (7 mg protein/ml) of mitochondorial fraction obtained fromcerebral tissue of rats in a conventional manner was used as a sample ofenzyme, and serotonin was used as the substrate. of MAO-A. The MAO-Aactivity was estimated in terms of the amount of ammonia produced fromserotonin by the enzymatic reaction.
Inhibitory rate of the test compounds (10⁻⁷ M) against the MAO-Aactivity was calculated according to the following equation. ##EQU1##NH₃ (T): the amount of NH₃ in test tube (addition of test compound)
NH₃ (C): the amount of NH₃ in control tube (no addition of testcompound).
Results
The results are shown in the following Table 1.
TABLE 1 ______________________________________ ##STR17## Inhibitory rate (%) against R.sup.1 MAO-A activity ______________________________________ H 78.4 OCH(CH.sub.3).sub.2 98.8 O(CH.sub.2).sub.2 CN 98.1 O(CH.sub.2).sub.3 CN 95.5 ##STR18## 93.5 O(CH.sub.2).sub.3 OH 91.7 OCH.sub.2 CHCH.sub.2 96.8 OCOCH.sub.3 76.6 ______________________________________
EXPERIMENT 2 Inhibitory effect against cerebral MAO-A and MAO-B activityin mouse. Method
A test compound (30 mg/kg) suspended in 0.5% aqueous sodiumcarboxymethylcellulose (CMC-Na) solution was administered orally to agroup of 3 mice. The brain was excised 45 minutes after theadministration. A control group was administered with the 0.5% aqueousCMC-Na solution alone.
The brain tissue was homogenized in 9 volumes of ice-cold distilledwater and the homogenate was used as enzyme. MAO-A activity wasestimated in the same manner as described in Experiment 1, whereas MAO-Bactivity was estimated in terms of the amount of benzaldehyde formedfrom benzylamine according to the method as described in "The Journal ofLaboratory and Clinical Medicine, Vol. 62, P.P. 766-776 (1963)".
Inhibitory rate of the test compound against the MAO-B activity arecalculated according to the following equation. ##EQU2## BA(T): theamount of benzaldehyde in the medicated group BA(C): the amount ofbenzaldehyde in the non-medicated control group.
Results
The results are shown in the following Table 2.
TABLE 2 ______________________________________ ##STR19## Inhibitory rate (%) R1 MAO-A MAO-B ______________________________________ OCH(CH.sub.3).sub.2 86.8 ± 3.6 ± 5.4 5.3 O(CH.sub.2).sub.2 CN 109.2 ± -1.0 ± 3.5 2.3 O(CH.sub.2).sub.3 CN 99.8 ± -1.9 ± 16.1 4.8 ##STR20## 71.4 ± 4.3 -4.5 ± 5.9 O(CH.sub.2).sub.3 OH 57.1 ± 1.0 ± 4.3 0.8 OCOCH.sub.3 56.4 ± -3.1 ± 7.4 1.8 (positive control) pargyline 42.0 ± 98.3 ± 2.4 5.9 ______________________________________
EXAMPLE 1
(1) A mixture of 16.7 g of ethoxycarbonyl chloride and 20 ml ofmethylene chloride is added dropwise to a mixture of 20.0 g of2-naphthylamine, 17.6 g of sodium bicarbonate, 100 ml of water and 200ml of methylene chloride under ice-cooling and stirring. The mixture isstirred overnight at room temperature. Chloroform is added to themixture and the organic layer is separated, dried and treated withcharcol. The residue is recrystallized from ethyl acetate-hexane to give25.26 g of N-ethoxycarbonyl-2-naphthylamine.
m.p. 69.0°-70.5° C.
(2) A mixture of 3.82 g of the product obtained in the the paragraph(1), 3.13 g of 2-(methoxymethyl)oxirane and 0.4 g of triethylamine isrefluxed for 3.5 hours. The reaction mixture is extracted with ethylacetate. The extract is washed with water, dried and filtered. Thefiltrate is condensed and the residue is purified by silica gel columnchromatography [solvent: ethyl acetate-hexane (2:3)] to give 3.75 g ofcrude 5-methoxymethyl-3-(2-naphthyl)-2-oxazolidone. Therecrystallization of this crude product from ethyl acetate-hexane gives3.17 g of colorless needles.
m.p. 79.5°-81.5° C.
EXAMPLE 2 to 5
(1) The corresponding starting compounds are treated in the same manneras described in Example 1-(1) to give compounds shown in Table 3.
TABLE 3 ______________________________________ ##STR21## Compound (II-a) Ex. No. R.sup.1 position* Physical Properties ______________________________________ 2-(1) 7-NO.sub.2 2 m.p. 143-144° C. (ethyl acetate - hexane) 3-(1) 5-OH 2 m.p. 117-121° C. (ethyl acetate - isopropyl ether - hexane) 4-(1) 6-SO.sub.3 Na 2 m.p. >320° C. (isopropyl ether - water) IR.sub.Max.sup.Nujol (cm.sup.-1): 3270, 1700 5-(1) H 1 m.p. 80.5-81° C. (ethyl acetate - hexane) ______________________________________ *A position of NHCO.sub.2 C.sub.2 H.sub.5 in naphthalene ring
(2) The products obtained in the paragraph (1) are treated in the samemanner as described in Example 1-(2) to give compounds shown in Table 4
TABLE 4 ______________________________________ ##STR22## ##STR23## Compound (I-f) Ex. No. R.sup.1 position* Physical Properties ______________________________________ 2-(2) 7-NO.sub.2 2 m.p. 153-154° C. (ethanol) 3-(2) 5-OCH.sub.3 2 oil IR.sub.Max.sup.Nujol (cm.sup.-1): 1750 4-(2) 6-SO.sub.3 Na 2 m.p. >300° C. (washed with isopropyl alcohol) IR.sub.Max.sup.Nujol (cm.sup.-1): 1750, 1730 5-(2) H 1 m.p. 108-108.5° C. (ethyl acetate - hexane) ______________________________________ *A position of 5methoxymethyl-2-oxazolidon-3-yl group in naphthalene ring
EXAMPLE 6
A mixture of 4.63 g of N-ethoxycarbonyl-2-naphthylamine, 4.2 g of2-(butoxymethyl)oxirane and 0.22 g of triethylamine is stirred at 100°to 105° C. for 1.5 hours. The reaction mixture is cooled, and thecrystalline precipitate are collected by filtration, treated withcharcol and recrystallized from ethyl acetate-isopropyl ether-hexane.4.7 g of 3-(2-naphthyl)-5-tert.butoxymethyl-2-oxazolidone are obtained.
m.p. 112.5°-113.0° C.
EXAMPLE 7
(1) 19.69 g of triethylamine are added to a solution of 10.23 g of1-amino-3-methoxy-2-propanol in 100 ml of tetrahydrofuran. After themixture is cooled, a solution of 16.60 g of benzyloxycarbonyl chloridein 50 ml of tetrahydrofuran is added dropwise thereto for 30 minutes.The mixture is stirred at room temperature for one hour. The reactionmixture is diluted with ethyl acetate, washed with water and dried. Theresidue is purified by silica gel column chromatography [solvent: ethylacetate-hexane (2:1)]. 13.2 g of1-benzyloxycarbonylamino-3-methoxy-2-propanol are obtained as colorlessoil. ##STR24##
(2) 10.2 g of the product obtained in the paragraph (1) are dissolved in200 ml of tetrahydrofuran, and 1.624 g of sodium hydride (60% dispersionin oil) are added thereto. The mixture is stirred at room temperaturefor one hour. Water is added to the reaction mixture and the mixture isextracted with chloroform. The extract is condensed and the residue ispurified by silica gel column chromatography [solvent: ethylacetate-hexane (3:1)]. 3.36 g of 5-methoxymethyl-2-oxazolidone areobtained as colorless oil. ##STR25##
(3) 1.2 g of sodium methoxide are added to a mixture of 38.44 g of1-amino-3-methoxy-2-propanol and 64.78 g of diethyl carbonate. Themixture is stirred at 100° C. for 2.5 days. An excess diethyl carbonateis removed from the mixture. The residue is dissolved in 50 ml ofanhydrous tetrahydrofuran, and 1.4 g of 63% of sodium hydride are addedthereto. The mixture is stirred overnight at room temperature. 4 ml ofacetic acid are added to the reaction mixture, and the mixture isstirred at room temperature for 3 hours. Insoluble materials arefiltered off. The filtrate is condenced and the residue is distilledunder reduced pressure. 42.38 g of 5-methoxymethyl-2-oxazolidone areobtained as colorless oil.
The physico-chemical properties of this product are identical to thoseof the compound obtained in the paragraph (2).
(4) 6.10 g of activated copper powder and 2.76 g of sodium carbonate areadded to a mixture of 5.24 g of the product obtained in the paragraph(2) or (3) and 4.14 g of 2-bromonaphthalene. The mixture is stirred at200° C. for 3 hours. After the mixture is cooled, ethyl acetate is addedthereto and insoluble materials are filtered off. The filtrate isevaporated under reduced pressure to remove the solvent. The residue ispurified by silica gel column chromatography [solvent: ethylacetate-hexane (2:3)]. 2.36 g of5-methoxymethyl-3-(2-naphthyl)-2-oxazolidone are obtained as colorlessneedles.
The physico-chemical properties of this product are identical to thoseof the compound obtained in Example 1.
EXAMPLES 8 AND 9
The corresponding starting compounds are treated in the same manner asdescribed in Example 7-(4) to give the compounds shown in Table 5.
TABLE 5 ______________________________________ ##STR26## ##STR27## Ex. Compound (I-g) No. R.sup.1 Melting Point ______________________________________ 8 OCH.sub.3 142-143.5° C. (ethyl acetate - isopropyl ether) ##STR28## 144-146° C. (ethyl acetate) ______________________________________
EXAMPLE 10
(1) 100 g of 1,2-epoxypropyl tert.-butyl ether are added dropwise to 500ml of conc. aqueous ammonia under ice-cooling and the mixture is stirredat room temperature for 20 hours. The reaction mixture is evaporatedunder reduced pressure to remove the aqueous ammonia. Chloroform isadded to the residue. The mixture is dried with potassium carbonate.Insoluble materials are filtered off and the filtrate is evaporated toremove the solvent. The residue is distilled under reduced pressure.49.3 g of 1-amino-3-tert.-butoxy-2-propanol are obtained.
b.p. 109°-110° C./8 mmHg.
m.p. 41°-43° C.
(2) A mixture of 49.3 g of the product obtained in the paragraph (1),4.91 g of diethyl carbonate and 0.18 g of sodium methoxide is heated at50° C. for 3 hours. About 40 ml of ethanol which is produced during thereaction are evaporated. After the reaction is completed, the mixture isevaporated under reduced pressure to remove excess diethyl carbonate.The residue is cooled, and the crystalline precipitates are washed withhexane. 55.4 g of 5-tert.-butoxymethyl-2-oxazolidone are obtained ascolorless crystals.
m.p. 57°-65° C.
(3) 1.1 g of the product obtained in the paragraph (2) and 1.0 g of2-benzyloxy-6-bromonaphthalene are treated in the same manner asdescribed in Example 7-(4). 0.73 g of3-(6-benzyloxy-2-naphthyl)-5-tert.-butoxymethyl-2-oxazolidone isobtained as colorless crystals.
m.p. 151.5°-152° C. (ethyl acetate-isopropyl ether).
EXAMPLE 11
(1) 21.0 g of tosyl chloride are added portionwise to a mixture of 14.4g of (R)-α,β-isopropylidene glycerol and 60 ml of pyridine underice-cooling. The mixture is stirred for 4 hours. 50 ml of water areadded to the mixture under ice-cooling. The mixture is stirred at roomtemperature for 10 minutes. The reaction mixture is extracted withdiethyl ether, the extract is washed with water and dried. The solventis removed by evaporation under reduced pressure. 29.5 g of(4S)-2,2-dimethyl-4-tosyloxymethyl-1,3-dioxolane are obtained as palebrown oil. ##STR29##
Mass (m/z): 276 (M⁺ -15), 155, 101, 91 (base), 43.
(2) A mixture of 9.51 g of the product obtained in the paragraph (1),5.25 g of 6-(cyclopropylmethoxy) naphthylamine, 5.54 g of sodium iodide,6.2 g of sodium bicarbonate and 42 ml of hexamethylphosphoric triamideis stirred at 120° C. for 11 hours. The reaction mixture is poured intowater and extracted with ethyl acetate. The extract is washed withwater, dried and evaporated. The residue is purified by silica gelcolumn chromatography [solvent: ethyl acetate-hexane (1:5)] andrecrystallized from ethyl acetate-hexane. 5.88 g of(4R)-4-[6-(cyclopropylmethoxy)-2-naphthylaminomethyl]-2,2-dimethyl-1,3-dioxolaneare obtained as pale yellow scales.
m.p. 108.5°-109.0° C. ##STR30##
(3) A mixture of 8.09 g of the product obtained in the paragraph (2), 35ml of 1N-hydrochloric acid and 80 ml of tetrahydrofuran is stirred at60° C. for 2 hours. The reaction mixture is condensed under reducedpressure. The residue is basified with aqueous sodium bicarbonatesolution and extracted with ethyl acetate. The extract is washed withwater, dried and evaporated under reduced pressure to remove thesolvent. The residue is recrystallized from ethyl acetatehexane. 6.93 gof (2R)-3-(6-cyclopropylmethoxy-2-naphthylamino)-1,2-propandiol areobtained as pale brown scales.
m.p. 138.0°-138.5° C. ##STR31##
(4) A mixture of 1.36 g of the product obtained in the paragraph (3),670 mg of diethyl carbonate, one ml of toluene and 50 mg of sodiummethoxide is stirred at 150° C. for one hour. The reaction mixture isevaporated under reduced pressure to remove the solvent. One drop ofacetic acid is added to the residue. The residue is purified by silicagel column chromatography [solvent; chloroform-ethyl acetate (1:1 to1:3)] and recrystallized from ethyl acetate-hexane. 1.06 g of(5R)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-hydoroxymethyl-2-oxazolidoneare obtained as colorless needles
m.p. 181.5°-182.5° C. ##STR32##
EXAMPLE 12
Amixture of 626 mg of(5R)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-hydroxymethyl-2-oxazolidone,114 mg of sodium hydride (63% dispersion in oil) and 5 ml ofdimethylformamide is stirred at room teperature for 10 minutes. 350 mgof methyl iodide are added to the mixture, and the mixture is stirred atroom temperature for 2 hours. 0.1 ml of acetic acid is added to thereaction mixture. The mixture is poured into water and extracted withethyl acetate, and the extract is washed with water, dried andevaporated under reduced pressure to remove the solvent. The residue ispurified by silica gel column chromatography [solvent: chloroform-ethylacetate (2:1)] and recrystallized from ethyl acetate-hexane. 501 mg of(5R)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneare obtained as colorless scales.
m.p. 119.0°-119.5° C. ##STR33##
EXAMPLE 13
6.99 g of 5-methoxymethyl-3-(7-nitro-2-naphthyl)-2-oxazolidone aresuspended in 140 ml of acetic acid, and 2.1 g of 10% palladium-carbonare added thereto. The mixture is subjected to catalytic hydrogenationunder atomospheric pressure at room temperature. The reaction mixture isfiltered with celite and the filtrate is evaporated under reducedpressure. The residue is extracted with ethyl acetate and the extract iswashed, dried and condensed. The residue is purified by silica gelcolumn chromatography [solvent: ethyl acetate-hexane (2:1 to 3:1)], andresidue is recrystallized from ethyl acetate-isopropyl ether to give4.96 g of 3-(7-amino-2-naphthyl)-5-methoxymethyl-2-oxazolidone.
m.p. 98°-99° C.
EXAMPLES 14 AND 15
A solution of 0.97 g of sodium nitrite is 6 ml of water is addeddropwise at 0° to 5° C. to a mixture of 3.47 g of3-(7-amino-2-naphthyl)-5-methoxymethyl-2-oxazolidone, 6 ml of water and3.3 ml of conc. hydrochloric acid. After the mixture is stirred for afew minutes, 100 ml of methanol are added thereto. The mixture isstirred at room temperature for 7 hours and then allowed to stand in arefrigerator overnight. The reaction mixture is extracted with ethylacetate and the extract is washed and dried. The aqueous layer isfurther extracted with chloroform and the extract is dried. The residue(1.88 g) is purified by silica gel column chromatography [solvent: ethylacetate-hexane (1:1)].5-methoxymethyl-3-(7-methoxy-2-naphthyl)-2-oxazolidone [Example 14, m.p.95.5°-96.5° C. (recrystallized from ethyl acetate-hexane)] and3-(7-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone [Example 15 ,m.p. 155°-157° C. (recrystallized from ethyl acetate-hexane)] areobtained.
EXAMPLE 16
1.0 ml of thionyl chloride is added to a suspension of 3.0 g of sodium6-(5-methoxymethyl-2-oxazolidone-3-yl)-2-naphthylsulfonate in 24 ml ofdimethylformamide under ice-cooling. The mixture is stirred at roomtemperature for one hour. After ice-cooling, the mixture is poured intoice-water and extracted with ethyl acetate. The extract is washed, driedand evaporated under reduced pressure to remove the solvent to give 2.9g of pale brown foam.
The foam is dissolved in 50 ml of tetrahydrofuran and 10 ml of conc.aqueous ammonium hydroxide solution are added thereto. The mixture isstirred at room temperature for 2 hours. 200 ml of water are added tothe mixture. The mixture is stirred for a minute and allowed to standovernight at room temperature. Crystalline precipitates are collectedand recrystallized from ethanol. 1.97 g of3-(6-aminosulfonyl-2-naphthyl)-5-methoxymethyl-2-oxazolidone areobtained as colorless powder.
m.p. 166°-168° C.
EXAMPLE 17
18.9 g of 3-(6-benzyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone isdissolved in 700 ml of tetrahydrofuran and 10.0 g of 10% ofpalladium-carbon are added thereto. The mixture is subjected tocatalytic hydrogenation under atmospheric pressure at room temperaturefor 10 hours. The catalyst is filtered off, and the filtrate isevaporated under reduced pressure to remove the solvent. The residue isrecrystallized from ethanol-tetrahydrofuran-isopropyl ether. 11.2 g of3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone are obtained ascolorless needles.
m.p. 192°-193° C.
EXAMPLE 18
30.6 g of 3-(6-benzyloxy-2-naphthyl)-5-tert.-butoxymethyl-2-oxazolidoneare treated in the same manner as described in Example 17. 22.7 g of3-(6-hydroxy-2-naphthyl)-5-tert.-butoxymethyl-2-oxazolidone are obtainedas colorless crystals.
m.p. 177°-178° C. (tetrahydrofuran-isopropyl ether-hexane).
EXAMPLE 19
5.06 g of potassium carbonate and 2 ml of ethyl iodide are added to asolution of 2.0 g of3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone in 25 ml ofdimethyl formamide. The mixture is stirred for 4 hours at roomtemperature. The reaction mixture is diluted with ethyl acetate, washedwith water and dried. The residue is recrystallized from ethylacetate-isopropyl ether. 1.89 g of3-(6-ethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone are obtained ascolorless plates.
m.p. 129.5°-130.5° C.
EXAMPLES 20 to 46
The corresponding starting compounds are treated in the same manner asdescribed in Example 19 to give a compounds shown in Table 6.
______________________________________ ##STR34## ##STR35## Ex. Compound (I-i) No. R.sup.1 R.sup.2 Melting Point ______________________________________ 20 O(CH.sub.2).sub.2 CH.sub.3 OCH3 94.5-95.5° C. (ethyl acetate - hexane) 21 OCH(CH.sub.3).sub.2 OCH3 111.5-116° C. (ethyl acetate - hexane) 22 O(CH.sub.2).sub.3 CH.sub.3 80.5-81° C. (ethyl acetate - hexane) 23 OCH(CH.sub.3)CH.sub.2 CH.sub.3 79-80° C. (ethyl acetate - hexane) 24 OCH.sub.2 CH(CH.sub.3).sub.2 114-114.5° C. (ethyl acetate - hexane) 25 O(CH.sub.2).sub.4 CH.sub.3 82-83° C. (ethyl acetate - hexane) 26 O(CH.sub.2).sub.2 CH(CH.sub.3).sub.2 88-89° C. (ethyl acetate - hexane) 27 ##STR36## 120-121° C. (ethyl acetate - isopropyl ether) 28 ##STR37## 113-125° C. (ethyl acetate - isopropyl ether) 29 O(CH.sub.2).sub.2 OH 120-121° C. (ethyl acetate - isopropyl ether) 30 O(CH.sub.2).sub.3 OH 87.5-88.5° C. (ethyl acetate - hexane) 31 O(CH.sub.2).sub.2 OCH.sub.3 102-103° C. (ethyl acetate - hexane) 32 O(CH.sub.2).sub.2 OC.sub.2 H.sub.5 82- 84° C. (ethyl acetate - hexane) 33 OCH.sub.2 CN OCH3 97-98° C. (ethyl acetate - hexane) 34 O(CH.sub.2).sub.3 CN 84.5-86° C. (ethyl acetate - hexane) 35 O(CH.sub.2).sub.2 N(CH.sub.3).sub.2 207-207.5° C. Hydrochloride (methanol - diethyl ether) 36 OCH.sub.2 CONH.sub.2 176.5-177.5° C. (ethyl acetate - hexane) 37 OCH(CH.sub.3)CO.sub.2 CH.sub.3 91-95° C. (ethyl acetate - hexane) 38 OCH.sub.2 CHCH.sub.2 108.5-109.5° C. (ethyl acetate - hexane) 39 O(CH.sub.2).sub.2 CHCH.sub.2 90-92° C. (ethyl acetate - hexane) 40 OCH.sub.2 CHC(CH.sub.3).sub.2 105.5-107° C. (ethyl acetate - hexane) 41 OCH.sub.2 CCH 99.5-100.5° C. (ethyl acetate - hexane) 42 O(CH.sub.2).sub.2 OCOCH.sub.3 89-92° C. (ethyl acetate - hexane) 43 O(CH.sub.2).sub.2 SCH.sub.3 81-84° C. (ethyl acetate - hexane) 44 OCON(CH.sub.3).sub.2 107-108° C. (ethyl acetate - hexane) 45 O(CH.sub.2).sub.2 CH.sub.3 OC(CH.sub.3).sub.3 121-122° C. (ethyl acetate - hexane) 46 O(CH.sub.2).sub.3 CH.sub.3 123-123.5° C. (ethyl acetate - hexane) ______________________________________
EXAMPLE 47
A mixture of 720 mg of3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone, 5 ml ofacrylonitrile, 5 ml of acrylonitrile, 5 ml of tetrahydrofuran and 0.1 mlof methanolic 40% benzyltrimethylammonium hydroxide solution is refluxedfor 2 days. The reaction mixture is condensed under reduced pressure todryness. The residue is extracted with ethyl acetate, and the extract iswashed with water, dried and condensed under reduced pressure. Theresidue is purified by silica gel column chromatography [solvent:chloroform-methanol (20:1)] and recrystallized from ethylacetate-hexane. 410 mg of3-(6-cyanoethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone are obtainedas colorless scale.
m.p. 110°-112° C.
EXAMPLES 48 to 50
The corresponding starting compounds are treated in the same manner asdescribed in Example 47 to give the compounds shown in Table 7.
TABLE 7 ______________________________________ ##STR38## ##STR39## Compound (I-i) Ex. No. R.sup.1 R.sup.2 Melting Point ______________________________________ 48 O(CH.sub.2).sub.2 CN O(CH.sub.3).sub.3 175.5-177° C. (ethyl acetate) 49 O(CH.sub.2).sub.2 CO.sub.2 CH.sub.3 OCH.sub.3 111-112° C. (ethyl acetate - hexane) 50 O(CH.sub.2).sub.2 CO.sub.2 C.sub.2 H.sub.5 OCH.sub.3 91.5-93° C. (ethyl acetate - hexane) ______________________________________
EXAMPLE 51
A mixture of 950 mg of3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone, 310 mg of ethylisocyanate, 15 ml of methylene chloride, 10 ml of tetrahydrofuran andone drop of triethylamine is stirred at room temperature for 4 hours.1.5 g of ethyl isocyanate are further added to the mixture, and themixture is refluxed for 3 hours. The reaction mixture is condensed underreduced pressure. The residue is dissolved in ethyl acetate and washedwith water treated with charcol and dried. The solvent is removed byevaporation under reduced pressure. The residue is recrystallized fromethyl acetate-isopropyl ether. 800 mg of3-(6-ethylaminocarbonyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone areobtained as colorless prisms
m.p. 126.5°-127.5° C.
EXAMPLE 52
A mixture of 2.0 g of3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone and 10 ml ofacetic anhydride is refluxed for one hour. The reaction mixture isevaporated to remove an excess acetic anhydride. The residue isrecrystallized from ethyl acetate-isopropyl ether. 2.25 g of3-(6-acetyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone are obtained ascolorless crystals.
m.p. 110°-112.5° C.
EXAMPLE 53
1.07 g of m-chloroperbenzoic acid are gradually added at roomtemperature to a mixture of 1.88 g of5-methoxymethyl-3-[6-(methylthioethoxy)-2-naphthyl]-2-oxazolidone and100 ml of methylene chloride. The mixture is stirred at room temperaturefor one hour. The reaction mixture is washed with 10% aqueous sodiumhydroxide solution and water, and then dried. The solvent is removed byevaporation under reduced pressure. The residue is purified by silicagel column chromatography [solvent: chloroform-methanol (30:1)] andrecrystallized from ethyl acetate-tetrahydrofuran-isopropyl ether. 1.21g of5-methoxymethyl-3-[6-(methylsulfinylethoxy)-2-naphthyl]-2-oxazolidoneare obtained as colorless prisms.
m.p. 133°-141° C.
EXAMPLE 54
1.65 g of m-chloroperbenzoic acid are gradually added at roomtemperature to a mixture of 1.20 g of5-methoxymethyl-3-[6-(methylthioethyloxy)-2-naphthyl]-2-oxazolidone and40 ml of methylene chloride. The mixture is stirred at room temperaturefor 3 hours. The reaction mixture is washed with 10% aqueous sodiumhydroxide solution and water and then dried. The solvent is removed byevaporation under reduced pressure. The residue is purified by silicagel column chromatography [solvent: chloroform-ethyl acetate (1:1)] andthen recrystallized from ethanol-tetrahydrofuran-isopropyl ether. 0.73 gof5-methoxymethyl-3-[6-(methylsulfonylethyloxy)-2-naphthyl]-2-oxazolidoneare obtained as colorless needles.
m.p. 128°-129° C.
EXAMPLE 55
10 ml of trifluoroacetic acid are added to 3.36 g of3-(2-naphthyl)-5-tert.-butoxymethyl-2-oxazolidone under ice-cooling. Themixture is stirred at room temperature for one hour. The reactionmixture is evaporated under reduced pressure to remove trifluoroaceticacid. The residue is recrystallized fromethanol-dimethylformamide-isopropyl ether. 2.16 g of5-hydroxymethyl-3-(2-naphthyl)-2-oxazolidone are obtained as colorlesscrystals
m.p. 174°-174.5° C.
EXAMPLES 56 to 58
The corresponding starting compounds are treated in the same manner asdescribed in Example 55 to give compounds shown in Table 8.
TABLE 8 ______________________________________ ##STR40## ##STR41## Compound (I-k) Ex. No. R.sup.1 Melting Point ______________________________________ 56 O(CH.sub.2).sub.2 CH.sub.3 149-150° C. (ethyl acetate - isopropyl ether) 57 O(CH.sub.2).sub.3 CH.sub.3 127-130° C. (ethyl acetate - isopropyl ether) 58 O(CH.sub.2).sub.2 CN 122-125° C. (ethyl acetate - isopropyl ether) ______________________________________
EXAMPLE 59
A mixture of 8.5 g of methylsulfonyl chloride and 120 ml of methylenechloride is added dropwise to a suspension of 12.0 g of5-hydroxymethyl-3-(2-naphthyl)-2-oxazolidone, 240 ml of methylenechloride and 10.0 g of triethylamine under ice-cooling. The mixture isstirred at room temperature for 3 hours. A mixture of 1.0 g ofmethylsulfonyl chloride and 50 ml of tetrahydrofuran is added dropwiseto the mixture, and the mixture is stirred at room temperature for 2hours. The reaction mixture is washed with water. The extract is dried,and then evaporated under reduced pressure to remove the solvent. Theresidue is recrystallized from isopropyl ether. 14.7 g of5-methylsulfonyloxymethyl-3-(2-naphthyl)-2-oxazolidone are obtained ascolorless crystals.
m.p. 169°-172° C.
EXAMPLE 60
A mixture of 3.0 g of5-methylsulfonyloxymethyl-3-(2-naphthyl)-2-oxazolidone, 120 ml of anaqueous 40% methylamine solution, 100 ml of tetrahydrofuran and 50 ml ofdimethylformamide is stirred at room temperature in a sealed tube for 2days. The reaction mixture is evaporated under reduced pressure toremove the excess methylamine and tetrahydrofuran. The mixture isextracted with ethyl acetate, and the extract is washed with water,dried evaporatedunder reduced pressure to remove the solvent. Theresidue is purified by silica gel column chromatography [solvent:chloroform-methanol (20:1)] and recrystallized from ethylacetate-hexane. 1.12 g of5-methylaminomethyl-3-(2-naphthyl)-2-oxazolidone are obtained ascolorless crystals.
m.p. 76.5°-78.0° C.
EXAMPLE 61
A mixture of 11.6 g of5-methylsulfonyloxymethyl-3-(2-naphthyl)-2-oxazolidone, 230 ml ofdimethylformamide, 4.84 g of sodium azide and 23 ml of water is stirredat 80° C. for 9 hours. The reaction mixture is poured into water,extracted with ethyl acetate, and the extract is washed with water,dried and evaporated under reduced pressure to remove the solovent. Theresidue is recrystallized from ethyl acetate-hexane. 8.62 g of3-(2-naphthyl)-5-triazomethyl-2-oxazolidone are obtained as colorlesscrystals.
m.p. 115.0°-116.5° C.
EXAMPLE 62
8.35 g of 3-(2-naphthyl)-5-triazomethyl-2-oxazolidone are dissolved in amixture of 100 ml of tetrahydrofuran and 100 ml of acetic acid. 2.0 g of10% palladium-carbon are added to the solution. The mixture is subjectedto catalytic hydrogenation at room temperature under atmosphericpressure. After the palladium-carbon is removed, the filtrate isevaporated under reduced pressure to remove the solvent. The residue isbasified with an aqueous sodium bicarbonate solution. Crystallineprecipitates are collected by filtration, and washed with water. Themixture is purified by silica gel column chromatography [solvent:chloroform-methanol (40:1 to 8:1)] and recrystallized fromethanol-isopropyl ether-hexane. 4.90 g of5-aminomethyl-3-(2-naphthyl)-2-oxazolidone are obtained as colorlesscrystals.
m.p. 112°-114° C.
EXAMPLE 63
A mixture of 1.8 g of 5-aminomethyl-3-(2-naphthyl)-2-oxazolidone, 36 mlof chloroform, 1.5 ml of acetic anhydride and 1.5 ml of pyridine isstirred at room temperature for one hour. The reaction mixture is washedwith water, dried and evaporated under reduced pressure to remove thesolvent. The residue is recrystallized from ethyl acetate-isopropylether. 1.56 g of 5-acetylaminomethyl-3-(2-naphthyl)-2-oxazolidone areobtained as colorless crystals.
m.p. 152°-154° C.
EXAMPLE 64
(1) A mixture of 2.0 g of3-(6-benzyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone, 20 ml ofethanol, 4 ml of water and 1.08 g of potassium hydroxide is stirred at100° C. for one hour. The reaction mixture is evaporated under reducedpressure to remove the ethanol. The residue is extracted with ethylacetate, and the extract is washed with water, dried and evaporatedunder reduced pressure to remove the solvent. The residue isrecrystallized from ethyl acetate-hexane to give 1.64 g ofN-(3-methoxy-2-hydroxypropyl)-6-benzyloxy-2-naphthylamine as colorlessneedles.
m.p. 103°-104° C.
(2) A mixture of 3.53 g of ethyl chloroformate and 5 ml of methylenechloride is added dropwise to a mixture of 10.0 g of the productobtained in the paragraph (1), 70 ml of methylene chloride, 70 ml ofwater and 4.98 g of sodium bicarbonate under ice-cooling. The mixture isstirred at room temperature for 1.5 hours. A mixture of 0.35 g of ethylchloroformate and 2 ml of methylene chloride is added to the mixture,and the mixture is further stirred at room temperature for 4 hours.Organic layer is separated from the reaction mixture. The aqueous layeris extracted with methylene chloride and conbined with the organiclayer. The conbined solution is dried and then evaporated under reducedpressure to remove the solvent. The residue is purified by silica gelcolumn chromatography [solvent: ethyl acetate-hexane (1:1)]. 12.66 g ofN-ethoxycarbonyl-N-(3-methoxy-2-hydroxypropyl)-6-benzyloxy-2-naphthylamineare obtained as colorless oil. ##STR42##
Mass (m/z): 409 (M⁺), 318, 91 (base).
(3) A mixture of 4.68 g of pyridine and 10 ml of tetrahydrofuran isadded dropwise to a mixture of 12.12 g of the product obtained in theparagraph (2), 120 ml of tetrahydrofuran and 11.5 g of(2S)-1-(2-naphthylsulfonyl)pyrrolidin-2-carbonyl chloride underice-cooling. The mixture is stirred at room temperature for 3.5 hours.The reaction mixture is diluted with 500 ml of ethyl acetate, washedwith 5% hydrochloric acid and water, dried and evaporated to remove thesolvent. The residue is purified by silica gel column chromatography[solvent: ethyl acetate-hexane (2:3)]. 9.48 g ofN-ethoxycarbonyl-N-{(2R)-3-methoxy-2-[(2S)-1-(2-naphthylsulfonyl)pyrrolidin-2-carbonyloxy]-propyl}-6-benzyloxy-2-naphthylamine(Product A) and 9.28 g ofN-ethoxycarbonyl-N-{(2S)-3-methoxy-2-[(2S)-1-(2-naphthylsulfonyl)pyrrolidin-2-carbonyloxy]-propyl}-6-benzyloxy-2-naphthylamine(Product B) are obtained as colorless oils.
Product A ##STR43## Product B ##STR44##
(4) A mixture of 8.95 g of Product A obtained in paragrapyh (3), 2.57 gof sodium hydroxide, 100 ml of ethanol and 20 ml of water is stirred at100° C. for one hour. The reaction mixture is evaporated under reducedpressure to remove the solvent, and water is added to the residue. Themixture is extracted with ethyl acetate. The extract is washed withwater, dried and condenced. Hexane is added to the residue, andcrystalline precipitates are collected by filtration. 3.76 g ofN-[(2R)-3-methoxy-2-hydroxypropyl]-6-benzyloxy-2-naphthylamine areobtained as colorless crystals.
m.p. 105°-106° C. ##STR45##
(5) A mixture of 3.65 g of the product obtained in the paragraph (4), 70ml of dry methylene chloride, 3.51 g of carbonyldiimidazol and 0.14 g ofdiisopropylethylamine is stirred at room temperature for 2 hours. Thereaction mixture is washed with 5% hydrochloric acid. The aqueous layeris extracted with ethyl acetate, and the extract is conbined with theorganic layer. The mixture is dried and evaporated under reducedpressure to remove the solvent. The residue is recrystallized from ethylacetate to give 3.60 g of(5R)-3-(6-benzyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone ascolorless scales.
m.p. 150°-150.5° C. ##STR46##
EXAMPLE 65
(1) 9.2 g ofN-ethoxycarbonyl-N-{(2S)-3-methoxy-2-[(2S)-1-(2-naphthylsulfonyl)-2-pyrrolidinylcarbonyloxy]propyl}-6-benzyloxy-2-naphthylamineare treated in the same manner as described in Example 64-(4). 3.76 g ofN-[(2S)-3-methoxy-2-hydroxypropyl]-6-benzyloxy-2-naphthylamine areobtained as colorless needles.
m.p. 105°-106° C. ##STR47##
(2) 3.62 g of the product obtained in the paragraph (1) are treated inthe same manner as described in Example 64-(5). 3.55 g of(5S)-3-(6-benzyloxy-2-naphthy)-5-methoxymethyl-2-oxazolidone ascolorless needles.
m.p. 149.5°-150.5° C. ##STR48##
EXAMPLE 66
A mixture of 16.9 g of(5R)-3-(6-benzyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone, 8.50 g of10% palladium-carbon and 400 ml of tetrahydrofuran are hydrogenated at45° to 50° C. for 2 hours under atmospheric pressure. Insolublematerials are filtered off. The filtrate is evaporated under reducedpressure to remove the solvent. The residue is recrystallized fromtetrahydrofuran-isopropyl ether. 11.5 g of(5R)-3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone are obtainedas colorless prisms.
m.p. 190°-191° C. ##STR49##
EXAMPLE 67
15.0 g of (5S)-3-(6-benzyloxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneare treated in the same manner as described in Example 66. 10.3 g of(5S)-3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone are obtainedas colorless prisms.
m.p. 190°-191° C. ##STR50##
EXAMPLE 68
A mixture of 2.38 g of(5R)-3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidone, 1.83 g ofcyclopropylmethyl bromide, 3.55 g of potassium carbonate and 30 ml ofdimethylformamide is stirred at 50° C. for 7 hours. The reaction mixtureis poured into water, extracted with ethyl acetate. The extract iswashed with water, dried and evaporated under reduced pressure to removethe solvent. The residue is purified by silica gel column chromatography[solvent: ethyl acetate-chloroform (1:10)] and recrystallized from ethylacetate-hexane. 2.51 g of(5R)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneare obtained as colorless scales.
m.p. 120.5°-121° C. ##STR51##
EXAMPLE 69
3.69 g of (5S)-3-(6-hydroxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneand 2.84 g of cyclopropylmethyl bromide are treated in the same manneras described in Example 68. 4.07 g of(5S)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneas colorless scales.
m.p. 119°-119.5° C. ##STR52##
What is claimed is:
1. A method for treatment or prophylaxis ofdepressive conditions in a warm-blood animal which comprisesadministering to said warm-blood animal a pharmaceutically effectiveamount of a naphthyloxazolidone compound of the formula:wherein R¹ is ahydrogen atom, a hydroxy group, a nitro group, an amino group, a sulfogroup, an aminosulfonyl group, a lower alkenyloxy group, a loweralkynyloxy group, a mono or di(lower alkyl) aminocarbonyloxy group, alower alkanoyloxy group or a lower alkoxy group which is unsubstitutedor has a substituent selected from the group consisting of a phenylgroup, a cycloalkyl group of 3 to 6 carbon atoms, a tetrahydrofurylgroup, a hydroxy group, a lower alkoxy group, a cyano group, a di(loweralkyl)amino group, an aminocarbonyl group, a lower alkoxycarbonyl group,a lower alkanoyloxy group, a lower alkylthio group, a loweralkylsulfinyl group and a lower alkylsulfonyl group; and R² is a loweralkoxy group; or a pharmaceutically acceptable salt thereof.
2. A methodin accordance with claim 1, wherein R¹ is a hydrogen atom, a hydroxygroup, a lower alkenyloxy group, a lower alkanoyloxy group or a loweralkoxy group which is unsubstituted or has a substituent selected fromthe group consisting of a cycloalkyl group of 3 to 6 carbon atoms, ahydroxy group, a lower alkyloxy group, a cyano group, a loweralkanoyloxy group and a lower alkylthio group.
3. A method in accordancewith claim 1 in which R¹ is at the 6-position of the naphthalene ringand the 5-substituted-2-oxazolidon-3-yl group is at the 2-position ofthe naphthalene ring.
4. A method in accordance with claim 3, wherein R¹is a lower alkenyloxy group or a lower alkoxy group which isunsubstituted or has a substituent selected from the group consisting ofa cycloalkyl group of 3 to 6 carbon atoms, a hydroxy group, a loweralkoxy group, a cyano group, a lower alkanoyloxy group and a loweralkylthio group.
5. A method in accordance with claim 1, wherein saidnaphthyloxazolidone compound is(5R)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneor a pharmaceutically acceptable salt thereof. 6.(5R)-3-(6-cyclopropylmethoxy-2-naphthyl)-5-methoxymethyl-2-oxazolidoneor a pharmaceutically acceptable salt thereof. | 2024-03-22 | 1990-10-18 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1993-01-26"
} |
US-13330980-A | Supersonic vibration driven motor device
ABSTRACT
A supersonic vibration driven motor comprising a supersonic oscillator and a mass rotationally driven thereby. The oscillator is provided with a vibration disc secured thereto on an end face thereof opposite to the mass to be driven. The mass is integrally formed with a plurality of plate-shaped resilient vibratory pieces annularly arranged on the end face opposite to the oscillator and axially extending at a predetermined angle of inclination relative to the axis of the mass, the vibration disc and vibratory pieces being located so as to come in contact with each other at their end portions, whereby vibratory displacement of the supersonic oscillator is transformed into rotational movement of the mass by way of flexible deformation of the vibratory pieces. Alternatively, the resilient vibratory pieces may be formed integrally with the vibration disc. A plurality of supersonic oscillators may be annularly arranged and located so as to come in contact with the end face of the mass so that operational phases of the respective supersonic oscillators have a predetermined phase relationship ensuring even and smooth rotation. A plurality of supersonic oscillators integrally formed with vibratory pieces and arranged in linear alignment may be located so as to come in contact with a mass to be linearly driven, whereby vibratory displacement of the supersonic oscillators is transformed into linear movement of the mass by way of flexible deformation of the vibratory pieces.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a supersonic vibration driven motordevice, and more particularly relates to a motor device which isconstructed such that vibratory displacement of the supersonicoscillator is transformed into rotational or linear movement of a massto be driven by way of flexible deformation of vibratory pieces.
2. Brief Description of the Prior Art
Almost all conventional motor devices used in a variety of industriesare driven by electromagnetic energy. In conventional motor devices,however, the dimensions, weight, rotary force (torque) and other factorsare limited by the materials and structure of the devices. Since thecharacteristic functions of the motor device depend on magneticproperties, mechanical strength, and other characteristics of thematerials used, it has been impossible to design and construct, in thehitherto known manner, a motor device having higher power in a smallersize than the conventional ones.
SUMMARY OF THE INVENTION
Hence, the present invention is intended to eliminate the drawbacksmentioned above associated with conventional motor devices. Theprinciple of the invention lies in the fact that vibratory energy of asupersonic oscillator is transformed into rotational or linear movementof a mass to be driven by the flexible deformation of a number ofplate-shaped resilient vibratory pieces.
In accordance with a first embodiment of the present invention, there isproposed a supersonic vibration driven motor device essentiallycomprising a supersonic oscillator and a mass to be rotationally drivenby way of supersonic vibration, wherein the supersonic oscillator isprovided with a vibration disc secured thereto on the end face thereofwhich is opposite to the mass to be driven. The mass to be driven isintegrally formed with a plurality of plate-shaped resilient vibratorypieces annularly arranged on the end face opposite to the oscillator andaxially extending at a predetermined angle of inclination relative tothe axis of the mass to be rotated, the vibration disc and vibratorypieces being located so as to come in contact at the end portionsthereof, whereby vibratory displacement of the supersonic oscillator istransformed into rotational movement of the mass by way of flexibledeformation of said vibratory pieces. Alternatively, the aforesaidplate-shaped resilient vibratory pieces may be formed integrally withthe vibration disc secured to the supersonic oscillator.
In accordance with a second embodiment of the present invention, aplurality of supersonic oscillators are annularly arranged and locatedso as to come in contact with the vibratory pieces, wherein operationalphases of the respective supersonic oscillators lag each other by apredetermined phase angle. Thus, even and smooth rotation is ensured forthe mass. Also in the case of this embodiment, the vibratory pieces maybe formed integrally with the vibration disc secured to the supersonicoscillator.
Further, in accordance with a third embodiment of the present invention,there is proposed a supersonic vibration driven motor essentiallycomprising a plurality of supersonic oscillators linearly arranged andconnected one after another with the aid of supporting members, and amass to be linearly driven by said supersonic oscillators, wherein eachsupersonic oscillator is provided, at its face toward the mass, with avibration disc on whose end face is integrally formed a plurality ofplate-shaped resilient vibratory pieces which are spaced apart andinclined at a predetermined angle and arranged linearly, and the mass tobe linearly driven and said vibratory pieces are located so as to comein contact, whereby vibratory displacement of the supersonic oscillatorsis transformed into linear movement of the mass by flexible deformationof said vibratory pieces.
Thus it is an object of the present invention to provide a supersonicvibration driven motor device which is different from the conventionalmotor device in structure and function and is designed and constructedwith a smaller size and lighter weight owing to the arrangement wherebyvibratory energy of supersonic oscillators is transformed intorotational or linear movement of a mass to be driven by way of flexibledeformation of vibratory pieces.
It is another object of the present invention to provide a supersonicvibration driven motor device which is simple in structure andinexpensive to manufacture.
Other objects and advantageous features of the present invention will bereadily apparent from the following description with reference to theaccompanying drawings.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWINGS
Now the present invention will be described in more detail withreference to the accompanying drawings which illustrate the preferredembodiments of the invention, in which:
FIG. 1 is a sectional view of a supersonic vibration driven motor devicein accordance with the first embodiment of the invention, sectioned inthe longitudinal direction.
FIG. 2 is a partial sectional view of the motor device in FIG. 1,particularly illustrating a significant part thereof in a larger scalethan that of FIG. 1.
FIG. 3 is a front view of the driven rotor, taken along line III--III inFIG. 2 and seen in the direction designated with arrow marks.
FIGS. 4(A) through (C) are partial schematic illustrations of thevibration disc of the supersonic oscillator and a vibratory piece on thedriven body respectively, shown in enlarged scale for facilitatingunderstanding of the principle of operation of the motor device inaccordance with the present invention.
FIG. 5 is a diagrammatic illustration of a force angle, in which thecompressive force imparted to the vibratory piece due to the vibratorydisplacement of the vibration disc is reduced to two components in the Xdirection and Y direction.
FIG. 6(A) is a diagram illustrating the relation between displacement ofthe vibration disc of the supersonic oscillator and time.
FIG. 6(B) is another diagram illustrating the movement L of a vibratorypiece and the movement N of the driven body, that is, the rotor, as afunction of time.
FIG. 7(A) is a schematic sectional view of the motor device inaccordance with another embodiment of the invention.
FIG. 7(B) is a front view of the driven rotor, taken along line VII--VIIin FIG. 7(A) and seen in the direction designated by arrow marks, and
FIG. 8 is a partial schematic sectional view of the motor device inaccordance with another embodiment of the invention.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS OF THE INVENTION
In FIG. 1 the reference numeral 11 designates a motor casing in which asupersonic vibrator 12 is disposed so as to be vibratively displaced toboth the left and the right. At the right part of said casing 11, arotor 13 is rotatably arranged between ball bearings 14. As is apparentfrom the drawing, said supersonic oscillator 12 and rotor 13 are locatedsuch that the right end face of the oscillator faces the left end faceof the rotor. Specifically, the rotor 13 to be driven is integrallyformed at the left end with a plurality of vibratory pieces 15, saidvibratory pieces 15 axially protruding at a predetermined angle ofinclination relative to the axis of the rotor 13, while a vibration disc16 is secured to the right end face of the supersonic oscilator 12.
Said vibration disc 16 and said vibratory pieces 15 are located suchthat the former is brought into contact with the end faces of thelatter. The reference numeral 17 designates bearing tightening threads,the reference numeral 18 denotes a retaining nut for the rotor 13, thereference numeral 19 denotes an electromagnetic coil, and the referencenumeral 20 denotes a casing cover.
In FIG. 2 a significant portion of the motor device in accordance withthe invention is schematically illustrated in a considerably largerscale. A plurality of vibratory pieces 15, integrally protruding fromthe left end face of the rotor 13, are brought in contact with thevibration disc 16 secured to the right end face of the supersonicoscillator 12. The vibratory pieces 15 obliquely extend at apredetermined angle of inclination relative to the axis of the rotor 13which is rotatably supported by bearing means 14, such as ball bearingsor the like.
Now a typical method for producing the plurality of vibratory pieces 15will be described. First, a circular recess having a diameter smallerthan the outer diameter of a metal rod is bored to a predetermineddepth, and then the resultant annular portion is subjected to a slottingoperation at a predetermined angle of inclination relative to thecentral axis. As a result, the required vibratory pieces are obtained asillustrated in FIGS. 1 to 3. In particular, FIG. 3 is a front view ofvibratory pieces 15 produced in the above-described manner, taken alongline III--III in FIG. 2 and seen in the direction designated by arrowmarks. It will be readily understood that the vibratory pieces arelocated at a certain distance from each other along the annular portionof the rotor 13. In the case of the embodiment illustrated in FIGS. 1and 2, the slotting operation is performed in the direction extendingfrom the upper right to the lower left. Alternatively, it is possible toperform the slotting operation in the opposite direction, that is, inthe direction extending from the upper left to the lower right, wherebythe rotor will be rotated in the opposite direction.
Next, the principles of operation of the motor device in accordance withthe present invention will be described. First, as illustrated in FIG.4(A), it is assumed that an origin 0 for an x - y coordinate system islocated at the lower part of the left end face 15a of the vibratorypiece 15 against which the right end face 16a of the vibration disc 16comes in abutment. In this connection it is to be noted that an angle θof inclination relative to the axis of the rotor 13 should be chosensmaller than the friction angle between the vibration disc 16 and thevibratory piece 15.
As the vibration disc 16 starts to vibrate and displaces by a distanceΔX in the X direction, the end face 15a of the vibratory piece 15 iscompressively displaced in the positive X direction. Due to the factthat the rotor 13 is immobile in the axial direction, a component f_(y)in the Y direction is derived from the compressive force f imparted tothe vibratory piece 15, corresponding to the displacement ΔX in the Xdirection, as illustrated in FIG. 5. The vibratory piece 15 is thusdisplaced away from the axis of the rotor 13 in the Y direction. Thedisplacement of the vibratory piece 15 in the Y direction is designatedby ΔY₁. (see FIG. 4(B)).
Next, as the vibration disc 16 is displaced by a distance ΔX in thenegative X direction in the next operational phase, the right end face16a of the vibration disc 16 parts from the left end face 15a of thevibratory piece 15, causing the frictional force therebetween todisappear. Thus the portion 15a of the vibratory piece 15 is flexiblydeformed and thereby displaced in the positive Y direction in accordancewith the characteristic frequency of the vibratory piece 15, whereby therotor 13 is rotated by ΔY₂ in the Y direction due to its own inertialforce. (see FIG. 4(C)). As the vibration disc 16 continues to vibrate,the relation between the vibration disc 16 and the next vibratory piece15 is restored to the original state as illustrated in FIG. 4(A). Byrepeating the above-described operational steps, the rotor 13 continuesto be rotated.
FIGS. 6(A) and (B) are intended to graphically illustrate theabove-described operational steps of the motor device in accordance withthe invention. FIG. 6(A) shows the movement of the vibration disc 16relative to time, while FIG. 6(B) shows the movement L of the vibratorypiece 15 at its left end portion 15a. It is to be noted that theaforesaid movement L of the vibratory piece 15 is composed of theamplitude M of the vibratory piece 15 itself and the movement N of therotor 13. In both graphs, the period from time t₁ to time t₂ on theabscissa represents an operational step during which the vibration disc16 comes in contact with the vibratory piece 15, while the period fromt₂ to t₃ represents the next operational step during which the vibrationdisc 16 moves away from the vibratory piece 15. During the former periodof time, the rotor is operatively driven, while during the latter periodof time, the rotor is rotated only by inertial force without any powersupply.
As mentioned abpve. the principle of the present invention lies in thefact that the vibratory movement of the vibration disc 16 secured to thesupersonic oscillator is transformed into rotational movement of therotor 13 by way of flexible deformation of the vibratory pieces 15 whichhave excellent resilience, wherein the displacement of the vibratorypieces 15 located remote from the axis of the rotor 13 producesrotational torque on the rotor, so that the required continuous rotationof the latter is achieved.
It is to be noted that in FIGS. 1 to 4 the present invention has beendescribed with the motor device in which the vibratory pieces 15 areformed integrally with the rotor 13 to be driven, but it shouldn't belimited only to this arrangement. Said vibratory pieces 15 may, forexample, be integral with the vibration disc 16 secured to thesupersonic oscillator 12.
FIGS. 7 and 8 schematically illustrate a motor device in accordance withother embodiments of the invention, respectively. In FIG. 7(A), thereference numeral 21 designates a plurality of supersonic oscillators,each of which is integrally formed with vibratory pieces 22. Saidvibratory pieces 22, axially extending at a predetermined angle ofinclination, are brought in contact against the left end face of a rotor23 to be driven. The vibratory pieces 22 are arranged at a predeterminedangle of inclination relative to the axis of the rotor 23 to be drivenin the same manner as in the case of the embodiment illustrated inFIG. 1. FIG. 7(B) is a sectional view of the motor device, taken alongline VII--VII in FIG. 7(A) as seen in the direction designated by thearrow marks. Said vibratory pieces 22 are located so as to come incontact with an annular peripheral portion 23' of the rotor 23, wherebyvibratory movement of the supersonic oscillators 21 in the axialdirection causes the rotor 23 to be rotationally driven by way offlexible deformation of the vibratory pieces 22 in accordance with theprinciple illustrated in FIG. 4. In this embodiment, the respectivesupersonic oscillators 21 are located in such a manner that, duringdriving operation of the rotor, they are not actuated in the same phase,but with a certain relative phase displacement between them, wherebysmooth rotation is ensured for the rotor 23.
In this embodiment, the vibratory pieces 22 are formed integrally with avibration disc (not shown) secured to the supersonic oscillators 21.Alternatively, the vibratory pieces 22 may be integral with the rotor 23in the same manner as in the case of the first embodiment illustrated inFIGS. 1 through 4.
Further referring to FIG. 8 which illustrates another embodiment of theinvention, a plurality of supersonic oscillators 31 are shown to belinearly disposed one after another, each being connected to theadjacent oscillator with the aid of support rods 32. The respectivesupersonic oscillators 31 are integrally formed, at their lower ends,with vibratory pieces 33 which extend at a predetermined angle ofinclination. As the supersonic oscillators 31 vibrate in the verticaldirection, the vibratory pieces 33 are flexibly deformed, and a linearlyextending mass 34, in the form of a plate or rod, is thereby linearlydriven in the direction designated by an arrow mark.
Thus the supersonic vibration driven motor device in accordance with thepresent invention has been described with respect to its principle ofoperation and in reference to its preferred embodiments. As is apparentfrom the above description, it can be concluded that the motor device ofthe invention is new and unique, since the same is operated in adifferent manner from conventional motor devices, that is, in such amanner that supersonic vibratory energy is transformed into rotationalor linear movement by way of flexible deformation of vibratory pieces.The motor device of the present invention is capable of generating highrotational force as well as linear driving force at a higher operativespeed with a smaller structure. Finally, it is to be added that themotor device of the invention can be put to use in substantially thesame fields of application as those of conventional ones.
It should, of course, be understood that the present invention isn'tlimited only to the above-described embodiments; it may be changed ormodified in a suitable manner without any departure from the spirit andscope of the invention.
What is claimed is:
1. A supersonic vibration driven motor devicecomprising:a supersonic oscillator; and a mass to be rotationally drivenby way of supersonic vibration, said supersonic oscillator beingprovided with a vibration disc secured thereto on an end face thereofwhich is opposite to said mass to be driven; said mass to be drivenbeing integrally formed with a plurality of plate-shaped resilientvibratory pieces annularly arranged on an end face thereof opposite tosaid oscillator and axially extending at a predetermined angle ofinclination relative to the axis of the mass to be rotated, saidvibration disc and vibratory pieces being located so that theirrespective end portions come in contact with one another, vibratorydisplacement of the supersonic oscillator, in a direction transverse tothe face of said mass being transformed into rotational movement of themass by the flexible deformation of said vibratory pieces, and furtherincluding additional supersonic oscillators, all of the oscillatorsbeing coupled to one another with the aid of supporting members andlocated so as to come in contact with the vibratory pieces formedintegrally with the mass to be driven and arranged on the end face ofthe supersonic oscillator in such a manner that operational phases ofthe respective oscillators lag each other by a predetermined phase angleso as to obtain even and smooth rotation of the mass.
2. A supersonicvibration driven motor device as set forth in claim 1, wherein thevibratory pieces formed integrally with the mass to be driven areinclined in the forward direction relative to movement of the mass, asseen from the supersonic oscillator.
3. A supersonic vibration drivenmotor device as set forth in claim 2 wherein the angle of inclination ofthe vibratory pieces relative to a plane perpendicular to the end faceof the mass to be driven is predetermined to be smaller than thefriction angle between the vibration disc secured to the supersonicoscillator and the vibratory pieces.
4. A supersonic vibration drivenmotor device as set forth in claim 1 wherein the angle of inclination ofthe vibratory pieces relative to a plane perpendicular to the end of themass to be driven is predetermined to be smaller than the friction anglebetween the vibration disc secured to the supersonic oscillator and thevibratory pieces.
5. A supersonic vibration driven motor devicecomprising:a supersonic oscillator; and a mass to be rotationally drivenby way of supersonic vibration, said supersonic oscillator beingprovided, at a face thereof toward the mass, with a vibration discsecured thereto, said vibration disc being integrally formed on its endface with a plurality of plate-shaped resilient vibratory piecesannularly arranged and opposing said mass and axially extending at apredetermined angle of inclination relative to the axis of the mass tobe rotated, said vibratory pieces and mass to be driven being located sothat their respective end portions come in contact with one another,vibratory displacement of the supersonic oscillator in a directiontransverse to the face of said mass being transformed into rotationalmovement of the mass by the flexible deformation of said vibratorypieces, and further including additional oscillations and vibratorypieces, the vibratory pieces being formed integrally with vibrationdiscs secured to supersonic oscillators which are annularly arranged andcoupled to one another with the aid of supporting members and beinglocated so as to come in contact with the mass to be driven in such amanner that operational phases of the respective oscillators lag eachother by predetermined phase angle so as to obtain even and smoothrotation of the mass.
6. A supersonic vibration driven motor devicecomprising:a plurality of supersonic oscillators linearly arranged andcoupled to one another with the aid of supporting members; and a mass inthe form of a plate or a rod to be linearly driven by said supersonicoscillators, each supersonic oscillator being provided with a vibrationdisc integrally formed with a plurality of plate-shaped resilientvibratory pieces which are extended at a predetermined angle ofinclination and arranged in linear alignment, said mass to be linearlydriven having a face and vibratory pieces being located so that theirrespective end portions come in contact with said face, vibratorydisplacement of the supersonic oscillators in a direction transverse tothe face of said mass being transformed into linear movement of the massby way of flexible deformation of said vibratory pieces.
7. A supersonicvibration driven motor device as set forth in claim 5 or 6, wherein thevibratory pieces formed integrally with the vibration disc secured tothe supersonic oscillator are inclined in the forward direction relativeto movement of the mass, as seen from the supersonic oscillator.
8. Asupersonic vibration driven motor device as set forth in claim 7,wherein the angle of inclination of the vibratory pieces relative to aplane perpendicular to the face of the mass to be driven ispredetermined to be smaller than the friction angle between the mass tobe driven and the vibratory pieces.
9. A supersonic vibration drivenmotor device as set forth in claim 5 or 6 wherein the angle ofinclination of the vibratory pieces relative to a plane perpendicular tothe face of the mass to be driven is predetermined to be smaller thanthe friction angle between the mass to be driven and the vibratorypieces. | 2024-03-22 | 1980-03-24 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1982-04-20"
} |
US-69154396-A | Lead frame pusher device
ABSTRACT
A lead frame pusher device for feeding lead frames in and out of a lead frame magazine including: a pusher mount installed between a pair of lead frame supply guide rails so that the pusher mount can travel along the supply guide rails, a pusher driver which moves the pusher mount along the supply guide rails, a first pusher fastened to the pusher mount so as to project upward from the pusher mount, a second pusher fastened to the pusher mount so as to be located below the first pusher and extends toward the magazine, and a pusher driver for vertically moving the pusher mount so that the first and second pushers are moved to a lead frame conveying path level of the lead frame supply guide rails.
BACKGROUND OF THE INVENTION
1. Field of the Invention
The present invention relates to a lead frame pusher device which feedslead frames into a lead frame magazine that is raised and lowered by anelevator device and then subsequently feeds the lead frames out of thelead frame magazine.
2. Prior Art
The baking oven described in Japanese Patent Application Laid-Open(Kokai) No. 7-130946 is an example of a conventional system in whichlead frames are fed into a lead frame magazine (called "magazine") by apusher of a pusher device and then subsequently fed out of the magazineby the pusher.
In this device, in order to feed the lead frames into the magazine, thepusher must operate so as to move a distance which is at least equal tothe length of the lead frame to be handled and a distance from the frontend of the lead frame to the rear end of the magazine. Furthermore, inorder to feed the lead frames out of the magazine, the pusher must beoperated to move a distance which is at least equal to the distance fromthe rear end of the magazine to the front end of the magazine.
In the prior art described above, when the lead frames are fed into andout of the magazine, the pusher must be moved a distance which is atleast equal to the length of the lead frames in the magazine plus thefeed-out distance of the lead frames from the magazine. As a result, thesize of the pusher device tends to be large, and considerable time isrequired for the movement of the pusher.
SUMMARY OF THE INVENTION
Accordingly, the object of the present invention is to provide a leadframe pusher device which allows the size of the pusher device to bereduced and the movement time of the pusher to be shortened.
The object is accomplished by a unique structure of the presentinvention for a lead frame pusher device in which lead frame supply anddischarge guide rails are installed respectively on the front and backof a magazine which is raised and lowered by an elevator device so thatlead frames are fed into and out of the magazine, and the uniquestructure of the present invention is that the pusher device furtherincludes:
a pusher mount installed on the supply guide rails so that the pushermount can move along the supply guide rails,
a pusher mount driving means which moves the pusher mount along thesupply guide rails,
a first pusher fastened to the pusher mount and projects upward from thepusher mount,
a second pusher fastened to the pusher mount so as to be below the firstpusher and extends toward the magazine, and
a pusher raising and lowering driving means which moves the pusher mountup and down so that the first and second pushers are positioned at theconveying path level of the supply guide rails.
The above-described pusher device may include a feeding roller means onthe supply guide rails so as to further smoothly feed the lead framesinto the magazine in a sandwiched fashion.
The above-described pusher device may further include a feeding rollermeans on the discharge guide rails so as to feed out the lead frames ina sandwiched fashion.
In addition, the above-described pusher device may include feedingroller means on the supply guide rails and on the discharge guide railsso as to feed the lead frames in a sandwiched fashion.
In the above described pusher device, lead frames are pushed by thefirst pusher positioned at the rear area of the pusher device and fedforward to the magazine. Then, the lead frames are pushed by the secondpusher so as to be completely fed into the magazine. When the leadframes accommodated in the magazine are to be fed out, they are fed outby the second pusher. In particular, after each lead frame has been fedforward by the first pusher, the pusher mount is withdrawn rearward sothat the second pusher can face the rear end of the lead frame, and thenthe second pusher is moved so as to push the lead frame out of themagazine entirely.
Accordingly, the amount of movement of the pusher mount on which thefirst pusher and second pusher are provided is either the amount ofmovement required to feed the lead frames into the magazine or theamount of movement required to feed the lead frames out of the magazine,whichever amount of movement is larger. Thus, the amount of movement ofthe pusher mount is small, and therefore, the overall size of the pusherdevice can be small.
In the structure of the pusher device that includes the feeding rollermeans on the lead frame supply guide rails, the amount by which the leadframes are fed toward the magazine by the first pusher may be either theamount of movement required for the lead frame to reach the feedingroller means or the amount of movement required for the lead frames tobe completely fed into the magazine by the second pusher, whicheveramount of movement is larger. Accordingly, the amount of movement of thepusher mount that is required to feed the lead frames into the magazinemay be reduced to an extremely small amount.
Furthermore, in the structure that includes the feeding roller means onthe discharge guide rails, the amount by which the lead frames are fedout from the magazine by the second pusher may be the feeding amountrequired for the lead frame to reach the feeding roller means.Accordingly, the amount of movement of the pusher mount that is requiredto feed the lead frames out of the magazine may be reduced to anextremely small amount.
In addition, in the pusher device that includes the feeding roller meanson the supply guide rails and on the discharge guide rails, the amountof movement required to feed lead frames into the magazine or to feedthe lead frames out of the magazine can be reduced by an even greateramount. In this case, the amount of movement may be set as the amount ofmovement required to feed the lead frames into the magazine or as theamount of movement required to feed the lead frames out of the magazine,whichever amount of movement is greater.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a top view which illustrates one embodiment of the lead framepusher device of the present invention;
FIG. 2 is a front view of FIG. 1;
FIG. 3 illustrates the operation for accommodating the lead frames inthe magazine; and FIG. 3(a) shows the feeding of lead frames by thefirst pusher, and FIG. 3(b) shows the feeding of lead frames by thefeeding roller means.
FIG. 4 illustrates the operation for completely accommodating the leadframes in the magazine; and FIG. 4(a) shows the state prior to theoperation of the second pusher, and FIG. 4(b) shows the state followingthe operation of the second pusher.
FIG. 5 illustrates the operation for feeding out the lead frames fromthe magazine; and FIG. 5(a) shows the state prior to the operation ofthe second pusher, and FIG. 5(b) shows the state following the operationof the second pusher.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
As shown in FIGS. 1 and 2, a lead frame magazine (merely called"magazine") 3 is installed inside a baking oven 2. The baking oven 2bakes an insulating tape or adhesive agent that has been attached tolead frames 1, and the magazine 3 is mounted on the elevator of anelevator device (not shown).
A pair of supply guide rails 4 and a pair of discharge guide rails 5which guide the lead frames 1 are respectively installed on the frontside (left side in FIG. 1) and on the rear side (right side in FIG. 1)of the baking oven 2 and magazine 3. In other words, the supply guiderails 4 are provided in front of the oven 2 and magazine 3, and thedischarge guide rails 5 are provided behind the oven 2 and magazine 3.Since this is a conventionally known structure, a further description isomitted.
Guide bushes 11 are provided on a base plate 10 which is located beneaththe lead frame supply guide rails 4, and guide rods 12 are supported inthe guide bushes 11 so that the guide rods 12 can move up and down (orin the perpendicular direction with reference to the surface of thedrawing sheet).
A raising and lowering plate 13 is fastened to the upper ends of theguide rods 12. Springs 17 are provided between lower spring mounts 15fixed to the base plate 10 and upper spring mounts 16 fixed to theraising and lower plate 13, so that the undersurface of the raising andlowering plate 13 is pressed against the operating rod 14a of a pusherraising and lowering cylinder 14.
A slide rail 20 which is positioned between and parallel to the pair oflead frame supply guide rails 4 is fastened to the raising and loweringplate 13, and a pusher mount 21 is slidably provided on this slide rail20.
A first pusher 22, which is a pawl, as best seen in FIG. 2, projectingupward over the pusher mount 21 and a lead frame conveying path 4a ofthe lead frame supply guide rails 4, is provided on the pusher mount 21.
In addition, a second pusher 23, which is a rod extending horizontallytoward the magazine 3 and below the upper end surface of the firstpusher 22, is also provided on the pusher mount 21.
Bearings 25 and 26 are fastened to the raising and lowering plate 13 onthe left and right sides, respectively, and pulley shafts 27 and 28 arerotatably supported on these bearings 25 and 26, respectively. Pulleys29 and 30 are coupled to the upper end portions of the pulley shafts 27and 28, respectively; and a belt 31 is provided between the pulleys 29and 30. One end of the belt 31 is connected to the pusher mount 21.
In addition, the pulley shaft 27 extends downward so as to project fromthe bottom surface of the raising and lowering plate 13, and a pulley 32is coupled to the lower end of the pulley shaft 27. A pusher feedingmotor 34 is provided on the undersurface of the raising and loweringplate 13 so as to be near the pulley 32 via a supporting plate 33. Abelt 36 is provided between the pulley 32 and a pulley 35 which iscoupled to the output shaft of the pusher feeding motor 34.
A free-rolling roller 40 and a drive roller 41 (collectively called"feed-in rollers") which feed or convey lead frames 1 while sandwichingthe lead frames 1 from above and below are provided at the forward endof the supply guide rails 4. Roller shafts 42 and 43 of the respectivefree-rolling roller 40 and drive roller 41 are rotatably provided onbearing holder 44 which is fastened to one of the supply guide rails 4;and a pulley 45 is also coupled to the roller shaft 43. A lead framefeeding motor 47 is provided, via a supporting plate 46, on the baseplate 10 so as to be located beneath the pulley 45. A pulley 48 iscoupled to the output shaft of the lead frame feeding motor 47, and abelt 49 is provided between the pulley 48 of the motor 47 and the pulley45 of the roller shaft 43.
FIGS. 1 and 2 show the pusher mount 21 in a retracted state. In thiscase, the distance between the free-rolling roller 40 and the firstpusher 22 is set to be sufficiently greater than the length of leadframes, and the tip end (or forward end, which is the left side end) ofthe second pusher 23 is located near the side of the free-rolling roller40.
A free-rolling roller 50 and a drive roller 51 (collectively called"feed-out rollers") are provided on the discharge guide rails 5 so as tofeed lead frames 1 while sandwiching the lead frames 1 from above andbelow. Though not shown in the Figures, the free-rolling roller 50 anddrive roller 51 are driven by a structure substantially the same as thatused for the feed-in rollers.
In operation, as shown in FIGS. 1 and 2, a lead frame 1 is first placedon the conveying path 4a of the supply guide rails 4 by a transferdevice (not shown) with the second pusher 23 positioned below theconveying path 4a of the supply guide rails 4. Then, the pusher feedingmotor 34 and lead frame feeding motor 47 are actuated in the forwarddirection.
When the pusher feeding motor 34 is thus actuated in the forwarddirection, the belt 31 rotates, and the point on the belt 31 to whichthe pusher mount 21 is attached is moved in the direction of arrow A viathe pulley 35, belt 36 and pulley 32. As a result, the pusher mount 21is moved along the slide rail 20 in the direction of arrow A, and therear end of the lead frame 1 is pushed toward the magazine 3 by thefirst pusher 22 of the pusher mount 21. When the front end portion ofthe lead frame 1 is moved between and is sandwiched by the feed-inrollers comprising the free-rolling roller 40 and the drive roller 41,the pusher feeding motor 34 is rotated in the reverse direction.
At this point, the lead frame feeding motor 47 has been actuated and isrotated as described above; accordingly, this rotation of the lead framefeeding motor 47 causes the drive roller 41 to rotate in the directionof arrow B via the pulley 48, belt 49 and pulley 45. As a result, therotating free-rolling roller 40 and drive roller 41, which sandwichesthe lead frame 1, feed the lead frame 1 into the magazine 3 as shown inFIG. 3(b). When the pusher feeding motor 34 is rotated in the reversedirection as described above, the pusher mount 21 is moved in theopposite direction from the direction of arrow A, so that the pushermount 21 returns to its initial position 55 as shown in FIG. 3(b).
As shown in FIG. 3(b) when the feed-in rollers (the free-rolling roller40 and drive roller 41) have fed the lead frame 1 into the magazine 3,the rear end of the lead frame 1 is not completely inside the magazine3. Accordingly, an operation which pushes the lead frame 1 completelyinside the magazine 3 is commenced.
More specifically, the pusher raising and lowering cylinder 14 is firstoperated so as to raise the operating rod 14a of the cylinder 14, thusmoving the raising and lowering plate 13 upward. As a result, the centerof the second pusher 23 is positioned at the height level of theconveying path 4a of the supply guide rails 4 as shown in FIG. 4(a). Inother words, the leading (or forward) end of the second pusher 23 isbrought behind the rear end of the lead frame 1. Then, the pusherfeeding motor 34 is actuated again so as to rotate in the forwarddirection and move the pusher mount 21 in the direction of arrow A. As aresult, the rear end of the lead frame 1 is pushed by the leading (orforward) end of the second pusher 23, and the lead frame 1 is completelypushed into the magazine 3 as shown in FIG. 4(b).
Afterward, the pusher feeding motor 34 is rotated in the reversedirection so that the pusher mount 21 is retracted. Also, the operatingrod 14a of the pusher raising and lowering cylinder 14 is retracted sothat the raising and lowering plate 13 is lowered, thus bringing thepusher device back to the state shown in FIGS. 1 and 2.
Once the lead frame 1 has been fed into the magazine 3, the magazine 3is raised one pitch by the elevator device (not shown) so that the nextlead frame accommodating section of the magazine is positioned at thelevel of the lead frame conveying path 4a. Then, when the next leadframe 1 is placed on the conveying path 4a of the supply guide rails 4,the lead frame 1 is fed into the magazine 3 by the series of operationsas described above. Afterward, these series of operations are repeateduntil the magazine 3 is filled with lead frames.
During the operation in which the lead frames 1 are fed into themagazine 3, the insulating tapes bonded to the lead frames 1 aresuccessively pre-baked by the heated atmosphere provided by the bakingoven 2 starting with the lead frame which was first fed into themagazine 3. When the feeding of the lead frames 1 into the magazine iscompleted, the elevator device is operated in the opposite directionfrom that described above so that the first lead frame accommodatingsection of the magazine 3 is brought to the level of the conveying path4a.
When the feed-in operation of the magazine 3 has been completed asdescribed above, the operating rod 14a of the pusher raising andlowering cylinder 14 is protruded so that the raising and lowering plate13 is moved upward, thus causing the second pusher 23 to be positionedat the height level of the conveying path as shown in FIG. 5(a) so thatthe lead frames are fed out of the magazine 3.
In particular, the pusher feeding motor 34 is actuated so as to rotatein the forward direction so that the second pusher 23 is moved in thedirection of arrow A and pushes the rear end of the corresponding leadframe 1 accommodated in the magazine 3. As a result, the front endportion of the lead frame 1 is sandwiched by the feed-out rollerscomprising the free-rolling roller 50 and drive roller 51 as shown inFIG. 5(b). Then, this lead frame 1 is fed out onto the discharge guiderails 5 by the rotation of the free-rolling roller 50 and drive roller51. After this, the pusher feeding motor 34 is rotated in the reversedirection so as to return to the position shown in FIG. 5(a) and FIG. 2.
Then, an operation is performed in which a new lead frame 1 is fed intothe now empty first lead frame accommodating section of the magazine 3.More specifically, a new lead frame 1 is placed on the supply guiderails 4 as described above, and the first and second pushers 22 and 23are operated as described above so that the lead frame 1 is fed into theempty first lead frame accommodating section of the magazine 3. Themagazine 3 is raised one pitch so that the next lead frame accommodatingsection is positioned at the level of the lead frame conveying path.Then, the pusher feeding motor 34 is again rotated in the forwarddirection so that the second pusher 23 pushes out the lead frame 1located inside the magazine 3 until the front end portion of the leadframe 1 is sandwiched by the free-rolling roller 50 and drive roller 51.Afterward, another lead frame is fed into the empty second lead frameaccommodating section of the magazine 3, and these series of operationsare successively repeated.
As seen from the above, the pusher mount 21 operates so that each leadframe is pushed by the first pusher 22, which is at the rear end area ofthe pusher device, from the position shown in FIGS. 1 and 2 until thefront end of the lead frame 1 is sandwiched by the free-rolling roller40 and drive roller 41 as shown in FIG. 3(a) . In other words, thepusher mount 21 only moves a distance of L1 from the initial position55, and then the lead frame 1 is almost completely fed into the magazine3 by the free-rolling roller 40 and drive roller 41 (Thus, L1 refers tothe distance in which the pusher mount 21 moves from the initialposition 55 so that the first pusher 22 pushes the lead frame until theforward end of the lead frame comes into the feed-in rollers).Afterward, as shown in FIGS. 4(a) and 4(b), the pusher mount 21 is moveda distance of L2 from the initial position 55; in other words, thesecond pusher 23 on the pusher mount 21 is moved a distance of L2, sothat the lead frame 1 is completely fed into the magazine 3 (Thus, L2refers to the distance in which the pusher mount 21 moves from theinitial position 55 so that the second pusher 23 pushes the lead frameuntil the lead frame is completely fed into the magazine 3).
As seen from the above, the maximum amount of movement of the pushermount 21 that is required to feed a lead frame placed on the conveyingpath 4a of the supply guide rails 4 into the magazine 3 is an amount ofmovement that corresponds to the distance L1 or L2, whichever is longer.Furthermore, in regard to the amount of movement of the pusher mount 21that is required to feed out a lead frame accommodated in the magazine 3onto the discharge guide rails 5, the pusher mount 21 is moved only adistance of L3 from the initial position 55 so that the front endportion of the lead frame 1 is sandwiched and fed out by thefree-rolling roller 50 and drive roller 51 as shown in FIGS. 5(a) and5(b) (Thus, L3 refers to the distance in which the pusher mount 21 movesfrom the initial position 55 so that the second pusher 23 pushes thelead frame accommodated inside the magazine 3 until the forward end ofthe lead frame comes into the feed-out rollers).
In FIG. 2, the distance between the leading or forward end of the leadframe 1 and the free-rolling roller 40 or drive roller 41 is shown as anextremely large distance; accordingly, the respective movement distancesshown in FIGS. 3(a), 4(b) and 5(b) are L1>L3 >L2. However, by settingthe pusher mount 21 to be at an advanced position beforehand inaccordance with the length of the lead frame to be handled, the distancebetween the leading end of the lead frame and the free-rolling roller 40can be extremely small. In other words, L1 can be shorter than L3, sothat L3 is longer than L1 or L2. Accordingly, a movement of the pushermount 21 within the range of L3 can feed the lead frame placed on thesupply guide rails 4 into the magazine 3 and feed out the lead frameonto the discharge guide rails 5. Thus, the pusher mount 21 is requiredto move only a short distance from the initial position 55, i. e., thefirst pusher 22 and second pusher 23 are required to move an extremelyshort distance. Accordingly, the size of the pusher device can beminimized.
The pusher device described above includes the feed-in rollerscomprising the free-rolling roller 40 and drive roller 41 as well as thefeed-out rollers comprising the free-rolling roller 50 and drive roller51. However, the pusher device of the present invention can be designedsmaller in size compared to a conventional device even though (1) thefree-rolling roller 40 and drive roller 41 are omitted, (2) thefree-rolling roller 50 and drive roller 51 are omitted, or (3) both setsof rollers are omitted, as described below. (1) A case in which thefeed-in rollers (the free-rolling roller 40 and drive roller 41) areomitted, and only the feed-out rollers (the free-rolling roller 50 anddrive roller 51) are installed, is described first:
When a lead frame 1 placed on the supply guide rails 4 as shown in FIG.1 and 2 is going to be pushed into the magazine 3 almost entirely asshown in FIG. 3(b), the rear end of the lead frame 1 is pushed by thefirst pusher 22 until the lead frame 1 assumes the position shown inFIG. 3(b). In this case, the pusher mount 21 is moved a distance of L4from the initial position 55 (Thus, L4 refers to the distance in whichthe pusher mount 21 moves from the initial position 55 so that the firstpusher 22 pushes the lead frame until the lead frame is fed into themagazine 3 except for the rear end area thereof as shown in FIG. 3(b)).Next, in order to push the lead frame 1 as shown in FIG. 3(b) into themagazine 3 completely, the pusher mount 21 is moved a distanceequivalent to L2 from the initial position 55 as in the aforementionedembodiment (this is illustrated in FIGS. 4(a) and 4(b)).
Since L4 is larger than L2, the lead frame 1 on the supply guide rails 4can be completely pushed into the magazine 3 by the pusher mount 21which is moved a distance of L4.
Furthermore, a lead frame 1 inside the magazine 3 can be fed out ontothe discharge guide rails 5 by causing the pusher mount 21 to move adistance equivalent to L3 from the initial position 55 as describedabove. In other words, since L4 is longer than L3, the maximum distancethat the pusher mount 21 must be moved so as to feed a lead frame placedon the supply guide rails 4 into the magazine 3 or to feed out a leadframe 1 accommodated in the magazine 3 onto the discharge guide rails 5is L4.
(2) In the case where the free-rolling roller 40 and drive roller 41 areinstalled, and the free-rolling roller 50 and drive roller 51 areomitted, the pusher mount 21 is operated in the following manner:
The maximum amount of movement of the pusher mount 21 that is requiredto achieve a complete push-in of a lead frame placed on the supply guiderails 4 into the magazine 3 is either L1 or L2, whichever is greater,from the initial position 55 as described above.
Furthermore, when a lead frame 1 inside the magazine 3 is to be fed outonto the discharge guide rails 5, the lead frame 1 is fed out by thesecond pusher 23. Accordingly, the second pusher 23 can move only adistance of L5 from the initial position 55 (Thus, L5 refers to thedistance in which the pusher mount 21 moves from the initial position 55so that the second pusher 23 pushes the lead frame accommodated in themagazine 3 until the lead frame is fed on the discharge guide rails 5).
In other words, since L5 is longer than L1 or L2, the maximum amount ofmovement of the pusher mount that is required to feed the lead frameplaced on the supply guide rails 4 into the magazine 3 or to feed outthe lead frame accommodated inside the magazine 3 onto the dischargeguide rails 5, is within the range of distance L5.
(3) In the case where the free-rolling roller 40 and drive roller 41, aswell as the free-rolling roller 50 and drive roller 51, are notprovided, the pusher mount 21 is operated in the following manner:
The amount of movement of the pusher mount that is required to achieve acomplete push-in of a lead frame placed on the supply guide rails 4 intothe magazine 3 is within the range of L4 from the initial position 55.
Also, the amount of movement of the pusher mount 21 that is required tofeed out a lead frame accommodated in the magazine 3 onto the dischargeguide rails 5 is within the range of L5 from the initial position 55.
In other words, the amount of movement of the pusher mount 21 may bewithin the range of L4 or L5, whichever is greater.
In conventional devices, it is necessary for a slider element to whichthe pusher is attached to move a distance equal to L4 plus L5 so as topush a lead frame placed on the supply guide rails 4 into the magazine 3or to feed out a lead frame accommodated in the magazine 3 onto thedischarge guide rails 5. In the present invention, even in cases wherethe free-rolling roller 40 and drive roller 41 or the free-rollingroller 50 and drive roller 51 (or both sets of rollers) are omitted, therequired amount of movement of the pusher mount 21 is either L4 or L5,whichever is larger, i. e., an amount of movement that is approximatelyhalf that required in a conventional device. Accordingly, the size ofthe pusher device can be reduced.
Furthermore, in cases where the free-rolling roller 40 and drive roller41 and the free-rolling roller 50 and drive roller 51 are all provided,the required amount of movement of the pusher mount 21 is the shortdistance L3; accordingly, the size of the device can be reduced evenfurther.
In the above embodiment, the feed-in rollers are provided on one of thepair of the lead frame supply guide rails 4. However, this invention isapplicable to a structure in which each one of the pair of the leadframe supply rails 4 is provided with feed-in rollers. Likewise,feed-out rollers can be provided on both of the pair of the lead framedischarge guide rails 5.
As described in detail above, the lead frame pusher device of thepresent invention includes:
a pusher mount which is installed between the supply guide rails so thatthe pusher mount can move along the supply guide rails,
a pusher mount driving means which drives the pusher mount along thesupply guide rails,
a first pusher which is fastened to the pusher mount so as to projectupward from the pusher mount,
a second pusher which is fastened to the pusher mount so as to be belowthe first pusher and extends toward the magazine, and
a pusher raising and lowering driving means which drives the pushermount up and down so that the first and second pushers are positioned atthe conveying path level of the supply guide rails.
Accordingly, the overall size of the pusher device can be minimized, andthe movement time of the pusher can be shortened.
We claim:
1. A lead frame pusher device comprising: a pair of supplyguide rails and a pair of discharge guide rails installed respectivelyon a front and a rear side of a magazine, which is raised and lowered byan elevator means, so that lead frames are fed into and fed out of saidmagazine via said guide rails, said lead frame pusher device furthercomprising:a pusher mount installed between said pair of supply guiderails for being moved along said supply guide rails, a pusher mountdriving means for driving said pusher mount along said supply guiderails, a first pusher means provided on said pusher mount and projectingupward from said pusher mount for coming into contact with said leadframes, a second pusher means provided on said pusher mount andextending toward said magazine below said first pusher means for cominginto contact with said lead frames, and a means for raising and loweringsaid pusher mount which moves said pusher mount upward and downward sothat said first and second pusher means are alternately positioned at aconveying path level of said pair of supply guide rails.
2. A lead framepusher device according to claim 1, further comprising a feed-in rollermeans provided on one of said pair of supply guide rails for sandwichingand feeding said lead frames into said magazine.
3. A lead frame pusherdevice according to claim 1, further comprising a feed-out roller meansprovided on one of said pair of discharge guide rails for sandwichingand feeding said lead frames out of said magazine.
4. A lead framepusher device according to claim 1, further comprising feed-in rollermeans and feed-out roller means respectively provided on said pair ofsupply guide rails and on said pair of discharge guide rails forsandwiching and feeding said lead frames.
5. A lead frame pusher devicefor feeding lead frames into a lead frame magazine comprising:a pair oflead frame supply guide rails extending in a first direction, a pushermount provided between said pair of supply guide rails for reciprocatingin said first direction, a pusher mount driving means for reciprocatingsaid pusher mount in said first direction, a first pusher means providedon said pusher mount for coming into contact with said lead frames andmoving said lead frames toward said lead frame magazine, a second pushermeans provided on said pusher mount for coming into contact with saidlead frames and feeding said lead frames into said lead frame magazine,and a means for moving said pusher mount in a second direction which isperpendicular to said first direction so that one of said first pushermeans and said second pusher means alternately comes into contact withsaid lead frame when said pusher mount moves toward said lead framemagazine.
6. A lead frame pusher device according to claim 5, whereinsaid second pusher means extends in said first direction, being largerin size than said first pusher means in said first direction.
7. A leadframe pusher device according to claim 5, further comprising a pair oflead frame discharge guide rails provided opposite from said lead framesupply guide rails with said magazine in between.
8. A lead frame pusherdevice according to claim 5, further comprising feed-in roller meansprovided on said lead frame supply guide rails for conveying said leadframes.
9. A lead frame pusher device according to claim 7, furthercomprising feed-out roller means provided on said lead frame dischargeguide rails for conveying said lead frames.
10. A lead frame pusherdevice according to claim 7, further comprising feed-in roller means andfeed-out roller means which are respectively provided on said lead framesupply guide rails and on said lead frame discharge guide rails forconveying said lead frames. | 2024-03-22 | 1996-08-02 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1998-10-27"
} |
US-51532365-A | Tool with a working spindle, particularly a screw driving tool
June 25, 1968 H. FELDPAUSCH 3,389,727
TOOL WITH A WORKING SPINDLE, PARTICULARLY A SCREW DRIVING TOOL FiledDec. 21, 1965 2 Sheets-Sheet 1 June 25, 1968 H FELDFAUSCH 3,389,727
TOOL WITH A WORKING SPINDLE, PARTICULARLY A SCREW DRIVING TOOL FiledDec. 21, 1965 2 Sheets-Sheet 2 h i! /E g i *7"? LL H 24 7M United StatesPatent 3,389,727 TOOL WITH A WORKING SPINDLE, PARTICU- LARLY A SCREWDRIVING TOOL Hugo Feldpausch, Ludenscheid, Westphalia, Germany, as-
signor to Feldpausch & Co., Ludenscheid, Westphalia, Germany Filed Dec.21, 1965, Ser. No. 515,323 Claims priority, applicatigzi $ermany, Dec.23, 1964,
89 3 Claims. (Cl. 144-32) This invention relates to a tool with aworking spindle, particularly a screw driving tool, with an axiallyfeeding spindle head casing and a multiple-disk clutch for a drive shaftof the working spindle.
In tools which have a working spindle, such as screw driving, boring anddrilling tools, threading tools and the like, the spindle head musttransmit torque and at the same time axial thrust to permit the screwdriving tool to function as is desired. Conventional feed means,generally of the compressed-air-operated type are adjusted to a uniformrate of feed and thus generate the axial thrust. The torque istransmitted through a suitable multiple-disk clutch. It is difiicult toadjust the ratio of these two forces to the changing conditions whichoccur during the in-feeding motion. Moreover, in screw driving tools theend of the screwdriver must be brought into engagement with the head ofthe bolt or screw. Since the Working spindle rotates whereas the screwis stationary, the
head of the screw may easily be damaged by the end of the screw drivingtool.
It is the object of the present invention to provide a spindle type toolin which the ratio of axial thrust and torque automatically adjustsitself during the in-feed of the working spindle and in which in thecase of a screw driving tool engagement between the tool and the head ofthe screw is automatically effected.
According to the present invention this is achieved by the provision ofa spindle type tool which comprises inside the spindle head causing acylindrical ball cage attached to the drive shaft of the working spindleand rotatably held between thrust bearings, said ball cage con tainingan axially movable sleeve which is attached to the working spindle andprovided with helically pitched grooves engaged by the balls in the ballcage.
In a preferred embodiment of the invention there is provided within theball cage a coiled compression spring which urges the sleeve in thedirection of feed of the spindle head casing.
The grooves which are engage by the balls are conveniently pitchedcontrary to the direction of rotation of the drive shaft of the workingspindle.
The proposed spindle head casing automatically adjusts the ratio ofthrust and torque. According to the pitch of the grooves for the ballsand the thrust of the compression spring a predetermined thrust isapplied to the working spindle. If the axial thrust varies during thein-feeding motion as a result of non-uniformity in the forward feed orin the threads of the holes in the workpiece into which the screws areto be driven, then the sleeve can yield against the resistance of thecompression spring until the reactive thrust has adjusted itself asrequired.
In order to bring the screw driving tool into proper engagement with thehead of the bolt or screw, the multiple-disk clutch may be provided witha toothed flange which is not engaged by corresponding teeth on aspindle input shaft until the final stage of the in-feeding motion sothat the screw driving tool will bear down on the screw head before itbegins to rotate. During the further descent of the spindle head casingthe retention of the screw driving tool on the screw head causes thesleeveto turn in the ball cage until the end of the screw driving toolcorice rectly engages the corresponding surfaces in the head of thescrew. The teeth of the input shaft are not pulled into engagement withthe toothed flange of the multiple-disk clutch until the in-feedingmotion reaches its final stage when the actual driving home of the screwtakes place. A screw driving tool of the above-described kind isnaturally suitable for driving screws of any kind, such as grub screws,slot-headed screws, socket-head screws and the like. A screw drivingtool as proposed by the invention is similarly suitable for drivingscrews having any type of thread, such as parallel and taper threads,wood screw threads and the like.
One embodiment of the invention will now be described by way of exampleand with reference to the accompanying drawings, in which:
FIG. 1 is a part sectional schematic general view of a Working unit in amulti-spindle screw driving machine tool;
FIG. 2 is a vertical section through the spindle head casing;
FIG. 3 is a perspective view of the sleeve which cooperates with theballs in the ball cage and of part of the spindle head casing, and
FIG. 4 is a vertical section through the multiple-disk clutch in thespindle drive.
FIG. 1 shows one of the driving heads of a multispindle automatic screwdriving machine. A clutch casing 1 contains a multiple-disk clutch 2which is driven by a V-belt transmission 3 and drives an input shaft 4.The clutch casing 1 is bolted or otherwise anchored to the machinepedestal not specially shown in the drawing. The spindle feed has theform of a preferably compressed-air operated feed cylinder 5 associatedwith a spindle head casing 7 which is attached by arms 6 to the pistonworking in said cylinder 5. A drive shaft 8 projects from above into thespindle head casing 7 and is driven by the shaft 4 through universaljoints and an intermediate shaft 9, an arrangement which permits thespindle head casing 7 to be laterally offset from the shaft 4 asrequired. Projecting from the bottom of the spindle head casing 7 is aworking spindle 10 which carries a screw driving tool 11. In FIG. 1 thistool 11 is illustratively shown to have a flat blade to fit the slottedhead of a screw or bolt. Naturally the screw driving tool 11 may have abox head for driving polygonal screw heads, a bunhead for Phillips-headscrews, a Setscrew head for socket-head screws or some other suitableshape.
Details of the spindle head casing 7 will now be de scribed by referenceto FIGS. 2 and 3. The spindle head casing 7 is clamped to one of thearms 6 or aflixed thereto in some other suitable way. Mounted betweenthrust bearings 12 in the spindle head casing 7 is a cylindrical ballcage 13 which is itself securely affixed to the end of the drive shaft8. The ball cage 13 contains preferably four openings 14, 15 arranged inquadrature of which each of two diametrically opposed openings 14 servesfor the reception of a ball 16. The two other diametrically opposedopenings 15 are engaged by retaining projections 17 formed in a slidablesleeve 18 which embraces the ball cage 13 and closes the two openings 14on the outside. A sleeve 19 is inserted into the ball cage 13 and keyedto the working spindle 10 which carries the screw driving tool 11. Ondiametrically opposite sides this sleeve 19 is provided with grooves 20in which the balls 16 can roll. The grooves 20 are pitched contrary tothe direction of rotation of the drive shaft 8, which is indicated inFIG. 3 by an arrow. A preferred angle of pitch is 30 which in the caseof the contemplated dimensions provides for an axial displaceability ofthe sleeve 19 of about 20 mm. Inserted between the end face 21 of thesleeve 19 and the end face 22 of the ball cage 13 is a coiledcompression spring 24.
is shown in FIG. 4. The multiple-disk clutch 2 is mounted H V in aconventional manner in ball bearings 25 and contains a number of disks26 associated with a toothed flange 27. For adjusting the maximum torquewhich the multiple-disk clutch 2 will transmit, a coiled compressionspring 28 is adjustable by means of a plate 29 and a threaded ring 30.The input shaft 4 carries teeth 31 which cooperate with the teeth on theflange 27.
The above-described screw driving machine functions as follows:
As many screws as there are spindles on the machine can be screwed intothreaded holes intended for their reception, the screws being held byspring loaded balls, guide rods or like means known in the art. Themultipledisk clutch 2 is continuously driven and the toothed flange 27therefore continuously rotates. However, as will be understood moreparticularly from FIG. 1, the shaft 4 does not at first rotate since thetoothed flange 27 does not engage the teeth 31 of the shaft 4. In thecourse of the automatically controlled working cycle the feed cylinder 5is then activated, causing the spindle head casing 7 and the workingspindle 10 to descend until the blade of the screw driving tool 11 makescontact with the head of the screw. This causes the sleeve 19 to belifted inside the ball cage 13 and the screw driving tool 11 to beturned until it engages the corresponding surfaces in the head of thescrew. As the descent of the spindle head casing 7 continues the dogclutch teeth 31 are pulled into engagement with the cooperating teeth onthe flange 27. The shaft 4 therefore begins to rotate. This rotation istransmitted to the working spindle 10 which therefore now drives thescrew into its hole. During the screw driving action the working spindle10 can to some extent move axially inside the ball cage 13 by movementof the balls in the grooves 20. The axial thrust thus adjusts itselfautomatically and allowance is made for slight non-uniformities in thedownward feed and in the screw threads. The magnitude of axial thrust isdetermined by the coiled compression spring 24 and the pitch of thegrooves 20 guiding the balls. The screw driving motion continues untilthe multiple-disk clutch 2 begins to slip when a maximum torque isexceeded. The feed cylinder then reverses in a conventional manner andthe spindle head casing 7 together with the working spindle 10 risesagain.
The ball cage which the invention provides permits a continuoustransmission of torque during; the entire screw driving operationalthough the multiple-disk clutch 2 is not itself displaced. During thefinal part of the screw driving operation the grooved sleeve graduallyshifts inside the ball cage whilst the thrust is maintained at the valuedetermined by the pitch of the grooves 20 and the thrust of the coiledcompression spring 24 and the necessary torque applied by the workingspindle 10 continues to be available. If desired, a larger number ofballs may be provided inside the ball cage and a correspondingnumassavzr Her of grooves may be provided in the sleeve 19. Theemployment of balls is preferred because friction is thereby reducedalthough in principle sliders might be provided for cooperation withsuitable slideways.
The invention may be embodied in other specific forms without departingfrom the spirit or essential characteristics thereof. The presentembodiment is therefore to be considered in all respects as illustrativeand not restrictive, the scope of the invention being indicated by theappended claims rather than by the foregoing description and all changeswhich come within the meaning and range of equivalency of the claims aretherefore intended to be embraced therein.
I claim:
1. A tool used for a screw driving machine comprising:
(a) a working spindle including a Work engaging means,
a drive shaft having a direction of rotation, a head casing, acylindrical rotatable ball cage containing balls, thrust bearings, andan axially movable sleeve having helically pitched grooves; and
(b) a multiple-disk clutch between a power source and said spindle, saidclutch including means controlling rotary movement of said drive shaftand a casing anchored against movement relative to said machine;
(c) said spindle further including means fixedly attaching said ballcage to said drive shaft inside said head casing between said thrustbearings, means for axially feeding said head casing, and
(d) said grooves being pitched in a direction opposite the direction ofrotation of said drive shaft and said balls of said ball cage beingengaged with said helically pitched grooves of said sleeve, and meansconnecting said sleeve to said work-engaging means.
2. A spindle type tool as claimed in claim 1, wherein a coiledcompression spring is provided within the ball cage and urges the sleevein the direction of feed of the spindle head casing.
3. A spindle type tool as claimed in claim 1, wherein the multiple-diskclutch casing is anchored against movement relative to the machine andsaid drive shaft controlling means includes a flange having teeth, aninput shaft having teeth, means for engaging said flange teeth with saidinput shaft to rotate said input shaft, and means for imparting rotatingmovement of said input shaft to said spindle during the final part ofthe in-feed of the said spindle head casing.
References Cited UNITED STATES PATENTS 594,741 11/1897 Harwood -53 X2,745,528 5/1956 Amtsberg 81-523 X 2,895,359 7/1959 Nelson 81-5232,886,075" 5/1959 Skoog 14432 DONALD R. SCHRAN, Primary Examiner.
1. A TOOL USED FOR A SCREW DRIVING MACHINE COMPRISING: (A) A WORKINGSPINDLE INCLUDING A WORK ENGAGING MEANS, A DRIVE SHAFT HAVING ADIRECTION OF ROTATION, A HEAD CASING, A CYLINDRICAL ROTATABLE BALL CAGECONTAINING BALLS, THRUST BEARINGS, AND AN AXIALLY MOVABLE SLEEVE HAVINGHELICALLY PITCHED GROOVES; AND (B) A MULTIPLE-DISK CLUTCH BETWEEN APOWER SOURCE AND SAID SPINDLE, SAID CLUTCH INCLUDING MEANS CONTROLLINGROTARY MOVEMENT OF SAID DRIVE SHAFT AND A CASING ANCHORED AGAINSTMOVEMENT RELATIVE TO SAID MACHINE; (C) SAID SPINDLE FURTHER INCLUDINGMEANS FIXEDLY ATTACHING SAID BALL CAGE TO SAID DRIVE SHAFT INSIDE SAIDHEAD CASING BETWEEN SAID THRUST BEARINGS, MEANS FOR AXIALLY FEEDING SAIDHEAD CASING, AND (D) SAID GROOVES BEING PITCHED IN A DIRECTION OPPOSITETHE DIRECTION OF ROTATION OF SAID DRIVE SHAFT AND SAID BALLS OF SAIDBALL CAGE BEING ENGAGED WITH SAID HELICALLY PITCHED GROOVES OF SAIDSLEEVE, AND MEANS CONNECTING SAID SLEEVE TO SAID WORK-ENGAGING MEANS. | 2024-03-22 | 1965-12-21 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1968-06-25"
} |
US-47765465-A | Load controlled brake proportioning system
Jan. 10, 1967 J. c. CUMMlNG LOAD CONTROLLED BRAKE PROPORTIONING SYSTEMFiled July 29, 1965 3 Sheets-Sheet 1 AXLE WEIGHT A I O9 AXLE WEIGHT CURBSTO P INVENTOR JAMES C. CUMMING QYM,7Zmfam M ATTORNEYS Jan. 10, 1967 J.c. CUMMING 3,297,368
LOAD CONTROLLED BRAKE PROPORTIONING SYSTEM Filed July 29, 1965 5Sheets-Sheet 2 TO MASTER CYLINDER /9 EMPTY 3 HALF LOADED FULLY LOADED-+E Q s7 I 42 0 I TO REAR I BRAKES I 76 I I I a A IIZII 80 I 84 A f fg'--mwr IEIIII l! llll INVENTOR JAMES C. CUMMING 29 M 72064/21/ 9 MATTORNEYS Jan. 10, 1967 J, c. @MNG 3,297,368
LOAD CONTROLLED BRAKE PROPORTIONING SY STEM Filed July 29, 1965 3Sheets-Sheet a INV EN 1 OR JAMES C. CUMMING ATTORNEYS United StatesPatent 3,297,368 LOAD CONTROLLED BRAKE PROPORTIONING SYSTEM JamesCharles Cumming, Pleasant Ridge, Mich., assignor to Rockwell-StandardCorporation, Pittsburgh, Pa., a corporation of Delaware Filed July 29,1965, Ser. No. 477,654 6 Claims. (Cl. 30322) This application is acontinuation-in-part of application Serial No. 429,082, filed January29, 1965, for Brake Systems, now abandoned.
The present invention refers to vehicle brake systems and moreparticularly to such systems including a load controlled brakeproportioning device.
In the operation of vehicle braking systems the set of wheel brakes atthe axle having the lightest static axle load tends to be locked-upbefore full braking is obtained at the other set of wheel brakes, thuscausing the wheels to skid with resulting adverse effects on thecontrollability of the vehicles.
This efiect caused by the uneven load distribution on the axles of thevehicle, is augmented by the load transfer which takes place duringbraking of the vehicle which shifts part of the weight of the vehicle atthe rear axle to the front axle due to the moment \of inertia. Theamount of load transfer is in direct proportion to the rate ofdeoeleration.
Customarily, the variations in static load on the wheels of a vehicleare taken into account by providing different size wheel brake cylindersat the front and rear wheels. In a front engine passenger car, forinstance, the front wheel cylinders are usually larger than the rearwheel cylinders .to compensate for the larger weight bearing on thefront axle whereas in trucks or other commercial vehicles the rear wheelcylinders usually are larger than the front wheel cylinders because ofthe larger rear axle loads in these vehicles.
However, these variations in wheel cylinder sizes do not compensatefully for the load shift during brake application and for this reasonvarious devices have been designed in the past to automaticallyproportion the brake pressure between the front and rear wheel brakes.Exemplary of such known prior devices are valve assemblies between themaster cylinder and the wheel brakes associated with the wheels carryingthe lightest load. Such prior valve assemblies usually have a movableball adapted to close the valve in one position and to open the valve inanother position. The valve assembly is usually mounted at an angle sothe position of the ball is a function of gravity and inertia. Normallythe ball is at the bottom of the valve assembly, opening the valve toprovide free communicaiton of fluid. However, during brake applicationand subsequent deceleration of the vehicle, the ball shifts at a certainpre-selected rate of deceleration to close the valve and thus interruptfluid communication from the master cylinder to the brakes at the wheelhaving the lightest load. The rate of deceleration at which the ballmoves to close the valve depends on the inclination at which the valveassembly is mounted.
An example of such a prior arrangement is disclosed, for instance, inUS. Patent No. 2,241,191 issued May 6, 1941 to W. R. Freeman.
However, all of the known prior art devices are operable only at apreselected rate of deceleration which is fixed once the device ismounted on the vehicle. Thus, the distance from the start ofdeceleration to the preselected point where the valve closes is fixedalthough it should vary widely depending on load conditions.Furthermore, these prior devices do not take varying load Y the onepre-selected for the average weight.
conditions into account which also affects the rate of deceleration.Since the prior proportioning devices are mounted at a fixed angle,which is calculated from a normal average vehicle load and averagenormal road conditions, actuation of these valves occurs always at afixed point of deceleration, say 0.3 to 0.4g regardless of variations inload or in road surface conditions. However, if the load on the wheelswhose brake pressure is to be controlled by this device is less thanaverage, the valve should close at a lower rate of deceleration thanOtherwise, the controlled brakes lock prior to reaching the preselectedrate of deceleration. Conversely, if the load is heavier than average,the closing of the proportioning valve should be delayed to occur at ahigher rate of deceleration to have sufiicient brake pressure available.
Accordingly, the primary Object of the present invention resides in theprovision of a pressure proportioning device for the brake system of amotor vehicle which is always effective to reduce or cut off pressure tothe set of Wheel brakes at the lightest loaded axle just prior tolocking the brakes regardless of Variation in the axle loading.
Another object is the provision of a pressure shut-off valve for avehicle braking system installed between the master cylinder and one setof wheel brakes, the valve incorporating a ball movable on an inclinedsurface the angle of which varies as :a function of the vehicle load, sothat pressure to the one set of brakes will be shut-off when apredetermined rate of deceleration is attained under normal loadconditions, and at other rates of deceleration as determined by thevariation in load applied to the wheels associated with this set ofbrakes.
A further object is to provide a novel brake pressure proportioningdevice of the inclined surface inertia type mounted between an axle andthe frame of the vehicle so that the inclination of the device will bechanged upon suspension articulation due to varying loads on that axle.
Still another object of the present invention is to provide an improvedinertia type pressure proportioning valve for a vehicle braking systemin which the ball member contained in the valve comprises the sole meansof closing or opening of the valve.
Other novel features will become more clearly apparent by the followingdetailed description having reference to the attached drawings in which:
FIGURE 1 is a schematic illustration of a vehicle braking systemembodying the present invention;
FIGURE 2 is an enlarged section through the inertia valve;
FIGURE 3 is a section taken along line 33 of FIG- URE 2;
FIGURE 4 is a side view of the inertia valve installed on the axle ofthe vehicle showing the various valve positions from minimum to maximumload conditions;
FIGURE 5 is a section through the lever arm connection taken along line55 of FIGURE 4;
FIGURE 6 is a graph plotted to show the load shifting duringdeceleration and the points of pressure cut-ofif at various loads;
FIGURE 7 is a side view of an alternate and presently preferred mountingof the inertia valve; and
FIGURE 8 is a front view of the mounting of FIG- URE 7.
With reference to FIGURE 1 there is shown a vehicle braking systemillustrated schematically and which includes a master cylinder 10adapted to be operated by the usual brake pedal 12. A conduit 14'1eadsfrom the pressure side of the master cylinder to a main conduit 16 whichis connected directly to the wheel cylinders 13 and 20 of the frontwheel brakes 22 and 24 through conduits 26 and 28. The wheel cylinders30 and 32 of the rear wheel brakes 34 and 36 are connected by conduits38 and 40, respectively, to a flexible branch conduit 42 which is incommunication with the outlet side of the novel pressure control valve44, the inlet side of which is connected by a flexible conduit 45 toconduit 16.
The wheel brakes 22, 24 and 34, 36 may be of any known construction andare here schematically illustrated as being of the anchored Lockheedtype, it being understood that the present invention is not limited to acertain type of brake.
With further reference to FIGURES 2 and 3, the novel control valve 44which is adapted to control the brake pressure at the wheels with whichit is associated, in this instance the rear wheels, is basically aninertia valve which functions under certain conditions in the movementof the vehicle, such as deceleration during braking without having toovercome any internal resistance such as springs, etc.
The valve 44 comprises a valve body 46 bored longitudinally to provideeccentric stepped bores 48 and 50. The larger bore 48 extendsapproximately to the center of the valve body where it connects to thesmaller bore 50 providing a chamfered valve seat 52. The outer end ofbore 48 extending to the valve seat 52 constitutes a chamber 58 adaptedto receive a metal ball 60 of smaller diameter than the chamber 58 whichis freely movable between the seat 52 and the plug 56. Normally, theball 60 rests on the lower surface 62 of the chamber 58 when the valveis properly installed as shown in FIGURE 2 and in this position the axisof the ball is on the centerline of the small bore 50. As illustrated inFIGURES 1 and 4 the valve 44 will be installed in the vehicle at anangle, with the plug 56 towards the rear of the vehicle pointingdownwardly so that the ball 60 initially sits in the rear of the chamber58 against the inner end of the plug. The lower chamber surface 62 uponwhich the ball rests is thus inclined and normally prevents the ballfrom moving against the valve seat 52. However, when the moving vehicleis braked, the ball 60 will, at a certain rate of deceleration, travelup the incline and close against the valve seat 52 due to its inertia.It will be noted that the distance the ball 60 travels from the end ofthe plug to the valve seat is very short to assure quick action ofthelvalve and to reduce rolling friction to a minimum.
The small diameter bore 50 provides an outlet passage and is threaded atits outer end to receive a fitting 66 which connects to the flexiblebranch conduit 42 leading to the wheel cylinders 30 and 32 of the rearbrakes 34 and 36.
Communication between the valve chamber 58 and the master cylinder isprovided by an inlet bore 70 leading into the valve chamber 58 oppositethe surface 62 and which is threaded to receive a fitting 72 connectedto flexible conduit 45 and thus to main conduit 16.
Thus, in the normal inclined position of the valve 44, that is, with theball 60 resting against the inner end of the plug 56 as in FIGURE 2 themaster cylinder 10 is in free fluid communication with the rear wheelbrakes. However, under certain braking conditions this communicationwill be interrupted when the ball 60 becomes lodged against the valveseat 52, thus preventing any further flow of fluid from the mastercylinder to the rear wheel cylinders as will be more fully explainedhereafter.
The valve 44 may be installed in the vehicle braking system to changeits inclination in response to variations in load at the rear axleeither as illustrated in FIGURE 4 or as illustrated in FIGURES 7 and 8.
Referring first to the installation of FIGURE 4, the valve 44 isattached by screws 74 to an inclined lever 76 with the plug 56 towardsthe rear pointing downwardly. The lever 76 is at one end pivotallyattached to a bracket 78, fastened to the rear axle 80 at any convenientlocation by studs 32. The axle 80 is connected in the usual way by asuspension comprising a multi-leaf spring 84 to the vehicle frame 86,these connections not being illustrated since they may be conventional.
The other end of the lever 76 is pivotally attached to the end ofanother lever 88 which is inclined upwardly towards the frame 86 and ispivotally attached at its other end to a bracket 90 fastened to theframe by screws 92.
The relative position of the connected levers 76 and 88 in relation toeach other and to the axle is such that the common pivot point 87 of thetwo levers is rearwardly of the axle 80 and the pivot point 77 of lever76 at the axle and pivot point 89 of lever 88 at the frame are, understatic load conditions, on a common vertical line X passing through thecenterline of the axle. By this arrangement which provides ascissor-like lever action between the axle and the frame of the vehicle,the inclined position of the valve 44 will be varied under articulationof the suspension and under varying loads applied on axle 80 asindicated in phantom lines in FIGURE 3 showing the range from empty tofully loaded condition. Thus, the angle of inclination to the horizontalindicated by the line Z is varied causing the valve to be actuated atvarying rates of deceleration depending on load conditions in contrastto the fixed position pressure control valves of prior art devices whichare actuated at only one pre-selected rate of deceleration.
The pivot connection of the levers 76, 88 is preferably by means of ablock of rubber 94 and bolt and nut assembly 96 as shown in FIGURE 5 todampen vibration effects and reduce noise and wear in addition to theability to resist twisting loads at the pivot connections duringarticulation.
In operation the operator applies the brakes in the usual manner bydepressing foot pedal 12 thereby exerting pressure on the fluid in themaster cylinder 10 which is transferred through the main conduit 16 tothe front brakes 22 and 24 and via the valve 44 which is open to therear brakes 34 and 36. When a certain rate of deceleration is reached,which is dependent on the load on the rear axle and the rate of loadtransfer, the ball 60 rides up the inclined surface 62 due to itsinertia and closes the outlet 51 by seating against the valve seat 52thus preventing the application of additional pressure to the rear Wheelbrakes. Thereafter, continued pressure through the inlet 70 holds theball 60 firmly against the valve seat. The valve 44 will closepreferably just short.
of the point at which the rear brakes lock.
Upon release of brake pedal 12 the reduction of pressure at the inletport 70 together with the force of the usual return springs at the rearbrakes causes fluid flow in reverse direction and immediately moves theball 60 away from valve seat 52 to open communication between the ports'51 and 70 through chamber 58.
The initial inclination of the valve 44 which determines the point ofvalve closing can be exactly determined by calculating the load shiftratio at a given load on the front and rear axle in relation to the linepressure of the brake system from 0.0g (start of deceleration) 1.0g(maximum stop of the vehicle).
By plotting a graph-in which the abscissa represents the rate ofdeceleration the left ordinate represents the curb load at the start ofdeceleration and the right ordinate represents the axle load at 1.0g orstop. The respective values are then drawn as straight lines from leftto right as illustrated in the composite graph of FIGURE 6 to arrive atthe desired point of pressure cut-off as will be more clearly explainedin the following examples from which the graph of FIGURE 6 was plotted.
The load shift ratio between front and rear axles is determined bydividing the center of gravity (in inches) by the wheel base (in inches)and multiplying the result in the total load on both axles. Theresultant amount is the amount of load shifted from the rear axle to thefront axle during the deceleration. In other words this amount is addedto the front axle and deducted from the rear axle. This load variationduring deceleration can be plotted as straight lines in the graph ofFIGURE 6 in which the solid lines represent the axle loads of an emptyvehicle during deceleration. Line RR represents the rear axle load andline F-F the front axle load. The
solid line LP represents the line pressure of the braking system whenthe brake work is equally divided between the front and rear brakes.This intersection S between the line LP and the line R-R represents thepressure at which the rear brakes would be locked under normalconditions and when no pressure control device is used. It is thepurpose of the system of the present invention to cut-off the linepressure at the rear brakes in advance of reaching point S to preventlocking of the rear brakes and subsequent skidding of the vehicle. Thisis accomplished by preferably limiting the line pressure to the rearbrakes to a value just below that which locks the brakes assuring themaximum load shift caused by deceleration at the maximum rate. Thisvalue is determined by drawing a horizontal line from point R at 1.0g(stop) to the line LP. The point of desired cutoff is at C where thelines intersect, giving in this instance a rate of deceleration of .28gat which the valve 44 closes. Thus, as the line pressure to the frontaxle increases the line pressure to the rear axle is cut-off at .28g tothereafter remain constant.
A convenient way to determine the angle a of inclination of the valve 44to assure cut-off at the desired rate of deceleration was found byassuming the calculated rate of deceleration for cut-01f, in thisinstance 28;; to be the tangent of the angle a of inclination. Thisangle is 15.6. By mounting the valve 44 at exactly this angle to thehorizontal the value functioned to close at the calculated rate ofdeceleration. Once the initial position of the valve 44 was determinedin this Way the relation remained to be true throughout the entire rangeof loading condition.
The broken lines R -R F -F and -LP graphically illustrate thefunctioning of the valve when the vehicle is half loaded. Here thedesired point of cut-off was found to be at .Sg which, assuming .Sg tobe a tangent required a 26.6 inclination of the valve. The scissor typelever arrangement to which the valve is attached is constructed andproportioned to provide this angle at half load.
The dotted lines RR", F"F" and L represent the functioning of the valveunder fully loaded conditions. Here the desired point of cut-off wasfound to be at .65g requiring the valve 44 to be at an angle of 33 whichwas also produced by the lever mechanism.
It has been found in practice that while the mounting of the valve 44 asshown in FIGURE 4 is satisfactory for most purposes, nevertheless, thevalve may be subject to excessive vibration in particularly heavy dutyuse especially when installed in off high vehicles which frequentlytraverse rough terrain. Under these severe operating conditions thevibration encountered in use may unlodge the ball from its seat andprematurely cut off fluid pressure to the rear brakes. The mounting ofFIGURES 7 and 8, to which detailed reference will now be made,eliminates this difficulty and is capable of functioning in the desiredmanner even under the most adverse operating conditions.
As in the previously described embodiment the mounting assembly includesa jack-knifing lever assembly comprising upper and lower links 100 and102 pivotally connected to each other by a resilient pivot constructionindicated generally at 104 which is preferably the same construotion asthe connection shown in FIGURE 5 described above. At its lower end thelink 102 is pivotally connected as at 106 to the plate 7-8 clamped tothe axle 80 in the manner previously described.
At its upper end the upper link 100 is pivotally connected as at 108 tothe mounting plate 90 carried by the vehicle frame 86 in the mannerpreviously described. As best shown in FIGURE 8 the upper end of theupper link 100 projects upwardly beyond the upper pivot 1418 and isreversely bent to provide a flat mounting area 110 to which the valveassembly 44 is secured by a plurality of bolts 112.
As in the previously described embodiment the valve assembly 44 is somounted as to incline the axis of the passage 50 upwardly in a forwarddirection. Further, in the embodiment of FIGURES 7 and 8, the valve isso mounted as to dispose the center of the ball 60 in alignment with theaxis of the upper pivot 108.
The apparatus is shown in FIGURES 7 and 8 in a typical position assumedwhen the vehicle carries a moderate load. When the load is increased,the distance between the pivots 108 and 106 will decrease thus rotatingthe valve assembly 44 to increase the angle of inclination of thepassage 50. Conversely, when the load is decreased the angle ofinclination of the valve assembly is correspondingly decreased. In eachcase the result is the same as that described in connection with theprevious embodiment.
Because of the mounting in the valve assembly 44 adjacent the upperpivot, the effects of vibration on the valve assembly will be minimizedsince the vibrations occuring at the axis are largely absorbed by thesuspension and the remainder dampened out by the resilient pivots.Further, since the ball 6t) in the valve assembly 44 is locatedessentially in alignment with the center of rotation of the upper pivotit is not effected by rotational movements of the links during vehicletravel.
From the foregoing it will be seen that the present novel pressurecontrol valve functions under any load condition from empty to fullyloaded and adjusts itself to the proper inclination to assure cut-off atany desired rate of deceleration corresponding to the respective loadconditions.
The advantages of this system over prior units in which the pressurecontrol valve was rigidly mounted at a certain angle which remainedconstant regardless of load variations will be readily apparent. Thecut-off was at a pre-selected constant rate of deceleration which iswholly inadequate. If, for instance, the pre-selected rate ofdeceleration for cut-off was set at .55; it will be ineffective in alighter loaded vehicle since the selected cut-off point is beyond thepoint S of locking the brake. The cut-olf in prior devices would usuallyoccur far too early in a heavier loaded vehicle thus depriving the rearbrakes of sufficient braking power.
It will be further appreciated that in the present pressure controlvalve no internal resistances have to be overcome by the ball during itsmovement as in known devices which rely on additional poppet valves forfluid communication, the operation of which is controlled by the ball.In the present invention the ball constitutes the sole means to controlthe fluid communication through the valve. Furthermore, rolling frictionis reduced to a minimum due to the exceedingly short travel of the ballassuring fast reaction and less wear.
The invention may be embodied in other specific forms without departingfrom the spirit or essential characteristics thereof. The presentembodiments are therefore to be considered in all respects asillustrative and not restrictive, the scope of the invention beingindicated by the appended claims rather than by the foregoingdescription, and all changes which come within the meaning and range ofequivalency of the claims are therefore intended to be embraced therein.
What is claimed and desired to be secured by Letters Patent is:
1. A braking system for use with a vehicle having a body and springsuspended axles carrying front and rear ground engaging wheel sets eachequipped with a fluid pressure operated brake comprising an operatorcontrolled fluid pressure source, conduits connecting said source tosaid brakes, a normally open valve assembly in the conduit leading tocertain of said brakes, said valve assembly comprising a valve chamberhaving a seat adjacent one end, a valve closure element received in saidchamber for free movement toward and away from said seat, a scissorslinkage comprising a pair of articulated links the free ends of whichare connected, respectively, to said spring suspended axle and to saidbody, means mounting said valve on one of said links to incline saidchamber and to dispose said seat at the upper end thereof whereby saidvalve elements is urged away from said seat by gravity and toward saidseat by inertia when the vehicle is decelerated, said articulatedlinkage being operable to increase the angle of inclination of saidchamber upon an increase in vehicle load.
2. The brake system according to claim 1 wherein said valve assembly iscarried by the link connected to said vehicle axle.
3. The brake assembly according to claim 1 wherein said valve assemblyis carried by tthe link connected to said body.
4. A braking system for use in the vehicle having a body and springsuspended axles carrying front and rear ground engaging wheel sets, eachequipped with a fluid pressure operated brake comprising an operatorcontrolled fluid pressure source, conduits connecting said source tosaid brakes, a normally open valve assembly in said conduit leading toone set of brakes, said valve assembly comprising a valve chamber havinga seat adjacent one end, a valve closure element received in saidchamber for free movement toward and away from said seat, a pair ofarticulated links connected, respectively, to said axle and to saidbody, and means mounting said valve assembly on the one of said linksconnected to said body to dispose said valve element in alignment withthe pivot connecting said one link to said body.
5. The braking system according to claim 4 wherein the pivots connectingthe links to each other, to said body and to said axle compriseresilient shock absorbing blocks to dampen the vibration transmittedfrom said axle assembly to said valve assembly.
6. A braking system for use with a vehicle having a body and springsuspended axles carrying front and rear ground engaging wheel sets, eachequipped with a fluid pressure operated brake, comprising an operatorcontrolled fluid pressure source, conduits connecting said source tosaid brakes, a normally open valve assembly in the conduit leading toone set of brakes, said valve assembly comprising a valve chamber havinga seat adjacent one end, a valve closure element received in saidchamber for free movement toward and away from said seat, a scissorslinkage mounting said valve to incline said chamber and to dispose saidseat at the upper end thereof whereby said valve element is urged awayfrom said seat by gravity and toward said seat by inertia when thevehicle is decelerated, one end of said scissors linkage being connectedto said spring suspended axles and the other end of said scissorslinkage being so arranged as to increase the angle of inclination ofsaid chamber in response to an increase in the vehicle load.
References Cited by the Examiner UNITED STATES PATENTS 2,030,288 2/1936Freeman.
2,241,191 5/1941 Freeman 30324 X 2,876,044 3/1959 Hill 303-24 2,934,3814/1960 Hill 30322 X 3,030,154 4/1962 Hill 30324 X 3,035,870 5/1962Beatty 3036 3,087,761 4/1963 Stelzer 30324 3,140,124 7/1964 Heiland303-6 EUGENE G. BOTZ, Primary Examiner.
1. A BRAKING SYSTEM FOR USE WITH A VEHICLE HAVING A BODY AND SPRINGSUSPENDED AXLES CARRYING FRONT AND REAR GROUND ENGAGING WHEEL SETS EACHEQUIPPED WITH A FLUID PRESSURE OPERATED BRAKE COMPRISING AN OPERATORCONTROLLED FLUID PRESSURE SOURCE, CONDUITS CONNECTING SAID SOURCE TOSAID BRAKES, A NORMALLY OPEN VALVE ASSEMBLY IN THE CONDUIT LEADING TOCERTAIN OF SAID BRAKES, SAID VALVE ASSEMBLY COMPRISING A VALVE CHAMBERHAVING A SEAT ADJACENT ONE END, A VALVE CLOSURE ELEMENT RECEIVED IN SAIDCHAMBER FOR FREE MOVEMENT TOWARD AND AWAY FROM SAID SEAT, A SCISSORSLINKAGE COMPRISING A PAIR OF ARTICULATED LINKS THE FREE ENDS OF WHICHARE CONNECTED, RESPECTIVELY, TO SAID SPRING SUSPENDED AXLE AND TO SAIDBODY, MEANS MOUNTING SAID VALVE ON ONE OF SAID LINKS TO INCLINE SAIDCHAMBER AND TO DISPOSE SAID SEAT AT THE UPPER END THEREOF WHEREBY SAIDVALVE ELEMENTS IS URGED AWAY FROM SAID SEAT BY GRAVITY AND TOWARD SAIDSEAT BY INERTIA WHEN THE VEHICLE IS DECELERATED, SAID ARTICULATEDLINKAGE BEING OPERABLE TO INCREASE THE ANGLE OF INCLINATION OF SAIDCHAMBER UPON AN INCREASE IN VEHICLE LOAD. | 2024-03-22 | 1965-07-29 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1967-01-10"
} |
US-84619386-A | Long-term sustained-release preparation
ABSTRACT
A solid sustained-release preparation in the form of a needle-like or bar-like shape, which consists essentially of an active ingredient and a pharmaceutically acceptable biodegradable carrier (e.g. proteins, preferably collagen, gelatin, and a mixture thereof). The sustained-release preparation can be administered to the body or implanted into the body by injection or an injection-like method and can release the active ingredient at an effective level for a long period of time when administered.
This is a continuation-in-part application of Ser. No. 660,052 filed onOct. 12, 1984, now abandoned.
The present invention relates to a long-term sustained-releasepreparation. More particularly, it relates to a long sustained-releasepreparation in the form of a bar-like or needle-like shaped preparationsuitable for injection or injection-like administration, which comprisesan active ingredient in admixture with one or more of pharmaceuticallyacceptable biodegradable carriers which can be implanted into the body.The preparation of the invention is particularly suitable formedicaments which are unstable to heat.
It is known to prepare a medicament embraced within a polymer, forexample polyethylene glycol diacrylate polymer, and to implant theproduct into the body in order to sustain the release of the medicament.However, such a technique has various problems in that the polymer isnot biodegradable and hence it must be removed by suitable means afteradministration and the implanting must be done by an operation withtroublesome treatment. Nevertheless, it has been desired to make asustained-release preparation of many medicaments.
The present inventors have intensively studied on an improvedsustained-release preparation or medicaments, and have found that thedesired sustained-release preparation can be obtained by admixing anactive ingredient with a specific biodegradable carrier and that theformed product of the preparation in the form of a bar-like orneedle-like shape is very useful for injection or implanting into thebody and can show excellent effect for release-sustaining of the activeingredient.
An object of the present invention is to provide an improvedsustained-release preparation. Another object of the invention is toprovide a long-term sustained-release preparation in the form of abar-like or needle-like shaped preparation which can injected orimplanted into the body and can release the active ingredient and canmaintain the desired level of the active ingredient in blood or inlesional region for a long period of time. A further object of theinvention is to provide a method for preparing the sustained-releasepreparation as set forth above without using any specific binding agentand without heating. A still further object of the invention is toprovide a device for administering a sustained-release preparation inthe form of a needle-like or bar-like shape. These and other objects andadvantages of the present invention will be apparent to persons skilledin the art from the following description.
The sustained-release preparation of the present invention in the formof a bar-like or needle-like shaped preparation consists essentially of(i) an active ingredient in admixture with (ii) one or more ofpharmaceutically acceptable biodegradable carriers which can be absorbedor be subject to enzymolysis in body and can be implanted within thebody. The sustained-release preparation is formed in a bar-like orneedle-like shape and can be injected or implanted into the body.
The active ingredient used in the present invention is not specified,but includes particularly medicaments which are effective in a verysmall amount and in which their activity is promoted by sustainedrelease, and more particularly medicaments which are unstable to heat.Suitable examples of the active ingredient are tissue plasminogenactivator, prostaglandins, prostacyclines, various bio-hormones,interferons, interleukins, tumor necrosis factor, and some othercytokines (e.g. macrophage activating factor, migration inhibitoryfactor and colony stimulating factor). The term bio-hormones meanssubstances which are produced within the living body and regulate thebio-functions, including growth hormone (GH) such as human growthhormone (HGH), bovine growth hormone (bGH) including biosyntheticproduct (B-HGH, etc.); growth hormone releasing factors (GRF) which areknown as peptides consisting of a number of amino acids of 44, 40, 37 or29 (e.g. hGRF(1-44)NH₂, hGRF(1-29)NH₂); somatomedines (SM) such as SM-A,SM-B, SM-C, insulin-like growth factor (IGF)-I, IGF-II, andmultiplication stimulating activity (MSA); and calcitonin (i.e. calciumregulating hormone secreted from the mammalian thyroid gland and innon-mammalian species from the ultimobranchial gland).
Interferon, interleukin, tumor necrosis factor, and some other cytokinesare somewhat different each other, but are common in that they have verysimilar molecular weight, are glycoproteins or proteins and have similarpharmacological and physicochemical properties as those of α-interferonas shown in experiments as disclosed hereinafter. All of these compoundsare prepared in the desired excellent sustained-release preparation ofthe present invention.
The above active ingredients may be used alone or in combination of twoor more thereof.
The biodegradable carrier used in the present invention means a carrierwhich can easily be absorbed or be subject to enzymolysis in body andcan be implanted into the body. Suitable examples of the biodegradablecarrier are proteins such as collagen, gelatin, albumin, or the like.These substances can be used alone or in any combination of two or morethereof, but in view of moldability, collagen or gelatin or a mixturethereof are preferable. Collagen is a protein which is a main protein ofconnective tissue of animals, has less antigenicity, and hence, haswidely been used as a safe operation yarn in various medical operations.The collagen may be an atelocollagen having far less antigenicity whichis obtained by removing the telopeptide region by treating collagen withan enzyme (e.g. pepsin) in order to make it safer. Gelatin is a proteinderived from collagen. Gelatin is a high molecular weight amphotericelectrolyte which has less antigenicity and the properties of beingconvertible between sol and gel forms, is inexpensive, and hence it hasalready been confirmed as a safe substance for medical use.
The medicaments and carriers used in the present invention arepreferably purified products, but commercially available products may beused as purchased. The commercially available medicaments and carrierscontain usually some appropriate additives such as stabilizers andbuffering agents to some extent. For instance, an aqueous collagensolution contains usually a buffer of inorganic or organic salts, suchas a phosphate buffer, citrate buffer or acetate buffer. Commerciallyavailable interferons contain usually sodium chloride and further humanserum albumin, amino acids (e.g. glycine, alanine, etc.), succharides(e.g. glucose, etc.), sugar-alcohols (e.g. mannitol, xylitol, etc.).Other medicaments occasionally contain fetal cow serum, bovine serumalbumin, phosphate buffered saline, Tris, etc. These products may beused as obtained, but in view of release-sustaining properties, it ispreferable to remove such additives or other components.
The preparation of the present invention contains the active ingredientin an amount in which the active ingredient is usually used. Forexample, interferon is usually contained in an amount of 10⁴ to 10⁹ IU,preferably 10⁵ to 5×10⁸ IU per dosage unit.
The ratio of the medicament and the carrier is not specified, but forexample, interferon is preferably incorporated in an amount of 10³ to10⁸ IU per 1 mg of the carrier.
One of the characteristics of the present invention is in that thepreparation can be prepared without using any specific binding agent andfurther without heat treatment through the steps. The preparation is,therefore, particularly suitable for medicaments which are unstable toheat.
The sustained-release preparation of the present invention can beprepared by the following method.
An active ingredient or an aqueous solution thereof is mixed with abiodegradable carrier or an aqueous solution thereof, and the mixture ishomogeneously mixed by stirring while preventing the occurrence of foamas much as possible. By the mixing of the active ingredient and thecarrier in the state of a liquid, the active ingredient is incorporatedinto the carrier matrix. Thereafter, the mixture is dried in order toproduce a shaped product having an enough strength for administering toa living body. The drying method is not specified, but it may be dried,for example, by allowing to stand, or by spray-drying or lyophilization.In addition, the mixture may optionally be concentrated at a lowtemperature before drying, for example, by allowing the solution tostand at room temperature. In the above steps, the mixing step anddrying step are usually carried out at room temperature or lower andoptionaly under cooling. For instance, the mixing step is usuallycarried out at about 5° C. to 30° C.; the drying by lyophilization isusually carried out at -50° C. to 0° C.; and the drying by allowing tostand or by spray-drying is usually carried out at room temperature orlower (i.e. about 15° C. to 30° C.). The spray-dry is usually carriedout by controlling the temperature of the solution and vessel at roomtemperature or lower, by which the temperature of the active ingredientcan be kept at room temperature or lower and hence no damage is causedto the active ingredient even though it is unstable to heat.
The preparation of the present invention preferably consistssubstantially of an active ingredient and a biodegradable carrier. Thatis, when components other than the active ingredient and carrier arepresent in the preparation of the invention, they occasionally promotethe release of active ingredient, and hence, it is preferable not toincorporate such other components as much as possible. However, from thepractical viewpoint, the preparation may contain other componentsoriginating from the commercially available medicaments and carriersunless they substantially affect the release-sustaining properties.Likewise, the preparation of the invention may pharmaceuticallyacceptable conventional stabilizers, preservatives, and local anestheticagents unless they substantially affect the release-sustainingproperties.
The preparation thus obtained is optionally pulverized into powdersunder cooling with dry ice or liquid nitrogen so that the preparation iskept at about -10° C. to about -100° C., or any other conventionalpulverization methods at room temperature or lower temperature. Thepowder is optionally compressed to form some specific shapes, such as aneedle-like or fine bar-like shaped preparation (in case of preparationfor human, diameter: about 0.5 mm-5 mm, preferably 0.5 mm-1.5 mm,length: about 5 mm-50 mm, preferably, 5 mm-15 mm; in case of preparationfor other animals, diameter: about 0.5 mm-10 mm, preferably 0.5 mm-5 mm,length: about 5 mm-100 mm, preferably 5 mm-50 mm), which can be insertedinto a body by operation or with a forceps needle for fiberscope, anindwelling needle, or other appropriate administration device asmentioned hereinafter. Alternatively, the powdery preparation is placedinto a mold, followed by concentrating at a low temperature, asmentioned hereinbefore, or by lyophilizing to compress and form it intoa needle-like or a fine bar-like shaped preparation.
Through all the steps for preparing the desired sustained-releasepreparations, the procedure is carried out under sterilized conditionsbecause the preparations are to be used as an injection or forimplanting into a body.
The long sustained-release preparation of the present invention can beadministered to human patients or other animals such as cattle, sheep,pig, rabbit, hen and cock, and the like by operation or by other variousmethods, for example, by inserting a fine tube into the body at thedesired region with an appropriate means, such as catheter, and theninserting the needle-like shaped preparation of the present invention bypassing through the inside of the fine tube, or by inserting thepreparation of the present invention directly into the body at thelesional region by means of forceps needle of fiberscope.
The present invention provides also an improved device for administeringthe needle-like or bar-like shaped preparation of the present invention.
The device for administration of the sustained-release preparation andadministration manner are explained referring to the accompanyingdrawings.
FIG. 1 shows an embodiment of a device for administering the preparationof the present invention which comprises a fine tube and an innerneedle.
FIG. 2 is an embodiment showing the state that the device as shown inFIG. 1 is stabbed into the body.
FIG. 3 is an embodiment showing the state that a needle-like shapedsolid preparation is administered into the body by the device as shownin FIG. 1.
FIG. 4 shows an embodiment of a needle for administering a needle-likeshaped solid preparation of the present invention wherein the solidpreparation is held.
FIG. 5 is an embodiment showing the state that the needle-like shapedsolid preparation is administered into the body with the administrationneedle as shown in FIG. 4.
FIG. 6 is an embodiment of a needle for administering a needle-likeshaped solid preparation of the present invention which is provided witha removable cover for preventing the held solid preparation from fallingdown.
FIG. 7 is a graph showing the relation of the blood level of an activeingredient and time elapsed after intramuscular administration of thepreparation in rabbits.
The device for administering a needle-like shaped preparation comprises(i) a fine tube and (ii) an inner needle which can freely slide withinthe fine tube.
The fine tube in the above device is a tube having an inner diameter of0.5 to 10 mm which can be inserted partly into a body. The length of thetube is not specified but may be any size convenient for injection, andis usually in the range of 2 cm to 10 cm. The material for preparing thetube may be any kind of material compatible with the body. The innerneedle has a sharp tip as shown in the accompanying FIG. 1 and has anouter diameter as the same as or smaller than the inner diameter of thefine tube.
The device for administering a needle-like shaped preparation is usuallyheld in a holding device (6) in use, but may be used by being held atthe tip of forceps needle of fiberscope.
The administration manner of the needle-like shaped preparation with theabove device is explained in more detail below. Firstly, the innerneedle (1) is stabbed into a portion of the body (2) and simultaneouslythe fine tube (3) is inserted into the body by sliding its inner wallalong the outer wall of the inner needle (1) (cf. the accompanying FIG.2). Thereafter, the inner needle (1) is pulled off, and then theneedle-like shaped preparation (4) is inserted into the body by passingit through the inner slit of the fine tube (3), and finally the finetube is removed. The insertion of the needle-like shaped preparationinto the body is usually carried out by inserting the preparation intothe fine tube after pulling off of the inner needle (1), pushing thepreparation with a pushing pole (5) into the inside of the body (2) (cf.the accompanying FIG. 3). The pushing pole (5) may be any pole which canbe inserted into and can freely slide inside the fine tube (3), and theabove inner needle (1) may also be used as the pushing pole.
In order to insert the preparation of the present invention into a deepregion of the body, i.e. internal organs such as the stomach wall, thedevice for a fiberscope may be used. Easy handling for a fiberscope caneffect procedures such as stabbing of an inner needle, insertion of thefine tube, pulling off of the inner needle, administration of thepreparation and taking off of the fine tube.
The preparation which can be administered by the above device may be anyneedle-like or bar-like shaped preparation which can be inserted andheld within the fine tube (3).
An alternative device for insertion of a needle-like shaped solidpreparation is an injection needle provided with a inner pushing polewhich can smoothly slide within the slit of the needle. The injectionneedle includes the conventional injection needle, and the pushing polehas an outer diameter which is equal to or smaller than the innerdiameter of the injection needle and can push the needle-like shapedsolid preparation having a diameter of 0.5 to 10 mm.
The device for insertion of a needle-like shaped solid preparation maybe held with conventional holding device (7), but may be used by holdingit at the tip of a forceps needle for a fiberscope.
The administration of the needle-like shaped solid preparation of thepresent invention is explained in more detail below.
Initially, the needle-like shaped solid preparation (9) is held withinthe injection needle (8) (cf. the accompanying FIG. 4), the injectionneedle (8) is stabbed into the portion of the body (11) andsimultaneously the preparation is administered into the body (11) bypushing it with a pushing pole (10) (cf. the accompanying FIG. 5). Inorder to administer the preparation to a deep region of the body such asthe stomach wall, it may be administered with a fiberscope as mentionedabove. In such a case, to prevent the preparation from falling out ofthe needle, it is preferable to provide a removable cover (12) at thetip of the needle (cf. the accompanying FIG. 6). The solid preparationuseful for the above administration may be in any form such asneedle-like or bar-like shape which can be held in a conventionalinjection needle.
As explained above, according to the device for injection of the presentinvention, the preparation of the present invention can easily beadministered, for example, into internal organs with a fiberscope, andsystematically or topically at the body surface by operation or with adevice or needle as mentioned above. These methods are practically andclinically very useful, and it is a novel idea that a biodegradablesolid preparation is administered in the above-mentioned manner.
The present invention is illustrated by the following Experiments andExamples, but should not be construed to be limited thereto.
EXPERIMENT 1
There were used as the test samples a needle-shaped preparation ofα-interferon-collagen prepared in Example 1 disclosed hereinafter(Sample A) and a reference (an aqueous injection of α-interferonoriginated from Namalwa cells). The test samples were each administeredintramuscularly to rabbit, and the change of level in blood of theactive ingredient with lapse of time was measured by RIA(radioimmunoassay) method. Two rabbits were used for each sample, andthe test samples were each administered in a dose of 10⁶ U/kg. The bloodlevel is shown as an average in two rabbits.
The results are shown in the accompanying FIG. 7. In FIG. 7, is thegraph of Sample A, and is that of reference (α-interferon aqueousinjection). As is clear from the figure, the Sample A showedrelease-sustaining properties, and even after 48 hours, the blood levelof several tens unit/ml was maintained.
Thus, it is suggested by in vivo tests using rabbits that thepreparation of the present invention is useful clinically.
EXAMPLE 1
An aqueous solution of α-interferon (titer: 4.9 MU/ml) (100 ml) and 2 %atelocollagen (50 g) are homogeneously mixed with stirring whilepreventing occurrence of foam as much as possible. The mixture islyophilized and pulverized at a low temperature using liquid nitrogen.The pulverized product thus obtained is formed under compression to givea needle-shaped sustained-release preparation (A) wherein interferon iscontained in an amount of 10 MU per 1 needle.
EXAMPLE 2
A commercially available aqueous solution of α-interferon (α-interferontiter 4.9 MU/ml, human serum albumin 1.5 mg/ml) (100 ml) and 2 %atelocollagen (50 g) are homogeneously mixed while preventing occurrenceof foam as much as possible. The mixture is lyophilized and pulverizedat a low temperature using liquid nitrogen. The pulverized product thusobtained is subjected to compression molding to give a needle-likeshaped sustained-release preparation (Sample B) wherein interferon iscontained in an amount of 10 MU per 1 needle.
EXAMPLE 3
An aqueous solution of α-interferon (titer, 4.9 MU/ml) (100 ml) and 2 %collagen (50 g) are homogeneously mixed while preventing occurrence offoam as much as possible. The mixture is lyophilized and pulverized at alow temperature using liquid nitrogen. The pulverized product thusobtained is subjected to a compression molding to give a bar-like shapedsustained-release preparation (Sample C) wherein interferon is containedin an amount of 5 MU per 1 bar.
EXAMPLE 4
An aqueous solution of α-interferon (titer, 4.9 MU/ml) (100 ml) andatelocollagen powder (1 g) are mixed and the mixture is dissolved byadding thereto 0.1 N hydrochloric acid, and the resulting solution isentered into a mold and lyophilized. The lyophilized product is formedunder compression to give a needle-shaped sustained-release preparation(Sample D) wherein interferon is contained in an amount of 10 MU per 1needle.
EXAMPLE 5
B-HGH (biosynthetic human growth hormone containing glycine 800 mg) (100IU) is dissolved in 10 % aqueous gelatin solution (3 ml). The mixture islyophilized and pulverized at a low temperature using liquid nitrogen.The pulverized product is compressed in a mold to give a needle-likeshaped, sustained-release preparation.
EXAMPLE 6
hGRF(1-29)NH₂ (i.e. human growth hormone-releasing factor) (1 mg) isdissolved in 2 % aqueous atelocollagen solution (2 ml). The mixture islyophilized and pulverized at a low temperature using liquid nitrogen.The pulverized product is compressed in a mold to give a bar-likeshaped, sustained-release preparation.
EXAMPLE 7
Gelatin (10 g) is dissolved in distilled water (100 ml). To the solution(5 ml) is added IGF-1 (insulin-like growth factor-1) (20 mg), and themixture is lyophilized and pulverized at a low temperature using liquidnitrogen to obtain a powder. The powdery product is compressed in a moldto give a needle-like shaped, sustained-release preparation.
EXAMPLE 8
Collagen (10 g) is dissolved in an aqueous solution (100 ml) containing1×10⁵ U of human GM-CSF (granulocyte-macrophage-colony stimulatingfactor), and the solution is lyophilized and pulverized at a lowtemperature using liquid nitrogen. The pulverized product is compressedin a mold to give a bar-like shaped sustained-release preparation.
What is claimed is:
1. A method for the preparation of a solidsustained-release preparation, which comprises mixing under aqueousconditions a physiologically active ingredient that is unstable to heatand a pharmaceutically acceptable biodegradable protein carrier toincorporate the active ingredient in a carrier matrix to a degreesufficient to provide sustained-release properties; drying the resultingmixture; and then forming the dried material into the form of aneedle-like or bar-like shape.
2. The method according to claim 1,wherein said biodegradable carrier is collagen, atelocollagen orgelatin.
3. The method according to claim 2, wherein said biodegradablecarrier is collagen.
4. The method according to claim 1, wherein saidactive ingredient is a member selected from the group consisting oftissue plasminogen activator, prostaglandins, prostacyclines,bio-hormones, interferons, interleukins, tumor necrosis factor and othercytokines.
5. The method according to claim 1, wherein said activeingredient is a member selected from the group consisting ofinterferons, interleukins, tumor necrosis factor, growth hormone, growthhormone releasing factor, somatomedines, calcitonin, macrophageactivating factor, migration inhibitory factor, and colony stimulatingfactor.
6. The method according to claim 1, wherein said mixing isconducted at a temperature of from 5° to 30° C.
7. The method accordingto claim 1, wherein said drying is conducted at a temperature of from15° to 30° C.
8. The method according to claim 6, wherein said drying isconducted at a temperature of from 15° to 30° C.
9. The method accordingto claim 1, wherein said drying is performed by lyophilization at atemperature of from -50° C. to 0° C.
10. The method according to claim9, wherein the product obtained from said lyophilization is subjected topulverization at a temperature of from -100° C. to about roomtemperature.
11. The method according to claim 4, wherein saidbiodegradable carrier is collagen.
12. The method according to claim 5,wherein said biodegradable carrier is collagen.
13. The method accordingto claim 6, wherein said biodegradable carrier is collagen.
14. Themethod according to claim 7, wherein said biodegradable carrier iscollagen.
15. The method according to claim 8, wherein saidbiodegradable carrier is collagen.
16. The method according to claim 1,wherein said sustained-release preparation is prepared without the useof any binding agent.
17. The method according to claim 3, wherein saidsustained-release preparation is prepared without the use of any bindingagent.
18. The method according to claim 8, wherein saidsustained-release preparation is prepared without the use of any bindingagent.
19. The method according to claim 10, wherein saidsustained-release preparation is prepared without the use of any bindingagent.
20. The method according to claim 14, wherein saidsustained-release preparation is prepared without the use of any bindingagent. | 2024-03-22 | 1986-03-31 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1988-09-27"
} |
US-43381574-A | Preset counter apparatus
ABSTRACT
The specification discloses a preset counter apparatus comprising a comparator circuit for producing a first control signal when a value to be compared is smaller than a reference value and producing a second control signal when said value to be compared is equal to or greater than said reference signal, a control means actuated by said second control signal from said comparator circuit to control operation of a utilization machine, a preset means to preset a preselected number of said machine operations and supply said preset information to said comparator circuit as said reference value, means operatively interlocked with said machine operations to generate signals representative of said operations, a counter circuit to count said operation representing signals and apply the count information thereof to said comparator circuit as said value to be compared with said reference value, and a start signal means to supply a machine operation start signal to said counter circuit. The counter circuit is so arranged as to usually hold therein said preset information from said preset means and, upon application of a signal from said start signal means, to clear said preset information and begin to count the number of signal from said operation representing signal means starting from zero state. Further, the counter circuit, upon beginning said count, being maintained in the state in which said preset information is cleared by means of said first control signal from said comparator circuit and, upon receiving said second control signal from said comparator circuit, being restored to said usual state, and at the same time resetting said start signal means to the original state before the operation was initiated.
United States Patent Kamiyama May 27, 1975 PRESET COUNTER APPARATUSsignal when said value to be compared is equal to or greater than saidreference signal, a control means ac- [75] lnvemor' Immnsu Kamyama'Tokyo Japan tuated by said second control signal from said compar- {73}Assignee: Konishiroku Photo Industry Co., ator circuit to controloperation of a utilization ma- Tokyo, Japan chine, a preset means topreset a preselected number {22] Filed. Jan 16 1974 of said machineoperations and supply said preset information to said comparator circuitas said reference [2]] Appl. No.: 433,815 value, means operativelyinterlocked with said machine operations to generate signalsrepresentative of [30] Foreign Application Priority Data saidoperations, a counter circuit to count said operation representingsignals and apply the count informa- Jan. 18, i973 Japan 48-7389 tionthereof to Said Comparator circuit as Said value to be compared withsaid reference value, and a start sig- [52] 235/92 gg?5 g 5 nal means tosupply a machine operation start signal Cl t l t. 5 l] Int. Cl. "03k21/36; G03b 27/06 to i [58] Field of Search 235/92 CA, 92 PD 92 SB Thecounter circuit is so arranged as to usually hold 235/92 PE, 132 E;355]4 therein said preset information from said preset means and, uponapplication of a signal from said start signal [56] Reierences Citedmeans, to clear said preset information and begin to count the number ofsignal from said operation 3 682 544 Z I PATENTS 355 14 representingsignal means starting from zero state. 336861483 831972unii'ilagiiip....111111111111111'555,92 $11 Further, the circuituponbeginning said Primary Examiner-Joseph M. Thesz, Jr. Attorney, Agent, orFirmJames E. Nilles [57] ABSTRACT i TSIGNA L J" l COUNTER count, beingmaintained in the-state in which said preset information is cleared bymeans of said first control signal from said comparator circuit and,upon receiving said second control signal from said comparator circuit,being restored to said usual state, and at the same time resetting saidstart signal means to the original state before the operation wasinitiated.
6 Claims, 3 Drawing Figures COMPARE SHEU PATENTEmmzmzs m 0E UU llm kd528 r 1 I 1 i I l 1 1 1 A omomobooomovom 900 PRESET COUNTER APPARATUSBACKGROUND OF THE INVENTION The present invention relates to animprovement of a preset counter.
In a conventional preset counter such as, for example, a copy counter of:1 copying machine as shown in FIG. 1, a signal generator I is providedwhich is interlocked with copying operations or movements of the machinesuch as the rotation of a photo-printing drum or the like to produce asignal representing the machine operation for every copying cycle, whichsignal is sequentially counted or accumulated by a counter circuit 2. Apreset means 3 in which a predetermined number of sheets to be printedis preset is also provided. The count information from the countercircuit 2 and the present count information from the preset means 3 areboth applied to a coincidence circuit 4 which, upon detection ofthecoincidence between the above count informations, produces an output tostop the further operation of the copying machine by means of a controlmeans 5. Accordingly, in case several pulses representative ofcorresponding times operations of the copying machine have been enteredinto the counter circuit 2 for a relatively short time interval or ifthe preset means 3 is inadvertently actuated just before the occurrenceof the coincidence to thereby reduce the initially set predeterminednumber of counts, it becomes impossible to detect the coincidence in thecircuit 4, so that the copying machine continues to operate beyond thepreset number of cycle. Further, because the arrangement is made suchthat a signal produced by a start signal means 6 in response to theactuation of a printing push button to inform the initiation of thecopying operation is applied directly to the coincidence detectorcircuit 4, there arises a possibility that the machine may operateerroneously if noise is mixed to the start signal. Besides, when thesystem is in the preset state that the machine is in an unoperation, thecounter circuit 2 steadily remains in the zero state. For this reason, acount information display means 7 to indicate the count state of thecounter circuit 2 can not be utilized to display the preset countinformation. Those are disadvantages of the hitherto known counterapparatus for the copying machine.
An object of the present invention is to provide an improved presetcounter apparatus from which the disadvantages of the conventionalcounter such as above mentioned are eliminated.
Another object of the invention is to provide a counter apparatus whichassures the correct operation of the utilization apparatus such as acopying machine nevertheless of possible accidental erroneous operationsor actuations of counters.
Further object of the invention is to provide an improved counterapparatus wherein the application of the start signal is effectedindependently from the comparator or coincidence circuit for whichaccurate operation is inherently required, whereby the possibleerroneous operations caused by noises can be inhibited.
The above and other objects, features and advantage will become apparentfrom the following description of a preferred embodiment of theinvention. The description makes reference to the drawing.
BRIEF DESCRIPTION OF DRAWING FIG. 1 is a schematic block diagram toillustrate the operation of a hitherto known counter apparatus;
FIG. 2 is a schematic block diagram of a preset counter apparatusaccording to the invention:
FIG. 3 is a diagram of an electric circuit corresponding to the blockdiagram shown in FIG. 2.
DETAILED DESCRIPTION OF THE INVENTION In FIG. 2, the same referencenumerals as those used in FIG. 1 denote the same or equivalentcomponents. According to the invention, the count information from acounter circuit 2 is applied to a comparator circuit 8 along with thepreset information from a preset means 3. The comparator circuit 8 is soconstructed as to produce a first control signal when the value to becompared (count information) is smaller than a reference value (presetinformation) and produce a second control signal when the former valueis equal to or greater than the reference value. Those two controlsignals are fed back to the counter circuit 2 and at the same timeapplied to a control means 5. The copying machine is maintained in thenon-operative or stationary state only when the second control signalappears.
The arrangement of the counter circuit 2 as well as the operatingrelations between the circuit 2 and the preset means 3, comparatorcircuit 8 and the start signal means 6 are as follows. The countercircuit 2 will usually hold or store therein the preset information.However, when the signal from the start signal means 6 is applied, thecounter circuit 2 is reset to clear the preset information and begins tocount the signal pulses from the operation signaling means 1 startingfrom the zero state. Additionally, when the counter circuit 2 has begunto count, the first control signal from the comparator 8 will hold thecircuit 2 in the state in which the preset information is cleared. Thesecond control signal from the comparator circuit 8 will restore thecounter circuit 2 to the usual state storing the preset information andreset the start signal means 6 to the original state before theactuation.
In copying operation, when the preset means 3 is set to the countcorresponding to a selected number of copying sheets, the presetinformation thereof is fed to the comparator circuit 8 and the countercircuit 2. In this manner, the counter circuit 2 conveys the presetnumber of sheets to the count information display means 7 and thecomparator circuit 8. Thus, the count information display means 7 candisplay the preset number of sheets as it is.
Because, at this time point, the value to be compared from the countercircuit 2 becomes equal to the reference value from the preset means 3,the comparator circuit 8 will produce the second control signal which isthen applied to the control means 5 to hold the copying machine in thestop or stationary state.
On the other hand, the second control signal is fed back to the countercircuit 2, whereby the latter circuit 2 is held in the state storing thepreset information therein. Operation of the apparatus is as following.The copying machine is actuated by pushing the printing button or thelike, thereby the start signal means 6 will respond thereto and producethe start signal. At the same time, the operation signaling means 1supplies the operation-representing-signal to the counter circuit 2, asa result of which the latter is reset to clear the stored presetinformation and begins to count the signal from the operation signalingmeans 1 starting from the zero state. The comparator circuit 8 as wellas the display means 7 then receive corresponding count information fromthe circuit 2.
So far as the value to be compared (count information) is smalier thanthe reference value (preset information), the comparator circuit 8produces the first control signal which is applied to the control means5 and the counter circuit 2. The copying machine thus continues toremain in the operating state. At this time point, the counter circuit 2is held by the first control signal in the state in which the presetinformation is cleared and hence the comparator circuit 8 can continueto perform its comparison operation, while the count information displaymeans 7 continues to display successively the current number of copiedor printed sheets. However, when the value to be compared becomes equalto the reference value as the copying operation proceeds, that is, whenthe number of the copied sheets has attained the predetermined number,the comparator circuit 8 will produce the second control signal in placeof the first control signal, as a result of which the operation of thecopying machine is stopped by means of the control means 5. The countercircuit 2 is then reset to the state in which the preset information isplaced thereinv The display means 7 also turns to the state to displaycontinuously the preset information. In other words, when the number ofsignals from the operation signaling means 1 has attained thepredetermined number, the counter circuit 2 will at first feed the countinformation based on said number to the comparator circuit 8. However,if the second control signal is supplied from the comparator circuit 8,the counter circuit 2 will then immediately supply the presetinformation from the preset means 3 to the compar ator circuit 8 and thecount information display means 7, the latter then being caused torestore the original state before the initiation of the copyingoperation.
In case the preset means 3 is erroneously actuated in advertently duringthe copying operation and the preset value is altered to the number lessthan the number of sheets which have been already printed, the value tobe compared (count information) becomes greater than the reference value(preset information). The comparator circuit 8 then immediately producesthe second signal to convey the operation stop command to the copyingmachine. In this manner, the copying machine can be restored to theoriginal state before the initiation of the copying operation.
In the illustrated embodiment, the preset counter apparatus has beenshown and described as applied to the copying machine. However. itshould be appreciated that the counter apparatus according to thepresent invention can be used for many other machines and apparatus.Furthermore, it is not always necessary to restrict the relation betweenthe actuation signal and the count information to one-to-onecorrespondence. It is of course possible to employ the correspondencerelation of a single information for plural times of actuations oroperations The counter apparatus according to the present in ventionpresents following advantages:
:1. Even if the counter is accidently erroneously oper ated, suchundesirable condition that the utilization apparatus or machine wouldnot be stopped can be effectively evaded.
h. The application of the start signal is effected inde pendently fromthe comparator circuit, whereby the erroneous operation possibly causedby noises can be excluded.
c. By connecting the count information display apparatus directly to thecounter circuit as is in the case of the illustrated embodiment, thepreset number can be displayed before or after the operation of themachine, while, during operation, the value corresponding to the numberof the operations or actuations of the machine can be continuouslydisplayed.
While the invention has been described with reference to a preferredembodiment, it should be apparent for those skilled in the art that manychanges and modifications may be made in the form of the inventionwithout departing from the scope and spirit thereof.
As hereinbefore explained, the present invention relates to a presetcounter for a copying machine using TTL (transistor transistor logic)components, DTL (diode transistor logic) components as digitalintegrated circuits and relays. In the integrated circuit for thecounter of the present invention, not only the TTL and DTL components,but also a digital [C (integrated circuit) component for sequenceoperation can be employed, such as P'MOS, N'MOS and C'MOS devices. Thecopying machine includes a conventional high voltage source and AC motoroperated thereby, so that many kinds of electrical noises are generatedtherein. Further, the preset value on the copy dial may he often alteredby the operator during copying operations. According to the copy counterof the present invention, the copying machine can be operated accuratelyeven if the electric noises are generated and the preset value isaltered.
An embodiment of the present invention using widely known types ofdigital IC components is shown in the attached FIG. 3. The portions ofthe circuit designated 1, 2, 3, 5, 6, 7 and 8 in FIG. 2 of theapplication drawing are designated by same numerals in FIG. 3. Theadditional reference numerals referred to hereinafter are shown in FIG.3.
In FIG. 3, a normally closed contact P is shown closed, so that avoltage is applied to the base of a transistor 18 and the collectoroutput 13 thereof is at low level. Accordingly, an output line 14 ofaNAND device 21 becomes high level and an output line 15 connected to aload terminal of the counter 2 through an inverter 31 becomes low level.This results in the counter 2 being in a preset state, so that thecounter indicates the preset value of the copy dial.
As stated above, the indication of the counter coincides with the presetvalue and therefore the compara tor 8 to which the indication of thecounter and the preset value are applied as inputs produces an output ofXnFH, Y =H and Y =H as a coincident output. Accordingly, one of theinput gates of the NAND device 21 becomes low state H" indicates highlevel," and L" indicates low level."
When a copy button switch SW is pushed in order to start the copyingoperation, a relay P is actuated, thereby operating the contact P toopen and the gate 13 of the NAND device 2] becomes high level. At thesame time, a normally open contact P of the relay P is closed and adifferential pulse generated by an RC circuit in an input circuit of atransistor 16 is applied to the base of the transistor 16. Accordingly,a low level pulse appears on the collector ll of the transistor 16which, in turn, is changed to a high level pulse by an inverter andapplied to a clear terminal of the counter 2 in order to clear it.
In this case, the required counter integrated circuits must be of a typein which the clear terminal is superior to the load terminal, and TexasInstrument type SN 74192 integrated circuits (synchronous 4-bit up/downcounters having dual clock with clear) were found to be suitabledevices. When the counter 2 output is cleared, the preset 3 valuebecomes larger than the counter 2 output, both being applied to thecomparator 8, so that the comparator output of X H, Y =L and Y =L isgenerated. Because the inputs to the NAND device 21 all become highlevel, the output line 14 becomes low level and the preset command ofthe counter 2 is cancelled. An output 22 through an m verter 30 becomeshigh level and is applied to the base of a transistor 23 in order toactuate it so that the relay P is held in the ON state.
Because the preset state of the counter 2 is cancelled. the counter 2 isoperated to count the number of copies and the function of theindicating portion is changed from the preset value indicating state tothe count value indicating state.
When the copying operation of the machine is started, electric signalsgenerated each time a copy is made, for example, by a cam in associationwith the machine and responsive to operation thereof are applied to aninput terminal 24 of the counter 2 and a low level pulse is generated atthe collector of a transistor 17 which in turn is applied to an upcounter terminal 25 of the counter 2 through a hysteresis circuit inorder to count a copy number.
When the copy number is increased and coincides with the preset value ofthe copy dial, the comparator 8 produces an output of Xm H, Y =H andY,=H, so that the output of a NAND device 19 becomes low level, theoutput 14 of the NAND device 21 becomes high level and the output of theinverter becomes low level, so that the transistor 23 and output relay Passume an OFF state. Further, the contact P returns to closed state andthe gate 13 of the NAND device 21 is locked at low level. Therefore,even if the spike noise is applied from the outside to the clearterminal of the counter 2 so as to clear the counter in the stop mode ofthe machine. the counter is preset soon and stabilized.
As FIG. 3 shows, the components in preset 3 may take the form, forexample, of four HD2204 dual 4- input NAND/NOR Gate devices and fourtype HD2202 Dual 4-lnput Expander devices, such devices being availablefrom Hitachi, Ltd, Tokyo, Japan, 6-2.2- chome. Otemachi, Chiyoda, Tokyoltltl.
As FIG. 3 further shows, the comparator 8 may employ Type DMSZOU 4-bitintegrated circuit compara- 6 tors available from National SemiconductorCorpora tion, Santa Clara, Calif. 95015.
As FIG. 3 shows, counter 2 may employ Type SN74l92 synchronous 4-bitup/down controls (dual clock with clear) available from TexasInstruments, lncorporated, Post Office Box 5012, Dallas, Tex. 75222.
What we claimed is:
l. A preset counter apparatus comprising a comparator circuit forproducing a first control signal when a value to be compared is smallerthan a reference value and producing a second control signal when saidvalue to be compared is equal to or greater than said reference signal.a control means actuated by said second control signal from saidcomparator circuit to control operation of a utilization machine, apreset means to preset a preselected number of said machine operationsand supply said preset information to said comparator circuit as saidreference value, means operatively interlocked with said machineoperations to generate signals represetative of said operations, acounter circuit to count said operation representing signals and applythe count information thereof to said comparator circuit as said valueto be compared with said reference value, and a start signal means tosupply a machine operation start signal to said counter circuit, whereinsaid counter circuit is so arranged as to usually hold therein saidpreset information from said preset means and, upon application of asignal from said start signal means, to clear said preset informationand begin to count the number of signal from said operation representing signal means starting from zero state, said counter circuit,upon beginning said count, being maintained in the state in which saidpreset information is cleared by means of said first control signal fromsaid comparator circuit and, upon receiving said second control signalfrom said comparator circuit, being restored to said usual state, and atthe same time resetting said start signal means to the original statebefore the operation was initiated.
2. Preset counter apparatus according to claim I, wherein saidutilization machine is a copying machine.
3. Preset counter apparatus according to claim 2, wherein said operationsignal means produces said operation representing signal for everyrotation of a photo-printing drum of said copying machine.
4. Preset counter apparatus according to claim 1, wherein said controlmeans is operative to stop the operation of said utilization machine.
5. Preset counter apparatus according to claim 1, further comprising acount information display means connected to said counter circuit.
6. Preset counter apparatus according to claim I, fur ther comprising apushbutton switch for stopping the copy operation at any time.
1. A preset counter apparatus comprising a comparator circuit forproducing a first control signal when a value to be compared is smallerthan a reference value and producing a second control signal when saidvalue to be compared is equal to or greater than said reference signal,a control means actuated by said second control signal from saidcomparator circuit to control operation of a utilization machine, apreset means to preset a preselected number of said machine operationsand supply said preset information to said comparator circuit as saidreference value, means operatively interlocked with said machineoperations to generate signals represetative of said operations, acounter circuit to count said operation representing signals And applythe count information thereof to said comparator circuit as said valueto be compared with said reference value, and a start signal means tosupply a machine operation start signal to said counter circuit, whereinsaid counter circuit is so arranged as to usually hold therein saidpreset information from said preset means and, upon application of asignal from said start signal means, to clear said preset informationand begin to count the number of signal from said operation representingsignal means starting from zero state, said counter circuit, uponbeginning said count, being maintained in the state in which said presetinformation is cleared by means of said first control signal from saidcomparator circuit and, upon receiving said second control signal fromsaid comparator circuit, being restored to said usual state, and at thesame time resetting said start signal means to the original state beforethe operation was initiated.
2. Preset counter apparatus according toclaim 1, wherein said utilization machine is a copying machine. 3.Preset counter apparatus according to claim 2, wherein said operationsignal means produces said operation representing signal for everyrotation of a photo-printing drum of said copying machine.
4. Presetcounter apparatus according to claim 1, wherein said control means isoperative to stop the operation of said utilization machine.
5. Presetcounter apparatus according to claim 1, further comprising a countinformation display means connected to said counter circuit.
6. Presetcounter apparatus according to claim 1, further comprising a pushbuttonswitch for stopping the copy operation at any time. | 2024-03-22 | 1974-01-16 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1975-05-27"
} |
US-54199875-A | Process for making sectionalized precision components
ABSTRACT
A process for fabricating precision components of the type including at least one member which is of a sectionalized construction comprising a plurality of assemblable mated sections. The sectionalized member is produced from a plurality of preliminarily formed sections which are adhesively secured into a bonded assembly which is finish machined as a unit, whereafter the bonded assembly is cleaved to provide a matched set of sections for use in the final assembly of the component.
CROSS REFERENCE TO RELATED APPLICATIONS
This application comprises a continuation-in-part of copendingapplication Ser. No. 444,120, filed Feb. 20, 1974, for "Process forMaking Split-Ring Ball Bearings", now U.S. Pat. No. 3,871,093.
BACKGROUND OF THE INVENTION
The present invention is particularly applicable but not necessarilylimited to the manufacture of split shell bearings, self-aligningbushings and precision split-ring ball bearing assemblies of the angularcontact type incorporating either a single or plural rows of balls andwhich are particularly adapted for carrying thrust loads, as well asradial loading. Of the foregoing, split-ring ball bearings are suitablefor use in turbine engines, torque converters, machine tool spindles,deep well pumps and various high load and/or high speed applicationsrequiring precision performance under conditions in which a combinationof radial and thrust loads are encountered. The bearing is alsoapplicable for use in non-precision applications, such as in conveyors,for example, in which greater latitude in the dimensional tolerances ofsuch bearings can be tolerated. In either event, it is conventional inbearings of the foregoing type to split either the inner or outer raceor ring member to enable an assembly of the maximum number of balls orantifriction elements, thereby optimizing the load carrying propertiesand durability of the bearing.
It has been conventional in accordance with prior art practices formanufacturing split-ring bearing assemblies to manually inspect themachined ring sections comprising each split race member in an effort toachieve a substantially identical set of mated ring sections. In spiteof the use of modern precision machining techniques, it is ordinarilyimpossible to effect a mating of identical ring sections, whichnecessitates a further final finishing such as by grinding of thepreliminarily mated ring set. Conventionally, the ring sets are mountedon suitable fixtures and are clamped thereon using a spacer, such as aprecision shim, between the abutting faces of the ring sections. Thepreliminarily matched set thereafter is processed together through allof the final finishing operations including race grinding, landgrinding, bore honing, radial clearance measurements, outer ring mating,washing and final packaging. During such processing, the ring sectionsare held together by various special fixtures, metal straps and wires,in order to permit the necessary finishing operations to be performedand which usually require a removal and remounting or retying on passingfrom one operation to the next operation. The foregoing tedious, timeconsuming and costly manufacturing operation is necessary since theindividual ring sections comprising the split or sectionalized ringmember must be as symmetrical and as identical to one another aspossible in order to provide for optimum load carrying capacity,performance and durability.
In spite of the painstaking inspection and measurements made ofindividual ring sections in an attempt to form matched sets andthereafter the concurrent processing of such sets while positioned onelaborate fixtures, the resultant sectionalized race members producedstill are not exactly identical due to the geometric variations thatinherently exist in randomly and separately manufactured components,which in turn prevents the attainment of optimum functional propertiesof the final bearing assembly.
The foregoing enumerated problems associated with the manufacture ofprecision split-ring bearing assemblies are also present in themanufacture of a variety of precision components of the type includingat least one member which is of a sectionalized construction comprisedof a plurality of assemblable mated sections which heretofore haverequired the careful match-mating of individual sections. Exemplary ofthe foregoing are split thick-walled shell or sleeve bearings andbushings, as well as self-aligning bushings, the latter comprising abushing member having a spherical periphery slidably disposed within ahousing having a conforming spherical seat to permit relative movementtherebetween.
In an attempt to overcome the foregoing problems associated with themanufacture of precision sectionalized components, it has heretoforebeen proposed to machine the precision components as an integral unit orto weld the individual sections together to form an integral unit andafter the completion of the precision machining operation, to cut orsever the integral components into the separate sections. The foregoingpractices have not received widespread commercial acceptance for anumber of reasons, not least of which is the cost associated with thecutting or severing operations, as well as the damage or distortion thatis sustained by the separated sections as a result of the separationprocess.
The present invention overcomes the problems and disadvantagesassociated with prior art manufacturing processes of precisioncomponents, providing not only a precision mating of individualsections, but also providing for a substantial simplification andreduction in costs heretofore associated with such manufacturingoperations.
SUMMARY OF THE INVENTION
The benefits and advantages of the present invention are achieved by aprocess for fabricating precision components or parts whichconventionally comprise a plurality of members, of which at least one isof a split or sectionalized construction comprised of a plurality ofmatched sections. The individual sections are separately manufactured towithin normally broad tolerances, and whereafter a random selection andmating of the individual sections is effected and the resultant set isadhesively secured together into a bonded assembly. The resultant bondedassembly is processed as in the case of integral members to effect afinal accurate finishing and grinding of the surfaces thereof, includingany bores, lands and shoulders, for example, thereby automaticallyproducing a perfectly matched set of sections. Thereafter, the adhesivebond is cleaved, enabling a separation of the individual sectionspreparatory to their assembly with any other parts to form the assembledprecision component.
Additional benefits and advantages of the present invention will becomeapparent upon a reading of the description of the preferred embodimentstaken in conjunction with the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 is a transverse vertical sectional view of a typical angularcontact ball bearing having a split inner ring member adapted formanufacture in accordance with the practice of the present invention;
FIG. 2 is a fragmentary sectional view of the ball bearing shown in FIG.1 having imposed thereon a thrust load in one direction;
FIG. 3 is a fragmentary sectional view similar to FIG. 2 showing theball bearing having a thrust load imposed thereon in a directionopposite to that shown in FIG. 2;
FIG. 4 is a fragmentary elevational view, partly in section, of a splitinner ring assembly bonded by an adhesive preparatory to a finishgrinding of the raceway;
FIG. 5 is a fragmentary elevational view, partly in section,illustrating the grinding of a split inner ring in accordance with priorart practices;
FIG. 6 is an end elevational view of a split flanged thick-wall shellbearing adapted for manufacture in accordance with the practice of thepresent invention;
FIG. 7 is a side view of the bearing shown in FIG. 6;
FIG. 8 is a perspective view of one preliminarily machined shell sectionof the bearing shown in FIG. 6;
FIG. 9 is an end elevational view of an adhesively-bonded assemblycomprising two of the shell members shown in FIG. 8 preparatory to thefinal precision machining operations;
FIG. 10 is a longitudinal vertical sectional view through aself-aligning spherical bushing as taken along the line 10--10 of FIG.11, which also can advantageously be manufactured in accordance with thepractice of the present invention;
FIG. 11 is an end elevational view of the self-aligning bushing andsurrounding housing shown in FIG. 10;
FIG. 12 is a fragmentary side elevational view of the housing of theself-aligning bushing shown in FIG. 10, which has been adhesively bondedso as to enable final finishing of the inner spherical surface thereof;and
FIG. 13 is a vertical longitudinal sectional view of an adhesivelybonded housing assembly of an alternative satisfactory sectionalizedconstruction from that shown in FIGS. 10-12.
DESCRIPTION OF THE PREFERRED EMBODIMENTS
Referring now in detail to the drawings, and as may be best seen inFIGS. 1-3, an angle contact ball bearing assembly, indicated at 10, isillustrated incorporating a split inner ring member which is typical ofthose suitable for manufacture in accordance with the process of thepresent invention. As shown, the ball bearing assembly comprises anouter ring or raceway member 12 incorporating an annular raceway 14 andan inner split-ring or raceway member 16 comprised of a pair of matedring sections 18 and 20. The ring section 18 defines an arcuate raceway22, while the ring section 20 defines a corresponding raceway 24, whichin combination with the raceway 14 of the outer ring member serve toretain a plurality of antifriction elements, such as balls 26, incircumferentially spaced relationship therealong.
In order to achieve optimum load carrying capacity, performance anddurability of such split-ring bearings, it is important that certaindimensional relationships between the two ring sections 18, 20 be asidentical as possible. In the exemplary split-ring member 16 illustratedin FIG. 1, the ring sections are symmetrical such that the followingimportant dimensions should be substantially identical: bore B₁ = B₂ ;land diameter H₁ = H₂ ; race diameter D₁ = D₂ ; race radius r₁ = r₂ ;rest angle θ₁ = θ₂ and axial offset of the center of raceway curvaturewith respect to the center line of the raceway e₁ = e₂.
By maintaining an accurate mating of the two ring sections, theimposition of thrust loading on the bearing in either direction asillustrated in FIGS. 2 and 3 by the arrows causes a slight axial offsetof the inner and outer race members such that the actual angle ofcontact of the balls 26 are equal (β₁ = β₂). In the specific embodimentillustrated, the raceway of the inner ring member as defined by races 22and 24 of the ring sections is of a gothic arch configuration, while theraceway 14 of the outer ring member is of a uniform radius concentricwith that of the periphery of the balls 26. It will be appreciated thatthe magnitude of offset (e₁, e₂) can vary to provide any desirednegative race radius offset, as well as any desired positive value andcan also be different for each ring section in order to optimize theperformance of the bearing consistent with its intended end use. It willbe further understood that the process as subsequently to be describedis also applicable to bearings in which the outer ring member is splitor of a sectionalized construction in addition to bearings includingdouble or plural rows of antifriction elements, as well as a pluralityof individual split-ring bearings mounted in tandem relationship toprovide the necessary load carrying capacity.
In accordance with the present process, the individual ring sections arepreliminarily machined in accordance with conventional machiningpractices to dimensional tolerances within several thousandths of aninch and are thereafter selected at random and mated into preliminarysets. The ring sets are thereafter adhesively secured into a bondedassembly 27 by means of an adhesive layer, indicated at 28 in FIG. 4,applied between the abutting faces 30, 32 of preliminarily machined ringsections 18', 20'. It is usually preferred to remove any cutting oils,lubricants or other residual contaminating substances from the abuttingfaces 30, 32 to assure the attainment of a uniform and high strengthadhesive bond. The adhesive layer 28 is applied in the form of a thinfilm having a thickness usually ranging from about 0.0001 to about0.0003 inch and is allowed to set and/or cure for the required timeperiod in accordance with the characteristics of the specific adhesivematerial employed.
Once the adhesive has set, the bonded assembly 27 is processed in thesame manner as an integral ring member, such as the outer member 12, toeffect a honing of the bore, a grinding of the lands, a grinding of theside faces and a final grinding of the raceways employing a grindingwheel indicated at 34 in FIG. 4. The cutting periphery of the grindingwheel is of a gothic arch configuration as defined by radii r₁, r₂,providing the desired curvature and offset. The processing of the bondedassembly 27 through the several final finishing operations, includingintervening inspections and measurements, is performed without the needof mounting the bonded assembly on special fixtures or tying orstrapping the ring sections together as is required in accordance withprior art practices. At the conclusion of the final finishing andmeasuring operations, the bonded assembly 27 is matched with an outerring member 12 and the necessary number of balls or antifrictionelements and the resulting matched components are thereafter retained asa matched group through the remaining assembly and packaging operation.The bonded assembly 27 can readily be cleaved into the individual ringsections by imposing a shear load on the adhesive bond line, causing arupture thereof and, whereafter, if desired, the abutting faces 30, 32can be further cleaned, such as by solvent, to remove any residualadhesive remaining thereon.
FIG. 5 is provided as a basis of comparing prior art practices with thepresent process in which carefully measured and selected ring sections36, 38 are securely mounted on a fixture including a spindle 40 andclamping nut 42. A shim 44 of an accurate thickness is placed betweenthe ring sections preliminary to the race grinding operation. As shownin FIG. 5, a grinding wheel 46 having a peripheral cutting face 48 of aconstant radius r_(o) is employed. Upon the completion of the racegrinding operation, the shim 44 is removed so that upon movement of thetwo ring sections toward each other until their abutting faces contact,a similar gothic arch raceway configuration is provided as in the caseof the grinding operation illustrated in FIG. 4. It will be appreciatedfrom the arrangement illustrated in FIG. 5 that a demounting andremounting of the individual ring sections is repeatedly necessitated inorder to enable successive grinding or honing of the bore and side facesof the inner ring member, which constitutes a tedious, time consumingand costly operation.
In the formation of a bonded assembly in accordance with the practice ofthe present invention, any suitable adhesive composition can be employedwhich serves to tenaciously bond the several ring sections together intoa substantially rigid assembly and wherein the bond formed is of astrength sufficient to withstand the forces normally imposed on thebonded component during the several finishing operations, as well asduring handling between operations. The adhesive also is characterizedas one which will not deteriorate upon coming in contact with thevarious cutting fluids and lubricants employed in the final finishingoperations and one which, at the conclusion of the process, can readilybe fractured such as by cleaving or applying a shear load to effect abond rupture. Particularly satisfactory results are achieved employingadhesive compositions consisting of polymerizable compounds havinganaerobic curing characteristics which may conveniently be defined asthe property of a polymerizable compound to polymerize rapidly andspontaneously to a solid or cured state upon the exclusion of air oroxygen. It will be appreciated that such anaerobic curing properties areparticularly desirable in the bonding or adhesive joining of theindividual ring sections into a bonded assembly since the adhesivecomposition can be permitted to stand in contact with air for extendedperiods of time without polymerizing. However, when applied in the formof a thin film between the abutting surfaces causing an exclusion ofair, the adhesive composition rapidly polymerizes and forms a strongbond.
Typical of various classes of resins and catalyst groups which can besatisfactorily employed in the adhesive systems are: an uncuredpolyester resin and a peroxide catalyst to promote room temperaturecuring with or without conventional accelerators; an unsaturated maleicalkyd resin dissolved in a copolymerizing monomer such as styrene and aperoxide catalyst; an uncured epoxy resin and a dibasic acid catalystsuch as phthalic acid or an amine catalyst such as ethylenediamine; anuncured alkyd resin and a diisocyanate catalyst such as toluenediisocyanate; phenolic one-stage resins and a strong acid such astoluene sulfonic acid; and high boiling monomers such as diallylphthalate or diallyl maleate with a peroxide catalyst; or the like.Further details of such anaerobic adhesive curing compositions aredisclosed in U.S. Pat. Nos. 2,901,099; 3,041,322; 3,043,820; 3,046,262and 3,218,303, the substance of which are incorporated herein byreference. In addition to the foregoing, a series of cyanoacrylateadhesives available from Eastman Chemical Products, Inc., can also besatisfactorily employed. Two particularly satisfactory adhesivesavailable from the foregoing supplier are available under thedesignations Eastman 910 MHT and Eastman 910 THT, which provide not onlystrong bonds, but also are capable of withstanding temperatures up toabout 475°F. Alternative satisfactory adhesive compositions which areheat-activatable and/or curable of the various types commerciallyavailable and which are of the requisite strength and compatibility, canalso be satisfactorily employed for use in the present process.
The manner by which the adhesive is applied to the joining surfaces ofthe ring sections is not important as long as a relatively thin anduniform bond line is achieved. The preliminarily secured assembly can beclamped under pressure in aligned relationship for a period of time asmay be dictated by the type of adhesives employed to assure propersetting of the adhesive joints, whereafter the bonded assembly can behandled free from any further restraints or attachments throughout theremaining processing cycle.
In addition to the split-ring type antifriction bearing assembly aspreviously described in connection with FIGS. 1-5 of the drawings,similar advantages are obtained in the fabrication of thick-wall splitsleeve-type flanged bearings of the type shown in FIGS. 6-9 of thedrawings. As shown, a split sleeve or shell-type bearing assembly,indicated at 50, comprises a pair of semicircular sections 52 havingintegrally formed radially projecting flanges 54 formed with partingfaces 56 disposed in a transverse diametrical plane passing through thecenter line of the bearing assembly 50. Each section 52, such as shownin FIG. 8, is preliminarily formed such as by blanking and stampingand/or forging operations to within relatively close dimensionaltolerances approaching those of the final machined bearing assembly.Preferably, at least the parting faces 56 are subjected to furtherfinishing to assure alignment of the two parting faces of each sectionand the proper degree of surface finish and flatness prior to theapplication of the adhesive thereto. As in the case of the split-ringtype antifriction bearing assembly previously described, thesemicircular sections 52 are selected at random and are adhesivelybonded together to form bonded bearing assemblies 58, as shown in FIG.9. The thickness of the adhesive film 60, as shown in FIG. 9, isexaggerated and is preferably controlled to a thickness of only severalten-thousandths of an inch.
After the adhesive film has set, the bonded assembly 58 is subjected tothe desired machining operations, including a machining of the frontface 62 and rear face 64 of the bonded assembly, the side edges 66 ofthe flanges 54, the bore 68 of the bonded assembly to a finished sizeindicated at 70 in phantom in FIG. 9, as well as the outer peripheralsurfaces of the bonded assembly as may be necessary or required toprovide the appropriate fit of the bearings in seated relationship inthe bearing retainer. At the completion of the final finishing andgrinding operations, the two perfectly-mated sections 52 are separatedby cleaving the bonded assembly at the adhesive bond line and anyresidual adhesive film on the parting faces 56 is removed. The resultantfinish-machined sections are assemblable into a precision sectionalizedcomponent, such as the bearing assembly 50 shown in FIGS. 6 and 7.
Another sectionalized precision component which can be advantageouslymanufactured employing the process of the present invention is aself-aligning bushing 72, such as shown in FIGS. 10 and 11 of thedrawings, comprising an annular split or sectionalized housing 74 formedwith an internal spherically-shaped seat or socket 76 against which abushing 78 is slidably seated for pivoting movement relative to thehousing. The bushing 78 is formed with an axially extending bore 80 forslidably or rotatably journaling a rod or shaft supported thereby. Inthe specific embodiment shown in FIGS. 10 and 11, the housing 74 issplit longitudinally into two semicircular sections 82 which areretained with their parting edges 84 in appropriate abuttingrelationship by means of a circular spring clip or retainer 86 disposedin a circumferential groove 88 extending around the periphery of thesectionalized housing as best seen in FIG. 10.
As in the embodiments previously described, a precision mating of thesections comprising the housing is achieved by randomly selecting a pairof preliminarily machined sections 82 and bonding them together with anadhesive forming an integral adhesively-bonded assembly 90, such asshown in FIG. 12. The adhesive layer 92 (the thickness of which isexaggerated in the drawing for illustrative purposes) is applied betweenthe parting edges 84 of the circumferentially aligned sections 82 andupon appropriate setting or curing of the adhesive film, the bondedassembly can be subjected to final accurate machining operations as anintegral unit. Typically, final finishing or grinding operations can beperformed on the end faces 94 of the sectionalized housing, thecylindrical periphery 96 of the housing including the circumferentialgroove 88 and the spherical seat or socket 76. The arrangementillustrated in FIG. 12 shows the bonded assembly 90 disposed between thejaws 98 of a suitable clamping fixture to permit grinding of theinternal seat 76 by a suitable abrasive finishing tool 100. At thecompletion of the final precision finishing operations, the housingsections 82 are separated by cleaving the adhesive bond 92 and theparting edges 84 are cleaned preliminary to the assembly of thesectionalized housing around a bushing 78 to form the self-aligningbushing assembly 72, which is retained by the retainer 86.
An alternative satisfactory embodiment of a sectionalized housing 102 isshown in FIG. 13 comprising a pair of annular ring sections 104 whichare adhesively secured by means of an adhesive layer 106 in face-to-faceabutting relationship forming the bonded assembly. Still otheralternative sectional configurations can be employed which areassemblable into the housing or other components of the sectionalizedprecision components processed in accordance with the present inventionto provide the required flexibility and efficiency in the fabrication ofthe individual sections and the final finishing of the resultantadhesively bonded assembly and such that the parting line between theindividual sections of the final assembly is located in a position toprovide for optimum performance and durability of the assembly.
While it will be apparent that the invention herein described is wellcalculated to achieve the benefits and advantages set forth above, itwill be appreciated that the invention is susceptible to modification,variation and change without departing from the spirit thereof.
What is claimed is:
1. In a process for fabricating precision componentsof the type comprising a member which is of a sectionalized constructionincluding a plurality of sections joined together in assembled conditionat an interface defined by a respective parting surface of each section,the steps of forming a plurality of sections having a shape and sizesuch that the assembly thereof at the parting surface of each sectionsubstantially defines the sectionalized member, applying a thin film ofadhesive to at least one said parting surface at each interface,adhesively securing said sections together at the interface defined bythe respective parting surface of each section into a bonded assembly inwhich the sections are disposed in an assembled relationshipcorresponding to their ultimate operating disposition, finishing atleast some of the surfaces of said bonded assembly including a surfaceincorporating an exposed edge of said interface to the desired finaldimensions and surface finish, and thereafter cleaving said bondedassembly and separating the mated finished said sections.
2. The processas defined in claim 1, further characterized by the fact that saidsectionalized member is in the form of a ring.
3. The process as definedin claim 1, in which said sectionalized member is in the form of a ringand wherein the step of forming said sections is performed to produce aplurality of ring-shaped sections assemblable into said ring.
4. Theprocess as defined in claim 1, in which said sectionalized member is inthe form of a ring and wherein the step of forming said sections isperformed to produce a plurality of arcuate sections assemblable intosaid ring.
5. The process as defined in claim 1, in which saidsectionalized member is in the form of a ring and wherein the step offorming said sections is performed to produce a pair of said sections ofsubstantially identical shape and size, each upon assembly defining onehalf of the sectionalized ring member.
6. The process as defined inclaim 1, including the further steps of transferring said bondedassembly through the finishing step as an integral individualunsupported component.
7. The process as defined in claim 1, furthercharacterized in that the step of adhesively securing said sectionstogether is performed in a manner which minimizes the thickness of theadhesive layer.
8. The process as defined in claim 1, including thefurther step of removing any residual adhesive from the surfaces of themated finished said sections after cleaving said bonded assembly.
9. Theprocess as defined in claim 1, in which the step of cleaving said bondedassembly is achieved by applying a force on the assembly to effect ashear rupture of the adhesive bond.
10. The process as defined in claim1, further characterized in the step of adhesively securing saidsections together utilizing an anaerobic type adhesive having a filmthickness ranging from about 0.0001 to about 0.0003 inch.
11. Theprocess as defined in claim 2, further characterized by the fact thatsaid ring comprises a split-type shell bearing comprised of a pair ofsemicircular sections the ends of which terminate in a parting surfaceadapted to be disposed in abutting contact with the parting surface ofthe other said section.
12. The process as defined in claim 11,including the further step of machining said parting surface to accuratedimensions prior to applying said adhesive thereto to form said bondedassembly.
13. The process as defined in claim 11, in which the step offinishing machining of said bonded assembly includes the inner surfaceof said bearing to provide the desired cylindrical configuration andsize.
14. The process as defined in claim 11, characterized by the factthat each of said sections further includes a flange extending radiallyfrom each end thereof in diametrically opposite relationship with thelongitudinal faces thereof defining said parting edge surface.
15. Theprocess as defined in claim 2, wherein said ring comprises a split-typehousing formed with an internal seating surface for receiving aself-aligning bushing adapted to be slidably disposed therein.
16. Theprocess as defined in claim 15, in which said seating surface is of aspherical configuration and said housing is split along a transverseplane disposed substantially perpendicular to the longitudinal axis ofsaid housing and passing through said housing in the region of themaximum transverse diameter of said seating surface.
17. The process asdefined in claim 15, in which said seating surface is of a sphericalconfiguration and said housing is split along a longitudinally extendingplane passing through the longitudinal axis of said housing, wherebyeach section is of a semicircular shape and comprises one-half of saidhousing.
18. The process as defined in claim 15, including the furthersteps of providing a bushing, assembling said sections about saidbushing and applying fastening means on the assembled said split-typehousing to retain said assembly together. | 2024-03-22 | 1975-01-17 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1976-09-07"
} |
US-74846676-A | Organic carbonate plasticized polycarbonate composition
ABSTRACT
A plasticized polycarbonate composition comprising in admixture a high molecular weight aromatic carbonate polymer and a minor amount of an organic carbonate.
This invention is directed to a plasticized polycarbonate compositioncomprising in admixture a high molecular weight aromatic carbonatepolymer and a minor amount of an organic carbonate.
BACKGROUND OF THE INVENTION
Polycarbonate polymers are excellent molding materials as products madetherefrom have high impact strength, toughness, high transparency, widetemperature limits (high impact resistance below -60° C and a UL thermalendurance rating of 115° C with impact), good dimensional stability,high creep resistance and electrical properties which qualify it as solesupport for current carrying parts.
Polycarbonates are, however, very difficult to fabricate from melts forthe reason that melts thereof have exceptionally high viscosities.Attempts to overcome this difficulty by the incorporation with thepolycarbonate of materials known to reduce the viscosity of other resinshave very generally been unsuccessful. Many standard viscosity controlagents appear to have little or no effect on the viscosity ofpolycarbonate. Other compounds known to lower the viscosity of resinscause degradation of polycarbonate resins. Some compounds,conventionally employed to improve the workability of polymers, producean embrittling effect on polycarbonates when they are mixed therewithand the resin is subjected to elevated temperatures as in molding. Stillother materials, while satisfactory stiffness modifying agents for otherplastics, are too volatile to be incorporated with polycarbonates sincepolycarbonates have much higher melting points than many otherthermoplastics.
From U.S. Pat. No. 3,269,971, it is known that particular carbonateesters when added to aromatic polycarbonates act as plasticizers.
DESCRIPTION OF THE INVENTION
It has been surprisingly discovered that, by admixing a minor amount ofan organic carbonate with a high molecular weight aromatic carbonatepolymer, the resultant polycarbonate composition has reduced meltviscosity and does not become brittle or degraded upon molding and thusretains its characteristic high impact strength.
In the practice of this invention, the organic carbonate additive ischaracterized by the following formula: ##STR1## wherein R and R" areindependently selected from the group consisting of C₁ to C₃₀ alkyl,aryl of 6 to 14 carbon atoms and substituted aryl wherein thesubstituents are C₁ to C₃₀ alkyl, halogen, C₁ to C₃₀ alkoxy, aryloxy of6 to 14 carbon atoms, alkylthio of 1 to 30 carbon atoms, arylthio of 6to 14 carbon atoms, R' is selected from the group consisting of C₁ toC₃₀ alkylene, arylene of 6 to 14 carbon atoms, alkarylene of 7 to 30carbon atoms, aralkylene of 7 to 30 carbon atoms and ##STR2## wherein Wis selected from the group consisting of: ##STR3## wherein A is ##STR4##and R₄ is hydrogen or C₁ -C₄ alkyl; R is independently selected from thegroup consisting of hydrogen, C₁ -C₁₅ alkyl, aryl of 6-14 carbon atomsand substituted aryl wherein the substituents are C₁ -C₅ alkyl;
(b) --CH₂ CH₂ --;
(c) --CH₂ B-CH₂ --;
wherein B is C₁ -C₁₆ alkylene or arylene of 6 to 14 carbon atoms;##STR5## wherein a is an integer of 3 to 15; (e) --O--;
(f) --S--; ##STR6## X and Y are independently selected from the groupconsisting of halogen and C₁ -C₁₂ alkyl; n is 0 or 1 with the provisothat when n is 0 at least one of R or R" is substituted aryl wherein thesubstituents are C₁ to C₃₀ alkoxy, aryloxy of 6 to 14 carbon atoms,alkylthio of 1 to 30 carbon atoms and arylthio of 6 to 14 carbon atoms.
The amount of organic carbonate employed in the practice of thisinvention may vary from 0.05 to about 5.0 parts per hundred parts ofaromatic carbonate polymer. Preferably, these carbonate esters areemployed in amounts of from 0.25 to 2.0 parts per hundred parts ofaromatic carbonate polymer.
In the practice of this invention, the high molecular weight aromaticpolycarbonates that can be employed herein are homopolymers andcopolymers and mixtures thereof which have an I.V. of 0.40 to 1.0 dl./g.as measured in methylene chloride at 25° C that are prepared by reactinga dihydric phenol with a carbonate precursor. Typical of some of thedihydric phenols that may be employed in the practice of this inventionare bisphenol-A, (2,2-bis(4-hydroxyphenyl)propane), bis(4-hydroxyphenyl)methane, 2,2-bis(4-hydroxy-3-methylphenyl) propane,4,4-bis(4-hydroxyphenyl) heptane,2,2-(3,5,3',5'-tetrachloro-4,4'-dihydroxydiphenyl) propane,2,2-(3,5,3',5'-tetrabromo-4,4'-dihydroxydiphenyl) propane,(3,3'-dichloro-4,4'-dihydroxydiphenyl)methane. Other dihydric phenols ofthe bisphenol type are also available and are disclosed in U.S. Pat.Nos. 2,999,835, 3,028,365 and 3,334,154.
It is, of course, possible to employ two or more different dihydricphenols or a copolymer of a dihydric phenol with a glycol or withhydroxy or acid terminated polyester, or with a dibasic acid in theevent a carbonate copolymer or interpolymer rather than a homopolymer isdesired for use in the preparation of the aromatic carbonate polymers ofthis invention. Also employed in the practice of this invention may beblends of any of the above materials to provide the aromatic carbonatepolymer.
The carbonate precursor may be either a carbonyl halide, a carbonateester or a haloformate. The carbonyl halides which can be employedherein are carbonyl bromide, carbonyl chloride and mixtures thereof.Typical of the carbonate esters which may be employed herein arediphenyl carbonate, di-(halophenyl) carbonates such as di-(chlorophenyl)carbonate, di-(bromophenyl) carbonate, di-(trichlorophenyl) carbonate,di-(tribromophenyl) carbonate, etc., di-(alkylphenyl) carbonates such asdi(tolyl) carbonate, etc., di-(naphthyl) carbonate, di-(chloronaphthyl)carbonate, phenyl tolyl carbonate, chlorophenyl chloronaphthylcarbonate, etc., or mixtures thereof. The haloformates suitable for useherein include bis-haloformates of dihydric phenols (bischloroformatesof hydroquinone, etc.) or glycols (bishaloformates of ethylene glycol,neopentyl glycol, polyethylene glycol, etc.). While other carbonateprecursors will occur to those skilled in the art, carbonyl chloride,also known as phosgene, is preferred.
Also included are the polymeric derivatives of a dihydric phenol, adicarboxylic acid and carbonic acid. These are disclosed in U.S. Pat.No. 3,169,121 which is incorporated herein by reference.
The aromatic carbonate polymers of this invention may be prepared byemploying a molecular weight regulator, an acid acceptor and a catalyst.The molecular weight regulators which can be employed in carrying outthe process of this invention include monohydric phenols such as phenol,chroman-I, paratertiarybutylphenol, parabromophenol, primary andsecondary amines, etc. Preferably, phenol is employed as the molecularweight regulator.
A suitable acid acceptor may be either an organic or an inorganic acidacceptor. A suitable organic acid acceptor is a tertiary amine andincludes such materials as pyridine, triethylamine, dimethylamiline,tributylamine, etc. The inorganic acid acceptor may be one which can beeither a hydroxide, a carbonate, a bicarbonate, or a phosphate of analkali or alkaline earth metal.
The catalysts which are employed herein can be any of the suitablecatalysts that aid the polymerization of bisphenol-A with phosgene.Suitable catalysts include tertiary amines such as, for example,triethylamine, tripropylamine, N,N-dimethylaniline, quaternary ammoniumcompounds such as, for example, tetraethylammonium bromide, cetyltriethyl ammonium bromide, tetra-n-heptylammonium iodide, tetra-n-propylammonium bromide, tetramethylammonium chloride, tetramethyl ammoniumhydroxide, tetra-n-butyl ammonium iodide, benzyltrimethyl ammoniumchloride and quaternary phosphonium compounds such as, for example,n-butyltriphenyl phosphonium bromide and methyltriphenyl phosphoniumbromide.
Also, included herein are branched polycarbonates wherein apolyfunctional aromatic compound is reacted with the dihydric phenol andcarbonate precursor to provide a thermoplastic randomly branchedpolycarbonate.
These polyfunctional aromatic compounds contain at least threefunctional groups which are carboxyl, carboxylic anhydride, haloformylor mixtures thereof. Examples of these polyfunctional aromatic compoundswhich may be employed in the practice of this invention include:trimellitic anhydride, trimellitic acid, trimellityl trichloride,4-chloroformyl phthalic anhydride, pyromellitic acid, pyromelliticdianhydride, mellitic acid, mellitic anhydride, trimesic acid,benzophenonetetracarboxylic acid, benzophenonetetracarboxylic anhydrideand the like. The preferred polyfunctional aromatic compounds aretrimellitic anhydride or trimellitic acids or their haloformylderivatives.
Also, included herein are blends of a linear polycarbonate and abranched polycarbonate.
The composition of the instant invention may be prepared by blending thehigh molecular weight aromatic polycarbonate with the additive byconventional methods.
Obviously, other materials can also be employed with the aromaticcarbonate polymer of this invention and include such materials asanti-static agents, pigments, thermal stabilizers, ultravioletstabilizers, reinforcing fillers and the like.
PREFERRED EMBODIMENT OF THE INVENTION
In order to more fully and clearly illustrate the present invention, thefollowing specific examples are presented. It is intended that theexamples be considered as illustrative rather than limiting theinvention disclosed and claimed herein. In the examples, all parts andpercentages are on a weight basis unless otherwise specified.
EXAMPLE I
One hundred (100) parts of an aromatic polycarbonate, prepared from2,2-bis(4-hydroxyphenyl) propane and phosgene in the presence of an acidacceptor and a molecular weight regulator and having an intrinsicviscosity of about 0.57, is mixed with the additive listed in the Tableby tumbling the ingredients together in a laboratory tumbler. Theresulting mixture is then fed to an extruder which is operated at about265° C, and the extrudate is comminuted into pellets.
The pellets are then fed into a plastometer and the flow rate of thepolymer is measured according to ASTM D1238-70, Condition 0. The meltflow rate is set forth in the Table.
Additionally, the pellets are injection molded at about 315° C into testspecimens of about 5 by 1/2 by 1/8 inch thick. The impact strength ofthese specimens is then measured according to the Izod test, ASTM D-256.The impact strength is set forth in the Table. The sample labeledCONTROL is the polycarbonate as prepared without additive.
Table __________________________________________________________________________ Amt. of Melt Impact Additive (Parts Flow Rate Strength Additive per Hundred) (gr./10 (Ft.Lbs./In.) __________________________________________________________________________ CONTROL -- 10.0 15.0 ##STR7## 1.0 13.94 13.9 ##STR8## 0.5 13.26 14.6 ##STR9## 1.0 13.60 13.2 ##STR10## 0.2 13.26 15.0 ##STR11## 0.5 15.74 14.6 ##STR12## 0.1 11.73 15.4 ##STR13## 0.5 12.63 10.9 ##STR14## 2.0 17.35 11.3 __________________________________________________________________________
It can be seen from the data in the Table that when the instant organiccarbonate additive is added to a high molecular weight aromaticpolycarbonate, the resulting polycarbonate composition has reduced meltviscosity as shown by the higher melt flow rate while retaining impactstrength.
It will thus be seen that the objects set forth above among those madeapparent from the preceding description are efficiently attained andsince certain changes may be made in carrying out the above process andin the composition set forth without departing from the scope of thisinvention, it is intended that all matters contained in the abovedescription shall be interpreted as illustrative and not in a limitingsense.
What is claimed is:
1. A plasticized polycarbonate compositioncomprising in admixture homopolymers, copolymers and mixtures thereof ofa high molecular weight aromatic carbonate polymer having an I.V. of0.40 to 1.0 dl/g in methylene chloride at 25° C. and a minor amount ofan organic carbonate of the following formula: ##STR15## wherein R andR" are independently selected from the group consisting of C₁ of C₃₀alkyl, aryl of 6 to 14 carbon atoms and substituted aryl wherein thesubstituents are C₁ and to C₃₀ alkyl, halogen, C₁ to C₃₀ alkoxy, aryloxyof 6 to 14 carbon atoms, alkylthio of 1 to 30 carbon atoms, arylthio of6 to 14 carbon atoms, R' is selected from the group consisting of C₁ toC₃₀ alkylene, arylene of 6 to 14 carbon atoms, alkarylene of 7 to 30carbon atoms, aralkylene of 7 to 30 carbon atoms and ##STR16## wherein Wis selected from the group consisting of ##STR17## wherein A is##STR18## and R₄ is hydrogen of C₁ -C₄ alkyl; R is independentlyselected from the group consisting of hydrogen, C₁ -C₁₅ alkyl, aryl of6-14 carbon atoms and substituted aryl wherein the substituents are C₁-C₁₅ alkyl;(b) --CH₂ CH₂ -- (c) --CH₂ B-CH₂ --wherein B is C₁ -C₁₆alkylene or arylene of 6 to 14 carbon atoms; ##STR19## wherein a is aninteger of 3 to 15; (e) --O--; (f) --S--; ##STR20## X and Y areindependently selected from the group consisting of halogen and C₁ -C₁₂alkyl; n is 0 or 1 with the proviso that when n is 0 at least one of Ror R" is substituted aryl wherein the substituents are C₁ to C₃₀ alkoxy,aryloxy of 6 to 14 carbon atoms, alkylthio of 1 to 30 carbon atoms andarylthio of 6 to 14 carbon atoms.
2. The composition of claim 1 whereinthe organic carbonate is present in an amount of from 0.05 to about 5.0parts per hundred parts of aromatic carbonate polymer.
3. Thecomposition of claim 1 wherein the aromatic carbonate polymer is derivedfrom bisphenol-A.
4. The composition of claim 1 wherein the aromaticcarbonate polymer is a copolymer derived from bisphenol-A and tetrabromobisphenol-A.
5. The composition of claim 1 wherein the organic carbonatehas the following formula: ##STR21##
6. The composition of claim 1wherein the organic carbonate has the following formula: ##STR22## 7.The composition of claim 1 wherein the organic carbonate has thefollowing formula: ##STR23##
8. The composition of claim 1 wherein theorganic carbonate has the following formula: ##STR24## | 2024-03-22 | 1976-12-08 | USPTO-Google Patents Public Data | {
"license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/",
"language": "en",
"publication_date": "1978-07-04"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.