Datasets:

deepcopy
/

pubmed-tables-latex-768px

Modalities:

Image

Text

Formats:

Size:

Libraries:

Dataset card Data Studio Files Files and versions

xet

Community

Dataset Viewer

Auto-converted to Parquet

Split (1)

train · 360k rows

latex string	filename string	image image
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Feature} & \textbf{XL CGD} & \textbf{AR CGD} \\ \hline Family history of lupus & 10\% & 3\% \\ \hline Age at diagnosis & 3.01 years & 7.81 years \\ \hline Perirectal abscess & 17\% & 7\% \\ \hline Suppurative adenitis & 59\% & 32\% \\ \hline Bacteremia and/or fungemia & 21\% & 10\% \\ \hline Gastric outlet obstruction & 19\% & 5\% \\ \hline Urinary obstruction & 11\% & 3\% \\ \hline Mortality (over 10 year observation) & 21.2\% & 8.6\% \\ \hline \end{tabular} \end{table}	PMC3128843_table_5
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Diagnosis} & \textbf{Number of diagnosis (\%)} & \textbf{Operated (\%)} & \textbf{Success (\%)} \\ \hline Vesicovaginal & 28 (35) & 22 (79) & 20(91) \\ \hline Rectovaginal & 4 (5) & 4 (100) & 4 (100) \\ \hline Recto and vesicovaginal & 7 (9) & 5 (71) & 4 (80) \\ \hline All fistula & 39 (48) & 32 (82) & 28 (88) \\ \hline 4th degree perineal tear & 21 (26) & 21 (100) & 21 (100) \\ \hline Other operable conditions & 21 (26) & 14 (67) & 10 (71) \\ \hline Total & 81 & 66(81) & 59 (89) \\ \hline \end{tabular} \end{table}	PMC3607911_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Biochemical factor} & \multicolumn{2}{c\|}{\textbf{category}} & \textbf{No.} & \textbf{\%} \\ \hline \textbf{Baseline NTx} & \textbf{normal} & \textbf{18 nM BCE $\leq$} & \textbf{30} & \textbf{50} \\ \hline & ab\textbf{normal} & > 18 nM BCE & \textbf{30} & \textbf{50} \\ \hline \multirow{2}{}{Baseline VEGF} & \textbf{normal} & \textbf{50}0 pg/ml $\leq$ & \textbf{30} & \textbf{50} \\ \hline ab\textbf{normal} & > \textbf{50}0 pg/ml & \textbf{30} & \textbf{50} \\ \hline \multirow{2}{}{Baseline CEA} & \textbf{normal} & 10 μg/L $\leq$ & 42 & 70 \\ \hline ab\textbf{normal} & > 10 μg/L & 18 & \textbf{30} \\ \hline \multirow{2}{}{Baseline CA 15-3} & \textbf{normal} & 51 U/mL $\leq$ & 21 & 35 \\ \hline ab\textbf{normal} & > 51 U/mL & 39 & 65 \\ \hline \multirow{2}{}{NTx (days 90)} & \textbf{normal} & $\leq$ 18 nM BCE & 34 & 56.7 \\ \hline ab\textbf{normal} & > 18 nM BCE & 16 & 43.3 \\ \hline \multirow{2}{*}{VEGF (days 90)} & \textbf{normal} & $\leq$ \textbf{50}0 pg/ml & 29 & 48.3 \\ \hline ab\textbf{normal} & > \textbf{50}0 pg/ml & 21 & 42.7 \\ \hline \end{tabular} \end{table}	PMC3196722_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Subject Characteristics} \\ \hline & Boys & Girls & P-value* \\ \hline N & 14 & 15 \\ \hline Age (years) & 12.6 $\pm$ 0.3 & 11.7 $\pm$ 0.4 & 0.075 \\ \hline Height (cm) & 156.0 $\pm$ 3.7 & 150.9 $\pm$ 2.6 & 0.28 \\ \hline Weight (kg) & 46.5 $\pm$ 2.8 & 41.9 $\pm$ 2.5 & 0.24 \\ \hline BMI (\%ile) & 55.9 $\pm$ 4.3 & 52.8 $\pm$ 6.2 & 0.69 \\ \hline Fat mass (kg) & 10.5 $\pm$ 0.8 & 10.1 $\pm$ 1.3 & 0.80 \\ \hline Fat mass (\%) & 22.7 $\pm$ 1.3 & 22.8 $\pm$ 2.0 & 0.98 \\ \hline Fat free mass (kg) & 36.0 $\pm$ 2.4 & 31.8 $\pm$ 1.4 & 0.15 \\ \hline Fat free mass (\%) & 77.3 $\pm$ 1.3 & 77.2 $\pm$ 2.0 & 0.98 \\ \hline Ventilation Threshold (mL·min-1) & 1067.5 $\pm$ 90.7 & 933.1 $\pm$ 42.1 & 0.18 \\ \hline Ventilation Threshold (mL·kg-1·min-1) & 23.0 $\pm$ 1.2 & 22.2 $\pm$ 0.9 & 0.59 \\ \hline \end{tabular} \end{table}	PMC2768671_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Clinical Parameters} & \multicolumn{2}{c\|}{\textbf{UNIVARIATE}} & \multicolumn{2}{c\|}{\textbf{MULTIVARIATE}} \\ \hline & \textbf{\textbf{Risk Ratio (95\% CI)}} & \textbf{\textbf{P value}} & \textbf{\textbf{Risk Ratio (95\% CI)}} & \textbf{\textbf{P value}} \\ \hline Age Above = 50 & 0.80 (0.54-1.19) & 0.2751 & 0.74 (0.49 - 1.14) & 0.1712 \\ \hline Stage IV & 2.15 (1.32 - 3.41) & 0.0028 & 1.82 (1.08 - 2.93) & 0.0243 \\ \hline Grade Poor & 1.27 (0.82-1.93) & 0.5303 & 1.15 (0.72 - 1.79) & 0.5445 \\ \hline Leptin R(Ob-R) Overexpression & 1.82 (1.22-2.75) & 0.0032 & 1.96 (1.28 - 3.06) & 0.0020 \\ \hline \end{tabular} \end{table}	PMC2754986_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{Main analysis}} & \multicolumn{2}{c\|}{\textbf{Depressive disorders spectrum analysis}} \\ \hline & \textbf{\textbf{Coefficient}} & \textbf{\textbf{[95\% confidence interval]}} & \textbf{\textbf{Coefficient}} & \textbf{\textbf{[95\% confidence interval]}} \\ \hline Arm characteristics \\ \hline RCT (Ref = Observational) & 4.59 & [2.61 to 6.56] & 2.45 & [0.97 to 3.93] \\ \hline Scale (Ref = HAM-21) \\ \hline HAMD-17 & 22.32 & [23.03 to 21.61] & 21.66 & [22.29 to 21.03] \\ \hline MADRS & 21.26 & [22.62 to 0.09] & 21.34 & [22.10 to 0.57] \\ \hline Treatment (Ref = Fluoxetine) \\ \hline Placebo & 23.35 & [23.97 to 22.74] & 23.42 & [23.93 to 22.92] \\ \hline Venlafaxine & 2.51 & [1.88 to 3.14] & 2.25 & [1.81 to 2.70] \\ \hline Double blind study (Ref = No) & 25.21 & [26.85 to 23.57] & 23.37 & [24.65 to 22.09] \\ \hline Placebo design study (Ref = No) & 24.54 & [25.50 23.58] to & 23.54 & [24.21 22.86] to \\ \hline Year of publication & 0.07 & [0.01 to 0.13] & 0.10 & [0.05 to 0.15] \\ \hline Duration & 0.27 & [0.14 to 0.40] & 0.17 & [0.11 to 0.23] \\ \hline Number of follow up assessments & 0.33 & [0.11 to 0.55] & 0.26 & [0.13 to 0.39] \\ \hline Exclusion of placebo responders & 20.27 & [21.06 to 0.52] & 20.08 & [20.71 to 0.54] \\ \hline Type of analysis PP (Ref=ITT with LOCF) & 2.52 & [1.45 to 3.6] & 2.55 & [1.87 to 3.23] \\ \hline Patient type (Ref = Inpatients) \\ \hline Outpatients & 1.81 & [0.88 to 2.72] & 2.81 & [2.18 to 3.43] \\ \hline Outpatients in primary care & 3.73 & [2.37 to 5.09] & 3.69 & [2.59 to 4.80] \\ \hline Patient characteristics \\ \hline Mean age & 20.16 & [20.26 to 20.07] & 20.05 & [20.11 to 0.01] \\ \hline Gender & 0.00 & [20.03 to 0.04] & 0.01 & [20.02 to 0.04] \\ \hline Baseline severity & 0.78 & [0.71 to 0.84] & 0.83 & [0.78 to 0.88] \\ \hline \end{tabular} \end{table}	PMC3110792_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{True proportion in active control} & \textbf{Non-inferiority bound using 10\% margin} & \multicolumn{3}{c\|}{\textbf{Approximate sample size per group assuming 1:1 randomization to new treatment and control required under:}} \\ \hline & & \textbf{Equal effects} & \textbf{5\% benefit} & \textbf{10\% benefit} \\ \hline 0.1 & 0.09 & 19,200 & 8,725 & 5,050 \\ \hline 0.2 & 0.18 & 8,500 & 3,900 & 2,250 \\ \hline 0.3 & 0.27 & 4,970 & 2,260 & 1,300 \\ \hline 0.4 & 0.36 & 3,200 & 1,450 & 825 \\ \hline 0.5 & 0.45 & 2,100 & 1,000 & 550 \\ \hline 0.6 & 0.54 & 1,440 & 640 & 360 \\ \hline 0.7 & 0.63 & 930 & 405 & 225 \\ \hline \end{tabular} \end{table}	PMC3113981_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{MIGS ID} & \textbf{Property} & \textbf{Term} & \textbf{Evidence code} \\ \hline & Classification & Domain Bacteria Phylum Actinobacteria Class Actinobacteria Order Actinomycetales Suborder Frankineae Family Nakamurellaceae Genus Nakamurella Species Nakamurella multipartita Type strain Y-104 & TAS [15] TAS [16] TAS [5] TAS [5] TAS [2] TAS [2] TAS [2] TAS [2] TAS [1] \\ \hline & Gram stain & positive & TAS [1] \\ \hline & Cell shape & coccus & TAS [1] \\ \hline & Motility & non-motile & TAS [1] \\ \hline & Sporulation & non-sporulating & TAS [1] \\ \hline & Temperature range & 10-35°C & TAS [1] \\ \hline & Optimum temperature & 25°C & TAS [1] \\ \hline & Salinity & up to 6g NaCl/L & TAS [1] \\ \hline \multirow{3}{}{MIGS-22} & Oxygen requirement & aerobic chemoorganotroph & TAS [1] \\ \hline Carbon source & sugars, alcohols, glucose, maltose, mannose, fructose, starch & TAS [1] \\ \hline Energy source & starch, ethanol, propanol & TAS [1] \\ \hline MIGS-6 & Habitat & activated sludge cultured in fed-batch reactors & TAS [1] \\ \hline MIGS-15 & Biotic relationship & free-living & NAS \\ \hline \multirow{3}{}{MIGS-14} & Pathogenicity & none & NAS \\ \hline Biosafety level & 1 & TAS [17] \\ \hline Isolation & activated sludge & TAS [1] \\ \hline MIGS-4 & Geographic location & not reported \\ \hline MIGS-5 & Sample collection time & not reported \\ \hline MIGS-4.1 MIGS-4.2 & Latitude Longitude & not reported \\ \hline MIGS-4.3 & Depth & not reported \\ \hline MIGS-4.4 & Altitude & not reported \\ \hline \end{tabular} \end{table}	PMC3035273_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Size of posterior fragment} & \textbf{N} & \textbf{AOFAS} & \textbf{VAS-pain} & \textbf{Dorsiflexion-restriction} & \textbf{OA grade 1} & \textbf{OA grade 2} & \textbf{OA grade 3} & \textbf{OA grade 4} \\ \hline <5 \% & 8 & 95 & 1.4 & 2.9° & 8 & 0 & 0 & 0 \\ \hline 5–25 \% & 56 & 88 & 2.1 & 6.2° & 38 & 9 & 7 & 2 \\ \hline >25 \% & 14 & 90 & 1.6 & 7.8° & 10 & 1 & 1 & 2 \\ \hline \end{tabular} \end{table}	PMC4548913_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \textbf{N} & \textbf{Mean} & \textbf{Std. Deviation} & \textbf{Std. Error} & \textbf{Minimum} & \textbf{Maximum} \\ \hline Stress to failure & Autoclave & 10 & .916 & .300 & .094 & .58 & 1.63 \\ \hline \multirow{5}{}{(MPa)} & Boiled & 10 & .882 & .245 & .077 & .63 & 1.47 \\ \hline Pasteurization & 10 & 1.222 & .743 & .235 & .46 & 2.59 \\ \hline Irradiation & 10 & 1.022 & .617 & .195 & .44 & 2.56 \\ \hline Control & 10 & 2.035 & 1.253 & .396 & .77 & 4.64 \\ \hline Total & 50 & 1.215 & .820 & .116 & .44 & 4.64 \\ \hline Strain to failure & Autoclave & 10 & 4.671 & 1.926 & .609 & 2.42 & 9.43 \\ \hline \multirow{5}{}{\%} & Boiled & 10 & 4.699 & 2.716 & .859 & 1.27 & 9.63 \\ \hline Pasteurization & 10 & 5.832 & 3.917 & 1.238 & 1.94 & 14.62 \\ \hline Irradiation & 10 & 3.654 & 1.272 & .402 & 1.39 & 5.79 \\ \hline Control & 10 & 9.691 & 7.526 & 2.380 & .71 & 25.35 \\ \hline Total & 50 & 5.709 & 4.481 & .633 & .71 & 25.35 \\ \hline Modulus & autoclave & 10 & 6.462 & 4.923 & 1.556 & 1.37 & 13.36 \\ \hline \multirow{5}{*}{(MPa)} & Boiled & 10 & 3.909 & 2.421 & .765 & 1.27 & 9.16 \\ \hline pasteur & 10 & 7.764 & 5.739 & 1.814 & 2.80 & 18.67 \\ \hline gamma & 10 & 10.593 & 5.025 & 1.589 & 1.29 & 17.02 \\ \hline Control & 10 & 19.039 & 16.358 & 5.173 & 7.18 & 49.35 \\ \hline Total & 50 & 9.553 & 9.646 & 1.364 & 1.27 & 49.35 \\ \hline \end{tabular} \end{table}	PMC2944266_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{mode based the olives percentage} & \textbf{Palmitic acid (\%)} & & \textbf{Stearic acid (\%)} & & & \textbf{Oleic acid (\%)} & & & \textbf{Linoleic acid (\%)} & & & \textbf{Free acidity (\% oleic acid)} & & \textbf{Polyphenols (mg kg−1)} & & \textbf{K232} & & & \textbf{K270} \\ \hline From the tree & 19.72 & A & 1.24 & a & A & 50.53 & d & B & 24.97 & a & A & 0.95 & E & 70.01 & A & 2.35 & c & B & 0.13 & D \\ \hline First fall & 19.93 & A & 1.04 & c & CD & 51.66 & c & B & 24.17 & ab & AB & 1.52 & D & 42.80 & B & 2.42 & c & B & 0.17 & C \\ \hline Second fall & 19.98 & A & 1.11 & b & B & 51.49 & c & B & 23.99 & abc & AB & 3.27 & C & 25.92 & C & 2.70 & b & A & 0.20 & B \\ \hline Third fall & 19.09 & B & 0.92 & d & D & 53.16 & b & A & 23.82 & bc & AB & 5.70 & B & 18.72 & D & 2.92 & a & A & 0.24 & A \\ \hline Forth fall & 18.70 & B & 1.12 & b & BC & 54.27 & a & A & 23.04 & c & B & 6.42 & A & 12.32 & E & 2.89 & ab & A & 0.23 & A \\ \hline regimes \\ \hline TWW (alternate) & 19.35 & B & 1.39 & & A & 50.71 & & B & 24.90 & & AB & 6.19 & B & 21.29 & D & 2.83 & a & AB & 0.26 & A \\ \hline TWW (continuous) & 17.40 & C & 0.94 & & C & 57.32 & & A & 21.48 & & C & 6.80 & A & 26.36 & C & 2.32 & c & C & 0.21 & B \\ \hline Not irrigated & 19.67 & B & 0.71 & & D & 51.49 & & B & 25.58 & & A & 0.72 & C & 50.87 & A & 2.63 & b & B & 0.15 & C \\ \hline CW & 21.52 & A & 1.30 & & B & 49.37 & & C & 24.03 & & B & 0.58 & C & 37.28 & B & 2.84 & a & A & 0.16 & C \\ \hline \end{tabular} \end{table}	PMC3361296_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{4}{c\|}{\textbf{Testosterone}} \\ \hline & \textbf{No.} & \textbf{\%} & \textbf{Mean $\pm$ SD (ng/ml)} & \textbf{P} \\ \hline All natural menopause \\ \hline AR expression \\ \hline Absent & 59 & 13.1 & 0.434 $\pm$ 0.198 & \multirow{4}{}{0.099b 0.002c 0.002d} \\ \hline \textbf{P}oor & 111 & 24.7 & 0.385 $\pm$ 0.187 \\ \hline Moderate & 120 & 26.8 & 0.384 $\pm$ 0.166 \\ \hline High & 159 & 35.4 & 0.462 $\pm$ 0.215 \\ \hline Totala & 449 & 100.0 & 0.419 $\pm$ 0.196 \\ \hline ER-positive \\ \hline AR expression \\ \hline Absent & 31 & 8.2 & 0.451 $\pm$ 0.203 & \multirow{4}{}{0.116b 0.003c 0.022d,f 0.216e,f} \\ \hline \textbf{P}oor & 91 & 24.1 & 0.402 $\pm$ 0.189 \\ \hline Moderate & 107 & 28.3 & 0.385 $\pm$ 0.170 \\ \hline High & 149 & 39.4 & 0.470 $\pm$ 0.217 \\ \hline Total & 378 & 100.0 & 0.200g 0.428 $\pm$ \\ \hline ER-negative \\ \hline AR expression \\ \hline Absent & 28 & 39.4 & 0.415 $\pm$ 0.193 & \multirow{4}{*}{0.204c 0.510b} \\ \hline \textbf{P}oor & 20 & 28.2 & 0.310 $\pm$ 0.160 \\ \hline Moderate & 13 & 18.3 & 0.378 $\pm$ 0.124 \\ \hline High & 10 & 14.1 & 0.345 $\pm$ 0.139 \\ \hline Total & 71 & 100.0 & 0.168g 0.369 $\pm$ \\ \hline \end{tabular} \end{table}	PMC3554552_table_1
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Characteristics} & \textbf{Value} \\ \hline Age \\ \hline Mean $\pm$ SD (years) & 52.1 $\pm$ 10.3 \\ \hline Range & 22-66 \\ \hline $\leq$50 years & 99 (45.8\%) \\ \hline >50 years & 117 (54.2\%) \\ \hline Primary tumor histology \\ \hline Ductal & 184 (85.2\%) \\ \hline Lobular & 12 (5.6\%) \\ \hline Other & 20 (9.3\%) \\ \hline Primary tumor grade \\ \hline I & 22 (10.2\%) \\ \hline II & 180 (83.3\%) \\ \hline III & 14 (6.5\%) \\ \hline Hormonal receptor status & 184 (85.2\%) \\ \hline Positive & 143 (66.2\%) \\ \hline Negative & 73 (33.8\%) \\ \hline HER2 \\ \hline Positive & 42 (19.4\%) \\ \hline Negative & 174 (80.6\%) \\ \hline Ki67 & 14 (6.5\%) \\ \hline >14\% & 147 (68.1\%) \\ \hline $\leq$14\% & 69 (31.9\%) \\ \hline AJCC stage \\ \hline I & 76 (35.2\%) \\ \hline II & 140 (64.8\%) \\ \hline \end{tabular} \end{table}	PMC4435774_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{5}{c\|}{\textbf{Expected genotype call (KASP)}} \\ \hline \textbf{Genotyping-by-sequencing} & \textbf{Nulliplex} & \textbf{Simplex} & \textbf{Duplex} & \textbf{Triplex} & \textbf{Quadruplex} & \textbf{Total} \\ \hline Concordant calls & 4,975 & 4,861 & 2,204 & 1,373 & 1,272 & 14,685 \\ \hline Discordant calls & 67 & 25 & 86 & 34 & 25 & 237 \\ \hline Percentage of concordant calls & 98.7\% & 99.5\% & 96.2\% & 97.6\% & 98.1\% & 98.4\% \\ \hline Median read-depth of concordant calls & 856 & 916 & 1016 & 926 & 756 & 896 \\ \hline Median read-depth of discordant calls & 526 & 566 & 736 & 836 & 476 & 616 \\ \hline Percentage of alternative reads for concordant calls & 0\% & 23\% & 49\% & 76\% & 100\% & – \\ \hline Percentage of alternative reads for discordant calls & 4\% & 36\% & 34\% & 56\% & 97\% & – \\ \hline \end{tabular} \end{table}	PMC3648547_table_4
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \multicolumn{3}{c\|}{\textbf{NWGP}} & \multicolumn{3}{c\|}{\textbf{WYB}} \\ \hline \textbf{\textbf{Variable}} & \textbf{\textbf{Available}} & \textbf{\textbf{Used}} & \textbf{\textbf{Variable}} & \textbf{\textbf{Available}} & \textbf{\textbf{Used}} \\ \hline ag 5km & 0.14 & 0.16 & ag 200m & 0.01 & -0.04 \\ \hline cliff 200m & -0.03 & 0.16 & cliff 200m & -0.02 & -0.03 \\ \hline ndvi 5km & -0.02 & 0.08 & slope 1km & -0.03 & -0.14 \\ \hline 5km2 ndvi & -0.11 & -0.14 & herb 5km m & -0.03 & -0.05 \\ \hline treed 5km & -0.12 & 0.00 & herb 5km sd & 0.00 & 0.03 \\ \hline ﬂat/open 200m & -0.01 & -0.05 & sage 5km m & -0.04 & -0.21 \\ \hline slope 5km & 0.00 & 0.23 & sage 5km sd & 0.00 & -0.12 \\ \hline sage 5km m & -0.03 & 0.01 & shrb 5km m & -0.04 & -0.10 \\ \hline sage 5km sd & -0.02 & 0.05 & lek count & -0.03 & -0.08 \\ \hline lek count lag & -0.03 & 0.02 & tmin & -0.05 & -0.09 \\ \hline Tmin & -0.07 & -0.20 & tmin2 & 0.04 & -0.07 \\ \hline tmin2 & -0.06 & -0.06 & ppt & 0.02 & 0.04 \\ \hline ppt lag & 0.04 & 0.14 & ppt2 & 0.02 & -0.05 \\ \hline lag2 ppt & -0.08 & -0.12 & elev & -0.03 & -0.13 \\ \hline Elev & 0.00 & -0.09 & elev2 & 0.01 & 0.03 \\ \hline elev2 & -0.14 & -0.03 \\ \hline \end{tabular} \end{table}	PMC4532434_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Bacteria (all natively sensitive to antibiotics)} & \textbf{Relevant Characteristics} & \textbf{Resistant or Sensitive} \\ \hline Salmonella typhimurium; Salmonella paratyphi; Salmonella pullorum/pFimH; Salmonella javiana & Express a FimH protein with Thr at amino acid 78 & Resistant \\ \hline Salmonella typhimurium/dFimH; Salmonella pullorum; Salmonella gallinarum & Express a FimH protein with Ile at amino acid 78 & Sensitive \\ \hline Shigella flexneri; E. coli & Invade and attach via alternative processes & Sensitive \\ \hline \end{tabular} \end{table}	PMC3143092_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & & \multirow{3}{}{\textbf{Test set n = 9 No. (\%)}} & \multirow{3}{}{\textbf{Validation set n = 24 No. (\%)}} \\ \hline \\ \hline \multicolumn{2}{c\|}{\textbf{Variable}} \\ \hline \multirow{2}{*}{Age at surgery, years (mean)} & & 64.7 & 76.0 \\ \hline Range & 52.3–71.5 & 48.4–93.6 \\ \hline Gender \\ \hline & Female & 3 (33\%) & 9 (37.5\%) \\ \hline & Male & 6 (67\%) & 15 (62.5\%) \\ \hline Tumour location \\ \hline & Right & 1 (11\%) & 0 (0\%) \\ \hline & Left & 8 (89\%) & 24 (100\%) \\ \hline TNM stage \\ \hline & I & 9 (100\%) & 21 (87.5\%) \\ \hline & II & 0 (0\%) & 0 (0\%) \\ \hline & III & 0 (0\%) & 2 (8.3\%) \\ \hline & IV & 0 (0\%) & (4.2\%)a 1 \\ \hline Histology, cancer \\ \hline & Adenocarcinoma & 9 (100\%) & 24 (100\%) \\ \hline Histology, adenoma \\ \hline & Tubular & 4 (44\%) & 11 (46\%) \\ \hline & Tubulovillous & 5 (56\%) & 11 (46\%) \\ \hline & Villous & 0 (0\%) & 2 (8\%) \\ \hline Vascular invasion & & 1 (11\%) & 0 (0\%) \\ \hline Mismatch repair protein \\ \hline & Normal expression & 9 (100\%) & 23 (96\%) \\ \hline & Loss & 0 (0\%) & 1 (4\%) \\ \hline \end{tabular} \end{table}	PMC4605595_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline N1A—H1A···O1Ai & 0.85 (3) & 2.02 (3) & 2.852 (3) & 165 (2) \\ \hline N1B—H1B···O1Bi & 0.83 (3) & 2.02 (3) & 2.833 (3) & 165 (2) \\ \hline C7A—H72A···Cg1ii & 0.96 & 2.71 & 3.637 (3) & 163 \\ \hline C8B—H83B···Cg2iii & 0.96 & 2.70 & 3.640 (3) & 167 \\ \hline \end{tabular} \end{table}	PMC3344021_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{All patients (n = 173)} & \textbf{IPAa Patients with (n = 15)} & \textbf{Patients without IPA (n = 158)} \\ \hline Cultured samples & 298b & 37 & 261 \\ \hline Positive (\% and 95\% CI) & 63 (21.1\% 16–26\%) & 27 (73\%, 58–88\%) & 36 (13.8\%, 10–18\%) \\ \hline Samples with MycAssay determinations & 308 & 37 & 271 \\ \hline CI)c Positive (\% and 95\% & 51(16.5\%, 13–21\%) & 24 (64.9\%; 49–81\%) & 27 (10.3\%, 7–14\%) \\ \hline Concordance between fungal \\ \hline MycAssayd culture and \\ \hline Culture 2/MycAssay 2 (\% and 95\% CI) & 217 (72.8\%, 68–78\%) & 9 (24.3\%, 10–39\%) & 208 (79.7\%, 75–85\%) \\ \hline +/MycAssay + Culture (\% and 95\% CI) & 33 (11.1\%, 7–15\%) & 23 (62.2\%, 46–79\%) & 10 (3.8\%, 1–6\%) \\ \hline + Culture 2/MycAssay (\% and 95\% CI) & 18 (6\%, 3–9\%) & 1 (2.7\%, 23–8\%) & 17 (6.5\%, 3–10\%) \\ \hline +/MycAssay Culture 2 (\% and 95\% CI) & 30 (10.1\%, 7–14\%) & 4 (10.8\%, 0–21\%) & 26 (10\%, 6–14\%) \\ \hline \end{tabular} \end{table}	PMC3631214_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Diagnosis} & \textbf{Sex} & \textbf{Age} & \textbf{PaO2/FiO2} & \textbf{LIS} & \textbf{APACHEII} & \textbf{PEEP} & \textbf{Outcome} \\ \hline Group A: FO \\ \hline 1. Pneumonia & M & 74 & 98 & 4 & 18 & 7 & D \\ \hline 2. Pneumonia & M & 48 & 166 & 2.3 & 17 & 8 & D \\ \hline 3. Pneumonia & M & 64 & 133 & 3.6 & 18 & 12 & D \\ \hline 4. Sepsis & M & 50 & 189 & 3 & 15 & 10 & L \\ \hline 5. Smoke aspiration & M & 40 & 132 & 3 & 16 & 11 & L \\ \hline 6. Bronchoaspiration & M & 72 & 84 & 2.6 & 21 & 8 & D \\ \hline 7. Mediastinitis & M & 70 & 147 & 3.3 & 19 & 10 & L \\ \hline 8. Bronchoaspiration & M & 36 & 183 & 2.5 & 15 & 7 & L \\ \hline Total Group A: & 8 M & 56 $\pm$ 15 & 141 $\pm$ 37 & 3 $\pm$ 0.5 & 17.4 $\pm$ 2.1 & 9.1 $\pm$ 1.9 & 4D/4L \\ \hline Group B: LCT \\ \hline 1. Pancreatitis & F & 52 & 152 & 3 & 16 & 11 & L \\ \hline 2. Bronchoaspiration & M & 57 & 198 & 4 & 21 & 15 & L \\ \hline 3. Bronchoaspiration & M & 56 & 177 & 2.6 & 17 & 9 & D \\ \hline 4. Status postpneumectomy & M & 63 & 60 & 4 & 19 & 10 & L \\ \hline 5. Pneumonia & M & 71 & 181 & 3 & 18 & 10 & L \\ \hline 6. Pneumonia & M & 43 & 186 & 3.3 & 14 & 8 & L \\ \hline 7. Pneumonia & M & 53 & 153 & 3 & 19 & 10 & D \\ \hline 8. Pneumonia & F & 81 & 157 & 3 & 22 & 9 & L \\ \hline Total Group B & 6M/2F & 59 $\pm$ 12 & 158 $\pm$ 43 & 3.2 $\pm$ 0.5 & 18.2 $\pm$ 2.6 & 10.3 $\pm$ 2.1 & 2D/6L \\ \hline Total n:16 & 14M/2F & 58 $\pm$ 13 & 149 $\pm$ 40 & 3.1 $\pm$ 0.5 & 17.8 $\pm$ 2.3 & 9.7 $\pm$ 2 & 6D/10L \\ \hline \end{tabular} \end{table}	PMC3080285_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline Bruker SMART CCD area-detector diffractometer & 2501 independent reflections \\ \hline Radiation source: fine-focus sealed tube & 1817 reflections with I > 2σ(I) \\ \hline graphite & Rint = 0.058 \\ \hline φ and ω scans & θmax = 26.1°, θmin = 1.9° \\ \hline Absorption correction: multi-scan (SADABS; Bruker, 2001) & h = −19→28 \\ \hline Tmin = 0.399, Tmax = 1.000 & k = −7→7 \\ \hline 6895 measured reflections & l = −22→21 \\ \hline \end{tabular} \end{table}	PMC3089252_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{ID} & \textbf{Phylum} & \textbf{Class} & \textbf{Order} & \textbf{Family} & \textbf{Genus} \\ \hline & Cyanobacteria & Oscillatoriophycideae & Oscillatoriales & Microcoleus & Microcoleus \\ \hline L1B56 & Proteobacteria & Alphaproteobacteria & Rhizobiales & Bradyrhizobiaceae & Bosea \\ \hline D1B20 & Proteobacteria & Alphaproteobacteria & Rhizobiales & Methylobacteriaceae & Methylobacterium \\ \hline L1B44 & Actinobacteria & Actinobacteria & Frankiales & Geodermatophilaceae & Modestobacter \\ \hline D1B45 & Actinobacteria & Actinobacteria & Micrococcales & Micrococcaceae & Arthrobacter \\ \hline L2B47 & Firmicutes & Bacilli & Bacillales & Bacillaceae & Bacillus (1) \\ \hline D1B51 & Firmicutes & Bacilli & Bacillales & Bacillaceae & Bacillus (2) \\ \hline \end{tabular} \end{table}	PMC4595634_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Individual} & \textbf{Sex} & \textbf{Age} & \textbf{Mutation and origin} & \textbf{Pre-op Ct} & \textbf{US results} & \textbf{Histology} & \textbf{ADM (years)} & \textbf{LN+/resecteda} & \textbf{pTNM} \\ \hline IV-10 & F & 22 & p.C634Y/V292M/R67H/R982C, Pat and Mat & 343.92 & Negative; TT & Bi-MTC & 13 (onset) & 5/51 & T2N1aM0 (stage III) \\ \hline II-5 & M & 70 & p.V292M/R67H/R982C, Pat & 76.35 & Negative; TT & Bi-MTC & 70 & 0/15 & T1N0M0 (stage I) \\ \hline III-3 & M & 48 & p.V292M/R67H/R982C, Pat & 49.86 & Negative; AS & No spec & 48 & No spec & No spec \\ \hline III-8 & F & 46 & p.V292M/R67H/R982C, Pat & 43.72 & Negative; AS & No spec & 46 & No spec & No spec \\ \hline III-11 & M & 44 & p.V292M/R67H/R982C, Pat & 58.66 & Negative; TT & Bi-CCH & 44 & - & - \\ \hline IV-3 & M & 22 & p.V292M/R67H/R982C, Pat & 39.34 & Normal & - & - & - & - \\ \hline IV-7 & F & 19 & p.V292M/R67H/R982C, Pat & 59.21 & Normal & - & - & - & - \\ \hline III-12* & F & 43 & p.C634Y, Mat & 408.32 & Negative; TT & Bi-MTC & 28 (onset) & 3/40 & T2N1aM0 (stage III) \\ \hline III-15 & M & 41 & p.C634Y, Mat & 104.35 & Negative; TT & Bi-MTC & 39 & 2/22 & T1N1aM0 (stage III) \\ \hline III-20 & F & 56 & p.C634Y, Mat & 260.49 & Negative; TT & Bi-MTC & 52 (onset) & 3/23 & T1N1aM0 (stage III) \\ \hline III-23 & M & 50 & p.C634Y, Mat & 163.23 & Negative; TT & Bi-MTC & 50 (onset) & 2/26 & T2N1aM0 (stage III) \\ \hline IV-21 & M & 25 & p.C634Y, Mat & 34.70 & Negative; TT & Bi-MTC & 24 & 0/15 & T1N0M0 (stage I) \\ \hline \end{tabular} \end{table}	PMC3105051_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Strategies} & \textbf{Sn} & \textbf{Sp} & \textbf{Acc} & \textbf{MCC} \\ \hline SEQ+WS & 0.688 & 0.941 & 0.857 & 0.669 \\ \hline WS only & 0.627 & 0.960 & 0.849 & 0.652 \\ \hline SEQ+WS, without AUTO-MUTE_RF & 0.658 & 0.925 & 0.836 & 0.622 \\ \hline WS only, without AUTO-MUTE_RF & 0.701 & 0.745 & 0.731 & 0.484 \\ \hline \end{tabular} \end{table}	PMC3549852_table_5
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{anti-PDI* Negative for (n = 848)} & \textbf{anti-PDI{ Positive for (n = 308)} & \textbf{p-value} \\ \hline Age & 52.7 (7.9) & 52.0 (7.0) & 0.1354 \\ \hline Male Sex & 454 (54\%) & 171 (56\%) & 0.5500 \\ \hline BMI & 31.0 (6.8) & 31.4 (7.0) & 0.3858 \\ \hline Smoking \\ \hline Never & 400 (47\%) & 164 (53\%) & 0.1625 \\ \hline Past & 325 (38\%) & 101 (33\%) \\ \hline Current & 123 (15\%) & 43 (14\%) \\ \hline At least some college education & 632 (75\%) & 236 (77\%) & 0.4665 \\ \hline obesity{ Abdominal & REF & 1.26 (0.96, 1.66) & 0.0925 \\ \hline Triglycerides{ Raised & REF & 1.21 (0.93, 1.58) & 0.1636 \\ \hline HDL{ Reduced & REF & 1.37 (1.05, 1.79) & 0.0199 \\ \hline Hypertension{ & REF & 1.29 (0.98, 1.69) & 0.0685 \\ \hline glucose{ Raised fasting & REF & 1.33 (1.01, 1.76) & 0.0457 \\ \hline Syndrome{ Metabolic & REF & 1.46 (1.11, 1.92) & 0.0062 \\ \hline (mg/dL)){,1 Log (CRP & 1.08 (0.04) & 1.12 (0.06) & 0.5957 \\ \hline mg/dL{,1 CRP.3 & REF & 1.01 (0.75, 1.36) & 0.9440 \\ \hline mg/dL{,1 CRP.10 & REF & 1.03 (0.61, 1.74) & 0.9246 \\ \hline (iu/ml){,1 Insulin & 12.0 (0.37) & 12.3 (0.60) & 0.6078 \\ \hline \end{tabular} \end{table}	PMC3176794_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Article section} & \multicolumn{2}{c\|}{\textbf{Main fact}} & \multicolumn{2}{c\|}{\textbf{Subfact}} & \multicolumn{2}{c\|}{\textbf{Synonym fact}} & \multicolumn{2}{c\|}{\textbf{Extra fact}} \\ \hline \textbf{Title} & \textbf{8.2} & \textbf{(1.5)} & \textbf{8.9} & \textbf{(3.2)} & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\ \hline Abstract & 42.5 & (18.7) & 38.1 & (23.9) & 13.3 & (13.3) & 14.6 & (13.1) \\ \hline Introduction & 20.9 & (6.7) & 32.8 & (18.6) & 13.3 & (12.6) & 9.9 & (8.0) \\ \hline Results & 43.3 & (20.9) & 73.7 & (35.2) & 3.0 & (3.0) & 16.9 & (13.1) \\ \hline Discussion & 36.6 & (14.9) & 44.5 & (21.1) & 0.7 & (\textbf{\textbf{0.0}}) & 3.8 & (3.8) \\ \hline Figure Heading & 9.7 & \textbf{(1.5)} & 30.8 & (13.4) & 0.7 & (0.7) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\ \hline Figure Legend & 7.5 & (0.7) & 16.2 & (9.7) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 5.2 & (5.2) \\ \hline Table Data & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 0.4 & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\ \hline Methods & 0.7 & (\textbf{\textbf{0.0}}) & 2.0 & (0.8) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 4.2 & (3.3) \\ \hline Conclusion & 1.5 & (0.7) & 1.6 & (1.2) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\ \hline Footnotes & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) & 3.7 & (3.0) & \textbf{\textbf{0.0}} & (\textbf{\textbf{0.0}}) \\ \hline Section Headings & 11.2 & \textbf{(1.5)} & 22.3 & (9.7) & 0.7 & (0.7) & 0.5 & (0.5) \\ \hline \end{tabular} \end{table}	PMC2761905_table_4
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Substrate} & \textbf{Residual glucose (g/L)} & \textbf{Residual starch (g/L)} & \textbf{Total ABE produced (g/L broth)} & \textbf{Yield (g/g)} & \textbf{Productivity (g/L/h)} \\ \hline Glucose (control) & 16.2 & – & 14.2 & 0.35 & 0.22 \\ \hline Food waste (81 g/L) & 5.4 & 5.3 & 18.8 & 0.38 & 0.46 \\ \hline Food waste (129 g/L) & 21.7 & 17.8 & 19.7 & 0.36 & 0.41 \\ \hline Food waste (181 g/L) & 40.5 & 32.6 & 20.9 & 0.37 & 0.42 \\ \hline Food waste (228 g/L) & 61.7 & 50.2 & 19.1 & 0.38 & 0.38 \\ \hline Food waste vacuum (129 g/L) & 1.1 & 16.0 & 27.2 & 0.36 & 0.49 \\ \hline \end{tabular} \end{table}	PMC4572674_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Agent}} & \multirow{2}{}{\textbf{Strain E. coli MG1655}} & \multirow{2}{*}{\textbf{EAEC 042}} \\ \hline \\ \hline Chloramphenicol & 4a & .32 \\ \hline Tetracyline & 2 & .32 \\ \hline Streptomycin & 2 & .128 \\ \hline Spectinomycin & 16 & .128 \\ \hline Nalidixic acid & 8 & 2 \\ \hline Ciprofloxacin & ,0.015 & ,0.015 \\ \hline Gentamicin & 0.5 & 0.5 \\ \hline Erythromycin & 32 & 32 \\ \hline Ceftriaxone & 0.06 & 0.06 \\ \hline Cloxacillin & .128 & .128 \\ \hline Triclosan & ,0.03 & ,0.03 \\ \hline Ethidium bromide & 512 & 256 \\ \hline Acriflavine & 128 & 64 \\ \hline \end{tabular} \end{table}	PMC2808357_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline A Category & Functional annotation & p-value & # genes \\ \hline Cellular development & development of lymphocytes & 8.17E-03 & 6 \\ \hline \multirow{3}{}{Cellular movement} & cell movement of neutrophils & 2.14E-04 & 6 \\ \hline chemotaxis & 5.45E-03 & 6 \\ \hline migration of cells & 1.30E-02 & 12 \\ \hline Cell-to-cell signaling & activation of cells & 5.17E-03 & 8 \\ \hline \multirow{4}{}{Hematological system} & quantity of neutrophils & 6.78E-05 & 6 \\ \hline differentiation of hematopoietic progenitor cells & 8.45E-05 & 6 \\ \hline differentiation of blood cells & 1.55E-02 & 7 \\ \hline quantity of leukocytes & 1.91E-03 & 10 \\ \hline \multirow{2}{}{Immunological disease} & hypersensitive reaction & 9.54E-04 & 7 \\ \hline systemic autoimmune syndrome & 7.88E-04 & 11 \\ \hline \multirow{2}{}{Inﬂammatory response} & inﬂammation of lung & 1.70E-03 & 6 \\ \hline inﬂammatory response & 4.54E-03 & 7 \\ \hline Organismal injury & ﬁbrosis & 6.89E-03 & 6 \\ \hline B Category & Functional annotation & p-value & # genes \\ \hline Carbohydrate metabolism & uptake of monosaccharide & 4.14E-02 & 4 \\ \hline Cellular growth and proliferation & formation of cells & 1.88E-02 & 6 \\ \hline Free radical scavenging & synthesis of reactive oxygen species & 5.17E-03 & 8 \\ \hline Hematological system & homeostasis of blood & 2.93E-03 & 3 \\ \hline \multirow{2}{*}{Inﬂammatory response} & inﬂammatory response & 2.74E-02 & 8 \\ \hline inﬂammation of body region & 2.95E-02 & 9 \\ \hline Muscular disorders & congenital anomaly of musculoskeletal system & 6.50E-04 & 10 \\ \hline Nucleic acid metabolism & metabolism of nucleic acid component & 1.06E-02 & 8 \\ \hline Tissue development & growth of epithelial tissue & 3.59E-02 & 7 \\ \hline \end{tabular} \end{table}	PMC4532500_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Number of stool samples (ss) collected} & \textbf{Men/women/not known} & \textbf{Children/adults/not known} & \textbf{Number of detected A. baumannii (locations)} & \textbf{blaOXA23-like-positive A. baumannii} \\ \hline Year 2008 : 150 ss \\ \hline Dielmo: 73 ss & 71/79/0 & 150/0/0 & 9 (Dielmo) & 0 \\ \hline Ndiop: 77 ss \\ \hline Year 2009 : 496 ss \\ \hline Dielmo: 232 ss \\ \hline Ndiop: 258 ss & 222/256/18 & 246/222/28 & 27 (Dielmo: 20; Ndiop: 7) & 4 (Ndiop) \\ \hline Dakar: 4 ss \\ \hline Nhiakar: 2 ss \\ \hline Year 2010 : 20 ss \\ \hline Dielmo: 20 ss & 11/9/0 & 11/6/3 & 1 (Dielmo) & 0 \\ \hline Year 2011 : 51 ss \\ \hline Mbao: 28 ss \\ \hline Dominique-Pikine: 7 ss & 28/23/0 & 22/29/0 & 2 (Mbao) & 2 (Mbao) \\ \hline Roi Baudoin: 6 ss \\ \hline IHS: 4 ss \\ \hline Saint Martin: 6 ss \\ \hline \end{tabular} \end{table}	PMC3380006_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Functional cluster1} & \textbf{Gene ontology (GO)} & \textbf{Gene IDs identified in the functional cluster} \\ \hline Vascular development & GO:0001568 blood vessel development GO:0001944 vasculature development GO:0048514 blood vessel morphogenesis GO:0001525 angiogenesis GO:0016477 cell migration GO:0051674 localization of cell GO:0048870 cell motility & ANPEP2, CD442, CTGF2, CTHRC1, HTATIP2, IL1B2, IL182, ITGA62, NRP12, PLAU2, S100A2, QKI2, TGM2, THBS12 \\ \hline Coagulation & GO:0042060 wound healing GO:0050817 coagulation GO:0007596 blood coagulation GO:0007599 hemostasis GO:0050878 regulation of body fluid levels & CD9, CD442, DCBLD2, F2RL2, IL1B2, ITGA22, PLAU2, TFPI22 \\ \hline Cell-matrix interaction & GO:0030155 regulation of adhesion GO:0009611 response to wounding GO:0006928 cell motion GO:0050840 extracellular matrix binding GO:0045785 positive regulation of cell adhesion GO:0005178 integrin binding GO:0043236 laminin binding GO:0007155 cell adhesion GO:0022610 biological adhesion GO:0007160 cell-matrix adhesion GO:0005518 collagen binding GO:0031589 cell-substrate adhesion GO:0032403 protein complex binding GO:0009986 cell surface & ARHGDIB, CA2, CD9, CD442, CTGF2, DCBLD2, ITGA22, ITGA62, IL1B2, IL182, NRP12, PERP, PTPRR, SPP1, TGFB1, TGM2, THBS12 \\ \hline \end{tabular} \end{table}	PMC4637310_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Provider assesses 100\% of women (n = 96)} & \textbf{Provider assesses fewer than 100\% of women (n = 26)} \\ \hline & Correct n (\%) & Correct n (\%) & p- valuea \\ \hline Knowledge of risk \\ \hline Smoking during pregnancy increases the risk of: \\ \hline Miscarriage (losing the baby) & 90 (94) & 21 (81) & 0.055 \\ \hline Low birth weight of baby & 96 (100) & 24 (92) & 0.044 \\ \hline Breathing problems and sickness in infant & 93 (97) & 25 (96) & 1.000 \\ \hline Mother having high blood pressure and increased heart rate (pre- eclampsia)b & 3 (3) & 1 (4) & 1.000 \\ \hline Behavioural problems in childhood & 55 (57) & 13 (50) & 0.514 \\ \hline Total knowledge of risk score (median (Q1, Q3)) & 4 (3, 4) & 3.5 (3, 4) & 0.247 \\ \hline Knowledge of cessation \\ \hline Nicotine replacement therapy (patches, gum etc) can help women quit & 85 (89) & 20 (77) & 0.197 \\ \hline Nicotine replacement therapy shouldn’t be used in pregnancy & 71 (74) & 11 (42) & 0.004 \\ \hline An effective way to quit during pregnancy is to just stop altogether, right away & 48 (50) & 13 (50) & 1.000 \\ \hline An effective way to quit during pregnancy is to reduce by 1 to 2 dayc cigarettes each & 26 (27) & 4 (15) & 0.306 \\ \hline Total knowledge of smoking cessation score (median(Q1, Q3)) & 2 (2, 3) & 2 (1, 2) & 0.010 \\ \hline \end{tabular} \end{table}	PMC3311138_table_1
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Technical validation step} & \textbf{ELM-2} \\ \hline Target & MMP-9 and 212 degraded human elastin at amino acid number 552 \\ \hline Detection range/standard curve & 1.82–250ng/mL \\ \hline Dilution range of serum samples & 1:2 is recommended \\ \hline Dilution range of plasma samples & 1:2, 1:3 and 1:4 is recommended \\ \hline Dilution recovery of human serum* & 98\% \\ \hline Dilution recovery of human plasma* & 97\% \\ \hline Intra-assay variation & 6.4\% \\ \hline Inter-assay variation & 12\% \\ \hline Analyte stability*** & 96\% \\ \hline LLOQ & 5.4 ng/mL \\ \hline \end{tabular} \end{table}	PMC3689773_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Gene Symbol} & \textbf{Ensembl ID} & \textbf{Description} \\ \hline PTH & ENSG00000152266 & Parathyroid hormone precursor (Parathyrin) (PTH) (Parathormone) \\ \hline AGTR1 & ENSG00000144891 & Type-1 angiotensin II receptor (AT1) (AT1AR) (AT1BR). \\ \hline EDNRA & ENSG00000151617 & Endothelin-1 receptor precursor (Endothelin A receptor) (ET-A) (hET- AR) (ETA-R). \\ \hline AGT & ENSG00000135744 & Angiotensinogen precursor (Serpin A8) [Contains: Angiotensin-1 (Angiotensin I) (Ang I); Angiotensin-2 (Angiotensin II) (Ang II); Angiotensin-3 (Angiotensin III) (Ang III) (Des-Asp[1]-angiotensin II)]. \\ \hline REN & ENSG00000143839 & Renin precursor (EC 3.4.23.15) (Angiotensinogenase) \\ \hline HCN4 & ENSG00000138622 & Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4 \\ \hline EDNRB & ENSG00000136160 & Endothelin B receptor precursor (ET-B) (Endothelin receptor Non- selective type). \\ \hline HCN2 & ENSG00000099822 & Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 2 (Brain cyclic nucleotide- gated channel 2) (BCNG-2). \\ \hline ANG & ENSG00000214274 & Angiogenin precursor (EC 3.1.27.-) (Ribonuclease 5) (RNase 5). \\ \hline NPPA & ENSG00000175206 & Atrial natriuretic factor precursor (ANF) (Atrial natriuretic peptide) (ANP) (Prepronatriodilatin) (CDD-ANF) [Contains: Cardiodilatin-related peptide (CDP)]. \\ \hline INS & ENSG00000129965 & Insulin precursor [Contains: Insulin B chain; Insulin A chain] \\ \hline ACE & ENSG00000159640 & Angiotensin-converting enzyme \\ \hline EDN1 & ENSG00000078401 & Endothelin-1 precursor (Preproendothelin-1) (PPET1) [Contains: Endothelin-1 (ET-1); Big endothelin-1]. \\ \hline \end{tabular} \end{table}	PMC2946338_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{SFA} & \textbf{SMA} & \textbf{AI} & \textbf{AO} & \textbf{AC} & \textbf{TDCE} & \textbf{logSOL} & \textbf{awake} \\ \hline \textbf{SFA} & 1 & -0.882* & 0.515* & -0.031 & 0.170* & 0.172* & 0.218* & 0.076 \\ \hline \textbf{SMA} & & 1 & -0.292* & 0.292* & -0.240*** & -0.181* & -0.068 & -0.003 \\ \hline \textbf{AI} & & & 1 & -0.023 & 0.280*** & 0.196* & 0.322* & 0.079 \\ \hline \textbf{AO} & & & & 1 & -0.422* & 0.071 & -0.041 & 0.001 \\ \hline \textbf{AC} & & & & & 1 & 0.147 & 0.009 & -0.096 \\ \hline \textbf{TDCE} & & & & & & 1 & 0.235 & 0.017 \\ \hline \textbf{logSOL} & & & & & & & 1 & 0.329* \\ \hline \textbf{awake} & & & & & & & & 1 \\ \hline \end{tabular} \end{table}	PMC2770539_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Parameters} & \textbf{Group} & \textbf{Total} & \multicolumn{2}{c\|}{\textbf{lncRNA ANRIL}} & \textbf{P value} \\ \hline & & & \textbf{Low} & \textbf{High} \\ \hline \multirow{2}{}{Gender} & \multirow{2}{}{Male 51 23 28 Female 36 16 20} & \multirow{2}{}{0.952} \\ \hline \\ \hline \multirow{2}{}{Age (years)} & \multirow{2}{}{<60 42 18 24 $\geq$60 45 21 24} & \multirow{2}{}{0.721} \\ \hline \\ \hline \multirow{2}{}{Tumor size (cm)} & \multirow{2}{}{<3 cm 39 16 23 $\geq$3 cm 48 23 25} & \multirow{2}{}{0.520} \\ \hline \\ \hline \multirow{2}{}{Histology} & Adenocarcinoma & 38 & 20 & 18 & 0.197 \\ \hline Squamous cell carcinoma & 49 & 19 & 30 \\ \hline \multirow{2}{}{TNM stage} & \multirow{2}{}{I 26 19 7 II-III 61 20 41} & \multirow{2}{}{0.001} \\ \hline \\ \hline \multirow{2}{}{Lymph node metastasis} & \multirow{2}{}{Absence 40 32 8 Presence 47 7 40} & \multirow{2}{}{0.000} \\ \hline \\ \hline \end{tabular} \end{table}	PMC4599723_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Spacegroup}} & \multirow{2}{}{\textbf{PkAMA1 C2}} & \multirow{2}{}{\textbf{PkAMA1-FabR31C2 C2}} \\ \hline \\ \hline a, b, c (Å) & 90.32, 105.70, 104.75 & 165.86, 71.81, 90.69 \\ \hline (deg.) β & 98.04 & 116.37 \\ \hline Z & 4 & 2 \\ \hline (A3 Da-1) VM & 2.9 & 2.7 \\ \hline Resolution (Å) & 47.09–2.45 (2.58–2.45) & 43.35–3.10 (3.27–3.10) \\ \hline Unique reﬂections & 34848 (4876) & 17127 (2506) \\ \hline Redundancy & 2.9 (2.5) & 3.1 (3.2) \\ \hline Completeness (\%) & 97.3 (93.3) & 97.8 (99.1) \\ \hline Rmerge & 0.100 (0.499) & 0.152 (0.778) \\ \hline Rpim & 0.069 (0.376) & 0.097 (0.497) \\ \hline I/σ(I) & 9.7 (1.9) & 7.8 (1.3) \\ \hline CC(1/2) & 0.99 (0.59) & 0.99 (0.70) \\ \hline \end{tabular} \end{table}	PMC4401722_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Crude odds ratio (95\% CI)} & \textbf{Adjusted odds ratio (95\% CI)} \\ \hline Characteristics at ART initiation \\ \hline Female & 0.69 (0.25, 1.94) \\ \hline Age \\ \hline ,1 yr & 0.32 (0.05, 2.07) & 1.01 (0.05, 2.82) \\ \hline 1–1.9 yrs & 0.16 (0.03, 0.84) & 0.85 (0.14, 4.95) \\ \hline 2–4.9 yrs & 0.39 (0.07, 1.98) & 1.08 (0.10, 11.35)d \\ \hline $5 yrs & 1 & 1 \\ \hline Orphan & 7.22 (1.61, 32.45) & 17.30)e 3.32 (0.64, \\ \hline Travel time \\ \hline ,1 hr & 1 & 1 \\ \hline 1–2 hrs & 0.34 (0.04, 3.16) & 0.51 (0.07, 3.86) \\ \hline 3–4 hrs & 0.20 (0.03, 1.65) & 0.36 (0.05, 2.37) \\ \hline $5 hrs & 0.10 (0.01, 0.82) & 1.19)e 0.17 (0.02, \\ \hline (.50th High SES percentile) & 2.28 (0.35, 15.00) \\ \hline Education of the primary caregiver \\ \hline None/Primary school & 1 \\ \hline Secondary school/university & 1.22 (0.40, 3.78) \\ \hline Underweighta & 0.87 (0.28, 2.68) \\ \hline immunodeficiencyb Severe & 0.70 (0.24, 2.03) \\ \hline High viral load copies/mL)c (.750,000 & 0.60 (0.17, 2.04) \\ \hline ART regimen including stavudine & 0.47 (0.15, 1.48) \\ \hline ART regimen including nevirapine & 0.35 (0.46, 0.98) & 1.03)f 0.33 (0.11, \\ \hline ART regimen including fixed dose combinations & 2.30 (0.65, 8.10) \\ \hline Characteristics at each viral load measure \\ \hline Other people in the household on ART & 0.78 (0.48, 1.27) \\ \hline \end{tabular} \end{table}	PMC3084269_table_3
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multicolumn{3}{c\|}{\textbf{\% agreement with established EBV status}} \\ \hline & \multirow{2}{}{\textbf{Negative (N = 39) [95\% CI]}} & \multirow{2}{}{\textbf{Acute infection (N = 15) [95\% CI]}} & \multirow{2}{}{\textbf{Past infection (N = 464) [95\% CI]}} \\ \hline \\ \hline \multirow{2}{}{Enzygnost} & 100 & 100 & 99.1 \\ \hline [90.97\% – 100\%] & [78.2\% – 100\%] & [97.81\% – 99.75\%] \\ \hline \multirow{2}{}{Novagnost} & 89.7 & 100 & 86a, 98.8b \\ \hline [75.78\% – 97.13\%] & [78.2\% – 100\%] & 89.02\%]a, 99.6\%]b [82.5\% – [97.1\% to \\ \hline \multirow{2}{}{Merifluor IFA} & 92.3 & 100 & 98.1 \\ \hline [79.13\% – 98.38\%] & [78.2\% – 100\%] & [96.35\% – 99.11\%] \\ \hline \end{tabular} \end{table}	PMC3679805_table_6
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline Age groups & 6 (n = 11) & 7 (n = 10) & 8 (n = 15) & 9 (n = 13) & 10 (n = 12) \\ \hline Mean $\pm$ SD & 6.5460.27 & 7.6860.24 & 8.4660.30 & 9.5960.28 & 10.2560.24 \\ \hline Range & 6.1–6.9 & 7.27–7.96 & 8.00–8.94 & 9.12–9.96 & 10.02–10.69 \\ \hline Gender (M/F) & 5/6 & 5/5 & 7/8 & 5/8 & 7/5 \\ \hline \end{tabular} \end{table}	PMC3315543_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{HCV related HCC (\%)} & \textbf{HCV related chronic hepatitis (\%)} & \textbf{P} \\ \hline Anti HCV positive/ HCV RNA positive & 68 & 55 \\ \hline HCV Genotyping done & 50 (73.53) & 42 (73.36) & 0.3637 \\ \hline Genotype 1 & 14 (28) & 8 (19.05) & 0.1994 \\ \hline Genotype 3 & 30 (60) & 32 (76.19) & 0.0633 \\ \hline Genotype 4 & 6 (12) & 2 (4.76) & 0.1379 \\ \hline \end{tabular} \end{table}	PMC3643662_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \multicolumn{3}{c\|}{\textbf{mM \% Response to 10 RG2833}} \\ \hline & \textbf{1.5-Fold Increase in Frataxin} & \textbf{2.0-Fold Increase in Frataxin} \\ \hline Protein & 58 & 23 \\ \hline mRNA & 72 & 50 \\ \hline \end{tabular} \end{table}	PMC3656936_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{interRAI PURS Score} & \textbf{Proportion of residents at baseline} & \textbf{Pressure ulcer rate at reassessment} & \textbf{Odds ratio, 95\% confidence} \\ \hline 0 & 18.9\% & 0.8\% & Reference \\ \hline 1 & 22.3\% & 2.0\% & 2.53 (1.53, 4.16) \\ \hline 2 & 17.9\% & 3.3\% & 4.21 (2.59, 6.83) \\ \hline 3 & 24.0\% & 5.4\% & 7.11 (4.50, 11.23) \\ \hline 4 & 10.1\% & 9.0\% & 12.28 (7.65, 19.72) \\ \hline 5 & 4.7\% & 9.9\% & 13.62 (8.01, 23.14) \\ \hline 6 & 1.8\% & 14.2\% & 20.53 (11.09, 38.01) \\ \hline 7-8 & 0.3\% & 21.1\% & 33.11 (10.14, 108.13) \\ \hline \end{tabular} \end{table}	PMC2955034_table_3
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Plant species} & \textbf{Tissue/organelle} & \textbf{Treatment} & \textbf{No. of identiﬁed candidates} & \textbf{Reference} \\ \hline Arabidopsis thaliana & Cell cultures & GSNO-treated protein extracts & 63 & Lindermayr et al. (2005) \\ \hline Arabidopsis thaliana & Leaves & Plants treated with gaseous NO & 52 & Lindermayr et al. (2005) \\ \hline Kalanchoe pinnata & Leaves & GSNO-treated protein extracts & 19 & Abat et al. (2008) \\ \hline Arabidopsis thaliana & Leaf mitochondria & GSNO-treated protein extracts & 11 & Palmieri et al. (2010) \\ \hline Arabidopsis thaliana & Cell cultures & GSNO-treated protein extracts & 27 & Maldonado-Alconada et al. (2011) \\ \hline Arabidopsis thaliana & Leaves & Pseudomonas syringae avir/vir & 119 & Maldonado-Alconada et al. (2011) \\ \hline Arabidopsis thaliana & Cell cultures & untreated & 53 & Fares et al. (2011) \\ \hline Solanum tuberosum & Leaves & GSNO-treated protein extracts & 34 & Kato et al. (2012) \\ \hline Solanum tuberosum & Tubers & GSNO-treated protein extracts & 46 & Kato et al. (2012) \\ \hline Oryza sativa (WT) & Leaves & High light & 73 & Lin et al. (2012) \\ \hline Oryza sativa (nitric oxide excess1 mutant; noe1) & Leaves & High light & 100 & Lin et al. (2012) \\ \hline Pisum sativum & Leaf peroxisomes & GSNO-treated peroxisomes & 6 & Ortega-Galisteo et al. (2012) \\ \hline Pisum sativum & Leaf mitochondria & Salt-stressed plants & 24 & Camejo et al. (2012) \\ \hline \end{tabular} \end{table}	PMC3653056_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{VAD group} & \textbf{Control group} \\ \hline Pregnant rate & 45.9\% (11/24) & 75.0\% (6/8) \\ \hline Incidence of embryos dead & 45.5\% (5/11) & 0\% \\ \hline Filial No. of embryonic & 10.1761.47 (61/6) & 9.8360.75 (59/6) \\ \hline Filial No. of radiography & 58 & 56 \\ \hline \end{tabular} \end{table}	PMC3465343_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Year of outbreak} & \textbf{Number of cases} & \textbf{Serotype} & \textbf{Implicated source} & \textbf{Reference} \\ \hline 1993 & 18 & 1/2b & Rice salad & [41] \\ \hline 1994 & 45 & 1/2b & Chocolate milk & [30] \\ \hline 1997 & 1566 & 4b & Cold-corn-and-tuna salad & [31] \\ \hline 1998 & 5 & 1/2a & Cold smoked trout & [42] \\ \hline 2000 & 32 & 1/2 & Corned beef and ham & [43] \\ \hline 2001 & 16 & 1/2a & Delicatessen meat & [44] \\ \hline 2001 & 48 & 1/2a & Cheese & [45] \\ \hline \end{tabular} \end{table}	PMC3003996_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Plasmodium falciparum FCB1} & \textbf{0.53 $\pm$ 0.2} \\ \hline Leishmania donovani & IC50 > 100 \\ \hline NSCLC-N6 & IC50 > 35 \\ \hline A 549 & IC50 > 35 \\ \hline KMS-11 & IC50 > 60 \\ \hline GBM & IC50 > 60 \\ \hline HCT-116 & IC50 > 60 \\ \hline Trypanosoma brucei & MEC > 100 \\ \hline \end{tabular} \end{table}	PMC3705406_table_1
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Aptamer} & \textbf{Sequence} \\ \hline 30-14 & 59AGATGCCTGTCGAGCATGCTGTTGTGGTAGGGTTAGGGATGGTAGCGGTTGTAGCTAAACTGCTTTGTCGACGG93 \\ \hline 30-16/27 & 59TACCGTGGTAGGGAAGGTTGGAGTGTA93 \\ \hline 30-38/27 & 59ACCCGTGGTAGGGTAGGATGGGGTGGT93 \\ \hline 60-18/38 & 59CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA93 \\ \hline G15D & 59GGTTGGTGTGGTTGG93 \\ \hline 30-8 & 59AGATGCCTGTCGAGCATGCTGTGAATAGGTAGGGTCGGATGGGCTACGGTGTAGCTAAACTGCTTTGTCGACGGG93 \\ \hline \end{tabular} \end{table}	PMC3288073_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{Isoform} & \textbf{Average} & \textbf{Median} & \textbf{Range} & \textbf{St. dev.} \\ \hline \multirow{2}{}{A} & VDRl & 2368 & 2368 & 987 - 3749 & 1953.6 \\ \hline VDRs & 751 & 654 & 407-1371 & 401.7 \\ \hline \multirow{2}{}{B} & VDRl & 1088 & 833 & 4-2427 & 1231.5 \\ \hline VRDs & 1658 & 1581 & 30-3442 & 1407.4 \\ \hline \end{tabular} \end{table}	PMC3532837_table_3
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Domain} & \textbf{Question (Q) or instrument (I) in CGA} & \textbf{Condition/disease} \\ \hline Physical \\ \hline Medication & Do you experience difficulties or side effect with medication use? Polypharmacy defined as the use or three or more different medications Medication adherence (questionnaire of Aburuz) [55] & Medication safety and side effects Polypharmacy Medication adherence \\ \hline Mobility and stability & Have you fallen once or more in the past twelfth months? [56] Fear of falling (FES-I) [57] Do you experience dizziness? Fracture risk score [57,58] & Falls Fear of falling Dizziness Osteoporosis risk \\ \hline Nutrition & Short Nutritional Assessment Questionnaire (SNAQ) [59] Have you been admitted to a hospital because of dehydration? Difficulties with swallowing? Do you have pain in your mouth? & Malnutrition Dehydration Swallowing disturbance Oral hygiene \\ \hline Urine and fecal problems & Do you experience urinary incontinence? Do you experience fecal incontinence? Do you have a indwelling urinary catheter? Do you experience obstipation? & Urinary incontinence Feacal incontinence Indwelling urinary catheter use Obstipation \\ \hline Skin & Do you have pressure ulcer(s)? & Pressure ulcer \\ \hline Pain & Visual analogue scale for pain [60] & Pain \\ \hline Allergy & Are you allergic? & Allergy \\ \hline Phychological \\ \hline Cognition & Do you have memory problems? Mini- Mental State Examination (MMSE) [20] & Cognitive impairment \\ \hline Delirium & Have you ever experienced a delirium? Confusement Assessment Method(CAM) [61] & Delirium \\ \hline Depression & Geriatric depression Scale (GDS-2, GDS-15) [21,62] & Depression \\ \hline Anxiety & Do you feel anxious? & Anxiety \\ \hline Dependency & Do you smoke? Use of alcohol [63,64] Do you use benzodiazepines? & Alcohol, smoking and medication use \\ \hline Functional \\ \hline ADL functioning & Modified Katz ADL index score [31] & ADL dependency \\ \hline IADL functioning & IADL questions of Lawton and Brody [32] & IADL dependency \\ \hline Mobility difficulty & Are you using a walking aid? & Mobility difficulty \\ \hline Hearing & Do you experience difficulties with hearing, despite the use of a hearing aid? & Hearing impairment \\ \hline Visual & Do you experience difficulties with your vision, despite the use of glasses? & Visual impairment \\ \hline Sleep & Do you experience problems with sleeping? Do you use sleeping medication? If yes, how often? & Sleeping disorder \\ \hline Social \\ \hline Loneliness & Jong Gierveld-questionnaire [38] & Loneliness \\ \hline Finance & Can you manage financially? & Finance \\ \hline Health related quality of live & EQ-6D [34] & Health related quality of live \\ \hline Burden of caregiver & CarerQol instrument [37] & Burden of caregiver \\ \hline Physical examination \\ \hline Body mass index & (kg/m2) & Obesity or weight loss \\ \hline Blood pressure & (mmHg) & Hypertension \\ \hline Pulse & (beats/min) & Pulse \\ \hline Grip strength & Maximal grip strength in the dominant hand (kg) [22] & Frailty \\ \hline Walking speed & Walk three meter at usual pace (seconds) [22] & Frailty \\ \hline \end{tabular} \end{table}	PMC3374886_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{RAST Pathway} & \textbf{Description} & \textbf{ORF(s)} \\ \hline \multirow{8}{*}{Citrate Metabolism, Transport, and Regulation} & 2-(50-triphosphoribosyl)-39-dephosphocoenzyme-A synthase (EC 2.7.8.25) & YP_810049.1a \\ \hline Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase (EC 2.7.7.61) & YP_810048.1a \\ \hline Citrate lyase alpha chain (EC 4.1.3.6) & YP_810047.1a \\ \hline Citrate lyase beta chain (EC 4.1.3.6) & YP_810046.1a \\ \hline Citrate lyase gamma chain, acyl carrier protein (EC 4.1.3.6) & YP_810045.1a \\ \hline Citrate lyase transcriptional regulator CitI & YP_810041.1a \\ \hline Oxaloacetate decarboxylase involved in citrate fermentation (EC 4.1.1.3) & YP_810042.1a \\ \hline [Citrate [pro-3S]-lyase] ligase (EC 6.2.1.22) & YP_810044.1a \\ \hline \end{tabular} \end{table}	PMC3250461_table_3
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \multicolumn{4}{c\|}{\textbf{Recipient information}} & \multicolumn{4}{c\|}{\textbf{Donor (ELA-A2) information}} \\ \hline \textbf{\textbf{Horsea}} & \textbf{Breed} & \textbf{Age (years)} & \textbf{Sex} & \textbf{\textbf{Horsea}} & \textbf{MSC passage} & \textbf{MSC MHC class II status} & \textbf{Number of MSCs injected} \\ \hline A & Grade & 20 & Gelding & 4 (1) & P4 & Negative & 106 46 × \\ \hline B & Thoroughbred & 15 & Gelding & 9 & P5 & Negative & 106 50 × \\ \hline C & Holsteiner & 13 & Gelding & ND & P5 & Negative & 106 50 × \\ \hline D & Standardbred & 16 & Gelding & 9 & P3 & Positive & 106 50 × \\ \hline E & Thoroughbred & 15 & Mare & 6 & P5 & Positive & 106 33 × \\ \hline F & Thoroughbred & 18 & Gelding & 4 (2) & P5 & Positive & 106 50 × \\ \hline Control (Horse 2) & Thoroughbred & 14 & Gelding & 9 & P5 & Negative & 106 50 × \\ \hline \end{tabular} \end{table}	PMC4414005_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{c\|}{\textbf{90\%}} & \multicolumn{3}{c\|}{\textbf{95\%}} & \multicolumn{3}{c\|}{\textbf{99\%}} \\ \hline & \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} & \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} & \textbf{\textbf{\textbf{TL}}} & \textbf{\textbf{\textbf{IE}}} & \textbf{\textbf{\textbf{FEM}}} \\ \hline Best case & 36.6 & 36.6 & 42.7 & 23.3 & 23.3 & 28.4 & 2.8 & 2.9 & 7.1 \\ \hline Median case & 28.4 & 28.4 & 36.6 & 12.8 & 13.5 & 23.3 & 2.2 & 2.2 & 2.9 \\ \hline Worst case & 21.3 & 21.3 & 25.6 & 6.4 & 6.9 & 17.1 & 1.4 & 1.5 & 2.7 \\ \hline \end{tabular} \end{table}	PMC4401437_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline [Cu(C4H2O4)(C3H10N2)(H2O)]·H2O & F(000) = 596 \\ \hline Mr = 286.76 & m−3 Dx = 1.701 Mg \\ \hline Orthorhombic, Pmc21 & Mo Kα radiation, λ = 0.71073 Å \\ \hline Hall symbol: P 2c -2 & Cell parameters from 6311 reflections \\ \hline a = 14.993 (3) Å & θ = 1.4–25.0° \\ \hline b = 8.0948 (17) Å & mm−1 µ = 1.96 \\ \hline c = 9.259 (2) Å & T = 293 K \\ \hline Å3 V = 1123.7 (4) & Plate, blue \\ \hline Z = 4 & 0.30 × 0.20 × 0.10 mm \\ \hline \end{tabular} \end{table}	PMC2960309_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Pt-miRNAs} & \textbf{(59R39) GSP1} & \textbf{(59R39) GSP2} & \textbf{(59R39) GSP3} \\ \hline ptrmir156 & TTTTTTTTTTGTGCTCACTCTCTTCTG & GGAGTAGAAATGACAGAAGAGAGTGAG & TGACAGAAGAGAGTGAGCAC \\ \hline ptrmir164 & TTTTTTTTTTGCACGTGCCCTGCTTCT & GGAGTAGAAATGGAGAAGCAGGGCACG & TGGAGAAGCAGGGCACGTGCA \\ \hline ptrmir167 & TTTTTTTTTTTCAGATCATGCTGGCAG & GGAGTAGAAATGAAGCTGCCAGCATGA & TGAAGCTGCCAGCATGATCTGA \\ \hline ptr-mir171 & TTTTTTTTTTGGAGATATTGACGCGGC & GGAGTAGAAATTGAGCCGCGTCAATAT & TTGAGCCGCGTCAATATCTCC \\ \hline ptrmir319 & TTTTTTTTTTGGGAGCTCCCTTCAGTC & GGAGTAGAAATTGGACTGAAGGGAGCT & TTGGACTGAAGGGAGCTCCC \\ \hline ptrmir482a & TTTTTTTTTTCATGGGTGGAGTAGGGA & GGAGTAGAAATCTTCCCTACTCCACCC & TCTTCCCTACTCCACCCATGCC \\ \hline ptrmir482b & TTTTTTTTTTAATGGGAGGCATAGGGA & GGAGTAGAAATCTTCCCTATGCCTCCC & TCTTCCCTATGCCTCCCATTCC \\ \hline ptrmir1446 & TTTTTTTTTTTTGAAGCAGAGAGTTCA & GGAGTAGAAAATCTGAACTCTCTGCTT & ATCTGAACTCTCTGCTTCAA \\ \hline ptrmir435 & TTTTTTTTTTCCGACTCCAATTCCGGA & GGAGTAGAAATTATCCGGAATTGGAGT & TTATCCGGAATTGGAGTCGG \\ \hline \end{tabular} \end{table}	PMC2881865_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Variable}} & \multirow{2}{}{\textbf{Urban (n=1,805)}} & \multirow{2}{*}{\textbf{Rural (n=1,684)}} \\ \hline \\ \hline Mean age (years) & 37.8 ($\pm$1.36) & 37.5 ($\pm$1.36) \\ \hline Age-group (years) (\%) \\ \hline 15–24 & 21.4 & 20.8 \\ \hline >24–34 & 22.3 & 26.0 \\ \hline >34–44 & 24.7 & 21.9 \\ \hline >44–54 & 15.7 & 16.6 \\ \hline >54–64 & 16.0 & 14.7 \\ \hline Sex (\%) \\ \hline Male & 49.8 & 52.7 \\ \hline Female & 50.2 & 47.3 \\ \hline Education (\%) \\ \hline Illiterate & 12.7 & 31.1 \\ \hline Primary & 13.9 & 28.0 \\ \hline Secondary and higher secondary & 55.1 & 39.4 \\ \hline College & 10.4 & 0.7 \\ \hline Professional & 7.9 & 0.8 \\ \hline Occupation (\%) \\ \hline Business & 7.0 & 4.3 \\ \hline Farming & 0.7 & 16.7 \\ \hline Labour/ unskilled work & 3.5 & 20.1 \\ \hline Jobs/skilled work & 31.8 & 10.0 \\ \hline Household work & 26.3 & 10.9 \\ \hline Study/unemployed/ retired & 30.0 & 30.5 \\ \hline \end{tabular} \end{table}	PMC3702362_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Study year}} & \multirow{2}{}{\textbf{Total number of}} & \multicolumn{8}{c\|}{\textbf{Ever-smokers}} \\ \hline \textbf{N} & \textbf{\%} & \multicolumn{2}{c\|}{\textbf{Gender}} & \multicolumn{2}{c\|}{\textbf{Age}} & \multicolumn{2}{c\|}{\textbf{Education}} \\ \hline & & & & Men (\textbf{\%}) & Women (\textbf{\%}) & 20-44 (\textbf{\%}) & 45-64 (\textbf{\%}) & Low (\textbf{\%}) & High (\textbf{\%}) \\ \hline 1994 & 1864 & 516 & 27.7 & 81.9 & 18.1 & 64.6 & 35.4 & 49.4 & 50.6 \\ \hline 1996 & 2021 & 691 & 34.2 & 79.1 & 20.9 & 62.9 & 37.1 & 50.6 & 49.4 \\ \hline 1998 & 1874 & 654 & 34.9 & 73.5 & 26.5 & 70.8 & 29.2 & 46.4 & 43.6 \\ \hline 2000 & 2195 & 876 & 39.9 & 72.9 & 27.1 & 65.5 & 34.5 & 47.4 & 52.6 \\ \hline 2002 & 1883 & 706 & 37.5 & 72.2 & 27.8 & 54.5 & 45.5 & 38.5 & 61.5 \\ \hline 2004 & 1822 & 616 & 33.8 & 67.7 & 32.3 & 63.0 & 37.0 & 40.3 & 59.7 \\ \hline 2006 & 1739 & 654 & 37.6 & 65.7 & 34.3 & 59.8 & 40.2 & 41.7 & 58.3 \\ \hline 2008 & 1763 & 641 & 36.4 & 65.0 & 35.0 & 56.9 & 43.1 & 54.1 & 45.9 \\ \hline 2010 & 2000 & 729 & 36.5 & 55.9 & 44.1 & 56.4 & 43.6 & 53.2 & 46.8 \\ \hline \end{tabular} \end{table}	PMC4349467_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Ferret} & \textbf{Proximal latency (ms)} & \textbf{Proximal duration (ms)} & \textbf{Proximal amplitude (mV)} & \textbf{Proximal area (mV/ms)} & \textbf{Distal latency (ms)} & \textbf{Distal duration (ms)} & \textbf{Distal amplitude (mV)} & \textbf{Distal area (mV/ms)} & \textbf{Conduction velocity (m/sec)} \\ \hline N.1 & 2.8 & 2.2 & 7.1 & 3.7 & 1.4 & 2.3 & 17.4 & 8.9 & 53.6 \\ \hline N.2 & 3.2 & 4.9 & 16.8 & 18 & 1.8 & 4.7 & 20.6 & 20 & 64.3 \\ \hline N.3 & 3 & 4.8 & 9.4 & 7.9 & 0.9 & 4.7 & 10.5 & 6.3 & 60 \\ \hline N.4 & 2.9 & 4.7 & 11 & 9.6 & 1.6 & 4.6 & 13.3 & 11 & 69.2 \\ \hline N.5 & 2.4 & 4.1 & 7.6 & 6.1 & 1.2 & 3.8 & 9.9 & 7.1 & 66.7 \\ \hline N.6 & 2.4 & 4.1 & 11.1 & 10 & 1.5 & 3.7 & 12.8 & 10 & 77.8 \\ \hline N.7 & 2.8 & 4.5 & 12 & 11 & 1.6 & 4.2 & 12.2 & 11 & 62.5 \\ \hline N.8 & 2.9 & 4.2 & 11.5 & 9.6 & 1.6 & 4.3 & 11.2 & 8.9 & 67.7 \\ \hline N.9 & 2.7 & 5 & 12.1 & 11 & 1.3 & 4.8 & 11.7 & 9.7 & 57.1 \\ \hline N.10 & 2.6 & 3.4 & 9.3 & 7.4 & 1.2 & 3.5 & 10.6 & 7.9 & 53.6 \\ \hline MEAN & 2.77 & 4.19 & 10.79 & 9.43 & 1.41 & 4.06 & 13.02 & 10.08 & 63.25 \\ \hline SD & 0.25 & 0.85 & 2.75 & 3.79 & 0.26 & 0.77 & 3.41 & 3.81 & 7.56 \\ \hline \end{tabular} \end{table}	PMC2913798_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Proteins} & \textbf{Number of Hits Antibiotic Treated} & \textbf{Number of Hits No Antibiotics} \\ \hline superoxide dismutase [Acinetobacter baumannii ACICU] & 40 & 1 \\ \hline outer membrane protein, related peptidoglycan-associated (lipo)protein [Acinetobacter baumannii ACICU] & 9 & 2 \\ \hline gluconate kinase [Acinetobacter baumannii ACICU] & 8 & 2 \\ \hline electron transfer flavoprotein subunit alpha [Acinetobacter baumannii ACICU] & 7 & 3 \\ \hline Zn-dependent alcohol dehydrogenase, class III [Acinetobacter baumannii ACICU] & 2 & 1 \\ \hline putative porin protein associated with imipenem resistance [Acinetobacter baumannii ACICU] & 3 & 2 \\ \hline hypothetical protein ACICU_02436 [Acinetobacter baumannii ACICU] & 76 & 53 \\ \hline beta-lactamase [Acinetobacter baumannii ACICU] & 452 & 325 \\ \hline malate dehydrogenase [Acinetobacter baumannii ACICU] & 50 & 38 \\ \hline chaperonin GroEL [Acinetobacter baumannii ACICU] & 50 & 43 \\ \hline \end{tabular} \end{table}	PMC3409086_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Study and location} & \textbf{Surveillance tool} & \textbf{Implementation platforms} & \textbf{Quality assurance} & \textbf{Number of cluster} & \textbf{Sampling sites per cluster} & \textbf{Trap-nights per month} & \textbf{Temporal scale (Trap nights)} & \textbf{Duration of the surveys} & \textbf{Total number of trap months} \\ \hline Abilio et al. 2010 Zambezia province, central northern Mozambique & WET & Community-based (home owner) as stand alone & No & 19 & 6 & 114 & 788 & 2006-2007 and 2009-2010 & 48 \\ \hline Sharp et al. 2007 Bioko Island, Equatorial Guinea & WET & Community-based (home owner) as stand alone & No & 16 & 6 & 96 & 59,307 & 2004-2005 & 24 \\ \hline Chaki et al. (Urban Dar es Salaam, Tanzania) & ITT and HLC & Community-based (community volunteers) & Yes & 31 & 20 & 615 & 8,171 & Feb 2009- Oct 2010 & 20 \\ \hline \end{tabular} \end{table}	PMC3475008_table_3
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Early 1980s} & \textbf{Gabrielle Carlson et al. observe that bipolar symptomatology in preadolescent children can include severe irritability and emotional lability (as opposed to the classic symptoms that appear in adults and adolescents) [27].} \\ \hline 1994 & Geller et al. report in Journal of American Academy of Adolescent and Child Psychiatry (JAACAP) conversion to BP in 32\% of a sample of children with major depression [31]. \\ \hline 1995 & Geller et al. in suggested that children and adolescents with rapid-cycling mania characterized by elevated/ Journal of Affective Disorders expansive and/or grandiose mood have BP; the researchers did not use irritability to characterize BP because it also commonly appears in ADHD [29]. \\ \hline 1995 & Wozniak et al. [11] and Biederman et al. [30] in two JAACAP articles report that 16\% of a clinical population of children met the criteria for mania primarily by exhibiting chronically irritable mood and describe their use of the Child Behavior Checklist to confirm their diagnoses of BP in these children. \\ \hline 1998 & Klein et al., critique the move to consider chronic irritability a form of mania [47]. \\ \hline 2000 & Publication of The Bipolar Child by Demitri and Janice Papolos, a book aimed at parents, whose success coincides with an increase in visits to doctor’s offices by parents regarding a bipolar diagnosis for their children [6]. \\ \hline 2002 & magazine runs a cover story on children with BP [15]. Time \\ \hline 2003 & Leibenluft et al. describe a new syndrome, Severe Mood Dysregulation, (SMD), which aims to bring some conceptual order to the increasingly heterogeneous class of children receiving a BP diagnosis [28,48,49,51]. \\ \hline 2005 & Article by Kowatch et al. describing treatment guidelines for children and adolescents with BP published in JAACAP. Accompanying commentary calls attention to lack of evidence that childhood diagnosis is contiguous with adult BP and critiques some symptoms as difficult to distinguish from developmentally normal childhood behavior [46]. \\ \hline 2006 & Brotman et al. use the label Severe Mood Dysregulation in the title of a scientific article, offering a new label for many children now receiving the BP diagnosis [49]. \\ \hline 2007 & JAACAP publishes practice parameter for diagnosis and treatment of BP in children and adolescents. Parameter follows Geller et al. diagnostic criteria more than those proposed by Biederman et al. but warns of difficulty differentiating symptoms from normal childhood behavior and urges periodic revisions of any diagnosis and treatment plan [57]. \\ \hline 2007 & publishes study reporting a 40-fold increase between 1994 and 2003 in the number of office visits in which Archives of General Psychiatry children (0-19) had a diagnosis of BP [1]. \\ \hline 2009 & Zito et al. report a 10-year trend for Medicaid-insured youth with clinician-reported pediatric bipolar disorder showing a proportional increase in minority youth with this diagnosis from 1997 to 2006 (23\% increase in African-American and other minorities and corresponding drop in white youth) [85]. Crystal et al. report that poor children are four times more likely than wealthy children to receive atypical antipsychotics [70]. \\ \hline 2010 & Olfson et. al. report a doubling of the number of privately insured 2-5 year-old children with a psychiatric diagnosis who receive an antipsychotic, and lament the sparseness of non-pharmacological mental health resources [3]. Authors working on DSM V propose adding new diagnostic category, which is based on Severe Mood Dysregulation and may be called Temper Dysregulation Disorder with Dysphoria [54]. \\ \hline \end{tabular} \end{table}	PMC2846895_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Group} & \multicolumn{2}{c\|}{\textbf{ROS}} & \multicolumn{2}{c\|}{\textbf{MDA}} & \multicolumn{2}{c\|}{\textbf{GSH}} & \multicolumn{2}{c\|}{\textbf{SOD}} \\ \hline & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} & \textbf{\textbf{\textbf{\textbf{Serum (nmol/ mL)}}}} & \textbf{\textbf{\textbf{\textbf{Liver (ng/ mgprot)}}}} \\ \hline Control & 540.25$\pm$46.32 & 1.63$\pm$0.06 & 0.31$\pm$0.12 & 0.09$\pm$0.01 & 602.74$\pm$76.78 & 1.20$\pm$0.16 & 662.50$\pm$50.57 & 21.89$\pm$1.48 \\ \hline 10\% alcohol & 635.08$\pm$62.43 & 1.72$\pm$0.06 & 0.62$\pm$0.10* & 0.14$\pm$0.02 & 472.22$\pm$50.62* & 1.38$\pm$0.14 & 450.63$\pm$49.34* & 19.19$\pm$1.27 \\ \hline 20\% alcohol & 698.36$\pm$56.19* & 2.04$\pm$0.13* & 1.05$\pm$0.23* & 0.19$\pm$0.04* & 387.85$\pm$30.05* & 0.89$\pm$0.15* & 367.30$\pm$39.90* & 15.96$\pm$1.18* \\ \hline \end{tabular} \end{table}	PMC4451149_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Gene present in # genomes} & \textbf{# of genes} & \textbf{Prominent functions (remainder are hypothetical proteins)} \\ \hline 4 & 26 & petF, ho1, carbamoyltransferase, pebS, 5 virion structural proteins \\ \hline 5 & 17 & Enase VII, HN, DUF120 \\ \hline 6 & 14 & prnA, speD, carboxylesterase, 3 virion structural proteins \\ \hline 7 & 12 & 2 virion structural proteins \\ \hline 8 & 17 & purM, 3 virion structural proteins \\ \hline 9 & 15 & pstS, PTOX, 6 virion structural proteins \\ \hline 10 & 5 & petE, 1 virion structural protein \\ \hline 11 & 5 & all hypothetical proteins \\ \hline 12 & 11 & psbD, cpeT, 1 virion structural protein \\ \hline 13 & 3 & denV \\ \hline 14 & 6 & N6A-methylase, helicase, 2OG-FeII oxygenase, 1 virion structural protein \\ \hline 15 & 12 & talC, CP12, DUF680, endonuclease, 1 virion structural protein \\ \hline \end{tabular} \end{table}	PMC3037559_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline & \textbf{Question} \\ \hline 1 & What are the major health issues and challenges affecting Nsuta and/or Jansa? \\ \hline 2 & How do people commonly obtain health services? How do they obtain medications and/or pharmacy services? \\ \hline 3 & Are there any health services you think would be beneficial? What would they be? Who would obtain them? \\ \hline 4 & What kind of help would be useful for improvement of services? Do you think any help is needed from outside of Ghana? \\ \hline \end{tabular} \end{table}	PMC3639358_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{PET/CT positive/MRI positive} & \textbf{PET/CT negative/MRI positive} & \textbf{PET/CT positive/MRI negative} \\ \hline Spinal lesions & 14 & 54 & 24 \\ \hline SIJ lesions & 13 & 6 & 4 \\ \hline \end{tabular} \end{table}	PMC3472173_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Gene} & \textbf{Gene} Function & \textbf{Abiotic Stress Tolerance} & \textbf{Reference} \\ \hline Aldehyde dehydrogenase family 7 member (ALDH7) & Oxygen radical detoxification & Extenuated oxidative stress & [51,93] \\ \hline Ascorbate peroxidase (APX) & H2O2 metabolism & Preventing oxidative stress & [94] \\ \hline Glutathione reductase (GR) & H2O2 metabolism & Induced by oxidative stress & [95] \\ \hline Superoxide dismutase (SOD) & Oxygen radical detoxification & Improved drought tolerance; Induced by drought & [96–98] \\ \hline \end{tabular} \end{table}	PMC4519955_table_3
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Com\textbf{p}onent} & \textbf{Collective} & \textbf{Mean} & \textbf{SD} & \textbf{p} \\ \hline IL-6 & Daytime workers Shift workers & 2.30 2.67 & 1.54 3.79 & 0.276 \\ \hline TNF-a & Daytime workers Shift workers & 5.58 5.68 & 2.91 5.19 & 0.841 \\ \hline Lym\textbf{p}hocytes & Daytime workers Shift workers & 33.68 32.99 & 7.64 7.49 & 0.404 \\ \hline \textbf{Com\textbf{p}onent} & PSQI & \textbf{Mean} & \textbf{SD} & \textbf{p} \\ \hline IL-6 & PSQI 6 $\leq$ PSQI $\geq$ 6 & 2.47 2.58 & 2.50 3.77 & 0.761 \\ \hline TNF-a & PSQI $\leq$ 6 PSQI $\geq$ 6 & 5.53 5.68 & 3.49 5.41 & 0.759 \\ \hline Lym\textbf{p}hocytes & PSQI $\leq$ 6 PSQI 6 $\geq$ & 33.59 33.14 & 7.52 7.78 & 0.593 \\ \hline \end{tabular} \end{table}	PMC2914774_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{No of annotation terms matched (/40} & \textbf{HGNC symbol} & \textbf{gene1 XLMR} & \textbf{kb2 50} & \textbf{kb2 100} & \textbf{(kb)3 Dist} & \textbf{Strata} \\ \hline 24 & DMD & 1 & NX & NX & 71.7 & XAR \\ \hline 23 & GPM6B & 0 & NX & NX & 68 & XAR \\ \hline 19 & AP1S2 & 1 & X & X & 61.4 & XAR \\ \hline 19 & FGF13 & 0 & NX & NX & 157.8 & XCR \\ \hline 19 & ZDHHC9 & 1 & X & NX & 60.7 & XCR \\ \hline 18 & TAF9B & 0 & NX & NX & 133 & XCR \\ \hline 18 & FAM156A & 0 & X & NX & 90.8 & XCR \\ \hline 18 & FAM156B & 0 & X & NX & 90.8 & XCR \\ \hline 17 & ARHGEF9 & 1 & NX & X & 259.5 & XCR \\ \hline 17 & TMEM47 & 0 & NX & NX & 285.5 & XAR \\ \hline 16 & NAP1L2 & 0 & NX & NX & 182.7 & XCR \\ \hline 16 & NSBP1 & 0 & NX & NX & 80.3 & XCR \\ \hline 16 & PCSK1N & 0 & NX & NX & 56.7 & XCR \\ \hline 16 & UXT & 0 & X & NX & 64.4 & XCR \\ \hline 15 & BCOR & 1 & X & X & 253.8 & XAR \\ \hline 15 & ENOX2 & 0 & NX & NX & 155 & XCR \\ \hline 15 & HUWE1 & 1 & X & NX & 224.7 & XCR \\ \hline 15 & LAS1L & 0 & NX & NX & 132.8 & XCR \\ \hline 15 & THOC2 & 0 & NX & NX & 124 & XCR \\ \hline 14 & CXorf61 & 0 & NX & NX & 323.4 & XCR \\ \hline 14 & TBL1X & 0 & X & NX & 190.3 & XAR \\ \hline 14 & TMLHE & 0 & NX & NX & 154.8 & XCR \\ \hline 13 & C1GALT1C1 & 0 & NX & NX & 102.9 & XCR \\ \hline 13 & KAL1 & 0 & NX & NX & 58.6 & XAR \\ \hline 13 & PPP2R3B & 0 & NX & NX & 237.4 & XAR \\ \hline 13 & RNF12 & 0 & NX & NX & 65.4 & XCR \\ \hline 13 & ZMAT1 & 0 & NX & NX & 77 & XCR \\ \hline 12 & GABRE & 0 & NX & NX & 103 & XCR \\ \hline 12 & ZC4H2 & 0 & X & NX & 431.8 & XCR \\ \hline 12 & MAGED4 & 0 & NX & X & 115.6 & XCR \\ \hline 12 & MAGED4B & 0 & NX & X & 115.6 & XCR \\ \hline 12 & MORC4 & 0 & NX & NX & 64.2 & XCR \\ \hline 12 & RAI2 & 0 & NX & NX & 302.1 & XAR \\ \hline 11 & APLN & 0 & X & NX & 84.5 & XCR \\ \hline 11 & KLHL13 & 0 & NX & NX & 83.1 & XCR \\ \hline 11 & MUM1L1 & 0 & NX & NX & 93.4 & XCR \\ \hline 11 & RAP2C & 0 & X & NX & 160.1 & XCR \\ \hline 11 & SLITRK4 & 0 & NX & NX & 72.2 & XCR \\ \hline 11 & SYTL4 & 0 & NX & NX & 88.2 & XCR \\ \hline 10 & CHRDL1 & 0 & NX & NX & 300.5 & XCR \\ \hline 10 & PHF16 & 0 & NX & NX & 72.4 & XAR \\ \hline 10 & STAG2 & 0 & NX & NX & 60.9 & XCR \\ \hline \end{tabular} \end{table}	PMC3142252_table_4
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Descriptors} & \textbf{Characterization} & \multicolumn{2}{c\|}{\textbf{Median/Mean}} & \textbf{valued P} \\ \hline & & \textbf{Anaerobic metabolites (n = 1174)} & \textbf{Aerobic metabolites (n = 520)} \\ \hline MWa & Molecular weight & 214.70/310.72 & 289.38/317.69 & 0.52 \\ \hline AREAa & Total molecular surface area & 425.95/545.21 & 508.90/549.64 & 0.74 \\ \hline VOLa & Total molecular volume & 613.75/822.00 & 803.80/856.24 & 0.17 \\ \hline AtomCounta & Total atom count & 26/36.48 & 36/43.23 & 2.95E-06 \\ \hline Carbonsb & Carbon atom count & 8/10.94 & 15/16.06 & 1.06E-23 \\ \hline Oxygensb & Oxygen atom count & 6/7.24 & 4/5.38 & 1.08E-13 \\ \hline Nitrogensb & Nitrogen atom count & 1/1.67 & 0/0.73 & 1.19E-24 \\ \hline Sulfursb & Sulfur atom count & 0/0.10 & 0/0.11 & 0.57 \\ \hline Phosphorusb & Phosphorus atom count & 0/0.68 & 0/0.08 & 6.12E-56 \\ \hline AlogP98c & Logarithm of partition coefficient, atom-type value, using latest parameters & 21.08/20.80 & 1.26/1.43 & 2.51E-63 \\ \hline PSAa & Polar molecular surface area & 242.40/280.12 & 169.47/195.99 & 9.96E-28 \\ \hline PVa & Polar molecular volume & 170.50/247.37 & 127.61/165.27 & 1.71E-21 \\ \hline Acceptora & H-bond acceptor count & 6/7.66 & 4/5.56 & 1.21E-14 \\ \hline Donora & H-bond donor count & 3/3.81 & 2/2.37 & 8.83E-20 \\ \hline Hydrophobea & Hydrophobic fragment count & 1/1.43 & 2/2.45 & 3.09E-23 \\ \hline RingCounta & Ring count & 1/1.34 & 3/2.55 & 3.11E-38 \\ \hline AromaticRingsb & Aromatic ring count & 0/0.44 & 0/0.79 & 3.40E-13 \\ \hline BondCounta & Total bond count & 26/36.83 & 38/44.78 & 1.34E-07 \\ \hline RotBondsa & Rotatable bond count & 7/8.97 & 5/6.22 & 4.99E-18 \\ \hline Chirala & Chiral center count & 2/3.02 & 2/3.78 & 4.69E-04 \\ \hline \end{tabular} \end{table}	PMC3305344_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multirow{2}{}{\textbf{Māori N (\%)}} & \multirow{2}{}{\textbf{Pacific N (\%)}} & \multirow{2}{*}{Non-Māori/ non-\textbf{Pacific N (\%)}} \\ \hline \\ \hline Total & 302 (100) & 70 (100) & 1427 (100) \\ \hline Age (years) \\ \hline 20–35 & 10 (3.3) & 4 (5.7) & 25 (1.8) \\ \hline 36–50 & 97 (32.1) & 37 (52.9) & 377 (26.4) \\ \hline 51–65 & 137 (45.4) & 19 (27.1) & 589 (41.3) \\ \hline >65 & 58 (19.2) & 10 (14.3) & 436 (30.6) \\ \hline NZDep (quintiles) \\ \hline Q1 (least deprived) & 16 (5.3) & 5 (7.1) & 282 (19.8) \\ \hline Q2 & 31 (10.3) & 5 (7.1) & 265 (18.6) \\ \hline Q3 & 52 (17.2) & 9 (12.9) & 333 (23.4) \\ \hline Q4 & 73 (24.2) & 21 (30.0) & 325 (22.8) \\ \hline Q5 (most deprived) & 130 (43.1) & 30 (42.9) & 218 (15.3) \\ \hline Extent \\ \hline Local & 136 (52.5) & 28 (52.8) & 712 (56.7) \\ \hline Regional & 116 (44.8) & 23 (43.4) & 528 (42.0) \\ \hline Distant & 7 (2.7) & 2 (3.8) & 16 (1.3) \\ \hline Tumour size (mm) \\ \hline <10 mm & 34 (12.8) & 9 (15.8) & 308 (23.6) \\ \hline 11–19 & 69 (25.9) & 16 (28.1) & 416 (31.9) \\ \hline 20–29 & 105 (39.5) & 13 (22.8) & 325 (24.9) \\ \hline 30+ & 58 (21.8) & 19 (33.3) & 255 (19.6) \\ \hline Diabetes \\ \hline Yes & 58 (19.2) & 12 (17.1) & 115 (8.1) \\ \hline No & 244 (80.8) & 58 (82.9) & 1,309 (91.9) \\ \hline screeninga Eligible for free \\ \hline \% never screened & 5 \% & 5 \% & 12 \% \\ \hline \% tumours < 10 mm (p <0.001) & 14 \% & 20 \% & 26 \% \\ \hline \% localized stage (p <0.001) & 47 \% & 40 \% & 53 \% \\ \hline \end{tabular} \end{table}	PMC4575458_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Citation} & \textbf{Country (WHO Region)*} & \textbf{N} & \textbf{Facility Infrastructure Level} & \textbf{Prospective vs Retrospective} & \textbf{Population Based vs Sample} & \textbf{Denominator description} & \textbf{\% Utilizing Facility} \\ \hline Awasthi, 2009 [8] & India (SEAR) & 510 enrolled in baseline facility based survey & Public hospital with doctors and basic diagnostic and treatment facilities & Prospective & Sample: 2 urban public hospitals in Lucknow & Enrolled sick newborns who came to the facility & 80\% utilized the facilities in baseline assessment \\ \hline Bari, 2006 [15] & Bangladesh (SEAR) & 2,290 newborns in comparison sample & Private hospital with specialized pediatric care & Prospective & Sample: Mirzapur subdistrict, Tangail district & Sick newborns who utilized the local hospital & 18-23\% utilized referral hospital \\ \hline Dongre 2009 [16] & India (SEAR) & 503 mothers of babies < 12 months & Public or private hospitals attended by doctors & Prospective & Sample: Wardha district, Maharashtra & \textbf{N}ewborns with clinical danger signs presenting to local hospitals & 48\% utilized local hospital in needs assessment phase \\ \hline Kumar, 2008 [17] & India (SEAR) & 1079 live births in “control” arm & Primary health centers with trained physicians & Prospective & Sample: Shivgarh district, Uttar Pradesh & 296 newborns with “any” illness & 16.7\% were attended by a doctor or nurse/ midwife \\ \hline Manandhar, 2004 [18] & \textbf{N}epal (SEAR) & 3,226 live births in control areas & \textbf{N}ot specified & Prospective & Sample: Makwanpur district & \textbf{N}eonates with signs of illness (cough, fever, diarrhea) & 10\% utilized a health facility for illness \\ \hline McPherson, 2006 [19] & \textbf{N}epal (SEAR) & \textbf{N}umber in baseline survey population not specified & \textbf{N}ot specified & Household survey before/ after community intervention & Sample: Siraha District & \textbf{N}ot specified & 11-17\% utilized postnatal care services \\ \hline \end{tabular} \end{table}	PMC3253732_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Characteristcs} & \textbf{Number of patients} & \textbf{(\%)} \\ \hline Total number of patients & 19 \\ \hline Age (years) \\ \hline $\pm$ Mean SD (range) & $\pm$ 61.3 1.4(38-75) \\ \hline Sex \\ \hline Male & 13 & 68.4 \\ \hline Female & 6 & 31.6 \\ \hline Karnofsky performance status \\ \hline 80-100 & 19 & 100 \\ \hline Histological type (Japanese classiﬁ cation) \\ \hline Differntiated & 5 & 26.3 \\ \hline Undifferentiated & 14 & 73.7 \\ \hline Primary treatment \\ \hline Curative gastrectomy & 6 & 31.6 \\ \hline Palliative gastrectomy & 10 & 52.6 \\ \hline Without gastrectomy & 3 & 15.8 \\ \hline Target lesions \\ \hline primary & 3 & 15.8 \\ \hline peritoneal dissemination & 14 & 73.3 \\ \hline lymph node metastasis & 5 & 26.3 \\ \hline liver metastasis & 2 & 10.5 \\ \hline \end{tabular} \end{table}	PMC3161668_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Variable} & \textbf{Value} \\ \hline Sample size & 1,018 \\ \hline Age (years) & 56)a 48 (41, \\ \hline Male:Female & 419:599 \\ \hline Percent African ancestry & 82.0 (74.7, 87.5) \\ \hline Serum creatinine (mg/dL) & 0.9 (0.7, 1.0) \\ \hline m2) Glomerular filtration rate (mL/min/1.73 & 102.1 (86.7, 119.2) \\ \hline Type 2 diabetes (prevalence) & 15.6\% \\ \hline Hypertension (prevalence) & 50.0\% \\ \hline \end{tabular} \end{table}	PMC3441677_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Variables} & \multicolumn{2}{c\|}{\textbf{WRMSDs (n = 376)}} & \textbf{P-value+} \\ \hline & \textbf{Yes (n = 275)} & \textbf{No (n = 101)} \\ \hline & \multicolumn{2}{c\|}{Mean (SD)} \\ \hline Age (yr) & 29.62 (7.13) & 30.21 (6.70) & 0.46 \\ \hline Years of employment as nurses & 7.33 (4.89) & 7.61 (5.18) & 0.64 \\ \hline Working hours/week & 45.17 (5.17) & 44.65 (5.17) & 0.41 \\ \hline \multirow{2}{}{Body mass index (kg/m2) (BMI)} & 24.39 (4.49) & 23.65 (4.44) & 0.15 \\ \hline \multicolumn{2}{c\|}{\% (n)} \\ \hline Race \\ \hline Malay & 94.20 (260) & 94.10 (95) & 0.96 \\ \hline Non-Malay & 5.80 (15) & 5.90 (6) \\ \hline Marital status \\ \hline Married & 78.91 (217) & 70.30 (71) & 0.09 \\ \hline Not married & 21.09 (58) & 29.70 (30) \\ \hline \end{tabular} \end{table}	PMC4387780_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline O1 & 0.0185 (4) & 0.0326 (5) & 0.0136 (4) & 0.0000 & −0.0019 (4) & 0.0000 \\ \hline O2 & 0.0169 (4) & 0.0368 (6) & 0.0242 (5) & 0.0000 & −0.0042 (4) & 0.0000 \\ \hline C1 & 0.0169 (5) & 0.0170 (5) & 0.0137 (5) & 0.0000 & 0.0004 (4) & 0.0000 \\ \hline C2 & 0.0176 (5) & 0.0251 (6) & 0.0153 (5) & 0.0000 & −0.0002 (5) & 0.0000 \\ \hline C3 & 0.0220 (6) & 0.0270 (6) & 0.0143 (5) & 0.0000 & −0.0021 (5) & 0.0000 \\ \hline C4 & 0.0246 (6) & 0.0248 (6) & 0.0131 (5) & 0.0000 & 0.0025 (5) & 0.0000 \\ \hline C5 & 0.0185 (5) & 0.0213 (5) & 0.0177 (5) & 0.0000 & 0.0031 (5) & 0.0000 \\ \hline C6 & 0.0176 (5) & 0.0173 (5) & 0.0147 (5) & 0.0000 & 0.0003 (4) & 0.0000 \\ \hline C7 & 0.0182 (6) & 0.0214 (5) & 0.0172 (5) & 0.0000 & −0.0011 (5) & 0.0000 \\ \hline C8 & 0.0164 (5) & 0.0232 (6) & 0.0130 (5) & 0.0000 & −0.0007 (4) & 0.0000 \\ \hline C9 & 0.0259 (5) & 0.0244 (4) & 0.0185 (4) & −0.0011 (4) & 0.0028 (3) & 0.0028 (3) \\ \hline \end{tabular} \end{table}	PMC3254460_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{L} & \textbf{N} & \textbf{Coefficients} \\ \hline 3 & 3 & ς12 = 0.681306, ς13 = 0.444312, ς23 = 0.679452 \\ \hline 4 & 4 & ς12 = 0.739716, ς13 = 0.432467, ς14 = 516734, ς23 = 0.571812, ς24 = 0.4434453, ς34 = 0.737795 \\ \hline 5 & 5 & ς12 = 769,240, ς13 = 0.438591, ς14 = 0.467191, ς15 = 0.495116, ς23 = 0.431753, ς24 = 0.625867, ς25 = 0.579681, ς34 = 0.656805, ς35 = 0.213527, ς45 = 0.881820 \\ \hline \end{tabular} \end{table}	PMC4367419_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{-NH2 groups} & \textbf{Frequencies/cm-} & \textbf{Amide N-H} & \textbf{Frequencies/cm-}1 & \textbf{C=O groups} & \textbf{Frequencies/cm-}1 \\ \hline υasN(99)-H & 3670vw & υN(23)-H & 3446w & υC(11)-O(12) & 1639w \\ \hline υasN(13)-H & 3646 vw & υN(109)-H & 3356m & υC(97)-O(98) & 1629m \\ \hline υasN(31)-H & 3592 vw & ρN(109)-H & 1567s \\ \hline υsN(99)-H & 3551 vw & ρN(23)-H & 1563w \\ \hline υsN(13)-H & 3538 w \\ \hline υsN(31)-H & 3458m \\ \hline δN(31)-H & 1711vw \\ \hline δN(13)-H & 1686vw \\ \hline δN(99)-H & 1679vw \\ \hline δC(28)-H & 1316vw \\ \hline δC(96)-H & 1315vw \\ \hline δC(10)-H & 1328vw \\ \hline \end{tabular} \end{table}	PMC2812828_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Thickness (µm)} & \textbf{Stiffness Coefficient (N·m)} & \textbf{Sensitivity(rad/(°/s))} \\ \hline 25 & 10−4 4.443 × & 10−5 1.822 × \\ \hline 48 & 10−3 3.145 × & 10−5 1.808 × \\ \hline 75 & 10−2 1.200 × & 10−5 1.643 × \\ \hline \end{tabular} \end{table}	PMC4481988_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Variables} & \textbf{Mean (SD)} \\ \hline Haematological Parameters \\ \hline Haemoglobin (gm/dl) & 10.65 (1.65) \\ \hline White cell count(per cmm) & 6.08 (3.28) \\ \hline Platelets * & 87.00 (87;135) \\ \hline Prothrombin Time(Sec) & 15.80 (4.79) \\ \hline Biochemistry \\ \hline Total Protein (gm/dl) & 6.75 (1.32) \\ \hline Albumen (gm/dl) & 2.61 (0.71) \\ \hline Creatinine (mg/dl) & 1.10 (0.57) \\ \hline Sodium (Meq/L) & 134 (5) \\ \hline Potassium (Meq/L) & 3.97 (0.62) \\ \hline Chloride (Meq/L) & 106 (9.6) \\ \hline Bicarbonate (Meq/L) & 20.46 (3.74) \\ \hline Liver function tests & Median (IQR) \\ \hline Total Bilirubin (mg/dl) & 1.5 (1;2.95) \\ \hline SGPT (IU/L) & 39 (25;58) \\ \hline SGOT (IU/L) & 59 (40;92) \\ \hline GGT (IU/L) & 48 (30;81) \\ \hline ALK Phosphate (IU/L) & 110 (79;166) \\ \hline \end{tabular} \end{table}	PMC3542150_table_2
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Gene} & \textbf{Sequence} \\ \hline Aromatase & Forward primer gcttctcatcgcagagtatccgg Reverse primer caagggtaaattcattgggcttgg \\ \hline Bax & Forward primer ggggacgaactggacagtaa Reverse primer cagttgaagttgccgtcaga \\ \hline Bcl-2 & Forward primer atgtgtgtggagagcgtcaa reverse primer acagttccacaaaggcatcc \\ \hline Bcl-x & Forward primer cgtagacaaggagatgcaggt Reverse primer accagcggttgaagcgctcct \\ \hline FGF-2 & Forward primer ccgttacctggctatgaagg Reverse primer actgcccagttcgtttcagt \\ \hline GAPDH & Forward primer tcgtggaaggactcatgac Reverse primer ccatcacgccacagttt \\ \hline \end{tabular} \end{table}	PMC3354660_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{First author} & \textbf{Settings} & \textbf{IGRA method} & \textbf{Samples} & \multicolumn{4}{c\|}{\textbf{Test results}} & \textbf{QUADAS score} \\ \hline & & & & \textbf{TP} & \textbf{FP} & \textbf{FN} & \textbf{TN} \\ \hline \multirow{2}{}{Wilkinson} & UK & ELISPOT & PE & 10 & 1 & 0 & 7 & 10 \\ \hline & & Blood & 10 & – & 0 & – \\ \hline \multirow{2}{}{Ariga} & Japan & ELISA & PE & 27 & 1 & 1 & 46 & 11 \\ \hline & & Blood & 21 & 14 & 6 & 33 \\ \hline \multirow{2}{}{Losi} & Italy, Germany, Netherlands & ELISPOT & PE & 19 & 5 & 1 & 16 & 10 \\ \hline & & Blood & 18 & 7 & 2 & 14 \\ \hline \multirow{2}{}{Baba} & South Africa & ELISA & PE & 12 & 2 & 15 & 4 & 10 \\ \hline & & Blood & 17 & 0 & 7 & 6 \\ \hline \multirow{2}{}{Chegou} & South Africa & ELISA & PE & 13 & 2 & 10 & 13 & 13 \\ \hline & & Blood & 16 & 5 & 6 & 12 \\ \hline \multirow{4}{}{Dheda} & South Africa & ELISPOT & PE & 38 & 8 & 6 & 9 & 11 \\ \hline & & Blood & 30 & 7 & 6 & 9 \\ \hline & ELISA & PE & 23 & 6 & 19 & 12 \\ \hline & & Blood & 26 & 4 & 4 & 9 \\ \hline \multirow{2}{}{Lee} & Taiwan & ELISPOT & PE & 18 & 3 & 1 & 18 & 9 \\ \hline & & Blood & 14 & 2 & 4 & 19 \\ \hline \multirow{2}{}{Ates} & Turkey & ELISA & PE & 21 & 6 & 22 & 23 & 11 \\ \hline & & Blood & 30 & 14 & 13 & 15 \\ \hline Chuang & South Korea & ELISA & Blood & 42 & 17 & 12 & 26 & 8 \\ \hline \multirow{4}{}{Kang} & South Korea & ELISPOT & PE & 15 & 8 & 0 & 3 & 9 \\ \hline & & Blood & 18 & 6 & 2 & 8 \\ \hline & ELISA & PE & 10 & 5 & 5 & 5 \\ \hline & & Blood & 4 & 6 & 0 & 7 \\ \hline \multirow{2}{}{Eldin} & Egypt & ELISA & PE & 16 & 3 & 4 & 15 & 7 \\ \hline & & Blood & 14 & 7 & 6 & 11 \\ \hline Gao & China & ELISA & PE & 54 & 2 & 4 & 18 & 8 \\ \hline \multirow{2}{}{Keng} & Taiwan & ELISA & PE & 24 & 2 & 31 & 57 & 8 \\ \hline & & PE & 22 & 1 & 9 & 56 \\ \hline \multirow{2}{}{Liu} & China & ELISPOT & PE & 53 & 2 & 2 & 41 & 9 \\ \hline & & Blood & 51 & 10 & 4 & 33 \\ \hline \multirow{2}{*}{Liao} & China & ELISPOT & PE & 269 & 0 & 12 & 51 & 8 \\ \hline & & Blood & 220 & 7 & 61 & 44 \\ \hline \end{tabular} \end{table}	PMC4451019_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline & \textbf{Controls (n = 14)} \\ \hline Females & 4 (29\%) \\ \hline Median age in months (range) & 12 (1–64) \\ \hline Exclusion tracheal/bronchial malformation & 7 (50\%) \\ \hline Foreign body aspiration/ Aspiration & 5 (36\%) \\ \hline Atelectasis & 2 (14\%) \\ \hline \end{tabular} \end{table}	PMC3226624_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Pt} & \textbf{Age/gender/Spa type} & \textbf{Type of infection} & \textbf{Treatment} & \textbf{Animal contact} & \textbf{Extra} \\ \hline 1 & 40/male/t011 & External otitis & Surgical cleansing, no antibiotic treatment & Pig farmer & Cured \\ \hline 2 & 90/male/t567 & Pleural empya & Surgical drainage, quinelones and rifampin & None & Post infectious sterile pleural effusion, surgically drained and secondarily infected through drain (colonized) with LA-MRSA \\ \hline 3 & 41/male/t011 & Abscess finger & Incision and drainage no antibiotic treatment & Butcher & Abscess of trauma with knife, wound cured. \\ \hline 4 & 89/male/t108 & Abcess tooth/jaw & Incision and drainage (2x) no antibiotic treatment & None & Cured \\ \hline 5 & 60/male/t108 & Wound infection of lymphnode biopsie & No specific treatment & Horse farm & T cell lymphoma, wound infection cured \\ \hline 6 & 80/female/t011 & Conjunctivitis & Topical antibiotics (fusidinic acid) & None & Conjunctivitis occurred during stay on ICU for gram negative urosepsis. Conjunctivitis cured \\ \hline 7 & 40/female/t011 & Toe wound & Numerous antibiotics & None & Wound occurred after a visit to Turkey. Wound cured. \\ \hline \end{tabular} \end{table}	PMC4407377_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|} \hline & & \multicolumn{2}{c\|}{\textbf{(50→30) Sequence}} \\ \hline & & \textbf{Forward} & \textbf{Reverse} \\ \hline Anthocyanin & biosynthesis \\ \hline CHS & Chalcone synthase & TGTGCAAAGTTGATTTTATTCGAC & ATGTCAGAAAGGAGGGTCCAATGG \\ \hline CHI & Chalcone isomerase & GAGTGGTTAAGCAGATGACACGAC & AAGAAAATTGACAACATGCAGAAG \\ \hline FHT & Flavanone 3-hydroxylase & TTGCACCTGAAGTAGAATTTTACA & TTCTGACAGAACTTCAAGCAATTT \\ \hline F3050H1 & 30,50-hydroxylase Flavonoid & TCCATTGATTAAAATGAGGGACCA & TATGGTAAGTTGGGGATGTCTGAT \\ \hline ANS & Anthocyanidin synthase & ATGTCAACTTTTTATTGGTCCTAA & GAGCACAGCAAGAACTTTGGTAGC \\ \hline MYB3 & Transcription factor & CAATGCAGCAACATTTACACTACTCCCA & AAGAATCCATGAATGTAGCAGCAGCATC \\ \hline bHLH1 & Transcription factor & AAGGTGATCGTTGTGAAAATGTCT & GGCCGTCTAGTTTGGTGGTTGGTT \\ \hline \multicolumn{2}{c\|}{Flowering time} \\ \hline FT1 & Flowering locus T & CCTCAGGGAATACCTGCACTGTTT & ATCCCTCTAAAGTTTAGGTGTGTTATAAG \\ \hline FT2 & Flowering locus T & TCTTTGACTCTCTTGCTTTCTTGATGA & ACCATCTTTCTACGACCGTTGCAT \\ \hline TFL1 & Terminal flowering 1 & AAGATTATGGATTTGTACTCTTAGTCT & TAACTAATGATAAGATTATGTGAAG \\ \hline W14/15 & Esterase & CTAGTCTCTACCATTTGTCCC & TCTACAAACAATGCACCTGG \\ \hline \end{tabular} \end{table}	PMC3561071_table_4
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variables} & \textbf{Categories} & \multicolumn{3}{c\|}{\textbf{Univariate analysis}} & \multicolumn{3}{c\|}{\textbf{analysisb Multivariate}} \\ \hline & & \textbf{\textbf{HR}} & \textbf{\textbf{95\% CI}} & \textbf{\textbf{valuec P}} & \textbf{\textbf{HR}} & \textbf{\textbf{95\% CI}} & \textbf{\textbf{valuec P}} \\ \hline Training Cohort \\ \hline Age (years) & $\geq$60 / <60 & 2.263 & 1.389-3.687 & 0.001 & 2.770 & 1.691-4.537 & <0.001 \\ \hline Sex & Male / female & 0.878 & 0.596-1.293 & 0.510 \\ \hline Tumor location & Colon / rectum & 1.401 & 0.923-2.125 & 0.113 \\ \hline Tumor size (cm) & $\geq$5 / <5 & 1.114 & 0.753-1.648 & 0.590 \\ \hline Differentiation grade & Poor / well + moderate & 2.626 & 1.761-3.916 & <0.001 & 2.010 & 1.337-3.023 & 0.001 \\ \hline TNM stage & III / I+ II & 2.734 & 1.846-4.048 & <0.001 & 2.402 & 1.603-3.598 & <0.001 \\ \hline expressiona CA7 & Low / high & 2.469 & 1.642-3.717 & <0.001 & 2.247 & 1.481-3.401 & <0.001 \\ \hline Validation Cohort \\ \hline Age (years) & $\geq$60 / <60 & 1.976 & 1.080-3.614 & 0.027 & 2.293 & 1.247-4.217 & 0.008 \\ \hline Sex & Male / female & 0.737 & 0.459-1.183 & 0.207 \\ \hline Tumor location & Colon / rectum & 0.961 & 0.599-1.542 & 0.868 \\ \hline Tumor size (cm) & $\geq$5 / <5 & 0.814 & 0.503-1.317 & 0.403 \\ \hline Differentiation grade & Poor / well + moderate & 1.688 & 1.017-2.803 & 0.043 \\ \hline TNM stage & III / I+ II & 2.828 & 1.734-4.611 & <0.001 & 2.674 & 1.615-4.428 & <0.001 \\ \hline expressiona CA7 & Low / high & 2.632 & 1.520-4.545 & 0.001 & 2.058 & 1.174-3.610 & 0.012 \\ \hline \end{tabular} \end{table}	PMC4406128_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{length (bp)} & \textbf{Sn (\%)} & \textbf{Sp (\%)} & \textbf{time (s)} & \textbf{memory (MB)} \\ \hline Blastz (default) & 5,643,656 & 97.4 & 44.4 & 72 & 348 \\ \hline Blastz (T = 2 C = 2) & 4,035,271 & 95.3 & 60.0 & 22 & 346 \\ \hline AVID & 4,044,527 & 94.7 & 59.3 & 147 & 2297 \\ \hline NUCmer & 1,121,714 & 26.1 & 59.2 & 12 & 90 \\ \hline Cgaln (-X4000) & 4,313,795 & 96.3 & 57.2 & 9 & 167 \\ \hline \end{tabular} \end{table}	PMC2873541_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Primer name} & \textbf{Sequence (5′-3′)} & \textbf{Application} \\ \hline T7 & TAATACGACTCACTATAGG & cDNA cloning \\ \hline SP6 & ATTTAGGTGACACTATAGAA & cDNA cloning \\ \hline 5′SP1 & CCCACAGCACTGAGCCCAATC & Genome walking \\ \hline 5′SP2 & TATTTCCCGGTGATGGACATGA & Genome walking \\ \hline 5′SP3 & GGTAGAAACAGCGAGGGCAACT & Genome walking \\ \hline 3′SP1 & CACCTCCGCCAAGATTGTTATT & Genome walking \\ \hline 3′SP2 & CGCACTTGAAAGAACCATAGCAG & Genome walking \\ \hline 3′SP3 & GCTTTATGAGATTCGTTTGCGTGAT & Genome walking \\ \hline F-R2 & CAGAAGATGTTACAAGACTAAAG & RT-PCR \\ \hline F-S2 & GAGTTGCCCTCGCTGTTTGCTAT & RT-PCR \\ \hline F-R3 & CGTGGTCTTGATGACGATGT & RealTime-PCR \\ \hline F-S3 & TGGCTCAGTGCTGTGGGGT & RealTime-PCR \\ \hline Actin-R & CTCCTGCTTGCTGATCCACATC & RT & RealTime-PCR \\ \hline Actin-S & GCATCCACGAGACCACTTACA & RT & RealTime-PCR \\ \hline \end{tabular} \end{table}	PMC2949604_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Enzyme} & \textbf{Substrate} & \textbf{kcat} \\ \hline TrCel7A & PASC (1 g/L) & 0.44/second \\ \hline TrCel7A core & PASC (1 g/L) & 0.24/second \\ \hline TrCel7A & pNP-lac (0.5 mM) & 0.07/second \\ \hline TrCel7A core & pNP-lac (0.5 mM) & 0.06/second \\ \hline \end{tabular} \end{table}	PMC3257202_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \multirow{2}{}{\textbf{Treatment outcome}} & \multirow{2}{}{\textbf{Intervention group (\%) (n = 2,107)}} & \multirow{2}{*}{\textbf{Control group (\%) (n = 1,984)}} \\ \hline \\ \hline Treatment completed & 911 (43.2) & 694 (35.0) \\ \hline Cured & 695 (33.0) & 708 (35.7) \\ \hline Defaulted & 158 (7.5) & 202 (10.2) \\ \hline Treatment interrupted & 0 (0.0) & 15 (0.8) \\ \hline Treatment failure & 79 (3.8) & 113 (5.7) \\ \hline Multi-drug resistant TB & 1 (0.1) & 3 (0.2) \\ \hline Died & 151 (7.2) & 137 (7.0) \\ \hline Moved/transferred & 107 (5.1) & 99 (5.0) \\ \hline No outcome data available & 5 (0.2) & 13 (0.7) \\ \hline \end{tabular} \end{table}	PMC3680200_table_4
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Experiment Name} & \textbf{Concentration HPRT in ng/μl} & \textbf{Concentration HA in ng/μl} & \textbf{Denaturation CT} & \textbf{Extension CT} \\ \hline 1:0 & 6.25 × 10−7 & 0 & 26.5 & 21.3 \\ \hline 1:1 & 6.25 10−7 × & 6.25 10−7 × & 26.3 & 19.3 \\ \hline 1:2 & 6.25 10−7 × & 12.5 10−7 × & 26.2 & 18.2 \\ \hline 1:10 & 6.25 × 10−7 & 6.25 × 10−6 & 26.3 & 17.9 \\ \hline 1:20 & 6.25 × 10−7 & 12.5 × 10−6 & 24.9 & 15.8 \\ \hline \end{tabular} \end{table}	PMC4515875_table_2
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{Condition} & \textbf{Parameters} \\ \hline Cell temperature (°C) & 60 \\ \hline Gas dew point (°C) & 41 (40\% RH) \\ \hline Gas flow rate (L/min) & 1, 2, 4 \\ \hline \end{tabular} \end{table}	PMC3279239_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Analyte} & \textbf{Dogs (n)} & \textbf{Median (Range)} & \textbf{2.5th Percentile (90\% CI)} & \textbf{97.5th Percentile (90\% CI)} & \textbf{Normality (p)} \\ \hline uNAG/c (U/g) & 17 & 5.74 (2.75–13.396) & ND & ND & 0.003 \\ \hline uRBP/c (μg/g) & 30 & 21.74 (BDL-76.56) & <2.77 (ND) & 82.74 (51.86–132.24) & <0.001 \\ \hline uAlb/c (mg/g) & 30 & 19.30 (2.06–96.65) & 1.82 (1.04–3.27) & 233.72 (143.58–476.58) & 0.001 \\ \hline (mg/g)a uIgG/c & 28 & 1.41 (0.26–23.60) & 0.15 (0.09–0.3) & 9.78 (4.82–20.80) & <0.001 \\ \hline \end{tabular} \end{table}	PMC4504498_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Digoxin-exposed} & \textbf{Person-years} & \textbf{Relapse, number} & \textbf{Hazard ratio (95\% CI)} & \textbf{P-value1} \\ \hline \multirow{2}{}{All} & Yes & 1,872 & 69 & 1.13 (0.88, 1.46) & 0.04 \\ \hline No & 148,034 & 5,037 & 1.0 \\ \hline Estrogen receptor status \\ \hline \multirow{2}{}{Positive} & Yes & 1,524 & 55 & 1.15 (0.87, 1.52) & 0.03 \\ \hline No & 111,485 & 3,456 & 1.0 \\ \hline \multirow{2}{}{Negative} & Yes & 280 & 10 & 0.93 (0.45, 1.90) & 0.94 \\ \hline No & 30,256 & 1,345 & 1.0 \\ \hline \multirow{2}{}{Unknown} & Yes & 67 & 4 & 1.67 (0.49, 5.69) & 0.53 \\ \hline No & 6,293 & 236 & 1.0 \\ \hline treatment2 Digoxin exposure with anti-estrogen \\ \hline \multirow{2}{}{Tamoxifen} & Yes & 353 & 26 & 1.04 (0.68, 1.60) & 0.36 \\ \hline No & 23,742 & 1,431 & 1.0 \\ \hline \multirow{2}{}{Aromatase inhibitors} & Yes & 79 & 4 & 1.87 (0.46, 7.56) & 0.68 \\ \hline No & 2,467 & 87 & 1.0 \\ \hline \multirow{2}{*}{Neither} & Yes & 1,038 & 33 & 1.10 (0.75, 1.61) & 0.49 \\ \hline No & 81,704 & 2,815 & 1.0 \\ \hline \end{tabular} \end{table}	PMC3672748_table_1
\begin{table} \begin{tabular}{\|l\|l\|} \hline \textbf{18–60 Years} & \textbf{> 60 Years} \\ \hline \textbf{Seroconversion rate > 40\%} & \textbf{Seroconversion rate > 30\%} \\ \hline Mean geometric increase > 2.5 & Mean geometric increase > 2.0 \\ \hline Seroprotection rate > 70\% & Seroprotection rate > 60\% \\ \hline \end{tabular} \end{table}	PMC4494249_table_0
\begin{table} \begin{tabular}{\|l\|l\|} \hline F2 Refinement on & Primary atom site location: structure-invariant direct methods \\ \hline Least-squares matrix: full & Secondary atom site location: difference Fourier map \\ \hline R[F2 2σ(F2)] > = 0.046 & Hydrogen site location: inferred from neighbouring sites \\ \hline wR(F2) = 0.128 & H-atom parameters constrained \\ \hline S = 1.03 & 1/[σ2(Fo 2) (0.0568P)2 w = + + 0.3537P] 2 2)/3 where P = (Fo + 2Fc \\ \hline 10300 reflections & (Δ/σ)max = 0.001 \\ \hline 399 parameters & Å−3 Δρmax = 0.43 e \\ \hline 0 restraints & Å−3 Δρmin = −0.28 e \\ \hline \end{tabular} \end{table}	PMC3008119_table_0
\begin{table} \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{Frequency} & \textbf{Percentage} \\ \hline \multicolumn{2}{c\|}{Effect of MMC on the risk of acquiring HIV} \\ \hline No effect & 11 & 2.8 \\ \hline It increases the risk of acquiring HIV & 6 & 1.5 \\ \hline It reduces the risk of acquiring HIV & 375 & 95.2 \\ \hline Other & 1 & 0.3 \\ \hline Missing & 1 & 0.3 \\ \hline \multicolumn{2}{c\|}{Whether risky sexual behaviour can remove} & circumcision \\ \hline Yes & 340 & 86.3 \\ \hline No & 35 & 8.9 \\ \hline Unsure & 18 & 4.6 \\ \hline Missing & 1 & 0.3 \\ \hline \multicolumn{2}{c\|}{Whether male circumcision protects women} & with HIV \\ \hline Yes & 34 & 8.7 \\ \hline No & 347 & 94.9 \\ \hline Unsure & 11 & 11.0 \\ \hline Missing & 2 & 0.5 \\ \hline \end{tabular} \end{table}	PMC4564906_table_2
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Variables} & \multicolumn{2}{c\|}{\textbf{Sense of contribution to society}} & \multicolumn{2}{c\|}{\textbf{Sense of bonding with work\textbf{\textbf{p}}lace}} \\ \hline & \textbf{\textbf{Value}} & \textbf{\textbf{p}} & \textbf{\textbf{Value}} & \textbf{\textbf{p}} \\ \hline \textbf{Sense of bonding with work\textbf{\textbf{p}}lace} & 0.47 & < 0.01 & - & - \\ \hline Sociodemogra\textbf{\textbf{p}}hic characteristics \\ \hline Sex* & 6.36 & 0.10 & 6.04 & 0.11 \\ \hline Age grou\textbf{\textbf{p}} & 0.11 & < 0.01 & 0.09 & < 0.01 \\ \hline Job \textbf{\textbf{p}}osition* & 16.0 & < 0.01 & 30.1 & < 0.01 \\ \hline De\textbf{\textbf{p}}artment* & 6.68 & 0.35 & 3.45 & < 0.01 \\ \hline Job stress factor \\ \hline Su\textbf{\textbf{p}}\textbf{\textbf{p}}ort from su\textbf{\textbf{p}}ervisors & 0.19 & < 0.01 & 0.30 & < 0.01 \\ \hline Su\textbf{\textbf{p}}\textbf{\textbf{p}}ort from co-workers & 0.22 & < 0.01 & 0.28 & < 0.01 \\ \hline Su\textbf{\textbf{p}}\textbf{\textbf{p}}ort from family & 0.14 & < 0.01 & 0.18 & < 0.01 \\ \hline Quantitative workload & 0.07 & 0.02 & 0.04 & 0.19 \\ \hline Qualitative workload & 0.12 & < 0.01 & 0.07 & 0.05 \\ \hline Job control latitude & 0.23 & < 0.01 & 0.23 & < 0.01 \\ \hline \end{tabular} \end{table}	PMC3369557_table_1
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{c\|}{\textbf{DSI vs. DSU}} & \multicolumn{2}{c\|}{\textbf{L1I vs. L1U}} & \multicolumn{2}{c\|}{\textbf{B713I vs. B713U}} \\ \hline \textbf{Families} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}} & \textbf{\textbf{\textbf{Up}}} & \textbf{\textbf{\textbf{Down}}} & \textbf{Total} \\ \hline MYB & 19 & 5 & 7 & 13 & 3 & 6 & 48 \\ \hline ERF & 13 & 6 & 6 & 10 & 6 & 5 & 44 \\ \hline WRKY & 10 & 3 & 10 & 9 & 2 & 1 & 29 \\ \hline HSF & 5 & 2 & 2 & 3 & 2 & 3 & 14 \\ \hline GRAS & 6 & 2 & 4 & 1 & 0 & 2 & 11 \\ \hline BZIP & 4 & 2 & 3 & 0 & 2 & 0 & 10 \\ \hline NAC & 0 & 1 & 1 & 2 & 1 & 2 & 7 \\ \hline \end{tabular} \end{table}	PMC4646469_table_6
\begin{table} \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Bangladesh Sera} & \textbf{\% Sensitivity} & \textbf{\textbf{95\% Confidence Interval}} & \textbf{\% Specificity} & \textbf{\textbf{95\% Confidence Interval}} \\ \hline K28-LF* & 98.1 & 89.93–99.95\% & 92.5 & 79.61–98.43\% \\ \hline Kalazar Detect* & 88.7 & 76.97–95.73\% & 100 & 91.19–100.0\% \\ \hline No. of Sera Tested & 53 & & 40 \\ \hline \end{tabular} \end{table}	PMC2939046_table_2
\begin{table} \begin{tabular}{\|l\|l\|} \hline \multicolumn{2}{c\|}{\textbf{Determine which impacts to marine mammals need to be monitored:}} \\ \hline \textbf{The energy resource is} \\ \hline Wind & Go to A \\ \hline Tidal & Go to B \\ \hline Waves & Go to C \\ \hline (A) The stage of the wind energy project is \\ \hline Construction & W1, W2, W3, W4, W5 \\ \hline Operation & W1, W2, W3, W4, W5 \\ \hline Decommissioning & W1, W2, W3, W4, W5 \\ \hline (B) The stage of the tidal energy project is \\ \hline Construction & W1, W2, W3, W4, W5 \\ \hline Operation & W1, W2, W3, W4, W5 \\ \hline Decommissioning & W1, W2, W3, W4, W5 \\ \hline (C) The stage of the wave energy project is \\ \hline Construction & W1, W2, W3, W4, W5 \\ \hline Operation & W1, W2, W3, W4, W5 \\ \hline Decommissioning & W1, W2, W3, W4, W5 \\ \hline \end{tabular} \end{table}	PMC3540755_table_4