zehui127's picture
Update README.md
9166fd2 verified
metadata
license: mit

Model Card for Omni-DNA

Requirement

pip install datasets ai2-olmo

Overview

Omni-DNA is a cross-modal, multi-task genomic foundation model designed to generalize across diverse genomic tasks. Unlike previous Genomic Foundation Models (GFMs), which require separate fine-tuning for each task, Omni-DNA leverages auto-regressive transformer-based training and multi-task fine-tuning, enabling a single model to perform a wide range of genomic tasks with state-of-the-art performance.

Omni-DNA models range from 20M to 1B parameters and support tasks such as sequence annotation, regulatory element classification, acetylation/methylation prediction, and DNA2Function/DNA2Image mapping.

Base Model Details

Size Training Tokens Layers Hidden Size Attention Heads Context Length
Omni-DNA 20M 300B 8 256 8 250
Omni-DNA 60M 300B 8 512 8 250
Omni-DNA 116M 300B 12 768 16 250
Omni-DNA 300M 300B 16 1024 16 250
Omni-DNA 700M 300B 16 1536 16 250
Omni-DNA 1B 300B 16 2048 16 250

Model Description

  • Supported by: Microsoft Research Asia
  • Model type: Auto-regressive transformer-based genomic model
  • License: mit
  • Date cutoff: 2024
  • Contact: Research inquiries at [email protected]

Model Sources

Capabilities

Omni-DNA is trained to perform multiple genomic tasks including:

  • Regulatory Element Classification: Enhancer/promoter/splice site detection
  • Histone Modification Prediction: Acetylation and methylation state identification
  • Genomic Function Annotation: DNA-to-text mapping (DNA2Function)
  • Cross-modal Learning: DNA-to-image mapping (DNA2Image)
  • Multi-task Learning: A single model can solve multiple tasks simultaneously

Usage


import argparse
import json
import os
import re
import torch
from tqdm import tqdm
from datasets import load_dataset
from transformers import AutoModelForCausalLM, AutoTokenizer

def preprocess_response(response, mask_token="[MASK]"):
    """
    Preprocess the response to extract text after the [MASK] token.

    Args:
        response (str): The raw model output.
        mask_token (str): The token after which the response is extracted.

    Returns:
        str: Processed response text.
    """
    if mask_token in response:
        response = response.split(mask_token, 1)[1]
    response = re.sub(r'^[\sATGC]+', '', response)
    return response

def generate(message, model, tokenizer):
    message = message + "[MASK]"
    tokenized_message = tokenizer(
        [message], return_tensors='pt', return_token_type_ids=False, add_special_tokens=True
    ).to('cuda')
    response = model.generate(**tokenized_message, max_new_tokens=110, do_sample=False)
    reply = tokenizer.batch_decode(response, skip_special_tokens=True)[0]
    return preprocess_response(reply)

model_tokenizer_path = "zehui127/Omni-DNA-DNA2Function"
tokenizer = AutoTokenizer.from_pretrained(model_tokenizer_path)
model = AutoModelForCausalLM.from_pretrained(model_tokenizer_path).to('cuda')
# Define the input dna sequence
dna = "TGCTGGCTTCAGGGGCACAGATGCTAACATTGGAGCGATACAGAGAAGATTAACGTGGCCACTGCGCAAGCATGACATGCAAACTCGTAAAGCATTCTTTTAATTT"
generate(dna, model, tokenizer)