chunk_id
string | chunk
string |
|---|---|
9a5e6cd28aad9b3982063052a853dbb2_12 | The viral load of RV positive samples were quantified by qRT-PCR as described in the manuscript published by Lu and coworkers [10] . The Eurogentec One-Step Reverse Transcriptase qPCR kit was used for preparation of the master mix as described above. The primerset |
9a5e6cd28aad9b3982063052a853dbb2_13 | HRSV-AF F 669-695 ctgtgatagarttccaacaaaagaaca [8, 9] HRSV-AF F 718-745 agttacacctgcattaacactaaattcc [8, 9] HRSV-BN N 435-458 ggctccagaatataggcatgattc [8, 9] HRSV-BN N 480-508 tggttattacaagaagagcagctatacacagt [8, 9] MGB probes and probe, located in 5'UTR, were added to a final concentration of 1 μM and 0.1 μM, respectively. cRNA standards were constructed based on the PCR product of sample 1 using the MegaScript kit (Ambion, Austin, TX, USA). Quantification was performed with a spectrophotometer at 260 nm and converted to the molecule number [11] . Tenfold serial dilutions, allowing detection in a range of 8.6 × 10 6 to 8.6 × 10 2 RNA copies were used. The RT-PCR assays were carried out on a ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). An initial reverse transcription step was performed at 48°C for 30 min, followed by a denaturation step at 95°C for 10 min. Finally, an amplification step of 45 cycli at 95°C for 15 sec and 1 min at 60°C was |
9a5e6cd28aad9b3982063052a853dbb2_14 | completed. (37.5%) men, with a median age of 29 (range 9 -46 years). Age and gender was missing for 2 participants of the second group. In total, 52% of the participants were between 20-30 years old. Only 6% were younger than 20 years old and 3% were older than 70 years. In totality, 80 patients (78.4%) were already feeling ill for 1 to 7 days at the day the sample was obtained. Seven volunteers (6.8%) were symptomatic for 8 to 14 days and 9 participants (8.8%) were already ill for more than 14 days at the day of sample collection. Data on the duration of symptoms was lacking for 6 patients. Almost all volunteers experienced at least 2 symptoms except for two patients (Table 1) . Forty-seven (46.1%) volunteers complained about a constant runny or stuffy nose, 43 (42.2%) had frequent sneezing events and 38 (37.3%) participants had a serious sore throat (Table 1) . |
9a5e6cd28aad9b3982063052a853dbb2_15 | In a first part of the study, we collected 70 EBCs. Screening of the EBCs for 14 respiratory viruses (Table 2) , showed 5 RV (7.1%) positive samples (Table 3 ). In a second part, we collected 32 EBCs from patients that presented themselves to their general practitioner. Two of these EBCs were positive for one of the 14 investigated respiratory viruses, 1 for RV and 1 for InfB. To inspect the detection rate of respiratory viruses in the condensate, a NS was taken from this second group of volunteers for comparison. In 15 out of 32 NS (46.8%), one or more viral pathogens were isolated. Viral screening of the NS resulted in the detection of RV, InfA (subtype H1N1) and HRSV-B. Quantification of the HRSV-B viral load demonstrated for samples 72 and 101 viral titers of 8.0 × 10 4 RNA copies/ml and 6.8 × 10 7 RNA copies/ml respectively. The RV RT-PCR assay did not allow the quantification of all samples that tested positive for RV by PCR ( Table 3) . Presence of the same pathogen in both the |
9a5e6cd28aad9b3982063052a853dbb2_16 | EBC and the NS was confirmed for only 1 sample: sample 71, which tested positive for RV in both the EBC and the NS. For sample 81, RV was detected in the NS and analysis of the EBC demonstrated an InfB infection. |
9a5e6cd28aad9b3982063052a853dbb2_17 | For EBC samples that were collected in the fall and winter of 2009/2010, measurements with the ECoVent in (Table 3 , sample 81) was positive for InfB when using the RTube™ in combination with the EcoVent. In theory, the viral generation rate (number of viral RNA copies exhaled per minute) can be predicted by quantification of the exhaled viral load. Then, an estimation of the RNA copies per litre exhaled air or per minute can be calculated. Quantification of the exhaled InfB would allow us to predict the generation rate for this virus. Due to insufficient sample volume, we could not determine the number of RNA copies in the sample. |
9a5e6cd28aad9b3982063052a853dbb2_18 | Collection of exhaled breath condensates is a novel and non-invasive method for obtaining samples of the upper respiratory tract. The collection of EBC is easy to perform and can be conducted in a home environment. This method is much more agreeable for the patient when compared to the unpleasant and invasive collection of nasal swabs, BAL, aspirates, etc. This aspect renders the method very attractive for routine laboratory diagnostics of viral infections. Most studies that perform breath analyses for viral detection use modified face masks, with a removable central region in electret or a removable Teflon filter on which exhaled particles impact [12] [13] [14] . With the RTube™ collection device, aerosolized particles of the airway lining fluid are precipitated into a condensate when the breath is cooled which serves as an immediate starting point for molecular testing. |
9a5e6cd28aad9b3982063052a853dbb2_19 | Until now, this is the study with the largest subset of volunteers that investigated EBC as a specimen for the detection of respiratory viruses. Previous studies reported the inclusion of a limited subset of participants and investigated the presence of a limited number of viruses in the breath samples. The study performed by Fabian and colleagues, included 12 volunteers [12] . Huynh and co-workers recruited 9 volunteers for exhaled breath sampling [13] . In the study by Stelzer-Braid et al., 50 EBCs were analysed [14] and St-George et al. report the participation of 12 adults [15] . These studies have focused on the detection of InfA and -B, PIV1-3, HRSV and HMPV, while we have screened the samples for a panel of 14 commonly circulating respiratory viruses. Based on the analysis of 99 EBCs (3 EBCs were excluded), our results support the exhalation of RV and InfB in 7% of our samples. Since many of the volunteers had already been experiencing symptoms for 1 to 7 days, we initially |
9a5e6cd28aad9b3982063052a853dbb2_20 | presumed that they were already recovering from the infection and were no longer exhaling the virus. For common cold infections it is suggested that a person may already be infectious for 1 or 2 days before experiencing any symptoms. However, in a second part of our study we started collecting EBCs in parallel with nasal swabs from patients presenting themselves to their medical doctor, 1 to 3 days after onset of symptoms. Only for 1 condensate the same pathogen was detected in both the EBC and the NS. The detection rate for respiratory viral pathogens in the NS was 46.8% which is much higher than the 7% detection rate in the EBCs. The low detection of virus positive condensates can therefore not be attributed to the fact that volunteers were no longer infectious. The discrepant detection rate between samples may also be explained by different severity of respiratory infection, since comparator samples were of different parts of the respiratory tract. Patients that delivered a |
9a5e6cd28aad9b3982063052a853dbb2_21 | positive NS may have possibly suffered from an upper airway infection whereas EBC positive volunteers may have experienced a more advanced, lower respiratory tract infection. However, the effect of nasal inhalation on EBC collection, guiding formed particles in the upper respiratory tract to the lower compartments, in stead of oral inhalation was not investigated. Patients with positive EBC samples were experiencing symptoms for maximum two days at the time of collection. However, this was not different for 7 patients with positive NS. Six patients that provided positive NS were experiencing symptoms for a longer period at the time of collection (Table 3 ). In the group of volunteers that provided an EBC negative or EBC and NS negative sample, the manifestation of symptoms were reported ranging from 1 day to more than two weeks. When reported symptoms were compared between EBC positive patients (7) and NS positive patients (15) , 27% and 33% in the positive NS group experienced |
9a5e6cd28aad9b3982063052a853dbb2_22 | shivering and muscle pain whereas this symptom was not indicated by any patient of the EBC positive group. In all groups fever, headache, watering eyes, stuffed nose, frequent sneezing, sore throat and coughing were reported. |
9a5e6cd28aad9b3982063052a853dbb2_23 | Volunteers were not diagnosed with other pathogens before participation in the study. Since we did not test these samples for other than viral pathogens, we can not exclude the possibility that some of the negative NS are positive for bacteria or other pathogens causing respiratory illness. Recently, one study reported a detection rate of 5% for influenza in EBC [15] . This is in the same range of the detection rate that we report for respiratory viruses in general. Other studies with a limited number of patients, describe a markedly higher sensitivity of 33 to 36% [12] [13] [14] but the higher percentage may be due to the low number of participants subjects were included [12] . Remarkably, the studies reporting this higher detection rate used collections masks, while the study using the RTube™ reported comparable findings. Face masks consist of electret which trap viruses based on permanently charged fibres [13] . In addition, the Teflon filter has 2 μm pores which will retain all |
9a5e6cd28aad9b3982063052a853dbb2_24 | larger particles. Possibly, the lower detection rate can partly be explained by the fact that the RTube™ is manufactured in polypropylene and does not possess a virus attracting and filtering feature like the aforementioned materials. |
9a5e6cd28aad9b3982063052a853dbb2_25 | The qRT-PCR developed by Lu and coworkers for the detection of RV, did not allow the assessment of the viral load present in the EBC samples [10] . Also for 4 NS, the viral titer remained undetermined, probably due to the limited sensitivity of the assay. For diagnosis, more sensitive methods might be necessary to detect respiratory viruses present in EBC since it is unpredictable how diluted the viral particles in the specimen are. Recently, nested qRT-PCR assays have been developed to allow a more sensitive detection of viruses in aerosols [16] . |
9a5e6cd28aad9b3982063052a853dbb2_26 | Also person-dependent factors, such as the number of particles produced, the exhaled volume and the age of the patient, have been suggested to play an important role for exhalation of viral particles. The participants that were recruited in the study of Fabian and coworkers were 12 years of age and older [12] . For hospitalized children a much higher rate of virus positive samples is reported [14] . In our study, the majority of volunteers were between 20 and 30 years old. Only two children less than 10 years and 3 elderly people (> 70 years) were included. One of the children tested positive for InfA in the NS, but the infection was not confirmed in the EBC. |
9a5e6cd28aad9b3982063052a853dbb2_27 | For influenza, an exhaled generation rate of <3.2 to 20 influenza RNA copies per minute was predicted by quantifying the virus aerosols that impacted on a removable Teflon filter of a collection mask [12] . We used the RTube™ in combination with the ECoVent, that allowed the registration of additional ventilation parameters such as breathing frequency and exhaled volume. In this way, when the number of RNA copies in the EBC is quantified, the amount of viral particles that are exhaled per litre or per minute can be estimated. Unfortunately, we were not able to predict a virus generation rate for InfB since viral load remained undetermined. |
9a5e6cd28aad9b3982063052a853dbb2_28 | Although an inventive, new and promising method, EBC collected by the RTube™ does not appear to be appropriate for diagnosis of respiratory infections. Nonetheless, this method may provide an alternative for current sample procurement for epidemiological studies of circulating viruses. This technique also confirms the observation that viruses are able to disseminate through normal breathing, particularly RV. |
9a5e6cd28aad9b3982063052a853dbb2_29 | In addition, EBC collection from patients during respiratory infections may be further investigated for biomarker patterns. In calves that were experimentally infected with bovine RSV, an increase in leukotriene B 4 , indicating oxidative stress, was observed. This increased level was also associated with the development of bronchial hyperresponsiveness [17] . In humans, a transiently elevated H 2 O 2 level was observed during common cold infection. This marker returned to baseline values when volunteers recovered from infection. H 2 O 2 has also been recognized as an interesting marker in asthma, where it is associated with chronic lower airway inflammation [18] . In InfA infected volunteers, an increased CO level was observed during upper respiratory infection. This observation might imply that CO is an indicator of airway inflammation or represents one of the host defence mechanisms against viral infection [19] . Therefore, a better identification of the biomarker signature in |
9a5e6cd28aad9b3982063052a853dbb2_30 | condensates of individuals experiencing a viral infection might imply interesting findings towards the identification of markers reflecting inflammation or antiviral protection. This may contribute to the biomarker profiles established for diseases like asthma and COPD, for which viral infections are suggested to trigger or exacerbate symptoms [20] . |
9cac61f0d3c65a74ddd079765b2d8769_0 | Community-acquired pneumonia in children — a changing spectrum of disease
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5608782/
SHA: eecb946b106a94f26a79a964f0160e8e16f79f42
Authors: le Roux, David M.; Zar, Heather J.
Date: 2017-09-21
DOI: 10.1007/s00247-017-3827-8
License: cc-by |
9cac61f0d3c65a74ddd079765b2d8769_1 | Abstract: Pneumonia remains the leading cause of death in children outside the neonatal period, despite advances in prevention and management. Over the last 20 years, there has been a substantial decrease in the incidence of childhood pneumonia and pneumonia-associated mortality. New conjugate vaccines against Haemophilus influenzae type b and Streptococcus pneumoniae have contributed to decreases in radiologic, clinical and complicated pneumonia cases and have reduced hospitalization and mortality. The importance of co-infections with multiple pathogens and the predominance of viral-associated disease are emerging. Better access to effective preventative and management strategies is needed in low- and middle-income countries, while new strategies are needed to address the residual burden of disease once these have been implemented. |
9cac61f0d3c65a74ddd079765b2d8769_2 | Text: Pneumonia has been the leading cause of death in children younger than 5 years for decades. Although there have been substantial decreases in overall child mortality and in pneumonia-specific mortality, pneumonia remains the major single cause of death in children outside the neonatal period, causing approximately 900,000 of the estimated 6.3 million child deaths in 2013 [1] . Substantial advances have occurred in the understanding of risk factors and etiology of pneumonia, in development of standardized case definitions, and in prevention with the production of improved vaccines and in treatment. Such advances have led to changes in the epidemiology, etiology and mortality from childhood pneumonia. However in many areas access to these interventions remains sub-optimal, with large inequities between and within countries and regions. In this paper we review the impact of recent preventative and management advances in pneumonia epidemiology, etiology, radiologic presentation and |
9cac61f0d3c65a74ddd079765b2d8769_3 | outcome in children. |
9cac61f0d3c65a74ddd079765b2d8769_4 | The overall burden of childhood pneumonia has been reduced substantially over the last decade, despite an increase in the global childhood population from 605 million in 2000 to 664 million in 2015 [2] . Recent data suggest that there has been a 25% decrease in the incidence of pneumonia, from 0.29 episodes per child year in low-and middle-income countries in 2000, to 0.22 episodes per child year in 2010 [3] . This is substantiated by a 58% decrease in pneumonia-associated disability-adjusted life years between 1990 and 2013, from 186 million to 78 million as estimated in the Global Burden of Disease study [1] . Pneumonia deaths decreased from 1.8 million in 2000 to 900,000 in 2013 [1] . These data do not reflect the full impact of increasingly widespread use of pneumococcal conjugate vaccine in low-and middle-income countries because the incidence of pneumonia and number of deaths are likely to decrease still further as a result of this widespread intervention [4] . |
9cac61f0d3c65a74ddd079765b2d8769_5 | Notwithstanding this progress, there remains a disproportionate burden of disease in low-and middle-income countries, where more than 90% of pneumonia cases and deaths occur. The incidence in high-income countries is estimated at 0.015 episodes per child year, compared to 0.22 episodes per child year in low-and middle-income countries [3] . On average, 1 in 66 children in high-income countries is affected by pneumonia per year, compared to 1 in 5 children in low-and middle-income countries. Even within low-and middleincome countries there are regional inequities and challenges with access to health care services: up to 81% of severe pneumonia deaths occur outside a hospital [5] . In addition to a higher incidence of pneumonia, the case fatality rate is estimated to be almost 10-fold higher in low-and middle-income countries as compared to high-income countries [3, 5] . |
9cac61f0d3c65a74ddd079765b2d8769_6 | Childhood pneumonia can also lead to significant morbidity and chronic disease. Early life pneumonia can impair longterm lung health by decreasing lung function [6] . Severe or recurrent pneumonia can have a worse effect on lung function; increasing evidence suggests that chronic obstructive pulmonary disease might be related to early childhood pneumonia [7, 8] . A meta-analysis of the risk of long-term outcomes after childhood pneumonia categorized chronic respiratory sequelae into major (restrictive lung disease, obstructive lung disease, bronchiectasis) and minor (chronic bronchitis, asthma, abnormal pulmonary function) groups [9] . The risk of developing at least one of the major sequelae was estimated as 6% after an ambulatory pneumonia event and 14% after an episode of hospitalized pneumonia. Because respiratory diseases affect almost 1 billion people globally and are a major cause of mortality and morbidity [10] , childhood pneumonia might contribute to substantial morbidity |
9cac61f0d3c65a74ddd079765b2d8769_7 | across the life course. |
9cac61f0d3c65a74ddd079765b2d8769_8 | Chest radiologic changes have been considered the gold standard for defining a pneumonia event [11] because clinical findings can be subjective and clinical definitions of pneumonia can be nonspecific. In 2005, to aid in defining outcomes of pneumococcal vaccine studies, the World Health Organization's (WHO) standardized chest radiograph description defined a group of children who were considered most likely to have pneumococcal pneumonia [12] . The term "end-point consolidation" was described as a dense or fluffy opacity that occupies a portion or whole of a lobe, or the entire lung. "Other infiltrate" included linear and patchy densities, peribronchial thickening, minor patchy infiltrates that are not of sufficient magnitude to constitute primary end-point consolidation, and small areas of atelectasis that in children can be difficult to distinguish from consolidation. "Primary end-point pneumonia" included either end-point consolidation or a pleural effusion associated with a |
9cac61f0d3c65a74ddd079765b2d8769_9 | pulmonary parenchymal infiltrate (including "other" infiltrate). |
9cac61f0d3c65a74ddd079765b2d8769_10 | Widespread use of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination has decreased the incidence of radiologic pneumonia. In a review of four randomized controlled trials and two case-control studies of Haemophilus influenzae type B conjugate vaccination in high-burden communities, the vaccination was associated with an 18% decrease in radiologic pneumonia [13] . Introduction of pneumococcal conjugate vaccination was associated with a 26% decrease in radiologic pneumonia in California between 1995 and 1998 [14] . In vaccine efficacy trials in low-and middle-income countries, pneumococcal conjugate vaccination reduced radiologic pneumonia by 37% in the Gambia [15] , 25% in South Africa [16] and 26% in the Philippines [17] . |
9cac61f0d3c65a74ddd079765b2d8769_11 | The WHO radiologic case definition was not intended to distinguish bacterial from viral etiology but rather to define a sub-set of pneumonia cases in which pneumococcal infection was considered more likely and to provide a set of standardized definitions through which researchers could achieve broad agreement in reporting chest radiographs. However, despite widespread field utilization, there are concerns regarding inter-observer repeatability. There has been good consensus for the description of lobar consolidation but significant disagreement on the description of patchy and perihilar infiltrates [18, 19] . In addition, many children with clinically severe lung disease do not have primary end-point pneumonia: in one pre-pneumococcal conjugate vaccination study, only 34% of children hospitalized with pneumonia had primary end-point pneumonia [20] . A revised case definition of "presumed bacterial pneumonia" has been introduced, and this definition includes pneumonia cases with |
9cac61f0d3c65a74ddd079765b2d8769_12 | WHO-defined alveolar consolidation, as well as those with other abnormal chest radiograph infiltrates and a serum C-reactive protein of at least 40 mg/L [21, 22] . This definition has been shown to have greater sensitivity than the original WHO radiologic definition of primary end-point pneumonia for detecting the burden of pneumonia prevented by pneumococcal conjugate vaccination [23] . Using the revised definition, the 10-valent pneumococcal conjugate vaccine (pneumococcal conjugate vaccination-10), had a vaccine efficacy of 22% in preventing presumed bacterial pneumonia in young children in South America [22] , and pneumococcal conjugate vaccination-13 had a vaccine efficacy of 39% in preventing presumed bacterial pneumonia in children older than 16 weeks who were not infected with human immunodeficiency virus (HIV) in South Africa [21] . Thus there is convincing evidence that pneumococcal conjugate vaccination decreases the incidence of radiologic pneumonia; however there is no |
9cac61f0d3c65a74ddd079765b2d8769_13 | evidence to suggest that pneumococcal conjugate vaccination modifies the radiologic appearance of pneumococcal pneumonia. |
9cac61f0d3c65a74ddd079765b2d8769_14 | Empyema is a rare complication of pneumonia. An increased incidence of empyema in children was noted in some high-income countries following pneumococcal conjugate vaccination-7 introduction, and this was attributed to pneumococcal serotypes not included in pneumococcal conjugate vaccination-7, especially 3 and 19A [24] . In the United States, evidence from a national hospital database suggests that the incidence of empyema increased 1.9-fold between 1996 and 2008 [25] . In Australia, the incidence rate ratio increased by 1.4 times when comparing the pre-pneumococcal conjugate vaccination-7 period (1998 to 2004) to the post-pneumococcal conjugate vaccination-7 period (2005 to 2010) [26] . In Scotland, incidence of empyema in children rose from 6.5 per million between 1981 and 1998, to 66 per million in 2005 [27] . These trends have been reversed since the introduction of pneumococcal conjugate vaccination-13. Data from the United States suggest that empyema decreased by 50% in |
9cac61f0d3c65a74ddd079765b2d8769_15 | children younger than 5 years [28] ; similarly, data from the United Kingdom and Scotland showed substantial reduction in pediatric empyema following pneumococcal conjugate vaccination-13 introduction [29, 30] . |
9cac61f0d3c65a74ddd079765b2d8769_16 | Several national guidelines from high-income countries, as well as the WHO recommendations for low-and middleincome countries, recommend that chest radiography should not be routinely performed in children with ambulatory pneumonia [31] [32] [33] . Indications for chest radiography include hospitalization, severe hypoxemia or respiratory distress, failed initial antibiotic therapy, or suspicion for other diseases (tuberculosis, inhaled foreign body) or complications. However, point-of-care lung ultrasound is emerging as a promising modality for diagnosing childhood pneumonia [34] . |
9cac61f0d3c65a74ddd079765b2d8769_17 | In addition to the effect on radiologic pneumonia, pneumococcal conjugate vaccination reduces the risk of hospitalization from viral-associated pneumonia, probably by reducing bacterial-viral co-infections resulting in severe disease and hospitalization [35] . An analysis of ecological and observational studies of pneumonia incidence in different age groups soon after introduction of pneumococcal conjugate vaccination-7 in Canada, Italy, Australia, Poland and the United States showed decreases in all-cause pneumonia hospitalizations ranging from 15% to 65% [36] . In the United States after pneumococcal conjugate vaccination-13 replaced pneumococcal conjugate vaccination-7, there was a further 17% decrease in hospitalizations for pneumonia among children eligible for the vaccination, and a further 12% decrease among unvaccinated adults [28] . |
9cac61f0d3c65a74ddd079765b2d8769_18 | A systematic review of etiology studies prior to availability of new conjugate vaccines confirmed S. pneumoniae and H. influenzae type B as the most important bacterial causes of pneumonia, with Staphylococcus aureus and Klebsiella pneumoniae associated with some severe cases. Respiratory syncytial virus was the leading viral cause, identified in 15-40% of pneumonia cases, followed by influenza A and B, parainfluenza, human metapneumovirus and adenovirus [37] . |
9cac61f0d3c65a74ddd079765b2d8769_19 | More recent meta-analyses of etiology data suggest a changing pathogen profile, with increasing recognition that clinical pneumonia is caused by the sequential or concurrent interaction of more than one organism. Severe disease in particular is often caused by multiple pathogens. With high coverage of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination, viral pathogens increasingly predominate [38] . In recent case-control studies, at least one virus was detected in 87% of clinical pneumonia cases in South Africa [39] , while viruses were detected in 81% of radiologic pneumonia cases in Sweden [40] . In a large multi-center study in the United States, viral pathogens were detected in 73% of children hospitalized with radiologic pneumonia, while bacteria were detected in only 15% of cases [41] . A meta-analysis of 23 case-control studies of viral etiology in radiologically confirmed pneumonia in children, completed up to 2014, reported good |
9cac61f0d3c65a74ddd079765b2d8769_20 | evidence of causal attribution for respiratory syncytial virus, influenza, metapneumovirus and parainfluenza virus [42] . However there was no consistent evidence that many other commonly described viruses, including rhinovirus, adenovirus, bocavirus and coronavirus, were more commonly isolated from cases than from controls. Further attribution of bacterial etiology is difficult because it is often not possible to distinguish colonizing from pathogenic bacteria when they are isolated from nasal specimens [43] . |
9cac61f0d3c65a74ddd079765b2d8769_21 | Another etiology is pertussis. In the last decade there has also been a resurgence in pertussis cases, especially in highincome countries [44] . Because pertussis immunity after acellular pertussis vaccination is less long-lasting than immunity after wild-type infection or whole-cell vaccination, many women of child-bearing age have waning pertussis antibody levels. Their infants might therefore be born with low transplacental anti-pertussis immunoglobulin G levels, making them susceptible to pertussis infection before completion of the primary vaccination series [45] . In 2014, more than 40,000 pertussis cases were reported to the Centers for Disease Control and Prevention in the United States; in some states, population-based incidence rates are higher than at any time in the last 70 years [44] . In contrast, most low-and middleincome countries use whole-cell pertussis vaccines and the numbers of pertussis cases in those countries were stable or decreasing until 2015 [46] . However |
9cac61f0d3c65a74ddd079765b2d8769_22 | recent evidence from South Africa (where the acellular vaccine is used) shows an appreciable incidence of pertussis among infants presenting with acute pneumonia: 2% of clinical pneumonia cases among infants enrolled in a birth cohort were caused by pertussis [39] , and 3.7% of infants and young children presenting to a tertiary academic hospital had evidence of pertussis infection [47] . |
9cac61f0d3c65a74ddd079765b2d8769_23 | Similarly, childhood tuberculosis is a major cause of morbidity and mortality in many low-and middle-income countries, and Mycobacterium tuberculosis has increasingly been recognized as a pathogen in acute pneumonia in children living in high tuberculosis-prevalence settings. Postmortem studies of children dying from acute respiratory illness have commonly reported M. tuberculosis [48, 49] . A recent systematic review of tuberculosis as a comorbidity of childhood pneumonia reported culture-confirmed disease in about 8% of cases [50] . Because intrathoracic tuberculosis disease is only culture-confirmed in a minority of cases, the true burden could be even higher; tuberculosis could therefore be an important contributor to childhood pneumonia incidence and mortality in high-prevalence areas. |
9cac61f0d3c65a74ddd079765b2d8769_24 | Childhood pneumonia and clinically severe disease result from a complex interaction of host and environmental risk factors [37] . Because of the effectiveness of pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination for prevention of radiologic and clinical pneumonia, incomplete or inadequate vaccination must be considered as a major preventable risk factor for childhood pneumonia. Other risk factors include low birth weight, which is associated with 3.2 times increased odds of severe pneumonia in low-and middle-income countries, and 1.8 times increased odds in high-income countries [51] . Similarly, lack of exclusive breastfeeding for the first 4 months of life increases odds of severe pneumonia by 2.7 times in low-and middle-income countries and 1.3 times in highincome countries. Markers of undernutrition are strong risk factors for pneumonia in low-and middle-income countries only, with highly significant odds ratios for underweight for age |
9cac61f0d3c65a74ddd079765b2d8769_25 | (4.5), stunting (2.6) and wasting (2.8) . Household crowding has uniform risk, with odds ratios between 1.9 and 2.3 in both low-and middle-income countries and high-income countries. Indoor air pollution from use of solid or biomass fuels increases odds of pneumonia by 1.6 times; lack of measles vaccination by the end of the first year of age increases odds of pneumonia by 1.8 times [51] . It is estimated that the prevalence of these critical risk factors in low-and middle-income countries decreased by 25% between 2000 and 2010, contributing to reductions in pneumonia incidence and mortality in low-and middle-income countries, even in countries where conjugate vaccines have not been available [3] . |
9cac61f0d3c65a74ddd079765b2d8769_26 | The single strongest risk factor for pneumonia is HIV infection, which is especially prevalent in children in sub-Saharan Africa. HIV-infected children have 6 times increased odds of developing severe pneumonia or of death compared to HIV-uninfected children [52] . Since the effective prevention of mother-to-child transmission of HIV, there is a growing population of HIV-exposed children who are uninfected; their excess risk of pneumonia, compared to HIV unexposed children, has been described as 1.3-to 3.4-fold higher [53] [54] [55] [56] [57] . |
9cac61f0d3c65a74ddd079765b2d8769_27 | The pneumococcal conjugate vaccination and Haemophilus influenzae type B conjugate vaccination have been effective tools to decrease pneumonia incidence, severity and mortality [58, 59] . However, equitable coverage and access to vaccines remains sub-optimal. By the end of 2015, Haemophilus influenzae type B conjugate vaccination had been introduced in 73 countries, with global coverage estimated at 68%. However, inequities are still apparent among regions: in the Americas coverage is estimated at 90%, while in the Western Pacific it is only 25%. By 2015, pneumococcal conjugate vaccination had been introduced into 54 countries, with global coverage of 35% for three doses of pneumococcal conjugate vaccination for infant populations [60] . To address this issue, the WHO's Global Vaccine Access Plan initiative was launched to make life-saving vaccines more equitably available. In addition to securing guarantees for financing of vaccines, the program objectives include building political |
9cac61f0d3c65a74ddd079765b2d8769_28 | will in low-and middle-income countries to commit to immunization as a priority, social marketing to individuals and communities, strengthening health systems and promoting relevant local research and development innovations [61] . |
9cac61f0d3c65a74ddd079765b2d8769_29 | Maternal vaccination to prevent disease in the youngest infants has been shown to be effective for tetanus, influenza and pertussis [62] . Influenza vaccination during pregnancy is safe, provides reasonable maternal protection against influenza, and also protects infants for a limited period from confirmed influenza infection (vaccine efficacy 63% in Bangladesh [63] and 50.4% in South Africa [64] ). However as antibody levels drop sharply after birth, infant protection does not persist much beyond 8 weeks [65] . Recently respiratory syncytial virus vaccination in pregnancy has been shown to be safe and immunogenic, and a phase-3 clinical trial of efficacy at preventing respiratory syncytial virus disease in infants is under way [66] . Within a decade, respiratory syncytial virus in infancy might be vaccine-preventable, with further decreases in pneumonia incidence, morbidity and mortality [67] . |
9cac61f0d3c65a74ddd079765b2d8769_30 | Improved access to health care, better nutrition and improved living conditions might contribute to further decreases in childhood pneumonia burden. The WHO Integrated Global Action Plan for diarrhea and pneumonia highlights many opportunities to protect, prevent and treat children [68] . Breastfeeding rates can be improved by programs that combine education and counseling interventions in homes, communities and health facilities, and by promotion of baby-friendly hospitals [69] . Improved home ventilation, cleaner cooking fuels and reduction in exposure to cigarette smoke are essential interventions to reduce the incidence and severity of pneumonia [70, 71] . Prevention of pediatric HIV is possible by providing interventions to prevent mother-to-child transmission [72] . Early infant HIV testing and early initiation of antiretroviral therapy and cotrimoxazole prophylaxis can substantially reduce the incidence of community-acquired pneumonia among HIV-infected children [73] . |
9cac61f0d3c65a74ddd079765b2d8769_31 | Community-based interventions reduce pneumonia mortality and have the indirect effect of improved-careseeking behavior [58] . If these cost-effective interventions were scaled up, it is estimated that 67% of pneumonia deaths in lowand middle-income countries could be prevented by 2025 [58] . |
9cac61f0d3c65a74ddd079765b2d8769_32 | Case management of pneumonia is a strategy by which severity of disease is classified as severe or non-severe. All children receive early, appropriate oral antibiotics, and severe cases are referred for parenteral antibiotics. When implemented in highburden areas before the availability of conjugate vaccines, case management as part of Integrated Management of Childhood Illness was associated with a 27% decrease in overall child mortality, and 42% decrease in pneumonia-specific mortality [74] . However the predominance of viral causes of pneumonia and low case fatality have prompted concern about overuse of antibiotics. Several randomized controlled trials comparing oral antibiotics to placebo for non-severe pneumonia have been performed [75] [76] [77] and others are ongoing [78] . In two studies, performed in Denmark and in India, outcomes of antibiotic and placebo treatments were equivalent [76, 77] . In the third study, in Pakistan, there was a non-significant 24% vs. 20% rate of |
9cac61f0d3c65a74ddd079765b2d8769_33 | failure in the placebo group, which was deemed to be non-equivalent to the antibiotic group [75] . Furthermore, because WHO-classified non-severe pneumonia and bronchiolitis might be considered within a spectrum of lower respiratory disease, many children with clinical pneumonia could actually have viral bronchiolitis, for which antibiotics are not beneficial [79] . This has been reflected in British [33] and Spanish [31] national pneumonia guidelines, which do not recommend routine antibiotic treatment for children younger than 2 years with evidence of pneumococcal conjugate vaccination who present with non-severe pneumonia. The United States' national guidelines recommend withholding antibiotics in children up to age 5 years presenting with non-severe pneumonia [32] . However, given the high mortality from pneumonia in low-and middle-income countries, the lack of easy access to care, and the high prevalence of risk factors for severe disease, revised World Health Organization |
9cac61f0d3c65a74ddd079765b2d8769_34 | pneumonia guidelines still recommend antibiotic treatment for all children who meet the WHO pneumonia case definitions [80] . |
9cac61f0d3c65a74ddd079765b2d8769_35 | Use of supplemental oxygen is life-saving, but this is not universally available in low-and middle-income countries; it is estimated that use of supplemental oxygen systems could reduce mortality of children with hypoxic pneumonia by 20% [81] . Identifying systems capacity to increase availability of oxygen in health facilities, and identifying barriers to further implementation are among the top 15 priorities for future childhood pneumonia research [82] . However, up to 81% of pneumonia deaths in 2010 occurred outside health facilities [5] , so there are major challenges with access to health services and health-seeking behavior of vulnerable populations. Identifying and changing the barriers to accessing health care is an important area with the potential to impact the survival and health of the most vulnerable children [82] . |
9cac61f0d3c65a74ddd079765b2d8769_36 | Much progress has been made in decreasing deaths caused by childhood pneumonia. Improved socioeconomic status and vaccinations, primarily the conjugate vaccines (against Haemophilus influenzae and pneumococcus), have led to substantial reductions in the incidence and severity of childhood pneumonia. Stronger strategies to prevent and manage HIV have reduced HIV-associated pneumonia deaths. However, despite the substantial changes in incidence, etiology and radiology globally, there remain inequities in access to care and availability of effective interventions, especially in low-and middle-income countries. Effective interventions need to be more widely available and new interventions developed for the residual burden of childhood pneumonia. |
6affe5fdf4b3dbc765ce1e33b3124244_0 | Immunomodulatory Activity and Protective Effects of Polysaccharide from Eupatorium adenophorum Leaf Extract on Highly Pathogenic H5N1 Influenza Infection
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3789439/
SHA: efba2008a6ccf1ad2614aebd79a6a741ea6538b9
Authors: Jin, Yi; Zhang, Yuewei; Wan, Chunyan; Wang, Hongjun; Hou, Lingyu; Chang, Jianyu; Fan, Kai; Xie, Xiangming
Date: 2013-09-18
DOI: 10.1155/2013/194976
License: cc-by |
6affe5fdf4b3dbc765ce1e33b3124244_1 | Abstract: The development of novel broad-spectrum, antiviral agents against H5N1 infection is urgently needed. In this study, we evaluated the immunomodulatory activities and protective effect of Eupatorium adenophorum polysaccharide (EAP) against the highly pathogenic H5N1 subtype influenza virus. EAP treatment significantly increased the production of IL-6, TNF-α, and IFN-γ both in vivo and in vitro as measured by qPCR and ELISA. In a mouse infection model, intranasal administration of EAP at a dose of 25 mg/kg body weight prior to H5N1 viral challenge efficiently inhibited viral replication, decreased lung lesions, and increased survival rate. We further evaluated the innate immune recognition of EAP, as this process is regulated primarily Dectin-1 and mannose receptor (MR). These results indicate that EAP may have immunomodulatory properties and a potential prophylactic effect against H5N1 influenza infection. Our investigation suggests an alternative strategy for the development |
6affe5fdf4b3dbc765ce1e33b3124244_2 | of novel antiinfluenza agents and benefits of E. adenophorum products. |
6affe5fdf4b3dbc765ce1e33b3124244_3 | Text: Highly pathogenic H5N1 subtype influenza virus can be transmitted directly from poultry to human and cause acute respiratory infections. Pandemic influenza virus H5N1 posed a worldwide threat to the public health because of rapid spread and high pathogenicity [1, 2] . The symptoms in animals or humans infected with H5N1 include fever, encephalitis, pneumonia, and severe acute respiratory syndrome (SARS) [3, 4] . The World Health Organization reported 622 human cases of highly pathogenic H5N1 influenza virus infection, including 371 deaths (a mortality rate >50%), from 2003 to 2013 (http://www.who.int/ influenza/human animal interface/H5N1 cumulative table archives/en/index.html). Currently, the most effective preventive measure against the influenza virus is vaccination. Several antiinfluenza medications have been widely used, including zanamivir (Relenza) and oseltamivir (Tamiflu). |
6affe5fdf4b3dbc765ce1e33b3124244_4 | Unfortunately, their benefits have been significantly restricted by drug-resistance and frequent antigenic mutation [5, 6] . Therefore, the development of novel antiinfluenza agents against the H5N1 subtype is very important. |
6affe5fdf4b3dbc765ce1e33b3124244_5 | The invasive plant Eupatorium adenophorum, native to Central America, has a strong ability to adapt to different environments all over the world. This plant first invaded southern Yunnan Province (China) in the 1940s from Burma and Vietnam, and quickly spread across southwestern China throughout the 1950s [7, 8] . Over the past 50 years, E. adenophorum has seriously impacted the ecological environment in China's middle subtropical zones, including Yunnan, Guizhou, Sichuan, and Guangxi Provinces, by encroaching farmlands, pasture fields, and forests [7] . Manual, chemical, or biological control of E. adenophorum has hindered its comprehensive development and utilization for economic benefit. Many bioactive components isolated from E. adenophorum have shown antimicrobial activity and immunomodulating 2 Evidence-Based Complementary and Alternative Medicine properties [9] . In a recent study, the anti-inflammatory properties of ethanolic leaf extract was evaluated [10] . However, there |
6affe5fdf4b3dbc765ce1e33b3124244_6 | have been few reports addressing the bioactivity of E. adenophorum polysaccharide (EAP). |
6affe5fdf4b3dbc765ce1e33b3124244_7 | The immunomodulating properties and therapeutic potential of a large number of botanical polysaccharides have been reported [11] . Several polysaccharides from Cordyceps militaris, Portulaca oleracea, Gracilaria lemaneiformis, Gyrodinium impudium, and Panax ginseng have been described as efficacious antiinfluenza agents against H1N1 and H3N2 strains [12] [13] [14] [15] . In recent reports, polysaccharidebased adjuvants enhanced the immunogenicity and improved the protective efficacy of H5N1 vaccines in animal infection models [16, 17] . However, to our knowledge there have not been any reports regarding the treatment with EAP against highly pathogenic H5N1 influenza. |
6affe5fdf4b3dbc765ce1e33b3124244_8 | In the present study, we investigated the potential effect of EAP against H5N1 influenza infection in a mouse model. Immune enhancement effects and the innate immune recognition of EAP were also evaluated. Our results suggest the anti-H5N1 effects of EAP offer an alternative strategy for developing antiinfluenza agents and the utilization of E. adenophorum products.
Virus. The H5N1 influenza virus (A/bar-headed goose/ Qinghai/1/2010) used in this study was isolated from Qinghai Lake in May 2010. This isolate is highly pathogenic in poultry, mouse, and Madin-Darby canine kidney (MDCK) cells. The virus was propagated in MDCK cells at 37 ∘ C for 48 h, and the viral supernatant was harvested, aliquoted, and stored at −80 ∘ C. Viral titers were determined by plaque assay as described previously [18] . |
6affe5fdf4b3dbc765ce1e33b3124244_9 | Animal and Cells. 8-10-week-old Female BALB/c mice were obtained from Vital River Laboratories (Beijing, China), and the original breeding pairs were purchased from Charles River (Beijing, China). Mice were raised in independent ventilated cages (IVC) and received pathogen-free food and water. Animal treatments were governed by the Regulations of Experimental Animals of Beijing Authority, and approved by the Animal Ethics Committee of the China Agriculture University.
The mouse leukemic monocyte macrophage Raw 264.7 cell line, human lung adenocarcinoma epithelial A549 cell line, and Madin-Darby canine kidney (MDCK) cell lines were provided by the Cell Resource Center of Peking Union Medical College. The cells were cultured and maintained according to the supplier's recommendations. |
6affe5fdf4b3dbc765ce1e33b3124244_10 | Yunnan province, China. The leaves were sliced and dried in shade. 100 g dried materials were powdered in a mixer and then filtered with 40 meshes. Leaf powder was extracted by ultrasonic treatment with 1000 mL of distilled water for 45 min. The supernatant was collected and the precipitate resuspended in 1000 mL of distilled water and again extracted by ultrasonic treatment for 30 min. The resulting supernatant was combined with that obtained from the first ultrasonic treatment. The final aqueous fraction was evaporated to dryness in a rotary evaporator. The residue obtained was dissolved in distilled water and kept frozen at 4 ∘ C. |
6affe5fdf4b3dbc765ce1e33b3124244_11 | The extract was centrifuged at 3000 g/min for 25 min and concentrated under 80 ∘ C for 8 h to prepare polysaccharide. The supernatant was then deproteinized using the Sevag method, and dialyzed against water for 48 h. The final liquid was mixed with three-fold volume of 95% ethanol (v/v) and centrifuged at 3000 g/min for 10 min. The precipitates were successively washed with absolute ethanol, ether, and dried under vacuum at 40 ∘ C to obtained the crude polysaccharide (yield = 1.2%). EAP content was determined by the phenol-H 2 SO 4 method [19] .
Vitro. 2.5 mL A549 and Raw 264.7 cells (4 × 10 5 /mL) per well were plated in 6-well plates and cultured at 37 ∘ C under 5% CO 2 for 24 h. Media was removed and 2.5 mL culture medium containing different concentrations of EAP (50, 100, 200 g/mL) was added to each well. Controls were treated with phosphate-buffered saline (PBS). Cells were collected 36 h after treatment for RNA extraction and quantitative polymerase chain reaction (qPCR). |
6affe5fdf4b3dbc765ce1e33b3124244_12 | Assay. Mice were administrated EAP at a dose of 5, 10, 25, or 50 mg/kg body weight, intranasally once daily for 5 days before the challenge. Control mice were administered PBS using the same schedule. Influenza virus stocks were diluted in PBS. Mice were anesthetized with Zotile (Virbac, France) intramuscularly at 15 mg/kg (body weight) and then infected intranasally with 120 plaqueforming units (PFU) of H5N1 influenza virus in 50 L. The lung tissue of five mice per group was collected on day 0 before challenge for qPCR and ELISA. Lung tissue from another five mice on day 3 postinfection was collected for plaque assay and qPCR. Ten mice per group were observed for survival for 14 days and body weights recorded. |
6affe5fdf4b3dbc765ce1e33b3124244_13 | 2.6. Plaque Assay. MDCK cells were cultured in DMEM (Hyclone Laboratories, Logan, UT, USA) containing 10% FBS (Hyclone Laboratories), 100 U/mL penicillin, and 100 g/mL streptomycin (Invitrogen, San Diego, CA, USA). Lung tissue supernatant was diluted 10-fold and added to a cell monolayer covered by semisolid agar containing 0.5 g/mL of trypsin TPCK (Sigma-Aldrich, St. Louis, MO, USA). Plates were incubated at 37 ∘ C, 5% CO 2 for 60-72 h and stained with 1% crystal violet. |
6affe5fdf4b3dbc765ce1e33b3124244_14 | Total RNA from 1 × 10 6 cells or 10 mg lung tissue were prepared by Trizol (Invitrogen) according to the manufacturer's instructions. DNaseItreated RNA (0.2 g) was reverse transcribed into cDNA using random primers. The expression of the hemagglutinin (HA) gene of H5N1 influenza virus was detected by qPCR using the Power SYBR Green PCR Master Mix kit (Applied Biosystems, Foster City, CA, USA). The following primers AGG CAC CA-3 5 -CTC CTT AAT GTC ACG CAC GAT TTC-3 h IL-6 5 -CCT TCG GTC CAG TTG CCT TCT-3 5 -CCA GTG CCT CTT TGC TGC TTT C-3 h IFN were used: forward primer, 5 -CGC AGT ATT CAG AAG AAG CAAGAC-3 ; and reverse primer, 5 -TCC ATA AGG ATA GAC CAG CTA CCA-3 . The reaction was run on an ABI 7500 thermal cycler with an initial denaturation step at 95 ∘ C for 10 min, followed by 40 cycles of 95 ∘ C for 15 s, 56 ∘ C for 30 s, and 72 ∘ C for 40 s. The copy number of the HA gene was calculated by 7500 software v2.0 (Applied Biosystems) using an HA-containing plasmid of known |
6affe5fdf4b3dbc765ce1e33b3124244_15 | concentration as a standard. |
6affe5fdf4b3dbc765ce1e33b3124244_16 | Relative qPCR was performed for other eight genes: hactin, h IL-6, h IFN-, and hTNF-for A549 cells; mactin, mTLR-2, mTLR-4, mDectin-1, mMR, mIL-6, mIFN-, and mTNF-for Raw264.7 cells. The sequences of primers were shown in Table 1 . The reaction was run with 95 ∘ C for 10 min, followed by 40 cycles of denaturation at 95 ∘ C for 15 sec, annealing at 52 ∘ C for 30 s, and extension at 72 ∘ C for 40 s. The fold change in gene expression was normalized to controls (naive mice) by 2 −ΔΔCT using -actin as an internal standard [20] . |
6affe5fdf4b3dbc765ce1e33b3124244_17 | 2.8. ELISA. IL-6, TNF-, and IFN-levels in lung were tested with ELISA kits (Boster, Wuhan, China) according to the manufacturer's protocol. One gram of lung tissue from each mouse was ground in 1 mL PBS and centrifuged for 20 min at 5000 rpm. The supernatants were collected and diluted 10fold for ELISA. 2.10. Statistical Analysis. The statistical analysis was performed using one-way ANOVAs with SPSS 12.0 (SPSS Taiwan Corp., Taiwan), and < 0.05 was considered significant. |
6affe5fdf4b3dbc765ce1e33b3124244_18 | Many botanical polysaccharides exhibit an immunomodulatory effect [11] . To determine the immunomodulatory properties of EAP, we investigated the potential effect of the polysaccharides on A549 and Raw264.7 cells. Cells were treated with various concentrations of EAP (50, 100, 200 g/mL) for 36 h. The mRNA levels of IL-6, TNF-, and IFN-were detected by qPCR. Figure 1 shows the immunomodulatory activities of EAP in vitro. Various concentrations of EAP triggered a strong secretion of IL-6, TNF-, and IFN-in a dosedependent manner both in A549 cells (Figures 1(a)-1(c) ) and Raw264.7 cells (Figures 1(d) -1(f)) compared with the PBS treatment group. |
6affe5fdf4b3dbc765ce1e33b3124244_19 | To test whether EAP could protect H5N1 infected mice, mice were treated with EAP at a dose of 5, 10, 25, or 50 mg/kg body weight intranasally once daily for 5 days prior to viral challenge with 120 PFU. Ten mice per group were monitored for 14 days for the survival rate. As shown in Figure 2 (a), all mice receiving PBS died at day 11. Mice administrated 25 mg/kg EAP had a survival rate of 50% at day 14, which was significantly higher than those receiving PBS (by log rank analysis). EAP treatment of 10 mg/kg and 50 mg/kg also appeared to have a survival advantage, but not statistically significant. This result suggests that the protective effect of EAP against H5N1 infection requires a moderate dose. EAP treatment also alleviated weight loss in infected mice (Figure 2(b) ). |
6affe5fdf4b3dbc765ce1e33b3124244_20 | To determine the viral load in the lung of the infected mice, plaque assays and qPCR were performed. The pulmonary viral titers in the EAP (25 mg/kg) group were significantly lower than the titers in the mice that received PBS at day 3 postinfection (Figures 2(c) and 2(d) ). These data clearly indicate that intranasal administration of EAP controls H5N1 viral replication and improves survival rates in a mouse model. The protective effect of EAP against H5N1 virus is likely due to its immunomodulatory properties. To detect IL-6, TNF-, and IFN-expression, lungs of five mice per group were collected at day 0 before infection and tested by qPCR and ELISA. The mRNA levels in the EAP group (25 mg/kg) were significantly higher than those in the PBS control (naive mice) (Figures 3(a)-3(c) ). Soluble cytokine levels at day 0 were measured by ELISA, and results were consistent with the qPCR results, even though IFN-production in the EAP group was not significantly higher than that of the PBS |
6affe5fdf4b3dbc765ce1e33b3124244_21 | group ( = 0.0599) (Figures 3(g)-3(i) ). These results suggest that EAP increases the IL-6, TNF-, and IFN-production. |
6affe5fdf4b3dbc765ce1e33b3124244_22 | IL-6, TNF-, and IFN-expression at day 3 postinfection was determined by qPCR. In contrast, TNF-mRNA levels following EAP (25 mg/kg) treatment were significantly lower than those in the PBS group (Figure 3(e) ), while IL-6 and IFN-expression were only slightly lower (not significant) (Figures 3(d) and 3(f) ). These results may be explained by a higher viral load, and the more severe inflammatory response in PBS treated mice. |
6affe5fdf4b3dbc765ce1e33b3124244_23 | Excessive inflammation can cause severe lung lesions during H5N1 influenza infection. To evaluate histopathological changes in the lungs of infected mice, tissues of each group at day 3 postinfection were examined. The lungs of PBS treated mice exhibited a severe inflammation response, characterized by interstitial edema, inflammatory cellular infiltration around small blood vessels, alveolar lumen flooded with edema fluid mixed with exfoliated alveolar epithelial cells, and a thickening of alveolar walls (Figures 4(c) and 4(d) ). The lungs of EAP (25 mg/kg) treated mice exhibited milder lesions than those receiving PBS, characterized by signs of bronchopneumonia with interstitial edema, and inflammatory cell infiltration around small blood vessels (Figures 4(a) and 4(b) ). Viral loads and inflammatory cytokine production in the lung were correlated; suggesting that EAP treatment reduces lung lesions in H5N1 infected mice. |
6affe5fdf4b3dbc765ce1e33b3124244_24 | Polysaccharides derived from many plants enhance the secretion of cytokines and chemokines, such as TNF-, IL-6, IL-8, and IL-12 [11] . This immunomodulatory effect is mediated mainly through recognition of polysaccharide polymers by several pattern recognition receptors (PRRs). To determine which receptor contributes directly to the innate immune recognition of EAP, Toll-like receptor 2 (TLR2), TLR4, Dectin-1, and mannose receptor (MR) were examined by qPCR both in vivo and in vitro. Mice were treated with EAP at a dose of 25 mg/kg body weight intranasally once daily for 5 days, with control mice receiving PBS. Lung total RNA was prepared for qPCR. The expression of Dectin-1 and MR in EAP treated mice was significantly elevated compared with controls, while expression of TLR2 and TLR4 were slightly higher, but not statistically significant (Figure 5(a) ). In vitro assay showed similar trends. As shown in Figure 5 (b), Raw264.7 cells were treated with 200 g/mL EPA for 36 h before qPCR. |
6affe5fdf4b3dbc765ce1e33b3124244_25 | Dectin-1 and MR levels were significantly higher, while expression of TLR2 and TLR4 did not change. These data suggest that EAP recognition occurred mainly via the Dectin-1 and MR pathway. |
6affe5fdf4b3dbc765ce1e33b3124244_26 | In this study, we evaluated the immunomodulatory activities and protective effect of EAP against H5N1 influenza infection in a mouse model. To our knowledge, these findings are the first to show the anti-H5N1 effect of EAP. Intranasal administration of EAP prior to H5N1 viral challenge improved survival rates of infected mice with a corresponding reduction of pulmonary viral load. The anti-H5N1 effect was very likely due to the innate immune recognition of EAP and the secretion of innate immune mediators (IL-6, TNFand IFN-) before infection. Furthermore, the effect of EAP on PRR expression (including TLR2, TLR4, Dectin-1, and MR) was determined both in vivo and in vitro. These results suggest that the innate immune recognition of EAP was dependent upon the activation of the Dectin-1 and MR pathways. Our data demonstrate the feasibility of using EAP as a novel immunomodulatory agent against influenza infection. Unfortunately, the sugar composition of EAP has not been characterized. |
6affe5fdf4b3dbc765ce1e33b3124244_27 | The emergence of new drug-resistant strains resulting from antigenic drift limits the therapeutic benefits of vaccination and antiviral agents in controlling influenza [6, 21, 22] . Thus, development of novel broad-spectrum antiinfluenza strategies is urgently needed. Most botanical polysaccharides are ideal candidates for novel immunomodulatory agents due to their nontoxic properties and fewer side effects compared with bacterially derived polysaccharides. A number of polysaccharides isolated from plant and fungi exhibit effective antiviral benefits against influenza A virus (including H1N1 and H3N2 subtypes) [12] [13] [14] [15] . The use of polysaccharides as immunomodulatory agent in anti-H5N1 studies is rare. In this paper, our data show the immunomodulatory activities of EAP both in vivo and in vitro. EAP treatment elevated the production of IL-6, TNF-, and IFNand provides a survival advantage in H5N1 infected mice. The survival rate following EAP pretreatment (25 mg/kg body |
6affe5fdf4b3dbc765ce1e33b3124244_28 | weight) was significantly higher than in mice receiving PBS (50% to 0%). |
6affe5fdf4b3dbc765ce1e33b3124244_29 | In previous reports, high levels of proinflammatory cytokines and chemokines (including TNF-, IL-6 and IFN-) were detected during H5N1 infection [23, 24] . This "cytokine storm" leads to the severe respiratory symptoms and host immune injury. Thus, H5N1-induced cytokine storms are hypothesized to be the main cause of mortality, and the use of anti-inflammatory agents may therefore provide a therapeutic effect [25, 26] . However, it is unclear whether the lack of proinflammatory cytokines (such as TNFand IL-6) facilitates viral clearance. Interestingly, knockout 8 |
6affe5fdf4b3dbc765ce1e33b3124244_30 | Evidence-Based Complementary and Alternative Medicine mice deficient in TNF-, TNF-receptor, IL-6, MIP-1 , and IL-1R or steroid-treated, wild-type mice did not have a survival advantage compared with wild-type mice following H5N1 influenza infection [27, 28] . Interestingly, prophylactic treatment of TLR3 agonist PolyICLC, which strongly upregulates cytokine production, provides protection against H1N1 and H5N1 infections [29, 30] . These conflicting studies may be explained in that the inflammatory response helps clear the virus, while aggravating host pathological damage. Elevated production of cytokines, such as IL-6, TNF-, and IFNare very important for viral clearance in the early stage of infection by activating the innate immune system. Once the viral infection has triggered a cytokine storm due to the high viral load, the inflammatory response causes severe pathological injury or even death. In this case, receiving an immunomodulator alone cannot help animal to survive [25] . |
6affe5fdf4b3dbc765ce1e33b3124244_31 | This likely explains why immunomodulator treatment prior to viral infection results in a better survival rate [26, 30] . In our study, treatment of EAP shortly after infection or 24 h postinfection did not provide a survival advantage (data not show). |
6affe5fdf4b3dbc765ce1e33b3124244_32 | The antiinfluenza properties of IL-6, TNF-, and IFNhave been discussed in many studies, despite their participation in cytokine storms triggered by influenza infection. IL-6 plays an important role in protecting against influenza A virus as it is required for viral clearance and essential for animal survival [31] . TNF-has been reported to exert a defensive effect against influenza infection in vitro [32] . IFN-treatment in the early stages of influenza infection improves the survival rate in mouse models [33] . In addition, high levels of IFN-secretion stimulated by ginseng polysaccharides provide an antiinfluenza effect in vivo [12] . In this report, intranasal administration of EAP before H5N1 challenge elevates expression of IL-6, TNF-, and IFNcompared with mice receiving PBS. The high levels of these mediators contribute to the viral clearance and antiviral response. Pulmonary viral titers following EAP treatment were lower at day 3 postinfection. In contrast, IL-6 and IFN-mRNA |
6affe5fdf4b3dbc765ce1e33b3124244_33 | levels were slightly lower, while TNF-production was significantly lower than that of PBS group. Regarding the excessive inflammation induced by H5N1 virus, massive secretion of mediators contributes to lung injury rather than an antiviral response. Therefore, the timing of EAP treatment as a prophylactic agent is very important. |
6affe5fdf4b3dbc765ce1e33b3124244_34 | The immunomodulatory activities of botanical polysaccharides are thought to be mediated by several PRRs [11] . In this study, we examined the mRNA levels of TLR2, TLR4, Dectin-1, and MR after EAP treatment. EAP was found to upregulate Dectin-1 and MR mRNA expressions significantly both in vivo and in vitro. Our hypothesis is that the innate immune recognition of EAP is driven mainly via a Dectin-1 and MR dependent pathway. Binding to these receptors, EAP may activate complex intracellular signaling pathways, and increase cytokine production, leading to an antiviral response. Thus, the protection against H5N1 by EAP treatment is less likely to cause drug resistance, and may represent a broad-spectrum antiinfluenza effect. |
6affe5fdf4b3dbc765ce1e33b3124244_35 | In conclusion, our study demonstrates that EAP leaf extract is a prophylactic and immune enhancement agent against H5N1 influenza virus infection. Treatment with EAP effectively inhibits H5N1 viral replication and improves animal survival. This approach offers an alternative strategy for antiinfluenza immunomodulatory agent development, and benefits the utilization of E. adenophorum products. |
7ade6ed0693867cc37ff07e283690136_0 | A 3-year prospective study of the epidemiology of acute respiratory viral infections in hospitalized children in Shenzhen, China
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4181804/
SHA: ef5fe7296ec8baf90d974cf5737af0da3ed403ea
Authors: He, Ying; Lin, Guang-Yu; Wang, Qiong; Cai, Xiao-Ying; Zhang, Yin-Hui; Lin, Chuang-Xing; Lu, Chang-Dong; Lu, Xue-Dong
Date: 2014-05-14
DOI: 10.1111/irv.12257
License: cc-by |
7ade6ed0693867cc37ff07e283690136_1 | Abstract: BACKGROUND: The epidemiology of local viral etiologies is essential for the management of viral respiratory tract infections. Limited data are available in China to describe the epidemiology of viral respiratory infections, especially in small–medium cities and rural areas. OBJECTIVES: To determine the viral etiology and seasonality of acute respiratory infections in hospitalized children, a 3-year study was conducted in Shenzhen, China. METHODS: Nasopharyngeal aspirates from eligible children were collected. Influenza and other respiratory viruses were tested by molecular assays simultaneously. Data were analyzed to describe the frequency and seasonality. RESULTS: Of the 2025 children enrolled in the study, 971 (48·0%) were positive for at least one viral pathogen, in which 890 (91·7%) were <4 years of age. The three most prevalent viruses were influenza A (IAV; 35·8%), respiratory syncytial virus (RSV; 30·5%) and human rhinovirus (HRV; 21·5%). Co-infections were found in |
7ade6ed0693867cc37ff07e283690136_2 | 302 cases (31·1%), and dual viral infection was dominant. RSV, HRV and IAV were the most frequent viral agents involved in co-infection. On the whole, the obvious seasonal peaks mainly from March to May were observed with peak strength varying from 1 year to another. CONCLUSIONS: This study provides a basic profile of the epidemiology of acute respiratory viral infection in hospitalized children in Shenzhen. The spectrum of viruses in the study site is similar to that in other places, but the seasonality is closely related to geographic position, different from that in big cities in northern China and neighboring Hong Kong. |
7ade6ed0693867cc37ff07e283690136_3 | Text: Acute respiratory tract infections (ARTIs) are a persistent and pervasive public health problem in both developed and developing countries. They cause a great burden of disease worldwide. Especially in developing countries including China, ARTIs, mainly pneumonia, are the leading cause of death among children under the age of 5 years. 1,2 A great variety of pathogens can cause ARTIs, and viruses have been considered as the predominant pathogens in this children population. 3, 4 The most frequently reported viruses include respiratory syncytial virus (RSV), influenza viruses A and B (IAV, IBV), parainfluenza viruses (PIVs), human rhinovirus (HRV) and adenovirus (ADV), which are responsible for most episodes of ARTIs in children. 1 In the past decade, several new viruses associated with ARTIs such as human metapneumovirus (HMPV), novel strains of coronaviruses (SARS-CoV, HCoV-NL63 and HKUI), human bocavirus (BOV), WU polyomavirus (WUPoyV) and KI polyomavirus (KIPoyV) have been |
7ade6ed0693867cc37ff07e283690136_4 | discovered in human respiratory tract specimens. Among them, some have been identified to be causative pathogens of ARTIs. 1, 4, 5 Currently, there are no approved vaccines or medications available for most of the respiratory viruses. 1 A better understanding of the epidemiology of viral respiratory tract infections in children plays a key role for the prevention, control and treatment of ARTIs. Studies showed that many viral respiratory infections exhibited predictable seasonal variations. However, the epidemiological profiles of viral respiratory infections from different climate zones or different countries in the same climate zone may be varied. [6] [7] [8] [9] [10] [11] [12] China is a large country crossing three climate zones, and great differences in climate are found from region to region. A better understanding of the epidemiology of ARTIs in different regions could be helpful to develop effective surveillance, prevention and treatment strategies. Although some studies on |
7ade6ed0693867cc37ff07e283690136_5 | the epidemiology of ARTIs have recently been reported in big cities such as Beijing, Shanghai and Hong Kong, [13] [14] [15] [16] the epidemic characteristics of viruses in ARTIs are still not well established all around China, especially in other cities and rural areas. |
7ade6ed0693867cc37ff07e283690136_6 | Shenzhen is the largest migratory city of China with high population density and population mobility. It is located in southern China at 22°27 0 -22°52 0 N and 113°46 0 -114°37 0 E, immediately north of Hong Kong, with a typical subtropical monsoon climate. The annual average temperature and relative humidity of Shenzhen are about 23°C (12-33°C) and 77%, respectively. The purpose of this study is to investigate the prevalence, seasonality and clinical characteristics of acute viral respiratory infections in hospitalized children in Shenzhen and to provide insights into etiologies of ARTIs in local infants and children. |
7ade6ed0693867cc37ff07e283690136_7 | A consecutive 3-year prospective study from July 2007 to June 2010 was conducted in Shenzhen, a coastal city neighboring Hong Kong. Four hospitals including a children's hospital were chosen for the study. Selected patients with ARTIs admitted to the pediatric wards were enrolled. The inclusion criteria were as follows: less than 14 years old, acute fever (T ≥ 38°C), with any one of respiratory symptoms (such as sore throat, cough, wheezing and dyspnoea/ tachypnoea), normal or low leukocyte count, the onset of illness within 3 days before hospitalization. The diagnosis of pneumonia was based on the guideline of the management of childhood community acquired pneumonia (CAP) issued by the Chinese Medical Association in 2006. 17 In the guideline, the clinical symptoms and signs for the diagnosis of childhood CAP include fever, cough, tachypnoea (defined according to different age), difficulty breathing and/or lower chest wall indrawing. X-ray evaluation has been carried out when |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.