texts
list
meta
dict
scores
list
avg_score
float64
0
1
num_sents
int64
1
118k
[ "This is a very good synopsis of the gas crimes trials in California. ", " Please \nnote comments of Assembly Republican John Campbell---perhaps the sole bright \nspot in the California Legislature...\n\nCompeting evidence clouds Calif. investigation\n\nPrompted in part by the California Public Utilities Commission, the \nCalifornia Assembly\nhas been scrutinizing the role that interstate pipelines have played in the \nstate\u0001,s current\nenergy crisis. ", "In the efforts to find a smoking gun, legislators have leaned \nheavily on a\nreport prepared by The Brattle Group, a consultancy commissioned by utility \nSouthern California\nEdison to dig up evidence of market power abuse.", "\n\nBut the state\u0001,s biggest transporter of gas to California -- El Paso Natural \nGas -- is not\nready to take the rap. ", "The pipeline has commissioned its own study, which it \nrecently presented\nas evidence that it has not circumvented any laws or regulation.", "\n\nAs reported in both the trade press and national media, SoCal Ed and the CPUC \nare pointing\nthe finger of blame at El Paso for alleged manipulation of California border \nprices through\naffiliate deals and capacity hoarding. ", "And exhibit A in their case against El \nPaso is The Brattle\nGroup\u0001,s study of the California market.", "\n\nRichard Zeiger, a spokesman for Assembly Member Darrell Steinberg, chairman \nof the\nCalifornia Assembly Judiciary Committee, told Gas Daily that The Brattle \nGroup\u0001,s market\nstudy proved that the surge in gas prices at the California border was not \ncaused by normal\nmarket forces (GD 4/20). ", "His remarks followed an oversight hearing during \nwhich Assembly\nmembers questioned Dynegy and El Paso officials about their involvement in \nthe California\nmarket.", "\n\nEl Paso presented a different version of events to the Assembly. ", "In a report \npresented to\nlegislators, a research group hired by El Paso concluded that a convergence \nof factors, not a\nconspiracy, caused the price run-up.", "\n\nLukens Consulting Group, a Houston-based consultancy, was retained by El Paso \nto conduct\nwork on several fronts. ", "In its study of the California market, Lukens \nconcluded that the\nincreasing convergence of the gas and electricity businesses was one of the \nmain culprits in the\nCalifornia gas price imbroglio.", "\n\nAssemblyman John Campbell, a Republican member of the oversight committee, \nsaid he\n\"didn\u0001,t see any smoking gun\" in either report.", "\n\n\"We had our committee hearing, and we certainly had a lot on the Brattle \nStudy and a little\non the Lukens study. ", "To some degree, I\u0001,m not sure that the California \nlegislature is the best\nplace to adjudicate the differences between these two studies,\" Campbell \nsaid. \"", "I believe FERC\nis looking at this situation \" and it would seem to me that that\u0001,s the \nappropriate place.\"", "\n\nCampbell said that the CPUC had been prodding the California legislature to \ngive support\nto its claims of market power abuse by pipelines. \"", "It\u0001,s being pushed \nbasically by the Public\nUtilities Commission here, which believes that there was collusion\" by \npipeline companies to\npush up gas prices in California, he said.", "\n\nThe CPUC, Campbell suggested, sought satisfaction before the California \nassembly when\nit had failed on the federal level: \"There\u0001,s a concerted effort, not just on \nnatural gas but on other\nthings here in California, for entities and organizations here to point the \nfinger elsewhere for\nthe problems that we\u0001,re having in this state and I think you\u0001,re seeing some \nof that with the\npublic utilities commission.\"", "\n\nWhether either report wins over the public incensed by high natural gas \nprices is a different\nmatter entirely. ", "In the meanwhile, the dueling California market studies seem \nto have taken\non a life of their own.", "\n\nThe Brattle Group Study, for instance, has become the center of a heavily \nlitigated effort to\nforce FERC to compel the release of market data by California market \nparticipants. ", "Following\non a request by SoCal Ed, which said it needed additional data to round out \nThe Brattle Group\nreport, FERC Chief ALJ Curtis Wagner issued subpoenas to the other three \nmajor pipelines that\nserve the state as well as to Sempra Energy Trading.", "\n\nSeveral parties resisted FERC\u0001,s call for market information, saying the \nrequested data\ncontained commercially sensitive information. ", "FERC allowed the discovery \nprocess to move\nforward but only after attaching strict data protection rules restricting \naccess to evidence\n(GD 4/23).", "\n\nCritics of the pipeline industry have already suffered one setback in their \ncase. ", "The commission\nrecently dismissed the CPUC\u0001,s claim that El Paso rigged the auction of a \nlarge block of\npipeline capacity in favor of affiliate El Paso Merchant Energy. ", "In \naddressing the California\nAssembly, representatives of Dynegy said that FERC\u0001,s recent ruling on the \nCalifornia border\ncontroversy obviated the need for more investigation.", "\n\nThe controversy, however, is far from over. ", "FERC last month also ordered a \nhearing into\nwhether El Paso Natural Gas and its affiliates manipulated capacity to drive \nup the price of gas\ndelivered into California (GD 3/29). ", "That hearing is likely to take place \nthis summer. (", "RP00-\n241, et al.) ", "NH\n\n\n\n\n\n\tRob Bradley\n\t04/25/2001 09:13 AM\n\t\t\n\t\t To: Jeff Dasovich/NA/Enron@Enron\n\t\t cc: Alan Comnes/PDX/ECT@ECT, James D Steffes/NA/Enron@Enron, Janel \nGuerrero/Corp/Enron@Enron, Jeff Dasovich/NA/Enron@Enron, Joe \nHartsoe/Corp/Enron@Enron, Karen Denne/Corp/Enron@Enron, Leslie \nLawner/NA/Enron@Enron, Paul Kaufman/PDX/ECT@ECT, Richard \nShapiro/NA/Enron@Enron, Sandra McCubbin/NA/Enron@Enron, [email protected], \nSusan J Mara/NA/Enron@Enron\n\t\t Subject: Re: Some Background on California Gas Price Spikes--The Other Side \nof the Story\n\nHere is the Q&A I will give to Ken on this topic, and I invite any \nimprovements:\n\nQuestion: \"What is your opinion about the study of the Brattle Group (Dr. \nPaul Carpenter) that market power exercised by El Paso and Dynegy exacerbated \nthe natural gas price spike at the California border that contributed to the \nelectricity price spike.\"", "\n\nAnswer: \"I always discount conspiracy theories when prices rise or fall and \nbelieve fundamental forces of supply and demand explain prices in this \ninstance. ", " I will say, however, that the transmission grid must be more open \nand transparent to improve everyone's confidence in the economics behind \nprice formation. ", " Long term contracting in the wholesale commodity market \nshould also reduce speculation about price manipulation.\"", "\n\n- Rob\n\n\n\n\n\n\tJeff Dasovich\n\tSent by: Jeff Dasovich\n\t04/24/2001 06:57 PM\n\t\t \n\t\t To: Richard Shapiro/NA/Enron@Enron, [email protected], James D \nSteffes/NA/Enron@Enron, Paul Kaufman/PDX/ECT@ECT, Leslie \nLawner/NA/Enron@Enron, Joe Hartsoe/Corp/Enron@ENRON, Rob \nBradley/Corp/Enron@ENRON, Janel Guerrero/Corp/Enron@Enron, Karen \nDenne/Corp/Enron@ENRON, Alan Comnes/PDX/ECT@ECT, Sandra \nMcCubbin/NA/Enron@Enron, Susan J Mara/NA/Enron@ENRON\n\t\t cc: \n\t\t Subject: Some Background on California Gas Price Spikes--The Other Side of \nthe Story\n\nLast week, I distributed a presentation that the Brattle Group gave before \nthe California Inquisition (i.e., legislative gas oversight committee looking \ninto the gas price spikes at the Cal border). ", " \n\nThe Brattle Group is a consulting firm that Edison has long used to beat up \non SoCalGas (recall that Edison used to be a big gas customer when it owned \npower plants). ", " Edison \"arranged\" for the Brattle Group to be the star \nwitness at the Cal Leg gas hearing. ", " Their job was to set up El Paso and \nDynegy for the hit at hearings that took place the following day. ", " Their \nmessage was simple (and simplistic):\n\nEl Paso and Dynegy have market power.", "\nThey have used the market power to drive up basis and thus the price of gas \nat the border (to \"obscene\" levels).", "\nThat, in turn, has driven up electricity prices.", "\n\nKen Lay is giving a gas talk tomorrow, and Rob Bradley asked that I provide \nthe alternative view to the Edison/Brattle rant, in the event that he gets \nany questions on the topic. ", " It's attached. ", " Apologies, it's quick and dirty, \nbut it provides the basics.", "\n\nObviously no need for us to defend El Paso or Dynegy, but might be useful to \noffer a more rationale explanation than the one that the California \nLegislature is peddling.", "\n\nFinally, we were also fingered somewhat as culprits at the hearing (the \nCalifornia PUC FERC lawyer claimed that ENA and TW colluded to drive up basis \nwhen ENA controlled a portion of the capacity), but the overriding goal of \nthe hearing was to go after EP and Dynegy.", "\n\nBest,\nJeff" ]
{ "pile_set_name": "Enron Emails" }
[ 0.0005777549231424928, 0.0005877182702533901, 0.0007515973993577063, 0.008398466743528843, 0.0006532976985909045, 0.0008230142411775887, 0.0006331831100396812, 0.0006075302371755242, 0.0006118827150203288, 0.0005684447241947055, 0.0005789773422293365, 0.0005510356277227402, 0.0006768974126316607, 0.000741674390155822, 0.0005825345870107412, 0.0005583410384133458, 0.0006174460286274552, 0.0006612511351704597, 0.0005879236268810928, 0.0005722108180634677, 0.0007130036246962845, 0.0006364034488797188, 0.0006424066377803683, 0.0006072925752960145, 0.0005596412811428308, 0.0005743303336203098, 0.000607255264185369, 0.0006168816471472383, 0.0005558639531955123, 0.0006771748303435743, 0.0006578495376743376, 0.0005617688875645399, 0.0007055339519865811, 0.0008005038253031671, 0.0006438368582166731, 0.0005572739173658192, 0.0005719850887544453, 0.0007283644517883658, 0.0007971460581757128, 0.0007587260333821177, 0.0008703678031452, 0.0007481052889488637, 0.0009485910413786769, 0.0008244522614404559, 0.0006213445449247956, 0.0006944696069695055, 0.010339539498090744, 0.0012815495720133185, 0.0009371560881845653, 0.0006105536012910306 ]
0.001024
50
[ "Perioperative cerebral ischaemia in cardiac surgery and BIS.", "\nA 46-year-old woman was monitored by bispectral index monitoring (BIS) during redo aortic and mitral valve replacement. ", "On release of the aortic cross clamp there was a sudden, severe, unexplained, and sustained fall in the BIS value. ", "Postoperatively, a CT scan was consistent with multiple ischaemic lesions. ", "The lesions were presumed to be due to air embolism. ", "This case suggests that a sudden unexplained and persistent fall in BIS may indicate cerebral ischaemia." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.000703058612998575, 0.0010783353354781866, 0.0006588503019884229, 0.0007507470436394215, 0.000771397550124675, 0.0005838869838044047 ]
0.000758
6
[ "Ileal endogenous amino acid flow response to nitrogen-free diets with differing ratios of corn starch to dextrose in broiler chickens.", "\nAn experiment was conducted to determine response in digestibility of DM and the AA composition of ileal endogenous flow of 26-d-old broilers to nitrogen-free diets (NFD) formulated with different ratios of corn starch to dextrose. ", "A total of four hundred eighty 3-wk-old broiler chickens were used in a 4-d trial to estimate ileal endogenous flow (IEF) of amino acid (AA). ", "The ratios of dextrose to corn starch investigated were 0:849, 283:566, 566:283, or 849:0 for diet numbers 1, 2, 3, or 4, respectively. ", "All diets contained a calculated dietary electrolyte balance of 115 mEq/kg and chromic oxide (5 g/kg) as an indigestible marker. ", "The birds received a standard starter diet from d 1 to 22 posthatch. ", "On d 22 posthatch, all the birds were weighed and allocated to 4 treatments in a randomized complete block design. ", "On d 26 posthatch, birds were asphyxiated with CO2 and ileal digesta was collected. ", "Ileal DM digestibility was lowest in diet 1 (77.9%) and increased as the proportion of corn starch in the diet decreased. ", "The IEF for all the indispensable AA were different (P < 0.01) among diets with the exception of Thr, which was not (P = 0.07). ", "The respective IEF of AA (mg/kg of DMI) in birds fed diets 1, 2, 3, or 4 were 630, 664, 646, or 1,235 for Lys, 173, 172, 177, or 361 for Met, and 68, 74, 70, or 166 for Trp. ", "For the dispensable AA and total AA, IEF of most AA except for Cys and Pro was highest (P < 0.01) in diet 4. ", "Ileal endogenous flow of Pro was not different among diets. ", "Diet 4 had the lowest (P < 0.01) IEF of Cys, whereas there was no difference among other diets. ", "In conclusion, the data from the current study show that the variation in proportion of corn starch and dextrose in a nitrogen-free diet may affect estimates of ileal endogenous flows of N and AA." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.023458516225218773, 0.0011322431964799762, 0.00325910490937531, 0.001199438120238483, 0.0008150339708663523, 0.0015072060050442815, 0.0008448350708931684, 0.003753403900191188, 0.0011795958271250129, 0.0008074509678408504, 0.0007538802456110716, 0.0010754639515653253, 0.0006982992636039853, 0.0012123787309974432, 0.0007002097554504871 ]
0.002826
15
[ "Q:\n\nHow to unite two List and assign result to the third List?", "\n\nI have 3 List<> objects.", "\nList<T> listA = new List<t>();\nList<T> listB = new List<t>();\nList<T> listC = new List<t>();\n\nI need to unite listA and ListB and assign it to ListC:\nList<T> listC = new ListA +ListB;\n\nMy question is how to implement it?", "\n\nA:\n\n List<int> A = new List<int>();\n A.Add(1);\n A.Add(2);\n List<int> B = new List<int>();\n B.Add(3);\n B.Add(4);\n\n List<int> C = new List<int>();\n\n C = A.Union<int>(B).ToList<int>();\n\nA:\n\nUse AddRange:\nList<T> listA = new List<t>();\nList<T> listB = new List<t>();\nList<T> listC = new List<t>();\n\nlistC.AddRange(listA);\nlistC.AddRange(listB);\n\nA:\n\nTry AddRange() this:-\n listC.AddRange(listA);\n listC.AddRange(listB);\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0008503294666297734, 0.000689638196490705, 0.0010521655203774571, 0.003333084052428603 ]
0.001481
4
[ "const stream = require('stream');\nconst PrettyStream = require('bunyan-prettystream')\n\n\nclass StringStream extends stream.", "Writable {\n constructor() {\n super();\n this.chunks = [];\n }\n\n _write(chunk, enc, next) {\n this.chunks.push(chunk);\n next();\n }\n\n toString() {\n return Buffer.concat(this.chunks).toString();\n }\n\n reset() {\n this.chunks = [];\n }\n}\n\nconst testStream = {\n level: 'info',\n stream: new StringStream(),\n}\n\nconst stdoutStream = {\n level: 'info',\n stream: process.stdout,\n}\n\nconst getLogStreams = (name, env) => {\n switch (env) {\n case 'development': {\n const prettyStdOut = new PrettyStream({\n mode: 'pm2',\n lessThan: 'error',\n });\n const prettyStdErr = new PrettyStream({\n mode: 'pm2',\n });\n prettyStdOut.pipe(process.stdout);\n prettyStdErr.pipe(process.stderr);\n return [\n {\n type: 'raw',\n level: 'error',\n stream: prettyStdErr,\n reemitErrorEvents: true,\n },\n {\n type: 'raw',\n level: 'debug',\n stream: prettyStdOut,\n reemitErrorEvents: true,\n },\n ]\n }\n case 'test': {\n return [\n testStream,\n ]\n }\n default: {\n return [\n stdoutStream,\n ]\n }\n }\n}\n\nmodule.exports = {getLogStreams, testStream}\n" ]
{ "pile_set_name": "Github" }
[ 0.0006467432831414044, 0.0024868608452379704 ]
0.001567
2
[ "(If you're still having trouble finding a working download, check the description box to the above video at YouTube. ", "You can also nose around in the Sonic Fan Remix thread at Sonic Retro. ", "The discussion there is pretty lively, too.)", "\n\nNow, my modesty has prevented me from pointing out the fact that I'm the programmer for Sonic Fan Remix. ", "In fact, whenever I mention the game I tend to neglect that fact altogether. ", "It just seemed to be kind of unfair to toot my own horn when it's the beautiful graphics that are the real heart of the game. ", "I didn't want people who read too quickly to get the idea that I was somehow responsible for more than I actually was, which is just the programming.", "\n\nHowever, it's probably common knowledge by now, so I'll take the opportunity to mention a few things about the physics.", "\n\nThere are a few minor changes from classic Sonic physics, which were intentionally made because we thought they were improvements. ", "That said, there is still a fair number of unintentional glitches and unwanted differences. ", "Getting everything to work accurately in a 3D environment is tricky! ", "Rest assured, though, most of these issues are known and will be addressed in later releases. ", "It is just a demo, after all.", "\n\nBut it's a damn good one! ", "So stop listening to me ramble on and go play it already!", "\n\n...Unless you're still waiting for it to download, in which case I'll happily regale you with the story of the time I was stuck in Carnival Night Zone. ", "It was dark, there were over 8 minutes on the clock, and Tails - as usual, when things go bad - was nowhere to be seen..." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0006005063187330961, 0.0006043314351700246, 0.0005776340840384364, 0.0007432983256876469, 0.0005763169610872865, 0.00488848052918911, 0.0006755781942047179, 0.000532178848516196, 0.0006069237715564668, 0.0006853930535726249, 0.0008867933647707105, 0.000553038960788399, 0.0008996932301670313, 0.33868494629859924, 0.06474589556455612, 0.0008564561721868813, 0.0015177029417827725 ]
0.024626
17
[ "[ ]{}\n\n(Running head: [*Optical excitations in PPV family*]{})\n\n[Kikuo Harigaya]{}\n\n[*Physical Science Division, Electrotechnical Laboratory,\\\nUmezono 1-1-4, Tsukuba, Ibaraki 305, Japan*]{}\n\n(Received                                   )\n\n[**Abstract**]{}\\\nComponent of photoexcited states with large spatial extent is investigated for optical absorption spectra of the electroluminescent conjugated polymers by using the intermediate exciton theory. ", "We calculate the ratio of oscillator strengths due to long-range excitons with respect to sum of all the oscillator strengths of the absorption as a function of the monomer number. ", "The oscillator strengths of the long-range excitons in poly([*para*]{}-phenylene) are smaller than those in poly([*para*]{}-phenylenevinylene), and those of poly([*para*]{}-phenylenedivinylene) are larger than those in poly([*para*]{}-phenylenevinylene). ", "Such relative variations are explained by the differences of the number of vinylene units. ", "The oscillator strengths of long-range excitons in poly(di-[*para*]{}-phenylenevinylene) are much larger than those of the above three polymers, due to the increase of number of phenyl rings. ", "We also find that the energy position of the almost localized exciton is neary the same in the four polymers.", "\n\nPACS numbers: 78.66.Qn, 73.61.Ph, 71.35.Cc\n\nIntroduction\n============\n\nThe observation of remarkable electroluminescent properties of the polymer poly([*para*]{}-phenylenevinylene) (PPV) \\[1\\] has attracted physical and chemical research activities. ", "An important recent development is the observation of stimulated emission and lasing from a PPV layer incorporated within an optical cavity \\[2\\]. ", "Lasing has been also proposed in order to explain the band-narrowing observed on high intensity photoexcitation of a composite film of a PPV derivative and nanoparticles of TiO$_2$ \\[3\\]. ", "Therefore, understanding of structures of photoexcited states in PPV and related polymers containing phenyl rings is one of interesting research topics.", "\n\nIn the PPV polymer, the onset of the photocurrents locates at the excitation energy between 3.0 eV and 4.0 eV \\[4,5,6\\], and this energy is significantly larger than both of the optical absorption edge at about 2.0 eV and the lowest peak energy at 2.4 eV. In the previous study \\[7,8\\], we have characterized the extent of photoexcited states of the PPV by using the intermediate exciton theory. ", "When the distance between an electron and a hole is shorter than the spatial extent of the monomer, we have called the exciton as a “short-range\" exciton. ", "When the exciton width is larger than the extent of the monomer, we have called the exciton as a “long-range\" exciton. ", "We have characterized each photoexcited state as “short-range\" or “long-range\". ", "We have shown that a long-range exciton feature starts at the energy in the higher energy side of the lowest feature of the optical absorption of PPV. ", "The energy position is nearly the same as that of the semiconducting energy gap which has been interpreted as the onset of the large photocurrents observed in experiments. ", "Therefore, the presence of photoexcited states with large spatial extent is essential in mechanisms of remarkable photocurrents observed in PPV.", "\n\nThe purpose of this paper is to look at contributions from long-range excitons, which make large effects on photoconduction properties in PPV-related polymers: poly([*para*]{}-phenylene) (PPP), poly([*para*]{}-phenylenedivinylene) (PPD), and poly(di-[*para*]{}-phenylenevinylene) (PDV). ", "The structures of these polymers, namely, PPV family, are illustrated in Fig. ", "1. ", "These polymers are composed of phenyl rings and vinylene CH-dimers. ", "The names of the two polymers and their abbreviations, PPD and PDV, are pseudonyms (tentative names) in this paper, because current common names of these polymers have not been known at present. ", "The long-range excitons are characterized as we have done for PPV in the previous study \\[7,8\\].", "\n\nIn the next section, the theoretical formalism is explained, and the characterization method of long-range excitons is given. ", "The calculated results are reported in §3, and the paper is concluded with a summary in §4.", "\n\nModel\n=====\n\nWe consider the following model with electron-phonon and electron-electron interactions. ", "H &=& H\\_[pol]{} + H\\_[int]{},\\\nH\\_[pol]{} &=& - \\_[i,j ,]{} ( t - y\\_[i,j]{} ) ( c\\_[i,]{}\\^c\\_[j,]{} + [h.c.]{} ) ", "+ \\_[i,j ]{} y\\_[i,j]{}\\^2,\\\nH\\_[int]{} &=& U \\_[i]{} (c\\_[i,]{}\\^c\\_[i,]{} - ) (c\\_[i,]{}\\^c\\_[i,]{} - )\\\n&+& \\_[i,j]{} W(r\\_[i,j]{}) (\\_c\\_[i,]{}\\^c\\_[i,]{} - n\\_[el]{}) (\\_c\\_[j,]{}\\^c\\_[j,]{} - n\\_[el]{}). ", "In eq. (", "1), the first term $H_{\\rm pol}$ is the tight binding model along the polymer backbone with electron-phonon interactions which couple electrons with modulation modes of the bond lengths, and the second term $H_{\\rm int}$ is the Coulomb interaction potentials among electrons. ", "In eq. (", "2), $t$ is the hopping integral between the nearest neighbor carbon atoms in the ideal system without bond alternations; $\\alpha$ is the electron-phonon coupling constant that modulates the hopping integral linearly with respect to the bond variable $y_{i,j}$ which measures the magnitude of the bond alternation of the bond $\\la i,j \\ra$; $y_{i,j} > 0$ for longer bonds and $y_{i,j} < 0$ for shorter bonds (the average of $y_{i,j}$ is taken to be zero); $K$ is the harmonic spring constant for $y_{i,j}$; and the sum is taken over the pairs of neighboring atoms. ", "Equation (3) is the Coulomb interactions among electrons. ", "Here, $n_{\\rm el}$ is the average number of electrons per site; $r_{i,j}$ is the distance between the $i$th and $j$th sites; and W(r) = is the parametrized Ohno potential. ", "The quantity $W(0) = U$ is the strength of the onsite interaction; $V$ means the strength of the long-range part ($W(r) \\sim aV/r$ in the limit $r \\gg a$); and $a = 1.4$Å  is the mean bond length. ", "The parameter values used in this paper are $\\alpha = 2.59t$/Å, $K=26.6t$/Å$^2$, $U=2.5t$, and $V=1.3t$. They have been determined by comparison with experiments of PPV, and have been used in \\[7,8\\]. ", "Most of the quantities in the energy units are shown by the unit of $t$ in this paper.", "\n\nExcitation wavefunctions of the electron-hole pair are calculated by the Hartree-Fock approximation followed by the single excitation configuration interaction method. ", "This method, which is appropriate for the cases of moderate Coulomb interactions – strengths between negligible and strong Coulomb interactions – is known as the intermediate exciton theory in the literatures \\[7,8\\]. ", "We write the singlet electron-hole excitations as |, = (c\\_[, ]{}\\^c\\_[, ]{} + c\\_[, ]{}\\^c\\_[, ]{} ) | g , where $\\mu$ and $\\lambda$ mean unoccupied and occupied states, respectively, and $| g \\rangle$ is the Hartree-Fock ground state. ", "The general expression of the $\\kappa$th optical excitation is: | = \\_[(,)]{} D\\_[,(,)]{} | , . ", "After inserting the relation with the site representation $c_{\\mu,\\sigma} = \\sum_i \\alpha_{\\mu,i} c_{i,\\sigma}$, we obtain | = \\_[(i,j)]{} B\\_[,(i,j)]{} (c\\_[i,]{}\\^c\\_[j,]{} + c\\_[i,]{}\\^c\\_[j,]{} ) | g , where B\\_[,(i,j)]{} = \\_[(,)]{} D\\_[,(,)]{} \\_[,i]{}\\^\\* \\_[,j]{}. ", "Thus, $|B_{\\kappa,(i,j)}|^2$ is the probability that an electron locates at the $i$th site and a hole is at the $j$th site.", "\n\nWe shall define the following quantity: P\\_= \\_[i M]{} \\_[j M]{} |B\\_[,(i,j)]{}|\\^2, where $M$ is a set of sites within a single monomer, in other words, a set of carbon sites included in the brackets of each polymer shown in Fig. ", "1. ", "When $P_\\kappa > 1/N_{\\rm m}$ ($N_{\\rm m}$ is the number of monomers used in the calculation of periodic polymer chains), the electron and hole favor to have large amplitudes in the same single monomer. ", "Then, this excited state is identified as a short-range exciton. ", "On the other hand, when $P_\\kappa < 1/N_{\\rm m}$, the excited state is characterized as a long-range exciton. ", "This characterization method is performed for all the photoexcited states $| \\kappa \\rangle$, and a long-range component in the optical absorption spectrum is extracted from the total absorption. ", "In the next section, numerical results are to be reported and discussion will be given.", "\n\nLong-range excitons in PPV family\n=================================\n\nPPP and PPV\n-----------\n\nWe discuss properties of photoexcited states in PPP \\[Fig. ", "1 (a)\\] and PPV \\[Fig. ", "1 (b)\\] in this subsection. ", "Numerical results of PPV have been shown in refs. ", "\\[7,8\\] already, but they are shown again comparing with the results of PPP. ", "Figures 2 and 3 show optical absorption spectra and long-range component of the oscillator strengths for PPP, and Figs. ", "4 and 5 show results of PPV.", "\n\nFigures 2 (a) and (b) show anisotropies of the optical absorption of PPP. ", "The electric field of light is parallel and perpendicular to the polymer axis in Figs. ", "2 (a) and (b), respectively. ", "The thin lines show the contributions from long-range excitons. ", "In Fig. ", "2 (a), there are two features centered around about $1.4t$ and $2.5t$. The former comes from optical excitations between the highest occupied molecular orbital (HOMO) and the lowest unoccupied molecular orbital (LUMO). ", "The HOMO and LUMO have certain magnitudes of dispersions near the Brillouin zone center, and therefore the excitons near the energy $1.4t$ have an appreciable long-range component. ", "In fact, we observe a peak due to long-range excitons around the energy $1.8t$. On the other hand, the feature around $2.5t$ is due to transitions between spatially localized band states \\[9\\]. ", "So, this feature does not have an appreciable long-range component in the higher energy side of the peak. ", "Next, we discuss the case with perpendicular electric field shown in Fig. ", "2 (b). ", "There is a feature at $2.2t$, whose long-range exciton component exists at the higher energy side. ", "In higher energies than this feature, several transitions are mixed, and the long-range component is dominant in energies larger than $3.0t$. Figure 2 (c) shows the absorption spectra where the direction of the electric field of light is orientationally averaged. ", "We find that two features around $1.4t$ and $2.5t$ in the parallel electric field case give the central two peaks in the spectra. ", "The features in the perpendicular field case overlap with the lower and higher energy sides of the dominant feature around $2.5t$.\n\nFigure 3 summarizes the long-range component of the oscillator strengths of PPP. ", "It is shown as a function of the PPP monomer number $N_{\\rm m}$. The squares are for the total absorption. ", "The circles and triangles indicate the data for the cases with the electric field parallel and perpendicular to the polymer axis, respectively. ", "Generally, the long-range component of the perpendicular electric field case is larger than that of the parallel field case. ", "It seems that the long-component of the orientationally averaged spectra saturates at approximately 7 % near $N_{\\rm m} = 20$. Note that the small fluctuation of the plots with respect to $N_{\\rm m}$ is due to the numerical calculation errors, and is not an intrinsic behavior. ", "Such numerical fluctuations have also been seen in our previous work of PPV \\[7,8\\]. ", "Readers are suggest to look at the overall variations of the long-range component with respect to $N_{\\rm m}$.\n\nNext, we compare the results of PPP with those of PPV. ", "Numerical absorption spectra are shown in Fig. ", "4, and their long-range component is shown in Fig. ", "5. ", "The results have been already reported in \\[7,8\\], but they are shown again in order to compare with results of the other polymers. ", "Comparing Fig. ", "2 with Fig. ", "4, we observe that peak structures of PPP and PPV are similar at the first glance. ", "However, there is a quantitative difference: the oscillator strengths of the lowest excitation in Figs. ", "4 (a) and (c) are larger in PPV than those of PPP. ", "The long-range component of the lowest exciton is larger in PPV, too. ", "This fact reflects in the larger saturated value of the total long-range component of PPV shown in Fig. ", "5 than that of PPP shown in Fig. ", "3.", "\n\nAs noted in ref. ", "\\[9\\], the lowest optical excitations of PPP and PPV have characters like those of excitons in a simple prototype polymer: [*trans*]{}-polyacetylene. ", "The band structures of polyacetylene are well described by the Su-Schrieffer-Heeger (SSH) model \\[10\\]. ", "The quasiparticle band structures have finite dispersions at the top (bottom) of the valence band (conduction band). ", "Therefore, the lowest exciton owing to these dispersive bands has apparent long-range component at the higher energy side after taking into account of Coulomb interactions among electrons. ", "The lowest excitons of PPP and PPV have just the similar characters, and thus Figs. ", "2 (a) and 4 (a) show the dominant contributions of long-range excitons with respect to the lowest band-to-band optical excitations.", "\n\nThe difference in the polymer structures of PPP and PPV in Figs. ", "1 (a) and (b) is that a vinylene bond is added between phenyl rings of PPP. ", "This is related with the property that electronic structures near the energy gap of PPV have more dispersive characters than those of PPP, and thus the optical excitations owing to these bands will more resemble with those of [*trans*]{}-polyacetylene described by the SSH model. ", "Therefore, the relative oscillator strengths of the lowest excitons of PPV \\[Fig. ", "4 (a)\\] are larger than those of PPP \\[Fig. ", "2 (a)\\]. ", "Also, total long-range component (about 8 %) of PPV (Fig. ", "5) is larger than that (about 7 %) of PPP (Fig. ", "3). ", "We could say that optical excitations of PPV will have photoconductive properties which are stronger than those of PPP.", "\n\nPPD\n---\n\nIn PPD shown in Fig. ", "1 (c), there are two vinylene bonds between the neighboring phenyl rings. ", "In this subsection, we look at the optical properties resulting from electronic structures and excitonic effects of PPD.", "\n\nFigure 6 shows the optical absorption spectra, when the electric field of light is parallel to the polymer axis \\[Fig. (", "a)\\], perpendicular to the polymer \\[Fig. (", "b)\\], and is averaged over orientations \\[Fig. (", "c)\\]. ", "Long-range exciton contributions are also shown in these three figures. ", "When the electric field is along with the polymer axis \\[Fig. ", "6 (a)\\], the oscillator strengths of the lowest exciton around the energy $1.2t$ are dominant. ", "This feature has its long-range component at the higher energy side. ", "There is a small feature around the energy $2.5t$. The oscillator strengths of this feature becomes relatively smaller than those of PPV shown in Fig. ", "4 (a). ", "The lowest exciton feature becomes larger than that of Fig. ", "4 (a). ", "This comes from the larger number of vinylene units in PPD than that of PPV. ", "When the electric field is perpendicular to the polymer \\[Fig. ", "6 (b)\\], the overall spectral shape is similar to that in Fig. ", "4 (b). ", "Figure 6 (c) shows the orientationally averaged spectra. ", "The lowest exciton feature becomes more dominant from PPP \\[Fig. ", "2 (c)\\], PPV \\[Fig. ", "4 (c)\\], to PPD. ", "The three peak structure from $\\sim 2t$ to $\\sim 3t$ is commonly seen in these three polymers, but their oscillator strengths become relatively weaker.", "\n\nFigure 7 shows the long-range component of PPD as a function of the monomer number $N_{\\rm m}$. The maximum number of $N_{\\rm m}$ is 12. ", "The saturation behavior is seen at smaller $N_{\\rm m}$ than that of PPV, due to the larger dimension of the monomer unit. ", "The long-range component of the perpendicular field case is larger than that of the parallel field case. ", "The long-range component of the orientationally averaged case saturates at $N_{\\rm m} \\sim 10$ with the value of approximately 11 %. ", "This polymer will be more photoconductive than PPV.", "\n\nPDV\n---\n\nIn previous subsections, we have considered the series: PPP, PPV, and PPD, where number of vinylene bonds increases in each monomer unit. ", "There would be another series: PPP, PPV, and PDV \\[shown in Fig. ", "1 (d)\\], where number of phenyl rings increases in the monomer units. ", "We consider optical properties of PDV in this subsection.", "\n\nFigure 8 (a) shows the optical absorption spectra of the parallel electric field case. ", "There are two main features: the lowest exciton peak around $1.0t$ and the almost localized exciton feature around $2.5t$. They are commonly seen in polymers considered in this paper. ", "The broad structure from $\\sim 3t$ to $\\sim 4t$ is due to mixing of high energy transitions among molecular orbitals with large energies in the presence of more phenyl rings. ", "Figure 8 (b) is the spectra where the electric field is perpendicular to the polymer. ", "In contrast to the parallel field case, the spectral shape is rather similar to that of the other polymers. ", "The long-range exciton contributions are remarkable in this case. ", "Figure 8 (c) shows the averaged spectra. ", "The overall shape is like that of PPV shown in Fig. ", "4 (c). ", "There is a distinct lowest feature at around $1.0t$, and three small peaks are present in higher energies. ", "However, the long-range component is larger than that of PPV. ", "This polymer will show the largest photoconductive properties among polymers considered in this paper.", "\n\nFinally, Fig. ", "9 shows the long-range component as a function of the number of monomer units. ", "The long-range component of the perpendicular field case is larger than that of the parallel field case, as clearly seen in Fig. ", "8 (b). ", "The saturated value of the orientationally averaged spectra is approximately 17 %. ", "This is due to the complex molecular orbital structures of PDV. ", "Table I summarizes the long-range component of the four polymers before closing this section.", "\n\nSummary\n=======\n\nWe have considered optical excited states of the electroluminescent polymers which are related with the most famous polymer PPV. ", "We have payed attention to the long-range component of the optical excitations using the intermediate exciton theory. ", "The following is the main conclusions of this paper:\\\n(1) As we go from PPP, PPV, to PPD, the oscillator strengths of the long-range excitons become larger. ", "Such the relative variation is explained by the difference of number of the vinylene bonds in each monomer unit.\\\n(2) The oscillator strengths of long-range excitons in PDV are much larger than those of the above three polymers, due to the increase of number of phenyl rings.\\\n(3) The energy position of the almost localized exciton is neary the same ($\\sim 2.5t$) in the four polymers considered in this paper. ", "The excitation energy of the almost localized exciton is just $2.0t$ in a free electron model \\[9\\] for all the polymers. ", "The enhancement about $0.5t$ originates from the Coulomb interaction part of our model.", "\n\n[**Acknowledgements**]{}\n\nUseful discussion with Y. Shimoi, S. Abe, S. Kobayashi, K. Murata, and S. Kuroda is acknowledged. ", "Helpful communications with S. Mazumdar, M. Chandross, W. Barford, D. D. C. Bradley, R. H. Friend, E. M. Conwell, and Z. V. Vardeny are much acknowledged.", "\n\n[**References**]{}\n\n$[1]$ J. H. Burroughes, D. D. C. Bradley, A. R. Brown, R. N. Marks, K. Mackay, R. H. Friend, P. L. Burns, and A. B. Holmes, Nature [**347**]{}, 539 (1990).\\\n$[2]$ N. Tessler, G. J. Denton, and R. H. Friend, Nature [**382**]{}, 695 (1996).\\\n$[3]$ F. Hide, B. J. Schwarz, M. A. Diaz-Garcia, and A. J. Heeger, Chem. ", "Phys. ", "Lett. [**", "256**]{}, 424 (1996).\\\n$[4]$ K. Pichler, D. A. Halliday, D. D. C. Bradley, P. L. Burn, R. H. Friend, and A. B. Holmes, J. Phys.: ", "Condens. ", "Matter [**5**]{}, 7155 (1993).\\\n$[5]$ D. A. Halliday, P. L. Burn, R. H. Friend, D. D. C. Bradley, A. B. Holmes, and A. Kraft, Synth. ", "Met. [**", "55-57**]{}, 954 (1993).\\\n$[6]$ K. Murata, S. Kuroda, Y. Shimoi, S. Abe, T. Noguchi, and T. Ohnishi, J. Phys. ", "Soc. ", "Jpn. [**", "65**]{}, 3743 (1996).\\\n$[7]$ K. Harigaya, Y. Shmoi, and S. Abe, in [*Proceedings of the 2nd Asia Symposium on Condensed Matter Phytophysics*]{} (Nara, 1996), p. 25.\\\n$[8]$ K. Harigaya, J. Phys. ", "Soc. ", "Jpn. [**", "66**]{}, to be published (1997).\\\n$[9]$ Z. G. Soos, S. Etemad, D. S. Galvão, and S. Ramasessha, Chem. ", "Phys. ", "Lett. [**", "194**]{}, 341 (1992).\\\n$[10]$ W. P. Su, J. R. Schrieffer, and A. J. Heeger, Phys. ", "Rev. B [**22**]{}, 2099 (1980).\\\n\nTABLE I. The component of long-range excitons in four kinds of polymers for which we calculated.", "\n\n polymer long-range component\n --------- ----------------------\n PPP 7 %\n PPV 8 %\n PPD 11 %\n PDV 17 %\n\n[**Figure Captions**]{}\n\nFig. ", "1. ", "Lattice structures of the electroluminescent polymers studied in this paper. ", "The abbreviations, PPD and PDV, are pseudonyms.", "\n\nFig. ", "2. ", "Optical absorption spectra of the PPP. ", "The polymer axis is in the $x$-$y$ plane. ", "The electric field of light is parallel to the chain and in the direction of the $x$-axis in (a), and it is perpendicular to the axis and is along with the $z$-axis in (b). ", "The orientationally averaged spectra are shown in (c). ", "The number of the PPP units is $N_{\\rm m}= 19$. The bold line is for the total absorption. ", "The thin line indicates the absorption of the long-range component. ", "The Lorentzian broadening $\\gamma = 0.15 t$ is used.", "\n\nFig. ", "3. ", "Long-range component of the optical absorption spectra as a function of the PPP unit number $N_{\\rm m}$. The squares are for the total absorption. ", "The circles and triangles indicate the data for the cases with the electric field parallel and perpendicular to the polymer axis, respectively.", "\n\nFig. ", "4. ", "Optical absorption spectra of the PPV. ", "The polymer axis is in the $x$-$y$ plane. ", "The electric field of light is parallel to the chain and in the direction of the $x$-axis in (a), and it is perpendicular to the axis and is along with the $z$-axis in (b). ", "The orientationally averaged spectra are shown in (c). ", "The number of the PPV units is $N_{\\rm m}= 20$. The bold line is for the total absorption. ", "The thin line indicates the absorption of the long-range component. ", "The Lorentzian broadening $\\gamma = 0.15 t$ is used.", "\n\nFig. ", "5. ", "Long-range component of the optical absorption spectra as a function of the PPV unit number $N_{\\rm m}$. The squares are for the total absorption. ", "The circles and triangles indicate the data for the cases with the electric field parallel and perpendicular to the polymer axis, respectively.", "\n\nFig. ", "6. ", "Optical absorption spectra of the PPD. ", "The polymer axis is in the $x$-$y$ plane. ", "The electric field of light is parallel to the chain and in the direction of the $x$-axis in (a), and it is perpendicular to the axis and is along with the $z$-axis in (b). ", "The orientationally averaged spectra are shown in (c). ", "The number of the PPD units is $N_{\\rm m}= 12$. The bold line is for the total absorption. ", "The thin line indicates the absorption of the long-range component. ", "The Lorentzian broadening $\\gamma = 0.15 t$ is used.", "\n\nFig. ", "7. ", "Long-range component of the optical absorption spectra as a function of the PPD unit number $N_{\\rm m}$. The squares are for the total absorption. ", "The circles and triangles indicate the data for the cases with the electric field parallel and perpendicular to the polymer axis, respectively.", "\n\nFig. ", "8. ", "Optical absorption spectra of the PDV. ", "The polymer axis is in the $x$-$y$ plane. ", "The electric field of light is parallel to the chain and in the direction of the $x$-axis in (a), and it is perpendicular to the axis and is along with the $z$-axis in (b). ", "The orientationally averaged spectra are shown in (c). ", "The number of the PDV units is $N_{\\rm m}= 9$. The bold line is for the total absorption. ", "The thin line indicates the absorption of the long-range component. ", "The Lorentzian broadening $\\gamma = 0.15 t$ is used.", "\n\nFig. ", "9. ", "Long-range component of the optical absorption spectra as a function of the PDV unit number $N_{\\rm m}$. The squares are for the total absorption. ", "The circles and triangles indicate the data for the cases with the electric field parallel and perpendicular to the polymer axis, respectively.", "\n" ]
{ "pile_set_name": "ArXiv" }
[ 0.0007365310448221862, 0.0007649011095054448, 0.001059053116478026, 0.0006355466903187335, 0.0007959131035022438, 0.0005952334613539279, 0.0006235368782654405, 0.0005594663671217859, 0.0006894564139656723, 0.0005815562908537686, 0.000640628335531801, 0.0008840818190947175, 0.0008635271806269884, 0.0005787867121398449, 0.0006473208195529878, 0.0006453825626522303, 0.0006187771214172244, 0.0006291592144407332, 0.0005683464114554226, 0.0009391896310262382, 0.0012203905498608947, 0.0005689678946509957, 0.0006520619499497116, 0.0005716024897992611, 0.0005439285887405276, 0.0006262449314817786, 0.0236219335347414, 0.12969698011875153, 0.0007025867816992104, 0.0008195973350666463, 0.0007025867816992104, 0.0016431325348094106, 0.0006600070046260953, 0.0019393794937059283, 0.0011783745139837265, 0.0006477395654655993, 0.0005820228834636509, 0.000821208581328392, 0.0007548874127678573, 0.006062435917556286, 0.0024743997491896152, 0.011412505991756916, 0.0052077374421060085, 0.000796537147834897, 0.0009391896310262382, 0.0010145168052986264, 0.0007806285284459591, 0.0014738369500264525, 0.0005949935293756425, 0.000526242540217936, 0.0009214006713591516, 0.0009356928057968616, 0.00072306371293962, 0.00060745031805709, 0.000696156348567456, 0.0005710721015930176, 0.0006758318631909788, 0.0006062813918106258, 0.0006139992619864643, 0.0006830728962086141, 0.0006306752329692245, 0.0006813191575929523, 0.0008107043686322868, 0.0010109459981322289, 0.0006800342816859484, 0.0006315208738669753, 0.0005434546619653702, 0.0007573629263788462, 0.0006595429149456322, 0.0005853730835951865, 0.000599309045355767, 0.0006216730107553303, 0.0012175060110166669, 0.0005558697739616036, 0.0006305730203166604, 0.0007158686639741063, 0.000680155586451292, 0.0006063608452677727, 0.0006287993164733052, 0.0005637765862047672, 0.0013671473134309053, 0.0005555810639634728, 0.0007242774590849876, 0.0007041603676043451, 0.0005681187030859292, 0.000695636379532516, 0.0007551205926574767, 0.0006651017465628684, 0.0006199328927323222, 0.0007444604998454452, 0.00117425003554672, 0.0006600136402994394, 0.001322941156104207, 0.0007028137915767729, 0.0006355115328915417, 0.0007313168607652187, 0.0008507732418365777, 0.0006979885511100292, 0.0006416010437533259, 0.0008881256799213588, 0.000681872246786952, 0.0009205227834172547, 0.0013243190478533506, 0.0011275900760665536, 0.0005854559713043272, 0.000743622425943613, 0.0008951033232733607, 0.0006616633618250489, 0.0007742517627775669, 0.0007708119228482246, 0.000535034982021898, 0.0005655648419633508, 0.0007428036769852042, 0.0007971628219820559, 0.0018296621274203062, 0.0005857540527358651, 0.0007808710797689855, 0.0010923778172582388, 0.0005947165773250163, 0.0006981863989494741, 0.0007259061676450074, 0.0007426642114296556, 0.0007259061676450074, 0.0006970230024307966, 0.0007669543265365064, 0.0006309087621048093, 0.000769009639043361, 0.0005723035428673029, 0.0007738490239717066, 0.0009497436112724245, 0.0010214579524472356, 0.0008561542490497231, 0.0008718473836779594, 0.0007773274555802345, 0.0006257303757593036, 0.0007020265911705792, 0.0006890518707223237, 0.0005770331481471658, 0.0006299687083810568, 0.0007602014229632914, 0.0005476768128573895, 0.0005933396168984473, 0.0006227609701454639, 0.0007364068296737969, 0.0006159803597256541, 0.0006301921093836427, 0.0005544574232771993, 0.0005868920707143843, 0.0006667461711913347, 0.00073856400558725, 0.0006110251997597516, 0.0006120717152953148, 0.000536046689376235, 0.0008931494667194784, 0.0006175852031446993, 0.0006028891657479107, 0.0007903199875727296, 0.0005720978952012956, 0.0005877927760593593, 0.0005648165824823081, 0.0005813650786876678, 0.0005903369747102261, 0.0006384836742654443, 0.000721984775736928, 0.0008037638035602868, 0.0007111890008673072, 0.0005941514391452074, 0.000653133902233094, 0.0008066349546425045, 0.0012429299531504512, 0.0018622804200276732, 0.0008967235335148871, 0.000852675992064178, 0.0007978672510944307, 0.0008224234916269779, 0.0008957837708294392, 0.00078105233842507, 0.0007702670991420746, 0.0008083019638434052, 0.00078105233842507, 0.0007702670991420746, 0.0008082776912488043, 0.0012429299531504512, 0.0018622804200276732, 0.0008681538747623563, 0.0006753329653292894, 0.0008221172029152513, 0.0009391896310262382, 0.0005659355665557086, 0.001130330259911716, 0.0008292015991173685, 0.0011855863267555833, 0.0006363203283399343, 0.0008157475385814905, 0.0008268203237093985, 0.0005847454885952175, 0.0007707058684900403, 0.0005552110378630459, 0.003385000629350543, 0.0008292015991173685, 0.00117425003554672, 0.0006017338018864393, 0.0005558697739616036, 0.0008292015991173685, 0.0012900290312245488, 0.0006318336236290634, 0.0008157475385814905, 0.0008268203237093985, 0.0005847454885952175, 0.000746776582673192, 0.0005552110378630459, 0.003385000629350543, 0.0008292015991173685, 0.0013671473134309053, 0.0006019124994054437, 0.0005558697739616036, 0.0008292015991173685, 0.0012020646827295423, 0.0006476232083514333, 0.0008157475385814905, 0.0008268203237093985, 0.0005847454885952175, 0.0007611187174916267, 0.0005552110378630459, 0.003385000629350543, 0.0008292015991173685, 0.0013101327931508422, 0.0006082651671022177, 0.0005558697739616036, 0.0008292015991173685, 0.0014581200666725636, 0.0006164733786135912, 0.0008157475385814905, 0.0008268203237093985, 0.0005847454885952175, 0.0006789340986870229, 0.0005552110378630459, 0.003385000629350543, 0.0008292015991173685, 0.001350246137008071, 0.0005920510739088058, 0.0005558697739616036, 0.0019954426679760218 ]
0.00154
243
[ "About offering\n\nGeologists study how the Earth works, including the natural planetary processes and issues directly affecting people, such as viability of resources, geological hazards, climate change and environmental protection.", "\n\nThe first year gives you a basic foundation in chemistry, physics, maths, scientific communication and computer skills, as well as an introduction to geology. ", "The second year focuses on the theoretical, laboratory and field skills required to understand geological processes. ", "The final year provides comprehensive coverage of all applied disciplines of geology.", "\n\nThe first two years of the program are based in Perth at the Bentley campus, and the third year is offered at Bentley only (as the Applied Geology stream) or in Kalgoorlie only at Curtin’s WA School of Mines (as the Mining Geology stream). ", "This three year course, Petroleum Geology stream only, is also based at Curtin Malaysia campus in Miri, Sarawak.", "\n\nSome streams in this course are not available to students studying in Australia; please refer to information provided for individual streams.", "\n\nThe course contains practical and work-relevant components that include practical geological work similar to that conducted in resources and environmental industry settings. ", "This includes hands-on computing and practical exercises with industry standard software and geology field trips to various sites.", "\n\nPlease refer to the handbook for additional course overview information.", "\n\nWhat you'll learn\n\nsynthesise geological data on a range of spatial and temporal scales to make interpretations that allow for scientific uncertainty\n\ncommunicate geological information concisely and accurately using written, visual, and verbal means appropriate to the situation\n\nemploy new and established technologies to collect and interpret geological data, recognising their strengths and limitations\n\nacquire geological knowledge and expertise from a range of sources in a variety of situations\n\nappreciate international perspectives on geoscience and recognise the importance of global standards for collecting and reporting geological data\n\nrecognise the need for sustainable use of earth resources, and value environmental, indigenous and other community perspectives on geological activities\n\nwork ethically and professionally alone and as part of a team, complying with applicable legislation and managing time and other resources efficiently and effectively\n\nWhy study Bachelor of Science (Applied Geology)\n\nThis is a hands-on, practical course with direct industry involvement\n\nThis comprehensive course qualifies graduates for many geology careers\n\nWe offer a range of relevant double degree options with enhanced career options\n\nYou will have the opportunity to study at Curtin's Western Australian School of Mines (WASM), a leader in mining and geosciences education in Australia.", "\n\nHow this course will make you industry ready\n\nAfter two years of grounding in the fundamentals of geology, your final year will focus on its application in the work place. ", "You'll study minerals, petroleum, groundwater and environmental industries and complete practical exercises that mirror as closely as possible the activities undertaken by industry professionals.", "\n\nStudent profile\n\nView our student profile table to get an indication of the likely peer cohort for new students at Curtin University. ", "This table provides data on students that commenced undergraduate study and passed the census date in the most relevant recent intake period for which data are available. ", "It includes those admitted through all offer rounds and international students studying in Australia.", "\n\nCareer information\n\nGeologist\n\nGeological Engineer\n\nMany graduates work in the mineral and petroleum industries, with some working in groundwater and environmental geology. ", "You will also be well placed to work in global applied geology roles for large organisations, mining companies or consultancy firms.", "\n\nWhat kind of applicant are you?", "\n\nCompleted your secondary education in Australia within the past two years? ", "Learn how you can apply to Curtin.", "\n\nApplicants with work and life experience(Finished secondary education more than two years ago)\n\nSee how to apply if you’ve completed a pathway program, finished secondary education more than two years ago or spent time in the workforce.", "\n\nApplicants with vocational education and training (VET) study\n\nLearn how you can gain entry with a TAFE or other vocational education training (VET) qualification.", "\n\nApplicants with higher education study\n\nFind out how to apply and what credit you may be eligible for if you have previous higher education study.", "\n\nApplicants with recent secondary education\n\nApplicants with recent secondary education are those whose admission is primarily based on the completion of Year 12 within the last two years, but also includes those who may have completed their senior secondary studies with a TAFE or other VET provider within the same time frame. ", "This includes applicants whose secondary education was undertaken interstate or overseas.", "\n\nGuaranteed ATAR: 70\n\nThis is the ATAR level at which an offer of admission is guaranteed, subject to any other non-ATAR criteria being met.", "\n\nEssential WACE subjects (prerequisites):\n\nMathematics: Applications ATAR, or equivalent.", "\n\nSTAT entry:&nbspWritten English, Verbal and Quantitative\n\nThe Special Tertiary Admissions Test (STAT) assesses competencies considered important for success at uni.", "\nThese tests are provided by the Tertiary Institutions Service Centre (TISC) to help mature age candidates apply for certain courses.", "\n\nPortfolio entry is available for those who can demonstrate equivalence to Curtin’s ATAR entry through the submission of a portfolio that includes evidence of your academic achievements, qualifications and ability. ", "Find out more about portfolio entry.", "\n\nLowest selection rank to which a recent Year 12 student offer was made (including the consideration of any equity or other adjustment factors)\n\nView the lowest selection rank (incorporating ATAR plus any adjustments) of an applicant to which an offer of a place was made in the most relevant recent intake period, this includes any ATAR adjustments.", "\n\nATAR and selection rank profile for those offered places wholly or partly on the basis of ATAR in the most recent intake period\n\nApplicants with work and life experience(Finished secondary education more than two years ago)\n\nApplicants with work and life experience are those who left secondary education more than two years ago (i.e. who are not classified as recent secondary education applicants) and have not undertaken vocational education training (VET) or higher education study since then.", "\n\n‘Experience’ includes a combination of factors sufficient to demonstrate readiness for higher education such as mature-age entry, professional experience whether completion of the Special Tertiary Admission Test (STAT) is required or not, community involvement or work experience. ", "Applicants may have undertaken non-formal programs that have helped prepare them for tertiary education or are relevant to the proposed higher education field of study.", "\n\nGuaranteed ATAR: 70\n\nThis is the ATAR level at which an offer of admission is guaranteed, subject to any other non-ATAR criteria being met.", "\n\nEssential WACE subjects (prerequisites):\n\nMathematics: Applications ATAR, or equivalent.", "\n\nSTAT entry:&nbspWritten English, Verbal and Quantitative\n\nThe Special Tertiary Admissions Test (STAT) assesses competencies considered important for success at uni.", "\nThese tests are provided by the Tertiary Institutions Service Centre (TISC) to help mature age candidates apply for certain courses.", "\n\nPortfolio entry is available for those who can demonstrate equivalence to Curtin’s ATAR entry through the submission of a portfolio that includes evidence of your academic achievements, qualifications and ability. ", "Find out more about portfolio entry.", "\n\nApplicants with vocational education and training (VET) study\n\nApplicants with vocational education and training (VET) study are those whose highest level of study since leaving secondary education is a VET course. ", "This includes study at a public TAFE or other VET provider, whether a qualification was completed or not. ", "Applicants with VET study may have other qualifications such as a Year 10 or Year 12 secondary school certificate.", "\n\nGuaranteed ATAR: 70\n\nThis is the ATAR level at which an offer of admission is guaranteed, subject to any other non-ATAR criteria being met.", "\n\nThe Special Tertiary Admissions Test (STAT) assesses competencies considered important for success at uni.", "\nThese tests are provided by the Tertiary Institutions Service Centre (TISC) to help mature age candidates apply for certain courses.", "\n\nPortfolio entry is available for those who can demonstrate equivalence to Curtin’s ATAR entry through the submission of a portfolio that includes evidence of your academic achievements, qualifications and ability. ", "Find out more about portfolio entry.", "\n\nApplicants with higher education study\n\nApplicants with higher education are those whose highest level of study since leaving secondary education is a higher education course, such as a university degree. ", "This includes applicants who are currently studying a higher education course at another education provider and want to transfer to Curtin University, or applicants who are currently studying at Curtin but want to switch to a different course. ", "It also includes applicants who have completed past study with university and non-university higher education providers.", "\n\nEssential course prerequisites\n\nMathematics.", "\n\nDomestic students commencing mid-year might need to study part time for one or more semesters and usually will not be able to complete the course in three years because availability of some units is limited to specific semesters.", "\n\nDomestic students commencing mid-year might need to study part time for one or more semesters and usually will not be able to complete the course in three years because availability of some units is limited to specific semesters.", "\n\nOther requirements and notes for this course\n\nMid-year intake is not available for international students.", "\n\nDomestic students commencing mid-year might need to study part time for one or more semesters and usually will not be able to complete the course in three years because availability of some units is limited to specific semesters.", "\n\nAdmission criteria may be different if you are studying this major as part of a Bachelor of Science (Honours) degree. ", "Please contact the Admissions Office for more information.", "\n\nIn addition to the course-specific admission criteria listed above, please read our general admission criteria. ", "Our general admission criteria apply to all courses at Curtin University.", "\n\nAdvanced standing / credit transfer / recognition of prior learning\n\nAustralia / New Zealand students\n\nStudent type toggle\n\nInternational students\n\nAt Curtin, we understand that everyone’s study journey has been different.", "\n\nYou may have already studied some of the units (subjects) listed in your Curtin course, or you may have work experience that matches the degree requirements.", "\n\nIf this applies to you, you can apply for credit for recognised learning (CRL), which means your previous study is recognised and matched against a similar unit in your intended Curtin course.", "\n\nA successful CRL application exempts you from having to complete certain units within your course and means you could finish your degree in a shorter amount of time.", "\n\nCRL is also known as recognition of prior learning, advanced standing and credit transfer.", "\n\nUse the CRL search to find out how much CRL you qualify for, or contact us at:\n\nFees and charges\n\nAustralian and New Zealand student indicative fees for 2019\n\nFee year: 2019\n\nStudent type\n\nCost\n\nCommonwealth supported\n\nWhat is a Commonwealth supported place (CSP)?", "\n\nA CSP is subsidised by the Australian Government. ", "They pay part of the course fees directly to Curtin and then the student pays the remainder (referred to as the “student contribution amount”). ", "The student can defer this fee to their HECS-HELP loan.", "\n\nAll Australian students studying an undergraduate degree are automatically awarded a Commonwealth supported place. ", "A limited number of Commonwealth supported places are also available for some postgraduate courses.", "\n\nLearn more about CSPs and whether you’re eligible by visiting the Australian Government’s StudyAssist website.", "\n\n$9,370*\n\nFees are indicative first year only and are subject to passage of legislation.", "\n\n*The indicative first-year fee is calculated on 600 credit points, which is the typical full-time study load per year, however some courses require additional study to be completed, in which case the fee will be higher than that shown.", "\n\nThis fee is a guide only. ", "It may vary depending on the units you choose and does not include incidental fees (such as lab coats or art supplies) or the cost of your textbooks – visit other fees and charges for more information. ", "For more information on fees and to determine your eligibility for HECS-HELP or FEE-HELP, please visit fee basics or the Study Assist website\n\nIf you’re not an Australian citizen, permanent resident or New Zealand citizen, please see information for international students.", "\n\nInternational student fees for 2019\n\nFee year: 2019\n\nInternational onshore – fee paying\n\nCost\n\nIndicative essential incidental course fee\n\n$2,320*\n\nOffer letter (100 credit) published fee\n\n$17,300*\n\nTotal indicative course fee\n\n$109,800*\n\nIndicative year 1 fee\n\n$35,400*\n\nFee year: 2020\n\nInternational onshore – fee paying\n\nCost\n\nIndicative essential incidental course fee\n\n$2,320*\n\nOffer letter (100 credit) published fee\n\n$18,000*\n\nTotal indicative course fee\n\n$114,200*\n\nIndicative year 1 fee\n\n$36,800*\n\nThe fees shown above apply to international students studying on-campus in Western Australia. ", "The tuition fee is subject to an annual tuition fee increase of up to 5 per cent per annum. ", "For information about fees at other locations please visit Curtin International’s offshore site.", "\n\nNext steps\n\nIf you are successful in your application to study at Curtin, you will receive a letter of offer via email. ", "You can either accept or defer your offer. ", "To find out more about this process, view our enrolment web page.", "\n\nApplicants with other international qualifications\n\nThe offering information on this website applies only to future students. ", "Current students should refer to faculty handbooks for current or past course information. ", "View courses information disclaimer.", "\n\nCurtin University would like to pay our respect to the indigenous members of our community by acknowledging the traditional owners of the land on which the Bentley Campus is located, the Wadjuk people of the Nyungar Nation; and on our Kalgoorlie Campus, the Wongutha people of the North-Eastern Goldfields.", "Watch our traditional Aboriginal welcome" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0005724439979530871, 0.0007019342156127095, 0.0005620738957077265, 0.0005735308513976634, 0.0006161103956401348, 0.0005709616234526038, 0.0005269236280582845, 0.0005472507909871638, 0.0005654543056152761, 0.0005057278904132545, 0.0005408818833529949, 0.0005780261708423495, 0.0005274791619740427, 0.0005513494834303856, 0.0005684198113158345, 0.0005579614662565291, 0.000561375985853374, 0.0005205594352446496, 0.0031501285266131163, 0.0007380697643384337, 0.0006935144774615765, 0.0005592224770225585, 0.0006232357118278742, 0.0005852060858160257, 0.0005945116281509399, 0.0005877454532310367, 0.0006258916691876948, 0.0005984408780932426, 0.000644207582809031, 0.0006308204028755426, 0.000528812175616622, 0.0006066779023967683, 0.0006062525208108127, 0.0005580749711953104, 0.0005837929784320295, 0.0005415434716269374, 0.0006258916691876948, 0.0005984408780932426, 0.000644207582809031, 0.0006308204028755426, 0.000528812175616622, 0.0006066779023967683, 0.0006722823600284755, 0.0006514271371997893, 0.0006389203481376171, 0.0006258916691876948, 0.0005992736550979316, 0.0006308204028755426, 0.000528812175616622, 0.0006066779023967683, 0.0007088258280418813, 0.000668525171931833, 0.0005748127587139606, 0.0006743890698999166, 0.0005752059514634311, 0.0005752059514634311, 0.0005799971404485404, 0.0005752059514634311, 0.0005434577469713986, 0.0005601629381999373, 0.0005339668714441359, 0.0005793137825094163, 0.0005437227664515376, 0.0005411946913227439, 0.0005725987139157951, 0.0007505410467274487, 0.0006050414522178471, 0.0006158740725368261, 0.0006530227838084102, 0.0007855573785491288, 0.0006988964159972966, 0.0005994032835587859, 0.0005408033030107617, 0.0006199210765771568, 0.0006033058743923903, 0.0005753630539402366, 0.0011704593198373914, 0.0005712141282856464, 0.0005108874756842852, 0.0006119929603300989, 0.0006753947236575186, 0.0005180853768251836, 0.0005357550107873976, 0.0007534479373134673, 0.0005219257436692715, 0.000567388953641057, 0.0005495284567587078, 0.0006790069164708257, 0.0005859131924808025, 0.0009064254118129611 ]
0.000636
90
[ "Topics - Tekuji\n\nthrow/toss an object arround with swipe gestures.( ", "and everything arround it). ", "maybe tossing balls(sphere) in to a wagon in a 2d orthographic scenewhere they disappear when collide with wagon and an image is visible on the wagonif u want u can put the image as a create gameobject(or something) where u create a new ball out of the image on the wagon.(Like, to take them out of wagon and toss it arround again.)" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0012703993124887347, 0.000742074626032263, 0.0009106021607294679 ]
0.000974
3
[ "*Yawn*I woke up early this morning, so I did this instead of sleeping I drew.", "Unluckily I couldn't get this finished before going to school so I'm uploading this now" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.001535047427751124, 0.002350745489820838 ]
0.001943
2
[ "Q:\n\nOpenshift - 'oc' commands fail with \"Unable to connect to the server: x509: certificate signed by unknown authority\"\n\nAfter installing openshift locally, I can start minishift. ", "on https://192.168.x.y:8443\nWhen starting an 'oc' command, like 'oc project', then I get this error: \nUnable to connect to the server: x509: certificate signed by unknown authority\nWhen I start an 'oc' command without starting minishift, then I get this error: \nUnable to connect to the server: dial tcp 192.168.x.y:8443: connectex: (Translated) Trying to connect failed because the connected party has not answered correctly after a certain time, or the established connection failed because the connected host did not answer.", "\nBefore: I could work with oc with Openshift online. ", "\n\nA:\n\nSolved, I guess a missing SSH issue. ", "\nAfter starting minimshift, perform a 'oc login' results in this meesage: \nAuthentication required for https://192.168.99.100:8443 (openshift)\nSo after providing the username and password, everything works find!", "\nAnd of course, you can use the SSH tokens. ", "You can find info by opening the Online Console > Question mark pulldown menu > command line. ", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.000974868715275079, 0.0008409169968217611, 0.0005798711790703237, 0.0024115750566124916, 0.000985991908237338, 0.002704693004488945, 0.0005959456320852041, 0.0019954426679760218 ]
0.001386
8
[ "If this is your first visit, be sure to\ncheck out the FAQ by clicking the\nlink above. ", "You may have to register\nbefore you can post: click the register link above to proceed. ", "To start viewing messages,\nselect the forum that you want to visit from the selection below.", "\n\nAnother number of discs question\n\nHi folks,\n\nRecently put in Fueling 574 Cams, ported heads with a .030 head gasket along with a 50mm TB on my 103\" Street Bob. ", "I had my Supermeg set with 20 discs and closed end cap. ", "Bike produced 105hp and 100tq where most others with similar builds were a fair bit more. ", "The tuner thought that perhaps the pipe was a little restrictive. ", "The HP does climb pretty quick right to the end but starts much lower up to 4k than what it should. ", "I'd like to play with the disc setup to get these numbers moving in the right direction if possible. ", "I do own an open end cap but do not currently use it. ", "Any thoughts as to where to start?", "\n\nRecently put in Fueling 574 Cams, ported heads with a .030 head gasket along with a 50mm TB on my 103\" Street Bob. ", "I had my Supermeg set with 20 discs and closed end cap. ", "Bike produced 105hp and 100tq where most others with similar builds were a fair bit more. ", "The tuner thought that perhaps the pipe was a little restrictive. ", "The HP does climb pretty quick right to the end but starts much lower up to 4k than what it should. ", "I'd like to play with the disc setup to get these numbers moving in the right direction if possible. ", "I do own an open end cap but do not currently use it. ", "Any thoughts as to where to start?", "\n\nthanks!", "\n\nTry adding a couple discs at a time to provide more \"top end\" flow.", "\nOr go with the \"open\" end-cap keeping in mind it flows equivalent of 10-12 discs.", "\n\nCan you post the dyno chart showing the bike's AFR readings? ", "It's easy to say, just add more discs or put on an open end-cap or that someone thinks the pipe was a little restrictive. ", "Problem is, if your AFR is below 13:1, even with all that stuff removed, your ignition system will fail to keep up with all the fuel it's being told to chemically burn.", "\n\nPosting the AFR graph will shed light on exactly what's going on in your combustion chamber." ]
{ "pile_set_name": "Pile-CC" }
[ 0.000761144794523716, 0.0006072873948141932, 0.0005452212644740939, 0.0021155988797545433, 0.0010551025625318289, 0.0007582685211673379, 0.0006590531556867063, 0.0006618147599510849, 0.0006224553217180073, 0.0006844237796030939, 0.0006732986657880247, 0.005027454812079668, 0.0010551025625318289, 0.0007582685211673379, 0.0006590531556867063, 0.0006618147599510849, 0.0006224553217180073, 0.0006844237796030939, 0.0006732986657880247, 0.0007347132777795196, 0.0006148917018435895, 0.0006313225603662431, 0.0007022038334980607, 0.0006493942928500473, 0.006066635251045227, 0.0005406468408182263 ]
0.001124
26
[ "Auswirkungen der Kohäsionspolitik auf die Eingliederung schutzbedürftiger Gemeinschaften und Gruppen (Aussprache) \nDer Präsident\nAls nächster Punkt folgt die Aussprache über den Bericht von Gábor Harangozó im Namen des Ausschusses für regionale Entwicklung zu den Auswirkungen der Kohäsionspolitik auf die Eingliederung schutzbedürftiger Gemeinschaften und Gruppen.", "\nGábor Harangozó\nBerichterstatter. - (", "HU) Vielen Dank, Herr Präsident! ", "Frau Kommissarin Hübner, meine Damen und Herren Abgeordneten! ", "Es gibt Regionen, und in diesen Regionen leben Menschen, die nicht in der Lage sind, die Möglichkeiten zu nutzen, die wir ihnen aus Mitteln der Gemeinschaft bieten, damit sie möglichst schnell das Durchschnittsniveau der Europäischen Union erreichen und die Armut, in der sie leben, überwinden.", "\nMit diesem Bericht wollte ich aufzeigen, weshalb es uns nicht gelungen ist, diese Regionen zu entwickeln, und Empfehlungen geben, wie sich diese Lage verändern und überwinden lässt. ", "Aus dem Vierten Zwischenbericht der Europäischen Kommission über den Zusammenhalt geht hervor, dass die Kohäsionspolitik auf nationaler Ebene in einigen Ländern recht erfolgreich ist. ", "Konkret heißt das, dass in diesen Ländern, die der Europäischen Union beigetreten sind und Mittel aus dem Kohäsionsfonds erhalten, dynamischere Entwicklungen und echte Fortschritte im Hinblick auf den Zusammenhalt zu verzeichnen sind. ", "Bei Betrachtung der etwas darunter liegenden territorialen Ebenen ist jedoch erkennbar, dass die Unterschiede zwischen den einzelnen Regionen nicht im gleichen Maße abgebaut werden. ", "Als Beispiel möchte ich Ungarn anführen: In diesem Land hat das Pro-Kopf-BIP in der zentralen Region 110 % des Durchschnittswertes der Europäischen Union erreicht, wohingegen es in vier der sieben Regionen Ungarns unter 45 % des EU-Durchschnitts liegt. ", "In diesen Regionen nehmen die Unterschiede immerhin nicht weiter zu. ", "Aus dem Vierten Bericht über den Zusammenhalt geht indes auch hervor, dass die territorialen Unterschiede innerhalb der Regionen oftmals weiterhin zunehmen.", "\nWas könnten die Ursachen dafür sein, dass es einigen Regionen gelingt, die ihnen zur Verfügung stehenden Möglichkeiten zu ihrem Vorteil zu nutzen, während andere dazu nicht in der Lage sind? ", "Bei näherer Betrachtung wird deutlich, dass diese Entwicklung sehr schwer wiegende strukturelle Ursachen hat, das heißt strukturelle Ursachen auf territorialer Ebene. ", "In Territorien, die nur eine schwache Entwicklung aufzuweisen haben, fehlt es eindeutig an Humankapazitäten zur Schaffung entsprechender Projekte, ist die für die Gewinnung von Investitionen in diese Territorien erforderliche Infrastruktur nicht vorhanden und mangelt es an angemessenen Bildungs- und sachgemäßen medizinischen Versorgungseinrichtungen für die Bürger. ", "Es gibt beispielsweise in Ungarn mehrere Mikroregionen, in denen die Lebenserwartung der Männer um mehr als fünfzehn Jahre unter dem Landesdurchschnitt liegt.", "\nWas können wir dagegen unternehmen? ", "Da wir es hier mit einem Problem von äußerst komplexer Natur zu tun haben, das sich ganz offensichtlich auf bestimmte Mikroterritorien und Mikroregionen konzentriert, müssen wir nach meinem Dafürhalten darüber nachdenken, ob es denn richtig ist, dass die Kohäsionspolitik nur auf interregionaler Ebene, also auf der Ebene der Regionen, analysiert wird. ", "Wäre es nicht eher angebracht zu prüfen, ob denn nicht stärker fokussierte und zielgerichtete Maßnahmen auf der Ebene der Mikroregionen erforderlich sind, wo die Probleme am deutlichsten zutage treten? ", "Als ersten Schritt sollten wir uns die Statistiken ansehen, auf die wir als Ausgangsbasis für den Entscheidungsprozess zurückgreifen. ", "Mir war dieses Problem bei der Erarbeitung des Berichts bekannt, ich kann Ihnen aber keine konkrete Grundlage für einen statistischen Vergleich liefern, da es in der gesamten EU an vergleichbaren statistischen Daten für die Mikroregionen fehlt. ", "Wir müssen von nun an prüfen, ob es richtig ist, ländliche Kohäsion in die Agrarpolitik einzubinden, auch wenn es sich zumeist um ländliche Gebiete handelt. ", "Wäre es nicht viel besser, die Probleme der ländlichen Gebiete im Rahmen der Kohäsionspolitik zu behandeln und die Instrumente der Kohäsionspolitik zu nutzen, sodass die Maßnahmen der Agrarpolitik lediglich eine reinweg ergänzende Funktion haben?", "\nAn dieser Stelle möchte ich den Schattenberichterstattern für ihr äußerst konstruktives Engagement bei der Erarbeitung dieses Berichts danken. ", "Zugleich möchte ich darauf verweisen, dass die PPE-DE-Fraktion nach mehrwöchigen Verhandlungen und nachdem ich ihren Bericht mit einem ganz maßgeblichen Änderungsantrag zu einem wichtigen Punkt des Berichts angenommen hatte, beschloss, gegen den von ihr selbst vorgebrachten Punkt zu stimmen. ", "Für mich stellt sich nun die Frage, was wollen wir eigentlich? ", "Soll lediglich festgestellt werden, dass es ein Problem gibt, ohne etwas dagegen zu unternehmen, oder wollen wir uns dem Problem stellen und Empfehlungen für die Änderung unserer Politik abgeben und uns mehr auf die Bestimmung von Bereichen konzentrieren, in denen wir wirklich etwas unternehmen können, um das Problem zu lösen? ", "Vielen Dank für Ihre Aufmerksamkeit.", "\nDanuta Hübner\nMitglied der Kommission. - (", "EN) Herr Präsident! ", "Ich möchte Herrn Harangozó für seinen Bericht danken sowie für seine Bemühungen um einen einvernehmlichen Standpunkt seines Ausschusses zum schwierigen Thema der schutzbedürftigen Gemeinschaften und Gruppen. ", "Um zu verhindern, dass Wirtschaftswachstum einhergeht mit sozialer Polarisierung innerhalb unserer Gesellschaft, richtet sich die Kohäsionspolitik gegen die soziale Ausgrenzung und zielt insbesondere auf die Integration schutzbedürftiger Gemeinschaften und Gruppen. ", "Dies wird auch in der Zukunft ein wichtiges Ziel der Kohäsionspolitik bleiben.", "\nDarüber hinaus ist es eine Tatsache, dass die im Bericht benannten Probleme an der Schnittstelle zwischen territorialem Zusammenhalt einerseits und sozialem Zusammenhalt andererseits liegen. ", "Somit werden Probleme der sozialen Polarisierung und der sozialen Ausgrenzung, wenn sie in bestimmten Gebieten konzentriert auftreten, zu Problemen des territorialen Zusammenhalts.", "\nWir sehen uns sozialer Ausgrenzung in den ärmsten Gebieten der Europäischen Union gegenüber, aber wir finden sie auch in Form von Inseln sozialer Isolation in den reichsten Städten der EU. ", "Im Bericht wird die Kommission ersucht, im Rahmen des kommenden Grünbuchs über den territorialen Zusammenhalt eine umfassende Definition des territorialen Zusammenhalts vorzulegen, und ich kann versichern, dass das für Ende September dieses Jahres zu erwartende Grünbuch zu einem Fortschritt im unionsweiten gemeinsamen Verständnis des Konzepts der territorialen Kohäsion beitragen wird.", "\nIm Bericht wird außerdem anerkannt, dass der Begriff der schutzbedürftigen Gruppen und Gemeinschaften als solcher ganz sicher kein ganz einfacher ist und nicht allein auf Roma-Gemeinschaften beschränkt werden sollte. ", "Auf der anderen Seite ist es weithin anerkannt, dass die Situation der Roma-Gemeinschaften in Europa besonderes Augenmerk verdient. ", "Um den vielschichtigen Problemen der Ausgrenzung der Roma zu begegnen, brauchen wir einen integrierten Ansatz. ", "Das Parlament hat darüber im Zusammenhang mit seiner Entschließung zu einer europäischen Strategie für die Roma im Januar ausgiebig diskutiert. ", "Im Paket zur erneuerten Sozialagenda wird die Kommission Anfang Juli ihr Arbeitspapier zu gemeinschaftlichen Instrumenten und Maßnahmen zur Integration der Roma vorstellen.", "\nIch teile die im Bericht geäußerte Meinung, dass wir die Synergien und Komplementaritäten der europäischen Maßnahmen und der verschiedenen verfügbaren Finanzierungsinstrumente besser nutzen müssen. ", "Die Kommission hat darauf großes Augenmerk gerichtet, als sie die operationellen Programme der Kohäsionspolitik mit den nationalen und regionalen Behörden verhandelte.", "\nAuch hinsichtlich des Anliegens, vergleichbare intraregionale Daten für alle Regionen der Europäischen Union unter besonderer Berücksichtigung sozialer Indikatoren verfügbar zu machen, teile ich die Meinung des Berichts: Auch wenn dies essenziell erscheint, ist das Problem komplexerer Natur. ", "Wie den Mitgliedern bewusst ist, erhebt Eurostat keine Daten, sondern verwaltet die von den nationalen statistischen Systemen gelieferten Informationen.", "\nWir haben soeben das zweite Städteaudit für den Zeitraum bis 2004 abgeschlossen, und wir sehen deutlich, wie wenige territoriale Daten unterhalb der klassischen regionalen NUTS 2-Ebene vorliegen. ", "Um diese schwierige Aufgabe zu lösen und auch den Kontext der Grünbuchvorbereitungen zum territorialen Zusammenhalt zu nutzen, hat die Generaldirektion Regionalpolitik Maßnahmen zur Verbesserung der Qualität der Forschung zu regionaler Politik einschließlich der statistischen Grundlagen erarbeitet. ", "Im Ergebnis dessen werden nun die Ausgaben 2000-2006 auf die Ebene NUTS 3 heruntergebrochen, auf 20 Ausgabenkategorien auf dieser Ebene, und zwar für Ziel-I-Regionen, Ziel-II-Regionen, die Programme Urban und Interreg sowie den Kohäsionsfonds.", "\nDie Durchführung von Audits für ländliche Regionen ist eine Aufgabe, die noch vor uns liegt. ", "Leider muss ich eingestehen, dass uns heute noch keine verlässlichen Daten dazu vorliegen, wo ausgeschlossene Gruppen vermehrt vorkommen. ", "Daher ist es unmöglich, unsere neuen Informationen, wo und wofür Ressourcen der Kohäsionspolitik eingesetzt werden, mit der örtlichen Konzentration dieser Gruppen abzugleichen So wie sich das Problem heute darstellt, glaube ich, dass wir in diesem Bereich noch Spielraum für Fortschritt haben, besonders bei der konkreten Forschung mithilfe qualitativer Analysen.", "\nIch möchte dem Parlament noch einmal dafür danken, dass Sie diese wichtigen Punkte angesprochen haben und freue mich auf die heutige Debatte.", "\nIlda Figueiredo\nVerfasserin der Stellungnahme des mitberatenden Ausschusses für Landwirtschaft und ländliche Entwicklung. - (", "PT) Als Verfasserin der Stellungnahme des mitberatenden Ausschusses für Landwirtschaft und ländliche Entwicklung möchte ich erneut die Notwendigkeit betonen, ländliche Gebiete sowie Bergregionen zu unterstützen, in denen Frauen eine zentrale Rolle übernehmen. ", "Wir müssen ihre Arbeit würdigen und ihnen ein angemessenes Einkommen garantieren.", "\nEs bedarf gut bezahlter Produktionstätigkeiten und hochwertiger öffentlicher Dienste, um junge Menschen zu halten und Landflucht zu verhindern. ", "Bei der gegenwärtigen Reform der Gemeinsamen Agrarpolitik muss Familienbetrieben sowie kleinen und mittleren landwirtschaftlichen Betrieben besondere Aufmerksamkeit gewidmet werden, damit eben diese Politik gerechter wird, Landflucht bekämpft und landwirtschaftliche Erzeugnisse gefördert werden können.", "\nBesonders hervorheben möchte ich auch, dass es notwendig ist, die benachteiligten Regionen, die strukturell dauerhaft benachteiligten Gegenden, die Gebiete in äußerster Randlage und die Gegenden, die von industriellen Umstrukturierungen, Abwanderung oder Betriebsschließungen betroffen waren, zu unterstützen, um den wirtschaftlichen und sozialen Zusammenhalt und die soziale Integration schutzbedürftiger Gemeinschaften und Gruppen zu stärken.", "\nMaria Petre\nim Namen der PPE-DE-Fraktion. - (", "RO) Herr Präsident, Frau Kommissarin, liebe Kolleginnen und Kollegen! ", "Zuallererst möchte ich mich bei dem Berichterstatter für seine Arbeit und für die von ihm unternommenen Anstrengungen, verschiedene Gesichtspunkte miteinander in Einklang zu bringen, bedanken. ", "Wir sind alle der Meinung, dass schutzbedürftige Gruppen und Gemeinschaften in ihrer Entwicklung mit vielen Schwierigkeiten zu kämpfen haben und dass sie im Rahmen der Kohäsionspolitik besonderer Aufmerksamkeit sowie der anderen zur Verfügung stehenden finanziellen Hilfsinstrumente bedürfen.", "\nWährend aller Arbeitsphasen habe ich die Notwendigkeit unterstützt, den Bericht in zwei voneinander getrennte Teile zu gliedern: Ein Teil bezieht sich aus Sicht der ethnischen Zugehörigkeit auf schutzbedürftige Gemeinschaften, und der zweite Teil befasst sich mit schutzbedürftigen Gemeinschaften, die durch gewisse geografisch bedingte Benachteiligungen geprägt sind. ", "Leider spiegelt sich unsere Bitte in der gegenwärtigen Form des Berichts nicht wider. ", "Unsere Fraktion hat drei Änderungsvorschläge eingebracht, von deren Annahme unser Stimmverhalten abhängt, nämlich die Streichung von Erwägung Ee, deren Inhalt identisch ist mit dem Inhalt von Erwägung I, der Erklärung des Konzepts eines schutzbedürftigen Gebiets oder einer schutzbedürftigen Zone durch deren Aufzählung sowie die Streichung von Ziffer 17. ", "Wir hoffen, dass uns der Berichterstatter in dieser Beziehung zustimmen wird.", "\nSchließlich möchte ich noch zwei weitere Gedanken hervorheben: Die Probleme schutzbedürftiger Gemeinschaften, ganz gleich unter welchem Gesichtspunkt, dem ethnischen und/oder dem geografischen, könnten effizienter behandelt werden, wenn es in diesem Bereich eine Zusammenarbeit zwischen lokalen, regionalen, einzelstaatlichen und europäischen Behörden gäbe. ", "Gleichzeitig ist die Rolle des Bildungssystems sowie der öffentlichen, der sozialen und der Verkehrsinfrastruktur für die Integration schutzbedürftiger Gruppen und Gemeinschaften unentbehrlich.", "\nZum Schluss möchte ich ausführen, dass, wie ich bereits erwähnte, unser endgültiger Standpunkt von der Annahme der drei Änderungsanträge abhängt, insbesondere von der Streichung von Ziffer 17, über die in der Kommission abgestimmt wurde. ", "Im Falle der Annahme dieser Änderungsanträge werden wir den Bericht selbstverständlich unterstützen.", "\nLidia Joanna Geringer de Oedenberg\nim Namen der PSE-Fraktion. - (", "PL) Herr Präsident! ", "Zu Beginn möchte ich dem Berichterstatter für seine Arbeit an dem Bericht danken, der uns heute vorgelegt wurde. ", "Ich bin wie der Berichterstatter der Ansicht, dass es dringend erforderlich ist, einen mikroregionalen Ansatz zu finden, der auf intraregionale Disparitäten und auf besonders schutzbedürftige Gebiete ausgerichtet ist.", "\nIntraregionale Disparitäten spielen in bestimmten Fällen sogar eine größere Rolle als Unterschiede zwischen den Regionen. ", "Vergessen wir nicht, dass es das Ziel und die Grundannahme der europäischen Regionalpolitik ist, Unterschiede in der Entwicklung zwischen einzelnen Regionen zu verringern, und das Phänomen der territorialen Ausgrenzung wurde noch nicht in den politischen Instrumenten berücksichtigt. ", "In den neuen Mitgliedstaaten treten gesellschaftliche Segregation und mangelnde Chancengleichheit am häufigsten in ländlichen Gebieten auf, wirtschaftliche und soziale Initiativen in den Regionen konzentrieren sich dagegen auf dynamische Zentren, vorrangig auf städtische Zentren.", "\nDie Mittel zur Bekämpfung von Armut und sozialer Ausgrenzung sind von Land zu Land verschieden; um aber eine Europäische Union des territorialen und sozialen Zusammenhalts zu schaffen, gilt es zusätzliche Maßnahmen zu ergreifen, mit denen das Potenzial entfaltet wird, das in den wirtschaftlich unterentwickelten Regionen schlummert.", "\nRamona Nicole Mănescu\nim Namen der ALDE-Fraktion. - (", "RO) Herr Präsident! ", "Zuallererst möchte ich dem Berichterstatter für seine Arbeit danken.", "\nFür die Gemeinschaften in den unterentwickelten Regionen und Teilregionen ist die Kohäsionspolitik lebenswichtig. ", "Wirtschaftliche und soziale Aspekte, wie z. B. Armut, mangelnde Infrastruktur und Verwaltungskapazitäten, Deindustrialisierung, niedriges Bildungs- und Ausbildungsniveau, hohe Arbeitslosenquoten, schlechte Lebensbedingungen und beschränkter Zugang zu Dienstleistungen von allgemeinem Interesse machen diese Gemeinschaften zu schutzbedürftigen Gruppen. ", "Diese stellen eine immer größere Herausforderung für den territorialen Zusammenhalt der Europäischen Union dar. ", "So entsteht eine wechselseitige Beziehung zwischen der Notwendigkeit, die sozioökonomischen Unterschiede zwischen den Regionen zu reduzieren und der Notwendigkeit, schutzbedürftige Gruppen in die Gesellschaft zu integrieren, eine Beziehung, die selbstverständlich zu einem konstruktiven Prozess führen sollte, der ein territoriales Herangehen sowohl auf nationaler als auch europäischer Ebene mit sich bringt.", "\nHerr Präsident, meiner Ansicht nach beweisen das Fehlen statistischer Angaben hinsichtlich der Verteilung dieser Gruppen und des Grades ihrer sozialen Ausgrenzung sowie auch die Tatsache, dass die Indikatoren zur Messung der Ungleichheiten zwischen den Regionen keine verlässlichen Daten liefern können, einmal mehr, dass die Mitgliedstaaten und die Kommission enger zusammenarbeiten müssen, damit sie sich ein reelles Bild von der Lage schutzbedürftiger Regionen und Gruppen machen und konkrete Programme und Strategien zur territorialen Entwicklung und zur Überwindung sozialer Ausgrenzung entwickeln können.", "\nIch bin auch der Meinung, dass der erste Schritt der Mitgliedstaaten darin bestehen sollte, diese schutzbedürftigen Gruppen zu ermitteln und ihre Priorität in den nationalen strategischen Plänen festzulegen und im Anschluss daran Mechanismen zur Auswertung und Beobachtung zu entwickeln. ", "Wir sollten nicht vergessen, dass Migration meistens eine Folge von Armut ist und dass das Phänomen der Migration selbst Instabilität und Konflikte hervorruft. ", "Aus diesem Grund, sehr verehrter Herr Präsident, sollten unserer Meinung nach schutzbedürftige Gruppen von der sozialen Hilfe aller Mitgliedstaaten, von der Chancengleichheit und, darüber hinaus, von besonderen Programmen zur Entwicklung ihrer Herkunftsregionen profitieren.", "\nMieczysław Edmund Janowski\nim Namen der UEN-Fraktion. - (", "PL) Herr Präsident! ", "Ich möchte Herrn Harangozó dafür danken, sich mit diesem schwierigen Thema befasst zu haben, auch wenn der Bericht nicht auf alle Aspekte eingeht, die sich auf Situationen, Personen oder Umfelder beziehen, die ausgegrenzt oder bedroht werden.", "\nObwohl ein erheblicher Teil des Haushalts der Europäischen Union für die Umsetzung ihrer Kohäsionspolitik bestimmt ist, gibt es nach wie vor gravierende Ungleichheiten. ", "Betrachten wir nur einmal das BIP pro Kopf: In den reichsten Gegenden liegt es fast zehnmal höher als in den ärmsten Regionen. ", "Wir dürfen nicht vergessen, dass es auch innerhalb der Regionen wesentliche Unterschiede gibt. ", "In großen Ballungsgebieten gibt es auch verarmte Stadtbezirke. ", "Das ist zudem auch in vielen ländlichen Gebieten ein erhebliches Problem. ", "Diese Armut wird teilweise von einer Generation zur nächsten weitergegeben.", "\nSchützen wir deshalb die Kinder und Familien vor diesem Phänomen. ", "In erster Linie muss hier Chancengleichheit geschaffen werden, insbesondere in den Bereichen Bildung, Gesundheitsfürsorge und Wohnraum. ", "Damit stellen wir den sozialen und territorialen Zusammenhalt unter Beweis, den wir bislang noch nicht richtig definiert haben. ", "Die Zukunftsaussichten von Menschen, die in räumlicher, kultureller und kommunikationstechnischer Hinsicht isoliert leben, sind deutlich schlechter. ", "Das betrifft die technische wie auch die soziale Infrastruktur, ebenso wie Arbeitsplätze und die Schaffung eines Klimas der inneren Aktivität in diesen Gesellschaften.", "\nHelfen wir unseren Mitbürgern, die auf die eine oder andere Weise diskriminiert werden, damit sie wieder an ihre Chance glauben können, der niedrigen gesellschaftlichen Stellung zu entkommen. ", "Wir müssen auch mit den Klischees brechen, die diese Gruppen unterbewerten. ", "Das betrifft sehr viele behinderte oder obdachlose Menschen, auch die Gesellschaften der Roma, über die hier gesprochen wurde. ", "Diese Art von Segregation steht im Widerspruch zu unserer gemeinsamen Solidarität und ist ein Zeichen von mangelnder Achtung der Würde des Menschen. ", "Denken wir daran, wie oft wir es in diesen Kreisen mit kinderreichen Familien oder mit Einwandererfamilien zu tun haben.", "\nAußerdem brauchen wir eine gemeinsame Politik, um Gleichheit auf verschiedenen Ebenen zu schaffen: auf regionaler, nationaler und auf EU-Ebene. ", "Wir benötigen auch Freiwillige, und wir brauchen Nichtregierungsorganisationen.", "\nLambert van Nistelrooij\n(NL) Herr Präsident, Frau Kommissarin! ", "Ich danke Herrn Harangozó für die Aufmerksamkeit, die er den schutzbedürftigen Gruppen entgegenbringt. ", "Die Kohäsionspolitik leistet schon seit Langem einen wesentlichen Beitrag zur Verbesserung der Lage der schutzbedürftigen Gruppen. ", "Nehmen wir beispielsweise Irland, einst ein Land mit sehr schutzbedürftigen Gruppen: immens hohe Jugendarbeitslosigkeit, heruntergekommene Städte, rückständige Provinz, nahezu chancenlos. ", "Auch in etlichen anderen Ländern muss an die Stelle sozialer Ausgrenzung Beschäftigung, Bildung und Beteiligung treten. ", "Das ist der Weg, den wir beschreiten und der auch überaus erfolgreich ist.", "\nEin zweiter Gesichtspunkt. ", "Wie ich bemerkt habe, heißt es vor allem, wir wüssten zu wenig, hätten zu wenig Informationen. ", "Ich stimme zu, dass das vor allem seitens der Mitgliedstaaten, der Regionen und der Städte selbst verbessert werden könnte. ", "Herr Harangozó ist erstaunt, weshalb die Lebenserwartung der Ungarn 15 % unter der durchschnittlichen Lebenserwartung in der EU liegt. ", "Den Grund dafür kenne auch ich nicht, allerdings habe ich Krankenhäuser besucht. ", "Die Ess- und Trinkgewohnheiten sind extrem ungesund, und dagegen kann die Europäische Gemeinschaft nichts tun. ", "Eigenverantwortung der Menschen in den Regionen zählt, wie ich meine, zu den wesentlichen Grundlagen unserer Politik.", "\nUnd was ist schließlich der eigentliche Grund, weshalb die PPE-DE NUTS 4 ablehnt? ", "Wir sind dagegen, weil wir uns 2004 für die Stärkung der Politik bis 2013, für mehr Substanz, einen stärkeren Fokus entschieden haben. ", "Wir haben sogar beschlossen, die gesamte Außengrenze als solche in die Politik für die Interreg-Gebiete an den Außengrenzen einzubeziehen. ", "Tendenziell führt dies zur Zersplitterung, Verzettelung bei unseren Bemühungen, und diesen Weg sollten wir künftig auf diesem Gebiet nicht einschlagen. ", "Das wäre ein Fehler. ", "Deshalb fordere ich Sie nochmals zur Streichung des betreffenden Artikels auf. ", "Im Übrigen nehme ich gern die auch vom Berichterstatter formulierte Herausforderung an, im nächsten Halbjahr einmal eingehend über den territorialen Zusammenhalt zu diskutieren.", "\nIratxe García Pérez\n(ES) Herr Präsident! ", "Ich möchte ebenfalls mit einem Dank an den Berichterstatter dafür beginnen, dass er die Initiative für die Erarbeitung eines Berichts ergriffen hat, in dem erklärt wird, dass eines der Hauptziele der Europäischen Union in der Verringerung der sozialen, wirtschaftlichen und regionalen Ungleichheiten besteht.", "\nDie Kohäsionspolitik hat einen wirksamen Beitrag zum Abbau dieser Ungleichheiten geleistet, doch bleibt noch viel zu tun, wie im vierten Kohäsionsbericht erklärt wird.", "\nIn allen Regionen, selbst in den wohlhabendsten, leben schutzbedürftige Bevölkerungsgruppen, die Gefahr laufen, in die soziale Ausgrenzung und völlige Armut abzugleiten. ", "Ein integrierter Ansatz ist notwendig, wenn es um mangelnde Chancengleichheit geht. ", "Die Mitgliedstaaten und regionalen Verwaltungen brauchen Strategien, um die schutzbedürftigen Gebiete wiederzubeleben, ihre Infrastruktur zu entwickeln und echte Entwicklungsmöglichkeiten entsprechend ihrem spezifischen Wirtschaftspotenzial zu fördern und dabei die Dienste von allgemeinem Interesse über die Stärkung der lokalen Verwaltungen durch die Dezentralisierung des öffentlichen Sektors aufrechtzuerhalten.", "\nEmmanouil Angelakas\n(EL) Herr Präsident, Herr Kommissar! ", "Der Bericht von Herrn Harangozó stellt aufgrund seiner Zielgerichtetheit und spezifischen Thematik einen äußerst wichtigen Schritt des Europäischen Parlaments dar, sich den schutzbedürftigen Gemeinschaften und Gruppen zu widmen und sie im Rahmen einer europäischen Kohäsionspolitik schrittweise zu integrieren. ", "Als Initiative erhält dies meine volle Zustimmung, und ich gratuliere dem Berichterstatter zu seinen Bemühungen, doch wenn es mir erlaubt ist, möchte ich der Herangehensweise an das Thema widersprechen. ", "Einigen Aspekten des Berichts fehlt es trotz der gründlichen Arbeit meines Kollegen noch an Substanz.", "\nBei einigen dieser Aspekte geht es um schutzbedürftige Gemeinschaften und Gruppen, die ein breites Spektrum der Gesellschaft und von Mikrogemeinschaften, und nicht nur die Roma repräsentieren. ", "Das Europäische Parlament hat auf diese Kategorie bereits in einem spezifischen Bericht verwiesen, der neben anderen auch die sozialen und geografischen Aspekte hätte umfassen müssen. ", "Die Fraktion der Europäischen Volkspartei (Christdemokraten) und europäischer Demokraten hat betont, dass ein solcher umfassenderer Ansatz sinnvoll sei, doch ihrem Rat ist man nicht gefolgt. ", "Der Bericht ist nach wie vor einseitig und beinhaltet oft einen kurzsichtigen Umgang mit der Thematik.", "\nIch denke ganz besonders an die Berg- und Inselregionen, deren Schutzbedürftigkeit niemand in Frage stellen kann. ", "Sie finden an keiner Stelle des Berichts Erwähnung. ", "Mir missfällt, dass fortwährend Definitionen oder spezifische Verweise auf Sachen und Situationen vermieden werden. ", "Außerdem möchte ich hervorheben, dass es schutzbedürftige Gemeinschaften und Gruppen nicht nur auf überregionaler, sondern auch auf regionaler Ebene gibt. ", "Sie benötigen materielle und technische Unterstützung, technologisches und wissenschaftliches Know-how, Bildung, Ausbildung und eine administrative Basis. ", "Besonderes Augenmerk sollte auf die Dezentralisierung des öffentlichen Sektors und den Ausbau der Verkehrsnetze gelegt werden. ", "Auch in diesem Fall und in diesen Gruppen kann die ehrenamtliche Tätigkeit eine wichtige Rolle spielen und zur Aktivierung und Integration beitragen.", "\nDie Bemühungen des Berichterstatters stehen zwar außer Frage, doch ich halte die Gesamtstruktur des Berichts für unbefriedigend. ", "Er ist gespickt mit Uneindeutigkeiten, und seine Absätze weisen keine klare Ordnung auf. ", "Wenn wir wirklich dazu beitragen wollen, die Probleme schutzbedürftiger Gruppen zu lösen, müssen wir klare und eindeutige Texte verfassen, die einen Überblick über das Thema vermitteln.", "\nEvgeni Kirilov\n(EN) Herr Präsident! ", "Ich möchte meinem Kollegen, Herrn Harangozó, zu seinem Initiativbericht gratulieren.", "\nIm Rahmen der EU-Kohäsionspolitik bedeutet besondere Aufmerksamkeit für schutzbedürftige Gruppen, dass wir nicht vergessen haben, dass der Schwerpunkt dieser Politik auf dem Beitrag der EU zum Wohlergehen unserer Bürger liegt.", "\nDie regionale Dimension dieser Angelegenheit ist eindeutig. ", "Gleichwohl ist es notwendig, die Entwicklungsstärke der kleinen Gebietseinheiten zu analysieren, um die besonderen Bedürfnisse und den Ort der schutzbedürftigen Gruppen zu bestimmen. ", "Obwohl wir feststellen konnten, dass die Schutzbedürftigkeit ein Problem auf niedrigeren Ebenen ist - beispielsweise in den ärmsten Regionen - wirkt es sich auf das gesamte Gebiet aus und betrifft alle darin lebenden sozialen Gruppen. ", "Daher müssen Politik, Strategie und Maßnahmen zu den Problemen der schutzbedürftigen Gruppen umfassend sein und auf einem gemeinsamen Ansatz der europäischen, nationalen und lokalen Institutionen beruhen.", "\nBernadette Bourzai\n(FR) Herr Präsident, Frau Kommissarin, meine Damen und Herren! ", "Zunächst möchte ich Gábor Harangozó zu der hervorragenden Arbeit, die er geleistet hat, und zu seinen Gedanken zu diesem komplexen und heiklen Thema beglückwünschen. ", "Ich wollte mich aktiv an der Stellungnahme des Ausschusses für Landwirtschaft und ländliche Entwicklung zu diesem Bericht beteiligen, da die hilfsbedürftigsten Personen häufig in den am wenigsten entwickelten ländlichen Gebieten und in Regionen mit dauerhaften naturbedingten Nachteilen konzentriert sind, was bedeutet, dass die Agrarpolitik und die Politik zur Entwicklung des ländlichen Raums dort eine wichtige Rolle zu spielen haben.", "\nDie Kohäsionspolitik muss meines Erachtens darauf abzielen, einkommensgenerierende landwirtschaftliche und nichtlandwirtschaftliche Tätigkeiten in den ländlichen Gebieten aufrechtzuerhalten, um eine Bevölkerung zu halten, die häufig in die Versuchung der Landflucht gerät, aber auch um neue Bewohner willkommen zu heißen. ", "Familienbetriebe müssen gefördert werden, weil dadurch Arbeitsplätze geschaffen werden, und gleicher Zugang zu öffentlichen Dienstleistungen sowie die Erbringung öffentlicher Dienstleistungen müssen gewährleistet sein, um den Bedürfnissen benachteiligter Familien, Gemeinschaften und gesellschaftlicher Gruppen gerecht zu werden. ", "Kurz gesagt, müssen wir das ländliche Umfeld attraktiv und lebenswert machen. ", "Dieses Ziel können wir erreichen, indem wir die verschiedenen Politiken, die in diesen Regionen und für diese benachteiligten Gruppen durchgeführt werden, miteinander verbinden und so stärker die Komplementarität der verschiedenen verfügbaren Finanzinstrumente nutzen.", "\nMiloš Koterec\n(SK) Ich danke Gábor Harangozó für den ausgezeichneten Bericht. ", "Er berührt Fragen, die bisher noch nicht offenkundig sind, aber eine latente Quelle deutlich größerer Probleme darstellen. ", "Insbesondere möchte ich auf zwei im Bericht enthaltene konkrete Bereiche eingehen: die Fortentwicklung der schutzbedürftigen Gemeinschaften, zu denen vor allem Menschen aus dem ländlichen Raum und den Randlagen der Städte gehören, und die Entwicklung der zurückgebliebenen Mikroregionen, die je nach den besonderen Gegebenheiten der einzelnen Länder verschieden verstreut sind und von der derzeitigen Statistik kaum erfasst werden.", "\nDiese beiden Bereiche werden nicht genau ausgewiesen und deswegen auch vernachlässigt. ", "Wir müssen eindeutig feststellen, welche wirtschaftlich und sozial schutzbedürftigen Gemeinschaften wir in der Europäischen Union haben, wir müssen analysieren, welche Arten von unterentwickelten Mikroregionen es in der EU gibt und wo sie lokalisiert sind, und wir müssen Lösungen für diese Probleme finden. ", "Beide sind vor dem Hintergrund der umfassenden Erfolge der Kohäsionspolitik schwer zu erkennen. ", "Wir dürfen nicht zulassen, dass die Kohäsionspolitik einem Emmentaler Käse gleicht, der nach außen hin sehr kompakt aussieht.", "\nMiroslav Mikolášik\n(SK) In dem vorgelegten Bericht wird ganz richtig auf den Zusammenhang zwischen der Lösung sozialer Fragen und der regionalen Entwicklung verwiesen. ", "Hier muss sich Europa solidarisch zeigen und die Kohäsionspolitik umsetzen.", "\nIch selbst verwende einen großen Teil meiner Zeit für Fragen, die mit der Unterstützung zurückgebliebener Regionen, vor allem in der Slowakei, zu tun haben. ", "Die Bewahrung eines starken und attraktiven ländlichen Raums in Europa ist sowohl aus wirtschaftlichen als auch aus kulturellen und umweltpolitischen Gründen unabdingbar. ", "Ich unterstütze die Forderung an die Kommission, die im vorbereiteten Grünbuch über den territorialen Zusammenhalt vorgesehenen Mittel für die Lösung regionaler Probleme aufzustocken. ", "Dabei muss für eine aktive Beteiligung der Regionen gesorgt und auch mit den Nichtregierungsorganisationen eng zusammengearbeitet werden.", "\nIn diesem Zusammenhang möchte ich besonders die soziale Tätigkeit der Kirchen und Religionsgemeinschaften hervorheben. ", "Ich weiß aus eigener Erfahrung, dass ihr Wirken zugunsten der armen Gesellschaftsgruppen und Regionen äußerst effektiv und oft unersetzlich sind. ", "Wir sollten sie daher als untrennbaren Bestandteil des europäischen Bemühens um Hilfe für die schutzbedürftigen Gruppen ansehen und sie auf europäischer Ebene angemessen unterstützen.", "\nStavros Arnaoutakis\n(EL) Herr Präsident, Herr Kommissar, liebe Kolleginnen und Kollegen! ", "Auch ich möchte darauf hinweisen, dass wir mit diesem Bericht unsere Überzeugung zum Ausdruck bringen, dass mit der Kohäsionspolitik zwanzig Jahre nach ihrer Formulierung die Solidarität der Union auch in Zukunft nicht nur den am meisten benachteiligten europäischen Regionen und Ländern, sondern auch den besonders schutzbedürftigen Gemeinschaften und Gruppen unserer Bevölkerung demonstriert werden soll.", "\nWir müssen die Kohäsionspolitik nicht nur finanziell, sondern auch mit geeigneten Mechanismen und Verfahren stärken, die es ermöglichen, komplexe, vielschichtige soziale und wirtschaftliche Ungleichheiten auf lokaler Ebene aufzudecken und zu bekämpfen.", "\nAufgrund der Schwierigkeiten, mit denen unserer Regionen gegenwärtig konfrontiert sind, dürfen wir nicht unsere Augen vor den Problemen der Armut und der sozialen und territorialen Ausgrenzung verschließen. ", "Es bedarf koordinierter Maßnahmen auf allen Ebenen, eines integrierten Ansatzes sowie aufeinander abgestimmter Mittel und Strategien, um dieser Probleme Herr zu werden.", "\nCzesław Adam Siekierski\n(PL) Herr Präsident! ", "Derzeit konzentriert sich das Wirtschaftwachstum auf Hauptstädte und städtische Großräume. ", "Die Entwicklung in den übrigen Regionen, darunter auch in ländlichen Gebieten, verläuft deutlich langsamer, und deshalb sind diese Regionen anfälliger für Probleme. ", "Ziel der Kohäsionspolitik sollte es sein, diesen Regionen zu helfen und den territorialen Zusammenhalt zu unterstützen.", "\nDeshalb kommt es ganz wesentlich darauf an, die Infrastruktur zu verbessern und die Attraktivität dieser Regionen für Investoren zu erhöhen, die öffentlichen Dienste aufrechtzuerhalten und die Wohn- und Lebensbedingungen zu verbessern. ", "Für die Entwicklung der ländlichen Gebiete ist der Ausbau der Verkehrsinfrastruktur sehr wichtig, also vor allem Verkehrswege und Kläranlagen, weil das die notwendigen Bedingungen für den Investitionsfluss und die Entstehung neuer Arbeitsplätze schafft, was den Menschen die Möglichkeit gibt, weiter in den Regionen zu bleiben und dort menschenwürdig zu leben.", "\nDer Schwerpunkt der Gemeinsamen Agrarpolitik lag bislang hauptsächlich auf der Qualität der Nahrungsmittel, der Ernährungssicherheit und dem Wettbewerb, mit der ländlichen Entwicklung abseits der Landwirtschaft hat sie sich aber weniger befasst. ", "Deshalb müssen die Kohäsionspolitik, die Politik der ländlichen Entwicklung und die Beschäftigungspolitik besser miteinander koordiniert werden.", "\nEwa Tomaszewska\n(PL) Herr Präsident! ", "In Erwägung N des Berichts wird zu Recht unterstrichen, dass Armut und Ausgrenzung einen stark territorialen Charakter aufweisen. ", "Unter Berücksichtigung des in der Europäischen Union allgemein respektierten Solidaritätsprinzips und des Inhalts der Erwägung N plädiere ich dafür, dass die Mittel der Europäischen Fonds zur Förderung der Integration wirtschaftlich benachteiligter Gebiete genutzt werden.", "\nLeider wurde in meinem Land dieses Jahr gegen dieses Prinzip verstoßen. ", "Die Mittel zur Verbesserung der Infrastruktur und andere Hilfsfonds gelangen überwiegend in wohlhabendere und bereits gut entwickelte Gebiete. ", "Das liegt oft daran, dass die Personen, die sich um diese Mittel bewerben, besser vorbereitet sind. ", "Ich hoffe, dass das vorliegende Dokument dazu beitragen wird, diese Unregelmäßigkeiten in der ganzen Europäischen Union zu beseitigen.", "\nDanuta Hübner\nMitglied der Kommission. - (", "EN) Herr Präsident! ", "Meines Erachtens war dies eine gute Diskussion, und ich möchte allen danken, die an der Aussprache teilgenommen haben. ", "Sie hat gezeigt, dass ein integrativer politischer Ansatz der beste Weg ist, um dem Problem unterschiedlicher schutzbedürftiger Gemeinschaften und Gruppen effizient zu begegnen. ", "Besonders wichtig scheint dabei die Verknüpfung von Kohäsionspolitik und Politik für die Entwicklung des ländlichen Raumes.", "\nIch teile ebenfalls den Standpunkt der Abgeordneten, dass in Fällen territorialer Häufung der Probleme in Verbindung mit schutzbedürftigen Gruppen ein gebietsbezogener Politikansatz gerechtfertigt ist. ", "Soziale Eingliederung sollte nicht von territorialem Zusammenhalt getrennt werden.", "\nIch danke den Abgeordneten auch für ihre Betonung der intraregionalen Unterschiede. ", "Wie viele Abgeordnete herausgestellt haben, wäre die Entwicklung hochwertiger, verlässlicher intraregionaler Statistiken in diesem Kontext eine große Hilfe. ", "Wie ich bereits in meinen einleitenden Worten gesagt habe, will die Kommission weiterhin in die Entwicklung einer entsprechenden Datenbank investieren. ", "Derzeit erarbeiten wir ein Audit für ländliche Regionen, ähnlich den bisher bereits durchgeführten Städteaudits. ", "Dabei spielt eine gute Zusammenarbeit mit den Mitgliedstaaten eine entscheidende Rolle, und ich vertraue in diesem Zusammenhang stark auf die Unterstützung des Parlaments.", "\nGábor Harangozó\nBerichterstatter. - (", "HU) Vielen Dank, Herr Präsident! ", "Frau Kommissarin! ", "Meine Damen und Herren Abgeordneten! ", "Ich möchte zunächst Kommissarin Hübner danken, nicht nur für ihren Beitrag zu diesem Bericht und zur Debatte, sondern auch für ihre stetigen Bemühungen um Weiterentwicklung und effizientere Gestaltung dieser Politik. ", "Ich weiß ihre Arbeit sehr zu schätzen und danke ihr auch für ihre Offenheit in Bezug auf meinen Bericht.", "\nIch möchte nun zu einigen der aufgeworfenen Fragen Stellung nehmen. ", "Wollen wir das Problem ernsthaft in Angriff nehmen, dann sollten wir meines Erachtens zunächst das tun, was wir auch getan haben, als wir die Notwendigkeit des Lissabon-Prozesses sowie die Bedeutung der Umsetzung dieses Prozesses in der Kohäsionspolitik mit allem Ernst erkannt hatten und daraufhin die Einführung eines Systems der Zuweisung von Kohäsionsfonds zur Unterstützung des Lissabon-Prozesses beschlossen. ", "Auf die gleiche Art und Weise können wir Maßnahmen zur Bekämpfung der territorialen Konzentration der Armut ergreifen, wenn wir denn wollen. ", "Wenn wir uns entschließen, dies zu tun.", "\nFerner möchte ich der PPE-DE-Fraktion und insbesondere Herrn van Nistelrooij sagen, dass die Streichung von Ziffer 17 aus dem Bericht bedeuten würde, dass wir akzeptieren, dass es Mikroregionen gibt, die nicht in der Lage sind, die ihnen gebotenen Möglichkeiten zu nutzen. ", "Wir wissen, dass es sich dabei um Mikroregionen handelt, aber warum wollen wir genau die Ziffer aus dem Bericht streichen, in der wir die Kommission auffordern zu prüfen, ob es deshalb nicht sinnvoller ist, den betroffenen Regionen auf mikroregionaler Ebene Kohäsionsunterstützung zu gewähren? ", "Ich verstehe immer noch nicht, weshalb wir das tun sollten.", "\nFrau Petre möchte ich entgegnen, dass ich das vorgelegte Papier als einen Bericht über die Regionalpolitik und somit nicht als richtigen Ort für die Diskussion von Fragen ethnischer Gruppen betrachte. ", "Ich verstehe nicht, weshalb wir hier die Problematik der ethnischen Gruppen überhaupt ansprechen sollen. ", "Wenn wir die Angelegenheit in Rumänien aus ethnischer Sicht betrachten, welche Gruppen soll ich ihrer Meinung nach denn in den Bericht aufnehmen? ", "Die Roma, die in bestimmten Gebieten in äußerster Armut leben? ", "Die Csángó, die in einem bestimmten Gebiet ebenfalls unter miserablen Bedingungen leben? ", "Oder die in den Gebirgsregionen lebenden Rumänen? ", "Auf dieser Basis können wir keine Entscheidungen treffen; wir benötigen komplexe Indikatoren, einen komplexen Ansatz und eine integrierte Umsetzung. ", "Vielen Dank für Ihre Aufmerksamkeit.", "\nDer Präsident\nDie Aussprache ist geschlossen.", "\nDie Abstimmung findet morgen um 12.00 Uhr statt.", "\nSchriftliche Erklärungen (Artikel 142)\nBairbre de Brún \nIch möchte den vorliegenden Bericht von Herrn Harangozó über die Auswirkungen der Kohäsionspolitik auf die Eingliederung schutzbedürftiger Gemeinschaften und Gruppen begrüßen. ", "Die Forderungen werden immer lauter, etwas gegen die unsicheren Zukunftsaussichten von Stadtvierteln oder Landstrichen zu unternehmen, deren Bewohner nicht in die Entscheidungsfindung und die Wirtschaftsentwicklung eingebunden sind.", "\nAus meinem eigenen Wahlkreis kenne ich die Schwierigkeiten, mit denen nicht nur benachteiligte Stadtviertel, sondern auch Randgebiete in den Grenzbezirken Irlands konfrontiert sind. ", "Diese ländlichen Gebiete sind häufig nicht in der Lage, Unternehmens- oder Infrastrukturinvestitionen zu sichern. ", "Die Politiker sollten sich vor allem darauf konzentrieren, die im Bericht angesprochene Landflucht zu bekämpfen.", "\nHerr Harangozó verweist zu Recht auf die Bedeutung der kleinen und mittleren landwirtschaftlichen Betriebe für den Erhalt der ländlichen Gemeinschaften. ", "Ländliche Gemeinschaften sollten in der Kohäsionspolitik nicht zurückgestuft werden, und im Kampf gegen die soziale Ausgrenzung bedarf es einer stärkeren Verknüpfung zwischen ländlicher und regionaler Entwicklung.", "\nDie Abgelegenheit von Kommunikations- und Verkehrsnetzen ist ein praktisches Problem, dem wir uns widmen müssen.", "\nBogdan Golik \nschriftlich. - (", "PL) Die Kohäsionspolitik, für die etwa 33 % des EU-Haushalts verwendet werden, ist von größter Wichtigkeit für alle Länder der EU. ", "Polen beteiligt sich gern an allen Maßnahmen, die einer vollen wirtschaftlichen Integration der europäischen Gesellschaft und einem Abbau der Disparitäten auf mikroregionaler Ebene dienen. ", "Meines Erachtens sind die Maßnahmen im Rahmen der Kohäsionspolitik die Grundvoraussetzung, um nachhaltige Entwicklung zu fördern und Arbeitslosigkeit, Armut und soziale Ausgrenzung, die ernste soziale und wirtschaftliche Probleme in Europa darstellen, zu beseitigen. ", "Die Zusammenarbeit zwischen allen europäischen Ländern und der Erfahrungsaustausch sind hier ganz besonders wichtig.", "\nDie Probleme, die die nachhaltige Entwicklung in der EU hemmen, zu denen niedrige Einkommen, schwache Infrastruktur und geringe soziale Mobilität gehören, tauchen vornehmlich in ländlichen Gebieten auf. ", "Die Situation wird von der zunehmenden Abwanderung der Menschen aus ländlichen Gebieten und der verstärkten sozialen Ausgrenzung in diesen Regionen noch verschärft. ", "Darüber hinaus zählen auch externe Faktoren wie etwa die zunehmenden Entwicklungsunterschiede zwischen der Europäischen Union und den USA zu den Problemen, vor denen die europäische Kohäsionspolitik zu Beginn des 21. ", "Jahrhunderts steht. ", "In den Jahren 1995-2005 lag das Produktivitätswachstum in Europa deutlich unter dem in den Vereinigten Staaten oder in Japan. ", "Das wirkt sich merklich auf die sinkende Wettbewerbsfähigkeit des europäischen Marktes aus.", "\nIch möchte Herrn Harangozó dafür danken, dass er uns diese Probleme verdeutlicht hat.", "\nLívia Járóka \nschriftlich. - (", "HU) Im Interesse der Förderung von Beschäftigung, Wachstum und Wettbewerbsfähigkeit muss die Europäische Union das ihr zur Verfügung stehende Unternehmens- und Arbeitskräftepotenzial so gut wie möglich nutzen. ", "Da die Mehrzahl der nahezu zehn Millionen in Europa lebenden Roma von strukturbedingter und/oder absoluter Arbeitslosigkeit betroffen oder auf dem grauen Markt bzw. ", "in der Schattenwirtschaft tätig ist, könnte die Integration der Roma erhebliche Auswirkungen auf das Ergebnis der Lissabon-Agenda und die Kohäsionspolitik haben. ", "Im Bericht wird festgestellt, dass die Kohäsionspolitik den ärmsten Regionen dabei geholfen hat, den Rückstand bei der wirtschaftlichen und sozialen Entwicklung zu verringern. ", "Gleichwohl sind weitere Anstrengungen sowohl in quantitativer als auch in qualitativer Hinsicht erforderlich. ", "Die Europäische Kommission und die Mitgliedstaaten müssen darauf hinarbeiten, dass die verfügbaren finanziellen Ressourcen künftig koordiniert werden und sich gegenseitig ergänzen; und bis das dann so weit ist, muss mithilfe der Finanzinstrumente der Europäischen Union - hier seien vorrangig der Europäische Sozialfonds und der Europäische Fonds für regionale Entwicklung genannt - eine Vielzahl von Einzelprogrammen unterstützt werden, und zwar von der Bereitstellung von Mikrokrediten für Unternehmen bis hin zu Investitionen in den Ausbau der Infrastruktur. ", "Damit diese Programme ein Erfolg und die Mittel auch für den vorgesehenen Zweck eingesetzt werden, müssen sowohl allgemeine als auch besondere Hindernisse erkannt und beseitigt werden. ", "In ihrer Entwicklung zurückgebliebene Regionen, die mit komplexen Problemen zu kämpfen haben, können die Gegenwertmittel nicht aufbringen, die aber erforderlich sind, damit sie die Unterstützung der Gemeinschaft erhalten können, auf die sie Rechtsanspruch haben. ", "Was das Volk der Roma anbetrifft, so haben sich die Benachteiligungen, die aus einem geringen Bildungsstand und Arbeitslosigkeit über mehrere Generationen resultieren, inzwischen vervielfacht.", "\nCătălin-Ioan Nechifor \nDas Europäische Parlament hat den Entwurf einer Entschließung zu den Auswirkungen der Kohäsionspolitik auf die Eingliederung schutzbedürftiger Gemeinschaften und Gruppen zur Diskussion gestellt und besteht darauf, dass in den ländlichen Gebieten bestimmte wirtschaftlich rentable Produktionstätigkeiten aufrechterhalten werden, wobei insbesondere auf Familienbetriebe, aber auch kleine und mittlere landwirtschaftliche Betriebe zu achten ist.", "\nDie Gemeinsame Agrarpolitik muss gerechter werden, damit es angesichts der für wahrscheinlich gehaltenen Lebensmittelkrise möglich wird, dass sich Menschen in vorwiegend landwirtschaftlich geprägten ländlichen Gebieten niederlassen können.", "\nIch glaube, dass nach der Verabschiedung dieser Entschließung Rumänien erhebliche Unterstützung im Kampf gegen die Armut in den ländlichen Gebieten gewährt werden wird. ", "Dort leben 10 Millionen Menschen, und Phänomene wie soziale und territoriale Ausgrenzung gefährden die bloße Existenz des rumänischen Staates sowie die Lebensmittel- und Ernährungssicherheit.", "\nDurch Ausrichtung der rumänischen Landwirtschaft auf kleine landwirtschaftliche Betriebe, auf die Subsistenzlandwirtschaft und auf Landwirte, die mit ihren Familien kleine Flächen bewirtschaften, wird diese Landwirtschaft eine reelle Chance haben und somit den Beitrag dieses Sektors an der Erwirtschaftung des BIP erhöhen.", "\nBei dieser Gelegenheit möchte ich die Regierung Rumäniens ersuchen, alle nötigen Schritte zur Annahme dieser Entschließung zu ergreifen, um zu retten, was im Agrarsektor noch zu retten ist - also dort, wo die europäische Integration bisher noch nichts gebracht hat.", "\n" ]
{ "pile_set_name": "EuroParl" }
[ 0.08259803056716919, 0.001621993025764823, 0.004928343463689089, 0.04312753677368164, 0.049775030463933945, 0.3155905604362488, 0.014612860977649689, 0.03955448046326637, 0.018842581659555435, 0.08026978373527527, 0.4932909607887268, 0.07337138801813126, 0.05590641498565674, 0.22267629206180573, 0.04427905008196831, 0.21377593278884888, 0.01667608506977558, 0.05079119652509689, 0.11937028169631958, 0.2393261045217514, 0.3792874813079834, 0.031404390931129456, 0.021342134103178978, 0.44932296872138977, 0.42293646931648254, 0.3699963092803955, 0.02034398354589939, 0.00195017596706748, 0.0010559175861999393, 0.0028292278293520212, 0.12036769837141037, 0.0698920264840126, 0.848737359046936, 0.05814071372151375, 0.01605433225631714, 0.0381789393723011, 0.061526328325271606, 0.15152579545974731, 0.007492858450859785, 0.028618255630135536, 0.004294232465326786, 0.030708394944667816, 0.2251182645559311, 0.021883657202124596, 0.027771979570388794, 0.041300516575574875, 0.029840616509318352, 0.12262658774852753, 0.06298140436410904, 0.046582479029893875, 0.4508455991744995, 0.063834547996521, 0.748052716255188, 0.001537251751869917, 0.015073039568960667, 0.015728574246168137, 0.21972690522670746, 0.048452019691467285, 0.13791920244693756, 0.0015644774539396167, 0.050718653947114944, 0.2210511863231659, 0.07820772379636765, 0.3329748213291168, 0.2539333701133728, 0.12285373359918594, 0.1016964241862297, 0.08401607722043991, 0.021911349147558212, 0.18916074931621552, 0.19817566871643066, 0.0009526414214633405, 0.0021924679167568684, 0.09620795398950577, 0.03719960153102875, 0.011026699095964432, 0.014926450327038765, 0.00561256380751729, 0.04228310286998749, 0.0010634383652359247, 0.006134579423815012, 0.026425518095493317, 0.031073326244950294, 0.010781505145132542, 0.04148394986987114, 0.10991611331701279, 0.10568327456712723, 0.06529329717159271, 0.016208603978157043, 0.08527164906263351, 0.0009506384958513081, 0.0021924679167568684, 0.5614879727363586, 0.14306987822055817, 0.08023764938116074, 0.04885408654808998, 0.03646942228078842, 0.006546787451952696, 0.3735835552215576, 0.27894333004951477, 0.0701279491186142, 0.24325060844421387, 0.3104862868785858, 0.07223133742809296, 0.07883443683385849, 0.7785104513168335, 0.11962725967168808, 0.07365244626998901, 0.11779693514108658, 0.016125600785017014, 0.07773444056510925, 0.00511553417891264, 0.516120433807373, 0.07200329005718231, 0.18186473846435547, 0.2430090755224228, 0.033308859914541245, 0.009264699183404446, 0.12090039253234863, 0.19602982699871063, 0.10593924671411514, 0.3878910541534424, 0.10677213221788406, 0.020929578691720963, 0.02873757667839527, 0.08356625586748123, 0.102635458111763, 0.4443241059780121, 0.014157084748148918, 0.005544375162571669, 0.22347351908683777, 0.0057075656950473785, 0.06262605637311935, 0.14843516051769257, 0.019562918692827225, 0.22231946885585785, 0.02044164389371872, 0.0026133572682738304, 0.03641321137547493, 0.08810707926750183, 0.1465243101119995, 0.1127084419131279, 0.010619780980050564, 0.13802561163902283, 0.031064065173268318, 0.1617453545331955, 0.05039673298597336, 0.002715992508456111, 0.14228394627571106, 0.0010692169889807701, 0.04011819511651993, 0.08609908819198608, 0.38808032870292664, 0.08432789891958237, 0.03110075555741787, 0.007534172385931015, 0.12064262479543686, 0.12997612357139587, 0.015006816945970058, 0.04662727937102318, 0.04925457015633583, 0.006278607528656721, 0.016303814947605133, 0.23388256132602692, 0.14247775077819824, 0.1066988930106163, 0.058644481003284454, 0.010082220658659935, 0.6953723430633545, 0.02610514499247074, 0.3041042387485504, 0.28046107292175293, 0.7717357873916626, 0.01736334338784218, 0.09307471662759781, 0.1580239236354828, 0.015132100321352482, 0.021542998030781746, 0.2448096126317978, 0.034971993416547775, 0.04531608149409294, 0.015097140334546566, 0.29546770453453064, 0.03829113394021988, 0.007821766659617424, 0.019202886149287224, 0.3856743276119232, 0.05838653817772865, 0.058159828186035156, 0.05640445649623871, 0.0021992381662130356, 0.05746820569038391, 0.00914072711020708, 0.020181631669402122, 0.09740997105836868, 0.05450890213251114, 0.13176216185092926, 0.13459625840187073, 0.004481857176870108, 0.05416563153266907, 0.022060690447688103, 0.6769722700119019, 0.04877268150448799, 0.48074179887771606, 0.1373983919620514, 0.0010559175861999393, 0.0028292278293520212, 0.8392629027366638, 0.05916247144341469, 0.15152616798877716, 0.02528897114098072, 0.07005048543214798, 0.09835600107908249, 0.10167264193296432, 0.6938115954399109, 0.02750742994248867, 0.08127220720052719, 0.001621993025764823, 0.004928343463689089, 0.03594684973359108, 0.031333714723587036, 0.1642676740884781, 0.15856891870498657, 0.12663033604621887, 0.07584583014249802, 0.23920534551143646, 0.810393750667572, 0.16474777460098267, 0.06161198019981384, 0.017353493720293045, 0.1004280149936676, 0.06400436908006668, 0.06848280876874924, 0.6720234751701355, 0.9121586084365845, 0.7519543766975403, 0.03680258244276047, 0.00195017596706748, 0.011076358146965504, 0.17607171833515167, 0.01209565531462431, 0.06109553202986717, 0.19290044903755188, 0.09584131091833115, 0.807464063167572, 0.019329210743308067, 0.028363415971398354, 0.025834865868091583, 0.0009155544103123248, 0.03168941289186478, 0.1265275627374649, 0.03902783989906311, 0.18583714962005615, 0.023726318031549454, 0.041468486189842224, 0.2388848066329956, 0.016966314986348152, 0.0031533767469227314, 0.15776857733726501, 0.25336796045303345, 0.0007757409475743771, 0.0968240350484848, 0.057812102138996124, 0.009170410223305225, 0.02894323505461216, 0.08741029351949692, 0.04277758672833443, 0.3274518847465515, 0.05683884769678116, 0.15559126436710358, 0.00942195300012827, 0.21018515527248383, 0.3605024814605713, 0.14624595642089844, 0.018429337069392204, 0.28788021206855774, 0.0019954426679760218 ]
0.12998
277
[ "Ideal ratio​\n\nAccording to Greg Cumberford, general manager of the Ahiflower Division of TCI, the oil derived from the species Buglossoides arvensis ​offers the highest levels of non-GM omega-3 essential fatty acids among commercially available dietary plant oils, combining ALA (alpha linolenic acid) and a uniquely high level of SDA (stearidonic acid). ", "Ahiflower also contains significant levels of GLA (gamma linolenic acid), an omega-6 essential fatty acid, and oleic acid, an omega-9 fatty acid, to complement the overall healthy profile of this completely unique plant oil.", "\n\n“Omega fatty acids are essential and they bioaccumulate preferentially in certain key body tissues like retina, brain and heart tissue,”​ Cumberford told NutraIngredients-USA. “", "When we offer the body a healthy omega 3-6-9 ratio that’s what the emerging science says is most healthy. ", "It is driven by a desire to more accurately reflect the balance of naturally occurring omega fatty acids in our own tissues.", "”​\n\nSDA content​\n\nA key differentiator in TCI’s ingredient is its SDA content, Cumberford said. ", "One issue with all plant based omega-3 sources has been the very low conversion ratio of ALA, the predominant omega-3 in plant sources such as flax, chia and hemp, into EPA, one of the two (along with DHA) omega-3 fatty acids for which most of the research on health benefits has been done. ", "Most experts peg this conversion at as low as 3% to as much as 20% for vegetarians. ", "The proportion of ALA converted to DHA is vanishingly small.", "\n\nSDA, on the other hand, is a much more efficient plant-based source of omega-3s, Cumberford said, and this is where Ahiflower shines.", "\n\n“SDA is the metabolic product of the conversion of ALA in the body. ", "SDA converts to EPA at ratio of 30% to 35%. ", "Direct consumption of SDA is therefore far more efficient than consuming large amounts of ALA. ", "Our specification is for an 18% to 20% SDA content in Ahiflower oil, which is the largest SDA content of any non GM plant source such as echium, black currant seed or hemp,”​ Cumberford said.", "\n\nRaising SDA levels in plants has been a target of developers for a number of years. ", "TCI, which is based in Winston-Salem, NC, has had its crops under development for about 10 years in the UK, Cumberford said.", "\n\n“As a plant, ​Buglossoides arvensis is pretty much endemic in the whole Northern Hemisphere. ", "It has traditionally been seen as a weed species associated with the cultivation of wheat. ", "TCI procured naturally occurring germ plasm from all over the world and selectively bred it over a period of years,” ​he said. ", "​\n\nNatural positioning, traceability benefits​\n\nThat natural breeding process is a differentiator, Cumberford said. ", "With the big benefits the higher SDA conversion ratio offers, raising those levels in plants has been the target of genetic modification experiments, with DSM and Monsanto cooperating on the commercialization of a GM soybean variety that has enhanced SDA levels. ", "Ahiflower offers a non GMO alternative, an attribute that is becoming increasing attractive as the various mandatory labeling initiatives make their way through the legislative process.", "\n\nThe ingredient offers traceability and sustainability benefits, too, Cumberford said.", "\n\n“In addition to being non GM, it is far more sustainable in the long run as an essential fatty acid source when you look at the issues that marine fatty acids are facing. ", "It is also fully traceable to the fields where it is grown. ", "Flax and chia tend to be highly commoditized oils,”​ Cumberford said. ", "The crop is also one of the plants that can be used as a “break” crop in the UK’s crop rotation system, Cumberford said, and seems to support a large number of insect pollinator species. ", "The crop is currently being grown conventionally, but TCI might look at an organic version if it appeared the market would support it, he said.", "\n\nCumberford said the oil is aimed both at food and supplement markets. ", "In foods, it has applications in sports recovery drinks or as an addition to dairy products to improve their nutritional profiles. ", "The oil is highly refined as is said to have a mile taste. ", "For supplements, Cumberford anticipates it being offered both as a bulk oil and in softgels. ", "As far as price goes, Cumberford said the ingredient will be competitive with existing plant-based omega-3 sources, especially when the more efficient SDA conversion story is taken into account.", "\n\nTechnology accelerator​\n\nCumberford wears a number of hats, including one as vice president of strategic initiatives of the Bent Creek Institute​, based in Asheville, NC. ", "Bent Creek was formed to expand the development natural products businesses in North Carolina.", "\n\n“This is project that was spearheaded by TCI. ", "Bent Creek Institute’s role was to be involved with the business operational plan development,” ​Cumberford said.", "\n\nThat plan including introduction into the North American market. ", "But hard on the heels of that will come the EU, with an application to the European Food Safety Authority in the works. ", "South Korea and Australia are also other potential targets for near-term development, he said." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0006494307308457792, 0.0009443860035389662, 0.0012960167368873954, 0.0005596650880761445, 0.0007720289286226034, 0.0007276157848536968, 0.0007172347395680845, 0.000812354264780879, 0.0009648766717873514, 0.0007004560902714729, 0.0007611042237840593, 0.000683685066178441, 0.0006921998574398458, 0.0007079303613863885, 0.0005693720304407179, 0.0005882077966816723, 0.0006976945442147553, 0.0013862077612429857, 0.0009635722381062806, 0.0006817592075094581, 0.0006051654345355928, 0.0005769229028373957, 0.0006593820871785283, 0.0006082732579670846, 0.0005426693824119866, 0.0007681582355871797, 0.0006714598275721073, 0.0005315539892762899, 0.0007575242780148983, 0.0005572208319790661, 0.0006665397086180747, 0.0006935478886589408, 0.0005668619414791465, 0.0006733047775924206, 0.0005867701838724315, 0.0006375146913342178, 0.0006350640906020999, 0.0005925368750467896, 0.0006249814759939909, 0.000562771805562079 ]
0.00071
40
[ "Premierul Ludovic Orban a anunţat vineri seară, la Piteşti, că toţi prefecţii şi subprefecţii numiţi în timpul guvernării anterioare vor fi schimbaţi după turul al doilea al alegerilor prezidenţiale, potrivit Agerpres.", "\n\n\"Acum i-am lăsat pe prefecţi să organizeze alegerile, că dacă ne apucam să schimbăm prefecţii, imediat ne-ar fi acuzat (...). ", "Îi batem cu prefecţii lor şi îi batem de le sună apa în cap cu prefecţii lor\", a spus Orban în cadrul unei întâlniri cu membrii organizaţiei PNL Argeş.", "\n\n\"Pe de altă parte, prefectul e reprezentantul guvernului în fiecare judeţ, nu putem accepta să lucrăm cu cei pe care i-a pus Dăncilă sau mai ştiu eu ce pesedist (...). ", "Ei, dacă ar fi avut demnitate, ar fi venit şi şi-ar fi scris demisia, pentru că aşa procedează normal un om care înţelege că el este pe sens invers, că nu poate să reprezinte guvernul PNL şi al opoziţiei în judeţ. (...) ", "Încă mai au timp să-şi scrie demisiile după alegeri, dacă nu şi le scriu, cu siguranţă vom înlocui toţi prefecţii şi toţi subprefecţii, nu există niciun fel de dubiu în privinţa asta\", a adăugat premierul.", "\n\nEl a anunţat că vor avea loc schimbări şi la conducerile instituţiilor din judeţe, dar a subliniat că toate funcţiile trebuie să fie ocupate de oameni competenţi, în mod transparent.", "\n\n\"În privinţa celorlalte instituţii care funcţionează la nivel judeţean, v-o spun foarte clar, 'depesedizarea' e necesară, dar pe de altă parte, înlocuirea lor nu trebuie să se facă pe alte criterii decât de profesionalism, de corectitudine, de ocupare a poziţiilor publice ca urmare a unor concursuri drepte, transparente, care să permită ca în funcţiile de conducere să ajungă cei mai buni oameni\", a precizat Ludovic Orban.", "\n\nEditor web: Liviu Cojan" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.10150104016065598, 0.09768078476190567, 0.03544216975569725, 0.12226512283086777, 0.07883627712726593, 0.06302652508020401, 0.18057939410209656, 0.02204347588121891, 0.0009827641770243645 ]
0.07804
9
[ "Q:\n\nBash script to convert from HTML entities to characters\n\nI'm looking for a way to turn this:\nhello &lt; world\n\nto this:\nhello < world\n\nI could use sed, but how can this be accomplished without using cryptic regex?", "\n\nA:\n\nTry recode (archived page; GitHub mirror; Debian page):\n$ echo '&lt;' |recode html..ascii\n<\n\nInstall on Linux and similar Unix-y systems:\n$ sudo apt-get install recode\n\nInstall on Mac OS using:\n$ brew install recode\n\nA:\n\nWith perl:\ncat foo.html | perl -MHTML::Entities -pe 'decode_entities($_);'\n\nWith php from the command line:\ncat foo.html | php -r 'while(($line=fgets(STDIN)) !", "== FALSE) echo html_entity_decode($line, ENT_QUOTES|ENT_HTML401);'\n\nA:\n\nAn alternative is to pipe through a web browser -- such as: \necho '&#33;' | w3m -dump -T text/html\nThis worked great for me in cygwin, where downloading and installing distributions are difficult.", "\nThis answer was found here\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0007294779061339796, 0.0009914799593389034, 0.0006769525934942067, 0.0008187796920537949 ]
0.000804
4
[ "John Peterson, U.S. Department of Health and Human Services- National Institutes of Health News\n\nThis National Institutes of Health News article documents a study being done to use two compounds associated with Florida red tide to treat mucus build-up related to cystic fibrosis. ", "Researchers began looking at the toxins associated with red tide to create \"anti-toxins,\" which led them to question the anti-toxin's usefulness in fighting cystic fibrosis." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0010618692031130195, 0.001994309015572071 ]
0.001528
2
[ "Effects of petroleum contamination on soil microbial numbers, metabolic activity and urease activity.", "\nThe influence of petroleum contamination on soil microbial activities was investigated in 13 soil samples from sites around an injection water well (Iw-1, 2, 3, 4) (total petroleum hydrocarbons (TPH): 7.5-78 mg kg(-1)), an oil production well (Op-1, 2, 3, 4, 5) (TPH: 149-1110 mg kg(-1)), and an oil spill accident well (Os-1, 2, 3, 4) (TPH: 4500-34600 mg kg(-1)). ", "The growth rate constant (μ) of glucose stimulated organisms, determined by microcalorimetry, was higher in Iw soil samples than in Op and Os samples. ", "Total cultivable bacteria and fungi and urease activity also decreased with increasing concentration of TPH. ", "Total heat produced demonstrated that TPH at concentrations less than about 1 g kg(-1) soil stimulated anaerobic respiration. ", "A positive correlation between TPH and soil organic matter (OM) and stimulation of fungi-bacteria-urease at low TPH doses suggested that TPH is bound to soil OM and slowly metabolized in Iw soils during OM consumption. ", "These methods can be used to evaluate the potential of polluted soils to carry out self-bioremediation by metabolizing TPH." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0005795802571810782, 0.0005498692626133561, 0.000582279812078923, 0.0010486795799806714, 0.0006968812667764723, 0.0006621888605877757, 0.0013983333483338356 ]
0.000788
7
[ "Q:\n\nSeparating class code into a header and cpp file\n\nI am confused on how to separate implementation and declarations code of a simple class into a new header and cpp file. ", "For example, how would I separate the code for the following class?", "\nclass A2DD\n{\n private:\n int gx;\n int gy;\n\n public:\n A2DD(int x,int y)\n {\n gx = x;\n gy = y;\n }\n\n int getSum()\n {\n return gx + gy;\n }\n};\n\nA:\n\nThe class declaration goes into the header file. ", "It is important that you add the #ifndef include guards, or if you are on a MS platform you also can use #pragma once. ", "Also I have omitted the private, by default C++ class members are private.", "\n// A2DD.h\n#ifndef A2DD_H\n#define A2DD_H\n\nclass A2DD\n{\n int gx;\n int gy;\n\npublic:\n A2DD(int x,int y);\n int getSum();\n\n};\n\n#endif\n\nand the implementation goes in the CPP file:\n// A2DD.cpp\n#include \"A2DD.h\"\n\nA2DD::A2DD(int x,int y)\n{\n gx = x;\n gy = y;\n}\n\nint A2DD::getSum()\n{\n return gx + gy;\n}\n\nA:\n\nIn general your .h contains the class defition, which is all your data and all your method declarations. ", "Like this in your case:\nA2DD.h:\n\nclass A2DD\n{\n private:\n int gx;\n int gy;\n\n public:\n A2DD(int x,int y); \n int getSum();\n};\n\nAnd then your .cpp contains the implementations of the methods like this:\nA2DD.cpp:\n\nA2DD::A2DD(int x,int y)\n{\n gx = x;\n gy = y;\n}\n\nint A2DD::getSum()\n{\n return gx + gy;\n}\n\nA:\n\nIt's important to point out to readers stumbling upon this question when researching the subject in a broader fashion that the accepted answer's procedure is not required in the case you just want to split your project into files. ", "It's only needed when you need multiple implementations of single classes. ", "If your implementation per class is one, just one header file for each is enough.", "\nHence, from the accepted answer's example only this part is needed:\n#ifndef MYHEADER_H\n#define MYHEADER_H\n\n//Class goes here, full declaration AND implementation\n\n#endif\n\nThe #ifndef etc. ", "preprocessor definitions allow it to be used multiple times.", "\nPS. ", "The topic becomes clearer once you realize C/C++ is 'dumb' and #include is merely a way to say \"dump this text at this spot\".", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0006341668777167797, 0.0007162129622884095, 0.0031078748870640993, 0.0007372781401500106, 0.0007218251121230423, 0.0052228402346372604, 0.0009414752130396664, 0.0006386162713170052, 0.0007228897302411497, 0.003103127470239997, 0.0006044475012458861, 0.0009656914044171572, 0.10779590159654617, 0.0019954426679760218 ]
0.009136
14
[ "Background\n==========\n\nAlmost sixty years ago, J. Haldane suggested that malaria had selected hemoglobinopathies to high gene frequencies in malaria-endemic areas due to the protection they confer against this life-threatening disease \\[[@B1]\\]. ", "This \\\"malaria hypothesis\\\" is now the paradigm of evolutionary selection by infectious diseases, and malaria is considered the strongest known force in this regard \\[[@B2]\\]. ", "Continuing this early finding a major goal of medical genetics during the last two decades has been to unravel the influence of host\\'s genetics on susceptibility or pathogenesis of common diseases and find specific associations of human genetic variations with these diseases \\[[@B3],[@B4]\\].", "\n\nWhile in case of malaria it is obvious that genetic variations of the erythrocyte -- target of the malaria parasite *Plasmodium*-- can prevent or modulate disease, host proteins involved in pathogen recognition and defense may also be of pathophysiological importance in malaria \\[[@B5]\\] and other infectious diseases. ", "The discovery of the toll-like receptor (TLR) system and of central signaling molecules has improved our understanding of host-pathogen interaction in many infectious diseases \\[[@B6]\\]. ", "Genetic variations within this system have been found and some relate to disease susceptibility and manifestation \\[[@B7]\\]. *", "In vitro*and *in vivo*data point to TLRs -2, -4 and -9 to be central for *Plasmodium*recognition and subsequent inflammatory host responses \\[[@B8]-[@B14]\\]. ", "The Toll-interleukin 1 receptor (TIR) domain containing adaptor protein (*TIRAP*, also known as Mal) mediates downstream signaling of TLR-2 and TLR-4, eventually inducing pro-inflammatory responses \\[[@B15]\\]. ", "Recently, an S180L single nucleotide polymorphism (SNP) of *TIRAP*has been reported to diminish TLR-2 signaling and to occur at a prevalence of some 30% among healthy subjects in the UK and in 2--6% among individuals from West and East Africa. ", "Heterozygosity for this SNP has been claimed to confer protection against malaria and severe malaria to an extent comparable to HbAS, and in addition, to more than halve the risks of bacteremia and tuberculosis in African populations \\[[@B16]\\]. ", "In an attempt to verify these broad and evolutionary important effects, we screened for *TIRAP*S180L in a Ghanaian population exposed to holoendemic malaria transmission, and examined the role of the SNP in Caucasian and Asian patients affected by sepsis or leprosy.", "\n\nMethods\n=======\n\nStudy groups\n------------\n\nWe examined *TIRAP*S180L (rs8177374) in four groups of individuals: i) 1095 delivering women were recruited at the Presbyterian Mission Hospital in hyper- to holoendemic Agogo, Ashanti Region, Ghana in 2000 and in 2006. ", "Diagnosis of placental *Plasmodium falciparum*infection by PCR and malariological indices of the majority of women have been described elsewhere. ", "Briefly, although roughly half of the woman were infected by *Plasmodium falciparum*as evidenced by specific PCR assays, only 4.5% were febrile. ", "Still, anaemia (hemoglobin \\< 11 g/dL) and low birth weight (\\< 2500 g) occurred in 33% and 15%, respectively, of woman with live singleton delivery (median age: 25, range 15--47) \\[[@B17]\\]. ", "ii) 223 patients with sepsis (mean age: 61.4 ± 12.3, male/female: 138/85) and 188 controls without infection (mean age: 62.0 ± 12.5, male/female: 122/66) were recruited at the intensive care unit, Department of Surgery and Surgical Oncology, Robert-Rössle-Klinik, Charité -- University Medicine Berlin, Germany, as part of a retrospective case-control study on the influence of different SNPs on sepsis following surgery. ", "Site of infection, relevant microorganisms detected, type of surgery, and infectious complications were recorded (Table [1](#T1){ref-type=\"table\"}). ", "Sepsis was defined according to standard criteria \\[[@B18]\\]. ", "iii) 263 leprosy patients (mean age, 31.1 ± 15.6; male/female, 160/103), from north-west Bangladesh were randomly chosen from the COLEP study \\[[@B19]\\]. ", "280 healthy controls were taken from the same study (mean age: 25.2 ± 14.8, male/female: 140/131, data from 9 samples are not available). ", "Patients were classified as paucibacillary (n = 245) or multibacillary (n = 18) according to the 1998 World Health Organization classification for treatment purposes at the Rural Health Program Bangladesh in 2002 and 2003 \\[[@B20]\\]. ", "iiii) 60 leprosy patients (mean age: 64.0 ± 12.6, male/female: 45/15, lepromatous: n = 50 and tuberculoid leprosy: n = 10) from Turkey, all of Turkish descent, were recruited at the Leprosy Hospital, Elazig, and Akdeniz University, Antalya, Turkey. ", "Diagnosis was based on clinical findings and laboratory tests. ", "Blood smears were analyzed from all patients, skin biopsies were taken from all tuberculoid leprosy patients and most of the lepromatous leprosy patients. *", "M. leprae*was identified by the detection of acid-fast bacilli and specific histopathological changes. ", "Differential diagnoses, including granulomatous disease, syphilis, tuberculosis, sarcoidosis, and deep fungal infection, were excluded by clinical and laboratory criteria. ", "One hundred asymptomatic control subjects were recruited from the same centers and had neither a family history nor symptoms related to leprosy (mean age: 43.7 ± 10.5, male/female: 45/55).", "\n\n###### \n\nDetailed description of sepsis patients\n\n ----------------------------------------------------------------------------------------------------------------------\n **Cohort (n = 223)** **Characteristic** ^a^**Ser/Ser**\\ ^a^**Ser/Leu**\\ ^a^**Leu/Leu**\\\n **(n = 170)** **(n = 43)** **(n = 10)**\n ----------------------------- ---------------------------------- ----------------- ----------------- -----------------\n **No (%) of patients** **Co-existing diseases** \n\n 103 (46.2) Arterial hypertension 77 (74.8) 22 (21.4) 4 (3.9)\n\n 82 (36.8) Myocardial disease 67 (81.7) 14 (17.0) 1 (1.2)\n\n 53 (23.8) Diabetes 35 (66.0) 14 (26.0) 4 (7.5)\n\n 52 (23.3) Lung pathology 44 (84.6) 6 (11.5) 2 (3.8)\n\n 16 (7.2) Renal pathology 11 (68.8) 4 (25.0) 1 (6.3)\n\n \n\n **No (%) of patients** **Type of surgery** \n\n 76 (34.1) Upper-GI resection 58 (76.3) 16 (21.1) 2 (2.6)\n\n 62 (27.8) Colorectal resection 46 (74.2) 12 (19.4) 4 (6.5)\n\n 50 (22.4) ^b^Other abdominal 37 (74.0) 10 (20.0) 3 (6.0)\n\n 15 (6.7) Thoracic 11 (73.4) 3 (20.0) 1 (6.7)\n\n 20 (9.0) Limb and others 18 (90.0) 2 (10.0) \\- -\n\n \n\n **No (%) of infections** **Type of Infection** \n\n 92 (41.3) Pneumonia 68 (73.9) 20 (21.7) 4 (4.3)\n\n 38 (17.0) Peritonitis 27 (71.1) 9 (23.7) 2 (5.3)\n\n 65 (29.2) Abscess 52 (80.0) 10 (15.4) 3 (4.6)\n\n 4 (1.8) Urinary tract infections 3 (75.0) 1 (25.0) \\- -\n\n 24 (10.8) Other 20 (83.3) 3 (12.5) 1 (4.2)\n\n \n\n **No (%) of infections**^c^ **Microorganisms** \n\n 129 (57.9) Gram-negative 97 (75.2) 25 (19.4) 7 (5.4)\n\n 83 (37.2) Gram-positive 60 (72.3) 18 (21.7) 5 (6.0)\n\n 15 (6.7) Fungi 13 (86.7) 2 (13.3) \\- -\n\n 31 (13.9) Polymicrobial 19 (61.3) 9 (29.0) 3 (9.8)\n\n 24 (10.8) Clinically diagnosed 15 (62.5) 8 (33.3) 1 (4.2)\n\n \n\n **No (%) of patients** **Morbidity and Mortality** \n\n 114 (51.1) Sepsis without organ dysfunction 90 (78.9) 22 (19.3) 2 (1.8)\n\n 109 (48.9) Severe sepsis and septic shock 80 (73.4) 21 (19.3) 8 (7.3)^d^\n\n 28 (12.6) Mortality ICU 21 (75.0) 6 (21.4) 1 (3.6)\n\n 34 (15.3) Mortality hospital 26 (76.5) 7 (20.6) 1 (2.9)\n ----------------------------------------------------------------------------------------------------------------------\n\n^a^Ser/Ser indicates wildtype, Ser/Leu indicates heterozygous and Leu/Leu indicates homozygous individuals. ", "^b^Other abdominal operations: pancreas-, liver- and multiple visceral organ resection. ", "^c^Numbers might exceed total number of infections due to multiple or no detections. ", "^d^Increased frequency of Leu/Leu in patients with severe sepsis and septic shock compared to patients without organ dysfunction, 7.3 versus 1.8%, *P*= 0.1. ", "No significant differences were observed by comparing patient characteristics. ", "Abbreviation: ICU: Intensive Care Unit.", "\n\nEthical approval\n----------------\n\nThe study protocols were reviewed and approved by the Committee on Human Research Publication and Ethics, School of Medical Sciences, University for Science and Technology, Kumasi, Ghana, and by the human subject review committees at Humboldt-University Berlin, Germany, and Akdeniz University, Antalya, Turkey, and the institutional guidelines were followed in conducting this study. ", "For the Bangladesh study, written approval was granted by the Ethical Review Committee of Bangladesh Medical Research Council (BMRC/ERC/2001--2004/799 and BMRC/ERC/2004--2007/120.", "\n\nSample size calculations\n------------------------\n\nFor this exploratory survey, no definite sample size calculation was performed. ", "However, considering published average prevalences of *TIRAP*S180L of 30% in Caucasians, Asians and 4% in Africans \\[[@B16]\\], and 33% in Bangladesh, this study had a power of 80% at a 95% confidence level to display risk reductions (odds ratios) of 0.27, 0.50, 0.22, and 0.56 for malaria, sepsis, leprosy (Turkey) and leprosy (Bangladesh), respectively.", "\n\nGenotyping\n----------\n\nDNA was extracted from blood by standard techniques. ", "Genotyping for *TIRAP*S180L was carried out by melting curve analysis employing the Lightcycler 480 device (Roche Diagnostics, Mannheim, Germany) using the following primers and probes: sense primer: GCCAGGCACTGAGCAGTAGT, antisense primer: GTGGGTAGGCAGC-TCTTCTG, anchor probe: Red640-GATGGTGCAGCCCTCGGCCCC, and sensor probe: AGGCCCAACAGCAGGG-FL. ", "The melting peaks are at 53°C and 62°C for the wildtype and the mutated sequences, respectively. ", "Due to secondary structures and allele biased amplification within the region of this SNP, analysis of heterozygous genotypes may sometimes result in false homozygous results. ", "Therefore, all mutated samples were reanalysed by conventional RFLP method described by Khor et al. ", "\\[[@B16]\\]. ", "Genomic DNA was amplified with following primers: CTCCAGGGGCCGAGGGCTGCACCATCCCCATGCTG and TACT-GTAGCTGAATCCCGTTCC. ", "The resulting PCR product was digested with BstXI and analysed by gel electrophoresis.", "\n\nStatistical analysis\n--------------------\n\nComparison of proportions of heterozygous and wild type individuals was done by χ^2^or Fisher\\'s exact test, as applicable.", "\n\nResults\n=======\n\nThe prevalence of *TIRAP*S180L among German controls of 26.6% (allele frequency, 19.2%) closely matched the reported figure from the United Kingdom \\[[@B16]\\]. ", "Surprisingly, however, we detected the heterozygous *TIRAP*S180L variant in only one (0.1%) out of 1095 individuals from malaria holoendemic Ghana. ", "This asymptomatic woman had a placental *P. falciparum*infection with a mean of 28 parasites/microscopic high power field, and prematurely delivered a child of low birth weight. ", "The mere absence of the SNP in more than 500 *P. falciparum*non-infected women rendered statistical analysis meaningless (Table [2](#T2){ref-type=\"table\"}).", "\n\n###### \n\nFrequency of the *TIRAP-*S180L variant in different populations\n\n No. ", "of individuals with genotype (%) \n -------------------------- ----- ------ -------------------------------------- ----------- ------------ ------\n Ghana, delivering women \n  *P. falciparum*positive 541 0.1 540 (99.8) 1 (0.2) 0 (0) 0.49\n  *P. falciparum*negative 554 0 554 (100) 0 (0) 0 (0) \n Germany \n  Sepsis patients 223 18.1 170 (76.2) 43 (19.3) 10 (4.5) 0.19\n  Controls 188 19.2 138 (74.4) 48 (25.5) 2 (1.1)^b^ \n Bangladesh \n  Leprosy patients 263 16.3 186 (70.7) 68 (25.9) 9 (3.4) 0.22\n  Controls 280 17.2 188 (67.1) 88 (31.5) 4 (1.4) \n Turkey 0.11\n  Leprosy patients 60 10.8 47 (78) 13 (21) 0 (0) \n  Controls 100 6.5 88 (88) 11 (11) 1 (1) \n\n^a^Comparison of proportions of heterozygotes and wildtype individuals by χ^2^or Fisher\\'s exact test, as applicable. ", "^b^*P*value = 0.04, for comparison of homozygous 180L individuals and other individuals. ", "Differences of allele frequencies are not significant.", "\n\nIn the German sepsis study, the heterozygous *TIRAP*S180L genotype was frequent but there was no significant association with the risk of developing sepsis. ", "Nevertheless, heterozygosity was slightly more frequent in controls than in patients, 25.5% versus 19.3%, respectively (*P*= 0.19, Table [2](#T2){ref-type=\"table\"}), potentially indicating some advantage when the heterozygous genotype was present. ", "In contrast, the homozygous *TIRAP*180L genotype was significantly more frequent in patients, (4.5 versus 1.1%, *P*= 0.04, Table [2](#T2){ref-type=\"table\"}), indicating this genotype to potentially be a risk factor for developing sepsis. ", "This is also being reflected by a trend showing a slightly increased frequency of the homozygous *TIRA*P 180L within the patient group of severe sepsis and septic shock compared to septic patients without organ dysfunction (7.4 versus 1.7%, *P*= 0.1, Table [1](#T1){ref-type=\"table\"}).", "\n\nBoth leprosy studies showed no significant association either of heterozygosity or homozygosity with leprosy (Table [2](#T2){ref-type=\"table\"}). ", "Again, we found a slightly enhanced frequency of heterozygosity in controls from Bangladesh compared to leprosy patients, 31.4% versus 25.9% (*P*= 0.22), also potentially indicating some degree of advantage of the heterozygous mutation for leprosy. ", "The small study from Turkey showed controversial results. ", "We observed heterozygous *TIRAP*S180L in 11% of control individuals, but more frequently, 22%, in leprosy patients (Table [2](#T2){ref-type=\"table\"}). ", "However, the sample number of this study is too low for significant conclusions.", "\n\nDiscussion\n==========\n\nWe here report the virtual absence of a putatively malaria-protective SNP in an area of holoendemic malaria transmission in West Africa. ", "This not only contrasts the published prevalence among African populations of 2--6% \\[[@B16]\\], also, and more importantly, it argues against clinical-epidemiological relevance in malaria and against the hypothesis that malaria has exerted significant positive selective pressure on the presence of this SNP. ", "According to Haldane\\'s malaria hypothesis \\[[@B1],[@B2]\\], higher frequencies of this SNP than reported and observed here should be expected in highly malaria-endemic areas considering the postulated protective effect against this disease of 42--96% \\[[@B16]\\]. ", "We are at loss to explain the discrepancy between the reported prevalences of 5.9 and 3.4% among control populations in such distantly located African countries as The Gambia and Kenya and the 0.1% we found in Ghana. ", "Nevertheless, the latter figure -- particularly when facing the 15--30% in Caucasians -- strongly argues against an expected positive selection of a malaria-protective trait in Africa. ", "The absence of homozygosity for *TIRAP*180L in the African studies could suggest a state of balanced polymorphism due to a yet unknown disadvantage in homozygotes and acting against relevant allele frequencies. ", "A homozygous disadvantage has been claimed for Caucasians with respect to a slightly increased risk for invasive pneumococcal disease and pneumococcal empyema \\[[@B16]\\]. ", "One theoretical limitation of the present study is that we examined predominantly asymptomatic women with or without placental *P. falciparum*infection. ", "Thus, potential protective features of the SNP could be missed in individuals with non-severe malaria. ", "However, in The Gambia the risk reductions in terms of severe malaria and \\\"general malaria\\\" were very similar \\[[@B16]\\]. ", "Ultimately, the extremely low prevalence of heterozygous *TIRAP*S180L in Ghana, where malaria endemicity is among the highest in the world argues against attempts to replicate its putatively protective effect: Given the observed prevalence of heterozygosity of 0.1%, a study able to confirm the reported risk reduction would need to comprise several tens of thousands of individuals to have sufficient statistical power. ", "This, in turn, is even another argument against the presumed clinical relevance of this mutation in Africa.", "\n\nHeterozygosity for *TIRAP*S180L has been suggested to be protective not only against malaria but also against bacterial infections including invasive pneumococcal disease, pneumococcal empyema, overall and pneumococcal bacteremia, and tuberculosis \\[[@B16]\\]. ", "In our study populations from Germany, Bangladesh, and Turkey we found allele frequencies of 19, 17, and 6.5%, respectively. ", "However, we only found very limited evidence for heterozygosity being protective in both, sepsis and leprosy patients. ", "Likewise, within the subgroup of sepsis patients suffering from pneumonia no significant protection of heterozygosity could be observed (Table [1](#T1){ref-type=\"table\"}). ", "In the sepsis study, the proportion of heterozygous *TIRAP*S180L genotype seem to be influenced by co-existing diseases such as Diabetes and renal pathology, however, there is no significant difference (Table [1](#T1){ref-type=\"table\"}). ", "In contrast, we found at borderline significance an increased frequency of homozygosity in sepsis patients (p = 0.04, Table [2](#T2){ref-type=\"table\"}). ", "This is in line with the data reported by Khor et al. ", "\\[[@B16]\\], who also showed an increased, but not significant, frequency of homozygosity in invasive pneumococcal disease and pneumococcal empyema. ", "However, larger studies are needed to verify whether heterozygosity is protective or homozygosity is a risk factor. ", "Remarkably also, in a recent study from Ghana, Russia and Indonesia, *TIRAP*S180L also failed to show any association of heterozygosity with tuberculosis in any population. ", "Of note, this study also found a very low allele frequency for the *TIRAP*S180L of only 0.08% in Ghana \\[[@B21]\\].", "\n\nConclusion\n==========\n\nWhile the TLR system has been shown to be critically involved in susceptibility to and manifestation of malaria, we found a very low frequency of the S180L mutation in the TLR downstream mediator *TIRAP*in a highly endemic region arguing against a major role of this SNP in malaria. ", "In our study populations with a relative high prevalence of the *TIRAP*S180L, we found a trend but no significant protection of heterozygosity in sepsis and leprosy. ", "In contrast, in sepsis *TIRAP*180L homozygosity appears to be a risk factor for disease. ", "Taking together our data and those of Khor et al. ", "\\[[@B16]\\], we suggest that there might be a slight protective effect of heterozygous *TIRAP*S180L in several diseases. ", "At the same time homozygous *TIRAP*180L appears to be a risk factor for the same diseases. ", "The specific role of *TIRAP*S180L needs further investigation.", "\n\nCompeting interests\n===================\n\nThe authors declare that they have no competing interests.", "\n\nAuthors\\' contributions\n=======================\n\nSamples were collected by EA, OK, RPS, LO, GB-A, and FPM. ", "Genotyping was performed by LH. ", "Statistics were done by FPM and RPS. ", "LH, UB, FPM, and RRS conceptualized and designed the study. ", "LH, FPM, and RRS wrote the manuscript. ", "All authors read and approved the final manuscript.", "\n\nPre-publication history\n=======================\n\nThe pre-publication history for this paper can be accessed here:\n\n<http://www.biomedcentral.com/1471-2350/10/65/prepub>\n\nAcknowledgements\n================\n\nWe thank the patients and controls participating in this study. ", "Financial support was provided by Charité -- Universitätsmedizin Berlin (grant 2007-486) and the German Research Foundation (to R.R.S). ", "We acknowledge the excellent technical assistance of Diana Woellner and Fränzi Creutzburg (Institute for Microbiology, Charité, Berlin). ", "The Colep study was funded by the American Leprosy Missions and The Leprosy Mission Internaional.", "\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0.0009401413844898343, 0.0007575383642688394, 0.0006602054927498102, 0.0008692725095897913, 0.0005983836017549038, 0.0006153478170745075, 0.0007059539784677327, 0.0009626523242332041, 0.0006250082515180111, 0.0007160661625675857, 0.0006525611388497055, 0.0006928680813871324, 0.0007609381573274732, 0.00366921816021204, 0.0007991197053343058, 0.0006873616366647184, 0.0005913281347602606, 0.000886053079739213, 0.0006600658525712788, 0.0005426205461844802, 0.0005767269176431, 0.0008498235838487744, 0.0005804161191917956, 0.001688310643658042, 0.0008778683841228485, 0.0009514468256384134, 0.0007461188943125308, 0.0032550678588449955, 0.0008212520042434335, 0.00061755784554407, 0.002163992263376713, 0.000580398365855217, 0.0006539301830343902, 0.0005385148106142879, 0.0005133799859322608, 0.0006250353762879968, 0.0007338141440413892, 0.0011732213897630572, 0.002002433408051729, 0.0006019991124048829, 0.0008846400887705386, 0.0006013640086166561, 0.001564759761095047, 0.023508107289671898, 0.0006850619101896882, 0.0006548822275362909, 0.0005872456822544336, 0.0008006388670764863, 0.14825890958309174, 0.0012749977177008986, 0.0007171359611675143, 0.0018765678396448493, 0.003907444886863232, 0.0006722375401295722, 0.0014657813590019941, 0.0006232562009245157, 0.0012748793233186007, 0.0014245123602449894, 0.0007193420897237957, 0.0006814717780798674, 0.0005605707410722971, 0.0007114001200534403, 0.0006022946909070015, 0.0007807847578078508, 0.0006482929456979036, 0.0007356961723417044, 0.0007189928437583148, 0.0005796222249045968, 0.0009715761989355087, 0.013053731992840767, 0.002151751657947898, 0.0008393387543037534, 0.0006857863627374172, 0.000619718455709517, 0.0006233705207705498, 0.0013842935441061854, 0.0005601669545285404, 0.0008620551670901477, 0.0007176948129199445, 0.0006966899964027107, 0.0006659755017608404, 0.0006609682459384203, 0.0036987592466175556, 0.000711108383256942, 0.0005946003366261721, 0.0007204417488537729, 0.0006701889215037227, 0.0009564875508658588, 0.001439765328541398, 0.000623137631919235, 0.001592016313225031, 0.018447354435920715, 0.0005996378604322672, 0.0006653296877630055, 0.0006962647894397378, 0.0008023259579204023, 0.0005933404318057001, 0.0005907576996833086, 0.0006488136714324355, 0.000526786083355546, 0.000590645126067102, 0.0005674368585459888, 0.0005337861948646605, 0.0006774772773496807, 0.0019954426679760218 ]
0.002847
105
[ "Architects: Showcase your work and find inspiration for your next project through Architizer, and enter the One Drawing Challenge for a chance to win $2,500!", "\n\nHistorically, religious architecture across Japan has often possessed imported styles from other East Asian countries such as China and South Korea. ", "However, the temples of Japan have rarely been a direct translation of their Asian counterparts due to large variations in climate, leading architects to incorporate many different materials. ", "With no strong roots in a historical context, the aesthetic language of Japanese temples has continually evolved over the centuries.", "\n\nToday, many architects designing temples in the country are beginning to focus on the future. ", "When conceiving temples for both rural and urban settings, architects acknowledge the Japanese culture of innovation and experimentation, all the while embracing the age-old values of peaceful introspection and simplicity. ", "This is executed by finding a nuanced balance between contrasting elements: modern materials and natural materials, light and darkness, and open and enclosed spaces.", "\n\nThe following seven projects showcase a truly diverse range of architectural styles for the same programming and intentions. ", "These structures illustrate that temple architecture in Japan continues to evolve, but continues to evoke an atmosphere that chimes with the timeless values of the country.", "\n\nEkoin Nenbutsudo by Yutaka Kawahara Design Studio, Tokyo, Japan\n\nModern frames and materials take into consideration the temple’s urban context, while a green terrace shrouds the building on all sides to incorporate a natural element.", "\n\nWhite Temple by Takashi Yamaguchi & Associates, Kyoto, Japan\n\nA single rectangular volume contrasts with the more traditional architecture of its surroundings, representing the value of looking to the future.", "\n\nKoenji Temple by Schri Kakinuma, Fukuoka, Japan\n\nWood is the main material used for both the exterior and interior of this temple, but a wide range of types and shades of wood create different moods in different places.", "\n\nShinkoji Temple by MAMIYA SHINICHI DESIGN SUTUDIO, Aichi Prefecture, Japan\n\nWhile the mass of the concrete exterior creates enclosed spaces for introspection, strategically placed glass openings throughout give this temple beautiful moments of light and openness.", "\n\nTemple Harajuku by Ciel Rouge Creation, Tokyo, Japan\n\nThe repetition of six softly curved arches were not just designed for acoustics but also as a symbol of the sky.", "\n\nGlass Temple by Takashi Yamaguchi & Associates, Kyoto, Japan\n\nA truly abstract modern design, an exposed ground space composed of glass allows light to flood into the underground temple.", "\n\nMyoenji Columbarium by Furumori Koichi architectural design studio, Fukuoka, Japan\n\nSunlight comes down from the skylight through a multiple-piled lattice timber roof, illuminating a room where randomly placed timber columns create a unique and impressive atmosphere.", "\n\nArchitects: Showcase your work and find inspiration for your next project through Architizer, or enter the One Drawing Challenge for a chance to win $2,500!" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0007127257995307446, 0.0006138602620922029, 0.0005430668243207037, 0.000586716749239713, 0.0005366430268622935, 0.0005445894785225391, 0.0006008847849443555, 0.0005314344307407737, 0.0005318682524375618, 0.0006069806986488402, 0.0005503427237272263, 0.0005641448078677058, 0.0005764958332292736, 0.000599206832703203, 0.0006280389497987926, 0.0006378161488100886, 0.0007179476087912917 ]
0.000593
17
[ "Tag Archives: drug monitoring program\n\nNew Jersey Gov. Chris Christie is urging physicians to be more careful about their prescribing habits when it comes to potentially addictive painkillers, and is encouraging their participation in the state’s voluntary drug monitoring program. ", "The comments came at a doctors’ conference where the governor described how deeply affected he has been by the recent death of a close friend due to pain medication, according to this article.", "\n\nOnly about 20 to 25 percent of doctors in the state voluntarily use the program, the article says. ", "Meanwhile, treatment centers in the state reported 7,238 admissions for painkiller addictions in 2010, 12 times more than in 2000, the article adds, citing data from the Substance Abuse and Mental Health Services Administration.", "\n\nA major doctors’ organization is urging its members to practice greater caution and restraint when prescribing prescription painkillers in light of the abuse epidemic. ", "The American College of Physicians said in a policy letter published in the Annals of Internal Medicine that prescription drug abuse is a “serious public health problem” and that physicians and other health professionals with prescribing privileges play an important role in helping to ensure safe and effective use of drugs like OxyContin and Vicodin.", "\n\nAccording to the group, evidence-based, nonbinding guidelines should be established regarding recommended maximum dosage and duration of therapy that a patient taking controlled substance medications may receive.", "\n\nIn addition, the ACP called for the establishment of a national prescription drug monitoring program to help doctors detect and prevent prescription drug abuse by identifying individuals who seek to obtain prescriptions for addictive medications from multiple physicians for themselves or to sell. ", "Former President George W. Bush launched an initiative in 2005 authorizing federal grants for states to establish or enhance PDMPs, the group said, but funding was initially delayed and has been inconsistent.", "\n\nForty-nine states have taken measures to implement prescription drug monitoring databases in light of the pill addiction epidemic, but Missouri lacks such a program — despite the fact that it has the seventh highest drug overdose death rate in the country, a majority of which are from prescription drugs, according to this article.", "\n\nApproximately 3,200 people in Missouri seek treatment for a prescription drug abuse problem each year, and the most commonly used drugs were controlled substances such as Xanax, OxyContin, and Vicodin, the article says, pointing to data from the Missouri Department of Mental Health. ", "Yet efforts to establish a prescription drug monitoring program were stymied when a Missouri senator filibustered the legislation that would have brought the database to the state, citing concerns over patient privacy, the article says.", "\n\nOverdose deaths involving opioid analgesics have shown a similar increase, the CDC found: starting with 4,030 deaths in 1999, the number of deaths increased to 15,597 in 2009 and 16,651 in 2010. ", "Read more...\n\nThe proposed legislation would require coroners to report prescription overdose deaths to the state’s medical board for review, according to the Los Angeles Times, which earlier reported on the nearly 4,000 accidental deaths involving prescription drugs in Southern California and found that in half the cases, drugs that caused or contributed to a death had been prescribed by that person’s physician.", "\n\nThe legislation would also enhance and provide sustained funding for California’s prescription drug monitoring system, known as CURES, which contains detailed data on prescriptions for painkillers, the LA Times said.", "\n\nBetween 2002-2004 and 2008-2010, past year heroin use increased among people reporting past year nonmedical use (PYNMU) of opioid pain relievers, but not among those reporting no PYNMU. ", "Frequent nonmedical users – people reporting 100-365 days of PYNMU – had the highest rate of past year heroin use and were at increased risk for ever injecting heroin and past year heroin abuse or dependence as compared to infrequent nonmedical users (1-29 days of PYNMU).", "\n\nIn 2008-2010, 82.6% of frequent nonmedical users who used heroin in the past year reported nonmedical use of opioid pain relievers prior to heroin initiation compared to 64.1% in 2002-2004. ", "Read more...\n\nThe California Senate has given the stamp of approval to a package of bills aimed at reducing prescription drug abuse and overdose deaths, including a measure that would require coroners to report deaths involving prescription drugs to the Medical Board of California. ", "The Los Angeles Times reports that the Senate also signed off on a bill that would upgrade the state’s prescription drug monitoring program, known as CURES. ", "In addition, lawmakers approved a measure that would make it easier for the medical board to investigate physicians suspected of overprescribing and suspend their prescribing privileges, and a bill that would prohibit pharmacies from advertising commonly abused narcotic medications, such as OxyContin and Vicodin, according to the LA Times.", "\n\nThe package of legislation will now move on to the California Assembly for approval.", "\n\nThe CURES bill faced the strongest opposition from the pharmaceutical and biotech industries, the Times says, even though it had the support of a coalition of law enforcement groups, health insurance companies, and business, labor and consumer organizations. ", "That opposition was dropped after the bill’s sponsors removed a provision that called for a tax on drug makers to pay for teams of investigators to crack down on drug-seeking patients and doctors who recklessly prescribe to them, according to the Times. ", "Read more...\n\nA California Senate committee has given the stamp of approval to a package of bills aimed at reducing prescription drug abuse and overdose deaths, including a measure that would require coroners to report deaths involving prescription drugs to the Medical Board of California. ", "The Los Angeles Times reports that the committee also signed off on a bill that would upgrade the state’s prescription drug monitoring program, known as CURES. ", "In addition, the committee approved a measure that would make it easier for the medical board to investigate physicians suspected of overprescribing and suspend their prescribing privileges, and a bill that would prohibit pharmacies from advertising commonly abused narcotic medications, such as OxyContin and Vicodin, according to the LA Times.", "\n\nBefore moving to the Senate floor, all four bills must clear additional committees, the Times said.", "\n\nThe Times recently issued a report finding that the California Medical Board has repeatedly failed to protect patients from reckless prescribing by doctors: it rarely tries to suspend the prescribing privileges of doctors under investigation, and even when it imposes sanctions, in most cases it allows doctors to continue practicing and prescribing. ", "The Times’ examination of board records and county coroners’ files from 2005 through 2011 found that eight doctors disciplined for excessive prescribing later had patients die of overdoses or related causes; prescriptions those doctors wrote caused or contributed to 19 deaths.", "\n\nIowa has taken an interesting approach towards stopping the practice of seeking out multiple doctors for painkiller prescriptions with a program that “locks” Medicaid recipients into using one doctor, one pharmacy and one hospital. ", "And according to this article, the program appears to be having some positive results: by locking in more patients, the state saved $14.8 million from July 2010 through September 2012 in the cost of drugs and doctors’ visits.", "\n\nThe number of “locked-in” Iowa Medicaid recipients has increased sevenfold from 200 in 2010 to 1,430 in January, the article says, a jump that came after Iowa Medicaid started screening patients not for just doctor-filled prescriptions, but for non-emergency visits to hospital emergency rooms.", "\n\nThe state’s prescription drug monitoring program was launched in March 2009, but only one-quarter of Iowa doctors and prescribers are registered to use the database, which includes more than 4.2 million prescriptions annually, the article says.", "\n\nPrescription painkillers caused 62 deaths in Iowa in 2011, up from just four deaths in 2000, while prescription abuse treatment admissions more than quadrupled from 187 in 1999 to 878 in 2009, according to the Iowa Department of Public Health." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0005782179650850594, 0.0005589626962319016, 0.0006318383966572583, 0.000721649790648371, 0.0007116246270015836, 0.000684992060996592, 0.0005695652216672897, 0.0007155095227062702, 0.0005657346919178963, 0.0007291783113032579, 0.0006445724284276366, 0.0007151918835006654, 0.0011348964180797338, 0.000626400054898113, 0.0006755312206223607, 0.0012687710113823414, 0.004795979242771864, 0.002006244147196412, 0.0005995358806103468, 0.0006269519799388945, 0.0007843142375349998, 0.0005396534688770771, 0.0006963301566429436, 0.0011884198756888509, 0.0005950292106717825, 0.0006043178727850318, 0.0007469935808330774, 0.0006080414750613272, 0.0007197699742391706, 0.0008053561905398965, 0.00066427729325369, 0.0006119815516285598, 0.000600251427385956, 0.0005648784572258592, 0.0007946539553813636 ]
0.00086
35
[ "Laura Freudenthaler\n\nLaura Freudenthaler (born 1984, Salzburg) is an Austrian writer. ", "She studied German language and literature at university. ", "She published a book of short stories titled Der Schädel der Madeleine in 2014. ", "She has also published two novels: Die Königin schweigt (winner of the Förderpreis zum Bremer Literaturpreis in 2018) and Geistergeschichte (winner of the EU Literature Prize in 2019).", "\n\nShe lives in Vienna.", "\n\nReferences\n\nCategory:Austrian writers\nCategory:1984 births\nCategory:Living people\nCategory:People from Salzburg" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0010086774127557874, 0.000723418255802244, 0.0006990389665588737, 0.0011876514181494713, 0.0008061366388574243, 0.0005597322597168386 ]
0.000831
6
[ "Weight loss rules ..\n\nDelete Food Apps ..\n\nEating at a restaurant will increase weight ..\n\nDrinks are also the cause ..\n\nFalse Nutrition Information ..\n\nRestaurant Mentality ..\n\nMany people who are accustomed to restaurants, hotels and food applications aside from home meals often suffer from a variety of health problems, including obesity and hormonal imbalances. ", "So, as part of the weight loss challenge, immediately say goodbye to these food ordering applications and make a good decision.", "We hope you already adhere to the Four Rules as part of the New Year Challenge. ", "When it comes to the latter, there is no man without desires. ", "But it must be said that controlling desires is a little more difficult. ", "However, if you are planning to lose weight, there are certain things that should not be hard.", "In fact, we all think about social media addiction, but there are some applications that can harm our health without our knowledge being installed on our mobile phones. ", "Food ordering applications, not Aveo. ", "They offer discounts and offers, not just on home meals, but on outside hotels. ", "While these may help you meet your unhealthy food cravings, they do more than good.", "Just click on your order and order it. ", "In addition, these applications are taking the world ahead of hotels and restaurants. ", "People often forget the kitchen and rely on these applications. ", "Go to the kitchen, make sure all the ingredients are there, set aside time, cook, and then wash the utensils. ", "But there is nothing in the application, just one click and the food you want will come to you. ", "This is how people feel comfortable. ", "Are you hungry Applications include pizza, french fries and biryani, all within one tap distance. ", "Similarly, if you are thinking about healthy food, instead of looking at your refrigerator and kitchen, look for places on the Internet that advertise that you are serving quality food. ", "We are often deceived into believing the words, if they are said to provide a home-like taste and cleanliness. ", "Kadantara ...Not sure how delicious, healthy and cooked meats are in the hotels and restaurants outside, but they are great. ", "So for now, remove those applications from your phone if at all possible. ", "After that, go to the nearest grocery stores and bring home the essentials. ", "Gradually this habit is seen as not relying on food applications.", "Most of us are in dire situations with habits that order from outside hotels. ", "So much so that you can spend such time playing mobile games. ", "Also, there is no way to get out of the habit. ", "This new year, include the removal of these applications in the decisions you will make. ", "And then notice the changes yourself.", "Even in an emergency, you can stay away from these food apps by calling the restaurant landline, or using friends' apps.", "In fact, many prefer eating in a restaurant with a variety of varieties, rather than at home. ", "You don't have to cook here, someone else does, someone else serves you, at least the characters don't even need to be cleaned. ", "But here's one thing everyone forgets is that these restaurant foods can lead to weight gain and bad fats in the body. ", "The ingredients in restaurant foods are not only weight gainers, but also unhealthy metabolism.", "The meal sizes in the restaurant are a bit larger than the food you usually eat. ", "To appease the average consumer, these restaurants offer a lower rate of food. ", "The priority that restaurants give to money is not keeping the consumer healthy.", "If you must go to a restaurant, tell the server to serve only a second, or a third, of the plate rather than eating it in large quantities. ", "Also avoid ordering high-intake foods.", "It is common in many restaurants to offer drinks before meals. ", "Often this is mainly due to soda beverages or sweetened iced tea. ", "Diners at these restaurants often use 32 ounces of glass for 8 ounces of soda. ", "For this reason, the drink often offered at fast food restaurants is twice as large as the 16 ounces. ", "Wine and cocktails are similarly consumed. ", "A 5-ounce wine has 125 calories, while a 2-ounce dairy has 112 calories. ", "This is why it is advisable to order as much water or un-sweetened tea as possible, without going to the sink.", "Many restaurants may not have these nutritional information. ", "But some restaurants in the meantime are following this policy. ", "If you take a diet based on the nutrients mentioned, there should be no problems. ", "But, unknowingly gain weight and metabolic problems. ", "The reason for this is that the number of calories this restaurant claims to have is wrong. ", "According to Time Health, restaurant meals often contain 18 percent more calories. ", "If you eat a meal that is listed as 500 calories, you are likely to burn 590 calories. ", "Nutritionists say that consuming more than 90 calories more than the calories you need every day will increase your weight by 9 pounds each year. ", "When you see nutritional information in restaurants, beware of counting 20 percent more than the number of calories listedWhen you dine with friends, you are 35 percent more likely to eat without your knowledge. ", "Speaking and eating is another reason for this. ", "Some people forget that the stomach is full.", "According to Purdue University, the restaurant recommends going alone, or with as few people as possible, to avoid weight gain." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0017053475603461266, 0.0005674298154190183, 0.0005956863169558346, 0.0011748848482966423, 0.0006465331534855068, 0.0010175892384722829, 0.0006042139139026403, 0.000731416919734329, 0.0005942567368037999, 0.0012866626493632793, 0.001044932403601706, 0.0005832804599776864, 0.0007564190891571343, 0.0032202061265707016, 0.002432149136438966, 0.0005806214176118374, 0.0009749564924277365, 0.0006120232865214348, 0.0006710111047141254, 0.0006512856343761086, 0.0010218808893114328, 0.0011970726773142815, 0.0005992094520479441, 0.0008372630109079182, 0.0009417475084774196, 0.0010270581115037203, 0.0006238353089429438, 0.0009291812311857939, 0.0006645711255259812, 0.0006996541633270681, 0.0010603731498122215, 0.056652769446372986, 0.000760818540584296, 0.0006559654138982296, 0.0006398204131983221, 0.0006448731874115765, 0.0008000195375643671, 0.0006953785195946693, 0.0005992205697111785, 0.0005766609683632851, 0.0006403200095519423, 0.0007111849263310432, 0.0005956153618171811, 0.0009628921980038285, 0.0009993873536586761, 0.0005675361026078463, 0.0005935124354436994, 0.0007886720122769475, 0.000896889774594456, 0.001185599947348237, 0.0007305872859433293, 0.05931338295340538, 0.003753006225451827, 0.003092943923547864, 0.0007100262446328998, 0.0024626648519188166, 0.0006213022279553115 ]
0.002995
57
[ "Author\nTopic: Logix (Read 954 times)\n\nThe Track Logix was designed to skid through the front part of the lane then react big on the backend. ", "This ball combines the QR-7 Pearl coverstock with the LT-2 core to create a versatile upper-mid performance ball that is easy to throw out to the dry and then it comes right back to the pocket on different oil patterns. ", "The QR-7 Pearl coverstock provides length with backend angularity and continuation. ", "The core of this ball, the LT-2, was designed to store energy for the backend. ", "This ball works best when it is up against medium oil conditions.", "\n\nLogix (Box Surface and 500/2000 and 500/light polish and 500/2000/polish)\n\nPin above the bridge CG to the right diagonally of my ring finger positive axis point is 4 3/8 right 1/2 up.", "\n\nHouse Shot Patterns Fresh and Broken Down\n\nI usually put bowling balls through a series of surface adjustments to see how it rolls and reads the lane off my hand. ", "I cannot say I have seen a cover like the logix, box surface and 500/2000/polish I got that nice length and down lane read the finish is just as strong as the legion solid was. ", "When I put 500/2000 and 500/light polish the cover for me turned into a drastically low RG type ball it literally picked up a little after the arrows skid some more and somehow rolled heavy through the pins it was difficult to predict the reaction but it cleaned the rack when it was flush. ", "I like to see the pins low but it was fun to see the pins in the air on contact. ", "I left this surface adjustment on it to see what would happen on a 3rd/4th game broken down house pattern. ", "I was amazed I was crossing the fourth arrow pretty easily getting it as far right as I could and almost the same reaction, picked up later down the lane skid but this time hooked and roll or just kept hooking into the pocket. ", "That is different for me and at the same time like I said before fun to watch.", "\n\nLogged\n\nWhen you get a chance please check out the track recommendation tool however before doing so I will strongly suggest you go to your local pro shop and ask for assistance with getting your Rev Rate, Tilt, Axis Rotation and Ball Speed.", "Ronald Davis Jr.Track Amateur Staff" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0007455659797415137, 0.0007113442406989634, 0.0005716561572626233, 0.0007114567561075091, 0.0006459323922172189, 0.0014765424421057105, 0.0007658982067368925, 0.000670574780087918, 0.0011041284305974841, 0.0006057274877093732, 0.0005557005060836673, 0.0007528942660428584, 0.0006593145080842078, 0.0005670426762662828, 0.0008302899077534676 ]
0.000758
15
[ "In an online profile on a health website, Emil Shawky Gayed describes himself a “calm” and “sensitive” obstetrician and gynaecologist who has “practised medicine for many years”.", "\n\n“I have always managed to implement all the changes required to be able to provide the best quality care as possible... my approach is sympathetic, warm, and nurturing,” the profile says.", "\n\nDozens of his former patients have a starkly different opinion. ", "They describe him as someone who was rude and irate when questioned, and who dismissed or made light of their complaints of being in severe distress and pain. ", "He has been found guilty by the New South Wales civil and administrative tribunal of professional misconduct for failing to adequately inform patients before performing surgery on them, and of needlessly performing surgeries such as hysterectomy and fallopian tube removal on women who could have been treated with painkillers and bed-rest. ", "One of his patients died.", "\n\n'I still feel mutilated': victims of disgraced gynaecologist Emil Gayed speak out Read more\n\nBut some of the hospitals where Gayed worked have no record of his employment. ", "This is alarming given Gayed is now the subject of two separate inquiries investigating his treatment of women spanning five public hospitals.", "\n\nWhat is known about Gayed is that he graduated from Egypt’s Ain Shams public university in 1976. ", "The University’s faculty of medicine is one of the most highly-regarded medical training faculties in Egypt. ", "A ledger of graduates held at the faculty’s registrar’s office shows Gayed obtained the second-lowest grade of ‘good’ out of a range of four grades ranging from ‘pass’ to ‘excellent’.", "\n\nRecords held by the Egyptian medical syndicate show Gayed registered as a doctor in 1977. ", "Egyptian doctors seeking to work abroad sometimes require a certificate of good standing from the medical syndicate and permission from the ministry of health, depending on the requirements of their workplace. ", "No record of such a letter exists on Gayed’s file with the syndicate. ", "Syndicate records show while he was licensed to practise medicine in Egypt with heavy supervision in a residency or similar program, he would have been unable to practise as a specialist or a GP without a masters degree or further specialisation, which it has no records of him obtaining.", "\n\nBy 1982 Gayed was working overseas. ", "Records from the General Medical Council, responsible for registering doctors to practise in the UK, shows Gayed registered there in 1982. ", "The council has no record of where in the UK he worked or if he received further training there.", "\n\nEmil Shawky Gayed: medical peak body subpoenaed for information in 2000 Read more\n\nBy the 90s Gayed had moved to Australia where he trained to become a specialist gynaecologist and obstetrician. ", "He graduated as a fellow of the Royal Australian College of Obstetricians and Gynaecologists in 1993. ", "While records of the first years Gayed worked in Australia are scarce, it is clear that within several years complaints and concerns arose about his work in his chosen speciality.", "\n\nGayed began working as a locum or visiting medical officer in rural and regional towns in NSW. ", "He often consulted patients in private rooms and performed procedures on them in the public hospitals of those towns. ", "Gayed did stints at Kempsey District hospital between 1990 and 2003, Grafton Base hospital between 1994 and 1995, Cooma hospital between 1994 and 1999, and Manning Base hospital between 1999 and 2016. ", "He filled in for several months as an obstetrician and gynaecologist at Canberra hospital in 1996, and also did some work at Mona Vale hospital on Sydney’s northern beaches between 2002 and 2007. ", "But the bulk of his career was spent in regional communities.", "\n\nAn investigation was first launched into Gayed in 2000 relating to his time working in Cooma, where general practitioners and midwives who worked with him there and in Canberra expressed concerns about his dismissive and uncaring treatment of women. ", "While the Royal Australian and New Zealand College of Obstetricians and Gynaecologists confirmed it was subpoenaed for information about Gayed at the time, it no longer has records of what specific information was requested, or the outcome of any investigation. ", "The ACT health department said it could find no records of Gayed as an employee, including as a contract medical officer or a visiting medical officer. ", "Several senior doctors spoken to by Guardian Australia have confirmed, however, that he did work at Canberra Hospital as a locum in 1996, and that midwives especially had concerns about him. ", "During this time, he performed ablation surgery on his own wife, which involves surgically destroying the lining of the uterus, at the John James private hospital. ", "She was transferred to Canberra hospital’s emergency department after suffering complications.", "\n\nGynaecologist who mutilated women faces inquiry in Australia Read more\n\nBut the bulk of complaints surrounding Gayed relate to his most recent employment as a visiting medical officer at the Manning Rural Referral hospital in the small town of Taree on the mid-north coast of NSW. ", "He consulted at his private clinic in Taree and at private rooms in Dee Why, a northern Sydney suburb 316km south. ", "He appeared to return to his home at Collaroy Plateau, near Dee Why, on weekends, and regularly worshipped at the St Rewis Coptic Orthodox church.", "\n\nAlthough staff at the public hospital and patients had serious concerns about Gayed spanning more than two decades, Gayed’s career did not start to unravel until 2015, when one of his patients made a complaint to the Health Care Complaints Commission. ", "The complaint was made by a woman who nearly died after a procedure Gayed had performed. ", "She mentioned to investigators that Gayed had paid for a friend of hers to get an abortion after he failed to detect she was pregnant before performing a procedure on her that would likely have harmed her unborn child.", "\n\nThis complaint sparked a wider investigation that found seven women received inappropriate medical treatment from Gayed between 2011 and 2016, and that many of them did not give informed consent to major surgery. ", "The investigation found he needlessly removed the uterus of a woman who could have been treated with painkillers and bed rest, and that he removed another woman’s healthy right fallopian tube. ", "After details of their cases were published by Guardian Australia, dozens more women came forward describing traumatic surgeries they did not want or did not need at the hands of Gayed. ", "Some alleged they were left with serious infections and nerve damage.", "\n\nEmil Gayed: concerns raised about disgraced surgeon in Canberra more than 20 years ago Read more\n\nManning hospital scanned Gayed’s ablation records and found ten further patients who Gayed had performed ablation on despite the presence of hyperplasia – which can be an early sign of cancer – in the uterus. ", "Ablation should never be performed on women with hyperplasia because scarring from the procedure can mask cancer growth and trigger the development of cancerous cells. ", "One of Gayed’s patients died after he failed to tell her that tests revealed she had hyperplasia. ", "He performed ablation on her and did not follow- up or refer her to a cancer specialist. ", "The hospital found Gayed had performed hundreds of ablations on women, at a far higher rate than other gynaecologists.", "\n\n\n\nDr Osama Ali, the clinical director of Manning hospital who is now reviewing the cases of more than 45 women who have made further complaints to a hotline the hospital established for Gayed’s patients, said he “struggled to understand why” Gayed performed needless procedures on women.", "\n\n“It’s a question for him to answer, why he’s operated on all these ladies,” Ali said. “", "Whether it’s a matter of money, increasing his skills, recklessness, a lack of insight... I can’t tell. ", "They’re all possibilities.” ", "He said there was never any indication that Gayed was mentally unwell.", "\n\nThe NSW Medical Board is now also under review for its responses to ‐ and management of ‐ historical complaints about Gayed.", "\n\nThe Guardian has tried to contact Gayed to comment on the accusations against him, but he has not returned calls. ", "His current whereabouts is unknown.", "\n\nAdditional reporting by Adham Youssef in Cairo." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.03956799954175949, 0.0005442866822704673, 0.0006045901100151241, 0.023062411695718765, 0.008743123151361942, 0.004413694608956575, 0.01814146153628826, 0.09728007018566132, 0.049771249294281006, 0.0006842593429610133, 0.016502495855093002, 0.016658619046211243, 0.0005119904526509345, 0.05515637248754501, 0.0005842070677317679, 0.19390809535980225, 0.04390859976410866, 0.0005539656849578023, 0.02610863745212555, 0.008951861411333084, 0.009638922289013863, 0.008525889366865158, 0.0005864212871529162, 0.025402847677469254, 0.001667613280005753, 0.0006949724047444761, 0.020498210564255714, 0.017808174714446068, 0.019879575818777084, 0.0005735638551414013, 0.008696901611983776, 0.0008070801850408316, 0.062262412160634995, 0.0007108769495971501, 0.0013012622948735952, 0.005698853638023138, 0.27697229385375977, 0.0091478256508708, 0.019373709335923195, 0.00632065674290061, 0.09974560886621475, 0.0028049107640981674, 0.003212649142369628, 0.04079698398709297, 0.2785162031650543, 0.0661945566534996, 0.45225852727890015, 0.023648913949728012, 0.0106659522280097, 0.001732040662318468, 0.008683030493557453, 0.6445075273513794, 0.04776114970445633, 0.030957208946347237, 0.0006562449270859361, 0.0006269955774769187 ]
0.050268
56
[ "Preggy Belly Tale #2: My Very Big Belly!", "\n\nFor such a petite person—or maybe because of it—at about ten weeks, my tummy shows already! ", "It literally pops out of my small frame! ", "Look at how big I am. ", "I should have shirts made that indicate how many weeks along I am and the line, “It’s big, I know!”", "\n\nIronically, when my back is turned to you, I don’t look pregnant. ", "So, this presents a problem when I’m walking very slowly up the MRT stairs. ", "The line behind me can get very long. ", "So I need another shirt that has this printed at the back, “Buntis ako. ", "Mauna ka na!”", "\n\nThe reason I show right away when I’m pregnant is because I actually have a big tummy even though I’m thin. ", "When I’m not pregnant (which is every other year since 2007), I’m always conscious to “tuck my tummy in.” ", "When I’m pregnant, I can breathe properly! ", "So, there. ", "My secret’s out of the bag. ", "Once I deliver this third child, I better get cracking on my stomach crunches!" ]
{ "pile_set_name": "Pile-CC" }
[ 0.09459026902914047, 0.010464551858603954, 0.0064957584254443645, 0.005648999009281397, 0.012797149829566479, 0.10305017977952957, 0.0012447620974853635, 0.0010804376797750592, 0.016891902312636375, 0.00783454068005085, 0.0332360677421093, 0.0978945717215538, 0.009436463005840778, 0.0009017642005346715, 0.014761392958462238, 0.13116596639156342 ]
0.034218
16
[ "Josep M. Armengol\n\nJosep María Armengol Carrera (Barcelona, 4 July 1977) is a Spanish literary scholar and researcher in the field of gender and masculinity studies.", "\n\nCareer \n\nBA and PhD in English from the University of Barcelona (2006), having authored the first doctoral thesis in Spain on cultural and literary representations of masculinity. ", "In 2007 he moved to the Center for the Study of Men and Masculinities at Stony Brook University, USA, where he carried out his postdoctoral research together with Dr. Michael Kimmel.", "\n\nSubsequently, he moved to the Universidad de Castilla-La Mancha, working as of 2012 as Associate Professor (accredited as Full Professor in 2018) in gender studies and American literature.", "\n\nAs part of his work on literary representations of African-American masculinities, he argued the centrality of race to James Baldwin's Giovanni’s Room, which had been traditionally studied as a book on homosexuality rather than ethnicity.", "\n\nBesides being a postdoctoral fellow of the Fulbright-SAAS program in the USA (2016), in 2018 he became the Principal Investigator of the MASCAGE project, focused on representations of masculinity and aging in contemporary European literatures and cinemas, and funded by the Gendernet-Plus Era-Net Co-fund program of the European Union.", "\n\nArmengol is also Editor of the international journal Men and Masculinities as well as the \"Masculinity Studies\" series Editor at Peter Lang publishing. ", "He is also cited as one of the fundamental experts in the study of \"Hegemonic Masculinity\" and \"alternative\" masculinities. ", "His research has been published in international journals such as Signs, Journal of Gender Studies, Men and Masculinities and MELUS, among others.", "\n\nWorks \nIn addition to editing volumes such as Debating Masculinity (2008), Alternative Masculinities for a Changing World (2014) and Masculinities and Literary Studies (2017), he is the author of the monographs Richard Ford and the Fiction of Masculinities, the winner of the “Enrique García Díez” Literary Research Award (Spanish Association for Anglo-American Studies, 2010) and Masculinities in Black and White, the recipient of the Javier Coy Research Award. (", "Spanish Association for American Studies, 2014).", "\n\nBooks\nArmengol, Josep M., and Àngels Carabí. ", "Gendering Men: Theorizing Masculinities in American Culture and Literature. ", "Tesi doctoral, Universitat de Barcelona. ", "Departament de Filologia Anglesa i Alemanya, 2006\nArmengol, Josep M., and Michael S. Kimmel. ", "Richard Ford and the Fiction of Masculinities. ", "New York: Perer Lang Publishing, 2010.", "\nArmengol, Josep M., ed. ", " Men in Color: Racialized Masculinities in U.S. Literature and Cinema. ", "Newcastle: Cambridge Scholars, 2011.", "\nArmengol, Josep M. Queering Iberia: Iberian Masculinities at the Margins. ", "New York: Peter Lang, 2013.", "\nArmengol, Josep M. Masculinities in Black and White Manliness and Whiteness in (African) American Literature. ", "Basingstoke: Palgrave Macmillan, 2014.", "\nArmengol, Josep M., and Angels Carabì. ", "Alternative Masculinities for a Changing World. ", "New York: Palgrave Macmillan, 2014.", "\nArmengol, Josep M., Marta Bosch-Vilarrubias, and Angels Carabí., ", "eds. ", " Rethinking Ethnic Masculinities: Intersections and New Directions. ", "2017.", "\n\nReferences\n\nExternal links \n Conferencia de José María Armengol. ", "Valencia, 1 mayo de 2018 at Universidad de Valencia\n \n\nCategory:Catalan philologists\nCategory:University of Castilla–La Mancha faculty\nCategory:Writers from Barcelona\nCategory:21st-century Spanish male writers\nCategory:Academic journal editors\nCategory:Living people\nCategory:1977 births" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0010209939209744334, 0.0005613174289464951, 0.0006189637933857739, 0.0006418955745175481, 0.0012874348321929574, 0.0005494545912370086, 0.0006673119496554136, 0.0007668688194826245, 0.0007496153702959418, 0.0006137780728749931, 0.0006408469052985311, 0.000656719843391329, 0.0024973691906780005, 0.0006939690792933106, 0.0006978781311772764, 0.0007943692617118359, 0.0006891004741191864, 0.0007865281077101827, 0.0015816770028322935, 0.0006160672637633979, 0.0008693117997609079, 0.0006921011954545975, 0.007185854017734528, 0.0006322992849163711, 0.0007082329830154777, 0.000871528871357441, 0.0006571086123585701, 0.0006701307720504701, 0.000717251852620393, 0.000828122952952981, 0.0008557835244573653, 0.0006585298688150942, 0.0006467966013588011 ]
0.001004
33
[ "YOUNG women are facing more challenges than young men when it comes to decision making and leadership, says the acting Director of the Youth Development department, within the Ministry of Women, Youth, Children and Family Affairs.", "\n\nMore than 100 women from three parishes and one district of KiraKira, Makira Province, and Marau Parish in South Guadalcanal, arrived in Honiara ahead of the gathering that will take place at Tangarare this week.", "\n\nTHIRTY stakeholders from across government, civil society organisations and development partners attended a one-day consultation to discuss the challenges and achievements in implementing the Government’s national gender equality and women’s development policy." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0007236020173877478, 0.0006603555520996451, 0.0005863617989234626 ]
0.000657
3
[ "/**\n * @param {number[][]} points\n * @param {number} K\n * @return {number[][]}\n */\nvar kClosest = function(points, K) {\n points.sort(\n (x, y) =>\n Math.pow(y[0], 2) +\n Math.pow(y[1], 2) -\n Math.pow(x[0], 2) -\n Math.pow(x[1], 2),\n );\n return points.slice(0, K);\n};\n" ]
{ "pile_set_name": "Github" }
[ 0.023883655667304993 ]
0.023884
1
[ "The Department of Justice and Department Homeland Security will partner to stop U.S. companies from hiring foreign workers with visas over qualified U.S. workers, the agencies announced Friday.", "\n\nThe collaboration’s goal is to quickly identify employers who discriminate against U.S. workers by hiring foreign visa workers as well as immigrants who commit fraud to get hired.", "\n\n“In the spirit of President Trump’s Executive Order on Buy American and Hire American, today’s partnership adds to the Civil Rights Division’s tools to stop employers from discriminating against U.S. workers by favoring foreign visa workers,” said Acting Assistant Attorney General John Gore of the Civil Rights Division. “", "The Division looks forward to expanding its partnerships with USCIS to hold accountable employers that discriminate against U.S. workers based on their citizenship status.”", "\n\nHiring foreign visa workers over qualified U.S. workers could be illegal, the agencies said. ", "The Justice Department has already fielded one lawsuit and reached a settlement with two employers since it launched its Protecting U.S. Workers Initiative last year." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0005934821092523634, 0.0012160241603851318, 0.0007788252551108599, 0.0008226974750868976, 0.0007041616481728852, 0.0006461380398832262 ]
0.000794
6
[ "Porcelaine\n\nThe Porcelaine is a breed of dog originating from France. ", "It is believed to be the oldest of the French scent hounds. ", "Its alternate name is the Chien de Franche-Comté, named after a French region bordering Switzerland.", "\n\nAppearance\n\nThe Porcelaine gets its name from its shiny coat, said to make it resemble a porcelain statuette. ", " The fur is white, sometimes with orange spots, often on the ears. ", "The skin should be white with black mottling that is visible through the white coat. ", "The fur is incredibly short and very fine. ", "The nose of a Porcelaine dog is black with very wide nostrils. ", "It also has black eyes and long ears that droop down. ", "The neck is long and the tail starts thick and narrows to a point at the end.", "\n\nPorcelaine males range from 22 to 23 inches (about 56 to 58.5 centimeters) tall. ", "Bitches are 21 to 22 inches (about 53.5 to 56 centimeters) tall. ", "They weigh from 55 to 62 pounds (about 25 to 28 kilograms).", "\n\nTemperament\nPorcelaines have a very high activity level and therefore need a lot of exercise. ", "Because of this, they are not recommended for people living in apartments because they cannot get sufficient exercise without a lot of work on the owner's part. ", "Despite the Porcelaines being fierce hunters, they are gentle and relatively easy to handle.", "\n\nHistory\nThe Porcelaine is thought to be a descendant of the English Harrier, some of the smaller Laufhounds of Switzerland, and the now-extinct Montaimboeuf. ", "There have been records of the breed in France since 1845 and in Switzerland since 1880. ", "The breed actually disappeared after the French Revolution (1789–99) but has been reconstructed.", "\nBreeders in the UK are attempting to have the Porcelaine accepted as a recognized breed. ", " As of 2009 there have been 14 puppies bred in the UK.", "\n\nHealth\nPorcelaines have no health issues specific to the breed. ", "Of course, they suffer from general dog issues like any other breed.", "\n\nCare\nThe coat, due to its shortness, is very easy to care for.", "\n\nHunting purposes\nThe Porcelaine is a hunting dog usually used to hunt hare, roe deer, and in the north wild boar. ", "The Porcelaines hunt in packs. ", "Being a scent hound, it has a very good sense of smell with which it hunts. ", "The Porcelaine is a fierce hunting dog that has been bred to hunt independently without many orders from the owner. ", "The Porcelaine is also being bred in small numbers in Italy and used to hunt wild boar, however Italian indigenous hounds continue to be the preferred choice of local hunters.", "\n\nReferences\n\nExternal links\nClub du Porcelaine \n\nCategory:FCI breeds\nCategory:Rare dog breeds\nCategory:Scent hounds\nCategory:Dog breeds originating in France" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.002964935265481472, 0.0006294912891462445, 0.0006384860607795417, 0.0006308083538897336, 0.002713471418246627, 0.007694168947637081, 0.0019149392610415816, 0.12387466430664062, 0.09863173961639404, 0.0021431187633424997, 0.011756129562854767, 0.9576476216316223, 0.0011481144465506077, 0.0008644384797662497, 0.000670357549097389, 0.0005747798713855445, 0.0007834048010408878, 0.0005385664408095181, 0.0006299651577137411, 0.0006277286447584629, 0.0009067760547623038, 0.0006976942531764507, 0.028271840885281563, 0.0012347283773124218, 0.0023809114936739206, 0.02047485113143921, 0.0008091076742857695, 0.0017193494131788611, 0.0006920761661604047, 0.0006706275162287056 ]
0.042498
30
[ "Q:\n\nAdding JS to the checkout\n\nHow to add custom JS to just the checkout page?", "\nI found this tutorial, but as far as I can tell it will add JS to the entire site.", "\n\nA:\n\nThe recommended way to add js is with requireJS ! ", "as it is explained in Magento DevDocs\n\napp/design/frontend/Vendor/theme-name/Magento_Checkout/web/js/myfile.js\nyour js functions goes here exemple : \ndefine(['jquery'], function($){\n \"use strict\";\n return function hello()\n {\n alert('Bonjour Amir');\n }\n});\n\napp/design/frontend/Vendor/theme-name/requirejs-config.js\nvar config = {\n map: {\n '*': {\n checkoutjs: 'Magento_Checkout/js/myfile'\n }\n }\n\n};\n\napp/design/frontend/Vendor/theme-name/Magento_Checkout/templates/onepage.phtml\nHere we call our js function otherwise, the js will not be loaded !", "\n<script type=\"text/javascript\">\n require(['jquery', 'checkoutjs'], function($, hello) {\n hello();\n });\n</script>\n\nClean all this folder contents pub/static except .htaccess\nClean all this folder contents var/view_preprocessed\nClean all this folder contents var/cache\nDeploy the static-content: php bin/magento setup:static-content:deploy -f\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0008560103015042841, 0.0006755463546141982, 0.0008158105774782598, 0.0007500358624383807, 0.0011116708628833294 ]
0.000842
5
[ "1. ", "Field of the Invention\nThe present general inventive concept relates to an ion neutralizer, and, more particularly, to an ion neutralizer comprising a reflection plate to neutralize plasma ions in a semiconductor processing plasma apparatus.", "\n2. ", "Description of the Related Art\nIn semiconductor processing, plasma has been widely used for various unit processes, such as physical or chemical vapor deposition, photosensitive agent cleaning, and other surface processes. ", "According to demands on high integration of a semiconductor device and an increase in a wafer diameter or area, requirements for an apparatus for processing an object also become strict, which is the same as those for plasma equipment. ", "In an attempt to enhance performance of the plasma equipment, it has been developed for the plasma equipment to perform high speed processing by increasing a density of the plasma within a chamber, or to perform processing of an object having a large area by providing uniform plasma distribution. ", "For example, a density of the plasma can be increased by inductively coupled plasma equipment, and the uniform plasma distribution can be provided by displacement of an antenna or variation of introducing location of reactant gas.", "\nHowever, in spite of the above attempt, the plasma processing has a limitation in performing super accuracy processing of wafers. ", "For example, if charged plasma ions are used for an etching process, an object of the etching process can also be charged during the etching process, thereby changing an etching profile or creating a voltage gradient and causing damage to a diode formed on the object. ", "Meanwhile, when accelerated plasma ions are used for the etching process, dislocations or deformed skin layers can be formed on a surface of a substrate. ", "In order to solve these problems, energy of the plasma ions must be lowered, or additional heat treatment must be performed to restore the damaged surface of the object after the etching process.", "\nIn order to solve the disadvantages of the plasma processing as described above, U.S. Pat. ", "No. ", "4,662,977 discloses a method using neutralized particles instead of the plasma ions in a conventional ion neutralizer. ", "According to the disclosure, the plasma ions generated from a plasma generator are transformed into the neutralized particles after being reflected by heavy metal plates, so that the neutralized particles are used for processing an object. ", "Processing equipment using the above method requires an ion neutralizer for neutralizing the plasma ions. ", "However, the conventional ion neutralizer has various disadvantages, and thus the disadvantages of the conventional ion neutralizer should be overcome to improve the plasma processing.", "\nThe conventional ion neutralizer has a construction as follows.", "\nThe conventional ion neutralizer comprises a ring-shaped frame defining an outer periphery of the ion neutralizer, and a plurality of reflecting plates arranged in parallel inside the frame. ", "The frame is formed with a refrigerant path for cooling heat generated upon impact of plasma ions, and a plurality of slots for inserting the reflection plates within a diameter of the frame. ", "Each reflecting plate is inserted at both ends thereof into the slots, and fixed thereto. ", "When the plasma ions collide with the reflecting plates, the plasma ions are subjected to charge exchange, and are then transformed into neutralized particles.", "\nWhen the plasma ions collide with the reflecting plates, heat of the plasma ions is transferred to the reflecting plates, increasing a temperature of the reflecting plates. ", "The heat is transferred to the frame, and is then finally discharged to an outside thereof via the refrigerant passing through the refrigerant path in the frame. ", "Meanwhile, if the heat transfer between the reflecting plates and the frame is not smoothly performed, the reflecting plates have a remarkably increased temperature, and are subjected to thermal deformation, causing the reflecting plates to be bent. ", "When the reflection plates are bent, a direction of the neutralized particles reflected by the reflection plates is deviated from a designed direction, negatively influencing the result of the process.", "\nIn the conventional ion neutralizer, since the frame and the reflecting plates are provided by machining metallic materials, some degree of surface roughness is necessarily formed on the surfaces of the frame and the reflecting plates, so that when the reflecting plates are inserted into the slots of the frame, a plurality of point contacts are created between the reflecting plates and the frame. ", "As a result, since the heat transfer between the reflecting plates and the frame is mainly carried out through these point contacts, a heat transfer rate is remarkably lowered. ", "Particularly, since the interior of the plasma equipment where the ion neutralizer is installed is generally in a vacuum state, there are no media, which can improve the heat transfer between the reflecting plates and the frame, thereby deteriorating a heat transfer rate therebetween." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.0009391896310262382, 0.0005820306832902133, 0.0011855863267555833, 0.000562475819606334, 0.0005695630679838359, 0.0005807226407341659, 0.0005905519938096404, 0.0006576611776836216, 0.0007366808713413775, 0.0006048241630196571, 0.0006728252628818154, 0.0006755818030796945, 0.0013785824412479997, 0.0006704137194901705, 0.0006251146551221609, 0.0006043734611012042, 0.0006859353743493557, 0.0005877215880900621, 0.0006283143884502351, 0.0006206287071108818, 0.00061422074213624, 0.0008105047163553536, 0.0006535236607305706, 0.0009868729393929243, 0.0006349945324473083, 0.000613250071182847, 0.000600882456637919, 0.0005656799185089767, 0.0006160484626889229 ]
0.000698
29
[ " RECORD IMPOUNDED\n\n NOT FOR PUBLICATION WITHOUT THE\n APPROVAL OF THE APPELLATE DIVISION\n This opinion shall not \"constitute precedent or be binding upon any court.\" ", "Although it is posted on the\n internet, this opinion is binding only on the parties in the case and its use in other cases is limited. ", "R. 1:36-3.", "\n\n\n\n\n SUPERIOR COURT OF NEW JERSEY\n APPELLATE DIVISION\n DOCKET NO. ", "A-3738-18T3\n\nR.T.,1\n\n Plaintiff-Appellant,\n\nv.\n\nZ.S.,\n\n Defendant-Respondent.", "\n________________________\n\n Argued February 12, 2020 – Decided June 23, 2020\n\n Before Judges Fuentes, Haas and Mayer.", "\n\n On appeal from the Superior Court of New Jersey,\n Chancery Division, Family Part, Middlesex County,\n Docket No. ", "FV-12-0199-19.", "\n\n Adam G. Rosenberg argued the cause for appellant.", "\n\n Charly Gayden argued the cause for respondent (Reid\n Weinman, attorney; Reid Weinman, of counsel; Charly\n Gayden, on the brief).", "\n\n\n\n1\n We refer to the parties by initials to protect their privacy. ", "R. 1:38-3(d)(10).", "\n\fPER CURIAM\n\n Plaintiff R.T. appeals from the order of the Family Part that granted\n\ndefendant S.Z.'s motion for an award of counsel fees pursuant to Rule 5:3-5,\n\nfollowing the court's decision to deny plaintiff a final restraining order (FRO)\n\nagainst defendant under the Prevention of Domestic Violence Act (PDVA),\n\nN.J.S.A. 2C:25-17 to -35. ", "We reverse.", "\n\n The parties dated for five years. ", " During the last two years of their\n\nrelationship, both parties filed multiple complaints alleging acts of domestic\n\nviolence against each other, many of which were found to be meritless and\n\ndismissed. ", " On July 24, 2018, plaintiff filed his fourth domestic violence\n\ncomplaint against defendant alleging three predicate acts under N.J.S.A. 2C:25-\n\n19, to wit: harassment, N.J.S.A. 2C:33-4; stalking, N.J.S.A. 2C:12-10; and\n\ncriminal mischief, N.J.S.A. 2C:17-3. ", "Plaintiff obtained a temporary restraining\n\norder (TRO) against defendant, with a return date of September 11, 2018 for the\n\nFRO hearing.", "\n\n After considering the testimony from both parties and defendant's\n\nwitnesses, the Family Part judge issued an oral decision in which he dismissed\n\nplaintiff's complaint and vacated the TRO against defendant as a matter of\n\n\n\n\n A-3738-18T3\n 2\n\fcredibility. ", "In the judge's own words: \"frankly . . . ", "I don't find [plaintiff] to be\n\ncredible.\"", "\n\n On October 24, 2018, defendant's counsel filed a certification in support\n\nof an application for attorney's fees pursuant to Rule 5:3-5. ", "In an order dated\n\nNovember 16, 2018, the Family Part judge awarded defendant $2800 in counsel\n\nfees without opposition from plaintiff. ", " It is uncontested, however, that\n\ndefendant's counsel inadvertently failed to serve plaintiff's counsel with the\n\nmotion papers. ", "Once he received the court's order awarding counsel fees,\n\nplaintiff's counsel immediately moved for reconsideration.", "\n\n The matter came for oral argument before the Family Part judge on\n\nFebruary 13, 2019. ", "After some initial discussions, the judge asked plaintiff's\n\ncounsel whether it was his position that a \"defendant in a domestic violence\n\nmatter, if successful, [could] never be awarded attorney's fees.\" ", "In response,\n\nplaintiff's counsel stated that a defendant who prevails in a PDVA case can only\n\nbe awarded counsel fees if the court finds the complaint was frivolous or was\n\nbrought in bad faith under N.J.S.A. 2A:15-59.1. ", "Plaintiff's counsel further\n\nemphasized that the PDVA authorized a court to grant counsel fees only to the\n\nplaintiff as part of compensatory damages.", "\n\n\n\n\n A-3738-18T3\n 3\n\f The judge rejected this argument outright and stated: \"I disagree with you\n\nthat it has to be frivolous litigation for attorney's fees to be awarded. ", "That's\n\nwhere we part ways . . . ", "you may have to go to the Appellate Division; I don't\n\nagree with you.\" ", "The judge thereafter provided the following explanation for\n\ngranting defendant's application for an award of attorney's fees pursuant to Rule\n\n5:3-5:\n\n The [c]ourt can award attorney's fees and . . . [", "under]\n Rule 5:3-5. ", "There it says under subsection (c), an\n award of attorney's fees is subject to provisions of Rule\n 4:42-9(b), (c), and (d). ", "In the discretion of the [c]ourt,\n the [c]ourt may make . . . ", "allowances for attorney's fees.", "\n It says . . . ", "on final determination . . . ", "the [c]ourt finds\n that it would be deemed just in any successful -- party\n that is successful in an action. ", "It can be in a claim for\n divorce, dissolution of a civil union, termination of\n domestic partnership.", "\n\n It goes on and then it has a catchall, and any other\n claims relating to family type matters, which is the\n catchall. ", "It gives the [c]ourt the right to – to award\n attorney's fees. ", "The problem with the only application\n is that there's no applications of services. ", "In this case\n the [c]ourt notes that the parties have been in court\n multiple times.", "\n\n And the [c]ourt finds that at the time – at the hearing\n the [c]ourt finds that . . . ", "the plaintiff was not credible.", "\n And counsel wants to argue that he brought the claim\n in good faith. ", "The [c]ourt, trying to preserve some level\n of decorum if you will, did not outright call the plaintiff\n a liar, but I found that he lacked credibility. ", "And if you\n were to take that argument further, the [c]ourt would\n\n A-3738-18T3\n 4\n\f find that it was brought in bad faith. ", "The [c]ourt notes\n that these parties go back to 2015. ", "And there had been\n complaints filed by both parties.", "\n\n But here the [c]ourt finds more importantly that the\n discussions of settlements and good faith and all of that\n is of no consequence. ", "The rule simply says that in the\n [c]ourt's discretion, if the [c]ourt deems it to be just,\n that attorney's fees can be awarded. ", "I find that to be the\n case.", "\n\n Twenty-five years ago in M.W. v. R.L., 286 N.J. Super. ", "408 (1995), this\n\ncourt was asked to decide, as a matter of first impression, whether a prevailing\n\ndefendant in an action filed by a plaintiff under the PDVA could recover counsel\n\nfees. ", "Writing for the court, then Judge Long 2 explained why an award of counsel\n\nfees to a defendant in this context would directly undermine the public policy\n\nunderpinning the PDVA:\n\n In our view, even if a domestic violence complaint\n could be conceived of as a family type matter for\n purposes of [Rule] 4:42-9, the rule cannot be invoked\n to award counsel fees to a prevailing non-victim in a\n domestic violence case. ", "Otherwise, the chilling effect\n the Legislature tried to avoid by limiting the award of\n fees to victims under the Domestic Violence Act would\n certainly result. ", "By invoking [Rule] 4:42-9(a)(1), a\n prevailing non-victim would, in effect, succeed in\n obtaining by indirection a benefit intentionally made\n\n\n2\n Justice Virginia Long served on the Appellate Division from 1984 until 1999,\nwhen she was appointed by Governor Christine Wittman to serve as an Associate\nJustice of the Supreme Court. ", "Justice Long retired from the Court in 2012.", "\n A-3738-18T3\n 5\n\f unavailable under the Domestic Violence Act. ", "This\n cannot be countenanced.", "\n\n [Id. at 411.]", "\n\n Thus, the Legislature expressly provided counsel fees under the PDVA as\n\npart of a list of compensatory damages imposed on defendants to compensate\n\nvictims of domestic violence:\n\n An order requiring the defendant to pay to the victim\n monetary compensation for losses suffered as a direct\n result of the act of domestic violence. ", "The order may\n require the defendant to pay the victim directly, to\n reimburse the Victims of Crime Compensation Office\n for any and all compensation paid by the Victims of\n Crime Compensation Office directly to or on behalf of\n the victim, and may require that the defendant\n reimburse any parties that may have compensated the\n victim, as the court may determine. ", "Compensatory\n losses shall include, but not be limited to, loss of\n earnings or other support, including child or spousal\n support, out-of-pocket losses for injuries sustained,\n cost of repair or replacement of real or personal\n property damaged or destroyed or taken by the\n defendant, cost of counseling for the victim, moving or\n other travel expenses, reasonable attorney's fees, court\n costs, and compensation for pain and suffering. ", "Where\n appropriate, punitive damages may be awarded in\n addition to compensatory damages.", "\n\n [N.J.S.A. 2C:25-29b(4) (emphasis added).]", "\n\n Against this backdrop, Judge Long explained in M.W. that when \"a party\n\nfiles a domestic violence complaint in bad faith, based on his or her own perjured\n\n\n A-3738-18T3\n 6\n\ftestimony or suborned perjured testimony, N.J.S.A. 2A:15-59.1 permits the\n\naward of counsel fees in order to punish the filing party and deter the improper\n\nconduct of litigation in the future.\" ", "286 N.J. Super. ", "at 412 (emphasis added).", "\n\nHere, although the Family Part judge did not find plaintiff's testimony credible,\n\nhe did not find plaintiff filed this domestic violence complaint in bad faith or\n\npresented perjured testimony within the meaning of N.J.S.A. 2C:28-1.", "\n\n The \"American Rule\" provides that \"the prevailing litigant is ordinarily\n\nnot entitled to collect a reasonable attorneys' fee from the loser.\" ", "Redine v.\n\nPantzer, 141 N.J. 292, 321 (1995) (quoting Alyeska Pipeline Serv. ", "Co. v.\n\nWilderness Society, 421 U.S. 240, 247 (1975)). ", " \"Although New Jersey\n\ngenerally disfavors the shifting of attorneys' fees, a prevailing party can recover\n\nthose fees if they are expressly provided for by statute, court rule, or contract.\"", "\n\nPackard-Bamberger & Co. v. Collier, 167 N.J. 427, 440 (2001) (internal\n\ncitations omitted) (emphasis added).", "\n\n New Jersey's frivolous litigation statute \"has been recognized as serving\n\na dual purpose.\" ", "Tolls Bros., Inc. v. Twp. ", "of W. Windsor, 190 N.J. 61, 67\n\n(2007). \"", "On the one hand, 'the statute serves a punitive purpose, seeking to deter\n\nfrivolous litigation.' ", "On the other hand, the statute serves a compensatory\n\npurpose, seeking to reimburse 'the party that has been victimized by the party\n\n\n A-3738-18T3\n 7\n\fbringing the frivolous litigation.'\" ", "Ibid. (", "quoting Deutch & Shur, P.C. v. Roth,\n\n248 N.J. Super. ", "133, 141 (App. ", "Div. ", "1995)).", "\n\n N.J.S.A. 2A:15-59.1a(1) authorizes an award of attorneys' fees if the judge\n\nfinds that \"a complaint, counterclaim, cross-claim or defense of the\n\nnonprevailing person was frivolous.\" ", "In making such a finding, the trial court\n\nmust determine whether:\n\n (1) The complaint, counterclaim, cross-claim or\n defense was commenced, used or continued in bad\n faith, solely for the purpose of harassment, delay or\n malicious injury; or\n\n (2) The nonprevailing party knew, or should have\n known, that the complaint, counterclaim, cross-claim or\n defense was without any reasonable basis in law or\n equity and could not be supported by a good faith\n argument for an extension, modification or reversal of\n existing law.", "\n\n [N.J.S.A. 2A:15-59.1b(1) to -59.1b(2).]", "\n\n Rule 1:4-8(f) provides \"[t]o the extent practicable, the procedures\n\nprescribed by this rule shall apply to the assertion of costs and fees against a\n\nparty other than a pro se party pursuant to N.J.S.A. 2A:15-59.1.\" ", "In Bove v.\n\nAkPharma Inc., we held:\n\n Strict compliance with each procedural requirement of\n Rule 1:4-8 is \"a prerequisite to recovery[,]\" and failure\n to conform to the rule's procedural requirements will\n result in a denial of the request for an attorney's fees\n\n A-3738-18T3\n 8\n\f sanction. [", "State v. Franklin Sav. ", "Account No. ", "2067, 389\n N.J. Super. ", "272, 281 (App. ", "Div. ", "2006).] ", "For example, a\n frivolous litigation motion must be filed \"no later than\n [twenty] days following the entry of final judgment.\"", "\n R. 1:4-8(b)(2). ", "Also, subsection (b)(1) of Rule 1:4-8\n requires a party seeking frivolous litigation sanctions to\n \"file a separate motion [for the sanction] describing the\n specific conduct alleged to be a violation of the Rule.\"", "\n Toll Bros., 190 N.J. at 69. ", "Prior to filing such a motion,\n the litigant seeking the sanction must \"serve a written\n notice and demand on the attorney or pro se party,\n which must include a request that the allegedly\n frivolous paper [or pleading] be withdrawn.\" ", "Ibid. ", "This\n notice is generally referred to as a \"safe harbor\" notice.", "\n Ibid. ", "The notice must \"set [] forth 'with specificity' the\n basis for his or her belief that the pleading is frivolous.", "\n The notice must be sufficiently specific and detailed to\n provide an opportunity to 'withdraw the assertedly\n offending pleadings.'\" ", "Ferolito v. Park Hill Ass'n, 408\n N.J. Super. ", "401, 408 (App. ", "Div. ", "2009) (quoting Trocki\n Plastic Surgery Ctr. ", "v. Bartkowski, 344 N.J. Super. ", "399,\n 406 (App. ", "Div. ", "2001)). ", "See R. 1:4-8(b)(1)(i)-(ii).", "\n\n [460 N.J. Super. ", "123, 149-50 (App. ", "Div. ", "2019)\n (alterations in original) (emphasis added).]", "\n\n Our Supreme Court has explained the importance of these procedural\n\nrequirements:\n\n Although the notice requirement may have a limiting\n impact on the compensation that one may receive for\n costs and fees, the public policies underlying N.J.S.A.\n 2A:15-59.1 militate in favor of requiring that claims\n against parties meet the Rule's procedural requirements\n to the fullest extent possible. ", "By insisting on\n compliance as soon as practicable, the salutary benefits\n of adhering to the notice requirement will more\n\n A-3738-18T3\n 9\n\f promptly rid the judicial forum of frivolous litigation\n behavior and will concomitantly provide\n reimbursement for the fees and costs actually\n attributable to an adversary's uncorrected offending\n conduct.", "\n\n [Tolls Bros., 190 N.J. at 72 (emphasis added).]", "\n\n Although the Family Part judge invoked Rule 5:3-5(c) for his authority to\n\ngrant defendant's motion for an award of attorney's fees, his decision was\n\npremised on the alleged frivolous nature of plaintiff's domestic violence claims.", "\n\nHowever, the record does not contain any evidence of defendant's attempt to\n\ncomply with the procedural requirements of Rule 1:4-8. ", "While defense counsel\n\nrepresented orally that he served plaintiff's counsel with a letter indicating that\n\nhe would pursue attorney's fees, there was no separate formal motion filed as\n\nrequired by Rule 1:4-8(b)(1). ", "Without the letter in the appellate record, there is\n\nno way to determine whether defendant made a good faith attempt to comply\n\nwith the \"safe-harbor\" provisions of Rule 1:4-8(b)(1). ", "Finally, defendant filed\n\nthis application for counsel fees forty-three days after the entry of final\n\njudgment, well beyond the twenty-day timeframe set out in Rule 1:4-8(b)(2).", "\n\n In short, the Family Part judge's decision does not reflect an appreciation\n\nfor these substantive and procedural requirements and is utterly irreconcilable\n\n\n\n\n A-3738-18T3\n 10\n\fwith a dispositive, precedential opinion from this court published a quarter\n\ncentury ago.", "\n\n Reversed.", "\n\n\n\n\n A-3738-18T3\n 11\n\f" ]
{ "pile_set_name": "FreeLaw" }
[ 0.000624922220595181, 0.0005710812984034419, 0.0008083654684014618, 0.0008319010375998914, 0.0007938765920698643, 0.0008058321545831859, 0.0007766400231048465, 0.0012409891933202744, 0.0006588142132386565, 0.0007969410507939756, 0.0005231500254012644, 0.0007904653903096914, 0.0007686008466407657, 0.0007374815759249032, 0.0005480305990204215, 0.0006468928186222911, 0.000935746356844902, 0.0006698539946228266, 0.0006492528482340276, 0.0011758460896089673, 0.0006670118309557438, 0.0005679790046997368, 0.0006094530690461397, 0.0006144060753285885, 0.0005494027282111347, 0.0006079223821870983, 0.0005968343466520309, 0.0006412470829673111, 0.0006545275682583451, 0.0006862420705147088, 0.000676133728120476, 0.0005765765672549605, 0.0007880349294282496, 0.0006492896354757249, 0.0006363795255310833, 0.0016153875039890409, 0.0007333041285164654, 0.0013619614765048027, 0.0006703080143779516, 0.0007835507858544588, 0.0007833174895495176, 0.0009163533104583621, 0.009138188324868679, 0.0012992647243663669, 0.0006024132599122822, 0.0010815138230100274, 0.0007676255190744996, 0.0005422604153864086, 0.0049261674284935, 0.001159157371148467, 0.0005761681240983307, 0.0006091975374147296, 0.000767596997320652, 0.0008280692854896188, 0.0006560910260304809, 0.0007564577390439808, 0.0005921853589825332, 0.0005696599837392569, 0.0006369510665535927, 0.0006763625424355268, 0.0008095927187241614, 0.0007692871149629354, 0.0006652922602370381, 0.0007354582194238901, 0.000635161530226469, 0.0006320552784018219, 0.0008985624881461263, 0.0017545516602694988, 0.0006453853566199541, 0.0006960275932215154, 0.0009294359479099512, 0.0005967831239104271, 0.0007237868849188089, 0.10463254898786545, 0.0006880874861963093, 0.0006569495308212936, 0.0005802097730338573, 0.0005910086329095066, 0.0006522350595332682, 0.0011593286180868745, 0.000671436486300081, 0.0009815080557018518, 0.0008701558690518141, 0.0006818680558353662, 0.0010020259069278836, 0.0007375287241302431, 0.0008487391751259565, 0.0008231978863477707, 0.0008215604466386139, 0.0007395496941171587, 0.0006406584871001542, 0.003535138675943017, 0.0006674540927633643, 0.0010511240689083934, 0.0008092441130429506, 0.0011634289985522628, 0.0006546264048665762, 0.0008487391751259565, 0.0008139818673953414, 0.0006364841829054058, 0.0007692061481066048, 0.0007009622640907764, 0.0007544890395365655, 0.0007682586438022554, 0.0007755429251119494, 0.0006025932962074876, 0.0007755429251119494, 0.0007263981970027089, 0.0005904861027374864, 0.5047359466552734, 0.0006886153132654727, 0.0008487391751259565, 0.0018376503139734268, 0.0007933242013677955, 0.000725707970559597, 0.0008487391751259565, 0.0008093289216049016, 0.0006482110475189984, 0.0008670423412695527, 0.0007316061528399587, 0.0008487391751259565, 0.0005847438587807119, 0.0005768772098235786, 0.0010082258377224207, 0.000623823085334152, 0.0006984370411373675, 0.0006257306667976081, 0.000635702395811677, 0.0005659727612510324, 0.0005800535436719656, 0.0005806642584502697, 0.0009353408240713179, 0.0018658966291695833 ]
0.005462
133
[ "Wentz's coaches and teammates will assure you that the quarterback's rapid ascension is no accident. ", "It is born, they say, out of a willingness to slog. ", "To study. ", "To meticulously catalog those studies. ", "To debate his coaches on the merits of those studies. ", "Back at North Dakota State, where Wentz led the Bison to FCS national championships in 2014 and 2015, his coaches dissected the team's third downs on Tuesdays. ", "In the meeting room, their discussions started promptly at 6 a.m. By 6:30, Tim Polasek, then the offensive coordinator in Fargo, would have multiple text messages. ", "Wentz, first thing every Tuesday morning, plied his coach with third-down suggestions. ", "Polasek would consider Wentz's offerings, then look at the board full of plays the staff had cooked up.", "\n\n\"Jeez,\" he'd say. \"", "Let's erase that idea. ", "This one's better.\"", "\n\nAs a pro, Wentz still engages in those debates. ", "At home against Washington in late October, the Eagles installed a play at Wentz's behest that came straight from his old college playbook -- a two-tight-end package that culminated in a touchdown pass to running back Corey Clement. ", "He even called NDSU to secure old film, evidence to convince the Eagles brass that the play could work. \"", "The way I trust Carson right now is because of the way he studies and prepares,\" Eagles coach Doug Pederson says. \"", "If he were just coming to me with out-of-the-blue ... just pulling things from the air, it would be a little different. ", "But I know when he comes to me, it's well-thought-out.\"", "\n\nLater that same Monday night against Washington, just five seconds into the fourth quarter, Wentz lined up in the shotgun on third-and-8. ", "Six Redskins descended on Wentz's pocket, where he was swallowed whole and a sack felt inevitable. \"", "Wentz will be ... escaping!\" ", "screamed Monday Night Football play-by-play man Sean McDonough. ", "As Wentz fled from the pile of bodies that McDonough, Washington's rushers and all of Philadelphia thought had engulfed him, Eagles quarterbacks coach John DeFilippo, who had been planning for the next series, looked up from his call sheet. \"", "All of a sudden I hear the crowd go crazy,\" he says. \"", "And out he goes.\"", "\n\nWentz would scramble for 17 yards and a first down, just one more play in a growing stockpile that has delivered this team and its fans from a familiar feeling: disappointment. \"", "Even if he wins a couple of Super Bowls along the way,\" Didinger says, \"when people are just kicking back in some bar in Fishtown, talking about Carson Wentz, it won't take very long before somebody says, 'But you know what play I remember the best? ", "That play against the Redskins.'\"", "\n\nRandall Cunningham is known around these parts as an Eagles legend, but when he talks about Wentz, he sounds more like the pastor he has become in his post-playing days. ", "The young Eagles quarterback, he says, \"is in a divine place at a divine time.\"", "\n\nTherein lies the nagging twinge of trepidation in Philadelphia's Wentz-infused mania. ", "These fans have felt sure they had the divine person in the divine place at the divine time before. ", "Once upon a time, there was a second-year star who led the Eagles to unforeseen heights ahead of schedule. ", "Who won the town over in the winds of a pretty magical season. ", "Who dazzled them early on with visions of Super Bowls and trophies and parades down Broad Street.", "\n\nHis name was Donovan McNabb.", "\n\nMcNabb's legacy is so loaded, the totality of what he achieved -- and more crucially, failed to -- so all-consuming, that there are no trees, only forest. ", "Why reminisce on his breakout second season, which saw him lead the 2000 Eagles to an unexpected playoff berth? ", "His encore act was three straight losses in the NFC championship game. ", "Why wax nostalgic on his 2004 Super Bowl run? ", "He came up short and never got back, right?", "\n\nIn truth, he's one in a long parade of quarterbacks whose relationships with the city proved complicated at best. ", "Ron Jaworski led the Eagles to their first Super Bowl appearance in 1980 and is an icon in the area now, but he was heckled relentlessly in his day. \"", "I don't remember the exact year, but I think I started off against the Colts,\" he says. \"", "I completed my first 11 passes. ", "The 12th was incomplete and they booed.\" ", "Cunningham was electric, but he won one playoff game in 11 years. ", "Even Jeff Garcia, who wished the city a Merry Christmas after downing Dallas and became a folk hero for a spell, wasn't in town long enough to engender either disillusionment or idolatry.", "\n\n“Wentz seems like a guy that could be living in a row house in Kensington.” - Sportswriter Ray Didinger\n\nAmong them, though, McNabb stands out as a singular lightning rod. ", "He has been since the day in 1999 when Paul Tagliabue walked up to the mic and said, \"With the second pick, the Philadelphia Eagles select Donovan McNabb, quarterback, Syracuse University.\" ", "Before Tagliabue had even finished, a chorus of boos -- vociferous, arm-thrashing boos -- rained down. ", "The Dirty 30, as that band of Eagles fans came to be known, had unknowingly, and permanently, shifted the city's relationship with the man who would become the best quarterback in team history. \"", "I think Donovan took that personally and it bothered him,\" Jaworski says. \"", "I think it still bothers him.\"", "\n\nThat the Dirty 30 was, in fact, an event orchestrated by a local radio personality, not truly an organic geyser of disgust, didn't prove to be a salve. ", "Neither did the fans' later assertions that they weren't booing McNabb per se; they were booing the act of not picking reigning Heisman winner Ricky Williams. ", "Nor did a slew of personal apologies from the Dirty 30's representatives -- to McNabb, to his parents, to the entire Eagles organization. ", "Not even the quarterback's success -- his 92-49-1 record as an Eagles starter, five NFC title games, one Super Bowl -- could ever quite resolve the reality that Donovan McNabb and Philadelphia never really found peace with each other. \"", "Every time I go back [to Philly], somebody will always mention, 'Hey, you never really liked the fans,'\" he says. \"", "And I'm like, 'Why would you think I didn't like the fans?'\"", "\n\nThere's no easy answer for the dearth of misty gratitude toward McNabb. ", "While Philadelphia has embraced Wentz for his blue-collar persona, it bristled at McNabb and his (understandable) unwillingness to move past those boos. ", "And McNabb hasn't shied away from acknowledging any ugly forces at play. ", "In 2013, when asked if race played a part in how he was perceived in his career, he didn't balk. \"", "It's been a part,\" he told Philadelphia Magazine. \"", "What percentage, I don't know. ", "Do I care? ", "No. ", "But it's been a part.\" ", "In the end, this seemed an unbreachable clash of personalities -- McNabb, to fans, was thin-skinned and distant; Philadelphians, from his perspective, were demanding and inhospitable.", "\n\nOver the years, though, the frustration between McNabb and Eagles fans seems to have given way to mutual apathy. ", "Outside Lincoln Financial Field before the Denver game in Week 9, there is a steady dose of nostalgia. ", "Brian Dawkins jerseys abound. ", "Reggie White. ", "Harold Carmichael. ", "There's just precious little McNabb-fueled wistfulness. ", "Fans applaud him when he returns. ", "They thank him for the wins and, yes, the memories. ", "But they don't long for him, despite the clear gulf between his time at quarterback and his successors'. \"", "I played for over a decade there and my winning percentage speaks for itself,\" McNabb says. \"", "And then after I left, they thought Kevin Kolb was going to be the guy. ", "Michael Vick went through his deal. ", "Nick Foles. ", "It was quarterback after quarterback after quarterback, but they weren't able to duplicate the things that we were doing consistently.\"", "\n\nIt is now Carson Wentz's turn to try to accomplish what McNabb never did. ", "What none of his predecessors was able to do. ", "It is his turn to try to win the Super Bowl, and to become -- and remain -- beloved in Philadelphia." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0006919017760083079, 0.011963020078837872, 0.0008585246396251023, 0.0005593408131971955, 0.0005606063059531152, 0.0006557813030667603, 0.0005735953454859555, 0.0007489834097214043, 0.0006382548599503934, 0.0007953273598104715, 0.001474425895139575, 0.0006222067750059068, 0.0007477892213501036, 0.0008264210191555321, 0.0006733891204930842, 0.0005971253267489374, 0.0007830122485756874, 0.0006021282752044499, 0.0014710599789395928, 0.00330400955863297, 0.024491846561431885, 0.0008100044215098023, 0.0018987907096743584, 0.0053194137290120125, 0.0038608263712376356, 0.0006616497994400561, 0.0006653379532508552, 0.0008591293008066714, 0.0005980112473480403, 0.0006774730863980949, 0.07529494166374207, 0.0005393534083850682, 0.000652992632240057, 0.0006118208984844387, 0.0006810750346630812, 0.001071671606041491, 0.0008445985149592161, 0.0006123193888925016, 0.0009139390313066542, 0.0012596659362316132, 0.0009735943167470396, 0.0015060689765959978, 0.0016920166090130806, 0.0006149420514702797, 0.0006097406148910522, 0.024566715583205223, 0.0006813291693106294, 0.00337974913418293, 0.0007264996529556811, 0.0006266986601985991, 0.0925653949379921, 0.0032211688812822104, 0.0006729711894877255, 0.0009249604190699756, 0.020535776391625404, 0.002235488500446081, 0.009630918502807617, 0.0007826657383702695, 0.000685235601849854, 0.0008484424324706197, 0.0007274667732417583, 0.003008729312568903, 0.0012033100938424468, 0.0013130095321685076, 0.0006837834953330457, 0.0007734309765510261, 0.0758775994181633, 0.0013785824412479997, 0.0007346011698246002, 0.0008713818388059735, 0.001234132912941277, 0.0005829961155541241, 0.0009521454921923578, 0.0013597431825473905, 0.0009054690017364919, 0.0014047673903405666, 0.0006299675442278385, 0.0005076244124211371, 0.0007968472200445831, 0.0006321980617940426, 0.0007212864002212882, 0.000664606923237443, 0.005064686294645071, 0.0007935098255984485, 0.00126085733063519, 0.000864777946844697, 0.0009989000391215086 ]
0.004884
87
[ "Q:\n\nПридаточное времени или изъяснительное?", "\n\nСкажите, пожалуйста, выделенное предложение придаточное времени или изъяснительное? ", "\nКак надо правильно задавать вопрос: ждал чего? ", "или ждал какого момента? ", "\nЯ сидел и ждал, пока она придет с работы. ", "\nСпасибо! ", "\n\nA:\n\nЭто придаточное изъяснительное, ПОКА (=КОГДА) является союзным словом. ", "В общем случае изъяснительное грамматическое значение определяется по семантике опорного слова, в данном случае глагол \"ждать\" имеет значение восприятия, целенаправленного наблюдения.", "\nДля сравнения: общим грамматическим значением для придаточных времени является временное соотношение двух ситуаций.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0014739815378561616, 0.0018145310459658504, 0.0015956751303747296, 0.006523722782731056, 0.0011442804243415594, 0.00600714236497879, 0.0012889574281871319, 0.0012387452879920602, 0.0014954466605558991, 0.0019954426679760218 ]
0.002458
10
[ "From the mind of Tom Beland\n\nCreator of True Story Swear to God\n\nThursday, October 16, 2008\n\nDODGERS BLUE... MY WORLD IS GOLDEN\n\nYou have to understand my long-standing hatred for the Los Angeles Dodgers to appreciate how great it was to see them get so close to the Word Series... only to fail. ", "MMMMmmmmMMmm.... it was like homemade cookies in the oven, I tell ya.", "\n\nI've always been a San Francisco sports fan. ", "Love the Giants, even though they're currently hopeless. ", "Love the Niners, even though they're currently hopeless. ", "Love the Warriors, even though they own the rights to looking hopeless. ", "And when you're a fan of the SF teams, LA is your worst enemy. ", "And if we can't win something... then they DEFINITELY can't win it..\n\nFelt pretty damned good.", "\n\nBut I'll say this. ", "For Los Angles not to have an NFL team is a crime and a farce. ", "Washing and Dallas have their rivalries. ", "So does New York and Boston. ", "You cannot be serious that Seattle-San Francisco is a good rivalry. ", "Or Arizona-San Francisco. ", "Nope. ", "Wont' do. ", "We need LA and we need it soon.", "\n\nThe high school I went to, The Boston Latin School, was founded in 1635 and has the oldest continuous football rivalry in the country going against Boston English.", "\n\nWhen I was attending, the Headmaster - that's what they call a principal when your school is older than the country, said that the team could lose every game of the year leading up to the Thanksgiving showdown with English, but that if you won that game, the season was a success.", "\n\nYou just described every sports nut I know. ", "You were born in (Insert name of home town) San Franciso so you love (Insert name of local team) The Giants and you hate (Insert name of specified rival) The Dodgers.", "\n\nI oughta know.. I'm raising two Dodger's fans. ", "I can't help it though, the were born in (insert name of home town here) Los Angeles.", "\n\nBy the way, you should talk. ", "The Giants started making LA fans happy 2 or 3 seasons ago.", "\n\nAbout Me\n\nI'm living my dream. ", "I'm the creator of the Eisner-nominated series, TRUE STORY, SWEAR TO GOD. ", "I also write for Marvel and Bongo comics. ", "I love music, sports and movies. ", "Most of all... I love my Lily.", "\nEmail me at [email protected]" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0033829743042588234, 0.0014530509943142533, 0.0007609928725287318, 0.0008125845924951136, 0.002124891383573413, 0.0008458299562335014, 0.14239932596683502, 0.009668266400694847, 0.0006774053326807916, 0.20381413400173187, 0.0010579318040981889, 0.0007233410724438727, 0.0008122396538965404, 0.0006329109892249107, 0.0036054900847375393, 0.004487707279622555, 0.0007248102338053286, 0.0006519827293232083, 0.0006778489914722741, 0.0006585153751075268, 0.01629089005291462, 0.001644252217374742, 0.0007627811282873154, 0.0005934963119216263, 0.0006081509636715055, 0.0006883728201501071, 0.0032904716208577156, 0.0012246719561517239, 0.0007734143873676658, 0.000623488740529865, 0.0007961197989061475 ]
0.013138
31
[ "A step-by-step guide for how to cook asparagus in the oven! ", "This oven roasted baked asparagus recipe is ready in under 20 minutes, with basic ingredients. ", "It’s the best way to cook asparagus! ", "GET THE RECIPE Asparagus in the Oven submitted by Wholesome Yum\n\nThis keto air fryer onion rings recipe is SO CRISPY, with 7 ingredients! ", "Learning how to make onion rings in the air fryer is the key to keto onion rings that are just as crispy as real ones. ", "GET THE RECIPE air fryer onion rings submitted by Wholesome Yum\n\nThe best gluten-free keto coconut macaroons recipe takes just 25 minutes! ", "Learn how to make coconut macaroons with just 6 ingredients + one bowl. ", "GET THE RECIPE keto coconut macaroons submitted by Wholesome Yum\n\nWant to know how to make chimichurri sauce? ", "It’s super easy! ", "This authentic Argentinian chimichurri sauce recipe is the perfect topping for steak. ", "GET THE RECIPE Chimichurri Sauce submitted by Wholesome Yum\n\nPortobello pizza is an easy and delicious way to make keto stuffed mushrooms! ", "This low carb portobello mushroom pizza recipe is quick with a few ingredients, delicious for the whole family, and Atkins friendly. ", "GET THE RECIPE Portobello Pizza submitted by Wholesome Yum\n\nThis baked lemon herb parmesan crusted salmon recipe is super easy and delicious! ", "It’s one of the best ways to make salmon. ", "Ready in less than 30 minutes start to finish! ", "GET THE RECIPE Baked Lemon Herb Crusted Salmon submitted by Wholesome Yum\n\nA super easy steak bites appetizer! ", "This flavorful steak bites recipe with chimichurri sauce is quick and easy to make with just 4 common ingredients. ", "GET THE RECIPE Easy steak bites appetizer submitted by Wholesome Yum\n\nThis easy, creamy chicken florentine soup recipe is simple to make using just a few common ingredients. ", "Healthy, delicious, and ready in only 20 minutes! ", "GET THE RECIPE Creamy Chicken Florentine submitted by Wholesome Yum" ]
{ "pile_set_name": "Pile-CC" }
[ 0.007434864994138479, 0.0007675626548007131, 0.030811334028840065, 0.00297108618542552, 0.000903919106349349, 0.013786946423351765, 0.0009550165268592536, 0.0015856631798669696, 0.0008746942621655762, 0.0010238225804641843, 0.002268884563818574, 0.001073336461558938, 0.0014068445889279246, 0.001218665624037385, 0.0012473982060328126, 0.01213159877806902, 0.0006214090972207487, 0.0009573796414770186, 0.0006486791535280645, 0.0021751699969172478 ]
0.004243
20
[ "Course Descriptions\n\nAUT - Automotive\n\nAUT 297\n\nCOOPERATIVE EDUCATION\n\n(1 - 5.00 CR.)", "\n\nSupervised on-the-job training for pay in approved business and government organizations. ", "Applicable to all curricula at the discretion of the College. ", "See eligibility requirements on page 39. ", "Credit/work ratio not to exceed 1:5 hrs. ", "May be repeated for credit. ", "Variable hrs." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0006057078717276454, 0.0005701806512661278, 0.0008780161151662469, 0.0006009357748553157, 0.0005920820985920727, 0.0005625109770335257, 0.000677756906952709 ]
0.000641
7
[ "Have you ever visited a paranormal museum? ", "Now you can,\nJohn Zaffis, a renown paranormal investigator, has complied a few of the\nmany items in his paranormal museum, read about the sinister statue that\ncaused its owner to have very bad feelings about it after only one day of\nhaving it in his home, the organ, the skull and many more items. ", "Click on the\nlink and enter the world of the paranormal through John\nZaffis' Paranormal Museum\n\nEver experience something paranormal and unexplainable? ", "Have an apparition in your house that is unwelcome? ", "Maybe you, yourself, are experiencing the onslaughts of demonic activity.", "\nMany people ask where can we go for help? ", "Who do we turn to? ", "Who will believe me?", "\n\nThese are questions that no one should have to ask, but there are many people that do.", "\nWe are here to answer your questions, to believe you, to help.", "\n\nWe have been in the Paranormal field for many years and plan to continue for many years to come. ", "This site is dedicated to the research of paranormal activity. ", "Explore, read our stories and see pictures that we have taken.", "\n\nPlease contact us with your situation and your area and we will contact you right away. ", "All personal information will be kept confidential.", "\n\nVisit back often for updated pictures, stories and site enhancements\n\nContact us at:\n\nTo contact us about paranormal ideas, questions, or for more information, you\ncan reach us my clicking on our names below:\n\nInterested in finding out more about ghosts?", "\nWonder what Lycanthropy is? ", "Want to know how to take ghost pictures or\nread a crystal ball? ", "Are Vampires real? ", "These and other topics are\ndisplayed under our Investigating and Ghost Information Section.", "\n\nYou can now visit us through our new web\naddress....www.", "AwareFoundation.net\n\nDid filmmakers catch a Ghost in a Car Commercial?", "\n\nThis is a spoof car advertisement from Europe.", "\nThe story goes: \"When the company finished filming the ad, the people who\nmade it noticed a ghostly white mist moving along the side of the car. ", "The ad\nwas never put on TV because the unexplained ghostly phenomenon frightened the\nproduction team.", "\n\nTurn your sound on (you can hear a crackling noise when\nthe mist appears), then click\nhere to watch the movie. ", "About half-way through, watch the white mist\ncross from in front of the car then begin to follow it.\"", "\n\nOur good friend and renown paranormal investigator, John Zaffis, just came\nout with his own book.", "\n\nJohn has investigated thousands of reports of alleged\nhauntings and witnessed and assisted in over 85 exorcisms to date. ", "He has\nwitnessed and documented levitating furniture, physical attacks by unseen\nentities and many other inexplicable actions encompassing the supernatural and\npreternatural." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0008040598477236927, 0.0006443783058784902, 0.0009156900923699141, 0.014963817782700062, 0.4170331656932831, 0.0005868459702469409, 0.0015708684222772717, 0.00627986341714859, 0.0006382515421137214, 0.0009432569495402277, 0.0005634846165776253, 0.0006506763747893274, 0.0005550163914449513, 0.0008868749719113111, 0.0005979309207759798, 0.0005572842783294618, 0.0015156816225498915, 0.0009085173369385302, 0.0021357485093176365, 0.0005648615187965333, 0.0006019655847921968, 0.001153583754785359, 0.00770782632753253, 0.0005743787041865289, 0.0007730183424428105, 0.0023796071764081717, 0.0008094345685094595, 0.0006297676591202617, 0.0011362892109900713, 0.0006813947693444788 ]
0.015659
30
[ "YOUR CART\n\nWorking Equitation\n\nAim\n\nRiders are required to negotiate a number of obstacles, ultimately at the walk and canter but with walk and trot at the lower levels. ", "The courses are designed to show the rider’s ability to control their horse’s paces correctly and to display trust and empathy between horse and rider as well as the horse’s acceptance and trust of and response to the rider’s aids. ", "The ultimate aim is to ride the obstacle course as in a dressage test, showing obedience and collection in walk and canter with the reins in one hand (the left) throughout the test. ", "The horse should be participating with his rider showing no insecurity or hesitation at the obstacles. ", "Accuracy, balance and lightness should be demonstrated from one obstacle to the next.", "\n\nWorking Equitation should be judged on the classical principles, which is without force, showing true empathy between horse and rider and the horse working with the rider not for the rider\n\nHistory\n\nWorking Equitation is growing at an incredible rate in Australia today. ", "The working equitation discipline originated in Portugal, and is based on the need for horse to accept and tolerate any strange obstacle they may encounter during everyday field work around cattle and stock.", "\n\nWorking Equitation became recognised as a competitive sport in 1996 with the first European Championships taking place that year in Italy. ", "It is now a recognised sport in France, Spain, Italy, Portugal, Brazil, UK, Belgium, Mexico and most recently, Australia, having secured considerable following in each of these countries.", "\n\nThe characteristics of Working Equitation lead to its huge success and the four initial countries in which trials of this type were used - Portugal, Spain, France and Italy – were promptly expanded to other countries such as Germany, Belgium, England, Sweden, Switzerland, Austria, Australia, Holland, Czech Republic, San Marino, Brazil, Colombia, Slovenia, USA and Mexico.", "\n\nAustralia’s W.E governing body, WEGBI has its patron Gill Kennerley to thank for introducing the sport to Australia and becoming the founder of working equitation in Australia in 2009\n\nAll breeds are welcome in theirtraditional/acceptable competition attire;\n\n· Andalusian\n\n· Warmblood\n\n· Western, Paint, Quarter Horse\n\n· Traditional\n\n· Pony Club\n\n· Australian Stock Horse\n\n· Pony breeds\n\nUpgrade your skills,join our club today!", "\n\nGive it a go!", "\n\nRegular training/practice days are held at Mulgoa, with kind and gentle instructors and assistants to guide you through every obstacle and phase, to answer your questions and encourage you along the way, all to prepare you for your first competition!" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0010437036398798227, 0.0011446522548794746, 0.0008257015724666417, 0.001064277603290975, 0.0005876751965843141, 0.0005979303386993706, 0.0007538250647485256, 0.0005809670547023416, 0.0005693449056707323, 0.0005561347352340817, 0.0008604524773545563, 0.0023848507553339005, 0.0006801565759815276 ]
0.000896
13
[ "El consenso general en torno a cada trabajo de Manic Street Preachers siempre ronda en torno a cuánto se acercan o alejan de sus discos más representativos de la década de los 90. ", "Si giran hacia la delicadeza melodiosa, y por momentos orquestal, de “Everything Must Go” (1996) creado después de la desaparición de Richey Edwards, o a las composiciones más directas de “Generation Terrorists” (1992) con el guitarrista aún en sus filas. ", "La verdad es que el presente de los galeses en “Resistance Is Futile” bebe de ambas fuentes, y ese equilibrio configura un viaje fascinante por una nueva entrega con aires que tienen que ver más con el rejuvenecimiento de la banda que con su retiro, en tiempos en que la solidez discursiva se ve enfrentada al desconcierto generalizado hacia las ideologías. ", "Tarea difícil para un grupo que siempre tiene algo que decir sobre su entorno político y social.", "\n\nAcostumbrados a las letras de gran bagaje intelectual, el bajista Nicky Wire traspasa las historias de grandes personajes como “Vivian”, inspirada en la niñera Vivian Maier, fotógrafa aficionada que dejó alrededor de 150 mil postales de Chicago y Nueva York descubiertas sólo tras su muerte; “In Eternity”, homenaje a Bowie que sónicamente descansa en el camino que el duque blanco trazó en “Station To Station” (1976) y “Low” (1977); “Dylan & Caitlin”, cantada a dúo con la talentosa The Anchoress, quien aporta la perspectiva femenina para hablar sobre la tormentosa relación del poeta Dylan Thomas y su esposa Caitlin MacNamara; e “International Blue”, colorida aproximación a su catálogo más clásico y guitarrero, con un gancho eufórico que honra la memoria de Yves Klein, artista francés representante del movimiento neodadísta. ", "La energía melancólica de “Liverpool Revisited” rememora a los 96 hinchas del Liverpool que murieron aplastados contra una de las vallas del estadio, en lo que se conoce como la Tragedia de Hillsborough, hecho ocurrido en 1989 y que los Manics retratan en un track lleno de esperanza que invita a seguir luchando para buscar respuestas.", "\n\nPrecisamente, la idea del malestar social presente en nuestros días se refleja en “People Give In”, cuyo riff luminoso y reconciliador –que parece haber salido de una caja musical– explota en la interpretación grandilocuente de James Dean Bradfield, adornada por una impecable sección de cuerdas, presentes también en el bello medio tiempo de “Distant Colours”, formulada a partir del panorama de confusión política que se vive actualmente en el mundo con una enternecedora sensibilidad pop, estilo que también se adueña de “Hold Me Like A Heaven”, rebosante de una vitalidad que la hace sentir muy actual. ", "Como complemento de su lado melódico, lo más rockero de la placa se palpa en “Broken Algorithms”, con una excelente introducción de la batería de Sean Moore, que marca el paso para que irrumpa el simple pero efectivo riff de Bradfield, y “Sequels Of Forgotten Wars”, que trae a la mesa un sonido muy confrontacional para escupir una crítica ácida sobre la histeria digital.", "\n\nLa vibra de “A Song For The Sadness” –también de aproximación muy frontal– contrasta con la languidez de “The Left Behind”, encargada de cerrar el disco con un oscuro manto de melancolía que fluye en una exquisita progresión de acordes liderada por el piano, una prueba irrefutable de que la banda sabe que puede confiar en las medallas ganadas y aun así volver a sus raíces para facturar un disco orgánico, directo e interesante, tomando la guitarra como punto de partida, tal y como lo fue en sus primeros días, pero agregando los elementos que han ido descubriendo en el trayecto recorrido.", "\n\nTras un silencio discográfico de cuatro años, en el que se dedicaron a las giras de conmemoración de “The Holy Bible” (1994), “Everything Must Go” y el lanzamiento de “Futurology” (2014), “Resistance Is Futile” encuentra a Manic Street Preachers en un punto en que sus dos almas conviven de buena manera a diez años desde que la justicia británica cambiara el estado legal de Richey Edwards de “persona desaparecida” a “presuntamente fallecida”. ", "La banda no escapa de su pasado y afronta bien el futuro, porque sabe que resistirse a él sería atentar contra un diseño que construyeron para toda una vida. ", "Quién iba a pensar que la agrupación que alguna vez declaró que iban a desaparecer en el cénit de su estrellato tras lanzar un solo disco y llenar el Wembley tres veces seguidas iba a estar aquí tras veinte años de carrera y trece discos, negándose a saltar desde el puente de la nostalgia para no caer en la intrascendencia.", "\n\nArtista: Manic Street Preachers\n\nDisco: Resistance Is Futile\n\nDuración: 46:18\n\nAño: 2018\n\nSello: Columbia" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.015769517049193382, 0.032435860484838486, 0.1358552724123001, 0.0374678410589695, 0.002560393186286092, 0.008628223091363907, 0.01465883944183588, 0.01836870238184929, 0.017408864572644234, 0.02997102588415146, 0.034330230206251144, 0.06364253163337708, 0.005876138806343079 ]
0.032075
13
[ "import {expect} from 'chai';\n\nimport Agent from '../../../../../app/agent';\nimport Fixture from '../../../../../app/fixture';\n\nvar patchData;\n\nbeforeEach(function() {\n patchData = {\n data: {\n type: 'books',\n id: '1',\n attributes: {\n title: 'tiddlywinks'\n }\n }\n };\n return Fixture.reset();\n});\n\ndescribe('updatingResources', function() {\n\n it('must respond to a successful request with an object', function() {\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.an('object');\n });\n });\n\n it('must respond to an unsuccessful request with a JSON object', function() {\n patchData.data.id = 'asdf';\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(400, 499);\n expect(res.body).to.be.an('object');\n expect(res.body.errors).to.be.an('array');\n });\n });\n\n // need to implement update / updateRelationship etc\n it.skip('must require a single resource object as primary data', function() {\n patchData.data = [patchData.data];\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(400);\n });\n });\n\n it('must require primary data to have a type member', function() {\n delete patchData.data.type;\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(400);\n });\n });\n\n it('must require a content-type header of application/vnd.api+json', function() {\n return Agent.request('PATCH', '/v1/books/1')\n .type('json')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(415);\n });\n });\n\n // TODO: Source/DB test: verify rollback on error\n it('must not allow partial updates');\n\n describe('updatingResourceAttributes', function() {\n it('should allow only some attributes to be included in the resource object', function() {\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n });\n });\n\n it('should allow all attributes to be included in the resource object', function() {\n patchData.data = {\n id: '1',\n type: 'books',\n attributes: {\n date_published: '2014-02-25',\n title: 'tiddlywinks'\n },\n relationships: {\n stores: {data: [\n {type: 'stores', id: '1'},\n {type: 'stores', id: '2'}\n ]}\n }\n };\n var firstRead;\n return Agent.request('GET', '/v1/books/1?include=stores').promise()\n .then(function(res) {\n firstRead = res.body;\n\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise();\n })\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var secondRead = res.body;\n var payloadData = secondRead.data;\n var payloadRelationships = payloadData.relationships;\n var updateRelationships = patchData.data.relationships;\n\n expect(secondRead.included.length).to.equal(2);\n expect(payloadData.attributes.title).to.equal(patchData.data.attributes.title);\n expect(payloadData.attributes.date_published).to.equal(patchData.data.attributes.date_published);\n expect(payloadRelationships.stores.data[0].id).to.equal(updateRelationships.stores.data[0].id);\n expect(payloadRelationships.stores.data[1].id).to.equal(updateRelationships.stores.data[1].id);\n\n });\n });\n\n it('must interpret missing fields as their current values', function() {\n var firstRead;\n return Agent.request('GET', '/v1/books/1?include=stores').promise()\n .then(function(res) {\n firstRead = res.body;\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise();\n })\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var secondRead = res.body;\n expect(secondRead.included).to.deep.equal(firstRead.included);\n expect(secondRead.data.attributes.title).to.not.equal(firstRead.data.attributes.title);\n expect(secondRead.data.attributes.date_published).to.equal(firstRead.data.attributes.date_published);\n expect(secondRead.data.links).to.deep.equal(firstRead.data.links);\n });\n });\n });\n\n describe('updatingResourceRelationships', function() {\n it('must update to-One relationship with relationship member', function() {\n patchData.data.relationships = {\n author: {data: {type: 'authors', id: '2'}},\n series: {data: {type: 'series', id: '2'}}\n };\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n return Agent.request('GET', '/v1/books/1?include=author,series').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n var updateRelationshps = patchData.data.relationships;\n expect(payloadRelationships.author.data.id).to.equal(updateRelationshps.author.data.id);\n expect(payloadRelationships.series.data.id).to.equal(updateRelationshps.series.data.id);\n });\n });\n\n it('must attempt to remove to-One relationship with null', function() {\n patchData.data.relationships = { series: {data: null }};\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n return Agent.request('GET', '/v1/books/1?include=series').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(payloadRelationships.series.data).to.equal(null);\n });\n });\n });\n\n // A server MAY reject an attempt to do a full replacement of a to-many relationship. ", "In such a case, the server MUST reject the entire update, and return a 403 Forbidden response.", "\n // Note: Since full replacement may be a very dangerous operation, a server may choose to disallow it. ", "A server may reject full replacement if it has not provided the client with the full list of associated objects, and does not want to allow deletion of records the client has not seen.", "\n describe('updatingResourceToManyRelationships', function() {\n it('must update homogeneous to-Many relationship with an object with type and id members under relationships', function() {\n patchData.data.relationships = {\n stores: { data: [\n { type: 'stores', id: '1' },\n { type: 'stores', id: '2' }\n ]}\n };\n\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n var updateRelationships = patchData.data.relationships;\n expect(res.body.included.length).to.equal(2);\n expect(payloadRelationships.stores.data[0].id).to.equal(updateRelationships.stores.data[0].id);\n expect(payloadRelationships.stores.data[1].id).to.equal(updateRelationships.stores.data[1].id);\n });\n });\n\n it('must attempt to remove to-Many relationships with the id member of the data object set to []', function() {\n patchData.data.relationships = {\n stores: {data: []},\n };\n\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.be.within(200, 299);\n expect(res.body).to.be.a('object');\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(payloadRelationships.stores.data).to.deep.equal([]);\n });\n });\n\n // Endpoints does not support heterogenous to-Many relationships\n // it('must require heterogeneous to-Many relationship links to be an object with a data member containing an array of objects with type and id members');\n });\n\n describe('responses', function() {\n\n describe('204NoContent', function() {\n it('must return 204 No Content on a successful update when attributes remain up-to-date', function() {\n return Agent.request('PATCH', '/v1/stores/1')\n .send({\n data: {\n type: 'stores',\n id: '1',\n attributes: {\n name: 'empty store'\n }\n }\n })\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n });\n });\n });\n\n describe('200Ok', function() {\n\n it('must return 200 OK if it accepts the update but changes the resource in some way', function() {\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(200);\n // must include a representation of the updated resource on a 200 OK response\n expect(res.body.data.attributes.title).to.equal(patchData.data.attributes.title);\n });\n });\n });\n\n // API decision to not create the route - endpoints will always support updating\n // describe('403Forbidden', function() {\n // it('must return 403 Forbidden on an unsupported request to update a resource or relationship');\n // });\n\n describe('404NotFound', function() {\n it('must return 404 Not Found when processing a request to modify a resource that does not exist', function() {\n patchData.data.id = '9999';\n return Agent.request('PATCH', '/v1/books/9999')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(404);\n });\n });\n\n it('must return 404 Not Found when processing a request that references a to-One related resource that does not exist', function() {\n patchData.data.relationships = {\n author: {data: {type: 'authors', id: '9999'}}\n };\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(404);\n });\n });\n\n it('must return 404 Not Found when processing a request that references a to-Many related resource that does not exist', function() {\n patchData.data.relationships = {\n stores: {data: [{type: 'stores', id: '9999'}]}\n };\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(404);\n });\n });\n });\n\n describe('409Conflict', function() {\n it('should return 409 Conflict when processing an update that violates server-enforced constraints', function() {\n patchData.data.relationships = {\n author: {data: null}\n };\n return Agent.request('PATCH', '/v1/books/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(409);\n });\n });\n\n // FIXME: Re-implement test\n it.skip('must return 409 Conflict when processing a request where the id does not match the endpoint', function() {\n return Agent.request('PATCH', '/v1/books/2')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(409);\n });\n });\n\n // FIXME: Re-implement test\n // see request-handler/lib/verify_data_object\n it.skip('must return 409 Conflict when processing a request where the type does not match the endpoint', function() {\n return Agent.request('PATCH', '/v1/authors/1')\n .send(patchData)\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(409);\n });\n });\n });\n\n // Not testable as written. ", "Each error handling branch should be\n // unit-tested for proper HTTP semantics.", "\n // describe('otherResponses', function() {\n // it('should use other HTTP codes to represent errors');\n // it('must interpret errors in accordance with HTTP semantics');\n // it('should return error details');\n // });\n });\n});\n\ndescribe('updatingRelationships', function() {\n\n describe('updatingToOneRelationships', function() {\n // /books/1/author\n it('must update relationships with a PATCH request to a to-one `relationship` URL containing a data object with type and id members and return 204 No Content on success', function() {\n return Agent.request('PATCH', '/v1/books/1/relationships/author')\n .send({ data: { type: 'authors', id: '2' }})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=author').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(payloadRelationships.author.data.id).to.equal('2');\n });\n });\n\n it('must remove relationships with a PATCH request to a to-one relationship URL containing a data object with a null value and return 204 No Content on success', function() {\n return Agent.request('PATCH', '/v1/books/1/relationships/series')\n .send({ data: null })\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=series').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(payloadRelationships.series.data).to.equal(null);\n });\n });\n\n it('must require a top-level data member containing either an object with type and id members or null', function() {\n return Agent.request('PATCH', '/v1/books/1/relationships/series')\n .send({ data: { what: 'a bad request'}})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(400);\n });\n });\n });\n\n describe('updatingToManyRelationships', function() {\n it('must require a top-level data member an array of linkage objects for PATCH requests', function() {\n return Agent.request('PATCH', '/v1/books/1/relationships/stores')\n .send({ data: [\n { what: 'a bad request' }\n ]})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(400);\n });\n });\n\n // /books/1/relationships/stores\n it('must update relationships with a PATCH request to a to-many relationship URL containing a data object with type and id members and return 204 No Content on success', function() {\n return Agent.request('PATCH', '/v1/books/1/relationships/stores')\n .send({ data: [\n { type: 'stores', id: '1' },\n { type: 'stores', id: '2' }\n ]})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(res.body).to.have.property('included');\n expect(payloadRelationships.stores.data[0].id).to.equal('1');\n expect(payloadRelationships.stores.data[1].id).to.equal('2');\n });\n });\n\n it('must remove relationships with a PATCH request to a to-many relationship URL containing a data object with a null value and return 204 No Content on success', function() {\n var newIds = [];\n return Agent.request('PATCH', '/v1/books/1/relationships/stores')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(payloadRelationships.stores.data).to.deep.equal(newIds);\n });\n });\n\n it('must completely replace every member of the relationship on a PATCH request if allowed', function() {\n var newIds = [\n { type: 'stores', id: '1' }\n ];\n return Agent.request('PATCH', '/v1/books/1/relationships/stores')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(res.body).to.have.property('included');\n expect(payloadRelationships.stores.data.length).to.equal(1);\n expect(payloadRelationships.stores.data[0].id).to.equal('1');\n });\n });\n\n it('must return an appropriate error if some resources cannot be found or accessed', function() {\n var newIds = [\n { type: 'stores', id: '3' }\n ];\n return Agent.request('PATCH', '/v1/books/1/relationships/stores')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(404);\n });\n });\n\n it('must return a 403 Forbidden if complete replacement is not allowed by the server', function() {\n var newIds = [\n { type: 'books', id: '1' }\n ];\n return Agent.request('PATCH', '/v1/stores/2/relationships/books')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(403);\n });\n });\n\n it('must require a top-level data member an array of linkage objects for POST requests', function() {\n return Agent.request('POST', '/v1/books/1/relationships/stores')\n .send({ data: [\n { what: 'a bad request' }\n ]})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(400);\n });\n });\n\n it('must append specified members of a POST request and return 204 No Content if the resource is successfully added or already present', function() {\n var newIds = [\n { type: 'stores', id: '1' }\n ];\n return Agent.request('POST', '/v1/books/1/relationships/stores')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(res.body).to.have.property('included');\n expect(payloadRelationships.stores.data.length).to.equal(2);\n expect(payloadRelationships.stores.data[0].id).to.equal('1');\n expect(payloadRelationships.stores.data[1].id).to.equal('2');\n });\n });\n\n it('must not add existing type and id combinations again in a POST request, but still respond with 204 No Content', function() {\n var newIds = [\n { type: 'stores', id: '2' }\n ];\n return Agent.request('POST', '/v1/books/1/relationships/stores')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(res.body).to.have.property('included');\n expect(payloadRelationships.stores.data.length).to.equal(1);\n expect(payloadRelationships.stores.data[0].id).to.equal('2');\n });\n });\n\n it('must require a top-level data member an array of linkage objects for DELETE requests', function() {\n return Agent.request('DELETE', '/v1/books/1/relationships/stores')\n .send({ data: [\n { what: 'a bad request' }\n ]})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(400);\n });\n });\n\n it('must respond 204 No Content to a DELETE request if the relationship is successfully deleted', function() {\n var newIds = [\n { type: 'stores', id: '2' }\n ];\n return Agent.request('DELETE', '/v1/books/1/relationships/stores')\n .send({data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(payloadRelationships.stores.data).to.deep.equal([]);\n });\n });\n\n it('must respond 204 No Content to a DELETE request if the relationship is already missing', function() {\n var newIds = [\n { type: 'stores', id: '1' }\n ];\n return Agent.request('DELETE', '/v1/books/1/relationships/stores')\n .send({ data: newIds})\n .promise()\n .then(function(res) {\n expect(res.status).to.equal(204);\n return Agent.request('GET', '/v1/books/1?include=stores').promise();\n })\n .then(function(res) {\n var payloadRelationships = res.body.data.relationships;\n expect(res.body).to.have.property('included');\n expect(payloadRelationships.stores.data.length).to.equal(1);\n expect(payloadRelationships.stores.data[0].id).to.equal('2');\n });\n });\n\n // API decision to not create the route - endpoints will always support deleting relationships\n // it('must respond 403 Forbidden to a DELETE request if the method is unsupported');\n });\n\n describe('responses', function() {\n\n // Tested above\n // describe('204NoContent', function() {\n // it('must return 204 No Content if the update is successful and the attributes remain up to date');\n // });\n\n // API decision to not create the route - endpoints will always support updating\n // describe('403Forbidden', function() {\n // it('must return 403 Forbidden in response to an unsupported request to update a relationship');\n // });\n\n // Not testable as written. ", "Each error handling branch should be\n // unit-tested for proper HTTP semantics.", "\n // describe('otherResponses', function() {\n // it('should use other HTTP codes to represent errors');\n // it('must interpret errors in accordance with HTTP semantics');\n // it('should return error details');\n // });\n });\n});\n" ]
{ "pile_set_name": "Github" }
[ 0.0018211277201771736, 0.0008434741757810116, 0.0006926631322130561, 0.0007061046781018376, 0.0009789454052224755, 0.0005956834647804499, 0.001058278139680624, 0.0005956834647804499, 0.0009262078674510121 ]
0.000913
9
[ "/* Demo */\n\n.demo:first-of-type {\n margin-top: 2rem;\n}\n.demo:last-of-type {\n margin-bottom: 2rem;\n}\n@media (min-width: 940px) {\n .demo:last-of-type {\n margin-bottom: 4rem;\n }\n}\n\n.demo-wrapper {\n position: relative;\n max-width: 740px;\n margin: 0 auto;\n padding: 0 2rem;\n}\n\n\n/* Toggle Button ----------------------------- */\n\n.demo-toggle-button {\n position: relative;\n display: block;\n margin: 0;\n padding: .5em 1.5em;\n line-height: 1.5;\n font: inherit;\n font-weight: 600;\n font-size: 1.2em;\n text-align: left;\n border: none;\n color: inherit;\n background-color: transparent;\n transition: border-color .12s;\n outline: none;\n}\n\n.demo-toggle-button:before,\n.demo-toggle-button:after {\n content: \"\";\n position: absolute;\n left: 0;\n width: 2px;\n height: 50%;\n background-color: hsl(0,0%,88%);\n transition: transform .2s cubic-bezier(.4,.1,0,1);\n}\n.demo-toggle-button:before {\n top: 0;\n transform-origin: bottom center;\n transform: translateX(.7em) rotate(-30deg) scale(.75);\n}\n.demo-toggle-button:after {\n bottom: 0;\n transform-origin: top center;\n transform: translateX(.7em) rotate(30deg) scale(.75);\n}\n.is-open .demo-toggle-button:before,\n.is-open .demo-toggle-button:after {\n transform: rotate(0deg);\n}\n.demo-toggle-button:focus:before,\n.demo-toggle-button:focus:after {\n background-color: currentColor;\n}\n\n/* Meta info */\n\n.demo-meta {\n margin-top: .2em;\n font-size: 11px;\n font-weight: 300;\n text-transform: uppercase;\n color: var(--color-subtle);\n}\n.demo-meta-divider {\n margin: 0 .5em;\n}\n\n\n/* Demo Box ----------------------------- */\n\n.demo-box {\n display: none;\n position: relative;\n padding: 2em;\n margin-top: 1em;\n margin-bottom: 2em;\n border-radius: 6px;\n border: 1px solid var(--color-border);\n background-color: var(--color-bg);\n}\n.demo-box:before {\n content: \"\";\n position: absolute;\n top: -11px;\n width: 20px;\n height: 20px;\n background-color: inherit;\n border-top: inherit;\n border-right: inherit;\n border-top-right-radius: 3px;\n transform: rotate(-45deg);\n}\n\n.is-open .demo-box {\n display: block;\n animation: demo-box-fade-in .2s cubic-bezier(0, .20, .20, .96);\n}\n@keyframes demo-box-fade-in {\n 0% { opacity: 0; transform: translateY(-20px); }\n 100% { opacity: 1; transform: translateY(0); }\n}\n\n.demo-box > p:first-child {\n margin-top: 0;\n}\n\n.demo-box h5 {\n font-size: 1em;\n margin-bottom: .6em;\n}\n\n\n/* Demo Controls ----------------------------- */\n\n.demo-controls {\n display: flex;\n align-items: center;\n}\n\n.demo-button {\n align-self: flex-start;\n margin-right: 1em;\n border: 2px solid;\n border-radius: 4px;\n font: inherit;\n font-size: 1.2em;\n padding: .4em 1.2em;\n color: inherit;\n background-color: transparent;\n}\n.demo-button:focus {\n outline: none;\n background-color: white;\n}\n.demo-button:active {\n border-color: var(--color-border);\n}\n\n.demo-input {\n flex: 1;\n border: 2px solid var(--color-border);\n border-radius: 4px;\n font: inherit;\n font-size: 1.2em;\n padding: .4em .8em;\n color: inherit;\n background-color: transparent;\n}\n.demo-input:focus {\n outline: none;\n border-color: hsl(0,0%,80%);\n background-color: white;\n}\n\n.demo-response {\n flex: 1;\n word-break: break-word;\n}\n\n.smooth-appear {\n opacity: 1;\n transition: opacity .5s ease-in-out;\n}\n\n.disappear {\n opacity: 0;\n}\n.demo-button.smooth-disappear:focus {\n outline: inherit;\n border-color: inherit;\n background-color: inherit;\n}\n\n/* ProTip ----------------------------- */\n\n.demo-protip {\n margin-top: 2rem;\n padding: 1.5rem 2rem 2rem 2rem;\n border: 1px solid hsla(0,0%,0%,.06);\n border-radius: 6px;\n background: var(--color-accent) linear-gradient(hsla(0,0%,100%,.85), hsla(0,0%,100%,.85));\n}\n.demo-protip h2 {\n margin: 0 0 .5rem 0;\n}\n.demo-protip strong {\n font-weight: 600;\n}\n\n" ]
{ "pile_set_name": "Github" }
[ 0.0013106194091960788 ]
0.001311
1
[ "Comparability of data obtained from migrant farmworkers and their spouses on occupational history.", "\nEpidemiologic studies, particularly case-control studies, often rely on proxy respondents to provide information about subjects' occupational histories. ", "The quality of proxy-reported information in occupational histories has never been evaluated for migrant farmworkers. ", "We compared occupational histories self-reported by 31 farmworkers with those reported by their wives. ", "The work histories were obtained using an icon/calendar-based questionnaire that was designed to facilitate recall for migrant farmworkers, who typically have complex work histories. ", "The work histories provided by proxy respondents contained 32% fewer jobs and accounted for 24% fewer years than the self-reported histories. ", "Correlations for lifetime duration of employment in different types of jobs were moderate to good for general agricultural jobs in Washington (0.70) and apple-related jobs (0.65), which were held by virtually all of the farmworkers; correlations were moderate to poor for less common jobs and for specific types of tasks. ", "Agreement was better after marriage than before, and for jobs held in the current year compared to other time frames. ", "Overall, the ability of the spouses to provide occupational histories for farmworkers was within the range observed in studies involving other occupations and industries. ", "In studies involving farmworkers, when study subjects cannot be interviewed, spouses can provide useful information on occupational histories. ", "However, the information should be used only for more generalized exposure assessments; it is most appropriate for estimating cumulative duration of agricultural work, or recent work, by place or for common crops." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0005849667941220105, 0.0005623397300951183, 0.0006063443724997342, 0.000630678259767592, 0.0005696906591765583, 0.0006618841434828937, 0.0006085269851610065, 0.0005544817540794611, 0.0005533145158551633, 0.0005576288676820695, 0.0005270077381283045 ]
0.000583
11
[ "Thursday, September 30, 2010\n\nI fought Chinese food...\n\nand the Chinese food won:\n\nHoly Dex mountain, batman!", "\n\nI think I need to start doing a 40/60 dual wave - the MEF backlash always happens because I tank shortly after eating my meal...and then have to chug some juice and stop my square 3-hour delivery for fear of killing myself. ", "Right around midnight I start to pay for my error. ", "And then, of course, I aggressively correct that sucker upon waking and end up low on the subway.", "\n\n2 comments:\n\nThis may sound crazy. ", "Okay I know it's crazy. ", "But I was determined to figure out Chinese food and pizza for Caleb so I would chart it out every time he had them. ", "I would bolus and check his bg every hour or two after and map out where he needed more or less insulin and finally came up with a plan. ", "It took a while, but it usually works. ", "I keep the \"dose formula\" in a note on my phone bc I won't likely remember it.", "\n\nI hate chasing those numbers! ", "Ellie was HIGH HIGH HIGH, we put more and more insulin in that little girl...then 1:45 in the morning I have Dexcom screaming LOW LOW LOW. ", "Ugh! ", "If it's not the food hiding in her with awful timing...it's the insulin hiding in her waiting for me to fall asleep! ", "Damn D! ", "Good luck to ya on your quest to figure out chinese food!", "\n\nHi there.", "\n\nI'm Karen. ", "I'm a PWD - Type 1 diabetes, to be exact. ", "I live in Brooklyn. ", "I obsess about things. ", "I have a husband, a darling little girl, and two cats (all awesome). ", "I read a lot. ", "I love coffee (a bit too much)." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0019349193898960948, 0.052813366055488586, 0.0030874134972691536, 0.76450115442276, 0.00790815893560648, 0.010999944992363453, 0.0005644331104122102, 0.006562809459865093, 0.0006681961822323501, 0.0006213540327735245, 0.031151309609413147, 0.00454462505877018, 0.02280685491859913, 0.005590330809354782, 0.9345082640647888, 0.0008949468610808253, 0.0006280841771513224, 0.0010670226765796542, 0.0008094600634649396, 0.000905383552890271, 0.02367965318262577, 0.0009909142972901464, 0.0006533440318889916, 0.0005994152743369341 ]
0.07827
24
[ "NAIA Women’s Soccer Players of the Week - No. ", "4\n\nConrad and Langille earn national weekly honors\n\nSeptember 25, 2012\n\nBy -, -\n\nBy Alan Grosbach, Manager of Communications and Sports Information\n\nKANSAS CITY, Mo. - Mallory Conrad of Bethel (Ind.) has been named the NAIA National Women's Soccer Defensive Player of the Week and Kelsey Langille of Cumberland (Tenn.) has been tabbed National Women's Soccer Offensive Player of the Week, the national office announced Tuesday. ", "Conrad and Langille were selected based on their performances from Sept. 17 - 23 and were chosen out of a pool of conference/independent/unaffiliated groupings. ", "The honor is the second of the season for Langille.", "\n\nConrad, a freshman goalkeeper from Osceola, Ind., posted a 1-0 shutout in her first collegiate start on Sept. 19 against then-No. ", "25 Siena Heights (Mich.). ", "Additionally, it marks the first time this season the Saints have been held scoreless. ", "Conrad, who had seen action as a reserve in two previous games, tallied eight saves, including five in the second half. ", "She currently owns a 1.140 goals against average and .867 save percentage.", "\n\nLangille, a freshman forward from Ardrossan, Alberta, totaled seven goals, including both game-winners, to lead Cumberland to victories against Mid-South Conference rivals Campbellsville (Ky.) and Cumberlands (Ky.) last week. ", "Against Campbellsville on Sept. 19, Langille netted the eventual game-winner in the 32nd minute and connected on another just three minutes later to propel the Bulldogs to a 2-0 victory. ", "Her scoring streak continued with a career-high five-goal effort, including a hat trick in the first half, to lead Cumberland to a 7-0 victory against Cumberlands on Sept. 22. ", "The victory extended the Bulldogs current win streak to four games.", "\n\nLangille, who has only been held scoreless in one game this season, leads the NAIA in goals per game (2.5), while ranking second in goals (20), points (42), points per game (5.25), shots per game (8.25) and shots on goal per game (4.75).", "\n\nFor a complete listing of all the national statistical leaders, click here." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0009499974548816681, 0.0006471953238360584, 0.0005654729320667684, 0.0007447997340932488, 0.0032517772633582354, 0.000645783671643585, 0.000803485803771764, 0.0007704803720116615, 0.001772782183252275, 0.0007445860537700355, 0.0008348658448085189, 0.0010763792088255286, 0.0008312552818097174, 0.000837567844428122, 0.0005536231328733265 ]
0.001002
15
[ "<!", "DOCTYPE html>\n<html lang=\"en\">\n<head>\n <title>Schedule Typescript Component</title>\n <meta charset=\"utf-8\" />\n <meta name=\"viewport\" content=\"width=device-width, initial-scale=1.0, user-scalable=no\" />\n <meta name=\"description\" content=\"Typescript UI Controls\" />\n <meta name=\"author\" content=\"Syncfusion\" />\n <link rel=\"stylesheet\" href=\"https://maxcdn.bootstrapcdn.com/bootstrap/3.3.7/css/bootstrap.min.css\" />\n <link rel=\"stylesheet\" href=\"../../css/highcontrast.css\" />\n <script data-main=\"schedule.js\" src=\"../../../node_modules/requirejs/require.js\"></script>\n <script src=\"../require.config.js\"></script>\n</head>\n<body>\n <div class=\"container-fluid\" style=\"margin-top:15px;\">\n <div class=\"row\">\n <div class=\"col-md-12\">\n <div id=\"schedule\">\n </div>\n </div>\n </div>\n </div>\n</body>\n</html>" ]
{ "pile_set_name": "Github" }
[ 0.006595529615879059, 0.0008274429710581899 ]
0.003711
2
[ "STOP THE KEYSTONE XL PIPELINE FROM COMMITTING ENVIRONMENTAL ABUSE\n\nI am worried about how this pipeline will impact our environment in the near future. ", "The money made from the Keystone pipeline is not worth the vast amount of carbon emissions that will be put into the atmosphere and the extensive damage to animal’s habitats. ", "The pipeline could also ruin the surrounding land that it is built on. ", "The Keystone XL pipeline will also impact the people living near the pipelines route. ", "This includes many farmers whose land and water supply could be contaminated by the heavy crude bitumen carried in the pipes, as well as damaging the First Nations people’s sacred land. ", "This issue is important to me because I feel strongly that we need to try our best to preserve our environment for future generations. ", "My viewpoint on this issue is this pipeline has already done and will continue to do great damage to our environment.", "\n\nI researched this issue and found out burning one barrel of Canadian tar sands crude emits one hundred and seventy pounds of greenhouse gases into our already deteriorating atmosphere. ", "We do not need to burn more barrels of oil than we already are. ", "Right now climate change is a huge issue and we need to try our best to slow it down, not speed it up. ", "This pipeline will also affect the beautiful land it is being built on. ", "This pipeline will destroy an almost 2000 kilometer stretch of land. ", "Building it means destruction of land, deforestation, destroying many animals’ habitats and possibly making certain species endangered. ", "I foresee that this pipeline will cause great damage to the environment. ", "Oil spills are another issue that comes with building this pipeline. ", "This is already an issue as the existing Keystone pipeline had 14 oil spills last year including most recently in South Dakota where 210 000 gallons of diluted bitumen was spilled. ", "Building the Keystone XL will guarantee more oil spills which inevitably cause even more pollution in the long run. ", "We need to stop this pipeline from being built and instead invest money into clean energy that will improve our environment instead of destroying it." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0007309946231544018, 0.0012343862326815724, 0.001958790933713317, 0.0005775352474302053, 0.0008306708768941462, 0.0005317496252246201, 0.003648237558081746, 0.0007132901228033006, 0.02755381539463997, 0.0008966236491687596, 0.0006569895776920021, 0.025884680449962616, 0.0014987135073170066, 0.00810160394757986, 0.0012648248812183738, 0.0008032967452891171, 0.001044979551807046, 0.0008014276972971857 ]
0.004374
18
[ "INTRODUCTION {#S0001}\n============\n\nRunning is of high popularity and can be performed over different distances ^\\[[@CIT0001],\\ [@CIT0002]\\]^ such as 100 m ^\\[[@CIT0003]\\]^, 200 m ^\\[[@CIT0004]\\]^, 400 m ^\\[[@CIT0005]\\]^, 5,000 m ^\\[[@CIT0006]\\]^, the half-marathon distance ^\\[[@CIT0007],\\ [@CIT0008]\\]^, the marathon distance ^\\[[@CIT0009],\\ [@CIT0010]\\]^ and different ultra-marathon distances ^\\[[@CIT0011]\\]^. Different characteristics in physiology, training and anthropometry seem to influence running performances ^\\[[@CIT0012]--[@CIT0015]\\]^.\n\nRegarding training, in one study, both volume and intensity appeared to influence running performance ^\\[[@CIT0016]\\]^. In another study, Bale et al. ", "investigated 60 athletes of three different levels in training for a national 10,000 m road race championship ^\\[[@CIT0017]\\]^. The top-class athletes performed faster over the 10,000 m distance ^\\[[@CIT0017]\\]^ after higher training frequency, higher volume of weekly training and more running experience than athletes of lower level. ", "Billat et al. ", "^\\[[@CIT0018]\\]^ also reported that elite marathoners trained for more weekly kilometers and at a higher velocity than non-elite marathoners. ", "And in another study, the peak of running velocity during training was highly associated with 5,000 m running times regardless of gender ^\\[[@CIT0019]\\]^.\n\nAnthropometry also seems to play an important role in running times. ", "Several studies, for example, have shown positive associations between anthropometric characteristics including body mass ^\\[[@CIT0020]--[@CIT0022]\\]^, body mass index ^\\[[@CIT0021],\\ [@CIT0023],\\ [@CIT0024]\\]^, body fat percentage ^\\[[@CIT0021],\\ [@CIT0024],\\ [@CIT0025]\\]^, skin-fold thickness of the lower body ^\\[[@CIT0026],\\ [@CIT0027]\\]^, the circumference of upper arm ^\\[[@CIT0021],\\ [@CIT0022],\\ [@CIT0028]\\]^ and the circumference of calf ^\\[[@CIT0029]\\]^ and running times. ", "On the other hand, no significant correlations have also been reported between anthropometric characteristics including body mass index, skeletal muscle mass, leg length, skinfold thicknesses or limb circumferences; and race time in multi-sports athletes competing in a Deca Iron ultra-triathlon ^\\[[@CIT0030]\\]^.\n\nMoreover, the association of running performance with both single skin-fold thicknesses and the sum of skin-folds has been intensively investigated ^\\[[@CIT0026],\\ [@CIT0027],\\ [@CIT0031],\\ [@CIT0032]\\]^. One study found significant negative correlations between the sum of seven skin-fold thicknesses and marathon race times ^\\[[@CIT0031]\\]^. However, significant positive correlations have also been reported between running times and the thickness of selected skin-folds, in elite runners of 100 m to 10,000 m and marathon distances ^\\[[@CIT0026],\\ [@CIT0032]\\]^. The anterior thigh and the medial calf skin-fold were positively correlated with both 1,500 m and 10,000 m race times in male runners ^\\[[@CIT0026]\\]^. Another study also found a significant association of the calf skin-fold with total race distance over 350 km with 11,000 m of altitude in a 7-day mountain ultra-marathon ^\\[[@CIT0027]\\]^.\n\nIn the running disciplines, the half-marathon distance has been the fastest growing road race distance in the United States of America since 2003 ^\\[[@CIT0033]\\]^. For seven consecutive years between 2006 and 2012, the number of half-marathon finishers has increased by at least 10% each year. ", "Since 2000, the number of half-marathon finishers in the United States of America has nearly quadrupled from 482,000 to 1,850,000 with an impressive increase of 284%. ", "For the first time in history, 60% of these half-marathon finishers were women.", "\n\nWhile there is abundant literature on the association between both anthropometric and training characteristics and race times from 100 m to the marathon distance ^\\[[@CIT0009],\\ [@CIT0017],\\ [@CIT0020],\\ [@CIT0023],\\ [@CIT0025],\\ [@CIT0026]\\]^, the amount of data available from female and male half-marathoners remains limited^\\[[@CIT0007],\\ [@CIT0008],\\ [@CIT0034]\\]^. The differences in anthropometry between male and female half-marathoners have been described previously ^\\[[@CIT0034]\\]^ and the anthropometric characteristics showed differential sex correlations with running times ^\\[[@CIT0007],\\ [@CIT0008],\\ [@CIT0034]\\]^. Rüst et al ^\\[[@CIT0008]\\]^ analyzed recreational male runners and found a positive correlation between body mass index and race time but running speed during training correlated negatively with running times in recreational male half-marathoners. ", "Knechtle et al. ", "^\\[[@CIT0007]\\]^ also found a positive relationship between mid-axilla skin-fold thickness and running times in recreational female half-marathoners. ", "In both men and women, running speed during training sessions correlated significantly and negatively to half-marathon race time. ", "In another study ^\\[[@CIT0034]\\]^, anthropometric variables were positively correlated to half-marathon performance times in both men and women. ", "Compared to men, the anthropometric variables in women (sum of 8 skin-folds: women *β*=0.28, men *β*=0.06; body mass index: women *β*=0.97, men *β*=2.25; mean speed of the training session: women *β*=-3.98, men *β*=66.97, respectively) were significantly associated to half-marathon race times.", "\n\nHowever, the findings in these two studies might have been influenced by the rather small sample size. ", "Knechtle et al. ", "^\\[[@CIT0007]\\]^ investigated 84 male half-marathoners while Rüst et al. ", "^\\[[@CIT0008]\\]^ described only 42 female half-marathoners. ", "The aim of the present study was to compare anthropometry and training between recreational men and women in a larger sample of half-marathoners. ", "First, we hypothesized that female and male half-marathoners would differ in both anthropometric and training characteristics. ", "Secondly, we hypothesized that half-marathon race times would differ with anthropometric characteristics according to gender.", "\n\nMETHODS AND SUBJECTS {#S0002}\n====================\n\nSubjects and races {#S20003}\n------------------\n\nThe 'Basel Marathon' held in Basel, Switzerland was the setting of choice to carry out this study. ", "In this marathon, athletes normally run either a half-marathon or a marathon. ", "The half-marathon, target of this study, involves running one lap of 21.0975 km on asphalt with a total altitude of 200 m. All female and male half-marathoners participating in the 2010 and 2011edition of this half-marathon were informed via electronic newsletters sent by the organizer three months before the race. ", "Information about the planned investigation was also provided on the race website. ", "Participating athletes were included only once and recruited continuously during two consecutive years from 2010 to 2011, in order to increase the sample size. ", "Course and nutrition for athletes and general weather conditions were nearly identical in both years. ", "The study was approved by the Institutional Review Board for use of Human Subjects of the Canton of St. Gallen, Switzerland. ", "All athletes participating in the study were informed of the experimental procedures and gave informed written consent.", "\n\nMeasurements and Calculations {#S20004}\n-----------------------------\n\nThe participants were asked to record the amount and units of their training for a period of three months, commencing upon study registration until the race date. ", "The investigator provided an electronic file where the subjects could insert each training unit with distance in kilometers (km), duration in minutes (min) and speed in kilometers per hour (km/h). ", "The investigator calculated the mean weekly training hours, the mean weekly training kilometers achieved and the mean running speed during training in the pre-race preparation. ", "The participants were also asked to report the number of completed half-marathons and their personal best time in half-marathon. ", "The personal best time in half-marathon was defined as the fastest time ever achieved during life in half-marathon running.", "\n\nOn the afternoon of the day before the races, the following anthropometric characteristics were measured: body mass, body height, the circumferences of the limbs, the length of the leg and the thicknesses of skin-folds at pectoral, mid-axilla, triceps, subscapular, abdominal, suprailiacal, front thigh and medial calf site. ", "The circumferences of the limbs and skin-fold thicknesses were measured on the right side of the body. ", "The body mass index was calculated using these anthropometric data. ", "Both the percentage of body fat and the skeletal muscle mass were estimated using anthropometric methods.", "\n\nBody mass was measured using a commercial scale (Beurer BF 15, Beurer, Ulm, Germany) to the nearest 0.1 kg. ", "Body height was determined using a stadiometer (Tanita HR 001 Portable Height Measure, Tanita Europe, Amsterdam, Netherlands) to the nearest 1.0 cm. ", "The length of the leg and the circumferences of the limbs were measured using a non-elastic measuring (cm) tape (KaWe CE, Kirchner und Welhelm, Germany) to the nearest 0.1 cm. ", "The circumference of the upper arm was measured at mid-arm, the circumference of the thigh was taken at mid-thigh and the circumference of the calf was measured at mid-calf. ", "All skin-fold data were obtained using a skin-fold calliper (GPM-Hautfaltenmessgerät, Siber & Hegner, Zurich, Switzerland) and recorded to the nearest 0.2 mm. ", "The skin-fold caliper measures with a pressure of 0.1 MegaPascal (Mpa) ± 5% over the whole measuring range. ", "The skin-fold measurements were taken once for all eight skin-fold sites, and then the procedures were repeated twice more by the same investigator. ", "The mean of the three measurements was used for calculation. ", "The timing of the skin-fold measurements was standardized to ensure reliability. ", "It has been suggested that the best readings are those performed 4 sec after applying the caliper ^\\[[@CIT0035]\\]^. One trained investigator took all skin-fold measurements as inter-tester variability is a major source of error in skin-fold measurements. ", "Intra- and inter-rater agreement was assessed from 27 male runners prior to an ultra-marathon, based on measurements taken by two experienced primary care physicians ^\\[[@CIT0036]\\]^. Intra-class correlation (ICC) within the two raters was excellent for all anatomical measurement sites and for various summary measurements of skin-fold thicknesses (ICC\\>0.9). ", "Agreement tended to be higher within than between raters, but still reached excellent reliability. ", "That is, ICC=0.99 (0.99-1.00 95% confidence interval) for the summary measurements of skin-fold thicknesses between raters. ", "ICC for investigator 1 versus investigator 1 and for investigator 2 versus investigator 2 for the single skin-fold thicknesses were between 0.98 and 0.99 respectively. ", "For the sum of seven and eight skin-folds ICC was 0.99-1.00. ", "For the sum of eight skin-folds for investigator 1, bias (*i.e*. ", "average difference between investigator 1 and investigator 2) was -- 0.515 mm, standard deviation of the average difference was 1.492 mm; and 95% limits of agreement were between -3.439 mm and 2.409 mm.", "\n\nFor women, percentage of body fat was estimated using the formula percentage of body fat = --6.407 + 0.419 (Σ3SF) -- 0.001 (Σ3SF) ^2^ + 0.125 (hip) + 0.065 (age) following Ball et al ^\\[[@CIT0037]\\]^. Σ3SF was taken as the sum of the three skin-fold thickness of the triceps, suprailiac and front thigh skin-fold. ", "Hip was the circumference of the hip. ", "For men, percentage of body fat was estimated using the anthropometric formula according to Ball et al ^\\[[@CIT0038]\\]^ with percent body fat = 0.465 + 0.180 × (S7SF) -- 0.0002 × (S7SF)^2^ + 0.066 × (age), where S7SF is the sum of skin-fold thickness of pectoralis, axillar, triceps, subscapular, abdomen, suprailiacal and thigh mean in mm and age is in years. ", "Skeletal muscle mass (SMM) was estimated for both sexes using the formula of Lee et al ^\\[[@CIT0039]\\]^ with SMM = Ht × (0.007 × CAG^2^ + 0.001 × CTG^2^ + 0.004 × CCG^2^) + 2.4 × sex -- 0.048 × age + race + 7.8 where Ht = height, CAG = skin-fold-corrected upper arm girth, CTG = skin-fold-corrected thigh girth, CCG = skin-fold-corrected calf girth, sex = 1 for men; age is in years; race = 0 for white men and 1 for black men. ", "This equation was validated using magnetic resonance imagining (MRI) to determine skeletal muscle mass. ", "There was a high correlation between the predicted skeletal muscle mass and the MRI-measured skeletal muscle mass (*r*^*2*^=0.83, *P*\\<0.0001, SEE=2.9kg). ", "The correlation between the measured and the predicted skeletal muscle mass difference and the measured skeletal muscle mass was significant (*r*^*2*^=0.90, *P*=0.009).", "\n\nStatistical Analysis {#S20005}\n--------------------\n\nData were analysed using SPSS software version 15 (SPSS Inc., Chicago, USA). ", "Prior to analysis, data were checked for distribution of normality and are presented as mean ± standard deviation (SD). ", "The coefficient of variation (CV) of performance (CV% = 100 × SD/mean) was calculated. ", "The coefficient of variation describes the magnitude sample values and the variation within them. ", "Data for the female and male half-marathoners were compared using the Mann-Whitney U-test. ", "To investigate a potential association between anthropometric and training characteristics with race time, in a first step, the relationship between race time as the dependent variable and the variables of age, anthropometry, training and previous experience was investigated using bivariate Pearson correlation analysis. ", "In order to reduce the variables for the multi-variate analysis, Bonferroni correction was applied (*P*\\<0.0017 for 29 variables). ", "In a second step, all significant variables after bi-variate analysis entered the multiple linear regression analysis (stepwise, forward selection, *p* of F for inclusion \\< 0.05, *p* of F for exclusion\\> 0.1). ", "Multi-collinearity between the predictor variables was excluded with *r*\\>0.9. ", "For the strength of a correlation, *r*\\>0.70 indicated a very strong, *r* =0.40-0.69 a strong, *r* =0.30-0.39 a moderate, *r* =0.20-0.29 a weak and *r* =0.01-0.19 a negligible relationship, respectively. ", "A power calculation was performed according to Gatsonis and Sampson ^\\[[@CIT0040]\\]^. To achieve a power of 80% (two-sided Type I error of 5%) to detect a minimal association between race time and anthropometric characteristics of 20% (*i.e*. ", "coefficient of determination *r*^*2*^ =0.2) a sample of 40 participants was required. ", "An alpha level of 0.05 was used to indicate significance for all statistical tests.", "\n\nRESULTS {#S0006}\n=======\n\nA total of 83 female and 147 male half-marathon runners were investigated. ", "Women completed the half-marathon within 125.7±16.7min (CV 13.8%), running at a mean speed of 10.2±1.3 km/h. Expressed in percent of the course record (1 h 31 min of Jennifer Eyermann in 2010), women finished within 138 ±18%. ", "Men finished within 106.8±17.3 min (CV 16.2%), while running at a mean speed of 12.2±1.9 km/h. They finished within 157±21% of the course record of 1 h 8 min set by Berhane Ogubit in 2011. ", "Men ran significantly faster compared to women (*P*\\<0.0001). ", "When the performance expressed in percent of the course record was compared between the sexes, women were significantly faster than men (*P*\\<0.001).", "\n\nRegarding anthropometry, women had a lower body mass, a shorter body height, and a lower body mass index ([Table 1](#T0001){ref-type=\"table\"}). ", "The circumferences of upper arm and calf were smaller in women; the thigh circumference showed no statistically significant gender difference. ", "Women had a thicker skin-fold at triceps, thigh and calf site compared to men. ", "At subscapular site, women possessed a thinner skin-fold than men. ", "Women had a higher sum of total skin-fold thicknesses, a higher percent of body fat and a lower skeletal muscle mass compared to men. ", "For the training characteristics, no gender differences were found in the volume of training. ", "Women were running slower during training, had completed fewer previous half-marathons and had a slower personal best half-marathon race time compared to men.", "\n\n###### \n\nComparison of anthropometric and training characteristics between female and male half-marathoners\n\n Variable Women (*n*=83) Mean (SD) Men (*n*=147) Mean (SD) *P*. ", "value\n --------------------------------------- -------------------------- ------------------------- ------------\n **Age (years)** 38.3 (9.2) 40.2 (10.1) NS\n **Body mass (kg)** 60.1 (7.8) 75.8 (8.6) \\<0.001\n **Body height (m)** 1.66 (0.06) 1.79 (0.06) \\<0.001\n **Body mass index (kg/m**^**2**^**)** 21.7 (2.3) 23.3 (2.2) \\<0.001\n **Length of leg (cm)** 82.9 (3.6) 87.7 (4.8) \\<0.001\n **Circumference of upper arm (cm)** 26.6 (1.8) 29.7 (2.0) \\<0.001\n **Circumference of thigh (cm)** 55.4 (3.8) 55.9 (3.2) NS\n **Circumference of calf (cm)** 36.5 (2.5) 38.2 (2.5) \\<0.001\n **Skin-fold pectoral (mm)** 8.5 (4.5) 9.4 (4.2) NS\n **Skin-fold axilla (mm)** 10.4 (4.5) 10.6 (4.3) NS\n **Skin-fold triceps (mm)** 13.5 (4.3) 8.6 (2.8) \\<0.001\n **Skin-fold subscapular (mm)** 10.5 (4.5) 11.3 (4.3) \\<0.05\n **Skin-fold abdominal (mm)** 16.9 (6.5) 18.8 (9.1) NS\n **Skin-fold iliacal (mm)** 20.7 (8.3) 20.8 (9.4) NS\n **Skin-fold thigh (mm)** 26.4 (9.4) 13.7 (6.1) \\<0.001\n **Skin-fold calf (mm)** 10.3 (4.8) 6.7 (2.7) \\<0.001\n **Sum of skin-folds (mm)** 117.3 (38.3) 99.9 (35.6) \\<0.001\n **Percent body fat (%)** 28.4 (5.3) 17.5 (4.6) \\<0.001\n **Skeletal muscle mass (kg)** 27.6 (2.7) 39.1 (3.1) \\<0.001\n **Years as active runner (y)** 6.1 (5.0) 7.9 (8.0) NS\n **Weekly running kilometers (km)** 33.5 (17.0) 33.7 (20.5) NS\n **Minimal weekly distance (km)** 15.5 (10.1) 16.2 (13.5) NS\n **Maximal weekly distance (km)** 41.6 (18.5) 45.2 (29.1) NS\n **Weekly running hours (h)** 3.6 (1.8) 3.9 (2.0) NS\n **Number of training units (n)** 3.0 (1.0) 3.1 (1.3) NS\n **Distance per training unit (km)** 10.4 (2.9) 11.3 (3.2) NS\n **Duration per training unit (min)** 63.5 (16.0) 63.0 (16.5) NS\n **Speed in running training (km/h)** 9.8 (1.5) 10.8 (1.5) \\<0.01\n **Number of completed races (n)** 5 (2); *n*=43 6 (7); *n*=108 \\<0.05\n **Personal best time (min)** 115 (21) 102 (17) \\<0.01\n\nSD: Standard Deviation; NS: Non-significant\n\nSignificant variables after bi-variate analysis of both anthropometry and training related to half-marathon race time ([Table 2](#T0002){ref-type=\"table\"}) were multi-variately correlated to half-marathon race times. ", "For women ([Table 3](#T0003){ref-type=\"table\"}), body fat percentage and running speed during training sessions were significantly correlated to half-marathon race times. ", "For men ([Table 4](#T0004){ref-type=\"table\"}), body fat percentage, running speed during trainings session and body mass index were significantly correlated to half-marathon race times.", "\n\n###### \n\nAssociation between anthropometric and training characteristics with race time for female and male half-marathoners\n\n Variable Women (*n*=83) Men (*n*=147) \n -------------------------------- ---------------- --------------- ------- ----------\n **Age** 0.27 0.01 0.27 0.001\n **Body mass** 0.63 \\<0.0001 0.27 0.0009\n **Body height** 0.27 0.01 -0.17 0.04\n **Body mass index** 0.57 \\<0.0001 0.46 \\<0.0001\n **Length of leg** 0.16 0.1 -0.21 0.01\n **Circumference of upper arm** 0.55 \\<0.0001 0.37 \\<0.0001\n **Circumference of thigh** 0.51 \\<0.0001 0.15 0.07\n **Circumference of calf** 0.53 \\<0.0001 0.14 0.08\n **Skin-fold pectoral** 0.48 \\<0.0001 0.43 \\<0.0001\n **Skin-fold axilla** 0.56 \\<0.0001 0.41 \\<0.0001\n **Skin-fold triceps** 0.45 \\<0.0001 0.35 \\<0.0001\n **Skin-fold subscapular** 0.52 \\<0.0001 0.39 \\<0.0001\n **Skin-fold abdominal** 0.54 \\<0.0001 0.44 \\<0.0001\n **Skin-fold iliacal** 0.39 0.0002 0.35 \\<0.0001\n **Skin-fold thigh** 0.49 \\<0.0001 0.29 0.0004\n **Skin-fold calf** 0.59 \\<0.0001 0.48 \\<0.0001\n **Sum of skin-folds** 0.58 \\<0.0001 0.47 \\<0.0001\n **Percent body fat** 0.60 \\<0.0001 0.49 \\<0.0001\n **Skeletal muscle mass** 0.24 0.03 -0.07 0.4\n **Years as active runner** -0.16 0.1 -0.02 0.8\n **Weekly running kilometers** -0.20 0.07 -0.48 \\<0.0001\n **Minimal weekly distance** -0.30 0.006 -0.36 \\<0.0001\n **Maximal weekly distance** -0.18 0.1 -0.46 \\<0.0001\n **Weekly running hours** -0.11 0.3 -0.30 0.0002\n **Number of training units** -0.06 0.6 -0.42 \\<0.0001\n **Distance per training unit** -0.29 0.007 -0.32 \\<0.0001\n **Duration per training unit** -0.03 0.7 -0.2 0.01\n **Speed in running training** -0.77 \\<0.0001 -0.58 \\<0.0001\n **Number of completed races** -0.08 0.6 -0.13 0.1\n **Personal best time** 0.35 0.1 0.85 \\<0.0001\n\nVariables with *P*. ", "values of \\<0.0017 are used for the multi-variate analysis (n=29 variables)\n\n###### \n\nAssociations between significant characteristics after bi-variate analysis and race time for women using multiple linear regression\n\n Women (*n*=83) *β* *SE* *P*\n -------------------------------- ------ ------ ----------\n **Body mass** 0.09 0.3 0.8\n **Body mass index** 0.9 0.9 0.3\n **Circumference of upper arm** 0.3 0.8 0.7\n **Circumference of thigh** -0.1 0.5 0.8\n **Circumference of calf** 0.9 0.7 0.2\n **Percent body fat** 0.75 0.2 0.003\n **Speed in running training** -6.5 0.8 \\<0.0001\n **Body mass** 0.3 0.2 0.3\n **Circumference of upper arm** 0.4 0.8 0.6\n **Circumference of thigh** 0.04 0.4 0.9\n **Circumference of calf** 0.8 0.7 0.3\n **Percent body fat** 0.7 0.2 0.003\n **Speed in running training** -6.5 0.8 \\<0.0001\n\nß= regression coefficient; SE= standard error of the regression coefficient; the coefficient of determination (*r*^*2*^) of the model was 0.73.", "\n\nPercentage of body fat and running speed during training were associated with half-marathon race time. ", "When body mass index was excluded, *r*^*2*^ remained unchanged at 0.73, and both percentage of body fat and running speed during training remained predictive\n\n###### \n\nAssociations between significant characteristics after bi-variate analysis and race time for men using multiple linear regression\n\n Men (*n*=147) *β* *SE* *P*\n ------------------------------------- -------- ------ ----------\n **Body mass** -0.3 0.2 0.1\n **Body mass index** 1.9 0.8 0.01\n **Circumference of upper arm** 0.1 0.6 0.9\n **Percent body fat** 0.6 0.3 0.03\n **Weekly running kilometers** -0.2 0.1 0.1\n **Minimal weekly running distance** -0.1 0.1 0.3\n **Maximal weekly running distance** 0.003 0.06 0.9\n **Weekly running hours** 1.4 0.9 0.1\n **Number of training units** -1.8 1.3 0.1\n **Distance per training unit** -0.3 0.4 0.4\n **Speed in running training** -3.7 0.8 \\<0.0001\n **Body mass** 0.004 0.1 0.9\n **Circumference of upper arm** 0.5 0.6 0.4\n **Percent body fat** 0.8 0.3 0.008\n **Weekly running kilometers** -0.2 0.1 0.1\n **Minimal weekly running distance** -0.1 0.1 0.3\n **Maximal weekly running distance** -0.005 0.07 0.9\n **Weekly running hours** 1.0 0.9 0.2\n **Number of training units** -1.4 1.3 0.3\n **Distance per training unit** -0.3 0.4 0.4\n **Speed in running training** -4.1 0.8 \\<0.0001\n\n*ß*= regression coefficient; SE= standard error of the regression coefficient; the coefficient of determination (*r*^2^) of the model was 0.51. ", "Body mass index, percentage of body fat and running speed during training were related to half-marathon race time. ", "When body mass index was excluded, *r*^2^ remained decreased to 0.49, and both percentage of body fat and running speed during training remained predictive\n\nIn a second model, body mass index was excluded. ", "Multi-variate analysis in women, showed no influence on the predictor variables. ", "In men, however, the coefficient of determination (*r*^*2*^) decreased from 0.51 to 0.49. ", "For both women ([Fig. ", "1](#F0001){ref-type=\"fig\"}) and men ([Fig. ", "2](#F0002){ref-type=\"fig\"}), the running speed during training was significantly and negatively associated with the percentage of body fat, respectively.", "\n\n![", "For women, percentage of body fat was significantly and negatively related to running speed during training (*r*=-0.38, *P*=0.0005).](ASJSM-5-010-g001){#F0001}\n\n![", "For men, percentage of body fat was significantly and negatively associated with running speed during training (*r*=-0.39, *P*\\<0.0001).](ASJSM-5-010-g002){#F0002}\n\nDISCUSSION {#S0007}\n==========\n\nThe aim of the present study was to compare anthropometric and training characteristics between female and male recreational half-marathon runners in a larger sample of runners than in previous studies ^\\[[@CIT0007],\\ [@CIT0008]\\]^. Based on the existing literature, we first hypothesized that female and male half-marathoners would differ in both anthropometric and training characteristics. ", "Secondly, we expected anthropometric characteristics to be differentially associated with half-marathon race times according to gender.", "\n\nComparison of anthropometry and training between women and men {#S20008}\n--------------------------------------------------------------\n\nThe most important finding was that men and women showed the same predictor variables for half-marathon race time in anthropometry and training characteristics including body fat percentage (women: *β*=0.7, men: *β*=0.8,) and running speed during training (women: *β*= -6.5, men: *β*=-4.1,). ", "Also, for recreational marathoners, men showed the same predictor variables for the race time including body fat (*β*=0.504) and running speed during training sessions (*β*=-0.57) ^\\[[@CIT0041]\\]^. For recreational female marathoners, however, the circumference of calf (*r*=-0.41, *P*=0.02) and running speed during training sessions (*r*=-0.60, *P*=0.0005) were positively associated with marathon race times in the multi-variate analysis ^\\[[@CIT0029]\\]^.\n\nAs expected, men and women showed differences in their anthropometric characteristics. ", "The most important differences found were for body mass, body height, body mass index, leg length, circumference of upper arm and calf, body fat percentage, the sum of eight skin-folds (*e.g*. ", "pectoral, axilla, triceps, subscapular, abdominal, iliacal, thigh and calf) and skeletal muscle mass. ", "Knechtle et al ^\\[[@CIT0034]\\]^ investigated anthropometric variables in female and male half-marathon runners. ", "They found significant differences in body mass, body height and body mass index, differences in several skin-fold thicknesses (*i.e*. ", "triceps, front thigh and medial calf) and body fat percentage. ", "In contrast to their findings, the present study included further anthropometric characteristics including leg length, the circumferences of both upper arm and calf and skeletal muscle mass. ", "The inclusion of these variables and the larger sample might explain the difference in findings.", "\n\nAnother important difference is that in the present study, the sum of eight skin-folds showed a significant gender difference. ", "The sum of eight skin-folds was higher for women than for men. ", "However, in keeping with Knechtle et al ^\\[[@CIT0034]\\]^, the sum of skin-folds was not different between men and women. ", "We assume these differences are due to the larger sample of runners. ", "Other more recent studies investigated 42 female half-marathoners ^\\[[@CIT0007]\\]^, and 84 male half-marathoners ^\\[[@CIT0008]\\]^. The present study, however, included two times the subjects with 83 women and 147 men. ", "In the current study and in the study of Knechtle et al ^\\[[@CIT0034]\\]^ investigating 15 women and 52 men, women showed highly significant skin-folds for three variables (*i.e*. ", "triceps, thigh and calf) which also were thicker than those in men. ", "This might be due to the fact that men have lower body fat percentage and higher skeletal muscle mass. ", "All other variables such as age, circumference of thigh, thickness of pectoral, axillar, abdominal and suprailiacal skin-folds showed no significant gender differences.", "\n\nAs far as training characteristics were concerned, men ran faster during training than women, had a faster personal best time and had completed more races than women. ", "Besides, in the study of Knechtle et al. ", "investigating differences in anthropometric and training characteristics in female and male half-marathoners ^\\[[@CIT0034]\\]^, men ran significantly faster during training than women, but there were no significant differences in in the amount of running, and personal best times were not reported.", "\n\nCorrelation of anthropometric and training characteristics with race time {#S20009}\n-------------------------------------------------------------------------\n\nFor both men and women, body fat percentage was positively and the running speed during training sessions was negatively associated with half-marathon race times after correction of co-variables in the multi-variate analysis. ", "In recreational male marathoners, race time correlated to body fat percentage and running speed during training sessions ^\\[[@CIT0041]\\]^. Marathon race time was faster when body fat was lower and running speed during training was higher. ", "In recreational female marathoners, running speed of the training session was related to marathon race time, whereas body fat percentage was not related to performance ^\\[[@CIT0029]\\]^. In contrast, the circumference of calf as an anthropometric variable was related to race time ^\\[[@CIT0029]\\]^. A possible explanation for the gender differences between the studies could be the anthropometry of the runners and the sample sizes.", "\n\nArrese and Ostariz ^\\[[@CIT0026]\\]^ reported that various skin-fold thicknesses showed different associations with the different running distances. ", "Presumably, the explanation for the different findings regarding the present results was that Arrese and Ostariz ^\\[[@CIT0026]\\]^ investigated a smaller sample size of high-level runners and their results were not corrected with co-variates like training. ", "In the present study, body fat percentage and running speed explained 73% of the variance in recreational female runners but only 51% (with body mass index) and 49% (without body mass index) in recreational men runners. ", "In contrast, Knechtle et al ^\\[[@CIT0007]\\]^ reported that mid-axilla skin-fold and mean speed of the training correlated with the race time in recreational female half-marathoners. ", "These different results were probably due to the larger sample size in the present study. ", "In addition, Rüst et al ^\\[[@CIT0008]\\]^ only reported a positive correlation in body mass index with half-marathon race time of male runners and a negative correlation in speed of the training session with race time. ", "In the current study, body fat percentage played an important role for male runners as well (*β*=0.8). ", "The most likely reason for the different findings was again the sample size.", "\n\nWe excluded body mass index in a second multi-variate analysis for men and the coefficient of determination (*r*^*2*^) decreased from 0.51 to 0.49. ", "The difference of 2% seems to show that body mass index has only a minor influence on race time in men. ", "Body fat percentage and speed during training still correlated with race time for men. ", "On the contrary, for women, the exclusion of the body mass index showed no consequences for the predictive values of the race time with no change in *r*^*2*^. For both men and women body fat percentage and the running speed during training were of importance. ", "For men, the coefficient of determination (*r*^*2*^=0.49) was lower when compared to women (*r*^*2*^=0.73). ", "The included variables of anthropometry and training might not fully explain the performance in half-marathoners since aspects of physiology and psychology might also considerably influence running performance.", "\n\nAssociation between anthropometry and training characteristics {#S20010}\n--------------------------------------------------------------\n\nThe predictor variables of body fat percentage and running speed during training were important for half-marathon race times for both men and women. ", "We found a significant and negative correlation between running speed during training and body fat percentage for both women and men. ", "This relationship was moderate for both men (*r*=0.39) and women (*r*=0.38). ", "This association might show that a fast running speed during training leads to a low body fat. ", "However, a correlation does not prove cause and effect. ", "Athletes can reduce their body fat also by diet with restriction of calorie intake.", "\n\nStrength, weakness, limitations and implications for future research {#S20011}\n--------------------------------------------------------------------\n\nThe strength of the present study was the large sample of 83 female and 147 male half-marathoners. ", "A weakness was that the extremity/trunk skin-fold ratio (E/T ratio) ^\\[[@CIT0034]\\]^ was not included as an anthropometric variable. ", "Furthermore, physiological characteristics such as maximum oxygen uptake ^\\[[@CIT0042]\\]^ and lactate threshold ^\\[[@CIT0043]\\]^ which are considered to influence running time were not included. ", "Also, data about nutrition ^\\[[@CIT0044]\\]^ and motivation ^\\[[@CIT0045]\\]^ of the subjects are missing. ", "The results of this study can only be implemented for recreational half-marathoners but not for elite runners since only recreational athletes were included. ", "Future studies need to investigate elite half-marathoners with inclusion of physiological and motivational aspects.", "\n\nCONCLUSION {#S0012}\n==========\n\nDespite the various differences in anthropometry and only one difference in training characteristics (*i.e*. ", "speed during training) for both female and male recreational half-marathon runners, body fat percentage correlated positively and running speed during training correlated negatively with half-marathon race times for both men and women. ", "The influence of body mass index as a predictor variable was lower than presumed. ", "In addition, the sum of the skin-fold thicknesses seemed to be more important than the single folds. ", "For practical applications, body fat percentage and running speed during training sessions were the best predictors for half-marathon race time in both female and male recreational runners.", "\n\nThe authors would like to thank the race director for the opportunity to perform this study. ", "A special thanks goes to all our subjects helping us to record all these data. ", "We also thank Martinez Gonzalez Nahara Anani for her help in English translation.", "\n\n {#S0013}\n\n**Conflict of interests:** None\n\n[^1]: Concept / Design\n\n[^2]: Acquisition of Data\n\n[^3]: Data Analysis / Interpretation\n\n[^4]: Manuscript Preparation\n\n[^5]: Critical Revision of the Manuscript\n\n[^6]: Funds Collection\n\n[^7]: Approval of the Article\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0.0008048253366723657, 0.0006481168675236404, 0.0007145984563976526, 0.000712442968506366, 0.0006140425684861839, 0.002108736429363489, 0.0008443144615739584, 0.0006542263436131179, 0.004897835198789835, 0.0012983419001102448, 0.0009008332272060215, 0.0013300152495503426, 0.000607145600952208, 0.0006411630311049521, 0.0010326107731088996, 0.0005446847062557936, 0.0009008332272060215, 0.0019034675788134336, 0.005096833687275648, 0.0007766958442516625, 0.0009106857469305396, 0.0006444170139729977, 0.0006535162101499736, 0.000677306845318526, 0.0007253076764754951, 0.0005416529602371156, 0.0005524755106307566, 0.0005295297014527023, 0.0005351986619643867, 0.0005415584892034531, 0.0005775858880952001, 0.000578718027099967, 0.0005531249335035682, 0.0005909314495511353, 0.0007174206548370421, 0.0006988991517573595, 0.000646322441753, 0.0006358411628752947, 0.0012984841596335173, 0.0005923807621002197, 0.0005666909273713827, 0.000656185788102448, 0.00212490139529109, 0.0005929681938141584, 0.0006484640762209892, 0.0005423007532954216, 0.0005504240398295224, 0.0005391866434365511, 0.0006160352495498955, 0.0005840949015691876, 0.0005406043492257595, 0.0006108373636379838, 0.0006135592702776194, 0.0007102756062522531, 0.0007140633533708751, 0.000624218606390059, 0.01490260474383831, 0.05195096507668495, 0.007701875641942024, 0.01316931564360857, 0.0005901049007661641, 0.0007691954378969967, 0.0006913985125720501, 0.0006011700606904924, 0.0005572139634750783, 0.0005878076190128922, 0.0005565963219851255, 0.000875093275681138, 0.0005547402543015778, 0.0006517314468510449, 0.000774785818066448, 0.0007570310262963176, 0.002412221161648631, 0.000661524070892483, 0.0005810481961816549, 0.0005786429974250495, 0.0008017569198273122, 0.0007986584096215665, 0.0009140347829088569, 0.005738160572946072, 0.0010165238054469228, 0.014441987499594688, 0.0036392516922205687, 0.01599525660276413, 0.00688895583152771, 0.04021478071808815, 0.000576326041482389, 0.0015464040916413069, 0.0012421061983332038, 0.01013386994600296, 0.0018990329699590802, 0.0008617292041890323, 0.05447682738304138, 0.015947308391332626, 0.018570270389318466, 0.027467431500554085, 0.0016585647827014327, 0.0011880797101184726, 0.00102526368573308, 0.0007822835468687117, 0.0010702958097681403, 0.000664031074848026, 0.000995983136817813, 0.0019055787706747651, 0.06839638948440552, 0.0028051133267581463, 0.0006327267037704587, 0.0007713942904956639, 0.0009010641952045262, 0.0015137864975258708, 0.004425212740898132, 0.0009945991914719343, 0.0007465648232027888, 0.06677648425102234, 0.0007477268227376044, 0.000530783727299422, 0.0006082408362999558, 0.018865423277020454, 0.0010673775104805827, 0.0005794556927867234, 0.001451605698093772, 0.0009675577748566866, 0.011027904227375984, 0.08225490897893906, 0.0014092461206018925, 0.0011014521587640047, 0.0006712688482366502, 0.0007093559834174812, 0.0008022686233744025, 0.0028537483885884285, 0.0008286833763122559, 0.0006082895561121404, 0.0006279569352045655, 0.0011021418031305075, 0.000949653098359704, 0.0005713350255973637, 0.0007419685134664178, 0.007015272043645382, 0.0005893615307286382, 0.0006716329953633249, 0.0009086451027542353, 0.006839802023023367, 0.003092332510277629, 0.0010098239872604609, 0.000617677578702569, 0.0009653985034674406, 0.007013007532805204, 0.0007804976194165647, 0.020063944160938263, 0.0006208316772244871, 0.05068596452474594, 0.0010785922640934587, 0.0009763695416040719, 0.0005994295934215188, 0.0007347692735493183, 0.0006164367077872157, 0.0006119334721006453, 0.0008286702795885503, 0.0010961978696286678, 0.0006502690957859159, 0.0005886558792553842, 0.0008336567552760243, 0.0005062000709585845, 0.0005108606419526041, 0.0005249662790447474, 0.0006240172660909593 ]
0.004666
166
[ "Lumbala Airport\n\nLumbala Airport is an airport serving the town of Lumbala N'guimbo in the Moxico Province of Angola.", "\n\nSee also\n\n List of airports in Angola\n Transport in Angola\n\nReferences\n\nExternal links \nOpenStreetMap - Lumbala\nOurAirports - Lumbala\n\nCategory:Airports in Angola" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0008436891948804259, 0.0005743631045334041 ]
0.000709
2
[ "hen 61 is divided by d.\n19\nSuppose 0 = -5*o - y + 41 - 12, 22 = 4*o + 2*y. ", "Suppose -10*c + 6*c = -12. ", "What is the remainder when o is divided by c?", "\n0\nCalculate the remainder when (-1)/1 - -10 - 2 is divided by 3.", "\n1\nLet m = 8 - 4. ", "Suppose 4*z = m*p - 72, 2*p + 0*z - 40 = 3*z. ", "Let w(x) = x**2 + 5*x - 9. ", "Calculate the remainder when w(-9) is divided by p.\n13\nLet p(d) = 2*d**3 - d**2 + 3*d - 2. ", "Suppose y = -0 + 9. ", "What is the remainder when p(2) is divided by y?", "\n7\nLet r(i) = i**2 + 8*i + 3. ", "What is the remainder when 35/2*(17 - 15) is divided by r(-9)?", "\n11\nLet o(n) = -n + 4. ", "Suppose 6*d - d = g - 57, -183 = -4*g + 5*d. ", "Calculate the remainder when g is divided by o(-7).", "\n9\nLet m(v) = 3*v**3 - 3*v**2 - 10*v + 3. ", "Let w(g) = g**3 + g**2 - g. Let f(t) = m(t) - 4*w(t). ", "What is the remainder when 10 is divided by f(-6)?", "\n1\nLet k(h) = h + 8. ", "Let p be (2 + -3)/((-1)/3). ", "Suppose -m - m = 5*u - 1, 3*u + p = 0. ", "What is the remainder when k(-3) is divided by m?", "\n2\nSuppose 4*b = 4, -3*i - 1 = -4*i + b. Suppose i*g + 3*u = 5*u + 48, 4*u - 58 = -3*g. ", "Calculate the remainder when 42 is divided by g.\n20\nLet j(q) = 28*q**3. ", "Let x(v) = -v**2 + 7*v + 10. ", "Suppose 1 = -3*u + 22. ", "What is the remainder when j(1) is divided by x(u)?", "\n8\nLet a = -42 - -54. ", "Calculate the remainder when 46 is divided by a.\n10\nLet g = 161 - 104. ", "Let j be (0 - -2) + 0/2. ", "Calculate the remainder when g is divided by ((-3)/2)/(j/(-20)).", "\n12\nLet d(y) = y**3 + 7*y**2 - y + 5. ", "Let r be d(-7). ", "Let z(c) = -c**3 - 18*c**2 - 3*c + 7. ", "What is the remainder when z(-18) is divided by ((-6)/(-8) + 1)*r?", "\n19\nSuppose -z + 4 = z. Suppose 4*r - 32 = z*r. ", "Calculate the remainder when r is divided by 9.", "\n7\nSuppose -4*c - 189 = 91. ", "Let a = -105 + 64. ", "Let r = a - c. Calculate the remainder when r is divided by 16.", "\n13\nCalculate the remainder when -2 + -17*(-4)/4 is divided by 6.", "\n3\nLet o(s) = 5*s + 7. ", "Let u(b) = b**3 - 11*b**2 - b + 6. ", "Let z be u(11). ", "Calculate the remainder when o(6) is divided by ((-5)/z)/((-1)/(-13)).", "\n11\nSuppose -2*y - y + 45 = 0. ", "Suppose 4*a - 49 = y. Suppose -2*h + 5*q + a = 0, h - 2*h - 5*q = 7. ", "What is the remainder when 8 is divided by h?", "\n2\nLet h be 5/2 + 1/2. ", "Suppose -100 = -4*s - 5*y, -2*y - 86 = -h*s - 3*y. ", "Calculate the remainder when s is divided by 16.", "\n14\nLet w be (-3)/9*1*-12. ", "Suppose v = -4*y + 4, -w*v + 14 = -5*v + 5*y. ", "What is the remainder when (20/(-6))/(v/12) is divided by 6?", "\n4\nSuppose 5*m + 8 = 7*m. ", "Suppose 3*u - 12 = -3. ", "What is the remainder when m is divided by u?", "\n1\nLet u = -30 + 49. ", "Calculate the remainder when u is divided by (-150)/(-40)*4/3.", "\n4\nWhat is the remainder when 21 - (2 + -3)*4 is divided by 9?", "\n7\nLet r(a) = -a**3 + 8*a**2 - 3*a - 4. ", "What is the remainder when 93 is divided by r(7)?", "\n21\nLet x = -30 + 109. ", "What is the remainder when x is divided by 27?", "\n25\nSuppose d = 6*d - 20. ", "Let f = d - 1. ", "Let i = 10 - 2. ", "What is the remainder when i is divided by f?", "\n2\nLet i(q) = -q**3 + 10*q**2 - 12*q. ", "Let x be i(8). ", "Let h be (-2)/((-4)/(-5))*-2. ", "Suppose -h*k + k = -x. ", "What is the remainder when k is divided by 5?", "\n3\nLet s = -2 + 2. ", "Let b(g) = -4 + 5 + s - 2*g. ", "What is the remainder when 50 is divided by b(-8)?", "\n16\nLet d(h) = -h**3 + 4*h**2 + 1. ", "Calculate the remainder when 3 is divided by d(4).", "\n0\nLet j be 2/(1*2/(-3)). ", "What is the remainder when 2/j - (-448)/6 is divided by 25?", "\n24\nSuppose -a = 3*a + 40. ", "Let t = a - 1. ", "Let s = -5 - t. What is the remainder when 23 is divided by s?", "\n5\nCalculate the remainder when (-36)/(-21)*231/6 is divided by 17.", "\n15\nSuppose -5*x + 3*x = -2*b - 40, -105 = 5*b - 4*x. ", "Let u = -15 - b. Let d = -14 - -33. ", "Calculate the remainder when d is divided by u.\n9\nLet n = 5 + 35. ", "What is the remainder when n is divided by 11?", "\n7\nLet f be (-9)/6*116/(-6). ", "Let x = f - 3. ", "What is the remainder when 49 is divided by x?", "\n23\nLet g = 7 + -2. ", "Suppose -4*f + 14 = -g*m, -6*f = 5*m - 3*f + 7. ", "What is the remainder when 26 is divided by m*1 - (-13 - 3)?", "\n12\nLet q(r) = r**3 - 2*r**2 + 1. ", "Let l be q(-1). ", "Let b(t) = -3*t - 3. ", "What is the remainder when 8 is divided by b(l)?", "\n2\nSuppose -w = -2*w + 20. ", "What is the remainder when 59 is divided by w?", "\n19\nLet c(j) = j**3 - 2*j - 1. ", "Let h be c(2). ", "Suppose 2*o + 26 = h*o. ", "Suppose -3*g + 5*g - 152 = 0. ", "What is the remainder when g is divided by o?", "\n24\nLet s(n) = -22*n. ", "Let b be s(2). ", "Let o = -16 - b. Let t = o - 16. ", "Calculate the remainder when 34 is divided by t.\n10\nSuppose 3*a - 96 = -2*h, a - 50 = -h - a. What is the remainder when h is divided by 18?", "\n6\nSuppose 0 = 2*k - 10 + 2. ", "Let f(q) = q**2 - 2*q + 3. ", "Let p(o) = o**2 + 7*o - 6. ", "Let h be p(-8). ", "Calculate the remainder when k is divided by f(h).", "\n1\nSuppose -2*v + 304 = 4*z, -v = 5*z - z - 162. ", "Calculate the remainder when v is divided by 48.", "\n46\nLet n = 77 - 49. ", "Let o = -20 + n. Suppose r - o = 1. ", "What is the remainder when 16 is divided by r?", "\n7\nSuppose -u + 4 = i, -7 = -5*u + i + 7. ", "Suppose -5*a + a = -8, -18 = -g - u*a. ", "What is the remainder when 33 is divided by g?", "\n9\nSuppose 4*w - 26 = 10. ", "Suppose -4*a - 16 = -4*s + 4, -a = 5*s - 25. ", "What is the remainder when w is divided by s?", "\n4\nSuppose -5*v - 3*j + 21 = -29, -2*v - 5*j + 1 = 0. ", "What is the remainder when v is divided by 8?", "\n5\nLet x(h) = 27*h - 616. ", "Let t(j) be the third derivative of 3*j**5/20 - j**3/6 - j**2. ", "Calculate the remainder when t(-1) is divided by x(23).", "\n3\nLet r(n) = n**2 + n + 3. ", "Suppose -5*y + 9 = 4*m, 3*m - 3*y = 4 - 31. ", "What is the remainder when (-2)/6*(-1 + -86) is divided by r(m)?", "\n14\nLet u = 33 - 4. ", "Let n = u + -18. ", "Calculate the remainder when 40 is divided by n.\n7\nLet r(z) = -2*z**3 - 3*z**2 - 2. ", "Let u be 2 + (-2 - (-4 - -3)). ", "Suppose l + 0*l = 5*b - u, -2*b = 2*l - 22. ", "Calculate the remainder when r(-3) is divided by l.\n7\nSuppose 2*c - 32 = -2*c. ", "Calculate the remainder when (-97)/(-2) - (-4)/c is divided by 13.", "\n10\nLet p be (-6)/(-4)*(-24)/(-9). ", "Let i(q) = 0*q - q - p + 7. ", "Calculate the remainder when i(-8) is divided by 6.", "\n5\nSuppose 4*z + 168 - 68 = 0. ", "Let s(q) = q**3 + 9*q**2 - 12*q. ", "Let d be s(-9). ", "What is the remainder when 30 is divided by d/10 - 5/z?", "\n8\nLet n = 11 + -8. ", "Suppose q + n*q = 68. ", "Calculate the remainder when 67 is divided by q.\n16\nSuppose -3*k + 4*a + 14 = -0*k, -3*k - 2*a - 16 = 0. ", "Let t = -1 - k. What is the remainder when -2 - -2 - 0 - -2 is divided by t?", "\n0\nSuppose 54 + 10 = 4*q. ", "Calculate the remainder when q is divided by 6.", "\n4\nLet y = 14 + -9. ", "What is the remainder when 9 is divided by y?", "\n4\nSuppose 4*x = 2*x + 2. ", "Let l = x - -4. ", "Suppose l*d + 25 = 0, c - 3*c + 3*d + 29 = 0. ", "What is the remainder when 13 is divided by c?", "\n6\nLet s(o) = -o + 9. ", "Let n be (-2)/(-4) + (-60)/(-8). ", "What is the remainder when 3 is divided by s(n)?", "\n0\nLet o(h) be the first derivative of -7*h**2 + h - 3. ", "What is the remainder when (84/(-15))/((-1)/5) is divided by o(-1)?", "\n13\nLet u = 6 - 6. ", "Suppose -5*v + 4*x = -32, -2*v + 5*v - 5*x - 14 = u. Suppose 3*l - 7*l + 88 = 0. ", "What is the remainder when l is divided by v?", "\n6\nLet x(r) = -2*r + 5. ", "Let j be x(5). ", "Suppose 30 = 5*n - 5. ", "What is the remainder when 1*19*(-5)/j is divided by n?", "\n5\nLet u be (-2)/(-3) + (-24)/9. ", "Suppose -z + 0 + 7 = 0. ", "Let r = u + z. What is the remainder when r is divided by 3?", "\n2\nSuppose 10 = 7*a - 60. ", "Calculate the remainder when 17 is divided by a.\n7\nSuppose -20 = -0*h - 5*h. ", "What is the remainder when 15 is divided by h?", "\n3\nLet u(k) = 16*k - 29. ", "Calculate the remainder when u(9) is divided by 17.", "\n13\nSuppose 21*h = 20*h + 65. ", "Calculate the remainder when h is divided by 17.", "\n14\nLet s = 135 - 114. ", "What is the remainder when s is divided by 8?", "\n5\nSuppose -4*h - 9 = -1. ", "Let m be h/(3/(30/(-4))). ", "Suppose 25 = 5*b - m. Calculate the remainder when b is divided by 3.", "\n0\nSuppose -t = 4*t - 5*y, 0 = -5*t - 4*y - 45. ", "Let i = t + 52. ", "Calculate the remainder when i is divided by 10.", "\n7\nLet l be (-222)/4*4/(-3). ", "Suppose 0 = -2*s - s - 4*p + l, -2*p - 44 = -3*s. ", "What is the remainder when 34 is divided by s?", "\n16\nLet y(u) = 2*u**2 + 37*u + 16. ", "What is the remainder when y(-19) is divided by 6?", "\n5\nSuppose -2*g + 6 + 88 = 0. ", "Let r = 27 - g. Let u = 28 + r. Calculate the remainder when u is divided by 3.", "\n2\nLet k = -17 - -19. ", "Suppose 1 = -f - 3. ", "What is the remainder when f/6 + (-17)/(-3) is divided by k?", "\n1\nLet z(v) = v**2 - 9*v + 4. ", "Let i be z(9). ", "Suppose 2*y = i*y - 22. ", "Calculate t" ]
{ "pile_set_name": "DM Mathematics" }
[ 0.011815703473985195, 0.0014294445281848311, 0.0008547669276595116, 0.0006477327551692724, 0.0013780193403363228, 0.014479996636509895, 0.004399824887514114, 0.00149176933337003, 0.0014872801257297397, 0.0007351397071033716, 0.09018571674823761, 0.0006710775778628886, 0.026228196918964386, 0.004638203419744968, 0.0006938540027476847, 0.05022760108113289, 0.36614927649497986, 0.0007108055287972093, 0.008720900863409042, 0.0017265313072130084, 0.02312895841896534, 0.0007285629981197417, 0.11506123095750809, 0.001232567592523992, 0.007102650590240955, 0.0015957822324708104, 0.001175000797957182, 0.002708049491047859, 0.0007923997472971678, 0.0018133905250579119, 0.000656664080452174, 0.015133492648601532, 0.0012527740327641368, 0.12611420452594757, 0.0009104718919843435, 0.00814004335552454, 0.000734223984181881, 0.0010661482810974121, 0.002010856755077839, 0.0008548626210540533, 0.0006560636102221906, 0.10146894305944443, 0.20166532695293427, 0.0042456150986254215, 0.0006460761651396751, 0.0016184942796826363, 0.008930540643632412, 0.0008730752160772681, 0.00350951193831861, 0.07195202261209488, 0.0006806107703596354, 0.006539531052112579, 0.010705527849495411, 0.0006545206997543573, 0.0052010612562298775, 0.0018201095517724752, 0.0009662506054155529, 0.0030583662446588278, 0.0006725515122525394, 0.0007436436717398465, 0.04659118503332138, 0.0006455224938690662, 0.0012215565657243133, 0.0008077076054178178, 0.0015911676455289125, 0.005150181706994772, 0.0010315621038898826, 0.0013658030657097697, 0.016590595245361328, 0.0016497147735208273, 0.0014080514665693045, 0.48216918110847473, 0.0008351499564014375, 0.0028490694239735603, 0.0991235226392746, 0.0006720011588186026, 0.01494571752846241, 0.0006326754228211939, 0.002724049612879753, 0.0007009562687017024, 0.0009510720265097916, 0.001603380893357098, 0.0011612593661993742, 0.0006303038098849356, 0.003602620679885149, 0.00937459897249937, 0.0010233992943540215, 0.0008546675671823323, 0.03125105798244476, 0.0020856179762631655, 0.0008365130634047091, 0.003420925000682473, 0.11973245441913605, 0.005161547102034092, 0.016031892970204353, 0.000998653587885201, 0.03153963387012482, 0.0007224028813652694, 0.0011783532099798322, 0.0007958008209243417, 0.013181591406464577, 0.001545903505757451, 0.06581238657236099, 0.005291371140629053, 0.0010205794824287295, 0.10422621667385101, 0.0017474140040576458, 0.04193568229675293, 0.0009497073478996754, 0.269148588180542, 0.10407315939664841, 0.19132821261882782, 0.002323293825611472, 0.0013367190258577466, 0.0019847333896905184, 0.0007091264706104994, 0.0010386686772108078, 0.03861808031797409, 0.0008081044070422649, 0.010652365162968636, 0.22878886759281158, 0.0007981923990882933, 0.0014197322307154536, 0.003170932410284877, 0.0010137332137674093, 0.007110149599611759, 0.0008680004393681884, 0.0020197893027216196, 0.005475575570017099, 0.0006332892808131874, 0.07413451373577118, 0.005338076036423445, 0.0007441246416419744, 0.001334701431915164, 0.007190573960542679, 0.0017362507060170174, 0.001964749302715063, 0.03309517726302147, 0.0008888980373740196, 0.0006130820838734508, 0.002303476445376873, 0.005597340874373913, 0.0006082318723201752, 0.0012198671465739608, 0.00870128907263279, 0.0015681044897064567, 0.000828396761789918, 0.006372779607772827, 0.014556297101080418, 0.1610652357339859, 0.0030122974421828985, 0.0021652942523360252, 0.0007085843826644123, 0.0023242158349603415, 0.0008168781641870737, 0.0015113572590053082, 0.001523359096609056, 0.013050754554569721, 0.0007229792536236346, 0.011531616561114788, 0.0028198990039527416, 0.0008365452522411942, 0.005167071707546711, 0.0006648827693425119, 0.0013291382929310203, 0.01317683421075344, 0.0008898904779925942, 0.0030445721931755543, 0.0013834256678819656, 0.006786090321838856, 0.0008393931202590466, 0.01000325195491314, 0.0010701233986765146, 0.0013613655464723706, 0.0012878610286861658, 0.0012217089533805847, 0.0008947924943640828, 0.9533604383468628, 0.0006492865504696965, 0.00200109020806849, 0.000790055317338556, 0.0008562420844100416, 0.0008061608532443643, 0.001684730057604611, 0.0011679010931402445, 0.0009646570542827249, 0.011574170552194118, 0.002018911065533757, 0.0007111517479643226, 0.0019849298987537622, 0.02719820849597454, 0.0008050577016547322, 0.07759974896907806, 0.0006944116321392357, 0.0014017439680173993, 0.0019508501281961799, 0.004758579656481743, 0.001422583358362317, 0.0009098041919060051, 0.01628079079091549, 0.001421906054019928, 0.0027846565935760736, 0.007470158394426107 ]
0.024116
203
[ "Overall\n\nVision Vision\n\nOriginality Originality\n\nTechnique Technique\n\nImpact Impact\n\nAl parecer se trata de una continuación directa de un dibujo anterior en el que hiciste a Sweetie Belle como una androide tra haber perdido la vida. ", "No me tomé la molestia de ver quién la comisionó, así que desconozco si es el mismo cliente, pero no importa realmente del todo. ", "Este dibujo me ha gustado mucho, la idea de un cyborg o androide inmune a balas y explosivos convencionales me recuerda a varias películas excelentes de ciencia ficción; Y el meter algo como eso dentro de un personaje de My Little Pony (Especialmente uno tan dulce e inocente como Sweetie Belle) es algo interesante sin dudas.", "Eres bastante bueno dibujando cyborgs, pues pese a que considero complicado darle detalles mecánicos a un personaje que es humano originalmente, tú eres capaz de llevarlo de una buena manera sin problemas. ", "Se puede ver el metal y los mecanismos necesarios para hacer funcionar las partes en la superficie de su armadura, e igualmente el detalle de los ojos rojos nunca está de más; Si mal no recuerdo, en el dibujo original estos eran verdes, como lo son de la propia Sweetie. ", "También destaco los detalles de su vestido destrozado y con quemaduras a causa de los ataques.", "Por último, ya te he dicho lo bueno que eres dibujando paisajes infernales o con fuego, aquí no es la excepción. ", "Se puede ver en este dibujo un progreso en mi opinión, pues en el fondo no hay una simple gradiente con varios colores anaranjados, sino que se pueden ver detalles de una explosión al fondo, junto con algo de humo que sale de diferentes incendios. ", "Las chispas y áscuas pequeñas volando por todos lados también se ven muy bien, aunque no hay un enorme progreso como con esto anterior. ", "Pienso que es uno de los mejores progresos que has tenido desde la última vez que dibujaste algo así (Que si mal no recuerdo, fue un dibujo con Bowsette) así que te llevas puntos extra por eso, te felicito.", "En conclusión, un buen trabajo pese a ser una comisión, y de los mejores. ", "Creo que este me ha gustado mucho má que el dibujo anterior." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0013431418919935822, 0.03556222468614578, 0.07305067777633667, 0.28023964166641235, 0.05756315216422081, 0.025014057755470276, 0.3678699731826782, 0.06099122390151024, 0.06076452508568764, 0.09918124973773956, 0.010434919036924839, 0.061134785413742065 ]
0.094429
12
[ "Actual Advice Mallard\n\n*posts facebook video of her kid cussing up a storm while everyone laughs*\n\n\"he doesn't have behavioral issues! ", "the teacher shouldn't have become a teacher if she doesn't know how to control kids!\"" ]
{ "pile_set_name": "OpenWebText2" }
[ 0.012575182132422924, 0.03810437023639679 ]
0.02534
2
[ "(CNN) Police in Australia say they've identified an alleged serial killer behind three previously unlinked murders but they can't arrest the suspect due to lack of evidence.", "\n\nSouth Australia police made the extraordinary admission in a public call for help for information that could lead to the arrest of the suspect, a 39-year-old man in Riverland in the neighboring state of Victoria.", "\n\n\"We clearly know where he is. ", "He knows he has been a focus of the investigation for many years, he knows that we're looking at it again now,\" Detective Superintendent Des Bray, the officer in charge of the Major Crime Investigation Branch, told reporters on Tuesday.", "\n\nPolice said new forensic evidence and other information had confirmed previous suspicions that a single suspect was responsible for three murders stretching back 20 years.", "\n\nThe cold cases include the deaths of Adelaide grandmothers Phyllis Harrison in 1998 and Beverley Hanley in 2010, and Stephen Newton, from Mount Gambier, in 2011.", "\n\nPolice revealed a secret task force, including seven detectives, had been reviewing the cases since January.", "\n\nSuspect lived nearby\n\nPolice said the suspect was known to all the victims and at the time of their deaths had lived within about 10 minutes of them.", "\n\nBray said that police can't arrest the suspect because \"[we want to] make sure we gather enough evidence so we can convict in court... to jump in early and arrest him without sufficient evidence and let him get off would simply expose the public to more risk.\"", "\n\nThe detective said that theft was the motive in all three murders.", "\n\n\"This was a cowardly attack on our grandmothers, on an elderly pensioner,\" he added. \"", "Each attack was extremely brutal, and the type of people that commit these offenses are not worthy of people defending them. ", "So I'd encourage anyone with information to think about it, consider their conscience, consider the families of each of the victims, and do the right thing now and come forward.\"", "\n\n\"It's clear that some people have withheld information and some people have told lies, and some of those people may be scared of this offender,\" he added.", "\n\nReward\n\nA reward of $150,000 (A$200,000) is being offered for information that leads to a conviction in the cases of the two grandmothers. ", "A separate reward is being offered in relation to the death of the third victim.", "\n\nHarrison, 71, was found dead in her ransacked home in Elizabeth South, an Adelaide suburb. ", "She had suffered multiple stab wounds, the online police statement said.", "\n\nBray said that she \"was killed most likely because she knew her attacker and to stop her from identifying him.\"", "\n\nThe body of 64-year-old Hanley was found at her home in Elizabeth North, a neighboring suburb. ", "She was doing her laundry when attacked and suffered severe head injuries, her house was ransacked and her handbag stolen.", "\n\n\"Importantly, a witness heard [Hanley]... talking to a male near the back door of the house, who she apparently knew,\" said Bray. \"", "During the course of that conversation, their voices became elevated, and it was clear an argument developed, followed by a scream, some loud thuds, as someone had apparently been struck. ", "Then silence fell.\"", "\n\nThe decomposing body of Newton, 55, was found in his home in Mount Gambier, said the statement. ", "He died as a result of an assault, and his was body was discovered over a month later. ", "A range of items including a TV, DVDs, a computer game console and games were taken.", "\n\n\"In this case it's possible that more than one offender may have been present at the time of his death, and in any event it's likely that more than one offender was involved in disposing the property that was stolen from his house,\" said Bray.", "\n\nIn Newton's case, a man was charged and convicted in relation to property theft and was sentenced to jail in 2012.", "\n\nThe families of the victims have previously released appeals about the cases, an ABC report said, and earlier this year Harrison's daughters spoke publicly about their mother's death.", "\n\n\"My son went in first and then I went in and I noticed that she was laying on the floor and I just freaked out,\" daughter Diane Smoker said, according to the report.", "\n\nThe family has previously indicated it believes Harrison's killer was someone she knew.", "\n\n\"They got into the house with her acknowledgment and that's when they took advantage of her,\" daughter Julie Lane was quoted as saying." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.000625325832515955, 0.0006512076943181455, 0.0007868226966820657, 0.000583256536629051, 0.0007466264069080353, 0.0006352275377139449, 0.0006102199549786747, 0.0007444377988576889, 0.0019859683234244585, 0.001544901286251843, 0.11294444650411606, 0.00239433441311121, 0.0005171544034965336, 0.0015484875766560435, 0.0007034838781692088, 0.0007846285589039326, 0.00196017581038177, 0.008712883107364178, 0.0023313930723816156, 0.0010911255376413465, 0.05112333968281746, 0.0006530605023726821, 0.0009403640287928283, 0.002040453488007188, 0.0008690693066455424, 0.005749611184000969, 0.0006595498998649418, 0.0007766496273688972, 0.000951847992837429, 0.0006676532211713493, 0.001131493248976767, 0.0006543257622979581, 0.000709023792296648 ]
0.006328
33
[ "He went unconcious after a few minutes under the water, and he was sure it was over, and at the same time he realized that he had regained control. ", "It was too late to get out though.", "\n\nAwhile later he awoke hitting a concrete wall really hard, with the amazing pressure of the water against him.", "\n\nHe coughed, spewing water out of his mouth and his lungs. ", "He tried to take a breath, but the water was pressing him against the wall.", "\n\nHe got his footing on the wall and propelled himself off, he knew that the only way out now was to get farther downstream. ", "He lived to regret that decision, spending the next 5 minutes slamming into other obstacles, barely being able to take a breath in the freezing water.", "\n\nBut finally, he noticed small alcove along the edge of the river. ", "He dove under to gain speed, and at the last moment, used his the last of his waning strength to launch himself out of the river and across the concrete alcove. ", "He hit it hard, but now he was out of the water, and taking deep breaths, trying to recover.", "\n\nHe spat out more water, I guess this means I'm supposed to be around for awhile more...\n\nHe would've chuckled following the thought, but more water came out instead. ", "He leaned up against the wall, catching his breath.", "\n\nA small group had assembled above him, on the street overlooking the river.", "\n\nOne of the authorities was leaning over the edge looking at him.", "\n\n\"You, trooper! ", "Are you okay?\"", "\n\nAkira managed a nod, \"Just fine.\"", "\n\nHe was glad he had regained control, but wasn't exactly sure how he did. ", "He'd figure that out in time.", "\n\nHe stood, but used his bad wrist to stand up, and abruptly slipped, breaking the wrist even more. ", "Akira clenched his teeth and tried again on the other side this time, standing up. ", "He began to limp away, dripping wet with freezing water, but still alive.", "\n\nHe now knew that somehow, he could return to his normal mental state...if only he could figure out how that happened..\n\nyou very much If a tree would fall in the woods.....would the other trees laugh at it?" ]
{ "pile_set_name": "Pile-CC" }
[ 0.000890365510713309, 0.0038217431865632534, 0.0018202211940661073, 0.03825550526380539, 0.044052984565496445, 0.010063758119940758, 0.003413932165130973, 0.0007209414034150541, 0.012415912933647633, 0.0008897730731405318, 0.0007516611949540675, 0.07358181476593018, 0.0008190313819795847, 0.0010329008800908923, 0.13679072260856628, 0.0009312579059042037, 0.0006878160638734698, 0.0006896647973917425, 0.0005750565906055272, 0.004896910395473242, 0.039015598595142365, 0.016509220004081726, 0.014520613476634026 ]
0.017702
23
[ "Concentration and mean degree of polymerization of Rubus ellagitannins evaluated by optimized acid methanolysis.", "\nEllagitannins are a major class of phenolics largely responsible for the astringent and antioxidant properties of raspberries and blackberries. ", "The Rubus ellagitannins constitute a complex mixture of monomeric and oligomeric tannins. ", "Rubus oligomeric ellagitannins contain, beside the well-known ellagic acid and gallic acid moieties, the sanguisorboyl linking ester group. ", "When exposed to acids or bases, ester bonds are hydrolyzed and the hexahydroxydiphenic acid spontaneously cyclizes into ellagic acid. ", "This study describes a new, rapid procedure for the acid hydrolysis of Rubus ellagitannins in methanol, which results in maximal yield and enables the quantification of all the major reaction products. ", "Additionally, the method provides the rationale for estimating the mean degree of polymerization of Rubus ellagitannins." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0012581198243424296, 0.0027832414489239454, 0.001536710187792778, 0.003807048313319683, 0.0012671941658481956, 0.0006065727211534977, 0.001157818827778101 ]
0.001774
7
[ "[Clinical study of integrative medicine in treatment of nephropathy: strategy and innovation].", "\nThe author analyzed the main issues in current clinical study of integrative medicine in treatment of renal diseases, and proposed the target-oriented strategy for clinical study of different renal diseases, emphasizing the importance of method improvement for academic innovation." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0007222042186185718, 0.0005457401275634766 ]
0.000634
2
[ "1. ", "Introduction {#sec1}\n===============\n\nTraumatic brain injury (TBI) affects almost two million people in the US each year, leaving 2% of the population suffering from disabilities resulting from single, or multiple, brain injuries \\[[@B1], [@B2]\\]. ", "In the phases that follow the initial impact, the secondary injury produces molecular and cellular changes that we can quantify \\[[@B3], [@B4]\\]. ", "To date, TBI diagnosis relies on clinical judgment based on neurological examinations and brain imaging results. ", "Currently, clinicians do not have a rapid and effective way to test the presence or severity of TBI. ", "However, a quick diagnosis is critical to classify TBI according to its degree of severity to prevent long-term disability; biomarkers with high sensitivity and specificity are needed.", "\n\nThe local inflammation after TBI does not exclusively affect the brain; it also affects other organs, including the liver. ", "Along with hepatic acute phase proteins (APP), such as serum amyloid P, C-reactive protein, complement proteins, and serum amyloid A (SAA) all influence the inflammation process \\[[@B5]\\]. ", "Human SAA is a family of proteins consisting of SAA1, SAA2, and SAA4. ", "SAA1 and SAA2 are the major APP primarily synthesized by hepatocytes; however, an extrahepatic production has been reported \\[[@B6]\\]. ", "In mice, the SAA family is formed by three inducible genes, Saa1, Saa2, and Saa3, plus a constitutively expressed Saa4. ", "SAA has low basal levels but high inducibility associated with its role in inflammation-associated neuropathologies \\[[@B7], [@B8]\\]. ", "Specifically, up to 1000-fold increase levels of SAA were found in mice injected with lipopolysaccharides (LPS) \\[[@B9]\\]. ", "Our laboratory has previously demonstrated that the SAA levels were increased in blood and liver at early hours after TBI in a mouse model \\[[@B10]\\].", "\n\nClinical studies have shown SAA concentrations in serum at day one after hypoxic-ischemic encephalopathy to be significantly correlated with the severity of damage in neonates \\[[@B11]\\]. ", "Furthermore, SAA levels in adult TBI patients with severe polytrauma have also been reported \\[[@B12]\\]. ", "However, it remains unknown if the circulating SAA levels depend explicitly on the severity of TBI. ", "Precisely, there is a current lack of experimental models of TBI that interrogate SAA as a potential biomarker of injury severity.", "\n\nIn this study, we tested if SAA protein in serum could be a measure of the severity of the head injury. ", "To do this, we used an experimental TBI model in mice, and we measured both the extent of the lesion and several cellular markers of the neuroinflammatory and neurodegenerative responses. ", "Due to the need to find severity-dependent biomarkers of brain damage, SAA level quantification can be viewed as a sensitive and effective candidate to predict the severity of brain injury.", "\n\n2. ", "Materials and Methods {#sec2}\n========================\n\n2.1. ", "Mice and Controlled Cortical Impact (CCI) Injury Model {#sec2.1}\n-----------------------------------------------------------\n\nWe used nine-week-old male C57BL/6J mice weighing 22-25 g. All mice were purchased from Jackson Laboratories and were kept under 12:12 hour light and dark cycle with access to food and water ad libitum. ", "We anesthetized mice with isoflurane (3% for induction, 1.5% for maintenance) and performed controlled cortical impact (CCI) injury on the left side of the brain at the primary motor and somatosensory cortices using an electromagnetically driven CCI device (Impact One stereotaxic impactor; Leica Microsystems, Buffalo Grove, IL). ", "The site of impact was located at 2 mm lateral and 2 mm posterior to the bregma, and the parameters used for injury severity correspond as follows: mild CCI (0.5 mm depth, 3.26 m/s) and severe CCI (2.5 mm depth, 5.25 m/s), with a 3 mm diameter flat impact tip. ", "Sham mice received the same craniotomy without the impact injury. ", "All animal studies were approved by the Georgetown University Institutional Animal Care and Use Committee (IACUC) and were conducted following the NRC Guide to the Care and Use of Laboratory Animals.", "\n\n2.2. ", "Tissue Extraction and Serum Collection {#sec2.2}\n-------------------------------------------\n\nWe sacrificed the animals at 1, 3, and 7 days post-injury (dpi) for the time course study, and at 1 day after injury for the injury severity study. ", "All mice were euthanized with carbon dioxide (20%) and perfused with Phosphate-Buffered Saline (PBS). ", "For serum collection, trunk blood was collected and allowed to clot for 10 minutes at room temperature, and serum was obtained by centrifugation (14,000 x g) at 4°C for 10 minutes and stored at -80°C. ", "Brains were removed, postfixed in 4% paraformaldehyde overnight, and stored at 4°C in a 30% sucrose solution.", "\n\n2.3. ", "Western Blot Analysis for Detection of SAA {#sec2.3}\n-----------------------------------------------\n\nSerum samples were diluted 1:5 with Tris-Buffered Saline (TBS), combined with 2x Laemmli sample buffer (Bio-Rad), and heated at 95°C for 5 min before loading into 12% SDS-PAGE gel electrophoresis. ", "Separated proteins were transferred onto nitrocellulose membranes. ", "Following transfer, membranes were blocked in 5%*w/v* skim milk powder in TBS-Tween 20 (TSB-T) blocking buffer for 1 h at room temperature. ", "Membranes were incubated with primary antibody in 5%*w/v* skim milk/TBS-T goat anti-SAA (1:500; AF2948, R&D Systems, Minneapolis, MN) overnight at 4°C. ", "Following primary antibody incubation, membranes were washed for 3 x 5 min in TBS-T and probed with secondary horseradish peroxidase-conjugated rabbit anti-goat antibody (1:1000; Jackson ImmunoResearch Laboratories, West Grove, PA) in 3%*w/v*skim milk powder in TBS-T for 2 h at room temperature. ", "Membranes were washed for 3 x 5 min in TBS-T and developed with SuperSignal West Pico enhanced chemiluminescence reagent (Thermo Scientific, Waltham, MA). ", "An Amersham 600 imaging acquisition system (GE Healthcare, Chicago, IL) equipped with a cooled charge-coupled device camera was used for the detection of the proteins. ", "After the detection of SAA protein, the membranes were blocked again with 5% casein-based blocking buffer for 30 minutes at room temperature and incubated overnight at 4°C with rabbit anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000; Invitrogen, Carlsbad, CA) acting as a loading control. ", "After incubation, the membranes were washed, incubated with the anti-rabbit secondary antibody (1:1000; Jackson ImmunoResearch Laboratories, West Grove, PA) as before, and developed as above. ", "Raw pixel intensities of bands from Western blots were quantified by densitometry using Image J software (NIH, Bethesda, MD).", "\n\n2.4. ", "ELISA Assay {#sec2.4}\n----------------\n\nA quantitative enzyme-linked immunosorbent assay (ELISA) (Aviva Systems) has been used to measure SAA1/2 in mouse serum (Aviva Systems, OKEH04394, San Diego, CA) according to the manufacturer\\'s protocol. ", "Absorbance was measured at 450 nm on a microplate reader purchased from Perkin Elmer (Waltham, MA).", "\n\n2.5. ", "Immunohistochemical Analysis {#sec2.5}\n---------------------------------\n\nSerial microtome coronal brain sections (20 *μ*m thick) through the dorsal hippocampus were collected for immunohistochemistry analysis. ", "Free-floating parallel brain sections were washed with PBS with 0.5% Triton X-100 (PBS-T) 3 x 5 min and blocked with 5% normal goat serum (NGS) in PBS-T for 1 h. Brain sections were incubated at 4°C overnight in PBS-T and 3% of NGS using the following primary antibodies: anti-rabbit Iba-1 antibody (1:500, Wako, Chemicals, Richmond, VA) for microglia/macrophages, and anti-rat Ly6B.2 alloantigen antibody (1:100, Bio-Rad, Hercules, CA) for neutrophils. ", "After incubation, brain sections were washed in PBS-T and incubated with the corresponding anti-rabbit Alexa Fluor 568-conjugated or anti-rat Alexa Fluor 488-conjugated IgG secondary antibodies (all 1:1000, Invitrogen) for 2 h at room temperature. ", "Sections were rinsed with PBS 3 x 5 min and incubated in PBS with DAPI solution (1:50,000, Sigma-Aldrich, St. Louis, MO) for counterstained nuclei. ", "The sections were rinsed with distilled water and coverslipped with Fluoro-Gel with Tris Buffer mounting medium (Electron Microscopy Sciences, Hatfield, PA).", "\n\n2.6. ", "Histological Nissl Staining and Lesion Volume Measurements {#sec2.6}\n---------------------------------------------------------------\n\nNissl staining was assessed on an average of 10 brain sections spaced equidistantly apart between 0 and -2.70 mm from bregma corresponding to the injured area. ", "Brain slices were mounted on gelatin-coated glass slides (SuperFrost Plus, Thermo Fisher Scientific, IL) and stained for 10 min with 0.5% cresyl violet (Sigma-Aldrich, St. Louis, MO) dissolved in distilled water and filtered. ", "Stained slides were dehydrated for 2 min using 100%, 95%, 70%, and 50% ethanol, cleared in xylene for 2 min (x2), covered with Permount mounting medium (Thermo Fisher Scientific) and coverslipped. ", "All slides were scanned, and the lesion score ranged from 0 to 4; (0, no lesion; 1, small cortical lesion; 2 medium cortical lesion; 3, large cortical lesion and small hippocampal lesion; 4, large cortical and hippocampal lesion). ", "The lesion score captures the depth and the speed of the impact into the cortex and how it increases the injury severity.", "\n\n2.7. ", "Cell Death Assay {#sec2.7}\n---------------------\n\nBrain sections were processed for terminal deoxynucleotidyl transferase-mediated biotinylated-dUTP nick end labeling (TUNEL). ", "Staining was performed by using the*in situ* Cell Death Detection Kit, Fluorescein (Roche, IL), according to the manufacturer\\'s instructions. ", "Coronal brain sections were mounted on gelatin-coated glass slides. ", "Briefly, brain sections were rinsed with PBS and were incubated with kit-supplied TUNEL reaction mixture at 37°C for 1 h. For double staining, brain sections were incubated with primary antibody against monoclonal anti-mouse NeuN (1:200, Sigma-Aldrich) overnight at 4°C; Alexa Fluor 568-conjugated goat anti-mouse IgG (1:1,000, Invitrogen) were applied for 1 h at room temperature. ", "Sections were rinsed with PBS 3 x 5 min and incubated in PBS with DAPI solution. ", "The sections were rinsed with distilled water and coverslipped with Fluoro-Gel with Tris Buffer mounting medium. ", "TUNEL-positive nuclei were counted in 5 cortical regions (x20) in the three to five coronal sections for each animal (n=5 mice/group at each time point).", "\n\n2.8. ", "Quantitative Analysis {#sec2.8}\n--------------------------\n\nFor quantitative analysis of immunolabeled sections, we implemented unbiased standardized sampling techniques to measure tissue areas corresponding to the injured cortex showing positive immunoreactivity as we previously described \\[[@B13], [@B14]\\]. ", "To quantify the number of TUNEL, NeuN, and Ly6B.2-positive cells, an average of four sections from the lesion epicenter (--1.34 to -- 2.30 mm from bregma) were counted in cortical layers in 3 to 5 coronal sections for each animal, n = 5 mice per group, within each brain region, every positive cell in each of 5 cortical fields (x20, 151.894 mm^2^) around the impact area, as we have previously described \\[[@B15]\\]. ", "For proportional area measurements, the microglial/macrophages (Iba-1 positive) activation was reported as the proportional area of tissue occupied by immunohistochemical stained cellular profiles within a defined target area. ", "Thresholded images converted to 8-bit grayscale were made using ImageJ (NIH, Bethesda, MD). ", "The thresholding function was then used to set a black and white threshold corresponding to the imaged field, with the averaged background subtracted out. ", "Once a threshold is set, the \"Analyze Particles\" function was used to sum up the total area of positive staining and to calculate the fraction of the total area that is positive for the stain as previously was described \\[[@B13], [@B14]\\]. ", "Data are shown as the percentage of Iba-1 positive immunoreactivity per the total area that occupied on the field studied. ", "Images were acquired on an Axioplan 2 microscope (Zeiss, Thorwood, NY) with a Photometrics camera and analyzed using AxioVision software (4.8, SP1).", "\n\n2.9. ", "Statistical Analysis {#sec2.9}\n-------------------------\n\nAll data in this study are expressed as the mean ± standard error of the mean (SEM). ", "P \\< 0.05 or less was considered statistically significant. ", "For data with a single time point after injury, intergroup differences were evaluated by one-way analysis of variance (ANOVA), followed by Dunnett\\'s multiple comparison test when comparing all values to the control, and Bonferroni posttest when comparing selected values. ", "For statistical comparison of mild and severe TBI data, the Mann-Whitney U test was used for groups of two. ", "All statistics were performed with GraphPad Prism 5.0 software (GraphPad, San Diego, CA).", "\n\n3. ", "Results {#sec3}\n==========\n\n3.1. ", "SAA Expression in Blood Peaks at 1 Day after Injury and Is Severity Dependent {#sec3.1}\n----------------------------------------------------------------------------------\n\nWe tested if SAA protein levels were acute or severity dependent. ", "SAA protein levels were quantitated by western blot in blood serum collected in sham and injured mice at 1, 3, and 7 days after CCI ([Figure 1(a)](#fig1){ref-type=\"fig\"}). ", "Immunoblot analysis revealed a single band of molecular weight 12 kDa that corresponds to SAA1/SAA2, indicated as SAA. ", "While SAA levels were slightly detectable in sham mice, in injured mice at 1 day after CCI, SAA levels reached their peak, increasing up to 3-fold change to sham animals. ", "Subsequently, SAA levels decreased at 3 and 7 days after CCI with no significant difference observed in sham mice. ", "Summarizing, TBI induced an acute increase in the levels of SAA in serum. ", "SAA levels in serum were highest after severe CCI, lower after mild CCI, and nearly absent in sham mice ([Figure 1(b)](#fig1){ref-type=\"fig\"}). ", "To corroborate these results, we used a sensitive ELISA analysis and found an increase of 23% of SAA1/2 levels in the severe injury compared to mild CCI ([Figure 1(c)](#fig1){ref-type=\"fig\"}). ", "For these experiments, we used GAPDH protein as a control.", "\n\n3.2. ", "Injury Severity Increases Lesion Extension and Neuronal Cell Death {#sec3.2}\n-----------------------------------------------------------------------\n\nWe next examined SAA protein levels compared to lesion size. ", "We observed larger lesions in mice that were severely injured compared to those that were mildly injured ([Figure 2(a)](#fig2){ref-type=\"fig\"}). ", "Next, we examined CCI-induced neuronal cell death in the pericontusional cortex and around regions to the impact site using TUNEL assay in combination with immunofluorescence staining for the neuronal marker, NeuN (Figures [2(d)](#fig2){ref-type=\"fig\"}--[2(f)](#fig2){ref-type=\"fig\"}). ", "We observed 71% more TUNEL positive cells in severely injured brains compared with mild brain injury ([Figure 2(b)](#fig2){ref-type=\"fig\"}). ", "At 1 day after injury, there was a 43% decrease in NeuN positive cells in mild CCI, and 75% in severe CCI compared with sham brains in the cortical regions ([Figure 2(c)](#fig2){ref-type=\"fig\"}).", "\n\n3.3. ", "Injury Severity Increases Microglia/Macrophage Density and Neutrophil Infiltration into the Injured Brain {#sec3.3}\n--------------------------------------------------------------------------------------------------------------\n\nUsing immunohistochemistry, we detected Iba-1 positive cells and calculated the percentage of Iba-1 area in severe and mild injured brain cortical regions at 1 day after CCI. ", "We observed that the total Iba-1 positive area was significantly higher in severely injured brains (80% increase in mild TBI vs. 30% in sham) (Figures [3(a)](#fig3){ref-type=\"fig\"} and [3(b)](#fig3){ref-type=\"fig\"}). ", "CCI injury induces a rapid infiltration of neutrophils (Ly-6B.2) into the cortex. ", "Sham-injured brains have little to no evidence of Ly-6B.2 positive cells in the cortex. ", "At 1 day after CCI, we observed 18% more Ly-6B.2 positive cells in mild-CCI brains compared with sham and displayed a significant increase of 55% in the severe-CCI brains. ", "Between mild and severe brain injury we observed a 3-fold increase in the number of infiltrated neutrophils (Figures [3(c)](#fig3){ref-type=\"fig\"} and [3(d)](#fig3){ref-type=\"fig\"}).", "\n\n3.4. ", "Increased SAA Protein Levels Correlate with Injury Severity {#sec3.4}\n----------------------------------------------------------------\n\nFinally, we examined SAA levels in correlation with lesion score, cell death, microglia/macrophages, and neutrophil infiltration. ", "As illustrated in [Figure 4(a)](#fig4){ref-type=\"fig\"}, SAA in the blood is likely to reflect an injury-induced release of neurodegenerative features in the brain after 1 day after CCI. ", "We found a positive correlation between SAA levels and lesion score (r = 0.85; p = 0.0001) and neuronal cell death (r = 0.89; p = 0.0001), ([Figure 4(b)](#fig4){ref-type=\"fig\"}). ", "SAA in the blood is likely to reflect an injury-induced release of neurodegenerative features in the brain after 1 day after CCI. ", "We then evaluated the link between the SAA levels in serum and the microglia/macrophages and infiltrated neutrophils density. ", "We found a positive correlation between SAA levels and microglia/macrophages density (r = 0.77; p = 0.0006) and neutrophil infiltration (r = 0.83; p = 0.0002), (Figures [4(c)](#fig4){ref-type=\"fig\"} and [4(d)](#fig4){ref-type=\"fig\"}).", "\n\n4. ", "Discussion {#sec4}\n=============\n\nHere we found that increased brain injury severity, cell death, microglia/macrophages, and neutrophil infiltration correlate with increases in SAA protein. ", "We have previously shown that SAA protein is produced at high levels by the liver in response to TBI in a mouse model \\[[@B10]\\]. ", "Expression levels in liver proteins help to accurately and directly measure the severity of brain injury and should be a useful tool for TBI diagnosis when pathological symptoms or neuroimaging analysis do not provide this information. ", "In this work, we have used a well-characterized experimental model of TBI to assess the severity of the lesion over time \\[[@B14]\\]. ", "Our western blot analyses revealed that SAA was significantly overexpressed in the sera from TBI-mice compared to sham mice and was further validated by ELISA. ", "We also found that SAA expression was higher in mice with severe TBI compared to mild TBI. ", "The levels of SAA are of high sensitivity and severity dependent and thus may be a neuroinflammation-based diagnostic and prognostic biomarker for TBI patients ([Figure 4(e)](#fig4){ref-type=\"fig\"}). ", "While we did not differentiate between the SAA proteins, due to the low molecular weight of these proteins, it is difficult to find an antibody exclusive to one type of SAA.", "\n\nThe acute response of the TBI affects the systemic inflammatory state of the organs of the periphery \\[[@B25]\\]. ", "The fastest form of communication between the brain and the periphery is via the release of extracellular vesicles to the circulation \\[[@B26]\\]. ", "This peripheric inflammation mediated by cytokines and other small molecules promotes transmigration of leukocytes and an increase in systemic inflammation and damage in peripheral organs \\[[@B26]\\], including the liver. ", "A recent study has shown how a single fluid percussion injury (FPI) episode in the rat cortex induces significant peripheral inflammatory and oxidative stress, disrupt redox statutes, and mitochondrial function in the liver \\[[@B27]\\]. ", "High levels of circulating cytokines elicited by brain trauma affect the response injury in the brain and contribute to a blood-brain barrier opening and neutrophil infiltration \\[[@B28]\\]. ", "Favorable changes to hepatic oxidative inflammation may exert protective effects on acute hyperglycemia and the cerebral inflammatory response induced by severe TBI. ", "Furthermore, in our animal model of TBI, we observed that brain injury severity induced an increase in the infiltration of neutrophils in the brain lesion. ", "A recent study demonstrated that the recruitment of leukocytes in the brain lesion occurs quickly and is maintained for at least a week \\[[@B29]\\]. ", "The production of APP in the liver in response to a brain injury leads to the systemic inflammatory response syndrome \\[[@B29]\\], establishing a channel of communication between the liver and the extrahepatic organs, including the brain \\[[@B30]\\].", "\n\nHepatic SAA is increased in blood after TBI, which suggests that the SAA protein is transported rapidly in the circulation after brain trauma. ", "Thus, SAA could be a potential TBI biomarker candidate but requires validation at the clinical level. ", "Another compelling aspect of using SAA as a brain injury biomarker is its reliable detection at early time points \\[[@B31]\\]. ", "Early detection is an essential property of SAA since early identification of intracranial injuries will assist clinical decisions and likely reduce long-term cognitive deficits, and potentially even death.", "\n\nA first step for the majority of TBI patients is to perform a neuroimaging analysis to determine injury severity and localization. ", "These tests, such as computerized tomography (CT) and magnetic resonance imaging (MRI) scans, are expensive and slow, especially concerning blood-based evaluations of TBI biomarkers. ", "There currently exists a wide range of existing biomarkers for TBI in the blood, such as S100*β*, neurofilament heavy chain protein (NF-L), glial fibrillary acidic protein (GFAP), C-terminal ubiquitin hydrolase-1 (UCH-L1), neuron-specific enolase (NSE), myelin basic protein (MBP), and tau protein as well as other biomarkers detected in the cerebrospinal fluid (CSF) \\[[@B16], [@B17]\\]. ", "Biomarkers in blood or CSF widely studied in TBI have been classified, together with the Glasgow coma scale (GCS), to provide additional information \\[[@B18]--[@B21]\\]. ", "For example, serum levels of NF-L increase the first week after injury \\[[@B22]\\]. ", "However, there are no*in vivo* studies that have fully assessed the serum half-life of NF-L. Another panel of three biomarkers, NSE, metallothionein 3, and neurogranin, were all identified in mild TBI patients during the first 6 hours after trauma \\[[@B23]\\]. ", "Their levels in blood, however, were undetectable days after injury, and these markers require clinical validation.", "\n\nProteins produced in the brain after damage are detectable at extremely low concentrations in the plasma. ", "Many of them suffer from proteolytic degradation in the blood, and their levels can be affected by the elimination of blood through the liver or kidneys \\[[@B24]\\]. ", "All of these factors are critical for accurate diagnosis and for designing appropriate rehabilitation therapies. ", "Recent studies have shown that healthy university athletes express serum biomarkers related to concussion in varying concentrations \\[[@B24]\\]. ", "It is clear that serum biomarkers have high variability and, above all, demographic factors such as sex have not been considered.", "\n\nRecently, a panel of high-sensitivity markers has been approved by the FDA to detect serum levels of GFAP and UCH-L1 within 12 hours after head injury. ", "However, this TBI diagnostic has generated controversy as it does not measure the severity of the damage, nor does it diagnose a concussion, and the time of blood draw is critical to the measurement. ", "There is a need to identify alternative serum biomarkers that may perform with respect to the limitations of current biomarkers. ", "In summary, there remain multiple issues regarding the development of reliable TBI blood biomarkers.", "\n\nPrevious clinical studies have shown that SAA was elevated after TBI in humans \\[[@B11], [@B12], [@B32]--[@B35]\\], and the levels of SAA may be sensitive to injury severity. ", "Clinical studies report that TBI patients with severe multitrauma showed higher serum SAA compared with mild to moderate only head trauma patients \\[[@B12]\\]. ", "However, a correct association of SAA with brain trauma patients has not been established, mainly due to any validation in animal models. ", "Therefore, we suggest that SAA may represent a sensitive biomarker that can be used to diagnose patients with mild to severe TBI within the first hours after injury, thus complementing the traditional GCS.", "\n\n5. ", "Conclusion {#sec5}\n=============\n\nCollectively, our findings demonstrate that SAA production dynamics in serum appear to be correlated with injury severity, which increases or decreases in function of harmful secondary events, thus indicating SAA could act as a novel biomarker for monitoring TBI patients. ", "Our work demonstrates, for the first time, in a mouse model of TBI that the SAA levels increase with the severity of the damage. ", "SAA thus represents a promising new biomarker of the inflammatory and pathobiological responses to TBI severity. ", "Although this needs to be further vetted and validated in clinically TBI patients, our findings reinforce the idea that TBI-related injuries are not limited to secondary damage in the brain. ", "Additional studies are required to specifically block this response in the liver and thereby reduce neuroinflammation in the brain induced by the acute hepatic response.", "\n\nThis work was supported by R03NS095038 (Sonia Villapol) Grant from the National Institute for Neurological Disorders and Stroke (NINDS). ", "We thank the Master\\'s Degree in Biochemistry and Molecular Biology Program at Georgetown University for the support.", "\n\nData Availability\n=================\n\nAll data generated or analyzed to support the findings of this study are included within the article.", "\n\nConflicts of Interest\n=====================\n\nThe authors declare that there are no conflicts of interest regarding the publication of this paper.", "\n\n![*", "SAA levels peak at 1 day after injury and increase with the injury severity*.*Time course of acute phase proteins in response to brain injury*. (", "a) SAA expression increases after injury in serum at 1 day after injury and returns to sham levels at 7 days after injury. ", "At 1 day after CCI, severe injury has higher SAA expression than mild injury or sham mice as is shown by western blot (b) or by ELISA analysis (c). ", "Protein expression in serum was normalized with GAPDH. ", "Mean±sem, *∗*p\\<0.001, n=5/group.](BMRI2019-5967816.001){#fig1}\n\n![*", "Neuronal loss and cortical lesion are injury severity dependent.*Representative sections of injured brains stained with cresyl violet. ", "Blue box represents the cortical brain region analyzed. ", "Severe injury has an increased lesion score compared to mild injury at 1 day after CCI (a). ", "The number of dying neurons around the cortical impact site in sham mice or after mild injury is fewer compared to severe injury (b). ", "Increased numbers of NeuN positive cells in sham mice are reduced 2 folds after mild TBI, and 4 folds after severe injury (c). ", "Representative images show the number of dying neurons around the cortical impact site in sham, and mild or severe injured mice indicated by TUNEL (green), NeuN (red), and DAPI positive cells (blue). ", "Mean±sem, n=5/group, *∗∗∗*p\\<0.001, *∗∗*p\\<0.01, *∗*p\\<0.05 injured vs. sham, and \\#p\\<0.05 mild vs. severe injury.](BMRI2019-5967816.002){#fig2}\n\n![*", "Microglia activation and neutrophil infiltration are dependent on injury severity*. ", "Immunofluorescence images show microglia/macrophages from sham to mild and severe injury (Iba-1, red) (a). ", "Quantitative analysis of Iba-1 immunoreactivity is reduced in injured brains in sham mice and increased 3 folds after mild TBI and 5 folds after severe injury (b). ", "Immunofluorescence images show infiltrated neutrophils from sham to mild and severe injury (Ly-6B.2, green; dapi, blue) (c). ", "The number of Ly-6B.2 positive cells increased in injured brains 3 folds after mild TBI, and 5 folds after severe injury (d). ", "Mean±sem, n=5/group, *∗∗∗*p\\<0.001, *∗∗*p\\<0.01 injured vs. sham, and \\#p\\<0.05, \\#\\#p\\<0.01 mild vs. severe injury.](BMRI2019-5967816.003){#fig3}\n\n![*", "SAA expression increases within injury severity.* ", "Correlation between the SAA levels in serum after 1 day after injury with the lesion score (a), cell death (b), microglia/macrophages (c), and neutrophil infiltration (d) was assessed. (", "e) Summary of secondary injury processes that trigger neuropathological and inflammatory responses and release into the bloodstream. ", "Mild to severe injury causes lower to higher SAA levels, respectively.](BMRI2019-5967816.004){#fig4}\n\n[^1]: Academic Editor: Annalena Venneri\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0.0009391896310262382, 0.002195411827415228, 0.0006041384767740965, 0.0006277567590586841, 0.000706924416590482, 0.0006205828976817429, 0.0010875039733946323, 0.0005806304980069399, 0.0010546674020588398, 0.0006157370517030358, 0.0008169007487595081, 0.0015995914582163095, 0.0009476204868406057, 0.0006714646588079631, 0.001735376426950097, 0.0011963129509240389, 0.000611534109339118, 0.0006582455825991929, 0.0005727209500037134, 0.000792678096331656, 0.00075464544352144, 0.0011855863267555833, 0.0011304229265078902, 0.0007356724236160517, 0.0008733627037145197, 0.0006251708837226033, 0.013808449730277061, 0.0005565565661527216, 0.0013893850846216083, 0.0006637096521444619, 0.0012084927875548601, 0.0012145291548222303, 0.003268701024353504, 0.0013590188464149833, 0.0008478246163576841, 0.0006287750438787043, 0.0008831022423692048, 0.0006471184897236526, 0.00134273839648813, 0.0007259410922415555, 0.000572695629671216, 0.0006742390687577426, 0.0007500976789742708, 0.0007173991180025041, 0.0013036086456850171, 0.0006388893234543502, 0.0005847663851454854, 0.0012572675477713346, 0.0010997159406542778, 0.0029426238033920527, 0.0032530988100916147, 0.0005879134987480938, 0.0008311237907037139, 0.0012262482196092606, 0.0007997557986527681, 0.0007227289024740458, 0.0006659082137048244, 0.002982579404488206, 0.0007160200621001422, 0.0012852748623117805, 0.0017836536280810833, 0.0006445312174037099, 0.0015651866560801864, 0.0008266324875876307, 0.0006181423086673021, 0.0009024006430990994, 0.0005678848247043788, 0.0013313802191987634, 0.0006612000288441777, 0.0006567270029336214, 0.0005878465599380434, 0.000610062968917191, 0.0006724025006406009, 0.0006072740652598441, 0.0006834610248915851, 0.0005950025515630841, 0.0012863923329859972, 0.000655793584883213, 0.0006415677489712834, 0.0005711460835300386, 0.0006104171625338495, 0.0005898296949453652, 0.00117425003554672, 0.001212505274452269, 0.000908389687538147, 0.0006678311037831008, 0.0006730070454068482, 0.009294465184211731, 0.0008948471513576806, 0.0005754195153713226, 0.000784454750828445, 0.0005483211134560406, 0.0005699793109670281, 0.0013830541865900159, 0.0011154524981975555, 0.0005861957906745374, 0.0006632499862462282, 0.0007913757581263781, 0.0010954561876133084, 0.0013750585494562984, 0.0009258721256628633, 0.0008400768274441361, 0.0014198735589161515, 0.0029509568121284246, 0.0010881433263421059, 0.001398423919454217, 0.0013624537969008088, 0.0008616716368123889, 0.0008128145127557218, 0.0010098823113366961, 0.0014179062563925982, 0.0007094431784935296, 0.0006858037086203694, 0.0012900290312245488, 0.0009793044300749898, 0.0006792435306124389, 0.0006308943266049027, 0.0005793938762508333, 0.0008662104373797774, 0.0009808209724724293, 0.0006812388892285526, 0.0005709515535272658, 0.0008819930371828377, 0.0009063744801096618, 0.0014323701616376638, 0.0006595639861188829, 0.0011481560068205, 0.0008362476364709437, 0.0011551842326298356, 0.0012351536424830556, 0.0010375832207500935, 0.0015797738451510668, 0.0005720060435123742, 0.0008041950641199946, 0.0009825672022998333, 0.0006935796118341386, 0.0016419915482401848, 0.0008790628635324538, 0.000619761529378593, 0.0007231294875964522, 0.0007209726609289646, 0.0007078240741975605, 0.000795852392911911, 0.0032645852770656347, 0.0005791335133835673, 0.0005658009322360158, 0.0007362082251347601, 0.0006417331169359386, 0.0007220339612103999, 0.000564771587960422, 0.0007545271655544639, 0.0006745044374838471, 0.0008549478370696306, 0.0006475892150774598, 0.0007032861467450857, 0.0013671473134309053, 0.0006397122051566839, 0.0005801677471026778, 0.0007352522225119174, 0.0006772959022782743, 0.0009026805055327713, 0.0007335973205044866, 0.0005286892410367727, 0.000636921962723136, 0.0007659073453396559, 0.004387372173368931, 0.0007862725760787725, 0.0007885927334427834, 0.0011259473394602537, 0.0006106950459070504, 0.0015302249230444431, 0.0022126506082713604, 0.000777404464315623, 0.0031470980029553175, 0.0012556076981127262, 0.001732949516735971, 0.0006386065506376326, 0.0011126353638246655, 0.0008514933288097382, 0.0007098259520716965, 0.0012541100149974227, 0.0009705819538794458, 0.0011539991246536374, 0.0011401224182918668, 0.0006252957391552627, 0.0007090501021593809, 0.0011373287998139858, 0.0007334292167797685 ]
0.001109
188
[ "The Vampire And The Maiden, part 3\n\n\"I know I'm Sparky but I'm trying.\" ", "It was hard. ", "She had partners but didn't really have friends and life had made her mistrustful. ", "Part of her was comfortable being the way that she was and the other part could easily empathize with Sean- there was a lack of connection and it didn't feel very good. \"", "I've never really wanted to try before. ", "I have no idea what I'm doing.\" ", "Every part of her body made it clear, she was embarrassed but telling the truth.", "\n\n\"And you think I do?\" ", "He chuckled, though his smile was soft rather than teasing. \"", "What do you want?\" ", "He asked as he lead them towards the veranda again, for some privacy and to cool off a bit.", "\n\nHis first question caused her to open her mouth as though preparing to argue- of course she thought he did. ", "Sean always had something to say, he always had a reaction to her, even most absurd, actions. ", "He was so smooth, how could it even be possible that he didn't know what he was doing? ", "It didn't compute.", "\n\nJessenna followed him to the veranda, glad she had a fan because she was getting warm. ", "She even removed her mask. ", "Maybe that was symbolic somehow. \"", "I don't know, I haven't thought that far. ", "Should I have?\" ", "Her heart was thumping and she was almost confident it was loud enough for Sean to hear even though he wasn't a real vampire. ", "Micah's conversation didn't cover any of this was a night of trying new things.", "\n\n\"I just- I can't believe I'm even saying this,\" she huffed, \"last...time...I was just really embarassed and felt so stupid. ", "Kissing blackmailing strangers really isn't something I do and I know I got really pushy,\" literally,\"I.... It was dumb and I actually felt really bad for being mean to you.\" ", "She'd done a lot of mean things before but she hadn't felt guilty about it before. ", "Was it an explanation? ", "An apology? ", "She didn't know but she said the things she'd wanted to, maybe not in the truest or most eloquent way but self reflection was unexplored territory. \"", "I mean, the whole thing pinning you to the table was stupid. ", "And I promise I won't stab you unless you really, actually, legally deserve it.\"", "\n\nHe smiled genuinely at her, \"it's alright, don't worry about it. ", "We both needed to be set straight on what really happened then. ", "I have to be honest though, I wouldn't mind repeating certain things, without blackmail and you running away this time though.\" ", "He pinched two glasses of sparkly water from a passing by waiter and handed her one.", "\n\nOh. ", "So he'd notice the part where she tucked tail and ran off. ", "Jessenna took a skeptical sip of the drink, decided it had been alright, and enjoyed half the glass in a shot.", "\n\n\"Certain things? ", "You wouldn't be talking about the guns and sandwiches would you?\"", "\n\nHe grinned, \"oh those are extra amenities.\" ", "Sean stepped as little closer again, slow enough to give her time and room to back out.", "\n\nFor now the man was permitted to be in her space. ", "Normally it was dangerous to share the basket with the coiled cobra but there was something serene when it was charmed into peaceful obedience; its venom and power calm, soft even. \"", "Hmm. ", "Maybe that's one of the reasons I like you,\" she said quietly with a grin, her earlier taunt not forgotten.", "\n\n\"What, common grounds?\" ", "He chuckled softly, looking down at her visage, slowly coaxing her into revealing more.", "\n\nShe giggled. \"", "What's not to like about a man who can make a delicious lunch?\" ", "Clearly a tease but her eyes looked up into his, pupils dilated and wide, her cheeks growing rosier as she smiled with a hint of mischief as she raised her hand to trace the red lining on his vest.", "\n\n\"Eh, anyone can make sandwiches. ", "Or read a recipe then make 'em.\" ", "His hands looped around her waist very loosely.", "\n\nJessenna's breathing slowed. ", "What a weird feeling- she wanted so bad to be right there in the middle of his affections but the current running through her made her want to squirm away. ", "It was like the butterflies everyone so romantically talked about fluttering in their stomach were under attack instead being eaten by wild birds which was not nearly as lovely an image.", "\n\nSean had her brain temporarily on the fritz but eventually she remembered to say something, and she did so even more quietly than before. \"", "You're right. ", "Maybe that's not why I like you.\" ", "Oh but now she was definitely remembering quite vividly.", "\n\n\"Oh I know, it was my natural appearance,\" he ran his fingers over his mouth and chin to remind of his scruffy beard and mustache. ", "He had a fairly good idea what she was really talking about but it was somewhat fun to see her trying to tempt him, and having her not fight him and actually play along was the tempting bit.", "\n\n\"Your blackmail scheme would not have worked if it weren't for your natural appearance. \" ", "Jessenna eased slightly as Sean's grip did similarly. ", "It was empowering in a way as the pressure relieved but he was doing a fantastic job at distracting her with his words. ", "The mental game took away from the weird feeling in her tummy. \"", "It was too nice to crush into the table,\" she chuckled. ", "It still was, even shaved. \"", "I've never said that before,\" the woman confessed, punctuating the point with gentle pokes.", "\n\nHis grin spread slowly, \"you're doing pretty good for a first timer though.\"", "\n\n\"If you're such a good judge then a lot of girls must tell you that,\" she said, infected by his smile. ", "He had a nice one, even with the fangs. \"", "I do like it though, even without the fuzz.\"", "\n\nHe touched one of the fangs with his tongue theatrically, \"only when I wear fangs.\" ", "He chuckled, \"I don't go all out for just anyone, Jessenna. ", "The encounters I usually have are job related, or just relief. ", "I don't get all fancy and shave 'n such for them.\"", "\n\nJust anyone? ", "What did that mean? ", "Her quick expression hinted at her curiosity but she didn't acknowledge it with her following words. \"", "I know how that is. ", "Last time I did anything social was a lunch date to the holodeck with guns and bows.\"", "\n\nShe took pride in her work, invested herself in it, and if she wasn't working she was training- learning new things or continuing to perfect the machine that was her body. ", "It all had its reward- she was relied on, trusted even, and no one in the department could deny that her efforts made all the difference. ", "But none of them knew how to separate her from the job. ", "Her desire to plunge into her work blinded her to how her behavior might be a way to fill in gaps, holes that she was unsure what else to fill it with.", "\n\nShe was quiet, which he wasn't sure how to take. ", "Did he say too much with the whole, yeah I'm into casual and fool around for work too thing?", "\n\n\"Anyway, let's not put a wet rag on our fun.\" ", "Jessenna started, not sure where she was going to finish when he didn't respond. \"", "That's one lesson the Lieutenant didn't have to give me, actually.\" ", "She added with a touch of pride in her smile before she finished her drink and turned so that she could look down at the water since gazing adoringly up at his eyes was starting to make her neck hurt.", "\n\nHe smirked. ", "So she was still here and not backing off, though he wasn't sure if she actually understood what he'd said or if she didn't mind.", "\n\n\"Agreed. ", "So, would you be interested in doing something social again?\" ", "He ventured.", "\n\n\"Another encounter with you? ", "Sure.\" ", "Jessenna used his own words but the special tone that went along with such a suggestive term was absent. ", "She'd once said she wasn't that type of girl but how far did that go exactly? \"", "Beside this one of course. ", "I think I might like to get to know you if that isn't worrisome.\"", "\n\nHe chuckled, \"nah, you can even pick the setting and all. ", "It was my choice last time, you pick, whatever ya like.\"", "\n\n\"I kind of just do things. ", "Planning isn't really something I'm good unless it's tactical. ", "People call it being impulsive I think but it's a family trait.\" ", "Jessenna shrugged it off although she did wonder what circumstance she might like to see Sean in next but why imagine him when he was right there? ", "Her eyes looked him over again before settling on a few lights on the horizon.", "\n\nHe settled next to her, overlooking the horizon, their shoulders, or rather sides, lightly touching, \"how about we pick a day while we're here and just see what we can get up to? ", "There's a boatload of stuff to do.\"", "\n\n\"Wouldn't a vampire rather go out of an evening,\" she asked teasingly, pushing on him slightly which was a change from the typical grab and shove she was known for, \"preying on defenseless damsels and draining them of their blood before making them your slave? ", "Or does the slave part come first?\" ", "She looked over at him thoughtfully before giving into her instinct, which to be fair she had ignored for a very long time, and lifted his top lip with her dainty little fingers. \"", "Could you actually bite someone with those if you wanted?\"", "\n\nJessenna hadn't heard anyone talk quite like that before and she couldn't help but giggle a little. ", "Who knew that a man with such a serious job could be so silly. \"", "Only if you dare!\"", "\n\n\"Vell,\" he turned to face her fully, slowly tracing the right side of her neck with the back of his fingertips, \"dere are several veys vone ken do dis.\"", "\n\nSean's soft touch coaxed her into silence, her lips parting but nothing came out, as the skin beneath him succumb to goosebumps but her attention was all his.", "\n\n\"Dis iz vone...\" he spoke softly and leaned down, gently pressing his lips against hers, one hand pulling her closer, the other palming her cheek gently.", "\n\nJessenna made a content noise as Sean embraced her. ", "Now there weren't any games, no coy things to say, only indulging in the soft lips of someone who sparked excitement in your chest. ", "She's been on her best behavior the entire night but the excitement charged through her like electricity. ", "The woman returned his affections softly at first, just like the taste test of the sparkling water, but her drive for more pushed her closer to him, willingly drawn in by his hand and pressing herself further. ", "One kiss simply wasn't enough. ", "Neither was two. ", "But how much before it was too much?", "\n\nAt first her hands were flat against his chest but as the kiss deepened and the surge of passion and intensity flared up in her they clung tightly to the soft, dark fabric of his costume.", "\n\nHe smiled into the kiss, happy that he'd called it right and that she wasn't attempting to stab him or running away. ", "Caution though returned to him as he remembered their last heated encounter. ", "Leaning his forehead against hers gently, arms around her waist, he took a deep breath.", "\n\n\"I have to ask you something, before we go past the point of return.\"", "\n\n\"My hands are right here,\" Jessenna started assuming that he might be a little worried even though she really didn't want to hurt him, but she simmered down before continuing, \"what is it?\" ", "Should she be nervous? ", "Why was her heart rushing?", "\n\n\"How far do you want to go?\" ", "He asked softly, leaning back a little to catch her eyes and her face, \"before you ask me how far I want to go, the answer is all the way, but I know you're not like that..so, if you don't know...just...stop me at the cut off point, okay? ", "I may take a bit to cool off, but I won't mind.\"", "\n\nTruth be told, he had the training and the guile to manipulate her into whatever he wanted easily. ", "But it wasn't what he wanted.", "\n\nAt first her expression was curious but as he elaborated understanding drowned her features, her eyes widening a little with surprise and she bit her bottom lip. ", "She's been asked a lot of things but this was a first. ", "The shock was a bit like having ice cold water poured over her.", "\n\nBut suppose she needed to answer him eventually, and even though she wasn't sure how to react she avoided the typical barrage of physical and verbal threats. ", "She had built a certain level of trust with Sean and she felt like doing such things would be a betrayal of that.", "\n\n\"I...\" didn't know how honest to be? \"...", "don't want to go as far as you, I haven't had-\" she stopped herself short. ", "Jessenna was in new territory and didn't know how to take the next step. ", "She didn't want to stop either. ", "She didn't know what to do and it showed but she hadn't let go of him yet and she hadn't pulled away.", "\n\nHe snuck a finger under her chin, nodding slowly, \"so just stop me when it gets too much, ok? ", "That's all you need to do. ", "We can figure things out if this starts going anywhere, if you like.\"", "\n\nSimply put, Jessenna trusted that he would be a man of his word. \"", "What does that mean?\" ", "Maybe it was a dumb question but in her experience is was common for dumb struck people.", "\n\n\"Well...do you want this...\" he motioned between them, \"to go somewhere? ", "I mean you seem to, but I understand you lack experience in this area...\"\n\nHer lips made an 'oh' as she grasped his meaning. ", "This was them.", "> Verbalizing her lack of experience was a stab to the head but the truth couldn't be wrestled with. ", "Figuring it out as they went sounded like the best idea, plotting it out would spoil the fun, and the loose form of commitment sounded good if not ideal. \"", "You only learn by doing, right?\"", "\n\nJessenna went ahead and kissed him. ", "Actions spoke louder than words anyway. \"", "If you want any more of that we're going to have to take this,\" she mimicked his previous gesture, \"somewhere else.\"", "\n\nA chuckle, \"you sure?\"", "\n\nHer eyebrows furrowed and she pulled away slightly. \"", "Have I ever said something and not meant it?\" ", "There weren't any picnic benches to crawl on here and there were all sorts of people from the ship walking around and worse yet, strangers. ", "If she was going to get what she wanted, whatever the heck that was, she wanted to grab it somewhere a little more private.", "\n\nHe raised his hands in surrender, laughing softly, \"alright Sparky, lead on.\"" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0007360177114605904, 0.0019511154387146235, 0.0010426318040117621, 0.0008158831624314189, 0.00077147624688223, 0.0007608688902109861, 0.0026602838188409805, 0.0014333751751109958, 0.000725159072317183, 0.001227271743118763, 0.000991228735074401, 0.006124699488282204, 0.0009706272976472974, 0.0006964954663999379, 0.0009407462202943861, 0.0011934760259464383, 0.0034318065736442804, 0.0006003226735629141, 0.000669084198307246, 0.0011009438894689083, 0.0030961877200752497, 0.0009572948329150677, 0.09749399870634079, 0.05299706757068634, 0.000763924268539995, 0.0009671678999438882, 0.0009609843837097287, 0.000601831590756774, 0.8174275755882263, 0.5269222259521484, 0.0005890956381335855, 0.000535620201844722, 0.007856196723878384, 0.0006403261213563383, 0.0019147295970469713, 0.005266467109322548, 0.0007267579203471541, 0.000667398446239531, 0.0011011604219675064, 0.0007210042676888406, 0.0024399696849286556, 0.000836991413962096, 0.0005580196739174426, 0.0021304350811988115, 0.0037389567587524652, 0.0007301818113774061, 0.002357069170102477, 0.0008666326175443828, 0.0009710337617434561, 0.002246790798380971, 0.0007061652722768486, 0.0008089245529845357, 0.005144245456904173, 0.0007960579823702574, 0.011855940334498882, 0.001080669229850173, 0.001525873551145196, 0.0007507034461013973, 0.0015930343652144074, 0.0006106560467742383, 0.010521339252591133, 0.0012589511461555958, 0.021839743480086327, 0.000826859672088176, 0.0006796767120249569, 0.02357242815196514, 0.0008341518114320934, 0.0006322312401607633, 0.000686400686390698, 0.0007706096512265503, 0.07209881395101547, 0.0005645683850161731, 0.10195660591125488, 0.0006136886077001691, 0.0015137295704334974, 0.0005974606028757989, 0.03810853883624077, 0.000925283064134419, 0.0007941974909044802, 0.0005590202054008842, 0.0007295325049199164, 0.000989015563391149, 0.0007606713334098458, 0.0006929467199370265, 0.0011769930133596063, 0.0012295623309910297, 0.0010903956135734916, 0.0011714374413713813, 0.007697449531406164, 0.000752640247810632, 0.0007669206825084984, 0.004319638013839722, 0.001094167004339397, 0.0010009825928136706, 0.0006196771282702684, 0.0006596362800337374, 0.0007703207083977759, 0.0017425788100808859, 0.0006751231267116964, 0.000760069175157696, 0.0008305902010761201, 0.0005810767179355025, 0.0006678695790469646, 0.0007422941853292286, 0.000724437297321856, 0.0007153315818868577, 0.00063538015820086, 0.0006702090031467378, 0.0006905529880896211, 0.000638900266494602, 0.0006357862730510533, 0.0010446675587445498, 0.24197110533714294, 0.008403105661273003, 0.002657935256138444, 0.027510011568665504, 0.0010862263152375817, 0.3995573818683624, 0.13739189505577087, 0.061061419546604156, 0.005996482912451029, 0.005995400715619326, 0.002579584950581193, 0.003849080065265298, 0.0012157745659351349, 0.0010165059939026833, 0.0075052231550216675, 0.0008980997954495251, 0.000973899441305548, 0.0021437418181449175, 0.006897243205457926, 0.0007201284170150757, 0.0017088002059608698, 0.0006223393720574677, 0.0009282645769417286, 0.0014993137447163463, 0.0008245048811659217, 0.0019474612781777978, 0.027012990787625313, 0.0009807836031541228, 0.008860497735440731, 0.0010407482041046023, 0.022533752024173737, 0.0005612828535959125, 0.0020991445053368807, 0.001370005775243044, 0.0005514030926860869, 0.0009131708648055792, 0.004639924969524145, 0.0009883505990728736, 0.0012038707500323653, 0.0019124317914247513, 0.021655552089214325, 0.0016462501371279359, 0.0005478780949488282, 0.0006467316416092217, 0.0007346978527493775, 0.47312816977500916, 0.0011600831057876348, 0.0036722454242408276, 0.002855928149074316, 0.002255940344184637, 0.0005492872442118824, 0.0007599258096888661, 0.003165175672620535, 0.0006028354400768876, 0.0007184979040175676, 0.000752865569666028, 0.0007170392782427371, 0.0008105785236693919, 0.0031037842854857445, 0.002660267287865281, 0.0006542852497659624 ]
0.019849
173
[ "Strengths-based case management: individuals' perspectives on strengths and the case manager relationship.", "\nStrengths-based practice in social work has a strong theoretical foundation as an effective helping strategy that builds on a person's successes. ", "Although there is growing empirical evidence informing outcomes associated with strengths-based approaches, missing from the literature is an understanding of how individuals who receive these services view their experiences. ", "Qualitative data collection methods were used to gather individuals' experiences of participating in strengths-based case management implemented in a substance abuse aftercare program. ", "The research questions that guided the study were \"What are individuals' perceptions of strengths-based case management?\" ", "and \"How do those perceptions compare and contrast to the key principles of strengths-based case management?\" ", "The emerging themes centered on individuals' responses to a focus on strengths (acceptance of strengths; holding on to strengths and deficits simultaneously; and initial mistrust of the approach) and to the relationship with the case manager (acceptance of the relationship; guilt when success is not achieved; and not needing the relationship). ", "Implications for social work practice are discussed." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0005850833258591592, 0.0005527586326934397, 0.0005259782774373889, 0.0006348840543068945, 0.0005676472210325301, 0.000597065023612231, 0.0005841132951900363, 0.0005712901474907994 ]
0.000577
8
[ "Q:\n\nSharing files between two containers\n\nFor couple of hours I am struggling with docker compose. ", "I am building angular app. ", "And I could see the files in the dist directory. ", "Now I want to share these files with the nginx container. ", "I thought the shared volume will do it. ", "But when I add\nservices:\n client:\n volumes: \n - static:/app/client/dist\n nginx:\n volumes: \n - static:share/user/nginx/html\n\nvolumes:\n static:\n\nan try docker-compose up --build\nI got this error\nclient_1 | EBUSY: resource busy or locked, rmdir '/app/client/dist'\nclient_1 | Error: EBUSY: resource busy or locked, rmdir '/app/client/dist'\nclient_1 | at Object.fs.rmdirSync (fs.js:863:18)\nclient_1 | at rmdirSync (/app/client/node_modules/fs-extra/lib/remove/rimraf.js:276:13)\nclient_1 | at Object.rimrafSync [as removeSync] (/app/client/node_modules/fs-extra/lib/remove/rimraf.js:252:7)\nclient_1 | at Class.run (/app/client/node_modules/@angular/cli/tasks/build.js:29:16)\nclient_1 | at Class.run (/app/client/node_modules/@angular/cli/commands/build.js:250:40)\nclient_1 | at resolve (/app/client/node_modules/@angular/cli/ember-cli/lib/models/command.js:261:20)\nclient_1 | at new Promise (<anonymous>)\nclient_1 | at Class.validateAndRun (/app/client/node_modules/@angular/cli/ember-cli/lib/models/command.js:240:12)\nclient_1 | at Promise.resolve.then.then (/app/client/node_modules/@angular/cli/ember-cli/lib/cli/cli.js:140:24)\nclient_1 | at <anonymous>\nclient_1 | npm ERR! ", "code ELIFECYCLE\nclient_1 | npm ERR! ", "errno 1\nclient_1 | npm ERR! ", "[email protected] build: `ng build --prod`\nclient_1 | npm ERR! ", "Exit status 1\nclient_1 | npm ERR! ", "\nclient_1 | npm ERR! ", "Failed at the [email protected] build-prod script.", "\nclient_1 | npm ERR! ", "This is probably not a problem with npm. ", "There is likely additional logging output above.", "\n\nAny help is fully appreciated\n\nA:\n\nI believe this is, as the error suggests, a deadlock situation. ", "Your docker-compose file has 2 services that start approximately, if not, simultaneously. ", "Both of them has some sort of hold on the Docker volume (named, \"static\"). ", "When Angular executes ng build, by default, --deleteOutputPath is set to true. ", "And when it attempts to delete the output directory, the error message that you received occurs.", "\nIf deleteOutputPath is set to false the issue should be resolved. ", "Perhaps that is sufficient for your needs. ", "If not, as an alternative, having the --outputPath set to a temp directory within the project directory and after Angular builds, move the contents into the Docker volume. ", "If the temp directory path is out/dist and the volume maps to dist this can be used:\nng build && cp -rf ./out/dist/* ./dist\n\nHowever, that alternative solution is really just working around the issue. ", "To make note, the docker-compose depends_on key will not help in this situation as it simply signifies a dependency and nothing to do with \"readiness\" of the dependent service.", "\nAnd also to make note, executing docker volume rm <name> will have no consequences as a solution here. ", "Remember, both services have a hold on the volume as one is trying to remove it.", "\nJust a thought, haven't tested, as another alternative solution is to delete the contents within the output path. ", "And set the deleteOutputPath to false, since Angular seems to be attempting to delete the directory itself.", "\nUpdate:\nSo removing the contents in the output path seems to work! ", "As I mentioned, set deleteOutputPath to false. ", "And in your package.json file, in the scripts object, having something similar to this:\n{\n \"scripts\": {\n \"build:production\": \"rm -rf ./dist/* && ng build --configuration production\",\n }\n}\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0005849158042110503, 0.0007635181536898017, 0.0006056325510144234, 0.0006038592546246946, 0.0005861787358298898, 0.000866535643581301, 0.000938511686399579, 0.000923834799323231, 0.0013030979316681623, 0.0009100795141421258, 0.0010309539502486587, 0.000976156850811094, 0.0010309539502486587, 0.0007052805740386248, 0.0005923090502619743, 0.0005531911156140268, 0.0007090664003044367, 0.0006613141158595681, 0.000996745890006423, 0.0009655719040893018, 0.001751131727360189, 0.0008460790268145502, 0.0006664685206487775, 0.0006908086943440139, 0.0005801232764497399, 0.0006349654868245125, 0.0006344246794469655, 0.0006873370730318129, 0.0029398633632808924, 0.0008933774661272764, 0.013839345425367355, 0.0006465593469329178 ]
0.001285
32
[ "Nearly 150,000 people are living with HIV/AIDS in Central America. ", "While HIV prevalence among the general population is below 2% ([@CIT0001]), higher prevalence rates are found among key vulnerable populations defined as men who have sex with men (MSM), female sex workers (FSW), and MSM who identify as transgender women (TW) ([@CIT0002], [@CIT0003]). ", "The greatest HIV burden is found among TW -- country-level estimates range from 7.5% in Belize to 28.6% in Honduras ([@CIT0001]), compared to 19.1% globally ([@CIT0004]). ", "In this paper, we refer to MSM as men who engage in sexual activity with other men regardless of how they identify themselves (with regards to sex or gender) ([@CIT0003]). ", "Several studies concur that violence may increase an individual\\'s risk for HIV infection through forced or coercive sexual intercourse, irrespective of relationship type (same sex or male-female) ([@CIT0003], [@CIT0005]--[@CIT0007]). ", "Studies reviewed have also found a relationship between various forms of violence, including sexual violence, intimate partner violence, physical violence, community violence, and risky sexual behavior or STIs ([@CIT0008], [@CIT0009]). ", "In both middle-and high-income countries, exposure to intimate partner violence, including controlling behavior of a partner, physical violence, and sexual violence, is associated with high-risk sexual behavior, including multiple and concurrent sexual partnerships, substance abuse, and transactional sex, thereby heightening the risk for HIV and other STIs ([@CIT0010]--[@CIT0012]). ", "Globally, intimate partner violence is often seen as a direct consequence of gender power inequities, both at the community and interpersonal levels that increases the vulnerability and decreases decision-making power among victims ([@CIT0013]).", "\n\nViolence is widespread throughout Central America, with El Salvador, Guatemala, and Honduras facing some of the worst statistics in Latin America for homicide, robbery, and victimization rates. ", "Close to 16% of adults in Guatemala and El Salvador report being victims of violent crime within the previous 12 months ([@CIT0014]). ", "Domestic Violence is also high, with estimates of physical abuse ranging from 16 to 39% across five countries in Latin America ([@CIT0015]). ", "The most recent data on intimate partner violence in Central America comes from Guatemala, where 24.5 and 12.3% of women report ever being physically or sexually abused and 16% of men report perpetrating physical violence within a marital relationship ([@CIT0016]). ", "Within a socio-ecological framework, violence within the community precipitates other forms of violence ([@CIT0017]). ", "Previous studies have shown that societal level violence and indirect violence (witnessing violence against others) are significantly associated with the experience and perpetration of intimate partner violence ([@CIT0018], [@CIT0019]). ", "Indirect violence is also hypothesized to have independent effects on vulnerability to and risk of HIV ([@CIT0018]), and the experience or perceptions of neighborhood violence are found to have significant effects on domestic violence ([@CIT0019]).", "\n\nClosely related to this context of endemic violence is the 'machismo' culture and widespread homophobia found in Central America. ", "Results from a regional study found that close to 40% of respondents believe that 'God' punishes homosexuals and sex workers with AIDS for their way of life, and 38.5% of respondents agree that people have the right to assault transgender and transvestite individuals ([@CIT0020]). ", "Individuals associated with homosexual behavior in Central America are often hidden and exposed to social marginalization, stigma, targeted homophobia, and discrimination ([@CIT0001], [@CIT0021]). ", "In social and cultural contexts where homophobia or transphobia is prevalent, MSM and TW are at an even greater vulnerability due to structural factors ([@CIT0002], [@CIT0022]). ", "Structural factors, including social, economic, organizational, and political inequities ([@CIT0023]) lessen MSM and transgender women\\'s ability and motivation to report violence, negotiate safer sexual practices ([@CIT0024]), seek healthcare, and/or disclose sexual orientation to health care providers ([@CIT0025]).", "\n\nThe experience of violence is found to be more common in MSM than among heterosexual men, and possibly women ([@CIT0026]). ", "Data collected from a study in Thailand and Mexico among MSM and TW showed that at least 50% of MSM and over 65% of TW screened through HIV clinical services and drop-in centers experienced emotional, physical, or sexual violence. ", "TW, in particular, were found to experience greater levels of violence in both countries ([@CIT0022]). ", "However, there is a dearth of research examining the linkages between violence and HIV risk behavior among MSM and TW due, in part, to the highly stigmatized nature of homosexual behavior ([@CIT0003], [@CIT0007], [@CIT0027], [@CIT0028]).", "\n\nThe associations between sexual identity, violence, risk of-and vulnerability to-HIV infection are complex. ", "Available literature shows that both heterosexual and lesbian, gay, bisexual, and transgender (LGBT) populations who experience intimate partner violence are at greater risk for HIV/STIs ([@CIT0005]). ", "Moreover, due to their position of vulnerability and disempowerment, MSM and TW who experience violence are less likely to negotiate safer sex practices, often engage in riskier behavior that further increases their risk of HIV/STIs, and face greater obstacles in accessing health services ([@CIT0022], [@CIT0027]). ", "The magnitude of violence experienced by MSM and its association with HIV are inconsistently addressed and poorly understood by healthcare, legal, and social services ([@CIT0029]). ", "A US-based study conducted in Los Angeles among professionals affiliated with health, psychosocial, and legal services for survivors of violence report that their respective agencies are ill-equipped to address the needs of LGBT populations ([@CIT0030]). ", "Previous experience with stigma and discrimination from law enforcement is a barrier for MSM in the pursuit of legal recourse in incidents of violence ([@CIT0031]).", "\n\nThe purpose of this paper is to contribute to the growing evidence that looks at the association of violence with HIV/STI risk behavior among MSM populations in Central America. ", "In this paper, we use population-based survey results to independently examine not only the correlation of physical violence but also verbal/psychological and sexual violence on HIV risk behavior among MSM populations across nine cities in Central America. ", "Our data are inclusive of TW as the broader group of MSM and we are able to examine the relationship between self-identification and risk behaviors under study. ", "Through this study, we are able to quantify experiences of violence among this group, which is currently understudied ([@CIT0003]) and very relevant in terms of public health and human rights.", "\n\nThe theoretical framework used in this study hypothesizes that MSM populations in Central America who report experiences of violence are more likely to engage in risky sexual behavior further increasing their risk of acquiring HIV and STIs as evidenced in our review of literature ([@CIT0013], [@CIT0026], [@CIT0028]). ", "This framework extends an individual-level behavioral model to include situational factors, such as the experience of violence and forms of social vulnerability, to explain engagement in HIV risk or protective behaviors ([@CIT0013]).", "\n\nOf particular interest to our analysis is the experience of different forms of violence, either physical or psychological/verbal, and sexual self-identification. ", "Measures of sexual identity and 'outness' were previously proposed as determinants of both violence and HIV risk behaviors in MSM ([@CIT0007], [@CIT0012], [@CIT0032]). ", "Studies have shown differential levels of HIV testing among categories of self-identification ([@CIT0033]) and associations between identity and HIV risk behaviors that are both direct and indirect (operating through substance abuse, battering, aversive emotions, and HIV alienation) ([@CIT0032]). ", "We examine the experience of different types of violence and their associations with reporting multiple partners, engagement in transactional sex, use of alcohol and drugs during sexual relationships, and reported STI symptoms. ", "We argue that further research and studies are needed to deepen our understanding of the correlation between violence experienced by MSM and TW populations as a mechanism that leads to increased HIV risk behaviors and to improve HIV prevention interventions.", "\n\nMethods {#S0002}\n=======\n\nPurpose of the study {#S0002-S20001}\n--------------------\n\nIn 2011, Population Services International\\'s regional affiliate -- the Pan American Social Marketing Organization (PASMO) -- conducted population-based surveys, with funding support from USAID and PEPFAR\\'s Combination Prevention for HIV program in Central America. ", "To evaluate and improve HIV prevention efforts among MSM and TW. ", "These population-based surveys were designed by the PASMO/PSI Regional Research and Metrics team and implemented by CID Gallup. ", "This study provides estimates of different forms of violence among understudied groups, previously unmeasured.", "\n\nThe surveys were conducted using respondent-driven sampling (RDS) in nine cities in Guatemala, El Salvador, Nicaragua, Cost Rica, and Panama. ", "The sites included in this study were selected because they were key target locations of the Combination Prevention for HIV program. ", "The total sample size for all cities combined was 3,949; sample sizes per city are shown in [Table 1](#T0001){ref-type=\"table\"}.", "\n\n###### \n\nRDS recruitment and sample sizes by city\n\n Country Cities Number of seeds Waves (max) Total sample\n ------------- ---------------- ----------------- ------------- --------------\n Guatemala Quetzaltenango 5 9 308\n Guatemala City 3 12 487\n El Salvador San Salvador 2 15 436\n Santa Ana 2 13 298\n Nicaragua Chinandega 5 9 293\n Managua 4 12 489\n Costa Rica San Jose 8 13 752\n Panama Panama City 6 19 530\n Colon 7 7 356\n Total 3,949\n\nStudy participants recruitment {#S0002-S20002}\n------------------------------\n\nRDS is widely used to sample hidden or hard-to-reach populations such as MSM and TW. ", "This sampling methodology allows researchers to measure HIV risk behaviors and HIV/STI prevalence and helps to attain a representative sample when studying a population without a sampling frame ([@CIT0034]). ", "The use of RDS is preferred over snowball sampling as it reduces biases through a more controlled peer and social network recruitment while using statistical weights to provide unbiased population estimates ([@CIT0035], [@CIT0036]).", "\n\nIn this study, RDS was used to recruit a sample of individuals in each of the selected cities. ", "The initial group of individuals, known as 'seeds', was selected using the following criteria: individuals who represented subgroups of MSM by self-identification (homosexual vs. heterosexual or bisexual vs. transgender), socio-economic strata (low-, middle- and high-income), and by sex work practices (charged for sex in the past year or not). ", "These initial groups began the recruitment process using a 'chain referral' methodology ([@CIT0035]). ", "RDS uses a dual incentive system to drive the chain referral methodology by having seeds recruit peers from within their social network ([@CIT0036], [@CIT0037]). ", "In the PASMO studies, participants received a US\\$5.00 incentive upon being interviewed and incentives of equal value for recruiting a maximum of three eligible peers into the study.", "\n\nOutcomes of field work {#S0002-S20003}\n----------------------\n\nThe total number of seeds used in each city ranged from two to eight. ", "The process began by selecting two seeds per country, and then using additional seeds when recruitment chains terminated. ", "As indicated in [Table 1](#T0001){ref-type=\"table\"}, in El Salvador and Guatemala City, the samples were achieved using two or three seeds and the highest number of waves ranged between 12--15. ", "Other countries required additional seeds, but these were able to achieve recruitment waves up to 7--19. ", "RDS is based on the assumption that with a sufficient number of recruitment waves, the composition of the sample becomes independent of the initial seeds ([@CIT0035]) and is said to reach 'equilibrium'. ", "In each site, we used RDSAT v 6.0 to calculate measures of homophily, the maximum number of waves needed to reach equilibrium, and the equilibrium proportions for three key outcomes (condom plus water-based lubricant use, multiple partnerships, and sex under the influence of alcohol/drugs). ", "In all sites, the maximum number of waves and the average number of waves surpassed the estimated number of waves required to achieve equilibrium. ", "Diagnostic measures suggested that the samples did not demonstrate a high level of homophily (the principle that people associate and recruit people who are similar to themselves ([@CIT0038]).", "\n\nEthical considerations {#S0002-S20004}\n----------------------\n\nEthical approval was granted by PSI\\'s Research Ethics Board (REB) in Washington, DC. ", "The study was also submitted to and approved by the Ministry of Public Health in Belize, El Salvador, Guatemala, and Nicaragua, and by the local ethics committee in Panama and Costa Rica; HIV and AIDS National Program in Panama; and the University of Medical Science in Costa Rica.", "\n\nTo ensure protection of subjects participating in the study, no printed information was given unless requested. ", "Also, references to sex or MSM activities were not included in the RDS vouchers. ", "Verbal informed consent was obtained for each participant by interviewers prior to conducting the interview, with the exception of Costa Rica, where the local IRB required written informed consent. ", "The interview took place at the study site or at a location indicated by the study participant.", "\n\nMeasure of interest {#S0002-S20005}\n-------------------\n\nFour measures of violence were collected as part of this study. ", "These were defined as:Psychological violence: having felt threatened, in fear or put in danger by somebody in the past 12 months;Verbal violence: having been yelled at, insulted, humiliated, or made felt inadequate by somebody in the past 12 months;Physical violence: having been slapped, punched, hit, or harmed physically by somebody in the past 12 months; andSexual violence: having been forced or coerced to have sexual relations against their will in the past 12 months.", "\n\nThis study examines the association between violence and: 1) HIV risk behaviors relevant to the study populations; 2) protective behaviors; and 3) reported STIs. ", "These outcomes are defined as:Transactional sex: reporting partners with whom the respondent received payment for sex in the past 30 days.", "Sex under the influence of drugs or alcohol: reporting sex under the influence of alcohol or drugs with any type of partner in the past 30 days.", "Multiple partners: reporting more than one sex partner in the past 30 days.", "Condom plus lubricant use: reporting joint use of a condom and lubricant at the last sexual encounter.", "Reported STI diagnosis or symptoms: reporting abnormal or excessive genital discharge, reporting an ulcer, sore, pustule, or excessive genital itching; and/or having an STI diagnosis in the past 12 months.", "\n\nAnalysis {#S0003}\n========\n\nWeighted univariate point estimates are presented for each city, and unweighted estimates are presented for all cities combined (under the regional column in [Table 2](#T0002){ref-type=\"table\"}). ", "Individualized RDS estimator weights for each outcome variable were calculated using RDSAT v 6.0 software and exported to STATA version 12.0. ", "Individualized weights are calculated using the respondent\\'s network size and composition using the dual component estimate. ", "The RDS methodology and accompanying software was designed for point estimation but does not lend itself to multivariate analysis ([@CIT0039], [@CIT0040]). ", "The unweighted multivariate findings thus cannot be generalized beyond the population under study; however, they still provide important insights regarding the relationships between violence and HIV risk behaviors that can inform program interventions and future research.", "\n\n###### \n\nWeighted univariate distributions of violence, risk behaviors, condom and lubricant use, and reported STIs among MSM in Central American Cities\n\n Guatemala El Salvador Nicaragua Costa Rica Panama Regional (unweighted) \n ---------------------------------------------------------- ----------- ------------- ----------- ------------ -------- ----------------------- ------- ------- ------- -------\n N 464 300 428 294 471 289 733 518 317 3,814\n Experienced psychological violence in the past 12 months 35.57 20.93 27.53 23.39 28.90 10.06 20.00 10.74 12.17 22.26\n Experienced verbal violence in the past 12 months 44.87 28.13 32.48 17.65 39.67 10.20 28.68 7.64 6.12 26.19\n Experienced physical violence in the past 12 months 25.04 12.60 16.00 8.39 18.30 3.93 14.82 4.57 6.39 13.43\n Experienced sexual violence in the past 12 months 5.38 6.87 6.50 4.06 7.35 1.96 2.11 4.03 4.20 5.11\n Transactional sex in the past 30 days 40.33 12.89 31.83 18.03 19.77 23.26 35.81 17.71 17.30 27.03\n More than one partner in the past 30 days 76.27 59.95 71.85 76.17 54.87 80.00 70.94 56.22 77.79 69.46\n Sex under influence of drugs or alcohol 44.50 39.11 36.85 36.39 25.37 34.69 45.54 27.77 56.99 40.59\n Condom and lubricant use at last sex 60.35 58.07 35.15 37.75 39.03 38.27 44.94 62.96 49.05 48.08\n Had an STI or symptoms in the past 12 months 17.48 15.24 11.33 13.44 6.01 5.22 7.54 12.94 34.55 14.03\n\n\\*Calculated for an analytical sample with no missing values on all covariates.", "\n\nLogistic regression analysis was used to determine whether there are associations between the five outcome variables and violence, after adjusting for other covariates. ", "Covariates were determined on a review of the literature and availability of data measured as part of the study, and include: 1) socio-demographic variables, such as age, marital status, having one or more children, socio-economic status (SES), educational attainment, ethnicity, and city of residence and 2) other variables measuring social vulnerability, including self-identification (whether the respondent self-identifies as heterosexual, homosexual, bisexual, or transgender) and housing insecurity (the number of times within the past 12 months that the respondent has changed residences) ([@CIT0007], [@CIT0012], [@CIT0032], [@CIT0033], [@CIT0041], [@CIT0042]). [", "Table 3](#T0003){ref-type=\"table\"} presents the unweighted distribution of these covariates by city. ", "Measures of verbal and psychological violence were combined to form a single variable because of their high correlation and conceptual overlap. ", "Measures of sexual and physical violence were combined, as the distribution of sexual violence was too low to be included in multivariate model. ", "Associations are presented as odds ratios and with their respective confidence intervals.", "\n\n###### \n\nSocio-demographic characteristics among MSM in Central American cities\n\n Guatemala El Salvador Nicaragua Costa Rica Panama Regional \n ----------------------------------------------- ----------- ------------- ----------- ------------ -------- ---------- ------- ------- ------- -------\n N 464 300 428 294 471 289 733 518 317 3,814\n Self-identification \n  Heterosexual 4.53 5.33 7.24 22.79 2.34 6.23 13.23 4.25 2.21 7.60\n  Bisexual 51.08 46.00 34.58 30.61 24.63 41.18 50.20 23.36 15.14 36.31\n  Homosexual 38.36 43.67 45.79 30.27 49.04 36.33 34.38 65.06 69.09 45.57\n  Transvestite 6.03 5.00 12.38 16.33 23.99 16.26 2.18 7.34 13.56 10.50\n Age category \n  18--24 49.35 67.67 67.29 65.99 77.92 66.78 50.48 56.76 34.38 58.91\n  25--29 19.18 18.33 18.22 15.65 13.59 21.45 24.69 22.20 31.86 20.74\n  30--34 15.30 6.67 10.05 9.86 6.16 9.34 14.60 11.39 20.50 11.80\n  35 and higher 16.16 7.33 4.44 8.50 2.34 2.42 10.23 9.65 13.25 8.55\n Marital status \n  Single 79.74 87.67 86.68 89.12 83.23 79.24 84.45 77.41 71.61 82.17\n  Married 11.85 6.33 12.38 9.18 15.71 18.34 11.05 21.24 26.81 14.60\n  Separated/divorced/widowed 8.41 6.00 0.93 1.70 1.06 2.42 4.50 1.35 1.58 3.22\n Educational level \n  Primary or less 22.63 7.67 7.01 11.56 7.01 13.15 25.10 1.74 3.79 12.27\n  Secondary 30.39 15.00 24.30 24.49 71.13 76.12 57.71 70.85 64.67 50.13\n  Higher 46.98 77.33 68.69 63.95 21.87 10.73 17.19 27.41 31.55 37.60\n Ethnicity \n  Black 2.16 0.33 0.47 4.76 0.85 1.38 2.18 22.39 40.69 7.76\n  Indigenous 21.55 35.00 0.23 3.06 1.06 1.04 1.23 5.60 7.89 7.50\n  Ladino 74.78 64.00 92.99 87.76 96.18 91.35 28.51 46.53 41.64 65.39\n  White 1.51 0.67 6.31 4.42 1.91 6.23 68.08 25.48 9.78 19.35\n Housing security \n  Changed residences 2+ times in the past year 36.64 32.00 23.83 13.61 26.54 17.99 45.70 32.43 12.62 29.57\n Socio-economic status \n  Low 50.86 26.33 55.14 67.01 63.91 82.35 54.16 62.36 60.88 57.68\n  Middle 28.23 36.00 30.61 26.19 28.87 14.53 28.10 27.61 31.86 28.19\n  High 20.91 37.67 14.25 6.80 7.22 3.11 17.74 10.04 7.26 14.13\n\n\\*Unweighted univariate values are calculated for an analytical sample with no missing values on all covariates.", "\n\nMany of the HIV risk behaviors that we used as dependent variables in this analysis may be co-occurring. ", "To account for this, a second set of models for each outcome was created in which the potentially co-occurring risk behaviors under study are included as independent variables (along with the original set of covariates). ", "These are presented in column (II) under each outcome variable in [Table 4](#T0004){ref-type=\"table\"}. ", "A similar analysis was used elsewhere ([@CIT0042]) when examining co-occurring psychosocial health conditions as independent correlates of each other in multivariable models. ", "This second set of statistical models allows us to determine whether there is a relationship between violence and each risk behavior, after accounting for the effects of other co-occurring risk behaviors. ", "For the models associated with multiple partners and transactional sex, a high correlation and insufficient sample size in all cells required omission of the corresponding variable from the model as an independent variable (i.e. multiple partnerships were excluded as an independent variable in the transactional sex model and vice versa).", "\n\n###### \n\nMultivariate results of experience of violence on HIV risk behaviors, condom and lubricant use, and STI symptoms among MSM and transgender women in nine cities in Central America\n\n -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n Transactional sex in the past 30 days Multiple partners in the past 30 days Sex under the influence of alcohol/drugs in the past 30 days Condom+lubricant use at last sex STI symptoms or diagnosis in the past 12 months \n -------------------------------------------------------------- ---------------------------------------------- ----------------------------------------------- -------------------------------------------------------------- ----------------------------------------------- ------------------------------------------------- ---------------------------------------------- ---------------------------------------------- ---------------------------------------------- ---------------------------------------------- ----------------------------------------------\n (n=3,829)\\ (n=3,829)\\ (n=3,829)\\ (n=3,829)\\ (n=3,829)\\ (n=3,829)\\ (n=3,784)\\ (n=3,783)\\ (n=3,829)\\ (n=3,829)\\\n R^2^=0.1144\\ R^2^=0.1379\\ R^2^=0.075\\ R^2^=0.1413\\ R^2^=0.052\\ R^2^=0.120\\ R^2^=0.061\\ R^2^=0.065\\ R^2^=0.088\\ R^2^=0.094\\\n H-L p=0.0935 H-L p=0.1504 H-L p=0.3392 H-L p=0.7543 H-L p=0.099 H-L p=0.184 H-L p=0.269 H-L p=0.310 H-L p=0.301 H-L p=0.361\n\n Psychological/verbal violence 1.112\\ 1.056\\ 1.120\\ 1.030\\ 1.359[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.349[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.017\\ 1.016\\ 1.797[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.742[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\\n \\[0.935, 1.345\\] \\[0.878, 1.271\\] \\[0.947, 1.325\\] \\[0.863, 1.229\\] \\[1.164, 1.586\\] \\[1.147, 1.587\\] \\[0.871, 1.187\\] \\[0.869, 1.187\\] \\[1.448, 2.230\\] \\[1.403, 2.165\\]\n\n Physical/sexual violence 1.761[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.643[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.368[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 1.234\\ 1.509[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.370[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 0.865\\ 0.838\\ 1.724[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.639[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\\n \\[1.421, 2.183\\] \\[1.320, 2.045\\] \\[1.092, 1.713\\] \\[0.974, 1.563\\] \\[1.242, 1.833\\] \\[1.116, 1.682\\] \\[0.710, 1.056\\] \\[0.686, 1.024\\] \\[1.343, 2.213\\] \\[1.274, 2.110\\]\n\n Self-identification (homosexual Ref.) ", " \n\n  Heterosexual 1.059\\ 0.953\\ 1.443[\\*](#TF0001){ref-type=\"table-fn\"}\\ 1.285[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 1.523[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 1.414[\\*](#TF0001){ref-type=\"table-fn\"}\\ 0.653[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 0.649[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 0.879\\ 0.843\\\n \\[0.762, 1.470\\] \\[0.682, 1.332\\] \\[1.065, 1.956\\] \\[0.936, 1.764\\] \\[1.154, 2.010\\] \\[1.058, 1.890\\] \\[0.492, 0.868\\] \\[0.488, 0.864\\] \\[0.580, 1.331\\] \\[0.556, 1.279\\]\n\n  Bisexual 1.053\\ 0.977\\ 1.992[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.898[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.381[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 1.176\\ 0.734[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 0.729[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 0.887\\ 0.846\\\n \\[0.861, 1.288\\] \\[0.796, 1.200\\] \\[1.669, 2.377\\] \\[1.578, 2.282\\] \\[1.171, 1.628\\] \\[0.988, 1.400\\] \\[0.623, 0.865\\] \\[0.618, 0.861\\] \\[0.700, 1.127\\] \\[0.664, 1.078\\]\n\n  Transgender 3.940[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 3.769[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.789[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.667[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 1.471[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\ 1.141\\ 1.331[\\*](#TF0001){ref-type=\"table-fn\"}\\ 1.222\\ 0.655[\\*](#TF0001){ref-type=\"table-fn\"}\\ 0.613[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\\n \\[3.066, 5.113\\] \\[2.891, 4.915\\] \\[1.372, 2.332\\] \\[1.265, 2.198\\] \\[1.159, 1.866\\] \\[0.886, 1.468\\] \\[1.051, 1.686\\] \\[0.961, 1.555\\] \\[0.461, 0.931\\] \\[0.428, 0.877\\]\n\n Transactional sex in the past 30 days *[\\*](#TF0001){ref-type=\"table-fn\"} excluded* 1.648[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.447[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.099\\\n \\[1.389, 1.956\\] \\[1.217, 1.721\\] \\[0.863, 1.400\\]\n\n Multiple partners in the past 30 days *[\\*](#TF0001){ref-type=\"table-fn\"} excluded* 3.799[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 1.039\\ 1.198\\\n \\[3.157, 4.571\\] \\[0.880, 1.227\\] \\[0.930, 1.543\\]\n\n Sex under the influence of alcohol/drugs in the past 30 days 2.313[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 4.419[\\*\\*\\*](#TF0003){ref-type=\"table-fn\"}\\ 0.888\\ 1.389[\\*\\*](#TF0002){ref-type=\"table-fn\"}\\\n \\[1.959, 2.731\\] \\[3.704, 5.272\\] \\[0.766, 1.029\\] \\[1.128, 1.711\\]\n -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------\n\nAll logistic regression models control for the following variables: age, marital status, having one or more children, socio-economic status (SES), educational attainment, ethnicity, city of residence, and housing insecurity.", "\n\nColumn (I) includes only violence, sexual identity, and the control variables listed above. ", "Column (II) includes these and other relevant sexual risk behaviors.", "\n\np\\<0.05\n\np\\<0.01;\n\np\\<0.001.", "\n\nResults {#S0004}\n=======\n\nUnivariate {#S0004-S20001}\n----------\n\nThe experience of violence varied greatly by type of violence and by city under study. ", "MSM in Guatemala City reported the highest level of psychological violence (35.6%) and verbal violence (44.9%), while the cities of Panamá and Colon reported the lowest percentages of these types of violence (10.7 and 12.2% experienced psychological and 7.6 and 6.1% experienced verbal violence, respectively).", "\n\nGuatemala City, Managua, and San Salvador presented the highest rates of physical violence (25.0, 18.3 and 16.0%, respectively). ", "Regionally, 5% of men reported sexual violence -- city-level estimates ranged from 7.4% in Managua to 2.0% in Chinandega.", "\n\nThere are also marked differences in the city-level estimates of reported risk behaviors. ", "Regionally, 35.5% of MSM reported having sex under the influence of alcohol and/or drugs, with city-level variations ranging between 57.0% in Colon and 25.4% in Managua. ", "Transactional sex was higher in the Capital cities (40.3% in Guatemala City and 35.8% in San Jose) as compared to the smaller cities (12.8% in Quetzaltenango and 17.3% in Colon). ", "Regionally, 68.5% of MSM reported multiple partnerships in the past 12 months -- more than half of MSM in all cities reported this risk behavior.", "\n\nWith regards to condom plus lubricant use, close to 50% of MSM regionally reported using protection at last sex -- the lowest estimates are found in the two cities studied in El Salvador (San Salvador: 35.2%; Santa Ana: 37.9%) and Nicaragua (Managua: 39.0%; Chinandega: 38.3%). ", "Reported STI symptoms or diagnosis were highest in Colon (34.6%) and lowest in the two cities studied in Nicaragua (Managua: 6.0% and Chinandega: 5.2%).", "\n\nMultivariate {#S0004-S20002}\n------------\n\nThe experience of physical violence (including sexual violence) within the past 12 months was significantly associated with all the HIV risk behaviors under study, after controlling for other factors. ", "MSM who experienced physical violence were more likely to be engaged in transactional sex (OR: 1.76 \\[1.42--2.18\\]), have multiple partners in the past 30 days (OR: 1.37 \\[1.09--1.71\\]); and have engaged in sex under the influence of alcohol or drugs (OR: 1.51 \\[1.24--1.83\\]). ", "The experience of psychological and/or verbal violence within the past 12 months was only found to be significantly associated with having engaged in sex under the influence of alcohol and drugs (OR: 1.36 \\[1.16--1.59\\]), but not with the other risk behaviors examined.", "\n\nAnother factor found to be associated with risk behaviors was the respondent\\'s self-identification. ", "Self-identification corresponds to the respondents reported sexual identity, which may also indirectly capture variables that are unmeasured by this study, including disclosure, internalized stigma, or experiences of social stigma. ", "As compared to individuals who identified as being homosexual, TW were 3.9 times more likely to report engaging in transactional sex. ", "Respondents who were heterosexual, bisexual, or transgender were also more likely to both report multiple partnerships (OR: 1.44 \\[1.07--1.96\\]; 1.99 \\[1.67--2.38\\]; 1.79 \\[1.37--2.33\\], respectively) and more likely to report engaging in sex under the influence of alcohol or drugs (OR: 1.52 \\[1.15--2.01\\]; 1.38 \\[1.17--1.63\\]; 1.47 \\[1.16--1.87\\], respectively) as compared to those identifying as homosexual.", "\n\nIn models controlling for other risk factors, the odds of reporting a risk behavior among those experiencing violence are attenuated (i.e. the odds ratios for violence in each model decrease when controlling for other risk factors), but in most cases the patterns of association remain significant. ", "For example, after controlling for multiple partnerships and engagement in transactional sex, the odds of engaging in sex under the influence of alcohol/drugs for those experiencing physical violence are reduced from OR=1.51 \\[1.24, 1.83\\] to OR=1.37 \\[1.12, 1.68\\]. ", "A similar pattern is seen with all other outcomes, with the exception of the model for multiple partnerships. ", "In this case, the association between physical violence and multiple partnerships in the past 30 days goes from being significant to insignificant when controlling for having sex under the influence of alcohol/drugs. ", "These results demonstrate that there is generally an independent association between violence and risk behaviors after controlling for other measured co-occurring risk behaviors.", "\n\nBoth physical violence and psychological/verbal violence were also associated with reporting STI symptoms or diagnosis within the past 12 months (OR: 1.72 \\[1.34--2.21\\] and 1.80 \\[1.45--2.23\\], respectively). ", "In this case, self-identification as transgender had a protective effect (OR: 0.66 \\[0.46--0.93\\]) on reporting an STI. ", "The association between violence and condom and water-based lubricant use was examined to determine if experience of violence had a negative influence on protective behaviors for HIV prevention. ", "Here, no association was seen between either measure of violence and condom plus water-based lubricant use.", "\n\nDiscussion {#S0005}\n==========\n\nGuatemala and El Salvador present the highest reported levels of violence of all the cities included in this study. ", "This finding is consistent with reports of violent crime among the general population across all countries in the isthmus ([@CIT0014]). ", "A major contribution of this study is the quantification of the experience of violence among MSM and TW in Central American cities, both as an important factor in HIV prevention and access to clinical services ([@CIT0043]--[@CIT0046]), and also from a human rights perspective. ", "Estimates of sexual violence in MSM in Guatemala City are similar to comparable indicators among ever-married women (5.8% vs. 4.0%, respectively) ([@CIT0016]). ", "A similar pattern is observed in San Salvador: experience of sexual violence in the past 12 months in MSM is 6.5% compared to 4.5% among ever-married women ([@CIT0047]). ", "Our lack of data on perpetration makes comparing other indicators of violence between MSM and other populations difficult. ", "However, our estimates of different forms of violence for MSM populations in Central America are similar to those reported for intimate partner battering by MSM in the United States ([@CIT0026]). ", "While this study and others have started documenting the high rates of violence experienced by MSM and TW in Central America ([@CIT0025], [@CIT0048]), the lack of official statistics and absence of political will that protects and recognizes key populations makes changing legislation, providing services, and documenting violence among these groups challenging.", "\n\nThere is a lack of homogeneity in the experience of violence and risk behaviors both across cities and according to sexual identification. ", "As compared to those self-identifying as homosexual, respondents who report as transgender were more likely to have multiple partnerships and more likely to have had sex under the influence of alcohol and/or drugs. ", "Our findings are in line with other studies that demonstrate that TW are more vulnerable, at greater risk, and have poorer health outcomes than MSM ([@CIT0049]). ", "In this study, and elsewhere, TW are several more times likely to engage in transaction sex than MSM ([@CIT0022]).", "\n\nWe found that the experience of physical violence is associated with transactional sex and multiple partners and that both physical and psychological violence are associated with sex under the influence of alcohol or drugs. ", "Though the associations were found to be strong in many cases (odds ranging from 1.5 to 1.7), the mechanism by which violence influences risk behaviors cannot be discerned and it is plausible that, just as violence can be a determinant of risk behavior, the risk behaviors measured in this study may also put individuals in a situation where they may experience violence. ", "For example, this study examines whether the experience of violence influences engagement with multiple sexual partners, whereas other studies have examined engagement in multiple partnerships as a determinant of violence ([@CIT0050]). ", "In the experience of MSM in Central America, where individual risk behaviors take place within a context of homophobia, machismo culture, widespread gender-based violence, and widespread societal violence, it is likely that many risk behaviors and determinants of risk behaviors are co-occurring and reinforcing. ", "In this study, we attempted to control for co-occurring risk factors to isolate the association between risk behaviors and violence. ", "In doing so, we found the effects of violence attenuated, but not eliminated for most outcomes. ", "The relationships between the co-occurring risk factors examined in this study have previously been described as a mutually enhancing syndemic ([@CIT0042]), where epidemics are not only simultaneous but also interact and reinforce causing poorer health outcomes, which are sustained through social conditions. ", "For example, substance abuse, violence, and HIV are described as phenomena that are concurrent and interdependent in how they influence health and well-being ([@CIT0018]). ", "For HIV prevention and care programs operating in this region, these results indicate that interventions cannot be implemented in isolation and must use combination prevention strategies that address violence prevention and care, as well as substance abuse, in order to truly address HIV risk behaviors. ", "Our findings suggest that additional social and behavioral studies that deepen our understanding of the interplay between violence, alcohol abuse, drug use and mental health disorders are necessary to better address HIV risk behaviors in this population. ", "Individual-level interventions may be effective at reducing risk behaviors of MSM and TW; however, these effects are stifled by the absence of higher order structural changes, within social networks, communities, and policies ([@CIT0023]). ", "Political will and legislation that is inclusive of MSM and TW is imperative to give visibility and ensure their full inclusion in the HIV prevention response ([@CIT0004]). ", "Future interventions should work toward ensuring legislation of protective laws and access to services such as physical and mental health care, protection, security, and legal representation.", "\n\nA key outcome under this study was having sex under the influence of alcohol and/or drugs within the past 30 days. ", "This outcome is relevant under the premise that abuse of alcohol and drugs influence the overall use and, more specifically, correct use of condoms during high-risk encounters. ", "The co-occurrence of alcohol abuse and high-risk sex signals other potential conditions and behaviors of poor health such as violence and mental health disorders. ", "Alcohol abuse is also an important factor because it is not only associated with victimization but also with perpetration of violence ([@CIT0051]). ", "In many contexts, studies among women show associations between alcohol abuse and experiencing intimate partner violence ([@CIT0052]). ", "This same pattern is repeated among studies examining interpersonal violence by MSM in the United States ([@CIT0007]). ", "Previous studies that examine the associations between violence, risk behaviors, and HIV have found that depression and violence have a strong association with HIV status that is mediated by risk behaviors, including drug and alcohol abuse ([@CIT0050], [@CIT0053], [@CIT0054]). ", "Similar results are found in research conducted among young, urban MSM ([@CIT0055]), where psychosocial health problems (such as binge drinking, drug use, and interpersonal violence) were found to have additive effects on the odds of HIV positive status and on more proximal sexual risk behaviors, including multiple anal sex partners and unprotected anal sex.", "\n\nAbsent from our findings is a significant association between violence and condom and water-based lubricant use at last sex. ", "The theoretical model framing this study postulates that the experience of violence interferes with condom use and access to health care and health products ([@CIT0046]). ", "We hypothesize an inverse association between the experience of violence and condom plus water-based lubricant use; however, no such association is observed. ", "It is likely that the absence of information regarding the identity of perpetrators of violence (whether an intimate partner or some other person) and whether the perpetrator corresponds to the current sexual partner may inhibit this study from capturing the reduced agency of victims of violence within the context of an abusive relationship.", "\n\nLimitations {#S0006}\n===========\n\nOver the past decade, RDS has become a methodology commonly used to draw samples of hidden populations for which traditional sampling frames do not exist ([@CIT0056]). ", "Recently, studies have indicated that RDS estimates have high variances and likely do not meet all the assumptions underlying the methodology ([@CIT0057], [@CIT0058]). ", "Critics of the methodology rightly call for caution when implementing and interpreting RDS studies as, in some cases, they may be inadequate to meet some of the objectives for which they are used. ", "While caution must be used in interpreting results, RDS is one of the limited methods available to collect data on MSM in Central America, and presents advantages over alternatives with regards to reaching important populations subgroups, ensuring containment of costs and other practical considerations, such as ensuring safety of teams during field work ([@CIT0059]). ", "We attempted to reduce these sources of bias by ensuring that initial seeds were diverse with regards to variables deemed important to recruitment. ", "During analysis, we also verified that all samples achieved the maximum number of waves to reach equilibrium and that homophily within the sample was within a tolerable range.", "\n\nPooled data across all cities were used to conduct multivariate analysis. ", "Previous studies conducted with RDS have pooled data across samples for this purpose, some of which have attempted to control for the clustered nature of the data and dependence of observations ([@CIT0039], [@CIT0060]--[@CIT0067]). ", "The unavailability of MSM population-size estimates for each city under study and the independence of our RDS samples (which are not linked across cities) precluded us from implementing this strategy. ", "By presenting unweighted estimates from the pooled data, we acknowledge that the results, though presented as regional, do not represent regional estimates of MSM in Central America.", "\n\nAnother important limitation of this study is the cross-sectional nature of the data, which does not allow us to establish a temporal order between outcomes and exposure to violence. ", "Even though the recall period for variables measuring violence is 12 months, and the recall period for most associated behaviors is 30 days, we still cannot assume that the reported experience of violence preceded that of the reported risk behaviors. ", "The study used a 30-day recall period for measures of self-reported condom use, substance abuse, and transactional sex to minimize recall bias.", "\n\nResults of this study may be subject to omitted variable bias in the models predicting risk behaviors. ", "There is the potential that key variables that may be associated with the outcomes under study, but also associated with the experience of violence, such as depression or childhood experience of violence, are unmeasured and therefore unaccounted for in our results. ", "Finally, this study lacks information regarding the relationship between respondents and perpetrators. ", "Absence of this information has implications in the interpretation of findings and the operationalization of results in the HIV prevention context as acts of violence perpetrated by intimate partners may require intervention that differs from acts of violence perpetrated by others.", "\n\nConclusion {#S0007}\n==========\n\nVictimization of MSM and TW by different forms of violence is widespread in Central American cities. ", "The experience of violence is shown in this study and in previous research to be independently associated with risk behaviors for HIV infection. ", "Though the association between violence and other factors of risk and vulnerability, such as drug and alcohol abuse, are not fully understood, their catalytic effects on HIV risk behaviors require consideration in HIV prevention and human rights programs that work with these populations. ", "The high prevalence of violence experienced by MSM and TW coupled with a lack of formal structures in Central American countries to report and follow-up cases of violence, forces survivors to remain silent. ", "Our findings provide evidence that can be used to raise awareness and make policy level, structural, and programmatic changes to address these challenges.", "\n\nThe study was funded by the United States Agency for International Development (USAID) through the HIV Combination Prevention Program. ", "Deep appreciation goes to the participants, field supervisors, and interviewers. ", "Special thanks go to Jose Enrique Martínez, Fredy Alvarenga, Paul Callejas, Carlos Palma, and Kattia Lopez. ", "We also thank USAID for their continued support and Giovanni Melendez for his thoughtful review and comments.", "\n\nConflict of interest and funding {#S0008}\n================================\n\nThe authors have not received any funding or benefits from industry or elsewhere to conduct this study.", "\n\nDisclaimer {#S0009}\n==========\n\nThe findings and recommendations of this study are those of the authors and do not necessarily reflect the views of the funder.", "\n\n[^1]: Responsible Editor: Maria Emmelin, Lund University, Sweden.", "\n" ]
{ "pile_set_name": "PubMed Central" }
[ 0.07459031045436859, 0.026358263567090034, 0.000909364374820143, 0.011487798765301704, 0.014066847041249275, 0.0016924451338127255, 0.0035190682392567396, 0.0007880566990934312, 0.0011390064610168338, 0.0006837359396740794, 0.0007288539200089872, 0.0011398011120036244, 0.0006424950552172959, 0.0006578325992450118, 0.0007663037395104766, 0.007777426391839981, 0.21852292120456696, 0.16028322279453278, 0.011389932595193386, 0.008365143090486526, 0.0015555759891867638, 0.0016143934335559607, 0.000683603051584214, 0.008789018727838993, 0.005581756588071585, 0.01110893115401268, 0.0013048714026808739, 0.0006879891734570265, 0.0009846859611570835, 0.00065381865715608, 0.0005969619960524142, 0.0008736514719203115, 0.000544002978131175, 0.0005334474262781441, 0.001602622913196683, 0.0006291703321039677, 0.0021276483312249184, 0.007283975835889578, 0.0010540219955146313, 0.0009090339299291372, 0.0006655236938968301, 0.0007048363331705332, 0.0008463216363452375, 0.0005763653316535056, 0.0006455351831391454, 0.000550621363800019, 0.0007738490239717066, 0.0005669089150615036, 0.0007406569784507155, 0.0006290223100222647, 0.0006137251039035618, 0.0005225121276453137, 0.0011211881646886468, 0.0005539978737942874, 0.0006798218237236142, 0.0005500941188074648, 0.0006173383444547653, 0.0005491982446983457, 0.000546877970919013, 0.0005508993053808808, 0.0005733512225560844, 0.001395062543451786, 0.0005803605308756232, 0.004124553874135017, 0.0006128299282863736, 0.0005481204716488719, 0.0005564382881857455, 0.004147951025515795, 0.0005281427875161171, 0.0005529259797185659, 0.0007201146800071001, 0.00987155083566904, 0.0007973496685735881, 0.009320107288658619, 0.05430639535188675, 0.0031362513545900583, 0.16528086364269257, 0.021441426128149033, 0.0005948101170361042, 0.0006101931794546545, 0.0006503967451862991, 0.0006014204700477421, 0.0005837681819684803, 0.044415734708309174, 0.0005937454989179969, 0.0006513489643111825, 0.0006117206066846848, 0.0006576398736797273, 0.002413302194327116, 0.0005650626262649894, 0.10349862277507782, 0.0006525975768454373, 0.0005634564440697432, 0.0005898170056752861, 0.0006231017177924514, 0.0005727018578909338, 0.0006344425491988659, 0.023872675374150276, 0.07013831287622452, 0.008583581075072289, 0.012505794875323772, 0.014408985152840614, 0.0007575408671982586, 0.0008304576040245593, 0.0006877436535432935, 0.028419682756066322, 0.0006017146515659988, 0.0075580887496471405, 0.0068955752067267895, 0.0006557894521392882, 0.024312341585755348, 0.0006433826056309044, 0.001156151294708252, 0.044969044625759125, 0.0015057564014568925, 0.0006905141635797918, 0.0007278149132616818, 0.19178661704063416, 0.055330947041511536, 0.0006257002241909504, 0.003169821575284004, 0.0005624565528705716, 0.0032669168431311846, 0.0006097479490563273, 0.0008048103773035109, 0.011837558820843697, 0.0026340605691075325, 0.011998540721833706, 0.0007819392485544086, 0.0012550780083984137, 0.0005774865276180208, 0.003231327747926116, 0.0035730444360524416, 0.0007328964420594275, 0.0005681197508238256, 0.0005738110048696399, 0.006385582499206066, 0.12684129178524017, 0.0007243917789310217, 0.027099967002868652, 0.005164253059774637, 0.0005920708063058555, 0.0007523118983954191, 0.0013132616877555847, 0.0005821429658681154, 0.0005776376347057521, 0.0005661596660502255, 0.0009024621685966849, 0.0006726325955241919, 0.000904998043552041, 0.0005606498452834785, 0.0006338998209685087, 0.0006204376695677638, 0.017563605681061745, 0.007359082344919443, 0.037991613149642944, 0.0017126559978350997, 0.0012356261722743511, 0.0005613559624180198, 0.0008660152088850737, 0.03740686923265457, 0.051770731806755066, 0.0015426625031977892, 0.006118242163211107, 0.0009475387050770223, 0.0006482027238234878, 0.0005722282221540809, 0.0005971131031401455, 0.0005637204740196466, 0.0005399688961915672, 0.0005772441509179771, 0.0005617171991616488, 0.0005481606931425631, 0.0006082101026549935, 0.0005345881800167263, 0.0005747984978370368, 0.0005928150494582951, 0.00876467302441597, 0.0005610114894807339, 0.0005508732865564525, 0.0005736221210099757, 0.0007329662912525237, 0.0014809105778113008, 0.0008723891223780811, 0.0006717629148624837, 0.0005625125486403704, 0.0005590039654634893, 0.000651773065328598, 0.0004963452811352909, 0.000600419647525996, 0.0005103077855892479, 0.0010682131396606565, 0.0009179376647807658, 0.000619419093709439, 0.0019954426679760218 ]
0.010047
195
[ "1. ", "Field of Invention\nThis invention pertains to a jewelry assembly formed of a housing with a cavity and one or more replaceable decorative inserts sized and shaped to fit snuggly into the housing. ", "Magnetic elements are provided to keep and hold the inserts in the cavity.", "\n2. ", "Description of the Prior Art\nMany different kinds of jewelry are formed of two components: a housing and an insert mounted in the housing. ", "The housing is usually made of a precious metal, such as an alloy of gold, silver, platinum, etc., ", "and the insert may be made of many different materials, including metal alloys, plastics, ceramics or even precious or semi-precious stone. ", "Both components have decorative designs, sometimes having very complex shapes. ", "Conventionally the insert is permanently attached to the housing and the housing is sized and shaped to be worn either directly on a person's body, or attached to clothing.", "\nMany users, however, would find it advantageous if the inserts would be exchangeable between different pieces of jewelry because such an arrangement would give them more flexibility. ", "For example, a jewelry piece with one colored stone would be suitable with one outfit while the same jewelry piece with a different colored stone would be suitable for another outfit.", "\nWhile many attempts have been made to make such multi-piece jewelry, none of these attempts were successful." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.0009391896310262382, 0.0006920650484971702, 0.0006478842697106302, 0.0011855863267555833, 0.000550161290448159, 0.000602351501584053, 0.0005470525939017534, 0.000582125794608146, 0.0007287844782695174, 0.0005342221120372415, 0.0005898963427171111, 0.0006156449671834707 ]
0.000685
12
[ "Q:\n\nSecure UUID v4 generation in PHP - without mt_rand()\n\nI'm looking to generate a UUID (version 4) in PHP however all the methods I've seen use mt_rand() which I want to avoid as it poses security implications if the UUID generated can be guessed.", "\nI have come up with the following:\nfunction uuid_v4()\n{\n return sprintf('%04x%04x-%04x-%04x-%04x-%04x%04x%04x',\n // 32 bits for \"time_low\"\n random_mcrypt(), random_mcrypt(),\n\n // 16 bits for \"time_mid\"\n random_mcrypt(),\n\n // 16 bits for \"time_hi_and_version\",\n // four most significant bits holds version number 4\n random_mcrypt(0x0fff) | 0x4000,\n\n // 16 bits, 8 bits for \"clk_seq_hi_res\",\n // 8 bits for \"clk_seq_low\",\n // two most significant bits holds zero and one for variant DCE1.1\n random_mcrypt(0x3fff) | 0x8000,\n\n // 48 bits for \"node\"\n random_mcrypt(), random_mcrypt(), random_mcrypt()\n );\n}\n\nfunction random_mcrypt($max = 0xffff)\n{\n $int = current(unpack('S', mcrypt_create_iv(2, MCRYPT_DEV_URANDOM)));\n $factor = $max / 0xffff;\n return round($int * $factor);\n}\n\nIs this sufficient for my needs? ", "Is there anything I should be aware of?", "\nEDIT: This has been marked as duplicate, it isn't cuz in my question I say that other answers (including the one that his was marked a duplicate of) use mt_rand() which I didn't want to use for security reasons.", "\nEDIT 2: To be clear, this is not a question on how to you generate a v4 UUID but does my method improve on the security of an implementation of methods using mt_rand() and are there any pitfalls I should know about.", "\n\nA:\n\nWhether it is sufficient for your needs depends on your threat model. ", " Do you have a bunch of kids who want to mess with you, corporate espionage fears, or is the entire Chineese government trying to break your system?", "\nMCRYPT_DEV_URANDOM generates entropy from /dev/urandom. ", " This avoids DOS attacks on /dev/random where you ask for a bunch of UUIDs and deplete the system entropy until the program blocks. ", " However, it also means you have absolutely no guarantee as to how many bits of entropy are actually in your UUID - none whatsoever.", "\nThere have been threat models written which start with the assumption that you ping a server with thoudsands of requests to deplete the entropy of /dev/urandom and then start cracking the urandom key.", "\nIf you truly care about security, there are cryptographic PRNGs which are designed to be secure, like Blum Blum Shub.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0007160593522712588, 0.0009469385258853436, 0.0007270879577845335, 0.0006717495271004736, 0.0006732665933668613, 0.0011516426457092166, 0.11641549319028854, 0.0020915071945637465, 0.022255046293139458, 0.04193124920129776, 0.0018252080772072077, 0.10695164650678635, 0.0019954426679760218 ]
0.02295
13
[ "WHO KNEW… – Maryland Bartending Academy\n\nBefore the 1950’s a screwdriver was only known as a vodka and orange juice. ", "It is said that some American engineers working on oil rigs in the Persian Golf were working long and tedious hours. ", "Seeking reprieve from the stress of working so many hours the engineers would discreetly pour vodka and orange juice into cans. ", "They would then stir their secret alcoholic beverage with a screwdriver.", "\n\nIf you would like to learn how to mix a screwdriver, without using a screwdriver, contact us!", "\n\nIf you have any questions about Bartending Tips & Tricks or wish to register for an upcoming class, please contact the Maryland Bartending Academy by calling 410-787-0020 or visit MarylandBartending.com today!", "\n\nMaryland Bartending Academy is not only Maryland’s oldest bartending school, but we also offer the most comprehensive curriculum around. ", "We will have you ready for your new career in two weeks and then we will help you find bartender jobs around Maryland and DC! ", "We have trained and placed thousands and thousands of bartenders into some of the busiest bars throughout not only Maryland and DC, but also the entire nation." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0031295386143028736, 0.0006190396379679441, 0.0031595551408827305, 0.053928814828395844, 0.0017640808364376426, 0.0006819847039878368, 0.0006726902793161571, 0.0009973641717806458, 0.0005974153755232692 ]
0.007283
9
[ "Recherche\n\nMicromem Technologies Inc. Completes Private Placements\n\nTORONTO AND NEW YORK, Sept. 12, 2012 /CNW/ - Micromem Technologies Inc.\n(the \"Company\") (CNSX: MRM) (OTCBB: MMTIF) announces the completion of\narm's length private placements totalling 728,572 Units (\"Unit\") at a\nsubscription price of CDN$0.14 per Unit for the gross proceeds of CDN\n$102,000. ", "Each Unit is comprised of one Common Share (\"Common Share\")\nand one Common Share Purchase Warrant (\"Warrant\"). ", "Each Warrant may be\nexercised for one Common Share at an exercise price of CDN $0.17 for a\nperiod of one year. ", "The proceeds from the offering will be used for\ngeneral working capital purposes and the shares will be subject to\nresale restrictions.", "\n\nThis press release contains forward-looking statements. ", "Such\nforward-looking statements are subject to a number of risks,\nassumptions and uncertainties that could cause the Company's actual\nresults to differ materially from those projected in such\nforward-looking statements. ", "In particular, factors that could cause\nactual results to differ materially from those in forward looking\nstatements include: our inability to obtain additional financing on\nacceptable terms; risk that our products and services will not gain\nwidespread market acceptance; continued consumer adoption of digital\ntechnology; inability to compete with others who provide comparable\nproducts; the failure of our technology; the infringement of our\ntechnology with proprietary rights of third parties; inability to\nrespond to consumer and technological demands; inability to replace\nsignificant customers; seasonal nature of our business; and other risks\ndetailed in our filings with the Securities and Exchange Commission.", "\nForward-looking statements speak only as of the date made and are not\nguarantees of future performance. ", "We undertake no obligation to\npublicly update or revise any forward-looking statements. ", "When used in\nthis document, the words \"believe,\" \"expect,\" \"anticipate,\" \"estimate,\"\n\"project,\" \"plan,\" \"should,\" \"intend,\" \"may,\" \"will,\" \"would,\"\n\"potential,\" and similar expressions may be used to identify\nforward-looking statements.", "\n\nThe CNSX or any other securities regulatory authority has not reviewed\nand does not accept responsibility for the adequacy or accuracy of this\npress release that has been prepared by management." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0005792649462819099, 0.0006079458398744464, 0.0005385461263358593, 0.0005988506018184125, 0.0005289818509481847, 0.0005996227264404297, 0.0006871393416076899, 0.0005635378183797002, 0.0006778001552447677, 0.0005571127403527498, 0.0006248718709684908 ]
0.000597
11
[ "The present invention relates to a free line switch arrangement for power-and-free trolley conveyors wherein the free line comprises two rails.", "\nConventional power-and-free trolley conveyors comprise a free line rail extending immediately below a power line rail and carriers suspended from the free line rail and each thereby supported at its center portion. ", "Accordingly the power line rail, free line rail and other parts are positioned immediately above the article placed on the carrier, with the resulting likelihood that oil, dust, etc. ", "will fall onto the article. ", "To render the article on the carrier free from deposits such as oil and dust, we have already proposed a power-and-free trolley conveyor comprising a power line rail, a free line rail disposed immediately below the power line rail, another free line rail provided at one side of the free line rail in parallel thereto, and carriers suspended from the free line rails and each thereby supported at its opposite sides (Application for Japanese Utility Model Registration No. ", "172007/80). ", "However, at a branch or confluent junction of free lines of such a trolley conveyor, the two rails of a first free line are joined to the two rails of a second free line, with one of the rails of one free line intersecting one of the rails of the other free line, so that the switch arrangement needed for diverting carriers at the branch or confluent junction generally becomes complex in construction." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.000595868332311511, 0.0006313325720839202, 0.0006481505697593093, 0.001627202844247222, 0.0006154258153401315, 0.0008226351346820593, 0.0006629248382523656 ]
0.000801
7
[ "World Athletics Championships on the BBC Venue: London Stadium Dates: 4-13 August Coverage: Live across BBC One and Two, BBC Radio 5 live, BBC Radio 5 live sports extra, the BBC Sport website and app. ", "Click for times\n\nBotswana will hold a national holiday in honour of Isaac Makwala if he wins 200m gold at the World Championships.", "\n\nMakwala, whose exploits in London have been a major talking point this week, races in the final later on Thursday.", "\n\nOn Tuesday he was barred from the 400m final, as officials tried to halt a \"very virulent\" norovirus outbreak.", "\n\nBut he returned and progressed from an individual 200m time trial on Wednesday - he was quarantined for Monday's heats - and celebrated by doing press-ups.", "\n\nThe 30-year-old, who said he is \"still running with a broken heart\" will be going up against South Africa's Wayde van Niekerk, who on Tuesday dominated the 400m race for which Makwala said he had been training.", "\n\nBotswana's Sports Minister Thapelo Olopeng told BBC World Service's Sport Today the country would also pay Makwala the $10,000 (£7,500) he would have received from the government had he won 400m gold.", "\n\n\"The president has set aside a certain day for him,\" said Olopeng. \"", "It will be a public holiday for people to come and meet Makwala and all over the country there will be celebrations with music and dancing. ", "The man has lifted the name of our country higher and higher, and he deserves this welcome as our hero.\"", "\n\nThe minister said that the country had submitted a further complaint about the handling of the issue by the International Association of Athletics Federations (IAAF), the world governing body.", "\n\n\"The way he performed yesterday [in the 200m qualifiers] he showed no signs of ailment and I don't understand why the IAAF has continued with the same decision,\" Olopeng said.", "\n\n\"They should call for a re-run or give him the same opportunity as they did in the 200m [a time-trial run on his own]. ", "They have not responded and if they don't then we will take the matter forward, we have a legal team waiting to give us advice on how far we can take it.", "\n\n\"What happened to our athlete has created a lot of displeasure in the country and we are very unhappy. ", "To me it's a great disappointment.\"", "\n\nMakwala's 'heart is still broken' after missing 400m final\n\nThe IAAF - criticised for its decision to stop Makwala running in the 400m final - allowed him another chance to compete in the 200m after receiving a written request from the Botswanan federation.", "\n\nMakwala, who qualified second fastest behind the United States' Isiah Young, has the quickest season's best and personal best of the nine-man field.", "\n\nVan Niekerk, running his fifth race in as many days, only made it through as a fastest loser.", "\n\nMeanwhile, the number of people associated with the World Championships who have reported illness has risen from 30 to 40, Public Health England announced.", "\n\nThe body said that three cases have been confirmed as norovirus by laboratory testing.", "\n\nThe IAAF defended its actions and said it was under instruction to quarantine athletes who showed symptoms of the virus.", "\n\nIt acknowledged Makwala's absence was \"a sad case\" but said its medical staff examined the athlete and notes taken by a doctor showed he had been vomiting over an 18-hour period." ]
{ "pile_set_name": "OpenWebText2" }
[ 0.0005864704726263881, 0.0006528744124807417, 0.000718147843144834, 0.0007210575276985765, 0.0007049821433611214, 0.0015598104801028967, 0.0007271243957802653, 0.0006279910448938608, 0.0007600670796819031, 0.0005469532334245741, 0.0005487391026690602, 0.0006611815188080072, 0.0007207312737591565, 0.0006046079797670245, 0.0005411503370851278, 0.0005634988774545491, 0.0007398675661534071, 0.0008167438791133463, 0.06770196557044983, 0.0006637615151703358, 0.0005795410834252834, 0.0006714179180562496, 0.0007310061482712626 ]
0.003615
23
[ "// SPDX-License-Identifier: GPL-2.0-only\n/*\n * hdac-ext-controller.c - HD-audio extended controller functions.", "\n *\n * Copyright (C) 2014-2015 Intel Corp\n * Author: Jeeja KP <[email protected]>\n * ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n *\n * ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n */\n\n#include <linux/delay.h>\n#include <linux/slab.h>\n#include <sound/hda_register.h>\n#include <sound/hdaudio_ext.h>\n\n/*\n * maximum HDAC capablities we should parse to avoid endless looping:\n * currently we have 4 extended caps, so this is future proof for now.", "\n * extend when this limit is seen meeting in real HW\n */\n#define HDAC_MAX_CAPS 10\n\n/*\n * processing pipe helpers - these helpers are useful for dealing with HDA\n * new capability of processing pipelines\n */\n\n/**\n * snd_hdac_ext_bus_ppcap_enable - enable/disable processing pipe capability\n * @bus: the pointer to HDAC bus object\n * @enable: flag to turn on/off the capability\n */\nvoid snd_hdac_ext_bus_ppcap_enable(struct hdac_bus *bus, bool enable)\n{\n\n\tif (!", "bus->ppcap) {\n\t\tdev_err(bus->dev, \"Address of PP capability is NULL\");\n\t\treturn;\n\t}\n\n\tif (enable)\n\t\tsnd_hdac_updatel(bus->ppcap, AZX_REG_PP_PPCTL,\n\t\t\t\t AZX_PPCTL_GPROCEN, AZX_PPCTL_GPROCEN);\n\telse\n\t\tsnd_hdac_updatel(bus->ppcap, AZX_REG_PP_PPCTL,\n\t\t\t\t AZX_PPCTL_GPROCEN, 0);\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_ppcap_enable);\n\n/**\n * snd_hdac_ext_bus_ppcap_int_enable - ppcap interrupt enable/disable\n * @bus: the pointer to HDAC bus object\n * @enable: flag to enable/disable interrupt\n */\nvoid snd_hdac_ext_bus_ppcap_int_enable(struct hdac_bus *bus, bool enable)\n{\n\n\tif (!", "bus->ppcap) {\n\t\tdev_err(bus->dev, \"Address of PP capability is NULL\\n\");\n\t\treturn;\n\t}\n\n\tif (enable)\n\t\tsnd_hdac_updatel(bus->ppcap, AZX_REG_PP_PPCTL,\n\t\t\t\t AZX_PPCTL_PIE, AZX_PPCTL_PIE);\n\telse\n\t\tsnd_hdac_updatel(bus->ppcap, AZX_REG_PP_PPCTL,\n\t\t\t\t AZX_PPCTL_PIE, 0);\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_ppcap_int_enable);\n\n/*\n * Multilink helpers - these helpers are useful for dealing with HDA\n * new multilink capability\n */\n\n/**\n * snd_hdac_ext_bus_get_ml_capabilities - get multilink capability\n * @bus: the pointer to HDAC bus object\n *\n * This will parse all links and read the mlink capabilities and add them\n * in hlink_list of extended hdac bus\n * Note: this will be freed on bus exit by driver\n */\nint snd_hdac_ext_bus_get_ml_capabilities(struct hdac_bus *bus)\n{\n\tint idx;\n\tu32 link_count;\n\tstruct hdac_ext_link *hlink;\n\n\tlink_count = readl(bus->mlcap + AZX_REG_ML_MLCD) + 1;\n\n\tdev_dbg(bus->dev, \"In %s Link count: %d\\n\", __func__, link_count);\n\n\tfor (idx = 0; idx < link_count; idx++) {\n\t\thlink = kzalloc(sizeof(*hlink), GFP_KERNEL);\n\t\tif (!", "hlink)\n\t\t\treturn -ENOMEM;\n\t\thlink->index = idx;\n\t\thlink->bus = bus;\n\t\thlink->ml_addr = bus->mlcap + AZX_ML_BASE +\n\t\t\t\t\t(AZX_ML_INTERVAL * idx);\n\t\thlink->lcaps = readl(hlink->ml_addr + AZX_REG_ML_LCAP);\n\t\thlink->lsdiid = readw(hlink->ml_addr + AZX_REG_ML_LSDIID);\n\n\t\t/* since link in On, update the ref */\n\t\thlink->ref_count = 1;\n\n\t\tlist_add_tail(&hlink->list, &bus->hlink_list);\n\t}\n\n\treturn 0;\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_get_ml_capabilities);\n\n/**\n * snd_hdac_link_free_all- free hdac extended link objects\n *\n * @bus: the pointer to HDAC bus object\n */\n\nvoid snd_hdac_link_free_all(struct hdac_bus *bus)\n{\n\tstruct hdac_ext_link *l;\n\n\twhile (!", "list_empty(&bus->hlink_list)) {\n\t\tl = list_first_entry(&bus->hlink_list, struct hdac_ext_link, list);\n\t\tlist_del(&l->list);\n\t\tkfree(l);\n\t}\n}\nEXPORT_SYMBOL_GPL(snd_hdac_link_free_all);\n\n/**\n * snd_hdac_ext_bus_get_link_index - get link based on codec name\n * @bus: the pointer to HDAC bus object\n * @codec_name: codec name\n */\nstruct hdac_ext_link *snd_hdac_ext_bus_get_link(struct hdac_bus *bus,\n\t\t\t\t\t\t const char *codec_name)\n{\n\tint i;\n\tstruct hdac_ext_link *hlink = NULL;\n\tint bus_idx, addr;\n\n\tif (sscanf(codec_name, \"ehdaudio%dD%d\", &bus_idx, &addr) !", "= 2)\n\t\treturn NULL;\n\tif (bus->idx !", "= bus_idx)\n\t\treturn NULL;\n\n\tlist_for_each_entry(hlink, &bus->hlink_list, list) {\n\t\tfor (i = 0; i < HDA_MAX_CODECS; i++) {\n\t\t\tif (hlink->lsdiid & (0x1 << addr))\n\t\t\t\treturn hlink;\n\t\t}\n\t}\n\n\treturn NULL;\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_get_link);\n\nstatic int check_hdac_link_power_active(struct hdac_ext_link *link, bool enable)\n{\n\tint timeout;\n\tu32 val;\n\tint mask = (1 << AZX_MLCTL_CPA_SHIFT);\n\n\tudelay(3);\n\ttimeout = 150;\n\n\tdo {\n\t\tval = readl(link->ml_addr + AZX_REG_ML_LCTL);\n\t\tif (enable) {\n\t\t\tif (((val & mask) >> AZX_MLCTL_CPA_SHIFT))\n\t\t\t\treturn 0;\n\t\t} else {\n\t\t\tif (!((", "val & mask) >> AZX_MLCTL_CPA_SHIFT))\n\t\t\t\treturn 0;\n\t\t}\n\t\tudelay(3);\n\t} while (--timeout);\n\n\treturn -EIO;\n}\n\n/**\n * snd_hdac_ext_bus_link_power_up -power up hda link\n * @link: HD-audio extended link\n */\nint snd_hdac_ext_bus_link_power_up(struct hdac_ext_link *link)\n{\n\tsnd_hdac_updatel(link->ml_addr, AZX_REG_ML_LCTL,\n\t\t\t AZX_MLCTL_SPA, AZX_MLCTL_SPA);\n\n\treturn check_hdac_link_power_active(link, true);\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_link_power_up);\n\n/**\n * snd_hdac_ext_bus_link_power_down -power down hda link\n * @link: HD-audio extended link\n */\nint snd_hdac_ext_bus_link_power_down(struct hdac_ext_link *link)\n{\n\tsnd_hdac_updatel(link->ml_addr, AZX_REG_ML_LCTL, AZX_MLCTL_SPA, 0);\n\n\treturn check_hdac_link_power_active(link, false);\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_link_power_down);\n\n/**\n * snd_hdac_ext_bus_link_power_up_all -power up all hda link\n * @bus: the pointer to HDAC bus object\n */\nint snd_hdac_ext_bus_link_power_up_all(struct hdac_bus *bus)\n{\n\tstruct hdac_ext_link *hlink = NULL;\n\tint ret;\n\n\tlist_for_each_entry(hlink, &bus->hlink_list, list) {\n\t\tsnd_hdac_updatel(hlink->ml_addr, AZX_REG_ML_LCTL,\n\t\t\t\t AZX_MLCTL_SPA, AZX_MLCTL_SPA);\n\t\tret = check_hdac_link_power_active(hlink, true);\n\t\tif (ret < 0)\n\t\t\treturn ret;\n\t}\n\n\treturn 0;\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_link_power_up_all);\n\n/**\n * snd_hdac_ext_bus_link_power_down_all -power down all hda link\n * @bus: the pointer to HDAC bus object\n */\nint snd_hdac_ext_bus_link_power_down_all(struct hdac_bus *bus)\n{\n\tstruct hdac_ext_link *hlink = NULL;\n\tint ret;\n\n\tlist_for_each_entry(hlink, &bus->hlink_list, list) {\n\t\tsnd_hdac_updatel(hlink->ml_addr, AZX_REG_ML_LCTL,\n\t\t\t\t AZX_MLCTL_SPA, 0);\n\t\tret = check_hdac_link_power_active(hlink, false);\n\t\tif (ret < 0)\n\t\t\treturn ret;\n\t}\n\n\treturn 0;\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_link_power_down_all);\n\nint snd_hdac_ext_bus_link_get(struct hdac_bus *bus,\n\t\t\t\tstruct hdac_ext_link *link)\n{\n\tunsigned long codec_mask;\n\tint ret = 0;\n\n\tmutex_lock(&bus->lock);\n\n\t/*\n\t * if we move from 0 to 1, count will be 1 so power up this link\n\t * as well, also check the dma status and trigger that\n\t */\n\tif (++link->ref_count == 1) {\n\t\tif (!", "bus->cmd_dma_state) {\n\t\t\tsnd_hdac_bus_init_cmd_io(bus);\n\t\t\tbus->cmd_dma_state = true;\n\t\t}\n\n\t\tret = snd_hdac_ext_bus_link_power_up(link);\n\n\t\t/*\n\t\t * clear the register to invalidate all the output streams\n\t\t */\n\t\tsnd_hdac_updatew(link->ml_addr, AZX_REG_ML_LOSIDV,\n\t\t\t\t ML_LOSIDV_STREAM_MASK, 0);\n\t\t/*\n\t\t * wait for 521usec for codec to report status\n\t\t * HDA spec section 4.3 - Codec Discovery\n\t\t */\n\t\tudelay(521);\n\t\tcodec_mask = snd_hdac_chip_readw(bus, STATESTS);\n\t\tdev_dbg(bus->dev, \"codec_mask = 0x%lx\\n\", codec_mask);\n\t\tsnd_hdac_chip_writew(bus, STATESTS, codec_mask);\n\t\tif (!", "bus->codec_mask)\n\t\t\tbus->codec_mask = codec_mask;\n\t}\n\n\tmutex_unlock(&bus->lock);\n\treturn ret;\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_link_get);\n\nint snd_hdac_ext_bus_link_put(struct hdac_bus *bus,\n\t\t\t\tstruct hdac_ext_link *link)\n{\n\tint ret = 0;\n\tstruct hdac_ext_link *hlink;\n\tbool link_up = false;\n\n\tmutex_lock(&bus->lock);\n\n\t/*\n\t * if we move from 1 to 0, count will be 0\n\t * so power down this link as well\n\t */\n\tif (--link->ref_count == 0) {\n\t\tret = snd_hdac_ext_bus_link_power_down(link);\n\n\t\t/*\n\t\t * now check if all links are off, if so turn off\n\t\t * cmd dma as well\n\t\t */\n\t\tlist_for_each_entry(hlink, &bus->hlink_list, list) {\n\t\t\tif (hlink->ref_count) {\n\t\t\t\tlink_up = true;\n\t\t\t\tbreak;\n\t\t\t}\n\t\t}\n\n\t\tif (!", "link_up) {\n\t\t\tsnd_hdac_bus_stop_cmd_io(bus);\n\t\t\tbus->cmd_dma_state = false;\n\t\t}\n\t}\n\n\tmutex_unlock(&bus->lock);\n\treturn ret;\n}\nEXPORT_SYMBOL_GPL(snd_hdac_ext_bus_link_put);\n" ]
{ "pile_set_name": "Github" }
[ 0.0006637887563556433, 0.0017660468583926558, 0.0013857365120202303, 0.0022819768637418747, 0.001586444559507072, 0.0016007936792448163, 0.003283566329628229, 0.03426012769341469, 0.014967275783419609, 0.0021477248519659042, 0.0010707214241847396, 0.013880673795938492, 0.0012914243852719665 ]
0.006168
13
[ "For the first case, 'As Couples' is heard first, so you work As Couples to do\nthe call 'Once Removed Latch On'. ", "See diagrams below.", "\n\nImagine you start herewhere each dancer is a couple\n\nafterOnce Removed Latch On\n\nFor the second case, 'Once Removed' is heard first, so you work Once\nRemoved to do the call 'As Couples Latch On'. ", "Note that, for this case, the\ndancers in the set\n{,\n,\n,\n}\nare on every other plane in both the starting formation and the ending formation.", "\nSimilarly, so are the dancers in the set\n{,\n,\n,\n}." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0006422626902349293, 0.0005933591164648533, 0.000941673933994025, 0.0006235654000192881, 0.0007983589894138277 ]
0.00072
5
[ "Q:\n\nNilpotency class of subgroup\n\nLet $G$ be a group of nilpotency class $n$. Every proper subgroup of $G$ would have nilpotency class at most $n$.\nDo we know of an example where the commutator subgroup of a nilpotent group of class $n$ also has class $n$?", "\n\nA:\n\nNo. ", "Recall that the nilpotenct class of $G$ can be defined as the smallest natural number $n$ such that $\\gamma_n (G)=0$, where $\\gamma_1(G)=G$, $\\gamma_{j+1}(G)=[G,\\gamma_j(G)]$. Since $\\gamma_1([G,G])=[G,G]=\\gamma_2(G)$ it follows (by induction) that $\\gamma_j([G,G]) \\leq \\gamma_{j+1}(G)$ for $j$ a natural number. ", "This means that if $G$ has nilpotency class $n$, then $0\\leq \\gamma_{n-1}([G,G])\\leq \\gamma_n(G)=0$ and hence $[G,G]$ has nilpotency class at most $n-1$.\nFor the induction step above note that if $\\gamma_{k}([G,G]) \\leq \\gamma_{k+1}(G)$, then since $[G,G]\\leq G$ we have that $$\\gamma_{k+1}([G,G])=[[G,G],\\gamma_{k}([G,G])] \\leq [G,\\gamma_{k+1}(G)] = \\gamma_{k+2}(G)$$\nas required.", "\nEdit 2015-12-05: We will improve the bound according to Derek Holt's comment (to the extent I was able).", "\nWe prove by induction on $k$ that $$[\\gamma_k(G),\\gamma_l(G)] \\leq \\gamma_{k+l}(G).\\qquad\\qquad(*)$$\nBase case: By definition we know that for all $l$ \n$$[\\gamma_1(G),\\gamma_l(G)] = [G,\\gamma_l(G)] = \\gamma_{1+l}(G).$$\nNow for the induction step. ", "Suppose that for all $l$ and for $k\\leq n$\n$$[\\gamma_k(G),\\gamma_l(G)] \\leq \\gamma_{k+l}(G).$$ Using the three subgroups lemma for the first inequality and the inductive hypothesis for the second and third we obtain:\n$$[\\gamma_{n+1}(G),\\gamma_l(G)] = [[G,\\gamma_n(G)],\\gamma_{l}(G)]\\leq [\\gamma_n(G),[G,\\gamma_{l}(G)]][G,[\\gamma_{n}(G),\\gamma_l(G)]]\\leq[\\gamma_n(G),\\gamma_{l+1}(G)][G,\\gamma_{n+l}(G)]\\leq \\gamma_{n+1+l}(G)$$\nas required.", "\nNext we will prove that for all $j$ and $k$ that\n$$\\gamma_j(\\gamma_k(G)) \\leq \\gamma_{jk}(G).\\qquad\\qquad \\text{$($#$)$}$$\nSince $\\gamma_1(\\gamma_k(G)) = \\gamma_{k}(G)$ and if $\\gamma_j(\\gamma_k(G)) \\leq \\gamma_{jk}(G)$, then\n$$\\gamma_{j+1}(\\gamma_k(G)) =[\\gamma_k(G),\\gamma_j(\\gamma_k(G))]\\leq [\\gamma_k(G),\\gamma_{jk}(G)] \\leq \\gamma_{k+jk}(G)=\\gamma_{(j+1)k}(G),$$\nusing $(*)$ for the second inequality, $($#$)$ follows by induction.", "\nNow suppose that $G$ is of nilpotency class $n$. Then for each $k$ if $m=\\lceil \\frac{n}{k}\\rceil$ we have that $\\gamma_m(\\gamma_k(G)) \\leq \\gamma_{mk}(G)=0$ (since $mk\\geq n$) so that the nilpotency class of $\\gamma_k(G)$ is less than or equal to $m$. Setting $k=2$ gives a bound of $\\lceil \\frac{n}{2} \\rceil$ for the nilpotency class of $[G,G]$.\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0015465623000636697, 0.0010212911292910576, 0.00792874675244093, 0.013939722441136837, 0.0005580313736572862, 0.00428833207115531, 0.04131648316979408, 0.04437379911541939, 0.017403751611709595 ]
0.014709
9
[ "Christine Matison\n\nChristine Matison (born 29 October 1951) is an Australian former professional tennis player who reached the semi-finals of the 1978 Australian Open as a qualifier.", "\n\nMatison was the first woman qualifier to reach the semi-finals of a Grand Slam tournament. ", "The next woman qualifier to do so was Alexandra Stevenson in the 1999 Wimbledon Championships.", "\n\nIn 1975, Matison won the doubles of the Western Australian Championships in Perth partnering Lesley Turner Bowrey, beating Sue Barker and Michelle Tyler-Wilson in the final in two sets.", "\n\nReferences\n\nExternal links\n \n \n\nCategory:1951 births\nCategory:Living people\nCategory:Australian female tennis players\nCategory:Place of birth missing (living people)" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0011997094843536615, 0.0012613215949386358, 0.0006345746805891395, 0.000893952208571136, 0.0006427473272196949 ]
0.000926
5
[ "9 prime?", "\nTrue\nIs 18301 composite?", "\nFalse\nIs 50387 composite?", "\nFalse\nIs 1374151 composite?", "\nTrue\nIs 457087 prime?", "\nTrue\nIs 40199 a composite number?", "\nTrue\nIs 29905 a prime number?", "\nFalse\nIs 322993 a composite number?", "\nTrue\nIs 3761 composite?", "\nFalse\nIs 1801 composite?", "\nFalse\nIs 429317 a prime number?", "\nFalse\nIs 56543 a composite number?", "\nFalse\nIs 5059 composite?", "\nFalse\nIs 19553 a prime number?", "\nTrue\nIs 30803 composite?", "\nFalse\nIs 55766 a prime number?", "\nFalse\nIs 317795 a prime number?", "\nFalse\nIs 701 a prime number?", "\nTrue\nIs 1495679 a composite number?", "\nTrue\nIs 14513 composite?", "\nTrue\nIs 5509 composite?", "\nTrue\nIs 5493 composite?", "\nTrue\nIs 6131 composite?", "\nFalse\nIs 273503 a composite number?", "\nFalse\nIs 78809 a composite number?", "\nFalse\nIs 44537 composite?", "\nFalse\nIs 975343 a prime number?", "\nTrue\nIs 234703 a composite number?", "\nTrue\nIs 17002 composite?", "\nTrue\nIs 1463131 prime?", "\nFalse\nIs 337287 a prime number?", "\nFalse\nIs 7343 composite?", "\nTrue\nIs 1315 a prime number?", "\nFalse\nIs 75971 prime?", "\nFalse\nIs 233 prime?", "\nTrue\nIs 386017 composite?", "\nFalse\nIs 110527 a prime number?", "\nTrue\nIs 13561 prime?", "\nFalse\nIs 65833 a composite number?", "\nTrue\nIs 127923 a prime number?", "\nFalse\nIs 12571 a prime number?", "\nFalse\nIs 72001 prime?", "\nFalse\nIs 1249 composite?", "\nFalse\nIs 232723 composite?", "\nTrue\nIs 209995 prime?", "\nFalse\nIs 4729 prime?", "\nTrue\nIs 922379 prime?", "\nFalse\nIs 26653 composite?", "\nTrue\nIs 11721 a composite number?", "\nTrue\nIs 22267 a prime number?", "\nFalse\nIs 19207 prime?", "\nTrue\nIs 985571 composite?", "\nFalse\nIs 1982551 prime?", "\nTrue\nIs 29123 a composite number?", "\nFalse\nIs 8263 composite?", "\nFalse\nIs 7151 a prime number?", "\nTrue\nIs 2999 a prime number?", "\nTrue\nIs 768489 prime?", "\nFalse\nIs 185123 a prime number?", "\nTrue\nIs 673 a composite number?", "\nFalse\nIs 4847 a prime number?", "\nFalse\nIs 50329 composite?", "\nFalse\nIs 25057 composite?", "\nFalse\nIs 837283 composite?", "\nFalse\nIs 595121 a prime number?", "\nFalse\nIs 160997 a prime number?", "\nTrue\nIs 37003 a prime number?", "\nTrue\nIs 11269 a prime number?", "\nFalse\nIs 11143 prime?", "\nFalse\nIs 20161 composite?", "\nFalse\nIs 12323 a composite number?", "\nFalse\nIs 739411 composite?", "\nTrue\nIs 1639 composite?", "\nTrue\nIs 172951 a prime number?", "\nFalse\nIs 1361 prime?", "\nTrue\nIs 4009 composite?", "\nTrue\nIs 4742 a prime number?", "\nFalse\nIs 33551 composite?", "\nTrue\nIs 17111 a prime number?", "\nFalse\nIs 207777 prime?", "\nFalse\nIs 1095773 a prime number?", "\nFalse\nIs 1871 a composite number?", "\nFalse\nIs 7283 composite?", "\nFalse\nIs 163 a composite number?", "\nFalse\nIs 4227 a prime number?", "\nFalse\nIs 9661 a prime number?", "\nTrue\nIs 587 composite?", "\nFalse\nIs 9229 composite?", "\nTrue\nIs 7661 prime?", "\nFalse\nIs 2573 prime?", "\nFalse\nIs 23531 a composite number?", "\nFalse\nIs 14341 prime?", "\nTrue\nIs 28597 prime?", "\nTrue\nIs 847135 prime?", "\nFalse\nIs 56843 prime?", "\nTrue\nIs 93679 prime?", "\nFalse\nIs 186889 a composite number?", "\nFalse\nIs 46357 a prime number?", "\nFalse\nIs 53969 a composite number?", "\nTrue\nIs 211559 composite?", "\nFalse\nIs 18559 a composite number?", "\nTrue\nIs 1306273 composite?", "\nFalse\nIs 37915 prime?", "\nFalse\nIs 4979515 a composite number?", "\nTrue\nIs 43751 a prime number?", "\nFalse\nIs 351609 a composite number?", "\nTrue\nIs 4319 composite?", "\nTrue\nIs 1151 a composite number?", "\nFalse\nIs 12055 a prime number?", "\nFalse\nIs 887 composite?", "\nFalse\nIs 8131 a prime number?", "\nFalse\nIs 80943 prime?", "\nFalse\nIs 27442 a composite number?", "\nTrue\nIs 30122 composite?", "\nTrue\nIs 5209 a composite number?", "\nFalse\nIs 662819 prime?", "\nTrue\nIs 4001 a prime number?", "\nTrue\nIs 41186 a prime number?", "\nFalse\nIs 267571 prime?", "\nFalse\nIs 833947 composite?", "\nFalse\nIs 38195 a prime number?", "\nFalse\nIs 3761 prime?", "\nTrue\nIs 207941 composite?", "\nFalse\nIs 1397 prime?", "\nFalse\nIs 376021 a prime number?", "\nTrue\nIs 8903 composite?", "\nTrue\nIs 1259 composite?", "\nFalse\nIs 2174017 composite?", "\nFalse\nIs 168897 composite?", "\nTrue\nIs 21781 composite?", "\nTrue\nIs 2545009 composite?", "\nTrue\nIs 120187 composite?", "\nTrue\nIs 697423 a prime number?", "\nTrue\nIs 2293829 a composite number?", "\nFalse\nIs 5617 a prime number?", "\nFalse\nIs 1151 composite?", "\nFalse\nIs 16846 a prime number?", "\nFalse\nIs 106273 prime?", "\nTrue\nIs 209733 a composite number?", "\nTrue\nIs 368491 prime?", "\nTrue\nIs 31547 composite?", "\nFalse\nIs 23509 prime?", "\nTrue\nIs 251 a prime number?", "\nTrue\nIs 4919 a composite number?", "\nFalse\nIs 402047 a composite number?", "\nTrue\nIs 28973 prime?", "\nFalse\nIs 4957 a composite number?", "\nFalse\nIs 746 a prime number?", "\nFalse\nIs 89 prime?", "\nTrue\nIs 21347 prime?", "\nTrue\nIs 18419 a composite number?", "\nTrue\nIs 35797 composite?", "\nFalse\nIs 7249 a composite number?", "\nTrue\nIs 15347 composite?", "\nTrue\nIs 562 a prime number?", "\nFalse\nIs 24071 composite?", "\nFalse\nIs 546835 a composite number?", "\nTrue\nIs 11441 composite?", "\nTrue\nIs 20279 prime?", "\nFalse\nIs 689 composite?", "\nTrue\nIs 13963 composite?", "\nFalse\nIs 202307 composite?", "\nTrue\nIs 352553 composite?", "\nTrue\nIs 2101 a prime number?", "\nFalse\nIs 10007 a prime number?", "\nTrue\nIs 207329 prime?", "\nTrue\nIs 158959 prime?", "\nTrue\nIs 836839 composite?", "\nFalse\nIs 8653 a composite number?", "\nTrue\nIs 877 a prime number?", "\nTrue\nIs 48171 a composite number?", "\nTrue\nIs 5227 prime?", "\nTrue\nIs 140111 composite?", "\nFalse\nIs 167861 a composite number?", "\nFalse\nIs 177149 composite?", "\nTrue\nIs 931231 a composite number?", "\nTrue\nIs 55967 composite?", "\nFalse\nIs 20021 a composite number?", "\nFalse\nIs 8819 a prime number?", "\nTrue\nIs 36021 a composite number?", "\nTrue\nIs 18397 prime?", "\nTrue\nIs 1909 a composite number?", "\nTrue\nIs 13909 a prime number?", "\nFalse\nIs 230761 composite?", "\nFalse\nIs 25399 a composite number?", "\nTrue\nIs 3911767 composite?", "\nFalse\nIs 57481 composite?", "\nTrue\nIs 27581 a prime number?", "\nTrue\nIs 2729303 a composite number?", "\nFalse\nIs 6607 composite?", "\nFalse\nIs 253 prime?", "\nFalse\nIs 378971 a prime number?", "\nFalse\nIs 136189 composite?", "\nFalse\nIs 1981649 prime?", "\nTrue\nIs 8399 prime?", "\nFalse\nIs 513829 prime?", "\nTrue\nIs 1270897 a composite number?", "\nFalse\nIs 11409 a composite number?", "\nTrue\nIs 592793 prime?", "\nTrue\nIs 581 a composite number?", "\nTrue\nIs 1249 a composite number?", "\nFalse\nIs 173827 a prime number?", "\nTrue\nIs 697 a composite number?", "\nTrue\nIs 29683 a prime number?", "\nTrue\nIs 583 composite?", "\nTrue\nIs 10798 a composite number?", "\nTrue\nIs 34721 prime?", "\nTrue\nIs 10743 prime?", "\nFalse\nIs 24263 prime?", "\nFalse\nIs 18861 a composite number?", "\nTrue\nIs 251741 a prime number?", "\nFalse\nIs 6023935 a composite number?", "\nTrue\nIs 15601 a prime number?", "\nTrue\nIs 26141 a composite number?", "\nFalse\nIs 445 composite?", "\nTrue\nIs 615001 a prime number?", "\nFalse\nIs 367097 composite?", "\nFalse\nIs 5455 a prime number?", "\nFalse\nIs 110023 a composite number?", "\nFalse\nIs 289 a composite number?", "\nTrue\nIs 19949 a composite number?", "\nFalse\nIs 3280169 a prime number?", "\nFalse\nIs 105751 a prime number?", "\nTrue\nIs 94669 a prime number?", "\nFalse\nIs 3349 a prime number?", "\nFalse\nIs 2035343 a composite number?", "\nFalse\nIs 26459 a composite number?", "\nFalse\nIs 170997 a prime number?", "\nFalse\nIs 29269 prime?", "\nTrue\nIs 2153603 composite?", "\nTrue\nIs 54857 prime?", "\nFalse\nIs 553013 composite?", "\nFalse\nIs 143357 a composite number?", "\nFalse\nIs 45579 composite?", "\nTrue\nIs 327599 prime?", "\nTrue\nIs 233641 composite?", "\nFalse\nIs 355261 prime?", "\nTrue\nIs 313309 prime?", "\nFalse\nIs 11539 a composite number?", "\nTrue\nIs 211543 a prime number?", "\nTrue\nIs 328931 composite?", "\nFalse\nIs 25451 a prime number?", "\nFalse\nIs 180317 composite?", "\nFalse\nIs 2146499 a prime number?", "\nTrue\nIs 12437 composite?", "\nFalse\nIs 15101 a prime number?", "\nTrue\nIs 6779 a composite number?", "\nFalse\nIs 409177 a prime number?", "\nTrue\nIs 426805 a composite number?", "\nTrue\nIs 7031 a composite number?", "\nTrue\nIs 6469 prime?", "\nTrue\nIs 1472671 a composite number?", "\nTrue\nIs 200579 a prime number?", "\nTrue\nIs 35671 a composite number?", "\nFalse\nIs 22669 a prime number?", "\nTrue\nIs 2085445 composite?", "\nTrue\nIs 4247 a prime number?", "\nFalse\nIs 2201 a composite number?", "\nTrue\nIs 3049 a prime number?", "\nTrue\nIs 260747 composite?", "\nFalse\nIs 557435 composite?", "\nTrue\nIs 55415 composite?", "\nTrue\nIs 164311 a prime number?", "\nFalse\nIs 57037 a composite number?", "\nFalse\nIs 348761 a prime number?", "\nFalse\nIs 36658 a composite number?", "\nTrue\nIs 783433 composite?", "\nTrue\nIs 9197 a composite number?", "\nTrue\nIs 251673 a prime number?", "\nFalse\nIs 114371 composite?", "\nFalse\nIs 770135 a composite number?", "\nTrue\nIs 98261 a composite number?", "\nTrue\nIs 360533 prime?", "\nFalse\nIs 515737 prime?", "\nTrue\nIs 17567 composite?", "\nTrue\nIs 289387 prime?", "\nFalse\nIs 1828895 a composite number?", "\nTrue\nIs 400643 composite?", "\nFalse\nIs 366217 a prime number?", "\nTrue\nIs 2053 a prime number?", "\nTrue\nIs 53993 prime?", "\nTrue\nIs 90291 a composite number?", "\nTrue\nIs 8197 composite?", "\nTrue\nIs 2923 composite?", "\nTrue\nIs 94967 composite?", "\nTrue\nIs 4771 prime?", "\nFalse\nIs 48131 a prime number?", "\nTrue\nIs 11185 a prime number?", "\nFalse\nIs 5353 a composite number?", "\nTrue\nIs 300851 a composite number?" ]
{ "pile_set_name": "DM Mathematics" }
[ 0.0009484572801738977, 0.0008839655783958733, 0.001615381333976984, 0.0012012944789603353, 0.0012603200739249587, 0.0013329535722732544, 0.0015029121423140168, 0.0028252648189663887, 0.0010108603164553642, 0.0013172294711694121, 0.0033145120833069086, 0.0020567625761032104, 0.002197511261329055, 0.002215673914179206, 0.0009477991843596101, 0.0023375877644866705, 0.002868529176339507, 0.002530563622713089, 0.0013957415940240026, 0.0009174284059554338, 0.0009720158413983881, 0.0010510614374652505, 0.0009044489124789834, 0.001722486806102097, 0.003131612902507186, 0.0017566041788086295, 0.002572317374870181, 0.001383793423883617, 0.0008890886674635112, 0.0010505999671295285, 0.002293339231982827, 0.0030167873483151197, 0.001384441857226193, 0.003982905764132738, 0.0020038255024701357, 0.0008294627186842263, 0.0019909541588276625, 0.0010582997929304838, 0.0028005954809486866, 0.001345294644124806, 0.0023688210640102625, 0.0012768545420840383, 0.004196919500827789, 0.0020893628243356943, 0.0013802601024508476, 0.0017944853752851486, 0.0013111199950799346, 0.0015339311212301254, 0.0011825512629002333, 0.0014883569674566388, 0.0018430618802085519, 0.00110053236130625, 0.0014676011633127928, 0.0010463693179190159, 0.002451764652505517, 0.002268018899485469, 0.0015218540793284774, 0.0012759938836097717, 0.002270009368658066, 0.0013325790641829371, 0.0017578505212441087, 0.002539917128160596, 0.0010665328009054065, 0.003910053055733442, 0.0026790203992277384, 0.0027993093244731426, 0.0015761279501020908, 0.0013480817433446646, 0.002176039619371295, 0.0013209154130890965, 0.0015973808476701379, 0.003158657345920801, 0.0012364007998257875, 0.0013509240234270692, 0.0020064350683242083, 0.001023850287310779, 0.0011542860884219408, 0.0012539582094177604, 0.0012996960431337357, 0.002780995098873973, 0.0024261209182441235, 0.0014068278251215816, 0.0030411165207624435, 0.0019264686852693558, 0.0027796318754553795, 0.0026273506227880716, 0.0009965962963178754, 0.001657890621572733, 0.00112369772978127, 0.002054702490568161, 0.0019259490072727203, 0.0015285093104466796, 0.0011168895289301872, 0.0011738116154447198, 0.0026603280566632748, 0.0012083338806405663, 0.002384848427027464, 0.002693100832402706, 0.004226239863783121, 0.0009382120915688574, 0.0019007890950888395, 0.0010841143084689975, 0.002539565786719322, 0.00327136367559433, 0.0013571828603744507, 0.0012485655024647713, 0.001020899973809719, 0.0010216155787929893, 0.0019017931772395968, 0.002159806899726391, 0.00191359908785671, 0.002266963943839073, 0.0012102910550311208, 0.0008886042633093894, 0.0011924395803362131, 0.0027783478144556284, 0.0013434016145765781, 0.0016594651388004422, 0.0010306087788194418, 0.0012611408019438386, 0.002616296987980604, 0.0025314195081591606, 0.0009333129273727536, 0.002615447388961911, 0.0022117672488093376, 0.0009900947334244847, 0.0010461818892508745, 0.002083342522382736, 0.0016389241209253669, 0.0010451668640598655, 0.0009830811759456992, 0.000860457366798073, 0.001466949237510562, 0.0012625915696844459, 0.0022911515552550554, 0.0016023804200813174, 0.0019221187103539705, 0.0016389123629778624, 0.001355903223156929, 0.0011855163611471653, 0.0008192963432520628, 0.003530332585796714, 0.0015469255158677697, 0.0010860535548999906, 0.0017542042769491673, 0.0010385053465142846, 0.0017169839702546597, 0.002585400827229023, 0.0022858199663460255, 0.001005575293675065, 0.0011864252155646682, 0.000982057536020875, 0.0014377355109900236, 0.001056859502568841, 0.0014444758417084813, 0.0026621937286108732, 0.0021935792174190283, 0.0009427103213965893, 0.0011498770909383893, 0.004118838347494602, 0.0010164565173909068, 0.0018821079283952713, 0.0008628753712400794, 0.0013676650123670697, 0.002147908555343747, 0.001078168977983296, 0.0013895286247134209, 0.0009197174804285169, 0.002028062706813216, 0.0014273372944444418, 0.0012164493091404438, 0.0009084390476346016, 0.0008602101588621736, 0.003544187406077981, 0.0009346316801384091, 0.0009993469575420022, 0.001135053695179522, 0.0016386228380724788, 0.002279214560985565, 0.001137930667027831, 0.0009878667769953609, 0.0009552781120873988, 0.0014266830403357744, 0.005146712996065617, 0.003665844677016139, 0.0010525615653023124, 0.0014535632217302918, 0.0014566343743354082, 0.0014276024885475636, 0.0016313408268615603, 0.002041562693193555, 0.004187630955129862, 0.0014774195151403546, 0.0018738536164164543, 0.0013083626981824636, 0.002210671082139015, 0.0015559811145067215, 0.0034070522524416447, 0.001268147025257349, 0.0012033535167574883, 0.001222834805957973, 0.0016401495086029172, 0.0011963972356170416, 0.0014060074463486671, 0.0010535612236708403, 0.0012981378240510821, 0.0011903118574991822, 0.0011291297851130366, 0.0031704334542155266, 0.0015527072828263044, 0.001418492291122675, 0.002049702685326338, 0.001289183390326798, 0.0009592765127308667, 0.0031292352359741926, 0.0011893598129972816, 0.00413183867931366, 0.0020840743090957403, 0.001541524543426931, 0.00178347690962255, 0.0010864073410630226, 0.0020689622033387423, 0.0022098843473941088, 0.0013342389138415456, 0.0026754222344607115, 0.0018852772191166878, 0.0014574939850717783, 0.0028066118247807026, 0.0021335738711059093, 0.0012529488885775208, 0.001082661678083241, 0.0013656794326379895, 0.001749595394358039, 0.0016503800870850682, 0.0010649525793269277, 0.0009235043544322252, 0.0010638178791850805, 0.0011001309612765908, 0.0012433230876922607, 0.001263160491362214, 0.0009353947243653238, 0.0023087700828909874, 0.0014614376705139875, 0.003309588646516204, 0.0009054715046659112, 0.0019415230490267277, 0.0013930783607065678, 0.0032350453548133373, 0.0014010966988280416, 0.0009722261456772685, 0.001215331139974296, 0.001130120363086462, 0.0014095724327489734, 0.0011826206464320421, 0.002748858416453004, 0.0007809986709617078, 0.001158828497864306, 0.0022592591121792793, 0.001463893917389214, 0.0009068080107681453, 0.003023396246135235, 0.0008337100734934211, 0.0012972726253792644, 0.001369358622469008, 0.004347761627286673, 0.0029194438830018044, 0.0010116021148860455, 0.001257077674381435, 0.0018078208668157458, 0.0017357093747705221, 0.0014949704054743052, 0.001152479904703796, 0.0010739946737885475, 0.0014298399910330772, 0.0009541924810037017, 0.0011153080267831683, 0.002710175234824419, 0.0009844336891546845, 0.003124361392110586, 0.0013053686125203967, 0.0014037577202543616, 0.0011183336609974504, 0.0010263998992741108, 0.0009848290355876088, 0.0011962497374042869, 0.0010594663908705115, 0.0022994985338300467, 0.0012115603312849998, 0.001955958316102624, 0.0010910466080531478 ]
0.001719
290
[ " Case: 12-11106 Date Filed: 02/05/2013 Page: 1 of 4\n\n [DO NOT PUBLISH]\n\n\n\n IN THE UNITED STATES COURT OF APPEALS\n\n FOR THE ELEVENTH CIRCUIT\n ________________________\n\n No. ", "12-11106\n Non-Argument Calendar\n ________________________\n\n D.C. Docket No. ", "8:11-cr-00372-JDW-AEP-3\n\nUNITED STATES OF AMERICA,\n\n Plaintiff-Appellee,\n\n versus\n\nALVIN MARTINEZ,\n\n Defendant-Appellant.", "\n ________________________\n\n Appeal from the United States District Court\n for the Middle District of Florida\n ________________________\n\n (February 5, 2013)\n\nBefore TJOFLAT, MARCUS and KRAVITCH, Circuit Judges.", "\n\nPER CURIAM:\n\n Alvin Martinez pled guilty to both counts of a two-count indictment\n\ncharging him (and four others) in Count One with conspiracy to possess with intent\n\f Case: 12-11106 Date Filed: 02/05/2013 Page: 2 of 4\n\nto distribute five kilograms or more of a mixture and substance containing cocaine\n\non board a vessel subject to the jurisdiction of the United States and, in Count Two\n\nwith possession with intent to distribute the same on board a vessel subject to the\n\njurisdiction of the United States. ", "And the District Court sentenced him to\n\nconcurrent prison terms of 210 months, at the low end of the guideline sentence\n\nrange of 210 to 262 months’ confinement. ", "Martinez now appeals his sentences.", "\n\n Martinez’s appeal presents one issue: Whether the District Court erred by\n\ndenying him safety-valve relief under U.S.S.G. § 5C1.2(a). ", "He argues that the\n\nGovernment failed to present independent and objective proof that he withheld\n\ninformation or lied during his proffer on pleading guilty. ", "He further asserts that he\n\ntold the truth and disclosed all relevant information prior to the sentencing hearing,\n\nand that he cannot be punished for failing to answer questions that he was not\n\nasked by the Government during his proffer interview.", "\n\n In reviewing the denial of safety-valve relief, we review the district court’s\n\nfactual determination of the truthfulness and completeness of a defendant’s proffer\n\nfor clear error. ", "United States v. Johnson, 375 F.3d 1300, 1301 (11th Cir. ", "2004);\n\nUnited States v. Brownlee, 204 F.3d 1302, 1305 (11th Cir. ", "2000). ", "The Sentencing\n\nGuidelines direct the court to impose a sentence within the applicable guideline\n\nsentence range without regard to any mandatory minimum when a defendant\n\nsatisfies five criteria. ", "U.S.S.G. § 5C1.2(a). ", "The criterion relevant here is that the\n\n\n 2\n\f Case: 12-11106 Date Filed: 02/05/2013 Page: 3 of 4\n\ndefendant truthfully proffer, at a time no later than the sentencing hearing, all\n\ninformation that he has regarding his offense. ", "Id. § 5C1.2(a)(5). ", "If a defendant\n\nconvicted of a controlled substance offense satisfies the U.S.S.G. § 5C1.2(a)\n\ncriteria, he receives a two-level decrease in his offense level. ", "Id. § 2D1.1(b)(16).", "\n\nThe defendant has an affirmative responsibility to make a truthful and complete\n\ndisclosure about the offense and all relevant conduct, and bears the burden of\n\nshowing that he fulfilled this requirement. ", "Johnson, 375 F.3d at 1302. ", "The\n\nGovernment is under no obligation to solicit information from a defendant who\n\nseeks to qualify for safety-valve relief. ", "United States v. Milkintas, 470 F.3d 1339,\n\n1345-46 (11th Cir. ", "2006).", "\n\n When a defendant lies or fails to proffer the whole truth, this does not\n\npreclude safety-valve relief if he gives a truthful and complete proffer “not later\n\nthan the commencement of the sentencing hearing.” ", "Brownlee, 204 F.3d at 1305.", "\n\nIn United States v. Garcia, 405 F.3d 1260, 1274-75 (11th Cir. ", "2005), we elaborated\n\nthat the temporal element discussed in Brownlee is not binding, because the\n\ndefendant in Brownlee gave his proffer prior to the commencement of sentencing.", "\n\nIn Garcia, we held that the district court has discretion to continue a sentencing\n\nhearing to allow a defendant to make the necessary proffer, even where the motion\n\nto continue is made at the hearing. ", "Garcia, 405 F.3d at 1275. ", "In the typical case,\n\nthough, the proffer should be made before the commencement of the sentencing\n\n\n 3\n\f Case: 12-11106 Date Filed: 02/05/2013 Page: 4 of 4\n\nhearing. ", "Id. (noting that the situation in the case was atypical because the\n\ndefendant did not speak English; the initial proffer interview was conducted\n\nwithout an independent translator; the defendant’s counsel believed that the\n\ndefendant had already made a sufficient proffer; and there was no evidence that the\n\ndefendant’s failure to give a full proffer prior to sentencing was done in bad faith).", "\n\n We conclude that the District Court did not commit clear error in finding\n\nthat Martinez’s proffer was untruthful and incomplete. ", "Hence, the court did not err\n\nin denying Martinez’s request for safety-valve relief.", "\n\n AFFIRMED.", "\n\n\n\n\n 4\n\f" ]
{ "pile_set_name": "FreeLaw" }
[ 0.0006889602518640459, 0.0010281535796821117, 0.0006741246907040477, 0.0008566590258851647, 0.0009777843952178955, 0.001104229362681508, 0.0032222929876297712, 0.0007082350202836096, 0.0008140179561451077, 0.0005912503111176193, 0.0005840712110511959, 0.0008256036089733243, 0.0007613276247866452, 0.0007551072631031275, 0.0005947680911049247, 0.000792252249084413, 0.0005801456281915307, 0.0008176040137186646, 0.000682910205796361, 0.0008309357799589634, 0.0006079038139432669, 0.0006689442088827491, 0.0006060757441446185, 0.0008517116075381637, 0.0007848869427107275, 0.000809636723715812, 0.0007245661108754575, 0.0007925904355943203, 0.0005626201163977385, 0.0006075620767660439, 0.0006901424494571984, 0.0005498006357811391, 0.0006203232915140688, 0.0007736558327451348, 0.0007157564396038651, 0.0007905580569058657, 0.0010853192070499063 ]
0.000814
37
[ "\nFun Linux commands - tonteldoos\nhttp://www.binarytides.com/linux-fun-commands/\n======\nblackdivine\ntelnet towel.blinkenlights.nl is not working. ", "RIP\n\n~~~\nmajormjr\nStill works for me.", "\n\n~~~\nblackdivine\nmunir@munir-HP-ProBook-450-G2:~$ telnet\n\ntowel.blinkenlights.nl\n\nTrying 94.142.241.111...\n\nConnected to towel.blinkenlights.nl.", "\n\nEscape character is '^]'.", "\n\nConnection closed by foreign host.", "\n\n" ]
{ "pile_set_name": "HackerNews" }
[ 0.004016051068902016, 0.0036174722481518984, 0.0020369822159409523, 0.0006122423801571131, 0.0005918727838434279, 0.0019954426679760218 ]
0.002145
6
[ "import type { TPromsterOptions, TMetricTypes } from '@promster/types';\nimport type { TRequestRecorder } from '@promster/metrics';\nimport { FastifyInstance, FastifyRequest } from 'fastify';\n\nimport fastifyPlugin from 'fastify-plugin';\nimport merge from 'merge-options';\nimport {\n Prometheus,\n createMetricTypes,\n createRequestRecorder,\n createGcObserver,\n defaultNormalizers,\n isRunningInKubernetes,\n} from '@promster/metrics';\nimport pkg from '../../package.json';\n\nlet recordRequest: TRequestRecorder;\nlet upMetric: TMetricTypes['up'];\n\n// @ts-expect-error\nconst extractPath = (req: FastifyRequest) => req.raw.originalUrl || req.raw.url;\nconst getRequestRecorder = () => recordRequest;\nconst signalIsUp = () =>\n upMetric?.forEach((upMetricType) => upMetricType.set(1));\nconst signalIsNotUp = () =>\n upMetric?.forEach((upMetricType) => upMetricType.set(0));\n\nconst createPlugin = async (\n fastify: FastifyInstance,\n options: TPromsterOptions\n) => {\n const defaultedOptions = merge(\n createMetricTypes.defaultOptions,\n createRequestRecorder.defaultOptions,\n defaultNormalizers,\n options\n );\n\n const shouldSkipMetricsByEnvironment =\n defaultedOptions.detectKubernetes === true && !", "isRunningInKubernetes;\n\n const metricTypes = createMetricTypes(defaultedOptions);\n const observeGc = createGcObserver(metricTypes);\n\n recordRequest = createRequestRecorder(metricTypes, defaultedOptions);\n upMetric = metricTypes?.up;\n\n if (!", "shouldSkipMetricsByEnvironment) {\n observeGc();\n }\n\n fastify.decorate('Prometheus', Prometheus);\n fastify.decorate('recordRequest', recordRequest);\n fastify.decorateRequest('__promsterStartTime__', null);\n\n fastify.addHook('onRequest', async (request, _) => {\n // @ts-expect-error\n request.__promsterStartTime__ = process.hrtime();\n });\n\n fastify.addHook('onResponse', async (request, reply) => {\n const labels = Object.assign(\n {},\n {\n method: defaultedOptions.normalizeMethod(request.raw.method, {\n request,\n reply,\n }),\n status_code: defaultedOptions.normalizeStatusCode(\n reply.res.statusCode,\n { request, reply }\n ),\n path: defaultedOptions.normalizePath(extractPath(request), {\n request,\n reply,\n }),\n },\n defaultedOptions.getLabelValues?.(request, reply)\n );\n\n const shouldSkipByRequest =\n defaultedOptions.skip?.(request, reply);\n\n if (!", "shouldSkipByRequest && !", "shouldSkipMetricsByEnvironment) {\n // @ts-expect-error\n recordRequest(request.__promsterStartTime__, {\n labels,\n });\n }\n });\n};\n\nconst plugin = fastifyPlugin(createPlugin, {\n fastify: '>= 1.6.0',\n name: pkg.name,\n});\n\nexport { plugin, getRequestRecorder, signalIsUp, signalIsNotUp, extractPath };\n" ]
{ "pile_set_name": "Github" }
[ 0.0017162682488560677, 0.001509473891928792, 0.0015176524175330997, 0.0314473919570446, 0.001183744752779603 ]
0.007475
5
[ "Spain’s jobless rely on pensioners to survive\n\nAfter a career spent repairing trains, Francisco Marcos Gallego once thought he and his wife would end their days in comfort. ", "Instead they are struggling to support their unemployed son and his children. “", "Even if it is hard, as long as I am alive, I…" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0015764626441523433, 0.020804787054657936, 0.0012457637349143624 ]
0.007876
3
[ "Q:\n\nLet .. in statement doesn't work in IO?", "\n\nI can hardly make the difference between \"where\" and \"let .. int\" statements.", "\nHere's my code. ", "I want 2 ways to print 5.", "\nmain = do\n print x\n where x = 5\n let x = 5 in print x\n\nFirst one works, but I get a \"parse error on input 'let'\"\nIs this a matter of indentation, or is my code plain wrong ?", "\n\nA:\n\nwhere always ends a statement; nothing should go after where.", "\nSo, you could write it like this:\nmain = do\n let x = 5 in print x\n print x\n where x = 5\n\nThis is valid because the where clause ends the statement, where it should belong. ", "Your code was invalid because the parser expected to find nothing after the where x = 5, but discovered your let clause.", "\n\nA:\n\nYour code is wrong. ", "The where clause must occur at the end of the definition, while let is an expression that could occur anywhere an expression is valid.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0009785210713744164, 0.0007163958507589996, 0.0015663182130083442, 0.0011188889620825648, 0.0008216574788093567, 0.0008223627810366452, 0.0008087953901849687, 0.0029805777594447136, 0.0020272694528102875, 0.0007702928269281983, 0.0019954426679760218 ]
0.001328
11
[ "Q:\n\nneo4j start causes ERROR: JAVA_HOME is incorrectly defined\n\nI'm trying to run the neo4j server on an Ubuntu machine using this command:\nsudo neo4j start\n\nBut it gives me this error:\nERROR: JAVA_HOME is incorrectly defined as /usr/lib/jvm/java-1.7.0-openjdk-amd64/bin/ (the executable /usr/lib/jvm/java-1.7.0-openjdk-amd64/bin//bin/java does not exist)\n\nNow, I have set JAVA_HOME to the correct directory where Java is installed. ", "Here is what I get when I run echo $JAVA_HOME:\n/usr/lib/jvm/java-8-oracle\n\nI don't know where it's getting that value for JAVA_HOME. ", "I checked the configuration files but I couldn't find any variables referring to JAVA_HOME that I might need to set.", "\n\nA:\n\nIt's the same problem with 7 and you can fix it like this:\nJAVA_HOME should be set to the name of the directory that contains the bin directory that contains the Java executables (in particular, java itself).", "\nAssuming you do have a /usr/lib/jvm/jdk1.7.0 directory, it probably contains a jre subdirectory that contains the bin directory that contains java and related executables.", "\nSo you should probably be setting JAVA_HOME to /usr/lib/jvm/jdk1.7.0/jre rather than /usr/lib/jvm/jdk1.7.0.", "\nSee\nJAVA_HOME is not defined correctly for more info.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.001225296058692038, 0.000641517573967576, 0.0005614729016087949, 0.0008750882116146386, 0.0007198972161859274, 0.0007132149767130613, 0.0005806927802041173, 0.0019954426679760218 ]
0.000914
8
[ "1. ", "Field of the Invention\nThe present invention relates to a packing method of packing an article in which an article is packed by wrapping a band around the article, tightening the band, cutting the band and adhering the ends of the band to each other, and also a packing apparatus for packing an article.", "\n2. ", "Description of the Prior Art\nSo-called xe2x80x9cband-wrapping packing apparatusesxe2x80x9d are known, which wrap a band around an article, tighten the band, cut the band and adhere the ends of the band to each other. ", "The band-wrapping packing apparatuses comprise, for example, a sealing device and a band-feeding device. ", "The sealing device has a sealing motor. ", "When the sealing motor is driven, the sealing device holds a band, cuts the band and adhere the ends of the band to each other. ", "The band-feeding device has a band reel, a drive motor and a drive roller. ", "The drive motor can rotate the drive roller in a forward direction and the reverse direction. ", "When rotated in the forward direction, the drive roller feeds a band from a band reel. ", "When rotated in the reverse direction, the drive roller draws back the band and tightens the band.", "\nThe method in which a packing apparatus of this type packing an article comprises the following five steps:\n(1) Band-inserting step of wrapping a band around the article and inserting the distal end of the band into a band insertion port;\n(2) Band-holding step of holding the end of the band, which has been inserted into the band insertion port;\n(3) Band-tightening step of drawing the band back, thus tightening the band around the article with an appropriate force;\n(4) Band-sealing step of cutting the band and adhering the ends of the band to each other; and\n(5) Band-feeding step of feeding the band for a prescribed distance from the band reel.", "\nPacking apparatuses are classified into two types. ", "The first type is an automatic one. ", "The second type is a semiautomatic one.", "\nThe automatic packing apparatus has an arch unit. ", "The arch unit is located above the table supporting the article to be packed or at one side of the table.", "\nIn the automatic packing apparatus, a band is automatically fed from the band reel into the arch unit. ", "In the arch unit, the distal end of the band is inserted into the band insertion port and is held fast. ", "When a power switch on the automatic packing apparatus is turned on, the band-feeding step, band-inserting step and band-holding step are automatically carried out. ", "Thus, when a start switch on the apparatus is turned on after an article has been placed on the table, the apparatus carries out the band-tightening step and band-sealing step, thus automatically packing the article. ", "The apparatus then performs the band-feeding step, band-inserting step and band-holding step, in preparation for the next packing cycle. ", "In the band-tightening step, the band is pulled back from the arch unit, wrapped around the article and tightened around the article.", "\nBy contrast, the semiautomatic packing apparatus has no arch unit. ", "After feeding a band for a prescribed distance, the apparatus waits until the power switch is turned on. ", "The operator puts an article on the table, wraps the band around the article and inserts the end of the band into the band insertion port. ", "When the end of the band is inserted into the port, the power switch is automatically turned on. ", "Then, the apparatus automatically carries out the band-holding step, band-tightening step and band-sealing step, one after another. ", "The article is thereby packed. ", "Then, the apparatus performs the band-feeding step, in preparation for the next packing cycle. ", "In the semiautomatic packing apparatus, the band-inserting step is manually performed, whereas the band-holding step, band-tightening step, band-sealing step and band-feeding step are automatically carried out, one after another.", "\nIn the packing apparatus, either automatic or semiautomatic, all steps, except the band-inserting step, are effected under automatic control that is accomplished by the sealing motor, the drive motor, and the like.", "\nIn the packing apparatus of either type, the force adjustment dial is turned to adjust and set a desired force for tightening the band. ", "The apparatus of either type stops tightening the band when a sensor detects that the force applied to the band reaches the desired value. ", "The semiautomatic packing apparatus has a band-length dial, too. ", "This dial may be turned to preset a distance for which to feed the band in the band-feeding step.", "\nIn the automatic packing apparatus, the packing sequence starts when the start switch is manually turned on. ", "In the semiautomatic packing apparatus, the packing sequence starts when the start switch is automatically turned on after the end of a band is manually inserted into the band insertion port. ", "In either type of the apparatuses, the packing sequence cannot be interrupted once it has started. ", "In other words, once started, the packing sequence continues until it completes one cycle of operation.", "\nThe conventional packing apparatuses, in which the packing sequence cannot be interrupted once the start switch is turned on, are disadvantageous in the following respects:\n(1) If the band is wrapped around the article and tightened at a wrong position on the article, the position cannot be easily corrected. ", "Further, if the band tightened around the article extends obliquely, it can hardly be straightened as is desired.", "\n(2) Protective plates can hardly be placed on the article at desired positions to prevent the band from being wrapped directly on the article. ", "This is because the operator\"\"s hands may be caught in the gap between any protective plate and the band. ", "Once arranged on the article, the protective plates cannot be easily adjusted in position.", "\n(3) If the force preset to tighten the band around the article is improper, it cannot be adjusted at all.", "\nIf the band wrapped around the article can hardly straightened, if the protective plates cannot be adjusted in position, or if the force of tightening the band cannot be adjusted, the band must be cut and the packing sequence must be repeated. ", "This lowers the packing efficiency. ", "Particularly in packing a cardboard box, the band must be cut and the packing sequence needs to be performed again since the band is tightened while the two straps at the open top remain standing and these straps may not be closed.", "\nJapanese Patent Application KOKAI Publication No. ", "57-153817, for example, discloses a packing method in which the band-tightening step is divided into a preliminary tightening step and a final tightening step. ", "A band is tightened with a smaller force in the preliminary tightening step than in the final tightening step. ", "After the preliminary tightening step and before the final tightening step, the band can be corrected in position and orientation, and any protective plate used can be adjusted in position. ", "The final tightening step can be carried out, for example, while pushing the two straps of a cardboard box to close the open top thereof. ", "Thus, the cardboard can packed and closed at the same time. ", "In this packing method, too, the band is tightened with a preset force that cannot be adjusted at all.", "\nJapanese Patent Application KOKAI Publication No. ", "57-153817 discloses a packing apparatus, too. ", "This apparatus needs to have a preliminary tightening roller and a final tightening roller, in addition to the drive roller, and a mechanism for moving one of the band-tightening rollers. ", "The preliminary tightening roller remains in contact with the drive roller. ", "The mechanism moves the final tightening roller between two positions. ", "At the first position, the final tightening roller contacts the drive roller. ", "At the second position, it does not contact the drive roller. ", "Comprising three rollers, the packing apparatus is complicated in construction.", "\nJapanese Patent Application KOKAI Publication No. ", "11-171124 discloses a packing method. ", "In this method, the drive roller is driven at a high speed in the first half of the band-tightening step and at a low speed in the latter half of the band-tightening step. ", "More precisely, the drive roller draws a band back at 6 m/sec in the first half of the step, wrapping the band around an article, and pulls the band at 0.2 m/sec in the latter half of the step, tightening the band wrapped around the article. ", "In the packing method, the band is pulled and tightened at a low speed in the latter half of the band-tightening step. ", "This gives the operator a time long enough to correct the position and orientation of the band and to adjust the positions of the protective plates placed between the article and the band. ", "In the first half of the band-tightening step, the band is drawn back for only the time set by a timer. ", "In the latter half of the band-tightening step, the band is pulled until a sensor detects that the tension on the band reaches a preset value. ", "It is therefore impossible to adjust the tension on the band, i.e., the force that tightens the band. ", "An apparatus that performs this packing method must have a timer and a tension sensor and is inevitably complicated in construction.", "\nA first object of the present invention is to provide a packing method which enables the operator to adjust the position and orientation of a band wrapped around an article, the positions of protective plates placed between the article and the band, and the force tightening the band.", "\nA second object of the invention is to provide a packing apparatus which makes it easy for the operator to adjust the position and orientation of a band wrapped around an article and the positions of protective plates placed between the article and the band, which enables the operator to adjust the force tightening the band, and which can be simple in construction.", "\nTo achieve the first object, there is provided a packing method in which the distal end of a band is held even after the band-holding step, a switch is manually operated to control the drive roller in the next step, i.e., band-tightening step, and the band-sealing step and band-feeding step are automatically performed, after a signal is generated, indicating that the band-tightening step has been completed.", "\nTo attain the second object, there is provided a packing apparatus that comprises a band-tightening switch and a tightening stop switch, in addition to a sealing device and a band-feeding device. ", "The band-feeding device has a drive roller. ", "The tightening stop switch is manually operated to control the rotation of the drive roller. ", "The tightening stop switch generates a signal indicating that a band has been completely tightened around an article." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.0009391896310262382, 0.0006349506438709795, 0.0011855863267555833, 0.0008064048015512526, 0.0006138207390904427, 0.0006366515881381929, 0.0006673523457720876, 0.0010116974590346217, 0.0008985376334749162, 0.0006674916367046535, 0.0007301138830371201, 0.0007616113871335983, 0.0006532145198434591, 0.0006730041932314634, 0.0009311997564509511, 0.0006881160079501569, 0.000628093141131103, 0.0006691218004561961, 0.0006445429171435535, 0.0007294637034647167, 0.000613355019595474, 0.0006377778481692076, 0.0006191310239955783, 0.0007462845533154905, 0.0006085815257392824, 0.0007773475372232497, 0.000759404560085386, 0.0006563046481460333, 0.0006067233043722808, 0.0005780868232250214, 0.0007517299964092672, 0.000658490345813334, 0.0005974820232950151, 0.0006574246217496693, 0.0007065567770041525, 0.0006144102080725133, 0.0006137798191048205, 0.0006710552261210978, 0.0006140536279417574, 0.0005824132822453976, 0.0006238261121325195, 0.00054375414038077, 0.000611104944255203, 0.0007833929266780615, 0.0005795959732495248, 0.0006540963659062982, 0.0006293179467320442, 0.0006659450591541827, 0.000631416158284992, 0.000716845563147217, 0.0005995244719088078, 0.0005808674031868577, 0.0005530943162739277, 0.0006030408549122512, 0.0006431187503039837, 0.0006776893860660493, 0.000716845563147217, 0.0006135671865195036, 0.0006892308592796326, 0.0009509660303592682, 0.0008191296947188675, 0.0007304685423150659, 0.0009784557623788714, 0.000674721144605428, 0.000716845563147217, 0.0006136332522146404, 0.0007234351942315698, 0.0008153792005032301, 0.0006196637987159193, 0.0006303783156909049, 0.0005924634169787169, 0.0006266392883844674, 0.0006655192701146007, 0.000583239016123116, 0.0006375571829266846, 0.0005983887240290642, 0.0006186008104123175, 0.0006356496596708894, 0.0009956335416063666, 0.0008349633426405489, 0.0006043178727850318 ]
0.000692
81
[ "---\nabstract: 'Causal modeling has been recognized as a potential solution to many challenging problems in machine learning (ML). ", "While counterfactual thinking has been leveraged in ML tasks that aim to predict the consequences of actions/interventions, it has not yet been fully leveraged in more traditional/static supervised learning tasks, such as the prediction of labels in image classification tasks. ", "Here, we propose a counterfactual approach to remove/reduce the influence of confounders from the predictions generated a deep neural network (DNN). ", "Rather than attempting to prevent DNNs from directly learning the confounding signal, we propose a counterfactual approach to remove confounding from the feature representations learned by DNNs in anticausal prediction tasks. ", "By training an accurate DNN using softmax activation at the classification layer, and then adopting the representation learned by the last layer prior to the output layer as our features, we have that, by construction, the learned features will fit well a (multi-class) logistic regression model, and will be linearly associated with the labels. ", "Then, in order to generate classifiers that are free from the influence of the observed confounders we: (i) use linear models to regress each learned feature on the labels and on the confounders and estimate the respective regression coefficients and model residuals; (ii) generate new counterfactual features by adding back to the estimated residuals to a linear predictor which no longer includes the confounder variables; and (iii) train and evaluate a logistic classifier using the counterfactual features as inputs. ", "We validate the proposed methodology using colored versions of the MNIST and fashion-MNIST datasets, and show how the approach can effectively combat confounding and improve generalization in the context of dataset shift. ", "Comparison against a variation of the SMOTE [@chawla2002] approach showed that the causality-aware approach compared favorably against SMOTE balancing in our experiments. ", "Finally, we also describe how to use conditional independence tests to evaluate if the counterfactual approach has effectively removed the confounder signals from the predictions.'", "\nauthor:\n- |\n Elias Chaibub Neto\\\n Sage Bionetworks, Seattle, WA 98109\ntitle: 'Causality-aware counterfactual confounding adjustment for feature representations learned by deep models: with an application to image classification tasks'\n---\n\nIntroduction\n============\n\nAs pointed out in [@irm2019], DNN models are able to learn complex prediction rules from biased data, tarnished by confounding factors and selection biases. ", "Training DNN models in biased datasets allows the models to carelessly leverage all correlations in the data, including spurious correlations contributed by these data biases, which are unrelated to the causal mechanisms of interest. ", "The unwanted consequence is a potential decrease in generalization performance under dataset shift. ", "As a hypothetical example, consider a slight variant of the though experiment described in [@irm2019], where the goal is to classify cows versus camels. ", "Suppose that the training set is comprised of pictures taken outdoors under natural settings where 99% of pictures of cows were taken in green pastures while 99% of pictures of camels are taken in deserts. ", "In this situation it is possible that a convolutional neural network (CNN) might learn to exploit landscape color to classify cows versus camels, so that the CNN might easily misclassify pictures of cows taken, for instance, in a beach. ", "If this is the case, and we want to evaluate the classifier performance on a test set where only 80% of the cow and camel pictures are taken in green pastures and beige deserts, respectively, then we might see degraded generalization performance.", "\n\nIn situations where the context where the picture is taken (e.g., green pasture versus desert in the above example) is available, we can use this observed confounding variable to try to remove, or at least reduce, the impact of the confounder on the predictive performance of the classifier. ", "Confounding adjustment is an active research area in ML, with balancing approaches being commonly adopted remedies to prevent DNNs from leveraging spurious associations induced by confounders.", "\n\nIn this paper, we propose an alternative approach inspired by the causality-aware counterfactual confounding adjustment described in [@chaibubneto2020]. ", "While the approach in reference [@chaibubneto2020] is only directly applicable to linear structural causal models, here we show how it can be easily adapted to remove confounding biases from the learned representations generated by DNNs. ", "The key insight is that by training a highly accurate DNN using softmax activation at the classification layer, and adopting the feature representation learned by the last layer prior to the output layer (as illustrated in Figure \\[fig:linearization.trick\\]) as the features of a logistic regression model, we have that, by construction, our features will fit well a logistic regression model, since the softmax classification used to generate the output of the DNN is essentially performing logistic regression classification. ", "Therefore, even though the associations between the raw inputs and the labels can be highly non-linear, the associations between the learned representation/features and the labels can be well captured by a linear classifier. ", "As a consequence, we can use a simple linear regression model to adjust for confounding, using the counterfactual confounding adjustment proposed by [@chaibubneto2020]. *", "Throughout the text we denote this process of learning a feature representation that fits well a linear classifier as the “linear modeling step\" performed by DNNs.*", "\n\n![", "The softmax classification step involving the last two layers of this cartoon DNN represent the “linear modeling step\" performed by DNNs.[]{data-label=\"fig:linearization.trick\"}](linearization_trick_figure){width=\"4in\"}\n\n- 0.1in\n\nThe causality-aware counterfactual confounding adjustment is presented in detail in Algorithm 1 in Section 4. ", "In a nutshell, the approach is implemented by regressing each learned feature on the confounder and label variables in order to estimate regression coefficients and residuals, and then generate new counterfactual features by adding back the estimated residuals to a linear predictor which excludes the confounder variables. ", "By doing so, we generate counterfactual features whose association with the confounder variable is exclusively mediated by the labels, and then use these counterfactual features as the inputs of logistic regression classifiers, which no longer leverage the associations with the confounder in their predictions.", "\n\nWe validate the proposed counterfactual confounding adjustment using a variant of the “colored MNIST\" dataset described in reference [@irm2019], which corresponds to a synthetic binary classification dataset derived from the MNIST data. ", "Following [@irm2019], we assign label “0\" to digits $\\{0, 1, 2, 3, 4\\}$, and label “1\" to digits $\\{5, 6, 7, 8, 9 \\}$, and color each digit image as either red or green, in a way that most of the training set images labeled as “0\" are assigned the green color and most of the training set images labeled as “1\" are assigned the red color. ", "Using this dataset we evaluate the effectiveness of the approach in a series of experiments in both the: (i) absence of dataset shift, where the test set is colored in exactly the same manner as the training set; and (ii) presence of increasing amounts of dataset shift, where we decrease the proportion of green images labeled as “0\" and red images labeled as “1\" in the test set, in order to generate a shift in the joint distribution of the confounder (red or green color) and label (“0\" or “1\") variables. ", "In order to validate our approach in a more challenging dataset, we also repeat our experiments using the “colored fashion-MNIST\" dataset, generated by coloring the fashion-MNIST dataset [@fashion2017] in the exact same way as the MNIST data.", "\n\nOur experiments show that while increasing amounts of dataset shift lead to increasing degradation of the generalization performance for classifiers trained without any adjustment, the classifiers built with counterfactually adjusted features still achieved strong generalization performance across all levels of dataset shift. ", "We also show that in the absence of dataset shift, a situation where the color variable improves the predictive performance, the counterfactual adjustment leads to a decrease in predictive performance, as it prevents the classifier from exploiting the image color for the predictions. ", "Comparison against a variation of the SMOTE [@chawla2002] approach (where we balance the joint training distribution of confounders and labels) showed that the causality-aware approach compared favorably against SMOTE balancing in the colored MNIST dataset.", "\n\nThe remaining of this paper is organized as follows. ", "Section 2 provides notation and background required for the other sections. ", "Section 3 describes the causal model underlying image databases. ", "Section 4 describes in detail the proposed counterfactual adjustment. ", "In Section 5 we show how to use conditional independence tests proposed in [@chaibubneto2019] to evaluate the effectiveness of the counterfactual adjustment. ", "Sections 6 and 7 describe the colored MNIST and colored fashion-MNIST experiments, respectively. ", "Section 8 presents the comparison against the SMOTE balancing approach. ", "Section 9 shows how the adoption of a linear classifier is essential part of the approach. ", "Section 10 describes related previous work. ", "Finally, Section 11 presents final remarks and puts our work in a broader context of applications outside image classification.", "\n\nNotation and background\n=======================\n\nThroughout the text, we let $Y$, $C$, and $P_{ix}$ represent, respectively, the classification labels, the confounder variable, and the raw image data (pixels). ", "We use $X$ to denote a feature representation learned by a DNN, and denote the set of learned features by ${\\boldsymbol{X}}= \\{X_1, X_2, \\ldots, X_k \\}$, where $k$ represents the number of units in the hidden layer prior to the output layer (e.g., $k=3$ in the cartoon DNN in Figure 1 in the main text. ", "As before, the causality-aware counterfactual versions of the learned features are represented by $X^\\ast$. Selection mechanisms are represented by an squared $S$ variable. ", "We let the superscripts $tr$ and $ts$ represent, respectively, the training and test sets.", "\n\nIn this work, we subscribe to Pearl’s mechanism-based approach to causation [@pearl2009] where the joint probability distribution of a set of random variables is supplemented by a *directed acyclic graph* (DAG), describing the qualitative assumptions about the causal relation between the variables, also denoted as a *causal diagram/graph*. ", "In this framework, the *nodes* on the causal graph represent the random variables, and the *directed edges* represent causal influences of one variable on another. ", "We represent observed variables by round frames, and variables that have been assigned an specific value (i.e., variables that have been conditioned on) by squared frames.", "\n\nA path is said to be *d-separated* or *blocked* [@pearl2009] by a set of nodes ${\\boldsymbol{W}}$ if and only if: (i) the path contains a chain $V_j \\rightarrow V_m \\rightarrow V_k$ or a fork $V_i \\leftarrow V_m \\rightarrow V_k$ such that the middle node $V_m$ is in ${\\boldsymbol{W}}$; or (ii) the path contains a collider $V_j \\rightarrow V_m \\leftarrow V_k$ such that $V_m$ is not in ${\\boldsymbol{W}}$ and no descendant of $V_m$ is in ${\\boldsymbol{W}}$. Otherwise, the path is said to be *d-connected* or *open*. ", "A joint probability distribution over a set of variables is *faithful* [@spirtes2000; @pearl2009] to a causal diagram if no conditional independence relations, other than the ones implied by the d-separation criterion are present. ", "We adopt the notation $V_1 {\\not\\perp\\!\\!\\!\\perp}V_2$ and $V_1 {\\perp\\!\\!\\!\\perp}V_2$ to represent marginal statistical dependence and independence, respectively. ", "Conditional dependencies and independencies of $V_1$ and $V_2$ given $V_3$ are represented, respectively, by $V_1 {\\not\\perp\\!\\!\\!\\perp}V_2 \\mid V_3$ and $V_1 {\\perp\\!\\!\\!\\perp}V_2 \\mid V_3$.\n\nThe causal model underlying image classification databases\n==========================================================\n\nAs pointed in reference [@irm2019], in image classification tasks causation does not happen between pixels, but between the real-world concepts captured by the camera. ", "Here, we describe the “real-world causal mechanisms\" generating the observed variables, $Y$, $C$, and $P_{ix}$, in a image classification database. ", "While the causal model is general, for concreteness we describe it in terms of the cows versus camels classification example, and let the nature variable $Y = \\{\\mbox{cow}, \\mbox{camel}\\}$ represent the labels and $A = \\{\\mbox{green}, \\mbox{beige}\\}$ represent a surrogate variable for the environment (pasture or desert) where these animals live under natural circumstances. ", "We let $S$ represent a binary variable indicating the presence of a selection bias mechanism (described in more detail below).", "\n\nFigure \\[fig:causal.diagram.", "Y.A.P\\] presents the causal diagram. ", "The arrow $Y \\rightarrow P_{ix}$ indicates that the real world cow or camel causes the observed patterns and intensities of pixels in the image. ", "Note that, in terms of the real-world causal mechanisms, the cow or camel precedes the picture and when we take a picture of a cow or a camel the shape and color of these animals is imprinted as a pattern of pixels with varying intensities. ", "Clearly, the observed pixels in the picture cannot cause a cow or a camel in the real-world[^1]. ", "Similarly, the arrow $C \\rightarrow P_{ix}$ indicates that while the green pasture or beige desert environments also influence the observed intensities and patterns of pixels in the image, the observed pixels cannot “cause\" a pasture or desert environment in the real-world.", "\n\n$$\\[email protected]{\n& *+[F-:<10pt>]{C} \\ar[dl] \\ar[r] & *+[F]{S} \\\\\n*+[F-:<10pt>]{P_{ix}} & & *+[F-:<10pt>]{Y} \\ar[ll] \\ar[u] \\\\\n}$$\n\nFinally, note that the arrows pointing from both $Y$ and $C$ towards the square-framed $S$ variable indicates the presence of a selection mechanism generating an association between $Y$ and $C$ in the database. ", "Here, the squared frame around $S$ indicates that we are conditioning on the $S$ variable.", "\n\nAs an example, consider a database (denoted database 1) where the cow pictures were taken in organic livestock farms in France, while the camel pictures were taken in Middle East deserts. ", "For this database, most of the cow pictures will be associated with green pasture backgrounds, while most of the camel pictures will be associated with beige desert backgrounds. ", "Hence, conditional on the fact that database 1 was generated from pictures taken in France and in the Middle East, we observe a strong association between $Y$ and $C$. ", "In this example, we define $S$ as a binary variable assuming value 1 when a picture was taken in France or in the Middle East, and value 0 otherwise. ", "Because any ML models generated from database 1 are conditional on the fact that that the data came from France or the Middle East, i.e., $S = 1$, we represent $S$ using a square frame. (", "Note that by conditioning on $S = 1$ the $C$ and $Y$ variables become d-connected.)", "\n\nNow, consider a second database (denoted database 2) where the cow pictures were taken in natural grassland farms in semi-arid African countries and the camel pictures were taken in the Sahara desert. ", "In this second dataset, the association between the green/beige background color and the cow/camel labels is expected to be weaker than in database 1, because except for the cow pictures taken during the rainy season, when the natural grasslands are green, the pictures taken during the dry season will also show beige backgrounds of dried grasslands. ", "For this second dataset, we have that $S$ represents a binary variable assuming value 1 when a picture was taken in Africa, and 0 otherwise. ", "Due to the different selection mechanisms, there is a clear drift in the joint distribution of $\\{C, Y\\}$ in database 2 relative to database 1.", "\n\nThe causal diagram in Figure \\[fig:causal.diagram.", "Y.A.P\\] shows that $C$ represents a confounder of the relationship between the labels, $Y$, and the pixels, $Pix$. Figure \\[fig:conf.adjusts\\] describes two ways we can potentially remove the spurious associations between $Y$ and $P_{ix}$ generated by $C$. ", "Panel a shows that we could attempt to remove the association between $Y$ and $C$ by balancing the data, while panel b shows that we could try to remove the causal influence of $C$ on $P_{ix}$ by using a counterfactual approach. ", "In this paper, we take the latter route. ", "However, instead of attempting to directly model the highly non-linear causal relations $Y \\rightarrow P_{ix}$ and $C \\rightarrow P_{ix}$, we leverage the “linear modeling step\" described before and work with the learned representation, ${\\boldsymbol{X}}$, as described in the next section.", "\n\n$$\\[email protected]{\n(a) & *+[F-:<10pt>]{C} \\ar[dl] & & (b) & *+[F-:<10pt>]{C} \\ar[r] & *+[F]{S} \\\\\n*+[F-:<10pt>]{P_{ix}} & & *+[F-:<10pt>]{Y} \\ar[ll] & *+[F-:<10pt>]{P_{ix}^\\ast} & & *+[F-:<10pt>]{Y} \\ar[ll] \\ar[u] \\\\\n}$$\n\nCausality-aware counterfactual confounding adjustment for learned representations\n=================================================================================\n\nUsing the “linear modeling step\" we generate a set of learned features, ${\\boldsymbol{X}}$. Training a logistic regression classifier using ${\\boldsymbol{X}}$ as inputs is essentially equivalent as training a DNN on the raw input data. ", "Clearly, because ${\\boldsymbol{X}}$ simply corresponds to a transformation of the raw data $P_{ix}$, we can still represent the data generation process associated with $Y$, $C$, and ${\\boldsymbol{X}}$ by the causal diagram in Figure \\[fig:learned.features.causal.diagrams\\]a, where $P_{ix}$ is replaced by ${\\boldsymbol{X}}$.\n\nHowever, training a logistic regression classifier on ${\\boldsymbol{X}}$ will still generate predictions biased by $C$. ", "In order to remove/reduce the influence of $C$ on the predictive performance of the classifier, we apply the proposed causality-aware adjustment to generate counterfactual features, ${{\\boldsymbol{X}}^\\ast}$, according to the causal diagram in Figure \\[fig:learned.features.causal.diagrams\\]b. ", "The key idea is to apply a modification of Pearl’s three step approach for generating deterministic counterfactuals [@pearl2009] where we: (i) regress each separate feature on the labels and the confounders; (ii) estimate the regression coefficients and model residuals; and (iii) generate new counterfactual features by adding back the estimated residuals to a linear predictor that no longer includes the confounder variable.", "\n\n[$$\\[email protected]{\n(a) & *+[F-:<10pt>]{C} \\ar[dl] ] \\ar[r] & *+[F]{S} & (b) & *+[F-:<10pt>]{C^{tr}} \\ar[r] & *+[F]{S^{tr}} & *+[F]{S^{ts}} & *+[F-:<10pt>]{C^{ts}} \\ar[l] & \\\\\n*+[F-:<10pt>]{{\\boldsymbol{X}}} & & *+[F-:<10pt>]{Y} \\ar[ll] \\ar[u] & *+[F-:<10pt>]{{{\\boldsymbol{X}}^\\ast}^{tr}} & & *+[F-:<10pt>]{Y^{tr}} \\ar[ll] \\ar[u] & *+[F-:<10pt>]{Y^{ts}} \\ar[rr] \\ar[u] & & *+[F-:<10pt>]{{{\\boldsymbol{X}}^\\ast}^{ts}} \\\\\n}$$]{} -0.1in\n\n-0.1in\n\nMechanistically, the approach is implemented according to Algorithm 1:\n\nFit a DNN to the training images.\\\nPropagate the raw data from each image in the training and test set through the DNN and extract the respective learned features (which correspond to the values generated by the hidden-layer of the DNN closer to the output layer).\\\n\nNote that we do not make use of the test set labels in the estimation of the counterfactual test set features.", "\n\nOnce the counterfactual features have been generated by Algorithm 1, we can then use $\\hat{{\\boldsymbol{X}}}^{\\ast tr}$ to train a logistic regression classifier, and then use $\\hat{{\\boldsymbol{X}}}^{\\ast ts}$ to generate predictions that are no longer biased by the confounder (or at least impacted by a lesser degree).", "\n\nNow, it is important to clarify that we cannot compute the test set causality-aware features in the same way as in the training set by simply adding the test set residuals, $\\hat{W}_{X_j}^{ts}$, to the linear predictor $\\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j} Y}^{ts} \\, Y^{ts}$ since we cannot use the test set labels (the quantity we want to predict) to calculate the test set counterfactual features. ", "Nonetheless, we show next that the computation of the test set causality-aware features as $\\hat{X}_j^{\\ast ts} = X_j^{ts} - \\sum_i \\hat{\\beta}_{{X_j} {C_i}}^{tr} \\, C^{ts}_i$ (line 5 of Algorithm 1) is a good approximation for $\\hat{X}_j^{\\ast ts} = \\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j} Y}^{ts} \\, Y^{ts} + \\hat{W}_{X_j}^{ts}$.\n\nNote that because both the training and test features $\\hat{{\\boldsymbol{X}}}^{tr}$ and $\\hat{{\\boldsymbol{X}}}^{ts}$ are generated by propagating the raw pixel data from the training and test images, $P_{ix}^{tr}$ and $P_{ix}^{ts}$, on the same trained CNN we have that, by construction, the conditional distributions of the learned features given the labels and the confounders will be the same in the training and test sets, $$Pr^{tr}(X_j \\mid Y, {\\boldsymbol{C}}) \\, = \\, Pr^{ts}(X_j \\mid Y, {\\boldsymbol{C}})~,$$ so that for large enough sample sizes the estimates of the regression coefficients $\\mu_j$, $\\beta_{{X_j} Y}$, and $\\beta_{{X_j}{C_i}}$ will be similar in the training and test sets. ", "This shows that, for large enough sample sizes (what is usually the case in deep learning applications), we have that the estimation of the causality-aware test features as, $\\hat{X}_j^{\\ast ts} = X_j^{ts} - \\sum_i \\hat{\\beta}_{{X_j} {C_i}}^{tr} \\, C^{ts}_i$, is approximately equivalent to computing the features as $\\hat{X}_j^{\\ast ts} = \\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j} Y}^{ts} \\, Y^{ts} + \\hat{W}_{X_j}^{ts}$ since, $$\\begin{aligned}\nX_j^{\\ast ts} &= X_j^{ts} - \\sum_i \\hat{\\beta}_{{X_j} {C_i}}^{tr} \\, C^{ts}_i \\\\\n&\\approx X_j^{ts} - \\sum_i \\hat{\\beta}_{{X_j} {C_i}}^{ts} \\, C^{ts}_i \\\\\n&= X_j^{ts} - \\sum_i \\hat{\\beta}_{{X_j} {C_i}}^{ts} \\, C^{ts}_i + (\\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j}Y}^{ts} Y^{ts}) - (\\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j}Y}^{ts} Y^{ts}) \\\\\n&= \\underbrace{\\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j} Y}^{ts} \\, Y^{ts}}_{\\mbox{linear predictor}} + \\underbrace{X_j^{ts} - \\hat{\\mu}_j^{ts} - \\hat{\\beta}_{{X_j}Y}^{ts} Y^{ts} - \\sum_i \\hat{\\beta}_{{X_j} {C_i}}^{ts}}_{\\mbox{test set residuals}} \\\\\n&= \\hat{\\mu}_j^{ts} + \\hat{\\beta}_{{X_j} Y}^{ts} \\, Y^{ts} + \\hat{W}_{X_j}^{ts}~.\\end{aligned}$$\n\nIn the next section, we describe how to empirically evaluate if the adjustment is working well in practice.", "\n\nEmpirical evaluation of the adjustment’s effectiveness\n======================================================\n\nFollowing [@chaibubneto2019], we describe a simple approach to evaluate if the causality-aware adjustment is indeed removing the spurious associations generated by the confounders from the predictions generated by the logistic regression classifier. ", "The key idea is to represent the data generation process of the observed data together with the data generation process giving rise to the predictions as a causal diagram, and compare the conditional independence relations predicted by d-separation against the conditional independence (CI) relations observed in the data. ", "For instance, Figure \\[fig:classification.causal.diagram\\]a represents the full causal diagram for image classification task, where $\\hat{R}^{ts}$ represents the predicted positive class probability of the test set examples. ", "Figure \\[fig:classification.causal.diagram\\]b represents a simplified version that displays only the test data and omits the learned representation node, ${{\\boldsymbol{X}}}^{ts}$. Note that for this diagram, $C$ represents a confounder[^2] of the prediction $\\hat{R}^{ts}$, since there is an open path from $C^{ts}$ to $\\hat{R}^{ts}$ that does not go through $Y^{ts}$, as well as, an open path from $C^{ts}$ to $Y^{ts}$ that does not go through $\\hat{R}^{ts}$. Figure \\[fig:classification.causal.diagram\\]c and d represent causal diagrams for tasks trained with the causality-aware counterfactual features. ", "Note that in Figure \\[fig:classification.causal.diagram\\]d, $C^{ts}$ is no longer a confounder of the predictions $\\hat{R}^{ts}$, since the only open path connecting $C^{ts}$ to $\\hat{R}^{ts}$ goes through $Y^{ts}$.\n\n[$$\\[email protected]{\n*+[F]{S^{tr}} & *+[F-:<10pt>]{C^{tr}} \\ar[l] \\ar[d] & (a) & *+[F-:<10pt>]{C^{ts}} \\ar[r] \\ar[d] & *+[F]{S^{ts}} & (b) & *+[F-:<10pt>]{C^{ts}} \\ar[r] \\ar[dl] & *+[F]{S^{ts}} \\\\\n*+[F-:<10pt>]{Y^{tr}} \\ar[u] \\ar[r] \\ar@/^1.25pc/@[red][rr] & *+[F-:<10pt>]{{{\\boldsymbol{X}}}^{tr}} \\ar@[red][r] & *+[F-:<10pt>]{\\hat{R}^{ts}} & *+[F-:<10pt>]{{{\\boldsymbol{X}}}^{ts}} \\ar@[red][l] & *+[F-:<10pt>]{Y^{ts}} \\ar[u] \\ar[l] & *+[F-:<10pt>]{\\hat{R}^{ts}} & & *+[F-:<10pt>]{Y^{ts}} \\ar[u] \\ar@[red][ll] \\\\\n*+[F]{S^{tr}} & *+[F-:<10pt>]{C^{tr}} \\ar[l] & (c) & *+[F-:<10pt>]{C^{ts}} \\ar[r] & *+[F]{S^{ts}} & (d) & *+[F-:<10pt>]{C^{ts}} \\ar[r] & *+[F]{S^{ts}} \\\\\n*+[F-:<10pt>]{Y^{tr}} \\ar[u] \\ar[r] \\ar@/^1.25pc/@[red][rr] & *+[F-:<10pt>]{{{\\boldsymbol{X}}^\\ast}^{tr}} \\ar@[red][r] & *+[F-:<10pt>]{\\hat{R}^{ts}} & *+[F-:<10pt>]{{{\\boldsymbol{X}}^\\ast}^{ts}} \\ar@[red][l] & *+[F-:<10pt>]{Y^{ts}} \\ar[u] \\ar[l] & *+[F-:<10pt>]{\\hat{R}^{ts}} & & *+[F-:<10pt>]{Y^{ts}} \\ar[u] \\ar@[red][ll] \\\\\n}$$]{}\n\nIf the causality-aware counterfactual adjustment is effective (and faithfulness holds) then, from the application of d-separation [@pearl2009] to the simplified causal graph in Figure \\[fig:classification.causal.diagram\\]d, we would expect to see the following pattern of CI relations in the data: $${\\hat{R}^{ts}} {\\not\\perp\\!\\!\\!\\perp}Y^{ts}~, \\;\\; {\\hat{R}^{ts}} {\\not\\perp\\!\\!\\!\\perp}C^{ts}~, \\;\\; C^{ts} {\\not\\perp\\!\\!\\!\\perp}Y^{ts}~,$$ $${\\hat{R}^{ts}} {\\not\\perp\\!\\!\\!\\perp}Y^{ts} \\mid C^{ts}~, \\;\\; {\\hat{R}^{ts}} {\\perp\\!\\!\\!\\perp}C^{ts} \\mid Y^{ts}~, \\;\\; C^{ts} {\\not\\perp\\!\\!\\!\\perp}Y^{ts} \\mid \\hat{R}^{ts}~.$$ That is, we would expect ${\\hat{R}^{ts}}$ and $C^{ts}$ to be conditionally independent given $Y^{ts}$, since conditioning on $Y^{ts}$ blocks the path $C^{ts} \\rightarrow S^{ts} \\leftarrow Y^{ts} \\rightarrow \\hat{R}^{ts}$ in Figure \\[fig:classification.causal.diagram\\]b. ", "On the other hand, if the adjustment has failed (or if no adjustment was performed), we would expect to see the conditional association ${\\hat{R}^{ts}} {\\not\\perp\\!\\!\\!\\perp}C^{ts} \\mid Y^{ts}$ in the data. ", "In the next sections we illustrate the application of these sanity checks in our experiments with the colored MNIST and colored fashion-MNIST data.", "\n\nColored MNIST experiments\n=========================\n\nWe validated the proposed confounding adjustment using a variant of the “colored MNIST\" dataset described in reference [@irm2019]. ", "For each grey-scale image in the MNIST data we generate a synthetic RGB colored image by assigning the original grey-scale image pixels to either the red channel or the green channel of the synthetic colored image, depending on whether the image was colored as red or green. ", "Similarly to [@irm2019], we assign label “0\" to digits $\\{0, 1, 2, 3, 4\\}$, and label “1\" to digits $\\{5, 6, 7, 8, 9 \\}$, and color each digit image as either red or green, in a way that 98% of the training set images labeled as “0\" are assigned the green color and 98% of the training set images labeled as “1\" are assigned the red color. ", "Using this training dataset, we evaluate the effectiveness of the approach in a series of separate experiments, with increasing amounts of dataset shift in the test set relative to the training set.", "\n\nExplicitly, we conducted the following 6 experiments: (i) “**no shift experiment**\" where the joint distribution of labels and colors in the test set was the same as in the training set; (ii) “**shift experiment 1**\" where 90% of the “0\" labels were colored as green and 90% of the “1\" labels were colored red; (iii) “**shift experiment 2**\" where 70% of the “0\" labels were colored as green and 70% of the “1\" labels were colored red; (iv) “**shift experiment 3**\" where 50% of the “0\" labels were colored as green and 50% of the “1\" labels were colored red; (v) “**shift experiment 4**\" where 30% of the “0\" labels were colored as green and 30% of the “1\" labels were colored red; and (vi) “**shift experiment 5**\" where 10% of the “0\" labels were colored as green and 10% of the “1\" labels were colored red. ", "Figure \\[fig:shift.mosaic.plots\\] presents mosaic plots comparing the joint distribution of labels and color in the training set against the test set joint distributions in each of the 6 experiments.", "\n\n![", "Joint distributions of the label and color variables in the training set (panel a) versus 6 distinct test sets in the absence (panel b) and presence (panels c, d, e, f, and g) of dataset shift.[]{data-label=\"fig:shift.mosaic.plots\"}](shift_mosaicplots){width=\"\\columnwidth\"}\n\nIn all experiments we trained convolutional neural networks (CNNs) for 10 epochs using the RMSprop optimizer with learning rate 0.001, and mini-batches of 128 images according with the following architecture: Input $\\rightarrow$ Conv2d(32, (3, 3), relu) $\\rightarrow$ Conv2d(32, (3, 3), relu) $\\rightarrow$ MaxPooling2d((2, 2)) $\\rightarrow$ Dropout(0.25) $\\rightarrow$ Conv2d(32, (3, 3), relu) $\\rightarrow$ Conv2d(32, (3, 3), relu) $\\rightarrow$ MaxPooling2d((2, 2)) $\\rightarrow$ Dropout(0.25) $\\rightarrow$ Dense(16, relu) $\\rightarrow$ Dropout(0.5) $\\rightarrow$ Dense(2, softmax), where: Conv2d($f$, $s$, $a$) represents a convolutional layer with number of filters given by $f$, strides given by $s$, and activation given by $a$; MaxPooling2d($p$) represents the max-pooling operation with pool-size $p$; Dropout($r$) represents a dropout layer with dropout rate $r$; and Dense($u$, $a$) represents a dense layer with number of units given by $u$, and activation function given by $a$. (Note that the learned representation used in these illustrations corresponds to the values extracted from the 16 units in the Dense(16, relu) layer.) ", "All experiments were performed using the `keras` [@rkeras2017] R package [@rproject2019] (a R wrapper of Keras[@keras2015]). (", "Alternative training settings produced similar results.)", "\n\nFigure \\[fig:colored.mnist.experiments\\] reports the results. ", "The boxplots represent the results over 100 independent replications of each experiment, where for each replication a different set of randomly selected images were colored as red or green (in both the training and test sets). ", "Panel a reports the test set accuracies obtained by logistic regression classifiers trained with the CNN’s 16 learned features (without any adjustment) across the 6 experiments and shows a pronounced reduction in generalization performance with larger amounts of dataset shift. ", "These results illustrate that the feature representations learned by CNNs trained on the highly unbalanced training set were able to effectively capture the color signal. ", "Panel b shows the test set accuracies obtained by logistic regression classifiers trained and evaluated with the counterfactual feature representations. ", "Note the strong improvements in generalization performance in the experiments involving strong amounts of dataset shift. (", "Observe, as well, that the drop in accuracy in the “no shift experiment\", and to a lesser degree in the “shift experiment 1\", is expected since under no to small amounts of dataset shift the color actually helps the predictions, but the counterfactual adjustment removes its contribution.) ", "Finally, panels c to h present the results of the conditional independence “sanity checks\" for the “no shift experiment\" (panel c) and “shift experiments\" 1 to 5 (panels d to h), for both the “no adjustment\" (orange boxplots) and counterfactual adjustment (blue boxplots) cases. ", "In all experiments, the blue boxplots show that the CI relations are consistent with the causal graph in Figure \\[fig:classification.causal.diagram\\]d, showing that the counterfactual approach effectively removed the contribution of the color confounder to the predictive performance (as the partial correlation between $\\hat{R}^{ts}$ and $C^{ts}$ given $Y^{ts}$ is close to 0), while the orange boxplots provide evidence that the color confounder is still contributing to the predictive performance for classifiers trained with the unadjusted learned features (i.e., ${\\hat{R}^{ts}} {\\not\\perp\\!\\!\\!\\perp}C^{ts} \\mid Y^{ts}$).", "\n\n![", "Experimental results.[]{data-label=\"fig:colored.mnist.experiments\"}](colored_nmist_supple_figure){width=\"4.9in\"}\n\n-0.1in\n\n-0.1in\n\nColored fashion-MNIST experiments\n=================================\n\nWe also repeated our experiments using the fashion-MNIST dataset [@fashion2017]. ", "This dataset shares the same image size, number of classes, and training and test set sample sizes as the original MNIST data, and is often used as a direct drop-in replacement for the MNIST dataset. ", "It contains grey-scale images of clothing items such as shirts, coats, shoes, sandals, etc, and represents a more challenging classification task. ", "We colored the fashion-MNIST images and performed the exact same experiments as we did for the colored MNIST experiments. ", "The results were largely consistent, although the predictive performances were slightly but consistently lower and noisier than in the colored MNIST experiments. ", "The results are reported in Supplementary Figure \\[fig:colored.fashion.mnist.experiments\\].", "\n\nComparison with SMOTE balancing\n===============================\n\nWe compared the proposed counterfactual confounding method against a variant of the SMOTE (Synthetic Minority Over-sampling TEchnique) adjustment [@chawla2002] using the colored MNIST data. ", "Similarly to SMOTE, where the goal is to balance the label classes by under-sampling examples from the majority class and over-sampling synthetically modified examples from the minority class, our variation under-samples from the label/color majority categories and over-samples synthetically modified examples from the minority categories, in order to balance the label/color categories. ", "We denote this variation of SMOTE as “SMOTE balancing\". ", "In our experiments, the training set (Figure \\[fig:shift.mosaic.plots\\]a) contained the following four $\\{\\mbox{label}, \\mbox{color}\\}$ categories (at the following proportions): $\\{``0\", ``\\mbox{green}\"\\}$ (49%); $\\{``1\", ``\\mbox{green}\"\\}$ (1%); $\\{``0\", ``\\mbox{red}\"\\}$ (1%); and $\\{``1\", ``\\mbox{red}\"\\}$ (49%). ", "Application of the SMOTE balancing generated datasets with 25% of examples in each of the 4 categories where we randomly under-sampled images from the $\\{``0\", ``\\mbox{green}\"\\}$ and $\\{``1\", ``\\mbox{red}\"\\}$ categories, and over-sampled synthetically modified versions of images in the $\\{``0\", ``\\mbox{red}\"\\}$ and $\\{``1\", ``\\mbox{green}\"\\}$ categories. (", "Namely, for each one of the 600 images in each of these minority categories we generated 24 additional randomly rotated versions of the original image.)", "\n\nWe applied SMOTE balancing to the same 100 distinct training sets used in the causality-aware adjustment experiments reported in Figure \\[fig:colored.mnist.experiments\\]), and compared the SMOTE performance to the proposed causality-aware approach. ", "Figure \\[fig:counterfactual.vs.smote\\] reports the results and shows that while the SMOTE balancing (green boxplots) approach improves generalization relative to the no adjustment experiments (orange boxplots), the causality-aware approach compares favorably to SMOTE for the experiments based on stronger amounts of dataset shift. ", "Furthermore, the causality-aware approach has the additional practical advantage that it does not require the re-training of the DNN using balanced data. ", "This is particularly advantageous in applications involving massive datasets and large DNNs that have already been trained on biased data.", "\n\n![", "Comparison of the causality-aware adjustment (blue) against the SMOTE balancing adjustment (green). ", "The results without any adjustment are shown in orange.[]{data-label=\"fig:counterfactual.vs.smote\"}](colored_nmist_main_text_figure){width=\"2.0in\"}\n\nOn the need of linear classifiers\n=================================\n\nHere, we illustrate how the adoption of a linear classifier is an essential part of the proposed approach. ", "Using random forest classifiers, we show how non-linear classifiers trained on the counterfactual features can still exploit the confounder signal and suffer from decreased generalization performance under dataset shift conditions. ", "To this end, we repeated the same 6 experiments reported in Section 6 (colored MNIST) comparing the generalization performance obtained by adopting random forest and penalized logistic classifiers (based on ridge-regression and lasso penalties) as the shallow classifiers trained on the learned feature representations. ", "Figure \\[fig:linear.vs.nonlinear.shallow\\] reports the results. ", "The top panels show the results for the random forest classifier, where we see that the counterfactual adjustment (panel b) is still showing a more accentuated decrease in generalization performance for the experiments with strong shift. ", "Panel c reports the partial correlation between the classifier prediction and the color confounder conditional on the label variable, for classifiers trained on the original/unadjusted learned features (orange boxplots), as well as, on the counterfactual features (blue boxplots). ", "The fact that $\\mbox{cor}(\\hat{R}^{ts}, C^{ts} \\mid Y^{ts})$ is removed from 0 illustrates that the random forest prediction is still leveraging the color signal (even when trained on the counterfactual features). ", "The middle and bottom row panels show the results based on penalized logistic regression models (using the exact same learned feature data as the random forest), and illustrate how these linear classifiers achieve better generalization when trained on counterfactual features (panels e and h). (", "For completeness, Supplementary Figures \\[fig:random.forest.", "CIs\\], \\[fig:ridge.", "CIs\\], and \\[fig:lasso.", "CIs\\] show the CI patterns for each of these 3 models).", "\n\n![", "Comparison of linear vs non-linear shallow models trained on the features learned by a DNN.[]{data-label=\"fig:linear.vs.nonlinear.shallow\"}](linear_vs_nonlinear_shallow_models){width=\"3.5in\"}\n\n-0.1in\n\n-0.1in\n\nRelated work\n============\n\nPublished work in the intersection between causality and ML can be roughly split into two different categories. ", "The first, largely focus on the estimation of causal effects, and only uses supervised ML techniques as a tool to improve the estimation of causal effects [@kreif2019]. ", "The second, uses causality to improve the robustness and generalizability of ML predictions. ", "Here, we focus on this second category. ", "The potential benefits of causal modeling in challenging ML tasks has been well articulated in [@pearl2019; @scholkopf2019]. ", "Causal approaches based on counterfactual thinking have been used to predict the outcomes of different actions, policies, and interventions using observational data [@bottou2013; @swaminathan2015; @johansson2016; @schulam2017], as well as, to generate causality-aware predictions in static ML tasks based on linear structural causal models [@chaibubneto2020]. ", "An interesting line of research has also explored the close connection between invariance and causation aiming to learn invariant associations across different environments in order to improve generalization under dataset shifts [@irm2019]. ", "Related work in the particular context of image classification include [@chalupka2015; @lopezpaz2017; @shen2017].", "\n\nDiscussion\n==========\n\nIn real life applications, the effective use of counterfactual adjustments require the specification of a model that fits well the observed data. ", "For instance, attempting to fit a linear regression model to variables showing non-linear associations may lead to the estimation of regression coefficients that fail to capture the associations between outputs and inputs, so that these associations might still be leaked to the residuals. ", "The main insight in this paper is the realization that the “linear modeling step\" performed by DNNs allows for effective counterfactual adjustment in anticausal classification tasks where we can train an accurate DNN. (", "Anticausal tasks correspond to prediction problems where the output variable has a causal influence on the inputs.)", "\n\nWhile we have only illustrated the approach using CNNs in a simple binary classification task influenced by a single discrete confounder variable, the approach might also be potentially used with alternative DNN models, in multi-class tasks, and accounting for multiple discrete and/or continuous confounders. ", "However, empirical performance on these alternative settings is yet to be evaluated.", "\n\nIn addition to the image classification applications used as illustrations in this paper, the approach can be potentially applied outside computer vision problems. ", "For instance, diagnostic tasks in health applications, where the goal is to predict disease status based on input variables that measure disease symptoms, represent another important class of anticausal classification tasks that are often plagued by confounding biases.", "\n\nFinally, it is important to point out that the proposed approach is trivial to implement (as the generation of the counterfactual features only require the computation of linear regression fits), and that it does not require re-training DNNs (an important practical advantage in applications involving very large neural networks trained on massive datasets).", "\n\n[50]{}\n\nAllaire, J. J. and Chollet, F. (2018) keras: R Interface to ’Keras’. ", "R package version 2.0.8.9008. ", "https://keras.rstudio.com.", "\n\nArjovsky M., Bottou L., Gulrajani I., Lopez-Paz D. (2019) Invariant risk minimization. *", "arXiv:1907.02893v3*.", "\n\nBottou, J., et al (2013) Counterfactual reasoning and learning systems: the example of computational advertising. *", "Journal of Machine Learning Research*, **14**, 3207–3260.", "\n\nChaibub Neto, E., et al. (", "2019) Causality-based tests to detect the influence of confounders on mobile health diagnostic applications: a comparison with restricted permutations. ", "In Machine Learning for Health (ML4H) Workshop at NeurIPS 2019 - Extended Abstract. ", "arXiv:1911.05139.", "\n\nChaibub Neto, E. (2020) Towards causality-aware predictions in static machine learning tasks: the linear structural causal model case. ", "arXiv:2001.03998.", "\n\nChalupka, K., Perona, P., Eberhardt, F. (2015) Visual causal feature learning. *", "Uncertainty in Artificial Inteligence (UAI)*, 2015.", "\n\nChawla, N. V., Bowyer K. W., Hall L. O., Kegelmeyer W. P. (2002) SMOTE: synthetic minority over-sampling technique. *", "Journal of Artificial Intelligence Research*, **16**, 321–357.", "\n\nJohansson, F. D., Shalit, U., and Sontag, D. (2016) Learning representations for counterfactual inference. *", "International Conference on Machine Learning (ICML)*, 2017.", "\n\nKreif, N. and DiazOrdaz, K. (2019) Machine learning in policy evaluation: new tools for causal inference. ", "arXiv:1903.00402.", "\n\nLopez-Paz, D., Nishihara, R., Chintala, S., Scholkopf, B., Bottou, L. (2017) Discovering causal signals in images. ", "CVPR, 2017.", "\n\nPearl, J. (2009) *Causality: models, reasoning, and inference.* ", "Cambridge University Press New York, NY, 2nd edition.", "\n\nPearl, J. (2019) The seven tools of causal inference with reflections on machine learning. *", "Communications of ACM*, **62**, 54-60.", "\n\nR Core Team. (", "2019) R: A language and environment for statistical computing. ", "R Foundation for Statistical Computing, Vienna, Austria. ", "URL http://www.R-project.org/.\n\nSchölkopf, B. (2019) Causality for machine learning. ", "arXiv:1911.10500.", "\n\nSchulam, P., Saria, S. (2017) Reliable Decision Support Using Counterfactual Models. *", "Neural Information Processing Systems (NIPS)*, 2017.", "\n\nShen, Z., Cui, P., Kuang, K., Li, B. (2017) On image classification: correlation vs causality. ", "arXiv:1708.06656.", "\n\nSpirtes, P., Glymour, C. and Scheines, R. (2000) *Causation, Prediction and Search.* ", "MIT Press, Cambridge, MA, 2nd edition.", "\n\nSwaminathan, A., and Joachims, T. (2015) Batch learning from logged bandit feedback through counterfactual risk minimization. *", "Journal of Machine Learning Research*, **16**, 1731-1755.", "\n\nXiao, H., Rasul, K., Vollgraf, R. (2017) Fashion-MNIST: a novel image dataset for benchmarking machine learning algorithms. ", "arXiv:1708.07747\n\nChollet, F. (2015) Keras, Github repository, https://github.com/fchollet/keras.", "\n\nSupplementary figures {#supplementary-figures .unnumbered}\n=====================\n\n![", "Experimental results for the colored fashion-MNIST experiments.[]{data-label=\"fig:colored.fashion.mnist.experiments\"}](colored_fashion_nmist_figure){width=\"3.5in\"}\n\n![", "Conditional independence patterns for random forest classifiers trained on the unadjusted features (orange boxplots) and causality-aware counterfactual features (blue boxplots).[]{data-label=\"fig:random.forest.", "CIs\"}](correlation_plots_rf){width=\"3.5in\"}\n\n![", "Conditional independence patterns for ridge logistic regression classifiers trained on the unadjusted features (orange boxplots) and causality-aware counterfactual features (blue boxplots).[]{data-label=\"fig:ridge.", "CIs\"}](correlation_plots_ridge){width=\"3.5in\"}\n\n![", "Conditional independence patterns for lasso logistic regression classifiers trained on the unadjusted features (orange boxplots) and causality-aware counterfactual features (blue boxplots).[]{data-label=\"fig:lasso.", "CIs\"}](correlation_plots_lasso){width=\"3.5in\"}\n\n[^1]: One can argue that looking at the picture causes the human cognition to label it as a cow or a camel. ", "However, this “human cognition causal process\" is different from the “real-world causal process\" generating the observed variables. ", "This distinction between real-world causal mechanisms and human cognition causal processes is clearly presented in Figure 6 of reference [@irm2019]. ", "Because we are interested in modeling the causal processes underlying a machine learning classification task, in our work we will focus on the real-world causal mechanism giving rise to the observed data.", "\n\n[^2]: Following Pearl [@pearl2009], we adopt a graphical definition of confounding where a variable $C$ is a confounder of the relationship between variables $X$ and $Y$, if there is an open path from $C$ to $X$ that does not go thorough $Y$, and there is an open path from $C$ to $Y$ that does not go thorough $X$, in the DAG representing the data generation process giving rise to these variables.", "\n" ]
{ "pile_set_name": "ArXiv" }
[ 0.0005856931675225496, 0.0005929043400101364, 0.0006384139414876699, 0.000871493190061301, 0.0005940248374827206, 0.0006731405155733228, 0.000576418882701546, 0.0006558766472153366, 0.0005716528976336122, 0.0007092059240676463, 0.0008256212458945811, 0.0005668646190315485, 0.0007192443590611219, 0.0006937317084521055, 0.0006688524736091495, 0.0005510975606739521, 0.0005837570643052459, 0.0006991219124756753, 0.0005959271220490336, 0.0005767689435742795, 0.0006068277289159596, 0.0005467538721859455, 0.000606456829700619, 0.0005374571774154902, 0.0019055787706747651, 0.0006071270327083766, 0.0015240589855238795, 0.0006458335556089878, 0.0005885504651814699, 0.0007235665689222515, 0.0005254516145214438, 0.0005741075146943331, 0.0005705454386770725, 0.0005770922871306539, 0.0006108545348979533, 0.0005616535199806094, 0.0005438406951725483, 0.0005887841689400375, 0.000553870399016887, 0.0005761428619734943, 0.0006209308048710227, 0.0006713965558446944, 0.0005641771131195128, 0.0005680114845745265, 0.0005669878446497023, 0.0006714419578202069, 0.0008072693599388003, 0.0007793300319463015, 0.000712298322468996, 0.0005863304249942303, 0.0006029187352396548, 0.0005602312739938498, 0.013475177809596062, 0.0006468826904892921, 0.002304001245647669, 0.0014415514888241887, 0.0005964422016404569, 0.0008427362772636116, 0.0006523444317281246, 0.0008944766595959663, 0.0007846031803637743, 0.0010292502120137215, 0.0006274107727222145, 0.0008306154632009566, 0.0006253759493120015, 0.002170722233131528, 0.006684829015284777, 0.0005435416824184358, 0.000606116431299597, 0.0005713290302082896, 0.0006178556941449642, 0.0005927240708842874, 0.0013244161382317543, 0.000564412388484925, 0.0005895958747714758, 0.0005675888387486339, 0.0005907019949518144, 0.0007892271969467402, 0.0008738492033444345, 0.0006694681360386312, 0.000597622653003782, 0.0007093813037499785, 0.022170929238200188, 0.0008976630051620305, 0.0007492239819839597, 0.0006521915202029049, 0.007286455482244492, 0.0008654402918182313, 0.0006826447206549346, 0.0018528203945606947, 0.015248499810695648, 0.0007329359068535268, 0.0005364359240047634, 0.0008107376052066684, 0.0012063081376254559, 0.05374537780880928, 0.0027194637805223465, 0.0005945989396423101, 0.0007074538734741509, 0.0006384766311384737, 0.0007918592891655862, 0.0005091181956231594, 0.0006836766260676086, 0.0006098333396948874, 0.0019055787706747651, 0.0008944622240960598, 0.0005943116848357022, 0.0005834533367305994, 0.0006514848791994154, 0.0005549364723265171, 0.0005843549151904881, 0.0005556459072977304, 0.0006427302141673863, 0.0005330484709702432, 0.000565572059713304, 0.0005723618669435382, 0.0009385760058648884, 0.0019055787706747651, 0.0006971014081500471, 0.0006261900416575372, 0.0006344174034893513, 0.0006540595786646008, 0.0006578643224202096, 0.0005957973189651966, 0.0008110508788377047, 0.0007049874984659255, 0.0009767829906195402, 0.0010302960872650146, 0.001113766455091536, 0.0006577633903361857, 0.0006009552162140608, 0.0006198047194629908, 0.0005896009388379753, 0.0007967929122969508, 0.0019055787706747651, 0.0006058259168639779, 0.0006479908479377627, 0.0006275105988606811, 0.0006143460632301867, 0.000605909968726337, 0.0005374710308387876, 0.0005710606928914785, 0.0011366268154233694, 0.0005900801625102758, 0.0007032941794022918, 0.0011488249292597175, 0.0033520113211125135, 0.0006009998614899814, 0.0019055787706747651, 0.0005825551343150437, 0.0006251983577385545, 0.0006555716972798109, 0.0006398115656338632, 0.0006005822215229273, 0.0006380067206919193, 0.0005138539127074182, 0.0005969461053609848, 0.0006159316399134696, 0.000582217937335372, 0.0006031788070686162, 0.0007675816887058318, 0.0005786877009086311, 0.0005551967187784612, 0.0005598787101916969, 0.0006330683827400208, 0.0005567473126575351, 0.000680368859320879, 0.0007305127801373601, 0.0009682525997050107, 0.0006140694604255259, 0.0008443531114608049, 0.0006210684077814221, 0.0007926097605377436, 0.0006896454142406583, 0.0006211923900991678, 0.00060371367726475, 0.000743861950468272, 0.0006542128976434469, 0.0007546328706666827, 0.0006746487342752516, 0.0005858358344994485, 0.0009337904630228877, 0.0006725909188389778, 0.0006503229378722608, 0.0006347225862555206, 0.0006795309600420296, 0.0007372714462690055, 0.0006765839643776417, 0.0007599902455694973, 0.0006228395504876971, 0.0007094594184309244, 0.0006207879050634801, 0.0007010788540355861, 0.0006440000724978745, 0.0006252489401958883, 0.0006207310943864286, 0.0007403821218758821, 0.0006818299880251288, 0.00064846221357584, 0.0006137230666354299, 0.0006512393592856824, 0.0007417571032419801, 0.0006406313623301685, 0.0006674801697954535, 0.000637824647128582, 0.0007212760974653065, 0.0006754575297236443, 0.0006921840249560773, 0.0012033605016767979, 0.0006287130527198315, 0.0006115486612543464, 0.0006682917010039091, 0.0006177977193146944, 0.0006620740168727934, 0.0007838058518245816, 0.0009271556627936661, 0.000583415268920362, 0.0005630741943605244, 0.0005194808472879231, 0.0006709004519507289, 0.0019954426679760218 ]
0.001275
221
[ "Eva Puck\n\nEva Puck (November 25, 1892 – October 25, 1979) was an American entertainer, a vaudeville headliner who later found success performing in Broadway musical comedies and film.", "\n\nEarly life\nShe was born in New York City, the middle of three children raised by Abraham and Lena (née Salmon) Puck. ", "There is some question about the family surname being Puck or Salmon, both were used in early press articles. ", "Little is known of her mother who came to America from Poland in 1874 or her English father who immigrated in 1882. ", "They married in 1887 and by 1899 had Eva and her older brother Harry performing in a vaudeville song and dance act known as the Two Little Pucks.", "\n\nOn May 10, 1903, police raided the Trocadero Music Hall in Manhattan's Fort George district where the Puck children were performing as headliners and arrested their parents and the theater manager, Freeman Bernstein. ", "They were charged with a violation of Section 289 of the Penal Code in unlawfully consenting to the employment, and in the employment, of minors in a theatrical exhibition. ", "The investigators were concerned over the hours that Eva and her brother were keeping and also found the Trocadero an unsuitable environment for children with patrons smoking and consuming alcohol. ", "The three were later brought to trial in the Court of Special Sessions, and found guilty. ", "The judge, in passing sentence said, in part:\n\n\"We cannot resist the conviction that these parents have been living largely upon the earnings of these children, which amount from $125 to $150 per month. ", "Now, this sort of business cannot be continued or permitted, and if these defendants come before this Court again the punishment will be more drastic.”", "\n\nHer father was fined $100, or thirty days jail time; and her mother $25, or fifteen days in the City Prison. ", "Bernstein was fined $50.", "\n\nFor the next few years, the Two Little Pucks continued to perform at venues outside New York and later, as they entered their teens, toured as Eva and Harry Puck before disbanding sometime around 1918. ", "Harry went on to be a successful choreographer, composer, songwriter and music publisher. ", "He was a business partner of lyricist Bert Kalmar and wrote songs with him until Kalmar started his more famous songwriting partnership with composer Harry Ruby. ", "Eva remained in vaudeville, soon teaming up with her future husband, song and dance comedian Sammy White (1894-1960).", "\n\nTheir younger brother, Laurence \"Larry\" Puck, became a radio and television producer and general manager of Unicorn Productions Inc., a subsidiary of CBS. ", "He later married Mabel Withee, a singer and dancer active on Broadway over the 1920s.", "\n\nCareer\nEva Puck became a member of the vaudeville comedy act Clayton and White that, after Lew Clayton's departure around 1920, became known as Puck and White. ", "One of their popular vaudeville sketches (\"Opera vs. Jazz\") portrayed White as a scholarly music teacher and Eva as his inept student. ", "The couple married in 1922. ", "and together appeared in Broadway shows such as the Greenwich Village Follies (1923), Rodgers and Hart musical The Girl Friend (1926), and Jerome Kern's Show Boat (1927). ", "Puck also appeared as Helen Cheston in the original Broadway run of the musical Irene from November 1919 to June 1921.", "\n\nThe two played in the original 1927 Broadway stage version of Show Boat. ", "In the musical, White played the role of comic dancer Frank Schultz, and Puck played the role of Ellie May Chipley, who eventually marries Frank. ", "In 1932, the two reprised their roles in the first Broadway revival of the show. ", "However, by the time Universal Pictures released the 1936 film version, the two had divorced, so the role of Ellie went to Queenie Smith, with White repeating his performance as Frank in the film.", "\n\nPuck and White appeared in a short film made by Lee De Forest in his Phonofilm sound-on-film process, which premiered at the Rivoli Theater in New York City on 15 April 1923. ", "The film shows Puck and White performing their comic routine entitled \"Opera vs. Jazz\", and is preserved in the Maurice Zouary film collection at the Library of Congress.", "\n\nIn the mid-1930s, Eva Puck married Robert Groves (or Graves), a California merchant, and retired from the stage.", "\n\nDeath\nEva Puck died in 1979, aged 86, at the Granada Hills Community Hospital in Los Angeles. ", "She had a daughter, Lauretta (sometimes spelled Laurette) Puck, born in New York in 1912. ", "Nothing is known about her father except that he was born in Hungary. ", " She appeared in the short Leon Errol film Should Wives Work? (", "1937) and had previously toured with the Arthur Ashley Players.", "\n\nLauretta later married William R. Golden, a Hollywood executive, and became a nationally known exhibitor and breeder of Irish Setters. ", "A resident of Pacific Palisades, she died after an extended illness on July 17, 1972.", "\n\nExternal links\n\nEva Puck and Sammy White at SilentEra with photo of Puck and White performing their sketch \"Opera vs. Jazz\"\nBook with information on Eva Puck\n\nReferences\n\nCategory:1892 births\nCategory:1979 deaths\nCategory:American people of Polish descent\nCategory:American people of English descent\nCategory:Vaudeville performers\nCategory:American musical theatre actresses\nCategory:19th-century American actresses\nCategory:American stage actresses\nCategory:20th-century American actresses\nCategory:American film actresses\nCategory:20th-century American singers\nCategory:20th-century American women singers" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0010680548148229718, 0.002127269748598337, 0.000665685161948204, 0.0006859857239760458, 0.001433409284800291, 0.000953939335886389, 0.0015137019800022244, 0.00496242381632328, 0.0011172209633514285, 0.0007326289778575301, 0.0008848487050272524, 0.009025152772665024, 0.0009362198761664331, 0.0021447252947837114, 0.0009014729293994606, 0.000776706263422966, 0.0009123903582803905, 0.0007669134065508842, 0.0008462963160127401, 0.001209624926559627, 0.002339286496862769, 0.0006581596680916846, 0.0007515734760090709, 0.0007483623921871185, 0.0006563506321981549, 0.0010141166858375072, 0.0005577952251769602, 0.0006867572665214539, 0.0006580423796549439, 0.0006364498985931277, 0.0011304703075438738, 0.0013207555748522282, 0.0014148415066301823, 0.000686870189383626, 0.002173250075429678, 0.0006948929512873292, 0.0012554234126582742, 0.0014246139908209443, 0.0006505374331027269 ]
0.001362
39
[ "Hand-operated plier tools have been used for crimping electrical connectors to ends of electrical leads. ", "These various plier tools often include a pair of cooperating jaws that may be either fixed or interchangeable. ", "The cooperating jaws are mounted to the ends of cooperating handles.", "\nThe cooperating handles are capable of moving, relative to each other, in either an open or a closed configuration. ", "More specifically, in the open configuration, the handles are moved relative to each other in such a way that the cooperating jaws are separated from one another. ", "Likewise, in the closed configuration, the handles are moved relative to each other in such a way that the cooperating jaws are brought together, such that the jaws are closed about any objects, such as electrical connectors, that may be placed between the cooperating jaws.", "\nIt is known to provide similar hand-operated plier tools that require electrical connectors to be positioned in a direction across the tool such that the electrical connector is parallel to the pivot axis of the cooperating interconnecting handles of the tool.", "\nThe use of such hand-operated plier tools is made difficult in confined spaces. ", "For example, electrical leads located in engine compartments and instrument panels of vehicles are typically disposed within narrow spaces between adjacent structures and, in such cases, the electrical leads are often too short to extend outwardly from the narrow space, making access to the electrical connector difficult, and the crimping of the electrical connector even more frustrating. ", "The inaccessibility of the electrical leads may cause the user numerous failed attempts to crimp the electrical connector to the electrical lead, ultimately resulting in tossed electrical connectors.", "\nAccordingly, there is a need for an improved electrical connector crimping tool that is particularly useful in crimping electrical connectors to ends of the electrical leads in tight and confined spaces." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.0006745478021912277, 0.0007496160687878728, 0.0012530162930488586, 0.0006001595756970346, 0.0006518196314573288, 0.0006732588517479599, 0.0006483124452643096, 0.000627924979198724, 0.0005626034107990563, 0.0007365014753304422, 0.0006143826176412404 ]
0.000708
11
[ "Andre Hardy Jr.\n\nAndre Elton Hardy Jr. (born March 18, 1987) is an American football tight end who is currently a free agent.", "\n\nEarly life and college basketball career\nHardy was born in San Diego. ", "His father, Andre Hardy, was a running back who played in the NFL from 1984 to 1987. ", "Hardy played basketball at St. Augustine High School in San Diego. ", "While an all-state and all-county player, Hardy did not earn GPA and SAT scores high enough for NCAA eligibility. ", "Thus, his family decided to have Hardy miss one credit for graduation from St. Augustine and transfer to the New Hampton School. ", "Although Hardy committed to the University of San Francisco while at New Hampton, the university ultimately did not admit Hardy, so Hardy enrolled at Oral Roberts University the summer after graduating from New Hampton in 2007.", "\n\nWith the Oral Roberts Golden Eagles, Hardy averaged 4.1 points and 3.6 rebounds as a freshman in 2007–08. ", "That season, Oral Roberts won the Summit League Tournament and an automatic berth to the NCAA Tournament. ", "Hardy then averaged and 7.5 points and 5.5 rebounds as a sophomore in 2008–09.", "\n\nHe then transferred to Cal State Fullerton and sat out the 2009–10 season per NCAA transfer rules. ", "Hardy missed the first 12 games of the season due to ankle surgery but led the team in rebounding with 8.5 per game, in addition to averaging 10.6 points per game. ", "Hardy was elected Big West Newcomer of the Year by conference coaches. ", "As a senior, Hardy averaged 4.9 points and 4.5 rebounds; he left the team in January 2012 for personal reasons.", "\n\nNFL career\nHardy signed with the Oakland Raiders as an undrafted free agent on April 12, 2012 and was released on May 14, 2012.", "\n\nOn January 7, 2014, Hardy signed with the Arizona Cardinals on a futures contract. ", "During the preseason, Hardy made 2 receptions for 24 yards. ", "He was placed on the practice squad on August 31. ", "On December 30, Hardy was placed on the practice squad injured reserve after a calf injury.", "\n\nReferences\n\nCategory:1987 births\nCategory:Living people\nCategory:American football tight ends\nCategory:Basketball players from California\nCategory:Sportspeople from San Diego\nCategory:Arizona Cardinals players\nCategory:Oakland Raiders players\nCategory:Oral Roberts Golden Eagles men's basketball players\nCategory:Cal State Fullerton Titans men's basketball players\nCategory:Forwards (basketball)\nCategory:Brooklyn Bolts players\nCategory:American men's basketball players" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.003937454428523779, 0.0007905896636657417, 0.0010764033067971468, 0.0009763220441527665, 0.0008291232516057789, 0.0006926278001628816, 0.0006223618984222412, 0.0006016928236931562, 0.0006915273261256516, 0.0006988471141085029, 0.001091403653845191, 0.0009159449255093932, 0.0006309965392574668, 0.0006901019951328635, 0.0010131529998034239, 0.0006881639710627496, 0.0006298102089203894, 0.0008178451680578291, 0.000997754861600697, 0.0005875634378753603 ]
0.000949
20
[ "The information being provided by California Regional Multiple Listing Service, Inc. (“CRMLS”) is for your personal, non-commercial use and may not be used for any purpose other than to identify prospective properties you may be interested in purchasing. ", "Any information relating to a property referenced on this web site comes from CRMLS. ", "This web site may reference real estate listing(s) held by a brokerage firm other than the broker and/or agent who owns this website. ", "The accuracy of all information is deemed reliable but not guaranteed and should be personally verified through personal inspection by and/or with the appropriate professionals. ", "The data contained herein is copyrighted by CRMLS and is protected by all applicable copyright laws. ", "Any dissemination of this information is in violation of copyright laws and is strictly prohibited.", "\n\n3518 E Del Mar Boulevard, PasadenaCA, 91107(Residential)\n\nThis 4 bed 3 bath home blends an open and spacious floor plan with warmth and charm. ", "It is located in Pasadena's highly desirable Chapman Woods neighborhood and is walking distance from shopping and restaurants. ", "Features include hardwood flooring, updated windows, central air and heat. ", "The large living room with a beautiful fireplace leads into the dining area, kitchen and backyard. ", "Floor plan is made for entertaining and the kitchen serves the den, dining area and backyard. ", "Large private and enclosed backyard is perfect for dogs, extra storage shed, and playground equipment for kids.", "\n\nPrice\n\nSold Price:$650,000Sold Date:08/07/2015\n\nCounty:\nLos Angeles\n\nBeds: 4\n\nBaths: 3 Full\n\nSq ft:1,742 (approx)\n\nMLS#: 15905709\n\nStatus: Closed\n\nDescription\n\nThis 4 bed 3 bath home blends an open and spacious floor plan with warmth and charm. ", "It is located in Pasadena's highly desirable Chapman Woods neighborhood and is walking distance from shopping and restaurants. ", "Features include hardwood flooring, updated windows, central air and heat. ", "The large living room with a beautiful fireplace leads into the dining area, kitchen and backyard. ", "Floor plan is made for entertaining and the kitchen serves the den, dining area and backyard. ", "Large private and enclosed backyard is perfect for dogs, extra storage shed, and playground equipment for kids.", "\n\nListing Information\n\nProperty Type: Single Family, Traditional\n\nBedrooms:4\n\nBathrooms:3 Full\n\nLot Size:0.14 Acres / 6,342 sq.ft.", "\n\nSquare Feet:1,742 (approx)\n\nPrice per Sq. ", "Ft.:$373.13\n\nYear Built:1941\n\nNeighborhood\n\nRoom Information\n\nBathrooms\n\nFull Baths: 3\n\nInterior Features\n\nFlooring:Hardwood, Linoleum\n\nCooling:Central Air\n\nHeating:None\n\nFireplaces:Living Room\n\nExterior / Lot Features\n\nParking:Street Parking, Driveway\n\nZoning:LCR1*\n\nDriving Directions\n\nOn Del Mar east\n\nFinancial Considerations\n\nTax/Property ID:\n5754024012\n\nListing Price History\n\nPasadena Real Estate\n\nPasadena is located in California.", "\nPasadena, California 91107 has a population of 137,316.", "\n\nThe median household income in Pasadena, California 91107 is\n$68,310.", "\nThe median household income for the surrounding county is $56,241\ncompared to the national median of $53,046.", "\nThe median age of people living in Pasadena 91107 is\n37.1 years.", "\n\nLoading nearby sales and history ...\n\nCourtesy: Teles Properties Roberto Rodriguez;\n\nThe information being provided by California Regional Multiple Listing Service, Inc. (“CRMLS”) is for your personal, non-commercial use and may not be used for any purpose other than to identify prospective properties you may be interested in purchasing. ", "Any information relating to a property referenced on this web site comes from CRMLS. ", "This web site may reference real estate listing(s) held by a brokerage firm other than the broker and/or agent who owns this website. ", "The accuracy of all information is deemed reliable but not guaranteed and should be personally verified through personal inspection by and/or with the appropriate professionals. ", "The data contained herein is copyrighted by CRMLS and is protected by all applicable copyright laws. ", "Any dissemination of this information is in violation of copyright laws and is strictly prohibited." ]
{ "pile_set_name": "Pile-CC" }
[ 0.0005408772849477828, 0.0006279392982833087, 0.0006170465494506061, 0.0005282313795760274, 0.0006637950427830219, 0.0006465800106525421, 0.0006492278189398348, 0.0006144698709249496, 0.0006325747817754745, 0.0006267369026318192, 0.0006603426882065833, 0.000823752605356276, 0.0006173474248498678, 0.0006144698709249496, 0.0006325747817754745, 0.0006267369026318192, 0.0006603426882065833, 0.000823752605356276, 0.0007114344043657184, 0.0007502070511691272, 0.0006207351689226925, 0.0007293079979717731, 0.0006756228976882994, 0.0006677662022411823, 0.0007145984563976526, 0.00055455177789554, 0.0006279392982833087, 0.0006170465494506061, 0.0005282313795760274, 0.0006637950427830219, 0.0006465800106525421 ]
0.000649
31
[ "As wireless technologies become ubiquitous and the pace of development of wireless applications quickens, the likelihood that users will desire the ability to efficiently utilize different wireless devices in a vast array of environments increases. ", "In some cases, users carry multiple devices that execute different applications. ", "However, operating each of the different devices is likely to result in transmission and/or energy inefficiency. ", "The problem is exacerbated by limited radio resources that can result in restricted system capacity." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.000549221585970372, 0.0006489778752438724, 0.0005937613314017653, 0.0009290542802773416 ]
0.00068
4
[ "1. ", "Field of the Invention\nThe present invention relates to a mobile communication system, and more particularly to a handover method in a mobile communication system used in multiple radio zones.", "\n2. ", "Description of the Related Art\nIn a conventional mobile communication system that provides services with mobile unite (mobile stations) such as automobile or portable telephones, a system is employed whereby the entire servicing area of the mobile communication system is divided into small zones which are covered by a plurality of radio zones. ", "The radio zone here means a range of area in which communication is made between respective radio base stations and mobile units through radio channels, and there is one radio base station in one radio zone and each mobile unit can freely move within this radio zone.", "\nAlso, each radio base station can utilize a plurality of radio channels and, based on the condition of radiowave propagation between the radio base station and the mobile unit concerned in communication, the radio channel used is decided. ", "Further, when, in the course of receiving the services from the mobile communication system, the mobile unit experiences a deterioration of radiowave propagation environments of the radio channel being used, it is possible for the mobile unit to change the channel to another channel. ", "This change-over of channels during the communication is called \"handover\". ", "The device which controls the radio base stations and carries out exchanges with fixed networks (public telephone networks) is the mobile switching center.", "\nWhere the small zone system as explained above is adopted, it is necessary that the current location of the mobile unit be registered in order to receive calls addressed to the traveling mobile unit. ", "Various location registration systems have been proposed, and one of them has been disclosed in Japanese Patent Application Kokai Publication No. ", "Hei 5-3581.", "\nTwo typical handover systems, according to a reference (S T S Chia, \"The control of handover initiation in microcells\", IEEE VTC '91, pp. ", "531-536, 1991), are a backward handover initiation via the existing radio channel and a forward handover initiation via the target radio channel.", "\nIn the conventional systems, as shown in a reference (Fumiaki Ishino at. ", "al, \"Mobile Communication Switching System for Voice/Nonvoice Services\", IEEE GLOBECOM '91, pp. ", "485-1489, 1991), the existing radio base station and the target radio base station are multi-connected by the mobile switching centers during the handover in order to prevent the occurrence of a momentary disruption at the handover.", "\nIn the foregoing mobile communication system, as a means to effectively utilize radio frequencies, each of the radio zones is made small so that the same frequency may be repeatedly used in remote zones. ", "Along with the making of zones smaller in this way, the handovers with which the mobile unit travels from one radio zone to another have become more frequent, resulting in a burden to the mobile switching center. ", "Also, the multiple radio zone environment in which radio zones of varying sizes coexist necessitates the handover processing among the radio zones of different sizes. ", "Thus, various means are being studied so as not to increase the volume of control processing of handovers.", "\nA method for processing calls or communications has been disclosed in Japanese Patent Application Kokai Publication No. ", "Hei 2-143725 in which, for selecting control channels in a multiple radio zone environment, the traveling speed of the mobile unit is estimated using the fading pitch of changes in the received signal level or the number of level crossings and, when the traveling speed of the mobile unit is high, the control channel of the large radio zone is selected while, when the traveling speed of the mobile unit is low, the control channel of the small radio zone is selected.", "\nIn the conventional technology, where the arrangement disclosed in the above Japanese Patent Application Kokai Publication No. ", "Hei 2-143725 is applied to the handovers in the multiple radio zone environment, since the size of the handover target radio zone needed is selected based on the physical speed of the mobile unit, it requires a device which measures the fading pitch or the number of level crossings. ", "Also, due to differences in the mobile characteristics such as the size of the radio zone in which the mobile unit currently exists and the ways in which the mobile unit travels, the mobile unit which travels faster does not necessarily traverse a larger number of boundaries of radio zones, hence a larger number of handovers. ", "Furthermore, in the future, the multiple radio zone environment in which the radio zones of varying sizes coexist may change so as to cover a very small zone, smaller than that now contemplated or a very large zone, or a nation wide radio zone realized by use of satellite, in which case the selection of radio zones by the physical speeds of the mobile unit will become meaningless due to diversification of environment." ]
{ "pile_set_name": "USPTO Backgrounds" }
[ 0.0009391896310262382, 0.0005515216034837067, 0.0011855863267555833, 0.0005436378414742649, 0.0006008261116221547, 0.0005362993688322604, 0.0005441191024146974, 0.0006471136002801359, 0.0006225933320820332, 0.0005315360031090677, 0.0005838986253365874, 0.0009149187244474888, 0.0005956358509138227, 0.0008897094521671534, 0.0006707393913529813, 0.0006187564576976001, 0.0006337882950901985, 0.0005519862752407789, 0.0006064155022613704, 0.0006098066223785281, 0.0005959458067081869, 0.0006131261470727623, 0.0005779796047136188, 0.0005828822031617165, 0.00059469387633726, 0.0005498545942828059, 0.000574648380279541 ]
0.000647
27
[ "\n713 A.2d 239 (1998)\nHarold NEWTON et al.", "\nv.\nThe ZONING BOARD OF REVIEW OF the CITY OF WARWICK et al. ", "and Giuseppe Illiano et al.", "\nNo. ", "97-84-M.P.\nSupreme Court of Rhode Island.", "\nJune 12, 1998.", "\n*240 Paul M. Finstein for Plaintiff.", "\nJames S. Lawrence, Timothy J. Moore, for Defendant.", "\nBefore WEISBERGER, C.J., and LEDERBERG, BOURCIER, FLANDERS and GOLDBERG, JJ.", "\nOPINION\nWEISBERGER, Chief Justice.", "\nThis case comes before us on a petition for certiorari filed by Giuseppe Illiano and Eugenia L. Illiano (applicants), who had successfully applied for a special-use permit and a dimensional variance from the Zoning Board of Review of the City of Warwick (board). ", "The applicants by their petition seek review of a judgment of the Superior Court that reversed the board's decision granting a special-use permit and a dimensional variance to build a six-unit multifamily dwelling. ", "On consideration of the record in this case, we deny the petition for certiorari and affirm the judgment of the Superior Court. ", "The facts and travel of this case insofar as pertinent to this petition for certiorari are as follows.", "\nThe applicants are the owners of a certain parcel of real estate known as lot No. ", "3 on assessor's plat No. ", "329 located at 2038 Warwick Avenue in the city of Warwick. ", "This parcel is a corner lot and constitutes an area of approximately 13,741.65 square feet. ", "The lot has a frontage of 96.66 feet on Warwick Avenue and 145.26 feet on Bethel Street. ", "At the time of the hearing in the Superior Court, an unoccupied and uninhabitable single-family residential structure was located on the lot.", "\nThe subject lot was zoned in the category \"office.\" ", "The applicants applied pursuant to § 906.3(C) of the City of Warwick Zoning Code of Ordinances (ordinance) to demolish the existing residential structure and replace it with a two-and-a-half story brick multifamily dwelling that would contain six one-bedroom units. ", "Such a structure could be authorized by a special-use permit pursuant to section 300, table 1 of the ordinance. ", "In addition to the special-use permit, applicants requested dimensional variances from the requirements of minimum-lot area, side-lot line, rear-lot line, parking line, density, design, and landscaping.", "\nThe Superior Court found that the petition was duly advertised, abutting owners were given the required notice, and a public hearing was held before the board on June 20, 1995. ", "At the public hearing applicants presented testimony from a real estate expert and a traffic engineer. ", "The applicants' testimony indicated that the granting of the special-use permit and the dimensional variances would have no adverse affect on the surrounding property and would generate less traffic than an office building. ", "The applicants also presented a petition signed by certain neighbors and abutting property owners as well as individual letters from three neighbors in support of the proposed multifamily dwelling.", "\nCertain remonstrants opposed the application. ", "Two neighbors testified concerning their belief that the proposed multifamily dwelling would cause the value of their property to depreciate and would result in increased traffic. ", "The remonstrants submitted the letters of three neighbors who expressed similar objections. ", "No expert testimony was presented on behalf of remonstrants. ", "The planning department of the city recommended that the petition be denied on the ground that it did not meet the development regulations contained in the zoning ordinance, that it presented an \"over-intensification of the property,\" and that it did not qualify for a use variance. ", "The planning *241 board pointed out that the property could be developed as a two-family dwelling or an office building.", "\nOn October 17, 1995, the board rendered a decision granting all the relief requested in the application. ", "The board's decision set forth seventeen findings of fact, which in summary determined that the proposed multifamily dwelling would not be injurious to the general health, safety, or welfare of the surrounding area and that applicants would suffer hardship if the dimensional variances were not granted and that such hardship would amount to more than a mere inconvenience.", "\nThereafter, remonstrants, Harold Newton, Susan Cayer, and Kenneth Brown, filed a complaint in the Superior Court, seeking review of the board's decision and alleging that the decision was in violation of the governing law. ", "A justice of the Superior Court reviewed the decision pursuant to the provisions of G.L.1956 § 45-24-69(D), which provide in pertinent part:\n\"The court shall not substitute its judgment for that of the zoning board of review as to the weight of the evidence on questions of fact. ", "The court may affirm the decision of the zoning board of review or remand the case for further proceedings, or may reverse or modify the decision if substantial rights of the appellant have been prejudiced because of findings, inferences, conclusions, or decisions which are:\n(1) In violation of constitutional, statutory, or ordinance provisions;\n(2) In excess of the authority granted to the zoning board of review by statute or ordinance;\n(3) Made upon unlawful procedure;\n(4) Affected by other error of law;\n(5) Clearly erroneous in view of the reliable, probative, and substantial evidence of the whole record; or\n(6) Arbitrary or capricious or characterized by abuse of discretion or clearly unwarranted exercise of discretion.\"", "\nApplying these statutory standards, the Superior Court justice determined that the board's decision granting the application was in violation of statutory and ordinance provisions and was affected by error of law. ", "He therefore reversed the decision of the board and entered judgment accordingly.", "\nThe applicants sought review of this judgment by filing a petition for certiorari. ", "We granted the writ June 20, 1997, in order to review the judgment of the Superior Court.", "\nIn holding that the board had as a matter of law exceeded its authority in granting the application, the Superior Court justice relied on Northeastern Corporation v. Zoning Board of Review of New Shoreham, 534 A.2d 603 (R.I.1987), which held in effect that a dimensional deviation could not be granted in a situation in which a use was permitted by way of a special exception. ", "Id. at 605 (citing Zammarelli v. Beattie, 459 A.2d 951, 954 (R.I.1983)). ", "The applicants challenge this holding on the ground that since our opinion in Northeastern Corporation, the Legislature has adopted a new Zoning Enabling Act, §§ 45-24-41 and 45-24-42. ", "This amendment was adopted in 1991 (P.L.1991, ch. ", "307, § 1), and the applicants argue that it superseded earlier case law.", "\nThere is no question that the amended Zoning Enabling Act would supersede case law in so far as such case law would be inconsistent with the amended statute. ", "See Town of East Greenwich v. Narragansett Electric Co., 651 A.2d 725, 729 (R.I.1994). ", "However, our opinion in Northeastern Corporation is not superseded by the amended statute or by the ordinance adopted pursuant thereto.", "\nThe ordinance in effect at the time of this application authorized the board to allow a multifamily dwelling to be built in an area zoned for office use by special-use permit. ", "Such a permit would be granted in accordance with § 906 of the ordinance and further subject to § 502 thereof as well as the use regulations contained in § 302. ", "Specifically the standards for granting a special-use permit are set forth in § 906.3(C) of the ordinance as follows:\n\"In granting a special use permit, the board shall require that evidence to * * * the satisfaction of the following standards be entered into the record of the proceedings:\n*242 (1) That the special use is specifically authorized by this ordinance, and setting forth the exact subsection of this ordinance containing the jurisdictional authorization;\n(2) That the special use meets all of the criteria set forth in the subsection of this ordinance authorizing such special use; and\n(3) That the granting of the special use permit will not alter the general character of the surrounding area or impair the intent or purpose of this ordinance or the comprehensive plan of the city.\"", "\n(Emphasis added.)", "\nSection 502.3 of the ordinance sets forth the minimum standards for lot size, side- and rear-lot requirements, density, parking, exit, entrance, and landscaping. ", "The ordinance specifically provides that a special-use permit to erect a multifamily dwelling in an area zoned for office use must meet these minimum standards. ", "It is undisputed, as found by the Superior Court, that applicants' lot did not meet any of these developmental standards. ", "Section 502.3 of the ordinance required a minimum of 20,000 square feet for the construction of a multiunit residence in an office zone. ", "It is undisputed that the subject lot contains a total area of 13,741.65 square feet. ", "It is also undisputed that the lot would not provide for the necessary side-lot, or rear-lot dimensions set forth in the ordinance. ", "Indeed, applicants sought relief from these dimensional standards. ", "As we held in Northeastern Corporation, supra, such a dimensional variance could not be granted in conjunction with the issuance of a special-use permit. ", "The ordinance is unambiguous and imperative in requiring that a special use meet all the criteria authorizing such special use. ", "These criteria would include the specific standards set out in § 502.3 of the ordinance.", "\nIt is also instructive to consider the terms of the amended statute pursuant to which this ordinance was adopted. ", "Section 45-24-31(61)(b) deals specifically with the issue of a dimensional variance as follows:\n\"Dimensional Variance. ", "Permission to depart from the dimensional requirements of a zoning ordinance, where the applicant for the requested relief has shown, by evidence upon the record, that there is no other reasonable alternative way to enjoy a legally permitted beneficial use of the subject property unless granted the requested relief from the dimensional regulations. ", "However, the fact that a use may be more profitable or that a structure may be more valuable after the relief is granted shall not be grounds for relief.\"", "\nThe terms of this portion of the statute would unequivocally command that a dimensional variance be granted only in connection with the enjoyment of a legally permitted beneficial use, not in conjunction with a use granted by special permit. ", "This point makes our analysis in Northeastern Corporation, supra, completely applicable to the construction of the present statute as well as the construction of the Warwick Zoning Code of Ordinances. ", "Consequently the Superior Court justice was correct in his determination that a special-use permit could not be combined with a dimensional variance.", "\nFor the reasons stated, the petition for certiorari is denied. ", "The writ previously issued is quashed, and the judgment of the Superior Court is affirmed. ", "The papers in the case may be remanded to the Superior Court with our decision endorsed thereon.", "\n" ]
{ "pile_set_name": "FreeLaw" }
[ 0.0006736600189469755, 0.0006575229926966131, 0.0007214517099782825, 0.0013785824412479997, 0.0006685398402623832, 0.000730387051589787, 0.0008754230802878737, 0.0006042864988557994, 0.0006883633323013783, 0.0009031068184413016, 0.0005571560468524694, 0.0006413430091924965, 0.0005889106541872025, 0.0006131735281087458, 0.0009383824653923512, 0.0008925899746827781, 0.0006845108000561595, 0.0008659797022119164, 0.001116342842578888, 0.0007544390973635018, 0.0006180180353112519, 0.0006892748060636222, 0.0005370976869016886, 0.0005623027100227773, 0.0006392764043994248, 0.0005423960974439979, 0.0006068751099519432, 0.0005880612297914922, 0.0009134014835581183, 0.0006277992506511509, 0.0006261819507926702, 0.0006983171915635467, 0.0006071244715712965, 0.0006260804948396981, 0.0005703931674361229, 0.0006607185350731015, 0.0007089724531397223, 0.000610350864008069, 0.0006820678827352822, 0.0006077587022446096, 0.0007153691258281469, 0.0006671593291684985, 0.0006112503469921649, 0.0006767300656065345, 0.00079524697503075, 0.0006337828235700727, 0.0005974840023554862, 0.0005984428571537137, 0.0006227917619980872, 0.0006378574762493372, 0.0005836194031871855, 0.0006327086011879146, 0.0006017911946401, 0.0006075950805097818, 0.0005979727720841765, 0.0005822351085953414, 0.0006400829879567027, 0.0006710235611535609, 0.0006299098604358733, 0.0007131259189918637, 0.0006209565326571465, 0.0005625648191198707, 0.0005585156031884253, 0.0005662668263539672, 0.0005657597212120891, 0.0005397172644734383, 0.000587248825468123, 0.0005703366477973759, 0.0005587685154750943, 0.0006131560076028109, 0.0005592002999037504, 0.0005959555273875594, 0.0006411620997823775, 0.0006942465552128851, 0.0005579552962444723, 0.0019954426679760218 ]
0.000683
76
[ "Boluminek\n\nBoluminek () is a village in the administrative district of Gmina Dąbrowa Chełmińska, within Bydgoszcz County, Kuyavian-Pomeranian Voivodeship, in north-central Poland. ", "It lies south of Dąbrowa Chełmińska, east of Bydgoszcz, and north-west of Toruń.", "\n\nThe village has a population of 120.", "\n\nReferences\n\nBoluminek" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0016936338506639004, 0.002756430534645915, 0.001892539206892252, 0.000776292581576854 ]
0.00178
4
[ "\"oh god please help me\"\n\nSo we all know people use religion as a crutch, everyone needs something to help keep them upright in life at some point or another..... But when things are really bad for you - say the person you love is dying.... Would you ever find yourself, an atheist, down on your knees praying for them to get better?", "\n\nI think praying is a healthy and natural thing to do even though I'm almost certain that there is no supernatural god. ", "I have prayed and will continue to pray.", "\n\nWhat we experience as consciousness is only a small part of our mental totality. ", "How do we unlock the ideas, solutions, emotional strength, and otherwise untapped capacity of our subconscious minds?", "\n\nI don't think religion has created an appetite for prayer but merely taken advantage of a psychological need we've evolved. ", "Doesn't thought start off as external speech when we are young? ", "It is only later that we learn to talk internally, I.e. think. ", "If this is true, then the whole basis for our thought process is rooted in talking to someone more powerful than us - a parent. ", "Maybe prayer is just a means to satisfying this psychological need? ", "I certainly feel better after I have prayed, it's quite natural I think to have the load lightened having spoken to someone.", "\n\nI like this, particularly the part about cognition deriving of some phylogenetic need to \"talk\" to a parent - perhaps to find new and better ways to express our needs to the parent so that the parent can respond better to our needs?", "\n\nYou say you are 'almost certain there is no supernatural god'. ", "Although we can never be certain of anything in life, you can be sure of your faith. ", "Faith in what ever form it takes. ", "Normally this is a faith in others. ", "The people you trust most and look up to or follow for guidance in life. ", "Like you say, as a child, for most people this faith emerges from a parental guidance. ", "But when you 'pray' are you perhaps just talking to your inner self... Sounding ideas out and questioning internally in readiness for coping with things externally. ", "Human beings are very well adapted to coping, it makes us a successful species of creatures on this planet doesn't it!", "\n\nJules111. ", "I am without doubt just talking to my subconscious even though I find it more comforting to converse as if to another, rather than just chew things over. ", "As I said, I think the roots may be in early thought development.", "\n\nSimilarly, but not quite as comforting, I talk to my dog Chester. ", "I think it's the same principle except I find his head-cocking a little off putting.", "\n\nWhile I agree with you that talking to a well loved family pet may offer some comfort and reassurance that you are not alone, one must not forget you are 'playing it safe' as subcouisously you know the pet can not answer back. ", "Unless of course you also talk for the said pet, giving it a funny little voice of it's own .... Then you do have to, perhaps, start worrying!", "\n\nWe evolved an appendix, that at the time had a value, but no longer does; it's gradually fading away, as has, some biologists say, our vestigial tail, though thankfully, I've managed to retain most of mine.", "\n\nFurther, some things we do, aren't necessarily what we evolved to do. ", "Various features that have evolved for other purposes, can be used to watch TV, but one can't honestly say that we've evolved into couch potatoes, except for my Uncle Fred. ", "All we can say with certainty, is that what we've evolved, ALSO permits such activity, to say otherwise, would leave the door open to admit we're evolved to misuse alcohol or narcotics - because we can do it, doesn't mean we're evolved to do it.", "\n\nFeet that evolved from hand-like appendages, used for grasping branches, into flatter, sturdier vehicles for propelling ourselves across solid ground, could never - literally in a million years - have been envisioned by our ancestors to be instrumental to the performance of a Prima Ballerina in her breathtaking pas de deux of Swan Lake, but we're all the richer because she discovered another use for that which she evolved, to get from Point A to Point B.\n\nWe Humans are resourceful animals - we find many uses for the features we evolve - in the case of prayer, I can't say that we've evolved to do it, so much as we've evolved a brain capable of learning to do it, in which case, yes, it could well be valueless, unless we impart value to it.", "\n\nI recently read a religiously-slanted article that maintained that prayer was scientifically shown to have beneficial health effects to the one praying - not from a supernatural source necessarily, but from releasing beneficial endorphins that benefit he who prays - buried near the bottom, was a tiny, two-sentence paragraph casually mentioning that meditation was found to have the same effect. ", "Can't have information like THAT getting out, can we?", "\n\nI'm not proud of having screamed to infinity for my partner being dragged away. ", "At no stage can I say I actually thought anyone was listening. ", "I just had nobody else to scream to, and I really needed someone, anyone, to help me. ", "But look, I survived, and learned to love again too, so I'm the fortunate one.", "\n\nI tried meditation - actually because my deceased partner would meditate daily and felt it was a wonderful thing. ", "So I tried. ", "Empty your mind, they say. ", "Fat chance.", "\n\nI've actually considered trying it from a different angle. ", "I need to try to empty my mind of opinions on stuff. ", "But then again, I'm in a different place now, in a different time, and I seem to have a large chunk of natural happiness, so not being in need of support, I don't have the drive to meditate any more." ]
{ "pile_set_name": "Pile-CC" }
[ 0.21935130655765533, 0.0006879544234834611, 0.0005438573425635695, 0.0011942909331992269, 0.0005846404237672687, 0.0006635079043917358, 0.0008084236178547144, 0.0006156182498671114, 0.0005840492085553706, 0.0009478226420469582, 0.0005224289488978684, 0.0005728263640776277, 0.0009119748137891293, 0.0006788342143408954, 0.0007248703041113913, 0.000716865062713623, 0.0005556159885600209, 0.000724228098988533, 0.0007541020167991519, 0.0008918474777601659, 0.0008269267273135483, 0.0006284737028181553, 0.0005275430157780647, 0.0006751607288606465, 0.25252822041511536, 0.0007565867272205651, 0.0017953242640942335, 0.000608535367064178, 0.0006242754170671105, 0.0006898771389387548, 0.0005840075318701565, 0.0010511546861380339, 0.0009675176697783172, 0.0008188533829525113, 0.0007017382304184139, 0.0008133561350405216, 0.005853353533893824, 0.0007171407341957092, 0.0006184180383570492, 0.0009077437571249902, 0.20245373249053955, 0.19230122864246368, 0.0005569704808294773, 0.0011143574956804514, 0.000716281880158931 ]
0.020064
45
[ "Q:\n\nCan I mix 9.0 and 8.5 designer with 8.5.3 and 9.0.1 servers?", "\n\nWe have a single server inside the firewall used for all of our production apps. ", "The server and clients are 8.5.3.", "\nWe have a single 'portal' server outside the firewall used by a small set of our customers for read-only access to a few apps via a browser. ", "This server is currently at 8.5.3. ", "Mail isn't implemented on this server; customers log in, see dbs, view docs, and leave. ", "The only admin tasks I perform on this server are to add new users and push new replicas onto the external box (which I do from my Notes client, not the admin client)\nBecause of POODLE, we're going to be upgrading our portal server to 9.0.1. ", "We have no plan to upgrade our internal server (or clients).", "\nI'm the developer and admin for both servers.", "\nI don't intend to install the 9.0.x designer client on my system.", "\nDo I need to install the 9.0.x admin client or can I just keep using my 8.5.3 version?", "\nAny risks with either scenario?", "\nThanks for any tips or suggestions.", "\n\nA:\n\nMixed versions of domino server and clients can be used and actually have been used for a long time. ", "Certainly only the intersection set of features of these versions can be used.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0007489916170015931, 0.0006439752178266644, 0.0006640620995312929, 0.0006416888209059834, 0.0006497836438938975, 0.0007493043085560203, 0.000839090789668262, 0.0006708679138682783, 0.0006916152779012918, 0.0009299558005295694, 0.0008998650591820478, 0.0006693406030535698, 0.0005363530362956226, 0.000546471041161567, 0.0005653444095514715, 0.0019954426679760218 ]
0.000778
16
[ "948 F.2d 1277\nHicksv.", "State of New York\nNO. ", "91-2257\nUnited States Court of Appeals,Second Circuit.", "\nOCT 18, 1991\n\n1\nAppeal From: W.D.N.Y.\n\n\n2\nAFFIRMED.", "\n\n" ]
{ "pile_set_name": "FreeLaw" }
[ 0.0009514549165032804, 0.0007650586194358766, 0.0008295990992337465, 0.0007163692498579621, 0.0019954426679760218 ]
0.001052
5
[ "Nataliia Zharkova\n\nNataliia Zharkova (born 1989) is a 2017 freediving champion of Europe and Ukraine. ", "Zharkova holds multiple records in the discipline of freediving. ", "She also is a freediving runner-up champion of the world, 2013. ", "She is the first Ukrainian and the second woman to ever dive below the arch of the Blue Hole vertical underwater cave in Dahab, Egypt, on a single breath.", "\n\nBiography\n\nSwimming career, 1997–2007 \n\nZharkova started swimming at the age of 7 when her parents introduced her to swimming to alleviate her spine medical condition. ", "In six months she would be accepted in the school of Olympic Reserve of Ukraine where she spent a total of 10 years.", "\n\nZharkova represented Ukraine in various Europe swimming championships while attending the school of Olympic Reserve of Ukraine.", "\n\nFreediving career 2008–present \n\nIn 2008 Zharkova gets introduced to freediving and begins active training.", "\n\nIn 2009, Zharkova participated in a world championship held at Aarhus, Denmark. ", "Zharkova set new Ukraine's national records in freediving.", "\n\nIn 2010, Zharkova competed in Ukraine, Russia and Latvia. ", "Each participation brought Zharkova a new Ukraine's national record.", "\n\nIn 2011, the first depth competitions AIDA International World Championship were held at Kalamata, Greece. ", "Zharkova's first participation in the depth competitions drew here near the top freedivers in the discipline taking 6th place in the CNF discipline (constant weight, no fins). ", "She also set new Ukraine's national records in the discipline. ()", "\n\nIn 2012, Ukraine's first team world championship participation, event was held in Nice, France. ", "Zharkova represented Ukraine along with Alexander Bubenchikov and Valentin Kuznetsov. ", "Men's team has taken 14th place out of a total of 30. ", "Zharkova updated her previous national records and took 5th place in the world rating.", "\n\nIn 2013, the AIDA International World Championships were held in Kalamata, Greece. ", "Nataliia Zharkova along with Natalia Molchanova won medals in all of the disciplines of the championship.", "\n\n Silver – CNF (Constant weight apnea without fins), 60m\n Silver – FIM (Free immersion apnea), 78m\n Bronze – CWT (Constant weight apnea, Bi-fins), 85m\n\nIn 2013–15, Zharkova was a finalist in the Pool World Championship held at Belgrad, Serbia. ", "\n\nIn 2015, the AIDA International Depth World Championships were held at Limassol, Cyprus.", "\n Bronze – FIM (Free immersion apnea)\n Bronze – CWT (Constant weight apnea, with a monofin)\n\nIn 2017 Zharkova won 2 gold and a bronze medals at Championship of Europe held at Kaş, Turkey. ", "She set 2 new World Records according to CMAS. ", "All immersions of that championship were filmed with the Dive Eye underwater drone.", "\n\n CWT (Constant weight apnea, Bi-fins) – 85m 2 ming 51 sec – gold, world record\n CNF (Constant weight apnea without fins) – 65m 2 ming 41 sec – gold, world record\n\nCurrent activities \n\nCurrently Zharkova is a master Instructor at AIDA International, instructor (Emergency First Response-EFR). ", "She is a chairman of the Freediving committee at UFUA (Ukrainian Federation of Underwater Activities) and is a member of the CMAS international committee. ", "She is an author of multiple training programs and a coach in Deep Division freediving school in Kharkiv, Ukraine. ", "Zharkova conducts trainings in warm climate locations, most notably in Dahab, Egypt and actively prepares for upcoming competitions.", "\n\nPersonal records \n\n DYN, Dynamic apnea with fins – 172 meters\n DNF, Dynamic apnea without fins – 132 meters \n FIM, Free immersion apnea – 82 meters, National record of Ukraine\n CWT, Constant weight apnea – 95 meters, National record of Ukraine\n STA, Static Apnea – 6 minutes 02 seconds, National record of Ukraine\n CWT, Constant weight apnea, Bi-fins – 85 meters, CMAS World record\n CNF, Constant weight apnea without fins – 65 meters, CMAS World record\n\nEducation \n\nZharkova graduated Kharkiv State Technical University of Construction and Architecture in 2012 as a BSc in the field of Architecture led by professor Alexander Buryak.", "\n\nNotable achievements\n\nSwimming underneath the arch of Blue Hole \n\nOn 27 October 2016, Nataliia Zharkova became the first Ukrainian and the second woman in the world (after Natalia Molchanova) to dive through an underwater vertical cave known as Blue Hole on a single breath. ", "Zharkova immersed to a depth of 56 meters and then swam 30 meters under the arch.", "\n\nReferences\n\nExternal links\n \n\nCategory:1989 births\nCategory:Freedivers\nCategory:Living people\nCategory:Sportspeople from Kharkiv" ]
{ "pile_set_name": "Wikipedia (en)" }
[ 0.0008402020903304219, 0.0006150426343083382, 0.0006291634635999799, 0.0020583204459398985, 0.0007244027801789343, 0.000602827116381377, 0.0006963026244193316, 0.0005880883545614779, 0.0005701116751879454, 0.0007263524457812309, 0.0005863276892341673, 0.000689539301674813, 0.0005597664276137948, 0.0005995544488541782, 0.0006451482768170536, 0.0005626382771879435, 0.0007333806715905666, 0.000824643240775913, 0.0006968698580749333, 0.0005739378975704312, 0.000758998328819871, 0.0006478519062511623, 0.000585121859330684, 0.0006530974642373621, 0.0006592344143427908, 0.0006340107065625489, 0.0006931104580871761, 0.0006011333898641169, 0.0006191519787535071, 0.0005352376610971987, 0.0007360254530794919, 0.0008187484345398843, 0.0006331896875053644, 0.0006268599536269903 ]
0.000698
34
[ "\"My plea to the community is, you know, just come forward,\" Kiatoukaysi said. \"", "If you know anything, or if you had seen anything or heard anything, just come forward. ", "If nothing else, give closure to the family. ", "They survive a refugee camp to come to Kansas City, and to lose someone like that is just heartbreaking.\"", "\n\nPolice said so far there have been very few tips in the case. ", "If you have any information or were around the Maple Hill Laundromat this weekend, you're encouraged to contact KCK Police." ]
{ "pile_set_name": "Pile-CC" }
[ 0.000707834551576525, 0.0011712344130501151, 0.000586049456615001, 0.0011757671600207686, 0.0005871665198355913, 0.0007902507204562426 ]
0.000836
6
[ "If there's one thing we know about The Great Gatsby, which is finally getting released this Friday, May 10 (!!!), ", "it's that this movie is going to be a spectacle. ", "It's kinda hard not to be beautiful when the film revolves around rich people in the 1920's and said rich people are Leonardo DiCaprio and Carey Mulligan though, you know?", "\n\nTo get you excited for the film, which, of course, is part of our OK! ", "Movie Maniasummer blockbuster package, scroll through the gorgeous movie stills below of Jay, Daisy, Nick, and more. ", "Then, come back to OKMagazine.com all week for more amazing content around the most anticipated film of the summer, including our review of the film. ", "We've got tons planned, so stay tuned!" ]
{ "pile_set_name": "Pile-CC" }
[ 0.0006211716681718826, 0.0008138279081322253, 0.0007194256759248674, 0.000641443592030555, 0.000659762998111546, 0.000593051256146282, 0.0006624378729611635 ]
0.000673
7
[ "Synthesis, characterization and anticonvulsant activity evaluation of some 1,4-dihydropyridines and 3,5-(substituted)oxycarbonyl-1,4-dihydro-2,6-dimethyl-N-[2-(4-sulfamoylphenylamino)-acetyl]-4-(substituted)pyridines.", "\nA series of 3,5-(substituted)oxycarbonyl-1,4-dihydro-2,6-dimethyl-4-(substituted)pyridines (1a-j) were synthesized by Hantzsch method for pyridine synthesis. ", "Treatment with chloroacetyl chloride produced N-(2-chloroacetyl)-3,5-(substituted)oxycarbonyl-1,4-dihydro-2,6-dimethyl-4-(substituted)pyridines (2a-e), which on further treatment with sulfanilamide resulted in 3,5-(substituted)oxycarbonyl-1,4-dihydro-2,6-dimethyl-N-[2-(4-sulfamoylphenylamino)-acetyl]-4-(substituted)pyridines (3a-e). ", "The structures has been established on the basis of spectral (IR, 1H-NMR, mass) and elemental analysis. ", "Compounds 1a-j and 3a-e (5 mg/kg and 10 mg/kg) were evaluated for their anticonvulsant effect against pentylenetetrazole-induced convulsions with diazepam (4 mg/kg) as the reference. ", "Compounds 3a-e exhibited significant (p<0.01) anticonvulsant activity compared to the control." ]
{ "pile_set_name": "PubMed Abstracts" }
[ 0.0008254930726252496, 0.0009148346143774688, 0.0010314617538824677, 0.000531937403138727, 0.0007801351021043956, 0.0006627952679991722 ]
0.000791
6
[ "Q:\n\nHow to get a sid pbuilder in ubuntu\n\nBefore releasing packages to Debian (and later sync them to Ubuntu) I need to test them in a sid chroot, but I get this error on a clean 14.04 system:\n$ sudo DIST=sid ARCH=i386 pbuilder create\n[sudo] password for u: \nI: Distribution is unstable.", "\nI: Current time: Mon Mar 17 09:37:53 EDT 2014\nI: pbuilder-time-stamp: 1395063473\nI: Building the build environment\nI: running debootstrap\n/usr/sbin/debootstrap\nI: Retrieving Release \nI: Retrieving Release.gpg \nI: Checking Release signature\nE: Release signed by unknown key (key id 8B48AD6246925553)\nE: debootstrap failed\nW: Aborting with an error\nI: cleaning the build env \nI: removing directory /var/cache/pbuilder/build//8688 and its subdirectories\n\nWhat type of keys do I have to install to avoid such failure?", "\n\nA:\n\nIn order to get it fixed I had to install:\nsudo apt-get install debian-archive-keyring\n\nAnd then create the chroot with\nsudo DIST=sid ARCH=i386 pbuilder create --debootstrapopts \\\n--keyring=/usr/share/keyrings/debian-archive-keyring.gpg\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0020212058443576097, 0.0008163564489223063, 0.0026691860985010862 ]
0.001836
3
[ "Q:\n\nDoes erlang implement record copy-and-modify in any clever way?", "\n\ngiven:\n-record(foo, {a, b, c}).", "\n\nI do something like this:\nThing = #foo{a={1,2}, b={3,4}, c={5,6}},\nThing1 = Thing#foo{a={7,8}}.", "\n\nFrom a semantic view, Thing and Thing1 are unique entities. ", " However, from a language implementation standpoint, making a full copy of Thing to generate Thing1 would be intensely wasteful. ", " For example, if the record were a megabyte in size and I made a thousand \"copies,\" each modifying a couple of bytes, I've just burned a gigabyte. ", " If the internal structure kept track of a representation of the parent structure and each derivative marked up that parent in a way that indicated its own change but preserved everyone elses' versions, the derivates could be created with a minimum of memory overhead.", "\nMy question is this: is erlang doing anything clever - internally - to keep the overhead of the usual erlang scribble;\nThing = #ridiculously_large_record,\nThing1 = make_modified_copy(Thing),\nThing2 = make_modified_copy(Thing1),\nThing3 = make_modified_copy(Thing2),\nThing4 = make_modified_copy(Thing3),\nThing5 = make_modified_copy(Thing4)\n\n...to a minimum?", "\nI ask because there would be a number of changes to the way that I did cross-process communications if this were the case.", "\n\nA:\n\nThe exact workings of the garbage collection and memory allocation is only known to a few. ", "Thankfully, they are very happy to share their knowledge and the following is based on what I have learnt from the erlang-questions mailing list and by discussing with OTP developers.", "\nWhen messaging between processes, the content is always copied as there is no shared heap between processes. ", "The only exception is binaries bigger than 64 bytes, where only a reference is copied.", "\nWhen executing code in one process, only parts are updated. ", "Let's analyze tuples, as that is the example you provided.", "\nA tuple is actually a structure that keeps references to the actual data somewhere on the heap (except for small integers and maybe one more data type which I can't remember). ", "When you update a tuple, using for example setelement/3, a new tuple is created with the given element replaced, however for all other elements only the reference is copied. ", "There is one exception which I have never been able to take advantage of.", "\nThe garbage collector keeps track of each tuple and understands when it is safe to reclaim any tuple that is no longer used. ", "It might be that the data referenced by the tuple is still in use, in which case the data itself is not collected.", "\nAs always, Erlang gives you some tools to understand exactly what is going on. ", "The efficiency guide details how to use erts_debug:size/1 and erts_debug:flat_size/1 to understand the size of the data structure when used internally in a process and when copied. ", "The trace tools also allows you to understand when, what and how much was garbage collected.", "\n\nA:\n\nThe record foo is of arity four (holding four words), but the whole structure is 14 words in size. ", "Any immediate (pids, ports, small integers, atoms, catch and nil) can be stored directly in the tuples array. ", "Any other term which can't fit into a word, such as other tuples, are not stored directly but referenced by boxed pointers (a boxed pointer is an erlang term with a forwarding address to the real eterm ... just internals).", "\nIn your case a new tuple of same arity is created and the atom foo and all the pointers are copied from the previous tuple except for index two, a, which points to the new tuple {7,8} which constitutes 3 words. ", "In all 5 + 3 new words are created on the heap and only 3 words are copied from the old tuple the other 9 words are not touched.", "\nExcessively large tuples are not recommended. ", "When updating a tuple, the whole tuple, i.e the array and not the deep content, needs to copied and then updated in other to preserve a persistent data structure. ", "This will also generate increased garbage, forcing the garbage collector to heat up which also hurts performance. ", "The dict and array modules avoids using large tuples for this reason and have a shallow tuple tree instead.", "\n\n" ]
{ "pile_set_name": "StackExchange" }
[ 0.0007909380947239697, 0.0005891602486371994, 0.0011537232203409076, 0.0006207517581060529, 0.005234931595623493, 0.0029534620698541403, 0.0005524639273062348, 0.0011312098940834403, 0.0005482665146701038, 0.003605609992519021, 0.0005277919699437916, 0.0006505836499854922, 0.0008662632899358869, 0.0005778460763394833, 0.0007268261397257447, 0.0007921303040347993, 0.0006956138531677425, 0.000641072925645858, 0.016040463000535965, 0.0006883465684950352, 0.0006300557288341224, 0.0005882352706976235, 0.010284189134836197, 0.0006665762048214674, 0.0006865488248877227, 0.0008091893396340311, 0.001040619914419949, 0.001045303768478334, 0.02210991270840168, 0.000672296155244112, 0.15224139392375946, 0.0008366338443011045, 0.0019954426679760218 ]
0.00706
33