Dataset Viewer
latex
string | filename
string | image
image |
|---|---|---|
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Feature} & \textbf{XL CGD} & \textbf{AR CGD} \\
\hline
Family history of lupus & 10\% & 3\% \\
\hline
Age at diagnosis & 3.01 years & 7.81 years \\
\hline
Perirectal abscess & 17\% & 7\% \\
\hline
Suppurative adenitis & 59\% & 32\% \\
\hline
Bacteremia and/or fungemia & 21\% & 10\% \\
\hline
Gastric outlet obstruction & 19\% & 5\% \\
\hline
Urinary obstruction & 11\% & 3\% \\
\hline
Mortality (over 10 year observation) & 21.2\% & 8.6\% \\
\hline
\end{tabular}
\end{table} | PMC3128843_table_5 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Diagnosis} & \textbf{Number of diagnosis (\%)} & \textbf{Operated (\%)} & \textbf{Success (\%)} \\
\hline
Vesicovaginal & 28 (35) & 22 (79) & 20(91) \\
\hline
Rectovaginal & 4 (5) & 4 (100) & 4 (100) \\
\hline
Recto and vesicovaginal & 7 (9) & 5 (71) & 4 (80) \\
\hline
All fistula & 39 (48) & 32 (82) & 28 (88) \\
\hline
4th degree perineal tear & 21 (26) & 21 (100) & 21 (100) \\
\hline
Other operable conditions & 21 (26) & 14 (67) & 10 (71) \\
\hline
Total & 81 & 66(81) & 59 (89) \\
\hline
\end{tabular}
\end{table} | PMC3607911_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Biochemical factor} & \multicolumn{2}{c|}{\textbf{category}} & \textbf{No.} & \textbf{\%} \\
\hline
\textbf{Baseline NTx} & \textbf{normal} & \textbf{18 nM BCE $\leq$} & \textbf{30} & \textbf{50} \\
\hline
& ab\textbf{normal} & > 18 nM BCE & \textbf{30} & \textbf{50} \\
\hline
\multirow{2}{*}{Baseline VEGF} & \textbf{normal} & \textbf{50}0 pg/ml $\leq$ & \textbf{30} & \textbf{50} \\
\hline
ab\textbf{normal} & > \textbf{50}0 pg/ml & \textbf{30} & \textbf{50} \\
\hline
\multirow{2}{*}{Baseline CEA} & \textbf{normal} & 10 μg/L $\leq$ & 42 & 70 \\
\hline
ab\textbf{normal} & > 10 μg/L & 18 & \textbf{30} \\
\hline
\multirow{2}{*}{Baseline CA 15-3} & \textbf{normal} & 51 U/mL $\leq$ & 21 & 35 \\
\hline
ab\textbf{normal} & > 51 U/mL & 39 & 65 \\
\hline
\multirow{2}{*}{NTx (days 90)} & \textbf{normal} & $\leq$ 18 nM BCE & 34 & 56.7 \\
\hline
ab\textbf{normal} & > 18 nM BCE & 16 & 43.3 \\
\hline
\multirow{2}{*}{VEGF (days 90)} & \textbf{normal} & $\leq$ \textbf{50}0 pg/ml & 29 & 48.3 \\
\hline
ab\textbf{normal} & > \textbf{50}0 pg/ml & 21 & 42.7 \\
\hline
\end{tabular}
\end{table} | PMC3196722_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Subject Characteristics} \\
\hline
& Boys & Girls & P-value* \\
\hline
N & 14 & 15 \\
\hline
Age (years) & 12.6 $\pm$ 0.3 & 11.7 $\pm$ 0.4 & 0.075 \\
\hline
Height (cm) & 156.0 $\pm$ 3.7 & 150.9 $\pm$ 2.6 & 0.28 \\
\hline
Weight (kg) & 46.5 $\pm$ 2.8 & 41.9 $\pm$ 2.5 & 0.24 \\
\hline
BMI (\%ile) & 55.9 $\pm$ 4.3 & 52.8 $\pm$ 6.2 & 0.69 \\
\hline
Fat mass** (kg) & 10.5 $\pm$ 0.8 & 10.1 $\pm$ 1.3 & 0.80 \\
\hline
Fat mass** (\%) & 22.7 $\pm$ 1.3 & 22.8 $\pm$ 2.0 & 0.98 \\
\hline
Fat free mass (kg) & 36.0 $\pm$ 2.4 & 31.8 $\pm$ 1.4 & 0.15 \\
\hline
Fat free mass (\%) & 77.3 $\pm$ 1.3 & 77.2 $\pm$ 2.0 & 0.98 \\
\hline
Ventilation Threshold (mL·min-1) & 1067.5 $\pm$ 90.7 & 933.1 $\pm$ 42.1 & 0.18 \\
\hline
Ventilation Threshold (mL·kg-1·min-1) & 23.0 $\pm$ 1.2 & 22.2 $\pm$ 0.9 & 0.59 \\
\hline
\end{tabular}
\end{table} | PMC2768671_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Clinical Parameters} & \multicolumn{2}{c|}{\textbf{UNIVARIATE}} & \multicolumn{2}{c|}{\textbf{MULTIVARIATE}} \\
\hline
& \textbf{\textbf{Risk Ratio (95\% CI)}} & \textbf{\textbf{P value}} & \textbf{\textbf{Risk Ratio (95\% CI)}} & \textbf{\textbf{P value}} \\
\hline
Age Above = 50 & 0.80 (0.54-1.19) & 0.2751 & 0.74 (0.49 - 1.14) & 0.1712 \\
\hline
Stage IV & 2.15 (1.32 - 3.41) & 0.0028 & 1.82 (1.08 - 2.93) & 0.0243 \\
\hline
Grade Poor & 1.27 (0.82-1.93) & 0.5303 & 1.15 (0.72 - 1.79) & 0.5445 \\
\hline
Leptin R(Ob-R) Overexpression & 1.82 (1.22-2.75) & 0.0032 & 1.96 (1.28 - 3.06) & 0.0020 \\
\hline
\end{tabular}
\end{table} | PMC2754986_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Main analysis}} & \multicolumn{2}{c|}{\textbf{Depressive disorders spectrum analysis}} \\
\hline
& \textbf{\textbf{Coefficient}} & \textbf{\textbf{[95\% confidence interval]}} & \textbf{\textbf{Coefficient}} & \textbf{\textbf{[95\% confidence interval]}} \\
\hline
Arm characteristics \\
\hline
RCT (Ref = Observational) & 4.59 & [2.61 to 6.56] & 2.45 & [0.97 to 3.93] \\
\hline
Scale (Ref = HAM-21) \\
\hline
HAMD-17 & 22.32 & [23.03 to 21.61] & 21.66 & [22.29 to 21.03] \\
\hline
MADRS & 21.26 & [22.62 to 0.09] & 21.34 & [22.10 to 0.57] \\
\hline
Treatment (Ref = Fluoxetine) \\
\hline
Placebo & 23.35 & [23.97 to 22.74] & 23.42 & [23.93 to 22.92] \\
\hline
Venlafaxine & 2.51 & [1.88 to 3.14] & 2.25 & [1.81 to 2.70] \\
\hline
Double blind study (Ref = No) & 25.21 & [26.85 to 23.57] & 23.37 & [24.65 to 22.09] \\
\hline
Placebo design study (Ref = No) & 24.54 & [25.50 23.58] to & 23.54 & [24.21 22.86] to \\
\hline
Year of publication & 0.07 & [0.01 to 0.13] & 0.10 & [0.05 to 0.15] \\
\hline
Duration & 0.27 & [0.14 to 0.40] & 0.17 & [0.11 to 0.23] \\
\hline
Number of follow up assessments & 0.33 & [0.11 to 0.55] & 0.26 & [0.13 to 0.39] \\
\hline
Exclusion of placebo responders & 20.27 & [21.06 to 0.52] & 20.08 & [20.71 to 0.54] \\
\hline
Type of analysis PP (Ref=ITT with LOCF) & 2.52 & [1.45 to 3.6] & 2.55 & [1.87 to 3.23] \\
\hline
Patient type (Ref = Inpatients) \\
\hline
Outpatients & 1.81 & [0.88 to 2.72] & 2.81 & [2.18 to 3.43] \\
\hline
Outpatients in primary care & 3.73 & [2.37 to 5.09] & 3.69 & [2.59 to 4.80] \\
\hline
Patient characteristics \\
\hline
Mean age & 20.16 & [20.26 to 20.07] & 20.05 & [20.11 to 0.01] \\
\hline
Gender & 0.00 & [20.03 to 0.04] & 0.01 & [20.02 to 0.04] \\
\hline
Baseline severity & 0.78 & [0.71 to 0.84] & 0.83 & [0.78 to 0.88] \\
\hline
\end{tabular}
\end{table} | PMC3110792_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{True proportion in active control} & \textbf{Non-inferiority bound using 10\% margin} & \multicolumn{3}{c|}{\textbf{Approximate sample size per group assuming 1:1 randomization to new treatment and control required under:}} \\
\hline
& & \textbf{Equal effects} & \textbf{5\% benefit} & \textbf{10\% benefit} \\
\hline
0.1 & 0.09 & 19,200 & 8,725 & 5,050 \\
\hline
0.2 & 0.18 & 8,500 & 3,900 & 2,250 \\
\hline
0.3 & 0.27 & 4,970 & 2,260 & 1,300 \\
\hline
0.4 & 0.36 & 3,200 & 1,450 & 825 \\
\hline
0.5 & 0.45 & 2,100 & 1,000 & 550 \\
\hline
0.6 & 0.54 & 1,440 & 640 & 360 \\
\hline
0.7 & 0.63 & 930 & 405 & 225 \\
\hline
\end{tabular}
\end{table} | PMC3113981_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{MIGS ID} & \textbf{Property} & \textbf{Term} & \textbf{Evidence code} \\
\hline
& Classification & Domain Bacteria Phylum Actinobacteria Class Actinobacteria Order Actinomycetales Suborder Frankineae Family Nakamurellaceae Genus Nakamurella Species Nakamurella multipartita Type strain Y-104 & TAS [15] TAS [16] TAS [5] TAS [5] TAS [2] TAS [2] TAS [2] TAS [2] TAS [1] \\
\hline
& Gram stain & positive & TAS [1] \\
\hline
& Cell shape & coccus & TAS [1] \\
\hline
& Motility & non-motile & TAS [1] \\
\hline
& Sporulation & non-sporulating & TAS [1] \\
\hline
& Temperature range & 10-35°C & TAS [1] \\
\hline
& Optimum temperature & 25°C & TAS [1] \\
\hline
& Salinity & up to 6g NaCl/L & TAS [1] \\
\hline
\multirow{3}{*}{MIGS-22} & Oxygen requirement & aerobic chemoorganotroph & TAS [1] \\
\hline
Carbon source & sugars, alcohols, glucose, maltose, mannose, fructose, starch & TAS [1] \\
\hline
Energy source & starch, ethanol, propanol & TAS [1] \\
\hline
MIGS-6 & Habitat & activated sludge cultured in fed-batch reactors & TAS [1] \\
\hline
MIGS-15 & Biotic relationship & free-living & NAS \\
\hline
\multirow{3}{*}{MIGS-14} & Pathogenicity & none & NAS \\
\hline
Biosafety level & 1 & TAS [17] \\
\hline
Isolation & activated sludge & TAS [1] \\
\hline
MIGS-4 & Geographic location & not reported \\
\hline
MIGS-5 & Sample collection time & not reported \\
\hline
MIGS-4.1 MIGS-4.2 & Latitude Longitude & not reported \\
\hline
MIGS-4.3 & Depth & not reported \\
\hline
MIGS-4.4 & Altitude & not reported \\
\hline
\end{tabular}
\end{table} | PMC3035273_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Size of posterior fragment} & \textbf{N} & \textbf{AOFAS} & \textbf{VAS-pain} & \textbf{Dorsiflexion-restriction} & \textbf{OA grade 1} & \textbf{OA grade 2} & \textbf{OA grade 3} & \textbf{OA grade 4} \\
\hline
<5 \% & 8 & 95 & 1.4 & 2.9° & 8 & 0 & 0 & 0 \\
\hline
5–25 \% & 56 & 88 & 2.1 & 6.2° & 38 & 9 & 7 & 2 \\
\hline
>25 \% & 14 & 90 & 1.6 & 7.8° & 10 & 1 & 1 & 2 \\
\hline
\end{tabular}
\end{table} | PMC4548913_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & \textbf{N} & \textbf{Mean} & \textbf{Std. Deviation} & \textbf{Std. Error} & \textbf{Minimum} & \textbf{Maximum} \\
\hline
Stress to failure & Autoclave & 10 & .916 & .300 & .094 & .58 & 1.63 \\
\hline
\multirow{5}{*}{(MPa)} & Boiled & 10 & .882 & .245 & .077 & .63 & 1.47 \\
\hline
Pasteurization & 10 & 1.222 & .743 & .235 & .46 & 2.59 \\
\hline
Irradiation & 10 & 1.022 & .617 & .195 & .44 & 2.56 \\
\hline
Control & 10 & 2.035 & 1.253 & .396 & .77 & 4.64 \\
\hline
Total & 50 & 1.215 & .820 & .116 & .44 & 4.64 \\
\hline
Strain to failure & Autoclave & 10 & 4.671 & 1.926 & .609 & 2.42 & 9.43 \\
\hline
\multirow{5}{*}{\%} & Boiled & 10 & 4.699 & 2.716 & .859 & 1.27 & 9.63 \\
\hline
Pasteurization & 10 & 5.832 & 3.917 & 1.238 & 1.94 & 14.62 \\
\hline
Irradiation & 10 & 3.654 & 1.272 & .402 & 1.39 & 5.79 \\
\hline
Control & 10 & 9.691 & 7.526 & 2.380 & .71 & 25.35 \\
\hline
Total & 50 & 5.709 & 4.481 & .633 & .71 & 25.35 \\
\hline
Modulus & autoclave & 10 & 6.462 & 4.923 & 1.556 & 1.37 & 13.36 \\
\hline
\multirow{5}{*}{(MPa)} & Boiled & 10 & 3.909 & 2.421 & .765 & 1.27 & 9.16 \\
\hline
pasteur & 10 & 7.764 & 5.739 & 1.814 & 2.80 & 18.67 \\
\hline
gamma & 10 & 10.593 & 5.025 & 1.589 & 1.29 & 17.02 \\
\hline
Control & 10 & 19.039 & 16.358 & 5.173 & 7.18 & 49.35 \\
\hline
Total & 50 & 9.553 & 9.646 & 1.364 & 1.27 & 49.35 \\
\hline
\end{tabular}
\end{table} | PMC2944266_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{mode based the olives percentage} & \textbf{Palmitic acid (\%)} & & \textbf{Stearic acid (\%)} & & & \textbf{Oleic acid (\%)} & & & \textbf{Linoleic acid (\%)} & & & \textbf{Free acidity (\% oleic acid)} & & \textbf{Polyphenols (mg kg−1)} & & \textbf{K232} & & & \textbf{K270} \\
\hline
From the tree & 19.72 & A & 1.24 & a & A & 50.53 & d & B & 24.97 & a & A & 0.95 & E & 70.01 & A & 2.35 & c & B & 0.13 & D \\
\hline
First fall & 19.93 & A & 1.04 & c & CD & 51.66 & c & B & 24.17 & ab & AB & 1.52 & D & 42.80 & B & 2.42 & c & B & 0.17 & C \\
\hline
Second fall & 19.98 & A & 1.11 & b & B & 51.49 & c & B & 23.99 & abc & AB & 3.27 & C & 25.92 & C & 2.70 & b & A & 0.20 & B \\
\hline
Third fall & 19.09 & B & 0.92 & d & D & 53.16 & b & A & 23.82 & bc & AB & 5.70 & B & 18.72 & D & 2.92 & a & A & 0.24 & A \\
\hline
Forth fall & 18.70 & B & 1.12 & b & BC & 54.27 & a & A & 23.04 & c & B & 6.42 & A & 12.32 & E & 2.89 & ab & A & 0.23 & A \\
\hline
regimes \\
\hline
TWW (alternate) & 19.35 & B & 1.39 & & A & 50.71 & & B & 24.90 & & AB & 6.19 & B & 21.29 & D & 2.83 & a & AB & 0.26 & A \\
\hline
TWW (continuous) & 17.40 & C & 0.94 & & C & 57.32 & & A & 21.48 & & C & 6.80 & A & 26.36 & C & 2.32 & c & C & 0.21 & B \\
\hline
Not irrigated & 19.67 & B & 0.71 & & D & 51.49 & & B & 25.58 & & A & 0.72 & C & 50.87 & A & 2.63 & b & B & 0.15 & C \\
\hline
CW & 21.52 & A & 1.30 & & B & 49.37 & & C & 24.03 & & B & 0.58 & C & 37.28 & B & 2.84 & a & A & 0.16 & C \\
\hline
\end{tabular}
\end{table} | PMC3361296_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{4}{c|}{\textbf{Testosterone}} \\
\hline
& \textbf{No.} & \textbf{\%} & \textbf{Mean $\pm$ SD (ng/ml)} & \textbf{P} \\
\hline
All natural menopause \\
\hline
AR expression \\
\hline
Absent & 59 & 13.1 & 0.434 $\pm$ 0.198 & \multirow{4}{*}{0.099b 0.002c 0.002d} \\
\hline
\textbf{P}oor & 111 & 24.7 & 0.385 $\pm$ 0.187 \\
\hline
Moderate & 120 & 26.8 & 0.384 $\pm$ 0.166 \\
\hline
High & 159 & 35.4 & 0.462 $\pm$ 0.215 \\
\hline
Totala & 449 & 100.0 & 0.419 $\pm$ 0.196 \\
\hline
ER-positive \\
\hline
AR expression \\
\hline
Absent & 31 & 8.2 & 0.451 $\pm$ 0.203 & \multirow{4}{*}{0.116b 0.003c 0.022d,f 0.216e,f} \\
\hline
\textbf{P}oor & 91 & 24.1 & 0.402 $\pm$ 0.189 \\
\hline
Moderate & 107 & 28.3 & 0.385 $\pm$ 0.170 \\
\hline
High & 149 & 39.4 & 0.470 $\pm$ 0.217 \\
\hline
Total & 378 & 100.0 & 0.200g 0.428 $\pm$ \\
\hline
ER-negative \\
\hline
AR expression \\
\hline
Absent & 28 & 39.4 & 0.415 $\pm$ 0.193 & \multirow{4}{*}{0.204c 0.510b} \\
\hline
\textbf{P}oor & 20 & 28.2 & 0.310 $\pm$ 0.160 \\
\hline
Moderate & 13 & 18.3 & 0.378 $\pm$ 0.124 \\
\hline
High & 10 & 14.1 & 0.345 $\pm$ 0.139 \\
\hline
Total & 71 & 100.0 & 0.168g 0.369 $\pm$ \\
\hline
\end{tabular}
\end{table} | PMC3554552_table_1 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristics} & \textbf{Value} \\
\hline
Age \\
\hline
Mean $\pm$ SD (years) & 52.1 $\pm$ 10.3 \\
\hline
Range & 22-66 \\
\hline
$\leq$50 years & 99 (45.8\%) \\
\hline
>50 years & 117 (54.2\%) \\
\hline
Primary tumor histology \\
\hline
Ductal & 184 (85.2\%) \\
\hline
Lobular & 12 (5.6\%) \\
\hline
Other & 20 (9.3\%) \\
\hline
Primary tumor grade \\
\hline
I & 22 (10.2\%) \\
\hline
II & 180 (83.3\%) \\
\hline
III & 14 (6.5\%) \\
\hline
Hormonal receptor status & 184 (85.2\%) \\
\hline
Positive & 143 (66.2\%) \\
\hline
Negative & 73 (33.8\%) \\
\hline
HER2 \\
\hline
Positive & 42 (19.4\%) \\
\hline
Negative & 174 (80.6\%) \\
\hline
Ki67 & 14 (6.5\%) \\
\hline
>14\% & 147 (68.1\%) \\
\hline
$\leq$14\% & 69 (31.9\%) \\
\hline
AJCC stage \\
\hline
I & 76 (35.2\%) \\
\hline
II & 140 (64.8\%) \\
\hline
\end{tabular}
\end{table} | PMC4435774_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{Expected genotype call (KASP)}} \\
\hline
\textbf{Genotyping-by-sequencing} & \textbf{Nulliplex} & \textbf{Simplex} & \textbf{Duplex} & \textbf{Triplex} & \textbf{Quadruplex} & \textbf{Total} \\
\hline
Concordant calls & 4,975 & 4,861 & 2,204 & 1,373 & 1,272 & 14,685 \\
\hline
Discordant calls & 67 & 25 & 86 & 34 & 25 & 237 \\
\hline
Percentage of concordant calls & 98.7\% & 99.5\% & 96.2\% & 97.6\% & 98.1\% & 98.4\% \\
\hline
Median read-depth of concordant calls & 856 & 916 & 1016 & 926 & 756 & 896 \\
\hline
Median read-depth of discordant calls & 526 & 566 & 736 & 836 & 476 & 616 \\
\hline
Percentage of alternative reads for concordant calls & 0\% & 23\% & 49\% & 76\% & 100\% & – \\
\hline
Percentage of alternative reads for discordant calls & 4\% & 36\% & 34\% & 56\% & 97\% & – \\
\hline
\end{tabular}
\end{table} | PMC3648547_table_4 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{NWGP}} & \multicolumn{3}{c|}{\textbf{WYB}} \\
\hline
\textbf{\textbf{Variable}} & \textbf{\textbf{Available}} & \textbf{\textbf{Used}} & \textbf{\textbf{Variable}} & \textbf{\textbf{Available}} & \textbf{\textbf{Used}} \\
\hline
ag 5km & 0.14 & 0.16 & ag 200m & 0.01 & -0.04 \\
\hline
cliff 200m & -0.03 & 0.16 & cliff 200m & -0.02 & -0.03 \\
\hline
ndvi 5km & -0.02 & 0.08 & slope 1km & -0.03 & -0.14 \\
\hline
5km2 ndvi & -0.11 & -0.14 & herb 5km m & -0.03 & -0.05 \\
\hline
treed 5km & -0.12 & 0.00 & herb 5km sd & 0.00 & 0.03 \\
\hline
flat/open 200m & -0.01 & -0.05 & sage 5km m & -0.04 & -0.21 \\
\hline
slope 5km & 0.00 & 0.23 & sage 5km sd & 0.00 & -0.12 \\
\hline
sage 5km m & -0.03 & 0.01 & shrb 5km m & -0.04 & -0.10 \\
\hline
sage 5km sd & -0.02 & 0.05 & lek count & -0.03 & -0.08 \\
\hline
lek count lag & -0.03 & 0.02 & tmin & -0.05 & -0.09 \\
\hline
Tmin & -0.07 & -0.20 & tmin2 & 0.04 & -0.07 \\
\hline
tmin2 & -0.06 & -0.06 & ppt & 0.02 & 0.04 \\
\hline
ppt lag & 0.04 & 0.14 & ppt2 & 0.02 & -0.05 \\
\hline
lag2 ppt & -0.08 & -0.12 & elev & -0.03 & -0.13 \\
\hline
Elev & 0.00 & -0.09 & elev2 & 0.01 & 0.03 \\
\hline
elev2 & -0.14 & -0.03 \\
\hline
\end{tabular}
\end{table} | PMC4532434_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Bacteria (all natively sensitive to antibiotics)} & \textbf{Relevant Characteristics} & \textbf{Resistant or Sensitive} \\
\hline
Salmonella typhimurium; Salmonella paratyphi; Salmonella pullorum/pFimH; Salmonella javiana & Express a FimH protein with Thr at amino acid 78 & Resistant \\
\hline
Salmonella typhimurium/dFimH; Salmonella pullorum; Salmonella gallinarum & Express a FimH protein with Ile at amino acid 78 & Sensitive \\
\hline
Shigella flexneri; E. coli & Invade and attach via alternative processes & Sensitive \\
\hline
\end{tabular}
\end{table} | PMC3143092_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& & \multirow{3}{*}{\textbf{Test set n = 9 No. (\%)}} & \multirow{3}{*}{\textbf{Validation set n = 24 No. (\%)}} \\
\hline
\\
\hline
\multicolumn{2}{c|}{\textbf{Variable}} \\
\hline
\multirow{2}{*}{Age at surgery, years (mean)} & & 64.7 & 76.0 \\
\hline
Range & 52.3–71.5 & 48.4–93.6 \\
\hline
Gender \\
\hline
& Female & 3 (33\%) & 9 (37.5\%) \\
\hline
& Male & 6 (67\%) & 15 (62.5\%) \\
\hline
Tumour location \\
\hline
& Right & 1 (11\%) & 0 (0\%) \\
\hline
& Left & 8 (89\%) & 24 (100\%) \\
\hline
TNM stage \\
\hline
& I & 9 (100\%) & 21 (87.5\%) \\
\hline
& II & 0 (0\%) & 0 (0\%) \\
\hline
& III & 0 (0\%) & 2 (8.3\%) \\
\hline
& IV & 0 (0\%) & (4.2\%)a 1 \\
\hline
Histology, cancer \\
\hline
& Adenocarcinoma & 9 (100\%) & 24 (100\%) \\
\hline
Histology, adenoma \\
\hline
& Tubular & 4 (44\%) & 11 (46\%) \\
\hline
& Tubulovillous & 5 (56\%) & 11 (46\%) \\
\hline
& Villous & 0 (0\%) & 2 (8\%) \\
\hline
Vascular invasion & & 1 (11\%) & 0 (0\%) \\
\hline
Mismatch repair protein \\
\hline
& Normal expression & 9 (100\%) & 23 (96\%) \\
\hline
& Loss & 0 (0\%) & 1 (4\%) \\
\hline
\end{tabular}
\end{table} | PMC4605595_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
N1A—H1A···O1Ai & 0.85 (3) & 2.02 (3) & 2.852 (3) & 165 (2) \\
\hline
N1B—H1B···O1Bi & 0.83 (3) & 2.02 (3) & 2.833 (3) & 165 (2) \\
\hline
C7A—H72A···Cg1ii & 0.96 & 2.71 & 3.637 (3) & 163 \\
\hline
C8B—H83B···Cg2iii & 0.96 & 2.70 & 3.640 (3) & 167 \\
\hline
\end{tabular}
\end{table} | PMC3344021_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{All patients (n = 173)} & \textbf{IPAa Patients with (n = 15)} & \textbf{Patients without IPA (n = 158)} \\
\hline
Cultured samples & 298b & 37 & 261 \\
\hline
Positive (\% and 95\% CI) & 63 (21.1\% 16–26\%) & 27 (73\%, 58–88\%) & 36 (13.8\%, 10–18\%) \\
\hline
Samples with MycAssay determinations & 308 & 37 & 271 \\
\hline
CI)c Positive (\% and 95\% & 51(16.5\%, 13–21\%) & 24 (64.9\%; 49–81\%) & 27 (10.3\%, 7–14\%) \\
\hline
Concordance between fungal \\
\hline
MycAssayd culture and \\
\hline
Culture 2/MycAssay 2 (\% and 95\% CI) & 217 (72.8\%, 68–78\%) & 9 (24.3\%, 10–39\%) & 208 (79.7\%, 75–85\%) \\
\hline
+/MycAssay + Culture (\% and 95\% CI) & 33 (11.1\%, 7–15\%) & 23 (62.2\%, 46–79\%) & 10 (3.8\%, 1–6\%) \\
\hline
+ Culture 2/MycAssay (\% and 95\% CI) & 18 (6\%, 3–9\%) & 1 (2.7\%, 23–8\%) & 17 (6.5\%, 3–10\%) \\
\hline
+/MycAssay Culture 2 (\% and 95\% CI) & 30 (10.1\%, 7–14\%) & 4 (10.8\%, 0–21\%) & 26 (10\%, 6–14\%) \\
\hline
\end{tabular}
\end{table} | PMC3631214_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Diagnosis} & \textbf{Sex} & \textbf{Age} & \textbf{PaO2/FiO2} & \textbf{LIS} & \textbf{APACHEII} & \textbf{PEEP} & \textbf{Outcome} \\
\hline
Group A: FO \\
\hline
1. Pneumonia & M & 74 & 98 & 4 & 18 & 7 & D \\
\hline
2. Pneumonia & M & 48 & 166 & 2.3 & 17 & 8 & D \\
\hline
3. Pneumonia & M & 64 & 133 & 3.6 & 18 & 12 & D \\
\hline
4. Sepsis & M & 50 & 189 & 3 & 15 & 10 & L \\
\hline
5. Smoke aspiration & M & 40 & 132 & 3 & 16 & 11 & L \\
\hline
6. Bronchoaspiration & M & 72 & 84 & 2.6 & 21 & 8 & D \\
\hline
7. Mediastinitis & M & 70 & 147 & 3.3 & 19 & 10 & L \\
\hline
8. Bronchoaspiration & M & 36 & 183 & 2.5 & 15 & 7 & L \\
\hline
Total Group A: & 8 M & 56 $\pm$ 15 & 141 $\pm$ 37 & 3 $\pm$ 0.5 & 17.4 $\pm$ 2.1 & 9.1 $\pm$ 1.9 & 4D/4L \\
\hline
Group B: LCT \\
\hline
1. Pancreatitis & F & 52 & 152 & 3 & 16 & 11 & L \\
\hline
2. Bronchoaspiration & M & 57 & 198 & 4 & 21 & 15 & L \\
\hline
3. Bronchoaspiration & M & 56 & 177 & 2.6 & 17 & 9 & D \\
\hline
4. Status postpneumectomy & M & 63 & 60 & 4 & 19 & 10 & L \\
\hline
5. Pneumonia & M & 71 & 181 & 3 & 18 & 10 & L \\
\hline
6. Pneumonia & M & 43 & 186 & 3.3 & 14 & 8 & L \\
\hline
7. Pneumonia & M & 53 & 153 & 3 & 19 & 10 & D \\
\hline
8. Pneumonia & F & 81 & 157 & 3 & 22 & 9 & L \\
\hline
Total Group B & 6M/2F & 59 $\pm$ 12 & 158 $\pm$ 43 & 3.2 $\pm$ 0.5 & 18.2 $\pm$ 2.6 & 10.3 $\pm$ 2.1 & 2D/6L \\
\hline
Total n:16 & 14M/2F & 58 $\pm$ 13 & 149 $\pm$ 40 & 3.1 $\pm$ 0.5 & 17.8 $\pm$ 2.3 & 9.7 $\pm$ 2 & 6D/10L \\
\hline
\end{tabular}
\end{table} | PMC3080285_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
Bruker SMART CCD area-detector diffractometer & 2501 independent reflections \\
\hline
Radiation source: fine-focus sealed tube & 1817 reflections with I > 2σ(I) \\
\hline
graphite & Rint = 0.058 \\
\hline
φ and ω scans & θmax = 26.1°, θmin = 1.9° \\
\hline
Absorption correction: multi-scan (SADABS; Bruker, 2001) & h = −19→28 \\
\hline
Tmin = 0.399, Tmax = 1.000 & k = −7→7 \\
\hline
6895 measured reflections & l = −22→21 \\
\hline
\end{tabular}
\end{table} | PMC3089252_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{ID} & \textbf{Phylum} & \textbf{Class} & \textbf{Order} & \textbf{Family} & \textbf{Genus} \\
\hline
& Cyanobacteria & Oscillatoriophycideae & Oscillatoriales & Microcoleus & Microcoleus \\
\hline
L1B56 & Proteobacteria & Alphaproteobacteria & Rhizobiales & Bradyrhizobiaceae & Bosea \\
\hline
D1B20 & Proteobacteria & Alphaproteobacteria & Rhizobiales & Methylobacteriaceae & Methylobacterium \\
\hline
L1B44 & Actinobacteria & Actinobacteria & Frankiales & Geodermatophilaceae & Modestobacter \\
\hline
D1B45 & Actinobacteria & Actinobacteria & Micrococcales & Micrococcaceae & Arthrobacter \\
\hline
L2B47 & Firmicutes & Bacilli & Bacillales & Bacillaceae & Bacillus (1) \\
\hline
D1B51 & Firmicutes & Bacilli & Bacillales & Bacillaceae & Bacillus (2) \\
\hline
\end{tabular}
\end{table} | PMC4595634_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Individual} & \textbf{Sex} & \textbf{Age} & \textbf{Mutation and origin} & \textbf{Pre-op Ct} & \textbf{US results} & \textbf{Histology} & \textbf{ADM (years)} & \textbf{LN+/resecteda} & \textbf{pTNM} \\
\hline
IV-10 & F & 22 & p.C634Y/V292M/R67H/R982C, Pat and Mat & 343.92 & Negative; TT & Bi-MTC & 13 (onset) & 5/51 & T2N1aM0 (stage III) \\
\hline
II-5 & M & 70 & p.V292M/R67H/R982C, Pat & 76.35 & Negative; TT & Bi-MTC & 70 & 0/15 & T1N0M0 (stage I) \\
\hline
III-3 & M & 48 & p.V292M/R67H/R982C, Pat & 49.86 & Negative; AS & No spec & 48 & No spec & No spec \\
\hline
III-8 & F & 46 & p.V292M/R67H/R982C, Pat & 43.72 & Negative; AS & No spec & 46 & No spec & No spec \\
\hline
III-11 & M & 44 & p.V292M/R67H/R982C, Pat & 58.66 & Negative; TT & Bi-CCH & 44 & - & - \\
\hline
IV-3 & M & 22 & p.V292M/R67H/R982C, Pat & 39.34 & Normal & - & - & - & - \\
\hline
IV-7 & F & 19 & p.V292M/R67H/R982C, Pat & 59.21 & Normal & - & - & - & - \\
\hline
III-12* & F & 43 & p.C634Y, Mat & 408.32 & Negative; TT & Bi-MTC & 28 (onset) & 3/40 & T2N1aM0 (stage III) \\
\hline
III-15 & M & 41 & p.C634Y, Mat & 104.35 & Negative; TT & Bi-MTC & 39 & 2/22 & T1N1aM0 (stage III) \\
\hline
III-20 & F & 56 & p.C634Y, Mat & 260.49 & Negative; TT & Bi-MTC & 52 (onset) & 3/23 & T1N1aM0 (stage III) \\
\hline
III-23 & M & 50 & p.C634Y, Mat & 163.23 & Negative; TT & Bi-MTC & 50 (onset) & 2/26 & T2N1aM0 (stage III) \\
\hline
IV-21 & M & 25 & p.C634Y, Mat & 34.70 & Negative; TT & Bi-MTC & 24 & 0/15 & T1N0M0 (stage I) \\
\hline
\end{tabular}
\end{table} | PMC3105051_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Strategies} & \textbf{Sn} & \textbf{Sp} & \textbf{Acc} & \textbf{MCC} \\
\hline
SEQ+WS & 0.688 & 0.941 & 0.857 & 0.669 \\
\hline
WS only & 0.627 & 0.960 & 0.849 & 0.652 \\
\hline
SEQ+WS, without AUTO-MUTE_RF & 0.658 & 0.925 & 0.836 & 0.622 \\
\hline
WS only, without AUTO-MUTE_RF & 0.701 & 0.745 & 0.731 & 0.484 \\
\hline
\end{tabular}
\end{table} | PMC3549852_table_5 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{anti-PDI* Negative for (n = 848)} & \textbf{anti-PDI{ Positive for (n = 308)} & \textbf{p-value} \\
\hline
Age & 52.7 (7.9) & 52.0 (7.0) & 0.1354 \\
\hline
Male Sex & 454 (54\%) & 171 (56\%) & 0.5500 \\
\hline
BMI & 31.0 (6.8) & 31.4 (7.0) & 0.3858 \\
\hline
Smoking \\
\hline
Never & 400 (47\%) & 164 (53\%) & 0.1625 \\
\hline
Past & 325 (38\%) & 101 (33\%) \\
\hline
Current & 123 (15\%) & 43 (14\%) \\
\hline
At least some college education & 632 (75\%) & 236 (77\%) & 0.4665 \\
\hline
obesity{ Abdominal & REF & 1.26 (0.96, 1.66) & 0.0925 \\
\hline
Triglycerides{ Raised & REF & 1.21 (0.93, 1.58) & 0.1636 \\
\hline
HDL{ Reduced & REF & 1.37 (1.05, 1.79) & 0.0199 \\
\hline
Hypertension{ & REF & 1.29 (0.98, 1.69) & 0.0685 \\
\hline
glucose{ Raised fasting & REF & 1.33 (1.01, 1.76) & 0.0457 \\
\hline
Syndrome{ Metabolic & REF & 1.46 (1.11, 1.92) & 0.0062 \\
\hline
(mg/dL)){,1 Log (CRP & 1.08 (0.04) & 1.12 (0.06) & 0.5957 \\
\hline
mg/dL{,1 CRP.3 & REF & 1.01 (0.75, 1.36) & 0.9440 \\
\hline
mg/dL{,1 CRP.10 & REF & 1.03 (0.61, 1.74) & 0.9246 \\
\hline
(iu/ml){,1 Insulin & 12.0 (0.37) & 12.3 (0.60) & 0.6078 \\
\hline
\end{tabular}
\end{table} | PMC3176794_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Article section} & \multicolumn{2}{c|}{\textbf{Main fact}} & \multicolumn{2}{c|}{\textbf{Subfact}} & \multicolumn{2}{c|}{\textbf{Synonym fact}} & \multicolumn{2}{c|}{\textbf{Extra fact}} \\
\hline
\textbf{Title} & \textbf{8.2} & \textbf{(1.5)} & \textbf{8.9} & \textbf{(3.2)} & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\
\hline
Abstract & 42.5 & (18.7) & 38.1 & (23.9) & 13.3 & (13.3) & 14.6 & (13.1) \\
\hline
Introduction & 20.9 & (6.7) & 32.8 & (18.6) & 13.3 & (12.6) & 9.9 & (8.0) \\
\hline
Results & 43.3 & (20.9) & 73.7 & (35.2) & 3.0 & (3.0) & 16.9 & (13.1) \\
\hline
Discussion & 36.6 & (14.9) & 44.5 & (21.1) & 0.7 & (\textbf{\textbf{0.0}}) & 3.8 & (3.8) \\
\hline
Figure Heading & 9.7 & \textbf{(1.5)} & 30.8 & (13.4) & 0.7 & (0.7) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\
\hline
Figure Legend & 7.5 & (0.7) & 16.2 & (9.7) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 5.2 & (5.2) \\
\hline
Table Data & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 0.4 & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\
\hline
Methods & 0.7 & (\textbf{\textbf{0.0}}) & 2.0 & (0.8) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 4.2 & (3.3) \\
\hline
Conclusion & 1.5 & (0.7) & 1.6 & (1.2) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\
\hline
Footnotes & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 3.7 & (3.0) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\
\hline
Section Headings & 11.2 & \textbf{(1.5)} & 22.3 & (9.7) & 0.7 & (0.7) & 0.5 & (0.5) \\
\hline
\end{tabular}
\end{table} | PMC2761905_table_4 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Substrate} & \textbf{Residual glucose (g/L)} & \textbf{Residual starch (g/L)} & \textbf{Total ABE produced (g/L broth)} & \textbf{Yield (g/g)} & \textbf{Productivity (g/L/h)} \\
\hline
Glucose (control) & 16.2 & – & 14.2 & 0.35 & 0.22 \\
\hline
Food waste (81 g/L) & 5.4 & 5.3 & 18.8 & 0.38 & 0.46 \\
\hline
Food waste (129 g/L) & 21.7 & 17.8 & 19.7 & 0.36 & 0.41 \\
\hline
Food waste (181 g/L) & 40.5 & 32.6 & 20.9 & 0.37 & 0.42 \\
\hline
Food waste (228 g/L) & 61.7 & 50.2 & 19.1 & 0.38 & 0.38 \\
\hline
Food waste vacuum (129 g/L) & 1.1 & 16.0 & 27.2 & 0.36 & 0.49 \\
\hline
\end{tabular}
\end{table} | PMC4572674_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Agent}} & \multirow{2}{*}{\textbf{Strain E. coli MG1655}} & \multirow{2}{*}{\textbf{EAEC 042}} \\
\hline
\\
\hline
Chloramphenicol & 4a & .32 \\
\hline
Tetracyline & 2 & .32 \\
\hline
Streptomycin & 2 & .128 \\
\hline
Spectinomycin & 16 & .128 \\
\hline
Nalidixic acid & 8 & 2 \\
\hline
Ciprofloxacin & ,0.015 & ,0.015 \\
\hline
Gentamicin & 0.5 & 0.5 \\
\hline
Erythromycin & 32 & 32 \\
\hline
Ceftriaxone & 0.06 & 0.06 \\
\hline
Cloxacillin & .128 & .128 \\
\hline
Triclosan & ,0.03 & ,0.03 \\
\hline
Ethidium bromide & 512 & 256 \\
\hline
Acriflavine & 128 & 64 \\
\hline
\end{tabular}
\end{table} | PMC2808357_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
A Category & Functional annotation & p-value & # genes \\
\hline
Cellular development & development of lymphocytes & 8.17E-03 & 6 \\
\hline
\multirow{3}{*}{Cellular movement} & cell movement of neutrophils & 2.14E-04 & 6 \\
\hline
chemotaxis & 5.45E-03 & 6 \\
\hline
migration of cells & 1.30E-02 & 12 \\
\hline
Cell-to-cell signaling & activation of cells & 5.17E-03 & 8 \\
\hline
\multirow{4}{*}{Hematological system} & quantity of neutrophils & 6.78E-05 & 6 \\
\hline
differentiation of hematopoietic progenitor cells & 8.45E-05 & 6 \\
\hline
differentiation of blood cells & 1.55E-02 & 7 \\
\hline
quantity of leukocytes & 1.91E-03 & 10 \\
\hline
\multirow{2}{*}{Immunological disease} & hypersensitive reaction & 9.54E-04 & 7 \\
\hline
systemic autoimmune syndrome & 7.88E-04 & 11 \\
\hline
\multirow{2}{*}{Inflammatory response} & inflammation of lung & 1.70E-03 & 6 \\
\hline
inflammatory response & 4.54E-03 & 7 \\
\hline
Organismal injury & fibrosis & 6.89E-03 & 6 \\
\hline
B Category & Functional annotation & p-value & # genes \\
\hline
Carbohydrate metabolism & uptake of monosaccharide & 4.14E-02 & 4 \\
\hline
Cellular growth and proliferation & formation of cells & 1.88E-02 & 6 \\
\hline
Free radical scavenging & synthesis of reactive oxygen species & 5.17E-03 & 8 \\
\hline
Hematological system & homeostasis of blood & 2.93E-03 & 3 \\
\hline
\multirow{2}{*}{Inflammatory response} & inflammatory response & 2.74E-02 & 8 \\
\hline
inflammation of body region & 2.95E-02 & 9 \\
\hline
Muscular disorders & congenital anomaly of musculoskeletal system & 6.50E-04 & 10 \\
\hline
Nucleic acid metabolism & metabolism of nucleic acid component & 1.06E-02 & 8 \\
\hline
Tissue development & growth of epithelial tissue & 3.59E-02 & 7 \\
\hline
\end{tabular}
\end{table} | PMC4532500_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Number of stool samples (ss) collected} & \textbf{Men/women/not known} & \textbf{Children/adults/not known} & \textbf{Number of detected A. baumannii (locations)} & \textbf{blaOXA23-like-positive A. baumannii} \\
\hline
Year 2008 : 150 ss \\
\hline
Dielmo: 73 ss & 71/79/0 & 150/0/0 & 9 (Dielmo) & 0 \\
\hline
Ndiop: 77 ss \\
\hline
Year 2009 : 496 ss \\
\hline
Dielmo: 232 ss \\
\hline
Ndiop: 258 ss & 222/256/18 & 246/222/28 & 27 (Dielmo: 20; Ndiop: 7) & 4 (Ndiop) \\
\hline
Dakar: 4 ss \\
\hline
Nhiakar: 2 ss \\
\hline
Year 2010 : 20 ss \\
\hline
Dielmo: 20 ss & 11/9/0 & 11/6/3 & 1 (Dielmo) & 0 \\
\hline
Year 2011 : 51 ss \\
\hline
Mbao: 28 ss \\
\hline
Dominique-Pikine: 7 ss & 28/23/0 & 22/29/0 & 2 (Mbao) & 2 (Mbao) \\
\hline
Roi Baudoin: 6 ss \\
\hline
IHS: 4 ss \\
\hline
Saint Martin: 6 ss \\
\hline
\end{tabular}
\end{table} | PMC3380006_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Functional cluster1} & \textbf{Gene ontology (GO)} & \textbf{Gene IDs identified in the functional cluster} \\
\hline
Vascular development & GO:0001568 blood vessel development GO:0001944 vasculature development GO:0048514 blood vessel morphogenesis GO:0001525 angiogenesis GO:0016477 cell migration GO:0051674 localization of cell GO:0048870 cell motility & ANPEP2, CD442, CTGF2, CTHRC1, HTATIP2, IL1B2, IL182, ITGA62, NRP12, PLAU2, S100A2, QKI2, TGM2, THBS12 \\
\hline
Coagulation & GO:0042060 wound healing GO:0050817 coagulation GO:0007596 blood coagulation GO:0007599 hemostasis GO:0050878 regulation of body fluid levels & CD9, CD442, DCBLD2, F2RL2, IL1B2, ITGA22, PLAU2, TFPI22 \\
\hline
Cell-matrix interaction & GO:0030155 regulation of adhesion GO:0009611 response to wounding GO:0006928 cell motion GO:0050840 extracellular matrix binding GO:0045785 positive regulation of cell adhesion GO:0005178 integrin binding GO:0043236 laminin binding GO:0007155 cell adhesion GO:0022610 biological adhesion GO:0007160 cell-matrix adhesion GO:0005518 collagen binding GO:0031589 cell-substrate adhesion GO:0032403 protein complex binding GO:0009986 cell surface & ARHGDIB, CA2, CD9, CD442, CTGF2, DCBLD2, ITGA22, ITGA62, IL1B2, IL182, NRP12, PERP, PTPRR, SPP1, TGFB1, TGM2, THBS12 \\
\hline
\end{tabular}
\end{table} | PMC4637310_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Provider assesses 100\% of women (n = 96)} & \textbf{Provider assesses fewer than 100\% of women (n = 26)} \\
\hline
& Correct n (\%) & Correct n (\%) & p- valuea \\
\hline
Knowledge of risk \\
\hline
Smoking during pregnancy increases the risk of: \\
\hline
Miscarriage (losing the baby) & 90 (94) & 21 (81) & 0.055 \\
\hline
Low birth weight of baby & 96 (100) & 24 (92) & 0.044 \\
\hline
Breathing problems and sickness in infant & 93 (97) & 25 (96) & 1.000 \\
\hline
Mother having high blood pressure and increased heart rate (pre- eclampsia)b & 3 (3) & 1 (4) & 1.000 \\
\hline
Behavioural problems in childhood & 55 (57) & 13 (50) & 0.514 \\
\hline
Total knowledge of risk score (median (Q1, Q3)) & 4 (3, 4) & 3.5 (3, 4) & 0.247 \\
\hline
Knowledge of cessation \\
\hline
Nicotine replacement therapy (patches, gum etc) can help women quit & 85 (89) & 20 (77) & 0.197 \\
\hline
Nicotine replacement therapy shouldn’t be used in pregnancy & 71 (74) & 11 (42) & 0.004 \\
\hline
An effective way to quit during pregnancy is to just stop altogether, right away & 48 (50) & 13 (50) & 1.000 \\
\hline
An effective way to quit during pregnancy is to reduce by 1 to 2 dayc cigarettes each & 26 (27) & 4 (15) & 0.306 \\
\hline
Total knowledge of smoking cessation score (median(Q1, Q3)) & 2 (2, 3) & 2 (1, 2) & 0.010 \\
\hline
\end{tabular}
\end{table} | PMC3311138_table_1 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Technical validation step} & \textbf{ELM-2} \\
\hline
Target & MMP-9 and 212 degraded human elastin at amino acid number 552 \\
\hline
Detection range/standard curve & 1.82–250ng/mL \\
\hline
Dilution range of serum samples & 1:2 is recommended \\
\hline
Dilution range of plasma samples & 1:2, 1:3 and 1:4 is recommended \\
\hline
Dilution recovery of human serum* & 98\% \\
\hline
Dilution recovery of human plasma* & 97\% \\
\hline
Intra-assay variation** & 6.4\% \\
\hline
Inter-assay variation** & 12\% \\
\hline
Analyte stability*** & 96\% \\
\hline
LLOQ & 5.4 ng/mL \\
\hline
\end{tabular}
\end{table} | PMC3689773_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene Symbol} & \textbf{Ensembl ID} & \textbf{Description} \\
\hline
PTH & ENSG00000152266 & Parathyroid hormone precursor (Parathyrin) (PTH) (Parathormone) \\
\hline
AGTR1 & ENSG00000144891 & Type-1 angiotensin II receptor (AT1) (AT1AR) (AT1BR). \\
\hline
EDNRA & ENSG00000151617 & Endothelin-1 receptor precursor (Endothelin A receptor) (ET-A) (hET- AR) (ETA-R). \\
\hline
AGT & ENSG00000135744 & Angiotensinogen precursor (Serpin A8) [Contains: Angiotensin-1 (Angiotensin I) (Ang I); Angiotensin-2 (Angiotensin II) (Ang II); Angiotensin-3 (Angiotensin III) (Ang III) (Des-Asp[1]-angiotensin II)]. \\
\hline
REN & ENSG00000143839 & Renin precursor (EC 3.4.23.15) (Angiotensinogenase) \\
\hline
HCN4 & ENSG00000138622 & Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4 \\
\hline
EDNRB & ENSG00000136160 & Endothelin B receptor precursor (ET-B) (Endothelin receptor Non- selective type). \\
\hline
HCN2 & ENSG00000099822 & Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Brain cyclic nucleotide- gated channel 2) (BCNG-2). \\
\hline
ANG & ENSG00000214274 & Angiogenin precursor (EC 3.1.27.-) (Ribonuclease 5) (RNase 5). \\
\hline
NPPA & ENSG00000175206 & Atrial natriuretic factor precursor (ANF) (Atrial natriuretic peptide) (ANP) (Prepronatriodilatin) (CDD-ANF) [Contains: Cardiodilatin-related peptide (CDP)]. \\
\hline
INS & ENSG00000129965 & Insulin precursor [Contains: Insulin B chain; Insulin A chain] \\
\hline
ACE & ENSG00000159640 & Angiotensin-converting enzyme \\
\hline
EDN1 & ENSG00000078401 & Endothelin-1 precursor (Preproendothelin-1) (PPET1) [Contains: Endothelin-1 (ET-1); Big endothelin-1]. \\
\hline
\end{tabular}
\end{table} | PMC2946338_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{SFA} & \textbf{SMA} & \textbf{AI} & \textbf{AO} & \textbf{AC} & \textbf{TDCE} & \textbf{logSOL} & \textbf{awake} \\
\hline
\textbf{SFA} & 1 & -0.882*** & 0.515*** & -0.031 & 0.170* & 0.172* & 0.218* & 0.076 \\
\hline
\textbf{SMA} & & 1 & -0.292*** & 0.292*** & -0.240*** & -0.181* & -0.068 & -0.003 \\
\hline
\textbf{AI} & & & 1 & -0.023 & 0.280*** & 0.196* & 0.322*** & 0.079 \\
\hline
\textbf{AO} & & & & 1 & -0.422*** & 0.071 & -0.041 & 0.001 \\
\hline
\textbf{AC} & & & & & 1 & 0.147 & 0.009 & -0.096 \\
\hline
\textbf{TDCE} & & & & & & 1 & 0.235** & 0.017 \\
\hline
\textbf{logSOL} & & & & & & & 1 & 0.329*** \\
\hline
\textbf{awake} & & & & & & & & 1 \\
\hline
\end{tabular}
\end{table} | PMC2770539_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Parameters} & \textbf{Group} & \textbf{Total} & \multicolumn{2}{c|}{\textbf{lncRNA ANRIL}} & \textbf{P value} \\
\hline
& & & \textbf{Low} & \textbf{High} \\
\hline
\multirow{2}{*}{Gender} & \multirow{2}{*}{Male 51 23 28 Female 36 16 20} & \multirow{2}{*}{0.952} \\
\hline
\\
\hline
\multirow{2}{*}{Age (years)} & \multirow{2}{*}{<60 42 18 24 $\geq$60 45 21 24} & \multirow{2}{*}{0.721} \\
\hline
\\
\hline
\multirow{2}{*}{Tumor size (cm)} & \multirow{2}{*}{<3 cm 39 16 23 $\geq$3 cm 48 23 25} & \multirow{2}{*}{0.520} \\
\hline
\\
\hline
\multirow{2}{*}{Histology} & Adenocarcinoma & 38 & 20 & 18 & 0.197 \\
\hline
Squamous cell carcinoma & 49 & 19 & 30 \\
\hline
\multirow{2}{*}{TNM stage} & \multirow{2}{*}{I 26 19 7 II-III 61 20 41} & \multirow{2}{*}{0.001} \\
\hline
\\
\hline
\multirow{2}{*}{Lymph node metastasis} & \multirow{2}{*}{Absence 40 32 8 Presence 47 7 40} & \multirow{2}{*}{0.000} \\
\hline
\\
\hline
\end{tabular}
\end{table} | PMC4599723_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Spacegroup}} & \multirow{2}{*}{\textbf{PkAMA1 C2}} & \multirow{2}{*}{\textbf{PkAMA1-FabR31C2 C2}} \\
\hline
\\
\hline
a, b, c (Å) & 90.32, 105.70, 104.75 & 165.86, 71.81, 90.69 \\
\hline
(deg.) β & 98.04 & 116.37 \\
\hline
Z & 4 & 2 \\
\hline
(A3 Da-1) VM & 2.9 & 2.7 \\
\hline
Resolution (Å) & 47.09–2.45 (2.58–2.45) & 43.35–3.10 (3.27–3.10) \\
\hline
Unique reflections & 34848 (4876) & 17127 (2506) \\
\hline
Redundancy & 2.9 (2.5) & 3.1 (3.2) \\
\hline
Completeness (\%) & 97.3 (93.3) & 97.8 (99.1) \\
\hline
Rmerge & 0.100 (0.499) & 0.152 (0.778) \\
\hline
Rpim & 0.069 (0.376) & 0.097 (0.497) \\
\hline
I/σ(I) & 9.7 (1.9) & 7.8 (1.3) \\
\hline
CC(1/2)* & 0.99 (0.59) & 0.99 (0.70) \\
\hline
\end{tabular}
\end{table} | PMC4401722_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Crude odds ratio (95\% CI)} & \textbf{Adjusted odds ratio (95\% CI)} \\
\hline
Characteristics at ART initiation \\
\hline
Female & 0.69 (0.25, 1.94) \\
\hline
Age \\
\hline
,1 yr & 0.32 (0.05, 2.07) & 1.01 (0.05, 2.82) \\
\hline
1–1.9 yrs & 0.16 (0.03, 0.84) & 0.85 (0.14, 4.95) \\
\hline
2–4.9 yrs & 0.39 (0.07, 1.98) & 1.08 (0.10, 11.35)d \\
\hline
$5 yrs & 1 & 1 \\
\hline
Orphan & 7.22 (1.61, 32.45) & 17.30)e 3.32 (0.64, \\
\hline
Travel time \\
\hline
,1 hr & 1 & 1 \\
\hline
1–2 hrs & 0.34 (0.04, 3.16) & 0.51 (0.07, 3.86) \\
\hline
3–4 hrs & 0.20 (0.03, 1.65) & 0.36 (0.05, 2.37) \\
\hline
$5 hrs & 0.10 (0.01, 0.82) & 1.19)e 0.17 (0.02, \\
\hline
(.50th High SES percentile) & 2.28 (0.35, 15.00) \\
\hline
Education of the primary caregiver \\
\hline
None/Primary school & 1 \\
\hline
Secondary school/university & 1.22 (0.40, 3.78) \\
\hline
Underweighta & 0.87 (0.28, 2.68) \\
\hline
immunodeficiencyb Severe & 0.70 (0.24, 2.03) \\
\hline
High viral load copies/mL)c (.750,000 & 0.60 (0.17, 2.04) \\
\hline
ART regimen including stavudine & 0.47 (0.15, 1.48) \\
\hline
ART regimen including nevirapine & 0.35 (0.46, 0.98) & 1.03)f 0.33 (0.11, \\
\hline
ART regimen including fixed dose combinations & 2.30 (0.65, 8.10) \\
\hline
Characteristics at each viral load measure \\
\hline
Other people in the household on ART & 0.78 (0.48, 1.27) \\
\hline
\end{tabular}
\end{table} | PMC3084269_table_3 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{\% agreement with established EBV status}} \\
\hline
& \multirow{2}{*}{\textbf{Negative (N = 39) [95\% CI]}} & \multirow{2}{*}{\textbf{Acute infection (N = 15) [95\% CI]}} & \multirow{2}{*}{\textbf{Past infection (N = 464) [95\% CI]}} \\
\hline
\\
\hline
\multirow{2}{*}{Enzygnost} & 100 & 100 & 99.1 \\
\hline
[90.97\% – 100\%] & [78.2\% – 100\%] & [97.81\% – 99.75\%] \\
\hline
\multirow{2}{*}{Novagnost} & 89.7 & 100 & 86a, 98.8b \\
\hline
[75.78\% – 97.13\%] & [78.2\% – 100\%] & 89.02\%]a, 99.6\%]b [82.5\% – [97.1\% to \\
\hline
\multirow{2}{*}{Merifluor IFA} & 92.3 & 100 & 98.1 \\
\hline
[79.13\% – 98.38\%] & [78.2\% – 100\%] & [96.35\% – 99.11\%] \\
\hline
\end{tabular}
\end{table} | PMC3679805_table_6 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
Age groups & 6 (n = 11) & 7 (n = 10) & 8 (n = 15) & 9 (n = 13) & 10 (n = 12) \\
\hline
Mean $\pm$ SD & 6.5460.27 & 7.6860.24 & 8.4660.30 & 9.5960.28 & 10.2560.24 \\
\hline
Range & 6.1–6.9 & 7.27–7.96 & 8.00–8.94 & 9.12–9.96 & 10.02–10.69 \\
\hline
Gender (M/F) & 5/6 & 5/5 & 7/8 & 5/8 & 7/5 \\
\hline
\end{tabular}
\end{table} | PMC3315543_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{HCV related HCC (\%)} & \textbf{HCV related chronic hepatitis (\%)} & \textbf{P} \\
\hline
Anti HCV positive/ HCV RNA positive & 68 & 55 \\
\hline
HCV Genotyping done & 50 (73.53) & 42 (73.36) & 0.3637 \\
\hline
Genotype 1 & 14 (28) & 8 (19.05) & 0.1994 \\
\hline
Genotype 3 & 30 (60) & 32 (76.19) & 0.0633 \\
\hline
Genotype 4 & 6 (12) & 2 (4.76) & 0.1379 \\
\hline
\end{tabular}
\end{table} | PMC3643662_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{c|}{\textbf{mM \% Response to 10 RG2833}} \\
\hline
& \textbf{1.5-Fold Increase in Frataxin} & \textbf{2.0-Fold Increase in Frataxin} \\
\hline
Protein & 58 & 23 \\
\hline
mRNA & 72 & 50 \\
\hline
\end{tabular}
\end{table} | PMC3656936_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{interRAI PURS Score} & \textbf{Proportion of residents at baseline} & \textbf{Pressure ulcer rate at reassessment} & \textbf{Odds ratio, 95\% confidence} \\
\hline
0 & 18.9\% & 0.8\% & Reference \\
\hline
1 & 22.3\% & 2.0\% & 2.53 (1.53, 4.16) \\
\hline
2 & 17.9\% & 3.3\% & 4.21 (2.59, 6.83) \\
\hline
3 & 24.0\% & 5.4\% & 7.11 (4.50, 11.23) \\
\hline
4 & 10.1\% & 9.0\% & 12.28 (7.65, 19.72) \\
\hline
5 & 4.7\% & 9.9\% & 13.62 (8.01, 23.14) \\
\hline
6 & 1.8\% & 14.2\% & 20.53 (11.09, 38.01) \\
\hline
7-8 & 0.3\% & 21.1\% & 33.11 (10.14, 108.13) \\
\hline
\end{tabular}
\end{table} | PMC2955034_table_3 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Plant species} & \textbf{Tissue/organelle} & \textbf{Treatment} & \textbf{No. of identified candidates} & \textbf{Reference} \\
\hline
Arabidopsis thaliana & Cell cultures & GSNO-treated protein extracts & 63 & Lindermayr et al. (2005) \\
\hline
Arabidopsis thaliana & Leaves & Plants treated with gaseous NO & 52 & Lindermayr et al. (2005) \\
\hline
Kalanchoe pinnata & Leaves & GSNO-treated protein extracts & 19 & Abat et al. (2008) \\
\hline
Arabidopsis thaliana & Leaf mitochondria & GSNO-treated protein extracts & 11 & Palmieri et al. (2010) \\
\hline
Arabidopsis thaliana & Cell cultures & GSNO-treated protein extracts & 27 & Maldonado-Alconada et al. (2011) \\
\hline
Arabidopsis thaliana & Leaves & Pseudomonas syringae avir/vir & 119 & Maldonado-Alconada et al. (2011) \\
\hline
Arabidopsis thaliana & Cell cultures & untreated & 53 & Fares et al. (2011) \\
\hline
Solanum tuberosum & Leaves & GSNO-treated protein extracts & 34 & Kato et al. (2012) \\
\hline
Solanum tuberosum & Tubers & GSNO-treated protein extracts & 46 & Kato et al. (2012) \\
\hline
Oryza sativa (WT) & Leaves & High light & 73 & Lin et al. (2012) \\
\hline
Oryza sativa (nitric oxide excess1 mutant; noe1) & Leaves & High light & 100 & Lin et al. (2012) \\
\hline
Pisum sativum & Leaf peroxisomes & GSNO-treated peroxisomes & 6 & Ortega-Galisteo et al. (2012) \\
\hline
Pisum sativum & Leaf mitochondria & Salt-stressed plants & 24 & Camejo et al. (2012) \\
\hline
\end{tabular}
\end{table} | PMC3653056_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{VAD group} & \textbf{Control group} \\
\hline
Pregnant rate & 45.9\% (11/24) & 75.0\% (6/8) \\
\hline
Incidence of embryos dead & 45.5\% (5/11) & 0\% \\
\hline
Filial No. of embryonic & 10.1761.47 (61/6) & 9.8360.75 (59/6) \\
\hline
Filial No. of radiography & 58 & 56 \\
\hline
\end{tabular}
\end{table} | PMC3465343_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Year of outbreak} & \textbf{Number of cases} & \textbf{Serotype} & \textbf{Implicated source} & \textbf{Reference} \\
\hline
1993 & 18 & 1/2b & Rice salad & [41] \\
\hline
1994 & 45 & 1/2b & Chocolate milk & [30] \\
\hline
1997 & 1566 & 4b & Cold-corn-and-tuna salad & [31] \\
\hline
1998 & 5 & 1/2a & Cold smoked trout & [42] \\
\hline
2000 & 32 & 1/2 & Corned beef and ham & [43] \\
\hline
2001 & 16 & 1/2a & Delicatessen meat & [44] \\
\hline
2001 & 48 & 1/2a & Cheese & [45] \\
\hline
\end{tabular}
\end{table} | PMC3003996_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Plasmodium falciparum FCB1} & \textbf{0.53 $\pm$ 0.2} \\
\hline
Leishmania donovani & IC50 > 100 \\
\hline
NSCLC-N6 & IC50 > 35 \\
\hline
A 549 & IC50 > 35 \\
\hline
KMS-11 & IC50 > 60 \\
\hline
GBM & IC50 > 60 \\
\hline
HCT-116 & IC50 > 60 \\
\hline
Trypanosoma brucei & MEC > 100 \\
\hline
\end{tabular}
\end{table} | PMC3705406_table_1 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Aptamer} & \textbf{Sequence} \\
\hline
30-14 & 59AGATGCCTGTCGAGCATGCTGTTGTGGTAGGGTTAGGGATGGTAGCGGTTGTAGCTAAACTGCTTTGTCGACGG93 \\
\hline
30-16/27 & 59TACCGTGGTAGGGAAGGTTGGAGTGTA93 \\
\hline
30-38/27 & 59ACCCGTGGTAGGGTAGGATGGGGTGGT93 \\
\hline
60-18/38 & 59CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA93 \\
\hline
G15D & 59GGTTGGTGTGGTTGG93 \\
\hline
30-8 & 59AGATGCCTGTCGAGCATGCTGTGAATAGGTAGGGTCGGATGGGCTACGGTGTAGCTAAACTGCTTTGTCGACGGG93 \\
\hline
\end{tabular}
\end{table} | PMC3288073_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Group} & \textbf{Isoform} & \textbf{Average} & \textbf{Median} & \textbf{Range} & \textbf{St. dev.} \\
\hline
\multirow{2}{*}{A} & VDRl & 2368 & 2368 & 987 - 3749 & 1953.6 \\
\hline
VDRs & 751 & 654 & 407-1371 & 401.7 \\
\hline
\multirow{2}{*}{B} & VDRl & 1088 & 833 & 4-2427 & 1231.5 \\
\hline
VRDs & 1658 & 1581 & 30-3442 & 1407.4 \\
\hline
\end{tabular}
\end{table} | PMC3532837_table_3 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Domain} & \textbf{Question (Q) or instrument (I) in CGA} & \textbf{Condition/disease} \\
\hline
Physical \\
\hline
Medication & Do you experience difficulties or side effect with medication use? Polypharmacy defined as the use or three or more different medications Medication adherence (questionnaire of Aburuz) [55] & Medication safety and side effects Polypharmacy Medication adherence \\
\hline
Mobility and stability & Have you fallen once or more in the past twelfth months? [56] Fear of falling (FES-I) [57] Do you experience dizziness? Fracture risk score [57,58] & Falls Fear of falling Dizziness Osteoporosis risk \\
\hline
Nutrition & Short Nutritional Assessment Questionnaire (SNAQ) [59] Have you been admitted to a hospital because of dehydration? Difficulties with swallowing? Do you have pain in your mouth? & Malnutrition Dehydration Swallowing disturbance Oral hygiene \\
\hline
Urine and fecal problems & Do you experience urinary incontinence? Do you experience fecal incontinence? Do you have a indwelling urinary catheter? Do you experience obstipation? & Urinary incontinence Feacal incontinence Indwelling urinary catheter use Obstipation \\
\hline
Skin & Do you have pressure ulcer(s)? & Pressure ulcer \\
\hline
Pain & Visual analogue scale for pain [60] & Pain \\
\hline
Allergy & Are you allergic? & Allergy \\
\hline
Phychological \\
\hline
Cognition & Do you have memory problems? Mini- Mental State Examination (MMSE) [20] & Cognitive impairment \\
\hline
Delirium & Have you ever experienced a delirium? Confusement Assessment Method(CAM) [61] & Delirium \\
\hline
Depression & Geriatric depression Scale (GDS-2, GDS-15) [21,62] & Depression \\
\hline
Anxiety & Do you feel anxious? & Anxiety \\
\hline
Dependency & Do you smoke? Use of alcohol [63,64] Do you use benzodiazepines? & Alcohol, smoking and medication use \\
\hline
Functional \\
\hline
ADL functioning & Modified Katz ADL index score [31] & ADL dependency \\
\hline
IADL functioning & IADL questions of Lawton and Brody [32] & IADL dependency \\
\hline
Mobility difficulty & Are you using a walking aid? & Mobility difficulty \\
\hline
Hearing & Do you experience difficulties with hearing, despite the use of a hearing aid? & Hearing impairment \\
\hline
Visual & Do you experience difficulties with your vision, despite the use of glasses? & Visual impairment \\
\hline
Sleep & Do you experience problems with sleeping? Do you use sleeping medication? If yes, how often? & Sleeping disorder \\
\hline
Social \\
\hline
Loneliness & Jong Gierveld-questionnaire [38] & Loneliness \\
\hline
Finance & Can you manage financially? & Finance \\
\hline
Health related quality of live & EQ-6D [34] & Health related quality of live \\
\hline
Burden of caregiver & CarerQol instrument [37] & Burden of caregiver \\
\hline
Physical examination \\
\hline
Body mass index & (kg/m2) & Obesity or weight loss \\
\hline
Blood pressure & (mmHg) & Hypertension \\
\hline
Pulse & (beats/min) & Pulse \\
\hline
Grip strength & Maximal grip strength in the dominant hand (kg) [22] & Frailty \\
\hline
Walking speed & Walk three meter at usual pace (seconds) [22] & Frailty \\
\hline
\end{tabular}
\end{table} | PMC3374886_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{RAST Pathway} & \textbf{Description} & \textbf{ORF(s)} \\
\hline
\multirow{8}{*}{Citrate Metabolism, Transport, and Regulation} & 2-(50-triphosphoribosyl)-39-dephosphocoenzyme-A synthase (EC 2.7.8.25) & YP_810049.1a \\
\hline
Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase (EC 2.7.7.61) & YP_810048.1a \\
\hline
Citrate lyase alpha chain (EC 4.1.3.6) & YP_810047.1a \\
\hline
Citrate lyase beta chain (EC 4.1.3.6) & YP_810046.1a \\
\hline
Citrate lyase gamma chain, acyl carrier protein (EC 4.1.3.6) & YP_810045.1a \\
\hline
Citrate lyase transcriptional regulator CitI & YP_810041.1a \\
\hline
Oxaloacetate decarboxylase involved in citrate fermentation (EC 4.1.1.3) & YP_810042.1a \\
\hline
[Citrate [pro-3S]-lyase] ligase (EC 6.2.1.22) & YP_810044.1a \\
\hline
\end{tabular}
\end{table} | PMC3250461_table_3 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\multicolumn{4}{c|}{\textbf{Recipient information}} & \multicolumn{4}{c|}{\textbf{Donor (ELA-A2) information}} \\
\hline
\textbf{\textbf{Horsea}} & \textbf{Breed} & \textbf{Age (years)} & \textbf{Sex} & \textbf{\textbf{Horsea}} & \textbf{MSC passage} & \textbf{MSC MHC class II status} & \textbf{Number of MSCs injected} \\
\hline
A & Grade & 20 & Gelding & 4 (1) & P4 & Negative & 106 46 × \\
\hline
B & Thoroughbred & 15 & Gelding & 9 & P5 & Negative & 106 50 × \\
\hline
C & Holsteiner & 13 & Gelding & ND & P5 & Negative & 106 50 × \\
\hline
D & Standardbred & 16 & Gelding & 9 & P3 & Positive & 106 50 × \\
\hline
E & Thoroughbred & 15 & Mare & 6 & P5 & Positive & 106 33 × \\
\hline
F & Thoroughbred & 18 & Gelding & 4 (2) & P5 & Positive & 106 50 × \\
\hline
Control (Horse 2) & Thoroughbred & 14 & Gelding & 9 & P5 & Negative & 106 50 × \\
\hline
\end{tabular}
\end{table} | PMC4414005_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{90\%}} & \multicolumn{3}{c|}{\textbf{95\%}} & \multicolumn{3}{c|}{\textbf{99\%}} \\
\hline
& \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} & \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} & \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} \\
\hline
Best case & 36.6 & 36.6 & 42.7 & 23.3 & 23.3 & 28.4 & 2.8 & 2.9 & 7.1 \\
\hline
Median case & 28.4 & 28.4 & 36.6 & 12.8 & 13.5 & 23.3 & 2.2 & 2.2 & 2.9 \\
\hline
Worst case & 21.3 & 21.3 & 25.6 & 6.4 & 6.9 & 17.1 & 1.4 & 1.5 & 2.7 \\
\hline
\end{tabular}
\end{table} | PMC4401437_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
[Cu(C4H2O4)(C3H10N2)(H2O)]·H2O & F(000) = 596 \\
\hline
Mr = 286.76 & m−3 Dx = 1.701 Mg \\
\hline
Orthorhombic, Pmc21 & Mo Kα radiation, λ = 0.71073 Å \\
\hline
Hall symbol: P 2c -2 & Cell parameters from 6311 reflections \\
\hline
a = 14.993 (3) Å & θ = 1.4–25.0° \\
\hline
b = 8.0948 (17) Å & mm−1 µ = 1.96 \\
\hline
c = 9.259 (2) Å & T = 293 K \\
\hline
Å3 V = 1123.7 (4) & Plate, blue \\
\hline
Z = 4 & 0.30 × 0.20 × 0.10 mm \\
\hline
\end{tabular}
\end{table} | PMC2960309_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Pt-miRNAs} & \textbf{(59R39) GSP1} & \textbf{(59R39) GSP2} & \textbf{(59R39) GSP3} \\
\hline
ptrmir156 & TTTTTTTTTTGTGCTCACTCTCTTCTG & GGAGTAGAAATGACAGAAGAGAGTGAG & TGACAGAAGAGAGTGAGCAC \\
\hline
ptrmir164 & TTTTTTTTTTGCACGTGCCCTGCTTCT & GGAGTAGAAATGGAGAAGCAGGGCACG & TGGAGAAGCAGGGCACGTGCA \\
\hline
ptrmir167 & TTTTTTTTTTTCAGATCATGCTGGCAG & GGAGTAGAAATGAAGCTGCCAGCATGA & TGAAGCTGCCAGCATGATCTGA \\
\hline
ptr-mir171 & TTTTTTTTTTGGAGATATTGACGCGGC & GGAGTAGAAATTGAGCCGCGTCAATAT & TTGAGCCGCGTCAATATCTCC \\
\hline
ptrmir319 & TTTTTTTTTTGGGAGCTCCCTTCAGTC & GGAGTAGAAATTGGACTGAAGGGAGCT & TTGGACTGAAGGGAGCTCCC \\
\hline
ptrmir482a & TTTTTTTTTTCATGGGTGGAGTAGGGA & GGAGTAGAAATCTTCCCTACTCCACCC & TCTTCCCTACTCCACCCATGCC \\
\hline
ptrmir482b & TTTTTTTTTTAATGGGAGGCATAGGGA & GGAGTAGAAATCTTCCCTATGCCTCCC & TCTTCCCTATGCCTCCCATTCC \\
\hline
ptrmir1446 & TTTTTTTTTTTTGAAGCAGAGAGTTCA & GGAGTAGAAAATCTGAACTCTCTGCTT & ATCTGAACTCTCTGCTTCAA \\
\hline
ptrmir435 & TTTTTTTTTTCCGACTCCAATTCCGGA & GGAGTAGAAATTATCCGGAATTGGAGT & TTATCCGGAATTGGAGTCGG \\
\hline
\end{tabular}
\end{table} | PMC2881865_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Variable}} & \multirow{2}{*}{\textbf{Urban (n=1,805)}} & \multirow{2}{*}{\textbf{Rural (n=1,684)}} \\
\hline
\\
\hline
Mean age (years) & 37.8 ($\pm$1.36) & 37.5 ($\pm$1.36) \\
\hline
Age-group (years) (\%) \\
\hline
15–24 & 21.4 & 20.8 \\
\hline
>24–34 & 22.3 & 26.0 \\
\hline
>34–44 & 24.7 & 21.9 \\
\hline
>44–54 & 15.7 & 16.6 \\
\hline
>54–64 & 16.0 & 14.7 \\
\hline
Sex (\%) \\
\hline
Male & 49.8 & 52.7 \\
\hline
Female & 50.2 & 47.3 \\
\hline
Education (\%) \\
\hline
Illiterate & 12.7 & 31.1 \\
\hline
Primary & 13.9 & 28.0 \\
\hline
Secondary and higher secondary & 55.1 & 39.4 \\
\hline
College & 10.4 & 0.7 \\
\hline
Professional & 7.9 & 0.8 \\
\hline
Occupation (\%) \\
\hline
Business & 7.0 & 4.3 \\
\hline
Farming & 0.7 & 16.7 \\
\hline
Labour/ unskilled work & 3.5 & 20.1 \\
\hline
Jobs/skilled work & 31.8 & 10.0 \\
\hline
Household work & 26.3 & 10.9 \\
\hline
Study/unemployed/ retired & 30.0 & 30.5 \\
\hline
\end{tabular}
\end{table} | PMC3702362_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Study year}} & \multirow{2}{*}{\textbf{Total number of}} & \multicolumn{8}{c|}{\textbf{Ever-smokers}} \\
\hline
\textbf{N} & \textbf{\%} & \multicolumn{2}{c|}{\textbf{Gender}} & \multicolumn{2}{c|}{\textbf{Age}} & \multicolumn{2}{c|}{\textbf{Education}} \\
\hline
& & & & Men (\textbf{\%}) & Women (\textbf{\%}) & 20-44 (\textbf{\%}) & 45-64 (\textbf{\%}) & Low (\textbf{\%}) & High (\textbf{\%}) \\
\hline
1994 & 1864 & 516 & 27.7 & 81.9 & 18.1 & 64.6 & 35.4 & 49.4 & 50.6 \\
\hline
1996 & 2021 & 691 & 34.2 & 79.1 & 20.9 & 62.9 & 37.1 & 50.6 & 49.4 \\
\hline
1998 & 1874 & 654 & 34.9 & 73.5 & 26.5 & 70.8 & 29.2 & 46.4 & 43.6 \\
\hline
2000 & 2195 & 876 & 39.9 & 72.9 & 27.1 & 65.5 & 34.5 & 47.4 & 52.6 \\
\hline
2002 & 1883 & 706 & 37.5 & 72.2 & 27.8 & 54.5 & 45.5 & 38.5 & 61.5 \\
\hline
2004 & 1822 & 616 & 33.8 & 67.7 & 32.3 & 63.0 & 37.0 & 40.3 & 59.7 \\
\hline
2006 & 1739 & 654 & 37.6 & 65.7 & 34.3 & 59.8 & 40.2 & 41.7 & 58.3 \\
\hline
2008 & 1763 & 641 & 36.4 & 65.0 & 35.0 & 56.9 & 43.1 & 54.1 & 45.9 \\
\hline
2010 & 2000 & 729 & 36.5 & 55.9 & 44.1 & 56.4 & 43.6 & 53.2 & 46.8 \\
\hline
\end{tabular}
\end{table} | PMC4349467_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Ferret} & \textbf{Proximal latency (ms)} & \textbf{Proximal duration (ms)} & \textbf{Proximal amplitude (mV)} & \textbf{Proximal area (mV/ms)} & \textbf{Distal latency (ms)} & \textbf{Distal duration (ms)} & \textbf{Distal amplitude (mV)} & \textbf{Distal area (mV/ms)} & \textbf{Conduction velocity (m/sec)} \\
\hline
N.1 & 2.8 & 2.2 & 7.1 & 3.7 & 1.4 & 2.3 & 17.4 & 8.9 & 53.6 \\
\hline
N.2 & 3.2 & 4.9 & 16.8 & 18 & 1.8 & 4.7 & 20.6 & 20 & 64.3 \\
\hline
N.3 & 3 & 4.8 & 9.4 & 7.9 & 0.9 & 4.7 & 10.5 & 6.3 & 60 \\
\hline
N.4 & 2.9 & 4.7 & 11 & 9.6 & 1.6 & 4.6 & 13.3 & 11 & 69.2 \\
\hline
N.5 & 2.4 & 4.1 & 7.6 & 6.1 & 1.2 & 3.8 & 9.9 & 7.1 & 66.7 \\
\hline
N.6 & 2.4 & 4.1 & 11.1 & 10 & 1.5 & 3.7 & 12.8 & 10 & 77.8 \\
\hline
N.7 & 2.8 & 4.5 & 12 & 11 & 1.6 & 4.2 & 12.2 & 11 & 62.5 \\
\hline
N.8 & 2.9 & 4.2 & 11.5 & 9.6 & 1.6 & 4.3 & 11.2 & 8.9 & 67.7 \\
\hline
N.9 & 2.7 & 5 & 12.1 & 11 & 1.3 & 4.8 & 11.7 & 9.7 & 57.1 \\
\hline
N.10 & 2.6 & 3.4 & 9.3 & 7.4 & 1.2 & 3.5 & 10.6 & 7.9 & 53.6 \\
\hline
MEAN & 2.77 & 4.19 & 10.79 & 9.43 & 1.41 & 4.06 & 13.02 & 10.08 & 63.25 \\
\hline
SD & 0.25 & 0.85 & 2.75 & 3.79 & 0.26 & 0.77 & 3.41 & 3.81 & 7.56 \\
\hline
\end{tabular}
\end{table} | PMC2913798_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Proteins} & \textbf{Number of Hits Antibiotic Treated} & \textbf{Number of Hits No Antibiotics} \\
\hline
superoxide dismutase [Acinetobacter baumannii ACICU] & 40 & 1 \\
\hline
outer membrane protein, related peptidoglycan-associated (lipo)protein [Acinetobacter baumannii ACICU] & 9 & 2 \\
\hline
gluconate kinase [Acinetobacter baumannii ACICU] & 8 & 2 \\
\hline
electron transfer flavoprotein subunit alpha [Acinetobacter baumannii ACICU] & 7 & 3 \\
\hline
Zn-dependent alcohol dehydrogenase, class III [Acinetobacter baumannii ACICU] & 2 & 1 \\
\hline
putative porin protein associated with imipenem resistance [Acinetobacter baumannii ACICU] & 3 & 2 \\
\hline
hypothetical protein ACICU_02436 [Acinetobacter baumannii ACICU] & 76 & 53 \\
\hline
beta-lactamase [Acinetobacter baumannii ACICU] & 452 & 325 \\
\hline
malate dehydrogenase [Acinetobacter baumannii ACICU] & 50 & 38 \\
\hline
chaperonin GroEL [Acinetobacter baumannii ACICU] & 50 & 43 \\
\hline
\end{tabular}
\end{table} | PMC3409086_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Study and location} & \textbf{Surveillance tool} & \textbf{Implementation platforms} & \textbf{Quality assurance} & \textbf{Number of cluster} & \textbf{Sampling sites per cluster} & \textbf{Trap-nights per month} & \textbf{Temporal scale (Trap nights)} & \textbf{Duration of the surveys} & \textbf{Total number of trap months} \\
\hline
Abilio et al. 2010 Zambezia province, central northern Mozambique & WET & Community-based (home owner) as stand alone & No & 19 & 6 & 114 & 788 & 2006-2007 and 2009-2010 & 48 \\
\hline
Sharp et al. 2007 Bioko Island, Equatorial Guinea & WET & Community-based (home owner) as stand alone & No & 16 & 6 & 96 & 59,307 & 2004-2005 & 24 \\
\hline
Chaki et al. (Urban Dar es Salaam, Tanzania) & ITT and HLC & Community-based (community volunteers) & Yes & 31 & 20 & 615 & 8,171 & Feb 2009- Oct 2010 & 20 \\
\hline
\end{tabular}
\end{table} | PMC3475008_table_3 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Early 1980s} & \textbf{Gabrielle Carlson et al. observe that bipolar symptomatology in preadolescent children can include severe irritability and emotional lability (as opposed to the classic symptoms that appear in adults and adolescents) [27].} \\
\hline
1994 & Geller et al. report in Journal of American Academy of Adolescent and Child Psychiatry (JAACAP) conversion to BP in 32\% of a sample of children with major depression [31]. \\
\hline
1995 & Geller et al. in suggested that children and adolescents with rapid-cycling mania characterized by elevated/ Journal of Affective Disorders expansive and/or grandiose mood have BP; the researchers did not use irritability to characterize BP because it also commonly appears in ADHD [29]. \\
\hline
1995 & Wozniak et al. [11] and Biederman et al. [30] in two JAACAP articles report that 16\% of a clinical population of children met the criteria for mania primarily by exhibiting chronically irritable mood and describe their use of the Child Behavior Checklist to confirm their diagnoses of BP in these children. \\
\hline
1998 & Klein et al., critique the move to consider chronic irritability a form of mania [47]. \\
\hline
2000 & Publication of The Bipolar Child by Demitri and Janice Papolos, a book aimed at parents, whose success coincides with an increase in visits to doctor’s offices by parents regarding a bipolar diagnosis for their children [6]. \\
\hline
2002 & magazine runs a cover story on children with BP [15]. Time \\
\hline
2003 & Leibenluft et al. describe a new syndrome, Severe Mood Dysregulation, (SMD), which aims to bring some conceptual order to the increasingly heterogeneous class of children receiving a BP diagnosis [28,48,49,51]. \\
\hline
2005 & Article by Kowatch et al. describing treatment guidelines for children and adolescents with BP published in JAACAP. Accompanying commentary calls attention to lack of evidence that childhood diagnosis is contiguous with adult BP and critiques some symptoms as difficult to distinguish from developmentally normal childhood behavior [46]. \\
\hline
2006 & Brotman et al. use the label Severe Mood Dysregulation in the title of a scientific article, offering a new label for many children now receiving the BP diagnosis [49]. \\
\hline
2007 & JAACAP publishes practice parameter for diagnosis and treatment of BP in children and adolescents. Parameter follows Geller et al. diagnostic criteria more than those proposed by Biederman et al. but warns of difficulty differentiating symptoms from normal childhood behavior and urges periodic revisions of any diagnosis and treatment plan [57]. \\
\hline
2007 & publishes study reporting a 40-fold increase between 1994 and 2003 in the number of office visits in which Archives of General Psychiatry children (0-19) had a diagnosis of BP [1]. \\
\hline
2009 & Zito et al. report a 10-year trend for Medicaid-insured youth with clinician-reported pediatric bipolar disorder showing a proportional increase in minority youth with this diagnosis from 1997 to 2006 (23\% increase in African-American and other minorities and corresponding drop in white youth) [85]. Crystal et al. report that poor children are four times more likely than wealthy children to receive atypical antipsychotics [70]. \\
\hline
2010 & Olfson et. al. report a doubling of the number of privately insured 2-5 year-old children with a psychiatric diagnosis who receive an antipsychotic, and lament the sparseness of non-pharmacological mental health resources [3]. Authors working on DSM V propose adding new diagnostic category, which is based on Severe Mood Dysregulation and may be called Temper Dysregulation Disorder with Dysphoria [54]. \\
\hline
\end{tabular}
\end{table} | PMC2846895_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Group} & \multicolumn{2}{c|}{\textbf{ROS}} & \multicolumn{2}{c|}{\textbf{MDA}} & \multicolumn{2}{c|}{\textbf{GSH}} & \multicolumn{2}{c|}{\textbf{SOD}} \\
\hline
& \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} \\
\hline
Control & 540.25$\pm$46.32 & 1.63$\pm$0.06 & 0.31$\pm$0.12 & 0.09$\pm$0.01 & 602.74$\pm$76.78 & 1.20$\pm$0.16 & 662.50$\pm$50.57 & 21.89$\pm$1.48 \\
\hline
10\% alcohol & 635.08$\pm$62.43 & 1.72$\pm$0.06 & 0.62$\pm$0.10* & 0.14$\pm$0.02 & 472.22$\pm$50.62* & 1.38$\pm$0.14 & 450.63$\pm$49.34* & 19.19$\pm$1.27 \\
\hline
20\% alcohol & 698.36$\pm$56.19* & 2.04$\pm$0.13* & 1.05$\pm$0.23* & 0.19$\pm$0.04* & 387.85$\pm$30.05* & 0.89$\pm$0.15* & 367.30$\pm$39.90* & 15.96$\pm$1.18* \\
\hline
\end{tabular}
\end{table} | PMC4451149_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene present in # genomes} & \textbf{# of genes} & \textbf{Prominent functions (remainder are hypothetical proteins)} \\
\hline
4 & 26 & petF, ho1, carbamoyltransferase, pebS, 5 virion structural proteins \\
\hline
5 & 17 & Enase VII, HN, DUF120 \\
\hline
6 & 14 & prnA, speD, carboxylesterase, 3 virion structural proteins \\
\hline
7 & 12 & 2 virion structural proteins \\
\hline
8 & 17 & purM, 3 virion structural proteins \\
\hline
9 & 15 & pstS, PTOX, 6 virion structural proteins \\
\hline
10 & 5 & petE, 1 virion structural protein \\
\hline
11 & 5 & all hypothetical proteins \\
\hline
12 & 11 & psbD, cpeT, 1 virion structural protein \\
\hline
13 & 3 & denV \\
\hline
14 & 6 & N6A-methylase, helicase, 2OG-FeII oxygenase, 1 virion structural protein \\
\hline
15 & 12 & talC, CP12, DUF680, endonuclease, 1 virion structural protein \\
\hline
\end{tabular}
\end{table} | PMC3037559_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
& \textbf{Question} \\
\hline
1 & What are the major health issues and challenges affecting Nsuta and/or Jansa? \\
\hline
2 & How do people commonly obtain health services? How do they obtain medications and/or pharmacy services? \\
\hline
3 & Are there any health services you think would be beneficial? What would they be? Who would obtain them? \\
\hline
4 & What kind of help would be useful for improvement of services? Do you think any help is needed from outside of Ghana? \\
\hline
\end{tabular}
\end{table} | PMC3639358_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{PET/CT positive/MRI positive} & \textbf{PET/CT negative/MRI positive} & \textbf{PET/CT positive/MRI negative} \\
\hline
Spinal lesions & 14 & 54 & 24 \\
\hline
SIJ lesions & 13 & 6 & 4 \\
\hline
\end{tabular}
\end{table} | PMC3472173_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Gene} Function & \textbf{Abiotic Stress Tolerance} & \textbf{Reference} \\
\hline
Aldehyde dehydrogenase family 7 member (ALDH7) & Oxygen radical detoxification & Extenuated oxidative stress & [51,93] \\
\hline
Ascorbate peroxidase (APX) & H2O2 metabolism & Preventing oxidative stress & [94] \\
\hline
Glutathione reductase (GR) & H2O2 metabolism & Induced by oxidative stress & [95] \\
\hline
Superoxide dismutase (SOD) & Oxygen radical detoxification & Improved drought tolerance; Induced by drought & [96–98] \\
\hline
\end{tabular}
\end{table} | PMC4519955_table_3 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Com\textbf{p}onent} & \textbf{Collective} & \textbf{Mean} & \textbf{SD} & \textbf{p} \\
\hline
IL-6 & Daytime workers Shift workers & 2.30 2.67 & 1.54 3.79 & 0.276 \\
\hline
TNF-a & Daytime workers Shift workers & 5.58 5.68 & 2.91 5.19 & 0.841 \\
\hline
Lym\textbf{p}hocytes & Daytime workers Shift workers & 33.68 32.99 & 7.64 7.49 & 0.404 \\
\hline
\textbf{Com\textbf{p}onent} & PSQI & \textbf{Mean} & \textbf{SD} & \textbf{p} \\
\hline
IL-6 & PSQI 6 $\leq$ PSQI $\geq$ 6 & 2.47 2.58 & 2.50 3.77 & 0.761 \\
\hline
TNF-a & PSQI $\leq$ 6 PSQI $\geq$ 6 & 5.53 5.68 & 3.49 5.41 & 0.759 \\
\hline
Lym\textbf{p}hocytes & PSQI $\leq$ 6 PSQI 6 $\geq$ & 33.59 33.14 & 7.52 7.78 & 0.593 \\
\hline
\end{tabular}
\end{table} | PMC2914774_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{No of annotation terms matched (/40} & \textbf{HGNC symbol} & \textbf{gene1 XLMR} & \textbf{kb2 50} & \textbf{kb2 100} & \textbf{(kb)3 Dist} & \textbf{Strata} \\
\hline
24 & DMD & 1 & NX & NX & 71.7 & XAR \\
\hline
23 & GPM6B & 0 & NX & NX & 68 & XAR \\
\hline
19 & AP1S2 & 1 & X & X & 61.4 & XAR \\
\hline
19 & FGF13 & 0 & NX & NX & 157.8 & XCR \\
\hline
19 & ZDHHC9 & 1 & X & NX & 60.7 & XCR \\
\hline
18 & TAF9B & 0 & NX & NX & 133 & XCR \\
\hline
18 & FAM156A & 0 & X & NX & 90.8 & XCR \\
\hline
18 & FAM156B & 0 & X & NX & 90.8 & XCR \\
\hline
17 & ARHGEF9 & 1 & NX & X & 259.5 & XCR \\
\hline
17 & TMEM47 & 0 & NX & NX & 285.5 & XAR \\
\hline
16 & NAP1L2 & 0 & NX & NX & 182.7 & XCR \\
\hline
16 & NSBP1 & 0 & NX & NX & 80.3 & XCR \\
\hline
16 & PCSK1N & 0 & NX & NX & 56.7 & XCR \\
\hline
16 & UXT & 0 & X & NX & 64.4 & XCR \\
\hline
15 & BCOR & 1 & X & X & 253.8 & XAR \\
\hline
15 & ENOX2 & 0 & NX & NX & 155 & XCR \\
\hline
15 & HUWE1 & 1 & X & NX & 224.7 & XCR \\
\hline
15 & LAS1L & 0 & NX & NX & 132.8 & XCR \\
\hline
15 & THOC2 & 0 & NX & NX & 124 & XCR \\
\hline
14 & CXorf61 & 0 & NX & NX & 323.4 & XCR \\
\hline
14 & TBL1X & 0 & X & NX & 190.3 & XAR \\
\hline
14 & TMLHE & 0 & NX & NX & 154.8 & XCR \\
\hline
13 & C1GALT1C1 & 0 & NX & NX & 102.9 & XCR \\
\hline
13 & KAL1 & 0 & NX & NX & 58.6 & XAR \\
\hline
13 & PPP2R3B & 0 & NX & NX & 237.4 & XAR \\
\hline
13 & RNF12 & 0 & NX & NX & 65.4 & XCR \\
\hline
13 & ZMAT1 & 0 & NX & NX & 77 & XCR \\
\hline
12 & GABRE & 0 & NX & NX & 103 & XCR \\
\hline
12 & ZC4H2 & 0 & X & NX & 431.8 & XCR \\
\hline
12 & MAGED4 & 0 & NX & X & 115.6 & XCR \\
\hline
12 & MAGED4B & 0 & NX & X & 115.6 & XCR \\
\hline
12 & MORC4 & 0 & NX & NX & 64.2 & XCR \\
\hline
12 & RAI2 & 0 & NX & NX & 302.1 & XAR \\
\hline
11 & APLN & 0 & X & NX & 84.5 & XCR \\
\hline
11 & KLHL13 & 0 & NX & NX & 83.1 & XCR \\
\hline
11 & MUM1L1 & 0 & NX & NX & 93.4 & XCR \\
\hline
11 & RAP2C & 0 & X & NX & 160.1 & XCR \\
\hline
11 & SLITRK4 & 0 & NX & NX & 72.2 & XCR \\
\hline
11 & SYTL4 & 0 & NX & NX & 88.2 & XCR \\
\hline
10 & CHRDL1 & 0 & NX & NX & 300.5 & XCR \\
\hline
10 & PHF16 & 0 & NX & NX & 72.4 & XAR \\
\hline
10 & STAG2 & 0 & NX & NX & 60.9 & XCR \\
\hline
\end{tabular}
\end{table} | PMC3142252_table_4 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Descriptors} & \textbf{Characterization} & \multicolumn{2}{c|}{\textbf{Median/Mean}} & \textbf{valued P} \\
\hline
& & \textbf{Anaerobic metabolites (n = 1174)} & \textbf{Aerobic metabolites (n = 520)} \\
\hline
MWa & Molecular weight & 214.70/310.72 & 289.38/317.69 & 0.52 \\
\hline
AREAa & Total molecular surface area & 425.95/545.21 & 508.90/549.64 & 0.74 \\
\hline
VOLa & Total molecular volume & 613.75/822.00 & 803.80/856.24 & 0.17 \\
\hline
AtomCounta & Total atom count & 26/36.48 & 36/43.23 & 2.95E-06 \\
\hline
Carbonsb & Carbon atom count & 8/10.94 & 15/16.06 & 1.06E-23 \\
\hline
Oxygensb & Oxygen atom count & 6/7.24 & 4/5.38 & 1.08E-13 \\
\hline
Nitrogensb & Nitrogen atom count & 1/1.67 & 0/0.73 & 1.19E-24 \\
\hline
Sulfursb & Sulfur atom count & 0/0.10 & 0/0.11 & 0.57 \\
\hline
Phosphorusb & Phosphorus atom count & 0/0.68 & 0/0.08 & 6.12E-56 \\
\hline
AlogP98c & Logarithm of partition coefficient, atom-type value, using latest parameters & 21.08/20.80 & 1.26/1.43 & 2.51E-63 \\
\hline
PSAa & Polar molecular surface area & 242.40/280.12 & 169.47/195.99 & 9.96E-28 \\
\hline
PVa & Polar molecular volume & 170.50/247.37 & 127.61/165.27 & 1.71E-21 \\
\hline
Acceptora & H-bond acceptor count & 6/7.66 & 4/5.56 & 1.21E-14 \\
\hline
Donora & H-bond donor count & 3/3.81 & 2/2.37 & 8.83E-20 \\
\hline
Hydrophobea & Hydrophobic fragment count & 1/1.43 & 2/2.45 & 3.09E-23 \\
\hline
RingCounta & Ring count & 1/1.34 & 3/2.55 & 3.11E-38 \\
\hline
AromaticRingsb & Aromatic ring count & 0/0.44 & 0/0.79 & 3.40E-13 \\
\hline
BondCounta & Total bond count & 26/36.83 & 38/44.78 & 1.34E-07 \\
\hline
RotBondsa & Rotatable bond count & 7/8.97 & 5/6.22 & 4.99E-18 \\
\hline
Chirala & Chiral center count & 2/3.02 & 2/3.78 & 4.69E-04 \\
\hline
\end{tabular}
\end{table} | PMC3305344_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Māori N (\%)}} & \multirow{2}{*}{\textbf{Pacific N (\%)}} & \multirow{2}{*}{Non-Māori/ non-\textbf{Pacific N (\%)}} \\
\hline
\\
\hline
Total & 302 (100) & 70 (100) & 1427 (100) \\
\hline
Age (years) \\
\hline
20–35 & 10 (3.3) & 4 (5.7) & 25 (1.8) \\
\hline
36–50 & 97 (32.1) & 37 (52.9) & 377 (26.4) \\
\hline
51–65 & 137 (45.4) & 19 (27.1) & 589 (41.3) \\
\hline
>65 & 58 (19.2) & 10 (14.3) & 436 (30.6) \\
\hline
NZDep (quintiles) \\
\hline
Q1 (least deprived) & 16 (5.3) & 5 (7.1) & 282 (19.8) \\
\hline
Q2 & 31 (10.3) & 5 (7.1) & 265 (18.6) \\
\hline
Q3 & 52 (17.2) & 9 (12.9) & 333 (23.4) \\
\hline
Q4 & 73 (24.2) & 21 (30.0) & 325 (22.8) \\
\hline
Q5 (most deprived) & 130 (43.1) & 30 (42.9) & 218 (15.3) \\
\hline
Extent \\
\hline
Local & 136 (52.5) & 28 (52.8) & 712 (56.7) \\
\hline
Regional & 116 (44.8) & 23 (43.4) & 528 (42.0) \\
\hline
Distant & 7 (2.7) & 2 (3.8) & 16 (1.3) \\
\hline
Tumour size (mm) \\
\hline
<10 mm & 34 (12.8) & 9 (15.8) & 308 (23.6) \\
\hline
11–19 & 69 (25.9) & 16 (28.1) & 416 (31.9) \\
\hline
20–29 & 105 (39.5) & 13 (22.8) & 325 (24.9) \\
\hline
30+ & 58 (21.8) & 19 (33.3) & 255 (19.6) \\
\hline
Diabetes \\
\hline
Yes & 58 (19.2) & 12 (17.1) & 115 (8.1) \\
\hline
No & 244 (80.8) & 58 (82.9) & 1,309 (91.9) \\
\hline
screeninga Eligible for free \\
\hline
\% never screened & 5 \% & 5 \% & 12 \% \\
\hline
\% tumours < 10 mm (p <0.001) & 14 \% & 20 \% & 26 \% \\
\hline
\% localized stage (p <0.001) & 47 \% & 40 \% & 53 \% \\
\hline
\end{tabular}
\end{table} | PMC4575458_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Citation} & \textbf{Country (WHO Region)*} & \textbf{N} & \textbf{Facility Infrastructure Level} & \textbf{Prospective vs Retrospective} & \textbf{Population Based vs Sample} & \textbf{Denominator description} & \textbf{\% Utilizing Facility} \\
\hline
Awasthi, 2009 [8] & India (SEAR) & 510 enrolled in baseline facility based survey & Public hospital with doctors and basic diagnostic and treatment facilities & Prospective & Sample: 2 urban public hospitals in Lucknow & Enrolled sick newborns who came to the facility & 80\% utilized the facilities in baseline assessment \\
\hline
Bari, 2006 [15] & Bangladesh (SEAR) & 2,290 newborns in comparison sample & Private hospital with specialized pediatric care & Prospective & Sample: Mirzapur subdistrict, Tangail district & Sick newborns who utilized the local hospital & 18-23\% utilized referral hospital \\
\hline
Dongre 2009 [16] & India (SEAR) & 503 mothers of babies < 12 months & Public or private hospitals attended by doctors & Prospective & Sample: Wardha district, Maharashtra & \textbf{N}ewborns with clinical danger signs presenting to local hospitals & 48\% utilized local hospital in needs assessment phase \\
\hline
Kumar, 2008 [17] & India (SEAR) & 1079 live births in “control” arm & Primary health centers with trained physicians & Prospective & Sample: Shivgarh district, Uttar Pradesh & 296 newborns with “any” illness & 16.7\% were attended by a doctor or nurse/ midwife \\
\hline
Manandhar, 2004 [18] & \textbf{N}epal (SEAR) & 3,226 live births in control areas & \textbf{N}ot specified & Prospective & Sample: Makwanpur district & \textbf{N}eonates with signs of illness (cough, fever, diarrhea) & 10\% utilized a health facility for illness \\
\hline
McPherson, 2006 [19] & \textbf{N}epal (SEAR) & \textbf{N}umber in baseline survey population not specified & \textbf{N}ot specified & Household survey before/ after community intervention & Sample: Siraha District & \textbf{N}ot specified & 11-17\% utilized postnatal care services \\
\hline
\end{tabular}
\end{table} | PMC3253732_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Characteristcs} & \textbf{Number of patients} & \textbf{(\%)} \\
\hline
Total number of patients & 19 \\
\hline
Age (years) \\
\hline
$\pm$ Mean SD (range) & $\pm$ 61.3 1.4(38-75) \\
\hline
Sex \\
\hline
Male & 13 & 68.4 \\
\hline
Female & 6 & 31.6 \\
\hline
Karnofsky performance status \\
\hline
80-100 & 19 & 100 \\
\hline
Histological type (Japanese classifi cation) \\
\hline
Differntiated & 5 & 26.3 \\
\hline
Undifferentiated & 14 & 73.7 \\
\hline
Primary treatment \\
\hline
Curative gastrectomy & 6 & 31.6 \\
\hline
Palliative gastrectomy & 10 & 52.6 \\
\hline
Without gastrectomy & 3 & 15.8 \\
\hline
Target lesions \\
\hline
primary & 3 & 15.8 \\
\hline
peritoneal dissemination & 14 & 73.3 \\
\hline
lymph node metastasis & 5 & 26.3 \\
\hline
liver metastasis & 2 & 10.5 \\
\hline
\end{tabular}
\end{table} | PMC3161668_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Variable} & \textbf{Value} \\
\hline
Sample size & 1,018 \\
\hline
Age (years) & 56)a 48 (41, \\
\hline
Male:Female & 419:599 \\
\hline
Percent African ancestry & 82.0 (74.7, 87.5) \\
\hline
Serum creatinine (mg/dL) & 0.9 (0.7, 1.0) \\
\hline
m2) Glomerular filtration rate (mL/min/1.73 & 102.1 (86.7, 119.2) \\
\hline
Type 2 diabetes (prevalence) & 15.6\% \\
\hline
Hypertension (prevalence) & 50.0\% \\
\hline
\end{tabular}
\end{table} | PMC3441677_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Variables} & \multicolumn{2}{c|}{\textbf{WRMSDs (n = 376)}} & \textbf{P-value+} \\
\hline
& \textbf{Yes (n = 275)} & \textbf{No (n = 101)} \\
\hline
& \multicolumn{2}{c|}{Mean (SD)} \\
\hline
Age (yr) & 29.62 (7.13) & 30.21 (6.70) & 0.46 \\
\hline
Years of employment as nurses & 7.33 (4.89) & 7.61 (5.18) & 0.64 \\
\hline
Working hours/week & 45.17 (5.17) & 44.65 (5.17) & 0.41 \\
\hline
\multirow{2}{*}{Body mass index (kg/m2) (BMI)} & 24.39 (4.49) & 23.65 (4.44) & 0.15 \\
\hline
\multicolumn{2}{c|}{\% (n)} \\
\hline
Race \\
\hline
Malay & 94.20 (260) & 94.10 (95) & 0.96 \\
\hline
Non-Malay & 5.80 (15) & 5.90 (6) \\
\hline
Marital status \\
\hline
Married & 78.91 (217) & 70.30 (71) & 0.09* \\
\hline
Not married & 21.09 (58) & 29.70 (30) \\
\hline
\end{tabular}
\end{table} | PMC4387780_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
O1 & 0.0185 (4) & 0.0326 (5) & 0.0136 (4) & 0.0000 & −0.0019 (4) & 0.0000 \\
\hline
O2 & 0.0169 (4) & 0.0368 (6) & 0.0242 (5) & 0.0000 & −0.0042 (4) & 0.0000 \\
\hline
C1 & 0.0169 (5) & 0.0170 (5) & 0.0137 (5) & 0.0000 & 0.0004 (4) & 0.0000 \\
\hline
C2 & 0.0176 (5) & 0.0251 (6) & 0.0153 (5) & 0.0000 & −0.0002 (5) & 0.0000 \\
\hline
C3 & 0.0220 (6) & 0.0270 (6) & 0.0143 (5) & 0.0000 & −0.0021 (5) & 0.0000 \\
\hline
C4 & 0.0246 (6) & 0.0248 (6) & 0.0131 (5) & 0.0000 & 0.0025 (5) & 0.0000 \\
\hline
C5 & 0.0185 (5) & 0.0213 (5) & 0.0177 (5) & 0.0000 & 0.0031 (5) & 0.0000 \\
\hline
C6 & 0.0176 (5) & 0.0173 (5) & 0.0147 (5) & 0.0000 & 0.0003 (4) & 0.0000 \\
\hline
C7 & 0.0182 (6) & 0.0214 (5) & 0.0172 (5) & 0.0000 & −0.0011 (5) & 0.0000 \\
\hline
C8 & 0.0164 (5) & 0.0232 (6) & 0.0130 (5) & 0.0000 & −0.0007 (4) & 0.0000 \\
\hline
C9 & 0.0259 (5) & 0.0244 (4) & 0.0185 (4) & −0.0011 (4) & 0.0028 (3) & 0.0028 (3) \\
\hline
\end{tabular}
\end{table} | PMC3254460_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{L} & \textbf{N} & \textbf{Coefficients} \\
\hline
3 & 3 & ς12 = 0.681306, ς13 = 0.444312, ς23 = 0.679452 \\
\hline
4 & 4 & ς12 = 0.739716, ς13 = 0.432467, ς14 = 516734, ς23 = 0.571812, ς24 = 0.4434453, ς34 = 0.737795 \\
\hline
5 & 5 & ς12 = 769,240, ς13 = 0.438591, ς14 = 0.467191, ς15 = 0.495116, ς23 = 0.431753, ς24 = 0.625867, ς25 = 0.579681, ς34 = 0.656805, ς35 = 0.213527, ς45 = 0.881820 \\
\hline
\end{tabular}
\end{table} | PMC4367419_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{-NH2 groups} & \textbf{Frequencies/cm-} & \textbf{Amide N-H} & \textbf{Frequencies/cm-}1 & \textbf{C=O groups} & \textbf{Frequencies/cm-}1 \\
\hline
υasN(99)-H & 3670vw & υN(23)-H & 3446w & υC(11)-O(12) & 1639w \\
\hline
υasN(13)-H & 3646 vw & υN(109)-H & 3356m & υC(97)-O(98) & 1629m \\
\hline
υasN(31)-H & 3592 vw & ρN(109)-H & 1567s \\
\hline
υsN(99)-H & 3551 vw & ρN(23)-H & 1563w \\
\hline
υsN(13)-H & 3538 w \\
\hline
υsN(31)-H & 3458m \\
\hline
δN(31)-H & 1711vw \\
\hline
δN(13)-H & 1686vw \\
\hline
δN(99)-H & 1679vw \\
\hline
δC(28)-H & 1316vw \\
\hline
δC(96)-H & 1315vw \\
\hline
δC(10)-H & 1328vw \\
\hline
\end{tabular}
\end{table} | PMC2812828_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Thickness (µm)} & \textbf{Stiffness Coefficient (N·m)} & \textbf{Sensitivity(rad/(°/s))} \\
\hline
25 & 10−4 4.443 × & 10−5 1.822 × \\
\hline
48 & 10−3 3.145 × & 10−5 1.808 × \\
\hline
75 & 10−2 1.200 × & 10−5 1.643 × \\
\hline
\end{tabular}
\end{table} | PMC4481988_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Variables} & \textbf{Mean (SD)} \\
\hline
Haematological Parameters \\
\hline
Haemoglobin (gm/dl) & 10.65 (1.65) \\
\hline
White cell count(per cmm) & 6.08 (3.28) \\
\hline
Platelets * & *87.00 (87;135) \\
\hline
Prothrombin Time(Sec) & 15.80 (4.79) \\
\hline
Biochemistry \\
\hline
Total Protein (gm/dl) & 6.75 (1.32) \\
\hline
Albumen (gm/dl) & 2.61 (0.71) \\
\hline
Creatinine (mg/dl) & 1.10 (0.57) \\
\hline
Sodium (Meq/L) & 134 (5) \\
\hline
Potassium (Meq/L) & 3.97 (0.62) \\
\hline
Chloride (Meq/L) & 106 (9.6) \\
\hline
Bicarbonate (Meq/L) & 20.46 (3.74) \\
\hline
Liver function tests* & Median (IQR) \\
\hline
Total Bilirubin (mg/dl) & 1.5 (1;2.95) \\
\hline
SGPT (IU/L) & 39 (25;58) \\
\hline
SGOT (IU/L) & 59 (40;92) \\
\hline
GGT (IU/L) & 48 (30;81) \\
\hline
ALK Phosphate (IU/L) & 110 (79;166) \\
\hline
\end{tabular}
\end{table} | PMC3542150_table_2 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Gene} & \textbf{Sequence} \\
\hline
Aromatase & Forward primer gcttctcatcgcagagtatccgg Reverse primer caagggtaaattcattgggcttgg \\
\hline
Bax & Forward primer ggggacgaactggacagtaa Reverse primer cagttgaagttgccgtcaga \\
\hline
Bcl-2 & Forward primer atgtgtgtggagagcgtcaa reverse primer acagttccacaaaggcatcc \\
\hline
Bcl-x & Forward primer cgtagacaaggagatgcaggt Reverse primer accagcggttgaagcgctcct \\
\hline
FGF-2 & Forward primer ccgttacctggctatgaagg Reverse primer actgcccagttcgtttcagt \\
\hline
GAPDH & Forward primer tcgtggaaggactcatgac Reverse primer ccatcacgccacagttt \\
\hline
\end{tabular}
\end{table} | PMC3354660_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{First author} & \textbf{Settings} & \textbf{IGRA method} & \textbf{Samples} & \multicolumn{4}{c|}{\textbf{Test results}} & \textbf{QUADAS score} \\
\hline
& & & & \textbf{TP} & \textbf{FP} & \textbf{FN} & \textbf{TN} \\
\hline
\multirow{2}{*}{Wilkinson} & UK & ELISPOT & PE & 10 & 1 & 0 & 7 & 10 \\
\hline
& & Blood & 10 & – & 0 & – \\
\hline
\multirow{2}{*}{Ariga} & Japan & ELISA & PE & 27 & 1 & 1 & 46 & 11 \\
\hline
& & Blood & 21 & 14 & 6 & 33 \\
\hline
\multirow{2}{*}{Losi} & Italy, Germany, Netherlands & ELISPOT & PE & 19 & 5 & 1 & 16 & 10 \\
\hline
& & Blood & 18 & 7 & 2 & 14 \\
\hline
\multirow{2}{*}{Baba} & South Africa & ELISA & PE & 12 & 2 & 15 & 4 & 10 \\
\hline
& & Blood & 17 & 0 & 7 & 6 \\
\hline
\multirow{2}{*}{Chegou} & South Africa & ELISA & PE & 13 & 2 & 10 & 13 & 13 \\
\hline
& & Blood & 16 & 5 & 6 & 12 \\
\hline
\multirow{4}{*}{Dheda} & South Africa & ELISPOT & PE & 38 & 8 & 6 & 9 & 11 \\
\hline
& & Blood & 30 & 7 & 6 & 9 \\
\hline
& ELISA & PE & 23 & 6 & 19 & 12 \\
\hline
& & Blood & 26 & 4 & 4 & 9 \\
\hline
\multirow{2}{*}{Lee} & Taiwan & ELISPOT & PE & 18 & 3 & 1 & 18 & 9 \\
\hline
& & Blood & 14 & 2 & 4 & 19 \\
\hline
\multirow{2}{*}{Ates} & Turkey & ELISA & PE & 21 & 6 & 22 & 23 & 11 \\
\hline
& & Blood & 30 & 14 & 13 & 15 \\
\hline
Chuang & South Korea & ELISA & Blood & 42 & 17 & 12 & 26 & 8 \\
\hline
\multirow{4}{*}{Kang} & South Korea & ELISPOT & PE & 15 & 8 & 0 & 3 & 9 \\
\hline
& & Blood & 18 & 6 & 2 & 8 \\
\hline
& ELISA & PE & 10 & 5 & 5 & 5 \\
\hline
& & Blood & 4 & 6 & 0 & 7 \\
\hline
\multirow{2}{*}{Eldin} & Egypt & ELISA & PE & 16 & 3 & 4 & 15 & 7 \\
\hline
& & Blood & 14 & 7 & 6 & 11 \\
\hline
Gao & China & ELISA & PE & 54 & 2 & 4 & 18 & 8 \\
\hline
\multirow{2}{*}{Keng} & Taiwan & ELISA & PE & 24 & 2 & 31 & 57 & 8 \\
\hline
& & PE & 22 & 1 & 9 & 56 \\
\hline
\multirow{2}{*}{Liu} & China & ELISPOT & PE & 53 & 2 & 2 & 41 & 9 \\
\hline
& & Blood & 51 & 10 & 4 & 33 \\
\hline
\multirow{2}{*}{Liao} & China & ELISPOT & PE & 269 & 0 & 12 & 51 & 8 \\
\hline
& & Blood & 220 & 7 & 61 & 44 \\
\hline
\end{tabular}
\end{table} | PMC4451019_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
& \textbf{Controls (n = 14)} \\
\hline
Females & 4 (29\%) \\
\hline
Median age in months (range) & 12 (1–64) \\
\hline
Exclusion tracheal/bronchial malformation & 7 (50\%) \\
\hline
Foreign body aspiration/ Aspiration & 5 (36\%) \\
\hline
Atelectasis & 2 (14\%) \\
\hline
\end{tabular}
\end{table} | PMC3226624_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Pt} & \textbf{Age/gender/Spa type} & \textbf{Type of infection} & \textbf{Treatment} & \textbf{Animal contact} & \textbf{Extra} \\
\hline
1 & 40/male/t011 & External otitis & Surgical cleansing, no antibiotic treatment & Pig farmer & Cured \\
\hline
2 & 90/male/t567 & Pleural empya & Surgical drainage, quinelones and rifampin & None & Post infectious sterile pleural effusion, surgically drained and secondarily infected through drain (colonized) with LA-MRSA \\
\hline
3 & 41/male/t011 & Abscess finger & Incision and drainage no antibiotic treatment & Butcher & Abscess of trauma with knife, wound cured. \\
\hline
4 & 89/male/t108 & Abcess tooth/jaw & Incision and drainage (2x) no antibiotic treatment & None & Cured \\
\hline
5 & 60/male/t108 & Wound infection of lymphnode biopsie & No specific treatment & Horse farm & T cell lymphoma, wound infection cured \\
\hline
6 & 80/female/t011 & Conjunctivitis & Topical antibiotics (fusidinic acid) & None & Conjunctivitis occurred during stay on ICU for gram negative urosepsis. Conjunctivitis cured \\
\hline
7 & 40/female/t011 & Toe wound & Numerous antibiotics & None & Wound occurred after a visit to Turkey. Wound cured. \\
\hline
\end{tabular}
\end{table} | PMC4407377_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|}
\hline
& & \multicolumn{2}{c|}{\textbf{(50→30) Sequence}} \\
\hline
& & \textbf{Forward} & \textbf{Reverse} \\
\hline
Anthocyanin & biosynthesis \\
\hline
CHS & Chalcone synthase & TGTGCAAAGTTGATTTTATTCGAC & ATGTCAGAAAGGAGGGTCCAATGG \\
\hline
CHI & Chalcone isomerase & GAGTGGTTAAGCAGATGACACGAC & AAGAAAATTGACAACATGCAGAAG \\
\hline
FHT & Flavanone 3-hydroxylase & TTGCACCTGAAGTAGAATTTTACA & TTCTGACAGAACTTCAAGCAATTT \\
\hline
F3050H1 & 30,50-hydroxylase Flavonoid & TCCATTGATTAAAATGAGGGACCA & TATGGTAAGTTGGGGATGTCTGAT \\
\hline
ANS & Anthocyanidin synthase & ATGTCAACTTTTTATTGGTCCTAA & GAGCACAGCAAGAACTTTGGTAGC \\
\hline
MYB3 & Transcription factor & CAATGCAGCAACATTTACACTACTCCCA & AAGAATCCATGAATGTAGCAGCAGCATC \\
\hline
bHLH1 & Transcription factor & AAGGTGATCGTTGTGAAAATGTCT & GGCCGTCTAGTTTGGTGGTTGGTT \\
\hline
\multicolumn{2}{c|}{Flowering time} \\
\hline
FT1 & Flowering locus T & CCTCAGGGAATACCTGCACTGTTT & ATCCCTCTAAAGTTTAGGTGTGTTATAAG \\
\hline
FT2 & Flowering locus T & TCTTTGACTCTCTTGCTTTCTTGATGA & ACCATCTTTCTACGACCGTTGCAT \\
\hline
TFL1 & Terminal flowering 1 & AAGATTATGGATTTGTACTCTTAGTCT & TAACTAATGATAAGATTATGTGAAG \\
\hline
W14/15 & Esterase & CTAGTCTCTACCATTTGTCCC & TCTACAAACAATGCACCTGG \\
\hline
\end{tabular}
\end{table} | PMC3561071_table_4 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Variables} & \textbf{Categories} & \multicolumn{3}{c|}{\textbf{Univariate analysis}} & \multicolumn{3}{c|}{\textbf{analysisb Multivariate}} \\
\hline
& & \textbf{\textbf{HR}} & \textbf{\textbf{95\% CI}} & \textbf{\textbf{valuec P}} & \textbf{\textbf{HR}} & \textbf{\textbf{95\% CI}} & \textbf{\textbf{valuec P}} \\
\hline
Training Cohort \\
\hline
Age (years) & $\geq$60 / <60 & 2.263 & 1.389-3.687 & 0.001 & 2.770 & 1.691-4.537 & <0.001 \\
\hline
Sex & Male / female & 0.878 & 0.596-1.293 & 0.510 \\
\hline
Tumor location & Colon / rectum & 1.401 & 0.923-2.125 & 0.113 \\
\hline
Tumor size (cm) & $\geq$5 / <5 & 1.114 & 0.753-1.648 & 0.590 \\
\hline
Differentiation grade & Poor / well + moderate & 2.626 & 1.761-3.916 & <0.001 & 2.010 & 1.337-3.023 & 0.001 \\
\hline
TNM stage & III / I+ II & 2.734 & 1.846-4.048 & <0.001 & 2.402 & 1.603-3.598 & <0.001 \\
\hline
expressiona CA7 & Low / high & 2.469 & 1.642-3.717 & <0.001 & 2.247 & 1.481-3.401 & <0.001 \\
\hline
Validation Cohort \\
\hline
Age (years) & $\geq$60 / <60 & 1.976 & 1.080-3.614 & 0.027 & 2.293 & 1.247-4.217 & 0.008 \\
\hline
Sex & Male / female & 0.737 & 0.459-1.183 & 0.207 \\
\hline
Tumor location & Colon / rectum & 0.961 & 0.599-1.542 & 0.868 \\
\hline
Tumor size (cm) & $\geq$5 / <5 & 0.814 & 0.503-1.317 & 0.403 \\
\hline
Differentiation grade & Poor / well + moderate & 1.688 & 1.017-2.803 & 0.043 \\
\hline
TNM stage & III / I+ II & 2.828 & 1.734-4.611 & <0.001 & 2.674 & 1.615-4.428 & <0.001 \\
\hline
expressiona CA7 & Low / high & 2.632 & 1.520-4.545 & 0.001 & 2.058 & 1.174-3.610 & 0.012 \\
\hline
\end{tabular}
\end{table} | PMC4406128_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{length (bp)} & \textbf{Sn (\%)} & \textbf{Sp (\%)} & \textbf{time (s)} & \textbf{memory (MB)} \\
\hline
Blastz (default) & 5,643,656 & 97.4 & 44.4 & 72 & 348 \\
\hline
Blastz (T = 2 C = 2) & 4,035,271 & 95.3 & 60.0 & 22 & 346 \\
\hline
AVID & 4,044,527 & 94.7 & 59.3 & 147 & 2297 \\
\hline
NUCmer & 1,121,714 & 26.1 & 59.2 & 12 & 90 \\
\hline
Cgaln (-X4000) & 4,313,795 & 96.3 & 57.2 & 9 & 167 \\
\hline
\end{tabular}
\end{table} | PMC2873541_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Primer name} & \textbf{Sequence (5′-3′)} & \textbf{Application} \\
\hline
T7 & TAATACGACTCACTATAGG & cDNA cloning \\
\hline
SP6 & ATTTAGGTGACACTATAGAA & cDNA cloning \\
\hline
5′SP1 & CCCACAGCACTGAGCCCAATC & Genome walking \\
\hline
5′SP2 & TATTTCCCGGTGATGGACATGA & Genome walking \\
\hline
5′SP3 & GGTAGAAACAGCGAGGGCAACT & Genome walking \\
\hline
3′SP1 & CACCTCCGCCAAGATTGTTATT & Genome walking \\
\hline
3′SP2 & CGCACTTGAAAGAACCATAGCAG & Genome walking \\
\hline
3′SP3 & GCTTTATGAGATTCGTTTGCGTGAT & Genome walking \\
\hline
F-R2 & CAGAAGATGTTACAAGACTAAAG & RT-PCR \\
\hline
F-S2 & GAGTTGCCCTCGCTGTTTGCTAT & RT-PCR \\
\hline
F-R3 & CGTGGTCTTGATGACGATGT & RealTime-PCR \\
\hline
F-S3 & TGGCTCAGTGCTGTGGGGT & RealTime-PCR \\
\hline
Actin-R & CTCCTGCTTGCTGATCCACATC & RT & RealTime-PCR \\
\hline
Actin-S & GCATCCACGAGACCACTTACA & RT & RealTime-PCR \\
\hline
\end{tabular}
\end{table} | PMC2949604_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Enzyme} & \textbf{Substrate} & \textbf{kcat} \\
\hline
TrCel7A & PASC (1 g/L) & 0.44/second \\
\hline
TrCel7A core & PASC (1 g/L) & 0.24/second \\
\hline
TrCel7A & pNP-lac (0.5 mM) & 0.07/second \\
\hline
TrCel7A core & pNP-lac (0.5 mM) & 0.06/second \\
\hline
\end{tabular}
\end{table} | PMC3257202_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{Treatment outcome}} & \multirow{2}{*}{\textbf{Intervention group (\%) (n = 2,107)}} & \multirow{2}{*}{\textbf{Control group (\%) (n = 1,984)}} \\
\hline
\\
\hline
Treatment completed & 911 (43.2) & 694 (35.0) \\
\hline
Cured & 695 (33.0) & 708 (35.7) \\
\hline
Defaulted & 158 (7.5) & 202 (10.2) \\
\hline
Treatment interrupted & 0 (0.0) & 15 (0.8) \\
\hline
Treatment failure & 79 (3.8) & 113 (5.7) \\
\hline
Multi-drug resistant TB & 1 (0.1) & 3 (0.2) \\
\hline
Died & 151 (7.2) & 137 (7.0) \\
\hline
Moved/transferred & 107 (5.1) & 99 (5.0) \\
\hline
No outcome data available & 5 (0.2) & 13 (0.7) \\
\hline
\end{tabular}
\end{table} | PMC3680200_table_4 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Experiment Name} & \textbf{Concentration HPRT in ng/μl} & \textbf{Concentration HA in ng/μl} & \textbf{Denaturation CT} & \textbf{Extension CT} \\
\hline
1:0 & 6.25 × 10−7 & 0 & 26.5 & 21.3 \\
\hline
1:1 & 6.25 10−7 × & 6.25 10−7 × & 26.3 & 19.3 \\
\hline
1:2 & 6.25 10−7 × & 12.5 10−7 × & 26.2 & 18.2 \\
\hline
1:10 & 6.25 × 10−7 & 6.25 × 10−6 & 26.3 & 17.9 \\
\hline
1:20 & 6.25 × 10−7 & 12.5 × 10−6 & 24.9 & 15.8 \\
\hline
\end{tabular}
\end{table} | PMC4515875_table_2 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{Condition} & \textbf{Parameters} \\
\hline
Cell temperature (°C) & 60 \\
\hline
Gas dew point (°C) & 41 (40\% RH) \\
\hline
Gas flow rate (L/min) & 1, 2, 4 \\
\hline
\end{tabular}
\end{table} | PMC3279239_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Analyte} & \textbf{Dogs (n)} & \textbf{Median (Range)} & \textbf{2.5th Percentile (90\% CI)} & \textbf{97.5th Percentile (90\% CI)} & \textbf{Normality (p)} \\
\hline
uNAG/c (U/g) & 17 & 5.74 (2.75–13.396) & ND & ND & 0.003 \\
\hline
uRBP/c (μg/g) & 30 & 21.74 (BDL-76.56) & <2.77 (ND) & 82.74 (51.86–132.24) & <0.001 \\
\hline
uAlb/c (mg/g) & 30 & 19.30 (2.06–96.65) & 1.82 (1.04–3.27) & 233.72 (143.58–476.58) & 0.001 \\
\hline
(mg/g)a uIgG/c & 28 & 1.41 (0.26–23.60) & 0.15 (0.09–0.3) & 9.78 (4.82–20.80) & <0.001 \\
\hline
\end{tabular}
\end{table} | PMC4504498_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Digoxin-exposed} & \textbf{Person-years} & \textbf{Relapse, number} & \textbf{Hazard ratio (95\% CI)} & \textbf{P-value1} \\
\hline
\multirow{2}{*}{All} & Yes & 1,872 & 69 & 1.13 (0.88, 1.46) & 0.04 \\
\hline
No & 148,034 & 5,037 & 1.0 \\
\hline
Estrogen receptor status \\
\hline
\multirow{2}{*}{Positive} & Yes & 1,524 & 55 & 1.15 (0.87, 1.52) & 0.03 \\
\hline
No & 111,485 & 3,456 & 1.0 \\
\hline
\multirow{2}{*}{Negative} & Yes & 280 & 10 & 0.93 (0.45, 1.90) & 0.94 \\
\hline
No & 30,256 & 1,345 & 1.0 \\
\hline
\multirow{2}{*}{Unknown} & Yes & 67 & 4 & 1.67 (0.49, 5.69) & 0.53 \\
\hline
No & 6,293 & 236 & 1.0 \\
\hline
treatment2 Digoxin exposure with anti-estrogen \\
\hline
\multirow{2}{*}{Tamoxifen} & Yes & 353 & 26 & 1.04 (0.68, 1.60) & 0.36 \\
\hline
No & 23,742 & 1,431 & 1.0 \\
\hline
\multirow{2}{*}{Aromatase inhibitors} & Yes & 79 & 4 & 1.87 (0.46, 7.56) & 0.68 \\
\hline
No & 2,467 & 87 & 1.0 \\
\hline
\multirow{2}{*}{Neither} & Yes & 1,038 & 33 & 1.10 (0.75, 1.61) & 0.49 \\
\hline
No & 81,704 & 2,815 & 1.0 \\
\hline
\end{tabular}
\end{table} | PMC3672748_table_1 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\textbf{18–60 Years} & \textbf{> 60 Years} \\
\hline
\textbf{Seroconversion rate > 40\%} & \textbf{Seroconversion rate > 30\%} \\
\hline
Mean geometric increase > 2.5 & Mean geometric increase > 2.0 \\
\hline
Seroprotection rate > 70\% & Seroprotection rate > 60\% \\
\hline
\end{tabular}
\end{table} | PMC4494249_table_0 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Primary atom site location: structure-invariant direct methods \\
\hline
Least-squares matrix: full & Secondary atom site location: difference Fourier map \\
\hline
R[F2 2σ(F2)] > = 0.046 & Hydrogen site location: inferred from neighbouring sites \\
\hline
wR(F2) = 0.128 & H-atom parameters constrained \\
\hline
S = 1.03 & 1/[σ2(Fo 2) (0.0568P)2 w = + + 0.3537P] 2 2)/3 where P = (Fo + 2Fc \\
\hline
10300 reflections & (Δ/σ)max = 0.001 \\
\hline
399 parameters & Å−3 Δρmax = 0.43 e \\
\hline
0 restraints & Å−3 Δρmin = −0.28 e \\
\hline
\end{tabular}
\end{table} | PMC3008119_table_0 | |
\begin{table}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \textbf{Frequency} & \textbf{Percentage} \\
\hline
\multicolumn{2}{c|}{Effect of MMC on the risk of acquiring HIV} \\
\hline
No effect & 11 & 2.8 \\
\hline
It increases the risk of acquiring HIV & 6 & 1.5 \\
\hline
It reduces the risk of acquiring HIV & 375 & 95.2 \\
\hline
Other & 1 & 0.3 \\
\hline
Missing & 1 & 0.3 \\
\hline
\multicolumn{2}{c|}{Whether risky sexual behaviour can remove} & circumcision \\
\hline
Yes & 340 & 86.3 \\
\hline
No & 35 & 8.9 \\
\hline
Unsure & 18 & 4.6 \\
\hline
Missing & 1 & 0.3 \\
\hline
\multicolumn{2}{c|}{Whether male circumcision protects women} & with HIV \\
\hline
Yes & 34 & 8.7 \\
\hline
No & 347 & 94.9 \\
\hline
Unsure & 11 & 11.0 \\
\hline
Missing & 2 & 0.5 \\
\hline
\end{tabular}
\end{table} | PMC4564906_table_2 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variables} & \multicolumn{2}{c|}{\textbf{Sense of contribution to society}} & \multicolumn{2}{c|}{\textbf{Sense of bonding with work\textbf{\textbf{p}}lace}} \\
\hline
& \textbf{\textbf{Value}} & \textbf{\textbf{p}} & \textbf{\textbf{Value}} & \textbf{\textbf{p}} \\
\hline
\textbf{Sense of bonding with work\textbf{\textbf{p}}lace} & 0.47 & < 0.01 & - & - \\
\hline
Sociodemogra\textbf{\textbf{p}}hic characteristics \\
\hline
Sex* & 6.36 & 0.10 & 6.04 & 0.11 \\
\hline
Age grou\textbf{\textbf{p}} & 0.11 & < 0.01 & 0.09 & < 0.01 \\
\hline
Job \textbf{\textbf{p}}osition* & 16.0 & < 0.01 & 30.1 & < 0.01 \\
\hline
De\textbf{\textbf{p}}artment* & 6.68 & 0.35 & 3.45 & < 0.01 \\
\hline
Job stress factor \\
\hline
Su\textbf{\textbf{p}}\textbf{\textbf{p}}ort from su\textbf{\textbf{p}}ervisors & 0.19 & < 0.01 & 0.30 & < 0.01 \\
\hline
Su\textbf{\textbf{p}}\textbf{\textbf{p}}ort from co-workers & 0.22 & < 0.01 & 0.28 & < 0.01 \\
\hline
Su\textbf{\textbf{p}}\textbf{\textbf{p}}ort from family & 0.14 & < 0.01 & 0.18 & < 0.01 \\
\hline
Quantitative workload & 0.07 & 0.02 & 0.04 & 0.19 \\
\hline
Qualitative workload & 0.12 & < 0.01 & 0.07 & 0.05 \\
\hline
Job control latitude & 0.23 & < 0.01 & 0.23 & < 0.01 \\
\hline
\end{tabular}
\end{table} | PMC3369557_table_1 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{DSI vs. DSU}} & \multicolumn{2}{c|}{\textbf{L1I vs. L1U}} & \multicolumn{2}{c|}{\textbf{B713I vs. B713U}} \\
\hline
\textbf{Families} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}} & \textbf{Total} \\
\hline
MYB & 19 & 5 & 7 & 13 & 3 & 6 & 48 \\
\hline
ERF & 13 & 6 & 6 & 10 & 6 & 5 & 44 \\
\hline
WRKY & 10 & 3 & 10 & 9 & 2 & 1 & 29 \\
\hline
HSF & 5 & 2 & 2 & 3 & 2 & 3 & 14 \\
\hline
GRAS & 6 & 2 & 4 & 1 & 0 & 2 & 11 \\
\hline
BZIP & 4 & 2 & 3 & 0 & 2 & 0 & 10 \\
\hline
NAC & 0 & 1 & 1 & 2 & 1 & 2 & 7 \\
\hline
\end{tabular}
\end{table} | PMC4646469_table_6 | |
\begin{table}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Bangladesh Sera} & \textbf{\% Sensitivity} & \textbf{\textbf{95\% Confidence Interval}} & \textbf{\% Specificity} & \textbf{\textbf{95\% Confidence Interval}} \\
\hline
K28-LF* & 98.1 & 89.93–99.95\% & 92.5 & 79.61–98.43\% \\
\hline
Kalazar Detect* & 88.7 & 76.97–95.73\% & 100 & 91.19–100.0\% \\
\hline
No. of Sera Tested & 53 & & 40 \\
\hline
\end{tabular}
\end{table} | PMC2939046_table_2 | |
\begin{table}
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{c|}{\textbf{Determine which impacts to marine mammals need to be monitored:}} \\
\hline
\textbf{The energy resource is} \\
\hline
Wind & Go to A \\
\hline
Tidal & Go to B \\
\hline
Waves & Go to C \\
\hline
(A) The stage of the wind energy project is \\
\hline
Construction & W1, W2, W3, W4, W5 \\
\hline
Operation & W1, W2, W3, W4, W5 \\
\hline
Decommissioning & W1, W2, W3, W4, W5 \\
\hline
(B) The stage of the tidal energy project is \\
\hline
Construction & W1, W2, W3, W4, W5 \\
\hline
Operation & W1, W2, W3, W4, W5 \\
\hline
Decommissioning & W1, W2, W3, W4, W5 \\
\hline
(C) The stage of the wave energy project is \\
\hline
Construction & W1, W2, W3, W4, W5 \\
\hline
Operation & W1, W2, W3, W4, W5 \\
\hline
Decommissioning & W1, W2, W3, W4, W5 \\
\hline
\end{tabular}
\end{table} | PMC3540755_table_4 |
End of preview. Expand
in Data Studio
README.md exists but content is empty.
- Downloads last month
- 120