TOPIC_TITLE
stringlengths 15
156
| CATEGORIES
stringlengths 2
199
| POST
stringlengths 36
177
| ANSWERS
stringlengths 0
51.8k
|
|---|---|---|---|
Put something between computer and printer | wireless-networking;printer;wireless-networking;printer | Put something between computer and printer
Ask Question
|
0
You want the MiTM (Man in the Middle) Attack on your Network, that's cool. Well i'm not expert in this area but i would suggest you to create something like a Server, connect your printer to this server via USB, and open Wifi Printer Sharing through your Server. With some more software (i guess) you will be able to monitor Printer's Queue and save all the files are being pushed to your printer.ShareImprove this answer
Follow
answered Oct 2, 2014 at 23:32DevianDevian57644 silver badges1212 bronze badgesAdd a comment | |
Does a greater number of hard drive platter increase the risk of failure? | hard-drive;hard-drive | Does a greater number of hard drive platter increase the risk of failure?
Ask Question
|
3
Backblaze published one of the biggest real-life studies to life expactancies of hdd´s. I looked up the number of platters and the platter capacity for each of the hdd´s they tested (data in Excel format here). I tested the number of platters vs. age and the capacity per platter vs age. Here are the graphs:My conclusion, (without further statistical testing or conditional probability analysis) is that the number of platters isn't really much of an issue (in this test pupulation), but the platter capacity is. You are better off (in terms of expected age) with more platters and less capacity per platter.ShareImprove this answer
Follow
answered Oct 3, 2014 at 11:15agtoeveragtoever6,20411 gold badge2323 silver badges3737 bronze badges4Just noticed Backblaze updated their data which is not incorporated in these numbers.
– agtoeverOct 3, 2014 at 11:22I don't know how they got these results, but two WD Caviar Green EARS 2TB bought at diffent places and time went down. They were the one with 5 platters, in comparison and in the same conditions, the EZRX with only two platters are still here. I mean, if they are comparing Caviar Blacks and Caviar Green, it's normal to have such results. Blacks have a far more better quality than Greens. While the Greens usually have more platters and density than Blacks, they are the first one to reach the biggest capacity.
– X.LINKOct 3, 2014 at 13:47I agree that the black and green series are a very different league. But even if you take the green's out, the pattern remains the same. I honestly don't know why Backblaze uses green drives (good question, though). But with all due respect, I think your n=2 experience can't beat Backblaze's n=26.556 experience. So I don't understand your downvote of my answer...
– agtoeverOct 3, 2014 at 14:23Excellent answer. Thanks for the awesome graphs!
– superuserOct 11, 2014 at 18:53Add a comment | ;
2
Having less platter means less mechanized parts, so less chance of failure. Consequently it also means less heat and also failure. But the problem is that if you got a failure on a whole platter, you will lose everything.On the other side, a single platter means much more density, so do speed and access times.I do personally prefer one platter since it's faster, lighter, but also less failure due to less mechanized parts. I mean, the more you have, the more it will be harder for the heads to spin correctly on the right cylinder, so the more it will easily be aged.ShareImprove this answer
Follow
answered Oct 2, 2014 at 23:53X.LINKX.LINK2,24455 gold badges2121 silver badges3131 bronze badges3Practically speaking, if a single platter in a multi-platter HD fails, you won't be able to access the rest anyway.
– ChrisInEdmontonOct 2, 2014 at 23:59Well, it depends on a lot of factors, if the datas were contiguous or not, on the same platter, etc. Physical data recovery where replacing failing platters is possible, for a price...
– X.LINKOct 3, 2014 at 0:02Yeah my wrong i deleted my answer. I Misunderstood the question sorry.
– DevianOct 3, 2014 at 0:05Add a comment | ;
2
Technically, the parameter of interest should be the number of read/write heads rather than the number of platters.Typically there would be one R/W head per platter surface. A platter has two surfaces, so if both surfaces are used for data storage, then the number of R/W heads is double the number of platters (for the typical case).I haven't opened up a HDD in a long time, but in the past I have seen HDDs built with unused surfaces and/or platters. Presumably these were platters that had only one "good" side and installed in a low-capacity model that was otherwise identical to a high-capacity model.Increasing the number of R/W heads in a HDD is considered a performance benefit, since more data would be in each cylinder and thus can reduce seeks.The typical tradeoffs for more R/W heads is added cost and reduced reliability (added electronics, more mass to the head actuator) and increased susceptibility to a head crash.if you have a 4TB hard drive with one solid 4TB disk and you have another 4TB hard drive with 4 discs, does the one with 4 discs have a greater chance of failure?I would consider a 2-head (single platter) drive to have less chance of failure than a 8-head (4 platter) drive. But (assuming similar areal densities) the 8-head drive should have better random access times. How about 2 platters vs 3 platters? Until someone quantifies the increased risk of failure due to the number of R/W heads, you shouldn't base reliability and/or a purchase decision solely on the number of platters and/or R/W heads. ShareImprove this answer
Follow
edited Oct 3, 2014 at 1:22
answered Oct 3, 2014 at 0:45sawdustsawdust16.9k11 gold badge3333 silver badges4646 bronze badges7Having more platters should theorically improve performance, it is not since the heads cannot move independently. Furthermore, if the data is placed on the same platter, it doesn't even means something. On the other side, one platters shortens access times since the density of bit per square make bits much more closer to access between each others. This just look like the problem between PATA and SATA.
– X.LINKOct 3, 2014 at 1:16"the 8-head drive should have better random access times" It won't since it is not possible, for the same capacity to have the same density for different platter number. "you shouldn't base reliability and/or a purchase decision solely on the number of platters and/or R/W heads.": I do prefer WD since not even one of them failed me, instead of Seagate, Hitachi and Fujitsu. You know that quality cannot be quantified exactly, but I can assure that WDs are the only one who park their heads when powered off, meaning much less head failures. And guess what, they are even really good on density. ;)
– X.LINKOct 3, 2014 at 1:29@user3755746 -- FYI I have first-hand experience developing firmware for disk controller and disk device drivers for various OSes. More heads is not a "theoretical" performance benefit; it's real. But increasing the areal density can provide a similar performance benefit, since that can increase the amount of data per cylinder. You are ignoring my stipulation of "similar areal densities".
– sawdustOct 3, 2014 at 1:381Someone like you should even not have any doubts about the "8-head drive should have better random access times". To be even worse, if datas are scattered into multiple platters, meaning not the same cylinder on every level, how even on earth can this be more faster than datas stored on a single and continuous segment of the same platter ? Heads just have to wiggle so much more since they all move at the same time !!!
– X.LINKOct 3, 2014 at 1:46@user3755746 - "a single and continuous segment of the same platter" -- That sounds a bit like the misconception mentioned in superuser.com/questions/432318/what-are-disk-sectors-for
– sawdustOct 3, 2014 at 1:59 | Show 2 more comments |
Compare two excel files | microsoft-excel;comparison;microsoft-excel;comparison | Compare two excel files
Ask Question
|
10
IMPORTANT This guide applies for Microsoft Office Professional Plus 2013 or Office 365 ProPlus. Spreadsheet Compare Feature is not included in any other Microsoft Office Distribution.Spreadsheet CompareIn Windows 7 On the Windows Start menu, under Office 2013 Tools, click Spreadsheet Compare.In Windows 8 On the Start screen, click Spreadsheet Compare. If you do not see a Spreadsheet Compare tile, begin typing the words Spreadsheet Compare, and then select its tile.In addition to Spreadsheet Compare, you'll also find the companion program for Access – Microsoft Database Compare. It also requires Office Professional Plus 2013. (In Windows 8, type Database Compare to find it.)Compare two Excel workbooksClick Home > Compare Files.The Compare Files dialog box appears.Click the blue folder icon next to the Compare box to browse to the location of the earlier version of your workbook. In addition to files saved on your computer or on a network, you can enter a web address to a site where your workbooks are saved..Click the green folder icon next to the To box to browse to the location of the workbook that you want to compare to the earlier version, and then click OK.TIP You can compare two files with the same name if they're saved in different folders.In the left pane, choose the options you want to see in the results of the workbook comparison by checking or unchecking the options, such as Formulas, Macros, or Cell Format. Or, just Select All.Click OK to run the comparison.If you get an "Unable to open workbook" message, this might mean one of the workbooks is password protected. Click OK and then enter the workbook's password. Learn more about how passwords and Spreadsheet Compare work together.The results of the comparison appear in a two-pane grid. The workbook on the left corresponds to the "Compare" (typically older) file you chose and the workbook on the right corresponds to the "To" (typically newer) file. Details appear in a pane below the two grids. Changes are highlighted by color, depending on the kind of change.Understanding the resultsIn the side-by-side grid, a worksheet for each file is compared to the worksheet in the other file. If there are multiple worksheets, they're available by clicking the forward and back buttons on the horizontal scroll bar.NOTE Even if a worksheet is hidden, it's still compared and shown in the results.Differences are highlighted with a cell fill color or text font color, depending on the type of difference. For example, cells with "entered values" (non-formula cells) are formatted with a green fill color in the side-by-side grid, and with a green font in the pane results list. The lower-left pane is a legend that shows what the colors mean.In the example shown here, results for Q4 in the earlier version weren't final. The latest version of the workbook contains the final numbers in the E column for Q4.In the comparison results, cells E2:E5 in both versions have a green fill that means an entered value has changed. Because those values changed, the calculated results in the YTD column also changed – cells F2:F4 and E6:F6 have a blue-green fill that means the calculated value changed.The calculated result in cell F5 also changed, but the more important reason is that in the earlier version its formula was incorrect (it summed only B5:D5, omitting the value for Q4). When the workbook was updated, the formula in F5 was corrected so that it's now =SUM(B5:E5).If the cells are too narrow to show the cell contents, click Resize Cells to Fit.Source: Microsoft SupportShareImprove this answer
Follow
edited Oct 3, 2014 at 0:18
answered Oct 2, 2014 at 23:36DevianDevian57644 silver badges1212 bronze badges41Link only answers can quickly become invalid. It would be useful to summarize what the page says in your answer.
– RaystafarianOct 2, 2014 at 23:55Summarize, not reproduce...
– RaystafarianOct 3, 2014 at 0:262Well reproducing is not a bad thing either, since i attached the source. I'm at Work atm, have no time to summarize, and since i posted it, i edited it very quickly. Your comment will be useful on my next answers...!
– DevianOct 3, 2014 at 0:27you can download this as a standalone for other office versions
– PiecevcakeJan 31, 2022 at 18:11Add a comment | |
Accessing a particular directory via HTTPS | ubuntu;ssl;https;lamp;ubuntu;ssl;https;lamp | Accessing a particular directory via HTTPS
Ask Question
|
0
The file "sites-available/default-ssl.conf" can be used to set up a default HTTPS install, provided you put in your SSL certs etc - and assuming this directory is read by Apache - which it is by default on most installs which have this layout.ie sites-available/default-ssl.conf negates the need to include conf/extra-httpd-ssl.conf (but there is nothing stopping you creating conf/xtra/httpd-ssl.conf and linking the file into your httpd.conf file if you so desire)ShareImprove this answer
Follow
answered Oct 2, 2014 at 22:49davidgodavidgo66.4k1212 gold badges9999 silver badges155155 bronze badgesAdd a comment | |
Virtualbox host key not working, can't get out of scale mode | windows;virtualbox;keyboard;windows-8.1;virtual-machine;windows;virtualbox;keyboard;windows-8.1;virtual-machine | Virtualbox host key not working, can't get out of scale mode
Ask Question
|
0
Solved my issue. The issue is with a slew of Windows 8.1 updates that are affecting a number of other keyboard commands as well, including breaking the Shift key functionality of Synergy (issue tracker 1, issue tracker 2) and breaking alt code characters (the character only appears after the next keypress and instead of it, if at all. Possibly other programs are affected.The list of broken Windows updates is long. For me specifically it was KB2993651. Others have reported different patch numbers. Sometimes multiple patches have to be uninstalled. See the Synergy issue trackers above for more details.ShareImprove this answer
Follow
answered Oct 13, 2014 at 18:10SkyNTSkyNT90722 gold badges99 silver badges1212 bronze badgesAdd a comment | ;
0
I wasted an hour on a very similar problem because I forgot I had the on screen keyboard open. Apparently VirtualBox and the on screen keyboard don't like each other. This might cause a similar issue.ShareImprove this answer
Follow
edited Feb 19, 2017 at 21:41bertieb7,2243636 gold badges4040 silver badges5252 bronze badges
answered Feb 19, 2017 at 20:24Virtual_KB_AbuserVirtual_KB_Abuser1Add a comment | |
Removing Windows Technical Preview from Windows Update | windows-update;windows-10-preview;windows-update;windows-10-preview | Removing Windows Technical Preview from Windows Update
Ask Question
|
15
All you need to do is uninstall KB2990214Just navigate to Control Panel\All Control Panel Items\Programs and Featuresthen click on View Installed UpdatesSourceI don't have it installed so its not listedShareImprove this answer
Follow
answered Oct 2, 2014 at 22:40RamhoundRamhound40.2k3434 gold badges100100 silver badges127127 bronze badges6I'm basically waiting for Windows Update to confirm, but yeah this looks like the right answer.
– EriksterOct 3, 2014 at 0:32Why don't you just try it, you can view the details of the update, and confirm yourself
– RamhoundOct 3, 2014 at 0:56I did, I'm just waiting for Windows Update to return to normal. It's been "checking for updates" for the last few hours.
– EriksterOct 3, 2014 at 16:06I'll leave one last note: You'll need to restart once or twice after removing the update to get Windows Update back to normal.
– EriksterOct 7, 2014 at 3:56The serial downvoting of my highly accepted answers is getting a ridiculous. If you have a problem with something I have said, come talk to me in chat, don't serial downvote me on Stackoverflow and Superuser its just going to get reversed anyways.
– RamhoundMar 4, 2015 at 16:41 | Show 1 more comment;
6
wusa.exe /uninstall /kb:2990214I did not have it listed under 'view installed updates'. Running command above will uninstall it from your machine if present.ShareImprove this answer
Follow
edited Oct 6, 2014 at 6:03Kunal1,86955 gold badges2222 silver badges3030 bronze badges
answered Oct 5, 2014 at 17:49pakjebakmeelpakjebakmeel6111 bronze badgeAdd a comment | |
VirtualBox kernal error in Windows 10 trying to run Vagrant | virtualbox;vagrant;windows-10-preview;virtualbox;vagrant;windows-10-preview | VirtualBox kernal error in Windows 10 trying to run Vagrant
Ask Question
|
1
I've had the same errors. Try to install VirtualBox 4.3.12 (older version). That works just fine for me.ShareImprove this answer
Follow
edited Oct 13, 2014 at 8:32Jan Doggen4,01088 gold badges3434 silver badges4848 bronze badges
answered Oct 12, 2014 at 17:21RinieRinie1111 bronze badge0Add a comment | |
How Does a Router Map Inbound Traffic to LAN Nodes? [duplicate] | ip;routing;mac-address;ip;routing;mac-address | How Does a Router Map Inbound Traffic to LAN Nodes? [duplicate]
Ask Question
|
1
It works precisely the same way end systems do it. When your browser makes two connections to a web server, the destination IP address and destination port are the same. The system, whether router doing NAT or end node, assigns each connection a distinct local source port address. Replies are distinguished by the destination port address in the reply which corresponds to the source port address in the outbound packets.ShareImprove this answer
Follow
answered Oct 2, 2014 at 22:49David SchwartzDavid Schwartz61.4k77 gold badges9999 silver badges148148 bronze badgesAdd a comment | |
How can I remove malicious spyware, malware, adware, viruses, trojans or rootkits from my PC? | windows;anti-virus;virus;malware;community-faq;windows;anti-virus;virus;malware;community-faq | How can I remove malicious spyware, malware, adware, viruses, trojans or rootkits from my PC?
Ask Question
|
291
Here's the thing: Malware in recent years has become both sneakier and nastier:Sneakier, not only because it's better at hiding with rootkits or EEPROM hacks, but also because it travels in packs. Subtle malware can hide behind more obvious infections. There are lots of good tools listed in answers here that can find 99% of malware, but there's always that 1% they can't find yet. Mostly, that 1% is stuff that is new: the malware tools can't find it because it just came out and is using some new exploit or technique to hide itself that the tools don't know about yet.Malware also has a short shelf-life. If you're infected, something from that new 1% is very likely to be one part of your infection. It won't be the whole infection: just a part of it. Security tools will help you find and remove the more obvious and well-known malware, and most likely remove all of the visible symptoms (because you can keep digging until you get that far), but they can leave little pieces behind, like a keylogger or rootkit hiding behind some new exploit that the security tool doesn't yet know how to check. The anti-malware tools still have their place, but I'll get to that later.Nastier, in that it won't just show ads, install a toolbar, or use your computer as a zombie anymore. Modern malware is likely to go right for the banking or credit card information. The people building this stuff are no longer just script kiddies looking for fame; they are now organized professionals motivated by profit, and if they can't steal from you directly, they'll look for something they can turn around and sell. This might be processing or network resources in your computer, but it might also be your social security number or encrypting your files and holding them for ransom.Put these two factors together, and it's no longer worthwhile to even attempt to remove malware from an installed operating system. I used to be very good at removing this stuff, to the point where I made a significant part of my living that way, and I no longer even make the attempt. I'm not saying it can't be done, but I am saying that the cost/benefit and risk analysis results have changed: it's just not worth it anymore. There's too much at stake, and it's too easy to get results that only seem to be effective.Lots of people will disagree with me on this, but I challenge they are not weighing consequences of failure strongly enough. Are you willing to wager your life savings, your good credit, even your identity, that you're better at this than crooks who make millions doing it every day? If you try to remove malware and then keep running the old system, that's exactly what you're doing.I know there are people out there reading this thinking, "Hey, I've removed several infections from various machines and nothing bad ever happened." Me too, friend. Me too. In days past I have cleaned my share of infected systems. Nevertheless, I suggest we now need to add "yet" to the end of that statement. You might be 99% effective, but you only have to be wrong one time, and the consequences of failure are much higher than they once were; the cost of just one failure can easily outweigh all of the other successes. You might even have a machine already out there that still has a ticking time bomb inside, just waiting to be activated or to collect the right information before reporting it back. Even if you have a 100% effective process now, this stuff changes all the time. Remember: you have to be perfect every time; the bad guys only have to get lucky once.In summary, it's unfortunate, but if you have a confirmed malware infection, a complete re-pave of the computer should be the first place you turn instead of the last.Here's how to accomplish that:Before you're infected, make sure you have a way to re-install any purchased software, including the operating system, that does not depend on anything stored on your internal hard disk. For this purpose, that normally just means hanging onto cd/dvds or product keys, but the operating system may require you to create recovery disks yourself.1 Don't rely on a recovery partition for this. If you wait until after an infection to ensure you have what you need to re-install, you may find yourself paying for the same software again. With the rise of ransomware, it's also extremely important to take regular backups of your data (plus, you know, regular non-malicious things like hard drive failure).When you suspect you have malware, look to other answers here. There are a lot of good tools suggested. My only issue is the best way to use them: I only rely on them for the detection. Install and run the tool, but as soon as it finds evidence of a real infection (more than just "tracking cookies") just stop the scan: the tool has done its job and confirmed your infection.2At the time of a confirmed infection, take the following steps:Check your credit and bank accounts. By the time you find out about the infection, real damage may have already been done. Take any steps necessary to secure your cards, bank account, and identity.Change passwords at any web site you accessed from the compromised computer. Do not use the compromised computer to do any of this.Take a backup of your data (even better if you already have one).Re-install the operating system using original media obtained directly from the OS publisher. Make sure the re-install includes a complete re-format of your disk; a system restore or system recovery operation is not enough.Re-install your applications.Make sure your operating system and software is fully patched and up to date.Run a complete anti-virus scan to clean the backup from step three.Restore the backup.If done properly, this is likely to take between two and six real hours of your time, spread out over two to three days (or even longer) while you wait for things like apps to install, windows updates to download, or large backup files to transfer... but it's better than finding out later that crooks drained your bank account. Unfortunately, this is something you should do yourself, or a have a techy friend do for you. At a typical consulting rate of around $100/hr, it can be cheaper to buy a new machine than pay a shop to do this. If you have a friend do it for you, do something nice to show your appreciation. Even geeks who love helping you set up new things or fix broken hardware often hate the tedium of clean-up work. It's also best if you take your own backup... your friends aren't going to know where you put what files, or which ones are really important to you. You're in a better position to take a good backup than they are.Soon even all of this may not be enough, as there is now malware capable of infecting firmware. Even replacing the hard drive may not remove the infection, and buying a new computer will be the only option. Thankfully, at the time I'm writing this we're not to that point yet, but the day is definitely approaching fast.If you absolutely insist, beyond all reason, that you really want to clean your existing install rather than start over, then for the love of God make sure whatever method you use involves one of the following two procedures:Remove the hard drive and connect it as a guest disk in a different (clean!) computer to run the scan.ORBoot from a CD/USB key with its own set of tools running its own kernel. Make sure the image for this is obtained and burned on a clean computer. If necessary, have a friend make the disk for you.Under no circumstances should you try to clean an infected operating system using software running as a guest process of the compromised operating system. That's just plain dumb.Of course, the best way to fix an infection is to avoid it in the first place, and there are some things you can do to help with that:Keep your system patched. Make sure you promptly install Windows Updates, Adobe Updates, Java Updates, Apple Updates, etc. This is far more important even than anti-virus software, and for the most part it's not that hard, as long as you keep current. Most of those companies have informally settled on all releasing new patches on the same day each month, so if you keep current it doesn't interrupt you that often. Forced Windows Update reboots typically only happen when you ignore the notices for too long. If this happens to you often, it's on you to change your behavior. These are important, and it's not okay to continually just choose the "install later" option, even if it's easier in the moment.Do not run as administrator by default. In recent versions of Windows, it's as simple as leaving the UAC feature turned on.Use a good firewall tool. These days the default firewall in Windows is actually good enough. You may want to supplement this layer with something like WinPatrol that helps stop malicious activity on the front end. Windows Defender works in this capacity to some extent as well. Basic Ad-Blocker browser plugins are also becoming increasingly useful at this level as a security tool.Set most browser plug-ins (especially Flash and Java) to "Ask to Activate".Run current anti-virus software. This is a distant fifth to the other options, as traditional A/V software often just isn't that effective anymore. It's also important to emphasize the "current". You could have the best antivirus software in the world, but if it's not up to date, you may just as well uninstall it.For this reason, I currently recommend Microsoft Defender. There are likely far better scanning engines out there, but Microsoft Defender is built into Windows and will keep itself up to date via the normal Windows Update mechanism, without ever risking an expired registration. AVG and Avast also work well in this way. I just can't recommend any anti-virus software you have to actually pay for, because it's just far too common a paid subscription lapses and you end up with out-of-date definitions.It's also worth noting here that Mac users now need to run antivirus software, too. The days when they could get away without it are long gone. As an aside, I think it's hilarious I now must recommend Mac users buy anti-virus software, but advise Windows users against it.Avoid torrent sites, warez, pirated software, and pirated movies/videos. This stuff is often injected with malware by the person who cracked or posted it — not always, but often enough to avoid the whole mess. It's part of why a cracker would do this: often they will get a cut of any profits.Use your head when browsing the web. You are the weakest link in the security chain. If something sounds too good to be true, it probably is. The most obvious download button is rarely the one you want to use any more when downloading new software, so make sure to read and understand everything on the web page before you click that link. If you see a pop up or hear an audible message asking you to call Microsoft or install some security tool, it's a fake.Also, prefer to download the software and updates/upgrades directly from vendor or developer rather than third party file hosting websites.1 Microsoft now publishes the Windows 10 install media so you can legally download and write to an 8GB or larger flash drive for free. You still need a valid license, but you don't need a separate recovery disk for the basic operating system any more.2 This is a good time to point out that I have softened my approach somewhat. Today, most "infections" fall under the category of PUPs (Potentially Unwanted Programs) and browser extensions included with other downloads. Often these PUPs/extensions can safely be removed through traditional means, and they are now a large enough percentage of malware that I may stop at this point and simply try the Add/Remove Programs feature or normal browser option to remove an extension. However, at the first sign of something deeper — any hint the software won't just uninstall normally — and it's back to repaving the machine.ShareImprove this answer
Follow
edited Jul 28, 2022 at 20:34
answered Nov 30, 2012 at 15:16Joel CoehoornJoel Coehoorn28k1313 gold badges8686 silver badges132132 bronze badges115This seems to be the wisest, nowadays, indeed. I would add that there is another reason for some malware to be sneaky: they will remain dormant, and use your computer for other activities. Could be proxying, storing things more or less illegal, or be a part of a DDOS attack.
– GnoupiNov 30, 2012 at 15:232@ConradFrix Too soon to say... I haven't needed to do this to a Windows 8 PC yet... but I'm pessimistic because it doesn't result in reformatting the drive. Windows 8 includes several security improvements, including running antivirus software from time 0 as part of the OS, such that I'm hopeful to never need to do this for Windows 8 at all.
– Joel CoehoornNov 30, 2012 at 20:115@DanielRHicks read the full sentence. It's two to six hours of your time, spread over a day or three where you are efficient about kicking something off and checking back later. If you're baby-sitting everything, then yeah: it's gonna take a while.
– Joel CoehoornDec 5, 2012 at 22:212@JoelCoehoorn Is it just me, or malware this advanced would also infect firmware on all kinds of components making any removal effort futile?
– Enis P. AginićOct 6, 2014 at 11:335Please remember that if you take a backup AFTER you discover the infection, it is highly probable that the backup itself is infected. Please scan the backup before attempting a restore.
– Tejas KaleAug 14, 2016 at 8:43 | Show 6 more comments;
206
How can I tell if my PC is infected?General symptoms for malware can be anything. The usual are:The machine is slower than normal.Random failures and things happening when they shouldn't (e.g. some new viruses put group policy restrictions on your machine to prevent task manager or other diagnostic programs from running).Task manager shows a high CPU when you think your machine should be idle (e.g. <5%).Adverts popping up at random.Virus warnings popping up from an antivirus you don't remember installing (the antivirus program is a fake and tries to claim you have scary sounding viruses with names like 'bankpasswordstealer.vir'. You're encouraged to pay for this program to clean these).Popups/ fake blue screen of death (BSOD) asking you to call a number to fix the infection.Internet pages redirected or blocked, for example, home pages of AV products or support sites (www.symantec.com, www.avg.com, www.microsoft.com) are redirected to sites filled with adverts, or fake sites promoting bogus anti virus / "helpful" removal tools, or are blocked altogether. Increased startup time, when you have not been installing any applications (or patches)... This one is awkward.Your personal files are encrypted and you see a ransom note.Anything out the blue, if you "know" your system, you typically know when something is very wrong.How do I get rid of this?Using a Live CDSince the infected PC's virus scanner might be compromised, it's probably safer to scan the drive from a Live CD. The CD will boot a specialized operating system on your computer, which will then scan the hard drive.There are, for example, Avira Antivir Rescue System or ubcd4win. More suggestions can be found at FREE Bootable AntiVirus Rescue CDs Download List such as: Kaspersky Rescue CDBitDefender Rescue CDF-Secure Rescue CDAvira Antivir Rescue DiskTrinity Rescue Kit CDAVG Rescue CDConnecting the hard drive to another PCIf you are connecting the infected hard drive to a clean system in order to scan it, make sure that you update the virus definitions for all the products that you will be using to scan the infected drive. Waiting a week to let the antivirus providers release new virus definitions can improve your chances of detecting all the viruses. Make sure your infected system remains disconnected from the internet as soon as you find it is infected. This will prevent it from being able to download new editions of viruses (among other things).Start with a good tool such as Spybot Search and Destroy or Malwarebytes' Anti-Malware and perform a full scan. Also try ComboFix, and SuperAntiSpyware. No single antivirus product will have every virus definition. Using multiple products is key (not for real time protection). If even just one virus remains on the system, it may be able to download and install all the latest editions of new viruses and all the effort so far would have been for nothing.Remove suspicious programs from bootStart up in safe mode.Use msconfig to determine what programs and services start at boot (or startup under task manager in Windows 8).If there are programs/services that are suspicious, remove them from the boot. Else skip to using a live CD.Restart.If the symptoms do not go away and/or the program replaces itself at startup, try using a program called Autoruns to find the program, and remove it from there. If your computer cannot start up, Autoruns has a feature where it can be run from a second PC called "Analyse offline PC". Pay especially close attention to the Logon and Scheduled tasks tabs.If there is still no success in removing the program, and you are sure that it is the cause of your problems, boot into regular mode, and install a tool called UnlockerNavigate to the location of the file that is that virus, and attempt to use unlocker to kill it. A few things may happen:The file is deleted, and does not reappear on restart. This is the best case.The file is deleted, but immediately reappears. In this case, use a program called Process Monitor to find out the program that re-created the file. You will need to delete that program as well.The file cannot be deleted, unlocker will prompt you to delete it on reboot. Do that, and see if it reappears. If it does, you must have a program in boot that causes that to happen, and re-examine the list of programs that run in boot.What to do after restoringNow it should be safe (hopefully) to boot into your (previously) infected system. Still, keep your eyes open for signs of infection. A virus can leave changes on a computer that would make it easier to re-infect even after the virus has been removed. For example, if a virus changed DNS or proxy settings, your computer would redirect you to fake versions of legitimate websites, so that downloading what appears to be a well-known and trusted program could actually be downloading a virus. They could also get your passwords by redirecting you to fake bank account sites or fake email sites. Be sure to check your DNS and proxy settings. In most cases, your DNS should be provided by your ISP or automatically acquired by DHCP. Your proxy settings should be disabled. Check your hosts file (\%systemroot%\system32\drivers\etc\hosts) for any suspicious entries and remove them immediately. Also make sure your firewall is enabled and that you have all the latest Windows updates.Next, protect your system with a good antivirus and supplement it with an Anti malware product. Microsoft Security Essentials is often recommended along with other products.What to do if everything failsIt should be noted that some malware is very good at avoiding scanners. It's possible that once you are infected, it can install rootkits or similar to stay invisible. If things are really bad, the only option is to wipe the disk and reinstall the operating system from scratch. Sometimes a scan using GMER or Kaspersky's TDSS Killer can show you if you have a rootkit.You may want to do a few runs of Spybot Search and Destroy. If after three runs it is unable to remove an infestation (and you fail to do it manually) consider a re-install.Another suggestion: Combofix is a very powerful removal tool when rootkits prevent other things from running or installing. Using multiple scan engines can certainly help to find malwares best hidden, but it's a fastidious task and a good backup/restore strategy will be more efficient and secure.Bonus: There is an interesting video series beginning with, "Understanding and Fighting Malware: Viruses, Spyware" with Mark Russinovich, the creator of Sysinternals ProcessExplorer & Autoruns, about malware cleaning.ShareImprove this answer
Follow
edited Jul 31, 2018 at 9:18
community wiki
25 revs, 21 users 27%William Hilsum1175Wiping the drive is often the quickest and safest route as is being suggested all over this site as the "best answer"
– Ivo FlipseJan 25, 2010 at 18:052From my experience I would not trust spybot as my first choice. Avira, Kaspersky Virus Removal Tool & AVG are good free choice according AV-comparative av-comparatives.org & AV-Test.org: blogs.pcmag.com/securitywatch/2009/12/…
– fluxtenduFeb 20, 2010 at 20:2818One suggestion is that many of these malware programs do steal passwords and bank data, so it's not a bad idea to disconnect from the internet once you do become suspicious of an infection. It very well may be too late, but there's a chance you'll limit data leaks, or prevent the malware from updating itself, until such time as you are successful in your cleaning.
– emgeeApr 15, 2011 at 21:265@emgee Good rule of thumb on data exfiltration: when in doubt, pull it out (the ethernet plug)
– Nate KoppenhaverAug 4, 2011 at 17:176Combofix.org is not the official download location of Combofix, and is not authorized or recommended by Combofix's author. The official download is here.
– Andrew LambertDec 14, 2011 at 19:13 | Show 6 more comments;
91
There are some great malware-fighting tips in Jeff Atwood's "How to Clean Up a Windows Spyware Infestation". Here's the basic process (be sure to read through the blog post for screenshots and other details that this summary glosses over):Stop any spyware currently running. Windows' builtin Task Manager won't cut it; get Sysinternals Process Explorer.Run Process Explorer.Sort the process list by Company Name.Kill any processes that don't have a Company Name (excluding DPCs, Interrupts, System, and System Idle Process), or that have Company Names that you don't recognize.Stop the spyware from restarting the next time the system is booted. Again, Windows' builtin tool, MSconfig, is a partial solution, but Sysinternals AutoRuns is the tool to use.Run AutoRuns.Go through the entire list. Uncheck suspicious entries -- those with blank Publisher names or any Publisher name you don't recognize.Now reboot.After rebooting, recheck with Process Explorer and AutoRuns. If something "comes back", you'll have to dig deeper.In Jeff's example, one something that came back was a suspicious driver entry in AutoRuns. He talks through tracking down the process that loaded it in Process Explorer, closing the handle, and physically deleting the rogue driver.He also found an oddly-named DLL file hooking into the Winlogon process, and demonstrates finding and killing the process threads loading that DLL so that AutoRuns can finally remove the entries.ShareImprove this answer
Follow
edited Jul 31, 2018 at 9:20
community wiki
5 revs, 4 users 84%quack quixote23Also, Trend Micro HijackThis is a free utility that generates an in depth report of registry and file settings from your computer. I will warn this finds good and bad stuff, and makes no distinction, but Google is our friend if we're suspicious.
– Umber FerruleJun 24, 2011 at 20:331Autoruns is fantastic, but the suggestion to rely on the Publisher may not be useful. This stackoverflow question shows how the version information can be easily modified (and therefore spoofed) [stackoverflow.com/questions/284258/…. I tried this on a Java DLL and Autoruns showed the publisher incorrectly.
– AlainDFeb 2, 2016 at 15:50Add a comment | ;
53
My way of removing malware is effective and I have never seen it fail:Download Autoruns and if you still run 32-bit download a rootkit scanner.Boot into Safe Mode and start Autoruns if you are able to, then go to step 5.If you can't get into Safe Mode, connect the disk to another computer.Start Autoruns on that computer, go to File -> Analyze Offline System and fill it in.Wait for the scan to be done.In the Options menu, select everything.Let it scan again by pressing F5. This will go quick as things are cached.Go through the list and uncheck anything that is conspicious or does not have a verified company.Optional: Run the rootkit scanner.Let a top virus scanner remove any files that were left.Optional: Run anti-malware and anti-spyware scanners to get rid of junk.Optional: Run tools like HijackThis/OTL/ComboFix to get rid of junk.Reboot and enjoy your clean system.Optional: Run the rootkit scanner again.Make sure your computer is sufficiently protected!Some remarks:Autoruns is written by Microsoft and thus shows any locations of things that automatically start...Once software is unchecked from Autoruns, it will not start and can't prevent you from removing it...There do not exist rootkits for 64-bit operating systems because they would need to be signed...It is effective because it will disable malware/spyware/viruses from starting,you are free to run optional tools to clean out any junk that was left on your system.ShareImprove this answer
Follow
edited Jul 31, 2018 at 9:20
community wiki
3 revs, 2 users 98%Tom Wijsman1I have infected 64-bit Windows 7, with a virus, not letting to run antiviruses and system utils, and Autoruns still didn't help. I did a question about this. superuser.com/questions/1444463/… . I believe a to tool should be run at system boot to control OS behavior.
– WebComerJul 4, 2019 at 9:20Add a comment | ;
46
Follow the order given below to disinfect your PCOn a PC that is not infected, make a boot AV disc then boot from the disc on the Infected PC and scan the hard drive, remove any infections it finds. I prefer the Windows Defender Offline boot CD/USB because it can remove boot sector viruses, see "Note" below.Or, you can try out some other AV Boot discs.After you have scanned and removed malware using the boot disc, Install free MBAM, run the program and go to the Update tab and update it, then go to the Scanner Tab and do a quick scan, select and remove anything it finds.When MBAM is done install SAS free version, run a quick scan, remove what it automatically selects.If windows system files were infected you may need to run SFC to replace the files, you may have to do this offline if it will not boot due to the removal of the infected system files. I recommend you run SFC after any infection removal is done.In some instances you may have to run a startup repair (Windows Vista and Windows7 only) to get it booting properly again. In extreme cases 3 startup repairs in a row may be needed.MBAM and SAS are not AV softwares like Norton, they are on demand scanners that only scan for nasties when you run the program and will not interfere with your installed AV, these can be run once a day or week to ensure you are not infected. Be sure you update them before each daily-weekly scan.Note: that the Windows Defender Offline product is very good at removing persistent MBR infections which are common these days..For Advanced Users:If you have a single infection that represents itself as software, ie "System Fix" "AV Security 2012" etc, see this page for specific removal guides.ShareImprove this answer
Follow
edited Nov 9, 2012 at 4:29
community wiki
14 revs, 2 users 83%Moab53Having a second pc dedicated to virus scanning is probably the best solution, as you don't rely on the infected drive for your system. However, besides computer support firms, I doubt many people have such ready solution.
– GnoupiJun 28, 2010 at 8:422If no dedicated PC is available, a similar procedure can be carried out by booting the system with a live CD
– Ophir YoktanMar 18, 2011 at 19:28@Ophir: Live CD?
– user46959Jun 20, 2011 at 21:021for example: http://distro.ibiblio.org/tinycorelinux/welcome.html
– Ophir YoktanJun 20, 2011 at 21:21Just as a note the Microsoft Standalone System Sweeper is just the old name of Windows Defender Offline, in case someone found that too.
– Scott ChamberlainMar 16, 2012 at 18:04Add a comment | ;
38
If you notice any of the symptoms then one thing to check is the DNS settings on your network connection.If these have been changed either from "Obtain DNS server address automatically" or to a different server from the one it should be, then that's a good sign that you have an infection. This will be the cause of the redirects away from anti-malware sites, or a complete failure to reach the site at all.It's probably a good idea to take a note of your DNS settings before an infection occurs so you know what they should be. Also the details will be available on the help pages of your ISP's web site.If you don't have a note of the DNS servers and can't find the information on your ISP site then using the Google DNS servers is a good alternative. They can be found at 8.8.8.8 and 8.8.4.4 for the primary and secondary servers respectively.While resetting the DNS won't fix the problem it will allow you to a) reach the anti-malware sites to get the software you need to clean the PC and b) spot if the infection recurs as the DNS settings will change again.ShareImprove this answer
Follow
edited Mar 15, 2017 at 10:35
community wiki
2 revsChrisF0Add a comment | ;
33
RansomwareA newer, particularly horrible form of malware is ransomware. This kind of program, usually delivered with a Trojan (e.g. an e-mail attachment) or a browser exploit, goes through your computer's files, encrypts them (rendering them completely unrecognizable and unusable), and demands a ransom to return them to a usable state.Ransomware generally uses asymmetric-key cryptography, which involves two keys: the public key and the private key. When you get hit by ransomware, the malicious program running on your computer connects to the bad guys' server (the command-and-control, or C&C), which generates both keys. It only sends the public key to the malware on your computer, since that's all it needs to encrypt the files. Unfortunately, the files can only be decrypted with the private key, which never even comes into your computer's memory if the ransomware is well-written. The bad guys usually state that they will give you the private key (thereby letting you decrypt your files) if you pay up, but of course you have to trust them to do so.What you can doThe best option is to reinstall the OS (to remove every trace of malware) and restore your personal files from backups you made earlier. If you don't have backups now, this will be more challenging. Make a habit of backing up important files.Paying up will probably let you recover your files, but please don't. Doing so supports their business model. Also, I say "probably let you recover" because I know of at least two strains that are so poorly written that they irreparably mangle your files; even the corresponding decryption program doesn't actually work.AlternativesFortunately, there's a third option. Many ransomware developers have made mistakes that let the good security professionals develop processes that undo the damage. The process for doing that depends entirely on the strain of ransomware, and that list is constantly changing. Some wonderful people have put together a big list of ransomware variants, including the extensions applied to the locked files and the ransom note name, which can help you identify which version you have. For quite a few strains, that list also has a link to a free decryptor! Follow the appropriate instructions (links are in the Decryptor column) to recover your files. Before you begin, use the other answers to this question to make sure the ransomware program is removed from your computer.If you can't identify what you got hit with from only the extensions and ransom note name, try searching the Internet for a few distinctive phrases from the ransom note. Spelling or grammar mistakes are usually fairly unique, and you'll likely come upon a forum thread that identifies the ransomware.If your version isn't yet known, or doesn't have a free way to decrypt the files, don't give up hope! Security researchers are working on undoing ransomware and law enforcement is pursuing the developers. It's possible that a decryptor will eventually appear. If the ransom is time-limited, it's conceivable that your files will still be recoverable when the fix is developed. Even if not, please don't pay unless you absolutely have to. While you're waiting, make sure your computer is free of malware, again using the other answers to this question. Consider backing up the encrypted versions of your files to keep them safe until the fix comes out.Once you recover as much as possible (and make backups of it to external media!), strongly consider installing the OS from scratch. Again, that will blow away any malware that lodged itself deep inside the system.Additional variant-specific tipsSome ransomware-variant-specific tips that aren't yet in the big spreadsheet:If the decryption tool for LeChiffre doesn't work, you can recover all but the first and last 8KB of each file's data using a hex editor. Jump to address 0x2000 and copy out all but the last 0x2000 bytes. Small files will be completely wrecked, but with some fiddling you might be able to get something helpful out of larger ones.If you've been hit with WannaCrypt and you're running Windows XP, haven't rebooted since the infection, and are lucky, you might be able to extract the private key with Wannakey.Bitdefender has a number of free tools to help identify the variant and to decrypt some specific variants.(others will be added as they are discovered)ConclusionRansomware is nasty, and the sad reality is that it's not always possible to recover from it. To keep yourself safe in the future: Keep your operating system, web browser, and antivirus up to dateDo not open e-mail attachments you weren't expecting, especially if you don't know the senderAvoid sketchy web sites (i.e. those featuring illegal or ethically dubious content)Make sure your account only has access to documents you personally need to work withAlways have working backups on external media (not connected to your computer)!ShareImprove this answer
Follow
edited Oct 26, 2018 at 23:55
community wiki
5 revs, 3 users 97%Ben N4There are a few programs now available that supposedly protect you against ransomware, for example: winpatrol.com/WinAntiRansom (a commercial program). I've never used this because I'm no longer on Windows, but that company's WinPatrol product is one I used for years and have frequently recommended. A few of the antivirus developers have anti-ransomware tools available, sometimes as a higher-cost option.
– fixer1234Sep 13, 2016 at 22:37For information specifically about removing Petya ransomware, also see this question and answer: superuser.com/questions/1063695/…
– fixer1234Sep 14, 2016 at 1:322I'd add another thing to the list of advice in the conclusion: Avoid visiting sites that promote illegal or amoral behavior, such as media and software piracy; content that is outlawed in most parts of the world; etc. These sites often contract with the least reputable advertising vendors, who make no real effort to filter the content of their "ads" at all, making it easy for criminals to inject your webpage with content that delivers malware or attempts to exploit your browser to gain access to your system. Sometimes even a good adblocker will miss this stuff.
– allquixoticSep 14, 2016 at 17:50@allquicatic I added a bullet point in that vein. Let me know if anything else can be expanded. Thanks!
– Ben NSep 14, 2016 at 18:18Add a comment | ;
31
There is a wide variety of malware. Some of it is trivial to find and remove. Some of it is trickier. Some of it is really difficult to find, and very hard to remove.But even if you have a mild malware you should strongly consider reformating and reinstalling the OS. This is because your security has already failed, and if it failed for a simple malware maybe you're already infected with a vicious malware.People working with sensitive data or inside networks where sensitive data is held should strongly consider wipe and re-install. People whose time is valuable should strongly consider wipe and re-install (it's quickest and easiest and surest method). People who are not comfortable with advanced tools should strongly consider wipe and re-install.But people who have the time, and enjoy noodling around, can try methods listed in other posts.ShareImprove this answer
Follow
answered Oct 4, 2011 at 19:08
community wiki
DanBeale
13Correct. This stuff is designed to go around security and cleaning and mundane OS use. Don't take part in an arms race. Zero tolerance is the only policy.
– XTLMar 7, 2012 at 12:59Add a comment | ;
30
The possible solutions for a virus infection are in order: (1) antivirus scans, (2) system repair, (3) total reinstall.Make first sure that all your data is backed up.Load and install some antiviruses, make sure they are up to date, and scan deeply your hard disk. I recommend using at least Malwarebytes' Anti-Malware. I also like Avast.If that doesn't work for any reason, you may use a rescue live-CD virus scanner : I like best Avira AntiVir Rescue System because it gets updated several times a day and so the download CD is up-to-date. As a boot CD it's autonomous and doesn't work using your Windows system.If no virus is found, use "sfc /scannow" to repair important Windows files.See this article.If that also doesn't work, you should Perform a Repair Installation.If nothing works, you should format the hard disk and reinstall Windows.ShareImprove this answer
Follow
answered Feb 8, 2010 at 18:10
community wiki
harrymc
12When infected with a recent virus/trojan I used Knoppix on a USB stick, ran apt-get wine, installed Dr Web Cure-It in my wine session, and ran that to clean my infection. I had to do it this way because my laptop wouldn't boot some of the other live-CD alternatives.
– PP.Feb 24, 2010 at 17:15Add a comment | ;
23
Another tool I would like to add to the discussion is the Microsoft Safety Scanner. It was just released a few months ago. It is a bit like the Malicious Software Removal Tool, but designed for offline use. It will have the latest definitions as of the moment you download it and will only be useable for 10 days as it will consider its definitions file "too old to use". Download it with another computer and run this in safe mode. It works pretty well.ShareImprove this answer
Follow
edited Aug 22, 2011 at 12:40
community wiki
2 revs, 2 users 73%Scott ChamberlainAdd a comment | ;
23
A bit of theory first: please realize that there is no substitute for understanding. The ultimate antivirus is to understand what you are doing and generally what is going on with your system, with your own mind and in the so-called reality. No amount of software or hardware will fully protect you from yourself and from your own actions which in most cases is how the malware gets into a system in the first place.Most modern "production level" malware, adware and spyware rely on various "social engineering" tricks to fool you into installing "useful" apps, add-ons, browser toolbars, 'virus scanners' or clicking big green Download buttons which will install malware on your machine.Even an installer for a supposedly trusted app, such as e.g. uTorrent, would install by default adware and possibly spyware if you simply click the Next button, and don't take the time to read what all the checkboxes mean.The best way to fight the social engineering tricks that hackers use is reverse social engineering - if you master this technique you will manage to avoid most types of threats and keep your system clean and healthy even without an antivirus or firewall.If you have noticed signs of malicious/unsolicited life forms inhabiting your system the only clean solution would be to fully reformat and reinstall your system. Make a backup as described in other answers here, quick format the discs and reinstall your system, or, even better, move the useful data to some external storage, and re-image the system partition from a clean partition dump you have made earlier.Some computers have a BIOS option to revert the system to the original factory settings. Even if this might seem a bit of an overkill, it will never hurt and, more importantly, this will solve all the other eventual issues, whether you are aware of them or not, without having to handle each issue one by one.The best way to 'fix' a compromised system is to not fix it at all, but instead revert to a known 'good' snapshot using some kind of partition imaging software, such as Paragon Disk Manager, Paragon HDD Manager, Acronys Disk Manager, or e.g. dd if you made the backup from Linux.ShareImprove this answer
Follow
edited Jul 25, 2015 at 4:30
community wiki
5 revs, 2 users 98%ccpizzaAdd a comment | ;
12
With Reference to William Hilsum "How Do I Get Rid Of This: Using A Live CD" above:A virus won't be able to run in a live CD environment, so you can make temporary use of your computer without fear of further infection. Best of all you can access all your files. On June 20th 2011 Justin Pot wrote a booklet entitled "50 Cool Uses for Live CDs". The beginning of the booklet explains how to boot from CD, Flash Drive or SD Card, and pages 19-20 explain about scanning with different "antimalwares" some that were already mentioned. The advice given is invaluable for this scenario, and is explained in easy to understand English. Of course the rest of the booklet is invaluable for your other computing needs. (the link to the download (in PDF format) is provided from the link below. Always remember to be sensible when using the internet, don't be tempted to stray to "places" where malware is very likely to be lurking, and you should be fine. Any Antivirus, Internet Security Suites etc that you maybe using should have the latest updates, and whichever OS you maybe using should also be kept up to date.http://www.makeuseof.com/tag/download-50-cool-live-cds/ Once you have clicked on or copied and pasted the above link, please then click onDOWNLOAD 50 Cool Uses for Live CDs (written in blue)Please Note I tried to write this in the comments section, but couldn't fit it in. So I have given it in an official answer, as it is invaluable.ShareImprove this answer
Follow
edited Jun 20, 2017 at 13:56
community wiki
4 revs, 2 users 83%Simon1I should disagree: IMHO if a virus is present in one file on the HDD even if the system starts Clean from the livecd it's always possible to execute the malicious code when you execute the infected file. If not detected or stopped it can even spread on other files or devices.
– HasturFeb 13, 2015 at 12:27Add a comment | ;
9
Two important points:Don't get infected in the first place. Use a good firewall and antivirus, and practice "safe computing" -- stay away from questionable sites and avoid downloading stuff when you don't know where it's coming from.Be aware that many sites on the web will tell you you're "infected" when you aren't -- they want to trick you into buying their junky anti-spyware, or, worse, they want you do download stuff that is, in fact, spyware disguised as a "free antispyware application". Similarly, be aware that many on this site, mostly out of stupidity, will diagnose any "odd" error, particularly the sort of registry corruption that Windows is famous for, as signs of spyware.ShareImprove this answer
Follow
answered Dec 5, 2012 at 21:39
community wiki
Daniel R Hicks
Add a comment | ;
8
As suggested before in this topic, if you ARE SURE you are infected, use a linux live CD to boot your computer and immediately backup all your sensitive data.It is also a good practice to have your sensitive files stored in a hard drive different from your OS boot drive. this way you can safely format the infected system and run a comprehensive scan on your sensitive data just to be on the safe side.As a matter of fact, there is no best solution than to format the system partition to make sure you run a virus and malware free environment. Even if you run a good tool (and no doubt there are many out there), there are always leftovers left behind and your system may seem clean at the moment, but it surely becomes a time-bomb awaiting to explode later.ShareImprove this answer
Follow
answered Jan 13, 2013 at 21:07
community wiki
Lorenzo Von Matterhorn
Add a comment | ;
7
On December 8th 2012. Remove-Malware released a video tutorial entitled "Remove Malware Free 2013 Edition" together with a complementary Guide outlining how to get rid of malware from your infected PC for free.They outlineBackup – How to backup up your important personal documents just in-case your PC become inaccessible.Gathering the needed software for this guide.Bootable Antivirus – Why bootable antivirus is the best way to remove malware.Bootable Antivirus Disc – How to create a bootable antivirus disc.Bootable Antivirus Disc – How to scan your PC with a bootable antivirus disc.Cleanup – Round up the remnants and remove them.Prevent it from happening againThe Video Tutorial is over 1 hour long in duration and together with the written guide is an excellent resource.The video tutorial:linkWritten Guide:linkUpdate:A very informative article written today 1st February 2013 by J. Brodkin entitled "Viruses, Trojans, and worms, oh my: The basics on malwareMobile malware may be trendy, but PC malware is still the big problem." from arstechnica.com highlights the continual problem of malware & different types of malware with explanations of each, highlighting:BackdoorsRemote Access TrojansInformation stealersRansomwareThe article also highlights the spreading of malware, botnet operation and businesses under attack.ShareImprove this answer
Follow
edited Oct 22, 2013 at 18:08
community wiki
4 revs, 2 users 83%SimonAdd a comment | ;
1
SHORT ANSWER:Backup all your files.Format your system partition.Reinstall Windows.Install antivirus.Update your windows.Scan your backup with antivirus before starting to use it.Today you can never be sure that you've completely removed an infestation, except if you wipe your drive and start over.ShareImprove this answer
Follow
edited Jul 18, 2018 at 14:00
community wiki
2 revs, 2 users 94%svin83Add a comment | ;
0
I do not think that AV programs such as MSE, MCAfee, Norton, Kaspersky, etc. can protect you 100% because their definition files always come after the fact - after the malware is already out there on the web and can have done a lot of damage. And many of those do not protect you against PUPs and Adware.I also do not think that the scanners like Malwarbytes, Superantispyware, Bitdefender scanner and others can help a lot when the malware has already damaged your system. If you have enough scanners, you will be able to remove the malware but you will not be able to repair the damage that this malware has done.I therefore have developed a two layer strategy:I make weekly images (I use free Macrium) of my system partition and my data partition to two external disks that are only connected during the imaging. Thus no malware can get to them. Should something not work in my system, I can always restore the latest image. I usually keep half a dozen full images in case I have to go back further than last week. In addition I have system restore enabled in my OS so that I can quickly set back in case of a faulty update. But system images (shadows) are not very reliable because they can disappear for various reasons. Relying on system images alone does not suffice.Most of my internet work I do from a virtual Linux partition. Linux itself is not the target of malware and Windows malware cannot effect Linux. With that system I doall my downloads and checking them with Virus Total before I move them to the Windows system. Virus Total runs the file thru 60 of the best known AV programs and if it comes out clean, chances are very high that it is clean.all internet access to websites where I am not 100% certain that they are clean - like e.g. this website here.all my mail. That is the advantage of Gmail and AOL. I can check my mail with my browser. Here I can open any piece of mail without being afraid to get a virus. And attachments I run thru Virus Total.all my on-line banking. Linux provides me with an extra layer of securityWith this approach I have not seen any malware in years. If you like to try a virtual Linux partition, here is how.ShareImprove this answer
Follow
edited Mar 23, 2015 at 22:09
community wiki
3 revs, 2 users 92%whs3In what way is this an answer to "What should I do if my Windows computer seems to be infected with a virus or malware?"
– Andrew MortonMar 23, 2015 at 21:59@whs: Andrew Morton is right about this not being an answer to this question, but it is a great answer to a different question, and it would be a real shame if it gets downvoted for being in the wrong place. Ask a new question, like, "How can I avoid getting malware infections beyond just running an A/V program and avoiding shady web sites", and post this answer there.
– fixer1234Mar 23, 2015 at 22:17I know this is an old answer, but I have to add my 2 cents. Linux is not immune to all malware. en.wikipedia.org/wiki/Linux_malware Also, constantly making backups of a personal computer in not within the purview of 99% of the average users.
– computercarguyJan 11, 2018 at 22:06Add a comment | ;
-15
The problem with scanning malware externally or with a live CD is that many of these nasty pieces of software hook into memory processes, drivers and much more. If the PC's operating system is not loaded neither are they which makes for a frustrating removal process. ALWAYS scan for malware while the infected OS is booted.With that said, load up Windows with a copy of RKILL on a USB drive. Running this utility kills any malware process chugging away in the background, allowing you to do move forward with the removal. It is VERY effective. I have yet to run into a situation where the program has failed its job and I'm surprised at how many techs have never heard of it.Next I choose to scan with either Malware bytes or ComboFix. The nice perk about these scanners is rather than utilizing virus definitions, they locate malware relentlessly based on behavior - a very effective technique. A word of warning though - they are also much more dangerous and can REALLY wreck some serious shop on your OS. Make sure you have a backup.90 percent of the time the above process works for me and I remove a TON of these things on the daily. If your extra paranoid, running a scan with something like AVG, SuperAntiSpyware or Microsoft Security Essentials may not be a bad idea. Although I haven't seen these programs detect much more than the harmless tracker cookie, some people swear by them. Give yourself the peace of mind and do it if you must.ShareImprove this answer
Follow
answered Oct 14, 2012 at 4:13
community wiki
Scandalist
211ALWAYS scan for malware while the infected OS is booted...that's kinda like saying Always fight the enemy while they're paying attention. If your malware scanner can't find the malicious code while it's at rest in a file, it doesn't stand a chance against the code while it's in memory able to perform it's voodoo cloaking stunts.
– I say Reinstate MonicaNov 1, 2014 at 1:361So you want to load the OS, so that the malicious processes are running, and THEN you want to kill the processes so you can remove them? That's just backwards in my opinion.
– svin83Dec 3, 2015 at 11:12Add a comment | |
How to install TP-Link TL-WN722N USB Wireless Adapter on Debian Wheezy armhf? | wireless-networking;debian-wheezy;wireless-networking;debian-wheezy | How to install TP-Link TL-WN722N USB Wireless Adapter on Debian Wheezy armhf?
Ask Question
|
5
This is a long shot, to a quite old question that I hope you've found the answer for...I did the following to get it working on my system, also Wheezy.Added the non-free packages to /etc/apt/sources.listapt-get updateapt-get install firmware-atherosrebootAnd it showed up in iw list :)HTHs someone!ShareImprove this answer
Follow
answered Oct 8, 2015 at 9:00geekscrapgeekscrap16611 silver badge22 bronze badges2I already resolved my problem. For my case installing the firmware simply wasn't enough, so I also have to install ath9k_htc driver. I put some thorough explanation in udoo.org/forum/threads/… that link is for embedded board but the same principle apply for any Wheezy system. Thanks for answering, I'll mark your answer as accepted.
– Raymond LagondaNov 29, 2016 at 10:07Hi, will this work on TL-WN823N?
– Bertram GilfoyleFeb 25, 2019 at 20:19Add a comment | |
Ubuntu: secure a folder & contents ? | ubuntu;permissions;root;ubuntu;permissions;root | Ubuntu: secure a folder & contents ?
Ask Question
|
0
you can use sudo to let users use apt-get, but if the folder is owned by root and set to 700, and the users are not in the wheel group, they should not be able to access it in any way.visudo you can explicit grant the command /usr/bin/apt-get to the user(s) or group(s)userA ALL=(ALL) /usr/bin/apt-getor%groupA ALL=(ALL) /usr/bin/apt-getthen, this is all you need:chmod 700 secret_folder; chown root:root secret_folerShareImprove this answer
Follow
answered Nov 6, 2014 at 14:29johnshen64johnshen644,5731616 silver badges1111 bronze badges1Wow, quick response & absolutely what I was looking for!
– Ross The BossNov 6, 2014 at 14:37Add a comment | ;
0
You can stop access to a folder by clearing execute permission, but this won't hide it. To hide it you would need to enclose in another inaccessible folder, called something innocuous like /.system.Logged in as root do the following:-mkdir /.systemmkdir /.system/SecretFolderchmod 700 /.systemIf you make sure apt-get is owned by root and do:-chmod a+s `which apt-get`This gives users root access while running apt-get without needing to give them access to sudo.ShareImprove this answer
Follow
answered Nov 6, 2014 at 14:46AFHAFH17k33 gold badges3030 silver badges4848 bronze badges4If you give everyone root access while running apt-get, what stops them from apt-get 'ing a program that changes permissions on that folder... ?
– Ross The BossNov 6, 2014 at 14:55Any such program would work only if it broke the security system, and I would not expect apt-get to have such a program available, and I am not sure it's even possible without cracking the root password.
– AFHNov 6, 2014 at 18:03This solution will give E: Unable to write to /var/cache/apt/ E: The package lists or status file could not be parsed or opened. though ... not sure why.
– Ross The BossNov 7, 2014 at 16:02Sorry about that. I checked that set user ID works with an editor, and I could edit files in root directories, and perform commands requiring root privileges. I could run sh and get root privileges, but running bash got me original owner privileges. I can only surmise that apt-get calls bash scripts to do some of its work.
– AFHNov 7, 2014 at 17:46Add a comment | ;
0
Okay, neither solution is completely correct. But... for future reference where is what works & why: sudo visudo# ... then put this at the end of the fileusername ALL = NOPASSWD: /usr/bin/apt-getmy experience was if you do this with the other combos of (ALL), other files seem to be lockedSecret Foldersumkdir .some_other_foldercd .some_other_foldermkdir secret_foldercd ../chmod -R 700 .some_other_folderchown -R root:root .some_other_folderFinal result : .some_other_folder/secret_folderthis works because ls will not even show .some_other_folder, but even if they do use something like ls -las , cd .some_other_folder is denied. Hope that helps somebody. ShareImprove this answer
Follow
answered Nov 7, 2014 at 16:34Ross The BossRoss The Boss10133 bronze badgesAdd a comment | |
Can My ISP's Assigning me a New IP Explain Poor Performance on my Home Network? | router;performance;home-networking;dhcp;isp;router;performance;home-networking;dhcp;isp | Can My ISP's Assigning me a New IP Explain Poor Performance on my Home Network?
Ask Question
|
3
No, but there can be numerous causes for low transfer rates on your local network. In many cases, the router is at fault and if so, rebooting it may (temporarily) solve the problem. The assignment of a new IP address is an unrelated side-effect of rebooting.ShareImprove this answer
Follow
answered Nov 6, 2014 at 14:01Marcks ThomasMarcks Thomas6,23222 gold badges2121 silver badges3737 bronze badgesAdd a comment | |
How to protect my files on external harddisk from being deleted [duplicate] | hard-drive;external-hard-drive;file-permissions;hard-drive;external-hard-drive;file-permissions | How to protect my files on external harddisk from being deleted [duplicate]
Ask Question
|
1
This can't be done if you give the HDD away. Physical access to the device implies write access. ShareImprove this answer
Follow
answered Nov 6, 2014 at 13:52Marcks ThomasMarcks Thomas6,23222 gold badges2121 silver badges3737 bronze badgesAdd a comment | ;
0
Sorry, but encryption is the only way. Dropbox sharing is a good idea for this sort of thing if you don't end up filling your drive though. On the other hand, password-locked zip documents are a possibility... But deleting it is still possible.ShareImprove this answer
Follow
answered Nov 6, 2014 at 14:49Vector LightningVector Lightning13111 gold badge22 silver badges55 bronze badgesAdd a comment | ;
0
If you give him physical access then only solution against deletion is always having a backup at all times.ShareImprove this answer
Follow
answered Nov 16, 2014 at 22:10LukeLuke79022 gold badges66 silver badges1818 bronze badgesAdd a comment | |
chrome extension to control brightness on any website [closed] | google-chrome-extensions;brightness;google-chrome-extensions;brightness | chrome extension to control brightness on any website [closed]
Ask Question
|
2
Have a look to this extension, Sunglasses:https://chrome.google.com/webstore/detail/sunglasses/elcjekocfhomlfniihikpmbbgjdbgcooShareImprove this answer
Follow
answered Nov 6, 2014 at 13:39neoDevneoDev1,13455 gold badges1414 silver badges2121 bronze badgesAdd a comment | |
How can we add imported Developer certificates in Mac can be added to key chain | macos;code-signing;macos;code-signing | How can we add imported Developer certificates in Mac can be added to key chain
Ask Question
|
2
Today i had the same issue, I solved as reported here: link to macrumorsThe issue is:The certificate has a key length of 8192 bits, signature algorithm of SHA256RSA.Mac OS won't import CA certs with this lenght, so:sudo defaults write /Library/Preferences/com.apple.security RSAMaxKeySize -int 8192and after a reboot I was able to import it.ShareImprove this answer
Follow
answered Jul 23, 2015 at 9:07MiPnamicMiPnamic15877 bronze badgesAdd a comment | |
After Installation of Visual studio 2013 on Windows 8 [closed] | windows-7;windows;networking;windows-8;partitioning;windows-7;windows;networking;windows-8;partitioning | After Installation of Visual studio 2013 on Windows 8 [closed]
Ask Question
|
1
Please try disabling the "Hardware Graphics Acceleration" in Visual Studio. Please follow the below steps and check the outcome. Tools > Options > Environment > General > deselect the "Automatically adjust visual experience based on client performance", "Use hardware graphics acceleration if available" and "Enable rich client visual experience" options. Hope this helps.ShareImprove this answer
Follow
answered Nov 6, 2014 at 13:15vembutechvembutech6,18211 gold badge1919 silver badges2121 bronze badges1How would this option cause his computer to boot slower than normal?
– RamhoundNov 6, 2014 at 14:53Add a comment | |
How can I remove malicious spyware, malware, adware, viruses, trojans or rootkits from my PC? | windows;anti-virus;virus;malware;community-faq;windows;anti-virus;virus;malware;community-faq | How can I remove malicious spyware, malware, adware, viruses, trojans or rootkits from my PC?
Ask Question
|
291
Here's the thing: Malware in recent years has become both sneakier and nastier:Sneakier, not only because it's better at hiding with rootkits or EEPROM hacks, but also because it travels in packs. Subtle malware can hide behind more obvious infections. There are lots of good tools listed in answers here that can find 99% of malware, but there's always that 1% they can't find yet. Mostly, that 1% is stuff that is new: the malware tools can't find it because it just came out and is using some new exploit or technique to hide itself that the tools don't know about yet.Malware also has a short shelf-life. If you're infected, something from that new 1% is very likely to be one part of your infection. It won't be the whole infection: just a part of it. Security tools will help you find and remove the more obvious and well-known malware, and most likely remove all of the visible symptoms (because you can keep digging until you get that far), but they can leave little pieces behind, like a keylogger or rootkit hiding behind some new exploit that the security tool doesn't yet know how to check. The anti-malware tools still have their place, but I'll get to that later.Nastier, in that it won't just show ads, install a toolbar, or use your computer as a zombie anymore. Modern malware is likely to go right for the banking or credit card information. The people building this stuff are no longer just script kiddies looking for fame; they are now organized professionals motivated by profit, and if they can't steal from you directly, they'll look for something they can turn around and sell. This might be processing or network resources in your computer, but it might also be your social security number or encrypting your files and holding them for ransom.Put these two factors together, and it's no longer worthwhile to even attempt to remove malware from an installed operating system. I used to be very good at removing this stuff, to the point where I made a significant part of my living that way, and I no longer even make the attempt. I'm not saying it can't be done, but I am saying that the cost/benefit and risk analysis results have changed: it's just not worth it anymore. There's too much at stake, and it's too easy to get results that only seem to be effective.Lots of people will disagree with me on this, but I challenge they are not weighing consequences of failure strongly enough. Are you willing to wager your life savings, your good credit, even your identity, that you're better at this than crooks who make millions doing it every day? If you try to remove malware and then keep running the old system, that's exactly what you're doing.I know there are people out there reading this thinking, "Hey, I've removed several infections from various machines and nothing bad ever happened." Me too, friend. Me too. In days past I have cleaned my share of infected systems. Nevertheless, I suggest we now need to add "yet" to the end of that statement. You might be 99% effective, but you only have to be wrong one time, and the consequences of failure are much higher than they once were; the cost of just one failure can easily outweigh all of the other successes. You might even have a machine already out there that still has a ticking time bomb inside, just waiting to be activated or to collect the right information before reporting it back. Even if you have a 100% effective process now, this stuff changes all the time. Remember: you have to be perfect every time; the bad guys only have to get lucky once.In summary, it's unfortunate, but if you have a confirmed malware infection, a complete re-pave of the computer should be the first place you turn instead of the last.Here's how to accomplish that:Before you're infected, make sure you have a way to re-install any purchased software, including the operating system, that does not depend on anything stored on your internal hard disk. For this purpose, that normally just means hanging onto cd/dvds or product keys, but the operating system may require you to create recovery disks yourself.1 Don't rely on a recovery partition for this. If you wait until after an infection to ensure you have what you need to re-install, you may find yourself paying for the same software again. With the rise of ransomware, it's also extremely important to take regular backups of your data (plus, you know, regular non-malicious things like hard drive failure).When you suspect you have malware, look to other answers here. There are a lot of good tools suggested. My only issue is the best way to use them: I only rely on them for the detection. Install and run the tool, but as soon as it finds evidence of a real infection (more than just "tracking cookies") just stop the scan: the tool has done its job and confirmed your infection.2At the time of a confirmed infection, take the following steps:Check your credit and bank accounts. By the time you find out about the infection, real damage may have already been done. Take any steps necessary to secure your cards, bank account, and identity.Change passwords at any web site you accessed from the compromised computer. Do not use the compromised computer to do any of this.Take a backup of your data (even better if you already have one).Re-install the operating system using original media obtained directly from the OS publisher. Make sure the re-install includes a complete re-format of your disk; a system restore or system recovery operation is not enough.Re-install your applications.Make sure your operating system and software is fully patched and up to date.Run a complete anti-virus scan to clean the backup from step three.Restore the backup.If done properly, this is likely to take between two and six real hours of your time, spread out over two to three days (or even longer) while you wait for things like apps to install, windows updates to download, or large backup files to transfer... but it's better than finding out later that crooks drained your bank account. Unfortunately, this is something you should do yourself, or a have a techy friend do for you. At a typical consulting rate of around $100/hr, it can be cheaper to buy a new machine than pay a shop to do this. If you have a friend do it for you, do something nice to show your appreciation. Even geeks who love helping you set up new things or fix broken hardware often hate the tedium of clean-up work. It's also best if you take your own backup... your friends aren't going to know where you put what files, or which ones are really important to you. You're in a better position to take a good backup than they are.Soon even all of this may not be enough, as there is now malware capable of infecting firmware. Even replacing the hard drive may not remove the infection, and buying a new computer will be the only option. Thankfully, at the time I'm writing this we're not to that point yet, but the day is definitely approaching fast.If you absolutely insist, beyond all reason, that you really want to clean your existing install rather than start over, then for the love of God make sure whatever method you use involves one of the following two procedures:Remove the hard drive and connect it as a guest disk in a different (clean!) computer to run the scan.ORBoot from a CD/USB key with its own set of tools running its own kernel. Make sure the image for this is obtained and burned on a clean computer. If necessary, have a friend make the disk for you.Under no circumstances should you try to clean an infected operating system using software running as a guest process of the compromised operating system. That's just plain dumb.Of course, the best way to fix an infection is to avoid it in the first place, and there are some things you can do to help with that:Keep your system patched. Make sure you promptly install Windows Updates, Adobe Updates, Java Updates, Apple Updates, etc. This is far more important even than anti-virus software, and for the most part it's not that hard, as long as you keep current. Most of those companies have informally settled on all releasing new patches on the same day each month, so if you keep current it doesn't interrupt you that often. Forced Windows Update reboots typically only happen when you ignore the notices for too long. If this happens to you often, it's on you to change your behavior. These are important, and it's not okay to continually just choose the "install later" option, even if it's easier in the moment.Do not run as administrator by default. In recent versions of Windows, it's as simple as leaving the UAC feature turned on.Use a good firewall tool. These days the default firewall in Windows is actually good enough. You may want to supplement this layer with something like WinPatrol that helps stop malicious activity on the front end. Windows Defender works in this capacity to some extent as well. Basic Ad-Blocker browser plugins are also becoming increasingly useful at this level as a security tool.Set most browser plug-ins (especially Flash and Java) to "Ask to Activate".Run current anti-virus software. This is a distant fifth to the other options, as traditional A/V software often just isn't that effective anymore. It's also important to emphasize the "current". You could have the best antivirus software in the world, but if it's not up to date, you may just as well uninstall it.For this reason, I currently recommend Microsoft Defender. There are likely far better scanning engines out there, but Microsoft Defender is built into Windows and will keep itself up to date via the normal Windows Update mechanism, without ever risking an expired registration. AVG and Avast also work well in this way. I just can't recommend any anti-virus software you have to actually pay for, because it's just far too common a paid subscription lapses and you end up with out-of-date definitions.It's also worth noting here that Mac users now need to run antivirus software, too. The days when they could get away without it are long gone. As an aside, I think it's hilarious I now must recommend Mac users buy anti-virus software, but advise Windows users against it.Avoid torrent sites, warez, pirated software, and pirated movies/videos. This stuff is often injected with malware by the person who cracked or posted it — not always, but often enough to avoid the whole mess. It's part of why a cracker would do this: often they will get a cut of any profits.Use your head when browsing the web. You are the weakest link in the security chain. If something sounds too good to be true, it probably is. The most obvious download button is rarely the one you want to use any more when downloading new software, so make sure to read and understand everything on the web page before you click that link. If you see a pop up or hear an audible message asking you to call Microsoft or install some security tool, it's a fake.Also, prefer to download the software and updates/upgrades directly from vendor or developer rather than third party file hosting websites.1 Microsoft now publishes the Windows 10 install media so you can legally download and write to an 8GB or larger flash drive for free. You still need a valid license, but you don't need a separate recovery disk for the basic operating system any more.2 This is a good time to point out that I have softened my approach somewhat. Today, most "infections" fall under the category of PUPs (Potentially Unwanted Programs) and browser extensions included with other downloads. Often these PUPs/extensions can safely be removed through traditional means, and they are now a large enough percentage of malware that I may stop at this point and simply try the Add/Remove Programs feature or normal browser option to remove an extension. However, at the first sign of something deeper — any hint the software won't just uninstall normally — and it's back to repaving the machine.ShareImprove this answer
Follow
edited Jul 28, 2022 at 20:34
answered Nov 30, 2012 at 15:16Joel CoehoornJoel Coehoorn28k1313 gold badges8686 silver badges132132 bronze badges115This seems to be the wisest, nowadays, indeed. I would add that there is another reason for some malware to be sneaky: they will remain dormant, and use your computer for other activities. Could be proxying, storing things more or less illegal, or be a part of a DDOS attack.
– GnoupiNov 30, 2012 at 15:232@ConradFrix Too soon to say... I haven't needed to do this to a Windows 8 PC yet... but I'm pessimistic because it doesn't result in reformatting the drive. Windows 8 includes several security improvements, including running antivirus software from time 0 as part of the OS, such that I'm hopeful to never need to do this for Windows 8 at all.
– Joel CoehoornNov 30, 2012 at 20:115@DanielRHicks read the full sentence. It's two to six hours of your time, spread over a day or three where you are efficient about kicking something off and checking back later. If you're baby-sitting everything, then yeah: it's gonna take a while.
– Joel CoehoornDec 5, 2012 at 22:212@JoelCoehoorn Is it just me, or malware this advanced would also infect firmware on all kinds of components making any removal effort futile?
– Enis P. AginićOct 6, 2014 at 11:335Please remember that if you take a backup AFTER you discover the infection, it is highly probable that the backup itself is infected. Please scan the backup before attempting a restore.
– Tejas KaleAug 14, 2016 at 8:43 | Show 6 more comments;
206
How can I tell if my PC is infected?General symptoms for malware can be anything. The usual are:The machine is slower than normal.Random failures and things happening when they shouldn't (e.g. some new viruses put group policy restrictions on your machine to prevent task manager or other diagnostic programs from running).Task manager shows a high CPU when you think your machine should be idle (e.g. <5%).Adverts popping up at random.Virus warnings popping up from an antivirus you don't remember installing (the antivirus program is a fake and tries to claim you have scary sounding viruses with names like 'bankpasswordstealer.vir'. You're encouraged to pay for this program to clean these).Popups/ fake blue screen of death (BSOD) asking you to call a number to fix the infection.Internet pages redirected or blocked, for example, home pages of AV products or support sites (www.symantec.com, www.avg.com, www.microsoft.com) are redirected to sites filled with adverts, or fake sites promoting bogus anti virus / "helpful" removal tools, or are blocked altogether. Increased startup time, when you have not been installing any applications (or patches)... This one is awkward.Your personal files are encrypted and you see a ransom note.Anything out the blue, if you "know" your system, you typically know when something is very wrong.How do I get rid of this?Using a Live CDSince the infected PC's virus scanner might be compromised, it's probably safer to scan the drive from a Live CD. The CD will boot a specialized operating system on your computer, which will then scan the hard drive.There are, for example, Avira Antivir Rescue System or ubcd4win. More suggestions can be found at FREE Bootable AntiVirus Rescue CDs Download List such as: Kaspersky Rescue CDBitDefender Rescue CDF-Secure Rescue CDAvira Antivir Rescue DiskTrinity Rescue Kit CDAVG Rescue CDConnecting the hard drive to another PCIf you are connecting the infected hard drive to a clean system in order to scan it, make sure that you update the virus definitions for all the products that you will be using to scan the infected drive. Waiting a week to let the antivirus providers release new virus definitions can improve your chances of detecting all the viruses. Make sure your infected system remains disconnected from the internet as soon as you find it is infected. This will prevent it from being able to download new editions of viruses (among other things).Start with a good tool such as Spybot Search and Destroy or Malwarebytes' Anti-Malware and perform a full scan. Also try ComboFix, and SuperAntiSpyware. No single antivirus product will have every virus definition. Using multiple products is key (not for real time protection). If even just one virus remains on the system, it may be able to download and install all the latest editions of new viruses and all the effort so far would have been for nothing.Remove suspicious programs from bootStart up in safe mode.Use msconfig to determine what programs and services start at boot (or startup under task manager in Windows 8).If there are programs/services that are suspicious, remove them from the boot. Else skip to using a live CD.Restart.If the symptoms do not go away and/or the program replaces itself at startup, try using a program called Autoruns to find the program, and remove it from there. If your computer cannot start up, Autoruns has a feature where it can be run from a second PC called "Analyse offline PC". Pay especially close attention to the Logon and Scheduled tasks tabs.If there is still no success in removing the program, and you are sure that it is the cause of your problems, boot into regular mode, and install a tool called UnlockerNavigate to the location of the file that is that virus, and attempt to use unlocker to kill it. A few things may happen:The file is deleted, and does not reappear on restart. This is the best case.The file is deleted, but immediately reappears. In this case, use a program called Process Monitor to find out the program that re-created the file. You will need to delete that program as well.The file cannot be deleted, unlocker will prompt you to delete it on reboot. Do that, and see if it reappears. If it does, you must have a program in boot that causes that to happen, and re-examine the list of programs that run in boot.What to do after restoringNow it should be safe (hopefully) to boot into your (previously) infected system. Still, keep your eyes open for signs of infection. A virus can leave changes on a computer that would make it easier to re-infect even after the virus has been removed. For example, if a virus changed DNS or proxy settings, your computer would redirect you to fake versions of legitimate websites, so that downloading what appears to be a well-known and trusted program could actually be downloading a virus. They could also get your passwords by redirecting you to fake bank account sites or fake email sites. Be sure to check your DNS and proxy settings. In most cases, your DNS should be provided by your ISP or automatically acquired by DHCP. Your proxy settings should be disabled. Check your hosts file (\%systemroot%\system32\drivers\etc\hosts) for any suspicious entries and remove them immediately. Also make sure your firewall is enabled and that you have all the latest Windows updates.Next, protect your system with a good antivirus and supplement it with an Anti malware product. Microsoft Security Essentials is often recommended along with other products.What to do if everything failsIt should be noted that some malware is very good at avoiding scanners. It's possible that once you are infected, it can install rootkits or similar to stay invisible. If things are really bad, the only option is to wipe the disk and reinstall the operating system from scratch. Sometimes a scan using GMER or Kaspersky's TDSS Killer can show you if you have a rootkit.You may want to do a few runs of Spybot Search and Destroy. If after three runs it is unable to remove an infestation (and you fail to do it manually) consider a re-install.Another suggestion: Combofix is a very powerful removal tool when rootkits prevent other things from running or installing. Using multiple scan engines can certainly help to find malwares best hidden, but it's a fastidious task and a good backup/restore strategy will be more efficient and secure.Bonus: There is an interesting video series beginning with, "Understanding and Fighting Malware: Viruses, Spyware" with Mark Russinovich, the creator of Sysinternals ProcessExplorer & Autoruns, about malware cleaning.ShareImprove this answer
Follow
edited Jul 31, 2018 at 9:18
community wiki
25 revs, 21 users 27%William Hilsum1175Wiping the drive is often the quickest and safest route as is being suggested all over this site as the "best answer"
– Ivo FlipseJan 25, 2010 at 18:052From my experience I would not trust spybot as my first choice. Avira, Kaspersky Virus Removal Tool & AVG are good free choice according AV-comparative av-comparatives.org & AV-Test.org: blogs.pcmag.com/securitywatch/2009/12/…
– fluxtenduFeb 20, 2010 at 20:2818One suggestion is that many of these malware programs do steal passwords and bank data, so it's not a bad idea to disconnect from the internet once you do become suspicious of an infection. It very well may be too late, but there's a chance you'll limit data leaks, or prevent the malware from updating itself, until such time as you are successful in your cleaning.
– emgeeApr 15, 2011 at 21:265@emgee Good rule of thumb on data exfiltration: when in doubt, pull it out (the ethernet plug)
– Nate KoppenhaverAug 4, 2011 at 17:176Combofix.org is not the official download location of Combofix, and is not authorized or recommended by Combofix's author. The official download is here.
– Andrew LambertDec 14, 2011 at 19:13 | Show 6 more comments;
91
There are some great malware-fighting tips in Jeff Atwood's "How to Clean Up a Windows Spyware Infestation". Here's the basic process (be sure to read through the blog post for screenshots and other details that this summary glosses over):Stop any spyware currently running. Windows' builtin Task Manager won't cut it; get Sysinternals Process Explorer.Run Process Explorer.Sort the process list by Company Name.Kill any processes that don't have a Company Name (excluding DPCs, Interrupts, System, and System Idle Process), or that have Company Names that you don't recognize.Stop the spyware from restarting the next time the system is booted. Again, Windows' builtin tool, MSconfig, is a partial solution, but Sysinternals AutoRuns is the tool to use.Run AutoRuns.Go through the entire list. Uncheck suspicious entries -- those with blank Publisher names or any Publisher name you don't recognize.Now reboot.After rebooting, recheck with Process Explorer and AutoRuns. If something "comes back", you'll have to dig deeper.In Jeff's example, one something that came back was a suspicious driver entry in AutoRuns. He talks through tracking down the process that loaded it in Process Explorer, closing the handle, and physically deleting the rogue driver.He also found an oddly-named DLL file hooking into the Winlogon process, and demonstrates finding and killing the process threads loading that DLL so that AutoRuns can finally remove the entries.ShareImprove this answer
Follow
edited Jul 31, 2018 at 9:20
community wiki
5 revs, 4 users 84%quack quixote23Also, Trend Micro HijackThis is a free utility that generates an in depth report of registry and file settings from your computer. I will warn this finds good and bad stuff, and makes no distinction, but Google is our friend if we're suspicious.
– Umber FerruleJun 24, 2011 at 20:331Autoruns is fantastic, but the suggestion to rely on the Publisher may not be useful. This stackoverflow question shows how the version information can be easily modified (and therefore spoofed) [stackoverflow.com/questions/284258/…. I tried this on a Java DLL and Autoruns showed the publisher incorrectly.
– AlainDFeb 2, 2016 at 15:50Add a comment | ;
53
My way of removing malware is effective and I have never seen it fail:Download Autoruns and if you still run 32-bit download a rootkit scanner.Boot into Safe Mode and start Autoruns if you are able to, then go to step 5.If you can't get into Safe Mode, connect the disk to another computer.Start Autoruns on that computer, go to File -> Analyze Offline System and fill it in.Wait for the scan to be done.In the Options menu, select everything.Let it scan again by pressing F5. This will go quick as things are cached.Go through the list and uncheck anything that is conspicious or does not have a verified company.Optional: Run the rootkit scanner.Let a top virus scanner remove any files that were left.Optional: Run anti-malware and anti-spyware scanners to get rid of junk.Optional: Run tools like HijackThis/OTL/ComboFix to get rid of junk.Reboot and enjoy your clean system.Optional: Run the rootkit scanner again.Make sure your computer is sufficiently protected!Some remarks:Autoruns is written by Microsoft and thus shows any locations of things that automatically start...Once software is unchecked from Autoruns, it will not start and can't prevent you from removing it...There do not exist rootkits for 64-bit operating systems because they would need to be signed...It is effective because it will disable malware/spyware/viruses from starting,you are free to run optional tools to clean out any junk that was left on your system.ShareImprove this answer
Follow
edited Jul 31, 2018 at 9:20
community wiki
3 revs, 2 users 98%Tom Wijsman1I have infected 64-bit Windows 7, with a virus, not letting to run antiviruses and system utils, and Autoruns still didn't help. I did a question about this. superuser.com/questions/1444463/… . I believe a to tool should be run at system boot to control OS behavior.
– WebComerJul 4, 2019 at 9:20Add a comment | ;
46
Follow the order given below to disinfect your PCOn a PC that is not infected, make a boot AV disc then boot from the disc on the Infected PC and scan the hard drive, remove any infections it finds. I prefer the Windows Defender Offline boot CD/USB because it can remove boot sector viruses, see "Note" below.Or, you can try out some other AV Boot discs.After you have scanned and removed malware using the boot disc, Install free MBAM, run the program and go to the Update tab and update it, then go to the Scanner Tab and do a quick scan, select and remove anything it finds.When MBAM is done install SAS free version, run a quick scan, remove what it automatically selects.If windows system files were infected you may need to run SFC to replace the files, you may have to do this offline if it will not boot due to the removal of the infected system files. I recommend you run SFC after any infection removal is done.In some instances you may have to run a startup repair (Windows Vista and Windows7 only) to get it booting properly again. In extreme cases 3 startup repairs in a row may be needed.MBAM and SAS are not AV softwares like Norton, they are on demand scanners that only scan for nasties when you run the program and will not interfere with your installed AV, these can be run once a day or week to ensure you are not infected. Be sure you update them before each daily-weekly scan.Note: that the Windows Defender Offline product is very good at removing persistent MBR infections which are common these days..For Advanced Users:If you have a single infection that represents itself as software, ie "System Fix" "AV Security 2012" etc, see this page for specific removal guides.ShareImprove this answer
Follow
edited Nov 9, 2012 at 4:29
community wiki
14 revs, 2 users 83%Moab53Having a second pc dedicated to virus scanning is probably the best solution, as you don't rely on the infected drive for your system. However, besides computer support firms, I doubt many people have such ready solution.
– GnoupiJun 28, 2010 at 8:422If no dedicated PC is available, a similar procedure can be carried out by booting the system with a live CD
– Ophir YoktanMar 18, 2011 at 19:28@Ophir: Live CD?
– user46959Jun 20, 2011 at 21:021for example: http://distro.ibiblio.org/tinycorelinux/welcome.html
– Ophir YoktanJun 20, 2011 at 21:21Just as a note the Microsoft Standalone System Sweeper is just the old name of Windows Defender Offline, in case someone found that too.
– Scott ChamberlainMar 16, 2012 at 18:04Add a comment | ;
38
If you notice any of the symptoms then one thing to check is the DNS settings on your network connection.If these have been changed either from "Obtain DNS server address automatically" or to a different server from the one it should be, then that's a good sign that you have an infection. This will be the cause of the redirects away from anti-malware sites, or a complete failure to reach the site at all.It's probably a good idea to take a note of your DNS settings before an infection occurs so you know what they should be. Also the details will be available on the help pages of your ISP's web site.If you don't have a note of the DNS servers and can't find the information on your ISP site then using the Google DNS servers is a good alternative. They can be found at 8.8.8.8 and 8.8.4.4 for the primary and secondary servers respectively.While resetting the DNS won't fix the problem it will allow you to a) reach the anti-malware sites to get the software you need to clean the PC and b) spot if the infection recurs as the DNS settings will change again.ShareImprove this answer
Follow
edited Mar 15, 2017 at 10:35
community wiki
2 revsChrisF0Add a comment | ;
33
RansomwareA newer, particularly horrible form of malware is ransomware. This kind of program, usually delivered with a Trojan (e.g. an e-mail attachment) or a browser exploit, goes through your computer's files, encrypts them (rendering them completely unrecognizable and unusable), and demands a ransom to return them to a usable state.Ransomware generally uses asymmetric-key cryptography, which involves two keys: the public key and the private key. When you get hit by ransomware, the malicious program running on your computer connects to the bad guys' server (the command-and-control, or C&C), which generates both keys. It only sends the public key to the malware on your computer, since that's all it needs to encrypt the files. Unfortunately, the files can only be decrypted with the private key, which never even comes into your computer's memory if the ransomware is well-written. The bad guys usually state that they will give you the private key (thereby letting you decrypt your files) if you pay up, but of course you have to trust them to do so.What you can doThe best option is to reinstall the OS (to remove every trace of malware) and restore your personal files from backups you made earlier. If you don't have backups now, this will be more challenging. Make a habit of backing up important files.Paying up will probably let you recover your files, but please don't. Doing so supports their business model. Also, I say "probably let you recover" because I know of at least two strains that are so poorly written that they irreparably mangle your files; even the corresponding decryption program doesn't actually work.AlternativesFortunately, there's a third option. Many ransomware developers have made mistakes that let the good security professionals develop processes that undo the damage. The process for doing that depends entirely on the strain of ransomware, and that list is constantly changing. Some wonderful people have put together a big list of ransomware variants, including the extensions applied to the locked files and the ransom note name, which can help you identify which version you have. For quite a few strains, that list also has a link to a free decryptor! Follow the appropriate instructions (links are in the Decryptor column) to recover your files. Before you begin, use the other answers to this question to make sure the ransomware program is removed from your computer.If you can't identify what you got hit with from only the extensions and ransom note name, try searching the Internet for a few distinctive phrases from the ransom note. Spelling or grammar mistakes are usually fairly unique, and you'll likely come upon a forum thread that identifies the ransomware.If your version isn't yet known, or doesn't have a free way to decrypt the files, don't give up hope! Security researchers are working on undoing ransomware and law enforcement is pursuing the developers. It's possible that a decryptor will eventually appear. If the ransom is time-limited, it's conceivable that your files will still be recoverable when the fix is developed. Even if not, please don't pay unless you absolutely have to. While you're waiting, make sure your computer is free of malware, again using the other answers to this question. Consider backing up the encrypted versions of your files to keep them safe until the fix comes out.Once you recover as much as possible (and make backups of it to external media!), strongly consider installing the OS from scratch. Again, that will blow away any malware that lodged itself deep inside the system.Additional variant-specific tipsSome ransomware-variant-specific tips that aren't yet in the big spreadsheet:If the decryption tool for LeChiffre doesn't work, you can recover all but the first and last 8KB of each file's data using a hex editor. Jump to address 0x2000 and copy out all but the last 0x2000 bytes. Small files will be completely wrecked, but with some fiddling you might be able to get something helpful out of larger ones.If you've been hit with WannaCrypt and you're running Windows XP, haven't rebooted since the infection, and are lucky, you might be able to extract the private key with Wannakey.Bitdefender has a number of free tools to help identify the variant and to decrypt some specific variants.(others will be added as they are discovered)ConclusionRansomware is nasty, and the sad reality is that it's not always possible to recover from it. To keep yourself safe in the future: Keep your operating system, web browser, and antivirus up to dateDo not open e-mail attachments you weren't expecting, especially if you don't know the senderAvoid sketchy web sites (i.e. those featuring illegal or ethically dubious content)Make sure your account only has access to documents you personally need to work withAlways have working backups on external media (not connected to your computer)!ShareImprove this answer
Follow
edited Oct 26, 2018 at 23:55
community wiki
5 revs, 3 users 97%Ben N4There are a few programs now available that supposedly protect you against ransomware, for example: winpatrol.com/WinAntiRansom (a commercial program). I've never used this because I'm no longer on Windows, but that company's WinPatrol product is one I used for years and have frequently recommended. A few of the antivirus developers have anti-ransomware tools available, sometimes as a higher-cost option.
– fixer1234Sep 13, 2016 at 22:37For information specifically about removing Petya ransomware, also see this question and answer: superuser.com/questions/1063695/…
– fixer1234Sep 14, 2016 at 1:322I'd add another thing to the list of advice in the conclusion: Avoid visiting sites that promote illegal or amoral behavior, such as media and software piracy; content that is outlawed in most parts of the world; etc. These sites often contract with the least reputable advertising vendors, who make no real effort to filter the content of their "ads" at all, making it easy for criminals to inject your webpage with content that delivers malware or attempts to exploit your browser to gain access to your system. Sometimes even a good adblocker will miss this stuff.
– allquixoticSep 14, 2016 at 17:50@allquicatic I added a bullet point in that vein. Let me know if anything else can be expanded. Thanks!
– Ben NSep 14, 2016 at 18:18Add a comment | ;
31
There is a wide variety of malware. Some of it is trivial to find and remove. Some of it is trickier. Some of it is really difficult to find, and very hard to remove.But even if you have a mild malware you should strongly consider reformating and reinstalling the OS. This is because your security has already failed, and if it failed for a simple malware maybe you're already infected with a vicious malware.People working with sensitive data or inside networks where sensitive data is held should strongly consider wipe and re-install. People whose time is valuable should strongly consider wipe and re-install (it's quickest and easiest and surest method). People who are not comfortable with advanced tools should strongly consider wipe and re-install.But people who have the time, and enjoy noodling around, can try methods listed in other posts.ShareImprove this answer
Follow
answered Oct 4, 2011 at 19:08
community wiki
DanBeale
13Correct. This stuff is designed to go around security and cleaning and mundane OS use. Don't take part in an arms race. Zero tolerance is the only policy.
– XTLMar 7, 2012 at 12:59Add a comment | ;
30
The possible solutions for a virus infection are in order: (1) antivirus scans, (2) system repair, (3) total reinstall.Make first sure that all your data is backed up.Load and install some antiviruses, make sure they are up to date, and scan deeply your hard disk. I recommend using at least Malwarebytes' Anti-Malware. I also like Avast.If that doesn't work for any reason, you may use a rescue live-CD virus scanner : I like best Avira AntiVir Rescue System because it gets updated several times a day and so the download CD is up-to-date. As a boot CD it's autonomous and doesn't work using your Windows system.If no virus is found, use "sfc /scannow" to repair important Windows files.See this article.If that also doesn't work, you should Perform a Repair Installation.If nothing works, you should format the hard disk and reinstall Windows.ShareImprove this answer
Follow
answered Feb 8, 2010 at 18:10
community wiki
harrymc
12When infected with a recent virus/trojan I used Knoppix on a USB stick, ran apt-get wine, installed Dr Web Cure-It in my wine session, and ran that to clean my infection. I had to do it this way because my laptop wouldn't boot some of the other live-CD alternatives.
– PP.Feb 24, 2010 at 17:15Add a comment | ;
23
Another tool I would like to add to the discussion is the Microsoft Safety Scanner. It was just released a few months ago. It is a bit like the Malicious Software Removal Tool, but designed for offline use. It will have the latest definitions as of the moment you download it and will only be useable for 10 days as it will consider its definitions file "too old to use". Download it with another computer and run this in safe mode. It works pretty well.ShareImprove this answer
Follow
edited Aug 22, 2011 at 12:40
community wiki
2 revs, 2 users 73%Scott ChamberlainAdd a comment | ;
23
A bit of theory first: please realize that there is no substitute for understanding. The ultimate antivirus is to understand what you are doing and generally what is going on with your system, with your own mind and in the so-called reality. No amount of software or hardware will fully protect you from yourself and from your own actions which in most cases is how the malware gets into a system in the first place.Most modern "production level" malware, adware and spyware rely on various "social engineering" tricks to fool you into installing "useful" apps, add-ons, browser toolbars, 'virus scanners' or clicking big green Download buttons which will install malware on your machine.Even an installer for a supposedly trusted app, such as e.g. uTorrent, would install by default adware and possibly spyware if you simply click the Next button, and don't take the time to read what all the checkboxes mean.The best way to fight the social engineering tricks that hackers use is reverse social engineering - if you master this technique you will manage to avoid most types of threats and keep your system clean and healthy even without an antivirus or firewall.If you have noticed signs of malicious/unsolicited life forms inhabiting your system the only clean solution would be to fully reformat and reinstall your system. Make a backup as described in other answers here, quick format the discs and reinstall your system, or, even better, move the useful data to some external storage, and re-image the system partition from a clean partition dump you have made earlier.Some computers have a BIOS option to revert the system to the original factory settings. Even if this might seem a bit of an overkill, it will never hurt and, more importantly, this will solve all the other eventual issues, whether you are aware of them or not, without having to handle each issue one by one.The best way to 'fix' a compromised system is to not fix it at all, but instead revert to a known 'good' snapshot using some kind of partition imaging software, such as Paragon Disk Manager, Paragon HDD Manager, Acronys Disk Manager, or e.g. dd if you made the backup from Linux.ShareImprove this answer
Follow
edited Jul 25, 2015 at 4:30
community wiki
5 revs, 2 users 98%ccpizzaAdd a comment | ;
12
With Reference to William Hilsum "How Do I Get Rid Of This: Using A Live CD" above:A virus won't be able to run in a live CD environment, so you can make temporary use of your computer without fear of further infection. Best of all you can access all your files. On June 20th 2011 Justin Pot wrote a booklet entitled "50 Cool Uses for Live CDs". The beginning of the booklet explains how to boot from CD, Flash Drive or SD Card, and pages 19-20 explain about scanning with different "antimalwares" some that were already mentioned. The advice given is invaluable for this scenario, and is explained in easy to understand English. Of course the rest of the booklet is invaluable for your other computing needs. (the link to the download (in PDF format) is provided from the link below. Always remember to be sensible when using the internet, don't be tempted to stray to "places" where malware is very likely to be lurking, and you should be fine. Any Antivirus, Internet Security Suites etc that you maybe using should have the latest updates, and whichever OS you maybe using should also be kept up to date.http://www.makeuseof.com/tag/download-50-cool-live-cds/ Once you have clicked on or copied and pasted the above link, please then click onDOWNLOAD 50 Cool Uses for Live CDs (written in blue)Please Note I tried to write this in the comments section, but couldn't fit it in. So I have given it in an official answer, as it is invaluable.ShareImprove this answer
Follow
edited Jun 20, 2017 at 13:56
community wiki
4 revs, 2 users 83%Simon1I should disagree: IMHO if a virus is present in one file on the HDD even if the system starts Clean from the livecd it's always possible to execute the malicious code when you execute the infected file. If not detected or stopped it can even spread on other files or devices.
– HasturFeb 13, 2015 at 12:27Add a comment | ;
9
Two important points:Don't get infected in the first place. Use a good firewall and antivirus, and practice "safe computing" -- stay away from questionable sites and avoid downloading stuff when you don't know where it's coming from.Be aware that many sites on the web will tell you you're "infected" when you aren't -- they want to trick you into buying their junky anti-spyware, or, worse, they want you do download stuff that is, in fact, spyware disguised as a "free antispyware application". Similarly, be aware that many on this site, mostly out of stupidity, will diagnose any "odd" error, particularly the sort of registry corruption that Windows is famous for, as signs of spyware.ShareImprove this answer
Follow
answered Dec 5, 2012 at 21:39
community wiki
Daniel R Hicks
Add a comment | ;
8
As suggested before in this topic, if you ARE SURE you are infected, use a linux live CD to boot your computer and immediately backup all your sensitive data.It is also a good practice to have your sensitive files stored in a hard drive different from your OS boot drive. this way you can safely format the infected system and run a comprehensive scan on your sensitive data just to be on the safe side.As a matter of fact, there is no best solution than to format the system partition to make sure you run a virus and malware free environment. Even if you run a good tool (and no doubt there are many out there), there are always leftovers left behind and your system may seem clean at the moment, but it surely becomes a time-bomb awaiting to explode later.ShareImprove this answer
Follow
answered Jan 13, 2013 at 21:07
community wiki
Lorenzo Von Matterhorn
Add a comment | ;
7
On December 8th 2012. Remove-Malware released a video tutorial entitled "Remove Malware Free 2013 Edition" together with a complementary Guide outlining how to get rid of malware from your infected PC for free.They outlineBackup – How to backup up your important personal documents just in-case your PC become inaccessible.Gathering the needed software for this guide.Bootable Antivirus – Why bootable antivirus is the best way to remove malware.Bootable Antivirus Disc – How to create a bootable antivirus disc.Bootable Antivirus Disc – How to scan your PC with a bootable antivirus disc.Cleanup – Round up the remnants and remove them.Prevent it from happening againThe Video Tutorial is over 1 hour long in duration and together with the written guide is an excellent resource.The video tutorial:linkWritten Guide:linkUpdate:A very informative article written today 1st February 2013 by J. Brodkin entitled "Viruses, Trojans, and worms, oh my: The basics on malwareMobile malware may be trendy, but PC malware is still the big problem." from arstechnica.com highlights the continual problem of malware & different types of malware with explanations of each, highlighting:BackdoorsRemote Access TrojansInformation stealersRansomwareThe article also highlights the spreading of malware, botnet operation and businesses under attack.ShareImprove this answer
Follow
edited Oct 22, 2013 at 18:08
community wiki
4 revs, 2 users 83%SimonAdd a comment | ;
1
SHORT ANSWER:Backup all your files.Format your system partition.Reinstall Windows.Install antivirus.Update your windows.Scan your backup with antivirus before starting to use it.Today you can never be sure that you've completely removed an infestation, except if you wipe your drive and start over.ShareImprove this answer
Follow
edited Jul 18, 2018 at 14:00
community wiki
2 revs, 2 users 94%svin83Add a comment | ;
0
I do not think that AV programs such as MSE, MCAfee, Norton, Kaspersky, etc. can protect you 100% because their definition files always come after the fact - after the malware is already out there on the web and can have done a lot of damage. And many of those do not protect you against PUPs and Adware.I also do not think that the scanners like Malwarbytes, Superantispyware, Bitdefender scanner and others can help a lot when the malware has already damaged your system. If you have enough scanners, you will be able to remove the malware but you will not be able to repair the damage that this malware has done.I therefore have developed a two layer strategy:I make weekly images (I use free Macrium) of my system partition and my data partition to two external disks that are only connected during the imaging. Thus no malware can get to them. Should something not work in my system, I can always restore the latest image. I usually keep half a dozen full images in case I have to go back further than last week. In addition I have system restore enabled in my OS so that I can quickly set back in case of a faulty update. But system images (shadows) are not very reliable because they can disappear for various reasons. Relying on system images alone does not suffice.Most of my internet work I do from a virtual Linux partition. Linux itself is not the target of malware and Windows malware cannot effect Linux. With that system I doall my downloads and checking them with Virus Total before I move them to the Windows system. Virus Total runs the file thru 60 of the best known AV programs and if it comes out clean, chances are very high that it is clean.all internet access to websites where I am not 100% certain that they are clean - like e.g. this website here.all my mail. That is the advantage of Gmail and AOL. I can check my mail with my browser. Here I can open any piece of mail without being afraid to get a virus. And attachments I run thru Virus Total.all my on-line banking. Linux provides me with an extra layer of securityWith this approach I have not seen any malware in years. If you like to try a virtual Linux partition, here is how.ShareImprove this answer
Follow
edited Mar 23, 2015 at 22:09
community wiki
3 revs, 2 users 92%whs3In what way is this an answer to "What should I do if my Windows computer seems to be infected with a virus or malware?"
– Andrew MortonMar 23, 2015 at 21:59@whs: Andrew Morton is right about this not being an answer to this question, but it is a great answer to a different question, and it would be a real shame if it gets downvoted for being in the wrong place. Ask a new question, like, "How can I avoid getting malware infections beyond just running an A/V program and avoiding shady web sites", and post this answer there.
– fixer1234Mar 23, 2015 at 22:17I know this is an old answer, but I have to add my 2 cents. Linux is not immune to all malware. en.wikipedia.org/wiki/Linux_malware Also, constantly making backups of a personal computer in not within the purview of 99% of the average users.
– computercarguyJan 11, 2018 at 22:06Add a comment | ;
-15
The problem with scanning malware externally or with a live CD is that many of these nasty pieces of software hook into memory processes, drivers and much more. If the PC's operating system is not loaded neither are they which makes for a frustrating removal process. ALWAYS scan for malware while the infected OS is booted.With that said, load up Windows with a copy of RKILL on a USB drive. Running this utility kills any malware process chugging away in the background, allowing you to do move forward with the removal. It is VERY effective. I have yet to run into a situation where the program has failed its job and I'm surprised at how many techs have never heard of it.Next I choose to scan with either Malware bytes or ComboFix. The nice perk about these scanners is rather than utilizing virus definitions, they locate malware relentlessly based on behavior - a very effective technique. A word of warning though - they are also much more dangerous and can REALLY wreck some serious shop on your OS. Make sure you have a backup.90 percent of the time the above process works for me and I remove a TON of these things on the daily. If your extra paranoid, running a scan with something like AVG, SuperAntiSpyware or Microsoft Security Essentials may not be a bad idea. Although I haven't seen these programs detect much more than the harmless tracker cookie, some people swear by them. Give yourself the peace of mind and do it if you must.ShareImprove this answer
Follow
answered Oct 14, 2012 at 4:13
community wiki
Scandalist
211ALWAYS scan for malware while the infected OS is booted...that's kinda like saying Always fight the enemy while they're paying attention. If your malware scanner can't find the malicious code while it's at rest in a file, it doesn't stand a chance against the code while it's in memory able to perform it's voodoo cloaking stunts.
– I say Reinstate MonicaNov 1, 2014 at 1:361So you want to load the OS, so that the malicious processes are running, and THEN you want to kill the processes so you can remove them? That's just backwards in my opinion.
– svin83Dec 3, 2015 at 11:12Add a comment | |
Is there a filepath for the highest level, Computer, directory on the mac? (dir above Macintosh HD) | macos;finder;macos;finder | Is there a filepath for the highest level, Computer, directory on the mac? (dir above Macintosh HD)
Ask Question
|
2
You'd be looking for /Volumes. Here all network volumes are mounted, as well as CDs/DVDs, DMGs, USB drives, etc.$ ls -l /Volumestotal 8lrwxr-xr-x 1 root admin 1 Nov 6 08:39 Macintosh HD -> /drwxrwxrwx 0 root wheel 0 Nov 6 14:06 MobileBackupsShareImprove this answer
Follow
answered Nov 6, 2014 at 13:11slhckslhck218k6767 gold badges591591 silver badges578578 bronze badgesAdd a comment | |
Typescript syntax highlighting in netbeans? | netbeans;netbeans | Typescript syntax highlighting in netbeans?
Ask Question
|
1
As a stopgap solution, you can use this Netbeans plugin for Typescript https://github.com/Everlaw/nbts/releasesYou will need NodeJS for it to work. After installing both the plugin and NodeJS, navigate to Tools | Options | HTML/JS and select the NodeJS tab to make the plugin aware of NodeJS.Import your Typescript files into a new HTML5/JS project.However, indenting does not work for me using this plugin. ShareImprove this answer
Follow
answered Jun 28, 2016 at 9:41eingekrauteingekraut1111 bronze badgeAdd a comment | |
Showing filenames when grepping from mysqlbinlog | mysql;grep;mysql;grep | Showing filenames when grepping from mysqlbinlog
Ask Question
|
1
There are comments and timestamps that appear above each SQL command.When you run the grep, use the -A, -B, or -C option.What that does is the following-A shows you a number of lines after the pattern is found-B shows you a number of lines before the pattern is found-C shows you a number of lines before and after the pattern is foundFor example, run the grep like this to include 2 lines above the matching patternfind -name "binlog.000056*" -exec mysqlbinlog {} \; | grep -i -B 2 "update .* my_special_column=value"If you want the iterate through the names and see the filename, do thisfor X in `ls binlog.000056*` ; do echo ${X} ; mysqlbinlog ${X} | grep -i -B 2 "update .* my_special_column=value" ; doneGive it a Try !!!ShareImprove this answer
Follow
edited Nov 14, 2014 at 22:52
answered Nov 14, 2014 at 22:46RolandoMySQLDBARolandoMySQLDBA3,02511 gold badge1919 silver badges2525 bronze badges1Although I was thinking there is a solution with pipes only your solution works for me. Thank you!
– V GNov 17, 2014 at 15:14Add a comment | ;
0
You need to run multiple commands in exec. Have a look to this question and the different answers.ShareImprove this answer
Follow
edited Mar 20, 2017 at 10:17CommunityBot1
answered Nov 12, 2014 at 9:37ZimmiZimmi35111 silver badge55 bronze badgesAdd a comment | |
Replace a character in middle of characters using regular expression in notepad ++ | notepad++;notepad++ | Replace a character in middle of characters using regular expression in notepad ++
Ask Question
|
3
You could also do a Find and Replace for Cell to cell and a second from Voltage to voltage if these variables are sprinkled about your code. If there are other instances of Cell or Voltage in your code that you don't wish to convert to lowercase you could CTRL+H for Find and replace, select Regex at the bottom and use (Cell_.._Voltage) for the "FindWhat" and \L\1 for the "Replace With"Share
Follow
answered Sep 16, 2014 at 16:01JNevillJNevill1,21666 silver badges1212 bronze badgesAdd a comment | ;
2
Is that simply uppercase to lowercase... If so just select all text > right click > lowercase...Share
Follow
answered Sep 9, 2014 at 13:26CharlesHCharlesH2,14333 gold badges1414 silver badges1818 bronze badgesAdd a comment | ;
2
Select the text you want to update and press Ctrl+U. This will convert capital letters to lower case.Share
Follow
answered Sep 9, 2014 at 13:26ExcellllExcellll12.5k1111 gold badges5050 silver badges7878 bronze badgesAdd a comment | |
How to change admin panel port on Asus RT-N66U Black Knight Wireless Router | networking;router;networking;router | How to change admin panel port on Asus RT-N66U Black Knight Wireless Router
Ask Question
|
5
You don't need to do anything special, as long as you don't want to access the admin interface from the external Internet.Turn on port forwarding for port 80 and route to your webserverTry accessing 192.168.1.1:80 (note that the router's admin interface still works)Try accessing your router through its external IP (your webserver should come up)Share
Follow
answered Mar 4, 2016 at 2:21mrgrievesmrgrieves15111 silver badge33 bronze badges1This is the correct method for what the OP is doing. There is nothing special that needs to be done but port forwarding of port 80/TCP to whatever the internal IP address of the webserver is. From the outside port 80 is not open for router administration, no external access is allowed at all by default (but can be enabled on port 8080 by default, configurable).
– acejavelinMar 4, 2016 at 4:02Add a comment | ;
1
This can be done using Tomato, an alternative firmware. There are several Tomato mods out there, depending on your needs you could use Shibby or Toastman.Describing how to flash a new firmware is our of scope here, but here's a link to get you going.Share
Follow
answered Sep 24, 2014 at 8:41JanJan1,8881313 silver badges1818 bronze badgesAdd a comment | ;
0
Although I would strongly recommend against doing this:Login to the router from your LAN. In the left column click on "Administration"Find the option "Enable Web Access from WAN" select Yes and click the Apply button.You can also change the default portnumber from 8080 (perhaps in your case it says 8443 here) to something else. But I'd stick to 8080 if I were you.The helptext of this option says:This feature allows you to configure the wireless router via the Internet. The default port is 8080 and you can use http://[[WAN IP]]:8080 or http://[[DDNS name]]:8080 to launch the wireless router's web user interface.Note that this way port 80 remains available to be forwarded to a webserver on your LAN.Also: make sure you have a very strong password for the login account as this exposes the router's setup UI to the big bad world. Share
Follow
answered Jul 25, 2015 at 8:25Mausy5043Mausy504315611 silver badge99 bronze badgesAdd a comment | ;
0
Let's assume your public ip is 1.2.3.4First, you have your router at 192.168.1.1Its admin panel is running at port 80, so you can access it with "192.168.1.1:80" using your browser, or just "192.168.1.1" (because the browser will visit port 80 by default).From outside, you can access this by just doing "1.2.3.4(:80)".Now you have your web service running at 192.168.1.2Its service also uses port 80, so you can access it with "192.168.1.2:80"From LAN, you can access both different services by doing "192.168.1.1" and "192.168.1.2".Your router probably automatically forwarded its own port 80 to the outside, so you can access it from outside by going to 1.2.3.4 by default. But your router is also just a device in your network.So when you entered a rule that says local ip = 192.168.1.2, local port = 80, port range = 80This basically means 1.2.3.4:80 -> 192.168.1.2:80Now you can enter a different rule local ip = 192.168.1.1, local port = 80, port range = 8080This will make possible 1.2.3.4:8080 -> 192.168.1.1:80Share
Follow
answered Aug 3, 2019 at 16:27Jinqiu LiuJinqiu Liu1Add a comment | |
How can I change the resolution seen by a bootloader in VirtualBox? | virtualbox;resolution;virtualbox;resolution | How can I change the resolution seen by a bootloader in VirtualBox?
Ask Question
|
0
You need to configure the vga kernel startup parameter:For example at boot you might use: vga=795. This would set your system to boot using the Live label with a screen resolution to 24bit 1280X1024. Here are some more examples of common vga boot values:Depth | 800×600 | 1024×768 | 1152×864 | 1280×1024 | 1600×1200 8 bit | vga=771 | vga=773 | vga=353 | vga=775 | vga=79616 bit | vga=788 | vga=791 | vga=355 | vga=794 | vga=79824 bit | vga=789 | vga=792 | NA | vga=795 | vga=799See this post from the Ubuntu forums for more details:http://ubuntuforums.org/showthread.php?t=258484Edit:If using GRUB2 and its graphical interface, you will need to edit /etc/default/grubfind the line #GRUB_GFXMODE=640x480remove the # and change 640x480 for the preferred mode you wrote down. e.g. GRUB_GFXMODE=1200x800save, then type sudo update-grubNOTE: the preferred mode has to be among those listed by vbeinfo.See post https://askubuntu.com/questions/54067/how-do-i-safely-change-grub2-screen-resolution for additional detailsShare
Follow
edited Apr 13, 2017 at 12:22CommunityBot1
answered Sep 9, 2014 at 13:58MarceloMarcelo89866 silver badges99 bronze badges1I don't think that's going to change how GRUB2 itself renders.
– detlySep 9, 2014 at 23:42Add a comment | ;
0
For rEFInd:# Set the EFI text mode to be used for textual displays. This option# takes a single digit that refers to a mode number. Mode 0 is normally # 80x25, 1 is sometimes 80x50, and higher numbers are system-specific # modes. Mode 1024 is a special code that tells rEFInd to not set the # text mode; it uses whatever was in use when the program was launched. # If you specify an invalid mode, rEFInd pauses during boot to inform # you of valid modes. # CAUTION: On VirtualBox, and perhaps on some real computers, specifying # a text mode and uncommenting the "textonly" option while NOT specifying# a resolution can result in an unusable display in the booted OS. # Default is 1024 (no change) # #textmode 2 # Set the screen's video resolution. Pass this option either: # * two values, corresponding to the X and Y resolutions # * one value, corresponding to a GOP (UEFI) video mode # Note that not all resolutions are supported. On UEFI systems, passing # an incorrect value results in a message being shown on the screen to # that effect, along with a list of supported modes. On EFI 1.x systems # (e.g., Macintoshes), setting an incorrect mode silently fails. On both # types of systems, setting an incorrect resolution results in the default # resolution being used. A resolution of 1024x768 usually works, but higher # values often don't. # Default is "0 0" (use the system default resolution, usually 800x600). # #resolution 1024 768 #resolution 1440 900 #resolution 3resolution 1920 1080Share
Follow
answered Aug 3, 2019 at 22:50norajnoraj35611 gold badge44 silver badges1414 bronze badgesAdd a comment | |
Listing files in directory: weird output | windows;command-line | Listing files in directory: weird output
Ask Question
|
1
I suspect it's because of the behavior mentioned in Raymond Chen's blog (warning - not actual documentation).For example, if your pattern ends in .*, the .* is ignored. Without this rule, the pattern *.* would match only files that contained a dot, which would break probably 90% of all the batch files on the planet, as well as everybody's muscle memory, since everybody running Windows NT 3.1 grew up in a world where *.* meant all files.Your pattern is *t.*, which gets changed to, I'm assuming, *t, which then matches 5bbb.exeTxt. I'm not sure how DirectoryInfo.GetFiles works, why not just test it?Looks like perhaps short names are also matched, or the first three characters of the extension.G:\junk\filetest>dir Volume in drive G is Extended2 Volume Serial Number is 3E2F-7A67 Directory of G:\junk\filetest09/09/2014 10:01 AM <DIR>.09/09/2014 10:01 AM <DIR>..09/09/2014 09:59 AM 6 test.txtR09/09/2014 10:01 AM 2 test.txtrrr2 File(s) 8 bytes2 Dir(s) 162,957,000,704 bytes freeG:\junk\filetest>dir *.txt Volume in drive G is Extended2 Volume Serial Number is 3E2F-7A67 Directory of G:\junk\filetest09/09/2014 09:59 AM 6 test.txtR09/09/2014 10:01 AM 2 test.txtrrr2 File(s) 8 bytes0 Dir(s) 162,957,000,704 bytes freeG:\junk\filetest>dir /x *.txt Volume in drive G is Extended2 Volume Serial Number is 3E2F-7A67 Directory of G:\junk\filetest09/09/2014 09:59 AM 6 TEST~1.TXT test.txtR09/09/2014 10:01 AM 2 TEST~2.TXT test.txtrrr2 File(s) 8 bytes0 Dir(s) 162,957,000,704 bytes freeShare
Follow
edited Sep 9, 2014 at 14:03
answered Sep 9, 2014 at 13:26dsolimanodsolimano2,88822 gold badges2222 silver badges3737 bronze badges15@dsolimano: how do you explain the 4th output then?
– user366518Sep 9, 2014 at 13:421@dsolimano: here's another weird output: postimg.org/image/dtb1r1ck7, maybe you can explain this?
– user366518Sep 9, 2014 at 13:45I cannot! Perhaps it's matching a short name? Or perhaps it just matches the first three characters of the extension. I'll post a test I just ran.
– dsolimanoSep 9, 2014 at 14:01@dsolimano: first three characters of extension maybe - that would explain Output Nr 4 in my latest screenshot? I am not sure what you tried to show in your sample... Maybe this way of pattern matching is not very reliable?
– user366518Sep 9, 2014 at 14:071@georgem Type dir *t /x and it will explain your latest output issue.
– IsziSep 9, 2014 at 14:31 | Show 10 more comments;
1
I think @dsolimano (and his source, Raymond Chen) got pretty close to your problem but perhaps don't quite have the right explanation. After some thinking and searching and testing, although I've yet to come up with actual documentation to back this up, I believe I've come to a reasonably accurate conclusion.My hypothesis is based on somewhat related behavior in domain names and some other named computer resources. With domain names, there's actually an implied trailing dot at the end. Therefore www.superuser.com is actually www.superuser.com.. My conclusion, after some testing, is that the Windows API (if not the filesystem itself) uses the same convention for filenames.Think about all the file names you gave which matched your result. If you consider that 8.3 filenames are included in searches, as described here, and assume that long filenames with a trailing dot and 8.3 filenames with a trailing dot are also included, you'll see that every one of those files matches by at least one version of its filename. (Remember that the * wildcard is a placeholder which represents "any number of characters, or no characters".)c:\test\1.1.1990.txt matches as 1.1.1990.txt. or 111990~1.TXT.c:\test\1.31.1990.txt matches as 1.31.1990.txt. or 131199~1.TXT.c:\test\1.txttxt matches as 1.txttxt. or 1956B~1.TXT.c:\test\11.11.2007.txtGif matches as 111120~1.TXT.c:\test\12.1.1990.txt matches as 12.1.1990.txt. or 12199~1.TXT.c:\test\12.31.1990.txt matches as 12.31.1990.txt or 123119~1.TXT.c:\test\2.tGift matches as 2.tGift.c:\test\2.txtGif matches as 2BEFD~1.TXT.c:\test\5bbb.exeTxt matches as 5bbb.exeTxt.c:\test\test.txt matches as test.txt or test.txt.You can test this by creating a series of test files in C:\test as described below, and running dir *t.* against it again.A file with an extension ending in "t".A file with name ending in "t".A file with an extension longer than three letters with the third letter in the extension being "t".Some files which match more than one of the above criteria.A file with name ending in "t", and no extension at all.Some files which do not meet any of the above criteria.You should see, as I have, that dir *t.* will only return files which fall into categories 1-5 above. Files in category 6 will be excluded. You can also thest the GetFiles method more directly against the same files with PowerShell, using the below command, and you should see the same results.[IO.Directory]::GetFiles('C:\test','*t.*')Share
Follow
edited Sep 9, 2014 at 16:48
answered Sep 9, 2014 at 16:21IsziIszi13.4k4343 gold badges113113 silver badges177177 bronze badges2I will study your theory. But in my case users will type the matching pattern. Hence, I need to be exactly sure what the output be, I can't rely on "Suprises". Considering that, do you still recommend using Directory.GetFiles method?
– user366518Sep 9, 2014 at 17:36@georgem Honestly, I'm neither a programmer nor do I know exactly what your requirements are. So, I really can't give you a good answer for that. I will say that PowerShell's Get-ChildItems command appears to have more "normal" behavior, and it does support RegEx. So, you might want to look into how it does its job and try to work from there.
– IsziSep 9, 2014 at 20:52Add a comment | |
Files with denied Read permissions are not visible in UNC Share | permissions;unc;permissions;unc | Files with denied Read permissions are not visible in UNC Share
Ask Question
|
1
I would guess what you are talking about is a feature from Windows Server 2003 SP1 upwards called ABE. It's an advanced sharing feature designed to hide files and folders from view of users who do not have access to at least read them. You can review the ABE settings on your Server by going to Share and Storage Management, open properties on the share then go to SMB settings and advanced. I believe there is a ticket box to enable/disable the Access Based Enumeration... I'm going from memory as not in front of a Server at the moment so hopefully the above steps are correct.Thanks,CharlesShare
Follow
answered Sep 9, 2014 at 12:49CharlesHCharlesH2,14333 gold badges1414 silver badges1818 bronze badges2Thanks Charles , disabling ABE did the trick.I still wonder why show these files to the user if he accesses them through a local path. I guess hiding them when the "hidden" flag is not set is illogical. :)
– Dhiwakar RavikumarSep 10, 2014 at 4:10Well I think Microsoft assume that the user would not be able to access that path any other way rather than a UNC. Would you be kind enough to mark this as an answer on the left hand side? :) thanks
– CharlesHSep 10, 2014 at 8:12Add a comment | |
Lost Sound after power shortage | windows-7;laptop;audio;64-bit;windows-7;laptop;audio;64-bit | Lost Sound after power shortage
Ask Question
|
1
I would say it's because your PC was out of charge, and the power shortage made the CMOS nearly ran out of battery but can still be used to hold for a day or shorter. So that the BIOS settings resets everytime you boot. Maybe try replacing the battery, it can be bought in any local tech shop. Here is how: http://www.computerhope.com/issues/ch000239.htmShare
Follow
answered Sep 10, 2014 at 10:57user1046193user10461932655 bronze badges3Thank you for your answer, but as you can see my battery is already FULLY dead, as in empty and won't charge anymore.
– OmarrrioSep 10, 2014 at 10:58@Omarrrio I believe he is talking about your CMOS battery; not the main laptop battery. The CMOS battery is a small non rechargeable battery on the main board. It's only job is to keep the CMOS alive between boots.
– kroweSep 10, 2014 at 12:45Aaaaah i see well i will try ti buy a new one soon
– OmarrrioSep 10, 2014 at 13:08Add a comment | |
Converted existing win7 instalation from mbr to gpt using gdisk, can't lauch OS | gpt;gpt | Converted existing win7 instalation from mbr to gpt using gdisk, can't lauch OS
Ask Question
|
1
Okay, thanks to @Marcelo comment I was able to figure this out, 10 hours later...1.) First, the ASRock P67 Pro3 has undocument feature (or bug, if you wish to call it so), it is amusingly hard to boot a CD as UEFI. The UEFI option will keep disapearing from boot menu even if you set your SATA mode to AHPI (tested on BIOS 40 version)2.) Sooo, prepare a UEFI pen-drive (at least 4 gb) with Windows Installer. Instructions here: http://www.eightforums.com/tutorials/15458-uefi-bootable-usb-flash-drive-create-windows.html3.) Make a backup of system partition. As in my case I was upgreading from old drive, I've already had a backup on it, but in your case do a Clonezilla or similiar backup of everything to another drive of the same or higher capacity4.) Format drive and set it up as GPT (I used Gparted for this)5.) Install Windows 7 from pen-drive boot in UEFI mode (F11 after POST checks)(If it says that it cannot be installed in GPT drive, then you didn't boot it in UEFI mode)6.) Use Clonezilla again to overwrite windows instalation with your backupAnd now here comes the tricky part: if you try to boot your Windows now, you will encounter 0x0000007B BSoD1.) First of all, boot your Win7 installation pen-drive once more, select repair and wait until it tell you that there were some problems and were repaired (when scanning for system list)2.) In my case I had to boot pen-drive installer again and select repair again, so the Windows would fix drive file system. Don't know if this is manditory step or just sanity check of NTFS filesystem3.) Boot pen-drive installer for the third time and select console, then enter:bcdboot C:\windows(replace C: with your windows drive letter, you can see it in the OS picker tool just before you picked console). Then enter4.) It still won't boot up, until you turn SATA mode back to IDE. I don't know why the hell it works, but it works.5.) After booting you will be prompted to install disk driver, which will require reboot6.) FINALLY! You should have Windows 7 working on 2tb+ hard disc :-)Share
Follow
answered Sep 10, 2014 at 0:21PiotrKPiotrK42166 silver badges1616 bronze badges1You also could have used gdisk in Windows to change the type ID of the 100MB partition from (gdisk)0700 to ef00. Then extended it, reformatted it with FAT32. Then bcdboot would have worked directly.
– Milind RSep 10, 2014 at 6:28Add a comment | |
Kali Linux OllyDBG update to latest version | kali-linux | Kali Linux OllyDBG update to latest version
Ask Question
|
0
OllyDbg is a program running on Wine. You'll have to download the binary from the authors website.Share
Follow
answered Sep 9, 2014 at 13:29StolasStolas10122 bronze badgesAdd a comment | |
Adding calculated columns to Excel Pivot without details | microsoft-excel;pivot-table;microsoft-excel;pivot-table | Adding calculated columns to Excel Pivot without details
Ask Question
|
1
Out of the box standard Pivot Tables don't allow this.First I'll describe how you could work around this using regular Pivot Tables, secondly I'll show you how you can achieve this using the PowerPivot add-in.Option 1: Two Standard Pivot TablesI'd tackle it by simply sitting two pivot tables next to each other, one with years as a column label, and one without (this second table sitting one row lower so they line up).You would need to make sure the row labels columns are sorted and filtered identically. Then you can just hide the labels column on the second table.(In this screenshot I've manually added "Total" labels in row 3)Option 2: Using PowerPivotUsing PowerPivot and DAX you could create all these columns as individual measures so you can control the filters applied quite precisely. First make sure you have PowerPivot installed - Excel doesn't ship with it apart from in certain editions of Excel 2013. I won't walk through the install process but a quick search should help if you're stuck.Select your data range and click Create Linked Table on the PowerPivot toolbar.The green PowerPivot window should appear. By default your table will get simply named Table1 - let's rename it ProductSales to make it more meaningful.Click the PivotTable button in the middle of green ribbon and place it wherever you like. Now we need to create some measures. PowerPivot uses a type of code called DAX (Data Analysis eXpressions) which is a lot like normal Excel formulae.Back in Excel, start by adding Product to the Row Labels of your PivotTable. Now click the New Measure button on the PowerPivot ribbon tab. In the resulting window, set Measure name (all PivotTables) to Units Total and in the Description free text box enter:=sum(ProductSales[Units])Create another measure, called Units 2013. Enter this code: =CALCULATE([Units Total],ProductSales[Year]=2013)The CALCULATE() function in DAX allows you to apply (multiple) filters to an aggregated expression - so here we're filtering the Units Total measure we've just created, by the relevant year. Repeat for Units 2014, and then do the same again for Revenue Total,Revenue 2013 & Revenue 2014.You can now order and format your columns as you like - to mimic your screenshots above I've manually set the 2013 & 2014 columns to grey.Share
Follow
edited Sep 10, 2014 at 10:24
answered Sep 9, 2014 at 12:37Andi MohrAndi Mohr4,15044 gold badges3131 silver badges4646 bronze badges5Unfortunately hiding will not solve the issue, since it's basically the same workaround I'm currently using (and without a risk that some rows/columns will mismatch. On the other hand, PowerPivot might not be an overkill after all. If it can solve the issue, it is OK. I guess the problem with PowerPivot, is that it should be installed on other people's computers if they will want to manipulate the table.
– turezkySep 9, 2014 at 12:58So, how do you do it with PowerPivot? I've just added a measure, but it yields same result.
– turezkySep 9, 2014 at 17:52I've expanded my answer to show a PowerPivot solution.
– Andi MohrSep 10, 2014 at 10:25So it basically means manually creating an entry for each year. It is the shortcut solution for the given case, but it might become a pickle when columns are months or when they are a longer list (names, regions, etc) that should be generated automatically.
– turezkySep 10, 2014 at 17:03Yep, both have weaknesses. If you've got many columns you need to do this for, I'd suggest the first option is the best one. With a bit of VBA you could enforce common sorting on both tables.
– Andi MohrSep 11, 2014 at 8:30Add a comment | |
Having trouble in Ubuntu with dual monitors | linux;ubuntu;multiple-monitors;linux;ubuntu;multiple-monitors | Having trouble in Ubuntu with dual monitors
Ask Question
|
0
Based on the comments above, it sounds like junking this install and starting fresh is the right approach. In Ubuntu all of your personal files should reside in your home directory: /home/yoususername. Backing that directory up will save 90% of what you need. Make sure you get the whole directly as their may be some hidden configuration files in there you may want to keep. Those will start with a period "." and you can see them on the command line with by `ls -a /home/yourusername/If you've installed software that you want to take with you to the new installation, simply make a note of it so you can do a sudo apt-get <software1> <software2> when you get the machine back up and running. If you've made any config changes to that software in /etc/softwarename/someconfigfile.conf, you may want to make quick back up of that as well (like a php.ini file or /etc/apache2/sites-enabled/* if you were running an apache web server, for instance). That being said, it's probably not a great idea to just start blindly copying everything out of /etc/* and then blindly back all that up... just make copies of things you know you changed and then selectively restore them when the machine is back. If you changed nothing, then no reason to copy here.That should cover like 99% of everything. In some cases, folks install software like Deluge or XBMC that, when installing, may have set up a specific user for the software and may have files hanging out in /home/xbmc/* or /var/deluge and whatnot... you would probably remember if you set up software like this, so if nothing is ringing a bell, then don't worry about it. Plus, you can always set this stuff up again fresh.Share
Follow
answered Sep 9, 2014 at 13:18JNevillJNevill1,21666 silver badges1212 bronze badges3I didn't want to have to do that, but sounds like I will have to :/ how would I backup the /home folder to a flash drive for example?
– mgil90Sep 9, 2014 at 13:32Well.. you don't necessarily HAVE to do that, but without knowing what commands you fired off, it's impossible to suggest a way to fix it so you are back to one monitor. As for backing up, if you are on the desktop ui, then just stick in your flash drive, navigate to your computer's base directory and then go to /home. There you'll see your user's folder. Just copy and paste that on to your flash drive.
– JNevillSep 9, 2014 at 13:53wiping the computer sounds a bit extreme to me. You could try to rename your xorg.conf file and just restart the computer. I will post an answer below explaining the basic steps.
– chriskellySep 11, 2014 at 12:48Add a comment | ;
0
Normally your window configuration is stored in a file called xorg.conf.You should be able to get your default display settings back by simply moving it out of the way. I presume you cannot see your screen at all now so this is what you should do:Clearing xorg settings:IMPORTANT: You will need to know your username and password.open a consoleOpen a console by pressing CTRL + ALT + F1.login with your username (press ENTER) then passwordcheck if xorg.conf existsat the prompt ($) type the following to list files in your X11 folder (you will be asked for the same password you used already):ls /etc/X11/Check if there is a file called xorg.conf.if yes, rename itIf you see that filename, do the following mv /etc/X11/xorg.conf /etc/X11/xorg.conf.20140911reboot and check if everything worked.rebootDetach the second monitor cable if it is still attached You should have only one monitor now Don't worry, even if it does not work, it will not cause any harm to your PC Share
Follow
answered Sep 11, 2014 at 12:48chriskellychriskelly10111 bronze badgeAdd a comment | |
Firewalling VirtualBox: restrict host inbound connections to guests only | virtualbox;firewall;cygwin;windows-firewall;spoofing;virtualbox;firewall;cygwin;windows-firewall;spoofing | Firewalling VirtualBox: restrict host inbound connections to guests only
Ask Question
|
0
This may take some more resources, but not much.You can try getting a software firewall, like pfsense, and create an internal "vm network" that will be firewalled by a powerful software-based firewall.ShareImprove this answer
Follow
answered Sep 24, 2014 at 11:22adgelbfishadgelbfish62466 silver badges1212 bronze badges2But pfsense does not run on Windows
– antonioSep 24, 2014 at 14:20run it in a virtual machine. then tunnel all vm traffic through it using virtualbox's built in networking features.
– adgelbfishSep 28, 2014 at 0:47Add a comment | ;
0
You could set up a host-only network within Virtualbox. This is a virtual LAN which includes the host and any guests which are attached to it. You would then add a network adapter to each of your guests and attach the adapter to the host-only network. The guests and the host would be able to communicate through the private network.Once you've done this, processes running on the host could bind specifically to the IP address for the host-only network interface. Only processes running on the host or one of the VMs would be able to contact the host's host-only network address.The basic process is as follows:Start Virtualbox manager and go to File->Preferences->Network->Host-only networks.Click the "+" icon at right to create a new one.Click the screwdriver icon to access properties for the new network.Enable a DHCP server if desired (if you don't do this, you'll have to assign static IPs to each guest).ShareImprove this answer
Follow
edited Sep 24, 2014 at 23:13
answered Sep 24, 2014 at 18:57KensterKenster7,19122 gold badges3131 silver badges4444 bronze badges3Kenster, the host-only network prevents the guest to talk with the outside world, but not the host, and my question is: "open a listening port on the host accepting only inbound connections from the VMs".
– antonioSep 24, 2014 at 20:26I've spelled out a little more clearly what I was getting at.
– KensterSep 24, 2014 at 20:58Sorry, how can we do this by interface and not by IP? otherwise the last part of the question might apply?
– antonioSep 24, 2014 at 21:38Add a comment | |
Why is storage and transfer given in bytes? | storage;storage | Why is storage and transfer given in bytes?
Ask Question
|
2
The majority of todays computer systems is internally working with multiples of 8 bits. On the lowest level, smaller quantities happen to be transferred (e.g. nybbles (4 bits) to the PHY of a 100 MBit/s ethernet connection), but everything exposed to higher levels is in multiples of 8 bits. This leads to memories working with 8 bit (or more) chunks. The lowest common demoninator of everything sensible to measure for the end-user is what we today call Byte, so that’s the unit of choice. Data in files is often aligned to the byte boundary, because accessing single bits is a more expensive operation. The smallest quantity supported by most of todays computers instructions is 8 bits of data, and that is what a memory address points to. Thus, some parts of files may be 32 bit chunks or 64 bit chunks, but one will only rarely find a 7 bit chunk which is not filled up to 8 bits (like 7-bit ASCII).ShareImprove this answer
Follow
answered Sep 24, 2014 at 11:31Jonas SchäferJonas Schäfer1,4121111 silver badges2323 bronze badges5Actually, accessing anything smaller than a sector on disk is at best as expensive as accessing a full sector. For modern hard drives, this is 512 or 4096 bytes.
– userSep 24, 2014 at 11:331And of courcse it's only PC related. There is a lot of industrial applications where more specialised devices are used.
– AntonSep 24, 2014 at 11:36@MichaelKjörling True – although modern operating systems will avoid that cost by loading the whole sector into the cache, and users generally need to worry even less about it than application developers.
– Jonas SchäferSep 24, 2014 at 11:401Actually, that only reinforces my point. But the data as stored on the platter today uses complex encodings which normally can't be read in part: you either read an entire sector, or nothing. LBA also addresses storage in terms of sectors, so there isn't even a LBA command to tell the hard disk "read byte nnnnnnnnnn", only "read sector nnnnnnn". What the software (including the operating system) does with the data later is a completely separate issue.
– userSep 24, 2014 at 11:52@MichaelKjörling - "But the data as stored on the platter today uses..." -- Recording digital data on magnetic media has always required transfers of sectors or records with gaps in between. See superuser.com/questions/427554/… The last paragraph mentions why a read has to start in the gap rather than in the middle of a sector.
– sawdustSep 24, 2014 at 19:55Add a comment | ;
0
Yes, your understanding is correct.Sizes are typically specified in bytes for a variety of reasons. One is that specifying numbers in bits would result in larger, less convenient numbers. Another is that units smaller than a single byte are almost never transferred, so there is no reason to use a smaller unit.ShareImprove this answer
Follow
answered Sep 24, 2014 at 11:25David SchwartzDavid Schwartz61.4k77 gold badges9999 silver badges148148 bronze badges1Thanks, for the additional perspective. (I'd up vote if I had the rep.)
– UserSep 24, 2014 at 11:58Add a comment | ;
0
Historically, computers have worked with widely varying word sizes. For example, 36 or 40 bit words wasn't entirely uncommon in early electronic computers (these led to convenient 18- or 20-bit "half words" which were sufficient for many purposes, while the full-length words allowed larger quantities or more precision where that was needed).These days, almost all general-purpose computers work with data in terms of power-of-two multiples of eight bits. Eight bits is a convenient quantity to use as a baseline, and it fits nicely into the "power of two" scheme that because of their binary nature computers have an easy time working with.Consequently, hardware is designed to work with such multiples of eight-bit quantities, in a sort of self-reinforcing loop.In all honesty, today's computers are often designed to work efficiently with significantly larger quantities than eight bits at a time: not uncommonly 32, 64 or even 128 bits at a time. Note that all of these are power-of-two multiples of eight bits, and as such can easily be deconstructed or combined if necessary.On the lower level, storage capacities are often specified in terms of bits, because some systems don't work in terms of bytes. It's also a fixed quantity: eight-bit words fit a lot of uses, but not all, so whereas bytes might not apply in every situation, available-bit counts always remain the same.As David Schwartz pointed out, showing bit quantities to the user would simply inflate the numbers without providing much (if indeed any) actual additional information. While an electronics engineer or firmware programmer can be expected to know how to work in bits, the average computer user cannot be expected to have such knowledge. Early personal computers also used encoding schemes that always encoded a single character as a single byte (or in a few cases, some small multiple of bytes), so the concept of "character = byte" was easy to convey. This isn't quite the case today with variable-length encodings such as UTF-8, but on the other hand storage capacities are so great these days that we don't normally need to worry about those details.ShareImprove this answer
Follow
edited Mar 20, 2017 at 10:17CommunityBot1
answered Sep 24, 2014 at 11:48useruser29.1k1111 gold badges9999 silver badges144144 bronze badges0Add a comment | |
Hide a column when auto filter is active | microsoft-excel;microsoft-excel-2010;microsoft-excel;microsoft-excel-2010 | Hide a column when auto filter is active
Ask Question
|
1
I found a solution https://stackoverflow.com/a/12808974/3789751 .I have the following subSub HideUnHide()Set AWS = ActiveSheetfstate = ""If AWS.FilterMode Then c = AWS.AutoFilter.Filters.Count For i = 1 To c Step 1 If AWS.AutoFilter.Filters(i).On Then ActiveSheet.Columns(1).Hidden = True End If Next iElse ActiveSheet.Columns(1).Hidden = FalseEnd IfEnd SubAnd this is called from a Worksheet_CalculateSub Worksheet_Calculate() Call Modul1.HideUnHideEnd SubShareImprove this answer
Follow
edited May 23, 2017 at 12:41CommunityBot1
answered Sep 24, 2014 at 14:29mowsesmowses1111 bronze badge0Add a comment | ;
0
In VBA functions are very unreliable when it come to modifying the worksheet (they are great at returning values). You are better off using a sub instead. The sub would have two parameters; The input range and the output string.ShareImprove this answer
Follow
answered Sep 24, 2014 at 13:01Gary's StudentGary's Student19.1k66 gold badges2525 silver badges3838 bronze badges1It tried it with a SUB but didn't know how to call that SUB when a filter was changed.
– mowsesSep 24, 2014 at 14:25Add a comment | |
How to reload vundle plugin after configuration change | vim;vim | How to reload vundle plugin after configuration change
Ask Question
|
7
Most plugins directly use the configuration variables, so it suffices to apply the variable setting to the current Vim session, and then re-trigger the plugin.For the first, you can either re-source your entire ~/.vimrc (if it's clean, and you avoid re-defining autocmds twice)::source ~/.vimrc(You can abbreviate that as :so % if you're currently editing it.) Or you just selectively execute the changed line, e.g. via:yy:@"For NERD_tree and this particular config, retriggering can be done via:closing and reopening NERD_treezooming the NERD_tree window in and outShareImprove this answer
Follow
answered Sep 24, 2014 at 11:50Ingo KarkatIngo Karkat22.2k22 gold badges4242 silver badges5858 bronze badges3How does one "zoom" in and out of a window (this is not the same as ctrl+w+w)?
– Adrian ForsiusSep 24, 2014 at 12:451See :h NERDTree-A; this expands the sidebar window (for long filenames / deep trees).
– Ingo KarkatSep 24, 2014 at 12:53Short form of :source ~/.vimrc is :so ~/.vimrc. If you are currently editing ~/.vimrc you can just run :so %.
– patryk.bezaSep 11, 2019 at 18:36Add a comment | ;
0
I figured out that a restarting the plugin (in this case :NERDTree) with the basic start command was enough hence this was my solution:Edit .vimrclet g:NERDTreeWinSize = 60Save .vimrc:wReload .vimrc as source:source %Run :NERDTree:NERDTreeShareImprove this answer
Follow
answered Sep 24, 2014 at 11:38Adrian ForsiusAdrian Forsius14311 silver badge66 bronze badgesAdd a comment | |
Remove beginnings of email addresses from text using grep or sed | shell-script;regex;grep;sed;shell-script;regex;grep;sed | Remove beginnings of email addresses from text using grep or sed
Ask Question
|
0
How about this?echo -e John Stevenson Johnnyboy34 [email protected] 0320423\\n Mike Anderson AndersMike [email protected] 0234234 | sed -r -e 's/((\w|[.])+)@/@/g'Which yields:John Stevenson Johnnyboy34 @company.com 0320423 Mike Anderson AndersMike @mikeltd.foo 0234234ShareImprove this answer
Follow
answered Sep 24, 2014 at 21:03EricMEricM14122 bronze badgesAdd a comment | |
How to open the actual folder a library subfolder refers to? | windows-libraries;windows-libraries | How to open the actual folder a library subfolder refers to?
Ask Question
|
0
The only workaround I found so far is copy-pasting the path from the address bar (which is expanded correctly on clicking) and pasting it into a different explorer window or the start menu's text field. But that is tedious if repeated often, and spams my ClipX clipboard history.ShareImprove this answer
Follow
answered Sep 24, 2014 at 10:11Tobias KienzlerTobias Kienzler4,31177 gold badges4343 silver badges7474 bronze badgesAdd a comment | ;
0
put the following line in a .bat file and run it from the folder you want to open:%SystemRoot%\explorer.exe %~dp0this opens explorer in batch file location.ShareImprove this answer
Follow
answered Sep 24, 2014 at 10:40adgelbfishadgelbfish62466 silver badges1212 bronze badges3hm, not exactly effortless I am afraid to say. But that brings me to the idea of simply adding a new "Open" option to the folder type...
– Tobias KienzlerSep 24, 2014 at 11:391keep the batch file in clipx :)
– adgelbfishSep 24, 2014 at 11:53Indeed interesting suggestion, especially with its sticky plugin :D
– Tobias KienzlerSep 24, 2014 at 11:59Add a comment | |
"swapfiles" taking 45 GB space on Mac... What's the fix? | mac;memory;ssd;mac;memory;ssd | "swapfiles" taking 45 GB space on Mac... What's the fix?
Ask Question
|
0
You should not blindly delete them. /var is just a link to /private/var. A typical thing that takes a lot of space there is temporary files in /private/var/tmp and /private/tmp. You can safely delete those after closing all programs and rebooting.ShareImprove this answer
Follow
answered Sep 24, 2014 at 10:57orkodenorkoden82988 silver badges1010 bronze badgesAdd a comment | |
How to mount external Windows NTFS volume on Mac? | macos;hard-drive;mount;macos;hard-drive;mount | How to mount external Windows NTFS volume on Mac?
Ask Question
|
4
In the recent macOS, this command should work:diskutil mount disk1s1Where disk1s1 is the disk and partition number from diskutil list.The volume will mount in read-only.For the write access support, read: recommendations for reading and writing NTFS from macOS.ShareImprove this answer
Follow
answered Jul 30, 2017 at 22:53kenorbkenorb23.5k2626 gold badges122122 silver badges186186 bronze badges1I thought NTFS mounts automatically nowadays, but I can't test it now.
– SPRBRNOct 30, 2017 at 11:58Add a comment | ;
2
You don't need external program to mount NTFS volume, follow these steps to mount NTFS external disk on macOS. This is tested and working on macOS Mojave-sudo mkdir /Volumes/MyNTFSsudo mount -t ntfs -o rw <Disk Identifier> /Volumes/MyNTFSTo get disk identifier, you can run diskutil list. For example, if below is the output-/dev/disk2 (external, physical): #: TYPE NAMESIZE IDENTIFIER 0: GUID_partition_scheme *2.0 TBdisk2 1: Microsoft Basic Data MyNTFS 2.0 TBdisk2s1Then you can run following command to mount-sudo mount -t ntfs -o rw /dev/disk2 /Volumes/MyNTFSShareImprove this answer
Follow
answered May 26, 2019 at 5:55riteshritesh12133 bronze badges1Thank you!! This is the only method that worked for me. Disk utility and diskutil mount didn't work.
– Pietro CoelhoDec 27, 2022 at 21:08Add a comment | ;
1
If you need access to your drive, there is commercial alternatives such as Paragon NTFS for Mac, or Tuxera NTFS for Mac.I don't have much experience with either, but I believe them to be acceptable solutions.If however, you feel in the experimental mood, there is unofficial NTFS support in macOS. However, no guarantee is provided.ShareImprove this answer
Follow
answered Apr 22, 2017 at 10:01MindToothMindTooth13633 bronze badgesAdd a comment | ;
0
It is NTFS, you cannot mount it. It must be Mac OS Journaled or FAT32.ShareImprove this answer
Follow
answered Sep 24, 2014 at 17:41EdGEdG61611 gold badge55 silver badges1616 bronze badges41Strange. I mount another NTFS hard drive with command sudo mount -t ntfs /dev/disk2s1 /Volumes/VERBATIM/ and it work perfectly.
– Davide BrognoliSep 24, 2014 at 18:36That is surprising, as Apple say that Snow Leopard and up cannot mount an NTFS drive. Now I am on my Macbook, I can use links. NTFS3G (macntfs-3g.blogspot.co.uk) allows you to mount NTFS drives, format as NTFS etc.
– EdGSep 24, 2014 at 18:40I have Paragon NTFS installed on my machine and I can mount every NTFS disk.
– Davide BrognoliSep 24, 2014 at 18:59Should've mentioned that! Maybe the disk is corrupted then
– EdGSep 24, 2014 at 19:06Add a comment | ;
0
You can mount any NTFS disk, natively. You simply can't write to it without additional 3rd party software. If you can't see the drive at all, or it won't mount, the drive is most likely beginning to fail/failing/failed.ShareImprove this answer
Follow
answered Mar 15, 2015 at 20:28user428322user4283221Add a comment | ;
0
For those who are already using ntfs for mac by Paragon, and have faced the famous "Unable to mount" error,try executing -sudo kextunload /Library/Extensions/ufsd_NTFS.kext // unloads driversudo kextload /Library/Extensions/ufsd_NTFS.kext // reloads itThis is what worked for me. However, if the issue persits, here's an article that might help - https://kb.paragon-software.com/article/406ShareImprove this answer
Follow
answered Jul 27, 2019 at 19:34Niket PathakNiket Pathak26922 silver badges55 bronze badgesAdd a comment | |
What is the relationship between Unix, Linux, Ubuntu, Debian and Android? | linux;ubuntu;unix;debian;operating-systems;linux;ubuntu;unix;debian;operating-systems | What is the relationship between Unix, Linux, Ubuntu, Debian and Android?
Ask Question
|
54
Unix is an Operating System developed starting in 1969. It was originally designed to be a developer station rather than application platform, but, as development progressed and different vendors got involved, Unix was added to. Unix was initially written in assembly, but later developed into C.In relation to the others, the Linux kernel is Unix-like. Linux is a Unix-like kernel. It was initially developed by Linus Torvalds through the 1990s. This kernel was used in the initial software releases by the Free Software Movement to compile a new Operating System. The kernel is responsible for managing the systems resources and allocating them to applications. Note here despite many of its releases being referred to as 'Linux' this is a specific aspect which makes up the Operating System along with the text editor, compiler, debugger etc and not an Operating System in its own right.Debian is one of the forms of this Operating System released in the early 1990s as is one of the most popular of the many versions of Linux available today. Ubuntu is another Operating System which was released in 2004 and is based on the Debian Operating System. It is very popular because is is easy to learn without the need to use the terminal. Linux: Kernel (Still in active development)Debian: Early Operating System to Ubuntu (Still in active development)Ubuntu: Newer Operating System based on Debian (Still in active development)Unix: An old Operating System which the Linux kernel loosely based onReading: Linux KernelReading DebianReading UbuntuReading: UnixIf you are really interested in learning the history behind all this I recommend a film called Revolution OS, which goes into a lot of the history behind the development of this free software movement.ShareImprove this answer
Follow
edited Sep 27, 2014 at 20:32CommunityBot1
answered Sep 24, 2014 at 9:43Matthew WilliamsMatthew Williams4,2841212 gold badges2626 silver badges3838 bronze badges157Linux is not "based on Minix" in a meaningful way, except that Linus had seen the Minix source before he set out to see if he could make something like that himself. There's no code pedigree from Minix in Linux.
– hmakholm left over MonicaSep 24, 2014 at 11:4328Linux wasn't based on Unix either. No code from Unix was used in Linux. Debian is not an "early OS" it's as modern as Ubuntu and still very much under active development. A text editor, compiler and debugger are not part of the OS! They are applications that run on it. Oh, and there's no such thing as Debian Unix!
– terdonSep 24, 2014 at 12:334@terdon | I didn't say any code from Unix was used in Linux. The point was it was Unix like. Although I didn't put that across well. I will edit accordingly. I meant Debian was early in relation to Ubuntu. As in it has it's release date earlier. I am perfectly aware both are still in very active development. I don't know what your bit about Debian Unix is talking about. What is Debian Unix?
– Matthew WilliamsSep 24, 2014 at 12:479@kostix So, uh, by that definition, WoW becomes part of the Windows OS once it's installed? I'm pretty sure the line is closer to what terdon describes.
– IzkataSep 24, 2014 at 19:489OS X is a direct Unix descendant via BSD which is a true-blue Unix OS (unlike Linux which does not conform to the Single UNIX Specification) via it's evolution from NeXTStep which evolved out of BSD. There are only two root implementations of Unix: BSD and System V both of which decends directly from the original code of AT&T Unix. In fact, OS X is a registered Unix variant (Apple has certified it with the Single Unix Specification) and therefore they are allowed to use the trademark "UNIX" when marketing OS X.
– slebetmanSep 25, 2014 at 3:55 | Show 10 more comments;
75
There's one more thing you need to know of: GNU.GNU stands for "GNU's Not Unix", and it is an attempt to create a free, independent version of Unix, developed by the Free Software Foundation.They got very far, they made a C compiler, a C library, a linker, editors, shells, all the commands you'd expect in a typical Unix shell, lots of stuff. But the kernel (called "Hurd") wasn't finished. All the things outside the kernel (running as processes owned by users) are together known as the "userland".When Linus Torvalds created his Linux kernel, he didn't create a userland. He just had a kernel, it wasn't a full system either. It turned out to be possible to compile his kernel and use it inside the GNU userland (this was probably not trivial, but I wasn't there and don't know).The OS people usually refer to as "Linux" actually started out as the Linux kernel with the GNU userland, and lots of other stuff has been added since. The Free Software Foundation has always insisted it should be called GNU/Linux as a result.Debian is a "distribution" of Linux; they did all the hard work of compiling all the various tools you needed to make a whole Linux system, compiled them and offered them for download as a bunch of floppies. Or a CD, later. Others did the same, e.g. Slackware, Red Hat and so on.Many other distributions were later created, often not from scratch, but taking an existing distribution as a starting point and adding extra software to it, or organizing it differently, or whatever. Ubuntu was based on Debian this way.ShareImprove this answer
Follow
answered Sep 24, 2014 at 11:46RemcoGerlichRemcoGerlich85155 silver badges44 bronze badges1819Outside of the FSF, most people just roll their eyes whenever Stallman insists on the use of GNU/Linux and continue to only use the latter. In some ways that's not really fair; but such is the real world.
– Dan Is Fiddling By FirelightSep 24, 2014 at 12:4220They do have a point. Once upon a time I installed a "Linux from scratch" machine, and something like 75 out of 90 packages you needed to get a running system came from GNU. Of course, I never say GNU/Linux either, but I thought it was necessary to know about GNU in order to keep Unix/Linux/Debian etc apart.
– RemcoGerlichSep 24, 2014 at 13:004At the same time, any non-trivial distro these days is going to include lots of stuff that is neither part of GNU nor the Linux kernel itself. Does anyone really want to chain all of those into a name less practical than the full titles of reigning monarchs?
– Dan Is Fiddling By FirelightSep 24, 2014 at 18:0313Calling it GNU/Linux can be useful, as a way to distinguish from Android Linux (which has little to none of the GNU userland).
– MarkSep 25, 2014 at 6:072@Clearer The term "open source" has as much meaning as the term "source" itself - within the context it is used, it does mean that you can use the source for more than examination. Arguing semantics this way is meaningless in and of itself since we can extend this indefinitely and all language breaks down. We have a separate term for source code you can only look at and it's "shared source". It's a newer term because it didn't make much sense until recently. If we're going to argue semantics, all software is open source by necessity since you can read the machine code.
– mechalynxSep 25, 2014 at 17:07 | Show 13 more comments;
17
"Unix" was originally the name of an operating system for the PDP-11, developed at Bell Labs in the 1970s. Its design was immensely influential, and it was copied and reimplemented dozens of times.Nowadays, "Unix" is an umbrella term for an entire family of operating systems, some but not all of which are directly descended from that original OS; anything whose primary system programming interface is compatible with the POSIX.1 API specification can legitimately be called an implementation of Unix -- and there are dozens of them. It is easier to list the operating systems still in wide use today that are NOT implementations of Unix:WindowsIBM's z/OS and their relatives, which have been under continuous development since before 1970a few deeply-embedded things that are more like runtime libraries than complete OSes(There are also a bunch of experimental research prototypes that are trying to move beyond the Unix design, but they don't qualify as "in wide use", alas.)"Linux" is the common name of one implementation of Unix. It has been around since the 1990s and is one of the top five most commonly used implementations today -- probably either #1 or #2, depending on how you count these things.Linux is unusual in that the kernel, the C library, the compiler, the basic set of "shell" utilities, and so on are all developed by different groups of people; moreover, there's more than one choice for most of those pieces. Someone has to pick a set of pieces and put them together and make sure they work properly in combination. That someone (usually a group of people, nowadays) is traditionally referred to as a distributor of Linux, and their output is a distribution. Debian and Ubuntu are distributions of Linux; they used to be extremely closely related but have since diverged quite a bit.(Technically, the name Linux refers specifically to the kernel, and it'd be a little weird to call an operating system Linux if you didn't use that kernel, but there are people keeping everything else and swapping out the kernel, e.g. Debian kFreeBSD.)(Footnote for pedants: all glossing-over of fine distinctions in this post was 100% intentional.)ShareImprove this answer
Follow
answered Sep 25, 2014 at 0:43zwolzwol1,25888 silver badges2323 bronze badges4Might be worth stating that Ubuntu began as (and still is) a derivative of Debian. Other than that, excellent answer!
– Thane BrimhallSep 25, 2014 at 19:27I like this answer the best!
– Niko BellicSep 27, 2014 at 21:01What do you mean "Linux" is the common name of one implementation of Unix? I thought they shared no code?
– Koray TugayJan 30, 2015 at 9:191@KorayTugay Sharing code with the historical original is no longer an interesting criterion, because almost all of that code has been superseded anyway. As far as I'm concerned, anything whose primary system programming interface conforms to POSIX.1 is an implementation of Unix no matter where the code came from. It has to be the primary system programming interface, though; compatibility layers (which both Windows and z/OS have) don't count.
– zwolJan 30, 2015 at 16:34Add a comment | ;
7
UNIX and Linux are not related to DOS or Windows. DOS was an outgrowth of the 8-bit CP/M operating system popular in the late 70's/early 80's.Windows NT (of which XP, Vista, 7 and 8 are based on) was developed new by Microsoft starting in 1993 and borrows a lot of concepts and ideas from VAX VMS. Windows NT was developed to be a "real" modern, preemptive, multi-user, multi-tasking secure operating system.Windows 3.1, 95, 98, and ME were pretty much Microsoft's idea/execution of multi-tasking (not multi-user, or secure) DOS.Regarding UNIX, Linux, etc.:UNIX is a kernel/API/operating system that has been around since the 70's.A kernel provides a platform for programs to run, in the case of Unix, it allows multiple programs to run on a single computer and multiple users to access it. A kernel runs no programs on its own, these must be separately developed and provided.An API is a standard way for programs to talk to the kernel. It's part of the kernel.An operating system is a kernel plus common utility programs to manage and administrate the system. Common utility programs for UNIX include basic programs that manage services and logins (init), a shell that allows you enter commands (sh, bash), and basic file management commands such as cp, ls, mv, etc. Linux is a UNIX-like kernel released under the GPL which at first worked on PC hardware, but now works on almost anything with a CPU (if you are allowed to run it).GPL is a license that says anyone that modifies/enhances Linux, and publishes their modifications, is required to make those modifications available to the public and allow others to do the same.Linux implements the UNIX API, so UNIX programs can run generally unmodified if they are recomplied (this is far easier than rewriting them from scratch) - since they use the UNIX API, they don't care if they are really talking to Linux or UNIX or something else, as long as the API does the same thing.Debian is a Linux distribution. It started in 1993 and is among the oldest distributions. Linux distributions generally provide:a Linux kernel,basic utility programs,an installer so you can install Linux on your system,a package manager (plus a format for packages - Debian uses .deb)a repository of packagesSo you can install a distribution, get a basic Linux environment up and running, then call up packages from the distribution's repository, using the package manager, when you need software. It's different from Windows where traditionally software has been distributed on CDs and years go by between versions and updates. Software in repositories is typically updated frequently and the package manager handles downloading and applying any updates.Debian is also strict about releasing only open source software, meaning things that require proprietary software to run, like modern video cards or Wi-Fi chipsets, won't work optimally (or at all) with Debian "out of the box." Debian typically creates new versions slowly and is more interested in stability than new features. This makes Debian a favorite for servers where the hardware is relatively static and software stability is important.Ubuntu is a "fork" of DebianDebian allows others to create distributions based on it, using its package management tools. Doing this is termed "forking."In addition to the specific branding and look of Ubuntu, Ubuntu adds additional Ubuntu-specific repositories containing more and newer software. Ubuntu is more "bleeding-edge" than Debian - it was created to be more friendly and useful from a non-technical or non-UNIX-expert standpoint. It is all about new features and hardware working out of the box.Most software that works on Debian will work on Ubuntu. The other way around can be a bit problematic since Debian's software is typically older. You might run into some base components that need updating to run Ubuntu stuff, but can't be updated because there's no newer version in the Debian repos. You can update these manually, but then that might require other components to be updated, etc.Should note that Debian is a lot friendlier and aware of modern hardware these days than before.ShareImprove this answer
Follow
edited Sep 24, 2014 at 22:37terdon51.5k1212 gold badges120120 silver badges167167 bronze badges
answered Sep 24, 2014 at 15:56LawrenceCLawrenceC71.9k1515 gold badges123123 silver badges211211 bronze badges3Windows NT was not developed new beginning in 1993. NT was simply a rebranded copy of OS/2 3.0 with Presentation Manager replaced by the Windows GDI.
– Carey GregorySep 25, 2014 at 0:52Good point. I didn't consider OS/2. Wasn't OS/2 compatibility in NT was implemented as a subsystem (like the Win32 API and POSIX API on top of the native NT API) though?
– LawrenceCSep 25, 2014 at 12:211NT didn't exactly have OS/2 compatibility because it was OS/2. Aside from the UI and API naming conventions, they were initially the exact same code base. For example, in a command line session when errors occurred, the error message text you got on NT and OS/2 was word-for-word identical. They gradually grew apart, but all the basic concepts implemented in NT to this day were originally part of the OS/2 design.
– Carey GregorySep 25, 2014 at 22:17Add a comment | ;
6
Unix = a commercial operating system specificationLinux = a free Unix clone (only the kernel)Debian = a Linux distribution (Linux + other stuff)Ubuntu = Debian redistributed (Debian made more end user friendly)ShareImprove this answer
Follow
answered Sep 26, 2014 at 8:01Georges St. ClairGeorges St. Clair6111 bronze badgeAdd a comment | ;
4
"Unix" is a trademark for an operating system that was inspired by the 1960s-vintage operating system named "Multics"; "Unix" was a wordplay meant to suggest that it was like Multics, but not as complicated. (Personal note: In the late 1980s, I worked on a commercialized descendant of Multics that was not a type of Unix.) Development of Unix began in 1969 on a DEC PDP-7, and moved to a PDP-11 in 1970. In 1972, it was rewritten in C; to that point it had been written in assembly language. (DEC assembly language was relatively programmer-friendly, but it was still assembly language.) It remained mostly a Bell Labs research project through what was known as "Version 7", which was released in 1979.Along the way, circa 1977, an alternate branch developed: "BSD" (Berkeley Software Distribution). AT&T licensed a commercial version of its branch, "System III", in 1982, and then "System V" in 1983. Then there was a bunch of legal fighting between AT&T and Berkeley, which hurt both, until the lawsuit was eventually settled.Partly in response to the battles over System V and BSD, two new projects began: Minix (by Andrew Tanenbaum, which replicated the key features of existing Unix-family kernels, with a micro-kernel design) and the GNU project (which replicated most of the important non-kernel parts of existing Unix), both with entirely new code that avoided the legal troubles between System V and BSD. Standardization efforts tried to resolve the differences between the two main branches; the main result was POSIX.In 1991 – inspired by Minix, older Unix branches, and the absence of progress on a GNU kernel – Linus Torvalds created Linux. It was also all new code, and returned to the old-Unix type of kernel rather than the Minix-type micro-kernel.In 1997, Apple took over the BSD-based Nextstep, and eventually developed it into a new Mac operating system, and adapted it to other Apple devices.Linux exists in a variety of distributions, which are packages that include a Linux kernel and assorted utilities. Debian was one distribution of Linux, and it has branched into a family of distributions. Ubuntu is a distribution that is part of the Debian family, and it has in turn branched into a family of distributions.Windows and DOS have a very different history. Circa 1963, DEC built the PDP-6, which had an operating system named Monitor. When they built the PDP-10, they named the operating system "TOPS-10". Gary Kildall wrote an operating system for Intel 8080-family computers and named it "CP/M"; it was inspired by TOPS-10. CP/M inspired "86-DOS", written for 8086-family machines by Tim Paterson (using Microsoft's "Standalone Disk BASIC-86" 8-bit FAT filesystem), because CP/M-86, the 8086-family sequel to CP/M, was delayed.IBM wanted to license CP/M-86 for its first 8088 machine, but there were problems with the deal. IBM had heard of 86-DOS, and asked Microsoft to get it for them. Microsoft licensed it (and later bought it), and licensed it to IBM as "PC-DOS" – and licensed it to others as "MS-DOS".Some time later, inspired by Visi On (which was in turn inspired by the Xerox Star, better known as the inspiration for Apple's Lisa and Macintosh), Microsoft developed Windows as an add-on to MS-DOS. Early versions were not very successful, but eventually Windows 3.0 was good enough for commercial success. Several later versions (3.1, 3.11, 95, 98, and ME) all ran on DOS, but Microsoft recognized that DOS was holding back progress on Windows. Near the end, much of that branch of Windows was 32-bit, but it still depended on 16-bit DOS.In an attempt to get around the limitations of DOS, Microsoft worked with IBM on OS/2, which was meant to be "Better DOS than DOS, and better Windows than Windows". Initial versions were not much good, however, and eventually IBM and Microsoft ended joint development. IBM took it over, and ended up making a pretty good OS/2.Meanwhile, DEC created the VAX series of computers to replace its PDP-11 line, and the VMS operating system to run on it. It shared some history with the TOPS-10 operating system, but they weren't mutually compatible.Hedging against the possibility of problems with OS/2, Microsoft hired a bunch of top VMS developers (and some micro-kernel researchers) to build a new, 32-bit Windows, from scratch. Deep down, it resembled a micro-kernel adaptation of the best features of VMS. On top, it looked like Windows. The first release of 32-bit Windows was "Windows NT 3.1", followed by Windows NT 3.5, 3.51, and 4.0, then Windows 2000 (without the "NT"), XP (the first 64-bit Windows), Vista, 7, 8, and 8.1.One interesting thread tying those mostly-unconnected development paths together is DEC. A lot of early Unix history was tied to DEC the PDP-7, PDP-11, and VAX. The DEC PDP-6 and PDP-10 inspired some DOS prehistory. And veterans of DEC's VAX-VMS team built the core of the Windows NT family.ShareImprove this answer
Follow
edited Sep 27, 2014 at 22:27
community wiki
4 revs, 2 users 98%Steve4The correct spelling is "Linus Torvalds". Also, according to his book "Just for Fun", Torvalds didn't know much about the GNU project until after he released Linux and people in Usenet encouraged him to put it under the GPL! He never intended to write THE GNU kernel! (this also would make Hurd developers sad)
– JosefSep 25, 2014 at 13:54Thanks for the spelling correction. Even if I got the other 700+ words right, it's still a bit embarrassing to get one wrong. The GNU kernel clarification is useful; although Torvalds hadn't intended to to write a GNU kernel, he also said that he wouldn't have written Linux if a GNU kernel had existed -- or if Tanenbaum's publishers had allowed him to open-source Minix. (Torvalds also said one goal was to learn more about the 386; a kernel is a good project for that sort of thing.)
– SteveSep 25, 2014 at 23:43I could point out a number of things that are wrong with this. 86-DOS (originally QDOS) was developed independently as a stopgap measure for 8086 development when no CP/M-86 was forthcoming from DRI. The IBM/Microsoft partnership broke apart before the release of Windows 3.0 in 1990 (Windows 3.0 was the version that took off). The Mac was launched in 1984, Windows development was inspired by a 1982 demo of Visi On, and Windows 1.0 was released in 1985; compare to the Apple Lisa. OS/2 1.x weren't bad for what they were; the architecture was decent, native software was another matter. And so on.
– userSep 26, 2014 at 12:27@Michael Kjörling : The Microsoft-IBM Joint Development Agreement survived at least through the December 1990 release of OS/2 1.3; Windows 3.0 was released in May 1990, so although both sides were dissatisfied with the JDA by that point, it was (best I can tell) still in force. I searched for ancient news articles indicating an earlier dissolution of the JDA, but I didn't find anything. I'll look at the other points later, and revise if appropriate.
– SteveSep 27, 2014 at 21:41Add a comment | ;
3
I suspect they are all Operating Systems They are or were all operating systems. Nowadays Unix is a trademark and not an operating system.that may be based upon one anotherIn one way or another this is true. The latter group were essentially based on a re-implementation of many ideas that came from Unix. There was no Unix code in Linux (although this was the subject of prolonged litigation which ultimately failed).similar to how Windows is based on DOS.I suspect there's not any PC-DOS code in Windows 8, maybe not even for compatibility purposes. There is a clear progression from DOS to Windows 8 though. This is not really the case with Unix and Linux.Is this the same type of relationship?Not really, Ownership and development of Unix and Linux are clearly separate.Linux is an operating system kernel initially developed entirely by Linus Torvalds. It was intended to be a bit like Unix and drew many ideas from Unix. Torvalds did not start with any Unix code as a base. To make a usable operating system you notably add to a Linux kernel a set of "GNU" tools independently developed by the FSF. You also nowadays add one or more of several competing subsystems (e.g. Gnome or KDE desktop manager). Each of these is called a "distribution".There are many such distributions, each with their own particular choice of features.Some distributions are essentially modified forms of other distributions. Typically one distribution is referred to as an upstream distribution. Releases of the downstream distribution depend to a large extent on new releases of the upstream distribution.Ubuntu is a downstream distribution of Debian. One in which Ubuntu add a lot of value (compared to some other such relationships such as CentOS and RedHat perhaps)ShareImprove this answer
Follow
answered Sep 24, 2014 at 15:56RedGrittyBrickRedGrittyBrick80.5k1919 gold badges132132 silver badges201201 bronze badgesAdd a comment | ;
2
Linux per se is just the kernel.You can compare the Linux kernel with the Windows kernel.The biggest difference is, Linux uses a pure monolithic kernel where Windows uses a hybrid one.But they are both kernels, and normal people cannot do stuff with just the kernel, because the kernel is not intended in giving us users access to functionality, but rather solve the tasks necessary for providing our access to functionality.Debian and Ubuntu are flavors of distributions. Distributions are everything that run ON/AROUND the kernel. And since the kernel cannot do stuff, you'll need some basic applications, to lift Linux to be a fully operating system. So some basic needs a distribution provides is: posibilities to manage libraries and applications, managing startup applications, handling serval protocols, and a GUINone of these are necessary, but are needed to have the full functionality of a "common" OS like what Windows or MAC OS provides.Also Debian is one of the forefathers of distributions. It is one distribution that a LOT of distributions depend on/develop from. Like Ubuntu for example.Now, why do so much people use Ubuntu instead of Debian?Because Debian comes with as little preinstalled software as possible, but just as much as needed to run a full OS. (Which is this case is without GUI because it is mainly used on Servers). The result is, very stable and slink OS.Now the "majority" of people would need a GUI, and might like to hear their music on their PC's and laptops, access the internet, and so on. With Debian, that wouldn't work without investing time in installing a GUI, serval drivers and configuring these and that. And here is where Ubuntu comes in. Ubuntu provides all the stability Deiban provides and adds a lot of functionality needed for daily home use. Windows does not have these dynamics. But still, there is the Windows version everybody uses and the Server versions. Which is just not as diverse as the Linux flavours. But still a big customization for the existing group of customers AND applications realms.Both, DOS and the Linux terminal are executed on the Kernel. But they can also be "emulated" in the OS. In the OS these emulators do nothing else than passing the commands to the kernel. The Kernel then dumps information which is picked up by the emulators and printed in the terminals.PS: I intentionally say GUI is needed for a full OS and that Debian is a forefather for the sake of easier understanding. I am aware that these states are technically not fully right. Just a little info for keeping the hardcore nerds from spinning too fast while reading this :)ShareImprove this answer
Follow
edited Sep 24, 2014 at 17:36chue x24311 gold badge66 silver badges1313 bronze badges
answered Sep 24, 2014 at 10:29Harrys KavanHarrys Kavan29911 gold badge22 silver badges1010 bronze badges1You can choose to install a GUI when you install Debian. It took me less than an hour to get Gnome and working wifi on my laptop, at which point you have default applications comparable to Ubuntu. To be fair, if you're terrified of the command line and don't want to learn, Ubuntu's a better choice.
– Gordon GustafsonSep 24, 2014 at 15:09Add a comment | ;
1
Unix is a class of operating systems all based around the same theory and all similar enough that most people can't tell the difference. The history is kinda convoluted and involves Berkley (BSD) and AT&T (SysV) and a standard called POSIX.Linux is a type of Unix, although purists will tell you that Linux is just the "kernel" the lowest-level part. The rest of the OS is made of Unix compatible tools from the GNU Software Association and other places. Together, this makes GNU/Unix.Debian is a general distribution of Linux. Every distribution has its own package management tools, set of default packages that are pre-installed, and may differ in what services are pre-installed and even what configuration files and such are used.Ubuntu is based on Debian. They take the latest stable Debian and add their own Desktop apps, software management tools and other things to make it unique. There are many other distributions of Linux. Most are either based on Debian or based on Redhat, although there are also Slackware and Gentoo based systems. Each of these 4 bases are built upon by the other distributions. For example, I'm running Elementary OS right now, which is based on Ubuntu which is based on Debian which is a version of Linux which is a flavor of Unix. Got it?Mac OS/X is similar to Unix in that it uses a different kernel (Mach) that is also Unix compatible with a set of software packages on top of that to make it compatible (mostly) with BSD-flavors of Unix. A lot of software is easy to port from Linux to Mac because of Mac's BSD compatibility. However, they change the upper layers of the OS with a GUI based on display PDF and other additions. The whole thing was originally created as NeXT Step and Apple bought it and gave it a facelift. Its in the Unix family.Android uses a Linux kernel, but the rest of the OS is of their own design, so while the lowest levels of the OS are based on Unix, the rest is not, and its not generally considered to be a Unix flavor, although some consider it a Linux flavor. Confused yet? Android doesn't conform to the POSIX standards.DOS/Windows is totally different. MS-DOS was originally a port of CP/M from the 8080 to the 8086 (the 8080 is an 8-bit CPU and a .COM file is an 8-bit executable for CP/M). Microsoft didn't write it, they bought it then licensed it to IBM and its competitors. Windows started out as the old Apple API, more or less stolen legally, which is why it uses a Pascal calling convention. Windows 95 and Windows Me and a few others still used DOS internally for some things (there were lawsuits about this). Newer versions of Windows are based on the Win32 API which was co-written by IBM for OS/2. Microsoft broke off from the OS/2 deal and took the code with them. The Windows NT kernel is normally used for running the Win32 API which doesn't use DOS at all, and Microsoft actually borrowed some ideas from Unix .. in fact a couple Unix copyrights even show up when you boot NT, but its still FAR from Unix compatible.ShareImprove this answer
Follow
answered Sep 25, 2014 at 4:44Evan LangloisEvan Langlois13122 bronze badgesAdd a comment | ;
0
UNIX - A flavor for Power PC as oppose to 'Windows'.Linux - Sub-set of Unix flavor - an OS devised under Free Software Foundation and it is "Free"Debian - A foundation which devised Linux - also invited associates to come under the umbrella of Free Software Foundation and contribute for everything that can make complete Linux with many short of tools and utilities and many many application which can be installed on said system, including a package manager to support installation and configuration of all such application.Ubuntu - an extracted version of Debian to suite/fit to Desktop environment in the format of 'Default installation'. Further it is dressed up for desktop themes and utilities.ShareImprove this answer
Follow
edited Sep 27, 2014 at 15:44slhck218k6767 gold badges591591 silver badges578578 bronze badges
answered Sep 27, 2014 at 15:23KamleshKamlesh911 bronze badgeAdd a comment | ;
-1
UNIX was an OS created in the 60s and 70s. Computers were expensive, and UNIX was expensive. That was not a problem. Only big companies, universities and governments had computers back then, and they had money. It was so expensive that Linus Torvalds created an alternative: Linux, which stands for Linux Is Not UniX. He wanted it to be open and free. UNIX was copyrighted, so he rewrote all necessary code (with many helping hands), and required all code to be free, using a special license. As this was a lot cheaper, many people started using it. It was cheaper than UNIX, soon had more users, was used on more servers. As it was cheaper and faster than Windows, it was more popular for cheap webservers as well. There are two main distributions: Debian/Ubuntu and Redhat/Centos. Besides that there are some other distributions, but these have the main marketshare. Debian is mainly used as server OS. Ubuntu was created on top of that, but then with normal users in mind - those that don't know how to use a terminal, those who want something that simply works. Redhat and Centos both are server systems, like Debian. They both have desktop versions (and debian as well), but not as user friendly as Ubuntu, which has a server system as well, which is becoming more and more popular. Redhat is the OS of choice for big companies, because they offer support contracts - expensive but for some people not a problem. ShareImprove this answer
Follow
answered Sep 25, 2014 at 13:13SPRBRNSPRBRN7,0821313 gold badges5959 silver badges9090 bronze badges13-1 linaa: Linux is not an acronym. Ubuntu 'simply works' implying that other distros don't? Desktop 'versions'? Initial install selection aside, you add or subtract packages to make the system do what you want.
– mcalexSep 26, 2014 at 9:01Add a comment | |
Bash expansion to list from a directory | bash;shell;tab-completion;bash;shell;tab-completion | Bash expansion to list from a directory
Ask Question
|
0
You can create a symbolic link to the directory you want to quickly navigate to:ln -s ~/web/project-b ~/web/project-name ~This is a lot simpler than implementing a shell script plus a custom Bash completion script.Another easy solution you can use without implementing anything is to search through your Bash history: Ctrl-r starts a substring search, and by the time you've entered project-name it has probably already found the entry. If not, pressing Ctrl-r again searches for the next older history entry with the same substring. With a simple configuration tweak you can also simply type cd and press Up to go to earlier commands starting with "cd".ShareImprove this answer
Follow
edited Sep 24, 2014 at 11:39
answered Sep 24, 2014 at 11:33l0b0l0b07,03733 gold badges3131 silver badges5454 bronze badges2Both of those seem to work to an extent, interested to explore the search option and whether I'd be able to avoid relative directory cd commands which would likely pollute the history if I was in a directory with a different relative path.
– M1keSep 24, 2014 at 12:16If you make sure to generally use an absolute path or one anchored at ~ you shouldn't have any problems with this.
– l0b0Sep 24, 2014 at 14:29Add a comment | |
What can I do if I forgot my Windows password? | windows-7;windows;passwords;community-faq;windows-7;windows;passwords;community-faq | What can I do if I forgot my Windows password?
Ask Question
|
150
If you have an Ubuntu live CD you can reset it using chntpw applicationYou can use Bart's PE + Password Renew to reset the passwordYou can use Offline NT Password Editor to reset the password.Detailed instructions on using any of the 3 are available over here.ShareImprove this answer
Follow
edited Nov 1, 2011 at 11:13
answered Nov 18, 2009 at 18:46Sathyajith Bhat♦Sathyajith Bhat61.1k3838 gold badges178178 silver badges264264 bronze badges5this answer should have gotten a check. if it didn't it means you were looking for recovery, not reset. that takes WAY longer and involves rainbow tables or lophtcrack with syskey and registry dumps...way beyond the scope of a superuser question but I have you a starting point for some google queries
– RobotHumansOct 20, 2010 at 3:0423To expand on aking1012's comment, users should keep in mind that resetting a Windows password results in the permanent loss of all encrypted files and data. Most of the time this isn't a big deal, but it can be.
– Harry JohnstonSep 7, 2011 at 21:22@HarryJohnston The password can be reset without losing access to encrypted data (files, certificates, etc.) by using a pass-the-hash technique. See description here. I couldn't find a ready made tool to do it right now, so I'm just writing a comment.
– David BalažicApr 4, 2015 at 15:561@DavidBalažic: that appears to be AD only, so not applicable to most home users.
– Harry JohnstonApr 5, 2015 at 2:27NTPWEdit seems to be a port of chntpw to Windows. I just used it to reset a windows password by connecting the drive via USB.
– someonrDec 20, 2022 at 9:41Add a comment | ;
57
If you can find a Microsoft ERD 6.5 or 7.0 boot disk, it can reset the Windows 7 password by using the Locksmith utility. It has to match the bit version to work, 32 or 64-bit Windows X.ERD (Emergency Repair Disc) boot disk is part of the DaRT (Diagnostic and Recovery Toolset), which is part of MDOP (Microsoft Desktop Optimization Pack). These are not available to the public, but they can be found.ERD comes in five versions currently:5.0 for XP6.0 for Vista6.5 or 7.0 for Windows 78.0 for Windows 8, 8.110.0 for Windows 10There is an alternative method for Windows 7; all you need is either a Windows 7 install disk, System Repair Disk or WinRE partition on the hard drive.Use F8 or boot from the disc. Once RE loads, choose "Repair your Computer", then load Command Prompt and run these two commands. The second command you will get a prompt to overwrite; say "yes".copy c:\windows\system32\sethc.exe c:\copy c:\windows\system32\cmd.exe c:\windows\system32\sethc.exeRestart the PC. When you reach the Login screen, hit the Shift key five times. A command window will open. Type the following:net user (type the name of the account) (type any password)and hit the Enter key, and when prompted to overwrite, type "Yes", and hit the Enter key again, and close the command window, and log on with the new password you just created.After that you might want to put the original sticky key file back in its place, so go ahead and boot your PC with the repair CD or USB that you used earlier, and in the command prompt window type the following:copy c:\sethc.exe c:\windows\system32\sethc.exepress Enter, then when prompted to Overwrite, type "Yes" and hit the Enter key again, then close the window, and restart the PC.Or if you prefer a 3rd party password cracker, here is a good one"tested from NT3.5 up to Windows 8.1, including the server versions like 2003, 2008 and 2012. Also 64 bit windows supported."ShareImprove this answer
Follow
edited Apr 9, 2020 at 19:24
answered Feb 19, 2011 at 21:56MoabMoab57.7k2121 gold badges111111 silver badges173173 bronze badges84Between this and the linux program that removes the password... I am surprised Microsoft wouldn't find a way to prevent these exploits if they claim to have Enterprise level security... though I guess one could argue that physical access controls are always required.
– MetaGuruMar 19, 2013 at 17:568@ioSamurai Resetting the password makes you loose anything stored in secured storage (certificates, ect...), and as you said the 3rd law of computer security "If a bad guy has unrestricted physical access to your computer, it's not your computer anymore"
– Scott ChamberlainApr 29, 2013 at 19:159I just realized... you got that screenshot from Wikipedia, and I uploaded it to Wikipedia like 4 years ago. The circle of (internet) life!
– nhinkleMay 23, 2013 at 16:572Worked like a charm, However I was unable to change the password with the net user command. I was able to activate the admin account though and then login through that with this command net user administrator /active:yes
– Cosco TechJul 20, 2015 at 14:041For me the system repair disk didn't allow admin password to be changed as it asked for repair disk on USB or floppy not DVD. Using system repair disk or running command-line after system recovery did not allow the replacing of sethc.exe with cmd.exe trick/hack. Using linux system rescue cd (4.8.2) I could not mount the drive - GPT partition - tools ntfs-3g gparted sfdisk should work with GPT but didn't. What eventually DID work was follow system recover sequence (no cd needed) at end view logfile (opens in Notepad). Then do file open - browse to cmd.exe - copy - paste - overwrite sethc.exe.
– gaoitheSep 26, 2016 at 12:43 | Show 3 more comments;
28
Run an Ophcrack LiveCD to try and crack the password, provided that you have a sufficiently easy alphanumerical password.ShareImprove this answer
Follow
answered Oct 15, 2010 at 18:16brandon927brandon9271,04977 silver badges1111 bronze badges32I don't think I can upvote or downvote this answer because it seems like a waste of time compared to just blanking the password and setting it when you boot into Windows.
– Natalie AdamsOct 16, 2010 at 15:2119@Nathan, keep in mind that resetting the password results in permanently losing access to all encrypted files and data.
– Harry JohnstonSep 7, 2011 at 21:21I've had very limited success with Ophcrack. It worked for me once when helping a friend, who had a very simple password (it was just her name followed by a number). With a sufficiently strong password, it doesn't work very well.
– Charles BurgeAug 15, 2016 at 21:43Add a comment | ;
24
Offline NT Password EditorOffine NT Password & Registry Editor works basically the same as PC Login Now in that it erases your Windows password instead of recovering it. You can then simply log in to your account without entering a password.sourceShareImprove this answer
Follow
edited Oct 16, 2010 at 13:40Sathyajith Bhat♦61.1k3838 gold badges178178 silver badges264264 bronze badges
answered Nov 18, 2009 at 17:47joejoe12.2k1212 gold badges6666 silver badges103103 bronze badges0Add a comment | ;
13
Grab a copy of unetbootin from here. Install NTpasswd onto a flash drive. By running NTpasswd off the flash drive you'll be able to reset the password on the computer to blank. It's pretty easy to use as well.ShareImprove this answer
Follow
answered Oct 15, 2010 at 17:49KravlinKravlin1,18577 silver badges1515 bronze badges0Add a comment | ;
10
Use this bootdisk to boot PCs with Windows OSes to blank out the LOCAL user account passwords, ENABLE or DISABLE LOCAL user accounts, etc. You can use this if you've forgotten your LOCAL Windows user account password, you've done a factory reimage/reset on your Windows OS and the account has a password you don't know what it is, and things of this sort of nature so you can log into Windows as some account WITHOUT a password just to get in, and then set the password from the Windows Control Panel, etc. to something you do know afterwards.THE STEPS IN BRIEFDownload the bootdisk image fileBurn bootdisk image file onto media (e.g. USB or CD) to boot PC from it rather than the hard drive or Windows.Put the newly burned bootdisk media into the PC, and then instruct the PC to boot from it rather than the internal hard drive with Windows installed.Follow the instruction from the below section labeled INSTRUCTIONS ONCE BOOTED TO for what options to pick, etc. to enable existing local Windows accounts and/or blank out the password of the accounts and so on.General InformationResource: http://pogostick.net/~pnh/ntpasswd/bootdisk.htmlOffline Windows Password & Registry Editor, Bootdisk / CDI've put together a CD or USB Drive image which contains things needed to reset the passwords on most systems. The bootdisk should support most of the more usual disk controllers, and it should auto-load most of them. Both PS/2 and USB keyboard supported.More or less tested from NT3.5 up to Windows 8.1, including the server versions like 2003, 2008 and 2012. Also 64 bit windows supported.DANGER WILL ROBINSON!If password is reset on users that have EFS encrypted files, and the system is XP or newer, all encrypted files for that user will be UNREADABLE! and cannot be recovered unless you remember the old password again If you don't know if you have encrypted files or not, you most likely don't have them. (except maybe on corporate systems)Please see the Frequently Asked Questions and the version history below before emailing questions to me. Thanks!Download BootdiskResource: http://pogostick.net/~pnh/ntpasswd/bootdisk.htmlDownloadNote: Some links may be offsite.CD release, see below on how to usecd140201.zip (~18MB) - Bootable CD image. usb140201.zip (~18MB) - Files for USB install Previous release:cd110511.zip (~4MB) - Bootable CD image. usb110511.zip (~4MB) - Files for USB install The files inside the USB zip are exactly the same as on the CD. See below for instructions on how to make USB disk bootable.Floppy release (not updated anymore), see below on how to use thembd080526.zip (~1.4M) - Bootdisk image drivers1-080526.zip (~310K) - Disk drivers (mostly PATA/SATA) drivers2-080526.zip (~1.2M) - Disk drivers (mostly SCSI) Previous versions may sometimes be found here (also my site) NOTE: Versions before 0704xx will corrupt the disk on VISTA/win7/8!NOTE THAT THE BOOTDISK CONTAINS CRYPTHOGRAPHIC CODE, and that it may be ILLEGAL to RE-EXPORT it from your country.HOW TO USEResource: http://pogostick.net/~pnh/ntpasswd/bootdisk.htmlHow to use?Please read the walthrough (now a bit outdated, sorry) and the FAQ before mailing me questions If you have the CD or USB, all drivers are included.OverviewGet the machine to boot from the CD or USB drive.Load drivers (usually automatic, but possible to run manual select)Disk select, tell which disk contains the Windows system. Optionally you will have to load drivers.PATH select, where on the disk is the system? (now usually automatic)File select, which parts of registry to load, based on what you want to do.Password reset or other registry edit.Write back to disk (you will be asked)DON'T PANIC!! - Most questions can usually be answered with the default answer which is given in [brackets]. Just press enter/return to accept the default answer. The walkthrough and instructions is now on its own page! but is quite old.. hope to make a new one..What can go wrong?Well. Lots of things, actually. But most of the problems is of the type "cannot find" something. And then nothing happens.Also, see the FAQ for help with common problems.INSTRUCTIONS ONCE BOOTED TOIt may be best to print these instruction and then follow from that printed copy—and print from the version on the web site resource URL perhaps too in case they update something with it since after my post here. This is the detail that explains what options to pick once the bootdisk starts booting to find and point to the internal hard drive and pick the current Windows OS objects to blank out the LOCAL user accounts on that Windows OS on the hard drive.This part may seem complex or involved at first, but just let the bootdisk boot up and go through the screen until it prompts or waits for you to tell it what to do. Look over these instructions and just pick the appropriate options as instructed—it should make sense so just read it over until you get it.Typically though you'll. . . a. pick the Windows disk partition on the hard drive the bootdisk inspectsb. from the list of usernames it finds, type the name of the account you'll change (e.g. administrator, jsmith, etc.)c. from the next list, it'll tell you if the account is disabled, expired, etc. so you know what you'll need change to reset it for specifically to ensure you can sign on with it afterwards when booted back to Windowsd. on the next screen you'll want to unlock the account, blank the password on the account or set account as local administrator (option 1, 3, and 4).i. you may need to do step "d." one time per action and then pick the username of the account again for the next action if it needsmore than one action completed (e.g. blank password, unlock account,etc.)ii. I'd just steer clear of setting passwords here and just do that through Windows Control Panel once you get signed onto Windows with a blank password as administrator, etc.e. be sure you select "Y" to save your changes to and then when the PC reboots, let it reboot to Windows and then sign on with the blank password to the account you changed with the bootdisk.If it doesn't work, boot to the bootdisk and do it again, maybe you didn't pick some option so it didn't do what you expected it to. Since you're factory wiping this hard drive anyway, there should not be much danger in loosing anything or corrupting anything as then you'd just reimage/factory reset it again.Resource: http://pogostick.net/~pnh/ntpasswd/walkthrough.htmlOffline NT Password & Registry Editor, Walkthrough2014, NOTE: This is now a bit old, some are the same, some look a bit different..The following is a walkthrough of using the CD to reset one user (admin) on a test Vista computer.Insert the CD and convince your BIOS that it should boot from it. How to boot from a CD varies from computer make to computer make, so I cannot help you much. Some BIOS shows a boot device select menu if you press ESC, F8, F11 or F12 or something like that during the self test. (some even tell you on the screen what to press)If it boots, you should see this: ISOLINUX 3.51 2007-06-10 Copyright (C) 1994-2007 H. Peter Anvin*************************************************************************** * * * Windows NT/2k/XP/Vista Change Password / Registry Editor / Boot CD* * * * (c) 1998-2007 Petter Nordahl-Hagen. Distributed under GNU GPL v2 * * * * DISCLAIMER: THIS SOFTWARE COMES WITH ABSOLUTELY NO WARRANTIES!* * THE AUTHOR CAN NOT BE HELD RESPONSIBLE FOR ANY DAMAGE * * CAUSED BY THE (MIS)USE OF THIS SOFTWARE* * * * More info at: http://pogostick.net/~pnh/ntpasswd/ * * Email : [email protected] * * * * CD build date: Sun Sep 23 14:15:35 CEST 2007 * *************************************************************************** Press enter to boot, or give linux kernel boot options first if needed. Some that I have to use once in a while: boot nousb - to turn off USB if not used and it causes problems boot irqpoll - if some drivers hang with irq problem messages boot nodrivers - skip automatic disk driver loading boot: Usually just press enter here. If you have linux knowledge, you can tweak kernel options if you need/like.Then it boots and outputs a lot of kernel messages about your hardware and such.. most if not all are nothing to worry about. Loading vmlinuz.................. Loading scsi.cgz......................... Loading initrd.cgz.......... Ready. Linux version 2.6.22.6 (root@athene) (gcc version 4.1.1 20060724 (prerelease) (4.1.1-3mdk))#2 Sun Sep 9 16:59:48 CEST 2007 BIOS-provided physical RAM map: BIOS-e820: 0000000000000000 - 000000000009f800 (usable) BIOS-e820: 000000000009f800 - 00000000000a0000 (reserved) BIOS-e820: 00000000000ca000 - 00000000000cc000 (reserved) BIOS-e820: 00000000000dc000 - 0000000000100000 (reserved) BIOS-e820: 0000000000100000 - 00000000316f0000 (usable) BIOS-e820: 00000000316f0000 - 00000000316ff000 (ACPI data) BIOS-e820: 00000000316ff000 - 0000000031700000 (ACPI NVS) BIOS-e820: 0000000031700000 - 0000000031800000 (usable) BIOS-e820: 00000000fec00000 - 00000000fec10000 (reserved) BIOS-e820: 00000000fee00000 - 00000000fee01000 (reserved) BIOS-e820: 00000000fffe0000 - 0000000100000000 (reserved) 792MB LOWMEM available. Zone PFN ranges: DMA 0 ->4096 Normal 4096 -> 202752 early_node_map[1] active PFN ranges ... Serial: 8250/16550 driver $Revision: 1.90 $ 4 ports, IRQ sharing enabled serial8250: ttyS0 at I/O 0x3f8 (irq = 4) is a 16550A Floppy drive(s): fd0 is 1.44M FDC 0 is a post-1991 82077 RAMDISK driver initialized: 16 RAM disks of 32000K size 1024 blocksize USB Universal Host Controller Interface driver v3.0 Initializing USB Mass Storage driver... usbcore: registered new interface driver usb-storage USB Mass Storage support registered. serio: i8042 KBD port at 0x60,0x64 irq 1 serio: i8042 AUX port at 0x60,0x64 irq 12 usbcore: registered new interface driver usbhid drivers/hid/usbhid/hid-core.c: v2.6:USB HID core driver Using IPI Shortcut mode BIOS EDD facility v0.16 2004-Jun-25, 1 devices found Freeing unused kernel memory: 144k freed Booting ntpasswd Mounting: proc sys Ramdisk setup complete, stage separation.. In stage 2 Spawning shells on console 2 - 6 Initialization complete! ** Preparing driver modules to dir /lib/modules/2.6.22.6 input: AT Translated Set 2 keyboard as /class/input/input0Most of the generic linux boot now done, and we try to load the disk drivers. If you use the floppy version you will be asked to swap floppies at this point. Drivers are then tried based on PCI hardware indentification. ** Will now try to auto-load relevant drivers based on PCI information ---- AUTO DISK DRIVER select ---- --- PROBE FOUND THE FOLLOWING DRIVERS: ata_piix ata_generic mptspi --- TRYING TO LOAD THE DRIVERS ### Loading ata_piix scsi0 : ata_piix scsi1 : ata_piix ata1: PATA max UDMA/33 cmd 0x000101f0 ctl 0x000103f6 bmdma 0x00011050 irq 14 ata2: PATA max UDMA/33 cmd 0x00010170 ctl 0x00010376 bmdma 0x00011058 irq 15 ata2.00: ATAPI: VMware Virtual IDE CDROM Drive, 00000001, max UDMA/33 ata2.00: configured for UDMA/33 scsi 1:0:0:0: CD-ROM NECVMWar VMware IDE CDR10 1.00 PQ: 0 ANSI: 5 sr0: scsi3-mmc drive: 1x/1x xa/form2 cdda tray Uniform CD-ROM driver Revision: 3.20 ### Loading ata_generic ### Loading mptspi Fusion MPT base driver 3.04.04 Copyright (c) 1999-2007 LSI Logic Corporation Fusion MPT SPI Host driver 3.04.04 PCI: Found IRQ 9 for device 0000:00:10.0 mptbase: Initiating ioc0 bringup ioc0: 53C1030: Capabilities={Initiator} scsi2 : ioc0: LSI53C1030, FwRev=01032920h, Ports=1, MaxQ=128, IRQ=9 scsi 2:0:0:0: Direct-AccessVMware, VMware Virtual S 1.0 PQ: 0 ANSI: 2 target2:0:0: Beginning Domain Validation target2:0:0: Domain Validation skipping write tests target2:0:0: Ending Domain Validation target2:0:0: FAST-40 WIDE SCSI 80.0 MB/s ST (25 ns, offset 127) sd 2:0:0:0: [sda] 83886080 512-byte hardware sectors (42950 MB) sd 2:0:0:0: [sda] Write Protect is off sd 2:0:0:0: [sda] Cache data unavailable sd 2:0:0:0: [sda] Assuming drive cache: write through sd 2:0:0:0: [sda] 83886080 512-byte hardware sectors (42950 MB) sd 2:0:0:0: [sda] Write Protect is off sd 2:0:0:0: [sda] Cache data unavailable sd 2:0:0:0: [sda] Assuming drive cache: write through sda: sda1 sd 2:0:0:0: [sda] Attached SCSI diskMost of these messages are from the drivers themselves. Some talk a lot, some doesn't. But all give info on the brand and model and size of the disks found, if any. ------------------------------------------------------------- Driver load done, if none loaded, you may try manual instead. ------------------------------------------------------------- ** If no disk show up, you may have to try again (d option) or manual (m).You can later load more drivers..************************************************************************* * Windows Registry Edit Utility Floppy / chntpw* * (c) 1997 - 2007 Petter N Hagen - [email protected]* * GNU GPL v2 license, see files on CD* * * * This utility will enable you to change or blank the password of * * any user (incl. administrator) on an Windows NT/2k/XP/Vista * * WITHOUT knowing the old password. * * Unlocking locked/disabled accounts also supported.* * * * It also has a registry editor, and there is now support for * * adding and deleting keys and values. * * * * Tested on: NT3.51 & NT4: Workstation, Server, PDC.* * Win2k Prof & Server to SP4. Cannot change AD. * * XP Home & Prof: up to SP2 * * Win 2003 Server (cannot change AD passwords)* * Vista 32 and 64 bit* * * * HINT: If things scroll by too fast, press SHIFT-PGUP/PGDOWN ... * ************************************************************************* ========================================================= There are several steps to go through: - Disk select with optional loading of disk drivers - PATH select, where are the Windows systems files stored - File-select, what parts of registry we need - Then finally the password change or registry edit itself - If changes were made, write them back to disk DON'T PANIC! Usually the defaults are OK, just press enterall the way through the questions ========================================================= ¤ Step ONE: Select disk where the Windows installation is ========================================================= Disks: Disk /dev/sda: 42.9 GB, 42949672960 bytes Candidate Windows partitions found: 1 : /dev/sda1 40958MB BOOTHere it has found one disk with one partition Please select partition by number or q = quit d = automatically start disk drivers m = manually select disk drivers to load f = fetch additional drivers from floppy / usb a = show all partitions found l = show propbable Windows (NTFS) partitions only Select: [1]Here you select one of the partitions listed above (in this case there is only one) or one of the letters from the menu.Floppy users may need to do 'f' to load in more drivers from another floppy.The 'd' option will re-run the PCI scan and start relevant drivers (they must already be loaded from floppy with 'f' option)The 'm' for manual load will present a list of all the drivers with short description if available, and allow you to specify which to load. (Dependecies are handled automatically)Here we only have one partition, so we just press enter to select it. Selected 1 Mounting from /dev/sda1, with filesystem type NTFS NTFS volume version 3.1.It was an NTFS filesystem, and it mounted successfully. ========================================================= ¤ Step TWO: Select PATH and registry files ========================================================= What is the path to the registry directory? (relative to windows disk) [WINDOWS/system32/config] :The registry is usually system32/config under WINDOWS or WINNT directory, depending on the windows version (and it may be changed during installation). If the correct partition has been selected, the default prompt will be adjusted to match if it can find one of the usual variants.We accept the defaults.. and get a (bit filtered) directory listing showing most of the interesting registry files -rw------- 2 0 0262144 Feb 28 2007 BCD-Template-rw------- 2 0 0 6815744 Sep 23 12:33 COMPONENTS -rw------- 1 0 0262144 Sep 23 12:33 DEFAULT drwx------ 1 0 00 Nov 2 2006 Journal drwx------ 1 0 0 8192 Sep 23 12:33 RegBack -rw------- 1 0 0524288 Sep 23 12:33 SAM -rw------- 1 0 0262144 Sep 23 12:33 SECURITY -rw------- 1 0 0 15728640 Sep 23 12:33 SOFTWARE -rw------- 1 0 0 9175040 Sep 23 12:33 SYSTEM drwx------ 1 0 0 4096 Nov 2 2006 TxR drwx------ 1 0 0 4096 Feb 27 2007 systemprofile Select which part of registry to load, use predefined choices or list the files with space as delimiter 1 - Password reset [sam system security] 2 - RecoveryConsole parameters [software] q - quit - return to previous [1] :Choice 1 is for password edit, most used. But if you wish, you can load any of the files (just enter it's name) and do manual registry edit on them.But here, we select 1 for password edit, some files are copied around into memory and the edit application is invoked. Selected files: sam system security Copying sam system security to /tmp ========================================================= ¤ Step THREE: Password or registry edit ========================================================= chntpw version 0.99.5 070923 (decade), (c) Petter N Hagen Hive name (from header): <\SystemRoot\System32\Config\SAM> ROOT KEY at offset: 0x001020 * Subkey indexing type is: 666c <lf> Page at 0x44000 is not 'hbin', assuming file contains garbage at end File size 524288 [80000] bytes, containing 11 pages (+ 1 headerpage) Used for data: 288/250904 blocks/bytes, unused: 15/23176 blocks/bytes. Hive name (from header): <SYSTEM> ROOT KEY at offset: 0x001020 * Subkey indexing type is: 686c <lh> Page at 0x8b4000 is not 'hbin', assuming file contains garbage at end File size 9175040 [8c0000] bytes, containing 2117 pages (+ 1 headerpage) Used for data: 96982/6224016 blocks/bytes, unused: 4381/2830032 blocks/bytes. Hive name (from header): <emRoot\System32\Config\SECURITY> ROOT KEY at offset: 0x001020 * Subkey indexing type is: 666c <lf> Page at 0x6000 is not 'hbin', assuming file contains garbage at end File size 262144 [40000] bytes, containing 5 pages (+ 1 headerpage) Used for data: 334/17312 blocks/bytes, unused: 7/3008 blocks/bytes. * SAM policy limits: Failed logins before lockout is: 0 Minimum password length : 0 Password history count : 0 ======== chntpw Main Interactive Menu ======== Loaded hives: 1 - Edit user data and passwords 2 - Syskey status & change 3 - RecoveryConsole settings - - - 9 - Registry editor, now with full write support! q - Quit (you will be asked if there is something to save) What to do? [1] ->This demo shows selection 1 for password edit, but you can also do other things. Note that 2, Syskey may be dangerous! AND NOT NEEDED TO RESET PASSWORDS! and does not work at all on Vista, but you get some info before you do any changes.Selection 3, RecoveryConsole is only relevant for Win2k, XP and 2003 and you must have selected to load the SOFTWARE part of the registry (selection 2) earlier.The manual registry editor is always available, it is not the most user-friendly thing, but anyway..We continue our quest to change our "admin" users password.. ===== chntpw Edit User Info & Passwords ==== | RID -|---------- Username ------------| Admin? |- Lock? --| | 03e8 | admin | ADMIN || | 01f4 | Administrator | ADMIN | dis/lock | | 03ec | grumf1 | || | 03ed | grumf2| || | 03ee | grumf3| | | | 01f5 | Guest | | dis/lock | | 03ea | jalla1| ADMIN | *BLANK* | | 03eb | jalla2| | *BLANK* | | 03e9 | petro | ADMIN | *BLANK* |This is a list of all local users on the machine. You may see more users here than in the overly user-friendly control panel, for example XP has some help and support built in users. The users marked "ADMIN" are members of the administrators group, which means they have admin rights, if you can login to one of them you can get control of the machine.The buildt in (at install time in all windows versions) administrator is always RID 01f4. This example is from Vista, and Vista by default has this locked down (the installer instead asks and makes another user the regular use administrator, in this case RID 03e8)The "lock?" collumn show if the user account is disabled or locked out (due to many logon attempts for example) or BLANK if the password seems to be blank.We select to edit the "admin" user (this was the user made administrator by the Vista installer) Select: ! - quit, . - list users, 0x - User with RID (hex) or simply enter the username to change: [Administrator] admin RID: 1000 [03e8] Username: admin fullname: comment : homedir : User is member of 1 groups: 00000220 = Administrators (which has 4 members)Group 220 is THE BOSS GROUP! :) Account bits: 0x0214 = [ ] Disabled | [ ] Homedir req. | [X] Passwd not req. | [ ] Temp. duplicate | [X] Normal account | [ ] NMS account| [ ] Domain trust ac | [ ] Wks trust act. | [ ] Srv trust act | [X] Pwd don't expir | [ ] Auto lockout | [ ] (unknown 0x08) | [ ] (unknown 0x10) | [ ] (unknown 0x20) | [ ] (unknown 0x40) | Failed login count: 0, while max tries is: 0 Total login count: 3Some status info, user is locked out if "Disabled" is set or "Failed login count" is larger than "max tries" policy setting. This user is not locked in any way. The lockout can be reset with option 4 below. - - - - User Edit Menu: 1 - Clear (blank) user password 2 - Edit (set new) user password (careful with this on XP or Vista) 3 - Promote user (make user an administrator) (4 - Unlock and enable user account) [seems unlocked already] q - Quit editing user, back to user select Select: [q] > 1 Password cleared!Here we just reset/clear/blank the password. But you can also try to set a new password with option 2, but it will only work if the password is not blank already. Also, it often fails to work on XP and newer systems.Number 3 is to put a non-admin user into the administrators (220) group, thus making the user an administrator. IT IS STILL EXPERIMENTAL AND IT MAY sometimes RESULT IN STRANGE ERRORS WHEN LATER EDITING THE GROUP FROM WINDOWS! Also, usually pointless in promoting the Guest user, as it is most likely forbidden to log in by the security policy settings. Select: ! - quit, . - list users, 0x - User with RID (hex) or simply enter the username to change: [Administrator] !Exclamation point ! quits out (it's SHIFT 1 on the US keyboard layout used on the boot CD) Then we get back to the main menu, and select to quit.. ======== chntpw Main Interactive Menu ======== Loaded hives: <sam> <system> <security> 1 - Edit user data and passwords 2 - Syskey status & change 3 - RecoveryConsole settings - - - 9 - Registry editor, now with full write support! q - Quit (you will be asked if there is something to save) What to do? [1] -> q Hives that have changed: # Name 0 - OK ========================================================= ¤ Step FOUR: Writing back changes ========================================================= About to write file(s) back! Do it? [n] : yYou must answer y, or the changes will not be saved. This is the last chance to change your mind! Writing samOnly changed files of the registry are actually written back.If you forgot something, you may run again, else press CTRL-ALT-DEL to reboot. ***** EDIT COMPLETE ***** You can try again if it somehow failed, or you selected wrong New run? [n] : n ========================================================= * end of scripts.. returning to the shell.. * Press CTRL-ALT-DEL to reboot now (remove floppy first) * or do whatever you want from the shell.. * However, if you mount something, remember to umount before reboot * You may also restart the script procedure with 'sh /scripts/main.sh' (Please ignore the message about job control, it is not relevant) BusyBox v1.1.0-pre1 (2005.12.30-19:45+0000) Built-in shell (ash) Enter 'help' for a list of built-in commands. sh: can't access tty; job control turned off And I got about a gazillion questions on this error message, even if it is mentioned in the FAQ It is from the shell telling it cannot do "job control" which means it cannot handle CTRL-C etc. It HAS NOTHING TO DO WITH YOUR PASSWORD RESET DID NOT WORK! That is caused by a lot of other things.ShareImprove this answer
Follow
edited Jan 4, 2018 at 4:39
answered Dec 26, 2015 at 15:18Vomit IT - Chunky Mess StyleVomit IT - Chunky Mess Style38.5k2626 gold badges7777 silver badges116116 bronze badgesAdd a comment | ;
9
You can gain command line access (in SYSTEM context) to a Windows computer by changing a couple of registry values. You can then reset passwords, create new accounts, run cracking tools, and so on.This is the short version, for advanced users and sysadmins:1) Boot to Windows 7 from the installation or repair DVD, or from Windows PE 3 boot media, or from a Windows 7 installation on another HDD. (If the target OS is Vista, use the Vista installation DVD, or Windows PE 2, or another Vista installation. If the target OS is Windows XP, use Windows PE or another Windows XP installation.)2) Load the SYSTEM registry hive from the target OS. Back it up first.3) In the Setup key, change SetupType to 2 and CmdLine to cmd.exe.4) Boot the target OS. You’ll get a command-line window in system context.There are more details here including instructions for non-experts on using this technique to reset a password. (Remember that resetting a password will result in the loss of all encrypted files and data.)ShareImprove this answer
Follow
edited Sep 7, 2011 at 21:26
answered Sep 7, 2011 at 21:14Harry JohnstonHarry Johnston5,66477 gold badges3030 silver badges5555 bronze badgesAdd a comment | ;
8
You can reset your password using another tool called Hiren's BootCD. Download Hiren's Boot from here, unzip it and use BurnCDCC.exe to burn the ISO to a DVD. Boot using Hiren's Boot on your locked PC and in the menu shown select Offline NT/2000/XP/Vista/7 Password Changer and click Enter twice (for confirmation and to continue for the list of Linux Kernel Boot).In the following prompt select the correct drive where the Windows is installed. Press Enter to confirm that your registry directory is Windows/system32/config. On the chntpw Main Interactive Menu select [1] for Edit user data and passwordsSelect the user you want to reset the password by typing the username and hitting EnterThere you have a list of options for this user. [1] should be for Clear the password. After successfully resetting your forgotten Windows password, type “!” to close the User Editor Tool.Now type “q” and hit Enter to close the Offline Password Editor and Registry tool.Now type “y” and hit Enter to confirm the password change.Now it will ask you whether you want to use it again or not. Just type “n” and hit Enter.Remove your CD and restart the PC and your user shouldn't have a password anymore. Hope this helps you. ShareImprove this answer
Follow
edited Jan 4, 2016 at 19:47Stackcraft_noob1,8001111 silver badges1515 bronze badges
answered Nov 10, 2014 at 9:19Radu DrambaRadu Dramba14411 silver badge11 bronze badge1Hiren's is considered pirated software as of the date you posted.
– MoabAug 16, 2016 at 21:54Add a comment | ;
7
Windows Boot Genius - Recovers your lost Windows local administrator/user passwords in Windows 8.1, 8, 7, Vista, XP.Password Recovery Bundle - Instantly bypass, unlock or reset lost administrator and other account passwords on any Windows 8, 7, 2008, Vista, XP, 2003, 2000 system, if you forgot Windows password and couldn't log into the computer. It can also reset Windows domain administrator/user password for Windows 2012 / 2008 / 2003 / 2000 Active Directory servers.Renee Passnow - Use PassNow which is independent of Windows system: reset login password, clone hard disk, create disk partition or format disk, erase data and fix system startup problems.ShareImprove this answer
Follow
edited Jan 20, 2015 at 15:39
answered Jan 18, 2015 at 22:22DavidenkoDavidenko1,31644 gold badges1616 silver badges3232 bronze badges1None of these are free as of 2016
– MoabAug 16, 2016 at 21:57Add a comment | ;
6
Adding an answer to cover the method that worked for me (which is not yet fully covered in other answers here). This works for Windows 7, later versions of windows have this exploit closed. I attempted some other procedures listed in other answers without success. What worked for me was the replace sethc.exe (sticky keys) with cmd.exe hack/trick. But I had to do this through using Notepad.exe which is run to view logfiles after system recovery. Other techniques to get in on command-line as admin with drive mounted didn't work so I had to use this Notepad trick.Procedure:Shutdown and reboot. When Windows starting is seen hold down the power button and power off.Power on. Windows boot should report that last Windows start up failed so it will give the option of "Launch startup repair". Choose this option.Cancel the Startup Repair. Cancel the System Restore.A report dialog will show reporting repair could not be done. In there expand "View problem details". Under problem details a link to x:/windows/... log file is shown. Click on this.Notepad.exe opens showing the logfile. This Notepad is running as Administrator and the mounted filesystem x: is your hard disk.5.1 Notepad: File - Open - browse to X:/Windows/system32 - scroll to sethc.exe5.2 Right-click on sethc.exe and rename to sethc-BACKUP.exe5.3 Scroll to cmd.exe. Right-click on cmd.exe. Copy. Right click. Paste.5.4. When I pasted cmd.exe the command-line ran (as Administrator) so I did 'cd x:/Windows/system32' and then 'copy cmd.exe sethc.exe' on command-line.5.4-1 If you prefer not command-line then just use Notepad File Open browser and make a copy of cmd.exe and rename it to sethc.exeReboot without any funny stuff.At login page hit shift key 5 times or more triggering sticky keys. Instead of sticky keys prompt a command-line dialog appears. Running as Administrator. 'net user Administrator *' to set the password.Good description with screenshots of the procedure here:http://null-byte.wonderhowto.com/how-to/hack-windows-7-become-admin-0160151/Background: The Administrator password with laptop was not known by owner. They had a user account with admin privs so didn't find the need of it. UNTIL the windows login page stopped showing their user! We are guessing the User profile became corrupt or had something bad in it.I attempted a series of procedures before getting the Notepad+sticky keys replace hack to work. For the record here they are (and the problem I encountered with them):When trying to log in as Administrator after an incorrect password you are prompted to insert rescue disk (in order to reset password). We had a Windows 7 rescue disk on cd. But the prompt asked for floppy or USB. I had no handy USB stick and was too lazy to go shopping and messing with creating USB boot disk.Using system repair disk to get in on command-line did not allow the replacing of sethc.exe with cmd.exe trick/hack. Or allow resetting admin password 'net use Administrator *'. The command-line was running as admin but not as the real admin on machine more as the system repair admin and the disk did not seem to be mounted with full access . . . ~ not sure ~Using linux system rescue cd (https://www.system-rescue-cd.org (version 4.8.2)) I could not mount the drive. I would kindof see it was a GPT partitioned drive - tools ntfs-3g gparted sfdisk should work with GPT but didn't. This computer has a prompt for username + domain + password before windows starts so not sure but maybe there is some extra security (which is needed to mount drive?)What eventually DID work was follow system recover sequence (no external/additional cd needed) at end view logfile (opens in Notepad). Then do file open - browse to cmd.exe - copy - paste - overwrite sethc.exe. Then reboot - trigger sticky keys - set password using command-line 'net user Administrator *'. In conclusion, this solution doesn't require you to have any extra boot or repair CD. It is very portable :-) It is pretty simple. So it is probably worth trying as one of the first password recovery methods. ShareImprove this answer
Follow
edited Sep 26, 2016 at 14:22
answered Sep 26, 2016 at 13:45gaoithegaoithe50144 silver badges88 bronze badges1The PC I'm using has the sticky keys shortcut disabled. I tried this, and when I got to login, clicked the ease of access centre to launch sticky keys, but just got an error message. Went to system repair to undo my dirty work, and this time was prompted for a password before I could even launch system repair. Seems like I pissed windows off...
– Some_GuyJun 18, 2018 at 2:17Add a comment | ;
5
Use Kon-Boot to boot into the system bypassing the login. After you login change to your required password.ShareImprove this answer
Follow
edited Mar 17, 2015 at 5:29janot1,03222 gold badges1111 silver badges2020 bronze badges
answered Apr 26, 2013 at 5:28ShankarShankar14522 silver badges88 bronze badges55please be more precise in your Answer! Explain how to use konboot and how to change the password afterwards!
– SimonApr 26, 2013 at 6:301Konboot is a simple CD, just boot the disk. It will bypass the Windows password when you normally would be asked for one.
– Jeff ClaytonDec 31, 2014 at 22:10To change the password is simple too, just go to the control panel and look for Users and Groups to edit.
– Jeff ClaytonDec 31, 2014 at 22:11You can change the password for any user there.
– Jeff ClaytonDec 31, 2014 at 22:12Kon Boot is no longer Free........
– MoabAug 16, 2016 at 21:56Add a comment | ;
4
Some of the answers here are quite complicated for some. The easiest way I know is to use windows password rescuer..how to use explanation are all here:http://www.daossoft.com/documents/how-to-use-windows-password-rescuer-personal.htmlEDIT: As suggested in the comment here is what you need.Another computerWindows Password Rescuer SoftwareA USB disk or a CD/DVDSteps:Download the tool from the Daosoft website http://www.daossoft.com/products/windows-password-rescuer.html .Install it on an available computer then run it. Create a password recovery disk (USB flash drive or a CD/DVD) using the tool..choose between the media types depending on what u have (USB flash drive or a CD/DVD).. choose which drive it is on then on the step 2 click on begin burning..when it is done remove the USB flash drive or the CD/DVD usedNow on the computer to be repaired boot it to CD/DVD or USB disk depending on the recovery disk made.Restart your computer.. recovery disk should already be inserted.It should boot through your recovery diskon the ui choose the windows which is affected. next choose the account you want to resetthen click on reset password, a prompt will appear asking you for confirmation on resetting that account's password - click on yeson the table the account chosen should have the word blank on passwordClick on reboot. There will be a confirmation window telling you can eject the recovery disk.. eject it then click yes. You should have no problems logging in your account now.ShareImprove this answer
Follow
edited Sep 14, 2016 at 6:23
answered Sep 13, 2016 at 6:29ChanChan6911 silver badge77 bronze badges22Your answer looks simple because you don't tell the details on how to rescue the password using the tool. Should the link you provided break in the future your answer would be worthless.
– zagrimsanSep 13, 2016 at 7:01Worked, but only when I was not in safe mode or possibly safe mode with network
– NilzorOct 8, 2021 at 21:38Add a comment | ;
3
One more tip. For Windows 8 and Windows 10, the preferred the login method is with Microsoft account. So you can reset the password and use the new for login.Microsoft account password reset page: https://account.live.com/password/resetFor local windows account, you can reset the password by following this tutorial.ShareImprove this answer
Follow
edited Oct 9, 2016 at 6:34
answered Sep 26, 2016 at 7:19zuliganzuligan4122 bronze badgesAdd a comment | ;
3
Reset Admin-Password Windows 8.1, November 2016I'd prefer to answer to this question, because it is about Windows 8.1 and not 7, but it has been closed unwisely. To avoid any misunderstanding: I needed to recover a Win 8.1 admin-pw. If you try this answer: https://superuser.com/a/952224/82741 , and its Option 1, you'll find, that the trick no longer works. The last step, when @td512 suggests to use net user ..., it did not work in my case. Instead, I found that I can have a GUI from Windows to change the PW: type control userpasswords2, which made it appear, instead of net user .... ShareImprove this answer
Follow
edited Mar 20, 2017 at 10:04CommunityBot1
answered Nov 30, 2016 at 20:04Keks DoseKeks Dose26333 silver badges1212 bronze badgesAdd a comment | ;
1
i had this problem in past but i found a way to break the password.you just download this and read README.txt file you will get all easy steps using which you can break your password. still i am writing a steps for you :STEPS:step 1 : download the file from here step 2 :copy all downloaded files in you removable disk (pen drive) step 3 :open a command prompt write this line: h:\syslinux.exe -ma h: (replace "h" with your removable drive like i,j,G) step 4:insert a pen drive in your targeted PC and boot this pen drive(legacy must be ON).step 5: click enter though out all the steps until you get instruction like clear password.step 6:after getting this step clear password.complete this step and restart your system now it will not ask a password to enter and computer will start. ShareImprove this answer
Follow
edited Jan 4, 2016 at 19:47Stackcraft_noob1,8001111 silver badges1515 bronze badges
answered Sep 21, 2015 at 15:58ALI SHEKHALI SHEKH6766 bronze badgesAdd a comment | ;
1
Here is a step-by-step for Windows 10:Prepare a Windows 10 installation USB Drive: https://www.microsoft.com/en-us/software-download/windows10Boot from the disc. After the computer boots from the installation CD/DVD, the Windows Setup screen will appear. On the screen, press Shift + F10 on your keyboard. This will open a CMD window. In the command prompt, run the following commands:cd c:\windows\system32\move utilman.exe utilman.exe.bakcopy cmd.exe utilman.exeExecute wpeutil reboot to reboot the system.After the computer boots up and displays the Windows 10 sign-in screen, click on the "Ease of Access" icon on the lower right corner. This will execute utilman.exe (which is now cmd.exe) and launch a command prompt. Execute net user to display the list of available usersExecute net user USERNAME pass123, where USERNAME is the user account that you reset the password for. Note that the double-quotes (") are required for usernames containing a space (e.g., "joe smith").Login to USERNAME's account with a password of pass123Reference: https://www.isumsoft.com/windows-10/reset-windows-10-password-with-boot-cd.htmlShareImprove this answer
Follow
answered Mar 25, 2020 at 17:22
community wiki
Moshe
Add a comment | ;
0
I was able to regain access by hex editing the SAM registry file after plugging the hard disk into a different computer. The steps were:Pull the drive out of the machine whose password is forgottenConnect it to another (Windows) machineOpen the c:\windows\system32\config\SAM file in a hex editor like HxDSearch the bytes (not the ASCII) for F401Find an occurrence (for me it was the second) where there is an odd number, probably 11 or 15, that is 6 bytes after the F401Overwrite the odd number with a number that is one less i.e. if the number is -5, set it to 14. If it's 11, set it to 10. (in HxD click on e.g the 11 and press keys 1, 0save and reboot, choose the Administrator user from the login screen and set up anything you need..Editing this byte to be an even number will clear the "account is disabled" flag, enabling the built in Admin accountSide note:Because the machine I had a problem with was originally prepared from a cloned hard disk, and the only other machine available to plug the disk into was also a clone from the same master image, there was a disk ID conflictTo resolve this the Disk Management snap in was used to mark the disk as Online (which silently changes its ID). To revert it (otherwise the bootloader doesn't work when you put it back in the old machine) you can use DISKPART:Open an admin command prompt and type the following:DISKPARTSELECT DISK x(x is the number of the pulled disk. You can get the number from Disk Management mmc)UNIQUE DISK ID=xxxxxx(xxxxxx is the hex ID of the disk. You can get it off the other disk in the system because they're clones)If there are multiple other disks it would be wise, before you set the disk online in Disk Management, to reveal and record the ID of the relevant disk. To do that, do:DISKPARTSELECT DISK x(x is the number of the pulled disk, get it from Disk Management)UNIQUE DISKThe disk will go offline again because it's back in conflict with another drive.. but that's ok; we're doneShareImprove this answer
Follow
edited Sep 15, 2021 at 5:17
answered Sep 14, 2021 at 21:55Caius JardCaius Jard39411 gold badge33 silver badges1313 bronze badgesAdd a comment | |
Modify default saving folder/location for Adobe CS6 (Ps, Ai, Id) in Mac OS X? | macos;photoshop-cs6;file-location;save-as;adobe-cs6;macos;photoshop-cs6;file-location;save-as;adobe-cs6 | Modify default saving folder/location for Adobe CS6 (Ps, Ai, Id) in Mac OS X?
Ask Question
| |
Files in 'C:/Users/Tomin Jacob' gone missing after uninstalling an application | windows-8;uninstall;windows-8;uninstall | Files in 'C:/Users/Tomin Jacob' gone missing after uninstalling an application
Ask Question
| |
OS X - GPU Panic | macos;gpu;kernel-panic;macos;gpu;kernel-panic | OS X - GPU Panic
Ask Question
|
2
Your GPU is dying. Only a replacement plan from Apple can help you. But I doubt that it is near. At least you are not alone. 2011 models also have heating problems. Well . . . cooling problems actually. This is why the latest macbooks have more air inlets on the side of the chassis. The finally figured out they needed to give up some of the design aesthetics for better cooling.https://discussions.apple.com/thread/4766577?start=9495You can get to a more or less workable state by disabling the kernel extensions that are needed by the GPU: It will force the system to use Intel HD 3000 Graphics. But at least you can boot, do some work and / or recover files. Reboot your computer and hold CMD + S, and type and press enter the following commands:/sbin/mount -uw / mkdir /System/Library/DisabledExtensions/mv /System/Library/Extensions/AMD* /System/Library/DisabledExtensions/mv /System/Library/Extensions/ATI* /System/Library/DisabledExtensions/Reboot by typing 'reboot' and enter.If you need to restore the drivers:Boot normally, and from OSX open a Terminal window.sudo mv /System/Library/DisabledExtensions/* /System/Library/Extensions/sudo rebootDownsides:Can't adjust screen brightness;Machine won't sleep. Need to shut it down before bagging it;Can't adjust any external display;Graphics performance is CPU only, so it's quite slow.ShareImprove this answer
Follow
answered Nov 5, 2014 at 7:51Michiel RoosMichiel Roos20622 silver badges22 bronze badges1This was an interesting solution! The problem does indeed seem to reside in the GPU. However, I have had some success using gfxCardStatus to force the machine into using the integrated graphics, but I'll give this a shot if needed. Thanks!
– krystahNov 7, 2014 at 12:36Add a comment | |
Automatically connecting to a VPN at startup and sending email with IP address | windows-7;vpn;windows-7;vpn | Automatically connecting to a VPN at startup and sending email with IP address
Ask Question
| |
Recovery Console Commands in CMD | windows;windows-xp;cmd.exe;console | Recovery Console Commands in CMD
Ask Question
| |
Emacs -- sort - usefulness of side effect modifying initial list [closed] | emacs;emacs | Emacs -- sort - usefulness of side effect modifying initial list [closed]
Ask Question
|
1
The function sort assumes that the initial list is disposable and it leaves said list in an unusuable state. The following is a workaround that leaves the initial list unscathed:(defun lawlist-sort (seq predicate) (let ((disposable-list (copy-list seq))) (sort disposable-list predicate)))ShareImprove this answer
Follow
answered Oct 26, 2014 at 18:24lawlistlawlist1,34711 gold badge77 silver badges2424 bronze badgesAdd a comment | |
How to debug network connection? | windows-7;networking;wireless-networking;windows-7;networking;wireless-networking | How to debug network connection?
Ask Question
|
3
This article gives good overview on diagnosing network problems on Windows: http://technet.microsoft.com/en-us/magazine/ff625276.aspx It starts with GUI methods you probably tried, but then touches on netsh (Network Shell) which is very powerful command line utility. It allows you to control everything network related (command reference); in particular it provides tracing with netsh trace context (command reference). Netsh can include windows events and network traffic in it's traces as well as plethora of additional diagnostic information. You may also combine both methods (quoted from technet article): When you enable tracing with Netsh.exe, Windows 7 can create two files. An ETL file contains trace events for Windows components, and if specified, network traffic. By default, the ETL file is named Nettrace.etl and stored in the %TEMP%\NetTraces folder. You can specify a different name and storage location with the tracefile= parameter. An optional CAB file can contain several types of files including text, Windows Registry, XML and others that store additional troubleshooting information. The CAB file also includes a copy of the ETL file. By default, the CAB file is named Nettrace.cab and stored in the %TEMP%\NetTraces folder.You can also use Netsh.exe tracing in conjunction with Control Panel | Troubleshooting. First, use the appropriate Netsh.exe command to enable tracing for the scenario. For example, use the netsh trace scenario=internetclient report=yes command. Use Control Panel | Troubleshooting to run the Connect to the Internet troubleshooting session. When complete, run the netsh trace stop command. Now, when you view the history of the troubleshooting session, you’ll be able to access the CAB file.ShareImprove this answer
Follow
answered Oct 25, 2014 at 20:24wmzwmz7,03211 gold badge2020 silver badges3232 bronze badgesAdd a comment | ;
0
I understand you need to have a tool to troubleshoot network in general.In this case you can get a lot of network-related information by using tcpdump or Wireshark if you want a nice GUI.ShareImprove this answer
Follow
answered Oct 25, 2014 at 17:13nochkinnochkin39722 silver badges66 bronze badges2I need to trobleshoot even network I can't connect to (no actual network connection exists).
– Tomáš ZatoOct 25, 2014 at 17:20That's exactly what Wireshark does -- it will show you even failed connections with all related information and reasons on why it failed.
– nochkinOct 25, 2014 at 22:38Add a comment | ;
-1
The command you're referring to is called "ipconfig".It will tell you if you get an ipaddress from the router and if so, what it is.If you get an 169.254.?.? address, it basically says: this computer wants to get an IP address from a DHCP server, but no DHCP server gave an ip address.This can be due to not being able to reach the router, or the router's dhcp not working properly, or all slots have been taken.If you do get an ip address from the router, or you have a static one, the next step is to ping the router to see if you can get a connection between you and the router. If so, ping the internet both by an url and by an ip address, for example 8.8.8.8Lastly, determine if there are more computers in the network who have network issues.Also, physically look at the network connector that goes into the computer. There are 2 lights. A green and Orange one. Both should be blinking. If not, something is wrong with the cable or its not connected properly, or the device at the other end does not provide any network activity. (a hub that lost power for example)I can go into far more details, but that would make this way too broad for the scope of SuperUser.ShareImprove this answer
Follow
answered Oct 25, 2014 at 17:20LPChipLPChip57.5k99 gold badges9292 silver badges135135 bronze badges5Thanks for trying, but I'm debuging a problem where "Windows can't connect to network" - that means no ipconfig, no nmap or something like that. In my particular case it's wireless network, so there are no physical cables.
– Tomáš ZatoOct 25, 2014 at 17:22ipconfig still gives you details about the connection. If the computer cannot find it, look for the source, the device that creates the connection. Try a powercycle on it.
– LPChipOct 25, 2014 at 17:29When you can't connect to network, the ipconfig reports Disconnected for the WiFi hardware. Powercycling solves the problems for a few minutes. I need to find out why does the router refuse connections - when find out, I'll be able to ask better question than this one. I'm really suprised that my question has no easy answer. Has nobody ever failed to connect to WiFi network?
– Tomáš ZatoOct 25, 2014 at 18:59Your question indicates you want to find the cause. The wifi router is your cause. If it works for a few minutes and then stops working again, look for problems concerning your wifi router. Possibly update the firmware or consider replacing it.
– LPChipOct 25, 2014 at 19:28Well, first I want to know what's causing the problem. The router worked for years. Maybe it's just a capacitor blown. Maybe somebody screwed up with antenna when absentmindedly touching it. But I want to know at which point windows fails. I want to know the general solution, because sometimes it's just me who can't connect. So I need a general problem finder. There must be some obserwable protocol...
– Tomáš ZatoOct 25, 2014 at 19:43Add a comment | |
Is the warranty period on a hard drive a reliable indicator of its expected service life? [closed] | mybook;mybook | Is the warranty period on a hard drive a reliable indicator of its expected service life? [closed]
Ask Question
|
2
Drive failures are random.Some drives die ten minutes after you plug them in. Some go on for five, ten years. There's a whole lot in between. It depends on manufacturing design and batches, temperatures, usage patterns, even where you live will affect it.There's no easy way to predict drive failures. And even if you manage to predict some types of failure, other types can happen without any warning whatsoever.If you care about your data at all, you need backups. That pretty much means storing another copy - the chances of two drives failing simultaneously is considerably lower than a single one. If you want to be safer, you can have an offline backup - keep the backup drive unplugged, so it's not wearing down at a similar rate to the primary drive. If you really care about your data, consider having an offsite backup - that's a backup stored elsewhere, e.g. at a friend's home, in case of fire or other disaster.That said, research indicates that failure is significantly more likely both in the first three months and after the first two years. That does not mean it can't fail in between; it's just slightly lower probability.ShareImprove this answer
Follow
answered Oct 25, 2014 at 17:06BobBob60k2424 gold badges185185 silver badges213213 bronze badgesAdd a comment | |
Installing a secondary drive in an HP Envy 17 laptop | hard-drive;laptop;installation;ssd;hard-drive;laptop;installation;ssd | Installing a secondary drive in an HP Envy 17 laptop
Ask Question
|
0
All you have to do is grab an SSD and put it into secondary slot. Then you can select boot hard drive from BIOS. Seriously, there is not first or second hard disk. About SSD, you should look for kits where it has additional equipment you might need. Like this.ShareImprove this answer
Follow
answered Oct 25, 2014 at 20:06HaploHaplo43622 silver badges88 bronze badges2I vaguely recall reading something about a master/slave relationship between primary and secondary drives, but I could be wrong.
– PieterOct 25, 2014 at 20:22It was way too back when old IDE drives was existed. With SATA, there is not a problem like this as far as i know.
– HaploOct 25, 2014 at 20:25Add a comment | ;
-1
I have an older 17" HP Pavilion DV7 running an Intel i7 2670, to which I successfully added another (SSD) dirve, transferred the operating system to the new drive and carried on. I noted the boot time dropped substantially.I believe the Envy is a similar machine in that it has TWO internal HD drive bays and only one is normally occupied.You will, however, need to get a mounting tray and HP cable to complete this addition. Also you may need some mounting screws, if the tray vendor does not include them in the pack!NzOldunShareImprove this answer
Follow
answered Nov 24, 2014 at 2:24Grant NotleyGrant Notley1Add a comment | |
sysgrep and CopyProfile=true not actually copying profile or seems to be doing anything in Windows 8.1 | windows;windows-8;windows-8.1;clone;windows;windows-8;windows-8.1;clone | sysgrep and CopyProfile=true not actually copying profile or seems to be doing anything in Windows 8.1
Ask Question
|
1
This has been solved finally. The issue is simply a matter of case-sensitivity. I formatted the xml document using Visual Studio to get proper indentation, and didn't notice that it changed say from <CopyProfile> to <copyprofile>. I then updated the case as per another sample file, and it worked. The working unattend.xml is copied below:<?xml version="1.0" encoding="utf-8"?><unattend xmlns="urn:schemas-microsoft-com:unattend"> <settings pass="specialize"> <component name="Microsoft-Windows-Shell-Setup" processorArchitecture="amd64" publicKeyToken="31bf3856ad364e35" language="neutral" versionScope="nonSxS" xmlns:wcm="http://schemas.micro...fig/2002/State" xmlns:xsi="http://www.w3.org/20...hema-instance"> <CopyProfile>true</CopyProfile> <DoNotCleanTaskBar>true</DoNotCleanTaskBar> <RegisteredOrganization>XXXXXXXXX</RegisteredOrganization> </component> <component name="Microsoft-Windows-Shell-Setup" processorArchitecture="x86" publicKeyToken="31bf3856ad364e35" language="neutral" versionScope="nonSxS" xmlns:wcm="http://schemas.micro...fig/2002/State" xmlns:xsi="http://www.w3.org/20...hema-instance"> <CopyProfile>true</CopyProfile> <DoNotCleanTaskBar>true</DoNotCleanTaskBar> <RegisteredOrganization>XXXXXXXXX</RegisteredOrganization> </component> </settings> <settings pass="windowsPE"> <component name="Microsoft-Windows-Setup" processorArchitecture="amd64" publicKeyToken="31bf3856ad364e35" language="neutral" versionScope="nonSxS" xmlns:wcm="http://schemas.micro...fig/2002/State" xmlns:xsi="http://www.w3.org/20...hema-instance"> <UseConfigurationSet>true</UseConfigurationSet> </component> </settings> <cpi:offlineImage cpi:source="wim:c:/users/tech/desktop/install.wim#Windows 8 Pro" xmlns:cpi="urn:schemas-microsoft-com:cpi" /></unattend>Please note that the offlineImage does not actually need to match an actual file it seems. I don't know exactly why this is needed.ShareImprove this answer
Follow
answered Oct 27, 2014 at 12:35Karl CassarKarl Cassar32111 gold badge66 silver badges1515 bronze badgesAdd a comment | |
Is it safe to remove /var/cache to free space? | linux;ubuntu;disk-space;linux;ubuntu;disk-space | Is it safe to remove /var/cache to free space?
Ask Question
|
4
Do not remove manually.The proper way to do it issudo apt-get cleansudo apt-get autocleansudo apt-get autoremoveShareImprove this answer
Follow
answered Oct 26, 2014 at 8:49R JR J59022 silver badges66 bronze badges29That will only handle /var/cache/apt though.
– David SchwartzOct 26, 2014 at 9:32Upvoted, David's comment. Still, in number of cases that might be enough (it was for me).
– LAFK says Reinstate MonicaMay 6, 2015 at 9:37Add a comment | ;
1
I'd use a tool like like Bleachbit to safely clean up caches.sudo apt-get install bleachbitShareImprove this answer
Follow
answered Dec 17, 2014 at 17:15MoontyMoonty1911 bronze badge1Please quote the essential parts of the answer from the reference link, as the answer can become invalid if the linked page changes or the target site is unreachable/permanently offline.
– DavidPostill♦ Dec 17, 2014 at 17:18Add a comment | |
99% CPU on Win8.1, Can't find offending process [closed] | windows-8.1;cpu-usage;diagnostic;windows-8.1;cpu-usage;diagnostic | 99% CPU on Win8.1, Can't find offending process [closed]
Ask Question
|
0
You have no CPU usage in the trace. The CPU is idle for 99%:Resource Monitor shows 104% CPU usage so this is a bug and you can ignore this.ShareImprove this answer
Follow
answered Oct 26, 2014 at 7:38magicandre1981magicandre198196.3k2929 gold badges175175 silver badges244244 bronze badges41Not an answer.. this is better suited as a comment.
– AStopherOct 26, 2014 at 7:431@magicandre1981, This is the problem. Task manager and Resource monitor show 99%, while Procmon and this trace show no CPU usage.
– BlinkyBillOct 26, 2014 at 7:55@magicandre1981, ok I think I'm with you now. You're saying there's a bug reporting bad CPU readings in task manager/Resource Monitor, as evidenced by the 104%.
– BlinkyBillOct 26, 2014 at 8:023@magicandre1981, looked into CPU usage > 100%, and it looks like it has to do with CPU performance scaling, so an >100 reading is valid. More detail at superuser.com/questions/256921/….
– BlinkyBillOct 26, 2014 at 8:22Add a comment | ;
0
Ensure you are running Task Manager with admin rights, as it will not show processes run with administrator rights, if the user does not have administrator rights and therefore omit to show the processes which may be causing the high CPU usage.To do this, open a CMD window with admin rights and it will show "Administrator:" in the title bar if it is run with admin rights. Then run the command taskmgr.exeShareImprove this answer
Follow
answered Jan 27, 2017 at 9:25MikeCMikeC13944 bronze badgesAdd a comment | ;
0
On my PC, this problem seemed to be caused by one of the Balanced power saver mode. Simply switching to High Performance or Power Saver fixed this problem for me. Now, Task Manager shows the correct amount of CPU usage.ShareImprove this answer
Follow
edited Feb 15, 2017 at 10:44
answered Mar 17, 2015 at 12:15nomadnomad111 bronze badge1Resource Monitor says "104% Maximum Frequency". The processor is not throttling. Quite the opposite, in fact: the processor is operating at Turbo speeds. This therefore can't possibly explain the issue.
– bwDracoMar 18, 2015 at 6:41Add a comment | ;
-1
I had the same problem. Turns out a program (Steam, if you must know) was being showed incorectly. It was using up loads of CPU but the task manager reckoned it was only using 23%. Check if any program is constantly updating or performing background tasks?ShareImprove this answer
Follow
answered Jul 8, 2016 at 19:27LukeLuke1Add a comment | |
How do I make a transparent desktop icon (like the Firefox icon) | icons;desktop-icons;icons;desktop-icons | How do I make a transparent desktop icon (like the Firefox icon)
Ask Question
|
2
Does your image have an alpha channel? You posted a JPEG file on your question. Is this the image you are trying to convert? If so, you'll need the image with transparency in the first place saved in a different format that supports it, like PNG. Example:The JPEG format does not store an alpha channel and thus does not have transparency.ShareImprove this answer
Follow
answered Oct 26, 2014 at 7:35RyaknaRyakna1,09022 gold badges1212 silver badges2929 bronze badges1Thanks! that's exactly what I was looking for, thank's for the info!
– RoboliskOct 27, 2014 at 1:44Add a comment | |
Computer won't boot after uninstalling Ubuntu and reinstalling windows | windows-7;ubuntu;boot;mbr | Computer won't boot after uninstalling Ubuntu and reinstalling windows
Ask Question
|
0
It seems like a problem with your GPT/MBR. If you cannot access the BIOS, unplug your PC and put the battery away (since it's a laptop), open it up and find a battery on the motherboard that looks like this one: And then wait a few seconds. Then put it back in the boot the PC. It will restart the BIOS configuration and then you should be able to use repair disks, et cetera. P.S. Before opening the PC, touch something metallic that connects to the ground (i.e. a metal sink) in order to discharge any static electricity you may carry. This will protect you PC when you open it up because some circuits are vulnerable to static electricity. ShareImprove this answer
Follow
edited Oct 26, 2014 at 5:30
answered Oct 26, 2014 at 5:25matan129matan1291,95022 gold badges1818 silver badges2424 bronze badges2Thanks for the help! I can't figure out how to add a picture to the comment (I'm using my phone), but I opened the back and there is a small plastic circular thing connected to the motherboard, stuck on with glue, and I removed the connector for that, and the BIOS didn't restart. Now there's another circular piece that looks like it could be the battery, but it would require taking off almost every part to get to it. Would the BIOS battery be that covered with stuff? Should I give it a try? Or is the plastic thing the battery?
– user382280Oct 26, 2014 at 5:32The battery is almost always a button cell about 20mm in diameter and usually in some type of button cell holder that is soldered in. There could be some kind of insulating cover over it. The only thing I can think of that would be round, plastic, and glued on, with a wire and connector would be a little speaker. The CMOS battery typically lasts on the order of 4-5 years and you don't often need to remove it for a purpose like this, so they don't design the laptop with battery serviceability as a goal.
– fixer1234Oct 26, 2014 at 6:05Add a comment | ;
0
My storyHello, I suffered same situation two days ago, computer won't boot can't get past the manufacturer's logo. After searching internet helplessly, I discovered that problem was with my RAM, the carbon build up on ram stopped computer from booting, After cleaning the RAM from Acetone. Voila it started again. What to do-My conclusion is that clean your ram and then try booting the PC. Here's the guide to clean the ram- "how to clean your ram", If that is not the problem it might be the CMOS battery that is creating problem, you need to change it here's a guide- "Replacing the battery".ReferencePersonally experienced.ShareImprove this answer
Follow
answered Oct 26, 2014 at 5:32
user341645user3416453Thanks for the advice! I don't know RAM on a motherboard could get dirty (I'm new to the whole physic side of computing), but I'll give it a try!
– user382280Oct 26, 2014 at 5:34@barlowmen Also check the CMOS battery, there's guide in my answer. or here's a video
– user341645Oct 26, 2014 at 5:38I would worry about using acetone. If you need a solvent, 91% or higher isopropyl alcohol (available at drug stores and supermarkets) would avoid the risk of damaging the plastic or coatings. Use it on a cotton swab and clean only the contact areas.
– fixer1234Oct 26, 2014 at 16:17Add a comment | |
Node mirrors - or is it load balancing or reverse proxying? | networking;networking | Node mirrors - or is it load balancing or reverse proxying?
Ask Question
|
0
The commercial, proprietary and a bit expensive solution: CISCO content switchingCISCO has a product line called Content Service Switches (their CSS 11500 series). Based on your question, this comes close to what you're looking for. The terms they use (and you can use them to Google for similar products) is "content switching" or "application switching".(I haven't used such devices in real-life nor am I affiliated in any way to Cisco)High Availability design principes: Keep it simpleIn my opinion, there is a weak point in your diagram and that's the write (POST) to all servers. You rely on the "device" to sync all instances of the server (Apache, NSF folders, database, etc.). This introduces a new SPoF (the device itself, as you already noticed) and adds the complexity of synchronization. If one of the servers is (temporary) unavailable, who is responsible for the re-sync? The server itself or the "device"? A better pattern is to put the responsibility of failover / high availability within the infrastructure itself:on a hardware level (RAID, redundant hardware, multiple network paths, etc.), on the OS level (under Linux: Heartbeat: the cluster messaging layer, Pacemaker: the cluster resource manager and Cluster Glue: the cluster management tools) and on the application level. For example Apache had several options, such as Camel, all database platforms come with clustering options and NSF can be setup using the OS's HA features).High available failover LAMP serverI think for a MediaWiki the general solution is to build a high available failover LAMP. If you Google on those terms, lots of solutions pop up, such as described in this article and a great schematic of a high available LAMP setup here on serverfault. ShareImprove this answer
Follow
edited Apr 13, 2017 at 12:14CommunityBot1
answered Oct 27, 2014 at 9:58agtoeveragtoever6,20411 gold badge2323 silver badges3737 bronze badges3That makes sense - I'm not keen on syncing the OS or the database (at least not all the time, if one node goes down, I'm happy to sync it up with the other). The application level would be ideal - I'll look at camel. The problem with the high-availability example with LAMP is the sql syncing, which makes the sql system a SPOF - if you upgrade, you have to upgrade them all, and an error will propagate. With separate nodes syncing at the application level, one node can use MySQL and the other sqlite, so you're protected against database software induced errors, sync & XML level.
– Peter BrooksOct 27, 2014 at 10:37Having two brands of DBMSs is very unusual; I've never seen that in real life. Software or configuration errors should be filtered out in the DTAP stages before a configuration to production.
– agtoeverOct 27, 2014 at 22:13Yes, I know it's unusual. I've known of cases (very few admittedly) where an upgrade/patch to a database has destroyed it - with mirrored DBMS, both have died and the entire system has gone. Pre-live testing of all patches should prevent this, certainly, but it doesn't always. So I think two is a good idea, particularly if the primary is sqlite for speed and the secondary mysql for reliability. Human error can also destroy both, more difficult with different technologies, and no mirroring.
– Peter BrooksNov 1, 2014 at 7:01Add a comment | |
Is there a Windows keyboard shortcut to quit Firefox? | windows;firefox;keyboard-shortcuts;windows;firefox;keyboard-shortcuts | Is there a Windows keyboard shortcut to quit Firefox?
Ask Question
|
8
Firefox support says (for Windows):Exit: Ctrl + Shift + Q (from Keyboard shortcuts - Perform common Firefox tasks quickly)(retrieved with Firefox 58, Windows 10)ShareImprove this answer
Follow
answered Mar 15, 2018 at 8:38ayeseeemayeseeem9611 silver badge22 bronze badges21Stephen please help accept this answer. Confirmed to work immediately in Firefox Quantum 61.0.1 (64-bit) as well without any additional set-up necessary.
– ADTCJul 25, 2018 at 21:58To disable: about:config > set these to true: (1) browser.sessionstore.warnOnQuit and (2) browser.warnOnQuit. See support.mozilla.org/en-US/questions/1279145. Workarounds: askubuntu.com/questions/10880/…
– Ray WoodcockNov 17, 2021 at 5:38Add a comment | ;
5
Create a file named 'ffquit.bat' and add the line 'taskkill /im firefox.exe' Save.Create shortcut to this file and right click the shortcut and select properties.On the Shortcut tab, assign a shortcut key (CTRL+SHIFT+F for example)Under the Run menu, select minimized.Under Advanced, select 'Run as Administrator'. Click OK to save and close the Properties window.Now every time you press CTRL+SHIFT+F Firefox will quit.ShareImprove this answer
Follow
edited Oct 26, 2014 at 13:18Robotnik2,38033 gold badges2323 silver badges4141 bronze badges
answered Oct 26, 2014 at 9:05JohnnyVegasJohnnyVegas3,45011 gold badge1313 silver badges1717 bronze badges2This is an interesting technique. What are the consequences, if any, of having the OS forcekill the Firefox process instead of terminating Firefox via its own standard user interface?
– RockPaperLz- Mask it or CasketOct 26, 2014 at 19:162I'm assuming that as I am not invoking the /F(force) command that the process ends cleanly. I may be mistaken, although whenever firefox closes incorrectly it informs you and tries to recover tabs. I don't get that message when using TASKKILL
– JohnnyVegasOct 26, 2014 at 19:49Add a comment | ;
0
Good question. But unfortunately there is no standard shortcut for this, nor is there an about:config preference to create one. You may wish to write a feature request and submit it on bugzilla so that the developers will consider to add it as a feature.ShareImprove this answer
Follow
edited Oct 26, 2014 at 20:21
answered Oct 26, 2014 at 3:59RockPaperLz- Mask it or CasketRockPaperLz- Mask it or Casket7,4042626 gold badges6767 silver badges117117 bronze badgesAdd a comment | ;
0
The usual straightforward way is to run Task Manager with Ctrl+Shift+Esc, then choose the Firefox process in the Applications tab and pressing Del to kill it (or clicking the "End task" button).(This is Windows 7; it looks somewhat different in different versions.)ShareImprove this answer
Follow
edited Oct 27, 2014 at 4:13Haplo43622 silver badges88 bronze badges
answered Oct 26, 2014 at 13:18tripleeetripleee3,03455 gold badges3131 silver badges3434 bronze badges21I would use ctrl-shift-esc instead of ctrl-alt-del to open the Task Manager
– nixdaOct 26, 2014 at 13:512That seems like even more work than Alt + f, x. But I suppose it would work.
– Stephen SOct 26, 2014 at 19:23Add a comment | |
Can Connecting devices with the wrong type of cable (crossover/straight through) damage them? | crossover;crossover | Can Connecting devices with the wrong type of cable (crossover/straight through) damage them?
Ask Question
|
1
Assuming we're talking about Ethernet connecting to Ethernet, without PoE (power over Ethernet) then no, connecting an Ethernet cable will not harm either device. Connecting Ethernet to a modem port may harm one of the devices, but I forget which one. Connecting Ethernet with PoE to a device with the incorrect cable MAY harm the device NOT supplying power. There are likely several other combinations which could cause harm to either or both sides.ShareImprove this answer
Follow
answered Oct 26, 2014 at 3:49kronenpjkronenpj56844 silver badges1111 bronze badges31Additionally, in the simple case of ethernet to a non-ancient switch, if you use a crossover cable it will auto-negotiate just fine.
– davidgoOct 26, 2014 at 4:08So would you say its true in cases depending on the device the incorrect type is connected to?
– LeoinuOct 26, 2014 at 4:10Though I'm not completely sure what you're asking, I'll venture to say yes. The compatibility or damage will depend on the two devices being connected together. But in general Ethernet to Ethernet, straight through or cross-over, no harm will occur.
– kronenpjOct 26, 2014 at 14:21Add a comment | |
What is a faster way to search the Windows registry? | windows-7;windows;windows-registry;regedit;windows-7;windows;windows-registry;regedit | What is a faster way to search the Windows registry?
Ask Question
|
8
Faster, and dumps all results so you can go through the whole list without hitting next a hundred times. Also free since it is a powershell script:https://github.com/KurtDeGreeff/PlayPowershell/blob/master/Search-Registry.ps1Search-Registry.ps1 improves on regedit's Find feature in four ways:The script searches by using regular expressions.It can search the registry on remote computers.It can limit the number of returned search results.It outputs objects than can be filtered, sorted, exported to comma-separated value (CSV) files, and so on.# Download scriptcurl https://raw.githubusercontent.com/KurtDeGreeff/PlayPowershell/master/Search-Registry.ps1 -OutFile Search-Registry.ps1# View docsGet-Help .\Search-Registry.ps1# Simple example (search HKEY_CURRENT_USER for values with data containing "powershell").\Search-Registry -StartKey HKCU -Pattern "PowerShell" -MatchDataShareImprove this answer
Follow
edited Apr 30, 2021 at 9:16mwfearnley6,92055 gold badges2323 silver badges3232 bronze badges
answered Nov 2, 2014 at 1:55glallenglallen2,1561212 silver badges2323 bronze badges0Add a comment | ;
7
I would recommend the little and powerful tool RegScanner by Nirsoft.ShareImprove this answer
Follow
edited Jul 16, 2018 at 8:32Ajay90233 gold badges99 silver badges2525 bronze badges
answered Feb 14, 2017 at 8:49David.PDavid.P33511 gold badge55 silver badges1818 bronze badges15Please read How do I recommend software for some tips as to how you should go about recommending software. You should provide at least a link, some additional information about the software itself, and how it can be used to solve the problem in the question.
– DavidPostill♦ Feb 14, 2017 at 16:20Add a comment | ;
5
There's a very easy solution: start search in RegEdit when HKEY_LOCAL_MACHINE branch is focused on the left pane. This way you'll skip HKEY_CLASSES_ROOT and HKEY_CURRENT_USER branches, and you don't need them because HKEY_CLASSES_ROOT is actually a subkey of HKEY_LOCAL_MACHINE and HKEY_CURRENT_USER is a subkey of HKEY_USERS.ShareImprove this answer
Follow
answered Mar 26, 2016 at 5:10Davie AntDavie Ant6911 silver badge33 bronze badges1I think this is less of a "very easy solution" sort of answer, and more of a "You can save time by..." sort of answer. But definitely good to be aware of.
– mwfearnleyOct 12, 2020 at 13:30Add a comment | ;
3
1. Summary I use Registry Finder to search the Windows registry.2. DisclaimerThis answer is relevant for September 2019. In the future, its data may be outdated.3. FeaturesFully freeActively maintained as of 2019PowerfulWorks for Windows XP and above4. SpeedFrom official documentation:Fast, non blocking search.The Find operation is efficient and quick. All found items are displayed in a separate window as a list. Each line represents a single match with the search criteria. The icon shows where the match occurred: key name, value name or value data. Matched text is highlighted with red.For example, I tried to search keys, values and data uTorrent in entire registry.Time — 37.4 seconds for ~500000 registry keys. That's speed enough for me.5. Additional linksRegistry Finder official siteShareImprove this answer
Follow
answered Sep 27, 2019 at 14:09Саша ЧерныхСаша Черных8071313 silver badges2929 bronze badgesAdd a comment | ;
2
There is a Software called RegEditX which is pretty fast: http://www.dcsoft.com/products/regeditx/If you want a free Version search for the old v2.0, but 9.95$ isn't very much.ShareImprove this answer
Follow
answered Nov 2, 2014 at 1:30bejonwebejonwe12666 bronze badgesAdd a comment | |
How to view movies frame by frame or move smoothly through a video sequence (golf swing!) | video;video-playback;video;video-playback | How to view movies frame by frame or move smoothly through a video sequence (golf swing!)
Ask Question
|
0
VLC Media Player can do it [freeware, all platforms]Using default key-commands, can be changed in prefs.Spacebar to pausectrl, alt or shift plus arrow key to jump differing amounts back & forwards to get the right start pointE key will then frame-by-frameShareImprove this answer
Follow
answered Oct 25, 2014 at 19:01TetsujinTetsujin42.9k77 gold badges9696 silver badges122122 bronze badges3Should be noted that you can't move backwards, just one frame forward at a time.
– slhckOct 25, 2014 at 19:58True - I hadn't noticed that... but you can do 'very short jump' in either direction, which is 1 second.
– TetsujinOct 26, 2014 at 8:44… which is 400 frames in the case of the OP :) I think there was a plugin for VLC which allowed to do frame-by-frame skipping, also backwards, but it's not compatible with the latest release.
– slhckOct 26, 2014 at 9:00Add a comment | |
Access iCloud Drive via terminal | macos;terminal;dropbox;icloud;macos;terminal;dropbox;icloud | Access iCloud Drive via terminal
Ask Question
|
14
Step One, Setup a Link to the iCloud Drive Folder actual path:First, create a link in your home directory to your iCloud drive:cd ~ln -s ~/Library/Mobile\ Documents iCloudThe lines above do the following:// brings you to home directory// creates link to said path as the name, 'iCloud'Typing cd ~/iCloud in terminal will now deliver you to this directory.Step Two, Setup your Aliases in your Bash Profile:Once, a link has been established, we need to setup an alias. Aliases are removed once we restart terminal, so we have to add an extra step where we edit a file called .bash_profile (or create one if we don't have one already).Once done, we can simply type any binding and be delivered to our desired directory. In this example, we'll use i to take us right to our iCloud Documents folder. We can create an alias to the iCloud Drive folder and save it in our bash profile as follows:cd ~ls -aLook for a file called .bash_profile.If you don't have .bash_profile, type:sudo touch .bash_profileEnter your admin password and press enter. (Note: adding sudo forces the terminal command to run as admin, thus the need to authenticate. Not adding sudo before the command may cause the command to be rejected due to user access privileges).Once you have found .bash_profile, or finished creating it, we must now open it and define our alias inside as follows. Type:sudo nano .bash_profileYou will again be prompted to enter you admin password. Enter it and press enter.This will load up the nano editor. Press esc to be able to edit, and using the keyboard, arrow key down to the bottom. Type:alias i="cd ~/iCloud/com~apple~CloudDocs/Documents"Press Ctrl + O to save, and then enter, then press Ctrl + X to exit. Your alias is now saved. If we had not edited our .bash_profile, and just typed the alias in terminal, it would be erased when we restarted terminal. Adding this command into our bash profile will prevent this.Type your Alias in Terminal:Now that you've saved your alias to your .bash_profile, we must finally execute our alias at least once (I tried not doing this and it didn't work), by re-typing our alias in the general terminal:alias i="cd ~/iCloud/com~apple~CloudDocs/Documents"This will create the alias, and will now work. If you restart terminal, and run your alias command again, it should also still work.Results:After this setup, we can simply type: i into the terminal, which will load our iCloud Drive\Documents directory.Note: You can create any number of aliases to any folder, using any key binding you'd like, using the formula above. I just chose the Documents folder as this was the OP's question. The above strategy was outlined in a tech blog article here: https://danielmiessler.com/blog/access-icloud-drive-terminalHere's a tutorial on saving aliases to bash_profile (note sudo is not included in the write up, so if not working be sure to include):http://www.techradar.com/how-to/computing/apple/terminal-101-creating-aliases-for-commands-1305638How I Set Mine Up:I setup an alias called idev where by typing that in terminal, delivers me to a Development folder I created on my iCloud drive at: ~/iCloud/com~apple~CloudDocs/DevelopmentNote, the line above is still using the link setup initially in Step One.My personal Alias I setup is as follows:alias idev="cd ~/iCloud/com~apple~CloudDocs/Development"Using a link and then an alias can allow us to access the iCloud docs folder easily. The most confusing part is editing the .bash_profile file, but overall just follow the steps and now any time you open terminal your aliases should work!ShareImprove this answer
Follow
edited Feb 7, 2017 at 6:57
answered Feb 4, 2017 at 10:12twknabtwknab26622 silver badges55 bronze badges3You should absolutely not be using sudo to edit your local user's shell-profile files.
– ELLIOTTCABLEJun 5, 2017 at 3:382@ELLIOTCABLE (in all caps) Rather than just -1 me and give me your coy response, why not give me your rationale and the way YOU'D approach it, buy submitting YOUR answer below.
– twknabJun 6, 2017 at 0:381@ELLIOTCABLE Furthermore, the only way to edit my bash profile and save any changes I make to the file, is by using sudo to access the file as the admin. I've seen numerous examples of editing files this way and considering you just neg'd my answer without providing one of your own, I can't respect or accept the quality of your comment or answer.
– twknabJun 6, 2017 at 0:41Add a comment | ;
113
You're correct in that the iCloud Drive directory is located within Mobile Documents. From your user's home directory, you can access iCloud Drive via terminal with:cd ~/Library/Mobile\ Documents/com~apple~CloudDocsShareImprove this answer
Follow
edited Oct 10, 2015 at 12:34
answered Oct 17, 2014 at 17:23Matthew WhiteMatthew White1,23122 gold badges99 silver badges55 bronze badges64Awesome! Gonna symlink that into my home folder so I can spot it faster.
– Ingwie PhoenixOct 17, 2014 at 17:46Has this moved? I don't even have a Library/Mobile\ Documents/ directory.
– Joe HansenDec 1, 2014 at 17:47@JosephHansen I'm not sure, on my system the Mobile Documents directory is still present as of OSX 10.10.1.
– Matthew WhiteDec 7, 2014 at 11:483He has given a relative path here. Make sure you're in/at ~ before you copy pasta this into your terminal.
– DigitalDesignDjJan 21, 2015 at 20:21My mistake sorry, I'll update my answer.
– Matthew WhiteOct 10, 2015 at 12:31 | Show 1 more comment;
6
Matthew is right; IF you have iCloud Drive turned on in sysPrefs, the iCloud Drive folder is there, he was just listing it relative to your user account. I'm not sure about the "com.apple.CloudDocs" though. The com~ files & plists for everything, including mobile apps, are NOT visible in Finder -only in Terminal.As of 10.10.1 if you're looking for the absolute path to the all-encompassing directory, try: /Users/username/Library/Mobile\ Documentsalternatively:~/Library/Mobile\ DocumentsShareImprove this answer
Follow
edited Feb 22, 2015 at 15:44apaderno1,45033 gold badges2323 silver badges3838 bronze badges
answered Jan 5, 2015 at 19:37johnnytcomojohnnytcomo6111 silver badge44 bronze badgesAdd a comment | ;
2
To find the path to a file simply open the terminal (you can use the search tool), drag the file from finder in the terminal and it will provide you its path. This is however problematic with files in the iCloud Drive as apparently, the provided path does not work when trying to access it from other programs than the one it is registered with.ShareImprove this answer
Follow
answered Jan 10, 2015 at 10:02Paul VaucherPaul Vaucher2111 bronze badgeAdd a comment | ;
1
I created an Automator App that run this terminal command:open ~/Library/Mobile\ Documents/com~apple~CloudDocsYou can download here. Just put it inside Applications and drag it to the dock.ShareImprove this answer
Follow
edited Aug 11, 2016 at 10:41
answered Aug 11, 2016 at 10:35Mattia AstorinoMattia Astorino11133 bronze badgesAdd a comment | ;
1
I cannot write comments.Because of the ~ the path have to be in "" to open. I created a symlink to access it more easy.sudo mkdir /mountssudo cd /mountssudo ln -s "/Users/fusca/Library/Mobile Documents/com~apple~CloudDocs" iCloudShareImprove this answer
Follow
answered Mar 14, 2018 at 16:26Fusca SoftwareFusca Software12133 bronze badgesAdd a comment | |
How can I make printf print unicode characters saved in a variable? | linux;printing;unicode;tcsh;linux;printing;unicode;tcsh | How can I make printf print unicode characters saved in a variable?
Ask Question
|
1
The following gets what I want in the first code block in the question. It is significantly faster than the second code block.#!/bin/tcshset horz_line = ""foreach x (`seq 1 1 80`) set horz_line = ${horz_line}'\\u2550' # double lineendprintf "`echo $horz_line`\n"unset horz_lineShareImprove this answer
Follow
answered Oct 17, 2014 at 16:11Kaushal ModiKaushal Modi30322 silver badges88 bronze badges1Good find! For me it had to be one backslash: check="\u2718" then later printf "`echo -e $check`"
– Heath RafteryAug 8, 2019 at 13:20Add a comment | |
Adding syntax highlighting for a comment section in Emacs | emacs;regex;syntax-highlighting;elisp;emacs;regex;syntax-highlighting;elisp | Adding syntax highlighting for a comment section in Emacs
Ask Question
|
2
My crystal ball tells me what you do wrong is copy&paste code you don't understand. Looks like it's feeling sarcastic today, sorry, I promise I'll get a new one soon.As for your problem, it's the \\< in your regexp, which is a special constructor which matches the beginning of a word, so it can never match in front of a - since words can only start with proper letters or digits.ShareImprove this answer
Follow
answered Oct 17, 2014 at 19:24StefanStefan1,1991111 silver badges2424 bronze badges6I thought for sure it was the comment-start in the syntax table. I'll try this asap, thanks
– Sean AllredOct 17, 2014 at 19:37Thanks again. I did try to find a reference for the syntax of the regular expression here; since \\< isn't standard, there must be some documentation on it. I couldn't find it anywhere in the manual, however -- do you know where I should look?
– Sean AllredOct 17, 2014 at 20:57@SeanAllred: Yes, see the Elisp manual, node Regexp Backslash, and look for \<. And see node Syntax for Strings for info about doubling the backslash.
– DrewOct 17, 2014 at 21:01In the manual. This is the \< special operator (where the `` needs to be doubled in strings because it's a special escaping character in strings).
– StefanOct 17, 2014 at 21:01Related, before I ask another Q (in case it's another silly mistake like this...) - is there any reason it should work for this face? gist.github.com/vermiculus/6b2e6aad3c2ec14dc20d @Drew Ah, I suppose there's no (easy) way then to mark comment-only syntax.
– Sean AllredOct 17, 2014 at 21:35 | Show 1 more comment |
Create custom command in tmux | tmux;tmux | Create custom command in tmux
Ask Question
|
4
Originally, tmux doesn't have any support for custom commands except for running external shell scripts.There's a mod adding full-fledged scripting support to tmux: http://ershov.github.io/tmux/It also allows to create user commands. For example, yours would look like:proc no-side-status {} { set status-left-length 0 set status-right-length 0}proc side-status {} { set status-left-length 50 set status-right-length 150}To use from tmux command line just type C-b : and side-status or no-side-status.To bind it to a key use bind C-p tcl side-status.ShareImprove this answer
Follow
answered Apr 19, 2016 at 0:35Yuriy ErshovYuriy Ershov15133 bronze badgesAdd a comment | ;
2
bind C-p run "/usr/bin/notify-send Foo"ShareImprove this answer
Follow
answered Jan 28, 2015 at 11:39guneysusguneysus21611 silver badge1111 bronze badges3How does this answer my question?
– gitaarikJan 28, 2015 at 12:17Partial answering, that you can bind shortcut to a external shell function. (that you can type with prefix key + colon)
– guneysusJan 28, 2015 at 12:29I'm not trying to bind an external shell function to a shortcut.
– gitaarikJan 28, 2015 at 15:06Add a comment | ;
2
This is the full answer. You can have two tmux configuration.One containset status-left-length 0set status-right-length 0bind-key R source-file ~/.tmux.alternative.conf \; \display-message "Alternative configuration loaded"The other containset status-left-length 50set status-right-length 15bind-key R source-file ~/.tmux.conf \; \display-message "Default configuration loaded"ShareImprove this answer
Follow
answered Jan 28, 2015 at 12:35guneysusguneysus21611 silver badge1111 bronze badges2I could try this approach, though I actually don't want to bind it to a keyboard shortcut but want to create a custom command.
– gitaarikJan 28, 2015 at 15:09Good luck. It seems difficult without hacking the tmux core. You should consider the answers above, binding a key to shell scripts/functions.
– guneysusJan 28, 2015 at 22:05Add a comment | ;
2
The closest experience you can get right now is:create tmux shell script and put it in $PATHrun the script inside tmux using the run-shell command (short: ru)Example in tmux (say the script is named tm.xx)c-b :ru tm.xxSo you are typing three extra characters - ru ShareImprove this answer
Follow
answered Aug 18, 2021 at 10:02KayKay1,17111 gold badge1010 silver badges1111 bronze badges1Agreed that this is probably the best bet still almost 7 years after the question was asked. I was thinking :source tm.tmux for "pure tmux commands", but that can't handle the PATH. run-shell can.
– NotTheDr01dsAug 18, 2021 at 22:35Add a comment | ;
0
tmux supports float windows now. You could popup a window by using tmux display-popup. And then in this popup window, run the script you want to use.ShareImprove this answer
Follow
edited Nov 25, 2022 at 11:59Donald Duck2,4451010 gold badges2929 silver badges4545 bronze badges
answered Nov 23, 2022 at 9:34Cong WuCong Wu111 bronze badge1Could you please use full sentences and correct your grammar? Even with knowledge about the topic it is hard to grasp what you are writing.
– mashuptwiceNov 24, 2022 at 1:07Add a comment | |
Apache client denied by server configuration after mac OS X upgrade to Yosemite | macos;php;apache-http-server;macos;php;apache-http-server | Apache client denied by server configuration after mac OS X upgrade to Yosemite
Ask Question
|
19
In your user .conf (douglas.conf) replace:Order allow,denyAllow from allWith:Require all grantedThe difference is how apache 2.4 handles permissionshttp://httpd.apache.org/docs/2.4/upgrading.htmlShareImprove this answer
Follow
edited Oct 18, 2014 at 15:10Zoe Edwards10533 bronze badges
answered Oct 17, 2014 at 15:34chrisMcchrisMc20622 silver badges22 bronze badges3I changed the settings in httpd.conf and douglas.conf but I still get the same error
– new2codeOct 17, 2014 at 21:121Don’t forget to restart Apache
– Zoe EdwardsOct 18, 2014 at 13:20This is cool, although the old Order/Allow/Deny are still working if you have the access_compat module turned on. I think it would have been better for me to get errors and fix my setups instead of letting it go for longer with the old configs.
– Alexis WilkeOct 23, 2014 at 0:42Add a comment | ;
13
I had the same issue and I fixed it by doing so:Load the userdir module:edit httpd.conf (/etc/apache2/httpd.conf on macbook) and uncomment these lines:LoadModule userdir_module libexec/apache2/mod_userdir.soandInclude /private/etc/apache2/extra/httpd-userdir.confEdit httpd-userdir.conf (at /etc/apache2/extra/httpd-userdir.conf), find and uncomment the following line:Include /private/etc/apache2/users/*.confEdit your config file at users/*.conf, add Require local and + (or -) character before all options in the options line:<Directory "/Users/user/Sites/"> Options +Indexes +MultiViews +FollowSymLinks +SymLinksIfOwnerMatch +ExecCGI AllowOverride All Require local Order allow,deny Allow from all</Directory>ShareImprove this answer
Follow
edited Dec 7, 2021 at 11:40ZygD2,4311111 gold badges2525 silver badges4343 bronze badges
answered Oct 18, 2014 at 16:01s4njis4nji24011 silver badge66 bronze badges11This (exactly this, nothing more, nothing less) worked for me, when nothing else did. Thx!
– oromeOct 18, 2014 at 21:50Add a comment | ;
1
I experienced the same thing but on Mavericks after applying the security update from a couple days ago. Mavericks is still using Apache 2.2 so it wasn't the config issue chrisMc mentioned, though it looks like he's right and you'll need to change that as well.In my case, I first resolved the core problem by commenting out the Homebrew PHP 5.4 module line I had previously added. In the httpd.conf:#LoadModule php5_module /usr/local/opt/php54/libexec/apache2/libphp5.soAnd instead opting for the default PHP module which I had commented out before:LoadModule php5_module libexec/apache2/libphp5.soThat fixed it, but as for why the Homebrew version broke, I think maybe a system library it was compiled against was updated in the security update. When I ran php -v I got a warning about an icu4c library that wasn't loaded.So, I just recompiled PHP and it worked again. In my case, I just didbrew uninstall php54brew install php54Then the Homebrew module could be enabled again.ShareImprove this answer
Follow
answered Oct 18, 2014 at 12:37toddabrahmtoddabrahm1111 bronze badgeAdd a comment | ;
1
Since I have never used homebrew I ended up following this guide. Setup for personal development.I did see that the permissions that the first poster was talking about as being part of the problem, but I still have a permissions issue with personal setup using a user.conf file. This setup used virtual hosts. I have no idea what homebrew did that solved the problem. I guess I would call this a work around because it did not fix my original issue, which is that I cannot access anything on the web server using a user.conf file. ShareImprove this answer
Follow
answered Oct 18, 2014 at 16:45new2codenew2code14311 gold badge11 silver badge66 bronze badges1Awesome! The key for me was simply commenting out lines 220-221 ( # AllowOverride none and # Require all denied) which were apparently newly added in Yosemite.
– MarkHuSep 4, 2015 at 23:22Add a comment | ;
1
The answers above do work, on a stock install. If not, a few things that might help:On your filesystem, the folder needs to be exactly Sites with a capital S (the folder name is hardcoded in the userdir module, it can't be any different) Its permissions must be:drwxr-xr-x 2 username staff 68 29 mar 11:26 SitesThe <Directory…> configuration is applied on top of it, so it needs to match the folder name exactly, including the case (we're coming from Linux…). Permissions of the /etc/apache2/users/username.conf file:-rw-r--r-- 1 root wheel 189 29 mar 11:42 username.confSo make sure that the line <Directory "/Users/user/Sites/"> refers exactly to the right folder with the right username (with user matching the name of the configuration file), case included, and the Sites folder does exist exactly as is, case included.ShareImprove this answer
Follow
edited Mar 29, 2016 at 3:42techraf4,7921111 gold badges2424 silver badges4040 bronze badges
answered Mar 29, 2016 at 2:53BrunniBrunni1111 bronze badgeAdd a comment | ;
0
In httpd.conf uncomment:LoadModule authz_core_module libexec/apache2/mod_authz_core.so LoadModule authz_host_module libexec/apache2/mod_authz_host.so LoadModule userdir_module libexec/apache2/mod_userdir.so Include /private/etc/apache2/extra/httpd-userdir.confAnd in /etc/apache2/extra/httpd-userdir.conf uncomment:Include /private/etc/apache2/users/*.confThen restart Apache.ShareImprove this answer
Follow
edited Mar 30, 2015 at 17:11blavla10322 bronze badges
answered Oct 18, 2014 at 13:53chrisMcchrisMc2833 bronze badgesAdd a comment | ;
0
In my case, apache version 2.4.27. Solved problem after Changing my httpd-vhosts.conf file from "/etc/apache2/extra/httpd-vhosts.conf" directory.From<VirtualHost *:80> ServerName inventory.loc ServerAlias www.inventory.loc DocumentRoot "/Users/Vagabond/Sites/inventory/public/" ErrorLog "/Users/Vagabond/Sites/logs/inventory.loc-error_log" CustomLog "/Users/Vagabond/Sites/logs/inventory.loc-access_log"</VirtualHost>To, <VirtualHost *:80> ServerName inventory.loc ServerAlias www.inventory.loc DocumentRoot "/Users/Vagabond/Sites/inventory/public/" <Directory /Users/Vagabond/Sites/inventory/public/> Require all granted Options Includes FollowSymLinks </Directory> ErrorLog "/Users/Vagabond/Sites/logs/inventory.loc-error_log" CustomLog "/Users/Vagabond/Sites/logs/inventory.loc-access_log"</VirtualHost>ShareImprove this answer
Follow
edited Oct 25, 2017 at 19:24
answered Oct 25, 2017 at 19:19sh6210sh621013144 bronze badgesAdd a comment | |
how to get debain package unpacked first before debconf prompt is shown? | debian;apt-get;packages;dpkg;debian;apt-get;packages;dpkg | how to get debain package unpacked first before debconf prompt is shown?
Ask Question
|
1
The quest has ended!Now I understand the complete process as described in debconf manpage. There are different phases or steps whatever you call it. They are:dpkg-preconfiguredpkg -idpkg-reconfigureAll these steps initiate debconf communication with user. When someone installs a package using dpkg -i then the config script is run just before running the postinst script with same command line options. By the time debconf communication begins the package is already unpacked.When someone installs a package using apt-get then first dpkg-preconfigure is run that executes the config script and then dpkg -i to actually install the package which again runs the same config script.In the second case of apt-get, when config script is run as part of dpkg-preconfigure then the package is yet to be unpacked so I was facing this problem.I just added a if condition to continue if files are unpacked or else exitif [ ! -f /usr/share/pkg-name/common-codebase ]; then exit 0 fi /usr/share/pkg/common-codebaseThis way when installing package using apt-get, dpkg-preconfigure attempt to run config script is skipped while the second attempt at dpkg -i is honored. This works for me because the debconf questions I ask to user does not impact on any other package.In case you have shared templates and your choices may impact anything outside the package then remember even if you delay your prompts still the other related/dependent packages being installed by apt-get will still prompt user during dpkg-preconfigure step. Make sure that is fine for you before attempting this solution.ShareImprove this answer
Follow
answered Oct 20, 2014 at 7:22i01000001i010000012133 bronze badgesAdd a comment | |
How can I find wget processes older than one day in unix? | linux;kill;ps;linux;kill;ps | How can I find wget processes older than one day in unix?
Ask Question
|
1
You can try formatting the output of ps:ps -ae -o start,pid,commandIf the process is older than 24 hours, it shows date instead of time in the first column.ShareImprove this answer
Follow
answered Oct 17, 2014 at 15:23chorobachoroba18k44 gold badges4848 silver badges5252 bronze badges1can you please provide me the complete command ?
– ravi kumarOct 17, 2014 at 15:52Add a comment | ;
0
As long as you mean "more than 24 hours" when you say older than a day, this should work.for wgetpid in $(ps -eo "%t %p %c" | grep "^ *[0-9][0-9]*-" | grep wget | cut -d ' ' -f 2);do kill -9 $wgetpiddoneThe ps -eo command outputs the time (in format [[dd-]hh:]mm:ss), the pid and the process name.If the process has been running for less than 24 hours, there's no - in the time.The first grep command matches lines that start with (^) zero or more spaces (processes running for 1-9 days are indented if there are any processes that have been running for 10 or more days), a number, zero or more numbers (for 2+ digit number of days), then the - that indicates the previous number was days.The second grep filters that down to wget processes.The cut command grabs just the 2nd field (the pid).Then the for loop cycles through those pids, and kills each one.ShareImprove this answer
Follow
answered Oct 17, 2014 at 19:25OmnipresenceOmnipresence64933 silver badges66 bronze badges3Thanks. This ans was really useful. can someone provide a command or a script which can provide me the processes older than one hour for wget and kill them.
– ravi kumarNov 1, 2014 at 19:07can someone please provide a script which can provide provide me the processes older than one hour for wget and kill them.
– ravi kumarNov 3, 2014 at 14:24@ravikumar That requires entirely different logic. I suggest you first accept one of the answers for your existing question (processes older than one day), then ask a new question about processes older than 1 hour.
– OmnipresenceNov 3, 2014 at 16:49Add a comment | |
DNS caching not clearing Mac OSX | macos;google-chrome;dns;macos;google-chrome;dns | DNS caching not clearing Mac OSX
Ask Question
|
1
It sounds like it's being cached by the DNS server at 10.0.0.1 (probably your router). There are two potential levels of caching involved, and flushing one of them doesn't affect the other. Let me run through the options:dig +trace domainname.com traces the DNS query through authoritative servers, in your case getting the final answer from 66.117.5.83.dig domainname.com just sends the query to the DNS server configured in your network settings (in your case 10.0.0.1). This is usually just a caching server, which will remember results it's looked up before, and hand out the same answer until its time-to-live expires (in xxx.com. 3174 IN SOA dns1.registrar-servers.com..., it has 3174 seconds to go).Using the domain with normal (non-DNS-oriented) programs like Chrome go through OS X's resolver, which checks its cache (same TTL policy applies here), and if it's not there checks the configured DNS server (remember that that's probably a caching server).Resetting the OS X cache doesn't affect the cache at the DNS server. Also, note that even if you reset your DNS server (e.g. by rebooting your router), other DNS servers throughout the net may still have the old info cached. In general, when you make a DNS change, you have to wait for the TTL to expire before assuming the new info is available everywhere.(And actually, there's another level you have to worry about -- your secondary DNS servers only check the primary server for updates periodically, so you have to wait for the secondary to update, THEN for the TTL to expire all the old info out of various caches...)ShareImprove this answer
Follow
answered Oct 19, 2014 at 18:03Gordon DavissonGordon Davisson33.4k55 gold badges6464 silver badges7070 bronze badgesAdd a comment | ;
0
All working fine far as I can tell. The domain xxx.com seems to be synchronized and working just fine. Also noticed you used dig http://www.xxx.com. Dig dosen't understand URLs, try with just the domain name part, dig www.xxx.com, so you get a correct response.$ dig www.xxx.com; <<>> DiG 9.9.5-3-Ubuntu <<>> www.xxx.com;; global options: +cmd;; Got answer:;; ->>HEADER<<- opcode: QUERY, status: NOERROR, id: 45553;; flags: qr rd ra; QUERY: 1, ANSWER: 1, AUTHORITY: 0, ADDITIONAL: 1;; OPT PSEUDOSECTION:; EDNS: version: 0, flags:; udp: 4096;; QUESTION SECTION:;www.xxx.com. IN A;; ANSWER SECTION:www.xxx.com. 86331 IN A 141.0.173.173;; Query time: 0 msec;; SERVER: ;; WHEN: Sun Oct 19 16:44:50 MDT 2014;; MSG SIZE rcvd: 56Here's the nameserver details.$ checksoa xxx.comSerial # RTT(ms) Version Nameservers (name, IP, SOA mname field) for xxx.com 2014040205 80 not currently available ns4.serverstack.com 69.55.56.130 SOA: ns1.serverstack.com 2014040205111 not currently available ns1.serverstack.com 69.55.62.180 SOA: ns1.serverstack.com 2014040205185 not currently available ns2.serverstack.com 141.0.173.228 SOA: ns1.serverstack.com 2014040205174 not currently available ns3.serverstack.com 87.233.226.25 SOA: ns1.serverstack.comYou may have to clear your local DNS caches if this is not being refreshed. The negative cache TTL is what gets you on newly added records. In this case, the negative TTL is 1800 seconds for xxx.com, so you could just wait that 30 minutes and it'll clear up on it's own.This is a common problem. You make a DNS change to add a new record and then you lookup the name immediately, before it's had a few minutes to propagate to all name servers, so you get a negative cache entry right before it was live and thus have to wait the full time (30 minutes), or resort to flushing local DNS caches to get it working.PS: For those that will berate me for believing xxx.com was the real domain, don't bother. I know it's bogus, but my point is to leave in the real domains otherwise the help is limited. I hate guessing as much as the next guy. Use the real domains people.ShareImprove this answer
Follow
edited Oct 19, 2014 at 22:53
answered Oct 19, 2014 at 22:48millimilli1,8701111 silver badges88 bronze badgesAdd a comment | |
DNS caching not clearing Mac OSX | macos;google-chrome;dns;macos;google-chrome;dns | DNS caching not clearing Mac OSX
Ask Question
|
1
It sounds like it's being cached by the DNS server at 10.0.0.1 (probably your router). There are two potential levels of caching involved, and flushing one of them doesn't affect the other. Let me run through the options:dig +trace domainname.com traces the DNS query through authoritative servers, in your case getting the final answer from 66.117.5.83.dig domainname.com just sends the query to the DNS server configured in your network settings (in your case 10.0.0.1). This is usually just a caching server, which will remember results it's looked up before, and hand out the same answer until its time-to-live expires (in xxx.com. 3174 IN SOA dns1.registrar-servers.com..., it has 3174 seconds to go).Using the domain with normal (non-DNS-oriented) programs like Chrome go through OS X's resolver, which checks its cache (same TTL policy applies here), and if it's not there checks the configured DNS server (remember that that's probably a caching server).Resetting the OS X cache doesn't affect the cache at the DNS server. Also, note that even if you reset your DNS server (e.g. by rebooting your router), other DNS servers throughout the net may still have the old info cached. In general, when you make a DNS change, you have to wait for the TTL to expire before assuming the new info is available everywhere.(And actually, there's another level you have to worry about -- your secondary DNS servers only check the primary server for updates periodically, so you have to wait for the secondary to update, THEN for the TTL to expire all the old info out of various caches...)ShareImprove this answer
Follow
answered Oct 19, 2014 at 18:03Gordon DavissonGordon Davisson33.4k55 gold badges6464 silver badges7070 bronze badgesAdd a comment | ;
0
All working fine far as I can tell. The domain xxx.com seems to be synchronized and working just fine. Also noticed you used dig http://www.xxx.com. Dig dosen't understand URLs, try with just the domain name part, dig www.xxx.com, so you get a correct response.$ dig www.xxx.com; <<>> DiG 9.9.5-3-Ubuntu <<>> www.xxx.com;; global options: +cmd;; Got answer:;; ->>HEADER<<- opcode: QUERY, status: NOERROR, id: 45553;; flags: qr rd ra; QUERY: 1, ANSWER: 1, AUTHORITY: 0, ADDITIONAL: 1;; OPT PSEUDOSECTION:; EDNS: version: 0, flags:; udp: 4096;; QUESTION SECTION:;www.xxx.com. IN A;; ANSWER SECTION:www.xxx.com. 86331 IN A 141.0.173.173;; Query time: 0 msec;; SERVER: ;; WHEN: Sun Oct 19 16:44:50 MDT 2014;; MSG SIZE rcvd: 56Here's the nameserver details.$ checksoa xxx.comSerial # RTT(ms) Version Nameservers (name, IP, SOA mname field) for xxx.com 2014040205 80 not currently available ns4.serverstack.com 69.55.56.130 SOA: ns1.serverstack.com 2014040205111 not currently available ns1.serverstack.com 69.55.62.180 SOA: ns1.serverstack.com 2014040205185 not currently available ns2.serverstack.com 141.0.173.228 SOA: ns1.serverstack.com 2014040205174 not currently available ns3.serverstack.com 87.233.226.25 SOA: ns1.serverstack.comYou may have to clear your local DNS caches if this is not being refreshed. The negative cache TTL is what gets you on newly added records. In this case, the negative TTL is 1800 seconds for xxx.com, so you could just wait that 30 minutes and it'll clear up on it's own.This is a common problem. You make a DNS change to add a new record and then you lookup the name immediately, before it's had a few minutes to propagate to all name servers, so you get a negative cache entry right before it was live and thus have to wait the full time (30 minutes), or resort to flushing local DNS caches to get it working.PS: For those that will berate me for believing xxx.com was the real domain, don't bother. I know it's bogus, but my point is to leave in the real domains otherwise the help is limited. I hate guessing as much as the next guy. Use the real domains people.ShareImprove this answer
Follow
edited Oct 19, 2014 at 22:53
answered Oct 19, 2014 at 22:48millimilli1,8701111 silver badges88 bronze badgesAdd a comment | |
Storage Space Error Inaccessible; Reconnect Drives | windows-8;hard-drive;file-recovery;storage-spaces;windows-8;hard-drive;file-recovery;storage-spaces | Storage Space Error Inaccessible; Reconnect Drives
Ask Question
|
1
+50
The trial version of ReclaiMe Storage Spaces Recovery can fix some metadatacorruption errors.ShareImprove this answer
Follow
answered Oct 21, 2014 at 6:48harrymcharrymc429k2929 gold badges492492 silver badges872872 bronze badgesAdd a comment | ;
1
I had similar problem with my two-way mirror recently, only I had yellow warning and could access my data.I solved it by adding 3rd drive and removing second drive that I knew was bad because of my experiments.After "Repairing" cycle, my Storage pool became green and happy.So my advice to you: if you know which drive of those 2 is bad - replace it with another empty drive, like you would if it failed.If you don't know which one then do this (let's name those drive a and drive b):1) get new empty drive with at least 600Gb (100Gb larger than smallest drive) size (let's name it drive c)2) disconnect drive b.3) connect drive c.4) wait for "Repairing" cycle to finish5) if pool is green go to step 206) disconnect drive a7) disconnect drive c8) get new empty drive with at least 600Gb (100Gb larger than smallest drive) size (let's name it drive d)9) connect drive b10) connect drive d11) wait for "Repairing" cycle to finish12) if pool is green go to step 2013) disconnect drive b14) connect drive c15) wait for "Repairing" cycle to finish16) if pool is green go to step 2017) remember the data loss and never make mirror size bigger than smallest drive size, because you can always increase size of Storage Space and extend size of the Volume that resides on it.18) goto step 2019) mark my answer as accepted20) end of procedureShareImprove this answer
Follow
answered Mar 3, 2015 at 3:35alpavalpav44722 gold badges66 silver badges1616 bronze badges1:) like, especially #19. Unfortunately, as extremely useful as this information is likely to be for some future poor soul, it wouldn't have helped in my situation. I'm 99% sure I tried this idea. Restoring everything to a 3rd drive via ReclaiMe and starting over was my last resort, but it eventually worked.
– Lee RichardsonMar 4, 2015 at 4:01Add a comment | |
How do you swap the primary mouse button via commandline in Windows 8 without a reboot? | windows;windows-8;command-line;mouse;windows;windows-8;command-line;mouse | How do you swap the primary mouse button via commandline in Windows 8 without a reboot?
Ask Question
|
2
Swap mouse buttons from command lineWe can swap mouse buttons by editing the registry value SwapMouseButtons under the registry key HKEY_CURRENT_USER\Control Panel\Mouse. To swap mouse buttons we need to set its value to 1.Same thing can be done from command line using the below command.reg add "HKEY_CURRENT_USER\Control Panel\Mouse" /v SwapMouseButtons /t REG_SZ /d 1It requires a logoff or reboot to make the changes effective.Reference Swap mouse buttons from command line:Alternative SolutionHow do I use Rundll32 to swapmousebutton? for a C# solution (requires the .NET Framework Runtime to be installed)ShareImprove this answer
Follow
edited May 23, 2017 at 12:41CommunityBot1
answered Dec 27, 2014 at 8:39DavidPostill♦DavidPostill149k7777 gold badges343343 silver badges383383 bronze badges31Unfortunately, by doing this, it requires a reboot. Which doesn't work since I want to be able to call this at will during work.
– JonathanDec 27, 2014 at 8:51Please edit your question to include this new requirement... :/
– DavidPostill♦ Dec 27, 2014 at 8:53@JonathanLeaders alternative solution added
– DavidPostill♦ Dec 27, 2014 at 9:02Add a comment | ;
0
I used the text below on windows 10 and saved it as sandbox_mouse_button_swap.wsbDouble-clicking that file opens up the sandbox with the mouse buttons swapped, no reboot required.<Configuration> <LogonCommand> <Command>rundll32.exe user32.dll,SwapMouseButton</Command> </LogonCommand></Configuration>ShareImprove this answer
Follow
edited Sep 15, 2022 at 3:57
answered Sep 15, 2022 at 3:42jt-pdxjt-pdx122 bronze badgesAdd a comment | ;
0
I am no expert at this - I tried both the above solutions but it did not work and so I simply created a .bat file with the following command script, saved it to my Desktop and whenever I want to swap, I double-click the script to make it run and it does the job for me.rundll32.exe user32.dll,SwapMouseButtonShareImprove this answer
Follow
answered Nov 17, 2022 at 13:50VinnyVinny11That's exactly what OP used!
– TotoNov 17, 2022 at 15:13Add a comment | |
Why can't I boot off a USB device on my new PC without getting an error message? | windows-7;boot;usb;drivers | Why can't I boot off a USB device on my new PC without getting an error message?
Ask Question
|
0
If you have a SATA CD drive, you shouldn't need any drivers. It sounds like your motherboard just doens't want to install with a USB. My motherboard had the same problem when I tried to install Windows 7, despite the company saying it would work. Just burn the ISO onto a blank DVD using PowerISO and put it in a SATA DVD drive and then boot your PC. It should attempt to load from the DVD. Windows 7 is easy to install as it has a very visually based installer. From there you can just choose your hard drive, change your partitions and stuff.On boot at the splash screen you can press the F11 key to access your MSI boot menu. From there you should be able to select your usb drive to boot from.If all else fails, chances are you have a really dodgey ISO and should acquire a new oneShareImprove this answer
Follow
edited Dec 28, 2014 at 21:27Moab57.7k2121 gold badges111111 silver badges173173 bronze badges
answered Dec 27, 2014 at 9:06Gaben NewilGaben Newil12211 gold badge11 silver badge66 bronze badges1My CD drive is USB. Therefore I can not use it until the drivers are installed.
– user328783Dec 27, 2014 at 11:22Add a comment | ;
0
Ok, so after a while I discovered the problem.The issue was with the memory stick that I was using. I installed Ubuntu onto the USB and booted successfully off that so I knew that it was not an issue with the PC. I found that that what fixed my problem was to format the memory stick to NTFS. It is important that you uptick the 'quick format' box if using windows. I formatted the memory stick plenty of times but was only able to boot from it when the box had been untucked and I re-flashed the ISO to the memory stick using the 'Windows USB tool' that can be downloaded by clicking here.Hope that this is helpful to anyone else having issues!ShareImprove this answer
Follow
answered Dec 31, 2014 at 17:07
user328783user328783Add a comment | |
I accidentally update my bluetooth driver, now it won't work | windows-7;drivers;bluetooth;windows-7;drivers;bluetooth | I accidentally update my bluetooth driver, now it won't work
Ask Question
|
0
Okay, this problem has been solved. I reboot my machine, and do the usual thing, uninstall my bluetooth and installed it again with the latest driver, and my bluetooth work again.ShareImprove this answer
Follow
answered Dec 28, 2014 at 20:33YagamiYagami2155 bronze badgesAdd a comment | |
What are the names of my network adapters? (Vagrant related) | networking;virtualbox;bridge;vagrant;networking;virtualbox;bridge;vagrant | What are the names of my network adapters? (Vagrant related)
Ask Question
|
12
In Windows it's a bit messy.What you want to do is to use VBoxManage.exe list bridgedifs to list the possible bridge interface names (the actual names are device names, not connection names which you see in ipconfig output)VBoxManage is probably not in your %PATH% but you can find it in Virtualbox's dir.You also can just copy the device name from Connection Properties in Control Panel. ShareImprove this answer
Follow
answered Jan 17, 2015 at 12:32m1keilm1keil96877 silver badges77 bronze badges3I had to use vboxmanage list bridgedifs in OSX to get the desired interface names. ifconfig does not print the full interface names. Thanks for your help.
– atripesJun 29, 2016 at 7:41Note it's NOT the 'Network' name in VirtualBox manager.
– George M Reinstate MonicaSep 14, 2018 at 22:37If you have git bash installed, you can edit your ~/.bashrc file and add this alias so that you can use vboxmanage without the full path: alias vboxmanage='C:\\Program\ Files\\Oracle\\VirtualBox\\vboxmanage.exe'
– Buttle ButkusAug 18, 2021 at 0:33Add a comment | |
How to update bash on Mac OS X Yosemite | macos;bash;shell;shell-script;bash-scripting;macos;bash;shell;shell-script;bash-scripting | How to update bash on Mac OS X Yosemite
Ask Question
|
16
Your problem is in your first line. You have this:#!/bin/bashwhich explicitly states that the shell script should be ran with the old /bin/bash.What you really want, is this:#!/usr/local/bin/bashto use the new bash from /usr/local/bin.ShareImprove this answer
Follow
answered Dec 27, 2014 at 5:15BenjiWiebeBenjiWiebe8,6541111 gold badges4141 silver badges6464 bronze badges7weird thing, but it actually didn't work. Still same result((( But I'm sure this is a part of a problem
– drew1kunDec 27, 2014 at 8:41Do I need to specify this path somewhere else? In some shell file or something?
– drew1kunDec 27, 2014 at 8:491Maybe the environment is set by the calling shell, i.e. the old Bash? How exactly are you calling your script, @Andrew?
– slhckDec 27, 2014 at 9:261@Andrew, I suspect that your sh is in /bin. brew maybe didn't make a symlink for bash called sh. With your $PATH set correctly, try starting it like this: bash script.sh.
– BenjiWiebeDec 27, 2014 at 21:4011For future reference, you should probably use #!/usr/bin/env bash
– pjvandehaarOct 25, 2015 at 4:19 | Show 2 more comments;
16
Install new bash:brew install bashMake this the default shell:chsh -s /usr/local/bin/bashSet the environment in a script:#!/usr/bin/env bashUsing env will look for Bash in your $PATH and use the first one it encounters. You can see which bash it will use by typing which bash. If it's seeing /bin/bash first, you will need to set your $PATH in ~/.bashrc and /.bash_profile.ShareImprove this answer
Follow
edited Mar 31, 2016 at 22:08Will40311 gold badge44 silver badges1212 bronze badges
answered Feb 12, 2016 at 1:21BenBen26122 silver badges44 bronze badges13If you see "non-standard shell" printed out when using chsh, you will need to update /etc/shells.
– Scott WillekeJun 4, 2016 at 6:34Add a comment | ;
7
As pjv pointed out, you really should use#!/usr/bin/env bashin your scripts everywhere to be portable. E.g. if you try to run your script with#!/usr/local/bin/bashit will fail on most linux systems.ShareImprove this answer
Follow
answered Nov 16, 2015 at 11:39Agoston HorvathAgoston Horvath27333 silver badges77 bronze badgesAdd a comment | |
Install 2.5" drive in 3.5" bay | hard-drive;installation;hard-drive;installation | Install 2.5" drive in 3.5" bay
Ask Question
|
6
I don't know where you are from or whether you can shop online, but in 5 min. of search…:http://www.newegg.com/Product/Product.aspx?Item=N82E16817994085So, I guess they are not that much of a specialty item… (or maybe they aren't, if you go to the more geeky/specialized stores).ShareImprove this answer
Follow
answered Dec 27, 2014 at 1:27PaulJPaulJ1,22011 gold badge2020 silver badges3333 bronze badgesAdd a comment | ;
5
There are two types of adapters for this situation. If you are installing the drive into a drive bay with a built-in connector such as in a server or a removable drive bay that accepts bare drives (rare in desktops), you would need a special adapter that is the size of a 3.5 inch drive and has connectors in the same location as a 3.5 inch drive, but has a spot inside to mount the 2.5 inch drive with separate connectors for that drive. Such adapters are about $15-25 each. Western Digital Velociraptor drives are 2.5 inch drives that come in such an adapter.The other type (likely the kind that you need) are about $5-10. They just have screw holes that fit the 3.5 inch mounting with structural metal or plastic allowing mounting a 2.5 inch drive inside, but have no connectors, so you have to attach your connecting cables directly to the 2.5 inch drive. This type of adapter often comes with SSDs so that they can be mounted in standard cases, which often have 3.5 inch drive bays but not 2.5 inch bays.UPDATE: Some servers such as SuperMicro also have specially-made inserts for their 3.5" drive trays that allow you to mount 2.5" drives in those trays in a way that places the 2.5 inch drive connector exactly where the 3.5" connectors would be. This isn't normally possible due to differences in the locations and sizes of the mounting points, but these trays have extra holes to accommodate both drive types.ShareImprove this answer
Follow
edited Dec 23, 2019 at 16:43
answered Dec 27, 2014 at 4:30JamesJames1,30933 gold badges1111 silver badges1919 bronze badgesAdd a comment | ;
1
You need a standard 3.5 to 2.5 inch adapter plate - hard drive form factors haven't changed since the 1980s. Readily available at any decent computer parts store for a few dollars, Intel includes one in their retail-box SSDs (but not the brown-box products) along with a couple of cables. You will need one extra set of screws but the plate will probably include them.I have several gathering dust if you want to pick them up.ShareImprove this answer
Follow
answered Dec 27, 2014 at 8:36peterpeter25111 silver badge22 bronze badges1Thanks, but I have no idea where you're located! :)
– FrecklefootDec 29, 2014 at 19:10Add a comment | |
Windows Tablet data and power from one USB | usb;battery;hub;splitter;usb;battery;hub;splitter | Windows Tablet data and power from one USB
Ask Question
|
0
Most of the tablet devices gets power from the same usb port at the same time while data transfer take place. You don't need a splitter, the laptop or desktop also serve as the power source for the tablet device. If this is not the case with your tablet, then I think it is an exceptional case. Re check the battery charging status while connected with PC and see your tablet's documentation.ShareImprove this answer
Follow
answered Dec 27, 2014 at 20:54Usman ShamsiUsman Shamsi122 bronze badgesAdd a comment | |
Windows 8 refuses to install on new partition created using Boot Camp | windows-8;mac;osx-lion;boot-camp;windows-8;mac;osx-lion;boot-camp | Windows 8 refuses to install on new partition created using Boot Camp
Ask Question
|
2
It was happened also to me, from my personal experience, I had addressed the problem in that way:Select Boot Camp partition.Click on Drive Option (Advanced).Erase it.Select the new blank partition and click Next to install Windows on it.After login in Windows, you can download Boot Camp driver from Apple and install.ShareImprove this answer
Follow
answered Jan 3, 2015 at 15:44Matteo GuarnerioMatteo Guarnerio12133 bronze badgesAdd a comment | |
Simultaneous failure of 8x SSD's in raid 10 [closed] | hard-drive;ssd;raid;software-raid;hardware-raid;hard-drive;ssd;raid;software-raid;hardware-raid | Simultaneous failure of 8x SSD's in raid 10 [closed]
Ask Question
|
2
The odds of a failure of identical SSD's failing in a RAID10 are higher than one might imagine as you are really relying on tiny differences in manufacturing to provide your robustness, compounded that when SSD drives fail they tend to fail catastrophically. You would be better off to use different drives in each part of the array so they come from different factories and have different failure characteristics - but this is really little more than common sense.Some references with respect of another incorrect poster as per his request for evidence -RAID is available on my "bulk standard" consumer grade Samsung 840 EVOSSD (and, of course, links show this is not atypical here (samsung) and here *for OCD) and see the dump from my (Intel) SSD SMART request for a start) - smartctl -i /dev/sda smartctl 6.2 2013-07-26 r3841 [x86_64-linux-3.13.0-35-generic] (local build) Copyright (C) 2002-13, Bruce Allen, Christian Franke, www.smartmontools.org=== START OF INFORMATION SECTION === Device Model:Samsung SSD 840 EVO 500GB mSATA Serial Number: S1KMNEAF100764Y LU WWN Device Id: 5 002538 844584d30 Firmware Version: EXT41B6Q User Capacity: 500,107,862,016 bytes [500 GB] Sector Size: 512 bytes logical/physical Rotation Rate: Solid State Device Device is: Not in smartctl database [for details use: -P showall] ATA Version is: ACS-2, ATA8-ACS T13/1699-D revision 4c SATA Version is: SATA 3.1, 6.0 Gb/s (current: 6.0 Gb/s) Local Time is: Sat Dec 27 20:34:11 2014 NZDT SMART support is: Available - device has SMART capability. SMART support is: EnabledSoftware TRIM RAID Suport - See here and here.SSD's are prone to failure well before the read/write cycles are up, and typically do so catastrophically (ie the drive stops working, rather than goes read only from too many writes.)ShareImprove this answer
Follow
edited Apr 13, 2017 at 12:14CommunityBot1
answered Dec 27, 2014 at 7:41davidgodavidgo66.4k1212 gold badges9999 silver badges155155 bronze badges6By all due respect - how is this post of yours is settling the score between the OP and his/her friend? Not to mention that SSD is still cutting-edge while HDD is known, old and trusted in homes and in the enterprise? Where am I wrong on SMART, or on TRIM, about less than 80% SSD capacity to be used ON SSDs or about anything else I wrote?
– arch-abitDec 27, 2014 at 8:12What you are describing is the lack of the SSD technology to predict failure - but please read my post. Failure is a defect, end of predicted service live is a published documentation. SSD technology do not currently have SMART.
– arch-abitDec 27, 2014 at 8:17The purpose of SU is technical information, not settling scores. SSD's are not cutting edge, they are mainstream and starting to rival Hard drives in capacity although not price per gig (1tb drives are common in a 2.5" form factor) - for cutting edge look at HP's Memrister technology. I'll add references rebutting your assertions in my post in a few minutes.
– davidgoDec 27, 2014 at 8:20Please look at the OP's dilemma - Which one would you choose for a RAID 10 - SSD or HDD?
– arch-abitDec 27, 2014 at 8:27Can't answer this question - not enough information (ie how much data needs to be stored and whats the risk/speed requirements, bulk reads or lots of small files). SSD's have a lower failure rate the HDD's (about 1-2% per year as opposed to 5% - not when I say failure I mean failure, not end of useful life). And Sorry, but only someone who lacks a grasp of risk mitigation would use drives all from the same batch for both halves of a RAID array when there are easily available alternatives.
– davidgoDec 27, 2014 at 8:43 | Show 1 more comment;
0
The majority of SSD's do not support TRIM in RAID no matter if you use a high-end controller or kernel RAID. Then, SSD's appreciate less than about 80% storage allocation of the total capacity so the drive's firmware is able recondition the allocated data area by replacing higly used sections with new (unallocated) sections. If you use a journaling filesystem then the transparency between RAID and journaling gets more complicated for a kernel (software) RAID, and if you use a controller then some of this might be excluded, at least partially, when and how usage patterns are calculated inside the SSDs - provided that all the SSDs and the controller and the OS fully support each other. I am only guessing here, but I would support YOUR argument against your friend's stance on SSD's versus HDD on RAID. I too prefer HDDs in RAID 1 and up for data redundancy, and SSD's for single drive config or at most RAID 0 where perfomance is the primary goal. Especially when using RAID 10 - perfomance is going to suffer no matter what you are using, but HDDs are going to be a better choice. SSD's are simply amazing at swappping or for paging, provided you allocate no more than 50% of their total storage capacity. When eventually the SSD [edit: wears out, instead of fails - fails means a defect, wears our means reaching a predictable end of service] due to really heavy swapping you only loose some swap or a Windows page file - replace the drive and keep going!By the way, SMART is HDD, not SSD technology, and if your kernel RAID or controller is able to report on it to your OS that is stellar - but SMART has to do with the HDD's health, not with the OS or your config of RAID, or the controller itself.I have no idea about the 'simultaneous failure of 8x' drive, but the answer for that must be somewhere along these lines.ShareImprove this answer
Follow
edited Dec 27, 2014 at 6:18
answered Dec 27, 2014 at 4:36arch-abitarch-abit46533 silver badges1313 bronze badges141Voted down because there are lots of dubious (false) statements and unsupported speculation in this post (including "RAID and TRIM", SMART is HDD not SSD technology, and it does not really answer the question - sorry.
– davidgoDec 27, 2014 at 7:36Thank you - there is nothing more annoying but drive-by down voters, and you are NOT one of them. I appreciate that. Please let us see.
– arch-abitDec 27, 2014 at 7:412Actually SSDs have SMART attributes as well, and the lack of trim in many hardware raid implimentations is well documented. Some citations would be nice.
– Journeyman Geek♦ Dec 27, 2014 at 8:59I do not argue against the lack-of it, I argue for it. S.M.A.R.T for SSD as is now for HDD is a necessity to introduce SSD into an array just the way HDD is now. Of course SSD is the winner, SSD is going to overtake HDD, no contest. Only the fact some people suggest or truly believe that SSD is here and now on the same level. It is not, and their perseverance is a discredit to the potentials to the technological limits of SSD. Seriously - like comparing a kite to a jet fighter. SSD now is the kite, and HDD is the string to fly the thing.
– arch-abitDec 27, 2014 at 9:462It seems you’re misunderstanding something. TRIM is simply a feature a SSD can support. Whether a program or RAID controller or whatever sends the TRIM command is another matter altogether. Whether TRIM works in a RAID array is up to the controller, which has to forward the command to the appropriate array members. Journaling or filesystems are yet another different thing. TRIM is not self-maintenance. It is a command the host can send to the disk, specifying a block range which is to be marked as unused.
– Daniel BDec 27, 2014 at 13:45 | Show 9 more comments |
Why is file transfer speed decreased when copying multiple smaller files? | file-transfer;speed;file-transfer;speed | Why is file transfer speed decreased when copying multiple smaller files?
Ask Question
|
9
When transferring data, if you move one large file, you only have to write the directory entry once and then stream the data and write more or less continuously. When you have many files, you write the directory info, move to the file area and write the data, then go back and write the directory entry for the next file and then move back to the data area and write the data and back and forth. The overhead of moving back and forth adds up.ShareImprove this answer
Follow
answered Dec 27, 2014 at 1:21BlackbeagleBlackbeagle6,6262020 silver badges2525 bronze badgesAdd a comment | ;
8
If you transfer a file, theres an open+read+close at the source, and an open+write+close at the destination, with all the associated attributes (ctime/atime/mtime etc) being created at the destination. Fragmentation (higher seek times) will also affect the datarate. Congestion of e.g. a sata-channel may also be an issue (use a separate ports for each disk, buy a sata card if you run out). Bigger files have longer consecutive reads or writes, and will transfer faster. Im sure there's much more to it. Does this help you?ShareImprove this answer
Follow
answered Dec 27, 2014 at 1:19user400344user40034434611 silver badge44 bronze badgesAdd a comment | ;
2
That's the way windows works, and that's the part HDD are bad at. Usually SSDs are good at copying small files. You can check out benchmarking of HDDs and SSDs about file transfer speeds. But you have to know that other things are in place, like windows is reading first the files, then your antivirus checks them, and then they get written to the new destination folder. Not to mention that when you cut a file, the deletion process is added. So, more files, more "real" time added to copy a bigger number of files.ShareImprove this answer
Follow
answered Dec 27, 2014 at 1:27Erlis D.Erlis D.77866 silver badges1414 bronze badgesAdd a comment | ;
0
Because data which is written to (external) hdd is not cached, but written directly to the hdd, and an usb drive then also has to work the index (fat, allocation table) for every file, so it has to scratch the hdd back and forth from file data to file allocation data. Because if failure when cached, files will be lost, hdd corrupt, etc.Internal drives can be cached. Then it can like burst the files to hdd.In fact they do it to slow you down, like the whole commercial computer business.Further drivers on usb hdd drives are not intelligen, nor is the hdd.People want cheap stuff.Cache settings....Don't they say it on the description of the hdd, no, off course not. They only mention the large file transfer rate.ShareImprove this answer
Follow
edited Jun 13, 2019 at 4:54
answered Jun 13, 2019 at 4:15Gerard WensinkGerard Wensink1122 bronze badges4So, use a zip file.
– Gerard WensinkJun 13, 2019 at 4:15Also try xcopy source destination /q/s from dos command box. For me it goes much(!!!) faster (the old dos commands....) then with windows 10 explorer.
– Gerard WensinkJun 13, 2019 at 5:43codetwo.com/kb/how-to-speed-up-an-external-hdd
– Gerard WensinkJun 13, 2019 at 5:45It's not DOS. DOS has been gone since Windows ME.
– Alan BFeb 2, 2021 at 12:45Add a comment | ;
-1
Think of it like this,The computer is assigned a task to take 10 books (10 files) from point A to point B, If they are individual then the computer needs to get one take it to point B and then come back to point A to pick up the next book and so on. Whereas if it needed to take one big book that was the equivalent weight of the 10 books combined it would take longer to move the book but it will be a quicker process because the computer only makes one trip.ShareImprove this answer
Follow
edited Oct 5, 2018 at 19:50
answered Oct 5, 2018 at 3:50TheLifeHackerTheLifeHacker111 bronze badge11Nice metaphor, but I can't see why the two processes are similar.
– Máté JuhászOct 5, 2018 at 4:01Add a comment | |
Computer is slower on faster network | linux;networking;wireless-networking;internet;internet-connection;linux;networking;wireless-networking;internet;internet-connection | Computer is slower on faster network
Ask Question
|
0
I believe you are mistaking response time with bandwidth. Having quick response time does NOT necessarily translate into higher speed if you do not have the bandwidth to do anything. I'll bet your ISP at home is throttling your total available bandwidth and thus you are getting the results you are seeing.ShareImprove this answer
Follow
answered Jun 14, 2014 at 1:49mdpcmdpc4,40499 gold badges2727 silver badges3636 bronze badges1Thanks for the reply, but you are wrong. There are no problems on other computers or downloading huge torrents.
– Ijustwant2learnJun 14, 2014 at 2:28Add a comment | ;
0
Seems likely that your university network is blocking access to some botnet or virus that's on your computer, and your home network isn't...so you connect at home and (whatever it is) beats your network and computer to death.ShareImprove this answer
Follow
answered Jun 14, 2014 at 3:31EcnerwalEcnerwal5,2141919 silver badges3232 bronze badges1Nope, checked the requests coming from computer (via wireshark)
– Ijustwant2learnJun 14, 2014 at 12:30Add a comment | ;
0
When you "plug in" into the LAN at home that sounds like an ethernet cable. Does the link light on your Buffalo indicate the speed and duplex of your connection 10? 100? 1000? Mbps? Use miitool or ethtool to see the connection status ... maybe your wired at home connection is only connecting at half-duplex. Is your laptop at home also slow when using wireless relatively close to your Buffalo? The router webpage should say how busy it is handling gateway duties. Further, may be a roommate throttled down your laptop at home?Is there an "always on" VPN in order to connect at school? ip route should look altogether different at school than at home. ShareImprove this answer
Follow
answered Jun 14, 2014 at 5:53rjtrjt1,01822 gold badges1414 silver badges1717 bronze badges4It seems it is full-duplex. Also, wireless is fine.
– Ijustwant2learnJun 14, 2014 at 12:21So you confirm your Linux laptop's network performance is fine at home over wireless but exhibits horrible performance over a Cat6 wired ethernet connection. What are the results of 'mii-tool eth0' and 'ethtool eth0'?
– rjtJun 16, 2014 at 21:07eth0: negotiated 100baseTx-FD flow-control, link ok
– Ijustwant2learnJun 17, 2014 at 17:38Turn wireless off on a fast performing machine in the house. Disconnect your Cat5E cable from the back of your laptop and connect it to a machine that performs fine. Leave the cable plugged into the same port on the switch. Does the fast machine become slow? The ethernet patch cable should say CATV, Cat5E, or Cat6. It should not say Cat3 nor CatIII.
– rjtJul 4, 2014 at 7:38Add a comment | |
Why some devices does not require usb driver on Linux, but do on Windows? | linux;windows;usb;drivers;linux;windows;usb;drivers | Why some devices does not require usb driver on Linux, but do on Windows?
Ask Question
|
6
Also you'll find that on Linux, standard distributions (and sometimes kernel builds) tend to include a ton of interesting and specific hardware drivers already, mostly due to contributions by users over time. Windows doesn't really have a way for arbitrary developers to create drivers for common hardware then include it in all new distributions of Windows. It's a different software and distribution model. With Linux a lot of things make there way into the mainstream over time. It's not just that Linux has more "generic" drivers (but this is often true, especially when contributors are interested in writing as wide-scoped drivers as possible rather than vendors writing proprietary drivers for their specific hardware), it just ships with a big collection that people can contribute to and quickly make their way into main distributions, forever.I see all kinds of strange things that ship with Linux. For example, CAN is a serial interface and protocol for use in industrial automation and control. Use is relatively rare, but the kernel that ships with Ubuntu has generic CAN support built-in, and controller card vendor-specific interface kernel modules are shipped with Ubuntu standard. That kind of distribution isn't possible with more controlled operating systems like Windows or OSX. I wouldn't have found out about this had I not worked on a robotics project recently and, much to my surprise, not only were the interface drivers built into the kernel, but modules for my vendor's controller card were also already (surprisingly) included.Off-topic-ish: It's also worth noting that even for drivers that don't ship standard, both OS's are much better about it than they were in the past. Popular Linux distributions have been working hard to make obtaining software as easy as possible in order to stay competitive, so in many cases a driver that isn't already on the system is easily obtainable through a package repository (15 years ago it was a lot harder to get random hardware to work on Linux). Windows, in recent years, has been getting better about having a large repository of drivers available online for automatic download when hardware is attached - these days, at least for me, it is much rarer to encounter "a driver for this device could not be located" on Windows. It will only get better (on all OS's), too. Ease of installation of software and drivers is so ubiquitous today (especially due to advances in "app" style platforms spurred by mobile devices - and now look; you have Ubuntu's Software Center, the Windows 8 Marketplace, the iTunes Store, Google Play, even individual software like Chrome, Firefox, all have new features focused entirely on ease of finding and installing new software) that it's almost expected; it's a bug if you have to hunt around for software, where it used to be a bonus if you didn't. ShareImprove this answer
Follow
edited Jun 13, 2014 at 23:56
answered Jun 13, 2014 at 23:25Jason CJason C10.2k99 gold badges3838 silver badges5757 bronze badgesAdd a comment | ;
0
AFAIK Linux includes all the "drivers" in the kernel, but Windows keeps them separate. So Linux does have drivers but they are already included with the heart of the system. Also Linux uses more generic drivers while Windows has more specific drivers to target certain devices.ShareImprove this answer
Follow
answered Jun 13, 2014 at 22:44p1xelp1xel50022 gold badges44 silver badges1111 bronze badges1Some drivers are included in the kernel, many are built as modules that aren't loaded until they are needed (conceptually equivalent to Windows' DLL-based driver system). Exactly which are built-in vs. included depend on the Linux distribution.
– Jason CJun 14, 2014 at 0:01Add a comment | |
add line number after matched pattern in vim | linux;vim;sed;linux;vim;sed | add line number after matched pattern in vim
Ask Question
|
4
In vim I would add the first line (>1), then create a simple macro which yanks the numbered line, goes down one line, pastes the yank and increments the number. In vim normal-mode commands: yyjpCtrl-a. If you saved the macro to register q, execute it with @q.Assuming the first record is on the first line, you can do it with two invocations of GNU sed like this:sed '=' file | sed 's/^[0-9]/>&/'Or with nl which only numbers lines that contain data:nl file | sed 's/^ *\([0-9]\+\)\t*/>\1\n/'It can be done more intuitively with awk:awk 'NF { print ">" ++i "\n" $0 }' fileOutput in all cases:>1CTACGGTGTGCTCTTCCGATCTGACTATG>2AGTTGGTGTGCTCTCCCGATCTCGCTCCCTC>3GTGAGGTGTGCTCTTCCGATCTCCGGCAGTGTGCTShareImprove this answer
Follow
edited Jun 13, 2014 at 22:50
answered Jun 13, 2014 at 22:34ThorThor6,21411 gold badge3535 silver badges4242 bronze badgesAdd a comment | ;
2
To insert a line number plus a marker that will be used in the next command, you can use something like this::%s/^/\=printf('>%-d ', line('.'))To insert a newline, replace something telltale with "\r". Something very simple such as this should do the job in this case:'<,'>s/ /\rThere are a lot more vim tips at http://vim.wikia.com/wiki/Vim_Tips_WikiShareImprove this answer
Follow
answered Jun 14, 2014 at 0:18user332939user3329392122 bronze badgesAdd a comment | |
Unable to connect to IP-camera | networking;wireless-networking;router;ip;camera;networking;wireless-networking;router;ip;camera | Unable to connect to IP-camera
Ask Question
|
1
If there is any button on the device the manual has to provide reset procedure. It is just how it is done, it is a standard.ShareImprove this answer
Follow
answered Jun 15, 2014 at 20:16user1825608user18256081911 gold badge11 silver badge1212 bronze badges41As mentioned before there is not a reset button on the camera. There is no manual available either.
– hansnJun 15, 2014 at 20:25@hansn Please provide exact model name.
– user1825608Jun 15, 2014 at 22:14I don't have it, but I will see if I can find it somewhere.
– hansnJun 16, 2014 at 5:451It's SinoCam h . 264
– hansnJun 16, 2014 at 14:36Add a comment | ;
1
I experienced a similar problem when wi-fi IP address was set to be the same as the wired IP address. I resolved it by turning the wi-fi radio on the router off and by connecting both computer and the camera by ethernet wires. I was able to access camera's setup page that way and change the wi-fi IP address.ShareImprove this answer
Follow
answered Nov 7, 2014 at 18:46wsokolwsokol1111 bronze badge11This does not answer the question.
– Dave MNov 7, 2014 at 19:02Add a comment | ;
0
Maybe you can download the free "Network scanner" tool from Softperfect. It shows you a list of all connected devices and their IP addresses.Then attach the router only to you PC with an ethernet cable and type the IP into your browser. You should then arrive at the router's internal home page.Hope my answer can help you!ShareImprove this answer
Follow
answered Jul 22, 2014 at 3:04cindy ycindy y1Add a comment | |
Need to extract the text occuring between first two single quotes. | microsoft-excel;microsoft-excel | Need to extract the text occuring between first two single quotes.
Ask Question
|
3
Try this formula:=MID(A1,FIND("'",A1)+1,FIND("'",A1,FIND("'",A1)+1)-FIND("'",A1)-1)ShareImprove this answer
Follow
answered Jun 13, 2014 at 22:02NetlohNetloh25422 silver badges77 bronze badges1My columns are K and M
– user333217Feb 5, 2016 at 14:30Add a comment | |
how to remove soavee on? | google-chrome;browser-addons;google-chrome-extensions;virus-removal;google-chrome;browser-addons;google-chrome-extensions;virus-removal | how to remove soavee on?
Ask Question
|
0
I ended up removing it by reinstalling chrome, with removing all browsing history.ShareImprove this answer
Follow
answered Jun 17, 2014 at 21:13MrFoxMrFox29922 gold badges88 silver badges1919 bronze badgesAdd a comment | |
Linux volume on a Windows dynamic disk | windows;partitioning;windows;partitioning | Linux volume on a Windows dynamic disk
Ask Question
|
0
Although the Windows Disk Management does not allow the resize of dynamic disks,some third party tools claim that ability.Some of the better-known ones are :EaseUS Partition Master (free) - see the article How to resize dynamic volume?AOMEI Partition Assistant (Home version is free but unclear if can resize dynamic disks)AOMEI Dynamic Disk Manager ($36 with trial)If the tools can as advertised shrink the dynamic disk, the resulting unallocated spacecan be used in a new partition.[EDIT1]I still have the feeling you have it backward: I believe that the quoted Microsoft text meant that you create the dynamic disk over the entire physical disk, then allocate a volume in it and use that volume in a non-Windows OS.Some recent Linux distributions understand dynamic disks, but I don't know to what degree. Otherwise you might need to find out which physical sectors are occupied by the volume(s) and mount in Linux as as a raw device (horrifying even if possible).[EDIT2]You wish for a separate RAID for Windows-only, which requires dynamic disks,which are a proprietary Windows format, not well-supported by Linux.Below is an idea for another solution.This solution will require studying and trying - I have never done it and socan't offer a cookbook. The idea is to use an advanced boot manager such as Grub4dos, that can hide/unhidepartitions depending on the OS booted. It can also map partitions and do disk emulation. You might be able to use it to fool Windows into thinking that two partitions on two disks are each the entire disk (Windows will not see the rest of the disk), so you could set up dynamic disks on the two virtual disks without affecting Linux which will be using the rest of the physical disks.ShareImprove this answer
Follow
edited Jun 29, 2014 at 6:52
answered Jun 22, 2014 at 9:18harrymcharrymc430k3030 gold badges493493 silver badges873873 bronze badges13I am not looking to resize dynamic volumes. To clarify, I am interested in shrinking the LDM metadata GPT partition and the LDM content GPT partition to leave room for non-LDM GPT partitions.
– Ivan VučicaJun 22, 2014 at 12:15I don't see the difference. Could you post some information about the partitions on the disk(s) in question, and which ones you would like to reduce and by how much.
– harrymcJun 22, 2014 at 17:22For formatting reasons, I will update the question.
– Ivan VučicaJun 23, 2014 at 18:43Question has been expanded.
– Ivan VučicaJun 23, 2014 at 18:55I now understand better, but I still have the feeling you have it backward: I believe that the quoted Microsoft text meant that you create the dynamic disk over the entire physical disk, then allocate a volume in it and use that volume in a non-Windows OS. Some recent Linux distributions understand dynamic disks, but I don't know to which degree. Otherwise you might need to find out which physical sectors are occupied by the volume and mount it in Linux as as a raw device (horrifying even if at all possible).
– harrymcJun 23, 2014 at 20:22 | Show 8 more comments |
Xcode Header Autocomplete | macos;osx-mountain-lion;autocomplete;xcode;headers;macos;osx-mountain-lion;autocomplete;xcode;headers | Xcode Header Autocomplete
Ask Question
|
0
Fixed it by updating to mavericks (something I've been meaning to do for a long time). It seems that doing so updates the place where headers are stored.ShareImprove this answer
Follow
answered Jun 13, 2014 at 23:161110101001111010100111144 bronze badges1well that's a radical solution to solve that problem
– jokoonJun 6, 2015 at 22:22Add a comment | |
How can I get an email alert after a program is done executing? | email;windows-task-scheduler;events;email;windows-task-scheduler;events | How can I get an email alert after a program is done executing?
Ask Question
|
0
There won't be an event log entry made because the program completed unless the program specifically makes a log entry to announce it's done; which 99% of programs don't do (thankfully).Instead, create a batch file or script (PowerShell is probably easiest) to launch the program, wait until it's done, and then email you.Then run that batch/script instead of running the program directly (either manually or via a scheduled task).ShareImprove this answer
Follow
answered Jun 13, 2014 at 20:36Ƭᴇcʜιᴇ007Ƭᴇcʜιᴇ007111k1919 gold badges198198 silver badges262262 bronze badges2I agree that scripting is easy to implement, in either PowerShell or CMD. However, an alternative worth investigating is NirCmd from NirSoft (nirsoft.net), which has a huge number of options, including launching a command when another completes. There is an advantage is that NirCmd can run without a task-bar presence. There are a number of other very useful utilities on the site, and they are all freeware.
– AFHJun 13, 2014 at 21:45@AFH Seems reasonable, why not add that as an answer? :)
– Ƭᴇcʜιᴇ007Jun 14, 2014 at 17:59Add a comment | ;
0
I agree that scripting is easy to implement, in either PowerShell or CMD.However, an alternative worth investigating is NirCmd from NirSoft, which has a huge number of options, including launching a command when another completes. There is an advantage is that NirCmd can run without a task-bar presence.There are a number of other very useful utilities on the site, and they are all freeware.ShareImprove this answer
Follow
answered Jun 14, 2014 at 21:57AFHAFH17k33 gold badges3030 silver badges4848 bronze badgesAdd a comment | |
Start program, wait until it outputs certain string, then continue | windows-7;script;batch-file;windows-7;script;batch-file | Start program, wait until it outputs certain string, then continue
Ask Question
|
2
If I understood your requirement correctly, then for /f will not work as it waits till inner process ends. You could try to synchronize on the file, like in this example:(this would be your depended scripts file, say wait.bat) : @echo off:looptimeout /t 1(type res.txt |find "trip") > nul 2>&1if errorlevel 1 goto loopecho I can go!start it in cmd window, then open second cmd (same dir) and run (again, as an example):ping localhost |find "trip" >res.txtYou should see 'I can go' only after ping outputs 'trip' (yes it quits shortly after, but your main script/process does not need to) Please also note that normally you would start your main script first! This also ensures that the synchro file gets emptied. You have not said what exactly you need to wait for - maybe there is a more straightforward way of checking that? (eg. using netstat to check open connections)? ShareImprove this answer
Follow
edited Jun 13, 2014 at 22:05
answered Jun 13, 2014 at 21:50wmzwmz7,03211 gold badge2020 silver badges3232 bronze badges5I didn't say what exactly I'm waiting for precisely because I am not interested in answers that try to explore those alternatives. At any rate, thank you for confirming my fears re: FOR /f; I was hoping someone would know of a workaround for that. Anyway, this answer does not help me because I cannot modify the script I'm running (such edits would just get wiped out when the script is updated, and I'm not authorized to push such a change), but I appreciate the information, so +1.
– KRyanJun 13, 2014 at 22:03you do not need to modify it. Put your master (ping in my example) command in one batch file, put your dependent scripts into second batch below the loop (where I put 'I can go') and create third batch which will just start the other two (with start)
– wmzJun 13, 2014 at 22:15sorry even easier: Put your master (ping in my example) command in one batch file, put start myMaster.bat at top of wait.bat, put your dependent scripts below loop (where I put 'I can go')
– wmzJun 13, 2014 at 22:23Ah, I think I see. I cannot test it right at this moment, but I believe this will work. I'll accept once I have confirmed that.
– KRyanJun 13, 2014 at 22:33Thank you, it works perfectly. Took me a it to figure out what you meant put where, but it works.
– KRyanJun 16, 2014 at 16:57Add a comment | ;
0
It sounds like you are using the wrong approach. There are operators which you can use to pipe the output to something, but also to pipe something into a program.The second method will allow you to control a commandline program such as FTP.exe, and by what you're writing, it sounds like this is exactly what you need.Create a textfile that has all the keypresses you need to do yourself, press an enter when an enter is necessary, so each command appears on its own line.For example input.txt:MyUsernameqwertyPasswdy23quitThe above will first enter MyUsername and press enter. Then it will write the second line, etc.Now, start your program and pipe the textfile into it:C:\>ftp.exe <input.txt.A breakdown of the commands:C:\>ftp.exe this is an example of a program you could be running.<input.txt note the < character, this inputs the content of input.txt and treat it as userinput.Note that if the program does not expect keyboard input, the pipe will wait supplying it.ShareImprove this answer
Follow
answered Jun 13, 2014 at 20:02LPChipLPChip57.5k99 gold badges9292 silver badges135135 bronze badges4No, this isn't even remotely what I need. The commands that I issue aren't commands in the first program, but rather separate batch scripts. They just use the connection established by the first program.
– KRyanJun 13, 2014 at 20:11You can also use the output of one script as the input for another. Maybe it still works. In order to do this use the | character. Program1|Program2 where program1's output will be transmitted to the output of program2. (or script in this case)
– LPChipJun 13, 2014 at 21:10I'm not familiar enough with Windows scripting, but how well is that going to work when the first script is outputing multiple lines at separate instances. If the piped script runs as soon as it gets any input, it won't get the string. If it waits for the first script to terminate, that's just not going to happen because it doesn't (and shouldn't) terminate.
– KRyanJun 13, 2014 at 21:14I can't answer that because I have insuffucient knowledge of your script. You should try it out and see what happens.
– LPChipJun 13, 2014 at 22:06Add a comment | |
make default python 2.7 instead of python 2.6 in centos6 | linux;centos;python;linux;centos;python | make default python 2.7 instead of python 2.6 in centos6
Ask Question
|
2
tldr: you don'tPython is one of those things you don't want to mess with too much since important things in your OS rely on it. You could break your system horribly.For testing purposes, you might be able to give the full path to python 2.7 explicitly in your python scripts. This is kinda hacky and dosen't scale. Do only if you know that the production environment will be identical, and other options seem unpalatable. You really want to use virtualenv instead to set up a python environment for your use. There's a few nice things here - it lets you select the version of python you want (and pull in the dependencies for just that environment), doesn't risk hosing important software that relies on python 2.6, and doesn't clobber your whole system since you aren't trying to rewire a system to work in a manner its not designed to.See also pyenv and pythonz for more options - they will let you have an isolated python environment as a user which is pretty coolShareImprove this answer
Follow
answered Mar 8, 2015 at 13:10Journeyman Geek♦Journeyman Geek125k5151 gold badges252252 silver badges418418 bronze badgesAdd a comment | |
Remove particularly tricky items from context menu | windows-7;7-zip;context-menu;windows-7;7-zip;context-menu | Remove particularly tricky items from context menu
Ask Question
|
2
As policy, if something can be done via the registry, I would steer clear of third party apps offering to do the same thing. Freeware apps could be a nice way for a company to promote itself and there are trustworthy ones out there but sometimes, Freeware could also be a way of injecting your PC with a nice piece of spyware for purposes of identity theft and fraud. I've even found fake Open Source projects on SourceForge that were packing spyware. I've uploaded my registry patches for you. It's easier then try to get super user's formatting to play nice.Remove Previous Versions (.reg files)http://www.mediafire.com/download/zy2bnld84k6yc97/Previous_Versions_Remove_and_Restore_Context_Menu.zipI don't know about Cut, Copy, Delete, Rename as I use them and have never had reason to remove them but if I find a way, I'll update my answer. I'm running Win7 x64 sp1 pro. I would make sure the info in the restore .reg file is consistent with the entries in your own Windows registry before merging the delete .reg file (you never know if these things change across version of Windows). Just use the ctrl - F and F3 to search for the code within curly brackets {}.EDIT:Have searched around through the forums, it seems that the consensus is that Cut, Copy, Delete, Rename are not things that have registry values that can be modded (or they are unknown). I did come across a tutorial on how to mod shell32.dll.mui files to remove built in shell entries using Resource Hacker: http://www.sevenforums.com/customization/170036-remove-create-shortcut-file-folder-context-menu.html . That unfortunately requires the installation of 3rd party software for Resource Editing. There is Resource Hacker by Angus J. It's not open source but he's been maintaining the project for 16 years and the latest build has 0 hits on Virustotal.ShareImprove this answer
Follow
edited Mar 23, 2016 at 0:47
answered Mar 22, 2016 at 21:58thebunnyrulesthebunnyrules67088 silver badges1313 bronze badges11"I've uploaded my registry patches for you". Please don't do that. Answers must be self contained. If you can't format correctly someone will help you - please first read Markdown help.
– DavidPostill♦ Mar 22, 2016 at 23:13Add a comment | ;
1
Autoruns is a pretty powerful tool for controlling this sort of thing. Click on the explorer tab. Look for all the sections headed something ending in "ContextMenuHandlers". Untick anything you don't want, bearing in mind it often will appear many times in different sections. I got rid of Avira this way.If you want to remove built in entries, you also need to go to "Options => Filter options => untick hide Microsoft/Windows entries".I don't have myself "Restore previous versions", but it may be related to "Previous versions property page".Cut/copy/delete/rename I expect you are out of luck.ShareImprove this answer
Follow
answered Feb 24, 2016 at 21:52AdamSAdamS28622 silver badges88 bronze badgesAdd a comment | ;
1
How do I remove items from the context menu?Add, Remove, Edit Context Menu items in Windows 7 | 8 lists different context menu editors:Ultimate Windows CustomizerRight-Click Extender for WindowsContext Menu Editor for WindowsContextEdit will allow you easily control the items that appear on your context menu of Windows ExplorerShellExtView or ShellMenuView. They are small utilities that display the list of static menu items that appear in the context menu when you right-click a file/folder in Windows Explorer, and allow you to easily disable or edit unwanted menu items.File Menu Tools lets you add, delete & customize the context menu items of the Windows Explorer.for a fast and easy way to clean up your Window Explorer and Internet Explorer right-click context menu, try MenuMaid.Links are provided for all of these together with additional information and screenshots.ShareImprove this answer
Follow
edited Jan 18, 2017 at 11:40
answered Mar 8, 2015 at 13:33DavidPostill♦DavidPostill149k7777 gold badges343343 silver badges383383 bronze badges2thanks but I had already found this page. The info given there does not enable the "particularly tricky items" I list to be removed. Hence the title of this post, "particularly tricky items".
– mike rodentMar 9, 2015 at 9:38The avira one was probably an install option when you installed avira. You could try a reinstall and see if there is an option you can uncheck
– DavidPostill♦ Mar 9, 2015 at 9:40Add a comment | ;
0
I've found that ShellMenuView and ShellExView are pretty good for editing the context menu.ShareImprove this answer
Follow
answered Mar 14, 2017 at 21:19StevoisiakStevoisiak13k3636 gold badges9595 silver badges150150 bronze badgesAdd a comment | |
Adult websites open on visiting any website in my chrome [duplicate] | google-chrome;virus;malware;google-chrome;virus;malware | Adult websites open on visiting any website in my chrome [duplicate]
Ask Question
|
1
There are way too many possible causes for this. For instance, it could be your system's Proxy settings, though if you're using Microsoft Windows then this would also likely affect MS IE. It may be good to see if Mozilla Firefox experiences the same issue, since Firefox has its own separate proxy settings.An add-on could cause this. Resetting customized settings wouldn't be likely to "fix" this if the add-on is still installed. Removing add-ons might. Re-installing Chrome might.If info is being inserted by an external device (e.g. from a hacked router, or incorrect DNS settings that cause your traffic to go through a MITM) then this would probably not be limited to Chrome.Anti-Virus software may detect malware that is affecting things.So I've now mentioned multiple different approaches to possibly fix this, because there are multiple possible causes. I expect that I haven't listed every possibility of what is causing this, but since there are so many things that could cause such an issue, we may need more details to figure out what's wrong (if the above steps don't help to more clearly identify the problem).ShareImprove this answer
Follow
answered Mar 8, 2015 at 13:02TOOGAMTOOGAM15k33 gold badges4040 silver badges5858 bronze badges11This same virus is in all my vireless devices, Laptop, Andorid Tablet (Nexus 7), Phone (Nexus 5)
– PiyushMar 8, 2015 at 13:52Add a comment | |
How to prevent additions to Chrome search engines (not just default) | google-chrome;search-engines;google-chrome;search-engines | How to prevent additions to Chrome search engines (not just default)
Ask Question
|
6
There is an extension that prevents additions to the list:Don't Add Custom SearchUnfortunately, Chrome doesn't appear to offer a built-in way to disable this."You can't disable this feature. Google wanted to make things simple so that users don't have to manually add search engines. Power users might not like this feature, but there's no way to disable it."Source: Google Chrome Help Forum : How do I disable automatic add of new search engines?ShareImprove this answer
Follow
edited May 23, 2020 at 20:51Adrià Vilanova10311 silver badge66 bronze badges
answered Mar 17, 2017 at 16:08Ray LiRay Li17611 silver badge44 bronze badges3While this link may answer the question, it is better to include the essential parts of the answer here and provide the link for reference. Link-only answers can become invalid if the linked page changes.
– Donald DuckMar 18, 2017 at 9:14At the moment, this extension doesn't work (github.com/gregsadetsky/chrome-dont-add-custom-search-engines/…), the code was last updated Mar 2016. Still looking for another solution.
– rocketmonkeysSep 19, 2017 at 14:463"Google wanted to make things simple...." which logically excludes a "simple way to disable this bug/feature"
– humanityANDpeaceMay 18, 2018 at 15:33Add a comment | ;
0
The "Don't Add Custom Search" extension is still incomplete. It doesn't cover all heuristics employed by Chrome to determine when to add a custom (other) search. I reviewed this extension in Jan 2018. Revisiting the sites still had them adding their search definition to Chrome. The author came up with some new code. After a couple revisions, I re-reviewed his extension in Aug 2018. It is still flawed. Upon repeated revisits of sites that want to add their search definition, some still succeed - which means this extension fails.I doubt Google is publishing any documentation on what decision tree that Chrome uses to decide when to add a site's search string to the list of "Other search engines". Outsiders have to guess from observed behavior but that means getting the triggers wrong or not catching all of them. As such, only Google can truly provide an option to enable/disable the automatic addition of search engines along with an option, when enabled, to prompt the user instead of automatically adding. Keep sending Google feedback that they screwed up.https://github.com/gregsadetsky/chrome-dont-add-custom-search-engines/commit/aa02ac9760de3bf58d03215067075151e6013368That shows the code for the "Don't Add Custom Search" extensions. Not much there. Looks like we have OpenSearch.org to blame for autodiscovery of search descriptors. From https://en.wikipedia.org/wiki/OpenSearch and https://www.chromium.org/tab-to-search, I wonder if an extension that redefines the application/opensearchdescription+xml MIME type would nullify OpenSearch elements in a web page; however, maybe trying to change this MIME type's definition after the document (page) has already loaded (DOMContentLoaded) would be too late. From the Chromium article, this extension author is using method 2 with an event listener.ShareImprove this answer
Follow
answered Sep 3, 2018 at 22:42VanguardlhVanguardlh11Add a comment | |
Group Chat with persistent members in pidgin | plugins;pidgin;chat;plugins;pidgin;chat | Group Chat with persistent members in pidgin
Ask Question
|
3
I already found the trick! :-DMaybe I should have waited some minutes. But I don't delete the question since I think maybe it can help some people in the future.The trick is once the creator creates the chat, other people should also create a chat with the same name; they will join to the original one and no new room will be made. Then everyone can see this chat in his/her list and can set both Auto-Join and Persistent properties. ShareImprove this answer
Follow
answered Mar 8, 2015 at 12:23Zeinab AbbasimazarZeinab Abbasimazar19522 silver badges1313 bronze badgesAdd a comment | |
Overriding DNS in peer-peer fashion | linux;networking;dns;linux;networking;dns | Overriding DNS in peer-peer fashion
Ask Question
|
0
Sounds like Avahi (Multicast DNS) could be what you’re looking for. In combination with nss-mdns, you can use its FQDN host names just like any other DNS host name. Packages should be available for just about every Linux distribution out there.To enable nss-mdns, you need to edit /etc/nsswitch.conf so the hosts: line looks like this:hosts: files mdns4_minimal [NOTFOUND=return] dns mdns4After enabling both the Avahi daemon and nss-mdns, you should be able to connect to a machine with host name my-machine like this:sftp my-machine.localShareImprove this answer
Follow
answered Mar 8, 2015 at 12:46Daniel BDaniel B56.9k99 gold badges115115 silver badges151151 bronze badges2Thanks - this seems to work locally, I don't have my second device on me right now. nss-mdns seems to be a plugin (libnss-mdns). The avahi documentation isn't great - no examples, or similar that I can find. Manpages are terse at best. Thanks again for the advice! I'd looked at avahi, but hadn't understood how to use it. I assume that for mdns to work, I need to enable it in nsswitch.conf on all devices, not just the one I want to be able to resolve from? lastly, the .local seems to be compulsory. avahi-resolve wont resolve without it, even though its not part of the computer's host name.
– user425952Mar 8, 2015 at 14:39Generally, you don’t need to configure anything at all with Avahi. Except when you want to advertise services. About .local: It is part of the host name—the fully qualified host name. You need to edit nsswitch.conf only on devices where you want to be able to resolve host names from all programs.
– Daniel BMar 8, 2015 at 16:09Add a comment | ;
0
If you're actually on the same subnet, why not alias the network interface and configure the alias with a static IP address that would be on the same subnet? Pick something completely different, so if they're using 10.0.0.0/8, use 192.168.0.0/24 or something. Assuming that peer to peer switching is enabled on the network edge that should just work. Assuming you're not wireless, of course. If you are wireless, can you set up an ad-hoc wireless network? Some network cards allow you to join multiple networks at once. Not sure if you can join an ad-hoc and a normal one at the same time, though.Then you can just add the ip address of the other machine to the /etc/hosts file.ShareImprove this answer
Follow
edited Mar 8, 2015 at 12:24
answered Mar 8, 2015 at 12:17Bacon BitsBacon Bits6,53511 gold badge2121 silver badges2121 bronze badgesAdd a comment | |
Midnigh Commander rendering fail in CygWin, Windows 8 and ConEmu (or Console) | windows-8;terminal;cygwin;conemu;console2;windows-8;terminal;cygwin;conemu;console2 | Midnigh Commander rendering fail in CygWin, Windows 8 and ConEmu (or Console)
Ask Question
|
1
Your reference to your LANG setting solved it for me. I got:$ localeLANG=de_DE.UTF-8LC_CTYPE="de_DE.UTF-8"LC_NUMERIC="de_DE.UTF-8"LC_TIME="de_DE.UTF-8"LC_COLLATE="de_DE.UTF-8"LC_MONETARY="de_DE.UTF-8"LC_MESSAGES="de_DE.UTF-8"LC_ALL=Starting mc with LANG=C mc fixed it for me. You might want to set this into your .bashrc or .profile.ShareImprove this answer
Follow
answered Mar 31, 2015 at 10:21Benjamin MarwellBenjamin Marwell20011 silver badge1111 bronze badges2It doesn't work(
– user1248256Sep 16, 2015 at 15:52It's been some time. Conemu might have changed since then.
– Benjamin MarwellSep 16, 2015 at 19:23Add a comment | ;
0
Seems like your mc/cygwin installation is broken. The origin of the problem is the fact "mc is trying to write utf-8 to console". But it hasn't properly prepared it.The problem don't relate to ConEmu or Console2. If you run mc from Win+R you will get the same result. Check your cygwin/mc configs, refer to their manuals or contact with their developers.BTW, I have no problems with mc in my trst box. So I can't say what is wrong in your settings. It will be interesting to get information about it if you solve the problem.ShareImprove this answer
Follow
answered Mar 8, 2015 at 13:09MaximusMaximus20.5k1616 gold badges9090 silver badges115115 bronze badges22Inside standard Cygwon terminal emulator, mintty, everything works good. Locale settings are completely equals, ru_RU.UTF-8. Could you help me with debug it?
– Artur EshenbrenerMar 8, 2015 at 18:10mintty works completely different than expected in Windows. wiki. So you can't compare mintty with ConEmu. The only valid comparison will be, as I've said before, with mc started from Win+R.
– MaximusMar 8, 2015 at 23:53Add a comment | |
Should I trust a hard drive from a dropped laptop, that spontaneously started working again? | hard-drive;laptop;hard-drive-failure;hard-drive;laptop;hard-drive-failure | Should I trust a hard drive from a dropped laptop, that spontaneously started working again?
Ask Question
|
4
You wouldn't trust someone who told you, "Hey, I put a dent in your car," and then later told you, "Oh, never mind, your car is fine."We should identify what lied, since the laptop couldn't boot, and then it could.Before doing so, I must emphasize: It it good practice to make backups anyway.There are two suspects:The driveThe components relating to the drive (SATA connection, motherboard)1. The driveThere could be drive damage that hasn't manifested itself in S.M.A.R.T. because the damaged areas haven't been discovered by the drive yet. You wouldn't know unless the damaged sectors were being read from or written to.2. The components relating to the driveIt is also possible that the drive is completely fine, but perhaps a connection to the drive has been flaky. If this is happening, I would just open the laptop to make sure the cables to the drive are secure.Probable CauseYour sister's laptop indicated that there was a "disk read error", which would have triggered a S.M.A.R.T. attribute to increment if the disk itself reported the issue, but you discovered that there were no S.M.A.R.T. errors. This might mean that the laptop was unable to connect to the drive entirely, which could have triggered the "disk read error".ConclusionThe drive is likely fine, but always make sure you or your sister has a backup and recovery plan as a precaution.ShareImprove this answer
Follow
edited Mar 8, 2015 at 3:57
answered Mar 8, 2015 at 3:27DeltikDeltik19.1k1717 gold badges7171 silver badges114114 bronze badges2I've seen the problem described in the last paragraph. As you said, @Deltik, the HD never logs a S.M.A.R.T. error because it never got the read command in the first place. The drive might well be fine (laptop HDs are amazingly robust); the problem could be an intermittent on the laptop's motherboard. But you can't prove it from a few boots.
– Jamie HanrahanMar 8, 2015 at 3:52As little as i know about laptop hard drives, they are supposed to have a built in shock/drop detection system, that parks the head, and stops the drive. If the drive had been disabled from a shock, via a logic curcuit, it could be that a full power cycle (battery depleted) reset the shock system. Whatever, still the best advice is all here, a proper backup of everything covers it all.
– PsycogeekMar 8, 2015 at 4:19Add a comment | |
Why would a solid wallpaper cause a Windows PC a long time to login? | windows-7;desktop-customization;windows-7;desktop-customization | Why would a solid wallpaper cause a Windows PC a long time to login?
Ask Question
|
1
Simple solutions:There is a Hot Fix available (Thanks to magicandre1981 ).Change the wallpaper from solid colour to an image that has a solid colour. Another Solution(Requires editing Windows Registry): Configure the value of the DelayedDesktopSwitchTimeout registry entry. This value determines the time-out interval of a session before Windows 7 or Windows Server 2008 R2 switches between sessions.To configure the value of the DelayedDesktopSwitchTimeout registry entry, follow these steps:Click Start button, type regedit in the Search programs and files box, and then press ENTER.Locate the following registry subkey:HKEY_LOCAL_MACHINE\SOFTWARE\Microsoft\Windows\CurrentVersion\Policies\SystemDouble-click the DelayedDesktopSwitchTimeout registry entry. In the Value data box, type 5, and then click OK.This answer is reproduced from this Microsoft support article.ShareImprove this answer
Follow
edited Jul 17, 2015 at 11:46Dave25.3k1010 gold badges5454 silver badges6969 bronze badges
answered Jul 17, 2015 at 9:35RogUERogUE3,44199 gold badges3434 silver badges5656 bronze badges0Add a comment | |
Issues splitting a video into multiple, less than 10 second parts when using FFmpeg | linux;video;ffmpeg;video-editing;linux;video;ffmpeg;video-editing | Issues splitting a video into multiple, less than 10 second parts when using FFmpeg
Ask Question
|
1
I'm pretty sure your video has a GOP length of (at least) 10 seconds. In other words, there's an IDR frame (I frame where the decoder can start independent of other frames) only every 10 seconds. That means ffmpeg cannot split the video into shorter segments, because segments must start with an IDR frame. To overcome that you will have to re-encode the video stream, setting a fixed GOP length, e.g. every second for a 24 fps video:ffmpeg -i input -c:v libx264 \-r 24 -x264opts keyint=24:min-keyint=24 -crf 19 \out.mp4Of course you can also do the splitting directly instead of outputting to out.mp4.Set the CRF to control the quality – check H.264 encoding guide for more info.ShareImprove this answer
Follow
edited Mar 10, 2015 at 18:17
answered Mar 10, 2015 at 7:27slhckslhck218k6767 gold badges591591 silver badges578578 bronze badges4thanks, that sounds logical. Is there a way to re-encode the videos if they are of a shorter duration and still split them?
– BharatMar 10, 2015 at 18:14Sure, just set the keyframe interval accordingly – see my updated answer.
– slhckMar 10, 2015 at 18:17I get this error when I run the above command, is it because the output settings are incorrect, or something I am mis-interpreting "Error while opening encoder for output stream #0:0 - maybe incorrect parameters such as bit_rate, rate, width or height"
– BharatMar 10, 2015 at 18:30Please show the full, uncut commandline output (post it on Pastebin or something)
– slhckMar 10, 2015 at 18:50Add a comment | |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.